RMCP Vol. 7, Núm. 3 (2016): Julio-Septiembre by Revista Mexicana de Ciencias Pecuarias

Revista Mexicana de Ciencias Pecuarias

Edición Bilingüe Bilingual Edition

Rev. Mex. Cienc. Pecu. Vol. 7 Núm. 3, pp. 263-403, JULIO-SEPTIEMBRE-2016

ISSN: 2007-1124

Aislamiento de microRNAs a partir de células clorofílicas de Bouteloua gracilis y su caracterización in silico

Pags.

Isolation of microRNAs from Bouteloua gracilis chlorophyllous cells and their in silico characterization Perla Lucía Ordóñez-Baquera, Everardo González-Rodríguez, Gerardo Armando Aguado-Santacruz, Quintín Rascón-Cruz, Eduviges Burrola-Barraza .................................................................................................... 263

Producción y calidad de forraje en mezclas de veza común con cebada, avena y triticale en cuatro etapas fenológicas Forage production and quality of common vetch mixtures with barley, oat and triticale in four phenol ogical stages Manuel de Jesús Flores Nájera, Ricardo A. Sánchez Gutiérrez, Francisco G. Echavarría Cháirez, Ramón Gutiérrez Luna, Cesar A. Rosales Nieto, Homero Salinas González ................................................................................................... 274

Estimación Tier II de emisión de metano entérico en hatos de vacas lactantes en Querétaro, México Tier II estimation of enteric methane emission in dairy cow herds in Querétaro, México Daniela Morante López, Aurelio Guevara Escobar, Humberto Suzán Azpiri, Vicente Lemus Ramírez, Carlos Francisco Sosa Ferreyra .....................................................................................................293

Influencia de taninos sobre características físicas y sensoriales de carne de bovinos en engorda Influence of tannins on the physical and sensory attributes of meat from feedlot cattle Briceida Ortiz-López, María Antonia Mariezcurrena-Berasaín, Rubén Barajas-Cruz, Patricia López-Perea, Héctor Bernardo Escalona-Buendía, José Luis Borquez-Gastelum, María Dolores Mariezcurrena-Berasaín ....................................................................................................309

Evaluación de la calidad de la carne de pollo en el mercado minorista: efectos del tipo y origen de las canales Evaluation of the broiler meat quality in the retail market: Effects of type and source of carcasses Youssef A. Attia, Mohammed A. Al-Harthi, Mohamed A. Korish, Mohamed M. Shiboob ...................................................................................................321

Desarrollo del eje reproductivo endocrino en corderos de pelo Development of the endocrine reproductive axis in hair breed ram lambs Luis Javier Montiel-Olguín, Héctor Raymundo Vera-Ávila, Eugenio Villagómez-Amezcua, Vicente Castañeda-Rodríguez, Mario Cárdenas-León, Héctor Jiménez-Severiano ....................................................................................................341

Destete artificial en ovinos: respuesta de estrés y bienestar animal. Revisión Artificial weaning in sheep: stress response and animal welfare. Review Aline Freitas-de-Melo, Rodolfo Ungerfeld ....................................................................................................361

Análisis de variables morfológicas de pavos de traspatio mexicanos ( Meleagris gallopavo gallopavo ) Analysis of morphological variables in Mexican backyard turkeys ( Meleagris gallopavo gallopavo ) Ángel Ríos Utrera, Sergio Iván Román Ponce, Alejandra Vélez Izquierdo, Eduardo Cabrera Torres, Antonio Cantú Covarrubias, Lino De la Cruz Colín, Marina Durán Aguilar, Jorge Alonso Maldonado Jaquez, Fernando Edgar Martínez Silva, Guillermo Martínez Velázquez, Felipe de Jesús Ruiz López, Alessandro Bagnato, Vicente Eliezer Vega Murillo .................................................................................................... 377

Crecimiento y especialización regional del sector pecuario en México, 1994 a 2013 Regional specialization and growth of the livestock sector in Mexico, 1994-2013 Alfredo Rebollar Rebollar, Samuel Rebollar Rebollar, Germán Gómez Tenorio, Juvencio Hernández Martínez, Felipe de Jesús González Razo ....................................................................................................391

Revista Mexicana de Ciencias Pecuarias Rev. Mex. Cienc. Pecu. Vol. 7 Núm. 3, pp. 263-403, JULIO-SEPTIEMBRE-2016

CONTENIDO CONTENTS

Rev. Mex. Cienc. Pecu. Vol. 7 Núm. 3, pp. 263-403, JULIO-SEPTIEMBRE-2016

NUESTRA PORTADA

Becerro Angus rojo amamantando, Campo Experimental Vaquerías. Fotografía tomada por: Miguel Luna Luna. Concurso de Fotografía INIFAP 2010.

REVISTA MEXICANA DE CIENCIAS PECUARIAS Volumen 7 Número 3 julio-septiembre, 2016. Es una publicación trimestral de acceso abierto, revisada por pares y arbitrada, editada por el Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias (INIFAP). Avenida Progreso No. 5, Barrio de Santa Catarina, Delegación Coyoacán, C.P. 04010, Cuidad de México, www.inifap.gob.mx Distribuida por el Centro Nacional de Investigación Disciplinaria en Microbiología Animal, Km 15.5 Carretera México-Toluca, Colonia Palo Alto, Cuidad de México, C.P. 05110. Editor responsable: Arturo García Fraustro. Reservas de Derechos al Uso Exclusivo número 04-2016-060913393200-203. ISSN: 2448-6698, otorgados por el Instituto Nacional del Derecho de Autor (INDAUTOR). Responsable de la última actualización de éste número: Arturo García Fraustro, Centro Nacional de Investigación Disciplinaria en Microbiología Animal, Km. 15.5 Carretera México-Toluca, Colonia Palo Alto, Ciudad de México, C.P. 015110. http://cienciaspecuarias. inifap.gob.mx, la presente publicación tuvo su última actualización en julio de 2016.

DIRECTORIO FUNDADOR John A. Pino EDITOR EN JEFE EDITORES ADJUNTOS Arturo García Fraustro Oscar L. Rodríguez Rivera Alfonso Arias Medina Microbiología: Epidemiología: Parasitología: Reproducción: Genética: Nutrición:

Apicultura: Socioeconomía: Forrajes y Pastizales: Inocuidad: Inmunología:

EDITORES POR DISCIPLINA Elizabeth Loza Rubio Juan Carlos Saiz Calahorra Ramón Molina Barrios Ma. Cristina Schneider Guillermina Ávila Ramírez Emmanuel Camus Héctor Jiménez Severiano José J. Hernández Ledesma Juan Hebert Hernández Medrano Sergio Román Ponce Mauricio A. Elzo Armando Partida de la Peña José L. Romano Muñoz Alejandro Placencia Jorquera Juan Ku Vera Yolanda B. Moguel Ordóñez Fernando Cervantes Escoto Javier F. Enríquez Quiroz Alfonso Hernández Garay James A. Pfister Jesús Vázquez Navarrete Sergio Rodríguez Camarena

INIFAP INIA IT Sonora PAHO UNAM CIRAD INIFAP Consultor UNAM INIFAP Univ. Florida INIFAP INIFAP UABJ UADY INIFAP UA Chapingo INIFAP CP USDA INIFAP INIFAP

México España México EE.UU. México Francia México EE.UU. México México EE.UU. México México México México México México México México EE.UU. México México

TIPOGRAFÍA Y FORMATO Nora del Rocío Alfaro Gómez Indizada en el “Journal Citation Report” Science Edition del ISI (http://thomsonreuters.com/). Inscrita en el Sistema de Clasificación de Revistas Científicas y Tecnológicas de CONACyT; en EBSCO Host y la Red de Revistas Científicas de América Latina y el Caribe, España y Portugal (RedALyC) (www.redalyc.org); en la Red Iberoamericana de Revistas Científicas de Veterinaria de Libre Acceso (www.veterinaria.org/revistas/ revivec); en los Índices SCOPUS y EMBASE de Elsevier (www.elsevier. com) I

REVISTA MEXICANA DE CIENCIAS PECUARIAS La Revista Mexicana de Ciencias Pecuarias es un órgano de difusión científica y técnica de acceso abierto, revisada por pares y arbitrada. Su objetivo es dar a conocer los resultados de las investigaciones realizadas por cualquier institución científica, relacionadas particularmente con las distintas disciplinas de la Medicina Veterinaria y la Zootecnia. Además de trabajos de las disciplinas indicadas en su Comité Editorial, se aceptan también para su evaluación y posible publicación, trabajos de otras disciplinas, siempre y cuando estén relacionados con la investigación pecuaria. Se publican en la revista tres categorías de trabajos: Artículos Científicos, Notas de Investigación y Revisiones Bibliográficas (consultar las Notas al autor); la responsabilidad de cada trabajo recae exclusivamente en los autores, los cuales, por la naturaleza misma de los experimentos pueden verse obligados a referirse en algunos casos a los nombres comerciales de ciertos productos, ello sin embargo, no implica preferencia por los productos citados o ignorancia respecto a los omitidos, ni tampoco significa en modo alguno respaldo publicitario hacia los productos mencionados. Todas las contribuciones serán cuidadosamente evaluadas por árbitros, considerando su calidad y relevancia académica. Queda entendido que el someter un manuscrito implica que la investigación descrita es única e inédita. La publicación de Rev. Mex. Cienc. Pecu. es

trimestral en formato bilingüe Español o Inglés. El costo total por publicar es de $ 5,600.00 por manuscrito editado. Se publica en formato digital en acceso abierto, por lo que autoriza la reproducción total o parcial del contenido de los artículos si se cita la fuente. El envío de los trabajos se debe realizar directamente en el sitio oficial de la revista. Correspondencia adicional deberá dirigirse al Editor Adjunto a la siguiente dirección: Calle 36 No. 215 x 67 y 69 Colonia Montes de Amé, C.P. 97115 Mérida, Yucatán, México. Tel/Fax +52 (999) 941-5030. Correo electrónico (C-ele): rodriguez_oscar@prodigy.net.mx. La correspondencia relativa a suscripciones, asuntos de intercambio o distribución de números impresos anteriores, deberá dirigirse al Editor en Jefe de la Revista Mexicana de Ciencias Pecuarias, CENID Microbiología Animal, Km 15.5 Carretera MéxicoToluca, Col. Palo Alto, D.F. C.P. 05110, México; Tel: +52(55) 38718700 ext. 80316; garcia.arturo@inifap.gob.mx o arias.alfonso@inifap.gob.mx. Inscrita en la base de datos de EBSCO Host y la Red de Revistas Científicas de América Latina y el Caribe, España y Portugal (RedALyC) (www.redalyc.org), en la Red Iberoamericana de Revistas Científicas de Veterinaria de Libre Acceso (www.veterinaria.org/revistas/ revivec), indizada en el “Journal Citation Report” Science Edition del ISI (http://thomsonreuters. com/) y en los Índices SCOPUS y EMBASE de Elsevier (www.elsevier.com)

VISITE NUESTRA PÁGINA EN INTERNET Artículos completos desde 1963 a la fecha y Notas al autor en: http://cienciaspecuarias.inifap.gob.mx Revista Mexicana de Ciencias Pecuarias is an open access peer-reviewed and refereed scientific and technical journal, which publishes results of research carried out in any scientific or academic institution, especially related to different areas of veterinary medicine and animal production. Papers on disciplines different from those shown in Editorial Committee can be accepted, if related to livestock research. The journal publishes three types of papers: Research Articles, Technical Notes and Review Articles (please consult Instructions for authors). Authors are responsible for the content of each manuscript, which, owing to the nature of the experiments described, may contain references, in some cases, to commercial names of certain products, which however, does not denote preference for those products in particular or of a lack of knowledge of any other which are not mentioned, nor does it signify in any way an advertisement or an endorsement of the referred products. All contributions will be carefully refereed for academic relevance and quality. Submission of an article is understood to imply that the research described is unique and unpublished. Rev. Mex. Cienc.. Pecu. is published quarterly in original lenguaje Spanish or English. Total fee charges are US $ 300.00 per article.

Part of, or whole articles published in this Journal may be reproduced, stored in a retrieval system or transmitted in any form or by any means, electronic, mechanical, photocopying or otherwise, provided the source is properly acknowledged. Manuscripts should be submitted directly in the official web site. Additional information may be mailed to: Associate Editor, Revista Mexicana de Ciencias Pecuarias, Calle 36 No. 215 x 67 y 69 Colonia Montes de Amé, C.P. 97115 Mérida, Yucatán, México. Tel/Fax +52 (999) 941-5030. E-mail: rodriguez_oscar@prodigy.net.mx. For subscriptions, exchange or distribution of previous printed issues, please contact: Editor-in-Chief of Revista Mexicana de Ciencias Pecuarias, CENID Microbiología Animal, Km 15.5 Carretera México-Toluca, Col. Palo Alto, D.F. C.P. 05110, México; Tel: +52(55) 3871-8700 ext. 80316; garcia.arturo@inifap.gob.mx or arias.alfonso@inifap.gob.mx. Registered in the EBSCO Host database. The Latin American and the Caribbean Spain and Portugal Scientific Journals Network (RedALyC) (www.redalyc.org). The Iberoamerican Network of free access Veterinary Scientific Journals (www.veterinaria.org/ revistas/ revivec). Thomson Reuter´s “Journal Citation Report” Science Edition (http://thomsonreuters.com/). Elsevier´s SCOPUS and EMBASE (www.elsevier.com) and the Essential Electronic Agricultural Library (www.teeal.org).

VISIT OUR SITE IN THE INTERNET Full articles from year 1963 to date and Instructions for authors can be accessed via the site http://cienciaspecuarias.inifap.gob.mx

REVISTA MEXICANA DE CIENCIAS PECUARIAS REV. MEX. CIENC. PECU.

VOL. 7 No. 3

JULIO-SEPTIEMBRE-2016

CONTENIDO ARTÍCULOS

Aislamiento de microRNAs a partir de células clorofílicas de Bouteloua gracilis y su caracterización in silico

Pág.

Isolation of microRNAs from Bouteloua gracilis chlorophyllous cells and their in silico characterization

Perla Lucía Ordóñez-Baquera, Everardo González-Rodríguez, Gerardo Armando Aguado-Santacruz, Quintín Rascón-Cruz, Eduviges Burrola-Barraza ................................................................................... 263

Producción y calidad de forraje en mezclas de veza común con cebada, avena y triticale en cuatro etapas fenológicas

Forage production and quality of common vetch mixtures with barley, oat and triticale in four phenological stages

Manuel de Jesús Flores Nájera, Ricardo A. Sánchez Gutiérrez, Francisco G. Echavarría Cháirez, Ramón Gutiérrez Luna, Cesar A. Rosales Nieto, Homero Salinas González .......................................... 274

Estimación Tier II de emisión de metano entérico en hatos de vacas lactantes en Querétaro, México Tier II estimation of enteric methane emission in dairy cow herds in Querétaro, México

Daniela Morante López, Aurelio Guevara Escobar, Humberto Suzán Azpiri, Vicente Lemus Ramírez, Carlos Francisco Sosa Ferreyra ............................................................................................................ 293

Influencia de taninos sobre características físicas y sensoriales de carne de bovinos en engorda

Influence of tannins on the physical and sensory attributes of meat from feedlot cattle

Briceida Ortiz-López, María Antonia Mariezcurrena-Berasaín, Rubén Barajas-Cruz, Patricia López-Perea, Héctor Bernardo Escalona-Buendía, José Luis Borquez-Gastelum, María Dolores Mariezcurrena-Berasaín ................................................................................................. 309

Evaluación de la calidad de la carne de pollo en el mercado minorista: efectos del tipo y origen de las canales

Evaluation of the broiler meat quality in the retail market: Effects of type and source of carcasses

Youssef A. Attia, Mohammed A. Al-Harthi, Mohamed A. Korish, Mohamed M. Shiboob ....................... 321

III

Desarrollo del eje reproductivo endocrino en corderos de pelo

Development of the endocrine reproductive axis in hair breed ram lambs

Luis Javier Montiel-Olguín, Héctor Raymundo Vera-Ávila, Eugenio Villagómez-Amezcua, Vicente Castañeda-Rodríguez, Mario Cárdenas-León, Héctor Jiménez-Severiano ................................... 341

REVISIÓN BIBLIOGRÁFICA

Destete artificial en ovinos: respuesta de estrés y bienestar animal. Revisión Artificial weaning in sheep: stress response and animal welfare. Review

Aline Freitas-de-Melo, Rodolfo Ungerfeld ............................................................................................. 361

NOTAS DE INVESTIGACIÓN

Análisis de variables morfológicas de pavos de traspatio mexicanos (Meleagris gallopavo gallopavo) Analysis of morphological variables in Mexican backyard turkeys (Meleagris gallopavo gallopavo)

Ángel Ríos Utrera, Sergio Iván Román Ponce, Alejandra Vélez Izquierdo, Eduardo Cabrera Torres, Antonio Cantú Covarrubias, Lino De la Cruz Colín, Marina Durán Aguilar, Jorge Alonso Maldonado Jaquez, Fernando Edgar Martínez Silva, Guillermo Martínez Velázquez, Felipe de Jesús Ruiz López, Alessandro Bagnato, Vicente Eliezer Vega Murillo ............................................................. 377

Crecimiento y especialización regional del sector pecuario en México, 1994 a 2013 Regional specialization and growth of the livestock sector in Mexico, 1994-2013

Alfredo Rebollar Rebollar, Samuel Rebollar Rebollar, Germán Gómez Tenorio, Juvencio Hernández Martínez, Felipe de Jesús González Razo ............................................................. 391

Actualización: enero, 2016

NOTAS AL AUTOR La Revista Mexicana de Ciencias Pecuarias se edita completa en dos idiomas (español e inglés) y publica tres categorías de trabajos: Artículos científicos, Notas de investigación y Revisiones bibliográficas.

Los autores interesados en publicar en esta revista deberán ajustarse a los lineamientos que más adelante se indican, los cuales en términos generales, están de acuerdo con los elaborados por el Comité Internacional de Editores de Revistas Médicas (CIERM) Bol Oficina Sanit Panam 1989;107:422-437. 1.

Sólo se aceptarán trabajos inéditos. No se admitirán si están basados en pruebas de rutina, ni datos experimentales sin estudio estadístico cuando éste sea indispensable. Tampoco se aceptarán trabajos que previamente hayan sido publicados condensados o in extenso en Memorias o Simposio de Reuniones o Congresos (a excepción de Resúmenes).

Todos los trabajos estarán sujetos a revisión de un Comité Científico Editorial, conformado por Pares de la Disciplina en cuestión, quienes desconocerán el nombre e Institución de los autores proponentes. El Editor notificará al autor la fecha de recepción de su trabajo.

El manuscrito deberá someterse a través del portal de la Revista en la dirección electrónica: http:// cienciaspecuarias.inifap.gob.mx, consultando el “Instructivo para envío de artículos en la página de la Revista Mexicana de Ciencias Pecuarias”. Para su elaboración se utilizará el procesador de Microsoft Word, con letra Arial a 12 puntos, a doble espacio. Asimismo se deberá remitir una carta de presentación firmada por todos los autores, aceptando el orden de co-autoría, remitiéndola en forma digitalizada como archivo complementario; en ella se indicará el responsable de la correspondencia con la Revista, indicando dirección (no apartado postal), teléfono y dirección electrónica.

Por ser una revista con arbitraje, y para facilitar el trabajo de los revisores, todos los renglones de cada página deben estar numerados; asimismo cada página debe estar numerada, inclusive cuadros, ilustraciones y gráficas.

Los artículos tendrán una extensión máxima de 20 cuartillas a doble espacio, sin incluir páginas de Título, y cuadros o figuras (los cuales no deberán exceder de ocho). Las Notas de investigación tendrán una

extensión máxima de 15 cuartillas y 6 cuadros o figuras. Las Revisiones bibliográficas una extensión máxima de 30 cuartillas y 5 cuadros.

Los manuscritos de las tres categorías de trabajos que se publican en la Rev. Mex. Cienc. Pecu. deberán contener los componentes que a continuación se indican, empezando cada uno de ellos en página aparte. Página del título Resumen en español Resumen en inglés Texto Agradecimientos Literatura citada Cuadros y gráficas

Página del Título. Solamente debe contener el título del trabajo, que debe ser conciso pero informativo; así como el título traducido al idioma inglés. En el manuscrito no es necesaria información como nombres de autores, departamentos, instituciones, direcciones de correspondencia, etc., ya que estos datos tendrán que ser registrados durante el proceso de captura de la solicitud en la plataforma del OJS (http://ciencias pecuarias.inifap.gob.mx).

Resumen en español. En la segunda página se debe incluir un resumen que no pase de 250 palabras. En él se indicarán los propósitos del estudio o investigación; los procedimientos básicos y la metodología empleada; los resultados más importantes encontrados, y de ser posible, su significación estadística y las conclusiones principales. A continuación del resumen, en punto y aparte, agregue debidamente rotuladas, de 3 a 8 palabras o frases cortas clave que ayuden a los indizadores a clasificar el trabajo, las cuales se publicarán junto con el resumen. Resumen en inglés. Anotar el título del trabajo en inglés y a continuación redactar el “abstract” con las mismas instrucciones que se señalaron para el resumen en español. Al final en punto y aparte, se deberán escribir las correspondientes palabras clave (“key words”).

10. Texto. Las tres categorías de trabajos que se publican en la Rev. Mex. Cienc. Pecu. consisten en lo siguiente:

a) Artículos científicos. Deben ser informes de trabajos originales derivados de resultados parciales o finales de investigaciones. El texto del Artículo científico se divide en secciones que llevan estos encabezamientos:

referencias; las “observaciones inéditas” y las “comunicaciones personales” no deben usarse como referencias, aunque pueden insertarse en el texto (entre paréntesis).

En los artículos largos puede ser necesario agregar subtítulos dentro de estas divisiones a fin de hacer más claro el contenido, sobre todo en las secciones de Resultados y de Discusión, las cuales también pueden presentarse como una sola sección.

Nombre de los autores, con mayúsculas sólo las iniciales, empezando por el apellido paterno, luego iniciales del materno y nombre(s). En caso de apellidos compuestos se debe poner un guión entre ambos, ejemplo: Elías-Calles E. Entre las iniciales de un autor no se debe poner ningún signo de puntuación, ni separación; después de cada autor sólo se debe poner una coma, incluso después del penúltimo; después del último autor se debe poner un punto.

Introducción Materiales y Métodos Resultados Discusión Conclusiones e implicaciones

Reglas básicas para la Literatura citada

b) Notas de investigación. Consisten en modificaciones a técnicas, informes de casos clínicos de interés especial, preliminares de trabajos o investigaciones limitadas, descripción de nuevas variedades de pastos; así como resultados de investigación que a juicio de los editores deban así ser publicados. El texto contendrá la misma información del método experimental señalado en el inciso a), pero su redacción será corrida del principio al final del trabajo; esto no quiere decir que sólo se supriman los subtítulos, sino que se redacte en forma continua y coherente.

El título del trabajo se debe escribir completo (en su idioma original) luego el título abreviado de la revista donde se publicó, sin ningún signo de puntuación; inmediatamente después el año de la publicación, luego el número del volumen, seguido del número (entre paréntesis) de la revista y finalmente el número de páginas (esto en caso de artículo ordinario de revista). Puede incluir en la lista de referencias, los artículos aceptados aunque todavía no se publiquen; indique la revista y agregue “en prensa” (entre corchetes). En el caso de libros de un solo autor (o más de uno, pero todos responsables del contenido total del libro), después del o los nombres, se debe indicar el título del libro, el número de la edición, el país, la casa editorial y el año.

c) Revisiones bibliográficas. Consisten en el tratamiento y exposición de un tema o tópico de relevante actualidad e importancia; su finalidad es la de resumir, analizar y discutir, así como poner a disposición del lector información ya publicada sobre un tema específico. El texto se divide en: Introducción, y las secciones que correspondan al desarrollo del tema en cuestión.

Cuando se trate del capítulo de un libro de varios autores, se debe poner el nombre del autor del capítulo, luego el título del capítulo, después el nombre de los editores y el título del libro, seguido del país, la casa editorial, año y las páginas que abarca el capítulo.

11. Agradecimientos. Siempre que corresponda, se deben especificar las colaboraciones que necesitan ser reconocidas, tales como a) la ayuda técnica recibida; b) el agradecimiento por el apoyo financiero y material, especificando la índole del mismo; c) las relaciones financieras que pudieran suscitar un conflicto de intereses. Las personas que colaboraron pueden ser citadas por su nombre, añadiendo su función o tipo de colaboración; por ejemplo: “asesor científico”, “revisión crítica de la propuesta para el estudio”, “recolección de datos”, etc. 12. Literatura citada. Numere las referencias consecutivamente en el orden en que se mencionan por primera vez en el texto. Las referencias en el texto, en los cuadros y en las ilustraciones se deben identificar mediante números arábigos entre paréntesis, sin señalar el año de la referencia. Evite hasta donde sea posible, el tener que mencionar en el texto el nombre de los autores de las referencias. Procure abstenerse de utilizar los resúmenes como

En el caso de tesis, se debe indicar el nombre del autor, el título del trabajo, luego entre corchetes el grado (licenciatura, maestría, doctorado), luego el nombre de la ciudad, estado y en su caso país, seguidamente el nombre de la Universidad (no el de la escuela), y finalmente el año.

Emplee el estilo de los ejemplos que aparecen a continuación, los cuales están parcialmente basados en el formato que la Biblioteca Nacional de Medicina de los Estados Unidos usa en el Index Medicus. Revistas

Artículo ordinario, con volumen y número. (Incluya

el nombre de todos los autores cuando sean seis o menos; si son siete o más, anote sólo el nombre de los seis primeros y agregue “et al.”).

Basurto GR, Garza FJD. Efecto de la inclusión de grasa o proteína de escape ruminal en el comportamiento de toretes Brahman en engorda. Téc Pecu Méx 1998;36(1):35-48.

inducción de estro lactacional [resumen]. Reunión nacional de investigación pecuaria. Querétaro, Qro. 1998:13.

XII) Cunningham EP. Genetic diversity in domestic animals: strategies for conservation and development. In: Miller RH et al. editors. Proc XX Beltsville Symposium: Biotechnology’s role in genetic improvement of farm animals. USDA. 1996:13.

Sólo número sin indicar volumen.

II) Stephano HA, Gay GM, Ramírez TC. Encephalomielitis, reproductive failure and corneal opacity (blue eye) in pigs associated with a paramyxovirus infection. Vet Rec 1988;(122):6-10.

Tesis.

III) Chupin D, Schuh H. Survey of present status ofthe use of artificial insemination in developing countries. World Anim Rev 1993;(74-75):26-35.

XIII) Alvarez MJA. Inmunidad humoral en la anaplasmosis y babesiosis bovinas en becerros mantenidos en una zona endémica [tesis maestría]. México, DF: Universidad Nacional Autónoma de México; 1989.

No se indica el autor.

XIV) Cairns RB. Infrared spectroscopic studies of solid oxigen [doctoral thesis]. Berkeley, California, USA: University of California; 1965.

IV) Cancer in South Africa [editorial]. S Afr Med J 1994;84:15.

Suplemento de revista.

Organización como autor.

V) Hall JB, Staigmiller RB, Short RE, Bellows RA, Bartlett SE. Body composition at puberty in beef heifers as influenced by nutrition and breed [abstract]. J Anim Sci 1998;71(Suppl 1):205.

XV) NRC. National Research Council. The nutrient requirements of beef cattle. 6th ed. Washington, DC, USA: National Academy Press; 1984.

XVI) SAGAR. Secretaría de Agricultura, Ganadería y Desarrollo Rural. Curso de actualización técnica para la aprobación de médicos veterinarios zootecnistas responsables de establecimientos destinados al sacrificio de animales. México. 1996.

Organización, como autor.

VI) The Cardiac Society of Australia and New Zealand. Clinical exercise stress testing. Safety and performance guidelines. Med J Aust 1996;(164):282-284.

En proceso de publicación.

XVII) AOAC. Oficial methods of analysis. 15th ed. Arlington, VA, USA: Association of Official Analytical Chemists. 1990.

VII) Scifres CJ, Kothmann MM. Differential grazing use of herbicide treated area by cattle. J Range Manage [in press] 2000.

XVIII) SAS. SAS/STAT User’s Guide (Release 6.03). Cary NC, USA: SAS Inst. Inc. 1988.

Libros y otras monografías

XIX) SAS. SAS User´s Guide: Statistics (version 5 ed.). Cary NC, USA: SAS Inst. Inc. 1985.

Autor total.

Publicaciones electrónicas

VIII) Steel RGD, Torrie JH. Principles and procedures of statistics: A biometrical approach. 2nd ed. New York, USA: McGraw-Hill Book Co.; 1980. IX)

XI)

XX) Jun Y, Ellis M. Effect of group size and feeder type on growth performance and feeding patterns in growing pigs. J Anim Sci 2001;79:803-813. http:// jas.fass.org/cgi/reprint/79/4/803.pdf. Accessed Jul 30, 2003.

Autor de capítulo.

Roberts SJ. Equine abortion. In: Faulkner LLC editor. Abortion diseases of cattle. 1rst ed. Springfield, Illinois, USA: Thomas Books; 1968:158-179.

XXI) Villalobos GC, González VE, Ortega SJA. Técnicas para estimar la degradación de proteína y materia orgánica en el rumen y su importancia en rumiantes en pastoreo. Téc Pecu Méx 2000;38(2): 119-134. h t t p : / / w w w. t e c n i c a p e c u a r i a . o r g / t r a b a j o s / 200212175725.pdf. Consultado 30 Ago, 2003.

Memorias de reuniones.

Loeza LR, Angeles MAA, Cisneros GF. Alimentación de cerdos. En: Zúñiga GJL, Cruz BJA editores. Tercera reunión anual del centro de investigaciones forestales y agropecuarias del estado de Veracruz. Veracruz. 1990:51-56.

XXII) Sanh MV, Wiktorsson H, Ly LV. Effect of feeding level on milk production, body weight change, feed conversion and postpartum oestrus of crossbred lactating cows in tropical conditions. Livest Prod Sci 2002;27(2-3):331-338. http://

Olea PR, Cuarón IJA, Ruiz LFJ, Villagómez AE. Concentración de insulina plasmática en cerdas alimentadas con melaza en la dieta durante la

VII

www.sciencedirect.com/science/journal/03016226. Accessed Sep 12, 2003.

i.v. J kg km L log Mcal MJ m msnm µg µl µm mg ml mm min ng

13. Cuadros, Gráficas e Ilustraciones. Es preferible que sean pocos, concisos, contando con los datos necesarios para que sean autosuficientes, que se entiendan por sí mismos sin necesidad de leer el texto. Para las notas al pie se deberán utilizar los símbolos convencionales.

14 Versión final. Es el documento en el cual los autores ya integraron las correcciones y modificaciones indicadas por el Comité Revisor. Los trabajos deberán ser elaborados con Microsoft Word. Las gráficas y figuras se deberán elaborar en Word, Power Point, Corel Draw y enviadas en archivo aparte (nunca insertarlas como imágenes en el texto). Los cuadros no deberán contener ninguna línea vertical, y las horizontales solamente las que delimitan los encabezados de columna, y la línea al final del cuadro. 15. Una vez recibida la versión final, ésta se mandará para su traducción al idioma inglés o español, según corresponda. Si los autores lo consideran conveniente podrán enviar su manuscrito final en ambos idiomas.

gravedades

16. Tesis. Se publicarán como Artículo o Nota de Investigación, siempre y cuando se ajusten a las normas de esta revista. 17. Los trabajos no aceptados para su publicación se regresarán al autor, con un anexo en el que se explicarán los motivos por los que se rechaza o las modificaciones que deberán hacerse para ser reevaluados. 18. Abreviaturas de uso frecuente: cal cm °C DL50 g ha h i.m.

p PC PCR pp ppm % rpm seg t TND UA UI

intravenosa (mente) joule (s) kilogramo (s) kilómetro (s) litro (s) logaritmo decimal megacaloría (s) megajoule (s) metro (s) metros sobre el nivel del mar microgramo (s) microlitro (s) micrómetro (s)(micra(s)) miligramo (s) mililitro (s) milímetro (s) minuto (s) nanogramo (s) probabilidad (estadística) página proteína cruda reacción en cadena de la polimerasa páginas partes por millón por ciento (con número) revoluciones por minuto segundo (s) tonelada (s) total de nutrientes digestibles unidad animal unidades internacionales

caloría (s) centímetro (s) grado centígrado (s) dosis letal 50% gramo (s) hectárea (s) hora (s) intramuscular (mente)

versus

Cualquier otra abreviatura se pondrá entre paréntesis inmediatamente después de la(s) palabra(s) completa(s).

19. Los nombres científicos y otras locuciones latinas se deben escribir en cursivas.

VIII

Update: January, 2016

INSTRUCTIONS FOR AUTHORS Revista Mexicana de Ciencias Pecuarias is a scientific journal published in a bilingual format (Spanish and English) which carries three types of papers: Research Articles, Technical Notes, and Reviews. Authors interested in publishing in this journal, should follow the belowmentioned directives which are based on those set down by the International Committee of Medical Journal Editors (ICMJE) Bol Oficina Sanit Panam 1989;107:422-437. 1.

Only original unpublished works will be accepted. Manuscripts based on routine tests, will not be accepted. All experimental data must be subjected to statistical analysis. Papers previously published condensed or in extenso in a Congress or any other type of Meeting will not be accepted (except for Abstracts).

All contributions will be peer reviewed by a scientific editorial committee, composed of experts who ignore the name of the authors. The Editor will notify the author the date of manuscript receipt.

Papers will be submitted in the Web site http:// cienciaspecuarias.inifap.gob.mx, according the â&#x20AC;&#x153;Guide for submit articles in the Web site of the Revista Mexicana de Ciencias Pecuariasâ&#x20AC;?. Manuscripts should be prepared, typed in a 12 points font at double space (including the abstract and tables), At the time of submission a signed agreement co-author letter should enclosed as complementary file; co-authors at different institutions can mail this form independently. The corresponding author should be indicated together with his address (a post office box will not be accepted), telephone and Email.

Title page Abstract Text Acknowledgments References Tables and Graphics

Title page. It should only contain the title of the work, which should be concise but informative; as well as the title translated into English language. In the manuscript is not necessary information as names of authors, departm ents, institutions and correspondence addresses, etc.; as these data will have to be registered during the capture of the application process on the OJS platform (http:// cienciaspecuarias.inifap.gob.mx). Abstract. On the second page a summary of no more than 250 words should be included. This abstract should start with a clear statement of the objectives and must include basic procedures and methodology. The more significant results and their statistical value and the main conclusions should be elaborated briefly. At the end of the abstract, and on a separate line, a list of up to 10 key words or short phrases that best describe the nature of the research should be stated.

Text. The three categories of articles which are published in Revista Mexicana de Ciencias Pecuarias are the following:

a) Research Articles. They should originate in primary works and may show partial or final results of research. The text of the article must include the following parts: Introduction Materials and Methods Results Discussion Conclusions and implications

To facilitate peer review all pages should be numbered consecutively, including tables, illustrations and graphics, and the lines of each page should be numbered as well. Research articles will not exceed 20 double spaced pages, without including Title page and Tables and Figures (8 maximum). Technical notes will have a maximum extension of 15 pages and 6 Tables and Figures. Reviews should not exceed 30 pages and 5 Tables and Figures.

In lengthy articles, it may be necessary to add other sections to make the content clearer. Results and Discussion can be shown as a single section if considered appropriate.

b) Technical Notes. They should be brief and be

evidence for technical changes, reports of clinical cases of special interest, complete description of a limited investigation, or research results which should be published as a note in the opinion of the editors. The text will contain the same information presented

Manuscripts of all three type of articles published in Revista Mexicana de Ciencias Pecuarias should contain the following sections, and each one should begin on a separate page.

in the sections of the research article but without section titles.

names(s), the number of the edition, the country, the printing house and the year.

c) Reviews. The purpose of these papers is to summarize,

e. When a reference is made of a chapter of book written by several authors; the name of the author(s) of the chapter should be quoted, followed by the title of the chapter, the editors and the title of the book, the country, the printing house, the year, and the initial and final pages.

analyze and discuss an outstanding topic. The text of these articles should include the following sections: Introduction, and as many sections as needed that relate to the description of the topic in question.

10. Acknowledgements. Whenever appropriate, collaborations that need recognition should be specified: a) Acknowledgement of technical support; b) Financial and material support, specifying its nature; and c) Financial relationships that could be the source of a conflict of interest.

f. In the case of a thesis, references should be made of the author’s name, the title of the research, the degree obtained, followed by the name of the City, State, and Country, the University (not the school), and finally the year. Examples

People which collaborated in the article may be named, adding their function or contribution; for example: “scientific advisor”, “critical review”, “data collection”, etc.

The style of the following examples, which are partly based on the format the National Library of Medicine of the United States employs in its Index Medicus, should be taken as a model.

11. References. All references should be quoted in their original language. They should be numbered consecutively in the order in which they are first mentioned in the text. Text, tables and figure references should be identified by means of Arabic numbers. Avoid, whenever possible, mentioning in the text the name of the authors. Abstain from using abstracts as references. Also, “u npu blished observations” and “personal communications” should not be used as references, although they can be inserted in the text (inside brackets).

Journals

Basurto GR, Garza FJD. Efecto de la inclusión de grasa o proteína de escape ruminal en el comportamiento de toretes Brahman en engorda. Téc Pecu Méx 1998;36(1):35-48.

Issue with no volume

Key rules for references

II) Stephano HA, Gay GM, Ramírez TC. Encephalomielitis, reproductive failure and corneal opacity (blue eye) in pigs associated with a paramyxovirus infection. Vet Rec 1988;(122):6-10.

a. The names of the authors should be quoted beginning with the last name spelt with initial capitals, followed by the initials of the first and middle name(s). In the presence of compound last names, add a dash between both, i.e. Elias-Calles E. Do not use any punctuation sign, nor separation between the initials of an author; separate each author with a comma, even after the last but one.

III) Chupin D, Schuh H. Survey of present status of the use of artificial insemination in developing countries. World Anim Rev 1993;(74-75):26-35.

No author given

b. The title of the paper should be written in full, followed by the abbreviated title of the journal without any punctuation sign; then the year of the publication, after that the number of the volume, followed by the number (in brackets) of the journal and finally the number of pages (this in the event of ordinary article).

IV) Cancer in South Africa [editorial]. S Afr Med J 1994;84:15.

Journal supplement

V) Hall JB, Staigmiller RB, Short RE, Bellows RA, Bartlett SE. Body composition at puberty in beef heifers as influenced by nutrition and breed [abstract]. J Anim Sci 1998;71(Suppl 1):205.

c. Accepted articles, even if still not published, can be included in the list of references, as long as the journal is specified and followed by “in press” (in brackets).

d. In the case of a single author’s book (or more than one, but all responsible for the book’s contents), the title of the book should be indicated after the

Standard journal article (List the first six authors followed by et al.)

Organization, as author

VI) The Cardiac Society of Australia and New Zealand. Clinical exercise stress testing. Safety and performance guidelines. Med J Aust 1996;(164):282-284.

In press

XVII) AOAC. Official methods of analysis. 15th ed. Arlington, VA, USA: Association of Official Analytical Chemists. 1990.

VII) Scifres CJ, Kothmann MM. Differential grazing use of herbicide-treated area by cattle. J Range Manage [in press] 2000.

XVIII) SAS. SAS/STAT User’s Guide (Release 6.03). Cary NC, USA: SAS Inst. Inc. 1988. XIX) SAS. SAS User´s Guide: Statistics (version 5 ed.). Cary NC, USA: SAS Inst. Inc. 1985.

Books and other monographs

Author(s)

Electronic publications

VIII) Steel RGD, Torrie JH. Principles and procedures of statistics: A biometrical approach. 2nd ed. New York, USA: McGraw-Hill Book Co.; 1980. IX)

XI)

Chapter in a book

Roberts SJ. Equine abortion. In: Faulkner LLC editor. Abortion diseases of cattle. 1rst ed. Springfield, Illinois, USA: Thomas Books; 1968:158-179.

Conference paper

Olea PR, Cuarón IJA, Ruiz LFJ, Villagómez AE. Concentración de insulina plasmática en cerdas alimentadas con melaza en la dieta durante la inducción de estro lactacional [resumen]. Reunión nacional de investigación pecuaria. Querétaro, Qro. 1998:13.

12. Tables, Graphics and Illustrations. It is preferable that they should be few, brief and having the necessary data so they could be understood without reading the text. Explanatory material should be placed in footnotes, using conventional symbols.

13. Final version. This is the document in which the authors have incorporated all the corrections and modifications asked for by the editors. Graphs and figures should be submitted separately in Microsoft Word, MS Power Point, or Corel Draw. Figures must not be inserted as images within the text. In Tables do not use internal horizontal or vertical lines.

Thesis

14. Once accepted, the final version will be translated into Spanish or English, although authors should feel free to send the final version in both languages. No charges will be made for style or translation services.

XIV) Cairns RB. Infrared spectroscopic studies of solid oxigen [doctoral thesis]. Berkeley, California, USA: University of California; 1965.

15. Thesis will be published as a Research Article or as a Technical Note, according to these guidelines.

Organization as author

XV) NRC. National Research Council. The nutrient requirements of beef cattle. 6th ed. Washington, DC, USA: National Academy Press; 1984.

16. Manuscripts not accepted for publication will be returned to the author together with a note explaining the cause for rejection, or suggesting changes which should be made for re-assessment.

17. List of abbreviations: cal cm

calorie (s) centimeter (s)

Â°C DL50 g ha h i.m. i.v. J kg km L log Mcal MJ m Âľl Âľm mg ml mm min

degree Celsius lethal dose 50% gram (s) hectare (s) hour (s) intramuscular (..ly) intravenous (..ly) joule (s) kilogram (s) kilometer (s) liter (s) decimal logarithm mega calorie (s) mega joule (s) meter (s) micro liter (s) micro meter (s) milligram (s) milliliter (s) millimeter (s) minute (s)

ng p CP PCR pp ppm % rpm sec t TDN AU IU

nanogram (s) probability (statistic) page crude protein polymerase chain reaction pages parts per million percent (with number) revolutions per minute second (s) metric ton (s) total digestible nutrients animal unit international units

gravidity

versus

The full term for which an abbreviation stands should precede its first use in the text.

18. Scientific names and other Latin terms should be written in italics.

XII

AISLAMIENTO DE MICRORNAS Y SU CARACTERIZACIÓN Rev Mex IN SILICO Cienc Pecu 2016;7(3):263-274

Aislamiento de microRNAs a partir de células clorofílicas de Bouteloua gracilis y su caracterización in silico

Isolation of microRNAs from Bouteloua gracilis chlorophyllous cells and their in silico characterization Perla Lucía Ordóñez-Baqueraa, Everardo González-Rodrígueza, Gerardo Armando Aguado-Santacruzb, Quintín Rascón-Cruzc, Eduviges Burrola-Barrazaa

RESUMEN

Bouteloua gracilis es un pasto nativo del norte de México, que es utilizado como fuente de forraje para el ganado por

su alto contenido nutritivo; tiene elevada tolerancia al estrés osmótico que le permite vivir en climas secos; sin embargo, los mecanismos moleculares que le confieren esta tolerancia aún no se han reportado. Existe una clase de RNAs pequeños (sRNAs) llamados microRNAs (miRNAs), que se unen por complementariedad a RNAs mensajeros blanco, etiquetándolos para su degradación o supresión de la traducción. En este trabajo se reporta el aislamiento de sRNAs de B. gracilis, a través de la clonación de concatámeros y su secuenciación. El análisis in silico de la secuencias, permitió la identificación de miRNAs conservados en B. gracilis y reportados en Populus trichocarpa, Brachypodium distachyon, Oryza sativa, Sorghum bicolor , Zea mays, Malus domestica y Linum usitatissimum . Además, se predijo la estructura secundaria de los precursores de dos miRNAs (pre-miRNAs), usando como referencia los genomas de Glycine max , Zea mays, Sorghum bicolor y Oryza sativa . Finalmente, se identificaron seis mRNAs blanco para uno de ellos. La identificación de miRNAs en Bouteloua gracilis, ayudará a comprender como estas moléculas regulan la expresión genética en esta especie, y sus relaciones con los mecanismos de respuesta a estrés ambiental. PALABRAS CLAVE: Navajita azul, miRNAs, Regulación genética, Análisis bioinformático.

ABSTRACT

Bouteloua gracilis is a grass native to Mexico, it is used as forage source for livestock because of its high nutritional

value. It has high tolerance to osmotic stress and therefore can live in arid zones; however, regulation mechanisms in gene expression that confer these characteristics have not been reported. There is a class of small RNAs (sRNAs) called microRNAs (miRNAs), which regulate gene expression. They are complementary and act by binding to messenger RNAs (mRNAs to inhibit translation or by degrading them. In this work, the isolation of sRNAs from B. gracilis through cloning and sequencing of concatemers is reported. In silico analysis of the sequences obtained allowed to identify conserved sequences in Populus trichocarpa, Brachypodium distachyon, Oryza sativa, Sorghum bicolor, Zea mays, Malus domestica, and Linum usitatissimum. Furthermore, the secondary structure of the miRNA precursor (premiRNA) was predicted from two sequences isolated from In silico analysis using Glycine max, Zea mays, Sorghum bicolor, and Oryza sativa as reference genomes. Finally, six target mRNAs were identified for one of the miRNAs obtained. Identification of miRNAs in Bouteloua gracilis will help to understand how these molecules regulate gene expression and in the future will allow for the study at molecular level, providing insight on how this grass responds to environmental stress. KEY WORDS: Blue gramma, miRNAs, Genetic regulation, Bioinformatics analysis. Recibido el 20 de mayo de 2015. Aceptado el 19 de septiembre de 2015. a

b c

Facultad de Zootecnia y Ecología, Universidad Autónoma de Chihuahua. Periférico R. Almada Km. 1 C.P. 31453, Chihuahua, Chihuahua, México. Tel (614) 4340303. evegonzal@uach.mx. Correspondencia al segundo autor. Programa de Posgrado, Instituto Tecnológico de Roque. Celaya, Guanajuato, México.

Facultad de Ciencias Químicas, Universidad Autónoma de Chihuahua. Chihuahua, México.

263

Perla Lucía Ordóñez-Baquera, et al. / Rev Mex Cienc Pecu 2016;7(3):263-274

INTRODUCCIÓN

INTRODUCTION

En plantas, estas moléculas participan en la regulación de diferentes etapas fisiológicas, como el cambio de la fase vegetativa a la floral, en el desarrollo y crecimiento de hojas, tallos, raíces y de órganos reproductivos. También se ha encontrado que los miRNAs regulan la respuesta de las plantas a distintas condiciones de estrés abiótico y biótico como la carencia de nutrientes, salinidad, sequia, estrés oxidativo, frio, radiación UV y por la presencia de virus(2,3). Estudios in silico dirigidos a la ortología de los miRNAs en plantas, han demostrado que los miRNAs son conservados entre especies; sin embargo, también existen miRNAs específicos de especie(4). Los miRNAs maduros en plantas son conservados en mayor grado que los premiRNAs(2,5). La mayoría de los miRNAs que se encuentran conservados en distintas especies regulan genes homólogos(5), esta característica permite analizar y predecir los posibles RNAs mensajeros blancos de miRNAs de especies que no tienen su genoma secuenciado. La predicción de mRNA blanco es indispensable para identificar la función del miRNA, por lo general, esto se realiza bioinformáticamente. El principal criterio usado es la detección de secuencias

In plants, these molecules are involved in the regulation of different physiological stages, as the change of the vegetative to the floral development and growth of leaves, stems, roots and reproductive organs. It has also been found that miRNAs regulate plant response to various abiotic and biotic stress such as lack of nutrients, salinity, drought, oxidative stress, cold, UV radiation and the presence of virus(2,3). In silico studies aimed at orthologous plant miRNAs have shown that miRNAs are conserved between species; however, there are also species-specific miRNAs (4) . Mature miRNAs in plants are preserved to a greater extent than premiRNAs(2,5). Most miRNAs that are conserved in different species homologous genes regulate(5), this feature allows to analyze and predict potential targets messenger RNAs of miRNAs in species that have its genome sequenced. Predicting target mRNA is usually essential to identify the role of miRNA, this is done by bioinformatics analysis. The main criterion used is the detection of complementary sequences between the miRNA and its target(6). This is possible because the complementarity between them is perfect or nearly perfect, allowing quick identification and reliable target mRNAs(2,7).

Los miRNAs son secuencias de RNA de cadena sencilla, de 18 a 25 nucleótidos de longitud; en plantas, su biogénesis inicia cuando los genes MIRNAS son transcritos por la RNA polimerasa II, generando transcritos primarios con longitudes de 200 a 300 nucleótidos denominados como pri-miRNAs, que son procesados a una estructura única de talloburbuja por la acción de una ribonucleasa III (DCL), generando un dúplex de pre-miRNA; este dúplex es transportado del núcleo al citoplasma en donde se une con el complejo Argonauta (AGO) conformando el complejo RISC; finalmente, el complejo se une por complementariedad a los RNAs mensajeros objetivo, induciendo degradación o supresión de la traducción, por que los miRNAs son considerados moléculas silenciadoras de la expresión genética(1).

Sequences of miRNAs are single stranded RNA in 18 to 25 nucleotides in length; on plants, their biogenesis starts when miRNAs genes are transcribed by RNA polymerase II, generating primary transcripts with lengths of 200 to 300 nucleotides referred to as pri-miRNAs, which are transcripts containing a short internal stemloop structure near the ribonuclease III (DCL), generating a pre-miRNA duplex. This duplex is transported from the nucleus to the cytoplasm where it joins the complex Argonauta (AGO) forming the RNA-induced silencing complex (RISC); finally, the complex binds to messenger RNAs complementary to the target, inducing degradation or suppression of translation, the miRNAs are considered silencing molecules of gene expression(1).

264

AISLAMIENTO DE MICRORNAS Y SU CARACTERIZACIÓN IN SILICO

Bouteloua gracilis (Willd. Ex Kunth) Lag. ex

complementarias entre el miRNA y su blanco(6); esto es posible ya que la complementariedad entre ellos es perfecta o casi perfecta, lo que permite una identificación de mRNAs blanco rápida y confiable(2,7).

Griffiths is a perennial grass belonging to the Poaceae family with C4 metabolism are of thin stem that grow in forests, grasslands and thickets(8,9). They are found in semi-arid regions of the United States and Mexico(10). This grass is of great economic importance, because it is a source of fodder for feeding cattle and native wildlife, for its high protein content and high digestibility, and its ability to adapt to adverse weather conditions such as drought and cold(11,12). Due to the above features, this grass has been subject to various ecological and physiological investigations. However, to date there is no information about the miRNAs expressed in B. gracilis and therefore its relationship with the regulation of gene expression in this grass is unknown. In this work sequences of small RNAs from cells chlorophyll Bouteloua gracilis were isolated and characterized, with the aim of identifying miRNAs. In addition, an in silico analysis was carried out to identify potential target mRNAs of miRNAs, as well as a search of the biological processes in which these genes involved was performed.

Bouteloua gracilis (Willd. ex Kunth) Lag. ex

Griffiths es un pasto perenne perteneciente a la familia Poaceae con metabolismo C4, de tallo delgado que crece en bosques, pastizales y matorrales(8,9). Se localiza en las regiones semiáridas de los Estados Unidos y México(10). Esta gramínea es de gran importancia económica, ya que es fuente de forraje para la alimentación de ganado bovino y fauna nativa, por su alto contenido de proteína y alto grado de digestibilidad, además de su capacidad de adaptación a climas adversos como sequía y frío(11,12). Debido a las características anteriores, este pasto ha sido sujeto de diversas investigaciones ecológicas y fisiológicas. Sin embargo, a la fecha no existe información acerca de los miRNAs expresados en B. gracilis y por lo tanto, se desconoce su relación con la regulación de la expresión genética en este pasto. En el presente trabajo se aislaron y caracterizaron secuencias de RNAs pequeños a partir de células clorofílicas de Bouteloua gracilis, con el objetivo de identificar miRNAs. Además, se realizó un análisis in silico para la identificación de los potenciales mRNAs blanco de los miRNAs encontrados, así como la búsqueda de los procesos biológicos en los que participan estos genes.

MATERIAL AND METHODS

Growth of chlorophyll cells of B. gracilis

The cell line was developed in INIFAP-Celaya(13). An inoculum of chlorophyll cells Bouteloua gracilis (HBK) Lag added. ex Steud., TIANSJ98, 25 ml of liquid medium MPC, the basal medium containing Murashige-Skoog plant, 2,4-D, BAP, adenine and sucrose at pH 5.8. Cultures were maintained under stirring at 90 rpm, with continuous fluorescent light (77 mol-1 m-2) at a temperature of 33 ± 1 °C for 5 d. Subsequently, cells were harvested by filtration and the excess medium was removed. They were frozen in liquid nitrogen and stored at -70 °C until used.

MATERIAL Y MÉTODOS

Crecimiento de células clorofílicas de B. gracilis

La línea celular se desarrolló en INIFAPCelaya(13). Se agregó un inóculo de células clorofílicas de Bouteloua gracilis (H.B.K.) Lag. ex Steud., TIANSJ98, a 25 ml de medio MPC líquido, el cual contiene medio basal para plantas Murashige-Skoog, 2,4-D, bencilaminopurina, adenina y sacarosa a pH de 5.8. Los cultivos se mantuvieron en agitación a 90 rpm, con luz continua fluorescente (77 mols-1 m-2) a una temperatura de 33 ± 1 °C durante cinco días.

Extraction of total RNA

Approximately 150 mg of B. gracilis cells were lysed by maceration with the Sample Grinding 265

Perla Lucía Ordóñez-Baquera, et al. / Rev Mex Cienc Pecu 2016;7(3):263-274

Posteriormente, las células se cosecharon por filtración y se eliminó el exceso de medio. Se congelaron en nitrógeno líquido y se almacenaron a -70 °C hasta su uso.

Kit™ (GE Healthcare, Sweden) system and subsequently RNA was isolated using the extraction method Trizol™ (Ambion, USA) and Plant RNA Isolation Kit™ (Ambion, USA) according to the manufacturers specifications.

Extracción de RNA total

Cloning of sRNAs

Aproximadamente 150 mg de células de B. gracilis se lisaron por maceración con el sistema “Sample Grinding Kit™ (GE Healthcare, Suecia) y posteriormente, el RNA se aisló con el uso del método de extracción con Trizol™, (Ambion, EUA) y Plant RNA Isolation Kit™ (Ambion, EUA) de acuerdo a las especificaciones de los fabricantes.

The cloning of the sRNAs by concatemerization was performed with the miRCat™ (Integrated DNA Technologies, USA) kit according to the manufacturer’s recommendations. Concatemers obtained were cloned into the PCR 4-TOPO (Invitrogen™, USA) vector for later insertion into chemically competent bacteria E. coli TOP10 One Shot™ (Invitrogen, USA). From the transformed cells, by extraction of plasmid DNA by the alkaline lysis miniprep was performed. SRNAs sequences inserted at the site of the polylinker of four PCR-TOPO vector was amplified with T7™ (5’-TAA-TAC-GAC-TCA-CTA-TAG-GG-3’) and T3™ (5’ oligonucleotides -ATT-AAC-CCT-CACTAA-GA-AGG-3’) flanking the cloning sites of the vector. The amplification program used a 94 °C initial denaturation for 1 min, 35 cycles of denaturation at 94 °C for 1 min, alignment at 55 °C for 1 min, extension at 72 °C for 1 min and at the end of the cycles, a final 72 °C extension for 10 min. The PCR products were separated on agarose gel 1.5% and the bands 190 to 400 base pair (bp) were recovered from the gel and purified using minicolumns by Wizard SV Gel and Clean-Up System according to fabricant specifications. The purified DNA was amplified and sent for synthesis and DNA sequencing at the Institute of Biotechnology of the UNAM located at Cuernavaca, Morelos, Mexico. Sequencing was performed on a Perkin Elmer Model 3730 (Applied Biosystems, USA).

Clonación de sRNAs

La clonación de los sRNAs por concatemerización se realizó con el kit miRCat™ (Integrated DNA Technologies, EUA) de acuerdo a las recomendaciones del fabricante. Los concatámeros obtenidos se clonaron en el vector PCR-TOPO 4 (Invitrogen™, EUA) para posteriormente introducirlo en bacterias químicamente competentes de E. coli One Shot TOP10™ (Invitrogen, EUA). A partir de las células transformadas, se realizó extracción de DNA plasmídico por minipreparación por lisis alcalina. Las secuencias de sRNAs insertadas en el sitio del polilinker del vector PCR-TOPO 4 se amplificaron con los oligonucleótidos T7™ (5’-TAA-TAC-GAC-TCA-CTA-TAG-GG-3’) y T3™ (5’ATT-AAC-CCT-CAC-TAA-AGG-GA-3’) que flanquean los sitios de clonación del vector. El programa de amplificación utilizado fue de desnaturalización inicial 94 ºC por 1 min, 35 ciclos de desnaturalización a 94 ºC por 1 min, alineamiento 55 ºC 1 min, extensión 72 ºC por 1 min y al finalizar los ciclos, una extensión final a 72 °C durante 10 min. Los productos de PCR se separaron en gel de agarosa al 1.5% y las bandas de 190 a 400 pares de bases (pb) se recuperaron del gel y se purificaron con el uso de minicolumnas Wizard SV Gel and CleanUp System™ de acuerdo a las especificaciones del proveedor. El DNA amplificado y purificado se envió a la unidad de síntesis y secuenciación

Bioinformatics analysis

The obtained sequences were downloaded for FASTA alignment analysis and by using the BLASTn program through NCBI platform (http:/ /blast.ncbi.nlm.nih.gov/Blast.cgi) with the algorithm for alignment two or more sequences, and preset parameters for an alignment of high similarity (MegaBLAST). Sequences corresponding 266

AISLAMIENTO DE MICRORNAS Y SU CARACTERIZACIÓN IN SILICO

de DNA del Instituto de Biotecnología de la UNAM, ubicado en Cuernavaca, Morelos, México. La secuenciación se realizó en un equipo Perkin Elmer modelo 3730 (Applied Biosystems, EUA).

to vector were eliminated, as well as the connector (5'-ACC-TTG-CCT-GTG-ACA G-3') that are present in sequences possible miRNAs.

The candidate sequences of 18 to 25 nucleotids were analyzed in the miRBase(14) database and compared with mature miRNAs Viridiplantae kingdom there reported, according to the algorithm and preset parameters. Candidate sequences were also analyzed in the UEA Workbench(15) with platform miRCat tool for the precursor sequence and secondary structure. They were used as reference genomes of Oryza sativa, Zea mays, Sorghum bicolor and Glycine max with preset parameters. Moreover, all sequences were compared to the Rfam(16) database for possible annotations within the different types of RNAs (rRNAs, tRNAs, mRNAs, ncRNAs, etc.) with preset parameters.

Análisis bioinformático

Las secuencias obtenidas se descargaron en formato FASTA y mediante análisis de alineamiento utilizando el programa BLASTn, a través de la plataforma del NCBI (http:// blast.ncbi.nlm.nih.gov/Blast.cgi), con el algoritmo de alineamiento de dos o más secuencias, y parámetros preestablecidos para un alineamiento de alta similitud (Megablast). Se eliminaron secuencias correspondientes al vector, así como las de los conectores (5’-ACCTTG-GTG-CCT-ACA-G-3’) presentes entre secuencias de los posibles miRNAs.

Finally, the sequences similar to known miRNAs in order to find target mRNA was carried out using the psRNATarget(17) program. Because the genome of Bouteloua gracilis has not been reported, the database annotation of transcripts rice MSU version 7(18) was used. The parameters used for searching for target mRNAs were more restrictive than the default values, “E value” (maximum expectation) maximum used was 2.0 (3.0 default) and “UPE” value (accessibility to the binding region) up to 20 (25 default); by decreasing the maximum values of both parameters fewer false positives are obtained(17). Sequences of potential target genes were downloaded, and functional analysis of these, with Blast2GO program(19) was performed.

Las secuencias candidato de 18 a 25 nucleótidos se analizaron en la base de datos miRBase(14), comparándose con los miRNAs maduros del reino Viridiplantae ahí reportados, de acuerdo al algoritmo y parámetros preestablecidos. Las secuencias candidatas también se analizaron en la plataforma UEA Workbench (15) con la herramienta miRCat, para obtener la secuencia precursora, así como su estructura secundaria. Se usaron como referencia los genomas de Oryza sativa, Zea mays, Sorghum bicolor y Glycine max con los parámetros preestablecidos. Además, todas las secuencias se compararon con la base de datos Rfam(16) para buscar posibles anotaciones dentro de los diferentes tipos de RNAs (rRNAs, tRNAs, mRNAs, ncRNAs, etc.) con los parámetros preestablecidos.

RESULTS

Identification of miRNAs in Bouteloua gracilis

Finalmente, a las secuencias que tuvieron similitud con miRNAs conocidos se les realizó la búsqueda de mRNA objetivo con el programa psRNATarget(17). Debido a que el genoma de Bouteloua gracilis no se ha reportado, se utilizó la base de datos de anotación de transcritos de arroz MSU versión 7(18). Los parámetros usados para la búsqueda mRNAs objetivo fueron más restrictivos que los preestablecidos, el “E value”

Ten (10) plasmids were amplified, four were selected to generate PCR products ranging from 400 to 150 nucleotides. Sequencing and analysis of the amplified DNA showed the existence of nine sequences with lengths of 18 to 25 nucleotides of the miRNAs characteristic (Table 1). These sequences were analyzed on the basis of data Rfam observed lack of similarity with 267

Perla Lucía Ordóñez-Baquera, et al. / Rev Mex Cienc Pecu 2016;7(3):263-274

Cuadro 1. Análisis in silico de las secuencias de sRNAs obtenidas a partir de concatámeros de B. gracilis Table 1. In silico analysis of sRNAs sequences obtained from B. gracilis concatemers No 1 2 3 4 5 6 7 8 9

Sequence 5'-3'

GATCAGATGGAGGCTAAAATC AGGGAGCACCCTTCAGTCCAA TTTCATCAACGCTGCACTCAA ATTGAGTGCAGCGTTGATGAA ACCAACTAACCTTAGGCA AAACCCCAGTTTCACACCTCCGCT GTACACACATCGATCAGTCTTATT TGTACATCACTAAGGTAACAAAA CAATGACATCGCAAACAAGTGCCT

21 21 21 21 18 24 24 23 24

MiRBase database(14) was used to identify mature miRNAs.

miRBase

miR7828-5p miR319 miR397-3p miR397-5p NF NF NF NF NF

Species

Ptr Bdi Osa Sbi Zma Mdm Lus Bdi NA NA NA NA NA

Lg= Length of the sequence; Ptr= Populus trichocarpa; Bdi= Brachypodium distachyon; Osa= Oryza sativa; Sbi= Sorghum bicolor; Zma= Zea mays; Mdm= Malus domestica; Lus= Linum usitatissimum. NF=Not found; NA= Not apply.

(máxima expectación) máximo usado fue 2.0 (3.0 preestablecido) y el valor “UPE” (accesibilidad a la región de unión) como máximo 20 (25 preestablecido); al disminuir los valores máximos de ambos parámetros se obtienen menos falsos positivos (17) . Se descargaron las secuencias de los genes objetivo potenciales, y se realizó un análisis funcional de estos, con el programa Blast2GO(19).

reported there RNAs (rRNA, tRNA snRNA, snoRNA). Analysis of sequence homology with the miRNAs deposited in miRBase(14) showed that sequences 1 to 4 had the best alignment with the miRNAs miR7828-5p of Populus trichocarpa (20) ; the miR319 reported in Brachypodium distachyon(21), Oryza sativa(22), Sorghum bicolor(23) and Zea mays(24); the miR397-3p from Malus(25) and the miR397-5p reported in Linum usitatissimum (26) and Brachypodium distachyon(23). However, five to nine sequences did not show similarity to previously reported miRNAs.

RESULTADOS

Identificación de miRNAs en B. gracilis

De 10 plásmidos que fueron amplificados, se seleccionaron cuatro que generaron productos de PCR en un rango de 400 a 150 nucleótidos. La secuenciación y análisis del DNA amplificado demostró la existencia de nueve secuencias con longitudes de 18 a 25 nucleótidos característicos de los miRNAs (Cuadro 1). Estas secuencias se analizaron en la base de datos Rfam, observándose la ausencia de similitud con los RNAs ahí reportados (rRNA, tRNA snRNA, snoRNA). El análisis de homología de las secuencias con los miRNAs depositados en miRBase(14), demostró que las secuencias uno

In order to characterize these sequences, the UEA miRCat Workbench tool(15) was used which is a platform for predicting new miRNAs, as well as for performing mapping studies of potential miRNAs in a genome of interest. If the mapping of such genome is positive, it allows for determining whether the miRNA precursor sequence has a stem-loop (pre-miRNAs) secondary structure. The analysis was performed with all the obtained sequences and the results demonstrated that only miRNAs and characterized (miR397 and miR319) generated pre-miRNAs. So the sequence two (miR319) 268

AISLAMIENTO DE MICRORNAS Y SU CARACTERIZACIÓN IN SILICO

was located in the genomes of Zea mays, Oryza sativa and Sorghum bicolor where the structure of the pre-miRNA (Table 2, Figure 1) was obtained. With respect to sequence four (miR397-5p) it was also possible to identify their

a cuatro tuvieron el mejor alineamiento con los miRNAs miR7828-5p de Populus trichocarpa(20); el miR319 reportado en Brachypodium distachyon (21), Oryza sativa (22), Sorghum bicolor(23) y en Zea mays(24); el miR397-3p de

Cuadro 2. Análisis in silico de las secuencias de sRNAs obtenidas a partir de concatámeros de B. gracilis, con la plataforma miRCat(15), con los genomas de soya, maíz, sorgo y arroz Table 2. In silico analysis of sRNAs sequences obtained from concatemers of B. gracilis, with miRCat platform (15), with the genomes of soybean, corn, sorghum and rice Spe

Zma Osa Sbi Gma Gma

Loc

chr3 Os01g46984 chro_3 Gm08 Gm13

Start

210558024 541 1240353 4639122 34383089

End

210558044 561 1240373 4639142 34383109

St -

Sec 5'-3'

AGGGAGCACCCTTCAGTCCAA AGGGAGCACCCTTCAGTCCAA AGGGAGCACCCTTCAGTCCAA ATTGAGTGCAGCGTTGATGAA ATTGAGTGCAGCGTTGATGAA

21 21 21 21 21

Lg Pre 170 192 200 179 136

% G/C 54 50 56 39 37

MFE

-66.5 -80.1 -94.3 -67.3 -56.4

Spe= Species; Loc= location in the genome; Start= Location of start of sequence in the genome; End= Location of end of the sequence in the genome; St= string where sequence is located: Sec 5'-3‘= sequence in the 5’ to 3 ‘ direction; Lg= length of the sequence; Lg Pre= length precursor sequence; %G/C= percentage of the content of guanine and cytokines in the premiRNA sequence; MFE= minimum free energy of the structure of pre-miRNA; Zma= Zea mays; Osa= Oryza sativa; Sbi= Sorghum bicolor; Gma= Glycine max; Gm08= Cromosome 8; Gm13= Cromosome 13; chro_3= Cromosome 3; Os01g46984= location number of the rice genome sequence.

Figura 1.

Figure 1.

Estructura secundaria de los pre-miRNAs predichos bioinformáticamente para la secuencia dos (miR3193p). En verde, se señala la secuencia del miRNA identificado. A) Localización en el cromosoma uno de Oryza sativa. B) Localización en el cromosoma tres de Sorghum bicolor. C). Localización en el cromosoma tres de Zea mays Secondary structure bioinformatically predicted of pre-miRNAs for sequence two (miR319-3p). Green indicates the miRNA sequence identified. A) Location of chromosome one of Oryza sativa. B) Location of chromosome three of Sorghum bicolor. C). Location of chromosome three of Zea mays

AGGGAGCACCCTTCAGTCCAA_LOC_Os 01g46984_541-561

AGGGAGCACCCTTCAGTCCAA_chromosome_3_ 1240353-1240373

269

AGGGAGCACCCTTCAGTCCAA_chr3_ 210558024-210558044

Perla Lucía Ordóñez-Baquera, et al. / Rev Mex Cienc Pecu 2016;7(3):263-274

Malus domestica(25) y el miR397-5p reportado en Linum usitatissimum(26) y en Brachypodium distachyon(23) (Cuadro 1). Sin embargo, las

secondary structure, but only in the genome of Glycine max (Table 2; Figure 2). Regarding sequences one, five, six, seven, eight and nine, none could be identified in any of the reference genomes.

secuencias cinco a nueve, no mostraron similitud con miRNAs reportados previamente.

