2013 mb by sergi maicas

Mol Biotechnol (2013) 55:150–158 DOI 10.1007/s12033-013-9667-3

RESEARCH

Construction of an Expression Vector for Production and Purification of Human Somatostatin in Escherichia coli Sergi Maicas • Ismaı¨l Moukadiri • Almudena Nieto • Eulogio Valentı´n

Published online: 3 May 2013 Ó Springer Science+Business Media New York 2013

Abstract Somatostatin/growth hormone-inhibiting hormone is the peptide that inhibits secretion of somatotropin/ growth hormone. Solid-phase synthesis methods are being currently used to produce somatostatin. Recombinant peptide synthesis is widely described for the production of small proteins and peptides; however, the production at industrial scale of peptides for biopharmaceutical applications is limited for economic reasons. Here, we propose the use of a new pGB-SMT plasmid to produce Somatostatin, as a C-terminal fusion protein with a Kluyveromyces lactis b-galactosidase fragment. To facilitate removal of that fragment by CNBr cleavage, a methionine residue was introduced at the N-terminal of the hormone peptide. The use of this construction enables an IPTG-free expression system. The suitability of this procedure has been assessed in a 15 l scale-up experiment yielding almost 300 mg, with purity [99 % and it is being implemented for commercial scale. The plasmid pGB-SMT here described is an alternative option for a cheap and high expression of other short peptide hormones. Keywords Escherichia coli Expression FPLC HPLC Human somatostatin Ion exchange purification

S. Maicas (&) A. Nieto E. Valentıń Departament de Microbiologia i Ecologia, Universitat de Vale`ncia, Dr. Moliner, 50, 46100 Burjassot, Spain e-mail: sergi.maicas@uv.es I. Moukadiri Laboratorio de Gene´tica Molecular, Centro de Investigacioń ‘‘Prıńcipe Felipe’’, Camino de las Moreras s/n, 46013 Valencia, Spain

123

Introduction Somatostatin/growth hormone-inhibiting hormone (GHIH) was first discovered in hypothalamic extracts and identified as a hormone that inhibited the secretion of somatotropin/ growth hormone (GH) [1]. Although first described in the hypothalamus, Somatostatin-producing cells occur in many organs, including the central and peripheral nervous system, pancreas, gut, thyroid, adrenals, spleen, liver, kidneys and prostate. Furthermore, somatostatin is produced by inflammatory and immune cells [1]. It is synthesized as a precursor molecule, preprosomatostatin, which after processing generates two bioactive forms, somatostatin-14 and somatostatin-28. The two cysteine residues in the 14 amino acid peptide (NH2–A-G-C-K-N-F-F-W-K-T-F-T-S-C–COOH) allow the formation of an internal disulphide bond [2]. Somatostatin is produced in different quantities by different cells and, at least in the rat, the gut accounts for 65 % of total body somatostatin-like immunoreactivity, the brain for 25 %, the pancreas for 5 % and the remaining organs for 5 % [3]. Nutrients (glucose, amino acids and lipids), neurotransmitters, neuropeptides (glucagon, GH releasing and bombesin), hormones (insulin and glucocorticoids) and cytokines (interleukin-1, interleukin-6, transforming growth factor-b, tumour necrosis factor-a, insulinlike growth factor, leptin or interferon-c), and several intracellular mediators including cyclic AMP, cyclic GMP, Ca2? and nitric oxide, all influence the expression and/or secretion of somatostatin [4, 5]. Somatostatin acts as a neurotransmitter and as an autocrine, paracrine or endocrine regulator. It controls many physiological functions including modulation of neurotransmission, cell secretion and proliferation, smooth muscle cell contractility, intestinal motility, absorption of nutrients and immune cell functions [5].

Mol Biotechnol (2013) 55:150–158

151

Small peptides production methods including somatostatin by solid-phase synthesis are being currently used [6, 7]. Some Biotech companies are producing peptides with pharmacological properties with a market value close to USD 40 billion per year. Recombinant proteins have a share of about 50 %. Peptide production has always been considered as marginal because of the small volumes of product involved [8]. Biotechnological production of human somatostatin has been a feasible alternative since 1977 when engineered bacteria harbouring a somatostatin synthetic gene was used to produce this hormone [9]. This step is widely considered to represent the opening moments of modern biotechnology for peptide production. Some other research groups have reported approaches for somatostatin production in prokaryotic cells [2, 10] although efficiencies have not been further proved in market. Our goal has been the feasible commercial production of somatostatin using a highly efficient b-galactosidase– somatostatin fusion plasmid for high recovery.

