AE&M 63-2

ISSN 2359-4292

OFFICIAL JOURNAL OF THE BRAZILIAN SOCIETY OF ENDOCRINOLOGY AND METABOLISM Vol. 63 – No. 02 – April 2019

editorial 95 The long and still uncertain journey of BRAF as a prognostic tool in patients with papillary thyroid cancer Rafael Selbach Scheffel, Ana Luiza Maia

Archives of Endocrinology

original articles

OFFICIAL JOURNAL OF THE BRAZILIAN Danielle Pessôa-Pereira, Mateus Fernandes da Silva Medeiros, Virna Mendonça Sampaio Lima, Joaquim Custódio da Silva Jr., Taíse Lima de Oliveira Cerqueira, Igor Campos da Silva, Luciano Espinheira Fonseca Jr., Luiz José Lobão Sampaio, SOCIETY OF Cláudio Rogério Alves de Lima, Helton Estrela Ramos 107 Preoperative detection of TERT promoter and BRAF mutations in papillary thyroid carcinoma in high-risk thyroid nodules ENDOCRINOLOGY Tatiana Marina Vieira Giorgenon, Fabiane Tavares Carrijo, Maurício Alamos Arruda, Taíse Lima Oliveira Cerqueira, Haiara Ramos Barreto, Juliana Brandão Cabral, Thiago Magalhães da Silva, Patrícia Künzle Ribeiro Magalhães, Léa Maria Zanini Maciel, Helton Estrela Ramos AND METABOLISM 97 Association between BRAF (V600E) mutation and clinicopathological features of papillary thyroid carcinoma:

a Brazilian single-centre case series

V600E

and Metabolism

113 Cognitive functions in children with congenital adrenal hyperplasia

Nermine Hussein Amr, Alaa Youssef Baioumi, Mohamed Nagy Serour, Abdelgawad Khalifa, Nermine Mahmoud Shaker

121 Prediction of gestational diabetes mellitus in the first trimester: comparison of maternal fetuin-A, N-terminal proatrial

natriuretic peptide, high-sensitivity C-reactive protein, and fasting glucose levels Hatice Kansu-Celik, A. Seval Ozgu-Erdinc, Burcu Kisa, Rahime Bedir Findik, Canan Yilmaz, Yasemin Tasci

128 Could semiquantitative analysis of real-time ultrasound elastography distinguish more liver parenchyma alterations

of nonalcoholic fatty liver disease in patients with polycystic ovary syndrome?

Na Di, Xinchuan Zhou, Yaxiao Chen, Xiaomiao Zhao, Lin Li, Linlin Jiang, Baoming Luo, Xiaoli Chen, Dongzi Yang

Archives of

137 Serum calcitonin nadirs to undetectable levels within 1 month of curative surgery in medullary thyroid cancer

Fernanda Andrade, Geneviève Rondeau, Laura Boucai, Rebecca Zeuren, Ashok R. Shaha, Ian Ganly, Fernanda Vaisman, Rossana Corbo, Michael Tuttle

142 Triiodothyronine (T3) upregulates the expression of proto-oncogene TGFA independent of MAPK/ERK pathway activation

in the human breast adenocarcinoma cell line, MCF7

Endocrinology

Tabata M. Silva, Fernanda C. F. Moretto, Maria T. De Sibio, Bianca M. Gonçalves, Miriane Oliveira, Regiane M. C. Olimpio, Diego A. M. Oliveira, Sarah M. B. Costa, Igor C. Deprá, Vickeline Namba, Maria T. Nunes, Célia R. Nogueira

148 Effects of a new approach of aerobic interval training on cardiac autonomic modulation and cardiovascular parameters

of metabolic syndrome subjects Laís Manata Vanzella, Stephanie Nogueira Linares, Rodolfo Augusto Travagin Miranda, Anne Kastelianne França da Silva, Diego Giuliano Destro Christófaro, Jayme Netto Júnior, Luiz Carlos Marques Vanderlei

and Metabolism

157 Correlation analysis between short-term insulin-like growth factor-I and glucose intolerance status after transsphenoidal

adenomectomy in acromegalic patients: a large retrospective study from a single center in China Yi-Lin Li, Shuo Zhang, Xiao-Peng Guo, Lu Gao, Wei Lian, Yong Yao, Kan Deng, Ren-Zhi Wang, Bing Xing

review

OFFICIAL JOURNAL OF THE BRAZILIAN SOCIETY OF ENDOCRINOLOGY AND METABOLISM

167 Combined pituitary hormone deficiency caused by PROP1 Mutations: an update 20 years from discovery

Fernanda A. Correa, Marilena Nakaguma, João L. O. Madeira, Mirian Y. Nishi, Milena G. Abrão, Alexander A. L. Jorge, Luciani R. Carvalho, Ivo J. P. Arnhold, Berenice B. Mendonça

case report 175 The 4Ds of ectopic ACTH syndrome: diagnostic dilemmas of a difficult disease Marcelo Vieira-Corrêa, Débora Moroto, Giovanna Carpentieri, Igor Veras, Claudio E. Kater

brief report 182 Serum PTH reference values in an adult Brazilian population: implications for the diagnosis of hyperparathyroidism Pedro Weslley Rosario, Maria Regina Calsolari

AND METABOLISM OFFICIAL JOURNAL OF THE BRAZILIAN SOCIETY OF ENDOCRINOLOGY AND METABOLISM

OFFICIAL JOURNAL OF THE BRAZILIAN SOCIETY OF ENDOCRINOLOGY AND METABOLISM

Financial and editorial assistant: Roselaine Monteiro roselaine@endocrino.org.br Rua Botucatu, 572 – conjunto 83 – 04023-062 – São Paulo, SP Telefax: (11) 5575-0311 / 5082-4788

Archives of Endocrinology Online submission / Electronic publishing www.aem-sbem.com • www.scielo.br/abem

and Metabolism

OFFICIAL JOURNAL OF THE BRAZILIAN SOCIETY OF ENDOCRINOLOGY AND METABOLISM

Archives of

Rua Anseriz, 27, Campo Belo 04618-050 – São Paulo, SP. Fone: 11 3093-3300 www.segmentofarma.com.br • segmentofarma@segmentofarma.com.br

Publication code: 23727.4.19

Endocrinology

and Metabolism

All adds have to comply with RDC no 96/08 Commercial advising: Estela Kater estela.kater@gmail·com

OFFICIAL JOURNAL OF THE BRAZILIAN SOCIETY OF ENDOCRINOLOGY AND METABOLISM

Indexed in Biological Abstracts, Index Medicus, Latindex, Lilacs, MedLine, SciELO, Scopus, ISI-Web of Science BRAZILIAN ARCHIVES OF ENDOCRINOLOGY AND METABOLISM Brazilian Society of Endocrinology and Metabolism – São Paulo, SP: Brazilian Society of Endocrinology and Metabolism, volume 5, 1955Six issues/year Continued from: Brazilian Archives of Endocrinology (v. 1-4), 1951-1955 ISSN 2359-4292 (online issues) 1. Endocrinology – journals 2. Metabolism – journals I. Brazilian Society of Endocrinology and Metabolism II. Brazilian Medical Association CDU 612.43 Endocrinology CDU 612.015.3 Metabolism

OFFICIAL JOURNAL OF THE BRAZILIAN SOCIETY OF ENDOCRINOLOGY AND METABOLISM

OFFICIAL JOURNAL OF THE BRAZILIAN SOCIETY OF ENDOCRINOLOGY AND METABOLISM

Archives of endocrinology and metabolism Official journal of SBEM – Brazilian Society of Endocrinology and Metabolism (Department of the Brazilian Medical Association), SBD – Brazilian Diabetes Society, ABESO – Brazilian Association for the Study of Obesity and Metabolic Syndrome

2019-2022 EDITOR-IN-CHIEF Marcello D. Bronstein (SP)

CO-EDITORS

REPRESENTATIVES OF COLLABORATING SOCIETIES

Laércio Joel Franco (SP)

SBD

Larissa Gomes (SP)

Luiz Alberto Andreotti Turatti (SP)

Léa Maria Zanini Maciel (SP)

ABESO

Leandro Kasuki (SP)

Archives of Endocrinology Ana Luiza Maia (RS) Beatriz D’ Agord Schaan (RS) Bruno Ferraz de Souza (SP) Erika Parente (SP) Francisco Bandeira (PE) Fernanda Vaisman (RJ) Fernando M. A. Giuffrida (BA) João Roberto Maciel Martins (SP) Melanie Rodacki (RJ) Monica R. Gadelha (RJ) Nina Rosa C. Musolino (SP) Poli Mara Spritzer (RS) Ricardo Meirelles (RJ) Rogerio Friedman (RS)

OFFICIAL JOURNALMadson Queiroz Almeida (SP) OF THE BRAZILIANManoel Ricardo Alves Martins (CE) Brazilian Editorial Commission Marcio Mancini (SP) Alexander A. L. Jorge (SP) OF SOCIETY Alexandre Hohl (SC) Margaret Cristina S. Boguszewski (PR) ENDOCRINOLOGY Ana Amélia Hoff (SP) Maria Candida B. V. Fragoso (SP) AND METABOLISM Ana Claudia Latronico (SP) Maria Izabel Chiamolera (SP) Maria Edna de Melo (SP)

and Metabolism FOUNDER Waldemar Berardinelli (RJ)

1951-1955 Waldemar Berardinelli (RJ) Thales Martins (RJ) 1957-1972 Clementino Fraga Filho (RJ) 1964-1966* Luiz Carlos Lobo (RJ)

Berenice B. Mendonça (SP)

Maria Marta Sarquis (MG) Mario Saad (SP) Mário Vaisman (RJ) Marise Lazaretti Castro (SP) Milena Caldato (PA)

Archives of

ASSOCIATE EDITORS

Bruno Halpern (SP)

Carlos Alberto Longui (SP)

César Luiz Boguszewski (PR)

Raquel Soares Jallad (SP) Rodrigo Moreira (RJ) Ruth Clapauch (RJ) Sandra R. G. Ferreira (SP)

Endocrinology

PRESIDENTS OF THE SBEM DEPARTMENTS

ADRENAL AND HYPERTENSION

Madson Queiroz de Almeida (SP) DIABETES MELLITUS

Clarisse Ponte (CE)

Delmar Muniz Lourenço Jr. (SP)

Simão A. Lottemberg (SP)

Denise Momesso (RJ)

Sonir Roberto Antonini (SP)

Eder Carlos R. Quintão (SP)

Suemi Marui (SP)

and Metabolism

Hermelinda Cordeiro Pedrosa (DF)

Edna Nakandakare (SP)

DYSLIPIDEMIA AND ATHEROSCLEROSIS

Edna T. Kimura (SP)

1969-1972* João Gabriel H. Cordeiro (RJ)

Maria Izabel Chiamolera (SP)

BASIC ENDOCRINOLOGY

Mônica de Oliveira (PE)

PEDIATRIC ENDOCRINOLOGY

1991-1994 Rui M. de Barros Maciel (SP)

BONE AND MINERAL METABOLISM

Carlos Alberto Longui (SP) Miguel Madeira (RJ))

1995-2006 Claudio Elias Kater (SP)

NEUROENDOCRINOLOGY

2007-2010 Edna T. Kimura (SP)

OBESITY

Heraldo Mendes Garmes (SP) Mario Kehdi Carra (SP) THYROID

Jose Augusto Sgarbi (SP)

Victória Borba (PR)

Elaine Maria Frade Costa (SP) Felipe Gaia (SP)

OFFICIAL JOURNAL OF THE FlavioBRAZILIAN Hojaij (SP) FEMININE ENDOCRINOLOGY AND SOCIETY OF ENDOCRINOLOGY AND METABOLISM Gil Guerra-Júnior (SP) ANDROLOGY

1983-1990 Antônio Roberto Chacra (SP)

2015-2018 Marcello D. Bronstein (SP)

Antônio Roberto Chacra (SP)

INTERNATIONAL ASSOCIATE EDITOR

Cynthia Melissa Valério (RJ)

2011-2014 Sergio Atala Dib (SP)

Andrea Glezer (SP)

Ayrton Custódio Moreira (SP)

1966-1968* Pedro Collett-Solberg (RJ)

1978-1982 Armando de Aguiar Pupo (SP)

André Fernandes Reis (SP)

Tânia S. Bachega (SP)

Shlomo Melmed (Los Angeles, EUA)

EDITORS-IN-CHIEF, EDITORIAL OFFICE*

Ana Luiza Silva Maia (RS)

International Editorial Commission Antonio C. Bianco (EUA)

Giovanna Balarini Lima (RJ)

Décio Eizirik (Bélgica)

Gisah M. do Amaral (SP)

Franco Mantero (Itália)

Hans Graf (SP)

Fernando Cassorla (Chile)

José Augusto Sgarbi (SP)

Gilberto Paz-Filho (Austrália)

José Gilberto H. Vieira (SP)

John P. Bilezikian (EUA)

Julio Z. Abucham (SP)

Ken Ho (Austrália)

SBEM – Brazilian Society of Endocrinology and Metabolism SBEM BRAZILIAN BOARD OF DIRECTORS 2019-2020 President Vice-President Executive Secretary Adjunct Executive Secretary Treasurer-General Adjunct Treasurer

Rodrigo de Oliveira Moreira César Luiz Boguszewski Neuton Dornelas Gomes Marcio Corrêa Mancini Paulo Augusto Carvalho Miranda Maria Amazonas

Rua Humaitá, 85, cj. 501 22261-000 – Rio de Janeiro, RJ Fone/Fax: (21) 2579-0312/2266-0170 www.endocrino.org.br sbem@endocrino.org.br

Scientific Departments - 2019/2020 Brazilian Society of Endocrinology and Metabolism ADRENAL AND HYPERTENSION

DIABETES MELLITUS

President Madson Queiroz de Almeida madsonalmeida@usp.br

President Hermelinda Cordeiro Pedrosa pedrosa.hc@globo.com Vice-President Rosane Kupfer Directors Erika Bezerra Parente

Thaisa Dourado Guedes Trujilho

Fábio Ferreira de Moura

Janice Sepulveda Reis

Ana Cristina Ravazzani de Almeida

Vice-President Directors

Milena Coelho Fernandes Caldato Marivânia da Costa Santos Flávia Amanda Costa Barbosa Leonardo Vieira Neto

DYSLIPIDEMIA AND ATHEROSCLEROSIS

BASIC ENDOCRINOLOGY

President Cynthia Melissa Valério cy_valerio@yahoo.com.br

President Maria Izabel Chiamolera mchiamolera@unifesp.br Vice-President Maria Tereza Nunes Directors Tania Maria Ruffoni Ortiga

Bruno Ferraz de Souza

Marisa Maria Dreyer Breitenbach

Luciani Renata Silveira Carvalho

Vania Maria Correa da Costa

Vice-President Directors

Renan Magalhães Montenegro Júnior Joaquim Custódio da Silva Júnior Marcello Casaccia Bertoluci Joana Rodrigues Dantas Pereira

Scientific Departments - 2019/2020 WOMEN ENDOCRINOLOGY AND ANDROLOGY President Mônica de Oliveira morecife@hotmail.com Vice-President Directors

Rita de Cassia Viana Vasconcellos Weiss Dolores Perovano Pardini Ruth Clapauch Larissa Garcia Gomes Marcelo Fernando Ronsoni Alexis Dourado Guedes

PEDIATRIC ENDOCRINOLOGY President Carlos Alberto Longui carloslongui@msn.com Vice-President Directors

Julienne Ângela Ramires de Carvalho Sonir Roberto Rauber Antonini Claudia Braga Monteiro Paulo César Alves da Silva

BONE AND MINERAL METABOLISM

NEUROENDOCRINOLOGY

President

Vice-President Directors

President Heraldo Mendes Garmes heraldmg@uol.com.br Vice-President Manoel Ricardo Alves Martins Directors Andrea Glezer

Leandro Kasuki Jomori de Pinho

Mauro Ântonio Czepielewski

Nina Rosa de Castro Musolino

Silvia Regina Correa da Silva

Miguel Madeira migmadeira@gmail.com Francisco Alfredo Bandeira e Farias Carolina Aguiar Moreira Sérgio Setsuo Maeda Marise Lazaretti Castro Bárbara Campolina Carvalho Silva Catarina Brasil D´alva

OBESITY

THYROID

President Mario Kehdi Carra mariocarra@gmail.com Vice-President Fábio Rogério Trujilho Directors Maria Edna de Melo

Rosana Bento Radominski

Rodrigo Lamounier

Bibiana Prada de Camargo Colenci

Jacqueline Rizzolli

President José Augusto Sgarbi jose.sgarbi@gmail.com Vice-President Patricia de Fátima dos Santos Teixeira Directors Rafael Selbach Scheffel

Gisah Amaral de Carvalho

Danilo Glauco Pereira Villagelin Neto

Permanent Commissions - 2019/2020 Brazilian Society of Endocrinology and Metabolism STRATEGIC PLANNING FOLLOW-UP

HISTORY OF ENDOCRINOLOGY

President Alexandre Hohl alexandrehohl@uol.com.br Members Nina Rosa de Castro Musolino, Airton Golbert,

Ricardo Martins da Rocha Meirelles,

Ruy Lyra da Silva Filho

President Henrique de Lacerda Suplicy hsuplicy@gmail.com Members Adriana Costa e Forti, Thomaz Rodrigues Porto da Cruz

ENDOCRINOLOGY CAMPAIGNS

President

Mônica Roberto Gadelha

mgadelha@hucff.ufrj.br

Members

César Luiz Boguszewski

President Erika Bezerra Parente ebparente@gmail.com Members Alina Coutinho Rodrigues Feitosa,

Carolina Ferraz da Silva, Mariana Guerra Paulino Guerra

SCIENTIFIC COMISSION President César Luiz Boguszewski clbogus@uol.com.br Indicated by the directories Sonir Roberto Rauber Antonini, Carolina Aguiar Moreira,

Fernanda Vaisman, Bruno Halpern,

Manoel Ricardo Alves Martins,Fábio Rogério Trujilho,

Luciana Antunes de Almeida Secchi,

Karen Faggioni de Marca Seidel, Fernando Gerchman,

Milena Coelho Fernandes Caldato

SOCIAL COMMUNICATION President Ricardo Martins da Rocha Meirelles r.meirelles@terra.com.br Nominated by the president Alexandre Hohl ABEM Editor Marcello D. Bronstein Members Nina Rosa de Castro Musolino

INTERNATIONAL

NORMS, QUALIFICATION AND CERTIFICATION President Vivian Carole Moema Ellinger vivianellinger@gmail.com Members Ronaldo Rocha Sinay Neves,

Marisa Helena César Coral,

Maria Emilia Pereira de Almeida,

Milena Coelho Fernandes Caldato

JOINT COMMISSION – CAAEP President Julienne Angela Ramires de Carvalho julienne@endocrinoped.com.br Members Marilia Martins Guimarães, Suzana Nesi França

RESEARCH President

Members

Freddy Eliaschewitz freddy.g@uol.com.br Antônio Roberto Chacra, Luiz Augusto Tavares Russo

GUIDELINES PROJECT CONTINUOUS MEDICAL EDUCATION President João Eduardo Nunes Salles jensalles@yahoo.com.br Members César Luiz Boguszewski, Alexandre Hohl

STATUTES, RULES AND REGULATIONS President Fábio Rogério Trujilho trtruji@terra.com.br Members Alessandra Ferri Casini, Cynthia Melissa Valério,

Ruy Lyra da Silva Filho, Wellington Santana da Silva Júnior

PROFESSIONAL ETHICS AND DEFENCE President Maite Trojaner Salona Chimeno etica@endocrino.org.br Vice-Inspector Itairan da Silva Terres 1ST member Diana Viegas Martins 2ND member João Modesto Filho 3RD member Luis Henrique Santos Canani 4TH member Márcio Weissheimer Lauria 5TH member Cristina Bardou Pizarro

ENDOCRINE DYSREGULATORS President Elaine Maria Frade Costa elainefradecosta@gmail.com Vice-President Maria Izabel Chiamolera Members Eveline Gadelha Pereira Fontenele,

Tânia Aparecida Sanchez Bachega,

Ricardo Martins da Rocha Meirelles

Coordinator Alexis Dourado Guedes dr.alexis@uol.com.br Adrenal and hypertension Madson Queiroz de Almeida Dyslipidemia and atherosclerosis Cynthia Melissa Valério Diabetes Mellitus Luiz Alberto Andreotti Turatti Basic endocrinology Maria Izabel Chiamolera Feminine and Andrology Rita de Cássia Viana Vasconcellos Weiss Pediatric Endocrinology Julienne Angela Ramires de Carvalho Bone and mineral metabolism Carolina Aguiar Moreira Neuroendocrinology Marcello D. Bronstein Obesity Maria Edna de Melo Thyroid Célia Regina Nogueira

TEMPORARY – SPORT AND EXERCISE ENDOCRINOLOGY - CTEEE President: Clayton Luiz Dornelles Macedo clayton.macedo@uol.com.br Members: Yuri Galeno Pinheiro Chaves de Freitas,

Roberto Luís Zagury, Fulvio Clemo Santos Thomazelli,

Felipe Henning Gaia Duarte, Ricardo de Andrade Oliveira,

Andrea Messias Britto Fiorettiia

TITLE OF SPECIALIST IN ENDOCRINOLOGY AND METABOLISM President: Josivan Gomes de Lima josivanlima@gmail.com Vice-President: Márcio Corrêa Mancini Members: Marise Lazaretti Castro, Mauro Antônio Czepielewski,

Milena Coelho Fernandes Caldato,

Renan Magalhães Montenegro Júnior,

Rogério Friedman

VALORIZATION OF NEW LEADERSHIPS President Wellington Santana da Silva Junior wellingtonsantanajr@gmail.com Members Mateus Dornelles Severo, Ricardo Mendes Martins

Brazilian Societies and Associations for Endocrinology and Metabolism

SBD – BRAZILIAN DIABETES SOCIETY SBD BRAZILIAN BOARD OF DIRECTORS (2018/2019)

President

Hermelinda Cordeiro Pedrosa

Vice-Presidents

Gustavo Caldas

Janice Sepulveda Reis

João Eduardo Nunes Salles

Rosane Kupfer

Rosângela Réa

1ST Secretary

Karla Melo

2ND Secretary

Fernanda Thomé

1ST Treasurer

Antonio Carlos Lerário

2ND Treasurer

Luiz Antônio Araújo

Supervisory Board

Silmara Leite

Regina Calsolari

Nely Calegaro

Estela Muskat Jatene

Rua Afonso Brás, 579, cj. 72/74 04511-011– São Paulo, SP Fone/Fax: (11) 3842-4931 www.diabetes.org.br

ABESO – BRAZILIAN ASSOCIATION FOR THE STUDY OF OBESITY AND METABOLIC SYNDROME ABESO BRAZILIAN BOARD OF DIRECTORS (2019-2020)

President

Mario K. Carra

Vice-President

Rodrigo Lamounier

1ST Secretary General

Jacqueline Rizzoli

2ND Secretary General

Bibiana Colenci

Treasurer

Cintia Cercato

Rua Mato Grosso, 306, cj. 1711 01239-040 – São Paulo, SP Fone: (11) 3079-2298/Fax: (11) 3079-1732 info@abeso.org.br www.abeso.org.br

editorial

The long and still uncertain journey of BRAF as a prognostic tool in patients with papillary thyroid cancer Rafael Selbach Scheffel1,2, Ana Luiza Maia2

Arch Endocrinol Metab. 2019;63/2

Departamento de Farmacologia, Instituto de Ciências Básicas da Saúde, Universidade Federal do Rio Grande do Sul, Porto Alegre, RS, Brasil 2 Unidade de Tireoide, Hospital de Clínicas de Porto Alegre, Faculdade de Medicina, Universidade Federal do Rio Grande do Sul, Porto Alegre, RS, Brasil 1

Correspondence to: Ana Luiza Maia Unidade de Tireoide, Hospital de Clínicas de Porto Alegre Rua Ramiro Barcelos, 2350 90035-003 – Porto Alegre, RS, Brasil almaia@ufrgs.br Received on Apr/3/2019 Accepted on Apr/23/2019 DOI: 10.20945/2359-3997000000140

Copyright© AE&M all rights reserved.

T

he principle underlying personalized medicine is that using specific information about a person’s disease will help in establishing a diagnostic, a therapeutic strategy or defining a prognosis. Nevertheless, the underlying assumptions of the precision-medicine model may not be obvious, since it includes the existence of meaningful subgroups of patients and the ability to identify them with this approach.

Perhaps the most successful area of personalized medicine is cancer treatment. Tumors arise as a result of an accumulative series of events from genetic variants, usually in a limited set of genes, which identification led to molecular-target therapies. Examples of successful use of personalized medicine include the use of targeted therapies to treat specific types of cancer cells, such as HER2-positive breast cancer cells, BRAF mutation‐related melanoma, and RET driven tumors (1).

BRAF is one of the most studied genes in papillary thyroid cancer (PTC). BRAF mutations activate the mitogen-activated protein kinase (MAPK) pathway resulting in increases of cellular proliferation, inhibition of differentiation and apoptosis (2).

The BRAF point mutation T1799A is the most common, resulting in the exchange of valine to glutamate at residue 600 (BRAFV600E). The first studies describing the role of BRAFV600E mutation on the pathogenesis of PTC were published in 2003 (3).

Subsequent studies focused on searching an association between BRAF mutation and features of an unfavorable course of the disease. The impact of the mutation in clinical outcomes (persistent disease, recurrence, survival) remains debatable with studies showing conflicting results (4). So far, it seems that BRAFV600E mutation is not an independent prognostic marker and should be analyzed in association with other prognostic factors.

In this edition of the Archives of Endocrinology and Metabolism, two studies shed light on the prognostic role of BRAFV600E on Brazilian patients. Pessôa-Pereira and cols retrospectively studied 43 PTC patients to evaluate the association between BRAFV600E mutation and several clinicopathological features of PTC, meaning tumor size, histological subtype, multifocality, extrathyroidal extension, vascular invasion, lymph node and distant metastases, and AJCC/TNM or recurrence risk stage systems (5). The authors report a high prevalence of BRAFV600E mutation (65.1%), which was associated with older age and absence of Hashimoto’s thyroiditis, but not with other high-risk features. In the study of Giorgenon and cols (6), the authors evaluated BRAFV600E mutation and TERT (telomerase reverse transcriptase) gene promoter mutation preoperatively in 45 high-risk thyroid nodules with confirmed anatomopathological diagnostic PTC. TERT is involved in cellular immortality, by preserving the telomere length at the end of chromosomes and enhancing other cellular functions such as proliferation and cell cycles. The authors also found a high prevalence of BRAFV600E

95

BRAF mutation and papillary thyroid cancer

mutation (66.7%), but only 4 patients (8.9%) showed TERT mutation. No association was observed between BRAFV600E mutation and clinicopathological aspects.

Interestingly, however, in agreement with previous studies (7), the TERT mutation was associated with advanced age and advanced AJCC TNM stage.

These studies show interesting similarities: both of them observed a high prevalence of BRAFV600E mutation, conflicting with previous studies in Southeastern region (28.1 to 48.3%) (8,9) but in accordance with results obtained from Goiânia (63.8%) and Porto Alegre (59.4%) (10,11). These observations indicate a significant heterogeneity on the prevalence of BRAFV600E mutation among the different regions in Brazil.

Contrasting with other reports (4), the studies failed to demonstrate an association between the BRAFV600E mutation and high-risk clinicopathological features, which might be partially explained by the relatively small sample sizes of both studies. Unfortunately, the lack of data on patient-centered outcomes (i.e., status of the disease on long term follow-up) in both studies, and the absence of multivariate analyses on the second one (6) limit the study’s conclusions.

The use of specific molecular classifier as prognostic markers is a research trend in thyroid cancer, and a potential role of BRAFV600E mutation has been long advocated. However, until now, the studies have failed to demonstrate its use as a single, independent predictive factor in clinical practice. Accordingly, the current guidelines do not indicate a routine application of BRAF mutation status for initial risk stratification in PTC. Thus, the real place of BRAFV600E as a tool in personalized medicine in the prognostic of PTC patients remains uncertain. On the other hand, studies point that identification TERT promoter mutation in preoperative specimens might be useful as an independent marker for risk stratification and helpful on defining the best treatment strategy for PTC patients.

REFERENCES 1. Ong FS, Das K, Wang J, Vakil H, Kuo JZ, Blackwell WL, et al.

Personalized medicine and pharmacogenetic biomarkers: progress in molecular oncology testing. Expert Rev Mol Diagn.

2012;12(6):593-602.

2. Romitti M, Ceolin L, Siqueira DR, Ferreira CV, Wajner SM, Maia AL. Signaling pathways in follicular cell-derived thyroid carcinomas (review). Int J Oncol. 2013;42(1):19-28.

3. Kimura ET, Nikiforova MN, Zhu Z, Knauf JA, Nikiforov YE, Fagin JA. High prevalence of BRAF mutations in thyroid cancer: genetic evidence for constitutive activation of the RET/PTC-RAS-BRAF signaling pathway in papillary thyroid carcinoma. Cancer Res. 2003;63(7):1454-7.

4. Czarniecka A, Oczko-Wojciechowska M, Barczyński M. BRAF V600E mutation in prognostication of papillary thyroid cancer (PTC) recurrence. Gland Surg. 2016;5(5):495-505.

5. Pessôa-Pereira D, Medeiros MFS, Lima VMS, Silva Jr JC, Cerqueira TLO, Silva IC, et al. Association between BRAF (V600E) mutation and clinicopathological features of papillary thyroid carcinoma: a Brazilian single-centre case series. Arch Endocrinol Metab. 2019;63(2):97-106.

6. Giorgenon TMV, Carrijo FT, Arruda MA, Cerqueira TLO, Barreto HR, Cabral JB, Silva TM, et al. Preoperative detection of TERT promoter and BRAFV600E mutations in papillary thyroid carcinoma in high-risk thyroid nodules. Arch Endocrinol Metab.

2019;63(2):107-12.

7. Vuong HG, Duong UN, Altibi AM, Ngo HT, Pham TQ, Tran HM, et al. A meta-analysis of prognostic roles of molecular markers in papillary thyroid carcinoma. Endoc Connect. 2017;6(3):R8-R17.

8. Oler G, Cerutti JM. High prevalence of BRAF mutation in a Brazilian cohort of patients with sporadic papillary thyroid carcinomas: correlation with more aggressive phenotype and decreased expression of iodide-metabolizing genes. Cancer.

2009;115(5):972-80.

9. Araujo PP, Marcello MA, Tincani AJ, Guilhen AC, Morari EC, Ward LS. mRNA BRAF expression helps to identify papillary thyroid carcinomas in thyroid nodules independently of the presence of BRAFV600E mutation. Pathol Res Pract. 2012;208(8):489-92.

10. da Silva RC, de Paula HS, Leal CB, Cunha BC, de Paula EC, Alencar RC, et al. BRAF overexpression is associated with BRAF V600E mutation in papillary thyroid carcinomas. Genet Mol Res. 2015;14(2):5065-75.

11. Lutz BS, Leguisamo NM, Cabral NK, Gloria HC, Reiter KC, Agnes G, et al. Imbalance in DNA repair machinery is associated with BRAFV600E mutation and tumour aggressiveness in papillary thyroid carcinoma. Mol Cell Endocrinol. 2018;472:140-8.

Copyright© AE&M all rights reserved.

Disclosure: no potential conflict of interest relevant to this article was reported.

96

Arch Endocrinol Metab. 2019;63/2

original article

Association between BRAF (V600E) mutation and clinicopathological features of papillary thyroid carcinoma: a Brazilian single-centre case series Danielle Pessôa-Pereira1, Mateus Fernandes da Silva Medeiros1, Virna Mendonça Sampaio Lima1, Joaquim Custódio da Silva Jr.1, Taíse Lima de Oliveira Cerqueira1, Igor Campos da Silva2, Luciano Espinheira Fonseca Jr.2,3, Luiz José Lobão Sampaio4, Cláudio Rogério Alves de Lima5, Helton Estrela Ramos1

ABSTRACT Objectives: We aimed to investigate the prevalence of the BRAF (V600E) mutation in consecutive cases of papillary thyroid carcinoma (PTC) in patients diagnosed and treated at the Hospital Sao Rafael (Salvador, BA, Brazil) and evaluate its association with clinical and pathological characteristics of PTC. Subjects and methods: We retrospectively enrolled in the study a total of 43 consecutive PTC patients who underwent total thyroidectomy. We performed DNA extraction from formalinfixed paraffin-embedded (FFPE) tumour tissue samples. Polymerase chain reaction (PCR) and direct sequencing were used to determine BRAF (V600E) mutation status. Univariate and multivariate logistic regression analyses were employed to identify independent associations. Results: The prevalence of BRAF (V600E) mutation was 65.1% (28/43). A high frequency of older patients (p value: 0.004) was observed among the BRAF-mutated PTC group and, in contrast, a low frequency of concurrent Hashimoto’s thyroiditis (HT) (p value: 0.011) was noted. Multivariate analysis confirmed that older age (OR: 1.15; 95% CI: 1.00 - 1.33; p value: 0.047) and HT (OR: 0.05; 95% CI: 0.006-0.40; p value: 0.005) were independent factors associated with BRAF (V600E) mutation. Conclusion: We found a high prevalence of BRAF (V600E) mutation in PTC cases. Older age and no concurrent HT were independently associated with BRAF (V600E) mutation. Arch Endocrinol Metab. 2019;63(2):97-106

INTRODUCTION

T

hyroid cancer is the most frequently diagnosed endocrine malignancy worldwide, currently ranking in ninth place for global incidence (1).

Papillary thyroid carcinoma (PTC), which accounts for up to 85% of all thyroid cancer cases (2), has a relatively indolent behaviour and shows better prognosis than other malignant thyroid tumours, such as medullary and anaplastic thyroid carcinoma (3). However, some patients may experience extrathyroidal extension (ETE), local and/or distant metastases, as well as present recurrent disease after surgery and radioactive iodine therapy, all of which significantly contribute Arch Endocrinol Metab. 2019;63/2

Correspondence to: Helton Estrela Ramos Departamento de Biorregulação, Universidade Federal da Bahia Av. Reitor Miguel Calmon, s/n, Vale da Canela, sala 300 40110-100 – Salvador, BA, Brasil ramoshelton@gmail.com Received on Nov/20/2018 Accepted on Jan/14/2019 DOI: 10.20945/2359-3997000000120

to a poorer prognosis (4). Recurrence and mortality risk stratifications, which are mainly based on clinical and pathological criteria, are currently the main tool for determining suitable clinical management of PTC (5,6). Nevertheless, those clinicopathological factors, such as older age, histological subtypes, tumour size and distant metastasis, have not been able to provide complete accuracy in terms of predicting a poor prognosis (7). Therefore, many studies have focused on identifying additional parameters, such as molecular markers, in order to provide an accurate risk assessment.

Significant advances in understanding oncogenic events involved in the onset and progression of PTC have arisen over recent decades. Thyroid oncogenesis 97

Copyright© AE&M all rights reserved.

Keywords Papillary thyroid cancer; BRAF mutation; Hashimoto’s thyroiditis

Departamento de Biorregulação, Laboratório de Estudo da Tireoide, Instituto de Saúde e Ciência, Universidade Federal da Bahia (UFBA), Salvador, BA, Brasil 2 Departamento de Anatomia Patológica e Citopatologia, Hospital São Rafael, Salvador, BA, Brasil 3 Departamento de Anatomia Patológica e Medicina Legal, Faculdade de Medicina da Bahia, Universidade Federal da Bahia (UFBA), Salvador, BA, Brasil 4 Departamento de Medicina Nuclear, Hospital São Rafael, Salvador, BA, Brasil 5 Departamento de Cirurgia de Cabeça e Pescoço, Hospital São Rafael, Salvador, BA, Brasil 1

BRAF mutation in papillary thyroid carcinoma

often involves constitutive activation of the mitogenactivated protein kinase (MAPK) kinase (MEKK)/ extracellular signal-regulated kinase (ERK) pathway, usually driven by the T1799A somatic mutation in the v-raf murine sarcoma viral oncogene homolog B1 (BRAF) exon 15, a process which results in a V600E amino acid replacement (8). Several studies have shown a positive association between BRAF (V600E) and PTC aggressive phenotype, including ETE, distant metastasis, and silencing of thyroid-specific iodinemetabolizing genes (9). On the other hand, these findings have not been found in some other studies (10), raising doubts about whether BRAF (V600E) could be used as an appropriate prognostic factor for PTC. Considering the lack of consistent evidence in the literature and that there are no published reports on the prevalence of BRAF (V600E) mutation in PTC patients in North-eastern Brazil, we conducted a crosssectional study of consecutive case series of PTC from a reference hospital in Salvador, BA, Brazil, in order to evaluate the association between BRAF (V600E) mutation and clinicopathological features of PTC.

SUBJECTS AND METHODS Ethics statement This study was formally approved by the institutional Research Ethics Committee of the Federal University of Bahia (n. 102.290), along with the medical board of Sao Rafael Hospital (Salvador, Bahia, Brazil), and was carried out in accordance with the Declaration of Helsinki of the World Medical Association.

Copyright© AE&M all rights reserved.

Patient selection We retrospectively enrolled 43 consecutive PTC patients who had undergone total thyroidectomy as initial treatment for PTC in the Department of Head and Neck Surgery at Sao Rafael Hospital between 2006 and 2012. All clinical and pathological data, including age, sex, tumour size, histological subtype, multifocality, concurrent Hashimoto’s thyroiditis (HT), ETE, vascular invasion, lymph node and distant metastasis status, were collected from medical records (Table 1).

Patients were classified as low, intermediate and high risk according to the 2015 American Thyroid Association (ATA) risk stratification for well-differentiated thyroid cancer (6,11), as well as according to the Brazilian 98

consensus (5). We excluded from the study patients whose cancer-related medical records and/or formalinfixed paraffin-embedded (FFPE) tumour specimens derived from their surgical resections were unavailable.

Tumor samples FFPE blocks were obtained from the archives of the Department of Anatomic Pathology and Cytopathology at Sao Rafael Hospital in order to acquire thyroid tumour samples for BRAF (V600E) mutation analysis. All samples were histologically reviewed on haematoxylin and eosin (HE)-stained slides by two pathologists. Tumours were staged according to the 8th edition of the TNM-based staging system proposed by the American Joint Association on Cancer (AJCC).

Representative tumour areas containing at least 60% of cancer cells were marked on the HE-stained sections.

Subsequently, five sequential sections of 10-μm thickness were obtained from each chosen FFPE tissue block. Marked tumour areas were manually scraped off from the unstained sections by sterile needles using their respective HE-stained slides as a guide. In cases of multifocal disease, we only collected the largest tumour focus for analysis.

DNA isolation Genomic DNA isolation from the FFPE samples was performed using Gentra Puregene Core Kit B (Qiagen, Valencia, CA, USA) at the Thyroid Study Laboratory (Salvador, BA, Brasil), preceded by a total removal of the paraffin from the samples with xylene and washing steps with ethanol, according to the manufacturer’s protocol. Concentration levels and quality were assessed using a Nano Spectrophotometer Kasvi K230002 (Kasvi, Sao Jose dos Pinhais, PR, Brazil).

Polymerase chain reaction Polymerase chain reaction (PCR) was performed to amplify the exon 15 of BRAF from the isolated DNA, as previously described (8). Briefly, BRAF exon 15 was amplified in a 20-μl reaction volume containing 100 ng of genomic DNA, 7.5 pmol of each primer (Forward: 5 ’ - A A A C T C T T C ATA AT G C T T G C T C T G - 3 ’ ; Reverse: 5’-GGCCAAAAATTAATCAGTGGA-3’), 100 μm deoxynucleoside triphosphates (dNTPs), 5 μCi [α32P]dCTP, 1.5 mm MgCl2, Platinum TaqDNA polymerase high fidelity and buffer (Thermo Fisher Scientific, Waltham, MA, USA). The PCR reaction was Arch Endocrinol Metab. 2019;63/2

BRAF mutation in papillary thyroid carcinoma

Table 1. Clinical and pathological features of the PTC patients Age (y)

Sex

Tumour PTC variant HT size (mm)

1

20

F

25

Classical

2

12

F

40

3

17

F

6

4

17

F

10

Classical

5

13

F

22

Classical

6

36

F

25

Follicular

7

40

F

20

Follicular

8

26

F

15

Distant 8th AJCC TNM 2015 ATA metastasis T N M CS Recurrence Risk

Multifocal disease

ETE

Vascular invasion

LM

Yes

Yes

No

Yes

No

No

Classical

Yes

Yes

No

No

Yes

Classical

No

No

No

No

Yes

No

No

No

No

Yes

Yes

No

No

Yes

Yes

No

No

No

No

Yes

No

No

No

Classical

Yes

Yes

Yes

No

Yes

No

1a 1b 0

2 0 0

I

No

2 1b 0

No

1a 1b 0

No

No

No

No

BRAF (V600E) mutation

Intermediate

Negative

I

High

Negative

I

Intermediate

Negative

1a 0 0

I

Low

Positive

2 0 0

I

Low

Negative

No

2 0 0

I

Low

Negative

Yes

1b 0 1 II

High

Positive

I

Intermediate

Positive

9

44

F

10

Classical

Yes

No

No

No

Yes

No

1a 1a 0

I

Low

Negative

10

38

F

12

Classical

Yes

Yes

No

No

No

No

1b 0 0

I

Low

Positive

11

39

F

12

Classical

Yes

Yes

No

No

No

No

1b 0 0

I

Low

Negative

12

26

F

10

Classical

No

No

No

No

Yes

No

1a 1a 0

I

Low

Positive

13

40

M

13

Classical

No

Yes

No

No

No

No

1b 0 0

I

Low

Positive

14

31

F

30

Follicular

No

No

No

No

No

No

2 0 0

I

Low

Negative

15

45

F

15

Classical

No

No

Yes

No

Yes

No

1b 1a 0

I

Intermediate

Positive

16

36

F

10

Follicular

No

No

No

No

Yes

No

1a 1a 0

I

Low

Negative

17

41

F

5

Classical

Yes

Yes

No

No

Yes

No

1a 1a 1

I

Low

Negative

18

45

F

20

Classical

No

Yes

No

No

No

No

1b 0 0

I

Low

Positive

19

32

F

16

Classical

Yes

No

No

No

No

No

1b 0 0

I

Low

Negative

20

36

F

13

Follicular

No

No

No

No

No

Yes

1b 0 1 II

High

Negative

21

35

F

15

Tall cell

Yes

No

No

No

Yes

No

1b 1a 0

I

High

Negative

22

30

F

15

Follicular

No

Yes

No

No

Yes

No

1b 1a 0

I

Intermediate

Negative

23

24

F

10

Classical

No

No

No

No

No

No

1a 0 0

I

High

Positive

24

37

F

20

Classical

No

Yes

No

No

No

No

1b 0 0

I

High

Positive

25

42

M

15

Classical

No

No

No

No

No

No

1b 0 0

I

Low

Positive

26

33

F

20

Classical

Yes

No

Yes

No

Yes

No

3b 1a 0

I

High

Positive

27

29

F

10

Classical

No

No

No

No

No

No

1a 0 0

I

Low

Positive

28

27

F

20

Classical

No

Yes

No

No

No

No

1b 0 0

I

Low

Positive

29

24

F

20

Classical

Yes

No

No

No

No

No

1b 0 0

I

Low

Negative

30

41

M

35

Classical

No

No

No

No

No

No

2 0 0

I

Low

Positive

31

46

F

10

Follicular

No

Yes

No

No

Yes

No

1a 1a 0

I

Low

Positive

32

46

F

37

Classical

No

Yes

No

Yes

Yes

No

2 1a 0

I

Intermediate

Positive

33

46

F

9

Classical

No

Yes

No

No

No

No

1a 0 0

I

Low

Positive

34

61

F

50

Trabecular

No

Yes

No

No

No

No

3a 0 0 II

Low

Positive

35

42

F

30

Classical

Yes

No

No

No

Yes

No

2 1b 0

36

62

F

50

Classical

Yes

Yes

No

Yes

No

No

3a 0 0 II

37

44

F

15

Oncocytic

No

Yes

No

No

No

No

1b 0 0

38

28

F

15

Classical

No

No

No

No

No

No

39

41

F

13

Classical

No

Yes

No

No

Yes

No

40

36

F

13

Classical

No

No

No

No

No

41

78

F

15

Follicular

No

Yes

No

No

No

42

69

F

18

Classical

Yes

Yes

Yes

No

43

38

F

18

Classical

Yes

No

No

No

I

Low

Positive

Intermediate

Positive

I

Low

Positive

1b 0 0

I

Low

Positive

1b 1a 0

I

Low

Positive

No

1b 0 0

I

Low

Positive

No

1b 0 0

I

Low

Positive

No

No

3b 0 0 II

High

Positive

Yes

No

1b 1a 0

High

Positive

I

Copyright© AE&M all rights reserved.

Patient

Y: years-old; F: female; M: male; mm: millimetres; PTC: papillary thyroid carcinoma; HT: Hashimoto’s thyroiditis; ETE: extrathyroidal extension; AJCC: American Joint Committee on Cancer; CS: clinical stage; ATA: American Thyroid Association.

Arch Endocrinol Metab. 2019;63/2

99

BRAF mutation in papillary thyroid carcinoma

heated to 95 °C for 5 minutes for initial denaturation followed by 35 cycles of 95 °C for 30 seconds, 58 °C for 30 seconds and 72 °C for 45 seconds, with a final extension at 72 °C for 5 minutes. All PCR amplifications were performed using the Veriti 96-Well Thermal Cycler (Thermo Fisher Scientific, Waltham, MA, USA).

Agarose gel eletrophoresis PCR products were electrophoresed in 1,5% UltraPureTM Agarose diluted in UltraPureTM TBE Buffer 1X (Thermo Fisher Scientific, Waltham, MA, USA) containing 0,1μl/mL SYBR Safe DNA Gel Stain (Thermo Fisher Scientific, Waltham, MA, USA) at 90v for 45 minutes using the Loccus horizontal gel electrophoresis system, model LCH 13x15 (Loccus Biotechnology, Cotia, SP, Brazil). BRAF exon 15 amplification was confirmed by the presence of single bands containing 231 base pairs visualized using a Safe Imager 2.0 (Thermo Fisher Scientific, Waltham, MA, USA).

DNA sequecing After confirmation of BRAF exon 15 amplification, PCR products were purified using the PureLink Quick PCR Purification Kit (Thermo Fisher Scientific, Waltham, MA, USA) and precipitated using 70% isopropyl alcohol

and Hi-DITM Formamide (Thermo Fisher Scientific, Waltham, MA, USA). Subsequently, DNA sequencing reaction were performed using a BigDye® Terminator v3.1 Cycle Sequencing Kit (Thermo Fisher Scientific, Waltham, MA, USA) in the capillary automatic sequencer ABI 3130XL PRISM Genetic Analyzer (Thermo Fisher Scientific, Waltham, MA, USA) at the Fundação Oswaldo Cruz – Instituto Gonçalo Moniz (Salvador, Bahia, Brazil). The BRAF (V600E) mutation was confirmed by comparing sequences using the Basic Local Alignment Search Tool (BLAST) program, available at the NCBI website (http://www. ncbi.nlm.nih.gov/BLAST/). We considered tumours as being BRAF (V600E) positive those which were harbouring a homozygous or heterozygous BRAF (V600E) mutation (T1799A) (Figure 1).

Statistical analysis Qualitative variables were presented using frequencies and percentages, whereas continuous variables were presented using mean values and standard deviation.

An independent t-test was used to compare the mean values of continuous variables and a chi-square test or Fisher’s exact test to compare frequencies of qualitative variables. Univariate and multivariate logistic regression

A

Copyright© AE&M all rights reserved.

B

Figure 1. Representative DNA sequencing of BRAF exon 15. A) Absence of thymine to adenine replacement (T1799A), indicating a wild-type BRAF. B) Heterozygous BRAF (V600E) mutation.

100

Arch Endocrinol Metab. 2019;63/2

BRAF mutation in papillary thyroid carcinoma

RESULTS Clinical and pathological characteristics of PTC patients All clinical and pathological data of the 43 selected PTC patients are summarized in Table 2. The mean age at diagnosis was 37 years, ranging from 12 to 78 years.

Even though only four patients (3.6%) were considered as paediatric cases (≤ 18 years old), most patients were > 55 years old (90.7%). Therefore, our case series were mainly comprised by early-stage PTC patients (88.4% and 11.6% for clinical stage I and II, respectively), according to current pathological TNM system. Most patients were female (40/43; 93%) and presented multifocal disease (23/43; 53.5%). Seventeen patients (39.5%) had concurrent Hashimoto’s thyroiditis (HT).

As expected, there were more conventional PTC cases (32/43; 8/43; 74.4%), followed by the follicular variant (8/43; 18.6%). Three cases of rare PTC histological subtypes were observed, which included an oncocytic (oxyphilic), variant, a trabecular variant and a tall cell variant. Tumour sizes ranged from 5 to 50 mm (mean, 19.23 mm), most of them having more than 10 mm (32/43; 74.4%). Furthermore, 16 patients (37.2%) had lymph node metastasis at diagnosis, but only few cases presented vascular invasion (3/43; 7%), ETE (4/43; 9.3%) and distant metastases (2/43; 2%).

As stated by 2015 ATA risk stratification, 27 (62.8%) and 16 patients had low and intermediate/high risk of recurrence, respectively. Moreover, 24 (55.8%) and 19 (44.2%) patients had very low/low and intermediate/ high risk of recurrence, respectively, according to the current Brazilian consensus.

Association of BRAF (V600E) mutation and clinicopathological characteristics of PTC BRAF (V600E) mutation was detected in 28 PTC tumour samples (65.1%). No homozygous mutant or Arch Endocrinol Metab. 2019;63/2

other genetic alterations were found in BRAF exon 15.

Patients were categorized according to BRAF (V600E) mutation status in order to evaluate possible associations between clinical and pathological features of PTC and presence of BRAF (V600E) (Table 2). All ≥ 55-yearold (4/43) and male (3/43) patients presented PTC harbouring a BRAF (V600E) mutation. Only one paediatric patient (1/3) had a BRAF-mutant PTC: a 17-year-old young woman who presented PTC with no aggressive behaviour. Furthermore, follicular variant was predominantly observed in the BRAF-wild type PTC group (5/8; 62.5%). BRAF (V600E) was detected in the isolated rare cases of trabecular variant and oncocytic variant, but not in the tall cell PTC variant. All patients who presented PTC with ETE (4/43) were tested as BRAF (V600E) positives.

After comparing the groups, we found that the frequency of BRAF (V600E) mutation was significantly higher in older patients (40.96 ± 13.69 vs 29.73 ± 10.18; p value: 0.004) and lower in PTC with concurrent HT (25 vs 66.7%; p value: 0.011). However, no significant differences were found for other clinical and pathological parameters, including intermediate to high risk of recurrence.

Univariate and multivariate logistic regression analysis To further investigate the effect of BRAF (V600E) on age and HT in PTC patients, we performed a univariate analysis to measure the association between these parameters and the presence of a BRAF (V600E) mutation (Table 3). Once again, we found that older age at diagnosis (OR: 1.09; 95% CI: 1.02-1.17; p value: 0.016) and negative HT (OR: 0.17; 95% CI: 0,04-0,66; p value: 0.011) were significantly associated with BRAF-mutated PTC. Finally, we performed a multivariate regression logistic analysis in order to investigate whether these features could be considered as independent predictors of BRAF (V600E) mutation.

Crude OR values confirmed the significant associations revealed in the univariate analysis. After adjusting for tumour size, multifocality, vascular invasion, extrathyroidal extension, lymph node and distant metastasis, we found that older age (OR: 1.15; 95% CI: 1.00-1.33; p value: 0.047) and negative HT (OR: 0.05; 95% CI: 0.006-0.40; p value: 0.005) were still significantly associated with the BRAF (V600E) mutation.

101

Copyright© AE&M all rights reserved.

analyses were performed to evaluate the associations between clinical and pathological parameters of PTC and the BRAF (V600E) mutation. Values of odds ratio (OR) were determined to measure the strength of the associations. The statistical significance of these associations was based on p value < 0.05 and 95% confidence intervals (CI). All statistical data analyses were performed using the statistical software program SPSS for Windows, v. 20.0 (IBM, Armonk, NY, USA).

