St. Louis Medical News June 2013

PROUDLY SERVING THE GATEWAY CITY

June 2013 December 2009 >> $5

PHYSICIAN SPOTLIGHT PAGE 3

David G. Meyers, MD, MPH

Mending Small Hearts

SLCH provides numerous cutting-edge pediatric cardiology treatments

By LyNNE JETER

ON ROUNDS The Trust Factor ReviveHealth reveals results of 7th annual payor survey; trust represents greater factor than rate In the wake of national health reform, the trust factor between hospitals and health insurance companies is perilously low ... 4

Primary care physicians in St. Louis may rest easier after diagnosing patients with heart anomalies, knowing the cardiac electrophysiology (EP) team at St. Louis Children’s Hospital (SLCH) treats the most complex cases, including arrhythmias in children with congenital heart disease.

“A major success story is that more patients with congenital heart disease, some with even the most severe that would cause babies to die within a couple of days of life, are surviving well into adulthood,” said George Van Hare, MD, a pediatric cardiologist and EP, and director of the Department of Pediatrics Division of Cardiology at the Washington University School of Medicine (WUSM). “Part of the story of pediatric cardiac surgery is that now all forms of congenital heart disease are amenable to some type of corrective surgery. Much of that happens during the newborn period.”

Dr. Van Hare checks monitor readings of one of his small patients.

(CONTINUED ON PAGE 6)

St. Louis Nightingale Carolynn Ingerson-Hoffman, RN, takes entrepreneurial concept to nationally prominent nurse staffing company

Lending Voice and Vehicle

By LyNNE JETER

AARP and RWJF collaborating with select states on national nurse education redesign program Twenty states, including five in Medical News markets, are working on a dynamic nurse initiative redesigning nurse education to bolster the advancement of nurses ... 5

ONLINE: STLOUIS MEDICAL NEWS.COM PRSRT STD U.S. POSTAGE PAID FRANKLIN, TN PERMIT NO.357

stlouismedicalnews

Carolynn IngersonHoffman

In her youth, Carolynn Ingerson-Hoffman, RN, might never have imagined leading a local nurse staffing company to national prominence in a 28-year journey.

Under her circumstances, getting an education was a chore. Then, starting a company with negligible assets in the 1980s was a major challenge.

“It was extremely rare to find a woman-owned business,” said Ingerson-Hoffman, founder and president of Manchester Road-based MediNurse, a leading provider of private duty services, and community and corporate

Now Available!

wellness programs in St. Louis. “From the first day, I ran into many obstacles … getting a business loan, getting credit, and being taken seriously.”

Even though Ingerson-Hoffman knew the odds against an entrepreneurial concept taking root and growing continuously for three decades weren’t good, she was determined.

“Failure wasn’t a word I chose to recognize,” she explained. “But success was. I used the power of visualization to picture myself successful: giving presentations, holding meetings with a staff I knew I would have one (CONTINUED ON PAGE 8)

Register FREE online at StLouisMedicalNews.com to receive your digital edition copy of Medical News optimized for your computer, tablet or smartphone!

PRINTED ON RECYCLED PAPER .com

JUNE 2013

>

1

100% Loan to Value Mortgages with No Private Mortgage Insurance Required.1

Is there a doctor in the house? There is now.

Introducing the Doctor Loan Program from Fifth Third.

Offering new and established doctors (MD or DO) a wide range of fixed and adjustable rate loan solutions to meet all of your home financing needs.2 Residents, Fellows and New Physicians3 may be able to receive financing up to 100% of home value on a new purchase, up to $500,000—or 95% up to $1 million. Plus, employment start dates up to 90 days after closing are allowed.

Established Physicians4 may be able to receive financing up to 100% of home value on a new purchase or refinance a 95% loan-to-value up to $650,000—or 85% up to $1.5 million.

You’re almost home.

Just contact us at 314-889-3325 www.53.com 1. Terms and conditions apply. The information contained is subject to change without notice. Loans are subject to credit review and approval. If the borrower can document that the student loan payment is deferred or is in forbearance for at least 12 months after closing, the student loan payment can be excluded from the DTI calculation. 2. After the interest-only or ARM period, it is possible that the borrower’s payments may increase substantially over the remaining term of the loan. 3. Scheduled to complete medical residency and begin work within 60 days of closing date or commenced work within the last 12 months with a hospital or physician group. 4. Licensed and employed as a non-Intern/Resident Fellow for at least 12 months by a hospital or physician group or self-employed for at least two years as a MD or DO. This offer requires you to participate in our automatic payment program and requires automatic payment deduction from your qualifying Fifth Third account. $50 minimum required to open a new checking account. Offer for primary owner occupied properties only. Investment properties, second homes, construction to perm and lot loans are ineligible. Fifth Third Mortgage Company, 38 Fountain Square Plaza, Cincinnati, OH 45263 an Illinois Residential Mortgage Licensee. Fifth Third Mortgage is the trade name used by Fifth Third Mortgage Company and Fifth Third Mortgage-MI, LLC. Fifth Third and Fifth Third Bank are registered service marks of Fifth Third Bancorp. Member FDIC.

Equal Housing Lender.

R05127146C

2

>

JUNE 2013

stlouismedicalnews

.com

PhysicianSpotlight

David G. Meyers, MD, MPH

By LUCY SCHULTZE

For cardiologist David G. Meyers, MD, MPH, leaving a career in academic medicine to adopt something completely different may have been the best trade he’s ever made.

“This has been an utter gift,” said Meyers, who retired as a tenured professor from the University of Kansas School of Medicine to follow his new wife to St. Louis.

He joined Cardio-Pulmonary Associates of St. Luke’s Hospital this past August, adopting much of the patient load from a recently retired colleague and scaling back his own practice schedule to three days a week.

The group of 11 physicians includes both cardiologists and pulmonologists, and is based on the St. Luke’s campus on South Woods Mill Road in Chesterfield.

“What more can one ask than to go to a part-time practice that you don’t have to build, and to work three days a week with lovely people at a first-rate community hospital?” Meyers said. “I can’t imagine a more wonderful setting than what I lucked into.”

Meyers spent a 30-year career in academic medicine, beginning with a faculty position at the University of Nebraska Medical Center College of Medicine in Omaha. He spent the past 17 years at the UK School of Medicine in Kansas City, where he retired as professor of cardiology, internal medicine and preventive medicine.

Coming to St. Louis, where his wife, Gay Burns, works as a corporate executive, has brought about a threefold shift for Meyers – a new city, a new work environment, and a new pace.

So far, it’s suiting him just fine.

“I have found a three-day work week to be quite civilized,” he said.

A native of Iowa, Meyers was raised in a small town along the Mississippi River and received his medical degree from the University of Iowa in Iowa City.

He completed his post-graduate training in internal medicine at Creighton University, and in cardiology at the Medical College of Virginia. He also earned a master’s degree in public health and preventive medicine at the Medical College of Wisconsin.

Meyers is board certified in internal medicine, cardiology, preventive medicine and clinical lipidology.

His interest in preventive cardiology began in the 1980s.

“Some very, very ancient Chinese doctor wrote that a good doctor cures disease – but the truly excellent doctor prevents it,” Meyers said. “That really is what I’ve tried to do.”

In his practice, that’s meant steering patients away from simply trying to fix their problems with medicines and vitamin supplements. stlouismedicalnews

.com

“Of course, the most important way to achieve good health is by being very selective in choosing your parents,” he quipped.

“But after you’ve done that, then the key really is lifestyle. It’s eating a healthy diet – all things in moderation. Occasionally low-dose alcohol, avoiding smoking and being physically and mentally active.”

While Meyers has watched that perspective become a more popular talking point in healthcare discussions, he doesn’t believe much has really changed over the past 30 years.

“I don’t know that doctors actually

do that much preventive medicine, and among the general public, I don’t know that people are exercising more,” he said.

“We smoke less, thank God, but that’s about it.”

In his career in academic medicine, Meyers focused his research on exploring some unexpected connections in preventive cardiology. Those included the effects of taking various vitamin supplements, getting flu shots and donating blood on preventing heart attacks.

“Indeed, people who regularly donate blood have fewer heart attacks than those who only occasionally do,” he said. “And several studies have shown the correlation between cold weather and heart attacks, in that having an upper-respiratory disease can increase your risk.”

