JoTT 3(8): 1961-2032 26aug2011

August 2011 | Vol. 3 | No. 8 | Pages 1961–2032 Date of Publication 26 August 2011 ISSN 0974-7907 (online) | 0974-7893 (print)

Š L.J. Mendis Wickramasinghe

Dasia halianus

Creative Commons Attribution 3.0 Unported License. JoTT allows unrestricted use of articles in any medium for non-profit purposes, reproduction and distribution by providing adequate credit to the authors and the source of publication.

Journal of Threatened Taxa Published by Wildlife Information Liaison Development Society

Typeset and printed at Zoo Outreach Organisation

9A, Lal Bahadur Colony, Peelamedu, Coimbatore, Tamil Nadu 641004, India Phone: +91 422 2561087, 2561743; Fax: +91 422 2563269 Email: threatenedtaxa@gmail.com, articlesubmission@threatenedtaxa.org Website: www.theatenedtaxa.org EDITORS Founder & Chief Editor Dr. Sanjay Molur, Coimbatore, India Managing Editor Mr. B. Ravichandran, Coimbatore, India Associate Editors Dr. B.A. Daniel, Coimbatore, India Dr. Manju Siliwal, Dehra Dun, India Dr. Meena Venkataraman, Mumbai, India Editorial Advisors Ms. Sally Walker, Coimbatore, India Dr. Robert C. Lacy, Minnesota, USA Dr. Russel Mittermeier, Virginia, USA Dr. Thomas Husband, Rhode Island, USA Dr. Jacob V. Cheeran, Thrissur, India Prof. Dr. Mewa Singh, Mysuru, India Dr. Ulrich Streicher, Oudomsouk, Laos Mr. Stephen D. Nash, Stony Brook, USA Dr. Fred Pluthero, Toronto, Canada Dr. Martin Fisher, Cambridge, UK Dr. Ulf Gärdenfors, Uppsala, Sweden Dr. John Fellowes, Hong Kong Dr. Philip S. Miller, Minnesota, USA Prof. Dr. Mirco Solé, Brazil Editorial Board / Subject Editors Dr. M. Zornitza Aguilar, Ecuador Prof. Wasim Ahmad, Aligarh, India Dr. Giovanni Amori, Rome, Italy Mr. Deepak Apte, Mumbai, India Dr. M. Arunachalam, Alwarkurichi, India Dr. Aziz Aslan, Antalya, Turkey Prof. R.K. Avasthi, Rohtak, India Dr. N.P. Balakrishnan, Coimbatore, India Dr. Hari Balasubramanian, Arlington, USA Dr. Maan Barua, Oxford OX , UK Dr. Aaron M. Bauer, Villanova, USA Dr. Gopalakrishna K. Bhat, Udupi, India Dr. S. Bhupathy, Coimbatore, India Dr. Anwar L. Bilgrami, New Jersey, USA Dr. Renee M. Borges, Bengaluru, India Dr. Gill Braulik, Fife, UK Dr. Prem B. Budha, Kathmandu, Nepal Mr. Ashok Captain, Pune, India Dr. Cleofas R. Cervancia, Laguna , Philippines Dr. Apurba Chakraborty, Guwahati, India Dr. Kailash Chandra, Jabalpur, India

Dr. Anwaruddin Choudhury, Guwahati, India Dr. Richard Thomas Corlett, Singapore Dr. Gabor Csorba, Budapest, Hungary Dr. Paula E. Cushing, Denver, USA Dr. Neelesh Naresh Dahanukar, Pune, India Dr. R.J. Ranjit Daniels, Chennai, India Dr. A.K. Das, Kolkata, India Dr. Indraneil Das, Sarawak, Malaysia Dr. Rema Devi, Chennai, India Dr. Nishith Dharaiya, Patan, India Dr. Ansie Dippenaar-Schoeman, Queenswood, South Africa Dr. William Dundon, Legnaro, Italy Dr. J.L. Ellis, Bengaluru, India Dr. Susie Ellis, Florida, USA Dr. Zdenek Faltynek Fric, Czech Republic Dr. Hemant Ghate, Pune, India Dr. Dipankar Ghose, New Delhi, India Dr. Gary A.P. Gibson, Ontario, USA Dr. M. Gobi, Madurai, India Dr. Stephan Gollasch, Hamburg, Germany Dr. Michael J.B. Green, Norwich, UK Dr. K. Gunathilagaraj, Coimbatore, India Dr. Mohammad Hayat, Aligarh, India Dr. V.B. Hosagoudar, Thiruvananthapuram, India Prof. Fritz Huchermeyer, Onderstepoort, South Africa Dr. V. Irudayaraj, Tirunelveli, India Dr. Rajah Jayapal, Bengaluru, India Dr. Weihong Ji, Auckland, New Zealand Prof. R. Jindal, Chandigarh, India Dr. Pierre Jolivet, Bd Soult, France Dr. Werner Kaumanns, Eschenweg, Germany Dr. P.B. Khare, Lucknow, India Dr. Vinod Khanna, Dehra Dun, India Dr. Cecilia Kierulff, São Paulo, Brazil Dr. Ignacy Kitowski, Lublin, Poland Dr. Krushnamegh Kunte, Cambridge, USA Prof. Dr. Adriano Brilhante Kury, Rio de Janeiro, Brazil Dr. Carlos Alberto S de Lucena, Porto Alegre, Brazil Dr. Glauco Machado, São Paulo, Brazil Dr. Gowri Mallapur, Mamallapuram, India Dr. George Mathew, Peechi, India Prof. Richard Kiprono Mibey, Eldoret, Kenya Dr. Shomen Mukherjee, Jamshedpur, India Dr. P.O. Nameer, Thrissur, India Dr. D. Narasimhan, Chennai, India Dr. T.C. Narendran, Kozhikode, India Stephen D. Nash, Stony Brook, USA Dr. K.A.I. Nekaris, Oxford, UK Dr. Heok Hee Ng, Singapore Dr. Boris P. Nikolov, Sofia, Bulgaria continued on the back inside cover

JoTT Paper

3(8): 1961–1974

Taxonomic status of the arboreal Skink Lizard Dasia halianus (Haly & Nevill, 1887) in Sri Lanka and the redescription of Dasia subcaeruleum (Boulenger, 1891) from India L.J. Mendis Wickramasinghe 1, Nethu Wickramasinghe 2 & Lalith Kariyawasam 3 Herpetological Foundation of Sri Lanka, Thalarukkarama Road, Kudawaskaduwa, Waskaduwa, Sri Lanka Department of National Museums, Sir Marcus Fernando Mawatha, Colombo 7, Sri Lanka Email: 1 boiga2000@gmail.com (corresponding author), 2 nemzy821@gmail.com, 3 kglalith4@gmail.com

1,2 3

Date of publication (online): 26 August 2011 Date of publication (print): 26 August 2011 ISSN 0974-7907 (online) | 0974-7893 (print) Editor: Aaron Bauer Manuscript details: Ms # o2300 Received 28 August 2009 Final received 18 June 2011 Finally accepted 20 July 2011 Citation: Wickramasinghe, L.J.M., N. Wickramasinghe & L. Kariyawasam (2011).

Taxonomic status of the arboreal Skink Lizard Dasia halianus (Haly & Nevill, 1887) in Sri Lanka and the redescription of Dasia subcaeruleum (Boulenger, 1891) from India. Journal of Threatened Taxa 3(8): 1961–1974.

Copyright: © L.J. Mendis Wickramasinghe, Nethu Wickramasinghe & Lalith Kariyawasam 2011. Creative Commons Attribution 3.0 Unported License. JoTT allows unrestricted use of this article in any medium for non-profit purposes, reproduction and distribution by providing adequate credit to the authors and the source of publication.

For Author Details and Acknowledgemet see end of this article Author Contribution: The first author designed and carried out the study, while the co-authors, contributed with the preparation of the manuscript, literature survey and reference works in the corresponding museums.

OPEN ACCESS | FREE DOWNLOAD

Abstract: A comparative study of Dasia halianus in India and Sri Lanka is discussed.

Indian specimens of “D. halianus” are in fact referable to D. subcaeruleum. D. halianus is again considered a Sri Lankan endemic.

Keywords: Dasia, Dasia halianus, Dasia subcaeruleum, India, Scincidae, Sri Lanka.

Sinhala Abstract: bkaoshdj iy Y%S ,xldj ;=, yuqjk Dasia halianus kï yslk,a úfYaIh ms<sn|j isÿfl? ixikaokd;aul wOHhkhla fuu ,smsh u.ska idlÉPd flf¾. bkaoshdj ;=, yuqjk úfYaIh D. halianus fkdj trgg wdfõksl D. subcaeruleum úfYaIh nj;a Y%S ,xldj ;=, yuqjk D. halianus úfYaIh Y%S ,xldjg wdfõksl úfYaIhla nj;a fuu ,smsh ;=,ska ikd: lr oS we;.

INTRODUCTION By 2001 a total of 84 species of scincid lizards belonging to 19 genera were recognized in South Asia, 62 in India and 27 in Sri Lanka, with seven species common to both (Das 2001). Since then four new species have been described, a new range extension of Chalcides cf. ocellatus from Sri Lanka and a new genus described from India, increasing the total number of species to 89 (Batuwita & Pethiyagoda 2007; Wickramasinghe et al. 2007; Das et al. 2008; Karunarathna et al. 2008), and the genera to 20 (Eremchenko & Das 2004). Also, the genus Mabuya in the region was changed to Eutropis, keeping the genus and species count without any change (Mausfeld & Schmitz 2003). Two species from Sri Lanka, Sphenomorphus rufogularis Taylor, 1950, and S. striatopunktatus Ahei, 1856, were synonymised with Lankaskincus fallax (Peters, 1860), and L. taprobanensis (Kelaart, 1854), respectively, reducing the total number of species to 86 (Greer 1991; Wickramasinghe et al. 2007).

Skinks found in both countries are as follows, Dasia halianus (Haly & Nevill in Nevill 1887), Lygosoma punctata (Gmelin, 1799), Eutropis bedomi (Jerdon, 1870), E. bibroni (Gray, 1839), E. carinata (Schneider, 1801), E. macularia (Blyth, 1835), and Sphenomorphus dussumieri (Duméril & Bibron, 1839). Of these the last six species were recorded in both countries before 1980 (Deraniyagala 1931, 1953; Smith 1935; Taylor 1950, 1953; Greer 1970; Inger 1980). Dasia halianus on the other hand was considered endemic to Sri Lanka until as recently as 1984, when it was reported for the first time from India by Joshua & Sekar (1984). Meanwhile, without any evidence, Das & de Silva (2005) provided a list where they

Journal of Threatened Taxa | www.threatenedtaxa.org | August 2011 | 3(8): 1961–1974

1961

Dasia halianus and D. subcaeruleum

L.J.M. Wickramasinghe et al.

stated that D. halianus is endemic to Sri Lanka, but again in later publications D. halianus was considered as a non endemic species (de Silva et al. 2005a,b; de Silva 2006; IUCN & MENR 2007). Currently there are four Dasia species D. halianus, D. olivacea Gray, 1839, D. nicobarensis Biswas & Sanyal, 1977, and D. subcaeruleum (Boulenger, 1891) found in India (Das 1994, 1997, 2001) and a single species, D. halianus, found in Sri Lanka (Das 2001; Deraniyagala 1931; Smith 1935, 1937; Taylor 1950; Deraniyagala 1953; Taylor 1953; Greer 1970; Inger 1980; de Silva 1994, 1995, 1996; IUCN 2000; Bambaradeniya 2001; Das & de Silva 2005; de Silva et al. 2005a,b; MFE 2005; de Silva 2006; IUCN & MENR 2007; DWC 2008a,b; Somaweera & Somaweera 2009). D. nicobarensis is endemic to the Nicobars (Das 1994, 1999, 2002). D. olivacea ranges from southern Thailand, Malaysia and Singapore to Borneo, and Java (Cox et al. 1998; Das, 2002). The Indian endemic species D. subcaeruleum on the other hand was not mentioned from India for nearly a century until the description was repeated by Murthy (1990).

Although there are seven species said to be found in both these countries there has not been a proper comparative study done so far, amongst these species.

In our present study we have provided a comparison between D. halianus found in India and Sri Lanka.

MATERIAL AND METHODS The following 22 measurements were taken with a Mitutoyo digital Vernier calliper (to the nearest 0.01mm) axilla to groin (AG, distance between axilla and groin), distance between back of eye (DBE, measured between the posterior edge of eyes), distance between front of eye (DFE, measured between the anterior edges of eyes), ear length (EL, the greatest vertical length of ear), ear width (EaW, the widest horizontal distance of ear), ear to ear distance (EE, distance between ears), eye to nostril distance (EN, distance between the anterior most point of eyes and nostrils), eye width (EW, measured between the anterior and posterior edges of eye), forearm length (FL, distance between the palm and elbow), head depth (HD, the maximum height of head, from the occiput to throat), head length (HL, distance between posterior edge of the last supralabial and the snout tip), head 1962

width (HW, measured at angle of jaws), internarial distance (IN, distance between nares), nostril to ear distance (NE, the distance between the posterior point of nostril and the anterior point of ear), snout to ear distance (SED, distance between the tip of snout and the anterior point of ear), snout to eye distance (SE, distance between the tip of snout and the anterior most point of eyes), snout to nostril (SN, distance between the tip of snout and the anterior point of nostril), snout to vent length (SVL, from the tip of snout to vent), tibia length (TBL, the greatest length of tibia, between knee and sole), tail depth (TD, the highest depth of tail base), tail length (TL, from vent to the tip of tail end), and tail width (TW, measured at the base of tail), Infralabials at end of gape (IL), Lamellae of Finger 1 (LF1), Lamellae of Finger 2 (LF2), Lamellae of Finger 3 (LF3), Lamellae of Finger 4 (LF4), Lamellae of Finger 5 (LF5), Lamellae of toe 1 (LT1), Lamellae of toe 2 (LT2), Lamellae of toe 3 (LT3), Lamellae of toe 4 (LT4), Lamellae of toe 5 (LT5), Paravertibral (PV), Scale around mid body (SMB), Subcaudals (SC), Supralabials at end of gape (SLG), Supralabials at mid orbit (SLO), Ventrals (V).

Preserved specimens were examined in the Colombo National Museum of Sri Lanka (NMSL), (The specimen in the best condition was selected for the description), Bombay Natural History Society collection (BNHS) and The Natural History Museum, London, UK (BMNH), as part of a study carried out, by the Sri Lankan Herpetological Foundation, for the non-endemic Saurian species in Sri Lanka.

The locations pertaining to the collection points of specimens according to previous literature were obtained using a Garmin E-trex venture GPS. Guidelines to evaluate the conservation status of species were taken from the IUCN Red List Categories and Criteria (version 3.1; IUCN 2001)

RESULTS Systematics Dasia halianus (Haly & Nevill, 1887) Euprepes halianus Haly & Nevill in Nevill 1887: 2: 56.

Lygosoma halianus—Haly, 1893: 4: 13.

Theconyx halianus—Annandale, 1906: 191.

Lygosoma (Keneuxia) halianus—Deraniyagala, 1931:

Journal of Threatened Taxa | www.threatenedtaxa.org | August 2011 | 3(8): 1961–1974

Dasia halianus and D. subcaeruleum

L.J.M. Wickramasinghe et al.

174.

Dasia haliana—Smith, 1935: 278; Taylor, 1950: 33; Taylor, 1953: 35; Deraniyagala, 1953: 69; Das, 1996: 4; Somaweera & Somaweera, 2009.

Dasia halianus—Das, 2001: 23.

Description of uncatalogued NMSL specimen (Images 1 & 2): Snout to vent length (SVL) 59.13 mm, body moderately elongate. Head depressed and narrow (HD/HW ratio 0.59 and HD/HL ratio 0.37); elongated and (HD/NE ratio 0.47 and HL/SVL ratio 0.24); distinct from the neck; snout long (SE/HW ratio 0.60); longer than the eye width (EW/SE ratio 0.56); eye relatively lager than the ear (EW/EL ratio 6.30 and EW/EaW ratio 9.55); ear opening small (EL/HL ratio 0.03); snout to eye distance greater than the width of eye (SE/EW ratio 1.80); body length greater than tail length (SVL/TL ratio 0.95), and round in cross section (TD/TW ratio 0.87).

Rostral concave; supranasal present; no postnasal; frontonasal larger than the prefrontals along the longitudinal axis, lateral border touching first loreal and supranasal; prefrontals is slightly separated,

lower border touching both loreal scales, but touching the posterior loreal more than half, the posterior border touching the first supraocular, and frontal; frontal slightly longer or equal in its distance to tip of snout, and approximately shorter or slightly equal in frontoparietals and interparietal combined; seven or eight supraciliaris; four supraoculars, first one longer than wide, second wider than long, first three in contact with frontal, third in contact with frontal and frontoparietal, fourth in contact with frontoparietal, parietal and upper pretemporal; frontoparietals distinct, slightly smaller than interparietal length; posterior tip of interparietal barely in point-contact with primary nuchal scales, parietal touching upper and lower pretemporal scales laterally, primary nuchal and three small scales touching parietal post laterally (Image 2A); non fused nasal and in contact with 1st supralabial; two loreal scales, anterior loreal touching nasal, supranasal, frontonasal, prefrontal, 1st and 2nd supralabials or 1st, 2nd, and 3rd supralabial scales. Posterior loreal longer, and wider than the anterior loreal, posterior loreal

© L.J. Mendis Wickramasinghe

Image 1. The dorsolateral view of uncatalogued specimen of Dasia halianus in NMSL collection

Image 2. NMSL uncatalogued specimen of Dasia halianus A - dorsal aspect, B - lateral aspect, and C - ventral aspect of head; D - lamellae on right fore limb, and E - lamellae on left hind limb.

Journal of Threatened Taxa | www.threatenedtaxa.org | August 2011 | 3(8): 1961–1974

1963

Dasia halianus and D. subcaeruleum

L.J.M. Wickramasinghe et al.

touching prefrontal, 1st supraciliaries, upper and lower preocular scales. Lower border touching 2nd and 3rd supralabials or third; two preocular scales, lower ones lager than the others; eight supraciliaries, in a row, the first one is lager than the others; seven supralabials, the last supralabial single, 5th at the mid orbit point; 12 subocular scales, smaller than the supraciliaries scales; the subocular row touching 5th to the 6th supralabial scales and primary temporal scale, the first subocular scale touching the presubocular, and 5th supralabial scale, the last subocular scale touching the primary temporal scale; presubocular scale touching lower preocular, 4th and 5th supralabial scales; Lower eye lid scaly, six large scales on window eye lid touching the upper edge of window, two scales on either side smaller than the once in the centre, and small scales filling the gaps at the upper edge between larger scales, lower edge has two scale rows; two small scale rows between window eyelid and subocular scales; four anterior and three posterior postocular scales, anterior postoculars smaller than the posterior postocular scales; two pretemporal scale, smaller than the primary temporal scale, upper pretemporal scale touched by parietal, lower pretemporal scale, upper and lower postoculars and last supraciliaries scale; single primary temporal, primary temporal touching 6th and 7th supralabial scales; tow secondary temporal scales, the lower secondary temporal touching 7th supralabial and primary temporal scale, the upper secondary temporal touching parietal, lower pretemporal, and primary temporal scale, the secondary temporal larger than the primary temporal scale; seven infralabials, the sixth one being the largest (Image 2B); mental wider than postmental, transverse axis but shorter than longitudinal axis, postmental touching first and second infralabial only; two pairs of chinshields behind postmental, the first pair meeting in midline, the first chinshield in contact with second and third infralabial scales, the second pair in contact with third and forth infralabials, the second pair of chinshields separated by a single scale (Image 2C); dorsal body scales with three to five obtuse ridges, and lateral and ventral mid body scales smooth, the two vertebral series of scales feebly widened, 24 rows around body; 46 paravertebral scales; 54 scales between the mental and vent; the median preanals enlarged, outer preanals overlap with inner; dorsal tail scales with three obtuse ridges but some scales with four or five obtuse ridges, 1964

67 smooth subcaudals scale; three ridges on each dorsal scale on fore and hind limbs, ridges more prominent on hind limbs, scales on underside of limbs smooth; the fourth finger and fourth toe longer than others; the fourth finger having 14 smooth lamellae; the fourth toe having 16 smooth lamellae; the lamellar formulae for fingers and toes, respectively: 4>3>2>5>1 (Image 2D) and 4>3>5>2>1 (Image 2E). Digits having single row of scales dorsolaterally; scales of palm and sole elevated, six large, prominent “heel” scales, which can easily be separated from those of sole.

Colour in alcohol: Six dark brown cross bands from neck to base of tail, fourth bifurcated; there are twelve dark brown bands upon the tail; simultaneously rows of dark brown bands seen upon limbs. Four, broad, dark brown longitudinal bands upon head, starting from close to the ear. Band interspaces and venter off white (Image 1).

Colour in life: The colour pattern is the same with brighter colours. Colour changes from dark brown to black and off white to white.

Variation: The following differences were observed apart from the general description for D. halianus.

Specimen NMSL R.S.K II has a small interparietal; frontoparietals larger than the interparietal length; parietals touching each other behind interparietal. A specimen deposited in 1906, collected from Elehara (North Central Province) has the first two supraoculars in contact with frontal and the third supraocular in contact with frontoparietals.

Dasia subcaeruleum (Boulenger, 1891) Lygosoma subcaeruleum Boulenger, 1891: 289 Dasia subcaerulea—Smith, 1935: 278 Dasia subcoerulea [sic]—Smith, 1937: 226 Dasia haliana—Joshua & Sekar, 1984: Karthikeyan, 1991: 88

82;

Description of BNHS 1391: (Images 3 & 4) 28.xi.1984, snout to vent length (SVL) 89.54mm, Kalakkad Hills, Tirunelveli, Tamil Nadu. Coll. by A.J.T. Johnsingh and party.