BRAF mutation in papillary thyroid carcinoma

Table 2. Associations between BRAF (V600E) mutation and clinicopathological features of PTC Characteristics

All patients

BRAF mutation (-)

BRAF mutation (+)

p value

Total number of patients (%)

43

15

28

−

Paediatric patients (≤ 18 y)

4 (9.3)

3

1 (3.6)

37.04 ± 13.58

29.73 ± 10.18

40.96 ± 13.69

0.004

0.280a

Age at diagnosis, y Mean Median

37

Range

12-78

< 55

39 (90.7)

15 (100)

24 (85.7)

≥ 55

4 (9.3)

0

4 (14.3)

Sex Male Female

0.540a 3 (7)

0

3 (10.7)

40 (93)

15 (100)

25 (89.3)

19.23 ± 11.36

17.60 ± 9.51

19.21 ± 11.20

0.622

0.275a

Tumour size, mm Mean Median

15

Range

5-50

< 10

11 (25.6)

2 (13.3)

1 (3.6)

≥ 10

32 (74.4)

13 (86.7)

27 (96.4)

Classical PTC

32 (74.4)

9 (60)

23 (82.1)

Non-classical PTC

11 (25.6)

6 (40)

5 (17.9)

Follicular variant

8 (18.6)

5 (33.3)

3 (10.7)

Tall cell variant

1 (3.6)

1 (6.7)

0

Trabecular variant

1 (3.6)

0

1 (3.6)

Oncocytic variant

1 (3.6)

0

1 (3.6)

No

26 (60.5)

5 (33.3)

21 (75)

Yes

17 (39.5)

10 (66.7)

7 (25)

No

20 (46.5)

8 (53.3)

12 (42.9)

Yes

23 (53.5)

7 (46.7)

16 (57.1)

Histological subtype

0.150

0.011

Hashimoto’s thyroiditis

Multifocal disease

0.54

ETE

0.280a

No

39 (90.7)

15 (100)

24 (85.7)

Yes

4 (9.3)

0

4 (14.3)

No

40 (93)

14 (93.3)

26 (92.9)

Yes

3 (7)

1 (6.7)

2 (7.1)

Vascular invasion

1a

Lymph node metastasis

0.348

No

27 (62.8)

8 (53.3)

19 (67.9)

Yes

16 (37.2)

7 (46.7)

9 (32.1)

Distant metastasis

1a

No

41 (95.3)

14 (93.3)

27 (96.4)

Yes

2 (4.7)

1 (6.7)

1 (3.6)

8th AJCC/TNM stage system

0.643a

I

38 (88.4)

14 (93.3)

24 (85.7)

II

5 (11.6)

1 (6.7)

4 (14.3)

Low

27 (62.8)

9 (60)

18 (64.3)

Intermediate/High

16 (37.2)

6 (40)

10 (35.7)

Very low/Low

24 (55.8)

9 (60)

16 (57.1)

Intermediate/High

19 (44.2)

6 (40)

12 (42.9)

Copyright© AE&M all rights reserved.

2015 ATA recurrence risk

0.782

SBEM recurrence risk

1

: Fisher’s exact test. Y: years-old; mm, millimetres; ETE: extrathyroidal extension; AJCC: American Joint Committee on Cancer; ATA: American Thyroid Association; SBEM: Sociedade Brasileira de Endocrinologia e Metabologia. a

102

Arch Endocrinol Metab. 2019;63/2

BRAF mutation in papillary thyroid carcinoma

Table 3. Univariate and multivariate regression logistic analysis of BRAF (V600E) mutation and clinicopathological features of PTC Characteristics

Univariate OR (95% CI)

Age at diagnosis, y Mean

Multivariate

p value

OR (95% CI)

0.016

1.09 (1.01 - 1.18)

1 1.09 (1.02 - 1.17)

p value

Adjusted ORa (95% CI)

0.021

1.15 (1.00 - 1.33)

1

p value

1 0.047

Hashimoto’s thyroiditis No

1

Yes

0.17 (0.04 - 0.66)

1 0.011

1

0.14 (0.03 - 0.68)

0.014

0.05 (0.006 - 0.40)

0.005

DISCUSSION Although PTC usually displays excellent behaviour at clinical presentation (3), some cases may present a worse prognosis, with ETE, lymph node and distant metastases, as well as acquiring treatment resistance (4).

In an effort to find potential prognostic biomarkers in PTC that could identify those patients, several studies have investigated the role of the BRAF (V600E) mutation, a common genetic alteration in PTC. However, it remains unclear whether BRAF (V600E) is closely associated with aggressive behaviour of PTC. Because few studies have been performed by using Brazilian cohorts, this research was designed to verify the frequency of BRAF (V600E) mutation in PTC patients in a reference hospital in Salvador, BA, Brazil, and investigate its association with their clinical and pathological characteristics.

The prevalence rates of the BRAF (V600E) mutation in PTC range between 27.3 to 90.2% worldwide (12,13). Most Brazilian studies that investigated the presence of BRAF mutation in FFPE or fresh frozen PTC samples were conducted in the South-eastern region, mainly in the State of Sao Paulo (14-18). While these studies reported BRAF (V600E) frequencies between 28.1 to 48.3%, we noted a higher prevalence rate (65.1%) in PTC patients in the present study. Our finding is similar to those reported in PTC patients diagnosed in cities from other Brazilian regions, such as Goiânia (74/116; 63,8%) and Porto Alegre (19/32; 59,4%) (19,20). Some studies have implied that the increased occurrence of BRAF (V600E) mutation in PTC may be associated with high dietary iodine intake (21). We found in a previous study from our laboratory a high risk of excessive nutritional iodine intake among schoolchildren in Salvador (22), a coastal Brazilian city.

If extrapolated to the adult population, this finding suggested that most residents in Salvador may also have Arch Endocrinol Metab. 2019;63/2

a relatively high iodine intake. However, considering the low frequency reported by the studies conducted in Sao Paulo, where thyroid cancer incidence and iodine intake levels are considered higher than other Brazilian regions (23), we assume there are other features that could have influenced the high prevalence rate of BRAF (V600E) mutation found in the present study, such as environmental factors and genetic background of the PTC patients.

In the past few decades, numerous meta-analyses have reported BRAF (V600E) as being strictly associated with aggressive clinicopathological features and poorer clinical outcomes PTC (12,13), but this association remains controversial. We found that BRAF (V600E) mutation was significantly linked with older age, with such patients being more likely to have a BRAF-mutated PTC according to univariate and multivariate analyses. Advanced age has been considered an important prognostic factor for PTC patients and is significantly associated with recurrence and survival (24). Interestingly, Shen and cols. have recently demonstrated in a large cohort that age is an independent risk factor for mortality in PTC patients with BRAF (V600E) mutation, but not in wild type BRAF (25). In contrast to the adult population, differentiated thyroid cancer is an uncommon event in childhood and adolescence (26). From our case series, only four PTC patients were classified as paediatric cases. As opposed to adult PTC, paediatric PTC usually displays aggressive behaviour at clinical presentation, manifested by high incidence of multifocal disease, lymph node and distant metastasis (26). In spite of that, paediatric PTC often has a better prognosis compared to adult PTC (26). Among all paediatric PTC patients enrolled in the present study, only one presented a BRAF-mutant PTC. Consistently, the literature has reported low frequency of BRAF mutations in paediatric PTC (27). Conversely, rearranged during 103

Copyright© AE&M all rights reserved.

Y: years; OR: odds ratio. a : Adjusted for tumour size, multifocality, vascular invasion, extrathyroidal extension, lymph node and distant metastasis.

CopyrightŠ AE&M all rights reserved.

BRAF mutation in papillary thyroid carcinoma

transfection (RET)/PTC translocations seems to be the most frequent genetic change in those cases, which are most often associated with radiation exposure (27).

Remarkably, BRAF (V600E) mutation, but not RET/ PTC rearrangements, has been associated with genomic instability and consequently with decreased expression of the sodium-iodine symporter (NIS) (14,28), somewhat corroborating the better recurrence-free survival observed in paediatric PTC patients when compared to adults.

HT is an autoimmune disease that promotes inflammation and subsequently a progressive depletion of thyroid cells, which are gradually replaced by fibrosis and mononuclear infiltrate (29). Although the association between inflammation and cancer has been well established in distinct human cancers (30), the pathological and molecular connections between HT and PTC are still discussed. It has been postulated that genetic alterations promoting carcinogenesis can activate proinflammatory programs, which result in the formation of an inflammatory tumour microenvironment (31). In turn, the inflammatory cells contribute to tumour progression by inducing the expression of growth factors, proangiogenic factors, extracellular matrix-degrading enzymes, as well as by releasing reactive oxygen species into the tumour microenvironment (30). Indeed, some studies conducted using in vitro models have demonstrated that RET/PTC rearrangements and BRAF (V600E) mutation, the most frequent genetic events in PTC, can increase the expression of proinflammatory chemokines and cytokines, which facilitate tumour proliferation, migration and survival (32-34). However, it is worth mentioning that most studies have reported that RET/ PTC translocations are more frequent in PTC patients with HT than in patients with PTC alone, which has a higher frequency of BRAF (V600E) mutation in contrast (35,36). Consistently, we found a significant and independent negative association between BRAF (V600E) and HT in PTC patients. Because RET/PTC rearrangements is also detected in HT-affected thyroid epithelial cells (35), we believe that the molecular circuits linking HT and PTC mostly do not involve BRAF (V600E) mutation, but preferably RET/PTC rearrangements.

Overall, we did not demonstrate a significant association between BRAF (V600E) mutation and the remaining clinicopathological characteristics of PTC, which included sex, tumour size, histological subtype, 104

multifocality, ETE, vascular invasion, lymph node and distant metastases, as well as intermediate/high risk to recurrence according to current guidelines.

There were some important limitations in our study, notably the small sample size and the predominance of early-stage patients; therefore, we did not confirm the association between BRAF (V600E) mutation and aggressive behaviour and poor prognosis in PTC. The 8th TNM edition recently removed microscopic ETE and regional lymph node metastasis from the classification of T3 disease. In addition, the 8th TNM edition changed the age at diagnosis cut-off from 45 to 55 years, downstaging a significant number of PTC patients (37). Because we selected consecutive cases, only patients classified into the stage I/II were included in the present study. However, our results are in accordance with the majority of Brazilian studies, which did not find correlation between BRAF mutations and PTC aggressive phenotype (15-20). In contrast, Oler and Cerutti reported that the BRAF (V600E) mutation was associated with tumour size, ETE, lymph node metastasis, high risk of recurrence and mortality in PTC patients (14).

Many factors could explain this discrepancy, including case selection, different statistical approaches and the effect of possible confounding factors. Taking into account the conflicting results obtained from several studies addressing BRAF (V600E) prognostic value in PTC around the world, some authors suggest reconsidering the clinical relevance of the BRAF (V600E) mutation (10). Indeed, there is a possibility that this mutation may be in fact indirectly involved in tumour progression. By causing genomic instability, the BRAF (V600E) mutation may coexist with secondary genetic and/or epigenetic alterations (38,39), which in turn might cooperate in terms of tumour aggressiveness and even be more reliable prognostic indicators for PTC. In conclusion, we found a high prevalence of BRAF (V600E) mutation in a PTC case series from patients diagnosed and treated in Salvador, BA, Brazil. Furthermore, older age and concurrent HT was independently associated with the presence and absence of the BRAF (V600E) mutation, respectively.

We consider that further investigation is required to clarify potential mechanisms underlying the association between HT and the BRAF (V600E) mutation.

Acknownledgements: we would like to thank Dr. Edna Teruko Kimura for providing the protocol used to amplify the BRAF exon 15.

Arch Endocrinol Metab. 2019;63/2

BRAF mutation in papillary thyroid carcinoma

Funding statement: this work was supported in part by grants of FAPESB (Fundação de Amparo à Pesquisa no Estado da Bahia, APP0040/2011).

15. Araujo PP, Marcello MA, Tincani AJ, Guilhen AC, Morari EC, Ward LS. mRNA BRAF expression helps to identify papillary thyroid carcinomas in thyroid nodules independently of the presence of BRAFV600E mutation. Pathol Res Pract. 2012;208(8):489-92.

Disclosure: no potential conflict of interest relevant to this article was reported.

16. Dutenhefner SE, Marui S, Santos AB, de Lima EU, Inoue M, Neto JS, et al. BRAF: a tool in the decision to perform elective neck dissection? Thyroid. 2013;23(12):1541-6.

1. Bray F, Ferlay J, Soerjomataram I, Siegel RL, Torre L, Jemal A. Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin. 2018.

2. Lim H, Devesa SS, Sosa JA, Check D, Kitahara CM. Trends in thyroid cancer incidence and mortality in the United States, 1974-2013. JAMA. 2017;317(13):1338-48.

3. Noone AM, Howlader N, Krapcho M, Miller D, Brest A, Yu M, et al. (eds.). SEER Cancer Statistics Review, 1975-2015. Bethesda, MD. National Cancer Institute. Available from: https://seer.cancer.gov/ csr/1975_2015/.

4. Hirsch D, Levy S, Tsvetov G, Gorshtein A, Slutzky-Shraga I, Akirov A, et al. Long-term outcomes and prognostic factors in patients with differentiated thyroid cancer and distant metastases. Endocr Pract. 2017;23(10):1193-200.

5. Rosário PW, Ward LS, Carvalho GA, Graf H, Maciel RM, Maciel LM, et al.; Sociedade Brasileira de Endocrinologia e Metabologia. Thyroid nodules and differentiated thyroid cancer: update on the Brazilian consensus. Arq Bras Endocrinol Metabol. 2013;57(4):240-64.

6. Haugen BR, Alexander EK, Bible KC, Doherty GM, Mandel SJ, Nikiforov YE, et al. 2015 American Thyroid Association Management Guidelines for Adult Patients with Thyroid Nodules and Differentiated Thyroid Cancer: The American Thyroid Association Guidelines Task Force on Thyroid Nodules and Differentiated Thyroid Cancer. Thyroid. 2016;26(1):1-133.

7. Papaleontiou M, Haymart MR. New insights in risk stratification of differentiated thyroid cancer. Curr Opin Oncol. 2014;26(1):1-7.

8. Kimura ET, Nikiforova MN, Zhu Z, Knauf JA, Nikiforov YE, Fagin JA. High prevalence of BRAF mutations in thyroid cancer: genetic evidence for constitutive activation of the RET/PTC-RASBRAF signaling pathway in papillary thyroid carcinoma. Cancer Res. 2003;63(7):1454-7.

9. Xing M. BRAF mutation in papillary thyroid cancer: pathogenic role, molecular bases, and clinical implications. Endocr Rev. 2007;28(7):742-62.

18. Pinheiro Dos Santos MJC, Bastos AU, da Costa VR, Delcelo R, Lindsey SC, Colozza-Gama GA, et al. LIMD2 Is Overexpressed in BRAF V600E-Positive Papillary Thyroid Carcinomas and Matched Lymph Node Metastases. Endocr Pathol. 2018;29(3):222-30.

19. da Silva RC, de Paula HS, Leal CB, Cunha BC, de Paula EC, Alencar RC, et al. BRAF overexpression is associated with BRAF V600E mutation in papillary thyroid carcinomas. Genet Mol Res. 2015;14(2):5065-75.

20. Lutz BS, Leguisamo NM, Cabral NK, Gloria HC, Reiter KC, Agnes G, et al. Imbalance in DNA repair machinery is associated with BRAFV600E mutation and tumour aggressiveness in papillary thyroid carcinoma. Mol Cell Endocrinol. 2018;472:140-8.

21. Kim HJ, Park HK, Byun DW, Suh K, Yoo MH, Min YK, et al.

Iodine intake as a risk factor for BRAF mutations in papillary thyroid cancer patients from an iodine-replete area. Eur J Nutr.

2018;57(2):809-15.

22. Campos Rde O, Reboucas SC, Beck R, de Jesus LR, Ramos YR, Barreto Idos S, et al. Iodine Nutritional Status in Schoolchildren from Public Schools in Brazil: A Cross-Sectional Study Exposes Association with Socioeconomic Factors and Food Insecurity.

Thyroid. 2016;26(7):972-9.

23. Veiga LH, Neta G, Aschebrook-Kilfoy B, Ron E, Devesa SS. Thyroid cancer incidence patterns in São Paulo, Brazil, and the U.S SEER program, 1997-2008. Thyroid. 2013;23(6):748-57.

24. Ito Y, Miyauchi A. Prognostic factors and therapeutic strategies for differentiated carcinomas of the thyroid. Endocr J. 2009;56(2):177-92.

25. Shen X, Zhu G, Liu R, Viola D, Elisei R, Puxeddu E, et al. Patient Age-Associated Mortality Risk Is Differentiated by BRAF V600E Status in Papillary Thyroid Cancer. J Clin Oncol. 2018;36(5): 438-45.

26. Vaisman F, Corbo R, Vaisman M. Thyroid carcinoma in children and adolescents-systematic review of the literature. J Thyroid Res. 2011;2011:845362.

10. Gandolfi G, Sancisi V, Piana S, Ciarrocchi A. Time to re-consider the meaning of BRAF V600E mutation in papillary thyroid carcinoma. Int J Cancer. 2015;137(5):1001-11.

27. Nikiforova MN, Ciampi R, Salvatore G, Santoro M, Gandhi M, Knauf JA, et al. Low prevalence of BRAF mutations in radiationinduced thyroid tumours in contrast to sporadic papillary carcinomas. Cancer Lett. 2004;209(1):1-6.

11. Francis GL, Waguespack SG, Bauer AJ, Angelos P, Benvenga S, Cerutti JM, et al.; American Thyroid Association Guidelines Task Force. Management Guidelines for Children with Thyroid Nodules and Differentiated Thyroid Cancer. Thyroid. 2015;25(7):716-59.

28. Liu D, Hu S, Hou P, Jiang D, Condouris S, Xing M. Suppression of BRAF/MEK/MAP kinase pathway restores expression of iodidemetabolizing genes in thyroid cells expressing the V600E BRAF mutant. Clin Cancer Res. 2007;13(4):1341-9.

12. Li C, Lee KC, Schneider EB, Zeiger MA. BRAF V600E mutation and its association with clinicopathological features of papillary thyroid cancer: a meta-analysis. J Clin Endocrinol Metab.

2012;97(12):4559-70.

29. Hiromatsu Y, Satoh H, Amino N. Hashimoto’s thyroiditis: history and future outlook. Hormones (Athens). 2013;12(1):12-8.

13. Liu C, Chen T, Liu Z. Associations between BRAF(V600E) and prognostic factors and poor outcomes in papillary thyroid carcinoma: a meta-analysis. World J Surg Oncol. 2016;14(1):241.

31. Colotta F, Allavena P, Sica A, Garlanda C, Mantovani A. Cancerrelated inflammation, the seventh hallmark of cancer: links to genetic instability. Carcinogenesis. 2009;30(7):1073-81.

14. Oler G, Cerutti JM. High prevalence of BRAF mutation in a Brazilian cohort of patients with sporadic papillary thyroid carcinomas: correlation with more aggressive phenotype and decreased expression of iodide-metabolizing genes. Cancer. 2009;115(5):972-80.

32. Russell JP, Shinohara S, Melillo RM, Castellone MD, Santoro M, Rothstein JL. Tyrosine kinase oncoprotein, RET/PTC3, induces the secretion of myeloid growth and chemotactic factors. Oncogene.

2003;22(29):4569-77.

Arch Endocrinol Metab. 2019;63/2

30. Hanahan D, Weinberg RA. Hallmarks of cancer: the next generation. Cell. 2011;144(5):646-74.

105

Copyright© AE&M all rights reserved.

REFERENCES

17. Penna GC, Pestana A, Cameselle JM, Momesso D, de Andrade FA, Vidal APA, et al. TERTp mutation is associated with a shorter progression free survival in patients with aggressive histology subtypes of follicular-cell derived thyroid carcinoma. Endocrine.

2018;61(3):489-98.

BRAF mutation in papillary thyroid carcinoma

33. Borrello MG, Alberti L, Fischer A, Degl’innocenti D, Ferrario C, Gariboldi M, et al. Induction of a proinflammatory program in normal human thyrocytes by the RET/PTC1 oncogene. Proc Natl Acad Sci U S A. 2005;102(41):14825-30.

34. Zhou D, Li Z, Bai X. BRAF (V600E) and RET/PTC Promote Proliferation and Migration of Papillary Thyroid Carcinoma Cells In Vitro by Regulating Nuclear Factor-κB. Med Sci Monit. 2017;23:5321-9.

35. Muzza M, Degl’Innocenti D, Colombo C, Perrino M, Ravasi E, Rossi S, et al. The tight relationship between papillary thyroid cancer, autoimmunity and inflammation: clinical and molecular studies. Clin Endocrinol (Oxf). 2010;72(5):702-8.

37. Tuttle RM, Haugen B, Perrier ND. Updated American Joint Committee on Cancer/Tumor-Node-Metastasis Staging System for Differentiated and Anaplastic Thyroid Cancer (Eighth Edition): What Changed and Why? Thyroid. 2017;27(6):751-6.

38. Quiros RM, Ding HG, Gattuso P, Prinz RA, Xu X. Evidence that one subset of anaplastic thyroid carcinomas are derived from papillary carcinomas due to BRAF and p53 mutations. Cancer.

2005;103(11):2261-8.

39. Hou P, Liu D, Xing M. Genome-wide alterations in gene methylation by the BRAF V600E mutation in papillary thyroid cancer cells. Endocr Relat Cancer. 2011;18(6):687-97.

Copyright© AE&M all rights reserved.

36. Marotta V, Guerra A, Zatelli MC, Uberti ED, Di Stasi V, Faggiano A, et al. BRAF mutation positive papillary thyroid carcinoma is less

advanced when Hashimoto’s thyroiditis lymphocytic infiltration is present. Clin Endocrinol (Oxf). 2013;79(5):733-8.

106

Arch Endocrinol Metab. 2019;63/2

original article

Preoperative detection of TERT promoter and BRAFV600E mutations in papillary thyroid carcinoma in high-risk thyroid nodules Departamento de Medicina Interna, Faculdade de Medicina de Ribeirão Preto da Universidade de São Paulo (FMRP-USP), Ribeirão Preto, SP, Brasil 2 Departamento de Biorregulação, Laboratório de Estudo da Tireoide, Instituto de Ciências da Saúde, Universidade Federal da Bahia (UFBA), Salvador, BA, Brasil 3 Programa de Pós-graduação em Processos Interativos dos Órgãos e Sistemas, Instituto de Ciências da Saúde, Universidade Federal da Bahia (UFBA), Salvador, BA, Brasil 4 Departamento de Patologia, Hospital Aristides Maltez, Liga Bahiana Contra o Câncer, Salvador, BA, Brasil 5 Departamento de Ciências Biológicas, Universidade Estadual do Sudoeste da Bahia (UESB), Jequié, BA, Brasil 1

Tatiana Marina Vieira Giorgenon1, Fabiane Tavares Carrijo2,3, Maurício Alamos Arruda2, Taíse Lima Oliveira Cerqueira2, Haiara Ramos Barreto2, Juliana Brandão Cabral4, Thiago Magalhães da Silva5, Patrícia Künzle Ribeiro Magalhães1, Léa Maria Zanini Maciel1, Helton Estrela Ramos2,3,4

ABSTRACT Objectives: This observational study analyzed telomerase reverse transcriptase (pTERT) mutations in 45 fine-needle aspiration (FNA) specimens obtained from thyroid nodules followed by postoperatively confirmation of papillary thyroid cancer (PTC) diagnosis, examining their relationship with clinicopathologic aspects and the BRAFV600E mutation. Subjects and methods: Clinical information was collected from patients who presented to Ribeirao Preto University Hospital for surgical consultation regarding a thyroid nodule and who underwent molecular testing between January 2010 to October 2012. Tests included a DNA-based somatic detection of BRAFV600E and pTERT mutations. Results: We found coexistence of pTERTC228T and BRAFV600E mutations in 8.9% (4/45) of thyroid nodules. All nodules positive for pTERT mutations were BRAFV600E positives. There was a significant association between pTERTC228T/BRAFV600E with older age and advanced stage compared with the group negative for either mutation. Conclusions: This series provides evidence that FNA is a reliable method for preoperative diagnosis of high-risk thyroid nodules. pTERTC228T/BRAFV600E mutations could be a marker of poor prognosis. Its use as a personalized molecular medicine tool to individualize treatment decisions and follow-up design needs to be further studied. Arch Endocrinol Metab. 2019;63(2):107-12 Keywords TERT; BRAFV600E; papillary thyroid carcinoma

Correspondence to: Helton E. Ramos Departamento de Biorregulação, Universidade Federal da Bahia, Av. Reitor Miguel Calmon, s/n, Vale do Canela, Room 301 40110-102 – Salvador, BA, Brasil ramoshelton@gmail.com Received on Sept/24/2018 Accepted on Jan/14/2019

INTRODUCTION

P

apillary thyroid cancer (PTC) risk stratification and prognostication has been normally placed on clinicopathologic aspects, which are usually unreliable and presurgically nonexistent (1). In recent years, molecularly established prognostication for PTC has been broadly advised (2-4). The role of BRAFV600Emutation test in bettering the preoperative premonition of thyroid nodules US guided fine-needle aspiration (FNA) is dubious in terms of the prognostic accuracy of BRAFV600E mutations in PTC (5,6).

Telomerase reverse transcriptase (TERT) has been known to play a decisive role in cellular immortality by preserving the telomere length at the end of Arch Endocrinol Metab. 2019;63/2

chromosomes and in encouraging other cellular functions such as proliferation and cell cycles (7).

TERT gene promoter mutations (pTERT) increment the transcriptional activities of the TERT and have been connected to malignant tumors with superlative recurrence and lower survival in PTC (7,8). Only three studies preoperatively investigated pTERT mutations in PTC patients and proposed that the awareness of the mutation status might guide the amplitude of initial surgery (9-11). Coexistence of BRAFV600E and pTERT mutations leads to a more aggressive subgroup of PTC, whereas the two mutations alone have relatively less impact on the aggressiveness of PTC (12). This study preoperatively scrutinized high-risk thyroid nodules confirmed as PTC tumors for pTERT mutations and 107

Copyright© AE&M all rights reserved.

DOI: 10.20945/2359-3997000000116

TERT promoter and BRAFV600E mutations in papillary thyroid carcinomas

inspected their relationship with clinicopathologic features at the moment of the diagnosis and cooccurrence with the BRAFV600E-mutation.

SUBJECTS AND METHODS

Copyright© AE&M all rights reserved.

FNA specimens We have studied 59 consecutive patients with highrisk thyroid nodules after US evaluation, followed up at the Thyroid Outpatient Clinic of the Division of Endocrinology of the Ribeirao Preto Medical School of University of São Paulo, Brazil, who needed another FNA examination and were chosen in our hospital from January 2010 to October 2012. Inclusion criteria were: (1) TIRADS 4-6 at US, or (2) TIRADS 3 that meet at least one of the following criteria: the nodule grows during follow-up (more than a 50% change in volume or a 20% increase in at least two nodule dimensions with a minimal increase of 2 mm in solid nodules or in the solid portion of mixed cystic-solid nodules), patients with higher risk of malignancy like those exposed to previous radiation to the neck or family history of DTC, and (3) histologic confirmation of PTC after thyroidectomy and elective lymph node dissection. TNM classification was built according to the American Joint Committee on Cancer (AJCC) 8th edition (13,14). Genomic DNA from FNA specimens preoperatively obtained was isolated, and nested PCR was performed for direct genomic DNA sequencing to identify both the C228T and C250T pTERT mutations as previously described (9-11).

FNA biopsy used 24-gauge needles fitted to a 10mL syringe. Most of the material (about two thirds) from the needle was used for cytological examination, and the remaining amount was used for DNA isolation after needle washing with 1 mL of the phosphate buffer.

Then the sample was stored and frozen for future DNA extraction, using 20-50 μL of DNA extraction buffer solution (50 mM Tris buffer, pH 8.3; 1 mM EDTA, pH 8.0; 5% Tween 20 and 100 μg/mL proteinase K) with 10% resin added to the samples and incubated at 56.8 °C for a minimum of 1 hour. After incubation, the tubes were heated to 100 °C for 10 minutes, followed by centrifugation to pellet the debris, and 5 μL of the supernatant was used in the PCR reaction.

containing 100 ng of genomic DNA, 7.5 pmol of each primer, 100 μm deoxynucleoside triphosphates (dNTPs), 5 μCi [α32P] dCTP, 1.5 mm MgCl2, Platinum TaqDNA polymerase high fidelity and buffer (Thermo Fisher Scientific, Waltham, MA, USA). The primer pair was designed flanking BRAF exon 15: 5‘ AAACTCTTCATAATGCTTGCTCTG3’ (sense) and 5‘GGCCAAAAATTTAATCAGTGGA 3’ (antisense).

Quality confirmation of the PCR products was achieved by gel electrophoresis, and sequencing PCR was performed using the Veriti 96-Well Thermal Cycler (Thermo Fisher Scientific, Waltham, MA, USA).

pTERT mutation analysis A fragment of the pTERT, which contained the sites for pTERTC250T and pTERTC228T mutations, was amplified by nested PCR on 50-100 ng of genomic DNA from FNA specimens. The first PCR used pair primers [5’ACGAACGTGGCCAGCGGCAG3’ (sense) and 5’CTGGCGTCCCTGCACCCTGG3’ (antisense)] in a 0,4 µM, 200 µM dNTPs, 1,5 mM MgCl2, PCRx Enhancer System 1X (Life Technologies, Carlsbad, CA), Taq DNA polimerase recombinant (Life Technologies, Carlsbad, CA), buffer and water (UltraPure™ DNase/RNase-Free Distilled Water, Life Technologies, Carlsbad, CA). It was performed with an initial denaturation at 94 °C for 5 minutes, followed by 40 cycles of 94 °C for 30 seconds, 62 °C annealing for 30 seconds, 72 °C elongation for 45 seconds and final completion with an elongation at 72 °C for 15 min. The second PCR used a dilution (1:50) of the first PCR product. The primers used were 5’ AGTGGATTCGCGGGCACAGA 3’ (sense) and 5’ CAGCGCTGCCTGAAACTC 3’ (antisense) in a 0,5 µM, 200 mM dNTPs, PCRx Enhancer System 1X (Life Technologies, Carlsbad, CA), Taq DNA polimerase Hot Start High Fidelity (Life Technologies, Carlsbad, CA), buffer and water to 50 µL of final volume. This PCR was performed with an initial denaturation at 98 °C for 3 minutes, followed by 35 cycles of 98 °C for 20 seconds, 66 °C annealing for 30 seconds, 72 °C elongation for 30 seconds and final completion with an elongation at 72 °C for 10 minutes.

Statistic analysis BRAF

V600E

mutation analysis

PCR was performed to amplify the exon 15 of BRAF from the isolated DNA in 20 μL reaction volume 108

For analysis of the relationship between tumor clinicopathologic features and presence of pTERT/ BRAFV600E mutations, Pearson’s chi-square test and Arch Endocrinol Metab. 2019;63/2

TERT promoter and BRAFV600E mutations in papillary thyroid carcinomas

Fisher’s exact test were used. A linear-by-linear test was used to examine the association between T stage, N stage, AJCC stage, and mutations.

RESULTS A total of 59 patients with confirmed PTC was enrolled, and 14 patients were excluded due PCR failure (n = 8) and 6 due to incomplete clinical data. Therefore, 45 thyroid nodules confirmed as PTC cases were included after histological re-review by two experienced pathologists. As reported in Table 1, 39 out of 45 Table 1. Clinical and pathological characteristics of 45 patients harboring thyroid nodules confirmed as papillary thyroid carcinoma and preoperatively submitted to molecular analysis of pTERT and BRAFV600E mutations Variables

n

%

6

13.3

39

86.7

Gender Male Female Age, mean (sd)

48.5 (14.33)

≤ 55

23

51.1

> 55

22

48.9

≤ 1 cm

13

29.5

> 1 cm

31

70.5

Absent

34

75.6

Present

11

24.4

Absent

41

91.1

Present

4

8.9

Absent

38

84.4

Present

7

15.6

I+II

33

75.0

III+IV

11

25.0

Absent

37

82.2

Present

8

17.8

Wild Type

15

33.3

Mutated

30

66.7

Tumor size

Multicentricity

Extrathyroid extension

patients (86.7%) were women, and the mean age for all the cases was 48.5 ± 14.33 years (range 16-78). Among those, 16 patients were over 55 years old (median) at the time of diagnosis. The median tumor size was 1.9 cm (range 0.6-6.8), mean 1.35 ± 1.48 cm, with 13 (29.5%) tumors smaller than 1 cm. More than half (75.6%) of PTC were unifocal; 4 cases had a focal extra thyroidal extension, and only 7 cases had lymph node metastases at diagnosis. Four distant metastases were observed. In all, 17 (38.6%) patients had locally advanced disease (AJCC stage III or IV), and the presence of capsular invasion was observed for 8 (17.8%) patients. In all, 66.7% (30/45) and 8.9% (4/45) of the cases were BRAFV600E-mutated and TERT-mutated, respectively.

Correlation between pTERT/BRAFV600E status and clinicopathological parameters Four PTC tumors (two oncocytic, one classic and one trabecular) had pTERT mutations, and all additionally harbored the BRAFV600E mutation. There was no association between isolated BRAFV600E mutations and clinic-pathological parameters. However, the found pTERTC228T mutation was independently associated with advanced age (p = 0.02) and high AJCC stage (p = 0.03) (Table 2). Interestingly, three of four patients with concomitant BRAFV600E and pTERTC228T mutations were classified as stage III-IV. There was significant difference in age at diagnosis between wild type for both BRAFV600E and pTERTC228T mutations, only BRAFV600E positive and with concomitant BRAFV600E and pTERTC228T mutations patients. (p = 0.03) (Figure 1).

Lymphnode metastases p = 0.037 80

BRAF status

40

20

BRAF-/TERT-

TERT status Wild Type

41

91.1

Mutated

4

8.9

Arch Endocrinol Metab. 2019;63/2

60

BRAF+/TERT-

BRAF+/TERT+

Figure 1. Relationship between age at PTC diagnosis and mutation status.

109

Copyright© AE&M all rights reserved.

Capsular invasion

Age at diagnosis (years)

AJCC stage

TERT promoter and BRAFV600E mutations in papillary thyroid carcinomas

Table 2. Relationship of pTERT/BRAFV600E mutation and clinicopathologic aspects in 45 thyroid nodules specimens obtained by fine needle aspiration and postoperatively confirmed as papillary thyroid carcinoma Variables

BRAF status, n (%) Wild type

Mutated

P value

TERT status, n (%) Wild type

Mutated

P value

Gender Male

1 (6.7)

5 (16.7)

14 (93.3)

25 (83.3)

44.0 (14.35)

50.7 (14.0)

≤ 1 cm

3 (21.4)

10 (33.3)

> 1 cm

11 (78.6)

20 (66.7)

Absent

12 (80.0)

22 (73.3)

Present

3 (20.0)

8 (26.7)

Absent

14 (93.3)

27 (90.0)

Present

1 (6.7)

3 (10.0)

Absent

14 (93.3)

24 (80.0)

Present

1 (6.7)

6 (20.0)

I+II

12 (85.7)

21 (70.0)

III+IV

2 (14.3)

9 (30.0)

Absent

13 (86.7)

24 (80.0)

Present

2 (13.3)

6 (20.0)

Female Age, mean (sd)

0.647

5 (12.2)

1 (25.0)

36 (87.8)

3 (75.5)

0.448

0.139

46.9 (13.5)

64.0 (15.3)

0.022

0.498

13 (32.5)

0 (0.0)

0.302

27 (67.5)

4 (100.0)

30 (73.2)

4 (100.0)

11 (26.8)

0 (0.0)

38 (92.7)

3 (75.0)

3 (7.3)

1 (25.0)

36 (87.8)

2 (50.0)

5 (12.2)

2 (50.0)

Tumor size

Multicentricity 0.726

0.558

Extrathyroid extension 1.00

0.320

Lymphnode metastases 0.395

0.108

AJCC stage 0.456

0.002

33 (82.5)

0 (0.0)

7 (17.5)

4 (100.0)

0.699

34 (82.9)

3 (75.0)

0.557

7 (17.1)

1 (25.0)

Capsular invasion

However, in the follow-up evaluation, one patient had died, two present excellent response and another has indeterminated response to treatment at the study data snapshot.

Copyright© AE&M all rights reserved.

CONCLUSION We investigated the feasibility of combined BRAFV600E/ pTERT mutations testing on routine FNA specimens and its prognostic value in US guide biopsied of high suspicious thyroid nodules. The BRAFV600E and pTERT mutations were found in a frequency of 66.7% and 8.9%, respectively. Indeed, we observed that BRAFV600E/pTERT mutation-positive thyroid nodules were detected only in cancers that behaved aggressively, representing 4/11 (36%) of advanced stage PTCs and harboring threatening clinic-pathological features such 110

as lymph node metastases, extra-thyroidal invasion and distant metastases (Table 3).

We did not evaluate the degree of concordance between matched FNA and formalin-fixed, paraffinembedded samples. The mutation analysis sensitivity can be compromised by using lavage fluid once the amount and composition of the cellular content is unknown, potentially leading to discordance between matched FNA and formalin-fixed, paraffin-embedded. As a result, we were not able to measure the mutation false-negative and false-positive rates on FNA preparations. Indeed, strategies such as real-time Light Cycler PCR and fluorescence melting curve analysis might be superior.

In conclusion, preoperative determination of BRAFV600E and pTERT mutations status can be easily performed on cytologic preparation using lavage fluids collected from needle rinsing. The presence of the BRAFV600E/pTERT mutations could be a marker of poor Arch Endocrinol Metab. 2019;63/2

TERT promoter and BRAFV600E mutations in papillary thyroid carcinomas

Table 3. Correlation of pTERT/BRAFV600E mutations and clinicopathologic aspects in 45 thyroid nodules specimens obtained by fine needle aspiration and postoperatively confirmed as papillary thyroid carcinoma Variables

BRAF/TERT status, n (%) BRAF-/TERT-

BRAF+/TERT-

BRAF+/TERT+

14 (93.3)

22 (84.6)

3 (75.0)

Gender Male Female Age, mean (sd)

1 (6.7)

4 (15.4)

1 (25.0)

P valuea = 0.407

P valueb = 0.636

P valuec = 0.386

44.0 (14.35)

48.7 (12.9)

64.0 (15.3)

P valuea = 0.042

P valueb = 0.881

P valuec = 0.037

3 (21.4)

10 (38.5)

0 (0.0)

Tumor size ≤ 1 cm > 1 cm

11 (78.6)

16 (61.5)

4 (100.0)

P valuea = 0.284

P valueb = 0.316

P valuec = 1.00

Absent

12 (80.0)

18 (69.2)

4 (100.0)

Present

3 (20.0)

8 (30.8)

0 (0.0)

P value = 0.592

P value = 0.716

P valuec = 1.00

Absent

14 (93.3)

24 (92.3)

3 (75.0)

Present

1 (6.7)

2 (7.7)

1 (25.0)

P value = 0.509

b

P value = 1.00

P valuec = 0.386

Absent

14 (93.3)

22 (84.6)

2 (50.0)

Present

1 (6.7)

4 (15.4)

2 (50.0)

P value = 0.139

P value = 0.636

P valuec = 0.097

12 (85.7)

21 (80.8)

0 (0.0)

Multicentricity

a

b

Extrathyroid extension

a

Lymphnode metastases

a

b

AJCC stage I+II III+IV

2 (14.3)

5 (19.2)

4 (100.0)

P valuea = 0.004

P valueb = 1.00

P valuec = 0.005

13 (86.7)

21 (80.8)

3 (75.0)

Capsular invasion Absent Present

2 (13.3)

5 (19.2)

1 (25.0)

P valuea = 0.861

P valueb = 1.00

P valuec = 0.530

Global test.

BRAF-/TERT- vs BRAF+/TERT- comparasion. c BRAF-/TERT- vs BRAF+/TERT+ comparasion. a

b

prognosis in elderly population, although the absence of the mutation may not yet be considered an index of good prognosis to individualize treatment decisions and follow-up protocol. Preoperative knowledge of the BRAFV600E/pTERT mutations status would help determine the extent of surgery for thyroid nodules.

Disease free or overall survival is still unclear.

Financial support: this work was supported in part by grants Fapesb (Fundação de Amparo à Pesquisa no Estado da Bahia, Edital 011/2013; TOU RED010/2013). FAEPA (Fundação de Amparo ao Ensino, Pesquisa e Assistência do Hospital das Clínicas da Faculdade de Medicina de Ribeirão Preto).

Acknowledgements: this study was supported by Fapesb (Fundação de Amparo à Pesquisa no Estado da Bahia, Edital 011/2013; TOU RED010/2013). FAEPA (Fundação de Amparo ao Ensino,

Disclosure: no potential conflict of interest relevant to this article was reported.

Arch Endocrinol Metab. 2019;63/2

111

Copyright© AE&M all rights reserved.

Pesquisa e Assistência do Hospital das Clínicas da Faculdade de Medicina de Ribeirão Preto).

TERT promoter and BRAFV600E mutations in papillary thyroid carcinomas

REFERENCES 1. Nikiforov YE. Thyroid cancer in 2015: Molecular landscape of thyroid cancer continues to be deciphered. Nat Rev Endocrinol.

2016;12(2):67-8.

9. Crescenzi A, Trimboli P, Modica DC, Taffon C, Guidobaldi L, Taccogna S, et al. Preoperative Assessment of TERT Promoter Mutation on Thyroid Core Needle Biopsies Supports Diagnosis of Malignancy and Addresses Surgical Strategy. Horm Metab Res. 2016;48(3):157-62.

2. Yip L, Ferris RL. Clinical application of molecular testing of fineneedle aspiration specimens in thyroid nodules. Otolaryngol Clin North Am. 2014;47(4):557-71.

10. Liu R, Xing M. Diagnostic and prognostic TERT promoter mutations in thyroid fine-needle aspiration biopsy. Endocr Relat Cancer. 2014;21(5):825-30.

3. Nikiforov YE, Yip L, Nikiforova MN. New strategies in diagnosing cancer in thyroid nodules: impact of molecular markers. Clin Cancer Res. 2013;19(9):2283-8.

11. Lee SE, Hwang TS, Choi YL, Han HS, Kim WS, Jang MH, et al.

Prognostic Significance of TERT Promoter Mutations in Papillary Thyroid Carcinomas in a BRAF(V600E) Mutation-Prevalent Population. Thyroid. 2016;26(7):901-10.

4. Xing M. BRAF V600E mutation and papillary thyroid cancer.

JAMA. 2013;310(5):535.

5. Kim SW, Lee JI, Kim JW, Ki CS, Oh YL, Choi YL, et al. BRAFV600E mutation analysis in fine-needle aspiration cytology specimens for evaluation of thyroid nodule: a large series in a BRAFV600E-prevalent population. J Clin Endocrinol Metab. 2010;95(8):3693-700.

6. Marotta V, Sciammarella C, Colao AA, Faggiano A. Application of molecular biology of differentiated thyroid cancer for clinical prognostication. Endocr Relat Cancer. 2016;23(11):R499-R515.

7.

Kim TH, Kim YE, Ahn S, Kim JY, Ki CS, Oh YL, et al. TERT promoter mutations and long-term survival in patients with thyroid cancer.

Endocr Relat Cancer. 2016;23(10):813-23.

13. Brierley JD, Panzarella T, Tsang RW, Gospodarowicz MK, Oâ&#x20AC;&#x2122;Sullivan B. A comparison of different staging systems predictability of patient outcome. Thyroid carcinoma as an example.

Cancer. 1997;79(12):2414-23.

14. Haugen BR, Alexander EK, Bible KC, Doherty GM, Mandel SJ, Nikiforov YE, et al. 2015 American Thyroid Association Management Guidelines for Adult Patients with Thyroid Nodules and Differentiated Thyroid Cancer: The American Thyroid Association Guidelines Task Force on Thyroid Nodules and Differentiated Thyroid Cancer. Thyroid. 2016;26(1):1-133.

CopyrightŠ AE&M all rights reserved.

8. Liu R, Xing M. TERT promoter mutations in thyroid cancer. Endocr Relat Cancer. 2016;23(3):R143-55.

12. Xing M, Liu R, Liu X, Murugan AK, Zhu G, Zeiger MA, et al. BRAF V600E and TERT promoter mutations cooperatively identify the most aggressive papillary thyroid cancer with highest recurrence. J Clin Oncol. 2014;32(25):2718-26.

112

Arch Endocrinol Metab. 2019;63/2

original article

Cognitive functions in children with congenital adrenal hyperplasia Nermine Hussein Amr1, Alaa Youssef Baioumi1,2, Mohamed Nagy Serour1, Abdelgawad Khalifa3, Nermine Mahmoud Shaker4

ABSTRACT

Department of Paediatrics, Ain Shams University, Cairo, Egypt 2 Department of Paediatrics, Ain Shams University, Cairo, Egypt. Kent, Surrey and Sussex, Health Education England, UK 3 Institute of Psychiatry, Ain Shams University, Cairo, Egypt 4 Department of Psychiatry, Ain Shams University, Cairo, Egypt 1

Objective: There is controversy regarding cognitive function in patients with congenital adrenal hyperplasia (CAH). This study is aimed at the assessment of cognitive functions in children with CAH, and their relation to hydrocortisone (HC) therapy and testosterone levels. Subjects and methods: Thirty children with CAH due to 21 hydroxylase deficiency were compared with twenty age- and sexmatched healthy controls. HC daily and cumulative doses were calculated, the socioeconomic standard was assessed, and free testosterone was measured. Cognitive function assessment was performed using the Wechsler Intelligence Scale – Revised for Children and Adults (WISC), the Benton Visual Retention Test, and the Wisconsin Card Sorting Test (WCST). Results: The mean age (SD) of patients was 10.22 (3.17) years [11 males (36.7%), 19 females (63.3%)]. Mean (SD) HC dose was 15.78 (4.36) mg/ m2/day. Mean (SD) cumulative HC dose 44,689. 9 (26,892.02) mg. Patients had significantly lower scores in all domains of the WISC test, performed significantly worse in some components of the Benton Visual Retention Test, as well as in the Wisconsin Card Sorting Test. There was no significant difference in cognitive performance when patients were subdivided according to daily HC dose (< 10, 10 – 15, > 15 mg/m2/day). A positive correlation existed between cumulative HC dose and worse results of the Benton test. No correlation existed between free testosterone and any of the three tests. Conclusion: Patients with CAH are at risk of some cognitive impairment. Hydrocortisone therapy may be implicated.

This study highlights the need to assess cognitive functions in CAH. Arch Endocrinol Metab. 2019;63(2):113-20

Correspondence to: Alaa Youssef Baioumi dralaayoussef@gmail.com Received on Dec/12/2017 Accepted on Feb/9/2019 DOI: 10.20945/2359-3997000000125

INTRODUCTION

C

ongenital adrenal hyperplasia (CAH) is a group of autosomal recessive diseases, the most common enzyme defect of which is 21-hydroxylase deficiency.

This defect is characterised by defective cortisol synthesis, elevation of adrenocorticotrophic hormone, and accumulation of adrenal androgens. Patients present in early life with virilisation of female newborns or by salt-losing crises which can occur in both sexes (1).

Cognitive functions represent the highest environmentally acquired mental functions of the human brain. The four main areas of cognitive assessment are 1) attention, which is the ability to maintain concentration on a single stimulus in an environment containing other distracters; 2) perception, which is an essential step in processing sensory information; 3) memory; 4) executive functions, which are the most advanced of all cognitive functions as they encompass integration of input from the environment with what is stored in memory to be used for planning and choosing strategies (2).

Data on cognitive functions in CAH patients is controversial (3). Visuospatial processing may be Arch Endocrinol Metab. 2019;63/2

affected by prenatal androgen exposure through an effect on the hippocampus (4). Memory performance defects were demonstrated in some patients with CAH (5), some showed defects in mental rotation (6), executive functions (7), spatial abilities (8), while others showed no differences in cognitive functions between patients and controls (9). The androgenic effect on spatial abilities during a critical time of development was thought to be curvilinear, so that very low and very high doses of testosterone impair cognition, whereas doses in the intermediate zone improve cognition (4).

There is paucity of such data in children with CAH (5,10,11). Cognitive deficits are hypothesized to result either from the disease process itself owing to prolonged exposure to high androgen levels, or could be the effect of glucocorticoid medication that is used in the treatment (3,4). Another postulated mechanism is the effect of hyponatraemia (4).

The aim of this study is to assess the cognitive functions in children with CAH, and their relation to hydrocortisone (HC) therapy and testosterone level.

113

Copyright© AE&M all rights reserved.

Keywords Congenital adrenal hyperplasia; children; cognitive functions; corticosteroid treatment

Cognitive functions in children with congenital adrenal hyperplasia

SUBJECTS AND METHODS

Copyright© AE&M all rights reserved.

Thirty patients aged 6-16 years with classic congenital adrenal hyperplasia due to 21 hydroxylase deficiency were included in this case–control study. Patients were recruited during between August 2014 and December 2015 from the Pediatric Endocrinology Clinic at AinShams University Hospital, Cairo, Egypt. All parents signed an informed consent prior to recruitment and the patients dis so as well if this was deemed appropriate.

The study protocol was approved by the local ethics committee of Ain-Shams University. Diagnosis was made based on clinical signs and biochemical assessment (elevated ACTH, 17 hydroxy-progesterone, dehydroepiandrosterone, androstenedione, total and free testosterone, in addition to low cortisol). Saltwasting (SW) was diagnosed in patients with frank hyponatraemia and hyperkalaemia accompanied by low plasma aldosterone and elevated renin concentrations. All patients were receiving glucocorticoid treatment in the form of hydrocortisone. No antenatal dexamethasone was used in any of the patients. Salt-wasting patients were on 9-alphafludrocortisone therapy at a dose of 50–100 µg/m2/day. The simple virilising (SV) patients did not receive mineralocorticoid treatment. Patients were excluded from the study if they had other chronic medical conditions or co-morbid psychiatric diagnoses.

Twenty age- and sex-matched controls were recruited from the General Pediatric Outpatient Clinic of AinShams Children’s University Hospital. Controls were healthy subjects attending the outpatient clinic accompanying their sick siblings.

scale, to the nearest 0.1 kg, wearing light clothing and without shoes. Body mass index (BMI) was calculated using the formula kg/m2. Standard deviation scores for weight, height, and BMI were calculated (12,13).

Socioeconomic status (SES) was determined for patients and controls based on parental education and occupation, family income, crowding index, and sanitation available. A score of 25–30 is considered high SES, 20–24 middle, 15–19 score low SES, and < 14 is very low SES (14). Patients showed different pubertal stages ranging from Tanner stage 1 to Tanner stage 5 in both males and females. Patients were not categorised according to their pubertal stage to detect the effect puberty might have on cognitive function, as this would have created many subgroups in male and female patients which would have decreased the individual group power when trying to correlate the resulting subgroups with their various cognitive function tests.

However, cognitive function tests were applied and comparison was done to age and sex-matched controls.

Laboratory evaluation Serum free testosterone level was measured for patients only, as part of a routine assessment with a commercially available kit (DRG International Inc., USA, EIA-2924) using the principle of competitive immunoenzymatic colorimetric assay.

Neurocognitive functions assessment All patients and controls underwent the following tests.

Clinical evaluation

Wechsler Intelligence Scale-Revised for Children and Adults (WISC)

Patients’ files were reviewed for date of birth, age at diagnosis, ambiguity at birth, sex assignment, and karyotype. Family history of similar condition was also reported.

The mean daily dose of hydrocortisone in relation to body surface area was calculated and patients were subdivided according to their daily dose (< 10 mg/m2/day, 10-15 mg/m2/day, > 15 mg/m2/ day) at the time of assessment. Duration of treatment and total hydrocortisone dose since the start of treatment was calculated in milligrams. All patients and controls underwent physical examination. Height was measured without shoes to the nearest 0.1 cm, using the Harpenden stadiometer (Holtain ltd, Croswell, Crymych, UK). Weight was measured using a digital

WISC reflects the intellectual performance through verbal (VIQ), performance (PIQ), and full scale IQ. It is used for assessment of different cognitive functions, including executive functions, and provides an overview of the integrity of cognitive abilities (2) and its Arabic version has been validated (15). The WISC comprises ten subtests numbered in order of their administration, in which verbal and performance tests are alternated.

The Wechsler Intelligence Scale for Children assesses a panel of cognitive function parameters. Five verbal linguistic subtests underlie the verbal IQ; information (factual knowledge), similarities (verbal concept formation), arithmetic (mental arithmetic), vocabulary (word definitions), and comprehension (social understanding). Five visuospatial subtests underlie the

114

Arch Endocrinol Metab. 2019;63/2

Cognitive functions in children with congenital adrenal hyperplasia

Benton Visual Retention Test This test assesses visual perception, visual memory and visuoconstructive abilities. It measures perception of spatial relations and memory for newly-learned material.

The examiner compares the examinee’s obtained scores with the expected scores found in the norm tables. The larger the difference, the more probable it is that the examinee has neurological impairment. A difference <4 is a normal score (17).

Wisconsin Card Sorting Test (WCST) WCST is a tool for recognising frontal cortical executive functions (planning – shifting – cognitive flexibility – sustained attention) (18). A computer-based test is used, in which 4 stimulus cards appear on the screen, with symbols differing in colour, shape, and number.

A fifth card is presented to the child, and the child is asked to match the card presented with one of the 4 stimulus cards and sort it under the most suitable stimulus card. The examiner declares if this match is right or wrong and accordingly the child keeps or changes his chosen strategy. Ten indices are chosen for assessment (total trials administered, total correct trials, total errors, percentage errors, trials to complete first category, failure to maintain set, percentage conceptual level response, learning to learn, categories completed, and percentage preservative). The test is normal if the number of categories completed >6 (18).