As stimulating an environment as it can be, Meyers isn’t missing the university hospital setting, with its large scale and political milieu.

“Being in a community hospital where everybody helps everybody and is friendly and collegial, is very nice,” he said. “They are very different places, and I’m reveling in what I’m doing at the moment. My practice life is so full.”

Beyond his new practice, Meyers is continuing his hobby of taking part in Civil War reenactments by playing the role of a surgeon from that era. As one of the original members of the Society of Civil War Surgeons, Meyers has been taking part in reenactments since 1985.

Among large events he’s looking forward to taking part in this year are the 150th anniversary reenactment of the battle at Gettysburg.

“One of the key things is really demonstrating what medicine was like in that period,” he said. “In those days, equipment wasn’t sterile, so your surgical tools had wood, ivory or ebony handles.”

While such relics are hard to come by these days, Meyers employs a collection of tools he acquired years ago from a dealer in medical antiquities.

Demonstrating Civil War battlefield surgery also involves an accurate representation of anesthesia techniques, he said.

“Virtually everybody got anesthesia before surgery, either chloroform or ether,” he said. “You didn’t really have people biting down on bullets to withstand the pain.”

With his more-flexible schedule, Meyers is also looking out for ways to revive other hobbies he enjoyed in Kansas City, such as playing the drums in rock-and-roll bands and playing badminton.

While he’s yet to find either a band to join or a badminton facility to use, he hasn’t had trouble filling his two free days a week.

“I help in a food pantry, and I’ve joined Rotary,” he said. “And I run errands for my very busy wife.”

CCGATCTGGGCAACGCATCACGAGCTATATCGGAGCTATCAGT GACAAAAGTATCACGAGCCCACCTATCTCAACGTATGGGGTTC GCACCGGCAGTCCACGGTGAGCTCGAAAGGCCCACCGGTATT GCACGTGACGCACCGGTAATATCGCCGGTCTAATACACGAGGT CAGGCATAGAGAATATACAGTCGTTCGGCCCTTAGGGGAAAGT

GPS’s tumor sequencing tests offer a cost-effective and efficient analysis of clinically actionable genetic biomarkers spanning a wide range of cancers.

■

GPS test results aid in the identification of optimal treatment strategies

Learn more phone

314.747.7337

toll-free 1.866.450.7697

■

Expert interpretation of genomic results

email

gps@wustl.edu

■

CAP-accredited, CLIA-certified laboratories

web

gps.wustl.edu/info

JUNE 2013

>

3

The Trust Factor

ReviveHealth reveals results of 7th annual payor survey; trust represents greater factor than rates

By LYNNE JETER

In the wake of national health reform, the trust factor between hospitals and health insurance companies is perilously low.

That’s the consensus of 373 hospital and health system administrators responsible for negotiating contracts with major health plans in the seventh annual National Payor Study. Conducted by Nashville-based ReviveHealth, the 2013 survey paints an interesting picture of administrators’ opinions about various private payor trends, including rates, payment of claims, denials and other actions.

“The trust factor is huge when it comes to hospitals and health plans being able to play nice in the new world order of risk— sharing and improved health outcomes,” said ReviveHealth CEO Brandon Edwards.

Brandon For the second conEdwards secutive year, hospital and health system leaders who negotiate managed care contracts with national health insurance companies pointed to

WellPoint/Anthem as the nation’s worst plan, with only a 16 percent favorability rating. WellPoint manages health plans in 14 states, including Anthem Blue Cross in California.

“Even though WellPoint now has a CEO with a strong provider background, he’s got to turn around an aircraft carrier, and that takes time,” said Edwards, noting that business practices and corporate behavior have contributed to the company’s poor reputation. “Their major imperative has to be improving their reputation and rebuilding trust with providers.”

For the third consecutive year, UnitedHealthcare exacerbates its perennial poor showing, ranked worst in all areas of contract negotiations except payment plans. The payor held firm as the health plan with the most consistently poor reputation among hospitals – and the slowest to pay.

“Honesty and candor represent United’s biggest challenges,” noted Edwards.

“Hospitals year in and year out cite UnitedHealthcare’s low rates, slow payments, bureaucracy, and honesty as reasons for their poor rankings.”

Aetna was given high marks for the best rates, followed closely by Cigna.

The cytogenetic laboratory and information resource of choice for physicians who demand accurate, timely, and state of the art cytogenetic diagnostic services for their patients.

“Honesty and easy business dealings seem to matter more than rates,” said Edwards. “Otherwise, Aetna would be the best rated plan in every category.”

This year, independent Blue Cross and Blue Shield (BCBS) plans and Cigna tied for the top favorability spot, with 49 percent. Last year, Cigna held the spot alone. In this year’s survey, Aetna’s approval rating was 46 percent, followed

by Coventry and UnitedHealthcare at 30 percent each, and Humana at 25 percent.

Despite having the lowest rates for three consecutive years, BCBS plans earned top ranking for best overall business practices.

“Independent BCBS plans, however, ranked well ahead of Cigna (30 percent compared to 19 percent) in terms of overall best to deal with, despite having the lowest ranking in payment rates to hospitals,” said Edwards. “For several years in a row, the survey revealed a complete lack of correlation between payment rates from any payor, and a hospital’s perception of that payor.”

The survey, conducted in partnership with Catalyst Healthcare Research (CHR) and The Godbey Group, is the only one of its kind in the United States to target hospital leaders who negotiate managed care contracts with national health insurance companies. Respondents included CEOs, CFOs, and managed care/payor relations executives who negotiate on behalf of about one-third of the nation’s hospitals.

“The goal of the study is to provide a national perspective of hospital leaders’ opinions of large health plans,” said Edwards, who initiated the survey after noticing a void in payor ratings. “Even though health plans rate hospitals and their physicians routinely, no one was rating the health plans.”

On an optimistic note, nearly half of all participants believe their negotiated rates will improve this year.

Providers have varying strategies for success, with wellness programs a top priority for their employees, and clinical in-

tegration a second focal point.

“Hospitals are taking the lead on wellness and population health programs with their own employees,” said Edwards.

“Now they need to take that experience and go out to local employers with solutions to keep those employees healthy and costs down.”

Nearly 40 percent of respondents reported their hospital had been in at least one public contract dispute in the past five years that resulted in non-participation.

Also, the gap between rates for the largest payor and rates for the second and third largest payors have widened considerably.

“This ‘payor cost shift’ drives up profitability for the biggest plans at the expense of the smaller market share plans,” said Edwards. “That’s proven by the fact that more than one-third of hospitals would fail to meet profit margin goals if all private payor rates were the same as their largest payor.”

Contracting priorities for the upcoming year – the top three are the same as 2012 – involve: 1. Increasing rates with the largest payor.

2. Producing better language protection against denials.

3. Increasing rates with the second and third largest payors.

4. Balancing the threat and opportunity of narrow networks within the hospital’s market.

5. Having better contracting language with the largest payor.

6. Procuring better reimbursement for high-cost drugs, implants and other carve-outs.

7. Expediting claims processing and payments.

8. Improving rates for Medicare Advantage plans.

9. Shifting reliance away from the largest payor.

10. Bundling payments for medical home, ACO, or other population health strategies.

SOURCE: ReviveHealth.

• Chromosome Analysis • Fluorescence In Situ Hybridization (FISH)

• Array Comparative

Genomic Hybridization (Microarray)

1916 Patterson Street Suite 400 Nashville, TN 37203 (615) 327-4532 1-800-331-GENE (4363)

Genetics Associates Inc. is CAP accredited, CLIA and State of Tennessee Licensed.

Our professional staff includes three American Board of Medical Genetics (ABMG) certified directors.

Where advanced cytogenetic technology meets old-fashioned service www.geneticsassociates.com 4

>

JUNE 2013

stlouismedicalnews

.com

Lending Voice and Vehicle AARP and RWJF collaborating with select states on national nurse education redesign program

By LYNNE JETER

Twenty states, including five in Medical News markets, are working on a dynamic nurse initiative redesigning nurse education to bolster the advancement of nurses.

