Science Matters : Winter 2012

science matters Winter 2012 / 2013

Keeping up to date with Syngenta Research & Development

Our Crop Focus Looking at the R&D innovations behind some of our solutions in

Vegetables and Rice

Contents 3 Our crop focus – rice and vegetables Introduction by Robert Berendes, Head Global Research & Development ad interim

6

4 Quality, quantity and efficiency in rice production Increasing production and consumer satisfaction in rice 6 Delivering on the demand for fresh vegetables Meeting the complex demands of vegetable markets around the world 8 Creating vigor and value from hybrid rice Developing hybrid rice varieties for high yield and pleasing taste and texture

10

10 Persistence breeds the perfect pepper Innovative plant breeding has created a seedless sweet pepper that is an award-winning, tasty snack 12 A SKEP in the rice direction Collaboration between Syngenta and IRRI is helping rice farmers to increase their productivity 14 Picture perfect vegetables How image analysis accelerates plant breeding 16 Transplanting Tegra™ into Latin America Combining quality seeds, growth media and new planting technology to boost rice production in Latin America

16

18 The full Monty The predatory mite with a taste for thrips and whitefly 20 Farm income grows with Foundation’s fresh approach The Syngenta Foundation India is transforming the lives of rice farmers who now also grow vegetables to produce an income 22 Meeting food chain standards Supermarket standards create complex problems for growers – Syngenta helps to solve them 24 Masters of their fate Predicting the fate of chemicals in the environment and ensuring sustainable disease control in rice 26 On the right track Radio-tracking of birds improves ecological risk assessments for crop protection products 28 Spotlight on Collaborations How external collaborations are driving Syngenta’s R&D in rice and vegetables 30 Editors comments The importance of hybridization between plants, and between ideas

26

Our crop focus – rice and vegetables Welcome to this second issue in the series of Science Matters focused on our crop research. In this edition we look in detail at rice and vegetables, both of which are vital global food crops as well as important sources of business for Syngenta.

Rice is critical to global food security – it provides 60% of the calorie intake for more than two billion people every day. Despite demand, progress in modernizing rice production hasn’t yet delivered the yields that will meet the worlds’ growing needs. A key focus for Syngenta is helping the millions of smallholders growing rice to increase its quality and productivity. We are developing complete crop solutions that help them deal with labor and water shortage, as well as pests and diseases. Syngenta has recently strengthened its commitment to the rice business by tendering a successful offer to purchase Devgen, a leader in the development of rice hybrids with improved yield, quality and stress tolerance.

Vegetables are grown and consumed worldwide, and represent a key element of the human diet with clear health benefits. Marketability everywhere is driven by local consumer tastes and value chain requirements, whilst production methods vary hugely from smallholders using open fields in the developing world through to large-scale, highly controlled glasshouses in Europe. Syngenta is integrating its breeding know-how with its chemical and biological crop protection controls to create new, high-value vegetables with improved quality and yield that enable the grower to satisfy the differing needs of traders, retailers and consumers across this complex landscape.

In the following articles, scientists working across the breadth of our R&D activities describe the use of cutting-edge technology and scientific approaches to solve the critical challenges in growing large quantities of high-quality rice and vegetables in a sustainable way.

Robert Berendes Head Global Research & Development ad interim

Science Matters Keeping up to date with Syngenta R&D

3

Quality, quantity and efficiency in rice production Rice is a staple food eaten daily by almost half the world’s people. More rice must be produced to feed growing populations, but its quality must be maintained.

Kee Fui Kon and Jihong Liang explain how Syngenta is developing integrated offers of new seeds, crop protection chemicals and agronomic protocols to help farmers achieve these objectives.

Rice is critical to food security. It comprises over 20% of the calories consumed worldwide. In Asia, where over half the world’s population increase is occurring, some countries rely on rice for 60% of their daily calories. Owing to a lack of technology and poor agronomic practice, productivity gains in rice have lagged behind those of other crops, and current yield growth will not meet future demand.

Rice is mostly eaten as a grain at table.

Across Asia consumers have different preferences; for example, sticky short-grain rice is preferred in Japan, whereas loose slender-grain basmati rice is preferred in India. Because rice is eaten unprocessed, its grain shape, color, texture, taste and aroma drive the market price. Hence farmers tend to forgo increased yield if the quality of these attributes is reduced. Milling quality is also vital: millers want whole grains after removal of the husk because broken grain can only be sold more cheaply for animal feed.

4

Constraints on production More than 200 million farmers grow rice across different agro-ecological zones, from temperate to tropical, with water availability and temperature the main factors affecting yield. Temperature determines how quickly the plant matures, and hence the number of crops that may be grown in a year.

Cold or excess heat lowers the fertility of flowers, which reduces the number of grains per plant. Water is even more important than temperature. Rice is either rain-fed or grown on irrigated lowland, and too much or too little water creates problems. Lack of water combined with heat stress is particularly damaging to yield.

Other factors reducing productivity include snails, birds, rats, weeds, insects, diseases and nutrient imbalances. Furthermore, increases in seed weight may cause plants to fall over (“lodge”) and become difficult to harvest. Finally, rice production is labor intensive with the majority of the crop

Science Matters Keeping up to date with Syngenta R&D

transplanted into the field by hand during a 15-45 day period. As workers migrate to cities, labor availability decreases and costs increase.

Where Syngenta R&D comes into play “Achieving step changes in rice productivity and quality is our goal, and we aim to double yields by 2020,” says Kee Fui Kon, Rice Crop Protection R&D Lead. “Our focus is on rain-fed and irrigated lowland rice, where the rainfall pattern is favorable, because these areas will drive increased output. Our broad range of technologies, and Syngenta’s agronomic protocols, allow us to solve the main problems farmers face.”

Rice is a self-pollinating crop and inbred varieties are widely used. Despite having significantly higher yield than inbreds, hybrids have only been adopted on a small scale outside China, as they have lower quality. Syngenta is investing in hybrid rice to develop

Syngenta accelerates rice strategy In December 2012 Syngenta announced that its public offer to acquire Belgian company Devgen, a global leader in hybrid rice and RNAi technology, has been successful and that the integration will go ahead. This deal enables us to combine our leading crop protection portfolio and advanced breeding technology platform with Devgen’s best-in-class hybrids and broad germplasm diversity, which will provide opportunities to accelerate the development of integrated solutions. varieties that will meet consumer needs, as well as varieties that mature more quickly and therefore need less water (see article on p8). Research focuses on conventional breeding for disease resistance, to prevent lodging and to manage submergence during floods, and on genetic modification for insect resistance.

The GroMoreTM rice team won the prestigious

Kee Fui Kon

Purpose Award in the Syngenta Awards 2012

Rice Crop Protection

for their work in ensuring that GroMoreTM

R&D Lead

becomes the platform for our integrated strategy for rice and for their work in changing rice growers’ lives in rural communities across Asia.

Kon studied Agricultural Science at Massey University in New Zealand and completed his PhD in Weed Science at the

While new varieties are developed, crop protection chemicals will remain the front-line technology for protecting yield from pests and disease. Using newer, more selective chemistry and optimizing the number of applications lessens environmental impacts, protects beneficial insects and increases farmers’ incomes. Foliar application of chemicals remains important, but seed treatments are increasingly used. They reduce labor costs and problems arising from poor application methods. Treating the seed provides protection for the seedling through germination and transplantation, and encourages the vigorous establishment of the crop in the field.

Integrating our offer “Combining technology and agronomic know-how is at the heart of our customer solutions,” says Kon. Syngenta has developed bespoke agronomic and crop protection programs for a range of elite varieties and hybrids for differing production environments. The programs vary from the foundation of GroMore™ – a method to deliver precise amounts of crop protection chemicals and encourage beneficial insects – in the developing world, to more complex solutions for high value markets, which address specific value-chain requirements for residue and environmental management.

University of Western Australia. He joined a Syngenta predecessor company in 1990 where he

Syngenta has also introduced Tegra™, a complete crop solution that represents a step-change in rice production (see article on p 16). Additionally, researchers are already evaluating the next generation of innovative planting solutions.

led herbicide development for 10 years. He then became the APAC Business Manager for selective herbicides and rice. In 2005, he moved to New Zealand with his family and managed the arable crop business. In 2008, he came to Singapore and worked in insecticide development and then on Tegra™. Currently, he is the Rice R&D Crop Business Partner and Crop Protection R&D Lead.

Accelerating development With the rapid changes in production technology in rice, educating farmers is a key strategic requirement. Local agronomists provide farmers with knowledge that increases the productivity of their land and opportunities for developing their business. Increasingly, help will become available from electronic tools that take local environmental data and advise farmers on necessary actions through mobile technology.

sm

Contact:

kee_fui.kon@syngenta.com

Jihong Liang Head Rice Seeds R&D

Jihong has a BS in Microbiology from China

Finally, collaboration is vital in the efforts to improve rice production. “Combining strengths across public and private sectors provides the best products for farmers, and our work with the International Rice Research Institute (IRRI) is very important,” explains Kon. “We have set an enormous challenge for ourselves, but early indications from our own, and our partners’ work gives us confidence we can deliver the output that the world needs.”

Agricultural University and a PhD in Biochemistry from the University of Wisconsin-Madison. He also obtained an MBA from Keller Graduate School of Management in St. Louis, Missouri. He held various roles of increasing responsibility at Monsanto and Renessen LLC before joining Syngenta Biotechnology China (SBC) in 2009 as Head of Research Program and Business Development.

He became Head Rice Seeds R&D in 2012.

sm

Contact:

Jihong.liang@syngenta.com

Science Matters Keeping up to date with Syngenta R&D

5

Delivering on the demand for fresh vegetables Fresh vegetables are grown worldwide, but with a strong local focus as there is relatively limited global trade. Differing consumer tastes, value chain requirements and production constraints across the globe make vegetables a complex, but rewarding, set of problems for Syngenta R&D, as Franz Doppmann and Dan Fox explain.

Global fresh vegetable production, currently valued at $500bn, is growing strongly, driven by population growth, increasing prosperity in emerging markets, and greater awareness of the link between diet and health. Most of this growth is expected in Asia, which already produces 65% of global output.

Asia has many small-scale growers, with limited education and poor access to commercial markets. Production is often in open fields, using limited technology in seed and crop-protection inputs, resulting in poor yields. The lack of technology, coupled with population

6

growth, makes Asia a key opportunity for development.

By contrast, in the profitable developedworld markets, growers use the best seeds, advanced agronomic practices (often in protected environments), and tailored crop protection programs to deliver high-quality produce. Here, consumers drive market development by seeking new products that have the right taste and texture, are convenient to use, and meet increasingly stringent human and environmental safety standards.

Science Matters Keeping up to date with Syngenta R&D

Agronomic problems and consumer demands Despite variation in production environments, growers face common problems: optimizing yield, maintaining reliability of supply, and maximizing profitability. Solutions to these problems include accessing high-quality seeds, reducing labor costs, protecting the crop from pests and diseases, managing abiotic stresses, and optimizing plant nutrition. Fungal diseases sometimes cause complete loss of a crop, and are an increasing problem as production intensifies.

Insects cause direct damage as well as transmitting viruses. Finally, resistance management is critical to ensure that existing control methods remain effective.