Statistical analysis IBM SPSS Statistics (V. 22.0, IBM Corp., USA, 2013) was used for data analysis. Data is expressed as mean & standard deviation (SD) for parametric values, median and interquartile range (IQR) or 25th–75th percentile for non-parametric quantitative values, and number and percentage for categorised values. The Student’s t-test was used for comparison between two independent mean groups for parametric data, and the Wilcoxon Rank Arch Endocrinol Metab. 2019;63/2

Sum test was used for non-parametric quantitative data.

The Chi-square test was used to study the association between each two variables or comparison between two independent groups as regards the categorized data.

Pearson and Spearman correlation tests were used to study the correlation between parametric and non-parametric data respectively. The probability of error at 0.05 was considered significant, and 0.01 highly significant.

RESULTS The study included 30 patients, 11 males (36.67%) and 19 females (63.33%). Genders were confirmed by karyotype. The mean (SD) age of the patients was 10.22 (3.17) years. There were 23 (76.67%) patients with SW CAH and 7 (23.33%) were SV. Twenty healthy ageand sex-matched children were included as controls, 8 males (40%) and 12 females (60%). The mean (SD) age of the controls was 11.01 (2.71) years. Most (66.7%, 20 patients) were from a middle SES, 26.7% (8 patients) were of high SES, and 6.6% (2 patients) of low SES. Seventy per cent of the controls (14 subjects) were of middle SES, 25% (5 subjects) were of high SES, and 5% (1 subject) of low SES. No significant difference in SES was found between both groups (p > 0.05).

Sexual ambiguity at birth was evident in 19 patients (63.33%). Positive family history of CAH was present in 14 patients (46.7%). Some background data of the patients are listed in Tables 1 and 2.

Patients performed worse than controls in verbal, performance, and total IQ categories of the WISC test (p < 0.05) (Table 3). This was also evident in the Table 1. Background data of patients Median (IQR) Age at diagnosis (years)

0.34 (0.9)

Duration of treatment (years)

9.33 (5.77)

Hydrocortisone dose mg/m2/day

10 (7.63)

Total hydrocortisone dose (mg)

3585 (49923.75)

Fludrocortisone dose mg/day

0.08 (0.05)

Table 2. Comparison of anthropometric parameters in patients and controls Patients (n = 30) Mean ± SD

Controls (n = 20) Mean ± SD

p

Weight SDS

1.23 ± 0.95

0.96 ± 0.92

0.337

Height SDS

0.53 ± 1.54

-0.21 ± 1.49

0.101

BMI SDS

1.46 ± 0.92

1.6 ± 0.58

0.522

Copyright© AE&M all rights reserved.

performance IQ: picture completion (perception of visual detail), picture arrangement (logical reasoning), block design (visual analysis), object assembly (part/whole construction), and coding (symbol manipulation). The test also measures the total IQ. This test is also a practical tests of the working memory.

Scoring is as follows: > 90 is normal, 90-70 borderline, and < 70 is borderline. VIQ and PIQ were interpreted as normal if > 7 in each subscale, abnormal if < 7 (16).

115

Cognitive functions in children with congenital adrenal hyperplasia

Benton Visual Retention test. Patients had significantly higher median difference between obtained and expected errors, and significantly lower obtained correct scores and higher expected error score (p < 0.05) (Table 4). In the Wisconsin Card Sorting Test, patients performed significantly worse compared to controls, with less correct trials, more errors, and more failed trials to complete the test categories (p < 0.05) (Table 5). When patients were classified according to their daily hydrocortisone doses (> 15, 1015, and < 10 mg/m2/day), regarding the dose that was taken at the time of assessment, there were no significant differences detected in age, age at diagnosis, duration of treatment, and SES between the three groups (p > 0.05). Height SDS, weight SDS, BMI SDS, and free testosterone level did not differ significantly (p > 0.05). The WISC test, Benton Test and WCST results also did not significantly differ (p > 0.05).

Table 3. Wechsler Intelligence Scale for Children (WISC) in patients and controls

VIQ

Patients n = 30 Median (25th – 75th)

Controls n = 20 Median (25th – 75th)

p

85.5 (80-92.5)

109 (99-115.3)

0.000

Verbal comprehension

9 (7.8-10)

11.5 (10-13.8)

0.000

Verbal arithmetic

7 (5-9)

10.5 (7.3-12)

0.000

Verbal similarities

6 (5-9)

10 (9-12)

0.000

Verbal digit span

5 (4-6)

9 (8-10)

0.000

80.5 (74-88.8)

105 (98.5-109)

0.000

Picture completion

7 (6-8)

10 (9-11)

0.000

Block design

6 (5-8)

9 (8-10)

PIQ

Patients n = 30 Median (25th – 75th)

Controls n = 20 Median (25th – 75th)

p

Trials administered

128 (128-128)

99 (83-104)

0.000

0.000

Total correct trials

58.5 (47.3-75.3)

73 (67-80.3)

0.007

72 (51.1-80.8)

19 (16-24)

0.000

56 (40-67)

19 (18-26)

0.000 0.000

6.5 (5-9)

11.5 (9-13)

0.000

82.5 (75.8-90.3)

106 (100.3-111.8)

0.000

% Error

VIQ: verbal intelligence quotient, PIQ: performance intelligence quotient, TIQ: total intelligence quotient.

Table 4. Benton Visual Retention Test in patients and controls

OCS

Copyright© AE&M all rights reserved.

ECS

10 (8-15)

39.5 (23.5-71.3)

10 (10-15)

40 (26.8-74)

10 (8-12)

0.000

33.5 (22.8-58)

10 (10-12)

0.000

Perseverative error

0.000

p

22.5 (7-24.3)

9 (8-12)

0.04

2 (1-4.3)

5.5 (4-7.8)

0.000

% Perseverative error

17.5 (6.8-19.3)

10 (9-12)

0.07

Conceptual level responses

37.5 (11.8-68.3)

64 (62-73.5)

% Conceptual level responses

29.5 (13.8-54.3)

75 (65-76)

4 (2-6)

5 (4-6.8)

0.07

1 (0-2)

0.109

OES

12.5 (8.8-16)

6.5 (3.5-10)

0.000

9 (6-12)

7 (4-8.8)

0.026

3.5 (2-6.3)

1 (1-2)

0.000

OCS: obtained correct score, ECS: expected correct score, DIFF1: difference between obtained and expected correct score, OES: obtained error score, EES: expected error score, DIFF2: difference between obtained and expected error score.

116

42.5 (27.5-81.8)

% Perseverative responses

Controls n = 20 Median (25th – 75th)

2 (0-2.3)

DIFF2

Perseverative responses

Patients n = 30 Median (25th – 75th)

DIFF1 EES

Table 5. Wisconsin Card Sorting Test (WCST) in patients and controls

Total error

Coding TIQ

Comparing patients and controls of the same SES showed that among those from high SES, patients had significantly worse PIQ and TIQ (p < 0.05). Patients from high SES showed worse results than controls of the same SES in the difference between the obtained correct and expected correct scores in the Benton Visual Retention Test (p < 0.05).

In the Wisconsin Card Sorting Test, patients of high SES did significantly worse in many aspects, which was particularly evident in the number of trials administered being highly significant among patients (p < 0.01), and the number of completed test categories. (p <0.05), (Table 6).

Among patients and controls of middle SES, the VIQ, PIQ, and TIQ were highly significantly worse among patients (p < 0.01). A highly significant difference was obtained between the obtained error and expected error score in the Benton Visual Retention Test showing worse performance among patients (p < 0.01). In the Wisconsin Card Sorting Test, patients performed worse than controls in many aspects with a highly significant difference in the number of trials administered, and in the number of completed test categories (p < 0.01), as well as a significant difference in the number of trials to complete test categories (p < 0.05), (Table 7). No significant differences existed in age or anthropometric data between patients and

% Perseverative error Non perseverative error

Categories completed Trials to complete category Failure to maintain set

2 (1-4)

6 (6-6)

17.5 (12-76.5)

13 (11-13)

1 (0-2)

0 (0-1)

0.001 0.000 0.000 0.004 0.056

Arch Endocrinol Metab. 2019;63/2

Cognitive functions in children with congenital adrenal hyperplasia

controls of high SES, or those of medium SES. We could not compare patients and controls of low SES due to the small sample size (2 and 1 respectively).

Table 6. Cognitive tests among patients and controls of high SES Patients n = 8 Median (25th – 75th)

Controls n = 5 Median (25th – 75th)

p

VIQ

96.5 (93-105.8)

104 (98.5-113)

0.163

PIQ

91.5 (81-98)

105 (99.5-109)

0.018

TIQ

93.5 (82-101.8)

106 (99.5-109.5)

0.048

The difference between expected and obtained error score (DIFF 2) of the Benton Retention Test showed a significant positive correlation with the total hydrocortisone dose in the patient group (r = 0.421, (p < 0.05) (Figure 1). Free testosterone did not significantly correlate with any of the performed tests (p > 0.05).

WISC

Benton Visual Retention Test

Linear regression 5.00

4.00

OCS

5.5 (1.8-6.8)

5 (3.5-6)

0.076

ECS

5.5 (3-7)

4 (4-6.5)

1

DIFF1

2 (1.3-3)

1 (0-1)

0.029

OES

7.5 (4.3-12.8)

9 (5-10.5)

0.712

EES

6.5 (5-10.8)

8 (5-8.5)

0.825

DIFF2

2.5 (1-4.5)

1 (1-2)

0.149

1.00

128 (115.3-128)

83 (76-101.5)

0.006

.00

4 (2.3-5.8)

6 (6-6)

0.017

DIFF

3.00

2.00

Wisconsin Card Sorting Test

Patients n = 20 Median (25th – 75th)

Controls n = 14 Median (25th – 75th)

p

VIQ

85 (80-89.3)

110.5 (99-1166.5)

0.000

PIQ

80 (74-87)

105 (99.5-109)

0.000

TIQ

81 (75.3-85.5)

106.5 (100.8-112.5)

0.000

WISC

Benton Visual Retention Test OCS

2 (1-3.75)

6.5 (3.8-8)

0.000

ECS

3 (2-5.8)

5 (4-8)

0.043

1 (0-2)

1 (0-2)

0.432

OES

14.5 (9-16)

6 (3-10)

0.000

EES

10.5 (6.3-12)

7 (3.8-8.3)

0.02

4 (2-7)

1.5 (0-2)

0.001

128 (128-128)

99 (83-104.3)

0.000

1.5 (0.3-3.5)

6 (6-6)

0.000

23.5 (13.3 – 116.3)

13 (11-14)

0.014

Wisconsin Card Sorting Test Trials administered Categories completed Trials to complete

VIQ: verbal intelligence quotient, PIQ: performance intelligence quotient, TIQ: total intelligence quotient. OCS: obtained correct score, ECS: expected correct score, DIFF1: difference between obtained and expected correct score, OES: obtained error score, EES: expected error score, DIFF2: difference between obtained and expected error score.

Arch Endocrinol Metab. 2019;63/2

0 00

.0

0 .0 00

00 12

0.

00

00 10

00

0.

00 80

00

00 60

0.

00

00

0.

40

Total HC dose mg

Figure 1. Correlation between Benton Visual Retention Test and Total HC dose (p < 0.05).

DISCUSSION This study is one of the few studies addressing cognitive functions in children and adolescents in CAH. The present study shows that young patients with CAH have intellectual disabilities as reflected by lower total, verbal, and performance IQ scores. Furthermore, we find that these patients have impairment in both the visual memory and cortical executive functions. To our knowledge, this is one of the first studies to use the Benton Visual Retention Test and the Wisconsin Card Sorting Test in this population of patients.

Although some of the patients’ scores fell within the normal ranges, they were still significantly lower than the scores obtained from healthy controls. There were no differences in SES between patients and controls sufficient to eliminate the effect of SES. Additionally, when patients and controls of the same SES were compared, patients still scored worse than controls.

The strong family history of CAH in patients was related the fact that our clinic is a tertiary referral centre where we treat patients and some of their siblings as well. However, only one child from each family was 117

Copyright© AE&M all rights reserved.

Table 7. Cognitive tests among patients and controls of medium SES

DIFF2

0

00

VIQ: verbal intelligence quotient, PIQ: performance intelligence quotient, TIQ: total intelligence quotient. OCS: obtained correct score, ECS: expected correct score, DIFF1: difference between obtained and expected correct score, OES: obtained error score, EES: expected error score, DIFF2: difference between obtained and expected error score.

DIFF1

.0

Categories completed

R2 Linear = 0.178

20

Trials administered

CopyrightŠ AE&M all rights reserved.

Cognitive functions in children with congenital adrenal hyperplasia

included in the study to avoid overrepresentation of the genetic and environmental contribution to cognition in our studied sample.

Previous studies looking at the cognitive and psychosocial characteristics of patients with CAH showed controversial results (3). It is worth noting that most of these studies were conducted on older groups of patients. It was previously suggested that patients with CAH may have higher IQ scores. But when such patients were compared with their nonaffected siblings, the difference in the IQ was not observed (19,20). The outdated tests used in these studies, the under-presentation of SW patients, overrepresentation of females, might all have been reasons for the observed results (8). More recent studies found lower IQ scores among patients with CAH (8,11,21).

Collaer and cols. previously demonstrated lower scores in tasks examining spatial perception and short term memory. However, their cohort had a similar IQ to the controls (21), whereas the total IQ score in our patients was significantly lower than controls. Reduced verbal performance, irrespective of sex, was previously reported in CAH children (11).

Various factors could explain this: reduced endogenous glucocorticoid production, disruption of the hypothalamo-pituitary-adrenal axis, subsequent excess CRH and ACTH could all be the reason (22).

Difficulties in adjusting glucocorticoid dose is another problem â&#x20AC;&#x201C; it was demonstrated recently that excess glucocorticoid treatment increased pro-apoptotic signals in hippocampal neurons (23). The hippocampus plays a pivotal role in learning and memory, has high concentration of corticosteroid receptors (24), and is liable to damage by excess glucocorticoids. Some adults with CAH showed hippocampal dysgenesis (25). A recent study in adolescents and adults with CAH showed impaired executive functions represented by defects in visual and visuospatial working memory (26). Another recent study in adults showed that the doses of glucocorticoids that are used for treatment of CAH can alter brain micro- and macrostructure with quantitative brain magnetic resonance imaging (MRI) changes of reduced volume in the right hippocampus, thalami, cerebellum and brain stem. The effects of glucocorticoid treatment also affected the brain choline content of the mesial temporal lobe. Their patients also demonstrated cognitive impairment in some domains, e.g. working memory (27).

118

In this study, the total hydrocortisone dose correlated positively with the Benton Visual Retention Test DIFF2 result. This could possibly point to the deleterious effect of higher hydrocortisone dose on visual memory. The higher the cumulative hydrocortisone dose in our patients, the greater the difference there was between their obtained errors in the test and what was expected for their age. Such a finding was not observed when patients were compared according to the mean daily hydrocortisone dose. A previous study demonstrated that acute glucocorticoid administration negatively affects the different components of working memory, including executive functions (28). The positive correlation found in our study between total hydrocortisone dose and the Benton score supports this. Browne and cols. demonstrated reduced working memory in children with CAH, but the Digit Span test was used in their study (11). The negative effects of corticosteroids on learning and memory have been suggested using variable tests (29-31). These findings may call for a re-examination of the prescribed glucocorticoid dose in children with CAH to minimise short term memory deficits, which may affect their learning abilities, while still maintaining control over the excess intermediary metabolites of the cortisol synthesis pathway. Research in adult rats demonstrated that both high and low doses of glucocorticoids impaired memory (32). The same can occur in patients with CAH who are subjected to over- and under-dosing (33). There has been less research exploring a potential relationship in humans between low glucocorticoid levels and memory functioning, although an inverted U-shaped relationship between glucocorticoids and human memory retrieval has been demonstrated (34).

Antenatal and early postnatal exposure to high androgen levels is another possible explanation. Excess androgen exposure starting in utero was suggested to adversely affect the maturation of cerebral hemispheres, and to cause learning difficulties (8). Enhanced spatial abilities were previously observed in females with CAH compared to normal males, and on the other hand, males with idiopathic hypogonatropic hypogonadism showed lower spatial abilities (35). In our study, free testosterone levels did not correlate with the total IQ in the WISC test or the DIFF-2 of the Benton test, neither with any other test domain. Thus we could not prove that postnatal exposure to high androgen levels in children with CAH affects cognitive functions or spatial cognition, unlike that demonstrated in previous Arch Endocrinol Metab. 2019;63/2

Cognitive functions in children with congenital adrenal hyperplasia

Arch Endocrinol Metab. 2019;63/2

functions. The cumulative hydrocortisone dose is the most significant contributing factor in this regard, with an effect that seems to start early. We believe that further studies are warranted on greater numbers of patients. Specific neuro-imaging techniques are helpful in this regard. Early intervention in children with cognitive deficits is crucial to prevent learning deficits later in childhood.

Funding: this research received no specific grant from any funding agency in the public, commercial, or not-for-profit sectors.

Disclosure: no potential conflict of interest relevant to this article was reported.

REFERENCES 1.

Bretones P, Riche B, Pichot E, David M, Roy P, Tardy V, et al.; French Collaborative CAH Growth Study Group. Growth curves for congenital adrenal hyperplasia from a national retrospective cohort.

J Pediatr Endocrinol Metab. 2016;29(12):1379-88.

2. Sparrow SS, Davis SM. Recent advances in the assessment of intelligence and cognition. J Child Psychol Psychiatry.

2000;41(1):117-31.

3. Berenbaum SA. Cognitive function in congenital adrenal hyperplasia. Endocrinol Metab Clin North Am. 2001;30(1):173-92.

4. Puts DA, McDaniel MA, Jordan CL, Breedlove SM. Spatial ability and prenatal androgens: meta-analyses of congenital adrenal hyperplasia and digit ratio (2D:4D) studies. Arch Sex Behav.

2008;37(1):100-11.

5. Somajni F, Sovera V, Albizzati A, Russo G, Peroni P, Seragni G, et al. Neuropsychological assessment in prepubertal patients with congenital adrenal hyperplasia: preliminary study. Minerva Pediatr. 2011;63(1):1-9.

6. Hines M, Fane BA, Pasterski VL, Mathews GA, Conway GS, Brook C. Spatial abilities following prenatal androgen abnormality: targeting and mental rotations performance in individuals with congenital adrenal hyperplasia. Psychoneuroendocrinology.

2003;28(8):1010-26.

7. Agoston AM, Gonzalez-Bolanos MT, Semrud-Clikeman M, Vanderburg N, Sarafoglou K. Executive functioning in children with congenital adrenal hyperplasia. J Investig Med. 2017;65(1):49-52.

8. Johannsen TH, Ripa CP, Reinisch JM, Schwartz M, Mortensen EL, Main KM. Impaired cognitive function in women with congenital adrenal hyperplasia. J Clin Endocrinol Metab. 2006;91(4):1376-81.

9. Malouf MA, Migeon CJ, Carson KA, Petrucci L, Wisniewski AB. Cognitive outcome in adult women affected by congenital adrenal hyperplasia due to 21-hydroxylasedeficiency Horm Res. 2006;65(3):142-50.

10. Mueller SC, Temple V, Oh E, VanRyzin C, Williams A, Cornwell B, et al. Early androgen exposure modulates spatial cognition in congenital adrenal hyperplasia (CAH). Psychoneuroendocrinology.

2008;33(7):973-80.

11. Browne WV, Hindmarsh PC, Pasterski V, Hughes IA, Acerini CL, Spencer D, et al. Working memory performance is reduced in children with congenital adrenal hyperplasia. Horm Behav.

2015;67:83-8.

12. Sempe M, Pedrong G, Roy-Ternot NP. Auxologie le methods et sequences. Theraplix, Paris; 1979.

119

CopyrightŠ AE&M all rights reserved.

studies (5), (10). This may be due to differences in study designs, or differences in the age and sex of the included patients in previous studies.

Our cohort of CAH patients were not diagnosed by neonatal screening as it was not applied on a wide scale at the time of their diagnosis, and neither of them received prenatal dexamethasone, so the results on cognition bear no relation to prenatal dexamethasone administration.

Hyponatraemia is one of the mechanisms that may be incriminated in worse cognitive performance (8).

We could not compare SW and SV patients due to the small number of the SV group. Some authors found that patients with salt-wasting CAH have lower overall cognitive ability than patients with the simple virilising form, but both groups were within the normal range (3). This finding was significant in women with CAH, but the effect was not present for the performance IQ (8). Conversely, adolescent and young adult SW females were found to perform better than SV females in mental rotation tasks, an effect that was not demonstrated in verbal fluency or perceptual speed. Furthermore, this enhanced performance was predicted by the severity of prenatal androgen exposure (36). Such controversies in this respect warrant further research.

The limitations of this study include the small sample size, which also hampered comparing salt wasters with simple virilisers. It would be useful to study the relation between hyponatraemia and cognitive performance in this specific group. This was also demonstrated in the worse performance in some of the cognitive tests in patients with a high socioeconomic status compared to controls, a finding which appears counterintuitive and contradictory to what is known in normal children. This effect of socioeconomic status on cognitive functions in children with CAH needs to be addressed in larger studies. One of the factors affecting cognition could be the severity of neonatal dehydration at first presentation, which is difficult to document in retrospect. Another limitation was the difficulty finding a larger comparison group, which is often a problem when assessing psychological problems in a young population with chronic illness. One cannot ignore the possible effect of the chronic illness itself on performance.

In conclusion, this study showed that impaired cognitive functions exist in children with CAH mainly in the forms of lower intellectual performance and worse visual memory as well as worse executive

Cognitive functions in children with congenital adrenal hyperplasia

13. Cole TJ, Freeman JV, Preece MA. Body mass index reference curves for the UK 1990. Arch Dis Child. 1995;73(1):25-9.

14. Fahmy SI, El-Sherbini AF. Determining simple parameters for social classifications for health research. Bull High Inst Publ Health.

1983;13(5):95-108.

15. Ahmed RA, Gielen UP. Psychology in the Arab countries. Menoufia, Egypt: Menoufia University Press; 1998.

16. Wechsler D. Manual for the Wechsler Intelligence Scale for Children (3rd ed.). New York: The Psychological Corporation; 1991.

17. Benton AL. Benton Visual Retention Test (5th ed.) San Antonio: The Psychological Corporation; 1992.

18. Heaton RK, Chelune GJ, Talley JL, Kay GG, Curtiss G. Wisconsin card sorting test manual: revised and expanded (WCST). Psychological Assessment Resources (PAR), Odessa; 1993.

19. McGuire LS, Omenn GS. Congenital adrenal hyperplasia. I. Family studies of IQ. Behav Genet. 1975;5:165-73.

20. Wenzel U, Schneider M, Zachmann M, Knorr-Murset G, Weber A, Prader A. Intelligence of patients with congenital adrenal hyperplasia due to 21- hydroxylase deficiency, their parents and unaffected siblings. Helv Paediatr Acta. 1978;33:11-16.

21. Collaer ML, Hindmarsh PC, Pasterski V, Fane BA, Hines M. Reduced short term memory in congenital adrenal hyperplasia (CAH) and its relationship to spatial and quantitative performance. Psychoneuroendocrinology. 2016;64:164-73.

26. Karlsson L, Gezelius A, Nordenström A, Hirvikoski T, Lajic S. Cognitive impairment in adolescents and adults with congenital adrenal hyperplasia. Clin Endocrinol (Oxf). 2017;87(6):651-9.

27. Webb EA, Elliott L, Carlin D, Wilson M, Hall K, Netherton J, et al.

Quantitative MRI brain in congenital adrenal hyperplasia: in vivo assessment of the cognitive and structural impact of steroid hormones. J Clin Endocrinol Metab. 2018;103(4):1330-341.

28. Vaz LJ, Pradella-Hallinan M, Bueno OF, Pompéia S. Acute glucocorticoid effects on the multicomponent model of working memory. Hum Psychopharmacol. 2011;26(7):477-87.

29. Lupien SJ, Wilkinson CW, Brière S, Ménard C, Ng Ying Kin NM, Nair NP. The modulatory effects of corticosteroids on cognition: studies in young human populations. Psychoneuroendocrinology. 2002;27(3):401-16.

30. Rimmele U, Besedovsky L, Lange T, Born J. Blocking mineralocorticoid receptors impairs, blocking glucocorticoid receptors enhances memory retrieval in humans. Neuropsychopharmacology. 2013;38(5):884-94.

31. van Ast VA, Cornelisse S, Marin MF, Ackermann S, Garfinkel SN, Abercrombie HC. Modulatory mechanisms of cortisol effects on emotional learning and memory: novel perspectives. Psychoneuroendocrinology. 2013;38(9):1874-82.

32. McEwen BS, Sapolsky RM. Stress and cognitive function. Curr Opin Neurobiol. 1995;5(2):205-16.

22. Jacobson L, Sapolsky R. The role of the hippocampus in feedback regulation of the hypothalamic-pituitary-adrenocortical axis. Endocr Rev1991;12:118-34.

33. Reisch N, Arlt W, Krone N. Health problems in congenital adrenal hyperplasia due to 21-hydroxylase deficiency. Horm Res Paediatr.

2011;76(2):73-85.

23. Kurek A, Kucharczyk M, Detka J, S&lusarczyk J, Trojan E, Głombik K, et al. Pro-apoptotic Action of Corticosterone in Hippocampal Organotypic Cultures. Neurotox Res. 2016;30(2):225-38.

34. Schilling TM, Kölsch M, Larra MF, Zech CM, Blumenthal TD, Frings C, et al. For whom the bell (curve) tolls: cortisol rapidly affects memory retrieval by an inverted U-shaped dose-response relationship. Psychoneuroendocrinology. 2013;38(9):1565-72.

24. McEwen BS, De Kloet ER, Rostene W. Adrenal steroid receptors and actions in the nervous system. Physiol Rev. 1986;66(4):1121-88.

35. Hier DB, Crowley JrWF. Spatial ability in androgen-deficient men.

N Engl J Med. 1982;306(20):1202-5.

36. Hampson E, Rovet JF. Spatial function in adolescents and young adults with congenital adrenal hyperplasia: clinical phenotype and implications for the androgen hypothesis. Psychoneuroendocrinology. 2015;54:60-70.

Copyright© AE&M all rights reserved.

25. Mnif MF, Kamoun M, Mnif F, Charfi N, Kallel N, Rekik N, et al. Brain magnetic resonance imaging findings in adult patients with congenital adrenal hyperplasia: Increased frequency of white matter impairment and temporal lobe structures dysgenesis. Indian J Endocrinol Metab. 2013;17(1):121-7.

120

Arch Endocrinol Metab. 2019;63/2

original article

Prediction of gestational diabetes mellitus in the first trimester: comparison of maternal fetuin-A, N-terminal proatrial natriuretic peptide, high-sensitivity C-reactive protein, and fasting glucose levels Hatice Kansu-Celik1, A. Seval Ozgu-Erdinc1, Burcu Kisa1, Rahime Bedir Findik1, Canan Yilmaz1, Yasemin Tasci1

ABSTRACT

University of Health Sciences, Zekai Tahir Burak Health Practice Research Center, Ankara, Turkey 1

Objective: We investigated the utility of maternal fetuin-A, N-terminal proatrial natriuretic peptide (pro-ANP), high-sensitivity C-reactive protein (hs-CRP), and fasting glucose levels at 11-14 gestation weeks for predicting pregnancies complicated by gestational diabetes mellitus (GDM). Subjects and methods: This prospective cohort study included 327 low-risk pregnant women who completed antenatal follow-up at a tertiary research hospital between January and April 2014. Maternal blood samples were collected between 11–14 gestational weeks in the first trimester of pregnancy and then stored at –80 °C until further analyses. During follow-up, 29 (8.8%) women developed GDM. The study population was compared 1:2 with age- and body mass index-matched pregnant women who did not develop GDM (n = 59). Fasting plasma glucose (FPG) levels and serum fetuin-A, pro-ANP, and hs-CRP levels were measured using automated immunoassay systems. Results: There was a significant negative correlation between fetuin-A and hs-CRP (CC = –0.21, p = 0.047) and a positive correlation between FPG and hs-CRP (CC = 0.251, p = 0.018). The areas under the receiver operating characteristic curve for diagnosing GDM were 0.337 (p = 0.013), 0.702 (p = 0.002), and 0.738 (p < 0.001) for fetuin-A, hs-CRP, and FPG, respectively. The optimal cut-off values were > 4.65, < 166, and > 88.5 mg/dL for maternal hs-CRP, fetuin-A, and FPG, respectively. Conclusion: Reduced fetuin-A, elevated hs-CRP, and FPG levels in women in the first trimester can be used for the early detection of GDM. Further research is needed before accepting these biomarkers as valid screening tests for GDM. Arch

Correspondence to: A. Seval Ozgu-Erdinc University of Health Sciences, Zekai Tahir Burak Health Practice Research Center Talatpasa Bulvari 06230 – Ankara, Turkey sevalerdinc@gmail.com Received on Apr/172018 Accepted on Feb/20/2019 DOI: 10.20945/2359-3997000000126

Endocrinol Metab. 2019;63(2):121-7

INTRODUCTION

F

etuin-A is a novel biomarker that is mainly excreted from liver and adipose tissue and is associated with insulin resistance and metabolic syndrome (1).

It increases insulin resistance by inhibiting the insulin receptor tyrosine kinase and by mediating toll-like receptor 4 signaling (2). Its secretion may differ in various disease states, and decreased levels of fetuin-A indicate its anti-inflammatory or protective effects as a negative acute-phase reactant (APR) (3). Sindhu and cols. demonstrated a negative correlation between plasma levels of fetuin-A and systemic inflammatory markers in patients with type 2 diabetes (4). Serum levels of fetuin-A increase mid-trimester in normal Arch Endocrinol Metab. 2019;63/2

pregnancies (5). Only three previous studies have analyzed the potential relationship between fetuin-A levels and parameters of insulin resistance through the pregnancies complicated by GDM and normal pregnancies in the second trimester (6-8).

Atrial natriuretic peptide (ANP) is a peptide hormone mainly secreted by the heart. Although its main function is the regulation of hemodynamic homeostasis, several studies have observed a relationship between plasma glucose, insulin, and ANP levels (9). ANP circulates mainly as a 28-amino acid polypeptide, 99-126 amino acids at the C-terminal end prohormone, pro-ANP (10).

A rapid increase in ANP levels occurs in response to acute hyperglycemia, and it is associated with poor glycemic 121

Copyright© AE&M all rights reserved.

Keywords Gestational diabetes; first trimester screening; fetuin-A; N-terminal peptide of proatrial natriuretic peptide; high sensitivity C-reactive protein; fasting plasma glucose

Copyright© AE&M all rights reserved.

First trimester GDM prediction; fetuin-A, CRP

control (11). Yuksel and cols. demonstrated that ANP levels are significantly reduced in patients with GDM beyond 26 weeks of gestation and negatively correlated with some parameters of insulin resistance (12).

High-sensitivity C-reactive protein (hs-CRP) is an inflammatory agent secreted by the liver. It may be correlated with obesity and insulin resistance (13).

Increased maternal levels of hs-CRP in the first trimester are linked to increased risk of developing GDM (14).

To the best of our knowledge, this is the first study to investigate the utility of fetuin-A and pro-ANP levels in the first trimester as biomarkers for predicting GDM. We identified biochemical markers (fetuin-A, pro-ANP, hs-CRP, and FPG) related to GDM in the Turkish population in the first trimester to predict subsequent development of GDM.

OGTT performed according to the criteria identified

by Carpenter and Coustan (FPG: 95 mg/dL, 1st h: 180 mg/dL, 2nd h: 155 mg/dL, 3rd h: 140 mg/dL) (16).

Healthy controls were defined as pregnant women with a negative 50 g GCT (1st h < 140 mg/dL). The control group was selected and recruited for the study using a simple random-sampling method, and 59 pregnant women who did not develop GDM were matched by age and BMI at a 1:2 ratio.

Venous blood samples for fetuin-A, pro-ANP, hs-CRP, and FPG were collected at the routine obstetric examination at 11-14 weeks of gestation.

Maternal blood samples were immediately centrifuged, and serum was separated and stored at –80 °C until use.

All of the laboratory measurements were performed simultaneously in the same laboratory by the same technician.

SUBJECTS AND METHODS

Biochemical assays

This prospective cohort study included pregnant women who attended their routine antenatal follow-up at 11 and 14 gestational weeks at the Zekai Tahir Burak Women’s and Research Hospital between January and April 2014. This study was conducted in accordance with the Declaration of Helsinki (15). The institutional review board (23# 26/12/2013) approved the study.

Exclusion criteria included age < 18 years or > 40 years, diagnosis of chronic disease before conception (diabetes, hypertension, thyroid dysfunction, uncontrolled endocrine illness, or abnormal renal function), FPG levels exceeding 126 mg/dL, or postprandial 2nd h glucose level or glucose challenge test (GCT) value exceeding 200 mg/dL at gestational weeks of 24-28, history of a positive glucose tolerance test in the first trimester, and having had a previous pregnancy. Medical history and demographic characteristics including age, parity, pre-pregnancy body mass index (BMI), and smoking were noted. Gestational age was estimated via ultrasonography results between 11 and 14 weeks of gestation. BMI was calculated as weight (kg)/height (m)2. Type of delivery, complications during gestation, and neonatal outcomes were recorded. All subjects underwent a two-step GDM screening between 24 and 28 weeks of gestation A positive 50 g GCT was defined as a glucose level of at least 140 mg/dL 1 h after the glucose challenge. In case of positive 50g GCT, 100 g oral glucose tolerance test (OGTT) was performed following 3 days of normal diet. GDM was diagnosed if there were two or more abnormal values on a 100g

Serum levels of fetuin-A and pro-ANP in separate samples were quantified using enzyme linked immunosorbent assay (ELISA) kits according to the manufacturer’s protocols (Cat.No:YHB1184Hu, Lot No: 20160901, and Cat.No:YHB2435Hu, Lot No: 20160901; YEHUA Biological Technology, Shanghai, China). These kits use ELISAs based on a biotin double antibody sandwich technology to assay fetuin-A and pro-ANP. The detection limits of the assays were between 10-4,000 mg/L and 5-2,000 μmol/L, respectively, and the intra- and inter-assay coefficients of variation were < 10 and < 12%, respectively.

Serum levels of glucose were measured using a Beckman AU5800 biochemistry auto-analyzer with the hexokinase method. The total coefficient of variation was < 2.0%, and the reference interval was 60-100 mg/dL. Serum levels of hs-CRP were measured using a Siemens BN ProSpec nephelometer. The intra- and inter-assay coefficients of variation were 4.0% and 4.6%, respectively. The reference interval was < 2.87 mg/L.

122

Statistical analyses To calculate statistical power, we accepted the GDM prevalence in our population as 5% and the effect size as 0.8 (17). The sample size calculation for this study population of 88 women with an allocation ratio of 2 and a two-tailed sample comparison with a 5% level of significance (alpha) had a power of 0.94. This sample size was sufficient to detect a 0.5 standard deviation difference in continuous variables given the same power Arch Endocrinol Metab. 2019;63/2

First trimester GDM prediction; fetuin-A, CRP

RESULTS During the study period, 350 healthy low-risk pregnant women at 11-14 gestational weeks met the inclusion criteria. A total of 23 patients were excluded due to loss to follow-up, not participating in GDM screening, or having a chronic disease before pregnancy. In the final analysis, a total of 327 women completed antenatal follow-up in our hospital, 29 of whom (8.8%) Arch Endocrinol Metab. 2019;63/2

developed GDM, and 59 healthy controls were ageand BMI-matched in a 1:2 ratio.

The demographic characteristics and obstetric and neonatal outcomes of the patients are shown in Table 1.

There was no statistically significant difference between groups in terms of age, gravidity, parity, pre-pregnancy BMI, smoking status, gestational age at delivery, type of delivery, birth weight, Apgar scores at first and fifth minute, and NICU requirement (p > 0.05).

Fetuin-A levels were significantly lower, and hs-CRP levels were significantly higher, in cases of complicated GDM compared to uncomplicated ones (154 [95% CI: 47-2777] ng/mL vs. 210 [44-1860] ng/mL, p = 0.013; and 7.95 [3.14–27.7] ng/mL vs. 4.63 [3.1124.2] ng/mL, p = 0.032, respectively). There was no statistically significant difference between groups in terms of pro-ANP levels (P < 0.05) (Table 2).

According to Spearman rank correlation analyses, there was a significant inverse correlation between fetuin-A and hs-CRP (CC = –0.93, p = 0.009), and a positive correlation between hs-CRP and FPG, but no correlation between fetuin-A and FPG levels (CC = –0.186, p = 0.083).

Table 1. Demographics, obstetric and neonatal outcomes Variable

GDM Group (n = 29)

Control groups (n = 59)

p

Age (years) (Mean ± SD)

29.96 ± 3.79

29.28 ± 3.69

0.121

Gravidity Median (Min-Max)

3 (1-8)

2 (1-5)

0.139

Parity (Mean ± SD) (Min-Max)

1 (0-3)

1 (0-3)

0.11

Pre-pregnancy BMI (Mean ± SD)

27.74 ± 2.14

27.41 ± 2.18

0.656

1 (34%)

6 (10%)

0.418

38.60 ± 1.82

38.96 ± 1.56

0.359 0.656

Smoking n (%) Gestational age at delivery (week) (Mean ± SD) Mode of delivery n (%)

Vaginally

22 (76%)

47 (80%)

C-section

7 (24%)

12 (20%)

3391 ± 455

3372 ± 409

1th min

8 (6-9)

8 (6-9)

0.321

5th min

10 (8-10)

10 (8-10)

0.234

NICU (n,%)

3 (10%)

5 (8.4%)

0.115

Birthweight (g) (Mean ± SD) Apgar scores Median (Min-Max)

0.85

*p < 0.05: significant; BMI: body mass index; NICU: requirement of neonatal intensive care unit.

123

Copyright© AE&M all rights reserved.

and significance level. Sample size calculations were performed using the G*Power v.3.1.5 general power analysis program (18).

The mean and standard deviation (SD) were calculated for continuous variables, and categorical variables are expressed as numbers and percentages.

Chi-square tests or Fisher’s exact tests were used to compare categorical variables. The normality of variables was analyzed using the Kolmogorov-Smirnov test. Independent sample t-tests were used to compare continuous variables with normal distribution. The Mann–Whitney U test was used to analyze nonnormally distributed data. Correlation analyses were done using Spearman’s coefficient. Pearson’s test was performed when necessary. The accuracy of each test was evaluated separately, and a multiple binary logistic regression model was generated to identify variables that were significantly associated with the outcome of interest. For multivariate analyses, possible factors identified in univariate analyses were further analyzed by binary logistic regression to determine independent predictors of GDM in the first trimester of pregnancy.

The Hosmer–Lemeshow goodness of fit statistic was used to assess model fit. A 5% type-1 error level was used to infer statistical significance. The sensitivity, specificity, positive predictive value (PPV), negative predictive value (NPV), positive likelihood ratio (PLR), negative likelihood ratio (NLR), and diagnostic odds ratio (OR) with their associated 95% confidence intervals (CIs) were determined for each method. The detection and false-positive rates in the prediction of GDM were estimated using receiver operating characteristic (ROC) curves, and the diagnostic power of these screening tests to predict GDM in early pregnancy was assessed by comparing the areas under the ROC curve (AUROCs).

Youden’s index was used to select the cut-off value for diagnosis of GDM for each test (19). A two-tailed p-value < 0.05 was considered statistically significant.

The statistical software package IBM SPSS 21.0 (IBM Corp., Armonk, NY, USA) was used for data analyses.

First trimester GDM prediction; fetuin-A, CRP

Table 2. Maternal fetuin-A, pro-ANP, and hs-CRP levels between two groups

Fetuin-a (ng/mL)

GDM Group (n = 29)

Control groups (n = 59)

p

154 (47-2777)

210 (44-1860)

0.013*

Pro-ANP (mg/dL)

694 (461-4957)

721 (484-4551)

0.144

Hs-CRP (ng/mL)

8.89 (3.14-27.7)

4.63 (3.11-24.2)

0.003*

92.93 ± 7.84

85.79 ± 8.17

<0.001*

FPG (mg/dL)

*p < 0.05, significant. BMI: body mass index; Pro-ANP: N-terminal peptide of proatrial natriuretic peptide; hs-CRP: high sensitive C-reactive protein; FPG: fasting plasma glucose.

The area under ROC curves of fetuin-A, hs-CRP, and FPG for diagnosing GDM were 0.337 (95% CI: 0.212--0.461, p = 0.013), 0.702 (95% CI: 0.5920.812, p = 0.002), and 0.738 (95% CI: 0.626-0.850, p < 0.001), respectively (Figure 1). Table 3 shows the different measurements of diagnostic accuracy of FPG, hs-CRP, and fetuin-A. Maternal hs-CRP levels above 4.65 ng/mL had the highest sensitivity (86.21%, 95% C1: 67.43-95.49), NPV (88.24%, 95% CI: 71.61– 96.16), and PLR (61.36%, 95% CI: 50.35-71.38), with a diagnostic accuracy of 88.64%. Fetuin-A levels below 166 ng/mL had the highest specificity (76.27%, 95% CI: 63.11-85.98), NLR (64.77, 95% CI: 53.7974.45), and PPV (54.84%, 95% CI: 36.3-72.22) with a diagnostic accuracy of 70.45%. FPG levels above 88.5 mg/dL had a sensitivity of 79.31% (95% C1: 59.74-91.29), specificity of 59.32% (95% CI: 45.7671.67), and the PPV and NPV were 48.94% (95% CI: 34.3-63.74) and 85.37% (95% CI: 70.14-93.91), respectively, with a diagnostic accuracy of 85.23%.

DISCUSSION We evaluated the diagnostic value of first trimester fetuin-A, pro-ANP, and hs-CRP levels in predicting GDM. Low levels of fetuin-A and high levels of hs-CRP at 11 to 14 weeks of gestation were associated

0.8

0.6 Sensitivity

Variable

ROC Curve

1.0

0.4

0.2

0.0 0.0

0.2

0.4

0.6

0.8

1.0

1- Specificity Diagonal segments are produced by ties Source of the curve fetuin-A hs-CRP

FPG

Reference line

Figure 1. Area under receiver operating characteristic (ROC) curves for FPG, fetuin-A and hs-CRP in predicting GDM.

with GDM later in pregnancy. In addition, there was an inverse correlation between fetuin-A and hs-CRP levels.

GDM affects 8%-18% of all pregnancies, and with impaired glucose tolerance first recognized during the second or third trimester of pregnancy, it is a main cause of maternal and neonatal morbidity and mortality (20). The cornerstone of management is glycemic control, and poor control during pregnancy has been associated with miscarriage, preterm birth, stillbirth, macrosomia, urinary tract infection, polyhydramnios, shoulder dystocia, operative delivery, neonatal hyperbilirubinemia-hypocalcemia, and increased NICU admission (21).

Copyright© AE&M all rights reserved.

Table 3. Diagnostic performances of first trimester FPG, hs-CRP and fetuin-A FPG

hs-CRP

fetuin-A

Sensitivity (%) and 95 CI (%)

79.31 (59.74-91.29)

86.21 (67.43-95.49)

58.62 (39.13-75.91)

Specificity (%) and 95 CI (%)

59.32 (45.76-71.67)

50.85 (37.64-63.95

76.27 (63.11-85.98)

Positive Likelihood Ratio and 95 CI (%)

53.41 (42.51-64.01)

61.36 (50.35-71.38)

35.23 (25.55-46.21)

Negative Likelihood Ratio and 95 CI (%)

46.59 (35.99-57.49)

38.64 (28.62-49.65)

64.77 (53.79-74.45)

Positive Predictive Value (%) and 95 CI (%)

48.94 (34.3-63.74)

46.3 (32.84-60.27)

54.84 (36.3-72.22)

Negative Predictive Value (%) and 95 CI (%)

85.37 (70.14-93.91)

88.24 (71.61-96.16)

78.95 (65.75-88.2)

5.59 (1.98-15.78)

6.47 (2.0-20.88)

4.55 (1.76-11.8)

85.23

88.64

70.45

Diagnostic Odds Ratio and 95 CI (%) Diagnostic Accuracy (%)

124

Arch Endocrinol Metab. 2019;63/2

Therefore, some first-trimester markers may help to predict this complication and improve the management of such cases (22-24). Recent studies have found changes in the expression of fetuin-A, pro-ANP, and hs-CRP in pregnant women with GDM (12,14,25,26).

Fetuin-A, a member of the cystatin superfamily of protease inhibitors, is secreted by the liver in adults and by various fetal tissues (27). It is associated with insulin resistance and metabolic syndrome. It binds to the β-subunit of the insulin receptor, thus activating insulin receptor kinase (2). Some studies have reported high concentrations of fetuin-A in patients with type 2 DM, and others have reported low concentrations (25,28,29); therefore, the results have been conflicting and limited. Farhan and cols. observed no differences in fetuin-A levels in the third trimester of pregnancy and in the postpartum period in a group of GDM patients (6), whereas Kalabay and cols. and Iyidir and cols. found increased levels of fetuin-A in women with GDM compared to healthy pregnant women at 20-40 gestational weeks, and between 24-28 gestational weeks, respectively (7,8). In healthy individuals, fetuin-A concentrations range from 450 to 600 Οg/mL (30).

In Kalabay and cols., fetuin-A concentrations increased with gestational age in healthy pregnant women, but interval values during the pregnancy period were not clearly reported by the authors (7). Iyidir and cols. observed a mean level of 35 ng/dL in a GDM group at gestational weeks 24 and 28 (8). In Briana and cols., the mean concentration in healthy pregnant women during the first stage of labor or before elective C-section was 43 ng/dL (31). To the best of our knowledge, there are no data evaluating the utility of maternal fetuin-A levels at 11-14 weeks of gestation for predicting GDM. In the current study, we found that fetuin-A levels were significantly lower in women with GDM than in healthy pregnant women. Low levels of fetuin-A can be explained by several possible mechanisms. Some studies have reported that low concentrations of fetuin-A are related to inflammation and vascular calcifications, whereas high levels are associated with dyslipidemia and metabolic syndrome (1). Subclinical inflammation in the early period of pregnancy may lead to a decrease in fetuin-A levels due to its protective effects as an APR (3). In addition, the first trimester of pregnancy is known as the insulin-sensitive period. Catalano and cols. reported that insulin resistance progressively increases during the second trimester of pregnancy (32). We found no correlation between fetuin-A levels Arch Endocrinol Metab. 2019;63/2

and FPG, although FPG was significantly higher in patients who subsequently developed GDM. Future longitudinal studies showing changes in fetuin-A levels over time in women developing GDM are needed.

Recent cross-sectional studies have demonstrated an inverse correlation between ANP and metabolic syndrome, insulin resistance, and FPG. Magnusson and cols. demonstrated that low ANP concentrations predict later development of diabetes, and suggested that ANP deficiency may have a pivotal role in diabetes development (33). Yuksel and cols. demonstrated that ANP levels were significantly lower in patients with GDM beyond 26 weeks of gestation and negatively correlated with some parameters of insulin resistance (12). This may be because low levels of ANP may become evident due to either increased clearance or decreased cardiac production of ANP in subsequent gestational weeks (34). In our study, pro-ANP levels were lower in women with GDM than in healthy pregnant women, but the difference was not statistically significant. A progressive decline in ANP may lead to insulin resistance in the second trimester.

GDM is associated with both short- and long-term risks for mothers and fetuses during pregnancy and postpartum (35). Many validated prediction models are being developed to recognize GMD and intervene in the early weeks of pregnancy (35,36). Among these markers, hs-CRP levels in the first trimester are linked to an increased risk of developing GDM, with high specificity and diagnostic odds ratio (14,37). High hsCRP values are indicative of increased inflammation at baseline, which is also an independent risk factor for developing GDM (37). Consistent with previous studies, we demonstrated a positive association between hs-CRP levels and GDM prediction. On the other hand, hs-CRP is a positive APR. We found that levels of fetuin-A, a negative APR, were significantly lower in women with GDM than in healthy pregnant women.

Previous studies have documented that fetuin-A levels are inversely correlated with CRP levels in serum (38).

Our findings are consistent with the literature. We also demonstrated that hs-CRP has better diagnostic accuracy for GDM than fetuin-A and FPG (88.64 vs.

70.45 and 85.23%, respectively).

Similar to previous studies, we detected higher first trimester FPG levels among women who subsequently developed GDM. Riskin-Mashiah and cols. and OzguErdinc and cols. reported FPG cut-off values of 8085 mg/dL (75-55% sensitivity and 52-75% specificity) 125

CopyrightŠ AE&M all rights reserved.

First trimester GDM prediction; fetuin-A, CRP

First trimester GDM prediction; fetuin-A, CRP

and 90 mg/dL (55.1% sensitivity and 71% specificity), respectively for predicting GDM (14,39). We found a similar result of 88.5 mg/dL, with 79.3% sensitivity and 59.3% specificity. FPG has a test validity comparable to that of hs-CRP but is much easier and less costly to determine. Thus, for clinicians, this is the most valuable and helpful result of our study.

In the management of GDM, treatment modalities aimed to improve insulin sensitivity may be useful.

Controlling weight gain during pregnancy reduces the incidence of GDM in pregnant women (40). Exercise improves glycemic control, and exercising both prior to and during pregnancy has the greatest correlation with protection against GDM development. Changes in diet, exercise, and achieving desirable gestational weight gain should be encouraged to improve insulin sensitivity (40).

We did not include non-pregnant individuals as a control group. This is a limitation for our study.

Despite this, our study is the first trial investigating the circulating fetuin-A and pro-ANP levels in the first trimester of pregnancy, and our results provide important information on the associations between fetuin-A, hsCRP, and FPG and subsequent development of GDM. Elevated hs-CRP and FPG and reduced fetuin-A levels (compared to levels in uncomplicated pregnancies) at 11 to 14 weeks of gestation are associated with subsequent development of GDM. Thus, these markers may be useful for early detection and intervention in GDM. However, further studies with larger sample sizes are needed before accepting these markers as valid screening tests for GDM. Acknowledgments: none.

Funding statement: none.

Disclosure: no potential conflict of interest relevant to this article was reported.

Copyright© AE&M all rights reserved.

REFERENCES

modulating cardiovascular and glycemic outcomes in metabolic syndrome. Endocr Pract. 2014;20(12):1345-51.

4. Sindhu S, Akhter N, Shenouda S, Wilson A, Ahmad R. Plasma fetuin-A/α2-HS-glycoprotein correlates negatively with inflammatory cytokines, chemokines and activation biomarkers in individuals with type-2 diabetes. BMC Immunol. 2016;17(1):33.

5. Chaemsaithong P, Romero R, Tarca AL, Korzeniewski SJ, Schwartz AG, Miranda J, et al. Maternal plasma fetuin-A concentration is lower in patients who subsequently developed preterm preeclampsia than in uncomplicated pregnancy: a longitudinal study. J Matern Fetal Neonatal Med. 2015;28(11):1260-9.

6.

Farhan S, Handisurya A,Todoric J,Tura A, Pacini G, Wagner O, et al.

Fetuin-A Characteristics during and after Pregnancy: Result from a Case Control Pilot Study. Int J Endocrinol. 2012;2012:896736.

7. Kalabay L, Cseh K, Pajor A, Baranyi E, Csákány GM, Melczer Z, et al. Correlation of maternal serum fetuin/alpha2-HSglycoprotein concentration with maternal insulin resistance and anthropometric parameters of neonates in normal pregnancy and gestational diabetes. Eur J Endocrinol. 2002;147(2):243-8.

8. Iyidir OT, Degertekin CK, Yilmaz BA, Altinova AE, Toruner FB, Bozkurt N, et al. Serum levels of fetuin A are increased in women with gestational diabetes mellitus. Arch Gynecol Obstet.

2015;291(4):933-7.

9. Schlueter N, de Sterke A, Willmes DM, Spranger J, Jordan J, Birkenfeld AL. Metabolic actions of natriuretic peptides and therapeutic potential in the metabolic syndrome. Pharmacol Ther.

2014;144(1):12-27.

10. Espiner EA, Richards AM, Yandle TG, Nicholls MG. Natriuretic hormones. Endocrinol Metab Clin North Am. 1995;24(3):481-509.

11. McKenna K, Smith D, Tormey W, Thompson CJ. Acute hyperglycaemia causes elevation in plasma atrial natriuretic peptide concentrations in Type 1 diabetes mellitus. Diabet Med. 2000;17(7):512-7.

12. Yuksel MA, Alici Davutoglu E, Temel Yuksel I, Kucur M, Ekmekci H, Balci Ekmekci O, et al. Maternal serum atrial natriuretic peptide (ANP) and brain-type natriuretic peptide (BNP) levels in gestational diabetes mellitus. J Matern Fetal Neonatal Med. 2016;29(15):2527-30.

13. Dali-Youcef N, Mecili M, Ricci R, Andrès E. Metabolic inflammation: connecting obesity and insulin resistance. Ann Med. 2013;45(3):242-53.