Body moderately elongate. Head depressed and narrow (HD/HW ratio 0.53 and HD/HL ratio 0.37); elongated and (HD/NE ratio 0.47 and HL/SVL ratio 0.22); distinct from the neck; snout long (SE/HW ratio 0.58); longer than the eye width (EW/SE ratio 0.48); eye relatively lager than the ear (EW/EL ratio 3.22 and

Journal of Threatened Taxa | www.threatenedtaxa.org | August 2011 | 3(8): 1961–1974

Dasia halianus and D. subcaeruleum

L.J.M. Wickramasinghe et al.

Š L.J. Mendis Wickramasinghe

Image 3. The dorsolateral view of Dasia subcaeruleum BNHS 1391 (voucher specimen)

EW/EaW ratio 9.67); ear opening small (EL/HL ratio 0.06); snout to eye distance greater than the width of eye (SE/EW ratio 2.09). Body length equal in tail length (SVL/TL ratio 1.00), and round in cross section (TD/TW ratio 0.97).

Rostral slightly concave; supranasal present; no postnasal; frontonasal larger than the prefrontals along the longitudinal axis, lateral border touching first loreal and supranasal; prefrontals is separated, lower border touching both loreal scales, but touching the posterior loreal more than half, the posterior border touching the first supraocular, and frontal; frontal longer than its distance to tip of snout, and shorter than frontoparietals and interparietal combined; seven supraciliaris; four supraoculars, first one longer than wide, second one wider than long, first two in contact with frontal, third in contact with frontoparietal, fourth in contact with frontoparietal, parietal and upper pretemporal; frontoparietals distinct, its equal in interparietal length; parietals touching each other behind interparietal, parietal touching upper and lower pretemporal scales laterally, primary nuchal and two small scales touching parietal post laterally (Image 4A); non fused nasal

Image 4. Dasia subcaeruleum BNHS 1391 A - dorsal aspect, B - lateral aspect, and C - ventral aspect of head; D - lamellae on left fore limb, and E - lamellae on right hind limb.

and in contact with 1st supralabial; two loreal scales, anterior loreal touching nasal, supranasal, frontonasal, prefrontal, 1st and 2nd supralabial scales. Posterior loreal longer, and wider than the anterior loreal, posterior loreal touching prefrontal, 1st supraciliaries, upper and lower preocular scales. Lower border touching 2nd, 3rd, and 4th supralabials; two preocular scales, lower ones lager than the others; seven supraciliaries, in a row, the first one is lager than the others; seven supralabials, the last supralabial single, 5th at the mid orbit point; 10 subocular scales, smaller than the supraciliaries scales; the subocular row touching 5th to the 6th supralabial scales and primary temporal scale, the first subocular scale touching the presubocular and 5th supralabial scale, the last subocular scale touching the primary temporal scale; presubocular scale touching lower preocular, 4th and 5th supralabial scales; Lower eye lid scaly, four large scales on window eye lid, lower edge has two scale rows; two small scale rows between window of eyelid and subocular scales; five anterior and four posterior postocular scales, anterior postoculars smaller than the posterior postocular

Journal of Threatened Taxa | www.threatenedtaxa.org | August 2011 | 3(8): 1961â&#x20AC;&#x201C;1974

1965

Dasia halianus and D. subcaeruleum

L.J.M. Wickramasinghe et al.

scales; two pretemporal scales, smaller than the primary temporal scale; upper pretemporal scale touched by parietal lower pretemporal scale, upper and lower postoculars and last supraciliaries scale; single primary temporal, primary temporal touching 6th and 7th supralabial scales; two secondary temporal scales, the lower secondary temporal touching 7th supralabial and primary temporal scale, the upper secondary temporal touching parietal, lower pretemporal, and primary temporal scale, the secondary temporal larger than the primary temporal scale; seven infralabials, the fifth one being the largest (Image 4B); mental shorter than postmental in transverse axis but wider in longitudinal axis, touching first, second and third infralabials; two pairs of chinshields behind postmental, the first pair meeting in midline, the first chinshield in contact with third and forth infralabial scales, the second pair in contact with forth and fifth infralabials, the second pair of chinshields separated by a single scale (Image 4C); dorsal mid body scales smooth but dorsal back body scales with three obtuse ridges, lateral and ventral body scales smooth, the two vertebral series of scales feebly widened, 24 rows around mid body; 52 paravertebral scales; 56 scales between the mental and vent; the median preanals enlarged, outer preanals overlap with inner; dorsal tail scales with three obtuse ridges, 71 smooth subcaudals scale; three ridges on each dorsal scale on fore and hind limbs, ridges more prominent on hind limbs, scales on underside of limbs smooth; the fourth finger and fourth toe longer than others; the fourth finger having 15 smooth lamellae; the fourth toe having 18 smooth lamellae; the lamellar formulae for fingers and toes, respectively: 4>3>2>5>1 (Image 4D) and 4>3>5>2>1 (Image 4E). Digits having single row of scales dorsolaterally; scales of palm and sole elevated, eight pallets which look much the same as those of sole around heel.

Colour in alcohol: thin irregular dark brown cross bands with intermittent white spots from forelimbs to end of tail. Dark brown spots, seen on limbs. Four, thin, dark brown longitudinal bands beginning close to forelimbs moving towards head. Band interspaces and venter off white (Image 3).

1966

DISCUSSION Dasia halianus was introduced to science as Euprepes halianus Haly & Nevill, 1887 (in Nevill 1887), from the type localities Henarathgoda and Anuradhapura, Ceylon (Sri Lanka) and type material deposited in the NMSL (Haly & Nevill 1887) (Appendix 1). But the types are suspected to have been lost or misplaced during the upheavals of World War II (Kandamby 1997; Das et al. 1998). From its initial discovery till the year 1984, this species was considered to be endemic to the island (Haly 1893; Annandale 1906; Deraniyagala 1931; Smith 1935 and 1937; Taylor 1950; Deraniyagala 1953; Taylor 1953; Greer 1970; Inger 1980), until Joshua & Sekar on the 18th August 1984 reported D. halianus for the first time from the Thambiraparani River, Mundanthurai Wild Life Sanctuary, Tirunelveli District, Tamil Nadu, India.

Joshua & Sekar (1984) provided a text figure (black and white) of the specimen they found, but no mention of the specimen being deposited in a Museum or a relevant Institute. Although there were three species of Dasia described from India by that time, Joshua & Sekar mention that “The skink was strikingly different in colour and pattern from species so far known in India and was identified as D. halianus.” Also in this short discussion they do not provide any comparison between other congeners in the country. After this publication, however, there had been quite a number of sightings of this same species from the country (Karthikeyan 1991; Das 1994, 1997, 2001; Kumar et al. 2001). Such a specimen from the BNHS 1391, was critically examined, and compared with the Sri Lankan D. halianus specimens from NMSL, and from our results the following combination of characters clearly distinguished the Indian “D. halianus”, from that of the Sri Lankan D. halianus.

Sri Lankan D. halianus differs from the Indian specimen by the following combination of characters (the characters within brackets are of Indian D. halianus): primary nuchal and three small scales touching parietal post laterally (primary nuchal and two small scales touching parietal post laterally); Lower border of posterior loreal touching 2nd and 3rd supralabials or third (Lower border of posterior loreal touching 2nd, 3rd, and 4th supralabials); eight supraciliaries (seven supraciliaries); 12 subocular scales (10 subocular scales); six large scales on window

Journal of Threatened Taxa | www.threatenedtaxa.org | August 2011 | 3(8): 1961–1974

Dasia halianus and D. subcaeruleum

L.J.M. Wickramasinghe et al. © Collin McCarthy

Image 5. The dorsal view of type specimen of Dasia subcaeruleum BMNH 1946[1].8.15.55 011.

of eyelid (four large scales on window of eyelid); and small scales filling the gaps at the upper edge between larger scales (no small scales filing the gaps); four anterior postoculars (five anterior postoculars); three posterior postoculars (four posterior postoculars); sixth infralabial is largest (fifth infralabial is largest); mental wider than postmental in transverse axis (mental shorter than postmental in transverse axis); mental shorter than longitudinal axis (mental wider in longitudinal axis); postmental touching first and second infralabial (postmental touching first, second and third infralabials); first chinshield pair in contact with second and third infralabial scales (first chinshield pair in contact with third and forth infralabial scales); second chinshield pair in contact with third and forth infralabials (the second chinshield pair in contact with forth and fifth infralabials); dorsal body scales with three to five obtuse ridges (dorsal mid body scales smooth but dorsal back body scales with three obtuse ridges); six large, prominent “heel” scales (eight “heel” scales which look much the same as those of sole).

The Sri Lankan D. halianus can also be clearly separated from its Indian congener by the following combination of colour pattern features. Four broad,

dark brown longitudinal bands upon head, starting from close to the ear (vs Four thin, dark brown longitudinal bands beginning close to forelimbs moving towards head); six dark brown cross bands from neck to base of tail; there are twelve dark brown bands upon the tail (vs thin irregular dark brown cross bands with intermittent white spots from forelimbs to end of tail).

From the above results, we were able to conclude that the Indian D. halianus, in fact, matches the morphological characters of D. subcaeruleum. Type specimens of D. subcaeruleum, are found at the BMNH, under the following numbers 1946.8.15.55 (Image 5), and 1949.1.8.51 (Greer, 1970). Due to the incorrect identification in 1984, the mistake had been repeated until now that the species in India is D. halianus. As the Indian species can be confidently placed as D. subcaeruleum, D. halianus is indeed endemic to Sri Lanka.

Since there are quite a lot of recorded sightings of D. halianus from India after 1984, these sightings can now be considered as sightings of D. subcaeruleum, and thereby a distribution pattern of this species can be derived from earlier publications [(Kalakkad Hills, Tirunelveli, Tamil Nadu, Thambiraparani River, Mundanthurai Wildlife Sanctuary, Tirunelveli District, Tamil Nadu (Joshua & Sekar 1984), KalakadMundanthurai Tiger Reserve (Johnsingh 2001; Kumar et al. 2001), Mundanthurai Wildlife Sanctuary, Tamil Nadu (Karthikeyan 1991)]. At present the conservation status in India for D. subcaeruleum is Data Deficient (Molur & Walker 1998), and D. halianus is Critically Endangered. Hence according to IUCN criteria, for D. subcaeruleum, the species requires reassessment.

The present conservation status for D. halianus in Sri Lanka is Near Threatened (IUCN & MENR 2007).

Although the type localities of D. halianus are mentioned as Henarathgoda (07004’N & 80001’E) and Anuradhapura (08021’N & 80023’E), this species could only be found in the latter locality but not in the former, based on our field studies. However, Henarathgoda remains its type locality in most of the literature (Annandale 1906; Deraniyagala 1931; Smith 1935; Taylor 1950; Deraniyagala 1953; Das & de Silva 2005; Somaweera & Somaweera 2009), in spite of the fact that there remains no valid record after the initial sighting. Henarathgoda, is an area situated close to the present Gampaha Town (07005’N & 79059’E), located in the lowland wet zone. Therefore, the initial statement

Journal of Threatened Taxa | www.threatenedtaxa.org | August 2011 | 3(8): 1961–1974

1967

Dasia halianus and D. subcaeruleum

L.J.M. Wickramasinghe et al.

© L.J. Mendis Wickramasinghe

Image 6. Dorsal view of Dasia halianus deposited in 1906, collected from Elehara (North Central Province)

of distribution of D. halianus, in this locality could in fact be a mistake, which can very well be justified by the description of the type locality by Haly as “the hot and dry districts of Ceylon”, where Gampaha on the contrary belongs to the wet zone. Regardless, our field studies confirm that D. halianus does not exist at the Gampaha locality today.

According to Anandale, there exists a third specimen (half grown) from Horana collected and deposited on the 08 November 1901 by G.H. Swayne at the NMSL (Annandale 1906), without any mention of a district nor a province to relate this locality to. But according to our field studies and findings D. halianus is a species found only in the dry and intermediate zones of the country. P.E.P. Deraniyagala, in 1931 mentions that this species was found in “Horana”, in the North Central Province (Deraniyagala 1931).

But he himself later in 1953, states that the species was found in “Horana”, in the Western Province (Deraniyagala 1953). According to our field studies carried out so far, we have not been able to find D. halianus in the western province locality (wet zone), and there were no records from the Horana locality of the western province in the NMSL inventory. But D. halianus is found in the north central province, and 1968

there are records from the north central province in the NMSL inventory. Hence according to our studies we can confidently state that there is no evidence that D. halianus is found in the Horana (06043’N & 08003’E), nor anywhere in the wet zone of the western province.

After re-evaluating its conservation status of D. halianus remains Near Threatened due to its area of occurrence extending to more than 30,000km2, and its occupancy having a score of >60 points from available distribution data.

According to the museum inventory, there were ten specimens of D. halianus deposited in the NMSL. We were able to sort out four D. halianus specimens from the mixed up collection. Three specimens were recognized, and were in accordance to the inventory.

The remaining specimen was totally dried out and the labels were also destroyed, and was in an unrecognizable state (Image 6). Another specimen which could not be examined was found in the collection of exhibits.

According to the type description, two type specimens were deposited out of which one is a young individual and the other is an adult. Although there is a mention of Fig. 1, 2, and 3 of Plate 1, in the type description these were not present in the journal. The figures would no doubt have been good evidence to clarify the type specimens. Due to the absence of any figures the following from the adult type description will be good evidence in the identification of the adult type specimen, “White back with ten black bands, one on the nape one between the forelimbs; three on the back, one between the hind limbs, and four on the tail with remains of a fifth”.

In the inventory there were two specimens deposited under registry no. R.S.K II, but no mention of collection date and there locality. We were able to find one specimen of an adult which (Image 7), has a SVL of 74.65mm, in a labeled bottle under R.S.K. II. Six body bands, which matches the type description, were seen on this specimen, but tail bands were very difficult to recognize in the regenerated tail because of discolouration. R.S.K II also has the following characters, a small interparietal, frontoparietals are larger than the interparietal length, parietals touching each other behind interparietal. All these characters of R.S.K II, can be seen in the drawing done by Deraniyagala (Deraniyagala 1931, 1953).

The short tail length compared to its body length in the drawing, matches that of the regenerated tail of

Journal of Threatened Taxa | www.threatenedtaxa.org | August 2011 | 3(8): 1961–1974

Dasia halianus and D. subcaeruleum

L.J.M. Wickramasinghe et al. © L.J. Mendis Wickramasinghe

Image 7. Lateral view of NMSL R.S.K. II.

R.S.K II. Hence, we believe that this specimen was selected by Deraniyagala for his drawing. The two rupee note (Image 8) printed in the nineteen seventies, has a drawing of D. halianus, because of its shape, proportion and the scales on the head, we feel that the artist (Mr. Lucky Senanayake) had taken the same drawing by Deraniyagala with minor changes. This drawing is good evidence to confirm that R.S.K II, is a specimen belonging to Deraniyagala’s time hence is ruled out from any doubts of being any of the type specimens.

A specimen in the British Museum under BMNH 1908.3.19.3 (Image 9) from Ceylon presented by Prof.

Graham Kerr, accessioned on the 19 March 1908, having SVL 68mm and a tail length of 57mm (pers. comm. Colin McCarthy 2007), and the body bands, along with the tail matches well with the adult type description, and hence can be confidently placed as that of the adult type specimen, and we thus place this specimen of BMNH as the lectotype of D. halianus.

In the Ceylon Administration Report 1893, prepared by Mr. Haly, he mentions “A third specimen of Lygosoma halianus was purchased from the

Image 8. A side of a Two Rupee note, of the Democratic Socialist Republic of Sri Lanka, printed in 1979, by the Bank of Ceylon.

Southern Province. The rarity of this species is accounted for by the fact that it lives on tops of high trees”. In contrast Annandale in 1906, mentions that he used a third half grown specimen deposited in the NMSL, a specimen collected and presented by G.H. Swayne, 08 November 1901, for his description. This specimen which Annandale mentions should actually be the fourth, and is clearly evident from its location and date that this was not the specimen which Haly purchased. Hence it can be concluded that Annandale was not aware of the third specimen which Haly mentions in his report. Annandale had used a separate specimen, from that of his description for his drawing.

The drawing in Annandale’s description is captioned as “young Thyconyx halianus” (Image 10), which was three times enlarged, and matches with the juvenile

Journal of Threatened Taxa | www.threatenedtaxa.org | August 2011 | 3(8): 1961–1974

1969

Dasia halianus and D. subcaeruleum

L.J.M. Wickramasinghe et al. © Collin McCarthy

Image 9. Dorsolateral view of the lectotype Dasia halianus BMNH 1908.3.19.3.

type description “sixteen black bands, one in front and one behind the fore limbs” hence the drawing is the only sketch currently available of the missing juvenile paralectotype.

Another specimen also exists in the Zoological Survey of India under ZSI 15977 (Das et al. 1998), the handwritten label attached to the specimen states “Thyconyx halianus (Nevill) Annandale”. The next label states that this is a “co-type”, hence we feel that this specimen could have been what Annandale had selected to measure in his paper, which happens to be the fourth specimen, and is ruled out of being any of the type specimens.

From our studies in a fully grown tail there should be 10 to 12 black bands, hence according to the type description we can infer that the tail of the adult type specimen was regenerated. Also an important comment to be made on the type description is, “the single prefrontal touches both rostral and vertical.” which could well be the fronto nasal and not the prefrontal, because there are two prefrontals and this never touches the rostral. The specimen collected by P.E.P. Deraniyagala, from Galatabendiyawa Estate (there is a mention about another specimen collected in 1935, which we were not able to locate in the NMSL collection) and another 1970

Image 10. The sketch done by Annandale (1906) of the juvenile paralectotype.

from Wilpattu collected in 1967, and donated by Mr. Aditya were the other two recognized specimens. Two specimens apart from those in the inventory were also found (see Table 1 & 2). None of the specimens at the NMSL matched the figures (Fig. 2 & Fig. 3) in the publication by Anandale 1906. Finally this work has taxonomically established the status of D. halianus in Sri Lanka (Image 11), and has redescribed the Indian species D. subcaeruleum.

REFERENCES Annandale, A. (1906). New and interesting lizards in Colombo museum. Spolia Zeylanica 3: 189–192.

Bambaradeniya, C.N.B. (2001). Threatened herpetofauna of Sri Lanka, pp. 91–101. In: Bambaradeniya, C.N.B. & V.N. Samarasekara (eds.). An Overview of the Threatened Herpetofauna of South Asia. The World Conservation Union, Sri Lanka, vi+118pp.

Batuwita, S. & R. Pethiyagoda (2007). Description of a new

Journal of Threatened Taxa | www.threatenedtaxa.org | August 2011 | 3(8): 1961–1974

Dasia halianus and D. subcaeruleum

L.J.M. Wickramasinghe et al.

Table 1. The morphometric measurements (mm) of the voucher specimens of Dasia subcaeruleum and Dasia halianus normalized to the Head length (HL). * mark indicates broken tail.

Dasia subcaeruleum (BNHS)

Dasia halianus (NMSL)

1391

RSKII

RSKII(b)

001

002

003

004

Mean

SD

Range

AG

2.27

2.59

2.32

2.23

2.14

2.49

1.81

1.81 - 2.59

33.55

11.82

DBE

0.44

0.47

0.45

0.50

0.46

0.50

0.49

0.45 - 0.50

6.91

2.63

DFE

0.35

0.36

0.35

0.39

0.35

0.37

0.35

0.35 - 0.39

5.24

1.84

EaW

0.02

0.04

0.02

0.02

0.04

0.03

0.03

0.02 - 0.04

0.45

0.23

EE

0.63

0.71

0.63

0.62

0.61

0.68

0.53

0.53 - 0.71

9.29

3.27

EL

0.06

0.06

0.06

0.04

0.05

0.07

0.06

0.04 - 0.07

0.83

0.49

EN

0.27

0.29

0.27

0.28

0.28

0.28

0.28

0.27 - 0.29

4.05

1.42

EW

0.19

0.20

0.20

0.22

0.22

0.23

0.30

0.20 - 0.30

3.24

1.53

FL

0.51

0.48

0.49

0.43

0.41

0.48

0.36

0.36 - 0.49

6.55

2.31

HD

0.37

0.38

0.39

0.39

0.38

0.38

0.33

0.33 - 0.39

5.45

1.70

HL

1.00

1.00

1.00

1.00

1.00

1.00

1.00

1.00 - 1.00

14.52

5.07

HW

0.69

0.76

0.66

0.66

0.64

0.73

0.60

0.60 - 0.76

9.92

3.70

IN

0.16

0.17

0.16

0.19

0.20

0.17

0.21

0.16 - 0.21

2.63

0.98

NE

0.77

0.84

0.79

0.83

0.80

0.76

0.91

0.76 - 0.91

11.79

4.14

SE

0.40

0.42

0.41

0.40

0.42

0.42

0.42

0.40 - 0.42

6.00

2.21

SED

0.89

0.91

0.90

0.93

0.92

0.88

1.06

0.88 - 1.06

13.42

4.90

SN

0.12

0.14

0.13

0.14

0.15

0.13

0.19

0.13 - 0.19

2.09

0.86

SVL

4.49

4.75

4.56

4.41

4.25

4.64

3.97

3.97 - 4.75

65.01

22.56

TBL

0.51

0.56

0.53

0.50

0.54

0.51

0.46

0.46 - 0.56

7.57

2.32

TD

0.44

0.50

0.46

0.38

0.40

0.46

0.25

0.25 - 0.50

6.18

2.03

TL

4.48

0.95 *

3.05

4.63

0.61 *

4.25

1.16 *

0.61 - 4.63

36.69

31.36

TW

0.45

0.47

0.49

0.44

0.44

0.49

0.34

0.34 - 0.49

6.61

2.22

Table 2. The scale and lamellae counts of the voucher specimens of Dasia subcaeruleum and Dasia halianus. * marks indicate broken tail.

