The Daily Texan 2018-10-09 by The Daily Texan

serving the university of texas at austin community since

@thedailytexan |

thedailytexan . com

1900

TUESDAY, OCTOBER 9, 2018

volume

119,

issue

NEWS

OPINION

LIFE&ARTS

SPORTS

Students struggle to find time in between classes for UHS’ flu shot clinics. PA G E 2

Professors need to learn the correct pronunciations of their students’ names. PA G E 4

‘Big Mouth’s’ latest season adds humor to the mentality of puberty. PA G E 8

Herman talks Ehlinger, handling success before contest against Baylor. PA G E 6

CAMPUS

STATE

esports: the new way to play

Registered to vote for midterms yet? Today is last opportunity. By Sami Sparber @samisparber

Today is the last day to register to vote in the 2018 Texas midterms. Texas set a new voter registration record of 15.6 million people ahead of the upcoming election, said Texas Secretary of State Rolando Pablos last week. Bruce Elfant, Travis County’s voter registrar, said 92.6 percent of all eligible citizens in the county were registered in 2016, and the county is on track to break that record this year. “We expect we will exceed 93 percent this year,” Elfant said. “With all this voter activity going on, it feels more like a presidential election year than a gubernatorial election year.” Joshua Blank, manager of polling and research at UT’s Texas Politics Project, said several factors contribute to increased interest in voter registration. “The national environment is … relentless in focusing people on politics and (focusing) on politics for longer,” Blank said. “In addition, Texas has a high-profile Senate race between Beto O’Rourke and Ted Cruz that’s drawing a lot of local and national attention.” Blank said the number of competitive races for seats in the federal and state legislature is also influencing voter enthusiasm in Texas. “The fact that Democrats have nominated candidates

Competitive video games join intramural sports at Rec Center. By Nicole Stuessy @nicolestuessy

jeb milling

tudents looking to get involved in intramural sports can now do so without breaking a sweat. This semester, UT RecSports will host intramural esports, or competitive video gaming, for the first time. The first tournament is Oct. 29-30 and will hold a maximum of 30 players in Gregory Gym, according to Joseph Wise, assistant director of intramural sports. “We thought it would be a great way to reach students that we may not get an opportunity to interact with during the other sports we offer,” Wise said in an email. “For our first event, we will not offer different skill levels. The event will be totally open to anyone that wants to participate.” Wise said they chose Madden NFL

| the daily texan staff

19 for this tournament, and each player will play as an individual for their chosen NFL team. “This game has stood the test of time and continues to be a fan favorite,” Wise said. “In the future, we are open to exploring other games, but we wanted to start with a classic sports game.” RecSports will enforce rules for the event such as timing, team selections and level of difficulty, and will staff the event with their Intramural Sports Student Staff, Wise said. Wise said RecSports consulted members of the student organization Longhorn Gaming while setting up the tournament. “We wanted to ensure that our efforts would intrigue the gaming community and meet their expectations,” Wise said. “(Longhorn Gaming) gave us some great feedback, and we decided to

ESPORTS

page

VOTE

page

CITY

CAMPUS

Mayoral candidate Morrison supports affordable housing, traffic solutions

KUT exchanges paid overtime for time off

By Raga Justin

By Katie Balevic

@ragajus

@KatelynBalevic

Editor’s note: This is one in a series of profiles on the candidates running for Austin mayor. In the three years since her term as an Austin City Council member ended in 2014, Laura Morrison said she became convinced the City of Austin was heading in the wrong direction. “The kind of leadership that we need is much more community focused, much more people-first instead of special-interest focused, much more ‘Let’s bring the community to the table and find some real solutions as opposed to lots of talk and no action,’” Morrison said. Morrison is one of six candidates running for mayor against incumbent Steve Adler. Her platform focuses on improving affordability and mobility, issues she said students and other Austinites are most worried about. “Everywhere I go, cross-town, people are anxious,” Morrison

copyright laura morrison, and reproduced with permission Austin has only had one female mayor before, said Laura Morrison, but she’s hoping to change that by challenging incumbent mayor Steve Adler this fall.

said. “This is an anxious town … It’s so much more expensive, they don’t see progress being made on traffic and mobility, they’re stuck in traffic. Local businesses are having to close and people are having to leave … They’re just not sure if this is their city, if they’re gonna be part of the future.”

STEER CLEAR!

TEXAS ATHLETICS GAMEDAY CLEAR BAG POLICY

Morrison said she is also concerned with transparency. She said handling Austin’s bid for Amazon’s headquarters behind closed doors is creating frustration and distrust with residents. “We need to restore trust in City Hall,” Morrison said. “People are feeling written off and not listened to. And they feel like

the dialogue is not civil; you’re either a winner or a loser … There aren’t productive processes to bring people together.” There has only been one female mayor in Austin’s history, Morrison said. She said

MORRISON

page

A draft of new overtime payment policies at KUT, Austin’s NPR station on campus, has drawn criticism from KUT reporters who said their work would not be fairly compensated under the new policies. The policies, which were announced Oct. 1 and are not yet finalized, would log overtime as vacation hours rather than paying it out to employees as salary, KUT reporter Claire McInerny said in a string of tweets. “Reporters who work over 40 hours a week almost every week now are losing a huge chunk of compensation,” McInerny tweeted last Tuesday. “(The University) will only pay money for extreme breaking news situations.” McInerny said she has earned overtime in the past for covering events on weekends and meeting

APPROVED BAGS • Bags that are clear plastic and do not exceed 12” x 6” x 12” • One-gallon clear resealable plastic storage bags • Small clutch bags or purses that do not exceed 4.5” x 6.5”

PROHIBITED BAGS • Backpacks, purses, diaper bags, cases (camera, binocular, etc.), fanny packs, printed pattern plastic bags, reusable grocery totes, mesh or straw bags, duffle bags, large totes

TexasSports.com/clearbag

sources several miles away from her home. “Journalism happens all the time, on the schedule of other people,” McInerny tweeted. “So it was pretty rad that @KUT, a department within UT Austin compensated us for that.” However, the amount KUT pays for overtime costs has taken a sharp increase in recent years, and changes have to be made in order for KUT to remain a self-funded organization, said Kathleen Mabley, director of marketing and communications at the Moody College of Communication. “Last year, overtime costs within KUT were up more than 40 percent over the prior year’s overtime costs,” Mabley said in an email. “The changes in overtime policy being considered by KUT are intended to both to save money within their budget and

KUT

page

C H A S E K A R A C O S TA S NEWS EDITOR @THEDAILYTEXAN

TUESDAY, OCTOBER 9, 2018

CAMPUS This issue of The Daily Texan is valued at $1.25

PERMANENT STAFF

Editor-in-Chief Liza Anderson

Managing Editor Ellie Breed

Assoc. Managing Editors Catherine Marfin, Forrest Milburn

Assoc. Editors Spencer Bucker, Liam Verses, Tinu Thomas, Bella McWhorter

Forum Editors Jennifer Liu, Molly Bolf

News Editor Chase Karacostas

Assoc. News Editor London Gibson

News Desk Editors Brittany Wagner, Lisa Dreher, Stephanie Adeline, Anna Lassman, Meara Isenberg

Beat Reporters Sara Schleede, Gracie Awalt, Savanna Dunning, Katie Balevic, Megan Menchaca, Meghan Nguyen, Raga Justin, Chad Lyle, Sami Sparber

Projects Editor Paul Cobler

Associate Projects Editor Maria Mendez

Projects Reporters Kayla Meyertons, Morgan O'Hanlon, Lisa Dreher, Lisa Nhan

Copy Desk Chief Kirsten Handler

Associate Copy Desk Chiefs Jason Lihuang, Cecilia Gomez, Brittany Miller

Senior Photographers Katie Bauer, Anthony Mireles, Joshua Guenther, Angela Wang Life&Arts Editors Andrea Tinning Assoc. Life&Arts Editors Tiana Woodard, Jordyn Zitman Sr. Life&Arts Writers Brooke Sjoberg, Anna Kaye, Liliana Hall Sports Editors Alex Briseño, Ross Burkhart Senior Sports Reporters Steve Helwick, Robert Larkin, Keshav Prathivadi, Clay Vogel, Donnavan Smoot Comics Editor Channing Miller Assoc. Comics Editors Bixie Mathieu, Jeb Milling Senior Comics Artists Alekka Hernandez, Andrew Choi, Ella Williams, Lauren Ibanez Digital Editor Alexandria Dominguez Web Editor Natalie Heineman Analytics Specialist Alexandria Dominguez Engagement Reporter Megan Menchaca Sr. Digital Staffers Sabrina Martinez, Michael Hernandez, Ryan Steppe, Tirza Ortiz Science & Tech Editor Sarah Bloodworth