The AARP and Robert Wood Johnson Foundation (RWJF), developers of the national program, Future of Nursing:Campaign for Action (Campaign), is working with Florida, Louisiana, Mississippi, Missouri, and Tennessee to implement the Institute of Medicine’s (IOM) evidence-based recommendations on the next chapter of nursing. (The IOM defines “evidence-based practice” as a combination of best research evidence, best clinical experience, and consistency with patient values.) Other states involved in the initiative are Colorado, Connecticut, Georgia, Iowa, Idaho, Kansas, Maryland, Michigan, Nebraska, New Jersey, Pennsylvania, Rhode Island, Utah, Wisconsin and Wyoming. The RWJF committed $3 million to help the states prepare the nursing profession to address the nation’s most pressing healthcare challenges.

The Future of Nursing State Implementation Program will boost efforts already underway across the nation and the District of Columbia. The Campaign, the foundation explained, provides a voice and a vehicle for nurses at all levels to lead system change by collaborating with business, consumer, and other health professional

organizations.

“This program is designed to spur progress by supporting action coalitions, most of which are led by volunteers, that are doing promising work to implement the IOM recommendations,” said Susan B. Hassmiller, PhD, RN, RWJF senior adviser for nursing and director of the Campaign. “The foundation is committed to providing states with the support they need to build a more highly educated, diverse nursing workforce that will improve health outcomes for patients, families and communities.”

The initiative provided two-year grants of up to $150,000 to state-based action coalitions that have made substantial progress toward implementing the IOM recommendations. The grants call for states to match funds.

This pressing issue was addressed at the American Hospital Association’s annual meeting April 28-May 1 in Washington, DC, which focused advocacy efforts on transforming the healthcare delivery system, maintaining essential resources, and reducing the regulatory burden.

The U.S. Department of Labor has identified nursing as the fastest-growing occupation through 2012. More than 1 million new and replacement nurses will be needed to fill the nation’s healthcare needs.

“Current demand for quality nurses far outstrips the supply,” said Sheila Kelly, PhD, project director of the Mississippi Barriers to Nursing Education Survey. “Increased future needs will only exacerbate the crisis. In 2002, the Health Resources and Services Administration estimated that over 30 states were experiencing nursing shortages, and the shortfall would grow to over 44 states by the year 2020.”

The Center to Champion Nursing in America (CCNA), an AARP initiative, AARP Foundation, and RWJF serve as the national program office for the Future of Nursing State Implementation Program.

“This new program will help action coalitions get the strategic and technical

support required to advance their goals,” said Susan Reinhard, PhD, RN, senior vice president of the AARP Public Policy Institute and CCNA chief strategist. The nonprofit, nonpartisan national organization with more than 37 million members is one of the nation’s most powerful lobbying groups. “Our hope is that states will get the boost they need to be effective in achieving the triple aim of addressing cost, quality and access.”

LUNG CANCER IS THE DEADLIEST CANCER IN THE WORLD. WE CAN CHANGE THAT. The American Lung Association is leading the fight against the deadliest cancer there is—lung cancer.

Join the fight by giving a gift to the American Lung Association today.

314-645-5505 x1009 | 1-800-LUNG-USA www.breathehealthy.org 1118 Hampton Ave., St. Louis, MO 63139

Now Available Free!

Register online at StLouisMedicalnews.com to receive your FREE new digital edition of Medical News optimized for your computer, tablet and smart phone!

You will continue to receive your monthly print copy in the mail, but now Medical News will be available to you wherever you go.

stlouismedicalnews

.com

JUNE 2013

>

5

Mending Small Hearts, continued from page 1 Catheter ablations comprise the majority of procedures performed by Van Hare and cardiac EPs at SLCH. “Our success rates are very high; complication rates are very low,” said Van Hare, a pioneer in the use of radiofrequency catheter ablation in children.

“Being a high volume center for children allows us to be highly experienced.”

Two cardiac EPs work in tandem on almost all cases, “an important feature because you often don’t know what you’ll find when you get involved with a patient,” said Van Hare, who often collaborates with junior EP Jennifer Sylva, MD. “We may think it’ll be a straightforward case, but perhaps the patient’s problem is more complicated than previously imagined.”

Implantable loop recorders, similar to a halter monitor without the electrodes, is used effectively at SLCH. “It’s a gadget the size of a USB flash drive that can be implanted under the skin of children and adults in a very minor procedure,” said Van Hare, explaining that “as EPs, we’re referred children who have episodes that may indicate dangerous heart rhythm issues. If the family practice doctor sees a patient in clinic who’s had an episode

of fainting, which is common in teenagers, you don’t want the next episode to be sudden death.

So a lot are referred to us because of suspicion that their episodes of fainting or perhaps sensation of a racing heartbeat indicate more malignant cardiac disease that could lead to sudden death.”

Because the electrodes often cause a skin reaction, and a halter monitor is inconvenient to wear, pediatric patients better tolerate implantable loop recorders, Van Hare pointed out.

“A 7-year-old won’t put up with one of these monitors,” he said, explaining that “the loop recorder gives us an opportunity to put something underneath the skin that will continuously monitor heart rhythm for three years, transmitting episodes as needed.”

4-1-1 on George Van Hare, MD A native of Connecticut, George Van Hare, MD, graduated from the University of Connecticut School of Medicine, served as chief resident at Rainbow Babies & Children’s Hospital in Cleveland, Ohio, and completed fellowships in cardiology and electrophysiology (EP) at the University of California-San Francisco.

After teaching at Stanford University for a decade, where he directed the EP program, Van Hare left Palo Alto, Calif., where “the weather is almost perfect year-round” to relocate to St. Louis in 2008.

“I was privileged to have the opportunity to be chief of cardiology at one of the nation’s best medical schools (Washington University School of Medicine) and children’s hospitals (St. Louis Children’s Hospital),” he explained. “It also provided my wife (Michele Estabrook, MD), a pediatric infectious disease specialist, a wonderful opportunity. She’s very interested in medical education and infectious diseases in transplanted patients.”

As a pediatric cardiologist and EP, and director of the Department of Pediatrics Division of Cardiology at the Washington University School of Medicine (WUSM), Hare specializes in the diagnosis and treatment of children with heart rhythm disorders, including non-invasive tests, and also the performance of electrophysiology studies, catheter ablation procedures, and pacemaker and defibrillator implantation. An officer for the Heart Rhythm Society, he also holds the Louis Larrick Ward Chair in Pediatric Cardiology at St. Louis Children’s Hospital and WUSM. Missourians have embraced Van Hare, recognizing him as a “Best Doctor in America” in the 2012 edition of St. Louis Magazine.

Of three grown children, the eldest is pursuing a psychology degree; the middle son is a Vassar grad who works in Manhattan as a sound designer; and the youngest recently earned an EMT license.

“We love St. Louis,” said Van Hare. “We felt at home as soon as we got here.”

6

>

JUNE 2013

The implantable loop recorder helps cardiologists determine specific symptoms.

“A child fainted during a wrestling match, but we could never catch an episode,” recalled Van Hare. “We put in an implantable loop recorder and nine months went by before the child had another fainting spell. It turned out the recorder showed a very dangerous heart rhythm, which allowed us to give the patient specific therapy, in this case medication, to keep it from recurring. Another child had episodes of fainting that we couldn’t explain. With the implantable loop recorder, we found out the child’s heart was stopping for 30 seconds at a time. If we hadn’t implanted the loop recorder, we might not have made that diagnosis, and we wouldn’t have implanted a pacemaker to solve the patient’s problem altogether.”

Three-dimensional (3D) mapping systems represent cutting-edge treatment at SLCH. “The advantages are numerous,” he said. “With the 3-D mapping system, we’re able to construct a virtual 3D model of the heart chamber to allow us to precisely locate an abnormal focus that we’d attack with catheter ablation. This system allows us to locate catheters in 3D space without having to step on the fluoroscopy pedal and therefore, dramatically reduce the amount of radiation exposure associated with these procedures. That’s very important.”

A vital aspect of work being done at SLCH involves complex heart rhythm disorders, with the most complex cases occurring as a result of corrective cardiac surgery for congenital heart disease, said Van Hare, who was among the nation’s first specialists to perform catheter ablation for complex heart rhythm disorders in the early 1990s, and is often referred pediatric patients from cardiologists across the country to help with cases in which children cannot verbalize heart problems, and those in which an attempt has been made to fix a cardiac problem without success.

“Any time you create an incision, you create a scar, which could lead to abnormal heart rhythms that rotate around these

scars in a circular pattern,” he explained.