Bacterial Strains Escherichia coli DH5a [F-, endA1, glnV44, thi-1, recA1, relA1, gyrA96, deoR, nupG, U80, dlacZDM15, D(lacZYA? argF)U169, hsdR17(rK mK ), k ] was used as a host strain for cloning and plasmid propagation. Strains E. coli BL21 (DE3) (F-, ompT, gal, dcm, lon, hsdSB(rB mB ), k[DE3 (lacI lacUV5-T7 gene1, ind,1 sam7, nin5)], BL21 (DE3) pLys [F,- ompT, ga,l dcm, lon, hsdSB(rB mB ), k(DE3) R pLysS(cm )] from Novagen and BL21 (SI) [F-, ompT, hsdSB(rB-, mB-), ga,l dcm, endA1, lon, -proUp::T7 RNAP::malQ-lacZ (TetS)] from Invitrogen were used in expression studies. E. coli strains were grown routinely in LB medium (w/v) (0.5 % yeast extract, 1.0 % tryptone, 0.5 % NaCl) supplemented with 100 lg ampicillin/ml (LBA) as required. Strains BL21 (DE3), BL21 (DE3) pLys and BL21 (SI) were transformed as described by Hanahan et al. [11]. BL21 (DE3) ? pGB-SMT has been deposited in the Spanish Type Culture Collection with a code CECT5840. SDS-Polyacrylamide Gel Electrophoresis (PAGE) Analysis

Materials and Methods Chemicals and Reagents IPTG (Invitrogen, USA), CNBr, trifluoroacetic acid and acetonitrile (Sigma, USA), T4 DNA ligase and Vent DNA polymerase (New England Biolabs, USA), restriction enzymes, synthesized oligonucleotides and plasmid isolation kits (Roche, Germany) were used in this study.

Proteins were separated in 15 % polyacrylamide-N, N0 methylenebisacrylamide gel [12] on a Bio-Rad MiniPROTEIN II electrophoresis unit. The gel was stained with Coomassie Brilliant Blue R-250 (National Diagnostics, UK). Peptides were separated by Tris-tricine-SDS-PAGE as described by Scha¨gger and von Jagow [13].

Table 1 Oligonucleotides used as primers in PCR reactions for synthesis of plasmids Sequence (50 –[30 )

Name SOM-Da a

CGATTATGGCGGGCTGCAAAAACTTTTTTTGGAAAACCTTTACCAGCTGCTAAG

SOM-C

CATGCTTAGCAGCTGGTAAAGGTTTTCCAAAAAAAGTTTTTGCAGCCCGCCATAAT

SOM-5Fb SOM-3Rb

CGAAATCGATTATGGCGGGCTGC GTCCGCATGCTTAGCAGCTGGTA

BGL-5b

CAGGCTAGCCATATGTCTTGCCTTATTCC

BGL3-1b

ATTACTAGTGAGCTCCCAGTCTAAATTCT

ATTACTAGTGAGCTCCTGTACGTTCGTGT

BGL3-2

BGL3-3b

ATTACTAGTGAGCTCTGTGTGCTCGAAGC

BGL3-4b

ATTACTAGTGAGCTCTGGATATCAAATTC

BGL3-5b

ATTACTAGTGAGCTCGATCATGTCTGTTG

BGL3-6b

ATTACTAGTGAGCTCCACTCCGTCATGAA

BGL3-7

BGL3-8b

ATTACTAGTGAGCTCTCCTTATGCTACG ATTACTAGTGAGCTCTTATTCAAAAGCGATC

ATG and TAA sequences have been introduced in SOM-D to facilitate the CNBr digestion in the 50 terminus of the somatostatin and termination in E. coli in 30 terminus, respectively. Complementary sequences, TTA and CAT, have been introduced in SOM-C for the same purpose b

ATCGAT, GCATGC, GCTAGC and GAGCTC are the sequences recognized by restriction endonucleases ClaI, SphI, NheI and SacI, respectively

