RMCP Vol. 13 Num. 1 (2022): January-March [english version] by Revista Mexicana de Ciencias Pecuarias

Edición Bilingüe Bilingual Edition

Revista Mexicana de Ciencias Pecuarias Rev. Mex. Cienc. Pecu. Vol. 13 Núm. 1, pp. 1-322, ENERO-MARZ0-2022

ISSN: 2448-6698

Rev. Mex. Cienc. Pecu. Vol. 13 Núm. 1, pp. 1-322, ENERO-MARZO-2022

REVISTA MEXICANA DE CIENCIAS PECUARIAS Volumen 13 Numero 1, Enero-Marzo 2022. Es una publicación trimestral de acceso abierto, revisada por pares y arbitrada, editada por el Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias (INIFAP). Avenida Progreso No. 5, Barrio de Santa Catarina, Delegación Coyoacán, C.P. 04010, Cuidad de México, www.inifap.gob.mx Distribuida por el Centro Nacional de Investigación Disciplinaria en Salud Animal e Inocuidad, Km 15.5 Carretera México-Toluca, Colonia Palo Alto, Cuidad de México, C.P. 05110. Editor responsable: Arturo García Fraustro. Reservas de Derechos al Uso Exclusivo número 042021-051209561700-203. ISSN: 2428-6698, otorgados por el Instituto Nacional del Derecho de Autor (INDAUTOR). Responsable de la última actualización de este número: Arturo García Fraustro, Centro Nacional de Investigación Disciplinaria en Salud Animal e Inocuidad, Km. 15.5 Carretera México-Toluca, Colonia Palo Alto, Ciudad de México, C.P. 015110. http://cienciaspecuarias. inifap.gob.mx, la presente publicación tuvo su última actualización en abril de 2022. Yegua Criollo Colombiana en prueba de desempeño en piso; Medellín, Colombia. Fotografía: Eduar Roldán Montador y Equuslab

DIRECTORIO EDITOR EN JEFE Arturo García Fraustro

FUNDADOR John A. Pino EDITORES ADJUNTOS Oscar L. Rodríguez Rivera Alfonso Arias Medina

EDITORES POR DISCIPLINA Dra. Yolanda Beatriz Moguel Ordóñez, INIFAP, México Dr. Ramón Molina Barrios, Instituto Tecnológico de Sonora, Dr. Alfonso Juventino Chay Canul, Universidad Autónoma de Tabasco, México Dra. Maria Cristina Schneider, Universidad de Georgetown, Estados Unidos Dr. Feliciano Milian Suazo, Universidad Autónoma de Querétaro, México Dr. Javier F. Enríquez Quiroz, INIFAP, México Dra. Martha Hortencia Martín Rivera, Universidad de Sonora URN, México Dr. Fernando Arturo Ibarra Flores, Universidad de Sonora URN, México Dr. James A. Pfister, USDA, Estados Unidos Dr. Eduardo Daniel Bolaños Aguilar, INIFAP, México Dr. Sergio Iván Román-Ponce, INIFAP, México Dr. Jesús Fernández Martín, INIA, España Dr. Maurcio A. Elzo, Universidad de Florida Dr. Sergio D. Rodríguez Camarillo, INIFAP, México Dra. Nydia Edith Reyes Rodríguez, Universidad Autónoma del Estado de Hidalgo, México Dra. Maria Salud Rubio Lozano, Facultad de Medicina Veterinaria y Zootecnia, UNAM, México Dra. Elizabeth Loza-Rubio, INIFAP, México Dr. Juan Carlos Saiz Calahorra, Instituto Nacional de Investigaciones Agrícolas, España Dr. José Armando Partida de la Peña, INIFAP, México Dr. José Luis Romano Muñoz, INIFAP, México Dr. Jorge Alberto López García, INIFAP, México

Dr. Alejandro Plascencia Jorquera, Universidad Autónoma de Baja California, México Dr. Juan Ku Vera, Universidad Autónoma de Yucatán, México Dr. Ricardo Basurto Gutiérrez, INIFAP, México Dr. Luis Corona Gochi, Facultad de Medicina Veterinaria y Zootecnia, UNAM, México Dr. Juan Manuel Pinos Rodríguez, Facultad de Medicina Veterinaria y Zootecnia, Universidad Veracruzana, México Dr. Carlos López Coello, Facultad de Medicina Veterinaria y Zootecnia, UNAM, México Dr. Arturo Francisco Castellanos Ruelas, Facultad de Química. UADY Dra. Guillermina Ávila Ramírez, UNAM, México Dr. Emmanuel Camuus, CIRAD, Francia. Dr. Héctor Jiménez Severiano, INIFAP., México Dr. Juan Hebert Hernández Medrano, UNAM, México Dr. Adrian Guzmán Sánchez, Universidad Autónoma Metropolitana-Xochimilco, México Dr. Eugenio Villagómez Amezcua Manjarrez, INIFAP, CENID Salud Animal e Inocuidad, México Dr. José Juan Hernández Ledezma, Consultor privado Dr. Fernando Cervantes Escoto, Universidad Autónoma Chapingo, México Dr. Adolfo Guadalupe Álvarez Macías, Universidad Autónoma Metropolitana Xochimilco, México Dr. Alfredo Cesín Vargas, UNAM, México Dra. Marisela Leal Hernández, INIFAP, México Dr. Efrén Ramírez Bribiesca, Colegio de Postgraduados, México

TIPOGRAFÍA Y FORMATO: Oscar L. Rodríguez Rivera

Indizada en el “Journal Citation Report” Science Edition del ISI . Inscrita en el Sistema de Clasificación de Revistas Científicas y Tecnológicas de CONACyT; en EBSCO Host y la Red de Revistas Científicas de América Latina y el Caribe, España y Portugal (RedALyC) (www.redalyc.org); en la Red Iberoamericana de Revistas Científicas de Veterinaria de Libre Acceso (www.veterinaria.org/revistas/ revivec); en los Índices SCOPUS y EMBASE de Elsevier (www.elsevier. com).

REVISTA MEXICANA DE CIENCIAS PECUARIAS La Revista Mexicana de Ciencias Pecuarias es un órgano de difusión científica y técnica de acceso abierto, revisada por pares y arbitrada. Su objetivo es dar a conocer los resultados de las investigaciones realizadas por cualquier institución científica, relacionadas particularmente con las distintas disciplinas de la Medicina Veterinaria y la Zootecnia. Además de trabajos de las disciplinas indicadas en su Comité Editorial, se aceptan también para su evaluación y posible publicación, trabajos de otras disciplinas, siempre y cuando estén relacionados con la investigación pecuaria. Se publican en la revista tres categorías de trabajos: Artículos Científicos, Notas de Investigación y Revisiones Bibliográficas (consultar las Notas al autor); la responsabilidad de cada trabajo recae exclusivamente en los autores, los cuales, por la naturaleza misma de los experimentos pueden verse obligados a referirse en algunos casos a los nombres comerciales de ciertos productos, ello sin embargo, no implica preferencia por los productos citados o ignorancia respecto a los omitidos, ni tampoco significa en modo alguno respaldo publicitario hacia los productos mencionados. Todas las contribuciones serán cuidadosamente evaluadas por árbitros, considerando su calidad y relevancia académica. Queda entendido que el someter un manuscrito implica que la investigación descrita es única e inédita. La publicación de Rev. Mex. Cienc. Pecu. es trimestral en formato bilingüe Español e Inglés. El costo

total por publicar es de $ 7,280.00 más IVA por manuscrito ya editado. Se publica en formato digital en acceso abierto, por lo que se autoriza la reproducción total o parcial del contenido de los artículos si se cita la fuente. El envío de los trabajos de debe realizar directamente en el sitio oficial de la revista. Correspondencia adicional deberá dirigirse al Editor Adjunto a la siguiente dirección: Calle 36 No. 215 x 67 y 69 Colonia Montes de Amé, C.P. 97115 Mérida, Yucatán, México. Tel/Fax +52 (999) 941-5030. Correo electrónico (C-ele): rodriguez_oscar@prodigy.net.mx. La correspondencia relativa a suscripciones, asuntos de intercambio o distribución de números impresos anteriores, deberá dirigirse al Editor en Jefe de la Revista Mexicana de Ciencias Pecuarias, CENID Salud Animal e Inocuidad, Km 15.5 Carretera México-Toluca, Col. Palo Alto, D.F. C.P. 05110, México; Tel: +52(55) 3871-8700 ext. 80316; garcia.arturo@inifap.gob.mx o arias.alfonso@inifap.gob.mx. Inscrita en la base de datos de EBSCO Host y la Red de Revistas Científicas de América Latina y el Caribe, España y Portugal (RedALyC) (www.redalyc.org), en la Red Iberoamericana de Revistas Científicas de Veterinaria de Libre Acceso (www.veterinaria.org/revistas/ revivec), indizada en el “Journal Citation Report” Science Edition del ISI (http://thomsonreuters. com/) y en los Índices SCOPUS y EMBASE de Elsevier (www.elsevier.com)

VISITE NUESTRA PÁGINA EN INTERNET Artículos completos desde 1963 a la fecha y Notas al autor en: http://cienciaspecuarias.inifap.gob.mx Revista Mexicana de Ciencias Pecuarias is an open access peer-reviewed and refereed scientific and technical journal, which publishes results of research carried out in any scientific or academic institution, especially related to different areas of veterinary medicine and animal production. Papers on disciplines different from those shown in Editorial Committee can be accepted, if related to livestock research. The journal publishes three types of papers: Research Articles, Technical Notes and Review Articles (please consult Instructions for authors). Authors are responsible for the content of each manuscript, which, owing to the nature of the experiments described, may contain references, in some cases, to commercial names of certain products, which however, does not denote preference for those products in particular or of a lack of knowledge of any other which are not mentioned, nor does it signify in any way an advertisement or an endorsement of the referred products. All contributions will be carefully refereed for academic relevance and quality. Submission of an article is understood to imply that the research described is unique and unpublished. Rev. Mex. Cien. Pecu. is published quarterly in original lenguage Spanish or English. Total fee charges are US $ 425.00 per article in both printed languages.

Part of, or whole articles published in this Journal may be reproduced, stored in a retrieval system or transmitted in any form or by any means, electronic, mechanical, photocopying or otherwise, provided the source is properly acknowledged. Manuscripts should be submitted directly in the official web site. Additional information may be mailed to Associate Editor, Revista Mexicana de Ciencias Pecuarias, Calle 36 No. 215 x 67 y 69 Colonia Montes de Amé, C.P. 97115 Mérida, Yucatán, México. Tel/Fax +52 (999) 941-5030. E-mail: rodriguez_oscar@prodigy.net.mx. For subscriptions, exchange or distribution of previous printed issues, please contact: Editor-in-Chief of Revista Mexicana de Ciencias Pecuarias, CENID Salud Animal e Inocuidad, Km 15.5 Carretera México-Toluca, Col. Palo Alto, D.F. C.P. 05110, México; Tel: +52(55) 3871-8700 ext. 80316; garcia.arturo@inifap.gob.mx or arias.alfonso@inifap.gob.mx. Registered in the EBSCO Host database. The Latin American and the Caribbean Spain and Portugal Scientific Journals Network (RedALyC) (www.redalyc.org). The Iberoamerican Network of free access Veterinary Scientific Journals (www.veterinaria.org/ revistas/ revivec). Thomson Reuter´s “Journal Citation Report” Science Edition (http://thomsonreuters.com/). Elsevier´s SCOPUS and EMBASE (www.elsevier.com) and the Essential Electronic Agricultural Library (www.teeal.org).

VISIT OUR SITE IN THE INTERNET Full articles from year 1963 to date and Instructions for authors can be accessed via the site http://cienciaspecuarias.inifap.gob.mx

REVISTA MEXICANA DE CIENCIAS PECUARIAS

REV. MEX. CIENC. PECU.

VOL. 13 No. 1

ENERO-MARZO-2022

CONTENIDO Contents ARTÍCULOS Articles Pág. Efectos del genotipo, tamaño de la camada y el sexo sobre las características de la canal y el perfil de ácidos grasos en corderos de pelo Effects of genotype, litter size and sex on carcass characteristics and fatty acid profile in hair lambs Oscar Elías Cruz-Sánchez, José Herrera-Camacho, Ricardo A. García-Herrera, Lorena Aguayo-Ulloa, Víctor M. Moo-Huchin, Aldenamar Cruz- Hernández, Armando Gómez- Vázquez, Ulises Macias-Cruz, Alfonso J. Chay-Canul…………………………………………………………………………………………………………….1 Performance of lambs fed total feed silage based on cactus pear Rendimiento de corderos alimentados con ensilaje como alimento total a base de nopal Juscelino Kubitschek Bevenuto da Silva, Gherman Garcia Leal de Araújo, Edson Mauro Santos, Juliana Silva de Oliveira, Fleming Sena Campos, Glayciane Costa Gois, Tiago Santos Silva, Alex Gomes da Silva Matias, Ossival Lolato Ribeiro, Alexandre Fernandes Perazzo, Anderson de Moura Zanine ............………………………………………………………………………………………………………….19 Comparación en la calidad de huevos obtenidos en un sistema de producción en corrales al aire libre y los producidos en un sistema de jaula Comparison in the quality of eggs obtained in an outdoor pen production system and those produced in a cage system Samantha Romo, Daniela López, Néstor Ledesma, Carlos Gutiérrez, Antonio Quintana, Lucía Rangel …………………………………………………………………………………………………………………….…32 Using grapeseed meal as natural antioxidant in slow-growing Hubbard broiler diets enriched in polyunsaturated fatty acids Uso de harina de semilla de uva como antioxidante natural en dietas de pollos de engorda Hubbard de crecimiento lento enriquecidas con ácidos grasos poliinsaturados Margareta Olteanu, Tatiana Dumitra Panaite, Raluca Paula Turcu, Mariana Ropota, Petru Alexandru Vlaicu, Monica Mitoi …………………………………………………………………………………………………………..43

III

Factores asociados a indicadores de crianza de reemplazos bovinos durante el periodo de lactancia en unidades lecheras de pequeña escala Factors associated with indicators of calf rearing during the lactation period in small-scale dairy farms Fernando Villaseñor González, Eliab Estrada Cortés, Lilia del Rocío Montes Oceguera, Héctor Raymundo Vera Ávila, Luis Javier Montiel Olguín, Héctor Jiménez Severiano, Mario Alfredo Espinosa Martínez …………………………………………………………………………………………………………….…64 Impacto económico y productivo de una mezcla herbal con derivados de colina en la producción de conejos Economic and productive impact of an herbal mixture with choline derivatives on rabbit production Minerva Jaurez-Espinosa, Pedro Abel Hernández-García, Amada Isabel Osorio-Terán, Germán David Mendoza-Martínez, Juan José Ojeda-Carrasco, María Zamira Tapia-Rodríguez, Enrique EspinosaAyala ……………..……………………………………………………………………………………………………………….…82 Características de la canal y perfil de ácidos grasos de la carne de corderos criollos suplementados con semilla de algodón y maíz Carcass characteristics and fatty acid profile of the meat of Creole lambs supplemented with cottonseed and corn Emiro Suárez Paternina, Libardo Maza Ángulo, Wilson Barragán Hernández, Lorena Aguayo Ulloa, Oscar Vergara Garay…………………………………………………………………………………………….………………97 Correlación entre variables ante mortem y post mortem en canales de ovinos producidos en México Correlation between ante-mortem and post-mortem variables in sheep carcasses produced in Mexico Lizbeth Esmeralda Robles Jiménez, José Armando Partida de la Peña, Miguel Enrique Arechavaleta Velasco, Ignacio Arturo Domínguez Vara ……………………………………………………………..………………115 Financial performance and opportunistic commercialization of beef production systems in southern Brazil Desempeño financiero y comercialización oportunista de los sistemas de producción de carne de res en el sur de Brasil Amir Gil Sessim, Maria Eugênia Andrighetto Canozzi, Gabriel Ribas Pereira, Eduardo Madeira Castilho, Júlio Otávio Jardim Barcellos ....................................................................................127 Modelos de negocio para la producción de ovinos en el nororiente y centro del Estado de México Business models for sheep production in the Northeast and center of the State of Mexico Judith Calderón-Cabrera, Vinicio Horacio Santoyo-Cortés, Enrique Genaro Martínez-González, Víctor Herminio Palacio-Muñoz…………………………………….………………………………………………………145

Effect of early age at first calving on longevity, number of days in production and lifetime milk yield of Holstein and Brown Swiss dairy cows in Honduras Efecto de la edad al primer parto sobre la longevidad, el número de días en producción y la producción de leche durante la vida productiva de las vacas lecheras Holstein y Pardo Suizo en Honduras Karen Alessa Copas Medina, Manuel Valladares Rodas, Juan José Baeza Rodríguez, Juan Gabriel Magaña Monforte, José Candelario Segura Correa ………………………………………………………..………163 Efecto de la viscosidad en el medio para la criopreservación espermática de gallo (Gallus gallus) Effect of viscosity on the medium for rooster (Gallus gallus) sperm cryopreservation José Antonio Herrera Barragán, José Manuel Huitrón, Juan José Pérez-Rivero, Adrián Guzmán Sánchez, Alejandro Ávalos Rodríguez, Ana María Rosales Torres, Ricardo Camarillo Flores ….……175 Antimicrobial residues found in poultry commercialized in retail stores from the Metropolitan Area of Guadalajara, Jalisco Residuos de antimicrobianos encontrados en aves de corral comercializadas en tiendas minoristas de la zona Metropolitana de Guadalajara, Jalisco Delia Guillermina González-Aguilar, Maritza Alejandra Ramírez-López, Iyari Ximena Uribe-Camberos, Jeannette Barba-León …………………………………………………………………………………..……………………187 Determinación serológica del virus de leucosis enzoótica bovina (VLEB) en el municipio de Paipa, Boyacá (Colombia) Serological determination of enzootic bovine leukosis virus (EBLV) in the municipality of Paipa, Boyacá (Colombia) Jorge Alejandro Jiménez Sánchez, Diana María Bulla-Castañeda, Adriana María Díaz-Anaya, Diego José García-Corredor, Martin Orlando Pulido-Medellín ……………………………………………………………200 Hematological, biochemical, and endocrine parameters in acute response to increasingintensity exercise in Colombian Paso horses Parámetros hematológicos, bioquímicos y endocrinos en la respuesta aguda al ejercicio de intensidad creciente en caballos de Paso colombianos Angélica María Zuluaga Cabrera, Maria José Casas Soto, José Ramón Martínez Aranzales, Viviana Elena Castillo Vanegas, Nathalia María del Pilar Correa Valencia, María Patricia Arias Gutiérrez ...211 Efecto del comportamiento higiénico sobre la resistencia a la cría calcárea (Ascosphaera apis) en colonias de abejas africanizadas (Apis mellifera) Effect of hygienic behavior on resistance to chalkbrood disease (Ascosphaera apis) in Africanized bee colonies (Apis mellifera) Carlos Aurelio Medina-Flores, Luis Abdelmir Medina Medina, Ernesto Guzmán-Novoa ……………….225

Producción y calidad nutritiva de Tithonia diversifolia (Hemsl.) A. Grey en tres épocas del año y su efecto en la preferencia por ovinos Pelibuey Production and nutritional quality of Tithonia diversifolia (Hemsl.) A. Grey in three seasons of the year and its effect on the preference by Pelibuey sheep Vicky Tatiana Vargas Velázquez, Ponciano Pérez Hernández, Silvia López Ortiz, Epigmenio Castillo Gallegos, Cristino Cruz Lazo, Jesús Jarillo Rodríguez ……………………………………………………..………240 NOTAS DE INVESTIGACIÓN Technical notes Efecto del aceite de orégano en las propiedades fisicoquímicas, texturales y sensoriales del queso panela Oregano essential oil in panela-type cheese: its effects on physicochemical, texture and sensory parameters Niriel Sánchez-Zamora, Mónica Dinorah Cepeda-Rizo, Katty Lorena Tamez-Garza, Beatriz Adriana Rodríguez-Romero, Sugey Ramona Sinagawa-García, Alejandro Isabel Luna Maldonado, Emmanuel Flores-Girón, Gerardo Méndez-Zamora ………………………………………………………………………………..258 Efecto de la nisina en la inhibición del crecimiento de Staphylococcus areus y en las propiedades sensoriales del queso costeño Effect of nisin on the inhibition of the growth of Staphylococcus areus and on the sensory properties of coastal cheese Beatriz Alvarez Badel, Maria Alejandra Doria Espitia, Vanesa Hodeg Peña, Mónica María Simanca Sotelo, Yenis Pastrana Puche, Claudia Denise De Paula…………………………………………………….……272 El huevo de traspatio: ventana de oportunidad de ingresos en comunidades del Municipio de Texcoco, Estado de México Backyard eggs: an income opportunity window in communities in Texcoco, Mexico Juan Hernández Ortiz, Olga Jacqueline Galicia Rojano, Enrique Melo Guerrero, Ramón Valdivia Alcalá, Luis Manuel Valenzuela Núñez……………………………………………………………………………..……287 Rendimiento y digestibilidad de forraje de cultivares de Urochloa spp. a tres edades de rebrote en épocas de lluvias y seca Forage yield and digestibility of Urochloa spp. cultivars at three regrowth ages in the rainy and dry seasons in Ecuador Jonathan Raúl Garay Martínez, Benigno Estrada Drouaillet, Juan Carlos Martínez González, Santiago Joaquín Cancino, Hernán Patricio Guevara Costles, Marco Vinicio Acosta Jácome, Eugenia Guadalupe Cienfuegos Rivas……………………………………………………………………………………297 Incubación, pre-lisis y post-purificación en el rendimiento y pureza de ácidos nucleicos extraídos de sangre de cabras domésticas contenida en tarjetas FTA Incubation, pre-lysis and post-purification on the yield and purity of nucleic acids extracted from blood of domestic goats contained in FTA cards Carolina Sancho-Blanco, Esteban J. Jiménez-Alfaro, Ramón Molina-Bravo, Rodolfo UmañaCastro………………………………………………………………………………………………………………………………311

Actualización: marzo, 2020 NOTAS AL AUTOR La Revista Mexicana de Ciencias Pecuarias se edita completa en dos idiomas (español e inglés) y publica tres categorías de trabajos: Artículos científicos, Notas de investigación y Revisiones bibliográficas.

Los autores interesados en publicar en esta revista deberán ajustarse a los lineamientos que más adelante se indican, los cuales en términos generales, están de acuerdo con los elaborados por el Comité Internacional de Editores de Revistas Médicas (CIERM) Bol Oficina Sanit Panam 1989;107:422-437. 1.

Página del título Resumen en español Resumen en inglés Texto Agradecimientos y conflicto de interés Literatura citada

Sólo se aceptarán trabajos inéditos. No se admitirán si están basados en pruebas de rutina, ni datos experimentales sin estudio estadístico cuando éste sea indispensable. Tampoco se aceptarán trabajos que previamente hayan sido publicados condensados o in extenso en Memorias o Simposio de Reuniones o Congresos (a excepción de Resúmenes). Todos los trabajos estarán sujetos a revisión de un Comité Científico Editorial, conformado por Pares de la Disciplina en cuestión, quienes desconocerán el nombre e Institución de los autores proponentes. El Editor notificará al autor la fecha de recepción de su trabajo. El manuscrito deberá someterse a través del portal de la Revista en la dirección electrónica: http://cienciaspecuarias.inifap.gob.mx, consultando el “Instructivo para envío de artículos en la página de la Revista Mexicana de Ciencias Pecuarias”. Para su elaboración se utilizará el procesador de Microsoft Word, con letra Times New Roman a 12 puntos, a doble espacio. Asimismo se deberán llenar los formatos de postulación, carta de originalidad y no duplicidad y disponibles en el propio sitio oficial de la revista.

Por ser una revista con arbitraje, y para facilitar el trabajo de los revisores, todos los renglones de cada página deben estar numerados; asimismo cada página debe estar numerada, inclusive cuadros, ilustraciones y gráficas.

Los artículos tendrán una extensión máxima de 20 cuartillas a doble espacio, sin incluir páginas de Título, y cuadros o figuras (los cuales no deberán exceder de ocho y ser incluidos en el texto). Las Notas de investigación tendrán una extensión máxima de 15 cuartillas y 6 cuadros o figuras. Las Revisiones bibliográficas una extensión máxima de 30 cuartillas y 5 cuadros.

Los manuscritos de las tres categorías de trabajos que se publican en la Rev. Mex. Cienc. Pecu. deberán contener los componentes que a continuación se indican, empezando cada uno de ellos en página aparte.

Página del Título. Solamente debe contener el título del trabajo, que debe ser conciso pero informativo; así como el título traducido al idioma inglés. En el manuscrito no es necesaria información como nombres de autores, departamentos, instituciones, direcciones de correspondencia, etc., ya que estos datos tendrán que ser registrados durante el proceso de captura de la solicitud en la plataforma del OJS (http://ciencias pecuarias.inifap.gob.mx).

Resumen en español. En la segunda página se debe incluir un resumen que no pase de 250 palabras. En él se indicarán los propósitos del estudio o investigación; los procedimientos básicos y la metodología empleada; los resultados más importantes encontrados, y de ser posible, su significación estadística y las conclusiones principales. A continuación del resumen, en punto y aparte, agregue debidamente rotuladas, de 3 a 8 palabras o frases cortas clave que ayuden a los indizadores a clasificar el trabajo, las cuales se publicarán junto con el resumen.

Resumen en inglés. Anotar el título del trabajo en inglés y a continuación redactar el “abstract” con las mismas instrucciones que se señalaron para el resumen en español. Al final en punto y aparte, se deberán escribir las correspondientes palabras clave (“key words”).

10. Texto. Las tres categorías de trabajos que se publican en la Rev. Mex. Cienc. Pecu. consisten en lo siguiente: a) Artículos científicos. Deben ser informes de trabajos originales derivados de resultados parciales o finales de investigaciones. El texto del Artículo científico se divide en secciones que llevan estos encabezamientos:

VII

Introducción Materiales y Métodos Resultados Discusión Conclusiones e implicaciones Literatura citada

referencias, aunque pueden insertarse en el texto (entre paréntesis).

Reglas básicas para la Literatura citada Nombre de los autores, con mayúsculas sólo las iniciales, empezando por el apellido paterno, luego iniciales del materno y nombre(s). En caso de apellidos compuestos se debe poner un guión entre ambos, ejemplo: Elías-Calles E. Entre las iniciales de un autor no se debe poner ningún signo de puntuación, ni separación; después de cada autor sólo se debe poner una coma, incluso después del penúltimo; después del último autor se debe poner un punto.

En los artículos largos puede ser necesario agregar subtítulos dentro de estas divisiones a fin de hacer más claro el contenido, sobre todo en las secciones de Resultados y de Discusión, las cuales también pueden presentarse como una sola sección. b) Notas de investigación. Consisten en modificaciones a técnicas, informes de casos clínicos de interés especial, preliminares de trabajos o investigaciones limitadas, descripción de nuevas variedades de pastos; así como resultados de investigación que a juicio de los editores deban así ser publicados. El texto contendrá la misma información del método experimental señalado en el inciso a), pero su redacción será corrida del principio al final del trabajo; esto no quiere decir que sólo se supriman los subtítulos, sino que se redacte en forma continua y coherente.

El título del trabajo se debe escribir completo (en su idioma original) luego el título abreviado de la revista donde se publicó, sin ningún signo de puntuación; inmediatamente después el año de la publicación, luego el número del volumen, seguido del número (entre paréntesis) de la revista y finalmente el número de páginas (esto en caso de artículo ordinario de revista). Puede incluir en la lista de referencias, los artículos aceptados aunque todavía no se publiquen; indique la revista y agregue “en prensa” (entre corchetes).

c) Revisiones bibliográficas. Consisten en el tratamiento y exposición de un tema o tópico de relevante actualidad e importancia; su finalidad es la de resumir, analizar y discutir, así como poner a disposición del lector información ya publicada sobre un tema específico. El texto se divide en: Introducción, y las secciones que correspondan al desarrollo del tema en cuestión.

En el caso de libros de un solo autor (o más de uno, pero todos responsables del contenido total del libro), después del o los nombres, se debe indicar el título del libro, el número de la edición, el país, la casa editorial y el año. Cuando se trate del capítulo de un libro de varios autores, se debe poner el nombre del autor del capítulo, luego el título del capítulo, después el nombre de los editores y el título del libro, seguido del país, la casa editorial, año y las páginas que abarca el capítulo.

11. Agradecimientos y conflicto de interés. Siempre que corresponda, se deben especificar las colaboraciones que necesitan ser reconocidas, tales como a) la ayuda técnica recibida; b) el agradecimiento por el apoyo financiero y material, especificando la índole del mismo; c) las relaciones financieras que pudieran suscitar un conflicto de intereses. Las personas que colaboraron pueden ser citadas por su nombre, añadiendo su función o tipo de colaboración; por ejemplo: “asesor científico”, “revisión crítica de la propuesta para el estudio”, “recolección de datos”, etc. Siempre que corresponda, los autores deberán mencionar si existe algún conflicto de interés. 12. Literatura citada. Numere las referencias consecutivamente en el orden en que se mencionan por primera vez en el texto. Las referencias en el texto, en los cuadros y en las ilustraciones se deben identificar mediante números arábigos entre paréntesis, sin señalar el año de la referencia. Evite hasta donde sea posible, el tener que mencionar en el texto el nombre de los autores de las referencias. Procure abstenerse de utilizar los resúmenes como referencias; las “observaciones inéditas” y las “comunicaciones personales” no deben usarse como

En el caso de tesis, se debe indicar el nombre del autor, el título del trabajo, luego entre corchetes el grado (licenciatura, maestría, doctorado), luego el nombre de la ciudad, estado y en su caso país, seguidamente el nombre de la Universidad (no el de la escuela), y finalmente el año. Emplee el estilo de los ejemplos que aparecen a continuación, los cuales están parcialmente basados en el formato que la Biblioteca Nacional de Medicina de los Estados Unidos usa en el Index Medicus. Revistas

Artículo ordinario, con volumen y número. (Incluya el nombre de todos los autores cuando sean seis o menos; si son siete o más, anote sólo el nombre de los seis primeros y agregue “et al.”).

VIII

Basurto GR, Garza FJD. Efecto de la inclusión de grasa o proteína de escape ruminal en el comportamiento de toretes Brahman en engorda. Téc Pecu Méx 1998;36(1):35-48.

XI)

Sólo número sin indicar volumen. II) Stephano HA, Gay GM, Ramírez TC. Encephalomielitis, reproductive failure and corneal opacity (blue eye) in pigs associated with a paramyxovirus infection. Vet Rec 1988;(122):6-10.

XII) Cunningham EP. Genetic diversity in domestic animals: strategies for conservation and development. In: Miller RH et al. editors. Proc XX Beltsville Symposium: Biotechnology’s role in genetic improvement of farm animals. USDA. 1996:13.

III) Chupin D, Schuh H. Survey of present status ofthe use of artificial insemination in developing countries. World Anim Rev 1993;(74-75):26-35.

Tesis.

No se indica el autor.

XIII) Alvarez MJA. Inmunidad humoral en la anaplasmosis y babesiosis bovinas en becerros mantenidos en una zona endémica [tesis maestría]. México, DF: Universidad Nacional Autónoma de México; 1989.

IV) Cancer in South Africa [editorial]. S Afr Med J 1994;84:15.

Suplemento de revista.

XIV) Cairns RB. Infrared spectroscopic studies of solid oxigen [doctoral thesis]. Berkeley, California, USA: University of California; 1965.

V) Hall JB, Staigmiller RB, Short RE, Bellows RA, Bartlett SE. Body composition at puberty in beef heifers as influenced by nutrition and breed [abstract]. J Anim Sci 1998;71(Suppl 1):205.

Organización como autor. XV) NRC. National Research Council. The nutrient requirements of beef cattle. 6th ed. Washington, DC, USA: National Academy Press; 1984.

Organización, como autor. VI) The Cardiac Society of Australia and New Zealand. Clinical exercise stress testing. Safety and performance guidelines. Med J Aust 1996;(164):282-284.

XVI) SAGAR. Secretaría de Agricultura, Ganadería y Desarrollo Rural. Curso de actualización técnica para la aprobación de médicos veterinarios zootecnistas responsables de establecimientos destinados al sacrificio de animales. México. 1996.

En proceso de publicación. VII) Scifres CJ, Kothmann MM. Differential grazing use of herbicide treated area by cattle. J Range Manage [in press] 2000.

XVII) AOAC. Oficial methods of analysis. 15th ed. Arlington, VA, USA: Association of Official Analytical Chemists. 1990.

Libros y otras monografías

XVIII) SAS. SAS/STAT User’s Guide (Release 6.03). Cary NC, USA: SAS Inst. Inc. 1988.

Autor total. VIII) Steel RGD, Torrie JH. Principles and procedures of statistics: A biometrical approach. 2nd ed. New York, USA: McGraw-Hill Book Co.; 1980.

XIX) SAS. SAS User´s Guide: Statistics (version 5 ed.). Cary NC, USA: SAS Inst. Inc. 1985.

Publicaciones electrónicas

Autor de capítulo. IX)

XX) Jun Y, Ellis M. Effect of group size and feeder type on growth performance and feeding patterns in growing pigs. J Anim Sci 2001;79:803-813. http://jas.fass.org/cgi/reprint/79/4/803.pdf. Accessed Jul 30, 2003.

Roberts SJ. Equine abortion. In: Faulkner LLC editor. Abortion diseases of cattle. 1rst ed. Springfield, Illinois, USA: Thomas Books; 1968:158-179.

Memorias de reuniones. X)

Olea PR, Cuarón IJA, Ruiz LFJ, Villagómez AE. Concentración de insulina plasmática en cerdas alimentadas con melaza en la dieta durante la inducción de estro lactacional [resumen]. Reunión nacional de investigación pecuaria. Querétaro, Qro. 1998:13.

XXI) Villalobos GC, González VE, Ortega SJA. Técnicas para estimar la degradación de proteína y materia orgánica en el rumen y su importancia en rumiantes en pastoreo. Téc Pecu Méx 2000;38(2): 119-134. http://www.tecnicapecuaria.org/trabajos/20021217 5725.pdf. Consultado 30 Ago, 2003.

Loeza LR, Angeles MAA, Cisneros GF. Alimentación de cerdos. En: Zúñiga GJL, Cruz BJA editores. Tercera reunión anual del centro de investigaciones forestales y agropecuarias del estado de Veracruz. Veracruz. 1990:51-56.

XXII) Sanh MV, Wiktorsson H, Ly LV. Effect of feeding level on milk production, body weight change, feed conversion and postpartum oestrus of crossbred lactating cows in tropical conditions. Livest Prod Sci 2002;27(2-3):331-338. http://www.sciencedirect. com/science/journal/03016226. Accessed Sep 12, 2003.

ha hectárea (s) h hora (s) i.m. intramuscular (mente) i.v. intravenosa (mente) J joule (s) kg kilogramo (s) km kilómetro (s) L litro (s) log logaritmo decimal Mcal megacaloría (s) MJ megajoule (s) m metro (s) msnm metros sobre el nivel del mar µg microgramo (s) µl microlitro (s) µm micrómetro (s)(micra(s)) mg miligramo (s) ml mililitro (s) mm milímetro (s) min minuto (s) ng nanogramo (s)Pprobabilidad (estadística) p página PC proteína cruda PCR reacción en cadena de la polimerasa pp páginas ppm partes por millón % por ciento (con número) rpm revoluciones por minuto seg segundo (s) t tonelada (s) TND total de nutrientes digestibles UA unidad animal UI unidades internacionales

13. Cuadros, Gráficas e Ilustraciones. Es preferible que sean pocos, concisos, contando con los datos necesarios para que sean autosuficientes, que se entiendan por sí mismos sin necesidad de leer el texto. Para las notas al pie se deberán utilizar los símbolos convencionales. 14 Versión final. Es el documento en el cual los autores ya integraron las correcciones y modificaciones indicadas por el Comité Revisor. Los trabajos deberán ser elaborados con Microsoft Word. Las fotografías e imágenes deberán estar en formato jpg (o compatible) con al menos 300 dpi de resolución. Tanto las fotografías, imágenes, gráficas, cuadros o tablas deberán incluirse en el mismo archivo del texto. Los cuadros no deberán contener ninguna línea vertical, y las horizontales solamente las que delimitan los encabezados de columna, y la línea al final del cuadro. 15. Una vez recibida la versión final, ésta se mandará para su traducción al idioma inglés o español, según corresponda. Si los autores lo consideran conveniente podrán enviar su manuscrito final en ambos idiomas. 16. Tesis. Se publicarán como Artículo o Nota de Investigación, siempre y cuando se ajusten a las normas de esta revista. 17. Los trabajos no aceptados para su publicación se regresarán al autor, con un anexo en el que se explicarán los motivos por los que se rechaza o las modificaciones que deberán hacerse para ser reevaluados.

versus

gravedades

Cualquier otra abreviatura se pondrá entre paréntesis inmediatamente después de la(s) palabra(s) completa(s).

18. Abreviaturas de uso frecuente: cal cm °C DL50 g

caloría (s) centímetro (s) grado centígrado (s) dosis letal 50% gramo (s)

19. Los nombres científicos y otras locuciones latinas se deben escribir en cursivas.

Updated: March, 2020 INSTRUCTIONS FOR AUTHORS Revista Mexicana de Ciencias Pecuarias is a scientific journal published in a bilingual format (Spanish and English) which carries three types of papers: Research Articles, Technical Notes, and Reviews. Authors interested in publishing in this journal, should follow the belowmentioned directives which are based on those set down by the International Committee of Medical Journal Editors (ICMJE) Bol Oficina Sanit Panam 1989;107:422-437. 1.

Title page Abstract Text Acknowledgments and conflict of interest Literature cited

Only original unpublished works will be accepted. Manuscripts based on routine tests, will not be accepted. All experimental data must be subjected to statistical analysis. Papers previously published condensed or in extenso in a Congress or any other type of Meeting will not be accepted (except for Abstracts). All contributions will be peer reviewed by a scientific editorial committee, composed of experts who ignore the name of the authors. The Editor will notify the author the date of manuscript receipt. Papers will be submitted in the Web site http://cienciaspecuarias.inifap.gob.mx, according the “Guide for submit articles in the Web site of the Revista Mexicana de Ciencias Pecuarias”. Manuscripts should be prepared, typed in a 12 points font at double space (including the abstract and tables), At the time of submission a signed agreement co-author letter should enclosed as complementary file; coauthors at different institutions can mail this form independently. The corresponding author should be indicated together with his address (a post office box will not be accepted), telephone and Email.

Title page. It should only contain the title of the work, which should be concise but informative; as well as the title translated into English language. In the manuscript is not necessary information as names of authors, departments, institutions and correspondence addresses, etc.; as these data will have to be registered during the capture of the application process on the OJS platform (http://cienciaspecuarias.inifap.gob.mx).

Abstract. On the second page a summary of no more than 250 words should be included. This abstract should start with a clear statement of the objectives and must include basic procedures and methodology. The more significant results and their statistical value and the main conclusions should be elaborated briefly. At the end of the abstract, and on a separate line, a list of up to 10 key words or short phrases that best describe the nature of the research should be stated.

Text. The three categories of articles which are published in Revista Mexicana de Ciencias Pecuarias are the following:

a) Research Articles. They should originate in primary works and may show partial or final results of research. The text of the article must include the following parts:

To facilitate peer review all pages should be numbered consecutively, including tables, illustrations and graphics, and the lines of each page should be numbered as well.

Introduction Materials and Methods Results Discussion Conclusions and implications Literature cited

Research articles will not exceed 20 double spaced pages, without including Title page and Tables and Figures (8 maximum and be included in the text). Technical notes will have a maximum extension of 15 pages and 6 Tables and Figures. Reviews should not exceed 30 pages and 5 Tables and Figures.

In lengthy articles, it may be necessary to add other sections to make the content clearer. Results and Discussion can be shown as a single section if considered appropriate.

Manuscripts of all three type of articles published in Revista Mexicana de Ciencias Pecuarias should contain the following sections, and each one should begin on a separate page.

b) Technical Notes. They should be brief and be

evidence for technical changes, reports of clinical cases of special interest, complete description of a limited investigation, or research results which

should be published as a note in the opinion of the editors. The text will contain the same information presented in the sections of the research article but without section titles.

names(s), the number of the edition, the country, the printing house and the year. e. When a reference is made of a chapter of book written by several authors; the name of the author(s) of the chapter should be quoted, followed by the title of the chapter, the editors and the title of the book, the country, the printing house, the year, and the initial and final pages.

c) Reviews. The purpose of these papers is to summarize, analyze and discuss an outstanding topic. The text of these articles should include the following sections: Introduction, and as many sections as needed that relate to the description of the topic in question.

f. In the case of a thesis, references should be made of the author’s name, the title of the research, the degree obtained, followed by the name of the City, State, and Country, the University (not the school), and finally the year.

10. Acknowledgements. Whenever appropriate, collaborations that need recognition should be specified: a) Acknowledgement of technical support; b) Financial and material support, specifying its nature; and c) Financial relationships that could be the source of a conflict of interest.

Examples The style of the following examples, which are partly based on the format the National Library of Medicine of the United States employs in its Index Medicus, should be taken as a model.

People which collaborated in the article may be named, adding their function or contribution; for example: “scientific advisor”, “critical review”, “data collection”, etc. 11. Literature cited. All references should be quoted in their original language. They should be numbered consecutively in the order in which they are first mentioned in the text. Text, tables and figure references should be identified by means of Arabic numbers. Avoid, whenever possible, mentioning in the text the name of the authors. Abstain from using abstracts as references. Also, “unpublished observations” and “personal communications” should not be used as references, although they can be inserted in the text (inside brackets).

Key rules for references a. The names of the authors should be quoted beginning with the last name spelt with initial capitals, followed by the initials of the first and middle name(s). In the presence of compound last names, add a dash between both, i.e. Elias-Calles E. Do not use any punctuation sign, nor separation between the initials of an author; separate each author with a comma, even after the last but one. b. The title of the paper should be written in full, followed by the abbreviated title of the journal without any punctuation sign; then the year of the publication, after that the number of the volume, followed by the number (in brackets) of the journal and finally the number of pages (this in the event of ordinary article). c. Accepted articles, even if still not published, can be included in the list of references, as long as the journal is specified and followed by “in press” (in brackets).

Journals

Standard journal article (List the first six authors followed by et al.) I)

Basurto GR, Garza FJD. Efecto de la inclusión de grasa o proteína de escape ruminal en el comportamiento de toretes Brahman en engorda. Téc Pecu Méx 1998;36(1):35-48.

Issue with no volume II) Stephano HA, Gay GM, Ramírez TC. Encephalomielitis, reproductive failure and corneal opacity (blue eye) in pigs associated with a paramyxovirus infection. Vet Rec 1988;(122):6-10. III) Chupin D, Schuh H. Survey of present status of the use of artificial insemination in developing countries. World Anim Rev 1993;(74-75):26-35.

No author given IV) Cancer in South Africa [editorial]. S Afr Med J 1994;84:15.

Journal supplement V) Hall JB, Staigmiller RB, Short RE, Bellows RA, Bartlett SE. Body composition at puberty in beef heifers as influenced by nutrition and breed [abstract]. J Anim Sci 1998;71(Suppl 1):205.

d. In the case of a single author’s book (or more than one, but all responsible for the book’s contents), the title of the book should be indicated after the

XII

Organization, as author VI) The Cardiac Society of Australia and New Zealand. Clinical exercise stress testing. Safety and performance guidelines. Med J Aust 1996;(164):282284.

In press VII) Scifres CJ, Kothmann MM. Differential grazing use of herbicide-treated area by cattle. J Range Manage [in press] 2000. Books and other monographs

Author(s) VIII) Steel RGD, Torrie JH. Principles and procedures of statistics: A biometrical approach. 2nd ed. New York, USA: McGraw-Hill Book Co.; 1980.

Organization as author XV) NRC. National Research Council. The nutrient requirements of beef cattle. 6th ed. Washington, DC, USA: National Academy Press; 1984. XVI) SAGAR. Secretaría de Agricultura, Ganadería y Desarrollo Rural. Curso de actualización técnica para la aprobación de médicos veterinarios zootecnistas responsables de establecimientos destinados al sacrificio de animales. México. 1996. XVII) AOAC. Official methods of analysis. 15th ed. Arlington, VA, USA: Association of Official Analytical Chemists. 1990. XVIII) SAS. SAS/STAT User’s Guide (Release 6.03). Cary NC, USA: SAS Inst. Inc. 1988. XIX) SAS. SAS User´s Guide: Statistics (version 5 ed.). Cary NC, USA: SAS Inst. Inc. 1985.

Chapter in a book IX)

Roberts SJ. Equine abortion. In: Faulkner LLC editor. Abortion diseases of cattle. 1rst ed. Springfield, Illinois, USA: Thomas Books; 1968:158-179.

Conference paper X)

XI)

Thesis XIII) Alvarez MJA. Inmunidad humoral en la anaplasmosis y babesiosis bovinas en becerros mantenidos en una zona endémica [tesis maestría]. México, DF: Universidad Nacional Autónoma de México; 1989.

Electronic publications XX) Jun Y, Ellis M. Effect of group size and feeder type on growth performance and feeding patterns in growing pigs. J Anim Sci 2001;79:803-813. http://jas.fass.org/cgi/reprint/79/4/803.pdf. Accesed Jul 30, 2003. XXI) Villalobos GC, González VE, Ortega SJA. Técnicas para estimar la degradación de proteína y materia orgánica en el rumen y su importancia en rumiantes en pastoreo. Téc Pecu Méx 2000;38(2): 119-134. http://www.tecnicapecuaria.org/trabajos/20021217 5725.pdf. Consultado 30 Jul, 2003. XXII) Sanh MV, Wiktorsson H, Ly LV. Effect of feeding level on milk production, body weight change, feed conversion and postpartum oestrus of crossbred lactating cows in tropical conditions. Livest Prod Sci 2002;27(2-3):331-338. http://www.sciencedirect.com/science/journal/030 16226. Accesed Sep 12, 2003. 12. Tables, Graphics and Illustrations. It is preferable that they should be few, brief and having the necessary data so they could be understood without reading the text. Explanatory material should be placed in footnotes, using conventional symbols.

13. Final version. This is the document in which the authors have already integrated the corrections and modifications indicated by the Review Committee. The works will have to be elaborated with Microsoft Word. Photographs and images must be in jpg (or compatible) format with at least 300 dpi resolution. Photographs, images, graphs, charts or tables must be included in the same text file. The boxes should not contain any vertical lines, and the horizontal ones only those that delimit the column headings, and the line at the end of the box.

XIV) Cairns RB. Infrared spectroscopic studies of solid oxigen [doctoral thesis]. Berkeley, California, USA: University of California; 1965.

XIII

14. Once accepted, the final version will be translated into Spanish or English, although authors should feel free to send the final version in both languages. No charges will be made for style or translation services.

MJ m µl µm mg ml mm min ng

mega joule (s) meter (s) micro liter (s) micro meter (s) milligram (s) milliliter (s) millimeter (s) minute (s) nanogram (s) P probability (statistic) p page CP crude protein PCR polymerase chain reaction pp pages ppm parts per million % percent (with number) rpm revolutions per minute sec second (s) t metric ton (s) TDN total digestible nutrients AU animal unit IU international units

15. Thesis will be published as a Research Article or as a Technical Note, according to these guidelines. 16. Manuscripts not accepted for publication will be returned to the author together with a note explaining the cause for rejection, or suggesting changes which should be made for re-assessment.

17. List of abbreviations: cal cm °C DL50 g ha h i.m. i.v. J kg km L log Mcal

calorie (s) centimeter (s) degree Celsius lethal dose 50% gram (s) hectare (s) hour (s) intramuscular (..ly) intravenous (..ly) joule (s) kilogram (s) kilometer (s) liter (s) decimal logarithm mega calorie (s)

versus

gravidity

The full term for which an abbreviation stands should precede its first use in the text. 18. Scientific names and other Latin terms should be written in italics.

XIV

https://doi.org/10.22319/rmcp.v13i1.5727 Article

Effects of genotype, litter size and sex on carcass characteristics and fatty acid profile in hair lambs

Oscar Elías Cruz-Sánchez a José Herrera-Camacho b Ricardo A. García-Herrera a Lorena Aguayo-Ulloa c Víctor M. Moo-Huchin d Aldenamar Cruz- Hernández a Armando Gómez- Vázquez a Ulises Macias-Cruz e Alfonso J. Chay-Canul a*

Universidad Juárez Autónoma de Tabasco. División Académica de Ciencias Agropecuarias, Carr. Villahermosa-Teapa, km 25, CP 86280. Villahermosa, Tabasco, México. b

Universidad Michoacana de San Nicolás de Hidalgo. Instituto de Investigaciones Agropecuarias y Forestales. Michoacán, México. c

Corporación Colombiana de Investigación Agropecuaria-AGROSAVIA. Centro de Investigación Turipaná. Córdoba, Colombia. d

Tecnológico Nacional de México, Instituto Tecnológico de Mérida. Yucatán. México.

Universidad Autónoma de Baja California. Instituto de Ciencias Agrícolas. Baja California, México.

*Corresponding autor: alfonso.chay@ujat.mx; alfonsochay2@gmail.com

Rev Mex Cienc Pecu 2022;13(1):1-18

Abstract: The effect of the genotype (Pelibuey vs Katahdin), type of lambing (single vs. double) and sex (males vs. females) on the characteristics of the carcass and its cuts, in addition to the fatty acid profile of the loin were evaluated in 66 lambs slaughtered at weaning. The yield of the carcass and ribs were higher (P<0.05) in the Pelibuey breed. Slaughter weight, carcass weight and rib yield were higher (P<0.01) in single-born lambs, while the yield of shoulder and leg were lower (P<0.01) than in double-born lambs. The proportion of soft tissue of the different cuts was higher (P<0.05), but that of bone was lower (P< 0.05) in single-born lambs than in double-born lambs. Females had a higher (P<0.05) proportion of soft tissue and a lower proportion of bone (P<0.01) than males. The concentrations of C18:1n7 and C20:4n6 were higher (P<0.05) in the Pelibuey breed than in the Katahdin breed, while the C22:5n3 and C22:6n-3 were lower. The percentage of monounsaturated fatty acids was higher (P<0.05) in the meat of single-born lambs, while that of total polyunsaturated fatty acids and n-3 was higher (P<0.05) in double-born lambs. The characteristics of the carcass, the tissue composition of the commercial cuts and the fatty acid profile in hair sheep slaughtered at weaning varied more due to the type of lambing than due to the genotype or sex. Keywords: Carcass characteristics, Sheep carcasses, Lambs, Primal cuts, Tissue composition, Fatty acids.

Received: 10/07/2020 Accepted: 13/04/2021

Introduction Sheep meat in Mexico is consumed mostly in the form of barbacoa, an annual per capita consumption of 600-1000 g is estimated, so fattening male and female lambs, as well as cull adult ewes and rams, are used interchangeably for the preparation of this typical dish of the center of the country(1,2,3). However, there is currently a small sector of the Mexican population that demands gourmet dishes with high quality meat, preferably from young lambs(2,3). One of the most desired products in Mediterranean countries, such as Spain, is lactating lamb, which comes from lactating sheep with ultra-light carcasses and is characterized by having a meat traditionally considered to be of great sensory quality and highly appreciated locally(4). However, the commercialization of primal cuts or carcasses from young lambs, less than three months, has not been usual in Mexico(5). Notwithstanding the above and given the emergence of this market, it is very pertinent to define the type of

Rev Mex Cienc Pecu 2022;13(1):1-18

lambs that offers the best quality of carcass, meat and selling cuts, considering both the sex and type of lambing, as well as the genotype. In fattening lambs, carcass characteristics and meat quality vary due to genetic factors, type of lambing and sex, as well as some management factors that affect feeding, age and slaughter weight(4-11). These factors also influence the yield of commercial cuts and the fatty acid profile of meat from lambs(7,8). All these differences in carcass and meat are due to the fact that these factors cause metabolic, endocrine and gene expression variations, which lead lambs to vary in their growth, as well as in the formation of muscle tissue and fat tissue in the body(3). Several studies have documented the impact that genetic and environmental factors have on the preweaning growth of hair lambs(12-16); however, few have focused on the study of carcass characteristics, the tissue composition of commercial cuts and the fatty acid profile of meat. Recently, some authors(5,17) reported that the characteristics and tissue composition of the carcass are influenced by the type of birth of Blackbelly × Pelibuey lambs, with the carcasses of single-born lambs being heavier and with a higher soft tissue content than the carcasses of multiple-born lambs. However, no information was found regarding the effect of genotype and sex on carcass composition in lambs slaughtered at weaning. Hair sheep are widely distributed in the tropical and subtropical regions of Mexico and, in general, of the American continent, which is due to the fact that they do not present reproductive seasonality and adapt easily to warm climates(18), so they are used for the production of meat for slaughter, but their use is currently being promoted for the production of fine cuts aimed at a select market that demands young lamb meat(19). Therefore, the objective of the present study was to evaluate the effects of genotype, type of lambing and sex on carcass characteristics, tissue composition of commercial cuts and fatty acid profile of meat in lactating hair lambs.

Material and methods Location of the experiment The study was carried out at the ranch “El Rodeo”, located at 17º 84’ NL and 92º 81’ WL, in the municipality of Villahermosa, Tabasco, Mexico. The climate in the region is humid tropical, with an average temperature of 27 ºC and a rainfall of 2,550 mm per year(20). All the handling of the animals was carried out in accordance with the Mexican standards that describe the guidelines for the production, care and use of laboratory animals (NOM-062ZOO-1992), as well as their slaughter (NOM-033-ZOO-1995).

Rev Mex Cienc Pecu 2022;13(1):1-18

Animals and experimental management Sixty-six lambs, born to 49 multiparous ewes (age= 2-3 yr, live weight [LW]= 45.6 ± 6.8 kg and body condition= 2.2 ± 0.7 units(21) of the Pelibuey (n= 28) and Katahdin (n= 21) breeds, were used. Of the total number of lambs, 39 were of the Pelibuey breed (21 males and 18 females) and 27 Katahdin (15 males and 12 females), 31 of single lambing and 36 of double lambing, 36 males and 30 females. At lambing, the lambs were identified and housed in individual pens with their mothers, where they remained until d 56 when they were weaned and slaughtered. The pens were located under a shed built with galvanized sheets, without walls and with cement floor. Each pen was equipped with a drinker and a feeder designed so that the lambs did not have access to the mother’s food. The feeding of the ewes consisted of a comprehensive diet formulated to provide 12 MJ of ME/kg of dry matter and 15 % of crude protein. The diet was formulated with 50 % star grass hay (Cynodon nlemfuemsis), 30 % ground corn, 10 % soybean meal, 5 % molasses and 5 % minerals. The ewes were weighed weekly with the aim of adjusting the amount of feed offered according to live weight (LW) to ensure a daily rejection of around 15 %. Feed was offered daily at 0800 and 1500 h in a 50:50 ratio. The availability of water was ad libitum and the state of health of all animals was visually checked daily. In the case of the lambs, the feeding depended only on the consumption of the milk provided by the ewe, the consumption of milk of the lambs was supervised daily, so when some ewes refused to suckle them, the mother was held so that her lamb could suckle.

Characteristics of the carcass and commercial cuts The lambs were weaned at 56 d postpartum, weighed to obtain the live weight at slaughter (LWS) and slaughtered according to the guidelines of the Mexican standard for humanitarian slaughter (NOM-033-ZOO-1995). The lambs had their skin, head, trotters and viscera removed. The content of the gastrointestinal tract was calculated by difference between full and empty weight. The weight of the gastrointestinal content was subtracted from the LWS to obtain the empty live weight (ELW). Once the carcass was obtained, its hot weight (HCW) was recorded and after 24 h of refrigeration at approximately 2 °C, its cold weight (CCW) was recorded. Hot carcass (HCY% = HCW / LWS × 100) and cold carcass yields (CCY% = CCW / LWS × 100), as well as true yield (TY = HCW/ELW × 100), were also calculated. For the determination of the regional composition, the carcasses were cut along the dorsal midline and from the left half carcass, the following cuts were obtained: neck, shoulder, leg, loin and ribs, according to the methodology previously described(3). The weight of the half carcass was recorded, as well as of each cut and the percentage of each of them was calculated. Finally, to obtain the meat yield (composition), each cut was dissected by separating and recording the weight of soft tissue together (muscle, fat, aponeurosis, tendons,

Rev Mex Cienc Pecu 2022;13(1):1-18

nerves and vessels) and bone(22,23). The weight of the soft tissue and bone of each primal cut, as well as the half carcass, were expressed as a percentage of the weight of each cut and the left half carcass, respectively.

Determination of fatty acids In 24 selected lambs, 12 of each genotype and of which six were females and six were males, as well as six from single lambing and six from double lambing, the fatty acid composition of the Longissimus dorsi muscle was determined using a Perkin Elmer Auto system gas chromatograph (Perkin-Elmer, Norwalk, CT, USA), equipped with a flame ionization detector (FID). Fatty acid methyl esters (FAMEs) were prepared according to the methodology described above(24) and injected (1.0 μL) into a BPX–70 capillary column (60 m × 0.25 mm ID). The temperatures of the detector and injector were 260 °C and 240 °C, respectively. The temperature program of the column was from 140 to 240 °C with an increase of 4 °C per minute, using nitrogen (1.0 mL/min) as a carrier gas(25,26). A mixture of FAME standards was used for the identification (by comparison of retention times) of the chromatogram peaks of the samples. The area of the peaks was determined, and the percentage of FAMEs was obtained by the percentage of area by direct normalization. The results were expressed as a percentage of the area of each normalized peak of the total FAMEs identified.

Statistical analysis Information on the characteristics of the carcass and the fatty acid profile of the meat was subjected to an analysis of variance under a completely randomized design with a 2×2×2 factorial arrangements, where the model included the fixed effects of genotype (Pelibuey or Katahdin), type of lambing (single or double), sex (male or female) and possible interactions between factors. A mean analysis was performed with the Tukey test between levels of each main factor and a significance value of P<0.05 was considered. Analyses were performed with PROC GLM of SAS(27).

Results Genotype Significant differences (P<0.05) in the centesimal yields of the carcasses (P<0.05) were obtained between both breeds, but no differences (P>0.05) were found in the variables LWS, ELW, HCW and CCW. The carcasses of Pelibuey lambs had higher (P<0.01) HCYs (+3.82 pp), CCYs (+3.41 pp) and TYs (+4 pp) than Katahdin lambs (Table 1). Pelibuey lambs also achieved a higher (P<0.01) rib yield (+2.44 pp), but lower (P<0.05) neck yield compared to 5

Rev Mex Cienc Pecu 2022;13(1):1-18

Katahdin lambs (-1.83 pp). No significant differences were found in the shoulder and loin, and only a tendency (P=0.08) to an increase in leg yield in Katahdin lambs. The meat yields of the whole carcass and primal cuts were not affected (P=0.11) by the genotype (Table 2). Table 3 shows the fatty acid profile of the meat, with respect to the total fatty acids identified. Significant differences (P<0.01) were observed between breeds in one monounsaturated fatty acid and three polyunsaturated fatty acids. The meat (Longissimus M.) of the Pelibuey lambs presented higher proportions of vaccenic (C18:1n-7) and arachidonic acid (C20:4n-6) and lower proportions of DPA (C22:5n-3) and DHA (C22:6n-6) than the meat of lambs of the Katahdin breed. The total proportions of saturated (TS), monounsaturated (TM) and polyunsaturated fatty acids (PUFAsn-3, PUFAsn-6 and PUFAstotal) were not affected (P>0.05) by the effect of the breed, only the total content of saturated fatty acids showed a tendency (P= 0.07) to increase in the meat of the Katahdin breed compared to the meat of the Pelibuey breed.

Type of lambing Significant differences (P<0.01) were obtained for the type of lambing in the carcass weights, but not in their centesimal yields (CCY, TY). Single-born lambs achieved higher LWS (+2.94 kg), ELW (+2.75 kg), HCW (+1.59 kg) and CCW (+1.58 kg) compared to double-born lambs (Table 1). There was only one tendency (P= 0.08) to increase in HCY in single-born lambs compared to double-born lambs. Shoulder and leg yields were higher (P<0.01) in doubleborn lambs, but rib yield was higher (P<0.01) in single-born lambs (Table 1). The type of lambing also modified (P<0.01) the meat yield of the half carcass, ribs, loin and leg (Table 2). Single-born lambs obtained a higher proportion of soft tissue in the half carcass than double-born lambs (P<0.01). The proportions of soft tissue and bone of the ribs, loin and leg were higher (6.11 pp, +7.26 pp and +4.99 pp, respectively, P<0.01) in single-born lambs compared to double-born lambs. Significant differences (P≤0.05) were observed in the percentage of one saturated fatty acid, two monounsaturated and five polyunsaturated fatty acids (Table 3). Single-born lamb meat compared to double-born lamb meat had lower content of palmitic (C16:00) and elaidic acid (C18:1n-9), but higher content of vaccenic (C18:1n-7), linoleic (C18:2n-6), dihomo-gamma-linolenic (C20:3n-6), arachidonic (C20:4n6) and DPA acids (C22:5n-3). The type of lambing had an effect (P<0.05) on the total percentage of monounsaturated fatty acids (TM), PUFAsn-3 and PUFAsTotal. The TM ratio was higher (P>0.01) in the meat of single-born lambs compared to that of double-born lambs; opposite results were observed for total PUFAsn-3 and PUFAsTotal, where the highest percentage (P< 0.05) occurred in meat from double-born sheep (Table 3).

Sex

Rev Mex Cienc Pecu 2022;13(1):1-18

Sex did not affect (P≥0.08) LWS, ELW, carcass characteristics and the yield of commercial cuts (Table 1), but it did affect (P=0.04) the composition of the ribs, with the percentage of soft tissue being higher and the percentage of bone being lower in females than in males (Table 2). The fatty acid profile was not modified (P>0.05) by the effect of sex (Table 3).

Discussion Carcass characteristics and meat yield In Mexico, only a few studies(5,17) have reported the effect of the number of lambs and type of lambing of ewes on the characteristics and composition of the carcass of recently weaned lambs, so the literature is scarce. The results of the present study confirm preliminary findings regarding the effect of the type of lambing on the HCW; even with a wider difference in weights(5,17). Additionally, the present work indicates that in hair lambs slaughtered at weaning (56 d), the genotype also influences the main variables of quantitative quality of the carcass and its cuts. Single births caused greater weights of the lambs at weaning and of the carcasses of the lambs from double births, with differences of up to +2.94 kg for the LWS and +1.58 kg for the CCW, without difference in the carcass yields. However, the breed did not cause differences in weights but in yields, where the TY of the Pelibuey was 4 points higher than in the Katahdin. A study with information taken from productive records of a Pelibuey flock(28) found no differences in weaning weight between the type of lambing but in daily weight gain. In this work, as in the present study, no significant differences were found in weaning weight between males and females(5); however, several inconsistencies are mentioned(29). Some authors have also reported that, under intensive management conditions in the Pelibuey breed, the type of birth of the lamb affects its weaning weight (WW) and daily weight gain (DWG), while the sex of the lamb affects its development from birth to 180 d(30). However, in these studies only the main effects are considered, without considering the influence of the interaction between the two factors(31). In ruminants, prenatal growth is influenced by several factors, with the level of maternal nutrition and the functional capacity of the placenta standing out(17); while postnatal growth may be limited by maternal nutrition and environmental factors(32). Other authors(33) report that animals from single births have greater growth potential than those from double births. This fact, based on what has been described in previous studies(34), would be related to competition for the mother’s milk, given that lambs from double birth have a lower intake of milk. In this sense, obtaining double births allows greater efficiency in the production of sheep meat, but lambs reach the weight at slaughter at an older age than those from single birth(35). In previous studies(17), an increase in HCW was observed in single-born lambs, with no difference in LWS or CY. These differences between the carcass weight of lambs from single and multiple births may be due to the weight of muscle mass due to an increased individual

Rev Mex Cienc Pecu 2022;13(1):1-18

milk consumption at the lactation stage(17). In lactating lambs of the Canaria breed slaughtered between 48 and 51 d of age, the effect of the breed (Canaria of hair vs Canaria of wool) and sex on the characteristics of the carcass(36) was evaluated, on average, these animals weighed 9.13 kg at slaughter, they obtained carcasses of 4.5 kg and a CCY of 49.06 %, but no significant differences were observed in any variable due to breed or sex. Regarding the yield of the cuts, double-born lambs had a higher yield of the shoulder and leg, but the ribs had a higher yield in single-born lambs. With respect to the genotype, the neck had higher yield in the Katahdin breed and the ribs in the Pelibuey breed. In both cases, it is difficult to explain. Other authors(37), who compared wool lambs vs hair lambs, and males vs females, only obtained differences for both factors in the shoulder. In the composition of the carcass and its cuts, the most outstanding differences in meat yield for this type of product (ultra-light carcasses) originated from the type of lambing, where the lambs from single births reached higher values of soft tissue in the carcass and cuts, where the loin was the cut with the highest meat yield. In this regard, other authors(28), when assessing the meat yield in carcass lambs with similar characteristics, found differences in the kilos of soft tissue of the carcass, but not in the meat yield of the carcass itself, which was lower than in the present study. Regarding the cuts, they only found differences in the weight of the soft tissue of the leg. The physical parameters of meat quality are influenced by sex, in this regard, in previous studies(38), the amount of muscle and meat in males and females of Texel breed was evaluated, observing an increase in the proportion of muscle, being greater than that of fat for variables adjusted to the same weight of the carcass in males. It should be mentioned that the present study does not differentiate the type of tissue (muscle, fat, nerves, vessels, etc.), so the analysis of these results should be taken with caution when compared with those of other authors. The differences attributed to the type of lambing could be associated with an increase in both muscle and fat. In the case of sex, the higher meat yields of some cuts in females could be associated with a higher fat deposit; however, other authors found no differences due to sex on total fat(37).

Fatty acid composition of meat Regarding saturated fatty acids, previous studies conducted on goats(39) found a significant effect of the breed on the concentration of the fatty acids C17:0 and C18:0, of which the latter was the one with the highest proportion, reaching values above 14.5 %. In the case of palmitic acid, it presented a behavior similar to that observed in the present study, that is, its concentration was not affected by the genotype; however, the concentration oscillated between 26.32 and 27.32 %, values that were higher than those reported for lambs in the present work. Regarding the genotype, previous studies(36) show that the concentration of this fatty acid in cuts of bucklings (12 kg of LW) was significantly affected, observing values

Rev Mex Cienc Pecu 2022;13(1):1-18

ranging between 14.59 and 15.88 %, which were lower than those obtained in the present work. Evaluating the composition of fatty acids in hair lambs and a wool breed slaughtered at different weights (10, 16 and 25 kg), they found differences in several saturated fatty acids, mostly due to the effect of slaughter weight, which also significantly influenced the total saturated fatty acids (TS); they also found significant differences due to the effect of the sex; however, these differences were not reflected in the TS(40). In this study, the concentration of palmitic acid was higher than that of the present study, but that of stearic acid was lower in males. Only palmitic acid was significantly higher in females, so there was no effect of the genotype or weight. Regarding the total concentration of monounsaturated fatty acids (TM), a difference of almost 5 pp was observed due to the effect of the type of lambing on the TM, being greater in the meat of lambs from single births. This difference is basically due to the high concentration of oleic acid (C18:1n-9) in the meat of single-born lambs (+4.81 pp), which would cancel out the small difference of vaccenic acid in the meat of double-born lambs (+0.32 pp). Oleic acid was the fatty acid with the highest concentration in meat (30.8635.67 %), which is consistent with what was observed in previous studies carried out in lactating kids and lambs(36), as well as in lactating hair and wool lambs(40). In this regard, it is also pointed out that this fatty acid would decrease the content of LDL cholesterol in the blood, in addition to contributing (along with other fatty acids) to the firmness of the meat and its oxidative stability, and influencing the juiciness, flavor and color. Neither genotype nor sex influenced TM; however, the Pelibuey breed had a higher concentration of vaccenic acid than the Katahdin breed. Contrary to what was observed in the present work, other studies(36) reported an important effect of the genotype on the concentration of monounsaturated fats, recording values ranging from 30.92 to 32.45 %, which are lower than those observed in the present study. On the other hand, previous studies(41) determined that the concentration of monounsaturated fat in the Longissimus lumborum muscle was not affected by the genotype of the lambs. Similar results were obtained in other studies(42), where the concentration of monounsaturated fats was not affected by the sheep genotypes studied (Churra and Assaf, 39.16 vs 40.67 %, respectively). The greatest differences were detected in six polyunsaturated fatty acids (PUFAs) due to the type of lambing and genotype. Only the type of lambing affected the amount of PUFAsn-3 plus PUFAsTotal, the latter being higher than that recorded by other authors(42). No differences were detected in this type of fatty acids between males and females. Previous studies(40) showed that the effect of breed, weight, and sex influenced PUFAsTotal. In this regard, they pointed out that lean breeds (hair breeds) have a relatively higher proportion of PUFAsTotal than other less lean breeds, and that as the slaughter weight increases, this proportion decreases. This is consistent with the findings of the present study regarding the type of lambing, since this factor determined a difference in slaughter weight, which coincides with what was pointed out by these authors, who indicate that as the slaughter weight increases 9

Rev Mex Cienc Pecu 2022;13(1):1-18

(greater in single-born lambs), the proportion of PUFAsTotal decreases. Thus, the polyunsaturated fatty acids with higher concentrations in double-born lambs were linoleic (C18:2n-6) and arachidonic (C20:4n-6), and those with the lowest concentration were DPA (C22:5n-3) and C20:3n-6. The results regarding the genotype effect are less conclusive because there was no marked difference that affected the concentration of PUFAsTotal; however, the Pelibuey breed had higher concentrations of arachidonic acid and lower concentrations of DPA and DHA than the Katahdin breed; on the other hand, it has been found that the genotype does not affect the total concentration of PUFAsTotal in the Longissimus M. of ewes(41); contrary to what was reported by other authors(42), who did find an effect of the genotype on the concentration of PUFAsTotal in intramuscular tissue of lambs of the Churra (30.75 %) and Assaf breeds (28.96 %). The total concentration of PUFAsn-6 in lamb meat cuts was not affected by genotype, sex or type of lambing, the same trend was observed in the concentration of PUFAsn-3, except that for this type of fatty acids, the total concentration was affected by the type of lambing, observing a higher mean in carcasses of double-born lambs. In contrast to what was found in this research, other authors(42), when analyzing the concentration of omega-6 acids in the intramuscular fat of lambs of the Churra and Assaf breeds, reported a significant effect of the genotype on this type of fatty acids of 26.64 vs 24.29 %, respectively for each breed. When the effect of the genotype, sex and type of birth of the lamb on the concentration of PUFAsn-6 was analyzed, the arachidonic acid (20:4n-6) was affected by the genotype, with a higher proportion observed in lambs of the Pelibuey breed with respect to the Katahdin breed. On the other hand, the concentrations of linoleic (18:2n-6), dihomo-g-linolenic (20:3n-6) and arachidonic acids (20:4n-6) were affected by the type of lambing, with a higher proportion observed when the lambs were from double birth. In the particular concentration of omega6 fatty acids, in a similar way to what was observed in the present work, in previous studies(42), a significant effect of the genotype on the values of 20:4n-6 in intramuscular fat of lambs of the Churra and Assaf breeds (5.57 vs 4.75 %) has been observed, additionally and contrary to what was determined in this study, a higher concentration (P<0.05) of C18:2n6 has been observed(43) in Churra lambs than in Assaf lambs (19.38 vs 17.97 %, respectively). When the effect of the genotype, sex and type of birth of the lamb on the concentration of PUFAsn-3 was analyzed, only the fatty acids C22:5n-3 and C22:6n-3 were affected by the genotype, observing a higher concentration in the Katahdin lambs. Other studies(41,43) showed that rumen biohydrogenation can cause low levels in the lipid profile and the lack of difference in intramuscular fat deposition of animals fed with different energy levels.

Rev Mex Cienc Pecu 2022;13(1):1-18

Conclusions and implications The characteristics of the carcass and the yield of commercial cuts in hair sheep slaughtered at weaning varied according to the genotype and type of lambing, but not due to the sex. The meat yield of the half carcass and of each commercial cut was defined, mainly, by the type of lambing, with minimal changes due to genotype or sex. In general, Pelibuey lambs had higher carcass yield than Katahdin lambs, even though they obtained similar empty live weight and carcass weight; this could be associated with higher rib yield in Pelibuey lambs. According to the type of lambing, the single-born lambs had greater slaughter and carcass weight, as well as higher rib yield, but this was not reflected in a higher carcass yield. The type of lambing was the main factor that modified the fatty acid profile, producing a healthier meat for humans in the double-born lambs, since this meat had a higher proportion of polyunsaturated acids compared to the meat of single-born lambs. Literature cited: 1. González-Garduño R, Salinas-Hernández RM, Garduza-Arias G, Reyes-Montes R. Componentes corporales en ovinos de pelo para abasto en el sureste mexicano. Zootec Trop 2014;32(1):23-32. 2. Aguilar-Hernandez E, Chay-Canul AJ, Gomez-Vazquez A, Magaña-Monforte JG, RíosRincón FG, Cruz-Hernandez A. Relationship of ultrasound measurements and carcass traits in Pelibuey ewes. J Anim Plant Sci 2016;26(2):325-330. 3. Ruiz-Ramos J, Chay-Canul AJ, Ku-Vera JC, Magaña-Monforte JG, Gómez-Vázquez AG, Cruz-Hernandez A, González-Garduño R, Ayala-Burgos AJ. Carcass and non-carcass components of Pelibuey ewe subjected to three levels of metabolizable energy intake. Ecosistemas Rec Agropec 2016;3(7):21-31. 4. Sañudo C. Conferencia calidad de la canal y de la carne en los ovinos: factores que la determinan. Rev Arg Prod Anim 2006;26(2):155-167. 5. García-Osorio IC, Oliva-Hernández J, Hinojosa-Cuéllar JF. Composición tisular de la canal de corderos lactantes Blackbelly x Pelibuey. Ecosistemas Rec Agropec 2016;3(8):203-213. 6. Wood JD, Richardson RI, Nute GR, Fisher AV, Campo MM, Kasapidou E, Sheard PR, Enser M. Effect of fatty acids on meat quality: a review. Meat Sci 2004;66(1):21-32. 7. Juárez D, Horcada I, Alcalde A, Valera C, Mullen M, Molina A. Estimation of factors influencing fatty acid profiles in light lambs. Meat Sci 2007;79(2):203-210.

Rev Mex Cienc Pecu 2022;13(1):1-18

8. Hopkins DL, Stanley DF, Martin LC, Toohey ES, Gilmour AR. Genotype and age effects on sheep meat production 3. Meat quality. Aust J Exp Agric 2007;47(10):1155-1164. 9. Partida JA, Braña D, Martínez L. Desempeño productivo y propiedades de la canal de ovinos Pelibuey y sus cruzas con Suffolk o Dorset. Téc Pecu Méx 2009;47(3):313-322. 10. Macías-Cruz U, Álvarez-Valenzuela FD, Rodríguez-García J, Correa-Calderón A, Torrentera-Olivera NGG, Molina-Ramírez L, Avendaño-Reyes L. Crecimiento y características de canal en corderos Pelibuey puros y cruzados F1 con razas Dorper y Katahdin en confinamiento. Arch Med Vet 2010;42(3):147-154. 11. Guerrero A, Valero MV, Campo MM, Sañudo C. Some factors that affect ruminant meat quality: from the farm to the fork. Review. Acta Sci Anim Sci 2010; 35(4):335–347. https://doi.org/10.4025/actascianimsci.v35i4.21756. 12. Macías-Cruz U, Álvarez-Valenzuela FD, Olguín-Arredondo HD, Molina-Ramírez L, González-Reyna A, Avendaño-Reyes L. Pelibuey ewe productivity and subsequent preweaning performance using hair-sheep breeds under a confinement system. J Appl Anim 2009;36(2):255-260. 13. Magaña-Monforte JG, Huchin-Cab M, Ake-López RJ, Segura-Correa JC. A field study of reproductive performance and productivity of Pelibuey ewes in Southeastern Mexico. Trop Anim Health and Prod 2013;45(8):1771-1776. 14. Sánchez-Dávila F, Bernal-Barragán H, Padilla-Rivas G, del Bosque-González AS, Vázquez-Armijo JF, Ledezma-Torres RA. Environmental factors and ram influence litter size, birth, and weaning weight in Saint Croix hair sheep under semi-arid conditions in Mexico. Trop Anim Health Prod 2015;47(5):825-831 doi: 101007/s11250015-0795-6. 15. Nasrat MM, Segura-Correa JC, Magaña-Monforte JG. Breed genotype effect on ewe traits during the pre-weaning period in hair sheep under the tropical Mexican conditions. Small Ruminant Res 2016;137(1):157-161. 16. Chay-Canul AJ, Aguilar-Urquizo E, Parra-Bracamonte GM, Piñeiro-Vazquez AT, Sanginés-García JR, Magaña-Monforte JG, et al. Ewe and lamb pre-weaning performance of Pelibuey and Katahdin hair sheep breeds under humid tropical conditions. Ital J Anim Sci 2019;18(1):850-857. 17. García-Osorio IC, Oliva-Hernández J, Osorio-Arce MM, Torres-Hernández G, HinojosaCuéllar JF, González-Garduño R. Influencia del tipo y número de parto de la oveja sobre la eficiencia de crecimiento y características de la canal de corderos Blackbelly x Pelibuey. Ecosistemas Rec Agropec 2017;4(10):51-63.

Rev Mex Cienc Pecu 2022;13(1):1-18

18. Chay-Canul AJ, Magaña-Monforte JG, Chizzotti ML, Piñeiro-Vázquez ÁT, Canul-Solís JR, Ayala-Burgos AJ, Ku-Vera JC, et al. Requerimientos energéticos de ovinos de pelo en las regiones tropicales de Latinoamérica. Revisión. Rev Mex Cienc Pecu 2016;7(1):105-125. 19. Hernández-Marín JA, Valencia-Posadas M, Ruíz-Nieto JE, Mireles-Arriaga AI, CortezRomero C, Gallegos-Sánchez J. Contribución de la ovinocultura al sector pecuario en México. Agroproductividad 2017;10(3):87-93. 20. García, E. Modificaciones al sistema de clasificación climática de Köppen (Para adaptarlo a las condiciones de la República Mexicana). Segunda edición. Instituto de Geografía de la Universidad Nacional Autónoma de México. México, D.F. 1973. 21. Russel AJF, Doney JM, Gunn RG. Subjective assessment of body fat in live sheep. J Agric Sci 1969;72(3):451-454. 22. Martínez A, Bores R, Castellanos A. Zoometria y prediccíon de la composición corporal de la borrega Pelibuey. Téc Pecu Méx 1987;25(1):72-84. 23. Cantón JGC, Velázquez AM, Castellanos RA. Body composition of pure and crossbed Blackbelly sheep. Small Ruminant Res 1992;7(1):61-66. 24. Kramer JKG, Cruz-Hernández C, Deng Z, Zhou J, Jahreis G, Dugan ME. Analysis of conjugated linoleic acid and trans 18:1 isomers in synthetic and animal products. Am J Clin Nutr 2004;79(Supl 6):1137-1145. 25. Velasco S, Cañeque V, Pérez C, Lauzurica S, Díaz MT, Huidobro F. Fatty acid composition of adipose depots of suckling lambs raised under different production systems. Meat Sci 2001;59(3):325-333. 26. Moo-Huchin V, Estrada-Mota I, Estrada-León R, Cuevas-Glory L, Sauri-Duch E. Chemical composition of crude oil from the seeds of pumpkin (Cucurbita spp.) and mamey sapota (Pouteria sapota Jacq.) grown in Yucatan, Mexico. CyTA-Journal of Food 2013;11(4):324-327. 27. SAS, Statistical Analysis System. SAS V. 93 SAS Institute Inc, 2010. Cary, NC, USA. 28. Hinojosa-Cuéllar J, Oliva-Hernández J, Torres-Hernandez G, Segura-Correa JC, ArandaIbáñez E, González-Camacho J. Factores que afectan el crecimiento predestete de corderos Pelibuey en el trópico húmedo de México. Universidad y Ciencia 2012;28(2):163-171.

Rev Mex Cienc Pecu 2022;13(1):1-18

29. Oliva-Hernández J, Garcia-Osorio IC, Hinojosa-Cuéllar J. Crecimiento predestete de corderos de pelo en el trópico húmedo de México. In Berumen AC, et al, editores. Avances de la investigación sobre producción de ovinos de pelo en México 2017:45-57. https://www.researchgate.net/publication/321307604_Avances_de_la_investigacion_s obre_produccion_de_ovinos_de_pelo_en_Mexico. 30. Macedo R, Arredondo V. Efecto del sexo y del tipo de nacimiento y lactancia sobre el crecimiento de ovinos Pelibuey en manejo intensivo. Arch Zootec 2008;57(218):219228. 31. Ríos-Utrera A, Calderón-Robles R, Lagunes-Lagunes J, Oliva-Hernández J. Ganancia de peso predestete en corderos Pelibuey y sus cruces con Blackbelly, Dorper y Katahdin. Nova Scientia 2014;6(2):272-286. 32. Bell AW, Bauman DE, Currie WB. Regulation of nutrient partitioning and metabolism during pre and postnatal growth. J Anim Sci 1987;65(Supl 2):186-212. 33. Barros NN, Vasconcelos VR, Wanderi AE, Araújo MRA. Eficiência bioeconômica de cordeiros F1 Dorper x Santa Inês para produção de carne. Pesqui Agropecu Bras 2005; 40(8):825-831. 34. Silva FLR, Araújo AM. Características de reprodução e de crescimento de ovinos mestiços Santa Inês, no Ceará. Rev Bras Zootec 2010;29:1712-1720. 35. Carneiro RM, Pires CC, Müller L, Kippert CJ, Costa ML, Colomé LM, Osmari EK. Ganho de peso e eficiência alimentar de cordeiros de parto simples e duplo desmamados aos 63 dias e não desmamados. Rev Bras Agrocienc 2004 10:227-230. 36. Horcada A, Campo MM, Polvillo O, Alcalde MJ, Cilla I, Sañudo C. A comparative study of fatty acid profiles of fat in commercial Spanish suckling kids and lambs. Span J Agric Res 2014;12(2):427-435 doi.org/10.5424/sjar/2014122-4566. 37. Camacho Á, Capote J, Mata J, Argüello A, Viera JJ, Bermejo LA. Effect of breed (wool and hair) and sex on the carcass quality of suckling lambs under intensive management. Rev Bras Zootec (2013);42(12):892-898. 38 Johnson PL, McEwan JC, Dodds KG, Purchas RW, Blair HT. Meat quality traits were unaffected by a quantitative trait locus affecting leg composition traits in Texel sheep. J Anim Sci 2005;83(12):2729-2747. 39. Esteves GIF, Peripolli V, Costa Jr JBG, Tanure BC, Menezes MA, Souza RJ, et al. Effects of genetic group, pregnancy and age on carcass traits, meat quality 25 and fatty acid profile in female sheep. Rev Colom Cienc Pecu 2019;32(1):21-33.

Rev Mex Cienc Pecu 2022;13(1):1-18

40. Camacho A, Torres A, Capote J, Mata J, Viera J, Bermejo LA, Argüello A. Meat quality of lambs (hair and wool) slaughtered at different live weights. J Appl Anim Res 2017;45(1):400-408. 41. Coutinho MAS, Morais MG, Coelho RG, Alves FV, Fernandes HJ, Ítavo CCBF, Comparin MAS, Ribeiro CB. Lipid profile and cholesterol in meat cuts of ewe lambs fed different levels of concentrate. Semina: Ciénc Agrár 2014;35(6):3355-3366. 42. Mateo J, Caro I, Carballo DE, Gutiérrez-Méndez N, Arranz JJ, Gutiérrez-Gil B. Carcass and meat quality characteristics of Churra and Assaf suckling lambs. Animal 2017;12(5):1093-1101. 43. Sañudo C, Arribas MMC, Silva-Sobrinho AG. Qualidade da carcaça e da carne ovina e seus fatores determinantes. In: Silva Sobrinho, AG, et al. Produção de carne ovina. Jaboticabal: Funep, 2008;171-228.

Rev Mex Cienc Pecu 2022;13(1):1-18

Table 1: Slaughter weight, carcass characteristics and yield of primal cuts (means ± SE) due to the effects of genotype, type of lambing and sex in 56-day-old lactating lambs Character istics Pelibuey LWS, kg 10.73 ± 0.35 ELW, kg 9.63 ± 0.32 HCW, kg 5.43 ± 0.19 CCW, kg 5.17 ± 0.18 HCY, % 50.58 ± 0.52 CCY, % 48.03 ± 0.78 TY, % 56.38 ± 0.49 Commercial cuts (%) Neck 7.01 ± 0.22 Shoulder 18.97 ± 0.27 Ribs 24.90 ± 0.40 Loin 12.98 ± 0.32 Leg 35.90 ± 0.38

Breed Katahdin 11.11 ± 0.42 9.91 ± 0.38 5.22 ± 0.22 4.96 ± 0.21 46.76 ± 0.61 44.62 ± 0.93 52.38 ± 0.58 8.84 ± 0.27 19.34 ± 0.33 22.46 ± 0.48 12.69 ± 0.38 36.98 ± 0.45

P 0.49 0.57 0.46 0.44 <0.01 <0.01 <0.01

Type of lambing Single Double 12.39 ± 0.40 9.45 ± 0.37 11.15 ± 0.36 8.40 ± 0.33 6.12 ± 0.21 4.53 ± 0.20 5.85 ± 0.20 4.27 ± 0.19 49.37 ± 0.59 47.96 ± 0.54 47.20 ± 0.89 45.44 ± 0.83 54.88 ± 0.56 53.87 ± 0.52

P <0.01 <0.01 <0.01 <0.01 0.08 0.15 0.19

<0.01 0.40 <0.01 0.57 0.08

7.80 ± 0.25 18.48 ± 0.31 24.80 ± 0.46 13.25 ± 0.37 35.65 ± 0.43

0.47 <0.01 <0.01 0.11 0.01

8.06 ± 0.23 19.83 ± 0.29 22.57 ± 0.42 12.43 ± 0.34 37.22 ± 0.40

Males 11.02 ± 0.37 9.82 ± 0.33 5.29 ± 0.19 5.10 ± 0.19 48.17 ± 0.54 46.52 ± 0.81 53.97 ± 0.51

Sex Females 10.82 ± 0.41 9.72 ± 0.36 5.36 ± 0.21 5.03 ± 0.21 49.16 ± 0.60 46.12 ± 0.90 54.79 ± 0.56

P 0.73 0.83 0.83 0.79 0.22 0.74 0.29

8.09 ± 0.23 19.45 ± 0.29 23.51 ± 0.42 12.39 ± 0.33 36.47 ± 0.39

7.77 ± 0.26 18.87 ± 0.32 23.86 ± 0.46 13.29 ± 0.37 36.41 ± 0.44

0.37 0.19 0.58 0.08 0.91

LWS= live weight at slaughter, ELW= empty live weight, HCW= hot carcass weight, CCW= cold carcass weight, HCY= hot carcass yield, CCY= cold carcass yield, TY= true yield.