“Understanding these things often requires the ability to see the entire chamber electrically in three dimensions.”

Because SLCH is one of the nation’s most comprehensive heart transplant and heart failure programs for children, many patients are transferred to the children’s hospital for consideration of a heart transplant.

“Sometimes, kids are heading down the transplant route because they developed abnormal heart rhythms that are making their hearts worse.

Often, we’ll evaluate them to see if we can figure out a way to help their heart so they can get by without a transplant because once that’s been done, you’ve introduced a whole host of problems that limit their lives,” said Van Hare. “Some patients awaiting transplants simply need their medication adjusted; others need a different type of heart surgery to improve the heart. Anytime we can help kids not get transplanted, we consider it a big win.”

The SLCH team is also involved in the pediatric application of a specific treatment for heart failure, an area that was developed in the adult world primarily for adults like Vice President Dick Cheney and others with defibrillator dysfunction.

“The idea is to pace the heart in a way that causes it to function better,” said Van Hare. “Cardiac resynchronization therapy (CRT) is implanted in a particular way in adults, primarily in the catheterization lab. We’ve found that in children, there’s a completely different classification that could benefit from CRT, such as children born with one ventricle. We manage many single ventricle patients surgically. Those with single ventricles ultimately can develop heart failure due to dyssynchronous activation of the heart rate. By employing this particular type of pacemaker, CRT, which involves placing two sets of leads on a ventricle instead of one, we’re able to genetically improve heart function and get kids off the transplant list.”

Van Hare’s team is involved in various national projects, such as the recently FDA-approved national study on CRT issues in patients with heart failure that his colleague, Sylva, is leading.

“Cardiology is an incredibly exciting field,” said Van Hare, a practitioner since 1983. “Over the last 20 to 25 years, there’s been a dramatic shift from heart rhythm disorders being managed by open heart surgery to being managed by catheterization technique. I’ve been riding that wave the entire time. The field continues to evolve rapidly with new technology and knowledge. In our academic setting, we’re fortunate to be at the forefront.” stlouismedicalnews

.com

4927_Facts_STL_MedNews_4.875x13 11/19/12 1:49 PM Page 1

Steve Martin and The Steep Canyon Rangers.

Manna from Heaven Annual gala to benefit research raises nearly $2 million, thanks to Steve Martin and The Steep Canyon Rangers and the St. Louis community

By LYNNE JETER

The richly talented Steve Martin, an actor, comedian, musician, poet, and writer – and new father at the age of 67, with multiple projects on the books – made time to play with his band, Steve Martin and The Steep Canyon Rangers, at The Foundation for BarnesJewish Hospital’s 2013 illumination Gala that raised nearly $2 million for cancer research at the Alvin J. Siteman Cancer Center at BarnesJewish Hospital (BJH) and Washington University School of Medicine (WUSM).

A sold-out crowd of more than 600 guests attended the April 20 event, held at The Ritz-Carlton in St. Louis.

“This event to support cancer research at Siteman is such a meaningful opportunity for each of us to make a difference for our future and our children’s future,” said gala co-chair Ron Kruszewski, chairman, president and CEO of Stifel Financial Corp., noting that 1,500 cancer patients die daily, and 1.6 million new cases are diagnosed annually. “Thanks to research, the progress being made in cancer treatments just in the last few years is phenomenal.”

Kruszewski and Craig Schnuck, chairman of the executive committee with Schnuck Markets Inc., led community support for the gala this year. ACW Alliance and Stifel were presenting sponsors of the event, which included a cocktail reception, dinner, luxury auction, special videos and the musical entertainment of Steve Martin and The Steep Canyon Rangers.

“Siteman is leading the way to more personalized cancer treatments based on an individual’s genes—and the Cancer Frontier Fund is playing a significant part in those advancements,” said Schnuck. “It gives us all hope and I’m humbled to be part of it.”

The illumination Gala supports The Foundation’s Cancer Frontier Fund, created in 2009 to help Siteman Cancer Center researchers accelerate breakthroughs that will change cancer care and expedite cures.

When award-winning vocalist and actress Minnie Driver headlined the 2012 gala themed “fast-forward to a world without cancer,” $1.9 million was raised. Specifically, the Cancer Frontier Fund supported research to improve treatments and outcomes for pancreatic, cervical, breast, blood

cell and skin cancers; to develop a simple urine test to detect kidney cancer earlier; and to develop a way to stimulate the immune system to destroy tumors.

“Having watched friends and family members battle cancer, it’s such an honor to support research that will get us to cures faster,” Driver said.

A diverse group of entertainers have rallied the gala’s success: Christina Applegate, a breast cancer survivor, headlined in 2009; Kareem Abdul-Jabaar, the NBA’s all-time leading scorer and Hall of Famer, spoke in 2010; and Kristin Chenoweth, an awardwinning actress whose mother, Junie, is a breast cancer survivor, performed in 2011.

Amy and Bill Koman spearheaded the fundraising initiative.

“Philanthropic support is helping us speed the process of finding more effective, individualized treatments with fewer side effects, as we work to eliminate cancer completely in the future. It’s an exciting time in cancer research,” said Siteman director Timothy Eberlein, MD. The 350-plus researchers and physicians at Siteman Cancer Center hold more than $160 million in research and related training grants. Siteman patients participate in nearly 250 cutting-edge clinical studies.

“We’re so appreciative to all those who attended and supported illumination to make it so successful,” says Rich Liekweg, president of BJH and Barnes Jewish West County Hospital, and group president of BJC HealthCare. “Through the generosity of many, we’re able to keep our foot on the accelerator of cancer research so more people can live healthier lives.”

Siteman is the only cancer center statewide – and within 240 miles from St. Louis – to hold the prestigious Comprehensive Cancer Center designation from the National Cancer Institute. BJH and WUSM, Siteman’s parent institutions, also are nationally recognized, with U.S. News & World Report magazine consistently ranking both among the best in the country.

“None of our work is possible without continued support from the St. Louis community,” said Eberlein. “Drastically slashed budgets are the norm these days, so the money generated by illumination is like manna from heaven.”

illumination Gala 2014 is slated for Saturday, April 26, at The Ritz-Carlton.

stlouismedicalnews

.com

Source: Hospice Perception Study 2010

We want to change that statistic.

This is just one of the surprising statistics revealed by a nation-wide survey of physicians. And that’s why Crossroads Hospice wants to help medical professionals understand more about hospice and how much patients and families can benefit. To do that, we’ve sponsored and published a variety of papers like the one written by Physicians Practice magazine: What Every Doctor Should Know About Hospice.

3 easy ways to get your free whitepaper.

1. Scan this QR code 2. Email info@CrossroadsHospice.com (subject line: Every Doctor) 3. Visit CrossroadsHospice.com/stm

Fast, easy referrals: 888-909-6673 CrossroadsHospice.com/stm JUNE 2013

>

7

St. Louis Nightingale, continued from page 1 day. I even pictured how my office would look and how much revenue we’d generate.

I really think visualization is strategic planning of the subconscious because it worked and worked well. I still use the same technique today to achieve something I’m determined to achieve.”

Ingerson-Hoffman was born third of seven children – six girls and a boy – to a homemaker who secretly longed to be a nurse.

“She was a feminist before it became popular in the ‘60s,” said Ingerson-Hoffman, who learned later in life of her mom’s career dream. “She believed and instilled in me that women could do the same as any man – if given the chance. My father worked two and three jobs to provide for us. In addition, he and mom raised chickens and grew most of the vegetables we ate.”

As a schoolchild, Ingerson-Hoffman was unable to participate in extra-curricular activities.

“My sisters and I weren’t allowed to stay after school because of our home chores,” she said, rattling off a partial list: cleaning, ironing, cutting the grass and weeding gardens. A few exceptions occurred during her senior year: she served as senior maid to the Homecoming Court, and was allowed to attend select afterschool sporting events. “If I could have, I would’ve liked to join the choir or been involved in the school newspaper, yearbook or student council.”

Initially drawn to law school, a career path she knew she couldn’t afford to pursue, Ingerson-Hoffman’s interest in nursing was sparked at the old DePaul Hospital on Kingshighway Boulevard, where her dad was hospitalized several times for prolonged periods.