Dasia subcaeruleum (BNHS)

Dasia halianus (NMSL)

1391

RSKII

RSKII(b)

001

002

IL

7

7

6

7

7

003 7

004 7

LF1

8

10

9

9

8

10

10

LF2

10

12

12

11

11

12

12

LF3

14

13

14

13

13

13

14

LF4

15

14

16

14

14

14

15

LF5

11

12

12

11

12

11

12

LT1

9

8

9

8

8

8

9

LT2

12

12

14

12

12

11

11

LT3

17

14

18

15

16

15

16

LT4

18

17

19

16

17

17

18

LT5

15

15

15

13

13

13

15

PV

52

46

48

46

46

45

48

SC

71

12*

39

67

8*

64

13*

SLG

7

7

7

7

7

7

7

SLO

5

5

5

5

5

5

5

SMB

24

24

24

24

24

24

3

V

56

54

54

54

55

56

57

Journal of Threatened Taxa | www.threatenedtaxa.org | August 2011 | 3(8): 1961â&#x20AC;&#x201C;1974

1971

Dasia halianus and D. subcaeruleum

L.J.M. Wickramasinghe et al.

species of Sri Lankan litter skink (Squamata: Scincidae: Lankascincus). Ceylon Journal of Science (Bio Science) 36(2): 80–87.

Cox, M.J., P.P. Van Dijk, J. Nabhitabata & K. Thirakhupt (1998). A Photographic Guide to Snakes and Other Reptiles of Peninsular Malaysia, Singapore and Thailand. New Holland Publishers (U.K.) Ltd., London, 144pp.

Daniel, J.C. (2002). The Book of Indian Reptiles and Amphibians. Oxford university press, viii+238pp.

Das, I. (1994). The reptiles of South Asia: checklist and distribution summery. Hamadryad 19: 15–40.

Das, I. (1997). Checklist of the reptiles of India with English common names. Hamadryad 22(1): 32–45.

Das, I. (1999). Biogeography of the amphibians and reptiles of the Andaman and Nicobar Islands, India, pp. 43–77. In: Ota, H. (ed.), Tropical Island Herpetofauna. Elsevier, 353pp.

Das, I. (2001). Biodiversity and the biogeography of the herpetofauna of Southern Asia, pp. 1–38. In: Bambaradeniya, C.N.B. & V.N. Samarasekara (eds.). An Overview of the Threatened Herpetofauna of South Asia. The World Conservation Union, Sri Lanka, vi+118pp.

Das, I. (2002). A Photographic Guide to The Snakes and Other Reptiles of India. New Holland Publishers (U.K.) Ltd., London, 144pp.

Das, I., B. Dattaguota & N.C. Gayen (1998). History and catalogue of reptile types in the collection of the zoological survey of India. Journal of South Asian Natural History 3(2): 121–172.

Das, I., & A. de Silva (2005). Snakes and Other Reptiles of Sri Lanka. New Holland Publishers (U.K.) Ltd., London, 144pp.

Das, I., A. de Silva & C.C. Austin (2008). A new species of Eutropis (Squamata: Scincidae) from Sri Lanka. Zootaxa 1700: 35–52.

Deraniyagala, P.E.P. (1931). Some Ceylon Lizards. Ceylon Journal of Science (Section B), 16(2): 139–180.

Deraniyagala, P.E.P. (1953). A Coloured Atlas of Some Vertebrates From Ceylon. Vol. 2. Tetrapod Reptilia. The Ceylon Government Press, vii+101pp. de Silva, A. (1994). An introduction to the herpetofauna of Sri Lanka. Lyriocephalus 1(1&2): 3–19. de Silva, A. (1995). The herpetofauna of Sri Lanka, checklist and common names part 1, Testudines, Crocodylia and Lacertilia. Lyriocephalus 2(1&2): 26–27. de Silva, A. (1996). The Herpetofauna of Sri Lanka: A Brief Review. Published by author, xv+99pp. de Silva, A. (2006). Current status of the reptiles of Sri Lanka, pp. 34-163. In: Bambaradeniya, C.N.B. (eds.). Fauna of Sri Lanka: Status of Taxonomy, Research and Conservation.

The World Conservation Union, Sri Lanka and Government of Sri Lanka, 308pp. de Silva, A., C.C. Austin, A.M. Bauer, S. Goonaewardene, J. Drake, P. de Silva, T. Shripathy, S. Ramesh, K. Suthagar & A. Kajatheepan (2005a). Observations on the skinks inhabiting the Knuckles massif: with special reffernce to genus Lankascincus. Liriocrphalus Special Issue 6(1&2): 1972

95–100. de Silva, A., A.M. Bauer, C.C. Austin, S. Goonaewardene, J. Drake, P. de Silva, M.G.T.H. Aberathna, T. Dassanayaka, G.S. Samarawickrama, R.D.C.K. Dassanayaka, A.M.R.K. Amarakoon & M.M. Goonasekera (2005b).

The diversity of the Knuckles ecosystem, with special reference to its herpetofauna. Liriocrphalus Special Issue 6(&): 13–33.

DWC (2007a). Biodiversity Baseline Survey: Ritigala Strict Natural Reserve. Consultancy Services Report prepared by Green, M.J.B. (ed.), De Alwis, S.M.D.A.U., Dayawansa, P.N., How, R., Singhakumara, B.M.P., Weerakoon, D. and Wijesinghe, M.R. ARD Inc in association with Infotech Ideas and Greentech Consultants. Sri Lanka Protected Areas Management and Wildlife Conservation Project (PAM&WCP/CONSULT/02/BDBS), Department of Wildlife Conservation, Ministry of Environment and Natural Resources, Colombo, 44pp.

DWC (2007b). Biodiversity Baseline Survey: Wasgamuwa National Park. Consultancy Services Report prepared by Green, M.J.B. (ed.), De Alwis, S.M.D.A.U., Dayawansa, P.N., How, R., Singhakumara, B.M.P., Weerakoon, D. and Wijesinghe, M.R. ARD Inc in association with Infotech Ideas and Greentech Consultants. Sri Lanka Protected Areas Management and Wildlife Conservation Project (PAM&WCP/CONSULT/02/BDBS), Department of Wildlife Conservation, Ministry of Environment and Natural Resources, Colombo, 44pp.

Eremchenko, V.K. & I. Das (2004). Kaestlea: A new genus of scincid lizards (Scincidae: Lygosominae) from the Western Ghats, South-Western India, Hamadryad 28(1&2): 43-50.

Greer, A.E. (1970). The relationships of the skinks referred to the genus Dasia. Breviora 348: 1–30.

Greer, A.E. (1991). Lankascincus, a new genus of skink lizards from Sri Lanka, with description of three new species.

Journal of Herpetology 25(1): 59–64.

Haly, A. & H. Nevill (1887). Ceylon science. Taprobanian 2: 55–58.

Haly, A. (1893). Ceylon Administration Report 1893: 4: 13.

Inger, R.F., & W.C. Brown (1980). Species of the scincid genus Dasia (Gray). Fieldiana Zool 3: 1–11.

IUCN Sri Lanka (2000). The 1999 List of Threatened Fauna and Flora of Sri Lanka. The World Conservation Union, Sri Lanka, viii+113pp.

IUCN Sri Lanka & Ministry of environmental and natural resources Sri Lanka (2007). The 2007 Red List of Threatened Fauna and Flora of Sri Lanka. The World Conservation Union, Sri Lanka and Ministry of Environmental and Natural Resources Sri Lanka, xiii+148pp.

Johnsingh, A.J.T. (2001). The Kalakad–Mundanthurai Tiger Reserve: A global heritage of biological diversity. Current Science 80(3): 378–388.

Joshua, J., & A. G. Sekar (1984). Range extension of the skink Dasia haliana (H. Nevill, 1887). Journal of Bombay Natural History Society 82: 422-423.

Kandamby, D. S. (1997). Herpetological types reposed in

Journal of Threatened Taxa | www.threatenedtaxa.org | August 2011 | 3(8): 1961–1974

Dasia halianus and D. subcaeruleum

the National Museum Colombo, Sri Lanka. Lyriocephalus 3(1): 31–33.

Karthikeyan, S. (1991). Sighting of the arboreal skink Dasia haliana at Mundanthurai Wildlife Sanctuary, Tamil Nadu.

Journal of the Bombay Natural History Society 88(1): 122–123.

Karunarathna, D.M.S.S., L.J.M. Wickramasinghe, V.A.P. Samarawickrama, & D.A.I. Munindradasa (2008).

The range extension of genus Chalcides Laurenti, 1768 (Reptilia: Scincidae) in to Sri Lanka. Russian Journal of Herpetology 15(3): 225–228.

Kumar, A., R. Chellam, B.C. Choudhury, D. Mudappa, V. Karthikeyan, N.M. Ishwar & B. Noon (2001). Impact of rainforest fragmentation on small mammals and herpetofauna in the Western Ghats, south India. A summary of research findings. Occasional paper, 34pp.

Mausfeld, P. & A. Schmitz (2003). Molecular phylogeography, intraspecific variation and speciation of the Asian scincid lizard genus Eutropis, 1843 (Squamata: Reptilia: Scincidae): taxonomic and biogeographic implications. Organisms Diversity and Evolution 3: 161–171.

Ministry of Forestry and Environment (2005). Biodiversity Conservation in Sri Lanka: A Framework of Action..

Ministry of Environmental and Natural Resources Sri Lanka (Reprint), 114pp.

L.J.M. Wickramasinghe et al.

Molur, S. & S. Walker (eds.). (1998). Report on the Workshop “Conservation Assessment and Management Plan for Reptiles of India”. BCPP-Endangered Species Project, 175pp.

Murthy, T.S.N. (1990). A Field Book of the Lizards of India.

Record Zoological Survey of India. Occasional papers 115(8): 49.

Smith, M.A. (1935). The Fauna of British India, Including Ceylon and Berma. Reptilia and Amphibia. Vol. II: Sauria.

Taylor and Francis, London, xii+583.

Smith, M.A. (1937). A review of the genus Lygosoma (Scincidae: Reptilia) and its allies. Record of Indian Museum 39(3): 213–234.

Somaweera, R. & N. Somaweera (2009). Lizards of Sri Lanka, A Colour Guide with Field Keys. Edition Chimaira, Frankfurt Am Main, 303pp.

Taylor, E.H. (1950). Ceylon lizards of the family Scincidae.

The University of Kansas Science Bulletin 33(2): 481–518.

Taylor, E.H. (1953). A review of the lizards of Ceylon. The University of Kansas Science Bulletin 35(2): 1537–1542.

Wickramasinghe L.J.M., R. Rodrigo, N. Dayawansa & U.L.D. Jayantha (2007). Two new species of Lankascincus (Squamata: Scincidae) from Sripada Sanctuary (Peak Wilderness) in Sri Lanka. Zootaxa 1612: 1–24.

Appendix 1.

Haly, A. & H. Nevill (1887). Scincidae of Ceylon. Taprobanian vol. 2, (part II): 55-58.

This beautiful and distinct skink has long been in the Colombo Museum, and the director, Mr. Haly, has kindly drawn up for me the following diagnosis; as I have had the specimens figured for this journals, I cannot agree with him that it is better to leave them unnamed, in case they are already described, and the description overlooked by us. Unless his description and my figures be named, they cannot be registered for reference. It is known from the hot and dry districts of Ceylon, as yet.

Mr. Haly’s diagnosis is as follows On a probably new species of Euprepes.

Some years ago a specimens of a skink (Euprepes) from Henarathgoda was presented by Mrs. Horsford, and since that a young one of the same species from Anuradapura has been presented. Nothing like this species has described in Gunther’s Reptiles of British India, and as it is exceedingly rear, it is probably as yet undescribed.

Synopsis. - A pair of supranasal shields; the whole of the lower eyelid scaly; opening of the ear very small; each scale with four keels.

Description. - Adult, a pair of very narrow supranasal shields; the single prar-frontal touches both rostal and vertical. The fifth upper labial is below the eye, a little longer than high. Ear opening small, with no lobules. Lower eyelid scaly. Scales with four very weak keels anteriorly, becoming strong posteriorly, reduced to three on the tail, in thirty or thirty-one longitudinal series between the limbs, and twenty-four transverse series. Preanal scales not enlarged; sub-caudals rather larger than the others. Limbs of moderate strength. Third hind-toe nearly as long as the fourth.

White back with ten black bands, one on the nape, one between the fore limbs; three on the back, one between the hind limbs, and four on the tail with remains of a fifth. Black bands run from the nostril through the eyes, which are connected by a band across the occiput; this band throws forward a band each side of the vertical.

Young1 - In the young the suture of the rostral and pre-frontal is much broader. The prolongations of the occipital bands meet in a point in the pre-frontal, and are almost united in the middle, leaving two white spots on the vertex. There are sixteen black bands, one in front and one behind the fore limbs, and nine on the tail. The scales are smooth very faint indications of keels.

Appendix 2. Comparative material examined.

Dasia subcaeruleum (Boulenger, 1891). BNHS 1391. 28.xi.1984, 89.54mm (SVL), Kalakkad Hills, Tirunelveli, Tamil Nadu. Coll.

by A. J. T. Johnsingh and party.

Dasia halianus (Haly and Nevill, 1887). NMSL RSK11, 74.65mm (SVL), Ceylon. NMSL RSK11 (b), 79.15mm (SVL), Wilpattu, Donated by Mr. L. A. Aditya, 25 November 1967. NMSL 001 (uncatalogued specimen) 59.13mm (SVL). NMSL 002 (uncatalogued specimen) 61.71mm (SVL). NMSL 005 (uncatalogued specimen) 79.75mm (SVL), Galatabendiyawa Estate, Nikawveratiya, Sept.

1934. NMSL 006 (uncatalogued specimen) 35.68mm (SVL), Galatabendiyawa Estate, Nikawveratiya, Sept. 1934.

Journal of Threatened Taxa | www.threatenedtaxa.org | August 2011 | 3(8): 1961–1974

1973

Dasia halianus and D. subcaeruleum

L.J.M. Wickramasinghe et al. © L.J. Mendis Wickramasinghe

Image 11. Dasia halianus live specimen, from Kuda-oya, Sri Lanka.

1974

Author Details: L.J. Mendis Wickramasinghe, is the President of the Herpetological Foundation of Sri Lanka. Having over 17 years of field herpetological experience in Sri Lanka with a focus on taxonomic identification and biodiversity assessments. Currently leading several projects on herpetology in the country.

Nethu Wickramasinghe, is an MPhil (chemistry) student at the University of Peradeniya, completed the basic degree in chemistry at the University of Delhi. Currently an active member of the Herpetological Foundation of Sri Lanka.

Lalith Kariyawasam, is an MPhil (land snails) student at the University of Kelaniya, and currently a research assistant in the herpetological section of the Department of National Museums, Sri Lanka.

Acknowledgements: First author wishes to thank the Durell Wildlife Conservation Trust for giving a scholarship for the Amphibian Biodiversity Conservation course in India, which facilitated the reference of specimens at the BNHS, to the Nagao Natural Environment Foundation for part funding, to the support rendered by the Biodiversity Secretariat to Mr. Gamini Gamage (Director, Bio Diversity), Mrs Hasula Wickramasinghe, and Mrs. Dakshini Perera, for collaborating to do this work and for all the support, the Department of Wildlife Conservation for granting permission, to conduct the current project (Permit no. WL/3/3/354), especially to the former Director General Mr. Ananda Wijesooriya, to Dr. Chandrawansa Pathiraja (Director General) and the Deputy Director S.B. Dissanayake (Research and Training). to Dr. Channa Bambaradeniya, Mr. Bathiya Kekulandala, Dr. David Gower, Dr. Collin McCarthy, Mr. Varad Giri, Dr. P. N. Dayawansa, Dr. Sanjay Molur, and Ravi Chandran for encouraging and supporting this output. The authors wish to thank the Director National Museums of Sri Lanka, Dr. Nanda Wickramasinghe and staff members (Mrs. Swarnapali Samaradivakara, Mrs. Manaram de Silva Mrs. Mayuri Munasinghe and Mrs. Manori Nandasena), are gratefully acknowledged for their assistance in museum reference work.

Mr. Naresh Chaturvedi, the Curator of Bombay Natural History Society and the staff of the herpetology section of BNHS are thanked for their assistance in the collection reference work. Mr. Sameera Suranjan Karunarathna, Mr. Dulan Ranga Vidanapathirana, Mr. Dinal Samarasinghe, Major Udesh Rathnayake and Mr. W.L.D.P.T.S. de A. Goonatilake provided valuable literature relevant for this work. Mr. Mahesh Chaturanga, Mr. Lalith Senanayake and Mr. Kasun Pradeep Benaragama assisted in developing the photographs and Sinhala abstract. Mr. Jagath Krishantha, Mr. Ruwan Chinthaka, for their support and encouragement.

Finally, we also like to thank Dr. Aurélien Miralles and Mr. Jagath Gunawardana for their valuable comments.

Journal of Threatened Taxa | www.threatenedtaxa.org | August 2011 | 3(8): 1961–1974

JoTT Review

3(8): 1975–1980

Emerging trends in molecular systematics and molecular phylogeny of mayflies (Insecta: Ephemeroptera) K.G. Sivaramakrishnan 1, K.A. Subramanian 2, M. Arunachalam 3, C. Selva Kumar 4 & S. Sundar 5 Flat No.3, Rams Apartments, No.7 Natesan Street, T. Nagar, Chennai, Tamil Nadu 600017, India Zoological Survey of India, Western Regional Station, P.C.N.T. Post, Rawet Road, Akurdi, Pune, Maharastra 411044, India 3,4,5 Sri Paramakalyani Centre for Environmental Sciences, Manonmaniam Sundaranar University, Alwarkurichi, Tamil Nadu 627412, India Email: 1 kgskrishnan@gmail.com, 2 subbuka.zsi@gmail.com (corresponding author), 3 arunacm@gmail.com, 4 selvaaa06@gmail.com, 5 sundarstreco@gmail.com 1 2

Date of publication (online): 26 August 2011 Date of publication (print): 26 August 2011 ISSN 0974-7907 (online) | 0974-7893 (print) Editor: V.V. Ramamurthy Manuscript details: Ms # o2661 Received 29 December 2010 Final received 21 July 2011 Finally accepted 29 July 2011 Citation: Sivaramakrishnan, K.G., K.A. Subramanian, M. Arunachalam, C.S. Kumar & S. Sundar (2011). Emerging trends in molecular systematics and molecular phylogeny of mayflies (Insecta: Ephemeroptera). Journal of Threatened Taxa 3(8): 1975–1980.

Copyright: © K.G. Sivaramakrishnan, K.A. Subramanian, M. Arunachalam, C. Selva Kumar & S. Sundar 2011. Creative Commons Attribution 3.0 Unported License. JoTT allows unrestricted use of this article in any medium for non-profit purposes, reproduction and distribution by providing adequate credit to the authors and the source of publication.

Author Detail: see end of this article.

Author Contribution: KGS and KAS conceived and prepared the review. MA actively participated in the discussion of preparation of the manuscript and provided critical inputs. CSK and SS helped in compiling the literature.

Acknowledgements: K.G.Sivaramakrishnan is grateful to Dr. M. Arunachalam for having invited him to Sri Paramakalyani Centre for Environmental Sciences, Manonmaniam Sundaranar University, Alwarkurichi, Tamilnadu, India. He is indebted to authorities of Manonmaniam Sundaranar University for having offered facilities to carry out a UGC Major Project, during which period he could interact with co-authors to organize this review.

K.A.Subramanian is grateful to the Director, Zoological Survey of India for providing facilities to prepare the manuscript.

Abstract: Current trends are reviewed in the molecular systematics and phylogeny of the Ephemeroptera (mayflies), an ancient monophyletic lineage of pterygote insects. Theories of mayfly origins are analyzed, followed by a discussion of higher classification schemes in light of recent developments in molecular systematics. Ephemeroptera evolution is a classic example of ancient rapid radiation, presenting challenges for phylogenetic analysis.

The utility of combined studies of morphological and molecular data is substantiated with examples and the role of molecular systematics in unraveling the taxonomy of cryptic species complexes is highlighted. The importance of DNA barcoding in mayfly taxonomy is discussed in the light of recent progress, and future contributions of genetics to the study of taxonomy, ecology and evolution in mayflies are discussed.

Keywords: Cryptic species, DNA barcoding, Ephemeroptera, molecular phylogeny, molecular systematics.

INTRODUCTION The order Ephemeroptera presently encompasses over 3000 species and 400 genera, constituting at least 42 described families (Barber-James et al. 2008). The Ephemeroptera (mayflies) are an archaic lineage of insects, dating back to the late Carboniferous or early Permian periods, some 290 mya (Brittain & Sartori 2003). They occupy freshwater and brackish water habitats across the world, with the exception of Antarctica.

The nymphs are immature stages inhabiting lentic and lotic waters.

The imagos or adults are terrestrial; they lack mouth parts and do not feed, relying on nutritional build up during immature stages. They have an ephemeral lifespan of a day or two and their only function is reproduction. The presence of a subimago with functional wings at the penultimate moult is unique to pterygote insects. The winged stages of Ephemeroptera, as with Odonata (dragonflies and damselflies) and the extinct Palaeodictyoptera, cannot fold their wings horizontally over the abdomen as neopterans can.

This article briefly reviews current trends in the molecular systematics and phylogeny of the Ephemeroptera and discusses how combined analysis of morphological and molecular data can be used to fine tune phylogenetic conclusions.