Con el fin de caracterizar estas secuencias, se utilizó la herramienta miRCat de la plataforma UEA Workbench(15) que tiene como función la predicción de miRNAs nuevos, ya que realiza un mapeo de los potenciales miRNAs en estudio a un genoma de interés, y en caso de que el mapeo sea positivo a dicho genoma, determina si el miRNA tiene una secuencia precursora con estructura secundaria tallo-burbuja (premiRNAs). El análisis se realizó con todas las secuencias obtenidas y los resultados demostraron que sólo los miRNAs ya caracterizados (miR397 y miR319) generaron pre-miRNAs. Así la secuencia dos (miR319) se localizó en los genomas de Zea mays, Oryza sativa y Sorghum bicolor donde se obtuvo la estructura de su pre-miRNA (Cuadro 2; Figura 1). Respecto a la secuencia cuatro (miR397-5p)

MRNA target identification

Using the psRNATarget(17) program, predicted target mRNAs were used to identify potential targets of all sequences based on the degree of complementarity and the ability to access the complementary region. The analysis showed that only miR397-5p predicted six possible target mRNAs, which encode proteins laccases (Table 3). Functional analysis of target genes showed that encode proteins involved in metabolic processes and catabolic processes of lignin phenylpropanoids. In addition to these functions, each gene has different annotation involved in other processes. Five (Os01g63190, Os01g 63200, Os05g38420, Os11g48060 and Os12g 15680) have copper binding annotation. Two (Os01g63200 and Os12g15680) participate in

Figura 2. Estructura secundaria de los pre-miRNAs predichos bioinformáticamente para la secuencia cuatro (miR3975p). En verde se señala la secuencia del miRNA identificado. A) Localización en el cromosoma ocho de Glycine max. B) Localización en el cromosoma 13 de Glycine max Figure 2. Secondary structure bioinformatically predicted of pre-miRNAs for sequence for four (miR397-5p). In green the miRNA sequence identified is shown. A) Location of chromosome eight of Glycine max. B) Location of chromosome 13 of Glycine max

270

AISLAMIENTO DE MICRORNAS Y SU CARACTERIZACIÓN IN SILICO

Cuadro 3. mRNAs blanco predichos para la secuencia cuatro (miR397-5p) identificados con el programa psRNATarget(17) Table 3. Predicted target mRNAs for four string (miR397-5p) identified with psRNATarget program(17) Name Target Os05g38420 Os12g15680 Os01g63180 Os01g63200 Os11g48060 Os01g63190

1.0 1.5 1.5 1.5 1.5 2.0

UPE 17.7 13.1 17.4 19.7 14.5 17.5

Target start 746 748 1087 665 1179 753

Target end

Target Alignment 5'-3'

765 767 1106 684 1198 772

UCAUCAACGCUGCACUCAAC UCAUCAACGCUGCGCUCAAC UCAUCAACGCUGCGCUCAAC UCAUCAACGCUGCAGUCAAU UCAUCAACGCUGCACUGAAU UCAUCAACGCUGGACUCAAC

Database annotation of rice transcripts MSU version 7(18) was used as reference.

Target Description

Protein Precursor laccase Protein Precursor laccase Precursor laccase6 Protein Precursor laccase Precursor laccase 22 Protein Precursor laccase

Ev= Expectation value; UPE= Accessibility to the target value.

también fue posible identificar su estructura secundaria, pero únicamente en el genoma de Glycine max (Cuadro 2; Figura 2). Respecto a las secuencias uno, cinco, seis, siete, ocho y nueve, no fue posible identificarlas en ninguno de los genomas de referencia.

the development of the reproductive system. While Os11g48060 has functions involved in cell wall formation and Os05g38420 is involved in responses due to lack of water.

Identificación de RNAm blancos

Obtaining similar sequences to mature miRNAs reported in miRBase for Bouteloua gracilis indicates that synthesizes these molecules for the regulation of their gene expression. Nine isolated sequences, only four were similar to miRNAs conserved in miRBase; while the remaining five, no records of orthologous sequences in other plant species found. Mapping analysis with miRCat program indicated miRNAs potential, with genomes of other plant species showed clear correlation of miRNAs reported in miRBase and mapping the genomes of the species in which they were identified, and the generation of stable stem-loop secondary structures; however, the rest did not show any selected genome mapping. Together, these results confirm the high degree of conservation of miRNAs, miR319 and miR397 found in grasses such as Zea mays, Oryza sativa and Sorghum bicolor, in addition to the legume Glycine max, as well as in B. gracilis. It is interesting that although the number of sequences obtained is low, it was possible to detect the presence of both miR397-5p since it is complementary to

DISCUSSION

Con el uso del programa psRNATarget(17) que predice mRNAs objetivo con base en el grado de complementariedad y en la capacidad de acceso a la región complementaria, se procedió a la identificación de los posibles blancos de todas las secuencias. El análisis demostró que sólo a miR397-5p fue posible predecirle seis mRNAs objetivo, los cuales codifican para proteínas lacasas (Cuadro 3). El análisis funcional de los genes blanco demostró que las proteínas que codifican participan en procesos metabólicos de lignina y procesos catabólicos de fenilpropanoides. Además de estas funciones, cada gen tiene anotación distinta involucrada en otros procesos. Cinco (Os01g63190, Os01g63200, Os05g38420, Os11g48060 y Os12g15680) tienen anotación de unión a Cobre. Dos (Os01g63200 y Os12g15680) participan en el desarrollo del sistema reproductivo. Mientras que Os11g48060 tiene funciones involucradas en la formación de pared celular y Os05g38420 participa durante la respuesta por falta de agua. 271

Perla Lucía Ordóñez-Baquera, et al. / Rev Mex Cienc Pecu 2016;7(3):263-274

miR397-3p, so this miRNA might be active in B. gracilis. Regarding sequences five to nine, the absence of orthologs and the negative to one of the reference genomes employees mapping indicates the possibility that these sequences are specific to B. gracilis. Regarding sequence one, although it was similar with miR7828-5p of Populus trichocarpa, it was very low, since it had five mismatches.

DISCUSIÓN

La obtención de secuencias similares a miRNAs maduros reportados en la miRBase indica que Bouteloua gracilis sintetiza estas moléculas para la regulación de su expresión genética. De las nueve secuencias aisladas, sólo cuatro tuvieron similitud con miRNAs conservados en la miRBase; mientras que en las cinco restantes, no se encontraron registros de secuencias ortólogas en otras especies de plantas. El análisis de mapeo con el programa miRCat de nuestros potenciales miRNAs, con genomas de otras especies de plantas demostró clara correlación de los miRNAs reportados en la miRBase y su mapeo en los genomas de las especies en las que fueron identificadas, así como la generación de estructuras secundarias tallo-burbuja estables; sin embargo, el resto no mostró mapeo a ningún genoma seleccionado. En conjunto, estos resultados confirman el alto grado de conservación de los miRNAs, miR319 y miR397 encontrados en gramíneas como Zea mays, Oryza sativa y Sorghum bicolor, además de la leguminosa Glycine max, así como en B. gracilis. Es interesante comentar que aunque la cantidad de secuencias obtenidas es baja, fue posible detectar la presencia tanto del miR397-5p, como de su complementario miR397-3p, por lo que es posible que este miRNA tenga participación activa en B. gracilis . Con respecto a las secuencias cinco a nueve, la ausencia de ortólogos así como el mapeo negativo a alguno de los genomas de referencia empleados, indica la posibilidad de que estas secuencias sean específicas a B. gracilis. Respecto a la secuencia uno, a pesar de que tuvo similitud con el miR7828-5p de Populus trichocarpa, ésta fue muy baja, ya que tuvo cinco incomplementariedades.

The detected potential target mRNAs were predicted from the sequence four (miR397-5p); therefore, it is possible that the expression of this miRNA negatively regulates expression of laccases, which are glycoprotein enzymes having the function of oxidizing phenolic compounds present in the lignin(27). Inhibition of expression of these enzymes may be due to the fact that, as the chlorophyll cells are undifferentiated, in which there is the presence of lignin, the presence of laccases oxidize to such phenolic compounds are required. On the other hand, in the absence of lignin present, laccases could oxidize other phenolic compounds, which could affect the proper functioning of cells. Further, these genes had also functional annotations involved in the development of the reproductive system, formation of cell wall and response to lack of water, so it is expected that these genes are being muted because it is possible that none of these biological processes occur in undifferentiated cells, from which this study was done. On the other hand, miR319 is a much characterized miRNA, and although it was not possible predict a target in this analysis, it has been reported that one of its main objectives is in TCP transcription factors class II; which participate in the negative regulation of cell growth as reported in Arabidopsis(28).

Los potenciales mRNAs blanco detectados fueron predichos a partir de la secuencia cuatro (miR397-5p); por tanto, es posible que la expresión de este miRNA regule de manera negativa la expresión de las lacasas, que son enzimas glicoprotéicas que tienen la función de oxidar compuestos fenólicos presentes en la

The fact that other sequences did not present potential targets does not mean they do not exist; the above, it may be due to the fact that the selected parameters for analysis were very high to avoid false positives, or that targets are specific sequences of B. gracilis. 272

AISLAMIENTO DE MICRORNAS Y SU CARACTERIZACIÓN IN SILICO

lignina(27). La inhibición de la expresión de estas enzimas puede ser debida al hecho de que, como las células clorofílicas son indiferenciadas, en las que no existe la presencia de lignina, no se requiere la presencia de lacasas para que oxiden a dichos compuestos fenólicos. O bien, al no haber lignina presente, las lacasas pudieran oxidar otro tipo de compuestos fenólicos, lo que podría afectar el buen funcionamiento celular. Además, estos genes también tuvieron anotaciones funcionales involucradas en el desarrollo del sistema reproductivo, en formación de pared celular y respuesta a falta de agua, por lo que también es de esperarse que estos genes estén siendo silenciados, ya que es posible que ninguno de estos procesos biológicos ocurra en las células indiferenciadas, a partir de las cuales se realizó este estudio. Por otro lado, el miR319 es un miRNA muy caracterizado, y aunque no fue posible predecirle algún blanco en este análisis, se ha reportado que tiene como objetivos principales los factores de transcripción TCP clase II; los cuales, participan en la regulación negativa del crecimiento celular reportado en Arabidopsis(28).

CONCLUSIONS AND IMPLICATIONS

In this study it was possible to identify four miRNAs reported in miRBase; two of them are highly conserved. These results confirm the presence of small RNAs and miRNAs in B. gracilis . The identification of miR397-5p, miR397-3p, as well as their potential target mRNAs that encode for enzymes with laccase activity, is an indication that this molecule is very active in these cells. The evaluation of this miRNA expression in different plant tissues and cells and plants grown under conditions of water stress, will reveal the physiological relevance of this miRNA in B. gracilis.

ACKNOWLEDGMENTS

Luz Angelica Muñoz for technical help.

End of english version

como en células y plantas desarrolladas bajo condiciones de estrés hídrico, permitirá conocer la relevancia fisiológica que tiene este miRNA en B gracilis.

El hecho de que el resto de secuencias no presentaran posibles blancos no significa que estos no existan; lo anterior, se puede deber a que los parámetros seleccionados para realizar el análisis fueron muy elevados para evitar al máximo falsos positivos, o que los blancos sean secuencias específicas de B. gracilis.

AGRADECIMIENTOS

A la M.C. Luz Angélica Muñoz Bañales, por la ayuda técnica recibida.

CONCLUSIONES E IMPLICACIONES

En el presente estudio fue posible identificar cuatro miRNAs reportados en miRBase; dos de ellos, altamente conservados. Estos resultados confirman la presencia de RNAs pequeños como los miRNAs en B. gracilis. La identificación del miR397-5p, miR397-3p, así como sus potenciales mRNAs objetivo, que codifican a enzimas con actividad de lacasas, es un indicio de que esta molécula participa muy activamente en estas células. La evaluación de la expresión de este miRNA en diferentes tejidos de la planta, así

LITERATURA CITADA 1. 2. 3.

273

Mallory AC, Vaucheret H. Functions of microRNAs and related small RNAs in plants. Nat Genet 2006;38:S31-S36. Jung JH, Seo PJ, Park CM. MicroRNA biogenesis and function in higher plants. Plant Biotechnol Rep 2009;3:111-126.

Luan F, Han Y, Zhu H, Shao Y, Chen A, Tian H, Luo Y, Zhu B. Computational predicting novel microRNAs in tomato and validating with RT-PCR. Russian J Plant Physiol 2010;57:469479.

Perla Lucía Ordóñez-Baquera, et al. / Rev Mex Cienc Pecu 2016;7(3):263-274 4.

5. 6.

7. 8. 9.

Guzman F, Almerao MP, Körbes AP, Loss-Morais G, Margis R. Identification of microRNAs from Eugenia uniflora by high-throughput sequencing and bioinformatics analysis. PLoS ONE 2012;7:e49811.

next generation sequencing microRNA and small RNA datasets. Bioinformatics 2012;28:2059-2061.

Jones-Rhoades MW. Conservation and divergence in plant microRNAs. Plant Mol Biol 2012;80:3-16.

16. Burge SW, Daub J, Eberhardt R, Tate J, Barquist L, Nawrocki EP, Eddy SR, Gardner PP, Bateman A. Rfam 11.0: 10 years of RNA families. Nucleic Acids Res 2012;41. doi:10.193/ nar/gks1005.

Ha M, Pang M, Agarwal V, Chen ZJ. Interspecies regulation of microRNAs and their targets. Biochim Biophys Acta 2008;1779:735-742.

18. Kawahara Y, De-la-Bastide M, Hamilton JP, Kanamori H, McCombie WR, Ouyang S, Schwartz DC, et al. Improvement of Oryza sativa Nipponbare reference genome using next generation sequence and optical map data. Rice 2013;6:413.

Zeng C, Wang W, Zheng Y, Chen X, Bo W, Song S, Zhang W, Peng M. Conservation and divergence of microRNAs and their functions in Euphorbiaceaous plant. Nucleic Acid Res 2009;38:981-995.

17. Dai X, Zhao PX. psRNATarget: A plant small RNA target analysis server. Nucleic Acids Res 2011;W155-W159.

19. Conesa A, Götz S, García-Gómez JM, Talón M, Robles M. Blast2GO: a universal tool for annotation, visualization and analysis in functional genomics research. Bioinformatics 2005;21:3674-3676.

Evertson J. Bouteloua gracilis. American Nurseryman. 2010. www.amerinursery.com. Acesessed Jun 15, 2014.

Valdés-Reyna J, Dávila APD. Clasificación de los géneros de gramíneas ( Poaceae ) mexicanas. Acta Bot Mexicana 1995;33:37-50.

20. Shuai P, Liang D, Zhang Z, Yin W, Xia X. Identification of drought-responsive and novel Populus trichocarpa microRNAs by high-throughput sequencing and their targets using degradome analysis. BMC Genomics 2013;14:233.

10. Aguiar M, Lauenroth W. Local and regional differences in abundance of co-dominant grasses in the shortgrass steppe: a modeling analysis of potential causes. Plant Ecol 2001;156:161-171.

21. Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inzé D, Pé ME, Mica E. Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon. Mol Plant 2013;6:423-443.

11. Ortiz MV. Fluctuación en el contenido de proteína cruda y fósforo en 3 ecotipos de zacate navajita (Bouteloua gracilis) y banderilla (Bouteloua curtipendula) y 2 ecotipos de zacate toboso ( Hilaria mutica) en cuatro estados fenológicos. Contenido y fluctuación de nutrientes de las especies forrajeras consumidas por el ganado en los agostaderos de Chihuahua. Boletín Pastizales RELC-INIP-SARH. 1984;15:120.

22. Jones-Rhoades MW, Bartel DP. Computational identification of plant microRNAs and their targets, including a stressinduced miRNA. Molecular Cell 2004;14:787-799.

23. Dezulian T, Palatnik JF, Huson D, Weigel D. Conservation and divergence of microRNA families in plants. Genome Biol 2005;6:P13. doi:10.1186/gb-2005-6-11-p13.

12. Morales-Nieto C, Madrid-Pérez L, Melgoza-Castillo A, Martínez-Salvador M, Arévalo-Gallegos S, Rascón-Cruz Q, Jurado-Guerra P. Análisis morfológico de la diversidad del pasto navajita (Bouteloua gracilis Willd ex Kunth) Lag ex Steud. en Chihuahua México. Téc Pecu Méx 2009;47:245256.

24. Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, et al . A genome-wide characterization of microRNA genes in maize. PLoS Genet 2009:5(11). doi:10.1371/journal.pgen.1000716. 25. Xia R, Zhu H, An YQ, Beers EP, Liu Z. Apple miRNAs and tasiRNAs with novel regulatory networks. Genome Biology 2012;13:R47. doi:10.1186/gb-2012-13-6-r47.

13. Aguado-Santacruz GA, Cabrera-Ponce JL, Ramírez-Chávez E, C. León-Ramírez G, Rascón-Cruz Q, Herrera-Estrella L, Olalde-Portugal V. Establishment, characterization and plant regeneration from highly chlorophyllous embryogenic cell cultures of blue grama grass, Bouteloua gracilis (H.B.K) Lag. Ex Steud. Plant Cell Rep 2001;20:131-136.

26. Barvkar VT, Pardeshi VC, Kale SM, Qiu S, Rollins M, Datla R, et al. Genome-wide identification and characterization of microRNA genes and their targets in flax ( Linum usitatissimum). Planta 2013;237:1149-1161. 27. Preussler CA, Shimizu E, Villalba LL, Zapata PD. Inducción con cobre de la enzima lacasa en el hongo de pudrición blanca Trametes villosa (sw.:Fr.) Kreisel. Rev Cienc Tecnol 2009;12:9-16.

14. Kozomara A, Griffiths-Jones S. miRBase: integrating microRNA annotation and deep sequencing data. Nucleic Acids Res 2011;39:D152-D157.

15. Stocks MB, Moxon S, Mapleson D, Woolfenden HC, Mohorianu I, Folkes L, Schwach F, Dalmay T, Moulton V. The UEA sRNA workbench: a suite of tools for analysing and visualizing

28. Nag A, King S, Jack T. miR319a targeting of TCP4 is critical for petal growth and development in Arabidposis. PNAS 2009;106(52)22534-22539.

274

PRODUCCIÓN Y CALIDAD DE FORRAJE EN MEZCLAS DE RevVEZA Mex COMUN Cienc Pecu 2016;7(3):275-291

Producción y calidad de forraje en mezclas de veza común con cebada, avena y triticale en cuatro etapas fenológicas Forage production and quality of common vetch mixtures with barley, oat and triticale in four phenological stages Manuel de Jesús Flores Nájeraa, Ricardo A. Sánchez Gutiérreza, Francisco G. Echavarría Cháireza, Ramón Gutiérrez Lunaa, Cesar A. Rosales Nietob, Homero Salinas Gonzálezc

RESUMEN

Para determinar la producción y la calidad del forraje de la mezcla de veza común con cebada, avena, y triticale en dos proporciones de semilla (65:35; 35:65) durante cuatro etapas fenológicas, se estableció un experimento en un diseño de bloques completos al azar con arreglo factorial (3x4x4) con cuatro repeticiones. En mezclas de cultivos la mayor producción de materia seca (MS) la obtuvo la asociación avena-veza con 16.6 t ha-1 y en proporción de cultivos la avena-veza (65:35) produjo 19.9 t ha-1, durante la etapa grano masoso (P<0.001). La mayor cantidad de proteína cruda la obtuvieron las mezclas avena-veza (178 g kg-1 MS) y triticale-veza (161 g kg-1 MS) durante la etapa de embuche. Los menores valores de fibra detergente neutra los presentaron el monocultivo veza y su mezcla con avena (35:65), durante la etapa grano maduro (P<0.001). Las menores cantidades de fibra detergente ácida lo obtuvieron los monocultivos avena, veza y triticale durante la etapa grano lechoso (P<0.001). El mayor porcentaje de nutrientes digestibles totales lo obtuvo el monocultivo veza y su mezcla con cebada (65:35) durante la etapa grano lechoso, respectivamente (P<0.001). El contenido de energía neta de lactación y el valor relativo de forraje fue mayor para el monocultivo veza (P<0.001). Se concluye que la producción y calidad del forraje en mezcla de veza con cereales (cebada, avena y triticale) dependen de la etapa de cosecha. En este estudio, la mezcla avena-veza logró mayor producción de materia seca y mejor contenido de proteína cruda. Además, el valor relativo del forraje fue más alto durante la etapa grano maduro. PALABRAS CLAVE: Monocultivos, Cultivos asociados, Epoca de cosecha, Calidad del forraje.

ABSTRACT

The objective was to determine forage yield and quality of vetch mixtures with barley, oat and triticale in two seeding ratios (65:35; 35:65) at four phenological stages. To this end, a randomized block design with factorial array (3x4x4) and four replications was established. The greatest dry matter yield was obtained from the oat-vetch mixture at the grain doughy stage of maturity (16.6 t ha-1; P<0.00), while the seed proportion with the highest production was from the oat-vetch (65:35) ratio with 19.9 t ha-1 during the dough grain stage. The highest amount of crude protein was obtained from the oat-vetch (178 g kg-1 MS) and triticale-vetch (161 g kg-1 MS) mixtures during booting stage. The monoculture vetch and oats-vetch (35:65) proportion, both had lower amounts of neutral detergent fiber at the mature grain stage (P<0.001). The oat, vetch and triticale monocultures showed the lowest acid detergent fiber during milky grain stage (P<0.001). The greatest percentage of TDN was observed in vetch monoculture and its mixtures with barley (65:35) during the milky grain stage, respectively (P<0.001). The monoculture vetch provided highest values for NEL and RFV (P<0.001). In conclusion, the forage yield and quality of vetch mixtures with barley, oat and triticale depend on the maturity stage. Also, the oat-vetch mixture showed the greatest dry matter yield and high CP concentration. In addition, forage relative value was higher during the mature grain stage. KEY WORDS: Monocultures, Intercropping, Harvesting stage, Forage quality. Recibido el 15 de mayo de 2015. Aceptado el 13 de agosto de 2015. a

Campo Experimental Zacatecas. INIFAP. Km. 24.5 Carretera Zacatecas-Fresnillo, 98500 Calera de Víctor Rosales, Zacatecas, México.

Centro de Investigación Regional Norte Centro. INIFAP. Blvd. José Santos Valdez 1200 Poniente. 27440 Matamoros, Coahuila. México. salinas.homero@hotmail.com. Correspondencia al último autor.

Campo Experimental San Luis. INIFAP. San Luis Potosí. México.

275

Manuel de Jesús Flores Nájera, et al. / Rev Mex Cienc Pecu 2016;7(3):275-291

INTRODUCCIÓN

INTRODUCTION

La mezcla de cultivos o también llamado intercultivos es definida como el crecimiento simultaneo de dos o más especies durante una misma estación de crecimiento (1) . Históricamente, el tipo de inter-cultivos anuales conocidos ampliamente en el mundo es la combinación de un cereal con una leguminosa, pues permite que la inclusión de la leguminosa mejore la producción y la calidad del forraje(2). En esta asociación, los cereales se caracterizan por aportar una alta producción de materia seca, pero con bajo contenido de proteína cruda, lo que disminuye su calidad y valor nutritivo(3). En cambio, las leguminosas presentan aceptable producción de forraje, pero han sido reconocidas ampliamente como una fuente rica en proteína cruda (4) . Una de las leguminosas anuales ampliamente usadas como intercultivo con cereales es la veza común o ebo (Vicia sativa L), una leguminosa anual con un hábito de crecimiento trepador y con altos niveles de proteína cruda(5,6). Respecto a cereales, se han propuesto un gran número de especies que figuran ser los apropiados para intercalarlos con la veza, entre los que destaca el maíz (Zea mays), la avena (Avena sativa L.), la cebada (Hordeum vulgare L.), el triticale (x Triticosecale Wittmack. Ex. A. Camus) y el trigo (Triticum aestivum L. emend. Thell) (7,8,9).

Mixed cropping or also called intercropping is defined as the simultaneous growth of two or more species during a single growing season(1). Historically, the type of annual intercrops widely recognized in the world is the combination of a cereal with a legume, by allowing the inclusion of legumes production and improving forage quality (2) . In this partnership, cereals characteristically provide high dry matter yields, but low crude protein content; this lowers its quality and nutritional value(3). In comparison, legumes have acceptable forage yields; however, they are widely recognized as a rich source of crude protein(4). One of the annual legumes widely used for intercropping with cereals is the common vetch or vetch (Vicia sativa L.), an annual legume with a climbing growth habit and high levels of crude protein(5,6). With respect to cereals, a large number of species have been listed to be appropriate for combining them with vetch, among them are maize (Zea mays), oat (Oat sativa L.), barley (Hordeum vulgare L.), triticale (x Triticosecale Wittmack. Ex. A. Camus) and wheat (Triticum aestivum L. emend. Thell) (7,8,9). Previous studies have shown that barley produces more fodder than oat, triticale or wheat, when mixed with vetch(8,10). In contrast, Knight and Goicoechea(7) and Thomson et al(8) found that the most suitable for mixing with vetch cereal is oat. However, Anil et al(5) reported that triticale could be used as an alternative cereal for mixing with vetch.

Estudios previos han demostrado que la cebada produce mayor cantidad de forraje que la avena, triticale o trigo, cuando es mezclada con la veza(8,10). En cambio, Caballero y Goicoechea(7) y Thomson et al(8) encontraron que el cereal más adecuado para mezclar con la veza es la avena. Sin embargo, Anil et al(5) reportaron que el triticale puede ser usado como un cereal alternativo para mezclarlo con la veza.

Another factor that may modify the production and forage quality of the mixture is the seed ratio used for crop. Some authors suggest ranges varying from 20 to 80 kg ha-1 for cereals, while for common vetch values suggested fluctuate between 20 and 50 kg ha-1(11). Also, the harvest stage is another factor that may affect the production and quality of the forage. The plant quality continuously changes as it matures; in this state, the content of the cell wall increases; this causes more lignin buildup

Otro factor que puede modificar la producción y la calidad del forraje de la mezcla es la proporción de semilla utilizada por cultivo. Algunos autores sugieren rangos que van desde los 20 hasta los 80 kg ha-1 para los cereales, mientras que para la veza común fluctúan entre 276

PRODUCCIÓN Y CALIDAD DE FORRAJE EN MEZCLAS DE VEZA COMUN

los 20 y 50 kg ha-1(11). También, la etapa de cosecha es otro factor que puede afectar la producción y la calidad del forraje. La planta continuamente cambia de calidad conforme va madurando; en este estado, el contenido de la pared celular incrementa; esto representa que se acumule más lignina, compuesto indigestible que resulta posteriormente en una disminución de la calidad del forraje(4). Se sugiere la etapa vegetativa como la mejor etapa de cosecha debido a que se puede utilizar para cualquier tipo de ganado y en cualquier etapa productiva(12).

resulting in indigestible compound that consequently decreases forage quality(4). The vegetative stage has been suggested as the best harvest stage because it can be used for any livestock type and productive stage(12).

In this context, the objective of this study was to measure the production and quality of forage mixture of common vetch with barley, oat and triticale, at two seed ratios (65:35; 35:65), within four phenological harvest stages. MATERIAL AND METHODS Study site

En este contexto, el objetivo del presente estudio fue medir la producción y la calidad del forraje de la mezcla de veza común con cebada, avena y triticale, en dos proporciones de semilla (65:35; 35:65), en cuatro etapas fenológicas de cosecha.

The work was carried out in the Zacatecas Experimental Station belonging to the National Institute of Forestry, Agriculture and Livestock (INIFAP), located at 22° 54' N and 102° 39' W and 2,197 m asl, with an average temperature of 14.6 °C and annual rainfall of 416 mm, of which the majority occurs during the summer (June to September). The soil of the study area is classified as Kastanozem, pH 7.5, 1.26 % organic matter and with sandy loam texture(13). The land where crops associations were planted was homogeneous in fertility, texture and slope.

MATERIAL Y MÉTODOS Sitio de estudio

El trabajo se desarrolló en el Campo Experimental Zacatecas perteneciente al Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias (INIFAP), ubicado a 22°54' N y 102°39' O y 2,197 msnm, con temperatura media anual de 14.6 °C y precipitación media anual de 416 mm, la cual se presenta en mayor proporción en verano (junio a septiembre). El suelo del área de estudio es clasificado como Kastañozem, con un pH de 7.5, 1.26 % de materia orgánica y textura franco arenosa(13). El terreno donde se sembraron las asociaciones de cultivos fue homogéneo en fertilidad, textura y pendiente.

Crop management and experimental design

A combination of crops was established in an area of 1.78 ha, divided into 0.81 ha for planting Barley-Vetch, 0.52 ha for Oat-Vetch and 0.45 ha for Triticale-Vetch. The varieties used were capuchona barley ( Hordeum vulgare L.), chihuahua oat (Oat sativa L.), Nazas river triticale (x Triticosecale Wittmack. Ex. A. Camus) and common vetch (Vicia sativa L.). Site preparation consisted of a fallow period, tracking and leveling. Sowing was done on wet soil by November 14, 2013 for barley-vetch mixture, and November 22 for oat-vetch and triticale-vetch mixtures. For this a precision seeder was used, with a seeding density of 50 kg cereal seed with 20 kg of vetch. The dose of 80-46-00 fertilizer was applied; the sources

Manejo del cultivo y diseño experimental

La mezcla de cultivos se estableció en una superficie de 1.78 ha, dividida en 0.81 ha para la siembra de cebada-veza, 0.52 ha para avenaveza y 0.45 ha para triticale-veza. Las variedades empleadas fueron cebada capuchona (Hordeum vulgare L.), avena chihuahua (Avena sativa L.), 277

Manuel de Jesús Flores Nájera, et al. / Rev Mex Cienc Pecu 2016;7(3):275-291

triticale río nazas (x Triticosecale Wittmack. Ex. A. Camus) y veza común (Vicia sativa L.).

of these where from ammonium sulfate and triple superphosphate, applying all the phosphorous and half the nitrogen at planting, and the rest of nitrogen in the first supplementary irrigation. Four irrigations were applied by furrows irrigation at an interval of 20 d, including planting, providing approximately a total of 40 cm, this was estimated by measuring flow rate and time of irrigation.

La preparación del terreno consistió de barbecho, rastreo y nivelación. La siembra se realizó en húmedo el 14 de noviembre de 2013 para la mezcla cebada-veza, y el 22 de noviembre para las mezclas avena-veza y triticale-veza. Para ello se utilizó una sembradora de precisión, con una densidad de siembra de 50 kg de semilla de cereal con 20 kg de veza. La dosis de fertilización fue de 80-46-00 usando como fuentes sulfato de amonio y superfosfato triple, aplicando todo el fósforo y la mitad del nitrógeno a la siembra, y el resto del nitrógeno en el primer riego de auxilio. El riego se proporcionó por gravedad, con sifones, aplicando cuatro riegos a un intervalo de 20 días, incluyendo el de siembra, con una lámina total aproximada de 40 cm, estimada mediante el gasto conocido y el tiempo de riego.

The treatments were established with a completely randomized design with factorial arrangement (3x4x4). The first factor corresponded to three different cereal mixtures with vetch and were defined as follows: barleyvetch, oat-vetch and triticale-vetch. The second factor corresponded the mixture of cereals (barley, oat, triticale) with two vetch seed ratios defined at four levels: 100% monoculture cereal (barley, oat, triticale), cereal-vetch ratio of 65:35, cereal-vetch ratio of 35: 65, a 100% vetch monoculture and the third factor that corresponded to the growth stage of the crop that was defined by four phenological stages: booting stage, milky, doughy grain, and mature grain with four replicates per treatment. The experimental plots were 20 rows by 55 m in length with a spacing of 0.75 cm between them for barley + vetch mixture (825 m2) and for the mixtures of oat + vetch and triticale + vetch 20 rows that were 60 m long were used (900 m2).

Los tratamientos se establecieron con un diseño completamente al azar con arreglo factorial (3X4X4), donde el primer factor correspondió a la mezcla de cereales con veza definido por tres niveles: cebada-veza, avena-veza y triticaleveza, el segundo factor correspondió a la mezcla de cereales (cebada, avena, triticale) con veza en dos proporciones de semilla definido por cuatro niveles: monocultivo cereal 100% (cebada, avena, triticale), cereal-veza proporción 65:35, cereal-veza proporción 35:65, monocultivo veza (100%) y el tercer factor correspondió al estado fenológico de la cosecha definido por cuatro niveles: embuche, grano lechoso, grano masoso, y grano maduro con cuatro repeticiones por tratamiento. Las parcelas experimentales fueron 20 surcos de 55 m de largo con un espaciamiento de 0.75 cm entre ellas para la mezcla cebada + veza (825 m2) y para las mezclas de avena+veza y triticale+veza se utilizaron 20 surcos de 60 m de largo (900 m2).

Samplings dry forage yield

To estimate the production of green and dry fodder, two rows of each plot were used that were 3 m long and had a spacing of 0.75 m; the total area was 4.5 m2. Four samples were taken in each experimental plot, and these were carried out in a longitudinal to the surface of the plot. Each sampling was performed by cutting the forage with a sickle at a height of approximately 2 cm from the soil surface. To estimate the dry matter yield at each harvest, a 500 g sample of fresh forage was taken and placed to dry in an oven at 60 °C for 72 h, which was subsequently transformed to tons of

Muestreos de rendimiento de forraje seco

Para estimar la producción de forraje verde y seco, de cada parcela se utilizaron dos surcos 278

PRODUCCIÓN Y CALIDAD DE FORRAJE EN MEZCLAS DE VEZA COMUN

con un espaciado de 0.75 m entre ellos por 3 m de largo; el área total fue de 4.5 m2. Cuatro muestreos se realizaron en cada parcela experimental, y estos fueron llevados a cabo en forma longitudinal a la superficie de la parcela. Cada muestreo se realizó cortando el forraje con una rozadera a una altura aproximada de 2 cm de la superficie del suelo. Del forraje fresco cosechado, se tomó una muestra de 500 g para secarse en estufa a 60 °C por 72 h para estimar el rendimiento de materia seca, que se transformó posteriormente a toneladas de materia seca por hectárea. Los cortes de forraje en la etapa de embuche fueron a los 85, 103 y 101 días después de la siembra (dds) para la asociación cebada-veza, avenaveza y triticale-veza, respectivamente. En la etapa grano lechoso los cortes de las mezclas cebada-veza, avena-veza y triticale-veza fueron hechos a los 92, 130 y 129 dds, respectivamente. En la etapa grano masoso los cortes de las mezclas cebada-veza, avena-veza y triticale-veza fueron hechos a los 106, 140 y 139 dds, respectivamente. En la etapa grano maduro los cortes de las mezclas cebada-veza, avena-veza y triticale-veza fueron hechos a los 118, 150 y 165 dds, respectivamente.

dry matter per hectare. The cuts of forage in the booting stage were carried out at 85, 103 and 101 d after sowing (dap) for barley-vetch, oat-vetch and triticale-vetch, respectively association. For the milky grain stage cuts of barley-vetch, oat-vetch and triticale-vetch mixtures were made at 92, 130 and 129 dap, respectively. Doughy stage grain cuts of barleyvetch, oat-vetch and triticale-vetch mixtures were made at 106, 140 and 139 dap, respectively. In mature grain stage cuts of barley-vetch, oat-vetch and triticale-vetch mixtures were made at 118, 150 and 165 dap, respectively. Nutritional quality

The forage samples used to calculate percentages of dry matter was processed with a Willy mill with a millimeter sieve. All samples were analyzed for percentage of crude protein (CP) using the Dumas combustion method AOAC(14) using the LECO equipment. The neutral detergent fiber (NDF) and acid detergent fiber (ADF) were determined with the technique of detergents using an ANKOM fiber analyzer. The variables of total digestible nutrients (TDN), relative feed value (RFV) and net energy for lactation (NEL) were calculated using the equations adapted by Horroks and Vallentine(16).

Calidad nutricional

Las muestras de forraje con las que se determinaron los porcentajes de materia seca se procesaron en un molino Willy con criba de un milímetro. A todas las muestras se les determinó el porcentaje de proteina cruda (PC) mediante el método de Dumas por combustión AOAC(14), utilizando el equipo LECO. El contenido de fibra detergente neutro (FDN) y fibra detergente ácido (FDA) se determinaron con la técnica de detergentes(15) usando un analizador de fibra ANKOM. Las variables nutrientes digestibles totales (NDT), valor relativo del forraje (VRF) y energía neta para lactación (ENL) se calcularon utilizando las ecuaciones adaptadas por Horroks y Vallentine(16).

Data for all variables were analyzed using mixed models procedure set by the estimation method (RML) of SYSTAT 13, Chicago, IL(17). The model included fixed effects of crop mixtures at three levels: barley-vetch, oat-vetch and triticale-vetch, with repetition as random factor; seeding ratios at four levels: monoculture cereal (barley, oats, triticale) 100 %, cereal-vetch ratio of 65:35 and cereal-vetch ratio of 35:65 and 100 % vetch as well as crop growth stage with four levels: boot stage, milky, doughy grain and mature grain and their interactions, and the random effects of repetition and residual. The comparison between treatments for all variables was made by Tukey test. Data is presented as an average.

Los datos de todas las variables se analizaron usando el procedimiento de modelos mixtos 279

Manuel de Jesús Flores Nájera, et al. / Rev Mex Cienc Pecu 2016;7(3):275-291

ajustado por el método de estimación (RML) de SYSTAT 13, Chicago, IL(17). El modelo incluyó efectos fijos de mezclas de cultivos con tres niveles: cebada-veza, avena-veza y triticale-veza, con la repetición como factor aleatorio, proporción de siembra con cuatro niveles: monocultivo cereal (cebada, avena, triticale) 100 %, cereal-veza proporción 65:35, cerealveza proporción 35:65 y veza 100% y estado fenológico de cosecha con cuatro niveles: embuche, grano lechoso, grano masoso y grano maduro y sus interacciones, y los efectos aleatorios de la repetición y residual. La comparación entre tratamientos de todas las variables fue hecha mediante la prueba de Tukey. Los datos son presentados en promedio.

RESULTS

Dry matter yield

The mixed model analysis showed a significant effect of the mixture of cereals (oat, barley, triticale) with vetch on the production of dry matter (DM; P<0.001). Furthermore, the effect on the production of DM differ depending on the stage of harvest ( P <0.001). Thus, the highest production of DM was obtained by oat-vetch mixture during the doughy grain stage, while the lowest production was found with barleyvetch mixture during the boot stage (Table 1).

The results showed differences in regard to the production of DM in monocultures (oat, barley, triticale) and the mixture of these cereals with vetch seed in two ratios (65:35, 35:65), (Table 2; P<0.001). Furthermore, the effect of the ratio of seed on the DM production differed depending on the stage of harvest (P<0.001). Monoculture oat (17.2 t ha-1) and its mixture with vetch (65:35; 19.9 t ha-1) had higher amounts of DM during the doughy grain stage, while the lower production was obtained with monocultures barley (2.4 t) and vetch (2.6 t).

RESULTADOS

Rendimiento de materia seca

El análisis de modelos mixtos mostró un efecto significativo de la mezcla de cereales (avena, cebada, triticale) con la veza sobre la producción de materia seca (MS; P<0.001). Además, el efecto sobre la producción de MS difirió dependiendo de la etapa de cosecha (P<0.001). Así, la mayor producción de MS la obtuvo la mezcla avena-veza durante la etapa grano masoso, mientras que la menor producción la obtuvo la mezcla cebada-veza durante la etapa de embuche (Cuadro 1).

Nutritional quality

Crude protein (CP) content among crop mixtures was different (P<0.05; Table 1). In fact, the effect of the mixture of crops on the content of CP differ depending on the stage of harvest. The highest content of CP was obtained with oat-vetch mixtures and triticale-vetch during the boot stage, while the least was present in the barley-vetch and oat-vetch grain mixtures during the doughy stage.

Con respecto a la producción de MS evaluada por monocultivo (avena, cebada, triticale) y la mezcla de estos cereales con la veza en dos proporciones de semilla (65:35, 35:65), los resultados mostraron diferencias (Cuadro 2; P<0.001). Además, el efecto de la proporción de semilla sobre la producción de MS difirió dependiendo de la etapa de cosecha (P<0.001). El monocultivo avena (17.2 t ha-1) y su mezcla con la veza (65:35; 19.9 t ha-1) presentaron mayores cantidades de MS durante la etapa grano masoso, mientras que la menor producción la obtuvieron los monocultivos cebada (2.4 t) y veza (2.6 t).

The results with respect to CP content evaluated as a monoculture (oat, barley, triticale) and the mixture of these cereals with vetch seed in two ratios (65:35, 35:65) showed differences (P<0.001; Table 2). Furthermore, the effect of the seed ratio with respect to CP content differed depending on the stage of harvest (P<0.001). Thus, the highest CP was found with the vetch monoculture (294 g kg-1 DM) during mature 280

PRODUCCIร N Y CALIDAD DE FORRAJE EN MEZCLAS DE VEZA COMUN

Cuadro 1. Diferencias en la producciรณn de DM, CP, ADF, NDF, TDN, NEL and RFV entre asociaciones de cultivos en cuatro etapas fenolรณgicas

Table 1. Differences in the production of DM, CP, ADF, NDF, TDN, NEL and RFV among crop associations in four phenological stages Cereal Mix

Booting stage of grain

Barley-Vetch Oat-Vetch Triticale-Vetch

2.4a 6.6bc 6.1ab

Barley-vetch Oat-Vetch Triticale-Vetch

148.9b 178.7c 161.0cb

Barley-vetch Oat-Vetch Triticale-Vetch

326.6 353.2 365.7

Barley-vetch Oat-Vetch Triticale-Vetch

509.5 562.4 569.3

Barley-Vetch Oat-Vetch Triticale-Vetch

63.4 56.4 56.4

Barley-Vetch Oat-Vetch Triticale-Vetch Barley-Vetch Oat-Vetch Triticale-Vetch

Phenological stages Milky grain

DM, t ha-1 3.0a 10.7cd 9.1c

Doughy grain

CP, g/kg DM 108.1ab 125.4ab 136.4ab

ADF, g/kg DM 332.7 323.5 323.8 NDF, g/kg DM 507.9 462.7 500.5 64.6 59.2 60.6

TDN, %

NEL, Mcal/kg DM 1.43 1.32 1.32

1.45 1.32 1.30 116.9 103.1 100.6

117.0 129.7 112.0

RFV

4.7ab 16.6d 9.7bc

Mature grain 5.9bc 8.9c 9.5c

104.2a 95.4a 123.3ab

96.8a 98.4a 100.4a

400.0 336.2 343.0

362.8 335.0 351.2

579.2 475.4 511.8

553.1 462.8 531.7

61.8 60.2 59.1

58.9 60.7 58.4

1.38 1.35 1.29 95.3 123.6 114.3

1.32 1.37 1.25 105.9 130.6 111.3

DM= Dry matter; CP= Crude protein; ADF= Acid detergent fiber; NDF= Neutral detergent fiber; TDN= Total digestible nutrients; NEL= Net energy for lactation; and RFV= Relative feed value. abcd Different letters represent significant differences among treatments (P<0.05).

grain stage, followed by the seed ratio of oatvetch (35:65; 175 g kg-1 DM) during the boot stage. Minor amounts of CP were obtained by the barley and oat monocultures during the mature stages grain (56 g) and doughy grain (60 g), respectively.

Calidad nutricional

El contenido de PC entre mezclas de cultivos fue diferente (P<0.05; Cuadro 1). De hecho, el efecto de la mezcla de cultivos sobre el contenido de PC difiriรณ dependiendo de la etapa de cosecha. El mayor contenido de PC lo obtuvieron las mezclas avena-veza y triticaleveza durante la etapa de embuche, mientras que la menor cantidad la presentaron las

NDF was not different between crop mixtures (P>0.05; Table 1). There was also no effect 281

Manuel de Jesús Flores Nájera, et al. / Rev Mex Cienc Pecu 2016;7(3):275-291

mezclas cebada-veza y avena-veza durante la etapa grano masoso.

between the mixture of crops and harvest stage on the NDF (P>0.05). However, there was a significant effect of seed ratio in the mixture on the NDF (P<0.001). Furthermore, the effect of seed ratio on NDF content differed depending on the stage of harvest (P<0.001; Table 2).

Con respecto al contenido de PC evaluada por monocultivo (avena, cebada, triticale) y la mezcla de estos cereales con la veza en dos

Cuadro 2. Diferencias en la producción de DM, CP y NDF de monocultivos (cebada, avena y triticale) y la mezcla de estos cereales con la veza en dos proporciones de semilla (65:35, 35:65)

Table 2. Differences in the production of DM, CP and NDF in monocultures (barley, oat and triticale) and the mixture of these cereals with vetch in two seed ratios (65:35, 35:65) Cereal/ratio Barley/100 Vetch/100 Barley:veza/65:35 Barley:Vetch/35:65 Oat/100 Oat:Vetch/65:35 Oat:Vetch/35:65 Triticale/100 Triticale:Vetch/65:35 Triticale:Vetch/35:65

Booting stage of grain

Milky grain

Doughy grain

DM (t ha-1)

Barley/100 Vetch/100 Barley:veza/65:35 Barley:Vetch/35:65 Oat/100 Oat:Vetch/65:35 Oat:Vetch/35:65 Triticale/100 Triticale:Vetch/65:35

104bcde 288h 118cde 155fg 164g 142efg 175g 145efg 134efg

3.2ab 5.1bc 3.5ab 4.2abc ab 3.3 4.6abc ab 3.3 5.0bc f 11.3 17.2gh 11.7f 19.9h 11.0f 16.0g 9.4def 9.1def def 9.5 10.1f def 9.2 10.7f CP (g/kg DM) ab 84 62a 243h 287h 85ab 72ab 88ab 87abc ab 82 60a ab 94 61a defg 143 71ab 113cde 120cdef 123def 92abc

Barley/100 Vetch/100 Barley:veza/65:35 Barley:Vetch/35:65 Oat/100 Oat:Vetch/65:35 Oat:Vetch/35:65 Triticale/100 Triticale:Vetch/65:35 Triticale:Vetch/35:65

510bcdef 429ab 524cdefg 535cdefgi 586fgi 599gi 569efg 605hi 612i 560efghi

NDF (g/kg DM) 504bcdef 622i a 400 433abc cdefg 530 588fghi defghi 544 601ghi 456bc 492bcde 484bcde 471bcd 479bcde 484bcde 534fghi 512bcdef defgh 519 540defghi bcde 499 524fgh

Triticale:Vetch/35:65

2.4a 2.6a 2.8a 2.8a 6.7cd 6.7cd 7.3cde 6.3bcd 6.7cd 5.9bc

Phenological stages

140efg

121def

DM= Dry matter; CP= Crude protein; and NDF= Neutral detergent fiber.

abcdefghi Different letters represent significant differences among treatments (P<0.05).

282

76ab

Mature grain 6.2bcd 3.1ab 5.9bc 6.5bcd 10.1f 9.3def 8.6def 9.0def 9.7def 10.8f 56a 294h 65ab 71ab 65ab 61ab 64ab 75abc 62ab 586fghi 363a 586fghi 583fghi 478bcd 491cdef 407a 572fghi 553defghi 555fghi

67ab

PRODUCCIÓN Y CALIDAD DE FORRAJE EN MEZCLAS DE VEZA COMUN

proporciones de semilla (65:35, 35:65), los resultados mostraron diferencias (P<0.001; Cuadro 2). Además, el efecto de la proporción de semilla sobre el contenido de PC difirió dependiendo de la etapa de cosecha (P<0.001). Así, la mayor cantidad de PC la presentó el monocultivo veza (294 g kg-1 MS) durante la etapa grano maduro, le siguió la proporción avena-veza (35:65; 175 g kg-1 MS) durante la etapa de embuche. Las menores cantidades de PC las obtuvieron los monocultivos cebada y avena durante las etapas grano maduro (56 g) y grano masoso (60 g).

The least amount of NDF the vetch monoculture obtained (363 g kg-1 DM), followed oat-vetch ratio (35:65) with 407 g kg-1 DM, both data obtained during the mature grain stage, while NDF as much the present monoculture barley (622 g kg-1 DM) during grain doughy stage.

The content of ADF did not differ between crop mixtures (P>0.05; Table 1). However, there was an effect related to seed ratio in the mixtures with respect to ADF content ( P <0.01). Furthermore, the effect of the seed ratio on ADF content differed depending on the stage of harvest (P<0.001; Table 3). Minor amounts of the ADF presented the oat monocultures (305 g kg-1 DM), vetch (306 g) and ratio (35:65) triticale-vetch (306 g) during the milky stage, while larger amounts presented the monoculture barley (416 g), and barley-vetch 65:35 ratio (409 g) during the dough grain stage.

La FDN no fue diferente entre mezclas de cultivos (P>0.05; Cuadro 1). Tampoco hubo efecto entre la mezcla de cultivos y la etapa de cosecha sobre el contenido de FDN (P>0.05). Sin embargo, hubo un efecto significativo de la proporción de semilla en la mezcla sobre el contenido de FDN (P<0.001). Además, el efecto de la proporción de semilla sobre el contenido de FDN difirió dependiendo de la etapa de cosecha ( P <0.001; Cuadro 2). La menor cantidad de FDN la obtuvo el monocultivo veza (363 g kg-1 MS), le siguió la proporción avenaveza (35:65) con 407 g kg-1 MS, ambos datos obtenidos durante la etapa grano maduro, mientras que la mayor cantidad de FDN la presentó el monocultivo cebada (622 g kg-1 MS) durante la etapa grano masoso.

TDN content did not differ between crop mixtures (P>0.05; Table 1), but it was different in relation to the seed ratio in the mixture (P<0.001). In fact, the effect of the seed ratio on the content of TDN differ depending on the stage of harvest (P<0.01; Table 3). Thus, the highest amount of TDN was obtained by vetch monoculture with 66.7 % during the milky stage. Followed, monoculture barley (65.0 %) and its mixture with vetch (35:65; 64 %), both values obtained during the milky stage. The lowest percentage of TDN was obtained by vetch-triticale ratio (65:35), with 53.7 % during the boot stage. Followed by oat monoculture (54.4 %) and its mixture with vetch (65:35; 54.6 %), both during the boot stage. There was no interaction between the mix of crops and harvest stage on the content of TDN (P>0.05).

El contenido de FDA no fue diferente entre mezclas de cultivos (P>0.05; Cuadro 1). No obstante, hubo un efecto de la proporción de semilla en las mezclas sobre el contenido de FDA ( P <0.01). Además, el efecto de la proporción de semilla sobre el contenido de FDA difirió dependiendo de la etapa de cosecha (P<0.001; Cuadro 3). Las menores cantidades de FDA las presentaron los monocultivos avena (305 g kg-1 MS), veza (306 g) y la proporción (35:65) triticale-veza (306 g) durante la etapa grano lechoso, mientras que las mayores cantidades la presentaron el monocultivo cebada (416 g), y la proporción cebada-veza 65:35 (409 g) durante la etapa grano masoso.

NEL values were not different between crop mixtures (P>0.05; Table 1). However, there was an effect of monocultures (barley, oat, triticale) and their mixture with vetch in two seed ratios (65:35; 35:65) on the content of NEL (P<0.001; Table 3). The highest NEL was found with the vetch monoculture with 1.62 Mcal kg-1 DM. There was no effect with harvest stage on the 283

Manuel de Jesús Flores Nájera, et al. / Rev Mex Cienc Pecu 2016;7(3):275-291

net energy of lactation (P>0.05), nor with the interaction between the seed ratio mixtures and harvest stage on NEL (P>0.05).

El contenido de NDT no fue diferente entre mezclas de cultivos (P>0.05; Cuadro 1), pero sí fue diferente en relación a la proporción de semilla en la mezcla (P<0.001). De hecho, el efecto de la proporción de semilla sobre el contenido de NDT difirió dependiendo de la etapa de cosecha (P<0.01; Cuadro 3). Así, la

Relative feed value (RFV) did not differ between crop mixtures (P>0.05; Table 1). There was also no interaction between the cereal mixture

Cuadro 3. Diferencias en la producción de ADF, TDN y NEL de monocultivos (cebada, avena y triticale) y la mezcla de estos cereales con la veza en dos proporciones de semilla (65:35, 35:65)

Table 3. Differences in the production of ADF, TDN and NEL in monocultures (barley, oat and triticale) and the mixture of these cereals with two vetch seed ratios (65:35, 35:65) Cereal/ratio Barley/100 Vetch/100 Barley:veza/65:35 Barley:Vetch/35:65 Oat/100 Oat:Vetch/65:35 Oat:Vetch/35:65 Triticale/100 Triticale:Vetch/65:35 Triticale:Vetch/35:65

Phenological stages

Booting stage of grain 323ab 311a 322ab 343abc 356abc 380bc 345abc 374bcd 380bcd 371bcd

Barley/100 Vetch/100 Barley:veza/65:35 Barley:Vetch/35:65 Oat/100 Oat:Vetch/65:35 Oat:Vetch/35:65 Triticale/100 Triticale:Vetch/65:35 Triticale:Vetch/35:65

63.9efg 65.9fg 63.0cdef 62.1cdef 54.4a 54.6a 55.3ab 55.7a 53.7a 55.7a

Barley/100 Vetch/100 Barley:veza/65:35 Barley:Vetch/35:65 Oat/100 Oat:Vetch/65:35 Oat:Vetch/35:65 Triticale/100 Triticale:Vetch/65:35 Triticale:Vetch/35:65

1.42 1.62 1.41 1.44 1.27 1.24 1.29 1.25 1.20 1.28

Milky grain

Doughy grain

ADF (g/kg DM) 355abc 416d 306a 388cd abc 330 409d abc 327 382bc a 305 334abc 341abc 312abc 333abc 331abc 342abc 323ab 333abc 355abcd a 306 330abc TDN (%) fg 65.0 61.8cdef 66.7g 61.9cdef 63.9efg 62.1def 64.0efg 61.2bcdef 59.0bcd 59.5bcde ab 56.5 61.0bcde abcd 58.3 59.3bcde bcde 60.8 58.5bcde 58.8bcde 57.8b 60.8bcdef 58.5bcd NEL (Mcal/kg DM) 1.43 1.34 1.59 1.36 1.40 1.37 1.40 1.36 1.32 1.31 1.23 1.36 1.29 1.30 1.26 1.29 1.26 1.22 1.33 1.25

ADF= Acid detergent fiber; TDN= Total digestible nutrients; and NEL= Net energy for lactation. abcdef Different letters represent significant differences among treatments (P<0.05).

284

Mature grain 380bcd 307a 373bcd 364abc 322abc 324abc 362abc 395cd 346abc 335abc 58.0bc 63.7efg 61.9bcd 57.7ab 60.3bcde 59.7bcde 60.5bcde 57.8b 57.8b 57.8bcd 1.26 1.59 1.29 1.27 1.33 1.31 1.34 1.17 1.21 1.19

PRODUCCIÓN Y CALIDAD DE FORRAJE EN MEZCLAS DE VEZA COMUN

and harvest stage on the RFV ( P >0.05). However, there was an effect from monocultures (barley, oat and triticale) and mixtures of these cereals in two vetch seed ratios (65:35, 35:65; P<0.001). In addition, there was an effect of the harvest stage on the RFV ( P <0.001). Furthermore, the effect of the seed ratio on RFV differ depending on the stage of harvest (P<0.05; Table 4). Thus, the vetch monoculture had higher values during the mature grain stage (167.2) and milky (152.0). It was followed by the oat monoculture with a value of 133.3. The lowest values were found for the triticale monoculture (82.0) and barley (84.6), followed by the ratios of triticale-vetch (65:35; 90.2) and barley-vetch (35:65; 91.8).

mayor cantidad de NDT la obtuvo el monocultivo veza con 66.7 % durante la etapa lechoso. Le siguieron, el monocultivo cebada (65.0 %) y su mezcla con la veza (35:65; 64 %), ambos valores obtenidos durante la etapa lechoso. El menor porcentaje de NDT la obtuvo la proporción triticale-veza (65:35), con 53.7 % durante la etapa de embuche. Le siguió el monocultivo avena (54.4 %) y su mezcla con veza (65:35; 54.6 %), ambos durante la etapa de embuche. No hubo interacción entre la mezcla de cultivos y la etapa de cosecha sobre el contenido de NDT (P>0.05). Los valores de ENL no fueron diferentes entre mezclas de cultivos (P>0.05; Cuadro 1). Sin embargo, hubo un efecto de los monocultivos (cebada, avena, triticale) y su mezcla con la veza en dos proporciones de semilla (65:35; 35:65) sobre el contenido de ENL (P<0.001; Cuadro 3). La mayor cantidad de ENL la presentó el monocultivo veza con 1.62 Mcal kg-1 MS. No hubo efecto de la etapa de cosecha sobre la energía neta de lactancia (P>0.05). Tampoco se encontró interacción entre la proporción de semilla y la etapa de cosecha sobre la ENL (P>0.05).

DISCUSSION

The results show that forage production and nutritional quality of vetch mixture with cereals (barley, oats and triticale) and two seed ratios (65:35; 35:65) are associated with the phenological stage of harvest. Moreover, it was found that the oat-vetch mixture proved to be the association most suitable for crop DM production compared to triticale-vetch or barleyvetch mixtures. In particular, the ratio of oat-

Cuadro 4. Diferencias en el valor relativo del forraje (RFV) de monocultivos (cebada, avena y triticale) y la mezcla de estos cereales con la veza en dos proporciones de semilla (65:35, 35:65) Table 4. Differences in the relative feed value (RFV) in monocultures (barley, oat and triticale) and the mixture of these cereals with two vetch seed ratios (65:35, 35:65)

Barley/100 Vetch/100 Barley:veza/65:35 Barley:Vetch/35:65 Oat/100 Oat:Vetch/65:35 Oat:Vetch/35:65 Triticale/100 Triticale:Vetch/65:35 Triticale:Vetch/35:65

Booting stage of grain

Phenological stages

116.4bcd 140.2ef 113.6bcd 109.0abc 94.7ab 92.0abc 101.5abc 92.0ab 90.2ab 99.7abc

Milky grain 113.6bcd 152.0fg 111.3bcd 108.8abc 133.3de 121.3cde 123.5cde 82.0a 112.8bcd 121.3cde

abcde Different letters represent significant differences among treatments (P<0.05).

285

Doughy grain 84.6a 110.4bcd 92.0ab 91.8ab 119.0bcd 126.8de 121.5cde 116.5bcd 106.0abc 112.5bcd

Mature grain 94.7abc 167.2g 95.6abc 96.9abc 124.3de 121.0cde 125.8de 94.5abc 105.5abc 106.0abc

Manuel de Jesús Flores Nájera, et al. / Rev Mex Cienc Pecu 2016;7(3):275-291

vetch (65:35) produced 40 % more DM during the milky-dough grain stage than the triticalevetch mixture, and 80 % more than the barleyvetch mixture. These results agree with those obtained by Lithourgidis et al (9 ) ; they demonstrated that the mixture of common vetch with oat (55:45) achieved higher production of DM than triticale-vetch mixture. In that study, oat-vetch mixture produced 18 % more dry matter than the mixture triticale-vetch. In addition, the vetch-oat mixture produced 8 % more dry forage than vetch monoculture. This is because oats shows greater complementarity with vetch because better use nitrogen fixed by the legume on the ground compared to other grasses. Another factor may be the physical ability of species to grow; it has been shown that weight and plant height are higher in oatvetch mixtures than with barley-vetch or wheatvetch(18), furthermore oats grow better in competition; previous studies indicate that this crop shows a linear increase in competition with vetch as the density increases oat(11). These qualities allow the oats have better growth and consequently increased production of dry matter(19). For this reason, oat-vetch association is the best option for improving the dry matter production of vetch as reported in other studies(11). However, the harvesting stage is another factor that strongly influences the production of crop DM. Studies carried out regarding the optimal time for cutting show that for highest yield and quality for growing oats is in the milky and doughy grain stages, harvesting up to 19 t ha-1 of dry matter, similar to the data obtained in the present study(20).

El VRF no fue diferente entre mezclas de cultivos (P>0.05; Cuadro 1). Tampoco hubo interacción entre la mezcla de cereales y etapa de cosecha sobre el VRF (P>0.05). Sin embargo, hubo un efecto entre los monocultivos (cebada, avena y triticale) y la mezclas de estos cereales con la veza en dos proporciones de semilla (65:35, 35:65; P<0.001). También, hubo un efecto de la etapa de cosecha sobre el VRF (P<0.001). Además, el efecto de la proporción de semilla sobre el VRF difirió dependiendo de la etapa de cosecha (P<0.05; Cuadro 4). Así, el monocultivo veza presentó mayores valores durante las etapas grano maduro (167.2) y lechoso (152.0). Le siguió el monocultivo avena con un valor de 133.3. Los menores valores los presentaron los monocultivos triticale (82.0) y cebada (84.6), le siguieron las proporciones triticale-veza (65:35; 90.2) y cebada-veza (35:65; 91.8). DISCUSIÓN

Los resultados demuestran que la producción de forraje y la calidad nutritiva de la mezcla de veza con cereales (cebada, avena y triticale) en dos proporciones de semilla (65:35; 35:65), se asocian con la etapa fenológica de cosecha. En efecto, la mezcla avena-veza resultó ser la asociación de cultivos más adecuada para la producción de MS comparado a las mezclas triticale-veza o cebada-veza. Particularmente, la proporción avena-veza (65:35) la cual produjo 40 % más de MS durante la etapa grano lechoso-masoso que la mezcla triticale-veza, y 80 % más que la mezcla cebada-veza. Estos resultados concuerdan con los obtenidos por Lithourgidis et al(9); ellos demostraron que la mezcla veza común con avena (55:45) logró mayor producción de MS que la mezcla vezatriticale. En ese estudio, la mezcla veza-avena produjo 18 % más de materia seca que la mezcla veza-triticale; además, la mezcla vezaavena, produjo 8 % más de forraje seco que el monocultivo veza. Lo anterior se debe a que la avena muestra mayor complementariedad con la veza debido a que aprovecha mejor el nitrógeno fijado por esta leguminosa en el suelo en comparación con otras gramíneas. Otro factor

The crude protein content in dry matter is important in assessing the nutritional quality of fodder(21). In the present study, the CP varied depending on the type of mixture and at what harvesting stage it was evaluated. The highest amount of crude protein was found in the mixtures oat-vetch and triticale-vetch during booting stage; and in terms of seed mixture ratios, the vetch monoculture obtained the highest during the grain mature stage, followed 286

PRODUCCIÓN Y CALIDAD DE FORRAJE EN MEZCLAS DE VEZA COMUN

puede ser la capacidad física de las especies en crecer; se ha demostrado que el peso y la altura de la planta son más altos en mezclas de avena-veza que en asociaciones de cebada-veza o trigo-veza(18), además, la avena se adapta mejor a la competencia; estudios previos indican que este cultivo muestra un incremento lineal en competición con la veza conforme la densidad de la avena incrementa(11). Estas cualidades le permiten a la avena tener un mejor crecimiento y en consecuencia mayor producción de materia seca(19). Por esta razón, la asociación avenaveza es la mejor opción para mejorar la producción de materia seca de la veza tal como reportaron en otros estudios(11). Sin embargo, la etapa de cosecha es otro factor que influye fuertemente en la producción de MS de los cultivos. Estudios desarrollados al respecto indican que el momento óptimo de corte para rendimiento y calidad para el cultivo de la avena es en el estado grano lechoso y masoso con 19 t ha-1, dato similar al obtenido en el presente estudio(20).

by oat-vetch (35:65) ratio during the booting stage. One cause of the high concentration of CP in the booting stage is due to the capture of nitrogen. Studies indicate that during this stage, plants capture the highest amount of inorganic nitrogen due to the presence of many leaves(22). In fact, some authors reported that during this time period the ratio of grain:foliage is greater (17:83), which allows greater amount of crude protein to be present in the plant (grain, 25.7 %; foliage 18.79 %)(23). Data reported to nowadays indicate that the inclusion of vetch in cereals substantially improves CP content in the mixture, especially mixtures of oats and vetch(4). The inclusion of vetch with the cereal, improved significantly the CP content of the mixture. However, the increase depended more on the stage of harvest and not the ratio of cereal seed as reported in other studies(9,24). The neutral detergent fiber represents the structural or cell wall in the forage. This variable is inversely related to the amount that an animal is able to consume. Thus, forages with low NDF values have high intake levels than those with higher values. Therefore, a low value of NDF is desirable for ruminants(4). In this study, the low values of NDF where presented in the vetch monoculture (363 g kg-1 DM) and its mixture with oat (35:65; 407 g) during the mature grain stage. Studies conducted in mixtures of oat with vetch indicate that the ratio of common vetch in oat is usually associated with an increase in the cellular content and a decrease in the NDF(11,25,26). However, in this study, low values NDF found in vetch and its mixture with oat depend more on the stage of harvest than the ratio of vetch seed in the mixture. This probably can be attributed to the decline of NDF values with increasing maturity of the forage due to a dilution effect created by an increase in the ratios of grain relative to the forage(4).

El contenido de proteína cruda en la materia seca es importante para evaluar la calidad nutritiva del forraje(21). En el presente estudio, la PC varió en función del tipo de mezcla y de la etapa de cosecha en que se llevó a cabo la evaluación. La mayor cantidad de proteína cruda lo obtuvieron las mezclas avena-veza y triticaleveza durante la etapa de embuche; y en proporciones de semilla, la mayor cantidad la obtuvo el monocultivo veza durante la etapa grano maduro, le siguió la proporción avenaveza (35:65) durante la etapa de embuche. Una de las causas de la concentración de PC durante la etapa de embuche se debe a la captura de nitrógeno. Estudios al respecto indican que durante esta etapa, las plantas capturan mayor cantidad de nitrógeno inorgánico debido a la presencia de mayor cantidad de follaje(22). De hecho, algunos autores reportaron que durante ese tiempo la proporción grano: follaje es mayor (17:83), lo que permite tener mayor cantidad de proteína cruda en la planta (grano, 25.7 %; follaje 18.79 %)(23). Datos reportados a la fecha indican que la inclusión de veza en los cereales mejora sustancialmente

Acid detergent fiber mainly contains cellulose, lignin and silica(4). ADF low values represent high energy content and digestibility, which are 287

Manuel de Jesús Flores Nájera, et al. / Rev Mex Cienc Pecu 2016;7(3):275-291

el contenido de PC de la mezcla, sobre todo en mezclas de avena con veza(4). La inclusión de la veza en el cereal, mejoró de manera importante el contenido de PC de la mezcla. Sin embargo, el incremento dependió más de la etapa de cosecha y no de la proporción de semilla en el cereal, tal como lo reportan en otros estudios(9,24).

desirable for ruminants. In the present study, the ADF content of the seed ratios in mixtures depended on the stage of harvest, being monocultures oat, vetch and the ratio 35:65 triticale-vetch which showed fewer ADF during milky grain stage. Some reports indicate that the inclusion of vetch in cereals improves the nutritional quality of the mixture reducing the percentage of ADF compared to monoculture(27). According to what was observed in this study, only to the extent triticale-vetch (35:65) could have reduced levels of ADF by the presence of vetch; however, other mixtures including vetch in cereals (oat and barley) did not change significantly the content of ADF mixtures(9).

La fibra detergente neutro, representa la pared estructural o celular en el forraje. Esta variable está inversamente relacionada a la cantidad que un animal es capaz de consumir. Así, forrajes con bajos valores de FDN tendrán altos niveles de consumo que aquéllos con valores altos. Por lo tanto, un valor bajo de FDN es deseable para los rumiantes(4). En este estudio, los bajos valores de FDN lo presentaron el monocultivo veza (363 g kg-1 MS) y su mezcla con avena (35:65; 407 g) durante la etapa grano maduro. Estudios desarrollados en asociaciones de avena con veza indican que la proporción de veza común en la avena, es usualmente asociada con un incremento en el contenido celular y una disminución en la FDN(11,25,26). Sin embargo, en el presente estudio, los bajos valores de FDN encontrados en la veza y su mezcla con la avena dependió más de la etapa de cosecha que de la proporción de semilla de veza en la mezcla. Esto se debe probablemente a que el decline de los valores de FDN con el incremento en la madurez del forraje puede ser atribuido al efecto dilución creado por un incremento en la proporción de grano relativo al forraje(4).

TDN content refers to the nutrients from the forage that are available to the animals, and these values are associated with ADF concentrations in the forage. In previous studies carried out on cereal mixtures (oat and triticale) with vetch indicate that the content of TDN decreases as the ratio of seed vetch increased in the mixture(9). In the present study, the ratio of vetch seed in cereals did not reduce the concentrations of TDN, since the vetch monoculture and mixed with barley (65:35) were those who had higher amounts of TDN. It is likely that the high values of TDN reported in common vetch are attributed on one hand to the low values of ADF present in vetch, but mainly to the phenological stage in which it was harvested.