“It was during one of these hospitalizations that I decided to become a nurse and started planning what I needed to do to make that happen,” said IngersonHoffman, one of the original DePaul “Paulettes,” teen volunteers on the medical-surgical floors.

In her “first career” as a nurse, Ingerson-Hoffman was “a darned good one,” she joked, having achieved the level of assistant director of nursing for recruitment and special projects.

“This position, along with my time in the clinical area, gave me the foundation to move to the private sector,” she said. “I believe that my compassion for others helped me with the business. I’ve always said to employees that if they take care of the company, the company would take care of them and I meant it.”

Ingerson-Hoffman’s special focus as a business owner in the healthcare industry involved setting standards that were missing at the time.

“I’m happy to say we did indeed set standards that many of the local hospitals ended up following, not to mention others in my type of business,” she said. “My goal was to make a difference by running a good

“As physicians, we have so many unknowns coming our way...

One thing I am certain about is my malpractice protection.”

Medicine is feeling the effects of regulatory and legislative changes, increasing risk, and profitability demands—all contributing to an atmosphere of uncertainty and lack of control.

What we do control as physicians: our choice of a liability partner.

I selected ProAssurance because they stand behind my good medicine.

In spite of the maelstrom, I am protected, respected, and heard.

business based on business principles, but also with the patient as the center of our business. We’ve never lost sight of that in all these 28 years, and I believe we made a difference in the business, the community and in many lives.”

Indeed, MediNurse employs 100 healthcare professionals to serve families, businesses and hospitals, while also stepping up as a leader in the medical community by supplying speakers to schools, encouraging teens to consider a nursing career, and mentoring students. For the past decade, she’s gathered friends, families, colleagues, and student nurses from the Barnes-Jewish School of Nursing to fill, pack and wrap hundreds of holiday gifts to soldiers abroad.

“Carolynn defines success by helping people,” said Judy Goodman, a MediNurse vendor. “When I was in crisis, she provided a caregiver so my elderly parents could stay in their home.”

Ingerson-Hoffman’s empathic nature stems from overseeing her parents’ care and well-being for more than two decades.

“Like many family caregivers, the responsibility and stress caused my own health concerns,” she said. “On the plus side, I use myself as an example to help others see the importance of caring for yourself

LUNG CANCER IS THE DEADLIEST CANCER IN THE WORLD. WE CAN CHANGE THAT. The American Lung Association is leading the fight against the deadliest cancer there is—lung cancer.

Join the fight by giving a gift to the American Lung Association today.

when you’re caring for someone else.”

Since serving as president of the Barnes-Jewish College Goldfarb School of Nursing Alumni Association, IngersonHoffman has dreamed of starting a nonprofit for Nurses Caring for Nurses.

“I was acutely aware that nurses spend their whole professional career – the majority of their lives – caring for others and not caring for themselves,” she said. “I saw alumni who were alone in later years with many needs. Nurses Caring for Nurses will recruit younger nurses to help those nurses who are ill or elderly. I say ‘will’ because it will happen, of that you can be sure.”

Outside of work, Ingerson-Hoffman saves up spare time to spend with her husband, Harlan, for simple pleasures: walking on a beach, and perusing farmers’ markets and art and antique shows in the park.

“Harlan always gives me the gifts of laughter and patience,” she said. “His support has been key. And he’s always shared his experience in business with me and taught me a great deal along the way.”

The couple frequently traveled internationally and spent many evenings socializing. Even though friends remain very important to them, their primary extra-curricular activity these days involves “being at home for a big dose of peace and quiet,” said Ingerson-Hoffman, who loves to cook. “We love being around our Bichon, Versace. We spend a lot of time staying up to date on current affairs locally, nationally and around the world. We read a lot. I couldn’t even guess how many books we have! You’ll still find us holding hands.”

During long beach walks, IngersonHoffman mulls the company’s future and various avenues to pursue.

“My mind is always on,” she said. “My best ideas come during the night and I’ll wake up to write them down or else, I’ll forget them.”

The most valuable life lesson IngersonHoffman has learned involves opportunities that spring from obstacles.

“With every obstacle one faces, there’s an opportunity to be found if you look for it,” she said. “Unlike so many business owners who are throwing in the towel in today’s very challenging economic times, I look for the opportunities and I believe I have one. Stay tuned.”

314-645-5505 x1009 | 1-800-LUNG-USA www.breathehealthy.org 1118 Hampton Ave., St. Louis, MO 63139

I believe in fair treatment—and I get it.

Keystone IT provides the technology platforms which enable healthcare providers to deliver the highest level of care to their patients. These platforms unite strategic consulting, engineering, implementation, and support via cutting-edge technology and a diverse network of resources. keystone-it.com

(855) 621-9500

Professional Liability Insurance & Risk Management Services ProAssurance Group is rated A (Excellent) by A.M. Best.

ProAssurance.com • 800.492.7212

8

>

JUNE 2013

strategy • innovation • support

stlouismedicalnews

.com

Reflux KO

Torax Medical rolls out LINX procedure for GERD patients to select specialists

By LyNNE JETER

A few dozen approved surgeons specializing in gastroenterology procedures across the nation are offering a revolutionary solution for patients with gastroesophageal reflux disease (GERD) that’s so new, many primary care physicians and some specialists aren’t aware of it as an option.

“When the FDA ap- Reflux proved the LINX Reflux Management System, and the New England Journal of Medicine recently discussed the efficacy of the system, word began getting out,” said Sam Pace, MD, a board-certified gastroenterologist with Digestive Health Specialists in Tupelo, Miss., director of the Heartburn Center of North Mississippi, and a LINX-approved surgeon.

Torax Medical opted to launch the procedure nationwide at approved centers, Dr. Sam Pace usually one or two per state. Torax Medical develops and markets products designed to restore human sphincter function via its technology platform, Magnetic Sphincter Augmentation (MSA), which uses attraction forces to augment weak or defective sphincter muscles to treat GERD that often irritates the esophagus, causes heartburn and other symptoms. Left untreated, reflux could lead to serious complications, such as esophagitis, stricture, Barrett’s esophagus and esophageal cancer.

“I applaud the medical company for not doing a wholesale release,” said Pace.

“Instead, the company is releasing it to centers that do a lot of reflux work so the proper evaluation can be done.”

The LINX System’s new device is a quarter-sized flexible band of magnets encased in tiny titanium beads. The mag-

LINX closed

netic attraction between the beads helps keep a weak esophageal sphincter closed to prevent reflux. Implanted around a weak sphincter just above the stomach, the minimally invasive procedure typically takes less than an hour to complete.

“The force of swallowing breaks the magnetic bond to allow food and liquid to pass through, and then the magnetic attraction closes the lower esophageal sphincter back to form a barrier,” said David Gilliland, MD, FACS, a surgeon with Surgery Associates PA, in Tupelo, also an LINX-approved surgeon.

Until now, physiDr. David cians had only two opGilliland tions for treating reflux: medication or a surgical procedure called laparoscopic Nissen fundoplication, widely used since the early 1990s. In this procedure, the top part of the fundus is wrapped around the lower esophagus to improve the reflux barrier. Even though Nissen fundoplication may be effective, it has several drawbacks.

“After a patient has fundoplication, he can no longer belch or vomit,” said Gilliliand. “Some patients report gas bloating because of this.”

Three years after sphincter augmentation with the LINX System, the majority of treated patients were able to substantially

Swallowing

reduce or resolve their reflux symptoms, while also eliminating their use of refluxrelated medications, according to the New England Journal of Medicine summary.

In 100 percent of patients, severe regurgitation was eliminated, and nearly all patients (93 percent) reported a significant decrease in the need for medication. Ninety-four percent reported satisfaction with their overall condition after having the LINX System procedure, compared to 13 percent before treatment while taking medication.

“For years, surgery for reflux patients would best be described as a static deal,

where you sew everything down,” said Pace. “The LINX procedure is dynamic because opening and closing simulates the normal sphincter, except you’re keeping it closed so you don’t have reflux. Now we have a choice for patients that we can tailor-make the surgical approach to this problem.”

Like Nissen fundoplication, the procedure is done laparoscopically through five small punctures in the abdomen.

“Once we’re in the OR, we can decide which procedure the patient is better suited for, depending on anatomy,” Gilliland said. For example, the LINX procedure cannot be done if the patient has a hiatal hernia larger than three centimeters.