Growers must also meet value chain requirements. To meet consumer demands, retailers want vegetables with attractive appearance, long shelf life, consistency of supply and specific residue standards. Traders, who link growers and retailers, want uniformity of shape and good transportability to minimize waste. Failure to meet these requirements may cause rejection of the crop at harvest, resulting in high wastage and significant losses to the grower.

“Meeting many complex needs in a single crop, and growing it productively and profitably, is the fundamental challenge for growers,” says Franz Doppmann, Vegetables Crop Protection R&D Lead. “With its broad range of seed varieties, traits, crop protection, seed care and biological controls combined with agronomic know-how, Syngenta is uniquely placed to support them.” Dan Fox, Head, Vegetables Seeds R&D, continues: “We can use our seed and crop protection solutions across all production environments, maximizing learning and tailoring our solutions to local needs.”

Our seeds solutions Vegetable breeding is focused on tomato, sweet and hot peppers, brassicas, watermelon, cucumber, squash, sweet corn, okra, melon, lettuce, spinach, beans and peas.

The primary objective in all crops is providing the right varieties for growers to meet value-chain needs and sell their crop. Syngenta’s breeders use germplasm from around the world to create new varieties that solve local production problems and meet market requirements. Syngenta also invests in hybrid breeding to increase the yield and reliability of key crops. Hybrids have transformed the products available to growers and consumers, and generated significant increases in profitability, especially in emerging markets.

Introduction of native (that is, not genetically modified) traits is a key strategy. Input traits provide control of pests and diseases, resistance to abiotic stressors, such as shortage of water, and influence plant physiology.

Output traits improve yield and quality; for example, flavor, shelf life, shape and color of the consumed part of the crop. Combining several traits into a single product is complex, especially as each trait is often the product of many genes. Using advanced marker-assisted breeding (MAB) techniques, researchers can track genes associated with traits and so accelerate breeding. As Dan points out, “Using MAB and working in a coordinated way, we can share traits knowledge across our strategic crops and bring innovations to market faster than ever before. We especially focus on traits with applicability to many crops to maximize impact.”

Our chemistry solutions Protecting growers’ investments in high-quality seed by effective pest and disease control is crucial. As Franz explains, “Our fungicides and insecticides are important tools and development of new active ingredients remains a core area of research. We take a strategic view, by developing new products with many uses that are registered widely. This simplifies the range of products growers need and supports trade.” In addition to foliar sprays, seed treatments are increasingly important. Seed-care products have an excellent environmental safety profile owing to their targeted application.

They support effective early crop establishment, which is vital for crop uniformity and saleable yield at harvest.

Managing the risk of resistance to chemicals and traits is a continuing problem. Syngenta can offer combinations of traits and chemicals with different modes of action in order to minimize selection pressure.

Biological controls, such as bacteria, fungi and mites, provide alternative pest and disease control, further supporting resistance management.

Beyond pest control Syngenta also drives yield improvement through crop enhancement research and by sharing agronomic know-how.

Crop enhancement uses genetics, rootstocks, and chemicals that shift plant metabolism, in order to help a crop withstand abiotic stressors and increase yield. Agronomic know-how is shared through carefully tested protocols that define growing media, nutrients, water, light and heat for specific varieties to maximize yield. In emerging markets, educating growers who lack the agronomic knowledge to improve yields, dramatically improves

productivity, increases wealth and drives further improvements in agriculture.

In the complex world of vegetable production, combining advanced technologies and agronomy will ensure cost-effective, sustainable growth in production. Balancing global scale with local specificity is the challenge for R&D and marketing alike. As Dan comments, “Enabling collaboration across crops and geographies is the key human element in our strategy. Developing and integrating our technologies will provide a stream of innovative scalable solutions across the globe.”

Franz Doppmann Vegetables Crop Protection R&D Lead

Franz studied agronomy at the Schweizerische Fachhochschule für Landwirtschaft in Zollikofen, Switzerland and graduated with a BSc in plant production and a specialization in education and training. He joined the company in 1985 and worked in various management roles in Field Biology and R&D, in locations around the world.

Currently he is Vegetables Crop Protection R&D Lead and Global R&D Business Partner.

sm

Contact:

franz.doppmann@syngenta.com

Dan Fox Head, Vegetables Seeds R&D

Dan studied Marine Biology as a first degree at the University of Portsmouth and then moved onto doing a PhD in protein/protein interactions. After five years of post-doctoral studies investigating HIV-1 protein interactions he joined AstraZeneca. Over the next 8 years he established the Protein Science group at Jealott’s Hill working closely with Seeds Regulatory Affairs and Crop Protection Discovery.

He then moved into integration management before being appointed Head Lawn and Garden R&D. Currently he is leading the Vegetables Seeds R&D organization.

sm

Contact:

daniel.fox@syngenta.com

Science Matters Keeping up to date with Syngenta R&D

7

Creating vigor and value from hybrid rice Hybrid seeds currently offer the only proven way to increase the fundamental yield potential of rice. In a world with increasing food requirements, capturing hybrid vigor in varieties that consumers want to buy is the focus of Syngenta’s breeding program, as Kini Vittalaraya makes clear.

High-yielding inbred rice varieties are currently planted across the majority of the world’s rice-growing areas.

Whilst these varieties have provided substantial gain in yield in the past, productivity has now reached a plateau.

If we are to meet future demand, an increase in the genetic yield potential of the seed, most easily accessible through hybrid development, is required.

(see diagram). As well as having new combinations of traits, hybrids tend to be more vigorous than either parent, a phenomenon called heterosis. In general, heterosis increases as the genetic difference between the parental inbred lines becomes larger. Heterosis gives hybrids the potential to yield between 15 and 20% more than inbred lines grown under similar conditions.

China is the only country growing substantial quantities of hybrid rice, where it constitutes 60% of production.

After the famine in the early 1970s following the Cultural Revolution, the Chinese government invested heavily in hybrid rice research and mandated hybrid use. The first commercial hybrids were launched in 1976 and yields are now typically 7-10 t/ha, with Chinese researchers currently working on a ‘super-hybrid’, targeting a yield of 15 t/ha. Hybrid rice has not been adopted in India, where yields are typically 3 t/ha, principally because previous hybrid varieties failed to satisfy consumer preferences in taste and texture.

Rice has male and female organs in the same flower, meaning that in normal circumstances almost all rice seed is formed by self-pollination. To create hybrid rice, seed formation by selfpollination must be prevented. Syngenta uses a Cytoplasmic Male Sterility (CMS) system for rice hybrid development.

Creating hybrid rice with an acceptable taste for local consumers, at a price that creates an improved return on investment for the farmer, is the objective for Syngenta’s hybrid development team.

Hybrid breeding biology Hybrid rice is created by crossing two inbred varieties having characteristics that the breeder wishes to combine

8

In plants with CMS, genes in the mitochondria prevent the formation of fertile pollen: these plants act as the maternal parent during hybrid formation.

The maternal parent is pollinated by the paternal inbred to create the hybrid.

The paternal parent contains genes in the nucleus that override the effect of CMS and restore male fertility, so that the hybrid is able to set seed; the paternal parent of the hybrid is called the restorer. Because the maternal parent of the hybrid has CMS, it must be perpetuated by cross-pollination with a male fertile line. In this case, the male line is genetically identical to the CMS line, apart from the absence of the mitochondrial genes causing male sterility; the paternal parent of the inbred line is called the maintainer.

Science Matters Keeping up to date with Syngenta R&D

Hybrid production using the CMS system is well-proven. Effective hybrid development using the system is dependent on the creation of CMS and restorer inbred lines with the widest possible genetic diversity to maximize heterosis.

Syngenta’s hybrid program The program has three main components: generating a diverse collection of varieties to create parental lines; selecting traits and fixing the parental lines to breed true; and generating and evaluating hybrids.

Syngenta has been able to collect many parental lines and evaluate their suitability for hybrid rice breeding, and continues to seek new local resources.

Lines are selected for development based on agronomic and grain qualities, and their adaptability to differences in production environments. Selected lines are advanced through several generations of inbred breeding until they are homozygous. At this point they are tested to confirm their ability to restore or maintain male fertility. It is vital that the restorer lines are ‘strong’ – they give fertile F1 hybrids with high levels of grain production – because despite increased yields, farmers are dissatisfied if some parts of the rice inflorescence produce no seed.

Unfortunately, many potential parental lines are not effective at restoring male fertility, making them unsuitable for development of hybrids. The number of effective restorer lines restricts parental

What is Hybrid Rice?

Pollen transferred from flowers of Line A to the flowers of Line B Line B produces no viable pollen. Seeds on Line B will be A x B hybrids

Inbred Line A

Inbred Line B

Male fertile: produces viable pollen

Male sterile: no viable pollen

Selected for disease resistance

Selected for insect resistance

Chromosomes

Chromosomes

Homozygous: red/red; blue/blue

Homozygous: pink/pink; black/black

In contrast, hybrids between inbreds combine traits from both parents, producing plants that are highly heterozygous; for almost every gene, both copies are different. This means that hybrid rice plants do not breed true. The combination of traits in the hybrid separates, giving highly variable progeny. Because hybrids do not breed true, they have to be continually recreated from the inbred lines by specialist seed companies, and sold to the farmer each year.

F1 Hybrid A x B Male fertile Disease and pest resistance; heterosis

Chromosomes Heterozygous: red/pink; blue/black

diversity available to hybrid rice breeders and this is limiting heterosis. To tackle this problem, Syngenta is working hard to increase knowledge of the genetic basis of heterosis.

The best parental lines are evaluated for their ‘combining ability’ (their capacity to produce better hybrids regardless of the other parental line used), resistance to disease, ease of production, and fit to market requirements. Native traits to protect against fungal disease are particularly important because hybrids are more susceptible to fungi than are inbred varieties. Continuing work with the International Rice Research Institute (IRRI) on the rice genome will help the search for such traits.

Hybrid rice is created by crossbreeding different parental strains of rice. Although such crossing can occur spontaneously in nature, rice breeders deliberately cross genetically distinct “inbred” parents to result in an F1 generation that combines improved agronomic qualities, for example disease and pest resistance. In addition, hybrids are often more vigorous than either parent, a phenomenon called heterosis. The combinations of improved traits, along with heterosis, mean that hybrids often have higher yield than inbreds. Inbred lines are created by several generations of self-fertilization and selection and are highly homozygous. This means that inbreds “breed true” – self-fertilization produces progeny identical to the parent. Rice farmers can collect and keep the seed for replanting next season.

Finally, the developed parental lines are used to create hybrids, with the best ones progressed to commercialization based on yield, grain quality, adaptability, pest and disease resistance and other agronomic qualities. Testing for the chemical properties that indicate cooking and eating qualities also drives the selection of hybrids for commercializing.

Kini Vittalaraya Rice Breeding Lead South Asia

Kini Vittalaraya was awarded a PhD in Plant Breeding and Genetics in 1993 from the University

Breeding rice hybrids is technically difficult owing to limited resources and complex needs. As Kini Vittalaraya, Rice Breeding Lead South Asia explains, “Working on improving genetic diversity and introducing new traits into elite germplasm will ultimately provide commercial high-yielding hybrids that meet consumer needs, and we are confident these will achieve acceptance into the market place.”

of Agriculture Sciences, Bangalore, India, where he specialized in sunflower breeding. He joined the reputed Indian Agribusiness company E.I.D. Parry in 1993 to anchor an emerging Hybrid Rice breeding project. This project was eventually taken over by Monsanto in 1998. He joined Syngenta in 2004 as Product Development Head, Rice.