La fibra detergente ácido contiene principalmente celulosa, lignina y sílice(4). Valores bajos de FDA representan contenidos altos de energía y digestibilidad, los cuales son deseables para los rumiantes. En el presente estudio, el contenido de FDA de la proporción de semilla en las mezclas dependió de la etapa de cosecha, siendo los monocultivos avena, veza y la proporción 35:65 triticale-veza los que presentaron menor cantidad de FDA durante la etapa grano lechoso. Algunos reportes indican que la inclusión de la veza en los cereales mejora la calidad nutritiva de la mezcla reduciendo el porcentaje de FDA en comparación al monocultivo(27). De acuerdo

NEL was not affected by the mixture of crops, nor by the harvest phenological stage. Only the vetch monoculture (1.62 Mcal kg -1 DM) presented higher values of NEL than the cereals. These results differ from those by Lithourgidis et al(9), who reported that the net energy of lactation was similar for oat-vetch and triticalevetch mixtures and monocultures oat, triticale and vetch. Also, these same authors(28) found no significant differences between mixtures of vetch with barley or wheat vetch in terms of NEL content. It is likely that the content of NEL found in this study was due to sampling at the 288

PRODUCCIÓN Y CALIDAD DE FORRAJE EN MEZCLAS DE VEZA COMUN

a lo observado en este estudio, únicamente en la proporción triticale-veza (35:65) se podrían haber reducido los niveles de FDA por la presencia de la veza; sin embargo, en las otras mezclas la inclusión de la veza en los cereales (avena y cebada) no cambió de manera importante el contenido de FDA de las mezclas(9).

different phenological harvesting stages of the crop, since in the study reported by Lithorurgidis, NEL was evaluated in the milky-dough grain state, whereas in the present study, there was no interaction between monocultures and the harvest stage.

RFV is the index that is used to predict consumption and energy value of forage, and this is derived from the digestibility of dry matter and dry matter intake(29). Those forages with values greater than 151 are considered excellent(30). In the present study, vetch was the monoculture that presented the highest values (167.2) during the whole grain stage, which is considered excellent in animal feed. It was followed by the monoculture of oat with a value of 133, which was not different from the vetch. Both values depended on the phenological stage of harvest.

El contenido de NDT se refiere a los nutrientes del forraje que están disponibles para los animales, y estos valores están asociados a las concentraciones de FDA del forraje. En estudios previos desarrollados en mezclas de cereales (avena y triticale) con veza indicaron que el contenido de NDT disminuyó conforme se incrementó la proporción de semilla de veza en la mezcla (9) . En el presente estudio, la proporción de semilla de veza en los cereales no redujo las concentraciones de NDT, ya que el monocultivo veza y su mezcla con cebada (65:35) fueron los que obtuvieron mayores cantidades de NDT. Es probable que los altos valores de NDT reportados en veza común sean atribuidos por un lado a los bajos valores de FDA presentes en la veza, pero principalmente a la etapa fenológica en que se cosechó.

CONCLUSIONS AND IMPLICATIONS

It can be concluded that the production and quality of vetch mixed forage with cereals (barley, oat and triticale) depend on the stage of harvest. In this study, oat-vetch mixture achieved higher production of dry matter and better crude protein content. In addition, the relative feed value was higher during the mature grain stage. These results suggest that oatvetch mixture may be a viable alternative for the production of good quality forage for ruminant feed during the winter.

La ENL no fue afectada por la mezcla de cultivos, ni por la etapa fenológica de cosecha. Únicamente el monocultivo veza (1.62 Mcal kg-1 MS) fue el que presentó mayor cantidad de ENL que los cereales. Estos resultados difieren de los reportados por Lithourgidis et al(9), quienes mencionaron que la energía neta de lactancia fue similar para las mezclas avenaveza y triticale-veza y para los monocultivos avena, triticale y veza. También, estos mismos autores (28) no encontraron diferencias significativas entre mezclas de veza con cebada o veza con trigo sobre el contenido de ENL. Es probable que el contenido de ENL encontrado en el presente estudio se debió a la etapa fenológica de cosecha en que se llevó a cabo el muestreo, ya que en los estudios reportados por Lithorurgidis, la ENL se evaluó en el estado grano lechoso-masoso, mientras que en el presente estudio, no hubo una interacción entre el monocultivo y la etapa de cosecha.

ACKNOWLEDGEMENTS

We thank the COFUPRO-Fundación Produce Zacatecas for providing financial support through the project entitled “Technology transfer in cutting forage production and its conservation (silage in milk production).” End of english version

289

Manuel de Jesús Flores Nájera, et al. / Rev Mex Cienc Pecu 2016;7(3):275-291

El VRF es el índice que es usado para predecir el consumo y valor energético de los forrajes, y éste se deriva de la digestibilidad de la materia seca y del consumo de materia seca(29) . Aquellos forrajes con valores mayores a 151 son considerados como excelentes(30). En el presente estudio, la veza fue el monocultivo que presentó valores mayores (167.2) durante la etapa grano entero, lo cual es considerado como excelente en la alimentación animal. Le siguió el monocultivo avena con un valor de 133, el cual no fue diferente al de la veza. Ambos valores dependieron de la etapa fenológica de cosecha.

CONCLUSIONES E IMPLICACIONES

4. 5.

Se concluye que la producción y la calidad del forraje en mezcla de veza con cereales (cebada, avena y triticale) depende de la etapa de cosecha. En este estudio, la mezcla avena-veza logró mayor producción de materia seca y mejor contenido de proteína cruda. Además, el valor relativo del forraje fue más alto durante la etapa grano maduro. Estos resultados permiten sugerir que la mezcla avena-veza puede ser una alternativa viable para la producción de forraje de buena calidad en la alimentación de rumiantes durante el invierno.

Anil L, Park J, Phipps RH, Miller F. Temperate intercropping of cereal for forage: a review of potential for growth and utilization with particular reference to the UK. Grass Forage Sci 1998;(53):301-317. Thomson EF, Rihawi S, Nersoyan N. Nutritive value and yields of some forage legumes and barley harvested as immature herbage, hay and straw in North-West Syria. Exp Agric 1990;(26):49-56.

Caballero R, Goicoechea EL. Utilization of winter cereals as companion crops for common vetch and hairy vetch. Barba FM, Abreu JM editors. Grasslands facing the energy crisis. Proc General Meet European Grassland Federation. 1986:379-384.

Thompson DJ, Stout DG, Moore T. Forage production by 4 annual cropping sequences emphasizing barley under irrigation in southern interior British Columbia. Can J Plant Sci 1992;(72):181-185. Lithourgidis AS, Vasilakoglou IB, Dhima KV, Dordas CA, Yiakoulaki MD. Forage yield and quality of common vetch mixtures with oat and triticale in two seeding ratio. Field Crops Res 2006;(99):106-113.

11. Caballero R, Goicoechea EL, Hernaiz PJ. Forage yields and quality of common vetch and oat sown varying seeding ratios and seeding rates of vetch. Field Crops Res 1995;(41):135-140.

12. Núñez HG, Payán GJ, Peña RA, González CF, Ruiz BO, Arzola AC. Caracterización agronómica y nutricional del forraje de variedades de especies anuales en la región norte de México. Téc Pecu Méx 2010;1(2):85-98.

13. Echavarría CHFG, Serna PA, Flores NMJ, Medina GG, Gutiérrez LR, Salinas GH, et al. Sistema de producción de forrajes de temporal una opción para la reconversión productiva. Campo Experimental Zacatecas. CIRNOC.INIFAP. Folleto Técnico No. 53. 2014.

Se agradece a la COFUPRO-Fundación Produce Zacatecas por el apoyo financiero otorgado a través del proyecto titulado “Transferencia de tecnología en la producción de forrajes de corte y su conservación (ensilajes en la producción de leche)”.

14. AOAC. Official Methods of Analysis. 16th ed. Assoc. Off Anal Chem, Arlington, VA. 1996. 15. Georing HK, Van Soest PJ. Forage fiber analysis: Apparatus reagents, procedures, and some applications. Agric 1970. Handbook 379. 16. Horrocks RD, Vallentine JF. Harvested forage. London, UK: Academic Press; 1999. 17. SYSTAT 13, 2013. Chicago, IL, USA.

18. Ansar M, Ahmed ZI, Malik MA, Nadeem M, Majeed A, Rischkowsky BA. Forage yield and quality potential of winter cereal-vetch mixtures under rainfed conditions. Emir J Food Agric 2010;22(1):25-36.

LITERATURA CITADA 2.

Eskandari H, Ghanbari A, Javanmard A. Intercropping of cereals and legumes for forage production. Not Sci Biol 2009;(1):7-13.

10. Qamar IA, Keatinge JDH, Mohammad N, Ali A, Khan MA. Introduction and management of common vetch/barley forage mixtures in the rainfed areas of Pakistan. 3. Residual effects on following cereal crops. Aust J Agric Res 1999;(50):21–27.

AGRADECIMIENTOS

Ghanbari-Bonjar A. Intercropped wheat (Triticum aestivum) and bean (Vicia faba) as a low-input forage [Ph.D thesis], Wye College, University of London, England. 2000.

Ofori F, Stern WR. Cereal-legume intercropping system. Adv Agron 1987;(41):41-90.

19. Jannink JL, Liebman M, Merrick LC. Biomass production and nitrogen accumulation in pea, oat and vetch Green manure mixtures. Agron J 1996;88:231-240.

Francis, CA. Biological efficiencies in multiple cropping systems. Adv Agron 1989;(42):1-42.

290

PRODUCCIÓN Y CALIDAD DE FORRAJE EN MEZCLAS DE VEZA COMUN 20. Espitia RE, Villaseñor ME, Tovar GR, de la O OM, Limón OA. Momento óptimo de corte para rendimiento y calidad de variedades de avena forrajera. Rev Méx Cienc Agr 2012;3(4):771-783.

25. Haj-Ayed M, González J, Caballero R, Alvir MR. Nutritive value of on-farm common vetch-oat hays. II. Ruminal degradation of dry matter and crude protein. Ann Zootech 2000;(49):391-398.

22. Verhulst N, François I, Grahmann K, Cox R, Govaerts B. Nitrogen use efficiency and optimization of nitrogen fertilization in conservation agriculture. CAB Reviews 2013;8:053.

27. Yolcu H, Dasci M, Tan M. Evaluation of annual legumes and barley as sole crops and intercrop in spring frost conditions for animal feeding. I. Yield and quality. J Anim Vet Adv 2009;(7):1337-1342.

21. Assefa G, Ledin I. Effect of variety, soil type and fertilizer on the establishment, growth, forage yield, quality and voluntary intake by cattle of oats and vetches cultivated in pure stands and mixtures. Anim Feed Sci Technol 2001;(92):95-111.

26. Erol E, Kaplan M, Kizilsimsek M. Oats ( Avena sativa) common vetch ( Vicia sativa) mixtures grown on a lowinputs basis for a sustainable agriculture. Trop Grasslands 2009;(43):191-196.

23. Ramírez-Ordóñes S, Domínguez-Díaz D, Salmerón-Zamora JJ, Villalobos-Villalobos G, Ortega-Gutiérrez JA. Producción y calidad del forraje de variedades de avena en función del sistema de siembra y de la etapa de madurez al corte. Rev Fitotec Mex 2013;36(4):395-403.

28. Lithourgidis AS, Dhima KV, Vasilakoglou IB, Dordas CA, Yiakoulaki MD. Sustainable production of barley and wheat by intercropping common vetch. Agron Sustain Dev 2007;(27):95-99.

29. Moore JE, Undersander DJ. Relative forage quality: An alternative to relative feed value and quality index. Proc 13th Ann Florida Rum Nut Symp. Florida. 2002:16-32.

24. Bingol NT, Karsu MA, Yilmaz IH, Bolat D. The effects of planting time and combination on the nutrient composition and digestible dry matter yield of four mixtures of vetch varieties intercropped with barley. Turk J Vet Anim Sci 2007;(31):297-302.

30. Horrocks RD, Vallentine JF. Harvested forages, London, UK: Academic Press; 1999.

291

ESTIMACIÓN TIER II DE EMISIÓN DE METANO ENTÉRICO EN HATOS Rev Mex DE VACAS Cienc Pecu LACTANTES 2016;7(3):293-308

Estimación Tier II de emisión de metano entérico en hatos de vacas lactantes en Querétaro, México Tier II estimation of enteric methane emission in dairy cow herds in Querétaro, México Daniela Morante Lópeza, Aurelio Guevara Escobara, Humberto Suzán Azpiria, Vicente Lemus Ramírezb, Carlos Francisco Sosa Ferreyraa

RESUMEN

El metano (CH4) contribuye al cambio climático y su fuente antropogénica más importante es la fermentación entérica del ganado. A nivel continental el Panel Intergubernamental de Cambio Climático establece factores de emisión entérica de CH4 por defecto (Tier I); pero las decisiones y evaluación de la mitigación necesitan estimaciones más exactas. Así, el objetivo fue calcular la emisión de metano entérico de hatos de vacas Holstein-Friesian en Querétaro, México con datos de pesaje de leche (Tier II). Las curvas de lactación se modelaron con la función gamma incompleta por lactancia y hato. Un total de 11,092 lactancias del 2007 tuvieron un rendimiento ajustado a 305 días (d) de 9,985 kg leche. La curva de lactancia fue diferente entre primíparas y multíparas; la duración de la lactancia fue 365±21 días. Durante la lactancia, la emisión entérica para primíparas y multíparas a 305 días fue 165.7±3.8 y 181.6±8.3 kg CH4 vaca-1; a 365 d fue de 201.8±4.6 y 223.7±11.0 kg CH4 vaca-1 (P<0.0025). La intensidad de emisión entérica fue semejante entre primíparas y multíparas (18 y 19 g CH4 kg-1 leche), similar a lo reportado en la literatura para vacas de alta producción intensiva. Los registros de rendimiento fueron útiles para caracterizar el rendimiento, duración de la lactancia y el efecto de número de lactancia en su influencia sobre los estimados de intensidad de emisión entérica. PALABRAS CLAVE: Cambio climático, Factor de emisión, GEI, Mitigación, Metano.

ABSTRACT

Methane (CH4) contributes to climatic change and livestock enteric fermentation is the most important anthropogenic source. The Intergovernmental Panel on Climate Change establishes continental default emission factors for enteric methane (Tier I); but decisions and evaluation of mitigation needs more precise estimates. Therefore, the objective was to calculate the enteric emission of Holstein-Friesian herds in Queretaro, México using milk test-day records (Tier II). Lactation curves were modeled using the incomplete gamma function according to lactation number and herd. A total of 11,092 lactations from 2007 had an average 305 d milk yield of 9,985 kg. Lactation curve was different between primiparous and multiparous; average days in milk were 365±21 d. During lactation, the primiparous and multiparous enteric emission at 305 d was 165.7±3.8 and 181.6±8.3 kg CH4 head-1; at 365 d was 201.8±4.6 and 223.7±11.0 kg CH4 head-1 (P<0.0025). Enteric emission intensity was similar between primiparous and multiparous (18 and 19 g CH4 kg-1 milk), similar to reports in the literature for high yielding cows. Test day records were useful to characterize yield, days in milk and parity influencing the estimates of enteric emission intensity. KEY WORDS: Climatic change, Emission factor, GHG, Mitigation, Methane.

INTRODUCCIÓN

INTRODUCTION

Disminuir las emisiones de gases con efecto invernadero (GEI) es una estrategia de

Attempts to reduce greenhouse gases (GHG) are aimed at mitigating the causes of climate

Recibido el 6 de mayo de 2005. Aceptado el 4 de septiembre de 20015. a

Facultad de Ciencias Naturales. Universidad Autónoma de Querétaro. 76230. Juriquilla, Querétaro. México. guevara@uaq.mx. Correspondencia al segundo autor. Facultad de Medicina Veterinaria y Zootecnia. Universidad Nacional Autónoma de México. México.

293

Daniela Morante López, et al. / Rev Mex Cienc Pecu 2016;7(3):293-308

mitigación de las causas del cambio climático. Los inventarios de GEI miden los avances de los países en la disminución de estas emisiones en los sectores productivos. En 2010 las emisiones de GEI en México fueron 748,252 Gg de bióxido de carbono equivalente (Ceq); siendo un Gg igual a 109 g(1). La masa de gas emitida a la atmósfera y el efecto forzante radiativo de cada GEI determinan la importancia del CO2, CH4, N2O, O3, entre otros. En los inventarios de GEI, el metano (CH4) merece atención porque su efecto forzante radiativo es de 25 a 34 veces mayor al CO2, entonces un 1 g CH4 es igual a 25 g Ceq(2).

change. On an international level, GHG inventories measure progress made by different countries in reducing emissions in production sectors. In 2010, Mexico’s GHG emissions totaled 748,252 Gg carbon dioxide equivalents – 1 Gg is equal to 109 g(1). The overall mass of gas emitted into the atmosphere and the radiative forcing effect of each GHG in this mass determines the importance of greenhouse gases such as CO2, CH4, N2O, and O3, among others. Methane (CH4) deserves particular attention among the GHG because its radiative forcing effect is 25 to 34 times greater than that of CO2, that is, 1 g CH4 equals at least 25 g Ceq(2).

El papel de la ganadería en el contexto de las emisiones de GEI tiene gran debate e importancia(3,4,5). Para México, la emisión de CH4 por fermentación entérica fue el 20.1 % del CH4 total, después de las emisiones fugitivas en la producción de petróleo(6). El CH4 entérico y por excretas suman de 75 a 95 % de las emisiones totales de GEI en las granjas lecheras de 38 países(7). En el mundo, México ocupaba el 11° lugar en emisión de CH4 entérico con 22,244 Gg en 1998(8). Sin embargo, para 2010 se reportan 37,961 Gg Ceq por fermentación entérica y 7,553 Gg Ceq a partir del manejo de excretas; siendo 92,184 Gg Ceq el total para la categoría agricultura(1). Para el sector lechero mexicano la emisión fue de 144,000 Gg CH4 en 1970 y 270,000 Gg CH4 en 2010(9). Otro estudio estimaba en 1995 una emisión de 285 Gg CH4(10). Dado el amplio rango de las cifras, es importante reducir la incertidumbre en las estimaciones investigando sobre los factores e intensidades de emisión.

The role of livestock production in GHG emissions is actively debated, but clearly significant(3,4,5). In Mexico, for example, total CH 4 emissions from enteric fermentation accounted for 20.1 % methane emissions while fugitive emissions from petroleum production represented most of the remainder(6). Enteric and manure-related CH4 is responsible for 75 to 95 % of total GHG emissions at dairy farms in 38 countries(7). Worldwide, Mexico was in eleventh place as far as enteric CH4 emissions (22,244 Gg) in 1998(8). By 2010, however, emission from enteric fermentation was 37,961 Gg Ceq and that from feces management was 7,553 Gg Ceq, which together accounted for almost half the 92,184 Gg Ceq total CH 4 emissions from the agricultural sector (1) . However, other studies have generated disparate figures for the total amount of CH4 emitted. One study reported emissions of 144,000 Gg CH4 in 1970 and 270,000 Gg CH4 in 2010 for the dairy sector in Mexico(9), whereas another study reported emissions in 1995 to have been 285 Gg CH4(10). This wide range of figures highlights the need to reduce uncertainty in emissions estimations by studying emission factors and intensities.

Los países adheridos a la Convención Marco sobre el Cambio Climático acordaron reportar anualmente sus inventarios de emisión de GEI según las guías del Panel Intergubernamental del Cambio Climático (IPCC) usando alguno de tres Tier o niveles de precisión(11). Para la emisión de CH4 por fermentación entérica el Tier I considera niveles de actividad y factores de emisión por cabeza (FE); los primeros provienen de datos de inventarios ganaderos y

Signatory countries of the United Nations Framework Convention on Climate Change (UNFCCC) agreed to annually report GHG emission inventories following Intergovernmental 294

ESTIMACIÓN TIER II DE EMISIÓN DE METANO ENTÉRICO EN HATOS DE VACAS LACTANTES

los segundos de valores por defecto especificados para regiones continentales y sistemas productivos. La emisión de CH4 resulta de la multiplicación del nivel de actividad por el FE. En el Tier II el FE se calcula a partir del consumo de energía neta para mantenimiento, actividad, crecimiento, gestación y lactación. El Tier III determina el FE mediante metodologías de medición directa de la emisión de GEI.

Panel on Climate Change (IPCC) guidelines, using either of three Tier or precision levels(11). For CH 4 emissions originating in enteric fermentation, Tier I considers activity levels and emission factors (EF) per head of livestock; the former are taken from livestock inventory data and the latter from default values specified for continental regions and productive systems. The CH 4 emissions level is then calculated by multiplying the activity level by the EF. In Tier II, the EF are calculated from net energy intake for maintenance, activity, growth, gestation and lactation. Tier III determines the EF using direct GHG emissions measurement methodologies.

La metodología del IPCC basada en el cálculo por cabeza del FE (Tier I) desfavorece a la productividad como estrategia de mitigación; en tanto las emisiones de GEI por unidad de producto disminuyen conforme aumenta la productividad(12). La intensidad de emisión varía entre productores dada las diferentes condiciones agroecológicas, prácticas de pastoreo o estabulación, alimentación y alimentos. El concepto de intensidad de emisión es útil para valorar las estrategias de mitigación en el sistema productivo y para guiar los patrones de consumo de alimentos por la sociedad(13).

The Tier I methodology, based on calculation of EF per head, discourages changes in productivity as a mitigation strategy while GHG emissions per product unit decrease as productivity increases(12). Emission intensity varies among producers in response to agroecological conditions, grazing and rearing practices, feed regimes and feed type. The concept of emission intensity is useful in evaluating mitigation strategies at the productive system level and for guiding feed intake patterns(13).

Existen datos que no se usan en la generación de inventarios de GEI, pero integrarlos en el cálculo del inventario tiene mejor relación costo beneficio en comparación a: efectuar experimentos, diseñar nuevos procedimientos de medición o modificar las metodologías o ecuaciones existentes; una base de datos de este tipo es la mantenida por la Asociación Holstein de México (AHM) al recopilar, procesar, certificar y difundir información de los hatos lecheros. La AHM genera indicadores productivos para el mejoramiento genético del ganado y conserva datos genealógicos de la producción de vacas Holstein-Friesian; suficientes para calcular la emisión de CH4 por fermentación entérica usando el Tier II. Por tanto, el objetivo de este estudio fue calcular la emisión de CH4 entérico para la lactancia y el periodo seco con datos del año 2007 en Querétaro. Este año concuerda con el Censo Agrícola, Ganadero y Forestal del 2007 producido por el Instituto Nacional de Estadística y Geografía (INEGI). Se usó el Tier II y los datos proporcionados por la

Some data are not normally used in GHG inventory generation. Integrating them into inventory calculation can improve the cost:benefit ratio of inventory generation compared to other options such as running experiments, designing new measurement procedures or modifying existing methodologies or equations. For dairy herds in Mexico, an excellent source of this type of data is maintained by the Holstein Association of Mexico (Asociación Holstein de México - AHM), which collects, processes, certifies and publishes data on registered dairy herds. The AHM generates production indicators aimed at improving cattle genetics and archives genealogical data for production in Holstein-Friesian cows. These records are sufficient to allow calculation of enteric fermentation CH4 emissions using the Tier II methodology. 295

Daniela Morante López, et al. / Rev Mex Cienc Pecu 2016;7(3):293-308

The objective of the present study was to calculate the enteric CH4 emissions for lactation and dry periods of dairy cows using data from 2007 in the state of Querétaro, Mexico. In this same year, the National Institute of Statistics, Geography and Data Processing (Instituto Nacional de Estadística, Geografía e Informática - INEGI) conducted the Agricultural, Livestock and Forestry Census. The Tier II methodology was applied using AHM data representing confined, intensive system dairy herds in the state of Querétaro, Mexico.

AHM para representar hatos del sistema intensivo de producción lechera en estabulación en Querétaro. MATERIAL Y MÉTODOS

Los registros de lactancia consistieron en identificación del hato y de la vaca, fecha de nacimiento, fecha de parto, número de lactancia, fecha de fin de lactancia, fecha de medición del pesaje de leche, kilogramos de leche en la fecha de medición, porcentaje de grasa y proteína en el pesaje. El laboratorio de la AHM es certificado por Quality Certification Services Inc. y efectúa la medición de grasa y proteína con un analizador infrarrojo medio modelo Bentley 2000 (Bentley Instruments Inc., USA). Los registros tuvieron hasta diez fechas de pesaje, a un intervalo promedio de 33 días (d). Se usaron 11,092 registros; considerándose sólo lactancias con al menos un día de lactancia en el 2007 y lactancias mayores a 100 d y menores a 500 d. Al limitar el análisis a lactancias con 500 d se logra un compromiso razonable entre vacas con lactaciones de 305 d y vacas con lactancias más largas, pues sólo 5 % de las vacas lactan más de 500 d(14), pero 55 % lactan más de 305 d(15).

MATERIAL AND METHODS

The lactation data used in the calculations included herd and cow identification; date of birth; calving date; lactation number; lactation end date; milk yield (kg) and weighing date; and milk fat and protein percentage. The AHM laboratory is certified by Quality Certification Services Inc. and runs fat and protein measurements using a mid infrared analyzer (Bentley 2000, Bentley Instruments Inc., USA). Each lactation record contained up to ten weighing dates at an average interval of 33 d. A total of 11,092 records were used in the analysis, including those with at least one lactation day in 2007, lactations longer than 100 d and shorter than 500 d. Limiting the analysis to lactations of less than 500 d results in a reasonable compromise between cows with lactations of 305 d and those with longer lactations, as only 5 % of cows lactate longer than 500 d(14), but 55 % lactate for more than 305 d(15).

El rendimiento de leche determina una proporción importante de las necesidades de energía de la vaca, también la cantidad de leche diaria varía durante la lactancia y el número de lactancia. Se ha observado que la función gamma incompleta representa en forma adecuada la curva de lactancia caracterizada por una fase ascendente, un pico y un declive gradual(16); esta función tiene igual o menor varianza del error en comparación con otras funciones (Gaines, Rook, Dijkstra o Pollott) representativas de la curva de lactancia en hatos del centro de México (17). Considerando la relativa habilidad predictiva de modelos complejos de la curva de lactancia, se recomienda usar modelos como la función gama incompleta, a menos de necesitarse detalles mecanísticos de curva de lactancias extendidas > 800 d(15). La función utilizada es:

Milk yield determines a significant proportion of a cow’s energy requirements; daily milk yield can vary during lactation and by lactation number. The incomplete gamma function adequately represents the lactation curve characterized by an ascending phase, a peak and a gradual decline(16); indeed, it has an error variance equal to or less than other formulas (e.g. Gaines, Rook, Dijkstra or Pollott) used to represent lactation curves in herds in central Mexico(17). Given the relative predictive 296

ESTIMACIÓN TIER II DE EMISIÓN DE METANO ENTÉRICO EN HATOS DE VACAS LACTANTES

Yt= a · tb · e-ct

capacity of complex lactation curve models, those like the incomplete gamma function are recommended, unless mechanistic details are needed for extended lactation curves (> 800 d)(15). The formula used here was:

Donde Yt es la producción de leche en el t-ésimo día de lactancia; e es la base de los logaritmos naturales; a, b, c son los parámetros que definen las curvas a ajustar. El rendimiento inicial inmediatamente después del parto se representa por a ; b es la tasa de cambio desde la producción inicial hasta el máximo rendimiento; c es la tasa de cambio desde el máximo rendimiento hasta el final de la lactancia. La persistencia (s), definida como el grado con el que se mantiene el pico de producción de leche, se calculó como “(b+1) · ln(c)”; la producción de leche por lactancia a 305 d (Y) se obtuvo como la sumatoria de Yt hasta el día 305; el máximo rendimiento de leche (Ymax) se calculó con la expresión a · (b/c)b · e-b; y la media de los días en leche (DL), como el promedio de cada lactancia.

Yt= a · tb · e-ct

where Yt is milk yield on the tth day of lactation; e is the base of the natural logarithms; and a, b and c are the parameters defining the curves to fit. Yield immediately after calving is represented by a; the rate of change from initial production to maximum yield is b; and c is the rate of change from maximum yield to end of lactation. Persistence (s) is defined as the point at which peak milk yield is maintained; it is calculated as “(b+1) · ln(c)”. Milk yield per 305 d lactation (Y) was calculated as the sum of Yt to d 305. Maximum milk yield (Y max ) was determined with the formula a · (b/c)b · e-b, and mean duration of lactation (DL) was the average number of days in each lactation.

El modelo de curva de lactancia se determinó usando “Table Curve 2D” (Systat Software Inc.) y verificando la significancia de la prueba F para el error por bondad de ajuste, la normalidad y varianza homogénea de los residuales; sólo se consideraron los modelos significativos que cumplieran los supuestos de normalidad y homocedasticidad. La independencia en los residuales se confirmó con la función de auto-correlación hasta el orden 10 y prueba de t usando Minitab v 16 (Minitab Inc.). Las variables modeladas fueron rendimiento de leche (Yt) y porcentaje de grasa (Gt). Las vacas de cada hato fueron submuestras y los hatos las observaciones; para poder inferir sobre los hatos, poder verificar la bondad de ajuste y considerando al hato como una condición de manejo característico de cada grupo de animales. Las repeticiones fueron n = 16, 17, 16, 16, 13, 14 para la primera a sexta lactancia (L1 a L6). La sexta lactancia contempló los registros de seis o más lactancias. Las medias de los estimadores de los parámetros de la función gamma incompleta, DL, s, Y, Ymax y el pico de producción se compararon con la prueba Tukey-Kramer para modelos desbalanceados(18) y siendo la variable explicativa el número de

The lactation curve model was generated using the package Table Curve 2D (Systat Inc.). Significance was confirmed with the F test for goodness of fit error, normality and homogeneous variance of residuals. Only significant models that met the assumptions of normality and homoscedasticity were considered in the analysis. Residuals independence was confirmed with the autocorrelation function to the 10th order, and a t-test using the Minitab v. 16 pacakege (Minitab Inc.). Modeled variables were milk yield (Yt) and fat percentage (Gt). Cows within each herd were subsamples, while each herd was a replicate. This structure allowed us to infer about the herds, and confirm goodness of fit considering the herd as a characteristic management condition of each group of animals. Repetitions were n = 16, 17, 16, 16, 13, 14 for the first to the sixth lactation (L1 to L6). The sixth lactation included records for cows with six or more lactations. Parameter estimator means for the incomplete gamma function, DL, s, Y, Ymax and peak production were compared with a Tukey-Kramer test for 297

Daniela Morante López, et al. / Rev Mex Cienc Pecu 2016;7(3):293-308

lactancia. También se probó el contraste entre vacas primíparas y multíparas. En todas las hipótesis la confianza fue de 95%. Los procedimientos se efectuaron con el Paquete JMP v7 (SAS Institute Inc.).

imbalanced models(18), with lactation number as the explanatory variable. The contrast between primiparous and multiparous cows was also tested. The confidence level in all analyses was 95% and analyses were run with the JMP v7 package (SAS Institute Inc.).

La emisión de CH4 para cada hato y parto se calculó usando el Tier II(11). La emisión de CH4 procedente de la fermentación entérica se calculó en términos del contenido de energía bruta (EB) y la conversión de energía a metano (Y m ). La única propiedad del alimento considerada es la digestibilidad de la energía:

Methane (CH4) emissions were calculated for each herd and lactation number using the Tier II methodology(11). Emissions from enteric fermentation were calculated in terms of gross energy (GE) content and the conversion rate of energy to methane (Ym). The only feed property considered was energy digestibility:

Emisiones= FE · Población

Donde: Emisiones es la liberación de CH4 procedente de la fermentación entérica (kg CH4 año -1 ); FE es el factor de emisión correspondiente a una población específica (kg CH4 vaca-1 año-1) y Población es el número de vacas. El FE se calcula como:

Emissions= EF · Population

Where Emissions is the release of CH4 from enteric fermentation (kg CH4 yr-1); EF is the emission factors corresponding to a specific population (kg CH4 cow-1 yr-1); and Population is the number of cows. The EF is calculated as:

FE= (EB · Ym · 365 d) / (55.65 MJ / kg CH4)

EF= (GE · Ym · 365 d) / (55.65 MJ / kg CH4)

Donde: Ym es la tasa de conversión del CH4 a partir de energía bruta, con valor de 0.06 equivalente a 60 kJ MJ-1(11). No obstante, Ym puede variar con el nivel de producción de leche y las propiedades de los alimentos; para vacas de alta producción en Alemania (7,200 kg L vaca-1 año-1 ) se reporta un valor de 61 kJ MJ-1(19). Para vacas de alta producción en EE.UU. el Ym fue 5.63 % de la EB(20). La absorción EB en MJ vaca-1 d-1 se deriva como la suma de las necesidades de energía neta y las características de digestibilidad de los alimentos:

Where Ym is the CH4 conversion rate from GE with a value of 0.06 equivalent to 60 kJ MJ-1(11). However, Ym can vary in response to milk yield and feed properties. For example, Ym is 61 kJ MJ-1 in high yielding cows (7,200 kg L cow-1 yr1) in Germany(19), and in high-yield cows in the United States Ym was 5.63 % of GE(20). Absorption of GE in MJ cow-1 d-1 is derived from the sum of net energy needs and feed digestibility characteristics (DE= digestible energy, etc.):

EB= {[(Em + Ea + EL + Ep) / (Ema / ED)]} / (ED/100)

GE= {[(Em + Ea + EL + Ep) / (Ema / DE)]} / (DE/100)

La energía neta de mantenimiento (Em), en MJ d-1 es:

Net maintenance energy (Em) in MJ d-1 is: Em= Cfi · (weight)0.75

Em= Cfi · (peso)0.75

Where Cfi= 0.335, based on the coefficients for calculating Em(11). For the purpose of calculating Em, the body weight corresponding to L1, L2 and L3 were calculated from a sample of 165 cows from eleven corrals. The resulting averages

Donde: Cfi = 0.335, según los coeficientes para el cálculo de la Em(11). Para fines del cálculo de la Em, se estimó el peso correspondiente a las lactancias 1, 2 y 3

298

ESTIMACIÓN TIER II DE EMISIÓN DE METANO ENTÉRICO EN HATOS DE VACAS LACTANTES

con un muestreo de 165 vacas en 11 establos, los promedios fueron: 526, 590 y 640 kg; para las lactancias primera a tercera; para las lactancias 4, 5 y 6 se usó un peso de 680 kg representativo de vacas de talla grande(21).

were 526 kg for L1, 590 kg for L2 and 640 kg for L3; the weight 680 kg was used for lactations 4, 5 and 6 since it represents large cows(21). Net energy for milk synthesis (EM), in MJ d-1, is: Em= Yt · (1.47 + 0.40 · Gt)

La energía neta para la síntesis de leche (EL), en MJ d-1 es:

Net energy for pregnancy (Ep), in MJ d-1 is:

EL= Yt · (1.47 + 0.40 · Gt)

Ep= Cp · Em

La energía neta para la preñez Ep en MJ d-1 es: Ep= Cp · Em

where C p = 0.10, which is the pregnancy coefficient.

La relación entre la energía de mantenimiento presente en una dieta y la energía digestible consumida (Ema / ED), en MJ d-1 es:

Ema / DE= 1.123 – (4.092 · 10-3 · DE) + [1.126 · 10-5 · (DE)2] – (25.4/DE)

Donde: Cp= 0.10, correspondiente al coeficiente de preñez.

The ratio between maintenance energy in a diet and digestible energy (DE) intake (Ema / DE), in MJ d-1 is:

Ema / ED= 1.123 – (4.092 · 10-3 · ED) + [1.126 · 10-5 · (ED)2] – (25.4/ED)

Feed energy concentration was expressed as digestible energy (DE), calculated in Mcal kg-1 and converted to MJ kg-1(21):

La concentración de energía en el alimento expresada como energía digestible (ED) se calculó en Mcal kg-1 y convertida a MJ kg-1 es(21): ED= 0.1847371 · NDT (%)

DE= 0.1847371 · TDN (%)

Where TDN is total digestible nutrients. This is equal to 68 % of TDN in the diet of high-yield, large (average weight = 680 kg) cows, and includes a 3 % reduction in digestion efficiency in the TDN value when feeding at three times the maintenance level(21). The 12.56 MJ kg-1 value used for DE is similar to the 18.45 MJ kg-1 default value for GE concentration(22). Only one energy concentration value was used for all lactations, and changes in live weight during lactation were not considered. Daily CH 4 emissions were calculated up to d 305 to generate an EF comparable to the 305 d adjusted yield (Y), and also until the total DL to obtain the EF during lactation. Emission intensity per unit produced (EI, CH4 kg-1 milk) was calculated per lactation by adding the CH4 produced in all the herds during all the lactation days and dividing the result by the number of lactating cows on said days. This figure was divided by average milk yield in the lactation period.

Donde: NDT son los nutrimentos digestibles totales, igual al 68 % en la dieta de vacas de alta producción, talla grande y peso promedio de 680 kg y descontando 3 % por reducción en la eficiencia en la digestión en el valor del NDT al alimentar a un nivel tres veces el mantenimiento(21). El valor usado de ED, 12.56 MJ kg-1, es similar al valor por defecto para la concentración de energía de 18.45 MJ kg-1 de EB(22). Para todas las lactancias se usó un valor único para la concentración de energía. Así mismo, no se consideraron los cambios de peso vivo durante la lactancia. Se calculó la emisión de CH4 diaria hasta el día 305 para tener un FE comparable al rendimiento ajustado a 305 d (Y) y también hasta los de DL para obtener el FE durante la lactancia. La intensidad de emisión por unidad producida (IE, CH4 kg-1 de leche) se calculó por lactancia y

299

Daniela Morante López, et al. / Rev Mex Cienc Pecu 2016;7(3):293-308

Cuadro 1. Medias de los parámetros a, b y c de la función gamma incompleta Table 1. Means of parameters a, b and c of the incomplete gamma function Lactation 1 2 3 4 5 6+ SE

14.7a 30.9b 31.5b 24.8ab 30.5b 27.6b 2.9

Milk b

0.236a 0.032b 0.055b 0.132ab 0.116ab 0.089b 0.039

c x 10-4 2.42a 0.39a 1.55a 2.67a 1.56a 2.05a 2.43

7.5a 8.3a 8.1a 7.6a 7.9a 7.7a 3.0

ab Different letters in the same column indicate difference (P<0.05).

50.8a 36.7ab 39.8ab 34.6b 31.0b 39.8ab 3.9

Fat

0.110a 0.021ab 0.040ab 0.002b 0.046b 0.010b 0.024

c x 10-4

10.004a 1.762b 3.395ab 1.361b 2.117b 0.591b 1.9

SE= Standard error.

sumando la cantidad de CH4 producida por todos los hatos durante todos los días de lactancia y dividiendo entre la cantidad de vacas en lactancia en dichos días. El resultado se dividió entre el promedio de kilogramos de leche producido en el periodo de lactancia.

RESULTS AND DISCUSSION

Means of the lactation curve parameters were different between lactation numbers (Table 1). In terms of milk yield, differences were found between primiparous and multiparous cows in the a and b parameters of the incomplete gamma function (P<0.0001), s (P=0.05) and Ymax (P=0.017); no differences were present for c, DL or Y. Lactation persistence (s) was high due to a low rate of decrease in production after Ymax which generated relatively flat curves. In intensive system dairy herds, the a and b parameters differ between the first, second and third lactations(17). These variations are probably better explained through analysis of seasonal variability, herd management conditions or genotype.

RESULTADOS Y DISCUSIÓN

Las medias de los parámetros de las curvas de lactancia indicaron diferencias entre los números de lactancia (Cuadro 1). Para la producción del leche el contraste entre la primíparas y multíparas indicó diferencias en los parámetros a y b de la función gama incompleta (P<0.0001), s (P=0.05) y Ymax (P=0.017), pero no hubo diferencia para c , DL o Y. La persistencia (s) de las lactancias fue alta debido a que la tasa de descenso de la producción después de Ymax fue baja, generando curvas relativamente planas. En hatos lecheros intensivos los parámetros a y b son diferentes entre la primera, segunda y tercer lactancia(17). El análisis de la variabilidad estacional, de las condiciones de manejo de los hatos o genotipo podría explicar mejor la variación en la base de datos.

The number of modeled lactations was highest for L1 and then decreased thereafter (Table 2); this is probably an artifact of the voluntary early culling typical of intensive production dairy herds(15,23). The incomplete gamma function represented most (89.8 %) of the studied lactations, but all the L1 and L2 lactations had good fit (P<0.05). Lack of fit appeared when records were incomplete, or when the number of records increased as lactation number progressed in some herds. In contrast, the models were not significant when the curve

El número de lactancias modeladas fue mayor para L1 y después el número de registros disminuyó (Cuadro 2); esta conformación de la

300

ESTIMACIÓN TIER II DE EMISIÓN DE METANO ENTÉRICO EN HATOS DE VACAS LACTANTES

was flat and the b and c values were near zero (Table 1). The capacity of the incomplete gamma function to represent L1 or L2 agreed with reports for dairy herds in central Mexico in which a good fit was attained using this formula for the first, second and third lactations(17).

base de datos se consideró un reflejo del desecho voluntario temprano característico de los hatos lecheros en producción intensiva(15,23). El 89.8 % de las lactancias examinadas se representó con la función gama incompleta; pero todas las lactancias de L1 y L2 tuvieron buen ajuste (P<0.05). La falta de ajuste se observó cuando los registros de lactancia fueron incompletos o porque disminuyó el número de registros conforme aumentó el número de lactancia en algunos hatos. Por otra parte, los modelos no fueron significativos cuando la curva tuvo una forma plana y los valores de b y c fueron cercanos a cero (Cuadro 1). La capacidad de la función gama incompleta para representar L1 o L2 fue acorde al reporte para hatos lecheros del centro de México, donde se logró un buen ajuste con esta función para primera, segunda y tercer lactancia(17).

The long average DL (365 d) indicates the presence of extended lactations in the analyzed database (Table 2). Use of extended lactations is a management strategy that capitalizing on high lactation persistence and the financially profitable yield towards the end of a lactation; however, it can also be a consequence of reproductive failure(15). Extended and induced lactations are common in Mexican dairy herds, and are maintained by using bovine somatotropin(23). This is important to consider when calculating the annual GHG emissions inventory for a state or country since methane emissions will be greater in the absence of a dry period in any given year.

La DL promedio (365 d), indicó la presencia de lactancias extendidas en la base de datos analizada (Cuadro 2). Las lactancias extendidas es una estrategia de manejo que capitaliza en alta persistencia de la lactancia y producción económicamente rentable hacia el final de la lactancia; no obstante, la lactancia extendida también es consecuencia de la falla reproductiva(15).

Values for 305 d milk yield (Y) were similar between the analyzed lactations despite differences identified between the a and b estimates. Average Y was 9,985 kg in the database modeled with the incomplete gamma

Cuadro 2. Características de la base de datos y medias de producción: Y es el rendimiento a 305 d, Ymax es el rendimiento al pico de lactancia y DL, es la duración de la lactancia Table 2. Herd and mean production data: Y is yield at 305 d; Ymax is yield at lactation peak; and DL is duration of lactation Lactation 1 2 3 4 5 6+ SE

Herds 16 17 16 16 13 14

Records 4622 2939 1200 696 314 194

Y (kg milk) 9437a 10468a 10359a 9881a 11047a 10016a 725

Ymax (kg milk) 34.0a 35.1a 34.8a 35.0a 38.6a 35.4a 2.0

ab Different letters in the same column indicate difference (P<0.05). SE= Standard error.

301

DL (d)

366a 362a 362a 368a 364a 372a 21

Daniela Morante López, et al. / Rev Mex Cienc Pecu 2016;7(3):293-308

En hatos mexicanos, las lactancias extendidas y lactancias inducidas son comunes y se mantienen mediante la administración de somatotropina bovina(23) . Para calcular el inventario de emisiones de GEI anual en el estado o país, la duración de la lactancia es importante, pues la emisión de metano será mayor al no existir periodo seco en un año dado.

function. In terms of the variation coefficient, variation in Y in the database (28 %) was acceptable. However, as part of the uncertainty in the calculations, the standard error values must be included in the input parameters when calculating methane emissions inventories(24). The 95% confidence interval for Y in the present data ranged from 8,550 to 11,419 kg, which differs from the 7,078 L (7,312 kg corrected to 3.5 % fat) reported for Y in intensive diary production systems in Mexico for operations located in the states of Aguascalientes, Hidalgo, Guanajuato, Jalisco, Michoacán, Puebla and Querétaro(25).

El rendimiento de leche a 305 d (Y) fue semejante entre las lactancias examinadas a pesar de las diferencias identificadas para los estimados de a y b. El promedio de Y en la base de datos modelada con la función gamma incompleta fue de 9,985 kg. Aunque la variación de Y en la base de datos fue aceptable en términos del coeficiente de variación (28 %); los valores de error estándar deberán tomarse en cuenta en los parámetros de entrada para calcular inventarios de emisiones de metano como parte de la incertidumbre en el cálculo(24). Así, el intervalo de confianza al 95% para Y fue de 8,550 a 11,419 kg, siendo el resultado de Y diferente a los 7,078 L (7,312 kg corregido a 3.5 % de grasa) reportados para la producción de leche en sistema intensivo en México para empresas de los estados de Aguascalientes, Hidalgo, Guanajuato, Jalisco, Michoacán, Puebla y Querétaro(25).

Using the average DL figure of 365 d, the 95% confidence level was 11,061 to 12,793 kg. These yields are higher than the 6,700 kg milk yield described in the highest emission factors for dairy cattle using the Tier I methodology: in North America, high yield cows fed on grains and high quality forage have EF of 118 kg CH4 cow-1 yr-1(22).

Enteric fermentation EF values differed between primiparous and multiparous cows when the adjustment was made at 305 d (P=0.0025) to 365 d (P=0.0011), although emission intensity remained between 17.6 and 18.6 g CH4 kg milk (Table 3). For primiparous and multiparous cows, methane EF differed depending on the milk and fat production curve modeled for each herd and lactation number (Figure 1). Milk yield was

Considerando 365 d como promedio de DL, el intervalo de confianza al 95% para el

Cuadro 3. Factor de emisión (EF) e intensidad de emisión (EI) de metano entérico por lactancia de acuerdo a su duración ajustada a 365 o 305 días Table 3. Enteric methane emission factors (EF) and intensity (EI) per lactation based on duration adjustment from 365 or 305 days EF Lactation kg CH4 cow-1 Primiparous 201.8a Multiparous 223.7b

Lactation 365 days SE

4.6 11.0

EI g CH4 kg-1 milk 17.9a 18.8a

SE 0.3 1.0

EF kg CH4 cow-1 165.7a 181.6b

ab Different letters in the same column indicate difference (P<0.0025). SE= Standard error.

302

Lactation 305 days SE

3.8 8.3

EI g CH4 kg-1 milk 17.6a 18.6a

SE 0.2 0.9

ESTIMACIÓN TIER II DE EMISIÓN DE METANO ENTÉRICO EN HATOS DE VACAS LACTANTES

rendimiento de leche fue 11,061 a 12,793 kg. Estos rendimientos de leche son superiores a los 6,700 kg descritos para el factor de emisión más alto para el ganado lechero en el Tier I: región Norte América, vacas de alta producción, alimentadas con granos y forraje de alta calidad tienen un factor de emisión de 118 kg metano vaca-1 año-1(22).

the most valuable factor for describing methane emissions in the analyzed database, although its representation was simplified when expressed as emission intensity per production unit.

The present study contributed to characterize the intensive system milk production in Mexico and reducing uncertainty in application of the IPCC Tier II methodology. However, methane conversion factor (Ym), feed digestibility and feed composition values were taken from the literature, following IPCC best practices for inventory generation(11,22). Future research will need to include the wide diversity of management practices and environmental conditions present in any given country. Validation of the enteric CH4 emissions estimates used here could only be by using scaled data for CH4 measurements in individual animals or by disaggregating atmospheric measurements to the farm level by applying gas measurement and turbulent flow systems. Indeed, the Tier II methodology contains greater estimation and systemic errors than do mechanistic models of enteric CH4 emission(20,26). This methodology is intended for reporting regional and country inventories, and does not consider emissions associated with electric energy use, processing,

El factor de emisión por fermentación entérica fue diferente entre primíparas y multíparas cuando se ajustó a 305 d (P=0.0025) y a 365 d (P=0.0011), en tanto la intensidad de emisión se mantuvo entre 17.6 a 18.6 g CH4 kg leche (Cuadro 3). El factor de emisión de metano para primíparas y multíparas resultó diferente por la curva de producción de leche y grasa modelada para cada hato y número de lactancia; la Figura 1 presenta la evolución de la emisión durante la lactancia. El rendimiento de leche fue el aspecto importante para describir la emisión de metano en la base de datos analizada, pero la representación se simplificó cuando se expresa como intensidad de emisión por unidad de producto. El presente estudio contribuyó a caracterizar la producción de leche intensiva en México y Figura 1.

Emission of enteric methane in primiparous (A; n = 16) and multiparous cows (B; n = 76). Lines represent the mean and standard error

kg methane cow-1 d-1

Figure 1.

Emisión entérica de metano para vacas de primera lactancia (A; n = 16) y para vacas multíparas (B; n= 76). Las líneas son la media y su error estándar

Days

303

Daniela Morante López, et al. / Rev Mex Cienc Pecu 2016;7(3):293-308

fuels, etc. Grain import and transport of liquid milk are important aspects of the dairy market structure in Mexico. When applied in the future, the IPCC methodologies will need to be paired with direct measurements, comparisons with mechanistic models and calculation of lifecycle emissions for production systems.

reducir la incertidumbre en la aplicación de la metodología Tier II del IPCC. Sin embargo, para el factor de conversión de metano (Ym), la digestibilidad y composición del alimento fue necesario recurrir a valores reportados en la literatura y de acuerdo a las buenas prácticas del IPCC para la generación de inventarios(11,22). La diversidad en prácticas de manejo y condiciones ambientales deben representarse en la variabilidad de esos factores en futuros estudios. La validación de los estimados de emisión de CH4 entérico obtenidos aquí sólo es posible contando con datos escalados de mediciones de la emisión de CH4 en animales individuales o mediante la desagregación de mediciones atmosféricas a nivel de granja, usando sistemas de medición de gases y flujo turbulento. Más aún, la metodología Tier II del IPCC presenta mayores errores de estimación y sistemáticos en relación a modelos mecanísticos de emisión de CH4 entérico(20,26). La metodología del IPCC está orientada a reportar inventarios de regiones y países y no considera las emisiones asociadas por consumo de energía eléctrica, procesamiento, combustibles, etc. Para la estructura de mercado en México la importación de granos y la movilización de leche líquida son aspectos de importancia. De manera paralela a la aplicación de metodologías del IPCC, los esfuerzos futuros tendrán que generar mediciones directas, comparar modelos mecanísticos y calcular emisiones en los ciclos de vida para los sistemas de producción.

The emission factors and intensities reported in the literature need to be compared considering environmental conditions, productive systems, livestock management practices, the methane production estimation model used, available databases and study depth, among other factors. The present emission intensity results (17.6 to 18.6 g CH4 kg milk) were within previously reported ranges for high yield cows: 25 g CH4 L-1 milk (enteric fermentation and manure) for the dairy cow population in Mexico(9); 15.4 to 17.6 g CH4 kg-1 milk (enteric fermentation) in response to changes in the proportions of grazing to corn silage in the Netherlands(26); and 18.0 to 19.1 CH4 g kg-1 in experiments using different proportions of alfalfa and corn silage(27). The present EF per head results (201 to 223 kg CH4 cow-1 in 365 d) were higher than the average reported in some national inventories: 120.76 kg in the USA (28) ; 113 kg in the Netherlands (29) ; and 128.8 to 139 kg in Germany(19). This discrepancy is probably due to the fact that the AHM database does not include all the cows in a herd, since it focuses on high-yield dairy cows and longer lactations (365 vs 305 d). Emission of GHG increases as animal yield rises, but emissions per kilogram of milk corrected for fat content decreases notably as production increases(12). In addition, Tier II uses a fixed Ym, which can result in a 12.5 % overestimation in dairy cattle, negatively affecting its accuracy(19,20). Country-level solutions are needed in enteric methane inventories to derive feed composition and properties as a function of animal performance and thus generate more accurate calculations(19).

Los factores de emisión e intensidades de emisión reportados en la literatura deben contrastarse considerando las condiciones ambientales, sistemas productivos, manejo del ganado, tipo de modelo usado para estimar la producción de metano, bases de datos disponibles y nivel de profundidad del estudio, entre otros. Así, los resultados de intensidad de emisión (17.6 a 18.6 g CH4 kg leche) se encontraron en la misma escala de magnitud que los reportados para vacas de alto rendimiento: 25 g CH4 L-1 leche (fermentación entérica y excretas) para el hato lechero

304

ESTIMACIÓN TIER II DE EMISIÓN DE METANO ENTÉRICO EN HATOS DE VACAS LACTANTES

Enteric methane emission estimates for cattle using emission factors specific to Mexico have been done. In these studies, enteric emissions are represented as a function of energy intake in the feed and typical body mass of cattle classified by age and climatic region, but milk production levels are not considered(10). One national inventory applied a modified Tier I methodology using a 305 d lactation, a 60 d dry period, a 4,400 kg average yield per lactation in a typical 400 kg cow; and a lactation curve model(30). However, this lactation model was obtained from data fitted for yield from 100 Friesian cows in the third lactation from Reading, UK(31,32). Another national inventory used milk yield from FAO reports (2,800 to 4,541 kg milk cow-1 yr-1), milk composition and feed rations taken from previous studies, and assumed that all dairy cows were confined(9).

mexicano(9); entre 15.4 y 17.6 g CH4 kg-1 leche (fermentación entérica) en función de los cambios en la proporción de pastura en pastoreo respecto del ensilaje de maíz en Holanda(26); entre 18.0 y 19.1 CH4 g kg-1 en experimentos con proporción de ensilado de alfalfa y maíz(27).

El factor de emisión por cabeza (201 a 223 kg CH4 vaca-1 en 365 d) fue mayor al promedio reportado en inventarios nacionales: 120.76 kg en EE.UU.(28), 113 kg en Holanda(29), 128.8 a 139 kg en Alemania(19). Esto se explicó porque la base de datos de la AHM no considera a todas las vacas de cada hato y representó a vacas de alto rendimiento de leche diario, y también con lactancias más largas 365 vs 305 d. La emisión de gases con efecto invernadero aumenta conforme mayor es el rendimiento animal, pero las emisiones por kilo de leche corregida por grasa declinan sustancialmente conforme la productividad aumenta(12). Además el Tier II indica un valor fijo de Ym, que puede resultar en una sobre estimación de 12.5 % para el ganado lechero y ser inadecuado(19,20). Para los esfuerzos de inventarios de metano entérico se necesitan soluciones nacionales para derivar la composición y propiedades del alimento en función del desempeño animal y generar cálculos más precisos(19).

The historical contribution of methane emissions is significant, but simplifications need to be made in the model so that available databases can be used; for example, averaging the dairy and nondairy cattle emission factors to then multiply it by the cattle population of each country(8). Published studies expose the limitations in the availability and quality of cattle activity and population data, highlighting the need for further research in an effort to adequately quantify how much of GHG emissions originate in the livestock sector(3,4,5). Another challenge is difficulty in data analysis caused by inconsistency among the units used to report GHG emission figures, particularly when SI ( Sistème international d’unités) units are not employed. For instance, in one study the units Gg (109 g) and Mt (an abbreviation interpreted as megaton – equivalent to 1012 g, or as metric ton equivalent to 106 g) are used interchangeably and produce the same methane emission result for dairy cattle in Mexico(9). In another example, worldwide methane concentration from enteric fermentation from 1890-1998 was calculated as 1,183,095 Gg CH4(8), but the same authors later published the figure of 8 million Gg Ceq(33) for the same concept. These two figures are not comparable using acceptable values for

En la literatura se reportan varias estimaciones de la emisión de metano entérico por el ganado aplicando factores de emisión específicos para México. La emisión entérica se representó en función del consumo de energía en el alimento, y éste a su vez, en función de la masa corporal típica de bovinos clasificados por edad y región climática, pero no se consideró el nivel de producción de leche(10). Una modificación al Tier I para el inventario de México tomó en cuenta un ciclo productivo de 305 d en lactancia y 60 d de periodo seco, una producción promedio de 4,400 kg por lactancia de una vaca típica de 400 kg y un modelo de la curva de lactancia(30); sin embargo, el modelo de lactancia seleccionado correspondió al ajuste de

305

Daniela Morante López, et al. / Rev Mex Cienc Pecu 2016;7(3):293-308

conversion of methane into carbon dioxide equivalents(2). Finally, before any attempt at scaling is made to calculate GHG inventories, comparisons will be needed between the emission factors or intensities of different animal classes and productive models.

datos de rendimiento de 100 vacas Friesian en su tercera lactancia en Reading, Inglaterra(31,32). Otro inventario nacional consideró la producción de leche de acuerdo a informes de la FAO (2,800 a 4,541 kg de leche vaca-1 año-1); a partir de reportes de experimentos, se obtuvieron datos sobre composición de la leche y las raciones ofrecidas; también se asumió que todas las vacas lecheras se encontraban en estabulación(9).

CONCLUSIONS AND IMPLICATIONS

Analysis with the incomplete gamma formula and lactation curves showed high-yield dairy cows in Querétaro state to differ between primiparous and multiparous individuals for the studied variables. Average lactation was oneyear (365 d) long. Enteric methane emission during lactation differed between primiparous and multiparous cows, whether at 365 d or adjusted to 305 d. However, lactation number or duration had no effect on average enteric methane emission intensity per kilogram of milk produced. The uncertainty present in enteric methane emissions inventories can be reduced by incorporating data for milk yield, lactation duration, and herd composition in terms of primiparous and multiparous cows. Milk yield can be represented using the incomplete gamma formula. However, an acceptable simplification would be to multiply average daily milk yield by the number of lactation days. This was shown to be viable in the present study in which relatively flat, highly precise curves were identified for high-yield cows. If enteric methane emission on a dairy farm is assumed to be 75 % of its GHG emissions, and the emission factors are accounted for, then a dairy producer managing more than 2,500 cows would surpass the 25,000 Gg Ceq threshold established in the Rules of the General Climate Change Law for the National Register of Emissions for the Republic of Mexico (Reglamento de la Ley General de Cambio Climático en Materia del Registro Nacional de Emisiones para la República Mexicana – RENE), and the farm would be forced to report its emissions beginning in 2018. In response to applicable laws (e.g. NMX-SAA14064/1-IMNC-2007, NMX-SAA-14064/2-IMNC2007, among others), the Mexican Certification

La contribución histórica de las emisiones de metano es un asunto importante, pero es necesario hacer simplificaciones en el modelo para poder usar las bases de datos disponibles, por ejemplo promediar el factor de emisión del ganado lechero y no lechero para multiplicarse por la población de bovinos de cada país(8). En los estudios citados se manifiestan limitantes en disponibilidad y calidad de los datos de actividad y población, por eso se necesita investigación para dimensionar adecuadamente la responsabilidad del sector pecuario en la emisión de GEI(3,4,5). Otro problema es la incoherencia en las unidades usadas para reportar las cifras de emisión de GEI, sobre todo cuando no son unidades del sistema internacional de medidas; ocasionando dificultad en interpretación de la información. En otro trabajo, las unidades Gg (109 g) y Mt (la abreviatura puede interpretarse como mega tonelada equivalente a 1012 g, o tonelada métrica equivalente a 10 6 g) se utilizan indistintamente, con el mismo resultado sobre la emisión de metano del ganado lechero de México(9). La concentración de metano por fermentación entérica mundial durante 18901998 se calculó en 1’183,095 Gg CH4(8), pero después publican los mismos autores el mismo dato como 8 millones Gg Ceq(33); las cifras no son comparables usando los valores aceptables para conversión de metano en bióxido de carbono equivalente(2). Antes de efectuar el escalamiento para calcular inventarios de GEI es necesario contrastar los factores de emisión o la intensidad de emisión de las clases animales y modelos productivos. 306

ESTIMACIÓN TIER II DE EMISIÓN DE METANO ENTÉRICO EN HATOS DE VACAS LACTANTES

Organization (Entidad Mexicana de Acreditación) maintains current lists of the organizations that implement GHG emissions verification and validation to meet RENE stipulations.

CONCLUSIONES E IMPLICACIONES

Las vacas de alto rendimiento en Querétaro se representaron con la función gama incompleta y las curvas de lactancia fueron distintas para primíparas y multíparas. La lactancia tuvo una duración promedio de un año. La emisión de metano entérico durante la lactancia fue diferente entre vacas primíparas y multíparas, ya fuera hasta los 365 d o ajustada a 305 d. Sin embargo, el número de lactancia o duración de la lactancia no afectó la intensidad de emisión de metano entérico promedio por kilogramo de leche producida. Los inventarios de emisiones de metano entérico pueden disminuir su incertidumbre, al incorporar datos de rendimiento de leche, duración de la lactancia y composición del hato de acuerdo a primíparas y multíparas. El rendimiento de leche puede representarse con la función gama incompleta; sin embargo, una simplificación aceptable sería usar el promedio de producción diaria multiplicado por los días en leche, debido a que en el presente estudio se encontraron curvas relativamente planas y con alta persistencia para vacas de alto rendimiento de leche. Considerando que una emisión de metano entérico es de 75 % del total de GEI en una granja y los factores de emisión, entonces una empresa lechera mayor a 2,500 vacas posiblemente deba reportar a partir del 2018 obligatoriamente sus emisiones al rebasar el umbral de 25,000 Gg Ceq establecido en el Reglamento de la Ley General de Cambio Climático en Materia del Registro Nacional de Emisiones para la República Mexicana (RENE). La Entidad Mexicana de Acreditación mantiene listados vigentes de los organismos para verificación o validación de emisiones GEI para el RENE según la norma NMX-SAA-14064/1-IMNC-2007, NMX-SAA-14064/ 2-IMNC-2007, entre otras.

ACKNOWLEDGEMENTS

The research reported here was financed by the CONACYT-SEMARNAT 10873 fund, INEGobierno del Estado de Querétaro Anexo 34 2010, INECC Convenio INE/PS-051/20. Thanks to the Asociación Holstein de México for access to and use of their database. End of english version

Convenio INE/PS-051/20. Gracias a la Asociación Holstein de México por las facilidades y el uso de la base de datos.

LITERATURA CITADA 1.

2. 3. 4.

5. 6.

AGRADECIMIENTOS

Este trabajo fue financiado por el fondo CONACYT-SEMARNAT 10873, INE-Gobierno del Estado de Querétaro Anexo 34 2010, INECC

307

INECC. Instituto Nacional de Ecología y Cambio Climático. México quinta comunicación nacional ante la convención marco de las Naciones Unidas sobre el cambio climático. México, DF, México: Secretaría de Medio Ambiente y Recursos Naturales e Instituto Nacional de Ecología y Cambio Climático. 2012. Shindell TD, Faluvegi G, Koch MD, Schmidt AG, Unger N, Bauer ES. Improved attribution of climate forcing to emissions. Science 2009;326(5953):716-718. FAO. Food and Agriculture Organization of the United Nations. Livestock’s long shadow. Rome, Italy: Food and Agriculture Organization of the United Nations; 2006.

Glatzle A. Questioning key conclusions of FAO publications ‘Livestock’s long shadow’ (2006) appearing again in ‘Tackling climate change through livestock’ (2013). Pastor Res Policy Pract 2014;4(1):1-6. Reddy PP. Climate resilient agriculture for ensuring food security. New Delhi, India: Springer; 2015.

INE. Instituto Nacional de Ecología. México cuarta comunicación nacional ante la convención marco de las Naciones Unidas sobre el cambio climático. México, DF, México: Secretaría de Medio Ambiente y Recursos Naturales e Instituto Nacional de Ecología. 2009.

Hagemann M, Hemme T, Ddambi A, Alqaisi O, Sultana MN. Benchmarking of greenhouse gas emissions of bovine milk

Daniela Morante López, et al. / Rev Mex Cienc Pecu 2016;7(3):293-308

production systems for 38 countries. Anim Feed Sci Technol 2011;(166-167):46-58.

number, year, and season of initiation of lactation on milk yield of cows hormonally induced into lactation and treated with recombinant bovine somatotropin. J Dairy Sci 2011;94(9):4524-4530.

Muylaert de Araujo MS, Pires de Campos C, Pinguelli RL. Historical emissions, by country, of N2O from animal manure management and of CH4 from enteric fermentation in domestic livestock. Clim Res 2007;34(3):253-258.

24. Gentner DR, Ford TB, Guha A, Boulanger K, Brioude J, Angevine WM, et al. Emissions of organic carbon and methane from petroleum and dairy operations in California’s San Joaquin Valley. Atmos Chem Phys 2014;14(10):49554978.

Rendón-Huerta JA, Pinos-Rodríguez JM, García López JC, Yáñez-Estrada LG, Kebreab E. Trends in greenhouse gas emissions from dairy cattle in Mexico between 1970 and 2010. Anim Prod Sci 2013;54(3):292-298.

25. Mariscal VA, Estrella HQ, Ruiz AF, Sagarnaga MV, Salas JMG, González MA, Juárez AZ. La cadena productiva de bovinos lecheros y el TLCAN. En: Avila DJA, et al. editores. Presente y futuro de los sectores ganadero, forestal y de la pesca mexicanos en el contexto del TLCAN. México DF, México: El Colegio de México, Centro de Estudios Económicos Universidad Autónoma Chapingo. 2008.

10. Ruiz-Suárez LG, González-Avalos E. Modeling methane emissions from cattle in Mexico. Sci Total Environ 1997;206(2-3):177-186.

11. IPCC. Intergovernmental Panel on Climate Change. 2006 IPCC Guidelines for national greenhouse gas inventories. Hayama, Japan: Institute for Global Environmental Strategies. 2006.

26. Bannink A, van Schijndel MW, Dijkstra J. A model of enteric fermentation in dairy cows to estimate methane emission for the Dutch National Inventory Report using the IPCC Tier 3 approach. Anim Feed Sci Technol 2011;(166-167):603618.

12. Gerber P, Vellinga T, Opio C, Steinfeld H. Productivity gains and greenhouse gas emissions intensity in dairy systems. Livestock Sci 2011;139(1-2):100-108.

13. Knapp JR, Laur GL, Vadas PA, Weiss WP, Tricarico JM. Enteric methane in dairy cattle production: Quantifying the opportunities and impact of reducing emissions. J Dairy Sci 2014;97(6):3231-3261.

27. Arndt C, Powell JM, Aguerre MJ, Wattiaux MA. Performance, digestion, nitrogen balance, and emission of manure ammonia, enteric methane, and carbon dioxide in lactating cows fed diets with varying alfalfa silage-to-corn silage ratios. J Dairy Sci 2015;98(1):418-430.

14. Cole JB, Null DJ, VanRaden PM. Best prediction of yields for long lactations. J Dairy Sci 2009;92(4):1796-1810.

28. EPA. United States Environmental Protection Agency. Inventory of U.S. greenhouse gas emissions and sinks: 19902012. Common reporting format (CRF) tables. USA-20142012-v1.1.xls. Table 4.A Sectorial background data for agriculture: enteric fermentation. Washington DC, USA: United States Environmental Protection Agency. 2014.

15. Dematawea CMB, Pearson RE, VanRaden PM. Modeling extended lactations of Holsteins. J Dairy Sci 2007;90(8):3924-3936. 16. Wood PDP. Algebraic model of the lactation curve in cattle. Nature 1967;216(5111):164-165.

29. Smink W, Pellikaan WF, van der Kolk LJ, van der Hoek KW. Methane production as a result from rumen fermentation in cattle calculated by using the IPCC-GPG Tier 2 method. Feed Innovation Services Report FS 04 12 E, Utrecht, The Netherlands: National Institute for Public Health and the Environment. 2004.

17. Val-Arreola D, Kebreab E, Dijkstra J, France J. Study of the lactation curve in dairy cattle on farms in central Mexico. J Dairy Sci 2004;87(11):3789-3799.

18. Rafter AJ, Abell LM, Braselton PJ. Multiple comparison methods for means. SIAM Rev 2002;44(2):259-278.

19. Dämmgen U, Rösemann C, Haenel HD, Hutchings NJ. Enteric methane emissions from German dairy cows. Landbauforschung - vTI Agric For Res 2012;62(1-2):21-32.

30. Castelán-Ortega OA. Modeling methane emissions and methane inventories for cattle production systems in Mexico. Atmósfera 2014;27(2):185-191.