Another benefit is a quicker return to solid food.

“We try to get LINX patients to eat regular food right away to train the device,” Gilliland said. “With the Nissen procedure, they’re on a prescribed diet for at least two weeks.”

Because the procedure is new, insurance coverage varies by provider and is usually approved on a case-by-case basis.

We’re Ready for Your Call Night or day, the Children’s Direct team is ready to personally assist your practice.

Call Children’s Direct, our physician access line, 24 hours a day, 7 days a week to:

Don’t Get Left Behind Deliver your message to other healthcare professionals in

St. Louis Medical News.

Call Larry Henry @ 314.917.6107 for more information. stlouismedicalnews

.com

• Admit a patient • Consult with a pediatric specialist • Transport a patient • Schedule a patient appointment • Request information ADMIT | CONSULT | SCHEDULE | TRANSPORT | COMMUNICATE

800.678.HELP (4357) ChildrensDirect@bjc.org SLC15579_5/13

JUNE 2013

>

9

A Sense of Independence

By CINDY SANDERS

Nearing retirement in an era when 70 is the new 50, it can be difficult to picture a time when you won’t be able to hop in your car to run errands, swing a club or a racquet, attend an exercise class, or enjoy an evening out with good friends. Perhaps in the recesses of your mind the possibility exists that you might need a little assistance at some point in the very distant future … but that time is certainly not now.

Still, in your most prudent moments, you know the big house and big yard are really too big now that the children are grown and gone. And you hate the thought of your spouse or the kids hurriedly having to make critical decisions should something happen to you.

Still, you just aren’t ready to give up your self-sufficiency. And why should you when a solution exists that allows you to keep your independence while having a contingency plan in place?

For a growing number of senior adults, continuing care retirement communities (CCRCs) provide the best answer – supporting active, independent lifestyles while offering increasing levels of care when required. That continuum allows residents to age in place.

Headquartered in Des Moines, Iowa, Life Care Services has been developing and managing senior living communities for more than four decades. As the nation’s leading manager of full-service se-

Timber Ridge Seattle

Sagewood in Phoenix

nior living communities, the company owns or operates more than 80 communities in 28 states and the District of Columbia and serves nearly 30,000 residents.

Erik Gjullin, vice president/director of marketing & sales for Life Care Services, explained Heritage in Brentwood that residents arrive while independent with the knowledge that once you are in, you have a home for life. assisted living, skilled Yet, Gjullin said, the focus of their comnursing and memory munities is on maintaining wellness and care facilities are availindependence.

Erik Gjullin able onsite. Key draws “The driver for our prospects, who for living in CCRCs are are looking for solutions to senior housthe socialization aspect and knowing that ing, is to live somewhere where it’s easy

You take care of your patients... we'll manage the rest.

Operations & Strategy Financial Services & Support Technology & Electronic Information Revenue Cycle Performance Compliance & Legal

LHE Healthcare Seminars:

Springfield, MO - June 20, 9am-2pm St. Louis, MO - July 18, 9am-2pm

LeagueOfHealthcareExperts.com

Sagewood in Phoenix

to participate in a lifestyle that enhances health,” he said.

Gjullin explained Life Care Services takes a ‘whole person’ approach to wellness.

“Our HealthyLife™ Services program is really the overall health and wellness program that we practice in all our communities. It’s not just fitness,” he continued, “It’s nutrition.

It’s socialization. It’s education. It’s ongoing lifestyle that really creates the wellness for the whole person.”

While a number of programs and services are consistent across Life Care Services developments, the communities are far from ‘cookie cutter.’ Gjullin said, “The unique part of it is people live in different geographic regions for a reason. They like the lifestyle. They like the architecture. So if you go into our community in Phoenix, Ariz., it looks like it belongs in Phoenix.

It’s got local architecture, spaces and cuisine. It’s got the flavor of the southwest.”

Residents enjoy a range of living options from apartment-style residences to garden villas to detached cottages. Manicured lawns, gardening plots, walking and biking trails, guest accommodations, a clubhouse with restaurant-style menus, day spa, putting green, cocktail lounge, fitness center, library, convenience store, weekly cleaning service, 24-hour security and more are part of the well-appointed surroundings.

Luxury, of course, does come with a price. Gjullin said residents pay a onetime entrance fee and ongoing monthly fee, both of which vary depending on the size of the residence selected. The monthly fee, he continued, “covers everything you could possibly think about that you would be paying if you were living in your own residence.”

At death or upon moving, there are two return-of-capital plans that give back either 80 percent or 90 percent of the entrance fee to the resident or the estate. If residents needs to move to a higher level of care … either temporarily or permanently … they are guaranteed a bed, and the monthly fee remains the same as in the independent living phase.

“As you move through the contin(CONTINUED ON PAGE 12)

10

>

JUNE 2013

stlouismedicalnews

.com

stlouismedicalnews

.com

JUNE 2013

>

11

CONNECTing Caregivers to Prevent Patient Falls

By CINDY SANDERS

Preventing America’s seniors from falling is a national health priority both in terms of injury and cost. Yet, fall prevention programs have only proven to be marginally successful over the long term.

Cathleen S. Colón-Emeric, MD, MHS, and colleagues focused on the gap between quality improvement (QI) protocols and sustained bedside implementation in the nursing home setting. An associate professor of Medicine in the Division of Geriatrics at Duke University School of Medicine, Colón-Emeric said previous studies found the desired improvements occurred when outside trainers and researchers stepped in to create interventions. The external staff addressed multiple risk factors to help lower fall rates, recurrent falls and injurious falls. However, she continued, “When you try to train the existing nursing home staff to do those things, it doesn’t seem to work.”

Based on social constructivist theory, complexity science, and prior studies, the research team believed there was a direct link between the failure to successfully deploy fall interventions and the hierarchical culture present in most skilled nursing facilities. Colón-Emeric, who also serves as associate director – clinical program for the Durham VA Geriatric Research, Education & Clinical Center (GRECC), noted the vertical command structure doesn’t

foster broad-based, interdisciplinary staff interaction.

“They lack the connections with their coworkers that they need to share information and problem solve,” she said. “Nursing home staff tend to work in silos.”

Colón-Emeric continued, “Coordination of a multi-factorial risk reduction program requires a great deal of communication. Older adults don’t fall because of one risk factor … they fall because of five or six factors. To reduce risks, you have to intervene on all of those things.”

She added reasons for a fall might include any number of factors from a long, diverse list ranging from poor vision and tripping hazards to a drop in blood pressure upon standing or suboptimal choice of an assistive device.

“In order to improve fall rates,” ColónEmeric said, “the team needs to know what the resident’s behavior is like.”

However, the person with the most hands-on knowledge often isn’t the one creating that resident’s specific care plan.

Colón-Emeric pointed out aides deliver the majority of care in the nursing home setting. Yet, nurse aides aren’t typically part of the decision-making process and are often expected to communicate only within the chain of command. “They are less likely to implement the care plan if they haven’t been involved in making it in the first place,” she noted.

In an article published in Implementation

HELP PATIENTS QUIT. Refer your patients to the American Lung Association for smoking cessation options.

For questions or more information, contact Laura Frick at 314.645.5505 x1014 or lfrick@breathehealthy.org.

12

>

JUNE 2013

Science last year, the research team said QI programs could not reach optimal levels of staff behavioral changes unless the context of social learning was present. The team developed the CONNECT educational intervention to foster improved connections within and between disciplines, heighten communication flow and encourage cognitive diversity in solving problems on behalf of residents.

The next step was to see if the ‘all hands on deck’ approach made a difference in fall rates in comparison to traditional QI initiatives that focus on an individual’s mastery of content and process change.

Colón-Emeric said eight nursing homes in North Carolina and Virginia were selected with half randomized to receive three months of CONNECT training followed by three months of a traditional falls QI program and the other half receiving only the QI program training. The eight participants included a mix of community nursing homes and VA facilities.

The CONNECT intervention included interactive in-class learning sessions, unit-based mentoring and relationship mapping. All activities were focused on helping the staff build networks and relationships for problem-solving activities.

“We designed the CONNECT intervention to show staff where their communications weren’t working … where gaps existed … and to teach them some practical tools to better communicate,” she explained.