Currently he is Rice Breeding Lead South Asia.

sm

Contact: vittalaray.kini@syngenta.com

Science Matters Keeping up to date with Syngenta R&D

9

Persistence breeds the perfect pepper Launched into the market in 2011, Syngenta’s new Angello™ sweet, seedless pepper is a breakthrough innovation. Created by clever conventional breeding focused on meeting consumer needs, it represents “a dream come true” for Benny Nir and Moshe Bar. Today, western consumers want food that is healthy and convenient to prepare, as well as enjoyable to eat.

Benny Nir, Senior Breeder at Zeraim Gedera, a Syngenta company in Israel, keeps close to the market to understand these emerging consumer trends, as well as grower and retailer requirements.

From long-running discussions with key supermarket chains, he knew that they wanted a seedless pepper to meet consumer demands for convenience.

Despite several companies working on this problem for many years, no-one had been successful, and this really motivated Benny to take up the challenge.

In botany, “fruit” refers to a plant structure that contains seeds, and may be adapted to disperse them. Normally, the initiation of the fruit follows pollination and fertilization, and fruit

development coincides with maturation of the seeds. Occasionally, however, fruit initiation occurs without fertilization and seed formation by a process called parthenocarpy, which may occur naturally, either because of the plant’s genetics or exposure to particular environments. Alternatively, parthenocarpy may be artificially induced by treating plants with agents such as plant hormones. In pepper, parthenocarpy could not be induced, despite treatment with agents used successfully in other crops. It seems the pathway to fruit setting in pepper differs from those of other crops.

“In peppers, natural parthenocarpy is known, but the fruits are small and of poor quality, and often only on part of the plant,” explains Moshe Bar, Head Strategic Projects, Vegetable R&D, also at Zeraim Gedera. “Reliably obtaining

large quantities of seedless fruits, across all of the plant, with the right taste, texture and quality, was seen as the ‘Holy Grail’ of pepper breeding, and became the focus of this project.”

Peppers are self-pollinating, but those cultivated for consumption are hybrids, created by manual cross-pollination.

Using this method, Benny began crossing plants of different types in order to create new genotypes that may have high parthenocarpy. He began eight years ago, using many old and new varieties he had collected from across the world. Because there were no known parthenocarpic peppers, and as the genes controlling the trait had not been identified, he had to learn to spot weak signs of parthenocarpy and to combine them to strengthen the trait. Six years ago, Benny managed to obtain the first plant that could be considered a seedless pepper.

AngelloTM won the Fruit Logistica Innovation Award

10

Science Matters Keeping up to date with Syngenta R&D

Early consumer response has been excellent, and the product won the prestigious Innovation Award at the 2012 Fruit Logistica trade fair.

An award-winning result Further research focused on combining the seedless trait with good taste and texture. Products were repeatedly tested with consumers to ensure improvement through each breeding cycle. Eventually, this persistence led to Angello™, a patented invention and the first commercial variety of seedless pepper.

Angello™ is a small, conical, red baby pepper, which may be eaten whole as a snack; it has a crunchy texture, is sweeter than regular peppers, and is high in vitamin C. How to produce reliably sufficient quantities of Angello™ has been a key problem. Because it is seedless, the pepper is produced for commercial use by vegetative propagation, with small plants sold to growers. Also, AngelloTM grows differently from other pepper hybrids; for example it is bushier, and fruit set is less sensitive to light. So, in parallel with the breeding work, agronomic research developed tailormade protocols to maximize yield.

The protocols recommend soil type, along with levels of nutrients, light, temperature and moisture. Pest control is provided by program of biological controls and chemical crop protection designed to meet retailers’ quality and residue standards.

Taking the program forward Following a successful launch of AngelloTM, the pepper team is focused on the next applications of the seedless trait. As Moshe points out, “The seedlessness trait we discovered is independent of pepper type, color, or taste, enabling us to patent it and to apply it widely.” One focus for the breeding program is developing new seedless pepper varieties, initially involving new colors of the baby sweet peppers, and then different types and sizes of peppers. Another critical focus is developing parthenoncarpic plants that yield at least as well as the seeded varieties. Work will also aim to deepen knowledge of the genetics of parthenocarpy in order to find markers that can accelerate breeding. Finally, to simplify production, the program is developing seedless varieties that can be produced from seed as well as vegetatively.

“It has been immensely satisfying to see an idea develop into a commercial product that people are enjoying,” concludes Benny. “The program has opened the door to a ‘seedless’ future for peppers.”

Fruit Logistica Fruit Logistica is the world’s leading trade fair for the fresh fruit and vegetable business. It is held each year in Berlin, where it attracts over 2,500 exhibitors and 56,000 trade visitors. All exhibitors are eligible to enter products for the Fruit Logistica Innovation Award (FLIA), the premier award of its kind in the fresh fruit and vegetable sector.

An expert panel selects the ten best innovations and trade visitors vote for their favorite at the fair.

In 2012, the 7th FLIA was won

by Syngenta’s AngelloTM pepper, beating products such as Achacha, a fruit from the Bolivian Amazon grown commercially in Australia, new varieties of purple sprouting broccoli and green cherry tomatoes, a machine for making desserts from frozen fruit, and a website allowing “salad lovers from all over the world to share their passion for vegetables and salads”.

Benny Nir

Moshe Bar

Senior Breeder

Head Strategic Projects,

AngelloTM provides certain agronomic advantages to growers. As Moshe explains, “Because the parthenocarpic fruit setting does not require pollination, we can use the trait as a tool to secure yield for the grower in extreme temperatures that would adversely affect normal pollination.” Along with diversion of energy into seed production, poor pollination is one of the main factors contributing to “flushing”: weeks of high yield followed by weeks of low yield.

Flushing creates problems for growers in maintaining a steady supply to the market and in assessing glasshouse labor requirements. As it requires no pollination and produces no seed, AngelloTM has potential to reduce flushing and give growers the consistency of yield they need.

Vegetables R&D

Benny (Binyamin) holds a BSc in Agronomical

Moshe holds a BSc, MSc and PhD in plant breeding

Economics and MSc in genetics and plant breeding

and molecular biology from the Hebrew University

from the Hebrew University of Jerusalem, Israel.

of Jerusalem, Israel. Moshe worked with Zeraim

Before his advanced studies, Benny worked for

Gedera as a tomato breeder and team leader for

20 years as a farm manager in a kibbutz. He joined

eight years, and later as a Vice President of R&D for

Zeraim Gedera (now part of Syngenta) in 1996

four years. When Zeraim Gedera was acquired by

as a pepper breeder, and for 10 years he was part

Syngenta in 2007, Moshe became an R&D Pepper

of the breeding group that developed blocky pepper

crop lead. Currently he is Head Strategic Projects,

varieties for passive greenhouses. For the past

Vegetables R&D.

seven years he has been the leader of three pepper breeding projects: Kapya, Rootstock and Seedless peppers.

sm

Contact:

benny.nir@zeraim.com

sm

Contact:

moshe.bar@zeraim.com

Science Matters Keeping up to date with Syngenta R&D

11

A SKEP in the rice direction Successful development and deployment of new technology to meet rice farmers’ needs requires the skillful blending of expertise from many scientific disciplines.

Building partnerships between organizations with complementary capabilities is vital for success. Syngenta has established an important collaboration with the International Rice Research Institute (IRRI), as Harish Gandhi explains.

Syngenta and IRRI aim to solve problems facing rice farmers in an economical and environmentally sustainable way. Both organizations provide integrated solutions comprising improved varieties (inbred and hybrid), novel traits, innovative use of crop protection, and good agronomic practice.

Despite having common approaches to similar problems, Syngenta and IRRI have different strengths. IRRI is strong in plant breeding: it has a large and

genetically diverse collection of rice, and access to a network of global agricultural research institutes. IRRI is highly respected by farmers and policymakers across Asia, owing to its leadership in rice agronomy across a range of production systems.

Syngenta has substantial expertise in rapid screening of crops for useful traits, developing commercial-scale molecular breeding programs, diagnosing problems in crop production, and accessing the market.

To benefit from these complementary strengths, Syngenta and IRRI started their “Scientific Know-how and Exchange Program” (SKEP) in 2009.

SKEP aims to strengthen rice breeding by extending use of rice genetic diversity and modern molecular breeding, improving disease management and building scientific capacity and capability in rice research.

The first research areas for the collaboration were the use of SingleNucleotide Polymorphism (SNP – pronounced ‘snip’) marker technology,

The goal is to build a set of SNP markers for every major trait of interest and make them publicly available.

12

Science Matters Keeping up to date with Syngenta R&D

and addressing productivity constraints in rice production systems.

SNP marker technology A SNP is variation in DNA sequence among individuals of the same species at a single nucleotide at a specific place in the genome. SNPs are abundant in rice, and are identified by comparing DNA sequences from different rice varieties. In marker assisted breeding, the focus is on finding SNPs that are associated with desirable traits, because they are near to or within a gene that controls them. These SNPs can then be used as markers to identify and track plants with desirable traits during breeding. Using markers, rather than the traits themselves, to select plants results in rapid and efficient selection of the best genotypes (see diagram).

The second SKEP project sought to demonstrate the utility of the identified SNPs for breeding plants with improved traits. Using the scientific literature, public SNP databases and DNA sequencing, the team identified SNPs associated with improved grain quality, insect and disease resistance, and improved response to abiotic stressors. The validated SNPs were then used in pilot studies to demonstrate their effectiveness in breeding. Other collaboration projects based on SKEP II are in progress.

In the first SKEP project, Syngenta contributed to the discovery of an extensive collection of SNPs across the rice genome.

Addressing productivity constraints Accurate knowledge of the productivity constraints in rice cropping systems is vital for directing the application of existing technology and for defining research objectives. With an increasing rate of change in agricultural practice, the provision of accurate, up-to-date information from farmers’ fields is a key objective.

“SKEP I has been very successful with both technical outputs and the development of a productive working partnership,” explains Harish Gandhi, Head Genetics and Traits Projects – Rice.

The final SKEP project used a characterization protocol to take quantitative measures of rice production systems, including the losses caused by pests and abiotic stressors at different growth stages of the rice.

Additionally, questionnaires were used to assess farmers’ perceptions of the key constraints on rice productivity, and their views of potential management strategies and tools.

Statistical analysis of the data helped to quantify the link between production systems and crop health problems.

A simulation tool was then used to model the potential yield impacts of different pest control methods.

Simulations enabled scientists to develop and then field test protocols to address pest problems. To increase the likelihood of their adoption, the protocols included elements based on farmer perceptions as well as on field data. The statistical analysis also provided a rich source of information to direct future integrated crop solution research efforts.

All three aspects of SKEP have been successful and the collaboration with IRRI is certainly due to continue.

As Harish says, “With these projects we are able to maximize the benefit of combining the diverse expertise of IRRI and Syngenta to accelerate solutions for farmers. I am really excited to be part of them.”