20. Kebreab E, Johnson KA, Archibeque SL, Pape D, Wirth T. Model for estimating enteric methane emissions from United States dairy and feedlot cattle. J Anim Sci 2008;86(10):2738–2748.

31. Morant SV, Gnanasakthy A. A new approach to the mathematical formulation of lactation curves. Anim Prod 1989;49(2):151-162.

32. Ducker MJ, Haggett RA, Fisher WJ, Morant SV, Bloomeld GA. Nutrition and reproductive performance of dairy cattle 1. The effect of level of feeding in late pregnancy and around the time of insemination on the reproductive performance of first lactation dairy heifers. Anim Prod 1985;41(1):1-12.

21. NRC. National Research Council. Nutrient Requirements of Dairy Cattle. 7th ed. Washington, DC, USA: National Academy of Sciences; 2001.

22. IPCC. Intergovernmental Panel on Climate Change. Good practice guidance and uncertainty management in national greenhouse gas inventories. Chapter 4: Agriculture. Hayama, Japan: Institute for Global Environmental Strategies. 2000.

33. Muylaert de Araujo MS, Pires de Campos C, Pinguelli LR. GHG historical contribution by sectors, sustainable development and equity. Ren Sust Energy Rev 2007;11(5):988-997.

23. Mellado M, Antonio-Chirino E, Meza-Herrera C, Veliz FG, Arévalo JR, Mellado J, de Santiago A. Effect of lactation

308

INFLUENCIA DE TANINOS SOBRE CARACTERÍSTICAS FÍSICAS Y SENSORIALES Rev Mex DECienc LA CARNE Pecu 2016;7(3):309-320 DE BOVINOS

Influencia de taninos sobre características físicas y sensoriales de carne de bovinos en engorda Influence of tannins on the physical and sensory attributes of meat from feedlot cattle Briceida Ortiz-Lópeza, María Antonia Mariezcurrena-Berasaína, Rubén Barajas-Cruzb, Patricia López-Pereaa, Héctor Bernardo Escalona-Buendíac José Luis Borquez-Gasteluma, María Dolores Mariezcurrena-Berasaína

RESUMEN Para evaluar la adición de 0.3 % extracto de taninos en las características físicas y sensoriales de la carne de bovinos engordados de forma intensiva, se utilizaron muestras del músculo Longissimus dorsi de 16 toretes (Bos taurus x Bos indicus), los cuales durante los últimos 70 días de la engorda recibieron dieta de finalización (13.3% PC y 2.0 Mcal ENm/kg de MS), y en grupos de ocho se asignaron al azar para recibir uno de dos tratamientos: 1) dieta de finalización (testigo); 2) testigo más 0.3% (base seca) de extracto de taninos (ET). El extracto de taninos fue de Bypro® (SilvaFeed, Indunor, S.A., Argentina) que contiene 70 % de taninos. Los toretes se sacrificaron en la planta TIF No. 99. A las 24 h posteriores al sacrificio se tomaron cuatro muestras (2.5 cm de grosor) a la altura de la 12 a y 13 a costilla de la media canal izquierda. Se evaluaron las características físicas y el perfil sensorial, así como la percepción y aceptación de la carne por consumidores. Los taninos no influyeron en las características físicas de la carne (P>0.05). El perfil sensorial no fue influenciado por tratamientos (P>0.05). La percepción y preferencia del producto respecto a jugosidad y terneza fue similar para ambos tratamientos. Los consumidores mostraron preferencia por el nivel “Gusta moderadamente”, para testigo y tratamiento. Se concluye que la adición de 0.3 % de extracto de taninos en la dieta de bovinos en engorda intensiva, no afecta las características físicas y sensoriales de la carne. PALABRAS CLAVE: Taninos, Carne de bovino, Características físicas, Perfil sensorial.

ABSTRACT The aim was to evaluate the addition of 0.3 % of tannins extract on physical and sensory characteristics of meat from cattle fattened intensively. Samples of Longissimus dorsi muscle from 16 bulls (Bos Taurus x Bos indicus), that for the last 70 d of fattening received a finishing diet (13.3 % CP and 2.0 Mcal NEm/kg DM), in groups of eight were randomized assigned to receive one of two treatments: 1) Finishing diet (CTRL); and 2) CTRL plus 0.3 % (DM basis) of tannins extract (TE). The tannins extract was from Bypro® (Silvafeed, Indunor, S.A., Argentina) containing 70 % of tannins. The bulls were slaughtered in a TIF plant No. 99. At 24 h post-slaughter four samples (2.5 cm thick) were taken at the level of the 12th and 13th rib of the left middle carcass. Physical characteristics and sensory profile, as well as, the perception and acceptance of the meat by consumers were evaluated. Tannins did not influence the physical characteristics of the meat (P>0.05). The sensory profile was not influenced by treatments (P>0.05). The perception and preference regarding juiciness and tenderness was similar for both treatments. Consumers showed a preference for the level “Like moderately”. It is concluded that the addition of 0.3 % of tannins extracts in the diet of cattle fattened intensively, did not modify the physical and sensory characteristics of meat. KEY WORDS: Tannins, Beef, Physical characteristics, Sensory profile.

Recibido el 2 de marzo de 2015. Aceptado el 23 de abril de 2015. a

Universidad Autónoma del Estado de México, Toluca, Estado de México, México. nekkane16@hotmail.com. Correspondencia al último autor.

FMVZ-Universidad Autónoma de Sinaloa. Culiacán, Sinaloa, México.

Universidad Autónoma Metropolitana. México.

309

Briceida Ortiz-López, et al. / Rev Mex Cienc Pecu 2016;7(3):309-320

INTRODUCCIÓN

INTRODUCTION

La calidad de un alimento está determinada por diversos aspectos como cantidad y calidad de nutrientes y la seguridad sanitaria, entre otros; sin embargo, lo que determina la aceptación o rechazo del mismo está relacionado con la percepción del consumidor, es decir, aspectos ligados a la preferencia del color, sabor, textura, consistencia, presentación y otros aspectos del producto(1). En la evaluación de calidad de carne los parámetros más considerados son: apariencia, jugosidad, terneza y sabor (2). La textura, lleva consigo dos componentes principales: terneza y jugosidad, que explican el 64.0 y el 19.0 % respectivamente, de las diferencias entre la apetencia de las muestras(3); la evaluación de la terneza define la aceptación de la carne por parte del consumidor(4,5).

The food quality is determined by various aspects such as amount and quality of nutrients and health security, among others. However, what also determines the acceptance or rejection of a food is related to the perception of the consumer, i.e., aspects linked to the preference of the color, taste, texture, consistency, presentation and other aspects of the product(1). In the evaluation of meat quality parameters most considered are: appearance, juiciness, tenderness and flavor(2). Texture, has two main components: tenderness and juiciness, explaining the 64.0 and the 19.0 % respectively, of the differences among the appetence of samples(3); the evaluation of tenderness defined acceptance of meat by consumers(4,5). Other factors directly influencing the tenderness and juiciness of meat are: the content of intramuscular fat(6,7); the density of the muscle fiber; number, type and arrangement of connective tissue (related to genetics, sex, weight and age to slaughter, feeding, use of additives, animal stress, work, management of cold chain conditions) and type of cut associated with the involved muscle(3,8).

Otros factores que influyen directamente en la terneza y jugosidad de la carne son el contenido de grasa intramuscular(6,7); la densidad de fibra del musculo; cantidad, tipo y disposición del tejido conectivo (relacionado con la genética, sexo, peso y edad al sacrificio, alimentación, uso de aditivos, estrés animal, condiciones de faena, manejo de cadena fría) y tipo de corte asociado al músculo involucrado(3,8).

Secondary metabolites of plants such as tannins (condensed and hydrolysable), are used extensively for its potential to modulate the rumen fermentation and increase nutrients utilization in ruminants(9). These compounds added in low concentrations in the diet can produce beneficial effects, since they bind to proteins and protect them from immediate degradation, regulating the release rate of nitrogen in the rumen(10,11), increasing the flow of essential amino acids to the small intestine(11), which is attributed to a better productive performance of the animal(12,13). However, the reports in the literature of the path of absorption or elimination of the tannins are not very clear and therefore it is unknown if there is tissue buildup, or if they cause any changes in the muscle structure that affect the sensory characteristics of the meat. Therefore, the objective of the present study was to

Los metabolitos secundarios de las plantas como los taninos (condensados e hidrolizables), son utilizados de manera extensa por su potencial para modular la fermentación ruminal e incrementar la utilización de nutrientes en rumiantes(9); estos compuestos añadidos en bajas concentraciones en la dieta pueden generar efectos benéficos, ya que se unen a las proteínas y las protegen de una inmediata degradación, regulando la velocidad de liberación de nitrógeno en el rumen(10,11) incrementando el flujo de aminoácidos esenciales hacia el intestino delgado(11), a lo que se atribuye un mejor desempeño productivo del animal(12,13). Sin embargo, los reportes en la literatura de la vía de absorción o eliminación de los taninos no son muy claros y por tanto se desconoce si hay acumulación en tejido, o si provocan algún 310

INFLUENCIA DE TANINOS SOBRE CARACTERÍSTICAS FÍSICAS Y SENSORIALES DE LA CARNE DE BOVINOS

cambio en la estructura muscular que llegue a afectar las características sensoriales de la carne. Por lo anterior el objetivo del presente trabajo fue evaluar la adición de 0.3 % de extracto de taninos sobre las características físicas y atributos sensoriales en la carne de bovinos engordados de forma intensiva.

evaluate the addition of 0.3 % tannins extract on the physical properties and sensory attributes in the meat of feedlot cattle. MATERIAL AND METHODS Samples Samples of Longissimus dorsi muscle from 16 steers fattened intensively in the Experimental unit for cattle of the Facultad de Medicina Veterinaria y Zootecnia of the Universidad Autónoma de Sinaloa, with a gene load of approximately 75.0 % Brahman and remainder of Simmental, Brown Swiss, Charolais and Angus in variable proportion, with an average body weight of 422 ± 6.7 kg. The bulls were subjected to production management for a finishing phase, which consisted of subcutaneous application at the base of the ear, of a second trenbolone acetate implant and 17- estradiol (Component TES with Tylan; ELANCO®). During the last 30 d, all animals received in addition, 0.15 mg/kg of zilpaterol hydrochloride; (Zilmax; Lab Intervet - MSD®), same that was suspended 3 d before slaughter. The cattle were assigned randomly to groups of eight animals and were housed in pens to receive one of two treatments: 1) Finishing diet (13.3 % crude protein and 2.0 Mcal ENm/kg dry matter) the last 70 d of fattening (Control); 2) Control diet plus 0.3 % of tannins extract (ET). Tannin extract was of condensed tannins from quebracho (Shinopsis ssp) containing 700 g/kg DM (Bypro® SilvaFeed, Indunor, SA; Buenos Aires, Argentina).

MATERIAL Y MÉTODOS Obtención de muestras Se utilizaron muestras del músculo Longissimus dorsi de 16 toretes, engordados de forma intensiva en la Unidad Experimental para Bovinos de la Facultad de Medicina Veterinaria y Zootecnia de la Universidad Autónoma de Sinaloa, con una carga génica aproximada de 75.0 % Brahman y el resto de razas Simmental, Pardo Suizo, Charolais y Angus en proporción variable, con peso corporal promedio de 422 ± 6.7 kg. Los toretes se sometieron al manejo productivo para fase de finalización, que consistió en la aplicación vía subcutánea en la base de la oreja, de un segundo implante a base de acetato de trembolona y 17- estradiol (Component TES con Tylan; ELANCO®). Durante los últimos 30 días todos los animales además, recibieron 0.15 mg/kg de clorhidrato de zilpaterol (Zilmax; Lab Intervet – MSD®), mismo que se suspendió tres días antes del faenado. Los bovinos se asignaron de forma aleatoria a grupos de ocho animales y se alojaron en corrales para recibir uno de dos tratamientos: 1) dieta de finalización (13.3 % PC y 2.0 Mcal ENm/kg de MS) durante los últimos 70 días de la engorda (testigo); 2) dieta testigo más 0.3 % de extracto de taninos (ET). El extracto fue de taninos condensados de quebracho (Shinopsis ssp) que contiene 700 g/kg MS (Bypro® SilvaFeed, Indunor, S.A.; Buenos Aires, Argentina).

Slaughter was done at the abattoir TIF No. 99. The carcasses were placed in a cold room at 4 oC, and 24 h later held a cross section in the left side of the carcass between the 12th and 13th rib. In the area of the rib eye pH was measured in triplicate with a potentiometer (HI99163 membrane pH - meter, Hanna Instruments, USA), equipped with penetration electrode. Consecutively four 2.5 cm thick samples of the Longissimus dorsi muscle were taken; a portion of 2 cm2, placed in airtight bag previously identified and immediately water

Los bovinos se faenaron en la planta TIF No. 99. Las canales se colocaron en un cuarto frío a 4 oC, y 24 h después se realizó un corte transversal en el lado izquierdo de la canal entre la 12.a y 13.a costilla; en el área del ojo de chuleta se midió por triplicado el pH con un 311

Briceida Ortiz-López, et al. / Rev Mex Cienc Pecu 2016;7(3):309-320

potenciómetro (HI99163 membrane pH-meter, Hanna Instruments, EUA), equipado con electrodo de penetración. Consecutivamente se tomaron cuatro muestras del músculo Longissimus dorsi de 2.5 cm de espesor; de una muestra se tomó una porción de 2 cm2, se colocó en bolsa de cierre hermético previamente identificada y se midió de manera inmediata la capacidad de retención de agua; el resto de las muestras se empacaron al vacío y se colocaron en congelador a -20 oC hasta su uso en las determinaciones físicas y sensoriales.

retention capacity (WRC) was measured; the rest of the samples were vacuum packaged and frozen at -20 oC until be used for sensory and physical determinations. Measurement of physical properties The released fluid by applying external pressure, determined the WRC, weighting 0.3 ± 0.05 g of meat, standing inside a paper filter, between two glass plates, and subjected to compression with a weight of 2,250 kg for 5 min. The WRC was calculated by difference of initial weight and final weight, considering the percentage of juice released(14). Prior to the sensory and physical determinations, meat was thawed under refrigeration at 4 oC for 24 h. The samples were prepared according to the protocol of “Research Guidelines for Cookery, Sensory Evaluation and Instrumental Tenderness Measurements of Fresh Meat”(15); these were devoid of bone and weighted before cooking in an electric double grill (Mod. GRP4P-ar George Foreman® Grill, Miramar, FL, USA). It was used a thermocouple (Hanna Instrument®), to monitor the temperature at 70 ± 2 °C, this was inserted in the geometric center of the sample. Once cooked, it was left to cool for a period of 30 min, weighted to calculate loss by cooking, expressed as a percentage of weight loss with respect to the weight of the raw sample(14). After weighting, from each meat sample 10 cylinders of 1.6 cm in diameter, were obtained by inserting a punch parallel to the direction of the muscle fibers; to determine the shear force(16), each cylinder was placed perpendicular to the Warner-Bratzler blade equipment (Mod. KS 66502 Salter®, Manhattan, USA). The results of the physical characteristics of the meat, were analyzed through variance for a completely random design accepting differences with a level of probability <0.05(17), through the use of the computer package Statistix®, version 9.0(18).

Medición de características físicas Para determinar la capacidad de retención de agua (CRA), se consideró el fluido liberado al aplicar presiones externas. Se pesaron 0.3 ± 0.05 g de carne, colocándose dentro de un papel filtro, entre dos placas de vidrio, y se sometió a compresión con una pesa de 2.250 kg durante 5 min. La CRA se calculó por diferencia del peso inicial y el peso final, considerando el porcentaje de jugo liberado(14). Previo a las determinaciones físicas y sensoriales, la carne se descongeló en refrigeración a 4 oC por 24 h. Las muestras de carne se prepararon de acuerdo al protocolo de “Research guidelanes for cookery, sensory evaluation and instrumental tenderness measurements of fresh meat”(15); éstas fueron desprovistas de hueso y pesadas antes del cocinado en parrilla eléctrica doble (Mod. GRP4P-AR George Foreman ® Grill, Miramar, FL, EUA). Se usó un termopar (Hanna Instrument ® , EUA), para monitorear la temperatura a 70 ± 2 °C, éste se insertó en el centro geométrico de la muestra, la cual una vez cocinada se dejó enfriar por un periodo de 30 min, se pesó para calcular pérdida por cocción, expresándose como porcentaje de la pérdida de peso respecto al peso de la muestra cruda(14). Posterior al pesaje, de cada muestra de carne se extrajeron 10 cilindros de 1.6 cm de diámetro, los cuales se obtuvieron insertando un sacabocados de forma paralela a la dirección de las fibras musculares; para determinar la

Sensory profiles measurements Two complementary experiments were carried out. Samples were prepared following the protocol described for shear force evaluation. 312

INFLUENCIA DE TANINOS SOBRE CARACTERÍSTICAS FÍSICAS Y SENSORIALES DE LA CARNE DE BOVINOS

fuerza de corte(16), cada cilindro se colocó de forma perpendicular a la cuchilla Warner-Bratzler de un equipo Mod. KS 66502 Salter®, Manhattan, EUA. Los resultados obtenidos de las características físicas de la carne, se analizaron por medio de varianza para un diseño completamente al azar aceptando diferencias estadísticas con un nivel de probabilidad <0.05 (17) , mediante el uso del paquete computacional Statistix® (2007), versión 9.0(18).

After cooking the meat samples were cut into 1 cm3 pieces, were placed in No. 0 plastic cups, previously labeled with three random number key. To avoid drying out before being offered to the panelists, samples were kept in a container sealed to 40 °C. In all sensory tests panelist were offered water and crackers and asked they to eat a portion before and between samples with the aim of removing the flavors of the mouth(19).

Medición de atributos sensoriales

Experiment 1

Se realizaron dos experimentos complementarios. Para la preparación de las muestras se siguió el protocolo descrito en evaluación de fuerza de corte. Posterior al cocinado, las muestras de carne se cortaron en trozos de 1 cm3, se colocaron en vasos de plástico No. 0, previamente rotulados con clave de tres números aleatorios; para evitar la desecación antes de ser ofrecidas a los panelistas se ubicaron en un recipiente sellado a 40 °C.

It describes the sensory properties of the meat, and measured the intensity perceived by a panel previously coached, consisting of 14 volunteers (eight women and six men; 30 to 40 yr old), students and academics who worked in the Meat Science and Technology area. Slides, and oral explanation were used for training and previous tests with beef were carried out to ensure that the panelist identified the descriptors and the use of the scale(19). The panelists, after bibliographic review, elected by consensus the descriptors profile that provided information on the meat characteristics(20-23). A descriptive quantitative test (24,25) was performed, where panelist scored in a nine-point structured scale the intensity of the evaluated attribute, considering one as the value of less intensity. The results obtained were analyzed with the Wilcoxon signed-rank test, accepting statistical difference of P<0.05(24,26). The results are presented in Table 1.

En todas las pruebas sensoriales se ofreció a los panelistas agua y galletas integrales tipo habaneras, y se les solicitó que ingirieran una porción antes y entre muestras con la finalidad de remover los sabores de la boca(19). Experimento 1 Se realizó la descripción de las propiedades sensoriales de la carne, y se midió la intensidad percibida por un panel previamente entrenado, conformado por 14 voluntarios (ocho mujeres y seis hombres; 30 a 40 años), estudiantes y académicos quienes trabajaban en el área de Ciencia y Tecnología de Carne. Para el entrenamiento se utilizaron diapositivas, explicación oral y se realizaron ensayos previos con carne de bovino para garantizar que el panelista identificara los descriptores y el uso de la escala(19).

Experiment 2 Characteristics of the consumer panel. To perform the tests: Duo-trio, preference of pairs for juiciness and tenderness, as well as acceptance testing, 88 volunteers intervened, students from the faculties of Veterinary Medicine and Animal Hsbandry and Agricultural Sciences of the Universidad Autonoma del Estado de Mexico. The personal data collected indicated that 49 % were men and 51 % women, aged 19 to 27 yr; 43 % said consuming beef more than two times a week, 34 % once

Los panelistas, eligieron por consenso el perfil de los descriptores que proporcionaron información sobre las características de la carne, 313

Briceida Ortiz-López, et al. / Rev Mex Cienc Pecu 2016;7(3):309-320

previa revisión bibliográfica(20-23). Se realizó una prueba descriptiva cuantitativa(24,25), donde el panelista marcó en una escala estructurada de nueve puntos la intensidad del atributo evaluado, y se consideró el uno como el valor de menor intensidad. Los resultados obtenidos se analizaron con la prueba de jerarquía signada de Wilcoxon, aceptando diferencia estadística a P<0.05(24,26). Los resultados se presentan en el Cuadro 1.

a week, 14 % once every 15 d, while 9 % once a month. They reported that their way of habitual meat consumption was: roast, burgers and stews. Experimental development. Test Duo-trio(27) was conducted to determine if the meat under assessment was perceived similarly by the consumer. Two triads (A-REF AB and - REF BA) were used where A corresponded to the meat sample (control), which was used as a constant reference (REF) and (B) corresponded to the meat sample obtained from fed-tannins animal (ET). Three meat samples were offered to the panelists, one of them marked with the letter “R” reference sample, while the other two were encoded with a random three-digit number. The panelist identified which one of the samples was equal to R. The results obtained, were analyzed according to the standard BS ISO 10399:2004, “Sensory analysis-MethodologyDuo-trio test”(27).

Experimento 2 Características del panel de consumidores. Para realizar las pruebas: Dúo-trío, preferencia por pares para jugosidad y terneza, así como la prueba de aceptación, participaron 88 voluntarios, estudiantes de las Facultades de Medicina Veterinaria y Zootecnia y Ciencias Agrícolas de la Universidad Autónoma del Estado de México. Los datos personales recabados indicaron que, 49 % fueron hombres y 51 % mujeres, entre 19 y 27 años; 43 % afirmó

Cuadro 1. Descriptores de las características de carne elegidas por los panelistas Table 1. Descriptors of the characteristics of meat chosen by panelists Atributte

Scale

Definition

Technique

Smell: Blood

Soft to intense

Blood smell quantification

Assessed, approaching the meat 2 cm from the nose for a period of 5 sec

Toasted

Soft to intense

Boiled meat Green

Soft to intense Soft to intense

Aromatic associated with meat after keeping it at 100 °C for 15 min Aromatic associated with meat when it is boiled in water Aromas associated with plants or plant material

Taste: Salty Umami Fat Methalic

Soft to Soft to Soft to Soft to

Texture: Firmness Fibrous Fat sensation Juiciness

Minor to mayor Minor to mayor Soft to intense Dry to juicy

intense intense intense intense

Flavor that provides sodium chloride Taste of glutamate, amino acid salts. Similar to soy sauce The aromas associated with animal fat when cooking The impression of flavor of rusty metal, such as iron, copper, and silver spoons

Evaluated during chewing

Force required to penetrate the meat with the incisor teeth Quantification of fibers of the meat Fat feeling in the mouth The water perceived when the meat is chewed

Evaluated during chewing

314

INFLUENCIA DE TANINOS SOBRE CARACTERÍSTICAS FÍSICAS Y SENSORIALES DE LA CARNE DE BOVINOS

Preference pairs tests(24,25), were conducted to assess the juiciness and tenderness. Meat samples (control) and B (ET), were codified with three-digit numbers and were simultaneously presented to the panelist, in the form AB for some and BA for others. The panelist identified which one of the two samples was the softest and which the juiciest. The results were analyzed by the approximation test from the binomial distribution to the normal distribution (/2= 0.025); Z= (X-np)-0.5/√ npq, where X= number of trials of the most favorite sample, n= total number of judgments, p= probability of selecting the most favorite sample at random and q= 1-p, for paired different test p=q=½(23).

consumir carne de bovino más de dos veces a la semana, el 34 % una vez a la semana, el 14 % una vez cada 15 días, mientras que el 9 % una vez al mes. Ellos refirieron que su forma de consumo habitual de carne era: asada, en hamburguesas y en guisos. Desarrollo experimental. La prueba Dúo-trío(27), se realizó para determinar si las carnes sometidas a evaluación eran percibidas de manera similar por el consumidor. Se utilizaron dos tríadas (A-REF AB y A-REF BA) donde A correspondió a la muestra de carne (testigo), la cual se utilizó como referencia constante (REF) y B correspondió a la muestra de carne obtenida de los animales que consumieron taninos (ET). A los panelistas, se les presentaron tres muestras de carne, una de ellas marcada como muestra de referencia con la letra “R”, mientras que las otras dos fueron codificadas con números aleatorios de tres dígitos. El panelista identificó cuál de las muestras era igual a R. Los resultados obtenidos, se analizaron de acuerdo a la Norma BS ISO 10399:2004. “Sensory analysis-Methodology-Duo-trio test”(27).

Affective testing(24,25) was used to assess the acceptance of meat from fed-tannins cattle. Samples were presented in the same way as for the tests by paired test. The panelist assessed their preference on each sample according to a seven-point hedonic scale: 1) I dislike very much, 2) I dislike moderately 3) I dislike slightly, 4) Nor I like or I dislike, 5) I like slightly, 6) I like moderately, 7) I really like it. The results were transformed into numerical scale (1 to 7) in the same order. The frequencies were obtained and treatments were compared by level of acceptance using X2 test, accepting statistical differences at P<0.05(24,25). Statistical analyses were developed with version 9.0 of the computational Statistix package(18).

Las pruebas de preferencia por pares(24,25), se realizaron para evaluar la jugosidad y la terneza. Las muestras de carne A (testigo) y B (ET), se codificaron con números de tres dígitos y se presentaron a los panelista de manera simultánea, en forma AB para algunos y BA para otros. El panelista identificó cuál de las dos muestras era la más suave y cuál la más jugosa. Los resultados se analizaron por la prueba de aproximación de la distribución binomial a la distribución normal (/2=0.025); Z=(X-np)-0.5/√ npq, donde, x=número de juicios de la muestra más preferida, n=número total de juicios, p=probabilidad de escoger la muestra más preferida de forma aleatoria y q=1-p, para prueba de comparación por pares p=q=½(23).

RESULTS AND DISCUSSION The results of the physical characteristics are presented in Table 2. Addition of tannins had no effect on pH, WRC, cooking loss and shear force (P>0.05). pH influences many biochemical and sensory properties of fresh and cooked meat, such as flavor and tenderness(28); the decrease in pH allows activation of proteolytic enzymes, and also allows proteins to reach their isoelectric point and therefore inducing a decrease of muscle water holding capacity(2,28). The analyzed data showed a pH of 5.42 for

La prueba afectiva(24,25), se utilizó para evaluar la aceptación de la carne de bovinos alimentados con adición de extracto de taninos en la dieta. 315

Briceida Ortiz-López, et al. / Rev Mex Cienc Pecu 2016;7(3):309-320

Las muestras se presentaron de la misma forma que para las pruebas de comparación por pares. El panelista evaluó su preferencia sobre cada muestra de acuerdo a una escala hedónica de siete puntos: 1) me disgusta mucho, 2) me disgusta moderadamente, 3) me disgusta ligeramente, 4) ni me gusta ni me disgusta, 5) me gusta ligeramente, 6) me gusta moderadamente, 7) me gusta mucho. Los resultados, se transformaron a escala numérica (1 a 7) en el mismo orden. Se obtuvieron las frecuencias y se compararon los tratamientos por nivel de aceptación utilizando una prueba de X 2 , aceptando diferencia estadística a P<0.05 (24,25) . Los análisis estadísticos se desarrollaron con la versión 9.0 del paquete computacional Statistix(18).

both treatments, which is in the range considered as normal(2,16). Results indicated that the shear force was superior to 8 kgf. According to some researches (29-33) , these values may be influenced by factors such as breed, feeding, age and animal handling. Others(29,30), have shown that meat from Bos indicus is less tender than the meat from Bos taurus. It is important to remember that the gene load of animals used in this study was mainly from the Brahman breed. Riley et al(30), reported values greater than 8 kgf from Brahman meat. It was also mentioned(32,33) that the use of technologies to improve growth in feedlots (anabolic implants and ß-adrenergic agonists) influence negatively the meat tenderness, so as the maturity of the animal, because the solubility of collagen decreases with increasing age and therefore favors the increase of meat shear force(31,32). The value of shear force obtained in the experiment we are discussing it, could be due to the use of zilpaterol hydrochloride implants, coupled with maturity of animals in the finishing fattening stage.

RESULTADOS Y DISCUSIÓN Los resultados de las características físicas se presentan en Cuadro 2. Se aprecia que la adición de taninos no influyó en el pH, CRA, pérdida por cocción y fuerza de corte (P>0.05). El pH influye en numerosas propiedades bioquímicas y sensoriales de la carne fresca y cocinada, tales como el sabor y la terneza(28), el descenso de pH permite que las enzimas proteolíticas se activen, así como también permite a las proteínas alcanzar su punto isoeléctrico y por consiguiente se induce la disminución de la capacidad de retención de agua del músculo(2,28). Los datos analizados revelan un pH de 5.42 para ambos tratamientos, el cual está en el rango que se considera normal(2,16).

Exp 1 results obtained for the sensory profile are shown in Figure 1. Tannins did not influenced the intensity of the attributes evaluated (P>0.05). Taste and smell descriptors were

Cuadro 2. Influencia de la adición de extracto de taninos en las características físicas de la carne de bovinos alimentados de forma intensiva

Los resultados indicaron que la fuerza de corte fue superior a 8 kgf. De acuerdo a algunos investigadores(29-33), estos valores pueden estar influidos por factores tales como la raza, la alimentación, la edad y el manejo del animal. Otros investigadores(29,30), han demostrado que la carne de Bos indicus es menos tierna que la de Bos Taurus; es importante recordar que la carga génica de los animales utilizados en este estudio fue en mayor proporción Brahman. Riley et al(30), reportaron valores superiores a 8 kgf al evaluar la fuerza de corte en carne procedente

Table 2. Influence of the addition of tannin extract in the physical characteristics of the meat of cattle fed intensively

Variable

Treatments Control Tannins

SEM

P value

N pH Water retention, % Cooking loss, % Shear force, kgf

8 5.42 87.32 32.47 8.88

0.023 1.058 1.589 0.477

0.88 0.48 0.30 0.07

8 5.42 86.21 30.04 10.21

SEM= standard error of the mean.

316

INFLUENCIA DE TANINOS SOBRE CARACTERÍSTICAS FÍSICAS Y SENSORIALES DE LA CARNE DE BOVINOS

de raza Brahman. También mencionan(32,33) que el uso de tecnologías para mejorar el crecimiento en corral de engorda (implantes anabólicos y agonistas ß-adrenérgicos) influyen de manera negativa en la terneza de la carne, así como también la madurez del animal afecta, ya que la solubilidad del colágeno disminuye con el aumento de la edad y por consiguiente favorece el incremento de la fuerza de corte de la carne(31,32). El valor de fuerza de corte obtenido en el experimento que nos ocupa pudo deberse a que los animales recibieron implante y clorhidrato de zilpaterol; aunado a ello eran animales maduros en etapa de finalización de engorda.

perceived as soft, pleasing to the consumer, since they were located below the average scale. Another study(34), suggests that the flavor in beef can be influenced by heat, animal breed, aging time, type of muscle and the diet; the volatile components formed during meat cooking are those that produce the smell attribute, and contribute to the meat taste (28,34) characteristics . When cattle are fed with high-grains diets, the meat has higher palatability and preference by consumers(28,34). Attributes as fat, fat feeling and juiciness were perceived as soft, while the firmness and stringiness had high values. According to some research(2,3,5), water and fat affect the meat tenderness; less amount of water and fat, feels a meat with a less juicy and smaller feel fat, and therefore firmness and the woodiness (attributes of tenderness) are high.

Los resultados del Exp 1 obtenidos para el perfil sensorial se muestran en la Figura 1. Los taninos no influyeron en la intensidad de los atributos evaluados (P>0.05). Los descriptores de sabor y olor se percibieron como suaves, lo que agrada al consumidor, ya que se ubican por debajo de la media de la escala. En otra investigación(34), se sugiere que el sabor en carne de res puede estar influenciado por el calor, la raza animal, el tiempo de envejecimiento, el tipo de músculo y la dieta; los componentes volátiles formados durante el cocinado de la carne son los que producen el atributo de olor, y contribuyen en las características de sabor de la carne(28,34); cuando los bovinos son alimentados con dietas altas en granos, la carne presenta mayor palatabilidad y preferencia por los consumidores (28,34) . Los atributos, grasa, sensación grasa y jugosidad se percibieron como suaves, mientras que la firmeza y fibrosidad presentan valores altos. De acuerdo a algunas investigaciones(2,3,5), el agua y la grasa influyen en la terneza de la carne; a menor cantidad de agua y de grasa, se percibe una carne con una menor jugosidad y menor sensación grasa, y por consiguiente la firmeza y la fibrosidad (atributos de terneza) se perciben altas.

The results of the Exp 2 obtained by the Duotrio test, showed that more than the 75.0 % of

Figura 1. Perfil sensorial de carne de bovino. O= olor; T= textura; S= sabor Figure 1. Sensorial profile of the meat from bovine. O= odor; T= texture; S= flavor

El resultado del Exp 2 obtenido de la prueba Dúo-trío 100(27), mostró que más del 75.0 % de los consumidores considerarían similar la

The number below descriptor name indicates the P-value in agreement with test of Wilcoxon (<0.05)

317

Briceida Ortiz-López, et al. / Rev Mex Cienc Pecu 2016;7(3):309-320

carne proveniente de bovinos alimentados con y sin adición de taninos en la dieta.

consumers would consider a similar meat from cattle fed with and without addition of tannins in the diet. In the paired preference test, for meat juiciness, it was obtained a value of z=0.03, for /2=0.025, and comparing with the z-value of tables (1.96), shows that consumers do not perceive differences between meat samples. Similarly, for assessing tenderness, the value obtained for z=1.17, for /2= 0.025, showed that consumers do not perceive a change in the meat tenderness when animals were fed with addition of tannin extract in the diet.

En la prueba de preferencia por pares, donde se evaluó la jugosidad de la carne, se obtuvo un valor de z=0.03. Para un /2=0.025, al comparar con el valor de z de tablas (1.96), muestra que los consumidores no perciben diferencias entre las muestras de carne. De igual forma al evaluar terneza el valor obtenido para z=1.17. Para un /2=0.025, se observa que los consumidores no perciben un cambio en la terneza de la carne cuando los animales son alimentados con adición de extracto de taninos en la dieta.

Preference test results in Figure 2, show that the item of greater acceptance of consumers to beef fed with and without addition of tannins in

Los resultados de la prueba de preferencia se muestran en Figura 2, se aprecia que el ítem de mayor aceptación de los consumidores para carne de bovino alimentados con y sin adición de taninos en la dieta fue para “me gusta moderadamente”, donde el porcentaje de consumidores que prefirieron este nivel fue de 31.8 % para carne sin taninos y 35.2 % para carne con adición de taninos. Los resultados del análisis estadístico muestran que sólo en el ítem “me gusta mucho”, se percibieron diferencias entre las muestras de carne (P=0.02). Se aprecia que más del 74.4 % de los consumidores declaró que le gustó la carne, a 14.7 % le fue indistinto, mientras que 10.8 % mostró algún disgusto.

Figura 2. Preferencia de los consumidores por la carne de bovinos alimentados con y sin adición de taninos en la dieta Figure 2. Consumer preference for meat from cattle fed with and without addition of tannins in the diet 35

Número de consumidores (Number of consumers)

P = 0.74

Los resultados de las pruebas sensoriales muestran que la adición de 0.3 % de extracto de taninos en la dieta de bovinos engordados de forma intensiva no influyen en la aceptación de la carne por parte del consumidor; con las características físicas que presentó esta carne (fuerza de corte aproximada de 9.5 kgf), se tiene una buena aceptabilidad, ya que más del 74.0 % de los consumidores mostraron preferencia por ella.

30 P = 0.02

25 20

Testigo (Control) P = 0.88

Taninos (Tannins) P = 0.28

15 10

P = 0.42

5 P = 0.1

CONCLUSIONES E IMPLICACIONES El análisis sensorial mostró que al adicionar 0.3 % de extracto de taninos en la dieta de

Escala hedónica (Hedonic scale)

318

P = 0.16

INFLUENCIA DE TANINOS SOBRE CARACTERÍSTICAS FÍSICAS Y SENSORIALES DE LA CARNE DE BOVINOS

bovinos engordados de forma intensiva, no se perciben diferencias sensoriales al consumir la carne, ni provocan ningún cambio que sea perceptible por el consumidor. Lo anterior sugiere que bajas concentraciones de taninos pueden usarse como aditivos en dietas, sin riesgo de modificar las características físicas y sensoriales de la carne que provoquen atributos sensoriales inaceptables por el consumidor. En este estudio no se evaluó la presencia de taninos en carne, sin embargo, se considera prudente realizar esta medición, ya que con ello se podría discernir la duda de si los taninos se acumulan o no en tejido, y de ser positivo, conocer la concentración.

the diet was for “I like moderately”, where the percentage of consumers who preferred this level was 31.8 % for meat without tannins and 35.2 % for meat with addition of tannins. The results of statistical analysis show that only in the item “I like it very much”, perceived differences between the meat samples (P= 0.02). More than 74.4 % of consumers stated that they liked the meat, 14.7 % it was indistinct, while 10.8 % showed some disappointment. Sensory tests results show that the addition of 0.3 % tannin extract in the diet do not influence the acceptance of meat by consumers; with physical characteristics that presented this meat (approximately 9.5 shear force kgf), has a good acceptability, because more than 74.0 % of consumers showed preference for it.

AGRADECIMIENTOS Se agradece a la Dra. Isadora Martínez Arellano (UAM-Iztapalapa) su apoyo durante el proceso de esta investigación.

CONCLUSIONS AND IMPLICATIONS Sensory analysis showed that by adding 0.3 % tannin extract in the diet of intensively fattened cattle, do not influence the acceptance of meat, nor cause any change that is detectable by the consumer. This suggests that low concentrations of tannins can be used as additives in diets, without the risk of modifying the physical and sensory meat characteristics causing unacceptable sensory attributes by the consumer. The presence of tannins in the meat was not evaluated in this study, however, it is considered prudent to perform this measurement, since it could help to discern the doubt if the tannins are accumulated or not in tissue, and if positive, to know the concentration.

LITERATURA CITADA 1.

Liria DMR. Guía para la evaluación sensorial de los alimentos http:/ /w ww.slideshare.net/ evytaguevara/ gua-para-l aevaluacin-sensorial-de-alimentos. 2007. Consultado 15 abril, 2014.

Lawrie RA, Ledward DA. Lawrie’s meat science. 7th ed. Cambridge, England: Woodhead Publishing; 2006.

Bianchi. Alternativas tecnológicas para la producción de carne ovina de calidad en sistemas pastoriles. Montevideo, Uruguay: Hemisferio Sur; 2007.

Miller MF, Carr MA, Ramsey CB, Crockett KL, Hoover LC. Consumer thresholds for establishing the value of beef tenderness. J Anim Sci 2001;(79):3062-3068.

Rodas-González A, Huerta-Leidenz N, Jerez-Timaure N, Miller MF. Establishing tenderness thresholds of Venezuelan beef steaks using consumer and trained sensory panels. Meat Sci 2009;(83):218-23.

Killinger KM, Calkins CR, Umberger WJ, Feuz DM, Eskridge KM. Consumer sensory acceptance and value for beef steaks of similar tenderness, but differing in marbling level. J Anim Sci 2004;(82):3288-3293.

Brewer PS, James JM, Calkins CR, Rasby RM, Klopfenstein TJ, Anderson RV. Carcass traits and M. Longissimus lumborum palatability attributes of calf- and yearling-finished steers J Anim Sci 2007;(85):1239-1246.

Muchenje V, Dzam K, Chimonyo M, Strydom PE, Hugo A, Raats JG. Some biochemical aspects pertaining to beef eating

ACKNOWLEDGMENTS Thanks to Dra. Isadora Martínez Arellano (UAMIztapalapa) for support during the process of this investigation. End of english version

319

Briceida Ortiz-López, et al. / Rev Mex Cienc Pecu 2016;7(3):309-320

quality and consumer health: A review. Food Chemistry 2009;(112):279-289. Benchaar C, McAllister TA, Chouinard PY. Digestion, ruminal fermentation, ciliate protozoal populations and milk production from dairy cows fed cinnamaldehyde, quebracho condensed tannin, or Yucca schidigera saponin extracts. J Dairy Sci 2008;91(12)4765-4777.

22. Escalona BHB, Domínguez GM, García RMI, Ponce AE. Indicadores sensoriales de calidad en la cadena de producción de carne fresca de res y cerdo de México. XIV Congreso Nacional de Biotecnología y Bioingeniería. http:/ /www.smbb.com.mx/congresos%20smbb/queretaro11/ TRABAJOS/trabajos/ III/ cartel es/ CIII-86.pdf. 2011. Consultado 20 abril, 2014.

10. Frutos P, Raso M, Hervás G, Mantecón AR, Pérez V, Giráldez FJ. Is there any detrimental effect when a chestnut hydrolysable tannin extract is included in the diet of finishing lambs? Anim Res 2004;(53):127-136.

23. Pérez ML, Escalona H, Guerrero I. Effect of calcium choride marination on calpain and quality characteristics of meat f rom chi cken, horse, cattl e and rabbit. Meat Sci 1998;(48):125-134.

11. Makkar HP, Siddhuraju SP, Becker K. Plant secondary metabolites. Totowa, NJ: Human Press Inc; 2007.

24. O´Mahony M. Sensory evaluation of food statistical methods and procedures. New York, USA: Taylor & Francis; 1986.

12. Min BR, Pinchak WE, Anderson RC, Fulford JD, Puchala R. Effects of condensed tannins supplementation level on weight gain and in vitro and in vivo bloat precursors in steers grazing winter wheat. J Anim Sci 2006;(84):2546-2554.

25. Stone H, Sidel J. Sensory evaluation practices. 3rd ed. San Diego California, USA: Elsevier Academic Press; 2004. 26. Wayne WD. Bioestadística base para el análisis de las ciencias de la salud. 4ta ed. México DF: Limusa, SA de CV; 2004.

13. Barajas R, Cervantes BJ, Camacho A, Velázquez EA, Espino MA, Juárez F, et al. Condensed tannins supplementation on feedlot performance of growing bulls [abstract]. J Anim Sci 2010:88(Suppl 2):711.

27. BS ISO 10399:2004. Sensory analysis-Methodology-Duo-trio test. 2004. 28. Brewer MS. The chemistry of beef flavor -Executive summary. Centennial, CO. Illinois, USA. National Cattlemen’s Beef Association. 2006.

14. Cañeque V, Sañudo C. Estandarización de las metodologías para evaluar la calidad del producto (animal vivo, canal, carne y grasa) en los rumi antes. Madri d, E spaña: Monografías INIA: serie ganadera N° 3. 2005. 15. AMSA. Research guidelines for cookery, sensory evaluation and instrumental tenderness measurements of fresh meat. Savoy IL American Meat Sci Ass. 1995.

29. Johnson MH, Calkins CR, Huffman RD, Johnson DD, Hargrove DD. Differences in cathepsin B + L and calcium dependent protease activities among breed type and their relationship to beef tenderness. J Anim Sci 1990;(68):2371-2379.

16. González-Ríos H, Peña-Ramos A, Valenzuela M, ZamoranoGarcía L, Cumplido-Barbeitia G, González-Méndez NF HuertaLeidenz N. Comparison of physical, chemical, and sensorial characteristics between U.S.-Imported and Northwestern Mexico retail beef. J Food Sci 2010;(75):747-752.

30. Riley DG, Chase CC, Jr, Pringle TD, West RL, Johnson DD, Olson TA, et al. Effect of sire on m- and m-calpain activity and rate of tenderization as indicated by myofi bril fragmentation indices of steaks from Brahman cattle. J Anim Sci 2003;(81):2440-2447.

17. Steel RGD, Torrie JH. Bi oestadí stica: pri nci pios y procedi m ientos. 2da ed. Méxi co DF: McGraw -Hil l / interamericana de México; 1988.

31. Schereus NM, García F, Jurie C, Agabriel J, Micol D, Bauchart D, et al. Meta-analysis of the effect of animal maturity on muscle characteristics in different muscles, breeds, and sexes of cattle. J Anim Sci 2008;(86):2872-2887.

18. Statistix. Statistic User´s Manual. Release 9.0 Analytical Software, Tallahassee, FL. 2007.

32. Howard ST. Beef tenderness and the management of calffed Holstein steers to meet market standards [doctoral thesis]. Colorado, USA: Colorado State University; 2013.

19. ISO 8586:2012. Sensory analysis — General guidelines for the selection, training and monitoring of selected assessors and expert sensory assessors. 2012.

33. Garmyn AJ, Miller MF. Meat science and muscle biology symposium—Implant and beta agonist impacts on beef palatability. J Anim Sci 2014;(92):10-20.

20. Martínez AI, Severiano PP, Fernández FJ, Ponce AE. Changes in the physicochemical and sensory characteristics in raw and grilled ovine meat. J Sci Food Agric 2012;(93):1743-1750.

34. Tansawat R. Chemical characterization of meat related to animal diet. [All Graduate Theses and Dissertations]. http:/ /digitalcommons.usu.edu/etd/1339. 2012. Accessed Dec 12, 2014.

21. Adhikari K, Chambers IVE, Miller R, Vázquez-araújo L, Bhumiratana N, Philip C. Development of lexicon for beef flavor in intact muscle. J Sens Stud 2011;(26):413-420.

320

EVALUACIÓN DE LA CALIDAD DE CARNE DE Rev POLLO Mex Cienc Pecu 2016;7(3):321-339

Evaluación de la calidad de la carne de pollo en el mercado minorista: efectos del tipo y origen de las canales

Evaluation of the broiler meat quality in the retail market: Effects of type and source of carcasses Youssef A. Attiaa, Mohammed A. Al-Harthia, Mohamed A. Korishab, Mohamed M. Shiboobc

RESUMEN

El objetivo fue documentar la variabilidad en la calidad y contenido de nutrientes de la carne de pollo en el mercado de la ciudad de Jeddah (Arabia Saudita) proveniente de dos tipos de canales de pollos de engorda: congelados y frescos. También hay tres orígenes dentro de cada tipo (A, B, C) y (D, E y F), respectivamente. Estos fueron evaluados usando 45 canales de cada tipo, es decir, 15 canales de cada origen, seleccionadas durante tres meses. Los tipos de carne (congelada o fresca) y los orígenes dentro de cada tipo tuvieron una influencia significativa (P<0.05) en la apariencia y defectos de las canales, incluyendo peso de la piel y características de pechuga y pierna. Además, las cualidades físicas (pH, pérdida por goteo, ligereza y color amarillo) y la composición química (materia seca, proteína cruda, contenido de Ca, P, Na y K) fueron significativamente afectadas por cada tipo de carne y origen dentro de los tipos. La calidad de la carne de pollo en el mercado minorista mostró ser significativamente diferente en cuanto a selección del cliente para cumplir con su ingesta diaria recomendada. Esta diferencia en la calidad de la carne demostró potencial para impulsar su calidad nutritiva. Esto sugiere que los consumidores de carne pueden aumentar su ingesta de nutrientes a través de ser cuidadosos con sus compras. Además, dicha variación muestra la necesidad de la práctica constante en la cría y producción, en cuanto a la aplicación de normas y aspectos de nuevos controles de calidad. Basándose en el contenido nutricional declarado por las autoridades del mercado, esto puede impactar en el bienestar de los consumidores. PALABRAS CLAVE: Calidad carne, Perfil nutrientes, Mercado minorista, Pollo.

ABSTRACT

The aim of this work was to document the variability in the quality and nutrient content of broiler meat in the retail market of Jeddah city (Saudi Arabia) come from two types of broiler carcasses: frozen and fresh. There are also three sources within each type (A, B, C) and (D, E and F), respectively. These were evaluated using 45 carcasses from each type, i.e. 15 carcasses from each source, collected over three months. The meat types (frozen/fresh) and the sources within each type had a significant influence (P<0.05) on carcasses appearances and defects, including skin weight, and breast and leg parameters. In addition, physical qualities (pH, drip loss, lightness and yellowness) and chemical composition (dry matter, crude protein, Ca, P, Na and K content) were significantly affected by each type of meat and sources within the types. The quality of broiler meat in the retail market was shown to be significantly different in terms of customer selection to fulfil their recommended daily allowance. This difference in meat quality showed potential for the nutritious quality to be boosted. This suggests that consumers of meat can enhance their nutrient intake through being careful about their shopping. Furthermore, such variation shows the necessity of constant practice within husbandry and production, in terms of the implementation of regulations and aspects of new quality-controls. Based on the nutritional contents as stated by the market authorities, this may impact on consumers’ wellbeing. KEY WORDS: Meat quality, Nutrient profiles, Retail market, Broilers. Recibido el 26 de mayo de 2015. Aceptado el 27 de octubre de 2015. a

b c

Arid Land Agriculture Department, Faculty of Meteorology, Environment and Arid Land Agriculture, King Abdulaziz University, P.O. Box 80208, Jeddah 21589, Saudi Arabia, Tel:+966568575961, yaattia@kau.edu.sa. Correspondencia al primer autor. Department of Food and Dairy Science &Technology, Faculty of Agriculture, Damanhour University. Egypt.

Environmental Department, Faculty of Meteorology, Environment and Arid Land Agriculture, King Abdulaziz University. Saudi Arabia.

Funding agent: The Deanship of Scientific Research (DSR) at King Abdulaziz University, Jeddah, under grant no. 155-313-D1435.

321

Youssef A. Attia, et al. / Rev Mex Cienc Pecu 2016;7(3):321-339

INTRODUCCIÓN

INTRODUCTION

La carne de ave es una de las principales proteínas de origen animal para el consumo humano. Las compras de carne de pollo no solo se basan totalmente en precio sino también en características como la comodidad, la frescura y el origen de la producción(1). La carne de pollo es deliciosa, fácil de digerir y contiene nutrientes que cumplen las necesidades diarias recomendadas para la alimentación humana(2). Se encuentra en diferentes formas en todas las mesas de comida y es más barata que otros tipos de carne.

Poultry meat is one of the principle animal protein supplies for human consumption. Purchases of poultry meat are not totally based on price but also non-price characteristics such as convenience, freshness and origin of the product(1). Poultry meat is delicious, easy to digest, and contain nutrients that meet the recommended daily allowances for human(2). It is found in different forms on all food tables and is cheaper than other meat sources.

The quality of poultry meat is a particularly complex issue that may be evaluated from various standpoints. From a consumer and marketing perspective, carcass yields, appropriate carcass scores, good aesthetics, sensory and nutritional parameters are all desirable traits. In general, poultry meat is a considerable source of nutrients such as proteins, lipids, vitamins and minerals. It also has a relatively low fat content (3). In this respect, the chemical composition of muscle tissue is an essential constituent of the quality of poultry meat (4,5); which depends on a number of biological factors including: genotype, sex and age(3,6,7). Among the environmental factors that affect meat quality traits there is dietary composition of poultry(3,8,9). Regarding the profiles and intake of nutrients, feed type can to some extent influence the chemical composition of meat (10,11,12). In addition, rearing practice, health of broilers, environmental conditions, slaughter practices, storage and handling of meat are of importance(13,14), as well as the difference between fresh and frozen meat(15,16). Lately, the broiler husbandry system has been significant due to the fact that the modern market is totally dictated by the price and quality of broiler meat(17-20).

La calidad de la carne de ave es un asunto particularmente complejo que puede ser evaluado desde varios puntos de vista; desde una perspectiva del consumidor y mercadeo, rendimientos en canal, clasificación adecuada de la canal, buena apariencia, parámetros nutricionales y sensoriales, son todos rasgos deseables. En general, la carne de pollo es un origen importante de nutrientes como proteínas, lípidos, vitaminas y minerales. También tiene un contenido de grasas relativamente bajo(3); en este sentido, la composición química del tejido muscular es un componente esencial de su calidad (4,5), la cual depende de varios factores biológicos que incluyen: genotipo, sexo y edad(3,6,7). Entre los factores que afectan los rasgos de calidad está la composición de la dieta de las aves(3,8,9). Con respecto a los perfiles y la ingesta de nutrientes, el tipo de alimentación puede influir en cierta medida sobre la composición química de la carne(10,11,12). Además, prácticas de crianza, sanidad, condiciones ambientales, prácticas de sacrificio, almacenamiento y manipulación de la carne son de gran importancia(13,14), así como la diferencia entre carne fresca y congelada (15,16) . Últimamente el sistema de cría de pollos de engorda ha cobrado importancia, debido a que el mercado moderno es totalmente dictado por el precio y la calidad de la carne(17-20).

The chemical composition of poultry products is an important constituent in terms of consumption and from a wellbeing perspective of human. Therefore chemical composition has considerable influence on the consumption of meat and its health consequences(21). Meat

La composición química de los productos de aves de corral es un componente importante

322

EVALUACIÓN DE LA CALIDAD DE CARNE DE POLLO

en términos de consumo, y desde una perspectiva de bienestar del ser humano. Por lo tanto la composición química tiene una influencia considerable en el consumo de carne y sus consecuencias en la salud(21). La proteína de la carne, lípidos y minerales (Ca, P, K, Na y Fe) son críticos en la nutrición de los seres humanos y pollos; por consiguiente, los minerales generalmente se añaden a las dietas de las aves de corral(22). En este sentido, los niveles y orígenes de minerales dietéticos tienen efecto fuerte en cuanto a su acumulación en los tejidos animales y productos, así como la excreción y la consiguiente acumulación en el medio ambiente(21,23). Hoy en día existe un creciente interés en la mejora de la carne con varios nutrientes que tienen beneficios en la salud humana(24,25). Por lo tanto, documentar la calidad de la carne es esencial para tener en cuenta su variabilidad real en términos de perfiles externos e internos, tales como proteínas, lípidos, minerales Ca, P, Na, K y Fe, con el fin de monitorear esta calidad en el mercado y ayudar a desarrollar pautas de control de calidad.

protein, lipids and minerals (Ca, P, K, Na and Fe) are critical in the nutrition of both humans and chickens. Accordingly, minerals are usually added to poultry diets(22). In this regard, levels and sources of dietary minerals have strong effect in terms of their accumulation in animal tissues and products, as well as excretion and resulting build-up in the environment(21,23). Nowadays there is an increasing interest in enhancing meat with several nutrients which have human health benefits(24,25). Therefore, documentation of broiler meat quality essentially needs to take into account the variability in the actual meat quality in terms of external and internal nutrient profiles such as protein, lipids, Ca, P, Na, K and Fe minerals, in order to monitor the quality of broiler meat in the retail market and help to develop quality control guidelines. MATERIAL AND METHODS Meat source

A total of 90 whole broiler chicken carcasses were randomly collected from six sources named A, B, C, D, E and F, chosen from a big retail market, in Jeddah, Saudi Arabia during AprilJune 2014. The sample represented two types of broiler chickens carcasses: imported frozen (A, B and C) and locally produced fresh (cold) carcasses (D, E, and F). The frozen carcasses were one from France and two from Brazil. The sample size was five carcasses per source, replicated three times, resulting in 15 broiler carcasses per source. The carcasses were from the A grade and 1 kg weight classes, and had similar production and expire dates. However, the details of husbandry practice were not available from the producing companies. The rearing, husbandry and feeding practice were according to broilers management guide. It is well known that broilers are fed commercial diets that meet the requirements for dietary nutrients and were supplied with feed and fresh water ad libitum. Broilers were slaughtered in automatic slaughter houses according to the Islamic method.

MATERIAL Y MÉTODOS Origen de la carne

Un total de 90 canales enteras de pollos de engorda se recolectaron al azar de seis orígenes, nombradas A, B, C, D, E y F, elegidas de un gran mercado, en Jeddah, Arabia Saudita durante abril a junio de 2014. La muestra representa dos tipos de canales: importadas congeladas (A, B y C) y frescas (frías) (D, E y F) de producción local. Las canales congeladas fueron una de Francia y dos de Brasil. El tamaño muestral fue de cinco canales por origen, replicado tres veces, resultando en 15 canales por origen. Las canales eran de grado A, de 1 kg de peso y tenían producción y fechas de caducidad similares. Sin embargo, los detalles de la práctica de crianza no estuvieron disponibles en las empresas productoras.

La cría, salud y alimentación se llevaron de acuerdo a la guía de manejo de pollos de 323

Youssef A. Attia, et al. / Rev Mex Cienc Pecu 2016;7(3):321-339

engorda; es bien sabido que pollos que se alimentan con raciones comerciales cumplen con los requisitos de nutrientes, y además se proveyeron de alimento y agua fresca ad libitum. Los pollos se sacrificaron en rastros automatizados según el método islámico.

Carcass appearance and presence of defects

Carcass appearance and presences of defects were evaluated using a scale of five where 5= excellent. This was conducted using complete carcasses and parts with the whole skin on. A score of 5 signified the following: the skin was free from tears; the flesh was free from dryingout; there was a perfect covering of fat under the skin; and lastly there were no defects such as contusions, unusual colouration, feathers, broken bones and viscera. In addition, complete broilers and parts of broilers were totally fleshed and meaty. Scale 4= good, signifying that carcasses were free of most of the abovementioned defects and had only one defect. Scale 3= fair, signifying carcasses that had two or three above-mentioned defects. Scale 2= poor, signifying carcasses which had four to five defects. Lastly 1= bad, where carcasses had an unacceptable appearance and most of the defects listed above were in evidence.

Apariencia de la canal y presencia de defectos

El aspecto de la canal y la presencia de defectos se evaluaron utilizando una escala de 5, donde 5= excelente. Esto se realizó con canales completas y partes con toda la piel. Una puntuación de 5 significaba que la piel estaba libre de rasgaduras, la carne estaba libre de desecación, había una perfecta cobertura de grasa bajo la piel, y por último sin defectos tales como contusiones, coloración inusual, plumas, vísceras y huesos rotos; además, todas las partes del pollo totalmente carnosas. Escala 4= bueno, lo que significa canales libres de la mayoría de los defectos mencionados y tenían un único defecto. Escala 3= canales de feria, lo que significa que tenían dos o tres de los defectos mencionados. Escala 2= canales pobres, lo que significa que tenían de cuatro a cinco defectos. Por último 1= malo, donde las canales tenían un aspecto inaceptable y la mayoría de los defectos mencionados estaban presentes.

Meat yield

Carcasses were cut into different parts such as breast and legs to obtain absolute and relative weights (as relative to the carcass weight). Absolute and relative weights of meat and bone yield were done using the deboning method to obtain the meat and bone of breast and leg parts. Abdominal fat was separated and absolute and relative weights of abdominal fat were calculated relative to the carcass weight. In addition, the carcasses were deboned and absolute and relative weight of meat and bone, abdominal fat, breast and legs were calculated.

Rendimiento de la carne

Las canales se cortaron en diferentes partes como la pechuga y las piernas, para obtener pesos absolutos y relativos (respecto al peso de la canal). El peso absoluto y relativo del rendimiento de carne y hueso se realizaron utilizando el método de deshuesado. La grasa abdominal se separó y se calcularon sus pesos absolutos y relativos en relación con el peso de la canal. Además, se deshuesaron las canales y se calculó el peso absoluto y relativo de carne y hueso, grasa abdominal, pecho y piernas.

Meat physical characteristics

Thaw loss of the frozen carcasses was determined according to loss in carcass weight after keeping the carcass at room temperature for 12 h. Carcasses were cut into two halves, and the right side of the carcasses was skinned and deboned and meat was minced using a meat mincer (Moulinex-HV8, France). Water retention capacity (WRC) was determined according to Hamm(26) and adapted by Garcia et al(27).

Características físicas de la carne

La pérdida por descongelación de las canales se determinó según la pérdida de peso de la 324

EVALUACIÓN DE LA CALIDAD DE CARNE DE POLLO

canal después de mantenerla a temperatura ambiente durante 12 h. Las canales se cortaron en dos mitades; la parte derecha se peló y deshuesó, y la carne se picó con una máquina de picar carne (HV8 Moulinex, Francia). La capacidad de retención de agua (CRA) se determinó de acuerdo con Hamm(26), adaptado por Garcia et al(27).

The meat pH was measured with an InoLab digital pH 720 meter (Germany) after homogenisation of 1 g of raw muscles for 30 sec in 10 ml of distilled water(28). The colour of the breast muscle surface was measured according to Combes et al (29) using a colorimeter (Model CR-300, Minolta, Co., Ltd., Osaka, Japan) and expressed as Hunter values: L* (lightness), a* (redness) and b* (yellowness). Myoglobin content was determined according to Chaijan et al(30).

Se midió el pH de la carne con un InoLab digital pH 720 (Alemania) después de la homogeneización de 1 g de músculos crudos durante 30 seg en 10 ml de agua destilada(28). El color de la superficie del músculo del pecho se midió según Combes et al(29) usando un colorímetro (modelo CR-300, Minolta, Co., Ltd., Osaka, Japón) y expresado como valores Hunter: L* (luminosidad), a* (enrojecimiento) y b* (amarillamiento). El contenido de mioglobina se determinó según Chaijan et al(30). La pérdida a la cocción se determinó mediante la medición de las diferencias en el peso de la pierna antes y después de su cocción en agua hervida por 30 min(31) como sigue: Pérdida= (pierna después de cocida – pierna antes de cocida)/ pierna antes de cocinar × 100.

Cooking loss were determined by measuring the differences in the weight of the leg before and after cooking in boiled water for 30 min(31) as follows: Cooking loss=(leg after cooking leg before cooking)/leg before cooking × 100. A filter paper assay was applied to determine the drip loss(32). A 10 g section of breast fillet was kept under conditions that simulate retail sales. Samples were placed on polystyrene trays, covered with permeable plastic film, and stored at 4 ± 1 °C for 24 h. Drip loss was calculated by the difference between initial and final weights, reported on the initial weight and multiplied by 100.

Se aplicó un análisis con papel filtro para determinar la pérdida por goteo(32). Una sección de 10 g de filete de pechuga se mantuvo bajo condiciones que simulan ventas al por menor. Las muestras se colocaron en charolas de poliestireno cubiertas con película plástica permeable, y almacenadas a 4 ± 1 °C durante 24 h. La pérdida por goteo se calculó por la diferencia entre el peso inicial y final, sobre el informe del peso inicial y multiplicado por 100.

Meat chemical composition

Dry matter, fat, protein and ash contents were determined according to AOAC(33), using five pooled samples per treatment, collecting the same type of meat three times per meat source. The method numbers used were 934.01 for dry matter; 954.01 for crude protein; 920.39 for ether extraction, and 942.05 for ash(33). Meat mineral composition

Concentrations of Ca, K, Na and Fe were determined using a Varian ICP-Optical Emission Spectrometer (ICP-OEM): Varian 720-ES(34). Phosphorus concentrations were determined utilizing flame spectrophotometry technique(35).

Composición química de la carne

El contenido de materia seca, grasa, proteína y cenizas se determinaron según AOAC(33), con cinco muestras agrupadas por tratamiento, recolectando el mismo tipo de carne tres veces por su origen. La metodología numérica utilizada fue 934.01 para materia seca, 954.01 para proteína cruda, 920.39 para extracción de éter y 942.05 para ceniza(33).

Statistical analyses

The resulting data were statistically analysed according to SAS(36) using the PROC nested 325

Youssef A. Attia, et al. / Rev Mex Cienc Pecu 2016;7(3):321-339

according the following model: Yijk=  + Ci + Bij + eijk. Where Yijk= observed value of the dependent variable, = Overall mean, Ci= Carcass type effect (Frozen vs fresh), Bij= Source within type effect, eijklm= Experimental error of random distribution (0,2 ). The significance of the differences were tested at P<0.05 for all means(37). All percentages were transformed to their corresponding arcsine before running the analyses. Correlation analyses were also done to obtain the relationship between the different meat quality traits.

Composición mineral de la carne

Se determinaron las concentraciones de Ca, K, Na y Fe usando un espectrómetro Varian de emisión ICP-óptico (ICP-OEM): Varian 720ES(34). Se determinaron las concentraciones de fósforo utilizando espectrofotometría(35). Análisis estadísticos

Los datos obtenidos se analizaron estadísticamente según SAS(36) usando el PROC jerarquizado según el siguiente modelo: Yijk=  + Ci + Bij + eijk. Donde Yijk= valor observado de la variable dependiente, = media general, Ci= efecto del tipo de canal (congelada y fresca), Bij= efecto tipo de origen, eijklm= error experimental de la distribución al azar (0,2). La significancia de las diferencias entre medias se analizaron a una P<0.05(37). Los porcentajes se transformaron a su correspondiente arcoseno antes de ejecutar el análisis. También se realizaron análisis de correlación entre los diferentes rasgos de calidad.

RESULTS AND DISCUSSION External carcass quality

Fresh (cold) carcasses had significantly superior carcass appearances and lower defects (7.8 %) than frozen carcasses, but lower skin weight (10.7 %) and a lower skin weight percentage (11.8 %) (Table 1). The low quality of frozen carcasses may be due to more handling during distribution, retailing and customers’ selections, and longer storage periods than fresh (cold) carcasses. Bird handling represents the greatest cause of downgrading and loss of quality(38). Poor carcass quality will definitely reflect in

RESULTADOS Y DISCUSIÓN

Las canales frescas (frías) presentaron una mejor apariencia y menores defectos (7.8 %) que las

Cuadro 1. Efecto del tipo y origen de carne de pollo en el mercado minorista sobre las características de las canales (Media ± EE) Table 1.

Effect of meat type and different source in the retail market on carcasses characteristics (LS mean ± SE)

Parameters Meat type Frozen Fresh

Source of meat Frozen A Frozen B Frozen C Fresh D Fresh E Fresh F

Statistical analyses Meat type Source of meat

Carcass appearances and defects

Carcass weight (g)

Thaw loss (%)

Skin weight (g)

Skin weight (%)

Abdominal fat (g)

Abdominal fat (%)

3.85±0.081 4.15±0.061

990.3± 5.34 996.1± 5.46

——-

50.3±1.57 44.9±1.29

10.2±0.333 9.0±0.252

10.4±0.82 11.7±0.61

1.04±0.082 1.18±0.062

4.34±0.063a 3.54±0.151c 3.67±0.093c 4.34±0.105a 4.24±0.067a 3.90±0.111b

998.4± 9.29 986.6± 8.31 985.9±10.33 1003.2± 9.45 997.7±10.82 987.4± 8.06

4.15±0.405c 5.80±0.479b 7.98±0.805a ———-

55.5±2.41a 48.2±2.42b 47.3±2.98b 42.0±1.32c 47.2±2.83bc 45.6±2.23bc

11.2±0.579a 9.8±0.478b 9.6±0.621b 8.4±0.247c 9.5±0.559bc 9.2±0.427bc

10.5±1.61b 9.8±0.605b 10.8±1.85b 10.4±0.888b 10.4±1.02b 14.4±0.931a

1.05±0.159b 0.999±0.063b 1.09±0.184b 1.03±0.088b 1.05±0.109b 1.46±0.090a

0.001 0.001

0.445 0.615

— 0.001

0.002 0.018

0.002 0.029

0.108 0.037

0.107 0.029

SE= Standard error, n= 15 per source of each type.

a,b,c Differences among means within a column within each factor not sharing similar superscripts are significant (P<0.05).

326

EVALUACIÓN DE LA CALIDAD DE CARNE DE POLLO

canales congeladas, pero menor peso de la piel (10.7 %) y menor porcentaje de peso de la piel (11.8 %) (Cuadro 1). La baja calidad de las canales congeladas puede deberse más al manejo durante la distribución, venta menorista, selección de los clientes y plazos más largos de almacenamiento que las canales frescas. El manejo representa la mayor causa de degradación y pérdida de calidad(38); una calidad pobre de la canal, definitivamente reflejará una mala calidad de carne(39). Sin embargo, también la técnica de congelación puede afectar a la canal y calidad de la carne, ya que el proceso de congelación puede afectar su fracción de agua(40). Con la congelación del agua, aumenta la concentración de los solutos restantes (proteínas, carbohidratos, lípidos, vitaminas y minerales), y se perturba la homeostasis del sistema complejo de la carne(40). Los cambios en el entorno inmediato de las fibras musculares afectan las características de la membrana de la célula, que a su vez afectan la calidad de la carne(41).

poorer meat quality(39). However, also the freezing technique can affect the carcass and meat quality as freezing process can affect the water fraction of the meat(40). With the freezing of water, the concentration of the remaining solutes (proteins, carbohydrates, lipids, vitamins and minerals) increases, thereby upsetting the homeostasis of the complex meat system(40). The changes in the immediate environment of the muscle fibers affect the cell membrane characteristics, which in turn affect the quality of the meat(41).