Mayfly origins

OPEN ACCESS | FREE DOWNLOAD

The phylogenetic position of Ephemeroptera within the winged insects

Journal of Threatened Taxa | www.threatenedtaxa.org | August 2011 | 3(8): 1975–1980

1975

Mayfly systematics and phylogeny

K.G. Sivaramakrishnan et al.

(Pterygota) is hotly debated by systematists, and significant disagreement still exists in morphological and molecular studies. The first complete mitochondrial genome of a heptageniid mayfly, Parafronurus youi was sequenced using a long PCR-based approach

by Zhang et al. (2008). In their analysis, the basal Ephemeroptera hypothesis (Ephemeroptera versus (Odonata + Neoptera)) was supported. This result also received strong support by the nucleotide and amino acid datasets from mitochondrial protein-coding genes with BI and ML analyses. Zhang et al. (2008) tentatively concluded that mitochondrial genomes can answer the difficult question of the basic relationships among the winged insects. Ephemeroptera evolution is a classic example of “ancient rapid radiation of insects” presenting challenges for phylogenetic analysis because such radiations take place over short periods of time and allow few distinctive phylogenetic markers to accumulate among lineages.

The Ephemeroptera, Odonata and Neoptera present a challenging phylogenetic tree shape, regardless of their true relationships, because the first pterygotes may have emerged up to 400 mya, but the earliest representatives of their extant descendants is much younger than the first emergence of the lineage whose relationships are in question (Whitfield & Kjer 2008).

Molecular systematics and higher classification The original subordinal classification of McCafferty & Edmunds (1979), based mostly on thoracic morphology and wing pad position, comprised the holophyletic suborder Pannota and the paraphyletic suborder Schistonota indicating the retention of certain plesiomorphic (ancestral) traits. It was realized that monophyly derived from synapomorphy (shared derived characters) should be the driving force behind any taxonomic classification (Hennig 1966, 1979; Farris 1979). Later, McCafferty (1991) proposed 3 different suborders (Pisciforma, Setisura and Rectracheata) and traced phylogenetic relationships within and among the suborders. Concurrent to McCafferty’s work, Kluge (1988, 1998) independently proposed two suborders for Ephemeroptera. His suborder Furcatergalia is equivalent to McCafferty’s Rectracheata, except the exclusion of Oniscigastridae form Furcatergalia.

The other suborder proposal (Kluge 1988) was 1976

Costatergalia, which is equal to McCafferty’s (1991) Pisciforma + Setisura + Oniscigastridae. Topological comparison of Kluge’s system and McCafferty’ system of mayfly classification is presented in Fig. 1, after Ogden et al. (2009). In contrast to previous hypotheses based on morphological observations, the relationships inferred from the molecular data (Ogden & Whiting 2005) were congruent in some cases, but incongruent in others. In their analysis, the groups, Furcatergalia, Pannota, Carapacea, Ephemerelloidea and Caenoidea and 15 families were supported as monophyletic.

On the other hand, Setisura, Pisciforma, Baetoidea, Siphlonuroidea, Ephemeroidea, Heptagenoidea and five families (having more than one taxon represented) were not supported as monophyletic.

However, evidence supports the notion that combined data (morphology + molecular data) analysis provides a more robust estimate of phylogenetic relationships. The study of Ogden et al. (2009) represents the first formal morphological and combined (morphological and molecular) phylogenetic analyses of the order Ephemeroptera.

Taxonomic sampling comprised 112 species in 107 genera, including 42 recognized families (all major lineages of Ephemeroptera). Morphological data consisted of 101 morphological characters. Molecular data were acquired from DNA sequences of 12S, 16S, 18S, 28S and H3 genes. The Asian genus Siphluriscus (Siphluriscidae) was supported as sister to all other mayflies. The lineages Carapacea, Furcatergalia, Fossoriae, Pannota, Caenoidea and Ephemerelloidea were supported as monophyletic. However, some recognized families (for example, Ameletopsidae and Coloburiscidae) and major lineages (such as Setisura, Pisciforma and Ephemeroidea among others) were not supported as monophyletic, mainly due to convergences within nymphal characters (Ogden et al.

2009).

Efficacy of combined morphological and molecular phylogeny and systematics - examples from the Ephemeroptera It is quite obvious that most previous reconstructions of phylogeny and classification were strongly hampered by superficial external morphological similarities, which do not always reflect the true phylogeny of the

Journal of Threatened Taxa | www.threatenedtaxa.org | August 2011 | 3(8): 1975–1980

Mayfly systematics and phylogeny

K.G. Sivaramakrishnan et al.

Figure 1. Topological comparison of Kluge’s system and McCafferty’s system of mayfly classification (after Ogden et al.

2009).

Order. Homoplasies therefore seem a dominant trait in mayfly morphology and behaviour, especially in nymphs (Ogden et al. 2009) and combined analysis may solve many riddles. Apart from the outstanding recent contribution of Ogden et al. (2009) on these lines towards evolving a new paradigm in mayfly phylogeny, some families notably, Leptophlebiidae (O’Donnell & Jockusch 2008), Baetidae (Gattolliat et al. 2008) and Ephemerellidae (Ogden et al. 2009) have received considerable attention regarding intrafamilial relationships, in which molecular phylogenetic tools were extensively employed.

Using two nuclear genes (the D2 + D3 region of 28S ribosomal DNA and histone H3) and maximum parsimony (MP), maximum likehood (ML) and Bayesian inference (BI), O’Donnell and Jockusch (2008) inferred the evolutionary relationships of

69 leptophlebiids sampled from six continents and representing 30 genera plus 11 taxa of uncertain taxonomic rank from Madagascar and Papua New Guinea. Although they did not recover monophyly of the Leptophlebiidae, monophyly of two of the three leptophlebiid subfamilies, Habrophlebiinae and Leptophlebiinae, was recovered with moderate to strong support in most analyses. The Atalophlebiinae was rendered paraphyletic as a result of the inclusion of numbers of Ephemerellidae or the Leptophlebiinae clade. For the species-rich Atalophlebiinae, four groups of taxa were recovered with moderate to strong branch support: (i) an endemic Malagasy clade, (ii) a Paleoaustral group, a pan-continental cluster with members drawn from across the Southern Hemisphere, (iii) the Choroterpes group uniting fauna from North America, southeast Asia and Madagascar and (iv) a

Journal of Threatened Taxa | www.threatenedtaxa.org | August 2011 | 3(8): 1975–1980

1977

Mayfly systematics and phylogeny

K.G. Sivaramakrishnan et al.

group uniting three new world genera, Thraulodes, Farrodes and Traverella.

Gattolliat et al. (2008) reconstructed the first comprehensive molecular phylogeny of the Afrotropical Baetidae. They sequenced a total of ca.

2300 bp from nuclear (18S) and mitochondrial (12S and 16S) gene regions from 65 species belonging to 26 genera. They used three different approaches of phylogeny reconstruction viz., direct optimization, maximum parsimony and maximum likelihood. The molecular reconstruction indicated the Afrotropical Baetidae require a global revision at a generic as well as suprageneric level.

The investigation of Ogden et al. (2009) represented the combined molecular and morphological analysis for the mayfly family Ephemerellidae (Ephemeroptera), with a focus on the relationships of genera and species groups of the subfamily Ephemerellinae. The phylogeny was constructed based on DNA sequence data from three nuclear (18S rDNA, 28S rDNA, histone H3) and two mitochondrial (12S rDNA, 16S rDNA) genes, and 23 morphological characters.

Ephemerella, the largest genus of Ephemerellidae, and Serratella were not supported as monophyletic lineages.

Strongly supported as monophyletic include a grouping of the Timpanoginae genera Timpanoga, Dannella, Dentatella and Eurylophella, and groupings of the Ephemerellinae genera Torleya, Hyrtanella and Crinitella and the genera Kangella, Uracanthella and Teloganopsis. Further study and analysis of Ephemerellidae morphology is needed, and classification should be revised, if it is to reflect true phylogenetic relationships (Ogden et al. 2009).

do not allow reliable distinction. This is particularly true among larvae, the life-stage used most widely in biomonitoring studies. Williams et al. (2006) assessed the molecular diversity of this complex in one of the largest such studies of cryptic species in the order Ephemeroptera to date. Phylogenies were constructed using data from the mitochondrial cytochrome oxidase submit I (COI) gene. Two monophyletic groups were recovered consisting of one major haplogroup and a second clade of six smaller but distinct haplogroups.

Haplogroup divergence ranged from 0.2–3 % (within) to 8–19 % (among) with the latter values surpassing maxima typically reported for other insects, and provided strong evidence for cryptic species in the B. rhodani complex. However, the taxonomic status of these seven haplogroups remains to be defined clearly.

The potential implications of cryptic species in the B. rhodani complex on current and future ecological studies are particularly far-reaching given the large number of studies carried out on what now appears to be several possible distinct taxa. These results have wider relevance since cryptic species have been detected in other aquatic insects (Jackson & Resh 1998), and the presence and diversity of several taxa are widely used as biological indicators (Mason 1996).

The presence of cryptic species also has ramifications for the assessment of biodiversity in general, and the ability to account for them in future studies emphasizes the need to correlate genetic differences from multilocus data, with identifiable morphological characters and/or other factors including physiology.

Dna barcoding and mayfly taxonomy

Molecular systematics and cryptic species complex Genetic studies have highlighted cryptic diversity in many well-known taxa including aquatic insects, with the general implication that there are more species than are currently recognized. Baetis rhodani Pictet are among the most widespread, abundant and ecologically important of all European mayflies (Ephemeroptera), and used widely as biological indicators of stream quality. Traditional taxonomy and systematics have never fully resolved differences among suspected cryptic species in the B. rhodani complex because morphological characters alone 1978

The tool of DNA barcoding shows great potential for use by those studying the systematics of many Ephemeroptera species groups. One example of the utility of barcoding is the verification of stage associations, especially those not made by careful rearing. Recent revisionary study, on the family Ephemerellidae Klapalek provides an illustration. The species concept of Ephemerella altana Allen, a western Nearctic taxon, had been based on a larva belonging to the genus Ephemerella Walsh and an adult of Serretella Edmunds. Had barcoding technology been available at the time of E. altana’s discovery and description, it potentially could have shown that this association was

Journal of Threatened Taxa | www.threatenedtaxa.org | August 2011 | 3(8): 1975–1980

Mayfly systematics and phylogeny

erroneous. Furthermore, barcoding could have helped to resolve the species identities of the larva and adult.

Based on traditional specimen comparisons, the larva is thought to be that of the transcontinental species, Ephemerella excrucians Walsh, and the adult to be that of the western species, Serretella micheneri (Traver).

Ephemerella excrucians exhibits an amazing amount of morphological variability throughout its wide geographic range, which begs the question of whether the current species concept might contain various cryptic lineages that are unrecognizable by traditional, morphological means. Barcoding technology could be used to study various populations, including those from type localities, and could provide a guideline for decisions about species identities and boundaries (Zhou et al. 2008). Zhou et al. (2009) have made a pioneering attempt to generate a DNA barcode reference library for three insect orders- Ephemeroptera, Plecoptera and Trichoptera at one site in the Canadian subarctic. This study has demonstrated that DNA barcoding holds great promise as a tool for rapid biodiversity assessment in unknown faunas. A very close correspondence was observed between morphospecies as determined by taxonomic experts and barcode clusters designated using a standard sequence threshold. Several cases of proposed splitting may reflect cryptic species.

DNA barcodes of stream mayflies will improve descriptions of community structure and water quality for both ecological and bioassessment purposes (Sweeney et al. 2011). Rapid assessment of biodiversity will aid the selection of sites of special conservation value and will help to focus the efforts of taxonomists in revising and characterizing the diversity of life (Zhou et al. 2009).

CONCLUSIONS Future perspectives on systematics and phylogeny of Ephemeroptera using recent molecular tools are highlighted below: - Four sequencing markers which are well-surveyed and informative across a range of divergences viz., the mitochondrial COI and 16S genes, and the nuclear 18S and EF-Iα genes are suggested as standards for comparison for insect molecular systematic studies (Caterino et al. 2000).

- Species delineation continues to be one of the

K.G. Sivaramakrishnan et al.

primary applications of genetic techniques. Application of the Generalized Mixed Yule-coalescent (GMYC) model to species circumscription using single-locus DNA appears rewarding (Pons et al. 2006; Fontaneto et al. 2007). This approach has been applied successfully to 64 species of mayflies in Madagascar (Monaghan et al. 2009).

- Investigators of the demographic history of closely related populations or species can use several nuclear DNA sequences to test specific hypotheses of how past geological events influence observed patterns (e.g. Knowles et al. 2007). These techniques allow one to test a priori hypotheses rather than post hoc conclusions from patterns (Monaghan & Sartori 2009).

- Wilcock et al. (2005) demonstrated very well how the combination of ecological and genetic research, applied to several parts of the life cycle, can greatly advance our understanding of how populations function in nature.

- Routine sampling of population- and species- level genetic diversity, combined with coalescent-based methods of species delineation has great potential to become a standard procedure for the study of poorly known taxonomic groups like Ephemeroptera (Gattolliat & Monaghan 2010).

REFERENCES Barber-James, H.M., J.L. Gattolliat, M. Sartori & M.D. Hubbard (2008). Global diversity of mayflies (Ephemeroptera: Insecta) in freshwater. Hydrobiologia 595: 339–350.

Brittain, J.E. & M. Sartori (2003). Ephemeoptera of Insects.

(Edited by Resh, V.H. & R.T. Carde). Academic Press, San Diego, 373–380pp.

Caterino, M.S., S. Cho & F.A.H. Sperling (2000). The current state of insect molecular systematics: a thriving tower of Babel. Annual Review of Entomology 45: 1–54.

Farris, J.S. (1979). On the naturalness of phylogenetic classification. Systematic Zoology 28: 200–214.

Fontaneto, D., E.A. Herniou, C. Boshetti, M. Caprioli, G. Melone, C. Ricci & T.G. Barraclough (2007). Independently evolving species in asexual bdelloid rotifers. PLoS Biology 5: 914–921.

Gattolliat, J.L. & M.T. Monagan (2010). DNA-based association of adults and larvae in Baetidae (Ephemeroptera) with the description of a new Adnoptilum in Madagascar.

Journal of the North American Benthological Society 29(3): 1042–1057. (http://www.bioone.org/doi/abs/10.1899/09-

Journal of Threatened Taxa | www.threatenedtaxa.org | August 2011 | 3(8): 1975–1980

1979

Mayfly systematics and phylogeny

K.G. Sivaramakrishnan et al.

119.1).

Gattolliat, J.L., M.T. Monaghan, M. Sartori, J.M. Elouard, H. Barber-James, P. Derleth, O. Glaizot, Ferdy de Moor & A.P. Vogler (2008). A molecular analysis of Afrotropical Baetidae, pp. 219–232. In: Hauer F.R., J.A. Stanford & R.L. Newell (eds.) International advances in the Ecology, Zoogeography and Systematics of mayflies, and stoneflies Vol. 128. University of California Publication in Entomology, 422pp.

Hennig, W. (1979). The position of systematic among the biological sciences, pp. 1–99. In: Phylogenetic Systematics.

University of Illinois, Chicago, 350pp.

Hennig, W. (1966). Phylogenetics Systematics. University of Illinois Press, Urbana, 263pp.

Jacokson, J.K. & V.H. Resh (1998). Morphologically cryptic species confound ecological studies of the caddisfly genus Gumaga (Trichoptera: Sericostomatidae) in Northern California. Aquatic Insects 20: 69–84.

Kluge, N.J. (1988). The problem of the homology of the tracheal gills and paranotal processi of mayfly larvae and wings of the insects with reference to the taxonomy and phylogeny of the order Ephemeroptera. Chteniya Pamyati N.A. Kholodkovskogo (Lectures in Memory of N.A. Kholodkovski), Leningrad Academy of Sciences, Leningrad (in Russian), pp. 48–77.

Kluge, N.J. (1998). Phylogeny and higher classification of Ephemeroptera. Zoosystematica Rossica 7: 255–269.

Knowles, L.L., B.C. Carstens & M.L. Keat (2007). Coupling genetic and ecological-niche models to examine how past population distributions contribute to divergence. Current Biology 17: 940–946.

Mason, C.F. (1996). Biology of Freshwater Pollution. Longman Group Limited, England, 1–4pp.

McCafferty, W.P. & G.F. Edmunds (1979). The higher classification of the Ephemeroptera and its evolutionary basis. Annals of the Entomological Society of America 72: 5–12.

McCafferty, W.P. (1991). Toward a phylogenetic classification of the Ephemeroptera (Insecta): a commentary on systematic.

Annals of the Entomological Society of America 84: 343– 360.

Monaghan, M.T. & M. Sartori (2009). Genetic contributions to the study of taxonomy, ecology, and evolution of mayflies (Ephemeroptera): review and future perspectives. Aquatic Insects 31: 19–39.

Monaghan, M.T., R. Wild, M. Elliot, T. Fujisawa, M. Balke, D. J.G. Inward, D.C. Lees, R. Ranaivosolo, P. Eggleton, T.G. Barraclough & A.P. Vogler (2009). Accelerated species discovery on Madagascar using a coalescent-based model of species delineation. Systematic Biology 58: 298–311.

O’Donnell, B. & E.L. Jockusch (2008). Phylogenetic relationships of leptophlebiid mayflies as inferred by histone H3 and 28S ribosomal DNA, Systematic Entomology 33: 651–667.

Ogden, T.H. & M.F. Whiting (2005). Phylogeny of Ephemeroptera (mayflies) based on molecular evidence.

1980

Molecular Phylogenetics and Evolution 37: 625–643.

Ogden, T.H., J. L. Gattolliat, M. Sartori, A.H. Staniczek, T. Soldan & M.F. Whiting (2009). Towards a new paradigm in mayfly phylogeny (Ephemeroptera): Combined analysis of morphological and molecular data. Systematic Entomology 34: 616–634.

Pons, J., T.G. Barraclough, J.Gomez-Zurita, A. Cardoso, D.P. Duran, H.S. Azell, S. Kamoun, W.D. Sumlin & A.P. Vogler (2006). Sequence-based species delimitation for the DNA taxonomy of undescribed insects. Systematic Biology 55: 595–609.

Sweeney, B.W., Battle, J.M., Jackson, J.K. & T. Dapkey (2011). Can DNA barcodes of stream macroinvertebrates improve descriptions of community structure and water quality? Jounal of the North American Benthological Society 30(1): 195–216.

Whitfield, J.B. & K.M. Kjer (2008). Ancient Rapid Radiations of Insects: Challenges for Phylogenetic Analysis. Annual Review Entomology 53: 449–472.

Wilcock, H.R., M.W. Bruford, A.G. Hildrew & R.A. Nichols (2005). Recruitment, kin and the spatial genetic structure of a caddisfly in a southern English stream. Freshwater Biology 50: 1499–1514.

Williams, H.C., S.J. Ormerod & M.W. Bruford (2006).

Molecular systematics and phylogeography of the crptic species complex (Ephemeroptera, Baetidae). Molecular Phylogenetics and Evolution 40: 370–382.

Zhang, J., C. Zhou, Y. Gai, D. Song & K. Zhou (2008). The complete mitochondrial genome of Parafronurus youi (Insecta: Ephemeroptera) and phylogenetic position of the Ephemeroptera. Gene 424: 18–24.

Zhou, X., L.M. Jacobus, & P.D.N. Hebert (2008). DNA Barcoding North American mayflies - a call for international collaboration. The Mayfly Newsletter (Southwestern Oklahoma State University, USA) 15(2): 12.

Zhou, X., S.J. Adamowicz, L.M. Jacobus, R.E. Dewalt & P.D.N. Hebert (2009). Towards a comprehensive barcode library for arctic life - Ephemeroptera, Plecoptera, and Trichoptera of Churchill, Manitoba, Canada. Frontiers in Zoology 6: 30 (doi: 10.1186/1742-9994-6-30).

Author Details: Dr. K.G. Sivaramakrishnan has been working on aquatic insects especially on the systematics and biogeography of mayflies (Ephemeroptera) of India over last 35 years. He has many publications on the subject in international and national journals. Currently he is based in Chennai.

Dr. K.A. Subramanian is a scientist at Zoological Survey of India, Kolkata and has been working on aquatic insects since 1998.

Dr. M. Arunachalam Professor at Sri Paramakalayni Centre for Environmental Sciences, Manonmaniam Sundaranar University, Alwarkuruchi. He is a freshwater biologist and Ichthyologist and has been working on ecology and systematics of freshwater organisms, especially the freshwater fishes.

C. Selva Kumar Doctoral student at Sri Paramakalayni Centre for Environmental Sciences, Manonmaniam Sundaranar University, Alwarkuruchi. Currently working on Ephemeroptera of KalakkadMundanthurai Tiger Reserve.

S. Sundar Doctoral student at Sri Paramakalayni Centre for Environmental Sciences, Manonmaniam Sundaranar University, Alwarkuruchi. Currently working on Naucoridae (Hemiptera) of southern Western Ghats.

Journal of Threatened Taxa | www.threatenedtaxa.org | August 2011 | 3(8): 1975–1980

JoTT Communication

3(8): 1981–1989

Conservation status of the only Lungless Frog Barbourula kalimantanensis Iskandar, 1978 (Amphibia: Anura: Bombinatoridae) Biofagri A. Rachmayuningtyas 1, David P. Bickford 2, Mistar Kamsi 3, Sujatha N. Kutty 4, Rudolf Meier 5, Umilaela Arifin 6, Angga Rachmansah 7 & Djoko T. Iskandar 8 School of Life Sciences and Technology Institut Teknologi Bandung 10 Jalan Ganesa, Bandung 40132, Indonesia.