123

152

Mol Biotechnol (2013) 55:150–158

Fig. 1 Scheme of intermediate (pGB-IM) and final (pGB-SMT) plasmid series constructed in this work. The different final plasmids (from pGB-SMT1 to 8) were similar with the exception of the length of the Lac4 (b-galactosidase) fragment (1 55 aa, 2 86 aa, 3 124 aa, 4 157 aa, 5, 351 aa, 6 613 aa, 7 1,017 aa and 8 1,025 aa). AmpR is coloured in grey, Lac4 in between squares, and Somatostatin in black

Fig. 2 Quantities of fusion protein obtained with constructions harbouring different Lac4 (b-galactosidase) fragments, using pGBSMT1–pGB-SMT8 constructions. pGB-SMT4 (157C) was considered as control (100 % fusion protein level expression)

Sequencing DNA sequencing service was provided by the SCSIE (Universitat de Vale`ncia) for both strands using dideoxy chain-termination method. Cloning of Somatostatin Gene Standard DNA manipulation procedures were carried out as described by Sambrook and Rusell [14]. Basically, the strategy followed to obtain the somatostatin gene, to be expressed in E. coli, was a PCR approach using a pair of primers according to E. coli-favoured codon usage [15]. An amplicon of 57 bp was obtained using the sense primer SOM-D and the antisense primer SOM-C (Table 1), both containing a Met codon and a stop codon (both underlined) and 5 1 overlapping nucleotides. Using this pair of primers, a PCR was performed utilizing Pfu high fidelity DNA polymerase (Promega, Madison, USA) according to the following conditions: denaturation at 94 °C for 1 min, annealing at 52 °C for 30 s and primer extension at 72 °C

123

Fig. 3 Level of expression of the fusion protein with or without IPTG addition: BL21(DE3)-pGB-SMT4 (empty circle), BL21(DE3)pGB-SMT4 ? 0.6 mM IPTG (filled circle), BL21(DE3)-pLysS-pGBSMT4 (empty square), BL21(DE3)-pLysS-pGB-SMT4 ? 0.6 mM IPTG (filled square), BL21(SI)-pGB-SMT4 (empty triangle), BL21(SI)-pGB-SMT4 ? 0.6 mM IPTG (filled triangle)

for 30 s for 30 cycles. A final elongation step of 10 min at 72 °C was carried out. The PCR product was purified and cloned into the SmaI site of pUC18; the plasmid was named pUC18-SMT. The correct clone was confirmed by sequencing. A second-round PCR was conducted, as previously described, using a pair of primers: forward primer (SOM-5F) and reverse primer (SOM-3R) containing engineered restriction sites ClaI and SphI, respectively (underlined). The amplicon, named SOM53, was purified for the construction of the b-galactosidase fusion expression vector. The clone was confirmed by sequencing. Construction of a Recombinant Plasmid for Constitutive Expression The fusion of the somatostatin synthetic gene to LAC4 gene of Kluyveromyces lactis, encoding b-galactosidase, was

Mol Biotechnol (2013) 55:150–158

153

restriction sites ClaI and SphI, respectively (underlined), and the PCR conditions described above, an amplicon named SOM53 was obtained. This amplicon was ligated into the ClaI and SphI sites of plasmids pGB-IM1–pGBIM8 to yield the plasmids pGB-SMT1–pGB-SMT8, respectively. The correct clones were confirmed by sequencing. Recombinant b-Galactosidase Fragment: Somatostatin Expression

Fig. 4 a Cation exchange chromatography: Somatostatin was eluted from an SP-HP column (GE Healthcare, Upsala, Sweden) with a 150 mM NaCl step-wise gradient. Fractions were collected by Frac900 with 10 ml/tube. b A Coomassie brilliant blue R-250 stained 15 % Tricine-SDS-PAGE image. Lanes 1 solubilised material, 2 not retained fraction, 3 molecular weight marker, 4–9 Fractions between 25 and 75 min of elution. Induced band indicated by an arrow migrating below the 3.6-kDa marker (Kaleidoscope polypeptide standard) is shown