14. Ozgu-Erdinc AS, Yilmaz S, Yeral MI, Seckin KD, Erkaya S, Danisman AN. Prediction of gestational diabetes mellitus in the first trimester: comparison of C-reactive protein, fasting plasma glucose, insulin and insulin sensitivity indices. J Matern Fetal Neonatal Med. 2015;28(16):1957-62.

15. World Medical A. World Medical Association Declaration of Helsinki: ethical principles for medical research involving human subjects. JAMA. 2013;310:2191-4.

16. Coustan DR. Screening and testing for gestational diabetes mellitus. Obstet Gynecol Clin North Am . 1996;23(1):125-36.

17. Satman I, Omer B, Tutuncu Y, Kalaca S, Gedik S, Dinccag N, et al.; TURDEP-II Study Group. Twelve-year trends in the prevalence and risk factors of diabetes and prediabetes in Turkish adults. Eur J Epidemiol. 2013;28(2):169-80.

1. Ix JH, Shlipak MG, Brandenburg VM, Ali S, Ketteler M, Whooley MA. Association between human fetuin-A and the metabolic syndrome: data from the Heart and Soul Study. Circulation.

2006;113(14):1760-7.

18. Faul F, Erdfelder E, Lang AG, Buchner A. G*Power 3: a flexible statistical power analysis program for the social, behavioral, and biomedical sciences. Behav Res Methods. 2007;39(2):175-91.

2. Pal D, Dasgupta S, Kundu R, Maitra S, Das G, Mukhopadhyay S, et al. Fetuin-A acts as an endogenous ligand of TLR4 to promote lipid-induced insulin resistance. Nat Med. 2012;18(8):1279-85.

20. Oriot P, Radikov J, Gilleman U, Loumaye R, Ryckoort V, Debue E, et al. Gestational diabetes mellitus screening according to Carpenter-Coustan and IADPSG criteria: A 7-year follow-up of prevalence, treatment and neonatal complications at a Belgian general hospital. Diabetes Metab. 2018;44(3):309-12.

3.

126

Mukhopadhyay S, Mondal SA, Kumar M, Dutta D. Proinflammatory and antiinflammatory attributes of fetuin-a: a novel hepatokine

19. Youden WJ. Index for rating diagnostic tests. Cancer. 1950;3:32-5.

Arch Endocrinol Metab. 2019;63/2

First trimester GDM prediction; fetuin-A, CRP

21. Buhary BM, Almohareb O, Aljohani N, Alzahrani SH, Elkaissi S, Sherbeeni S, et al. Glycemic control and pregnancy outcomes in patients with diabetes in pregnancy: A retrospective study. Indian J Endocrinol Metab. 2016;20(4):481-90.

22. Yeral MI, Ozgu-Erdinc AS, Uygur D, Seckin KD, Karsli MF, Danisman AN. Prediction of gestational diabetes mellitus in the first trimester, comparison of fasting plasma glucose, two-step and one-step methods: a prospective randomized controlled trial.

Endocrine. 2014;46(3):512-8.

23. Yerebasmaz N, Aldemir O, Asıltürk SÇ, et al. Is HbA1c Predictive for Screening and Diagnosis of Gestational Diabetes Mellitus?

Gynecol Obstet Reprod Med. 2014;20:88-91.

24. Yılmaz ZV, Yılmaz E, I-çer B, et al. Association of Complete Blood Count Parameters with Gestational Diabetes Mellitus. Gynecol Obstet Reprod Med. 2017;23:65-9.

25. Ou HY, Yang YC, Wu HT, Wu JS, Lu FH, Chang CJ. Serum fetuin-A concentrations are elevated in subjects with impaired glucose tolerance and newly diagnosed type 2 diabetes. Clin Endocrinol (Oxf). 2011;75(4):450-5.

26. Aramesh MR, Dehdashtian M, Malekian A, ShahAli S, Shojaei K. Relation between fetal anthropometric parameters and cord blood adiponectin and high-sensitivity C-reactive protein in gestational diabetes mellitus. Arch Endocrinol Metab. 2017;61(3):228-32.

27. Mori K, Emoto M, Inaba M. Fetuin-A: a multifunctional protein.

Recent Pat Endocr Metab Immune Drug Discov. 2011;5(2): 124-46.

literature. Biomed Pap Med Fac Univ Palacky Olomouc Czech Repub. 2015;159(3):352-9.

31. Briana DD, Boutsikou M, Gourgiotis D, Boutsikou T, Baka S, Marmarinos A, et al. Serum fetuin-A/alpha2-HS-glycoprotein in human pregnancies with normal and restricted fetal growth. J Matern Fetal Neonatal Med. 2008;21(11):826-30.

32. Catalano PM, Tyzbir ED, Roman NM, Amini SB, Sims EA. Longitudinal changes in insulin release and insulin resistance in nonobese pregnant women. Am J Obstet Gynecol. 1991;165(6 Pt 1):1667-72.

33. Magnusson M, Jujic A, Hedblad B, Engström G, Persson M, Struck J, et al. Low plasma level of atrial natriuretic peptide predicts development of diabetes: the prospective Malmo Diet and Cancer study. J Clin Endocrinol Metab. 2012;97(2):638-45.

34. Dessì-Fulgheri P, Sarzani R, Tamburrini P, Moraca A, Espinosa E, Cola G, et al. Plasma atrial natriuretic peptide and natriuretic peptide receptor gene expression in adipose tissue of normotensive and hypertensive obese patients. J Hypertens. 1997;15(12 Pt 2):1695-9.

35. Benhalima K, Devlieger R, Van Assche A. Screening and management of gestational diabetes. Best Pract Res Clin Obstet Gynaecol. 2015;29(3):339-49.

36. Zhang Y, Lu S, Li R. Association between Maternal Serum Concentrations of Angiopoietin-like Protein 2 in Early Pregnancy and Subsequent Risk of Gestational Diabetes Mellitus. Chin Med J (Engl). 2016;129:2308-12.

37. Powe CE. Early pregnancy biochemical predictors of gestational diabetes mellitus. Curr Diab Rep. 2017;17:12.

38. Chen HY, Chiu YL, Hsu SP, Pai MF, Lai CF, Peng YS, et al. Association of serum fetuin A with truncal obesity and dyslipidemia in nondiabetic hemodialysis patients. Eur J Endocrinol. 2009;160(5): 777-83.

29. Gunduz FO, Yildirmak ST, Temizel M, Faki Y, Cakmak M, Durmuscan M, et al. Serum visfatin and fetuin-a levels and glycemic control in patients with obese type 2 diabetes mellitus. Diabetes Metab J. 2011;35(5):523-8.

39. Riskin-Mashiah S, Damti A, Younes G, Auslender R. First trimester fasting hyperglycemia as a predictor for the development of gestational diabetes mellitus. Eur J Obstet Gynecol Reprod Biol.

2010;152(2):163-7.

30. Dabrowska AM, Tarach JS, Wojtysiak-Duma B, Duma D. Fetuin-A (AHSG) and its usefulness in clinical practice. Review of the

40. Gavard JA, Artal R. Effect of exercise on pregnancy outcome. Clin Obstet Gynecol. 2008;51:467-80.

Copyright© AE&M all rights reserved.

28. Zhou Z, Ju H, Sun M, Chen H, Ji H, Jiang D, et al. Serum fetuin-A concentrations are positively associated with serum VEGF levels in patients with newly diagnosed type 2 diabetes. Endocr J. 2015;62(10):879-85.

Arch Endocrinol Metab. 2019;63/2

127

original article

Could semiquantitative analysis of real-time ultrasound elastography distinguish more liver parenchyma alterations of nonalcoholic fatty liver disease in patients with polycystic ovary syndrome?

Na Di1,2, Xinchuan Zhou1, Yaxiao Chen2, Xiaomiao Zhao2, Lin Li2, Linlin Jiang2, Baoming Luo1, Xiaoli Chen2, Dongzi Yang2

ABSTRACT Department of Ultrasound, Sun Yat-sen Memorial Hospital of Sun Yat-sen University, Guangzhou, China 2 Department of Obstetrics and Gynecology, Sun Yat-sen Memorial Hospital of Sun Yat-sen University, Guangzhou, China 1

Correspondence to: Dongzi Yang Department of Obstetrics and Gynecology, Sun Yat-sen Memorial Hospital of Sun Yat-sen University West Yanjiang Road 107, Guangzhou, China yangdz@mail.sysu.edu.cn Received on Oct/24/2018 Accepted on Dec/12/2018 DOI: 10.20945/2359-3997000000119

Objective: Nonalcoholic fatty liver disease is the commonest diffuse liver disease, of which women with polycystic ovary syndrome are at an increased risk. The aim of the present study was to assess the diagnostic value of the semiquantitative strain parameters of real-time ultrasound elastography for nonalcoholic fatty liver disease in patients with polycystic ovary syndrome. Subjects and methods: Thirty-five polycystic ovary syndrome patients with nonalcoholic fatty liver disease, 70 polycystic ovary syndrome patients without nonalcoholic fatty liver disease, and 70 healthy female controls of reproductive age were included. All participants underwent ultrasonic examination and semiquantitative analysis of real-time ultrasound elastography of the liver. Results: Main semi quantitative strain parameters, such as average strain value, differed significantly among groups polycystic ovary syndrome with nonalcoholic fatty liver disease, polycystic ovary syndrome without nonalcoholic fatty liver disease, and control (87.02 ± 10.16 vs. 96.31 ± 11.44 vs. 104.49 ± 7.28, p < 0.001). Clinical and laboratory parameters differed significantly between the two subgroups with low or high average strain value. For diagnostic value of average strain value for elevated aminotransferase, the area under the curve was 0.808 (range 0.721-0.895). In multiple linear regression analysis, polycystic ovary syndrome, waist circumference, and metabolic syndrome were stand-alone independent factors associated with average strain value among subjects without nonalcoholic fatty liver disease. Conclusion: Semiquantitative real-time ultrasound elastography analysis could distinguish liver parenchyma alterations in patients with polycystic ovary syndrome more sensitively. The diagnostic value of the proposed method for nonalcoholic fatty liver disease need further research. Arch Endocrinol Metab. 2019;63(2):128-36 Keywords Polycystic ovary syndrome; nonalcoholic fatty liver disease; real-time ultrasound elastography; semiquantitative analysis; metabolic disturbances

INTRODUCTION

Copyright© AE&M all rights reserved.

N

onalcoholic fatty liver disease (NAFLD) is the commonest diffuse liver disease, comprising the spectrum of liver damage from simple hepatic steatosis to nonalcoholic steatohepatitis to advanced fibrosis and cirrhosis, in patients without significant alcohol consumption and any other cause of liver diseases. The worldwide prevalence of NAFLD, which is 5%-58% in the general population, has increased over time and has become a major public health problem (1). In the Chinese population from Hong Kong, the prevalence of NAFLD is as high as 42% according to a 2015 128

report (2). NAFLD is also used as a marker of severe metabolic disorders.

Polycystic ovary syndrome (PCOS) is the most common endocrine disorder among women of reproductive age, and the prevalence varies from 5% to 20% (1,3). It is also a metabolic disease according to high prevalence of the accompanying metabolic disturbances, which may pose a high long-term risk of cardiovascular diseases for patients with PCOS (4).

Women with PCOS are at an increased risk of NAFLD as reported previously: the prevalence of NAFLD varies from 23.8% to 86.79% among women with PCOS Arch Endocrinol Metab. 2019;63/2

Real-time ultrasound elastography for nonalcoholic fatty liver disease in PCOS patients

SUBJECTS AND METHODS Sample size estimate No previous study had reported the efficacy of RTE in diagnose of NAFLD in patients with PCOS. According to report about RTE for assessment of liver fibrosis in chronic hepatitis B (18), a sample size of 5 in each group has a power of 0.949 at 5% significance to detect a difference of 6.39 in the value of MEAN between cases and controls calculated by PASS 11(NCSS LLC, Arch Endocrinol Metab. 2019;63/2

USA). We recruited more than 5 participants for each group. A total of 35 PCOS patients with NAFLD, 70 PCOS patients without NAFLD, and 70 healthy female controls aged 20 to 40 years were recruited in our Hospital from May 27, 2015, to November 31, 2015.

Patients and controls The study was approved by the Institutional Review Board of our Hospital. All participants provided written informed consent. The Chinese Clinical Trial Registry (http://www.chictr.org/en/) number is ChiCTROOC-15006452. Detailed data on all participates were deposited in the Research Electronic Data Capture (REDCap) databases.

PCOS was diagnosed according to the Rotterdam 2003 criteria (19), two of the following three criteria had to be met: 1) oligomenorrhea and/or anovulation, 2) clinical and/or biochemical hyperandrogenism, 3) polycystic ovaries (PCO) (presence in each ovary of 12 or more follicles measuring 2 to 9 mm in diameter and/or increased ovarian volume: more than 10 mL).

NAFLD was diagnosed according to conventional criteria (conventional ultrasonography) (20). Controls were defined as healthy non pregnant, amenorrheic women without endocrine disorders, PCO, and NAFLD. Women were excluded from the study if they had a medical history that included other known liver diseases, ovarian surgery, a malignant tumor, tobacco smoking, and alcohol drinking, other endocrine diseases, or a severe cardiocerebrovascular disease or if they were taking medication that may affect metabolism, blood pressure, or liver function during the last 3 months.

Bioclinical tests The medical history including menstrual regularity, medications, and past diseases was recorded. All anthropometric data were measured and recorded including waist circumference (WC), hip circumference (HC), waistline/hipline ratio (WHR), body mass index (BMI), acne score, modified Ferriman-Gallwey score (mFG) for body hair evaluation, systolic blood pressure (SBP), and diastolic blood pressure (DBP).

Basal follicle-stimulating hormone (FSH), luteinizing hormone (LH), prolactin (PRL), estradiol (E2), and total testosterone (TT) were quantified by chemiluminesce Immunoassay on an automatic biochemistry analyzer (DXI800, Beckman COULTER, Inc. USA) during the early follicular 129

CopyrightŠ AE&M all rights reserved.

(5,6). Accordingly, it has been suggested that women with PCOS should be screened for liver disease more actively (7).

Although a liver biopsy is still considered the gold standard for detection of a liver disease such as fibrosis, this procedure is invasive and is associated with possible problems such as bleeding and severe pain, sampling errors, and interobserver variability (8).

Computed tomography (CT) or magnetic resonance imaging (MRI) can quantify liver fat, but CT involves ionizing radiation, and both methods are costly (9).

Conventional ultrasonography has been used for detection of NAFLD in daily practice, but its accuracy is limited by subcutaneous fat thickness of patients and the operatorâ&#x20AC;&#x2122;s experience. Furthermore, it cannot provide information about mechanical properties of the tissue.

It is impractical to use these methods for assessment and frequent monitoring of NAFLD in PCOS patients of reproductive age. Real-time tissue elastography (RTE), one of the ultrasound elastography technologies, has been rapidly evolving in the last decade, being used for diagnosis of focal lesions in various organs. According to recent reports, RTE is also useful for assessment of fibrosis in patients with chronic liver diseases (10,11).

With the improvements in RTE, semiquantitative analysis of strain was developed. Parameters including the average strain value (MEAN) of RTE are reported to be useful for early diagnosis and staging of liver fibrosis (12-18).

On the other hand, application of RTE with semiquantitative parameters to NAFLD is rarely reported, never in PCOS women of reproductive age.

The aims of our study were to analyze semiquantitative strain parameters of RTE of the liver in PCOS patients with or without NAFLD as compared to healthy controls and then to evaluate the diagnostic value of these parameters for NAFLD in patients with PCOS.

Real-time ultrasound elastography for nonalcoholic fatty liver disease in PCOS patients

phase or first 3 days of progestin withdrawal bleeding.

Anti-Müllerian hormone (AMH) and sex hormonebinding globulin (SHBG) were analyzed by an enzyme-linked immunosorbent assay (ELISA) on a ELx808 plate reader (Biotek Instruments, Inc. USA).

Serum transaminases, plasma glucose, insulin, and lipid parameters were measured using standard methods on an automatic chemiluminescence immunoassay system (ADVIA Centaur xp, SIEMENS, Germen).

Oligomenorrhea/amenorrhea and PCO were defined according to the revised Rotterdam criteria. Biochemical hyperandrogenism (bHA) was defined as a total testosterone level of 2.39 nM or greater (21). Hirsutism was defined as mFG ≥ 5 as previously reported (22).

The acne score was measured according to a previous report (23). Homeostatic model assessment for insulin resistance (HOMA-IR) was calculated as fasting blood glucose (FBG) ×fasting insulin (FIN) ÷ 22.5. Insulin resistance (IR) was defined as HOMA-IR ≥ 2.14 and FIN ≥ 12.6 mIU/L (24,25). Impaired fasting glucose tolerance (FGT), impaired glucose tolerance (IGT) and type 2 diabetes mellitus (DM) were diagnosed according to 2006 WHO criteria (26). Hyperlipidemia was defined as cholesterol (CHOL) ≥ 6 mM, triglycerides (TG) ≥ 2.3 mM, or low-density lipoprotein cholesterol (LDL-C) ≥ 3.6 mM. Elevated aminotransferase was defined as alanine transaminase (ALT) or aspartate transaminase (AST) ≥ 40 U/L. Central obesity was defined as the waistline ≥ 80 cm. Elevated blood pressure (EBP) was defined as SBP ≥ 130 mmHg or DBP ≥ 85 mmHg. Metabolic syndrome (MS) was diagnosed according to NCEP-ATP III criteria (27).

Copyright© AE&M all rights reserved.

Ultrasound examination and RTE Transvaginal ultrasonography was performed in the early follicular phase if menses were regular or randomly if menses were irregular. Antral follicle count (AFC) was recorded.

All procedures were performed by a single operator with 10 years of experience in transabdominal ultrasonography who had specialized in elastography for the last 5 years. The operator was blinded to the clinical data of all the participants.

The ultrasonic examination (US) was performed by means of HI VISION PREIRUS (Hitachi Medical, Tokyo, Japan), which has both conventional ultrasonography and RTE capabilities. Conventional US was performed with a 3.5 MHz probe. A7-3MHz linear transducer (L52) was used for RTE. 130

RTE was performed as reported previously (16).

The region of interest window was set to 1 cm under the Glisson’s capsule in the right lobe, avoiding bile ducts and bile cysts. The pressure causing liver tissue strain came from subjects’ own heartbeat. The RTE software (EZU-TESH1, Hitachi) was used to generate histograms. Three effective acquisitions were performed for each patient. The mean of the total of three measurements served as a representative strain value. We measured 11 characteristic parameters of elastography imaging including MEAN in the range of 0-255 arbitrary units (a.u.) and the area ratio of a lowstrain region (AREA, %) as the main characteristics of liver stiffness. Standard deviation of the relative strain value (SD) was also determined.

Data analysis The results are presented as mean ± standard deviation or as a rate. The one-sample Kolmogorov-Smirnov test was used to determine whether the distribution of variants was normal. MEANs were compared among the groups using the t test or one-way analysis of variance (ANOVA). When equal variances were not assumed, variants were compared by nonparametric tests (MannWhitney U test or Kruskal-Wallis test). Categorical data were compared among the groups using the chisquared test. Receiver operating characteristic (ROC) curves were generated to analyze the diagnostic value of MEAN for elevated aminotransferase. Multiple linear regression analysis was used to access the correlation between MEAN or AREA and clinical parameters.

These analyses were performed in the SPSS software, version 13.0 for Windows (SPSS, Inc., Chicago, IL, USA), and statistical significance was assumed at p < 0.05.

RESULTS BMI, WC, WHR, SBP, DBP, FBG, two-hour glucose (2hGLU), FIN, HOMA-IR, TG, ALT, and AST levels significantly decreased in the following order: group PCOS with NAFLD > group PCOS without NAFLD > control group (p < 0.05). HDL-C levels showed an inverse trend among the three groups (p < 0.05).

LDL-C, apoB, AMH, LH, TT, mFG, menstrual cycles, and AFC were much higher in the PCOS groups than in the control group (p < 0.05), without significant difference between the two PCOS groups. Group PCOS without NAFLD had a significantly higher Arch Endocrinol Metab. 2019;63/2

Real-time ultrasound elastography for nonalcoholic fatty liver disease in PCOS patients

level of apoA than did group PCOS with NAFLD and control group (p < 0.05) (Table 1).

RTE for livers are shown in Figure 1. The MEAN value was the lowest in group PCOS with NAFLD, intermediate in group PCOS without NAFLD, and highest in the control group (87.02 ± 10.16 vs. 96.31 ± 11.44 vs. 104.49 ± 7.28, p < 0.001).The AREA value was the highest in group PCOS with NAFLD, intermediate in group PCOS without NAFLD, and lowest in the control group (42.49 ± 9.41 vs. 33.58

± 10.91 vs. 24.55 ± 8.14, p < 0.001).SD values were significantly different among the three groups in the same descending order as for AREA (68.78 ± 5.21 vs.

64.08 ± 6.73 vs. 58.25 ± 6.58, p < 0.001) (Figure 2).

To validate the clinical utility of MEAN, all subjects were subdivided into two subgroups according to MEAN levels. The cutoff value of MEAN (< 91.7) was set to the 5th percentile of the average relative strain value in 70 healthy controls. All 175 subjects were subdivided into group A (MEAN value

PCOS With NAFLD

PCOS without NAFLD

Control

35

70

70

29 ± 4.41

28.83 ± 4.51

BMI (kg/m )

25.41 ± 3.40

WCa (cm)

86.23 ± 7.94

WHR

SBPa (mmHg)

P1

P2

P3

28.97 ± 4.71

NS

NS

NS

22.81 ± 2.67

21.15 ± 2.61

< 0.001

< 0.001

< 0.001

77.80 ± 8.21

72.91 ± 8.53

< 0.001

< 0.001

< 0.001

0.8805 ± 0.0528

0.8337 ± 0.0619

0.8013 ± 0.0735

0.001

< 0.001

0.004

122.68 ± 12.79

117.18 ± 10.38

111.01 ± 9.48

0.021

< 0.001

< 0.001

DBPa (mmHg)

79.89 ± 9.51

75.85 ± 8.96

69.66 ± 7.14

0.033

< 0.001

< 0.001

FBGb (mmol/L)

5.28 ± 0.83

4.91 ± 0.45

4.72 ± 0.31

0.007

< 0.001

0.012

N Age

a a

2

a

2hGLU

7.75 ± 2.39

6.50 ± 1.94

5.53 ± 0.93

0.005

< 0.001

< 0.001

25.39 ± 13.95

14.15 ± 6.68

9.20 ± 5.51

< 0.001

< 0.001

< 0.001

HOMA-IR

6.01 ± 4.68

3.07 ± 1.64

1.96 ± 1.34

< 0.001

< 0.001

< 0.001

b

CHOL (mmol/L)

5.01 ± 1.35

4.74 ± 0.74

4.59 ± 0.72

NS

NS

NS

TGb (mmol/L)

1.92 ± 1.02

1.25 ± 0.72

0.81 ± 0.28

< 0.001

< 0.001

< 0.001

HDLCb (mmol/L)

1.21 ± 0.25

1.53 ± 0.37

1.44 ± 0.24

< 0.001

< 0.001

NS

LDLCb (mmol/L)

3.25 ± 1.08

2.90 ± 0.65

2.55 ± 0.67

NS

< 0.001

0.002

apoAb (g/L)

1.36 ± 0.33

1.57 ± 0.36

1.40 ± 0.23

0.002

0.002

0.010

apoBb (g/L)

0.88 ± 0.24

0.79 ± 0.21

0.70 ± 0.12

NS

0.001

0.017

ALT (U/L)

27.44 ± 16.25

15.52 ± 4.50

11.03 ± 4.89

0.001

< 0.001

< 0.001

ASTb (U/L)

39 ± 30.91

14.69 ± 8.74

15.17 ± 3.19

< 0.001

< 0.001

0.030

AMH (ng/dL)

9.99 ± 4.67

9.67 ± 4.52

4.52 ± 3.16

NS

< 0.001

< 0.001

TT (nmol/L)

1.9355 ± 0.7381

1.80 ± 1.1471

1.2114 ± 0.5210

NS

< 0.001

< 0.001

PRLa (ng/mL)

15.11 ± 7.67

14.53 ± 7.80

15.09 ± 6.81

NS

NS

NS

FSH (mIU//mL)

6.89 ± 1.87

6.50 ± 2.11

7.84 ± 2.55

NS

NS

0.001

LHb (mIU//mL)

7.53 ± 4.61

9.12 ± 7.30

4.23 ± 1.53

NS

< 0.001

< 0.001

b

FINb (mIU/L) b

b

b

a

a

mFGb

3.10 ± 3.29

3.78 ± 3.93

0.01 ± 0.12

NS

< 0.001

< 0.001

0.1667 ± 0.3791

0.4706 ± 0.7025

0.4265 ± 0.6063

0.039

NS

NS

Menstrual cycle Shortestb (day)

51.52 ± 35.63

42.87 ± 23.89

27.70 ± 2.51

NS

< 0.001

< 0.001

Menstrual cycle Longtestb (day)

108.07 ± 79.06

72.62 ± 45.56

31.68 ± 2.84

NS

< 0.001

< 0.001

AFCb

35.32 ± 12.47

31.15 ± 9.45

14.49 ± 3.28

NS

< 0.001

< 0.001

Acne scoreb

Values are mean ± standard.

P1: Comparison between PCOS with and without NAFLD Groups. P2: Comparison between PCOS with NAFLD and control Groups. P3: Comparison between PCOS without NAFLD and control Groups. a Compared by T test or one way ANOVA; b Compared by Nonparametric Test (Mann Whitney U test or Kruskal-Wallis test).

Arch Endocrinol Metab. 2019;63/2

131

Copyright© AE&M all rights reserved.

Table 1. Baseline clinical characteristics and laboratory parameters of all subjects

Real-time ultrasound elastography for nonalcoholic fatty liver disease in PCOS patients

< 91.7,49 cases) and group B (MEAN value ≥ 91.7, 126 cases).

BMI, WC, WHR, SBP, DBP, FIN, FBG, HOMAIR, TG, LDL-C, apoB, ALT, AST, AMH, mFG, menstrual cycles, and AFC were significantly higher in group A than in group B (p < 0.05). There were no differences in age, 2hGLU, CHOL, apoA, acne

score, and other endocrine parameters between the two groups (Table 2).

Prevalence of endocrine disorders and metabolic disturbances was obviously higher in group A than in group B. The prevalence of oligomenorrhea, PCO, PCOS, IR, IFG, hyperlipidemia, central obesity, EBP, and MS was significantly higher in group A than

Figure 1. RTE for livers.

ols ntr Co

D ut tho

OS

wi

wi

th

NA

NA FL

ols

FL D

80.00 70.00 60.00 50.00 40.00 30.00 20.00 10.00 0.00

PC OS

ut tho

PC OS

wi

th

NA

NA FL

ols ntr Co

NA FL

P1 < 0.001 P2 < 0.001 P3 < 0.001

SD

PC

PC

OS

wi

tho

ut

NA th

B

ntr

0.00

P1 < 0.001 P2 < 0.001 P3 < 0.001

Co

10.00

0.00

D

20.00

20.00

FL D

30.00

40.00

D

40.00

60.00

FL D

50.00

80.00

wi

AREA

60.00

100.00

PC OS

Copyright© AE&M all rights reserved.

C

wi

120.00

P1 < 0.001 P2 < 0.001 P3 < 0.001

OS

MEAN

PC

A

Figure 2. Comparison of RTE parameters between groups PCOS with NAFLD, PCOS without NAFLD, and control. Column bar graphs show significant differences of MEAN, SD, AREA between groups. There were significant trend from PCOS with NAFLD group, PCOS without NAFLD group to control group.

P1: Comparison between PCOS with and without NAFLD Groups. P2: Comparison between PCOS with NAFLD and control Groups. P3: Comparison between PCOS Without NAFLD and control Groups.

132

Arch Endocrinol Metab. 2019;63/2

Real-time ultrasound elastography for nonalcoholic fatty liver disease in PCOS patients

91.7 as the cutoff value, the sensitivity and specificity were 0.762 and 0.8 respectively, with the Youden index of 0.562 (Figure 3).

Table 2. Comparison of clinical characteristics between the groups formed on the basis of the cutoff value of MEAN Group B (MEAN ≥ 91.7)

p

49

126

a

Age

29.31 ± 4.47

28.77 ± 4.59

NS

BMIa

24.84 ± 2.73

21.80 ± 2.93

< 0.001

WCa

84.73 ± 8.70

74.65 ± 8.35

< 0.001

WHRa

0.8683 ± 0.0644

0.8147 ± 0.0682

< 0.001

SBPa

120.90 ± 10.20

113.68 ± 11.05

< 0.001

DBPa

78.73 ± 7.53

72.28 ± 9.12

< 0.001

FBGb

5.20 ± 0.76

4.801 ± 0.39

< 0.001

2hGLUb

7.51 ± 2.20

7.31 ± 2.49

NS

22.66 ± 13.12

11.26 ± 6.32

< 0.001

F INb

Table 3. Comparison of frequency of endocrine disorders and metabolic disturbances between the groups formed on the basis of the cutoff value of MEAN Group A (MEAN < 91.7)

Group B (MEAN ≥ 91.7)

49

126

Oligomenorrhea

44 (89.80)

PCO

46 (93.88)

bHA

X2

P

53 (42.06)

32.536

< 0.001

57 (45.24)

32.960

< 0.001

17 (34.69)

40 (31.75)

0.140

NS

Hirsutism

11 (22.45)

33 (26.19)

0.262

NS

PCOS

46 (93.88)

55 (43.65)

36.469

< 0.001

IR

41 (83.67)

39 (30.95)

39.515

< 0.001

IFG

3 (6.12)

1 (0.79)

4.485

< 0.05

IGT

11 (22.45%)

26 (20.63)

0.070

NS

DM

2 (4.08)

4 (3.17)

0.088

NS

Hyperlipidemia

19 (38.77)

22 (17.46)

8.935

< 0.05

Central obesity

39 (79.59)

33 (26.19)

41.547

< 0.001

EBP

14 (28.57)

17 (13.49)

5.504

< 0.05

MS

17 (34.69)

6 (4.76)

27.689

< 0.001

9 (18.37)

2 (1.59)

16.864

< 0.001

N

HOMA-IRb

5.36 ± 4.27

2.43 ± 1.53

< 0.001

CHOLa

4.83 ± 1.06

4.70 ± 0.82

NS

TGb

1.72 ± 0.99

1.01 ± 0.58

< 0.001

HDLCa

1.30 ± 0.35

1.47 ± 0.30

0.002

LDLCa

3.07 ± 0.92

2.73 ± 0.73

0.017

apoAa

1.43 ± 0.36

1.457 ± 0.30

NS

apoBa

0.84 ± 0.21

0.75 ± 0.19

0.013

ALT

22.904 ± 14.23

13.04 ± 5.61

< 0.001

ASTb

28.07 ± 27.04

15.82 ± 8.79

0.025

AMHa

9.79 ± 4.82

6.85 ± 4.53

0.001

Elevated aminotransferase

TTa

1.74 ± 0.62

1.53 ± 1.00

NS

Values are number (%).

PRL

13.75 ± 7.96

15.23 ± 7.11

NS

FSHa

6.87 ± 2.14

7.22 ± 2.40

NS

a

a

LH

7.89 ± 7.42

6.43 ± 4.78

NS

mFGa

3.41 ± 3.53

1.64 ± 3.18

0.002

Acne scorea

0.4091 ± 0.7256

0.3934 ± 0.6106

NS

Menstrual cycle Shortestb (day)

48.93 ± 26.01

35.69 ± 22.04

< 0.001

Menstrual cycle Longtestb (day)

96.86 ± 69.07

50.12 ± 37.50

< 0.001

AFCa

31.9 ± 12.68

21.86 ± 10.73

< 0.001

Values are mean ± standard. a Compared by T test or one way ANOVA. b Compared by Nonparametric Test (Mann Whitney U test or Kruskal-Wallis test).

in group B (p < 0.05). The prevalence of elevated aminotransferase was also higher in group A (p < 0.05). The prevalence of IGT and DM was slightly higher in group A (p > 0.05). Nevertheless, there were no differences in the prevalence of HA and hirsutism between the two groups (Table 3).

Receiver operating characteristic (ROC) curves were generated to analyze the diagnostic value of MEAN for elevated aminotransferase: the area under the curve was 0.808 (range 0.721-0.895). With the MEAN level of Arch Endocrinol Metab. 2019;63/2

ROC Curve 1.0

0.8

0.6 Sensitivity

b

0.4

0.2

0.0 0.0

0.2

0.4

0.6

0.8

1.0

1 - Specificity Diagonal segments are produced by ties

Figure 3. ROC curves for the diagnostic value of MEAN for elevated aminotransferase. ROC curves for MEAN value exhibit reasonable overall performance to discriminate patients with and without elevated aminotransferase.

133

Copyright© AE&M all rights reserved.

N

Group A (MEAN < 91.7)

Real-time ultrasound elastography for nonalcoholic fatty liver disease in PCOS patients

In multiple linear regression analyses, the MEAN value was a dependent variable. Independent variables included AGE, BMI, WC, WHR, mFG, FIN, FBP, HOMA-IR, AMH, CHOL, TG, LDL-C, HDL-C, apoA, apoB, ALT, AST, SBP, DBP, MS, and PCOS. The results showed that only PCOS, WC, and MS were stand-alone independent factors associated with the MEAN value among the 140 subjects without NAFLD (p < 0.05).

When AREA was a dependent variable (instead of MEAN), PCOS, WC, and MS were also in the list of stand-alone independent factors (p < 0.05).

CopyrightŠ AE&M all rights reserved.

DISCUSSION NAFLD is related to obesity, MS, IR, DM, and other metabolic disorders. These metabolic disorders are more frequent among patients with PCOS than among normal individuals. Studies confirmed that patients with PCOS are at a higher risk of NAFLD than controls are (5,6), and this finding is receiving more attention from gynecologists.

RTE is an excellent supplement to conventional ultrasonography. Nonetheless, it is mainly used for diagnosis of focal lesions with impressive accuracy in daily practice. In RTE, elastic strain is a relative indicator of texture stiffness. Compared to other elastographic methods such as transient elastography (TE), the use of RTE with NAFLD has been rarely reported, not to mention the populations with PCOS. So far, to our knowledge, this is the first study on RTE for assessment of NAFLD in patients with PCOS as compared to healthy controls.

With rapid development of technologies, RTE has been used in more organs than before. The new RTE system has better resolution than the old devices did.

Owing to the lower working frequency, the new probe allows for measurements in deeper locations, e.g., in patients with obesity. Automatic displacement of the liver parenchyma is induced by the heartbeat without any pressure from the operator. There is also a sinus curve beneath the RTE image, and this curve shows accuracy of the measurements (16). These technologies reduce interobserver variability remarkably (28).

Semiquantitative parameters of strain histograms of RTE may offer more information about texture elasticity. This approach is reported to be superior to visual scoring for assessment of target strain.

In addition, target size has no effect on the strain histogram ( 29). There is intrinsic relevance among 134

all the 11 semiquantitative strain parameters. Several authors developed different scoring systems based on the parameters calculated with different formulas, and currently there is no consensus (17,18). In this study, we analyzed only the main parameters including MEAN, AREA, and SD, especially MEAN. Our research confirmed that MEAN decreases in PCOS with NAFLD, while AREA and SD increase as compared to PCOS without NAFLD and healthy controls; these results are in agreement with other studies (12,16,17,29). This finding may be explained theoretically as follows: a softer tissue can be compressed more easily than a stiffer tissue; thus, the displacement of the reflected ultrasound echoes (MEAN) is smaller in the stiffer tissue. AREA is the ratio of low-strain (stiffer) region values. Higher AREA reflects a relatively uneven and harder region of interest. Histologically speaking, major researchers reported that fibrosis associated with hepatic stiffness could be assessed by RTE (30).

Furthermore, some researchers believe that steatosis could also affect liver stiffness. Research by Orlacchio and cols. showed that tissue mean elasticity varies consistently with steatosis. Other researchers also found that the steatosis grade is independently associated with a liver elastographic parameter (29,31-33).

In our study, low MEAN was associated with higher WC, BMI, and lipid and transaminase levels as well as with greater endocrine and metabolic disturbances.

ROC curve analysis confirmed that MEAN has a good diagnostic value for elevated aminotransferase.

These results corroborated the diagnostic value of semiquantitative strain parameters of RTE for NAFLD in addition to conventional ultrasonography.

We found that PCOS patients without NAFLD also had significantly lower MEAN and higher AREA as compared to controls. The levels of MEAN and AREA in PCOS patients without NAFLD were intermediate between those in PCOS patients with NAFLD and healthy controls. According to multiple linear regression analyses, besides WC and MS, PCOS is also a stand-alone independent factor associated with MEAN or AREA values among the subjects without NAFLD. It seems that strain parameters in RTE may distinguish alterations in the liver parenchyma more sensitively: before visual detection by conventional ultrasonic examination. Further research is needed to confirm this notion.

The lack of histological data from livers is a limitation of this study. Nonetheless, the PCOS Arch Endocrinol Metab. 2019;63/2

Real-time ultrasound elastography for nonalcoholic fatty liver disease in PCOS patients

Acknowledgment: we gratefully acknowledge the contributions of Hui Zhi, Yabo Yang, Ling Li, Wenchang Yu, Xinhua Ma, Jinglinag Ruan, and Jiayi Wu. Funding: the study was supported in part by the National Natural Science Foundation of China (grant # 81402168), the National Natural Science Youth Fund of China (grant # 81703784), the 5010 Programs Fund for clinical medicine research at Sun Yat-sen University (grant # 2014005), the Science and Technology research project of Guangzhou city (grant # 2014Y200512), and the Science and Technology Project of Guangdong Province (grant # 2018YJ034).

Disclosure: no potential conflict of interest relevant to this article was reported.

REFERENCES 1. Mathiesen UL, Franzen LE, Aselius H, Resjo M, Jacobsson L, Foberg U, et al. Status of homocysteine in polycystic ovary syndrome (PCOS). J Clin Diagn Res. 2014;8(2):31-3.

2. Fung J, Lee CK, Chan M, Seto WK, Lai CL,Yuen MF. High prevalence of non-alcoholic fatty liver disease in the Chinese – results from the Hong Kong liver health census. Liver Int. 2015;35(2):542-9.

3. Jayasena CN, Franks S. The management of patients with polycystic ovary syndrome. Nat Rev Endocrinol. 2014;10(10):624-36.

4. Fauser BC, Tarlatzis BC, Rebar RW, Legro RS, Balen AH, Lobo R, et al. Consensus on women’s health aspects of polycystic ovary syndrome (PCOS): the Amsterdam ESHRE/ASRM-Sponsored 3rd PCOS Consensus Workshop Group. Fertil Steril. 2012;97(1):28-38.e25.

5. Ramezani-Binabaj M, Motalebi M, Karimi-Sari H, Rezaee-Zavareh MS, Alavian SM. Are women with polycystic ovarian syndrome at a high risk of non-alcoholic Fatty liver disease; a meta-analysis.

Hepat Mon. 2014;14(11):e23235.

6. Romanowski MD, Parolin MB, Freitas AC, Piazza MJ, Basso J, Urbanetz AA. Prevalence of non-alcoholic fatty liver disease in women with polycystic ovary syndrome and its correlation with metabolic syndrome. Arq Gastroenterol. 2015;52(2):117-23.

7. Targher G, Rossini M, Lonardo A. Evidence that non-alcoholic fatty liver disease and polycystic ovary syndrome are associated Arch Endocrinol Metab. 2019;63/2

by necessity rather than chance: a novel hepato-ovarian axis? Endocrine. 2016;51(2):211-21.

8. Ferraioli G, Filice C, Castera L, Choi B I, Sporea I, Wilson SR, et al. WFUMB guidelines and recommendations for clinical use of ultrasound elastography: Part 3: liver. Ultrasound Med Bio. 2015;41(5):1161-79.

9. Papagianni M, Sofogianni A, Tziomalos K. Non-invasive methods for the diagnosis of nonalcoholic fatty liver disease. World J Hepatol. 2015;7(4):638-48.

10. Kim YW, Kwon JH, Jang JW, Kim MJ, Oh BS, Chung KW, et al.

Diagnostic usefulness of real-time elastography for liver fibrosis in chronic viral hepatitis B and C. Gastroenterol Res Pract.

2014;2014:210407.

11. Colombo S, Buonocore M, Del PA, Jamoletti C, Elia S, Mattiello M, et al. Head-to-head comparison of transient elastography (TE), real-time tissue elastography (RTE), and acoustic radiation force impulse (ARFI) imaging in the diagnosis of liver fibrosis. J Gastroenterol. 2012;47(4):461-9.

12. Morikawa H, Fukuda K, Kobayashi S, Fujii H, Iwai S, Enomoto M, et al. Real-time tissue elastography as a tool for the noninvasive assessment of liver stiffness in patients with chronic hepatitis C. J Gastroenterol. 2011;46(3):350-8.

13. Ferraioli G, Tinelli C, Malfitano A, Dal Bello B, Filice G, Filice C, et al. Performance of real-time strain elastography, transient elastography, and aspartate-to-platelet ratio index in the assessment of fibrosis in chronic hepatitis C. AJR Am J Roentgenol.

2012;199(1):19-25.

14. Fujimoto K, Kato M, Kudo M, Yada N, Shiina T, Ueshima K, et al.

Novel image analysis method using ultrasound elastography for noninvasive evaluation of hepatic fibrosis in patients with chronic hepatitis C. Oncology. 2013;84 Suppl 1:3-12.

15. Yada N, Kudo M, Morikawa H, Fujimoto K, Kato M, Kawada N. Assessment of liver fibrosis with real-time tissue elastography in chronic viral hepatitis. Oncology. 2013;84 Suppl 1:13-20.

16. Schenk JP, Alzen G, Klingmuller V, Teufel U, El SS, et al. Measurement of real-time tissue elastography in a phantom model and comparison with transient elastography in pediatric patients with liver diseases. Diagn Interv Radio. 2014;20(1):90-9.

17. Ge L, Shi B, Song YE, Li Y, Wang S, Wang X. Clinical value of realtime elastography quantitative parameters in evaluating the stage of liver fibrosis and cirrhosis. Exp Ther Med. 2015;10(3):983-90.

18. Wang J, Guo L, Shi X, Pan W, Bai Y, Ai H. Real-time elastography with a novel quantitative technology for assessment of liver fibrosis in chronic hepatitis B. Eur J Radiol. 2012;81(1):31-6.

19. Revised 2003 consensus on diagnostic criteria and long-term health risks related to polycystic ovary syndrome (PCOS). Hum Reprod. 2004;19(1):41-7.

20. Mathiesen UL, Franzen LE, Aselius H, Resjo M, Jacobsson L, Foberg U, et al. Increased liver echogenicity at ultrasound examination reflects degree of steatosis but not of fibrosis in asymptomatic patients with mild/moderate abnormalities of liver transaminases. Dig Liver Dis. 2002;34(7):516-22.

21. Zhao X, He Z, Mo Y, Chen X, Chen Y, Yang D. Determining the normal cut-off levels for hyperandrogenemia in Chinese women of reproductive age. Eur J Obstet Gynecol Reprod Biol.

2011;154(2):187-91.

22. Zhao X, Ni R, Li L, Mo Y, Huang J, Huang M, et al. Defining hirsutism in Chinese women: a cross-sectional study. Fertil Steril.

2011;96(3):792-6.

23. Pochi PE, Shalita AR, Strauss JS, Webster SB, Cunliffe WJ, Katz HI, et al. Report of the Consensus Conference on Acne Classification.

J Am Acad Dermatol. 1991;24(3):495-500.

24. Chen X, Yang D, Li L, Feng S, Wang L. Abnormal glucose tolerance in Chinese women with polycystic ovary syndrome. Hum Reprod.

2006;21(8):2027-32.

135

Copyright© AE&M all rights reserved.

patients of reproductive age came to our department mostly regarding fertility or menstrual problems, and the controls for a health check-up. Therefore, it was inappropriate for them to undergo an invasive liver biopsy. Nevertheless, comparison of MRI and RTE during assessment of liver changes between patients with PCOS and healthy controls may provide more information.

In conclusion, semiquantitative RTE analysis is useful for distinguishing PCOS patients with or without NAFLD and controls. The proposed method may be able to reveal liver parenchyma alterations in patients with PCOS more sensitively. More studies are needed on semiquantitative RTE analysis for diagnosis of NAFLD and other diffuse liver diseases in various populations including patients with PCOS.

Real-time ultrasound elastography for nonalcoholic fatty liver disease in PCOS patients

25. Chen X, Yang D, Li L, Feng S, Wang L. Appropriate BMI levels for PCOS patients in Southern China. Hum Reprod. 2010;25(5):1295-302.

26. WHO. Definition and diagnosis of diabetes mellitus and intermediate hyperglycaemia Report of a WHO/IDF consultation. Available at: http:// www.who.int/diabetes/publications/diagnosis_diabetes2006/en.

27. Rezaianzadeh A, Namayandeh SM, Sadr SM. National Cholesterol Education Program Adult Treatment Panel III Versus International Diabetic Federation Definition of Metabolic Syndrome, Which One is Associated with Diabetes Mellitus and Coronary Artery Disease? Int J Prev Med. 2012;3(8):552-8.

28. Carlsen JF, Ewertsen C, Saftoiu A, Lonn L, Nielsen MB. Accuracy of visual scoring and semi-quantification of ultrasound strain elastography â&#x20AC;&#x201C; a phantom study. PLoS One. 2014;9(2):e88699.

31. Yilmaz Y, Yesil A, Gerin F, Ergelen R, Akin H, Celikel CA, et al. Detection of hepatic steatosis using the controlled attenuation parameter: a comparative study with liver biopsy. Scand J Gastroenterol. 2014;49(5):611-6.

32. Chon Y E, Jung KS, Kim SU, Park JY, Park YN, Kim DY, et al. Controlled attenuation parameter (CAP) for detection of hepatic steatosis in patients with chronic liver diseases: a prospective study of a native Korean population. Liver Int. 2014;34(1):102-9.

33. Shen F, Zheng RD, Mi YQ, Wang XY, Pan Q, Chen GY, et al. Controlled attenuation parameter for non-invasive assessment of hepatic steatosis in Chinese patients. World J Gastroenterol.

2014;20(16):4702-11.

CopyrightŠ AE&M all rights reserved.

29. Orlacchio A, Bolacchi F, Antonicoli M, Coco I, Costanzo E, Tosti D, et al. Liver elasticity in NASH patients evaluated with real-time elastography (RTE). Ultrasound Med Biol. 2012;38(4):537-44.

30. Ochi H, Hirooka M, Koizumi Y, Miyake T, Tokumoto Y, Soga Y, et al.

Real-time tissue elastography for evaluation of hepatic fibrosis and portal hypertension in nonalcoholic fatty liver diseases. Hepatology. 2012;56(4): 1271-1278.

136

Arch Endocrinol Metab. 2019;63/2

original article

Serum calcitonin nadirs to undetectable levels within 1 month of curative surgery in medullary thyroid cancer Fernanda Andrade1, Geneviève Rondeau2, Laura Boucai3, Rebecca Zeuren3, Ashok R. Shaha4, Ian Ganly3, Fernanda Vaisman1, Rossana Corbo1, Michael Tuttle3

ABSTRACT Objective: Because serum calcitonin (CT) is a reliable marker of the presence, volume, and extent of disease in medullary thyroid cancer (MTC), both the ATA and NCCN guidelines use the 2-3 month post-operative CT value as the primary response to therapy variable that determines the type and intensity of follow up evaluations. We hypothesized that the calcitonin would nadir to undetectable levels within 1 month of a curative surgical procedure. Subjects and methods: This retrospective review identified 105 patients with hereditary and sporadic MTC who had at least two serial basal CT measurements done in the first three months after primary surgery. Results: When evaluated one year after initial surgery, 42 patients (42/105, 40%) achieved an undetectable basal calcitonin level without additional therapies and 56 patients (56/84, 67%) demonstrated a CEA within the normal reference range. In patients destined to have an undetectable CT as the best response to initial therapy, the calcitonin was undetectable by 1 month after surgery in 97% (41/42 patients). Similarly, in patients destined to have a normalize their CEA, the CEA was within the reference range by 1 month post-operatively in 63% and by 6 months in 98%. By 6 months after curative initial surgery, 100% of patients had achieved a nadir undetectable calcitonin, 98% had reached the CEA nadir, and 97% had achieved normalization of both the calcitonin and CEA. Conclusion: The 1 month CT value is a reliable marker of response to therapy that allows earlier risk stratification than the currently recommended 2-3 month CT measurement. Arch Endocrinol Metab. 2019;63(2):137-41 Keywords Calcitonin; medullary thyroid cancer; risk stratification; curative surgery; prognostic

Department of Medicine, Endocrinology Service, Instituto Nacional de Câncer (INCA), Rio de Janeiro, RJ, Brasil 2 Center Hospitalier de l’Université de Montréal, Medicine Endocrinology, Montreal, Canadá 3 Department of Medicine, Endocrinology Service, Memorial Sloan-Kettering Cancer Center, New York, NY, USA 4 Department of Surgery, Head and Neck Cancer, Memorial Sloan-Kettering Cancer Center, New York, NY, USA 1

Correspondence to: Fernanda Accioly de Andrade Departamento de Endocrinologia Instituto Nacional de Câncer José Alencar Gomes da Silva Praça da Cruz Vermelha, 23, 8º andar, 20230-130 – Rio de Janeiro, RJ, Brasil andrade.clinica@gmail.com Received on June/26/2018 Accepted on Dec/12/2018

INTRODUCTION

M

edullary thyroid carcinoma (MTC) is a rare and challenging malignancy that often presents with loco-regional metastases and less commonly with distant metastases. Not infrequently these patients have persistent biochemical or structural evidence of disease after primary surgery that often displays a protracted indolent course (1-3). Prognosis largely depends on the presenting clinico-pathologic features as reflected by the American Joint Committee on Cancer (AJCC) staging (4), and on the completeness of surgical resection of the primary tumor and regional lymph nodes as assessed by the post-operative serum calcitonin (CT) (5-8).

Arch Endocrinol Metab. 2019;63/2

Because serum CT is recognized to be a reliable biomarker of the presence, volume, and extent of disease in MTC (9-11), both the American Thyroid Association (ATA) and National Comprehensive Cancer Network (NCCN) guidelines post-operative CT and CEA values as the primary response to therapy variables that determines the type and intensity of follow up evaluations (2,3,8,12). While the ATA and NCCN guidelines recommend evaluating response to therapy at 2-3 months after initial therapy, several studies demonstrate that following curative surgery, serum calcitonin levels begin a rapid decline within hours after surgery (13) often achieving undetectable levels within the first few post-operative days (14-17). These data are 137

Copyright© AE&M all rights reserved.

DOI: 10.20945/2359-3997000000112

Prognostic value of 1 month calcitonin

consistent with our anecdotal clinical observations that surgically cured patients achieve undetectable calcitonin levels within 1 month of surgery even though the CEA values often required several months to normalize.

Therefore, the goal of this study was to determine if the 1 month post-operative CT value would identify patients that are destined to develop an undetectable calcitonin value following initial therapy. Rather than waiting two to three months to determine whether or not a curative surgery had been performed, we hypothesized that an undetectable serum calcitonin one month after surgery would identify the vast majority of patients destined to have an undetectable nadir calcitonin in response to initial therapy.

Follow-up and Calcitonin measurements In the first few months after initial surgery, basal CT measurements were ordered once a month for three months in order to obtain at least two serial values in the post-operative period. The next basal CT values were usually obtained at 6 and 12 months after primary surgery. Patients were seen in clinic every 3-6 months for the first year and at 6 month intervals thereafter at the discretion of the attending physician based on the risk of the individual patient and the clinical course of the disease. Since pentagastrin is not available in the United States (USA) or Brazil, no pentagastrin stimulated CT values were obtained in the patients included in the study.

Statistical methods

SUBJECTS AND METHODS Subjects After obtaining approval from the institutional review board, we retrospectively identified 105 MTC patients followed at Memorial Sloan Kettering Cancer Center in New York or the National Cancer Institute of Brazil in Rio de Janeiro (INCA) who had serial serum calcitonin measurements obtained using the same clinical assay at 1 month and 2-3 months after initial surgery. In patients that had both a 2 month and 3 month value, the value from month 3 was used for analysis. Thirty-nine patients also had a serum calcitonin in the same assay 6 months after primary surgery. Patients < 18 years old at diagnosis or those who did not have thyroid surgery as initial treatment for MTC were excluded from the study. The analysis of post operative calcitonin was performed in those patients with detectable calcitonin pre-operative.

CopyrightŠ AE&M all rights reserved.

Calcitonin and CEA assays The functional sensitivity of the calcitonin assays varied from 2 pg/mL in the Siemens DPC Immulite 20002500 Chemiluminescent Method (Quest Diagnostics, Madison, NJ, USA) to 8 pg/mL in the Siemens DPC Immulite ICMA Method (LabCorp, Burlington, NC, USA). Values below the functional sensitivity of the assay were classified as undetectable.