Design Editor Andrea D’Mello

Art Director Rena Li

Senior Designers Jeff Conley, Christiana Peek, Mireya Rahman, Renee Koite

Video Editor Sarah Tang

Assoc. Video Editor Peyton Young

Assoc. S&T Editor Freya Preimesberger Podcast Directors JT Lindsey, Morgan Kuehler Assoc. Podcast Director Zeke Fritts

Senior Videographer Faith Castle

Podcast Technical Producer Ryan Steppe

Photo Editor Carlos Garcia

Editorial Adviser Peter Chen

Assoc. Photo Editors Brooke Crim, Juan Figueroa

ISSUE STAFF Columnists Ashka Dighem, Gabi Mata, Angelica Lopez Comic Artists Veronica Jones, Selma Wanna, Annette Hui, Nathan Dinh Copy Editors Elizabeth Huang, Jimena Pinzon, Lawson Freeman Designers Emma Overholt, Sarah Tanguma

News Reporters Nicole Stuessy, Zoe Howard, Hannah Ortega, Tehreem Shahab, Maysa Mustafa

Professor emphasizes power of protest By Maysa Mustafa @maysamustafa

McGill University assistant professor Daniel Pratt presented his paper on self-sacrifice and the long-term importance of protesting, especially for students, at a talk held Monday by the Center for Russian, East European and Eurasian Studies. Jan Palach, a student protester from 1969, is remembered for his act of self-immolation, or killing himself as a sacrifice, in Prague out of protest against the Soviet Union’s invasion of Czechoslovakia. He was later credited as one of the principal factors that ended the Prague Spring. However, in his talk Pratt did not focus on the act so much as on “the meaning of his act.” “I was worried about doing this paper because I didn’t want to celebrate Palach too much,” Pratt said. “His act was taken as an altruistic act. It’s made clear by the reaction it caused.” Pratt credited Palach’s youth as a substantial reason his protest is remembered today. “There’s a way a young person can affect the world around them,” Pratt said. “The students themselves — they’re the ones change surrounds. There’s a way the youth is effective regardless of your political ideology.” Pratt said while social media is useful as a modern platform for youth protest, it can also be detrimental. “Social media is a great tool,” Pratt said. “But as any tool, it can

Photographers Pedro Luna, McKenzie Bentley, Milana Todua, Sarah El-Zein Sports Reporters Sydney Tasman S&T Reporters Lauren Schneider, Joyance Liao Mendoza

mckenzie bentley | the daily texan staff Assistant professor Daniel Pratt answers questions after reading his paper on self sacrifice and student protest. The talk centered around Jan Palach, a young student who set himself on fire in protest of the Soviet Union invasion of Czechoslovakia.

be mishandled. There are certain times a tweet could be sufficient to cause a revolution, but at the same time a tweet can be used to suppress opposition. It’s a powerful tool, but one that can be used by everybody. It can be used by both heroes and villains.” Government junior Conner Vanden Hoek said he embraces the protest

culture on campus. “One of the things I enjoy about UT is that we have the opportunity to express our opinions,” Vanden Hoek said. “It’s interesting because you’re surrounded by people who are your age and who care about what’s going on.” Business junior Omkar Patel was tabling on West Mall last week when the Young Conservatives of Texas held up

signs in support of Brett Kavanaugh, sparking attention on campus and contributing to nationwide discourse about Kavanaugh’s nomination. “As soon as I saw their signs, I knew that things were going to escalate given the sensitivity of the topic,” Patel said. “The events that unfolded that day show that, as students of a university, we should try to debate logically with one another, not provoke each other.”

CAMPUS

Students struggle to fit flu vaccines into their schedule By Zoë Howard @zoehoward51

MAIN TELEPHONE

(512) 471-4591

EDITOR-IN-CHIEF

Liza Anderson (512) 232-2212 editor@dailytexanonline.com

MANAGING EDITOR

Ellie Breed (512) 232-2217 managingeditor@ dailytexanonline.com

NEWS OFFICE

(512) 232-2207 news@dailytexanonline.com

The Texan strives to present all information fairly, accurately and completely. If we have made an error, let us know about it. Call (512) 232-2217 or e-mail managingeditor@ dailytexanonline.com.

AUSTIN WEATHER TODAY Oct. 9

HI LO

TOMORROW Oct. 10

84º 65º

HI 83º LO 60º

I’m so quirky!

BUSINESS & ADVERTISING

(512) 471-8590 advertise@texasstudentmedia.com

Director Gerald Johnson Business/ Operations Manager Frank Serpas III, Janie CastilloFlores, Brady Beal Advertising Manager Emily Cohen Product Manager Michael Gammon

Asst. Advertising Manager Colten Crist Account Executives Tim Bauer, Diane Byram, Harlea Holmes, Julianne Phillipp, Paulina Siller Design Rachel CanoCooney, Tillie Policastro

kut

THE DAILY TEXAN MAIL SUBSCRIPTION RATES

continues from page

One Semester (Fall/Spring) $60.00

Two Semesters (Fall & Spring) $120.00

Summer Session $40.00

One Year (Fall, Spring and Summer)

$150.00

To charge by VISA or MasterCard, call 471-5083. Send orders and address changes to Texas Student Media, P.O. Box D, Austin, TX 78713-8904.

ADVERTISING DEADLINES

Monday

Tuesday

Wednesday

Thursday

University Health Services hosts flu clinics on campus each year, but some students face difficulty finding time in their schedules to get their flu shots. The clinics are open to students and staff Tuesdays, Wednesdays and Thursdays from 12 p.m. to 4 p.m. at varying locations such as the Student Services Building and Gregory Gym. “Our main goal is to immunize as many students as efficiently as we can,” said Sherry Bell, University Health Services consumer education and outreach coordinator. “Last year, we immunized over 11,000 students, and this year we are trying to immunize even more.” Bell said a flu clinic visit takes only 15 minutes. However, some students with heavy afternoon schedules said they are struggling to find time. “I am in class during the majority of the times available,” psychology freshman Claire Perkins said. “I don’t have time to walk all the way to the clinic, wait in line, get my shot and get to my next class on time.” Perkins said University Health Services should expand their hours to better accommodate students’ schedules. “I definitely think there should be more times in the evening, when people don’t generally have class,” Perkins said. Expanding available hours would

Wednesday, 12 p.m. Thursday, 12 p.m. Friday, 12 p.m. Monday, 12 p.m.

Friday Tuesday, 12 p.m. Classified Word Ads 11 a.m. (Last business day prior to publication.)

Copyright 2018 Texas Student Media. All articles, photographs and graphics, both in the print and online editions, are the property of Texas Student Media and may not be reproduced or republished in part or in whole without written permission.

The Daily Texan, a student newspaper at The University of Texas at Austin, is published by Texas Student Media, 2500 Whitis Ave., Austin, TX 78712. The Daily Texan is published daily, Monday through Friday, during the regular academic year and is published once weekly during the summer semester. The Daily Texan does not publish during academic breaks, most Federal Holidays and exam periods. News contributions will be accepted by telephone (471-4591), or at the editorial office (HSM 2.120). Entire contents copyright 2018 Texas Student Media.

to be more closely aligned with UT and Moody College procedures and policies.” Adrienne Howarth-Moore, UT director of human resources, said the University has been “banking” overtime hours as vacation days for 19 years and the Moody College of Communication for 16 years, and employees usually do not complain about it because they are able to earn more vacation days. KUT has never participated in this policy, and employees were just working overtime and getting paid, Mabley said. “Because we’ve been banking for such a long period of time here at the University, most employees know this,” Howarth-Moore said. “So it’s just their norm, and they appreciate the extra leave time.” The process saves the departments money because overtime is not

esports continues from page

go down our current path with the hopes of potentially expanding in the near future.” Longhorn Gaming president Victor Wattigny said he hopes

milana todua | the daily texan staff Students and faculty members stand in line at McCombs College of Bussiness on Oct. 4, 2018, to get their flu shots. Students with heavy afternoon schedules found it extremely difficult to make the time to get their flu shots.