Raffles Museum for Biodiversity Research, Department of Biological Sciences, National University of Singapore. 14 Science Drive 4, Singapore 117543 3 Sumatran Orangutan Conservation Program, 51/74 Jl. KH Wahid Hasyim Medan, 20154, Indonesia 7 Present address: Fauna & Flora International, Indonesia Program, Ketapang, Kalimantan Barat, Indonesia.

Email: 1 biofagri@yahoo.com, 2 dbsbdp@nus.edu.sg, 3 mistar234@gmail.com, 4 sujatha@nus.edu.sg, 5 dbsmr@nus.edu.sg, 6 umilaela@gmail.com, 7 angga.rachmansah@gmail.com, 8 iskandar@sith.itb.ac.id (corresponding author) 1,6,7,8 2,4,5

Date of publication (online): 26 August 2011 Date of publication (print): 26 August 2011 ISSN 0974-7907 (online) | 0974-7893 (print) Editor: Mirco Solé Manuscript details: Ms # o2560 Received 07 September 2010 Final received 26 July 2011 Finally accepted 04 August 2011 Citation: Rachmayuningtyas, B.A., D.P. Bickford, M. Kamsi, S.N. Kutty, R. Meier, U. Arifin, A. Rachmansah & D.T. Iskandar (2011).

Conservation status of the only Lungless Frog Barbourula kalimantanensis Iskandar, 1978 (Amphibia: Anura: Bombinatoridae). Journal of Threatened Taxa 3(8): xxxx–xxxx.

Copyright: © Biofagri A. Rachmayuningtyas, David P. Bickford, Mistar Kamsi, Sujatha N. Kutty, Rudolf Meier, Umilaela Arifin, Angga Rachmansah & Djoko T. Iskandar 2011.

Creative Commons Attribution 3.0 Unported License. JoTT allows unrestricted use of this article in any medium for non-profit purposes, reproduction and distribution by providing adequate credit to the authors and the source of publication.

For Author Detail, Author Contribution and Acknowledgements: see end of this article.

OPEN ACCESS | FREE DOWNLOAD

Abstract: In response to the recent rediscovery of Barbourula kalimantanensis, which is currently the only known lungless frog, a number of biologically important aspects of the species were examined and its taxonomy and conservation status was reviewed.

Based on the species’ ecological requirements, habitat restrictions and recent severe habitat loss, we propose to change the conservation status of Endangered B2ab(iii) to Vulnerable B1ab(iii) and earmark the species as a conservation flagship for the region and for Indonesia.

Keywords: Archeobatrachia, Borneo, distribution, flatheaded frog, Indonesia, national park, protection status.

Indonesian Abstract: Untuk melengkapi penemuan kembali setelah tiga puluh tahun dari Barbourula kalimantanensis, yang pada saat ini dikenal sebagai satu-satunya katak yang tak berparu-paru di dunia, telah dilakukan analisis dari sejumlah aspek biologi yang dianggap penting dalam meninjau ulang status perlindungannya. Atas dasar kebutuhan ekologis, keterbatasan relung dan kehilangan habitat, maka diusulkan untuk mengubah status perlindungannya dari Terancam Punah atau Endangered B2ab(iii) menjadi Rawan Punah atau Vulnerable B1ab(iii). Jenis ini diusulkan pula sebagai hewan indikator bagi perlindungan kawasan di Indonesia.

INTRODUCTION Barbourula kalimantanensis Iskandar, 1978, is a frog with peculiar morphological adaptations (extreme flattening of the body, no lungs, and full webbing of the fingers) that lives in pristine, clear, fast, and coldrunning streams and is of great conservation interest because of severe recent habitat loss. It is the only member of the bombinatorid frog family in Indonesia and only found in Kalimantan, whereas the other members of the family, except Barbourula busuangensis Taylor & Noble, 1924 (found in the Philippines), have a completely Palaearctic distribution (Iskandar 1978). Before the recent rediscovery, surveys of suitable habitat had not recovered any further populations, suggesting that this species has a very limited distribution and/or is very rare (IUCN 2006). Additionally, it may Abbreviations: ANOVA, Analysis of Variance - AOO, Area of Occupancy; BBBR-NP - Bukit Baka-Bukit Raya – National Park; cyt b - cytochrome b; COI - cytochrome c oxidase subunit 1; DO - dissolved oxygen; EOO - Extent of Occurrence; ITB - Institut Teknologi Bandung; IUCN - International Union for the Conservation of Nature; NUS National University of Singapore; RMBR - Raffles Museum for Biodiversity Research; UNTAN - Universitas Tanjung Pura, Pontianak; VES - Visual Encounter Survey

Journal of Threatened Taxa | www.threatenedtaxa.org | August 2011 | 3(8): 1981–1989

1981

Conservation status of the Lungless Frog

B.A. Rachmayuningtyas et al.

be facing extirpation or extinction as forest stream habitats upon which it is dependent are being heavily modified due to illegal gold mining and deforestation (IUCN 2006). Based on our previously limited data, the International Union for Conservation of Nature (IUCN) categorized B. kalimantanensis as Endangered, applying criteria B2ab(iii); i.e., extent of occurrence (EOO) of less than 5000km2; all individuals in less than five locations and its forest habitat in Kalimantan is still in decline.

In order to conserve a species, accurate population, reproduction, ecology, and range information about the species are required to provide better assessment of conservation status and develop a feasible management plan. As information about B. kalimantanensis was previously incomplete, additional data were badly needed. Therefore, several expeditions were organized to confirm the species’ geographic range in the wild (5–21 August 2007, 30 June–9 July 2008, 7–15 July 2009 and 25 March–14 April 2011). The expeditions studied the area around Bukit Baka Bukit Raya-National Park (BBBR-NP), around the border of West and Central Kalimantan Province (00035.228’– 47.575’S & 112014.195’–19.241’E). We obtained nine specimens of B. kalimantanensis in 2007, two in 2008 and three others in 2009. Recently, a single specimen has been obtained on 10 April 2011, again from a production forest, northwest of the previously known distribution (Image 1). We discovered that this species is the first lungless frog (Bickford et al. 2008).

This adaptation will have major consequences for the ecology and distribution of the species but we still know

© David P. Bickford

Image 1. Barbourula kalimantanensis 1982

very little about the species’ ecology. In addition, we also obtained information about habitat and genetics.

With this additional information, the extinction risks of this species can be better understood and mitigated.

This paper summarizes this information and reviews the conservation status of B. kalimantanensis, making suggestions for a management strategy.

METHODS Field surveys We used VES, a method in which a team of five field personnel walked through the habitat of the frog (fast flowing streams > 4m wide) from 1900 to midnight, to search for B. kalimantanensis (Heyer et al. 1994). We investigated eight streams at a lower elevation (200– 400) within the primary rain forest around BBBRNP (Fig. 1). Six streams (Seti, Bahae, Baras Bahae, Kelawai, Sahaur, and Sepilang of Katingan River, part of Mendawai River Basin) were in the Kalimantan Tengah Province, while the other two streams (Ela Hulu and Semunga, part of Melawi River Basin) were in the Kalimantan Barat Province. The streams’ physico-chemical characteristics (DO, pH, salinity, water temperature, and current speed) were assessed with a YSI 556 Multi-Probe system. The stream substrate was also sampled from three spots along each stream and sorted using a Tyler Standard Screen Scale.

The substrate size compositions were then analyzed by cluster analysis and one way ANOVA. Genetic Analysis DNA Sequences: We used the DNeasy kit (QIAGEN), following the manufacturer’s protocol, to isolate DNA from tissue samples for eight specimens of B. kalimantanesis. Two gene fragments were amplified, approximately 500bp of cyt b and 450bp of COI. We used the universal HCO2198 (5’TAAACTTCAGGGTGACCAAAAAATCA -3’) –LCO1490 primers (5’GGTCAACAAATCATAAAGATATTGG -3’) to amplify COI (Folmer et al. 1994), and two alternative pairs of primers for cyt b (because of primer binding problems for some individuals) (see Sheridan et al. 2010). We used the same PCR protocol as Folmer et al. (1994) and Sheridan et al.

(2010) for the two COI and cyt b protocols, purified

Journal of Threatened Taxa | www.threatenedtaxa.org | August 2011 | 3(8): 1981–1989

Conservation status of the Lungless Frog

B.A. Rachmayuningtyas et al.

Figure 1. Localities where streams have been studied. (Modified from map of PT. Sari Bumi Kusuma).

1 - Semunga; 2 - Ela Hulu; 3 - Sepilang; 4 - Sahaur; 5 - Kelawai; 6 - Baras Bahae; 7 - Bahae; 8 - Seti.

the PCR products with SureClean, cycle sequenced using BigDye Terminator v3.1, and cleaned again with Agencourt’s CleanSEQ before being sequenced on an ABI 3130xl Genetic Analyzer. All sequences were aligned based on amino acid translations as described in Meier et al. (2006). In order to carry out a preliminary comparison of the intraspecific genetic variability of B. kalimantanesis with other archeobatrachian frogs, we used GenBank sequences for cyt b to quantify the intraspecific variability using uncorrected pairwise distances as determined in PAUP* (Swofford 2002). A similar comparison for COI was not carried out due to the lack of GenBank data for assessing the intraspecific variability across Archeobatrachia.

RESULTS Rediscovery of the species with new additional specimens We obtained nine specimens of B. kalimantanensis from two of eight streams sampled. One specimen was obtained from Ela Hulu stream in Melawi River Basin, West Kalimantan, and eight specimens from Bahae Stream; plus one, not collected specimen from Sahaur stream in Mendawai River Basin, Central Kalimantan in 2007 (Fig. 1). We also obtained two additional specimens from Bahae Stream in 2008 and three others in 2009 from the same site. From a recent independent survey, a single specimen has

Journal of Threatened Taxa | www.threatenedtaxa.org | August 2011 | 3(8): 1981–1989

1983

Conservation status of the Lungless Frog

B.A. Rachmayuningtyas et al.

Baras Bahae 2 Sahaur 2 Baras Bahae 1 Ela Hulu 3 Sahaur 1 Sahaur 3 Kelawai 2 Ela Hulu 2 Ela Hulu 1 Kelawai 1 Baras Bahae 3 Bahae 3 Semunga 2 Semunga 1 Semunga 3 Bahae 1 Bahae 2 Seti 3 Kelawai 3 Sepilang 3 Sepilang 2 Sepilang 1 Seti 2 Seti 1

Cluster 3

Cluster 2

Cluster 1

Genbank accession numbers: Mus No/ Voucher:

Acc COI:

Acc Cytb:

ZRC/RMBR 934

HM778123

HM778130

ZRC/RMBR 939

HM778124

HM778131

ITB/RMBR 989

-

HM778132

ITB/RMBR 1003

HM778118

HM778125

ITB/RMBR 1004

HM778119

HM778126

ZRC/RMBR 1005

HM778120

HM778127

ZRC/RMBR 1006

HM778121

HM778128

ITB/RMBR 1117*

HM778122

HM778129

Note: (*) Additional sequences for ITB/RMBR 1117: 12S–16S (mt): HM769263; CXCR4 (nuc): HM769266; NCX1 (nuc): HM769269; SLC8A3 (nuc): HM769272 (see Blackburn et al. 2010).

Table 1. Preliminary comparison of the intraspesific genetic variability of B. kalimantanensis with other archeobatrachian frogs No of Sequences

Median Distance

Range

Ascaphus truei

31

2.06%

0–9.7 %

Alytes obstetricans

19

0.78%

0–4.95 %

Discoglossus galganoi

45

0.56%

0–8.59 %

Discoglossus jeanneae

49

0%

0–0.85 %

Discoglossus pictus

22

6.12%

0–13.56 %

Barbourula kalimantanensis

8

0.09%

0–0.35 %

Bombina bombina

113

0.37%

0–6.43 %

Bombina variegata

257

0.82%

0–9.59 %

9

0.90%

0–6.02 %

Species 25

20

15

10

5

0

Rescaled Distance Cluster Combined

Figure 2. Result of cluster analysis based on the stream substrate.

been obtained from Melopang Stream (00035.228’N & 112014.195’E), Sokan River, another part of the Melawi Basin, West Kalimantan, bringing the total to 17 known specimens. Physico-chemical measurements of streams around BBBRNP where B. kalimantanensis were found revealed that the water is below 230C, usually 14–17 0C, with current speeds reaching 5m/s.

The DO averages 8.6mg/l (100.5%).

Results of cluster analysis of stream substrate showed that stream compositions varied between one another, however three clusters could be established (Fig. 2). Even though each cluster differed from the others significantly (p < 0.05), most clusters comprised of samples from different streams. Only one spot in the Baras Bahae Stream formed a separate cluster, caused by a large proportion of fine particles (> 40% are less than 0.25mm). Other streams, including Baras Bahae spot 1 and 3, are clustered together, either with Ela Hulu or with Bahae, indicating that they have a similar composition of substrate.

It is important to consider that the actual amount of suitable habitat within the range is small because it only consists of clear, fast, cold, and wide streams. The last discovery of the species from a small stream with 1984

Bombina maxima

lots of cascades and slab rock bottom indicates that the species is potentially capable of staying in damp cool areas on land and might explore wider habitats other than streams, thus facilitating the ability to move from one to another place on land.

Genetic Variations The eight cyt b sequences belong to four haplotypes with one population being monomorphic (3 sequences) and sharing its haplotype with the second population (for GenBank accession numbers see supporting information). All haplotypes are very similar (uncorrected pairwise distances: 0.09–0.35 %; median distance: 0.09%). Preliminary comparison of intraspecific genetic variability of Barbourula kalimantanesis with other archeobatrachian frogs using GenBank sequences for cyt b showed that the genetic variability of B. kalimantanesis is very low (n=8; mean 0.09%; range 0–0.35 %) (Table 1).

Journal of Threatened Taxa | www.threatenedtaxa.org | August 2011 | 3(8): 1981–1989

Conservation status of the Lungless Frog

DISCUSSION The Occurrence of Barbourula kalimantanensis Barbourula kalimantanensis was previously recorded from only three localities, Pinoh (Iskandar 1978) and Kelawit River (Iskandar 1995) in the Melawi River Basin, West Kalimantan, and Tengkalap River (Santoso et al. 2006) in the Belantikan River Basin, Central Kalimantan. From expeditions to BBBR-NP and neighboring areas, nine additional specimens of B. kalimantanensis were obtained from three new localities, Ela Hulu and Melopang Stream, Sokan River, West Kalimantan; in the Melawi River Basin, West Kalimantan; Bahae Stream in the Mendawai River Basin, Central Kalimantan i.e., the species is now known from seven localities representing an EOO of more than 5,000km2.

As the area around the type locality is now highly degraded due to illegal gold mining (IUCN 2006), much of the habitat is no longer suitable for B. kalimantanensis, and populations of this species in this area are assumed to be extirpated (Iskandar, unpub. data). As a result, two of the known sites are now lost, but we have at least three additional sites, which expand the EOO to above 5,000km2. Stream connectivity suggests that the EOO of this species could be much larger than 5,000km2. There are practically no geographic barriers between Ela Hulu and Bahae streams, though they are in different river basins on the same side of a small ridge. The area is relatively flat, and the headwaters adjacent to Ela Hulu (about 5km away) are interconnected with Bahae, making the distance between them and the Melawi Basin drainage only about 8km on the same gentle slope.

The Melopang Stream, Melawi River Basin, extends far to the west and is very close to Pawan River Basin which flows to the west coast of West Kalimantan. It is only separated by about 5km from the head water of Pawan River and can be located visually from the neighboring hilly area.

Compared to other archaeobatrachian frogs, the genetic variability of B. kalimantanesis is extremely low (Table 1). This probably indicates that the streams are historically well connected, with little isolation between populations of B. kalimantanensis in Melawi Basin and those in Mendawai Basin. As streams’ connectivity occurs, not only between the head waters of Melawi and Mendawai Basin to the south, Melawi-

B.A. Rachmayuningtyas et al.

Pawan to the west, but also between head waters such as Mendawai-Seruyan, Mendawai-Sampit, Seruyan-Belantikan, Mendawai-Dayak Besar, and also perhaps Dayak Besar-Dayak Kecil. Judging from the topography most of the aforementioned streams have their headwaters on the same gentle slope of the Schwanner mountain range facing south. For that reason, the extent of occurrence of B. kalimantanensis could thus be much larger than previously thought. It might encompass all headwaters, from the foot of the Schwanner mountain range, through the Belantikan basin up to Dayak Kecil basin (Image 2). Although suitable habitat is undoubtedly patchy all along these rivers, EOO is still potentially much greater than had previously been revealed from the limited number of specimens prior to 2007 as shown in the present discoveries.

Habitat Associations and Preference Barbourula kalimantanensis is a fully aquatic frog (Iskandar 1978) whose presence has always been associated with relatively shallow (< 1m), cold, fastflowing, clear, rocky streams in primary tropical rain forest (Iskandar 1978, 1995; Santoso et al. 2006). In fact, they seem to be inseparable, as B. kalimantanensis morphology shows extreme specialization for aquatic life in that specific habitat (Iskandar 1978; Bickford et al. 2008) which in turn reduces its ability to live elsewhere (Frazer 1973). As a lungless species, B. kalimantanensis needs higher levels of free oxygen that is only provided by shallow, clear, cold, fast flowing, and highly mixed streams. Physico-chemical measurements of streams clearly showed that the water is well aerated and oversaturated. In addition, none of the 14 specimens were caught among stones with dead leaves or other kinds of debris, probably avoiding water with less oxygen content caused by decomposing materials.

Bare rock and large stones are the major substrate of Barbourula kalimantanensis stream habitat and play an important role in the way this species lives. Large stones (> 30cm in diameter) are used as cover; hiding under bigger rocks and/or camouflaging directly on the stream substrate. The streams’ substrates also serve as home for benthic fauna which B. kalimantanensis preys upon. One individual of B. kalimantanensis (RMBR 1007, SVL 49mm) had the stomach filled with a large, barely digested aquatic dytiscid larva

Journal of Threatened Taxa | www.threatenedtaxa.org | August 2011 | 3(8): 1981–1989

1985

Conservation status of the Lungless Frog

B.A. Rachmayuningtyas et al.

11300’E

1040’S

0040’S

110050’E

Image 2. Possible connections between river basins in West-Central Kalimantan, illustrated by the arrows. The nearby position between the head of streams in Melawi Basin-Mendawai Basin, Mendawai Basin-Seruyan Basin, MendawaiSampit, Seruyan Basin-Belantikan Basin, Mendawai-Dayak Besar, and then perhaps Dayak Besar-Dayak Kecil, implicated on the extension of B. kalimantanensis range much wider than was previously thought.

Legend: 1 - Nanga Pinoh, the type locality; 2 - Kelawit River; 3 - Tengkalap, Belantikan River; 4 - Bahae River, Mendawai Basin; 5 - Ela Hulu River; 6 - Melopang, Sokan River; 7 - Batang Kawa River, Lamandau District, East Kalimantan (potential site for Barbourula as reported by local people.

of 30x7 mm (LxW), with its abdomen crumpled and a single, undigested trichopteran larva. The recent captured specimen of 60mm readily accepts small shrimp (Macrobrachium sp.) when kept in running water within a mesh cage. Considering its generally lethargic behavior, it is assumed that this species is a sit-and-wait predator of benthic fauna that pass by instead of actively looking for food.

From eight investigated streams, B. kalimantanensis were found only in Ela Hulu, Sahaur and Bahae streams. However, all streams were found to have similar substrate size and composition via cluster analysis of stream substrate samples. Other streams, except for Baras Bahae spot 2, were also clustered together, either with Ela Hulu or with Bahae, indicating that they shared the same composition of substrate, and could be the type of habitat suitable for B. kalimantanensis (Fig 2). The last discovery from a small, fast flowing stream with slate bedrock bottom 1986

and small cascades might indicate that the species can thrive on humid terrestrial habitat, analogous to many lungless salamanders of the North American forest (Welsh & Droege 2001; Dillard et al. 2008).

Threats For the time being, IUCN considers two major threat types for B. kalimantanensis, habitat loss and pollution mainly due to deforestation (logging) and gold mining. In logged areas, rocks in streams become coated with a thin layer of silt, and the food supply of benthic organisms is destroyed (Inger & Stuebing 1995). Barbourula kalimantanensis, in addition to feeding on small shrimp species, is now known to feed on larva of Trichoptera and Dytiscidae, all are benthic organisms and the insect larvae are known to feed on algae (McDonald et al. 1990). Thus, the silting of streams caused by logging and illegal gold mining would affect the benthic populations of prey species

Journal of Threatened Taxa | www.threatenedtaxa.org | August 2011 | 3(8): 1981–1989

Conservation status of the Lungless Frog

negatively. In a logged area, water temperature is found to be warmer than in the non-logged area (Graynoth 1979; De Groot et al. 2007). The effect of temperature increase for B. kalimantanensis is clear. It causes oxygen concentrations to decrease as a consequence of lower solubility (Hill et al. 2008). This condition could seriously harm not only B. kalimantanensis, but other aquatic organisms as well. Similar to logged areas, gold mining activities also cause adverse habitat modifications for B. kalimantanensis. The headwaters of most streams in the region are intersected by logging roads and the future of these streams is in jeopardy. In addition to logging and heavy silting of roads, gold mining also contributes to the pollution of streams with highly toxic mercury.

Several other risk categories such as global warming, habitat specificity because of lunglessness, and very low genetic variability should be added to the list of extinction threats for this species. The influence of global warming upon B. kalimantanensis may not be recognized as yet, but it has been confirmed to affect amphibian populations and is the most likely candidate for causing extinction of Bufo periglenes (Stuart et al. 2004, 2008; Flannery 2005). Threat from Batrachochytrium dendrobatidis could be set aside as the area where B. kalimantanensis is known to occur is still remote from excessive human activities and not yet influenced by introduced plant and animal species.