16 1

Rev Mex Cienc Pecu 2022;13(1):1-18

Table 2: Meat yields of carcass and primal cuts (means ± SE) due to the effects of genotype, type of lambing and sex in 56-dayold lactating lambs Breed Type of lambing Sex Variable (%) Pelibuey Katahdin P Single Double P Males Females P Half carcass Soft tissues Bone Neck Soft tissues Bone Shoulder Soft tissues Bone Ribs Soft tissues Bone Loin Soft tissues Bone Leg Soft tissues Bone

69.99 ± 0.65 69.99 ± 0.78 0.99 29.75 ± 0.55 29.65 ± 0.65 0.91

72.51 ± 0.75 67.97 ± 0.69 <0.01 27.81 ± 0.62 32.00 ± 0.57 <0.01

69.19 ± 0.68 70.79 ± 0.75 0.12 30.20 ± 0.57 29.20 ± 0.63 0.24

62.90 ± 1.50 66.40 ± 1.79 0.14 36.07 ± 5.89 43.21 ± 7.02 0.44

65.37 ± 1.71 63.33 ± 1.58 0.26 34.65 ± 6.73 36.62 ± 6.22 0.38

65.77 ± 1.56 63.52 ± 1.73 0.34 34.35 ± 6.13 35.93 ± 6.80 0.37

69.46 ± 1.34 67.82 ± 1.60 0.11 30.53 ± 0.62 32.26 ± 0.74 0.74

69.77 ± 1.53 69.30 ± 1.42 0.82 30.14 ± 0.71 30.65 ± 0.66 0.07

67.54 ± 1.40 71.43 ± 1.55 0.06 32.59 ± 0.65 28.60 ± 0.72 0.11

64.85 ± 0.94 65.82 ± 1.12 0.55 34.88 ± 0.94 33.88 ± 1.12 0.50

68.44 ± 1.07 62.33 ± 0.99 <0.01 31.56 ± 1.07 37.68 ± 0.99 <0.01

63.70 ± 0.98 66.90 ± 1.08 0.04 36.83 ± 0.97 32.94 ± 1.08 0.04

75.98 ± 1.20 77.90 ± 1.43 0.31 23.87 ± 1.27 21.69 ± 1.52 0.28

80.56 ± 1.37 73.30 ± 1.27 <0.01 19.45 ± 1.45 26.71 ± 1.34 <0.01

76.06 ± 1.25 77.62 ± 1.39 0.35 24.02 ± 1.33 22.54 ± 1.47 0.22

71.68 ± 0.87 71.16 ± 1.04 0.70 27.75 ± 1.04 28.27 ± 1.24 0.75

73.92 ± 1.00 68.93 ± 0.92 <0.01 25.97 ± 1.19 30.95 ± 1.10 <0.01

72.26 ± 0.91 70.99 ± 1.01 0.22 27.74 ± 1.09 28.98 ± 1.21 0.48

1 17

Rev Mex Cienc Pecu 2022;13(1):1-18

Table 3: Fatty acid profile of meat of hair lambs (means ± SE) due to the effects of genotype, type of lambing and sex in 56-dayold lactating lambs Genotype (G) Type Sex(s) Fatty acid Pelibuey Katahdin P Single Double P Males Females P 10:00 12:00 14:00 15:00 16:00 18:00 20:00 16:1n-9 16:1n-7 18:1n-9 18:1n-7 18:2n-6 20:2n-6 20:3n-6 20:4n-6 16:4n-3 22:5n-3 22:6n-3 TS TM PUFAsn-6 PUFAsn-3 PUFAsTotal

0.07 ± 0.02 0.42 ± 0.09 3.13 ± 0.66 0.383 ± 0.03 21.15 ± 1.0 14.03 ± 1.08 0.26 ± 0.06 0.40 ± 0.07 1.05 ± 0.19 33.90 ± 1.03 2.14 ± 0.09 10.24 ± 0.81 1.44 ± 0.18 0.52 ± 0.05 7.79 ± 0.54 2.06 ± 0.18 0.79 ± 0.10 0.19 ± 0.04 39.46 ± 1.61 37.50 ± 1.10 20.00 ± 1.46 3.04 ± 0.29 23.04 ± 1.73

0.09 ± 0.01 0.50 ± 0.09 3.79 ± 0.63 0.37 ± 0.03 22.09 ± 0.95 16.65 ± 1.02 0.27 ± 0.06 0.33 ± 0.06 1.01 ± 0.18 32.63 ± 0.97 1.64 ± 0.09 9.20 ± 0.76 1.57 ± 0.17 0.56 ± 0.04 5.74 ± 0.51 2.09 ± 0.17 1.10 ± 0.09 0.32 ± 0.03 43.78 ± 1.52 35.62 ± 1.04 17.08 ± 1.38 3.52 ± 0.27 20.60 ± 1.64

0.39 0.58 0.47 0.84 0.51 0.11 0.94 0.48 0.88 0.38 <0.01 0.36 0.62 0.52 0.02 0.91 0.04 0.02 0.07 0.23 0.17 0.25 0.32

0.09 ± 0.02 0.39 ± 0.10 3.40 ± 0.69 0.37 ± 0.04 23.11 ± 1.05 14.60 ± 1.13 0.19 ± 0.06 0.39 ± 0.07 1.23 ± 0.20 35.67 ± 1.07 1.73 ± 0.10 8.55 ± 0.84 1.30 ± 0.19 0.47 ± 0.05 5.71 ± 0.57 1.82 ± 0.19 0.75 ± 0.10 0.22 ± 0.04 42.14 ± 1.68 39.02 ± 1.15 16.03 ± 1.52 2.79 ± 0.30 18.83 ± 1.81

0.07 ± 0.01 0.54 ± 0.09 3.52 ± 0.59 0.39 ± 0.03 20.14 ± 0.90 16.08 ± 0.97 0.35 ± 0.05 0.34 ± 0.06 0.83 ± 0.17 30.86 ± 0.92 2.05 ± 0.08 10.90 ± 0.72 1.71 ± 0.16 0.62 ± 0.04 7.82 ± 0.49 2.34 ± 0.16 1.14 ± 0.09 0.28 ± 0.03 41.10 ± 1.44 34.09 ± 0.98 21.04 ± 1.30 3.77 ± 0.26 24.81 ± 1.55

0.49 0.27 0.90 0.65 0.05 0.34 0.08 0.62 0.16 <0.01 0.03 0.05 0.13 0.03 0.01 0.05 0.01 0.26 0.64 <0.01 0.17 0.03 0.02

0.09 ± 0.02 0.51 ± 0.09 3.58 ± 0.66 0.38 ± 0.03 20.74 ± 1.0 16.87 ± 1.10 0.22 ± 0.06 0.41 ± 0.07 1.03 ± 0.19 32.57 ± 1.03 1.84 ± 0.09 9.41 ± 0.81 1.66 ± 0.18 0.53 ± 0.05 6.63 ± 0.54 2.32 ± 0.18 0.95 ± 0.10 0.25 ± 0.04 42.39 ± 1.61 35.85 ± 1.10 18.23 ± 1.46 3.53 ± 0.29 21.75 ± 1.73

0.07 ± 0.02 0.42 ± 0.09 3.34 ± 0.62 0.37 ± 0.03 22.50 ± 0.95 13.82 ± 1.02 0.32 ± 0.06 0.33 ± 0.06 1.03 ± 0.18 33.96 ± 0.97 1.94 ± 0.09 10.04 ± 0.76 1.35 ± 0.17 0.55 ± 0.04 6.90 ± 0.51 1.83 ± 0.17 0.94 ± 0.09 0.25 ± 0.03 40.85 ± 1.52 37.26 ± 1.04 18.85 ± 1.38 3.04 ± 0.27 21.89 ± 1.64

0.46 0.51 0.80 0.84 0.22 0.06 0.23 0.38 0.97 0.34 0.46 0.58 0.25 0.78 0.72 0.07 0.98 0.98 0.50 0.37 0.76 0.24 0.96

Fatty acids are shown as a percentage (%) of total fatty acids. Only fatty acids found in levels above 0.05 % are shown. TS= total saturated; TM= total monounsaturated; PUFAsn-6= n-6 polyunsaturated fatty; PUFAsn-3: n-3 polyunsaturated fatty acids; PUFAsTotal= total polyunsaturated fatty acids.

2 18

https://doi.org/10.22319/rmcp.v13i1.5849 Article

Performance of lambs fed total feed silage based on cactus pear

Juscelino Kubitschek Bevenuto da Silva a Gherman Garcia Leal de Araújo b Edson Mauro Santos a Juliana Silva de Oliveira a Fleming Sena Campos b Glayciane Costa Gois c* Tiago Santos Silva d Alex Gomes da Silva Matias c Ossival Lolato Ribeiro e Alexandre Fernandes Perazzo f Anderson de Moura Zanine f

Universidade Federal da Paraiba (UFPB), Centro de Ciências Agrárias, Paraiba, Brazil.

Empresa Brasileira de Pesquisa Agropecuária (Embrapa Semiárido), Rodovia BR-428, Km 152, s/n – Zona Rural, 56302-970, Pernambuco, Brazil. c

Universidade Federal do Vale do São Francisco (UNIVASF), Campus de Ciências Agrárias, Pernambuco, Brazil. d

Instituto Federal de Educação, Ciência e Tecnologia do Sertão Pernambucano (IF Sertão), Pernambuco, Brazil. e

Universidade Federal do Recôncavo Bahiano (UFRB), Ciências Agrárias, Ambientais e Biológicas, Bahia, Brazil. f

Universidade Federal do Maranhão (UFMA), Centro de Ciências Agrárias e Ambientais, Maranhão, Brazil.

*Corresponding author: glayciane_gois@yahoo.com.br

Rev Mex Cienc Pecu 2022;13(1):19-31

Abstract: This study aimed was to evaluate the intake, apparent digestibility, water balance, nitrogen balance, and productive performance in lamb fed cactus pear silage associated with tropical forages. Forty male intact crossbred lambs, with an initial body weight of 18.85 ± 1.2 kg, were used in the experiment. The experimental design was completely randomized, with 5 treatments and 8 replications. The treatments consisted of diets with different proportions of buffelgrass and wheat bran as sources of neutral detergent fiber (NDF), in total feed silage (TFS) based on cactus pear: TFS1 - 279 g/kg of buffelgrass; TFS2 - 240 g/kg of buffelgrass and 17 g/kg of wheat bran; TFS3 - 198 g/kg of buffelgrass and 34 g/kg of wheat bran; TFS4 - 108 g/kg of buffelgrass and 74 g/kg of wheat bran; TFS5 – 118 g/kg of wheat bran. The lowest NDF intake was found in lambs that consumed TFS5 (402 g/d). The non-fibrous carbohydrates apparent digestibility was higher for TFS5, while the NDF apparent digestibility of TFS5 and TFS4 was higher than TFS1. Diets promoted an average daily weight gain of 180.8 g/d. Under experimental conditions, the use of forage cactus pear and concentrate in the form of total mixed rations silage leads to greater intake of crude protein, non-fibrous carbohydrates, ether extract and greater digestibility of non-fibrous carbohydrates and neutral detergent fiber, however, all diets were viable in the feed of confined sheep, providing gains of up to 198 g/d according with the formulation of the diet. Key words: Intake, Food conservation, Water balance, Weight gain.

Received: 13/11/2020 Accepted: 13/04/2021

Introduction Cactus pear (Opuntia fícus-indica Mill.) is a crop with great potential for the arid and semi-arid regions, since it is a crop that has a special physiological aspect regarding the absorption, use and loss of water, being well adapted to the soil and climatic conditions of the semi-arid, supporting long periods of drought, cactus pear is characterized as being the main food supplied to the herds, regardless of the time of year(1). Cactus pear is a forage species with a high potential for dry matter production (10-20 t/ha) per year in dry conditions. It has excellent palatability, high energy value (66– 74 % total digestible nutrients), high digestibility (69–78 %), and is rich in water (80 % natural matter)(2), contributing to the supply of quality water for the animal. The use of cactus pear silages in small ruminant diets is already being studied in Tunisia, Mexico, Zimbabwe and Brazil(3). Miranda-Romero et al(4) observed that finishing lamb fed with 20

Rev Mex Cienc Pecu 2022;13(1):19-31

cactus pear silage had higher dry matter intake (1.1 kg/d compared to lamb fed corn silage (0.7 kg/d). Moura et al(5) when evaluating the inclusion of cactus pear in the diet of lambs observed that cactus pear increase in the composition of the diets promoted greater daily gain in relation to the control diet (without cactus pear). Silva et al(6) when evaluating the water intake of lamb fed diets based on cactus pear silages found that lambs that ingested cactus pear silage had higher dry matter intake (1,480 kg/d) and higher water intake via food (2,724 kg/d) in relation to animals that received corn silage. Nevertheless, cactus pear use in small ruminants' diet must be associated with complementation of other high-fiber in roughage and by addition of a protein source, maintaining normal conditions in the rumen and allowing an adequate synchronization between the supply of energy and nitrogen for ruminal microorganisms, considering the high content of soluble carbohydrates in cactus pear(7). Buffelgrass (Cenchrus ciliares) might be used as a source of fiber for forage-based diets (368 g/kg NDF), as it is a grass also adapted to arid and semiarid regions(8). Another option to compose diets based on cactus pear for the production of total feed silage is the use of co-products with a high amount of neutral detergent fiber, as is the case of wheat bran, which has value average of 394 g/kg NDF(9). In situations where the fodder supply is limited, due to the common water deficit in arid and semiarid regions, the use of this co-product could economically make it possible to confine lambs fed on cactus pear feed because of its low cost. Therefore, it can be used as a fiber source in forage grasses substitution. As far as known, studies on the association of cactus pear silage with wheat bran and buffel grass hay in the diet of confined lambs are scarce and should be better explored. Thus, the present study aimed was to evaluate the intake, apparent digestibility, water balance, nitrogen balance, and productive performance in lamb fed cactus pear silage associated with tropical forages.

Material and methods Description of the study site

The experiment was carried out on the Experimental Caatinga Field, at the Animal Metabolism Unit, belonging to the Brazilian Agricultural Research Corporation, Embrapa Semiarid, located in the municipality of Petrolina - PE, Brazil. Annual rainfall average is 433 mm, relative humidity of 36.73 %, and mean annual temperatures, maximum and minimum, are around 32 to 26.95 ºC. This research was evaluated and approved by the Ethics Committee on Animal Use (CEUA) of the Embrapa Semiarid, with protocol number 0004/2016.

Rev Mex Cienc Pecu 2022;13(1):19-31

Animals, treatments and experimental diets

Forty (40) male intact crossbred lambs, with an initial body weight of 18.85 ± 1.2 kg, were used in the experiment. The animals were previously identified, weighed, treated against endo- and ectoparasites and distributed in individual pens (1.00 × 1.20 m), equipped with feeding and drinking troughs for the diets and water supply, where they remained for 66 d, preceded by 10 d for adaptation. The experimental design was completely randomized, with five treatments and eight replications. The diets were formulated in the form of total feed silage, composed of cactus pear (Opuntia fícus-indica Mill.) variety Redonda, buffelgrass (Cenchrus ciliares), wheat bran, soybean meal, ground corn and urea (Table 1). The treatments consisted of diets with different proportions of buffelgrass and wheat bran as sources of neutral detergent fiber (NDF), in total feed silage (TFS) based on cactus pear: TFS1 - 279 g/kg of buffelgrass; TFS2 - 240 g/kg of buffelgrass and 17 g/kg of wheat bran; TFS3 - 198 g/kg of buffelgrass and 34 g/kg of wheat bran; TFS4 - 108 g/kg of buffelgrass and 74 g/kg of wheat bran; TFS5 – 118 g/kg of wheat bran on a dry matter (DM) basis. The diets were balanced as to allow an average weight gain of 200 g/day, according to the recommendations of the NRC(10) (Table 2). Table 1: Chemical composition of the ingredients used in experimental diets Ingredients Fraction Cactus Buffel Wheat Soybean Ground Urea (g/kg DM) pear grass bran meal corn Dry matter* 144 623 886 896 892 980 Mineral matter 112 101 52.3 66.5 19.2 1.7 Crude protein 51.2 60.2 169 472 90.3 2822 Ether extract 19.0 17.4 32.1 21.1 51.2 0 a Neutral detergent fiber 269 683 433 133 133 0 Acid detergent fiber 193 479 153 92.3 44.5 0 Lignin 63.7 201 60.8 12.8 11.1 0 Cellulose 337 327 111 80.9 37.6 0 Hemicellulose 192 123 339 55.5 97.8 0 Total carbohydrates 837 834 717 442 845 0 Non-fiber carbohydrates 552 86.9 302 282 715 0 DM= Dry matter; *in g/kg Natural matter; a= corrected for ash and protein.

Rev Mex Cienc Pecu 2022;13(1):19-31

Table 2: Chemical composition of the experimental diets Experimental diets Ingredients (g/kg) TFS1 TFS2 TFS3 Cactus pear 553 571 590 Buffelgrass 279 240 198 Wheat bran 0 17 34 Soybean meal 48 50 51 Ground corn 116 119 124 Urea 4 3 3 Chemical composition (g/kg DM): Dry matter* 383 399 411 Mineral matter 70.5 88.1 82.8 Crude protein 134 136 142 Ether extract 11.6 18.6 20.4 NDFap 511 435 433 Acid detergent fiber 392 268 255 Lignin 63.9 43.1 40.7 Cellulose 328 225 214 Hemicellulose 136 215 209 Total carbohydrates 784 757 755 Non-fiber carbohydrates 318 356 356 Metabolizable energy, Kcal/d 23.1 24.1 24.5

TFS4 633 108 74 51 132 2

TFS5 681 0 118 53 147 1

431 79.4 141 22.7 439 215 40.2 175 232 757 340 24.3

449 71.1 139 25.7 338 141 29.3 111 280 764 438 25.5

TFS1= 279 g/kg of buffelgrass; TFS2= 240 g/kg of buffelgrass and 17 g/kg of wheat bran; TFS3= 198 g/kg of buffelgrass and 34 g/kg of wheat bran; TFS4= 108 g/kg of buffelgrass and 74 g/kg of wheat bran; TFS5= 118 g/kg of wheat bran; NM= Natural matter; DM= Dry matter; NDFap= Neutral detergent fiber corrected for ash and protein *in g/kg natural matter.

Buffelgrass used came from an established pasture, harvested at 65 d old, with 75 cm in high, cut at a height of 15 cm above the ground level. The harvest was performed manually. The cactus pear harvested at 12 mo’ age after the uniform cut. The materials were processed in a stationary forage (PP-35, Pinheiro máquinas, Itapira, São Paulo, Brazil) chopper to an average particle size of approximately 2.0 cm. The materials were homogenized, according to the treatments, and were ensiled in 200 L plastic-drum silos (89 x 59 x 59 cm) with a removable lid sealed with a metal ring. Diets were supplied twice a day at 0830 h and 1530 h and water was provided ad libitum. The leftovers were collected and weighed to determine intake and adjust the dry matter intake in order to allow 10% leftovers of the total offered. Samples of the food supplied and leftovers were collected weekly for further laboratory analysis.

Rev Mex Cienc Pecu 2022;13(1):19-31

Intake and digestibility of nutrients

The dry matter intake (DMI) was obtained by the difference between the total DM of the diet consumed and the total DM present in the leftovers of each animal. The nutrient intake was determined as the difference between the total nutrients present in the diet consumed and the total nutrients present in the leftovers, on a total DM basis. The digestibility test was performed in the final third of the performance productive period, with a duration of 5 d of collection preceded by 5 d of adaptation. The animals were distributed in metabolism cages provided with feeders and drinking fountains. Feces were sampled using collection bags fixed to the animals, which were attached to the animals before the sampling period. The bags were weighed and emptied twice daily (0800 h and 1500 h) and a sub-sample of 10 % of the total amount was collected for further analysis, which was stored at -20 °C.

Nitrogen balance

Urine was collected and weighed once daily in plastic buckets containing 100 mL 20% sulfuric acid (H2SO4) to avoid nitrogen volatilization and sampled (10% total excreted) to determine the nitrogen content. The nitrogen balance (NB) was calculated according to Silva and Leão(11).

Water balance

Water intake was evaluated daily. Water was weighed before being supplied in buckets and weighed again 24-h later. Three buckets containing water were distributed in the shed near the animal cages to determine daily evaporation. Water balance was evaluated according to Church(12). The production of metabolic water was estimated from the chemical analysis of the diets and calculated by multiplying the consumption of carbohydrates, protein and digestible ether extract by the factors 0.60; 0.42 and 1.10, respectively(12).

Growth performance

The lambs were weighed at the beginning, every 15 d, and the end of the experimental period, after a solid-feed deprivation period of 12-h (with access to water) to obtain the

Rev Mex Cienc Pecu 2022;13(1):19-31

initial weight (IW), final weight (FW), total weight gain (TWG; TWG= final weight initial weight), and daily weight gain (DWG; DWG= TWG/days in confinement). At the end of the experimental period, feed conversion (FC) was calculated by the following equation: FC = average DMI/ average DWG.

Laboratory analysis

Samples of diets, leftovers, and feces were pre-dried in a forced ventilation oven at 55 °C for 72-h and ground to 1 mm particles (Wiley Mill, Marconi, MA-580, Piracicaba, Brazil). All chemical analyses were performed using the procedures described by the AOAC(13) method for dry matter (DM, method 967.03), mineral matter (MM, method 942.05), crude protein (CP, method 981.10), ether extract (EE; method 920.29) and acid detergent fiber (ADF; Method 973.18). The neutral detergent fiber content corrected for ash and protein (using thermostable alpha-amylase) (NDFap)(14). Lignin (LIG) was determined by treating the acid detergent fiber residue with 72 % sulfuric acid(15). Hemicellulose (HEM) was calculated by the following equation: HEM = NDF - ADF. Total carbohydrates (TC), we used the equation(16): TC= 100 - (%CP +%EE +%Ash). The non-fiber carbohydrate (NFC) content were calculated as proposed by Hall(17) for diets containing urea, due to its presence in the diet supplied: NFC= 100 - [(CP- (%urea CP + %urea)) + % NDFap + %EE + %ash]. The apparent digestibility coefficient (ADC) of nutrients was calculated as described by Silva and Leão(11). Total digestible nutrients (TDN) were estimated based on the data of apparent digestibility and calculated according to Weiss et al(18). TDN of diets were converted into digestible (DE) and metabolizable energy (ME) using the equations described by the National Research Council(19).

Statistical analysis

Statistical analyses were run using the Statistical Analysis System version (SAS University) software, using the GLM, with a significance level of 5%, according to Tukey’s test.

Rev Mex Cienc Pecu 2022;13(1):19-31

Results The diets resulted in differences for intakes of CP (P=0.012), with lower mean values for TFS1, with lower percentage of cactus pear silage in its composition, not differing from TFS2, TFS3 and TFS4 diets (Table 3). The lowest NFC intake was shown by the animals that received the TFS1 diet, not differing from the TFS2 diet (P=0.006). The TFS1 diet also provided the animals lower EE intake compared to other diets tested (P=0.023). Higher intakes of OM, EE and ME were observed for TFS5; this same diet promoted a lower intake of NDF (P<0.05). Table 3: Intake, digestibility of dry matter and nutrients and productive performance of lambs fed total feed silage containing cactus pear Experimental diets P Variables TFS1 TFS2 TFS3 TFS4 TFS5 SEM value Intake (g/d): Dry matter Dry matter, %BW Organic matter Crude protein Non-fiber carbohydrates Ether extract Neutral detergent fiber Metabolizable energy, Kcal/ d Digestibility (g/kg): Dry matter Crude protein Non-fiber carbohydrates Organic matter Ether extract Neutral detergent fiber Productive performance (kg): Initial weight Final weight Total weight gain Daily weight gain, g/d Feed conversion abc

958 30.2 867b 128b 305c 11.1d 490a 2.22b

950 30.2 891b 129ab 339bc 17.6c 463a 2.29b

1071 33.0 982b 150ab 382b 21.8bc 449ab 2.55ab

1047 33. 2 984b 147ab 357b 23.8b 414bc 2.62ab

1189 33.4 1005a 165a 521a 30.6a 402c 3.04a

0.06 0.06 37.3 4.37 17.8 0.15 25.8 71.9

0.067 0.089 0.016 0.012 0.006 0.023 0.019 0.028

692 818 758c 869 771 522ab

643 832 780c 846 842 542ab

690 833 796bc 853 849 535ab

642 817 830ab 866 860 578a

697 788 853a 846 874 580a

13.6 13.8 37.5 27.4 27.9 35.3

0.414 0.170 0.001 0.131 0.072 0.001

20.8 31.8 11.0 183 5.23

21.5 31.6 10.1 168 5.97

21.9 31.7 10.9 169 6.63

19.9 31.1 11.2 186 6.43

22.1 34.0 11.9 198 6.16

0.27 0.36 0.19 0.02 0.36

0.295 0.551 0.598 0.596 0.613

SEM= Standard error of the mean; Means followed by different letters differ statistically by the Tukey test at the level of 5% probability.

The ADC of NFC (P=0.001) was lower in TFS1, increasing gradually with increasing level of cactus pear silage in the diets (Table 3). TFS4 and TFS5 diets had higher ADC of NDF compared to TFS1 (P=0.001). The ADC of DM, CP, OM and EE showed no

Rev Mex Cienc Pecu 2022;13(1):19-31

differences between the TFS performance (P>0.05). No differences were detected for the variables of productive performance (P>0.05). TFS did not have a significant effect on consumption, excretion and water balance (P>0.05; Table 4). TFS1 presented lower mean values for contents of nitrogen intake (P=0.027), nitrogen excreted via feces (P=0.001) and nitrogen excreted via urine (P=0.003). There was no effect of the diets for absorbed nitrogen, retained nitrogen and nitrogen balance (P>0.05). Table 4: Water balance and nitrogen balance of lambs fed total feed silage containing cactus pear Experimental diets P Variables TFS1 TFS2 TFS3 TFS4 TFS5 SEM Value Water balance (L/d): Water intake via drinking fountain Water intake via feed Metabolic water Total water intake Water excreted via feces Water excreted via urine Total water excretion Retained water Water balance, % Nitrogen balance (g/d): Nitrogen intake Nitrogen feces Nitrogen urine Absorbed nitrogen Retained nitrogen Nitrogen balance, % ab

2.37

2.05

2.12

2.03

2.32

0.38

0.058

1.52 0.50 4.0 0.55 1.03 1.58 2.09 39.1

1.42 0.53 3.48 0.51 0.88 1.29 1.82 37.2

1.53 0.53 3.44 0.62 0.93 1.36 1.89 39.0

1.38 0.61 3.41 0.61 0.89 1.50 2.12 43.6

1.19 0.61 3.51 0.45 1.07 1.63 2.24 46.8

0.06 0.04 0.12 0.03 0.08 0.42 0.33 3.19

0.055 0.115 0.149 0.447 0.348 0.358 0.219 0.224

20.5b 2.50c 2.48b 18.0 15.5 75.3

20.7ab 2.68bc 3.20a 18.0 14.8 71.1

24.0ab 2.66bc 3.19a 21.4 18.1 74.1

23.6ab 2.92b 3.16a 20.6 17.2 72.9

26.4a 3.38a 3.22a 23.0 18.7 74.0

2.78 0.30 0.36 1.60 1.85 3.69

0.027 0.001 0.003 0.068 0.214 0.549

SEM= Standard error of the mean. Means followed by different letters differ statistically by the Tukey test at the level of 5% probability.

Discussion Dry matter intake of total feed silages showed higher values than those recommended by the NRC(10), which suggests the intake of 820g/animal/d. Thus, it is evident that there were no limitations on the DMI (Table 3), which indicates that the silages in study presented desirable fermentation and high acceptability by animals, therefore, neither the filling effect nor a limiting effect on energy demand was noticed. Following the

Rev Mex Cienc Pecu 2022;13(1):19-31

same trend, it was verified that the values in %BW are suitable for sheep, which must present DMI of 3 to 5 % according to the NRC(10). Dry matter intake is an important factor in the performance of feedlot sheep, being considered the determining point of the supply of nutrients necessary to meet the requirements of maintenance and weight gain of the animals(20). Although the diets had similar DMI, the animals did not achieve the expected daily gain of 200 g, obtaining a ADG of 180.8 g/d. Crude protein intake by lambs fed with total feed silages were above that recommended by the NRC(10). In relation to ME, lambs fed with TFS3, TFS4 and TFS5 presented consumption above 2390 kcal/d recommended by the NRC(10), for animals in this category (Table 3). The increase in EE and NFC intakes can be explained by the increase in the contents of such nutrients in the diets, associated with a similar DMI among lamb. According to the NRC(10), adequate levels of energy intake for young sheep are necessary to develop for the animals and fulfill their potential, and the maintenance requirement of these lambs is achieved with lower intake when compared to lambs with greater weight and when seeking greater gains, for this it is essential to balance the feed and not only to meet the quality but also the quantity of the nutrients offered to the animals(20). Thus, all diets allowed the maximization of consumption by animals, which were not affected by physical limitation due to excess fiber or high concentration of energy. Furthermore, the higher MEI observed for animals that consumed TFS5 should be elucidated by the increase in NFC levels, reduction in NDF and ADF levels that occurred proportionally to the increase in the addition of cactus pear and wheat bran in the production of total feed silage. All silages presented NDF concentration above 25 % and NFC below 44 % in dry matter, as recommended by NRC(19). However, TFS4 and TFS5 showed lower NDF values from buffelgrass, as well as TFS5, which had a lower ADF value (Table 2). The higher digestibility coefficient of non-fibrous carbohydrates and NDF observed for TFS5 and TFS4, is probably due to the higher proportion of cactus pear and wheat bran in diets. Cactus pear and wheat bran have a lower concentration of lignin than buffelgrass (Table 1), favoring the digestibility of these diets. According to Raffrenato et al(21), lignin has less digestibility on the cell-wall of grasses than on grains because lignin is an important barrier for ruminal bacteria to move into the plant cell, reducing the cell-wall digestion of grasses. This effect may explain the fact that TFS1 is less digestible, since the NDF of this silage had higher proportions of buffelgrass, while the NDF of TFS5 had higher proportions of wheat bran (Table 3). The animals obtained an average consumption of 2.178 liters of water/d, higher than that recommended by the NRC(10), which suggests 0.800 L of water/d for lamb. About 37.7 % of the total water intake came from the diets supplied, demonstrating the

Rev Mex Cienc Pecu 2022;13(1):19-31

importance of forage preservation as silage form, aiming at an increase in water supply for animals raised in regions with high water deficits. As TFS4 and TFS5 showed higher amounts of wheat bran (Table 1), they also showed higher levels of non-degradable protein in the rumen that provided greater losses of N fecal than TFS1 (Table 4). The positive nitrogen balance indicates that the animals did not need to displace body protein reserves to meet their nutritional requirements and that the diet was sufficient to increase nitrogen intake.

Conclusions and implications Under experimental conditions, the use of forage cactus pear and concentrate in the form of total mixed rations silage leads to greater intake of crude protein, non-fibrous carbohydrates, ether extract and greater digestibility of non-fibrous carbohydrates and neutral detergent fiber, however, all diets were viable in the feed of confined sheep, providing gains of up to 198 g/day according with the formulation of the diet.

Acknowledgements

We thank to the external funding from the National Council for Scientific and Technological Development (CNPq), with process Number 435819/2018-6.

Conflict of interest

The authors declare that they have no competing interests. Literature cited: 1. Paula TA, Véras ASC, Guido SI, Chagas JCC, Conceição MG, Gomes RN, et al. Concentrate levels associated with a new genotype of cactus (Opuntia stricta [Haw]. Haw.) cladodes in the diet of lactating dairy cows in a semi-arid region. J Agric Sci 2019;156(10):1251-1258. https://doi.org/10.1017/S002185961900011X 2019 v.1. 2. Oliveira JPF, Ferreira MAF, Alves AMSV, Melo ACC, Andrade IB, Urbano SA, et al. Carcass characteristics of lambs fed spineless cactus as a replacement for sugarcane. Asian-Austral J Anim Sci 2018;31(4):529-536. https://doi.org/10.5713/ajas.17.0375.

Rev Mex Cienc Pecu 2022;13(1):19-31

3. Pereira GA, Santos EM, Oliveira JS, Araújo GGL, Paulino RS, Perazzo AF, et al. Intake, nutrient digestibility, nitrogen balance, and microbial protein synthesis in sheep fed spineless-cactus silage and fresh spineless cactus. Small Ruminant Res 2021;194(e106293):1-8. https://doi.org/10.1016/j.smallrumres.2020.106293. 4. Miranda-Romero LA, Vazquez-Mendoza P, Burgueño-Ferreira JA, Aranda-Osorio G. Nutritive value of cactus pear silages for finishing lambs. J Prof Assoc Cactus Dev 2018;20(1):196-215. http://www.jpacd.org/jpacd/article/view/37. 5. Moura MSC, Guim A, Batista AMV, Maciel MV, Cardoso DB, Lima Júnior DM, et al. The inclusion of spineless cactus in the diet of lambs increases fattening of the carcass. Meat Sci 2020;160(e107975):1–8. https://doi.org/10.1016/j.meatsci.2019.107975. 6. Silva TS, Araújo GGL, Santos EM, Oliveira JS, Campos FS, Godoi PFA, et al. Water intake and ingestive behavior of sheep fed diets based on silages of cactus pear and tropical forages. Trop Anim Health Prod 2021;53(e224):1-7. https://doi.org/10.1007/s11250-021-02686-3. 7. Matias AGS, Araújo GGL, Campos FS, Moraes SA, Gois GC, Silva TS, et al. Fermentation profile and nutritional quality of silages composed of cactus pear and maniçoba for goat feeding. J Agric Sci 2020;158(4):304–312. https://doi.org/10.1017/S0021859620000581. 8. Carvalho GGP, Rebouças RA, Campos FS, Santos EM, Araújo GGL, Gois GC, et al. Intake, digestibility, performance, and feeding behavior of lambs fed diets containing silages of different tropical forage species. Anim Feed Sci Techn 2017;228(1):140-148. https://doi.org/10.1016/j.anifeedsci.2017.04.006. 9. Silva KB, Oliveira JS, Santos EM, Cartaxo FQ, Guerra RR, Souza AFN, et al. Ruminal and histological characteristics and nitrogen balance in lamb fed diets containing cactus as the only roughage. Trop Anim Health Prod 2020;52(2):637645. https://doi.org/10.1007/s11250-019-02051-5. 10. NRC. Nutrient requirements of small ruminants: Sheep, goats, cervids, and new world camelids. National Research Council. The National Academy Press, Washington, DC; 2007. 11. Silva JFC, Leão MI. Fundamentos de nutrição de ruminantes. Livroceres: Piracicaba;1979. 12. Church DC. Digestive physiology and nutrition of ruminants: Digestive physiology. 2nd ed. O & B Books Publishing, Corvallis;1976. 13. Aoac - Association of Official Analytical Chemists. Official methods of analysis of AOAC International. Ed., Latimer Jr., G.W. 20th ed. Washington, DC; 2016.

Rev Mex Cienc Pecu 2022;13(1):19-31

14. Mertens DR. Gravimetric determination of amylase-treated neutral detergent fiber in feeds with refluxing in beaker or crucibles: collaborative study. J AOAC Int 2000;285(6):1217-1240. https://pubmed.ncbi.nlm.nih.gov/12477183/. 15. Silva DJ, Queiroz AC. Análise de alimentos: métodos químicos e biológicos. Editora UFV, Viçosa; 2002. 16. Sniffen CJ, O’Connor JD, Van Soest PJ. A net carbohydrate and protein system for evaluating cattle diets: II. Carbohydrate and protein availability. J Anim Sci 1992;70(11):3562–3577. https://www.ncbi.nlm.nih.gov/pubmed/1459919. 17. Hall MB. Challenges with non-fiber carbohydrate methods. J Anim Sci 2003;81(12):3226–3232. https://doi.org/10.2527/2003.81123226x. 18. Weiss WP. Energy prediction equations for ruminant feeds. In: Cornell Nutrition Conference Feed Manufactures, 61, Ithaca. Proc Ithaca: Cornell University, 1993:176-185. 19. NRC. Nutrient requirements of dairy cattle. National Research Council. 7th ed. Washington, DC: The National Academy Press; 2001. 20. McGrath J, Duval SM, Tamassia LFM, Kindermann M, Stemmler RT, Gouvea VN, et al. Nutritional strategies in ruminants: A lifetime approach. Res Vet Sci 2018;116(1):28-39. https://doi.org/10.1016/j.rvsc.2017.09.011. 21. Raffrenato E, Fievisohn R, Cotanch KW, Grant RJ, Chase LE, Van Amburgh ME. Effect of lignin linkages with other plant cell wall components on in vitro and in vivo neutral detergent fiber digestibility and rate of digestion of grass forages. J Dairy Sci 2017;100(10):8119-8131. https://doi.org/10.3168/jds.2016-12364.

https://doi.org/10.22319/rmcp.v13i1.5300 Article

Comparison in the quality of eggs obtained in an outdoor pen production system and those produced in a cage system

Samantha Romo a Daniela López a Néstor Ledesma a Carlos Gutiérrez a Antonio Quintana a Lucía Rangel a*

Universidad Nacional Autónoma de México. Facultad de Medicina Veterinaria y Zootecnia. Av. Universidad 300, 04510, Ciudad de México. México.

* Corresponding author: eliana@unam.mx

Abstract: Mexico is the main consumer of eggs worldwide with more than 23.22 kg of egg per capita per year. In recent years, production systems have diversified with the introduction of systems that promote animal welfare. The present study was carried out with the aim of comparing the quality of eggs produced in an outdoor pen system against those of a semitechnified cage system. The internal and external physical characteristics of the eggs were evaluated at 3 and 15 d after laying. The results of the present study showed that the egg produced in an outdoor pen system has less cleanliness (P<0.001), and lower quality (P<0.005) than eggs produced in the cage system, according to the classification of the Mexican Standard of “Poultry Products -fresh chicken egg- specifications and test methods” (NMX-FF-127-SCFI-2016). Finally, the storage time significantly decreased the quality of the egg produced in the outdoor pen system (P<0.001), but not that of the eggs from the conventional cage system. In conclusion, under the conditions of the present work, the quality 32

Rev Mex Cienc Pecu 2022;13(1):32-42

of the egg from conventional systems is better than that of the egg produced in outdoor pen systems, especially after 15 d of storage. These results suggest that more studies are needed to evaluate the effects of management practices, preventive medicine and the environmental conditions of cage-free systems on animal health and final egg quality. Key words: Egg, Quality, Cage production, Cage-free production.

Received: 21/03/2019 Accepted: 30/03/2021

Introduction In Mexico, poultry farming represents 63.3 % of livestock production, of which 34.9 % is table chicken, 28.2 % egg, and the remaining 0.2 % represents turkey production(1). Mexico is the world’s leading egg consumer with more than 22.3 kg (360 to 370 eggs) per capita and is fourth among the countries with the highest production, below China, the United States and India. In 2017, egg production in Mexico was 2,718,476 t, with a value of $49,505 million pesos, with the main producing states being Jalisco with 55 % of production and Puebla with 15 %(1). As poultry farming has evolved towards large-scale productions, conventional intensive farming systems have been developed, where birds are kept confined, allowing a greater number of animals to be kept in a small space, as well as greater mechanization and technification(2). In recent years, interest has been placed in the welfare of production animals, and to improve this, the use of alternative or unconventional systems in which animals are free has been suggested(3). The consumption of products generated under these systems is increasing worldwide, mainly in the European Union, the United States and Japan(4). In Mexico, egg production in outdoor pen or grazing systems has had a slow increase, as a sector of the population of the upper middle socioeconomic class seeks a better diet by consuming products that are marketed as natural and of higher quality(5). Additionally, companies in the food sector are committed to animal welfare, even companies such as Alsea, Bimbo, CMR (Corporación Mexicana de Restaurantes) and Marriot International have stated that by 2025 they require that their inputs come from cage-free production systems(6).

Rev Mex Cienc Pecu 2022;13(1):32-42

The production parameters of the cage-free system are not comparable to those of intensive production. Although the requirement for facilities is lower, the low population density per square meter increases the cost per bird. Additionally, the expenses for labor and food are higher, because birds, having more space, raise energy expenditure and require greater consumption of feed to cover their maintenance and production needs. Thus, the cost of production per kilogram of egg in the cage-free system is between 50 and 70 % higher than that of intensive production, therefore the competition of these systems lies in the quality of the final product and not in the selling price(7,8). When talking about egg quality, reference is made to certain internal and external physical properties that influence the acceptance of the product by the consumer. According to the NMX-FF-127-SCFI-2016(9), the egg is classified into four quality categories, which are Mexico extra, Mexico 1, Mexico 2 and out of classification. Mexico’s classification categories have equivalents to the classification used in the United States (Table 1). Internal quality tends to decrease from the time the egg is laid, and is affected by age or freshness, diseases in the flock, handling, temperature and storage humidity(10,11). To measure the freshness of the egg, the Haugh Units (HU) are used, which relate the total weight of the egg with the height of the albumen, these units decrease as the product ages(9,10). Table 1: Mexican classification of the egg according to the standard NMX-FF-127-SCFI2016(9), and its equivalents in the United States (USA) and in the Haugh Units (HU)

Mexico Extra Mexico 1 Mexico 2

USA AA A B

HU > 79 55 to 78 31 to 54

Out of classification

C (out of classification)

< 31

In external quality, the shape of the egg is evaluated, the cleanliness in which it should not have stains of blood, excrement or dust, while the shell should not have alterations such as wrinkles or stretch marks, or perforations, cracks or breaks(10). The objective of this work was to compare the quality of eggs produced in an outdoor pen system against those produced in a cage system. The physical characteristics of quality, internal and external, were evaluated at 3 and 15 days after laying. The hypothesis of the work was that the quality of the chicken egg produced in an outdoor pen system is better than that of those from the cage production system, regardless of the storage time.

Rev Mex Cienc Pecu 2022;13(1):32-42

Material and methods Leghorn hens in their first laying cycle were used, fed with the same concentrate, made at the FMVZ. The samples were taken from two centers of the Faculty of Veterinary Medicine and Zootechnics, of the National Autonomous University of Mexico, both with natural environment houses with manual egg collection, twice a day. The egg of the cage system (n= 60) came from the Center for Teaching, Research and Extension in Poultry Production, located in Tláhuac, Mexico City, in the Mexican highlands; while the eggs produced in the outdoor pen system (n= 60) were produced at the Agro Silvo Pastoral Teaching, Research and Extension Center, located in Chapa de Mota, State of Mexico. The traditional production is carried out in California-type cages of 40 cm front by 45 cm deep for three hens, while the production in outdoor pen is on a dirt floor with sheet metal nesting boxes and wooden perches, at a rate of a nest for five hens, and having a total of 1 m2 for four hens. For this study, the egg collection was carried out on the same day in both centers in the afternoon and the eggs were immediately transferred to the Faculty for identification and storage until the day of analysis. In the case of samples from outdoor pen production, only eggs that were found in the nests were included. Thirty (30) eggs from each system were evaluated three days after laying, while the remaining 60 eggs were stored in refrigeration at 4 ºC, with 60 % humidity, to be evaluated 15 d after laying. The parameters evaluated were: weight in grams, length and width in millimeters, shell thickness in millimeters, shell cleanliness (determining 4 categories (0) clean, (1) slightly dirty, (2) moderately dirty and (3) very dirty), yolk color using the Roche colorimetric fan. To measure the freshness of the egg, the Haugh Units (HU) were used, which decrease as the product ages(9,10). These HUs are calculated with the formula HU = 100 X log [(AH-(1.7 X EW) + 7.57], in which AH is the albumen height in mm and EW is the egg weight in grams. With the above evaluations, the eggs were classified according to the official Mexican standard (NMX-FF-127-SCFI-2016) in Mexico Extra, Mexico 1, Mexico 2 and without classification. For the effect of the type of production on the cleanliness of the egg and the yolk color, the Wilcoxon rank sum test was used. The difference between Haugh Units due to the type of production was analyzed with Student’s T, while the external characteristics of the egg were evaluated by an analysis of variance. To analyze the effect of storage time on the percentage of eggs in the different categories of the Mexican classification, a Chi-square was used.

Rev Mex Cienc Pecu 2022;13(1):32-42

Results Eggs produced in the cage production system were heavier than those produced in the outdoor pen system (62.3 vs 58.5; P<0.01). There were no significant differences (P>0.05) in the width (23.8 ± 3.7 mm) and length (28.6 ± 4.8 mm) of the egg, nor in the thickness of the shell (0.37 ± 0.008 mm) the external physical characteristics of the eggs due to the type of production. When the egg cleanliness was evaluated, it was found that it was significantly better (P<0.001) in the egg produced in a cage system, since 91.5 % of the egg produced under this system was classified as clean, against 45.8 % of the outdoor pen egg. Additionally, in the cage system, there were no eggs in the categories moderately dirty and very dirty, while in the outdoor pen system, 10.2 % of the eggs were classified as moderately dirty and very dirty (P<0.001) (Figure 1). Figure 1: Percentage of Clean, Slightly dirty, Moderately dirty and eggs, according to the production system (cage or outdoor pen)

Very dirty

The percentages of all cleanliness categories show differences (P<0.001) between the types of production.

Within the internal physical characteristics, the color of the yolk was not different between productions (P>0.05), nor was it affected by the storage time. No differences were found between treatments in albumen height on day 3 postoviposition (P>0.05), however, the storage time of the egg did affect it, significantly decreasing it (P<0.01), and this reduction was greater in eggs laid in cage-free pens (interaction: type of production by storage time, P<0.001) (Table 2).

Rev Mex Cienc Pecu 2022;13(1):32-42

Table 2: Characteristics of freshness of the egg produced in an outdoor pen system or in California-type cages, and effect of storage time (3 or 15 days) Type of production Standard Cage Outdoor pen error Storage days 3 15 3 15 a b a Albumen height, mm 4.6 3.9 5.3 2.6 c 0.2 a a a b Haugh Units 63.9 54.0 69.4 36.4 3.1 ab

Different literals within the same egg quality variable indicate significant differences (P<0.01).

Egg freshness, measured in Haugh Units, decreased with storage time (P<0.001). However, the storage time affected more (interaction P<0.05) the egg from free-range hens, so that the more storage days the lower the Haugh Units (Table 2). When the egg quality was evaluated, it was found that the egg produced in cages was of better quality (P<0.005), and this quality was better preserved (P<0.001) with storage time (Figure 2). One hundred percent of the eggs produced in cages had classifications Mexico 1 and Mexico 2 at 3 and 15 d of storage, while, in the egg produced in outdoor pens, of the 90 % of the eggs that were in category 1 to d 3, only 6.7 % remained in it at 15 d, the percentage of eggs in category Mexico 2 increased from 3.3 % to 43.3 %, and 36.7 % of the eggs left the classification. Figure 2: Egg quality classification, after 3 ▄ 15 ▄ days of storage, where: MX-E = Mexico extra, MX-1 = Mexico 1, MX-2 = Mexico 2, SC = without classification

Panel A = cage production; panel B = outdoor pen production.

Rev Mex Cienc Pecu 2022;13(1):32-42

Discussion The results of the present study show that the egg produced in cage systems has better quality after 15 days of storage, when compared to the egg obtained in an outdoor pen system. The current trend towards the consumption of food produced in systems similar to those of free-living has favored the increase of egg production systems with free-range hens, and one of the arguments is that the quality of the egg is better(12). However, in studies conducted to determine differences in egg quality according to the layers’ housing systems, very variable and inconsistent results have been found(13). The present study shows that the initial quality of the egg does not differ, but production in outdoor pen systems negatively affects the quality when the egg is stored for 15 d, even after standardizing the lineage and diet of the hens. The internal and external characteristics of the egg in both systems were similar in the fresh egg (3 d after laying). However, after 15 days of storage, a higher proportion of eggs from the outdoor pen system were classified in category Mexico 2, and there were even eggs out of classification, which indicates a decrease in egg quality over time. Among the factors associated with the decrease in the internal quality of the egg (Haugh Units) is the loss of water and CO₂(14,15,16), consequently, the pH of the egg increases (changes to basic), which results in an aqueous white due to the loss of structure of the dense albumen protein(14,17,18). Previous studies have reported that such changes begin to be observed after 5 d of storage, which even affects the taste of the egg(10). This would explain the decrease in HUs after 15 d of storage that was found in this study. Another factor that can also affect the internal quality of the egg is the ambient temperature(19,20,21). In this study, the eggs of both systems were stored in the same place and the storage temperature was the same for the following 15 d; however, it is possible that there has been a variation in it from the time of laying to the transfer to the laboratory. Cage production systems may have controlled air systems, which prevent temperature variations, which is not observed in outdoor pen productions(22). Thus, it has been observed that the quality of albumen is affected if the eggs are not immediately collected in a house with an elevated ambient temperature(23,24). Additionally, in outdoor pen systems, the hens have the availability of nests with bed, which can delay the loss of heat from the egg(23,25), which does not occur in the cage system, since the egg comes out towards the collection band immediately after laying, favoring the decrease of its temperature in less time. The results of the present work show an interaction between the production system and the storage time, the latter affecting more negatively the quality for the outdoor pen system.

Rev Mex Cienc Pecu 2022;13(1):32-42

On the other hand, the interval between egg collections in cage system is smaller than in outdoor pens systems, so the egg spends less time at the production site(25). Data provided by Macindoe(16) indicate that Haugh Units decrease considerably at a greater interval between egg collections. However, the results showed that the quality of the eggs from the outdoor pen system is even lower when the collection time was not different between systems. Finally, the cage egg had a percentage of cleanliness higher than that of the egg from the outdoor pen system. This is attributed to the fact that, in this last system, a part of the eggs is laid on the floor and the other in communal nests, which implies the contact of the eggs with dirty surfaces. In addition, eggs produced in cage-free systems have been shown to have greater bacterial contamination with staphylococci, streptococci and E. coli(24,26). This may explain the reduction in quality observed in this study when the eggs were kept for 15 d, since a greater number of bacteria in the shell increases the risk of contamination and therefore decreases the internal quality(23,24). The results show that the quality of the egg produced in an outdoor pen system is lower than that of eggs produced in conventional systems, and are consistent with what Wells and Belyavin(24) suggested, who mention that eggs produced in cage-free conditions do not present real advantages to the consumer in terms of composition and physical properties of the egg. They even suggest that eggs from outdoor pen systems have lower microbiological quality, so they consider that modifications in egg characteristics are not the arguments that should be used to support the change from traditional production systems. Additionally, the cost benefit must be evaluated, since, in general, in grazing systems mortality is higher and the production cost is higher due to the lower number of eggs produced and marketed.

Conclusions and implications In conclusion, it can be said that both production systems have advantages and disadvantages; however, the quality of the egg from conventional systems is better than that of the egg produced in outdoor pen systems. Further studies are required to evaluate the effects of management practices, preventive medicine and the environmental conditions of the outdoor pen system on animal health and final egg quality.

Rev Mex Cienc Pecu 2022;13(1):32-42

Literature cited: 1.

UNA. Unión nacional de Avicultores Compendio de indicadores económicos del sector avícola. Dirección de estudios económicos. México. 2018. www.una.org.mx. Consultado 18 Ene, 2018.

FAO. Organización de las Naciones Unidas para la Alimentación y Agricultura. México. 2015.

Sauveur B. El huevo para consumo: Bases productivas. El alojamiento de las gallinas ponedoras y de las aves reproductoras: características. España. 1993:214-260.

SADER (Secretaria de Agricultura y Desarrollo Rural) México. 2018.

Díaz VA, Pérez HA, Hernández AJ. Caracterización del consumidor de productos orgánicos en la ciudad de Toluca. Méx. Sociedad Mexicana de Administración Agropecuaria A. C. Torreón México. Rev Mex Agroneg 2015;(36):1178-1187.

Muñoz D. Gallinas libres… huevos caros. El financiero. México, 2016. http://www.elfinanciero.com.mx/empresas/gallinas-libres-huevos-caros. Consultado 17 Feb, 2018.

Appleby MC, Hueghes BO, Elson HA. Poultry production systems: Behaviour management and welfare. UK: CAB International; 1992.

Quintana JA. AVITECNIA: Manejo de las aves domésticas más comunes, 4 ed. México: Trillas; 2011.

NMX-FF-127-SCFI-2016. Productos Avícolas -huevo fresco especificaciones y métodos de http://sitios1.dif.gob.mx/alimentacion/docs/NMX-FF-127-SCFI2016_Huevo_fresco.pdf . Consultado 14 Oct, 2020.

gallinaprueba.

10. Coutts JA, Wilson GC. Manual práctico de calidad de huevo. 1ͣ ed. Reino Unido: 5M Publishing; 2007. 11. Pedroza RH. Manual de prácticas de laboratorio de inocuidad y calidad de los alimentos de origen animal. 2ᵅ ed. México: Universidad Autónoma de México; 2013.

Rev Mex Cienc Pecu 2022;13(1):32-42

12. Raigón MD, García M, Esteve P. Valoración de la calidad del huevo de granja ecológica e intensiva. Escuela Universitaria de Ingeniería Técnica Agrícola. 2007. Universidad Politécnica de Valencia. www.institutohuevo.com. Consultado 14 Abr, 2018. 13. Yenice G, Kaynar O, Ileriturk M, Hira F, Hayirli A. Quality of eggs in different production systems. Food technology and economy, engineering and physical properties. 2016;34:370-376. 14. Pérez-Cobos PF. Calidad interna del huevo y su conservación. Gallego SA, et al. Cordinadores. Lecciones sobre el huevo, Madrid: Instituto de estudios del huevo; 2002: 57-74. 15. Feddern V, Celant De Prá M, Mores R, Silveira N, Coldebella A, Abreu P. Egg quality assessment at different storage conditions, seasons and laying hen strains. Ciencia y Agrotecnologia, 2017;41:322-333. 16. Macindoe, R.N. Egg quality, collection and storage. Poultry Intern 1981; May:162-168. 17. Scott TA, Silversides FG. The effect of storage and strain of hen on egg quality. Poultry Sci 2000;79:1725–1729. 18. Castelló JA. Producción de huevos 2ᵅ ed. España: Real Escuela de Avicultura; 2010. 19. Torre C, Fonseca M, Quintana J. El huevo mitos realidades y beneficios. 2ͣ ed. México: Instituto Nacional Avícola; 2008. 20. Kashimori A. The illustrated egg handbook. 1ͣ ed. Cambringe, UK: Nabel/DSM; 2017. 21. Yeasmin A, Azhar K, Hishamuddin O, Awis QS. Effect of storage time and temperature on the quality characteristics of chicken eggs. J Food, Agr Environ 2014;12:87-92. 22. Moreno AJC. Reproducción e incubación en avicultura. 1ͣ ed. España: Real Escuela de Avicultura; 2003. 23. Buxade CC. La gallina ponedora sistemas de explotación y técnicas de producción. 1ͣ ed. España: Mundi-Prensa; 2000. 24. Wells RG, Belyavin CG. Egg quality-current problems and recent advance. 1ͣ ed. England: Poultry science symposium 1989.

Rev Mex Cienc Pecu 2022;13(1):32-42

25. Nys Y, Bain M, Van IF. Improving the safety quality of egg and egg products volume 2: Eggs safety and nutritional quality, England: Woodhead Publishing; 2011. 26. Ledvinka Z, Zita L, Klesalová L. Egg quality and some factors influencing it: a review. Scientia Agr Bohemica 2012;43:46-52.

https://doi.org/10.22319/rmcp.v13i1.5388 Article

Using grapeseed meal as natural antioxidant in slow-growing Hubbard broiler diets enriched in polyunsaturated fatty acids

Margareta Olteanu a* Tatiana Dumitra Panaite a Raluca Paula Turcu a,b Mariana Ropota a Petru Alexandru Vlaicu a,b Monica Mitoi c

National Research-Development Institute for Animal Biology and Nutrition (INCDBNA), Calea Bucuresti, no. 1, Balotesti, 077015, Ilfov, Romania. b

University of Agronomic Sciences and Veterinary Medicine of Bucharest, 59 Marasti Bd, District 1, Bucharest, Romania. c

Institute of Biology Bucharest, 296, Splaiul Independentei, 060031, Romania.

* Corresponding author: margaretaolteanu@yahoo.com

Abstract: The purpose of the study was to assess the effect of the grapeseed meal, added to slowgrowing Hubbard broilers diet high in polyunsaturated fatty acids (PUFA) due to the dietary flaxseed meal. The 7-wk feeding trial used 80 broiler chicks (14 d), assigned to two groups: control (C) and E, with 4 replicates of 10 chicks/group. The basal diet was similar for both groups during both feeding stages. The diet for group E was supplemented with 3% grapeseed meal. Six broilers from each group were slaughtered in the end of the feeding trial, and blood, breast and leg meat samples were collected. Serum cholesterol was significantly lower in group E (110.85 mg/dL), than in group C (146.82 mg/dL). The PUFA concentration was

Rev Mex Cienc Pecu 2022;13(1):43-63

significantly higher in group E, than in group C, both in the breast (31.34 %, compared to 27.73 % total fatty acid methyl ester - FAME) and in the leg (32.44 %, compared to 30.06 % total FAME). The cholesterol concentration was significantly lower in group E (42.52 mg), than in group C (60.91 mg/100 g fresh sample) in the leg. After 7 d of refrigeration, the peroxide value was significantly lower in group E (8.11 meq), than in group C (8.79 meq/kg fat) in the breast meat, while fat acidity was significantly lower in group E (40.82 mg KOH), than in group C (43.99 mg KOH / g fat) in the leg. The dietary 3 % grapeseed meal, used as natural antioxidant, in PUFA-enriched broiler diets, had positive effects on the blood parameters and meat quality. Key words: Broiler, Hubbard, Flaxseed meal, Grapeseed meal, Fatty acids.

Received: 21/05/2019 Accepted: 12/05/2021

Introduction There are many factors influencing broiler meat quality, among which the genetic makeup, animal welfare, pre-slaughter factors and the post-mortem changes of the muscles(1). Nowadays, the meat from slow-growing broiler hybrids became more known for its pleasant texture and flavour, less juicy, fitting the current consumer preferences(2,3). In Europa these hybrids are adapting faster to the alternative production systems, several lines being available, even if the growth performance of the slow-growing hybrids are less efficient than that of the fast-growing hybrids(2,3). Fatty acids contents were found to both hazards and beneficial effects on human health based on type of fats and meat consumption(4). Furthermore, consumer concern for high omega – 3 (ω-3 PUFA) foods in their daily diet increased due to their beneficial effect on human health(5,6,7). Animal foods can be enriched in PUFA by feeding the animals diets whose ingredients are high in PUFA. Some of the PUFA-high feed ingredients are the flaxseed(8,9) and flaxseed meal(10-13), camelina meal(14,15), and the rapeseed meal(16-19). Flax is an oleaginous plant in which ω-6 / ω-3 ratio is lower than the unit (0.436%), hence, the flax, in all its forms (seeds, oil and meal) is a viable feed ingredient that can increase the PUFA level of the diets(8). However, the increased levels of PUFA make the feeds prone to oxidation, which is why the diets have to be supplemented with antioxidants(20).

Rev Mex Cienc Pecu 2022;13(1):43-63

The winery by-products, grape pomace, grape seeds and grape peels, grapeseed cakes or grapeseed meals, have high levels of polyphenols, sources of natural antioxidants. The abundance of active polyphenols in these by-products is of real interest for animal nutrition, because they can be used as natural antioxidants, replacing the synthetic ones(21,22). The grapeseed cakes or meals result from the cold extraction or chemical extraction of the oil. The concentration of polyphenols ranges between 0.642 mg gallic acid equivalents, in the cakes, 3.186 mg gallic acid equivalents, in the grape pomace and 90.41 mg gallic acid equivalents / g sample in the grape seed meal. The antioxidant capacity ranges between 8.554 mM Trolox equivalents, in the grape pomace, 6.241 mM Trolox equivalents, in cakes and 493.07 mM Trolox equivalents /g sample, in the grape seed meal(11,23,24). The literature has several studies on the use of winery by-products, such as grape pomace(25,26,27) or grapeseed meal(28,29) in broiler feeding and on their beneficial effects on broiler performance, protein and amino acids digestibility, blood parameters and meat quality, due to the higher concentration of PUFA and lower lipid peroxidation. The studies conducted so far have shown that the inclusion of winery by-products in animal feeding, as natural antioxidants, is a good strategy for enhancing the oxidative stability of the animal products, meeting thus consumer requirement for high quality animal foods(30,31). Within this context, the purpose of the present study was to assess the effect of 3 % grapeseed meal, winery by-product, added to Hubbard broilers diet high in polyunsaturated fatty acids due to the dietary 2 % flaxseed meal, on broiler performance, energy profile of the blood plasma, on fatty acids and cholesterol levels and on broiler meat degradation indices.

Material and methods The feeding trial was conducted in the experimental facilities of the National Research Development Institute for Animal Biology and Nutrition (IBNA-Balotesti, Romania) on a protocol (no. 5122/03.08.2017) approved by the Ethics Commission of the institute in accordance with the EU Directive 2010/63/ EU and Romanian Law regarding Animal Protection.

Rev Mex Cienc Pecu 2022;13(1):43-63

Animals and experimental design

The 7-wk feeding trial was conducted on 80 Hubbard broiler chicks (14 d), reared on the floor, on wood shavings (10 cm thick). The chicks were weighed individually and assigned to two groups (40 chicks / group), having the average initial weight of 233.6 ± 5.53 g. Each group had four replicates of 10 chicks each. The chicks had free access to the feed and water. There was a 23 h light regimen, the temperature was 22 to 23 oC, and the relative humidity was 60 to 70 % throughout the entire experimental period, according to the Management guide for Hubbard CLASSIC broilers(32). The experimental design was monofactorial, completely randomized. It had two treatments, C (0%) and E (3%) with grapeseed meal applied for the two phases, growing (14-28 d) and finishing (28-63 d), according the feeding requirements of the slow-growing line Hubbard hybrid (Table 1). Both diets (C and E) were enriched in polyunsaturated fatty acids using 2% flaxseed meal. The flaxseed meal and the grapeseed meal were purchased from 2E Prod SRL, Romania. There was a single batch of diet / group for each period: grower and finisher. The growth performance of the broilers: average daily feed intake (g /broiler/d), initial weight (g), final weight (g) was monitored throughout the experimental period (14-63 d). It was calculated the average daily weight gain (g/broiler/d) and feed conversion ratio (g feed/g broiler), on basis of replicate of birds. Table 1: Compound feeds formulation and chemical analysis

Corn Wheat Corn gluten Soybean meal Flax meal Grapeseed meal Sunflower oil Monocalcium phosphate Calcium carbonate Salt Methionine Lysine Choline Premix* Total

Grower (14– 28 days)

Finisher (29– 63 days)

C 49.92 15.00 4.00 19.85 2.00 4.40 1.32 1.73 0.34 0.15 0.24 0.05 1.00 100

C 44.26 16.00 4.00 24.00 2.00 5.00 1.30 1.70 0.34 0.15 0.20 0.05 1.00 100

E 44.14 15.00 4.00 22.00 2.00 3.00 5.00 1.50 1.62 0.34 0.15 0.20 0.05 1.00 100

E 47.00 10.00 3.80 24.00 2.00 3.00 5.46 1.40 1.60 0.34 0.15 0.20 0.05 1.00 100

Rev Mex Cienc Pecu 2022;13(1):43-63

Chemical analysis results (% DM) Dry matter Crude protein Ether extractives Crude fibre Lysine Methionine Calcium Total phosphorus Concentration of total polyphenols (mg GAE / g) Antioxidant capacity (mM TE / g)

90.18 21.80 5.44 4.59 1.33 0.43 0.91 0.81 1.47 2.15

90.16 21.87 6.06 4.93 1.34 0.41 0.91 0.81 1.68 3.09

90.00 19.12 6.97 4.64 0.99 0.38 0.91 0.81 1.36 2.01

90.11 19.20 7.40 4.61 1.13 0.39 0.92 0.82 1.56 2.82

Fatty acids (% of total FAME) Saturated fatty acids (SFA) 11.04 Monounsaturated fatty acids (MUFA) 23.62 Polyunsaturated fatty acids (PUFA) 65.33 α-linolenic acid (ALA) 4.35 Omega-3 polyunsaturated fatty acids (ω-3) Omega-6 4.46 polyunsaturated fatty acids (ω-6) 60.87 ** 13.18 Calculated metabolizable energy (Mj / kg DM)

10.43 21.06 68.51 4.90 5.01 63.50 13.20

12.89 23.87 63.10 5.76 5.89 57.21 13.39

12.30 22.16 65.47 6.34 6.47 59.00 13.40

*Content per kg diet: vitamin A: 11000 IU; vitamin D3: 2000 IU; vitamin E: 27 IU mg; vitamin K3: 3 mg; vitamin B1: 2 mg; vitamin B2: 4 mg; pantothenic acid: 14.85 mg; nicotinic acid: 27 mg; vitamin B6: 3 mg; vitamin B7: 0.04 mg; vitamin B9: 1 mg; vitamin B12: 0.018 mg; vitamin C: 20 mg; manganese: 80 mg; iron: 80 mg; copper: 5 mg; zinc: 60 mg; cobalt: 0.37 mg; iodine: 1.52 mg; selenium: 0.18 mg. **Metabolizable energy was calculated from the chemical composition

Sampling and chemical analysis

Samples of flaxseed meal and grapeseed meal were collected before feed manufacturing and their chemical composition determined. Grower and finisher compound feed samples were collected and assayed for the basic chemical composition, calcium, phosphorus, lysine, methionine, fatty acids profile, concentration of polyphenols and antioxidant capacity. At the end of the experimental period (63 d of broiler age), six broilers per group were selected randomly. The blood samples (n= 6) were collected after which the broilers were slaughtered in 6 mL Vacutainer tubes, on anticoagulant heparin–lithium. The blood samples were centrifuged at 3,000 rpm, for 20 min, at +22 oC. The plasma was stored at – 80 oC until analysed. Six individual samples of breast meat and six individual samples of leg meat were formed. Each

Rev Mex Cienc Pecu 2022;13(1):43-63

sample was divided in three. One part was assayed for fatty acids and cholesterol, one sample was refrigerated (+4 °C) for 7 d and thereafter assayed for the fat degradation indices (peroxide value and fat acidity), and the third part was frozen (-18 °C) for one month and thereafter assayed for the fat degradation indices (peroxide value and fat acidity). The basic chemical composition of the flaxseed meal, of the grapeseed meal and of the compound feeds was determined using methods standardized according to Regulation (EC) no. 152/2009. Dry matter (DM) was determined by the gravimetric method using a Sartorius (Gottingen, Germany) scale and BMT drying closet, ECOCELL Blueline Comfort (Nuremberg, Germany). Crude protein (CP) was determined by the Kjeldahl method using a semiautomatic KJELTEC auto 2300 system – Tecator (Sweden). Ether extractives (EE) were determined by the extraction in organic solvents using a SOXTEC-2055 FOSS system – Tecator (Sweden). Crude fibre (CF) was determined by the method with intermediary filtration using a FIBERTEC 2010 system – Tecator (Sweden). Ash (Ash) was determined by the gravimetric method using a Caloris CL 1206 furnace. The calcium (Ca) was determined by the titrimetric method according to SR ISO 64911:2006. The phosphorus (P) was determined photometrically, according to Regulation (EC) no. 152/2009, using the Jasco V-530 spectrophotometer. Lysine and methionine of the compound feeds were determined by the liquid chromatographic method, according to Regulation (EC) no. 152/2009, using a Finningan Surveyor Plus HPLC (Thermo-Electron Corporation, Waltham, USA), fitted with PDA detector (Photo Diode Array Detector). The amino acids are separated on a Hypersil BDS C18 column with silica gel (250 ×4.6 mm), particle size 5 μm, with reverse phase and a +45 oC temperature. The results were expressed in g amino acids / 100 g DM. Concentration of polyphenols and antioxidant capacity of the grapeseed meal and compound feeds. The grapeseed meal samples and the compound feeds samples were first extracted in acidified methanol (methanol: hydrochloric acid = 80:20). The concentration of polyphenols in the methanol extracts was determined by spectrophotometer method(33), using a UV-VIS Thermo Scientific spectrophotometer. The results were expressed as mg gallic acid equivalents / g sample (mg GAE / g sample). The antioxidant capacity in the methanol extracts was determined by the DPPH method(34), using a UV-VIS Analytik Jena Specord 250 Plus spectrophotometer with thermostatic carousel. The results were expressed in mM Trolox equivalents /g sample (mM TE / g sample). Metabolic profiles of blood plasma. The blood biochemical parameters were determined from the plasma samples, using a biochemical analyser (Analyzer Chemistry Mindray BS 130) with ACCENT - 200 kits, according the manufacturer’s instructions.

Rev Mex Cienc Pecu 2022;13(1):43-63

Fatty acids profile of the feed ingredients, of the compound feeds and of the meat samples. The fat from the meat samples (breast and leg) were extracted, then saponified by reflux boiling in a solution of acidified methanol (2% H2SO4 in methanol), to obtain the fatty acids methyl esters (FAME). The fatty acids methyl esters were added to hexane and concentrated in rotavapor. The resulting samples were analysed by gas chromatographic method, according to the SR CEN ISO/TS 17764-2:2008, using a Perkin Elmer-Clarus 500 chromatograph, fitted with a system for injection into the capillary column, with high polarity stationary phase (BPX70: 60m x 0.25mm inner diameters and 0.25µm thick film); or high polarity cyanopril phases, which have similar resolution for different geometric isomers (THERMO TR-Fame: 120m x 0.25mm ID x 0.25µm film). Cholesterol level in the meat samples. For the meat samples saponification, it was started with a method described by Dihn et al(35), adapted in our laboratory. The meat samples (breast and leg) were saponified by reflux boiling in a solution of methanol and potassium hydroxide (5% KOH in methanol), followed by extraction in petrol ether, concentration in rotavapor, and addition of chloroform. The resulting samples were analysed by gas chromatographic method, according to AOAC International(36), using a Perkin Elmer-Clarus 500 chromatograph, with on-column injector (splitting ratio, about 1:100), with programmable column heater; flame ionization detector (FID) and capillary separation column HP-5 (30m, 0.32mm ID, 0.1 µm film) AGILENT. The peroxide value for the meat samples was determined with the iodometric method according to SR EN ISO 3960:2017. The results were expressed in milliequivalents / kg fat (meq/kg fat). The fat acidity for the meat samples was determined with the volumetric method according to ISO 660:2009. The results were expressed in mg potassium hydroxide / g fat (mg KOH / g fat).

Statistical analysis

The effects of treatments were tested by one-way analysis of variance using the GLM procedure of Minitab software(37) with treatment as a fixed effect, according to the model Yi = Ti + ei, where Yi was the dependent variable, Ti is the treatment and ei is the error. When overall F-test was significant, differences between means were declared significant at P < 0.05 using the Tukey comparison test.

Rev Mex Cienc Pecu 2022;13(1):43-63

Results Characterisation of flaxseed meal and grapeseed meal

The flaxseed meal, used as feed ingredient high in polyunsaturated fatty acids (PUFA), had: 344.4 g/kg protein, 109.7 g/kg fat, and 20.20 MJ/kg gross energy. The fatty acids profile was: 11.21 g saturated fatty acids (SFA), 20.00 g monounsaturated fatty acids (MUFA), 68.73 g polyunsaturated fatty acids (PUFA), of which 53.35 g ω-3 PUFA, and 15.37 g ω-6 PUFA / 100 g FAME, with ω - 6 / ω – 3 ratio of 0.29. Table 2 shows the basic chemical composition, the fatty acids profile, the concentration of polyphenols and the antioxidant capacity of the grapeseed meal used as natural antioxidant in PUFA-high diets. Table 2: Content of the main nutrients of grapeseed meal Specification

Grapeseed meal

Dry matter, % Crude protein, % DM Ether extractives, % DM Gross energy, MJ/kg Concentration of total polyphenols, mg GAE/g Antioxidant capacity, mM TE/g Fatty acids (% of total FAME): SFA MUFA PUFA ω -3 ω -6

918.5 129.0 72.2 18.55 26.65 148.35 12.30 20.39 67.14 0.68 66.45

SFA= saturated fatty acids; MUFA= monounsaturated fatty acids; PUFA= polyunsaturated fatty acids; ω -3omega 3 polyunsaturated fatty acids; ω -6- omega 6 polyunsaturated fatty acids.

Characterisation of compound feeds

The compound feeds were developed on the basis of the chemical composition of the feed ingredients, being isonitrogenous and isocaloric for each feeding phase, in agreement with the feeding requirements of the Hubbard hybrid (Table 1). Due to the inclusion of 3% grapeseed meal, the compound feed of group E had a higher concentration of polyphenols of 1.68 mg GAE (growing phase), respectively 1.56 mg GAE (finishing phase), compared to

Rev Mex Cienc Pecu 2022;13(1):43-63

the compound feed of group C 1.47 mg GAE (growing phase), respectively 1.36 mg GAE/g diet (finishing phase). Higher results were also determined regarding the antioxidant capacity of the E group compound feed of 3.09 mM TE (growing phase) and 2.82 mM TE (finishing phase), compared to C group which had 2.15 Mm TE (growing phase) and 2.01 mM TE/g diet (finishing phase).

Bird performance

Table 3 shows the effect of using a compound feed with 3% grapeseed meal on the growth performance of the broilers. The values for the entire experimental period (14- 63 d) were higher for group E, than for group C, for the final weight and feed conversion ratio. No mortalities were recorded. Table 3: Effect of the compound feed with grapeseed meal on the broiler performance: 1463 d (mean values) Items C E SEM P-value Average daily feed intake, g/broiler/d 114.2a 119.5a 3.89 0.497 a a Initial weight, g 233.3 233.7 3.88 0.962 a a Final weight, g 2545 2728.5 48.03 0.056 a a Average daily weight gain, g/broiler/d 47.18 50.70 1.04 0.090 a a Feed conversion ratio, g feed/g gain 2.42 2.35 0.29 0.913 Death rate, % 0.00 0.00 C= Control; E= Control + 3% grapeseed meal; SEM= Standard error of the mean. a-b Mean values within a row having different superscripts are different (P<0.05).

Metabolic profile of blood plasma

The metabolic profile of the blood plasma, collected at broiler age of 63 d (Table 4), shows significantly (P<0.05) lower energy profile in group E, than in group C, thus, glycaemia decreased by 16.88 %, cholesterol by 24.50 %, and the triglycerides by 34.90 %, in group E, compared to group C, the differences being statistically significant (P<0.05).

Rev Mex Cienc Pecu 2022;13(1):43-63

Table 4: Effect of compound feed with grapeseed meal on the metabolic profile of blood plasma in broilers of 63 d of age (mean values) Items

Glycaemia, mg/dL

271.03a a

Cholesterol, mg/dL Triglycerides, mg/dL

146.82 49.93a

SEM

P-value

225.28b

7.30

<0.0001

5.99 2.95

<0.0001 <0.0001

110.85 32.50b

C= Control; E= Control + 3% grapeseed meal: SEM= Standard error of the mean. a-b Mean values within a row having different superscripts are different (P<0.05).

Fatty acid concentration in the broiler meat

The PUFA concentration in the breast meat samples (Table 5) was significantly (P<0.05) higher in group E, than in group C, by 13.02 %. The concentration of ω - 3 PUFA, and of ω - 6 PUFA increased by 15.00 %, and by 12.84 %, in group E, compared to group C (P<0.05). The alfa linolenic acid (ALA) concentration in the breast meat was 1.89 g, in group E, and 1.82 g / 100 g total FAME, in group C (P>0.05). The PUFA concentration in the leg meat samples (Table 5) was significantly (P<0.05) higher in group E, than in group C, by 7.91 %. The concentration of ω –3 PUFA was also higher in group E, than in group C, by 9.66 %, but the difference was not statistically significant (P>0.05). The ALA concentration in the leg meat was 2.56 g in group E, significantly (P<0.05) higher than 1.97 g/ 100g total FAME, in group C. Table 5: Effect of compound feed with grapeseed meal on the fatty acids concentration in the broiler meat samples (mean values) Fatty acids (% of total FAME)

Breast meat

Leg meat

SFA MUFA PUFA, of which:

32.48a 32.33a 0.21 39.09a 35.83b 0.54

Pvalue 0.736 < 0.001

27.73a 31.34b 0.62

ALA ω -3 ω -6 Ratio ω–6 / ω-3

1.82a 2.80a 24.84a 8.92a

1.89a 3.22b 28.03b 8.73a

SEM

0.03 0.08 0.55 0.13

30.97a 29.29b 0.33 38.40a 38.01a 0.29

Pvalue 0.027 0.517

0.0002

30.06a 32.44b 0.62

0.049

0.276 0.003 0.0002 0.475

1.97a 3.00a 27.06a 9.02a

0.002 0.205 0.044 0.656

2.56b 3.29a 29.14b 8.85a

SEM

0.11 0.11 0.52 0.19

FAME=fatty acid methyl esters; C=Control; E= Control + 3% grapeseed meal; SEM= Standard error of the mean.

Rev Mex Cienc Pecu 2022;13(1):43-63 SFA–saturated fatty acids; MUFA-monounsaturated fatty acids; PUFA- polyunsaturated fatty acids; ALA -αlinolenic acid; ω-3 -omega-3 polyunsaturated fatty acids; ω-6 - omega-6 polyunsaturated fatty acids; a-b Mean values within a row having different superscripts are different (P<0.05).

Cholesterol level in the broiler meat

The cholesterol concentration in the breast meat samples (Table 6) were lower in group E, treated with 3 % grapeseed meal, than in group C, but the difference was not statistically significant (P>0.05). For the leg meat, the cholesterol concentration was 30.2 % lower in group E, compared to C (P<0.05). Table 6: Effect of compound feed with grapeseed meal on the cholesterol level in the broiler meat samples (mean values), (mg / 100 g fresh meat) Breast meat

Leg meat

SEM

P-value

SEM

P-value

44.28a

36.49a

2.05

0.052

60.91a

42.52b

3.76

0.006

C= Control; E= Control + 3% grapeseed meal; SEM= Standard error of the mean. a-b Mean values within a row having different superscripts are different (P<0.05).

Fat degradation indices in the broiler meat

Regarding the fat degradation indices (Table 7), the peroxide value of the breast meat samples, determined after 7 d of refrigeration at +4 oC, was 8.11 meq/kg fat, in groups E, significantly (P<0.05) lower than 8.79 meq, in group C. However, after one month of freezing (-18 oC), their values were similar (P>0.05). Fat acidity was lower in group E, than in group C, both after 7 d of refrigeration (+4 oC), and after one month of freezing (-18 oC), but the difference was not significant (P>0.05). The peroxide value of the leg meat samples (Table 7) determined after 7 d of refrigeration (+4 oC), and after one month of freezing (-18 oC), was similar in both groups (P>0.05). However, fat acidity after 7 d of refrigeration (+4 oC), 40.82 mg KOH / g fat, in group E, was significantly (P<0.05) lower than 43.99 mg KOH/g fat, in group C. After one month of freezing (-18 oC), the decrease of fat acidity in group E was not statistically significant (P>0.05), compared to group C.

Rev Mex Cienc Pecu 2022;13(1):43-63

Table 7: Effect of compound feed with grapeseed meal on the fat degradation indices in the broiler meat samples (mean values) Items Breast meat Peroxide value, meq/kg fat Fat acidity, mg KOH/g fat Peroxide value, meq kg fat Fat acidity, mg KOH/g fat Peroxide value, meq/kg fat Fat acidity, mg KOH/g fat Peroxide value, meq/kg fat Fat acidity, mg KOH/g fat

Period day 7refrigeration 1 monthfreezing Leg meat day 7refrigeration 1 monthfreezing

C 8.79a 36.42a 5.08a 20.89a

E 8.11b 36.44a 5.15a 20.30a

SEM 0.12 0.01 0.02 0.37

P-value 0.0002 0.955 0.161 0.442

11.25a 43.99a 6.39a 24.23a

11.10a 40.82b 6.23a 23.72a

0.13 0.52 0.04 0.26

0.589 <0.0001 0.043 0.410

C= Control; E= Control + 3% grapeseed meal; SEM= Standard error of the mean. Mean values within a row having different superscripts are different (P< 0.05).

a-b

Discussion The results on the flaxseed meal used as PUFA-high feed ingredient are in agreement with those of Panaite et al(11), who reported values of: 32.99 % protein, 9.42 % fat, 19.31 MJ / kg gross energy, 11.07 g SFA, 18.71 g MUFA, 70.23 g PUFA, of which 42.93 g ω-3 PUFA and 27.30 g ω-6 PUFA / 100 g FAME, and ω -6 / ω -3 ratio of 0.64. The concentration of polyphenols and the antioxidant capacity of the grapeseed meal, used as natural antioxidant, are in agreement with those of Turcu et al(29), who studied the effect of 2 % grapeseed meal given to Ross 308 broilers and reported 28.08 mg GAE / g samples, and 145.83 mM Trolox equivalents / g sample, antioxidant capacity. The efficiency of the natural antioxidants depends on their chemical composition which, in turn, depends on the variety of grapes, soil type, agro-climatic factors and wine-making techniques(38). The use of 2 % flaxseed meal, high in PUFA, in the compound feeds for Hubbard broilers, produced close values of the fatty acids profile both in the growing and in the finishing phases. As expected, the use of 3 % grapeseed meal as natural antioxidant, in the formulation for group E, increased the concentration of polyphenols and the antioxidant capacity compared to the feed formulation for group C, in both stages. Thus, the concentration of polyphenols was 14.28 % higher and the antioxidant capacity was 43.72% higher for the growth stage, and 14.70 % and 40.29 % higher, respectively, for the finishing stage. These results are in agreement with those reported by Vlaicu et al(28), who studied the effect of 2 % 54

Rev Mex Cienc Pecu 2022;13(1):43-63

grapeseed meal given to Ross 308 broilers (growth stage) and reported 54.31% higher concentration of polyphenols. Broiler performance for the entire experimental period, show that the use of grapeseed meal in the compound feed formulation for group E did not have adverse effects on the broilers, the differences from the control group not being statistically significant (P>0.05). The values of the blood plasma energy profile (glycaemia, cholesterol, triglycerides) (Table 4) were significantly (P<0.05) lower in group E, than in the control group. The lower blood cholesterol might be due to the flavonoid content of the grapeseed meal, which inhibits the formation of mycelia within the small intestine, thus reducing the absorption of the intestinal cholesterol(39). The results in this study on the blood profile are in agreement with those reported by Abu Hafsa and Ibrahim(40) who evaluated the effect of the dietary grapeseed powder (0; 10; 20 and 40 g/kg) given to Cobb 500 broilers. They reported decreases in the following blood parameters: glucose, from 188.42 mg/dL in group C, to 151.39 mg/dL, in the group with 40 g grapeseed powder; cholesterol, from 122.46 mg/dL, in group C, to 95.88 mg/dL, in the group with 40 g grapeseed powder; triglycerides from 67.46 mg/dL, in group C, to 60.75 mg/dL, in the group with 40 g grapeseed powder. Khodayari and Habib(26) studied the effect of various levels of dietary grape pomace (0, 2, 4 and 6 %) given to Ross 308 broilers, on broiler performance, lipid peroxidation and blood biochemical parameters, and reported the decrease of blood triglycerides from 52.00 mg/dL, in group C, to 35.33 mg/dL, in the group with 6 % dietary grape pomace. The blood cholesterol decreased from 163.33 mg/dL, in group C, to 129.33 mg/dL, in the group with 6 % dietary grape pomace. The fact that this study revealed lower values for blood glycaemia, cholesterol and triglycerides in group E, shows a better health state of those broilers, compared to the control group, due to the grapeseed meal added, as antioxidant, to the diet high in polyunsaturated fatty acids. Broiler meat enhanced in PUFA, particularly in ω -3 PUFA, has established beneficial effects for consumer health(4). Kamboh and Zhu(41) shows changes in the proportion of fatty acids (decrease in SFA and increase in PUFA), when the broiler diets were treated with bioflavonoids. The significantly (P<0.05) difference of the breast meat PUFA concentration in group E, can be explained by the fact that the dietary grapeseed meal, due to its antioxidant properties given by the content of polyphenols and flavonoids it slowed down the lipid degradation reactions(42,43). Other work(44) showed the positive effects of the winery by-products in preventing the oxidation of broiler meat PUFA. They studied the use of an extract of grape seeds and onion, alone or in combination with vitamin E, in the diet formulations for Ross broilers exposed to heat, and reported higher PUFA values in the broiler breast meat, compared to the control group. The significantly (P<0.05) higher concentration of ω –3 55

Rev Mex Cienc Pecu 2022;13(1):43-63

PUFA in the breast meat from group E, reported in this study, was also reported(29). By the addition of 2 % flaxseed meal and 2 % grapeseed meal to Ross 308 broiler diet, the concentration of ω –3 PUFA was 11.14 % higher in the experimental group than in the control group. The concentration of PUFA in the leg meat was significantly (P<0.05) different in group E than in group C. Just like for the breast meat samples, for the leg meat sample too, this can be explained by the fact that the dietary grapeseed meal, due to its antioxidant properties given by the content of polyphenols and flavonoids it slowed down the lipid degradation reactions(42,43). Significantly (P<0.05) higher PUFA concentrations were also reported by 19.38 %, and 20.02 %, compared to the control group, in the groups of Ross 308 broilers treated with 2 %, and 4 %, respectively, grapeseed meal(28). Other teams of researchers(27), studied the effect of another winery by-product, the grape pomace, given to broilers in amounts of: 0 %, 5 % and 10 %, reporting increases of PUFA concentration in the broiler leg meat, from 37.0 g, in group C, to 47.4 g, in the group treated with 5 % grape pomace, and to 53.1 g / 100 g total fatty acids, in the group treated with 10 % grape pomace. The alfa linolenic acid (ALA) is an essential fatty acid because it cannot be synthesized by the organism, the main source being the food. In this study, the ALA concentration in the broiler leg meat samples were significantly (P<0.05) higher in group E than in group C, as also reported by Chamorro et al(27), who used grape pomace in the diet formulations for Cobb broilers. As it is known, cholesterol is a component of fats, playing an important role in the formation of hormones and in vitamin metabolism. Cholesterol synthesis in the liver can be modified by the addition of derivatives of animal fats. Recently, the education and research in food safety increased consumer awareness regarding the health effects of the food cholesterol(4) Nutrition can be used to modify the profile of the fatty acids, to decrease ω - 6 / ω – 3 ratio, and the cholesterol level(10). The cholesterol level in the broiler breast and leg meat samples was lower in group E, treated with grapeseed meal. However, only for the leg meat, the decrease was statistically significant: 30.19 %, may be due to high lipid content in leg meat. These results are in contrast with those reported by Yong et al(45) who studied the effect of adding 0; 0.25 and 0.5 % grape meal to broiler diets on the cholesterol level in broiler meat. They observed that the cholesterol content of thigh and breast meat was not significantly affected by grape meal supplementation. The antioxidant effect of the grapeseed extract was investigated by Farahat et al(46), who used it in concentrations of 125 ppm to 2,000 ppm, in broiler diets, and reported lower values of the total cholesterol than in the broilers treated with synthetic antioxidant, BHT.

Rev Mex Cienc Pecu 2022;13(1):43-63

The lipid degradation indices showed lower values in the breast and leg meat from group E, both after 7 d of refrigeration and after one month of freezing. However, the decrease was significant only for the 7 d of refrigeration: the peroxide value of the breast meat sample was 7.73 % lower, compared to group C, and fat acidity of the leg meat was 7.21 % lower, compared to group C. Olteanu et al(47) reported similar effects, i.e., lower values of fat acidity after 7 d of refrigeration of the meat samples from Cobb 500, treated with 2 % grapeseed added to PUFA-high diet formulations, but the differences from the control group were not statistically significant. The available data from the literature include various information on the ability of grape meal to slow down the lipid peroxidation processes of broiler meat. Chamorro et al(27) studied the effect of the dietary grape pomace, and reported increasing oxidative stability of the broiler leg meat after 1 and 4 d of refrigeration, with the increasing dietary grape pomace by MDA decreasing levels. The obtained results showed significant lower differences (P<0.05) from 0.217 µg (C) to 0.112 µg (5 % GP) and 0.114 µg/g meat (10% GP) after 4 d of refrigeration. Kasapidou et al(48) concluded that the dietary grape pomace (2.5 % and 10 %) did not influence lipid oxidation of the broiler meat (breast and thigh) samples during 2 - 5 d of refrigeration. Also, it was found that antioxidants improved meat quality of Japanese quail and delayed oxidative rancidity(49). The results obtained in this study show that the grapeseed meal, a winery by-product with a lower price, can be used as natural and non-toxic antioxidant in broiler diets, replacing the synthetic antioxidants like butylated hydroxytoluene (BHT) and butylated hydroxyanisole (BHA)(45).

Conclusions and implications The inclusion of 3% grapeseed meal, as natural antioxidant, in Hubbard broiler diets high in polyunsaturated fatty acids did not affect broiler performance. The feeding quality of the broiler meat (breast and leg) was improved by the higher levels of total PUFA and omega – 3 PUFA, and by the lower cholesterol level. The health state of the broilers was also enhanced by the lower concentrations of cholesterol and triglyceride in the blood. These results highlight the antioxidant properties of the plant additive from the winery industry. The grapeseed meal added to broiler diets high in polyunsaturated fatty acids allowed the production of safe food of beneficial impact on human health.

Rev Mex Cienc Pecu 2022;13(1):43-63

Acknowledgements

This study was funded by Romanian Ministry of Research and Innovation through Program 1 – Development National Research-Development, Sub-program 1.2 – Institutional Performance - Projects funding excellence in R & D, Contract no. 17 PFE/ 17.10.2018 and the project PN 1641_02.04, Contract 24 N / 2016, NUCLEUS program. *** Commission Regulation (EC) No 152/2009 of 27 January 2009 laying down the methods of sampling and analysis for the official control of feed (Text with EEA relevance).

Literature cited: 1. Tougan PU, Dahouda M, Salifou CFA, Ahounou SGA, Kpodekon MT, Mensah GA, et al. Conversion of chicken muscle to meat and factors affecting chicken meat quality. A review. IJAAR 2013;3(8):1-20. 2. Fanatico AC, Pillai PB, Emmert JL, Gbur EE, Meullenet JF, Owens CM. Sensory attributes of slow-and fast-growing chicken genotypes raised indoors or with outdoor access. Poult Sci J 2007;86(11):2441–2449. 3. Napolitano F, Castellini C, Naspetti S, Piasentier E, Girolami A, Braghieri A. Consumer preference for chicken breast may be more affected by information on organic production than by product sensory properties. Poult Sci J 2013;92(3):820–826. 4. Attia YA, Al-Harthi MA, Korish MM, Shiboob MM. Fatty acid and cholesterol profiles, hypocholesterolemic, atherogenic, and thrombogenic indices of broiler meat in the retail market. Lipids Health Dis 2017;16:40:1-11. 5. Colussi G, Catena C, Novello M, Bertin N, Sechi LA. Impact of omega-3 polyunsaturated fatty acids on vascular function and blood pressure: relevance for cardiovascular outcomes. Nutr Metab Cardiovasc Dis 2017;27(3):191-200. 6. Tortosa-Caparrós E, Navas-Carrillo D, Marín F, Orenes-Piñero E. Anti-inflammatory effects of omega 3 and omega 6 polyunsaturated fatty acids in cardiovascular disease and metabolic syndrome. Crit Rev Food Sci Nutr 2017;57(16):3421-3429. 7. Shahidi F, Ambigaipalan P. Omega-3 polyunsaturated fatty acids and their health benefits. Annu Rev Food Sci Technol 2018;9:345-381.

Rev Mex Cienc Pecu 2022;13(1):43-63

8. Criste RD, Panaite TD, Ciurescu G, Ropota M, Rachieru D. Effects of moderate (5%) levels of linseed in layer diets. Arch C Zootech 2009;12(3):11-21. 9. Ahmad S, Ahsan-ul-Haq YM, Kamran Z, Sohail MU. Effect of feeding whole linseed as a source of polyunsaturated fatty acids on performance and egg characteristics of laying hens kept at high ambient temperature. Braz J Poultr Sci 2013;15(1):21-25. 10. Mridula D, Kaur D, Nagra SS, Barnwal P, Gurumayum S, Kumar SK. Growth performance and quality characteristics of flaxseed-fed broiler chicks. J Appl Anim Res 2015;43(3):345–351. 11. Panaite TD, Criste RD, Ropota M, Criste V, Vasile G, Olteanu M, et al. Determination of the feeding value of food industry by-products. Sci Papers Anim Sci Series 2016;66 (21):106-111. 12. Kumar F, Tyagi PK, Mir NA, Biswas AK, Dev K, Tyagi PK, et al. Optimizing of time duration of flaxseed meal feeding for optimum growth performance, carcass characteristics, and cost economics of broiler chicken meat production. Indian J Poult Sci 2018;53(1):44-48. 13. Leung H, Arrazola A, Torrey S, Kiarie E. Utilization of soy hulls, oat hulls, and flax meal fiber in adult broiler breeder hens. Poult Sci J 2018;97(4):1368-1372. 14. Pekel AY, Kim JI, Chapple C, Adeola O. Nutritional characteristics of camelina meal for 3-week-old broiler chickens. Poult Sci J 2015;94(3):371–378. 15. Woyengo TA, Patterson R, Slominski BA, Beltranena E, Zijlstra RT. Nutritive value of cold-pressed camelina cake with or without supplementation of multi-enzyme in broiler chicken. Poult Sci J 2016;95(10):2314–2321. 16. Thacker P, Widyaratne G. Effects of expeller pressed camelina meal and/or canola meal on digestibility, performance and fatty acid composition of broiler chickens fed wheat– soybean meal-based diets. Arch Anim Nutr 2012;66(5):402–415. 17. An BK, Jung JH, Oh ST, Kang CW, Lee KW, Lee SR. Effects of diets with graded levels of canola meal on the growth performance, meat qualities, relative organ weights, and blood characteristics of broiler chickens. Braz J Poultr Sci 2016;18(2):351-356.