SNP Allele conferring strong disease resistance

ATAGCTCGTTACGATCGATCGTTACGATCGA TATCGAGCAATGCTAGCTAGCAATGCTAGCT

Harish Gandhi Head Genetics and Traits Projects – Rice

Allele conferring weak disease resistance

ATAGATCGTTACGATCGATCGTTACGATCGA TATCTAGCAATGCTAGCTAGCAATGCTAGCT

Harish has a BSc in Agriculture from Dr Panjabrao Deshmukh Agriculture University, and an MSc in Agricuture from Mahatma Phule Agriculture

A plant may have inherited different alleles

screen plants for variation in “molecular markers”

University, India. He holds a PhD in Crop Science

(versions of a gene) for disease resistance

close to, or even within, the disease resistance

from Oregon State University, and recently earned

from its mother and father. Its offspring will

gene. A common molecular marker is a SNP:

an MBA from the University of Iowa. Harish joined

inherit either the gene for strong or the gene

variation in DNA sequence among individuals

Syngenta USA in 2006, where he was actively

for weak resistance. A plant breeder may be

of the same species at a single nucleotide at a

involved in developing marker assisted breeding

interested in keeping only the offspring that

specific place in the genome. By searching for

platform for soybean and information system tools

have inherited the allele for strong disease

the version of the SNP linked to the strong

for genetic data analysis. For his current role he is

resistance. It may be time-consuming and

resistance allele, the breeder may efficiently

based in Hyderabad, India.

expensive to test for resistance to disease.

identify and retain plants of interest, and discard

A quicker and cheaper option may be to

the remainder.

sm

Contact: harish.gandhi@syngenta.com

Science Matters Keeping up to date with Syngenta R&D

13

Picture perfect vegetables Vegetable breeders manipulate numerous characteristics such as color, shape, texture and structure when creating new varieties. Traditionally, they have relied on assessments by eye to do this. However, as Rob Lind explains, image analysis can now provide precise quantitative data on large numbers of plants to speed up and focus breeding programs.

14

To produce successful new varieties, vegetable breeders must understand the market, grower needs and the full variation in their crop in order to define the ‘perfect’ plant. They then cross numerous parental lines over many generations to produce progeny with the desired characteristics.

This approach creates significant problems in obtaining discriminating data to make decisions on which plants to select for further use: individual assessors may score the same plants differently, with variation in location, assessment day and environmental conditions all affecting the scoring.

Usually, traits are assessed by the breeder qualitatively by eye, using a subjective numerical scale.

To make effective use of the rapidly increasing availability of genetic marker data, accurate quantitative measures of plants are necessary in order to enable

Science Matters Keeping up to date with Syngenta R&D

reliable statistical analysis of putative associations between traits and markers. Image analysis provides a rapid, cheap, and effective method of measuring the thousands of vegetables that must be evaluated in breeding trials.

Data capture using image analysis Recent improvements in the resolution of digital cameras, faster computer processing and increases in data storage capacity have made image analysis a viable option for research.

Associating desired traits with genetic markers helped significantly to speed up the development of new cauliflower varieties.

By capturing and analyzing plant images, it is possible to rapidly and precisely quantify any visual characteristics using continuous (non-discrete) and therefore more discriminating scales. Associations between the trait scores and variation in genetic markers may then be analyzed. Each image can be used to assess several characteristics, and provides a permanent record of the plant, which may be analyzed in the future for any new traits of interest.

Effective image analysis requires knowledge of the biology of the crop, software coding and effective lighting and camera set-up. Rob Lind, Imaging Technical Exert, summarizes the process: “Talking to the breeders in order to understand fully the characteristics they want to measure is vital. We can then develop coding which provides an accurate analysis of the trait from the image.”

The Image Analysis Network led by Rob has developed a standardized laboratory camera and lighting kit that is transportable between trial sites. The cameras require manual set-up, because automatic camera settings alter the picture parameters, making it impossible to compare the images. Image analysis can also be used outside in field trials: images are captured from a camera positioned at the end of a long pole that is walked or pushed on a trolley through the plant rows. Small drone aircraft, guided by GPS tracking, and which take visible or infra-red pictures of the field, are also used.

Assessing color using image analysis may be particularly difficult. The efficiency of the lab lighting system

varies over time, and the environmental conditions in field trials change constantly; both factors may affect the assessment of color. Standardization is therefore very important, and is achieved by using a calibration card in every image.

The computer compares captured and calibrated data and adjusts the image to standardize it. In the field, a calibration card may be attached to the camera or large cards laid down in the field.

Image analysis in crop assessment Cauliflower breeding has been among the first programs to benefit from image analysis. Several traits were assessed from photographs of freshly-harvested cauliflower; these included the level of self-protection (outer leaf coverage), the smoothness, area, diameter, circularity, depth, hairiness and color of the curd, and the number of individual florets. The most desirable traits, as determined by the breeder, then had to be quantified, the information connected with genetic markers, and the preferred breeding lines identified.

Image analysis is being adopted across Syngenta beyond its vegetable breeding programs. In the US, the corn breeding team has developed a phenotyping system based on image analysis that can assess traits of interest in up to 5,000 plants in an afternoon. Again, variation in the traits is linked to genetic markers to accelerate breeding. As Rob says, “Breeders put lots of thought into designing their trials, and it is very satisfying to give them meaningful, quantitative results which enable them to make better decisions. We are expanding the use of image analysis all the time and are keen to hear from anyone in the company who would like to use this technology.”

Quick Response (QR) codes Quick Response (QR) codes on individual specimens have been vital in using image analysis on thousands of plants. The codes are linked to information on the parental lines and the specific trial.

The QR code is captured in the image and the computer reads the code, using error-correction software for fuzzy or misaligned codes.

Once quantitative analysis of the desired traits is complete, the data are loaded into a table alongside the breeding pedigree and trial information, enabling cross-trial analysis and genetic association.

Importantly, QR codes are a standard size, and so can be used to calibrate and scale the images.

Rob Lind Imaging Technical Expert

Rob holds a BSc, MSc and PhD in biology, toxicology and insect pharmacology, respectively.

He joined Zeneca (a predecessor company of Syngenta) full time in 1998, after a studentship that started in 1993. Soon after joining he became interested in imaging technologies, and went on to implement them to evaluate biological screens.

This led to a wider use of image processing and analysis, and Rob now leads the Image Analysis Network within Syngenta to promote the use of image analysis in all business areas.

sm

Contact:

rob.lind@syngenta.com

Science Matters Keeping up to date with Syngenta R&D

15

Transplanting Tegra into Latin America

™

Rice is a staple crop in the Caribbean and in Andean countries of South America, where increasing its productivity is vital for maintaining growers’ competitiveness.

By introducing Tegra™ into Latin America, Syngenta will provide an important tool to help farmers improve yield and minimize risk, as Pamela González explains.

16

Science Matters Keeping up to date with Syngenta R&D

Rice is an important source of calories for many people in Latin America. In this region, approximately 200,000 farmers cultivate two million hectares dedicated almost exclusively to rice. Farm sizes, cultivation practices and yields differ across countries, with a variety of planting systems and different levels of technology. With increasing globalization, and broader free trade agreements, improving productivity is vital for rice farmers in Latin America, not only to improve food security, but also to compete with foreign growers who currently have higher yields and lower production costs.

Production challenges Farmers in Latin America face technical, environmental and social constraints.

Access to quality seeds can be problematic: there is a significant market in non-certified seeds, which have poor genetics, and are often contaminated with weed seed and fungal spores.

Climate change in the region has led to the development of new pests and diseases, increasing the need for innovative crop protection technology.

Herbicide-resistant weeds also pose an increasing threat to rice production.

Farming sustainably in Latin America requires careful water management and soil-care. Countries have “irrigation systems” that administer water access rights and farmers have to pay for their share to gain access. Because water shortage at any growth stage damages yield, maximizing the benefits from available water is vital to the whole community. Ensuring the soil is well maintained is also critical to ongoing yield development and sustainability.

Finally, continuing migration to cities means that there are significant labor shortages affecting transplantation of rice. Shortages of labor raise costs and increase the complexity of production.

Pamela González, Strategic Crop Specialties Manager, describes Syngenta’s approach to solving some of the problems in rice production: “The Syngenta rice team is looking to introduce a fully integrated solution that will help farmers improve productivity, manage limited natural resources, mitigate risk, increase competitiveness, and ultimately boost their income and quality of life.”

The Tegra™ solution The global rice team have developed and commercialized the Tegra™ solution in Asia. It was introduced in

“As we commercialize the offer in the future, we know this will lead to increased productivity and the improvement of our farmers’ quality of life.”

India in 2011 in states such as such as Tamil Nadu and Andhra Pradesh. The launch was successful, with average yields increasing by up to 30%. So far, Tegra™ has been used on about 10,000 hectares, and it is intended to increase that considerably in 2013.

There are plans to introduce Tegra™ across Asia, and pilots are underway in Bangladesh. The Latin American team is launching Tegra™ pilots to refine the program to meet specific local problems in various countries.

The Tegra™ solution starts with the production of robust seedlings for transplantation. This requires the use of high-quality certified seeds, treated with crop protection products, and grown in trays using special media. The pilots will determine the most effective seedling production protocols and growth media.

with implementation beginning shortly in Ecuador, and other countries in the future. They will trial all the elements in the program to establish the best combinations in each country considering climate, environment and farm size. The team will measure the impact of the program on yield, grain quality, cycle length, use of natural resources and costs to the farmers.

As Pamela explains, “By refining the program we are confident we will be able to increase the efficiency of production, improve grain quality, reduce dependence on manual labor, minimize risk and ensure effective use of natural resources.”

The second element of the Tegra™ solution is mechanical transplantation of the seedlings using specialized equipment. For commercialization, Syngenta will work with distributors in the countries to provide this service to the farmers.

The third element of the Tegra™ solution is the provision of GroMoreTM protocols and advice on water and nutrient management. The GroMoreTM protocols will be trialed in the pilots, and are likely to consist of soil-applied herbicide, along with fungicide mixtures and insecticide mixtures in order to control pests and diseases while minimizing the development of resistance. Nutrient management will be via soil and foliar fertilizers applied as needed based on an assessment of crop condition. Guidance on the best use of natural resources is a key element in ensuring sustainable increases in productivity as a result of the program. Water use will be monitored throughout the pilots to quantify benefits arising from the Tegra™ program.

Introducing the program Pilots are now underway in Colombia,

Pamela González Strategic Crop Specialties Manager

Pamela holds a bachelor’s degree in agronomic science. She has worked in the agrochemical industry since 1999. Pamela joined Syngenta in 2001 as a sales representative in Chile, and soon became Crop Manager for Fruit there. In her current role as Head of Specialty and Local Crops for North Latin America, she is responsible for developing and implementing the territory strategy for a group of crops, which includes banana, rice, potatoes, sugarcane and coffee.

sm

Contact: pamela.gonzalez@syngenta.com

Science Matters Keeping up to date with Syngenta R&D

17

The sachets release Monty into the pepper crop over several weeks giving an extended period of protection from thrips and whitefly

The full Monty Biological pest control is a vital partner to chemical control in integrated crop management programs, especially in the intensive environment of glasshouse production. Simon Foster describes how the development of a new predatory mite, affectionately known as “Monty”, has provided an effective new control of thrips and whitefly.