Serum CEA was measured using either the AIA1800 IEMA Method (Tosoh, San Francisco, CA, USA) or the Siemens Chemiluminescent Method (Quest Diagnostics, Madison, NJ, USA). CEA values less than 5 ng/mL were considered to be within the expected reference range.

138

Continuous data are presented as means and standard deviations or median values with ranges. Comparisons between groups were performed with one-way ANOVA test. Analysis was performed using SPSS software (Version 24.0.1: SPSS Inc, Chicago, IL). A p value â&#x2030;¤ 0.05 was considered statistically significant.

RESULTS The demographic and clinic-pathologic features of the 105 MTC patients analyzed in this study are presented in Table 1. More than half of the patients were female (53.3%) and median age at diagnosis was 53 years old. The majority were sporadic cases with a median duration of follow-up of 4.5 years.

Considering the extent of the initial surgery, the vast majority was submitted to total thyrodectomy (102/105) and only 3 had hemithyrodectomy. Central lymph node dissection was perfomed in 64 patients and lateral compartment dissection in 56 patients . It is important to note that bilateral lymph node dissection were necessary in only 16 patients. From all the patients included in this study, 40% had cN1a disease and 44% cN1b. All 56 patients with lateral neck dissection were also submitted to central neck dissection as well. From the 64 patients with central neck dissection 26 had undetectable calcitonin. Some patients were operated because of RET mutation screening and some for clinically evident MTC, which had an impact on surgery choice. Due to the heterogeneous criteria for selecting the type of surgery performed, we were not able to show statistical significant correlation between the type of surgery and early biochemical remission.

Arch Endocrinol Metab. 2019;63/2

Prognostic value of 1 month calcitonin

Age (years)

Median 53 Mean 52 ± 14 Range 8-84

Gender

Male 49 (46.7%) Female 56 (53.3%)

Follow up (years)

Median 4.5 Mean 4.8 ± 4.5 Range 0.5 – 23.4

Hereditary/Sporadic

Hereditary 15 (14.3%) Sporadic 78 (74.3%) Uncertain 12 (11.4%)

Extra thyroidal extension

Yes = 36 (34.3%) No = 69 (65.7%)

Vascular invasion

Yes = 45 (42.8%) No = 60 (57.2%)

AJCC staging

I = 33 (31.4%) II = 15 (14.3%) III = 6 (5.7%) IVa = 35 (33.4%) IVb = 1 (0.9%) IVc = 13 (12.4%) Not staged = 2 (1.9%)

Pre op CEA level (ng/mL) (n = 40)

Median = 32 Mean = 175 ± 57 Range = 0.5 – 1,708

Pre op CT levels (pg/mL) (n = 56)

Median = 1,435 Mean 25,998 ± 18,421 Range < 5 – 1,035,000

When evaluated one year after initial surgery, 42 patients (42/105, 40%) achieved an undetectable basal calcitonin level without additional therapies (preoperative CT ranged from 10 to 1,428 pg/mL, with the median value of 174 pg/mL). Furthermore, 56 patients (56/84, 67%) demonstrated a CEA within the normal reference range (21 patients did not have a CEA measured at the one year time point, pre-operative CEA ranged from 0.5 to 1,708 pg/mL with a median value of 174 pg/mL. Of the 84 patients with both calcitonin and CEA values available at the 1 year time point, 34 (34/84, 41%) achieved both an undetectable calcitonin and a CEA within the normal reference range.

The time course to achieving an (1) undetectable calcitonin, (2) normal range CEA and (3) both an undetectable calcitonin and CEA value is shown in Figure 1. Following initial curative surgery an undetectable calcitonin was achieved within the first month after surgery in 97% of the patients despite Arch Endocrinol Metab. 2019;63/2

having pre-operative calcitonin values that ranged from 10 to 1,428 pg/mL. Interestingly, the 1 patient that failed to achieve an early undetectable calcitonin demonstrated a 1 month post-surgical calcitonin of only 5 pg/mL (assay limit of detection was 4 pg/mL). As expected, the CEA took longer to reach nadir with only 63% reaching the normal reference range by 1 month.

However, by 6 months after curative initial surgery, 100% of patients had achieved a nadir calcitonin, 98% had reached the CEA nadir, and 97% had achieved normalization of both the calcitonin and CEA. From the 42 patients that achieved undetectable calcitonin in the first year postoperative, 5 patients had detectable values at final follow up. However, only two cases had structural evidence of disease. Cases are described in Table 2.

100% 98% 97%

97%

63%

100% 100%100%

72%

1 month

6 months

12 months

Nadir CT undetectable (n = 36) Nadir CEA in the normal range (n = 49 Nadir CT undetectable & CEA in the normal range (n = 29)

Figure 1. Time course to the normalization of the tumor makers in MTC patients surgically cured

DISCUSSION Consistent with previous observations, our data clearly show that following curative surgery, serum calcitonin levels rapidly decline and nearly always achieve an undetectable nadir within 1 month. While CEA levels may take longer to normalize, 63% had already achieved normal range values within 1 month of surgery. Thus our data demonstrate that measurements of calcitonin and CEA within the first month of surgery can provide an early, meaningful response to therapy assessment predictive of the likelihood that a surgical cure has been achieved. Conversely, very few patients will achieve an undetectable calcitonin and normal CEA levels more than 6 months after initial surgical intervention allowing the clinician and the patient to understand that they will likely have persistent biochemical and or 139

Copyright© AE&M all rights reserved.

Table 1. Clinical characteristics of entire cohort of 105 patients with medullary thyroid carcinoma

Prognostic value of 1 month calcitonin

Table 2. Patients with at least ine undetectable calcitonin whithin the first year that had elevated calcitonin at the end of follow-up Patient 1

Patient 3

Patient 4

Patient 5

Age

56

51

39

65

48

Sex

Male

Male

Female

Male

Female

Tumor size (cm)

1.0

2.5

2.5

1.0

2.6

N1

Yes

No

Yes

No

No

Type of initial surgery

Total thyroidectomy + central and lateral neck dissection

Hemithyroidectomy

Total thyroidectomy+ central neck dissection

Total thyroidectomy

Total thyroidectomy+ central neck dissection

Time to elevation of calcitonin after initial undetectable measurement

12 months

6 months

12 months

5 months

22 months

Last calcitonin

CopyrightŠ AE&M all rights reserved.

Patient 2

659

4.4

39

4.0

8.0

Structural disease at the end of follow up

Yes- distant metastases

No

Yes- small lymph nodes under survalliance

No

No

Final response to therapy stratification

Structural incomplete

Biochemical incomplete

Structural incomplete

Biochemical incomplete

Biochemical incomplete

structural evidence of disease as the best response to initial therapy.

Because of its reliability to reflect presence and extent of disease, there has been increased interest in determining how early after surgery CT levels would help predict the clinical course of the disease. Early series of patients demonstrated that 4/6 patients normalized their calcitonin 2 weeks after surgery (15) while 15/33 did so within three postoperative days (16). Ismailov and Piulatova reported CT normalization in 15/22 patients with MTC by 4 weeks after surgery and as early as 2 days postoperative (17). More recently, Bumming and cols. compared a CT value 6-8 weeks after surgery with a follow up calcitonin measured between 3 and 12 months. Five of seven patients with undetectable CT at 6-8 weeks continued to have undetectable levels at follow up. All 13/20 patients with detectable CT at 6-8 weeks had persistent measurable calcitonin at follow up (18). Brauckhoff and cols. reported that in 12 patients destined to achieve an undetectable postoperative calcitonin level, the CT was undetectable by 24 hours in 8 patients, and by 2 weeks in an additional 4 patients (14). Our data is consistent with the studies reported above and suggests that the one-month CT value is a valuable tool to risk stratify patients for future follow up.

As with any retrospective study, there are important limitations that need to be considered. Because calcitonin and CEA levels were routinely done at set intervals (1 month, 2-3 months, 6 months, and 12 140

months post-operative), we cannot determine the precise time course of calcitonin and CEA values during the first few weeks after surgery. Secondly, while these patients have demonstrated an excellent response to therapy at the 1 year time point and appear to be cured, previous studies have suggested that disease recurrence can be seen in 5-15% of patients with longer follow up (2). Finally, the definition of undetectable calcitonin varied between patients as the assays used in individual patients varied between institutions and over time. It is recognized that in very rare cases, there is serum calcitonin negative MTC pre-operative (19). However, we donâ&#x20AC;&#x2122;t believe that this changes this results, since none of the patients that had undetectable calcitonin turned out to have structural evidence of disease.

In conclusion, measurements of serum calcitonin values as early as 1 month after surgery can provide meaningful insights into the likelihood that a curative surgical procedure has been performed. It is known that patients that reaches excellent response to therapy, the incidence of recurrence are low (2), independently of initial anatomic staging. In this context, this study shows that rather than waiting 3-6 months to find out if surgery was effective, this early response to therapy assessment can be used to create realistic expectations about their disease status and prognosis shortly after definitive surgery.

Disclosure: no potential conflict of interest relevant to this article was reported.

Arch Endocrinol Metab. 2019;63/2

Prognostic value of 1 month calcitonin

REFERENCES

8. Wells SA Jr, Asa SL, Dralle H, Elisei R, Evans DB, Gagel RF, et at. American Thyroid Association Guidelines Task Force on Medullary Thyroid Carcinoma. Revised American Thyroid Association guidelines for the management of medullary thyroid carcinoma.

Thyroid. 2015;25:567-610.

10. Engelbach M, Görges R, Forst T, Pfützner A, Dawood R, Heerdt S, et al. Improved diagnostic methods in the follow-up of medullary thyroid carcinoma by highly specific calcitonin measurements. J Clin Endocrinol Metab. 2000;85:1890-4.

11. Pacini F, Castagna MG, Cipri C, Schlumberger M. Medullary thyroid carcinoma. Clin Oncol (R Coll Radiol). 2010;22:475-85.

12. Haddad, R. Practice Guidelines in Oncology – Thyroid Carcinoma v.2.2017. [NCCN website]. May 17, 2017. Available from: www. nccn.org/professionals/physician_gls/PDF/thyroid.pdf. Accessed on: Jan 10, 2018.

13. Faggiano A, Milone F, Ramundo V, Chiofalo MG, Ventre I, Giannattasio R, et al. A decrease of calcitonin serum concentrations less than 50 percent 30 minutes after Thyroid surgery suggests incomplete Ccell tumor tissue removal. J Clin Endocrinol Metab. 2010; 95:E32-6.

14. Brauckhoff M, Gimm O, Brauckhoff K, Ukkat J, Thomusch O, Dralle H. Calcitonin kinetics in the early postoperative period of medullary thyroid carcinoma. Langenbecks Arch Surg. 2001;386:434-9.

15. Fugazzola L, Pinchera A, Luchetti F, Iacconi P, Miccoli P, Romei C, et al. Disappearance rate of serum calcitonin after total thyroidectomy for medullary thyroid carcinoma. Int J Biol Markers. 1994;9:21-4.

16. Girelli ME, Dotto S, Nacamulli D, Piccolo M, De Vido D, Russo T, et al. Prognostic value of early postoperative calcitonin level in medullary thyroid carcinoma. Tumori. 1994; 80:113-7.

17. Ismailov SI, Piulatova NR. Postoperative calcitonin study in medullary Thyroid carcinoma. Endocr Relat Cancer. 2004;11:357-63.

18. Bümming P, Ahlman H, Nilsson B, Nilsson O, Wängberg B, Jansson S. Can the early reduction of tumour markers predict outcome in surgically treated sporadic medullary thyroid carcinoma? Langenbecks Arch Surg. 2008; 393:699-7.

9. DeLellis RA, Rule AH, Spiler I, Nathanson L, Tashjian AH Jr, Wolfe HJ. Calcitonin and carcinoembryonic antigen as tumor markers in medullary Thyroid carcinoma. Am J Clin Pathol. 1978;70:587-94.

19. Timboli P, Giovanella L. Serum calcitonin negative medullary thyroid carcinoma: a systematic review of the literature. Clin Chem Lab Med. 2015;53:1507-14.

1. Kebebew E, Ituarte PH, Siperstein AE, Duh QY, Clark OH. Medullary Thyroid carcinoma: clinical characteristics, treatment, prognostic factors, and a comparison of staging systems. Cancer.

2000;88:1139-48.

2. Lindsey SC, Ganly I, Palmer F, Tuttle RM. Response to initial therapy predicts clinical outcomes in medullary thyroid cancer. Thyroid. 2015;25:242-9.

3. Yang JH, Lindsey SC, Camacho CP, Valente FO, Germano-Neto F, Machado AL, et al. Integration of a postoperative calcitonin measurement into an anatomical staging system improves initial risk stratification in medullary thyroid cancer. Clin Endocrinol (Oxf).

2015;83:938-42.

4. Amin MB, Edge SB, Greene F, et al. AJCC Cancer Staging Manual. 8th ed. New York, NY: Springer; 2017.

5. Ho AS, Wang L, Palmer FL, Yu C, Toset A, Patel S, et al. Postoperative Nomogram for Predicting Cancer-Specific Mortality in Medullary Thyroid Cancer. Ann Surg Oncol. 2015;22:2700-6.

6. Machens A, Dralle H. Benefit-risk balance of reoperation for persistent medullary thyroid cancer. Ann Surg. 2013;257:751-7.

Copyright© AE&M all rights reserved.

7. Tuttle RM, Ganly I. Risk stratification in medullary thyroid cancer: moving beyond static anatomic staging. Oral Oncol. 2013;49:695-701.

Arch Endocrinol Metab. 2019;63/2

141

original article

Triiodothyronine (T3) upregulates the expression of proto-oncogene TGFA independent of MAPK/ERK pathway activation in the human breast adenocarcinoma cell line, MCF7 Departamento de Medicina Interna, Faculdade de Medicina de Botucatu, Universidade Estadual Paulista (UNESP), Botucatu, SP, Brasil 2 Universidade Estadual Paulista (UNESP), Botucatu, SP, Brasil 3 Departamento de Fisiologia e Biofísica, Instituto de Ciências Biomédicas, Universidade de São Paulo (USP), São Paulo, SP, Brasil * Tabata M. Silva and Fernanda C. F. Moretto equally contributed to the article 1

Correspondence to: Tabata M. Silva Departamento de Medicina Interna, Faculdade de Medicina de Botucatu, Universidade Estadual Paulista (UNESP) Av. Prof. Mário Rubens Guimarães Montenegro, s/n, Campus de Botucatu 18618687 – Botucatu, SP, Brasil tabata.dih@gmail.com Received on Apr/10/2018 Accepted on Dec/12/2018 DOI: 10.20945/2359-3997000000114

Tabata M. Silva1*, Fernanda C. F. Moretto1*, Maria T. De Sibio1, Bianca M. Gonçalves1, Miriane Oliveira1, Regiane M. C. Olimpio1, Diego A. M. Oliveira2, Sarah M. B. Costa1, Igor C. Deprá1, Vickeline Namba1, Maria T. Nunes3, Célia R. Nogueira1

ABSTRACT Objective: To verify the physiological action of triiodothyronine T3 on the expression of transforming growth factor α (TGFA) mRNA in MCF7 cells by inhibition of RNA Polymerase II and the MAPK/ERK pathway. Materials and methods: The cell line was treated with T3 at a physiological dose (10−9M) for 10 minutes, 1 and 4 hour (h) in the presence or absence of the inhibitors, α-amanitin (RNA polymerase II inhibitor) and PD98059 (MAPK/ERK pathway inhibitor). TGFA mRNA expression was analyzed by RT-PCR. For data analysis, we used ANOVA, complemented with the Tukey test and Student t-test, with a minimum significance of 5%. Results: T3 increases the expression of TGFA mRNA in MCF7 cells in 4 h of treatment. Inhibition of RNA polymerase II modulates the effect of T3 treatment on the expression of TGFA in MCF7 cells. Activation of the MAPK/ERK pathway is not required for T3 to affect the expression of TGFA mRNA. Conclusion: Treatment with a physiological concentration of T3 after RNA polymerase II inhibition altered the expression of TGFA. Inhibition of the MAPK/ERK pathway after T3 treatment does not interfere with the TGFA gene expression in a breast adenocarcinoma cell line.

Arch Endocrinol Metab. 2019;63(2):142-7

Keywords Thyroid hormone; nongenomic actions; gene expression; breast cancer

INTRODUCTION

Copyright© AE&M all rights reserved.

I

n the last few years, there has been a disturbing increase in the incidence of breast cancer (1), the second most common type of cancer and the fifth leading cause of cancer death worldwide (2). The thyroid hormone (TH) signaling pathway is complex and highly regulated by the expression of specific transporters of TH and multiple isoforms of the receptors of this hormone (TRs) present in several cells and by the interactions that occur between them (3,4).

Besides its classic action via TR/elements responsive to TH (TERs), TH can act by other mechanisms (5); such mechanisms can be called non-classical or nongenomic action.

There is evidence that TH may affect the organization of the cytoskeleton, a mechanism by which it could interfere with the trafficking of vesicles to the membrane; this mechanism appears to involve 142

αvβ3 integrin or a truncated TRα TH receptor that does not have a DNA binding domain and remains in the cytoplasm, where it can associate with other proteins/enzymes (3). From the interaction of TH with this integrin, the mitogen-activated protein kinase/extracellular signal-regulated kinase (MAPK/ ERK) pathway is activated, which mediates the nongenomic effects of triiodothyronine (T3) on angiogenesis (6).

TH may act through non-classical or non-genomic mechanisms by interacting with iodothyronine receptors found on the plasma membrane or in the cytoplasm. The initiation sites are proteins characterized as iodothyronine receptors (7). The so-called nongenomic mechanisms may potentially influence gene expression, the onset of the pathway is non-genomic, as they depend on alternative pathways, but the consequences include increased transcription (5).

Arch Endocrinol Metab. 2019;63/2

T3 on TGFA expression in MCF7

It is known that T3 plays a role in the development and progression of breast cancer, by inducing the expression of progesterone receptors and increasing the mRNA levels of proto-oncogenes, such as the transforming growth factor α (TGFA) (8,9).

TGFA can be produced by a variety of cells, primarily by cells of ectodermal origin and may interact with the Epidermal Growth Factor (EGF) receptor to induce growth and proliferation responses during cell contact (10). It is expressed in several tissues, from embryogenesis to the adult phase (11). TGFA has been described as a factor that is produced by tumor cells and is circumstantially implicated in the regulation of the autocrine growth of breast cancer cells (12,13); TGFA overexpression may occur during malignant progression (14). It has been reported that TGFA mRNA and protein can be detected in approximately 50-70% of breast tumors. In addition, 2-3 times higher levels of this biologically active factor can be found in the pleural effusions of patients with breast cancer (13).

Our group has shown that there is an increase in the expression of TGFA during T3 treatment (15), but this expression does not occur in cellular models that do not express the estrogen receptor or when the cells are simultaneously treated with antiestrogen medications, like tamoxifen (9,16).

For this study, we selected the MCF7 lineage of breast cancer cells. Since the 1980s, this cell line has been used as a model for breast tumors expressing estrogen receptor α (ERα), which is the main estrogen receptor (ER) expressed in this cell line and estrogen receptor β (ERβ) and also thyroid hormone receptor (TR) α and β (9,17-19).

The objective of the present study was to verify if the hormone T3, at a physiological concentration, activates the MAPK/ERK pathway (its inhibitor is PD98059) and RNA Polymerase II (its inhibitor is α-amanitin) to modulate the expression of TGFA gene in the MCF7 breast adenocarcinoma cell line in a short time period of 10 minutes (min), 1 and 4 hour (h) of treatment.

α-amanitin, triiodothyronine (T3), dimethylsulfoxide (DMSO), sodium hydroxide (NaOH) and charcoalstripped FBS were purchased from Sigma Aldrich (St Louis, MO, EUA).

Cell culture This project was approved by the Research Ethics Committee of Botucatu Medical School, protocol no.

3367-2009.

The MCF7 cell line, an eternal breast cancer cell line, was initially obtained from a primary culture of this cancer, developed from a pleural effusion of a female patient showing metastasis of the disease (20).

These cells express both ERα and β as well as TRα and β (9,18,19). The cell line, initially acquired from the American Type Culture Collection (ATCC), Manassas, Virginia, USA, was expanded, grown and maintained in the cell bank of the Clinical Medicine Experimental Laboratory, UNESP, Botucatu. The cells were grown in RPMI 1640 medium supplemented with 1.2 g/L NaHCO3, 10 nM Hepes with pH 7.4 and 10% FBS and maintained at 37 °C in 5% CO2. The medium was changed every two days. To deplete all hormone sources in the culture medium, the cells were incubated with phenol red-free medium, supplemented with 10% charcoal-stripped FBS. After incubation, cells were treated with a physiological concentration T3, 10-9M, for 10 min, 1 h or 4 h, with all treatments being initiated at the same time, following which the cells were collected.

The inhibitor and T3 hormone concentrations used were as follows: PD98059 (5 μM; T3 group associated with PD) was used as an inhibitor of the MAPK/ ERK pathway and α-amanitin (50 μg/mL; T3 group associated with α-amanitin) was used as a transcription inhibitor. The untreated group received only 0.1% NaOH (T3 diluent) and served as the control (C). The inhibitors PD98059 and α-amanitin were added to the medium 1 h prior to the T3 treatment. The experiments were performed in triplicate.

MATERIALS AND METHODS Reagents Roswell Park Memorial Institute (RPMI) 1640 medium, fetal bovine serum (FBS) and antibiotic solution at a 1:100 dilution were purchased from Gibco BRL (Grand Island, NY, USA). PD98059 (PD), Arch Endocrinol Metab. 2019;63/2

Total RNA was extracted from MCF7 cells using the Trizol method (Invitrogen, São Paulo, Brazil), according to the manufacturer’s instructions. The High-Capacity cDNA Reverse Transcription RT-PCR kit (Invitrogen, São Paulo, Brazil) was used for the synthesis of 20 μL of complementary DNA (cDNA) from 1000 ng of total RNA. TGFA levels (Hs00608187_m1, Applied 143

Copyright© AE&M all rights reserved.

Gene expression

T3 on TGFA expression in MCF7

Effect of T3 on the maintenance of TGFA gene expression after inhibition of RNA polymerase II in MCF7 cells After 4 h of treatment, the T3 group associated with α-amanitin showed a significant decrease in TGFA gene expression, compared to the T3 group. However, there was no change in the expression when comparing the TGFA expression in the α-amanitin group with that in the control group and in the T3 group associated with α-amanitin (Figure 2). Comparison CxT3, CxAM, T3xAM+T3 and AMxAM+T3.

A)

1.5 Gene expression of TGFA (relative values)

Statistical analysis For statistical analysis, ANOVA was used in conjunction with the Tukey test and Student’s t-test and a minimum significance of 5% was assumed. Data were expressed as the mean ± standard deviation.

0.5

3 3

+T AM

AM

p < 0.001

p < 0.001

1.5 n.s

1.0 0.5

3

+T AM

AM

3

T

C h 4

h 1

mi

n

Treatment groups 10

Copyright© AE&M all rights reserved.

3

C

n.s

2.0

0.0

0.0 Time

Figure 1. Effects of T3 treatment length on TGFA mRNA levels in MCF7 cells. C: Control; T3: Triiodothyronine. The treatment times were 10 min, 1 h and 4 h. Relative expression levels represent the mean of 3 replicates.

Statistical analysis was performed using a Student’s t-test; p<0.05 is considered significant.

144

+T

0.5

Treatment groups

Gene expression of TGFA (relative values)

Gene expression of TGFA (relative values)

1.0

1.0

0.0

C)

T3

AM

AM

There was a significant increase in the gene expression of TGFA after the treatment of MCF7 cells with T3 for 4 h, but the increase was not observed after the treatment time-points of 10 min and 1 h (Figure 1).

Comparison CxT3.

C

3

1.5 Gene expression of TGFA (relative values)

T3 increases the expression of TGFA mRNA in MCF7 cells in 4 h

1.5

T

C

Treatment groups

RESULTS

p < 0.05

0.5

0.0

B)

2.0

1.0

T

Biosystems, Foster City, CA) were determined by Real-Time Quantitative Reverse Transcription PCR (qRT-PCR). The quantitative measurements were performed with the Applied Biosystems StepOne Plus detection system using the commercial TaqMan kit for qPCR (Applied Biosystems), according to the manufacturer’s instructions. The amplification conditions were activation of the enzyme at 50°C for 2 min, denaturation at 95°C for 10 min and amplification for 40 cycles of denaturation at 95°C for 15 s and extension at 60°C for 1 min. The analyses were performed in duplicate. Gene expression was quantified relative to the values of the control group, after normalization of the expression to that of an internal control, GAPDH (Hs02758991_g1), by the method of 2-ΔΔCt, as previously described (21).

Figure 2. Effect of T3 in association with α-amanitin (AM) on the gene expression of TGFA in MCF7 cells. C: Control; T3: Triiodothyronine; AM: α-amanitin; AM+T3: α-amanitin associated with triiodothyronine.

Triiodothyronine treatment was performed for 10 min (A), 1 h (B) and 4 h (C). Relative expression levels represent the mean of 3 replicates.

Statistical analysis was performed using an ANOVA, supplemented with the Tukey test; p<0.05 is considered significant.

Arch Endocrinol Metab. 2019;63/2

T3 on TGFA expression in MCF7

After 4 h of treatment, the T3 group associated with PD showed a significant increase in TGFA gene expression, compared to the T3 group and the PD group.

However, there was no change in this expression when we compared the TGFA expression in the PD and control groups (Figure 3). Comparison CxT3, CxPD, T3xPD+T3 and PDxPD+T3.

1.5 Gene expression of TGFA (relative values)

A)

1.0

0.5

3

+T PD

PD

3

T

C

0.0

Treatment groups 2.0 Gene expression of TGFA (relative values)

B)

1.5 1.0 0.5

3

+T PD

PD

3

T

C

0.0

Treatment groups p < 0.05

2.5 Gene expression of TGFA (relative values)

C)

n.s

2.0

p < 0.001

p < 0.05

1.5 1.0 0.5

3

PD +T

PD

3

T

C

0.0

Treatment groups

Figure 3. Effect of T3 in association with PD98059 (PD) on the gene expression of TGFA in MCF7 cells. C: Control; T3: Triiodothyronine; PD: PD98059; PD+T3: PD98059 associated with triiodothyronine.

Triiodothyronine treatment was performed for 10 min (A), 1 h (B) and 4 h (C). Relative expression levels represent the mean of 3 replicates.

Statistical analysis was performed using an ANOVA, supplemented with the Tukey test; p<0.05 is considered significant.

Arch Endocrinol Metab. 2019;63/2

DISCUSSION In the breast cancer cell line MCF7, T3 regulates gene expression either by binding to specific TRs that bind to TREs in the promoter region of target genes (22-25), or by activating alternative pathways, such as the MAPK/ ERK pathway, via their initiation sites, which are present in the plasma membrane or in the cytoplasm (7).

Our group identified an increase in the expression of TGFA (indicative of increased proliferative activity) in primary breast cancer cultures following treatment with estrogen and T3 (16). Moretto and cols. (15) demonstrated an increased TGFA expression in MCF7 cells after treatment with supraphysiological concentrations of T3 (10-8M) over periods of 10 min, 30 min, 1 h, and 4 h. In the present study, we show that treatment with physiological concentrations of T3 (10-9M) also increases the expression of TGFA, corroborating the results obtained by Moretto and cols.; however, at this lower dosage we were unable to detect expression changes in treatments under 4 h.

Fernandez and cols. (26) studied the effects of triiodothyronine on MDA-468 breast cancer cells, showing that at physiological doses, the hormone exerts control over the actions of TGFA. Unlike these studies, we show that short treatments with physiological concentrations of T3 do not affect TGFA expression.

Brito and cols. (27) demonstrated that TGFA expression is increased in esophageal cancer, indicating differential regulation of the gene in esophageal tumorigenesis. α-amanitin is a general transcription inhibitor that is selective for RNA polymerase II and is approved for the treatment of some types of sarcomas (28,29).

We have shown that on exposure to physiological T3 concentrations, there was an increase in the TGFA expression in a breast cancer cell line after 4 h, which suggests that further studies should be done to determine the effects of transcription blocking drugs on breast adenocarcinoma cell lines. Our data suggest that α-amanitin may provide additional therapeutic benefits when used in combination with other anticancer agents. This could allow for the development of more specific and effective drugs in the treatment of breast adenocarcinomas.

We determined that T3-mediated inhibition of the MAPK/ERK pathway leads to overexpression of TGFA. Studies have reported that increased expression of EGFR family proteins are a poor prognostic factor for cancer patients (30-32); is also associated with tumor 145

Copyright© AE&M all rights reserved.

Activation of the MAPK/ERK pathway is not required for T3 to affect the expression of TGFA mRNA

T3 on TGFA expression in MCF7

aggressiveness (32) and resistance to chemotherapy (30) and their levels are increased in 30% of solid tumors (31). Hence, we can infer that as the MAPK/ ERK pathway is not modulated by T3 treatment, this hormone can use some precursor that induces increased tumorigenesis in MCF7 cells. This situation was previously described in a report by Boldt and cols.

(33), who demonstrated that the modulation of the MAPK/ERK pathway, as an adjuvant treatment for breast cancer, is of limited value, as it may increase or decrease the efficacy of other chemotherapeutic drugs.

We conclude that the treatment of MCF7 cells with physiological doses of the hormone T3, over a period of 4 h, leads to an increased expression of TGFA via RNA Polymerase II. We also conclude that T3 does not increase TGFA expression by acting on the MAPK/ ERK pathway.

The results obtained in this study, together with previous results from our research group, suggest that T3 acts via nuclear pathways when present at physiological doses and via extra-nuclear pathways when present at supraphysiological doses.

Further studies are required to explore the effects of the modulation of the TGFA proto-oncogene in the treatment of breast adenocarcinomas.

Funding: this work was supported by FAPESP: scientific initiation process no. 2015/09686-8, thematic project process no.

2013/05629-4 and doctoral project process no. 2014/15209-5.

Disclosure: no potential conflict of interest relevant to this article was reported.

REFERENCES 1. Porter PMD. “Westernizing” Women’s Risks? Breast cancer in lower-income countries. N Engl J Med. 2008;358(3):213-6.

Copyright© AE&M all rights reserved.

2. Ferlay J, Soerjomataram I, Dikshit R, Eser S, Mathers C, Rebelo M, et al. Cancer incidence and mortality worldwide: Sources, methods and major patterns in GLOBOCAN 2012. Int J Cancer.

2015;136(5):359-86.

7. Cheng SY, Leonard JL, Davis PJ. Molecular aspects of thyroid hormone actions. Endocr Rev. 2010;31(2):139-70.

8. Hall LC, Salazar EP, Kane SR, Liu N. Effects of thyroid hormones on human breast cancer cell proliferation. J Steroid Biochem Mol Biol. 2008;109(1-2):57-66.

9. Nogueira CR, Bentani MM. Triiodothyronine mimics the effects of estrogen in breast cancer cell lines. Molec Biol J Steroid Biochem Moh’c Biol. 1996;59(3-4):271-9.

10. Wilcox JN, Derynck R. Developmental expression of transforming growth factors alpha and beta in mouse fetus. Mol Cell Biol.

1988;8(8):3415-22.

11. Rappolee DA, Brenner CA, Schultz R, Mark D, Rappolee DA, Brenner CA, et al. Developmental expression of PDGF, TGF-alpha, and TGF-beta genes in preimplantation mouse embryos. Nature.

1988;241(4874):1823-5.

12. Verheul HMW, Voest EE, Schlingemann RO. Are tumours angiogenesis-dependent? J Pathol. 2004;202(1):5-13.

13. Ciardiello F, Kim N, McGeady ML, Liscia DS, Saeki T, Bianco C, et al. Expression of transforming growth factor alpha (TGF alpha) in breast cancer. Ann Oncol. 1991;2(3):169-82.

14. Pavelic K, Hrascan R, Kapitanovica S, Karapandza N, Vranes Z, Belicza M, et al. Multiple genetic alterations in malignant metastatic insulinomas. J Pathol. 1995;177(4):395-400.

15. Moretto FCF, De Sibio MT, Luvizon AC, Olimpio RMC, De Oliveira M, Alves CAB, et al. Triiodothyronine (T3) induces HIF1A and TGFA expression in MCF7 cells by activating PI3K. Life Sci. 2016;154:52-7.

16. Conde SJ, Luvizotto RAM, Sibio MT, Katayama MLH, Brentani MM, Nogueira CR. Tamoxifen inhibits transforming growth factor-alpha gene expression in human breast carcinoma samples treated with triiodothyronine. J Endocrinol Invest.

2008;31(12):1047-51.

17. Brandes LJ, Hermonat MW. Receptor status and subsequent sensitivity of subclones of MCF-7 human breast cancer cells surviving exposure to diethylstilbestrol. Cancer Res. 1983;43(6):2831-5.

18. Razandi M, Pedram A, Merchenthaler I, Greene GL, Levin ER. Plasma membrane estrogen receptors exist and functions as dimers. Mol Endocrinol. 2004;18(12):2854-65.

19. McGuire WL, Chamness GC, Costlow ME, Shepherd RE. Hormone dependence in breast cancer. Metabolism. 1974;23(1):75-100.

20. Brooks S, Locke E, Soule H. Estrogen receptor in a human cell line (MCF-7) from breast carcinoma. J Biol Chem. 1973;248(17):6251-3.

21. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2 (- delta delta C (T)) method. Methods. 2001;25(4):402-8.

22. Larsen PR, Harney JW, Moore DD. Sequences required for celltype specific thyroid hormone regulation of rat growth hormone promoter activity. J Biol Chem. 1986;261(31):14373-6.

23. Catanzaro DF, West BL, Baxter JD, Reudelhuber TL. A pituitaryspecific factor interacts with an upstream promoter element in the rat growth hormone gene. Mol Endocrinol. 1987;1(1):90-6.

3. Cheng SY. Thyroid hormone receptor mutations and disease: Beyond thyroid hormone resistance. Trends Endocrinol Metab.

2005;16(4):176-82.

24. Ye, ZS, Samuels H. Cell-and sequence-specific binding of nuclear proteins to 5’-flanking DNA of the rat growth hormone gene.

1987;262(13):6313-7.

4. Williams GR. Neurodevelopmental and neurophysiological actions of thyroid hormone. J Neuroendocrinol. 2008;20(6):784-94.

25. Gustafson TA, Markhamt BE, Bahlt JJ. Thyroid hormone regulates expression of a transfected a-myosin heavy-chain fusion gene in fetal heart cells. 1987;84(5):3122-6.

5. Moeller LC, Broecker-Preuss M. Transcriptional regulation by nonclassical action of thyroid hormone. Thyroid Res. 2011;4(Suppl 1):S6.

6. Bergh JJ, Lin H-Y, Lansing L, Mohamed SN, Davis FB, Mousa S, et al. Integrin AVB3 contains a cell surface receptor site for thyroid hormone that is linked to activation of mitogen-activated protein kinase and induction of angiogenesis. Endocrinology.

2005;146(7):2864-71.

146

26. Fernandez PJ, Klos DJ, Hamilton PD. Modulation of transforming growth factor alpha-dependent expression of epidermal growth factor receptor gene by transforming growth factor beta, triiodothyronine, and retinoic acid. J Cell Biochem. 1989;41(3): 159-70.

27. Brito MJ, Filipe MI, Linehan J, Jankowski J. Association of transforming growth factor alpha (TGFA) and its precursors with Arch Endocrinol Metab. 2019;63/2

T3 on TGFA expression in MCF7

malignant change in Barrettâ&#x20AC;&#x2122;s epithelium: Biological and clinical variables. Int J Cancer. 1995;60(1):27-32.

Cancer Res. Journal of Experimental & Clinical Cancer Research; 2016;35(1):1-12.

28. Tattersall MHN, Sodergreen JE, Sengupta SK, Trites DH, Modest EJ, Frei E. Pharmacokinetics of actinomycin D in patients with malignant melanoma. Clin Pharmacol Ther. 1975;17(6):701-7.

31. Wykosky J, Fenton T, Furnari F, Cavenee WK. Therapeutic targeting of epidermal growth factor receptor in human cancer: Successes and limitations. Chin J Cancer. 2011;30(1):5-12.

29. Estlin EJ, Veal GJ. Clinical and cellular pharmacology in relation to solid tumours of childhood. Cancer Treat Rev. 2003;29(4): 253-73.

32. Ferreira GM, Martinez M, Camargo ICC, Domeniconi RF, Martinez FE, de Almeida Chuffa LG. Melatonin attenuates Her-2, p38 MAPK, p-AKT, and mTOR levels in ovarian carcinoma of ethanolpreferring rats. J Cancer. 2014;5(9):728-35.

33. Boldt S, Weidle UH, Kolch W. The role of MAPK pathways in the action of chemotherapeutic drugs. Carcinogenesis.

2002;23(11):1831-8.

CopyrightŠ AE&M all rights reserved.

30. Gao J, Ulekleiv CH, Halstensen TS. Epidermal growth factor (EGF) receptor-ligand based molecular staging predicts prognosis in head and neck squamous cell carcinoma partly due to deregulated EGF- induced amphiregulin expression. J Exp Clin

Arch Endocrinol Metab. 2019;63/2

147

original article

Effects of a new approach of aerobic interval training on cardiac autonomic modulation and cardiovascular parameters of metabolic syndrome subjects Laís Manata Vanzella1, Stephanie Nogueira Linares2, Rodolfo Augusto Travagin Miranda1, Anne Kastelianne França da Silva1, Diego Giuliano Destro Christófaro3, Jayme Netto Júnior3, Luiz Carlos Marques Vanderlei3

Programa de Pós-Graduação em Fisioterapia, Universidade Estadual Paulista, Presidente Prudente, SP, Brasil 2 Programa de Pós-Graduação em Fisioterapia, Universidade Federal de São Carlos, São Carlos, SP, Brasil 3 Departamento de Educação Física, Universidade Estadual Paulista, Presidente Prudente, São Paulo, Brasil 1

Correspondence to: Laís Manata Vanzella Universidade Estadual Paulista Rua Roberto Símonsen, 305 19060-900 – Presidente Prudente, SP, Brasil laismv@hotmail.com Received on Jan/23/2018 Accepted on Dec/12/2018 DOI: 10.20945/2359-3997000000111

ABSTRACT Objective: To evaluate the effects of 16 weeks of periodized aerobic interval training (AIT) on cardiac autonomic modulation and cardiovascular parameters of metabolic syndrome (Mets) individuals.

Subjects and methods: The sample was composed of 52 subjects with a diagnosis of Mets, allocated into two groups: AIT (AITG; n = 26) and control (CG; n = 26). The AITG was submitted to a periodized AIT program, over 16 weeks, while CG was not submitted to any training program. To evaluate the autonomic modulation and cardiovascular parameters in both groups, heart rate variability (HRV) indices, blood pressure (BP), and heart rate (HR) were measured at the beginning and end of the training. Results: Statistically significant differences were not observed in HFms2 (high frequency in milisseconds), LFnu (low frequency in normality unit), HFnu (high frequency in normality unit), and LF/HF ratio indices, or in the cardiovascular parameters BP and HR when comparing the AITG with the CG. However, significant increases in rMSSD (root-means square differences of successive R-R intervals), LFms2 (low frequency in milliseconds), and SDNN (standard deviation of normal to normal intervals) were observed in the AITG. Conclusion: Periodized AIT promoted positive effects on autonomic modulation of Mets subjects, characterized by an increase in the parasympathetic, sympathetic, and global modulation of this population. Additionally, cardiovascular parameter alterations were not observed in Mets subjects submitted to periodized AIT. Arch Endocrinol Metab.

2019;63(2):148-56 Keywords Autonomic nervous system; heart rate; blood pressure; metabolic syndrome; syndrome x; exercise

INTRODUCTION

Copyright© AE&M all rights reserved.

M

etabolic syndrome (Mets) is a complex disorder represented by a cluster of at least three cardiovascular risk factors (RF) that include high values of fasting blood glucose, triglycerides, blood pressure, and abdominal circumference and low HDLcholesterol (1). Mets has a high prevalence around the world, being present in about 23.7% of the American population (2), 30% of the European population (3), 27.4% of subjects in the north of China (4), and 29.6% of Brazilian individuals (5).

Among various alterations promoted by Mets (6-8) are some related to the autonomic nervous system (ANS), characterized by a reduction in vagal and global modulation of ANS and an increase in sympathetic atuation (9). Alterations on autonomic modulation in different conditions like Mets (6-8), can be identified 148

by heart rate variability (HRV) method, a noninvasive technique that describe oscillations between consecutives heart beats (R-R intervals). It is widely used to evaluate ANS influences in sinus node, that can be used to identify physiological stimuli and to disease induced to disorders (10).

Linear methods is one of the ways to analyze HRV. They were divided in time domain analysis and frequency domain analysis. Among the indices in time domain, we can cite: SDNN (standard deviation of normal to normal intervals) and rMSSD (root-means square differences of successive R-R intervals), that represent global and parasympathetic modulation, respectively (10).

In frequency domain analysis we can cite the indices: LFms2 (low frequency in milliseconds) and LFun (low frequency in normality unit) which is due to the joint action of the vagal and parasympathetic components on Arch Endocrinol Metab. 2019;63/2

Aerobic training on metabolic syndrome

Arch Endocrinol Metab. 2019;63/2

SUBJECTS AND METHODS The study is characterized as a nonrandomized control trial, which considers the effects of periodized AIT on cardiac autonomic modulation and cardiovascular parameters in subjects with Mets. The clinical trial was registered in ClinicalTrials.gov (NCT03119493).

The procedures of the study were approved by the Committee for Ethics and Research of the institution (CAAE: 53117116.0.0000.5402). The volunteers were informed about the procedures and aims of this study, and after agreeing to participate, signed a written informed consent form. In addition, each volunteer attached a copy of a medical certificate confirming them to be in a sufficient physical condition to perform the exercises.

Experimental approach For realization of this study, an interview was performed with each volunteer to identify personal data (name, age, and sex) and medication in use (investigated throughout the protocol) and all volunteers underwent an initial assessment which included anthropometric measures (height and weight), for sample characterization. After these procedures, blood pressure (BP) was measured.

Subsequently, the HR were recorded beat-by-beat using a heart rate monitor (Polar S810i, Finland), for 30 minutes in the supine position, for cardiac autonomic modulation analysis and resting HR acquisition.

After the initial evaluation, the volunteers were allocated by convenience into two groups: periodized AIT group (AITG) and control group (CG) and oriented to maintain their usual diet and daily activities during the study. The AITG were submitted to a 16 week periodized AIT program with a weekly frequency of three sessions, totalizing 48 sessions with a recovery interval between the sessions varying from 24 to 72 hours. The CG realized the same assessments as the AITG, however they did not perform any type of training protocol during the 16 weeks post the initial evaluation. The cardiovascular parameters were assessed and the HR beat-by-beat recorded again in both groups, for analysis of cardiac autonomic modulation, seven days after the end of the training protocol, to minimize possible residual effects of training.

In the AITG, only the subjects that demonstrated at least 85% presence in the periodized AIT protocol were reassessed. Intention to treat analysis was carried out for the remaining volunteers, who, after the period of 16 149

CopyrightŠ AE&M all rights reserved.

the heart, with predominance of the sympathetic ones, HFms2 (high frequency in milliseconds), HFun (high frequency in normality unit) which is an indicator of the vagus nerve on the heart, and the LF/HF ratio, that reflects the absolute and relative changes between the sympathetic and parasympathetic components of the ANS (10).

Autonomic alterations described above suggest a physiologic malfunction of the ANS and are related to high vulnerability of the heart and a risk of cardiovascular events (11). In this context, strategies that can act positively on autonomic modulation, such as physical exercise (12-14) should be studied in subjects with Mets to reduce cardiovascular risk in this population.

In healthy subjects or those with pathological conditions, aerobic interval training (AIT) has been highlighted for its easy applicability and positive effects that include increases in parasympathetic autonomic modulation and global variability (13,15,16), however, to our knowledge, there are no studies that evaluated the effects of this type of intervention on autonomic behavior in subjects with Mets.

Regarding this type of intervention, in the load dynamics utilized in studies that evaluated these effects on the autonomic modulation of different populations (13,15,16), a lack was observed with respect to the periodization and systematization of the training. Due to its specificity, the existing periodized models of training can be adapted for subjects with pathological conditions and, in this sense, periodization that includes preparatory periods with progressive increases in load, specific phases with less duration of intensity, and periods of transition for recuperation, could be seen as a new type of treatment that promotes security and efficacy in this population.

Taken together, these data point to some gaps in the literature. Could the realization of a periodized AIT program adapted for Mets subjects promote alterations in cardiac autonomic modulation and/or cardiovascular parameters? If so, what will these changes in cardiac autonomic modulation and cardiovascular parameters be?

In this sense, the objective of this study was to evaluate the effects of periodized AIT on cardiac autonomic modulation and cardiovascular parameters in Mets subjects. The hypothesis was that periodized AIT would promote positive alterations in cardiac autonomic modulation and cardiovascular parameters in Mets subjects.

Aerobic training on metabolic syndrome

weeks and final assessments in the control group, were offered the same opportunity to realize the periodized AIT, complying with ethical criteria.

Population The study population was recruited through digital media (television), campaigns held in a public square in the commercial center of a city in the interior of São Paulo, and delivery of folders in supermarkets, bank branches, pharmacies, health centers, and the fire brigade.

To define the sample size, the sample calculation based on the rMSSD index obtained in a study of Pichot and cols. (13) was performed. The magnitude of the significant difference assumed was 9 milliseconds (ms), considering a standard deviation of 7 ms, with an alpha risk of 5%, and beta of 80%, the sample size resulted in a minimum of 20 individuals in each group, and this value was increased by 30% considering possible sample losses.

Individuals who had been in regular physical activity in the previous six months, had an inflammatory Enrollment

and/or infectious process, an episode of muscletendon or osteoarticular injury in the lower limbs and/or spine, pacemaker, diagnosis of arritmia, had known respiratory, neurological and/or cardiovascular diseases, were excluded from the study.

Initially, 680 individuals were assessed for eligibility, of which 628 were excluded (541 did not meet the inclusion criteria, 34 gave up participating in the study, and 53 gave up for personal reasons). Fiftyfive adult subjects of both genders, aged 40-60 years, and Mets patients according to the criteria defined by the International Diabetes Federation (IDF) (1) participated effectively in the study. In the intervention group, one individual was excluded due to a capitation error, seven dropped out of the study due to transportrelated problems to reach the rehabilitation center, and one gave up due to a skeletal muscle injury unrelated to the training protocol. In the control group, two individuals were excluded due to a capture error and four dropped out of the study due to changes in the municipality and personal reasons (Figure 1).

Assessed for eligibility (n = 680) Excluded (n = 628) • Not meeting inclusion criteria (n = 541) • Declined to participate (n = 34) • Other reasons (n = 53) Randomized (n = 55)

Allocation Allocated to intervention (n = 28) • Received allocated intervention (n = 26) • Excluded due to poor signal capture (n = 2)

Allocated to intervention (n = 27) • Received allocated intervention (n = 26) • Excluded due to poor signal capture (n = 1)

Follow-Up Lost to follow-up (n = 4)

Copyright© AE&M all rights reserved.

Lost to follow-up (n = 7) Skeletal muscle injury (n = 1)

Analysis Analysed (IT) (n = 26)

Analysed (IT (n = 26)

Figure 1. Flow diagram.

150

Arch Endocrinol Metab. 2019;63/2

Aerobic training on metabolic syndrome

The training program was performed on a treadmill (movement, professional LC-160, Brazil and Inbramed, Export, Brazil) for 16 weeks, totalizing 39 sessions, with recovery intervals of between 24 and 72 hours, a weekly frequency of 3 times, and duration of 30 to 75 minutes per session.

Each session of the program was divided into 3 phases: warm-up, training, and cool down. The warm-up had a duration of 10 minutes, with 5 minutes of global stretching of the lower and upper limbs and 5 minutes of walking on the treadmill with a HR less than 20% of heart rate reserve (HRR). The cool down, also lasted 10 minutes and was composed of 5 minutes of walking on the treadmill with a HR of less than 20% of HRR and 5 minutes at rest. To monitor the volunteers, before the warm-up and after the cool down, vital signs were analyzed (BP, HR). Additionally, after the cool down the Borg scale was applied, to verify the perceived effort for each volunteer during the training.

The training phase was executed in a progressive form, with the intensity of training varying between 20% and 90% of HRR, as recommended by the European Association of Cardiovascular Prevention

and Rehabilitation, the American Association of Cardiovascular and Pulmonary Rehabilitation, and the Canadian Association of Cardiac Rehabilitation (17).

The active recovery between the series was realized at an intensity between 19% and 50% of HRR, according to the intensity of training: mild, moderate, and high.

The load dynamics, that is, the number of series and repetitions (time of effort), time of recovery between the series, total volume of AIT performed, and intensity of the effort are described in Figure 2.

As can be observed in Figure 2, the weeks of training were divided into intensity levels, mild (I) (training range 20-39% of HRR and recovery of 19% of HRR), moderate (II) (training range 40-59% of HRR and recovery of 30% of HRR), and high (III) (training range 60-90% of HRR and recovery of 50% of HRR).

The distributions of load for the AITG, number of series, times of effort were fixed for all volunteers. The time of recovery between the series (1 to 4 minutes), total time (sum of effort total time and recovery time between the series), and speed of effort were variable and established individually considering the subject’s response during the session and the percent at which the training was realized. The intensity of effort and

Week (phase)

Sessions

Sets x effort time

Recovery time between sets

Total time (effort time + recovery time)

1st 2nd 3rd 4th 5th 6th

1st and 2nd

5 x 4 minutes

1-4 minutes

24-32 minutes

3 and 4

6 x 4 minutes

1-4 minutes

29-39 minutes

7 x 4 minutes

1-4 minutes

34-46 minutes

7 , 8 and 9

8 x 4 minutes

1-4 minutes

39-53 minutes

10th, 11th and 12thª

9 x 4 minutes

1-4 minutes

44-60 minutes

rd

th

5th and 6th th

th

th

5 Recovery week th

(Adaptation)

13th, 14th and 15th

9 x 4 minutes

1-4 minutes

44-60 minutes

7 8th 9th 10th 11th

16 and 17

4 x 2.5 minutes

1-4 minutes

13-19 minutes

th

18 and 19

5 x 2.5 minutes

1-4 minutes

16.5-24.5 minutes

20th and 21st

6 x 2.5 minutes

1-4 minutes

20-30 minutes

thª

22 , 23 and 24

7 x 2.5 minutes

1-4 minutes

23.5-41 minutes

25th, 26th and 27th

7 x 2.5 minutes

1-4 minutes

23.5-41 minutes

th

th

th

th

nd

rd

(Intermediate) 12th 13th 14th 15th 16th (Final)

Training: 20-39% of HRR

Recovery: 19% of HRR (Light) Training: 40-59% of HRR Recovery: 30% of HRR (Moderate)

11 Recovery week th

28th and 29th

5 x 1.5 minutes

1-4 minutes

st

30 and 31

6 x 1.5 minutes

1-4 minutes

14-24 minutes

32nd and 33rd

7 x 1.5 minutes

1-4 minutes

16.5-28.5 minutes

th

Intensity of HRR %

11.5-19.5 minutes

14th Recovery week 34th, 35th and 36th

8 x 1.5 minutes

1-4 minutes

19-33 minutes

37ª, 38ª e 39ª

9 x 1.5 minutes

1-4 minutes

21.5-37.5 minutes

Training: 60-90% of HRR Copyright© AE&M all rights reserved.

Training program

Recovery: 50% of HRR (High)

Figure 2. Load dynamics (number of sets and repetitions, effort time, recovery time, total time, and effort intensity) of aerobic interval training.

Arch Endocrinol Metab. 2019;63/2

151

Copyright© AE&M all rights reserved.

Aerobic training on metabolic syndrome

HR recovery value were determined though the HRR, a form of prescription recommended by the ACSM (18), which can be easily utilized in clinical practice.

The HRR was obtained by the formula: HRR = (HRmax – HRrest) x %training + HRrest, being the maximal HR (HRmax) obtained through the Karvonen formula (HRmax = 220 – age [in years]) (18,19) and the resting HR (HRrest) obtained using a HR monitor with the volunteer at rest for 30 minutes; the average HR at 5 to 25 minutes was obtained using the Polar Pro Trainer program (5.41.002 version).

For the volunteers that used beta blockers, the HR was corrected by the formula: %HR of correction = y + 95.58/9.74 (20) where y is the dose in mg of propranolol or equivalent drug (for the dosage of the equivalent medication of propranolol, the Kaplan table was utilized) (10). The percentage resulting from this formula was subtracted from the HRmax for further corrections to the HRR. During the sessions, the subjects always used the same ergometer and vital signs were monitored (HR and BP), verified at the start of each active recovery period, and signs and symptoms were monitored throughout all sessions.

software (5.41.002 version) and 1000 RR consecutive intervals analyzed, before digital filtering complemented by manual filtering to eliminate ectopic, artifacts, and premature beats, realized by a blind evaluator. Only series with more than 95% sinus beat were included in the study (10). The HRV analysis was performed by linear methods (time and frequency domains) (10).