Post-intervention, three areas were reviewed for both the CONNECT and control groups — staff communications measures, charting, and fall rates. ColónEmeric said to measure communication, the team used surveys before, during and after the intervention. The team also reviewed documentation of the types of prevention interventions in the medical record.

Fall rates, she added, were viewed as an exploratory outcome in light of the small number of study sites.

“What we found was that the staff communication levels improved a little bit in the CONNECT group but decreased in the control facilities,” she said, adding the net result was significant. Among the CONNECT group, increased communication was more pronounced in the community settings, as Colón-Emeric said the VA facilities already had high levels of communication.

Charting turned out to be a non-factor. “Both groups improved a little bit and neither was significant,” she said, adding improved documentation did not correlate with decreased falls. “We don’t think the chart measures are really a good measure of what is happening at the bedside … at the site of patient care.”

As for the most important outcome — preventing falls — Colón-Emeric said the team saw the desired trajectory. “There was no change in fall rates in the control group, but the fall rate in the CONNECT facilities improved … they went down about 12 percent,” she said.

Colón-Emeric was quick to temper the significance of the outcome in light of the small number of participating study sites.

However, she said the group is now in the second year of a larger trial of 24 nursing homes with 12 each in the CONNECT and control groups.

“If we see the same magnitude of benefit, that would be statistically significant.”

She continued, “We should be finished with our last nursing homes in 2014 and have the results out shortly thereafter.”

Colón-Emeric added that if the improved collaboration is proven to positively impact falls QI initiatives, then it would be reasonable to apply the same tactics to other multi-factorial issues facing America’s growing senior population.

Falls Hurt Physically & Financially According to the Centers for Disease Control & Prevention, one in every three adults age 65 and older falls each year. In this age group, falls are the leading cause of injury death and are the most common cause of nonfatal injuries and hospital admissions for trauma.

In 2010, 2.3 million nonfatal fall injuries among older adults were treated in the emergency room with more than 662,000 requiring hospitalization. The direct medical cost of these falls, adjusted for inflation, was estimated to be $30 billion.

A Sense of Independence continued from page 10 uum of services, your monthly fee does not increase,” Gjullin said of a unique aspect of Life Care Services. In comparison to a skilled nursing facility where a room could cost $300-$400 a day, those who transition within the CCRC continue to pay their monthly fee … for a couple in an apartment-style residence that typically runs under $200 a day and under $100 a day for an individual in a one-bedroom apartment. “If you wanted to preserve your assets, what other program would you select?” he questioned.

Again, Gjullin stressed, the goal is to keep seniors spiritually, physically, mentally and emotionally healthy for as long as possible to enjoy the array of options that come with this type of community.

On any given day, seniors can be found attending a yoga class, planning community outings, choosing from chef-inspired cuisine, working out in the fitness center, sipping cocktails with friends or enjoying a relaxing manicure.

“Our philosophy is choice, flexibility, and control,” Gjullin said. “That’s what we offer people who live here. That’s what seniors want. They didn’t get to the point where they could afford to live in a community like this and not have that as a basic philosophy.” stlouismedicalnews

.com

GUARANTEED

CLICUGKH-S

THRO

Get verified results (impressions and/or clicks) for (LOCAL) online advertising.

Increase web traffic

Powerful branding opportunity Any metro market in the U.S. Preferred, certified brand-safe networks only Retargeting, landing pages, SEM services available DIGITAL@SOUTHCOMM.COM stlouismedicalnews

.com

JUNE 2013

>

13

GrandRounds Two St. Louis Doctors Elected to MPM Insurance Company of Kansas Board of Directors

Two distinguished St. Louis-area physicians have been elected to the board of directors of MPM Insurance Company of Kansas, a subsidiary of St. Louis-based Missouri Professionals Mutual (MPM), Missouri’s leading provider of medical professional liability insurance. The new board members are: • Jacques A. Herzog, M.D., of Chesterfield, an Assistant Professor of Clinical Otolaryngology at the Washington University School of Medicine, and a member of the Board of Dr. Jacques A. Managers of the Central Herzog Institute for the Deaf.

• Lawrence E. Samuels, M.D., also of Chesterfield, a Board Certified Dermatologist, Chief of Dermatology at St. Luke’s Hospital, and a member of the teaching faculty at Washington University Medical School.

Dr. Lawrenc E. He has provided expert Samuels dermatological care to patients for nearly 30 years, and is widely respected as a leader in his field.

MPM-Kansas was formed in 2010 and acquired last year by St. Louis-based MPM, which was founded in 2003 to help control the escalating costs of professional liability insurance for medical practitioners across the state. It focuses on support services and competitive pricing for doctors’ liability insurance.

Mercy Clinic Welcomes New Physicians

Mercy Clinic, the multi-specialty physician group affiliated with Mercy Hospital recently added new doctors.

Leonard D. Gaum, MD, previously in private practice, joined Mercy Clinic forming Mercy Clinic Urology, located on South New Ballas Rd. Dr. Gaum will continue in his role as chairman of the Department of Urology for Mercy Hospital St. Louis.

Paul Angleton, MD, joined Mercy Clinic and opened Mercy Clinic Family Medicine Wentzville, located on West Meyer Rd. He most recently served as family physician with Willamette Health Partners, part of Dr. Paul Salem Health, in Salem, Angelton Ore. Edward Ferguson, MD, joined Mercy Clinic Emergency Medicine and will care for patients in the Emergency Department at Mercy Hospital Dr. Edward St. Louis. He previously Ferguson served as medical director for the emergency department at St. Anthony’s Medical Center and as president of Emergency Physicians of St. Louis.

Gayathri Dundoo, MD, joined Mercy Clinic Adult Hospitalists St. Louis and will care for hospitalized patients at Mercy

14

>

JUNE 2013

Hospital St. Louis. She most recently served as a hospitalist at Christian Northeast Hospital.

Three faculty elected to National Academy of Sciences

Three Washington University in St. Louis scientists are among the 84 members and 21 foreign associates elected to the National Academy of Sciences this year. Election to the academy is considered one of the highest honors that can be accorded a U.S. scientist or engineer..

The university’s new academy members are: • Stephen M. Beverley, PhD, the Marvin A. Brennecke Professor of Molecular Microbiology and chair of the Department of Molecular Microbiology in the School of Dr. Stephen M. Beverly Medicine; • Robert D. Schreiber, PhD, Alumni Endowed Professor of Pathology and Immunology and professor of molecular microRobert D. biology in the School of Dr.Schreiber Medicine and co-leader of the Tumor Immunology Program at Siteman Cancer Center; • Joan E. Strassmann, PhD, professor of biology Dr. Joan E. Strassman in Arts & Sciences.

Beverley studies the biology of the protozoan parasite Leishmania, including virulence factors, host response and basic metabolic functions of the parasite.

Beverley earned his PhD in biochemistry from the University of California, Berkeley, and did postdoctoral research at Stanford University. In 1983 he moved to Harvard Medical School, where he eventually became the Hsien and Daisy Yen Wu Professor and interim chair of the Department of Biological Chemistry & Molecular Pharmacology. In 1997 he joined the faculty at Washington University School of Medicine as head of the Department of Molecular Microbiology.

Schreiber studies the intricate relationship between cancer and the immune system. With his colleagues, he has revived a century-old model of how the immune system interacts with tumors.

Schreiber earned a doctorate from the State University of New York at Buffalo in 1973. After a stretch as a postdoctoral fellow and faculty member at the Research Institute of the Scripps Clinic in La Jolla, Calif., he was recruited to Washington University in 1985. He received a Washington University Faculty Achievement Award in 2008.

Strassmann’s work focuses on cooperative alliances that have occurred at several important steps in the evolution of life that have proven evolutionarily and ecologically successful.

She received her PhD in 1979 from the University of Texas at Austin. From 1980 to 2011, Strassmann was on the faculty of Rice University in Houston, Texas,

where she was the Harry C. and Olga K. Wiess Professor in the Department of Ecology and Evolutionary Biology. In 2011, she became a professor of biology at Washington University.