Rev Mex Cienc Pecu 2022;13(1):43-63

18. Ashayerizadeh A, Dastar B, Shams Shargha M, Sadeghi Mahoonak AR, Zerehdaranc S. Effects of feeding fermented rapeseed meal on growth performance, gastrointestinal microflora population, blood metabolites, meat quality, and lipid metabolism in broiler chickens. Livestock Sci 2018;216:183-190. 19. Recoules E, Lessire M, Labas V, Duclos MJ, Combes-Soia L, Lardic L, et al. Digestion dynamics in broilers fed rapeseed meal. Sci Rep 2019;9:3052. 20. Ren Y, Perez TI, Zuidhof MJ, Renema RA, Wu J. Oxidative stability of omega-3 polyunsaturated fatty acids enriched eggs. J Agric Food Chem 2013;61(47):1159511602. 21. Radovanovic A, Radovanovic B, Jovancicevic B. Free radical scavenging and bacterial activities of southern Serbian red wines. Food Chem 2009;117(2):326–331. 22. Granato D, Castro IA, Katayama FCU. Assessing the association between phenolic compounds and the antioxidant activity of Brazilian red wines using chemometrics. LWT - Food Sci Technol 2009;43(10):1542–1549. 23. Deng Q, Penner MH, Zhao Y. Chemical composition of dietary fiber and polyphenols of five different varieties of wine grape pomace skins. Food Res Int 2011;44(9):2712– 2720. 24. Olteanu M, Criste RD, Panaite TD, Ropota M, Mitoi M, Varzaru I, et al. Study of the feeding value and antioxidant capacity of winery by-products, potential natural antioxidants for farm animal diet formulations. Arch Zootech 2014;17(2):55-69. 25. Sossidou EN, Kasapidou E, Dotas V, Ioannidis I. Mitlianga P. Effect of grape pomace supplementation on broiler performance and eating quality. The 64th Annual Meeting of the European Federation of Annim Scie 2013;26-30 august, Nantes, France. 26. Khodayari F, Habib AS. The Effect of Red Grape pomace on Performance. Lipid peroxidation (MDA) and some serum biochemical parameters in broiler. Adv Biomed Res 2014;5(3):82-87. 27. Chamorro S, Viveros A, Rebole A, Rica BD, Arija I, Brenes A. Influence of dietary enzyme addition on polyphenol utilization and meat oxidation of chicks fed grape pomace. J Food Res Int 2015;73:197-203.

Rev Mex Cienc Pecu 2022;13(1):43-63

28. Vlaicu PA, Panaite TD, Dragotoiu D, Ropota M, Bobe E, Olteanu M, et al. Feeding quality of the meat from broilers fed with dietary food industry by-products (flaxseed, rapeseeds and buckthorn meal, grape pomace). Sci Papers Series D Anim Sci 2017;LX: 123-130. 29. Turcu RP, Olteanu M, Criste RD, Ropota M, Panaite TD, Soica C, et al. The effect of using grape seeds meal as natural antioxidant in broiler diets enriched in fatty acids, on meat quality. J Hygienic Eng Design 2018;25:14-20. 30. Brenes A, Viveros A, Chamorro S, Arija I. Use of polyphenol-rich grape by-products in monogastric nutrition. A review. Anim Feed Sci Tech 2016; 211:1–17. 31. Chamorro S, Romero C, Brenes A, Sánchez-Patán F, Bartolomé B, Viveros A, Arijad I. Impact of a sustained consumption of grape extract on digestion, gut microbial metabolism and intestinal barrier in broiler chickens. Food Funct 2019;10:1444-1454. 32. HUBBARD CLASSIC – Broiler Management, www.hubbardbreeders.com. 33. Mihailović V, Matić S, Mišić D, Solujić S, Stanić S, Katanić J, et al. Chemical composition, antioxidant and antigenotoxic activities of different fractions of Gentiana asclepiadea L. roots extract. EXCLI J 2013;12:807-823. 34. Marxen K, Vanselow KH, Lippemeier S, Hintze R, Ruser A, Hansen UP. Determination of DPPH radical oxidation caused by methanolic extracts of some microalgal species by linear regression analysis of spectrophotometric measurements. Sensors 2007;7(10):2080-2095. 35. Dinh TTN, Thompson LD, Galyean ML, Brooks JC, Patterson KY, and Boylan LM. Cholesterol content and methods for cholesterol determination in meat and poultry. Compr Rev Food Sci 2011;10(5):269-289. 36. AOAC. Official methods of analysis. 99410: Cholesterol in food. 20th ed. Arlington, VA, USA: Association of Official Analytical Chemists. 2016. 37. GLM procedure of Minitab software, version 16, Minitab® Statistical Software. 38. Pintać D, Majkića T, Torović L, Orčića D, Beara I, Simina N, et al. Solvent selection for efficient extraction of bioactive compounds from grape pomace. Ind Crops Prod 2018;111:379–390.

Rev Mex Cienc Pecu 2022;13(1):43-63

39. Vermeer MA, Mulder TPJ, Molhuizen HOF. Theaflavins from black tea, especially theaflavin-3-gallate, reduce the incorporation of cholesterol into mixed micelles. J Agric Food Chem 2008;56(24):12031-12036. 40. Abu Hafsa SH, Ibrahim SA. Effect of dietary polyphenol-rich grape seed on growth performance, antioxidant capacity and ileal microflora in broiler chicks. J Anim Physiol Anim Nutr 2018;102(1):268–275. 41. Kamboh AA, Zhu WY. Effect of increasing levels of bioflavonoids in broiler feed on plasma anti-oxidative potential, lipid metabolites, and fatty acid composition of meat. Poult Sci J 2013;92(2):454–461. 42. Brenes A, Viveros A, Goni I, Centeno C, Sayago-Ayerdy SG, Arija I. Effect of grape pomace concentrate and vitamin E on digestibility of polyphenols and antioxidant activity in chickens. Poult Sci J 2008;87(2):307-316. 43. Goñi I, Brenes A, Centeno C, Viveros A, Saura-Calixto F, Rebole A, Arija I, Estevez R. Effect of dietary grape pomace and vitamin e on growth performance, nutrient digestibility and susceptibility to meat lipid oxidation in chickens. Poult Sci J 2007;86 (3):508–516. 44. Mazur-Kusnirek M, Antoszkiewicz Z, Lipiński K, Kaliniewicz J, Kotlarczyk S, Żukowski P. The effect of polyphenols and vitamin E on the antioxidant status and meat quality of broiler chickens exposed to high temperature. Arch Anim Nutr 2019;73(2):111-126. 45. Yong HI, Kim HJ, Jung S, Jayasena DD, Bae YS, Lee SK. et al. Effect of dietary supplementation of wild grape on the antioxidative potential of the breast and leg meat of broilers. Korean J Food Sci Anim Resour 2013;33(1):83-88. 46. Farahat MH, Abdallah FM, Ali HA, Hernandez-Santana A. Effect of dietary supplementation of grape seed extract on the growth performance, lipid profile, antioxidant status and immune response of broiler chickens. Animal 2017;11(5):771777. 47. Olteanu M, Criste RD, Panaite TD, Ropota M, Vlaicu PA, Turcu RP. Bioproductive parameters and fatty acids profile of the meat from broilers treated with flax meal and grape seeds meal. Sci Papers Anim Sci Biotech 2017;50(1):15-21.

Rev Mex Cienc Pecu 2022;13(1):43-63

48. Kasapidou E, Sossidou EN, Zdragas A, Papadaki C, Vafeas G, Mitlianga P. Effect of grape pomace supplementation on broiler meat quality characteristics. Europ Poult Sci 2016;80. doi:10.1399/eps.2016.135. 49. Attia YA, Abd El-Hamid E. Abd El-Hamid, Nagadi SA, Oliveira MC, Bovera F, Habiba HIA. Dietary distilled fatty acids and antioxidants improve nutrient use and performance of Japanese male quails. Anim Sci Pap Rep 2019;1(37):65-74.

https://doi.org/10.22319/rmcp.v13i1.5932 Article

Factors associated with indicators of calf rearing during the lactation period in small-scale dairy farms

Fernando Villaseñor González a Eliab Estrada Cortés a Lilia del Rocío Montes Oceguera b Héctor Raymundo Vera Ávila c Luis Javier Montiel Olguín d Héctor Jiménez Severiano d Mario Alfredo Espinosa Martínez d*

Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias (INIFAP). Campo Experimental Centro-Altos de Jalisco. Km 8, Carr. Libre Tepatitlán-Lagos de Moreno, Av. Biodiversidad No. 2470. Tepatitlán de Morelos, Jalisco, México. b

Universidad de Guadalajara-CU Altos. Jalisco, México.

Universidad Autónoma de Querétaro. Facultad de Ciencias Naturales. Querétaro, México.

INIFAP-Centro Nacional de Investigación Disiciplinaria en Fisiología y Mejoramiento Animal. Querétaro, México.

*Corresponding author: espinosa.mario@inifap.gob.mx

Abstract: The objective was to evaluate the impact of factors associated with the management of the mother and the quality of colostrum on the calf rearing during lactation, in the small-scale milk production system. In 13 dairy farms, information was obtained on body growth, colostrum feeding and information associated with the mother of 220 Holstein calves. The 64

Rev Mex Cienc Pecu 2022;13(1):64-81

variables of interest were: morbidity, concentration of immunoglobulins in colostrum (CIC; <110 mg/ml), serum protein concentration (SPC; <6.6 g/dL), daily weight gain (DWG; <0.650 kg/d) and daily height gain (DHG; <0.222 cm/d). The study factors were: body weight at birth (BWB; <42 kg), height at birth (HB; <82 cm), colostrum consumed on the first day (CCFD; <4 l), colostrum consumed on the first day/kg of LW (CFDLW), body condition at calving (BCC; <3), length of the dry period (LDP; >68 d), primiparous cows (PC) and cows without a challenge diet (CWCD). To determine the impact of the study factors on the events of interest, the odds ratio was obtained from multiple logistic regression analyses. The factors identified for morbidity were CCFD and PC (P<0.1). The factors for CIC were LDP and CWCD (P<0.1), while for DWG, it was CWCD (P<0.1). Finally, the factors for DHG were CWCD, BWB, HB and CFDLW (P<0.1). These results suggest that the mother’s nutrition during late gestation has an important impact on the health and body development of calves during lactation. Further studies should determine long-term effects. Key words: Colostrum, Calves, Morbidity, Growth.

Received: 29/01/2021 Accepted: 05/07/2021

Introduction The most critical phase for the survival of a dairy calf occurs in its first weeks of life, and the events that occur in this period can affect its productive and reproductive performance in the future(1,2,3). In highly technified and small-scale production systems, the highest morbidity and mortality rates in calves occur between birth and weaning, mainly due to problems of diarrhea and pneumonia(3,4,5). Studies generated in the technified system report mortality and morbidity rates of up to 6 % and 38 %, respectively, during the lactation stage(6,7,8). Some risk factors associated with this mortality and morbidity in calves are the low quality of colostrum(9), a late administration of colostrum(10), dystocia and body condition of the mother prior to calving(11), low weight at birth, a low concentration of IgG in serum, diseases during the period prior to weaning and a low consumption of fat in the liquid diet(12). However, in the small-scale milk production system in Mexico, the production and management conditions are different from those of the technified systems; there is less efficiency in the rearing process(4), milk production levels are lower(13), nutritional management is poor(14) and reproductive performance is below optimal(15). These differences allow questioning whether the risk factors reported in the technified system impact in the same way the indicators of

Rev Mex Cienc Pecu 2022;13(1):64-81

rearing in the small-scale production system. The determination of these factors in this last system would allow implementing or design specific strategies for stables under this production system, in order to improve the rearing of calves. Therefore, the objective of this study was to identify factors associated with indicators of calf rearing in small-scale milk production systems. The working hypothesis is that there are individual risk factors of calves, mother and colostrum associated with the performance of calves during the lactation stage in this production system.

Material and methods Location

The study was conducted in the Los Altos Sur region of Jalisco (20º 52’ N), in the municipalities of Valle de Guadalupe, San Ignacio Cerro Gordo and Tepatitlán de Morelos. In this region, there is a temperate subhumid climate, with an average annual temperature of 17.8 ºC and an average annual rainfall of 817 mm(16).

Information capture

During a nine-month period, information was obtained from 220 Holstein calves from 13 milk production farms with characteristics of the family system of the Los Altos region of Jalisco. The selection of stables was by a convenience sample with the following selection criteria: labor as the main operating support of the production unit, milk production as the primary target of the stable, a range between 10 and 100 cows in production and mediumlow levels of technification. With these criteria, the farms met the characteristics of family stables in the region(17,18). With the help of a veterinary zootechnician, with years of experience working in clinical practice in the region, and familiar from his participation in previous studies with the collection of samples, measurements and capture of necessary information, the calves were monitored from birth to weaning (71.6 ± 1.1 d), obtaining different growth indicators: weight at birth, weight at weaning, height at birth and height at weaning. From these values, the daily weight gain (DWG) at weaning and the daily height gain (DHG) at weaning were estimated. To estimate body weight, a tape measure specific to Holstein calves (Dairy Calf Tape, Coburn Co., Whitewater WI) was used, measuring their thoracic circumference behind the scapulae, while to record height at the withers, a somatometric ruler (Nasco, Whitewater WI) was used.

Rev Mex Cienc Pecu 2022;13(1):64-81

On the other hand, information was recorded on events associated with the calving of the mothers of the calves, length of the dry period, body condition at calving, number of calving and whether the mother received a challenge diet prior to calving (they received concentrate in the 2 to 3 wk prior to calving, regardless of its nutritional composition). To estimate the body condition at calving, a scale of 1 to 5 was considered, where a value of 1 corresponds to an animal in a state of wasting and a value of 5 to an obese animal(19). Additionally, the following were recorded: the consumption of colostrum by the calf at the first intake and on the first day, the time elapsed from birth to the first intake of colostrum, the quality of colostrum (mg/ml) and the amount of serum protein (g/dL) in the calves at 48 h after birth. To determine the quality of the first postpartum colostrum, a sample of approximately 250 mL was collected and placed in a bain-marie at a temperature of 22 ºC; once this temperature was reached, the colostrum was deposited in a specimen and the amount of immunoglobulins present (mg/mL) was read by means of a colostrometer (Biogenics©, Mapleton OR). The concentration of total serum protein in the calf, as an indicator of passive immunity transfer failure, was determined in a blood sample obtained from the jugular vein at 48 h of birth; the sample was centrifuged at 2,500 rpm for 15 min and the serum obtained was kept in freezing (-20 ºC) until its analysis by refractometry. To do this, by means of a Pasteur pipette, a drop of the serum was taken, which was kept at room temperature (22 ºC) and deposited in the prism of a portable refractometer (Danoplus, Mod. RETK-70), with automatic temperature compensation and a reading range of 0-12 g/dL, trying to completely cover the surface and avoiding the formation of air bubbles that could distort the reading of the results. The refractometer was focused on a light source and the reading obtained was recorded. Prior to use, the refractometer was calibrated using distilled water and adjusting the calibrator screw, according to the manufacturer’s instructions.

Events of interest

The selected events of interest were morbidity (sick calf at least once in the period from birth to weaning). The calves were monitored for signs of illness by the participating technician, as well as by information provided by the producer. Among the signs considered were lameness, difficulty moving, prostration, loss of appetite, dehydration, fever, cough, nasal or ocular discharges, lethargy and an abnormal consistency in the feces, without considering the length of these signs, nor their severity. Additionally, the remaining events of interest were the concentration of immunoglobulins in the first colostrum less than 110 mg/mL, serum protein concentration less than 6.6 g/dL, DWG less than 0.650 kg/d and DHG less than 0.222

Rev Mex Cienc Pecu 2022;13(1):64-81

cm/d. The limit values for the different events of interest were established based on the upper quartile of their distribution(15), except for daily weight gain at weaning.

Study factors

For the morbidity event, the factors considered were: colostrum consumed on the first day less than 4 l vs greater than or equal to 4 l, colostrum consumed/kg of live weight (LW) on the first day <0.105 vs >0.105 kg, body weight at birth less than 42 kg vs greater than or equal to 42 kg, height at birth less than 82 cm vs greater than or equal to 82 cm, body condition of the mother at calving less than 3 vs greater than or equal to 3, number of calving (first calving vs more than one calving) and offer of a challenge diet to the mother (NO vs YES). For the event serum protein concentration less than 6.6 g/dL, the factors analyzed were: colostrum consumed on the first day, colostrum consumed/kg of LW on the first day, weight at birth, height at birth, body condition of the mother at calving, number of calving, length of the dry period less than 68 d vs greater than or equal to 68 d and offer of a challenge diet to the mother. For the event DWG less than 0.650 kg/d and DHG <0.222 cm/d, the factors analyzed were: colostrum consumed on the first day, colostrum consumed/kg of LW on the first day, weight at birth, height at birth, body condition of the mother at calving, number of calving and offer of a challenge diet to the mother. The limit values for the different study factors were established based on the upper quartile of their distribution(15).

Statistical analysis

Statistical analyses were performed using the SAS 9.3 statistical package (SAS Institute Inc., Cary, NC). Initially, descriptive values for the variables considered in the study and their frequency were obtained. To build the multiple models, first, simple logistic regression models between each of the independent variables (study factors) and each event of interest were used, with the LOGISTIC procedure. Factors with significance P≤0.35 were keep to design the multiple models(20). Subsequently, simple correlation analyses were performed between study factors to prevent collinearity in multiple models with the FREQ procedure. When the confidence limits of the correlation coefficients did not include 0 (indicating that there is a positive or negative association), both factors were not part of the same model. To obtain the models with the greatest parsimony, the backward option of the LOGISTIC procedure was used to eliminate from the model the study factors that were not significant at a value of P>0.1(20). Finally, the odds ratios (OR) were obtained from logistic regression analyses, as a measure of association between the events of interest and the study factors(21).

Rev Mex Cienc Pecu 2022;13(1):64-81

Results Performance indicators

The weight and height of the calves at birth slightly exceeded 40 kg and 80 cm, respectively, with a daily weight gain at weaning of 503 g (Table 1). The liters of colostrum consumed in the first intake and the first day were 2.36 and 4.09, respectively, with more than 4 h, on average, elapsing to perform the first intake of colostrum. The immunoglobulin content in colostrum corresponded to a good quality, although with a wide range of values; the latter situation was similar to that observed in serum protein content and in the length of the dry period. Body condition at calving averaged 2.8. Table 1: Descriptive statistics of variables associated with the rearing and peripartum management of Holstein cows Lower Upper Variable n Average±SD Minimum Maximum quartile quartile Body weight at 207 40.39±2.99 29.00 39.00 42.00 52.00 birth, kg Weight gain at 220 0.503±0.23 0.001 0.397 0.644 1.027 weaning, kg/d Height at birth, cm 207 80.28±3.38 66.00 78.00 82.00 89.00 Height gain at 220 0.168±0.08 0.002 0.122 0.222 0.351 weaning, cm/d Colostrum 115 2.36±0.93 0.50 2.0 3.0 5.00 consumed in the first intake (l) Colostrum 207 4.09±0.51 1.00 4.00 4.00 5.50 consumed on the first day (l) Colostrum 115 0.058±0.002 0.012 0.048 0.071 0.125 consumed/kg LW, first intake (kg) Colostrum 213 0.102±0.00 0.026 0.095 0.105 0.139 consumed/kg LW, first day (kg) Time to first intake 119 4.24±3.31 0.35 2.0 6.0 18.00 of colostrum, h Immunoglobulins in 133 81.56±33.74 10.00 85 110 165.00 colostrum, mg/ml 69

Rev Mex Cienc Pecu 2022;13(1):64-81

Serum protein, g/dL Body condition at calving Length of the dry period, days Number of calvings

141 207

5.64±1.32 2.80±0.40

1.00 2.00

4.95 2.50

6.60 3.00

9.00 4.00

132

66.54±20.14

31.00

179.00

1.71±0.45

215

SD= Standard deviation; LW= live weight.

Except for morbidity (29.9 %), the rest of the events had a prevalence of more than 70 % (Table 2). Fifty-three percent of the sick calves were associated with the occurrence of diarrhea, while 24.2 % were associated with respiratory problems suggestive of pneumonia and 22.7 % showed some other sign of illness or alteration. Of the factors under study, consumption of colostrum on the first day less than 4 L was the one with the lowest prevalence (4.3 %), while body weight at birth less than 42 kg, height at birth less than 82 cm, body condition at calving less than 3 and consumption of colostrum on the first day <105 kg/kg LW had prevalences greater than 60 %. Table 2: Prevalences of events of interest and potential risk factors for calf rearing, included in logistic regression analyses Variable % Events of interest: Morbidity 29.95 Concentration of immunoglobulins in colostrum <110 mg/mL 74.36 Serum protein concentration <6.6 g/dL 75.00 Weight gain at weaning <0.650 kg/d 74.88 Height gain at weaning <0.222 cm/d 74.40 Study factors: Body weight at birth <42 kg 69.08 Height at birth <82 cm 63.29 Consumption of colostrum on the first day <4 l 4.35 Colostrum consumed /kg LW, first day (kg) 65.70 Body condition at calving <3 63.29 Length of the dry period ≥68 d 26.92 First calving cows 28.99 Cows without a challenge diet 51.56 LW= live weight.

Rev Mex Cienc Pecu 2022;13(1):64-81

Association of study factors on events of interest

The simple logistic regression analyses (Table 3) show that for the morbidity event, the four study factors with a P<0.35 that were included in the multiple analyses were colostrum consumed on the first day (P=0.025), colostrum consumed on the first day per kg of live weight (P=0.174), number of calving (P=0.008) and challenge diet (P=0.223). For the event concentration of immunoglobulin less than 110 mg/ml, the only study factors considered were the length of the dry period (P=0.063) and the challenge diet (P=0.005). For serum protein concentration less than 6.6 g/dL, as an indicator of passive immunity transfer failure, the only factor considered was weight at birth (P=0.178). For weight gain at weaning less than 0.650 kg/day, three factors were considered, the number of calving (P=0.280), the challenge diet (P=0.004) and the colostrum consumed on the first day per kg of LW (P=0.340), while the factors colostrum consumed on the first day (P=0.329), colostrum consumed on the first day per kg of LW (P=0.004), weight at birth (P=0.067), height at birth (P=0.001), number of calving (P=0.105) and challenge diet (P=0.008) were considered for the event height gain at weaning less than 0.222 cm/d. Table 3: Factors associated with some events. Analysis with simple models Event of interest Risk factor P (OR) Morbidity

Colostrum consumed on the first day (<4 vs ≥4 l) Colostrum consumed/kg LW, first day (<0.105 vs ≥0.105) Number of calving (primiparous vs multiparous) Challenge diet (without diet vs with diet) Length of the dry period (≥68 vs <68 Immunoglobulin days) concentration <110 mg/ml Challenge diet (without diet vs with diet) Serum protein concentration Weight at birth (<42 vs ≥42 kg) <6.6 g/dL Weight gain at weaning Number of calving (primiparous vs <0.650 kg/d multiparous) Challenge diet (without diet vs with diet) Colostrum consumed/kg LW, first day (<0.105 vs ≥0.105)

0.025 (5.071) 0.174 (1.571) 0.008 (2.358) 0.223 (0.675) 0.063 (4.385) 0.005 (5.665) 0.178 (1.727) 0.280 (1.495) 0.004 (0.372)

0.340 (1.395)

Rev Mex Cienc Pecu 2022;13(1):64-81

Height gain at weaning Colostrum consumed on the first day (<4 <0.222 cm/d vs ≥4 l) Colostrum consumed/kg LW, first day (<0.105 vs ≥0.105) Weight at birth (<42 vs ≥42 kg) Height at birth (<82 vs ≥82 cm) Number of calving (primiparous vs multiparous Challenge diet (without diet vs with diet)

0.329 (2.849) 0.004 (0.385) 0.067 (0.499) 0.001 (0.266) 0.105 (0.579) 0.008 (0.400)

P= probability value; OR= odds ratio; LW= live weight.

The significant effects of the multiple models for each event of interest, shown in Table 4, indicate that, for morbidity, the two factors that remained were colostrum consumption for a first model (P=0.023) and the number of calving for the second model (P=0.010). For the concentration of immunoglobulins less than 110 mg/ml, the factors that remained were the length of the dry period (P=0.062) and the challenge diet (P=0.005). For weight gain at weaning less than 0.650 kg/d, only the challenge diet remained (P=0.004). For the height gain at weaning less than 0.222 cm/d, the factors that remained in four models were the challenge diet for the first of them (P=0.008), weight at birth (P=0.055) and the challenge diet for the second (P=0.005), the height at birth (P=0.005) and the challenge diet (P=0.017) for the third model and the challenge diet and the consumption of colostrum on the first day/kg of LW (P=0.003). Table 4: Non-collinear factors identified by multivariate analysis for some events Variable Model Factor OR (95% CI) P Morbidity

Immunoglobulin 1 concentration <110 mg/mL

Consumption of colostrum on the first day <4l >4l Number of calving Primiparous Multiparous Length of the dry period ≥ 68 < 68 Challenge diet Without diet With diet

5.224 (1.257-21.711) Reference

0.023

2.395 (1.231-4.660) Reference

0.010

0.214 (0.043-1.079) Reference

0.062

0.170 (0.049-0.588) Reference

0.005

Rev Mex Cienc Pecu 2022;13(1):64-81

Weight gain at weaning <0.650 kg/d

3 Height gain at weaning <0.222 cm/d

Challenge diet Without diet 0.372 (0.187-0.736) With diet Reference Challenge diet Without diet 0.400 (0.204-0.785) With diet Reference Weight at birth < 42 kg 0.469 (0.216-1.017) ≥ 42 kg Reference Challenge diet Without diet 0.377 (0.190-0.747) With diet Reference Height at birth < 82 cm 0.253 (0.110-0.585) ≥ 82 cm Reference Challenge diet Without diet 0.430 (0.214-0.860) With diet Reference Challenge diet Without diet 0.368 (0.183-0.739) With diet Reference Colostrum consumed/kg LW on first day <0.105 2.882 (1.449-5.735) ≥0.105 Reference

0.004

0.008

0.055

0.005

0.001

0.017

0.005

0.003

OR= odds ratio; CI= confidence interval; P= probability value.

Discussion The average weight and height of calves at birth were similar to those described for this production system(4), although slightly lower than those published for calves from other systems(8,22,23). On the other hand, the average observed weight gain at weaning was lower than recommended(24) and showed results contrasting with that published by other authors(8,23,25). This could be due, at least in part, to the different management conditions of the farms, length of lactation periods and type of feeding (substitutes vs milk), among others.

Rev Mex Cienc Pecu 2022;13(1):64-81

The average consumption of colostrum in the first intake and the total of the first day were lower than that described by other authors(8,23). Even considering the consumption of colostrum per kilo of live weight in the first intake, it was not possible to cover the 10 to 12 % recommended for the first hours(26), achieving it only after the first day. A high percentage of calves consumed less than 4 L of colostrum on the first day, while the time elapsed to the first intake of colostrum is greater than that recorded in other studies(8,27). Despite the deficiencies observed in the consumption of colostrum, it seems that the protection achieved by calves, measured in total serum protein, was adequate(27), perhaps as a result of the high quality of the colostrum offered(24), which is higher than that observed in herds of a larger size and technification(23). In the latter, it has been described that only 23 % of colostrum meet quality standards(9). It is likely that the lower milk productions of cows in the small-scale system(13) will allow the concentration of immunoglobulins in colostrum to be higher by avoiding their dilution(28). Thus, although the first intake of colostrum in calves under the small-scale milk production system could be lower than suggested(26), its quality would guarantee effective protection. However, the wide variation in results observed in both the concentration of immunoglobulins in colostrum and the amount of serum protein should be considered. The low body condition of the cows at calving and the high percentage that had with less than 3 points of body condition may be the result of poor feeding conditions that exist in the herds(14,15,29), which is reflected in the low percentage of cows that received a challenge diet. For the morbidity event, the multiple analysis indicated that those calves that consumed less than 4 L of colostrum on the first day were 5.2 times more likely to get sick compared to those that consumed higher amounts. In this way, this should be taken into consideration, even if the average total serum protein readings show good results. Additionally, the greater probability of getting sick in calves that were daughters of first calving mothers vs multiparous mothers, similar to that described by other authors(30), may be due to the fact that the colostrum of the former contains less immunoglobulins or its quality may be lower than that of cows with a greater number of calvings(31,32,33). Due to the high morbidity rates recorded for this small-scale system, special attention should be paid to the feeding offered to the calf on the first day and the best housing conditions should be sought, especially when the calves come from first calving mothers. Considering that a low consumption of colostrum could put the health of a calf at risk, ensuring its quality is also a priority. Not consuming a challenge diet decreased the likelihood of having a colostrum of lower quality (<110 mg/ml), thus showing a protective effect. Although the offer of concentrate prior to calving, which coincides with the formation of colostrum(26), could favor a greater initial production, this could cause a dilution in the content of immunoglobulins. This is somewhat similar to what has been observed in the sheep species(34), where restricted sheep had a lower volume of colostrum, but a higher content of 74

Rev Mex Cienc Pecu 2022;13(1):64-81

immunoglobulins, compared to sheep consuming 100 % of their nutritional requirements. However, no differences in colostrum quality have been observed due to the consumption of concentrate or higher consumption of metabolizable energy prior to cow calving(35,36). The second factor associated with the concentration of immunoglobulins that remained in the multivariate analysis was the dry period; at a longer length of this period, the probability of a low concentration of immunoglobulins in colostrum decreased, compared to periods of less than 68 d. There is little comparable information available; although it has been described that a dry period of 40 days in cows showed no difference in the concentration of immunoglobulins in colostrum, compared to 60 d(37). It is likely that a longer dry period, which reached up to 179 days for the animals in this study, allows their greater body recovery and this favors the concentration of immunoglobulins in colostrum; this should be analyzed in subsequent studies. Not offering a challenge diet to the mother decreased the likelihood that the calf would have low weight and height gain at weaning (i.e., it had a protective effect). In this regard, no differences were observed in the weight or weight gain of calves whose mothers received or not concentrate, prior to calving(35). A limitation of this study is not having recorded the amount and nutritional composition of the challenge diet offered to the cows, which could give greater guidance on the results obtained. Some nutritional alterations during the in-utero life of the calves could affect their performance from birth(38), so it is likely that less nutrition of the cow during the final phase of gestation causes compensatory mechanisms in the calf that favor its initial growth after birth, as has been observed in other phases of growth(39). Only a few studies have described the favorable effects that nutrition in late gestation can have on the growth of calves(40), which may be partly due to the fact that most studies are generally limited to obtaining indicators in the calves at birth(41), without evaluating their subsequent performance. Additionally, it was observed in one of the models that consuming colostrum in an amount less than 0.105 kg/kg of LW on the first day increased almost 3 times the risk of having a lower growth in the calves. It is likely that components of colostrum, such as hormones, growth factors and nutrients, which may be in greater quantity in the first colostrum, favor the growth of calves(26). Unfortunately, height and its gain at weaning are not included in studies as often as body weight. Although there is a greater weight gain at weaning in calves with a higher consumption of colostrum(42), in another study, the same was not observed for height at weaning(43). However, the design considered the use of colostrum of good quality and in appropriate quantities, even for the group with the lowest consumption of colostrum (10 vs 15 and 20 % of body weight), which may decrease the possibility of observing differences between groups.

Rev Mex Cienc Pecu 2022;13(1):64-81

Conclusions and implications In conclusion, the factors associated with the rearing of calves identified were colostrum consumed on the first day, primiparous cows, length of the dry period, cows without a challenge diet, body weight at birth and height at birth. The factor with the greatest impact on the performance of calves during lactation was cows without a challenge diet, for positively impacting the events of interest concentration of immunoglobulins in colostrum, daily weight gain and daily height gain at weaning. This result is interesting because of the possible practical implications that could arise, for example, recommending not to provide a challenge diet to cows under this production system. However, complementary studies are needed to analyze the long-term effect on calf performance beyond the lactation stage and the productive and health impacts of the mother.

Acknowledgements

Study financed with fiscal funds allocated to the project SIGI 23335132549 entitled “Nutritional supplementation in critical periods of calf breeding, to improve their productive performance in family/semitechnified milk production systems” of the National Institute of Forestry, Agricultural and Livestock Research.

Conflict of interest

The authors declare that they do not have no financial or personal conflict of interest associated with this study.

Literature cited: 1. Ghoraishy SH, Rokouei M. Impact of birth weight of Iranian Holstein calves on their future milk production and reproductive traits. J Livest Sci Technol 2013;1:41-46.

Rev Mex Cienc Pecu 2022;13(1):64-81

2. Raboisson D, Delor F, Cahuzac E, Gendre C, Sans P, Allaire G. Perinatal, neonatal, and rearing period mortality of dairy calves and replacement heifers in France. J Dairy Sci 2013;96:1-12. 3. Aghakeshmiri F, Azizzadeh M, Farzaneh N, Gorjidooz M. Effects of neonatal diarrhea and other conditions on subsequent productive and reproductive performance of heifer calves. Vet Res Commun 2017;41:107-112. 4. Espinosa MMA, Estrada CE, Barretero HR, Rodríguez HE, Escobar RMC. Crianza de becerras para sistemas familiares/semitecnificados de producción de leche. Folleto para productores No. 1, 1ª ed. Ajuchitlán, Querétaro, México. INIFAP CENID Fisiología y Mejoramiento Animal. 2014. 5. Johnson KF, Chancellor N, Burn CC, Wathes DC. Prospective cohort study to assess rates of contagious disease in pre-weaned UK dairy heifers: management practices, passive transfer of immunity and associated calf health. Vet Rec 2017;4(1):e000226. 6. Lora I, Gottardo F, Contiero B, Dall AB, Bonfanti L, Stefani A, Barberio A. Association between passive immunity and health status of dairy calves under 30 days of age. Prev Vet Med 2018;152:12-15. 7. Svensson C, Linder A, Olsson SO. Mortality in Swedish dairy calves and replacement heifers. J Dairy Sci 2006;89:4769-4777. 8. Urie NJ, Lombard JE, Shivley CB, Kopral CA, Adams AE, Earleywine TJ, et al. Preweaned heifer management on US dairy operations: Part I. Descriptive characteristics of preweaned heifer raising practices. J Dairy Sci 2018;101(9):1-17. 9. Phipps AJ, Beggs DS, Murray AJ, Mansell PD, Stevenson MA, Pymant MF. Survey of bovine colostrum quality and hygiene on northern Victorian dairy farms. J Dairy Sci 2016;99:8981-8990. 10. Zitzmann R, Pfeiffer M, Söllner-Donat S, Donat K. Risk factors for calf mortality influence the occurrence of antibodies against the pathogens of enzootic bronchopneumonia. Tierarztl Prax Ausq G Grosstiere Nutzliere 2019;47(3):151-165. Abstract. 11. Mee JF, Grant J, Sánchez-Miguel C, Doherty M. Pre-calving and calving management practices in dairy herds with a history of high or low bovine perinatal mortality. Animals 2013;3(3):866-881.

Rev Mex Cienc Pecu 2022;13(1):64-81

12. Urie NJ, Lombard JE, Shivley CB, Kopral CA, Adams AE, Earleywine TJ, Olson JD, Garry FB. Preweaned heifer management on US dairy operations: Part V. Factors associated with morbidity and mortality in preweaned dairy heifer calves. J Dairy Sci 2018;101:1-16. 13. Sánchez GRA, Zegbe DJA, Gutiérrez BH. Tipificación de un Sistema integral de lechería familiar en Zacatecas, México. Rev Mex Cienc Pecu 2015;6(3):349-359. 14. Vera AHR, Hernández AL, Espinosa GJA, Ortega RL, Díaz AE, Román PH, et al. Producción de leche de bovino en el sistema familiar. Libro técnico. 1a ed. México, INIFAP CIRGOC;2009. 15. Montiel-Olguín LJ, Estrada-Cortés E, Espinosa-Martínez MA, Mellado BM, HernándezVélez JO, Martínez-Trejo G, et al. Risk factors associated with reproductive performance in small-scale dairy farms in Mexico. Trop Anim Health Prod 2019;51(1):229-236. 16. IIEG. Instituto de Información Estadística y Geográfica de Jalisco. Altos Sur Diagnóstico de la Región Agosto 2019. Gobierno de Jalisco. 2019. 17. Martínez-González JC, Castillo-Rodríguez SP, Villalobos-Cortés A, HernándezMeléndez J. Sistemas de producción con ruminates en México. Cienc Agropec 2017;26:132-152. 18. Montiel-Olguín LJ, Ruíz-López FJ, Mellado M, Estrada-Cortés E, Gómez-Rosales S, Elton-Puente JE, Vera-Avila HR. Body condition score and milk production on conception rate of cows under a small-scale dairy system. Anim 2019;9(10):800. 19. Edmonson AJ, Lean J, Weaver LF, Farver T, Webster G. A body condition scoring chart for Holstein dairy cows. J Dairy Sci 1989;72:68-78. 20. Potter TJ, Guitian J, Fishwick J, Gordon PJ, Sheldon IM. Risk factors for clinical endometritis in postpartum dairy cattle. Theriogenology 2010;74(1):127–134. 21. Szumilas M. Explaining odds ratios. J Can Acad Adolesc Psychiatry 2010;19(3):227229. 22. Bazeley KJ, Barrett DC, Williams PD, Reyher KK. Measuring the growth rate of UK dairy heifers to improve future productivity. The Vet J 2016;212:9-14.

Rev Mex Cienc Pecu 2022;13(1):64-81

23. Shivley CB, Lombard JE, Urie NJ, Haines DM, Sargent R, Kopral CA, et al. Preweaned heifer management on US dairy operations: Part II. Factors associated with colostrum quality and passive transfer status of dairy heifer calves. J Dairy Sci 2018;101:1-14. 24. Akins M. Dairy heifer development and nutrition management. Vet Clin Food Anim Pract 2016;32:303-317. 25. Davis Rincker LE, VandeHaar MJ, Wolf CA, Liesman JS, Chapin LT, Weber Nielsen MS. Effect of intensified feeding of heifer calves on growth, pubertal age, calving age, milk yield, and economics. J Dairy Sci 2011;94:3554-3567. 26 Godden SM, Lombard JE, Woolums AR. Colostrum management for dairy calves. Vet Clin North Am Food Anim Pract 2019;35:535-556. 27. Vogels Z, Chuck GM, Morton JM. Failure of transfer of passive immunity and agammaglobulinaemia in calves in south-west Victorian dairy herds: prevalence and risk factors. Aust Vet J 2013;91:150-158. 28. Elizondo-Salazar JA. Alimentación y manejo del calostro en el ganado de leche. Agronomía mesoamericana 2007;18(2):271-281. 29. Estrada CE, Espinosa MMA, Barretero HR, Rodríguez HE, Escobar RMC. Manejo del ganado bovino adulto en establos familiares/semitecnificados de producción de leche. Folleto para productores Num. 1, 1ª ed. Tepatitlán de Morelos, Jalisco, México. INIFAPCampo Experimental Centro Altos de Jalisco. 2014. 30. Swali A, Wathes DC. Influence of primiparity on size at birth, growth, the somatotrophic axis and fertility in dairy heifers. Anim Reprod Sci 2007;102(1-2):122-136. 31. Dunn A, Ashfield A, Earley B, Welsh M, Gordon A, Morrison SJ. Evaluation of factors associated with immunoglobulin G, fat, protein, and lactose concentrations in bovine colostrum and colostrum management practices in grassland-based dairy systems in Northern Ireland. J Dairy Sci 2017;100(3):2068-2079. 32. Reschke C, Schelling E, Michel A, Remy-Wohlfender F, Meylan M. Factors associated with colostrum quality and effects on serum gamma globulin concentrations of calves in swiss dairy herds. J Vet Intern Med 2017;31:1563-1571.

Rev Mex Cienc Pecu 2022;13(1):64-81

33. Sutter F, Borchardt S, Schuenemann GM, Rauch E, Erhard M, Heuwiesser W. Evaluation of 2 different treatment procedures after calving to improve harvesting of high-quantity and high-quality colostrum. J Dairy Sci 2019;102(10):9370-9381. 34. Swanson TJ, Hammer CJ, Luther JS, Calson DB, Taylor JB, Caton JS et al. Effects of gestational plane of nutrition and selenium supplementation on mammary development and colostrum quality in pregnant ewe lambs. J Anim Sci 2008;86:2415-2423. 35. Dunn A, Ashfield A, Earley B, Welsh M, Gordon A, McGee M, Morrison SJ. Effect of concentrate supplementation during the dry period on colostrum quality and effect of colostrum feeding regimen on passive transfer of immunity, calf health, and performance. J Dairy Sci 2017;100:1-14. 36. Hare KS, Wood KM, Fitzsimmons C, Penner B. Oversupplying metabolizable protein in late gestation for beef cattle: effects on postpartum ruminal fermentation, blood metabolites, skeletal muscle catabolism, colostrum composition, milk yield composition, and calf growth performance. J Anim Sci 2019;97:437-455. 37. Shoshani E, Rozen S, Doekes JJ. Effect of a short dry period on milk yield and content, colostrum quality, fertility, and metabolic status of Holstein cows. J Dairy Sci 2014;97:1-14. 38. Van Eetvelde M, Opsomer G. Innovative look at dairy heifer rearing: effect of prenatal and post-natal environment on later performance. Reprod Dom Anim 2017;52(Suppl. 3):30-36. 39. Choi YJ, Han IK, Woo JH, Lee HJ, Jang K, Myung KH, Kim YS. Compensatory growth in dairy heifers: the effect of a compensatory growth pattern on growth rate and lactation performance. J Dairy Sci 1997;80:519-524. 40. Larson DM, Martin JL, Adams DC, Funston RN. Winter grazing system and supplementation during late gestation influence performance of beef cows and steer progeny. J Anim Sci 2009;87(3):1147-1155. 41. Gao F, Liu YC, Zhang ZH, Zhang CZ, Su HW, Li SL. Effect of prepartum maternal energy density on the growth performance, immunity, and antioxidation capability of neonatal calves. J Dairy Sci 2012;95(8):4510-4518.

Rev Mex Cienc Pecu 2022;13(1):64-81

42. Abuelo A, Cullens F, Hanes A, Brester JL. Impact of 2 versus 1 colostrum meals on failure of passive immunity, pre-weaning morbidity and mortality, and performance of dairy calves in a large dairy herd. Anim 2021;11(3):782. 43. Moura SFL, Miqueo E, da Silva MD, Manzoni TT, Brito RN, Vieira SMS, Machado BCM. Thermoregulatory responses and performance of dairy calves fed different amounts of colostrum. Anim 2021;11:703.

https://doi.org/10.22319/rmcp.v13i1.5939 Article

Economic and productive impact of an herbal mixture with choline derivatives on rabbit production

Minerva Jaurez-Espinosa a Pedro Abel Hernández-García b Amada Isabel Osorio-Terán b Germán David Mendoza-Martínez c Juan José Ojeda-Carrasco b María Zamira Tapia-Rodríguez b Enrique Espinosa-Ayala b*

Universidad Autónoma del Estado de México. Centro Universitario UAEM Amecameca. Doctorado en Ciencias Agropecuarias y Recursos Naturales. México. b

Universidad Autónoma del Estado de México. Centro Universitario UAEM Amecameca, km 2.5 carretera Amecameca - Ayapango, 56900, Amecameca, Estado de México. México. c

Universidad Autónoma Metropolitana–Xochimilco. Departamento Producción Agrícola y Animal. Cd. de México, México.

* Corresponding author: enresaya1@hotmail.com; eespinosaa@uaemex.mx

Abstract: The use, as well as the productive and economic effect of herbal compounds on rabbit production has been little studied, for this reason, the objective was to evaluate the effect of a polyherbal mixture rich in choline conjugates based on Trachyspermum ammi, Achyranthes aspera, Azadirachta indica and Citrullus colocynthis, on the economic and productive response of meat rabbits. For this, 40 New Zealand X California rabbits (30-d old) were used,

Rev Mex Cienc Pecu 2022;13(1):82-96

which were randomized into five groups (0.0, 200, 400, 600 and 800 mg kg-1 of polyherbal DM, BioCholina®), the experiment lasted 34 days. The productive response, meat quality and economic indicators were evaluated. A completely randomized design with an arrangement of orthogonal polynomials was used to determine linear and quadratic effects, with a significance level of P<0.05. The results in terms of production parameters were similar between treatments, except for feed consumption (P=0.006) and feed conversion (P=0.005) with a linear effect at higher concentration of the polyherbal. The inclusion of the polyherbal increased pH in meat (linear, P=0.004) and coordinate b* (linear, P=0.009), it was observed that the treatment with 200 mg showed the best economic indicators, improving the income-expense ratio by 9 percentage units. It is concluded that the addition of polyherbal mixtures based on natural choline conjugate did not improve the productive variables, however, a favorable economic trend is marked with the addition of 200 mg kg-1 of DM. Key words: Economic analysis, Choline conjugates, Phytoadditives, Nutraceuticals, Meat quality.

Received: 10/02/2021 Accepted: 26/04/2021

Introduction Animal production presents productive and economic challenges that must be addressed through methods and techniques that do not represent health risks, which is why the use of natural additives considered phytobiotic (phytogenic) that can be included in the diet of animals in production(1) is proposed, with the intention of improving productive yield, carcass quality, and that they generate acceptable economic indicators(2). These additives include herbs, essential oils and extracts(3), which contain bioactive compounds (secondary metabolites) such as alkaloids, phenols, terpenoids, steroids, tannins, saponins, phenolic compounds (flavonoids, flavones, isoflavones), anthocyanins, lignans, stilbenes, coumarins, carotenoids (tetraterpenes), quinones, among others(4). Other metabolites exert various functions such as antimicrobial, antiparasitic, antioxidant, immunostimulant(5), antifungal, anti-inflammatory, antiulcer, antiviral, anticancer agents, and, in animal production, behave as appetite stimulants and growth promoters(6), since they can act on the metabolism of the intestine microbiota, inhibiting the replication of specific pathogenic microorganisms, as well as stimulating the production of endogenous digestive enzymes, which benefit health(7;8). There are several reports that demonstrate the use of herbal mixtures rich in choline derivatives in animal production, where the following has been evaluated: the response in

Rev Mex Cienc Pecu 2022;13(1):82-96

liver and productive function in broilers(9), the impact on rumen fermentation in lambs(8,10), oxidative stress and biochemical changes in dairy cows(11), gene expression and immunostimulant effect in female calves(1), blood analytes in lambs as indicators of lipid metabolism(12). Choline derivatives (conjugate) are essential nutrients for growth and productive yield of animals; this is because choline is involved in various cellular functions. Usable forms of choline are phosphatidylcholine, lysophosphatidylcholine and sphingomyelin, which are lipid-soluble (components of all cell membranes and have a central role in lipid metabolism and cell signaling), free choline and choline metabolites, acetylcholine (ACho), betaine, glycerophosphocholine and phosphocholine that are soluble in water(13); likewise, it acts as a donor of the methyl group, after oxidizing to betaine, to convert homocysteine into methionine in the transmethylation pathway in the liver to prevent the accumulation of fat(14). Due to the multiple functions and benefits, natural choline is an alternative for animal production as an additive to the use of synthetic choline chloride or other additives with side effects and high costs of addition(15), for this reason, the polyherbal mixture Biocholine® (source of low hygroscopicity phosphatidylcholine), made up of the plants Trachyspermum ammi, Achyranthes aspera, Azadirachta indica, Citrullus colocynthis and Andrographis paniculata(16), can be a productive and economically profitable alternative. That is why the objective of the present study was to evaluate the economic and productive impact of the addition of a polyherbal mixture in choline conjugates added to the diet of rabbits.

Material and methods Animals and diet The research was conducted under the guidelines approved by the Academic Committee of the Department of Animal Science of Ethics, Biosafety and Animal Welfare of the UAEM Amecameca University Center of the Autonomous University of the State of Mexico. The experiment was conducted in the rabbit metabolic area. Forty weaned kits (30 days old), California X New Zealand breed (506.52 ± 120.47 g), were used, which were assigned in individual cages in five treatments (n= 8); with levels of addition of the polyherbal mixture at 0.0, 200, 400, 600 and 800 mg kg-1 of dry matter (DM) (BioCholina Powder®, Technofeed Mexico), an additive composed of Trachyspermum ammi, Achyranthes aspera, Azadirachta indica, Citrullus colocynthis and Andrographis paniculata), which contains 16 g kg-1 of total choline conjugates(16), the five groups being homogeneous in terms of weight, which was considered as initial weight (P>0.05).

Rev Mex Cienc Pecu 2022;13(1):82-96

The experimental diet was formulated to meet the nutritional requirements of fattening rabbits(17) (Table 1), however, choline requirements were kept below (1,130 mg kg-1). The polyherbal formula was added to the formulated balanced feed, mixed and subsequently pelletized to offer it to rabbits ad libitum, as well as clean and drinking water. The experiment lasted 34 days, with seven days of adaptation, the diets of the treatments were isoenergetic and isoproteic. The following productive variables were determined, initial weight (0d), final weight (34d) and daily weight gain, as well as the record of the feed offered and rejected, to obtain voluntary consumption on a wet basis and its subsequent adjustment to dry matter; in addition, the feed conversion (kilos of feed to obtain one kilogram of live weight) was obtained. Table 1: Ingredients (g kg-1), polyherbal mixture (mg kg-1 of feed) and chemical composition of experimental diets Polyherbal mixture (mg kg-1 DM) Ingredients

Control

200

400

600

800

Wheat bran

Corn grain

Oat hay

Soybean meal (44% CP)

Alfalfa hay

Vegetable oil

Saccharomyces cerevisae

Polyherbal mix

0.0

200

400

600

800

Crude protein, %

17.9

Digestible energy, Mcal kg-1 2.85 DM

2.85

Crude fiber, %

12.6

Neutral detergent fiber, %

31.3

Acid detergent fiber, %

15.9

Choline, mg kg-1 DM

1127

1130

1133.2

1136.4

1139.6

NCR, 1977.

Rev Mex Cienc Pecu 2022;13(1):82-96

Sample collection and analysis

At 65 days of age of the rabbits, the slaughter was carried out, with previous fasting of 24 h. The management of the carcasses followed the methodology proposed by Peiretti and Mineri(18). During the slaughter, the weight of the hot carcass, the gastrointestinal tract including spleen and mesenteric tissue, liver and kidneys (abdominal organs), as well as heart and lungs (thoracic) were recorded. The carcasses were stored at 4 °C for 24 h and weighed again to obtain the weight of the cold carcass; to perform the meat quality measurements, the Longissimus dorsi muscle was dissected in its lumbar portion(19).

Meat quality

Analyses were performed on the Longissimus dorsi muscle at 24 h postmortem; measurements were made in duplicate for each of the variables. The pH was taken at the level of the 5th lumbar vertebra with a penetration potentiometer (Hanna instruments H199163)(20). Color measurements were taken with a colorimeter (Konica Minolta, trichromatic) and readings were reported as: L* (luminosity), a*(red), b* (yellow), used to obtain C* (chroma) and H* (Hue)(21). The water retention capacity (WRC) was determined through loss of water by dripping and by pressure(22) and also the loss of water by cooking(23). To determine the economic impact, the cost of the kit, cost of each ingredient of the diet, including the herbal mixture per treatment dose, were considered, with prices of 2020; all these as expenses of the activity. For income, the sale price of live animals and carcass was calculated based on the local market; once the income and expenses were obtained, the profit (income–expenses) was obtained for the live animal, in hot and cold carcass; finally, the income-expense ratios (income-expenses) were calculated, which allowed to know the rate of return in percentage units, where it is indicated that an income-expense rate less than 1 represents losses, equal to 1 indicates that there were no profits, while rates greater than 1 are indicative of profits. All economic values are indicated in US dollars at an exchange rate of $1USD to $20.03MX dated February 10, 2021.

Statistical analysis

The results were analyzed with a completely randomized design, using the R(24) software, using initial weight as a covariable for the productive variables and using orthogonal

Rev Mex Cienc Pecu 2022;13(1):82-96

polynomials to obtain linear and quadratic effects to evaluate the effects of the polyherbal additive(25) with a significance level of P<0.05.

Results The addition of the polyherbal mixture showed no significant effects (P>0.05) on final weight, daily weight gain, hot and cold carcass weight (Table 2). In contrast, a linear effect is observed on feed consumption (P=0.006) and feed conversion (P=0.005). Table 2: Productive test and characteristics of the carcass of rabbits added with a polyherbal mixture (g) Polyherbal mixture (mg kg-1 DM)

P-value SEM

Item

0.0

200

400

600

800

Linear Quadratic

Initial weight

513.0

516.5

513.8

498.0

481.1

25.92

0.52

0.71

Final weight *

1444.3

1505.5

1461.5

1443.6

1429.3

38.25

0.44

0.38

Daily weight gain

27.7

30.0

28.3

27.2

26.3

1.85

0.32

0.41

Feed intake *

82.9

87.6

88.6

89.3

91.1

3.22

0.006

0.55

Feed conversion

3.01

2.97

3.18

3.2

3.4

0.12

0.005

0.52

Hot carcass weight *

777.3

845.6

794.4

773.1

769.6

59.51

0.63

0.61

Cold carcass weight *

749.7

816.1

764.7

743.0

739.7

58.88

0.61

0.62

Gastrointestinal tract

340.2

338.5

348.0

335.5

288.7

26.29

0.14

0.19

Heart and lungs

22.5

20.7

23.1

22.7

20.8

2.17

0.84

0.70

Liver

35.5

39.0

35.8

35.2

2.24

0.68

0.21

Kidneys

12.6

13.0

12.7

12.5

0.92

0.95

0.75

SEM= standard error of the mean. * The initial weight was considered as covariable (P<0.05)

Rev Mex Cienc Pecu 2022;13(1):82-96

With respect to the weight of the hot and cold carcass, as well as the weight of the gastrointestinal tract, liver, kidneys and thoracic organs (heart and lungs), no significant effect was observed (P>0.05). The results on meat quality are shown in Table 3, where it can be seen that the pH showed a linear (P=0.004) and quadratic (P=0.009) effect in the groups added with the polyherbal mixture. As for the trichromatic coordinates of the meat, no effects (P>0.0.5) were observed in L*, a* and Hue angle, not so for b* and chroma that presented a linear effect (P=0.009 and 0.03), in the water retention capacity, no significant differences were observed (P>0.05). Table 3: Quality characteristics of the Longissimus dorsi muscle obtained from rabbits fed a polyherbal mixture Polyherbal mixture (mg kg-1DM) P-value SEM Item 0 200 400 600 800 Lin Quad pH

5.5

5.6

5.8

5.6

5.8

0.06

0.004

0.09

51.3

54.3

51.9

57.0

53.5

1.45

0.12

0.31

3.8

4.2

4.0

4.3

4.8

0.53

0.20

0.74

3.0

4.3

3.5

4.7

4.6

0.42

0.009

0.59

Chroma

4.9

6.1

5.4

6.4

6.7

0.58

0.03

0.99

Hue Angle

180.6

180.7

180.8

180.7

0.063

0.13

0.22

Drip loss, %

3.7

3.5

3.8

4.0

3.9

0.016

0.15

0.99

Cooking loss, %

33.9

34.9

33.6

34.4

34.1

0.002

0.39

0.50

Pressure loss, %

20.3

17.5

20.9

20.0

0.000

0.86

0.81

SEM= standard error of the mean; Lin= linear, Quad= quadratic. L*: luminosity; a*: it tends to red; b*: it tends to yellow

In the economic analysis (Table 4), an increase in costs as the addition of the polyherbal mixture increased was observed, both in costs per feed and per animal, finding the lowest costs in the control treatment, this derived from the cost of the additive. Regarding income per live animal, in hot and cold carcass, it was obtained that the treatment with the addition of 200 mg kg-1 presented higher incomes, a situation that is related to the productive response, since this group was the one with the highest weight.

Rev Mex Cienc Pecu 2022;13(1):82-96

With respect to the profit and the income-expense ratio, it was observed that the addition of 200 mg kg-1 gives the maximum value, reaching the highest profitability in the cold carcass, this being 1.38 (for each unit of expense, the unit is recovered and a profit of 0.38 units is obtained). Table 4: Economic analysis of rabbits fed a polyherbal mixture Polyherbal mixture (mg kg-1 DM) Item

200

400

600

800

Feed cost, $

0.7688

0.8152

0.8272

0.8362

0.8557

Cost per animal, $

2.7658

2.8122

2.8242

2.8332

2.8527

Income per live animal, $

3.2755

3.4767

3.3180

3.2026

3.0908

Income per hot carcass, $

3.4927

3.7993

3.5696

3.4737

3.4578

Income per cold carcass, $

3.5556

3.8706

3.6270

3.5242

3.5082

Profit per live animal, $

0.5097

0.6645

0.4937

0.3694

0.2381

Profit per hot carcass, $

0.7264

0.9885

0.7453

0.6405

0.6055

Profit per cold carcass, $

0.7898

1.0584

0.8027

0.6909

0.6555

Income-expense ratio live animal

1.18

1.24

1.17

1.13

1.08

Income-expense ratio hot carcass

1.26

1.35

1.26

1.23

1.21

Income-expense ratio cold carcass

1.29

1.38

1.28

1.24

1.23

Discussion Productive response

According to the results obtained, there were no significant effects on feed consumption and daily weight gain due to the addition of polyherbal mixtures, despite the fact that these additives are considered as phytogenic additives with the characteristic of stimulating the production of digestive enzymes, such as trypsin and amylase, with the ability to optimize the absorption of nutrients and consequently improve productive and carcass responses(6), however, in this study, these benefits were not observed, a situation similar to that presented

Rev Mex Cienc Pecu 2022;13(1):82-96

by other authors(12), in a study carried out in lambs fed choline conjugates at doses of 0 and 4 g day-1, no better response was found in the added treatment with respect to the control on final weight (28.63 – 28.68 kg) or daily weight gain (106.44 – 107.98 kg). Similarly, in two studies carried out in rabbits using various plants, they did not observed improvements in production parameters despite being plants rich in secondary metabolites(26,27), since it is reported that the metabolites present are not sufficient to modify the microbiota or the conditions of the gastrointestinal tract. On the other hand, the relationship between feed conversion and weight gain was not affected by the doses of polyherbal mixtures, values that agree with what was reported by another paper(10), an study in which there was a linear effect (P=0.07) in conversion but not in weight gain (P>0.10) in growing lambs, using a polyherbal formula, as well as in the results of Selvam et al(28) in chickens fed an herbal mixture (0.0, 500 and 1,000 g-1 t-1 of feed), and they obtained values of 1.58 in the control treatment and of 1.47 and 1.48 in the added groups. The addition of polyherbal mixtures showed a positive effect on the variables of feed consumption and daily weight gain, since rabbits with the lowest body weight were in the control group (27.7 g d-1), which is deficient in choline with 1,130 mg d-1, when the minimum requirement is 1,130 mg kg-1 DM. In this regard, in studies where choline deficiency has been experimentally induced, growth retardation, anemia, muscular dystrophy and death have been observed(29), a situation that is confirmed in this experiment. Although the active mechanism of choline chloride is still unclear, excess choline has been shown to negatively affect animal yield; one of the hypotheses that may explain the results obtained is that, when exceeding the ability to metabolize choline at the cellular level, an accumulation of phosphocholine occurs, a situation that could be occurring in treatments with 600 and 800 mg (27.2 and 26.3 g d-1 respectively), which are above the necessary requirement for rabbits at this stage of growth(16). An experiment conducted on quails at doses of 1,000, 1,500, 2,000 and 2,500 mg kg-1 of choline showed a greater weight gain between d 7 to 21 of age (1.95, 2.10, 2.98, 2.48 g), as well as better conversion (5.29, 5.44, 3.68, 4.35); this situation contrasts with what was observed in the present research, probably because the addition of polyherbal mixtures could have modified the digestive physiology, acting on the cecal microbiome, since the digestive system of the rabbit is adapted to the fermentation of plant epithelial cells in the cecum(30), while in birds, these digestive fermentation processes do not occur. Although in this study no hematological analyses were performed to know the hepatic functioning due to the addition of polyherbal mixtures, various studies have observed the variation of the response when using herbal formulas; in a research(31), they found that liver weight had no relationship in the production of specific enzymes (ALT and AST), as they 90

Rev Mex Cienc Pecu 2022;13(1):82-96

showed no changes between the groups when choline (1,000 mg kg-1) was added as a lipotropic agent in broilers, likewise(9), they observed a decrease in serum concentrations of AST in broilers fed choline (1 g kg-1) and lectin (0.5 g kg-1). It is worth mentioning that the use of various plants participates in the metabolism of lipids and cholesterol(32), a situation that modifies the general metabolism of the animal and therefore the productive response, it is possible that the plants that make up the polyherbal formula have effects on lipids and these in turn can modify the absorption of nutrients.

Meat quality

According to the pH results obtained, significant differences were found between the treatments added with polyherbal mixtures compared to the control (P<0.05), presenting values ranging from 5.5 for the control and 5.8 as a maximum for the added groups. These results are consistent with what was reported by others(33), where they found pH values of 5.8 for meat of rabbits fed different parts of the Tithonia tubaeformis plant. The optimal pH at 24 h postmortem for glycolytic muscles, such as the Longissimus dorsi muscle of the rabbit, is between 5.3 and 6.0(32); this parameter is one of the most important indicators for assessing meat quality, as it is associated with appearance, color (myoglobin chemical reactions) and water absorption(34). The parameters obtained of the variable b* of meat color are lower (between 3 and 4.7) than those reported(35) in rabbits fed flavonoids contained in alfalfa, at doses of 0.0, 400, 800, 1,200 mg kg-1 and find values that range between 6.1 and 6.6. As mentioned by Selvam et al(28), where they reported values of 8.34 and 10.16 for variable b of rabbits fed different parts of the Tithonia tubaeformis plant. The coordinate b* that represents the yellow pigment in meat, this value was affected in the treatments with the addition of the polyherbal mixture, which could be due to a series of nonenzymatic browning reactions that occur in the oxidation products of lipids and amines in the phospholipid head groups or the amine in the protein(36). Likewise, the presence of antioxidant compounds such as phenols and flavonoids contained in polyherbal mixtures could be responsible for the color differences observed. The results obtained in this experiment in terms of color indicate a meat with a slight coloration that tends to brown and is nonexudative, a situation that is not desirable since rabbit meat is pale nonexudative(37). In several studies(26,27) that involved the use of plants in the feeding of rabbits, it was observed that the incorporation at low levels of plants with high antioxidant potential and with phenolic compounds, they do not have the ability to modify the quality of the meat, a situation similar to that reported in this experiment, this because the volumes added are low.

Rev Mex Cienc Pecu 2022;13(1):82-96

Economic impact

The addition of 200 mg kg-1 DM of the polyherbal formula generated the highest live weight and the best feed conversion in this experiment, such a situation was reflected in the economic indicators; when adding this dose, the greatest profits and income-expense ratios were obtained, since it can be indicated that it was the optimal dose for these animals. In one study(38), it was observed that the addition of plants with immunostimulant potential generated economic benefits in the production of rabbits, a situation similar to that reported in this research; this effect may be due to the fact that polyherbal formulas contain a large number of metabolites, and these generate beneficial modifications in the gastrointestinal tract, or in the absorption of nutrients, a situation that generates better feed conversions. In the same sense, in a study conducted in dairy cattle, it was observed that the addition of a polyherbal formula rich in choline improved economic indicators due to the fact that milk production was improved and the number of pathology events was decreased(39).

Conclusions and implications The addition of polyherbal mixtures based on natural choline conjugate did not improve the productive variables; however, a favorable economic trend is marked with the addition of 200 mg/kg of dry matter, due to a positive effect on feed conversion. It is recommended to continue studying the use of natural choline in rabbits, at doses less than 200 mg kg-1, since in this research, the possible benefits were found in this group, as well as maintaining the recommended requirements of choline for optimal storage of vitamins, avoiding inefficiencies in absorption or dietary metabolism, and ensuring the physiological state of rabbits. Literature cited: 1. Díaz GC, Méndez OET, Martínez GD, Gloria TA, Hernández GPA, Espinosa AE, et al. Influence of a Polyherbal Mixture in Dairy Calves: Growth Performance and Gene Expression. Front Vet Sci 2021;7:623710. 2. Madhupriya V, Shamsudeen P, Manohar GR, Senthilkumar S, Soundarapandiyan V, Moorthy M. Phyto feed additives in poultry putrition: A review. Int J Sci Environ Technol 2018;7(3):815-822.

Rev Mex Cienc Pecu 2022;13(1):82-96

3. Salajegheh A, Salarmoini M, Afsharmanesh M, Salajegheh MH. Growth performance, intestinal microflora, and meat quality of broiler chickens fed lavender (Lavandula angustifolia) powder. J Liv Sci Technol 2018;6(1):31-38. 4. Irchhaiya DR. Anumalik Y, Nitika G, Swadesh K, Nikhil G, Santosh K, et al. Metabolites in plants and its classification. World J Pharmacy Pharmaceut Sci 2015;4(1):287-305. 5. Syahidah A, Saad CR, Daud HM, Abdelhadi YM. Status and potential of herbal applications in aquaculture: A review. Iran J Fisher Sci 2015;14(1):27-44. 6. Dalle-Zotte, A, Celia C, Szendrő Z. Herbs and spices inclusion as feedstuff or additive in growing rabbit diets and as additive in rabbit meat: A review. Livest Sci 2016;189:8290. 7. Soliman WSED. Trial on using of some herbal extracts as promising immunoprophylaxis feed additives in cultured Oreochromis niloticus. Egyp J Vet Sci 2017;48(2):53-60. 8. Razo OPB, Mendoza MGD, Silva GV, Osorio TAI, González SJF, Hernández GPA, et al. Polyherbal feed additive for lambs: effects on performance, blood biochemistry and biometry. J Appl Anim Res 2020;48(1):419-424. 9. Khosravinia H, Chethen PS, Umakantha B, Nourmohammadi R. Effects of lipotropic products on productive performance, liver lipid and enzymes activity in broiler chickens. Poultry Sci J 2015;3(2):113-120. 10. Ortega ANI, Mendoza GD, Martínez GJA, Bárcena GR, Buendía RG. Impact of a Polyherbal mixture (Withania somnifera, Ocimum sanctum, Tinospora cordifolia and Emblica officinalis) on lamb growth and ruminal fermentation. Int J Agri Biol Sci 2020;32(12):864-870. 11. Koujalagi S, Chhabra S, Randhawa SNS, Singh R, Randhawa CS, Kashyap N. Effect of herbal bio choline supplementation on oxidative stress and biochemical parameters in transition dairy cows. Pharma Innov J 2018;7(4):842-847. 12. Rodríguez-Guerrero V, Lizarazo AC, Ferraro S, Suárez N, Miranda LA, Mendoza GD. Effect of herbal choline and rumen-protected methionine on lamb performance and blood metabolites. S Afri J Anim Sci 2018;48(3):427-434. 13. De Veth MJ, Artegoitia VM, Campagna, SR, Lapierre H, Harte F, Girard CL. Choline absorption and evaluation of bioavailability markers when supplementing choline to lactating dairy cows. J Dairy Sci 2016;99(12):9732-9744. 14. Khose KK, Manwar SJ, Gole MA, Ingole RS, Rathod PR. Efficacy of herbal choline as a replacement of synthetic choline chloride in diets on growth performance of broilers. J Lives Res 2018;8(10):313-322. 93

Rev Mex Cienc Pecu 2022;13(1):82-96

15. Calderano AA, Nunes RV, Rodrigueiro RJB, César RA. Replacement of choline chloride by a vegetal source of choline in diets for broilers. Ciên Anim Bra 2015;16(1):37-44. 16. Martínez-Aispuro JA, Mendoza GD, Cordero-Mora JL, Ayala-Monter MA, SánchezTorres MT, Figueroa-Velasco JL, Gloria-Trujillo A. Evaluation of an herbal choline feed plant additive in lamb feedlot rations. Rev Bra Zoot 2019;48. 17. NRC. Nutrient Requirements of Rabbits. National Academy of Sciences, Washington, DC. 1977. 18. Peiretti PG, Meineri G. Effects on growth performance, carcass characteristics, and the fat and meat fatty acid profile of rabbits fed diets with chia (Salvia hispanica L.) seed supplements. Meat Sci 2008;80(4):1116-1121. 19. Blasco A. Ouhayoun J. Harmonization of criteria and terminology in rabbit meat research. Revised proposal. World Rabbit Sci 1996;4(2):93-100. 20. Hajji H, Joy M, Ripoll G, Smeti S, Mekki I, Gahete FM, Atti N. Meat physicochemical properties, fatty acid profile, lipid oxidation and sensory characteristics from three North African lamb breeds, as influenced by concentrate or pasture finishing diets. J Food Compos Anal 2016;48:102-110. 21. Wang W, Chen J, Zhou H, Wang L, Ding S, Wang Y, Li, A. Effects of microencapsulated Lactobacillus plantarum and fructooligosaccharide on growth performance, blood immune parameters, and intestinal morphology in weaned piglets. Food Agric Immunol, 2018;29(1):84-94. 22. Celi P, Cowieson AJ, Fru-Nji F, Steinert RE, Kluenter AM, Verlhac V. Gastrointestinal functionality in animal nutrition and health: new opportunities for sustainable animal production. Anim Feed Sci Tech 2017;234:88-100. 23. Liu H, Li K, Mingbin L, Zhao J, Xiong B. Effects of chestnut tannins on the meat quality, welfare, and antioxidant status of heat-stressed lambs. Meat Sci 2016;116:236-242. 24. Mirman D. Growth curve analysis and visualization using R. Chapman & Hall/CRC. The R Series. CRC Press. Boca Raton, FL, USA. 2014. 25. Steel RG, Torrie JH, Dickey DA. Principles and procedures of statistics. A biometrical approach. 2011. 26. Ayala MM, Zepeda BA, Soto SS. Dietary supplementation effects with Ruta graveolens on performance, carcass traits and meat quality on rabbits. Rev Mex Cien Pecu 2020; 11(4):1220-1230.

Rev Mex Cienc Pecu 2022;13(1):82-96

27. Zepeda BA, Martínez MA, Simental SS. Carcass and meat quality of rabbits fed Tithonia tubaeformis weed. Rev Bras Zootec 2019;48. 28. Selvam R, Saravanakumar M, Suresh S, Chandrasekeran CV, Prashanth DS. Evaluation of polyherbal formulation and synthetic choline chloride on choline deficiency model in broilers: implications on zootechnical parameters, serum biochemistry and liver histopathology. Asian-Australasian J Anim Sci 2018;31(11):1795. 29. Halls AE. Nutritional requirements for rabbits. Nutreco Canada Inc. Canada 2010. Accessed Jan 4, 2021 https://www.researchgate.net/profile/Rana-Al-Difaie/post/Whatthe-nutrient-requirement-for-rabbit-duringpregnancy/attachment/59d64eb079197b80779a7fc8/AS%3A493952089899008%4014 94778763533/download/nutritional-requirements-of-rabbits.pdf. 30. Fortun-Lamothe L, Boullier S. A review on the interactions between gut microflora and digestive mucosal immunity. Possible ways to improve the health of rabbits. Livestock Sci 2007;107(1):1-18. 31. Javed I, Iqbal Z, Rahman ZU, Khan FH, Muhammad F, Aslam B, Ali L. Comparative antihyperlipidaemic efficacy of Trachyspermum ammi extracts in albino rabbits. Pakistan Vet J 2006;26(1):23. 32. Rezaeipour V, Aghayar F, Bozorgnia A, Norozi M, Zakaria H. Effects of feeding strategies and supplemental lipotropic factors on growth performance, ascites-related indices, serum metabolites and meat quality in broiler chickens reared at high altitude. JAPS, J Anim Plant Sci 2019;29(1):25-32. 33. Zepeda BA, Martínez MA, Simental SS. Carcass and meat quality of rabbits fed Tithonia tubaeformis weed. Rev Bras de Zootec 2019;48:1-10. 34. Hulot F, Ouhayoun J. Muscular pH and related traits in rabbits: a review. World Rabbit Sci 1999;7(1). 35. Kozioł K, Maj D, Bieniek J. Changes in the color and pH of rabbit meat in the aging process. Med Weter 2015;71(2):104-108. 36. Dabbou S, Gasco L, Rotolo L, Pozzo L, Tong JM, Dong XF, Gai F. Effects of dietary alfalfa flavonoids on the performance, meat quality and lipid oxidation of growing rabbits. Asian-Australasian J Anim Sci 2018;31(2):270. 37. Wang Z, He Z, Li H. The effect of repeated freeze-thaw cycles on the meat quality of rabbit. World Rabbit Sci 2018;26(2):165-177.

Rev Mex Cienc Pecu 2022;13(1):82-96

38. Pulido HS, Espinosa AE, Hernández GPA, Mendoza MGD. Análisis productivo y económico de la adición de fórmula poliherbal en conejos en finalización. En: Herrera CJ, et al. Avances de la investigación sobre producción animal y seguridad alimentaria en México. Ed. Universidad Michoacana de San Nicolás de Hidalgo. 2018:991-995. 39. Ortega ANI, Mendoza MGD, Bárcena GR, Hernández GPA, Espinosa AE, Martínez GJA, Gloria TA. Economic impact of polyherbal mixtures containing choline, lysine and methionine on milk production and health of dairy cows. Emirates J Food Agric 2020;864-870.

https://doi.org/10.22319/rmcp.v13i1.5342 Article

Carcass characteristics and fatty acid profile of the meat of Creole lambs supplemented with cottonseed and corn

Emiro Suárez Paternina a,b* Libardo Maza Ángulo b Wilson Barragán Hernández a Lorena Aguayo Ulloa a Oscar Vergara Garay b

Corporación Colombiana de Investigación Agropecuaria - AGROSAVIA. Centro de Investigación Turipaná. Km 13 vía Montería-Cereté. Montería. Colombia. b

Universidad de Córdoba, Facultad de Medicina Veterinaria y Zootecnia. Grupo de investigación en Producción Animal Tropical, Montería. Colombia.

*Corresponding author: esuarez@agrosavia.co

Abstract: The objective was to evaluate the carcass characteristics and fatty acid (FA) profile of the meat of Creole lambs supplemented with cottonseed (CS) and ground corn (GC). Twentyfour (24) males of 90 d and 16 ± 2 kg of initial weight were used. The lambs were assigned to four treatments, T0: grazing; T1: grazing + 25%-CS + 75%-GC; T2: grazing + 50%-CS + 50%-GC and T3: grazing + 75%-CS + 25%-GC, under a complete randomized design. After 127 d of supplementation, the animals were slaughtered, and the hot and cold carcass was weighed. Two hundred grams of the Longissimus dorsi muscle were taken to evaluate the proportion of FAs in each animal using gas chromatography. An analysis of variance was developed to determine the effect of diet. The supplemented animals had an average weight of 32.15 kg, being higher (P<0.05) than that registered by the lambs of the T0 (23.3 kg). Similarly, a higher average yield of the carcasses of lambs that received supplementation

Rev Mex Cienc Pecu 2022;13(1):97-114

(48.2 vs 39.5 %) was observed. Palmitic and stearic FAs increased in the meat of supplemented animals (P≤0.05), especially in those fed the T2 diet. Supplementation with CS and GC positively altered (P≤0.05) the ratio of monounsaturated acids (MFAs) and polyunsaturated acids (PFAs). The treatments did not influence (P>0.05) the MFA:SFA ratio and the atherogenicity index. However, the diet affected (P<0.05) the desirable PFA:SFA and FA ratio. Supplementation with CS and GC positively influenced slaughter weight, carcass yield and fatty acid profile in lambs. Key words: Sheep, Energy-protein supplements, Biohydrogenation.

Received: 12/04/2019 Accepted: 09/04/2021

Introduction In Colombia, grasses are the main food source for sheep by virtue of their low cost of production (relative to feed), representing the most practical and economical form of feeding(1). However, despite their importance, their productivity is affected due to strong climatic variations throughout the year, which are manifested with periods of intense rainfall and prolonged periods of drought, lasting approximately four to five months, causing limitations in livestock production, mainly due to the decrease in the availability and nutritional quality of fodder, which leads to poor performance of the animals and affects the quality of the final product. In this sense, it is valid to incorporate technologies that lead to improve the productive parameters of sheep farming in the region, therefore, the use of energy-protein agro-industrial by-products can improve the nutritional quality of the diet and increase the weight gains, quality and conformation of sheep carcasses. Cottonseed has been widely referenced as an agro-industrial by-product of high nutritional value for ruminant feeding, which is characterized by containing high concentrations of lipids, protein and fiber(2). However, its nutritional quality is affected by the gossypol content, so its inclusion in diets should be regulated(3). Cottonseed and its by-products are alternative food sources, which can decrease the cost of the animals’ diet(4). These products have high concentrations of fatty acids, with an important effect on greater weight gain, increased fat deposition in the carcass and changes in the fatty acid profile of meat, which can influence their acceptability by the consumer and the impact on human health(5).

Rev Mex Cienc Pecu 2022;13(1):97-114

On the other hand, fatty acid composition and cholesterol concentrations in meat have received increasing attention due to their relationship with human health and product quality(6). Therefore, the trend has been a lower consumption of the so-called saturated fats, since these lead to an increased risk of obesity, cancer and cardiovascular diseases. In this context, lamb meat has a high content of saturated fatty acids and, to a lesser extent, polyunsaturated fatty acids. The latter play an important role in the development of the brain and retina and prevent diseases such as immunodeficiency, carcinogenesis, atherosclerosis, hypertension, obesity and cardiovascular diseases(7). Therefore, it is essential to enhance these healthy fatty acids, such as the n-3 series (the so-called omega 3), and the group of positional and geometric isomers of linoleic acid (the CLA fatty acids) in meat. In the last decade, nutritional strategies have been used to modify the concentrations of the different fatty acids in the musculature of animals, one of them is the use of oilseeds, due to their high concentration of polyunsaturated fatty acids(8). Work with diets for weaning lambs has shown an increase in the concentration of long-chain fatty acids in muscle and fat in intensively fattened lambs, also improving the color of subcutaneous fat(9). For their part, Peng et al(10) mention that it is possible to have meat products of better quality in terms of the composition of beneficial fatty acids through supplementation with oilseeds, which would provide healthier options for the consumption of these products. Given the growing importance of the sheep sector in Colombia, it is necessary to carry out this type of research, therefore, the objective of this study was to evaluate the characteristics of the carcass and the fatty acid profile of meat of lambs fed with cottonseed and ground corn.

Material and methods The experiment was developed in the Experimental Farm of the Faculty of Veterinary Medicine and Zootechnics, of the University of Córdoba, Berástegui campus, municipality of Ciénaga de Oro, Córdoba-Colombia. The area is classified as tropical rainforest, located at 8º52’ N and 75º54’ W, altitude 18 m asl, average temperature of 28 ºC, relative humidity of 85 % and annual rainfall of 1,340 mm. The area used in grazing was 10,000 m2, established with 70 % Star grass (Cynodon nlemfluensis Vanderyst) and 30 % Angleton grass (Dichantium aristatum (Poir.) C.E. Hubb.), which was divided into 13 paddocks of 713 m2 in order to establish a rotational system of 2-d of occupation and 24 d of rest. The sheep went out to graze in the morning

Rev Mex Cienc Pecu 2022;13(1):97-114

hours (0800 h) and returned to the sheepfold in the afternoon (1600 h), where they were separated by treatment for the offer of the supplement. Twenty-four Creole lambs with an initial weight of 16 ± 2 kg and an age of 3 mo were used, which were supplemented for 127 d, with isoenergetic and isoprotein diets based on cottonseed (CS) and ground corn (GC). The level of supplementation corresponded, on a dry basis, to 1 % of the live weight of the animals. The inclusion of cottonseed and ground corn, on a dry basis, varied to form to the treatments to be evaluated: T1) Grazing, T2) Grazing + 25% CS + 75% GC, T3) Grazing + 50% CS + 50% GC and T4: Grazing + 75% CS + 25% GC. The experimental diets were formulated according to the NRC(11), meeting the requirements of protein and metabolizable energy for an average daily weight gain of 160 g. During the test, adjustments were made according to the weight gain of the animals. The nutritional quality of forage and supplements was determined from composite samples. The forage samples were collected through the method of grazing simulation (hand plucking), for each forage sample 500 g per sample were collected, which were dried in a forced ventilation oven at 60 °C for 48 h, then ground with a Willey-type mill, using a onemillimeter mesh. The processing of the samples was carried out in the Animal Nutrition Laboratory of Agrosavia R.C. Turipaná, where crude protein (Kjeldalh method), neutral detergent fiber (NDF), acid detergent fiber (ADF) according to the method of the Association of Official Analytical Chemists(12) and the in situ digestibility of dry matter (ISDDM) according to the nylon bag technique(13) were determined. . The nutritional composition of the diets was estimated according to the Small Ruminant Nutrition System (SRNS) (Table 1). Similarly, the fatty acid composition of the pasture and food sources used was determined (Table 2). Table 1: Nutritional composition of the diets used in the feeding of lambs Nutritional composition of the diets Component (T0) (T1) (T2) (T3) Pasture 25CS:75GC 50CS:50GC 75CS:25GC CP, % 13.0 14.8 15.6 15.0 ME, Mcal/kg 2.1 2.3 2.3 2.3 NDF, % 56.4 48.6 51.9 55.2 EE, % 2.4 3.6 4.9 6.1 Digestibility, % 48.0 56.2 58.6 59.0 CS= cottonseed; GC= ground corn; CP= crude protein, ME= metabolizable energy, NDF= neutral detergent fiber, EE= ethereal extract. T0= grazing, T1= grazing + 25% cottonseed (CS) + 75% ground corn (GC), T2= grazing + 50% CS + 50% GC and T3= grazing + 75% CS + 25% GC.

100

Rev Mex Cienc Pecu 2022;13(1):97-114

Table 2: Fatty acid profile (%) for pasture, cottonseed and ground corn, used in the feeding of lambs Fatty acids Saturated C12:0 (Lauric) C14:0 (Myristic) C16:0 (Palmitic) C18:0 (Stearic) C20:0 (Arachidic) C22:0 (Behenic) C24:0 (Lignoceric) Monounsaturated C18:1.9 (Oleic) Polyunsaturated C18:2 (Linoleic) C18:3 (Linolenic) SFA MFA PFA

Pasture

Cottonseed

Ground corn

0.010 0.005 0.490 0.085 0.030 0.025 0.030

0.004 0.170 5.560 0.770 0.090 0.050 0.030

0.001 0.260 0.050 0.010 0.010

0.135

4.370

0.660

0.875 2.800 0.675 0.135 3.675

18.780 0.100 6.674 4.370 18.880

1.740 0.050 0.331 0.660 1.790

SFA= saturated fatty acids, MFA= monounsaturated fatty acids, PFA= polyunsaturated fatty acids.

To determine the dry matter intake (DMI), it was necessary to estimate the volume of feces and the digestibility of the food, for which chromium oxide (Cr2O3) was used as an external marker and the indigestible acid detergent fiber (iADF) as an internal marker. For the estimation of the production of feces, Cr2O3 was dosed daily orally for 15 d. The dosage was carried out by gelatin capsules of 1 g, at 0700 h. In the last five days of dosing, the collection of feces was performed directly from the rectal ampoule twice a day at 0800 and 1600 h. The fecal samples were homogenized to form a composite sample per animal. The samples were then dried in a forced ventilation oven at 60 °C for 48 h and ground using a 1 mm mesh. For the determination of the concentration of Cr2O3 in the feces, the microwave digestion methodology (3051) proposed by the United States Environmental Protection Agency(14) was used. The fecal production estimated in grams of dry matter per day (g DM.day-1) was obtained by the quotient of the dose of the marker, divided by the concentration of the marker in the feces(15). After 45 d of starting the experiment, 3 g of samples composed of grass, food supplements and feces were taken from each animal to determine iADF. The samples were packed in triplicate in nylon bags of 5 x 12 cm, which were fixed to the cannula using nylon of 10 cm in length. The bags already attached to the chain were soaked three times in a bucket with clean water and then introduced into the rumen of a fistulated male bovine with a grazing-

101

Rev Mex Cienc Pecu 2022;13(1):97-114

based diet, where they remained for 144 h. In the end, the bags were removed and washed with clean water. The bags were dried at 60 °C for 24 h, the residues corresponding to the repetitions of each sample were removed, and then subjected for one hour in solution in acid detergent and washed with hot water and acetone; once the samples were dried, the residue was considered as the iADF(16). Based on the iADF, the DM digestibility was estimated using equation (Eq.1)(17). DMD = 100 – 100 x (% marker in the DM of the food) x (recovery rate of the marker in the feces) / (% of the marker in the DM of the feces) (Eq. 1). DMI was determined based on fecal production and the digestibility estimated with the internal marker (Eq. 2). To do this, the equation established by Ramírez et al(15) was used. Voluntary intake (g/d) =

(Fecal production, g DM/ d) 𝐷𝑀 𝐷𝑖𝑔

[1−( 100 )]

(Eq.2).

After 127 d of evaluation, the animals were transported by truck to a private slaughter and processing plant adapted and authorized by the competent authority for the slaughter of sheep (registration INVIMA 007OC), located in the municipality of Cereté (Colombia). Prior to the slaughter, the sheep fasted for a period of 12 h with access to water. The technical protocols established by the plant were followed, which include slaughter using a captive bolt gun for stunning sheep. Subsequently, the hot carcass weight (HCW) was determined and after remaining 24 h at 4 ºC, the cold carcass weight (CCW). Hot and cold carcass yield was calculated as the ratio of HCW, CCW and fasting live weight (LW). From each carcass, 200 g of Longissimus dorsi muscle were obtained from the left half carcass of each animal, between the eleventh and thirteenth rib. Total lipids were extracted in duplicate using the ethereal extract procedure; for this purpose, 2 g of sample was weighed and washed with a solvent in a Golfish® equipment for the extraction of fat with petroleum ether for a period of 5 h. The total lipid content was determined gravimetrically by weight difference in the extraction vessels. The methylation of the fatty acids was carried out on 50 to 60 mg of the lipid extract, adding 500 μL of KOH 1N in methanol with stirring; subsequently, 700 μL of xylene was added to allow the complete separation of the fatty acid methyl esters in two phases; from the oily phase (xylene), 100 μL was taken and 50 μL of xylene was added, creating a dilution from which an aliquot of 5μL was injected into an Agilent Technologies gas chromatograph, model 6890N®, coupled to a flame ionization detector (FID), equipped with a DB-225 column and a Split/Splitless auto-injector. The operating conditions were as follows: the injection volume was 2 μl (at 250 °C), the carrier gas was helium (1 ml/min), and the detector temperature was kept constant at 220 °C. It started with a temperature of 70 °C and a heating ramp was programmed for time intervals until reaching a temperature of 220 °C with an increase of 2 °C per minute. The identification 102

Rev Mex Cienc Pecu 2022;13(1):97-114

of fatty acids (FAs) was based on the comparison of retention times of the pattern and the area under the curve of the peaks. The FAs were quantified using Galaxie workstation software (Varian Inc., Palo Alto, California, USA). Once the fatty acids were identified, the total sums of saturated (SFAs), monounsaturated (MFAs), polyunsaturated fatty acids (PFAs) were established and the MFA:SFA, PFA:SFA ratio calculated. Desirable fatty acids (DFAs) were calculated taking into account monounsaturated, polyunsaturated and stearic acids(18). Likewise, to determine the potential for obstruction of the arteries, the atherogenicity index was established using the equation proposed by Ulbrich and Southgate(19), AI=(C12:0+4*C14:0+C16:0)/ Unsaturated FA. A completely randomized design was used, with four treatments and six repetitions to evaluate the effect of CS and GC inclusion percentages on carcass characteristics and fatty acid profile of sheep meat. The mathematical model that described the design was: Yij = ɥ + Tj + eij Where Yij is the response variable; μ is the overall mean; Tj is the effect of j-th treatment; e is the random error of the i-th repetition that received the j-th treatment, distributed N (0,1) and σ2 constant. An analysis of variance (ANOVA) was performed, after fulfilling the assumptions of normality and homogeneity of the data, for which the Shapiro Wilk and Levene tests were used, respectively. For data analysis, the GLM procedure of the SAS statistical analysis package(20) was used. Treatment means were compared using the Tukey test with a significance level of P≤0.05. This study was carried out with the endorsement of the Ethics Committee of the Faculty of Veterinary Medicine and Zootechnics of the University of Córdoba.

Results The supplementation with cottonseed and ground corn influenced the sheep dry matter intake. The intake observed in the animals of the treatment 75CS:25GC was 1.4 kg.d-1, with difference (P≤0.05) to that obtained by the animals of the control treatment, which presented

103

Rev Mex Cienc Pecu 2022;13(1):97-114

average intakes of 0.514 kg.d-1. However, no differences in intake were observed in animals that received supplementation 25CS:75GC, 50CS:50GC and 75CS:25GC (Table 3). Table 3: Average dry matter and nutrient intake of Creole sheep supplemented with cottonseed and ground corn (T0) (T1) (T2) (T3) Variables p Pasture 25CS:75GC 50CS:50GC 75CS:25GC TDMIT, kg.d-1 0.514 b 0.788 ab 1.020 ab 1.400 a 0.0366 -1 b b ab a FDMI, kg.d 0.514 0.463 0.695 1.070 0.0021 -1 Supplement, kg.d 0.325 0.325 0.325 -1 CPI, kg.d 0.121 0.160 0.169 0.178 -1 MEI, Mcal.d 1.960 2.530 2.440 2.360 CS= cottonseed; GC= ground corn; TDMI= total dry matter intake, FDMI= forage dry matter intake, CPI= crude protein intake, MEI= metabolizable energy intake. ab Different letters in the rows differ statistically according to Tukey’s test (P≤0.05).

The slaughter live weight differed (P≤0.05), as did the HCW, CCW, with the carcasses of the control treatment animals being the least heavy. Similarly, differences were found (P≤0.05) for the CCY, with the animals of the treatment 50CS:50GC having the highest yields with 45.17 %, exceeding by 5.6, 3.8 and 3.0 percentage units the yields registered in the carcasses of the treatments pasture, 25CS:75GC, and 75CS:25GC, respectively (Table 4). Table 4: Characteristics of the carcass of Creole sheep supplemented with cottonseed and ground corn (T0) (T1) (T2) (T3) Variable p R2 CV (%) Pasture 25CS:75GC 50CS:50GC 75CS:25GC SLW 23.30 b 32.03 a 31.78 a 32.65 a 0.0063 0.80 12.7 b a a a HCW, kg 11.00 15.26 16.03 15.40 0.0098 0.68 13.7 b a a a CCW, kg 9.51 13.54 14.48 13.90 0.0052 0.71 14.1 b ab a ab CCY, % 39.51 41.33 45.17 42.14 0.0290 0.62 5.5 CS= cottonseed; GC= ground corn; SLW= slaughter live weight, HCW= hot carcass weight, CCW= cold carcass weight, CCY= cold carcass yield. ab Different letters in the rows differ statistically according to Tukey’s test (P≤0.05).

Although there was no difference in slaughter weight between the animals that received supplementation, the treatment 75CS:25GC proved to be the most economical, as it used US$10.4 in the purchase of the supplement, unlike the treatments 25CS:75GC and 50CS:50GC, which incurred a supplementation expense of US$13.1 and US$11.6, respectively. The feasibility of the treatment 75CS:25GC was due to a lower cost of cottonseed and the higher level of inclusion implemented.