High-value fruit and vegetables are often grown in glasshouses. While glasshouses provide excellent conditions for plant growth, they also offer the perfect environment for pests to thrive: often year-round stable temperature and humidity, and plenty of palatable plant material. Intensive use of

18

chemicals with similar modes of action causes pests to evolve resistance and renders control ineffective. As the range of effective products narrows, the likelihood of resistance to the remaining ones increases. Using biological control agents – beneficial insects and microbes, and biopesticides

Science Matters Keeping up to date with Syngenta R&D

(active plant extracts) – alongside synthetic chemicals broadens the range of control measures, delays resistance and provides much more stable pest management. In addition, such agents help growers meet residue reduction targets, increase quality and improve environmental sustainability.

Syngenta Bioline (see side-box) produces predatory insects and mites.

Application of these products is laborintensive and they work best in the predictable climate of a glasshouse; therefore they tend to be used on high-value crops. The company’s latest biological control product is called Montyline am™ – Monty for short – derived from the species’ Latin name, Amblyseius montdorensis. Simon Foster, Technical Manager, Syngenta Bioline, explains its uses: “Monty is a predatory mite that gives superior control of thrips and whitefly, major pests that distort fruit and vegetables, blemish leaves and transmit viruses. It is more effective at lower temperatures than other predatory mites, providing extended protection early and late in the season.”

Production problems Monty is a predatory mite from Australia that feeds on other mites in stored products. Bioline scientists first obtained a culture of it in 1997, and noticed that it demonstrated excellent control of thrips and whitefly. However, further evaluation showed that in order to commercialize Monty, an efficient bulk production method was needed.

Raising a predator such as Monty requires a food chain, with the predator at the top, a pest organism as its prey and a plant food source at the bottom.

Initially the team used the industrystandard prey mite, Tyrophagus putrescentiae, as food for Monty.

However, Monty was not keen to eat it, because it was hairy and aggressive, and its vigorous population growth made the cultures inhospitable to Monty.

The breakthrough for production came when the team discovered an alternative prey mite, Thyreophagus entomophagus, known as “TE”. Less hairy, slow-moving, non-aggressive and with a slower reproduction rate, TE proved an excellent food for Monty.

However, culturing TE in large quantities was difficult because several factors had to be optimized: the density of starting and ending cultures, temperature, humidity, air movement, culture medium, CO2 levels and its diet. Simon describes the main problem in producing food for Monty: “TE is a fussy eater, and we had to test many diets to find one that worked.” Bioline scientists researched what TE eats in nature, and used that knowledge to find the right blend of fats, carbohydrates and

proteins in the food, and how to present food in a form the mites would eat. They also learnt how to optimize the living space of the culture.

With significant quantities of TE available, research into the production of Monty could begin. The first experiments worked with small cultures of Monty and TE, with the objective of establishing an effective predator: prey ratio to maintain a culture. Usually, effective ratios are about 1:10, but Monty cultures require a higher prey ratio because TE breeds slowly. The production started with very small culture volumes and had to be scaled up significantly, which required great skill in managing the delicate dynamics of keeping the culture productive. In addition, specially designed climate rooms had to be built to control factors, such as temperature and humidity, which affect production. Today, more than 4,000 liters of culture and 400 million mites are produced each week.

Taking Monty to market Monty has been tested on cucumber, aubergines, peppers, tomatoes, flowers and strawberries. It has proved successful in controlling whitefly and thrips on all the crops except tomato, which exudes a sticky substance that impedes predation. Monty eats more pest eggs and larvae than do other mites. It also works at lower temperatures, and establishes itself on the plants more effectively. Monty is applied by hand using a loose formulation, or via a sachet formulation that hangs on the plant. Mites emerge from the sachet over several weeks, providing extended control, and the sachets can also be hung before a pest attack as a preventative measure.

Regulations control the use of nonindigenous biocontrol agents. Before Monty could be released into glasshouses, it was vital to evaluate whether the mite would survive the winter, and its range of prey, so that ecological risks to non-pest species could be assessed by regulators.

Montyline am™ is now registered in the UK and The Netherlands, with further applications underway. “It has been a complex challenge to create Montyline am™, but we are very excited about the positive contribution it can make to effective pest control in glasshouses, and we are looking forward to extending its use into other countries”, says Simon.

Monty will eat a range of prey including thrips, whitefly and this two spotted red spider mite

Syngenta Bioline The company was founded in 1979 in Colchester, England. It was bought by Ciba-Geigy in 1992, eventually becoming Syngenta Bioline, following the formation of Syngenta in 2000.

Bioline has sites in the UK, USA, The Netherlands, Portugal and Spain where it produces insects and mites for use in integrated crop management programs to control pests in covered salad vegetables, soft fruits and ornamentals. It also produces bumblebees, which are used to pollinate tomatoes and soft fruit. In 2010, the company won the prestigious Queen’s Award for Enterprise for its outstanding contribution to the UK’s international trade. To find out more about Bioline, visit its website: www.syngenta.com/global/bioline

Simon Foster Technical Manager, Syngenta Bioline

Simon graduated in Environmental Biology from Anglia Polytechnic University in Cambridge in 1996.

He joined Novartis (a predecessor company of Syngenta) in 1998 as a production technician, where he worked on many beneficial insect and mite rearing systems. In his current role, he focuses on the technical management of insect and mite production at the Bioline UK and Portugal sites.

He also manages the production development team in the UK, seeking to improve production and learning to rear new predators and parasites. Simon took his BASIS crop protection exam in 2010 and won the Barrie Orme Shield – the award for the top candidate.

sm

Contact: simonfoster@syngentabioline.com

Science Matters Keeping up to date with Syngenta R&D

19

Farm income grows with Foundation’s fresh approach In India, 80% of farmers are smallholders farming fewer than five acres, but together controlling 40% of the arable land. Smallholders’ limited use of technology means that many are unable to move beyond subsistence farming. As Partha Das Gupta explains, Syngenta Foundation India (SFI)1 is committed to helping these farmers transform their lives through growing crops to produce an income.

20

Science Matters Keeping up to date with Syngenta R&D

Smallholders in India face significant problems in making farming economically sustainable. First, their plots are shrinking as each generation splits up its inheritance. Secondly, they lack knowledge of the technology available to increase yield: better varieties, new traits, modern agrochemicals and optimal agronomic practice. The situation is worsening as government agricultural advisors, who provide invaluable guidance, become fewer. Even when there is awareness of technology, it is often unavailable or too expensive because of reduced government subsidies and poor access to credit. Furthermore, poor management has caused the collapse of co-operatives that helped smallholders to source inputs and machinery.

SFI focuses on smallholders in some of the least developed areas of India.

Its aim is to educate and support smallholders in moving from just producing grain for their own consumption, to income-generating commercial farming. Growing high-value vegetables is one option for farmers to increase their income. However, as Partha das Gupta, Principal Advisor – Agronomy, Syngenta Foundation India, points out, there are several problems: “The difficulties in developing farming in these areas are many and varied: technological, economic and social.

Despite significant knowledge of Indian agriculture, and our confidence that productivity can be increased, we needed experiments to find the most effective ways to make this happen.”

The First Pilots SFI prefers to work with an existing, respected local non-governmental organization (NGO). Its first partner was Maharogi Sewa Samiti (MSS), a well-known NGO that rehabilitates leprosy sufferers by engaging them in agriculture. SFI used MSS land to test the potential for producing income by growing vegetables alongside grains.

During the pilot, SFI provided agronomic advice and hands-on training, while the fieldwork was done by MSS people.

The first year delivered a net income of 100,000 rupees from three acres – 100 times the monthly income of 1,000 rupees considered to be the poverty line. This success prompted SFI to introduce commercial farming on a second MSS site, where SFI helped MSS erect a rainwater storage tank, enabling a further 70 acres to be cultivated. It also provided a tractor

to help till the additional land, and an agronomist to supervise the work. Rice productivity increased and 40 acres of vegetables were grown, netting an additional 1.8 million rupees after three years of SFI support.

Building on the successful pilots, SFI began work in three new areas.

Working with local NGOs, SFI held meetings with smallholders to understand their problems and design programs to solve them. Partha explains SFI’s approach: “Finding an ‘early adopter’ can be hard, as smallholders are often reluctant to change their methods. If we can’t find a smallholder who is willing to work with us, we set up demonstration trials in the first year to show them vegetable growing can work.” Once smallholders had agreed to participate, they were trained, given access to inputs (often with some credit), and helped with water management (via rainwater storage, damming or equipment for lifting water from wells). All three projects delivered significant success: increased yields of rice, and production of vegetables that generated a cash income.

Partha explains further: “We learned a lot from this second round of pilots.

In particular, we found that smallholders are very good at using technology once it is explained and the inputs are made available. The pilots also demonstrated that vegetables could provide an income, even from very small plots.” With just under one tenth of an acre, smallholders can generate 10,000 rupees from a single crop grown in three and a half months. The pilots showed smallholders that using new varieties and improving use of fertilizer and crop protection products increases yield. They also demonstrated the vital importance of reliable irrigation. Finally, the plots showed that training alone was insufficient; demonstrations, continuing support, and credit availability are also vital for success.

Access to markets Another significant lesson was the importance of accessible markets.

When only a few smallholders are growing vegetables, a good profit can be made at local markets or even by selling at the roadside. However, once many smallholders take up vegetable growing, the local market can’t absorb the produce, and poor infrastructure makes it difficult for individuals to access wholesale markets further away. SFI has been working with the smallholders to

solve this problem by helping them form producers’ groups, so they can pool their outputs and ensure a reliable production flow. SFI then facilitated the grading and packing of the vegetables, so they remain in good condition during transport. Working with agents who inform the co-operative by telephone about the latest prices, the smallholders can send the produce to the market where they can expect to earn the best wholesale price.

Scaling, replicating and sustaining the success Partha emphasises continuity: “While our success is very exciting, it is important that the program can be extended and maintained after SFI leaves.” During the past two years, SFI has increased the number of smallholders involved, by working with the early-adopter farmers to “spread the word”. SFI has also found new NGOs to expand the program’s geographic reach. Sustainability is achieved by training smallholders to become seed producers, creating additional income, and by connecting them with large food producers, who give them contracts that guarantee their income. Finally, Partha emphasizes the long-term commitment to sustainability through education: “SFI and MSS have set up a school to teach advanced vocational agriculture to young people, and this year the first 53 students graduated.

We are very proud of them all.”

1

Syngenta Foundation India is the organization

that runs projects in India for the Syngenta Foundation for Sustainable Agriculture, in partnership with Syngenta India Limited.

Partha R Das Gupta Principal Advisor – Agronomy, Syngenta Foundation India

Partha gained his PhD from Saskatchewan. He joined Syngenta legacy company Sandoz to build up and head its Seeds R&D organization in India.