offer students more time to attend the clinic, but Bell said this is no easy task. University Health Services sets up 12 to 14 immunization stations each day the clinic is open. “We have to set up chairs and organize multiple stations every day, which takes a long time,” Bell said. “Opening at noon gives us the time to make sure the immunization process goes as efficiently as possible.” Public health freshman Siddha

deducted from their budget, Howarth-Moore said. In September, the University became a default overtime banking institution, meaning overtime hours are automatically banked as additional time off, but colleges and departments can pay overtime in certain cases with prior approval, Mabley said. When the draft of the new policies was shared with KUT senior managers Oct. 1, reporters expressed uncertainty about how the changes will impact their livelihoods and KUT’s news production. “Massive hit to many who took jobs here expecting that lower salary would be somewhat alleviated by (overtime),” KUT reporter Mose Buchele tweeted. “There will be some type of exception for ‘breaking news’ but inevitable that this change will also impact our news production.” Mabley said the College of Communication and KUT understand news reporting is time

intramural esports will generate interest from students who might feel intimidated at a competitive esports event. “You don’t necessarily have to be good at soccer to go play intramural soccer, and you don’t have to be good at esports to play in a game or play in a match, but peo-

Sannigrahi visited the clinic to get her flu shot last Thursday and said the entire process took about 20 to 25 minutes. “It was really easy to fit in to my schedule,” Sannigrahi said. “I went after my first class ended and still had time to eat lunch after.” Economics freshman Grace Blumenfeld also got her flu vaccine through University Health Services. “I found the time in my

schedule to go to the clinic, but I think it should definitely go later,” Blumenfeld said. Although many students have difficult schedules to work around, Bell said students should prioritize getting the flu vaccination, which is free through University Health Services for students with insurance. “Getting the flu vaccination is so important,” Bell said. “I cannot encourage it enough.”

pedro luna | the daily texan staff Three members of the RTF 318 transfer interest group step outside BMC’s KUT radio station. KUT reporters have voiced their opinions against new overtime policies which would eliminate overtime compensation.

consuming, and the new policies will reflect that. “The nature of a reporter’s job means they will work more than 40 hours per week at certain

times,” Mabley said. “Timely and accurate reporting is of the utmost importance to the college and to KUT, so all of that will be taken into consideration.”

ple who come to our events think you do,” biomedical engineering senior Wattigny said. Amanda Tran, Longhorn Gaming communications director, said as esports grow in popularity, the stigma surrounding competitive video gaming has shifted. “Usually, just when people see

someone playing video games all day, they are seen as unproductive and lazy,” said Tran, a nutrition and computer science senior. “Esports gives students another outlook on being able to participate in a sport without it having to be a physically stressful sport.”

TUESDAY, OCTOBER 9, 2018

FA S H I O N

ashley ephraim | the daily texan staff Business management freshman Joyce Kabwe models the design “Heart Tee” from her clothing company, Munia, which she recently opened an online store for this semester.

Student’s clothing line embraces her roots By Hannah Ortega @_hannahortega_

As a child, Joyce Munia Kabwe felt shame about her foreign middle name. Now, she uses it as the moniker of her fashion brand. The clothing line was named Munia, which means sun in the African language Tshiluba, toward the end of Kabwe’s senior year at Saginaw High School in Fort Worth. However, she began hand embroidering shirts one year earlier after learning the craft from a YouTube video. Her first few shirts garnered praise from her classmates, which prompted Kabwe to start selling her designs. “I wore it to school, and I got a lot of compliments on it, and I was like, ‘Wow, I actually made

something that people like,’” business management freshman Kabwe said. “It was kind of like if people wanted it, they would just ask me for it. It wasn’t anything serious.” Kabwe informally sold embroidered shirts to her peers in high school, but in September, Kabwe launched the Munia website to ship her pieces nationwide. “Not a lot of people make a lot of hand-stitched things anymore, and for Joyce … to take the time to hand stitch every shirt that goes through an order, I think that’s pretty good,” biochemistry freshman Tu Banh said. Munia currently sells two designs: the Heart Tee and the Proud Tee, which features an outline of Africa. The continent is a driving force behind Kabwe’s brand, as her parents are from the Democratic

Republic of the Congo, and she said she wants her clothes to help others see Africa in a different light. “I remember listening to my parents talking about their houses back home and how grand and beautiful everything was before war and stuff happened,” Kabwe said. “So I feel like I have a duty to kind of shed light on the beauty of Africa and its people and show the world that it’s not just full of poverty and war.” Kabwe’s first online order came from Eva Mora, a high school classmate and UNT student. Mora had a Munia shirt from her time at Saginaw. “I think it’s great,” Mora said. “She’s young, she’s (doing) something that will benefit her, and if she’s into it, then I totally commend her for it.”

Mora tweeted a photo of herself with her Heart Tee once it arrived, and Kabwe said she was “overcome with happiness.” “Even if this doesn’t grow into what I would want it to be, just seeing that one person happy with what I made was so heartwarming,” Kabwe said. Kabwe said she wants to open Munia stores and sell in H&M in the future, as well as style celebrities and open a business that combines an art studio with a coffee shop. For now, she hopes to encourage other teens to chase their dreams. “The time is now, and there’s no point in waiting because you’re never guaranteed tomorrow,” Kabwe said. “And you don’t want to look back on your life and be like, ‘Oh, I wish I did this and I wish I did that.’ Like girl, just do it.”

CAMPUS

ContribUTe 2018 raises funds for select campus services, resources By Tehreem Shahab @turhem

ContribUTe 2018, an annual University-wide campaign to encourage students to participate in philanthropy, was launched this week and will continue throughout October. The campaign is led by the UT Student Foundation, a student organization that assists other organizations with fundraising in collaboration with the Office of Development. Students can donate to Student Emergency Services, UT Outpost and SURE Walk through a HornRaiser page set up by the Foundation. Students can also donate to other areas of campus, such as intramural sports teams or a specific college. UT Student Foundation’s president Hussain Alkhafaji said special attention was given to Student Emergency Services, which he has used himself, as well as to UT Outpost and SURE Walk.

morrison continues from page

she wants to be a force for further institutional change

“These resources are instrumental for students across all walks of life on this campus and, oftentimes, they are facing a significant deficit in their operational budgets,” said Alkhafaji, a public health and journalism senior, in an email. “Life is unpredictable, and students are found to be at their most vulnerable when they go to resources like Student Emergency Services.” Student Emergency Services and UT Outpost, a resource that provides food packages for students facing food insecurity, are operated mostly on donations. Over the last couple of years, Student Emergency Services has provided about $20,000 in financial support through various avenues, said Kelly Soucy, Student Emergency Services director. Soucy said through ContribUTe donations, the Student Emergency Services Emergency Fund may be able to provide more support for students struggling to pay rent or for prescription medication. “Since we are donation based,

and diversity. “I’m a big believer that having broader diversity in these arenas makes a difference,” Morrison said. “Frankly, we have only

we provide up to $300 for our students through our grant scholarship fees,” Soucy said. “But by being a beneficiary of the program, we might be able to provide more than $300.” UT Outpost coordinator Will Ross said donations could sustain the program so that it can continue providing nutritious food and professional clothing for interviews, a resource they recently started offering. “If we are ever having a period of low sustainable donations, (ContribUTe donations) would give us the freedom to be able to go buy food and put it on the shelves if need be to make sure we are meeting our students’ needs,” Ross said. Madeline Nassif, the Student Foundation’s vice president of development, said although anyone can participate in the campaign, it is primarily targeted toward students. “We all have a responsibility to each other, and it starts now,” social work senior Nassif said.

elected white men. What does that say about this community that we think only they are capable of being in charge? We should wake up.”

anthony mireles | the daily texan file Students wait in line to vote at the FAC during the spring primaries. Today is the late day to register to vote in the 2018 midterms.

vote

continues from page

in most Texas House and Senate districts means that voters who might not have even had a chance to vote in a competitive election now get the chance to,” Blank said. Elfant said he’s encouraged by the increase in voter enthusiasm and hopes it translates to increased voter turnout. “It’s not good enough just to register to vote,” Elfant said. “You have to follow through and actually vote. There’s so much at stake in this election, with different candidates wanting to take our

community and country in different directions. It’s up to the citizens to decide which direction they’d rather see us move toward — that’s how democracy is supposed to work.” Maya Patel, vice president of TX Votes, has spent months registering students to vote. Patel said there is no excuse for students not to register and vote. “If you have the power to vote, it’s more than just your civic duty to vote,” chemistry junior Patel said. “If there’s anything going on that upsets you, whether it’s something as small as how much traffic there is in Austin to … any large, federal issue, you can not complain about it unless you vote and unless you participate.”