104

Rev Mex Cienc Pecu 2022;13(1):97-114

A significant effect (P≤0.05) of the diets evaluated on the proportion of MFAs was found. The treatment 50CS:50GC presented the highest concentration with 10.14 %, followed by the treatments 25CS:75GC and 75CS:25GC with 9.0 % and 7.44 %, respectively, while the control treatment was the one that registered the lowest proportion 3.29 % (Table 5). Differences (P≤0.05) in the proportion of PFAs were identified. The treatments 25CS:75GC, 50CS:50GC and 75CS:25GC registered the highest abundance 1.52 %, in relation to the control treatment (0.78 %). The proportion of linoleic fatty acid (C18:2) ranged from 0.5 % in the control treatment to 1.47 % in the treatment 75CS:25GC (P≤0.05). Regarding linolenic fatty acid (C18:3), no differences (P>0.05) between treatments were detected, with an average value of 0.2 %. Table 5: Fatty acid profile (%) in the meat of Creole sheep supplemented with cottonseed and ground corn (T1) (T2) (T3) (T0) CV Fatty acids 25CS:75 50CS:50 75CS:25 p R2 Pasture (%) GC GC GC Saturated 4.67 b 11.70 ab 13.51 a 10.78 ab 0.017 0.46 39.4 C10:0 (Capric) 0.01 0.02 0.03 0.03 0.230 0.24 56.6 C12:0 (Lauric) 0.01 0.03 0.03 0.02 0.234 0.27 77.5 C14:0 (Myristic) 0.15 0.45 0.50 0.36 0.128 0.54 49.7 b ab a ab C16:0 (Palmitic) 1.82 5.16 6.05 4.71 0.075 0.59 43.6 b ab a ab C18:0 (Stearic) 2.63 6.00 6.83 5.60 0.058 0.61 35.6 C20:0 (Arachidic) 0.03 0.04 0.05 0.04 0.698 0.10 43.7 C22:0 (Behenic) 0.01 . 0.02 0.01 0.247 0.43 28.1 C24:0(Lignoceric) 0.02 . . 0.02 0.667 0.11 32.9 b ab a ab Monounsaturated 3.29 9.02 10.14 7.44 0.043 0.53 48.9 b ab a ab C18:1 (Oleic) 3.29 9.02 10.14 7.44 0.043 0.53 48.9 b ab a a Polyunsaturated 0.78 1.42 1.57 1.59 0.013 0.48 28.5 b a a a C18:2 (Linoleic) 0.50 1.19 1.39 1.47 0.004 0.77 25.4 C18:3 (Linolenic) 0.28 0.23 0.17 0.12 0.185 0.50 55.0 MFA:SFA 0.72 0.75 0.73 0.69 0.745 11.7 a b b ab PFA:SFA 0.20 0.12 0.12 0.15 0.015 0.47 24.7 b ab a ab DFA 6.71 16.45 18.54 14.64 0.028 0.42 41.4 AI 0.45 0.51 0.53 0.50 0.182 0.30 9.86 CS= cottonseed; GC= ground corn; P= probability, R2= coefficient of determination, CV= coefficient of variation. MFA/SFA= monosunsaturated:saturated, PFA/SFA= polyunsaturated:saturated, DFA= desirable fatty acids, AI= atherogenicity index. ab Different letters in the rows differ statistically according to Tukey’s test (P≤0.05).

105

Rev Mex Cienc Pecu 2022;13(1):97-114

For the ratio of monounsaturated and polyunsaturated fatty acids, no differences were observed (P>0.05) between the treatments, with mean values of 0.72; however, for the PFA:SFA ratio, the analysis detected a significant effect (P≤0.05), with the control treatment registering the highest ratio (Table 5). The atherogenicity index (AI) of lamb meat ranged from 0.45 to 0.53, with no differences (P>0.05) between the diets evaluated.

Discussion According to the results shown in Table 3, the highest intakes observed in the animals that received supplementation can be attributed to a higher nutritional quality of the diet (Table 1), which probably generated a greater contribution of energy and protein, thus improving the rumen environment and favoring the rate of passage of the organic matter ingested. These results are consistent with the statistical trend observed in forage consumption, in which it is observed that animals that were kept in the treatments 50CS:50GC and 75CS:25GC increased their forage consumption by 1.21 and 2.08 times more, compared to animals without supplementation. Overall, the level of dry matter and nutrient intake found in animals that received supplementation was adequate for sheep of 30 kg live weight(11). Results similar to those of this study were reported by Cunha et al(21), who evaluated the inclusion of cottonseed in 20, 30 and 40 % in the diet for Santa Inés sheep, they reported average consumptions of 1.23, 1.12 and 1.19 kg.d-1, respectively. Similarly, De Sousa(22), when evaluating the inclusion of cottonseed in 7, 14, 21 and 28 % of the feeding of sheep in confinement, observed that consumption had a decreasing linear behavior as the contribution of cottonseed was increased, reporting average values of 1.12, 1.16, 1.02 and 0.82 kg.d-1, respectively, consumptions slightly higher than those found in the present study. The reduction in the DMI of sheep supplemented with cottonseed is directly related to the level of inclusion in the diet and its relationship with the content of ethereal extract, generally greater than 6 % in the diet(23). In this regard, Junior et al(24) reported a decrease in the consumption of Santa Inés x Dorper sheep from 21.55 % of inclusion of cottonseed in the diet, with a percentage of EE of 4.89 %, an opposite effect was observed in the present study, particularly in the treatment 75CS:25GC, where the inclusion of cottonseed represented 17.4 % of the total intake of dry matter, with a contribution of 6.1 % of EE, these levels did not affect the digestibility of the ingested organic matter. In this sense, Cunha et al(21) indicate that the inclusion of cottonseed up to 25 and 30 % of the total ration does not affect the digestibility of the fiber, managing to maintain adequate intakes.

106

Rev Mex Cienc Pecu 2022;13(1):97-114

The results achieved in this study show that the contribution of energy and protein from the supplement is used more efficiently for weight gains, being reflected in a higher live weight and meat yields. Based on this statement, the animal response may be influenced by the type of food(25). Therefore, the low performance shown by the animals that received only pasture can be explained by the low consumption of protein and energy, which, in the case of this treatment, the contribution of these nutrients was given by the grazed grasses. In this regard, Calsamiglia(26) states that, when sheep consume only fodder and their nutritional value is of low quality, nutrient intake may be inadequate to obtain acceptable production levels. The mean values of LW, HCW, CCW and CCY obtained in this study are higher than those reported by Viana(27), who, evaluating the substitution of concentrate for cottonseed by 40 % in the diet of Santa Inés sheep, reported values of 32.4, 13.05, 12.71 kg and 42.64 %, respectively for LW, HCW, CCW and CCY. Likewise, to those obtained by Pires et al(28), which registered HCW and CCW of 13.0 and 12.5 kg in pure Santa Inés sheep; but similar to those published by Yamamoto et al(29), who evaluated different sources of vegetable oils in Santa Inés and Dorset x Santa Inés sheep, reporting HCW and CCW values of 14.56 and 14.18 kg for Santa Inés and 14.45 and 14.14 kg for the cross between Dorset x Santa Agnes, respectively. The concentrations of SFAs in the Longissimus dorsi muscle showed differences (P≤0.05) between the treatments evaluated (Table 5). In this sense, the control treatment registered the lowest proportion of SFAs (P≤0.05), in relation to the proportions of SFAs of the meat of the treatments with supplementation. The highest concentrations of SFAs observed in the meat of animals that received supplementation (T1, T2 and T3) may be related to the nutritional composition of the diets they consumed, since a higher contribution of SFAs was observed. Madruga et al(30) stated that feeding with cottonseed contributes to increasing the proportion of SFAs in sheep meat due to its high concentration of ethereal extract. Within the SFAs, palmitic acid (C16:0) and stearic acid (C18:0) were influenced (P≤0.05) by the diets evaluated. Myristic (C14:0) and palmitic (C16:0) fatty acids are considered hypercholesterolemic; however, stearic acid (C18:0), despite being a saturated fatty acid and representing between 10 and 20 % of the fats produced by ruminants, does not have this property(30). Stearic acid presented the highest (P≤0.05) proportions in the treatments that received cottonseed in relation to the control treatment, interesting results considering that stearic acid is a precursor of oleic acid (C18:1), which is an abundant acid in the meat of lambs(31). The percentage of myristic acid (C14:0) did not differ (P>0.05) between treatments, which is convenient when thinking about human health benefits, as this is a hypercholesterolemic acid. However, for the ratio of palmitic acid (C16:0), this was higher (P≤0.05) in the supplemented treatments. For some researchers(30,32), high concentrations of hypercholesterolemic acids can lead to increases in cholesterol synthesis and promote the accumulation of low-density lipoproteins, which represent a risk factor for the occurrence of cardiovascular diseases. The concentrations found in the present study are lower than those 107

Rev Mex Cienc Pecu 2022;13(1):97-114

indicated in other studies(22,33), where they evaluated percentages of inclusion of cottonseed between 15 and 30 % in the diet of Santa Inés sheep, and reported concentrations of hypercholesterolemic acids 71 % higher than those achieved in this study. The content of monounsaturated fatty acids (oleic C18:1) varied between the different treatments, being influenced (P≤0.05) by the diets. Likewise, the proportion of polyunsaturated fatty acids (sum of C18:2, linoleic and C18:3, linolenic) was also affected (P≤0.05) by the diets, with the treatments with supplementation presenting the highest proportions. In relation to these results, Madruga et al(30) reported values higher than those of the present study; however, these authors found no differences in the concentrations of monounsaturated and polyunsaturated fatty acids when evaluating the inclusion of cottonseed in a 20, 30 and 40 in the diet of Santa Inés sheep, which contrasts with the results obtained in this research, where the inclusion of cottonseed produced a significant increase in the concentrations of monounsaturated and polyunsaturated fatty acids in favor of treatments that received cottonseed. The increase in unsaturated fatty acids is beneficial for human health, as they are hypocholesterolemic, since they tend to lower blood cholesterol(34,35). In this study, an increase (P≤0.05) in the proportions of monounsaturated and polyunsaturated fatty acids in the meat of animals linked to treatments with supplementation was observed. The factors that may have contributed to these results are related to the nutritional content of the food sources used, which generated an increase in monounsaturated and polyunsaturated fatty acids in meat. Another justification for the results obtained may be that the diet of the treatments that received supplementation presented a greater digestibility, which possibly promoted a higher rate of passage of the ingested organic material, which could generate an incomplete biohydrogenation at the rumen level. In this regard, Bauman et al(36) affirm that diets with a higher proportion of concentrates increase the rate of passage in rumen. For their part, Vargas et al(37) indicated that, in diets with a higher proportion of linoleic acid compared to linolenic acid, they contribute to greater accumulation and rate of passage of linoleic acid by escape to the process of total biohydrogenation. These same authors indicate that the accumulation of linoleic acid, due to its lower rate of biohydrogenation, contributes to increasing the rate of passage of trans fatty acids (conjugated linoleic acid and vaccenic acid) as a product of the incomplete biohydrogenation process. This suggests that diets that included cottonseed may have affected the biohydrogenation process, as suggested by the tendency to a lower proportion of stearic and oleic fatty acid in the treatment that received 75CS:25GC compared to the other supplemented treatments. This could generate an accumulation and higher rate of passage of linoleic acid and possibly its intermediate products of biohydrogenation, as it evidenced a greater participation of this fatty acid in the muscle of the supplemented lambs, versus the control treatment. It is important to note that linoleic acid is considered an essential fatty acid for humans, whose only source is the diet(38). 108

Rev Mex Cienc Pecu 2022;13(1):97-114

The PFA:SFA ratio found in this study was within the range 0.15 to 0.25 proposed for animals raised on pasture(39,40). According to Jakobsen(41), the intake of fats rich in cholesterol and saturated fatty acids should be reduced and the consumption of monounsaturated and polyunsaturated fatty acids should be increased, since they contribute to reducing the risks of obesity, cancer and cardiovascular diseases. Fats that have a low ratio of PFA:SFA are considered unfavorable, as they can induce an increase in blood cholesterol(42). The desirable fatty acids in the supplemented treatments were 60 % higher (P≤0.05) in relation to the control treatment, these results may possibly be due to the effect of the diet, since the treatments that received cottonseed and ground corn made a greater contribution of MFAs and PFAs, which generated significant increases in the proportions of these acids in the meat. This effect is considered convenient given that MFAs and PFAs reduce low-density lipoprotein levels and consequently the risk of obesity, cancer and cardiovascular diseases(42,43). However, the results found in this study are lower than those reported in the literature(31,42,43), possibly due to the higher levels of inclusion of cottonseed evaluated in the diet of Santa Inés sheep, which ranged between 15 and 40 %. With regard to the atherogenicity index (AI), this indicates the potential for platelet aggregation stimulation, and suggests that, at low AI values, the greater the amount of antiatherogenic fatty acids and the greater the potential for preventing the occurrence of cardiovascular diseases(41). The results found in this study are within the values recommended by Ulbricht and Southgate(19), which propose an ideal value of <1.0 for lamb meat.

Conclusions and implications Supplementation with cottonseed and ground corn promoted a greater slaughter weight and carcass yield, as well as increasing the concentrations of monounsaturated and polyunsaturated fatty acids in sheep meat. Although no decrease in digestibility and dry matter consumption was observed in treatments that received supplementation with cottonseed, it is recommended to carry out further studies to determine the maximum level of inclusion of this raw material in diets for small ruminants. Under the conditions of this study, it is recommended to supplement at the rate of 1 % of the live weight and use cottonseed and corn in the proportions 75:25, since from the economic point of view, it turned out to be the diet with the lowest costs.

109

Rev Mex Cienc Pecu 2022;13(1):97-114

Acknowledgements

To the University of Córdoba for the financing of the research project (Code 11901) and to the Faculty of Veterinary Medicine and Zootechnics. Likewise, to the Administrative Department of Science, Technology and Innovation COLCIENCIAS and to the royalty fund of the department of Sucre for the scholarship granted to the first author. Literature cited: 1.

Socarrás ZM, Fandiño R, Miranda Á, Fernández RG. Manejo de ovinos de pelo en el trópico. Valledupar, Colombia: Corporación Colombiana de Investigación Agropecuaria, Corpoica; 2009.

Osti NP, Pandey SB. Use of whole cotton seed and cotton seed meal as a protein source in the diet of ruminant animals: Prevailing situation and opportunity. 6th National Workshop on Livestock and Fisheries Research. Khumaltar, Nepal. 2006:111-119.

Akande KE. Major antinutrients found in plant protein sources: their effect on nutrition. Pak J Nutr 2010;9(8):827-832.

Paim TP, Louvandini H, Mcmanus CM, Abdalla AL. Uso de subprodutos do algodão na nutrição de ruminantes. Ciênc Vet Tróp 2010;(13):24–37.

Calkins CR, Hodgen JM. A fresh look at meat flavor. Meat Sci 2007;(77):63-80.

Linares M Gallo C. Perfil de ácidos grasos de carne de ovino y caballo criados bajo un sistema de producción extensiva. Rev Investig Vet 2013;24(3):257-263.

Bhattacharya A, Banu J, Rahman M, Causey J, Fernandes G. Biological effects of conjugated linoleic acids in health and disease. J Nutr Biochem 2007;17(12):789-810.

Zhang RH, Mustafa AF, Zhao X. Effects of feeding oilseeds rich in linoleic and linolenic fatty acids to lactating ewes on cheese yield and on fatty acid composition of milk and cheese. Anim Feed Sci Technol 2006;(127):220–233.

Berthelot V, Bas P, Pottier E, Normand J. The effect of maternal linseed supplementation and/or lamb linseed supplementation on muscle and subcutaneous adipose tissue fatty acid composition of indoor lambs Effects on methane production, rumen fermentation, and milk production. Meat Sci 2012;(90):548–557.

110

Rev Mex Cienc Pecu 2022;13(1):97-114

10. Peng YS, Brown MA, Wua JP, Liu Z. Different oilseed supplements alter fatty acid composition of different adipose tissues of adult ewes. Meat Sci 2010;(85):542–549. 11. NRC, National Research Council. Nutrient Requirements of Small Ruminants: Sheep, Goats, Cervids, and New World camelids. Washington; DC, USA: National Academic Press; 2007. 12. AOAC, Association of Official Analytical Chemists. Official Methods of Analysis. XIII ed. Washington; DC, USA; 2002. 13. Orskov ER, Howell FD, Mould F. The use of nylon bag technique for the evaluation of feedstuff. Trop Anim Prod 1980;15(3):195-213. 14. EPA. Method 3051A, Microwave assisted acid digestion of sediments, sludges, soil and oil; 2007. 15. Ramírez-Pérez AH, Buntinx SE. Tapia-Rodríguez CY, Rosiles R. Effect of breed and age on the voluntary intake and the micromineral status of non-pregnant sheep. 1. Estimation of voluntary intake. Small Ruminant Res 2000;(37):223–229. 16. Ferreira MA, Valadares FSC. Avaliação de indicadores em estudos com ruminantes: digestibilidade. Rev Bras Zootec 2009;38(8):1568-1573. 17. Correa H, Pabón M, Sánchez M, Carulla J. Efecto del nivel de suplementación sobre el uso del nitrógeno, el volumen y la calidad de leche en vacas Holstein de primero y segundo tercio de lactancia en el trópico alto de Antioquia. Livest Res Rural Develop 2011;23(4). http://www.lrrd.org/lrrd23/4/corr23077.html. 18. Landim LA, Cardoso M, Castanheira M, Fioravanti M, Louvandini H, Mcmanus C. Fatty acid proﬁle of hair lambs and their cross-breds slaughtered at different weights. Trop Anim Health and Prod 2011;(43):1561-1566. 19. Ulbricht TL, Southgate DA. Coronary heart disease: seven dietary factors. Lancet 1991;(338): 985–992. 20. SAS. SAS/STAT User’s Guide (Release 9.1.3). Cary NC, USA: SAS Inst. Inc. 2007.

111

Rev Mex Cienc Pecu 2022;13(1):97-114

21. Cunha MGG, Carvalho FRR, Véras ASV, Batista AMY. Desempenho e digestibilidade aparente em ovinos confinados alimentados com dietas contendo níveis crescentes de caroço de algodão integral. Rev Bras Zootec 2008;37(6):1103-1111. 22. De Sousa AR. Caroço de algodão moído na alimentação de cordeiros (as) em confinamento [tese mestrado]. Piracicaba, Brasil: Escola Superior de Agricultura Luiz de Queiroz; 2014. 23. Palmquist DL. Digestibility of cotton lint ber and whole oilseeds by ruminal microorganisms. Anim Feed Sci Technol 1995;56(3):231-242. 24. Junior JR, Carvalho DMG, De Souza JG, Cabral LS, Da Silva JJ, Riveiro MD, Arnoldo TRQ, De Oliveira AS, Soares JQ. Caroço de algodão em dietas sem volumoso para cordeiros confinados. Semina: Ciênc Agrárs 2015;36 (4):2727-2738. 25. Piona MNM, Cabral LS, Zervoudakis JT, Abreu JG, Galati RL, Caetano GGG, Silva AR. Niveis de Caroço de algodão na dieta de cordeiros confinados. Rev Bras Saúde Prod Anim 2012;13(1):110-122. 26. Calsamiglia SE. La suplementación en los ovinos. Memorias IV Congreso Nacional Ovinos, Querátaro, Mexico. 1998:64-75. 27. Viana GP. Desempenho e avaliação da carcaças de ovinos Santa Inês suplementados com caroço de algodão e seus co-produtos [PhD Dissertation]. Brasilia, Brasil: Universidade de Brasilia; 2011. 28. Pires CC, Galvani BD, Carvalho S, Cardoso RA, Gasperin BG. Características da carcaça de cordeiros alimentados com dietas contendo diferentes níveis de fibra em detergente neutro. Rev Bras Zootec 2006;35(5):2058-2065. 29. Yamamoto SM, Macedo FAF, Zundt M. Fontes de óleo vegetal na dieta de cordeiros em confinamento. Rev Bras Zootec 2005;34(2):703-710. 30. Madruga SM, Vieira LTR, Cunha GMG, Filho PMJ, Queiroga RC, Sousa HW. Efeito de dietas com níveis crescentes de caroço de algodão integral sobre a composição química e o perfil de ácidos graxos da carne de cordeiros Santa Inês. Rev Bras Zootec 2008;37(8):1496-1502.

112

Rev Mex Cienc Pecu 2022;13(1):97-114

31. Diaz MT, Álvarez I, De La Fuente J, Saňudo C, Campo MM, Oliver MA, Fontifurnols M, Montossi F, San Julián R, Nute GR, Caňeque V. Fatty acid composition of meat from typical lamb production systems of Spain, United Kingdom, Germany and Uruguay. Barking Meat Sci 2005;71(2):256-263. 32. Moloney AP, Mooney MT, Kerry JP, Troy DJ. Producing tender and flavor some beef with enhanced nutritional characteristics. Nutrition Society. Cork, Ireland. 2001:221229. 33. Pérez LH. Milho, amido ou caroço de algodão associados a glicerina bruta em dietas para ovinos [PhD Dissertation]. Jaboticabal, Brasil: Universidade Estadual Paulista; 2015. 34. Williams CM. Dietary fatty acids human health. Annal de Zootec 2000;49(3):165-180. 35. Valsta LM, Tapanainen H, Männistö S. Meat fats in nutrition. Meat Sci 2005;70(3):525530. 36. Bauman DE, Baumgard LH, Corl BA, Griinari JM. Biosynthesis of conjugated linoleic acid in ruminants. 91st American Society of Animal Science. Indianapolis, Indiana, USA. 1999:1-15. 37. Vargas JA, Olivera-Angel M, Ribeiro CV, Daza C, Edgar E. In vitro rumen biohydrogenation kinetics of mixed linoleic and alfa-linolenic acids. Rev Colomb Cienc Pecu 2018;31(3):213-222. 38. Wood JD, Enser M, Fisher AV, Nute GR, Sheard PR, Richardson RI. Fat deposition, fatty acid composition and meat quality: A review. Meat Sci 2008;78(4):343–358. 39. Lee J, Kannan G, Eega K, Kouakou B, Getz W. Nutritional and quality characteristics of meat from goats and lambs finished under identical dietary regime. Small Ruminant Res 2008;74:255- 259. 40. Dierking R, Kallenbach R, Grün I. Effect of forage species on fatty acid content and performance of pasture finished steers. Meat Sci 2010;85:597-605. 41. Jakobsen K. Dietary modifications of animal fats: status and future perspectives. Fett Lipid 1999;101(12):475-483.

113

Rev Mex Cienc Pecu 2022;13(1):97-114

42. Arruda PCL, Pereira ES, Pimentel PG, Bomfim MAD, Mizubuti IY, Ribeiro ELA, Fontenele RM, Regadas JGL. Perfil de ácidos graxos no Longissimus dorsi de cordeiros Santa Inês alimentados com diferentes níveis energéticos. Semina: Ciênc Agrár 2012; 33(3):1229-1240. 43. Paim TDP, Viana P, Brandão E, Amador S, Barbosa T. Carcass traits and fatty acid proﬁle of meat from lambs fed different cottonseed by-products. Small Ruminant Res 2014;116:71-77.

114

https://doi.org/10.22319/rmcp.v13i1.5986 Article

Correlation between ante-mortem and post-mortem variables in sheep carcasses produced in Mexico

Lizbeth Esmeralda Robles Jiménez a José Armando Partida de la Peña b* Miguel Enrique Arechavaleta Velasco b Ignacio Arturo Domínguez Vara a

Universidad Autónoma del Estado de México, Facultad de Medicina Veterinaria y Zootecnia, Estado de México, México. b

Instituto Nacional de investigaciones Forestales, Agrícolas y Pecuarias, Centro Nacional de Investigación Disciplinaria en Fisiología y Mejoramiento Animal, km 1 Carretera a Colón, Ajuchitlán, Querétaro, México.

*Corresponding author: partida.jose@inifap.gob.mx

Abstract: The objective of the study was to estimate the correlations of the rib-eye area (REA) and the thickness of the dorsal subcutaneous fat (TDSF) with morphometric variables in sheep carcasses produced in Mexico. Seven hundred fifty sheep carcasses were used, which were grouped by genotype (hair, wool and crossed hair ˣ wool), sex (males and females) and production system (intensive and semi-intensive). The normality of the distribution was determined, and simple correlation analyses were performed to estimate the degree of association between the variables. In hair genotypes, REA correlated with the weight of the carcass both hot and cold (r=0.42**; n=328; P<0.001 in males and r=0.48**; n=91; P<0.001 in females), but in females the perimeter (r=0.52**; n=91; P<0.001) and width of the rump (r=0.48**; n=91; P<0.001) were also relevant. In hair animals, the TDSF correlated with slaughter weight (r=0.36**; n=328; P<0.001 in males and r=0.57**; n=91; P<0.001 in females). In wool males, REA showed high correlation with carcass length (r=0.61**; n=116; 115

Rev Mex Cienc Pecu 2022;13(1):115-126

P<0.001) and rump perimeter (r=0.50**; n=116; P<0.001), while the TDSF correlated with the internal depth of the thorax (r=0.50**; n=116; P<0.01) and its perimeter (r=0.45**; n=116; P<0.001). In crosses hair ˣ wool, REA had the highest correlation with thorax width (r=0.47**; n=215; P<0.001) and hot carcass weight (r=0.43**; n=215; P<0.001), while the TDSF only had a low correlation with slaughter weight (r=0.19**; n=215; P<0.001). Key words: Sheep, Carcasses, Correlation, Rib-eye area, Fat thickness.

Received: 29/04/2021 Accepted: 16/08/2021

Introduction In Mexico, sheep meat production has maintained an average annual growth of 4.7 % during the last twenty-five years, going from 29,887 t of carcass meat in 1995 to 64,758 t in 2020(1,2). Currently, there is a population of almost 9.5 million heads and, based on the growth of the last five years, there is an expectation of producing 65,891 t of carcass meat by the end of 2021, with an estimated value of 6,500 million pesos(3). Despite the good performance shown by the national sheep farming, Mexico does not have an official classification system for sheep carcasses and only has one standard (NMX-FF-106-SCFI-2006)(4) that is applied occasionally. There are also no quality standards that define the attributes of the sheep carcasses produced, nor are there differential prices based on the quality of the final product; there is only information that relates variables measurable in vivo with the properties of the carcass in the Pelibuey breed and in some of its crosses(5,6,7,8), as well as in crosses of Katahdin(9,10) and Hampshire(11) females with males of meat breeds. Non-invasive methods for estimating the composition and quality of the carcass have been available in the world for some years(12), such as ultrasound, computed axial tomography, Xrays and positron emission tomography(13,14,15); however, most of these methods are very expensive and impractical(16). Some studies have also been carried out to determine the relationship that exists between some body components with the weight and yield of the carcass(17), as well as the relationship between body conformation and live weight using zoometric measures(18,19), but the results obtained are limited to very specific genetic groups and do not allow predicting aspects of quality in the carcass. For all the above, the objective of this study was to estimate the degree of association between ante-mortem and post-mortem

116

Rev Mex Cienc Pecu 2022;13(1):115-126

variables with parameters indicative of quality, such as the rib-eye area and the thickness of the dorsal subcutaneous fat in sheep carcasses produced commercially in Mexico.

Material and methods Seventy hundred fifty animals from the states of Mexico (60), Hidalgo (50), Veracruz (36), Zacatecas (38), Puebla (30), Jalisco (40), Coahuila (60), Sinaloa (187), San Luis Potosí (40), Guanajuato (30), Querétaro (64), Tabasco (35), Chiapas (45) and Yucatán (35) were evaluated, which were slaughtered in accordance with the NOM-ZOO-1995 Humanitarian Sacrifice of Domestic and Wild Animals(20). The animals were finished in the intensive (fully stabled with balanced feed to freedom) and semi-intensive (grazing with strategic supplementation) production systems and slaughtered in the TIF or municipal slaughterhouse closest to the farms that allowed to access to their facilities and provided to this search with information prior to the slaughter. It was identified 11 pure breeds, of which the following stood out: Katahdin 11.0 %, Pelibuey 5.1 %, Rambouillet 5.0 %, Suffolk 3.4 %, Dorper 2.8 % and more than ten crosses, of which the most representative were: Pelibuey ˣ Katahdin 16.3 %, Pelibuey ˣ Dorper 9.6 %, Katahdin ˣ Suffolk 9.0 %, Katahdin ˣ Charollais 5.8 %, Katahdin ˣ Dorper 5.4 %. For the analysis of the data, the sex, breed and production system of each of the animals were identified. Using the methodology described by Partida et al(21), records were taken of the slaughter weight, weight of the hot and cold carcass, yield of the hot and cold carcass, internal length of the leg (most caudal distance of the perineum and the most distal point of the medial edge of the tarsometatarsal articular surface), carcass length (maximum distance between the anterior edge of the ischiopubic symphysis and the anterior edge of the first rib, at its midpoint), rump perimeter (at the level of the trochanters of both femurs), rump width (maximum width between the trochanters of both femurs), thorax width (maximum width between the ribs at the level of the 6th thoracic vertebra), thoracic perimeter (circumference of the carcass over the ribs at the height of the 6th thoracic vertebra) and internal depth of the thorax (maximum distance between the sternum and the back of the carcass at the level of the 6th thoracic vertebra) of each of the animals. Likewise, the carcass compactness index (weight of the cold carcass in kg / internal length of the carcass in cm) was calculated, the rib-eye area (in the cutting area at the level of the 13th rib) and the thickness of the dorsal subcutaneous fat (also in the cutting area over the 13th rib) were measured, variables that are related to carcass quality(22). All animals were classified according to their genetic group (hair, wool and crossed hair ˣ wool), sex (males and females) and production system (intensive and semi-intensive). From

117

Rev Mex Cienc Pecu 2022;13(1):115-126

this classification, the following four groups of animals were formed: hair males produced under the semi-intensive system (n= 328), hair females produced under the semi-intensive system (n= 91), wool males produced under the intensive system (n= 116) and crossed males produced under the semi-intensive system (n= 215). Initially, analyses were performed within each group to determine if the distribution of the variables included in the study followed a normal distribution, for this the KolmogorovSmirnov and Shapiro-Wilk tests were used(23), and subsequently simple linear correlation analyses were performed to estimate the degree of association between in vivo and postmortem variables with the rib-eye area and the thickness of the dorsal subcutaneous fat. Statistical analyses were performed using the JMP statistical package ver. 4.0(24).

Results and discussion The Kolmogorov-Smirnov and Shapiro-Wilk analyses showed that the distribution of the variables included in the study followed a normal distribution. In the group of hair males produced under the semi-intensive system, a positive and highly significant correlation was obtained between the rib-eye area (REA) and slaughter weight (r= 0.38**; n= 328; P<0.001), the hot carcass weight (r= 0.42**; n= 328; P<0.001) and cold carcass weight (r= 0.42**; n= 28; P<0.001), with averages of 43.34 ± 6.22; 21.46 ± 3.15 and 20.90 ± 3.04 kg respectively for the variables mentioned. In this group, the thickness of the dorsal subcutaneous fat (TDSF) was also positively and highly significantly correlated with slaughter weight (r= 0.36**; n= 328; P<0.001) and with the internal depth of the thorax (r= 0.34**; n= 91; P<0.001) (Table 1). Table 1: Correlation of rib-eye area and thickness of the subcutaneous fat with different carcass variables in hair males of the semi-intensive system (n= 328) Variable SW HCW CCW HCY CCY RP RW IDT CCI s 0.38* 0.42* 0.15* 0.27 0.24* REA 0.42** 0.16 0.28** 0.15** * ** * * * TDSF

0.36* *

0.23* *

0.26* *

-8.08

-0.11

0.25 **

0.20* *

0.34* *

0.17* *

SW= slaughter weight; HCW= hot carcass weight; CCW= cold carcass weight; HCY= hot carcass yield; CCY= cold carcass yield; RP= rump perimeter; RW= rump width; IDT= internal depth of the thorax; CCI= carcass compactness index. REA= rib-eye area; TDSF= thickness of the dorsal subcutaneous fat.

118

Rev Mex Cienc Pecu 2022;13(1):115-126

In the group of hair females produced under the semi-intensive system, REA showed highly significant coefficients of determination with hot carcass weight (r= 0.48**; n= 91; P<0.001) and cold carcass weight (r= 0.49**; n= 91; P<0.001), as well as with rump perimeter (r= 0.52**; n= 91; P<0.001), rump width (r= 0.48**; n= 91; P<0.001) and the carcass compactness index (r= 0.43**; n= 91; P<0.001). For its part, the TDSF showed the highest coefficient of determination with slaughter weight (r= 0.57**; n= 91; P<0.001) (Table 2). Table 2: Correlation of rib-eye area and thickness of the subcutaneous fat with different carcass variables in hair females of the semi-intensive system (n= 91) Variables

HCW

CCW

HCY

CCY

IDT

CCI

REA

0.32*

0.48**

0.49**

0.34*

0.36**

0.52**

0.48**

0.34*

0.43**

TDSF

0.57**

0.03

0.02

0.36**

0.34**

0.31*

0.09

-0.11

-0.05

The relationship between REA and the weight of the carcass, both hot and cold, which was observed in hair males and females produced under the semi-intensive system is consistent with what has been reported in the literature for some time(25,26,27), and is explained by the analogy between body size and the dimensions of each of the components that make up the carcass (allometric growth). However, some authors have indicated that live weight may present certain deficiencies as an indicator of body composition, because the distinction between different stages of maturity of the animal cannot be made(28). In this study, there was evidently variation in the age of the animals and in their degree of maturity, but this information was not provided by the producers before or at the time of slaughter. It is known that REA is a good estimator of the proportion of muscle existing in the carcass of different domestic species(29,30); in fact, very high correlations (r= 0.96) have been obtained between cold carcass weight and its proportion of muscle when extremely homogeneous genetic groups have been evaluated, such as, for example, lactating lambs of the Manchega breed, which were handled and fed under the same conditions(31). This shows that carcass weight could be useful and practical for estimating the REA and the proportion of muscle in the carcass, since its weighing is an easy and quick measurement. According to the results, the variable that had the highest correlation with TDSF was slaughter weight, both in hair females and males. This has also been observed in some studies that used ultrasound to measure fat cover in the sheep carcass(32,33,34). Similarly, in sheep of the Texel breed (with 20 kg of live weight), a correlation (r= 0.33; 186 P<0.05) was reported between slaughter weight and the TDSF(35). Likewise, other authors who used lambs of the Awassi breed observed a

119

Rev Mex Cienc Pecu 2022;13(1):115-126

correlation between the TDSF and slaughter weight, which increased (r= 0.71 to r= 0.83) when the body weight increased from 30 to 40 kg and when differentiating the sex within the model(34). As for the group of wool males raised in the intensive system, REA had a positive correlation with carcass length (r= 0.61**; n= 116; P<0.001) and rump perimeter (r= 0.58**; n= 116; P<0.001), while in dorsal TDSF, it was positively correlated with hot carcass yield (r= 0.42**; n= 116; P<0.001), the perimeter of the thorax (r= 0.45**; n= 116; P<0.001) and its internal depth (r= 0.50**; n= 116; P<0.001) (Table 3). Table 3: Correlation of rib-eye area and thickness of the subcutaneous fat with different carcass variables in wool male sheep of the intensive system (n= 116) Variables HCY

CCY

IDT

CCI

REA

-0.14

-0.01

0.58**

-0.08

-0.07

0.61**

-0.1

-0.20*

TDSF

0.42**

0.29**

-0.25*

0.45**

0.33**

-0.25*

0.50**

0.30**

HCY= hot carcass yield; CCY= cold carcass yield; RP= rump perimeter; TP= thorax perimeter; LL= leg length; CL= carcass length; IDT= internal depth of the thorax; CCI= carcass compactness index. REA= ribeye area; TDSF= thickness of the dorsal subcutaneous fat.

The high correlations of REA with carcass length have also been reported by other authors(31) who used lactating sheep of the Manchega and Churra Tensina breeds to predict the composition of the carcass, and observed that its length was the best correlated variable (r= 0.869 and r= 0.31, respectively for each of the breeds) with the weight of the muscle and concluded that the carcass length has a positive correlation with all usable meat, because longer carcasses have longer hindquarters, which have an important contribution to meat yield. This indicates that the greater the length and width of the carcass, the greater the amount of meat could be obtained from it, since the rib-eye area has shown a close correlation with the total amount of muscle present in the carcass(36); even in Australia, sheep farmers select the longest sheep because they assure that they are the ones that will produce the greatest amount of meat(37). When examining the variables that had a correlation with the thickness of the subcutaneous fat in wool sheep, it was observed that the thoracic perimeter and the internal depth of the thorax were the variables that showed the best correlation (r= 0.45; n= 116; P>0.001 and r= 0.50; n= 116; P>0.001, respectively), which is consistent with the results of other authors(16) who, when characterizing a new wool breed, indicated that the rib is the cut best correlated with the amount of subcutaneous fat in lambs, since the rib was the region of the carcass with the highest deposit of adipose tissue(38). However, other authors who evaluated

120

Rev Mex Cienc Pecu 2022;13(1):115-126

sheep of the Manchega breed determined that there is also a high correlation (r= 0.70) between thorax width and the amount of muscle existing in the carcass(31). In the group of crossed males produced in the semi-intensive system, the highest correlations of REA with thorax width (r= 0.47**; n= 215; P<0.001) and hot carcass weight (0.43**; n= 215; P<0.001) were obtained, while the TDSF only showed a low correlation with slaughter weight (r= 0.19**; n= 215; P<0.001) (Table 4). Table 4: Correlation of rib-eye area and thickness of the subcutaneous fat with different carcass variables in crossed (hair ˣ wool) male sheep of the semi-intensive system (n=215)

Variables

Slaughter weight

Hot carcass weight

Cold carcass weight

Thorax width

Leg length

REA

0.37**

0.43**

0.39**

0.47**

0.40**

TDSF

0.19**

0.14

0.12

0.06

-0.05

REA= rib-eye area; TDSF= thickness of the dorsal subcutaneous fat.

Also in the crossed (hair ˣ wool) males, the relationship between REA and carcass weight was maintained, which coincides with what was observed in the other two groups of the semiintensive system, which may be due to the greater participation of hair breeds such as Pelibuey and Katahdin in this type of productive system(21). For its part, the correlation of REA with thorax width could be more associated with the participation of meat breeds such as Dorper, which is characterized by its dimensions of perimeter and width of the thorax, derived from the genetic improvement that has focused on the selection of animals with a wider trunk. Currently, producers seek animals with greater trunk thickness, because they are the ones with the greatest amount of muscle in the carcass(37). In general, and despite the strong variation in the sheep carcasses produced in the country, carcass weight could be a useful and practical variable to estimate the proportion of muscle that makes it up; additionally, the weighing of the carcass is an easy, fast and economical measurement. Notwithstanding the foregoing, it is convenient to obtain prediction equations for each of the autochthonous genotypes, so as to minimize the errors involved in the application of equations that were calculated for other genotypes and weight ranges(39).

121

Rev Mex Cienc Pecu 2022;13(1):115-126

Conclusions and implications Under the conditions in which the present study was carried out and despite the high heterogeneity that exists in the sheep carcasses produced in Mexico, it was observed that in hair males and females of the semi-intensive system, as well as in the hair-by-wool crosses of that same system, the weight of the carcass, both hot and cold, correlated with the rib-eye area, which is a good estimator of the proportion of muscle in the carcass. Likewise, in hair males and females of the semi-intensive system, slaughter weight correlated with the thickness of the dorsal subcutaneous fat, which indicates the degree of finishing of the animal. On the contrary, in wool males of the intensive system, measurements of carcass length and rump perimeter had the best correlations with the rib-eye area, which is known to be a true estimator of carcass muscle. In general, it can be concluded that the best correlations between the parameters studied are associated with the body characteristics of the animal and with the particularities of the carcass, which are caused by the genotype of the animal. This implies that measurements on the live animal or its carcass could be very useful for producers and processors to have a better idea of the quality of the meat they offer to the market.

Acknowledgements

The authors thank CONACYT for the funding of this work and for the scholarship for studying a master's degree in science for the first author.

Conflict of interest

The authors of this paper declare that there is no conflict of interest of any kind. Literature cited: 1. SIACOM. Servicio de Información Agroalomentaria de Consulta. https://nube.siap.gob.mx/index.php/s/AQROGZKKqEek6wh. Consultado 22 Abr, 2021. 2. SIAP. Sistema de Información Agroalimentaria y Pesquera. Resumen Nacional Producción, Precio, Valor, Animales sacrificados y Peso. http://infosiap.siap.gob.mx/anpecuario_siapx_gobmx/ResumenNacional.do;jsessionid =169DC54CFE6DCBA023DC67653184405E. Consultado 22 Abr, 2021.

122

Rev Mex Cienc Pecu 2022;13(1):115-126

3. SNIIM. Sistema Nacional de Información e Integración de Mercados. SNIIM - Sistema Nacional de Información de Mercados. Secretaría de Economía Precios de Frutas, Hortalizas, Vegetales, Carnes, Pescados, Pecuarios, Pesqueros (economiasniim.gob.mx). Consultado 22 Abr, 2021. 4. NMX-FF-106 SCFI-2006. Norma Mexicana para la Clasificación de Carne Ovina en Canal. Productos Pecuarios. Publicada en el Diario Oficial de la Federación el 21 de agosto de 2006. 5. Gutiérrez J, Rubio MS, Méndez RD. Effects of crossbreeding Mexican Pelibuey sheep with Rambouillet and Suffolk on carcass traits. Meat Sci 2005;70:1-5. doi.org/10.1016/i.meatsc.2004.10.017. 6. Bautista-Diaz E, Salazar-Cuytun R, Chay-Canul A, García-Herrera R, Piñero-Vázquez A, Magaña-Monforte J, et al. Determination of carcass traits in Pelibuey ewes using biometric measurements. Small Ruminant Res 2017;147:115-119. doi.org/10.1016/j.smallrumres.2016.12.037. 7. Partida PJA, Braña BD, Martínez RL. Desempeño productivo y propiedades de la canal en ovinos Pelibuey y sus cruzas con Suffolk o Dorset. Téc Pecu Méx 2009;47(3):313322. 8. Aguilar-Hernández E, Chay-Canul A, Gómez-Vázquez A, Magaña-Monforte J, RíosRincón F, Cruz-Hernández A. Relationship of ultrasound measurements and carcass traits in Pelibuey ewes. J Anim Plant Sci 2016;26(2):325-330. 9. Vázquez SET, Partida PJA, Rubio LMS, Méndez MD. Comportamiento productivo y características de la canal en corderos provenientes de la cruza de ovejas Katahdin con machos de cuatro razas cárnicas especializadas. Rev Mex Cienc Pecu, 2009;2(3):247258. 10. Partida PJA, Vázquez E, Rubio MS. Méndez MD. Effect of breed sire on carcass traits and meat quality of Katahdin lambs. J Food Res 2012;1(4):141-149. 11. López VMM, De la Cruz CL, Partida PJA, Torre HG, Becerril PC, Buendía RG, Jiménez BMR, Alfar RRH. Efecto de la raza paterna en las características de la canal de corderos en un sistema de producción comercial en Hidalgo, México. Rev Mex Cienc Pecu 2016;7(4):441-453. 12. Scholz AM, Bünger L, Kongsro J, Baulain U, Mitchell AD. Non-invasive methods for the determination of body and carcass composition in livestock: dual-energy X-ray absorptiometry, computed tomography, magnetic resonance imaging, and ultrasound: invited review. Animal 2015;9:1250-1264.

123

Rev Mex Cienc Pecu 2022;13(1):115-126

13. Lambe N, Navajas E, BüngerL, Fisher A, Roehe R, Simm G. Prediction of lamb carcass composition and meat quality using combinations of post-mortem measurements. Meat Sci 2009;81:711-719. doi:10.1016/j.meatsci.2008.10.025. 14. Navajas EA, Glasbey CA, Mclean KA, Fisher AV, Charteris AJL, Lambe, NR, Bünger L, Simm G. “Science: In vivo Measurements of muscle volume by automatic image analysis of spiral computed tomography scans. Anim Sci 2006;82(4):545-553. doi:10.1079/ASC200662. 15 . Ripoll G, Joy M, Alvarez-Rodríguez J, Sanz A, Teixeira A. Estimation of light lamb carcass composition by in vivo real-time ultrasonography at four anatomical locations 1. J Anim Sci 2009;87(4):1455-1463. doi: 10.2527/jas.2008-1285. 16. Camacho A, Perez V, Mata J, Bermejo LA. Ecuaciones predictoras de la composición tisular de la canal en dos razas ovinas canarias. Arch de Zootec 2011;60:1125-1135. 17. González GR, Salinas HRM, Garduza AG, Reyes MF. Componentes corporales en ovinos de pelo para abasto en el sureste mexicano. Zootec Trop 2014;32(1):23-32. 18. Vilaboa AJ, Bozzi R, Díaz RP, Bazzi L. Conformación corporal de las razas ovinas Pelibuey, Dorper y Katahdin en el estado de Veracruz, México. Zootec Trop 2010;28(3)321-328. 19. Pulgarón BPP, Castro AR, Yglesias RO. Relación entre el peso y las medidas corporales al nacimiento en hembras y machos ovinos de la raza Pelibuey. Engormix ovinos 2012. https://www.engormix.com/ovinos/foros/relacion-entre-peso-medidas-t14793/. Consultado 28 Abr, 2021. 20. NOM-033-ZOO-1995: Sacrificio Humanitario de los Animales Domésticos y Silvestres. Secretaría de Agricultura, Ganadería y Desarrollo Rural. Publicada en el Diario Oficial de la Federación el 16 de julio de 1995. 21. Partida PJA, Ríos RFG, De la Cruz CL, Domínguez VIA, Buendía RG. Caracterización de las canales ovinas producidas en México. Rev Mex Cienc Pecu 2017;8(3):269-277. http://dx.doi.org/10.22319/rmcp.v8. 22. Cañeque V, Sañudo AC. Estandarización de las metodologías para la evaluar la calidad del producto (animal vivo, canal, carne y grasa) en los rumiantes. Monografías INIA: Serie Ganadera No. 3 Madrid, España. 2005. 23. Field A. Regression. Discovering Statistics Using SPSS. 3º ed. SAGA. 2009. 24. SAS. JMP. (Statistical Discovery Software), Ver 4.0 (academy); Cary N. C. USA Inst. Inc. 2002.

124

Rev Mex Cienc Pecu 2022;13(1):115-126

25. Delfa R, González C, Teixeira A. Use of cold carcass weight and fat depth measurements to predict carcass composition of raza Aragonesa. Small Ruminant Res 1996;20:267274. 26. Safari E, Hopkins DL, Fogarty NM. Diverse lamb genotypes 4. Predicting the yield of saleable meat and high value trimmed cuts from carcass measurements. Meat Sci 2001;58:207-214. 27. Carrasco S, Ripoll G, Panea B, Álvarez-Rodríguez J, Joy M. Carcass tissue composition in light lambs: Influence of feeding system and prediction equations. Livest Sci 2009; 126:112-121. doi:http://dx.doi.org/10.1016/j.livsci.2009.06.006. 28. Cavanauh CR, Jonas E, Hobbs M, Thomson PC, Tamman I, Raadsma HW. Mapping Quantitative Trait Loci (QTL) in sheep. III. QTL for carcass composition traits derived from CT scan and aligned with a meta-assembly for sheep and cattle carcass QTL. Genet Select Evol 2010;42:36. 29. Silva SR, Gudes CM, Santos VA, Lourenco Al, Azevedo JM, Dias-da Silva A. Sheep carcass composition estimated from Longissimus thoracis et lumborum muscle volume measured by in vivo real-time ultrasonography. Meat Sci 2007;76(4):708-714. doi: 10.1016/j.meatsci.2007.02.009. 30. Morais MG, Biava MB, Bertholini RC, Walker CC, Fernandes HJ, Duarte LSAR, Brandão FÍCC, Dias FGL. Models predict the proportion of bone, muscle, and fat in ewe lamb carcasses from in vivo measurements of the 9th to 11th rib section and of the 12th rib. Semina: Ciências Agrárias 2016;37(2):1081-1090. doi:10.5433/16790359.2016v37n2p1081. 31. Díaz MT, Cañeque V, Lauzurica S, Velasco S, Ruiz de Huidobro F, Perez C. Prediction of suckling lamb carcass composition from objective and subjective carcass measurements. Meat Sci 2004;66:895-902. doi.10.1016/j.meatsci.2003.08.013. 32. Leeds TD, Mousel MR, Notter DR, Zerby HN, Moffet CA, Lewis GS. B-mode real-time ultrasound for estimating carcass measures in live sheep: Accuracy of ultrasound measures and their relationships with carcass yield and value. J Anim Sci 2008;86:32033214. doi: 10.2527/jas.2007-0836. 33. Orman A, Calışkan UG, Dikmen S, Ustuner H, Oğan M, Calışkan C. The assessment of carcass composition of Awassi male lambs by real-time ultrasound at two different live weights. Meat Sci, 2008;80:1031-1036. doi:10.1016/j.meatsci.2008.04.022. 34. Orman A, Caliskan GU, Dikmen S. The assessment of carcass traits of Awassi lambs by real-time ultrasound at different body weights and sexes. J Anim Sci 2010;88(10):34283438. doi:10.2527/jas.2009-2431.

125

Rev Mex Cienc Pecu 2022;13(1):115-126

35. Wolf BT, Jones DA, Owen MG. In vivo prediction of carcass composition and muscularity in purebred Texel lambs. Meat Sci 2006;74(2):416-423. doi:10.1016/j.meatsci.2006.02.019. 36. Williams AR. Ultrasound applications in beef cattle carcass research and management. J Anim Sci 2002;80:183-188. doi:10.2527/animalsci2002.80E-Suppl_2E183x. 37. Anderson F, Pannier L, Pethick DW, Gardner GE. Intramuscular fat in lamb muscle and the impact of selection for improved carcass lean meat yield. Animal. 2015.1081-1090. doi: 10.1017/S1751731114002900. 38. Yakan A, Ünal N. Meat production traits of a new sheep breed called Bafra in Turkey 1. Fattening, slaughter, and carcass characteristics of lambs. Trop Anim Health and Produc 2010;42(4):751-759. doi 10.1007/s11250-009-9483-8. 39. Lauz FOG, Diniz RF, Teixeira CRA. Francieli FV, Benetti M. Measurement of rib-eye area by the method of digital images. R Bras Zootec 2012;4(3). doi.http://dx.doi.org/10.1590/51516-35982012000300047.

126

Rev Mex Cienc Pecu 2022;13(1):127-144

https://doi.org/10.22319/rmcp.v13i1.5888 Article

Financial performance and opportunistic commercialization of beef production systems in southern Brazil

Amir Gil Sessim a* Maria Eugênia Andrighetto Canozzi b Gabriel Ribas Pereira a Eduardo Madeira Castilho c Júlio Otávio Jardim Barcellos a

Federal University of Rio Grande do Sul – UFRGS. Faculty of Agronomy, Department of Animal Science. Porto Alegre, RS, Brazil. a

Instituto Nacional de Investigación Agropecuária (INIA). Estación Experimental INIA. Programa Producción de Carne y Lana. La Estanzuela, Colonia, Uruguay. Federal University of Pelotas – UFPEL. Faculty of Agronomy, Department of Animal Science. Pelotas, RS, Brazil. c

*Corresponding author: amirsessim@hotmail.com

Abstract: This study compares the technical and financial performance of different beef cattle production systems and assesses the opportunistic commercialization practiced in these systems. It was evaluated data from four production units located in southern Brazil: cowcalf in native pastures (CCNP; 1,155 ha; 1,529 animals); cow-calf with agriculture (CCA; 1,008 ha; 1,313 animals); rearing-fattening (RFU; 360 ha; 435 animals); and fattening (FU; 205 ha; 168 animals) as well as an integrated system simulating the physical and economic parameters of the four units (IAS; 2,728 ha; 3,445 animals). The four independent units were considered as opportunistic commercialization and IAS as nonopportunistic. The highest yield was obtained for RFU (297 kg/ha), followed by IAS (114 kg/ha), FU (98 kg/ha), CCNP (87 kg/ha), and CCA (83 kg/ha). The CCNP was the most economically efficient, considering the gross margin per kilogram (GM/kg) (US$ 0.93).

127

Rev Mex Cienc Pecu 2022;13(1):127-144

The GM/kg value of IAS (US$ 0.74) was 37 % higher compared to the sum of the average of the four units (US$ 0.54), and IAS had the lowest total production costs per kg (22.5 %). It was concluded that each independent unit could increase GM/kg (37 %) and GM/ha (3.8 %) and use calves in a rearing-fattening unit for further sale. Hence, the integration of beef production systems increases the gross margin of firms, presenting a profitable business advantage to rural entrepreneurs through non-opportunistic commercialization. Key words: Animal production, Economy, Gross revenue, Integration, Production cost.

Received: 03/12/2020 Accepted: 07/06/2021

Introduction The increased global demand for meat, especially beef, has kept cattle prices high since 2011(1). Under these market conditions, management improvements in beef production could yield significant economic gains. However, farmers must avoid opportunistic marketing processes, which are common in the production of Brazilian beef cattle(2-3). Opportunistic commercialization arises when farmers make commercial transactions in moments that they believe are the more advantageous; however, these opportunities do not always present themselves in a timely manner and this can lead to a reduction in the economic margin for the system. In independent systems within the same agricultural company, these events occur more often. Beef cattle profitability is closely related to the costs and efficiency of production. However, many farmer managers do not have an accurate knowledge of their farm’s costs, which compromises the management of the system(4). By contrast, production intensification, through efficient management activity, has become more widespread during the last decade resulting in interesting economic achievements(5). Hence, a more precise knowledge of production costs is a prerequisite for the establishment of efficient beef cattle systems. Integrating different activities within the same segment of the production system can increase profitability. For instance, this increase could be achieved by the exchange of information and resources, reduced transaction and production costs, increased purchasing power, and higher productivity(6). Indeed, many managers have been using

128

Rev Mex Cienc Pecu 2022;13(1):127-144

simulation software and databases to increase efficiency and profitability in beef cattle systems(7-8). Thus, production and financial management have become key factors for the economic viability of beef production systems, and their practical performance is fundamental for farmers to decide the best strategy to achieve better economic results. However, there are doubts regarding the financial performance and profitability of the stages of food production, whether they are conducted as one system or separately, and there is no concise study to aid decision-making. Therefore, the objective was to evaluate the technical and financial performance and the opportunistic commercialization from an integrated system compared to independent production units of different beef production systems.

Material and methods Data were collected from different production systems representative of southern Brazil. All analyses were performed using spreadsheets to compare the cattle physical parameters and the economic results between the productions units, as described previously(9-10). It is important to note that the production system is the most appropriate and modern term to refer to farms, considering that they are represented only by animal production, only by plant production or by the integration between both productions. It was evaluated records from four production units located at the same farming company in Dom Pedrito, Rio Grande do Sul, Brazil (latitude 30° 58' 33.885" S and longitude 54° 40' 11.657" W) between July 2014 and June 2015. The farm units have their own commercialization and are not integrated as a system. The farm units are in the Pampa Biome, a region characterized by a predominance of natural grassland with great biodiversity and a high capacity for forage production(11). The annual rainfall in the region is between 1,250 and 1,600 mm; during the current study, the average rainfall was 1,345 mm(12). The production units (Table 1) were: cow–calf in native pastures (CCNP); cow–calf with agriculture (CCA); rearing–fattening unit (RFU); and fattening unit (FU). It was simulated an additional unit, the integrated activities system (IAS), to represent the four units (CCNP, CCA, RFU, and FU) in a single system operating synergistically.

129

Rev Mex Cienc Pecu 2022;13(1):127-144

Table 1: Characterization of beef cattle production systems in southern Brazil CCNP CCA RFU FU IAS Beef production area, ha 1,155 1,008 360 205 2,728 Cultivated pasture area, % 8 41 46 12 Average annual herd size, head 1,529 1,313 435 168 3,445 Average annual stocking, AU/ha 0.85 0.7 0.8 0.7 0.76 Employees, No. 4 7 1 1 13 CCNP= cow-calf in native pasture unit; CCA= cow-calf with agriculture unit; RFU= rearing-fattening unit; FU= fattening unit, IAS; integrated activities system, AU= animal unit.

To generate the IAS data, the production area and the animals of the system were obtained by the sum of four independent units. However, the production and the revenues of the system were considered only by the sale of steers from RFU and cull cows from CCNP and FU. For costs, the sum costs of the four independent units were considered, except the animals’ purchase and its transactions from RFU and FU, as well as costs of transactions of calves from CCNP and CCA. Thus, the IAS was considered as a whole cycle that sell steer and cull cows from its own production. The commercialization of four independent units was performed according to the owner business activity. Thus, it was considered that the independent units were conducted by opportunistic commercialization. In contrast, it was considered that the IAS marketed animals at the end of its productive cycle, independently of a better commercialization opportunity for animals that were not the final product (steer and cull cow). Therefore, the IAS was considered as a non-opportunistic commercialization system.

Animal feeding

Animal feeding was based on the natural pasture characteristics of the Pampa Biome, composed of grass (Poaceae) such as Paspalum, Axonopus, Panicum, and legumes (Fabaceae) such as Adesmia, Lathyrus, and Trifolium(13). In addition, the pastures were over-seeded with winter annual soybean residue in the cultivated area of the CCA unit. Animals were placed in the CCA and RFU units with a cultivated ryegrass pasture. In the RFU unit, an exclusive area was reserved for livestock during winter pastures (Figure 1). Mineral supplementation and water were offered ad libitum for all animals in all units.

130

Rev Mex Cienc Pecu 2022;13(1):127-144

Figure 1: Schedule of the use of forage resources from July 2014 to June 2015 in cowcalf in native pasture unit (CCNP), cow-calf with agriculture unit (CCA), rearingfattening unit (RFU), fattening unit (FU) and integrated activities system (IAS)

Reproductive management

The mating season was between November and January, including fixed-time artificial insemination (cows), artificial insemination (heifers), and natural breeding in all females that were not pregnant from the insemination procedures. Weaning occurred in April when all calves reached 180 d of age. Heifers were maintained in the units until the first mating at 24 mo. Prior to implementing active reproductive management, heifers were selected based on a minimum body weight (BW) of 300 kg. Primiparous cows not conforming to breed standards, with a lower body condition score (BCS) of 3 (on a scale of 1 to 5)(14), and non-pregnant cows were evaluated by ultrasonography.

Characterization of production systems

The production flowchart demonstrates how the systems work and each unit is described in Figure 2.

131

Rev Mex Cienc Pecu 2022;13(1):127-144

Figure 2: Production flowchart of cow-calf in native pasture (CCNP), cow-calf with agriculture (CCA), rearing-fattening (RFU) and fattening (FU) in beef cattle

Cow–calf in native pastures (CCNP): comprised Braford animals. In this unit, all male calves were sold with a mean of 160 kg/BW, usually between April and May. In addition, culling cows were sold between June and November, with a mean of 450 kg/BW. Cow–calf with agriculture (CCA): this unit was similar to the CCNP unit but included an 8 % cultivated ryegrass pasture (Lolium multiflorum) and Angus animals. This CCA unit marketed all male calves between April and May (mean, 160 kg/BW). In addition, heifers that did not meet the minimum 300 kg/BW for mating at 24 mo and cull cows were directed to commercialization immediately after the pregnancy diagnosis, even when thin. Rearing–fattening unit (RFU): this unit received Angus and Braford males from CCNP and CCA. Calf rearing started in April when the animals were 7 mo old (mean, 160 kg/BW) in ryegrass pasture and ended in late February in native pastures (mean, 340 kg/BW). The animals were subsequently maintained in native and cultivated pastures and sold for slaughter when they reached a minimum of 440 kg/BW. Animals that did not reach 440 kg/BW by September were kept on cultivated pasture and marketed in November. 132

Rev Mex Cienc Pecu 2022;13(1):127-144

Fattening unit (FU): Angus cull cows from the CCA unit were included in the FU, which began in April with the cows having a mean of 390 kg/BW, until September when they were sold for slaughter at 460 kg/BW. All cows were kept on native pastures during the fattening period, except from May to July, when animals were allocated to an oats pasture (Avena strigosa). Integrated activities system (IAS): this unit included Angus and Braford animals for all the activities used in the production systems. Male calves were weaned when they were 7 mo old (mean, 160 kg/BW), kept on ryegrass pasture from April to November, and remained in native pastures until March. In April, the steers returned to the ryegrass pasture, where they remained until reaching 440 kg/BW, then slaughtered. Females were kept on native pastures from September to April and allocated for fattening on oat pasture from May to July. Sales were carried out between June and November upon achieving 460 kg/BW (multiparous cows), 450 kg/BW (primiparous), and 420 kg/BW (heifers) (Figure 3). Figure 3: Production flowchart of integrated activities system

In addition, a flowchart was developed for the herd structure used in this study, its mean annual production units, and IAS (Table 2).

133

Rev Mex Cienc Pecu 2022;13(1):127-144

Table 2: Herd structure annual of beef cattle production systems in southern Brazil CCNP CCA RFU FU IAS Category Head (%) Head (%) Head (%) Head (%) Head (%) Breeding cows 612 (40) 594 (45) 0 0 1,206 (35) Calves 459 (30) 420 (32) 0 0 879 (25) Females 1-2 yr 245 (16) 240 (19) 0 0 485 (14) Males 1-2 yr 15 (1) 29 (2) 350 (80) 0 394 (11.5) Males 2-3 yr 0 0 85 (20) 0 85 (2.5) Culled cows 168 (11) 0 0 168 (100) 336 (10) Bulls 30 (2) 30 (2) 0 0 60 (2) Total 1,529 (100) 1,313 (100) 435 (100) 168 (100) 3,445 (100) CCNP= cow-calf in native pasture unit; CCA= cow-calf with agriculture unit; RFU= rearing–fattening unit; FU= fattening unit; IAS= integrated activities system.

Technical and financial analysis

The weaning rate was calculated based on the production data—defined as the ratio between the number of weaned calves and total number of cows exposed to mating in a previous year—and the ratio of weaned calves for hectares. The estimated productivity was defined as the ratio of kilograms produced per hectare. In addition, it was obtained each unit’s costs and classified these as either fixed (FC: US$) or variable (VC: US$). The costs of associations, unions, and federal taxes, which were initially not stratified, were divided among the production units according to the area available for livestock. The total amount of technical assistance, electricity, and business office expenses were divided proportionally between the areas of livestock and agriculture. It was only considered the amount paid related to livestock to calculate the costs of each unit in the beef production systems. The mean value of each unit (US$/kg) during the study period was used as the selling price: US$ 2.26 (calves), US$ 1.59 (underweight cows), US$ 1.62 (culled cows), and US$ 1.73 (steers). It was also calculated the total sales of these categories and the total revenues (TR) of each production unit. From the costs and revenues, it was calculated the total cost (TC), the sum of the FC and VC, and the gross margin (GM, the difference between TR and TC). Data were collected from the production units over one year and information on production costs were corrected to the average values of the last 5 yr as practiced in the market and adjusted by the General Price Index (IGP). Data were obtained in Brazilian reals (R$) and converted to U.S. dollars (US$). To observe the consistency of these results, a sensitivity analysis was performed, in which nine different scenarios for GM/ha and GM/kg between the IAS and the sum of means of 134

Rev Mex Cienc Pecu 2022;13(1):127-144

the four independent units (MFIU). In this analysis, prices used for production costs and kilograms marketed were the current prices within a range from 10 % decrease and 10 % increase(15).

Results The physical parameters of the beef cattle produced by each unit showed that the RFU presented a productivity of 341, 358, 303, and 260 % higher than the CCNP, CCA, FU and IAS, respectively. The highest proportion of labor in the production costs was in the CCA unit (50.3 %), followed by IAS (42 %), CCNP (39.5 %), FU (9.2 %), and RFU (5.6 %) (Table 3). Animal purchase (67.7 %) and animal feeding (19.3 %) were the major costs in the RFU. In the FU, animal purchase (82.3 %) and labor (9.2 %) were the major costs. Table 3: Physical parameters and production costs according to the type of productive activity of beef cattle production systems in southern Brazil CCNP CCA RFU FU IAS Physical parameters Productivity, 87 83 297 98 114 kg/ha ADG, kg/d 0.49 0.4 0.7 0.65 0.58 Weaning rate/ha, 0.4 (75) 0.42 (71) 0 0 0.32 (73) (%) Production costs Fixed costs (FC) US$ (%) US$ (%) US$ (%) US$ (%) US$ (%) 1,045.71 2,297.89 997.13 (0.7) 197.58 (0.1) 57.46 (0.05) Taxes (0.9) (0.7) 48,832.09 75,269.52 11,345.16 9,651.29 145,098.06 Labor (39.5) (50.3) (5.6) (9.2) (42) 49,877.80 76,266.65 11,542.74 9,708.75 147,395.95 Subtotal FC (40.4) (51) (5.7) (9.25) (42.7) Variable costs US$ (%) US$ (%) US$ (%) US$ (%) US$ (%) (VC) 36,896.37 36,850.23 39,138.35 3,622.97 116,507.91 Animal feed (29.8) (24.6) (19.3) (3.5) (33.7) Animals 8,490.00 8,490.00 137,285.72 86,342.76 16,980.00 purchase (6.9) (5.7) (67.7) (82.3) (4.9) Variable 4,346.55 4,105.77 2,251.29 10,930.56 226.95 (0.35) expenses (3.5) (2.7) (1.1) (3.2) 15,242.11 14,948.12 30,190.23 0 0 Reproduction (12.3) (10) (8.7)

135

Rev Mex Cienc Pecu 2022;13(1):127-144

Animal health Transaction

8,345.46 (6.7)

8,542.13 (5.7)

446.84 (0.4)

418.84 (0.3)

73,767.33 Subtotal VC (59.7) 123,645.13 Total (FC + VC) (100)

73,383.09 (49) 149,649.74 (100)

5,372.98 (2,6) 7,225.56 (3.6) 191,273.89 (94.3) 202,816.63 (100)

351.82 (0.3) 4,546.36 (4.3) 95,090.86 (90.75) 104,799.61 (100)

22,612.39 (6.5) 893.68 (0.3) 198,114.77 (57.3) 345,510.72 (100)

CCNP= cow-calf in native pasture unit; CCA= cow-calf with agriculture unit, RFU= rearing–fattening unit; FU= fattening unit; IAS= integrated activities system; ADG= average daily gain.

The RFU (563.4 US$/ha) and FU (511.2 US$/ha) had the highest production costs per hectare (Figure 4a). The CCA unit had the highest production cost per kg (US$ 1.65), while the CCNP (0.93 US$/kg) and IAS (1.85 US$/kg) units had the lowest and second lowest production cost per kg/BW, respectively. In addition, there was also a reduction in cost/kg of 22.5 % when comparing the mean cost/kg of the four independent units (US$ 1.20) with that of the IAS (US$ 0.93). Figure 4: a) Production cost (US$/ha and US$/kg b) Gross margin (US$/ha and US$/kg)

Cow-calf in native pasture unit (CCNP), cow-calf with agriculture unit (CCA), rearing-fattening unit (RFU), fattening unit (FU) and integrated activities system (IAS).

The GM presented the greatest variation between the RFU (251.5 US$/ha) and CCA (17.25 US$/ha) units. In addition, there was a difference of 114 % when comparing RFU (251.5 US$/ha) and CCNP (117.3 US$/ha), the units with the highest GM. However, the CCNP (US$ 0.93) showed the best results for GM/kg, followed by IAS (US$ 0.74) and RFU (US$ 0.53). Moreover, when comparing GM/ha and GM/kg of MFIU (US$ 96.58; US$ 0.54) and IAS (US$ 100.28; US$ 0.74), we observed that the IAS showed a better result, yielding an increase of 3.7 % and 37 % in GM/ha and GM/kg, respectively (Figure 4b). The simulation of the scenarios with different production costs and kilograms marketed showed that the IAS presented superior results for GM/kg and GM/ha in nine and six scenarios, respectively (Table 4). 136

Rev Mex Cienc Pecu 2022;13(1):127-144

Discussion The higher productivity of the RFU can be accounted for by the higher ADG (0.7 kg/d) of the animals used, which is a consequence of the long ryegrass feeding period (240 d). The long period of cultivated pasture was due to the climate of southern Brazil, where the average temperature and pluviometry levels are favorable to ryegrass cultivation. Technologies such as cultivated pastures are capable of considerably increasing production rates in pasture systems for beef cattle, especially in periods of lower food supply such as winter(16-18). Higher productivity (356 kg/ha) was reported in rearing–fattening with winter and summer cultivated pastures(19) compared with the cultivated pasture systems used in RFU. The manager's decision to cultivate pasture involves increasing the system's complexity and production costs, however, as shown in the present results, this can increase productivity. Nevertheless, the manager must assess whether there will be an economic benefit to the system when implementing this type of technology. A simulation study(8) reported a similar productivity to the CCNP unit in a cow–calf systems (87 kg/ha). The lower productivity of the CCA unit (83 kg/ha) in this study is justified by the low body weight of culled cows, which are sold lean with 340 kg by decision of the producer not to fatten them. Furthermore, the CCA result is a consequence of changes in the production system caused by the sale of underweight cows. Originally, this unit was designated to market calves and adult cows that did not achieve greater productivity. In line with the CCA productivity reported here, it was reported a productivity of 79 kg/ha for underweight cows after weaning from a cow–calf system in southern Brazil(20). The low productivity of the FU (98 kg/ha) can be explained by the reduced number of animals being sold for slaughter. This occurred because of the relatively low ADG (0.4 kg/day), which did not meet market requirements. The low stocking rate was due to the 46% reduction in the total livestock area because of reassignment to soybean cultivation between September and May. The decision to keep fewer animals for fattening was taken by the farmer as a precaution; therefore, cattle could be allocated to a natural grazing area to support the total stocking. In the IAS, the reduced number of animals for fattening prevented greater production in terms of kg/ha but offered better production rates. The high proportion of labor in the production costs of the CCA unit (50.3 %) was due to a low worker-to-animal ratio (1/188). The lower ratio was a consequence of the greater complexity of the unit when compared with RFU and FU, and the need for qualified human resources due to the higher level of technology employed within the unit compared to the CCNP. Interestingly, it was reported that labor accounted for up to 64 % of total costs due to the low cost of the new technologies used for cow–calf systems(7). By

137

Rev Mex Cienc Pecu 2022;13(1):127-144

contrast, in complete-cycle systems, labor accounts for just 25 % of the total costs because of the higher costs for animal feeding and the greater worker-to-animal ratio (1/302)(21). Moreover, using the percentage of total cost to evaluate labor can be misleading due to the different characteristics of each system, which can result in large variations in costs. The lower purchase costs for the FU animals (15 % of total costs) compared to that of RFU animals was owing to the greater proportion of feeding costs for the FU in its total production costs. A study conducted in Brazil reported on two rearing–fattening systems in which 43 % and 61 % of the total costs were associated with animal purchases, resulting in higher feeding costs by 30 % and 9 %, respectively(22). According to authors, the superiority of one system related to the animal purchase costs was a consequence of the difference in the feeding costs between each system. In 2015, the livestock cost (per kg) from cow–calf systems in southern Brazil was US$ 1.26, higher than the CCNP (US$ 0.85) and lower than the CCA (US$ 1.65)(23). In fact, due to the high costs of pasture management, the RFU was cheaper (US$ 1.2) than the rearing–fattening systems on similar pastures in southern U.S. (US$ 3.02)(19). The low production costs presented by the IAS reflected the lower fixed costs due to integrating activities. Furthermore, the 22.5 % reduction in production cost between the independent and IAS units clearly indicates that the IAS is economically more promising among the evaluated activities. This difference was due to the lower animal purchase costs because the integrated system did not purchase animals for rearing and fattening— the system produced its own calves for rearing and cull cows for fattening. The superior GM/kg results for the CCNP, compared to the RFU and IAS units, indicate that CCNP is the most economically efficient unit. This difference was a consequence of the higher sales volume and better price received per kg/BW sold (US$ 0.10 and 0.04 higher than the IAS and RFU units, respectively). The difference in market price was linked to the timing of animals marketed: the CCNP calves sold, the steers sold from the RFU during the period of low prices, and the steers and culled cows sold from the IAS units during periods of lower retail beef prices. In contrast, a study showed a reduction in economic margins due to the low level of technology employed in the system, the value of land, and low productivity(10). Thus, good economic results depend on an understanding of these market changes(24). Moreover, other authors identified the fattening system as having the highest productivity yet found that the cow–calf system was the most profitable(8). For these authors, the results can be related to sale requirements during dry periods and therefore, to the increase in feeding costs not compensated by the price paid per kilogram. In a simulation of the rearing–fattening grazing system was found only small profit margins using slaughter animals at 18 mo(19). This was a result of the high cost of pastures used for animal fattening. In a whole-cycle system, in the same area as used in this study, was reported higher values for GM/ha and GM/kg by US$ 291.9 and US$ 2.1, respectively, compared 138

Rev Mex Cienc Pecu 2022;13(1):127-144

to IAS in this work due to the inclusion of the land opportunity costs and the depreciation of rural facilities into the final costs of the production systems(21). The GM values can be explained by the sale of underweight cows (CCA unit) and the low number of culled cows (FU) obtained from the lowest price received during the sales. After all, the timing of culled cow sales has an important economic impact(25). A study with higher technology employed in the production and feeding of animals compared to the present study, reported mean GM/ha values for cow–calf (US$ 518/ha) and fattening systems (US$ 451/ha)(8). Which makes it clear that the main reason for small GM was the low investment in animal feed technology (CCNP) or in a better control in the other stages of production, such as the moment of purchase and sale of animals (CCA and FU). The GM/ha and GM/kg of the IAS are higher than that of the MFIU by 3.8 % and 37 %, respectively, showing that the integration of activities with non-opportunistic commercialization is crucial for improving economic indicators. These improvements are mainly driven by lower animal purchase costs and better use of labor(6). In this study, the integration of beef production systems improved the economic margin by reducing the costs of livestock transaction and allowing better use of human resources. Thus, detailed analyses of production and financial data are essential to ensure the economic viability of beef production systems. The IAS values are better than the MFIU values for GM/kg in all scenarios and for GM/ha in six out of the nine simulated scenarios, demonstrating that the results found in this study are consistent and can be repeated in different situations. MFIUs showed higher GM/ha values than the IAS in three scenarios due to the difference generated by the simulation between prices of inputs and kilograms marketed, reducing the importance of the share of costs used for purchasing animals in the GM calculation. If the variation values used were 5 %, which represents a smaller challenge for the consistency of the presented data, the results would be better for IAS in all cases. Therefore, this shows that opportunistic commercialization is not beneficial to beef cattle production systems. Although not covered in the study, as these are real production systems, other decisionmaking could be recommended to improve the productive and economic standards of the farms. Among them, the use of technologies external to the system, such as the use of creep-feed to increase the weight at weaning of calves. Another strategy that could be considered is the lease of production areas for the fattening of cull cows or even to improve the rearing of male calves. It is emphasized that several possibilities exist outside the productive environment of a farm that can help in improving the results, but for this it is necessary a good planning and the adequate management of the production to reach the objectives outlined in an efficient way.

139

Rev Mex Cienc Pecu 2022;13(1):127-144

Conclusions and implications The knowledge of all costs and potential revenues of the different beef cattle production systems are essential to obtain the best financial performance. Independent production units can achieve better economic results when integrate in a whole cycle system using the calves in a rearing-fattening for future sale. This is due to a non-opportunistic commercialization, that reduce the costs of animal purchase and its transactions, and a better use of human resources in an integrated system. These findings also demonstrate that detailed characterization of cattle systems is needed for an accurate assessment of their economic viability. Hence, this should be the starting point for efficiency improvements of the beef production system.

140

Rev Mex Cienc Pecu 2022;13(1):127-144

Table 4: Simulation of gross margin (GM) per hectare and kilogram with 10 % increase or decrease and actuals prices for production costs and kilograms marketed in southern Brazil (US$) Kilograms Production costs marketed -10% Actuals +10% GM/ha GM/kg GM/ha GM/kg GM/ha GM/kg IAS MFIU IAS MFIU IAS MFIU IAS MFIU IAS MFIU IAS MFIU -10% 84.85 81.52 0.63 0.46 77.59 65.63 0.57 0.37 70.32 49.74 0.52 0.28 Actuals 107.54 112.47 0.79 0.63 100.28 96.58 0.74 0.54 93.02 80.69 0.69 0.46 +10% 130.23 143.43 0.96 0.81 122.97 127.53 0.91 0.72 115.71 111.64 0.85 0.63 IAS= integrated activities system; MFIU= mean of four independents units.

141

Rev Mex Cienc Pecu 2022;13(1):127-144

Acknowledgments

This study was supported by the Brazilian Council of Scientific and Technological Development (Project CNPq No. 133454/2014-2) and the Coordination for the Improvement of Higher Education Personnel/CAPES, Brazil (Project CAPES/PNPD No. 2842/2010). Literature cited: 1.

United States Department of Agriculture – USDA. Livestock and poultry: world markets and trade. 2018 https://downloads.usda.library.cornell.edu/usdaesmis/files/73666448x/mg74qq69r/j6731729p/livestock_poultry.pdf Accessed Jan 17, 2019.

Euclides FK. Supply chain approach to sustainable beef production from a Brazilian perspective. Livest Prod Sci 2004;90:53-61.

Oliveira TE, Gianezini M, Peripoli V, Barcellos JOJ. Marketing alliances and differentiation strategies in the beef supply chain in Brazil. Rev Ibero-Am de Est 2015;14:40-50.

Bravo UBE, Solís D, López VHM, Maripani JF, Thiam A, Rivas T. Technical efficiency in farming: A meta-regression analysis. J Prod Anal 2007;27:57-72.

Ash A, Hunt L, Mc Donald C, Scanlan J, Bell L, Cowley R, et al. Boosting the productivity and profitability of northern Australian beef enterprises: Exploring innovation options using simulation modelling and systems analysis. Agric Syst 2015;139:50-65.

Schroede TC, Kovanda J. Beef alliances: motivations, extent, and future prospects. Vet Clin North Am Food Anim Pract 2003;2:397-417.

Åby BA, Aass L, Sehested E, Vangen O. A bio-economic model for calculating economic values of traits for intensive and extensive beef cattle breeds. Lives Sci 2012;143:259-269.

Nasca J, Feldkamp CR, Arroquy JI, Colombatto D. Efficiency and stability in subtropical beef cattle grazing systems in the northwest of Argentina. Agric Syst 2015;133:85-96.

Ruviaro CF, Costa JS, Florindo TJ, Rodrigues W, Medeiros GIB, Vasconcelos BS. Economic and environmental feasibility of beef production in different feed management systems in the Pampa biome, southern Brazil. Ecol Indic 2016;60:930939.

142

Rev Mex Cienc Pecu 2022;13(1):127-144

10. Siqueira TTS, Duru M. Economics and environmental performance issues of a typical Amazonian beef farm: a case study. J Clean Prod 2016;112:2485-2494. 11. Carvalho PCF, Batello C. Access to land, livestock production and ecosystem conservation in the Brazilian Campos biome: the natural grasslands dilemma. Livest Sci 2009;120:158-162. 12. Instituto Nacional de Meteorologia (INMET). 2016. http://www.inmet.gov.br Consultado: 10 Ago, 2016. 13. Carvalho PCF. Pasture country profile: Brazil. In: Plant production and protection division. Food and Agriculture Organization 2006 http://www.fao.org Accessed Jan 11, 2019. 14. Lowman BG, Scott NA, Somerville SH. Condition scoring of cattle. In: Agric Anim Prod, East Scotland Coil 1976;6. 15. Pang H, Makarechian M, Basarab JA, Berg RT. Structure of a dynamic simulation model for beef cattle production systems. Can J Anim Sci 1999;79:409-417. 16. Braz SP, Urquiaga S, Alves BJR, Jantalia CP, Guimarães APP, Santos SC, Pinheiro EFM, Boddey RM. Soil carbon stocks under productive and degraded pastures in the Brazilian Cerrado. Soil Sci Soc Am J 2019;77:914-928. 17. Dill MD, Emvalomatis G, Saatkamp H, Rossi JA, Pereira GR, Barcellos JOJ. Factors affecting adoption of economic management practices in beef cattle production in Rio Grande do Sul state, Brazil. J Rural Stud 2015;52:21-28. 18. Silva RO, Barioni LG, Hall JAJ, Matsuura MF, Albertini TZ, Fernandes FA, Moran D. Increasing beef production could lower greenhouse gas emissions in Brazil if decoupled from deforestation. Nat Clim Change 2016;6:493–497. 19. Scaglia G, Rodriguez J, Gillespie J, Bhandari B, Wang JJ, Mc Millin KW. Performance and economic analyses of year-round forage systems for forage-fed beef production in the Gulf Coast. J Anim Sci 2014;92:5704-5715. 20. Vaz RZ, Lobato JFP, Restle J. Analysis of the economic efficiency of cow-calf systems with different ages of weaning. Biosci J 2014;6:1837-1845. 21. Oaigen RP, Barcellos JOJ, Christofari LF, Neto JB, Oliveira TE, Prates ER. Internal competitiveness in beef cattle activity in the State of Rio Grande do Sul. Ciênc Rural 2011;6:1002-1007. 22. Pini TRM, Alencar SAS, Lucas LS, Brumatti RC, Franco GL, Mourão GB, Silva SL. Economic analysis of beef cattle production systems. B Indústr Anim 2014;71:4757.

143

Rev Mex Cienc Pecu 2022;13(1):127-144

23. Escola Superior de Agricultura Luiz de Queiroz-Centro de estudos avançados em economia aplicada (ESALQ-CEPEA). Production costs in livestock. 2016 http://cepea.esalq.usp.br/boi. Consultado 13 Jun, 2016. 24. Mc Hugh N, Fahey AG, Evans RD, Berry DP. Factors associated with selling price of cattle at livestock marts. Animal 2010;8:1378-1389. 25. Turner BL, Rhoades RD, Tedeschi LO, Hanagriff RD, Mc Cuistion KC, Dunn BH. Analyzing ranch profitability from varying cow sales and heifer replacement rates for beef cow-calf production using system dynamics. Agric Syst 2013;114:6-14.

144

https://doi.org/10.22319/rmcp.v13i1.5816 Article

Business models for sheep production in the Northeast and center of the State of Mexico

Judith Calderón-Cabrera a Vinicio Horacio Santoyo-Cortés a Enrique Genaro Martínez-González a* Víctor Herminio Palacio-Muñoz a

Universidad Autónoma Chapingo. Centro de Investigaciones Económicas Sociales y Tecnológicas de la Agroindustria y la Agricultura Mundial (CIESTAAM). Km 38.5 Carretera México-Texcoco, C.P. 56230, Chapingo, Estado de México, México.

*Corresponding author: enriquemartinez@ciestaam.edu.mx

Abstract: Sheep farming is important because of the growing demand and the benefits it generates. However, to boost its productivity, it is required to know its business characteristics. The objective of the research was to explain the environment in which production takes place and to define the main business models, to specify their development prospects. A semistructured interview was applied to 32 companies. To analyze the profile of the producer and the production unit, descriptive statistics was used and to typify the companies depending on their business model, a cluster analysis was used. It was found that, due to the proximity to large urban centers, production is located in a peri-urban area with high demand for resources such as land and water, participates in a short-circuit commercial chain and producers carry out the activity in a complementary way. Under this context, three business models were identified: i) the traditional, which offers animals without differentiated attributes, without making productive and commercial improvements, which develops the activity in an inertial way and without prospects for improvement; ii) the intermediate, which shows greater willingness to apply technical, commercial and managerial knowledge, due to the schooling of its producers; and iii) the specialized, where a better productive management is carried

145

Rev Mex Cienc Pecu 2022;13(1):145.162

out, offering high-value products. It is concluded that, to boost productivity, it is necessary to take into account the business model and the environment, because only once the needs of the market are met, producers will improve their competitiveness. Key words: Sheep farming, Sheep, Family companies, Environment.

Received: 24/09/2020 Accepted: 13/04/2021

Introduction Livestock production systems are dynamic and are influenced by external and internal factors, which generate diversity, so to establish development strategies, it is necessary to differentiate them. In this sense, typifying has been one of the most used tools to have differentiated models(1). This tool groups the study subjects in the most homogeneous way possible, by means of some variable or the use of multivariate statistical methods such as cluster, factorial or principal component analysis(2). Due to the importance of sheep production in Mexico, there are investigations that have generated typologies through the application of multivariate statistics, based on the profile of the producer(1,3), productive management(4), the structure of the production unit(2,5,6) or the level of family participation(7); in order to characterize production systems and be a point of reference in the design of strategies. These characteristics are based on internal factors of the companies; however, there are external factors that affect their viability and existence, so it is necessary to analyze them together with the Business Model (BM). The BM allows understanding how the choices that are made affect competitiveness, in addition to facilitating the planning of strategies to take advantage of the conditions of the environment, making efficient use of resources(8,9). This analysis relates the resources and activities that they carry out with the purpose of satisfying the needs of customers, considering their value network to create, provide and capture value(10,11), being useful for any company that offers its product to the market, as it allows it to understand customers and its relationship with them, the process, the resources and capabilities needed to satisfy them and make commercialization channels more efficient. Osterwalder and Pigneur(12) present the BM composed of nine components: i) value proposition, as a central axis and that makes a client choose one company or another, through offering to meet their needs; ii) key partnerships, which comprises the actors that contribute

146

Rev Mex Cienc Pecu 2022;13(1):145.162

to the functioning of the BM (suppliers, institutions and organizations); iii) key activities, which must be carried out in order to offer the value proposition; iv) key resources, whether physical, economic, intellectual or human; v) customer relationships; vi) distribution channels; vii) market segment; viii) income; and ix) costs incurred. This analysis describes the bases on which companies create, provide and capture value, reflecting the way in which they function and adapt to the environment(12). Regardless of the scale of production, they all have an BM, since they make decisions about their offer and the organization of activities and resources to cover it(13). Therefore, the analysis has been used in various fields, the agri-food sector is not the exception(14,15,16), using it to understand the relationship with customers and the strategies implemented in a given environment. Sheep production is concentrated in the center of the country, where it is an important activity for family livestock farming, due to their easy management and their ability to take advantage of fodder, in addition to being widely promoted by the government(17,18,19), for valuing family labor(20). However, due to the regions and resources available, there is a great diversity. The main producing state is the State of Mexico, which in 2019 contributed 15 % of the national supply with 17,992 t of live sheep(21); this state has an advantage due to its proximity to the large barbacoa consumption centers(22), the main form of consumption of sheep meat. Despite the importance of the activity, there is little information on the business characteristics of sheep farmers who direct their production to the market, so the objective was to explain the business environment (partnerships, activities and resources), as well as the relationships with customers and distribution channels in which they operate and define the main BM, through the analysis of the structure of the companies, to specify their development prospects.

Material and methods The research was carried out in 14 municipalities in the northeast and center of the State of Mexico (Figure 1), which represented on average 28 % of the state supply in the period from 2010 to 2019: Temoaya, Acambay, Jocotitlán, Ixtlahuaca, Atlacomulco, Jilotepec, Morelos, El Oro, Toluca, Lerma, Metepec, Timilpan, Tianguistenco and Xalatlaco, reporting a production of 4,557 t of live sheep in 2019, with a value of more than 175 million pesos(21). The municipalities were selected based on the location of the production units of the members of the Local Livestock Association of Sheep Farmers of the Valley of Mexico (AGLOVM, for its acronym in Spanish), belonging to the state and producers registered in the good

147

Rev Mex Cienc Pecu 2022;13(1):145.162

livestock practice program of the Committee for the Promotion and Protection of Livestock of the State of Mexico (CFPPEM, for its acronym in Spanish). Figure 1: Municipalities that make up the study region

Identification of producers and collection of information

A semi-structured interview was applied to 32 sheep producers, selected by directed sampling, during June and July 2019. The selection was based on the orientation of their production towards the market and their productive objective (meat or breeding stock), with at least 15 heads in their flocks. These producers were members of the AGLOVM, or producers registered in the good livestock practice program of the CFPPEM. The questionnaire collected the following information, grouped into three groups:  Producer profile: age, schooling, percentage of income from sheep farming, complementary activities and experience in the activity.  Characteristics of the production unit: age, location, productive objective, facilities, form of financing, investments, purchase of inputs, inventory of the flock, breed, weight and price of the animals sold, mortality, age and weight at weaning, subsidies received, number of workers, family integration, business succession and problems.  BM: customers and their relationship with them, key partnerships, commercialization channels, product promotion, activities and key resources to carry out their production. 148

Rev Mex Cienc Pecu 2022;13(1):145.162

Statistical analysis The variables related to the producer’s profile and the unit of production were analyzed through descriptive statistics for the case of quantitative variables and proportion tables for the case of qualitative variables. Derived from this analysis, the variables by component of the BM were identified and the 10 with the greatest variation and that impact on the productive results were selected, which were used to perform a hierarchical cluster analysis. The answers were coded 0 for negative answers and 1 for affirmative answers (Table 1). Table 1: Binomial variables used to build the hierarchical cluster Component Affirmative Variable of the BM answers (%) Key You belong to a formal organization or association of 28.1 partnerships sheep producers Age at weaning is less than 2 mo 31.2 The percentage of mortality is less than 5 % 53.1 Key You carry out some activity to attract customers (attend 40.6 activities livestock fairs or events, social networks) You have made some investment in your production 46.9 unit in the last year (expansion or maintenance) Most permanent workers are family members (children, 65.6 wife, or siblings) The facilities of your pen are suitable for production Key (they have concrete floor, roof, avoid inclement weather 53.1 Resources and predators) Your production unit has a brand or logo 34.38 Channels

You have received a subsidy related to sheep farming

44.7

You deliver your animal in the pen

68.7

BM= business model.

It should be noted that, in the cluster analysis, only some variables related to four of the components of the BM were used, the rest were used for analysis and description. The hierarchical cluster used the Dice and Sorensen similarity measure, appropriate for binary variables and the weighted mean as an agglomeration method(23). Once the dendrogram was obtained, the types of companies were classified, determining the cut-off point through a qualitative analysis. In addition, an analysis of variance was performed with the Scheffé test for the quantitative variables that describe the producer and the production unit. Once the types of companies were determined, their BM was analyzed based on the components of the canvas proposed by Osterwalder and Pigneur(12).

149

Rev Mex Cienc Pecu 2022;13(1):145.162

Results General characteristics of sheep companies

The companies are owned by producers with an average age of 50 yr, engaged in sheep farming by family tradition, since it was inherited by their parents or grandparents. However, despite this, only 9 % contemplate a business succession agreement that allows the following generations to continue, even though they consider the activity with a high potential to generate income. These producers derive on average a third of their income from sheep farming and the rest from agriculture, trade or the provision of services. Fifty-three percent of the companies have adequate facilities, while the rest have rustic facilities to house the flock, which do not protect the animals from inclement weather or predators. However, whatever the type of facility, it was built with their own resources, without receiving any support, except for subsidies to equip it with machinery or acquire animals (56 % said they had received it). Regarding the investments made in the company during the last year, 53 % have not incurred any expenses, 22 % have made some maintenance improvement and only 25 % have expanded. In addition, producers do not incur expenses to promote themselves and attract customers. The main objective of these companies is the production of meat animals (75 %), which are marketed at the farm gate with an average weight of 53 kg. Fifty-three percent sell to occasional customers in their production unit, at a price of 46.6 pesos per kg; however, there is a minority that sells directly to the final consumer (6 %). There are also others that direct their production to the breeding of rams or purebred breeding stock, therefore 28 % belong to an organization of sheep producers, because, to sell them, a purity record that accredits the genealogical background of the animal is required. The 32 companies manage on average 108 black-faced animals, such as Dorper, Suffolk and Hampshire, of which 66 are ewes. The production units are located on their own land, located next to the house, which facilitates the participation of the family both permanently and temporarily; for example, of the total number of permanent workers, 48 % are family members and 52 % do not belong to the family, and of the total number of temporary workers, 53 % are family members, who provide their labor in exchange for goods purchased for the family, mainly food, clothing and footwear.