There was a significant effect (P<0.05) of carcass sources on most of the external carcasses traits except for absolute carcass weight due to the choice of carcasses of the same category of weight. The results showed that source A of the frozen carcasses and D and E of the fresh carcasses had superior carcass appearances compared to the other sources (P<0.05). In addition, source F of the fresh carcasses had higher carcass appearance than sources B and C of the frozen carcasses (P<0.05). The external traits of carcasses can strongly affect consumer purchase decision as it is one of the main factors affecting consumer’s choice (42) even if other factors as price, convenience, freshness and origin of the product can influence poultry meat purchase(1).

Hubo un efecto significativo (P<0.05) de los orígenes de canal en la mayoría de sus características externas, excepto el peso de la canal absoluta, debido a la elección de las canales de la misma categoría de peso. Los resultados mostraron que el origen A de canales congeladas y D y E de las canales frescas presentaron mejor aspecto en comparación con los otros orígenes (P<0.05). Además, el origen F de las canales frescas tenían mejor apariencia que las de origen B y C de las canales congeladas ( P <0.05). Las características externas pueden fuertemente afectar la decisión de compra del consumidor, ya que es uno de los principales factores que afectan la selección(42) aun cuando otros factores como precio, conveniencia, frescura y origen del producto pueden influir en la compra(1).

Thawing loss of the frozen carcasses was significantly (P<0.05) greater in C than in B and A sources. In addition, source B had higher thawing loss than source A (P<0.05). Increased thawing loss indicates low quality of carcass and this may be affected by age, handling processes, quality of packaging and storage conditions(38,43) as well as freezing and thawing techniques which can affect drip losses(40). Meat spoilage increases with increased length of display and storage and varies significantly between fresh and frozen carcasses(44,45,46).

La pérdida al descongelar las canales fue significativamente (P<0.05) mayor en C que en B y A; además, el origen B tuvo mayor pérdida por deshielo que el origen A (P<0.05). La pérdida creciente de descongelación indica baja

The absolute and relative weights of the skin were significantly greater for source A of the frozen carcasses than that of the other sources 327

Youssef A. Attia, et al. / Rev Mex Cienc Pecu 2016;7(3):321-339

calidad de la canal, y esto puede verse afectado por la edad, manejo de procesos, calidad de condiciones de envasado y almacenamiento(38,43), así como las técnicas de congelación y descongelación que pueden afectar las pérdidas por goteo(40). El deterioro de la carne aumenta con la mayor duración de la exhibición o almacenamiento, y varía significativamente entre canales frescas y congeladas(44,45,46).

of frozen or fresh carcasses. In addition, source B and C of the frozen carcasses had heavier absolute and relative weight of skin than source D of the fresh carcasses. The increase in weight and percentage of the skin may reveal higher fat/collagen content(38), and this has been shown to be affected by the strain, age and nutritional plan of broilers(48). The absolute and relative weights of the abdominal fat were significantly heavier in source F of the fresh carcasses than those of the other sources of frozen and fresh carcasses. Abdominal fat in broiler carcasses has been found to be affected by broiler genotypes, feed restriction and nutritional plans, particularly in terms of dietary concentrations of protein or essential amino acids or energy (38,49) . Increasing abdominal fat may be undesirable and has a negative impact on consumer health(49), but also in consumer choice as in recent years consumers preference for leaner carcasses has increased(50).

El peso absoluto y relativo de la piel fueron significativamente mayores para el origen A de las canales congeladas que el de los otros orígenes de canales congeladas o frescas. Además, el origen B y C de las canales congeladas tuvieron mayor peso absoluto y relativo de la piel que el origen D de las canales frescas. El aumento de peso y porcentaje de la piel puede revelar mayor contenido de grasa/ colágeno(38), y esto se ha demostrado que puede ser afectado por la línea, la edad y el plan nutricional de los pollos(48). El peso absoluto y relativo de la grasa abdominal fueron significativamente más pesados en origen F de las canales frescas que los de los otros orígenes de canales congeladas y frescas. Se ha encontrado que la grasa abdominal puede ser afectada por el genotipo, planes nutricionales, particularmente en términos de concentraciones dietéticas de proteína, aminoácidos esenciales o energía y restricción de la alimentación(38,49). El aumento de grasa abdominal puede ser indeseable y tiene un impacto negativo en la salud del consumidor(49), pero también en la selección de los consumidores, quienes han incrementado su preferencia por canales más magras(50).

Breast meat characteristics

Fresh carcasses had significantly (P< 0.05) greater absolute and relative weights of breast, absolute breast meat weight and absolute breast bone weight than frozen one (Table 2). However type of meat did not affect percentage of breast meat and breast bone (P>0.05).

The meat sources significantly ( P <0.05) influenced not only the breast meat weight percentage, but also the breast bone weight and breast bone percentage. The results showed that within frozen carcasses, the A and B sources exhibited similar breast meat percentages, and were significantly (P<0.05) greater than that of source C. The latter group had also significantly smaller values than the different fresh sources.

Características de la pechuga

Las canales frescas presentaron significativamente mayores pesos absolutos y relativos (P<0.05) de pechuga, peso absoluto de carne y absoluto del hueso de la pechuga que las congeladas (Cuadro 2). Sin embargo el tipo de carne no afectó el porcentaje de carne y hueso de la pechuga (P>0.05).

Source B of frozen meat had significantly smaller breastbone weight than another frozen source (C) as well as the different sources of fresh carcasses, showing smaller bone to meat ratio: a desired trait. Source C had an intermediate 328

EVALUACIÓN DE LA CALIDAD DE CARNE DE POLLO

Cuadro 2. Efecto del tipo y origen de carne de pollo en el mercado minorista sobre las características de la carne de la pechuga (Media ± EE)

Table 2. Effect of meat type and different source of frozen and fresh meat in the retail market on breast meat criteria (LSmean ± SE) Parameters Meat type Frozen meat Fresh meat

Source of meat Frozen A Frozen B Frozen C Fresh D Fresh E Fresh F

Statistical analyses Meat type Source of meat

Breast weight (g)

Breast weight (%)

Breast meat weight (g)

192.3± 5.78 242.7± 3.79

38.8±1.14 48.8±0.767

138.2±3.78 179.9±3.16

196.6± 8.1 188.8± 9.9 191.5±12.2 238.9± 8.2 246.9± 6.19 242.2± 5.35

39.5±1.77 38.3±2.01 38.7±2.22 47.7±1.71 49.5±1.00 49.1±1.22

146.7±5.78 138.4±5.79 129.6±7.52 175.1±5.64 180.8±6.20 183.9±4.58

0.001 0.724

0.001 0.093

0.001 0.771

Breast meat weight (%)

Breast bone (g)

Breast bone (%)

72.6±1.26 74.2±0.704

46.9±2.81 58.8±2.59

27.4±1.26 25.8±0.704

75.1±2.22a 74.1±1.76a 68.6±2.29b 73.5±0.989a 73.1±1.41a 75.9±1.17a

44.6±4.30cd 42.7±5.15d 53.7±4.92bc 54.8±5.48b 66.5±4.12a 54.9±3.18b

24.9±2.22b 25.9±1.76b 31.4±2.29a 26.6±0.986b 26.9±1.41b 24.0±1.17b

0.209 0.016

0.003 0.032

a,b,c Differences among means within a column within each factor not sharing similar superscripts are significant (P<0.05), n=15 per source of each type.

Los orígenes de la carne influyeron significativamente ( P<0.05) no sólo en el porcentaje del peso de carne de la pechuga, sino también en el peso y porcentaje del hueso y pechuga. Los resultados mostraron que dentro de las canales congeladas, las de origen A y B exhibieron porcentajes similares de carne de pechuga y fueron mayores (P<0.05) que la de origen C. Este último grupo también tuvo valores significativamente más pequeños que las canales frescas de diferentes orígenes.

0.209 0.016

value that did not differ from most of the other groups except for group E of the fresh carcasses. Within the fresh carcasses, source E had greater bone weight than the other sources. The relative weight of breast bone of frozen source C was significantly greater than that of the other sources of frozen carcass as well as the various sources of fresh meat. Carcasses with a high breast meat yield and high meat to bone ratios display a desired trait for consumers, due to increased meat quality in terms of the breast meat and low bone content. Several factors such as protein, amino acid and genotype have been reported to affect breast meat yield of broiler chickens(21,51).

La carne congelada de origen B tuvo significativamente menor peso de hueso de pechuga que la congelada C, así como de las canales frescas de diferentes orígenes, mostrando menor proporción de carne:hueso, un rasgo deseado. El origen C tuvo un valor intermedio que no difirió de la mayoría de los otros grupos, a excepción del grupo E de las canales frescas. Dentro de las canales frescas, el origen E tuvo un mayor peso de hueso que otros orígenes. El peso relativo del esternón del origen congelado C fue significativamente mayor que el de los otros orígenes de canal congelada, así como los diversos orígenes de carne fresca. Canales con mayor rendimiento de carne y alta

Leg meat characteristics

Fresh carcasses had significantly greater leg meat characteristics than frozen carcasses except for the percentage of leg meat (Table 3). Source of carcass had a significant effect on the different characteristics of leg meat. Within frozen carcasses, source C had significantly greater leg weight and percentage than sources A and B. In addition, source F had greater leg percentage than the various sources of frozen 329

Youssef A. Attia, et al. / Rev Mex Cienc Pecu 2016;7(3):321-339

proporción carne:hueso muestran un rasgo deseable para los consumidores. Se ha mencionado que varios factores tales como proteínas, aminoácidos y genotipo afectan el rendimiento de la pechuga(21,51).

carcasses. These trends are contrary to the findings with regards to breast meat characteristics, indicating a reverse relationship between breast meat and leg meat formation. The leg meat percentage of frozen source A was significantly greater than the other frozen sources as well as the different sources of fresh carcasses, which in turn did not show significant differences between them.

Características de la pierna

Las canales frescas tuvieron significativamente mejores características de carne de la pierna que canales congeladas, excepto el porcentaje de carne (Cuadro 3). El origen de la canal tuvo un efecto significativo en las diversas características de la carne de la pierna. Dentro de las canales congeladas, el origen C presentó significativamente mayor peso y porcentaje de la pierna que los orígenes A y B. Además, el origen F tuvo el mayor porcentaje de pierna que los diversos orígenes de canales congeladas. Estas tendencias son contrarias a los resultados en cuanto a características de la pechuga, indicando una relación inversa entre la formación de carne de pechuga y pierna. El porcentaje de carne de pierna de origen congelado A fue significativamente mayor que los otros orígenes congelados, así como los diferentes orígenes

Absolute and relative weights of leg bone were significantly lower for frozen source A than for other sources of both types of carcasses. In addition, frozen source C had significantly smaller leg bone weight than the other sources of fresh carcass. The increase in leg meat of frozen source A concurred with a decrease in leg bone, indicating an increase in the meat to bone ratio: a desired trait. Differences in leg meat could be attributed to: strains, age, and the nutritional regimen(48,51). The carcass weights show weak to moderate positive correlations with: thaw lass (r=0.817; P=0.001); breast weight (r=0.218; P=0.039); breast meat (r=0.237; P=0.025); leg weight

Cuadro 3. Efecto del tipo y origen de carne de pollo en el mercado minorista sobre las características de la carne de la pierna (Media ± EE)

Table 3. Effect of meat type and different source of frozen and fresh meat in the retail market on leg meat parameters (LS mean ± SE) Parameters Meat type Frozen Fresh

Source of meat Frozen A Frozen B Frozen C Fresh D Fresh E Fresh F

Statistical analyses Meat type Source of meat

Leg weight (g)

Leg weight (%)

Leg meat weight (g)

Leg meat weight (%)

Leg bone (g)

Leg bone (%)

166.0±1.98 182.8±1.64

33.5±0.369 36.7±0.289

110.9±1.61 118.3±1.53

66.8±0.729 64.3±0.807

48.0±1.34 59.8±1.60

33.2±0.729 35.2±0.807

159.0±1.79b 163.6±2.97b 175.5±3.85a 183.2±2.53a 182.6±3.36a 182.5±2.79a

31.9±0.410d 33.1±0.434c 35.6±0.644b 36.5±0.498ab 36.6±0.534ab 37.0±0.501a

111.0±2.01 107.0±2.92 114.6±3.15 121.7±2.82 117.8±2.71 115.4±2.29

69.8±1.06a 65.4±1.28b 65.3±1.14b 66.5±1.48b 64.7±1.37b 63.4±1.31b

41.5±1.63d 50.2±3.11c 52.4±2.26bc 57.0±2.89ab 61.4±2.45a 61.1±3.00a

30.2±1.06b 34.6±1.28a 34.7±1.14a 33.5±1.48a 35.3±1.37a 36.6±1.31a

0.001 0.001

0.001 0001

0.002 0.068

0.034 0.012

0.001 0.007

0.034 0.012

abcd Differences among means within a column within each factor not sharing similar superscripts are significant (P<0.05), n=15 per source of each type.

330

EVALUACIÓN DE LA CALIDAD DE CARNE DE POLLO

(r=0.402; P=0.001); and leg meat (r=0.447; P=0.001). Similarly found correlation between the intact upper arms and the skin, bone and muscle to be significant at r=0.60, 0.50 and 0.95, respectively(45). In addition, there was a positive relationship between thaw loss and carcass defects (r=0.433; P=0.003), and a negative relationship between carcass defects and breast weight (r=-0.218; P=0.0388), breast meat (r=-0.305; P=0.003), leg weight (r=-0.259; P=0.0125) and leg meat (r=-0.320; P=0.002). Skin weight similarly showed a slight negative correlation with leg weight (r=-0.279; P=0.007) and leg meat (r=-0.241; P=0.0219). Breast weight had a positive correlation with breast meat (r=0.894; P =0.001); breast bone (r=0.600; P =0.001); leg weight (r=0.452; P=0.001); leg meat (r=0.288; P=0.006); and leg bone (r=0.463; P=0.001). Breast meat showed a similar magnitude of correlation with breast bone, leg meat and bone. A weak positive correlation between breast bone and breast meat (r=0.344; P =0.009), and leg bone (r=0.359; P=0.005) was observed. In addition, leg weight showed a positive, moderate correlation with leg meat (r=0.633; P=0.001) and leg bone (r=0.629; P=0.001).

de canales frescas, que a su vez no mostraron diferencias significativas entre ellas. El peso absoluto y relativo del hueso de la pierna fueron significativamente menores para el origen congelado A que otros orígenes de ambos tipos de canal. Además, la canal congelada de origen C tuvo significativamente menor peso de hueso de pierna que los de otros orígenes de frescos. El aumento en la carne de pierna de origen congelado A coincidió con una disminución de hueso de la pierna, lo que indica un aumento en la proporción carne a hueso. Se podían atribuir a diferencias en la carne de la pierna: las cepas, la edad y el régimen nutricional(48,51).

Los pesos en canal presentaron débiles a moderadas correlaciones positivas con: pérdida a la descongelación(r=0.817; P=0.001); peso de la pechuga (r=0.218; P=0.039); carne de la pechuga (r=0.237; P=0.025); peso de la pierna (r=0.402; P=0.001); y carne de la pierna (r=0.447; P=0.001). Asimismo se encontró correlación importante entre los brazos superiores intactos y la piel, hueso y músculo en r=0.60, 0.50 y 0.95, respectivamente(45). Además, hubo una relación positiva entre la pérdida al descongelado y defectos de la canal (r=0.433; P=0.003) y una relación negativa entre defectos de la canal y el peso de la pechuga (r=-0.218; P =0.0388), carne de pechuga (r=-0.305; P =0.003), peso de la pierna (r=-0259; P=0.0125) y carne de la pierna (r=-0.320; P=0.002). El peso de la piel también mostró una leve correlación negativa con el peso de la pierna (r=-0.279; P=0.007) y carne de la pierna (r=-0.241; P=0.0219). El peso de la pechuga tuvo una correlación positiva con la carne de la pechuga (r=0.894; P=0.001), esternón (r=0.600; P=0.001), peso de la pierna (r=0.452; P =0.001), carne de la pierna (r=0.288; P =0.006) y hueso de la pierna (r=0.463; P=0.001). La carne de la pechuga demostró una magnitud similar de correlación con el esternón, la carne de la pierna y el hueso. Se observó una correlación positiva débil entre el esternón y la carne de la pechuga (r=0.344; P=0.009) y hueso de la pierna (r=0.359; P=0.005). Además, el peso de pierna

Meat physical characteristics

Fresh carcasses had significantly (P<0.05) lower: pH, drip loss, yellowness (Table 4). However their lightness was greater. This indicated that fresh carcasses were of superior quality compared to the frozen meat. Consistent with these results, other study(45) found also a strong relationship between physical appearances and odour of the meat: both criteria were negatively influenced by increasing length of display or storage. The differences in pH and drip loss could be attributed to different glycolysis rates post-mortem, and are in line with those reported by other researchers(52,53). On the other hand, it is reported(47) that frozen storage had no marked influence on pH change and organoleptic attributes such as appearance, flavour, texture and overall palatability, except for juiciness, 331

Youssef A. Attia, et al. / Rev Mex Cienc Pecu 2016;7(3):321-339

Cuadro 4. Efecto del tipo y origen de carne de pollo en el mercado minorista sobre la calidad física de la carne (Media ± EE)

Table 4. Effect of meat type and different source of frozen and fresh meat in the retail market on physical quality of meat (LS mean ± SE) Parameters Meat type Frozen Fresh

Source of meat Frozen A Frozen B Frozen C Fresh D Fresh E Fresh F

Statistical analyses Meat type Source of meat

WRC (cm2/g)

Drip loss (%)

Cooking loss (%)

Lightness (%)

Redness (%)

Yellowness (%)

Myoglobulin (%)

6.46±0.053 6.39±0.044

67.9±2.01 71.2±2.40

8.73±0.809 4.94±0.259

28.5±0.543 29.3±0.494

46.7±0.786 48.0±0.634

9.16±0.239 9.51±0.181

10.85±0.313 9.21±0.169

5.68±0.410 6.23±0.689

6.40±0.086 6.51±0.099 6.48±0.091 6.46±0.090 6.32±0.063 6.39±0.076

71.5±2.92 66.5±4.29 65.7±3.09 71.6±4.62 73.5±4.21 68.6±3.80

9.22±1.06 9.92±1.95 7.06±0.969 4.95±0.305 5.40±0.583 4.48±0.413

27.8±0.584 27.7±0.507 30.2±1.38 29.3±1.09 29.8±0.916 28.9±0.477

48.8±1.31a 45.3±1.39b 46.1±1.37b 48.9±1.17a 46.7±1.03ab 48.2±1.08a

9.96±0.439a 8.72±0.415b 8.79±0.377b 9.92±0.329a 9.49±0.296a 9.13±0.312b

12.58a0.528a 10.91±0.641b 9.05±0.310c 9.47±0.263c 9.21±0.329c 8.95±0.286c

4.99±0.221 5.85±0.872 6.19±0.875 7.98±1.77 4.85±0.746 5.85±0.189

0.299 0.736

0.293 0.715

0.001 0.349

0.282 0.266

0.031 0.008

0.063 0.001

0.001 0.001

0.480 0.191

WRC= Water retention capacity; SE= Standard error.

abc Differences among means within a column within each factor not sharing similar superscripts are significant (P<0.05), n=15 per source of each type. pH= The time escape from

slaughter to pH measurements was within 48 hrs for fresh meat, and it can’t be determined for frozen meat, but the carcasses for frozen meat were within the usage time.

demostró una correlación positiva moderada con la carne de la pierna (r= 0.633; P= 0.001) y hueso de la pierna (r= 0.629; P= 0.001).

however there are very important freezing and thawing techniques(39).

Differences between frozen and fresh carcasses in WRC, cooking loss, redness and myoglobin were not significant (P>0.05). However, the different sources did have a significant (P<0.05) effect on the meat colour. The results demonstrated that within the frozen carcasses, source A had significantly greater lightness, redness and yellowness than sources B and C. There was only a small difference (P<0.05) between sources B and C in terms of yellowness, showing a greater value for B than for C. Within the fresh carcasses, a significant difference (P<0.05) was only shown in redness with source F having a lower value than D and E. Differences in meat colour could be attributed to the genetic origin of the broilers, as well as dietary pigmentation content(38,48). These differences may also reflect differences in carotenoid content and hence antioxidants. In addition, meat colour can be influenced by: the age, sex, and stress of birds; as well as, intramuscular fat, moisture content, pre-slaughter conditions, and several

Características físicas de la carne

Las canales frescas tuvieron significativamente (P<0.05) menor: pH, pérdida por goteo, y amarillez (Cuadro 4). Sin embargo su luminosidad fue mayor. Esto indica que eran canales frescas de calidad superior en comparación con la carne congelada. De acuerdo con estos resultados, otro estudio(45) también encontró una fuerte relación entre la apariencia física y el olor de la carne: ambos criterios fueron influenciados negativamente por el aumento de tiempo de anaquel y almacenamiento. Las diferencias en pH y pérdida por goteo se podían atribuir a las tasas de glicolisis post mortem diferentes, y están en consonancia con los reportados en otras investigaciones (52,53) . Por otra parte, se menciona (47) que el almacenamiento en congelación no tiene ninguna influencia marcada sobre el cambio de pH y características organolépticas como aspecto, sabor, textura y 332

EVALUACIÓN DE LA CALIDAD DE CARNE DE POLLO

processing variables(54,55). Furthermore, amount of pigments such as myoglobin and haemoglobin within the muscles can also affect the meat colour. Pearson correlation coefficient analyses among the dry matter and the different physical characteristics of meat demonstrated a lack of relationship except for pH correlated with dry matter (r=0.605; P=0.001) and weakly with WRC (r=0.428; P=0.001).

palatabilidad general, excepción de jugosidad; sin embargo son muy importantes las técnicas de congelación y descongelación(39).

Las diferencias entre canales frescas y congeladas en CRA, pérdida a la cocción, enrojecimiento y mioglobina no fueron significativas ( P >0.05). Sin embargo, los diferentes orígenes tuvieron un significativo (P<0.05) efecto sobre el color de la carne. Los resultados demostraron que en las canales congeladas, el origen A tenía significativamente mayor ligereza, enrojecimiento y amarillez que las de origen B y C. Hubo solamente una diferencia pequeña (P<0.05) entre las de origen B y C en términos de amarillez, mostrando un mayor valor para B que para C. En las canales frescas, una diferencia significativa (P<0.05) fue demostrada solamente en enrojecimiento, las de origen F tuvieron un valor menor que D y E. Diferencias en el color de la carne se podían atribuir al origen genético de los pollos de engorda, así como el contenido de la pigmentación dietética(38,48). Estas diferencias también pueden reflejar diferencias en el

Nutrient profiles

Fresh carcasses had lower (P<0.05) dry matter and crude protein than the frozen carcasses (Table 5); and also superior juiciness than the frozen meat. Differences in the lipid and ash percentage were not significant (P >0.05). Onibi(45) found that moisture and lipid contents of meat samples were 69.89 and 4.58 % respectively, and they were similar to the values in this report. The meat sources had no significant effect within either frozen or fresh types, in relation to the nutrient profiles of meat. Similar conclusions were cited by several researches(48,52,56), attributing the differences in chemical composition of broiler meat to

Cuadro 5. Efecto del tipo y origen de carne de pollo en el mercado minorista sobre su composición química (Media ± EE) Table 5. Effect of meat type and different source of frozen and fresh meat in the retail market on chemical composition (LS mean ± SE) Parameters Meat type Frozen Fresh

Source of meat Frozen A Frozen B Frozen C Fresh D Fresh E Fresh F

Statistical analyses Meat type Source of meat

n=15 per source of each type.

Dry matter (%)

Crude protein (%)

Lipids (%)

Ash (%)

30.2±0.978 27.6±0.415

19.3±0.108 18.9±0.089

6.55±0.354 5.99±0.154

0.993±0.006 0.990±0.005

30.7±1.30 29.6±1.84 30.2±2.19 26.9±0.21 26.8±0.49 29.0±1.14

19.4±0.158 19.3±0.202 19.2±0.226 18.9±0.156 18.8±0.171 18.9±0.167

6.75±0.617 6.18±0.671 6.70±0.657 5.54±0.817 6.14±0.156 6.31±0.366

1.000±0.011 0.988±0.011 0.990±0.013 0.990±0.007 0.996±0.009 0.984±0.008

0.006 0.925

0.014 0.888

0.181 0.695

0.750 0.823

333

Youssef A. Attia, et al. / Rev Mex Cienc Pecu 2016;7(3):321-339

contenido de carotenoides y antioxidantes. Además, el color de la carne puede verse afectado por la edad, el sexo y el estrés de las aves; así como por grasa intramuscular, humedad, condiciones antes del sacrificio y diversas variables(54,55). Además, la cantidad de pigmentos como la mioglobina y la hemoglobina dentro de los músculos también puede afectar el color de la carne. El análisis del coeficiente de correlación de Pearson entre la materia seca y las diferentes características físicas de la carne demostraron una falta de relación excepto pH con materia seca (r=0.605; P=0.001) y débil con CRA (r=0.428; P=0.001).

genetic origin and nutrition plans(10-12). On the other hand, Santosh et al(46) indicate fresh chicken dressed under different condition reveal marked differences in their physic-chemical and microbiological qualities. These differences among different experimental results could be attributed to genetic factors i.e. stress, age and sex of birds and non-genetic factors such as feeding regimen, housing condition and husbandry practice(12).

Correlation between three (organic compounds) out of four nutrients in meat was significant with moderate to high magnitudes of correlation. The relationship between dry matter and protein (r=0.796; P =0.001) and lipids (r=0.906; P=0.001) were positively significant and high. In addition, the correlation between protein and lipids were positively significant and moderate (r=0.595; P=0.0005). However, ash percentage did not correlate with dry matter, protein or lipids. Hence, dry matter showed a strong relationship with the organic compounds in meat rather than the inorganic compounds. This could be explained by the greater distribution of protein and lipids (96 %) compared to ash (3 %).

Perfiles nutricios

Las canales frescas tuvieron menor materia seca y proteína cruda que las congeladas (P<0.05) (Cuadro 5), y una jugosidad superior que la carne congelada. El porcentaje de lípidos y cenizas fue similar (P>0.05). Onibi(45) reportó contenidos de humedad y lípidos de 69.89 y 4.58 % respectivamente, valores similares a los del presente informe. Los orígenes de la carne no tuvieron efectos significativos dentro de los tipos, ya sea congelado o fresco, en relación con los perfiles de nutrientes. Conclusiones similares fueron citadas por varios investigadores (48,52,56) , atribuyendo las diferencias en la composición química de la carne a la genética y tipo de nutrición(10,12). Por otra parte, Santoshet al(46) indican que el pollo fresco preparado de diversas maneras presenta marcadas diferencias en sus características físicoquímicas y microbiológicas. Estas diferencias entre los diferentes resultados experimentales podrían ser atribuidas a factores genéticos como estrés, la edad y sexo de las aves, y factores no genéticos como la alimentación, régimen alimenticio, instalaciones y prácticas de crianza (12) . La correlación entre tres (compuestos orgánicos) de cuatro nutrientes en la carne fue significativa con moderada a alta magnitud. La relación entre materia seca y proteína (r=0.796; P=0.001) y lípidos (r=0.906; P=0.001) fue positivamente alta y significativa. Además, la correlación entre proteínas y lípidos

Mineral content

Table 6 displays the impacts of the various types and sources of meat on their minerals content (Ca, P, Na, K and Fe). The overall mean of minerals content of meat are in acceptable range reported by USDA in National nutrient data base standard references release 27 for broilers and mature, and those reported by different studies(57-60). However, it should be mentioned that source A of frozen carcasses showed the l owest val ues of min erals, except for phosphorus and iron and can account for the variability in mineral contents of the present samples. Mineral contents in meat were found to be affected by feeding, management practice, slaughter age, storage and handling conditions and instruments used in mineral (59-61) determination . The results showed that K is the predominant element followed by Na, 334

EVALUACIÓN DE LA CALIDAD DE CARNE DE POLLO

Cuadro 6. Efecto del tipo y origen de carne de pollo en el mercado minorista sobre su contenido mineral (mg/100 g base materia seca) (Media ± EE)

Table 6. Effect of meat type and different source of frozen and fresh meat in the retail market on meat mineral contents (mg/100 g as a dry matter basis) (Mean ± SE) Parameters Meat type Frozen Fresh

Source of meat Frozen A Frozen B Frozen C Fresh D Fresh E Fresh F

Statistical analyses Meat type Source of meat

Calcium

Phosphorus

Sodium

Potassium

Iron

29.3±2.74 38.6±2.83

19.6±2.84 12.4±2.95

94.8±2.27 129.3±2.35

199.0±2.53 208.8±2.61

1.09±0.387 1.08±0.401

18.9±4.9c 35.1±4.4b 34.0±4.8b 32.8±4.7b 34.9±4.9b 48.2±4.8a

16.2±5.1 21.3±4.7 21.4±5.2 10.8±5.1 14.1±5.3 12.4±5.1

90.3±4.1d 89.4±3.7d 104.7±4.3c 120.4±4.2b 134.3±4.4a 133.1±4.5a

196.4±4.5c 202.6±4.1bc 198.0±4.7bc 206.8±4.6b 217.1±4.5a 202.4±4.8b

1.02±0.693 1.06±0.621 1.21±0.674 0.73±0.687 1.03±0.694 1.47±0.712

0.005 0.003

0.029 0.798

0.0001 0.001

0.002 0.046

0.927 0.384

abcd Differences among means within a column within each factor not sharing similar superscripts are significant (P<0.05), n=15 per

source of each type.

fue positiva moderada y significativa (r=0.595; P=0.0005). Sin embargo, el porcentaje de ceniza no se correlacionó con materia seca, proteínas o lípidos. Por lo tanto, la materia seca demostró una fuerte relación con los compuestos orgánicos en carne en lugar de los compuestos inorgánicos. Esto podría explicarse por la mayor distribución de proteínas y lípidos (96 %) en comparación con cenizas (3 %).

Ca, P and Fe. Similar findings were reported by other research groups(57-59). These authors reported that the mineral content of broiler meat was affected by dietary vitamin and mineral contents, sex of chickens, dark vs light meat (i.e. breast vs leg), disease status, and age at slaughter.

Fresh meat had significantly (P<0.05) higher Ca, Na, and K than frozen carcasses, but P was lower. On the other hand, iron was not significantly (P<0.05) different among types (frozen vs fresh) and sources of meat. The lower Ca, Na and K measurements in the frozen meat demonstrate the negative effects of freezing, handling and thaw on the cell membranes, causing loss of essential elements and hence reducing the nutritious value of meat. It was found that source F of fresh meat had the greatest levels of Ca while source A of frozen meat had the lowest value. The F and A groups were also different (P<0.05) than the other groups of frozen and fresh meat. In addition, source B and C of the frozen carcasses and D and E of fresh meat had similar Ca concentrations.

Contenido mineral

El Cuadro 6 muestra los impactos de los diferentes tipos y orígenes de carne en su contenido de minerales (Ca, P, Na, K y Fe). La media general del contenido de minerales de carne se encuentra en un rango aceptable reportado por USDA en la Base Nacional de Datos de Nutrientes referencia estándar 27 para pollos de engorda y adultos, así como por los reportados en diferentes estudios(57-60). Sin embargo, debe mencionarse que el origen A de canales congeladas mostró los valores más bajos de minerales, excepto hierro y fósforo, y son responsables de la variabilidad en el contenido mineral de las muestras presentes. Se encontró que el contenido mineral en carne 335

Youssef A. Attia, et al. / Rev Mex Cienc Pecu 2016;7(3):321-339

puede ser afectado por la alimentación, prácticas de manejo, edad de sacrificio, almacenamiento y manipulación de las condiciones y la metodología utilizada en la determinación mineral(59-61). Los resultados mostraron que el K es el elemento predominante, seguido de Na, Ca, P y Fe. Resultados similares se reportaron por otros grupos de investigación(57-59). Estos autores mencionan que el contenido mineral de la carne de pollo se ve afectado por la cantidad de vitaminas y minerales de la dieta, sexo de las aves, coloración de carne oscura vs más clara (es decir, pechuga vs pierna), salud y edad al sacrificio.

There was no significant difference in meat P among different sources of frozen and fresh meat. Differences in Na content was obvious within the frozen meat, showing greater Na in source C than that of the other sources. Within the fresh meat, sources E and F exhibited greater Na content than source D. The potassium content of fresh source E was significantly (P<0.05) greater than that of the other sources. Differences within the frozen meat were not significant (P>0.05), but sources D and F of fresh meat did exhibit significantly greater K content than only source A of the frozen meat. K is an essential element, needed for many body functions(22,60).

La carne fresca presentó mayor Ca, Na y K que canales congeladas (P<0.05), pero P fue menor. Por otra parte, el hierro fue similar (P>0.05) entre tipos (congelado vs fresco) y orígenes de carne. Las cantidades inferiores de Ca, Na y K en la carne congelada demuestran los efectos negativos de la congelación, manejo y descongelación, en las membranas celulares, causando la pérdida de elementos esenciales, y por lo tanto reduciendo el valor nutritivo de la carne. Los mayores niveles de Ca se encontraron en el origen F de carne fresca y el valor más bajo en el origen A de carne congelada. Los grupos F y A fueron también significativamente (P<0.05) diferentes de los otros grupos de carne congelada y fresca. Además, B y C de las canales congeladas y D y E de la carne fresca presentaron concentraciones similares de Ca.

The negative effect of freezing process on nutritive value of meat, in terms of its mineral content (Na, Ca, P and K), may be due to cold shock, which results in damage of the cell membranes and leakage of minerals. It is well known that meat minerals play a significant role in enzymatic processes, influencing muscle pH and hydration of protein. In this regard, elements such as Na, K, Ca and Mg play an important role in maintaining osmotic pressure and the electrolyte balance in the cells and tissues, hence they also play an essential role in regulating the hydration of meat(21,23). Moreover, P found in meat, in the form of phosphates, plays a significant role in maintaining WRC(61,62). In most cases, correlation analyses between the mineral contents of meat showed that correlation between the five minerals was generally absent except for a significant positive moderate correlation between Na and Ca (r=0.575; P=0.003) and K (r=0.449; P=0.011). In addition, a weak, negative correlation was observed between Fe and K (r=-0.479; P=0.015). The correlation between physiochemical characteristics of meat and meat mineral Na, Ca, K, P and Mg was low in most cases(61). Furthermore, it depends on the cut type, such as breast vs leg. In red muscle, an increase in

No hubo diferencias significativas en P entre diferentes orígenes de carne congelada y fresca. Diferencias en el contenido de Na fueron evidentes dentro de la carne congelada, mostrando mayor Na en origen C que el de los otros orígenes. Dentro de las carnes frescas, E y F exhibieron mayor contenido de Na que D. El contenido de potasio de origen fresco E fue mayor (P<0.05) que el de los otros orígenes. Las diferencias dentro de la carne congelada no fueron significativas (P>0.05), pero orígenes D y F de la carne fresca exhibieron mayor contenido de K que sólo el origen A de la carne

336

EVALUACIÓN DE LA CALIDAD DE CARNE DE POLLO

congelada. El K es un elemento esencial, necesario para muchas funciones del cuerpo(22,60).

K is correlated with lower WRC, with a pH of 2, at 15 min and 24 h post-mortem, along with higher cooking loss. They also reported a moderate positive relationship between P content and pH at 15 min, but a moderate negative correlation between P and yellowness.

El efecto negativo del proceso de congelación sobre el valor nutritivo de la carne, en cuanto a su contenido de minerales (Na, Ca, P y K), puede ser debido a un choque frío, que resulta en daño de las membranas celulares y pérdida de minerales. Es bien sabido que los minerales de la carne juegan un papel significativo en los procesos enzimáticos, que influyen en el pH muscular e hidratación de la proteína. En este sentido, elementos como el Na, K, Ca y Mg juegan un papel importante en mantener la presión osmótica y el equilibrio de electrolitos en las células y los tejidos, por lo tanto también juegan un papel esencial en la regulación de la hidratación de la carne(21,23). Por otra parte, el P encontrado en carne, en forma de fosfatos, juega un papel importante en el mantenimiento de la CRA(61,62).

CONCLUSIONS AND IMPLICATIONS

Overall, the quality of broiler meat in the retail market, in Jeddah, Saudi Arabia during AprilJune 2014 was shown has significant values for customer selection to fulfil their recommended daily allowance(63). The difference in meat quality had a potential for boosting the quality of the meat in terms of nutritious worth. This suggests that consumers can enhance their nutrient intake being more careful about their shopping. This variation also demonstrates the necessity for consistent practice of husbandry and production, and implementation of regulations. There is scope for new quality control regulations, based on nutrient contents, in terms of the impact this may have on consumers’ wellbeing.

En la mayoría de los casos, los análisis entre el contenido mineral de la carne, demostraron que la correlación entre los cinco minerales estaba generalmente ausente, excepto una significativa correlación positiva moderada entre Na y el Ca (r=0.575; P=0.003) y K (r=0.449; P=0.011). Además, se observó una correlación débil, negativa entre el Fe y K (r=-0.479; P=0.015). La correlación entre las características fisicoquímicas y minerales (Na, Ca, K, P y Mg) de la carne fue baja en la mayoría de los casos(61); además, depende el tipo de corte, como pechuga y pierna. En el músculo rojo, un aumento en K se correlaciona con CRA inferior, con un pH de 2, a los 15 min y 24 h post mortem, junto con mayor pérdida de cocción. También se ha informado una relación positiva moderada entre el contenido de P y pH a los 15 min, pero una correlación negativa moderada entre la P y amarillamiento.

ACKNOWLEDGMENTS

This work was supported by the Deanship of Scientific Research (DSR), King Abdulaziz University, Jeddah, under grant No 155-313D1435. The authors, therefore, gratefully acknowledge with thanks the DSR technical and financial support. End of english version

para su selección por el cliente y cumplir sus requerimientos diarios recomendados(63). La diferencia en la calidad de la carne presentó un potencial para incrementarla en términos de valor nutritivo. Esto sugiere que los consumidores pueden mejorar su ingesta de

CONCLUSIONES E IMPLICACIONES

En general, la calidad de la carne de pollo en el mercado, en Jeddah, Arabia Saudita, durante abril a junio 2014 mostró valores significativos 337

Youssef A. Attia, et al. / Rev Mex Cienc Pecu 2016;7(3):321-339

nutrientes al tener más cuidado con sus compras. Esta variación también demuestra la necesidad de implementar prácticas consistentes de crianza y producción. Hay margen para nuevas regulaciones de control de calidad, basadas en contenidos de nutrientes, en términos del impacto que esto puede tener sobre el bienestar de los consumidores.

11. Bonoli M, Caboni MF, Rodriguez-Estrada MT, Lercker G. Effect of feeding fat sources on the quality and composition of lipids of precooked ready-to-eat fried chicken patties. Food Chem 2007;101:1327-1337.

12. Grashorn MA. Functionality of poultry meat. J Appl Poult Res 2007;16:99-106. 13. Conchillo A, Ansorena,D, Astiasara´n L. The effect of cooking and storage on the fatty acid profile of chicken breast. Eur J Lipid Sci Technol 2004;106:301-306.

14. Fanatico AC, Pillai PB, Emmert JL, Owens CM. Meat quality of slow- and fast-growing chicken genotypes fed low-nutrient or standard diets and raised indoors or with outdoor access. Poult Sci 2007;86:2245-2255.

15. Javanmard M, Rokni N, Bokaie S, Shahhosseini G. Effects of gamma irradiation and frozen storage on microbial, chemical and sensory quality of chicken meat in Iran. Food Control 2006;17:469-473.

AGRADECIMIENTOS

Este trabajo fue apoyado por el Deanship of Scientific Research (DSR), King Abdulaziz University, Jeddah, subvención 155-313-D1435.

16. Bianchi M, Petracci M, Sirri F, Folegatti E, Franchini A, Meluzzi A. The influence of the season and market class of broiler chickens on breast meat quality traits. Poult Sci 2007;86:959963. 17. Ristic M. Influence of breed and weight class on the carcass value of broilers. Eur Symp Quality Poultry Meat. Doorwerth, The Netherlands. 2005:23-26.

LITERATURA CITADA 1.

2. 3. 4. 5. 6.

18. Holcman A, Vadnjal R, Žledner B, Stibilj V. Chemical composition of chicken meat from free range and extensive indoor rearing. Arch Geflügelk 2003;67:120-124.

Woolverton AE, Frimpong S. Consumer demand for domestic and imported broiler meat in urban Ghana: Bringing nonprice effects into the equation. Br J Mark Studies 2013;1:1631.

19. Bogosavljeviæ BS, Kurcubic V, Petrovic DM, Radovic V. The effect of sex and rearing system on carcass composition and cut yields of broiler chickens. Czech J Anim Sci 2006;51:31-38.

World Health Organization (WHO). Report of a joint WHO/ FAO/UNU expert consultation. Protein and amino acid requirements in human nutrition. Geneva, Switzerland. 2007.

20. Bogosavljeviæ BS, Pavlovski Z, Petrovic DM, Doskovic V, Rakonjac S. The effect of rearing system and length of fattening period on selected parameters of broiler meat quality. Arch Geflügelk 2011;75:158-163.

Bogosavljeviæ BS, Pavlovski Z, Petrovi MD, Doskovi V, Rakonjac S. Broiler meat quality: Proteins and lipids of muscle tissue. African J Biotechnol 2010;9:9177-9182.

21. Attia YA, El-Tahawy WS, Abd El-Hamid AE, Nizza A, AHarthi MA, El-Kelway MI, Bovera F. Effect of feed form, pellet diameter and enzymes supplementation on carcass characteristics, meat quality, blood plasma constituents and stress indicators of broilers. Archiv Tierzucht 2014;57:1-14.

Bokkers EAM, Koene P. Behaviour of fast- and slow growing broilers to 12 weeks of age and the physical consequences. Appl Anim Behav Sci 2003;81:59-72.

Grashorn MA, Clostermann G. Mast- und Schlachtleistung von Broilerherkünften für die Extensivmast. Arch. Geflügelk 2002;66:173-181.

22. National Research Council, NRC. Nutrient Requirements of Poultry. 9th Rev. Ed. Washington, DC, USA: National Academy Press; 1994.

Bogosavljeviæ BS, Gajic Z, Mitrovic S, Djokovic R. Meat quality parameters selected in yield of carcasses and parts of broilers from two non-industrial rearing systems. Proc Int Cong Meat Sci Technol 2003:41-42.

23. Hashish SM, Abdel-Samee LD, Abdel-Wahhab MA. Mineral and heavy metals content in eggs of local hens at different geographic areas in Egypt. Global Vet 2012;8:298-304.

Le Bihan-Duval E. Debut M, Berri MC, Sellier N, SantéLhoutellier V, Jégo Y, Beaumont C. Chicken meat quality: genetic variability and relationship with growth and muscle characteristics. BMC Genetics 2008;9:53.

24. Surai PF. Reviews: Selenium in poultry nutrition 2. Reproduction, egg and meat quality and practical applications. World’s Poult Sci J 2002;58:431-450.

Hellmeister F, Machadomenten JF, Neves Da Silva MA, Coelho AAD, Savino VJM. Efeito de Genótipo e do Sistema de Criacâo sobre o Desempenho de frangos Tipo Caipira. R Bras Zootec 2003;32:1883-1889.

25. Tolimir N, Pavlovski Z, Koljajic V, Mitrovic S, Anokic V. The effect of different sources and chromium level in ration on broiler breast musculature. Biotechnol Anim Husb 2005;21:153-158.

Tang H, Gong YZ, Wu CX, Jiang J, Wang Y, Li K. Variation of meat quality traits among five genotypes of chicken. Poult Sci 2009;88:2212-2218.

26. Hamm R. Biochemistry of meat hydration advances in food research. Cleverland 1960;10:335-443.

27. Garcia RG, Freitas LW de, Schwingel AW, Farias RM, Caldara FR, Gabriel AMA, et al. Incidence and physical properties of PSE chicken meat in a commercial processing plant. Rev Bras Cienc Avic 2010;12:215-219.

10. Andersen Henrik J, Oksbjerg Niels, Young Jette F, Therkildsen Margrethe. Review. Feeding and meat quality – a future approach. Meat Sci 2005;70:543-544.

338

EVALUACIÓN DE LA CALIDAD DE CARNE DE POLLO 28. Aitken A, Casey JC, Penny IF, Volys CA. Effect of during temperature in the accelerated freezes drying of pork. J Sci Food Agric 1962;13:439-442.

during frozen storage. Explor Amin Med Res 2014;4:95100.

47. Santosh KHT, Pal UK, Rao VK, Das CD, Mandal PK. Effects of processing practices on the physico-chemical, microbiological and sensory quality of fresh chicken meat. Int J Meat Sci 2012;2:1-6.

29. Combes S, Gonzalez I, Dejean S, Baccini A, Jehl N, Juin H, et al. Relationships between sensory and physicochemical measurements in meat of rabbit from three different breeding systems using canonical correlation analysis. Meat Sci 2008;80:835-841.

48. Wattanachant S. Factors affecting the quality characteristics of Thai indigenous chicken meat. Suranaree J Sci Technol 2008;15:317-322.

30. Chaijan M, Benjakul S, Visessanguan W, Faustman C. Characteristics and gel properties of muscles from sardine (Sardinella gibbosa) and mackerel (Rastrelliger kanagurta) caught in Thailand. Food Res Int 2004;37:1021-1030.

49. Fouad AM, El-Senousey HK. Nutritional factors affecting abdominal fat deposition in poultry: A review. Asian Austral J Anim Sci 2014;27:1057-1068.

31. Honikel KO. Influence of chilling on meat quality attributes of fast glycolysing pork muscles. In: Tarrant PV, Eikelenboom G, Monin G, editors. Evaluation and control of meat quality in pigs. Dordrecht: Martinius Nijhoff; 1987:273-283.

50. Tumova E, Teimouri A. Fat deposition in the broiler chicken: a review. Scientia Agric Bohemica 2010;41:121-128.

51. Moran ET Jr. Quality of poultry meat as affected by genetic and management factors. Eur Symp Poultry Meat Quality. Poznañ. 1997:31-36.

32. Kauffman RG, Eikelenboom G, Merkus SM, Zaar M. The use of filter paper to estimate drip loss of porcine musculature. Meat Sci 1986;18:191-200.

52. Sza kowska H, Meller Z. The influence of age and genotype on the quality and technological suitability of meat from chicken broilers. Eur Symp Quality Poultry Meat. Poznañ. 1997:108-112.

33. Association of official analytical chemists AOAC. Official Methods of Analysis of the Association of Official Analytical Chemists, 18th ed. Washington DC. USA. 2004.

53. Richardson RI. Some factors affecting poultry meat quality. Proc British Soc Anim Sci. Kraków. 2004:22-25.

34. Olajire A, Ayodele ET. Contamination of roadside soil and grass with heavy metals. Environ Inter 1997;23:91-101.

54. Galván SS, Rosales SG, Alarcón-Rojo AD, Angeles AL, Piña E, Shimada MA, Izaguirre MO. Effect of alpha-lipoic acid on productive parameters and carcass quality in broiler chickens. Rev Mex Cienc Pecu 2015;6:207-219.

35. Haraguchi H, Fuwa, K. Determination of phosphorus by molecular absorption flame spectrometry using the phosphorus monoxide band. Anal Chem 1976;48:784-786. 36. SAS, Institute. User’s guide. version 9.2 2nd ed. SAS institute Inc. Cary NC. USA. 2009.

55. Northcutt JK. 2009. Factors affecting poultry meat quality. University’s Bulletin 1157. http://pubs.caes.uga.edu/ caespubs/pubcd/B1157/B1157.htm. Accessed March 30, 2015.

37. Steel RGD, Torrie JH. Principles and procedures of statistics, 2nd ed, New York: McGraw-Hill; 1980.

56. Gornowicz E, Lewko L, Pietrzak M, Gornowicz J. The effect of broiler chicken origin on carcas and muscle yield and quality. J Cent Eur Agric 1997;10:193-200.

38. Groom GM. Factors affecting poultry meat quality. In: Sauveur B. editor. L’aviculture en Méditerranée. Montpellier: CIHEAM, 1990:205-210.

57. Essary EO. Moisture, fat, protein and mineral content of mechanically deboned poultry meat. J Food Sci 1979;44:1070-1073.

39. Adzitey F. Effect of pre-slaughter animal handling on carcass & meat quality. Int Food Res J 2011;18:484-490.

40. Akhtar S, Khan MI, Faiz F. Effect of thawing on frozen meat quality: A comprehensive review. Pak J Food Sci 2013;23:198-211.

58. Ogunmola OO, Taiwo OF, Ayankoso AS. The nutritive value of the meat quality of locally breed chicken, exotic chicken and turkey. IOSR J Applied Chem 2013;3:46-50.

41. Fellows, P. Food processing technology –Principles and practice. 2nd ed. Chichester, UK: Ellis Horwood; 2000:369380.

59. Ozturk E, Coskun I, Ocak N, Erener G, Dervisoglu M, Turhan S. Performance, meat quality, meat mineral contents and caecal microbial population response to humic substance administrated in drinking water in broilers. Br Poult Sci 2014;55:668-674.

42. Faustman C, Cassens RG, Schaefer D, Buege DR, Scheller KK. Vitamin E supplementation of Holstein steer diet improves sirloin steak color. J Food Sci 1989;54:485-486.

60. Zapata JFF, Moreira RS dos R, Origenes, M de FF, Sampaio EM, Morgano M. Meat mineral content in broilers fed diets without mineral and vitamin supplements. Pesquisa Agrop Brasileira 1998;33:1815-1820.

43. Tougan PU, Dahouda M, Salifou CFA, Ahounou SGA, Kpodekon MT, Mensah GA, et al. Conversion of chicken muscle to meat and factors affecting chicken meat quality: a review. Inter J Agr Agric Res 2013;3:1-20.

61. Poltowiez K, Doktor J. Macro mineral concentrations and technological properties of poultry meat depending on slaughter age of broiler chickens of uniform body weight. Anim Sci papers and reports 2013;31:249-259.

44. Joseph JK. Quality attributes of selected Nigerian meat types as influenced by frozen storage and film packaging. Proc Conf Anim Sci of Nigeria. Lagos Airport Hotel, Ikeja, Lagos 1998:230-233.

62. Grabowski T, Kijowski J. Miêso i przetwory drobiowe. Technologia, higiena, jakoœæ. In Polish. WNT. Warszawa. 2004.

45. Onibi GE. The effect of open -market retail conditions in Nigeria on oxidative deterioration of imported frozen upper arms (Brachium) of Turkeys. Int J Poult Sci 2003;2:454458.

63. Dietary reference intakes for energy, carbohydrate, fiber, fat, fatty acids cholesterol, protein and amino acids RDA 2002/2005. Office of dietary supplements -National Institute of health. USA. Gov.www.nap.edu., assayed 20.10.2012.

46. Santosh KHT, Pal UK, Mandal PK, Das CD. Changes in the quality of dressed chickens obtained from different sources

339

DESARROLLO DEL EJE REPRODUCTIVO ENDOCRINO EN CORDEROS Rev Mex Cienc DE PELO Pecu 2016;7(3):341-360

Desarrollo del eje reproductivo endocrino en corderos de pelo

Development of the endocrine reproductive axis in hair breed ram lambs Luis Javier Montiel-Olguínab, Héctor Raymundo Vera-Ávilaab, Eugenio VillagómezAmezcuabc, Vicente Castañeda-Rodrígueza, Mario Cárdenas-Leónd, Héctor Jiménez-Severianoab

RESUMEN

Los objetivos fueron caracterizar los perfiles de LH y testosterona (T) y la respuesta a GnRH en corderos de pelo. Estudio 1: se utilizaron corderos Blackbelly (n=4), Pelibuey (n=5), Blackbelly x Pelibuey (Cruzas; n=8). A las 2, 4, 8, 12, 16, 20 y 24 semanas de edad, se obtuvieron muestras de sangre cada 15 min durante 6 h, para caracterizar los perfiles de LH y T. No hubo diferencia entre genotipos a ninguna edad, para ninguna variable de LH y T (P>0.05); el efecto de la edad fue significativo (P<0.05): la concentración promedio de LH fue menor en la semana 2 (P<0.05), alcanzó el valor más alto en la 12, y disminuyó en la 16 (P<0.05). La concentración promedio de T aumentó constantemente entre 2 y 24 semanas (P<0.05). Estudio 2: se utilizaron corderos Blackbelly (n=4), Pelibuey (n=4), Cruzas (n=4). A las mismas edades, los corderos se desafiaron con GnRH (3, 9, 27 ng•kg-1 peso) y se obtuvieron muestras de sangre entre -15 y 180 min. En las semanas 8 y 12, la respuesta de LH fue mayor en los corderos Pelibuey, en comparación con Blackbelly. La respuesta de T tendió a ser diferente entre genotipos (P<0.10), con Blackbelly mostrando la menor respuesta. En conclusión, el desarrollo de los perfiles de LH y T no fue diferente entre genotipos, pero los corderos Pelibuey presentaron mayor capacidad de respuesta a GnRH en las semanas 8 y 12; es necesario determinar si estas diferencias tienen implicaciones sobre la capacidad reproductiva de los animales adultos. PALABRAS CLAVE: Blackbelly, Pelibuey, LH, Testosterona, Desarrollo sexual.

ABSTRACT

The objectives were to characterize the profiles of LH and testosterone (T) and the response to GnRH administration in hair ram lambs. Study 1: seventeen lambs were used: Blackbelly (n=4), Pelibuey (n=5), Blackbelly x Pelibuey (Crossbred; n=8). At 2, 4, 8, 12, 16, 20 and 24 wk of age, blood samples were collected every 15 min for 6 h, to characterize LH and T profiles. There was no significant difference between genotypes at any age, for any variable of LH and T profiles (P>0.05). The effect of age was significant (P<0.05): mean LH concentration was lower on wk 2 (P<0.05), achieved the highest value on wk 12, and decreased on wk 16 (P<0.05). Mean T concentration increased steadily between wk 2 and 24 (P<0.05). Study 2: twelve lambs were used: Blackbelly (n=4), Pelibuey (n=4), Crossbred (n=4). At the same ages, lambs were challenged with GnRH (3, 9, 27 ng•kg-1 BW) and blood samples were obtained between -15 and 180 min from GnRH administration. On wk 8 and 12, LH response to GnRH was greater in Pelibuey, as compared with Blackbelly. Testosterone response tended to be different between genotypes (P<0.10), with Blackbelly showing the smallest response. In conclusion, the sexual endocrine development, as evaluated by the non-stimulated LH and T profiles, was not different among genotypes; however, Pelibuey elicited the greatest responsiveness to GnRH administration at 8 and 12 wk of age. Whether or not such differences have implications on the reproductive capacity of the adult animals deserves additional research. KEY WORDS: Blackbelly, Pelibuey, LH, Testosterone, Sexual development. Recibido el 20 de abril de 2015. Aceptado el 20 de julio de 2015. a

b c

Centro Nacional de Investigación Disciplinaria en Fisiología y Mejoramiento Animal, INIFAP. Ajuchitlán, Querétaro, México. jimenez.hector@inifap.gob.mx. Correspondencia al sexto autor. Posgrado en Ciencias de la Producción y de la Salud Animal, FES Cuautitlán, UNAM. Cuautitlán Izcalli, Estado de México, México. Centro Nacional de Investigación Disciplinaria en Microbiología Animal, INIFAP. Cuajimalpa, DF, México. Instituto Nacional de Ciencias Médicas y Nutrición Salvador Zubirán. Tlalpan, DF, México.

341

Luis Javier Montiel-Olguín, et al. / Rev Mex Cienc Pecu 2016;7(3):341-360

INTRODUCCIÓN

INTRODUCTION

En los corderos Blackbelly se observa un aumento temprano de las concentraciones séricas de la hormona luteinizante (LH) a las 6 semanas de edad, y aumento de la testosterona (T) en las semanas 12 y 21(14); sin embargo, esta información se basó en muestras individuales; debido a la naturaleza pulsátil de la secreción de LH y T, es necesario obtener muestras con mayor frecuencia para caracterizar con precisión los perfiles hormonales y la sensibilidad del eje hipófisis-testículo. Adicionalmente, al parecer no se ha hecho una comparación directa del desarrollo endocrino entre corderos Blackbelly y Pelibuey; por lo tanto, el objetivo del estudio fue caracterizar el desarrollo del eje reproductivo endocrino en corderos Blackbelly, Pelibuey y Blackbelly x Pelibuey (cruzas). La hipótesis fue que el eje endocrino se desarrollaría más temprano en los

In Blackbelly male lambs, an early increase in serum LH was observed at 6 wk of age, with testosterone (T) increasing at wk 12 and 21(14); however, this information was based on single samples taken just before castration; because of the pulsatile nature of LH and T secretion, a more frequent blood sampling is necessary to characterize accurately the hormonal profiles and sensitivity of the hypophysis-testis axis. Furthermore, to our knowledge, comparison, in terms of endocrine development, between Blackbelly and Pelibuey males have not been made; therefore, the objective of this study was to characterize the development of the endocrine reproductive axis in Blackbelly, Pelibuey and Blackbelly x Pelibuey ram lambs. The hypothesis was that the endocrine axis will develop earlier in Blackbelly, as compared with Pelibuey lambs, with crossbred lambs being intermediate.

The sexual endocrine development has been studied in lambs of wool breeds(1,2), whereas in tropical hair sheep this information is scarce. From studies in wool breeds, several aspects have been described. It is known that there is an active endocrine axis in the new born lambs(3), which develops as the ram grows(1); the anatomical and histological changes during the prepubertal development are associated to endocrine changes (4) . The age at sexual maturation differs among breeds, some breeds being more precocious than others, and precocity is related to breed fertility and prolificacy in the adult ewe(5). Barbados Blackbelly (hereafter just Blackbelly) and Pelibuey are important hair breeds ( Ovis aries ) developed in tropical latitudes and, therefore, well adapted to tropical conditions. Blackbelly is considered one of the most prolific hair breeds(6); previous studies have shown that Blackbelly ewes are more prolific than Pelibuey ewes(7,8), but litter size in Pelibuey is greater than in other breeds raised in the tropics(9). Some controversy still exists as to whether Blackbelly is more precocious than Pelibuey(10-13).

El desarrollo endocrino sexual ha sido estudiado en corderos de razas de lana(1,2), mientras que en razas tropicales de pelo esta información es escasa. A partir de estudios con razas de lana, se han descrito varios aspectos. Se sabe que hay un eje endocrino activo en los corderos recién nacidos(3), que se desarrolla a medida que crecen (1) ; los cambios anatómicos e histológicos durante el desarrollo prepuberal se asocian a cambios endocrinos(4); la edad a la maduración sexual difiere entre razas, siendo algunas más precoces que otras, y la precocidad se relaciona con la fertilidad y prolificidad de los adultos(5). Barbados Blackbelly (en adelante simplemente Blackbelly) y Pelibuey son razas de pelo importantes (Ovis aries), desarrolladas en latitudes tropicales y, por lo tanto, bien adaptadas a estas condiciones. Blackbelly es considerada una de las razas de pelo más prolíficas(6); más prolífica que la Pelibuey(7,8), pero el tamaño de camada en esta última es mayor que en otras razas tropicales(9); por otro lado, hay controversia en cuanto a si Blackbelly es más precoz que Pelibuey(10-13).

342

DESARROLLO DEL EJE REPRODUCTIVO ENDOCRINO EN CORDEROS DE PELO

corderos Blackbelly que en los Pelibuey, siendo intermedios los corderos cruzados.

MATERIAL AND METHODS

Two studies were conducted using hair ram lambs: Blackbelly, Pelibuey and Blackbelly x Pelibuey (Crossbred). In the first study, the development of the circulating profiles of LH and T were evaluated by means of serial blood samplings. In the second study, graded doses of GnRH were administered to evaluate the development of the response, in terms of LH and T secretion.

MATERIAL Y MÉTODOS

Se realizaron dos estudios utilizando corderos Blackbelly, Pelibuey y Cruzas. En el primer estudio, se evaluó el desarrollo de los perfiles de LH y T circulantes por medio de muestreos sanguíneos seriados. En el segundo estudio, se administraron dosis crecientes de la hormona liberadora de gonadotropinas (GnRH) para evaluar el desarrollo de la respuesta, en términos de la secreción de LH y T.

General conditions

The studies were carried out in the state of Querétaro, México (20º 42’ N; 100º 01’ W). The experimental protocols and procedures were approved by the Institutional Subcommittee for Caring and Use of Animals for Experimentation (SICUAE), College of Veterinary Medicine and Animal Husbandry, National Autonomous University of Mexico, and according to the “International Guiding Principles for Biomedical Research Involving Animals” (http:// w w w. c i o m s . c h / i m a g e s / s t o r i e s / C I O M S / IGP2012.pdf). Ram lambs were born between March 2 and 29 (Study 1) or between October 29 and November 14 (Study 2). Before weaning (70 d of age), lambs were creep fed a diet containing 16.9 % CP and 2.74 Mcal ME/kg DM, and ewes were fed a diet containing 13.04 % CP and 2.33 Mcal ME/kg DM. After weaning, lambs were offered a diet with 14.05 % CP and 2.65 Mcal ME/kg DM, and water ad libitum. One day before each lamb reached 2, 4, 8, 12, 16, 20 and 24 wk of age, body weight (BW) was recorded, scrotal circumference (SC) was measured as described previously(15), and lambs were fitted with indwelling jugular catheters. At that time and at the end of samplings, lambs were administered vitamin B complex (thiamin 0.15 g, riboflavin 0.2 g, nicotinamide 0.3 g, pyridoxine 0.2 g, cyanocobalamin 90 µg and D-panthenol 0.15 g), to prevent anemia, and a long-acting oxytetracycline solution (20 mg•kg-1 BW) in a prophylactic manner, as the catheter remained in the vein for at least one day.

Condiciones generales

Los estudios se realizaron en el estado de Querétaro, México (20º 42' N; 100º 01' O). Los protocolos y procedimientos experimentales fueron aprobados por el Subcomité Institucional para el Cuidado y Uso de Animales de Experimentación (SICUAE), de la Facultad de Medicina Veterinaria y Zootecnia de la Universidad Nacional Autónoma de México, y de acuerdo con la “International Guiding Principles for Biomedical Research Involving Animals” (http://www.cioms.ch/images/stories/ CIOMS/IGP2012.pdf). Los corderos nacieron entre el 2 y 29 de marzo (estudio 1) o entre el 29 de octubre y 14 de noviembre (estudio 2). Antes del destete (70 días de edad), los corderos se alimentaron con una dieta que contenía 16.9 % PC y 2.74 Mcal EM/kg MS, y las ovejas con una dieta con 13.04 % PC y 2.33 Mcal EM/kg MS. Después del destete, a los corderos se les ofreció una dieta con 14.05 % de PC y 2.65 Mcal EM/kg MS, y agua ad libitum. Un día antes de que cada cordero cumpliera 2, 4, 8, 12, 16, 20 y 24 semanas de edad, se registró el peso corporal, se midió la circunferencia escrotal (CE), como se ha descrito previamente(15), y a cada cordero se le colocó un catéter en la vena yugular. En ese momento y al final de los muestreos, los corderos recibieron complejo B (0.15 g de tiamina, 0.2 g de riboflavina, 0.3 g de nicotinamida, 0.2 g de piridoxina, 90 µg de cianocobalamina y 0.15 g 343

Luis Javier Montiel-Olguín, et al. / Rev Mex Cienc Pecu 2016;7(3):341-360

de D-pantenol) para prevenir anemia, y en forma profiláctica, una solución de oxitetraciclina de acción prolongada (20 mg•kg-1), ya que el catéter se mantuvo en la vena durante al menos un día.

Study 1. Development of LH and testosterone profiles Ram lambs were allotted in three homogeneous genotype groups, based on birth weight, type of birth and age of the mother: Blackbelly (n=4), Pelibuey (n=5) and Crossbred (n=8). At 2, 4, 8, 12, 16, 20 and 24 wk of age, blood samples were collected every 15 min, during 6 h (0700 to 1300 h), and centrifuged at 720 xg for 15 min at 4 ºC; plasma was obtained and kept frozen at -20 ºC until assayed. The profile variables evaluated for LH and T were mean and basal concentrations (ng•ml-1), frequency (pulses•6h-1), amplitude and height of the pulses (ng•ml-1). Pulse detection was performed using computer algorithms(16) (Pulsar software, modified for IBM-PC by JF Gitzen and VD Ramirez, Urbana, IL). G(n)-values (G(n): cutoff parameters to determine if one point value or a series of consecutive values belong to a pulse-(16)), for LH were G(1)=10.0, G(2)=2.6, G(3)=1.9, G(4)=1.5 and G(5)=1.1; for T were G(1)=3.8, G(2)=2.6, G(3)=1.9, G(4)=1.5 and G(5)=1.1. The standard deviation of the assays used in the algorithm was modeled as a quadratic function of the dose for each hormone.

Estudio 1. Desarrollo de los perfiles de LH y testosterona

Los corderos se distribuyeron en tres grupos de acuerdo al genotipo, homogéneos con base en el peso al nacimiento, tipo de parto y edad de la madre: Blackbelly (n=4), Pelibuey (n=5); Cruzas (n=8). A las 2, 4, 8, 12, 16, 20 y 24 semanas de edad, se obtuvieron muestras de sangre cada 15 min, durante 6 h (0700 a 1300 h), y se centrifugaron a 720 xg durante 15 min a 4 ºC; se obtuvo el plasma y se mantuvo congelado a -20 ºC hasta su análisis. Las variables evaluadas de los perfiles de LH y T fueron las concentraciones promedio y basal (ng•ml -1 ), la frecuencia (pulsos•6 h -1 ), la amplitud y la altura de los pulsos (ng•ml-1). La detección de los pulsos se realizó utilizando algoritmos computarizados(16) (software Pulsar, modificado para IBM-PC por JF Gitzen y VD Ramírez, Urbana, IL). Los valores G(n) (G(n) parámetros de corte para determinar si un valor o una serie de valores consecutivos pertenece a un pulso-(16)), utilizados para la LH fueron: G(1)=10.0, G(2)=2.6, G(3)=1.9, G(4)=1.5 y G(5)=1.1; mientras que para T fueron: G(1)=3.8, G(2)=2.6, G(3)=1.9, G(4)=1.5 y G(5)=1.1. La desviación estándar de los ensayos utilizados en el algoritmo fue modelada como una función cuadrática de la dosis para cada hormona.

Study 2. Development of LH and testosterone response to GnRH administration

Experimental plan, GnRH administration and blood sample collection . Ram lambs were

allotted in three homogeneous genotype groups, based on birth weight, type of birth and age of the mother: Blackbelly (n=4), Pelibuey (n=4) and Crossbred (n=4). The acetate salt of the natural sequence of GnRH was used (Sigma Chemical Co., St Louis, MO.). At the same ages as in the study 1, animals were challenged in consecutive days with graded doses of GnRH: 3, 9 and 27 ng•kg-1 BW, via i.v. (small, medium and large dose, respectively), starting with the small dose at each age. The small dose was established based on a previous study with adult rams, where it was calculated that the administration of 3 ng•kg-1 generated LH pulses with characteristics similar to non-induced pulses(17); therefore, it was initially considered

Estudio 2. Desarrollo de la respuesta de LH y testosterona a la administración de GnRH

Plan experimental, administración de GnRH y obtención de muestras de sangre. Los corderos

se distribuyeron en tres grupos de acuerdo al genotipo, homogéneos con base en el peso al nacimiento, tipo de parto y edad de la madre: Blackbelly (n=4), Pelibuey (n=4); Cruzas (n=4). Se utilizó la sal de acetato de la secuencia natural de GnRH (Sigma Chemical Co., St Louis, 344

DESARROLLO DEL EJE REPRODUCTIVO ENDOCRINO EN CORDEROS DE PELO

MO.). En las mismas edades como en el estudio 1, los animales se desafiaron en días consecutivos con dosis crecientes de GnRH: 3, 9 y 27 ng•kg-1, vía i.v. (dosis baja, media y alta, respectivamente), comenzando con la dosis baja en cada edad. La dosis baja se estableció con base en un estudio previo con machos adultos, donde se calculó que la administración de 3 ng•kg-1 generaba pulsos de LH con características similares a los pulsos no inducidos(17); por lo tanto, inicialmente se consideró como la dosis fisiológica. Se obtuvieron muestras de sangre a -15, 0, 15, 30, 60, 120 y 180 min de la administración de GnRH (0700 a 1015 h), y se procesaron como se explicó para el Estudio 1.

as the physiological dose. Blood samples were collected at -15, 0, 15, 30, 60, 120 and 180 min from GnRH administration (0700 to 1015 h), and processed as explained for study 1.