SYSTEM

9 professors receive ConTex grant to work with Mexican universities By Lauren Schneider @laur_insider

Nine professors from across UT recently received the 2018 ConTex Collaborative Research Grants. This funding allows the research bonds between UT and Mexican institutions to continue to grow. ConTex was founded in 2016 and is a joint effort between the UT System and Mexico’s National Council of Science and Technology, according to the ConTex website. The goal of ConTex is to promote collaborative research between the United States and Mexico by allowing Mexican academics to contribute to UT research. In at least one case, collaboration

is a political necessity, according to James Austin Jr., senior research scientist at the Jackson School of Geosciences. He said he will study the southeastern Gulf of Mexico with ConTex’s support. Austin’s team will be drilling in Mexican, Cuban and U.S. waters. In order to do this, all three nations must be on board, Austin said. “(ConTex is) setting up the cooperation that we’re gonna need from Mexico and Cuba to get that (research) done,” Austin said. “ConTex doesn’t pay salaries. It doesn’t pay for the actual conduct of the research, but it does pay for the getting together and talking about all that.” Mexico’s input is especially use-

ful for UT researchers who focus their studies in the region, according to government associate professor Kenneth Greene. “There’s a special advantage when doing a project in Mexico to have a collaborator who’s in Mexico … in part because he grew up in Mexico, so he has more of a different perspective than the average collaborator might compared to me,” Greene said. Greene will conduct research with Alberto Simpser from the Instituto Tecnológico Autónomo de México. According to Greene, they will study vote-buying practices in Mexican elections. Juan Murcia-Delso, assistant professor in the Department of

Civil, Architectural and Environmental Engineering, met with professor Sergio Alcocer of the National Autonomous University of Mexico after the 7.1 magnitude earthquake that struck Mexico last year. “After the earthquake last year, I went down to Mexico,” Murcia-Delso said. “I got in touch with professor Alcocer, and we talked about maybe putting together some proposal trying to collaborate on this topic. The ConTex project opportunity came in, and we decided to propose and we finally got the project.” Murcia-Delso said his project will collect preliminary data about structures retrofitted for seismic activity after the 1985 earthquake in Mexico City.

“We want to learn about those practices and retrofit of buildings that did well (in 2017) and then report why did this happen,” Murcia-Delso said. “We’re trying also to strengthen the links between the (National Autonomous University of Mexico) and also UT. That’s another important goal of the project.” Greene said he wants to see more collaboration between the Instituto Tecnológico Autónomo de México and UT. “There have been a number of collaborations between the universities over many years, but those kinds of international collaborations can always be reinforced, so I’m hoping that occurs,” Greene said.

LIZA ANDERSON EDITOR-IN-CHIEF @TEXANOPINION

TUESDAY , OCTOBER 9, 2018

COLUMN

Professors: Pronounce your students’ names right By Angélica López Columnist

When Shawntal Brown, a graduate student in the Center for Women’s and Gender Studies, first heard her name mispronounced, the experience made a lasting impression. “I remember I had a teacher in fourth grade (who) would say my name like Shawn-tell,” Brown said. “In that moment, I kind of left it as it was, but I knew it bothered me.” This experience is common. Sociology junior Gabriella Olivares-Alvarado said introducing herself is almost always coupled with someone complaining about her name and assigning her a nickname. “It’s definitely been a conversation that I’ve had almost every single time that I’ve introduced myself,” said Olivares-Alvarado. Only six weeks into the semester, the issue is fresh on many students’ minds. When professors refuse to learn student names, it isolates them, said Dr. Belem López, a cognitive psychologist and director of the LLAMA psycholinguistic and sociolinguistic laboratory. López said students begin to doubt their connection to their class and institution when

professors consistently pronounce their names incorrectly. “You get these questions of ‘do I belong here? They don’t even know my name’,” López said. Olivares-Alvarado said learning how to say someone’s name correctly is a matter of respect. “If I have to learn your name and call you by what you want to be called, you have to do the same,” Olivares-Alvarado said. “The basic respect you can give me is to call

brittany le

| the daily texan staff

me by my name.” By establishing respect with students early on, professors build

welcoming environments that allow students to focus their energy on assignments and building strong academic relationships. “It’s something that other people don’t have to think

about,” Lopez said. “I think (worrying about your professor learning your name) takes away resources.” Brown’s experiences with teachers and professors mispronouncing her name have shaped the way she interacts with her own students. As an instructor in the Department of English, Brown said, “I have my students introduce themselves, then I hear how

they pronounce their name. I know how it makes me feel when someone thinks they know how to say my name rather than me pronouncing it for them.” This is one of many strategies used by educators to make the classroom a more welcoming environment for students of every background. But some professors still fail to employ these strategies. Olivares-Alvarado said changing the way professors learn names doesn’t have to be difficult, and asking a student how to pronounce their name is simple. López shares the same sentiment. She said language barriers should not prevent people from trying to learn a student’s name. “Linguistically, there might be some constructions that aren’t present in your language, but you can still try,” said López. The seemingly minor interaction of learning a student’s name can clearly make a significant difference in their experience at UT. If we want to make our campus accepting and welcoming, we must first learn each other’s names. López is a rhetoric and writing junior from McAllen.

COLUMN

Let’s make Hooked on Our Safety a continued effort

Students with disabilities deserve a proper testing center

By Gabriela Mata Columnist

Last Tuesday, Young Conservatives of Texas rallied in support of then-Supreme Court nominee Brett Kavanaugh amid a large counterprotest. On Saturday, Kavanaugh was confirmed and sworn in as a Supreme Court justice despite sexual assault allegations against him. Talking about sexual assault is not easy — it will never be easy — but it is crucial given the current events both on and off the 40 Acres. Advocates in both UT and OU’s student governments moved sexual assault to the forefront of the conversation leading up to the OU game with the Hooked on Our Safety campaign. The social media initiative promoted a consolidated list of sexual assault resources in Dallas before and during the weekend for all students in town for the OU game. However, students at all football games are susceptible to sexual assault. Making more campaigns with similar, location-based resources is essential. “A red-zone is a period of time where there is an increase in sexual assault. They’re kind of informally recognized. In the fall, OU weekend is the biggest one,” said Isabella Fanucci, interpersonal violence prevention director in UT’s student government. “When you have a lot of people going to the same place, sometimes spending the night together, and there’s a lot of alcohol involved, the (sexual assault) rates sadly skyrocket.” “Having these resources acts as a safety blanket,” said OU junior Ellie Curren about the Hooked on Our Safety program. “It’s helpful, and I think most girls can agree with me on that. However, we shouldn’t have to have (it) in the first place.” Curren is right. Ideally, sexual assault should not be so pervasive. We shouldn’t have to keep it in the back of our minds. And yet, we have to constantly think about it because sexual assault remains prevalent. Having support

resources may not address the problem at its root causes, but it at least gives students a way to report misconduct and seek medical attention. The correlation of increased sexual assault rates and huge football games, specifically those of Division I-A schools such as UT and OU, is alarming. A 2016 study found a 28 percent increase in rape reports among women 17 to 24 years old on Division I-A football game days compared to rape reports on non-game days. Researchers hypothesized that this spike in sexual assaults at football games was attributed to increased use of alcohol and drugs. That is why Hooked on Our Safety is such a significant campaign. More than just phone numbers and locations, these resources prove vital to helping survivors. They also increase visibility and awareness about sexual assault among the student population, which makes up a huge portion of college football attendees. While resources are always available, they’re not always visible. They should be consolidated and communicated to the student body for every football game, home or away. Moreover, a list of these resources — such as direct hotlines and addresses of hospitals with Sexual Assault Nurse Examiners — should be created for every away game, especially when students might be unfamiliar with resources available to them in a completely different city or different state. Prior to each game, our student government must work with the opposing team’s student government to promote sexual assault resources in their respective cities. We can take direct action in finding and advocating those resources ourselves — it’s already been done for the Red River Rivalry. No matter where a Longhorn may be, these resources must always be made available. We owe it to our community to support survivors. Mata is a psychology sophomore from Houston.