150

Rev Mex Cienc Pecu 2022;13(1):145.162

Characteristics of the groups and their denomination

Because the companies analyzed are not homogeneous with each other, it is necessary to consider aspects related to the structure of the company. In this sense, three types emerge (Figure 2), grouped according to their key partnerships, commercialization channels, key activities and resources. The groups were named as traditional, intermediate and specialized, based on the objectives of each company. The production units of the traditional ones are the ones with the oldest (34 yr), with an average flock of 117 heads and their owners have a basic level of schooling of 7 yr. Intermediate companies are owned by owners with a high- school level education (12 yr), have the lowest number of animals, 52 heads on average and their production units are not so old (10 years). While specialized companies have a larger flock, consisting of 179 heads, an average age of 18 yr and their owners have the highest level of schooling of the three groups (Table 2), with a higher level at least. Figure 2: Groups resulting from hierarchical cluster analysis

Among the groups, the variables that differ are schooling, age of the company, the number of heads and the percentage of workers who are members of the family (P<0.05), with the traditional and intermediate ones having a greater family participation (Table 2).

151

Rev Mex Cienc Pecu 2022;13(1):145.162

Table 2: Profile of producers and structure of the production unit by business model Traditional Intermediate Specialized Variables (n=6) (n=15) (n=11) a Producer age, years 52.0 52.3ª 47.1ª a Experience, years 27.7 16.5ª 11.6a Schooling, years 7.0a 11.9b 16.7c Income obtained from the activity, % 45.0a 25.0a 37.7a Age of the company, years 34.0b 10.5a 18.3a,b Flock size, heads 117.2ª,b 51.7a 179.2b Permanent workers who are family 66.7b 65.0b 13.6ª members, % abc

Values with different literal within the row are different (P<0.05).

Business models

According to the typology, the model that summarizes the main differences between the BMs was built, reflecting the way in which companies conduct their business. Table 3: Business models Component

Traditional (n=6)

Intermediate (n=15)

Key partnerships

CFPPEM SEDAGRO

CFPPEM SEDAGRO Investment in nutrition of lambs and lactating ewes

Key activities

Production parameters

Key Resources

Market segment

Specialized (n=11)

CFPPEM AGLOVM Investment in facilities and nutrition according to the productive stage Product Promotion Weaning at 3.5 mo Weaning at 3.2 mo Weaning at 2.2 mo with a weight of 28.5 with a weight of 23.6 with a weight of 23.8 kg kg kg Prolificacy of 1.0 Prolificacy of 1.2 Prolificacy of 1.2 Mortality of 10.7 % Mortality of 11.0 % Mortality of 7.3 % Family Labor Family Labor Brand or logo Arable area Arable area Arable area Experience Infrastructure Pedigree animals Schooling Occasional buyers Occasional buyers, Occasional buyers,

152

Rev Mex Cienc Pecu 2022;13(1):145.162

Restaurants, Barbacoyeros, Regional collectors,

Restaurants, Barbacoyeros, Regional collectors, Government of the State of Mexico Commercialization They take the animal They deliver at the They deliver at the channel to the customer farm gate farm gate Relationship with Personal Personal Telephone customers communication communication communication Annual revenue 102,520 MXP for 47 101,058 MXP for 40 192,270 MXP for 74 from the sale of animals animals animals animals for meat Value proposition Animals with an Animals with an Animals with a good average weight that average weight that meat yield, good size meet the local market meet the local market and genetics standard standard

Discussion The environment and its consequences for companies

It was found that sheep farming is a livestock activity that is inherited from generation to generation and that acquires importance due to the impact it has on the family economy and the proximity to the main centers of consumption, as indicated by a study carried out in the State of Mexico(22). For this reason, it is one of the livestock activities that receives the most support from the State; in the case of respondents, 94 % said they had received some type of subsidy (machinery, animals or technical advice) in order to increase their productivity and improve family welfare. This is how, due to its easy management and low investment, it provides stability in homes. In this sense, it was found that the family plays an important role in development and profitability, so the percentage of workers of this type is considerable. On the other hand, sheep farming is carried out in an environment of population growth and peculiar meat consumption habits, so the main objective is the production of meat, with black-faced animals due to their greater acceptance in the center of the country, which agrees with the study carried out on national carcasses, where the Suffolk, Hampshire and Dorset breeds prevail(24). The first aspect benefits the growth in demand but threatens production due to the transformation of rural areas to peri-urban areas, a situation that they consider as

153

Rev Mex Cienc Pecu 2022;13(1):145.162

the second most important problem that limits their activity; where there is competition for resources such as land, water and labor, conflicting with other activities that provide greater benefit. The second aspect refers to the fact that the production is mainly destined to the making of barbacoa, which is traditionally consumed on weekends in stands and social events, reducing its consumption to special occasions, due to the high sale price. Under this scenario, the competitiveness of a company not only depends on its internal aspects, but on factors of the environment, which, since they cannot be controlled directly, require to be analyzed to make the best decisions. In the case of the companies analyzed, these factors are: government support, urban growth, the tradition of production and consumption habits. Although they all take place in this environment, each BM takes advantage of it differently.

Identified business models and their prospects

Traditional business model

Sheep farming provides its producers with almost half of their income, they obtain the rest from agricultural or livestock activities, however, this flow of income is not continuous, as indicated by Hernández et al(4), since they only sell their animals when they need money. Producers have a basic level of schooling, so it is normal the existence of deficiencies in the main productivity parameters, such as in the weight at weaning, similar data was reported by Vázquez et al(2) in the cluster of subsistence family production units, where the age at weaning is greater than three months, with a weight of 17.6 kg. Based on this characteristic, decisions are made in a simple way and are based on the experience of the producer, as pointed out by some authors in the northwestern Tlaxcala, where technical decisions are based on experience, and this can determine the level of technology adoption(25). These companies do not see the activity as a profitable business, but as a way to use their resources (family labor and arable area) in order to generate economic stability in the family. In this sense, the results are the reflection of the disinterest in incurring additional expenses, since they only maintain the production unit by uses and customs. The flock is cared for by the family, women and children mainly, considering their labor as a key resource that is used while they get another activity that generates greater benefit or sell the land. Even though production generates profits, since they do not incur infrastructure,

154

Rev Mex Cienc Pecu 2022;13(1):145.162

labor, or food expenses, thus preserving the 102,520 pesos they obtain for the sale of finished animals. These companies are engaged in the production of sheep for meat by tradition of the region and because they inherited the activity from their parents or grandparents; competing with other local producers regarding the price because they do not have another attribute that differentiates them. Their customers are occasional buyers, who arrive at the production unit without the need to establish a formal relationship beforehand, who use the animal for selfconsumption. Due to the type of customer and the value proposition offered, the price received is lower than that of the other models, 44 pesos per live kg, a figure equal to that reported in Mexico City(5), because the customer is not loyal and seeks the best prices for negotiation; in addition, they do not show willingness to pay for characteristics related to animal welfare (which include the conditions under which the sheep lives and dies) or the breed, but they do lower the price for an age greater than a year or for discarded females. A study carried out in the south of the State of Mexico indicates that this price can be explained in part because the producer does not know the needs of the client, as well as the appropriate times to produce and market(19). In relation to government support, this BM receives advice from institutions, such as the CFPPEM and SEDAGRO; however, they are used to solve existing health problems, instead of being used for preventive management that maximizes productivity. The above due to the level of schooling and disinterest in incurring additional expenses. This same disinterest is visualized in the fact that none of the companies has received support for the acquisition of animals that genetically improve their flock, which can be justified by the disinterest in incurring additional expenses, since, in the case of receiving them, they would be forced to make investments due to the feeding and the specific management they require. Derived from these characteristics, the BM finds limitations for its continuity in the following generations, because, although the producers inherited this activity, they do not visualize it as a profitable business, but as a way to use their patrimony, while they sell the land or give it another use. Additionally, they present uncertainty in the business succession and the successor does not know the role they will play, this influences the low investment. At the same time, due to population growth and the change from rural to peri-urban areas, producers face problems that reduce incentives to continue, either because of opportunity cost or insecurity.

155

Rev Mex Cienc Pecu 2022;13(1):145.162

Intermediate business model

In this BM, producers obtain less than a third of their income from the activity and the rest is obtained from agriculture, livestock and trade, which differs from what was found in the municipality of Villa Victoria in the State of Mexico, where they indicate that they obtain 40 %(26). They have unfinished high-school education, and despite being the group with the lowest flock, they show interest in intensifying their production, investing in the nutrition of their lactating ewes and lambs, differentiating the feed they supply, because they recognize that these are crucial stages. It should be noted that this BM coincides with the traditional one, where the smaller the number of animals, the greater the participation of the family, and both women and children provide their labor. Of the total number of permanent workers, 65 % are members of the family, a situation that is favored by the easy management of animals and the valorization of labor; these results are consistent with what was published in the Mexican Sheep Production, where the producers registered in PROGAN in Mexico were analyzed, the authors conclude that the care of the flock is in charge of children, women and the elderly, especially in those units with smaller flock, because these family members are the ones who remain in rural areas(20). This participation reduces the costs that would be generated by hiring labor, thus increasing the profit that is obtained. Despite the family participation, these companies not only see sheep farming as an option to value their labor and make use of the arable area, but as a business, because they invest in improving their productive management, which is an indicator of competitiveness, through one of the activities that gives quick results, as indicated in the study of the problems and opportunities of sheep farmers in New Zealand(27). These producers invest in the nutrition of lambs and lactating ewes to improve their weight. This is due to the educational level of their owners, which allows them to be more receptive and incorporate new practices. However, they still do not develop business strategies to improve their sales process or add value. They are engaged in the production of sheep for meat because they inherited this activity. The sheep are marketed locally, delivered at the farm gate and their customers are occasional buyers, regional collectors, restaurateurs or barbacoyeros, who buy at 46.7 pesos per live kilo, on average, a price higher than that obtained by the traditional ones, since they relate to other actors. Regarding government support, these companies receive advice from government agencies (CFPPEM and SEDAGRO) and have been beneficiaries of subsidies to improve the genetics and productivity of their flock, at least once in the last five years, through certified ewes and rams, thus accessing better profits. 156

Rev Mex Cienc Pecu 2022;13(1):145.162

However, even though this BM shows a better use of the environment, like the traditional BM, it presents the uncertainty generated by business succession, where only 27 % have plans for retirement and in 36 % of cases, the successor is aware of the role they will play in the future, inheriting the production unit; facts that limit investments. However, they show good development prospects, since most visualize their company growing in the next five years, so with proactive actions that improve their competitiveness, such as genetic improvement, nutrition according to the productive stage and the search for customers who offer better prices, existence and viability is possible. Although to achieve this, it is necessary to change the paradigm of the producer, as suggested by Michalk et al, for developing countries that want to improve their productivity; directing their company to meet the needs of the market(28).

Specialized business model

Producers obtain more than a third of their income from production and the rest is obtained from the tertiary sector of the economy, providing professional services, since they have an academic level higher than that of the other groups, which allows them to improve their productivity and impacts on the structure of their BM, facilitating the incorporation of good livestock practices. According to Camacho Ronquillo et al(29), these companies have now increased and show good prospects, as they adopt new technologies in order to contribute to the national supply and improve their profitability. This group is likely to follow the behavior of the main exporters of sheep meat, providing greater production through the efficient use of their resources and not through the increase of the flock, incorporating technical and managerial knowledge that allow to do the same with fewer resources. The above accompanied by technologies that increase prolificacy, combining genetic and nutritional factors in the gestation and growth of lambs, increasing weight and productivity(27,28,30,31). As in the study on the contribution of sheep farming in Mexico(18), it was found that more and more producers stop seeing sheep farming as a backyard activity and visualize it as a business with high potential, this is how they have on average more than 100 ewes and carry out the activity taking advantage of the tradition of consumption and production. These companies are not family-owned, but they own a brand that allows them to create a reputation. They offer two types of products, animals for meat and for reproduction, highvalue products that differ within the market, taking advantage of their genetic value. However, competition for soil and a lack of promotion of meat consumption hinder their growth. 157

Rev Mex Cienc Pecu 2022;13(1):145.162

These companies recognize the importance of genetic improvement in their level of competitiveness and follow the global trend on the use of genetic technologies, which improve the growth and quality of the carcass, which aim to revolutionize production, which is threatened by the scarcity of resources, as indicated by some authors who investigated the preferences and trends of sheep production, in recent years, research has been carried out on sheep improvement, through genomic selection, in order to obtain better weights and quality in the carcass(32). On the demand side, there are two customers, those who seek animals for meat and those who request them for reproduction. The former buys the animal at 48 pesos per live kg, on average. These clients are collectors, barbacoyeros and restaurateurs, with whom they communicate by telephone, because they have dealt with them with before. However, they also sell to occasional customers, delivering at the pen. On the other hand, animals for reproduction are sold with purity records, directing their offer mainly to the State government. The sheep are in adequate facilities, reducing some health problems that occur in rustic production units, which were built with their own resources. They incorporate productive, reproductive, genetic and nutritional techniques that improve their productivity. In order to make their activities efficient and not only receive technical advice from government agencies, but also hire advice that instructs them in the preventive management of the flock, at least three times a year. They have also been beneficiaries of subsidized animals in the last five years. These animals have been provided by the government of the State of Mexico. The BM has allowed them to face the problems that afflict the value chain, as they have ventured into commercial, genetic and organizational aspects, since they are affiliated to an association of sheep farmers and carry out an intensive search for customers, through social networks and events. It should be noted that this group has incentives to improve its profitability, since they incur higher costs (labor, feeding, productive management, genetics, promotion and certification in some cases) and need to recover their investment. It is expected that this BM will remain in the long term, incorporating productive, commercial and managerial techniques, addressed in a comprehensive manner, since this type of companies shows interest in knowing the factors that affect their activity, continuously seeking to take advantage of the opportunities offered by the environment and the growing demand for sheep meat.

158

Rev Mex Cienc Pecu 2022;13(1):145.162

Conclusions and implications The sheep producers analyzed face factors in their environment that affect their growth and affect their viability, such as the transformation of rural areas to peri-urban areas and consumption habits. Under this context, three types of BMs can be distinguished: traditional, intermediate and specialized (18.7 %, 46.9 % and 34.4 %, respectively), which differ significantly in schooling, the age of the production unit, the size of the flock and the percentage of workers who are members of the family and who perceive sheep farming differently. Distinguished mainly by commercial aspects, from the way of relating to customers, the sale price, to the way of delivering their product; resources, which allow them to reduce expenses, such as family labor and arable land; and key activities, which improve the weight of animals and reduce their mortality. Thus, the traditional ones are companies that use their available resources to generate economic stability in the family, but show a tendency to change their land use in the medium term for activities that generate a greater benefit; the intermediate ones, although they carry out some activities to improve the feeding of the flock, they can only be developed by carrying out proactive actions that improve their productivity and the specialized companies, with the largest number of heads, show good prospects, since their choices have allowed them to address a market segment that offers better prices, coordinating their partnerships, activities and resources to meet the needs of their customers. In all three types, an additional challenge to continuity is to achieve successful generational succession. Literature cited: 1. Coronado-Minjarez AM, Figueroa-Rodríguez KA, Figueroa-Sandoval B, García-Herrera JE, Ramírez-López A. Caracterización y clasificación de los productores del Altiplano Oeste Potosino, México: Una propuesta de tipología multidimensional. Agric Soc Desar 2019;16:373–397. doi:10.1017/CBO9781107415324.004. 2. Vázquez-Martínez I, Jaramillo-Villanueva JL, Bustamante-González A, Vargas-López S, Calderón-Sánchez F, Torres-Hernández G, et al. Estructura y tipología de las unidades de producción ovinas en el centro de México. Agric Soc Desar 2018;15:85–97. doi:10.22231/asyd.v15i1.750. 3. Estévez-Moreno LX, Sánchez-Vera E, Nava-Bernal G, Estrada-Flores JG, GómezDemetrio W, Sepúlveda WS. The role of sheep production in the livelihoods of Mexican smallholders: Evidence from a park-adjacent community. Small Ruminant Res 2019;178:94–101. doi:10.1016/j.smallrumres.2019.08.001.

159

Rev Mex Cienc Pecu 2022;13(1):145.162

4. Hernández Valenzuela D, Sánchez Vera E, Gómez Demetrio W, Martínez García CG. Caracterización productiva y socioeconómica del sistema de producción ovina, en un área natural protegida de México. Rev Mex Cienc Pecu 2019;10(4):951–965. 5. Herrera Haro JG, Álvarez Fuentes G, Bárcena Gama R, Núñez Aramburu JM. Caracterización de los rebaños ovinos en el sur de Ciudad de México, México. Acta Univ 2019;29:1–15. doi:10.15174/au.2019.2022. 6. Nuncio-Ochoa G, Nahed T, Díaz Hernández B, Escobedo Amezcua F, Salvatierra Izaba EB. Caracterización de los sistemas de producción ovina en el estado de Tabasco. Agrociencia 2001;35(4):469–477. 7. Vázquez Martínez I, Vargas López S, Zaragoza Ramírez JL, Bustamante González A, Calderón Sánchez F, Rojas Álvarez J, et al. Tipología de explotaciones ovinas en la Sierra Norte del estado de Puebla. Téc Pecu Méx 2009;47(4):357–369. 8. Calderón Cabrera J. Modelos de negocio en producción de ovinos para carne en el Estado de México [tesis maestría]. Chapingo. Estado de México, México. Universidad Autónoma Chapingo. 2020. 9. Vargas Del Ángel MÁ, Muñoz Rodríguez M, López Tirado Q. Modelos de negocio de dos líderes latinos en carne bovina. Rev Glob Negocios 2015;3(1):69–82. 10. Belussi F, Orsi L, Savarese M. Mapping business model research: A document bibliometric analysis. Scand J Manag 2019;35:101048. doi:10.1016/j.scaman.2019.101048. 11. Ricart JE. Modelo de negocio: el eslabón perdido en la dirección estratégica. Universia Bus Rev 2009:12–25. 12. Osterwalder A, Pigneur Y. Generación de modelos de negocio. 1a ed. Clark T, editor. Barcelona, España; 2010. doi:10.1016/S0737-6782(96)90159-9. 13. Fjeldstad ØD, Snow CC. Business models and organization design. Long Range Plann. 2018;51(1):32–39. doi:10.1016/j.lrp.2017.07.008. 14. Cortés-Morales GV, Santoyo-Cortés VH, Altamirano-Cárdenas JR, Olivares-Gutiérrez R. Modelos de negocio de empresas de horticultura protegida en Texcoco, México. Agroproductividad 2018;11(9):105–110. 15. Coutiño-Puchuli V, Santoyo-Cortés VH, Flores-Verduzco JJ, Muñoz-Rodríguez M. Análisis comparativo de dos organizaciones de pequeños productores de café de Oaxaca, México. Rev Tur Econ Neg 2017;3:41–57.

160

Rev Mex Cienc Pecu 2022;13(1):145.162

16. Vargas-Del Ángel MÁ, Muñoz-Rodríguez M, Santoyo Cortés HV. Estrategias de diferenciación en cuatro modelos de negocio de carne bovina. Rev Glob Neg 2015;3(2):29–48. doi:10.1007/BF00991534. 17. Orona Castillo I, López Martínez JD, Vázquez Vázquez C, Salazar Sosa E, Ramírez Ramírez ME. Análisis microeconómico de una unidad representativa de producción de carne de ovino en el Estado de México bajo un sistema de producción semi intensivo. Rev Mex Agroneg 2014;34:720–728. 18. Hernández-Marín JA, Valencia-Posadas M, Ruíz-Nieto JE, Mireles-Arriaga AI, CortezRomero C, Gallegos-Sánchez J. Contribución de la ovinocultura al sector pecuario en México. Agroproductividad 2017;10(3):87–93. 19. Mondragón-Ancelmo J, Hernández-Martínez J, Rebollar-Rebollar S, Mohamed Salem AZ, Rojo-Rubio R, Domínguez-Vara IA, et al. Marketing of meat sheep with intensive finishing in southern State of Mexico. Trop Anim Health Prod 2014;46:1427–1433. doi:10.1007/s11250-014-0659-5. 20. Cuéllar Ordaz JA, Tórtora Pérez J, Trejo González A, Román Reyes P. La producción ovina mexicana: particularidades y complejidades. México: Universidad Nacional Autónoma de México. Facultad de Estudios Superiores Cuautitlán; 2012. http://repositorio.unan.edu.ni/2986/1/5624.pdf. 21.

SIAP. Anuario estadístico de la producción https://nube.siap.gob.mx/cierre_pecuario/. 2021. Consultado Mar 5, 2021.

ganadera.

22. Martínez-González EG, Muñoz-Rodríguez M, García-Muñiz JG, Santoyo-Cortés VH, Altamirano Cárdenas JR, Romero-Márquez C. El fomento de la ovinocultura familiar en México mediante subsidios en activos: lecciones aprendidas. Agron Mesoam 2011;22(2):367–377. 23. Pérez C. Técnicas de análisis multivariante de datos: Aplicaciones con SPSS. (Capella I, ed.). Madrid, España: Pearson Prentice Hall; 2004. 24. Partida de la Peña JA, Ríos Rincón FG, De la Cruz Colín L, Domínguez Vara IA, Buendía Rodríguez G. Caracterización de las canales ovinas producidas en México. Rev Mex Cienc Pecu 2017;8(3):269–277. 25. Rodríguez-Galaviz JR, Vargas-López S, Zaragoza-Ramírez JL, Bustamante-González, A, Ramírez-Bribiesca E, Guerrero-Rodríguez JD, et al. Evaluación territorial de los sistemas de producción ovina en la región nor-poniente de Tlaxcala. Rev Mex Cienc Pecu 2011;2(1):53–68.

161

Rev Mex Cienc Pecu 2022;13(1):145.162

26. Espejel García A, Barrera Rodríguez AI, Cuevas Reyes V, Ybarra Moncada MC. Gestión de conocimiento y uso de innovaciones en sistemas agropecuarios: una aplicación en la cadena ovinos. Rev Mex Cienc Agríc 2017;8(7):1661–1666. 27. McCoard SA. Issues and opportunities to capitalize on increased litter size in hill country sheep farming systems: A New Zealand perspective. Anim Front 2017;7(3):32–37. doi:10.2527/af.2017-0126. 28. Michalk DL, Kemp DR, Badgery WB, Wu J, Zhang Y, Thomassin PJ. Sustainability and future food security: A global perspective for livestock production. L Degrad Dev 2019;30:561–573. doi:10.1002/ldr.3217. 29. Camacho RJC, Hernández HJE, Villarreal EBOA, Franco GFJ, Camacho Becerra CA. Análisis económico de la engorda de ovinos en una granja integral en el estado de Puebla, México. Rev Mex Agronegocios 2018;42:819-826. 30. Morris ST, Kenyon PR. Intensive sheep and beef production from pasture: A New Zealand perspective of concerns, opportunities and challenges. Meat Sci 2014;98:330– 335. doi:10.1016/j.meatsci.2014.06.011. 31. OCDE-FAO. Carne. En: OCDE-FAO Perspectivas Agrícolas 2019‑2028. Roma; 2019:175–189. doi:10.1787/7b2e8ba3-es. 32. Montossi F, Font-i-Furnols M, del Campo M, San Julián R, Brito G, Sañudo C. Sustainable sheep production and consumer preference trends: Compatibilities, contradictions, and unresolved dilemmas. Meat Sci 2013;95(4):772–789. doi:10.1016/j.meatsci.2013.04.048.

162

https://doi.org/10.22319/rmcp.v13i1.5444 Article

Effect of early age at first calving on longevity, number of days in production and lifetime milk yield of Holstein and Brown Swiss dairy cows in Honduras

Karen Alessa Copas Medina a Manuel Valladares Rodas b Juan José Baeza Rodríguez c Juan Gabriel Magaña Monforte a José Candelario Segura Correa a*

Universidad Autónoma de Yucatán. Campus de Ciencias Biológicas y Agropecuarias. Km 15.5 carretera Mérida-Xmatkuil. 97315. Mérida, Yucatán, México. b

Asociación de Agricultores y Ganaderos de Oriente, Danlí, El Paraíso, Honduras.

Instituto Nacional de Investigaciones Forestales Agrícolas y Pecuarias. Campo Experimental Mocochá, Yucatán, México.

*Corresponding author: jose.segura@correo.uady.mx

Abstract: The aim was to determine the effect of age at first calving on longevity, lifetime number of productive days and lifetime milk yield of Holstein and Brown Swiss cows in the tropical savanna of Honduras. The information was collected from three dairy farms with Holstein (n = 1,391) and four farms with Brown Swiss cows (n = 480), born from 1993 to 2013, managed under intensive systems. The statistical model that described the variables of interest included the effect of farm, group of age at first calving, period of birth, season of birth and the interaction farm x period and the residual error. Effects of farm, period group of age at first calving and interaction of farm x period were found on the response variables.

163

Rev Mex Cienc Pecu 2022;13(1):163-174

A favorable effect of the cows that had their first calving at an earlier age on lifetime number of days in production and lifetime milk yield, and an increase in longevity, in both Holstein and Brown Swiss cows (P<0.05). In conclusion, cows that calved at an early age had more productive days in the farm and produced more milk during their productive life. Therefore, make the heifers to calf at an early age could be a management strategy to increase productivity in the farm. However, the weight at first calving and physiological aspects of the animal should be taken into consideration. Key words: Environmental effects, Milk yield, Longevity, Productive life, Tropics.

Received: 05/07/2019 Accepted: 23/04/2021

Introduction The dairy sector in Honduras has an annual production of approximately 650 million liters of milk, representing 28 % of the total production of Central America. However, the production of milk under intensive systems of production faces some difficulties in its development, since dairy breeds, such as Brown Swiss and Holstein cows, have problems to adapt to hot-humid climates(1). Under temperate environments, management, nutrition, year and season of calving, as well as breed, are cited among the main sources of variation that affect the performance of dairy cattle(2). There is some information on milk yield per lactation of Holstein and Brown Swiss cows under tropical conditions(3,4,5). However, no articles on lifetime milk production of specialized dairy cattle under tropical conditions have been published. Environmental and management factors have a direct influence on reproduction, and indirect on the quality and quantity of feed for the cows. The differences in fertility and milk yield between years and season of calving, are largely due to the availability of nutrients from the prairie, but are also a consequence of management(3,6). There are reports in the tropics that indicate poor reproductive and productive performance of Brown Swiss cattle, as indicated by the average age at first calving of over 34 mo(7). The time between the birth and first calving represents a time during which the female is unproductive and in consequence does not generate any income to the farm. Therefore, it has been suggested, to reduce the age at first calving to decrease production cost of replacements. In addition, it has been reported, under non-tropical conditions, that the age at first calving favors the productive life and lifetime milk yield per cow(8,9). The desirable age range for a

164

Rev Mex Cienc Pecu 2022;13(1):163-174

cow to have its first calving is 23 to 25 mo, to ensure greater productive lifetime, as well as greater milk production(10). Furthermore, a general age at first calving for all farms would not be proper, since this must be a function of management and feeding in the different farms. Therefore, the objective of this study was to determine the effect of group of age at first calving on the longevity, productive lifetime and lifetime milk yield of Holstein and Brown Swiss dairy cows kept under the tropics of Honduras.

Material and methods Seven (7) farms, three with Holstein and four with Brown Swiss cattle were studied. The farms belonged to the departments of Francisco Morazán, located in the central eastern zone of Honduras, Comayagua in the central region, and Cortes and Santa Bárbara in the Northwest region. All the farms were under tropical savanna conditions. The averages of temperature, humidity and rainfall for the central eastern, central and northwestern regions were 24.9 0C, 70 % and 1,186 mm; 26.5 oC, 68 % and 1,212 mm; and 26 oC, 75 % and 1,300 mm, respectively.

Description of the farms

The dairy farms were under intensive production systems in total confinement during the dry season and fed a commercial feed plus corn and sorghum, whereas in the rainy season animals intensive rotational grazing was used. Management in the farms was similar in the dry season, and varying only in the type of grass that was foraged and strategy of supplementation. The purpose of the farms was the production of milk and sale of animals of the Holstein and Brown Swiss breeds. The cows from the farms were progeny of dams inseminated with semen of the United States and Canada bulls. The land in the farms was planted with corn and sorghum for the production of silage and, to a lesser extent, for the establishment of Cynodon nlemfluensis, Brachiaria hybrid, Hyparrhenia rufa, Digitaria eriantha, Panicum maximum grass, as grazing forages.

165

Rev Mex Cienc Pecu 2022;13(1):163-174

Management

In general, in the seven farms here studied, females were grown in their own farms up to the service weight and kept as replacement of old cows. The females with not clinical signs of disease that showed estrous were kept into the herd, using the body weight at service as the only selection criterion. Those females were maintained into a continuous breeding scheme; where they were given service through artificial insemination. Animals that fail to get pregnant after four services received natural mating. Cows were divided into two management groups. The group of dry cows was kept under a rotational grazing scheme and given 3 kg/d of a commercial feed containing 18 % crude protein. The group of cows into production were kept under a feeding scheme depending on milk yield. It consisted in providing the cow with 0.5 kg/L of milk produced, and they were offered through an integrated ration composed of forage, corn silo and soybean meal three times a day. In winter, cows were given an integrated ration with corn or sorghum silage and left to graze. The health of the herds was kept based on vaccinations against blackleg, antrax and pasteurellosis every 6 mo and against infectious bovine rhinotracheitis and bovine viral diarrhea once a year. All the animals were dewormed every 6 mo with ivermectins and eprinomectin for the control of internal parasites and given periodic baths, from September to December, for the control of external parasites. Milk yield was measured daily. Data from 1993 to 2013 were captured in the VAMP® software and Software Ganadero SG® and later translate to a spreadsheet (Excel, 2013). Information used was farm, animal, bull and dam identifications, year of birth of the cow, lifetime milk yield, and dates of birth, first calving and culling or dead of cows. The data of year of birth of the cow were grouped into four periods, from 1993 to 2003 (collection of productive and reproductive records started), 2004 and 2005 (artificial insemination began to be used, and feeding was improved), period 2006 to 2008 and period 2009 to 2013 (period when feed was further improved and formal health practices were established). Two seasons of birth of cow were established according to the temperature and precipitation of the region (dry season from December to May and rainy season from June to November). In addition, the cows were classified into four age groups at first calving: <2.5, 2.5 to <3, 3 to <3.5 and > 3.5 yr. Data of Holstein (n= 1,391) and Brown Swiss (n= 480) cows were used to calculate, the longevity, as the number of days from birth to death or culling of the cow. The lifetime number of days in production for Holstein and Brown Swiss (n = 1,009; n = 437, respectively) was the time the cow stayed in the herd, from first calving until death or culling; and lifetime

166

Rev Mex Cienc Pecu 2022;13(1):163-174

milk yield (n= 950, n= 478) was the total kg of milk produced by cow during its useful lifetime.

Statistical analysis

Data were analyzed by breed (Holstein and Brown Swiss). Initially a statistical model was used that included the fixed effects of farm, period of birth, season of birth, age group at first calving and simple interactions. However, preliminary results indicated that, except for farm x period interaction, in the Holstein breed, interactions were not significant. The final statistical model was: Yijklm = μ + Hi + Perj + ENk + GEPPl + H x Perij + ɛijklm Where: Yijklm = Longevity, lifetime number of days in production or lifetime milk yield; μ = Overall mean; Hi = Effect of the ith farm; Perj = Effect of the jth period of birth; ENk = Effect of the kth season of birth; GEPPl = Effect of the lth group of age at first calving; H x Perij = Farm x period interaction; ɛijklm = residual effect, NID (0, 𝜎 2 ). All statistical analyzes were performed using the GLM procedure of the SAS program(11).

Results and discussion Holstein

The arithmetic means for longevity, number of days in production and lifetime milk yield for Holstein cows were 2,715 d (89.3 mo), 1,223 d (40.2 mo) and 13,400 kg of milk, respectively. The mean longevity in this study is greater than the average 70 mo reported for Holstein cows under mild subtropical conditions in Ethiopia(12), and much greater than the 57.2 mo mean reported under cold desert climate in Iranian Holstein cows(13). Differences between studies are in part due to management factors, which are expected to vary between farms. For

167

Rev Mex Cienc Pecu 2022;13(1):163-174

example, the mean age at first calving of the cows in Iran was 26.8 mo(13) and for this study 35.3 mo. Longevity increased linearly with age at first calving of the cow, similar to the results of a study in Korean Holstein(14), where was observed that first calving at the right maturity age, provide good body condition for lifetime, as observed also by other authors in other countries and under different climatic conditions and management(8,15). With respect to lifetime number of days in production or productive lifetime in the farm, the mean here found (40.2 mo) is higher than the mean value of 20.3 mo reported for Holstein under temperate conditions in Mexico(16) and 36.7 mo under mild subtropical weather in Ethiopia(12). A long productive lifetime is an important component of dairy cattle profitability, because it decreases the cost of replacement. Lifetime milk yield mean was 13,400 kg per cow, which differ from those reported in United States of America with means of 32,861 kg and 28,086 kg(17,18). However, the mean, here obtained, is higher than those reported in Israel (10,786 kg)(19) and Egypt (10,694 kg)(20). The improvement of reproductive management through better estrus detection, adequate insemination time, proper feeding, good health practices, and decreasing the involuntary culling rate of cows at early age are important for optimal breeding efficiency and lifetime milk yield(12). Group of age at first calving, and the other factors included in the model (farm, period of year and farm x period interaction, except season of birth of the cow) had significant (P<0.05) effect on the traits here evaluated. The least squares means by group of age at first calving are shown in Table 1. Longevity of cows increased with increasing age at first calving (2819 to 3651 d), in part, because by definition the trait age at first calving is contained into it. Table 1: Least squares means and standard errors by group of age at first calving for longevity (L), lifetime number of productive days (LNPD), and lifetime milk yield (LMY) of Holstein cows in Honduras Age group (years) <2.5 2.5 to <3 3 to 3.5 >3.5

L (days) N Mean 767 2819c 437 3177b 107 3289b 80 3651a a, b, c

SE 38.83 44.73 76.00 96.72

LNPD (days) N Mean 482 1380ª 368 1399a 88 1239ab 71 1080b

SE 42.22 48.41 81.78 99.86

LMY (kg) N Mean 384 14290ª 393 14396a 100 13141ab 73 10840b

Distinct literals per column means significant difference (P<0.05).

168

SE 476 555 938 1214

Rev Mex Cienc Pecu 2022;13(1):163-174

Cows that calved at >3.5 yr of age had less days in production and produced less milk than those that calved at an earlier age. Effect of age at first calving in Holstein cows on longevity or number of days in production have been reported under temperate conditions(13,21). In Belgium(22), it was found that cows that first calved between 22 and 26 mo of age had more productive days during their life, than those less than 22 and greater than 26 mo of age. Actually, there are no research carried out for lifetime traits of Holstein cows in intensive systems of production under tropical conditions of Honduras. Potocnik et al(21) mention that the relative risk of culling a cow, increases with increasing age at first calving, which, indicates that cows that calf at an older age had also some other problems, likely associated to reproductive success. Similar results were reported in Mexico(16). The most obvious effect of reducing calving age and increasing lifetime number of productive days, is that cows calving early, start producing earlier(23). It seems that the more effective way to evaluate the benefit of reducing the age at first calving is to take into consideration the lifetime milk yield production of cows. Some authors(24) observed that milk yield in second and greater lactations was not affected by early age at first calving, and indicated that milk yield and lifetime number of productive days could have a great impact on the profitability of the farm. Meyer et al(23) found that cows calving the first time at 23.3 mo produced twice the amount of milk than those cows that calved the first time at 30.3 mo of age. However, in Belgium, it was reported(22) that cows that first calved between 22 and 26 mo of age had more lifetime milk yield, than cows calving less than 22 and those calving after 26 mo of age. Therefore, those authors conclude that age at first calving is an important factor to ensure good lifetime milk yield and efficient cows able to produce more milk in less time.

Brown Swiss

The unadjusted means for longevity, lifetime number of productive days and lifetime milk yield were 2,586 d (85.1 mo), 1,664 d (54.7 mo) and 14,226 kg milk, respectively. In terms of longevity, the result obtained for the Brown Swiss breed in this study is longer than that reported in the United States, where 60 mo longevity was observed(25). Many and variables factors could be the reasons of the differences of results of the present study and USA; among them: failure to conceive, longer calving intervals, conformation problems, other culling criteria, etc. A report of American Brown Swiss cows in Chiapas, Mexico, estimated longevity of 141 mo; this value being greater than that found in this study(26). In Switzerland, it was reported an average longevity of 16 yr for Brown Swiss cows(27); and in the same country Vukasinovic et al(28) reported a mean of 29.5 mo for uncensored data. Differences between studies may be because longevity and productive lifetime are complex variables,

169

Rev Mex Cienc Pecu 2022;13(1):163-174

which depend of the fixed effects analyzed; mainly due to age at first calving and management(29). The lifetime milk yield obtained in this study differs from that found in Egypt, in Brown Swiss cows and other dairy breeds under subtropical weather, where it was obtained a mean of 10,118 kg lifetime milk yield(20). In Switzerland, and also in Brown Swiss, it was estimated a mean lifetime number of productive days of 4,888 and 14,893 kg lifetime milk yield(27). Differences among countries could be attributed to climate and different management conditions. Farm, period of birth of the cow, group of age at first calving and farm x period interaction had effect on longevity, lifetime number of productive days and lifetime milk yield (P<0.05). However, seasons seems not to be an important source of variation (P>0.05). The least squares means by age group are shown in Table 2. The mean longevity of the Brown Swiss cows that calved for the first time at a younger age was shorter than that of cows calving the first time at an older age. However, similar to what was found for Holstein, Brown Swiss cows that calved at a younger age had more lifetime number of days in production and more lifetime milk yield compared to cows that calved at a later age (P<0.05). Table 2: Least squares means and standard error by factor for Longevity (L), Lifetime number of productive days (LNPD) and lifetime milk yield (LMY) of Brown Swiss cattle in Honduras Age group (years) <2.5 2.5 to <3 3 to 3.5 >3.5

L (days) N Mean 134 2410b 182 2516ab 87 2785a 77 2718ab abc

SE 71.16 68.58 94.65 104.0

LNPD (days) N Mean 123 1639ª 164 1564ab 78 1646a 72 1230b

SE 70.96 67.94 92.75 102.5

LMY (kg) N Mean 134 15979a 182 13388b 86 12874bc 76 10411c

SE 763 735 1014 1114

Distinct literals per column means significant difference (P<0.05).

Effect of age at first calving of Brown Swiss cows on longevity and lifetime number of productive days have been reported under temperate environmental conditions(13). However, this is the first research about lifetime span and productivity for Brown Swiss cows under tropical conditions. The most obvious effect of reducing age at first calving in Holstein is the effect on lifetime number of productive days, because cows that calf at an early age enter to production earlier(23), and start paying off their cost of growing. As shown in Table 2, as the age group of first calving increased the lifetime milk yield decreased.

170

Rev Mex Cienc Pecu 2022;13(1):163-174

Therefore, make the heifers to calf at an early age could be a management strategy to increase productivity in the farm. However, the weight at first calving and reproductive aspects, such as estrus detection and failure to conceive of the animal should be taken into consideration.

Conclusions and implications The results of this study support the idea of better management practices to reduce the age at first calving, because, under the conditions of this study, Holstein and Brown Swiss cows, calving at an early age (< 36 mo), stayed productive longer time in the farm and had more lifetime milk yield.

Acknowledgements

Author’s thanks milk farmers from Honduras for providing the productive records for this study. The first authors thanks Mexican CONACYT for a PhD. scholarship.

Conflict of interest

The authors declare that do not have any conflict of interest. Literature cited: 1.

Faye B, Konuspayeva G. The sustainability challenge to the dairy sector– The growing importance of non-cattle milk production worldwide. Int Dairy J 2012;24(2):50-56.

2. M’hamdi N, Bouallegue M, Frouja S, Ressaissi Y, Kaur Brar S, Hamouda B. Effects of environmental factors on milk yield, lactation length and dry period in Tunisian Holstein cows. InTechOpen 2012;8:153-164. 3. Estrada-León R, Magaña JG, Segura JC. Genetic parameters for some reproductive traits of Brown Swiss cows in the tropics of Mexico. J Anim Vet Adv 2006;7(2):124-129. 4.

Echeverri M, Galeano-Vasco L, Cerón-Muñoz M, Márquez-Girón SM. Efecto de las variables climatológicas sobre la producción de leche de vacas Holstein. Livest Res Rural Develop 2015;27(7):Article #246.

171

Rev Mex Cienc Pecu 2022;13(1):163-174

5. Sierra-Montoya E, Cerón-Muñoz MF, Ruiz-Cortés ZT. Parámetros reproductivos y su relación con producción y calidad de leche en hatos del trópico alto. Livest Res Rural Develop 2017;29(7):Article #170. 6. WingChing-Jones R, Pérez R, Salazar E. Condiciones ambientales y producción de leche un hato de ganado Jersey en el trópico húmedo: el caso del módulo lechero. Agronomía Costarricense 2008;32(1):87-94. 7. Magaña JG, Segura JC. Estimates of breed and heterosis effects for some reproductive traits of Brown Swiss and Zebu-related breeds in South-eastern Mexico. Liv Res Rural Develop 2001;13(5):Article #49 8. Pirlo G, Miglior F, Speroni M. Effect of age at first calving on production traits and on difference between milk yield returns and reading costs in Italian Holsteins. J Dairy Sci 2000;83:603–608. 9. Eastham NT, Caots A, Cripps P, Richardson H, Smith R, Oikonomou G. Association between age at first calving and subsequent lactation performance in UK Holstein and Holstein-Friesian dairy cows. PloS ONE 2018;13(6):eo197764. 10. Richardson H. What age is the right age? The Journal for Holstein UK and British Friesian Breeders, August 2011;42–44. 11. SAS. SAS / STAT User’s Guide (Version 9.3, 4th Ed.) SAS Inst. Inc., Cary, NC. 2010. 12. Berihulay H, Mekasha Y. Breeding efficiency and lifetime production performance of Holstein-Friesian dairy cows at Alage dairy farm, South Western Ethiopia. Livest Res Rural Develop 2016;28(9):Article #157. 13. Nilforooshan MA, Edriss MA. Effect of age at first calving on some productive and longevity traits in Iranian Holsteins of the Isfahan Province. J Dairy Sci 2004;87:21302135. 14. Do C, Wasana N, Cho K, Choi Y, Choi T, Park D, Lee D. The Effect of age at first calving and calving interval on productive life and lifetime profit in Korean Holsteins. Asian-Australas J Anim Sci 2013;26(11):1511-1517. 15. Haworth G., Tranter WP, Chuck J, Cheng Z, Wathes DC. Relationship between age at first calving and first milk yield, and lifetime productivity and longevity in dairy cows. Vet Rec 2008;162(20):643-647. 16. Abadía-Rojas JR, Ruíz-López FJ, Vega-Murillo VE, Montaldo HH. Análisis genético para vida productiva en ganado Holstein de México. Rev Mex Cienc Pecu 2016;7(1):114.

172

Rev Mex Cienc Pecu 2022;13(1):163-174

17. Tsuruta S. Misztal I, Lawlor TJ. Changing the definition of productive life in US Holsteins: effect on genetic correlations. J Dairy Sci 2005;88:1156-1165. 18.

Heins B, Hansen L, Vriest A. Survival, lifetime production, and profitability of Normande × Holstein, Montbéliarde × Holstein, and Scandinavian Red × Holstein crossbreds versus pure Holsteins. J Dairy Sci 2012;95:1011-1021.

19. Weller J, Ezra E. Environmental and genetic factors affecting cow survival of Israeli Holsteins. J Dairy Sci 2015;98:676–684. 20.

El-Tarabany M, Roushdy E, El-Tarabany A. Production and health performance of Holstein, Brown Swiss and their crosses under subtropical environmental conditions. Anim Prod Sci 2016;57(6):1137-1143

21. Potočnik K, Gantner V, Krsnik J, Štepec M, Logar B, Gorjanc G. Analysis of longevity in Slovenian Holstein cattle. Acta Agric Slov 2011;98(1):93-100. 22. Froidmont E, Mayeres P, Picron P, Turlot A, Planchon V, Stilmant D. Association between age at first calving, year and season of first calving and milk production in Holstein cows. Animal 2013;7(4):665-672. 23. Meyer MJ. Everett RW, Van Amburgh ME. Reduced age at first calving: Effects on lifetime milk production, longevity and profitability. Kansas Agricultural Experiment Station Research Reports 2004; Vol. 10: Issue 2. htpps://doi.org/10.4148/23785977.3172. 24. Lin CY, McAllister AJ, Batra TR, Lee AJ, Roy GL, Vesely JA, Wauthy JM, Winter KA. Effects of early and late breeding of heifers on multiple lactation performance of dairy cows. J Dairy Sci 1988;71:2735-2743. 25. Garcia-Peniche TB, Cassell BG, Misztal I. Effects of breed and region on Longevity traits through five years of age in Brown Swiss, Holstein, and Jersey cows in the United States. J Dairy Sci 2006;89:3672–3680. 26. Domínguez-Olvera DA, Herrera JG, Caamal I, Dorantes J. Indicadores económicos en función de la longevidad verdadera de vacas Suizo Americano en hatos de las regiones centro y frailesca en Chiapas. Ciencia e Innovación 2018;1(1):167-176. 27.

Bielfeldt JC, Tölle K, Badertscher R, Krieter J. Longevity of Swiss Brown cattle in different housing systems in Switzerland. Livest Sci 2006;101:134–141.

28. Vukasinovic N, Moll J, Kunzi N. Analysis of productive life in Swiss Brown cattle. J Dairy Sci 1997;80:2572-2579.

173

Rev Mex Cienc Pecu 2022;13(1):163-174

29. Caraviello DA, Weigel KA, Gianola D. Prediction of longevity breeding values for US Holstein sires using survival analysis methodology. J Dairy Sci 2004;87:3518–3525.

174

https://doi.org/10.22319/rmcp.v13i1.5917 Article

Effect of viscosity on the medium for rooster (Gallus gallus) sperm cryopreservation

José Antonio Herrera Barragán a José Manuel Huitrón b Juan José Pérez-Rivero *a Adrián Guzmán Sánchez a Alejandro Ávalos Rodríguez a Ana María Rosales Torres a Ricardo Camarillo Flores c

Universidad Autónoma Metropolitana-Xochimilco. Departamento de Producción Agrícola y Animal. Calz. del Hueso 1100. Villa Quietud, Coyoacán. 04960. CDMX, México. b

Universidad Autónoma Metropolitana-Xochimilco. Agropecuarias. CDMX, México.

Maestría

Ciencias

Universidad Autónoma Metropolitana-Iztapalapa. Maestría en Biología de la Reproducción Animal. CDMX, México.

*Corresponding author: jjperez1_1999@yahoo.com

Abstract: In mammalian semen, viscosity has been shown to have a negative influence on its conservation. In bird semen, studies on the physical characteristics of ejaculates are limited, particularly viscosity has not been studied. The media for cryopreservation do not consider viscosity to maintain sperm viability. Therefore, the objective of this study was to evaluate the effect of viscosity on the medium to maintain its viability after thawing. The parameters of basic evaluation, maturation and acrosome reaction were determined, evaluating the presence and distribution of Ca2+ through co-incubation with

175

Rev Mex Cienc Pecu 2022;13(1):175-186

chlortetracycline. Twenty-five (25) evaluations of seminal pool were performed, cryopreserved in Lake medium supplemented with 6 % dimethylacetamide and with 0 % (Control), 10 %, 30 % and 45 % ficoll, to adjust the viscosity of the medium to conditions similar to those of semen and oviductal fluid and to a higher degree of viscosity. Sperm motility was lower (P0.05) in aliquots with a higher percentage of ficoll. The percentage of live spermatozoa was similar (P>0.05) in the control and all aliquots with different percentage of ficoll. Sperm maturation presented a higher (P0.05) percentage of noncapacitated spermatozoa when 10 % ficoll was used. Conversely the percentage of spermatozoa with acrosome reaction was also lower (P0.05) when 10 % ficoll was used. The results of this study show that variations in the degree of viscosity of the medium can maintain or increase sperm viability after thawing. Key words: Acrosome, Sperm capacitation, Freezing, Gallus gallus, Semen.

Received: 30/12/2020 Accepted: 22/04/2021

Introduction At present, poultry farming of domestic species cannot be conceived without the application of knowledge and innovative technologies of assisted reproduction; this includes cryopreservation of semen and artificial insemination (AI)(1). One of the biggest difficulties in achieving this is maintaining the viscosity of the seminal fluid, which can decrease when mixing semen with a diluent for its preservation, which can contribute to the loss of spermatozoa in the oviduct during AI(2). The viscosity of the seminal fluid is attributed to the presence of mucopolysaccharides, glycosaminoglycans and proteins, this has been studied in different animal species such as camelids, elephants and wild ungulates, where changes in semen viscosity represent a problem for its conservation and for AI(3-6). From the anatomical and physiological point of view, within the oviduct of birds, there are sperm storage tubules, which provide a specific microenvironment to maintain sperm viability and their fertilizing capacity for a long time(7,8). In birds, when spermatozoa are inside the storage tubules, they are immobile, so their metabolism is basal, resulting in a low consumption of ATP(9). However, they have active mitochondria, which provide energy for the activation of their motility and sperm capacitation(10). When the ejaculated spermatozoa carry out the acrosome reaction, they are able to penetrate the perivitelline membrane that surrounds the oocyte and carry out 176

Rev Mex Cienc Pecu 2022;13(1):175-186

fertilization(11). It has been mentioned that bird spermatozoa “do not need” a sperm capacitation process in order to carry out fertilization(11). During cryopreservation, cooling procedures, addition of cryoprotective agents, freezing and thawing contribute to a cryocapacitation process(12,13), which is evidenced by the continuity in sperm maturation, and reduces its fertilization capacity when used for artificial insemination. Considering that in other species it is important to maintain the viscosity of the seminal fluid to maintain sperm viability after thawing during AI processes and that this has not been studied in roosters, the objective of this work was to evaluate the effect of viscosity in the cryopreservation medium, to maintain the sperm viability determined by its parameters of sperm maturation after thawing.

Material and methods Use of animals

It was carried out in accordance with the Official Mexican Standard 062-ZOO-1999. “Official Mexican Standard NOM-062-ZOO-1999, Technical specifications for the production, care and use of laboratory animals”(14). Five Lohmann Brown lite roosters (Gallus gallus) were used, which were provided with balanced feed with 18 % protein and water ad libitum, and individual housing in metal cages of 70 x 70 x 90 cm, provided with a drinker and feeder.

Semen collection

Twenty-five (25) samples of semen were obtained from each rooster by dorsoventral massage(15). Semen was collected from the cloaca by aspiration with a SL10-1000 micropipette, (RANIN™, USA). The samples were mixed to obtain 25 groups, which were diluted in Lake medium composed of fructose 0.6 %, sodium glutamate 1.92 %, magnesium acetate 0.08 %, sodium acetate 0.51 %, potassium citrate 0.128 %, pH of 7.2 and osmolarity of 330 mOms (L)(16), and 6 % dimethylacetamide (DMA) was added as cryoprotectant. In each seminal group, its sperm concentration was determined by microscopy and with the use of a Neubauer chamber(1), to make six aliquots of 100 μL, with 100 x 106 spermatozoa, to which ficoll (F) was added to achieve different levels of semen viscosity. An aliquot of ejaculated semen (S) was considered as a control group. The group (S+L+ ficoll 10% +DMA) was conventionally diluted and 10 % F was added to achieve lower

177

Rev Mex Cienc Pecu 2022;13(1):175-186

viscosity compared to the control group. The group (S+L+ ficoll 30% +DMA) was added 30 % F to achieve similar viscosity compared to the control group and the group (S+L+ ficoll 45% +DMA) was added 45 % F to achieve greater viscosity compared to the control group.

Obtaining oviductal fluid

A polypropylene probe (5 FR) of 1 cm was introduced into the cloaca of five Lohmann Brown lite hens, 0.5 ml of sterile PSS were administered, which were aspirated with a 3 ml syringe, the samples were mixed to make a group.

Determination of viscosity

Fifty (50) microliters of semen from each group or oviductal fluid were deposited in a refractometer to observe the degree of density (°Brix), to convert them to g/ml, the °Brix to specific gravity conversion table of the National Institute of Standards and Technology (NIST) was used. With a Cannon-Manning Semi-Micro viscometer (Size 50, Cannon Instrument, PA), the kinematic viscosity of each sample in mm²/s (cSt) was determined by multiplying the flow time in seconds by the viscometer constant (Co= 0.003812). To obtain the viscosity in mPa*s (cP), the result was multiplied by the kinematic viscosity in mm²/s (cSt) and by the density in g/ml.

Seminal cryopreservation

Subsequently, aliquots diluted and added with the different percentages of ficoll were frozen in straws of 0.25 ml with 100 x 106 spermatozoa. It started with aliquots at 25 °C that were cooled to a curve of 1.6 °C per min, then they were kept in nitrogen vapor (-70 °C) for 10 min; finally, they were immersed in liquid nitrogen (-196 °C) to be cryopreserved for 30 d. The thawing of each straw was at 37.5 °C for 30 sec(17).

Basic sperm evaluation

In fresh and post-thawed semen, progressive motility was determined by optical microscopy (400X) to estimate the percentage of spermatozoa with a vigorous progressive movement in an aliquot of 15 μL at 37.5 °C. Sperm viability and morphology

178

Rev Mex Cienc Pecu 2022;13(1):175-186

were determined in a preparation on a slide, with 10 μL of the aliquot with spermatozoa and 3 μL of eosin blue vital stain (1 % of eosin and 5 % of nigrosin), two hundred cells were evaluated in each preparation, with a phase-contrast microscope (400X). Morphology was evaluated with a 100X magnification(1,18).

Sperm maturation and acrosome reaction Aliquots of 50 μL of semen belonging to all groups with a concentration of 5 x 106 spermatozoa were incubated with 0.9 M chlortetracycline (CTC) in darkness at 38 °C(19,20). By means of fluorescence microscopy (495 nm excitation and 520 nm emission), the spermatozoa were evaluated to determine their level of maturation, determining the proportion of non-capacitated, capacitated and with acrosome reaction spermatozoa(17).

Statistical analysis

The normality of the data was verified using a Jack-Vera test; subsequently, a KruskalWallis analysis was performed for the different treatments and variables. A Tukey test was performed to identify the difference in means, all statistical tests were performed with a significance level of P<0.05. The statistical program PAST(21) was used.

Results Density and viscosity

The density and viscosity parameters that were determined in the cryopreservation media showed different values, which are shown in Table 1. Table 1: Seminal density and viscosity and cryopreservation media (n=25) Density Specific Viscosity Viscosity 2 °Brix gravity (mm /s) *mPa*s Semen (S) 7.0 1.028 3.1440 3.2320 S+L+ ficoll (10%) +DMA 17.0 1.070 2.0279 2.1698 S+L+ ficoll (30%) +DMA 28.0 1.120 3.1601 3.5393 S+L+ ficoll (45%) +DMA 30.2 1.130 5.4092 6.1123 S= Semen; L= Lake; DMA= dimethylacetamide

179

Rev Mex Cienc Pecu 2022;13(1):175-186

Post-thawing basic sperm evaluation

Thawed sperm with different percentages of ficoll showed changes in motility; the less viscosity in the medium, the greater the motility, approaching that of the ejaculated semen (P0.05). The percentages of live spermatozoa showed no significant changes between ejaculated semen and thawed sperm (P>0.05). On the other hand, as the viscosity of the medium increases, the normal morphology of thawed spermatozoa improves (P0.05) (Table 2). Table 2: Percentages of basic evaluation in spermatozoa cryopreserved with different viscosity conditions (n=10) Percentage of spermatozoa (X±SE) Viscosity Motility Viability Morphology *mPa*s 3.2320 46.1 + 0.7a 74.2 + 2.9 a 86.1 + 1.0 a 2.1698 32.8 + 0.7b 72.4 + 2.9 a 86.7 + 1.0 a 3.5393 10.9 + 0.7 c 70.5 + 2.9 a 93 + 1.0 b 6.1123 5.1 + 0.7 d 70 + 2.9 a 91.2 + 1.0 b abcd

Values with different literal in columns differ (P<0.05).

Sperm maturation and acrosome reaction

The percentage of non-capacitated spermatozoa was higher in the group added with 10 % ficoll compared to the rest of the treatments (P0.05) as shown in Figure 1. The percentages of spermatozoa with sperm capacitation showed no statistical differences between the treatments and the ejaculated semen (P>0.05). The percentage of spermatozoa with acrosome reaction found was higher in the treatments added with 30 % and 45 % ficoll, compared to the treatment with 10 % ficoll (P0.05) and similar with ejaculated semen (P>0.05).

180

Rev Mex Cienc Pecu 2022;13(1):175-186

Figure 1: Post-thawing sperm maturation parameters in media with different viscosity

Discussion The content and characteristics of seminal plasma are different in each species; one of these physical differences is viscosity, which is produced from proteins that help maintain sperm viability for several days, until the sperm reaches the fertilization site(22). In camelid semen, the high viscosity is attributed to Mucin 5B(23,24). On the other hand, in roosters and turkeys, there are no studies related to the viscosity of semen, but it has been shown

181

Rev Mex Cienc Pecu 2022;13(1):175-186

that, in the seminal plasma of birds, up to 822 proteins are found in the case of the rooster and 607 in the turkey(9,22). In this work, it was determined that the viscosity of rooster semen is 3.23 mPa*s. The mechanisms that prolong sperm life in sperm storage tubules are unknown, but are thought to include reversible suppression of sperm respiration and motility, as well as membrane stabilization and acrosome maintenance(25). Although there is no demonstrable statistical difference in this work, the percentage of live spermatozoa was higher in semen cryopreserved with lower viscosity. The increase in viscosity decreased sperm motility; however, they kept their viability. In another study(26), different concentrations of Arabic gum were used to increase the viscosity of the medium for cryopreserving horse semen, and a better sperm viability after thawing was reported. Sperm capacitation is necessary to initiate the acrosome reaction, which occurs in vivo in the genital tract of the female, where different signals that cause a destabilization of the membrane participate, sperm hyper activation that facilitates the acrosome reaction(27). DMA at 5 % and glycerol have been used to freeze rooster spermatozoa, finding in both treatments, a reduction in the motility of cryopreserved spermatozoa, as well as their fertilizing capacity; however, this effect was lower in the group treated with DMA(28). Although a slightly higher concentration of 6 % of DMA was used in this work, and the cryopreserved spermatozoa reduced their motility, this effect is attributed to the increase in the viscosity of the medium, finding sperm viability greater than 70 %. It was also observed that in the parameters of incapacitation of thawed spermatozoa, they are greater than 30 %, remaining statistically the same (P>0.05), unlike spermatozoa with inclusion of 10 % ficoll, where there was a significant increase, reaching percentages higher than 50 %. Thus, the percentage of capacitated spermatozoa remains homogeneously above 30 %, regardless of the inclusion of ficoll. In thawed spermatozoa, the percentages of acrosome reaction, it was observed that the inclusion of 10 % ficoll decreased the percentage below 20 %, comparing them with the other inclusions (30 % and 45 %) where the percentages were greater than 40 %. It must be considered that cryopreservation is a process of thermal and osmotic stress that causes the viability and motility of the sperm to decrease. In different species, the process of sperm freezing makes the stimulus to induce the acrosome reaction greater(29), when comparing the process of acrosome reaction through cryopreservation with different cryoprotectants, they suggest in their results that the process for the acrosome reaction to take place is very sensitive to osmotic stress and rapid water/solute changes in the rooster, demonstrating that, using cryoprotectants such as DMA, there is less induction of the acrosome reaction.

182

Rev Mex Cienc Pecu 2022;13(1):175-186

Conclusions and implications In the results of the present work, it is evident that viscosity is a physical factor that influences sperm conservation in rooster semen; the appropriate viscosity parameters were determined to be 2.1698 mPa*s and 3.2320 mPa*s. The viscosity preserves the parameters of sperm viability and morphology in post cryopreservation, preventing energy expenditure in the sperm through the decrease of its motility. It was shown to reduce the spontaneous acrosome reaction in thawed spermatozoa and increase sperm incapacitation, which showed that it is a reversible physiological state, with which the sperm can be preserved intact until it reaches the fertilization site.

Acknowledgements

To Dr. Cindy Gabriela Hernández for her help during the use of the laboratory of Biochemistry of Reproduction of the Metropolitan Autonomous University-X.

Conflict of interest

It is declared that there is no type of conflict of interest. Literature cited: 1. Herrera JA, Quintana JA, López M, Betancourt M, Fierro R. Individual cryopreservation with dimethyl sulfoxide and polyvinylpyrrolidone of ejaculates and pooled semen of three avian species. Arch Androl 2005;51(5):353-360. doi: 10.1080/014850190944401. 2. Bootwalla S. Froman D. Effect of extender viscosity on the insemination dose for chickens. Poult Sci 1988;67(8):1218-1221. doi: 10.3382/ps.0671218. 3. Adams G, Ratto M, Collins C, Bergfelt D. Artificial insemination in South American camelids and wild equids. Theriogenology 2009;71(1):166-175. doi: 10.1016/j.theriogenology.2008.09.005. 4. Bravo P, Alarcon V, Baca L, Cuba Y, Ordonez C, Salinas J, Tito, F. Semen preservation and artificial insemination in domesticated South American camelids. Anim Rep Sci 2013;136(3):157-163. doi: 10.1016/j.anireprosci.2012.10.005.

183

Rev Mex Cienc Pecu 2022;13(1):175-186

5. El-Bahrawy K, Rateb S, Khalifa M, Monaco D, Lacalandra G. Physical and kinematic properties of cryopreserved camel sperm after elimination of semen viscosity by different techniques. Anim Rep Sci 2017;187(sn):100-108. doi: 10.1016/j.anireprosci.2017.10.011. 6. Holt W. Germoplasm cryopreservation in elephants and wildt ungulates. In: Cryobanking the genetic resource. Wildlife conservation for the future? Watson PF, Holt W, editors. CRC Press. 2001:319-348. 7. Baskt M, Wishart G, Brillard J. Oviductal sperm selection, transport, and storage in poultry. Poult Sci Rev 1994;5(3):117-143. 8. Blesbois E, Brillard J. Specific features of in vivo and in vitro sperm storage in birds. Animal 2007;1(10):1472-1481. doi: 10.1017/S175173110700081X. 9. Baskt M, Bauchan G. Lectin staining of the uterovaginal junction and sperm-storage tubule epithelia in broiler hens. Poult Sci 2016;95(4):948-955. doi.org/10.3382/ps/pev440. 10. Santiago-Moreno J, Esteso M, Villaverde-Morcillo S, Toledano-Diaz A, Castano C, Velázquez R, et al. Recent advances in bird sperm morphometric analysis and its role in male gamete characterization and reproduction technologies. Asian J Androl 2016;18(6):882-888. doi: 10.4103/1008-682X.188660. 11. Lemoine M, Grasseau I, Brillard J, Blesbois E. A reappraisal of the factors involved in vitro initiation of the acrosome reaction in chicken spermatozoa. Reproduction 2008;136(4):391. doi:10.1530/REP-08-0094. 12. Longobardi V, Albero G, De Canditiis D, Salzano A, Natale A, Balestrieri A, Neglia G, Campanile G, Gasparrini B. Cholesterol-loaded cyclodextrins prevent cryocapacitation damages in buffalo (Bubalus bubalis) cryopreserved sperm. Theriogenology 2017;89(sn):359–364. doi: 10.1016/j.theriogenology.2016.09.048 13. Laffaldano N, Di Iorio M, Cerolini S, Manchisi A. Overview of turkey semen storage: focus on cryopreservation. Annals Anim Sci 2016;16(4):961-974. https://doi.org/10.1515/aoas-2016-0026. 14. Norma Oficial Mexicana NOM-062-ZOO-1999. Especificaciones técnicas para la producción, cuidado y uso de los animales de laboratorio. 15. Burrows W, Quinn J. The collection of spermatozoa from the domestic fowl and turkey. J Poult Sci 1937;16(1):19-24. https://doi.org/10.3382/ps.0160019.

184

Rev Mex Cienc Pecu 2022;13(1):175-186

16. Lake P. The principles and practice of semen collection and preservation in birds. In: Symposia of the Zoological Society of London. 1978;43:31–49. 17. Camarillo R, Jiménez I, Guzmán A, Rosales A, Rodríguez F, Pérez-Rivero J, Herrera J. Oviductal proteins effect in rooster spermatic cryopreservation. CryoLetters 2019; 40(6): 352-356. http://www.cryoletters.org/Abstracts/vol_40_6_2019.htm. 18. Fischer DH, Failing SK, Meinecke‐Tillmann S, Wehrend A, Lierz M. Viability assessment of spermatozoa in large falcons (Falco spp.) using various staining protocols. Reprod Dom Anim 2020;55(10):1383-1392. https://doi.org/10.1111/rda.13785. 19. Lemoine M, Mignon S, Grasseau I, Magistrini M, Bleisbois E. Ability of chicken spermatozoa to undergo acrosome reaction after liquid storage or cryopreservation. Theriogenology 2011;75(1):122-130. doi: 10.1016/j.theriogenology.2010.07.017. 20. Herrera JA, Calderón G, Guzmán A, Vargas AK, Ávalos A, Rosales A. Evaluation of two diluents for the storage of fresh and cryopreserved eyaculado of Harris hawk (Parabuteo unicinctus). Autrals J Vet Sci 2017;49(1):39-43. doi.org/10.4067/s071981322017000100039. 21. Hammer Ø, Harper D, Ryan P. PAST: Paleontological statistics software package for education and data analysis. Paleontología Electrónica 2001;4(1):1-9. 22. Donoghue A, Wishart G. Storage of poultry semen. Anim Rep Sci 2000;62(1-3):213232. doi: 10.1016/s0378-4320(00)00160-3. 23. Skidmore J. The use of some assisted reproductive technologies in old world camelids. Anim Rep Sci 2019; 207(sn):138-145. doi: 10.1016/j.anireprosci.2019.06.001. 24. Al-Bulushi S, Manjunatha B, Bathgate R, Rickard J, De Graaf S. Liquid storage of dromedary camel semen in different extenders. Anim Rep Sci 2019; 207(sn):95-106. https://doi.org/10.1016/j.anireprosci.2019.06.008. 25. Lemoine, M. Potential involvement of several signaling pathways in initiation of the chicken acrosome reaction. Biol Rep 2009;81(4):657–665. doi: 10.1095/biolreprod.108.072660. 26. Ali M, Musa M, Alfadul S, Al-Sobayel K. Effect of gum arabic on stallion sperm survival during cold storage and post freezing. Mac Vet Rev 2018;41(1):21-31. https://doi.org/10.1515/macvetrev-2017-0026. 27. Lemoine M, Grasseau I, Brillard JP, Blesbois E. A reappraisal of the factors involved in in vitro initiation of the acrosome reaction in chicken spermatozoa. Reproduction 2008;136(4):391-399. doi: 10.1530/REP-08-0094.

185

Rev Mex Cienc Pecu 2022;13(1):175-186

28. Abouelezz F, Sayed M, Santiago-Moreno J. Fertility disturbances of dimethylacetamide and glycerol in rooster sperm diluents: Discrimination among effects produced pre and post freezing-thawing process. Anim Rep Sci 2017;184(sn):228-234. DOI: 10.1016/j.anireprosci.2017.07.021. 29. Mocé E, Grasseau I, Blesbois E. Cryoprotectant and freezing-process alter the ability of chicken sperm to acrosome react. Anim Rep Sci 2010;122(3-4):359-366. doi: 10.1016/j.anireprosci.2010.10.010.

186

https://doi.org/10.22319/rmcp.v13i1.5943 Article

Antimicrobial residues found in poultry commercialized in retail stores from the Metropolitan Area of Guadalajara, Jalisco

Delia Guillermina González-Aguilar a Maritza Alejandra Ramírez-López a Iyari Ximena Uribe-Camberos a Jeannette Barba-León a*

Universidad de Guadalajara. Departamento de Salud Pública. Camino Ramón Padilla Sánchez No. 2100 Nextipac, 45200, Zapopan, Jalisco. México.

* Corresponding author: jeannette.barba@academicos.udg.mx

Abstract: The increased demand to produce large quantities of meat and animal products for human consumption has promoted the indiscriminate use of antimicrobials. The increased use of these substances in the production of poultry, has negative consequences on Public Health due to the fact that the accumulation of antimicrobial residues in the organs and tissues of poultry might reach the consumer. The presence of antimicrobial residues can cause problems of hypersensitivity in humans, or the emergence of antimicrobial resistant pathogens. The purpose of this work was to assess the presence of antimicrobial residues in kidney and muscle tissue of poultry, commercialized in four municipalities of the Metropolitan Area of Guadalajara, Jalisco. The results show that kidney samples had a higher number of positive results compared to muscle tissue. Inhibitors of the folate pathway (sulfamethazine) were the antimicrobials with the highest number of positive results in kidney samples. In contrast, in muscle tissue, β-Lactam (penicillin) were the antimicrobials with the highest number of positive samples. Regarding the analysis of the results by municipalities, it was observed that one of them showed a greater number of positive samples for all the classes of antimicrobials evaluated. This work shows the presence of antimicrobial residues in kidney and muscle

187

Rev Mex Cienc Pecu 2022;13(1):187-199

tissues of poultry, commercialized in retail sites. Therefore, it is necessary to increase efforts to monitor and control the use of antimicrobial in poultry farms. Key words: Antibiotic residues, Poultry meat, Jalisco, Retail sale.

Received: 16/02/2021 Accepted: 15/06/2021

Introduction The poultry industry in Mexico is one of the most productive in terms of meat production(1). The increase on the demand for poultry meat has increased the use of antimicrobials in its production; either to control animal diseases or as growth promoters(2). In Europe, it is estimated that approximately 80 % of chicken poultry receives at least once antimicrobial treatment during their growth, with an average of 172 mg/kg from hatch to slaughter(3). One of the risks to human health, associated with the use of antimicrobials during intensive poultry production, is the presence of antimicrobial residues in the meat consumed. The presence of antimicrobial residues in the meat can promote health risks in consumers such as toxicity, immunopathological diseases, allergic reactions, carcinogenic effects, among other illnesses(4,5). Additionally, the presence and ingestion of antimicrobial residues, can promote the appearance of drug-resistant pathogens(6). According to the Center for Disease Control and Prevention (CDC), the emergence of antimicrobial-resistant pathogens, such as Campylobacter and Salmonella, is one of the greatest Public Health challenges of this century(6,7). It has been reported that the abuse of antimicrobials and their inappropriate use, in relation to the dose applied and the period of non-antimicrobials application to the animals before their slaughter (abstinence period), is the main cause of accumulation of antimicrobial residues in the organs and tissues of poultry(4,5). In this regard, antimicrobial residues can be located with different concentrations in several tissues, a situation that depends on the antimicrobial class and its route of administration(8). In addition to the study of the presence of antimicrobial residues in tissues intended for human consumption, several studies use the kidney as a sample matrix, since it is the organ responsible for excreting most drugs(9). Most antimicrobials, such as β-lactams, tetracyclines, streptomycin, sulfamethazine, and chloramphenicol, have been reported to be excreted in the urine either as the parent drugs or

188

Rev Mex Cienc Pecu 2022;13(1):187-199

as a derived metabolite(10). Therefore, in this study the presence of penicillin, sulfamethazine and streptomycin was analyzed as an indicator of the use of these antimicrobials during the production of the analyzed poultry. Scientific evidence shows that the classes of antimicrobials commonly used in the poultry industry in the world are aminoglycosides (streptomycin)(11), β-lactams (penicillin)(12), folate pathway antagonists (sulfonamides-sulfamethazine), quinolones (ciprofloxacin) and tetracyclines(13). The toxicity of each one of these classes is different, for example, aminoglycosides are hepatotoxic and ototoxic, Folate pathway inhibitors have teratogenic effects, and can cause urinary tract problems. On the other hand, β-Lactam causes neurotoxicity in cases where kidney function is altered or there are pre-existing brain lesions. Additionally, the three antimicrobial classes cause the disruption of the intestinal flora(5). In Mexico, these three classes are listed as drugs subject to monitoring in poultry(14). Therefore, this study tested the presence of three antimicrobial residues in kidney and muscle tissue of poultry in four municipalities of the Metropolitan Area of Guadalajara (MAG). The antimicrobial residues evaluated in this study are representative of the three antimicrobial classes monitored in Mexico.

Material and methods Collection of samples

A total of 177 kidneys and 177 muscle tissues, corresponding to the lower back (rump) of an equal number of poultry carcasses, were purchased in retail stores of four municipalities of the MAG. The samples were collected randomly, from February to June 2018. The municipalities tested were Guadalajara (A) with 43 samples assessed for each tissue tested (43 kidney samples and 43 muscle samples), Tlaquepaque (B) with 40 samples, Tonalá (C) with 44 samples and Zapopan (D) with 50 samples. The number of samples per municipality was calculated with Win Episcope v 2.0 software, considering a confidence of 95% and an error of 5%. Kidney and muscle tissue samples were transported in coolers to the Inocuidad de Alimentos Laboratory of the Departamento de Salud Pública of the Centro Universitario de Ciencias Biológicas y Agropecuarias, Universidad de Guadalajara, for analysis.

189

Rev Mex Cienc Pecu 2022;13(1):187-199

Sample processing

All the kidney and muscle tissue samples collected were dissected in triplicate with a sterile 8 mm punch, under aseptic conditions. The presence of antibiotic residues was assessed by the method of Bacillus subtilis (6 log10 CFU) plate diffusion agar(15,16) using MacConkey agar. The agar was made with three different pH's, where each pH allows testing a different class of antimicrobial. Medium with pH 6 was used in order to test for the presence of βLactam residues and was added with penicillin (0.10 I.U.); the medium with pH 7 was used to test for residues of the Folate pathway inhibitors, and it was added with sulfadiazine (0.5 μg); the medium with pH 8 was used to test for aminoglycosides residues, and it was added with streptomycin (0.5 μg). Each one of the samples obtained from kidney and muscle tissue were placed onto plates, corresponding to each one of the antimicrobials assessed, as shown in Figure 1. A 6 mm square of sterile filter paper (Whatman 4) was used as a negative control. The plates were incubated at 37 + 1 °C/24 h. The presence of antimicrobial residues was assessed based on the diameter of the inhibition zone formed in the growth plate of B. subtilis. The measurement was carried out with a vernier ranging from the outer edge of the sample to the end point of the inhibition zone. Inhibition zones equal or greater than 2 mm were considered positive; inhibition zones smaller than 2 mm but equal or greater than 1 mm were considered suspicious and inhibition zones smaller than 1 mm were considered negative(15). Figure 1: Scheme of the sample’s placement on the antimicrobial plates. M: muscle, K: kidney

190

Rev Mex Cienc Pecu 2022;13(1):187-199

Statistical analysis

The data were analyzed with GraphPad Prism 8.4.2. software. Mann Whitney test, KruskalWallis test and post hoc Dunn's multiple comparisons test was used. A P<0.05 was considered a statistically significant difference.

Results Kidney and muscle tissue samples from 177 chicken carcasses were assessed for antimicrobials residues of penicillin (pH 6), sulfamethazine (pH 7) and streptomycin (pH 8) using B. subtilis plate diffusion agar assay. The 33.3 % (59/177) of samples tested were positive for the presence of any of the antimicrobial residues evaluated, where 22.6 % (40/177) of the samples came from kidney specimens and 10.7 % (19/177) came from muscle tissue (P<0.05) (Table 1). In contrast, 44.1 % (78/177) of the samples were classified as suspicious, where 37.3 % (66/177) corresponded to kidney and 6.8 % (12/177) to muscle tissue (P<0.05). The 40.1 % (71/177) of the kidney samples and the 82.5 % (146/177) of muscle tissue samples were negative. Municipality B was the one with the highest percentage of positive samples reported (18.0 %), followed by municipality D (7.4 %) and municipality A (6.8 %). Regarding the suspicious results, municipality D showed the largest number of samples in this category (22.1 %), followed by municipality B (10.1 %) and municipality A (7.9 %). Municipality C was the one that showed the lowest number of positive (1.2 %) and suspicious samples (4.0 %). Table 1: Presence of antimicrobial residues in poultry sold in MAG retail stores Samples Resistant Suspicious samples Negative samples Municipality (n) samples (%)* (%) (%) Organ M K M K M K A 43 2.3 4.5 1.7 6.2 20.3 13.6 B 40 5.6 12.4 1.1 9.0 15.8 1.1 C 44 0.6 0.6 0.0 4.0 24.3 20.3 D 50 2.3 5.1 4.0 18.1 22.0 5.1 Total 177 *The percentage shown was calculated based on the total of muscle tissue (M) and kidney (K) samples analyzed.

The analysis of the positive samples by the type of residues tested, showed a similar number of positive samples in kidneys (P>0.05) (Figure 2). In contrast, penicillin was the residue that

191

Rev Mex Cienc Pecu 2022;13(1):187-199

showed the highest number of positive samples in muscle (8/177), followed by streptomycin (6/177) and sulfamethazine (5/177) (P>0.05). Regarding the number of suspicious samples, it was observed that kidney was again the organ with the highest number of suspicious samples, penicillin being the residue with the highest number of positive results (30/177) followed by streptomycin (21/177) and sulfamethazine (15/177). Interestingly, muscle samples reported fewer suspicious results for sulfamethazine (6/177), penicillin (4/177) and streptomycin (2/177). The statistical analysis of suspicious samples showed statistically significant differences between the type of samples (K vs M) (P<0.05). In contrast, no statistically significant difference was found by class of antimicrobial residue (P>0.05). Figure 2: Positive and suspicious samples by antimicrobial assessed

The graph shows in white the number of positive samples for each of the antimicrobials tested. The number of suspicious samples per antimicrobial tested is shown in gray. ABCDE Different capital letters indicate statistically significant differences (P<0.05).

The analysis of the antimicrobial residues results by locality showed that municipality B is the one with the highest number of positive samples for the three residues evaluated in both types of evaluated samples (K and M). Statistical analysis showed statistically significant differences for the number of positive samples for ampicillin residue in kidney tissue between municipalities B, C and D (P<0.05). For sulfamethazine, statistically significant differences were observed between municipalities B and C (P<0.05). Finally, for streptomycin residue, the differences were observed in municipalities A, B and C (P<0.05) (Figure 3a). Regarding the number of suspicious samples in kidney, it was found that municipality D was the one with the highest number of samples reported for the three residues evaluated compared with the rest of the municipalities (P<0.05).

192

Rev Mex Cienc Pecu 2022;13(1):187-199

A similar pattern was observed for muscle tissue, where municipality B was the one with the highest number of positive samples reporting the three residues evaluated (P>0.05) and municipality D the one with the highest number of suspicious samples for sulfamethazine and streptomycin residues (P>0.05) (Figure 3b). Interestingly, in muscle tissues, municipality C did not report positive or suspicious samples for sulfamethazine and streptomycin residues and only reported one positive sample for ampicillin residue. Figure 3: Positive and suspicious samples evaluated by antimicrobial and municipality a) Kidney

b) Muscle

The graph shows in white the number of positive samples for each of the antimicrobials tested. The number of suspicious samples per antimicrobial tested is shown in gray. * indicate statistically significant differences (P<0.05), between the bars indicated by the arrowheads.

193

Rev Mex Cienc Pecu 2022;13(1):187-199

Discussion Several investigations have reported the implications of the presence of antimicrobial residues in the tissues of animals destined for human consumption, both in human health as well as in the development of drug resistance in zoonotic pathogens. Currently, the World Health Organization indicates that, in order to prevent and control the spread of antimicrobial resistance, the agricultural sector should administer antibiotics to animals only under veterinary supervision, avoiding the use of antibiotics as growth promoters or to prevent diseases in healthy animals. The use of vaccines is recommended in animals destined for consumption, in order to reduce the need for the use of antibiotics. Likewise, it is recommended to improve hygiene at control points throughout the production chain(17). It has been reported that the emergence of zoonotic pathogens resistant to multiple classes of antimicrobials can spread from the animal to food, causing difficult-to-treat food-borne diseases in humans, resulting in a significant health, medical and socioeconomic impact(18). The inappropriate and excessive use of antimicrobials in poultry, evidenced by the presence of antimicrobial residues in organs such as the kidney and/or tissues, promotes either that the microbiota of poultry, or the zoonotic pathogens present within the animals, obtain, and transmit antimicrobial resistance genes by selection pressure. In consumers, the presence of antimicrobial residues in food can affect their health in two main ways: (1) promoting allergic and toxic reactions, due to prolonged exposure to low levels of residues or (2) due to a possible appearance and spread of antimicrobials resistance in the host microbiota or in pathogens that cause a difficult to treat infection(19). In this regard, in Vietnam found a relationship between the antimicrobial residues present in poultry meat from wet markets and supermarkets and non-typhoid Salmonella (NTS) strains obtained from the same samples. The study consisted of the analysis of 119 samples, where the presence of 10 antimicrobial residues was found. The classes of Folate pathway inhibitors, tetracyclines and macrolides were the ones that showed the highest number of NTS resistance. The prevalence of NTS was 71.8 %, the most common serotypes being Kentucky, Corvallis, Agona and ST2024. From the Salmonella isolates recovered, it was observed that bacterial resistance and the presence of antimicrobial residues in poultry meat corresponded to the classes of tetracyclines and Folate pathway inhibitors. The results shown in the Vietnam study emphasize that there is a correlation between the presence of antimicrobial residues in poultry tissues and the isolation of resistant pathogenic bacteria(20). This study shows the presence of residues in kidney and muscle tissues to three different classes of antimicrobials, β-Lactam (penicillin), Folate pathway inhibitors (sulfamethazine) and Aminoglycosides (streptomycin), from poultry commercialized in four municipalities of the MAG (Table 1). The percentage of positive samples (33.3 %) found in this study is higher

194

Rev Mex Cienc Pecu 2022;13(1):187-199

than that found in raw beef in Erbil, Iraq (10.8 %)(21) and in poultry in Shanghai, China (22.2 %)(19) and is lower than that reported in poultry food (47.3 %) in Fujian, China(22). The results obtained in this study compared to those obtained in Iraq and China show that despite the existence of regulations and antimicrobial residue control programs, their surveillance and control is not efficient. Either due to lack of infrastructure and diagnostic tests to identify antimicrobial residues in the organs and tissues of poultry or due to lack of experience to detect these residues. The results obtained here showed that the Folate pathway inhibitors were the ones with the highest number of positive samples reported in kidney, followed by β-Lactam and Aminoglycosides residues. In contrast, in muscle samples, the residue that reported the highest number of positive samples was β-Lactam, followed by Aminoglycosides and Folate pathway inhibitors. The observed results contrast with the results reported in China, where Tetracycline is the antimicrobial residue with the highest incidence in poultry(22). Likewise, the results of this study are in agreement with those reported in Pakistan and Nigeria, where the residues of Folate pathway inhibitors (sulfonamides) were the antibiotic class with the highest incidence in poultry(23,24). It appears that the presence of antimicrobial residues belonging to the classes of Folate pathway inhibitors and Tetracyclines is dependent on the antimicrobial frequently used in each country. The presence of antimicrobial residues in México, China and Africa shows the lack of economic resources that would allow the acquisition of supplies and technical training to carry out an adequate antimicrobial residue control program. In Mexico, although there are government regulations for antimicrobial residue control programs, these are only carried out in slaughter plants whose product is destined for export products, neglecting local consumption. On the other hand, studies have reported that positive kidney samples for antimicrobial residues are higher than those found in muscle, due to the fact that the abstinence period in the application of the antimicrobial is reflected more quickly in the muscle than in the kidney(25). For this reason, a positive result in kidney should not be considered an indicator of muscle tissue quality(25). In this regard, it has been reported that aminoglycoside residues remain in the kidney for prolonged periods of time, even months, due to their affinity to the renal cortex(26). Regarding the results of the number of samples positive to multiple classes of antibiotics, such as those observed in municipalities A, B and D, the results obtained are similar to those reported in China and the Netherlands(22,27). In China, it was reported that 28.8 % of the positive samples were positive for two or more antibiotic residues, where the tetracycline residue was the most frequently found, followed by the residues of Folate pathway inhibitors(22). Additionally, the differences observed in this study regarding findings obtained for municipalities A, B and D are possibly due to the origin of the broilers that process each slaughter plant. The results obtained suggest that the animals slaughtered in the plants of municipalities A and D come from farms that carry out some operational control program. In contrast, the results observed in municipality B suggest that broilers come from farms where 195

Rev Mex Cienc Pecu 2022;13(1):187-199

there is no adequate control in the administration and suspension of antimicrobial treatments prior to slaughter.

Conclusions and implications The results obtained show that the analyzed poultry reach the slaughter plants with the presence of antimicrobial residues in the kidney and muscle. The presence of antimicrobials analyzed in broilers suggests abuse in their administration. Since there are not traceability studies of the animals received in each slaughterhouse analyzed in this study, it is necessary to carry out studies that monitor the different classes of antimicrobials and doses administered to poultry. However, the results of this study only reflect a local problem in Jalisco, Mexico and the data in this study do not necessarily reflect the situation in the country. Likewise, the lack of human risk assessment studies within Mexican populations, makes it difficult to analyze the risk of exposure to antimicrobials, due to the ingestion of poultry meat, both locally and nationally.

Acknowledgements

The authors thank Kevin Brian Magallon Carrizales and Sergio Arturo Cordova Ramírez for his technical support.

Declaration of competing interest

All authors declare that there are no conflicts of interest. Literature cited: 1.

CEDRSSA. Centro de Estudios para el Desarrollo Rural Sustentable y la Soberanía Alimentaria. La importancia de la industria avícola en México. 2019. http://www.cedrssa.gob.mx/files/b/13/47Industria_Avicola_M%C3%A9xico.pdf. Consultado Mayo 19, 2021.

Hedman HD, Vasco KA, Zhang L. A review of antimicrobial resistance in poultry farming within low-resource settings. Animals 2020;10(8).

196

Rev Mex Cienc Pecu 2022;13(1):187-199

De Briyne N, Atkinson J, Pokludova L, Borriello SP. Antibiotics used most commonly to treat animals in Europe. Vet Rec 2014;175(13).

Muaz K, Riaz M, Akhtar S, Park S, Ismail A. Antibiotic residues in chicken meat: global prevalence, threats, and decontamination strategies: A review. J Food Prot 2018;81(4):619-627.

Vishnuraj M, Kandeepan G, Rao K, Chand S, Kumbhar V. Occurrence, public health hazards and detection methods of antibiotic residues in foods of animal origin: A comprehensive review. Cogent Food & Agriculture 2016;2(1235458):1-8.

Golden CE, Mishra A. Prevalence of Salmonella and Campylobacter spp. in alternative and conventionally produced chicken in the United States: A systematic review and Meta-Analysis. J Food Prot 2020;83(7):1181-1197.

CDC. Centers for Disease Control and Prevention. CDC. Antibiotic resistance threats in the United States, 2019. https://www.cdc.gov/drugresistance/pdf/threats-report/2019ar-threats-report-508.pdf. Accessed May 19, 2021.

Van Boeckel TP, Brower C, Gilbert M, Grenfell BT, Levin SA, Robinson TP, et al. Global trends in antimicrobial use in food animals. Proc Natl Acad Sci USA 2015;112(18):5649-5654.

Ezenduka EV. Screening of antimicrobial residues in poultry meat in Enugu metropolis, Enugu State, South East Nigeria. Vet Ital 2019;55(2):143-148.

10. Wu Q, Zhu Q, Shabbir MA, Sattar A, Peng DP, Tao YF, et al. The search for a microbiological inhibition method for the rapid, broad-spectrum and high-throughput screening of six kinds of antibiotic residues in swine urine. Food Chem 2021;339. 11. Pikkemaat MG, Rapallini M, Zuidema T, Elferink JWA, Oostra-van Dijk S, Driessenvan Lankveld WDM. Screening methods for the detection of antibiotic residues in slaughter animals: comparison of the European Union Four-Plate Test, the Nouws Antibiotic Test and the Premi (R) Test (applied to muscle and kidney). Food Additives & Contaminants 2011;28(1):26-34. 12. Hakem A, Titouche Y, Houali K, Yabrir B, Malki O, Chenouf N, et al. Screening of antibiotics residues in poultry meat by microbiological methods. University of Agricultural Sciences and Veterinary Medicine 2013;70(1). 13. Karmi M. Detection and presumptive identification of antibiotic residues in poultry meat by using FPT. Global J Pharmacol 2014;8(2):160-165.

197

Rev Mex Cienc Pecu 2022;13(1):187-199

14. SENASICA. Servicio Nacional de Sanidad IyCA. Tabla de Límites Máximos de Residuos, 2020. https://www.gob.mx/senasica/documentos/limites-maximos-deresiduos-toxicos-y-contaminantes?state=published. Consultado Mayo 19, 2021. 15. Bogaerts RWF. A standardized method for the detection of residues of antibacterial substances in fresh meat. Fleischwirtschaft 1980;60:672-674. 16. Gondová Z, Kožárová I, Poláková Z, Mad’arová M. Comparison of four microbiological inhibition tests for the screening of antimicrobial residues in the tissues of foodproducing animals. Ital J Anim Sci 2014;13(4):729-735. 17. World Health Organization. Antimicrobial resistance. 2020. https://www.who.int/newsroom/fact-sheets/detail/antimicrobial-resistance. Accessed May 19, 2021. 18. Madoroba E, Kapeta D, Gelaw AK. Salmonella contamination, serovars and antimicrobial resistance profiles of cattle slaughtered in South Africa. Onderstepoort J Vet Res 2016;83(1). 19. Wang HX, Ren LS, Yu X, Hu J, Chen Y, He GS, et al. Antibiotic residues in meat, milk and aquatic products in Shanghai and human exposure assessment. Food Control 2017;80:217-225. 20. Nhung NT, Van NTB, Cuong NV, Duong TTQ, Nhat TT, Hang TTT, et al. Antimicrobial residues and resistance against critically important antimicrobials in nontyphoidal Salmonella from meat sold at wet markets and supermarkets in Vietnam. Int J Food Microbiol 2018;266:301-309. 21. Al-Mashhadany DA. Detection of antibiotic residues among raw beef in Erbil City (Iraq) and impact of temperature on antibiotic remains. IJFS 2019;8(1):6-10. 22. Yang Y, Qiu WQ, Li YX, Liu LJ. Antibiotic residues in poultry food in Fujian Province of China. Food Addit Contam Part B-Surveill 2020;13(3):177-184. 23. Oyedeji AO, Msagati TAM, Williams AB, Benson NU. Determination of antibiotic residues in frozen poultry by a solid-phase dispersion method using liquid chromatography-triple quadrupole mass spectrometry. Toxicol Rep 2019;6:951-956. 24. Rabia A, Sidrah S. Identification and quantification of antimicrobial activity in commercially available chicken meat in a large urban centre in Pakistan. CRFS 2020;3:173-177. 25. Rahimi Z, Shahbazi Y, Ahmadi F. Comparative screening of chloramphenicol residue in chicken tissues using four plate test and premi (R) test methods. J Pharm Sci 2018;24(2):157-162.