Lunglessness is a highly specialized adaptation for living in a specific habitat, effectively preventing the species from living elsewhere. As habitat degradation on Borneo is very extensive, lunglessness could become a major liability for this species. Any kind of change that alters water quality, especially oxygen content, would seriously affect this frog. The only recourse for survival is to retreat upstream. The very low genetic variability of this species also indicates the possibility of a recent bottleneck effect, though confirmation of such an event is still needed.

A review to Barbourula kalimantanensisâ&#x20AC;&#x2122; IUCN conservation status Based on two specimens, IUCN (2006) categorized Barbourula kalimantanensis as Endangered B2ab(iii).

This category was given in consideration of its area of occupancy (AOO), previously thought to be less than 500km2, or an EOO of less than 5,000km2. Now, as discussed above, we believe its present range area

B.A. Rachmayuningtyas et al.

is more than 5,000km2. As a consequence, its EOO in category B for Endangered species designation is no longer appropriate. Lunglessness has made B. kalimantanensis very susceptible to changes in water quality, especially oxygen content. Possible responses of B. kalimantanensis are to retreat upstream. As all specimens of B. kalimantanensis were discovered upstream near the stream headwaters and not lower down stream, Habitat degradation in those areas will be catastrophic. In the meantime, all of the interconnected streams and many of the headwaters shown in figure 1 are in the area of logging concession (Singleton et al. 2004). Within this area, the threat from logging is severe. Moreover, logged areas are prime targets for indigenous and newly arrived slash and burn agriculturists, further deteriorating water quality of the stream habitats. In addition, there is evidence that illegal mining is continuing up the watercourses around the area (Jarvie et al. 1998; present study). Based on this information, populations of B. kalimantanensis are exposed to tremendous threats of extirpation and extinction. Logging should be managed carefully, and if agriculture and gold mining continue, it will exacerbate extinction risks of all the known and presumed populations of B. kalimantanensis. Despite the threats from habitat degradation, and the low adaptability of B. kalimantanensis (lungless and low genetic variability), we recommend that this species be listed as a Vulnerable B1ab(iii), as more and more localities are discovered in the last decades and covering major watersheds in west and central Kalimantan. Some clean small streams with slab rock bottom, crevices and cascades are found to be the home of B. kalimantanensis as well.

Conservation Efforts In Indonesia, no amphibian species is on the list of plants and animals protected by law (Dephut 2004). This condition is driven by lack of data supporting the importance of amphibian species as a component of ecosystems (Iskandar 2004), and by a lack of scientific monitoring efforts. Available data about B. kalimantanensis from this study might still be inadequate, but its unique adaptation and extreme specialization should be sufficient to garner attention from the Indonesian government. Besides, by following criteria of protected species from Indonesian Governmental Law no.7. 1999 (Noerdjito

Journal of Threatened Taxa | www.threatenedtaxa.org | August 2011 | 3(8): 1981â&#x20AC;&#x201C;1989

1987

Conservation status of the Lungless Frog

B.A. Rachmayuningtyas et al.

et al. 2005), B. kalimantanensis has already met at least two important criteria. The first criterion is living in a very specific and restricted habitat, and the second is low adaptability or ability to live elsewhere. Thus, we strongly suggest that the Indonesian government give more attention to this species, and put it on the list of protected species of Indonesia. In addition, protecting B. kalimantanensis means protecting the head waters and surrounding forest habitats, which for the time being, are subject to logging, fragmentation, other conversion threats (Singleton et al. 2004), and illegal gold mining activities (Lestariya 2005). Conserving B. kalimantanensis will thus also protect headwaters and affect forest quality.

At present, no additional specimens have been found inside Bukit Baka Bukit Raya National Park.

However, as the rivers that feed into the Melawi and Katingan (Mendawai) rivers have some of their headwaters in the park, it is very likely that BBBRNP is the most likely place for a B. kalimantanensis sanctuary. The remoteness of the park and other known sites is one advantage, although it nevertheless faces many threats (Jarvie et al. 1998). Thus, the park, along with government and local people, should work together to maximize conservation of this species.

Even though populations of B. kalimantanensis are exposed to tremendous threats of extirpation and extinction, there is still a good chance for this species to remain extant and sustain healthy populations in well-managed protected areas.

We propose that Barbourula kalimantanensis should become a flagship species for the park. Its endemicity, unique appearance, and lunglessness (as a special adaptation) will, without doubt, attract international attention and support. When public and scientific support has been generated, funding can be directed to maintain ecological processes and ecosystem integrity in streams and surrounding forest habitats, protecting not only this species, but also the remaining species in this area.

Supporting Information: Material examined: MZB Amph. 2335 (holotype), adult male from Sungai Pinoh, south of Nanga Pinoh,

by S. Wirjoatmodjo & T. Roberts, July 1977. ZRC 1.3219 1 ex, adult female from Sungai Kelawai, 1 km upstream of Nanga Pintas (0036’44”S & 111047’22”E)

by M. Kottelat, 17.ix.1993; ITB coll (RMBR 989, 1988

1003, 1004) 4 ex. (1 juv. female, 2 juv. males). ZRC coll. (RMBR 934, 939, 1005, 1006), 4 ex., (3 juv. females, 1 juv. male) from Bahae Stream, by D.T. Iskandar & coll., 15–21.viii.2007. ITB coll. (RMBR 1007) 1 ex (juv. female). preserved in ethanol 70%; ITB coll. RMBR 1117 from Ela Hulu Stream, D.T. Iskandar & coll., 15–21.viii.2007; ITB coll. MK 721, 722 (1 adult male and 1 juv.) from Bahae Stream, by M. Kamsi. June 2008. ITB coll. (FN RMBR 2060-2062; 3 ex, juv.) from from Bahae Stream, by D.P. Bickford & coll., July 2009. 10.iv.2011, AR 456 (1 ex.), from Melopang Stream, Sokan River, a part of the Melawi watershed, West Kalimantan, by A. Rachmansah.

REFERENCES Bickford, D., D. Iskandar & A. Barlian (2008). A lungless frog discovered on Borneo. Current Biology 8(9): 292–293.

Blackburn, D.C., D. Bickford, A. Diesmos, D.T. Iskandar & R. Brown (2010). An ancient origin for the enigmatic Flat-Headed Frogs (Bombinatoridae: Barbourula) from the islands of Southeast Asia. PLoS ONE 5(8) e12090: 1–10.

De Groot, J.D., S.G. Hinch & J.S. Richardson (2007). Effects of logging second-growth forests on headwater populations of coastal cutthroat trout: A 6-year, multistream, beforeand-after field experiment. Transactions of the American Fisheries Society 136: 211–226.

Dephut (Ministry of Foresty) (2004). Regulations and Laws Concerning Forest Protection and Conservation of Nature.

Sekretariat Direktorat Jenderal Perlindungan Hutan dan Konservasi Alam, Jakarta. (in Indonesian), iii+617pp.

Dillard, L.O., K.R. Russell & W.M. Ford (2008). Site-level habitat models for the endemic, threatened Cheat Mountain Salamander (Plethodon nettingi): the importance of geophysical and biotic attributes for predicting occurrence.

Biodiversity & Conservation 17: 1475–1492.

Flannery, T. (2005). The Weather Makers. The Text Publishing Company, Melbourne, 357pp.

Folmer, O., M. Black, W. Hoeh, R. Lutz & R. Vrijenhoek (1994). DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology & Biotechnology 3(5): 294–299.

Frazer, J.F.D. (1973). Amphibians. Wykeham Publications, London & Winchester, xii+478pp.

Graynoth, E. (1979). Effects of logging on stream environments and faunas in Nelson. New Zealand. Journal of Marine & Freshwater Research 13(1): 79–109.

Heyer, W.R., M.A Donnelly, R.W. McDiarmid, L.C. Hayek & M.S. Foster (1994). Measuring and Monitoring Biological Diversity. Standard Methods for Amphibians. Smithsonian Institution Press, Washington and London, xix+ 364pp.

Journal of Threatened Taxa | www.threatenedtaxa.org | August 2011 | 3(8): 1981–1989

Conservation status of the Lungless Frog

Hill, R.W. G.A. Wyse & M. Anderson (2008). Animal Physiology—2nd Edition.

Sunderland, Sinauer Associates, USA, xxvi+770pp.

Inger, R.F. & R.B. Stuebing (2005). A Field Guide to The Frogs of Borneo. Natural History Publication, Kota Kinabalu, vii+201pp.

Iskandar, D.T. (1978). A new species of Barbourula: first record of a discoglossid anuran in Borneo. Copeia 1978(4): 564–566.

Iskandar, D.T. (1995). Note on the second specimen of Barbourula kalimantanensis (Amphibia, Anura, Discoglossidae). Raffles Bulletin of Zoology 43: 309–311.

Iskandar, D.T. (2004). The Amphibians and Reptiles of Malinau Region, Bulungan Research Forest, East Kalimantan: Annotated Checklist with Notes on Ecological Preferences of the Species and Local Utilization. Center of International Forestry Research, Bogor, v+27pp.

IUCN (International Union for Conservation of Nature), Conservation International, and Nature Serve (2006). Global Amphibian Assessment. Available from http://www.globalamphibians.org (Accessed October 2007).

Jarvie, J.K., Ermayanti, U. Mahyar, A. Church & Ismail (1998). The habitats and flora of Bukit Baka-Bukit Raya National Park. Tropical Biodiversity 5(1): 11–56.

Lestariya, A.W. (2005). Management of Melawi watersheds. Jurnal llmiah Geomatika 11(2): 1–13 (in Indonesian).

McDonald, B., W. Borden & J. Lathrop (1990). Citizen stream Monitoring: A Manual for Illinois. Illinois Department of Energy and Natural Resources, ILENR/ RE-WR-90/18, Illinois, 96pp.

Meier, R., S. Kwong, G. Vaidya & P.K.L. Ng (2006). DNA Barcoding and taxonomy in Diptera: a tale of high intraspecific variability and low identification success.

Systematic Biology 55: 715–728.

Noerdjito, M., I. Maryanto, S.N. Prijono, E.B. Waluyo, R. Ubaidillah, Mumpuni, A.H. Tjakrawidjaja, R.M. Marwoto, W.A. Noerdjito & H. Wiriadinata (2005). Criterion of Biodiversity that Need to be Protected by and for Indonesian Community (Kriteria jenis hayati yang harus dilindungi oleh dan untuk masyarakat Indonesia). LIPI, Bogor, (in Indonesian), xiii+97pp.

Santoso, E., S. Shonleben, I. Sapari & L.A. Sadikin (2006). Barbourula kalimantanensis Iskandar, 1978 - a new record for Central Kalimantan, Indonesian Borneo (Amphibia: Anura: Discoglossidae). Herpetological Bulletin 98: 6–8.

Sheridan. A., D.P. Bickford & K.F.-Y. Su (2010). An examination of call and genetic variation in three wide-ranging Southeast Asian anuran species. Raffles Bulletin of Zoology 58: 369–379.

Singleton, I., S. Wich, S. Husson, S. Stephens, S.U. Atmoko, M. Leighton, N. Rosen, K. Traylor-Holzer, R. Lacy & O. Byers (eds.) (2004). Orangutan population and habitat viability assessment: Final Report. IUCN/SSC Conservation Breeding Specialist Group, Apple Valley, MN, 88pp.

Stuart, S.N., J.S. Chanson, N.A. Cox & B.E. Young (2004). Status and trends of amphibian declines and extinctions worldwide. Science 306: 1783–1786.

Stuart, S.N., M. Hoffmann, J.S. Chanson, N.A. Cox, R.J. Berridge, P. Ramani & B.E. Young (eds.) (2008). Threatened Amphibians of the World. Lynx Edicions, Barcelona, Spain; IUCN, Gland, Switzerland; and Conservation International, Arlington, Virginia, USA, xv+758pp.

Swofford, D. L. (2002). PAUP*. Phylogenetic Analysis Using Parsimony (*and other Methods). Version 4. Sinauer Associates, Sunderland, Massachusetts, 142pp.

Taylor, E.H & G.K. Noble (1924). A new genus of discoglossid frogs from the Philippine Islands. American Museum Novitates 121: 1–4.

Welsh, H.H.Jr. & S. Droege (2001). A case for using plethodontid salamanders for monitoring biodiversity and ecosystem integrity of North American forests.

Conservation Biology 15: 558–569.

Journal of Threatened Taxa | www.threatenedtaxa.org | August 2011 | 3(8): 1981–1989

B.A. Rachmayuningtyas et al.

Authors Details: Biofagri A. Rachmayuningtyas and Umilaela Arifin are both graduate students in Biology. Both are working on the taxonomy, ecology and conservation. David P. Bickford is an Assistant Professor at National University of Singapore. His research is focused on reptiles and amphibians, their ecology and evolution, understanding adaptive radiations, and biogeography. Mistar Kamsi is a freelance researcher in biology and conservation. He is mainly interested in amphibians and reptiles biology. Rudolf Meier, Associate Professor at National University of Singapore and his assistant Sujatha N. Kutty focused on molecular genetics, phylogenetic relationships, mainly on insects. Angga Rachmansah is a graduate student in biology and engaged as a part timer surveyor at Fauna & Flora InternationalIndonesia program, working on the ecology and conservation of amphibians and reptiles. Djoko T. Iskandar is the team leader and working as full Professor in Ecology and Biosystematics at School of Life Sciences and Technology, Institut Teknologi Bandung, working extensively on the herpetofauna of Southeast Asia and AustraloPapua.

Author Contributions: BAR and UA are responsible for data gathering in the field, data analysis, preparing figures and writing.

DPB is involved in the first expedition and also responsible for the third expedition, arrange for funding, analysis, photographing and writing.

He is mainly responsible in the paper writing, restructuring and very active in discussion about the content of this work. MK is responsible for the second expedition, mainly involved in finding specimens during the first and second expeditions, photographing and writing. RM and SNK are responsible in the genetic analysis and writing. AR is responsible in acquiring more data on Barbourula kalimantanensis since the first expedition up to present. DTI is the leader for the first expedition, arrange for logistics, permits and writing and preparing figures.a Acknowledgments: Fieldwork for this research was funded by the National University of Singapore under DPB’s startup R-154-000-383133 and the cryptic species project R-154-000270-112 and Mohammed bin Zayed species conservation fund. We acknowledge the help of Drs. E. Effendy (former) and Widada, Heads of the Bukit Baka-Bukit Raya National Park who accorded us to work and collect samples.

We also appreciate Mr. D. Liswanto (Titian Foundation, FFI), who coordinates logistics for the field trips in 2008 and 2011. Our sincere thanks are addressed to S. Howards and Dr. H.H. Tan from National University of Singapore, and the other students and colleagues, K. Indraswari, G. Ramadhan, L.R. Aditya, N. Firdaus, (ITB) and H.N. Tokan, Mediyansyah, H. Hasymi, D. Aryadi, D. Aryadi, B. Susilo (UNTAN), who helped us in the field.

1989

JoTT Communication

3(8): 1990–2000

Restinga lizards (Reptilia: Squamata) at the Imbassaí Preserve on the northern coast of Bahia, Brazil Danilo Couto-Ferreira 1, Moacir Santos Tinôco 2, Magno Lima Travassos de Oliveira 3, Henrique Colombini Browne-Ribeiro 4, Cecil Pergentino Fazolato 5, Ricardo Marques da Silva 6, Gilvana Santos Barreto 7 & Marcelo Alves Dias 8 Graduando em Ciências Biológicas - Universidade Católica do Salvador (UCSal), Av. Prof. Pinto de Aguiar, 2589, 41.740-090, Pituaçu, Salvador-BA, Brasil.

2 Docente do Instituto de Ciências Naturais e da Saúde da UCSal. PhD Candidate, Biodiversity Management - DICE, Department of Anthropology and Conservation, Marlowe Building, The University of Kent at Canterbury, Kent, CT2 7NZ. 3 Mestrando em Ecologia e Biomonitoramento - Universidade Federal da Bahia (UFBa), Rua Barão de Jeremoabo, s/n, 40.170-115, Ondina, Salvador-BA, Brasil.

2,4 M.Sc. em Ecologia e Biomonitoramento – UFBa. 8 Mestrando em Zoologia - PEDECIBA, Universidad de la República Uruguay. Oficinas Centrales, Av. 18 de Julio 1968, Montevideo, Uruguay.

1,2,3,4,5,6,7,8 Centro de Ecologia e Conservação Animal (ECOA/UCSal); 1,2,4,5,6,7,8 Lacerta Consultoria, Projetos e Assessoria Ambiental Ltda.

Email: 1 danilocoutoferreira@gmail.com (corresponding author), 2 mst8@kent.ac.uk, 3 magno_travassos@hotmail.com, 4 henriquebrowne@gmail.com, 5 fazolato.cp@gmail.com, 6 ricardomarquesdasilva@hotmail.com , 7 gilvanabarreto@gmail.com, 8 marceloalvesdias@yahoo.com.br 1,5,6,7

Date of publication (online): 26 August 2011 Date of publication (print): 26 August 2011 ISSN 0974-7907 (online) | 0974-7893 (print) Editor: Aaron Bauer Manuscript details: Ms # o2800 Received 11 May 2011 Final received 28 June 2011 Finally accepted 01 August 2011 Citation: Couto-Ferreira, D., M.S. Tinôco, M.L.T. de Oliveira, H.C. Browne-Ribeiro, C.P. Fazolato, R.M. da Silva, G.S. Barreto & M.A. Dias (2011).

Restinga lizards (Reptilia: Squamata) at the Imbassaí Preserve on the northern coast of Bahia, Brazil. Journal of Threatened Taxa 3(8): 1990–2000.

Copyright: © Danilo Couto-Ferreira, Moacir Santos Tinôco, Magno Lima Travassos de Oliveira, Henrique Colombini Browne-Ribeiro, Cecil Pergentino Fazolato, Ricardo Marques da Silva, Gilvana Santos Barreto & Marcelo Alves Dias 2011. Creative Commons Attribution 3.0 Unported License. JoTT allows unrestricted use of this article in any medium for non-profit purposes, reproduction and distribution by providing adequate credit to the authors and the source of publication.

Abstract: This study presents the diversity of lizard species at the Imbassaí Preserve, located in the Mata de São João municipality, on the northern coast of Bahia region, Brazil, with special attention to the threatened and endemic species. We present the main results on richness and abundance, from a long term monitoring program and especially from the period between November 2008 and June 2010. We applied the visual search method associated with pitfall traps and random encounters, on a 200m linear transect, in four different vegetation habitats. We detected 26 lizard species, distributed in 19 genera of 10 families. The study reveals a high diversity area for lizards, within the restinga ecosystem along the northern coast line, and therefore contributes to the knowledge of the herpetofauna on the northern coast of the Bahia region, as well as to future management and monitoring programs.

Keywords: Atlantic Forest, herpetofauna, northeast, restinga.

Portuguese Abstract: Este estudo apresenta a diversidade de espécies de lagartos na Reserva Imbassaí, localizada no município de Mata de São João, na região do litoral norte da Bahia, Brasil, com atenção especial para as espécies endêmicas e ameaçadas.

Nós apresentamos os principais resultados sobre a riqueza e abundância, a partir de uma programa de monitoramento de longa duração e especialmente do período entre novembro de 2008 e junho de 2010. Nós aplicamos o método da procura visual, associado à armadilhas de direcionamento e queda e encontros ocasionais, ao longo de um transecto linear de 200m, em quatro diferentes fitofisionomias. Nós detectamos 26 espécies de lagartos, distribuídas entre 19 gêneros e dez famílias. O estudo revela uma área de elevada diversidade de lagartos, em ecossistema de restinga ao longo da linha costeira, e assim contribuindo para o conhecimento sobre a herpetofauna do litoral norte da Bahia, bem como para futuros programas de manejo e monitoramento.

For Author Details, Author Contributions and Acknowledgements see end of this article

INTRODUCTION

OPEN ACCESS | FREE DOWNLOAD

1990

Squamates are the most speciose clade of reptiles. They comprise 7200 species, and even excluding snakes, there are still 4450 species, which leaves lizards with the greatest number of extant species among living reptile groups (Vitt & Caldwell 2009). In Brazil there are 308 species (7.11% of the global diversity). These are distributed in 14 families mainly inhabiting the Atlantic and Amazon forest biomes (Martins & Molina 2008).

Journal of Threatened Taxa | www.threatenedtaxa.org | August 2011 | 3(8): 1990–2000

Restinga lizards of Imbassaí Preserve

The Atlantic Forest biome brings together diverse ecosystems, including the rainforest, flooded forests, mangroves, swamps and the coastal sand dune plains, locally known as restinga (Câmara 2003). Even though it is classified as a global biodiversity hotspot, the entire biome and its associated ecosystems suffer from severe habitat loss due to urban growth and other human associated impacts, including tourism, industry and agriculture, mainly on the coastal lands of Brazil (Primack & Rodrigues 2001; Tabarelli et al. 2003, 2005). Among all of these disturbed areas, the northern coast of Bahia demands special attention for its extent and unique landscape features (Dias & Rocha 2005; Tinôco et al. 2008, 2010). As a result of this, most of the 20 endangered and endemic Brazilian reptile species, nine of them lizards, occur in the Atlantic Forest, and 13 of these are limited to coastal ecosystems, especially the restinga, (Tabarelli et al.

2003, 2005; Martins & Molina 2008).

Throughout this region where the restinga is the dominant landscape component, the construction of hotel resorts, highways, residential estates and villages, dating from the early 1960s (Kottak 2006) are contributing to the loss of large tracts of habitat, where the fauna is to some extent, still unknown, especially for those elements for which the actual biodiversity is not well described, as is the case for the herpetofauna (Dias & Rocha 2005; Tinôco et al. 2008, 2010).