Later, he became the first biotech regulatory affairs manager for Novartis Asia-Pacific, and subsequently for Syngenta. After retirement, he became advisor to the company on biotech regulatory policy, and in 2004, initiated the activities of Syngenta Foundation India of which he is now Principal Advisor – Agronomy.

sm

Contact:

partha.dasgupta@syngenta.com

Science Matters Keeping up to date with Syngenta R&D

21

Meeting food chain standards Secondary standards defined by the food chain set residue limits below those established as acceptable by government regulators. Delivering the required quantity and quality of produce, while meeting these increasingly stringent residue targets, creates complex problems for growers, as Caroline Willetts explains.

Secondary standards have developed over the past eight years, mainly in the European Union (EU). Their origin lies in food safety scares and poor consumer confidence in government regulations.

Dramatic stories in the press can cause substantial damage to food brands and reduce sales for many months.

Consequently, the food chain has introduced residue targets beyond legal requirements – so-called secondary standards – and often uses them in marketing. Despite not making food safer, secondary standards are increasing in number and complexity.

Secondary standards are considered voluntary (because growers don’t have to sell to a particular buyer); therefore, international trading law can’t prevent them, unless they create a trade barrier that discriminates against a particular country or region.

Food chain approach Secondary standards focus on fresh fruit, vegetables, and sometimes on wine. To avoid exceeding EU Maximum Residue Limits (MRLs), UK supermarkets specify which pesticides are allowed, restricted, or banned for use on certain crops in particular countries.

Elsewhere in the EU, supermarkets may restrict residues to a percentage of the MRL.

difficulties for growers trying to work out how to meet the standards effectively and in an economically viable way.

Food processors also set standards, often requiring residues to be below 0.01 milligrams of pesticide per kilogram of food. This is the level allowed in baby food, and is also the limit of what can be quantified by analytical methods, in effect meaning that processors don’t want detectable residues.

Impact on growers Complying with secondary standards can help growers in the developing world to use products safely and gain access to world markets. Meeting these standards can also result in premium prices for growers everywhere.

Secondary standards may also cause production problems, as growers may need to change the way they manage their crop in order to comply. In attempting to reach standards, farmers may reduce use of crop protection products, resulting in lower yield and quality. In addition, limiting the variety and lowering the doses of chemicals increases the probability that pests and diseases will evolve resistance. Finally, to avoid residues at harvest, growers may apply crop protection products early, before any pests appear, possibly resulting in unnecessary applications.

However, secondary standards also cause growers significant problems.

Achieving the standards is often costly, and failure to meet them can lead to loss of contracts or fines. The food chain often simply announces new standards, with little or no consultation, and the standards may be hard to understand, implement and audit. This complex environment creates

Syngenta’s approach Syngenta believes there is no need for secondary standards because the regulatory framework has already established safety limits based on detailed science; halving a safe level doesn’t make it safer. Caroline Willetts, Technical Expert, Operator and Consumer Safety, explains what this means for Syngenta and its customers:

The ambition is to control pest and disease damage before and after harvest whilst ensuring that the residue profile is acceptable

22

Science Matters Keeping up to date with Syngenta R&D

Oasis – Supporting sustainable production in greenhouses Greenhouses are intense and dynamic production environments, and are vital in maintaining the quality and quantity of vegetables. As part of its Sustainable Intensive Agriculture initiative, Syngenta directed scientific partners to develop the OASIS program to help farmers continuously improve their greenhouse practice and performance to ensure operator safety and water protection.

Greenhouse production environments are diverse and complex. They range from basic plastic tunnels to sophisticated glasshouses that use robotic tools. They often have multiple, diverse crops growing side by side, and use a variety of cultivation practices – growing plants in the soil, in pots on a table or using hydroponics. Planting is very dense, and the hot, humid and stable environment encourages pests to flourish. Maintaining effective production requires regular use of multiple crop protection products and methods. Because of this diversity, it is important to understand the individual situation to manage environmental risks and ensure operator safety.

Syngenta worked with researchers from the Universities of Almeria and

“Effective production requires growers to use as much crop protection as is needed and as little as possible.

However, while the secondary standards remain, our focus is on helping growers manage them so they can access the market and ensure a good return on investment.”

As part of its Responsible Residue Management Program, Syngenta scientists are developing protocols that protect the crop, ensure environmental sustainability and enable crops to remain below the required residue levels. These protocols use the full range of Syngenta’s technology – seed varieties, native traits, chemical sprays, seed treatments, biological control agents (fungi and insects) and biopesticides (natural extracts used in purified form, such as fungal proteins) – and will include other companies’ products where needed to deliver an effective outcome for the grower.

Piacenza, and the Benaki Phytopathological Institute, to develop the OASIS progam, which helps growers to better understand the risks of pesticide exposure to workers and environment.

Through targeted advice, growers can improve practice, technical equipment and infrastructure over time to meet legal and food chain standards.

Growers first provide information in an online self-assessment questionnaire and receive an automated feedback on current standards. Then an onsite assessment takes a closer look at the individual situation, covering all stages of product use: storage, planning, mixing and loading, application, cleaning and washing, disposal of liquids, and disposal of solids. The program examines behavior, such as how gloves are put on and taken off, as well as structural aspects such as the machinery used.

The assessment helps the grower to understand the strengths and weaknesses of his current approach, based on a series of levels, from noncompliant to compliant to best practice. The review provides valuable new input, particularly on the behavioral elements that are intrinsically hard to self-assess. The

Developing these protocols requires highly controlled efficacy and residue field trials, which account for differences in climate and production methodology.

At the end of the trials, the produce is analyzed to assess whether residue levels would meet supermarket standards. The aim is to provide growers with a protocol and guidance that, if followed carefully, will secure sale of their produce into their market of choice.

assessor can provide targeted advice, such as improving spray nozzles or introducing more automation. Advice may also cover behavior, with educational materials available as fliers, videos, or training programs if needed.

The intention is that the program also includes a follow-up audit every couple of years, to ensure that growers are continuously improving standards of sustainable production.

The OASIS team has been piloting the program to test the concept and prepare for its introduction during in the upcoming season in Italy, Spain and Greece. Growers may join the program if they meet the minimum compliance levels and demonstrate a commitment to continuous improvement. As part of the introduction of OASIS, Syngenta is engaging with the food chain to demonstrate the benefits of the program in improving sustainable production in greenhouses. As the program is introduced, the team plans to maintain a database to monitor improvements, and identify any new problems that the program needs to solve.

sm

OASIS Contact: patrick.weiss@syngenta.com

Caroline Willetts Technical Expert, Operator and Consumer Safety

Caroline has a degree in Biological Sciences from the University of Reading specializing in microbiology. Her first job was working for the National

“An example of success with this approach is pepper production in Spain, where there had been a problem of residues exceeding MRLs,” says Caroline. “By following our protocols and combining chemicals with biological control agents, growers were able to solve this problem and re-establish acceptable production.”

With field trials during 2011 and 2012, Syngenta has also tested protocols for sustainable orchard management for apples, pears and grapes, and will extend them to other crops as needed.

Health Service at St Mary’s Hospital, Paddington, raising monoclonal antibodies to Gardnerella vaginalis (in the same labs where Fleming discovered penicillin, and where she says that she rediscovered penicillin there quite a few times herself). She joined Syngenta predecessor company ICI in Jealott’s Hill, in 1987, as part of the analytical chemistry group in Environmental Sciences, developing immunoassays to pesticides.

She is now responsible for Food Chain Liaison for the Human Safety group.

sm

Contact: caroline.willetts@syngenta.com

Science Matters Keeping up to date with Syngenta R&D

23

Masters of their fate Rice is grown using a variety of cultural practices. Predicting the environmental fate of crop protection chemicals in diverse environments is essential to the development of safe products. As Natalia Peranginangin explains, Syngenta’s Environmental Safety team in the US is refining methods for environmental risk assessment and advising on sustainable agricultural practices.

Rice cultivation varies among regions, particularly in how water is managed.

Practices vary from dry-seeding and subsequent paddy flooding, commonly used in the US, to transplant of seedlings and into already flooded paddies, which is common across Asia. Furthermore, rice is often part of a crop rotation program. The pattern of water use and potential effects on subsequent crops must be considered when developing crop protection protocols for rice.

Rice production is affected by a variety of pests, including fungi, insects and weeds. Farmers control these pests with crop protection products, such as foliar sprays, soil applications, granules, and seed treatments. Managing pests efficiently while minimizing the impact of management on the environment requires detailed risk assessments based on thorough knowledge of the toxicity of compounds, and also their environmental fate – how they move

24

and persist in the environment – to work out potential exposure to humans and wildlife. This knowledge enables risk assessors to provide guidance to researchers in the early stages of product discovery and development, ensuring that time and resources are focused on developing products that are safe to humans and the environment.

Assuming the worst Predicting environmental fate requires information on the how the product will be used and how it behaves in the environment following application.

The Environmental Safety team uses a conceptual framework (see figure) to analyze the key dissipation pathways following application of each product.

The team then feeds this information into a computer model of rice cultivation systems to estimate likely exposures and establish safe patterns of use for each product.

Science Matters Keeping up to date with Syngenta R&D

Initially, the team uses only a few crucial environmental fate data – for example, how the compound partitions between soil and water, and how quickly it degrades in water – and makes worstcase assumptions about product use – for example, the highest application rate, maximum number of applications per year and minimal interval between applications – so that the likely highest environmental exposures are identified.

This approach enables suitable compounds to be identified and developed into products.

Introducing some realism Worst-case assumptions allow compounds and use patterns that pose low risk to be identified quickly. However, if a potentially valuable compound fails the initial, unrefined assessment – that is, the risk is not shown to be acceptable – the next stage may include further modeling or experimentation to refine the risk assessment.

Refinement involves making more realistic assumptions about the behavior of the compound in the environment.

To refine risk assessments for rice, the Environmental Safety team uses a computer model that incorporates more factors than the initial modeling; for example, it includes application timing, paddy water management, and site-specific weather and environmental characteristics. Based on the output of the model, the team makes recommendations about how new products may be used safely, including the number, timing and rates of applications. These recommendations may then be used to design field tests for efficacy of the product under those patterns of use. The model was used recently to help in the development and use of fungicides that treat rice sheath blight, a disease that devastates rice production in the US. In addition to more refined modeling, sometimes further experimentation is necessary to gather data for refined risk assessments. Soil studies for seed or granule treatments can be particularly difficult. Soil sampling following sowing or planting is prone to significant error, because the number of seeds collected in soil samples following routine planting can be variable. This variability may result in estimates of dissipation rates that do not accurately reflect the behavior of a product in the environment. Syngenta has used a “precision seeding and sampling” approach in which a precise number of treated seeds is planted within a defined area according to the normal use pattern. Soil sampling is then carried out within this area, and seed material is separated from the soil, thereby improving accuracy of soil analysis. This method enables precise measurements of the concentration of compounds in soil, allowing improved predictions of the dissipation of compounds from seed treatments.

The environmental fate of a product is also affected by variation in environmental characteristics, such as soil structure and pH, and climate.

Using a geographic information system (GIS), the team is able to map these environmental and climatic conditions and ensure that products are modeled or tested under conditions representative of those in which they will be used. The team can also use this GIS information to provide advice on alternative use patterns when local conditions make that necessary.

AIR

Drift, Photolysis, Volatilization

CROP

Photolysis, Metabolism, Harvest

WATER

Hydrolysis, Photolysis, Metabolism, Discharge

SOIL/ SEDIMENT

Metabolism, plant uptake, leaching

Risk assessors use a conceptual model to estimate how crop protection chemicals will move in the environment following application to rice.