constructed in two steps, as follows. First, LAC4 gene and truncated fragments of different lengths were obtained by PCR amplification using the plasmid pMR11 [16] as DNA template. The sense primer BGL-5 and alternative antisense primers (BGL3-1 to BGL3-8), containing engineered restriction sites NheI and SacI, respectively (underlined), were used for this purpose (Table 1). The PCR conditions were those described; with an additional 94 °C for 5 min initial step, before the 30 cycles. The amplicons obtained were purified, digested with NheI and SacI, and cloned into the NheI and SacI sites of the commercial vector pET17xb (Novagen, USA) to create the plasmids pGB-IM1–pGB-IM8. In a second step, using the plasmid pUC18-SMT as DNA template and the sense primer SOM-5F and the antisense primer SOM-3R containing engineered

For production of the LAC4-SOMA fusion protein, E. coli BL21 (DE3), E. coli BL21 (DE3) pLysS and E. coli BL21 (SI) containing plasmid pGB-SMT4 were used. Single colonies from LBA plates were inoculated into 5 ml of fresh liquid SL medium (composition in g/l: 26.8, peptone; 21.4, yeast extract; 8.5, NaCl; 0.86, MgSO4 7H2O; 5.4, K2HPO4; 1.6, NaH2PO2 2H2O; 2.0, lactose; pH 7) containing 100 mg ampicillin/l and grown overnight at 37 °C. The overnight culture was used to inoculate fresh media and incubated at 37 °C and protein expression was induced at OD600nm = 0.7 by addition of IPTG to a final concentration of 0.6 mM as a positive control of induction; in parallel, cultures without IPTG were used. Samples of 1 ml of cells were harvested every 2 h after induction, centrifuged at 10,0009g for 5 min and pellets were re-suspended in 100 ll of 62.5 mM Tris–HCl (pH 6.8), 10 % (v/v) glycerol, 2 % (w/v) SDS, 0.05 % (w/v) bromophenol blue, boiled at 95 °C, 5 min. After a new centrifugation step, the solubilised cell extracts in supernatant were analysed by SDS-PAGE and stained with Coomassie brilliant blue R-250. SDS-PAGE bands were quantified by scanning with a GelStation apparatus (TDI, Spain). Protein Purification Bacterial cells were harvested from an overnight 1 or 15 l culture and re-suspended in 200 ml of Tris–HCl 150 mM (pH 8.5) ? Triton-X100 2 % (w/v) and incubated overnight at 37 °C with gentle shaking. After centrifugation at 10,0009g for 10 min at 4 °C, the pellet was re-suspended in 50 ml of 50 mM NaOH for 10 min. After centrifugation at 10,0009g for 30 min at room temperature, the supernatant (fusion protein) was saved and stored at -80 °C for further use. The fusion protein was cleaved by incubating 45 ml of supernatant with 5 ml of a cyanogen bromide (CNBr) solution [200 mg CNBr/ml, 70 % (v/v) formic acid] for 18 h at room temperature [17]. The reaction was stopped by adding nine volumes of water and lyophilized for further analysis. Chromatographic purification was performed using the ¨ KTA-FPLC system (GE Healthcare, Sweden). The A

123

154

Mol Biotechnol (2013) 55:150â&#x20AC;&#x201C;158

Fig. 5 a Fraction 9 (Fig. 4) was injected in a Tricorn chromatography column (GE Healthcare, Sweden) containing Oasis HLB 30 lm resin (Waters 1436567) equilibrated in 0.1 % (v/v) TFA. The purified somatostatin was eluted in 35 % acetonitrile. b Not retained material (lane 1) and fractions 1â&#x20AC;&#x201C;4 (lanes 3, 4, 5 and 6), respectively, were subjected to 15 % Tricine-SDS-PAGE (see conditions in Fig. 4). Induced band indicated by an arrow migrating below the 3.6-kDa marker (Kaleidoscope polypeptide standard) is shown. The fractions which contained purified somatostatin were collected for further determinations

somatostatin peptide was purified first by cation exchange chromatography using an SP-HP column with a step-wise NaCl gradient. The lyophilized peptide mixture was resuspended in mobile phase A (20 mM citric acid buffer, 6 M urea, pH 3.5) and eluted with mobile phase B (150 mM NaCl ? mobile phase A). The collected (2 ml) fractions were analysed by Tricine-SDS-PAGE. A second purification step was performed to desalt and improve the peptide quality. Positive fractions were purified by reversed phase chromatography using an Oasis HLB 30 lm resin (Waters 1436567) equilibrated in 0.1 % (v/v) TFA. The purified peptide was eluted in 35 % (v/v) acetonitrile. The fractions containing purified somatostatin were collected for further determinations.