The rMSSD and SDNN indices were analyzed in the time domain. The rMSSD corresponds to the root mean square of the successive differences between the RR intervals in the record, divided by the number of RR intervals in a given time minus one RR interval.

The SDNN corresponds to the standard deviation of all normal RR intervals (10).

In the frequency domain, the spectral components of low frequency (LF: 0.04 – 0.15 Hz) and high frequency (HF: 0.15 – 0.40 Hz) were evaluated, in milliseconds squared (ms2) and normalized units (nu), and the relation between low and high frequency components (LF/HF). The spectral analyses were calculated utilizing the algorithm of Fast Fourier transform.

Heart rate variability evaluation

Blood pressure was verified in an indirect manner using a stethoscope (Littman, United State) and aneroid sphygmomanometer (WelchAllyn, Germany) (21). The cardiac frequency was evaluated with a HR monitor (Polar S810i, Finland).

Cardiac autonomic modulation was evaluated through heart rate variability (HRV). For this analysis, the HR was recorded beat-by-beat in the morning period (7h to 11h a.m.) in a room artificially heated to between 21ºC and 24ºC with relative air humidity between 40 and 60%. The volunteers were oriented not to consume stimulating substances such as tea, coffee, soda, chocolate, and alcoholic drinks for 24 hour prior to the HRV analysis.

To record HR, a HR monitor (Polar S810i, Finland) was placed on the distal third of the sternum, equipment previously validated for recording heart rate beat-to-beat and calculation of the HRV indices (10).

During the HR recording, the volunteers remained lying on a stretcher at rest, without moving or talking during the execution, and breathing spontaneously for 30 minutes in the supine position. The circulation of people was not permitted in the room during the data collection to reduce the anxiety of the subjects and avoid recording errors.

The data obtained from the HR monitor were transferred to a computer through Polar ProTrainer 5 152

Cardiovascular parameter

Data analysis Descriptive statistics were used to describe the population profile and the results are presented as average, standard deviation, medium, minimum, and maximum, and confidence interval of 95%.

For evaluation of the effects of the training on cardiovascular parameters and cardiac autonomic modulation, the difference between the values obtained at the end and start of the training protocol were compared in both groups. For this and for comparison of the group characteristics, covariance analysis (ANCOVA) was realized. This analysis compared the difference in the average between the control and training group, adjusting for possible confounders, sex, age and high blood pressure (controlled or not by betablockers and Ca+ channel blocker medication), that should be controlled due to their direct relationship with autonomic modulation. The significance level Arch Endocrinol Metab. 2019;63/2

Aerobic training on metabolic syndrome

adopted was established at 5% for all tests. The statistical program SPSS (13.0 version) (SPSS Inc., Chicago, IL, EUA) was used for this analysis.

RESULTS Table 1 presents the baseline characteristics of the two groups studied as well as the presence of each one of the Mets markers and the medication used by both groups, separated by class. Although it is possible to

note statistically significant differences in the variable weight, for the other variables, including BMI, no significant differences were observed.

The effects of periodized AIT on linear indices of HRV in the time and frequency domains and cardiovascular parameters can be visualized in Table 2. An increase in rMSSD, SDNN, and LFms2, were observed in the AITG group (p < 0.05). For HFms2, HFnu, and LF/HF, no statistically significant differences were observed. For cardiovascular parameters, no significant

Table 1. Characterization, Mets components, and class of medication used by volunteers separated by groups

AITG (n = 26)

CG (n = 26)

P value

Age (years)

49.96 ± 6.53 (40.00 – 59.00)

52.44 ± 6.42 (40.00 – 60.00)

0.16

0.93 ± 0.05 (0.83 – 1.04)

0.91 ± 0.06 (0.72 – 1.04)

0.23

AC (cm)

111.67 ± 10.39 (96.00 – 133.00)

107.61 ± 9.96 (94.50 – 133.00)

0.15

Weight (kg)

95.11 ± 16.39 (64.40 – 127.10)

83.25 ± 16.89 (56.00 – 124.7)

0.01

Height (m)

1.71 ± 0.09 (1.52 – 1.91)

1.63 ± 0.08 (1.47 – 1.80)

0.07

BMI (kg/m2)

32.38 ± 4.28 (23.94 – 40.56)

30.75 ± 4.42 (23.92 – 39.59)

0.18

BP

80.76

80.76

Blood glucose

69.23

69.23

Triglycerides

73.07

38.46

Waist-hip ratio

Mets compounded (%)

Low HDL

57.69

46.15

WC increased

100.00

100.00

Ca+ channel blocker

11.53

19.23

Antagonist of angiotensina II

46.15

34.61

Thiazide diuretics

30.76

34.61

Beta blockers

11.23

42.30

ECA inhibitors

15.38

7.69

Insulin

7.69

23.07

Sulfonylurea

3.84

26.92

DPP4 inhibitor

3.84

3.84

Metformin

19.23

30.76

Statin

26.92

30.76

Fibrate

7.69

0.00

Thiazolidinedione

0.00

7.69

Antiplatelet agent

7.69

3.84

Others

34.61

23.07

Boldface indicates statistical significance (p < 0.05). Average ± standard deviation (minimum – maximum).

AC: abdominal circumference; BMI: body mass index; Mets: Metabolic syndrome; cm: centimeters; kg: kilogram; m: meters; m2: square meters; %: percent; HBP: high blood pressure; HDL: high density lipoprotein; Ca+: Calcium; ECA: angiotensin converting enzyme; DPP4: dipeptidyl peptidase-4; HDL: high density lipoprotein.

Arch Endocrinol Metab. 2019;63/2

153

Copyright© AE&M all rights reserved.

Class of medication (%)

Aerobic training on metabolic syndrome

differences were observed for either group. Despite the absence of significance, the variables DBP and HR reduced in the AITG.

modulation in the AITG group was also observed in the HFms2 index, which presented a moderate effect size.

The mechanisms involved in the increase in HRV, and principally in parasympathetic modulation, in individuals submitted to exercise are speculative. Studies indicate that the fact could be related to a reduction in levels of angiotensin II, a substance that inhibits vagal activity (24). In addition the increase in nitric oxide could be related to an activation of vagal modulation, however further investigations related to this aspect are still necessary (25).

In addition to the indices described above, a significant increase in LFms2 was observed in our study. Studies demonstrate that this index is related to the global modulation of ANS with sympathetic predominance (10), furthermore, the LF was related to baroreflex gain, suggesting that it represents the ability to modulate the ANS influence on the heart though the baroreflex action (26).

With regard to baroreflex sensibility, it has been demonstrated that Mets components are related to a cardiovagal baroreflex dysfunction, representing increased cardiovascular risk in this population (27). A significant increase in the LFms2 index was observed in individuals of the AITG group, which suggests higher baroreflex gain in this population, and consequently, higher adaptation capacity of the ANS. With regard to the LF/HF ratio and the LF and HF indices in normalized units, statistically significant differences were not observed between groups. The increase in both indices in the frequency domain (LFms2

DISCUSSION The results of the present study suggest significant improvement in parasympathetic, sympathetic, and global modulation of HRV in the AITG group, considering the significant increase in rMSSD, LFms2, and SDNN indices respectively. For other HRV indices analyzed, including HFms2, LFun, HFun, and LF/ HF ratio, as well as the cardiovascular parameters SBP, DBP, and HR, statistically significant differences were not observed between the AITG and CG. Although the effects of the periodized AIT proposed by this study on the autonomic modulation of Mets individuals was not found in the literature (15,22) showed that the utilization of AIT in healthy subjects promoted improvement in parasympathetic and global modulation. Furthermore, beneficial effects on autonomic modulation in individuals submitted to AIT after percutaneous coronary intervention were also found by Munk and cols. after six months of high intensity interval training (23).

In the present study, significant improvements in SDNN and rMSSD indices were observed in the AITG group, suggesting that the periodized AIT performed promoted, respectively, increases in global variability and vagal modulation of the ANS. Furthermore, although not significant, an increase in parasympathetic

Table 2. Comparison of deltas of HRV indices and cardiovascular variables adjusted by sex, age, and medication use to control high blood pressure AITG

CG

Average (SE)

Average (SE)

rMSSD

6.15 (2.10)

SDNN

8.55 (2.63)

LF (nu) HF (nu) LF (ms ) HF (ms2)

Variable

F

P

Eta squared

Effect size

-0.18 (2.14)

4.228

0.045

0.084

Moderate

-1.51 (1.68)

6.823

0.012

0.129

Moderate

5.74 (3.29)

-1.67 (3.36)

2.365

0.131

0.049

Low

-5.72 (3.27)

1.66 (3.34)

2.375

0.130

0.049

Low

419.84 (123.53)

-7.08 (126.11)

5.560

0.023

0.108

Moderate

109.98 (48.22)

-29.94 (49.23)

3.920

0.054

0.079

Moderate

LF/HF

0.58 (0.63)

-0.109 (0.64)

0.561

0.458

0.012

Low

HR (bpm)

-1.03 (1.81)

0.55 (1.85)

0.360

0.360

0.008

Low

SBP (mmHg)

-1.68 (2.66)

-2.92 (2.71)

0.100

0.754

0.002

Low

DBP (mmHg)

-2.19 (2.10)

0.05 (2.14)

0.533

0.469

0.011

Low

CopyrightŠ AE&M all rights reserved.

2

Boldface indicates statistical significance (p < 0.05). rMSSD: is the root-mean square of differences between adjacent normal RR intervals in a time interval, expressed in milliseconds; SDNN: standard deviation of all normal RR intervals recorded in a time interval, expressed in milliseconds; LF: low frequency; HF: high frequency; SE: standard error; nu: normalized unit; ms: milliseconds square HR: heart rate; SBP: systolic blood pressure; DBP: diastolic blood pressure; bpm: beats per minute; SE: standard error; mmHg: millimeters of mercury.

154

Arch Endocrinol Metab. 2019;63/2

and HFms2) of the individuals that realized the periodized AIT compared to the control group, justifies the absence of significance of the indices expressed above.

The increase in autonomic modulation of the Mets individuals who performed the training protocol suggest a better adaptation capacity to external stimuli and less heart vulnerably to the risk of cardiovascular events (10,11), acting as an important protector mechanism in these individuals.

With respect to the cardiovascular parameters SBP and DBP, Stensvold and cols. (28) and Tjonna and cols.

(29) reported that the utilization of high intensity AIT, realized for 12 weeks, was not sufficient to promote significant alterations in this parameter, corroborating with our findings, although both studies presented clinically relevant reductions, since SBP reduced 6 mmHg and 10 mmHg respectively, and DPB reduced 4 mmHg and 5 mmHg respectively. Lower values of SBP (1.68 mmHg) and DBP reduction (2.19 mmHg) were observed in the present study with periodized AIT. The lower reduction observed could be related to the characteristics of the proposed training. In the model of proposed training, adaptive and intermediate phases were included that preceded the high intensity phase, denominated as the final phase, the latter having a duration of only four weeks. The training models used in the above studies (28,29) utilized high intensity training throughout the period, therefore the intensity of training could influence the lower reduction in the SBP and DBP values found in the present study, when compared to the existing literature (28,29).

In relation to HR, significant differences were not found between the groups studied. Despite this we observed a reduction in these values in the AIT group, possibly attributed to vagal modulation increase, which may not have been sufficient for the HR reduction in these individuals to be considered significant. Other mechanisms may also be responsible for reduction in resting HR such as the effect of aerobic exercise, as in the case of venous return and systolic volume (30).

The realization of the exercise program could increase the venous return and, consequently, blood volume in the cardiac cavity, promoting an increase in myocardial contractility and consequent improvement in systolic volume. In response to an increase in systolic volume, the HR decreases so the cardiac output remains constant (30). This effect is independent of ANS, and the time of periodized AIT or the intensity of the training used may not have been sufficient to promote Arch Endocrinol Metab. 2019;63/2

this effect, which justifies the absence of significance related to this parameter.

The present study presents weaknesses related to the randomization of the volunteers, which was not possible due to the logistics of the training. The proposed training was realized in the evening, which made adherence difficult for individuals that did not have transport and lived far away from the place of the training. These individuals were allocated to the control group, preventing randomization of the volunteers.

Furthermore, a large number of volunteers (80.76%) in TAI and control group had high blood pressure as component of Mets. Several of than were in use of medication that can directly influence in autonomic modulation. To minimize this aspect, the use of medication to high blood pressure were considered as confounding factors and the analyses realized were adjusted by medication use. Moreover, variables like sex and age were also considering as confounding factors during the statistical analysis process. In addition, an intention to treat analysis was realized in individuals that did not complete the periodized AIT. Aspects such as this reinforce our findings.

The present study has an importance clinical implication, since it suggests a new model of training able to produce beneficial effects on the autonomic modulation of Mets individuals, reducing the risk of cardiovascular events in this population. Furthermore, the model of training proposed can be considered safe for Mets individuals since complications related to the cardiovascular system were not observed in the AIT group, and the skeletal muscle injury demonstrated in Figure 1 did not occur during the training.

The absence of cardiovascular and musculoskeletal complications related to the training protocol is an aspect that can be highlighted. We attribute this aspect to the periodization characteristics of AIT, since this consisted of preparatory periods such as progressive increases in load, specific phases with less duration in intensity, and transition periods for recovery, important and positive characteristics of the proposed training.

The period of the protocol realized at an intensity higher than 60% of HHR was short (4 weeks), which may not be sufficient to promote significant responses in cardiorespiratory parameters of individuals in the AIT group. In this sense, the present study suggests that further investigations about the effects of periodized AIT on cardiorespiratory parameters of Mets individuals should be realized, prioritizing a longer duration of the training protocol at intensities higher than 60% of HHR. 155

CopyrightŠ AE&M all rights reserved.

Aerobic training on metabolic syndrome

Aerobic training on metabolic syndrome

We conclude that 16 weeks of periodized AIT suggested positive effects on autonomic modulation of Mets individuals, characterized by an increase in parasympathetic, sympathetic, and global activity in this population. Furthermore, cardiovascular parameter alterations were not evidenced in Mets individuals submitted to the periodized AIT. Acknowledgment: the authors would like to thank the Laboratory of Stress Physiology and Laboratory of Sports Physical Therapy for their support during this study.

Disclosure: no potential conflict of interest relevant to this article was reported.

Copyright© AE&M all rights reserved.

REFERENCES 1. Alberti KGMM, Eckel RH, Grundy SM, Zimmet PZ, Cleeman JI, Donato KA, et al., International Diabetes Federation Task Force on Epidemiology and Prevention, National Heart, Ling and Blood Institute, American Heart Association, World Heart Federation, International Atherosclerosis Society, International Association for the Study of Obesity Harmonizing the Metabolic Syndrome: A Joint Interim Statement of the International Diabetes Federation Task Force on Epidemiology and Prevention; National Heart, Lung, and Blood Institute; American Heart Association; World Heart Federation; International . Circulation. 2009;120:1640-5.

2. Ford ES, Giles WH, Dietz WH. Prevalence of the Metabolic Syndrome Among US Adults. 2005;287:17-20.

3. Hu G, Qiao Q, Tuomilehto J, Balkau B, Borch-Johnsen K, Pyorala K, DECODE Study Group. Prevalence of the metabolic syndrome and its relation to all-cause and cardiovascular mortality in nondiabetic European men and women. JAMA Inernal Med. 2004;164:1066-76.

4. Song Q-B, Zhao Y, Liu Y-Q, Zhang J, Xin S-J, Dong G-H 2015 Sex difference in the prevalence of metabolic syndrome and cardiovascular-related risk factors in urban adults from 33 communities of China: The CHPSNE study. Diabetes Vasc Dis Res. 12:189-98.

5. Vidigal CF, Bressan J, Babio N, Salas-Salvado J. Prevalence of metabolic syndrome in Brazilian adults: a systematic review.

BMC Public Health. 2013;13:1198.

6. Kaur J. A comprehensive review on metabolic syndrome. Cardiol Res Pract. 2014; 2014:943162.

7. Ren SY, Xu X. Role of autophagy in metabolic syndrome-associated heart disease. Biochim Biophys Acta. 2015;1852:225-31.

8. Esser N, Legrand-Poels S, Piette J, Scheen AJ, Paquot N. Inflammation as a link between obesity, metabolic syndrome and type 2 diabetes. Diabetes Res Clin Pract. 2014;105:141-50.

9. Stuckey MI, Tulppo MP, Kiviniemi AM, Petrella RJ. Heart rate variability and the metabolic syndrome: a systematic review of the literature. Diabetes Metab Res Rev. 2014;30:784-93.

10. Vanderlei LCM, Pastre CM, Hoshi A, Dias T, Fernandes M. Noções básicas de variabilidade da frequência cardíaca e sua aplicabilidade clínica. Rev Bras Cir Cardiovasc. 2009;24:205-17.

11. Tsuji H, Larson MG, Venditti FJ Jr, Manders ES, Evans JC, Feldman CL, et al. Impact of reduced heart rate variability on risk for cardiac events. The Framingham heart study. Circulation.

1996;94:2850-5.

12. Tibana RA, Nascimento D da C, de Sousa NM, de Souza VC, Durigan J, Vieira A, et al. Enhancing of women functional status with metabolic syndrome by cardioprotective and anti-inflammatory effects of combined aerobic and resistance training. Plos One. 2014;9:e110160.

156

13. Pichot V, Roche F, Denis C, Garet M, Duverney D, Costes F, et al. Interval training in elderly men increases both heart rate variability and baroreflex activity. Clin Auton Res. 2005;15:107-15.

14. Barbosa MPCR, Netto Júnior J, Cassemiro BM, Souza NM, Bernardo AFB, Silva AKF, et al. Impact of functional training on cardiac autonomic modulation, cardiopulmonary parameters and quality of life in healthy women. Clin Physiol Funct Imaging.

2015;36:318-25.

15. Rakobowchuk M, Harris E, Taylor A, Cubbon RM, Birch KM. Moderate and heavy metabolic stress interval training improve arterial stiffness and heart rate dynamics in humans. Eur J Appl Physiol. 2013;113:839-49.

16. Tamburus NY, Paula RFL, Kunz VC, César MC, Moreno MA, da Silva E. Interval training based on ventilatory anaerobic threshold increases cardiac vagal modulation and decreases high-sensitivity c-reative protein: Randomized clinical trial in coronary artery disease. Brazilian J Phys Ther. 2015;19:441-50.

17. Mezzani A, Hamm LF, Jones AM, McBride PE, Moholdt T, Stone JA, et al., European Association for Cardiovascular Prevention and Rehabilitation; American Association of Cardiovascular and Pulmonary Rehabilitation; Canadian Association of Cardiac Rehabilitation. Aerobic exercise intensity assessment and prescription in cardiac rehabilitation: a joint position statement of the European Association for Cardiovascular Prevention and Rehabilitation, the American Association of Cardiovascular and Pulmonary Rehabilitation. J Cardiopulm Rehabil Prev. 2013;20:327-50.

18. American College of Sports Medicine. Diretrizes do ACSM para os testes de esforço e sua prescrição. 8º edição. Rio de Janeiro: Guanabara Koogan; 2010.

19. Camarda SR, Tebexreni AS, Páfaro C, Sasai F, Tambeiro V, Juliano Y, et al. Comparação da Freqüência Cardíaca Máxima Medida com as Fórmulas de Predição Propostas por Karvonen e Tanaka.

Arq Bras Cardiol. 2008;91:311-4.

20. Costa RVC, Braga AMW, Carlos A. I Consenso Nacional de Reabilitação Cardiovascular. Arq Bras Cardiol. 1997;69:267-91.

21. Sociedade Brasileira de Cardiologia. 7ª Diretriz Brasileira de Hipertensão Arterial. 2016;107:1-103.

22. Ramos JS, Dalleck LC, Borrani F, Beetham KS, Mielke GI, Dias KA, et al. High-intensity interval training and cardiac autonomic control in individuals with metabolic syndrome: a randomised trial.

Int J Cardiol. 2017;245:245-52.

23. Munk PS, Butt N, Larsen AI. High-intensity interval exercise training improves heart rate variability in patients following percutaneous coronary intervention for angina pectoris. Int J Cardiol.

2010;145:312-4.

24. Townend JN, al-Ani M, West JN, Littler WA, Coote JH. Modulation of cardiac autonomic control in humans by angiotensin II. Hypertension. 1995;25:1270-5.

25. Chowdhary S, Townend JN. Role of nitric oxide in the regulation of cardiovascular autonomic control. Clin Sci. 1999;97:5-17.

26. Rahman F, Pechnik S, Gross D, Sewell L, Goldstein DS. LF Power Reflects Baroreflex Function, Not Cardiac Sympathetic Innervation. Clin Aut Res. 2011;21:133-41.

27. Grassi G, Seravalle G, Brambilla G, Pini C, Alimento M, Facchetti R, et al. Marked sympathetic activation and barore flex dysfunction in true resistant hypertension. Int J Cardiol. 2014;177:1020-5.

28. Stensvold D, Tjonna AE, Skaug E-A, Aspenes S, Stolen T, Wisloff U, et al. Strength training versus aerobic interval training to modify risk factors of metabolic syndrome. J Appl Physiol. 2010;108:804-10.

29. Tjonna A, Lee S, Rognmo O, Stolen T, Bye A. Aerobic interval training versus continuous moderate exercise as a treatment for the metabolic syndrome: a pilot study. Circulation. 2008;118:346-54.

30. Clausen JP. Effect of physical training on cardiovascular adjustments to exercise in man. Physiol Rev. 1977;57:779-815.

Arch Endocrinol Metab. 2019;63/2

original article

Correlation analysis between short-term insulin-like growth factor-I and glucose intolerance status after transsphenoidal adenomectomy in acromegalic patients: a large retrospective study from a single center in China Yi-Lin Li1,2,3, Shuo Zhang1,3, Xiao-Peng Guo1,3, Lu Gao1,3, Wei Lian1,3, Yong Yao1,3, Kan Deng1,3, Ren-Zhi Wang1,3, Bing Xing1,3

ABSTRACT

Department of Neurosurgery, Peking Union Medical College Hospital, Peking, China 2 Department No. 16, Plastic Surgery Hospital, Chinese Academy of Medical Sciences, Beijing, China 3 The Ministry of Health Key Laboratory of Endocrinology, Peking, China 1

Objectives: Our study aimed to investigate the associations of glucose tolerance status with insulinlike growth factor-I (IGF-I) and other clinical laboratory parameters of acromegalic patients before and after the patients underwent transsphenoidal adenomectomy (TSA) by conducting a singlecenter, retrospective study. Subjects and methods: A total of 218 patients with acromegaly who had undergone TSA as the first treatment were retrospectively analyzed. Serum IGF-I, growth hormone (GH) and glucose levels were measured before and after surgery. Results: The follow-up levels for random GH, GH nadir, and the percentage of the upper limit of normal IGF-I (%ULN IGF-I) were decreased significantly. The percentages of normal (39.0%), early carbohydrate metabolism disorders (33.0%) and diabetes mellitus (28.0%) changed to 70.2%, 16.5% and 13.3%, respectively, after TSA. %ULN IGF-I at baseline was higher in the diabetes mellitus (DM) group than in the normal glucose tolerance group and impaired glucose tolerance (IGT) /impaired fasting glucose (IFG) groups before TSA, and the DM group exhibited a greater reduction in %ULN IGF-I value after surgery. The follow-up %ULN IGF-I value after surgery was significantly lower in the improved group, and Pearsonâ&#x20AC;&#x2122;s correlation analysis revealed that the reductions in %ULN IGF-I corresponded with the reductions in glucose level. Conclusion: This study examined the largest reported sample with complete preoperative and follow-up data. The results suggest that the age- and sex-adjusted IGF-I level, which reflects altered glucose metabolism, and the change of it are associated with improved glucose tolerance in acromegalic patients both before and after TSA. Arch Endocrinol Metab. 2019;63(2):157-66

Correspondence to: Bing Xing xingbingemail@aliyun.com Received on July/25/2016 Accepted on Feb/17/2017 DOI: 10.20945/2359-3997000000118

INTRODUCTION

A

cromegaly results from the persistent hypersecretion of growth hormone (GH) and insulin-like growth factor-I (IGF-I), which causes most of the clinical manifestations of acromegaly. The etiology of more than 95% of acromegaly cases is a GH-secreting pituitary adenoma (1). Uncontrolled acromegaly is usually associated with a series of glucose metabolic disorders (2,3). Diabetes and other forms of impaired glucose metabolism with acromegaly are associated with an increased rate of mortality by promoting atherosclerosis, which results in cardiovascular and cerebrovascular Arch Endocrinol Metab. 2019;63/2

diseases (4). Selective transsphenoidal surgical resection, which is one of the most important treatment options for patients with GH-secreting pituitary adenoma (5), can reduce GH levels and improve disordered metabolic functions (1).

Although several studies have investigated the relationship between IGF-I level and insulin resistance, few studies have investigated the correlations between IGF-I or other clinical laboratory parameters and glucose tolerance status, and none have reported a positive correlation between IGF-I and glucose tolerance status both before and after transsphenoidal adenomectomy 157

CopyrightŠ AE&M all rights reserved.

Keywords Glucose tolerance; diabetes; acromegaly; transsphenoidal surgery; insulin-like growth factor-I

Correlations between IGF-I and glucose intolerance status

(TSA) in a large sample with complete follow-up data (6-10). Therefore, we analyzed 218 acromegalic patients who had undergone TSA for acromegaly at our hospital to investigate the associations between glucose tolerance status and both IGF-I and other clinical laboratory parameters before and after TSA.

SUBJECTS AND METHODS Subjects In this study, we analyzed 345 consecutive patients who had been diagnosed with acromegaly caused by a GH-secreting pituitary adenoma without dysfunctions of other endocrine axes and who had undergone TSA at Peking Union Medical College Hospital (Beijing, China) between July 1, 2012 and December 31, 2014. Data regarding routine medical procedures were collected retrospectively. All 345 patients underwent TSA via the same procedure, and the diagnosis of each patient was confirmed by experienced pathologists who analyzed the tumor tissue after surgery.

Among the 345 patients, 74 received medical treatment for acromegaly and 21 received gamma-knife radiosurgery before surgery. A total of 250 patients received TSA as the first treatment. The tumors in 5 of these patients were not completely removed during surgery, and 27 patients were lost to follow-up. The remaining 218 patients who underwent surgery that was performed by surgeons with equivalent surgical experience were selected for data analysis.

The baseline characteristics of the patients (n = 218) stratified by preoperative glucose tolerance status, i.e., normal glucose tolerance (NGT) (n = 85), IGT/IFG (n = 72), and diabetes mellitus (DM) (n = 61), are shown in Table 1. The mean disease duration time of these patients was 74.91 ± 65.48 months, and the mean ± SD age, BMI, systolic blood pressure (SBP),

and DBP were 40.7 ± 12.8 years, 26.36 ± 4.52 kg/m2, 124.06 ± 16.53 mmHg, and 77.06 ± 12.35 mmHg. Women composed 58.7% of the subjects. The follow-up interval of the patients was defined as the time interval between surgery and the first follow-up date, and the mean follow-up interval was 127.23 ± 71.04 days.

The diagnosis of acromegaly was based on failure of serum GH suppression to < 0.4 μg/L during the 75-g oral glucose tolerance test (OGTT) and an elevated serum IGF-I level. Pituitary adenoma was confirmed by magnetic resonance imaging (MRI) and by clinical features, including acral enlargement, increased skin thickness, increased sweating, DM, hypertension, headache, sleep apnea and osteopenia. Glucose tolerance status was evaluated by the 75-g OGTT. According to WHO criteria (11), NGT was defined as a blood glucose level < 110 mg/dL before glucose loading and < 140 mg/dL 2h after. DM was defined as a fasting blood glucose level of ≥ 126 mg/dL or a blood glucose level of ≥ 200 mg/dL at 2h after glucose loading. The remaining patients received a diagnosis of an early carbohydrate metabolism disorder, including IGT or IFG.

Biochemical measurements All of the serum samples were collected early in the morning after an eight-hour fasting period. The serum basal GH concentration was defined as the fasting GH concentration prior to administration of the 75-g OGTT. GH nadir (GHn) values were obtained during the 75-g OGTT, which was performed after a 12h fast. Blood samples were drawn to assess the baseline GH, IGF-I and glucose levels, with GH and glucose being assessed at 30, 60, 120 and 180 min.

The follow-up 75-g OGTT was performed 127.23 ± 71.04 days after surgery, at the first follow-up. It is strongly recommended that IGF-I assays be calibrated using the WHO international standard of highly

Table 1. Preoperative clinical characteristics of the acromegalic patients Total (n = 218)

NGT (n = 85)

IGT/IFG (n = 72)

DM (n = 61)

P

128 (58.7)

50 (58.8)

38 (52.8)

40 (65.6)

0.328

Age, years

40.65 ± 12.83

37.91 ± 12.64

38.22 ± 11.24

47.34 ± 12.61

0.000

BMI, kg/m2

26.36 ± 4.52

25.74 ± 4.27

27.00 ± 5.45

26.46 ± 3.50

0.217

Copyright© AE&M all rights reserved.

Female, n (%)

DD, months

74.91 ± 65.48

76.35 ± 63.17

70.94 ± 67.50

77.59 ± 67.09

0.817

SBP, mmHg

124.06 ± 16.53

120.85 ± 14.34

124.61 ± 15.98

127.87 ± 19.21

0.038

DBP, mmHg

77.06 ± 12.35

76.01 ± 10.73

76.13 ± 14.14

79.61 ± 12.04

0.164

Follow-up interval, days

127.23 ± 71.04

116.93 ± 63.81

130.67 ± 66.31

137.54 ± 84.13

0.198

The data are presented as absolute numbers (n) and percentages (%) or as the mean ± SD. SBP: systolic blood pressure; DBP: diastolic blood pressure; DD: disease duration; NGT: normal glucose tolerance; IGT/IFG: early carbohydrate metabolism disorders; DM: diabetes mellitus.

158

Arch Endocrinol Metab. 2019;63/2

Correlations between IGF-I and glucose intolerance status

Criteria for a biochemical cure The common consensus criteria are an IGF-I level in the age-adjusted normal range and a GH level < 1.0 μg/L from a random GH measurement, with nadir GH levels < 0.4 μg/L in patients undergoing neurosurgery (12).

Statistical analysis All statistical analyses were performed using IBM SPSS 20.0 software (SPSS Inc., Chicago, IL, USA). The data are reported as the mean ± SD for normally distributed continuous variables and as the number and percentage for dichotomous variables. The IGF-I level was calculated and expressed as a percentage of the upper limit of the normal IGF-I (%ULN IGF-I) level for each subject according to age using the Peking Union Medical College Hospital laboratory samples (%ULN=(IGF-IULN)/ULN×100%). Data were compared between groups using the χ2 test for categorical data and the t-test or ANOVA for continuous data. Associations between the two clinical laboratory parameters were assessed by Pearson’s correlation coefficient analysis.

A two-tailed p < 0.05 was considered to indicate statistically significant differences.

Arch Endocrinol Metab. 2019;63/2

RESULTS Clinical characteristics of the subjects before surgery Our study showed that 28.0% of the patients had diabetes and 33.0% had IFG or IGT, with the remaining 39.0% of patients having normal glucose tolerance.

The mean follow-up interval was 127 ± 71 days, with no significant difference between groups. There were gradual increases in age and SBP from NGT to IGT/ IFG to DM. The patient age was higher in the DM group than in the NGT (p = 0.000) and IGT/IFG (p = 0.000) groups, but it did not differ between the NGT and IGT/IFG groups (p = 0.871). The SBP was higher in the DM group than in the NGT group (p = 0.011).

The preoperative clinical laboratory parameters are shown in Table 2. There were significant differences in the %ULN IGF-I level before surgery among the three groups (p = 0.005); this level was higher in the DM group than in the NGT (p = 0.001) and IGT/IFG (p = 0.028) groups, but it did not differ between the NGT and IGT groups (p = 0.325). The GH and GHn levels did not differ significantly among the groups.

Associations of clinical parameters with glucose tolerance after TSA After TSA, the average Glu0h (basal glucose level on OGTT) and Glu2h (2-h glucose level on OGTT) decreased significantly in the IGT/IFG and DM groups (Table 2).

The change from the baseline Glu0h was significantly higher in the DM group than in the IGT/IFG (p = 0.000) and NGT groups (p = 0.000), but there was no significant difference between the IGT/IFG and NGT groups (p = 0.145). The change from the baseline Glu2h was significantly different among the three groups (p = 0.000).

The Glu2h of the DM group decreased the most, followed by the IGT/IFG group, and the differences between any two of the three groups were significant (p = 0.000).

As shown in Table 2, compared to the baseline levels, the follow-up random GH, GHn, and %ULN IGF-I levels decreased significantly in all three groups (p < 0.01). The changes from the baseline GH and GHn levels did not differ significantly among the groups. However, the change from the baseline %ULN IGF-I of the DM group was higher than were those of the IGT/IFG (p = 0.004) and NGT groups (p = 0.000), whereas it did not significantly differ (p = 0.191) between the IGT/IFG and NGT groups.

According to the remission criteria, 53.3% (116 of 218) of the patients achieved a random GH level of < 1.0 159

Copyright© AE&M all rights reserved.

purified recombinant IGF-I (WHO IS 02/254).

Furthermore, the GH assay should be calibrated to the 22-kDA isoform standard or, as a second choice, to multiple isoforms (12). Accordingly, GH levels were measured using an IMMULITE 2000 automated chemiluminescence analyzer (L2KGRH2, Siemens Healthcare Diagnostics Products Ltd., Glyn Rhonwy, Llanberis, Gwynedd LL55 4EL, UK) after an eighthour fasting period and administration of the 75-g OGTT. The IGF-I levels were measured using an IMMULITE 2000 chemiluminescence analyzer (L2KGFZ, Siemens Healthcare Diagnostics Products Ltd., Glyn Rhonwy, Llanberis, Gwynedd LL55 4EL, UK) and were compared to levels in control individuals of the same age and gender. The IGF-I level is expressed as a percentage of the upper limit of the normal IGF-I (%ULN IGF-I) level for age and sex for each individual laboratory sample because the IGF-I SDS scoring system has not been applied to the evaluation of IGF-I in our hospital and because one of the latest guidelines does not use IGF-I SDS as the diagnostic standard (13).

Correlations between IGF-I and glucose intolerance status

μg/L, 56.9% (124 of 218) achieved a GHn level of < 0.4 μg/L, 33.5% (73 of 218) achieved a normal ageadjusted IGF-I level, and 30.7% (67 of 218) achieved both a GHn level of < 0.4 μg/L and a normal ageadjusted IGF-I level. We compared the percentage of patients with a random GH level of < 1.0 μg/L, GHn level of < 0.4 μg/L, and normal age-adjusted IGF-I level among the three groups after surgery. However, no significant differences were observed.

Logistic regression analysis including age, BMI, SBP, follow-up Glu0h, follow-up Glu2h, and the parameters random GH, GHn and %ULN IGF-I was carried out to identify parameters associated with preoperative glucose status. The baseline %ULN IGF-I (p = 0.020, OR = 1.006) and change from the baseline %ULN IGF-I (p = 0.000, OR = 1.105) were the variables most significantly correlated with preoperative glucose status for these patients.

Table 2. Clinical laboratory parameters of patients after surgery at follow-up Total (n = 218)

NGT (n = 85)

IGT/IFG (n = 72)

DM (n = 61)

p

Random GH < 1.0 μg/L, n (%)

116 (53.2)

46 (54.1)

36 (50.0)

34 (55.7)

0.786

GHn < 0.4 μg/L, n (%)

124 (56.9)

45 (52.9)

40 (55.6)

39 (63.9)

0.401

Normal age-adjusted IGF-I, n (%)

73 (33.5)

30 (35.3)

21 (29.2)

22 (36.1)

0.634

Both GHn < 0.4 μg/L and normal age-adjusted IGF-I, n (%)

67 (30.7)

28 (32.9)

18 (25.0)

21 (34.4)

0.428

At baseline

113.14 ± 32.79

96.57 ± 7.93

105.39 ± 10.09

145.20 ± 46.66

0.000

At follow-up

101.61 ± 17.30

94.04 ± 8.83

97.47 ± 10.99

116.92 ± 21.98

0.000

(0.000)

(0.051)

(0.000)

(0.000)

-11.53 ± 25.22

-2.52 ± 9.37

-7.93 ± 9.91

-28.29 ± 40.72

0.000

At baseline

168.27 ± 77.29

107.56 ± 18.92

156.56 ± 24.86

266.82 ± 71.34

0.000

At follow-up

123.41 ± 59.99

98.73 ± 22.52

106.47 ± 32.25

177.64 ± 82.87

0.000

(0.000)

(0.007)

(0.000)

(0.000)

-44.86 ± 54.95

-8.64 ± 25.76

-50.08 ± 32.97

-89.18±69.72

0.000

At baseline

32.68 ± 44.92

35.93 ± 53.37

31.23 ± 42.70

29.87 ± 33.56

0.686

At follow-up

5.00 ± 8.98

5.74 ± 9.32

4.29 ± 5.69

4.82 ± 11.44

0.584

(0.000)

(0.000)

(0.000)

(0.000)

-27.68 ± 43.01

-30.19 ± 51.17

-26.94 ± 41.54

-25.06 ± 31.11

0.766

At baseline

24.21±36.65

27.81 ± 45.94

22.06 ± 31.95

21.73 ± 25.77

0.512

At follow-up

2.94 ± 5.67

3.61 ± 6.42

2.44 ± 4.38

2.60 ± 5.90

0.377

(0.000)

(0.000)

(0.000)

(0.000)

-21.27 ± 35.04

-24.21 ± 44.27

-19.62 ± 30.73

-19.14 ± 23.67

0.614

At baseline

200.95 ± 112.76

178.4 ± 101.83

195.88 ± 101.66

238.38 ± 130.62

0.005

At follow-up

59.71 ± 91.45

68.42 ± 102.93

61.51 ± 88.94

45.44 ± 75.72

0.321

(0.000)

(0.000)

(0.000)

(0.000)

-141.22 ± 120.43

-109.89 ± 111.34

-134.31 ± 111.58

-193.05 ± 127.22

Glu0h, mg/dL

(p*) Change from baseline Glu2h, mg/dL

(p*) Change from baseline Random GH, μg/L

(p*) Change from baseline GHn, μg/L

(p*) Change from baseline

Copyright© AE&M all rights reserved.

%ULN IGF-I

(p*) Change from baseline

0.000

Glu0h: basal glucose level on OGTT; Glu2h: 2-h glucose level on OGTT; GH: growth hormone; GHn: GH nadir; IGF-I: insulin-like growth factor-I; ULN: upper limit of normal range. p: p value among the three groups (NGT, IGT/IFG, and DM) as determined by ANOVA. (P*): p value between preoperative and follow-up parameters; change from baseline = follow-up-baseline.

160

Arch Endocrinol Metab. 2019;63/2

Correlations between IGF-I and glucose intolerance status

Association of clinical parameters with improved glucose tolerance after TSA To determine how the clinical parameters are related to preoperative glucose tolerance status after surgery, the patients with abnormal glucose tolerance (IGT/IFG and DM) were divided into the following three groups according to the preoperative and postoperative glucose tolerance status (Figure 1): an improved group (n = 44), including the patients with IGT/IFG before surgery who experienced restoration of NGT after surgery and those with DM before surgery but with IGT/IFG or NGT after surgery; a stable group (n = 87), including the patients with persistent IGT/IFG or DM before and after surgery; and a deteriorated group (n = 10), including the patients with IGT/IFG before surgery who developed DM after surgery. Because the number of patients in the deteriorated group was too low to generate accurate statistics, this group of patients was not included in the comparative analysis. The glucose status changes in the three groups after surgery are shown in Figure 1. Surgery improved glucose tolerance in 54.1% (33 of 61) of the patients in the DM group and in 73.6% (53 of 72) of those in the IGT/IFG group.

As shown in Table 3, the percentage of females in the improved group was significantly lower than that in the stable group (p = 0.021), whereas the average age in the improved group was significantly higher than that in the stable group (p = 0.013).

The baseline and follow-up Glu0h and Glu2h of the improved group were significantly lower than those

of the stable group (p < 0.01). The change from the baseline Glu2h in the improved group was significantly higher than that in the stable group (p = 0.001); the mean change from the baseline Glu0h was also higher in the improved group, but this difference was not statistically significant (p = 0.074).

Table 3. Clinical parameters of patients according to glucose tolerance before and after surgery Stable (n = 44) Female, n (%) Age, years

NGT (77) Deteriorated group

DM (0)

IGT/IFG (17) DM (2)

26.66 ± 3.10

26.79 ± 5.10

0.853

68.29 ± 56.03

0.233

SBP, mmHg

127.23 ± 19.32

125.71 ± 16.83

0.644

DBP, mmHg

80.20 ± 13.33

76.48 ± 13.31

0.133

Follow-up interval, days

133.16 ± 72.57

134.06 ± 76.89

76.89

Random GH < 1.0 μg/L, n (%)

17 (38.6)

51 (58.6)

0.031

GHn < 0.4 μg/L, n (%)

21 (47.7)

56 (64.4)

0.068

Normal age-adjusted IGF-I, n (%)

9 (20.5)

34 (39.1)

0.032

At baseline

148.27 ± 52.79

111.52 ± 19.10

0.000

At follow-up

124.13 ± 21.98

97.29 ± 9.55

0.000

(0.007)

(0.000)

-24.14 ± 45.94

-14.05 ± 17.30

0.074

At baseline

251.14 ± 92.06

185.56 ± 54.77

0.000

At follow-up

204.84 ± 78.55

105.21 ± 32.61

0.000

Glu0h, mg/dL

(p*) Change from baseline Glu2h, mg/dL

(0.013)

(0.000)

-46.30 ± 54.05

-80.35 ± 53.33

0.001

At baseline

31.18 ± 35.16

30.86 ± 40.74

0.965

At follow-up

5.29 ± 6.57

4.23 ± 9.79

0.519

(0.000)

(0.000)

-25.89 ± 33.24

-26.63 ± 39.23

0.915

At baseline

22.31 ± 26.37

22.13 ± 30.83

0.974

At follow-up

3.39 ± 5.14

2.12 ± 5.12

0.182

(0.000)

(0.000)

-18.92 ± 24.75

-20.02 ± 29.28

0.832

IGT/IFG (11)

At baseline

238.34 ± 126.49

204.71 ± 111.15

0.121

At follow-up

95.20 ± 97.28

35.94 ± 70.19

0.001

(0.000)

(0.000)

Improved group

-143.09 ± 140.36

-168.84 ± 111.57

Stable group

Figure 1. Categorization of the patients into three groups according to their

Arch Endocrinol Metab. 2019;63/2

(p*) Change from baseline

DM (27)

preoperative and postoperative glucose tolerance statuses.

(p*) GHn, μg/L

NGT (23) DM (61)

0.013

%ULN IGF-I

(p*) Change from baseline

0.256

161

Copyright© AE&M all rights reserved.

IGT/IFG (72)

0.021

85.36 ± 85.16

Change from baseline

NGT (53) 218 patients

45 (51.7) 40.31 ± 12.76

Random GH, μg/L

Post-operation

IGT/IFG (8)

32 (72.7) 46.14 ± 11.86

DD, months

Change from baseline

NGT (85)

p

BMI, kg/m

2

(p*)

Pre-operation

Improved (n = 87)

Correlations between IGF-I and glucose intolerance status

The baseline, follow-up, and change from the baseline levels of random GH and GHn were similar in both groups. However, the follow-up %ULN IGF-I after surgery was significantly lower in the improved group than in the stable group (p = 0.001), whereas the baseline and change from the baseline %ULN IGF-I did not significantly differ. Moreover, the improved group had a significantly higher proportion of patients with a random GH level of < 1.0 μg/L (p = 0.031) and normal age-adjusted IGF-I level (p = 0.032) than the stable group. In addition, the improved group had an increased proportion of patients with a GHn level of < 0.4 μg/L (p = 0.068) that approached statistical significance.

Logistic regression analysis of age, BMI, and the parameters random GH, GHn, and %ULN IGF-I showed that an improvement in glucose tolerance status was associated with a lower follow-up %ULN IGF-I (p = 0.001, OR = 1.011) and could be predicted by younger age (p = 0.044, OR = 1.042). According to the ROC curve analysis, the age cut-off value for predicting an improvement in glucose tolerance status after TSA was 45.5. The sensitivity and specificity were 59.1% and 29.9%, respectively, and the AUC was 63.3% (53.4%-73.2%) (p = 0.013).

Comparisons of glucose levels according to IGF-I criterion of a cure To suppress the interference of GH, we divided the 218 patients into cure (n = 73) and discordant (n = 145) groups according to the IGF-I criterion of a cure (a normal age-adjusted IGF-I) to compare the glucose levels between the two groups (Table 4).

The data showed that the follow-up Glu0h of the cure group was significantly lower than that of the discordant group (p = 0.007), and the average follow-up Glu2h was also lower in the cure group, approaching significance (p = 0.070).

Copyright© AE&M all rights reserved.

Clinical laboratory parameters and their associations with glucose tolerance We analyzed the relationships among the %ULN IGF-I and GH levels and glucose parameters. The %ULN IGF-I before surgery was positively correlated with all parameters before surgery, including the GH, GHn, Glu0 and Glu120 levels (rGH = 0.193, rGHn = 0.184, rGlu0 = 0.180, and rGlu120 = 0.231, p < 0.01). Reductions in the %ULN IGF-I corresponded with reductions in the glucose level (rGlu0 = 0.198 and rGlu120 = 0.168, p < 0.05). The changes in the 162

Table 4. Comparisons of glucose levels of the cure and discordant groups according to the IGF-I criterion of a cure Cured (n = 73)

Discordant (n = 145)

p*

130.23 ± 75.32

125.72 ± 69.01

0.659

109.36 ± 22.88

114.94 ± 36.75

0.225

At follow-up

97.11 ± 14.41

103.77 ± 18.20

0.007

Change from the baseline

-12.07 ± 17.84

-11.17 ± 28.29

0.805

At baseline

165.39 ± 70.98

169.71 ± 80.53

0.706

At follow-up

112.96 ± 56.03

128.63 ± 61.43

0.070

Change from the baseline

-52.43 ± 56.21

-41.08 ± 54.23

0.149

Follow-up interval, days Glu0h, mg/dL At baseline

Glu2h, mg/dL

%ULN IGF-I before and after surgery were correlated positively with changes in the glucose level (rΔGlu0 = 0.220, rΔGlu120 = 0.297, p < 0.01). The GH-related indexes were not significantly correlated with any of the glucose parameters.

DISCUSSION Glucose tolerance is frequently altered in acromegaly.

IGT and overt diabetes are usually associated with the acromegalic condition, and their prevalence rates range from 16 to 46% and from 19 to 56%, respectively (14).

The effects of GH and IGF-I on glucose metabolism are very complex. GH hypersecretion leads to increases in both hepatic (increased gluconeogenesis in hepatocytes) and peripheral insulin resistance in adipose tissue and muscles (15,16). In contrast, IGF-I increases insulin sensitivity and lowers the blood glucose level.

IGF-I may indirectly regulate carbohydrate metabolism through both the suppression of GH and enhancement of insulin activity (17). IGF-I reduces the serum GH concentration and GH-related insulin suppression of hepatic gluconeogenesis by increasing free fatty acid uptake in muscle, which indirectly enhances the activity of hepatic insulin (18). In addition, IGF-I directly stimulates glucose transport into muscle through either IGF-I or insulin/IGF-I hybrid receptors (19,20).

However, in acromegalic patients, the negative effects of GH largely overwhelm the possible beneficial effects of IGF-I on insulin sensitivity. Studies have reported that the plasma GH and IGF-I levels in acromegaly are associated with the insulin resistance status (21). In our study, in agreement with this finding, baseline %ULN IGF-I was significantly associated with the worse glucose status before surgery, whereas plasma GH level was not.

Arch Endocrinol Metab. 2019;63/2

We also found significant decreases in the levels of biochemical parameters, including Glu0h, Glu2h, random GH, GHn, and %ULN IGF-I, in our patients after surgery. These results suggest that TSA can indeed improve the glucose status in acromegaly, which should be analyzed in a large single-center sample. In accordance with previous observations (10,22,23), we observed that age and hypertension were significantly associated with the presence of diabetes in this sample; however, unexpectedly, no significant associations were found for sex, BMI, or disease duration.

According to the χ2 test, the proportions of biochemically cured patients did not significantly differ among the three groups, but they were slightly higher in the DM group than in the other two groups. In addition, we found that the patients with preoperative DM had significantly greater decreases in Glu0h, Glu2h, and %ULN IGF-I after surgery than in the IGT/IFG and NGT groups (Table 2). These results may be due to the initially higher %ULN IGF-I levels in the DM group; however, the average follow-up %ULN IGF-I was the lowest in that group, although this latter difference was not significant. This suggests that DM patients with pituitary GH adenoma might be more likely to benefit from the operation due not only to a greater decrease in %ULN IGF-I but also to a greater improvement in blood glucose level. The concentration of IGFBP-3, the main IGF carrier protein, is usually increased in acromegalic patients (24), and studies have indicated that the concentration of this protein is positively correlated with that of IGF-I (25). Therefore, the higher %ULN IGF-I before surgery in the DM group likely led to a higher IGFBP-3 level in this group, potentially increasing the binding of IGF-I and reducing the IGF-I level in the blood shortly after surgery. Such a mechanism might partially explain why the DM group had a lower %ULN IGF-I at follow-up. In addition, IGF-I is credited with reducing insulin resistance and the blood glucose level (17). One possible explanation for the greater decrease in the glucose level in the DM group is that diabetes patients with a high insulin level can have increased sensitivity of IGF-I receptors (26).

Similar to patients with glucose metabolic disorder that is caused only by high GH levels in the blood, the reduction or elimination of GH level can make such patients exhibit enhanced reactivity to IGF-I. We analyzed the clinical parameters associated with the improved glucose tolerance status in this sample.

The glucose tolerance of the IGT/IFG group was more Arch Endocrinol Metab. 2019;63/2

likely to be improved than that of the DM group. In accordance with this expectation, the improved group had better glucose tolerance and more easily achieved a biochemical cure than the stable group, especially with regard to the random GH and normal age-adjusted IGF-I levels. The results also revealed that the patients in the improved group were younger, that fewer were female, and that they had a lower %ULN IGF-I at follow-up. As age is one of the risk factors for decreased glucose tolerance in acromegaly (27), younger patients may have a greater possibility of improving their glucose status through operative treatment.

Similar to previous studies, the IGF-I levels fluctuated during the early postoperative period in this study (28).

A limited number of studies have investigated the time point at which the IGF-I level stabilizes after pituitary surgery. Patients’ IGF-I levels can become normalized early after surgery (within weeks), but delayed stabilization of up to 12 months can also occur (29-31), which may partly explain why fewer patients achieved a normal age-adjusted IGF-I level (33.5%) than GHn level (56.9%) (Table 2). Previous research (12) has shown that discordance between GH and IGF-I levels can occur in up to 30% of patients with acromegaly after treatment, and most discordance involves normal GH levels and elevated IGF-I levels. This discordance may arise due to many factors such as pulsatility, age, comorbidities, and genetic differences (12), including the longer half-life of the IGF-I hormone, which might result in a higher IGF-I level in the short time between surgery and the OGTT test. Another possible reason for this discordance is that very subtle abnormalities of GH secretion can be sufficient to increase IGF-I production into a supranormal range (32). In acromegaly, the tumor produces GH but not IGF-1, and absolute IGF1 levels or IGF-1 z-scores increase nonlinearly with GH levels, which results in a far greater extent of nonlinearity between GH and IGF-1 levels than has been previously recognized (33). However, the exact mechanism of this phenomenon remains unclear, and revealing it will require the measurement of IGF-1 and GH levels to monitor tumor activity.

In our study, a lower follow-up %ULN IGF-I was associated with an improved glucose status at an average of 133.76 days after surgery, indicating that the IGF-I level at approximately 4 months after surgery was already predictive of the glucose status. These findings indicate the importance of the early measurement of IGF-I in patients with an abnormal blood glucose level.

163

Copyright© AE&M all rights reserved.

Correlations between IGF-I and glucose intolerance status

CopyrightŠ AE&M all rights reserved.

Correlations between IGF-I and glucose intolerance status

These results were further confirmed by comparisons of the glucose levels according to the IGF-I criterion of a cure (Table 4). The follow-up glucose levels of the cure group were lower than were those of the discordant group after surgery.

Furthermore, to confirm the correlation between the %ULN IGF-I and glucose levels before and after surgery, Pearsonâ&#x20AC;&#x2122;s correlation analysis was performed.

The correlations detected between the laboratory indexes indicate that the change in %ULN IGF-I between before and after surgery might be predictive of an altered glucose level, despite the weak correlation observed. However, no significant relationships were found between the differences in the random GH or GHn levels before versus after surgery and the glucose parameters. Thus, the IGF-I level was a better indicator than the GH-related indexes of altered glucose metabolism in the acromegalic patients.