The verified development within the region reflects on the stability of the natural communities, and may be interfering with its natural balance, in such a way that important biodiversity elements may be disappearing or declining. Therefore, this also reflects on the high relevance of such studies, the outcomes of which include the bringing to light of the actual status of the fauna and flora on a long term basis (Tinôco et al.

2008, 2010).

Reptiles are, in the above context, especially well adapted to the restinga environment, first because their physiology allows most taxa to adapt to the low levels of moisture and to the high temperatures (Rocha 2000). However, although some local efforts have been made in the southeast of the country (Rodrigues 2005), little is known about this fauna in the restinga ecosystem of the northern coast of Bahia.

This knowledge is therefore, a fundamental tool for taking action to protect this diversity, and to discuss the current status of the taxa described as endemic or

D. Couto-Ferreira et al.

threatened to extinction (Dias & Rocha 2005; Tinôco et al. 2008, 2010).

This overall knowledge is well described in other parts of the country where restinga is present, as in the case of Guriri, in Espírito Santos State (Teixeira 2001), Jurubatiba, in Rio de Janeiro (Rocha et al. 2004) and Juréia, in São Paulo (Marques & Sazima 2004). These are significant studies conducted over ten years in some cases, but there are no accounts of comparable long term monitoring programs on the coast of Bahia, especially concerning reptiles, and more specifically, lizard species.

Following these assumptions, this study presents the lizard species composition and overall diversity at Imbassaí Preserve, including notes on the use of habitat in four vegetation type habitats, and distinctive contributions to herpetofaunal knowledge, giving special attention to endangered and endemic species.

MATERIALS AND METHODS Study site The study was conducted in the Imbassaí Preserve, a private preserve, one of a few protected areas within the region that includes the restinga ecosystem, in Mata de São João municipality, on the northern coast of Bahia, in Brazil (Image 1). The northern coast region of the state lies along 220km of coastline, all of which incorporates the restinga ecosystem in connection with important patches of rainforest remnants. The study site is also within the borders of the North Coast Environmental Protection Area (NCEPA), locally known as APA (“Area de Proteção Ambiental do Litoral Norte” Decreto Nº 1.046/1992).

The region is dominated by a tropical climate, with 1,500–2,100 mm annual rainfall, with greatest precipitation between the months of May and August, and annual air temperature varying along a 23–35 0 C gradient (Queiroz 2007). The Imbassaí Preserve (12028’43.11”S & 37057’28.64”W) is part of a more extensive property (138ha) of natural and developed areas, and it is comprised of residential villages, resort hotels, a commercial village, and a natural preserved environmental zone, which represents over 40% of the entire property, which is preserved as a part of a mitigation plan proposed by the governmental licensing process.

Journal of Threatened Taxa | www.threatenedtaxa.org | August 2011 | 3(8): 1990–2000

1991

Restinga lizards of Imbassaí Preserve

D. Couto-Ferreira et al.

Image 1. Study site location - Reserve Imbassaí, northern coast of Bahia, northeast of Brazil. (Map: C.M. Menezes 2008)

The landscape also includes a traditional village and other private properties, which have been left undisturbed nearby. The study site is composed of four dominant vegetation habitat types: herbaceous beach vegetation (BV; Images 2A,B), temporary and permanently flooded zones (HZ; Images 2B,C), scrub vegetation (SV; Images 2D,E) and dry restinga forest (RF; Images 2E,F).

Data collection and analysis Six surveys were conducted between November 2008 and June 2010 every two months, including all seasonal variations within a year. Each survey consisted of four simultaneous sample days in all four sampled vegetation type habitats (BV, HZ, SV, and RF). Each sampled site, consisted of a linear transect of 200 m, where visual searching technique and pitfall trapping were used. The visual search was conducted by two surveyors for two hour periods.

The six surveys were conducted from 0600hr to 1800hr, and covered all sample sites, and the four vegetation type habitats, where animals were searched 1992

for throughout the 12 daylight hour period during the one year study. All surveys also included a night search in all sampled vegetation type habitats, consisting of visual searching from 1900 to 2100 hr. Sample design consisted of the application of two main techniques: (1) the time constrained visual search, consisting of active searching, where all micro habitats and refuges were searched by two experienced surveyors, during two hours, totaling 384 hours effort, and; (2) drift fence pitfall trapping, using two 20 litter buckets, with a 10m long and 0.4m high black plastic construction sheet fixed with wooden poles. We used 50 such traps, which remained open for four consecutive days, in all four vegetation type habitats; (3) finally, random encounters (RE) were also recorded, and consisted of the record of any animal detected by chance along the transect, and outside of the search hours.

All recorded specimens had their location and habitat type registered, biometric information taken, and were marked (fluorescent elastomer) and released at the point of capture. The study was conducted under permit 03/2009 - NUFAU - IBAMA/BA, for the

Journal of Threatened Taxa | www.threatenedtaxa.org | August 2011 | 3(8): 1990–2000

Restinga lizards of Imbassaí Preserve

D. Couto-Ferreira et al.

A

B

C

D

E

F

Image 2. Restinga vegetation type at the Reserva Imbassaí, northern coast of Bahia, Brazil A - Herbaceous beach vegetation; B - Imbassaí river on the border of beach vegetation and the humid vegetation zone; C - Temporary humid zone flooded; D - Scrub vegetation; E - Transition between the scrubby vegetation and the dry restinga forest; F - Restinga Dry Forest. Photos by D. Couto-Ferreira.

Imbassaí Preserve Long Term Monitoring Program.

General counts are presented, including abundance and richness as the main data summaries. Shannon and Simpson diversity indices were calculated. The choice of these indices takes into account the presence

of rare and common species, and therefore gives a broader view of the local lizard diversity.

Species conservation status categories classification (Data Deficient - DD; Least Concern - LC; Vunerable - VU; Endangered - EN) considered the IUCN Red

Journal of Threatened Taxa | www.threatenedtaxa.org | August 2011 | 3(8): 1990–2000

1993

Restinga lizards of Imbassaí Preserve

D. Couto-Ferreira et al.

List, when listed, otherwise, the national red list was applied. Categories are indicated on the species list table.

Table 1. Lizard species list for the Reserve Imbassaí, restinga ecosystem, northern coast of Bahia, Brazil N - number of individuals; Vegetation type (1 - BV, 2 - HZ, 3 - SV, 4 - RF).

Family (Author) / Species (Author)

N

Vegetation type

Categ.

LC

RESULTS

Amphisbaenidae Gray, 1825 Amphisbaena alba Linnaeus, 1758

1

4

We registered 26 lizard species for the study site, distributed into 19 genera and 10 families: Amphisbaenidae (n=3), Iguanidae (n=1), Polychrotidae (n=2), Tropiduridae (n=3), Gekkonidae (n=2), Phyllodactylidae (n=4), Sphaerodactylidae (n=1), Teiidae (n=5), Gymnophthalmidae (n=3) e Scincidae (n=2). The most abundant species, in descending order were: Tropidurus hygomi Reinhardt & Luetken, 1861 (n=1599) a local restinga endemic species, Cnemidophorus ocellifer (Spix, 1825) (n=641), Coleodactylus meridionalis (Boulenger, 1888) (n=103), Mabuya macrorhyncha Hoge, 1947 (n=69), Phyllopezus pollicaris (Spix, 1825) (n=46), Bogertia lutzae Loveridge, 1941 (n=27), Hemidactylus mabouia (Moreau de Jonnès, 1818) (n=21), Cnemidophorus abaetensis Dias, Rocha & Vrcibradic, 2002, a local restinga endangered species according to the Brazilian red list (n=18), Tupinambis merianae (Duméril & Bibron, 1839) (n=7), Iguana iguana (Linnaeus, 1758) (n=4), Hemidactylus brasilianus (Amaral, 1935) (n=4), Micrablepharus maximiliani (Reinhardt & Luetken, 1862) (n=3) Tropidurus hispidus (Spix, 1825) (n=3), Anolis ortonii Cope, 1868 (n=3), Gymnodactylus darwinii (Gray, 1845) (n=2), Kentropix calcarata Spix, 1825 (n=2), Amphisbaena vermicularis Wagler, 1824 (n=2), and Amphisbaena alba Linnaeus, 1758, Amphisbaena octostega (Duméril, 1851), Ameiva ameiva (Linnaeus, 1758), Cercosaura ocellata Wagler, 1830, Colobossaura modesta (Reinhardt & Lütken, 1862), Mabuya agilis (Raddi, 1823), Phyllopezus periosus Rodrigues, 1986, Polychrus acutirostris Spix, 1825 and Tropidurus semitaeniatus (Spix, 1825) (all n=1) (Table 1; Images 3–5).

About 59 % of the detected species were using one vegetation type habitat, the other 25% were recorded using two of those habitats, 3% used three habitat types, and 11% were using all four. However, when looking at each vegetation type as a distinct habitat, the humid zones recorded 51% of the use, the beach vegetation and restinga forest 40%, and the scrub vegetation habitat type 33% of lizards’ richness (Table

Amphisbaena vermicularis Wagler, 1824

2

4

Amphisbaena octostega (Duméril, 1851)

1

4

4

1, 2

Polychrus acutirostris Spix, 1825

1

2

Anolis ortonii Cope, 1868

3

4

Tropidurus hispidus (Spix, 1825)

3

3

Tropidurus hygomi Reinhardt & Lütken, 1861

1599

1, 2, 3, 4

Tropidurus semitaeniatus (Spix, 1825)

2

2

Hemidactylus mabouia (Moreau de Jonnès, 1818)

21

1, 3

Hemidactylus brasilianus (Amaral, 1935)

4

2, 3

Bogertia lutzae Loveridge, 1941

27

2, 3

Gymnodactylus darwinii (Gray, 1845)

2

1

Phyllopezus periosus Rodrigues, 1986

1

4

Phyllopezus pollicaris (Spix, 1825)

46

1

103

2, 3, 4

Ameiva ameiva (Linnaeus, 1758)

1

2

Cnemidophorus abaetensis Dias, Rocha & Vrcibradic, 2002

18

3, 4

Cnemidophorus ocellifer (Spix, 1825)

641

1, 2, 3, 4

Tupinambis merianae (Duméril & Bibron, 1839)

7

2, 3

Kentropyx calcarata Spix, 1825

2

4

Cercosaura ocellata Wagler, 1830

1

2

Colobossaura modesta (Reinhardt & Luetken, 1862)

1

2

Micrablepharus maximiliani (Reinhardt & Luetken, 1862)

3

1, 2

Mabuya macrorhyncha Hoge, 1947

69

1, 2, 3, 4

Mabuya agilis (Raddi, 1823)

1

1

1994

Iguanidae Oppel, 1811 Iguana iguana (Linnaeus, 1758) Polychrotidae Fitzinger, 1843

Tropiduridae Bell, 1843

LC

Gekkonidae Gray, 1827

Phyllodactylidae Gamble, Bauer, Greenbaum & Jackman, 2008

Sphaerodactylidae Underwood, 1954 Coleodactylus meridionalis (Boulenger, 1888) Teiidae Gray, 1827

VU

LC

Gymnophthalmidae Merrem, 1820

Scincidae Gray, 1825

Journal of Threatened Taxa | www.threatenedtaxa.org | August 2011 | 3(8): 1990–2000

Restinga lizards of Imbassaí Preserve

D. Couto-Ferreira et al.

A

B

C

D

E

F

Image 3. Restinga’s lizards’ species, Reserva Imbassaí, northern coast of Bahia, Brazil A - Amphisbaena alba (Amphisbaenidae); B - Iguana iguana (Iguanidae); C - Polychrus acutirostris (Polychrotidae); D - Tropidurus hygomi (Tropiduridae); E - Hemidactylus brasilianus (Gekkonidae); F - Hemidactylus mabouia (Gekkonidae).

Photos by R. Marques.

1).

The Imbassaí Preserve lizard diversity is reflected in Shannon and Simpson diversity indices of 2.23 and 0.83, respectively. The humid vegetation habitat were associated with the highest diversity indices

(Shannon=2.1; Simpson=0.8) followed by dry forest habitat (Shannon=2.11; Simpson=0.79). Beach vegetation had the lowest values, although it showed a high abundance (Shannon=1.37; Simpson=0.62), preceded by the scrub vegetation type habitat

Journal of Threatened Taxa | www.threatenedtaxa.org | August 2011 | 3(8): 1990–2000

1995

Restinga lizards of Imbassaí Preserve

D. Couto-Ferreira et al.

A

B

C

D

E

F

Image 4. Restinga’s lizards’ species, Reserva Imbassaí, northern coast of Bahia, Brazil A - Gymnodactylus darwinii (Phyllodactylidae); B - Phyllopezus periosus (Phyllodactylidae); C - Coleodactylus meridionalis (Sphaerodactylidae); D - Ameiva ameiva (Teiidae); E - Cnemidophorus abaetensis (Teiidae); F - Cnemidophorus ocellifer (Teiidae). Photos by R. Marques.

(Shannon=1.41; Simpson=0.63). Despite differences, all vegetation type habitats supported relatively high diversity levels.

1996

DISCUSSION AND CONCLUSIONS When we consider the Brazilian list of reptile species (Bérnils 2010), the study recorded nearly 11% of Brazilian lizard diversity. Some species had

Journal of Threatened Taxa | www.threatenedtaxa.org | August 2011 | 3(8): 1990–2000

Restinga lizards of Imbassaí Preserve

D. Couto-Ferreira et al.

A

B

C

D

Image 5. Restinga’s lizards’ species, Reserva Imbassaí, northern coast of Bahia, Brazil A - Tupinambis merianae (Teiidae); B - Cercosaura ocellata (Gymnophthalmidae); C - Mabuya macrorhyncha (Scincidae); D - Anolis ortonii (Polychrotidae). Photos by R. Marques.

been undetected in previous studies, and some of these had been recorded earlier in the Caatinga and Cerrado biomes at the Atlantic Forest biome’s border and adjacent to the restinga ecosystem. These include: Tupinambis merianae and Phyllopezus periosus (Vanzolini et al. 1980; Rodrigues 2003; IUCN 2010).

Previous long term studies in large areas concerning the importance of lizard species in other biomes enhance the relevance of the restinga ecosystem for understanding lizard diversity in Brazil. Vitt et al.

(2008) detected 35 species on the Adolpho Ducke Preserve (Amazon), that study was conducted in a 10,000ha area (72 times larger than the Imbassaí Preserve) and Colli et al. (2002) found 34 species within five municipalities in the Cerrado biome.

Here, we present a small, but interesting portion of lizard diversity when compared to those studies, considering just a small fraction of the entire restinga’s

ecosystem.

Studies on the Atlantic Forest and associated restinga ecosystem herpetofauna, most of which were conducted in the southeastern region of Brazil, are not as extensive as those mentioned above, in the Amazon and the Cerrado. Teixeira (2001) recorded eight lizards species in a 12-month survey in Espírito Santo State, Marques & Sazima (2004) detected nine lizards species in a three-year survey, Rocha et al. (2004) recorded eight species in the Jurubatiba restinga habitats; Carvalho et al. (2007) registered 12 species for Marambaia Island (7,700 ha), off the coast of the Rio de Janeiro State, and the Centro de Ecologia e Conservação Animal (ECOA 2010) reported 19 lizard species in a seven-year monitoring program, in the Parque Metropolitano de Pituaçu (Salvador, Bahia, Brazil), urban Atlantic Forest remnant (~400 ha). Given these figures, and noting that the studies

Journal of Threatened Taxa | www.threatenedtaxa.org | August 2011 | 3(8): 1990–2000

1997

Restinga lizards of Imbassaí Preserve

D. Couto-Ferreira et al.

are not directly comparable, it is clear that the present study reports an important contribution to the overall restinga lizard fauna and adds relevance to the studies mentioned above.

Dias & Rocha (2005) in a study in the same region as this (covering three different localities), and also including another three localities on the south coast of Bahia, recorded 23 lizard species.

However, some of the species recorded here, were not registered in that study, such as, Amphisbaena vermicularis, Amphisbaena octostega, Polychrus acutirostris, Anolis ortonii, Tropidurus hispidus, Tropidurus semitaeniatus, Hemidactylus brasilianus, Gymnodactylus darwinii, Phyllopezus periosus, Phyllopezus pollicaris, Tupinambis merianae and Colobossaura modesta.

Though using different sample designs and time spans, these studies place into context the contribution of the Bahian northern coast to the overall lizard diversity in Brazil. Moreover, this clearly indicates that this is a highly significant region for the conservation of lizards, as it brings together elements (lizard species) from three of the four major biomes: Atlantic Forest, Caatinga and Cerrado, indicating its high biological importance, especially when considering endangered and endemic species.

The Bahian Sand Dune Lizard Cnemidophorus abaetensis and the Sand Dune Lava Lizard Tropidurus hygomi are both endemic to this restinga ecosystem in Bahia (Dias & Rocha 2005; Tinôco et al. 2010). The first is listed as endangered on the Brazilian red list (Martins & Molina 2008), and is of high relevance to this study, due to the gap of information concerning their actual conservation status within the region. This could, in some cases, stifle appropriate management policies by public authorities, justified by the lack of consistent published results. These lizards are critically restricted to the scrub and beach vegetation habitats, and therefore more vulnerable to restinga disturbance from the Capital City Salvador to the northern border of the State of Sergipe (Image 4E). Understanding of habitat use may represent an important tool for their conservation in a highly disturbed landscape.

The Bahian Sand Dune lizard and the Sand Dune Lava lizard are among the five Brazilian lizard species with geographical distributions restricted to the coastal restinga. The first one is also listed as Vulnerable in the Brazilian Red List of Threatened Species (Martins & 1998

Molina 2008). However, the other three species found here, are listed on the IUCN Red List, Amphisbaena alba, Tropidurus semitaeniatus, and the presumably introduced Tupinambis merianae, all under the Least Concern category (IUCN 2010). Tropidurus hygomi although in high abundance, is endemic to the region, occurs mostly on the beach vegetation dunes, and is thus highly vulnerable although it is not listed in any of the categories or lists.

In this study, the distribution of the Bahian Sand Dunes Lizard Cnemidophorus abaetensis was concentrated mainly in the scrub vegetation and the dry forest habitats as suggested by Tinôco et al.

(2010). That possibly indicates an important threat to the species’ conservation, as local legislation designates all scrub vegetation as development sites, and along the entire northern coast most of the scrub vegetation habitat is being destroyed or degraded for the construction of large hotel resorts and residential estates (Tinôco et al. 2010). These may lead to major gaps in the taxon’s distribution and thereby compromise its long term survival within the region. We believe that a combination of a management plan for the entire ecosystem, the establishment of protected areas linked by fauna corridors which can allow the preservation of the major vegetation type habitats and in accordance with the environmental public policies, may result in a better perspective for the conservation of this and the local populations of other taxa.

Our surveys recovered 93.1% (excepting only Tupinambis teguixin (Linnaeus, 1758) and Amphisbaena nigricauda (Gans, 1966)) of the known lizard diversity for the northern coast of the state of Bahia, representing 11.2% of Brazilian lizard biodiversity. This results in a high diversity index, especially for the dry forest and aquatic vegetation habitats, which are already protected by Brazilian and state legislation, and reveals, in a highly disturbed ecosystem, threatened, endemic, introduced, and new records for taxa such as the Sand Dune Lava Lizard Tropidurus hygomi and the Bahian Sand Dune Whiptail Cnemidophorus abaetensis, among four other threatened species.

This study contributes 13 new species records for the region, filling some distribution gaps on the northern coast of Bahia for endangered or endemic species, giving important support for the development of a management plan and conservation actions to protect

Journal of Threatened Taxa | www.threatenedtaxa.org | August 2011 | 3(8): 1990–2000

Restinga lizards of Imbassaí Preserve

lizards, particularly endemic and endangered species on the northern coast of Bahia. It indicates a relevant diversity index for four vegetation type habitats, apart from dry forest and aquatic vegetation habitats, which are already covered by protective legislation. Finally, these important contributions call for action and new policies providing real protection for the high lizard diversity of the Atlantic Forest ecosystem.

REFERENCES Bérnils, R.S. (org.). (2010). Brazilian reptiles – List of species.

Sociedade Brasileira de Herpetologia. <http://www. sbherpetologia.org.br/>. On-line version dated 27 May 2010.

Câmara, I.G. (2003). Brief history of conservation in the Atlantic forest, pp. 31–42. In: Galindo-Leal, C. & I.G. Câmara (eds.). The Atlantic Forest of South America: Biodiversity Status, Threats, and Outlook. Center for Applied Biodiversity Science and Island Press, Washington.

D.C. Carvalho, A.L.G., A.F.B. Araújo, H.R. Silva (2007). Lagartos da Marambaia, um remanescente insular de restinga e Floresta Atlântica no estado do Rio de Janeiro, Brasil. Biota Neotropica 7(1): 221–226.

Colli, G.R., R.P. Bastos & A.F.B. Araújo (2002). The character and dynamics of the Cerrado herpetofauna, pp. 223–241.

In: Oliveira, P.S. & R.J. Marquis (eds.). The Cerrados of Brazil: Ecology and Natural History of a Neotropical Savanna. Columbia University Press, New York.

Dias, E.J.R. & C.F.D. Rocha (2005). Os répteis nas restingas do Estado da Bahia: pesquisa e ações para a sua conservação.

Instituto Biotemas, Rio de Janeiro, 36pp.

ECOA (2010). Animais e plantas do Parque Metropolitano de Pituaçu – Lista de Espécies. Centro de Ecologia e Conservação Animal (ECOA). <http://www.ucsal.br/ pesquisa/ecoa/pesq_apresentacao.asp.> On-line version dated 15 September 2010.

IUCN (2010). IUCN Red List of Threatened Species.

Version 2010.4. <www.iucnredlist.org>. Downloaded on 30 December 2010.