St. Louis Senior Care Organizations Improving Healthcare Delivery and Cost

While U.S. hospitals and physicians have moved rapidly to install electronic medical records (EMR), the senior health services sector has moved more slowly. In St. Louis, Missouri, two leading long term care organizations are making strides to advance the cause of digital records. St. Andrews Resources for Seniors System and St. Agnes Home have jointly formed the LTC Collaborative for EMR. With their IT strategy partner, INNOVA Health Solutions LLC, the providers are proceeding to identify their priority needs and business requirements for an EMR. The LTC Collaborative joins six prominent long term care facilities; the majorities are members in the Leading Age professional association for Long Term Care facilities. The facilities total more than 520 Skilled Nursing or Intermediate Care Facility beds. St. Andrews and St. Agnes Home also offer Assisted Living Facilities that serve 330 residents.

St. Andrews also offers retirement living facilities and home and community based service programs.. The long term care facilities include Brooking Park, The Sarah Community, Villa Theresa, St. Paul’s Home, New Florence and St. Agnes Home. The LTC Collaborative was formed as a Joint Operating Committee (JOC) arrangement allow the entities to jointly fund the study and selection an EMR.. The project is governed by senior management from both St. Andrews and St. Agnes Home. The LTC Collaboratve project has been developed as follows: 1. Three work teams were formed to reflect the major functional areas of clinical, operations and finance/information technology.

2. Each work team has developed an extensive list of over 150 detailed needs and business requirements from an EMR system ranging from patient assessments to MDS tracking, guest meal requests and financial reporting.

3. The work teams have then developed “scripts” or scenarios presenting de-identified complex cases. Each bidding EMR vendor then showed the provider reviewers how their system would support the loading of information and tracking of care delivery throughout the resident’s stay. Scenarios included functionality needed for clinical, operations and finance areas.

St. Andrews and St. Agnes Home are seeking to prevent costly returns to acute care hospitals and generally keep seniors healthy as possible through improved care coordination. Electronic records and communications can greatly support this effort. When physicians, nurses and managers can all access a common care plan of action to treat and support critical patients, health care providers can best eliminate the costly gaps in care that also allow patients to deteriorate.

PUBLISHED BY: SouthComm, Inc. CHIEF EXECUTIVE OFFICER Chris Ferrell PUBLISHER Jackson Vahaly jvahaly@southcomm.com ASSOCIATE PUBLISHER Larry Henry lhenry@medicalnewsinc.com Ad Sales: 314.917.6107 NATIONAL EDITOR Pepper Jeter editor@medicalnewsinc.com LOCAL EDITOR Lynne Jeter lynne@medicalnewsinc.com CREATIVE DIRECTOR Susan Graham susan@medicalnewsinc.com 931.438.8771 GRAPHIC DESIGNERS Katy Barrett-Alley Amy Gomoljak Christie Passarello CONTRIBUTING WRITERS Lynne Jeter, Cindy Sanders, Lucy Schultze ACCOUNTANT Kim Stangenberg kstangenberg@southcomm.com CIRCULATION subscriptions@southcomm.com —— All editorial submissions and press releases should be emailed to: editor@medicalnewsinc.com —— Subscription requests or address changes should be mailed to: Medical News, Inc. 210 12th Ave S. • Suite 100 Nashville, TN 37203 615.244.7989 • (FAX) 615.244.8578 or e-mailed to: subscriptions@southcomm.com Subscriptions: One year $48 • Two years $78 SOUTHCOMM Chief Executive Officer Chris Ferrell Chief Financial Officer Patrick Min Chief Marketing Officer Susan Torregrossa Chief Technology Officer Matt Locke Business Manager Eric Norwood Director of Digital Sales & Marketing David Walker Controller Todd Patton Creative Director Heather Pierce Director of Content / Online Development Patrick Rains St. Louis Medical News is published monthly by Medical News, Inc., a wholly-owned subsidiary of SouthComm, Inc. ©2013 Medical News Communications.All rights reserved. Reproduction in whole or in part without written permission is prohibited. Medical News will assume no responsibilities for unsolicited materials.

All letters sent to Medical News will be considered Medical News property and therefore unconditionally assigned to Medical News for publication and copyright purposes.

stlouismedicalnews.com

stlouismedicalnews

.com

GrandRounds SSM Health Care is committed to providing a better way to health

SSM Health Care has announced plans to invest $180 million over the next several years to transform and improve the health care experience for patients across St. Charles, Warren and Lincoln counties. The plan includes a number of interdependent projects that will make it even easier for members of the community to receive the care they need, when and where they need it.

SSM Health Care will begin to introduce aspects of this new model of care over the next several years. At the same time, the health system will focus on building the infrastructure necessary to support this vision.

Some of these planned investments include: A complete redesign of the campus at SSM St. Joseph Hospital West in Lake Saint Louis. A new patient tower with 70 additional beds and much needed expanded parking will complement expanded outpatient and acute care services. Specific focus is being placed on creating world-class maternity and pediatric programs in partnership with SSM Cardinal Glennon Children’s Medical Center.

A new state-of-the-art emergency department and outpatient center at SSM St. Joseph Health Center – Wentzville at the Wentzville Parkway entrance to the campus. The new facility will open in 2014 and meet the needs of this growing population.

The development of a new stateof-the-art outpatient campus in eastern St. Charles. Many of the outpatient services currently located at SSM St. Joseph Health Center will be expanded and relocated to this new highly visible and accessible campus. When this center opens, it will be designed to incorporate every detail necessary to provide a whole new patient experience to the community.

Opening additional SSM Urgent Care sites to provide even more convenience of location and hours for care.

Aggressive recruiting of additional exceptional physicians who view health care as a partnership and are ready to take their patient relationships to the next level.

SSM Health Care has been serving and growing with the community for more than a century; most recently completing $40 million in renovations on the campus of SSM St. Joseph Health Center in St. Charles. This vision is the next step in the organization’s commitment to the community.

Siteman Director Appointed Vice Chair of National Cancer Network

Timothy Eberlein, MD, director of the Siteman Cancer Center at Barnes-Jewish Hospital and Washington University School of Medicine, has been named vice chair of the National Comprehensive Cancer Network Dr. Timothy (NCCN) board of directors.

Eberlein

stlouismedicalnews

.com

The network, which comprises 23 of the world’s leading cancer centers, develops and updates guidelines for treating breast, lung, prostate and other types of cancer.

Siteman is Missouri’s only member of the NCCN, formed in 1995 to improve the quality, effectiveness and efficiency of cancer care.

Eberlein has been director of Siteman since its inception in 1998. He also serves as the Bixby Professor and Spencer T. and Ann W. Olin Distinguished Professor and chairman of the Department of

Surgery at the School of Medicine, as well as surgeon-in-chief at Barnes-Jewish.

Nerve stimulation for severe depression changes brain function

For nearly a decade, doctors have used an implanted electronic stimulator to treat severe depression in people who don’t respond to standard antidepressant therapy.

Now, preliminary brain scan studies conducted by researchers at Washington University School of Medicine in St. Louis

are beginning to reveal the processes occurring in the brain during stimulation and may provide some clues about how the device improves depression.

They found that vagus nerve stimulation brings about changes in brain metabolism weeks or even months before patients begin to feel better.

The findings will appear in an upcoming issue of the journal Brain Stimulation and are now available online.

PHYSICIANS BUSINESS CONFERENCE Tools for Success

SAVE THE DATES October 26 and 27, 2013 LOCATION Sheraton Westport Lakeside Chalet The complete Physicians Business Conference seminar program with details on each seminar along with registration information will appear in the July issue and on the web site of St. Louis Medical News.

Conference Committee

Sponsored by St. Louis Medical News, this unique educational conference will include more than 25 hours of individual seminars focused on multiple business topics needed by health care physicians and health care business managers.

Seminars will address business issues practitioners face on a daily basis as well as arm practitioners with the tools to solve future challenges. Companies and Institutions involved in creating seminars for the conference include:

Seminar attendees will receive Tools for Success…knowledge and insight into solutions for the many challenges and changes facing today’s health care providers.

Washington University Physicians

Seminars are sold on an individual basis, giving attendees the ability to create their own educational experience. Early seminar registration is encouraged since seating is limited for each seminar.

Keystone – IT | MD Real Estate Advisors

New York Life | Missouri Professional Mutual Numerof & Associates | St. Louis University Sandberg, Phoenix & Von Gontard Brown, Smith & Wallace | Evans & Dixon Clifton, Larson, Allen | Fifth Third Bank

JUNE 2013

>

15