GALLERY

yulissa chavez

LEGALESE | Opinions expressed in The Daily Texan are those of the editor, the Editorial Board or the writer of the article. They are not necessarily those of the UT administration, the Board of Regents or the Texas Student Media Board of Operating Trustees.

| the daily texan staff

By Ashka Dighe Columnist

I once took half of a calculus midterm in a noisy hallway, left for two hours while my professor taught a class and then returned to the same busy hallway to finish the exam when he was done. I am registered with Services for Students with Disabilities and receive testing accommodations. These accommodations are supposed to provide me with a distraction-free environment for my exams. Many other SSD students have taken tests in similarly inappropriate settings. I reached out to Charles Mills, my calculus professor, to ask him why he found it acceptable to let me take a test in a hallway. He told me he had no choice. Situations like these only occur because some professors do not have the resources to accommodate the students for exams outside of class time. As of the spring in 2017, there were 2,564 students registered with SSD for various disabilities. Of these students, 2,279 are undergraduates, and most need testing accommodations. SSD has a limited amount of testing space in the Student Services Building offices and therefore encourages students to work with their professors for exam accommodations. Mills said in an email that in his two years at UT, he has taught approximately 40 SSD registered students, all of whom have requested to take the exam with him instead of in the SSD testing rooms. Professors, however, only have their classroom space for a designated amount of time and their offices are often shared with other professors. When students choose to reschedule their exams with their professors instead of through SSD, the professor becomes responsible for finding a proctor and working out a suitable testing time. While the chemistry department and the McCombs School of Business already have established testing centers, not all departments are equipped to accommodate students’ exam needs. If there was a proper testing center where exams could be taken and proctored, students with disabilities and their professors would not be faced with these hurdles. Training student tutors from the Sanger Learning Center to proctor exams could also allow for a more flexible testing schedule and help take the burden off the professor. This would give the student the opportunity to ask clarifying questions during the exam. UT’s Senate of College Councils passed a bill in February to establish a centralized testing center on campus by converting the

SUBMIT A FIRING LINE | Email your Firing Lines to editor@dailytexanonline.com. Letters must be more than 100 and fewer than 300 words. The Texan reserves the right to edit all submissions for brevity, clarity and liability.

jeb milling

| the daily texan staff

second floor of Perry-Castañeda Library into a testing space. The bill outlined why the library is appropriately equipped to hold the over 2,000 UT students who require exam accommodations. Although this bill has been passed, no action has been taken to convert the PCL’s second floor into a testing center. Michael Lee, UT Senate policy director, said a “freeze” has been placed on the bill, because the space the bill references is currently being used for other purposes. Although using the PCL may not be feasible, there are other spaces on campus that could be used as testing center for students. The Office of the Executive Vice President and Provost, which is responsible for policies and procedures related to students’ academic experience, should implement a policy that outlines in detail the steps to reschedule exams. A suitable location and time, appropriate proctor and all necessary testing resources should be made available to SSD students and any student with a documented reason to reschedule their exam. Exams are stressful enough. Students with disabilities or intense extracurricular commitments should not have to deal with unacceptable testing conditions. In order to properly accommodate SSD students, UT needs to implement procedures to reschedule exams in suitable spaces. Dighe is Plan II and neuroscience sophomore from Houston.

RECYCLE | Please recycle this copy of The Daily Texan. Place the paper in one of the recycling bins on campus or back in the burnt-orange newsstand where you found it. EDITORIAL TWITTER | Follow The Daily Texan Editorial Board on Twitter (@TexanOpinion) and receive updates on our latest editorials and columns.

TUESDAY, OCOTOBER 9, 2018

FOOTBALL

VOLLEYBALL

Ehlinger, Dicker awarded Big 12 honors

Texas rallies past Iowa State to stay perfect in Big 12 play

By CJ Vogel @CJVogel3

The Big 12 conference has awarded Texas quarterback Sam Ehlinger and kicker Cameron Dicker with Player of the Week honors for their performances in the Longhorns’ 48-45 victory over the then-No. 7 Oklahoma Sooners. As the wins continue to roll in, so do the accolades. The two awards this week give the Longhorns five total Player of the Week titles this season. Freshman wide receiver D’Shawn Jamison was named Special Teams Player of the Week against Kansas State, senior linebacker Gary Johnson was the Defensive Player of the Week after the USC game and freshman defensive back Caden Sterns was awarded the Newcomer of the Week for his two-interception performance against TCU. Quarterback Sam Ehlinger earned Offensive Player of the Week following his five-touchdown performance at the Cotton Bowl on Saturday. The

Longhorns’ 48 points on the afternoon was the most scored in school history for the Red River Rivalry. Ehlinger was 24-for-35 passing, and accounted for 314 yards through the air and two touchdowns. Most importantly, Ehlinger was turnover-free for the fifth straight game. The sophomore quarterback also found the end zone three times on the ground and led a game-winning drive that resulted in a go-ahead 40-yard field goal with nine seconds left in the fourth quarter. Speaking of the field goal, freshman kicker Cameron Dicker was named the Big 12 Special Teams Player of the Week . Dicker made two field goals — one from 40-yards, the other from 44-yards — Saturday and was perfect on six extra point attempts. This is the second consecutive week a Longhorn has been named the Big 12 Special Teams Player of the Week. The Longhorns will look to add to their impressive list of accolades Saturday when they play host to the Baylor Bears.

carlos garcia

| the daily texan file

Sophomore quarterback Sam Ehlinger dashes past an Oklahoma defender during the Longhorns’ 48-45 victory on Oct. 6 at the Cotton Bowl in Dallas. Ehlinger’s performance earned him Big 12 Offensive Player of the Week honors.

THIS WEEK IN TEXAS ATHLETICS SATURDAY, OCT. 13 | 2:30 P.M.

FOOTBALL VS. BAYLOR PRESENTED BY AT&T

ATTTTCCTTTTTATCTTTTTTTTTTTTTTCTTTTATTT

The Big Ticket seating is now general admission! Arrive early at Gates 27, 28, 29, 30 & 32 for the best student seats!

FRIDAY, OCT. 12 | 4:30 P.M.

By Keshav Prathivadi @kpthefirst

It didn’t take long for Texas to get going. Kills by outside hitter Micaya White and freshman outside hitter Logan Eggleston started off the game and got Gregory Gym off its feet. The pair set the tone at the match, and the Longhorns just kept it going as No. 4 Texas dispatched Iowa State in straight sets (25-21, 2522, 25-21), maintaining its perfect conference record this season. The first set started off quickly in Texas’ favor. A 1410 lead and kills across the board showed off the team’s balanced attack, but a push by the Cyclones cut the lead to two at 21-19. Texas wasn’t fazed, and closed out the set to take the first frame. Senior middle blocker Morgan Johnson tallied six of her seven kills in the set, and the savvy veteran proved her mettle once again. The second set started off the same way, but Iowa State fought back to take a late 19-18 lead in the set. That’s when Texas woke up, stringing together a 6-1 run to push it to a set point in the Longhorns’ favor. Despite earning a sweep, this match was a lot closer than it looked, with the Longhorns edging the Cyclones in a contest that was at most four-point matches. The third set brought more of the same, as the frame proved to be yet another close one. Texas had a late 21-17 lead and saw it through the set, finishing off a sweep of the strong Cyclone team. Iowa State dropped to 1–4 in conference play and 8–10 on the year after starting off the 2018 season as one of this year’s more promising teams. Eggleston and White led the way for Texas with 12 and

pedro luna | the daily texan file Freshman outside hitter Logan Eggleston gets ready to spike a ball against Iowa State on Oct. 6

nine kills, respectively. On the defensive side, the pair added 10 and 12 digs to complete their double-double efforts. Now Texas faces its toughest test thus far in conference

Help Wanted Tiff’s Treats Cookie Delivery is looking for happy, hard-working people who are quick on their feet, passionate and LOVE customer service to deliver treats to our customers! Drivers use their own vehicles for delivery and must have a valid driver’s license and insurance. Delivery Drivers Earn: $10/hour plus tips and delivery fees for a total averaging $15-20/hour. TO APPLY please visit our website at: www.cookiedelivery.com

Apply to become a Favor runner!

play as it travels to Lawrence, Kansas, to face the Jayhawks. Kansas is coming off an upset of No. 23 Baylor and its seventh consecutive victory. Last year’s trip to Lawrence

required five sets to swing in Texas’ favor, and the Longhorns should expect a similar fight when they make the trip up Wednesday. First serve is set for 8 p.m.

GET SOCIAL WITH TSM

KVRX.ORG Facebook at kvrxaustin

Texas Student Media will keep you connected with daily links to the news, sports and culture stories shaping the UT community.