Sigma (S1763) was included as a standard. For accurate quantifications European Directorate for the Quality of Medicines and Healthcare vials (S0945000) were used.

Reverse-Phase HPLC Analysis

Molecular Construction

The purity of desalted recombinant peptide was determined by reverse-phase HPLC (RP-HPLC) on the Waters Millenium (USA) using a 0.45 mm I.D. 9 30 mm Spherisorb analytical column filled with 5.0-lm particles. The column was equilibrated with 35 % (v/v) acetonitrile containing 0.1 % (v/v) trifluoroacetic acid (TFA) and run with a step from 35 to 50 % (v/v) acetonitrile for 70 min at a flow rate of 1 ml/min. The chromatography was monitored using a UV detector at 280 nm. Somatostatin purchased from

The commercial vector pET17xb was used as a basis for the construction of a functional modified plasmid able to overcome the use of an IPTG-inducible system to produce synthetic hormones of commercial use [19]. In a first step, the complete and different truncated fragments from the bgalactosidase gene from Kluyveromyces lactis [16] were amplified by PCR using forward primer BGL-5 and alternative reverse primers (BGL3-1-BGL3-8) (Table 1) and cloned in pET17xb to generate intermediate plasmids pGB-

123

MALDI-TOF MS Analysis The molecular mass of the eluted peptide and reference standard somatostatin were determined by MALDI-TOF MS using an Applied Biosystems Voyager-DE Pro mass spectrometer operated in linear mode as previously described [18].

Results

Mol Biotechnol (2013) 55:150–158

155

Fig. 6 RP-HPLC analysis of the fractions eluted from Oasis HLB 30 lm resin column

IM1–pGB-IM8. In parallel, somatostatin coding sequence was designed with the optimized E. coli-preferred codon usage encoding for human 14-aminoacid hormone to enable a correct peptide expression. After a PCR amplification step (Table 1), an optimized sequence was generated as follows: ATG GCG GGC TGC AAA AAC TTT TTT TGG AAA ACC TTT ACC AGC TGC TAA and cloned into the plasmid pUC18 to generate pUC18-SMT. This fragment was finally amplified with oligonucleotides SOM5F and SOM 3-R to generate an amplicon containing the somatostatin gene flanked by restriction sites ClaI and SphI. Finally, the plasmids obtained in the first step, pGB-

IM1–pGB-IM8, were digested with ClaI/SphI restriction enzymes and the somatostatin, digested with the same restriction enzymes, was subcloned to generate plasmids pGB-SMT1–pGB-SMT8 (Fig. 1). Somatostatin Production and Purification In order to find the best conditions to produce recombinant somatostatin, some improvement steps were carried out. First, E. coli BL21 (DE3) strain was transformed with plasmids pGB-SMT1–8 to determine the best construction to be used for fusion protein expression. SDS-PAGE bands