This conclusion is in agreement with those of previous studies reporting a closer correlation of IGF-I with indexes of insulin resistance than nadir or random GH (8-10). Hopkins and cols. first reported that IGF-I, but not GH, was significantly correlated with insulin resistance; however, the sample examined was small, including only ten patients with active acromegaly, seven with controlled disease and 22 normal individuals (9). Another study investigated 92 Japanese acromegalic patients who underwent surgery, but only a weak correlation between the IGF-I Z score and HOMA2-S % before surgery was reported; no postop data were reported (8). Dan and cols. also reported that IGF-I was associated with glucose intolerance, but they assessed only 29 patients treated with surgery without considering any preoperative parameters (10).

Our study, which involves the largest patient sample (218 patients) with complete follow-up data, is the largest study to correlate %ULN IGF-I with the glucose tolerance status both before and after surgery.

The specific physiological and pathological mechanisms underlying the correlation of IGF-I with glucose status in acromegaly is still unclear. However, the measurement of serum IGF-I may be the best single test for the diagnosis of acromegaly and may reflect the activity of the disease, as serum IGF-I concentrations do not vary according to daily activities but instead reflect integrated GH secretion during the preceding day or longer (6,34).

This result may partially explain the relationship between %ULN IGF-I and glucose status observed in our study.

Considering our findings, further study of the specific physiological and molecular mechanisms of the effects of IGF-I on glucose metabolism is warranted.

164

These observations suggest that the age- and sex-adjusted IGF-I level before and after TSA and its change are associated with improved glucose tolerance in acromegalic patients both before and after TSA. We suggest that the continuous monitoring of the serum IGF-I level is necessary to evaluate blood glucose improvement in these patients. For better long-term prognosis, improved control of blood glucose should be one of the goals in the management of acromegaly.

Considering this goal, we advise placing more emphasis on the IGF-I level at 3 months after surgery. A lower level indicates better recovery and control of DM and the IGF level; thus, more accurate criteria for the cure and control of acromegaly as well as guidelines that consider the treatment of complications must be established.

Limitations There are several limitations in our study. Our study was designed as a retrospective study with a relatively short follow-up period; thus, a long-term association of IGF-I with glucose metabolism could not be examined.

Moreover, with incomplete data, we failed to assess other markers for glucose metabolism before and after surgery, such as the HbA1c level, serum insulin levels and insulin sensitivity. As ours was a single-center study, additional multi-center studies should be performed.

In conclusion our study of acromegalic patients is the first to report complete preoperative and follow-up data. The results suggest that the age- and sex-adjusted IGF-I level is an effective parameter that reflects changes in glucose metabolism and that is associated with improved glucose tolerance in acromegalic patients both before and after TSA. Careful monitoring of the serum IGF-I level is recommended to evaluate blood glucose improvement in acromegalic patients.

Research involving human participants or animals: the present study was approved by the Institutional Ethics Committee of Peking Union Medical College Hospital, Chinese Academy of Medical Sciences and performed in accordance with the ethical standards established by the 1964 Declaration of Helsinki and its later amendments or comparable ethical standards.

Informed consent: informed consent was obtained from all individual participants who were included in the study.

Acknowledgments: the authors are grateful to the study subjects for participating in this study, to the nurses of the neurosurgery inpatient ward for measuring the patientsâ&#x20AC;&#x2122; hormone levels, to X. Bao and M. Feng at the office of their outpatient ward for their valuable feedback regarding the diagnoses of all patients, to B. Hou and F. Feng for performing MRI, and to H. Pang (statistician) for assistance with statistical analyses. In addition, the authors thank their colleagues at the Central Laboratory of PUMCH for their precise analyses of hormone levels. This study was not funded.

Arch Endocrinol Metab. 2019;63/2

Funding: this study was not funded.

14. Colao A, Ferone D, Marzullo P, Lombardi G. Systemic complications of acromegaly: epidemiology, pathogenesis, and management. Endocr Rev. 2004;25(1):102-52.

17. Clemmons DR. Metabolic actions of insulin-like growth factor-I in normal physiology and diabetes. Endocrinol Metab Clin North Am. 2012;41(2):425-43.

18. Yuen KC, Dunger DB. Therapeutic aspects of growth hormone and insulin-like growth factor-I treatment on visceral fat and insulin sensitivity in adults. Diabetes Obes Metab. 2007;9(1):11-22.

19. Furling D, Marette A, Puymirat J. Insulin-like growth factor I circumvents defective insulin action in human myotonic dystrophy skeletal muscle cells. Endocrinology. 1999;140(9):4244-50.

20. Henry RR, Abrams L, Nikoulina S, Ciaraldi TP. Insulin action and glucose metabolism in nondiabetic control and NIDDM subjects.

Comparison using human skeletal muscle cell cultures. Diabetes.

1995;44(8):936-46.

21. Stelmachowska-Banas8 M, Zdunowski P, Zgliczyn8ski W. Abnormalities in glucose homeostasis in acromegaly. Does the prevalence of glucose intolerance depend on the level of activity of the disease and the duration of the symptoms? Endokrynol Pol. 2009;60(1):20-4.

22. Dreval AV, Trigolosova IV, Misnikova IV, Kovalyova YA, Tishenina RS, Barsukov IA, et al. Prevalence of diabetes mellitus in patients with acromegaly. Endocr Connect. 2014;3(2):93-8.

23. Kreze A, Kreze-Spirova E, Mikulecky M. Risk factors for glucose intolerance in active acromegaly. Braz J Med Biol Res. 2001;34(11):1429-33.

24. Chanson P, Salenave S. Acromegaly. Orphanet J Rare Dis. 2008;3:17.

25. Hauffa BP, Lehmann N, Bettendorf M, Mehls O, Dörr HG, Stahnke N, et al. Central laboratory reassessment of IGF-I, IGF-binding protein-3, and GH serum concentrations measured at local treatment centers in growth-impaired children: implications for the agreement between outpatient screening and the results of somatotropic axis functional testing. Eur J Endocrinol.

2007;157(5):597-603.

26. Sarkar S, Jacob KS, Pratheesh R, Chacko AG. Transsphenoidal surgery for acromegaly: predicting remission with early postoperative growth hormone assays. Acta Neurochir.

2014;156(7):1379-87.

27. Nabarro JDN. Acromegaly. Clin Endocrinol. 1987;26(4):481-512.

28. Feelders RA, Bidlingmaier M, Strasburger CJ, Janssen JA, Uitterlinden P, Hofland LJ, et al. Postoperative evaluation of patients with acromegaly: clinical significance and timing of oral glucose tolerance testing and measurement of (free) insulin-like growth factor I, acid-labile subunit, and growth hormone-binding protein levels. J Clin Endocrinol Metab. 2005;90(12):6480-9.

29. Kreutzer J, Vance ML, Lopes MB, Laws, Jr ER. Surgical management of GH-secreting pituitary adenomas: an outcome study using modern remission criteria. J Clin Endocrinol Metab.

2001;86(9):4072-7.

30. Takahashi JA, Shimatsu A, Nakao K, Hashimoto N. Early postoperative indicators of late outcome in acromegalic patients.

Clin Endocrinol (Oxf). 2004;60(3):366-74.

31. Espinosa-de-los-Monteros AL, Mercado M, Sosa E, Lizama O, Guinto G, Lopez-Felix B, et al. Changing patterns of insulin-like growth factor-I and glucose-suppressed growth hormone levels after pituitary surgery in patients with acromegaly. J Neurosurg.

2002;97(2):287-92.

32. Elias PCL, Lugao HB, Pereira MC, Machado HR, Castro Md, Moreira AC. Discordant nadir GH after oral glucose and IGF-I levels on treated acromegaly: refining the biochemical markers of mild disease activity. Horm Metab Res. 2010;42(1):50-5.

15. Yakar S, Liu JL, Fernandez AM, Wu Y, Schally AV, Frystyk J, et al. Liver-specific igf-1 gene deletion leads to muscle insulin insensitivity. Diabetes. 2001;50(5):1110-8.

33. Oldfield EH, Jane JA Jr, Thorner MO, Pledger CL, Sheehan JP, Vance ML. Correlation between GH and IGF-1 during treatment for acromegaly. J Neurosurg. 2017;126(6):1959-66.

16. Møller N, Jørgensen JO. Effects of growth hormone on glucose, lipid, and protein metabolism in human subjects. Endocr Rev. 2009;30(2):152-77.

34. Freda PU. Monitoring of acromegaly: what should be performed when GH and IGF-1 levels are discrepant? Clin Endocrinol (Oxf).

2009;71(2):166-70.

Disclosure: no potential conflict of interest relevant to this article was reported.

REFERENCES 1. Melmed S. Medical progress: acromegaly. N Engl J Med. 2006;355(24):2558-73.

2. Barrande G, Pittino-Lungo M, Coste J, Ponvert D, Bertagna X, Luton JP, et al. Hormonal and metabolic effects of radiotherapy in acromegaly: long-term results in 128 patients followed in a single center. J Clin Endocrinol Metab. 2000;85(10):3779-85.

3. Mestron A, Webb SM, Astorga R, Benito P, Catala M, Gaztambide S, et al. Epidemiology, clinical characteristics, outcome, morbidity and mortality in acromegaly based on The Spanish Acromegaly Registry (Registro Espanol de acromegalia, REA).

Eur J Endocrinol. 2004;151(4):439-46.

4. Etxabe J, Gaztambide S, Latorre P, Vazquez JA. Acromegaly: an epidemiological study. J Endocrinol Invest. 1993;16(3):181-7.

5. Katznelson L, Atkinson J, Cook D, Ezzat S, Hamrahian A, Miller K. American Association of Clinical Endocrinologists medical guidelines for clinical practice for the diagnosis and treatment of acromegaly – 2011 update: executive summary. Endocr Practice.

2011;17(4):636-46.

6. Alexopoulou O, Bex M, Abs R, T’Sjoen G, Velkeniers B, Maiter D. Divergence between growth hormone and insulin-like growth factor-I concentrations in the follow-up of acromegaly. J Clin Endocrinol Metab. 2008;93(4):1324-30.

7. Espinosa-De-Los-Monteros AL, González B, Vargas G, Sosa E, Mercado M. Clinical and biochemical characteristics of acromegalic patients with different abnormalities in glucose metabolism. Pituitary. 2011;14(3):231-5.

8. Kinoshita Y, Fujii H, Takeshita A, Taguchi M, Miyakawa M, Oyama K, et al. Impaired glucose metabolism in Japanese patients with acromegaly is restored after successful pituitary surgery if pancreatic beta-cell function is preserved. Eur J Endocrinol.

2011;164(4):467-73.

9. Hopkins KD, Holdaway IM. Insulin secretion and insulin-like growth factor-I levels in active and controlled acromegaly. Clin Endocrinol (Oxf). 1992;36(1):53-7.

10. Niculescu D, Purice M, Coculescu M. Insulin-like growth factor-I correlates more closely than growth hormone with insulin resistance and glucose intolerance in patients with acromegaly.

Pituitary. 2013;16(2):168-74.

11. Alberti KG, Zimmet PZ. Definition, diagnosis and classification of diabetes mellitus and its complications. part 1: diagnosis and classification of diabetes mellitus provisional report of a WHO consultation. Diabet Med. 1998;15(7):539-53.

12. Giustina A, Chanson P, Bronstein MD, Klibanski A, Lamberts S, Casanueva FF, et al. A consensus on criteria for cure of acromegaly. J Clin Endocrinol Metab. 2010;95(7):3141-8.

13. Katznelson L, Laws ER Jr, Melmed S, Molitch ME, Murad MH, Utz A, et al. Acromegaly: an Endocrine Society clinical practice guideline. J Clin Endocrinol Metab. 2014;99(11):3933-51.

Arch Endocrinol Metab. 2019;63/2

165

Copyright© AE&M all rights reserved.

Correlations between IGF-I and glucose intolerance status

166

1

%ULN (B)

1

0.320**

%ULN (F)

Δ%ULN

1

0.460**

-0.694**

GH (B)

1

0.077

0.339**

0.193**

1

0.308**

0.361**

0.483**

0.007

GH (F)

ΔGH

1

-0.112

-0.980**

-0.005

-0.253**

-0.200**

1

-0.946**

0.338**

0.974**

0.077

0.328**

0.184**

GHn (B)

1

0.354**

-0.144*

0.942**

0.326**

0.415**

0.583**

0.029

GHn (F)

ΔGHn

1

-0.208**

-0.988**

0.966**

-0.201**

-0.966**

-0.013

-0.249**

-0.188**

1

-0.060

0.035

0.063

-0.059

0.052

0.067

-0.134*

0.046

0.180**

Glu0 (B)

1

0.650**

0.062

0.105

-0.043

0.040

0.090

-0.020

0.067

0.198**

0.089

Glu0 (F)

ΔGlu0

1

-0.161*

-0.854**

0.121

0.027

-0.112

0.104

-0.006

-0.101

0.220**

0.075

-0.174*

1

-0.610**

0.624**

0.798**

0.003

0.002

-0.002

-0.007

0.031

0.013

-0.227**

-0.013

0.231**

Glu120 (B)

1

0.706**

-0.342**

0.710**

0.637**

0.079

0.050

-0.068

0.061

0.018

-0.055

-0.019

0.168*

0.157*

Glu120 (F)

1

0.099

-0.635**

0.485**

-0.103

-0.427**

0.082

0.052

-0.070

0.076

-0.023

-0.078

0.297**

0.202**

-0.153*

ΔGlu120

**: significantly correlated at the 0.01 level (two sides); *: significantly correlated at the 0.05 level (two sides); (B): at baseline; (F): at follow-up; Δ: change from baseline; Glu0h: basal glucose level on OGTT; Glu120: 120-min glucose level on OGTT; GH: growth hormone; GHn: GH nadir; IGF-I: insulin-like growth factor-I; ULN: upper limit of normal range.

ΔGlu120

Glu120 (F)

Glu120 (B)

ΔGlu0

Glu0 (F)

Glu0 (B)

ΔGHn (F)

GHn

GHn (B)

ΔGH

GH

GH (B)

Δ%ULN

%ULN (F)

%ULN (B)

Pearson’s correlation matrix for laboratory parameters before and after TSA

Supplementary data

Copyright© AE&M all rights reserved.

Correlations between IGF-I and glucose intolerance status

Arch Endocrinol Metab. 2019;63/2

review

Combined pituitary hormone deficiency caused by PROP1 mutations: update 20 years post-discovery Fernanda A. Correa1*, Marilena Nakaguma1*, João L. O. Madeira1*, Mirian Y. Nishi1, Milena G. Abrão1, Alexander A. L. Jorge2, Luciani R. Carvalho1, Ivo J. P. Arnhold1, Berenice B. Mendonça1

ABSTRACT The first description of patients with combined pituitary hormone deficiencies (CPHD) caused by PROP1 mutations was made 20 years ago. Here we updated the clinical and genetic characteristics of patients with PROP1 mutations and summarized the phenotypes of 14 patients with 7 different pathogenic PROP1 mutations followed at the Hospital das Clínicas of the University of Sao Paulo.

In addition to deficiencies in GH, TSH, PRL and gonadotropins some patients develop late ACTH deficiency. Therefore, patients with PROP1 mutations require permanent surveillance. On magnetic resonance imaging, the pituitary stalk is normal, and the posterior lobe is in the normal position.

The anterior lobe in patients with PROP1 mutations is usually hypoplastic but may be normal or even enlarged. Bi-allelic PROP1 mutations are currently the most frequently recognized genetic cause of CPHD worldwide. PROP1 defects occur more frequently among offspring of consanguineous parents and familial cases, but they also occur in sporadic cases, especially in countries in which the prevalence of PROP1 mutations is relatively high. We classified all reported PROP1 variants described to date according to the American College of Medical Genetics and Genomics and the Association for Molecular Pathology (ACMG-AMP) guidelines: 29 were pathogenic, 2 were likely pathogenic, and 2 were of unknown significance. An expansion of the phenotype of patients with PROP1 mutations was observed since the first description 20 years ago: variable anterior pituitary size, different pathogenic mutations, and late development of ACTH deficiency. PROP1 mutations are the most common cause of autosomal recessive CPHD with a topic posterior pituitary lobe. Arch Endocrinol Metab. 2019;63(2):167-74 Keywords PROP1; combined pituitary hormone deficiency; growth hormone deficiency; short stature

Unidade de Endocrinologia do Desenvolvimento, Laboratório de Hormônios e Genética Molecular LIM/42, Disciplina de Endocrinologia, Hospital das Clínicas da Faculdade de Medicina da Universidade de São Paulo, São Paulo, SP, Brasil 2 Unidade de Endocrinologia Genética, Laboratório de Endocrinologia Celular e Molecular LIM/25, Disciplina de Endocrinologia, Hospital das Clínicas da Faculdade de Medicina da Universidade de São Paulo, São Paulo, SP, Brasil 1

* These three authors equally contributed to this work Correspondence to: Fernanda de Azevedo Correa Unidade de Endocrinologia do Desenvolvimento, Laboratório de Hormônios e Genética Molecular LIM/42, Hospital das Clínicas, Disciplina de Endocrinologia, Faculdade de Medicina da Universidade de São Paulo Av. Dr. Eneas de Carvalho Aguiar, 255 05403-000 – São Paulo, SP, Brasil feracorrea@uol.com.br Received on Apr/3/2018 Accepted on Mar/12/2019

INTRODUCTION

I

t has been 20 years since Wei Wu in M.G. Rosenfeld’s Research Unit first identified inactivating mutations of the PROP1 gene in humans with combined pituitary hormone deficiency (CPHD) (1). Until now this has been the most common genetic cause of CPHD (2).

Over the past 20 years, our Unit at the Hospital das Clínicas has contributed significantly to the knowledge of PROP1 in CPHD, describing for the first time spontaneous involution of the anterior pituitary and the development of cortisol deficiency (3). We also expanded the spectrum of PROP1 mutations (4-6). Here we review the cumulative knowledge of the genetics and clinical presentation of patients with PROP1 mutations and describe 14 patients who were followed at a single Brazilian center over the past 20 years.

Arch Endocrinol Metab. 2019;63/2

Spontaneous mouse mutants greatly contributed to our initial understanding of CPHD genetics. The Snell and Jackson mice had GH, prolactin and TSH deficiencies. In the early ‘90s, mutations in Pit1, which encodes pituitary-specific transcription factor-1, were described in these animals (7,8). This finding quickly led to the detection of mutations in the human homologue gene POU1F1 (previously known as PIT1) with a similar phenotype (9,10). The Ames dwarf mouse, another spontaneous mutant mouse with a similar phenotype, but without mutations in Pit1, had the genetic cause established a little while later: mutations in a paired-like homeodomain transcription factor termed ‘Prophet of Pit1’ (Prop1) (11). The Ames dwarf phenotype resulted from an apparent failure of initial determination of the Pit1 lineage, required for 167

Copyright© AE&M all rights reserved.

DOI: 10.20945/2359-3997000000139

20 years of PROP1 mutations

the production of GH, prolactin, and TSH, resulting in pituitary dysmorphogenesis and failure to activate Pit1 gene expression. These results suggested that a cascade of tissue-specific regulators is responsible for the determination and differentiation of specific cell lineages in pituitary organogenesis (11). Finally, in 1998, Wu and cols. reported 4 families in which CPHD was caused by inactivating mutations of the PROP1 gene in an autosomal recessive pattern (1). These mutations in the human PROP1 gene resulted in a gene product with impaired DNA binding and transcriptional activation ability. In contrast to individuals with POU1F1 mutations, patients with PROP1 mutations also had luteinizing hormone (LH) and follicle-stimulating hormone (FSH) deficiencies (1).

PROP1 (Prophet of Pit1), located in the long arm of chromosome 5 (5q35.3), has 3 exons and encodes a 226-amino-acid-paired–like homeodomain transcription factor (Figure 1) (12). In 1998, Cogan and cols. and Deladoëy and cols. reported a high frequency of the c.301_302delAG (also known as c.296_297delAG) deletion in exon 2 of PROP1, which remains the most frequent PROP1 mutation (13,14).

in contrast to patients with congenital CPHD caused by other etiologies, neonates with PROP1 defects lack perinatal signs of hypopituitarism. Mean birth weights and lengths are usually within the normal range, while neonatal hypoglycemia and prolonged neonatal jaundice are rare (15,16).

The phenotype usually includes short stature during childhood and a lack of sexual development at puberty.

Distinct phenotypes can be found with hormonal deficiencies progressing with age and asynchronously over time, even among individuals carrying the same genotype (3,17).

Hormonal deficiencies The impairment of pituitary production usually follows a pattern. GH and TSH deficiencies are usually present at diagnosis, LH and FSH deficiencies are noted at the onset of puberty, and ACTH deficiency, when it occurs, may develop during follow-up (15).

Short stature is generally the first symptom reported in PROP1 patients, probably due to combined GH and TSH deficiencies. Growth failure usually develops within the first year of life (height, -1.5 ± 0.9 SDS at 1.5 years of age) and becomes more prominent later in infancy and early childhood, mainly between the ages of 1.5 and 3 years (-3.6 ± 1.3 SDS at 3 years of age), when parents seek medical assistance (15,16). At diagnosis, the bone age is usually severely delayed (median, 3.3 years) (18).

Although TSH deficiency can present shortly after birth, it usually occurs together or after the onset of GH deficiency and before the age of 20 years (mean age, 6.8 years according to Deladoëy and cols.) (14,17).

CLINICAL CHARACTERIZATION Since Wu and cols. first described CPHD families with homozygosity or compound heterozygosity for inactivating mutations in the PROP1 gene, several cases have been reported and more detailed phenotypic characteristics have been described (1).

Patients with PROP1 mutations do not have an increased prevalence of birth via breech delivery or frequent complications during gestation (15). At birth,

c.109+1G>A

c.263T>C c.218G>A c.150delA

c.1A>G

c.301_302delAG c.342+1G>C 3’

5’

Copyright© AE&M all rights reserved.

c.2T>C

c.334C>T c.310delC

c.112_124del c.149_150delGA

c.46C>T c.109+1G>T c.109+2T>G

c.157delA c.211C>T c.212G>A c.217C>T

c.296G>A c.295C>T c.247C>T c.343-11C>G

c.467insT c.373C>T c.362G>C c.358C>T

c.629delC

c.349T>A c.343-2A>T

c.582G>A

Figure 1. Location of pathogenic variants of the PROP1 gene. The mutations detected in our cohort are shown in bold type.

168

Arch Endocrinol Metab. 2019;63/2

20 years of PROP1 mutations

Arch Endocrinol Metab. 2019;63/2

of patients with GH deficiency of the KIGS database (26). At diagnosis (mean age, 16.3 years), the average bone age delay was -6.0 years. Only 1 patient presented with an isolated GH deficiency, while 7 presented with GH and TSH deficiencies. Six patients started followup at the post-pubertal period; thus, they were already diagnosed with LH/FSH deficiency. The remaining patients failed to develop spontaneous puberty; in all cases, puberty was induced with sex steroids. Regarding ACTH deficiency, at the first visit, only one patient had a partial ACTH deficiency (35.8 years). Seven patients evolved to ACTH deficiency (mean age at diagnosis, 28 years, range 11.9–52.1 years) (Table 1).

The TRH stimulation test performed in 11 patients showed TSH peak levels of 2.9–6.8 mU/L with abnormal increment (<5 mU/L) (3). Prolactin levels were more variable with the peak after TRH stimulation (range, 1.5–30.2 ng/mL). However, in 7 patients, the prolactin peak was below 6.1 ng/mL. Patients with the highest prolactin peak levels also had the highest TSH peak levels. These findings suggest a pituitary rather than hypothalamic defect.

Neuroimaging In patients with PROP1 mutations, neuroimaging of the hypothalamic–pituitary region usually shows a hypoplastic or normal anterior pituitary lobe and a topic posterior pituitary lobe, similar to POU1F1 patients (27). This contrasts with the majority of patients with CPHD in whom ectopic posterior lobe and other midline defects are commonly detected (21,28).

Changes in pituitary size and morphology can occur over time and were first reported in 1999 (3).

An 8.8-year-old girl presented with a diffusely enlarged pituitary gland with a hyperintense signal on T1weighted magnetic resonance imaging (MRI); the anterior pituitary markedly decreased in size when the patient was 15 years old (height, from 8 mm to 2 mm). An enlarged pituitary gland may be mistaken for a tumor, leading to unnecessary surgery (29). On the other hand, anterior pituitary adenomas have been reported. The surgical removal of the mass revealed an amorphous material but no recognizable cell types on histopathological examination (3,30).

The pituitary can wax and wane in size before undergoing complete involution for reasons yet to be determined (31). Voutetakis and cols. suggested that the mass causing the pituitary enlargement most likely originates from the intermediate lobe (30). This 169

Copyright© AE&M all rights reserved.

It is important to note that TSH deficiency can be present in patients with an apparently normal TSH-T4 axis. Bottner and cols. diagnosed most cases early in the clinical course based on insufficient responses to thyrotropin-releasing hormone (TRH) stimulation tests; basal TSH levels were within the normal range and free T4 levels were only slightly decreased (15).

Hypothyroidism is usually mild in these cases, in contrast to several patients with POU1F1 mutations who have severe hypothyroidism and cretinism (19).

Gonadotroph function can also progressively decline and present as a primary or secondary lack of reproductive function. Clinically, it may manifest as a lack of pubertal development, i.e. failure to enter or complete puberty (14,20). There are reports of spontaneous puberty with a posterior decline of gonadotrophic function in Arg120Cys, Phe88Ser, and c.150delA PROP1 mutations (4,17,21). Impaired gonadotrophic function occurs in the most common PROP1 mutation (c.301_302delAG).

In 1999, Mendonca and cols. reported on an evolving ACTH deficiency in one patient (3). A corticotrophin deficiency was later confirmed in many but not all patients with PROP1 deficiency. It appears unlikely that a PROP1 transcription factor deficiency directly causes ACTH deficiency, but this clinical finding suggests that PROP1 has some role in corticotroph differentiation or viability. Since adrenal function has been shown to gradually decline over time, even after more than four decades, surveillance is extremely important in all patients with PROP1 mutations (20,22,23). Furthermore, as GH replacement can increase cortisol metabolism, it is necessary to be aware of the signs of an unveiled adrenal insufficiency (24).

The literature review revealed that the mean age at ACTH deficiency diagnosis is 25.3 years (range, 7.4– 67 years), confirming previous data demonstrating the emergence of an ACTH deficiency in the third decade of life (1,22).

Among our 14 patients, 3 were born by cesarean section due to obstetrical indications, the median weight was 3435 ± 390 g (SDS + 0.65 ± 0.92); and 2 presented with prolonged neonatal jaundice. Eight of 10 patients for whom term birth weight was available had birthweights according to gestational age above 50th percentile (Fetal Growth Longitudinal Study, World Health Organization) (25). This is similar to another cohort of patients with PROP1 deficiency (15). This finding contrasts with that of the majority

20 years of PROP1 mutations

enlargement might result from abnormal development of the anterior lobe and the absence of physiological regression of the intermediate pituitary lobe during organogenesis as was demonstrated by Ward and cols. in Ames dwarf mice (32). According to Ward and cols., the basis of the pathogenesis of pituitary lesions in PROP1 mutations is the arrest of normal proliferation and migration of the anterior pituitary lobe cells combined with dysmorphic hyperplasia of the dorsal part of the Rathke’s pouch.

Among our cohort of 14 patients, MRI showed a hypoplastic anterior pituitary in 11. The pituitary gland size varied over time from hyperplastic to normal in only 1 patient, while 2 had normal-sized pituitary glands (Table 1). Two patients (patients 11 and 12; Table 1) had pituitary imaging suggestive of microadenomas. Patient 11 presented a small anterior pituitary (height, 3.5 mm) with a hypointense nodular area (3.0 mm, T1-weighted MRI). Patient 12 presented a normal anterior pituitary (height, 5 mm) with a hypointense area (3.2 mm, T1-weighted MRI) suggestive of microadenoma.

GENETIC DIAGNOSIS Pathogenic PROP1 mutations are the most frequent cause of congenital CPHD, with a prevalence of 0.8– 64.8% in different countries (2,18). In our center, we screened 29 Brazilian index cases with CPHD and topic posterior pituitary lobe; 52% (15/29) of them carried bi-allelic PROP1 mutations (5). PROP1 defects do not lead to midline defects such as ectopic posterior pituitary lobe (EPP) or septic-optic dysplasia. It is noteworthy that the majority of patients with congenital CPHD present with EPP (2).

PROP1 mutations lead to CPHD in an autosomal recessive inheritance pattern; therefore, the prevalence of these mutations is higher in familial cases (2,5).

Among our Brazilian cohort of patients with CPHD and topic posterior pituitary lobe, all 6 familial cases presented with PROP1 mutations versus only 9 of the 23 sporadic cases (5). Like other recessive genetic disorders, the frequency of PROP1 mutations is also higher in patients born to consanguineous parents.

In our experience, 5 of 7 sporadic cases born to

Table 1. Clinical features and genetic diagnosis of 14 patients with PROP1 mutation followed at Hospital das Clínicas, University of Sao Paulo Medical School

Copyright© AE&M all rights reserved.

First visit Birth weight (g)

Final hormone deficiencies

Anterior pituitary lobe

PROP1 variants

2.5

3650

GH, TSH, LH/FSH*, ACTH

Hypoplasia

c.263T>C

2.0

3420

GH, TSH, ACTH, LH/FSH*

Normal

c.301_302delAG c.301_302delAG

Patient

Gender

CA (yrs)

Cm

SD

Bone age (yrs)

1

F

4.5

92.5

-3.1

2

F

6.3

100.0

-2.9

Height

3

F

6.6

101.1

-3.0

2.5

3780

GH, TSH, LH/FSH*, ACTH

Hyperplasia/ hypoplasia

4

F

7.4

103.1

-3.3

3.0

3550

GH, TSH, LH/FSH*

Hypoplasia

c.1A>G/c.263T>C

5

F

12.3

107

-6.1

7.8

2500

GH, TSH, LH/FSH*

Hypoplasia

c.301_302delAG

6

F

12.3

106.4

-6.4

5.5

3700

GH, TSH, LH/FSH*, ACTH

Hypoplasia

c.301_302delAG

7

F

14.9

104.0

-9.4

2.5

NA

GH, TSH, LH/FSH, ACTH

Hypoplasia

c.301_302delAG

8

F

25.8

126.5

-6.0

13.0

3200

GH, TSH, LH/FSH

Hypoplasia

PROP1 complete deletion

9

F

30.3

117.2

-7.5

10.0

NA

GH, TSH, LH/FSH

Hypoplasia

c.301_302delAG

10

F

35.5

119.0

-7.2

13.5

NA

GH, TSH, LH/FSH, pACTH

Hypoplasia

c.301_302delAG c.218G>A/c.342+1G>C c.1A>G/c.263T>C

11

F

38.2

136.1

-4.4

-

2780

GH, TSH, LH/FSH*, ACTH

Normal/ microadenoma

12

M

6.8

106

-2.5

2.7

3450

GH, TSH, LH/FSH*, ACTH

Hypoplasia/ microadenoma

13

M

9.5

97.0

-6.0

3.5

3250

GH, TSH, LH/FSH*, ACTH

Hypoplasia

c.301_302delAG

14

M

18.3

123

-7.8

-

NA

GH, TSH, LH/FSH, pACTH

Hypoplasia

c.109+1G>A/c.301_302delAG

CA: chronological age; F: female; M: male; TH: target height; NA: not available. * Patients developed LH/FSH deficiency during follow-up. Patient 6 was born preterm; patients 3 and 5 had neonatal jaundice. pACTH: partial adrenocorticotropin hormone deficiency (basal cortisol level > 5.0 µg/dL and peak cortisol level < 18.1 µg/dL.

170

Arch Endocrinol Metab. 2019;63/2

20 years of PROP1 mutations

consanguineous parents presented with PROP1 mutations versus only 4 of 16 sporadic cases born to non-consanguineous parents (5).

Different types of molecular defects reportedly disrupt PROP1 function, varying from complete gene deletion to frameshift small deletions and insertions and point mutations including missense, nonsense, splicing variants, and mutations affecting the initiation codon (5). Table 2 and Figure 1 summarize all PROP1 mutations reported to date.

The majority of PROP1 mutations classified as pathogenic according to the American College of Medical Genetics (33) are located on exon 2 and affect the PROP1 homeodomain, which is crucial for activating POU1F1 expression and pituitary organogenesis (34).

The most prevalent PROP1 mutation is the c.301_302delAG (p.Leu102Cysfs*8), which leads to a premature stop codon at residue 110 (1,13). This frameshift deletion is especially frequent in Eastern Europe, Portuguese, and Latin American patients,

Table 2. PROP1 variants reported to date. Effect on protein and classification according to ACMG guidelines (33). The mutations detected in our cohort are shown in bold type Effect on protein

ACMG classification

c.1A>G

Initiation codon mutation

Pathogenic

(5)

c.2T>C

Initiation codon mutation

Pathogenic

(28)

c.46C>T

Reference

p.Arg16Ter

Pathogenic

(40)

c.109+1G>A

Splicing site change

Pathogenic

(5)

c.109+1G>T

Splicing site change

Pathogenic

(28)

c.109+2T>G

Splicing site change

Pathogenic

(13)

c.112_124del

p.Ser38Profs*123

Pathogenic

(41)

c.149_150delGA

p.Gly52Aspfs*58

Pathogenic

(42)

c.150delA

p.Arg53Aspfs*112

Pathogenic

(36)

c.157delA

p.Arg53Aspfs*112

Pathogenic

(42)

c.211C>T

p.Arg71Cys

VUS

(43)

c.212G>A

p.Arg71His

VUS

(43)

c.217C>T

p.Arg73Cys

Pathogenic

(12,44)

c.218G>A

p.Arg73His

Pathogenic

(45)

c.247C>T

p.Gln83Ter

Pathogenic

(46)

c.263T>C

p.Phe88Ser

Pathogenic

(4)

c.295C>T

p.Arg99Ter

Pathogenic

(47)

c.296G>A

p.Arg99Gln

Likely pathogenic

(48)

c.301_302delAG

p.Leu102Cysfs*8

Pathogenic

(1)

c.310delC

p.Arg104Glyfs*61

Pathogenic

(49)

c.334C>T

p.Arg112Ter

Pathogenic

(50)

c.342+1G>C

Splicing site change

Pathogenic

(5)

c.343-11C>G

Splicing site change

Likely pathogenic

(49)

c.343-2A>T

Splicing site change

Pathogenic

(12)

c.349T>A

p.Phe117Ile

Pathogenic

(1)

c.358C>T

p.Arg120Cys

Pathogenic

(1)

c.362G>C

p.Arg121Thr

VUS

(51)

c.373C>T

p.Arg125Trp

Pathogenic

(49)

c.467insT

p.Tyr157Leufs*36

Pathogenic

(52,53)

c.582G>A

p.Trp194Ter

Pathogenic

(53,54)

c.629delC

p.Pro210Hisfs*25 (prolonged protein)

Pathogenic

(54)

CopyrightŠ AE&M all rights reserved.

Mutation

ACMG: American College of Medical Genetics (33); VUS: variant of uncertain significance.

Arch Endocrinol Metab. 2019;63/2

171

Copyright© AE&M all rights reserved.

20 years of PROP1 mutations

probably due to two ancestral founder haplotypes: one that originated from the Baltic Sea area around 2525 years ago and another that originated from the Iberian Peninsula around 583 years ago (35). The c.301_302delAG mutation, the most common genetic diagnosis in Brazilian patients with CPHD and topic posterior pituitary, was present in 9 of 15 index patients with PROP1 mutations in our group (5).

The second most prevalent mutation is the frameshift 1-bp deletion c.150delA (p.Arg53Aspfs*112) (36), which is probably due to the founder variant that originated from the Belarus region around 1093 years ago (35). Interestingly, we detected this mutation in only one index case in our cohort (5).

Although the known founder effect of the c.301_302delAG mutation in both Portuguese and Spanish populations potentially contributes to a high prevalence of PROP1 mutations in our cohort, 6 additional PROP1 mutations were identified in our population. The multi-ethnic origin of the Brazilian population (Amerindian, African, various European, and Asian immigrants) may contribute to these findings (5).

The molecular diagnosis of patients with congenital CPHD impacts the clinical follow-up: patients carrying PROP1 mutations fail to achieve normal puberty and may develop ACTH deficiency, while those carrying POU1F1 mutations present with only GH, TSH, and PRL deficiencies. Furthermore, confirming the diagnosis allows genetic counseling for family members and may contribute to the diagnosis of other affected relatives.

Although several algorithms have been designed to guide candidate gene screening by the Sanger method to identify the molecular etiology of congenital CPHD (2,37,38), mutations have been detected using this approach in only a minority of cases (2). In this context, large-scale sequencing (LSS) is a promising approach that sequences large stretches of DNA base pairs, which may include the entire exome (wholeexome sequencing) or multiple candidate genes (in an LSS panel) in a single sequencing run (39). Due to its capacity to simultaneously screen multiple genes, this method may be especially useful when genotype– phenotype correlation is poor or a candidate gene is not suspected (39). Although LSS has great potential for identifying novel genetic causes of rare diseases and expanding the phenotypes associated with known genes, it remains an expensive technique that is not available to all patients. Therefore, in patients with 172

congenital CPHD and topic posterior pituitary who live in areas with a high prevalence of PROP1 mutations such as Brazilian and some Eastern European cohorts, sequencing PROP1 using the Sanger method is an adequate first step of a molecular investigation. If no PROP1 mutations are found, an LSS panel or wholeexome sequencing could be considered.

CONCLUSIONS Since its first description 20 years ago, a large expansion of the phenotypes of patients with PROP1 mutations has occurred. In addition to deficiencies in GH, TSH, PRL, and gonadotropins, some patients develop late ACTH deficiency. Therefore, all patients require permanent surveillance. On MRI of patients with PROP1 mutations, the pituitary stalk appears intact and the posterior pituitary lobe appears in the normal position, in contrast to the majority of patients with CPHD, who have an interrupted stalk and ectopic posterior pituitary lobe. The anterior lobe in patients with PROP1 mutations is usually hypoplastic, but it may be normal or even enlarged and can wax and wane in size. Bi-allelic PROP1 mutations are presently the most frequently recognized genetic cause of CPHD worldwide. Here we classified all reported PROP1 variants identified to date according to ACMG-AMP guidelines into 29 pathogenic, 2 likely pathogenic, and 2 variants of uncertain significance. The prevalence is higher among offspring of consanguineous parents and familial cases, but sporadic cases can also occur.

Here we summarized the clinical, hormonal, imaging, and genetic characteristics of 14 patients followed at the Hospital das Clínicas of University of Sao Paulo Medical School with 7 different PROP1 mutations, the most diverse in a single unit. PROP1 mutations are the most frequent cause of autosomal recessive CPHD with topic posterior pituitary lobe.

Acknowledgments: the authors thank Maria Geralda Farah Osorio, Suemi Marui, Peter Kopp, and Maristela Vasconcelos Leite for their contributions to the study.

Funding: this work was supported by the National Council of Technological and Scientific Development – Brazil to BBM (grant number CNPq-PQ 305743/2011-2) and AALJ (grant number CNPq-PQ 304678/2012-0) and by the São Paulo Research Foundation – Fapesp to AALJ (grant number 2013/03236-5).

Disclosure: no potential conflict of interest relevant to this article was reported.

Arch Endocrinol Metab. 2019;63/2

20 years of PROP1 mutations

1. Wu W, Cogan JD, Pfaffle RW, Dasen JS, Frisch H, O’Connell SM, et al. Mutations in PROP1 cause familial combined pituitary hormone deficiency. Nat Genet. 1998;18(2):147-9.

2. De Rienzo F, Mellone S, Bellone S, Babu D, Fusco I, Prodam F, et al.; Italian Study Group on Genetics of CPHD. Frequency of genetic defects in combined pituitary hormone deficiency: a systematic review and analysis of a multicentre Italian cohort. Clin Endocrinol (Oxf). 2015;83(6):849-60.

3. Mendonca BB, Osorio MG, Latronico AC, Estefan V, Lo LS, Arnhold IJ. Longitudinal hormonal and pituitary imaging changes in two females with combined pituitary hormone deficiency due to deletion of A301,G302 in the PROP1 gene. J Clin Endocrinol Metab. 1999;84(3):942-5.

4. Osorio MG, Kopp P, Marui S, Latronico AC, Mendonca BB, Arnhold IJ. Combined pituitary hormone deficiency caused by a novel mutation of a highly conserved residue (F88S) in the homeodomain of PROP-1. J Clin Endocrinol Metab. 2000;85(8):2779-85.

5. Madeira JL, Nishi MY, Nakaguma M, Benedetti AF, Biscotto IP, Fernandes T, et al. Molecular analysis of brazilian patients with combined pituitary hormone deficiency and orthotopic posterior pituitary lobe reveals eight different PROP1 alterations with three novel mutations. Clin Endocrinol (Oxf). 2017;87(6):725-32.

6. Abrão MG, Leite MV, Carvalho LR, Billerbeck AE, Nishi MY, Barbosa AS, et al. Combined pituitary hormone deficiency (CPHD) due to a complete PROP1 deletion. Clin Endocrinol (Oxf).

2006;65(3):294-300.

7. Camper SA, Saunders TL, Katz RW, Reeves RH. The Pit-1 transcription factor gene is a candidate for the murine Snell dwarf mutation. Genomics. 1990;8(3):586-90.

cohort of patients with PROP1 gene defects. Eur J Endocrinol.

2005;153(3):389-96.

17. Flück C, Deladoey J, Rutishauser K, Eblé A, Marti U, Wu W, et al.

Phenotypic variability in familial combined pituitary hormone deficiency caused by a PROP1 gene mutation resulting in the substitution of Arg-->Cys at codon 120 (R120C). J Clin Endocrinol Metab. 1998;83(10):3727-34.

18. Navardauskaite R, Dusatkova P, Obermannova B, Pfaeffle RW, Blum WF, Adukauskiene D, et al. High prevalence of PROP1 defects in Lithuania: phenotypic findings in an ethnically homogenous cohort of patients with multiple pituitary hormone deficiency. J Clin Endocrinol Metab. 2014;99(1):299-306.

19. Tenenbaum-Rakover Y, Sobrier ML, Amselem S. A novel POU1F1 mutation (p.Thr168IlefsX7) associated with an early and severe form of combined pituitary hormone deficiency: functional analysis and follow-up from infancy to adulthood. Clin Endocrinol (Oxf). 2011;75(2):214-9.

20. Pavel ME, Hensen J, Pfäffle R, Hahn EG, Dörr HG. Long-term follow-up of childhood-onset hypopituitarism in patients with the PROP-1 gene mutation. Horm Res. 2003;60(4):168-73.

21. Riepe FG, Partsch CJ, Blankenstein O, Mönig H, Pfäffle RW, Sippell WG. Longitudinal imaging reveals pituitary enlargement preceding hypoplasia in two brothers with combined pituitary hormone deficiency attributable to PROP1 mutation. J Clin Endocrinol Metab. 2001;86(9):4353-7.

22. Pernasetti F, Toledo SP, Vasilyev VV, Hayashida CY, Cogan JD, Ferrari C, et al. Impaired adrenocorticotropin-adrenal axis in combined pituitary hormone deficiency caused by a two-base pair deletion (301-302delAG) in the prophet of Pit-1 gene. J Clin Endocrinol Metab. 2000;85(1):390-7.

8. Li S, Crenshaw EB, Rawson EJ, Simmons DM, Swanson LW, Rosenfeld MG. Dwarf locus mutants lacking three pituitary cell types result from mutations in the POU-domain gene pit-1. Nature. 1990;347(6293):528-33.

23. Asteria C, Oliveira JH, Abucham J, Beck-Peccoz P. Central hypocortisolism as part of combined pituitary hormone deficiency due to mutations of PROP-1 gene. Eur J Endocrinol. 2000;143(3): 347-52.

9.

Pfäffle RW, DiMattia GE, Parks JS, Brown MR, Wit JM, Jansen M, et al. Mutation of the POU-specific domain of Pit-1 and hypopituitarism without pituitary hypoplasia. Science. 1992;257(5073):111821.

24. Weaver JU, Thaventhiran L, Noonan K, Burrin JM, Taylor NF, Norman MR, et al. The effect of growth hormone replacement on cortisol metabolism and glucocorticoid sensitivity in hypopituitary adults. Clin Endocrinol (Oxf). 1994;41(5):639-48.

10. Tatsumi K, Miyai K, Notomi T, Kaibe K, Amino N, Mizuno Y, et al.

Cretinism with combined hormone deficiency caused by a mutation in the PIT1 gene. Nat Genet. 1992;1(1):56-8.

25. Papageorghiou AT, Ohuma EO, Altman DG, Todros T, Cheikh Ismail L, Lambert A, et al.; International Fetal and Newborn Growth Consortium for the 21st Century (INTERGROWTH-21st). International standards for fetal growth based on serial ultrasound measurements: the Fetal Growth Longitudinal Study of the INTERGROWTH-21st Project. Lancet. 2014;384(9946):869-79.

11. Sornson MW, Wu W, Dasen JS, Flynn SE, Norman DJ, O’Connell SM, et al. Pituitary lineage determination by the Prophet of Pit1 homeodomain factor defective in Ames dwarfism. Nature.

1996;384(6607):327-33.

12. Duquesnoy P, Roy A, Dastot F, Ghali I, Teinturier C, Netchine I, et al.

Human Prop-1: cloning, mapping, genomic structure. Mutations in familial combined pituitary hormone deficiency. FEBS Lett.

1998;437(3):216-20.

13. Cogan JD, Wu W, Phillips JA 3rd, Arnhold IJ, Agapito A, Fofanova OV, et al. The PROP1 2-base pair deletion is a common cause of combined pituitary hormone deficiency. J Clin Endocrinol Metab.

1998;83(9):3346-9.

14. Deladoëy J, Flück C, Büyükgebiz A, Kuhlmann BV, Eblé A, Hindmarsh PC, et al. “Hot spot” in the PROP1 gene responsible for combined pituitary hormone deficiency. J Clin Endocrinol Metab.

1999;84(5):1645-50.

15. Bottner A, Keller E, Kratzsch J, Stobbe H, Weigel JF, Keller A, et al. PROP1 mutations cause progressive deterioration of anterior pituitary function including adrenal insufficiency: a longitudinal analysis. J Clin Endocrinol Metab. 2004;89(10):5256-65.

16. Lebl J, Vosáhlo J, Pfaeffle RW, Stobbe H, Cerná J, Novotná D, et al. Auxological and endocrine phenotype in a population-based Arch Endocrinol Metab. 2019;63/2

26. Ranke MB, Price DA, Reiter EO. Growth hormone therapy in pediatrics: 20 years of KIGS. Basel/New York: Karger; 2007.

27. Arnhold IJ, Nery M, Brown MR, Voss TC, VanderHeyden TC, Adess ME, et al. Clinical and molecular characterization of a Brazilian patient with Pit-1 deficiency. J Pediatr Endocrinol Metab.

1998;11(5):623-30.

28. Lemos MC, Gomes L, Bastos M, Leite V, Limbert E, Carvalho D, et al. PROP1 gene analysis in Portuguese patients with combined pituitary hormone deficiency. Clin Endocrinol (Oxf). 2006;65(4): 479-85.

29. Nascif SO, Vieira TC, Ramos-Dias JC, Lengyel AM, Abucham J. Waxing and waning of a pituitary mass in a young woman with combined pituitary hormone deficiency (CPHD) due to a PROP-1 mutation. Pituitary. 2006;9(1):47-52.

30. Voutetakis A, Argyropoulou M, Sertedaki A, Livadas S, Xekouki P, Maniati-Christidi M, et al. Pituitary magnetic resonance imaging in 15 patients with Prop1 gene mutations: pituitary enlargement may originate from the intermediate lobe. J Clin Endocrinol Metab. 2004;89(5):2200-6.

173

Copyright© AE&M all rights reserved.

REFERENCES

20 years of PROP1 mutations

31. Turton JP, Mehta A, Raza J, Woods KS, Tiulpakov A, Cassar J, et al. Mutations within the transcription factor PROP1 are rare in a cohort of patients with sporadic combined pituitary hormone deficiency (CPHD). Clin Endocrinol (Oxf). 2005;63(1):10-8.

32. Ward RD, Raetzman LT, Suh H, Stone BM, Nasonkin IO, Camper SA. Role of PROP1 in pituitary gland growth. Mol Endocrinol.

2005;19(3):698-710.

33. Richards S, Aziz N, Bale S, Bick D, Das S, Gastier-Foster J, et al., Committee ALQA. Standards and guidelines for the interpretation of sequence variants: a joint consensus recommendation of the American College of Medical Genetics and Genomics and the Association for Molecular Pathology. Genet Med. 2015;17(5): 405-24.

34. Olson LE, Tollkuhn J, Scafoglio C, Krones A, Zhang J, Ohgi KA, et al. Homeodomain-mediated beta-catenin-dependent switching events dictate cell-lineage determination. Cell. 2006;125(3): 593-605.

35. Dusatkova P, Pfaffle R, Brown MR, Akulevich N, Arnhold IJ, Kalina MA, et al. Genesis of two most prevalent PROP1 gene variants causing combined pituitary hormone deficiency in 21 populations. Eur J Hum Genet. 2016;24(3):415-20.

typic and in vitro functional studies. J Clin Endocrinol Metab.

2004;89(11):5779-86.

44. Voutetakis A, Maniati-Christidi M, Kanaka-Gantenbein C, Dracopoulou M, Argyropoulou M, Livadas S, et al. Prolonged jaundice and hypothyroidism as the presenting symptoms in a neonate with a novel Prop1 gene mutation (Q83X). Eur J Endocrinol.

2004;150(3):257-64.

45. Vallette-Kasic S, Barlier A, Teinturier C, Diaz A, Manavela M, Berthezène F, et al. PROP1 gene screening in patients with multiple pituitary hormone deficiency reveals two sites of hypermutability and a high incidence of corticotroph deficiency. J Clin Endocrinol Metab. 2001;86(9):4529-35.

46. Parks JS, Brown MR, Hurley DL, Phelps CJ, Wajnrajch MP. Heritable disorders of pituitary development. J Clin Endocrinol Metab.

1999;84(12):4362-70.

47. Vieira TC, Dias da Silva MR, Cerutti JM, Brunner E, Borges M, Arnaldi LT, et al. Familial combined pituitary hormone deficiency due to a novel mutation R99Q in the hot spot region of Prophet of Pit-1 presenting as constitutional growth delay. J Clin Endocrinol Metab. 2003;88(1):38-44.

36. Krzisnik CK, Kolacio Z, Battelino T, Brown M, Parks JS, Laron Z. The “little people” of the island of Krk - revisited. Etiology of hypopituitarism revealed. J Endocr Genet. 1999;1:9-19.

48. Kelberman D, Turton JP, Woods KS, Mehta A, Al-Khawari M, Greening J, et al. Molecular analysis of novel PROP1 mutations associated with combined pituitary hormone deficiency (CPHD).

Clin Endocrinol (Oxf). 2009;70(1):96-103.

37. Davis SW, Castinetti F, Carvalho LR, Ellsworth BS, Potok MA, Lyons RH, et al. Molecular mechanisms of pituitary organogenesis: In search of novel regulatory genes. Mol Cell Endocrinol.

2010;323(1):4-19.

49. Ogo A, Maruta T, Ide C, Sakai Y, Matoba Y, Hiramatsu S, et al. Recombinant human growth hormone replacement in a Japanese man with a novel PROP1 gene mutation (R112X). Fukuoka Igaku Zasshi. 2011;102(9):277-83.

38. Bas F, Uyguner ZO, Darendeliler F, Aycan Z, Cetinkaya E, Berberoglu M, et al. Molecular analysis of PROP1, POU1F1, LHX3, and HESX1 in Turkish patients with combined pituitary hormone deficiency: a multicenter study. Endocrine. 2015;49(2):479-91.

50. Avbelj Stefanija M, Kotnik P, Bratanic N, Zerjav Tansek M, Bertok S, Bratina N, et al. Novel Mutations in HESX1 and PROP1 Genes in Combined Pituitary Hormone Deficiency. Horm Res Paediatr.

2015;84(3):153-8.

39. de Bruin C, Dauber A. Insights from exome sequencing for endocrine disorders. Nat Rev Endocrinol. 2015;11(8):455-64.

51. Nose O, Tatsumi K, Nakano Y, Amino N. Congenital combined pituitary hormone deficiency attributable to a novel PROP1 mutation (467insT). J Pediatr Endocrinol Metab. 2006;19(4):491-8.

40. Birla S, Khadgawat R, Jyotsna VP, Jain V, Garg MK, Bhalla AS, et al. Identification of Novel PROP1 and POU1F1 Mutations in Patients with Combined Pituitary Hormone Deficiency. Horm Metab Res. 2016;48(12):822-7.

41. Fofanova O, Takamura N, Kinoshita E, Parks JS, Brown MR, Peterkova VA, et al. Compound heterozygous deletion of the PROP-1 gene in children with combined pituitary hormone deficiency. J Clin Endocrinol Metab. 1998;83(7):2601-4.

42. Tatsumi KI, Kikuchi K, Tsumura K, Amino N. A novel PROP1 gene mutation (157delA) in Japanese siblings with combined anterior pituitary hormone deficiency. Clin Endocrinol (Oxf).