Favor Runners deliver anything our customers need: food & more! Earn up to $25+ hour. You earn a % of the delivery fee & 100% of all tips. You are in complete control of your schedule! Whether you want to run two hours a month or 200, you decide! You can run between 7am-3am, 7-days-a-week in Austin. Run in any of the 80+ cities where Favor is available & also choose which NEIGHBORHOOD you want to run! We process your payments EVERY DAY, so you don’t have to wait two weeks to see your money! Apply today & get a $100 BONUS! Enter referral code EARN100 Get started at apply.favordelivery.com

{

SOFTBALL VS. McLENNAN CC TTATCTTTTTCTTTTTCTTTCTTCTTCA

• FREE ADMISSION!

FRIDAY, OCT. 12 | 7 P.M.

SOCCER VS. OKLAHOMA

10/31/2018

TTTTTTTTTATTTTTTTATTT

• The ﬁrst 300 fans receive Texas Soccer trading cards! • Texas Traditions Night: Photo ops with Bevo XV, Smokey Smo the Cannon, and Texas Cheer and Pom

UT STUDENTS!

THE BIG TICKET TTTTTTTTTTTTTTTTTTTTTTTT

The Big Ticket for 2018-19 is on sale now to eligible UT students! Check your email for your customer # and PIN. TexasSports.com/BigTicket

www.arborcarwash.com

www.arborcarwash.com DT8L

OFFER VALID AT ANY LOCATION.

DT5W OFFER VALID AT ANY LOCATION.

ADVERTISING TERMS There are no refunds or credits. In the event of errors made in advertisement, notice must be given by 10 am the fi rst day of publication, as the publishers are responsible for only ONE incorrect insertion. In consideration of The Daily Texan’s acceptance of advertising copy for publication, the agency and the advertiser will indemnify and save harmless, Texas Student Media and its offi cers, employees and agents against all loss, liability, damage and expense of whatsoever nature arising out of the copying, print-ing or publishing of its advertisement including without limitation reasonable attorney’s fees resulting from claims of suits for libel, violation of right of privacy, plagiarism and copyright and trademark infringement. All ad copy must be approved by the newspaper which reserves the right to request changes, reject or properly classify an ad. The advertiser, and not the newspaper, is responsible for the truthful content of the ad. Advertising is also subject to credit approval.

Reduce • Reuse • Recycle

ALEX BRISEÑO & ROSS BURKHART SPORTS EDITORS @TEXANSPORTS

TUESDAY, OCTOBER 9, 2018

FOOTBALL

Herman: Longhorns need to maintain focus

carlos garcia | the daily texan file Texas head coach Tom Herman watches his team prepare during warm-ups ahead of the Longhorns’ matchup against the Oklahoma Sooners on Oct. 6 at the Cotton Bowl in Dallas.

Herman wants Texas to avoid complacency before matchup against Baylor. By Ross Burkhart @ross_burkhart

resh off a monumental win over Oklahoma, head coach Tom Herman walked to the podium Monday with comments about Sam Ehlinger’s strides, congratulatory text messages and Baylor’s “ridiculously high-powered offense.” Here’s the full breakdown from Herman’s press conference:

Ehlinger’sjumpfromhindrancetohero Anybody who’s kept up with Texas football over the last year and a half knows that quarterback Sam Ehlinger has had his fair share of late-game gaffes. After a huge, defining 48-45 win over what is perhaps the Longhorns’ biggest rival, it’s been nothing but allaround praise for Ehlinger. “Our team really believes in him right now, and there is a psychology to that, certainly,” Herman said Monday. “And I think us coaches and his teammates really, really believe in him and his abilities right now.” Ehlinger is now looking like one of the top signal callers in the Big 12 after graduating from the guy who consistently commits inexplicable turnovers to the veteran who can be relied on to lead game-clinching drives. “We had a long conversation about just because this is Oklahoma doesn’t mean we need to get conservative and play not to lose,” Herman said. “We need to get aggressive. I didn’t say reckless. I didn’t say silly. I said

aggressive and confident. It was a really good conversation and one I’m glad we had.”

Listening from inside the locker room

With a big win over OU comes big praise for a Texas head coach. When a season-opening loss to Maryland occurs, things don’t go so well. “I was up to 197 text messages (after Saturday),” Herman said. “I got nine after we lost to Maryland. I got nine.” Texas continues its climb up the Big 12 rankings. Fans and media personalities alike have taken notice, with the Longhorns most recently being named No. 9 in the AP Top 25 Poll. As a result, Herman has been emphasizing the need to filter any outside noise and stay focused on the voices inside the locker room. “I think these guys understand that the people in that locker room and the people in our program are the ones that are going to love ‘em and be by their side regardless of outcome, regardless

of ranking, regardless of what is said about ‘em,” Herman said.

Back to business with Baylor

Next up on the schedule for Texas are the Baylor Bears, who have already surpassed last year’s win total by three games just halfway through the season. “Baylor is 4–2, 2–1 in conference, and they have a ridiculously high-powered offense that can run and throw the football,” Herman said. “I think that’s the biggest thing. It’s just a really good football team that we’re playing, and in the Big 12 they’re all going to be.” Although the Longhorns are projected to be favored over the Bears at home, Herman doubled down on last week’s sentiment that Texas must play some of its best football to continue at the pace it’s currently on. “Hopefully someday, our C game will be good enough to beat some people,” Herman said. “But right now I think our kids really, really believe that we have to play our best to win.”

WOMEN’S TENNIS

Doubles title highlights Longhorns’ actionpacked weekend in California, Waco By Sydney Tasman @sydneytasman

The Longhorn women’s tennis team members have been on the go this past week. Some members of the team have been competing in Pacific Palisades, California, at the Riviera/ITA Women’s All-American Championships and others in Waco at the H-E-B Invitational hosted by Baylor. The women playing in California started off successful only to later face defeat in the final days of the tournament. UT junior Petra Granic beat Harvard’s Erica Oosterhout 7-5, 7-6 (8-6), which allowed her to advance to the main singles draw, where she fell to Melissa Lord of Stanford 6-3, 6-4, on Thursday. Granic continued to play Friday in a consolation match against Stanford’s Michaela Gordon. She lost the match 6-2, 6-1. Prior to the losses, Granic won three qualifying matches, making her the first Longhorn to qualify for the main draw since Breaunna Addison in 2015. The action in California continued as Granic partnered with Bojana Markovic in doubles play. The duo lost to Oklahoma State’s 24th-ranked pair, Sofia Blanco and Lisa Marie Rioux, 8-3, in the first round of the doubles

main draw. The pair continued to play Friday only to fall to Lauren Proctor and Megan Kauffman of Winthrop, 8-4, in a consolation doubles first-round match. Other downfalls in the tournament included an early loss by freshman Tijana Spasojevic who fell 6-2, 7-6 (7-5) to Florida State’s Emmanuelle Salas in the first round of qualifying. Anna Turati also dropped a tough three-set match (3-6, 6-1, 6-4) to Alexa Graham of North Carolina after defeating Mississippi State’s Magda Adologlou 6-1, 6-0, in the first round of qualifying. The women proved to be more victorious in Waco at the H-E-B Invitational. On Friday, the first day of the tournament, the Longhorns secured eight victories. Katie Poluta and Fernanda Labraña both won singles matches and advanced to Saturday’s quarterfinal round. The pair also proved formidable as a team, capturing two victories as doubles partners to move on to the doubles semifinals. Marta Perez-Mur added to the Longhorn victories Friday by defeating Minying Liang of North Texas 6-1, 6-3. She later fell 6-3, 7-6 (9-7) to Tyler Junior College’s Maria Genovese. In doubles, she paired with Julia Deming of Kansas and won 6-3 against Yamalapalli and Petra Kaszas of Sam Houston State. Saturday brought in more wins for Texas women’s ten-

angel ulloa | the daily texan file Sophomore Fernanda Labraña rallies against an opponent during a match at the Texas Tennis Center. Labraña’s performance this past weekend at the H-E-B Invitational included a doubles title and an appearance in the singles title championship.

nis. Labraña won her singles match against Jessica Hinojosa of Baylor in three sets (6-2, 1-6, 6-3) in the singles quarterfinals. She ended the day on a high note defeating Kansas’ Maria Toran Ribes 2-6, 6-2, 6-2, in

the semifinals. The doubles tandem of Labraña and Poluta again looked impressive in Saturday’s doubles competition, winning 6-2 against Luba Vasilyuk and Paris Corley of LSU.

Labraña finished the weekend in a disappointing fashion on the singles side, falling to Maria Genovese of Tyler Junior College 1-6, 7-6 (7-2), 6-1 in a back and forth match for the singles championship.