198

Rev Mex Cienc Pecu 2022;13(1):187-199

26. Tajik H, Malekinejad H, Razavi-Rouhani SM, Pajouhi MR, Mahmoudi R, Haghnazari A. Chloramphenicol residues in chicken liver, kidney and muscle: A comparison among the antibacterial residues monitoring methods of four plate test, ELISA and HPLC. Food Chem Toxicol 2010;48(8-9):2464-2468. 27. Pikkemaat MG, Rapallini M, Oostra-van DS, Elferink JWA. Comparison of three microbial screening methods for antibiotics using routine monitoring samples. Anal Chim Acta 2009;637(1-2):298-304.

199

https://doi.org/10.22319/rmcp.v13i1.5675 Article

Serological determination of enzootic bovine leukosis virus (EBLV) in the municipality of Paipa, Boyacá (Colombia)

Jorge Alejandro Jiménez Sánchez a Diana María Bulla-Castañeda a Adriana María Díaz-Anaya a Diego José Garcia-Corredor a Martin Orlando Pulido-Medellin a*

Universidad Pedagógica y Tecnológica de Colombia. Facultad de Ciencias Agropecuarias. Grupo de Investigación en Medicina Veterinaria y Zootecnia – GIDIMEVETZ. Avenida Central del Norte 39 - 115, Tunja (Boyacá) - Colombia.

*Corresponding author: martin.pulido@uptc.edu.co

Abstract: Enzootic Bovine Leukosis (EBL) is an economically important infection of dairy cattle, caused by the Enzootic Bovine Leukemia Virus (EBLV). The usual method of spread of EBLV infection is horizontal transmission, through direct and indirect exposure of susceptible animals to infected lymphocytes from blood or milk. After infection, animals appear to be clinically healthy during the first years after infection, but between 30 and 70 % of animals may develop persistent lymphocytosis and 0.1 to 10 % of cattle suffer from lymphosarcoma. This infection is detected by serological tests, usually by the enzyme-linked immunosorbent assay (ELISA). The objective of this research was to determine the seroprevalence of EBLV in bovine females from the municipality of Paipa (Boyacá). The epidemiological study was Descriptive Observational (Cross-sectional) with simple random sampling, where 1000 serum samples were collected, which were processed using the indirect ELISA technique implementing the commercial kit SERELISA® BLV Ab Mono Blocking. A seroprevalence of 31.1 % (311/1000) was determined, finding a statistically significant association between breed, age and seropositivity for the virus.

200

Rev Mex Cienc Pecu 2022;13(1):200-210

Key words: Bovine diseases, Leukosis, Seroprevalence, ELISA.

Received: 27/04/2020 Accepted: 07/04/2021

Introduction EBL or also known as Bovine Viral Leukosis (BVL) is a persistent infectious disease caused by a retrovirus that belongs to the genus Deltaretrovirus and attacks cattle, mainly milk-producing animals(1,2). Cattle are the only species that is naturally infected with EBLV, although it is possible to experimentally infect sheep, goats, horses, deer, rabbits, rats, guinea pigs, cats, among others(3). The virus mainly affects B lymphocytes, it is transmitted horizontally and vertically, the first being the most important source of contagion(4), which is mainly caused by arthropods such as horse flies and by the ingestion of colostrum from an infected cow. In addition, it can occur due to iatrogenic infection, which occurs through surgical instruments or sleeves contaminated with infected blood that remains as a residue of a rectal palpation(5). The disease does not spread rapidly between herds, however, within the affected herds, the seropositivity can be up to 80 %. The usual incubation period is 4 to 5 yr. Infection is rare in animals younger than 2 years and its maximum frequency occurs between 4 to 8 years of age(3). Animals infected with the virus usually have no visible signs, however, exophthalmia is the most specific sign of the disease, in which degeneration of the retroocular tissue and internal structures of the eye occurs(6,7). Other characteristic symptoms of the disease are loss of appetite, weight loss, general weakness and, sometimes, neurological manifestations. Superficial lymph nodes may become swollen and may be felt under the skin or by rectal examination(8). It is a disease that affects milk production. Animals infected with EBLV have been shown to have a decrease in milk production ranging from 2.5 to 5 % compared to the herd(9-12). In addition to this, there is greater susceptibility to the appearance of other diseases such as mastitis, diarrhea and pneumonia(7). While more than 20 countries have successfully eliminated EBLV through control programs, the prevalence of the virus can be up to 90 % in endemic areas such as Eastern Europe, South America, and several Asian countries(13).

201

Rev Mex Cienc Pecu 2022;13(1):200-210

In Colombia the disease is considered notifiable (ICA Resolution 3714 of 2015)(14). However, there is no program to prevent the spread of EBLV in cattle, which would help prevent the appearance of the disease, contributing to the mitigation of its economic impact(15). In the case of EBL, animals positive for the virus and those with persistent lymphocytosis can only be diagnosed through laboratory techniques, while animals with lymphosarcoma can be easily diagnosed by the veterinarian in the field(16). In Boyacá, little research has been done on the disease(8), which shows the lack of information about it in the area. In turn, in the municipality of Paipa, the seroprevalence of the virus and the relationship that exists with its manifestation in dairy production are unknown, a condition that is considered of great relevance, since this is a municipality with an agro-industrial economic profile with a strong livestock sector, and a marked trend towards growth. Considering the above, the objective of this research was to determine the seroprevalence of EBLV in the municipality of Paipa, Boyacá.

Material and methods Geographical location

The study was conducted in Paipa (Boyacá), a Colombian municipality located in the center-east of Colombia. It is located in the Tundama province of the department. According to the data from the 2005 census, it has a population of 27,274 inhabitants. In the regional economic structure, the municipality participates extensively with various products in each of the economic sectors. In the primary sector, agriculture, livestock and mining are carried out. Within agriculture, oats, barley, corn, wheat, potatoes and legumes are grown and in livestock, products such as milk and meat are obtained(17).

Sample size

According to the National Livestock Census conducted by the Colombian Agricultural Institute (2019)(18), in the municipality of Paipa, a bovine population of 22,975 heads of cattle was registered, where 16,968 of these individuals were females. Taking into account this information, a sample of 1,000 bovine females was determined from the following formula, obtained through the statistical program OpenEpi, version 3: [DEFF*Np(1-p)]/ [(d2/Z21-α/2*(N-1) + p*(1-p)]; where: d= confidence limits as a % of 100 (absolute +/-%) = 3%; n= population size (22,975); p= hypothetical frequency % of the result factor in the population = 50%+/-3; Z1-α/2= two-sided Z value, 1.96 for a 95 %

202

Rev Mex Cienc Pecu 2022;13(1):200-210

confidence interval; α= tail probability, e.g., 0.05 for a 95 % confidence interval; design effect (for group surveys-DEFF).

Variables evaluated

The variables mounting and artificial insemination, type of milking implemented in each farm, breed and age of the sampled animals were evaluated.

Sampling and processing

Blood samples were obtained from females older than 2 yr of age and belonging to the Ayrshire, Holstein, Jersey and Normande breeds; prior to taking the blood sample, the area was disinfected with alcohol to facilitate the collection and avoid its contamination. By puncture in the coccygeal vein using needle caliber 16 and 18 of 3 inches, 7 ml of blood were extracted, implementing the vacuum tube system (Vacutainer type, red or yellow top). These tubes were labeled, refrigerated in polystyrene coolers and transported to the Veterinary Parasitology laboratory of the Pedagogical and Technological University of Colombia (UPTC, for its acronym in Spanish), where they were centrifuged at 2,500 rpm for 10 min to separate the cells from the serum. Then with a Pasteur pipette, the serum was transferred to an Eppendorf tube for storage at -20 °C(19). The samples were processed with the indirect ELISA technique using the commercial kit SERELISA® BLV Ab Mono Blocking (Zoetis, United States) with a sensitivity of 97 % and specificity of 98 %, following the manufacturer’s instructions.

Statistical analysis

The epidemiological study was descriptive observational (cross-sectional) with simple random sampling, where the target population was made up of dairy cattle from the municipality of Paipa, while the study population were bovine females of the Holstein, Ayrshire, Jersey and Normande breeds that were two years or older. The data obtained were processed in the statistical program IBM SPSS Statistics 19. The chi-square test was performed to determine if there was a relationship between the presence of antibodies against EBLV and the variables evaluated (P≤0.05), where the reference categories for age was the age group of 2-3 yr and for the breed it was the Ayrshire. The variables that presented statistical significance, where the P value was ≤0.05, were analyzed by logistic regression. úsculas

203

Rev Mex Cienc Pecu 2022;13(1):200-210

Ethical considerations

The study was conducted under the conditions of Law 576 of 2000 and Law 84 of 1989 of the Republic of Colombia. Informed consent was obtained from the owners of the cattle prior to the collection of the samples.

Results A seroprevalence of 31.1 % was determined for EBLV (311/1000) in females from the municipality of Paipa. The Jersey breed was the one with the highest seroprevalence (39.2 %), followed by the Holstein, Ayrshire and Normande breeds, with 38.1, 36.7 and 11.3 % respectively. Regarding the age groups evaluated, it was determined that females between 3 and 4 years old have the highest seroprevalence (36.7 %), followed by individuals older than 4 years and the group of cattle between 2 and 3 yr old, with 23.4 and 21 % respectively. Likewise, the breed and age of the sampled individuals presented significant differences (P≤0.05). Regarding age, the age group of 3 to 4 yr presented a statistically significant association (P=0.000; P≤0.05). With respect to the breed, the females of the Normande breed presented a significant association (P=0.000; P≤0.05), in addition to having a value of OR<1, it can be considered that these cattle have less susceptibility to present antibodies against EBLV (Table 1). Table 1: Analysis of age and breed as risk factors associated with EBLV infections Variable Parameter OR CI P-value 2-3 years Age 3-4 years 2.106 1.466 – 3.025 0.000 > 4 years 1.111 0.688 – 1.794 0.667 Ayrshire Holstein 1.065 0.748 – 1.517 0.726 Breed Jersey 1.111 0.759 – 1.626 0.587 Normande 0.220 0.138 – 0.351 0.000 Results are presented as unadjusted Odds Ratio (OR) and 95 % confidence intervals (CI).

Of 651 pregnant females by natural mounting, 32.6 % (212) were seropositive for EBLV, while of 525 cows pregnant by artificial insemination, 30.8 % (162) had antibodies against the virus. However, none of these variables presented a statistically significant association with the appearance of the disease (P>0.05).

204

Rev Mex Cienc Pecu 2022;13(1):200-210

Regarding the milking characteristics implemented in the farms, of the females subjected to manual milking, 30.5 % (210/688) were seropositive for the disease, while, of the mechanically milked cattle, 31.7 % (91/446) presented antibodies against the virus. Finally, it should be noted that there was no statistical association between the seropositivity for the disease and the type of milking implemented (P≥0.05).

Discussion There are several studies carried out on EBL at the national level. Prevalences of 24.9 % have been reported in the Andean region, 14.4 % for the Caribbean, 15.3 % in the Piedemonte Llanero and 1.5 % in Córdoba using the immunodiffusion technique(20). On the other hand, implementing the ELISA technique in Pasto, the prevalence found was 19.8 %(21), 15 % in Yopal(22), 13.5 % in Toca (Boyacá)(8), 16.32 % and 16.07 % in Patía and Mercaderes (Cauca)(23). Finally, by molecular tests, the departmental distribution of the disease by animal and farm evaluated was established in Cundinamarca (69 and 90 %), Boyacá (71 and 94 %), Antioquia (73 and 100 %), Meta (85 and 100 %), Nariño (14 and 75 %) and Cesar (17 and 75 %)(24). At the international level the prevalences are variable, after the implementation of the ELISA technique, values of 14.6 % have been established in Chile(25), 92.7 % and 46.38 % in Peru(1,26), 5.6 % in Ecuador(27), from 11 to 100 % in Thailand(28). It should be noted that the variation in the results can occur due to the number of animals sampled and the techniques implemented for the diagnosis of the disease. In addition to this, the form of transmission of the virus must be taken into account, which can occur through milk and objects that are contaminated with infected lymphocytes, so the sanitary and management practices implemented in each sampled herd could influence the transfer of the virus from one animal to another(6). With respect to breeds, in the present study, a greater seroprevalence was found in the Jersey breed. This differs from the results obtained by Romero et al in 2015(29), where this breed presented a prevalence of 11.9 %. Likewise, during this study, statistical significant differences were found between this variable and the appearance of antibodies against the virus, results that agree with those reported by Hernandez et al(30), who affirm that there is a strong dependence between the breed group and the seropositivity measured by ELISA (P<0.01). However, this does not coincide with what was reported by other researchers(31), who determine that there is no association between the breed variable and the presence of EBL. On the other hand, the Normande breed is less likely to have the disease compared to individuals of the other breeds, which indicates that it acts as a protective factor against EBLV. This could occur in the first place because individuals of this breed have breed

205

Rev Mex Cienc Pecu 2022;13(1):200-210

characteristics that make them less susceptible to different pathologies and also, not being considered as a specific breed biotype for milk production, it is less likely to have the virus, since it should be taken into account that dairy breeds are more susceptible to the presence of the disease as reported by other studies(7,10,32). In addition to the above, it is important to note that the study developed by Hernandez et al(30) indicates a strong breed effect on the dynamics of infection with EBLV, where Creole cattle such as Harton del Valle had a lower rate of infection with the virus, animals that became infected developed less lymphocytosis, had a higher immune response and maintained a lower proviral load compared to the Holstein breed. Regarding age, there were statistical significant differences, which is consistent with what was stated by Betancur and Rodas(31), who identified a higher frequency of infection depending on the age range. Likewise, Hernandez et al(30) established that the presence of EBLV depends on the age of the animal; females between 3 and 4 years of age had the highest seroprevalence, after the implementation of molecular techniques and ELISA, they determined that animals older than 4 years had higher percentages of infection, observing a marked reduction in prevalences in younger animals. In this way, it can be established that there is greater susceptibility to the virus as the age of the animal increases, which could be explained by the existence of accumulated exposure to the virus by maintaining contact with infected animals(31,33). In addition, Gutiérrez et al(34) indicate that passive immunity in young animals can alter the percentages of infection measured by ELISA in a herd with high prevalence of EBLV. On the other hand, the risk factors that predispose to the presence of the disease may be given mainly by the management and practices that are carried out in each of the farms, this being an aspect to take into account to prevent the appearance of the disease and control its spread(8,22). Although in the present study no statistically significant association was found with the reproductive variables evaluated, it was established that there is a high seroprevalence of the virus in females who are pregnant by natural mounting (32.6 %). This is because horizontal transmission occurs mainly due to the presence of infected lymphocytes in biological fluids such as semen(35). In addition, Bonifas and Ulcuango(27) determined that direct mounting contributes to the spread of infection due to the use of EBL-positive bulls. In addition to this, rectal examination is a potential route of transmission of the virus, but transmission is related to other factors, such as the number of palpations with a common glove, the level of contamination of the glove with infected lymphocytes and the age of the animals(36). When relating the disease to the type of milking of the farms, no statistically significant differences were found between this variable and the disease. However, 30.5 and 31.7 % of cattle subjected to manual and mechanical milking, respectively, were seropositive for EBLV. Previous studies have reported that in dairy farms, when having different types of milking, greater intervention is required during this process, facilitating the iatrogenic

206

Rev Mex Cienc Pecu 2022;13(1):200-210

dissemination of viral particles through milk, equipment or hands of the operators, generating that the females are more prone to the appearance of the disease(5,37,38,39).

Conclusions and implications High seroprevalence of EBLV was determined in bovine females from the municipality of Paipa (Boyacá), finding statistical association with the breed and age of the individuals evaluated. It is considered that the early diagnosis of the disease will allow the establishment of effective programs to control it, preventing the spread of the virus in the region. In addition to this, future research is required to compare the influences of each risk factor (type of dehorning, implementation of hypodermic needles, mode of implementation of palpation sleeves, size of the herds, among others) responsible for transmission within the herd, thus contributing to the probability that the disease will reach low epidemic proportions in the future.

Conflict of interest

The authors of this article declare that there is no type of conflict of interest, nor any economic, personal, political relationship, financial or academic interest that may influence their judgment. Literature cited: 1. Sandoval MR, Delgado CA, Ruiz GL, Ramos CO. Determinación de la Seroprevalencia del Virus de la Leucemia Bovina en Lima, Perú. Rev Investig Vet del Perú 2015;26(1):152–158. 2. Vásconez-Hernández A, Sandoval-Valencia P, Puga-Torres B, De La Cueva-Jácome F. Seroprevalencia de leucosis enzoótica bovina en animales entre 6 a 24 meses en las provincias de Manabí, Pichincha y Chimborazo - Ecuador. La Granja 2017;26(2):131–141. 3.Buitrago-Mejia JA, Salzar-Torres LM. Virus de Leucosis Bovina (VLB): Una revisión. Sinergia 2018;3:130–151. 4.Algorta-Turini A, Alvarez-Albanell JP, De Brun-Mnéndez ML. Transmisión de la Leucosis Bovina Enzoótica en un campo de recría de ganado lechero en el sur del Uruguay [tesis doctorado]. Uruguay: Universidad de la República; 2014. 5.Gutiérrez G, Rodríguez SM, De Brogniez A, Gillet N, Golime R, Burny A, et al. Vaccination against δ-retroviruses: The bovine leukemia virus paradigm. Viruses 2014;6(6):2416–2427. 207

Rev Mex Cienc Pecu 2022;13(1):200-210

6.Nekouei O, VanLeeuwen J, Sanchez J, Kelton D, Tiwari A, Keefe G. Herd-level risk factors for infection with bovine leukemia virus in Canadian dairy herds. Prev Vet Med 2015;119(3–4):105–113. 7.Úsuga-Monroy C, Echeverri JJ, López-Herrera A. El componente racial influencia la resistencia a la infección con el virus de la leucosis bovina. Rev Fac Med Vet Zootec 2018;65(2):130–139. 8.Pulido-Medellín M, González-Ariza W, Bayona H, Chavarro-Tulcán G. Determinación de Leucosis Enzoótica Bovina mediante las claves hematológicas de Göttingen y Elisa en Boyacá, Colombia. Rev Fac Ciencias Vet 2017;58(1):10–16. 9.Baruta DA, Ardoino SM, Brandan JL, Sosa RE, Mariani EL, Albretch EM. Leucosis Enzoótica Bovina. Cienc Vet 2011;13(1):9–16. 10.Cadavid G. Impacto del virus de la leucosis bovina en la producción de leche. [tesis maestría]. Palmira, Colombia, Universidad Nacional de Colombia, Sede Palmira, 2012. 11.Erskine RJ, Bartlett PC, Byrem TM, Render CL, Febvay C, Houseman JT. Association between bovine leukemia virus, production, and population age in Michigan dairy herds. J Dairy Sci 2012;95(2):727–734. 12. Apaza J. Seroprevalencia de la Leucosis Viral Bovina (LVB) en vacunos de la raza Brown Swiss en tres asociaciones del distrito de Paucarcolla [tesis licenciatura]. Puno, Perú: Universidad Nacional del Altiplano; 2019. 13. Polat M, Takeshima S, Aida Y. Epidemiology and genetic diversity of bovine leukemia virus. Virol J 2017;14(209):1–16. 14. ICA. Resolución 3714 de 2015. Por la cual se establecen las enfermedades de declaración obligatoria en Colombia. 2015. https://www.ica.gov.co/getattachment/3188abb6-2297-44e289e63a5dbd4db210/2015R3714.aspx . 15. Tsutsui T, Kobayashi S, Hayama Y, Yamamoto T. Fraction of bovine leukemia virusinfected dairy cattle developing enzootic bovine leukosis. Prev Vet Med 2016;124:96–101. 16. Monge-Rojas CR, Elizondo-Salazar JA. La leucosis enzoótica bovina: un asesino silencioso. Nutr Anim Trop 2019;13(1):38–54. 17. Alcaldía Municipal P. Descripción Paipa, Boyacá. 2019. http://www.paipaboyaca.gov.co/MiMunicipio/Paginas/Economia.aspx. 18. ICA. Censo Pecuario Nacional año 2019 [Internet]. 2019. Disponible en: ttps://www.ica.gov.co/areas/pecuaria/servicios/epidemiologia-veterinaria/censos2016/censo-2018.

208

Rev Mex Cienc Pecu 2022;13(1):200-210

19. Figueredo M, Pompei A, Martini M. Manual veterinario de toma y envío de muestras. 2017. 20. Orjuela J. NM, Betancourt L. Salud y productividad en bovinos de la costa norte de Colombia. 2009. http://www.fao.org/3/u5700T07.htm. 21. Benavides-Benavides B, Cedeño-Quevedo DA, Serrano-de La Cruz MF. Epidemiological study of bovine leukemia virus in dairy cows in six herds in the municipality of Pasto, Nariño. Rev Lasallista Investig 2013;10(1):18–26. 22. Bautista RNA, Nova RYA, Pulido-Medellín MO, Andrade-Becerra RJ. Determinación serológica de leucosis bovina enzoótica en novillas de levante y vacas adultas de la vereda Morichal, Yopal, Casanare. Cienc Agric 2013;10(1):31–37. 23. Alvira HC, Velasco JA. Prevalencia del virus de la leucosis bovina (VLB) en los municipios de Patía y Mercaderes [tesis licenciatura]. Popayán, Cauca, Colombia, Universidad del Cauca; 2019. 24. Corredor-Figueroa AP, Salas S, Olaya-Galán NN, Quintero JS, Fajardo Á, Soñora M, et al. Prevalence and molecular epidemiology of bovine leukemia virus in Colombian cattle. Infect Genet Evol 2020;80:104171. 25. Grau MA, Monti G. Prevalencia serológica predial e intrapredial para el virus de la leucosis bovina (VLB) en lecherías de las regiones de Los Ríos y de Los Lagos de Chile. Arch Med Vet 2010;42(2):87–91. 26. Orellana MA. Determinación del status sanitario de Leucosis Bovina mediante la seroprevalencia a través de ELISA competitivo en un hato lechero en la provincia de Carchi [tesis licenciatura]. Florencia, Caquetá, Colombia: Universidad de la Amazonía; 2019. 27. Bonifas N, Ulcuango F. Prevalencia de Leucosis Bovina en la Comunidad Santo Domingo No1, Cayambe-Ecuador 2012. Rev Ciencias la Vida 2015;22(2):33–39. 28. Lee E, Kim E, Ratthanophart J, Vitoonpong R, Kim B, Cho I, Song J, Lee K, Shin Y. Infection, genetics and evolution molecular epidemiological and serological studies of bovine leukemia virus (BLV) infection in Thailand cattle. Infect Genet Evol 2016;41:245–254. 29. Romero JJ, Dávila G, Beita G, Dolz G. Relación entre el estado serológico a leucosis bovina enzoótica y parámetros reproductivos en hatos lecheros especializados de Costa Rica. Agron Costarric 2015;39(2). 30. Hernandez D, Muñoz J, Álvarez L. Dinámica de la leucosis bovina en el ganado criollo Hartón del Valle en infección natural. Arch Zootec 2016;65(251):365–373.

209

Rev Mex Cienc Pecu 2022;13(1):200-210

31. Betancur HC, Rodas GJ. Seroprevalencia del virus de la Leucosis Viral Bovina en animales con trastornos reproductivos de Montería. Rev MVZ Córdoba 2008;13(1):1197–1204. 32. Andreolla AP, Scheer Erpen LM, Frandoloso R, Kreutz LC. Development of an indirect ELISA based on recombinant capsid protein to detect antibodies to bovine leukemia virus. Brazilian J Microbiol 2018;49:68–75. 33. Carrero-Rojas JL, Arévalo-Martínez F, Tarazona-Suárez A, Cepeda BM. Prevalencia de la seropositividad a la leucosis bovina mediante la técnica diagnóstica de ELISA indirecta en hatos lecheros situados en Mesa de los Santos, Santander. Spei Domus. 2009;5(11):6–11. 34. Gutiérrez G, Alvarez I, Politzki R, Lomónaco M, Dus Santos MJ, Rondelli F, Fondevila N, Trono K. Natural progression of Bovine Leukemia Virus infection in Argentinean dairy cattle. Vet Microbiol 2011;151(3–4):255–263. 35. Monti GE, Frankena K, De Jong MCM. Transmission of bovine leukaemia virus within dairy herds by simulation modelling. Epidemiol Infect 2007;135(5):722–732. 36. Radostits OM, Gay CC, Hinchcliff KW, Constable PD. Veterinary medicine: A textbook of the diseases of cattle, horses, sheep, pigs and goats. New York: Elsevier Saunders; 2006. 37. Úsuga-Monroy C, Echeverri J, López-Herrera H. Diagnóstico molecular del virus de leucosis bovina en una población de vacas Holstein, Colombia. Arch Zootec 2015;64(248):383–388 38. Chamizo PEG. Leucosis Bovina Enzootica: Revisión. Rev Electron Vet 2005;6(7):1– 25. 39. Hernández-Herrera DY, Posso-Terranova AM, Benavides JA, Muñoz-Flórez JE, Giovambattista G, Álvarez-Franco LA. Bovine leukosis virus detection in Creole Colombian breeds using nested-PCR. Acta Agronómica 2011;60(4):311–317.

210

https://doi.org/10.22319/rmcp.v13i1.5882 Article

Hematological, biochemical, and endocrine parameters in acute response to increasing-intensity exercise in Colombian Paso horses

Angélica María Zuluaga Cabrera a* Maria José Casas Soto b José Ramón Martínez Aranzales a Viviana Elena Castillo Vanegas c Nathalia María del Pilar Correa Valencia a María Patricia Arias Gutierrez d

Grupo de Investigación CENTAURO, Escuela de Medicina Veterinaria, Universidad de Antioquia, Medellín, Colombia. b

Normandía Centro Equino, Rionegro, Colombia.

Laboratorio Clínico Veterinario Vitalab. Rionegro, Colombia.

Universidad CES, Facultad de Medicina Veterinaria y Zootecnia, Medellín, Colombia.

Corresponding author: angelica.zuluaga@udea.edu.co

Abstract: The present study aimed to describe the hematological, biochemical, and endocrine parameters in acute response to increasing-intensity exercise in Colombian Paso horses (CPHs). A standardized field exercise test was carried out on 11 untrained adult CPHs of both sexes. The variables of interest were measured before and after the test (i.e. hematocrit, total plasma proteins, creatine kinase, creatinine, blood urea nitrogen —BUN, aspartate aminotransferase, gamma glutamyl transpeptidase, triglycerides, cholesterol, alkaline phosphatase, cortisol, insulin, blood sugar levels). Evidence of sympathetic-adrenergic

211

Rev Mex Cienc Pecu 2022;13(1):211-224

response activation, described for other breeds and equestrian sports disciplines (i.e. hemoconcentration, negative change in plasma volume, slight increase in creatinine and BUN) was found. In addition, evidence of mobilization and use of energy sources such as glucose and triglycerides was found. In conclusion, the increasing-intensity exercise carried out during a standardized field test produced a negative change in plasma volume and the activation of the classic sympathetic-adrenergic response in CPHs. Key words: Clinical pathology, Equine, Splenic contraction, Training.

Received: 25/11/2020 Accepted: 08/06/2021

Introduction Standardized treadmill or field exercise tests have allowed to identify the horse's physiological responses and adaptations to exercise. Their characterization and interpretation would later become training indices(1,2). Hematological and biochemical parameters are included within the group of variables of interest to be evaluated from such exercise tests. Nevertheless, what has been reported in this regard in horses may differ according to the intensity and duration of the exercise(3,4). In addition, some findings are not considered as responses or physiological adaptations, but as exercise-induced disorders, including hemolysis and lymphopenia(5). In Colombian Paso horses (CPHs), there are not enough reports to confirm the expected changes during exercise in animals of this breed. Due to the increasing demand for professional accompaniment in the training of CPHs, it became important to describe the hematological, biochemical, and endocrine parameters in acute response to increasing-intensity exercise for the breed.

Material and methods Ethical considerations The procedures carried out on the animals of study were approved by the Comité de Ética para la Experimentación con Animales (CEEA) of the Universidad de Antioquia (Act #122, February 5, 2018).

212

Rev Mex Cienc Pecu 2022;13(1):211-224

Study location

The study was carried out in facilities located in a very humid lower montane forest life zone(6) (2,130 m asl), with an environmental temperature between 12 and 18 °C, and a relative humidity of 69 %.

Animals

Eleven (11) untrained adult CPHs were chosen at convenience. Nine non-pregnant females and two uncastrated males, with a mean of 6.6 ± 4.8 (2.5 to 16) years of age, 371 ± 30 kg of weight and 7/9(7) of body condition were included. Animals were clinically healthy on physical examination, with a complete and updated health plan (vaccines and deworming) at the time of the measurements. Regarding the management conditions, the animals were under complete housing and fed on pangola grass hay (Digitaria eriantha; 2.5 kg/d on average), green forage (Pennisetum purpureum; 30 kg/d on average), commercial balanced feed (2 kg/d on average), mineral salt formulated for horses (100 g/d), and water ad libitum.

Field exercise test

A standardized field exercise test was carried out and was composed by four steps with increasing-intensity, also considering moments of rest and recovery. Heart rate (HR) was measured using a monitor reference Ambit 3 vertical (Suunto®, Finland). The protocol used(8) controlled the intensity of the exercise in each step (warm-up, 58 to 65 % of the maximum HR + moderate intensity, 65 to 75 % of the maximum HR + high intensity, 75 to 85% of the maximum HR + maximum intensity, ≥ 85 % of maximum HR).

Definition of the hematological, biochemical, and endocrine parameters

A venous blood sample was collected in a tube with EDTA for the measurement of hematocrit (HTC) and total plasma proteins (TPPs) during the moments of rest and at the end of each step of the exercise test. The percentage of change in plasma volume was determined by the concentration of albumin at the moment of rest and at the end of the exercise test (9).

213

Rev Mex Cienc Pecu 2022;13(1):211-224

In addition, samples were taken both in a tube with EDTA and in a dry one, at the moments of rest and of maximum intensity for the behavior of the complete blood count [CBC; i.e. total concentration of erythrocytes, leukocytes, neutrophils, lymphocytes, basophils, monocytes, eosinophils, bands, platelets, hemoglobin, mean corpuscular hemoglobin concentration (MCHC), fibrinogen], and blood chemistry [i.e. creatine kinase (CK), creatinine, blood urea nitrogen (BUN), aspartate amino transferase (AST), gamma glutamyl transpeptidase (GGT), triglycerides, cholesterol, alkaline phosphatase (AP)], hormones (i.e. cortisol, insulin) and blood glucose levels.

Statistical analyses

Descriptive results for non-parametric data were reported as means (ME), interquartile range (IQR), standard deviation (SD), coefficient of variation (CV) for each variable instead. The Wilcoxon signed-rank test or u-test for paired samples (non-parametric alternative to t-test) with a confidence level of 95 % was used to compare the mean range of two related or paired samples for each horse in the study and for each variable of interest. The statistical software Stata 16.0 (StataCorp, 2020, College Station, Texas, USA) was used for all analysis.

Results Hematocrit, total plasma proteins, and plasma volume

The behavior of the HTC during the exercise test was consistent and homogeneous among the study animals, as shown by the low values of the SD for all the variables (Table 1). On the other hand, the TPPs showed slight changes during each step of the exercise test. Albumin was analyzed separately, and given the TPPs values, its values were relatively homogeneous. The mean plasma volume change was -4.65 ± 8.16 L, although three of the animals registered a positive change.

214

Rev Mex Cienc Pecu 2022;13(1):211-224

Table 1: Descriptive results of the hematocrit, total plasma proteins, and albumin values in each step of the field exercise test performed on the Colombian Paso horses of study Hematocrit (%) Moment/Step

ME (IQR)

Total plasma proteins (g/dL) ME (IQR)

Albumin (g/dL) ME (IQR)

Rest

37.9 (36.4 - 4.52 0.11 6.52 (6.0 - 6.6) 0.42 0.07 3.42 (3.30 - 0.18 0.05 43.8) 3.47) Warm-up 42.0 (37.0 - 4.62 0.11 6.62 (6.34 - 0.41 0.06 3.51 (3.44 - 0.28 0.08 42.5) 7.05) 3.94) Moderate 48.0 (46.0 - 5.09 0.11 6.96 (6.25 - 0.46 0.07 3.63 (3.57 - 0.36 0.10 intensity 52.6) 7.06) 4.15) High 49.7 (47.0 - 4.60 0.09 7.14 (6.32 - 0.49 0.07 3.69 (3.60 - 0.23 0.06 intensity 53.9) 7.25) 3.99) Maximum 51.4 (50.3 - 3.67 0.07 7.03 (6.49 - 0.48 0.07 3.65 (3.63 - 0.18 0.05 intensity 54.8) 7.13) 4.00) Recovery 41.5 (41.0 - 2.81 0.07 6.77 (6.07 - 0.49 0.07 3.60 (3.49 - 0.24 0.07 44.9) 7.13) 3.94) ME= Means; IQR= Interquartile range; SD= Standard deviation; CV= Coefficient of variation. Reference value for hematocrit(10)= 32 - 47%; reference value for total plasma proteins(11) = 5.2 - 7.9 g/dL; reference value for albumin(11) = 2.6 - 3.7 g/dL.

Hematological parameters

In the hematological parameters before and after the exercise test, there were changes in fibrinogen (P= 0.004), the total concentration of leukocytes (P= 0.0475) and bands (P= 0.0002) (Table 2). Table 2: Hematological parameters with significant statistical results, measured before and after the field exercise test performed on the Colombian Paso horses of study Hematological parameter Moment ME (IQR) SD CV Ref. value (10) Before

200 (200 – 600)

214.9

0.58

After

200 (200 – 500)

206.7

0.58

Total concentration of leukocytes, 103/mm3

Before

8.2 (7.1 – 10.5)

1.91

0.21

After

9.3 (8 – 12.2)

2.26

0.23

Total concentration of bands, 103/mm3

Before After

0.0 (0.0 – 0.08) 0.0 (0.0 – 0.08)

0.09 0.06

1.95 2.5

Fibrinogen, mg/dL

100 - 500 5.2 - 12.1 0 – 14

ME= Means; IQR= Interquartile range; SD= Standard deviation; CV= Coefficient of variation.

215

Rev Mex Cienc Pecu 2022;13(1):211-224

Biochemical parameters

The biochemical parameters were not different (P>0.05) for the mentioned steps, with the exception of AP. However, some enzymes showed an increased activity in relation to the physiological concentration (i.e. CK, AST), as presented in Table 3. Table 3: Biochemical parameters measured before and after the field exercise test performed on the Colombian Paso horses of study Biochemical parameter

Moment

Creatine kinase, U/L Creatinine, mg/dL Blood urea nitrogen, mg/dL

Before After Before After Before

Aspartate amino transferase, U/L Gamma glutamyl transpeptidase, U/L Triglycerides, mg/dL

After Before After Before After Before After

Cholesterol, mg/dL

Before After

Alkaline phosphatase, U/L

Before After

ME (IQR) 250 (196 - 293) 279 (247 - 337) 1.54 (1.44 - 1.62) 1.71 (1.62 - 1.99) 22.48 (20.37 24.45) 23.7 (22.54 - 26.7) 294 (263 - 341) 320 (270 - 356) 15 (11.31 - 23.92) 18 (16 - 24.51) 26.12 (15.5 - 35.8) 54.3 (35.1 - 63.9) 114.1 (90.05 123.6) 102.25 (58.3 131.15) 343.21 (320.7 541) a 335.05 (321.9 488.18) b

56.01 79.11 0.150 0.316 2.35

0.224 0.263 0.098 0.175 0.105

2.487 56.01 61.73 5.49 6.55 23.35 14.26

0.103 0.186 0.189 0.338 0.322 0.707 0.280

23.10

0.213

40.60

0.393

139.06

0.365

131.90

0.335

Ref. value 90 - 270(12) 1.2 - 1.9(11) 8 - 27(12)

226 - 366(11) 4.3 - 13.4(11) 11 - 52(12) 51 - 109(12)

109 - 315(12)

ME= Means; IQR= Interquartile range; SD= Standard deviation; CV= Coefficient of variation. Significant difference when each parameter was compared before and after the exercise test, according to the Wilcoxon signed-rank analysis (P<0.05).

Endocrine parameters (hormones and glycemia)

Table 4 shows the hormonal profiles and blood glucose levels obtained during the study, which were similar (P>0.05) for the mentioned steps.

216

Rev Mex Cienc Pecu 2022;13(1):211-224

Table 4: Behavior of cortisol, insulin, and glucose before and after the field exercise test performed on the Colombian Paso horses of study Endocrine parameter Moment

ME (IQR)

Cortisol, μg/dL

Before

7.91 (2.21 - 14.39)

6.781 0.780 3.0 - 13(13)

After

7.04 (5.19 - 9.61)

7.318 0.773

Before

40.98 (19.16 - 55.96) 50.84 1.067 4.52 -33.53(14)

After

26.47 (22.92 - 54.56) 18.60 0.535

Before

101 (85 - 153)

35.69 0.313 71 - 130(14)

After

134 (101 - 162)

37.89 0.286

Insulin, IU/mL

Glucose, mg/dL

Reference value

Discussion Acute responses to exercise, both hematological, biochemical, and endocrine, have been scarcely reported in CPHs. Therefore, the acute physiological changes that occur during exercise in this breed are currently not recognized. This situation represents a disadvantage for the professionals who participate in the sports conditioning processes, since it compels them to work from references that do not correspond to the context of the CPHs. On the other hand, the absence of such information enables the erroneous interpretation of findings in blood tests, although some of the hematological and biochemical variations provide a significant perspective of the pathological conditions that occur from intense exercise(15). Also, it is important to consider that the hematological, biochemical, and endocrine responses by themselves do not describe the athletic capacity of the horse; in fact, parameters such as HTC have not been found to be correlated with metabolic indicators, for example the anaerobic threshold(16). It is pertinent to clarify that the reference values considered for the present study were contrasted with previous studies carried out in animals of the same breed. The above corresponds to the hemoleukogram values(10), cortisol and insulin concentration(12-14). The other variables were contrasted with literature(11,12). The HTC was measured and not calculated, despite using automated equipment.

217

Rev Mex Cienc Pecu 2022;13(1):211-224

Exercise is an event of physiological stress, for this reason it is expected the HTC to increase, mainly in moderate, high, and maximum intensity, as occurred in the animals of the present study, exceeding the reference values for rest during the mentioned steps. The behavior observed for HTC is explained by splenic contraction and loss of water during exercise, reflecting hemoconcentration. It takes 30 to 60 sec for splenic erythrocyte release to occur in the presence of increased circulating epinephrine. During the recovery, the sequestration of erythrocytes and leukocytes by the spleen takes approximately 5 min, although their full reserve can take up to 30 min(15). Thus, the return of HTC to its value at rest or during warmup is explained by this phenomenon, in addition to the blood volume recovery. In view of the fact that HTC is highly affected by the adrenergic response during exercise (to establish polycythemia due to dehydration), it is recommended to include the total concentration of erythrocytes in the analysis and compare it with the HTC and the concentration of TPPs. In this group of horses, both events were found (hemoconcentration due to splenic release and decrease in plasma volume), as a consequence of dehydration. The TPPs and albumin showed an increasing behavior during exercise and were found to be augmented (within the reference range) due to the aforementioned loss of water. The concentration of plasma proteins at rest and during exercise, is the result of the interaction of numerous factors, such as the degree of filtration between the intra and extravascular spaces, metabolic demands, neuroendocrine control, nutritional status, and water balance(17). The plasma volume change found in the present study may be related to the movement of fluids between the different compartments, given the increasing of the hydrostatic pressure generated by the rise in arterial and venous pressure during exercise. In addition, it could be related to the secretion of natriuretic peptide, as the intensity of exercise increases(15). In humans, it has been reported that plasma volume can decrease due to hemoconcentration or even increase due to hemodilution, depending on the type of exercise performed. The decrease in plasma volume is greater during high intensity exercise(18,19), and the magnitude of sweating and hydration during exercise can also determine its decrease(20). In the present study, a reduction in plasma volume was observed at the end of the exercise test, when horses showed profuse sweating. This corroborates that, as in humans, high intensity exercise and sweating reduce this parameter. A previous study reported an increase of 5.12 % in plasma volume in endurance horses that competed in an 80 km race, hydrated with 30 L of a solution with sodium chloride and potassium chloride, while, in hydrated horses (with 10 L of the same solution), a decrease in plasma volume of -2.34 % was observed(21). In this study, the change in plasma volume was -4.65 %, which was expected, since the horses did not hydrate until the final of the exercise test and the sampling were completed. Starling forces explain these findings based on 218

Rev Mex Cienc Pecu 2022;13(1):211-224

changes in hydrostatic and oncotic pressures in the vascular and interstitial compartments. During physical activity, a redistribution of cardiac output occurs. Blood flow to the active musculoskeletal system and to the skin tissue increases, and the rise in capillary hydrostatic pressure favors the passage of water and even proteins to the interstitial compartment. These events explain how fluid movement affects plasma volume during exercise(19). The leukogram obtained from the animals in the present study was significantly different when the values obtained were compared in the rest and recovery steps. Leukocytes show transient alterations in response to increased sympathetic tone. When stored with red blood cells in the spleen, splenic contraction can lead to an increase in the count by approximately 30 %(15). However, its increase is not an indicator of physical condition, rather it is the neutrophil:lymphocyte ratio (10:1) with a shift to the left, is a sign of exhaustion, stress, or overtraining. In the horses of the present study, bands were found in three of the animals, without changes in the neutrophil:lymphocyte ratio. It was not considered a pathological finding, since the values were within the reference range, and it was not accompanied by other changes in the leukogram or at the clinical examination. In addition, values around 50 % of the total neutrophils are sequestered in the capillary spleen beds and are known as marginal pool or splenic reserve. Marginalized neutrophils can be mobilized under certain conditions, including exercise, stress, transport, and exogenous corticosteroids or catecholamine administration, causing variations in the leukogram(22). Within the biochemical values analyzed herein, the fibrinogen in some animals was found to be remarkable. It should be taken into account that fibrinogen is an acute phase protein, considered as a nonspecific indicator of inflammation(23). It is presumed that some of the animals in the present study experienced some process related to ongoing inflammation that was not reflected in the clinical examination, nor could it be related to leukocyte values. It is understood that the increase in fibrinogen is related to inflammatory processes of infectious or non-infectious origin, so the albumin:globulin ratio may clarify the origin of such increase. In addition, fibrinogen synthesized in the liver in response to an inflammatory process may remain increased —even when the lesions resolved several days ago, registering a peak between 5 and 7 d after the lesion. Therefore, fibrinogen is an indicator of inflammation with absent hemoconcentration. Blood biochemistry analyzes of the animals in the present study demonstrated that the effort printed on the test is sufficient to increase muscle biochemical activity. It is advisable to add a post-recovery measurement to check if the reestablishment of blood volume alters the concentration of related analytes or if these remain elevated as indicators of muscle injury. The post-test eligible time to detect underlying damage should be anticipated based on the analyte. In racehorses, it is known that 3 d after a competition, some hematic and biochemical values have not yet returned to their reference range(24).

219

Rev Mex Cienc Pecu 2022;13(1):211-224

Creatinine tends to increase during exercise, due to an augmented use of phosphocreatine and gluconeogenesis, and a decreased glomerular filtration rate(15), being a confident indicator of muscle metabolism and kidney function. The increased use of phosphocreatine evidences the high and maximum intensity work that the study horses experienced. The BUN did not show a specific trend. This was expected from this parameter since BUN is the result of the urea cycle and the metabolism of nitrogenous products obtained from the diet. Furthermore, it can be reabsorbed in the proximal convoluted tubule in about 30 %, therefore, it is not a good indicator of functionality nor is it a good index of metabolism to be observed after exercise. The CK is the enzyme in charge of hydrolyzing the reaction that produces ADP and phosphocreatine from ATP. Its increase is mainly associated with a rise in cell permeability due to acidosis or an increase in the use of ATP by the musculoskeletal system. The peak of its production occurs 4 to 12 h after the event that triggers it. The animals in the present study registered an increase in the blood concentration of this enzyme; however, no animal registered an increase related to injury. Nevertheless, no samples were taken during the described release peak, which limits the inference from this enzyme. Despite being present in several organs, AST is used as a marker of cellular injury in the liver or the musculoskeletal system. Its magnification must be 5 to 100 times greater than the reference value to be useful from the clinical point of view(15). This strengthens the premise that the field exercise test applied to the animals of the present study does not constitute a harmful activity for the musculoskeletal system in healthy horses without previous training. The biochemical analysis also allowed the recognition of the energy sources that the horses used for this kind of effort. An increased mobilization of glucose and triglycerides was observed. During exercise, glycolysis and lipolysis are activated to obtain energy for muscle contraction(15,25), especially under aerobic conditions, as occurred in the warm-up and other steps of the exercise test used herein. It is advisable to include bilirubin quantification to verify the presence of erythrocyte rupture due to the fragility of the membrane that can occur because of changes in blood pH derived from exercise. Hence the importance of accompanying this analysis with the measurement of MCHC. In the present study, bilirubin was not measured, however, MCHC remained within the reference range. The hormonal activity during exercise is related to the body's energy requirements. The activation of specific endocrine responses is highly dependent on the intensity and duration of exercise, which attempt to preserve the life of the animal through the use of multiple metabolic mechanisms to provide additional energy for muscle contraction(26). 220

Rev Mex Cienc Pecu 2022;13(1):211-224

Glycogenolysis and gluconeogenesis are activated during exercise, in part, by the release of cortisol, growth hormone, and catecholamines(27), while insulin secretion is decreased by the release of catecholamines during exercise(15). In contrast, other authors found that exercise does not influence insulin secretion(28). According to the results of the present study, this hormone was found to be elevated before and after the field exercise test. Therefore, metabolic disorders should not be ruled out in the study animals, which were "overweight" at the time of the test, according to the body condition assessment (7/9 on average). The physical and psychogenic stimuli associated with exercise induce the synthesis and secretion of adrenocorticotropic hormone (ACTH), β-endorphins, and cortisol. In addition, vasopressin —released during physical activity, enhances ACTH secretion. Cortisol measurement should be based on the circadian rhythm and breed, as reported for CPHs(13). In horses without adequate athleticism, elevated serum cortisol levels affect leukocyte function(15). However, this condition will remain as long as the exercise is strenuous. Contrary to expectations, in the case of the CPHs of study, the serum cortisol concentration remained within the reference intervals, even after the exercise test, although with a plasma concentration sufficient to explain the hyperglycemic and hyperlipemic observed effects. Future studies on CPHs´ sports medicine should propose the identification of physiological changes triggered by physical effort, and thus determine the starting point for the detection of pathologies or as a point of comparison after the application of a prescribed training.

Conclusions and implications The increasing-intensity exercise performed by the CPHs in the present study produced water loss, as evidenced by the change in plasma volume, with the consequent hemoconcentration, and the slight increase in both creatinine and BUN. The significant differences observed in the leukogram and fibrinogen were apparently produced by individual factors of some animals. Therefore, it cannot be concluded whether the exercise test actually produces physiological responses in this regard. In addition, evidence of anticipated stress response was found from the cortisol value, in the absence of muscle injury. The CPHs considered in the study were suspected of equine metabolic syndrome, although they were not diagnosed for it. These factors must be taken into account when interpreting acute responses and adaptations derived from physical training in horses of this breed.

221

Rev Mex Cienc Pecu 2022;13(1):211-224

Acknowledgments

To the Normandía Centro Equino and Mervequus for allowing the testing of their animals and to the sustainability strategy of CENTAURO Research Group (Universidad de Antioquia, Medellín, Colombia) and the Universidad CES (Medellín, Colombia) for the financial support. Conflict of interests

The authors declare that they have no conflict of interest. Literature cited: 1. Fraipont A, Van Erck E, Ramery E, Fortier G, Lekeux P, Art T. Assessing fitness in endurance horses. Can Vet J 2012;53(3):311-314. 2. De Mare L, Boshuizen B, Plancke L, De Meeus C, De Bruijn M, Delesall C. Standardized exercise tests in horses: current situation and future perspectives. Vlaams Diergeneeskd Tijdschr 2017;86(2):63-72. 3. Lekeux P, Art T, Linden A, Desmecht D, Amory H. Heart rate, hematological and serum biochemical responses to show jumping. In: Persson SGB et al. ICEEP Publications: Equine exercise physiology 3. 1991:385-390. 4. Zobba R, Ardu M, Niccolini S, Cubeddu F, Dimauro C, Bonelli P, et al. Physical, hematological, and biochemical responses to acute intense exercise in polo horses. J Equine Vet Sci 2011;31(9):542-548. 5. Masini A, Tedeschi D, Baragli P, Sighieri PC, Lubas G. Exercise-induced intravascular haemolysis in standardbred horses. Comp Clin Path 2003;12:45-48. 6. Holdridge LR, Grenke WC, Hatheway WH, Liang T, Tosi JA. Forest environments in tropical life zones: a pilot study, Pergamon Press; 1971. 7. Henneke DR, Potter GD, Kreider JL, Yeates BF. Relationship between condition score, physical measurements and body fat percentage in mares. Equine Vet J 1983;15(4):371372. 8. Arias MP, Maya JS, Arango L. Efectos de dos protocolos de entrenamiento sobre el lactato sanguíneo en caballos de paso fino. Rev Med Vet Zoot 2019;66(3):219-230. 9. Van Beaumont W, Strand JC, Petrofsky JS, Hipskind SG, Greenleaf JE. Changes in total plasma content of electrolytes and proteins with maximal exercise. J Appl Physiol 1973;34(1):102-106. 222

Rev Mex Cienc Pecu 2022;13(1):211-224

10. Castillo CA, Tobón M, Cano CA, Mira J, Suárez AP, Vásquez EM. Valores hematológicos en caballos criollos colombianos del valle de Aburrá. In: Corporación Universitaria Lasallista editores. Perspectivas y avances de investigación de la serie Lasallista investigación y ciencia. 1st ed. Caldas, Antioquia, CO: Delasalle; 2010:245262. 11. Kaneko J, Harvey J, Bruss M. Clinical biochemistry of domestic animals. 6th ed. David, USA: Academic Press; 2008. 12. Southwood L. Practical Guide to Equine Colic. 1st ed. Iowa; USA: Wiley-Blackwell; 2013. 13. Zuluaga AM, Martínez JR. Serum cortisol concentration in the Colombian creole horse. Rev Colomb Cienc Pecu 2017;30(3):231-238. 14. Rosas M. Diagnóstico de síndrome metabólico equino y su asociación con signos clínicos de laminitis en el caballo criollo colombiano en la sabana de bogotá [master thesis]. Bogotá, DC: Universidad de la Salle; 2017. 15. Boffi F. Fisiología del ejercicio en equinos, 1st ed. Buenos Aires, Argentina: Intermédica; 2007. 16. Valette JP, Barrey E, Wolter R. Multivariate analysis of exercise parameters measured during an incremental treadmill test. In: Persson SGB et al. ICEEP Publications: Equine exercise physiology 3. 1991:337-342. 17. Mesa-Rojas MC. Análisis del comportamiento de los parámetros hematológicos en caballos que compiten en carreras de enduro a 2640 M.S.N.M. [undergraduate thesis]. Bogotá, DC: Universidad de La Salle; 2016. 18. Sawka MN, Convertino VA, Eichner ER, Schnieder SM, Young AJ. Blood volume: importance and adaptations to exercise training, environmental stresses, and trauma/sickness. Med Sci Sports Exerc 2000;32(2):332-348. 19. Sanchis-Gomar F, Lippi G. Physical activity - an important preanalytical variable. Biochem Med 2014;24(1):68-79. 20. Mora-Rodríguez R, Fernández VE, Hamouti N, Ortega JF. Skeletal muscle water and electrolytes following prolonged dehydrating exercise: Fluid losses in exercising skeletal muscle. Scand J Med Sci Sports 2014;25(3):274-282. 21. Sampieri F, Schott HC, Hinchcliff KW, Gero RJ, Cunilleras JE. Effects of oral electrolyte supplementation on endurance horses competing in 80 km rides. Equine Vet J 2006;38(36):19-26.

223

Rev Mex Cienc Pecu 2022;13(1):211-224

22. McKenzie EV. Hematology and serum biochemistry of the equine athlete. In: Kenneth H, Andris K, Raymond G editors. Equine sports medicine and surgery. 2nd ed. USA: Elsevier Health Science; 2014:921-929. 23. Polla BS, Cossarizza A. Stress proteins in inflammation. EXS 1996;77:375-391. 24. Bos A, Compagnie E, Lindner A. Effect of racing on blood variables in Standardbred horses. Vet Clin Pathol 2018;47(34):625-628. 25. Bayly WM, Allen JR, Gollnick PD. Equine exercise physiology I: energy production and substrate utilization. Equine Vet Sci 1984;4(3):114-118. 26. Hinchcliff KW, Geor RJ, Kaneps AJ. Equine exercise physiology: the science of exercise in the athletic horse, Elsevier Saunders; 2008. 27. López-Chicharro JL, Fernández-Vaquero A. Fisiología del ejercicio, Ed. Panamericana, 3ª ed. Buenos Aires, Paris. 2006. 28. Noble GK, Sillence MN. Diurnal rhythm and effects of feeding, exercise and recombinant equine growth hormone on serum insulin concentrations in the horse. Equine Vet J 2013;45(6):745-750.

224

https://doi.org/10.22319/rmcp.v13i1.5907 Article

Effect of hygienic behavior on resistance to chalkbrood disease (Ascosphaera apis) in Africanized bee colonies (Apis mellifera)

Carlos Aurelio Medina-Flores a* Luis Abdelmir Medina Medina b Ernesto Guzmán-Novoa c

Universidad Autónoma de Zacatecas. Unidad Académica de Medicina Veterinaria y Zootecnia, Zacatecas, México. b

Universidad Autónoma de Yucatán. Departamento de Apicultura, Campus de Ciencias Biológicas y Agropecuarias. Carretera Mérida-Xmatkuil Km. 15.5, Mérida, Yucatán, Mexico. c

School of Environmental Sciences, University of Guelph, Guelph, Canada.

* Corresponding author: carlosmedina@uaz.edu.mx

Abstract: The objective was to evaluate the hygienic behavior (HB) of Africanized honeybees (Apis mellifera) and its impact on resistance to ascospherosis caused by Ascosphaera apis. The HB and the population of adult bees and brood of 50 colonies were evaluated. In addition, colonies with high (>95 %) and low (<50 %) HB were inoculated with A. apis and in them, the number of broods with signs of ascospherosis (mummies) was determined for 17 days, data that correlated with their degree of HB. The susceptibility to A. apis of larvae from colonies with high and low HB in a common environment was also evaluated to separate environmental from genotypic effects. The degree of HB between colonies varied significantly (CV>36 %), with 20 % of the colonies showing high HB (≥95 %) and this did not correlate with the population of adult bees and brood. Colonies with high HB had significantly fewer mummies than colonies with low HB and there was a negative correlation between HB and number of mummies (r= -0.63, P= 0.02). In addition, larvae from colonies 225

Rev Mex Cienc Pecu 2022;13(1):225-239

with high or low HB were equally susceptible to the fungus. These results suggest that HB and larval susceptibility are not associated and that the main protection mechanism against A. apis in Africanized bee populations is HB. Therefore, the selection of colonies with high hygienic behavior could contribute to improving the health and productivity of honeybees. Key words: Apis mellifera, Ascosphaera apis, Hygienic behavior, Larval susceptibility, Africanized bees, Yucatán.

Received: 18/12/2020 Accepted: 29/04/2021

Introduction Ascospherosis or chalkbrood, is a disease caused by the fungus Ascosphaera apis, which when it reproduces and sporulates in the larvae of honeybees (Apis mellifera) causes their mummification (black and white mummies), reduces the population size of their colonies, and in some regions can cause high losses in honey production(1,2). In the presence of A. apis and other health problems of the brood, honeybees can respond with behavioral and physiological resistance mechanisms(3,4). An important behavioral mechanism is hygienic behavior (HB), which consists of the ability of workers to detect, uncap and remove from inside the cells the brood that is sick or dead(5,6). The evaluation of the HB level of a bee colony is based on sacrificing broods inside capped cells by puncture(7) or freezing(8) and determining the percentage of removal in a short period of time by the workers. It has been reported that colonies with very high HB (≥95 % removal of the dead brood in 24 to 48 h) show some degree of resistance to chalkbrood(9,10) and American foulbrood(11-13), and there is some evidence of resistance of highly hygienic colonies against the parasitic mite Varroa destructor(14) and the deformed wing virus(15). It has also been argued that physiological mechanisms associated with the cellular and humoral immunity of bees could give them resistance against ascospherosis(4). Therefore, it is not clear what is the contribution and relative importance of HB to the resistance of bees against chalkbrood, particularly in Africanized bee populations. The HB has been reported to provide protection against the fungus A. apis in colonies of Africanized bees crossed with Europeans from South America(10). However, it is unknown whether this also happens in Africanized bee populations in other countries. In addition, the

226

Rev Mex Cienc Pecu 2022;13(1):225-239

relationship between HB expression and brood susceptibility in Africanized bees infected with the fungus A. apis has not been studied. Generating such information would be very useful to design control strategies against the disease, such as establishing selective breeding programs. In Mexico in particular, it is known that in certain regions the prevalence of chalkbrood can exceed 50 %, especially in humid areas(16), and that this disease can interact with others and cause bee colonies to collapse(17). In addition, in Mexico, the relationships of HB with ascospherosis and the susceptibility of Africanized bee larvae to the fungus have not been studied. Therefore, the objective of this study was to evaluate the degree of HB of Africanized bee colonies and its impact on the resistance and susceptibility of these insects to chalkbrood.

Material and methods Place of study

This study was carried out in experimental apiaries of the Department of Beekeeping of the Campus of Biological and Agricultural Sciences of the Autonomous University of Yucatán, in Xmatkuil, Mérida, Yucatán, Mexico (20° 52’ 3.00” N, 89° 37’ 29.15” W). This region has a hot-subhumid climate with rainfall in summer (Awo), with annual rainfall of 985 mm, annual temperature of 26.8 ºC and annual relative humidity of 78 %(18).

Hygienic behavior and bee population

The studies were carried out in 50 colonies of commercial bees to which a morphometric analysis was carried out in order to confirm that they were Africanized(19). The colonies were housed in Langstroth-type hives, distributed in five apiaries, and had different population conditions and food reserves, but without clinical signs of diseases. Colony bee populations were determined for both the capped brood area and the number of adult bees. To determine the brood area of each colony, two operators estimated the percentage of the area on both sides of each comb occupied by capped brood. The percentage area of the brood areas was converted to cm2, considering the area that has a Langstroth-type comb on both sides (1,760 cm2). In addition, the number of combs covered with bees was recorded and multiplied by

227

Rev Mex Cienc Pecu 2022;13(1):225-239

the number of bees that occupy a Langstroth comb in the brood chamber on both sides (2,430 bees)(20). The measurements were made in the afternoons (> 1700 h) when most of the bees were inside the hives and the same operators participated in all the measurements. The HB of the colonies was evaluated twice. The two assessments were conducted during July when there are no major blooms in the area and were made with an interval of 14 days. To estimate the HB level of each colony, a comb with capped brood with 3 to 4-day old pupae, identified by the white body and purple eyes(21), the most appropriate stage to determine HB(22), was selected. A galvanized sheet cylinder (8 cm diameter x 10 cm height) was placed over a compact capped brood area and 300 ml of liquid N2 was poured to sacrifice the pupae inside the cells by freezing. When the N2 evaporated, the cylinder was removed, and the frozen areas were photographed, and the comb was reintroduced into the colony being evaluated. The combs with the sacrificed brood of the experimental colonies were inspected 48 h after the previous procedure and the frozen areas were photographed again to record the number of dead pupae that were removed, and thus be able to determine the percentage of removal of the dead brood. The evaluations were carried out 48 hours after freezing because it is enough time to limit the reproduction and spread of an infectious agent, which is less strict than at 24 h and allows identifying the expression of HB in colonies not selected for this characteristic and naturally mated. Colonies that uncapped and removed 95 % or more of the frozen brood in the two tests were classified as highly hygienic (high HB) while colonies that removed 50 % or less of the frozen brood were considered to have low HB(8,12). Subsequently, 10 colonies that presented a high HB and 10 colonies that presented a low HB were selected in order to evaluate their relative resistance to ascospherosis.

Effect of hygienic behavior on ascospherosis

The 20 colonies with high and low HB selected from the previous experiment were relocated to an isolated apiary and their queens were marked with indelible ink on the thorax for their identification. The bee populations of both groups of colonies were homogenized based on the colony that had the least number of bees, brood area, honey and pollen reserves. Therefore, at the beginning of the experiment, the 20 colonies had approximately the same number of combs covered with adult bees (8), capped brood (3), open brood (2), honey (2) and pollen (1). Additionally, it was corroborated that no selected colony presented clinical signs of chalkbrood (mummies present in the combs, floor, or entrance). To obtain the fungus A. apis, black mummies (sporulated fungus) were initially identified from colonies outside the experiment. This clinical sign is pathognomonic of ascospherosis so there is certainty of obtaining the fungus from these mummies. Additionally, the

228

Rev Mex Cienc Pecu 2022;13(1):225-239

sporocysts of the fungus were observed under a microscope in mummy samples(23). To induce A. apis infection in brood of the experimental colonies, the protocol of Flores et al(24) was followed. Three mummies per milliliter of distilled water were macerated. Each of the 20 experimental colonies was inoculated with 6 ml of the macerate diluted in 120 ml of sucrose syrup (1:1), which was supplied to each colony by means of Boardman-type feeders. In addition, two combs containing young larvae (open brood) on at least 80 % of their area, as well as the bees present in those combs, were sprayed with 6 ml of the same macerate diluted in 14 ml of sucrose syrup (1:1), supplying 5 ml of the inoculum on each side of each comb. The colonies were reviewed to record the number of black and white mummies present in the comb cells on days 3, 5, 7, 9, 12 and 17, post-exposure(25).

Susceptibility of larvae from high and low HB colonies to ascospherosis

In order to assess whether the differences in the number of mummies in the combs between colonies with high and low HB from the previous experiment were due to any extent to differences in the susceptibility of their larvae to the fungus A. apis, larvae from five colonies of each type selected at random were used to inoculate them and allow their development in a common environment. From each colony, a comb section (7 x 7 cm) containing an average of 264 ± 3.4 larvae 3 to 4 days old was cut with a knife. Immediately afterwards, racks were assembled, each containing a section from a colony with high HB and another from a colony with low HB, these sections and five receiving colonies that had a low HB were inoculated with the fungus A. apis as described above. Each comb assembled in this way was placed in the center of the brood chamber of a receiving colony in order to give the larvae the same nest environment, and that the probability of being removed by the HB of the bees from the receiving colonies was similar for both types of larvae. Making larvae and bees cohabitate in the same brood nest has been used successfully in the past to separate environmental from genotypic effects in studies of various bee behaviors, including HB(26-29). The number of chalkbrood mummies in the comb sections was recorded on d 5, 9 and 13, post-exposure to the fungus.

Statistical analysis

Measures of central tendency and dispersion were obtained for the data from HB evaluations and population conditions of the 50 colonies. Pearson’s correlation tests were also performed between the data from the first and second test of HB, as well as between those from the HB and those from the bee population, brood areas, and the number of mummies recorded in the

229

Rev Mex Cienc Pecu 2022;13(1):225-239

combs. The percentage of HB, brood areas and bee population of colonies with high and low HB that were selected for testing the effect of HB on chalkbrood, as well as the proportion of larvae clinically affected by ascospherosis of the two types of colonies that were used in the susceptibility experiment, were analyzed with Student’s t-tests. The number of mummies from colonies with high and low HB and the effect of time on this variable were analyzed by means of repeated measures variance and Newman-Keuls comparison of means tests. Prior to the analyses, the percentage values of HB and mummified broods (susceptibility test) were transformed to square root of the arcsine and the number of mummies to logarithm, to ensure a normal distribution of the data. Statistical analyses were performed in the SAS program(30).

Results Hygienic behavior and bee population

Table 1 shows the degree of HB and population conditions of the 50 colonies, as well as the variation for these parameters. Clearly, there was a wide range and variability for the degree of HB between the colonies evaluated (CV >36 %). However, it is noteworthy that 20 % of them had a high HB (≥95 %), 30 % had a low HB (≤50 %) and 50 % had an intermediate level of HB (51-94 % of frozen brood removal). The adult bee population was also highly variable (CV >37 %), but not the amount of brood in the colonies (CV <18 %). There was a positive and significant correlation between the HB level of the first and second evaluation (r= 0.60, P= 0.0001), so the pupae freezing test showed repeatability. On the other hand, no relationship was found between the HB level and the number of adult bees (r= 0.03, P= 0.84) or with the capped brood area of the colonies (r= 0.02, P= 0.87), so it is presumed that these factors did not significantly influence the degree of HB of the colonies. Table 1: Mean and dispersion values of hygienic behaviour, estimated bee population and brood areas in two tests to 50 honeybee colonies Descriptive statistics Mean Standard error Coefficient of variability, % Minimum value Maximum value Range

Hygienic behavior (%) 66.12 0.48 36.2 12.5 100 87.5 230

Brood areas (cm2) 9,574.4 33.8 17.5 5,820 12,320 6,500

Adult bee population 32,683 245.43 37.5 9,720 53,460 43,740

Rev Mex Cienc Pecu 2022;13(1):225-239

Effect of hygienic behavior on ascospherosis

The colonies with high and low degree of HB that were selected for the test of relative resistance to chalkbrood differed significantly in their level of HB (t= 8.71, P<0.0001), but did not differ in terms of population of adult bees (t= 0.10, P= 0.75) or brood (t= 2.02, P= 0.17). Mean HB levels were 31 ± 0.81 and 97 ± 0.20 %, for colonies with low and high HB, respectively. After being exposed to A. apis, the clinical manifestation of chalkbrood (presence of mummies in combs) was observed at 3 d post-exposure, and although the amount of affected brood was similar in both colony groups until day five post-exposure, colonies of high HB had significantly fewer white (F1,76= 32.1, P<0.0001) and black mummies (F1,76= 10.8, P<0.001) in the combs than the colonies of low HB. In addition, the number of black and white mummies in the combs of both colony groups decreased significantly and progressively between days 9 and 17 post-exposure (F4,76= 3.2, P= 0.01 and F4,76= 2.6, P= 0.03, respectively), but there was no interaction effect between the degree of HB and the days post-exposure to the fungus in white (F4,76= 0.7, P= 0.61) and black mummies (F4,76= 0.95, P= 0.45; Figures 1 and 2). Figure 1: Number (mean ± SE) of white mummies recorded in the combs of colonies with high (■) and low (▲) hygienic behavior (HB) after inoculation with the fungus A. Apis 50 45

White mummies in comb

High H B

40 a

Low HB a

25 20 a

15 10 5

b a

0 3

Days after inoculation of A. apis ab

Different literals indicate significant differences (P<0.05) based on a repeated-measures analysis of variance and the Newman-Keuls comparison of means test, after transformation of the data to logarithm. Untransformed values are displayed.

231

Rev Mex Cienc Pecu 2022;13(1):225-239

Figure 2: Number (mean ± SE) of black mummies recorded in the combs of colonies with high (■) and low (▲) hygienic behavior (HB) after inoculation with the fungus A. Apis 30

High HB

Black mummies in comb

Low HB

20 a

a a

b b

Days after inoculation of A. apis ab

In addition to the above, a negative and significant correlation was found between the level of HB and the number of total mummies of the colonies inoculated with A. apis for the tests of resistance to chalkbrood (r= -0.63, P= 0.02). This result indicates that, the higher HB, the fewer mummies in the combs of the colonies, so this behavior seems to give resistance to honeybees against ascospherosis.

Susceptibility of larvae from colonies with high and low HB to ascospherosis

Regarding the susceptibility of larvae from colonies with high and low HB to the fungus A. apis, it was found that the proportion of mummies in the combs was not statistically different between both groups of larvae throughout the evaluation period (Table 2). In addition, there was no significant correlation between the HB level of the larval donor colonies and the percentage of mummies found in the combs post-exposure of the larvae with A. apis (r= 0.21, P= 0.55).

232

Rev Mex Cienc Pecu 2022;13(1):225-239

Table 2: Percentage (mean ± SE) of larvae from colonies with high and low hygienic behavior (HB) that clinically manifested ascospherosis post-exposure with A. apis Post-exposure days with A. apis 5 9 13

High HB (n= 5)

Low HB (n= 5)

6.54 ± 0.77 5.32 ± 3.24 1.34 ± 1.81

5.32 ± 0.33 4.14 ± 1.60 1.46 ± 1.01

3.93 0.21 1.30 0.80 1.91 0.54

The t and P values were obtained from the analysis of data on the percentage of mummified broods transformed to the square root of the arcsine.

Discussion Evaluations of the HB and strength of the population of the Africanized bee colonies studied showed wide variation as expected, but showed no correlation, which suggests that it is possible to identify bee colonies that vary in their HB regardless of their strength. These results coincide with what was reported in previous studies(10,12,31). In addition, the N2 test used to measure HB showed high correlation between repetitions, which indicates that it is reliable as previously demonstrated(32) and allows the categorization of colonies with different degrees of expression for this behavior. The frequency (20 %) of colonies that expressed a high degree of HB is within the ranges shown by European and Africanized bee colonies (10-31.5 %) in other regions(12,33-35). And this low frequency could be increased by breeding queens from colonies with high HB, allowing their free fertilization, as Spivak and Reuter(12) and Bigio et al(31) have shown in practice. This is based on the fact that part of the variability of HB is of genetic origin(36,37), that HB is a highly heritable behavior(38-41) and that this is inherited through the mother(28). Colonies selected for their high HB had significantly fewer broods with clinical signs of ascospherosis in the combs than colonies selected for their low HB. This was presumably because they removed more diseased brood from the combs than the colonies with low HB, and they did so progressively as the evaluation time passed. These results coincide with those of studies carried out in colonies with bees of European origin(42,43) and with those of a study carried out in colonies of Africanized bees crossed with Europeans(10). The detection of larvae infected by A. apis depends on the perception of volatile compounds by bees(44-46), with variation in the detection thresholds of these compounds in workers. Bees of strains selected for high HB are more sensitive and react to the smell of these compounds more frequently than bees not selected for this behavior(47). It has also been suggested that the efficiency of HB against chalkbrood depends on the early detection of larvae infected by the fungus prior to their mummification and sporulation, which limits the spread of the infection in the

233

Rev Mex Cienc Pecu 2022;13(1):225-239

colony(10). Timely removal of diseased broods reduces the risk of sporulation and spread of the fungus(9). This may explain why in colonies with high HB there were significantly fewer black and white mummies in combs compared to colonies with low HB. This conclusion is reinforced by the results of the correlation analysis that showed that, at a higher the degree of HB, the number of broods infected with A. apis in the combs of the bee colonies studied decreased significantly. It has been speculated that the resistance of bees to brood diseases depends on the interaction of physiological resistance factors such as the immune response to different pathogens, the antimicrobial activity of the microbiota and larval foods, as well as HB and other defense mechanisms(48,49). This study analyzed for the first time the susceptibility of larvae to A. apis in a common nest environment and found that larvae from colonies with high and low HB were equally susceptible to ascospherosis. Therefore, the results of the present study allow inferring that the level of HB expression and the susceptibility of larvae to A. apis are not associated, and support the hypothesis that although various factors and mechanisms could contribute to the resistance of bees against ascospherosis(50), HB is the most important of them. Therefore, it is suggested that efforts for the development of colonies resistant to brood diseases, such as ascospherosis, be focused on the selection of colonies with high HB. The frequency of colonies with high HB from genetic improvement programs is higher than that found in unselected populations(12) and it has been reported that this behavior is associated with greater honey production(12,34,51) and greater resistance to diseases(9,12-15,36); the latter is consistent with the results of the present study. Favorably, the selection and reproduction of queens from colonies with high HB seems to be sufficient to increase the frequency of colonies with high HB in bee populations(31,39,41), because HB is inherited mainly through the mother(28), so the implementation of selection and reproduction programs of queens whose colonies express a high HB would contribute to improving the health and productivity of the colonies.

Conclusions and implications It is concluded that the degree of HB between colonies is variable, and that the population of bees and broods do not significantly influence the HB degree of the colonies. The frequency of colonies with high HB in the Africanized bee population analyzed would allow genotypes to be selected to increase the HB degree of bee populations in genetic improvement programs. Colonies with high HB had greater control of ascospherosis than colonies with low HB. The susceptibility of larvae to ascospherosis and HB do not appear to be associated factors. These results suggest that the main protective mechanism against A. apis in Africanized bee

234

Rev Mex Cienc Pecu 2022;13(1):225-239

populations is HB. Future research is needed to study the humoral and cellular immunity of bees against A. apis, as well as the mechanisms for its identification and associated factors, so that they are integrated into genetic selection and improvement programs in order to improve the health and production of honeybee populations. Literature cited: 1. Gilliam M, Vandenberg JD. Fungi. In: Morse RA, Flottum K. Honey bee pest predators and diseases. 3a ed. AI Root Co. Medina USA; 1997:82-99. 2. Zaghloul OA, Mourad AK, El MK, Nemat FM, Morsy ME. Assessment of losses in honey yield due to the chalkbrood disease, with reference to the determination of its economic injury levels in Egypt. Commun Agric Appl Biol 2005;70(4):703-714. 3. Evans JD, Aronstein K, Chen YP, Hetru C, Imler JL, Jiang H, Hultmark D. Immune pathways and defense mechanisms in honey bees Apis mellifera. Insect Mol Biol 2006;15(5):645-656. https://doi.org/10.1111/j.1365-2583.2006.00682.x. 4. Larsen A, Reynaldi FJ, Guzmán-Novoa E. Bases del sistema inmune de la abeja melífera (Apis mellifera). Revisión. Rev Mex Cienc Pecu 2019;10(3):705-728. https://doi.org/10.22319/rmcp.v10i3.4785. 5. Boecking O, Drescher W. Apis mellifera removes Varroa jacobsoni and Tropilaelaps clareae from sealed brood cells in the topics. Am Bee J 1992;132(11):732-734. 6. Arathi HS, Ho G, Spivak M. Inefficient task partitioning among nonhygienic honeybees, Apis mellifera L., and implications for disease transmission. Anim Behav 2006;72:431438. https://doi.org/10.1016/j.anbehav.2006.01.018. 7. Newton DC, Ostasiewski, NL. A simplified bioassay for behavioral resistance to American foulbrood in honey bees (Apis mellifera L.). Am Bee J 1986;126:278-281. 8. Spivak M, Downey DL. Field assays for hygienic behavior in honey bees (Hymenoptera: Apidae). J Econ Entomol 1998;91(1):64-70. https://doi.org/10.1093/jee/91.1.64. 9. Spivak M, Gilliam M. Hygienic behaviour of honey bees and its application for control of brood diseases and Varroa. Part II. Studies on hygienic behaviour since the Rothenbuhler era. Bee World 1998;79(4):169-186. https://doi.org/10.1080/0005772X.1998.11099408. 10. Invernizzi C, Rivas F, Bettucci L. Resistance to chalkbrood disease in Apis mellifera L. (Hymenoptera: Apidae) colonies with different hygienic behaviour. Neotrop Entomol 2011; 40(1):28-34. http://dx.doi.org/10.1590/S1519-566X2011000100004.

235

Rev Mex Cienc Pecu 2022;13(1):225-239

11. Danka RG, Villa JD. Preliminary observations on the susceptibility of Africanized honey bees to American foulbrood. J Apic Res 1994;33(4): 243-245. https://doi.org/10.1080/00218839.1994.11100878. 12. Spivak M, Reuter GS. Performance of hygienic honey bee colonies in a commercial apiary. Apidologie 1998;29:291-302. 13. Palacio MA, Figini EE, Ruffinengo SR, Rodriguez EM, Hoyo ML, Bedascarrasburne EL. Changes in population of Apis mellifera L. selected for the hygienic behavior and its relation to brood disease tolerance. Apidologie 2000;31:471-478. https://doi.org/10.1051/apido:2000139. 14. Ibrahim A, Spivak M. The relationship between hygienic behavior and suppression of mite reproduction as honey bee (Apis mellifera) mechanisms of resistance to Varroa destructor. Apidologie 2006;37(1):31-40. https://doi.org/10.1051/apido:2005052. 15. Schöning C, Gisder S, Geiselhardt S, Kretschmann I, Bienefeld K, Hilker M, Genersch E. Evidence for damage-dependent hygienic behaviour towards Varroa destructorparasitised brood in the western honey bee, Apis mellifera. J Exp Biol 2012;215(2):264271. https://doi: 10.1242/jeb.062562. 16. Tapia-González J, Alcazar-Oceguera G, Macías-Macías J, Contreras-Escareño F, TapiaRivera J, Petukhova T, Guzmán-Novoa E. Ascosferosis en abejas melíferas y su relación con factores ambientales en Jalisco, México. Rev Mex Cienc Pecu 2020;11(2):468-478. https://doi.org/10.22319/rmcp.v11i2.4926. 17. Medina LM, Vicario-Mejía E. The presence of Varroa jacobsoni mite and Ascosphaera apis fungi in collapsing and normal honey bee (Apis mellifera L.) colonies in Yucatan, Mexico. Am Bee J 1999;139(10):794-796. 18. García E. Modificaciones al sistema de clasificación climática de Köppen, 5th. Ed. Universidad Nacional Autónoma de México (UNAM), México. 2004:90. http://www.publicaciones.igg.unam.mx/index.php/ig/catalog/view/83/82/251-1 Consultado: 25 Nov, 2020. 19. Nielsen DI, Ebert PR, Hunt GJ, Guzman-Novoa E, Kinee SA, Page RE. Identification of Africanized honey bees (Hymenoptera: Apidae) incorporating morphometrics and an improved PCR mitotyping procedure. Ann Entomol Soc Am 1999;92:167-174. 20. Delaplane KS, van der Steen J, Guzman-Novoa E. Standard methods for estimating strength parameters of Apis mellifera colonies. J Apic Res 2013;52(1):1-12. https://doi.10.3896/IBRA.1.52.1.03. 21. Jay CS. Colour changes in honeybee pupae. Bee World 1962;43(4):115-117.

236

Rev Mex Cienc Pecu 2022;13(1):225-239

22. Message D, Goncalves LS. Efeito das condições climáticas a da colônia no comportamento higiênico em abelhas Apis mellifera (africanizadas). Anais do 5o Congresso Brasileiro de Apicultura (Minas Gerais) 1980:55. 23. Guzmán-Novoa E, Zozaya-Rubio JA, Anguiano-Báez JR, Vázquez-Valencia I. Técnicas de diagnóstico de laboratorio de las enfermedades y parásitos de las abejas. En: GuzmánNovoa E, Correa-Benítez A editores. Patología, diagnóstico y control de las principales enfermedades y plagas de las abejas melíferas. México: Editorial Yire; 2015:141-166. 24. Flores JM, Gutierrez I, Puerta F. A comparison of methods to experimentally induce chalk brood disease in honey bees. Span J Agric Res 2004;2(1):79-83. 25. Spivak M, Gilliam M. Facultative expression of hygienic behaviour of honey bees in relation to disease resistance. J Apic Res 1993:32(3/4):147-157. 26. Winston ML, Katz SJ. Longevity of cross-fostered honey bee workers (Apis mellifera) of European and Africanized races. Can J Zool 1981;59(8):1571-1575. 27. Guzman-Novoa E, Gary NE. Genotypic variability of components of foraging behavior in honey bees (Hymenoptera: Apidae). J Econ Entomol 1993;86(3):715-721. 28. Unger P, Guzman-Novoa E. Maternal effects on the hygienic behavior of Russian x Ontario hybrid honeybees (Apis mellifera L.). J Hered 2010;101(1):91-96. https://doi.org/10.1093/jhered/esp092. 29. Gashout HA, Guzman-Novoa E, Goodwin PH, Correa-Benítez A. Impact of sublethal exposure to synthetic and natural acaricides on honey bee (Apis mellifera) memory and expression of genes related to memory. J Insect Physiol 2020;121:104014. https://doi.org/10.1016/j.jinsphys.2020.104014. 30. SAS. SAS User ́s Guide: Statistics (version 9 ed.). Cary NC, USA: SAS Inst. Inc. 2002. 31. Bigio G, Schurch R, Ratnieks FLW. Hygienic behaviour in honey bees (Hymenoptera: Apidae): effects of brood, food, and time of the year. J Econ Entomol 2013;106(6):22802285. http://dx.doi.org/10.1603/EC13076. 32. Espinosa-Montaño LG, Guzmán-Novoa E, Sánchez-Albarrán A, Montaldo HH, CorreaBenítez A. Estudio comparativo de tres pruebas para evaluar el comportamiento higiénico en colonias de abejas (Apis mellifera L.) Vet Méx 2008;39(1):39-54. 33. Oldroyd BP. Evaluation of Australian commercial honey bees for hygienic behaviour, a critical character for tolerance to chalkbrood. Aust J Exp Agric 1996;36:625-629.

237

Rev Mex Cienc Pecu 2022;13(1):225-239

34. Medina-Flores CA, Guzmán-Novoa E, Aréchiga FCF, Gutiérrez BH, Aguilera SJI. Producción de miel e infestación con Varroa destructor de abejas africanizadas (Apis mellifera) con alto y bajo comportamiento higiénico. Rev Mex Cienc Pecu 2014;5(2):157-170. 35. Gerdts J, Dewar RL, Finstrom MS, Edwards T, Angove M. Hygienic behaviour selection via freeze-killed honey bee brood not associated with chalkbrood resistance in eastern Australia. PloS one 2018;13(11):e0203969. https://doi.org/10.1371/journal.pone.0203969. 36. Arechavaleta-Velasco ME, Guzman-Novoa E. Relative effect of four characteristics that restrain the population growth of the mite Varroa destructor in honey bee (Apis mellifera) colonies. Apidologie 2001;32:157-174. 37. Lapidge KL, Oldroyd BP, Spivak M. Seven suggestive quantitative trait loci influence hygienic behavior of honey bees. Naturwissenschaften 2002;89(12):565-568. https://doi.org/10.1007/s00114-002-0371-6 38. Harbo JR, Harris JW. Heritability in honey bees (Hymenoptera: Apidae) of characteristics associated with resistance to Varroa jacobsoni (Mesostigmata:Varroidae). J Econ Ent 1999; 92(2):261-265. https://doi.org/10.1093/jee/92.2.261. 39. Boecking O, Bienefeld K, Drescher W. Heritability of the Varroa-specific hygienic behaviour in honey bees (Hymenoptera: Apidae). J An Breed Genet 2000;117(6):417– 24. https://doi.org/10.1046/j.1439-0388.2000.00271.x. 40. Stanimirovic Z, Stevanovic J, Mirilovic M, Stojic V. Heritability of hygienic behaviour in grey honey bees (Apis mellifera carnica). Acta Vet (Beograd) 2008;58(5-6):593-601. https://doi.org/10.2298/AVB0806593S. 41. Pernal SF, Sewalem A, Melathopoulos AP. Breeding for hygienic behaviour in honeybees (Apis mellifera) using free-mated nucleus colonies. Apidologie 2012;43(4):403-16. 42. Gilliam M, Taber S, Richardson VG. Hygienic behavior of honey bees in relation to chalkbrood disease. Apidologie 1983;14(1):29-39. 43. Gilliam M, Taber S, Lorenz BJ, Prest DB. Factors affecting development of chalkbrood disease in colonies of honey bees, Apis mellifera, fed pollen contaminated with Ascosphaera apis. J Invert Pathol 1988;52:314-325.

238

Rev Mex Cienc Pecu 2022;13(1):225-239

44. Swanson JAT, Torto SA, Kells KA, Mesce HH. Tumlinson JH, Spivak M. Odorants that induce hygienic behavior in honeybees: identification of volatile compounds in chalkbrood-infected honey bee larvae. J Chem Ecol 2009;35:1108-1116. https://doi.org/10.1007/s10886-009-9683-8. 45. Zhao HX, Liang Q, Lee JH, Zhang XF, Huang WZ, Chen HS, Luo YX. Behavioral responses of Apis mellifera adult workers to odors from healthy brood and diseased brood. Sociobiol 2015;62(4):564-570. 46. McAfee A, Chapman A, Iovinella I, Gallagher-Kurtzke Y, Collins TF, Higo H, Foster LJ. A death pheromone, oleic acid, triggers hygienic behavior in honey bees (Apis mellifera L.). Sci Rep 2018;8(1):5719. https://doi.org/10.1038/s41598-018-24054-2. 47. Masterman R, Ross R, Mesce K, Spivak M. Olfactory and behavioral response thresholds to odors of diseased brood differ between hygienic and non-hygienic honey bees (Apis mellifera L.). J Comp Physiol A 2001;187(6):441-452. https://doi.org/10.1007/s003590100216 48. Guzman-Novoa E, Morfin N. Disease resistance in honey bees (Apis mellifera L.) at the colony and individual levels. In: Moo-Young M. editor. Comprehensive Biotechnology. 3rd ed. Amsterdam, The Netherlands: Elsevier BV; 2019;4:811-817. https://dx.doi.org/10.1016/B978-0-444-64046-8.00254-8. 49. Spivak M, Danka RG. Perspectives on hygienic behavior in Apis mellifera and other social insects. Apidologie 2020:1-16. https://doi.org/10.1007/s13592-020-00784-z. 50. Evison SE, Fazio G, Chappell P, Foley K, Jensen AB, Hughes WO. Innate expression of antimicrobial peptides does not explain genotypic diversity in resistance to fungal brood parasites in the honey bee. Apidologie 2016;47(2):206-215. 51. Wielewski P, de Toledo VAA, Nunes ME, Costa-Maia FM, Faquinello P, Lourenco DAL, et al. Relationship between hygienic behavior and Varroa destructor mites in colonies producing honey or royal jelly. Sociobiology 2012;59(1):251-274.

239

https://doi.org/10.22319/rmcp.v13i1.5906 Article

Production and nutritional quality of Tithonia diversifolia (Hemsl.) A. Grey in three seasons of the year and its effect on the preference by Pelibuey sheep

Vicky Tatiana Vargas Velázquez a Ponciano Pérez Hernández a Silvia López Ortiz a Epigmenio Castillo Gallegos b Cristino Cruz Lazo b Jesús Jarillo Rodríguez b*

Colegio de Postgraduados. Campus Veracruz. México.

Universidad Nacional Autónoma de México. Facultad de Medicina Veterinaria y Zootecnia. Centro de Enseñanza, Investigación y Extensión en Ganadería Tropical, Km 5.5 carretera federal Martínez de la Torre-Tlapacoyan, 93600, Tlapacoyan, Veracruz, México.

* Corresponding author: jjarillo@unam.mx

Abstract: Production, nutritional quality and preference of T. diversifolia by Pelibuey sheep was determined, at different ages, in three seasons of the year. Dry matter (DM) production and nutritional quality of forage were measured every 14 d, from the cut to 84 d of age. Leaf and stem samples were taken to determine crude protein (CP), neutral detergent fiber (NDF), and acid detergent fiber (ADF). Eight adult Pelibuey sheep were used to determine their preference for T. diversifolia foliage at 42, 56 and 70 d of regrowth. Total DM production was similar in autumn and winter and both greater than spring. In autumn at 56 d and in winter at 70 d after the cut, the production of DM was 9 t ha-1, while in S at 84 d, it was close to 3 t ha-1. The increase or decrease of the morphological components of the biomass over time was different between the seasons evaluated and showed a curvilinear behavior over time, within each season. CP increased linearly with the cutting 240

Rev Mex Cienc Pecu 2022;13(1): 240-257

age. In autumn and winter, there was a higher percentage of NDF and ADF. The 42-d plants had a lower percentage of ADF. The yield of DM and the nutritional quality of T. diversifolia differs depending on the season of year and the age of regrowth. The cutting age of the plant affected its preference by Pelibuey sheep (P=0.0091), it was higher for the foliage of 42 d, followed by 56 and 70 d. Key words: Grazing sheep, Cynodon nlemfuensis, Tropics, Forage resources.

Received: 19/12/2020 Accepted: 29/04/2021

Introduction The feeding of sheep in the Mexican tropics is based on the grazing of grasses with low crude protein (CP) value, high in neutral detergent fiber (NDF), and acid detergent fiber (ADF), and low digestibility of dry matter (DM)(1,2,3); this causes low productivity, particularly in growing sheep that produce weight gains of less than 70 g d-1(4,5). The diet quality of sheep could be improved with the use of forage shrubs and trees known to have high CP contents (14-30 %), lower NDF (28.4 - 51.9 %) and ADF (19.5 - 37.5 %), and higher digestibility (48-80 %); the supplementation of the diet with foliage of this type of plants improves the consumption of grasses(2,6), the digestibility of DM(7,8), and generates benefits to the environment(9). A shrub species with forage potential is Tithonia diversifolia (Hemsl.) A. Gray, of the Asteraceae family, which produces up to 19.5 t of DM ha-1 yr-1(10), and, increased with fertilization, may contain 11.7 to 30 % CP(11,12,13), rumen degradability of 50 to 90 %(14), low contents of ADF (24.1 to 48.9 %) and NDF (14.8 to 55.9 %), acceptable levels of secondary compounds such as phenols (30.5 %) and tannins (5.7 %)(15,16), so its use can improve the productivity and profitability of production units, without affecting the quality of products(17,18). In addition, the use of T. diversifolia improves nutrient recycling(19), prevents soil erosion(20) and is used in cutting and carrying systems, as a forage bank or grazing in silvopastoral systems(13,20). The objective was to evaluate the amount produced of T. diversifolia DM, the nutritional quality at four cutting ages, in the autumn, winter and spring seasons; and the preference of sheep for foliage for this species at different ages of regrowth.