123

156

were quantified and results were relativized to 100 %, in comparison with the construction showing the best level of expression (pGB-SMT4, 157 aa–Lac4 fragment) (Fig. 2). The length of the b-galactosidase fragment used influenced the expression of the fusion protein. The plasmid including only the N-terminal fragment of b-galactosidase (pGBSMT1) and the complete b-galactosidase (pGB-SMT8) showed low level of expression, while the intermediate length constructions (pGB-SMT 2, 3, 4, 5, 6 and 7) showed high level of expression (80–100 %). Second, other strains of E. coli than BL21 (DE3) were used, BL21 (DE3) pLysS (Novagen, USA) and BL21 (SI) (Invitrogen, USA). Both strains were transformed with pGB-SMT4 harbouring Lac4-SOMA recombinant protein. The two new E. coli transformed strains did not improve the yield of fusion protein using BL21 (DE3); even it was lesser (Fig. 3). A similar result was obtained when media with glucose and IPTG were used instead of media with lactose without IPTG as carbon source. On the basis of the previous results, the best conditions we found to produce recombinant somatostatin were E. coli BL21 (DE3) as host strain and media with lactose as carbon source, without the addition of IPTG. Using these conditions a yield of 0.3 g (±0.05) fusion protein/l was produced after 8 h of incubation. Considering that our final purpose is an industrial production of somatostatin, we also checked whether we could improve the yield of fusion protein by incubating cells more than 8 h in lactose medium. The assay was performed until 16 h without any significant rising or reduction in the expression levels (±3.9 %). For industrial production, selected clones were incubated in 1 or 15 l of SL ? ampicillin production medium. Cells were lysed and the inclusion body fraction was saved and stored at -80 °C for further use. The fusion protein was cleaved by CNBr reaction [17]; the mixture was lyophilized and chromatographed by cation exchange chromatography to obtain somatostatin peptide. Carrier peptide (b-galactosidase fragment) and other contaminant peptides were not retained and eluted in fractions 1–5 together with small amounts of somatostatin while the somatostatin peptide eluted in fraction 9 (Fig. 4). Somatostatin containing fractions eluted from the cation exchange chromatography were desalted by reversed phase chromatography. The purified peptide was eluted in 35 % (v/v) acetonitrile, lyophilized and stored at -80 °C (Fig. 5). Somatostatin Quantification and Characterization Somatostatin peptide was quantified by HPLC technique, as previously described in the ‘‘Materials and Methods’’ section. Somatostatin eluted at a retention time of 37 min, perfectly matching to the somatostatin Sigma commercial

123

Mol Biotechnol (2013) 55:150–158 Table 2 Purification of somatostatin from Escherichia coli BL21 (DE3) harbouring pGB-SMT4 plasmid and expressing the recombinant protein 1 la

15 la

Cell pellet (g)

8.10 ± 0.40

148.50 ± 6.30

Fusion protein (g)

0.30 ± 0.03

4.60 ± 0.50

Fusion protein purityb (%) Purified peptide (mg)

[90 19.0 ± 0.50

[90 299.00 ± 2.60

Peptide purityc (%)

[99

The results were derived from 1 to 15 l cultures a

Data represent means ± standard deviations from at least triplicate assays b

Purity of fusion protein was determined by densitometry of gel shown in Fig. 2 (Lane 1)

Purity of peptide determined by HPLC chromatogram (Fig. 4)

standard. The eluted peak was collected in a total volume of 6 ml using a Fraction Collector III. Purity in samples was higher than 99 % (Fig. 6). The results in a series of 1 l assays were also obtained in scale-up experiments using a 15 l initial volume without loss of yield and purity (Table 2). Afterwards, the molecular mass of the purified eluted peptide from the 15 l assays was confirmed by MALDI-TOF MS (Fig. 7). A control peptide (S-1763) (Sigma, USA) was also analysed. The reported mass from the standard and the purified peptide showed an excellent correlation (99.98 %).

Discussion and Future Trends Process research development of bacterial host vectors for recombinant therapeutic products is expensive, time consuming and subject to strictly regulated processes. Biotechnological production of peptides for industrial use presents some economical inconvenience as procedures have to be defined at an early stage [19]. Furthermore, expression systems using inducible promoters require the use of expensive molecules such as isopropyl-b-D-thiogalactopyranoside IPTG [20–23]. This fact notably conditions the final industrial development as IPTG is expensive and must be depleted to 0.01 % (w/v) for biopharmaceutical production [24]. In this study, we have constructed a series of recombinant plasmids (pGB-SMT) for the expression of somatostatin without the need for IPTG. pGB-SMT plasmids encode for alternative different length b-galactosidase fragments from K. lactis [16] and somatostatin gene, with a CNBr cleavage site inserted between the two parts of the construction. The plasmid pGB-SMT4 harbouring Lac4-SOMA gave the best results, suggesting that the encoded ß-galactosidase fragment (157 aa) enables the production of a stable fusion protein. Constructions including less or more than 157 aa