Analysis of the hormonal response to GnRH administration. The variables of LH and T

response to GnRH administration were the following: peak height (the highest hormone concentration subsequent to GnRH administration); area under the curve of response (AUC), which was calculated using the trapezoid rule from the initial concentration (average of the -15 and 0 min samples) until 3 h after GnRH administration; magnitude of the response (LH and T), calculated by subtracting the average initial concentration from the peak height, and using the initial concentration as a covariable for each hormone.

Análisis de la respuesta hormonal a la administración de GnRH . Las variables de

respuesta de LH y T a la administración de GnRH fueron las siguientes: la altura del pico (concentración máxima de la hormonas después de la administración de GnRH); el área bajo la curva de respuesta (AUC), la cual se calculó usando la regla trapezoidal a partir de la concentración inicial (promedio de las muestras de -15 y 0 min) hasta 3 h después de la administración de GnRH; la magnitud de la respuesta (DLH y DT), se calculó restando la concentración inicial a la altura del pico, y usando la concentración inicial como covariable para cada hormona.

Hormone analysis

LH concentrations were determined by a double antibody RIA(18), sensitivity was 95 pg•ml-1, the intra- and inter-assay CV were 8.6 and 9.5 %, and 14.2 and 7 % for studies 1 and 2, respectively. Testosterone concentrations were determined by a solid phase RIA (Coat-ACount®, Siemens Medical Solutions Diagnostic; Los Angeles CA, USA); sensitivity was 40 pg•ml-1 ; the intra- and inter-assay CV were 4.9 and 7.1 %, and 5 and 5.9 % for studies 1 and 2, respectively. Statistical analyses

Análisis hormonal

Hormone data were analyzed as a completely randomized design, using the procedure MIXED of SAS (SAS Institute Inc. Cary NC, USA) for repeated measures, with the statement “repeated”, the option sub=animal (genotype) and the autoregressive (1) covariance structure within animal. Genotype, age (and dose in study 2) and the corresponding interactions were included in the model. The endocrine variables were transformed to Log n (Y+1), so the assumptions of the analysis of variance were valid; after analysis, data were transformed back to actual values for tables and figures. Data of

Las concentraciones de LH se determinaron mediante un RIA de doble anticuerpo(18), la sensibilidad fue de 95 pg•ml-1, los CV intra e inter-ensayo fueron 8.6 y 9.5 %, y 14.2 y 7 %, para los estudios 1 y 2, respectivamente. Las concentraciones de testosterona se determinaron mediante un RIA de fase sólida (Coat-A-Count®, Siemens Medical Solutions Diagnostic; Los Angeles CA, EE.UU.), la sensibilidad fue de 40 pg•ml-1, los CV intra e inter-ensayo fueron 4.9 y 7.1 %, y 5 y 5.9 %, para los estudios 1 y 2, respectivamente. 345

Luis Javier Montiel-Olguín, et al. / Rev Mex Cienc Pecu 2016;7(3):341-360

BW and SC were pooled across studies before the analysis, and each study was included in the model as a block. Differences were considered significant with P<0.05, and tended to be significant with P values between 0.05 and 0.1.

Análisis estadístico

Los datos hormonales se analizaron como un diseño completamente al azar, utilizando el procedimiento MIXED de SAS (SAS Institute Inc. Cary NC, EE.UU.) para mediciones repetidas, con el comando “repeated”, la opción sub= animal (genotipo) y la estructura de la covarianza dentro de animal auto regresiva (1). El genotipo, la edad (y la dosis en el estudio 2) y las interacciones correspondientes se incluyeron en el modelo. Las variables endocrinas fueron transformadas al Logn (Y+1), para cumplir con los supuestos del análisis de varianza; después del análisis, los datos se transformaron a los valores reales para los cuadros y figuras. Los datos de peso y CE de los dos estudios se combinaron antes del análisis, y cada estudio se incluyó en el modelo como bloque. Se consideraron diferencias significativas con valores de P<0.05 y tendencia a ser significativas con valores de P entre 0.05 y 0.1.

RESULTS

Development of LH profiles

The effect of genotype and genotype by age interaction were not significant for any of the variables of LH profiles, whilst the effect of age was significant for all variables (Table 1). The smallest mean concentration was observed on wk 2, an elevation was detected on wk 4 ( P <0.05); then, there was a progressive increase, reaching the greatest concentration on wk 12 to fall on wk 16 (P<0.05), with an additional increase observed on wk 24 (P<0.05). Basal concentration did not change from 2 to 8 wk; then, increased at wk 12 (P<0.05), when reached a plateau until wk 20, with an additional increase on wk 24 (P<0.05). Pulse frequency was greatest on wk 8, but no differences were detected from 2 to 20 wk, whilst the least frequency was detected on wk 24 (P<0.05). Pulses of low amplitude were detected on wk 2; then, amplitude increased drastically on wk 4 (P<0.05) to reach the greatest value on wk 12, with a decreasing trend thereafter.

RESULTADOS

Desarrollo de los perfiles de LH

El efecto del genotipo y la interacción genotipo por edad no fueron significativos para ninguna de las variables de los perfiles de LH, mientras que el efecto de la edad sí lo fue para todas las variables (Cuadro 1). La menor concentración promedio se observó en la semana 2, se detectó una elevación en la semana 4 (P<0.05), después hubo un aumento progresivo, alcanzando la mayor concentración en la semana 12 para descender en la semana 16 (P<0.05), con un incremento adicional observado en la semana 24 (P<0.05). La concentración basal no cambió entre 2 y 8 semanas; después aumentó en la semana 12 (P<0.05), alcanzando una meseta hasta la semana 20, con un incremento adicional en la semana 24 (P<0.05). La frecuencia de pulsos fue mayor en la semana 8, pero no se detectaron diferencias entre 2 y 20 semanas, mientras que la menor frecuencia se detectó en la semana 24 (P<0.05). Se detectaron pulsos de baja amplitud en la semana 2, después la

Development of testosterone profiles

The effect of genotype and genotype by age interaction were not significant for any of the variables of T profiles, whilst the effect of age was significant for all variables (Table 1). Mean T concentration increased constantly from wk 2 to 24 ( P <0.05). Basal concentration was maintained low until wk 8; thereafter, a sustained increase was observed from wk 12 to 24 (P<0.05). Pulses of low magnitude were detected in some animals at 2 wk of age, but the average frequency was very small and was different from the rest of the ages. The highest frequency was observed on wk 12, but it was not different from wk 8, 16, 20 and 24. Pulse 346

DESARROLLO DEL EJE REPRODUCTIVO ENDOCRINO EN CORDEROS DE PELO

Cuadro 1. Medias ± EE de las variables de los perfiles plasmáticos de LH y testosterona en corderos de pelo de 2 a 24 semanas de edad Table 1. Means ± SE for variables of LH and testosterone plasma profiles in hair ram lambs from weeks 2 to 24 of age Hormone LH

Testosterone

Age (weeks) 2 4 8 12 16 20 24 2 4 8 12 16 20 24

Mean concentration (ng•ml-1) v1.18 w2.16 wx2.52 xy3.42 w2.33 wx2.48 y3.77 v0.07 vw0.17 w0.33 x0.76 y1.69 y2.01 z2.31

± ± ± ± ± ± ± ± ± ± ± ± ± ±

0.24 0.34 0.43 0.35 0.25 0.27 0.39 0.01 0.03 0.07 0.14 0.22 0.29 0.22

Basal concentration (ng•ml-1) v0.71 vw0.89 vw1.07 x1.94 wx1.40 x1.76 y2.87 v0.04 v0.04 v0.09 w0.30 w0.46 x0.70 y1.03

± ± ± ± ± ± ± ± ± ± ± ± ± ±

0.18 0.19 0.23 0.31 0.20 0.25 0.35 0.00 0.00 0.02 0.09 0.11 0.15 0.23

Pulse frequency (pulses•6 h-1) vw2.35 vw2.29 w2.59 vw1.76 vw1.71 vw2.06 v1.65 v0.40 w1.20 wx1.60 x2.00 wx1.87 wx1.60 wx1.47

± ± ± ± ± ± ± ± ± ± ± ± ± ±

vwxyz Means without a common superscript within variable and hormone are different (P<0.05).

amplitud aumentó drásticamente en la semana 4 (P<0.05) para alcanzar el mayor valor en la semana 12, con una tendencia descendente a partir de entonces.

0.33 0.21 0.26 0.32 0.21 0.29 0.24 0.16 0.26 0.21 0.31 0.19 0.13 0.17

Pulse amplitude (ng•ml-1) v2.74 wx8.02 wx7.31 x11.11 wx7.97 w6.00 wx6.56 v0.69 v1.00 v0.95 v1.85 w4.51 x5.13 x5.59

± ± ± ± ± ± ± ± ± ± ± ± ± ±

0.46 1.46 1.11 1.78 1.03 1.17 1.07 0.21 0.16 0.15 0.28 0.43 0.73 0.48

amplitude was small between wk 2 and 8; then, significant increases were observed on wk 16 and 20 (P<0.05), with no further changes. Development of LH and testosterone responses to GnRH administration

Desarrollo de los perfiles de testosterona

El efecto del genotipo y la interacción genotipo por edad no fueron significativos para ninguna de las variables de los perfiles de T, mientras que el efecto de la edad sí lo fue para todas las variables (Cuadro 1). La concentración promedio de T aumentó constantemente entre las semanas 2 y 24 (P<0.05). La concentración basal se mantuvo baja hasta la semana 8; a partir de entonces se observó un aumento sostenido de la semana 12 a 24 (P<0.05). Se detectaron pulsos de baja magnitud en algunos animales a las 2 semanas de edad, pero la frecuencia era muy baja y diferente del resto de las edades. La frecuencia más alta se observó en la semana 12, pero no fue diferente de las semanas 8, 16, 20 y 24. La amplitud de los pulsos fue pequeña entre las semanas 2 y 8,

The effects of the main factors and the corresponding interactions on LH and T response to the administration of GnRH are shown in Table 2.

LH secretion after GnRH administration. The

triple interaction genotype by age by dose was not significant for any of the variables of LH response (Table 2). Genotype by age interaction was or tended to be significant for peak height of LH secretion ( P =0.046) and for LH (P=0.063; Tables 2 and 3). There were not differences between genotypes on wk 2, 4, 16 and 20, whereas on wk 8, 12 and 24, LH response was greatest in Pelibuey lambs. Pelibuey and crossbred lambs reached the highest response on wk 8 (P<0.05), which was 347

Luis Javier Montiel-Olguín, et al. / Rev Mex Cienc Pecu 2016;7(3):341-360

Cuadro 2. Efecto de los factores principales y las interacciones respectivas sobre la altura del pico, el área bajo la curva (AUC) y la magnitud de la respuesta (valores ) de LH y testosterona, después de la administración de GnRH en corderos de pelo Table 2. Effect of the main factors and the corresponding interactions on peak height, area under the curve (AUC) and magnitude of the response ( values) of LH and testosterone, after administration of GnRH in hair ram lambs Variable

Peak height

AUC

 Values

Genotype Dose Age Genotype x Age Genotype x Dose Dose x Age Genotype x Age x Dose Genotype Dose Age Genotype x Age Genotype x Dose Dose x Age Genotype x Age x Dose Genotype Dose Age Genotype x Age Genotype x Dose Dose x Age Genotype x Age x Dose

P-value 0.002 0.001 0.001 0.046 0.006 0.001 0.458 0.012 0.001 0.001 0.465 0.06 0.001 0.207 0.002 0.001 0.001 0.063 0.034 0.001 0.444

después se observaron aumentos significativos en las semanas 16 y 20 (P<0.05), sin más cambios posteriores.

Testosterone

P-value 0.105 0.001 0.001 0.425 0.406 0.001 0.664 0.080 0.001 0.001 0.644 0.405 0.002 0.676 0.082 0.001 0.001 0.712 0.161 0.001 0.647

maintained until wk 16, whereas Blackbelly lambs did not reach the highest response until wk 16 (P<0.05); after wk 16, peak height showed a decreasing trend for all the genotypes. Genotype by dose interaction was or tended to be significant for peak height (P=0.006), AUC (P=0.06) and LH (P=0.034; Table 2). No differences between genotypes were detected for the small dose (Table 4; peak height and LH), but for the medium and large doses, Pelibuey had the highest and Blackbelly the lowest LH response to GnRH, with crossbred lambs being intermediate. Dose by age interaction was significant for all the variables of LH response (Table 2); differences between doses were detected at every age in a dosedependent manner (Table 5), except for AUC at

Desarrollo de las respuestas de LH y testosterona a la administración de GnRH

Los efectos de los factores principales y las interacciones correspondientes de la respuesta de LH y T a la administración de GnRH se muestran en el Cuadro 2.

Secreción de LH después de la administración de GnRH. La triple interacción genotipo por edad

por dosis no fue significativa para ninguna de las variables de la respuesta de LH (Cuadro 2). La interacción genotipo por edad fue o tendió a ser significativa para la altura del pico de LH 348

DESARROLLO DEL EJE REPRODUCTIVO ENDOCRINO EN CORDEROS DE PELO

Cuadro 3. Interacción genotipo por edad sobre la altura del pico y la magnitud de la respuesta de LH (LH), después de la administración de GnRH. Los valores son medias ± EE (ng•ml-1) Table 3. Genotype by age interaction on peak height and magnitude of the LH response (LH), after administration of GnRH. Values are means ± SE (ng•ml-1) Variable

Peak height

LH

Age (weeks) 2 4 8 12 16 20 24 2 4 8 12 16 20 24

Blackbelly

Genotype Crossbred

w3.59 ± 0.46ª wx5.86 ± 1.25a wx6.34 ± 1.61a

w3.07 ± 0.63a wx4.70 ± 1.02a z12.80 ± 3.33b

y10.97 ± 2.06a xy7.40 ± 1.04a

z12.68 ± 1.92a y6.94 ± 1.24a

x6.71 ± 1.18a

xy7.10 ± 0.97ab w2.86 ± 0.48a

wx4.29 ± 1.27a wx4.99 ± 1.6a wx4.59 ± 1.06a y8.53 ± 2.06a

xy5.45 ± 1.05a x5.04 ± 1.05a

Pelibuey

w4.56 ± 0.81a w5.35 ± 1.19a y16.86 ± 3.69b

y8.42 ± 1.53a

xy6.45 ± 1.03a w2.39 ± 0.63a

y14.15 ± 2.15b y15.64 ± 2.82a x10.16 ± 1.80a

xy11.63 ± 2.29b w3.77 ± 0.77a w4.4 ± 1.24a

wx4.11 ± 0.98a z11.23 ± 3.25b

y14.9 ± 3.78b

y5.82 ± 1.68a z10.25 ± 1.83a

xy5.76 ± 1.26a xy5.71 ± 1.08a

ab Means without a common superscript within variable and age are different (P<0.05).

y11.12 ± 2.38b y12.95 ± 2.83a x8.87 ± 1.8a

xy10.59 ± 2.14b

wxyz Means without a common superscript within variable and genotype are different (P<0.05).

Cuadro 4. Interacción genotipo por dosis de GnRH sobre la altura del pico (ng•ml-1), el área bajo la curva de respuesta (AUC; ng•ml-1•3h-1) y la magnitud de la respuesta de LH (Delta LH; ng•ml-1), después de la administración de GnRH. (Medias ± EE)

Table 4. Genotype by GnRH dose interaction on peak height (ng•ml-1), area under the curve of response (AUC; ng•ml-1•3h-1) and magnitude of the LH response (Delta LH; ng•ml-1), after administration of GnRH. (Means ± SE) Variable

Peak height AUC LH

GnRH dose (ng•kg-1 BW)

Blackbelly

Genotype Crossbred

3 9 27

2.96 ± 0.37a 7.14 ± 0.70a 10.56 ± 0.97a

2.76 ± 0.41a 8.09 ± 0.82a 12.20 ± 1.34a

3 9 27

1.16 ± 0.23a 5.34 ± 0.67a 8.84 ± 0.94a

1.51 ± 0.33a 6.59 ± 0.77ab 10.78 ± 1.26a

3 9 27

316 ± 35a 488 ± 50a 665 ± 64a

284 ± 44ab 497 ± 40ab 723 ± 65ab

ab Means without a common superscript within variable and dose are different (P<0.05).

349

Pelibuey

3.15 ± 0.40a 10.89 ± 1.06b 19.04 ± 1.62b

338 ± 34b 666 ± 67b 1064 ± 85b

1.73 ± 0.37a 9.06 ± 0.97b 17.27 ± 1.63b

Luis Javier Montiel-Olguín, et al. / Rev Mex Cienc Pecu 2016;7(3):341-360

(P=0.046) y para LH (P=0.063; Cuadros 2 y 3). No hubo diferencias entre los genotipos en las semanas 2, 4, 16 y 20, mientras que en las semanas 8, 12 y 24, la respuesta de LH fue mayor en los corderos Pelibuey. Los corderos Pelibuey y cruzados alcanzaron la mayor respuesta en la semana 8 (P<0.05), la cual se mantuvo hasta la semana 16, mientras que los corderos Blackbelly alcanzaron la mayor respuesta hasta la semana 16 ( P <0.05); después de la semana 16, la altura del pico mostró una tendencia decreciente en todos los

wk 2. The effects of genotype, GnRH dose and age on the three variables of LH response were significant (Table 2). Pelibuey ram lambs always showed the greatest response, as compared with Blackbelly and crossbred lambs (Table 6). The response to GnRH administration was in a dose-dependent manner (Table 6). Regarding the effect of age, the greatest LH response was observed between 8 and 16 wk of age; thereafter, the response decreased (P <0.05) for the three variables evaluated (Figure 1).

Cuadro 5. Interacción dosis por edad sobre la altura del pico (ng•ml-1), el área bajo la curva de respuesta (AUC; ng•ml-1•3h-1) y la magnitud de la respuesta de LH (LH; ng•ml-1), después de la administración de GnRH, (Medias ± EE)

Table 5. Dose by age interaction on peak height (ng•ml-1), area under the curve of response (AUC; ng•ml-1•3h-1) and magnitude of the LH response (LH; ng•ml-1), after administration of GnRH. (Means ± SE) Variable Peak height

AUC

LH

Age(weeks) 2 4 8 12 16 20 24 2 4 8 12 16 20 24 2 4 8 12 16 20 24

3 ng•kg-1 BW

wx2.36 ± 0.60a w2.08 ± 0.70a wx2.33 ± 0.37a y4.59 ± 0.75a y3.95 ± 0.53a x2.61 ± 0.32a x2.68 ± 0.38a w252 ± 47a w237 ± 38a

wx290 ± 34a y527 ± 77a xy391 ± 46a w243 ± 49a w256 ± 42a

Doses of GnRH 9 ng•kg-1 BW w3.33 ± 0.34b w4.64 ± 0.84b

x11.81 ± 1.73b

x10.58 ± 1.31b y14.43 ± 1.34b

z23.31 ± 3.10c

y14.40 ± 2.25c z21.00 ± 2.06c

y13.42 ± 1.21c y14.18 ± 1.83c

xy722 ± 116b

z1184 ± 131c y868 ± 116b

w222 ± 22a w298 ± 36b

w344 ± 36b x501 ± 48c

xy720 ± 104b y815 ± 65b x595 ± 51b x562 ± 54b

w2.67 ± 0.30b w3.67 ± 0.93b

xy1.72 ± 0.48a

y11.64 ± 1.38b x7.11 ± 0.78b

wx1.21 ± 0.22a wx1.55 ± 0.37a

w5.68 ± 0.67c x9.33 ± 0.98c

x8.73 ± 0.71b x8.73 ± 0.76b

wx1.54 ± 0.57a w0.67 ± 0.18a w0.90 ± 0.21a y2.52 ± 0.79a

27 ng•kg-1 BW

z1153 ± 92c yz893 ± 90c

yz940 ± 129c

w4.95 ± 0.64c x8.50 ± 1.02c

x9.72 ± 1.59b x7.92 ± 1.40b

z21.85 ± 3.15c xy11.37 ± 2.48b

x7.34 ± 0.90b

y12.76 ± 1.77c

abc Means without a common superscript within variable and age are different (P<0.05).

z18.43 ± 2.09c y11.96 ± 1.26c

wxyz Means without a common superscript within variable and dose are different (P<0.05).

350

DESARROLLO DEL EJE REPRODUCTIVO ENDOCRINO EN CORDEROS DE PELO

Cuadro 6. Efecto del genotipo y la dosis de GnRH sobre la altura del pico (ng•ml-1), el área bajo la curva de respuesta (AUC; ng•ml-1•3h-1) y la magnitud de la respuesta de LH (LH) y testosterona (T) (ng•ml-1), después de la administración de GnRH (Medias ± EE) Table 6. Effects of genotype and GnRH dose on peak height (ng•ml-1), area under the curve of response (AUC; ng•ml-1 •3h-1) and magnitude of the LH and testosterone (T) responses (; ng•ml-1), after administration of GnRH (Means ± SE) Hormone LH T

Variable

Peak height AUC LH Peak height AUC T

Blackbelly 6.9±0.5a 489±32a 5.1±0.5a 3.1±0.4a 232±28a 1.5±0.2a

Genotype Crossbred 7.7±0.7a 501±35a 6.3±0.7a 3.6±0.3b 282±29b 2±0.3b

Pelibuey

11±0.9b 689±48b 9.4±0.9b

3.4±0.4ab 283±36b 1.9±0.3ab

GnRH dose (ng•kg-1 BW) 3 9 27

x3±0.2

y8.8±0.5

z14.1±0.9

x1.5±0.2

y7.0±0.5

z12.4±0.9

x315±2

y2.3±0.3 x136±16

y0.91±0.22

ab Means without a common superscript within hormone and variable are different (P<0.05). xyz Means without a common superscript within hormone and variable are different (P<0.05).

y555±33

z3.7±0.4 y288±29

z2.11±0.26

z826±46

z3.8±0.4 z372±39

z2.36±0.28

Testosterone secretion after GnRH administration. The triple interaction of genotype

genotipos. La interacción genotipo por dosis fue o tendió a ser significativa para la altura del pico (P=0.006), AUC (P=0.06) y LH (P=0.034; Cuadro 2). No se detectaron diferencias entre genotipos con la dosis baja (Cuadro 4; altura del pico y LH), pero con las dosis media y alta, Pelibuey tuvo la mayor respuesta y Blackbelly la menor respuesta a GnRH, con los corderos cruzados siendo intermedios. La interacción dosis por edad fue significativa para todas las variables de respuesta de LH (Cuadro 2); Se detectaron diferencias entre dosis en cada edad en una forma dosis dependiente (Cuadro 5), excepto para AUC en la semana 2. Los efectos de genotipo, dosis de GnRH y edad sobre las tres variables de respuesta de LH fueron significativos (Cuadro 2). Los corderos Pelibuey siempre mostraron la mayor respuesta, en comparación con los corderos Blackbelly y cruzados (Cuadro 6). La respuesta a la administración de GnRH fue de manera dosis dependiente. Respecto a la edad, la mayor respuesta de LH se observó entre las 8 y 16 semanas de edad; a partir de entonces, la respuesta disminuyó (P<0.05) para las tres variables evaluadas (Figura 1).

by age by dose, as well as the interactions of genotype by age and genotype by dose were not significant for any of the variables of T response (Table 2). Dose by age interaction was significant for the three variables of T response (Table 2). No differences among doses (Table 7) were detected for peak height (2 and 4 wk) and T (2 wk); AUC was greater for the large dose, as compared with the small dose (2 wk); AUC and T were greater in the large dose, as compared with the other doses. From wk 8 onwards, T response to the small dose was lower than T response to the medium and large doses, with no difference between the last for all variables, except for AUC at wk 24, when the response to all doses was different from each other. Within dose, T response increased as the lambs were older (Table 7); however, differences were not always significant. For the small dose, peak height did not change from 2 to 12 wk of age, but then it increased until wk 24; for the medium and large doses, peak height was not different between 2 and 4 wk, but from wk 8 it increased constantly until the end of the study. Regarding 351

Luis Javier Montiel-Olguín, et al. / Rev Mex Cienc Pecu 2016;7(3):341-360

Secreción de testosterona después de la administración de GnRH. La triple interacción

El efecto del genotipo en las tres variables de la respuesta de T tendió a ser significativo (Cuadro 2), los corderos Blackbelly siempre mostraron una respuesta inferior a los corderos cruzados (Cuadro 6), con los Pelibuey siendo intermedios. Los efectos de la dosis de GnRH y la edad fueron significativas (Cuadro 2); la

LH or Testosterone (ng • ml-1)

Figure 1. Effect of age on peak height (panel A), area under the curve of response (panel B) and magnitude of the response (panel C) of LH and testosterone, after administration of GnRH 12

8 4 0

800

LH or Testosterone (ng•ml-1•3h-1)

Dentro de dosis, la respuesta de T aumentó a medida que los corderos eran mayores (Cuadro 7); sin embargo, las diferencias no siempre fueron significativas. Para la dosis baja, la altura del pico no cambió entre 2 y 12 semanas de edad, pero después aumentó hasta la semana 24; para las dosis media y alta, la altura del pico no fue diferente entre las semanas 2 y 4, pero desde la semana 8 aumentó constantemente hasta el final del estudio. Con respecto al AUC, cuando se utilizaron las dosis baja y media, no hubo diferencia entre las semanas 2 y 4, después aumentó entre las semanas 8 y 20; para la dosis alta, el AUC aumentó continuamente entre las semanas 2 y 24. T no fue diferente entre 2 y 4 semanas, pero desde la semana 8 en adelante aumentó hasta la semana 24, para todas las dosis.

Figura 1. Efecto de la edad sobre la altura del pico (panel A), el área bajo la curva de respuesta (panel B) y la magnitud de la respuesta (panel C) de LH y testosterona, después de la administración de GnRH

400 200

0 12

c z

w 8

a v

c b

c z

b z

LH Testosterone

600

LH or Testosterone (ng • ml-1)

genotipo por edad por dosis, así como las interacciones de genotipo por edad y genotipo por dosis no fueron significativas para ninguna de las variables de la respuesta de T (Cuadro 2), mientras que la interacción dosis por edad fue significativa para las tres variables (Cuadro 2). No se detectaron diferencias entre las dosis (Cuadro 7) en la altura del pico (semanas 2 y 4) y T (semana 2); AUC fue mayor con la dosis alta, en comparación con la dosis baja (semana 2); AUC y T fueron mayores con la dosis alta, en comparación con las otras dosis. A partir de la semana 8, la respuesta de T a la dosis baja fue menor que la respuesta a las dosis media y alta, sin diferencias entre las últimas para todas las variables, excepto para AUC en la semana 24, cuando la respuesta a todas las dosis fue diferente entre sí.

AUC, when the small and medium doses were used, there was no difference between 2 and 4 wk, then it increased between wk 8 and 20; the AUC to the large dose increased continuously from 2 to 24 wk. T was no different between

w 12

Age (weeks)

x 16

Values are means ± SE, pooled across genotypes and doses. Means without a common superscript within each panel and hormone ( a,b,c,d LH; u,v,w,x,y,z testosterone) indicate differences between ages (P<0.05).

352

DESARROLLO DEL EJE REPRODUCTIVO ENDOCRINO EN CORDEROS DE PELO

Cuadro 7. Interacción dosis por edad sobre la altura del pico (ng•ml-1), el área bajo la curva de respuesta (AUC; ng•ml-1•3h-1) y la magnitud de la respuesta de testosterona (T; ng.ml1), después de la administración de GnRH (Medias ± EE) Table 7. Dose by age interaction on peak height (ng•ml-1), area under the curve of response (AUC; ng•ml-1•3h-1) and magnitude of the testosterone response (T; ng•ml-1), after administration of GnRH (Means ± SE) Variable

Peak height

AUC

T

Age (weeks) 2 4 8 12 16 20 24 2 4 8 12 16 20 24 2 4 8 12 16 20 24

3 ng•kg-1 BW

Doses of GnRH 9 ng•kg-1 BW

27 ng•kg-1 BW

v0.75 ± 0.24a v1.00 ± 0.17a

w1.33 ± 0.13b w2.08 ± 0.40b

w1.80 ± 0.19b w2.11 ± 0.28b

y5.72 ± 0.86a

y6.19 ± 0.37b z8.64 ± 0.50b

z9.19 ± 0.40b

v0.46 ± 0.21a v0.43 ± 0.19a w1.92 ± 0.45a x2.73 ± 0.51a v20 ± 6a v20 ± 5a

v0.43 ± 0.10a v0.59 ± 0.17a x4.44 ± 0.42b v24 ± 5ab v30 ± 9a

w53 ± 11a x105 ± 19a

w114 ± 15b w194 ± 36b

y260 ± 49a

x556 ± 60b

y199 ± 36a y276 ± 47a

v0.55 ± 0.15a v0.95 ± 0.14a x4.45 ± 0.35b y6.76 ± 0.37b v36 ± 12b

w77 ± 12b x149 ± 22b x215 ± 36b

x439 ± 45b x619 ± 29b

v0.07 ± 0.06a v0.02 ± 0.02a

v0.26 ± 0.08a v0.28 ± 0.13a

y498 ± 47b z729 ± 39b

z845 ± 104c

v0.43 ± 0.14a v0.78 ± 0.11b

w0.30 ± 0.14a w0.33 ± 0.09a

w1.25 ± 0.13b w1.04 ± 0.30b

w1.57 ± 0.19b w1.21 ± 0.31b

z3.72 ± 1.02a

z5.55 ± 0.78b

z6.16 ± 0.82b

x0.63 ± 0.24a y1.11 ± 0.55a

x2.38 ± 0.44b y3.82 ± 0.56b

x2.07 ± 0.30b y4.12 ± 0.70b

ab Means without a common superscript within variable and age are different (P<0.05).

vwxyz Means without a common superscript within variable and dose are different (P<0.05).

2 and 4 wk, but from wk 8 onwards it increased until wk 24, for all doses.

respuesta de T a la dosis baja fue menor que la respuesta a las dosis media y alta (Cuadro 6), sin diferencias entre las dosis mayores (altura del pico y T); el AUC fue diferente entre las tres dosis administradas. Las tres variables de la respuesta de T aumentaron a medida que los corderos iban creciendo (Figura 1).

The effect of genotype on the three variables of T response tended to be significant (Table 2), Blackbelly ram lambs always showed a lower response than crossbred lambs (Table 6), with Pelibuey being intermediate. The effects of GnRH dose and age were significant (Table 2); T response to the small dose was lower than the response to the medium and large doses (P<0.05; Table 6), with no difference between

Peso corporal y circunferencia escrotal

La interacción del genotipo por edad sobre el peso fue significativa (P=0.01; Figura 2A); de 353

Luis Javier Montiel-Olguín, et al. / Rev Mex Cienc Pecu 2016;7(3):341-360

the larger doses (peak height and T); AUC was different among the three doses administered (P<0.05). The response of T increased as the lambs were older for the three variables evaluated (Figure 1).

la semana 12 en adelante generalmente los corderos Blackbelly fueron más ligeros, mientras que los cruzados fueron más pesados (P<0.05). El efecto del genotipo y la interacción genotipo por edad sobre la CE no fueron significativos. El efecto de la edad sí lo fue (P<0.001), ya que la CE aumentó conforme los corderos iban creciendo (Figura 2B).

Body weight and scrotal circumference

The interaction of genotype by age on BW was significant (P=0.01; Figure 2A); from wk 12 onwards, Blackbelly lambs had usually the lightest and crossbred lambs had the heaviest BW (P<0.05). Regarding SC, the effect of the

DISCUSIÓN

La concentración promedio de LH siguió un patrón similar a lo reportado previamente para corderos Blackbelly (14) y varias razas de lana(1,2,3,21,22). Se observaron concentraciones bajas durante las primeras semanas de vida(2,3), alcanzando concentraciones máximas entre las 11 y 13 semanas de edad, dependiendo de la raza (3,22), seguido por una disminución o variaciones mínimas a partir de entonces. En el presente estudio, se detectaron pulsos de baja amplitud desde las 2 semanas de edad, lo cual coincide con lo reportado para razas de lana(1,21), lo que indica que, aunque inmaduro, existe un eje reproductivo funcional a edades

Figura 2. Medias ± EE del peso corporal (panel A) y la circunferencia escrotal (panel B) de corderos Blackbelly, Pelibuey y sus cruzas, de 2 a 24 semanas de edad Figure 2. Mean ± SE of body weight (panel A) and scrotal circumference (panel B) of Blackbelly and Pelibuey ram lambs and their crosses, from 2 to 24 wk of age A

Blackbelly Crossbred

Pelibuey

Body weight (kg)

10 0 30

Scrotal circumference (cm)

Estudios previos han encontrado una relación entre los cambios endocrinos durante el desarrollo prepuberal y algunas características reproductivas en los ovinos. La edad en la que la concentración de LH empieza a aumentar parece estar relacionada con la precocidad y prolificidad de la raza, ya que el aumento de LH se observa más temprano en razas más precoces(1) y más prolíficas(5,19). Por lo tanto, la falta de diferencias entre genotipos para cualquiera de las variables de los perfiles de LH y T fue inesperada, ya que varios autores han encontrado que Blackbelly es una raza más precoz y más prolífica que Pelibuey(7,8,10,12). Es posible que las diferencias entre sexos en los mecanismos endocrinos que conducen a la pubertad(20) hayan ocultado diferencias sutiles entre los machos de estas razas. Alternativamente, como las razas utilizadas en el presente estudio tienen orígenes parecidos(6), éstas no son muy diferentes entre sí, lo que contribuiría a un desarrollo endocrino similar.

12 16 Age (weeks)

Blackbelly Crossbred Pelibuey

Significant differences between genotypes, within age, are denoted by * (P<0.05) at wk 12 (Blackbellya, Pelibueyab, Crossbredb), 16 and 20 (Blackbellya, Pelibueyb, Crossbredc), and 24 (Blackbellya, Pelibueyb, Crossbredb). Note that at some time points the symbols are larger than the SE bar.

354

DESARROLLO DEL EJE REPRODUCTIVO ENDOCRINO EN CORDEROS DE PELO

muy tempranas. La amplitud de los pulsos a los 28 días fue similar a la reportada previamente para razas de lana de la misma edad(22). La frecuencia de pulsos a las 2 semanas fue mayor en los corderos del presente estudio, comparado con corderos de razas de lana de un mes de edad(22), en los que la frecuencia no alcanzó valores comparables a los corderos de este estudio hasta los 90 días.

genotype and genotype by age interaction were not significant. The effect of age was significant (P<0.001), and SC augmented as the age increased (Figure 2B). DISCUSSION

Previous studies have found a relationship between the endocrine changes during the prepubertal development and some reproductive characteristics in sheep. The age at which LH concentration starts increasing seems to be related with the precocity and prolificacy of the breed, as LH increase is observed earlier in life in more precocious (1) and more prolific breeds(5,19). Therefore, the lack of differences between genotypes for any of the variables of the LH and T profiles was unexpected, as several authors have reported that Blackbelly is a more precocious and prolific breed, as compared with Pelibuey(7,8,10,12). It is possible that differences between sexes in the endocrine mechanisms leading to puberty (20) had hidden subtle differences between males of these breeds. Alternatively, as the breeds used in the present study have similar origin(6), they are not too different from each other, which accounted for a similar endocrine development.

Un evento importante durante el desarrollo sexual es un aumento temprano de la concentración de LH. En este estudio, aumentos significativos de la concentración de LH y la amplitud de los pulsos se detectaron por primera vez a las 4 semanas de edad, lo cual coincide con estudios anteriores en corderos Blackbelly(14) y varias razas de lana(1,3,5,19). El aumento temprano y luego sostenido de la concentración de LH hasta la semana 12 resulta de una disminución en la sensibilidad del eje hipotálamo-hipófisis a la retroalimentación negativa de los esteroides, que representa tal vez el inicio del proceso puberal (14) . El subsiguiente descenso de los parámetros de los perfiles de LH después de la semana 12 (Estudio 1) y de la respuesta a GnRH después de la semana 16 (Estudio 2), en conjunto con el aumento de las concentraciones de T, pudieron ser consecuencia del establecimiento de los mecanismos de retroalimentación negativa de los esteroides gonadales(2,23).

Mean LH concentration followed a pattern similar to that reported previously for Blackbelly ram lambs(14) and for several wool breeds(1,2,3,21,22). There were small concentrations during the first weeks of life (2,3) , reaching maximum concentrations between 11 and 13 wk of age, depending on the breed(3,22), followed by a decline or minimal variations thereafter. In the present study, low amplitude pulses were detected as early as 2 wk of age, which agrees with that reported for wool breeds (1,21) , indicating that a functional, yet immature, reproductive axis exists at very early age. Pulse amplitude at 28 d of age was similar to that previously reported for wool breeds at the same age(22). Pulse frequency at 2 wk of age is higher in lambs from the present study, as compared

El aumento progresivo de las concentraciones y la amplitud de los pulsos de T coincide con lo encontrado anteriormente en razas de lana(1,4,22); éste es inicialmente desencadenado por el aumento de la frecuencia y (o) magnitud de los pulsos de LH(4,21,24), y por el incremento de la actividad esteroidogénica testicular y la capacidad de respuesta a la estimulación LH(2,21,22). A pesar de la disminución de la secreción de LH después de la semana 12, las concentraciones de T continuaron aumentando hasta la semana 24; se ha observado que durante este tiempo aumenta el número de células de Leydig(25) y el número de receptores para LH(22,26), se mejora la actividad enzimática

355

Luis Javier Montiel-Olguín, et al. / Rev Mex Cienc Pecu 2016;7(3):341-360

y hay mayor disponibilidad de colesterol al interior de las células(26).

with lambs from wool breeds at one month of age(22), in which frequency did not reach values comparable to our lambs until 90 d of age.

Al comienzo del estudio, la dosis baja de GnRH (3 ng•kg-1) fue considerada como la “dosis fisiológica”, ya que previamente esta dosis había inducido aumentos de LH con características similares a los pulsos naturales de LH en machos adultos(17). Sin embargo, después de analizar los datos fue evidente que LH para la dosis media (9 ng GnRH•kg-1) fue más parecida a la amplitud de los pulsos de LH del estudio 1 que la dosis baja; por lo tanto, la dosis media podría considerarse más cercana a las descargas fisiológicas de GnRH.

An important event during sexual development is an early rise in LH concentration. In our study, a significant increase in mean LH concentration and pulse amplitude was first detected at 4 wk of age, which is in agreement with previous studies in Blackbelly(14) and several wool sheep(1,3,5,19). The early and then sustained increase in LH concentration until wk 12 results from a decrease in the sensitivity of the hypothalamus-hypophysis axis to steroid negative feedback, representing perhaps the beginning of the pubertal process(14). The subsequent decline in the LH profile parameters after wk 12 (Study 1) and in the response to GnRH after wk 16 (Study 2), in conjunction with increasing T values, were probably consequence of the establishment of the mechanisms of negative feedback of gonadal steroids(2,23).

Las diferencias entre genotipos en la respuesta de LH a la GnRH no siempre fueron evidentes cuando se desafió con la dosis más baja; sin embargo, con las dosis altas la altura del pico y LH fueron mayores en los corderos Pelibuey, lo que indica una mayor capacidad de respuesta de la hipófisis en esta raza(27), principalmente en las semanas 8 y 12. Esto coincide con los datos del estudio 1, donde los cambios en las características del perfil de LH fueron evidentes a esas edades, los cuales parecen ser eventos endocrinos importantes asociados con el proceso de pubertad. Estos cambios endocrinos están temporalmente asociados con el establecimiento de la espermatogénesis(14) y con el desarrollo y mayor tasa de crecimiento testicular en corderos Blackbelly(15). En el presente estudio no se hicieron observaciones respecto al inicio de la pubertad; sin embargo, con base en estudios anteriores en condiciones similares(14), la espermatogénesis comienza entre las 9 y 12 semanas de edad y se completa (basado en la presencia de espermátidas alargadas en la mayoría de los túbulos seminíferos) hacia las semanas 15 a 18, aunque no se haya alcanzado la máxima capacidad; por otra parte, bajo condiciones similares, se observó la presencia de espermatozoides en la cola del epidídimo a las 18 semanas de edad(28).

The progressive increase of T concentration and pulse amplitude is in agreement with previous reports for wool breeds(1,4,22); it is initially triggered by the increased frequency and (or) magnitude of LH pulses (4,21,24) , and the enhanced testicular steroidogenic activity and responsiveness to LH stimulation(2,21,22). Albeit the decreased LH secretion after wk 12, T concentrations continued rising until wk 24; in addition to the greater number of Leydig cells(25), there are also increased numbers of LH receptors(22,26), enhanced enzymatic activity, and more availability of cholesterol to the interior of the cells(26). At the beginning of the study, the small dose of GnRH (3 ng•kg -1 ) was considered the “physiological dose”, as previously it had induced LH rises with characteristics similar to the natural LH pulses in adult rams(17). However, after analyzing the data, it was evident that LH for the medium dose (9 ng GnRH•kg-1) was more comparable to the LH pulse amplitude from the

La edad en que los corderos Pelibuey alcanzaron la mayor respuesta de LH coincide con lo

356

DESARROLLO DEL EJE REPRODUCTIVO ENDOCRINO EN CORDEROS DE PELO

observado en corderos Romney; en tal raza, la máxima respuesta a GnRH se observó a las 6 semanas de edad, y la magnitud de la respuesta disminuyó a medida que la edad avanzaba(29). La interacción dosis x genotipos sobre la respuesta de LH encontrada en el presente estudio, contrasta con información previa en corderos de varias razas de lana (Finn, Finngalway y High Fertility); en esta última, a los corderos se les administró entre 5 y 100 µg de GnRH, a las 4 y 8 semanas de edad, y la interacción raza por dosis no fue significativa a ninguna edad(30). Una posible explicación para esta discrepancia es que las dosis utilizadas en corderos de lana fueron tan altas que la respuesta provocada fue máxima a cualquier dosis; en contraste, la dosis máxima que se administró a los corderos del presente trabajo fue alrededor de 1 µg al final del estudio, lo cual pudo permitir cierto grado de discriminación en la magnitud del estímulo con GnRH.

study 1 than the small dose was; therefore, the medium dose might be considered closer to physiological GnRH discharges.

Differences among genotypes in the LH response to GnRH were not always evident when challenged with the small dose; however, with the larger doses peak height and LH were greater in Pelibuey lambs, which indicates a greater capacity of response of the hypophysis(27) in this breed, primarily on wk 8 and 12. This is in agreement with data from Study 1, where changes in the characteristics of LH profile are evident at those ages, which seem to be important endocrine events associated to the process of puberty. These endocrine changes are temporally associated with the establishment of spermatogenesis(14), testis development and the greatest rate of testicular growth(15) in Blackbelly ram lambs. In the present study no observations were made regarding the puberty status; however, based on previous studies under similar conditions(14), spermatogenesis starts between 9 and 12 wk of age and is completed (based on the presence of elongated spermatids in most of the seminiferous tubules) by wk 15 to 18, albeit not reached full capacity; furthermore, under similar conditions, sperms were present in the cauda epididymidis at 18 wk of age(28).

Los hallazgos en la secreción de T después de la administración de GnRH apoyan los resultados del primer estudio, en el cual las interacciones de genotipo por dosis y el genotipo por edad no fueron significativas para ninguna de las variables evaluadas. A pesar de que existieron diferencias entre genotipos en la respuesta de LH a la GnRH, éstas no fueron suficientes para inducir claras diferencias entre genotipos en la respuesta testicular, en términos de secreción de T. El efecto de la dosis de GnRH sobre la secreción de LH fue significativo y la respuesta fue siempre de una manera dosis dependiente, lo que concuerda con estudios similares anteriores(30,31). La respuesta de la testosterona también fue dosis dependiente, lo que sugiere que en los corderos en desarrollo, los testículos son capaces de detectar las diferentes concentraciones de LH inducidas por GnRH, y liberar T consecuentemente. Estos hallazgos contrastan con los reportados previamente para machos adultos, en los cuales, a pesar de la diferente respuesta de LH a dosis crecientes de GnRH, la magnitud de la respuesta de T fue la misma, independientemente de la dosis de GnRH(32). Por otro lado, en un estudio con

The age at which Pelibuey lambs reached the greatest LH response to GnRH is in agreement with a previous report for Romney lambs; in such breed, the maximal response to GnRH was observed at 6 wk of age, and the magnitude of the response decreased as the lambs became older(29). The dose by genotype interaction on LH response to GnRH found in the present study is in contrast with a study in lambs of several wool breeds (Finn, Finngalway and High Fertility). In the last, lambs were administered between 5 and 100 µg GnRH at 4 and 8 wk of age, and the breed by dose interaction was no significant at any age(30). A possible explanation to this disagreement is that the doses used with the wool lambs were so high that the response elicited was maximal at any dose; in 357

Luis Javier Montiel-Olguín, et al. / Rev Mex Cienc Pecu 2016;7(3):341-360

contrast, the maximum dose administered to our lambs was close to 1 µg at the end of the study, which could have allowed for some degree of discrimination in the magnitude of the GnRH stimulus.

toros, el AUC de respuesta de T fue acorde con la dosis de GnRH(33); la respuesta bifásica de LH, provocada al administrar dosis altas de GnRH, prolonga la estimulación testicular y, por lo tanto, favorece la secreción de mayores cantidades de T(33,34).

Findings in T secretion after GnRH administration support the results of the first study, in which the interactions of genotype by dose and genotype by age were not significant for any of the variables evaluated. Even though the differences between genotypes in the LH response to GnRH, they did not suffice to induce clear differences between genotypes in the testicular response, in terms of T secretion. The effect of GnRH dose on LH secretion was significant and the response was always in a dose-dependent manner, which agrees with previous similar studies(30,31). Testosterone response was also dose-dependent, which suggests that in developing lambs the testes are able to detect the different LH concentrations induced by GnRH, and release T accordingly. These findings contrast with those previously reported for adult rams; despite the differential LH response to graded doses of GnRH, the magnitude of T response was the same regardless the GnRH dose(32). On the other hand, in a study with bulls, AUC of T response was related to GnRH dose(33). The biphasic LH response, elicited when high doses of GnRH are administered, accounted for extended testis stimulation, and therefore, greater amounts of T were secreted(33,34).

A pesar de que los corderos Pelibuey mostraron una mayor capacidad de respuesta a la GnRH, esta capacidad aumentada no se hizo evidente ni tuvo repercusión en el proceso fisiológico normal de maduración endocrina (estudio 1). Es posible que en condiciones fisiológicas, el hipotálamo genere sólo los estímulos necesarios para desencadenar los cambios endocrinos asociados con el inicio de la pubertad y el desarrollo sexual, por lo cual, los perfiles de LH y T no difirieron entre genotipos (27) . La respuesta diferenciada a la administración de GnRH entre genotipos o entre individuos, sin embargo, podría ser de algún valor para predecir el comportamiento reproductivo del animal en la vida adulta o de su progenie(27,35), pero tal posibilidad no puede ser verificada a partir de los datos del presente estudio.

No se detectaron diferencias en el desarrollo de la CE, a pesar del mayor peso de los corderos Pelibuey y de los cruzados a partir de la semana 12; esto no concuerda con estudios anteriores, donde las diferencias en la CE durante el desarrollo de los corderos se explicaron basándose en los diferentes pesos de las razas(36). El pequeño número de corderos por grupo pudo haber influido para no detectar diferencias significativas entre los genotipos.

Even though Pelibuey lambs showed a greater capacity of response to GnRH, such enhanced capacity did not become evident nor had repercussion on the normal physiological process of endocrine maturation (Study 1). It is possible that under physiological conditions the hypothalamus generates only the necessary stimulus to trigger the endocrine changes associated with the onset of puberty and sexual development, and, therefore, the variables of the non-stimulated LH and T profiles did not differ between genotypes(27). The differential response to GnRH between genotypes or

CONCLUSIONES E IMPLICACIONES

En conclusión, el desarrollo endocrino sexual de los corderos Blackbelly, Pelibuey y sus cruzas no difiere cuando los perfiles de LH y T circulantes son evaluados; sin embargo, los corderos Pelibuey muestran una mayor capacidad de respuesta de la LH, cuando son desafiados con dosis fisiológicas y supra fisiológicas de GnRH. Esta respuesta diferenciada se observa durante un período en la vida del 358

DESARROLLO DEL EJE REPRODUCTIVO ENDOCRINO EN CORDEROS DE PELO

animal, en el que se producen importantes cambios en el desarrollo de la función testicular. Se requiere investigación adicional para determinar si esas diferencias tienen implicaciones sobre la capacidad reproductiva de los machos adultos.

between individuals, however, might be of some value to predict the reproductive performance of the ram in the adult life or its progeny(27,35), but such possibility cannot be verified from data of the present study. No differences were detected in SC development, albeit the greater BW in Pelibuey and crossbred lambs from wk 12, which disagree with previous studies, where differences in SC in developing ra m l am bs wer e ex p l ai ne d b ase d on differences in breed BW(36). The small number of lambs per group might have accounted for not detecting significant differences among genotypes.

AGRADECIMIENTOS

Se agradece a Leticia García y Patricia Sánchez por la asistencia técnica en el laboratorio, a Cristina Huerta y Martín Martínez por ayudar en la colección de las muestras y el cuidado de los corderos, a Anahy Vargas por la traducción al español. LJ Montiel-Olguín fue estudiante de posgrado, cuyo programa académico fue apoyado por el CONACYT, bajo la supervisión del último autor (HJS).

CONCLUSIONS AND IMPLICATIONS

In conclusion, the sexual endocrine development of Blackbelly, Pelibuey and their crosses does not differ when the non-stimulated circulating profiles of LH and T are evaluated; however, Pelibuey lambs showed a greater capacity of LH response, when challenged with physiological and supra physiological doses of GnRH. This differential response was observed during a period in the life, when important changes occur in the development of the testicular function of the rams. Whether or not such differences have implications on the reproductive capacity of the adult rams deserves additional research.

LITERATURA CITADA 1. 2.

5. 6. 7.

8. 9.

Echternkamp SE, Lunstra DD. Relationship between LH and testicular development in progesterone-implanted prepubertal ram lambs. J Anim Sci 1984;59(2):441-453. Rawlings NC, Churchill IJ, Currie WD, Joseph IBJK. Maturational changes in opioidergic control of luteinizing hormone and follicle-stimulating hormone in ram lambs. J Reprod Fertil 1991;93:1-7. Lee VW, Cumming IA, de Kretser DM, Findlay JK, Hudson B, Keogh EJ. Regulation of gonadotrophin secretion in rams from birth to sexual maturity. I. Plasma LH, FSH and testosterone levels. J Reprod Fertil 1976;46:1-6.

Klindt J, Ohlson DL, Davis SL, Schanbacher BD. Ontogeny of growth hormone, prolactin, luteinizing hormone, and testosterone secretory patterns in the ram. Biol Reprod 1985;33(2):436-444.

ACKNOWLEDGEMENTS

Thanks to Leticia García and Patricia Sánchez for technical assistance in the laboratory, Cristina Huerta and Martín Martínez for helping in collecting samples and caring for the lambs. LJ Montiel-Olguín is a former graduate student, whose academic program was supported by CONACYT, under the supervision of the last author (HJS).

Glatzel P. Variation in hormonal feedback and reproductive performance in rams of different genotypes from birth through puberty. Theriogenology 1988;30(4):763-776. Mason IL. Prolific tropical sheep 1980; Paper 17, FAO Rome.

González-Reyna A, Valencia MJ, Foote WC, Murphy BD. Hair sheep in México: reproduction in the Pelibuey sheep. Anim Breed Abstr 1991;59:509-524.

Segura JC, Sarmiento L, Rojas O. Productivity of Pelibuey and Blackbelly ewes in Mexico under extensive management. Small Ruminant Res 1996;21(1);57-62.

End of english version

Young LD, Fahmy MH, Torres HG. The use of prolific sheep: North America. In: MH Fahmy editor. Prolific Sheep. CAB International, Wallingford United Kingdom; 1996:289-349.

359

Luis Javier Montiel-Olguín, et al. / Rev Mex Cienc Pecu 2016;7(3):341-360 10. Valencia-Zarazúa M, González-Padilla E. Pelibuey sheep in Mexico. In: Fitzhugh HA, Bradford GE editors. Hair sheep of Western Africa and the Americas. A genetic resource for the tropics 1st ed. Boulder CO: Westview Press; 1983:5573.

24. Chase DJ, Schanbacher BD, Lunstra DD. Effects of pulsatile and continuous luteinizing hormone (LH) infusions on testosterone responses to LH in rams actively immunized against gonadotropin-releasing hormone. Endocrinology 1988;123(2):816-826.

12. Wildeus S. Hair sheep genetic resources and their contribution to diversified small ruminant production in the United States. J Anim Sci 1997;75:630-640.

26. O’Shaughnessy PJ, Willerton L, Baker PJ. Changes in Leydig cell gene expression during development in the mouse. Biol Reprod 2002;66(4):966-975.

11. Heredia AM, Velázquez MPA, Zarco QLA. Efecto de genotipo sobre el peso y edad a la pubertad en corderas Pelibuey, Blackbelly y sus cruzas [resumen]. Reunión Nacional de Investigación Pecuaria. Cuernavaca, Mor. México. 1996;322.

25. Monet-Kuntz C, Hochereau-de Reviers MT, Terqui M. Variations in testicular androgen receptors and histology of the lamb testis from birth to puberty. J Reprod Fertil 1984;70:203-210.

13. Zavala-Elizarraraz R, Ortiz-Ortiz JR, Ramón-Ugalde JP, Montalvo-Morales P, Sierra-Vásquez A, Sanginés-García JR. Pubertad en hembras de cinco razas ovinas de pelo en condiciones de trópico seco. Zoot Trop 2008;26(4):465473.

27. Evans NP, McNeilly JR, Springbett AJ, Webb R. Alterations in pituitary gland sensitivity in ram lambs to physiological doses of gonadotrophin-releasing hormone (GnRH), after divergent selection based on the luteinizing hormone response to a pharmacological GnRH challenge. J Reprod Fertil 1991;93:559-567.

14. Herrera-Alarcón J, Villagómez-Amezcua E, González-Padilla E, Jiménez-Severiano H. Stereological study of postnatal testicular development in Blackbelly sheep. Theriogenology 2007;68(4):582-591.

28. Vargas-Velázquez AD, Jiménez-Severiano H. Estudio morfométrico de los epidídimos durante el desarrollo postnatal de corderos Barbados Blackbelly. Rev Mex Cienc Pecu 2016;7(1):53-68.

15. Jiménez-Severiano H, Reynoso ML, Roman-Ponce SI, Robledo VM. Evaluation of mathematical models to describe testicular growth in Blackbelly ram lambs. Theriogenology 2010;74(7):1107-1114.

29. Wilson PR, Lapwood KR. Studies of reproductive development in Romney rams. I. Basal levels and plasma profiles of LH, testosterone and prolactin. Biol Reprod 1979;20(4):965970.

16. Merriam GR, Wachter KW. Algorithms for the study of episodic hormone secretion. American J Physiol 1982;243(4):E310-E318.

30. Hanrahan JP, Quirke JF, Gosling JP. Effect of lamb age, breed and sex on plasma LH after administration of GnRH. J Anim Sci 1981;61:281-288.

17. Jiménez-Severiano H. Endocrine and testicular responses of male cattle and sheep to chronic treatment with analogs of GnRH [unpublished PhD dissertation]. University of Nebraska; Lincoln 2001.

31. Tyrrell RN, Starr BG, Restall BJ, Donnelly JB. Repeatability of LH responses by lambs to monthly challenge with synthetic gonadotrophin releasing hormone (GnRH). Anim Reprod Sci 1980;3(2):155-160.

18. Jiménez-Severiano H, Jiménez-Krassel F, Menéndez-Trejo M. Endocrine and testicular responses of prepubertal Zebu crossbred bulls to active immunization against testosterone. Anim Reprod Sci 1996;41(3-4):169–81.

32. Jiménez-Severiano H, D’Occhio MJ, Lunstra DD, Mussard ML, Davis TL, Enright WJ, Kinder JE. Comparative response of rams and bulls to long-term treatment with gonadotropinreleasing hormone analogs. Anim Reprod Sci 2007;98(34):204-224.

19. Lunstra DD, Echternkamp SE. Repetitive testicular biopsy in the ram during pubertal development. Theriogenology 1988;29(4):803-810.

33. Post TB, Reich MM, Bindon BM. Characterization of LH and testosterone responses to intramuscular injection of GnRH in tropical post pubertal bulls. Theriogenology 1987;27(2):305-315.

20. Foster DL, Jackson LM. Puberty in sheep. In: Neill JD editor. Knobil and Neill’s Physiology of Reproduction. Third ed vol.1. San Diego CA; Elsevier Academic Press; 2006:2127-2176. 21. Foster DL, Mickelson IH, Ryan KD, Coon GA, Drongowski RA, Holt JA. Ontogeny of pulsatile luteinizing hormone and testosterone secretion in male lambs. Endocrinology 1977;102(4):1137-1146.

34. Evans NP, McNeilly JR, Webb R. Effects of indirect selection for pituitary responsiveness to gonadotropin-releasing hormone on the storage and release of luteinizing hormone and follicle-stimulating hormone in prepubertal male lambs. Biol Reprod 1995;53(2):237-243.

23. Schanbacher BD. Testosterone regulation of luteinizing hormone and follicle stimulating hormone secretion in young lambs. J Anim Sci 1980;51(3):679-684.

36. Notter DR, Lucas JR, McClaugherty FS, Copenhaver JS. Breed group differences in testicular growth patterns in springborn ram lambs. J Anim Sci 1985;60(3):622-631.

22. Yarney TA, Sanford LM. Pubertal changes in the secretion of gonadotropic hormones, testicular gonadotropic receptors and testicular function in the ram. Domest Anim Endocrinol 1989;6(3):219-229.

35. Haley CS, Lee GJ, Fordyce M, Baxter G, Land RB, Webb R. Study of LH response to GnRH in the young male as a criterion of genetic merit for female reproduction in sheep. J Reprod Fert 1989;86:119-133.

360

DESTETE ARTIFICIAL EN OVINOS: RESPUESTA DE ESTRÉS Rev Y BIENESTAR Mex CiencANIMAL Pecu 2016;7(3):361-375

Destete artificial en ovinos: respuesta de estrés y bienestar animal. Revisión Artificial weaning in sheep: stress response and animal welfare. Review Aline Freitas-de-Meloa, Rodolfo Ungerfeldb

RESUMEN

El vínculo oveja-cordero se establece al parto y cambia a lo largo del periodo de lactación hasta el destete natural. El destete artificial es un manejo frecuentemente utilizado en los diferentes tipos de sistemas de producción ovina, que es realizado más tempranamente que el destete natural. Es uno de los eventos más estresantes en la vida del animal, ya que genera cambios fisiológicos y de comportamiento fuertemente indicadores de estrés, pudiendo afectar negativamente la salud y el bienestar animal tanto de ovejas como de corderos, así como los resultados productivos. La presente revisión sintetiza y analiza información sobre cómo se establece el vínculo madre-cría, el desarrollo del mismo durante el período de lactación y el proceso de destete natural, así como los cambios que se producen cuando el destete se adelanta artificialmente. Además, se describe la respuesta generada por el destete artificial y qué factores la afectan, a nivel fisiológico, de comportamiento y productivo. Por último, se presenta la información existente sobre posibles estrategias que permitan minimizar los efectos negativos del estrés de destete artificial. Se agrega información original sobre cómo la variación cualitativa y cuantitativa de la oferta de pastura en los sistemas extensivos de producción ovino pueden afectar la respuesta de destete de los corderos, y manejos con potencialidad práctica que pueden mitigar la respuesta al destete artificial. Se especifican aspectos en los que existe necesidad de investigación para mejorar la comprensión y desarrollar alternativas sobre cómo modular la respuesta de estrés al destete. PALABRAS CLAVE: Amamantamiento, Comportamiento maternal, Corderos, Lactación, Ovinos.

ABSTRACT

The establishment of ewe-lamb bond occurs at lambing, and is modified along the lactation period until natural weaning. Artificial weaning is a management commonly used in sheep productive systems commonly performed before natural weaning. Artificial weaning provokes strong behavioral and physiological responses indicative of stress, and is considered as one of the most stressful situations in the life of the animal. Those responses negatively affect animal health and welfare, and the productive results. Therefore, it is important to elucidate which factors affect those responses, and to develop strategies to decreases the negative response. This review summarizes the available information on the establishment of ewe-lamb bonding, and how this bond evolves during the lactation period until natural weaning. Moreover, it describes the behavioral and physiological stress responses to artificial weaning, and the main factors that affect those responses at physiological, behavioral and productive levels. Finally, it presents information on some strategies available to decrease the negative effects of artificial weaning. Includes original information on the influence of quantitative and qualitative changes of pasture allowance in extensive sheep production systems and the stress responses of lambs to weaning; and handlings that potentially may be applied to decrease the stress response to artificial weaning. It suggests whether is room to study and to develop practical alternatives to modulate the stress response to weaning. KEY WORDS: Suckling, Maternal behavior, Lambs, Lactation, Ovine. Recibido el 13 de marzo de 2015. Aceptado el 13 de septiembre de 2015. a

Departamento de Biología Molecular y Celular, Universidad de la República, Lasplaces 1620, Montevideo (11600), Uruguay , tel.: (598) 26221195, alinefreitasdemelo@hotmail.com. Correspondencia al primer autor. Departamento de Fisiología, Facultad de Veterinaria, Universidad de la República, Lasplaces, Uruguay.

361

Aline Freitas-de-Melo, et al. / Rev Mex Cienc Pecu 2016;7(3):361-375

Los ovinos se caracterizan por presentar un vínculo madre-cría altamente selectivo, el que se establece inmediatamente después del parto(1). La intensidad del vínculo cambia a lo largo del periodo de lactación, a medida que se produce la independencia gradual del cordero hasta el destete natural(2). El destete artificial se realiza más tempranamente, y es caracterizado por el reemplazo completo del amamantamiento por la cría artificial con leche o la sustitución de la leche por alimentos sólidos(2,3,4). Este manejo implica la separación de la oveja y su cordero, además de cambios nutricionales para el cordero, y del ambiente físico (comúnmente los corderos y las ovejas son llevados a potreros diferentes) y social (un ambiente que estaba formado por ovejas y corderos, será formado por solamente corderos u ovejas)(2). La edad del destete artificial varía según el objetivo productivo, siendo realizado tempranamente (0-2 días) en los sistemas ovinos de producción de leche(4), y de acuerdo a nuestro conocimiento entre los 60 y 150 días en los sistemas dirigidos a la producción de carne y lana.

Sheep are characterized by a highly selective mother-lamb bonding, which is set immediately after lambing(1). The intensity of the bond changes throughout the lactation period, as the process of natural weaning advances and thus, the lamb gains independence (2) . Artificial weaning is performed earlier, and is characterized by the complete replacement of suckling by artificial rearing with milk, or milk substitution by solid food (2,3,4) . This management implies the separation of ewe and her lamb, in addition to nutritional changes to the lamb, and changes of the physical (commonly the lambs and sheep are taken to different paddocks) and social environments (an environment that was made up of sheep and lambs, will be formed by only lambs or ewes)(2). Age of artificial weaning varies according to the productive objective, being done early (0-2 d) in dairy sheep (4) , and according to our knowledge between 60 and 150 d in extensive systems aimed at meat and wool production. Weaning generates a stress response in ewes and their lambs that produces physiological changes and behavior. The intensity of the response to artificial weaning, and the consequences on production and welfare of the animals vary according to the intensity of the bond with the mother during the weaning period, the age of lambs, the sex of the offspring, breed and feeding of ewes during pregnancy and lactation (5,6,7) . There is information of the productive response and the negative effects produced by different types of weaning: abrupt, progressive, in stages, and through fencelines (placement of sheep and lambs, separated by a fence during several days before the final separation)(6,8,9,10). According to a series of studies, the abrupt weaning, despite being the most widely used weaning together with fenceline weaning, seem to be the systems that generate greater stress responses to weaning. In some studies management systems prior to weaning to decrease the stress response in sheep have been assessed.

El destete genera una respuesta de estrés tanto en la oveja como en su cordero, la que produce cambios fisiológicos y de comportamiento. La intensidad de la respuesta al destete artificial, y las consecuencias del mismo sobre la producción y el bienestar de los animales varía de acuerdo a la intensidad del vínculo con la madre durante el período anterior al destete, la edad de los corderos, el sexo de las crías, la raza y la alimentación de las ovejas durante la gestación y la lactancia(5,6,7). En ovinos se ha estudiado la respuesta productiva y los efectos negativos producidos por diferentes tipos de destete: abrupto, progresivo, en etapas, y alambrado de por medio (colocación de ovejas y corderos separados por un alambrado durante varios días antes de la separación definitiva)(6,8,9,10). De acuerdo a una serie de trabajos realizados, el destete abrupto a pesar de ser el más utilizado, y el destete realizado con alambrado de por medio, son los que generan mayores respuestas de estrés al

362

DESTETE ARTIFICIAL EN OVINOS: RESPUESTA DE ESTRÉS Y BIENESTAR ANIMAL

destete. También se han realizado trabajos para evaluar qué manejos previos al destete pueden disminuir la respuesta de estrés en ovinos.

While the stress of animals is evident at the field level, the scientific literature is still scarce and scattered. This review summarizes information about the physiological changes and behavioral responses to weaning, from both ewes and lambs, and the negative impact that this has on animal welfare and productive results. In turn, the information available on the main factors influencing the stress response to weaning is summarized, and some alternative management to decrease the negative effects are analyzed.

Si bien el estrés de los animales es evidente a nivel de campo, la bibliografía científica es aún escasa y dispersa. Esta revisión sintetiza información sobre los cambios fisiológicos y de comportamiento al destete, tanto en las ovejas como en los corderos, y las repercusiones negativas que esto tiene sobre el bienestar animal y los resultados productivos. A su vez se sintetiza la información disponible sobre los principales factores que influyen en la respuesta de estrés al destete, y se analizan algunos manejos alternativos que logran disminuir los efectos negativos.

Establishment of the mother-lamb bond

The link between the ewe and the lamb is displayed immediately lambing. Maternal behavior is induced by endocrine changes that occur in ewes during the peripartum period, mainly the decrease in the progesterone (P4) concentration and the increase on estrogen and oxytocin concentrations(11,12). In response to these changes, and only in this period, the ewe is strongly attracted to the amniotic fluid that surrounds the lamb(13). Cleaning of the lamb during the first 20 to 30 min helps the mother to recognize her offspring(14). After 60 to 120 min, if the mother receives a different offspring from her own or if she has not previously recognized her lamb, she rejects it(14). The ewe only directs her maternal behavior toward the lambs that were identified as their own offsp ri ng dur ing t h e f ir st postpartum minutes(15). Therefore, to keep the bond it is important that the lamb and the mother can identify each other among other animals in the group. Smell of the offspring is important for the memory of the mother, but the mother also recognizes her lamb through hearing and vision(16).

Establecimiento del vínculo madre-cría

El vínculo entre la oveja y el cordero se despliega inmediatamente del parto. El comportamiento maternal es inducido por los cambios endocrinos que ocurren en la oveja durante el periparto, principalmente la disminución de la concentración de progesterona (P4) y el aumento de las concentraciones de estrógenos y oxitocina(11,12). En respuesta a esos cambios, y solo en este período, la oveja tiene una fuerte atracción hacia el líquido amniótico que recubre al cordero(13). El comportamiento de limpieza del cordero desplegado durante los primeros 20-30 min ayuda a la madre a reconocer a su cría(14). Pasados los 60 a 120 min, si la madre recibe una cría diferente de la suya o si no ha reconocido previamente a su cría, la rechaza(14). Las ovejas solo dirigen su comportamiento maternal hacia los corderos que identificaron como su progenie en esos primeros minutos posparto(15). Por eso, para que el vínculo se mantenga es importante que el cordero y la madre sepan identificarse entre otros animales del grupo. El olfato es importante en la formación de la memoria de la madre hacia su cría, pero la madre también reconoce a su cría a través de la audición y visión(16).

The first behaviors displayed by the lambs after birth lead to reach the teat and suckle(13). If the mother accepts her offspring to suckle means that she has recognized it and accepted as her own(17). Lambs also recognizes their mother through sensory mechanisms, primarily hearing and vision(18), which increases the

Los primeros comportamientos desplegados por los corderos luego del parto llevan al

363

Aline Freitas-de-Melo, et al. / Rev Mex Cienc Pecu 2016;7(3):361-375

chances of survive(19). During the immediate postpartum period the mother-lamb bond is characterized by a high frequency of suckling and a strong tendency to be in physical proximity during the day (20,21) . Although temporary separations of short duration during this period do not have consequences on the later mother-lamb bond(13), they can generate transient behavior changes in the mother. For example, ewes can move away from their lamb when humans are present(22).

amamantamiento(13). Si la madre acepta que su cría mame significa que la reconoció y la aceptó como propia(17). El cordero también reconoce a su madre a través de mecanismos sensoriales, principalmente la audición y la visión(18), lo que aumenta sus probabilidades de sobrevivencia(19). El vínculo madre-cría durante el posparto inmediato se caracteriza por una alta frecuencia de amamantamientos y una fuerte tendencia de la díada a mantenerse físicamente cerca(20,21). Aunque separaciones temporarias de corta duración durante este período no tienen consecuencias sobre el vínculo madre-cría posterior (13) , pueden generar cambios de comportamiento transitorios en la madre. Por ejemplo, las ovejas pueden alejarse de la cría ante la presencia humana(22).