Products applied as foliar sprays may undergo spray drift or degradation by light (photolysis); they may move long distances after becoming a gas or vapor (volatilization); or they may be absorbed by the leaves and metabolized in the plant. Any spray that reaches the soil, either directly or through washoff from the foliage, may be dissipated through evaporation, degraded by hydrolysis or photolysis in the

Refining risk assessments Using data from experiments and applying computer models incorporating more realistic estimates of product use and behavior, environmental risk assessors can refine exposure estimates under field conditions. By combining the exposure estimates with data from laboratory or field toxicity studies, risk assessors can provide advice on application rates and timing for a range of uses and environments. As Natalia Peranginangin, Team Leader, Environmental Safety, explains, “The sooner we are involved with product development, the earlier we can provide advice on a product’s safety and its potential uses, focusing further research and development on compounds that will be efficacious and sustainable.”

paddy, or may move out of the paddy when the floodwater is released. Once in the soil, products may move into ground water, be degraded by soil microbes or other processes, or be absorbed in the plants’ roots and metabolized.

Laboratory testing during product development can give key indications of how products will behave in the environment and can provide valuable information for the use of the products. For example, tests can be conducted to measure rates of hydrolysis, photolysis, leaf absorption, plant metabolism and a product’s physical properties, such as its tendency to volatilize.

Natalia Peranginangin Team Leader, Environmental Safety

Natalia earned her Ph.D. in Biological and Environmental Engineering (formerly known as Agricultural and Biological Engineering) from Cornell University. After graduation in 2004, she joined Environmental Safety department at Syngenta as environmental fate modeller and risk assessor. She is currently a Team Leader in the Environmental Fate and Exposure group of the Environmental Safety platform, and the chair of Environmental Exposure Working Group (EEWG), an industry working group under Crop Life America..

sm

Contact: natalia.peranginangin@syngenta.com

Science Matters Keeping up to date with Syngenta R&D

25

Checking the signal before releasing a newly radio-tagged Yellow wagtail

On the right track Protecting birds from possibly harmful effects of pesticides requires careful risk assessments. Accurately predicting the potential exposure of birds to pesticides is a crucial part of these assessments. Roger Murfitt explains how knowledge of bird behavior obtained from radio-tracking is improving our predictions.

As agriculture has developed, and yields have increased and stabilized, the focus on environmental sustainability has sharpened. Predicting ecological impacts from the use of crop protection chemicals is essential for registration of these products. Risks to birds are particularly important, and are assessed by a combination of laboratory toxicity tests and estimates of field exposure.

Accurate estimates of field exposure through food consumption by birds are crucial, otherwise potential exposure to pesticides, and the risk to birds, may be overestimated.

Assessing risk to birds In Europe, the risk to wild birds from the application of a crop protection chemical is assessed by the Toxicity: Exposure ratio (TER) (see side box).

The TER compares the toxicity of the chemical to birds with the predicted

26

exposure of birds to that chemical following its use. Toxicity is measured in two ways. Acute toxicity studies look at the effects on survival of short-term exposure to high concentrations of the chemical. Long-term, or chronic, toxicity studies test lower concentrations of the chemical for effects on bird reproduction.

The TER is calculated by dividing a measure of the effect of the chemical – for instance, the concentration that causes 50% mortality – by the predicted exposure to the chemical; thus a higher value indicates lower risk. To meet EU regulatory requirements, TERs must exceed a value of 10 for acute and 5 for long-term risk assessments.

Risk assessment follows a tiered approach, screening out low risk products early to enable a focus on

Science Matters Keeping up to date with Syngenta R&D

those needing further detailed assessment. In initial assessments – so-called Tier 1 – the exposure calculation uses standard, worst-case exposure estimates, where birds are assumed to feed only on food items treated with the chemical. This is assumed to be the case even in longterm risk assessments considering feeding over several weeks.

Despite conservative assumptions about exposure, most pesticides pass Tier 1 assessments for acute risk to birds.

However, about 30% fail the Tier 1 long-term assessment, and thus require a more realistic, or refined, estimate of exposure. An important refinement is the introduction of additional factors into the exposure calculation, such as proportion of a bird’s diet obtained from treated areas, and the proportion of different food types in the diet, both of

Calculation and interpretation of toxicity: exposure ratios In Europe, the potential impact of use of a pesticide on wild birds is assessed by the Toxicity: Exposure ratio (TER). Toxicity is measured as the amount of the chemical that has a certain effect on birds.

Acute toxicity studies consider the effects of short-term exposure, and may estimate the amount of a chemical that causes 50% mortality (the lethal dose 50%, or LD50). Reproductive toxicity studies examine the potential effects of long-term exposure to the chemical on parents, eggs and chicks.

Initial estimates of exposure are made using an equation that provides a figure for the amount in milligrams of the chemical ingested per kilogram of body weight (bw) per day. This figure is the daily dietary dose (DDD), and is based on worst case assumptions, including that the birds’ diet comprises only items that have residues of the chemical: DDD = App rate x RUD x FIR/bw where DDD = Daily Dietary Dose (milligrams of active ingredient per kg of body weight per day) App rate = application rate of the pesticide active ingredient in kilograms per hectare RUD = standard residue concentration in fresh food after applying 1 kilogram per hectare FIR = food intake rate, the amount of food consumed per day bw = body weight of the bird An acute TER may be calculated as LD50/DDD. Values greater than 1 indicate that birds will be exposed to doses of the chemical that are lower than the LD50; for example, TER = 5 means that the birds will be exposed to doses five times lower than the LD50, and TER = 10 indicates the exposure will be 10 times lower. Thus, the higher the value of the TER, the lower the risk to birds. If the TER falls below a value that indicates acceptable risk, further evaluation is needed.

This often involves refining the assessment of the DDD with factors that take into account the birds’ real feeding behavior.

which can be measured by fieldwork.

Roger Murfitt, Technical Expert, Environmental Safety, explains the purpose of fieldwork: “The field studies must identify and study the bird species most at risk to assess the composition of their diet, and the proportion of time they spend feeding in a treated area.

Syngenta has worked hard, with experts in this field, to develop and establish leading methods for achieving this.”

Syngenta is committed to sustainable agriculture and to protecting the environment, as demonstrated in this intricate fieldwork that requires substantial investment.

Field methods A field study conducted in eastern England, where significant acreages of a wide variety of vegetables are grown, was able to cover several combinations of crops and crop protection products.

Having identified and agreed access to suitable farms, the first task was to identify focal species for further study.

Focal species are selected based on their frequency of occurrence in the crop and their size (smaller birds have higher food consumption rate relative to body size) in order to choose the most-exposed, most at risk, species.

Focal species are identified by expert observers surveying at least 20 fields per crop/country combination at three different times of the crop growth cycle, looking for species that are present in good numbers throughout the season.

In this study, woodpigeon, skylark and yellow wagtail were identified as the focal species in vegetable crops.

Field data on birds’ movement and behavior enables better quantification of the proportion of food that the focal species may ingest from treated areas.

In addition, analysis of feces, collected when the birds are caught, provides data on the food the focal species are consuming, and therefore a better estimate of the proportion of different food types in the diet. Together these data provide a more realistic estimate of exposure for use in the refined risk assessment.

Fieldwork involves monitoring the foraging behavior of the focal species.

It is not possible to make direct measurements of the amount of treated food a bird might ingest. Instead, risk assessment assumes that food intake from a particular crop field is proportional to the amount of time the birds spend foraging there, and hence it is possible to make an estimate of the proportion of diet from a treated area by tracking the birds’ movement and behavior. Tracking is achieved by catching birds and fitting them with temporary radio transmitters that enable field-based assessors to follow their movements in the landscape.

behavior; for example, active foraging, breeding, active but not foraging, or inactive. Every change in behavior and location is noted to the minute from dawn to dusk.

While this type of fieldwork helps to refine risk assessments, it is complex and costly, especially when the range of crops and countries across the EU is considered. As Roger explains, “Syngenta is committed to sustainable agriculture and to protecting the environment, as demonstrated in this intricate fieldwork that requires substantial investment. In future, we will try to simplify the assessments by agreeing focal species across agro-climatic zones with EU regulators, making any fieldwork more widely applicable.”

Roger Murfitt Technical Expert, Environmental Safety

Roger has a degree in Biology from Manchester University. After university, he worked for the Royal Society for the Protection of Birds on a temporary basis conducting surveys of wetland

Radio-tracked birds are caught either in the crop being studied or close by to ensure that a representative sample of the population that may be exposed is monitored. Tracking of the birds takes place over a full day for greater realism because shorter times could bias the result. Field workers aim to visually track the birds as much as possible, so that as well as knowing where they are in the landscape, they can classify their

birds. In 1984, he joined ICI in the Weed Control group at Jealott’s Hill Research Centre, UK, where he held a number of positions organizing glasshouse and field programs for herbicides.

In 2003, he took up his current role in the Environmental Safety group of Product Safety where he specializes in bird and mammal risk assessment.

sm

Contact: roger.murfitt@syngenta.com

Science Matters Keeping up to date with Syngenta R&D

27

Spotlight on collaborations Speedlings!

Sweeping up broomrape

Making tomatoes tastier

Seedlings that make the grade are sorted by image analysis and robotics

Species of Orobanchaceae, commonly known as the broomrape family, have jeopardized the cultivation of commercial tomatoes in many Mediterranean countries.

Broomrapes are flowering plants that have no chlorophyll and are totally dependent on their host plants for water, carbohydrates and other nutrients. Diversion of resources to the parasite causes serious loss of yield in the tomato host plants.

Have you ever wondered why tomato varieties differ in taste… and some are seemingly tasteless? Tomatoes have traditionally been bred for traits such as shelf life and uniformity rather than flavor.

Tomatoes taste best when they are very ripe, but by this stage they are often soft, difficult to transport and do not last long on supermarket shelves.

Image analysis and robotics are transforming the speed at which seedlings are graded at nurseries, thanks to a collaboration with Food & Biobased Research, part of Wageningen University and Research in the Netherlands.

Nurseries require seedlings to be of a consistently high standard, and sorting out the best ones by image analysis used to be very labor-intensive, time consuming and expensive. This is because plants have a complex 3D architecture, making it a challenge to capture them from just a single view point.

However, the software developed through the collaboration allows a rapid and accurate 3D reconstruction of every plant – automatically recognizing organs such as the cotyledons, stems and true leaves.

The seedlings are taken by conveyer belt past 10 cameras which film the seedling at many different angles. Using 3D-vision techniques, a 3D model of each plant is then evaluated on many different size and shape parameters. Those plants that make the grade are separated out for growing on.

This whole analysis process is completed in a breath-taking 30 milliseconds and enables an extremely high throughput of 18,500 seedlings per hour! This is a good example of how image analysis is allowing a truly quantitative, non-subjective seedling assessment, ensuring that standards are accurately met and consistent over time.

Paul van den Wijngaard is Global Lead Seed Physiology & Enhancement, based at Enkhuizen in the Netherlands.