Mol Biotechnol (2013) 55:150–158

157

Fig. 7 MALDI-TOF analysis of recombinant somatostatin expressed in E. coli cells

resulted in lower expression levels. Moreover, our results support the findings of Hansen et al. [25] that alternative substrates other than IPTG could be used to induce vector activity. As the medium contains lactose, which the bgalactosidase of E. coli converts to allolactose, analogue of IPTG, the described E. coli expression system acts as an autoinducing medium [26]. As such the cost is reduced, possible toxic effect of IPTG is avoided, but the same level of expression is maintained [27]. Under a commercial point of view, the lack of IPTG requirement to use this construction for somatostatin peptide production at a high yield permits its use in a biopharmaceutical company. The equilibrium between recombinant and cellular protein biosynthesis leads to stable and prolonged recombinant somatostatin production. On the other hand, the efforts to eliminate IPTG after protein production are avoided. The production and purification processes of recombinant proteins in E. coli have been reviewed by Choi and Lee [28] and Yoon et al. [29]. Some of these protocols involve several purification steps. Our process delivers a high amount of purified protein which is more than 99 % pure as revealed by the mass spectrometry and Tricine-SDS-PAGE. The yield of the protein is also good; with up to 20 mg somatostatin per litre of E. coli culture produced which should enable its commercial production. Previous reports of recombinant production of somatostatin

in E. coli did not apparently continue to commercial scale [2, 10]. This E. coli-based gene expression system is costeffective and requires only a two-stage chromatographic purification. Two-step procedures have also been previously reported using His-tagged proteins [30, 31]. Our procedure does not depend on His-tags, and, therefore, does not require a subsequent removal step. We are currently studying the applicability of this expression system to other peptide hormones. Acknowledgments Authors are grateful to Dr. J. Polaina for kindly providing plasmid pMR11 and Dr J. J. Calvete for mass spectrometry analysis. We thank P. Vicente, Dr. F. Bosch and Emeritus Professor R. Sentandreu for stimulating support to this project. This project was supported by Geńesis Especialidades Farmaceúticas y Biotecnologıá S.A. Fund, Spanish Government Fund (CDTI-05-0469) and Generalitat Valenciana Fund (IMPIVA-INCOMA-05-19). S. M. and A. N. were supported by Torres Quevedo Grants from the Ministerio de Ciencia e Innovacioń-Spanish Government.

References 1. Patel, Y. C. (1999). Somatostatin and its receptor family. Frontiers in Neuroendocrinology, 20, 157–198. 2. Zeng, Y. X., Du, N. X., & Tan, J. Y. (1991). Expression of somatostatin gene in Escherichia coli D29A1. Yi Chuan Xue Bao, 18, 282–288.

123

158 3. Patel, Y. C., & Reichlin, S. (1978). Somatostatin in hypothalamus, extrahypothalamic brain, and peripheral tissues of the rat. Endocrinology, 102, 523–530. 4. Mentlein, R., Eichler, O., Forstreuter, F., & Held-Feindt, J. (2001). Somatostatin inhibits the production of vascular endothelial growth factor in human glioma cells. International Journal of Cancer, 92, 545–550. 5. Reynaert, H., & Geerts, A. (2003). Pharmacological rationale for the use of somatostatin and analogues in portal hypertension. Aliment Pharmacology and Therapeutics, 18, 375–386. 6. Albericio, F. (2004). Developments in peptide and amide synthesis. Current Opinion in Chemical Biology, 8, 211–221. 7. Bruckdorfer, T., Marder, O., & Albericio, F. (2004). From production of peptides in milligram amounts for research to multitons quantities for drugs of the future. Current Pharmaceutical Biotechnology, 5, 29–43. 8. Loffet, A. (2002). Peptides as drugs, is there a market? Journal of Peptide Science, 8, 1–7. 9. Itakura, K., Hirose, T., Crea, R., Riggs, A. D., Heyneker, H. L., Bolivar, F., et al. (1977). Expression in Escherichia coli of a chemically synthesized gene for the hormone somatostatin. Science, 198, 1056–1063. 10. Karpova, S. K., Sazina, E. T., Karasev, V. S., Bader, L. B., Sergienko, O. V., Shishkina, A. A., et al. (1993). Synthesis of somatostatin in Escherichia coli cells, isolation and characteristics. Bioorganicheskaia Khimiia, 19, 612–622. 11. Hanahan, D., Jessee, J., & Bloom, F. R. (1991). Plasmid transformation of Escherichia coli and other bacteria. Methods in Enzymology, 204, 63–113. 12. Laemmli, U. K. (1970). Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature, 227, 680–685. 13. Scha¨gger, H., & von Jagow, G. (1987). Tricine-sodium dodecyl sulfate polyacrylamide gel electrophoresis for the separation of proteins in the range from 1 to 100 kDalton. Analytical Biochemistry, 166, 368–379. 14. Sambrook, J., & Russell, D. (2001). Molecular cloning, a laboratory manual (3rd ed.). Cold Spring Harbor: Cold Spring Harbor Laboratory Press. 15. Grosjean, H., & Fiers, W. (1982). Preferential codon usage in prokaryotic genes, the optimal codon-anticodon interaction energy and the selective codon usage in efficiently expressed genes. Gene, 18, 99–209. 16. Rubio-Texeira, M., Castrillo, J. I., Adam, A. C., Ugalde, U. O., & Polaina, J. (1998). Highly efficient assimilation of lactose by a metabolically engineered strain of Saccharomyces cerevisiae. Yeast, 14, 827–837. 17. Gros, E. (1967). The cyanogen bromide reaction. Methods in Enzymology, 11, 238–255.