2004;61(5):635-40.

53. Reynaud R, Barlier A, Vallette-Kasic S, Saveanu A, Guillet MP, Simonin G, et al. An uncommon phenotype with familial central hypogonadism caused by a novel PROP1 gene mutant truncated in the transactivation domain. J Clin Endocrinol Metab.

2005;90(8):4880-7.

54. Reynaud R, Gueydan M, Saveanu A, Vallette-Kasic S, Enjalbert A, Brue T, et al. Genetic screening of combined pituitary hormone deficiency: experience in 195 patients. J Clin Endocrinol Metab.

2006;91(9):3329-36.

Copyright© AE&M all rights reserved.

43. Reynaud R, Chadli-Chaieb M, Vallette-Kasic S, Barlier A, Sarles J, Pellegrini-Bouiller I, et al. A familial form of congenital hypopituitarism due to a PROP1 mutation in a large kindred: pheno-

52. Shibahara H, Ikeshita N, Sugiyama Y, Toda K, Yamamoto D, Herningtyas EH, et al. W194XProp1 and S156insTProp1, both of which have intact DNA-binding domain, show a different DNA-binding activity to the Prop1-binding element in human Pit-1 gene. Mol Cell Endocrinol. 2010;323(2):167-71.

174

Arch Endocrinol Metab. 2019;63/2

case report

The 4Ds of ectopic ACTH syndrome: diagnostic dilemmas of a difficult disease Marcelo Vieira-Corrêa1, Débora Moroto1, Giovanna Carpentieri1, Igor Veras1, Claudio E. Kater1

Unidade de Adrenal e Hipertensão, Disciplina de Endocrinologia e Metabologia, Departamento de Medicina, Escola Paulista de Medicina, Universidade Federal de São Paulo (EPM/Unifesp), São Paulo, SP, Brasil 1

SUMMARY Cushing’s syndrome (CS) is an uncommon condition that leads to high morbidity and mortality.

The majority of endogenous CS is caused by excessive ACTH secretion, mainly due to a pituitary tumor – the so-called Cushing’s disease (CD) – followed by ectopic ACTH syndrome (EAS), an extrapituitary tumor that produces ACTH; adrenal causes of CS are even rarer. Several methods are used to differentiate the two main etiologies: specific laboratory tests and imaging procedures, and bilateral inferior petrosal sinus sampling (BIPSS) for ACTH determination; however, identification of the source of ACTH overproduction is often a challenge. We report the case of a 28-year-old woman with clinical and laboratory findings consistent with ACTH-dependent CS. All tests were mostly definite, but several confounding factors provoked an extended delay in identifying the origin of ACTH secretion, prompting a worsening of her clinical condition, with difficulty controlling hyperglycemia, hypokalemia, and hypertension. During this period, clinical treatment was decisive, and measurement of morning salivary cortisol was a differential for monitoring cortisol levels. This report shows that clinical reasoning, experience and use of recent methods of nuclear medicine were decisive for the elucidation of the case. Arch Endocrinol Metab. 2019;63(2):175-81

Correspondence to: Claudio E. Kater Unidade de Adrenal e Hipertensão, Disciplina de Endocrinologia e Metabologia, Departamento de Medicina, Escola Paulista de Medicina, Universidade Federal de São Paulo Rua Pedro de Toledo, 781, 13º andar 04239-032 – São Paulo, SP, Brasil kater@unifesp.br Received on Dec/12/2017 Accepted on Feb/21/2019

INTRODUCTION

C

ushing’s syndrome (CS) is a cluster of clinical signs and symptoms secondary to cortisol excess. It may occur due to chronic glucocorticoid administration or, less frequently, due to endogenous production (1). Endogenous CS is classified according to ACTH dependence: ACTH-independent CS (primary adrenal disease) corresponds to less than 20% of cases, whereas the ACTH-dependent form (secondary disease) is much more prevalent (~80%). Confirmation of cortisol autonomy, identification of its etiology, and proper treatment remain challenges (1).

The major cause of CS, encompassing 60-70% of all cases, is an ACTH-producing pituitary tumor (Cushing’s disease [CD]), generally a microadenoma.

Ectopic ACTH syndrome (EAS), an ACTH-producing extra-pituitary tumor of several origins, is the second endogenous cause, responsible for 5-10% of cases (1,2). EAS may also result from an ectopic CRHproducing tumor (1). The most frequent neoplasms Arch Endocrinol Metab. 2019;63/2

associated with EAS are small-cell lung carcinoma and other neuroendocrine tumors of the lungs, thymus and pancreas (3). Occasionally, a thyroid medullary carcinoma, pheochromocytoma, gastrinoma, or prostate carcinoma may produce the EAS (3).

Classical stigmata of CS are present in both CD and EAS. However, metabolic derangements and several other unspecific features are more prevalent in EAS, such as a rapid disease progression (4), intense proximal muscle weakness, severe hypertension and hypokalemia (5), and marked hyperpigmentation secondary to higher plasma ACTH levels (usually >100 pg/mL) (6).

A major challenge in the EAS is to determine the origin of ACTH excess. Up to 50% of these tumors may escape detection by chest and abdominal computerized tomography (CT) and/or magnetic resonance imaging (MRI) (3,7), and remain “occult”.

Simultaneous or coupled use of plain (CT/MRI) and functional imaging (scintigraphy) are useful for these undetermined cases.

175

Copyright© AE&M all rights reserved.

DOI: 10.20945/2359-3997000000129

Dilemmas in ectopic ACTH syndrome

CASE REPORT A 28-year-old Caucasian woman was referred to the Adrenal Outpatient Clinic at EPM/UNIFESP because of progressive and rapid darkening of the skin and recent weight gain. In several weeks, her face turned plethoric, oily and hairy with acne. Within the past 6 months, the patient noticed a further progression of weight gain especially in her belly, a “buffalo hump”, several purple striae in her thighs and abdomen, and intense proximal muscle weakness.

The patient’s past medical history was unremarkable except for the presence of endometriosis, which has been treated for the past two years with the continuous use of a combined oral contraceptive (ethinylestradiol 30 mcg plus gestodene 75 mcg), making her amenorrheic ever since. She denied other comorbidities and the use of any other medications (including corticosteroids) and recreational drugs.

Initial physical exam disclosed weight of 66.2 kg and height of 167 cm (BMI = 23.7 kg/m2). The patient has a full-blown cushingoid appearance with moderate central obesity, discrete cervicodorsal adiposity, plethoric “moon facies”, diffuse scalp balding, increased hair in androgenic areas, facial and dorsal acne, skin thinning with squamation, purple striae in the abdomen and root of the thighs (some wider than 1 cm), and muscle hypotrophy in the legs, with a grade III diminished strength.

Investigation and treatment Initial laboratory results (Table 1) revealed hypercortisolism with increased ACTH levels, hyperandrogenism and an otherwise normal metabolic profile. These results typically supported the syndromic diagnosis of ACTH-dependent CS.

To investigate for the possibility of CD, a pituitary MRI proved non-informative. Subsequently, a chest CT and an MRI showed a 0.8 cm nodular lesion in the inferior lobe of the left lung. The suspicious nodule was then investigated with a Fluor-deoxyglucose scintigraphy (18F-FDG PET-CT; Figure 1), showing a discrete glucose uptake (SUV of 1.4). Additional investigation with an 111In-Pentetreotide scintigraphy (Octreoscan®) was negative.

After consulting with the thoracic surgeons and radiologists in the adrenal unit, it was concluded that the lesion characteristics were possibly of vascular origin and unrelated to the disease. Needle biopsy and surgical removal were both inadvisable.

Because a previous thyroid ultrasonography was positive for the presence of two solid nodules of 1.3 and 1.2 cm in diameter, attention was directed toward the possibility of a medullary thyroid carcinoma being the origin of ACTH excess. Fine-needle aspiration biopsy was performed, and the nodules were characterized as Bethesda II. ACTH and calcitonin levels in the fluid wash were negative.

A second pituitary MRI employing a 3-Tesla machine and dynamic study revealed a 6mm cystic lesion in the upper posterior right portion of the gland.

Although considered of low suspicion potential, it prompted a detailed reinvestigation of the pituitary as the origin of the disease.

We have not employed the high-dose 8 mg DST, and have virtually abandoned it because it generates up to 30% false results and a high rate of discordance with the CRH stimulation test (1).

Therefore, the patient underwent a bilateral inferior petrosal sinus sampling (BIPSS) for ACTH measurements (Table 2). Prolactin levels were used

Table 1. Results of initial hormonal evaluation and reference values Hormonal test Testosterone

Copyright© AE&M all rights reserved.

Dehydroepiandrosterone sulfate (DHEA-S)

Result

Reference values

98

< 10 – 75 ng/dL

504

96 – 512 mcg/dL

Dehydroepiandrosterone (DHEA)

1,200

100 – 1,200 ng/dL

Androstenedione

1,140

40 – 410 ng/dL

Follicle-stimulating hormone (FSH)

0.16

3.5 – 12.5 mUI/mL

Luteinizing hormone (LH)

0.07

2.4 – 12.6 mUI/mL

Corticotropin (ACTH)

138

7.2 – 63 pg/mL

Basal Serum cortisol

33.1

6.2 –19.4 mcg/dL

23h-Salivary cortisol

6,040

< 250 ng/dL

Post-1mg DST Salivary cortisol

1,110

< 50 ng/dL

Post-1mg DST Serum cortisol

13

< 2.5 mcg/dL

176

Figure 1. A suspicious lung nodule investigated with 18F-FDG PET-CT showing discrete glucose uptake (SUV of 1.4).

Arch Endocrinol Metab. 2019;63/2

Dilemmas in ectopic ACTH syndrome

Table 2. Bilateral inferior petrosal sinus sampling (BIPSS) ACTH (pg/ml) | PRL (ng/mL) Peripheral vein (PV)

LPS/PV

293 | 22.8

365 | 24.5

0.46

0.8

393 | 19.5

157 | 21.6

2.61

2.48

317 | 19.0

457 | 18.4

117 | 19.5

1.78

3.87

465 | 18.9

420 | 16.6

352 | 18.9

1.32

1.19

458 | 17.5

513 | 15.1

441 | 16.5

1.03

1.16

Left petrosal sinus (LPS)

Right petrosal sinus (RPS)

Basal (0 min)

170 | 16.7

1 min

413 | 23.3

3 min 5 min 10 min

to confirm adequate catheterization, and the ACTH/ prolactin ratio was used to interpret the results. Although the results were somewhat abnormal (RPS/PV ratio of 3.87 at 3 min), the final interpretation considered the pituitary lesion incidental and dismissed it as the source of the ACTH excess.

Eight months after the initial symptoms, the patient experienced spontaneous and significant clinical remission that lasted for 3 months. During this period, serum, salivary and urinary cortisol reduced to nearnormal levels. Afterward, however, symptomatology resumed very dramatically, associated with increased blood pressure, severe and symptomatic hypokalemia and hyperglycemia. The patient was admitted to the endocrine ward to receive regular IV insulin and potassium chloride in high doses, associated with oral spironolactone. While in the hospital, the patient had a spontaneous L2-vertebral fracture, developed severe and disabling muscle weakness, episodic psychosis, and primary hypothyroidism. The relapsed clinical picture was so intense and refractory to conventional therapy that a bilateral adrenalectomy was considered as an emergency therapy.

However, insulin pump infusion, high-dose spironolactone (200-300 mg/day), zoledronic acid, and nandrolone decanoate resulted in a progressive improvement of the clinical picture within the next several weeks, in particular of muscle weakness.

Nevertheless, we decided to perform a “pharmacologic adrenalectomy” via steroid-enzyme inhibition with ketoconazole (KCZ). After an initial oral dose of 200mg/day for a few days, the treatment schedule scaled up to 1.2 g/day and plateaued at 1 g/day.

During this treatment period, morning salivary cortisol levels were measured at weekly intervals to ascertain the effectiveness of cortisol blockade by KCZ (Figure 2).

During the next 4 months, serum and salivary cortisol levels decreased substantially on an average Arch Endocrinol Metab. 2019;63/2

RPS/PV

daily dose of 600 mg/day of KCZ and clinical manifestations improved. On continuous KCZ therapy, clinical effectiveness was confirmed when the patient began demonstrating signs of adrenal insufficiency, requiring introduction of oral prednisolone (2.5-5.0 mg/day).

Following pharmacologic control of the disease, etiological investigation continued. A somatostatin receptor imaging employing 68Gallium PET-CT (68Ga-DOTA-TATE) was obtained and disclosed an anomalous tracer uptake in the same region previously seen on 18F-FDG-PET-CT: a regular, solid, noncalcified lung nodule, located between the superior and basal posterior segments of the left inferior lobe of the right lung, that measured 1.3 x 0.9 cm in diameter, with an SUV of 6.1 (Figure 3). This finding was consistent with a tumor of neuroendocrine origin (a carcinoid tumor), reinforcing the diagnosis of an ectopic ACTHproducing lung tumor.

The patient underwent a left inferior lobe lung resection 22 months after the beginning of her clinical symptoms. A prompt drop in plasma ACTH and serum cortisol concentrations followed within 1 hour after tumor resection, reaching undetectable cortisol levels 24h later (Table 3).

OUTCOME AND FOLLOW-UP Pathology examination revealed a well-differentiated neuroendocrine lung neoplasia: immunohistochemistry was positive for ACTH, chromogranin A, and synaptofisin; Ki-67 was positive in less than 5% of the cells.

Less than 3 months after surgery, the patient was free of symptoms and from glucocorticoid replacement therapy. Cortisol levels were within the normal range and responsive to suppression (1 mg DST < 1.0 mg/ dL). The patient remains completely asymptomatic and hormonally controlled 2 years after surgery.

177

Copyright© AE&M all rights reserved.

Time

Dilemmas in ectopic ACTH syndrome

5000

1400

4500 1200

Morning salivary cortisol (ng/d)

3500

1000

3000

800

2500

600

2000 1500

400

Dose of ketoconazole (mg/d)

4000

1000 200

500 0

2 months

4 months

0 2 months after surgery

6 months Treatment time

Ketoconazole

Morning salivary

CopyrightŠ AE&M all rights reserved.

Figure 2. Morning salivary cortisol levels x Ketoconazole (KCZ) dose (mg/day).

Figure 3. 68Ga-DOTA-TATE PET-CT showing anomalous tracer uptake: a regular, solid, non-calcified lung nodule, located between the superior and basal posterior segments of the left lung inferior lobe that measured 1.3 x 0.9 cm in diameter, with an SUV of 6.1, consistent with a tumor of neuroendocrine origin (carcinoid tumor).

178

Arch Endocrinol Metab. 2019;63/2

Table 3. Pre- and post-operative levels of ACTH and cortisol Hormonal test

ACTH

Cortisol

Basal (Pre-Op)

102

19.2

7.2

11.8

2h

1.5

8.8

4h

< 1.0

3.9

24h

< 1.0

0.57

2 months

–

6.6

3 months

–

3.6

4 months

26.9

3.4

Post-operative period 1h

Normal ranges: ACTH: 7.2 – 63 pg/mL; cortisol: 6.2 – 19.4 mcg/dL.

DISCUSSION The etiology of Cushing’s syndrome may occasionally be difficult to ascertain. In patients with EAS, identification of the source of autonomous production of ACTH may remain unknown (occult or indeterminate) in up to 19% of cases (2). The delay in establishing the origin of the disease and in controlling hypercortisolism may predictably result in severe consequences.

One potential problem in diagnosing CS is the occurrence of a cyclical pattern of cortisol excess.

Although cyclic CS is observed more often in primary pigmented nodular adrenal hyperplasia/dysplasia (PPNAD), as well as in isolated micronodular adrenocortical disease, it may occur in any form of endogenous CS (1). The wax-and-wane pattern of symptoms raised the suspicion of cyclic CS in our patient.

Although the pre-test diagnostic probability of CD is higher than 80%, our team contemplated the less common EAS as the main diagnostic possibility for this patient from the beginning. The reasons contended were the sudden and rapid evolution of marked muscle weakness, and important hypokalemia and hyperpigmentation associated with significantly elevated plasma ACTH levels (2).

A pituitary MRI is usually the first imaging procedure indicated for the investigation of CS because of the major prevalence of CD. However, its results could be negative in identifying a pituitary microadenoma in up to 40% of patients. Subsequent chest and abdominal MRIs were suggestive of the presence of a suspicious left pulmonary nodule. A subsequent 18F-FDG PETCT scan confirmed a moderate uptake by this very lung lesion (3).

Arch Endocrinol Metab. 2019;63/2

In view of the modest 18F-FDG PET-CT outcome, an Octreoscan® scintigraphy was performed, with a negative result. However, this procedure has a variable sensitivity for small lesions (between 25 and 80%, with a detection limit of 5 mm) (7). Moreover, hypercortisolism per se may suppress subtype-2 somatostatin receptor concentration and density, yielding false-negative results (1).

Once an ectopic source of ACTH excess was temporarily excluded, a new and more precise pituitary MRI, performed on recent generation 3-Tesla equipment, disclosed a previously unidentified 6 mm cystic lesion during the dynamic study. Although the pituitary lesion was unlikely to be responsible for the condition, a BIPSS for ACTH was performed, since it is considered the gold standard by which to establish the pituitary as the source of ACTH excess in CD, with 95% sensitivity and specificity (1).

Nevertheless, the results were not consistent: out of five sampling time-points, only a single one (at 3 min following desmopressin stimulation) disclosed a moderate ACTH and ACTH:prolactin ratio gradient; furthermore, overall ACTH levels were not significantly reduced. This result could reflect the presence of a cyclic disease and/or a mild hypercortisolism with no significant suppression of the remaining non-tumorous corticotrophs at that given moment. Yet another even rarer possibility was contemplated: co-production of CRH by the ectopic tumor stimulating normal ACTHproducing pituitary cells, leading to a false-positive BIPSS result (8).

After a prolonged and distressing period during which no definitive etiological diagnosis was achieved, we were able to employ a recently available scintigraphy procedure to localize tumors of neuroendocrine origin (with excellent accuracy to identify ectopic ACTHproducing tumors [7]): 68Ga-DOTA-TATE PET-CT (5). The result was an image with a significant tracer uptake (SUV of 6.1) located in the same lung area previously identified on the chest CT/MRIs and FDG PET-CT. Given the increased activity of the lesion and the higher accuracy of DOTA-TATE (82% sensitivity and near-100% specificity, even for lesions smaller than 10 mm [9]), this lesion was definitively considered the source of ACTH excess in our patient.

The histological findings were consistent with a neuroendocrine tumor, one of the more common etiologies of EAS (10). Our patient had classic features of a bronchial carcinoid neoplasia: young 179

Copyright© AE&M all rights reserved.

Dilemmas in ectopic ACTH syndrome

Copyright© AE&M all rights reserved.

Dilemmas in ectopic ACTH syndrome

age, nonsmoker, a well-differentiated low-grade tumor, and usual immunohistochemical markers for ACTH, chromogranin A and synaptofisin. The patient underwent surgical tumor resection, the conventional treatment for bronchial carcinoid. The 5-year survival rate for typical carcinoid ranges from 92 to 100% (11).

Pharmacologic treatment of ectopic ACTHproducing neoplasms is usually transitory, to achieve normocortisolemia and improve clinical status until the occult tumor is found and surgically removed. Enzyme inhibitors of the steroid cascade are very effective for this purpose, although treatment with cabergoline, octreotide, and other ACTH suppressors may be effective as well (12,13). Any of these drugs has a chance for side effects, and availability may be limited.

Pharmacologic intervention with ketoconazole (KCZ) was pivotal to control the recurring severe clinical manifestations by blocking excessive cortisol production. This decision was made at a point when etiologic definition was obscure, and it allowed additional time to reinvestigate the source of the ACTH excess with excellent efficacy and acceptable tolerability.

Despite KCZ being associated with hepatotoxicity and gastrointestinal complaints, no significant side effect was observed in our patient (14). Instead of using classic and time-consuming 24h urinary free cortisol concentrations, titration of KCZ was achieved by weekly evaluation of morning salivary cortisol levels, an easy, fast, and reproducible method routinely used in our clinic.

There is no consensus regarding the follow-up of neuroendocrine tumors. ACTH-producing tumors that may relapse or spread after surgery must be strictly followed clinically and biochemically with at least yearly ACTH/cortisol screening and imaging procedures.

Some suggest chest and abdomen CTs every six months for the first two years, and then annually. Others recommend somatostatin-receptor-based imaging, such as Ga-68 DOTATE PET/CT (15).

In summary, we present the challenging case of a young patient with cyclic CS due to an ACTH-producing neuroendocrine tumor of the lung whose clinical manifestations were highly suggestive of EAS, although conflicting test results misled the final diagnosis.

investigation and treatment. They also provided clinical care for the patient, prepared the case report and contributed to the literature review. Claudio E. Kater is clinical endocrinologist and chief of the Adrenal and Hypertension Unit of the Division of Endocrinology and Metabolism, Department of Medicine at Escola Paulista de Medicina/Universidade Federal de São Paulo (EPM/Unifesp). He supervised all aspects of the clinical investigation and manuscript construction.

Author contribution statement: Marcelo Vieira Corrêa is a clinical endocrinologist who provided clinical care for the patient, analyzed data and images, conducted the literature review and the manuscript construction. Débora Moroto, Giovanna Carpentieri and Igor Veras were endocrinology residents during the patient’s

11. Fisseler-Eckhoff A, Demes M. Neuroendocrine Tumors of the Lung. Cancers (Basel). 2012; (4):777-98.

180

Patient consent: written informed consent was obtained from the patient for publication of the submitted article and any accompanying images.

Funding: this research did not receive any specific grant from any funding agency in the public, commercial or not-for-profit sector.

Disclosure: no potential conflict of interest relevant to this article was reported.

REFERENCES 1. Lacroix A, Feelders RA, Stratakis CA, Nieman LK. Cushing’s syndrome. Lancet. 2015;386:913-27.

2. Ilias I, Torpy DJ, Pacak K, Mullen N, Wesley RA, Nieman LK. Cushing’s syndrome due to ectopic corticotropin secretion: twenty years’ experience at the National Institutes of Health. J Clin Endocrinol Metab. 2005;90:4955-62.

3. Farage M, Costa MADL, Godoy-Matos AF. A rare case of Cushing syndrome by cyclic ectopic-ACTH. Arq Bras Endocrinol Metab.

2012;56(5):324-30.

4. Del Valle-Torres MDM, Amrani-Raissouni T, Moya-Espinosa P, Jiménez-Hoyuela JMG. Cushing’s syndrome due to ectopic ACTH. Contribution of the somatostatin receptor scintigraphy.

Rev Esp Med Nucl Imagen Mol. 2012;31(1):42-3.

5. Huang Y-T, Aziz SI, Kumar ASR. Gallium-68 DOTA-TATE positron emission tomography/computed tomography: Scintigraphic changes of adrenal glands following management of ectopic Cushing’s syndrome by steroidogenesis inhibitors. World J Nuclear Med. 2014;13(3):201-4.

6. Rodrigues P, Castedo JL, Damasceno M, Carvalho D. Ectopic Cushing’s syndrome caused by a pulmonary ACTH-secreting tumor in a patient treated with octreotide. Arq Bras Endocrinol Metab. 2012;56(7):461-4.

7. Nunes JM, Pinho E, Camões I, Maciel J, Bastos PC, Moura CS, et al. A challenging case of an ectopic Cushing syndrome. Case Rep Med. 2014;2014:413136.

8. Doppman JL, Chang R, Oldfield EH, Chrousos G, Stratakis CA, Nieman LK. The hypoplastic inferior petrosal sinus: A potential source of false-negative results in petrosal sampling for Cushing’s disease. J Clin Endocrinol Metab. 1999;84:533-40.

9. Isidori AM, Sbardella E, Zatelli MC, Boschetti M, Vitale G, Colao A, et al. Conventional and nuclear medicine imaging in ectopic Cushing’s syndrome: A systematic review. J Clin Endocrinol Metab. 2015;100(9):3231-44.

10. Alexandraki KI, Grossman AB. The ectopic ACTH syndrome. Rev Endocr Metab Disord. 2010;11:117-26.

12. Pivonello R, Ferone D, Lamberts SW, Colao A. Cabergoline plus lanreotide for ectopic Cushing’s syndrome. N Engl J Med. 2005;352(23):2457-8.

Arch Endocrinol Metab. 2019;63/2

Dilemmas in ectopic ACTH syndrome

13. Bruno OD, Danilowicz K, Manavela M, Mana D, Rossi MA. Longterm management with octreotide or cabergoline in ectopic corticotropin hypersecretion: case report and literature review.

Endocr Pract. 2010;16(5):829-34.

15. Thomas CF, Jett JR, Strosberg JR. In: Bronchial Neuroendocrine (carcinoid) Tumors: Treatment and Prognosis. UpToDate, Post TW, editors. UpToDate: Waltham, MA. 2017. (Accessed on 15 April 2017)

CopyrightŠ AE&M all rights reserved.

14. Feelders RA, Hofland LJ, de Herder WW. Medical treatment of Cushingâ&#x20AC;&#x2122;s syndrome: adrenal-blocking drugs and ketaconazole.

Neuroendocrinology. 2010;92(suppl1):111-5.

Arch Endocrinol Metab. 2019;63/2

181

brief report

Serum PTH reference values in an adult Brazilian population: implications for the diagnosis of hyperparathyroidism Pedro Weslley Rosario1, Maria Regina Calsolari1

ABSTRACT Santa Casa de Belo Horizonte, Belo Horizonte, MG, Brasil 1

Correspondence to: Pedro Weslley Rosario Instituto de Ensino e Pesquisa da Santa Casa de Belo Horizonte Rua Domingos Vieira, 590, Santa Efigênia 30150-240 – Belo Horizonte, MG, Brasil pedrowsrosario@gmail.com Received on July/23/2018 Accepted on Jan/16/2019 DOI: 10.20945/2359-3997000000117

Objective: To define serum parathyroid hormone (PTH) reference values in carefully selected subjects following the recommended pre-analytical guidelines. Subjects and methods: First, 676 adults who would be submitted to thyroidectomy were evaluated. Patients using interfering medications or with malabsorption syndrome, hypomagnesemia, hyper- or hypophosphatemia, hypo- or hypercalcemia, 25-hydroxyvitamin D < 30 ng/dL, estimated glomerular filtration rate < 60 mL/min/1.73 m2, urinary calcium/creatinine ratio ≥ 0.25, thyroid dysfunction, parathyroid adenoma detected during surgery were excluded. The sample consisted of 312 subjects. Results: The median, minimum, maximum, and 2.5th and 97.5th percentiles of the PTH values obtained were 30, 7.2, 78, 10.1, and 52 pg/mL, respectively.

Thus, the reference range was 10 to 52 pg/mL. PTH > 65 pg/mL, the upper limit of normal according to the manufacturer of the kit, was observed in only one subject (0.3%). Considering the upper limit proposed by the kit’s manufacturer, 1/6 hypercalcemic patients and 4/8 normocalcemic patients with PHPT had normal PTH. Using the upper limit established in this study, only one normocalcemic patient had normal PTH. Thus, the sensitivity of PTH in detecting asymptomatic primary hyperparathyroidism (PHPT) using the values recommended by the kit and established in this study was 64% and 93%, respectively (50% versus 87.5% for normocalcemic PHPT). Conclusion: The upper reference limit of PTH obtained for a rigorously selected sample was 20% lower than that provided by the assay, which increased its sensitivity in detecting PHPT. Arch Endocrinol Metab. 2019;63(2):182-5 Keywords Normal PTH; primary hyperparathyroidism; normocalcemic; secondary hyperparathyroidism; diagnosis

INTRODUCTION

Copyright© AE&M all rights reserved.

T

he measurement of parathyroid hormone (PTH) is necessary for the diagnosis of hyperparathyroidism.

In the presence of hypercalcemia, reduced PTH is expected and normal concentrations are sufficient for the diagnosis of primary hyperparathyroidism (PHPT) (1). In this situation, overestimated limits of normal PTH are unlikely to compromise the diagnosis.

A more serious consequence exists in normocalcemic subjects in whom an overestimated upper limit of PTH may mask the diagnosis of normocalcemic PHPT or secondary hyperparathyroidism (SHPT).

The minimum requirements for the definition of PTH reference values is that (i) a reasonable number of apparently healthy subjects are evaluated, that these subjects are (ii) normocalcemic, (iii) have vitamin D sufficiency, (iv) do not have moderate or severe chronic kidney disease, and (v) do not use medications known 182

to interfere with the concentrations of this hormone.

A recent review shows that few studies have met all of these criteria so far (2). Even among these few studies, many defined vitamin D sufficiency as concentrations > 20 ng/dL (2). Although this definition is widely accepted, specifically to establish normal PTH values, the cut-off value of 30 ng/dL seems to be more adequate since PTH elevation can occur at vitamin D concentrations between 20 and 30 ng/dL (2). Furthermore, other factors that can elevate PTH in apparently healthy subjects, both recognized as a cause of SHPT and included in the differential diagnosis of normocalcemic PHPT such as hypercalciuria and conditions of malabsorption (1), were not excluded in the previous studies. In addition to the selection criteria of the subjects, guidelines on blood collection (time and need for fasting) and processing must be followed for the measurement of PTH (2).

Arch Endocrinol Metab. 2019;63/2

Serum PTH reference values

As we have seen, studies establishing serum PTH reference values in carefully selected subjects following the recommended pre-analytical guidelines remain desired goals. This was the objective of the present prospective study which used an assay commonly employed for the measurement of PTH.

Table 1. Characteristics of the subjects studied Number of patients studied

312

Sex

Female: 232 Male: 80

Age (years)

18 to 70 (median: 48) < 60 years: 242 >-60 years: 70

Study design The study was prospective and was approved by the local Research Ethics Committee (3).

Patients First, 676 adults (age ≥ 18 years) with nodular thyroid disease who would be submitted to bilateral thyroidectomy (3) were evaluated. The subjects were submitted to the measurement of calcium (total and ionized), magnesium, phosphorus, 25-hydroxyvitamin D, creatinine, TSH, PTH, and urinary calcium and creatinine. The following patients were excluded: patients using diuretics, lithium, bisphosphonates, denosumab, recombinant PTH, corticosteroids and calcium or vitamin D supplements, and patients with primary aldosteronism [investigated in the recommended situations (4)], known malabsorption syndrome, hypomagnesemia, hyper- or hypophosphatemia, hypo- or hypercalcemia, 25-hydroxyvitamin D < 30 ng/dL, estimated glomerular filtration rate (eGFR) < 60 mL/min/1.73 m2, urinary calcium/creatinine ratio ≥ 0.25, or thyroid dysfunction.

The remaining patients also underwent measurement of tissue anti-transglutaminase IgA antibodies and those with a positive result were excluded. Using these criteria, 356 participants were excluded.

Parathyroidectomy Trained surgeons performed the surgery of all patients included in the study. The four parathyroid glands were fully explored and grossly abnormal parathyroid glands, i.e., enlarged, were removed. Eight patients had parathyroid adenoma detected during surgery (5,6) and were also excluded. Thus, the final sample consisted of 312 subjects (Table 1).

Methods Total calcium [corrected for low albumin (< 4 mg/dL) using the formula: (4 - albumin) x 0.8 + Ca] (reference range: 8.4 to 10.4 mg/dL) and urinary calcium were Arch Endocrinol Metab. 2019;63/2

Menopause status

Premenopausal: 130 Postmenopausal: 102

BMI (kg/m ) 2

18 to 33 (median: 25)

BMI: body mass index.

measured by a colorimetric method. Ionized calcium (reference range: 1.12 to 1.32 mmol/l) was measured with a selective electrode and automatic correction for pH variation. Serum PTH was measured with a chemiluminescent assay (Immulite 2000, Diagnostic Products Corporation, Los Angeles, CA), with reference values of 12-65 pg/mL. A chemiluminescence assay was used to measure 25-hydroxyvitamin D. The eGFR was calculated using the Modification of Diet in Renal Disease Study equation. Tissue anti-transglutaminase IgA antibodies were measured by enzyme immunoassay.

All measurements were obtained in the morning after fasting for approximately 10 h, and the samples were processed and analyzed immediately after collection.

Statistical analysis As reported in previous studies (7-19), the PTH values did not follow a normal distribution. Thus, the normality range was defined as corresponding to 95% of the results and the 2.5th and 97.5th percentiles as corresponding to the lower and upper limit, respectively (7-19). PTH levels were compared between men and women (preand postmenopausal) and between subjects < 60 and > 60 years (2) using the Student t-test and Kruskal-Wallis test. The two-tailed Pearson correlation coefficient test was used to analyze the correlation of age and BMI with PTH values.

RESULTS The median, minimum, maximum, and 2.5th and 97.5th percentiles of the PTH values obtained were 30, 7.2, 78, 10.1, and 52 pg/mL, respectively. Thus, the reference range was 10 to 52 pg/mL. PTH > 65 pg/mL, the upper limit of normal according to the manufacturer of the kit, was observed in only one subject (0.3%).

183

Copyright© AE&M all rights reserved.

SUBJECTS AND METHODS

Serum PTH reference values

No significant difference in PTH values was observed between men and women (pre- and postmenopausal) (Table 2). There was also no statistically significant difference in the results between subjects < 60 versus > 60 years (Table 2), although concentrations were higher in the latter. Finally, no correlation was found between PTH values and age (p = 0.18) or BMI (p = 0.78).

To analyze the impact of a new reference range of PTH on the diagnosis of asymptomatic PHPT, we reviewed the serum PTH levels of patients diagnosed with this condition among the 676 patients initially evaluated in this study: 6 had hypercalcemic PHPT (3) and 8 had normocalcemic PHPT (5,6). Considering the limit proposed by the manufacturer of the kit, 1/6 hypercalcemic patients and 4/8 normocalcemic patients had normal PTH. Using the upper limit established in this study, only one normocalcemic patient had normal PTH. Thus, the sensitivity of elevated PTH in detecting asymptomatic PHPT using the values recommended by the kit and established in this study was 64% and 93%, respectively (50% versus 87.5% for normocalcemic PHPT).

Table 2. Comparison of the serum PTH values Serum PTH (pg/mL) [range (median)] Women ( n = 232)

7.2-76 (29.4)

Men (n = 80)

7.4-78 (30.6)

Age < 60 years (n = 242)

7.2-65 (27)

Age >-60 years (n = 70)

8.5-78 (33)

Premenopausal women (n = 130)

7.2-68 (28.2)

Postmenopausal women (n = 102)

8-78 (32.8)

BMI < 25* kg/m2 (n = 156)

8.5-78 (31.2)

BMI > 25* kg/m (n = 156)

7.8-72 (28.5)

2

p-value

0.9 0.2 0.3 0.7

BMI: body mass index. * Median.

CopyrightŠ AE&M all rights reserved.

DISCUSSION We will first highlight some characteristics of the study.

A reasonable number of subjects were evaluated.

Rigorous selection was performed, following not only the traditionally required criteria [normocalcemia (in this study, total and ionized calcium); vitamin D sufficiency (defined as concentrations > 30 ng/dL); absence of chronic kidney disease, and no use of interfering drugs 184

(2)], but also excluding other factors that can alter PTH in apparently healthy individuals (e.g., hypercalciuria, conditions of malabsorption, hyperphosphatemia, hypomagnesemia), which were not considered in previous studies (2,18,19). In addition to the selection criteria of the subjects, for the measurement of PTH, the guidelines on blood collection and processing were followed (2). The assay chosen is commonly used for the measurement of PTH in Brazil. Finally, it is possible that the inadvertent inclusion of subjects with asymptomatic and normocalcemic PHPT overestimates normal PTH concentrations. However, in the present study, all subjects were submitted to surgical exploration of the parathyroid glands, which were apparently normal.

We found an upper limit that was 20% lower than that provided by the manufacturer of the kit (52 pg/mL instead of 65 pg/mL). As previously seen, an overestimated upper limit may mask the diagnosis of SHPT and especially of normocalcemic PHPT. In fact, 3/8 cases of normocalcemic PHPT from our series (5,6) would have their diagnosis masked if the values proposed by the kit and not the upper limit obtained in this study were used.

A significant influence of sex, age or BMI on PTH concentrations was not observed in the present study.

Any observed differences in PTH concentrations might be due to differences in vitamin D concentrations, eGFR, comorbidities and medication use, which was not the case in the present study in which the subgroups were uniform in terms of the selection criteria (vitamin D > 30 ng/dL, eGFR > 60 mL/ min/1.73m2, no comorbidities or use of interfering medications). However, we recognize that any difference may not have been detected because of the size of the subgroups (18).

In conclusion, the upper limit of the serum PTH reference range obtained for a sample of rigorously selected subjects was 20% lower than that provided by the assay, which increased the sensitivity of PTH in detecting normocalcemic PHPT. Funding: this work was supported by the National Council for Scientific and Technological Development (CNPq).

Compliance with Ethical Standards: the study was approved by the Research Ethics Committee of our institution.

Disclosure: no potential conflict of interest relevant to this article was reported.

Arch Endocrinol Metab. 2019;63/2

Serum PTH reference values

REFERENCES 1. Eastell R, Brandi ML, Costa AG, D’Amour P, Shoback DM, Thakker RV. Diagnosis of asymptomatic primary hyperparathyroidism: proceedings of the Fourth International Workshop. J Clin Endocrinol Metab. 2014;99:3570-9.

2. Souberbielle JC, Brazier F, Piketty ML, Cormier C, Minisola S, Cavalier E. How the reference values for serum parathyroid hormone concentration are (or should be) established? J Endocrinol Invest.

2017;40:241-56.

3. Rosário PW, Mourão GF, Calsolari MR. Screening for Hyperparathyroidism by Measurement of Calcium in Patients Undergoing Thyroid Surgery: A Prospective Study. Horm Metab Res. 2016;48:673-6.

4. Funder JW, Carey RM, Mantero F, Murad MH, Reincke M, Shibata H, et al. The Management of Primary Aldosteronism: Case Detection, Diagnosis, and Treatment: An Endocrine Society Clinical Practice Guideline. J Clin Endocrinol Metab. 2016;101(5):1889-916.

5. Rosário PW. Primary Hyperparathyroidism with Normal Calcium and PTH. World J Surg. 2017;41:1649-50.

6. Rosario PW, Calsolari MR, Oliveira LFF, Oliveira PHL, Silva TH. Normocalcemic primary hyperparathyroidism in adults without a history of nephrolithiasis or fractures: a prospective Brazilian study. Arq Endocrinol Metab. 2018;62(Suppl 4):S144.

11. La’ulu S, Roberts W. Performance characteristics of six intact parathyroid hormone assays. Am J Clin Pathol. 2010;134:930-8.

12. Rejnmark L, Vestergaard P, Heickendorff L, Mosekilde L. Determinants of plasma PTH and their implication for defining a reference interval. Clin Endocrinol. 2011;74:37-43.

13. Fillée C, Keller T, Mourad M, Brikman T, Ketelslegers JM. Impact of vitamin D-related serum PTH reference values on the diagnosis of mild primary hyperparathyroidism, using bivariate calcium/ PTH reference regions. Clin Endocrinol. 2012;76:785-9.

14. Deckers M, de Jongh R, Lips P, Penninx B, Milaschi Y, Smit J, et al. Prevalence of vitamin D deficiency and consequences for PTH reference values. Clin Chim Acta. 2013;426:41-5.

15. Touvier M, Deschasaux M, Montourcy M, Sutton A, Charnuax N, Kess-Guyot E, et al. Interpretation of plasma PTH concentrations according to 25OHD status, gender, age, weight status, and calcium intake: importance of the reference values. J Clin Endocrinol Metab. 2014;99:1196-203.

16. Djennane M, Lebbah S, Roux C, Djoudi H, Cavalier E, Souberbielle JC. Vitamin D status of schoolchildren in Northern Algeria, seasonal variations and determinants of vitamin D deficiency.

Osteoporos Int. 2014;25:1493-502.

7. Souberbielle JC, Cormier C, Kindermans C, Gao P, Cantor T, Forette F, et al. Vitamin D status and redefining serum parathyroid hormone reference range. J Clin Endocrinol Metab. 2011;86:3086-90.

17. Li M, Lv F, Zhang Z, Deng W, Li Y, Deng Z, et al. Establishment of a normal reference value of parathyroid hormone in a large healthy Chinese population and evaluation of its relation to bone turnover and bone mineral density. Osteoporos Int. 2016;27: 1907-16.

8. Glendenning P, Vasikaran S. Comment on: Vitamin D status and redefining serum PTH reference range in the elderly. J Clin Endocrinol Metab. 2002;97:946-7.

18. Farrell CL, Nguyen L, Carter AC. Parathyroid hormone: Data mining for age-related reference intervals in adults. Clin Endocrinol (Oxf). 2018;88:311-7.

9. Souberbielle JC, Fayol V, Sault C, Lawson-Body E, Kahan A, Cormier A. Assay-specific decision limits for two new automated parathyroid hormone and 25-hydroxyvitamin D assays. Clin Chem. 2005;51:395-400.

19. Cavalier E, Salsé M, Dupuy AM, Bargnoux AS, Watar F, Souberbielle JC, et al. Establishment of reference values in a healthy population and interpretation of serum PTH concentrations in hemodialyzed patients according to the KDIGO Guidelines using the Lumipulse® G whole PTH (3rd generation) assay. Clin Biochem.

2018;54:119-22.

Copyright© AE&M all rights reserved.

10. Aloia J, Feuerman M, Yeh J. Reference range for serum parathyroid hormone. Endocr Pract. 2006;12:137-44.

Arch Endocrinol Metab. 2019;63/2

185

Instructions for authors GENERAL INFORMATION We emphasize the importance of following these instructions carefully. Failure to do so will delay the processing of your manuscript.

that add substantially to the knowledge of the etiology, pathogenesis, and delineation of the natural history or management of the condition described. Case Reports should be 2,000 words or less, with no more than four figures and tables, and no more than 30 references.

Manuscripts should be submitted solely to the AE&M and should not have been published, or be under consideration for publication in any substantial form, in another periodical-either professional or lay.

We emphasize that only case reports that offer important basic translational or clinical contributions, preferentially together with a review of the literature, will be considered for publication.

Manuscripts should be submitted in English. Proofreading by a scientific editing service is strongly recommended; the following companies are suggested: Voxmed Medical Communications, American Journal Experts and PaperCheck. Manuscriptss that successfully complete the peer-review process and are recommended for publication will only be accepted and published upon receipt of a certificate proving professional academic English proofreading. In extraordinary circumstances, the certificate can be waived by editorial decision.

Papers that do not meet these requirements will be returned to the author for the necessary revisions before formal review.

All submissions are initially evaluated in depth by the scientific editors. Papers that do not conform with the general criteria for publication will be returned to the authors without detailed review, typically within three to five days. Otherwise, manuscripts will be sent to reviewers (most commonly two).

MANUSCRIPT CATEGORIES Reports of original research may be submitted to AE&M as Original Articles or Brief Reports. Other special categories of manuscripts are described below. All manuscripts must adhere to the word count limitations, as specified below, for text only; word count does not include the abstract, references, or figures/tables and their legends. Word count must be shown on the title page, along with the number of figures and tables. The format is similar for all manuscript categories, and it is described in detail in the “Manuscript Preparation” section.

Original Articles The Original Article is a scientific report of the results of original research that has not been published or submitted for publication elsewhere (either in print or electronically). It represents a substantial body of laboratory or clinical work. In general, Original Articles should not exceed 3,600 words in the main text, include more than six figures and tables, or more than 35 references.

Review Articles The AE&M publishes Review Articles that show a balanced perspective on timely issues within the field of clinical endocrinology. All reviews are submitted upon invitation and are subject to peer review. Articles in this category are requested by the Editors to authors with proven expertise in the field. Authors considering the submission of uninvited reviews should contact the editors in advance to determine whether the topic that they propose is of current potential interest to the Journal.

Review articles should be no longer than 4,000 words in the main text, include no more than four figures and tables, and no more than 60 references. The author should mention the source and/or request authorization for use of previously published figures or tables.

Consensus Statements Consensus Statements related to the endocrine and metabolic health standards and healthcare practices may be submitted by professional societies, task forces, and other consortia. All such submissions will be subjected to peer review, must be modifiable in response to criticism, and will be published only if they meet the usual editorial standards of the Journal. Consensus Statements should typically be no longer than 3,600 words in the main text, include no more than six figures and tables, and no more than 60 references.

Copyright© AE&M all rights reserved.

Brief Report The Brief Report consists of new data of sufficient importance to warrant immediate publication. It is a succinct description of focused study with important, but very straightforward, negative or confirmatory results. Brevity and clarity are always likely to enhance the chance of a manuscript being accepted for publication. A maximum of 1,500 words in the main text plus up to 20 references and normally no more than two illustrations (tables or figures or one of each) are acceptable for Brief Reports.

Case Report A Case Report is a brief communication presenting collected or single case reports of clinical or scientific significance. These reports should be concise and focused on the issue to be discussed. They should address observations of patients or families

Letters to the Editor Letters to the Editor may be submitted in response to manuscript that has been published in the Journal. Letters should be short commentaries related to specific points of agreement or disagreement with the published manuscript. Letters are not intended for the presentation of original data unrelated to a published article. Letters should be no longer than 500 words, with no more than five complete references, and should not include any figures or tables.

MANUSCRIPT PREPARATION GENERAL FORMAT The Journal requires that all manuscripts be submitted in a single-column format that follows these guidelines: • The manuscript must be submitted in MS-Word format.

• All text should be double-spaced with 2 cm margins on both sides using 11-point type Times Roman or Arial font.

• All lines should be numbered throughout the entire manuscript and the entire document should be paginated.

• All tables and figures must be placed after the text and must be labeled. Submitted papers must be complete, including the title page, abstract, figures, and tables. Papers submitted without all of these components will be placed on hold until the manuscript is complete.

ALL SUBMISSIONS MUST INCLUDE: • A cover letter requesting the evaluation of the manuscript for publication in AE&M, and any information relevant to the manuscript. Elsewhere on the submission form, authors may suggest up to three specific reviewers and/or request the exclusion of up to three others.

The manuscript must be presented in the following order: 1. Title page.

2. Structured abstract (or summary for case reports).

3. Main text.

4. Tables and figures. They must be cited in the main text in numerical order.

5. Acknowledgments.

6. Funding statement, competing interests and any grants or fellowships supporting the writing of the paper.

7. List of references.

Title Page The title page must contain the following information: 1. Title of the article (a concise statement of the major contents of the article).

2. Full names, departments, institutions, city, and country of all co-authors.

3. Full name, postal address, e-mail, telephone and fax numbers of the corresponding author.

4. Abbreviated title of no more than 40 characters for page headings.

5. Up to five keywords or phrases suitable for use in an index (the use of MeSH terms is recommended).

6. Word count – excluding title page, abstract, references, figures/tables and their legends.

7. Article type

Structured Abstracts All Original Articles, Brief Reports, Reviews, Case Reports should be submitted with structured abstracts of no more than 250 words. The abstract must be self-contained and clear without reference to the text, and should be written for general journal readership. The abstract format should include four sections that reflect the section

headings in the main text. All information reported in the abstract must appear in the manuscript. Please use complete sentences for all sections of the abstract.

of reproducing color figures in print (the publisher will provide price quotes upon acceptance of the manuscript).

Introduction

Photographs

The article should begin with a brief introductory statement that places the study in historical perspective, and explains its objective and significance.

The AE&M strongly prefers to publish unmasked patient photos. We encourage all prospective authors to work with families prior to submission and address the issue of permission for review and possible publication of patient images. If your submission contains ANY identifiable patient images or other protected health information, you MUST provide documented permission from the patient (or the patient’s parent, guardian, or legal representative) before the specific material circulates among editors, reviewers and staff for the purpose of possible publication in AE&M. If it is necessary to identify an individual, use a numerical designation (e.g. Patient 1) rather than using any other identifying notations, such as initials.

Materials and Methods These should be described and referenced in sufficient detail for other investigators to be able to repeat the study. The source of hormones, unusual chemicals and reagents, and special pieces of apparatus should be stated. For modified methods, only the modifications need be described.

Units of Measure The Results section should briefly present the experimental data in text, tables, and/ or figures. For details on preparation of tables and figures, see below. The Discussion should focus on the interpretation and significance of the findings, with concise objective comments that describe their relation to other studies in that area. The Discussion should not reiterate the Results.

Authorship The AE&M ascribes to the authorship and contributorship guidelines defined by the International Committee of Medical Journal Editors (www.ICMJE.org). Unrestricted joint authorship is allowed. A maximum of two corresponding authors is allowed.

The uniform requirements for manuscripts submitted to medical journals state that authorship credit should be based only on substantial contribution to: 1. The conception and design, or analysis and interpretation of data.

2. The drafting of the article or its critical review for important intellectual content.

3. The final approval of the version to be published.

All these conditions must be met. The corresponding author is responsible for ensuring that all appropriate contributors are listed as authors, and that all authors have agreed with the content of the manuscript and its submission to the AE&M.

Conflict of interest A conflict of interest statement for all authors must be included in the main document, following the text, in the Acknowledgments section. If authors have no relevant conflict of interest to disclose, this should be indicated in the Acknowledgments section.

Acknowledgments The Acknowledgments section should include the names of those people who contributed to a study but did not meet the requirements for authorship. The corresponding author is responsible for informing each person listed in the acknowledgment section that they have been included and providing them with a description of their contribution so they know the activity for which they are considered responsible.

Each person listed in the acknowledgments must give permission – in writing, if possible – for the use of his or her name. It is the responsibility of the corresponding author to provide this information.

References References to the literature should be cited in numerical order (in parentheses) in the text and listed in the same numerical order at the end of the manuscript on a separate page or pages. The author is responsible for the accuracy of references. The number of references cited is limited for each category of submission, as indicated above.

Tables Tables should be submitted in the same format as the article (Word), and not in another format. Please note: we cannot accept tables as Excel files within the manuscript. Tables should be self-explanatory and the data they contain must not be duplicated in the text or figures. Tables must be constructed as simply as possible and be intelligible without reference to the text. Each table must have a concise heading. A description of experimental conditions may appear together with footnotes at the foot of the table. Tables must not simply duplicate the text or figures.

Figures and Legends All figures must display the figure number. Sizing the figure: the author is responsible for providing digital art that has been properly sized, cropped, and has adequate space between images. All color figures will be reproduced in full color in the online edition of the journal at no cost to the authors. Authors are requested to pay the cost

Results should be expressed in metric units. Temperature should be expressed in degrees Celsius and time of day using the 24-hour clock (e.g., 0800 h, 1500 h).

Standard Abbreviations All abbreviations must be immediately defined after it is first used in the text.

Experimental Subjects To be considered for publication, all clinical investigations described in submitted manuscripts must have been conducted in accordance with the guidelines of The Declaration of Helsinki, and must have been formally approved by the appropriate institutional review committees or their equivalent.

The study populations should be described in detail.

Subjects must be identified only by number or letter, not by initials or names. Photographs of patients’ faces should be included only if scientifically relevant. The authors must obtain written consent from the patient for the use of such photographs. For further details, see the Ethical Guidelines.

Investigators must disclose potential conflict of interest to study participants and should indicate in the manuscript that they have done so.

Experimental Animals A statement confirming that all animal experimentation described in the manuscript was conducted in accordance with accepted standards of humane animal care, as outlined in the Ethical Guidelines, should be included in the manuscript.

Molecular Genetic Description • Use standard terminology for variants, providing rs numbers for all variants reported. These can be easily derived for novel variants uncovered by the study.

Where rs numbers are provided, the details of the assay (primer sequences, PCR conditions, etc.) should be described very concisely.

• Pedigrees should be drawn according to published standards (See Bennett et al.

J Genet Counsel (2008) 17:424-433 - DOI 10.1007/s10897-008-9169-9).

Nomenclatures • For genes, use genetic notation and symbols approved by the HUGO Gene Nomenclature Committee (HGNC) – (http://www.genenames.org/).

• For mutation nomenclature, please use the nomenclature guidelines suggested by the Human Genome Variation Society (http://www.hgvs.org/mutnomen/) • Provide information and a discussion of departures from Hardy-Weinberg equilibrium (HWE). The calculation of HWE may help uncover genotyping errors and impact on downstream analytical methods that assume HWE. • Provide raw genotype frequencies in addition to allele frequencies. It is also desirable to provide haplotype frequencies.

• Whenever possible, drugs should be given their approved generic name. Where a proprietary (brand) name is used, it should begin with a capital letter.

• Acronyms should be used sparingly and fully explained when first used.

Papers must be written in clear, concise English.

Avoid jargon and neologisms. The journal is not prepared to undertake major correction of language, which is the responsibility of the author. Where English is not the first language of the authors, the paper must be checked by a native English speaker.

For non-native English speakers and international authors who would like assistance with their writing before submission, we suggest Voxmed Medical Communications, American Journal Experts or PaperCheck.

ISSN 2359-3997 © A&EM – Rua Botucatu, 572 – conjunto 83 – 04023-062 – São Paulo, SP, Brazil

Copyright© AE&M all rights reserved.

Results and Discussion