Contact: paul.wijngaard_van_den@syngenta.com

sm

28

A collaboration with the Agricultural Research Organization (ARO) and the Volcani Center in Israel has enabled Syngenta to have an exclusive license to use the ORT1 Orobanche resistance trait, with the aim of developing tomato germplasm with resistance to Orobanche species.

ORT1 was developed at ARO and behaves as a single recessive gene, providing resistance to O. cernua (nodding broomrape) and O. crenata (bean broomrape).

The research group, led by Professor Yoram Kapulnik, developed the source of resistance by inducing genetic mutations in the public processing line M82 by fast-neutron mutagenesis.

Researchers have shown that resistance is likely to be acting by reducing levels of the strigolactone plant hormones solancol and didehydroorobanchol. Strigolactones have been suggested as signals that trigger Orobanche germination. The ORT1 mutation is an excellent model to study resistance mechanisms against Orobanche. The project has identified a genetic marker that segregates with Orobanche resistance, which could be used to help breeders to incorporate ORT1 into tomato varieties.

Moshe Bar is Head of Strategic Projects, Vegetable R&D, based at Zeraim Gedera, Israel.

A collaboration with Imperial College London, UK, is looking to redress this balance. By using “systems biology” – the study of complex interactions in biological systems – the researchers are able to identify molecular markers for flavor. These are then used by breeders to bring out some of the biochemical components of flavor earlier in ripening.

Syngenta’s Charlie Baxter is leading the project, working with Professors Stephen Muggleton and Mike Sternberg from Imperial College.

Candidate markers for use in breeding are identified using a mathematical technique called “machine learning”. The team developed new machine learning methods in order to integrate and process the complex data sets which showed the metabolites produced and the genes expressed during tomato ripening. The team is now focusing on applying the research findings to breeding, using published gene marker data linked to the insights that the machine learning approach has generated.

This project is part of a wider University Innovation Centre on Systems Biology at Imperial College which includes two other projects: Ecosystems Biology and Predictive Toxicology.

Breeding screening field under broomrape infection in northern Israel. Left: sensitive control.

Right: ORT1 resistance germplasm

Charlie Baxter is the Tomato Traits Project Lead, based at Jealott’s Hill in the UK.

Contact: moshe.bar@syngenta.com

Contact: charles.baxter@syngenta.com

sm

Science Matters Keeping up to date with Syngenta R&D

sm

Syngenta currently has over 500 external collaborations worldwide with universities and major agricultural institutes. This feature illustrates some of the innovations that the external collaborations program is delivering for our rice and vegetables R&D. Also featured is a project in West Africa, where the Syngenta Foundation for Sustainable Agriculture is helping to reduce dependence on rice imports.

The Editorial Team thanks everyone who contributed to this edition of “Spotlight on Collaborations”.

A first for watermelon

Turning demand into local income

Part of the watermelon genome collaborative team during “Cucurbitaceae 2012” in Turkey

Syngenta has been a key collaborator in producing the first draft genome for watermelon by contributing expertise in watermelon genetics, germplasm and commercial breeding. The draft covers 83% of the predicted watermelon genome.

Many of the data are publically available, and the significant findings have been published in the prestigious journal Nature Genetics.

As a collaborative partner, Syngenta has access to the genome data for the development of much needed watermelon traits, including resistance to the fungal diseases Fusarium wilt and Anthracnose.

Knowledge from this project will help Syngenta to improve cucumber, melon and squash.

The collaboration was led by the Beijing Vegetable Research Center (BVRC).

Syngenta’s Xingping Zhang was a director of the project alongside Dr Yong Xu, Director of NERCV. Following the production of the draft genome, the project continued with the re-sequencing of 20 diverse watermelon accessions, including elite, semi-wild and wild watermelons. This revealed the extent of genetic diversity and population structure of these watermelons, supporting the theory that cultivated watermelons were domesticated from semi-wild ones.

The research has also revealed genes that are switched on differently in flesh and rind during fruit development. This knowledge will help Syngenta scientists to develop tastier watermelons.

Xingping Zhang is a Science and Technology Fellow based at Woodland, California, USA.

sm

Contact: xingping.zhang@syngenta.com

Rice growers in Mali, West Africa

Think “rice”, and you may not automatically think “West Africa”. But over the past decade, rice has been the region’s fastest-growing food commodity. Many sub-Saharan countries regard it as a strategic crop. The Syngenta Foundation for Sustainable Agriculture (SFSA) is helping these countries reduce their dependence on imported rice.

Capturing Value “African urban consumers, and some seven million African famers, rely heavily on rice for their calories,” explains SFSA’s Oumar Niangado from Mali. “Availability and price are particularly crucial in West Africa, because households here spend so much of their income on food.”

However, the gap between supply and demand continues to widen. West Africa depends on imports for up to 40% of its rice. “That is a huge market, currently dominated by Thailand,” says Oumar.

“If local farmers and processors could capture more value, their livelihoods would significantly improve.”

West African decision-makers are now taking this issue very seriously. They look to organizations such as the SFSA to help make the local rice sector more competitive. “It is early days,” Oumar cautions, “but our pilot with researchers at AfricaRice shows major potential for increasing yields across the region.”

Two key “T’s” of better results The first “T” is technology. Farmers want knowledge and tools to improve their productivity. With rice such an international crop, West Africa sees ways to benefit from technology used elsewhere. That does not just mean better seedlings, crop

protection and irrigation. “With a bit of adaptation, Asian post-harvest equipment can also greatly help our smallholders,” Oumar notes.

Alongside technology, there’s another big “T”: trust. Growers will enter into contract farming only with traders they can trust for good prices. Omar knows from long experience with other crops that farmers who trust each other will also link up for better access to inputs and markets.

“However, helping them start and run cooperatives is still hard work,” he says.

SFSA can help build trust by brokering buyer-producer connections. “Importantly, that works both ways,” Oumar points out.

“Buyers have to trust smallholders to grow rice that meets all the requirements for volume, quality and profitability.”

Strengthening links SFSA aims to strengthen farmers’ links to suppliers, dealers and buyers. “We’ll also be working on compliance with standards for production and post-harvest handling, and train farmer organizations on topics such as marketing and logistics,” says Oumar.

Oumar Niangado is the Syngenta Foundation Delegate for West Africa, based in Mali, and can be contacted for more information on this specific project.

Contact: oumar.niangado@syngenta.com

sm

For information on Syngenta Foundation projects, the Agribusiness Manager can be contacted.

sm

Contact: robert.berlin@syngenta.com

Science Matters Keeping up to date with Syngenta R&D

29

Editor’s comments The importance of hybridization between plants, and between ideas

Plant hybridization has had profound effects on society. Throughout history, humans have purposefully created hybrids and harnessed natural hybrids for agriculture and horticulture.

I became interested in the consequences of natural hybridization during my PhD research on a species of saltmarsh grass called Spartina anglica. This species did not exist before about 1870, when it arose spontaneously near Southampton, England, by hybridization between a native species and a North American species that had been introduced accidentally, probably by shipping.

S. anglica spread rapidly, both naturally and by deliberate planting, causing huge changes – beneficial and harmful – to the coastlines of many countries worldwide.

This edition of Science Matters provides insights into the creation of hybrids to benefit farmers and consumers. As the story on page 8 shows, there is great potential to boost the productivity of rice as we learn how to manipulate male fertility in order to produce high-yielding hybrids that satisfy consumer tastes.

Similar research has already enabled Syngenta to breed hybrid barley that gives higher and more consistent yield than traditional varieties. Hybridization is also used extensively in vegetable breeding for increasing yield, and for developing new products, such as the seedless peppers described on page 10.

heterosis – but the lines must not become so different that they cannot be combined.

Several articles in this edition illustrate a process analogous to heterosis, in which expertise in different disciplines combines to great effect: image analysis and molecular genetics to advance vegetable breeding; seed production, seedling transplantation technology and agronomy to create new methods of rice production; and ecology and electronics to improve risk assessment.

I’m sure that many readers have similar experience of advances in science and technology occurring when apparently unrelated specialisms are brought together to work on a problem.

It is often said that organizations must “break down silos”. Perhaps the lesson from hybrids is that like inbred lines, scientific disciplines should be allowed to develop separately, but be regularly hybridized to exploit their different in-depth knowledge. Without the variation that separation brings, there will be no innovation heterosis; but neither will there be without crossfertilization. Don’t break the silos, hybridize them!

Alan Raybould Syngenta Fellow and Senior Technical Expert in Environmental Safety

Alan has a degree in botany from the University of Manchester and a PhD in population genetics from the University of Birmingham. He worked as a molecular ecologist for the Centre for Ecology and Hydrology for 12 years before joining Syngenta in

The success of hybrids is often based on heterosis: the greater vigor of a hybrid than that of its parents. In breeding for heterosis, the separate development of parental inbred lines is crucial – uncontrolled crosses between them would reduce their genetic differentiation and reduce

30

Science Matters Keeping up to date with Syngenta R&D

2001. Alan is a Syngenta Fellow in Product Safety at Jealott’s Hill, where his speciality is ecological risk assessment of genetically modified crops. Alan is also a Visiting Professor of Biological Sciences at the University of Southampton.

sm

Contact:

alan.raybould@syngenta.com

We are transforming rice production to help improve growers’ lives as population growth drives demand for this essential crop.

About Syngenta Syngenta is one of the world’s leading companies with more than 26,000 employees in over 90 countries dedicated to our purpose: Bringing plant potential to life. Through world-class science, global reach and commitment to our customers we help to increase crop productivity, protect the environment and improve health and quality of life. For more information about us please go to www.syngenta.com.

Our Research & Development (R&D) organization includes over 5,000 employees at R&D centers and field stations worldwide.

With specialist expertise in the seeds, seed care and crop protection areas, and our deep understanding of plant physiology, our people have the knowledge and global capabilities to solve growers’ challenges through the combination of several technologies.

Chief editor: Alan Raybould (Email: alan.raybould@syngenta.com) Editorial team: Isabelle Baumann, Carolyn Riches Main writer: Alison Craig Design & Production: Kre8tive Communications Limited Print: Geerings Print limited Unless otherwise indicated, trademarks indicated thus ® or TM are the property of a Syngenta Group Company. The Syngenta wordmark and ‘Bringing plant potential to life’ are trademarks of Syngenta International AG. © Syngenta International AG, 2012. All rights reserved Editorial completion November 2012.

Science Matters is printed using processes to reduce significantly the use of water and is printed using 80% recovered fiber and the remaining fiber is sourced from sustainable forests.

Cautionary statement regarding forward-looking statements This document contains forward-looking statements, which can be identified by terminology such as “expect”, “would”, “will”, “potential”, “plans”, “prospects”, “estimated”, “aiming”, “on track”, and similar expressions. Such statements may be subject to risks and uncertainties that could cause actual results to differ materially from these statements. We refer you to Syngenta’s publicly available filings with the US Securities and Exchange Commission for information about these and other risks and uncertainties. Syngenta assumes no obligation to update forward looking statements to reflect actual results, changed assumptions or other factors. This document does not constitute, or form part of, any offer or invitation to sell or issue, or any solicitation of any offer, to purchase or subscribe for any ordinary shares in Syngenta AG, or Syngenta ADSs, nor shall it form the basis of, or be relied on in connection with, any contract therefore.

Science Matters Keeping up to date with Syngenta R&D