241

Rev Mex Cienc Pecu 2022;13(1): 240-257

Material and methods Location of the research and description of the experimental site

The study was conducted at the Center for Teaching, Research and Extension in Tropical Livestock of the FMVZ-UNAM; located in the municipality of Tlapacoyan, at 20°02’ N and 97°06’ W, at 151 m asl. The climate in the region is Af(m)w”(e), warm humid(21) with an average annual temperature of 23.5 °C and annual rainfall of 1,991 mm. Three seasons of the year are distinguished: rains from July to October, northerly winds from November to February (autumn and winter), and dry from March to June (spring; Figure 1). The soil at the site is of the ultisol type; acidic of low fertility and reddish brown, tepetate immediately underlies, which originates a subterranean layer semipermeable to water that causes temporary flooding. Figure 1: Monthly temperature and rainfall of the experimental site

Phases of the research

The research was conducted in three phases. The first phase was carried out in July, to establish a plot of 158 x 55 m (8,715 m2) of T. diversifolia. The second was carried out from October 2018 to June 2019, to evaluate the dry matter yield and nutritional value of 242

Rev Mex Cienc Pecu 2022;13(1): 240-257

DM in three seasons of the year (autumn, winter and spring). In the third stage, from March 13 to April 1, 2019, a test of the preference of sheep for T. diversifolia forage at three ages was carried out. Phase 1. Establishment of Tithonia diversifolia A plot was established with T. diversifolia using cuttings of 20 to 30 cm in length, planted 60 x 60 cm apart for a density of 27,778 ha-1 plants. The plants remained without irrigation or fertilization, only manual control of weeds was carried out. Phase 2. Evaluation of yield and nutritional value of dry matter of Tithonia diversifolia Forage samplings were carried out in each season: autumn (October 9 to December 21, 2018); winter (January 6 to April 2, 2019) and spring (March 28 to June 20, 2019). In each season, a plant uniformization cut was made at 50 cm in height, 14 d prior to samplings. Fifty-two plants were selected and of these, four were randomly assigned to each of the six cutting ages (14, 28, 42, 56, 70 and 84 d). Forage samplings were planned to be carried out every 14 d until the plants reached their point of best forage condition; the plants reached that point before the beginning of flowering(13), therefore, observations of the phenology were made so that the last cut coincided with the first signs of flowering. In each sampling, the plants were cut 5 cm above the soil surface. The material of each plant was weighed and separated into leaves, stems, flowers and dead material, and dried in a forced air oven at 60 ºC for 72 h. The concentration of CP in leaves(22), NDF, ADF were determined by the filter bag method (ANKOM2000; Ankom Technology, NY, USA). Phase 3. Preference test For the preference test, the whole plant of T. diversifolia at 42, 56 and 70 d of regrowth age was used, the plants were pruned from January 12 to 16 for the age of 70 d, from January 16 to 30 for 56 d, and from January 30 to February 13 for 42 d. Eight adult sheep of the Pelibuey breed were used, with an average weight of 52 kg and approximate age of 14 mo; these animals were used to consume T. diversifolia from weaning, and under grazing of C. nlemfuensis. The experiment was carried out over a period of 20 d; the first 10 d were for adaptation(23); during this period, the animals remained in paddocks of C. nlemfuensis (6 x 5 m) 24 h a day and moved to the pen daily from 1200 to 1230 h to accustom them to handling. From day 11 to 20, the preference test was performed; 600 g of chopped green forage (whole plant) of T. diversifolia, equivalent to 77.1, 84.6 and 91.7 g DM of 42, 56 and 70 d, respectively, were offered daily. The foliage was offered for 15 min (from 1200 to 1215 h) simultaneously in a feeder with its respective separations. The preference for the age of T. diversifolia forage was estimated by the consumption of foliage of each regrowth age that was obtained based on the amount of DM offered minus

243

Rev Mex Cienc Pecu 2022;13(1): 240-257

the residual DM during the 15 min in which it was offered. A sample by age offered was collected daily to determine DM, CP, NDF, ADF and lignin.

Statistical analysis As age is a continuous variable, with the data of the biomass produced at the different ages of regrowth, a trend analysis was carried out using orthogonal polynomials, in order to determine if the effects of first to fifth degree of the age of the plant were significant or not. Likewise, the seasons were compared with each other, and the linear, quadratic and logarithmic responses were compared between seasons. The means of least squares and their standard errors (y) were plotted against the age of regrowth (x) for each season, and to determine the type of growth that the plant presented in the different seasons, resulting in a sigmoid curve for autumn and winter and one of the exponential type for spring. In the first two, they adjusted to the data with the following logistic model: 𝑎 𝑏 𝑐 1+( ) 𝑥 Where: a is the asymptotic value or maximum yield of DM (kg ha-1); b are the days at the value a/2; and c is a constant that determines the slope. For the spring season, the classic exponential growth equation was used, which is: 𝑦 = 𝑎𝑒 𝑐∗𝑥 Where: a is the value of the DM yield when x = 0, and c is the relative growth rate (kg kg-1 day-1). GraphPad Prism© v 7.05 was used to adjust these models. To determine the preference of sheep for any of the three ages of regrowth of T. diversifolia, a generalized mixed model (GLM procedure) was used for a completely randomized design and the model included the effect of treatment (age), day and the interaction treatment*day; the GLM procedure and the LSMEANS mean test of the Statistical Analysis System Version 9.3 were used.

Results Dry matter yield (DMY) In total DMY (kg d-1), the main effects of age, season and their interaction were significant, however, the main effects of regrowth age and season lose relevance by themselves, when interacting with each other (P<0.001), the age response depends on the season. Only the first-order effect of age (P<0.001) was found, while the second- to fifthorder effects were not significant (Table 1). With respect to the season, autumn and winter 244

Rev Mex Cienc Pecu 2022;13(1): 240-257

were similar to each other (P=0.4036) and both exceeded spring (P<0.0005 and P<0.0001, respectively). The linear effect of age was different between winter and spring (P<0.0214) and between autumn and spring (P<0.0001). For its part, the quadratic effect only differed between autumn and spring (P<0.0001), the same happened with the cubic effect (P<0.0001). All of this suggests a curvilinear response of the DMY that differs partially between seasons. Table 1: Comparisons of first- to fifth-order effects of regrowth age according to the season of the year Contrast

Estimator

Standard error

t-value

Pr > |t|

............................................................. Age ..................................................................... Linear 55635.00 6039.16 9.21 <.0001 Quadratic

-10024.00

6604.19

-1.52

0.1421

Cubic

-17372.00

9677.15

-1.80

0.0852

Quartic

1416.64

3814.71

0.37

0.7136

Quintic

-4228.24

11416.00

-0.37

0.7143

……………………………………………… Season …………………………………………… Winter vs Autumn

-765.59

900.39

-0.85

0.4036

Winter vs Spring

3529.51

880.92

4.01

0.0005

Autumn vs Spring

4295.11

148.15

28.99

<.0001

……………………………………………… Linear x Season ………………………………… Winter vs Autumn

-4649.11

18453.00

-0.25

0.8032

Winter vs Spring

44443.00

18061.00

2.46

0.0214

Autumn vs Spring

49092.00

3104.37

15.81

<.0001

……………………………………… Quadratic x Season ……………………………………… Winter vs Autumn

11108.00

20214.00

0.55

0.5877

Winter vs Spring

-20541.00

19775.00

-1.04

0.3093

Autumn vs Spring

-31649.00

3314.05

-9.55

<.0001

………………………….……………… Cubic x Season ……………………………………… Winter vs Autumn

-13391.00

29590.00

-0.45

0.6549

Winter vs Spring

-43049.00

28956.00

-1.49

0.1501

Autumn vs Spring

-29658.00

4924.77

-6.02

<.0001

……………………………………… Quartic x Season ………………………………………… Winter vs Autumn

-4077.04

11670.00

-0.35

0.7299

Winter vs Spring

-3243.43

11419.00

-0.28

0.7788

Autumn vs Spring

833.61

1927.01

0.43

0.6692

……………………………………… Quintic x Season ………………………………………… Winter vs Autumn

23420.00

35010.00

0.67

0.5099

Winter vs Spring

18496.00

34233.00

0.54

0.5940

Autumn vs Spring

-4923.63

5559.25

-0.89

0.3846

245

Rev Mex Cienc Pecu 2022;13(1): 240-257

The DMY at the age of regrowth in each season, as shown in Figure 2, autumn and winter showed a very similar behavior and the logistic model was adequately adjusted (R2>0.9) to the data. For its part, the exponential model in spring also had an R2>0.9. Figure 2: Relationship between days of regrowth and percentage contribution to the botanical composition of the flower, dead material, stem and leaf components of Thitonia diversifolia in the humid tropics of the state of Veracruz

Morphological components of the plant

The type III test of fixed effects revealed that the age of regrowth, the season and the interaction of both were significant in the models of the percentages of leaf, stem, dead material and flower that make up the DM of the plants. As in the DMY, the response to the effect of age depended on the season (P<0.0001). For this reason, comparisons of the linear, quadratic, cubic, up to fifth-order effects of the seasons were also made (Table 2). Most of the contrasts were highly significant (P<0.0001), which indicated that the morphological composition of the plant changed at each season, and that this change was

246

Rev Mex Cienc Pecu 2022;13(1): 240-257

curvilinear. The increase (or decrease) in the number of leaves (Figure 2, Table 3), for example, only coincided in cubic increments between winter and spring (P=0.3662), and quartic and quintic increments between autumn and spring (P=0.9221 and P=0.4229, respectively).

Table 2: Probabilities of the comparisons between seasons of first- to fifth-order effects of regrowth age on the percentage of leaf, stem, and dead material (EM) of Tithonia diversifolia Contrast

Morphological component Leaf

Stem

Flower

Winter vs autumn

........................ Linear....................................... <.0001 <.0001 0.3362

<.0001

Winter vs spring

0.0085

0.3349

<.0001

0.7830

Autumn vs spring

<.0001

0.0007

<.0001

..................... Quadratic..................................... Winter vs Autumn

<.0001

0.0318

<.0001

Winter vs Spring

0.0017

0.0019

<.0001

0.7939

Autumn vs Spring

<.0001

0.0979

<.0001

........................ Cubic......................................... Winter vs Autumn

<.0001

Winter vs Spring

0.3662

0.0002

0.0011

0.8614

Autumn vs Spring

<.0001

………………... Quartic ………….………….. Winter vs Autumn

<.0001

0.0006

0.0930

<.0001

Winter vs Spring

<.0001

0.0010

0.0004

0.9286

Autumn vs Spring

0.9221

<.0001

…………………... Quintic ………….……….. Winter vs Autumn

<.0001

0.0283

<.0001

Winter vs Spring

0.0002

0.6374

0.9747

Autumn vs Spring

0.4229

0.1098

<.0001

247

Rev Mex Cienc Pecu 2022;13(1): 240-257

Table 3: Parameters and adjustment statistics of the second- and third-degree polynomials, used to see the effect of the regrowth age (14, 28, 42, 56 and 84 d) on the percentage of the morphological components of the Tithonia diversifolia plant Season

Parameters B0 B1

Adjustment statistics Sy.x R2

Autumn Winter Spring

171.0 108.1 135.0

-4.476 -1.519 -2.237

0.033850 0.006833 0.013040

-------------

1.997 6.097 14.210

0.9948 0.9579 0.8489

2 3 3

Autumn Winter Spring

-55.330 -4.246 -11.670

5.238 1.303 0.735

-0.099310 -0.006961 -0.001491

0.000601 ---------

1.946 5.142 10.450

0.9923 0.9640 0.8463

2 2 2

Autumn Winter Spring

-20.180 -4.641 -23.300

1.166 0.2684 1.502

-0.009266 -0.000417 -0.011550

-------------

9.300 1.481 5.314

0.4480 0.9419 0.8244

3 3 3

-4.369 0.1303 0.002447 ----5.18 0.8560 3 Autumn 0.1462 -0.01007 0.0001332 ----0.07136 0.7857 3 Winter 3.418E-15 -2.82E-16 3.222E-18 ----1.982E-15 0.6153 3 Spring B0= intercept; B1, B2, B3= regression coefficients of first, second and third order, respectively; Sy.x= standard deviation of the residual; R2= is the one adjusted by the number of parameters in the equation.

Consistent with the decrease in leaves and the increase in stems with age, the amount of dead material (Figure 2, Table 3) also increased, showing a curvilinear behavior that differs in some contrasts (Table 2) but with a tendency to increase in the three seasons. The presence of flowers was only observed in the autumn and from d 42.

Chemical composition of DM of leaves

The CP content increased linearly as the cutting age increased (Table 4), with values ranging from 18.3 ± 2.9 to 21.3 ± 1.8 % for the ages of 42 and 84 d, respectively. The concentration of NDF, ADF and lignin increased from 42 to 56 d and remained from 70 to 84 d. The highest percentage of ADF and lignin was recorded in the autumn and winter seasons and the lowest during the spring; with respect to age, there was a higher percentage in plants 56 d old and lower in 84 d.

248

Rev Mex Cienc Pecu 2022;13(1): 240-257

Table 4: Content (%) of crude protein, neutral detergent fiber, acid detergent fiber and lignin of T. diversifolia at different seasons of the year Age (days)

NDF

ADF

Lignin

17.0 21.7 19.7

47.5 52.0 46.3

35.0 37.7 33.3

22.3 23.7 20.2

21.3 19.6 18.1 20.9

48.9 51.7 48.0 41.4

34.5 38.5 34.5 24.2

21.4 25.1 22.9 12.6

31.8 32.1 39.3 44.6

18.9 18.8 22.9 28.5

8.0 11.6 13.4 18.7

42.6±6.6

28.3±6.8

17.4±5.2

Autumn 42 56 70 84 Winter 42 56 70 84 Spring 42 16.1 56 17.3 70 22.0 84 23.5 Average ± standard deviation 19.8±2.4

CP= crude protein, NDF= neutral detergent fiber, ADF= acid detergent fiber.

Preference of sheep for Tithonia diversifolia In the preference test, the consumption (mean ± SE) of DM of T. diversifolia at 42, 56 and 70 d of regrowth was 62.6 ± 2.1; 42.7 ± 3.1; 34.7 ± 3.7 g DM d-1, respectively (P<0.0001) and the consumption of foliage of 42 d (P<0.05) was higher. When analyzing the daily consumptions of dry matter, a marginal interaction of the regrowth age x the test day (P=0.06) was observed, which caused the consumptions to vary throughout the days. In the first 2 d, foliage consumption increased at all three cutting ages. While from day 2 to 4 at the age of 42 d intake decreased 49.1 %, from 56 and 70 d of regrowth it decreased 25.7 and 45.3 %, respectively. However, from the fourth day at the age of 42 d, the intake increased and at the age of 56 the intake was maintained. After d 5, consumption remained without major fluctuations in the three ages of foliage.

Discussion Dry matter yield It has been reported that, with rainfall values less than 50 mm/month, the DM yield of T. diversifolia can decrease by up to 90 %(24), because it is a plant that responds widely to

249

Rev Mex Cienc Pecu 2022;13(1): 240-257

humidity(23,25). The results obtained in the present study are similar to those obtained in other studies(26). In all three seasons, yield slowly increased in the first few weeks after the cut (Figure 2); in autumn at 56 d and in winter at 70 d after the cut, the plants reached a yield close to 9.0 t DM ha-1, while in spring, at 84 d, the production was close to 3 t DM ha-1. The stabilization of growth between 56 and 70 d of regrowth in autumn and winter is due to pre-flowering, as other authors have mentioned(11,13,27), who recommend harvesting the forage between 50 and 60 d of regrowth, when its protein and NDF contents are higher. This shows that, in the agroecological conditions where the research was carried out, autumn and winter are the seasons with the optimal conditions for the growth of T. Diversifolia. This lower production of DM in spring was the result of lower rainfall and high temperatures (Figure 1), which even comes from winter(28); the same authors recommend a cutting frequency of 60 d in the rainy season and 80 d in the dry season. Others(29) also recommend making the use of forage of 45 to 60 d of rest in the rainy season and 70 to 90 d in the rainy season. It is considered, in cuts of 70 to 90 d, a good production and nutritional quality of DM(26). The adjustment to the logistics of autumn and winter and the exponential of spring are due to the availability of humidity from the rainfall registered in each season, while in autumn and winter, a rainfall of 164.7 mm and 74.6 mm is observed, in spring it was 112.7 mm with a temperature of 22.4 in autumn, 20.6 in winter and 27.3 in spring; however, rainfall in spring was minimal during the assessment year, coupled with the lower rainfall observed in the winter, which could explain the lower production of DM. The amount of dry matter in the present study (9 t ha-1 of DM for autumn and winter) is similar to the 9.1 t ha-1 with 20,000 plants/ha and cut at 40 cm(30), but lower than that reported by others(31), which, in addition to the lower rainfall received in the present trial, could also be related to the use of young plants in spring because their planting was carried out in July 2018, and at this age they have fewer branches and consequently lower yield of total dry matter, in addition to the availability of rainfall received. In Colombia, production was approximately 30 to 70 t ha-1 per cut of green forage, depending on planting density, soils and vegetative stage(32). On the other hand, they cite an annual production of 13.52 t DM ha-1 per year, with significant differences between the rainy period (9.1 t DM ha-1 per year) and the less rainy period (4.42 t DM ha-1 per year)(25). Other authors(7) mention that, if the cuts are made at a younger age, for example, between 30 and 60 d of regrowth, the production of DM is greater than that obtained with cuts at 90 and 110 d of age of the plant(25). The yield of 3 t DM ha-1 in spring is lower than the 3.5 t DM ha-1 at 60 d of age reported(28) in dry season and lower than the 4.42 t DM ha-1 per year(25).

250

Rev Mex Cienc Pecu 2022;13(1): 240-257

Morphological components of biomass

Although the change in the DMY of leaves was curvilinear, the tendency was to a decrease in leaves over time (Figure 2; Table 3), with a slight increase towards the end of spring; this is because the plants experience a second period of growth with the presence of rains in the last harvests, in June the presence of the first rains of the season is usually registered. The effect of age on the number of stems that varies between seasons is reasonable and is primarily explained by the age of the plants, since, as the plants grow the leaf-to-stem ratio decreases, the plants accumulate more stem as a supporting structure; this fact can vary between the seasons due to the effect of climatic variables, mainly rainfall, which induces a rapid and proportional growth between leaves and stems, while in dry season spring and winter (season with lower temperatures), the plants can limit the growth of leaves or present senescence of leaves, decreasing the leaf:stem ratio(33). The tendency in the appearance of dead matter is expected at older ages of the plants, which is natural, but there may also be a decrease in this material in the course of the growth period because the senescent leaves become detached or because there are growth upswings that change the relationships between the components of the plants(29,34). As observed with the decrease of leaf in autumn until 56 days and with the increase of stem at the same age. The presence of flowers was observed from 42 to 70 d of regrowth in autumn, this increase observed at the beginning of autumn and decrease at the end of the same season are associated with the decrease in temperature at the beginning and end of autumn, respectively, and that continues in winter, similar results are reported by other authors(11,13,34). A slight decrease is also reported at a higher age of regrowth in spring and autumn associated with an increase in temperature(25). The forage capacity of Tithonia diversifolia and its nutritional quality are determined, among other factors, by the phenological stage(34), however, when evaluating the cut of T. diversifolia in different phenological stages (pre-flowering, flowering and after flowering), it has been reported that yields are higher after flowering(35). Therefore, 42 d is recommended as the most appropriate time to harvest the forage during the autumn, without causing damage to the crop in the pre-flowering stage and with greater preference of Pelibuey sheep. Likewise, the presence of flowers observed in autumn from d 42 coincides with what is indicated in other studies(29,36). Some authors suggest the cut of 50 d with a green biomass production of 3.5 t DM ha-1(13,25,29). However, other authors recommend at 60 days with 7.2 t DM ha-1 yr(7,28) or 70 d(36), on the other hand, in browsing, the recovery of the plant requires longer periods, 60 to 90 d depending on the climate(29,30). Although, contrary to the number of leaves over 251

Rev Mex Cienc Pecu 2022;13(1): 240-257

time, the number of stems tends to increase with increasing age of regrowth(11,24); all increases in yield are different between seasons, except for the similarity of the linear effect between winter and spring. It can be observed that there are differences in the cutting age for better yield, this is related to the climatic conditions of each region, so it could be suggested that the cut is made in pre-flowering or at the beginning of flowering(34,35).

Chemical composition

The CP content increased linearly as the cutting age increased, these data are similar to those reported in Cuba when studying 29 T. diversifolia materials(26). It has been found 14.1 % CP at 56 d of regrowth in the whole plant(10), and also 29.79 and 17.27 % CP(7) at 30 and 60 d of age, respectively. The values of NDF and ADF recorded in the present study are similar to those reported by other authors (32.62 to 41.83 %), in different cultivars of T. diversifolia(26) and those of ADF (14.8 to 18.92 %) are slightly lower than those of the present trial. Elevated values of NDF (53.81 %) and ADF (48.18 %)(10), among others(36), have been reported, but they were performed with the whole plant, at ages greater than 56 d and with a cutting height (30 cm) lower than that of the present trial. However, the NDF value of T. diversifolia in the present trial is lower when compared to that reported in Digitaria eriantha(37), and similar to that reported in Leucaena leucocephala(38) under grazing. The content of NDF and ADF recorded may explain why T. diversifolia is a plant with a high percentage of degradability, which makes it very palatable for sheep(36). The percentage of ADF and lignin shows a tendency to increase at 56 d in autumn and winter and to decrease during spring, this could be related to the presence of flowering in the autumn, while in winter, the decrease in humidity and low temperature also have an effect.

Preference of sheep for Tithonia diversifolia

Sheep preferred the forage of 42 d of age, followed by that of 56 and 70 d, which indicates that, at an older age, the lower the consumption; this may be due to a better nutritional quality at 42 d, due to its higher CP content and lower fiber content, as has already been reported(23), in addition to the fact that, the younger the plant, the higher the leaf proportion and the more tender the stems, which generates a greater leaf-stem ratio(38). After d 5, consumption was higher and remained without large fluctuations in the three ages of foliage. This confirms the observation that sheep require 6 to 8 d to stabilize their consumption of T. diversifolia (23).

252

Rev Mex Cienc Pecu 2022;13(1): 240-257

The trend in the interaction (age x day) of 42 d of regrowth on d 4 of the test could be due to different factors such as the age of the plant, but also the season(39) and the soil where the harvested plant is, as reported in T. diversifolia and Gliricidia sepium(40).

Conclusions and implications The dry matter yield and nutritional quality of T. diversifolia differ according to the season of the year, it is higher in autumn and winter than in spring, so, under the agroecological conditions that prevail in the area, it is recommended to use the foliage at 42 d of regrowth in autumn, at 70 d in winter and after 84 d in spring. Sheep consume the foliage of this species at any age offered between 42 and 84 d of age, however, they prefer the younger foliage that has higher nutritional quality. Harvesting plants at 42 d to meet sheep preference involves sacrificing biomass yield at such an early age. This dilemma requires more precise research to know the voluntary consumption and weight gain of sheep when the age of the foliage offered increases. The potential yield, the high nutritional value and the preference shown by sheep, make this plant have a high forage potential for feeding this species and other ruminants in tropical conditions. It is necessary to deepen the research on T. diversifolia to evaluate different planting densities in the climatic seasons that occur and their relationship with yield, nutritional quality, animal response and the environment.

Acknowledgments and conflict of interest

The authors declare that they have no conflict of interest of any kind. Literature cited: 1. Góngora-Pérez RD, Góngora-González FS, Magaña-Magaña AM, Lara PEL. Caracterización técnica y socioeconómica de la producción ovina en el estado de Yucatán, México. Agron Mesoam 2010;(21):131-144. 2. Ramírez-Rivera U, Sanginés-García JR, Escobedo-Mex JG, Cen-Chuc F, Rivera-Lorca JA, Lara-Lara PE. Effect of diet inclusion of Tithonia diversifolia on feed intake, digestibility and nitrogen balance in tropical sheep. Agrofor Syst 2010;(80):295-302. 3. Archiméde A, Eugéne M, Marie-Magdeleine C, Boval M, Martín C. Comparison of methane production between C3 and C4 grasses and legumes. Anim Feed Sci Technol 2011;(166-167):59-64.

253

Rev Mex Cienc Pecu 2022;13(1): 240-257

4. Sanginés-García JR, Ku-Vera CJ, González-Valencia C, Ramón-Ugalde PJ. Ewe production in a pasture of star Grass (Cynodon nlenfuensis) fertilized with swine lagoon effluent. Small Ruminant Res 2003;(49):135-139. 5. Izaguirre F, Martínez TJJ, Jiménez FJO, Posada CS, García CCG, Martínez PC. Respuesta reproductiva y productiva de borregas Pelibuey a la suplementación con hojas de Caulote (Guazuma ulmifolia), Guaje (Leucaena leucocephala) y Yaite (Gliricidia sepium) en condiciones de trópico húmedo. Livest Res Rural Dev 2011;23(10):1-10. 6. Castañeda-Serrano RD, Piñeros-Varón R, Vélez-Giraldo A. Foliage of tropical arboreal species in feedenig ovines (Ovis aries): Intake, digestibility and balance nitrogen. Biol Scient Mus Hist Nat Univ Caldas 2018;22(1):58-68. 7. Lezcano Y, Soca M, Ojeda F, Roque E, Fontes D, Montejo IL, Santana H, Martínez J, Cubillas N. Caracterización bromatológica de Tithonia diversifolia (Hemsl.) A. Gray en dos etapas de su ciclo fisiológico. Pastos y Forrajes 2012;(35):275-282. 8. Molina IC, Donney´s GC, Montoya S, Rivera JE, Villegas G, Chará J, Barahona R. La inclusión de Leucaena leucocephala reduce la producción de metano de terneras Lucerna alimentadas con Cynodon plectostachuys y Megathyrsus maximus. Livest Res Rural Dev 2015;27(5):96. 9. Sandoval-Pelcastre AA, Ramírez-Mella MN, Rodríguez-Ávila NL, CandelariaMartínez B. Árboles y arbustos tropicales con potencial para disminuir la producción de metano en rumiantes. Revisión. Trop Subtrop Agroecosyst 2020;23(33):1-16. 10. Gallego-Castro LA, Mahecha-Ledesma L, Angulo-Arizala J. Calidad nutricional de Tithonia diversifolia Hemsl. A Gray bajo tres sistemas de siembra en el trópico alto. Agron Mesoam 2017;28(1):213-222. 11. Verdecia DM, Ramírez JL, Leonard I, Álvarez Y, Bazán Y, Bodas R, Andrés S, Álvarez J, Giráldez F, López S. Calidad de la Tithonia diversifolia en una zona del Valle del Cauco. Rev Electrón Vet 2011;12(5):1-13. 12. Botero-Londoño JM, Gómez-Carabalí A, Botero-Lodoño MA. Yield, agronomic parameters and nutritional quality of Tithonia diversifolia in response to different fertilization levels. Rev Mex Cienc Pecu 2019;10(3):789-800. 13. Mejía-Díaz E, Mahecha-Ledezma L, Angulo-Arizala J. Thitonia diversifolia especie para ramoneo en sistemas silvopastoriles y métodos para estimar su consumo. Agron Mesoam 2017;28(1):289-302. 14. La OO, González H, Orozco A, Castillo Y, Ruíz O, Estrada A, Castro B. Composición química, degradabilidad in situ y digestibilidad in vitro de ecotipos de T. diversifolia de interés para la alimentación de rumiantes. Rev Cuba Cienc Agríc 2012;46(1):4753.

254

Rev Mex Cienc Pecu 2022;13(1): 240-257

15. Cardona-Iglesias JL, Mahecha-Ledezma L, Angulo-Arizala J. Arbustivas forrajeras y ácidos grasos: estrategias para disminuir la producción de metano entérico en bovinos. Agron Mesoam 2016;28(1):273-288. 16. Rivera JE, Chará J, Gómez-Leyva JF, Ruíz T, Barahona R. Variabilidad fenotípica y composición fitoquímica de Tithonia diversifolia A. Gray para la producción animal sostenible. Livest Res Rural Dev 2018;(30):200. 17. González-Castillo JC, von-Hessberg CMH, Narvaéz-Solarte W. Características botánicas de T. diversifolia (Asterales : asterácea) y su uso en la alimentación animal. Bol Cient Mus His Nat 2014;18(2):45-58. 18. Gómez-Gurrola A, Del Sol García G, Sanginés-García L, Loya-Olguín L, BenítezMeza A, Hernández-Ballesteros A. Rendimiento en canal de corderos de pelo, alimentados con diferentes proporciones de Tithonia diversifolia y Pennisetum spp. Ábanico Veterinario 2017;7(2):34-42. 19. Olabode OS, Sola O, Akanbi WB, Adesina GO, Babajide PA. Evaluation of Tithonia diversifolia (Hemsl.) Gray for soil improvement. World J Agr Sci 2007;3(4):503507. 20. Argüello-Rangel J, Mahecha-Ledezma L, Angulo-Arizala J. Arbustivas forrajeras: importancia en las ganaderías de trópico bajo Colombiano. Agron Mesoam 2019;30(3):899-915. 21. García E. Modificaciones al sistema de clasificación climática de Koópen. 4a. ed. México: Ed. Limusa; 1987. 22. A.O.A.C. Official Methods of Analysis of the Association of Official Agricultural Chemists. 12 th ed. Published by the Association of Official Agricultural Chemists. Washington, D.C. 1975. 23. García DE, Medina MG, Clavero T, Humbría J, Baldizán A, Domínguez C. Preferencia de árboles forrajeros por cabras en la zona baja de los andes Venezolanos. Rev Cient FCV LUZ 2008;(18):549-555. 24. Navas-Panadero N, Montaña V. Comportamiento de Tithonia diversifolia bajo condiciones de bosque húmedo tropical. Rev Invest Vet Perú 2019;30(2):721-732. 25. Castillo-Mestre R, Betancourt-Bagué T, Toral-Pérez OC, Iglesias-Gómez JM. Influencia de diferentes marcos de plantación en el establecimiento y la producción de Tithonia diversifolia. Pastos y Forrajes 2016;39(2):89-93. 26. Ruíz TE, Alonso J, Febles GJ, Galindo JL, Savón LL, Chongo BB, Torres V, Martínez Y, La OO, Gutiérrez D, Crespo GJ, Cino DM, Scull I, González J. Tithonia diversifolia: I. Estudio integral de diferentes materiales para conocer su potencial de producción de biomasa y calidad nutritiva. Avances en Investigación Agropecuaria 2016;20(3):63-82. 255

Rev Mex Cienc Pecu 2022;13(1): 240-257

27. Partey TS. Effect of pruning frequency and pruning heigth on the biomass production of Tithonia diversifolia (Helms.) A. Gray. Agrofor Syst 2011;(83):181-187. 28. Ruíz TE, Febles G, Díaz H. Distancia de plantación, frecuencia y altura de corte en la producción de biomasa de Tithonia diversifolia colecta 10 durante el año. Rev Cub Cienc Agríc 2012;46(4):423-426. 29. Alonso J, Achan G, Santos LDT, Sampaio RA. Comportamiento productivo de Tithonia diversifolia en pastoreo con reposos diferentes en ambas épocas del año. Livest Res Rural Dev 2015;27(6):Article 15. 30. Holguín S, Ortiz A, Velasco A, Mora J. Evaluación multicriterio de 44 introducciones de Tithonia diversifolia (Hemsl.) A. Gray en Candelaria, Valle del Cauca. Rev Med Vet Zootec 2015;62(2):57-72. 31. Alonso J, Ruíz T, Achang G, Santos L, Sampaio R. Producción de biomasa y comportamiento animal en pastoreo con Tithonia diversifolia a diferentes distancias de plantación. Livest Res Rural Dev 2012;(24):Article1#60. http://www.Irrd.org/Irrd24/9/lazo24160.htm 32. Ríos CI, Salazar A. Botón de oro (Tithonia diversifolia Hemsl Gray) una fuente proteica alternativa para el trópico. Livest Res Rural Dev 1995;6(3):Article #25. 33. Buchanam-Wollaston V, Earl S, Harrison E, Mathas E, Navabpour S, Pague T, Pink D. Review. The molecular analysis of leaf senescence –a genomics approach. Plant Biotech J 2003;(1):3-22. 34. Londoño CJ, Mahecha LL, Angulo AJ. Desempeño agronómico y valor nutritivo de Tithonia diversifolia (Hemsl) A Gray para la alimentación de bovinos. Rev Colombiana Cienc Anim 2019;11(1). 35. De Souza,OFJ. Influência do espaçamento e da época de corte na produção de biomassa e valor nutricional de Tithonia diversifolia HEMSL.) Gray. Dissertação [Mestrado]. – Faculdade de Ciências Agrárias, Universidade de Marília, Unimar, Brasil. 2007. 36. Zavala Y, Rodríguez JC, Cerrato M. Concentración de carbono y nitrógeno a seis frecuencias de poda en Tithonia diversifolia y Morus alba. Tierra Tropical 2007;3(2):149-159. 37. Azuara-Morales I, López-Ortiz S, Jarillo-Rodríguez J, Pérez-Hernández P, OrtegaJiménez E, Castillo-Gallegos E. Forage availability in a silvopastoral system having different densities of Leucaena leucocephala under Voisin grazing management. Agrofor Syst 2020;(20):1-11. 38. García-Ferrer L, Bolaños-Aguilar ED, Ramos-Juárez J, Arce MO, Lagunes-Espinoza LC. Rendimiento y valor nutritivo de leguminosas forrajeras en dos épocas del año y cuatro edades de rebrote. Rev Mex Cienc Pecu 2015;6(4):453-468. 256

Rev Mex Cienc Pecu 2022;13(1): 240-257

39. Cabrera-Carrión JL, Jaramillo-Jaramiillo C, Dután-Torres F, Cun-Carrión J, García PA, Rojas de Astudillo L. Variación del contenido de alcaloides, fenoles, flavonoides y taninos en Moringa oleífera Lam. en función de su edad y altura. Bioagro 2017;29(1):53-60. 40. Santacoloma VLE, Granados JE. Interrelación entre el contenido de metabolitos secundarios de las especies Gliricidia Sepium y Tithonia diversifolia y algunas propiedades fisicoquímicas del suelo. Revista de Investigación Agraria y Ambiental 2012;3(1):53-62.

257

https://doi.org/10.22319/rmcp.v13i1.5567 Technical note

Oregano essential oil in panela-type cheese: its effects on physicochemical, texture and sensory parameters

Niriel Sánchez-Zamora a Mónica Dinorah Cepeda-Rizo a Katty Lorena Tamez-Garza a Beatriz Adriana Rodríguez-Romero a Sugey Ramona Sinagawa-García a Alejandro Isabel Luna Maldonado a Emmanuel Flores-Girón b Gerardo Méndez-Zamora a*

Universidad Autónoma de Nuevo León. Facultad de Agronomía. Francisco Villa s/n, ExHacienda El Canadá. 66050, General Escobedo, Nuevo León, México. b

Universidad Autónoma Chapingo, Departamento de Ingeniería Agroindustrial. Estado de México, México.

* Corresponding author: gerardo.mendezzm@uanl.edu.mx; mezage@hotmail.com

Abstract: Plant essential oils are increasingly used in the food industry for their antimicrobial, antioxidant and sensory properties. The effects of added oregano essential oil (OEO) in panela cheese (QP) production was evaluated on cheese physicochemical, textural and sensory properties during 15 day’s storage. Two addition levels were used, resulting in three treatments: control with no OEO (QP1); 0.05 g OEO/ L milk (QP2); and 0.10 g OEO/L milk (QP3). In all treatments, cheese pH was highest (P<0.05) on d 1 and lowest on d 15, although

258

Rev Mex Cienc Pecu 2022;13(1):258-271

it remained higher overall in QP1. Weight and weight loss did not differ between treatments. Color parameters differed minimally between treatments and over time, although increased OEO content pushed b* values towards yellow. Addition of OEO lowered cheese hardness and shear force values. Based on sensory parameters, consumer acceptance was highest (P<0.05) for the control treatment. Addition of OEO generally did not affect cheese physicochemical, textural and sensory characteristics during storage. It did slightly lower hardness and shear force values, and decreased consumer acceptance. If used at adequate levels, oregano essential oil can improve cheese performance during storage without substantially affecting quality parameters. Key words: Essential oil, Quality, Color, Milk, Attributes.

Received: 18/12/2019 Accpeted: 12/05/2021

Cheese and other milk derivatives constitute an important protein source in human diets. Myriad cheeses are produced in Mexico, panela-type fresh cheese being a well-known type. Production of panela cheese in Mexico has increased in recent years. National production in 2018 was 51,340 tons worth $2.96 million Mexican pesos, and in the first half of 2019 production was 25,850 tons worth $1.53 million pesos(1). Panela cheese is popular in Mexico, white in color and inverted truncated-conical in shape(2), with physical and sensory characteristics similar to those of Greek feta cheese(3). Cheeses, especially fresh types, experience biochemical processes such as lipolysis and proteolysis, and high water activity, making them susceptible to oxidation and microbiological deterioration, and reducing their shelf life(4). Fresh cheeses are considered to be a highly perishable food and it is recommended they be stored at temperatures below 5 °C(5). Addition of carbonates, citrates, gums, sorbates and propionates to fresh cheeses can increase their shelf life(6), by reducing water activity, regulating acidity, and thus stabilizing and better preserving the cheese. However, consumers increasingly demand cheeses free of preservatives and chemicals with potential health consequences, driving a search for natural additives to promote conservation, such as essential oils (EO) from aromatic plants. Oregano essential oil (OEO) has antioxidant and antimicrobial properties that can retard oxidation in food, maintaining its physicochemical properties, lengthening its shelf life, and thus improving consumer acceptance(4). Very few studies have been done to date on the use of EO as preservative agents in cheese or dairy products(7). Both OEO and rosemary EO are reported to reduce lipid oxidation and fermentation in cheeses prepared with a cream base(7). Addition

259

Rev Mex Cienc Pecu 2022;13(1):258-271

of OEO to organic cottage cheese is also reported to lower the rate of quality parameter deterioration during storage, suggesting its use as a natural preservative in perishable foods(4). The present study objective was to evaluate the effects of oregano (Lippia berlandieri Schauer) essential oil (OEO) on the physicochemical, textural and sensory properties of panela cheese during 15 day’s storage at 4 °C. The effects of addition of two OEO concentrations (0.05 and 0.10 g/L milk) to the milk used to produce panela cheese on physicochemical and sensory characteristics were evaluated at 1, 4, 8 and 15 d after production. The completely randomized design involved three treatments: QP1= control (no OEO); QP2= 0.05 g OEO/L milk; and QP3= 0.10 g OEO/L milk. Each treatment involved two replicates per treatment and period (1, 4, 8 and 15 d; 24 total cheeses), and the studied variables were evaluated four times per replicate (n= 8 periods/treatment). A total of 3.5 L commercial pasteurized milk (Comercializadora de Lácteos y Derivados, S.A. de C.V.) were used per cheese. Milk composition (g/100 ml) was 3.12 g protein, 3.32 g fat, 4.80 g carbohydrates, 0.046 g Na and 0.116 g Ca. The OEO was sourced from Natural Solutions SMI (Jiménez, Chihuahua, Mexico). Composition of the OEO was quantified by gas chromatography (PerkinElmer Clarus 600 and SQ8 GC/MS; PerkinElmer Inc., Waltham, MA, USA) according to Vazquez and Dunford(8). Its main constituents were carvacrol (60.0 %), cymene (16.1 %), terpinene (5.4 %) and thymol (3.4 %). Before addition to the milk the OEO was emulsified with Tween20 at a 50:50 ratio (OEO:emulsifier). This ratio was established based on preliminary tests in which OEO was mixed with Tween20 (polyoxyethylene [20] sorbitan monolaurate), stirred manually for 3 min and stored at 26 °C for 10 days. An emulsion was considered unstable when a creamy, oily layer or oil drops were observed. Using FAO guidelines (01.6.1, Note 38 – based on mixture to be skimmed)(9), a maximum limit of 80 mg Tween 20/kg unripened cheese was employed. Panela cheese production was done following an established protocol(10). Milk temperature was adjusted to 34 °C, and CaCl2 (15 g/100 L milk; dissolved in purified water) slowly added under constant stirring. In the QP2 and QP3 treatments, the indicated amount of emulsified OEO was then added by slow mixing for 2 min. Rennet (CUAMIXM.R., CHR HANSEN de México, S.A. de C.V., Mexico City; 15 mL/100 L milk; diluted in purified water) was slowly added to the milk under constant stirring for 1 min and allowed to settle for 40 min to set the milk. The resulting curd was cut into cubes (1 cm3), rested for 5 min and slowly stirred while raising its temperature to 38 °C for 2 min. After resting for 5 min, the cheese mass was obtained by partial draining (2/3 whey removed). Salt (600 g NaCl/100 L milk) was added under constant, slow stirring. The cheese was placed into cylindrical plastic self-pressed molds and turned every 30 min, twice per side. Finished cheeses were weighed, vacuum packed, labelled (replicate/treatment/period) and refrigerated at 4 °C until evaluation.

260

Rev Mex Cienc Pecu 2022;13(1):258-271

Five physicochemical variables were evaluated: weight (W); weight loss (%, WL); pH; titratable acidity (TA); and color. The cheeses were weighed when finished (day 0) and after 1, 4, 8 and 15 day’s storage; the results were used to calculate WL [(Winitial– Wfinal)/Winitial)) * 100]. The pH was measured with a puncture electrode (Orion 3 star ThermoFisher Scientific, Pittsburgh, USA) at four points in 50 g cheese for each replicate in each treatment. Titratable acidity (TA) was measured using an established method(11), with modifications in sample preparation: 1 g cheese was totally macerated in 10 g distilled water, 9 g mixture removed, three drops phenolphthalein added to it and this titrated with 0.1 M NaOH. Titratable acidity (TA) was calculated with the formula TA (g lactic acid/100 g product) = (V × 0.9)/m; where V is volume (ml) of 0.1 M sodium hydroxide; m is sample mass (grams), and 0.9 is the lactic acid conversion factor. Five color parameters (luminosity [L*], red tendency [a*], yellow tendency [b*], Hue angle and Chroma [Chro; saturation]) were measured with a CR-400 colorimeter (Konica Minolta®, Tokyo, Japan), based on the CIE Lab system(12). Measurement of each variable was done eight times per treatment per period. On d 1, 8 and 15, a texture analysis device (TA.XT.Plus , Stable M Micro Systems, Surrey, England) was used to measure shear force (SF) and run a texture profile analysis (TPA) for four cheese samples/replicate/period (i.e. n= 8 samples/treatment/period). For SF measurement, a 3 mm inverted triangle Warner-Bratzler blade was used to cut standardized rectangular samples (1 cm wide x 1 cm high x 3.5 cm long). Test conditions were a pre-test speed = 1.0 mm sec-1, a test speed = 2.0 mm sec-1 and a post-test speed =10.0 mm s-1. The SF was considered the maximum point of the resulting curve. In the TPA, standardized samples (1.5 cm high x 2.5 cm diameter) at 8 ºC were compressed to 50 % of their height in a cylindrical piston (75 mm diameter). Test conditions were a pre-test speed = 2 mm sec-1, a test speed = 2 mm sec-1 and a post-test speed = 5 mm sec-1, with 5 s between cycles. Using parameters defined by Bourne(13), and implemented by Lobato-Calleros et al(14) and SalinasValdés et al(15), deformation curves were produced from two compression cycles and used to calculate hardness (Newton; N), stickiness (g sec-1), elasticity (mm), cohesiveness (dimensionless), rubberiness (g), chewiness (g mm-1) and resistance (dimensionless). Using twenty semi-trained panelists (n = 20 per period) who were habitual cheese consumers, an affective attribute-based sensory evaluation was done on days 1, 4, 8 and 15. Each consumer was given four random 1 cm3 cheese cubes at 8 °C, placed in transparent plastic cups coded with three random digits. The evaluated attributes were white color, odor, flavor, softness and overall acceptability. A 5-point hedonic scale was used in the evaluation: 5 = I like it a lot; 4 = I like it; 3 = I neither like it nor dislike it; 2 = I dislike it; and 1 = I very much dislike it(16,17). The data produced with the completely random experimental design was analyzed with the GLM procedure of SAS(18) using the statistical model:

261

Rev Mex Cienc Pecu 2022;13(1):258-271

yij = µ + Ƭi + δj + (Ƭδ)ij + Ԑij; Where: yijk = physicochemical, texture and sensory variables evaluated over time; µ = general mean; Ƭi = effect of the i-th treatment (QP1, QP2 and QP3); δj = effect of the j-th evaluation day (1, 4, 8 and 15 days); (Ƭδ)ij = effect of the interaction between the i-th treatment and the j-th day; Ԑijk = random error normally distributed with mean and variance [Ԑij ~ N (µ, σ2)]. In the analysis of variance, a probability less than 0.05 (P<0.05) was considered significant, rejecting the null hypothesis (H0; equality of treatments, days and their interaction; α = 0.05). When the fixed factors and/or their interaction produced an effect, the means were compared with the adjust = Tukey instruction(18). The parameters whey loss, pH and TA are used to evaluate the quality of cheeses in storage. In the present results (Table 1), the treatments/time (days) interaction affected cheese weight, pH and TA (P<0.05). In QP2, weight was highest on day 1 but in QP3 it was highest on d 15. Values for pH were highest (P<0.05) on d 1, decreased gradually to d 8 and then notably by d 15 (P<0.05). Weight loss did not differ (P>0.05) between treatments and days. Water release during commercial cheese production is known as syneresis, and depends on factors such as pH, temperature, salt, milk composition and pre-treatments(19). When panela-type cheese loses water (i.e. whey) during storage at 4 °C it is also considered syneresis; additives can affect syneresis during storage. In the present results, weight at 15 d was lowest in QP1 and WL tended to increase over time (δj; P= 0.0592) but not between treatments (Ƭi; P = 0.2553). Apparently, addition of OEO did not modify syneresis during storage (WL) in the studied cheeses.

262

Rev Mex Cienc Pecu 2022;13(1):258-271

Table 1: Weight, pH and titratable acid in panela cheese produced with milk containing added oregano essential oil during 15 day’s storage. 1 Variables2 Treatments (Ƭi) /Days (δj) Weight (g) WL pH TA 1 day QP1 183.50b;AB 5.39 6.41A 0.016a;BC QP2 223.00a;A 3.88 6.42A 0.014a;C QP3 199.50b;AB 5.91 6.42A 0.016a;BC 4 days QP1 204.00a;AB 5.78 6.32B 0.019a;B QP2 202.00a;AB 5.40 6.31B 0.018a;B QP3 184.50a;AB 5.87 6.36AB 0.014a;C 8 days QP1 179.50a;AB 6.03 6.28B 0.028a;B QP2 196.00a;AB 5.55 6.29B 0.025a;B QP3 177.00a;AB 5.60 6.31B 0.029a;B 15 days QP1 173.00a;B 7.80 5.68C 0.044a;A QP2 177.00a;AB 6.81 5.73C 0.040a;A QP3 182.00a;AB 5.70 5.66C 0.029b;B SME 6.14 0.68 0.01 0.002 P-value Ƭi 0.0094 0.2553 0.2858 0.0109 δj 0.0013 0.0592 < 0.0001 < 0.0001 (Ƭδ)ij 0.0383 0.3793 0.0124 0.0025 1

QP1= control (no OEO); QP2= 0.05 g OEO/L milk; QP3= 0.10 g OEO/L milk. SME= standard mean error; Ƭi= effect of i-th treatment; δj= effect of j-th evaluation day (1, 4, 8 and 15 days); (Ƭδ)ij= effect of i-th treatment/ j-th evaluation day interaction. 2 WL= weight loss; TA= titratable acid (g lactic acid/100 g product). a-b Means with different lowercase superscripts in the same column, between treatments and/or evaluation days are significantly different (P<0.05). A-C Means with different uppercase superscripts in the same column, for all treatments and evaluation days, are significantly different (P<0.05).

All treatments had more acidic pH on day 15 than on d 1 (P<0.05), and, consequently, TA was also highest (P<0.05) on d 15. Among the treatments, TA on d 15 was lowest (P<0.05) in QP3 and highest (P<0.05) in QP1. In the center of panela-type cheese pH is reported to range from 6.4 on d 1 to 5.94 on d 15(2); the latter value is similar to those observed in the treatments on d 15. The decreases in pH observed here are probably due to production of lactic acid by bacteria, which contribute to cheese aroma and texture(3). Titratable acidity (TA) in all three treatments was low on d 1 and 4 (no difference; P>0.05) and increased up to d 15. This coincides with a study in which fresh cheeses containing Lactobacillus

263

Rev Mex Cienc Pecu 2022;13(1):258-271

acidophilus had increasingly higher TA at 1, 7, 14 and 21 d, which is attributed to the natural and continuous production of lactic acid and organic acids(20). The one exception in the present study was QP3, in which TA did not change from day 8 to d 15. This treatment had the highest OEO content (0.10 g OEO/L milk), which may have inhibited lactic acid bacteria growth after d 8. Carvacrol and thymol are known bioactive components of OEO and act to disintegrate the outer membrane of bacteria, increasing cytoplasmic membrane permeability and leading to cell death(21). Essential oils like OEO commonly exhibit greater inhibitory activity against Gram-positive bacteria than Gram-negatives because the latter have a lipopolysaccharide barrier on their outer membrane(21). Addition of OEO to the milk used to produce the studied panela-type cheeses had no effect (P>0.05) on their color over time ((Ƭδ)ij)(Table 2). However, treatment did affect (P<0.05) luminosity (L*) on d 1, with QP1 having the lowest (P<0.05) value and QP2 the highest (P<0.05). From d 4 onwards L* values did not differ between treatments. In contrast, time ((Ƭδ)ij) did affect a*, b*, Hue and Chroma (P<0.001). As expected, a* values were near zero in all treatments throughout the storage period because panela-type cheese is white, therefore manifesting no tendency to green or red. Increases in b* values in all the treatments suggest that, in conjunction with ripening, the pigments present in OEO, such as phenolic monoterpenes (carvacrol)(22), pushed b* values towards yellow. Consequently, the saturation index and tonality values varied somewhat by d 15 (b*>a*).

264

Rev Mex Cienc Pecu 2022;13(1):258-271

Table 2: Color evaluation in panela cheeses produced with milk containing added oregano essential oil during 15 day’s storage. 1 Color Variables2 Treatments (Ƭi) /Days (δj) L* a* b* Hue Chroma 1 day QP1 99.61b -0.41 9.78 91.24 9.78 QP2 100.00a -0.31 9.28 92.15 9.28 ab QP3 99.99 -0.34 9.36 92.23 9.34 4 days QP1 99.48a 0.06 9.51 89.58 9.51 a QP2 99.83 -0.06 9.19 90.44 9.20 a QP3 99.79 0.01 9.23 89.84 9.24 8 days QP1 99.88a -0.14 10.23 90.81 10.23 a QP2 100.00 -0.23 10.11 91.55 10.11 a QP3 100.00 -0.23 10.48 91.49 10.48 15 days QP1 99.54a 0.03 9.84 89.65 9.84 a QP2 99.98 -0.04 10.05 90.08 10.05 a QP3 99.88 0.26 9.86 88.25 9.88 SME 0.13 0.10 0.17 0.71 0.17 P-value Ƭi 0.0008 0.4944 0.3255 0.2965 0.3340 δj 0.0844 < 0.0001 < 0.0001 < 0.0001 < 0.0001 (Ƭδ)ij 0.9110 0.5553 0.2466 0.6935 0.2377 1

QP1= control (no OEO); QP2= 0.05 g OEO/L milk; QP3= 0.10 g OEO/L milk. SME= standard mean error; Ƭi= effect of i-th treatment; δj= effect of j-th evaluation day (1, 4, 8 and 15 days); (Ƭδ)ij= effect of i-th treatment/ j-th evaluation day interaction. 2 L*= luminosity; a*= red color tendency; b*= yellow color tendency; Hue: Hue angle; Chroma= saturation index. a-b Means with different lowercase superscripts in the same column, between treatments and/or evaluation days are significantly different (P<0.05).

Texture analysis identified the treatment/evaluation days interaction as affecting cohesiveness and resistance ((Ƭδ)ij; P<0.05) (Table 3). Values for both these variables were highest (P<0.05) in QP2 on d 1 and lowest (P<0.05) in QP1 on d 8. The treatments affected (Ƭi; P<0.05) SF, hardness, rubberiness and chewiness. Both SF and hardness values were highest in QP1 and lowest in QP2 on days 1 and 8. By d 15, the lowest SF (P<0.05) was in QP2 and the lowest (P<0.05) hardness in QP3. Values for rubberiness and chewiness were consistently higher (P<0.05) over time in QP1 than in QP2 and QP3, which did not differ (P>0.05). This coincides with a study of a fresh cheese in which, at d 3, hardness, elasticity

265

Rev Mex Cienc Pecu 2022;13(1):258-271

and cohesiveness values were similar to those of QP1 on d 1(23). Reduction in formulation fat content is the suggested cause, since it reduces interruption of protein areas in the cheese structure, which is reflected in higher hardness values(23). In cheeses, a larger protein fraction has been associated with higher firmness and SF values, which occurs because fat globules occluded in the casein matrix occupy interstitial space, effectively extending the protein network and undermining hardness(2,3). This could explain the lower hardness in QP2 and QP3 on d 8 and 15: OEO may have occupied interstices in the protein network and thus maintained cheese softness during storage. Reductions in hardness and cohesiveness have also been reported in panela-type cheese containing additives such as canola oil and whey protein(24). High hardness and chewiness values in fresh cheeses over time has been observed in a previous study(2). The present results suggest that addition of OEO (QP2 and QP3) reduced texture values over time compared to the control (QP1). Proteins are known to contribute to hardness in cheeses because they constitute the continuous solid phase, but proteolysis and lipolysis can also promote hardness; during storage, natural additives with antioxidant and antimicrobial properties, such as OEO, can mitigate these processes, slowing degradation and preserving product texture(15).

266

Rev Mex Cienc Pecu 2022;13(1):258-271

Table 3: Texture analysis of panela cheese made with milk containing added oregano essential oil during 15 day’s storage Treatment SF Hardness Stickiness Elasticity Gumminess Chewiness (Ƭi)1 Cohesiveness Resistance 2 -1 (kgf) (N) (g s ) (mm) (g) (g mm-1) /Days (δj) 1 day QP1 0.8109a 5.48a -7.99 0.86 0.71a;A 3.91a 3.40a 0.33a;AB b c a;A b b QP2 0.6891 4.23 -6.12 0.87 0.75 3.20 2.81 0.38a;A QP3 0.7389b 5.14b -2.13 0.86 0.73a;A 3.76b 3.24b 0.36a;AB 8 days QP1 0.8700a 9.57a -11.71 0.85 0.65a;B 6.16a 5.29a 0.27b;C QP2 0.7779ab 7.50c -9.59 0.78 0.68a;AB 4.92b 4.09b 0.31a;B QP3 0.8905a 8.98b -9.51 0.85 0.66a;B 5.94b 5.09b 0.29a;BC 15 days QP1 0.8674a 9.20a -7.78 0.85 0.70a;A 6.41a 5.48a 0.32a;B QP2 0.8131ab 8.33b -11.01 0.86 0.65a;B 5.40b 4.67b 0.28b;BC QP3 0.8191ab 7.98c -12.05 0.86 0.68a;B 5.44b 4.72b 0.31a;B SME 0.0295 0.48 1.78 0.024 0.012 0.28 0.26 0.013 P-value Ƭi 0.0018 0.0038 0.6939 0.5144 0.7314 0.0004 0.0009 0.2148 δj 0.0002 < 0.0001 0.0014 0.1840 < 0.0001 < 0.0001 < 0.0001 < 0.0001 (Ƭδ)ij 0.3163 0.4020 0.0786 0.2415 0.0032 0.4002 0.4047 0.0334 1

QP1= control (no OEO); QP2= 0.05 g OEO/L milk; QP3= 0.10 g OEO/L milk. SME= standard mean error; Ƭi= effect of i-th treatment; δj= effect of j-th evaluation day (1, 4, 8 and 15 days); (Ƭδ)ij= effect of i-th treatment/ j-th evaluation day interaction. 2 SF: shear force (kgf). a-c Means with different lowercase superscripts in the same column, between treatments and/or evaluation days are significantly different (P<0.05). A-C Means with different uppercase superscripts in the same column, for all treatments and evaluation days, are significantly different (P<0.05).

267 1

Rev Mex Cienc Pecu 2022;13(1):258-271

Odor, taste, softness and overall acceptability varied slightly between the treatments each day, with QP1 differing (P<0.05) most frequently from QP2 and QP3 (Table 4). In contrast, white color did not differ (P>0.05) between treatments or days, or in response to the treatment/day interaction. Overall, QP1 was the most accepted (P<0.05) treatment and QP2 the least (P<0.05). Indeed, QP2 and QP3 had lower acceptance values in all the sensory attributes except white color, suggesting that OEO content may have negatively affected these attributes. Its unpleasant taste and strong odor have limited use of OEO as a food preservative even though it does improve food safety and shelf life(25). Many essential oils have an intense aroma and their use in high concentrations to compensate for interactions with food components can negatively affect food sensory attributes(21). Table 4: Sensory attributes of panela-type cheese made with milk containing added oregano essential oil during 15 day’s storage Sensory attributes2 Treatment (Ƭi)1 Oregano Overall White color Flavor Softness /Days (δj) odor acceptance 1 day QP1 4.60 4.25a 4.40a 4.45a 4.32a QP2 4.60 3.60b 3.00b 4.05b 3.30b QP3 4.50 3.90ab 3.50b 4.30ab 3.50b 4 days QP1 4.40 4.10a 4.35a 4.50a 4.35a QP2 4.50 3.70a 2.80b 4.00b 3.40b QP3 4.50 4.05a 3.45b 4.35ab 3.80b 8 days QP1 4.70 4.25a 4.70a 4.55a 4.60a QP2 4.60 3.60b 2.85b 4.25a 3.10b QP3 4.70 3.85ab 3.30b 4.35a 3.45b 15 days QP1 4.60 4.30a 4.35a 4.45a 4.35a QP2 4.35 3.65a 2.90b 3.90a 3.05b QP3 4.45 3.75a 3.40b 3.90a 3.70ab SME 0.14 0.19 0.23 0.19 0.21 P-value Ƭi 0.8154 0.0001 < 0.0001 0.0055 < 0.0001 δj 0.2381 0.9695 0.9387 0.2793 0.7909 (Ƭδ)ij 0.8935 0.9108 0.9178 0.9163 0.6979 1

268 1

Rev Mex Cienc Pecu 2022;13(1):258-271 2

5-point hedonic scale: 5= I like it a lot; 4= I like it; 3= I neither like nor dislike it; 2= I dislike it; 1= I very much dislike it. a-b Means with different lowercase superscripts in the same column, between treatments and/or evaluation days are significantly different (P<0.05).

Use of 0.05 g OEO/L milk in the production of panela-type cheese did not substantially affect physicochemical, textural and sensory characteristics during storage in comparison to a control. In terms of softness, the cheeses produced with 0.1 g OEO/L milk exhibited the overall lowest shear force and hardness values. Sensory acceptance was most consistent for the cheese containing no OEO, although acceptance of that containing 0.1 g OEO/L milk increased slightly after 15 day’s storage. The present results show that natural alternatives such as oregano essential oil can be used in fresh cheeses to improve storage performance as long as levels are controlled to avoid quality parameter deterioration.

Conflicts of interest

The authors declare no conflict of interest.

Acknowledgements

The authors thank the Faculty of Agronomy, Universidad Autónoma de Nuevo León, for access to their laboratories, and Natural Solutions SMI (Jiménez, Chihuahua, México) for their donation of oregano essential oil. Literature cited: 1.

INEGI. Instituto Nacional de Estadística y Geografía. México en Cifras: Banco de Información Económica (BIE). https://www.inegi.org.mx/app/indicadores/?tm=0#divFV644629. Consultado: Nov 25, 2019.

Guerra-Martínez JA, Montejano JG, Martín-del-Campo ST. Evaluation of proteolytic and physicochemical changes during storage of fresh Panela cheese from Queretaro, Mexico and its impact in texture. CyTA-J Food 2012;10(4):296-305.

González-Córdova AF, Yescas C, Ortiz-Estrada ÁM, de la Rosa-Alcaraz MA, Hernández-Mendoza A, Vallejo-Cordoba B. Invited review: Artisanal Mexican cheeses. J Dairy Sci 2016;99(5):3250-3262.

269 2

Rev Mex Cienc Pecu 2022;13(1):258-271

Asensio CM, Grosso NR, Juliani HR. Quality preservation of organic cottage cheese using oregano essential oils. LWT-Food Sci Tech 2015;60(2):664-671.

Teng D, Wilcock A, Aung M. Cheese quality at farmer’s markets: observation of vendor practices and survey of consumer perceptions. Food Control 2003;15:579-587.

CXS 221-2001. Norma de grupo para el queso no madurado, incluido el queso fresco. Enmendada en 2018. http://www.fao.org/fao-who-codexalimentarius/codex-texts/liststandards/es/. Consultado: Nov 25, 2019.

Olmedo RH, Nepote V, Grosso NR. Preservation of sensory and chemical properties in flavoured cheese prepared with cream cheese base using oregano and rosemary essential oils. LWT-Food Sci Tech 2013;53:409-417.

Vazquez SR, Dunford TN. Bioactive components of Mexican oregano oil as affected by moisture and plant growth. J Essent Oil Res 2005;17(6):668-671.

CODEX STAN 192. Norma general para los aditivos alimentarios. Revisión 2019. http://www.fao.org/fao-who-codexalimentarius/codex-texts/list-standards/es/. Consultado: Feb 24, 2021.

10. Villegas de Gante A, Santos Moreno A. Manual básico para elaborar productos lácteos. 2nd ed. México, DF: Trillas SA de CV; 2016. 11. Sanz T, Salvador A, Jiménez A, Fiszman SM. Yogurt enrichment with functional asparagus fibre. Effect of fibre extraction method on rheological properties, colour, and sensory acceptance. Eur Food ResTechnol 2008;227:1515-1521. 12. CIE. 1976. International Commission on http://www.cie.co.at/. Consultado: Nov 25, 2019.

Illumination.

Colorimetry.

13. Bourne MC. Food texture and viscosity: Concept and measurement. Geneva, New York. 2002. 14. Lobato-Calleros C, Ramos-Solís L, Santos-Moreno A, Rodríguez-Huezo ME. Microstructure and texture of panela type cheese-like products: use of low methoxyl pectin and canola oil as milk-fat substitutes. Rev Mex Ing Quim 2006;5:71-79. 15. Salinas-Valdés A, De la Rosa Millán J, Serna-Saldívar SO, Chuck-Hernández C. Yield and textural characteristics of panela cheeses produced with dairy-vegetable protein (soybean or peanut) blends supplemented with transglutaminase. J Food Sci 2015;80(12):S2950-S2956. 16. Anzadúa-Morales A. La evaluación sensorial de los alimentos en la teoría y la práctica. Zaragoza, España: Acribia; 1994.

270 3

Rev Mex Cienc Pecu 2022;13(1):258-271

17. Meilgaard M, Civille GV, Carr TB. Sensory evaluation techniques. In: Meilgaard M, Civille GV, Carr TB editors, Affective tests consumer tests and in-house panel acceptance tests. 4th ed. Boca Raton, Florida, USA: CRC Press. 2006:231-251. 18. SAS 9.1.3 Software. Institute Inc., Cary, North Carolina, USA. 2006. 19. Pearse MJ, Mackinlay AG. Biochemical aspects of syneresis: a review. J Dairy Sci 1989; 72:1401-1407. 20. Buriti F, Jaliana S, Susana S. Incorporation of Lactobacillus acidophilus in Minas fresh cheese and its implications for textural and sensorial properties during storage. Int Dairy J 2005;15:1279-1288. 21. Burt S. Essential oils: their antibacterial properties and potential applications in foods-a review. Int J Food Microbiol 2004;94:223-253. 22. Khorshidian N, Yousefi M, Khanniri E, Mortazavian A. Potential application of essential oils as antimicrobial preservatives in cheese. Innov Food Sci Emerg Technol 2018;45:62-72. 23. Lobato-Calleros C, Reyes-Hernández J, Beristain CI, Hornelas-Uribe Y, SánchezGarcía JE, Vernon-Carter EJ. Microstructure and texture of white fresh cheese made with canola oil and whey protein concentrate in partial or total replacement of milk fat. Food Res Int 2007;40(4):529-537. 24. Lobato-Calleros C, Lozano-Castañeda I, Vernon-Carter EJ. Textura y microestructura de quesos tipo panela bajos en grasa y en colesterol: diferentes metodologías. Ing Agric Biosist 2009;1(1):39-48. 25. Calo J, Crandall P, O'Bryan C, Ricke S. Essential oils as antimicrobials in food systemsa review. Food Control 2015;54: 111-119.

271 4

https://doi.org/10.22319/rmcp.v13i1.5741 Technical note

Effect of nisin on the inhibition of the growth of Staphylococcus areus and on the sensory properties of coastal cheese

Beatriz Alvarez Badel a* Maria Alejandra Doria Espitia a Vanesa Hodeg Peña a Mónica María Simanca Sotelo a Yenis Pastrana Puche a Claudia Denise De Paula a

Universidad de Córdoba. Departamento de Ingeniería de alimentos, Sede Berástegui, Vía Cereté – Ciénega de Oro, Córdoba, Colombia.

*Corresponding author: bealvarez@correo.unicordoba.edu.co

Abstract: Staphylococcus aureus is a common cause of food poisoning in humans. It is very common in dairy products made with raw milk, such as costeño cheese, an artisanal cheese common on Colombia’s Caribbean coast. Costeño cheeses from Montería, Colombia, were analyzed to quantify their S. aureus load, the effect of added nisin in inhibiting S. aureus growth in this matrix and on product sensory characteristics. Staphylococcus aureus was isolated from commercial costeña cheeses and the minimum inhibitory concentration (MIC) of nisin versus this microbe quantified. Costeña cheese was made containing 0, 500 and 625 IU/kg added nisin, S. aureus counts done at 0 and 24 h storage, and the results analyzed using a random design with 57 experimental units. Sensory evaluation was done with a triangular test involving a panel of 40 tasters to identify any differences in the sensory characteristics of costeño cheese with and without 500 IU/kg added nisin. All the commercial costeño cheeses were contaminated with S. aureus, but all identified strains were inhibited by 500 IU/ml nisin

272

Rev Mex Cienc Pecu 2022;13(1): 272-286

(MIC). Addition of nisin during cheese production reduced (P≤0.05) S. aureus counts compared to a nisin-free control; at 24 h, nisin lowered S. aureus counts 2.3 log cycles in the 500 IU/kg nisin treatment and 1.9 log cycles in the 625 IU/kg treatment. Sensory characteristics did not differ (P≥0.05) between costeño cheese containing 500 IU nisin/kg and a nisin-free control. Addition of 500 IU/ml nisin to costeño cheese can inhibit S. aureus growth without affecting sensory characteristics. Key words: Bactericides, Minimum inhibitory concentration, S. aureus.

Received: 22/07/2020 Accepted:12/05/2021

Food safety consists of guaranteeing that food does not biologically, physically or chemically endanger the consumer; in other words, the absence of dangerous substances, the certainty of no adverse effects, the absolute opposite of risk(1). A major biological risk in food are pathogenic microorganisms such as Staphylococcus aureus. This gram-positive bacterium is a normal species in the human bacterial flora, but can effectively grow in many foods (sliced meats, milk and derivatives, sauces, preserves, bakery products, and egg creams, among others), where it produces exotoxins that can result in staphylococcal poisoning with an intake as low as 100 ng toxin(2).

Costeño cheese is a native food common on the Caribbean coast of Colombia. Produced artisanally from unpasteurized (raw) milk via enzymatic coagulation and dry salting, it is pressed, unripened, not acidified and white in color. Widely consumed in the region, the largely unsanitary conditions in which it is produced make it an important source of food poisoning(3). Colombian Technical Standard (NTC) 750 stipulates that coagulase-positive S. aureus counts in costeña-type cheese must remain between 100 and 1,000 CFU/g(4). Previous studies have identified unsafe Staphylococcus levels in costeña cheeses in Colombia. For example, 41.1 % of costeño cheese samples sold in Montería Municipality, Córdoba Department, were found to have unacceptable positive Staphylococcus coagulase values(5). Another study identified S. aureus in 75 % of studied soft costeña cheeses and 25 % of semihard cheeses sampled in Valledupar Municipality, Cesar Department(6).

Nisin (E234) is a FDA-approved food preservative classified as “generally recognized as safe” (GRAS) and is widely used to inhibit S. aureus. A polypeptide substance produced by

273

Rev Mex Cienc Pecu 2022;13(1): 272-286

different strains of Lactococcus lactis and Streptococcus lactis, it acts against gram-positive bacteria, is stable in acidic pH and slightly heat-sensitive. Widely used in cheese production(7), it has been frequently studied in this food matrix, especially against S. aureus(8). Quantifying an antimicrobial’s in vitro activity against a bacterial culture is done using broth or agar dilution techniques, such as minimum inhibitory concentration (MIC). This technique involves a series of tubes or plates containing broth or agar, respectively, to which the antimicrobial of interest is added in different concentrations. Each tube or plate is inoculated with a standardized suspension of the studied microorganism(s) and the MIC (expressed as μg/ml) measured based on the minimum bactericide concentration at which no bacterial development (i.e. turbidity) is observed(9).

The present study objective was to apply the minimum inhibitory concentration technique to evaluate how nisin affects the development of S. aureus isolated from costeño cheese sold at licensed distributors in Montería Municipality, Cordoba Department, Colombia. Analyses were also done of S. aureus growth in costeña cheeses containing nisin, and the effects of nisin on costeña cheese sensory characteristics.

S. aureus isolation and identification. Samples (250 g) of costeño cheese were acquired at points of sale in Montería and transported to the Food Microbiology Laboratory, University of Córdoba, Colombia. Serial dilutions were done, plated in duplicate on plates containing salt agar and mannitol, and incubated for 24 to 48 h at 37 ºC(10). Characteristic S. aureus colonies were confirmed by Gram stain, and the catalase and coagulase test(11). Three of the isolated strains were analyzed by PCR(12). Stored at 2 to 4 °C, the strains were activated with nutrient broth and cultured in Baird-Parker agar (BPA).

Measuring MCI of nisin versus S. aureus strains isolated from Costeño cheese. A McFarland scale was prepared as a turbidity standard to standardize density in microorganism preparations. The 0.5 scale was prepared with 0.18 M sulfuric acid and an aqueous solution of 0.048 M barium chloride equivalent to 1.5 x 108 CFU/m, with an optical density of 0.08 to 0.12 at 625 nm(13). Three S. aureus colonies were added to tubes containing 5 ml Mueller-Hilton (MH) broth, incubated at 37 °C for 1 h, and absorbance and turbidity measurements taken. Those tubes exhibiting absorbance and turbidity measurements within the established range were considered standardized on the 0.5 McFarland scale, with approximately 1.5 x 108 cells/mL(14).

274

Rev Mex Cienc Pecu 2022;13(1): 272-286

A nisin stock solution (NISIN(z) Qiqihaer Heilongjiang Province, China, from Amtech Biotech Laboratory, HS Code 2941909090) was prepared by diluting 1.0 g nisin in 100 ml 0.02 N HCl. The solution contained 1.0 x 104 IU/ml with a pH near 2.0, which was adjusted to 3.21 with 0.5 N NaOH. This was diluted with MH broth to seven concentrations: 100, 200, 500, 1,000, 1,500, 2,000 and 2,500 IU/ml(15). Broth alone was used as a control. Inoculum (10 µL) was prepared with S. aureus, added to each tube, and the tubes incubated at 37 °C for 24 h with shaking at 182 rpm.

The lethality curve was built based on four concentrations: ½ MIC, MIC, 2xMIC and 4xMIC. Tube contents were cultured in triplicate on BPA plates at six incubation times (0, 2, 4, 8, 20 and 24 h) and the colonies counted. When bacterial count (CFU/ml) vs exposure time (hours) was graphed(11), it showed a first-order exponential kinetics following the formula 𝑁𝑇 = 𝑁0 𝑒 −𝐾𝑇 ; applying logarithms produces 𝐿𝑛𝑁𝑇 = 𝐿𝑛𝑁0 − 𝐾𝑇, the lethality rate (K). Clearing the previous equation allows calculation of the time it takes for the microorganism population to reduce by half, known as the lethality rate: T1/2 = ln2/K(16).

Evaluating different nisin concentrations during costeña cheese production. An established protocol was used to produce costeña cheese(17). Acidity, pH (potentiometry)(18) and S. aureus counts(11) were measured in filtered milk. This was heated to 34 ± 1 ºC and CaCL2 (20 g/100 L milk) and Milkset liquid rennet (1.0 ml/10.0 L milk) added. The curd was cut into 1 to 2 cm squares and left to sit for 5 min. The whey was separated by gravity and salt added directly at 2.5 %. The salty curd was divided into three 500 g batches and nisin homogeneously distributed at one of the three studied concentrations (625, 500 and 0.0 IU/kg) in each batch. Each batch was individually molded and pressed, and samples taken from each and stored at 4 ± 2 °C. Counts of S. aureus populations were done in triplicate at 0 and 24 h after production, following an established method(11).

The resulting data were analyzed with a completely randomized design using 57 experimental units. The data was analyzed using the statistical software R Project version 3.1.1. An analysis of variance was run and a Duncan multiple range test (P<0.5) applied to identify significant differences between S. aureus counts in a control cheese with no nisin and those produced with the tested nisin concentrations.

Triangular test of regular and nisin-containing costeña cheeses. A sensory evaluation was done using forty untrained judges, aged 19 to 45 yr, to determine if sensory differences existed between a control costeño cheese without nisin and one containing 500 IU/kg nisin, the maximum permissible concentration(19). Sensory evaluation was done using a group of 275

Rev Mex Cienc Pecu 2022;13(1): 272-286

three cheese samples, two of which were the same, and the judge was asked to select which sample differed from the others. The number of correct answers was tabulated and compared in a table to identify the minimum number of correct answers and establish significance at different levels of probability in the triangular test (one-tailed, P= 1/3)(20). Isolation, selection and identification of S. aureus from costeña cheese. Staphylococcus aureus was isolated from all the studied costeño cheese samples. Eighteen (18) strains were identified with characteristics typical of S. aureus colonies (round, surrounded by a bright yellow area). The isolated strains characterized by cellular, colonial, and biochemical morphology corresponded to S. aureus. The PCR analysis identified three strains as having the genes that code for S. aureus enterotoxin. MIC versus S. aureus strains isolated from costeña cheese. The nisin concentration that best inhibited S. aureus was 500 IU/ml. At 24 h incubation no turbidity was observed at this concentration, while turbidity was present in the 100 and 200 IU/ml concentrations. When the range of concentrations was extended from 500 to 1,125 IU/ml, inhibition was also observed at 625 IU/ml. Lethality curve. The lethality curve clearly illustrates the relationship between nisin concentration and bactericide activity. Of the four tested nisin concentrations, 250 IU/ml did not inhibit S. aureus (Figure 1). Figure 1: Lethality curve of Staphylococcus aureus growth versus nisin concentration in Baird-Parker agar (IU/mL) 350000 300000

CFU/mL

250000 200000

250UI/mL 500UI/mL

150000

1000UI/mL 2000UI/mL

100000 50000

0 0

Time (hours)

276

Rev Mex Cienc Pecu 2022;13(1): 272-286

Cell counts decreased logarithmically when S. aureus was challenged with nisin at concentrations at or above the MIC (500 IU/mL)(Figure 2), indicating that nisin meets the criterion of a bactericide(21). Maximum bactericide activity at the MIC was attained at 20 h, with a 3.7log (CFU/ml) decrease in bacterial load. Figure 2: Surviving cell count (Log CFU/g) vs time in hours (IU/mL) 14

Log CFU/mL

8 Control 500UI/mL

1000UI/mL 2000UI/mL

0 0

Time (hours)

The lethality rate (CFU/hour) showed that cell counts decreased proportionally over time (Table 1), suggesting that as nisin concentration increased so did microorganism mortality.

Table 1: Lethality rate and Staphylococcus aureus population reduction at evaluated nisin concentrations Nisin (IU/ml) 500 1000 2000

K (CFU/hours) 0.154 0.184 0.205

277

T1/2 (hours) 4.50095572 3.76710424 3.38120576

Rev Mex Cienc Pecu 2022;13(1): 272-286

Evaluation of different nisin concentrations in costeño cheese production. The milk used as raw material in the costeña cheese production had pH (6.8) and acidity (0.16 % lactic acid) within established parameters, but S. aureus counts exceeding 10,000 CFU/mL(22). Inclusion of nisin during production lowered counts (P<0.05) at both the 625 and 500 IU/kg concentrations (Table 2). In the control treatment without added nisin, counts increased notably to levels above 103 CFU/g at both 0 and 24 h, which represents risk of food poisoning. At zero hours, the 625 IU/kg treatment exhibited the lowest (P<0.05) average count, followed by the 500 IU/kg treatment. The same held true at 24 h, although the count in the control without nisin had actually increased. Both nisin concentrations effectively controlled S. aureus counts in the evaluated costeña cheeses. Table 2: Average Staphylococcus aureus counts in three costeño cheese production lots at zero and 24 h storage Average counts (CFU/g) ± SD 24 hours

Reduction (B/A,%)

Nisin (IU/kg)

Zero hours

625

69.9 ± 49.1

11.1 ±9.2

15.9

500

658 ±254

64.4 ±53.6

9.8

NO nisin

1669 ±609

2403±738

abc

Different letters indicate difference (P<0.05).

During 24 h storage, average S. aureus populations increased in the control treatment without nisin, but were 3.62 logarithmic cycles lower in the 500 IU/kg treatment and 5.4 cycles lower in the 625 IU/kg treatment. (Figure 3).

278

Rev Mex Cienc Pecu 2022;13(1): 272-286

Figure 3: Average Staphylococcus aureus count in costeña cheeses containing different nisin concentrations and a nisin-free control

Sensory test. The panel of judges found no differences (P<0.05) between costeña cheese made with or without nisin, suggesting that addition of 500 IU/kg nisin to the cheese did not appreciably change sensory properties.

The presence of S. aureus in the studied costeña cheese samples showed that the population that consumes this product is at risk of food poisoning. This microorganism is most likely present in costeña cheese due to lack of milk pasteurization and poor hygiene practices during cheese handling, distribution and sale. In Colombia, 881 foodborne disease outbreaks were reported in 2018, cheeses being involved in 19.4 % of them. In cases where the etiological agent was identified, 12 % of the outbreaks were caused by S. aureus(23). Previous studies of costeña cheese shipped in Córdoba department have found the product unfit for human consumption due to a significant microbiological load associated with deficiencies in product han dling, production and storage facilities, and sales conditions(5). In the present study, most of the points where cheese was acquired exhibited clearly unsafe conditions during product distribution, storage and sale; very few establishments refrigerated the product. These conditions very probably directly affect costeño cheese microbiological quality. Review and monitoring of artisanal cheese production have been suggested since S. aureus contamination in artisanal cheeses can originate from the skin, mouth or nostrils of food handlers, from raw milk, and from processing and environmental conditions(24).

279

Rev Mex Cienc Pecu 2022;13(1): 272-286

Previous studies evaluating food safety in artisanal cheeses made with raw milk in various locations all found the presence of S. aureus to be associated with insufficient food safety practices(25-28). Specifically, in artisanal cheeses in which starter cultures were not used S. aureus had no competing bacterial flora (e.g. lactic acid bacteria) and exhibited a significant risk of toxin production if initial counts were high enough(29).

In the present results 500 IU/ml nisin MIC was required to inhibit S. aureus, which agrees with previous studies of artisanal cheeses. In Brazil, evaluation of nisin in S. aureuscontaminated artisanal cheese from Araxá (Minas Gerais) stored for 10 d found inhibition to be highest at 400 and 500 IU/ml nisin(30); in addition, 100 IU/ml nisin concentrations reduced a logarithmic cycle in microorganism count during 60 day’s storage, without changing attributes such as color and texture(31). Adding 500 IU/ml nisin to the milk used in production of fresh cheese in Minas Gerais produced 2 log cycle reductions in S. aureus counts in curd and whey, a 1.5 logarithmic cycle reduction in cheese at 30 d refrigerated storage, and extended the latent phase in S. aureus growth in milk by 8 h(32). A study of costeña cheese made with pasteurized milk and inoculated with S. aureus ATCC 29213 recorded a MIC of 500 IU/ml for nisin(33). Nisin’s antibacterial effect is probably due to depolarization of the cytoplasmic membrane as part of a dual-action process in which it first forms pores in the microorganism membrane and then acts as a detergent destabilizing it(34). This occurs in three steps. First, nisin’s positive charge interacts with the cell wall’s negative charge; second, it binds to a peptidoglycan carrier molecule from the cytoplasm to the cell wall (called lipid II), preventing synthesis; third, the nisin molecules bind to the lipid II to fix and bind to the cell membrane and form pores, causing cell death(7). Microbial lethality in response to nisin concentration was exponential in the present results, with first order kinetics due to linearity between the survivors-versus-treatment time logarithm. The curve slope symbolizes the rate at which cells die and is measured in CFU/time. The mathematical model that best estimates the slope, and determines CFUs at each time and concentration, optimally represented the results as comparable to the different kinetics of antimicrobials and antibiotics(35). The kinetic parameters and mathematical models describing microbial population inactivation in thermal, pressure and electromagnetic processes are known(36). Growth, survival or inactivation models have also been described for various microorganisms exposed to natural antimicrobials in various food matrices, and include information lag phase duration, generation time, maximum population density and exponential growth rate(37). For example, the primary model is reported to describe S. aureus inhibition in different types of meat(38).

280

Rev Mex Cienc Pecu 2022;13(1): 272-286

Although previous research exists on nisin addition in pasteurized costeña cheese to inhibit S. aureus, raw milk was used in the present study because pasteurization has been linked to destruction of enzymes, decreased mineral content and elimination of geographically distinct microorganisms which differentiate cheese color and texture, and even probiotic potential(39). In the raw milk used to produce costeña cheese, initial S. aureus concentrations exceeded maximum limits in Colombia; the presence of S. aureus in dairy products indicates contamination from handling or disease in cattle due to mastitis(40). Addition of nisin to costeño cheese during production lowered S. aureus counts at both zero and 24 h storage. This demonstrated an inverse relationship between nisin concentration and S. aureus counts over time, beginning during production and continuing during storage. This coincides with viability studies of S. aureus exposed to nisin for 1 to 24 h which report significant (P<0.01) reductions in microorganism population within the first hour of nisin exposure(41). Similar behavior has been reported in artisanal cheese from Araxá (Minas Gerais-Brazil) in which S. aureus was most inhibited at 8 h in milk containing nisin and this inhibition was concentration-dependent(31). As a food matrix, costeña cheese has considerable salt content, which supports nisin’s antimicrobial effect, but it also contains lipids, which can interfere with the effect, probably due to its amphipathic behavior(42). The greater bactericidal action of nisin in costeña cheese soon after production may be related to different factors: rapid diffusion of nisin when applied directly to food(43); acquired or adaptive microbial resistance of S. aureus developing during exposure to nisin(44), and degradation of nisin over time by food enzymes(45). Both the nisin concentrations (625 and 500 IU/kg) added to the studied costeña cheeses significantly reduced (2.3 and 1.9 logarithmic units, respectively) S. aureus concentrations at 24 h. However, 500 IU/kg is the highest concentration recommended in food systems(18). Sensory evaluation comparing costeña cheese with and without 500 IU/kg added nisin showed an absence (P>0.05) of perceived organoleptic differences. Similar results have been reported when adding 5 mg/kg nisin to costeño cheese(46). Because nisin is classified as GRAS, it can safely be used in food systems to lower S. aureus counts without affecting consumer acceptance. Costeña cheese samples sold in Montería, Colombia, were found to harbor high S. aureus counts. Addition of 500 IU/ml nisin inhibited S. aureus strains isolated from these cheeses, with a maximum reduction of 3.7 Log (CFU/ml) at 20 h incubation. Lethality rate was 0.154 CFU/h, with a 4.5 h population reduction time. Compared to a control, no differences in sensory properties were observed in costeña cheeses containing 500 IU/kg nisin. Addition of nisin to artisanal costeña cheese could potentially reduce S. aureus populations and consequently reduce the risk of food poisoning in exposed consumers.

281

Rev Mex Cienc Pecu 2022;13(1): 272-286

Literature cited: 1.

Hassauer C, Roosen J. Toward a conceptual framework for food safety criteria: Analyzing evidence practices using the case of plant protection products. Saf Sci 2020;127:104683.

Andrade FP, Medeiros BT, Barbosa TW, Silva ME. Fatores que propiciam o desenvolvimento de Staphylococcus aureus em alimentos e riscos atrelados a contaminação: uma breve revisão. Rev Ciênc Méd Biol 2019;18:8993.

Arteaga MR, Hernández HL, Peñate CD. Elaboración de un queso procesado tipo untable obtenido a partir de queso costeño. Inf Tecnol 2020;31:187-194.

ICONTEC. Instituto Colombiano de Normas Técnicas. NTC 750. Norma Técnica Colombiana sobre productos lácteos: Queso, 1-15, Colombia. 2009.

Ruíz RA, Menco NY, Chams LM. Valoración microbiológica de queso costeño artesanal y evaluación higiénico-locativa de expendios en Córdoba, Colombia. Rev Salud Pública 2017;19:311-317.

Acosta IP, José GG. Staphylococcus aureus procedentes de quesos costeños de Valledupar; susceptibilidad a antibióticos y perfil plasmídico. Rev Méd Risaralda 2019;25:14-14.

Sánchez MA, Salgado MT, San-Miguel Á, Pachón Jesús, Rodríguez E, Pastor MR, Cabrero P. Nisina (N 234), aditivo utilizado como conservante en alimentos. Gac Med Bilbao 2019;116:166-173.

Cano D, Gómez MA, Oviedo V, Rios LA. Nisina como conservante de alimentos: revisión sistemática de la literatura. Hechos Microbiol 2015;6:52-64.

Yolanda H, Krajaejun T. Review of methods and antimicrobial agents for susceptibility testing against Pythium insidiosum. Heliyom 2020;6e03737.

10. Abdel-Hameid AA, Saad NM, Valero A, Mahmoud S. Incidence of enterotoxigenic Staphylococcus aureus in milk and Egyptian artisanal dairy products. Food Control 2019;104:20–27.

282

Rev Mex Cienc Pecu 2022;13(1): 272-286

11. Silva N, Taniwaki MH, Junqueira VCA, Silveira NFA, Okazaki MM, Gomes RAR. Microbiological examination methods of food and water: a laboratory manual. 2nd ed. London, UK: Taylor & Francis Group; 2019. 12. Løvseth A, Loncarevic S, Berdal KG. Modified multiplex PCR method for detection of pyrogenic exotoxin genes in staphylococcal isolates. J Clin Microbiol 2004;42:3869– 3872. 13. Shehu HA, Mukhtar AG, Adetoyinbo II, Ojo AO, Mus’ab UA. Phytochemical screening and antibacterial activities of cassia fistula leaf extracts on some selected pathogens. Int J Pharmacon Phytochem Res 2020;9:1779-1783. 14. ASM. American Society for Microbiology. Kirby-bauer disk diffusion susceptibility test protocol. 2016. 15. Marvdashti LM, Yavarmanesh M, Koocheki A. Controlled release of nisin from polyvinyl alcohol - Alyssum homolocarpum seed gum composite films: Nisin kinetics, Food Biosci 2019;28:133-139. 16. Zhao X, Chen L, Zhao L, He Y, Yang H. Antimicrobial kinetics of nisin and grape seed extract against inoculated Listeria monocytogenes on cooked shrimps: Survival and residual eﬀects. Food Control 2020;115:1-13. 17. Pardo ME, Almanza F. Guía de procesos para la elaboración de productos lácteos. 1era ed. Bogotá, Colombia: Convenio Andrés Bello (CAB). 2005. 18. ICONTEC. Instituto Colombiano de Normas Técnicas. NTC 4978. Leche y productos lácteos. Determinación de la acidez titulable (Método de referencia). 2001. 19. FAO - OMS. Organización de las Naciones Unidas para la Alimentación y la Agricultura - Organización Mundial de la Salud. Codex Alimentarius. Leche y productos lácteos. Segunda ed. Roma. 2011. 20. Lawless HT, Heymann H. Sensory evaluation of food. Principles and practices. 2nd ed. New York, USA: Springer; 2010. 21. Ramírez L, Marin D. Metodologías para evaluar “in vitro” la actividad antibacteriana de compuestos de origen vegetal. Scientia et Technica 2009;15:263-268.

283

Rev Mex Cienc Pecu 2022;13(1): 272-286

22. MINSALUD. Ministerio de Salud y Protección Social. Decreto 616 del 2006. Reglamento Técnico sobre los requisitos que debe cumplir la leche para el consumo humano que se obtenga, procese, envase, transporte, comercialice, expenda, importe o exporte en el país. Bogotá, 2006. 23. INS. Instituto Nacional de Salud. Boletín Epidemiológico Semana 52. ETAS. 2018. 24. Martínez A, Ribot A, Riverón Y, Remón-Díaz D, Alelí Y, Jacsens L, Uyttendaele M. Staphylococcus aureus in the production chain of artisan fresh cheese. Rev Salud Anim 2019;41:2224-4700. 25. Mehramuz B, Taghizadeh S, Kafil HS, Zonouzaq GY, Khiabani MS, Sheikhsaran E, Mokarram RR, Dehghani L. High rate of contamination with Staphylococcus aureus in traditional Koozeh cheeses. A molecular typing approach. Ann Ig 2020;32:178-185. 26. Ferreira G, De Santa Helena AA, Madeira JT, Andrade JS, Mangiavacchi BM, Blanco PR, Neres A. Occurrence of Escherichia coli and Staphylococcus aureus in artisanal minas fresh cheeses produced in the rural area of the Baixada Fluminense region, Province of Rio de Janeiro, Brazil. WJPPS 2020;9:492-503. 27. Ganz K, Yamamoto E, Hardie K, Hum C, Hussein H, Locas A, Steele M. Microbial safety of cheese in Canada. J Food Microbiol 2020;321:1-7. 28. Silva TJ da, Silva AC da, Matos LG de, Silva M da, Camargo CH, Cobo R, Mores VL, Cirone NC. Enterotoxigenic potential and molecular typing of Staphylococcus sp. isolated from organic and conventional fresh minas cheese in the state of São Paulo, Brazil. Int Dairy J 2020;102:1-8. 29. Donnelly C. Review of controls for pathogen risks in Scottish artisan cheeses made from unpasteurised milk. Food Standards Scotland. Inbhe Bidh Alba. Report v 4.7. 2018. 30. Sobral D. Efeito da nisina na contagem de Staphylococcus aureus e nas características do Queijo Minas Artesanal da Região de Araxá. [Tesis doctoral]. Viçosa, Minas Gerais, Brazil: Universidad Federal de Viçosa; 2012. 31. Sobral D, Soares M, Martins VA, Bueno RG, Jacinto JC, Fernandes A, Machado GM. Nisin reduces the Staphylococcus aureus count without changing the characteristics of Artisanal Minas Cheese from Araxá. Rev Inst Laticínios Cândido Tostes, 2019;74:185196.