Still, Labraña still was able to clutch a championship title. Labraña and her partner Poluta captured the doubles title by defeating Maria Toran Ribes and Malkia Ngounoue of Kansas 7-6 (7-2).

TUESDAY, OCTOBER 9, 2018

The New York Times Syndication Sales Corporation The New York Times Syndication Sales 620 Eighth Avenue, New York, N.Y.Corporation 10018 620For Eighth Avenue,Call: New1-800-972-3550 York, N.Y. 10018 Information For Information Call: 1-800-972-3550 For Release Monday, October 8, 2018 For Release Tuesday, October 9, 2018

C Crossword rossword ACROSS ACROSS 1 Big name in 1banking “Gotta go!” 66Tempest Reject, as a lover 11 11Something Snub-nosedtodog download 14 ___ panel 14 “The Fox and the (rooftop Grapes” author installation) 15 Ancient Asia 15Minor Retouch a base region after a fly-out 16 Subject for 16“Dunkirk” Wall St. debut or “Apocalypse 17Now” In unison

SUDOKUFORYOU 2

8 5

1 9

9 8 8 3 2 9 4 7 1 2 3 8 9 8 7 2 5 6 7 2 8 9 9 4 6 9 2 1

Today’s solution will appear here next issue

7 2 1 3 4 6 9 8 5

4 6 8 9 1 5 7 2 3

5 9 3 7 2 8 6 4 1

9 7 5 4 6 3 2 1 8

8 3 2 5 9 1 4 6 7

1 4 6 2 8 7 5 3 9

6 5 7 1 3 2 8 9 4

3 8 9 6 5 4 1 7 2

2 1 4 8 7 9 3 5 6

19Defenseless Sternward 17 20target Vote in favor 19 Mauna 21Hawaii’s “Right now!,” to a ___ surgeon 20 Pitching stat 22 Hoity-toity sort 21 Transmits 23 The idea that 22 Hall-of-Fame matter is Broncos QB John composed of 24 Artsy Apple small,Big distinct neighborhood components 25 Rich ___” 27“Crazy Unfailingly (hit 2018 movie) 30 Respond to a 26 Directive that’s instimulus force until 31canceled Secure, as a ship

31 Eagles’ nests 32 Just the way you 32 Puerto see me___ 33 Just a touch 34 Actress Thurman 36 Lobbying org. for 37 seniors Common taxi destination 37 Pioneer in email 38 opposite 41 Wild’s Show with many notable___?” alums 39 “‘Sup, 40 Age energy 42 New Oozes field 43 Late playwright 42 Part of an urn Simon that can turn 44 when 44 Notice ___ Lama getting fired 46 Scarf Without bias 47 down 48 Big Big parts department 49 of donkeys store in a mall, e.g. that honk 50 Birds 51 52 Justice Pepsi, e.g. Sotomayor 53 Word spoken 53 Furry foot before and after 56 Meadow “James” 57 Repeated 54 comical Star athlete, for short reference

61 Words said just 58 When beforePac-Man dinner Rubik’s 62 and Stan’s buddyCube of were popular old comedies … or a phonetic hint 63 for Pre-C.I.A. spy3717-, 23-, org. and 48-Across 64 “Holy cow! This 62 “Whether ___ could be bad!” nobler …” 65 With ___ in sight 63 Department store that once famously put out DOWN catalogs 1 Lawyer’s 64 Pop music’s assignment Hall & ___ 2 Prince, to a 65 Hesitant throne speech sounds 3 “The Thin Man” 66 Rockne of Notre dog Dame fame 4 One in need of 67 Seize forcibly drying out

5 Unit of a TV series DOWN 6 Words Agree to join “old 1 before chap” 7 Newsman Chuck 2 8 Double Burden agent 3 potthe 9 Earthen Ocasek of Cars 4 Chubby 60 mostshowing things 10 57 Like Network Muddles through 5 Snowman of in “Ripley’s with what “Suits” and “Mr. song who’sone “a Believe has happy soul” jolly, Robot” It or Not!” 11 Middlesight school 6 Sauna ANSWER years, notably ANSWER TO TO PREVIOUS PREVIOUS PUZZLE PUZZLE 7 Musical Page 12 Song of praise SC AH MA BS AE S S T O GR A 8 “Yecch!” M M BA PI A P Says “Dear God TA RE IS EO DP O NI O CN UI A I S W I N A E R 13 9 Lament …” IS TI ST AT ZI ON OG D OU LC DK S TK EE R A 10 “Morning Edition” 18 Sodas not much ME IR DA S ES NE TN ED NS C EE L W P R A O Y airer seen nowadays S C O TS SO H HO A T HA S FI AA TN SS 11 One involved with can be white or OS LT EA SN D MI IN SG OO R SD EE R I O 23 aIt grand opening? boldfaced NA EE SR I CE ES N TR RI C I PO E TD A LB 12 Enthused about 24 Small scissor cut A A R BP U D GA EO TL C U TT A M E 13 Coped, barely CB OR NO A NA OU BR RA I ES NP I H G A O N T 25 Path of a Hail 18 Sporty Pontiacs Mary pass A P EW RA YL K UI NN OG SP A PP E LR ES of old NI EN EH RA L WE R E NE A PR RS A D A 26 Bygone Swedish 22 Mo auto IG NE DE S TE I GS RO N I SI RA I VP EA W R 23 Seniors’ org. 27 Bit of weeping TL EE NA M IR LU EN N SI LN OG VJ EO N K E 24 Gets emotional Images on BO RD OD I LG ER RA C TE A LO EL NL TI SE 28 at a wedding, Kansas City EO SS TS A TY EI P E S G EN TO SE E N T D maybe Chiefs’ helmets

Edited by by Will Will Shortz Shortz Edited 1 1

2 2

3 3

4 4

5 5

6 6

14 14

7 7

10 10

11 12 13 11 12 13 16 16

18 18

20 20

19 19

21 21

24 23 27 28

28 29

31 31

36 37

39 41

40 42 44 44

47 48

9 9

15 15

17 17

26 27

8 8

No.0904 0903 No.

32 33

33 34 35 34 35 36 38 40

42 46

48 49

51 58 59

30 30

45 45

50 52

25 25

23 22

49 51

52 53

53 54 55 54 55 56

56 57

57 58

59 61

60 62

61 63

62 64

63 65

64 66

65 67

PUZZLE BY BYBRUCE TRENT HAIGHT H. EVANS PUZZLE

29 Sheds A pun acan 41Capital Hawaiian 25 ___induce 38 due one instrument, (24-Down) north of the for short tip of northern 30 Soccer Resource 26 star Mia 42Denmark Land on the extracted from 27 You love:North Lat. Strait of Gibraltar Alaska’s 39 Keister Slope 43“What’s Model of 28 Beef cut 40 ___ for excellence me?” 34 Top-of-the-line Roman god of 29 love 45 Small batteries 45 “Now I see!” 32 Wiped out, 46Vampire’s Ones whotelltale are 46 35 as Wagers while said to grant sign 37 skateboarding NPR’s Shapiro three wishes 47 “You can say that 33 47again!” Eskimo home 38 Nascar Much ofadditive a salon 35 Aworker’s lot of it income is junk 48Severe Must-haves 48 but short, an illness 40 Italy, Peanut or pollen 51as Crackle and Pop’s 36 to Germany, reaction, buddyrefusal in W.W. II possibly 49 Polite

52Film Fairycritic tale Roger 50 beginning 51 Racket 53 Tree : Christmas :: ___ : Festivus 54 Smidgen 55 of skivvies? 54Pair Similar (to) 56 “Over here!”for ] 55[ Dandelion, one 58 “You should know better!” 58 Spoon-bending Geller 59 One laying an egg 59 Singer and former “American 60 ___ Claire, Wis. Idol” judge, familiarly 61 Paving goo

Online subscriptions: subscriptions:Today’s Today’spuzzle puzzleand andmore morethan than7,000 7,000past past Online puzzles, puzzles,nytimes.com/crosswords nytimes.com/crosswords($39.95 ($39.95aayear). year). Read Read about aboutand andcomment commenton oneach eachpuzzle: puzzle:nytimes.com/wordplay. nytimes.com/wordplay.