123

Mol Biotechnol (2013) 55:150–158 18. Jua´rez, P., Sanz, L., & Calvete, J. J. (2004). Snake venomics, characterization of protein families in Sistrurus barbouri venom by cysteine mapping, N-terminal sequencing, and tandem mass spectrometry analysis. Proteomics, 4, 327–338. 19. Seed, B. (1987). An LFA-3 cDNA encodes a phospholipid-linked membrane protein homologous to its receptor CD2. Nature, 329, 840–842. 20. Cserjan-Puschmann, M., Grabherr, R., Striedner, G., Clementschitsch, F., & Bayer, K. (2002). Optimizing recombinant microbial fermentation processes. Biopharma International, 15, 26–34. 21. Cserjan-Puschmann, M., Kramer, W., Duerrschmid, E., Striedner, G., & Bayer, K. (1999). Metabolic approaches for the optimisation of recombinant fermentation processes. Applied Microbiology and Biotechnology, 53, 43–50. 22. Tolia, N. H., & Joshua-Tor, L. (2006). Strategies for protein coexpression in Escherichia coli. Nature Methods, 3, 55–64. 23. Sadeghi, H. M., Rabbani, M., Rismani, E., Moazen, F., Khodabakhsh, F., Dormiani, K., et al. (2011). Optimization of the expression of reteplase in Escherichia coli. Res Pharm Sci, 6, 87–92. 24. Grindley, J., & Odgen, J. (2000). Understanding biopharmaceuticals, manufacturing and regulatory issues. Florida: CRC Press. 25. Hansen, L. H., Knudsen, S., & Sørensen, S. J. (1998). The effect of the lacY gene on the induction of IPTG inducible promoters, studied in Escherichia coli and Pseudomonas fluorescens. Current Microbiology, 36, 341–347. 26. Studier, F. W. (2005). Protein production by auto-induction in high density shaking cultures. Protein Expression and Purification, 41, 207–234. 27. Jensen, P. R., Westerhoff, H. V., & Michelsen, O. (1993). The use of lac-type promoters in control analysis. European Journal of Biochemistry, 211, 181–191. 28. Choi, J. H., & Lee, S. Y. (2004). Secretory and extracellular production of recombinant proteins using Escherichia coli. Applied Microbiology and Biotechnology, 64, 625–635. 29. Yoon, S. H., Kim, S. K., & Kim, J. F. (2010). Secretory production of recombinant proteins in Escherichia coli. Recent Patents on Biotechnology, 4, 23–29. 30. Sauter, S. R., Diekmann, S., & Braun, V. (2003). Two-step purification of the outer membrane transporter and activator protein ShlB from Escherichia coli using internally His6-tagged constructs. Journal of Chromatography B Analytical Technologies Biomedical and Life Science, 25, 33–37. 31. Dong, X. Y., Feng, X. D., & Sun, Y. (2010). His-tagged protein purification by metal-chelate affinity extraction with nickel-chelate reverse micelles. Biotechnology Progress, 26, 1088–1094.