Natural weaning

Natural weaning is characterized by the replacement of milk by solid food and the acquisition of social independence of the lamb(2). During the first 2 wk of the life, ewes allow lambs to suckle every time they require it and gradually, as the lactation proceeds, rejection is more frequent(23). During the period of lactation and the lamb growth, suckling frequency decreases at time that the physical distance between the ewe and lamb increase(20,21). At the same time, the lamb is familiarized and adapted to the consumption of solid food(2). The decrease of the suckling frequency is also associated with rumen development(24). For example, in Santa Inés lambs, rumen development is achieved when lambs reach approximately 15 kg of weight(25), allowing the lamb to change the diet.

Destete natural

El destete natural se caracteriza por el reemplazo de la leche por comida sólida, y por la independencia social de la cría(2). Durante las primeras dos semanas de vida las ovejas permiten al cordero mamar todas las veces que ellos lo requieren y gradualmente, a medida que la lactación avanza, lo van impidiendo más frecuentemente(23). A lo largo del periodo de lactación y a medida que el cordero crece, la frecuencia de amamantamientos disminuye y la distancia física entre la oveja y el cordero aumenta(20,21). Al mismo tiempo, la cría se va familiarizando y adaptando a la ingestión de alimentos sólidos (2). La disminución de la frecuencia de amamantamientos también está asociada a un mayor desarrollo ruminal(24). Por ejemplo, en corderos Santa Inés el desarrollo del rumen se completa al alcanzar los 15 kg de peso(25), lo que implica que el cordero está apto para el cambio de dieta.

The production of ewes’ milk is one of the main factors that influence the age of the natural weaning of their lambs(26). Age of natural weaning may also vary according to the nutritional status of the ewes; one of the factors that mostly affect is mother’s milk production(27). Suckling ends with the weaning of the lamb, about 4 to 5 mo of age(26).

La producción de leche de las ovejas es uno de los principales factores que determina la edad del destete natural de sus corderos(26). La edad del destete natural también puede variar de acuerdo a la situación nutricional de las ovejas, uno de los factores que más afecta es la producción de leche de la madre (27) . El

Artificial weaning

Artificial weaning is the forced end of suckling, the end of milk supply by the ewes to their lambs, and usually involves physical separation, and therefore the loss of the mother(2,3,4). Artificial weaning is commonly applied in sheep 364

DESTETE ARTIFICIAL EN OVINOS: RESPUESTA DE ESTRÉS Y BIENESTAR ANIMAL

amamantamiento finaliza con el destete espontáneo del cordero, a partir de los 4 a 5 meses de edad(26).

production systems, since it improves the reproductive and productive results. In meat and wool sheep production, weaning is done to improve body condition and weight, since they influence positively the conception rates, prolificacy and weight of lambs at birth and at weaning (28,29) . In sheep milk production systems artificial weaning is done early to obtain more milk, and is associated with the artificial rearing of lambs with dairy substitutes(4).

Destete artificial

El destete artificial es la finalización forzada de la succión y por tanto de la obtención de la leche por parte de la cría, y generalmente incluye la separación, y por tanto la pérdida de la madre(2,3,4). El destete artificial se aplica normalmente en los sistemas de producción ovina, ya que mejora los resultados reproductivos y productivos. En la producción de ovinos de carne y lana el destete se realiza para mejorar la condición corporal y peso, ya que los mismos influyen de manera positiva en las tasas de concepción, prolificidad, peso de los corderos al parto y al destete(28,29). En los sistemas de producción ovina de leche el destete artificial se realiza tempranamente para la utilización de la leche para la fabricación de productos lácteos, y está asociado a la cría artificial de los corderos con sustitutos lácteos(4).

Artificial weaning time varies depending on the purpose of each sheep farm, and depends on age, weight and ability of the lamb to eat solid food(4). According to the productive purpose, lambs can be weaned from 24 h postpartum until the age of their natural weaning. Dairy farms maintain ewes and lambs together for 24 to 48 h to allow lambs to suckling colostrum, and then make an abrupt weaning(4). On some farms of sheep milk, lambs continue accessing their mother during short periods of time, allowing a restricted suckling. Commonly, sheep meat and wool farmers wean their lambs between 60 to 150 d of age, but most often before 120 d, moment in which the lamb already increased the intake of solid food, and after the lactation peak that occurs in the 3rd to 4rd wk postpartum. In this case, farmers separate ewes and lambs without needing artificial rearing, making easier handling, and reducing costs.

El momento del destete artificial varía según el objetivo de cada establecimiento ovino. El momento en que se realiza el destete artificial también va a depender de la edad, peso y habilidad del cordero en comer alimentos sólidos(4). De acuerdo al objetivo productivo, el destete puede ser realizado desde las 24 h posparto hasta cerca de la edad del destete natural. Los establecimientos de producción lechera mantienen la oveja con su cordero por 24 a 48 h para permitir la ingestión del calostro, para luego realizar un destete abrupto(4). En algunos establecimientos de producción de leche ovina el cordero continúa accediendo a la madre durante tiempos reducidos, permitiendo un amamantamiento restringido. Comúnmente los productores ovinos de carne y lana realizan un destete entre los 60 y 150 días de edad, aunque lo más frecuente es que sea antes de los 120 días, momento en que el cordero ya incrementó el consumo de alimentos sólidos luego del pico de lactación que se da en la 3a a 4a semana posparto. En este caso, el productor realiza la

Stress response to artificial weaning

The abrupt and complete separation of the lambs before the natural weaning age is a stressful situation for ewes and lambs, which is caused by different stressors: 1) Emotional, generated by the end of the mother-lamb bond; 2) Changes in the physical and social environment, since at least one of the two is housed in a new environment, often with other animals with which they had no previous contact; 3) End of suckling, which implies the end of the neurophysiological changes induced by suckling and 4) Nutritional change, generated by the loss of milk and its complete replacement 365

Aline Freitas-de-Melo, et al. / Rev Mex Cienc Pecu 2016;7(3):361-375

separación de la oveja y su cordero sin la necesidad de la cría artificial, facilitando el manejo y reduciendo los costos de producción.

by other food(2,10,30). The response of the animal is the result of these stressors altogether, but the relative importance of each one has been poorly studied. After separation, ewes and lambs increase the frequency of behaviors related to searching the other. There is an increase in the frequency of vocalizations(9) and at the same time standing and walking, as well as pacing (when animals walk again and again at a distance of 1 to 2 m parallel to the fence, modifying the direction of back and forth continuously), behavior that in lambs is exclusively associated with the loss of the mother(30). The increase in the number of vocalizations and pacing are behavioral changes more closely related to the stress response to weaning. Usually these changes occur quickly, reaching their maximum frequency in few hours, and lasting 3 to 4 d. The rapid end of these behaviors could be related to their lack of effectiveness, since they generate important costs without achieving positive responses(10,31). In addition, the increase breeding of the ewe and the lamb search-related behaviors, both reduce the feeding and resting time: the animals spend less time laying, grazing and ruminating after weaning (10,30,32). In recently weaned lambs fed on pastures or with dairy substitutes, some lambs redirect the suckling behavior trying to suck from other lambs(33).

Respuesta de estrés al destete artificial

La remoción abrupta y completa de los corderos antes de la edad del destete natural es una situación estresante para la oveja y para el cordero, provocada por diferentes estresores: 1) emocional, generado por la ruptura del vínculo madre-cría; 2) cambios en el ambiente físico y social, ya que al menos uno de ambos es alojado en un nuevo ambiente, muchas veces con otros animales con los que no tenía contacto previo; 3) cese de la succión, lo que implica el cese de los cambios neurofisiológicos inducidos por la misma; y 4) cambio nutricional, generado por la pérdida de la leche y su sustitución completa por otros alimentos (2,10,30) . La respuesta del animal es consecuencia de todos estos estresores en conjunto, pero la importancia relativa de cada uno ha sido escasamente estudiada. Luego de la separación, la oveja y el cordero aumentan la frecuencia de comportamientos relacionados a la búsqueda del otro. Se observa un aumento de la frecuencia de vocalizaciones(9) y del tiempo que pasan parados y caminando, además de que frecuentemente costean (cuando los animales se mueven repetidas veces a 1 a 2 m de manera paralela al alambrado modificando la dirección de ida y vuelta en forma continua), comportamiento que en los corderos se asocia exclusivamente a la pérdida de la madre(30). El aumento en la cantidad de vocalizaciones y el despliegue del comportamiento costear son los cambios de comportamiento más indicativos de la respuesta de estrés al destete. Generalmente estos cambios se producen rápidamente, alcanzan su máxima frecuencia en pocas horas, y se manifiestan durante 3 a 4 días. El rápido cese de estos comportamientos podría estar relacionado a su falta de efectividad, ya que generan un importante costo sin lograr respuestas positivas(10,31). Además, al aumentar los comportamientos relacionados con la búsqueda de la cría o de la madre, las ovejas

The loss of the mother as a result of weaning is a main factor in the response of lamb’s stress. Damian et al(30) compared the stress response of lambs at weaning if they were reared artificially with sheep’s milk supplied in artificial teats or reared by their mothers. At weaning and when artificial rearing ended, only the lambs who lost their mother paced, and walked and vocalized more, decreasing the time grazing. This shows that these behaviors are mainly affected by the loss of the mother, and to a lesser extent by the loss of milk suckling and the change of feeding as a whole. Weaning also produces acute physiological changes indicators of stress in ewes and lambs, as a rapid increase in the serum concentration 366

DESTETE ARTIFICIAL EN OVINOS: RESPUESTA DE ESTRÉS Y BIENESTAR ANIMAL

y corderos reducen los comportamientos de alimentación y descanso: los animales pasan menos tiempo echados, pastando y rumiando luego del destete(10,30,32). En corderos recién destetados alimentados en base a pasturas o con sustitutos lácteos, se ha observado que algunos corderos redirigen el comportamiento de succión intentando mamar de otros corderos(33).

of cortisol(34,35), which is one of the main endocrine indicators of the stress response in sheep(36,37). The increase in the secretion of cortisol is associated with modulation of the immune response of the animal(38), since in ruminants, it has been reported that artificial weaning impairs immune function(39,40,41). Moreover, the amount of antibodies synthesized after an antigenic challenge is lower in the lambs during the postweaning than at other times(42). After weaning, there is an increase in the number of leukocytes(8), and a decrease in the concentration of total proteins and globulins of the ewe(10). As weaning is a stressful management that affects the immune system, the animals may be more susceptible to diseases. For example, lambs recently weaned and experimentally infected with Haemonchus contortus and Trichostrongylus colubriformis had more eggs of these parasites, lower hematocrit, and a posterior lower production of antibodies against these parasites than unweaned controls(43). It has also been reported that weaning naturally increases the excretion of coccidia oocysts(8,9).

La pérdida de la madre como consecuencia del destete es un factor central en la respuesta de estrés de los corderos. Damián et al (30) compararon la respuesta de estrés al destete de corderos criados artificialmente con leche ovina suministrada en ubres artificiales y corderos criados por sus madres. Al destete y cuando cesó la cría artificial (desleche) se observó que solamente los corderos que perdieron la madre desplegaron el comportamiento de costear, y dedicaron más a caminar y vocalizar, disminuyendo el tiempo pastando. Esto demuestra que estos comportamientos están afectados mayormente por la pérdida de la madre, y en menor medida por la pérdida de la leche, la succión y el cambio de alimentación en su conjunto.

Weaning also affects negatively the growth of the lambs, and if they are not artificially reared, this effect may be even greater in lambs weaned before ending the development of the rumen(44,45). This delay in growth could also be explained as a consequence of the worst immune status and increased susceptibility to gastrointestinal parasites, as well as changes of behavioral indicators of stress (8,30,43) . In synthesis, the behavioral changes and the physiological responses have negative consequences both at production and on welfare of animals, so it is important to develop alternatives to decrease them.

El destete también provoca cambios fisiológicos agudos indicadores de estrés en las ovejas y corderos, como un aumento rápido en la concentración sérica de cortisol(34,35), que es uno de los principales indicadores endocrinos de la respuesta de estrés en ovinos(36,37). El aumento de la secreción de cortisol está asociado con la modulación de la respuesta inmune del animal(38), ya que en los rumiantes se ha reportado que el destete artificial afecta negativamente la función inmune(39,40,41). Más aún, la cantidad de anticuerpos sintetizados luego de un desafío antigénico es menor en los corderos durante el período posdestete que en otros momentos(42). Luego del destete en las ovejas se observa un aumento de los leucocitos(8), y una disminución de la concentración de proteínas totales y globulinas(10). Dado que el destete es un manejo estresante y que afecta el sistema inmune, puede aumentar la

Factors affecting the response to separation of the ewe and her lamb

There are many factors that can influence the intensity of the response to the separation of the ewes and their lambs, as age, sex, genetics and feeding of the sheep during pregnancy. The excitement and the frequency of 367

Aline Freitas-de-Melo, et al. / Rev Mex Cienc Pecu 2016;7(3):361-375

vocalizations are greater after weaning lambs at 2 than at 4 mo (6) . The same authors observed the same behavioral changes, and a lower growth rate of the lambs when they weaned them at 13 to 16 wk(46).

susceptibilidad del animal a enfermedades. Por ejemplo, corderos recientemente destetados e infectados experimentalmente con Haemonchus contortus y Trichostrongylus colubriformis presentaron una mayor cantidad de huevos de estos parásitos, menor hematocrito, y una menor producción posterior de anticuerpos contra estos parásitos que los controles no destetados(43). Asimismo, se ha reportado que el destete provoca naturalmente un aumento de la excreción de ooquistes de coccidios(8,9).

The effect of age at weaning on the growth of the lambs has been widely studied(44,45,47,48). In general, the rate of growth is more affected when weaning is performed earlier, which is probably due to a slower adaptation to solid food intake in younger lambs(49). In addition, mortality rates at 210 d were greater in lambs weaned at 45 d than at 60 and 75 d(50). These results indicate that at a younger age, when the ewe-lamb bond is stronger, and lambs have a greater social and nutritional dependence, the negative effects of weaning on the lambs’ welfare are greater.

El destete también afecta negativamente el crecimiento de los corderos, el que puede ser más marcado en los corderos destetados antes de completar el desarrollo del rumen si no son criados artificialmente(44,45). Este retraso en el crecimiento también podría ser explicado como consecuencia del peor estatus inmunológico y el aumento de la susceptibilidad a parasitosis gastrointestinales, además de los cambios de comportamiento indicadores de estrés(8,30,43). En síntesis, los cambios de comportamiento y las respuestas fisiológicas tienen consecuencias negativas tanto a nivel productivo como en el bienestar de los animales, por lo que es importante desarrollar alternativas para disminuirlas.

It has also been determined that female lambs have stronger lamb-ewe bonds and greater responses to stressors than male lambs(51,52,53). In domestic sheep without limitations in the availability of food, abrupt weaning affected more the susceptibility to parasites and the growth rate of females than males(5,9). On the other hand, mountain sheep lambs (Bighorn) males weaned 2 to 4 wk before the estimated time of the natural weaning, showed slower growth until puberty than those that remained with their mothers, but females were not affected(54). This study was performed in natural conditions, where changes in the quality and quantity of available nutrients change throughout the year, having periods with strong feed limitations. This, together with the greater growth rate and energy demand of males, could explain the difference between male and female lambs. In general, although it has been reported that there are differences in susceptibility to parasites and the response of the immune system according to the gender of the offspring(55,56,57), information about the factors that differentially affect males and females in response to artificial weaning is still insufficient.

Factores que afectan la respuesta a la separación de la oveja y su cordero

Existen muchos factores que pueden influir sobre la intensidad de la respuesta a la separación de la oveja y su cordero, como la edad, el sexo, la genética y la alimentación de la oveja durante la gestación. La agitación y la frecuencia de vocalizaciones fueron mayores luego del destete en corderos de 2 que de 4 meses(6). Los mismos autores observaron los mismos cambios de comportamiento, y una menor tasa de crecimiento de los corderos cuando el destete se realizó a las 13 que a las 16 semanas(46).

El efecto de la edad al destete sobre el crecimiento de los corderos ha sido ampliamente estudiado(44,45,47,48). De manera general lo que 368

DESTETE ARTIFICIAL EN OVINOS: RESPUESTA DE ESTRÉS Y BIENESTAR ANIMAL

se ha observado es que cuanto menor es la edad al destete más se afecta la tasa de crecimiento, lo que probablemente sea debido a una adaptación más lenta al consumo de alimentos sólidos de los corderos más jóvenes(49). Además, corderos destetados a los 45 días de edad presentaron mayor mortalidad y fueron más livianos a los 210 días que los destetados a los 60 y 75 días(50) . Estos resultados indican que a menor edad, más fuerte es el vínculo oveja-cordero, y mayor es la dependencia social y nutricional de las crías, y por lo tanto las repercusiones negativas del destete sobre el bienestar de los corderos.

Lambs of different breeds have different growth rates, implying different degrees of advance in their natural weaning, and therefore the response to artificial weaning. Rhoenschaf lambs vocalized more at weaning than Merino lambs(58), which can be explained by the greater body development of this last(58). Similarly, F1 Texel by Corriedale lambs showed greater body weight and more rumination after weaning than pure Corriedale lambs, despite being both reared by Corriedale mothers(59,60).

The feeding level of the mother during pregnancy or after parturition can also affect the response of the lambs at weaning. Important feed restriction during pregnancy adversely affects the mother-lamb bond at lambing(61) delays mother-lamb recognition(62), and may alter the natural weaning process. Recently, it was observed that ewes maintained with food restriction before conception until the last third of gestation had lower body weight during pregnancy and produced less milk in the postpartum(7)(Freitas-de-Melo A, Ungerfeld R and Pérez-Clariget R, unpublished data). Lambs born from feed-restricted ewes grazed more before weaning, vocalized less and presented minor changes in the concentrations of albumin after weaning(63)(Freitas-de-Melo A, Ungerfeld R and Pérez-Clariget R, unpublished data). Probably the lambs of ewes that had better nutrition during pregnancy were more stressed because they had more losses at weaning, since in addition to the mother, they lost a greater quantity of milk in an age in which consumption is still important. Another no opposed explanation is that lambs born from undernourished ewes had advanced their natural weaning process, since they presented a greater frequency of grazing before weaning probably to compensate the access to less milk amounts.

También se ha determinado que las corderas presentan mayor intensidad de vínculo madrecría y mayor respuesta a estresores que los machos(51,52,53). En ovinos domésticos sin limitantes en la disponibilidad de alimento, el destete abrupto afectó más la susceptibilidad a parásitos y la tasa de crecimiento de las hembras que la de los machos(5,9). Contrariamente, corderos machos de ovejas de montaña (Big Horn) destetados 2 a 4 semanas antes del tiempo estimado del destete natural presentaron menor crecimiento hasta la pubertad que los que permanecieron con sus madres, pero las hembras no se vieron afectadas(54). Este trabajo se realizó en condiciones naturales, donde los cambios en la calidad y cantidad de nutrientes disponibles cambia a lo largo del año, habiendo periodos con fuertes limitantes de alimento. Esto, sumado a que los machos generalmente presentan una mayor tasa de crecimiento y demanda energética, podría explicar la diferencia entre corderos y corderas. De manera general, si bien se ha reportado que existen diferencias en la susceptibilidad a parásitos y en la respuesta del sistema inmune según el sexo de la cría(55,56,57), la información sobre los factores que afectan diferencialmente a los corderos y las corderas en la respuesta al destete artificial es aún insuficiente.

Types of artificial weaning

In sheep the available published scientific information relating ewe-lamb bond before weaning and the stress response is scarce. There are commonly four types of artificial weaning: abrupt, progressive, in steps with

Corderos de diferentes razas presentan diferentes tasas de desarrollo, por lo que también van a diferir en los ritmos de avance del destete natural, y por tanto la respuesta al

369

Aline Freitas-de-Melo, et al. / Rev Mex Cienc Pecu 2016;7(3):361-375

destete artificial. Se determinó que corderos de la raza Rhoenschaf vocalizaron más al destete que los corderos de la raza Merino(58), lo que puede ser explicado por el mayor desarrollo corporal de estos últimos(58). De manera similar, corderos Texel por Corriedale F1 presentaron mayor peso corporal y rumiaron más luego del destete, que corderos Corriedale puros, a pesar de ser ambos criados por madres Corriedale(59,60).

restriction of the time accessing the mother, and in steps through a fenceline. The most commonly applied type is abrupt weaning, with a complete separation of the ewe and her lamb so there is no visual, auditory or olfactory contact after weaning(10).

Progressive weaning is the gradual separation of the ewe and her lamb to increase the time of separation until the complete separation. In this type of weaning, vocalizations increase in the first periods of temporary separation, but animals habituate to the separations, and therefore changes are not so intensive after definitive separation(8). However, progressive weaning has caused a greater sensitivity to the infestation of parasites before and after definitive weaning(8). According to these authors, the lambs had greater sensitivity to parasite infestation (weaning was done at 3 mo), so according to them, at this age is preferable to abrupt weaning so the increase in the infestation of parasites is not so great(8).

El nivel de alimentación de la madre durante la gestación o luego de la misma también puede afectar la respuesta de los corderos al destete. Una restricción alimenticia importante durante la gestación afecta negativamente el vínculo madre-cría al parto (61) y retrasa el reconocimiento madre-cría(62), pudiendo alterar el proceso de destete natural. Recientemente se observó que las ovejas mantenidas con restricción alimenticia desde antes de la concepción hasta el tercio final de la gestación tuvieron un peso menor durante la gestación y una menor producción de leche en el posparto(7)(Freitas-de-Melo A, Ungerfeld R y Pérez-Clariget R, datos no publicados). Los corderos hijos de las ovejas que sufrieron restricción alimenticia pastaban más antes del destete, vocalizaron menos y presentaron un menor cambio en las concentraciones de albúmina luego del destete(63)(Freitas-de-Melo A, Ungerfeld R y Pérez-Clariget R, datos no publicados). Probablemente los corderos hijos de las ovejas que tuvieron un mejor plano nutricional durante la gestación se estresaron más porque tuvieron mayores pérdidas al destete, ya que además de la madre, perdieron una mayor cantidad de leche en una edad en que el consumo aún es importante. Otra explicación no contrapuesta es que los corderos hijos de las ovejas que sufrieron subnutrición hubieran adelantado su proceso de destete natural, ya que presentaron una mayor frecuencia de pastoreo antes del destete probablemente para compensar su dieta.

In weaning through fences animals can communicate, and thus visual, auditory and olfactory contact is maintained before the final separation(64). However, in this method lambs vocalized more the day of weaning, indicating greater stress than after abrupt weaning. Although females weaned from this method weighed more after weaning, they presented a smaller increase of the amount of coccidia that those weaned abruptly(9), indicating that the immune response was adversely affected after the abrupt weaning.

There are some studies in two-steps weaning, in which during the first period the lambs are barred from suckling of the lamb covering the udder of the ewe, and in a second stage is the definitive separation. The lambs thus weaned responded with less agitation and vocalized less than abruptly weaned lambs(6). Management to reduce the stress response to weaning

Tipos de destete artificial

En ovinos la información científica publicada disponible sobre cómo distintos manejos del

In addition to different types of weaning, there are some practices that can be applied before 370

DESTETE ARTIFICIAL EN OVINOS: RESPUESTA DE ESTRÉS Y BIENESTAR ANIMAL

vínculo madre-cría previo al destete afectan la respuesta de estrés al destete es escasa. Se han evaluado cuatro tipos de destete artificial: abrupto, progresivo, en etapas con restricción en el tiempo de acceso a la madre, y alambrado de por medio. El tipo más común de destete artificial es el abrupto, donde se realiza la separación completa de la oveja y su cordero de forma que no hay contacto visual, auditivo ni olfativo luego del destete(10).

or after weaning to reduce the response of ewes and lambs. Intravaginal devices used to synchronize estrus that release progesterone reduce the ewe response to weaning(10). With these treatments ewes vocalize and pace less frequently. In addition, the treatment moderated the decrease of total proteins concentration, due to a minor reduction of the globulin concentration. The values of serum globulins after weaning in the untreated ewes decreased more than in ewes treated, reaching levels of hipoglobulinemia, which could indicate a state of immuno-deficiency. Therefore, this treatment can reduce susceptibility to diseases of ewes after weaning.

En el destete progresivo se realiza la separación gradual de la oveja y su cordero aumentando el tiempo de separación hasta la separación completa. En este tipo de destete se ha observado un aumento de las vocalizaciones en los primeros periodos de separación temporaria, pero los animales se acostumbran a las separaciones, y por tanto, cuando se realiza el destete definitivo los cambios de comportamiento no son tan intensos(8). Sin embargo, el destete progresivo ha provocado una mayor sensibilidad a la infestación de parásitos antes y después del destete definitivo(8). De acuerdo a estos autores los corderos presentaban una mayor sensibilidad a la infestación a parásitos (el destete fue realizado a los 3 meses), por lo que de acuerdo a los mismos, a esta edad es preferible el destete abrupto para que no aumente tanto la infestación(8).

Although this treatment reduced the stress response to weaning, its application is not practical, as the treatment is prolonged and expensive. For this reason, it was recently investigated whether treatment with injectable progesterone administered only the day of weaning reduces the response of stress in sheep, which would generate practical alternatives. This treatment reduced markedly the frequency of pacing and walking the day of weaning, and a tendency to reduce the frequency of vocalizations compared with the control group(65). Other management that reduce the stress response is to induce estrus in the ewes by hormonal treatments the day of weaning, at the same time that rams are introduced(35). This management reduced the increase of vocalization frequency and the cortisol concentration at weaning, and may be easily included in accelerated lambing systems aimed to obtain pregnant ewes during the early postpartum period.

En el destete realizado con un alambrado de por medio los animales se pueden comunicar, ya que se mantiene el contacto visual, auditivo y olfativo antes de la separación definitiva(64). Sin embargo, en este método de destete los corderos vocalizaron más al día del destete, lo que indica mayor respuesta de estrés que en el destete abrupto. Aunque las hembras destetadas a partir de este método pesaron más después del destete, presentaron un menor aumento de la cantidad de coccidios que las que se destetaron abruptamente(9), lo que indica que la respuesta inmune se afectó negativamente luego del destete abrupto.

It is also important to consider the management of animals after weaning. The post-weaning social enrichment improves the welfare of lambs(66). The stress response of the lambs diminished when lambs remained for 1 h per day in close contact with a human who handled them gently (caressed them and spoke to them)

También se han estudiado los efectos del destete en dos etapas, en la primera se impide el

371

Aline Freitas-de-Melo, et al. / Rev Mex Cienc Pecu 2016;7(3):361-375

amamantamiento del cordero cubriendo la ubre de la oveja, y en una segunda etapa se realiza la separación definitiva. Los corderos destetados de esta forma respondieron con menor agitación y vocalizaron menos que los destetados abruptamente(6).

after weaning, or if stayed in contact with two adult ewes. In addition, the animals who received these treatments of social enrichment grew more during the fattening period. At the end of the fattening period, the lambs that were in contact with the human immediately after weaned were less reactive to human manipulation.

Manejos para reducir la respuesta de estrés al destete

Similarly, weaned lambs that grazed together with adult ewes presented a higher bite rate, and ruminated and grazed more than single weaned lambs(67). These results indicate that the presence of adult animals at weaning mitigates the negative effects of separation from the mother, improving the efficiency of grazing. However, this, rather than as part of social enrichment, can be part of a strategy of social facilitation accelerating feeding learning by the lambs. It was also noted that the provision of a protein supplementation after weaning reduced parasite infestation in ewes (5) , improving the animals’ welfare.

Además de diferentes tipos de destete, se han estudiado diferentes prácticas de manejo que pueden ser aplicadas antes, al día o luego del destete para disminuir la respuesta de estrés de ovejas y corderos. La aplicación de dispositivos intravaginales utilizados para sincronizar celos que liberan progesterona reduce la respuesta de estrés de las ovejas al destete(10). Con estos tratamientos se observa una menor cantidad de vocalizaciones y los animales realizaron menos frecuentemente el costeo. Además, el tratamiento moderó la disminución en las concentraciones de las proteínas totales, debido a una menor reducción de la concentración de globulinas. Los valores de globulinas séricas luego del destete en las ovejas no tratadas disminuyeron más que en las ovejas tratadas, alcanzando niveles de hipoglobulinemia, lo que podría indicar un estado de inmuno-deficiencia. Por lo tanto, este tratamiento puede reducir la susceptibilidad a enfermedades de las ovejas después del destete.

Synthesis

In summary, artificial weaning is a stressful event for both the ewe and lamb, affecting their health the welfare, and the productive results. While this handling is necessary to optimize the productive results, the development and implementation of management systems that reduce stress, in addition to promoting animal welfare, could have an even more positive impact on health and productive aspects. However, the available knowledge on how to reduce the negative effects of weaning is still scarce, especially considering that many of them are applicable only in specific production systems. The great variability of breeds existing in sheep productive systems makes it necessary to develop a range of tools that can impact according to the different conditions, but allowing in synthesis, to respond to the current demands of society and increase the efficiency of the production systems.

Si bien este tratamiento redujo la respuesta de estrés al destete, su aplicación no es viable desde el punto de vista práctico, ya que el tratamiento es prolongado y costoso. Por eso, recientemente investigamos si un tratamiento con progesterona inyectable administrada solamente el día del destete reduce la respuesta de estrés en las ovejas, lo que permitiría generar alternativas de aplicación práctica. Con este tratamiento se redujo marcadamente la frecuencia en que se observó a las ovejas costeando y caminando el día del destete, y una tendencia a vocalizar menos que el grupo control(65).

End of english version

Otro manejo que reduce la respuesta de estrés es la inducción hormonal del celo de las ovejas

372

DESTETE ARTIFICIAL EN OVINOS: RESPUESTA DE ESTRÉS Y BIENESTAR ANIMAL

el día del destete, al mismo tiempo que se introducían carneros(35). Este manejo redujo el aumento de la frecuencia de vocalizaciones y en la concentración de cortisol al destete, al tiempo que puede ser aplicado en sistemas de reproducción acelerada en que interesa preñar a las ovejas tempranamente en el posparto.

de los animales, y los resultados productivos. Si bien este manejo es necesario para optimizar los resultados productivos, el desarrollo y aplicación de manejos que disminuyan el estrés, además de favorecer el bienestar animal, podría tener un impacto aún más positivo sobre aspectos sanitarios y productivos. Sin embargo, el conocimiento existente sobre cómo disminuir los efectos negativos del destete es aún escaso, sobre todo considerando que muchos de ellos son aplicables solamente en sistemas productivos específicos. La gran variabilidad de razas y sistemas productivos existentes en ovinos hace necesario desarrollar un abanico de herramientas que puedan tener impacto de acuerdo a las condiciones de cada uno, pero que permitan en síntesis responder a las exigencias actuales de la sociedad y aumentar la eficiencia de los sistemas productivos.

También es importante el manejo que se realiza con los animales luego del destete. El enriquecimiento social posdestete mejora el bienestar de los corderos(66). La respuesta de estrés de los corderos disminuyó cuando luego del destete los corderos permanecían durante 1 h por día en contacto estrecho con un humano que los manejaba gentilmente (les acariciaba y les hablaba), o si permanecían en contacto con dos ovejas adultas. Además, los animales que recibieron estos tratamientos de enriquecimiento social crecieron más durante el periodo de engorde. Al finalizar el periodo de engorde, los corderos que estuvieron en contacto con el humano inmediatamente del destete fueron menos reactivos a la manipulación humana.

LITERATURA CITADA 1.

De manera similar, corderos destetados que pastorearon en grupos integrados también por ovejas presentaron una mayor tasa de bocados, rumiaron y pastorearon más que los corderos destetados solos(67). Estos resultados indican que la presencia de animales adultos al destete mitiga los efectos negativos de la separación de la madre mejorando la eficiencia de pastoreo. Sin embargo, esto, más que como parte del enriquecimiento social, puede ser consecuencia de una estrategia de facilitación social acelerando el aprendizaje de los corderos en su nueva alimentación. También se ha observado que la provisión de una suplementación proteica a partir del destete redujo la infestación de parásitos en corderos (5) , lo que incidió positivamente sobre el bienestar de los animales.

2. 3. 4. 5.

6. 7.

Síntesis

En síntesis, el destete artificial es un evento estresante tanto para la oveja como para el cordero, por lo que afecta la salud y el bienestar

373

Poindron P, Levy F, Keller M. Maternal responsiveness and maternal selectivity in domestic sheep and goats: the two facets of maternal attachment. Dev Psychobiol 2006;(49):5470. Weary DM, Jasper J, Hötzel MJ. Understanding weaning distress. Appl Anim Behav Sci 2008;(110):24-41.

Brown TH. Early weaning of lambs. J Agric Sci 1964;(63):191-204.

Napolitano F, Rosa D, Sevi A. Welfare implications of artificial rearing and early weaning in sheep. Appl Anim Behav Sci 2008;(110):58-72.

Shaw KL, Nolan JV, Lynch JJ, Coverdale OR, Gill HS. Effects of weaning, supplementation and gender on acquired immunity to Haemonchus contortus in lambs. Int J Parasitol 1995;(25):381-387. Schichowski C, Moors E, Gauly M. Effects of weaning lambs in two stages or by abrupt separation on their behavior and growth rate. J Anim Sci 2008;(86):220-225.

Freitas-de-Melo A, Ungerfeld R, Hötzel MJ, Abud MJ, AlvarezOxiley A, Orihuela A, et al. Mother–young behaviours at lambing in grazing ewes: Effects of lamb sex and food restriction in pregnancy. Appl Anim Behav Sci 2015;(168):3136. Orgeur P, Mavric N, Yvore P, Bernard S, Nowak R, Schaal B, Levy F. Artificial weaning in sheep: consequences on behavioural, hormonal and immuno-pathological indicators of welfare. Appl Anim Behav Sci 1998;(58):87-103. Orgeur P, Bernard S, Naciri M, Nowak R, Schaal B, Levy F. Psycological consequences of two different weaning methods in sheep. Reprod Nutr Dev 1999;(39):231-244.

Aline Freitas-de-Melo, et al. / Rev Mex Cienc Pecu 2016;7(3):361-375 10. Freitas-de-Melo A, Banchero G, Hötzel MJ, Damián JP, Ungerfeld R. Progesterone administration reduces the behavioural and physiological responses of ewes to abrupt weaning of lambs. Animal 2013;(8):1367-1373.

and productive traits in Lori-Bakhtiari sheep. Small Ruminant Res 2012;(106):105-109.

30. Damián JP, Hötzel MJ, Banchero G, Ungerfeld R. Behavioural response of grazing lambs to changes associated with feeding and separation from their mothers at weaning. Res Vet Sci 2013;(95):913-918.

11. Nowak R, Porter RH, Blache D, Dwyer CM. Behaviour and the welfare of the sheep. In: Dwyer C editor. The welfare of sheep. 1rst ed. Edinburgh, United Kingdom: Springer; 2008:81-134.

31. Weary DM, Fraser D. Signalling need: costly signals and animal welfare assessment. Appl Anim Behav Sci 1995;(44):159-169.

12. Lynch JJ, Hinch GN, Adams DB. The behaviour of sheep: Biological principles and implications for production. Melbourne, CSIRO, (1992):126-152.

32. Cockram MS, Imlah P, Goddard PJ, Harkiss GD, Waran NK. The behavioural, endocrine and leucocyte response of ewes to repeated removal of lambs before the age of natural weaning. Appl Anim Behav Sci 1993;(38):127-142.

13. Poindron P, Le Neindre P. Endocrine and sensory regulation of the maternal behavior in the ewe. Adv Study Behav 1980;(11):75-119.

33. Stephens DB, Baldwin BA. Observations on the behaviour of groups of artificially reared lambs. Res Vet Sci 1971;(12):219-224.

14. Smith FV, Van-toller C, Boyes T. The ‘critical period’ in the attachment of lambs and ewes. Anim Behav 1966;(14):120125. 15. Clutton-Brock TH. The evolution of parental care. 1rst ed. Princeton: Princeton University Press; 1991.

34. Rhind SM, Reid HW, McMillen SR, Palmarini G. The role of cortisol and b-endorphin in the response of the immune system to weaning in lambs. Anim Sci 1998;(66):397-402.

17. Nowak R, Keller M, Val-Laillet D, Lévy F. Perinatal visceral events and brain mechanisms involved in the development of mother-young bonding in sheep. Horm Behav 2007;(52):92-98.

36. Bush IE, Ferguson KA. The secretion of the adrenal cortex in sheep. J Endocr 1953;(10):1-8.

16. Lévy F, Keller M, Poindron P. Olfactory regulation of maternal behavior in mammals. Horm Behav 2004;(46):284-302.

35. Pérez-León I, Orihuela A, Lidfors L, Aguirre V. Reducing mother young separation distress by inducing ewes into oestrous into day of weaning. Anim Welf 2006;(15):383389.

18. Nowak R. Senses involved in discrimination of merino ewes at close contact and from a distance by their newborn lambs. Anim Behav 1991;(42):357-366.

37. Möstl E, Palme R. Hormones as indicators of stress. Domest Anim Endocrinol 2002;(23):67-74.

38. Griffin JFT. Stress and immunity: A unifying concept. Vet Immunol Immun 1989;(20):263-312.

19. Nowak R, Lindsay DR. Discrimination of Merino ewes by their newborn lambs: important for survival? Appl Anim Behav Sci 1992;(34):61-74.

39. Blecha F, Pollman DS, Nichols DA. Weaning pigs at an early age decreases cellular immunity. Can J Vet Res 1986;(4):522525.

20. Hinch GN, Lecrivain E, Lynch JJ, Elwin RL. Changes in maternal-young associations with increasing age of lambs. Appl Anim Behav Sci 1987;(17):305-318.

40. Lynch EM, Earley B, McGee M and Doyle S. Characterisation of physiological and immunological responses in beef cows to abrupt weaning and subsequent housing. BMC Vet Res 2010;(6):37.

21. Hinch GN. The suckling behaviour of triple, twin and single lambs at pasture. Appl Anim Behav Sci 1989;(22):39-48. 22. O’Connor CE, Jay NP, Nicol AM, Beatson PR. Ewe maternal behaviour score and lamb survival. Proc N Z Soc Anim Prod 1985;(45):159-162.

41. Ungerfeld R, Hotzel MJ, Scarsi A, Quintans G. Behavioral and physiological changes in early-weaned multiparous and primiparous beef cows. Animal 2011;(8):1270-1275.

23. Ewbank E. Nursing and suckling behaviour amongst Clun Forest ewes and lambs. Anim Behav 1967;(15):251-258.

24. Lyford SJ. Growth and development of the ruminant digestive system. In: Curch DC editor. The Ruminant Animal. New Jersey, USA: Prentice-Hall, 1988:44-63.

42. Napolitano F, Marino V, De Rosa G, Capparelli R, Bordi A. Influence of artificial rearing on behavioral and immune response of lambs. Appl Anim Behav Sci 1995;(45):245253.

26. Arnold GW, Wallace SR, Maller RA. Some factors involved in natural weaning processes in sheep. Appl Anim Ethol 1979;(5):43-50.

44. Lee GJ, Harris D, Ferguson BD, Jelbart RA. Growth and carcass fatness of ewe, wether, ram and cyptorchid crossbred lambs reared at pasture: effects of weaning age. Aust J Exp Agr 1990;(30):743-747.

43. Watson DL, Gill HS. The effect of weaning on antibody responses and nematode parasitism in Merino lambs. Res Vet Sci 1991;(51):128-132.

25. Geraseev LC, Perez JRO, Pedreira BC, Quintão FA, Oliveira RP. Effects of pre and postnatal nutritional restriction on visceral mass growth of Santa Ines lambs. Arq Bras Med Vet Zoo 2008;(60):960-969.

27. Berger J. Weaning conflict in desert and mountain bighorn sheep ( Ovis canadensis ): an ecological interpretation. Z Tierpsychol 1979;(50):188-200.

45. Caneque V, Velasco S, Diaz M, Perez C, Huidobro F, Lauzurica S, et al. Effects of weaning age and slaughter weight on carcass and meat quality of Talaverana breed lambs raised at pasture. Anim Sci 2001;(73):85-95.

28. Vatankhaha M, Salehi SA. Genetic and non-genetic factors affecting Lori-Bakhtiari ewe body weight and its relationship with productivity. Small Ruminant Res 2010;(94):98-102.

46. Schichowski C, Moors E, Gauly M. Influence of weaning age and an experimental Haemonchus contortus infection on behaviour and growth rates of lambs. Appl Anim Behav Sci 2010;(125):103-108.

29. Vatankhah M, Talebi MA, Zamani F. Relationship between ewe body condition score (BCS) at mating and reproductive

374

DESTETE ARTIFICIAL EN OVINOS: RESPUESTA DE ESTRÉS Y BIENESTAR ANIMAL 47. Geenty KG. Influence of weaning age, management, and slaughter age on export lamb carcass production and slipe wool weights. N Z J Agric Res 1980;(23):433-440.

59. Freitas-de-M elo A, Ungerfeld R, Pérez-Clariget R. Cruzamientos ovinos Texel por Corriedale: I. Comportamiento alimenticio y crecimiento corporal de los corderos. Aceptado para su presentación en XXIV Congreso de la Asociación Latinoamericana de Producción Animal (ALPA). Puerto Varas. Chile. 2015.

48. Gaili E. Effect of weaning age on postweaning feedlot performance and carcass characteristics of Najdi lambs. World Rev Anim Prod 1992;(27):61.

50. Aksakal V, Ebru E, Memis O, Muhlis M. Effects of various ages of weaning on growth performance of Morkaraman lambs. J Anim Vet Adv 2009;(8):1551-1554.

60. Freitas-de-M elo A, Ungerfeld R, Pérez-Clariget R. Cruzamientos ovinos Texel por Corriedale: II. Respuesta comportamental de los corderos al destete. Aceptado para su presentación en XXIV Congreso de la Asociación Latinoamericana de Producción Animal (ALPA). Puerto Varas. Chile. 2015.

52. Hernandez CE, Matthwes LR, Oliver MH, Bloomfield FH, Harding JE. Effects of sex, litter size and periconceptional ewe nutrition on the ewe–lamb bond. Appl Anim Behav Sci 2009;(120):76-83.

62. Olazabal-Fenochio A, Vera-Ávila HR, Serafín-López N, Medrano-Hernández JA, Sánchez-Saucedo H, Terrazas-García AM. Reconocimiento mutuo madre-cría en ovinos Columbia con restricción nutricional durante la gestación. Rev Mex Cienc Pecu 2013;4(2):127-147.

49. Langland JP, Donald GE. The intakes and growth rate of grazing Border Leicester X Merino lambs weaned at 21, 49, and 77 days. Anim Prod 1975;(21):175-181.

61. Dwyer CM, Lawrence AB, Bishop SC, Lewis M. Ewe-Lamb bonding behaviours at birth are affected by maternal undernutrition in pregnancy. Brit J Nut 2003;(89):123-136.

51. Gaudin S, Chaillou E, Cornilleau F, Moussu C, Boivin X, Nowak R. Daughters are more strongly attached to their mother than sons: a possible mechanism for early social segregation. Anim Behav 2015;(102):33-43.

53. Hernandez CE, Matthews LR, Oliver MH, Bloomfield FH, Harding JE. Effects of sex, litter size and periconceptional ewe nutrition on offspring behavioural and physiological response to isolation. Physiol Behav 2010;(101):588-594.

63. Freitas-de-Melo A, Ungerfeld R, Abud MJ, Pérez-Clariget R. Behavioural response of lambs weaned from ewes that grazed in two pasture allowances in pregnancy. Ann Meet European Fed Anim Sci (EAAP). Varsovia; Polonia. 2015:367.

54. Festa-Bianchet M, Jorgenson JT, Wishart WD. Early weaning in bighorn sheep, Ovis canadensis affects growth of males but not of females. Behav Ecol 1994;(5):21-27.

64. Orihuela A, Suárez E, Vázquez R. Effect of restricting suckling on the social bond between ewes and their 10-week-old lambs. Livest Prod Sci 2004;(87):259-264.

55. Folstad I, Karter AJ. Parasites, bright males and the immunocompetence handicap. American Naturalist 1992;(139):603-622.

56. Barger IA. Influence of sex and reproduction status on susceptibility of ruminants to nematode parasitism. Int J Parasitol 1993;(23):463-469.

65. Freitas-de-M elo A, Ungerfeld R, Pérez-Clariget R. Progesterone administration reduces the behavioural response of ewes at weaning. Ann Meet European Fed Anim Sci (EAAP). Varsovia; Polonia. 2015:369.

58. Seibert B, Gauly M, Erhardt G. Productivity of different sheep breeds in extensive pasture management. Arch Tierz 2004;(47):147-152.

67. Youssef MYI, Philips CJC, Metwally M. The effect of preweaning grazing experience and presence of adult ewes on grazing behaviour of weaned lambs. Appl Anim Behav Sci 1995;(44):257-281.

66. Pascual-Alonso M, Miranda-de la Lama GC, Aguayo-Ulloa L, Ezquerro L, Villarroel M, Marín RH, Maria GA. Effect of postweaning handling strategies on welfare and productive traits in lambs. J Appl Anim Welf Sci 2015;18(1):42-56.

57. Sarasa M, Rambozzi L, Rossi L, Meneguz PG, Serrano E, Granados JE, et al. Sarcoptes scabiei: Specific immune response to sarcoptic mange in the Iberian ibex Capra pyrenaica depends on previous exposure and sex. Exp Parasitol 2010;(124):265-271.

375

ANÁLISIS DE VARIABLES MORFOLÓGICAS DE PAVOS DE TRASPATIO Rev Mex Cienc MEXICANOS Pecu 2016;7(3):377-389

Análisis de variables morfológicas de pavos de traspatio mexicanos (Meleagris gallopavo gallopavo) Analysis of morphological variables in Mexican backyard turkeys (Meleagris gallopavo gallopavo)

Ángel Ríos Utreraa, Sergio Iván Román Ponceb, Alejandra Vélez Izquierdob, Eduardo Cabrera Torresc, Antonio Cantú Covarrubiasd, Lino De la Cruz Colíne, Marina Durán Aguilarf, Jorge Alonso Maldonado Jaquezg, Fernando Edgar Martínez Silvah, Guillermo Martínez Velázquezi, Felipe de Jesús Ruiz Lópezb, Alessandro Bagnatoj, Vicente Eliezer Vega Murilloa

RESUMEN

El objetivo fue evaluar algunas características morfológicas de pavos de traspatio (n=248) provenientes de 126 unidades rurales de producción localizadas en 75 municipios de 24 estados de la República Mexicana. El modelo estadístico incluyó sexo, estado y municipio anidado en estado. Las tres variables explicativas afectaron a todas las variables de respuesta (P<0.01), excepto municipio, que no afectó circunferencia de la pechuga (P>0.05). Los machos tuvieron mayor (P<0.001) longitud corporal (10.4 cm más), envergadura (11.4 cm más), circunferencia de la pechuga (13.8 cm más), longitud de tarso (2.5 cm más), peso corporal (2.5 kg más), robustez (9.0 puntos porcentuales más) y solidez (2.8 puntos porcentuales más) que las hembras. Peso corporal mostró estar altamente correlacionado fenotípicamente (P<0.01) con circunferencia de la pechuga tanto en machos (r=0.74) como en hembras (r=0.71). En machos, longitud corporal mostró una correlación baja con longitud del tarso (r=0.25; P<0.01), pero en hembras no estuvo correlacionada (r=0.05; P>0.05). El peso corporal aumentó 143 g (P<0.01) en machos y 113 g en hembras (P<0.01) por cada centímetro que aumentó la circunferencia de la pechuga. Los colores predominantes en el plumaje, la piel y el tarso fueron negro, blanco y café, respectivamente. El pavo de traspatio mexicano presentó dimorfismo sexual significativo y alta correlación fenotípica entre circunferencia de la pechuga y peso corporal. PALABRAS CLAVE: Pavo de traspatio, Morfología, Indices, Correlaciones fenotípicas.

ABSTRACT

The objective was to evaluate some morphological characteristics of backyard turkeys (n=248) coming from 126 rural production units located in 75 municipalities of 24 States of the Mexican Republic. The statistical model included sex, state, and municipality within state. The three explanatory variables affected all the response variables (P<0.01), except municipality, which did not affect breast circumference (P>0.05). Male turkeys had greater (P<0.001) body length (10.7 cm more), wingspan (11.4 cm more), breast circumference (13.8 cm more), shank length (2.5 cm more), body weight (2.5 kg more), stockiness (9.0 percentage units more) and massiveness (2.8 percentage units more) than female turkeys. Body weight showed to be highly correlated phenotypically (P<0.01) with breast circumference in both males (r=0.74) and females (r=0.71). Body length was lowly correlated with shank length (r=0.25; P<0.01) in males, but it was not correlated with shank length in females (r=0.05; P>0.05). Body weight increased 143 g in males (P<0.01) and 113 g in females (P<0.01) for each centimeter increment in breast circumference. The predominant colors in the plumage, skin and tarsus were black, white and brown, respectively. The Mexican backyard turkey presented significant sexual dimorphism and strong phenotypic correlation between breast circumference and body weight. KEY WORDS: Mexican backyard turkey, Morphology, Indices, Phenotypic correlations. Recibido el 20 de julio de 2015. Aceptado el 29 de septiembre de 2015. a

b c

d e f

h i

Campo Experimental La Posta, INIFAP, km 22.5 carretera federal Veracruz-Córdoba, Paso del Toro, Municipio de Medellín, 94277. Veracruz, México. Teléfono: 01 (229) 262-2222. vega.vicente@inifap.gob.mx. Correspondencia al último autor. Centro Nacional de Investigación Disciplinaria en Fisiología y Mejoramiento Animal, INIFAP. México. Campo Experimental Chetumal, CIRSE, INIFAP. México. Sitio Experimental Aldama, CIRNE, INIFAP. México. Campo Experimental Valle de México, CIRCE, INIFAP. México. Facultad de Estudios Superiores Cuautitlán, UNAM. México. Campo Experimental La Laguna, CIRNOC, INIFAP. México. Campo Experimental Valles Centrales de Oaxaca, CIRPAS, INIFAP. México. Campo Experimental Santiago Ixcuintla, CIRPAC, INIFAP. México. Università degli Studi di Milano, Dipartimento di Scienze e Tecnologie Veterinarie per la Sicurezza Alimentare. Italia.

377

Ángel Ríos Utrera, et al. / Rev Mex Cienc Pecu 2016;7(3):377-389

La conservación y mejoramiento de especies autóctonas de animales requiere su caracterización morfológica, así como la estimación de parámetros genéticos y fenotípicos de características de importancia económica. Por ejemplo, el conocimiento del tipo de asociación o correlación que guardan las características de importancia económica es fundamental para definir la estrategia adecuada de mejora genética, ya que la selección directa puede ser impráctica o costosa para características difíciles de medir y con baja heredabilidad.

Conservation and improvement of native animal species requires morphological characterization, as well as estimation of genetic and phenotypic parameters of economically significant traits. Understanding the types of associations or correlations between traits is fundamental to developing genetic improvement strategies, because direct selection can be impractical or costly for traits that are difficult to measure or of low heritability.

The Mexican domestic turkey ( Meleagris gallopavo gallopavo) is an important reservoir of useful genes with notable adaptive traits(1), that allow it to live and develop in almost any of the country’s many agro ecological zones. In recent years, a number of studies have addressed the morphological and genetic diversity in Mexican backyard turkeys from certain regions: the coast of the state of Oaxaca; Mani municipality in the state of Yucatan; the north-central portion of the state of Chiapas; the state of Michoacán; and Kopala municipality in the state of Puebla(2-9). This is only a small portion of the country, and studies are needed in many more agro ecological regions and production systems to create a functional database.

Sin lugar a dudas, el pavo doméstico mexicano ( Meleagris gallopavo gallopavo ) es un importante reservorio de genes útiles y posee características adaptativas(1) importantes que le permiten habitar y desarrollarse prácticamente en todas las zonas agroecológicas del territorio mexicano. En la última década, diversos estudios han tenido como objetivo la determinación de la diversidad morfológica y genética de pavos de traspatio mexicanos provenientes de algunas regiones específicas de nuestro país, como la Costa de Oaxaca, el municipio de Maní en Yucatán, centro-norte de Chiapas, el estado de Michoacán, y el municipio de Kopala en Puebla (2-9). Sin embargo, es necesaria la evaluación de pavos provenientes de un mayor número de regiones agroecológicas y sistemas de producción.

Only one study to date has included phenotypic correlation estimates for quantitative morphological characteristics such as body weight, breast circumference, tarsus length, body length, height, and leg length in Mexican backyard turkeys(7). The results suggest that phenotypic correlation estimates depend on the sex of the bird since they were moderate in males, but low in females, and some of the estimates in females were not significant. However, this study used a limited number of observations (<50 per sex) to calculate the estimates. Confirming estimates validity will require additional studies involving larger numbers of observations. The present study objective was to evaluate quantitative and qualitative morphological characteristics of backyard turkeys from twenty-four states in Mexico, and estimate the phenotypic correlations between the quantitative morphological variables.

Por otro lado, solo un estudio ha reportado estimadores de correlaciones fenotípicas para características morfológicas cuantitativas, como peso corporal, circunferencia de la pechuga, longitud del tarso, longitud corporal, altura y longitud de la pierna, de pavos de traspatio mexicanos(7). Los resultados de dicho estudio sugieren que los estimadores de las correlaciones fenotípicas dependen del sexo del ave, ya que los estimadores fueron moderados en machos, pero bajos, e incluso algunos fueron no significativos, en hembras. No obstante, el limitado número de observaciones (menos de 50 para cada sexo) utilizado por Estrada(7) para calcular los estimadores de las correlaciones 378

ANÁLISIS DE VARIABLES MORFOLÓGICAS DE PAVOS DE TRASPATIO MEXICANOS

fenotípicas, hacen necesario realizar estudios adicionales con un mayor número de observaciones, con el fin de confirmar tal hallazgo. Con base en lo anterior, el objetivo del presente estudio fue evaluar características morfológicas, cuantitativas y cualitativas, de pavos de traspatio provenientes de 24 estados de la República Mexicana, así como estimar las correlaciones fenotípicas entre las variables morfológicas cuantitativas.

From 2013 to 2014, morphological data from 248 backyard turkeys were collected by opportunity sampling in 126 rural production units located in 75 municipalities (Table 1) in 24 states of Mexico: Baja California Sur, Campeche, Chiapas, Chihuahua, Coahuila, Colima, Mexico City, Durango, Estado de México, Guanajuato, Hidalgo, Jalisco, Morelos, Nayarit, Nuevo León, Oaxaca, Puebla, Querétaro, Quintana Roo, Tabasco, Tamaulipas, Tlaxcala, Veracruz and Zacatecas. This sampling technique was used because of its low cost, minimal time requirements, relative simplicity and production of data from a wide array of individuals. The

Se analizó la información morfológica de 248 pavos de traspatio resultante de un muestreo por oportunidad que involucró 126 unidades

Cuadro 1. Municipios muestreados enlistados por estado Table 1. Sampled municipalities listed by state STATE

Baja California Sur Campeche Chiapas Chihuahua Coahuila Colima Distrito Federal Durango Estado de México Guanajuato Hidalgo Jalisco Morelos Nayarit Nuevo León Oaxaca Puebla Querétaro Quintana Roo Tabasco Tamaulipas Tlaxcala Veracruz Zacatecas

MUNICIPALITIES

Comondú, Los Cabos Champotón, Escárcega, Tenabo Ángel Albino Corzo, Chanal, Juárez, San Lucas Janos, Madera Francisco I. Madero, Matamoros, Viesca, Zaragoza Comala, Manzanillo, Minatitlán Milpa Alta Cuencamé, Lerdo Almoloya de Juárez, Amanalco, Ixtlahuaca, Jocotitlán, Temascalapa, Tequixquiac, San Felipe del Progreso Abasolo, Comonfort, Huanímaro, Salamanca Ajacuba, Cuautepec de Hinojosa, Huejutla de Reyes, Santiago de Anaya, Tula de Allende Cabo Corrientes, Cuautitlán de García Barragán, Villa Purificación Temixco, Tlaquiltenango Santiago Ixcuintla Agualeguas, Los Ramones Loma Bonita, Magdalena Peñasco, Pinotepa Nacional, San Jerónimo Sosola, San Martín Toxpalan, San Pedro Amuzgos, San Vicente Coatlán, Santa María Yalina Hueytamalco, San Martín Texmelucan Jalpan de Serra Felipe Carrillo Puerto Huimanguillo, Tacotalpa Aldama, Altamira Españita, Tlaxco Acayucan, Álamo Temapache, Alvarado, Ixhuatlán de Madero, Jalacingo, Jáltipan, Medellín, Soledad de Doblado, Tlacolulan, Tlalixcoyan Guadalupe, Juan Aldama 379

Ángel Ríos Utrera, et al. / Rev Mex Cienc Pecu 2016;7(3):377-389

sample included juvenile and adult turkeys of both sexes (138 males and 110 females).

rurales de producción ubicadas en 75 municipios de 24 estados de la República Mexicana: Baja California Sur, Campeche, Chiapas, Chihuahua, Coahuila, Colima, Distrito Federal, Durango, Estado de México, Guanajuato, Hidalgo, Jalisco, Morelos, Nayarit, Nuevo León, Oaxaca, Puebla, Querétaro, Quintana Roo, Tabasco, Tamaulipas, Tlaxcala, Veracruz y Zacatecas. El muestreo por conveniencia se aplicó porque es más barato, demanda menos tiempo, es menos complicado y asegura el muestreo de individuos. Los municipios muestreados se presentan en el Cuadro 1. La información se recolectó de 2013 a 2014 a partir de pavos de ambos sexos (138 machos y 110 hembras), tanto jóvenes como adultos.

Seven quantitative variables were evaluated: body length, wingspan, breast circumference, tarsus length, live body weight, robustness, and solidity. Three qualitative variables were evaluated: plumage color, skin color, and tarsus color. Measurement of quantitative variables was done following the FAO Guidelines for Animal Production and Health (10) . Turkeys were weighed with a 10 kg capacity hanging scale (ECO-DIN 10; PEXA; accuracy = ± 25 g). A flexible plastic measuring tape (FIBER-GLASS) was used to collect data on body length, wingspan, breast circumference and tarsus length. The seven quantitative variables were defined as follows:

Las variables cuantitativas evaluadas fueron: longitud del cuerpo, envergadura, circunferencia de la pechuga, longitud del tarso, peso vivo corporal, robustez y solidez, mientras que las cualitativas fueron: color del plumaje, color de la piel y color del tarso. Las mediciones de las variables cuantitativas se realizaron siguiendo los Lineamientos para la Producción Animal y la Salud de la Organización de las Naciones Unidas para la Alimentación y la Agricultura(10). El peso de los pavos se obtuvo con un dinamómetro colgante con capacidad para 10 kg (marca PEXA; modelo ECO-DIN 10; precisión ± 25 g), mientras que longitud del cuerpo, envergadura, circunferencia de la pechuga y longitud del tarso se midieron con una cinta métrica flexible de plástico (marca FIBER-GLASS). Las siete variables cuantitativas analizadas se definieron de la siguiente manera:

Body length. The distance between beak base

and caudal tip at the level of the uropygial gland, without considering feather length on the tail; measured while extending the neck.

Wingspan. The length from the terminal

phalange of one wing to the terminal phalange of the other wing (not including feathers) with the wings completely extended.

Breast circumference. Measured at the level of

the crest of the breastbone, extending the measuring tape along the posterior insertion of the wings.

Tarsus length. Metatarsal length measured as the distance from the intertarsal articulation to the metatarsophalangeal articulation.

Longitud del cuerpo. Se midió como la distancia

Body weight. Bird live weight as measured on

que existe entre la base del pico y el extremo caudal, a la altura de la glándula uropígea, sin considerar las plumas de la cola, teniendo el pescuezo del ave extendido.

a hanging scale at the time of the visit to the production unit.

Robustness. (Breast circumference/body length) x 100.

Envergadura. Se midió como la distancia de la

falange terminal de un ala a la falange terminal de la otra ala (sin incluir las plumas), manteniendo las alas del ave completamente extendidas.

Solidity. (Body weight/body length) x 100.

An analysis of variance (ANOVA) was run for each quantitative trait using the GLM procedure 380

ANÁLISIS DE VARIABLES MORFOLÓGICAS DE PAVOS DE TRASPATIO MEXICANOS

Circunferencia de la pechuga. Se midió a nivel

in the SAS statistics package(11). In all cases, the statistical model included sex, state, and municipality nested within state. The model was mathematically represented as:

de la punta de la quilla, pasando la cinta métrica por la parte posterior de la inserción de las alas.

Longitud del tarso. Correspondió al largo del

yijkl= µ + i +  j + k(j) + ijkl,

tarso-metatarso y se definió como la distancia de la articulación intertarsiana a la articulación metatarsofalángica.

where: yijkl is the l-th observation of the response variable (body length, wingspan, breast circumference, tarsus length, live body weight, robustness, or solidity); µ is the general mean; i is the fixed effect of the i-th sex (i= 1,2);  j is the fixed effect of the j-th state (j=1,…,24); k(j) is the fixed effect of the k-th municipality nested within the j-th state (k=1,…,75); and ijkl is the l-th random error; yijkl ~ N (µ, 2).

Peso corporal. Correspondió al peso del ave viva medido con una báscula en el momento en que se realizó la visita a la unidad de producción.

Robustez. Se definió como: (circunferencia de la pechuga/longitud corporal) x 100.

Differences between means of males and females were estimated using the PDIFF option in the GLM procedure. In addition, the CORR procedure was run to estimate the Pearson correlation coefficients among body length, wingspan, breast circumference, tarsus length and body weight. This was done to identify the variables most strongly correlated with body weight. The correlations were estimated independently for males and females, and then for the combined data set of males and females. In response to reports indicating that thoracic perimeter is a good indicator of body weight in different animal species(12), the REG procedure was run to estimate the linear regression coefficient of body weight on breast circumference. Again, this was done independently for males and females, and then for the combined data set of males and females. Finally, the FREQ procedure was applied to calculate the frequency of the categories observed in the field corresponding to each of the studied qualitative traits.

Solidez. Se definió como: (peso corporal/longitud corporal) x 100.

Se realizó un análisis de varianza para cada característica cuantitativa con el procedimiento GLM de SAS(11). En todos los casos, el modelo estadístico incluyó sexo, estado y municipio anidado dentro de estado. Matemáticamente, el modelo usado se representa de la siguiente manera: yijkl= µ + i +  j + k(j) + ijkl,

Donde: yijkl es la l-ésima observación de la variable de respuesta (longitud del cuerpo, envergadura, circunferencia de la pechuga, longitud del tarso, peso vivo corporal, robustez o solidez), µ es la media general, i es el efecto fijo del i-ésimo sexo (i=1,2),  j es el efecto fijo del j-ésimo estado (j=1,…,24), k(j) es el efecto fijo del k-ésimo municipio anidado dentro del jésimo estado (k=1,…,75) y ijkl es el l-ésimo error aleatorio; yijkl ~ N (µ, 2). Las diferencias entre las medias de machos y hembras se estimaron con la opción PDIFF del procedimiento GLM. Adicionalmente, con el procedimiento CORR de SAS(11) se estimaron los coeficientes de correlación de Pearson para las variables longitud del cuerpo, envergadura, circunferencia de la pechuga, longitud del tarso

Average weight in the studied animals was 4.6 kg, with a range of 2.5 to 8.7 kg (Table 2). This is similar to the 2.9 to 8.9 kg range reported for male and female turkeys in the state of Michoacán(8), but generally lower than the 6 to 20 kg range found in the Xochimilco region of 381

Ángel Ríos Utrera, et al. / Rev Mex Cienc Pecu 2016;7(3):377-389

Cuadro 2. Estadísticas descriptivas de variables morfológicas cuantitativas de pavos de traspatio (datos de machos y hembras agrupados)

Table 2. Descriptive statistics of quantitative morphological variables of backyard turkeys (male and female data grouped) Variable

BL, cm WI, cm BRC, cm TL, cm BW, kg RO, % SO, %

248 248 248 248 248 248 248

Mean 61.6 66.9 48.9 13.0 4.6 79.6 7.4

8.8 11.2 9.2 1.9 1.7 11.0 2.2

Min value 36.0 34.0 32.0 9.0 2.5 49.2 4.1

Max value 94.0 95.0 70.0 17.0 8.7 111.5 14.4

CV (%) 14 17 19 15 36 14 30

BL= body length; WI= wingspan; BRC= breast circumference; TL= tarsus length; BW= body weight; RO= robustness; SO= solidity.

y peso corporal, con el fin de conocer las variables que se asocian más fuertemente con el peso corporal. Las correlaciones se estimaron para machos y hembras de manera independiente, y para datos conjuntos de machos y hembras. Por último, dado que la literatura científica indica que en diferentes especies animales el perímetro torácico es un buen predictor del peso corporal(12), se estimó el coeficiente de regresión lineal del peso corporal sobre la circunferencia de la pechuga del ave, utilizando el procedimiento REG de SAS(11). Este análisis también se hizo para machos y hembras de manera independiente, y para datos conjuntos de machos y hembras. Las frecuencias de las categorías observadas en campo, correspondientes a cada una de las características cualitativas estudiadas, se calcularon con el procedimiento FREQ de SAS(11).

Mexico City(13). Minimum and maximum values for body length and wingspan were similar, although average wingspan (67 cm) was slightly greater than average body length (62 cm). The variation coefficients for body length, wingspan, breast circumference and tarsus length were about two times less than the body weight variation coefficient. State and sex were significant (P<0.01) sources of variation for all the analyzed quantitative variables. However, municipality affected (P<0.01) body length, wingspan, tarsus length, body weight, robustness and solidity, but not breast circumference.

Sexual dimorphism was clearly present in the sample. Least squares means of the quantitative variables showed males had greater (P<0.001) body length (10.4 cm more), wingspan (11.4 cm more), breast circumference (13.8 cm more), tarsus length (2.5 cm more), body weight (2.5 kg more), robustness (9.0 percentage points more), and solidity (2.8 percentage points more) than females (Table 3). This agrees with one previous study that found males to have greater weight than females(4), and another that found males to have greater body weight, dorsal length, breast circumference, tarsus length and wing length than females(5). A third study also found

En el Cuadro 2 se presentan las características descriptivas de las variables cuantitativas estudiadas. Los pavos muestreados pesaron de 2.5 a 8.7 kg, con una media de 4.6 kg. Estos valores son similares a los obtenidos por LópezZavala et al(8), quienes reportaron que el peso corporal de pavos michoacanos (machos y hembras) osciló entre 2.9 y 8.9 kg. En Xochimilco (Distrito Federal) se encontró que el

382

ANÁLISIS DE VARIABLES MORFOLÓGICAS DE PAVOS DE TRASPATIO MEXICANOS

Cuadro 3. Medias de cuadrados mínimos y errores estándar, por sexo, de variables morfológicas cuantitativas de pavos de traspatio

Table 3. Least squares means (± standard error), by sex, of quantitative morphological variables in backyard turkeys Sex

Females Males

BL (cm)

55.6±0.61 b 66.0±0.56 c

WI (cm)

58.4±0.79 b 69.8±0.72 c

BRC (cm)

40.7±0.77 b 54.5±0.70 c

TL (cm)

11.7±0.16 b 14.2±0.15 c

BW (kg)

3.2±0.14 b 5.7±0.13 c

RO (%)

74±1.0 b 83±0.9 c

SO (%)

5.9±0.20 b 8.7±0.18 c

BL= body length; WI= wingspan; BRC= breast circumference; TL= tarsus length; BW= body weight; RO= robustness; SO= solidity. b,c Different letter superscripts in the same column indicate difference (P<0.001).

peso corporal de pavos machos y hembras varió de 6 a 20 kg (13) , lo cual contrasta considerablemente con lo hallado en el presente estudio. Los valores mínimos y máximos de longitud corporal y envergadura fueron similares, aunque el valor promedio de envergadura fue un poco mayor que el de longitud corporal (67 vs 62 cm). Los coeficientes de variación de longitud corporal, envergadura, circunferencia de la pechuga y longitud del tarso fueron alrededor de dos veces menores que el coeficiente de variación del peso corporal.

that males had higher values than females in terms of breast circumference (54.03 vs 42.55 cm), tarsus length (15.35 vs 12.08 cm) and body weight (5.02 vs 2.94 kg)(7). The overall trend of males having higher quantitative variable values than females has also been observed in other countries such as Croatia(14,15) and Nigeria(16,17).