284

Rev Mex Cienc Pecu 2022;13(1): 272-286

32. Felicio BA, Pinto MS, Oliveira FS, Lempk MW, Pires ACS, Lelis CA. Effects of nisin on Staphylococcus aureus count and physicochemical properties of Minas frescal cheese. J Dairy Sci 2015;98:4364–4369. 33. Campo MC. Determinación del efecto de una bacteriocina adicionada en queso costeño sobre Staphylococcus aureus [tesis Bacteriología] Montería, Córdoba, Colombia: Universidad de Córdoba; 2010. 34. López MC. Aplicación de bacteriocinas para la bioprotección de alimentos [tesis doctoral] Andalucía, España: Universidad de Jaén. 2017. 35. Rodríguez MR. Variabilidad de la inactivación microbiana y de la fase de latencia de los microorganismos supervivientes a un proceso de acidificación [tesis doctoral] Madrid, España: Universidad Complutense de Madrid. 2016. 36. FDA. Food and Drug Administration. Kinetics of microbial inactivation for alternative food processing technologies. Overarching principles: kinetics and pathogens of concern for all technologies. J Food Sci 2000;65:1-118. 37. Jaiswal AK, Jaiswal S. Modelling the effects of natural antimicrobials as food preservatives. In: Taylor M. Handbook of natural antimicrobials for food safety and quality. 1rst ed. Cambridge, UK: Woodhead Publishing Limited;2014:259-284. 38. Ha J, Lee J, Lee S, Kim S, Choi Y, Oh H, Kim Y, Lee Y, Seo Y, Yoon Y. Mathematical models to describe the kinetic behavior of Staphylococcus aureus in Jerky. Food Sci Anim Resour 2019;39:371-378. 39. Serpa JG, Pérez TI, Hernández EJ. Effect of pasteurization and starter cultures on physicochemical and microbiological properties of costeño cheese. Rev Fac Nac Agron 2016;69:8007-8014. 40. INS. Instituto Nacional de Salud. Identificación de riesgos biológicos asociados al consumo de leche cruda bovina en Colombia. 2011. 41. Jensen C, Li H, Vestergaard M, Dalsgaard A, Frees D, Leisner J. Nisin damages the septal membrane and triggers DNA condensation in Methicillin-Resistant Staphylococcus aureus. Front Microbiol 2020;11:1007. 42. Heredia-Castro PY, Hérnández-Mendoza A, González-Córdova AF, Vallejo-Cordoba B. Bacteriocinas de bacterias ácido lácticas: mecanismos de acción y actividad antimicrobiana contra patógenos en quesos. Interciencia 2017;42:340-346.

285

Rev Mex Cienc Pecu 2022;13(1): 272-286

43. Coronado EP, Espitia R. Estudio del efecto de una película antimicrobiana en la vida útil del queso costeño [tesis Ingeniería de alimentos]. Berástegui, Colombia: Universidad de Córdoba; 2015. 44. Serra MÁ. La resistencia microbiana en el contexto actual y la importancia del conocimiento y aplicación en la política antimicrobiana. Rev Habanera Cienc Médi 2017;16:402-419. 45. FAO. Food and Agriculture Organization of the United Nations. Disposiciones sobre la ciclotetraglucosa (sin1504 i), El jarabe de ciclotetraglucosa (sin 1504 ii) y la nisina (sin 234). Programa conjunto FAO/OMS sobre normas alimentarias Comité del Codex sobre aditivos alimentarios. 47.ª reunión. Xi'an, China, 23 – 27 de marzo de 2015. 46. Araujo D, Ávila L, Jiménez Y. Nisina: una bioalternativa para la reducción de las intoxicaciones alimentarias en el caribe colombiano. Lasirc 2020;1:59-64.

286

https://doi.org/10.22319/rmcp.v13i1.5784 Technical note

Backyard eggs: an income opportunity window in communities in Texcoco, Mexico

Juan Hernández Ortiz a Olga Jacqueline Galicia Rojano a Enrique Melo Guerrero b* Ramón Valdivia Alcalá a Luis Manuel Valenzuela Núñez c

Universidad Autónoma Chapingo. División de Ciencias Económico Administrativas. Km. 38.5 Carretera México – Texcoco, 56230. Chapingo Texcoco, Estado de México. México. b

Universidad Autónoma del Estado de Hidalgo. Instituto de Ciencias Agropecuarias, Hidalgo, México. c Universidad Juárez del Estado de Durango. Facultad de Ciencias Biológicas, Laboratorio de Biología y Ecología Forestal. Durango, México.

*Corresponding author: emelogro@yahoo.com.mx

Abstract: Backyard egg production provides food and extra income to rural families. The resulting eggs are produced under conditions analogous to organic eggs, suggesting the possibility of a price premium for backyard eggs. The contingent valuation method was applied in a willingnessto-pay study of backyard eggs in four locations in the State of Mexico, Mexico. Results of a survey of 126 heads-of-household was analyzed using a binomial logit model. Most (70 %) interviewees were willing to pay a premium of 25 % for backyard eggs over the price for commercial eggs. The most significant variables were health awareness, fruit and vegetable consumption, monthly income and age. In the study area, backyard eggs could be sold at a premium price, potentially providing greater income to the rural families producing them. 287

Rev Mex Cienc Pecu 2022;13(1):287-296

Key words: Willingness to pay, Backyard eggs, Binomial logit, Contingent valuation.

Received: 28/08/2020 Accepted: 22/04/2021

Due in part to their high protein index and broad availability, eggs are one of the primary agricultural products of the human diet(1,2). In Mexico, eggs are the cheapest and most complete protein source(2), and have become the most accessible animal source protein(3). Per capita egg consumption in Mexico in 2012 was 20.8 kg, one of the world’s highest(2). By 2016, it had increased to 23.1 kg, representing an average annual growth rate of 1.5 % from 1994 to 2016(4). More current egg consumption data from the National Poultry Producers Union (Unión Nacional de Avicultores) shows that consumption remained at 23 kg per capita in 2020(5), keeping Mexico in first place worldwide. The primacy of eggs in the Mexican diet can be linked to factors such as high poverty rates and their continued status as the relatively lowest-priced animal protein, which is a consequence of technological improvements, genetic selection, and laying hen nutrition and health(1,6,7). Increases in egg consumption have essentially plateaued, and any future growth in total demand will be driven be population growth. Slower growth in the egg market will disproportionately affect small and medium-sized producers, who will be unable to compete with the economies of scale available to large companies. Product differentiation is one possible strategy for small and medium-sized producers to remain viable(8). Niche markets for differentiated eggs do exist in Mexico. These include eggs with higher nutrient content (mainly fatty acids, omega 3, vitamins and minerals), and eggs produced using specific systems such as a vegetarian diet, organic inputs, and free-range and cage-free systems, among others. In some cases, the price premium for these alternative products is triple that of generic or commercial eggs(8). Homegrown, or backyard, eggs produced at a very small scale using locally-adapted chickens can be considered a differentiated product. The hens (Gallus gallus domesticus) involved are an indeterminate mixture of breeds of different origins that have been adapted to rustic conditions through extensive backyard management(9). Diet in these systems consists of free grazing or semi-grazing supplemented in some cases with grains, kitchen waste and harvest residues, and essentially free of chemicals(10,11). Eggs from these systems have distinct organoleptic characteristics, are perceived by consumers as being healthier(9), and share some characteristics with organic eggs; the difference being that the latter are subject to a certification process(12).

288

Rev Mex Cienc Pecu 2022;13(1):287-296

Backyard eggs are largely produced on family poultry farms mainly located in rural and periurban areas. In Mexico, more than 80 % of rural families keep chickens in their backyards(13). The resulting egg production is mostly used for a family’s subsistence. However, surpluses are sold in local markets, or among relatives and neighbors, frequently at prices higher than commercial eggs, and thus represent a supplemental income source(8,9). Existence of a premium for natural or organic products is due to their higher production and processing costs, but also to the higher level of utility they represent for consumers, who perceive them as higher quality, more beneficial to health or environmentally-friendly(14,15). Backyard eggs may therefore have a potentially higher market value than commercial eggs because consumers perceive them as having characteristics similar to those of organic eggs. This perception may translate into a willingness-to-pay (WTP) a premium over the price of commercial eggs, depending on consumer age, number of members per family unit, income level, health awareness and fruit and vegetable consumption. The present study objective was to quantify willingness-to-pay a premium for backyard eggs in four locations in Texcoco Municipality, State of Mexico, Mexico, using the contingent valuation method, with the goal of generating useful data for backyard poultry farmers and proposing a better substantiated sale price to the public. The study was done in four towns (San Bernardino, San Miguel Coatlinchán, Montecillos and San Luis Huexotla) in the east of the State of Mexico where backyard poultry farming still occurs. The contingent valuation method (CVM) was applied, which is based on construction of a hypothetical market through application of surveys in which individuals express their WTP for a certain benefit in a specific product. The referendum type format was used, which is the most common format used in CVM(16). In this format the interviewee decides the premium amount determining their WTP, in this case for the differentiated product. The model’s dependent variable is the individual’s utility (U), and the independent variables are backyard egg consumption (Q), income (Y) and a vector of variables (S): U = f (Q, Y, S). Initial utility (U0) corresponds to a state of non-consumption of backyard eggs (Q0) which can change to (U1) through consumption (Q1). An additional amount (P) must be paid for this consumption, which comes from disposable income (Y). If the consumer agrees to pay “P” to maintain the proposed scenario, then the following must be true: V1(Q = 1, Y- P; S) – V0(Q = 0, Y; S)> e0 – e1(16); where e0 and e1 are assumed to be independent and identically distributed random variables. The change in U is equal to the difference between the final and initial utilities. The interviewer must propose a certain amount to be paid to arrive at the final situation. The general logistic model is expressed as: 289

Rev Mex Cienc Pecu 2022;13(1):287-296

Prob(Si)=Prob(V1-V0>η)=prob(α–βP)>η)=

1 1+exp(−α+βP)

Calculation of WTP was done using a binomial logit model estimated by maximum likelihood with the NLOGIT version 4.1 program. This was then used to estimate the variable parameters explaining interviewee WTP. The econometric model applied was: PrOb(Si)= α + β1(SPrec) + β2(CSal) + β3(FVer) + β4(Edd) + β5(IntF) + β6(Ing) + ε Where the binary dependent variable PrOb(Si) represents the probability of a “Yes” answer to the question of willingness to pay for the differentiated product, which depends on the hypothetical premium to be paid (SPrec), health awareness (CSal), fruit and vegetable consumption in home [(FVer) as an indicator of healthy eating habits], interviewee age (Edd), number of family members (IntF) and income level (Ing). Unobservable error is represented by ε. The explanatory variables were obtained directly from the survey, which was applied in July 2018. A total of 126 valid interviews were conducted through random sampling with an infinite population. Five price levels (Mexican pesos - MXP/kg) were used: $25, $27, $29, $31, and $33. The first corresponded to the price of backyard eggs in the region at the time of the survey, which was slightly higher than the $23 charged for commercial eggs. The methodology involves three stages: questionnaire design, survey application and data analysis using econometric methods. The questionnaire was designed considering recommendations for revealed preference assessment methods focused on consumption preferences and willingness-to-pay(17,18). It was organized into three sections(19). The first included closed questions about knowledge and perception of the products to be assessed, in this case backyard eggs (a natural product obtained without the use of chemicals which shares some aspects with organic eggs). In the second, the interviewee was asked about their WTP, and in the third about socioeconomic information. The WTP item was: “Based on your income level, expenses and preferences, would you be willing to pay ___ pesos for one kilogram of backyard eggs, which, according to production management techniques, share some characteristics with organic products (without being one), and is produced in different locations in Texcoco Municipality, State of Mexico?” Of the total number of interviewees, three quarters were women, with a mean age of 48 yr and an education level of 9.0 yr (junior high); the latter is lower than the 9.7 average for Texcoco municipality and the 9.1 for the state(19). About half of the interviewees fell within the 2,500 to 3,000 MXP monthly income bracket, and another third were within the 3,000 to 5,000 MXP bracket. According to the National Council for the Evaluation of Social Policy

290

Rev Mex Cienc Pecu 2022;13(1):287-296

(Consejo Nacional para la Evaluación de la Política Social - CONEVAL)(20), more than half the interviewees can be classified as in conditions of food poverty. Interviewee perceptions of backyard egg attributes showed that most had no knowledge of natural, chemical-free products, one third stated they had some idea as to what they are, and less than 10 % clearly understood what they are. When an explanation was provided of the characteristics of this product type and that backyard eggs can fulfill several characteristics of an organic product, 70 % of the interviewees indicated they were willing to pay a premium for backyard eggs. These results document behavior similar to that reported in a study of WTP for organic tortillas in which only 28 % of interviewees knew about the organic product in question, but, after an explanation of what it was, three quarters were willing to pay a premium price for the product(15). Of the 126 interviewees, almost two thirds stated that at some point they had consumed backyard eggs; of these, 79 % rated product quality as good to very good and 21 % as fair. One important result was that just over a quarter (28 %) of those who consume backyard eggs produce them in their backyards and 88 % of those who buy them do so at the home of a relative or friend. There was also a clear preference for backyard eggs since, under the condition that the price of backyard eggs was the same as commercial eggs, 83 % of the interviewees would prefer backyard eggs while 17 % would prefer commercial ones. These consumption preferences are consistent with those documented in rural locations, where people generally prefer backyard eggs to commercial eggs(12). The goodness-of-fit indicators for the results were within acceptable ranges. The McFadden R2 was 0.187, acceptable for this model, close to the recommended value range for this type of research (0.20 to 0.40) and equivalent to an R2 of 0.70–0.90 for an ordinary least squares regression(16,21). Restricted and unrestricted likelihood were used for the dependency test and produced a value of 28.41. This represents an acceptable χ2 dependency test, and confirms the hypothesis that the model slopes are equal to zero (P≤0.05). The most significant variables (P≤0.05) were income level, fruit and vegetable consumption, and age. The least significant variable was number of family members (Table 1).

291

Rev Mex Cienc Pecu 2022;13(1):287-296

Table 1: Binomial logit model results Variable Label Coefficient Constant Const 1.836551 Premium SPrec -0.168070* Fruit and vegetable consumption FVer 1.088604** Health awareness CSal 0.969891* Age Edd 0.369013** Family members IntF -0.148933 Income Ing 0.791453**

SE1 3.0493 0.0909 0.5008 0.5656 0.0172 0.1468 0.3498

χ2= 28.41933; Restricted likelihood logarithm = -75.92961; Unrestricted likelihood logarithm = -61.7199; McFadden pseudo R2 = 0. 1871426. 1 SE = Standard error. ***P≤0.001; ** P≤0.005; * P≤0.01.

Model prediction tests produced a value of 79.20 %, indicating the model to be adequate for quantifying backyard egg WTP. The following model was built using variables coefficients (Table 2):

Variable

Table 2: Variable marginal effects and elasticity Marginal effect Elasticity

Prec CSal FVer Edd IntF

-0.02993 0.19998 0.22056 0.00657 -0.02652

-1.12987373 0.21867067 0.22050975 0.39705464 -0.13837615

Ing

0.14094

0.34052117

DAP= 1.836 – 0.168Prec + 1.088FVer + 0.969CSal + 0.369Edd – 0.148 IntF + 0.791Ing.

The price (Prec) variable coefficient was negative, indicating that as the price of backyard eggs increases consumers will be less willing to pay the premium. In contrast, the variables related to good eating habits and interviewee health awareness exhibited a positive coefficient, reflecting consumer WTP for backyard eggs. This result is consistent with willingness-to-pay research on organic products, which shows that lifestyle variables tend to have a greater influence than socioeconomic variables(15,22,23). The values consumers consider when making decisions about consumption include (in descending order of importance) health, nutrition, environmental friendliness and animal welfare(24). Also positive was the age (Edd) variable coefficient, indicating that older interviewees were more willing to pay for backyard eggs. This agrees with WTP research(14,25), showing that consumer behavior is affected by age in purchases of differentiated products(14,15). The

292

Rev Mex Cienc Pecu 2022;13(1):287-296

income (Ing) variable coefficient was positive, meaning higher interviewee income level was linked to a greater WTP for backyard eggs. Since economic conditions tend to change constantly, the marginal effects and WTP elasticities were calculated for each explanatory variable in the econometric model (Table 2). Variable elasticities were linked to lifestyle (health awareness and fruit and vegetable consumption). This means that as the value of each of these variables increases by one percent, the rest of the variables being constant, WTP probability increases by 0.21 (health awareness) and 0.22 % (fruit and vegetable consumption). The relationship is inverse for the price variable, indicating that, when the price of backyard eggs rises by one percentage point, the WTP probability decreases by 1.12 %. The remaining variables are interpreted in the same way. To calculate WTP, it was estimated for each interviewee, using to the formula(26): WTP =

α + β2(CSal) + β3(FVer) + β4(Edd) + β5(IntF) + β6(Ing) β1(SPrec)

The resulting estimated WTP for one kilogram of backyard eggs in the surveyed communities was $28.75 pesos, with a confidence interval of ($27.5 ≤ 𝜇 ≥ $29.9) MXP and 95 % reliability. This represents a 25 % premium on the price of one kilogram of commercial eggs ($23 pesos), and 15 % premium on the actual price of backyard eggs ($25 pesos) at the time of the survey. Analogous studies of WTP for differentiated products in Mexico have reported a 16 % premium for organic rabbit meat in Iztapalapa(27), and for organic tortillas in Puebla(15). Even higher premiums have been reported elsewhere: 30 % for organic apples in Santiago de Chile(28); 53 % for lettuce in Texcoco, Mexico(29); and 88 % for a variety of cabbage in Thailand(30). Myriad factors affect a product’s price premium, including the product studied, and consumer educational level and socioeconomic status, among many other factors. Most of the respondents in the present study said they were willing to pay a higher price for backyard eggs versus commercial eggs; the variables affecting this WTP were health awareness, fruit and vegetable consumption, monthly income and age. Variables related to eating habits and health awareness were more influential than socioeconomic variables. These results suggest a possible market niche for backyard eggs focused on older consumers in higher income levels.

293

Rev Mex Cienc Pecu 2022;13(1):287-296

Literature cited: 1. Torre MM, Fonseca PM, Quintana LJ. El huevo mitos, realidades y beneficios. México, DF.: Trillas; 2012. 2. Cruz-Jiménez S, García MR, Mora JSF, García RCS. El mercado de huevo para plato en México, 1960-2012. Agr Soc Des 2016;13:385-399. 3. Luis-Rojas S, García-Sánchez RC, García-Mata R, Arana-Coronado OA, GonzálezEstrada A. Metodología Box - Jenkins para pronosticar los precios de huevo blanco pagados al productor en México. Agro 2019;53:911-925. 4. UNA Unión Nacional de Avicultores. Compendio de Indicadores Económicos del Sector Avícola. México: UNA; 2016. 5. UNA. Unión Nacional de Avicultores Situación de la Avicultura Mexicana: Expectativas 2021. https://una.org.mx/industria/# Consultado 8 Abr, 2021. 6. Li Y, Luo C, Wang J, Guo F. Effects of different raising systems on growth performance, carcass, and meat quality of medium-growing chickens. J Appl Anim Res 2017;45(1): 326-330. 7. Khawaja T, Khan SH, Mukhta N, Ali MA, Ahmed T, Ghafa A. Comparative study of growth performance, egg production, egg characteristics and haematobiochemical parameters of Desi, Fayoumi and Rhode Island Red chicken. J Appl Anim Res 2012;40 (4):273-283. 8. Mendoza RY, Brambila PJJ, Arana CJJ, Sangerman-Jarquin DM, Molina GJN. El mercado de huevo en México: tendencia hacia la diferenciación en su consumo. Rev Mex Cien Agr 2016;7(6):1455-1466. 9. Juárez-Caratachea A, Gutiérrez-Vázquez E, Segura-Correa J, Santos-Ricalde R. Calidad del huevo de gallinas criollas criadas en traspatio en Michoacán, México. Trop Subtrop Agro 2010;12:109-115. 10. Juárez, CA, Pérez TJ. Comportamiento de la parvada de gallinas en condiciones naturales del medio rural. Cien Nic 2003;35:73-80. 11. Gutiérrez-Triay M, Segura-Correa JC, López-Burgos L, Santos-Flores J, Santos-Ricalde RH, Sarmiento-Franco L, et al. Características de la avicultura de traspatio en el municipio de Tetiz, Yucatán, México. Trop Subtr Agro 2007;7:217-224.

294

Rev Mex Cienc Pecu 2022;13(1):287-296

12. Del Ángel-Coronel OA, Torres-rivera JA, Ortíz-Rubio LS, Aguas-Hernández MF. Evaluación sensorial, parámetros fisicoquímicos y preferencias de consumo de huevo de gallina de traspatio, orgánico e industrializado en la región cafetalera central de Veracruz, México. Rev Plan Cont Mic 2016;2(3):21-31. 13. Santos R, Hau CE, Belmar R, Armendariz I, Cetina R, Sarmiento L, Segura J. Socioeconomic and technical characteristics of backyard animal husbandry in two rural communities of Yucatan, Mexico. J Agr Rur Dev Trop Subt 2004;105:165-174. 14. Trujillo-Murillo J, Hernández-Ortiz J, Martínez-Damián MA. Disposición a pagar por productos orgánicos en Texcoco, Estado de México. REMEXCA 2019;10(7):16851691. 15. Jaramillo Villanueva JL. Preferencias del consumidor y disposición a pagar por el consumo de tortilla de maíz orgánico. Est Soc: Rev Alim Cont Des Reg 2016;25(47): 143-161. 16. Tudela JW, Damián MA, Valdivia R, Romo JL, Portillo M, Ventura R. Valoración económica de los beneficios de un programa de recuperación y conservación en el Parque Nacional Molino de Flores, México. RChSCFA 2011;17(2):231-244. 17. Mitchell RC, Carson RT. Using surveys to value public goods: The contingent valuation method. Washington, USA: Resources for the Future. 1989. 18. Melo-Guerrero E, Rodríguez-Laguna R, Martínez-Damián MA, Hernández-Ortiz J, Razo-Zárate R. Basic considerations for the application of discrete choice experiments: a review. Rev Mex Cienc For 2020;11(59):1-26. 19. CONEVAL. Consejo Nacional de Evaluación de la Política de Desarrollo Social Informe Anual Sobre la Situación de Pobreza y Rezago Social. http://www.dof.gob.mx/SEDESOL/Mexico_099.pdf Consultado 18 Ago, 2020. 20. CONEVAL. Consejo Nacional para la Evaluación de la Política Social. http://www.coneval.gob.mx/Informes/Coordinacion/Pobreza_2012/COMUNICADO_ PRENSA_003_MEDICION_2012.pdf. 2012 Consultado 14 Ago, 2020. 21. Melo-Guerrero E, Hernández-Ortiz J, Aguilar LA, Rodríguez Laguna R, Martínez DMA, Valdivia AR, Razo ZR. Experimentos de elección para el manejo del Parque Nacional Los Mármoles, México. RChSCFA 2020;26(2):257-272. 22. Gil JM, Gracia A, Sánchez M. Market segmentation and willingness to pay for organic products in Spain. Int Food Agrib Mana Rev 2000;3:207-226. 23. Roitner-Schobesberger B, Darnhofer I, Somsook S, Volg CR. Consumer perceptions of organic foods in Bangkok, Thailand. Food Pol 2008;33(2):112-121. 295

Rev Mex Cienc Pecu 2022;13(1):287-296

24. Shaw D, Grehan E, Shiu E, Hassan L, Thomson J. An exploration of the values in ethical consumer decisión making. J Cons Behav 2005;4:185-200. 25. Medina A, Escalera M, Vega MA. La edad como factor del comportamiento del consumidor de productos orgánicos. Europ Scient J 2014;10(7):21-36. 26. Hanemann M. Welfare evaluations in contingent valuation experiments with discrete responses. Am J Agric Econ 1984;66(1):332-341. 27. Cerda A, García L, Tolosa F, García V. Preferencias y disposición para pagar por manzanas orgánicas en la Región Metropolitana de Santiago de Chile. Rev Fac Agron 2014;31(2):274-289. 28. Jaramillo VJL, Vargas LS, Guerrero RJD. Preferencias de consumidores y disponibilidad a pagar por atributos de calidad en carne de conejo orgánico. Rev Mex Cienc Pecu 2015;6(2):221-232. 29. Trujillo-Murillo J, Hernández-Ortiz J, Martínez-Damián MA. Disposición a pagar por productos orgánicos en Texcoco, Estado de México. REMEXCA 2019;10(7):16851691. 30. Sriwaranum Y, Gan Christopher, Lee M, Cohen DA. Consumers’ willingness to pay for organic products in Thailand. Int J Soc Econ 2009;42(5):480-510.

296

https://doi.org/10.22319/rmcp.v13i1.5265 Technical note

Forage yield and digestibility of Urochloa spp. cultivars at three regrowth ages in the rainy and dry seasons in Ecuador

Jonathan Raúl Garay Martínez a Benigno Estrada Drouaillet b Juan Carlos Martínez González b Santiago Joaquín Cancino b* Hernán Patricio Guevara Costles c Marco Vinicio Acosta Jácome d Eugenia Guadalupe Cienfuegos Rivas b

Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias. Campo Experimental Las Huastecas. Tamaulipas, México. b

Universidad Autónoma de Tamaulipas. Facultad de Ingeniería y Ciencias. Tamaulipas, México. c

Escuela Superior Politécnica de Chimborazo. Riobamba, Ecuador.

Universidad Tecnológica Equinoccial, Campus Santo Domingo-Escuela de Ingeniería Agropecuaria, Vía Chone Km. 4 ½ y Av. Italia. 230101. Santo Domingo, Ecuador.

* Corresponding author: sjoaquin@docentes.uat.edu.mx

Abstract: The humid tropics of Ecuador is a potential livestock production area. Urochloa spp. cultivars are a forage option in this region. Environmental and management conditions determine forage yield and nutritional value and should be researched prior to establishing new forage 297

Rev Mex Cienc Pecu 2022;13(1):297-310

species. An evaluation was done of total dry matter yield (TDM; t ha-1), morphological components proportions (%; leaf, stem, dead material and inflorescence) and in situ dry matter digestibility (DMD; g kg-1)) in five Urochloa cultivars (Mulato II, Marandú, Xaraés, Piatá and Señal [control]) and at three regrowth ages (4, 6 and 8 wk) during the rainy and dry seasons. A completely randomized block design in a split plot arrangement was used to analyze the data by season. During the rainy season, TDM did not differ (P>0.05) between cultivars. In the dry season, Marandú had a lower yield than Xaraés (0.92 vs 1.21 t ha-1). Morphological component proportions differed between cultivars (P<0.05), although the leaves contributed the most overall to yield. From four to eight weeks, DMD decreased from 64 to 56 % in the rainy season and from 60 to 56 % in the dry season. The evaluated cultivars exhibited acceptable TDM yields (2.6 t ha-1 in rainy season, 1.0 t ha-1 in dry season) and DMD (602 g kg-1 in rainy season, 574 g kg-1 in dry season). They are adequate forage alternatives for livestock in the humid tropics of Ecuador. Key words: Hybrid Brachiaria, Brachiaria brizantha, Brachiaria decumbens, Rainy season, Dry season, Morphological composition, Nutritional value.

Received: 25/02/2020 Accepted: 22/12/2020

Ruminant livestock systems are based on forage as a low-cost feed source in extensive production systems and as a complement in intensive systems(1). Livestock productivity in the tropical zones of Ecuador is limited by low grassland forage yield. Two Urochloa (Syn. Brachiaria) species U. humidicola and U. decumbens dominate grasslands in Ecuador, but have low forage yield and nutritional value. They are also susceptible to the damaging effects of Aeneolamia spp. insects and foliar fungi such as Rhizoctonia solani, which significantly reduce forage yield(2).

To improve forage quality and increase livestock production, Urochloa cultivars have been selected for their adaptation to soils with poor fertility and toxic aluminum levels, resistance to pests and diseases, and higher forage yield and nutritional value(3). Different Urochloa cultivars have been introduced to overcome the problems observed in U. humidicola and U. decumbens(4). For example, annual dry matter (DM) production in U. hybrid cv. Mulato II and U. brizantha cv. Xaraés ranges from 25 to 30 t ha-1(5,6,7), while in U. decumbens the range is from 11 to 19 t ha-1(8). In studies of U. decumbens, U. hybrid cv. Mulato I and U. humidicola(9,10,11), as well as U. brizantha cv. Marandú and U. hybrid cv. Mulato II(12), total DM production was similar, although differences were observed in morphological 298

Rev Mex Cienc Pecu 2022;13(1):297-310

composition. In some genotypes (Mulato I and II), higher leaf production correlated with higher crude protein content(13). The Mulato II hybrid significantly outperforms other commonly used brachiariae (U. brizantha and U. humidicola) in terms of forage quality due to its 67 % DM digestibility(14); this is notably higher than the 58% DM digestibility of Xaraés and the 43 % of U. decumbens(15).

Genetic composition largely determines a forage species’ productive capacity(2), but environmental factors (climatic conditions) and pasture management modify the expression of foraging behavior and forage nutritional value(16,17). Before introducing a new forage species it is vital to evaluate its agronomic performance under controlled conditions to confirm that it is a viable option for livestock in the region(11). The present study objective was to evaluate forage yield, morphological composition and in situ digestibility of five Urochloa spp. forage cultivars at three regrowth ages, during the rainy and dry seasons in the humid tropics of Ecuador.

The study was carried out under seasonal conditions from December 2011 to November 2012. The experimental site is located in the El Oasis Farm of the School of Agricultural Engineering, Santo Domingo Campus, Equinoctial Technological University (Universidad Tecnológica Equinoccial), Ecuador (00° 13’ 19.70” S; 79° 15’ 39.00” W; 406 m asl). Local soils are classified as Andisol, with a 5.9 pH and 2.2 % organic matter content. The soil mineral profile consists of NH4 (41.0 mg kg-1), P (6.5 mg kg-1), S (6.3 mg kg-1), Fe (42.0 mg kg-1), K (0.3 cmol kg-1), Ca (8.3 cmol kg-1) and Mg (2.9 cmol kg-1). In the Köppen classification system, regional climate is tropical monsoon (Am), characterized by two welldefined periods or seasons: rainy (January to June) and dry (July to December). This is clearly reflected in the average monthly rainfall and temperatures (maximum and minimum) recorded during the experimental period, and average monthly rainfall from 2000 to 2012 (Figure 1).

299

Rev Mex Cienc Pecu 2022;13(1):297-310

Figure 1: Rainfall and temperature during experimental period, and average rainfall from 2000-2012

Two factors were studied: 1) cultivars, U. brizantha (Marandú, Piatá and Xaraés), the Mulato II hybrid (U. ruziziensis X U. brizantha) and U. decumbens as a control; and 2) regrowth age, 4, 6 and 8 wk. Harvest of each of the three genotypes was done at each regrowth age during both the rainy (13 March to 12 May, Tmin=20.8 °C, Tmax=28.6 °C; accumulated rainfall = 1,733 mm) and dry seasons (7 September to 3 November, Tmin=19.2 °C, Tmax=28.1 °C; accumulated rainfall = 39 mm).

Commercial seed was sown on 17 December 2011. Emergence of at least one plant was guaranteed by planting three seeds each in black polyethylene bags (approximate 2 kg) containing soil from the experimental site. Seven weeks after planting (4 February 2012), the plants were transplanted to 5×5 m plots (25 m2) with 0.5 m between plants and rows (total = 40,000 plants ha-1). Within each plot the effective area was 9 m2, which encompassed 7, three-meter-long rows containing 7 plants each. Three of the plants in each row were randomly selected for harvest at each regrowth age. At the time of transplanting, all plots were fertilized: 120 kg ha-1 N (Urea, FERTISA S.A., Ecuador); 60 kg ha-1 P2O5 (DAPHOS, Tecnifertpac S.A., Ecuador); 70 kg ha-1 K2O (potassium muriate, FERTISA S.A., Ecuador); 60 kg ha-1 Mg (magnesium oxide, Interfilk S.A., Ecuador); and 50 kg ha-1 SO4 (ammonium sulfate, FERTISA S.A., Ecuador).

300

Rev Mex Cienc Pecu 2022;13(1):297-310

The rainy season evaluation was begun on 17 March 2012, six weeks after transplanting, by making a uniform cut 15 cm above ground level. At the end of the rainy season, the plots were allowed to recover to avoid overlap between seasons and prevent confounding effects. The dry season evaluation was begun on 7 September 2012, by making a uniform cut 15 cm above ground level. For each sampling (4, 6 and 8 wk in both seasons), all the forage present in the 3 m effective area (i.e. seven plants) was harvested at 15 cm above ground level and weighed on a precision scale (Model PB3002-S, Mettler Toledo®, Switzerland) at the time of cutting (green matter). Samples were dried in a forced-air oven (Model 100-800, Memmert, Germany) at 65 °C for 48 h to estimate dry matter (DM) content. Two subsamples of approximately 0.2 and 1.0 kg were taken. The first was separated into morphological components (leaf, stem, dead material and inflorescence) and the second used for chemical and in situ digestibility analysis.

The variables evaluated included total dry matter yield (TDM; t ha-1) and the DM proportion (%) of each morphological component: leaf (DMl), stem (DMs), dead material (DMd) and inflorescence (DMi). Total dry matter (TDM), the neutral detergent fiber (NDF), acid detergent fiber (ADF) and lignin (Lig) contents (g kg-1) of the TDM were measured with an ANKOM fiber analyzer (ANKOM 200/220®) following ANKOM Technology protocols(18). In situ DM digestibility (DMD; g kg-1) was quantified using the technique of Vanzant et al(19). For the DMD analysis, samples were ground to a 2 mm particle size and 4 g sample (DM) placed in a 15×7 cm nylon bag (50 ± 10 µm pore size) tied to a metal chain. By means of a ruminal cannula, the samples were incubated for 48 h in three Holstein cows (560 ± 23 kg) feeding in Lolium perenne pastures and with free access to water. The samples were removed and washed with running tap water until the effluent became clear. They were dried in a forced-air oven at 65 °C for 48 h and weighed on an analytical scale.

The data were analyzed by season in a completely randomized design with four replicates and a divided plot arrangement; the large plot was cultivar and the small plot was regrowth age. Treatment means were compared with a Tukey test (α=0.05). The statistical analyses were run with the GLM procedure in the SAS program(20).

During the rainy season, regrowth age positively influenced forage yield (P<0.05), increasing from 1.14 (4 wk) to 4.23 (8 wk) t DM ha-1 per cut. At 4 weeks’ regrowth, the Marandú cultivar had the lowest TDM yield (0.79 t ha-1)(P<0.05), but at wk 6 and 8 TDM did not differ (P>0.05) between cultivars. As a result, average regrowth age TDM yield (2.64 t ha-1) did not differ (P˃0.05) between the evaluated cultivars. During the dry season, the Marandú cultivar had lower (P<0.05) TDM values than the Xaraés cultivar (0.92 vs 1.21 t ha-1; Table

301

Rev Mex Cienc Pecu 2022;13(1):297-310

1). Overall forage yield decreased 60 % from the rainy season (2.64 t ha-1) to the dry season (1.05 t ha-1).

Table 1: Total dry matter yield (t ha-1) of five Urochloa cultivars at three regrowth ages in the rainy (March-May) and dry (September-November) seasons Rainy season Cultivar

Dry season

Regrowth age (weeks)

Regrowth age (weeks) Average

4 Señal

Average

0.88 bc 2.71 a 4.22 a 2.60

a 0.41 a

0.77 ab 1.98 ab 1.05 ab

Marandú 0.79 c

2.55 a 3.90 a 2.41

a 0.43 a

0.71 b

1.62 b

Mulato II 1.28 a

2.32 a 4.17 a 2.59

a 0.28 b

0.64 b

1.92 ab 0.95 ab 1.97 ab 1.10 ab

Piatá

1.16 ab 2.31 a 4.39 a 2.62

a 0.40 ab 0.94 a

Xaraés

1.58 a

2.80 a 4.47 a 2.95

a 0.41 a

Average

1.14 C

2.54 B 4.23 A

0.83 ab 2.39 a

0.92 b

1.21 a

0.38 C 0.78 B 1.98 A

Within each season, different letters in the same column (a, b, c) or the same row (A, B, C) indicate statistical difference (Tukey; P=0.05).

The observed TDM accumulation was similar to that reported in a study of different U. humidicola (Rendle) Schweick cultivars during the dry season (average rainfall = 50 mm) in which no differences were found in TDM yield between cultivars(10). Climate factors such as rainfall and temperature significantly influence forage biomass production(21,22), and yield can drop as much as 50 % during the dry season(23). This is clearly the case in the present study, in which an approximately1700 mm fluctuation in rainfall resulted in an almost 60 % drop in forage TDM.

Morphological composition varied between genotypes within each season (P<0.05). During the rainy season, Señal grass had the highest DMs proportions among the evaluated regrowth ages. Dead matter (DMd) appeared at eight weeks’ regrowth in Señal (9 %), Mulato II (6 %) and Marandú (3 %), but not in the Piatá and Xaraés cultivars. Inflorescence DM (DMi) was only observed in Señal (0.6 % at 4 wk, 1.2 % at 6 wk, 3.5 % at 8 wk) and Piatá (3 % at 8 wk) in this season (Figure 2A).

302

Rev Mex Cienc Pecu 2022;13(1):297-310

Figure 2: Proportion of morphological components in five Urochloa cultivars at three regrowth ages in the rainy (A) and dry (B) seasons

Mul: Mulato II, Mar: Marandú, Xar: Xaraés, Pia: Piatá, Señ: Señal. Within each regrowth age, the bars represent statistical difference (Tukey, P=0.05).

Differentiation in morphological components between cultivars and regrowth periods was less pronounced during the dry season. At 4 wk the proportion of DMl was lowest in Señal (90 %) since it was the only cultivar to exhibit DMs (10 %) at this age. None of the cultivars had DMd at any time and DMi was only observed in Señal at 8 wk (2%; Figure 2B). In both seasons, DMl made the highest contribution to TDM yield, followed by DMs, DMd and DMi.

Season and regrowth age influenced cultivar DM production and morphological composition. The changes observed during the rainy season are the result of a higher tissue turnover rate and active growth, mainly due to moisture availability(24). During the dry season growth decreased(9), stem growth was minimal and therefore DMl constituted the greatest

303

Rev Mex Cienc Pecu 2022;13(1):297-310

contribution to forage yield and caused leaves to be the component that most contributed to TDM yield (Figure 2).

In all the cultivars, DMD during the rainy season only differed (P<0.05) between four and six weeks’ regrowth (Table 2). In the dry season, by contrast, differences (P<0.05) in DMD were observed between six and eight weeks’ regrowth. The overall decrease in DMD from four to eight weeks was 15.9 % (86 g kg-1) in the rainy season and 5.7 % (34 g kg-1) in the dry season. Similar behavior has been reported in U. decumbens, Marandú and Xaraés, in which average DMD was higher during the rainy season (650 vs 620 g kg-1)(21). This discrepancy between seasons might be due to higher production of secondary metabolites (phenylpropanoid conjugates with amines) during the dry season when plants are under stress; these are incorporated into the plant cell wall to increase its rigidity(25,26), consequently decreasing DMD.

Table 2: In situ dry matter digestibility (g kg-1) of five Urochloa cultivars at three regrowth ages during the rainy and dry seasons Rainy season Cultivar

Dry season

Regrowth age (weeks)

Regrowth age (weeks) Average

4 Señal

638

6 ab 581 b

Average

533 a

584 b

598 a 549 b

553 ab 567 bc

621 ab 576 a

622 a

609 a 598 a

609 a

605 a

590 a 571 ab 563 a

574 b

Marandú 670

Mulato II 649

ab 646 a

580 a

625 a

Piatá

647

ab 586 b

565 a

599 ab 595 a 557 b

584 a

579 b

Xaraés

615

533 a

579 b

500 b

543 c

Promedio 644

589 b

A 604 B 558 C

588 a 541 b

596 A 563 B 562 B

Within each season, different letters in the same column (a, b, c) or same row (A, B, C) indicate statistical significance (Tukey; α=0.05).

In situ dry matter digestibility (DMD) was >540 g kg-1 in all genotypes, regardless of season. It was highest in Mulato II and Marandú and lowest in Señal (U. decumbens). These results coincide with an another study in which U. decumbens was found to have lower digestibility than U. brizantha (430 vs. 580 g kg-1)(15). This discrepancy may arise from the fact that U. brizantha develops fibers with lower lignin content and thinner cell walls than U. decumbens(27). The observed progressive decrease in DMD with regrowth period is mainly 304

Rev Mex Cienc Pecu 2022;13(1):297-310

due to plant maturation and the consequent increase in lignin bound to hemicellulose and cellulose(28), which lowers rumen microorganism effectiveness and may reduce forage digestibility(29).

Neutral detergent fiber (NDF), ADF and Lig differed by season (P<0.05) between cultivars and regrowth ages (Table 3). During the rainy season, Xaraés had the highest NDF, ADF and Lig contents (P<0.05). During the dry season, Señal had 25% more Lig (P<0.05) than Mulato II (79 vs. 63 g kg-1). In both seasons, fiber content (NDF and ADF) increased in response to regrowth age from four to eight weeks. In the rainy season, NDF increased (P<0.05) by 3.7 % (25 g kg-1), ADF by 6.1 % (24 g kg-1) and Lig by 30.7 % (17 g kg-1), while in the dry season NDF increased (P<0.05) by 4.8 % (32 g kg-1), ADF by 12.3 % (44 g kg-1) and Lig by 26.9 % (17 g kg-1). This increase in cell wall components and consequent reduction in DMD was probably due to plant maturity(16) and the intrinsic characteristics of each genotype(2,30).

Table 3: Neutral detergent fiber (NDF), acid detergent fiber (ADF) and lignin (Lig) contents in five Urochloa cultivars, at three regrowth ages during the rainy and dry seasons Rainy season Cultivar

Dry season

Regrowth age (weeks)

Regrowth age (weeks) Average

Average 4

NDF (g kg-1) Señal

659 ab 681 a

691 b

677 c

Marandú

669 ab 683 a

692 b

682 bc 656 ab 678 a

691 ab 675 a

Mulato II

649 b

660 a

660 c

656 d

619 b

661 a

669 b

650 b

Piatá

678 ab 683 a

712 a

691 ab 682 a

686 a

696 a

688 a

Xaraés

694 a

718 a

702 a

680 a

696 a

687 a

Average

670 B 680 B 695 A

658 C 675 B 690 A

Señal

387 b

381 b

352 b

Marandú

399 b

397 ab 410 b

402 b

346 bc 391 a

Mulato II

360 c

375 b

375 c

331 c

374 b 380 b

Piatá

395 b

388 ab 427 ab 403 b

379 a

393 a

399 ab 390 ab

Xaraés

417 a

422 a

377 a

403 a

411 a

693 a

646 ab 670 a

685 a

696 a

671 a

ADF (g kg-1) 409 bc 392 b

388 c

445 a

428 a

305

394 a

414 a

387 bc

402 ab 380 c 361 d

397 a

Rev Mex Cienc Pecu 2022;13(1):297-310

Average

392 B 393 B 416 A

357 C 391 B 401 A

Lig (g kg-1) Señal

Marandú

cd 78

cd 62

ab 71

Mulato II

Piatá

bc 83

bc 63

bc 70

Xaraés

103 a

bc 70

Average

C 74

C 69

B 85

B 80

Within each season, different letters in the same column (a, b, c, d) or the same row (A, B, C) indicate significant difference (Tukey; α=0.05).

The NDF and ADF contents observed here at six weeks in both seasons (rainy and dry) are similar to those reported previously at 40 days’ regrowth for three cultivars: Marandú (680 and 396 g kg-1), Xaraés (700 and 400 g kg-1) and Piatá (670 and 370 g kg-1)(31). However, the present Lig values are higher than those reported in the same previous study at 40 days’ regrowth for Marandú (45 g kg-1) and Piatá (43 g kg-1)(31). Both season and regrowth age affect cell wall components; for example, at 24 days’ regrowth NDF was lower during the rainy season than in the dry season in U. decumbens (610 vs 690 g kg-1) and U. brizantha cv. Xaraés (690 vs 710 g kg-1), as was ADF (U. decumbens, 230 vs 340 g kg-1; and U. brizantha cv. Xaraés, 430 vs 510 g kg-1)(21). Cultivar can also affect these variables; in the present results, during the rainy season the Xaraés cultivar had the highest NDF, ADF and lignin contents, and lowest DMD, while the Mulato II cultivar had the lowest values for these cell wall components and the highest DMD. Lignin interferes with the use of digestible energy and is considered an antinutritional component(29). This is because in grasses, unlike in legumes, a greater proportion of lignin is bound to hemicellulose and cellulose(32), which prevents microbial action, lowering forage digestibility(28). Lignin content can also increase when plants experience stress due to high temperatures. They protect themselves through the structural mechanism of increasing cell walls (which are mainly lignin), thus reducing forage digestibility(25).

Lack of precipitation during the dry season negatively affected all the evaluated variables. Regrowth age significantly affected yield, morphological composition, fiber content and in situ dry matter digestibility. All the cultivars exhibited acceptable dry matter production per cut in both seasons even though the grasslands were recently established. The in situ digestibility values in the Mulato II and Marandú cultivars remained constant over time. Forage availability is critical in the humid tropics of Ecuador, especially at the end of the dry 306

Rev Mex Cienc Pecu 2022;13(1):297-310

season. The present results suggest the Mulato II, Marandú and Xaraés cultivars are promising forage alternatives due to their dry matter content and digestibility.

Acknowledgements

The Consejo Nacional de Ciencia y Tecnología (CONACYT) awarded research and visit grants (266100, 290618) to JRGM in Ecuador. The authors thank the Escuela Superior Politécnica de Chimborazo (Ecuador), the Escuela de Ingeniería Agropecuaria de la Universidad Tecnológica Equinoccial, Campus Santo Domingo (Ecuador) and the Facultad de Ingeniería y Ciencias, Universidad Autónoma de Tamaulipas (México) for access to the facilities that made this research possible.

Literature cited: 1. Martínez-González JC, Castillo-Rodríguez S, Villalobos-Cortés A, Hernández-Meléndez J. Sistemas de producción con rumiantes en México. Ciencia Agropecuaria 2017;(26):132-152. 2. Miles JW. Mejoramiento genético en Brachiaria: objetivos, estrategias, logros y proyecciones. Pasturas Trop 2006;28(1):26-30. 3. Lascano C, Pérez R, Plazas C, Medrano J, Pérez O, Argel PJ. Cultivar Toledo-Brachiaria brizantha (Accesión CIAT 26110); gramínea de crecimiento vigoroso para intensificar la ganadería colombiana. 1ra ed. Cali, Colombia: Centro Internacional de Agricultura Tropical; 2002. 4. Pizarro EA, Hare MD, Mutimura M, Changjun B. Brachiaria hybrids: potential, forage use and seed yield. Trop Grassl-Forrajes Trop 2013;1(1):31-35. 5. Guiot JD, Meléndez F. Producción anual de forraje de cuatro especies de Brachiaria en Tabasco. En: Universidad Veracruzana editor. XVI Reunión Científica Tecnológica Forestal y Agropecuaria. Veracruz. 2003:126-128. 6. Peters M, Franco LH, Schmidt A, Hincapié B. Especies forrajeras multipropósito: opciones para productores de Centroamérica. 1ra ed. Cali, Colombia: Centro de Investigación Agrícola Tropical; 2003.

307

Rev Mex Cienc Pecu 2022;13(1):297-310

7. Argel PJ. Cultivar mulato II (Brachiaria híbrido CIAT 36087). Gramínea de alta calidad y producción forrajera, resistente a salivazo y adaptada a suelos tropicales ácidos bien drenados. En: González C, Madrid N, Soto E, editores. Desarrollo sostenible de la ganadería doble propósito. 1ra ed. Maracaibo, Venezuela: Ediciones Astro Data SA.; 2008:347-362. 8. Enríquez JF, Meléndez N, Bolaños ED, Esqueda VA. Producción y manejo de forrajes tropicales. 1ra ed. D.F., México: Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias; 2011. 9. Cruz PI, Hernández A, Enríquez JF, Mendoza SI, Quero AR, Joaquín BM. Desempeño agronómico de genotipos de Brachiaria humidicola (Rendle) Schweickt en el trópico húmedo de México. Rev Fitotec Mex 2011;34(2):123-131. 10. Reyes-Purata A, Bolaños-Aguilar ED, Hernández-Sánchez D, Aranda-Ibañez EM, Izquierdo-Reyes F. Producción de materia seca y concentración de proteína en 21 genotipos del pasto Humidícola Brachiaria humidícola (Rendle) Schweick. Universidad y Ciencia 2009;25(3):213-224. 11. Rojas-Hernández S, Olivares-Pérez J, Jiménez-Guillén R, Gutiérrez-Segura I, AvilésNova F. Producción de materia seca y componentes morfológicos de cuatro cultivares de Brachiaria en el trópico. Rev Avan Inv Agrop 2011;15(1):3-8. 12. Maia GA, Costa KAP, Severiano EC, Epifanio PS, Neto JF, Ribeiro MG, et al. Yield and chemical composition of Brachiaria forage grasses in the offseason after corn harvest. Am J Plant Sci 2014;(5):933-941 13. Pérez JA, García E, Enríquez JF, Quero AR, Pérez J, Hernández A. Análisis de crecimiento, área foliar específica y concentración de nitrógeno en hojas de pasto “mulato” (Brachiaria híbrido, cv.). Téc Pecu Méx 2004;42(3):447-458. 14. Betancourth M, Avila P, Ramirez G, Lascano C. Milk yield of cows grazing Brachiaria pastures managed with high grazing pressure. In: Lascano CE editor. Annual report 2005. Tropical grasses and legumes: optimizing genetic diversity for multipurpose use (Project IP5). 1rst ed. Cali, Colombia: Centro Internacional de Agricultura Tropical; 2006:3-5. 15. Avellaneda-Cevallos J, González-Muñoz S, Pinos-Rodríguez J, Hernández-Garay A, Montañez-Valdez O, Ayala-Oseguera J. Enzimas fibrolíticas exógenas en la digestibilidad in vitro de cinco ecotipos de Brachiaria. Agron Mesoam 2007;18(1):1117.

308

Rev Mex Cienc Pecu 2022;13(1):297-310

16. Lara C, Oviedo LE, Betancur CA. Efecto de la época de corte sobre la composición química y degradabilidad ruminal del pasto Dichanthium aristatum (Angleton). Zootecnia Trop 2010;28(2):275-281. 17. Fagundes JL, da Fonseca DM, Gomide JA, Junior DN, Vitor CMT, de Morais RV, et al. Acúmulo de forragem em pastos de Brachiaria decumbens adubados com nitrogênio. Pesq Agropec Bras 2005;40(4):397-403. 18. ANKOM Technology. Operator´s manual. ANKOM Technology. 1rst ed. New York, USA: ANKOM Technology; 2006. 19. Vanzant E, Cochran R, Titgemeyer E. Standardization of in situ techniques for ruminant feedstuff evaluation. J Anim Sci 1998;76(10):2717-2729. 20. SAS. SAS/STAT® 9.2 User’s Guide. 1rst ed. Cary, North Carolina, USA: SAS Institute, Inc.; 2008. 21. Cuadrado C, Torregroza HL, Jiménez N. Comparación bajo pastoreo con bovinos machos de ceba de cuatro especies de gramíneas del género Brachiaria. Rev MVZ Córdoba 2004;9(2):438-443. 22. Thornton PK, van de Steeg J, Notenbaert A, Herrero M. The impacts of climate change on livestock and livestock systems in developing countries: A review of what we know and what we need to know. Agr Syst 2009;101(3):113-127. 23. Benítez D, Fernández JL, Ray J, Ramírez A, Torres V, Tandrón I, et al. Factores determinantes en la producción de biomasa en tres especies de pastos en sistemas racionales de pastoreo en el Valle del Cauto, Cuba. Rev Cubana Cienc Agríc 2007;41(3):231-235. 24. Castro R, Hernández A, Ramírez O, Aguilar G, Enríquez JF, Mendoza SI. Crecimiento en longitud foliar y dinámica de población de tallos de cinco asociaciones de gramíneas y leguminosa bajo pastoreo. Rev Mex Cienc Pecu 2013;4(2):201-215. 25. Del Pozo PP. Bases ecofisiológicas para el manejo de pastos tropicales. Pastos 2002;32(2):109-137. 26. Sepúlveda-Jiménez G, Porta-Ducoing H, Rocha-Sosa M. La participación de los metabolitos secundarios en la defensa de las plantas. Rev Mex Fitopatol 2003;21(3):355363. 27. Mauri J, Techio VH, Davide LC, Pereira DL, Sobrinho FS, Pereira FJ. Forage quality in cultivars of Brachiaria spp.: association of lignin and fibers with anatomical characteristics. Aust J Crop Sci 2015;9(12):1148-1153. 309

Rev Mex Cienc Pecu 2022;13(1):297-310

28. Lazzarini I, Detmann E, Sampaio CB, Paulino MF, Filho SCV, Souza MA, et al. Intake and digestibility in cattle fed low-quality tropical forage and supplemented with nitrogenous compounds. Rev Bras Zoot 2009;38(10):2021-2030. 29. Church DC, Pond WG, Pond KR. Fundamentos de nutrición y alimentación de animales. 2da ed. D.F., México: Limusa; 2007. 30. Valles B, Castillo E, Bernal H. Rendimiento y degradabilidad ruminal de materia seca y energía de diez pastos tropicales cosechados a cuatro edades. Rev Mex Cienc Pecu 2016;7(2):141-158. 31. Costa KAP, Assis RL, Guimarães KC, Severiano EC, Assis JM, Crunivel WS, et al. Silage quality of Brachiaria brizantha cultivars ensiled with different levels of millet meal. Arq Bras Med Vet Zoo 2011;63(1):188-195. 32. Cornu A, Besle JM, Mosoni P, Brene E. Lignin-carbohidrate complexes in forages: structure and consequenses in the ruminal degradation of cell-wall carbohydrates. Reprod Nutr Dev 1994;34(5):385-398.

310

https://doi.org/10.22319/rmcp.v13i1.5890 Technical note

Incubation, pre-lysis and post-purification on the yield and purity of nucleic acids extracted from blood of domestic goats contained in FTA cards

Carolina Sancho-Blanco a Esteban J. Jiménez-Alfaro b Ramón Molina-Bravo c Rodolfo Umaña-Castro a*

Universidad Nacional, Costa Rica. Campus Omar Dengo, Facultad de Ciencias Exactas y Naturales, Escuela de Ciencias Biológicas, Laboratorio de Análisis Genómico (LAGEN). Costa Rica. b

Universidad Nacional, Costa Rica. Facultad de Ciencias de la Tierra y el Mar, Escuela de Ciencias Agrarias. Costa Rica. c

Universidad Nacional, Costa Rica. Facultad de Ciencias de la Tierra y el Mar, Escuela de Ciencias Agrarias, Laboratorio de Biología Molecular. Costa Rica.

*Corresponding autor: rodolfo.umana.castro@una.ac.cr.

Abstract: Molecular techniques require extractions of nucleic acids in adequate quantity and purity. This work describes a generalized linear model (GLM) of an adjusted factor with fixed effects on nucleic acid yield (ng/μl) and purity (A260/A280 and A260/A230), for five methods of DNA extraction using FTA cards with goat (Capra aegagrus hircus) blood. Two commercial methods based on silica columns (Invitrogen and Macherey Nagel; MN), the chelating resin method (Chelex), the CTAB method and the phenol-chloroform-isoamyl alcohol (PCI) method were tested. Additionally, for MN, an incubation step with PBS (Phosphate Buffered Saline) buffer at high temperature prior to lysis and a purification step post extraction were

311

Rev Mex Cienc Pecu 2022;13(1):311-322

evaluated using a fixed-effect model of two factors with interaction. DNA concentrations and purity ratios were variable; the highest concentration was obtained with the MN kit (170.45 ng/μl), but with deficiencies in purity (0.32 of A260/A230, 0.34 of A260/A280). Despite this, all extraction methods generated PCR products with specific D-loop primers (mtDNA). The combined effect of the pre-incubation and post-purification stages yielded satisfactory purity values (1.89 for A260/A230 and 1.65 for A260/A280), as well as concentration ratios (476.78 ng/μl) with low variability. In conclusion, the concentration and purity of DNA from blood samples is greatly improved when using a commercial kit in combination with pre-lysis incubation and post-extraction purification. These nucleic acids are suggested for use in potential molecular applications a posteriori. Key words: DNA, Silica columns, CTAB, Phenol-chloroform, Chelex, PCR, Small ruminants.

Received: 07/12/2020 Accepted: 05/05/2021

Blood is commonly used for clinical studies and research, as it is an important source of genomic DNA (gDNA) in its fraction of white blood cells(1). For applications in zootechnics and veterinary medicines, it is collected and stored in FTA cards (Whatman® FTA® Cards), due to the convenience and long-term storage(2). FTA cards are then subsequently used in a variety of genomic applications, such as molecular markers and next-generation sequencing(3). There are different DNA extraction techniques, with different results and implications related to costs, inputs and risks for the user. DNA extractions by commercial kits through silica or cellulose columns are usually easy-to-use and moderately expensive (0.40 to 0.44 dollars)(4) procedures, require less time, amount of reagents and pose a lower health risk, compared to traditional methods that use salts (sodium chloride, guanidine salts), resins (chelex) and organic compounds (phenol, chloroform), allow the extraction of nucleic acids at a lower cost (0.27 dollars), however, they usually have longer execution times, limiting the number of samples that can be processed(5,6). Phenol-chloroform-isoamyl alcohol (PCI) is a commonly used method, based on organic compounds. A large amount of gDNA(7), while the phenol inactivates any potential nuclease and contaminating proteins of the DNA can be obtained(8). This process involves numerous steps with toxic and corrosive substances and prolonged incubations(6). Chelex resin is a chelating agent that purifies compounds through the exchange of ions, generally involves

312

Rev Mex Cienc Pecu 2022;13(1):311-322

simple and fast procedures, does not include organic solvents and does not require multiple tube transfers, however, DNA is obtained in reduced quantity and quality(3). The cetyltrimethylammonium bromide (CTAB) method has been widely used for DNA extraction in plant tissue, seeds(9,10), in animal tissues(5,11). Just as the PCI method, it uses hazardous chemicals and requires numerous steps that increase its execution time, affecting its applicability on a large scale(5,12). The main parameters analyzed after a nucleic acid extraction are purity, concentration and integrity. Purity and concentration are usually assessed by UV-VIS spectrophotometry and fluorometry. The absorbance profile measured by spectrophotometry allows the detection of contaminants such as proteins, salts and polysaccharides. On the other hand, agarose gel electrophoresis is a commonly used method to evaluate DNA integrity, either directly from DNA (striking band of DNA of high molecular weight) or by visualizing PCR products from the extracted nucleic acids(13). The objective of the present study was to compare five methods of extraction from goat blood samples kept in FTA cards, according to the concentration and purity of the resulting DNA. In addition, in the most promising method of extraction, it was evaluated the effect of a preincubation with PBS before cell lysis and post-purification of the eluate with organic solvents. Fifty-seven dairy goats (Capra aegagrus hircus) located in the Central, Caribbean, North, Chorotega and Central Pacific Regions of Costa Rica were sampled. The blood collection was carried out following the protocol of Berumen et al(14), placing approximately 200 μl of blood on a Whatman FTA® card (Flinders Technology Associates, UK). The cards were stored at room temperature (RT), in a cool (moisture-free) place, in the dark and inside airtight plastic bags. Five extraction methods were used: two of them were PureLink™ (Invitrogen, USA) and NucleoSpin® Blood (Mackerey Nagel, Germany) commercial kits; which were carried out following the manufacturer’s protocol. The DNA was resuspended in 100 ul of nuclease-free double deionized water. The third method used was that of CTAB by Lodhi et al, adapted(15), the fourth was by means of Chelex-100 resin (Bio Rad Laboratories, Inc, USA) and the last method was by means of phenol/chloroform/isoamyl-alcohol (PCI). Approximately one quarter of the circle of the FTA card was used in all extractions performed with the different methods. Additionally, prior to treatment with the lysis buffer (typical of each of the protocols evaluated), the effect of adding an additional incubation (pre-incubation) was tested in all extraction methods, with 200 μL of PBS buffer(16), for 1 h at 42 °C, stirring by inversion every 10 min. Once the incubation with PBS was finished, each of the extraction protocols was carried out. Three repetitions per individual were used, for a total of 174 repetitions.

313

Rev Mex Cienc Pecu 2022;13(1):311-322

In the extraction of DNA from Chelex resin, once the hour of incubation with PBS had finished, 500 μL of 10 % Chelex-100® resin was added and it was incubated at 70 °C with proteinase K (Thermo Scientific, USA) for 1 h. Subsequently, the samples were centrifuged at 14,000 rpm at 4 °C, an approximate volume of 70 μL of supernatant was isolated and transferred to a new tube. The sample was precipitated by adding 70 μL of 3M sodium acetate (NaOAc) (Ambion, USA) and 180 μL of 96 % ethanol (Sigma-Aldrich, Germany) and incubated for 20 min at -20 °C. Subsequently, the sample was centrifuged at 14,000 rpm for 15 min. The supernatant was discarded, and the resulting pellet was washed twice with 200 μL of 70 % ethanol, allowing it to dry completely at 42 ºC for 5 min using a Savant™ DNA SpeedVac™ concentrator (Thermo Scientific, USA). Finally, 50 μl of TE buffer was added and it was incubated at 37 °C for 30 min to facilitate resuspension. After incubation with PBS, 750 μL of lysis buffer (20 mM Na-EDTA, Tris-HCl, pH 8.0 with HCl, 1.4 M NaCl, 2.0 % (m/v) PVP and 0.2 % (v/v) beta-mercaptoethanol) and 8 μL of proteinase K (20 mg/ml) (Thermo Scientific, USA) were added the sample and was incubated at 70 °C for 1 h. Subsequently, 750 μL of chloroform:octanol (24:1) was added, mixing by inversion. The sample was centrifuged at 13,000 rpm by 5 min at RT and 300 μL of supernatant was transferred to a new tube, adding one volume of cold isopropanol (-20 °C). An incubation was performed at -20 °C for 20 min and the tube was centrifuged at 13,000 rpm at 4 °C for 10 min. The supernatant was discarded, and the sample was completely dried at 42 °C for 5 min with the use of a SpeedVac concentrator (Thermo Scientific, USA). The pellet was resuspended in 50 μL of TE buffer and incubated at 37 °C for 30 min. In the extraction of DNA with PCI(17), after incubation with PBS, an incubation was performed at 70 °C with 600 μL of STES buffer (0.5 M NaCl, 0.2 M Tris-Hcl, 0.01 M EDTA and 0.1 % SDS) and 8 μL of proteinase K (20 mg/mL). Subsequently, 600 μL of PCI (phenol:chloroform:isoamyl alcohol 25:24:1) was added and it was centrifuged at 10,000 rpm for 10 min at RT. Subsequently, the aqueous phase was isolated and a mixture of chloroform/isoamyl alcohol (24:1) (USB Corporation, USA) was added in a 1:1 ratio. The tubes were centrifuged at 10,000 rpm for 1 min, the upper phase was isolated and 100 μL of 3M NaOAc (pH 5.2) and 750 μL of absolute ethanol (Sigma-Aldrich, Germany) were added. The sample was incubated for 20 min at -20 ºC and centrifuged at 14,000 rpm for 10 min at 4 ºC to recover nucleic acids. The supernatant and pellet of the precipitated DNA were removed, washed with 500 μL of 70 % ethanol, then centrifuged at 18,000 rpm for 2 min at RT, and the supernatant was decanted. The pellet was completely dried at 42 °C for 5 min in a thermal block. Once the alcohol evaporated, the sample was resuspended with 100 μL of nuclease-free double deionized water and incubated at 37 °C for 30 min. All extracted genomic DNA samples were evaluated by electrophoretic mobilization in 1 % agarose gels (TBE buffer 0.5 %), at 80 V, 400 mA for 45 min. The purity (coefficients

314

Rev Mex Cienc Pecu 2022;13(1):311-322

A260/A280 and A260/A230) and the concentration of the samples were obtained using a NanoDrop 2000™ UV-visible microvolume spectrophotometer (Thermo Scientific, USA). Once all extractions were carried out, the method that yielded the highest amounts of recovered DNA (ng/µL) was selected, and an additional purification was carried out by phenol-chloroform(17) with an initial volume of 100 μL. Fifty microliters of phenol (pH 8.0) and 50 μL of chloroform:isoamyl alcohol (24:1) (USB Corporation, USA) were added. The sample was centrifuged at 12,000 rpm for 15 min at RT. The aqueous phase was transferred to another tube. One tenth of volume of 3M NaOAc (pH 5.2) (Ambion, USA) and 2.5 volumes of cold absolute ethanol (Sigma-Aldrich, Germany) were added and mixed by inversion. The sample was incubated at -20 °C for 20 min and centrifuged for 10 min at 12,000 rpm. The supernatant was removed, and the sample was resuspended in 70 μL of nuclease-free double deionized water. The integrity of the total DNA and the possible effect of inhibition by trace contaminants of the extraction method were evaluated by means of an end-time PCR (final volume: 20 μL), in triplicate and composed of 1X of PCR Master Mix (Thermo Scientific, USA), 0.8 μM of each primer and 1 μL total DNA (but not with equivalent concentrations). The selection of the samples was random. The D-loop region of the caprine mitochondrial DNA (mtDNA) was amplified using the primers DAF (5´TTCTTCAGGGCCATCTCATC3´) and DGR (3´GCGGATGCATGGTGAAAT5´)(18), synthesized by MACROGEN (Korea). The PCR was performed under the following cycling conditions: 94 °C for 3 min (initial denaturation), 35 cycles of: 94 °C for 30 sec (denaturation), 55 °C for 30 sec (annealing), 72 °C for 45 sec (extension) and finally 72 °C for 10 min as final extension. PCR products were resolved by 1.5 % agarose gel electrophoresis (TBE 1X), 80 V, 400 mA for 60 min in TBE 1X buffer solution (pH 8.0, Invitrogen, USA). The statistical analysis was performed in PROC GLM of SAS. A one-way fixed-effect model for the comparison of the five methods and a two-way fixed-effect model with interaction for the evaluation of incubation and purification by a Levene test were fitted, looking for evidence of homogeneity of variance. Multiple comparison tests between treatments were performed using the Tukey procedure. In all cases, the values of the statistic associated with α<0.05 were considered significant. The results obtained in this study showed that the five extraction protocols performed (Invitrogen, MN, Chelex, CTAB and PCI) differed in purity (A260/A230 and A260/A280) and amount of DNA (ng/μL). When assessing the concentration by absorbance at 260 nm, the highest concentrations and dispersion measurements were obtained with the MN (170.45 ng/μL ± 74.82) and Invitrogen (29.70 ng/μL ± 25.31) methods. Regarding the protocols with organic solvents, the CTAB method yielded the highest values of extracted DNA, followed

315

Rev Mex Cienc Pecu 2022;13(1):311-322

by Chelex and finally that of PCI (10.35 ng/μL, 2.96 ng/μL and 2.23 ng/μL, respectively) (Table 1). Table 1: Measurement of ratios A260/A230, A260/A280 and quantification of DNA (ng/μL) obtained by Nanodrop spectrophotometry from goat blood samples subjected to five nucleic acid isolation methods A260/A230 A260/A280 DNA (ng/μl) Method n Mean SD Mean SD Mean SD Invitrogen CTAB

9 10

0.38a 0.14b

0.09 0.02

0.45a 0.74a

0.22 0.09

29.70b 10.35c

25.31 8.30

PCI

0.37a

0.22

1.23b

0.53

2.23d

1.39

Chelex

0.26a

0.15

1.17c

0.69

2.96e

2.04

0.32ª

0.02

0.34a

0.02

170.45a

74.82

n= number of samples analyzed; SD= standard deviation; CTAB= hexadecyltrimethylammonium bromide; PCI= phenol-chloroform-isoamyl alcohol; MN= Mackerey Nagel. abcde Different letters correspond to significant differences (α<0.05). Different letters by column correspond to significant differences with α<0.05.

Regarding contamination due to proteins (A260/A280), no significant differences were found between the commercial methods, while in the organic solvent protocols, statistical differences were detected between the three, with PCI showing the best yield, followed by Chelex and CTAB (1.23, 1.17 and 0.74), respectively. The purity values associated with the coefficients of A260/A280 were below 1.8 in all extractions, with the commercial methods showing the lowest values, MN (0.34) and Invitrogen (0.45). In addition, all A260/A230 ratios showed values well below 1.5. However, the lowest values of A260/A230 corresponded to DNAs extracted by CTAB (0.14), followed by the Chelex method (0.26) (Table 1). Despite this, the DNA concentration and purity coefficients did not affect the obtaining of partial amplifications of the D-loop region from a PCR (294 bp, genbank accessions: MW514310 and MW514311), since amplicons were generated for all the samples analyzed, regardless of the extraction method used (Figure 1).

316

Rev Mex Cienc Pecu 2022;13(1):311-322

Figure 1: Partial amplification of the mitochondrial D-loop gene by PCR of the five different methods of DNA extraction from Capra aegagrus hircus blood

Lanes 1 and 11: molecular size marker (1Kb Thermo Fisher Scientific). 2-4: amplifications of samples extracted by the PCI method. 5-7: Chellex method. 8-10: CTAB method. 12-14: MN method. 15-17: Invitrogen method. 18: negative control (reaction mixture without DNA).

Based on the promising yield of the DNA concentration obtained by the MN method, and the execution of additional steps as an assumption of an improvement in yield and quality of nucleic acids, it was observed that incubation-purification step significantly increased the DNA concentration (476.78 ng/μL), as well as the purity of the extractions performed (Table 2, Figure 2). The magnitude of the difference between the means of the concentration of nucleic acids, from the method without modification (170.45 ng/μL) with respect to incubation-purification was 306.33 ng/μL, while when it was only purified, the increase was 80.63 ng/μL, and finally of 10.53 ng/μL when it was only incubated. On the other hand, the purity reflected in the A260/A230 and A260/A280 ratios for the MN method showed an improvement (1.89 and 1.65, respectively) in terms of the values obtained from no incubation – no purification (0.32 and 0.34, respectively).

317

Rev Mex Cienc Pecu 2022;13(1):311-322

Table 2: Effect of preincubation with PBS prior to cell lysis and post-purification of the eluate with phenol:chloroform on DNA extraction with the MN method from blood contained in FTA cards A260/A230 A260/A280 DNA (ng/μl) n Mean SD Mean SD Mean SD a a a Incubation-purification 36 1.89 0.21 1.65 0.20 476.78 164.37 b b b Incubation 36 0.33 0.03 0.35 0.03 180.98 62.40 c a c Purification 36 2.02 0.16 1.66 0.13 251.08 126.47 d c d No incubation-No 36 0.32 0.02 0.34 0.02 170.45 74.82 purification abcde

n= number of samples analyzed; SD= standard deviation. Different letters correspond to significant differences (α<0.05).

Figure 2: Distribution of nucleic acid concentrations (ng/extractedμL) according to the modifications made to the MN protocol

Incb= incubation only; Incb-Purf= incubation and purification combined as modifications in the method; No(Incb-Purf)= no incubation and no purification; Purf= purification only. Horizontal lines in the boxes represent the median, vertical lines represent the upper and lower limits, rhombuses inside the boxes represent the mean and circles outside the boxes represent outliers below or above the mean.

Preliminary results regarding the concentration of DNA obtained in the methods without a pre-incubation step (2 to 170 ng/μL) could indicate that the white blood cells retained in the FTA card were not released from the solid support or that the optimal digestion of the cell membrane did not occur. Therefore, the addition of a purification step together with a preincubation step in the MN method generated significant increases in extraction yields in terms 318

Rev Mex Cienc Pecu 2022;13(1):311-322

of concentration and purity. Other authors, as in this research, reported little variability and small deviations in DNA concentration when using a commercial kit(19). The results of this work showed that all the extractions conducted had A260/A280 purity values below the recommended one (1.8 to 2.0)(20). However, despite these non-optimal values (residual proteins and trace contaminants) obtained in the five DNA extraction methods, no inhibition of enzymatic reactions by PCR was observed. More sensitive molecular applications such as Sanger sequencing, PCR-RFLP genotyping, microarrays or NGS could be affected by the presence of salts, organic solvents, EDTA, nucleases and contaminating proteins that are carried in the DNAs(21-24). The low values obtained with the A260/A230 coefficient in samples extracted from commercial kits could be due to compounds with absorption at 230 nm acting as trace contaminants, which include chaotropic salts such as guanidine thiocyanate(25), EDTA, non-ionic detergents such as Triton™ X-100 and Tween®, proteins, amino acids(20,25), phenol, polysaccharides and other floating solid particles such as silica fibers. In the case of DNA extraction based on protocols with organic solvents (PCI and CTAB), values of A260/A230 below what was expected could be due to factors such as errors when separating the aqueous phase from the interphase or the carrying of contaminants such as phenol, chloroform in the successive steps in the extraction. In the case of ion exchange resins (Chelex), the lower values could be due to protein contamination(26). The results demonstrate the limitations of extracting DNA from FTA cards that retain goat blood samples, for their use in later genomic applications. However, positive results in the isolation and purification of total DNA using the commercial NucleoSpin® Blood kit of Mackerey Nagel (MN) for molecular analysis in small ruminants, with additional steps that ensure the quality and purity of nucleic acids for use in techniques with high concentration and DNA integrity requirements.

Acknowledgements

This research was conducted within the framework of the research project “Genomic characterization of Costa Rican dairy goats and meat sheep, for the identification of promising individuals as the basis of a genetic improvement program” SIA 0178-16.

Conflicts of interest

The authors declare no conflict of interest.

319

Rev Mex Cienc Pecu 2022;13(1):311-322

Literature cited: 1. Guha P, Das A, Dutta A, Chaudhuri T. A rapid and efficient DNA extraction protocol from fresh and frozen human blood samples. Clin Lab Anal 2018;32(1):22181. 2. Osorio J, Pachajoa H, Hurtado P. Concentración y pureza del ADN de muestras sanguíneas en papel Whatman FTA almacenadas entre 1 a 3 años. Rev Estomat Salud 2013;21(1):35-38. 3. Stowell L, Bentley E, Gagne R, Gustafson K, Rutledge L, Ernest H. Optimal DNA extractions from blood on preservation paper limits conservation genomic but not conservation genetic applications. J Nat Conserv 2018;46(1):89-96. 4. Poh J, Ken-En GS. Comparison of customized spin-column and salt-precipitation fingerprick blood DNA extraction. Biosci Rep 2014;34(5):629-634. 5. Schiebelhut LM, Abboud SS, Gómez LE, Swift HF, Dawson MN. A comparison of DNA extraction methods for high-throughput DNA analyses. Mol Ecol Resour 2016;17(4):721-729. 6. Montgomery GW, Sise JA. Extraction of DNA from sheep white blood cells. NZ J Agr Res 1990;33(3):437-441. 7. Ghaheri M, Kahrizi D, Yari K, Babaie A, Suthar RS, Kazemi E. Comparative evaluation of four DNA extraction protocols from whole blood sample. Cell Mol Biol 2016;62(3):120-124. 8. Di Prieto F, Ortenzi F, Tilio M, Concetti F, Napolioni V. Genomic DNA extraction from whole blood stored from 15- to 30-years at 20° C by rapid phenol chloroform protocol: A useful tool for genetic epidemiology studies. Mol Cell Probes 2011;(1):44-48. 9. Siegel, CS, Stevenson FO, Zimmer EA. Evaluation and comparison of FTA card and CTAB DNA extraction methods for non-agricultural taxa. Appl Plant Sci 2017;5(2): 1600109 10. Demeke T, Jenkins GR. Influence of DNA Extraction Methods, PCR inhibitors and quantification methods on real-time PCR assay of biotechnology-derived traits. Anal Bioanal Chem 2010;396(6):1977-1990. 11. Chakraborty S, Saha A, Neelavar A. Comparison of DNA extraction methods for nonmarine molluscs: is modified CTAB DNA extraction method more efficient than DNA extraction kits?. 3Biotech 2020;10(2):69. 12. Boesenberg-Smith KA, Pessarakli MD, Wolk DM. Assessment of DNA yield and purity: an overlooked detail of PCR troubleshooting. Clin Microbiol Newsl 2012;34(1):1-6.

320

Rev Mex Cienc Pecu 2022;13(1):311-322

13. Quinet C, Czaplicki G, Dion E, Dal Pozzo F, Kurz A, Saegerman C. First results in the use of bovine ear notch tag for bovine viral diarrhoea virus detection and genetic analysis. PloS one 2016;11(10):e0164451. 14. Berumen A, Palomera CL, Ojeda N. Manual de prácticas de la asignatura de clínica de ovinos y caprinos. Tabasco, México: Universidad Juárez Autónoma de Tabasco; 2010. 15. Lodhi MA, Guang-Ning Y, Norman FW, Bruce IR. A simple and efficient method for DNA extraction from grapevine cultivars, Vitis species. Plant Mol Biol Rep 1994;12(1):6-13. 16. Herrero L, Ávila R, Corrales E, Hun L. Procedimientos en virología médica. 1 era ed. San José, Costa Rica: Universidad de Costa Rica; 2004. 17. Sambrook J, Russell DW. Purification of nucleic acids by extraction with phenol: chloroform. Cold Spring Harbor Protocols. 2006; pdb-prot4455. 18. Kumar D, Singha SP, Singh R, Nagappa SK. A Highly specific PCR assay for identification of goat (Capra hircus) meat. Small Ruminant Res 2011;97(1-3):76-78. 19. Ríos-Sánchez E, Calleros E, González-Zamora A, Rubio J, Martínez OC, Martínez A, Hernández S, Pérez-Morales R. Análisis comparativo de diferentes métodos de extracción de DNA y su eficiencia de genotipificación en población mexicana. Acta Univ 2016;26(4):56-65 20. Neill MO, McPartlin JMc, Arthure K, Riedel S, McMillan ND. Comparison of the TLDA with the Nanodrop and the reference Qubit system. J Phys Conf Ser 2011;307(1): 012047. 21. Caboux E, Lallemand C, Ferro G, Hémon B, Mendy M, Biessy C, et al. Sources of preanalytical variations in yield of DNA extracted from blood samples: analysis of 50,000 DNA samples in EPIC. PLoS one 2012;7(7):e39821. 22. Psifidi A, Dovas CI, Bramis G, Lazou T, Russel CL, Arsenos G, et al. Comparison of eleven methods for genomic DNA extraction suitable for large-scale whole-genome genotyping and long-term DNA banking using blood samples of eleven methods for genomic DNA extraction suitable for large-scale whole-genome genotyping and longterm DNA banking using blood samples. PLoS one 2015;10(1):e0115960. 23. Koshy L, Anju AL, Harikrishnan S, Kutty VR, Jissa VT, Kurikesu I, et al. Evaluating genomic DNA extraction methods from human whole blood using endpoint and realtime PCR assays. Mol Biol Rep 2016;44(1):97-108.

321

Rev Mex Cienc Pecu 2022;13(1):311-322

24. Li Q, Wang X, Li X, He X, Wan Q, Yin J, et al. Obtaining high-quality blood specimens for downstream applications: a review of current knowledge and best practices. Biopreserv Biobank 2018;16(6):411-418. 25. Koetsier G, Cantor E. A practical guide to analyzing nucleic acid concentration and purity with microvolume spectrophotometer. New England Biolabs Inc 2019;1-8. 26. Singh UA, Kumari M, Iyengar S. Method for improving the quality of genomic DNA obtained from minute quantities of tissue and blood samples using Chelex 100 resin. Biol Proced Online. 2018;20(1):12.

322

Revista Mexicana de Ciencias Pecuarias

Edición Bilingüe Bilingual Edition

Rev. Mex. Cienc. Pecu. Vol. 13 Núm. 1, pp. 1-322, ENERO-MARZO-2022

ISSN: 2448-6698

CONTENIDO CONTENTS Pags. Efectos del genotipo, tamaño de la camada y el sexo sobre las características de la canal y el perfil de ácidos grasos en corderos de pelo

Effects of genotype, litter size and sex on carcass characteristics and fatty acid profile in hair lambs Oscar Elías Cruz-Sánchez, José Herrera-Camacho, Ricardo A. García-Herrera, Lorena Aguayo-Ulloa, Víctor M. Moo-Huchin, Aldenamar Cruz- Hernández, Armando Gómez- Vázquez, Ulises Macias-Cruz, Alfonso J. Chay-Canul ………………….……………………………………………………………………………………………………........……………….....…...1 Rendimiento de corderos alimentados con ensilaje como alimento total a base de nopal Juscelino Kubitschek Bevenuto da Silva, Gherman Garcia Leal de Araújo, Edson Mauro Santos, Juliana Silva de Oliveira, Fleming Sena Campos, Glayciane Costa Gois, Tiago Santos Silva, Alex Gomes da Silva Ma�as, Ossival Lolato Ribeiro, Alexandre Fernandes Perazzo, Anderson de Moura Zanine …………………………...................................................19

Comparación en la calidad de huevos obtenidos en un sistema de producción en corrales al aire libre y los producidos en un sistema de jaula

Comparison in the quality of eggs obtained in an outdoor pen production system and those produced in a cage system Samantha Romo, Daniela López, Néstor Ledesma, Carlos Gu�érrez, Antonio Quintana, Lucía Rangel ………………………….....……..…....……..…......……..…....……..…....……..…....……..…....…...…..….....……..…………….32

Using grapeseed meal as natural antioxidant in slow-growing Hubbard broiler diets enriched in polyunsaturated fatty acids

Uso de harina de semilla de uva como antioxidante natural en dietas de pollos de engorda Hubbard de crecimiento lento enriquecidas con ácidos grasos poliinsaturados Margareta Olteanu, Ta�ana Dumitra Panaite, Raluca Paula Turcu, Mariana Ropota, Petru Alexandru Vlaicu, Monica Mitoi ..........……..…….……………….….....…...……….....…….....…….....…….....…..…….......…….…43

Factores asociados a indicadores de crianza de reemplazos bovinos durante el periodo de lactancia en unidades lecheras de pequeña escala

Factors associated with indicators of calf rearing during the lactation period in small-scale dairy farms Fernando Villaseñor González, Eliab Estrada Cortés, Lilia del Rocío Montes Oceguera, Héctor Raymundo Vera Ávila, Luis Javier Mon�el Olguín, Héctor Jiménez Severiano, Mario Alfredo Espinosa Mar�nez ……….…......…………..…………..…………………………………………………………………………………………………………………….……..…..64

Impacto económico y productivo de una mezcla herbal con derivados de colina en la producción de conejos

Economic and productive impact of an herbal mixture with choline derivatives on rabbit production Minerva Jaurez-Espinosa, Pedro Abel Hernández-García, Amada Isabel Osorio-Terán, Germán David Mendoza-Mar�nez, Juan José Ojeda-Carrasco, María Zamira Tapia-Rodríguez, Enrique Espinosa-Ayala…………………………….……………………………………………………………………………………………………………………………………….…...………..82

Características de la canal y perfil de ácidos grasos de la carne de corderos criollos suplementados con semilla de algodón y maíz

Carcass characteristics and fatty acid profile of the meat of Creole lambs supplemented with cottonseed and corn Emiro Suárez Paternina, Libardo Maza Ángulo, Wilson Barragán Hernández, Lorena Aguayo Ulloa, Oscar Vergara Garay……………………………………………………………………………………………..……………...……….......97

Correlación entre variables ante mortem y post mortem en canales de ovinos producidos en México

Correlation between ante-mortem and post-mortem variables in sheep carcasses produced in Mexico Lizbeth Esmeralda Robles Jiménez, José Armando Par�da de la Peña, Miguel Enrique Arechavaleta Velasco, Ignacio Arturo Domínguez Vara …………......……………………………………………………………………..…..115

Financial performance and opportunistic commercialization of beef production systems in southern Brazil

Desempeño financiero y comercialización oportunista de los sistemas de producción de carne de res en el sur de Brasil Amir Gil Sessim, Maria Eugênia Andrighe�o Canozzi, Gabriel Ribas Pereira, Eduardo Madeira Cas�lho, Júlio Otávio Jardim Barcellos………………………………………..…….....…….....…….....…….....….………………….127

Modelos de negocio para la producción de ovinos en el nororiente y centro del Estado de México

Business models for sheep production in the Northeast and center of the State of Mexico viruses in bulls, and their relationship with the presence of the viruses in semen Judith Calderón-Cabrera, Vinicio Horacio Santoyo-Cortés, Enrique Genaro Mar�nez-González, Víctor Herminio Palacio-Muñoz……………….…………………………………………………………………………………………......145

Effect of early age at first calving on longevity, number of days in production and lifetime milk yield of Holstein and Brown Swiss dairy cows in Honduras

Efecto de la edad al primer parto sobre la longevidad, el número de días en producción y la producción de leche durante la vida productiva de las vacas lecheras Holstein y Pardo Suizo en Honduras Karen Alessa Copas Medina, Manuel Valladares Rodas, Juan José Baeza Rodríguez, Juan Gabriel Magaña Monforte, José Candelario Segura Correa ……………………………………...……….....…….....…….....……...163

Efecto de la viscosidad en el medio para la criopreservación espermática de gallo (Gallus gallus)

Effect of viscosity on the medium for rooster (Gallus gallus) sperm cryopreservation José Antonio Herrera Barragán, José Manuel Huitrón, Juan José Pérez-Rivero, Adrián Guzmán Sánchez, Alejandro Ávalos Rodríguez, Ana María Rosales Torres, Ricardo Camarillo Flores ……..………..…..…175

Antimicrobial residues found in poultry commercialized in retail stores from the Metropolitan Area of Guadalajara, Jalisco

Residuos de antimicrobianos encontrados en aves de corral comercializadas en tiendas minoristas de la zona Metropolitana de Guadalajara, Jalisco Delia Guillermina González-Aguilar, Maritza Alejandra Ramírez-López, Iyari Ximena Uribe-Camberos, Jeanne�e Barba-León ………….....…….....…….………………………………………………....……………………………....187

Determinación serológica del virus de leucosis enzoótica bovina (VLEB) en el municipio de Paipa, Boyacá (Colombia)

Serological determination of enzootic bovine leukosis virus (EBLV) in the municipality of Paipa, Boyacá (Colombia) Jorge Alejandro Jiménez Sánchez, Diana María Bulla-Castañeda, Adriana María Díaz-Anaya, Diego José García-Corredor, Mar�n Orlando Pulido-Medellín ……...………………………………………………………..……200

Hematological, biochemical, and endocrine parameters in acute response to increasing-intensity exercise in Colombian Paso horses

Parámetros hematológicos, bioquímicos y endocrinos en la respuesta aguda al ejercicio de intensidad creciente en caballos de Paso colombianos Angélica María Zuluaga Cabrera, Maria José Casas Soto, José Ramón Mar�nez Aranzales, Viviana Elena Cas�llo Vanegas, Nathalia María del Pilar Correa Valencia, María Patricia Arias Gu�errez ………………………………………………….....…….....…….....……....………………………………………………………………………………………………………..……..211

Efecto del comportamiento higiénico sobre la resistencia a la cría calcárea (Ascosphaera apis) en colonias de abejas africanizadas (Apis mellifera)

Effect of hygienic behavior on resistance to chalkbrood disease (Ascosphaera apis) in Africanized bee colonies (Apis mellifera) Carlos Aurelio Medina-Flores, Luis Abdelmir Medina Medina, Ernesto Guzmán-Novoa…………………………………………………………………….…………………………..….…………………………………………………....…………….…..225

Producción y calidad nutritiva de Tithonia diversifolia (Hemsl.) A. Grey en tres épocas del año y su efecto en la preferencia por ovinos Pelibuey

Production and nutritional quality of Tithonia diversifolia (Hemsl.) A. Grey in three seasons of the year and its effect on the preference by Pelibuey sheep Vicky Ta�ana Vargas Velázquez, Ponciano Pérez Hernández, Silvia López Or�z, Epigmenio Cas�llo Gallegos, Cris�no Cruz Lazo, Jesús Jarillo Rodríguez …………………………………………………………………………….240

NOTAS DE INVESTIGACIÓN Efecto del aceite de orégano en las propiedades fisicoquímicas, texturales y sensoriales del queso panela

Oregano essential oil in panela-type cheese: its effects on physicochemical, texture and sensory parameters Niriel Sánchez-Zamora, Mónica Dinorah Cepeda-Rizo, Ka�y Lorena Tamez-Garza, Beatriz Adriana Rodríguez-Romero, Sugey Ramona Sinagawa-García, Alejandro Isabel Luna Maldonado, Emmanuel Flores-Girón, Gerardo Méndez-Zamora ………………… ………..…………...………..…………………………………………………………………………………………………………………....…..258

Efecto de la nisina en la inhibición del crecimiento de Staphylococcus areus y en las propiedades sensoriales del queso costeño

Effect of nisin on the inhibition of the growth of Staphylococcus areus and on the sensory properties of coastal cheese Beatriz Alvarez Badel, María Alejandra Doria Espi�a, Vanesa Hodeg Peña, Mónica María Simanca Sotelo, Yenis Pastrana Puche, Claudia Denise De Paula……………………..…………..….......……………………........272

El huevo de traspatio: ventana de oportunidad de ingresos en comunidades del Municipio de Texcoco, Estado de México

Backyard eggs: an income opportunity window in communities in Texcoco, Mexico Juan Hernández Or�z, Olga Jacqueline Galicia Rojano, Enrique Melo Guerrero, Ramón Valdivia Alcalá, Luis Manuel Valenzuela Núñez………………………....……………………………………..…………...………..…………..287

Rendimiento y digestibilidad de forraje de cultivares de Urochloa spp. a tres edades de rebrote en épocas de lluvias y seca

Forage yield and digestibility of Urochloa spp. cultivars at three regrowth ages in the rainy and dry seasons in Ecuador Jonathan Raúl Garay Mar�nez, Benigno Estrada Drouaillet, Juan Carlos Mar�nez González, San�ago Joaquín Cancino, Hernán Patricio Guevara Costles, Marco Vinicio Acosta Jácome, Eugenia Guadalupe Cienfuegos Rivas………………………...............……………………………………………………………………………………………….........………..297

Incubación, pre-lisis y post-purificación en el rendimiento y pureza de ácidos nucleicos extraídos de sangre de cabras domésticas contenida en tarjetas FTA

Incubation, pre-lysis and post-purification on the yield and purity of nucleic acids extracted from blood of domestic goats contained in FTA cards Carolina Sancho-Blanco, Esteban J. Jiménez-Alfaro, Ramón Molina-Bravo, Rodolfo Umaña-Castro…………………………………………………..…………………………….....…………………………………………….................………..311

Revista Mexicana de Ciencias Pecuarias Rev. Mex. Cienc. Pecu. Vol. 13 Núm. 1, pp. 1-322, ENERO-MARZ0-2022

Performance of lambs fed total feed silage based on cactus pear

Rev. Mex. Cienc. Pecu. Vol. 13 Núm. 1, pp. 1-322, ENERO-MARZO-2022