ANDREA TINNING LIFE & ARTS EDITOR @THEDAILYTEXAN

TUESDAY, OCTOBER 9, 2018

TELEVISION

‘Big Mouth’ explores puberty of mind Season 2 of the Netflix original series delves into mental issues that come with development. By Brooke Sjoberg @sj0b3rg

ver wondered what a onster with a permanently flaccid penis for a nose looks like? “Big Mouth” is here to satisfy that curiosity. The latest installment of Nick Kroll and Andrew Goldberg’s disgustingly humorous Netflix Original “Big Mouth” has been released to the world in one giant cringe. The animated comedy, known for its crude depictions of puberty, has made its way from fart and period jokes to discussions of the mind. This season focuses on characters Nick (Nick Kroll) and Andrew (John Mulaney) as they experience the mental consequences of developing too slowly and too quickly, respectively. Their “Hormone Monster,” Maurice (Kroll), does his best to guide them through adolescence but find roadblocks left and right. While the first season of “Big Mouth” addressed the physicality of puberty — menstruation, facial hair, the works — the second season explores the mentality of middle schoolers and one weird adult in the throes of development. The show’s humor and animation are too direct for a young audience, yet they model healthy discussions of sex and mental health essential to proper

copyright netflix, and reproduced with permission “Big Mouth” is the brainchild of Nick Kroll and Andrew Goldberg and focuses on Jewish characters Nick Burch, Andrew Glouberman and Jessi Glaser.

human growth. The hallmark of Kroll’s voice acting within the series is his versatility. He is credited with at least 10 characters, and each voice is different enough that a viewer may not be able to discern who the characters are played by without searching the IMDb page. The voices Kroll provides for Lola, Maury, Nick and Coach Steve, to name a few, are unique and speak to their personalities. The series is truly gives credit to his talent. Many types of relationships are modeled in the series. Friendships that are both healthy and unhealthy

serve as “teachable moments” where Nick and Andrew have arguments that define their friendship, and Lola and Devin (June Diane Raphael) push each other over the edge and out of each other’s lives. Putting these relationships in the context of physical and mental upheavals experienced by preteens may provide parents with a model for discussing good and bad friendships with their children. The curious case of Coach Steve also provides a platform for understanding the frozen nature of traumatized children’s development. Previously, the coach was depicted

as a well-meaning but dim source of comic relief. As he evolves into a fully-developed character, it becomes clear that he was abused and neglected. Coach Steve was left to figure out what was going on with his body and the world on his own. He seems frozen in a similar stage of development as the children he is looking after, for they are his only friends. He refers to his own anatomy and that of others in reductive terms appropriate for children, but wildly inappropriate for a grown man. He is naive and unaware of this, so he is treated with kid gloves by the adults in his life.

“Big Mouth” R AT I N G SCORE

TV-MA

Perhaps biting off more than it could chew with Coach Steve, “Big Mouth” is a bitter exploration of what it means to become a teenager in all its nasty glory. The humor may be a bit on the nose for viewers with delicate sensibilities, but is well worth the watch if it can be stomached.

Q&A

Amanda Kramer’s film ‘Ladyworld’ analyzes female psyche By Savannah J Salazar @savan

DT: Another dark element of the film

is The Man. Could you talk about how it taps into female paranoia, and how The Man plays into our culture now?

Amanda Kramer’s debut feature film “Ladyworld” explores female hysteria and friendships in a refreshing and unsettling way. During a birthday party, eight girls are barricaded inside for a seemingly endless sleepover. As cliques form and the whereabouts of a suspicious character called The Man remain unknown, their collective sanity slowly falls apart. The Daily Texan sat down with Kramer after the world premiere at Fantastic Fest to talk more about “Ladyworld.”

The Daily Texan: What do you love most about making movies?

Amanda Kramer: The short of it is just

being with actors. It’s the most enriching aspect of the experience because … when you write a character and it lives inside of your head, it’s essentially your ego and your brain … It’s an endless possibility, and you cast someone and all the possibilities end. Then, it’s just a physical human being sitting in front of you, and that is

AK: When I first started writing

copyright noel david taylor, and reproduced with permission The Daily Texan sat down with Amanda Kramer at Fantastic Fest to talk about her debut feature film, “Ladyworld.”

freeing, terrifying and magical, and everything that exists coming from that person is so personal to them and so they steal from you. It’s a total loss, but then it’s … (an) incredible journey because then all of a sudden, it’s not yours anymore. You’re watching your character walk around … and it’s the most artistically satisfying and epic thing.

DT: How was the concept of “Ladyworld” conceived?

AK: The idea came very fast. You know, you wake up from a dream and you’re like, “Huh.” (laughs) What if I destroy eight people’s lives by trapping them in a house together? It sounds fun. You get these ideas pretty quickly, and then creating the full arc takes years. I wrote the script for a long time with

my co-writer (Benjamin Shearn), and we went from draft to draft. And in different drafts, different things happened and different characters seemed like leads and … others like supporting cast, and that all shifts over time. Even though the idea came quickly … it took a minute to understand what that would look like … and how they would represent different aspects of the female psyche.

(“Ladyworld”), I really wanted to talk about rape phobia, and this was before the movement we’re in now. I was writing in a time where this stuff was … not really discussed. It’s an intrinsically female thing to know that you are in danger. That was so important to get into the film because it’s not often spoken of. We see films where women are victimized or sexually assaulted, but what if it was just a hint of a sexual assault, which is every day, all day long? So, people should discuss that more because it’s another loss of innocence. It’s the understanding that you’re a sexualized being to a potential predator. I think as women, we’re born not knowing that, and then at a certain age we know that, and we never go back. You’re conscious for the first time that you could be really hurt, and I just definitely wanted to talk about that.

BOOK REVIEW

‘The Flame’ blends pop culture, insight into Leonard Cohen’s life By Anna-Kay Reeves @annakay_reeves

You, like many of today’s youth, probably know the song “Hallelujah” from “Shrek” as performed by John Cale. What you might not know is the song was originally released in 1984 by Leonard Cohen. Cohen, who died in 2016, was a prolific writer, musician and artist during his life. He amassed a sizable collection of sketches and notebooks that were previously unseen. “The Flame,” Cohen’s collection of posthumously published poems, lyrics and drawings makes the last years of the musical great’s artistic efforts available to the public in a beautiful and melancholy form. “The Flame” is arranged in a way that keeps the reader engaged throughout the 288-page collection. With Cohen’s drawings appearing every few pages, the eight sections of poetry and lyrics flow seamlessly into one another. Some other poetry collections feel overwhelming with page upon page of text blocks that seem arranged without regard to topic. This isn’t the case with “The Flame.” The drawings, which are matched with poems of similar subject matters, serve as punctuation marks between the topics of the writing. Its arrangement allows the reader a sort of palate cleanser before moving onto the next selection, like a

slice of ginger between courses. The drawings also serve as a bit of comic relief, breaking up the often melancholy poems into manageable doses of the heavier stuff in life. The majority of Cohen’s drawings are simple sketches of himself in pen, with the occasional female figure and charcoal drawing. Usually featuring handwritten notes, the drawings are intimate looks into Co-

‘The Flame’s’ poems use simple language to express complex ideas.” A N N A - K AY R E E V E S

THE DAILY TEXAN STAFF

hen’s humor. Standout sketches include two of Cohen’s self-portraits, one hastily done with the caption “failed portrait,” another charcoal outline captioned “looking for a good time, sailor?” The drawings are simple expressions of the little thoughts that passed through the mind each day, making them not only entertaining but relatable. Outside the section cataloged as lyrics, Cohen’s background as a songwriter

is apparent. “The Flame’s” poems use simple language to express complex ideas. Many poems also feature a song-like rhyme scheme and layout, rhyming every other line and with stanzas repeated as the chorus of a song. Yet, it’s also apparent that Cohen was writing beyond the confines of a songwriter. In poems such as “On Rare Occasions,” which does not include any rhyming, Cohen shows his ability as a free verse poet. The frequent modern references within this collection make for an interesting read. Poetry as experienced by students is so often not written by late and great poets such as Cohen, but very late and great poets such as Edgar Allan Poe or Walt Whitman. Without saying anything against Poe, Whitman or other classic poets, reading “The Flame” with references to traffic and Kanye West is refreshing. It reminds readers that poetry isn’t a creature that went extinct in the 19th century — it exists in the here and now. “Kanye West is not Picasso” is an excellent example. Cohen writes, “I am the Kanye West Kanye West thinks he is,” something that locks the poem into this cultural moment. The Flame is a collection that caps Cohen’s career beautifully. The book is available in hardcover print from major booksellers for $25.20, through Amazon for $18.30 and in a Kindle edition

copyright farrar, straus and giroux, and reproduced with permission Leonard Cohen’s final collection of poetry captures the career of a genius.