The Pearson correlation coefficients estimated separately for males and females showed body weight and breast circumference to be highly phenotypically correlated (P<0.01) in males (r= 0.74) and females (r= 0.71)(Table 4). In contrast, body length was unrelated to wingspan

Estado y sexo fueron fuentes de variación importantes (P<0.01) para todas las variables cuantitativas analizadas. Por el contrario, municipio afectó significativamente longitud del cuerpo, envergadura, longitud del tarso, peso corporal, robustez y solidez, pero no afectó circunferencia de la pechuga. Las medias de cuadrados mínimos y sus respectivos errores estándar de las variables cuantitativas estudiadas para pavos machos y pavos hembras se presentan en el Cuadro 3. Los machos tuvieron mayor (P<0.001) longitud corporal (10.4 cm más), envergadura (11.4 cm más), circunferencia de la pechuga (13.8 cm más), longitud de tarso (2.5 cm más), peso corporal (2.5 kg más) robustez (9.0 puntos porcentuales más) y solidez (2.8 puntos porcentuales más) que las hembras. Canul et al(4) encontraron que pavos machos fueron más pesados que pavos hembras, en concordancia con lo encontrado en el presente estudio. Otros

Cuadro 4. Coeficientes de correlación de Pearson para variables morfológicas cuantitativas de machos (debajo de la diagonal) y hembras (arriba de la diagonal) Table 4. Pearson correlation coefficients for quantitative morphological variables in males (below diagonal) and females (above diagonal) backyard turkeys BL WI BRC TL BW

BL 0.25 0.52 0.29 0.38

b b b b

0.00 0.28 b 0.49 b 0.30 b

BRC

0.31 b 0.40 b 0.25 b 0.74 b

0.05 0.43 b 0.18 c 0.34 b

0.35 0.25 0.71 0.39

b b b b

BL= body length; WI= wingspan; BRC= breast circumference; TL= tarsus length; BW= body weight b Highly significant correlation coefficients (P<0.01). c Significant correlation coefficients (P<0.05).

383

Ángel Ríos Utrera, et al. / Rev Mex Cienc Pecu 2016;7(3):377-389

autores(5) reportaron que los machos tuvieron mayor peso corporal, longitud dorsal, circunferencia de la pechuga, longitud del tarso y longitud de ala que las hembras. En forma similar, Estrada(7) reportó que pavos machos superaron a pavos hembras en circunferencia de la pechuga (54.03 vs 42.55 cm), longitud del tarso (15.35 vs 12.08 cm) y peso corporal (5.02 vs 2.94 kg). La superioridad de pavos machos sobre pavos hembras también ha sido observada en otros países, como Croacia(14,15) y Nigeria(16,17).

and tarsus length in females, but was correlated to them in males, though at a low value. The estimates for the phenotypic correlations of body weight with body length (r= 0.38), wingspan (r= 0.30), and tarsus length (r= 0.34) were moderate in males. For females, estimated values were moderate between body weight and body length (r= 0.35) and tarsus length (r= 0.34), but low between body weight and wingspan (r= 0.25).

When the data for males and females was analyzed as a set, all the correlation coefficients differed from zero (P<0.0001) and were positive, indicating that if one variable increased all the others did as well (Table 5). In this data set, body weight exhibited high phenotypic correlation with body length, tarsus length and wingspan. The phenotypic correlation estimates were low for body weight with wingspan (r= 0.42) and tarsus length (r= 0.49).

En el Cuadro 4 se muestran los coeficientes de correlación de Pearson estimados a partir de los datos individuales de machos y hembras, mientras que en el Cuadro 5 se presentan los coeficientes de correlación estimados a partir de los datos conjuntos. Peso corporal y circunferencia de la pechuga estuvieron altamente correlacionados fenotípicamente (P<0.01) en machos (r= 0.74) y en hembras (r= 0.71). En contraste, longitud corporal no mostró relación con envergadura y longitud del tarso en hembras, pero sí estuvo correlacionada con dichas variables en machos, aunque el estimador de la correlación fue bajo. Los estimadores de las correlaciones fenotípicas de peso corporal con longitud corporal (r=0.38), envergadura (r= 0.30) y longitud del tarso (r= 0.34) fueron moderados en machos; en contraste, en hembras, los estimadores de las correlaciones fenotípicas de peso corporal con longitud corporal (r= 0.35) y longitud del tarso (r= 0.34) fueron moderados, pero el estimador de la correlación entre peso corporal y envergadura fue bajo (0.25). Cuando se analizó la información de machos y hembras conjuntamente, todos los coeficientes de correlación fueron diferentes de cero (P<0.0001) y positivos, lo que indica que si incrementa una variable, incrementan las otras. Peso corporal mostró alta correlación fenotípica con circunferencia de la pechuga (r= 0.87), pero estuvo medianamente correlacionado con longitud corporal, longitud del tarso y envergadura. Los estimadores de las correlaciones fenotípicas de longitud del cuerpo

Correlation coefficient values between these variables have varied among a number of studies done in different countries and with different types of domestic turkeys. In one study done using the MH meat production turkey line, body weight and body length were found to have a low correlation (r= 0.38), while body weight was strongly associated (r= 0.85) with breast

Cuadro 5. Coeficientes de correlación de Pearson para variables morfológicas cuantitativas de pavos de traspatio (datos de machos y hembras agrupados) Table 5. Pearson correlation coefficients for quantitative morphological variables in backyard turkeys; male and female data grouped WI BRC TL BW

BRC

0.49 b 0.64 b

0.56 b 0.63 b 0.54 b

0.57 b 0.87 b

0.63 b

0.42 b 0.69 b

BL= body length; WI= wingspan; BRC= breast circumference; TL= tarsus length; BW= body weight. bHighly significant correlation coefficients (P<0.0001).

384

ANÁLISIS DE VARIABLES MORFOLÓGICAS DE PAVOS DE TRASPATIO MEXICANOS

circumference (18) . Native Nigerian turkeys (Meleagris gallopavo) were reported to have a strong correlation between body weight and wing length (r= 0.91), tarsus length (r= 0.97), body length (r= 0.93), and breast circumference (r= 0.89)(19). In a more recent study done in Tunisia(20), high correlations were identified between body weight and tarsus length (r= 0.89), and body length (r= 0.90). Another study reported moderate correlations between breast circumference and tarsus length in male turkeys (r= 0.67 and 0.46, respectively), but low correlations in females (r= 0.30 and 0.06, respectively)(7). Finally, in Nigeria(21) native turkeys (Meleagris gallopavo) were found to have high correlations between body weight and breast circumference (r= 0.83), body length (r= 0.90), and tarsus length (r= 0.89).

Figura 1. Regresión lineal del peso corporal (BW) sobre la circunferencia de la pechuga (BRC) de machos, hembras, y machos y hembras agrupados

Figure 1. Linear regression of body weight (BW) on breast circumference (BRC) in males, females, and males and females grouped Male BW= -2.1108 + 0.1427 BRC

9 8

Weight

7 6 5 4 3 2

Breast circumference

The regression analysis showed the regression coefficient of body weight on breast circumference to differ from zero (P<0.01). Body weight in males increased 143 g for every centimeter increase in breast circumference, and in females it increased 113 g. In the regression analysis of the grouped data, body weight increased 159 g per centimeter gain in breast circumference. The fit (Figure 1) of the linear regression of body weight (BW) on breast circumference (BRC) was run using one equation for males, one for females and a third for the grouped data:

Female BW= -1.3874 + 0.113 BRC

Weight

Breast circumference

BW= -2.1108 + (0.1427 x BRC) [males]

BW= -1.3874 + (0.1130 x BRC) [females]

Males & Females BW= -3.1485 + 0.1593 BRC

BW= -3.1485 + (0.1593 x BRC) [males & females]

For males, the standard error was 0.61888 for the intercept and 0.0111 kg for the regression coefficient; in the females they were 0.4561 and 0.01093 kg, respectively; and in the grouped set they were 0.28691 and 0.00577 kg, respectively. By comparison, 12-wk old native Nigerian turkeys were found to increase 106 g in body weight for every centimeter increase in breast circumference (22) . The difference

Weight

Breast circumference

385

Ángel Ríos Utrera, et al. / Rev Mex Cienc Pecu 2016;7(3):377-389

con envergadura y longitud del tarso fueron bajas (r= 0.42 y 0.49, respectivamente). En una línea de pavos para producción de carne conocida como MH, se encontró(18) que el peso y la longitud corporal tuvieron una baja correlación (r= 0.38); por el contrario, este mismo autor informó que peso corporal tuvo una fuerte asociación fenotípica con circunferencia de la pechuga (r= 0.85). Ogah(19) reportó que el peso corporal de pavos nigerianos nativos ( Meleagris gallopavo ) estuvo fuertemente relacionado con longitud del ala (r= 0.91), longitud del tarso (r= 0.97), longitud del cuerpo (r= 0.93) y circunferencia de la pechuga (r= 0.89). En un estudio más reciente realizado en Túnez(20) se encontró que las correlaciones entre peso corporal y longitud del tarso (r= 0.89) y entre peso corporal y longitud del cuerpo (r= 0.90) fueron altas. Estrada(7) reportó que peso corporal estuvo moderadamente correlacionado con circunferencia de la pechuga y longitud del tarso en pavos machos (r= 0.67 y 0.46, respectivamente), pero bajamente correlacionado en pavos hembras (r= 0.30 y 0.06, respectivamente). En otro trabajo(21) se encontró que el peso corporal de pavos autóctonos (Meleagris gallopavo) tuvo una alta correlación fenotípica con circunferencia de la pechuga (r= 0.83), longitud corporal (r= 0.90) y longitud del tarso (r= 0.89).

between this estimated regression coefficient and that in the present results could be due to differences in the average age of the animals in each study.

Thirteen (13) different plumage color phenotypes were documented in the present study, highlighting a wide diversity among the sampled locations. Of the four basic identified colors (white, brown, grey and black), black was the most frequent (30.8 %), followed by white (14.7 %), brown and then grey. Nine combinations of these four colors were identified (color order does not indicate relative predominance), the most frequent being “black with white” (18.1 %), followed by “black with white and brown” (10.2 %), “white with brown” (5.8 %), and “black with white and grey” (4.9 %). On the coast of Oaxaca state, the most frequent colors in turkey plumage were black (29.2 %) and “white with black” (30.3%)(2), whereas in the state of Yucatan the predominant colors were black and “black with brown and white”(4). Black was also found to be the predominant color among turkeys in the state of Puebla, both in males (46.7 %) and females (52.2 %)(7), and among native turkeys in Croatia(15) and Morocco(23).

Among the five skin colors observed in the studied sample, white was the most common (81 %), followed by yellow (11 %), and pink (3.9 %). Of the nine observed tarsus colors, the three most frequent were brown (31.3 %), white (26.4 %) and black (20.5 %), although pink, red, purple, green, yellow and grey were also present. This contrasts with the six tarsus colors documented on the coast of Oaxaca, white being the most frequent(2), and the four found in Yucatan, pink being most common(4).

Tanto en machos como en hembras y en datos agrupados de machos y hembras, el análisis de regresión mostró que el coeficiente de regresión del peso corporal sobre la circunferencia de la pechuga fue diferente de cero (P<0.01). En machos, el peso corporal aumentó 143 g por cada centímetro que aumentó la circunferencia de la pechuga, mientras que en hembras aumentó 113 g. El análisis de regresión de los datos agrupados mostró que el peso corporal aumentó 159 g por cada centímetro que aumentó la circunferencia de la pechuga. En la Figura 1 se muestra el ajuste lineal de la regresión del peso corporal (PC) sobre la circunferencia de la pechuga (CP) en datos de machos, datos de hembras y datos agrupados

The present results indicated the presence of five main distinguishing aspects among the sampled Mexican backyard turkeys. Sexual dimorphism was notable, with clear morphological distinction between males and females. Breast circumference and body weight were highly correlated in both males and 386

ANÁLISIS DE VARIABLES MORFOLÓGICAS DE PAVOS DE TRASPATIO MEXICANOS

de machos y hembras. Las ecuaciones de regresión estimadas fueron:

females, but for other traits the magnitude of the phenotypic correlation estimate was sexdependent. Black and “black with white” turkeys were the most common, most of the turkeys had white skin, and brown was the most frequent tarsus color.

PC= -2.1108 + (0.1427 x CP) [machos]

PC= -1.3874 + (0.1130 x CP) [hembras]

PC= -3.1485 + (0.1593 x CP) [machos y hembras]

Los errores estándar del intercepto y del coeficiente de regresión fueron: 0.61888 y 0.01119, 0.4561 y 0.01093, y 0.28691 y 0.00577 kg, para datos de machos, datos de hembras y datos agrupados de machos y hembras, respectivamente. Durosaro et al(22) reportaron que pavos nigerianos nativos de 12 semanas de edad aumentaron 106 g de peso corporal por cada centímetro que aumentó la circunferencia de la pechuga. La diferencia entre el coeficiente de regresión estimado por estos autores y el reportado en el presente estudio se pudo deber a la diferencia en la edad promedio de los pavos de ambos estudios.

ACKNOWLEDGEMENTS

The research was partially financed by INIFAP through project No. 10551832012, “Identificación de los recursos genéticos pecuarios para su evaluación, conservación y utilización sustentable en México. Aves y Cerdos”, and by the “Programa de Cooperación Científica y Tecnológica México-Italia 2014” through the project “La variabilidad genética en las razas avícolas autóctonas italianas y mexicanas: genética, el análisis filogenético y la interacción genotipo-ambiente”. Thanks to Lorenzo Granados Zurita, Sara Olazarán Jenkins, Alfredo Arroyo Lara, Héctor Velázquez Ocaña and Maribel Torres Niño for assistance with identifying backyard turkey production units, measuring animal morphology and entering field data.

Con respecto al color del plumaje, el presente estudio reveló la existencia de 13 fenotipos, indicando una amplia variación fenotípica en dicha característica. Se encontraron cuatro colores básicos: blanco, café, gris y negro, de los cuales el más frecuente fue el color negro (30.8 %), seguido del color blanco (14.7 %), mientras que los colores café y gris ocuparon el tercer y cuarto lugar, respectivamente. Adicionalmente, se encontraron nueve combinaciones diferentes de estos cuatro colores básicos; la combinación de colores más frecuente fue “negro con blanco” (18.1 %), seguida de las combinaciones “negro con blanco y café” (10.2 %), “blanco con café” (5.8 %) y “negro con blanco y gris” (4.9 %). En el caso de las combinaciones de colores encontradas en el plumaje, el orden de los colores proporcionado en el presente estudio es irrelevante y no representa la predominancia de algún color en particular. Camacho-Escobar et al(2) reportaron que en la costa de Oaxaca los colores más frecuentes en el plumaje de pavos de traspatio fueron negro (29.2 %) y

End of english version

“blanco con negro” (30.3%). En Yucatán(4) observaron que la mayor proporción de pavos tuvieron plumaje de color negro y “negro con café y blanco”. De manera similar, en el estado de Puebla el color predominante fue el negro, tanto en machos (46.7 %) como hembras (52.2 %)(7). En Croacia(15) y Marruecos(23) también se ha encontrado que el color negro es el más abundante en el plumaje de pavos autóctonos.

Se observaron cinco colores diferentes en la piel de los pavos de traspatio. Los pavos con piel de color blanco fueron los que predominaron 387

Ángel Ríos Utrera, et al. / Rev Mex Cienc Pecu 2016;7(3):377-389

(81 %), seguidos por los pavos con piel de color amarillo (11 %) y rosa (3.9 %). Los colores más observados en los tarsos de los pavos fueron: café (31.3 %), blanco (26.4 %) y negro (20.5 %), aunque también se observaron colores como rosa, rojo, morado, verde, amarillo y gris, identificando nueve colores en total. En la Costa de Oaxaca(2) observaron seis colores en los tarsos de pavos autóctonos, pero el color más común fue el blanco. En contraste, en Yucatán(4) solo encontraron cuatro colores (blanco, rosado, gris y negro) en los tarsos, siendo el rosado el más frecuente.

la medición morfológica de los animales y la captura de datos en campo.

LITERATURA CITADA 1.

Las variables estudiadas mostraron que: 1) el pavo de traspatio mexicano presenta una diferenciación morfológica importante entre machos y hembras (dimorfismo sexual), 2) la circunferencia de la pechuga y el peso corporal estuvieron altamente correlacionados tanto en machos como en hembras; sin embargo, para otras características la magnitud del estimador de la correlación fenotípica dependió del sexo, 3) pavos con plumaje de color negro y “negro con blanco” fueron predominantes, 4) la mayoría de los pavos tuvieron piel blanca, y 5) el color café fue el más común en sus patas.

AGRADECIMIENTOS

Al INIFAP por el financiamiento del proyecto fiscal No. 10551832012, “Identificación de los recursos genéticos pecuarios para su evaluación, conservación y utilización sustentable en México. Aves y Cerdos”, y al “Programa de Cooperación Científica y Tecnológica México-Italia 2014” por el apoyo para la realización del proyecto “La variabilidad genética en las razas avícolas autóctonas italianas y mexicanas: genética, el análisis filogenético y la interacción genotipoambiente”, así como a los M.C. Lorenzo Granados Zurita, Sara Olazarán Jenkins y Alfredo Arroyo Lara, al Ingeniero Agrónomo Zootecnista Héctor Velázquez Ocaña y a Maribel Torres Niño por su colaboración en la localización de las unidades de producción de pavos de traspatio,

Camacho-Escobar MA, Ramírez-Cancino L, Lira-Torres I, Hernández-Sánchez V. Phenotypic characterization of the Guajolote (Meleagris gallopavo gallopavo) in Mexico. Anim Genet Resour Inform 2008;43:59-66.

Camacho-Escobar MA, Hernández-Sánchez V, RamírezCancino L, Sánchez-Bernal EI, Arroyo-Ledezma J. Characterization of backyard guajolotes (Meleagris gallopavo gallopavo) in tropical zones of Mexico. Livest Res Rural Develop 2008;20(4). http://www.lrrd.cipav.org.co/lrrd20/4/ cama20050.htm. Consultado junio 5, 2015. Camacho-Escobar MA, Pérez-Lara E, Arroyo-Ledezma J, Jiménez-Hidalgo E. Diferencias y similitudes entre guajolote silvestre y de traspatio (Meleagris gallopavo). Temas Cienc Tec 2009;13(38):53-62. Canul SM, Sierra VA, Mena DO, Ortiz OJ, Zamora BR, Durán SL. Contribución a la caracterización fenotípica del Meleagris gallopavo en la zona sur de Yucatán, México. AICA 2011;1:284-287.

Cigarroa-Vázquez F, Herrera-Haro JG, Ruiz-Sesma B, CucaGarcía JM, Rojas-M artínez RI, Lemus-Flores C. Caracterización fenotípica del guajolote autóctono (Meleagris gallopavo) y sistema de producción en la región centro norte de Chiapas, México. Agrociencia 2013;47:579-591.

Chassin-Noria O, López-Zavala R, Cano-Camacho H, SuárezCorona E, Juárez-Caratachea A, Zavala-Páramo MG. Diversidad y similitud genética entre poblaciones de guajolotes mexicanos utilizando un método de amplificación aleatorio de ADN polimórfico (RAPD). Téc Pecu Méx 2005;43(3):415-424. Estrada MA. Caracterización fenotípica, manejo y usos del pavo doméstico ( Meleagris gallopavo gallopavo ) en la comunidad indígena de Kapola en la sierra nororiental del estado de Puebla, México [tesis de maestría]. Puebla, Pue., México. Colegio de Postgraduados; 2007. López-Zavala R, Monterrubio-Rico TC, Cano-Camacho H, Chassin-Noria O, Aguilera-Reyes U, Zavala-Páramo MG. Caracterización de sistemas de producción del guajolote (Meleagris gallopavo gallopavo) de traspatio en las regiones fisiográficas del estado de Michoacán, México. Téc Pecu Méx 2008;46(3):303-316. López-Zavala R, Cano-Camacho H, Chassin-Noria O, Oyamad K, Vázquez-Marrufo G, Zavala-Páramo MA. Diversidad genética y estructura de poblaciones de pavos domésticos mexicanos. Rev Mex Cienc Pecu 2013;4(4):417-434.

10. FAO (Food and Agriculture Organization of the United Nations). Phenotypic characterization of animal genetic resources. FAO Animal Production and Health Guidelines No. 11. Rome. 2012. 11. SAS. Statistical Analysis System, User’s Guide. Cary NC, USA. SAS Inst. Inc. 2012.

12. Contreras G, Chirinos Z, Molero E, Paéz A. Medidas corporales e índices zoométricos de toros Criollo Limonero de Venezuela. Zootecnia Trop 2012;30(2):175-181.

388

ANÁLISIS DE VARIABLES MORFOLÓGICAS DE PAVOS DE TRASPATIO MEXICANOS 13. Losada H, Rivera J, Cortés J, Castillo A, González RO, Herrera J. Un análisis de sistemas de producción de guajolotes ( Meleagridis gallipavo) en el espacio suburbano de la delegación de Xochimilco al sur de la Ciudad de México. Livest Res Rural Develop 2 006;18(4). http:// www.lrrd.cipav.org.co/lrrd18/4/losa18052.htm. Consultado junio 5, 2015.

18. Oblakova M. Characteristic of some productive indexes of turkey lines at the age of 20 weeks. Bulg J Agric Sci 2006;12:133-143. 19. Ogah DM. Assessing size and conformation of the body of Nigerian indigenous turkey. Slovak J Anim Sci 2011;44(1):2127.

20. Djebbi A, M’hamdi N, Haddad I, Chriki A. Phenotypic characterization of the indigenous turkey ( Meleagris gallopavo) in the North West Regions of Tunisia. Sci Agri 2014;2(1):51-56.

14. Janječić Z, Mužic S. Phenotypic traits in Zagorje turkey.. Agriculture 2007;13(1):205-208. 15. Kabalin AE, Menč ik S, Ostović M, Štokovi vić I, Grgas A, Horvath S, Balenović T, Sušić V, Karadjole I, Pavi vič ić Z. Morphological characteristics of Dalmatian turkey. Preliminary results. Maced J Anim Sci 2012;2(3):277-280.

21. Oyegunle OO. Genetic, phenotypic and environmental correlation estimates among physical body traits of three turkey genotypes. Int J Agric Food Sci 2013;4(1-2):484491.

16. Ilori BM, Peters SO, Ikeobi CON, Bamgbose AM, Isidahomen CE, Ozoje MO. Comparative assessment of growth in pure and crossbred turkeys in a humid tropical environment. Int J Poultry Sci 2010;9(4):368-375.

22. Durosaro SO, Oyetade MS, Ilori BM, Adenaike AS, Olowofeso O, Wheto M, et al. Estimation of body weight of Nigerian local turkeys from zoometrical measurements at 4, 8 and 12 weeks of age. Global J Sci Front Res 2013;13(1):1-4.

17. Yakubu A, Peters SO, Ilori BM, Imumorin IG, Adeleke MA, Takeet MI, Ozoje MO, Ikeobi CON, Adebambo OA. Multifactorial discriminant analysis of morphological and heattolerant traits in indigenous, exotic and cross-bred turkeys in Nigeria. Anim Genet Resour 2012;50:21-27.

23. Benabdeljelil K, Arfaoui T. Characterization of Beldi chicken and turkeys in rural poultry flocks of Morocco. Current state and future outlook. Anim Genet Resour 2001;31:87-95.

389

CRECIMIENTO Y ESPECIALIZACIÓN REGIONAL DEL SECTOR Rev PECUARIO Mex Cienc EN MEXICO Pecu 2016;7(3):391-403

Crecimiento y especialización regional del sector pecuario en México, 1994 a 2013

Regional specialization and growth of the livestock sector in Mexico, 1994-2013 Alfredo Rebollar Rebollara, Samuel Rebollar Rebollara, Germán Gómez Tenorioa, Juvencio Hernández Martínezb, Felipe de Jesús González Razoa

RESUMEN

Las políticas macroeconómicas adoptadas por México, ocasionaron una modificación en la estructura productiva del sector pecuario nacional y local. El objetivo del estudio fue determinar el crecimiento de las actividades pecuarias y la especialización regional en ocho regiones de México (Noroeste NO, Norte NR, Noreste NE, Centro-Occidente CO, Centro-Este CE, Sur SU, Oriente OR y Península de Yucatán PE) y evaluar su dinámica económica de 1994 a 2013. Se utilizaron técnicas de análisis regional, como el cociente de localización y el método diferencial-estructural modificado. Los resultados indicaron que en 1994 y 2013, las regiones NO, NE, SU y OR se especializaron en carne de bovino, y esta última, conjuntamente con CE también en pollo. La región NR se especializó en leche; en tanto que en NO, CO y PE fue en carne de cerdo. Las regiones NE, CO y CE también se especializaron en huevo de ave. De 1994 a 2003, las regiones NR, SU, CE y NO fueron dinámicas, ya que el crecimiento del sector pecuario regional (19.94, 11.59, 7.04 y 6.59 %), fue superior al nacional (4.08 %); el resto de las regiones se rezagaron. De 2003 a 2013, la dinámica regional del sector pecuario cambió. Las regiones CO, OR y PE rezagadas en el periodo anterior, fueron dinámicas en este periodo y, las que fueron dinámicas (NO, NR, CE y SU), se rezagaron. La región NE permaneció rezagada durante los dos periodos. Se concluye que el sector pecuario mostró una dinámica y especialización distinta entre las regiones de México. PALABRAS CLAVE: Dinámica regional, Método diferencial-estructural, Sector pecuario.

ABSTRACT

Macroeconomic policies adopted by Mexico caused modifications in the productive structure of national and local livestock sector. The aim of the research was to determine the growth of livestock activities and regional specialization in eight regions of Mexico (Northwest NW, North NR, Northeast NE, Central West CW, Central East CE, South SU, East E and Yucatán Península PE) and assess its economic dynamics from 1994 to 2013. Regional analysis techniques such as location quotient and modified differential-structural method were used. The results indicated that in 1994, 2003 and 2013, the regions NW, NE, CE, SU and E specialized in beef, and the last region in conjunction with CE in chicken also. NR region specialized in milk; and NW, CW and PE regions was pork. NE, CW and CE regions also specialized in chicken egg. From 1994 to 2003, the NR, SO, CE and NW regions were dynamics, because the growth of the regional livestock sector (19.94, 11.59, 7.04 and 6.59 %) was higher than the national growth (4.08 %); the rest of the lagged behind regions. From 2003 to 2013, the regional livestock sector dynamics changed. The CW, EA and PE lagging regions in the previous period, became dynamic in this period and which were dynamic (NW, NR, CE and SO), they behaved behind. The NE region remained behind during the two periods. It concludes that the livestock sector showed a different dynamics and specialization between regions in Mexico. KEY WORDS: Regional dynamics, Differential-structural method, Livestock sector.

In the last 15 yr, the Mexican agricultural sector showed an evolution that was characterized by

En los últimos 15 años, el sector agropecuario mexicano mostró una evolución que se Recibido el 10 de julio de 2015. Aceptado el 15 de octubre de 2015. a

Centro Universitario UAEM Temascaltepec. Universidad Autónoma del Estado de México. Barrio de Santiago s/n, Temascaltepec, Estado de México. 51300. México. gomte61@yahoo.com. Correspondencia al tercer autor. Centro Universitario UAEM Texcoco. Universidad Autónoma del Estado de México.

391

Alfredo Rebollar Rebollar, et al. / Rev Mex Cienc Pecu 2016;7(3):391-403

caracterizó por un ritmo de crecimiento menor y una volatilidad que puso en riesgo la producción(1). Dentro de las actividades del sector, la ganadería presentó un dinamismo mayor que la agrícola, pues en diversos periodos (1995 a 2000, 2001 a 2006 y 2007 a 2010) mantuvo tasas de crecimiento medias anuales de 4.60, 3.58 y 3.42 %, mientras que la agricultura creció 0.55, 2.82 y 0.78 %(2).

a lower growth rate and a volatility that threatened production(1). Among the activities of the sector, livestock had a greater dynamism than agricultural, because in different periods (1995-2000, 2001-2006 and 2007-2010) it maintained rates of annual average growth of 4.60, 3.58 and 3.42 %, while agriculture grew at 0.55, 2.82 and 0.78 %(2). During 2001-2010, real income of livestock production in Mexico, grew 23.66 %, of which, egg and poultry recorded the largest increase (38.29, 35.72 %), followed by beef, milk and swine (19.52, 15.82, 10.79 %), growths that were explained by increases in production and prices thereof(3). During this period, the poultry industry had the highest dynamism, due to growth in Jalisco, Veracruz, Durango, Queretaro and Puebla; where poultry companies whose strategy was based on the absorption of small businesses are positioned. The cattle and pigs were less dynamic, since the growth of these species in the northwest regions, west and south, was slow(4). The change in the regional production structure of the livestock sector in Mexico, has shown marked differences over time, due to the uneven growth of its activities.

Durante 2001 a 2010, el ingreso real de la producción pecuaria en México, creció 23.66 %, del cual, el huevo y carne de ave registraron los incrementos mayores (38.29, 35.72 %), seguidos de la carne de bovino, leche y porcino (19.52, 15.82, 10.79 %), crecimientos que se explicaron por aumentos en la producción y precio de los mismos(3). En ese periodo, la avicultura presentó el dinamismo mayor, debido al crecimiento registrado en Jalisco, Veracruz, Durango, Querétaro y Puebla; donde se posicionaron compañías avícolas cuya estrategia se basó en la absorción de empresas pequeñas. El ganado bovino y porcino fueron menos dinámicos, ya que el crecimiento de estas especies en las regiones noroeste, occidente y sur, fue lento(4). El cambio en la estructura productiva regional del sector pecuario en México, ha mostrado notables diferencias a través del tiempo, debido al crecimiento desigual de sus actividades.

Some studies (5,6,7) have addressed issues related to specialization and regional growth of livestock activities in Mexico; however, these have been rare, and have only been aimed at analyzing the pork sector.

Algunos trabajos(5,6,7) han abordado temas relacionados con especialización y crecimiento regional de actividades pecuarias en México; sin embargo, estos han sido escasos, y solo se han orientado a analizar el sector porcícola.

Therefore, an analysis of dynamics of livestock production to product and regional level is necessary, which would allow illustrate changes and trends at the regional level. All this, as indicators to guide planners and designers of regional development programs, and can be used by them as tools that will allow to formulate economic policies that incentivize the livestock sector with more of a territorial focus. Therefore, the aim of the study was to determine the growth of livestock activities and the regional specialization in eight regions of Mexico and assess their economic dynamics from 1994 to 2013. The hypothesis was that regional

Por ello, un análisis de dinámica de la producción pecuaria a nivel producto y región es necesario, el cual, permitiría ilustrar cambios y tendencias del sector a nivel regional. Todo ello, como indicadores que orienten a planificadores o diseñadores de programas de desarrollo regional, y puedan utilizarlos como herramientas que les permitirían formular políticas económicas que incentiven al sector pecuario con un enfoque territorial. Por lo anterior, el objetivo del estudio 392

CRECIMIENTO Y ESPECIALIZACIÓN REGIONAL DEL SECTOR PECUARIO EN MEXICO

fue determinar el crecimiento de las actividades pecuarias y la especialización regional en ocho regiones de México y evaluar su dinámica económica de 1994 a 2013. La hipótesis fue que la especialización regional contribuye a explicar el crecimiento del sector pecuario en el ámbito territorial.

specialization helps explain the growth of the livestock sector in the territory.

To carry out the regional economic analysis, Mexico was divided into eight regions; Northwest, NW (Baja California, Baja California Sur, Sonora, Sinaloa and Nayarit); North, NR (Chihuahua, Coahuila, Durango, San Luis Potosi and Zacatecas); Northeast, NE (Nuevo Leon and Tamaulipas); Central-West, CW (Aguascalientes, Colima, Guanajuato, Jalisco and Michoacan); Central-East, CE (Federal District, Hidalgo, State of Mexico, Morelos, Puebla, Queretaro and Tlaxcala); South, SU (Chiapas, Guerrero and Oaxaca); East EA (Tabasco and Veracruz); and Yucatan Peninsula, PE (Campeche, Yucatan and Quintana Roo)(8).

Para realizar el análisis económico regional, México se dividió en ocho regiones; Noroeste NO (Baja California, Baja California Sur, Sonora, Sinaloa y Nayarit); Norte NR (Chihuahua, Coahuila, Durango San Luis Potosí y Zacatecas); Noreste NE (Nuevo León y Tamaulipas); CentroOccidente CO (Aguascalientes, Colima, Guanajuato, Jalisco y Michoacán); Centro-Este CE (Distrito Federal, Hidalgo, Estado de México, Morelos, Puebla, Querétaro y Tlaxcala); Sur SU (Chiapas, Guerrero y Oaxaca); Oriente OR (Tabasco y Veracruz) y Península de Yucatán PE (Campeche, Quintana Roo y Yucatán)(8).

The behavior of the value of the actual production in the activities of the livestock sector at the regional and national level during the periods 1994-2003 and 2003-2013 was analyzed for pork, chicken, milk, beef and chicken eggs.

Se analizó el comportamiento del valor de la producción real de las actividades del sector pecuario como carne de bovino, carne de porcino, carne de pollo, leche de bovino y huevo de ave, a nivel regional y nacional, durante los periodos 1994 a 2003 y 2003 a 2013.

The first period included the start of Free Trade Agreement with North America (NAFTA) and ended with removal of tariffs for livestock products (except milk powder); while the second period, involved full tariff elimination for agricultural products(9) and ended with the evolution of the sector to more recent times.

El primer periodo incluyó el inicio del Tratado del Libre Comercio con América del Norte (TLCAN) y, finalizó con la desgravación para productos pecuarios (excepto la leche en polvo); mientras que el segundo, comprendió la eliminación arancelaria total para productos agropecuarios(9) y, finalizó con la evolución del sector hasta tiempos más recientes.

Two regional analysis techniques (ART) were used: location quotient(10) and the “shift and share” method with modification of structures (known as a modified differential-structural method)(11). Both tools are part of research and diagnostic manuals used in ECLAC (Economic Commission for Latin America) in order to measure and characterize a region by describing basic production units(10).

Se utilizaron dos técnicas de análisis regional (TAR): el cociente de localización(10) y el método "shift and share" con modificación de estructuras (conocido como método diferencial-estructural modificado)(11); ambas herramientas dentro de la etapa de diagnóstico e investigación utilizadas en manuales de la CEPAL (Comisión Económica para América Latina), que permiten medir y caracterizar a una región mediante la descripción de unidades básicas de producción(10).

The indicators were calculated by developing three types of sector-region matrices (SECRE)(10) that consisted of a double entry table, where rows represent the activities of the livestock sector and the columns the regions studied. The information processing was performed with the TASK v3.0 software(12) and 393

Alfredo Rebollar Rebollar, et al. / Rev Mex Cienc Pecu 2016;7(3):391-403

Microsoft Excel 2011. The variable analysis used was the value of regional output at constant prices (Base 2012= 100) for each of the livestock products. The current values by State were obtained from the Agricultural Information System and Fisheries (SIAP)(13).

Los indicadores, se calcularon a partir de la elaboración de tres matrices tipo sector-región (SECRE)(10), que consisten en una tabla de doble entrada, donde las filas representaron las actividades del sector pecuario y las columnas las regiones que se estudiaron. El procesamiento de la información se realizó con el software TAREA v3.0(12) y Microsoft Excel 2011. La variable de análisis que se utilizó, fue el valor de la producción regional a precios constantes (Base 2012= 100) para cada uno de los productos pecuarios. Los valores corrientes por entidad federativa, se obtuvieron del Sistema de Información Agroalimentaria y Pesquera (SIAP)(13).

The location quotient (Qij), indicates the relative size of an activity in a region, compared to the relative size of the same activity at the national level. Qij expression is: Qij=

Where Vij= value of the variable V corresponding to the activity “i” and the region “j”; i Vij= value of the variable V for the regional total; j Vij= value of the variable V corresponding to the national total activity “i”; i j Vij= value of the variable V corresponding to the national total.

El cociente de localización (Qij), indica el tamaño relativo de una actividad en una región, comparado con el tamaño relativo de la misma actividad a nivel nacional. La expresión de Qij es la siguiente: Qij=

Vij     j Vij i Vij i j Vij

The values assumed for Qij are: Qij= 1, indicates that if relative size of the activity “i” in the region “j” is identical to the relative size of the same activity in the country, then there is no regional specialization in the activity “i”. Qij< 1 indicates that if the relative size of the activity “i” in the region “j” is less than the relative size of the same activity in the country, no regional specialization in the activity “i”. Qij> 1, indicates that if the relative size of the activity “i” in the region “j” is greater than the relative size of the same activity in the country, there is a regional specialization in the activity “i”.

Donde V ij = valor de la variable V correspondiente a la actividad "i" y la región "j"; i Vij= valor de la variable V correspondiente al total regional; j Vij= valor de la variable V correspondiente al total nacional de la actividad "i";  i  j V ij = valor de la variable V correspondiente al total nacional. Los valores que adopta Qij son: Qij= 1, indica que si el tamaño relativo de la actividad "i" en la región "j", es idéntico al tamaño relativo de la misma actividad en el país, no hay especialización regional en la actividad "i". Qij< 1, indica que si el tamaño relativo de la actividad "i" en la región "j", es menor al tamaño relativo de la misma actividad en el país, no hay especialización regional en la actividad "i". Qij> 1, indica que si el tamaño relativo de la actividad "i" en la región "j", es mayor al tamaño relativo de la misma actividad en el país, se trata de una especialización regional en la actividad "i".

The differential-structural modified method is used to compare the observed change in a variable that has occurred over a period of time, both in a region and in a country(10). This method was used to determine whether the regional specialization evolved into sectors that are more dynamic or to see if the structural change was characterized by a specialization in sectors in decline at the end of the study.

El método diferencial-estructural modificado, consiste en comparar el cambio observado en

The "shift and share" structural modification methodology, is broken down into four 394

CRECIMIENTO Y ESPECIALIZACIÓN REGIONAL DEL SECTOR PECUARIO EN MEXICO

una variable ocurrido en un periodo de tiempo, tanto en la región, como en el país(10). Este método, se utilizó para indicar si la especialización regional evolucionó hacia sectores con mayor dinamismo o, el cambio estructural se caracterizó por una especialización en sectores en retroceso al final del estudio.

components: the total effect (TE), as amended regional effect (ARE), structural effect (SE) and modified structural effect (MSE).

TE compares the final value of the variable under study in region j, the value that hypothetically would have had this variable if the region had behaved like the country, in terms of growth. The expression of TE is:

El método shift and share con modificación de estructuras, se desagrega en cuatro componentes: efecto total (ET), efecto regional modificado (ERM), efecto estructural (EE) y efecto estructural modificado (EEM).

TEj =

El ET, compara el valor final de la variable en estudio en la región j, con el valor que hipotéticamente habría tenido dicha variable si la región se hubiera comportado como el país, en términos de crecimiento. La expresión del ET es:

ETj =

i=1

Vij (t) −

i=1

n i=1

Vij (t) −

i=1

Vij (0) ∗ rSR

Where Vij= value of the variable V corresponding to the activity "i" in the region "j".

0= initial year; t= final year; rSR= coefficient of variation at national level where rSR= ∑i ∑j Vij ( ) ∑i ∑j Vij (0) .

Vij (0) ∗ rSR

A positive TE indicates "hypothetical gain" due to the increased growth of the livestock sector in the region, compared to the national. A negative TE indicates "hypothetical loss", as the sector's growth in the region was lower than in the country(10). TE is given by the combination of the modified regional effect (ARE), structural effect (EE) and modified structural effect (MSE).

Donde V ij = valor de la variable V correspondiente a la actividad "i", en la región "j".

0= año inicial; t= año final; rSR= coeficiente de variación a nivel nacional; rSR= ∑i ∑j Vij ( ) ∑i ∑j Vij (0) .

TEj= AREj + SEj + MSEj

Un ET positivo indica "ganancia hipotética" debido al crecimiento mayor del sector pecuario en la región, comparado con el nacional. Un ET negativo indica "pérdida hipotética", dado que el crecimiento del sector en la región fue menor que en el país(10). El ET se explica por la combinación del efecto regional modificado (ERM), efecto estructural (EE) y efecto estructural modificado (EEM).

The structural effect reflects the difference in the composition of activities between the region and the country, derived from a different production structure at beginning of period(10). The SE expression is: =

ETj= ERMj + EEj + EEMj

∑j Vij (0) Vij (0) ∗ − ∑i Vij (0) ∑i ∑j Vij (0)

∗

n i=1

Vij (0)

Where national rSi = coefficient of variation

El efecto estructural, refleja la diferencia en la composición de actividades entre la región y el

activity rSi= 395

∑j Vij (t) ∑j Vij (0)

Alfredo Rebollar Rebollar, et al. / Rev Mex Cienc Pecu 2016;7(3):391-403

país, derivada de una estructura productiva distinta al inicio del periodo(10). La expresión del EE es: =

∑j Vij (0) Vij (0) ∗ − ∑i Vij (0) ∑i ∑j Vij (0)

∗

n i=1

A positive SE indicates regional specialization at the beginning of the period in dynamic activities in the country; while a negative SE refers regional specialization in activities in decline at the national level.

Vij (0)

The modified structural effect indicates the change in the difference in the regional production structure at the beginning and at end of the study period. It is obtained through the inverse difference structural effect EI and SE.

Donde rSi= coeficiente de variación nacional por actividad rSi=

∑j Vij (t) ∑j Vij (0)

Un EE positivo indica especialización regional al inicio del periodo en actividades dinámicas en el país; mientras que un EE negativo refiere especialización regional en actividades en retroceso en el ámbito nacional.

MSEj= EIj - SEj

Where:

El efecto estructural modificado indica el cambio de la diferencia existente en la estructura productiva regional al inicio y final del periodo de estudio. Se obtiene a través de la diferencia del efecto estructural inverso (EI) y EE.

(t) ∗

∑i ∑j Vij (0) ∑j Vij (0) − ∑i ∑j Vij (t) ∑j Vij (t)

A positive MSE, indicates regional specialization at the end of the period of dynamic activity in the country; while a negative MSE, refers regional specialization in activities in decline nationally.

EEMj= EIj - EEj

Donde:

The modified regional effect, determines the regional dynamics of each activity. This expression is:

∑i ∑j Vij (0) ∑j Vij (0) (t) ∗ − ∑i ∑j Vij (t) ∑j Vij (t)

AREj= TEj - SEj - MSEj

Un EEM positivo, indica especialización regional al final del periodo en actividades dinámicas en el país; mientras que un EEM negativo, refiere especialización regional en actividades en retroceso a nivel nacional.

A positive ARE indicates that the region is winning; while a negative ARE indicates that the region is losing(12).

During the years of study, all regions of Mexico obtained positive ratios, below and above the unit value, distributed in different livestock activities. These values indicate the presence or absence of regional specialization since the relative size of the value of the actual production that generated those products in the regions was more or less the same as products at the national level(14).

El efecto regional modificado, determina la dinámica regional de cada actividad. Su expresión es: ERMj= ETj - EEj - EEMj

Un ERM positivo indica que la región es ganadora; mientras que un ERM negativo refiere que la región es perdedora(12).

During 1994, the CW, PE, NW and SU regions specialized in pork and poultry eggs (except SU for egg); the latter two regions, did the same

Durante los años de estudio, todas las regiones de México obtuvieron cocientes de localización 396

CRECIMIENTO Y ESPECIALIZACIÓN REGIONAL DEL SECTOR PECUARIO EN MEXICO

Cuadro 1. Cocientes de localización del valor de la producción real por región de las actividades pecuarias en México: 1994

Table1. Location coefficients of actual cost of production by region of livestock activities in Mexico: 1994 Activity

Beef Chicken meat Bovine milk Pork meat Chicken egg

1.27 0.38 0.46 1.76 1.26

1.02 0.75 1.95 0.26 0.57

1.78 0.76 0.17 0.66 1.37

0.76 0.83 1.15 1.23 1.32

0.48 1.82 0.95 0.84 1.40

1.55 0.54 0.77 1.29 0.29

1.59 1.18 0.85 0.48 0.12

0.80 1.60 0.10 1.84 1.07

Regions of Mexico: Northwest (NW); North (NR); Northeast (NE); Center-West (CW); East Central (CE); South (SU); East (EA) and Yucatan Peninsula (PE).

positivos, inferiores y superiores a la unidad, distribuidos en las distintas actividades pecuarias; estos valores indicaron presencia o ausencia de especialización regional dado que el tamaño relativo del valor de la producción real que generaron esos productos en las regiones, fue mayor o menor a los mismos productos en el ámbito nacional(14).

for beef, together with NR, NE and EA. The NR region also did it in milk, while NE and CE did so with egg and only CE with chicken (Table 1). In 2013, the regions NW, CW and EA continued their specialization in the same activities as the previous year, while the rest of the regions changed their expertise to other products. The NR region increased its specialization in milk; while the NE region continued specializing in beef and egg. The CE region continued in chicken and egg and added, milk and pork. The SU region continued to specialize in beef, pork decreased and they added chicken. The PE region increased its specialization in pork and continued with chicken meat (Table 2).

Durante 1994, las regiones CO, PE, NO y SU se especializaron en carne de porcino y huevo de ave (excepto SU en huevo); estas dos últimas regiones, también lo hicieron en carne de bovino, conjuntamente con NR, NE y OR. La región NR también lo hizo en leche, mientras que NE y CE lo hicieron en huevo y, CE también en pollo (Cuadro 1). En 2013, las regiones NO, CO y OR continuaron su especialización en las mismas actividades que el año anterior, mientras que el resto de las regiones cambiaron su especialización hacia otros productos. La región NR incrementó su especialización en leche; mientras que la región NE continuó especializándose en carne de bovino y huevo. La región CE continuó en pollo y huevo y, añadió, leche y carne de porcino. La región SU continuó su especialización en carne de bovino, disminuyó en porcino y adicionó pollo. La región PE incrementó su especialización en carne de cerdo y continuó en carne de pollo (Cuadro 2).

During the study, in some regions there was a tendency to specialize in certain livestock activities, such as regions NW, NE, SU and EA in beef meat. The productive vocation of the first two can be partly explained by their cowcalf grazing system of production and their feedlot for fattening with high technological levels partly explained. While regions SU and EA are productive areas with dual-purposes and providing areas for fattening calves and finishing feedlots, where their destinations are the markets of central Mexico(15). In comparison, the regions CE and EA remained specializing in chicken meat. Its production profile is positioned as such due to the high

Durante el estudio, en algunas regiones hubo tendencia a especializarse en ciertas actividades

397

Alfredo Rebollar Rebollar, et al. / Rev Mex Cienc Pecu 2016;7(3):391-403

Cuadro 2. Cocientes de localización del valor de la producción real por región de las actividades pecuarias en México: 2013 Table 2. Location ratios of actual cost of production by region for livestock activities in Mexico: 2013 Activity

Beef Chicken meat Bovine milk Pork meat Chicken egg

1.64 0.61 0.40 1.62 0.88

1.02 0.98 2.18 0.18 0.33

1.54 0.93 0.21 0.89 1.38

0.63 0.87 0.94 1.05 1.80

0.59 1.29 1.04 1.02 1.06

1.68 1.05 0.86 0.92 0.16

1.68 1.22 0.66 0.96 0.07

0.69 1.29 0.09 2.33 0.86

Regions of Mexico: Northwest (NW); North (NR); Northeast (NE); Center-West (CW); Central East (CE); South (SU); East (EA) and Yucatan Peninsula (PE).

pecuarias, tales como las regiones NO, NE, SU y OR en carne de bovino. La vocación productiva en las dos primeras, se explicó en parte por el sistema de producción vaca-becerro bajo pastoreo y de engorda en corral con niveles tecnológicos altos. Mientras que las regiones SU y OR son áreas productoras de doble propósito y proveedoras de becerros para engorda y finalización en corral, cuyos destinos son los mercados del centro de México(15).

technological level of poultry companies located in Veracruz and Queretaro, whose strategy has been based on the absorption of small businesses(4). The permanence of the NR region in bovine milk was explained by the dynamics of intensive cattle farming located in the Laguna region (Coahuila and Durango), where companies use a high degree of mechanization(16) which is reflected in its productivity in the use of labor and land and make the activity profitable and competitive(17).

Por su parte, las regiones CE y OR permanecieron especializadas en carne de pollo. Su vocación productiva obedeció al posicionamiento de compañías avícolas con grado tecnológico alto, ubicadas en Veracruz y Querétaro, cuya estrategia se basó en la absorción de empresas pequeñas (4) . La permanencia de la región NR en leche de bovino, se explicó por la dinámica de la ganadería intensiva ubicada en la comarca lagunera (Coahuila y Durango), cuyas empresas se manejan con grado de tecnificación alto(16) que reflejan productividad en el uso de mano de obra y tierra y hacen que la actividad sea rentable y competitiva(17).

The NW, PE and CW regions remained specialized in pig meat. The vocation of the first two, can be explained by the dynamics of pork production in Sonora and Yucatan(5), which was based on the implementation of new forms of marketing, export dynamics and advanced technologies(6,18). In the CW region, the pig remained an activity of slow growth(5), because of lack of supportive policies and inefficient use of resources(7), with a low level of productivity(19) and low degree of mechanization compared to companies positioned in Jalisco(20); this led to classification of the region as a laggard region(5).

Some regions such as CW, CE and NE also specialized in poultry eggs, its productive vocation explained by the dynamics of Jalisco, Puebla and Nuevo Leon; entities with hightechnology companies that were able to increase their efficiency and productivity of their production systems(21).

Las regiones NO, PE y CO permanecieron especializadas en carne de porcino. La vocación de las dos primeras se explicó por la dinámica de la porcicultura en Sonora y Yucatán(5), que se basó en la implementación de nuevas formas de comercialización, dinámica exportadora y

398

CRECIMIENTO Y ESPECIALIZACIÓN REGIONAL DEL SECTOR PECUARIO EN MEXICO

tecnologías avanzadas(6,18). En la región CO, la porcicultura permaneció como una actividad de crecimiento lento(5), a causa de falta de políticas de apoyo e ineficiencia en el uso de los recursos(7), nivel de productividad bajo(19) y grado bajo de tecnificación de las empresas posicionadas en Jalisco(20); ello llevó a que se le clasificara como una región rezagada(5).

Although the location quotient generates information about presence or absence of regional specialization, there are causes that affect its magnitude, such as income distribution, consumption habits, technology and efficient use of resources. Its scope depends on the level of disaggregation of information(10). In the period 1994 to 2003, NR, CE, SU and NW regions had a positive overall effect (TE) due to higher growth in the value of real output recorded by the livestock sector in the regions, compared with growth in the country; therefore, these regions were considered as dynamic (Table 3).

Algunas regiones como CO, CE y NE también se especializaron en huevo de ave, su vocación productiva se explicó por la dinámica de Jalisco, Puebla y Nuevo León; entidades donde se asentaron empresas con grado tecnológico alto que lograron incrementar la eficiencia y productividad de los sistemas de producción(21).

TE values in regions NR and SU had greater impact, due to the role that the modified regional effect (ARE) and modified structural effect (MSE), which were also positive. ARE values indicated that chicken meat and bovine milk recorded higher growth in the regions, than in the country. MSE values meant that regions modified their production structure at the end of the period and reoriented their specialization towards dynamic activities at the national level such as with milk and chicken

Si bien el cociente de localización genera información sobre presencia o ausencia de especialización regional, hay causas que afectan su magnitud, como la distribución del ingreso, hábitos de consumo, tecnología y eficiencia en el uso de los recursos. Su alcance depende del nivel de desagregación de la información(10).

Cuadro 3. Coeficientes obtenidos de la aplicación del método diferencial-estructural modificado al valor de la producción pecuaria real por región en México: 1994-2003 (millones de pesos)

Table 3. Coefficients obtained from the application of the modified differential-structural method to the actual cost of production by region of livestock activities in Mexico: 1994-2003 (millions of Mexican pesos) Region NW NR NE CW CE SU EA PE

Total

539.35 4,427.86 -590.13 -1,990.24 1,018.99 948.95 -2,802.05 -1,552.73

Structural

Effects

-1,077.11 -200.92 -462.98 427.32 2,496.59 -781.61 -690.41 289.13

Modified structural -79.29 318.61 265.74 507.73 -462.95 65.75 -235.16 -380.42

Modified regional 1,695.76 4,310.17 -392.89 -2,925.29 -1,014.65 1,664.81 -1,876.48 -1,461.44

Regions of Mexico: Northwest (NW); North (NR); Northeast (NE); Center-West (CW); Central East (CE); South (SU); East (EA) and Yucatan Peninsula (PE).

399

Alfredo Rebollar Rebollar, et al. / Rev Mex Cienc Pecu 2016;7(3):391-403

Cuadro 4. Crecimiento del valor de la producción real por región de las actividades pecuarias en México: 1994-2003 (%) Table 4. Growth in the cost of actual production by region of livestock activities in Mexico: 1994-2003 (%) Activity

Beef Chicken meat Bovine milk Pork meat Chicken egg Livestock

-2.08 78.99 30.23 5.52 -21.41 6.59

-6.38 84.36 24.72 -12.77 -2.81 19.94

-30.46 84.87 21.82 26.39 -14.52 -3.22

-26.81 37.09 -11.29 -3.05 31.16 0.57

-7.66 14.06 10.59 -11.92 17.59 7.04

-4.86 90.97 31.49 1.03 -30.38 11.59

-16.96 -0.35 -12.24 33.20 1.98 -8.16

-11.88 -33.31 -4.12 8.19 -15.26 -12.57

National -14.29 29.28 6.96 1.13 11.04 4.08

Regions of Mexico: Northwest (NW); North (NR); Northeast (NE); Center-West (CW); Central East (CE); South (SU); East (EA) and Yucatan Peninsula (PE).

En el periodo 1994 a 2003, las regiones NR, CE, SU y NO tuvieron un efecto total (ET) positivo debido al crecimiento mayor del valor de la producción real registrado por el sector pecuario en las regiones, comparado con el crecimiento en el país; por ello, estas regiones se consideraron como dinámicas (Cuadro 3).

meat. The positive value of TE in the NW region was not influenced by the value of ARE, which meant increased growth of poultry meat, milk, beef and pork meat in the region, compared with that recorded in the country (Table 4).

The TE in the CE region was determined by the value of EE, this meant that the region specialized at beginning of period in dynamic activities at the national level as chicken meat and egg. Meanwhile, regions EA, CW, PE and NE had negative TE. These values indicated that the growth of real output value of the livestock sector in the regions was lower than that obtained by the country; therefore, these regions were considered as laggards, and specialization in activities in decline at the national level, such as beef and pork.

Los valores de ET en las regiones NR y SU se debieron a la aportación mayor que realizó el efecto regional modificado (ERM) y efecto estructural modificado (EEM) que también fueron positivos. Los valores del ERM indicaron que la carne de pollo y la leche de bovino registraron crecimientos superiores en las regiones, que en el país. Los valores de EEM significaron que las regiones modificaron su estructura productiva al final del periodo y reorientaron su especialización hacia actividades dinámicas en el ámbito nacional como fueron leche y carne de pollo. El valor positivo del ET en la región no fue influenciado por el valor del ERM, que significó un crecimiento mayor de carne de pollo, leche de bovino y carne de porcino en la región, comparado con el registrado en el país (Cuadro 4).

During 2003-2013, CW, EA and PE regions had positive TE, due to the higher growth of real output value of the livestock sector in these regions compared to registered in the country; therefore, these regions were considered dynamic (Table 5). The magnitude and sign of TE in these regions are due to the positive contribution of all factors that generate it (except SE in the region EA). The ARE indicated that activities such as chicken, pork (except CW), beef and egg (except EA and PE) and milk (except EA and PE) obtained

El ET en la región CE lo determinó el valor de EE, éste significó que la región se especializó al inicio del periodo en actividades dinámicas en el ámbito nacional como carne de pollo y huevo. Por su parte, las regiones OR, CO, PE y NE tuvieron ET negativos. Estos valores indicaron 400

CRECIMIENTO Y ESPECIALIZACIÓN REGIONAL DEL SECTOR PECUARIO EN MEXICO

Cuadro 5. Coeficientes obtenidos de la aplicación del método diferencial-estructural modificado al valor de la producción pecuaria real por región en México: 2003-2013 (millones de pesos) Table 5. Coefficients obtained from the application of the differential-structural method, modified to the actual cost of livestock production by region in Mexico: 2003-2013 (millions of Mexican pesos) Region NW NR NE CW CE SU EA PE

Total

-2,600.70 -2,179.23 -2,409.47 11,994.62 -5,147.92 -1,377.89 580.47 1,140.12

Structural

Effects

-881.88 -2,320.51 329.74 2,245.53 2,882.28 -1,134.64 -1,227.26 106.73

Modified Structural 469.75 512.12 -138.80 209.48 -2,250.69 590.87 523.10 84.17

Modified Regional -2,188.56 -370.85 -2,600.41 9,539.61 -5,779.50 -834.12 1,284.63 949.21

Regions of Mexico: Northwest (NW); North (NR); Northeast (NE); Center-West (CW); Central East (CE); South (SU); East (EA) and Yucatan Peninsula (PE).

que el crecimiento del valor de la producción real del sector pecuario en las regiones, fue menor al obtenido por el país; en consecuencia, estas regiones se consideraron como rezagadas, y con especialización en actividades en retroceso en el ámbito nacional, como carne de bovino y porcino.

higher growth in the regions, compared to the same activities in the country (Table 6).

Meanwhile the values of SE and MSE meant that regions (except EA) began and ended the period specializing in activities that are dynamic at the national level, such as chicken and egg. The regions NW, NR, NE, CE and SU had negative TE, due to the lower growth of beef, pork, chicken, milk and egg, in some regions for the country, as well as a specialization at the end of period

Durante 2003 a 2013, las regiones CO, OR y PE tuvieron ET positivos, debido al crecimiento mayor del valor de la producción real del sector

Cuadro 6. Crecimiento del valor de la producción real por región de las actividades pecuarias en México: 2003-2013 (%) Table 6. Growth of real output value by region of livestock activities in Mexico: 2003-2013 (%) Activity

Beef Chicken meat Bovine milk Pork meat Egg Livestock

47.10 86.04 -14.63 13.48 87.13 38.74

37.50 72.38 34.31 18.39 46.37 43.58

8.26 6.79 4.19 7.48 95.09 19.28

45.38 85.69 38.23 32.80 155.29 71.14

45.22 27.31 25.52 76.50 34.83 36.11

35.03 123.44 15.62 -2.70 75.88 40.31

34.77 105.60 8.13 86.54 19.37 52.84

6.45 144.15 8.20 46.92 96.13 64.06

National

37.49 69.84 27.15 35.55 101.32 50.08

Regions of Mexico: Northwest (NW); North (NR); Northeast (NE); Center-West (CW); Central East (CE); South (SU); East (EA) and Yucatan Peninsula (PE).

401

Alfredo Rebollar Rebollar, et al. / Rev Mex Cienc Pecu 2016;7(3):391-403

pecuario en esas regiones, comparado con el registrado en el país; por ello, estas regiones se consideraron dinámicas (Cuadro 5).

with activities that are shrinking at the national level such as beef and pork.

The regions NR, SU, CE and NW were dynamic during the period 1994 to 2003, lagged behind in 2003 to 2013, due to an increase of the cost of production of the livestock sector in those regions. These were better for the first period (19.94, 11.59, 7.04 and 6.59 %), were inferior in the second period (43.58, 40.31, 36.11 and 38.74 %), and also inferior in relation to the growth of national livestock sector in both periods (4.08 and 50.08 %). The change of dynamism of the livestock sector in those regions is due to regional factors that caused a decrease in the growth of production volume of some activities such as poultry, meat and milk from cattle, in addition to regional specialization in activities in decline at the national level, such as milk, beef and pork.

La magnitud y signo de los ET en esas regiones, se debió a la aportación positiva que realizaron todos los efectos que lo integran (excepto EE en la región OR). Los ERM indicaron que las actividades como carne de pollo, carne de porcino (excepto CO), carne de bovino y huevo (excepto OR y PE) y leche (excepto OR y PE) obtuvieron crecimientos superiores en las regiones, comparado con las mismas actividades en el país (Cuadro 6).

Por su parte los valores de EE y EEM significaron que las regiones iniciaron (excepto OR) y finalizaron el periodo especializándose en actividades dinámicas en el ámbito nacional, como carne de pollo y huevo. Las regiones NO, NR, NE, CE y SU tuvieron ET negativos, debido al crecimiento inferior de carne de bovino, porcino, pollo, leche y huevo, en algunas regiones respecto al país, además de una especialización al final del periodo en actividades en retroceso en el ámbito nacional como carne de bovino y porcino.

CW, PE and EA regions lagged behind in the first period, became dynamic during the second period, because in the latter, the regional livestock sector growth exceeded the national. The growth of chicken, egg and pork, as well as regional specialization in the first two products were the causes that determined the change in dynamics of the livestock sector in those regions.

Las regiones NR, SU, CE y NO que fueron dinámicas durante el periodo 1994 a 2003, se rezagaron en 2003 a 2013, debido a un cambio en el crecimiento del valor de la producción del sector pecuario en esas regiones, pues de ser superior durante el primer periodo (19.94, 11.59, 7.04 y 6.59 %), cambió a inferior en el segundo periodo (43.58, 40.31, 36.11 y 38.74 %); ellos, en relación con el crecimiento del sector pecuario nacional en ambos periodos (4.08 y 50.08 %). El cambio de dinamismo del sector pecuario en esas regiones, se debió a factores regionales que ocasionaron una disminución en el crecimiento del volumen de producción de algunas actividades como carne de pollo y leche de bovino, además de la especialización regional en actividades en retroceso en el ámbito nacional, como leche, carne de bovino y porcino.

Meanwhile, the permanent backwardness of the livestock sector in the NE region during the study was due to lower growth of most of their activities than the national average; coupled with a constant specialization in beef, this activity has slow growth in the country. In this regard, some authors(5,6,7) reported the dynamics and regional growth of pig production in Mexico, which has a similar pattern in some regions and different in others because different periods were evaluated.

The presence of regional specialization, contributed to the growth of the livestock sector in those territories that had positive structural and modified structural effects.

Las regiones CO, PE y OR que se rezagaron en el primer periodo, pasaron a ser dinámicas durante segundo periodo, debido a que en este

End of english version

402

CRECIMIENTO Y ESPECIALIZACIÓN REGIONAL DEL SECTOR PECUARIO EN MEXICO

último, el crecimiento del sector pecuario regional superó al nacional.

6. 7.

El crecimiento del pollo, huevo y carne de cerdo, así como la especialización regional en los dos primeros productos, fueron las causas que determinaron el cambio de dinamismo del sector pecuario en esas regiones.

8. 9.

Por su parte, el rezago permanente del sector pecuario en la región NE durante el estudio, fue porque el crecimiento de la mayoría de sus actividades fue inferior al nacional; aunado a una constante especialización en carne de bovino, cuya actividad fue de lento crecimiento en el país. Al respecto, grupos de investigadores(5,6,7), reportaron la dinámica y crecimiento regional de la producción porcina en México, que es un comportamiento similar en algunas regiones y diverso en otras, debido a que se evaluaron periodos distintos.

Bassols BA. Geografía económica de México: teoría, fenómenos generales, análisis regional. 4ta ed. México, D.F: Trillas; 1980.

Ruiz FM. Evolución reciente y perspectivas del sector agropecuario en México. ICE 2005;(821):89-106.

11. Cuadrado RJR, Mancha NT, Garrido YR. Convergencia regional en España: hechos, tendencias y perspectivas. Fundación Argentaria España: Visor; 1998.

12. Lira L, Quiroga B. Técnicas de análisis regional. Santiago de Chile: Manuales del Instituto Latinoamericano y del Caribe de Planificación Económica y Social (ILPES). 2003(30). 13. SIAP. Servicio de Información Agroalimentaria y Pesquera. Información de mercados. http://www.siap. gob.mx/ ?option=com_content&view=article&id= 181&Itemid=426. Consultado 9 ene, 2015.

14. Rendón RL, Mejía RP, Salgado VMC. Especialización y crecimiento manufacturero en dos regiones del Estado de México: un análisis comparativo. Economía: teoría y práctica 2013;(38):111-148.

15. Financiera Rural. Monografía de carne de bovino 2012. www.financierarural.gob.mx/informacionsectorrural/ Documents/Monografias/Monograf%EDaCarneBovino (feb2012).pdf. Consultado 12 feb, 2015. 16. Ruiz GJL, Aguilar VA, Gómez GG, Ruiz LJ. Circuitos de gestión del conocimiento: innovación para la competitividad de la agroindustria lechera en la región lagunera (CoahuilaDurango, México). Rev Mex Agronegocios 2005;IX(17):118.

LITERATURA CITADA

Del moral BLE, Ramírez GBP, Muñoz JAR. Crecimiento regional de la producción de carne de cerdo en México, 1980-2005. Análisis económico 2008;XXIII(52):271-290.

10. Boisier S. Técnicas de análisis regional con información limitada. Santiago de Chile: Cuadernos del Instituto Latinoamericano y del Caribe de Planificación Económica y Social (ILPES). Serie II, número 27; 1980.

La presencia de especialización regional, contribuyó al crecimiento del sector pecuario en aquellos territorios cuyos efectos estructurales y estructurales modificados fueron positivos.

Bobadilla SEE, Espinoza OA, Martínez CFE. Dinámica de la producción porcina en México de 1980 a 2008. Rev Mex Cienc Pecu 2010;1(3):251-268.

17. Odermatt P, Santiago CMJ. Ventajas comparativas en la producción de leche en México. Comercio Exterior 1997:955961.

Escalante SRI, Catalán H. Situación actual del sector agropecuario en México: perspectivas y retos. Economía informa 2008;(350):7-25.

Basurto HS, Escalante SR. Impacto de la crisis en el sector agropecuario en México. Economíaunam 2012;9(25):51-73.

18. Sierra MLD, Ortiz RB, Sierra VAC, Rivera LJA, Sanginés GJR, Magaña MMA. Estructura del mercado y comportamiento del precio de la carne de cerdo en Yucatán. Téc Pecu Méx 2005;43(3):347-360.

SAGARPA. Secretaría de Agricultura, Ganadería, Desarrollo Rural, Pesca y Alimentación. Situación actual y perspectiva de la producción de carne de pollo en México 2009. www.sagarpa.gob.mx/ganaderia/Publicaciones/Lists/ Estudios%20de%20situacin%20actual%20y%20perspectiva/ Attachments/28/sitpollo09.pdf. Consultado 9 feb, 2015.

20. Nava NJJ, Trueta SR, Finck VB, Barranco VB, Osorio HE, Lecumberri LJ. Impactos del nivel tecnológico en la eficiencia productiva y variables económicas, en granjas porcinas de Guanajuato, Jalisco, Sonora y Yucatán. Téc Pecu Méx 2009;47(2):157-172.

19. Bobadilla SEE, Franco MS, Regil GHH, Martínez CFE. Inventario porcino y su evolución en México. En: Bobadilla SEE, Martínez CFE editores. Porcicultura mexicana: auge y crisis de un sector. México: Universidad Autónoma Chapingo; 2013:33-51.

Brambila PJJ, Martínez DMA, Rojas RMM, Pérez CV. El valor de la producción agrícola y pecuaria en México: fuentes del crecimiento, 1980-2010. Rev Mex Cienc Agríc 2014;5(4):619631.

21. ASERCA. Agencia de Servicios a la Comercialización y Desarrollo de Mercados Agropecuarios. Huevo. Claridades Agropecuarias 1996;(36):1-44.

Rebollar RA, Gómez TG, Rebollar RS, Hernández MJ, González RFD. Dinámica regional de la producción porcina en México, 1994-2012. Agrociencia 2015;(49):455-473.

403

Revista Mexicana de Ciencias Pecuarias

Edición Bilingüe Bilingual Edition

Rev. Mex. Cienc. Pecu. Vol. 7 Núm. 3, pp. 263-403, JULIO-SEPTIEMBRE-2016

ISSN: 2007-1124

Aislamiento de microRNAs a partir de células clorofílicas de Bouteloua gracilis y su caracterización in silico

Pags.

Revista Mexicana de Ciencias Pecuarias Rev. Mex. Cienc. Pecu. Vol. 7 Núm. 3, pp. 263-403, JULIO-SEPTIEMBRE-2016

CONTENIDO CONTENTS

Rev. Mex. Cienc. Pecu. Vol. 7 Núm. 3, pp. 263-403, JULIO-SEPTIEMBRE-2016