Kottak, C.P. (2006). Assault on Paradise - The Globalization of A Little Community in Brazil. McGraw Hill, Fourth Edition, Boston, 221pp.

Marques, O.A.V. & I. Sazima (2004). História natural dos répteis da Estação Ecológica Juréia-Itatins, pp. 257–277.

In: O.A.V. Marques & W. Dulepa (eds.). Estação Ecológica Juréia-Itatins. Ambientes Físico, Flora e Fauna. Holos, Ribeirão Preto, 384pp.

Martins, M. & F.B. Molina (2008). Panorama Geral dos Répteis Ameaçados do Brasil, pp. 327–376. In: Machado,

D. Couto-Ferreira et al.

A., G. Drummond & A. Paglia (eds.). Livro Vermelho da Fauna Brasileira Ameaçada de Extinção. Ministério do Meio Ambiente, Fundação Biodiversitas, Brasília/DF, 1420pp.

Primack, R.B. & E. Rodrigues (2001). Biologia da Conservação. Editora Planta, Londrina/PR, 328pp.

Queiroz, E.P. (2007). Levantamento florístico e georreferenciamento das espécies com potencial econômico e ecológico em restinga de Mata de São João, Bahia, Brasil.

Biotemas 20(4): 41–47.

Rocha, C.F.D. (2000). Biogeografia de répteis de restinga: distribuição, ocorrência e endemismo, pp. 99–116. In: Esteves, F.A. & L.D. Lacerda (eds.). Ecologia de restingas e lagoas costeiras. Macaé/RJ, NUPEM/UFRJ, 446pp.

Rocha, C.F.D., M. Van-Sluys, D. Vrcibradic, F.H. Hatano, C.A. Galdino, M. Cunha-Barros & M.C. Kieffer (2004).

A comunidade de répteis da restinga de Jurubatiba, pp.

179–198. In: Rocha, C.F.D., F.A. Esteves & F.R. Scarno (orgs.). Pesquisas ecológicas de longa duração na restinga de Jurubatiba: ecologia, história natural e conservação.

RiMa Editora, São Carlos, 374pp.

Rodrigues, M.T. (2005). Conservação dos répteis brasileiros: os desafios para um país megadiverso. Megadiversidade, 1(1): 87-94.

Rodrigues, M.T. (2003). Herpetofauna da Caatinga, pp. 181236. In: Leal, I.R. M. Tabarelli & J.M.C. Silva (eds.).

Ecologia e conservação da Caatinga. Editora Universitária, Universidade Federal de Pernambuco, Recife, Brasil.

Tabarelli, M., L.P. Pinto, J.M.C. Silva & C.M.R. Costa (2003). The Atlantic Forest of Brazil: endangered species and conservation planning, pp. 86–94. In: Galindo-Leal, C. & I.G. Câmara (eds.). The Atlantic Forest of South America: biodiversity status, threats, and outlook. Center for Applied Biodiversity Science e Island Press, Washington. D.C. Tabarelli, M., L.P. Pinto, J.M.C. Silva, M.M. Hirota & L.C. Bedê (2005). Desafios e oportunidades para a conservação da biodiversidade na Mata Atlântica brasileira.

Megadiversidade 1(1): 133–138.

Teixeira, R.L. (2001). Comunidade de lagartos da restinga de Guriri, São Mateus, ES, Sudeste do Brasil. Atlântica, Rio Grande 23: 77–84.

Tinôco, M.S., H.C. Browne-Ribeiro, R. Cerqueira, M.A. Dias & I.A. Nascimento (2008). Habitat change and the conservation of amphibians in the Atlantic Forest in Bahia, Brazil. Froglog, IUCN/Amphibian Specialist Group 89: 1–3.

Tinôco, M.S., H.C. Browne-Ribeiro & M.A. Dias (2010).

The Bahian Sand Dunes Whiptail Lizard Cnemidophorus abaetensis Dias, Rocha & Vrcibradic 2002 (Reptilia, Scleroglossa, Teiidae), geographic distribution and habitat use in Bahia, Brazil. Herpetologicall Bulletin, 111: 19–24.

Vanzolini, P.E., A.M.M. Ramos-Costa & L.J. Vitt (1980).

Répteis das Caatingas. Academia Brasileira de Ciências,

Journal of Threatened Taxa | www.threatenedtaxa.org | August 2011 | 3(8): 1990–2000

1999

Restinga lizards of Imbassaí Preserve

D. Couto-Ferreira et al.

Rio de Janeiro.

Vitt, L.J., W.E. Magnusson, T.C. Ávila-Pires & A.P. Lima (2008). Guide to the Lizards of Reserva Adolpho Ducke, Central Amazonia. Átterna Design Editorial, Manaus/AM, 176pp.

Vitt, L.J. & Caldwell, J.P. (2009). Herpetology. Academic Press. 3rd Edition, Burlington, 713pp.

Author Details: Danilo Couto-Ferreira Biological Sciences undergraduate student and junior researcher at the Centro de Ecologia e Conservação Animal (ECOA), Universidade Católica do Salvador (UCSAL). Moacir Santos Tinôco Centro de Ecologia e Conservação Animal (ECOA) co-ordinator. Biodiversity Management PhD Candidate at the Durrell Institute for Conservation and Ecology, School of Anthropology and Conservation, University de Kent. Magno Lima Travassos de Oliveira MSc in Ecology and Biomonitoring at the Universidade Federal da Bahia (UFBA). Contributing researcher at the Centro de Ecologia e Conservação Animal (ECOA), Universidade Católica do Salvador (UCSAL).

Henrique Colombini BrowneRibeiro MSc in Ecology and Biomonitoring at the Universidade Federal da Bahia (UFBA).

Contributing researcher at the Centro de Ecologia e Conservação Animal (ECOA), Universidade Católica do Salvador (UCSAL).

Cecil Pergentino Fazolato Biological Sciences undergraduate student and junior researcher at the Centro de Ecologia e Conservação Animal (ECOA), Universidade Católica do Salvador (UCSAL). Ricardo Marques da Silva Biological Sciences undergraduate student and junior researcher at the Centro de Ecologia e Conservação Animal (ECOA), Universidade Católica do Salvador (UCSAL). Gilvana Santos Barreto Biological Sciences undergraduate student and junior researcher at the Centro de Ecologia e Conservação Animal (ECOA), Universidade Católica do Salvador (UCSAL).

Marcelo Alves Dias M.Sc. in Zoology at the Programa de Desarrollo de las Ciencias Básicas (PEDEClBA), da Universidad de la RepublicaUruguay. Contributing researcher at the Centro de Ecologia e Conservação Animal (ECOA), Universidade Católica do Salvador (UCSAL).

Author Contribution: All authors are members of the Long Term Restinga Herpetofauna Management and Monitoring Program, and have contributed to field work sampling in all surveys and the development of the current paper.

Acknowledgments: We thank the Long Term North East of Bahia Herpetofauna Program and the “Habitat Change and the Status of the Herpetofauna in the Atlantic Forest of Brazil” Project, of the Durrell Institute of Conservation and Ecology at the University of Kent, UK, the Centro de Ecologia e Conservação Animal (ECOA) - Universidade Católica do Salvador (UCSal) in Bahia, Brazil, the Lacerta Consultoria, Projetos e Assessoria Ambiental Ltda and the Reserva Imbassaí in Mata de São João, Bahia, for all their support and for the opportunity to develop this study.

2000

Journal of Threatened Taxa | www.threatenedtaxa.org | August 2011 | 3(8): 1990–2000

JoTT Communication

3(8): 2001–2010

Status and conservation of crocodiles in the Koshi Tappu Wildlife Reserve, eastern Nepal Rajesh Kumar Goit 1 & Khadga Basnet 2 B.P. Koirala Institute of Health Sciences, Department of Physiology, Dharan, Nepal P.O. Box 7053, Kathmandu, Nepal Central Department of Zoology, Tribhuvan University, Kirtipur, Kathmandu, Nepal Email: 1 goit_rajesh@yahoo.com (corresponding author), 2 kbasnet@ntc.net.np 1 2

Date of publication (online): 26 August 2011 Date of publication (print): 26 August 2011 ISSN 0974-7907 (online) | 0974-7893 (print) Editor: Nikhil Whitaker Manuscript details: Ms # o2735 Received 29 March 2011 Final received 20 June 2011 Finally accepted 13 July 2011 Citation: Goit, R.K. & K. Basnet (2011). Status and conservation of crocodiles in the Koshi Tappu Wildlife Reserve, eastern Nepal. Journal of Threatened Taxa 3(8): 2001–2010.

Copyright: © Rajesh Kumar Goit & Khadga Basnet 2011. Creative Commons Attribution 3.0 Unported License. JoTT allows unrestricted use of this article in any medium for non-profit purposes, reproduction and distribution by providing adequate credit to the authors and the source of publication.

Author Detail: Rajesh Kumar Goit has completed master of science in zoology (ecology) with first division from Central Department of Zoology, Tribhuvan University. Recently, he is studying master of science in human physiology in B.P. Koirala Institute of Health Sciences, Dharan, Nepal. Khadga Basnet is professor at Central Department of Zoology, Kirtipur, Kathmandu, Nepal.

Author Contribution: Field study and paper writing was done by RKG and was supervised

by KB. Acknowledgments: We thank Sanjan Bahadur Thapa and Bridhi Lal Sardar for field guidance and invaluable suggestions.

Tribhuvan University

OPEN ACCESS | FREE DOWNLOAD

Abstract: Koshi Tappu Wildlife Reserve is an area of 175km2 on the alluvial flood plains of the Koshi River in eastern Nepal. Surveys of crocodiles in the Koshi River and its surrounding areas in the reserve were conducted in winter and spring 2008 using direct observation and questionnaires besides literature reviews. Observations were done during the day using binoculars and photo shoots and sites were visited by boat, bicycle and also on foot. Although both Gavialis gangeticus and Crocodylus palustris were previously found in the reserve, only C. palustris was found in this study. The numbers of C. palustris were higher in the winter season - early January (21) than in the spring - mid March (5). The destruction and degradation of crocodiles in the reserve has been caused by various human activities such as wood collection, cattle grazing, fishing, as well as by some natural processes. The success of conservation programs depends upon awareness creation and the development of a positive attitude in the local people towards the species. During this study, most of the respondents from the local community as well as the Reserve staff were positive towards the conservation of C. palustris. This is important as it has its own role in the ecosystem. Continuous release and trans-boundary conservation efforts should be initiated for the protection of G. gangeticus.

Keywords: Crocodile, Crocodylus palustris, Gavialis gangeticus, Koshi River.

Introduction Information on biodiversity such as wildlife status (abundance, distribution and home range), population and community interaction and their contribution to ecosystem development is essential (Basnet 1998).

Such information is essential for conservation management of wildlife and protected areas which are developed by regular monitoring and maintaining records by various scientific methods (Basnet 1998).

The crocodiles of Nepal have attracted the attention of many herpetologists in the past. Biswas (1970) gave an account of the collection and hunting of muggers in the Koshi River. Since crocodile management commenced in Nepal, the program has maintained data on species, numbers involved and locations of release. Some 727 gharials and 164 muggers have been released from rearing stations to the wild from 1981 to 2008 (DNPWC 2008). Gharials have been successfully re-stocked into the Narayani, Babai and Karnali rivers (Andrews & McEachern 1994).

Reintroduced muggers have not been monitored (Andrews & McEachern 1994).

A study carried out by Mishra (2002) showed that the distribution and habitat of the gharial was mainly restricted to Karnali and Babai rivers in Abbreviation: KTWR - Koshi Tappu Wildlife Reserve; DNPWC - Department of National Parks and Wildlife Conservation; VDC - Village Development Committee

Journal of Threatened Taxa | www.threatenedtaxa.org | August 2011 | 3(8): 2001–2010

2001

Crocodiles in Koshi Tappu

R.K. Goit & K. Basnet

Bardia National Park and Rapti and Narayani rivers of Chitwan National Park. Habitat loss has been a leading cause for Nepal’s declining crocodile population. This was accelerated in the mid 1950s when an intensive malaria eradication program opened the Tarai for habitation. Intensive fishing reduced food levels and effected crocodile numbers. They become entangled in nets and either drowned or were killed by fishermen.

Subsequently, tribal hunters have been collecting eggs and slaughtering crocodiles for food and medicinal purpose (Andrews & McEachern 1994). In recent years, the construction of dams and barrages has blocked migratory routes.

During recent years, crocodile breeding has gained increasing importance. The health and disease in farmbred crocodiles have been a major concern in all parts of the world (Lal 1981). Management of crocodiles in both wild and captive conditions has attracted the attention of investigators. Recently, various techniques have been developed for their management. Shrestha (2001) gave an interesting account of management and conservation of crocodiles in Nepal. Le Foll (1982) studied zoo technical problems of muggers in Chitwan National Park.

IUCN Nepal initiated a program for muggers in 1992 in order to develop information about the status of crocodiles, which were declining due to the rapid loss of wetland habitats. However, the progress of this initiative was not made public. The recently created Wetland Inventory and Conservation Programme augments the crocodile projects by supplying logistic support and facilities.

Objective The main objective of the study was to assess the present status of crocodiles present in the Koshi Tappu Wildlife Reserve and provide information required for management.

The specific objectives of this study were as follows: - To estimate the population of crocodiles in the reserve - To assess the threats associated with the crocodiles in the reserve, and - To provide management recommendations for conservation

2002

Materials and Methods A preliminary survey was conducted in KTWR from 1 to 6 November 2007 to explore the potential sites of crocodiles. Reserve staff, nature guides and local people (fishermen, cattle grazers, timber/ firewood collectors, boatmen etc.) were consulted.

The detailed survey was carried out from 1 to 9 January in winter and from 15 to 20 March in spring.

The survey was carried out during the daytime from 0900 to 1600 hr. Observations were made along the river and from the eastern bank. Binoculars and photos were used for observation. The presence of crocodiles in segmented areas was based on sightings as well as indirect evidence. Mugger crocodiles were categorized into size classes- >1.5m as adults, <1.5m as sub adult (Andrews 1993). In order to count the crocodile population and its signs, the study area was divided into three stretches (transects) on the basis of the main river and its branches (Image 1).

Transect I: Included the main river where the river course was deep and fast moving with wide width from Prakashpur to Kushaha, about 8km in length.

The riverine vegetation with Dalbergia sissoo–Acacia catechu forest, dominated the western edge of the river in this area. This forest is mainly associated with Saccharum–Phragmitis grassland with other grassland species like Setaria pallidifusca, Cyperus sp., Eclipta prostrata, Alternanthera sessilis, Desmodium.

Transect II: Included the western branch of the river from Madhuban to Kushaha about 4km in length.

In this branch of the river the water velocity was slow.

In these areas, vegetation like tall elephant grasses Imperata cylindria and Saccharum spontaneous along with scattered Dalbergia sissoo were found.

Transect III: Included the eastern branch of the river from Prakashpur to Shripur about 10km. The structure and vegetation of this area was the same as in Transect II. This part also included marshy areas situated between the river and the eastern embankment of the reserve from Madhuban to Shripur. The area was wide with shallow water at the margins and deep water in the middle, with elevated patches of land.

In this area, vegetation like Imperata cylindria and Saccharum spontaneous along with emergent species Fimbristyllis squarrosa, Saccharum spontaneum, Persicaria lapathifolia; floating species Nymphoides

Journal of Threatened Taxa | www.threatenedtaxa.org | August 2011 | 3(8): 2001–2010

Crocodiles in Koshi Tappu

R.K. Goit & K. Basnet

Image 1. Transects in the study area

hydrophyllum and submerged species Hydrilla– Ceratophyllum were found profusely.

Specific river stretches (transects) were repeatedly surveyed. If animals or signs of them were seen in the same locations as previously observed, then they were classified as repeat counts. If the number was more than previously or different in size and shape than previously seen, or if the signs were found in different places, it was counted as different animals or signs.

During the survey a multi-platform count was done to increase the chances of recording all the individuals and to reduce sampling biases. There were two persons deployed in each of its three potential habitats (Sixth Tower, Madhuban and Prakashpur in winter; and Kushaha, Madhuban and Prakashpur in spring).

During the fixed time period, observers noted the number of individuals in each area to get less biased results. The maximum count in any one count effort on a particular site was taken as the final count unless the individual’s size and shape was different than previously seen. Adults and subadults were counted on the basis of ocular estimation. If a crocodile was

observed and the situation allowed, the attempt was to approach the individual as close as possible.

For indirect evidence of crocodile presence in an area, “U” shaped markings were checked. Generally crocodiles leave a “U” shape on the sand bank along the riverbanks (Whitaker & Basu 1983). The coordination of the observation of the crocodile and its signs were recorded by Garmin GPS. The coordinates were recorded as close as possible to the animal, paying attention not to scare it. Both natural and anthropogenic disturbance factors were identified by field observation, questionnaire surveys, and literature reviews.

Results A total of 21 muggers were observed which included 14 adults and seven sub adults in five different locations and eight marks of animals in winter (Table 1). In spring, only five adult muggers were observed in four different locations with 14 marks (Table 2).

Journal of Threatened Taxa | www.threatenedtaxa.org | August 2011 | 3(8): 2001–2010

2003

Crocodiles in Koshi Tappu

R.K. Goit & K. Basnet

Table 1. The result of survey in winter 2008 Date

Time

Number

Type

Habitat

Position

Place

2 Jan

1430

2

Adult

GB

Basking

Tetriganchi Tal

2 Jan

1430

1

Sub-adult

SGB

Seeking

Tetriganchi Tal

3 Jan

1100

1*+1

Sub-adult

SGB

Sub-merged

Tetriganchi Tal

3 Jan

1100

2*

Adult

GB

Basking

Tetriganchi Tal

4 Jan

1000

2*

Adult

GB

Basking

Tetriganchi Tal

4 Jan

1500

2*+1

Sub-adult

SGB

Sub-merged

Tetriganchi Tal

5 Jan

0930

1

Mark

SB

Dry

Kushaha

5 Jan

1030

1

Adult

SB

Basking

Sixth Tower

6 Jan

1015

5

Adult

SB

Basking

Madhuban

6 Jan

1035

7

Marks

SB

Fresh

Madhuban

6 Jan

1400

5*+1

Adult

SB

Gaping

Madhuban

6 Jan

1400

1

Sub-adult

SB

Basking

Madhuban

6 Jan

1500

1*+1

Adult

SB

Seeking

Sixth Tower

6 Jan

1500

1

Sub-adult

SB

Sub-merged

Sixth Tower

7 Jan

1200

5*

Adult

SB

Basking

Madhuban

7 Jan

1255

1*+2

Sub-Adult

SB

Basking

Madhuban

7 Jan

0200

1

Adult

RC

Sub-merged

Prakashpur

8 Jan

1300

2

Adult

SB

Gaping

Madhuban #

8 Jan

1330

1

Sub-adult

SB

Basking

Madhuban #

* - Repeated count; # - River branch; GB - Grass Bank; RC - River Channel; SGB - Sand Grass Bank; SB - Sand Bank

Table 2. The result of survey in spring 2008 Date

Time

Number

Type

Habitat

Position

Place

18 March

1000

2

Marks

SB

Fresh

Kushaha

18 March

1020

1

Mark

SB

Fresh

Kushaha

18 March

1110

2

Marks

SB

Dry

Fifth Tower

18 March

1150

6

Marks

SB

Fresh

Madhuban

18 March

0115

2

Marks

SB

Fresh

Prakashpur

18 March

0210

2

Adult

SGB

Running

Madhuban

18 March

0240

1

Adult

SGB

Running

Kushaha

19 March

1045

3*

Marks

SB

Fresh

Kushaha

19 March

1050

1

Mark

SB

Old

Kushaha

19 March

1215

1

Adult

SB

Running

Madhuban

19 March

0210

1*+1

Adult

SGB

Running

Kushaha

In both the seasons gharial was not observed. In this study marks were observed near the side where animals were observed.

Field characteristics of the mugger crocodile Muggers were mainly observed during the basking, gaping, seeking, submerged positions on the western banks of the river and its branches and the marshes (Tetriganchi Tal) in winter; while all the muggers observed in spring were in motion (running) from the bank towards the river. Observations from a hide-out from late morning to late evening showed that most of 2004

* - Repeated count; # - River branch; GB - Grass Bank; RC - River Channel; SGB - Sand Grass Bank; SB - Sand Bank

the time muggers exhibited little or no activity (Tables 1 & 2).

Muggers practiced basking on land (Images 2A,B) or in submerged positions (Image 2C) during the day.

So, temperature selection (either heat seeking or heat avoidance) within available habitats was an important daily activity of the muggers. They sought shade, lying near the basking spot (Images 2D,E). The shade seeking activity started at about 1400hr (Table 1). At noon, the muggers were seen gaping by opening their buccal cavity to the sun for long periods (Image 2F).

Field observations showed that muggers used the same

Journal of Threatened Taxa | www.threatenedtaxa.org | August 2011 | 3(8): 2001â&#x20AC;&#x201C;2010

Crocodiles in Koshi Tappu

R.K. Goit & K. Basnet

A

B

C

D

E

F

Image 2. A - An adult mugger basking on the sand grass bank; B - An adult mugger basking on the sand bank; C - An adult mugger basking on the submerged position; D - A sub adult mugger basking on the sand bank; E - A mugger seek shade lying mear the basking area; F - An adult mugger gaping on the submerged position

basking platform (Images 3A–C), finding the area by leaving a trail (Images 3D–F).

Natural and anthropogenic disturbances threatening mugger There was very little historical information on the population of crocodiles in KTWR. So finding the factors responsible for the decreasing population of crocodiles was based on questionnaire surveys with the people of the community as well as with

the Reserve staff and other crocodile experts and interested persons. The destruction and degradation of crocodiles in the reserve was caused by various human activities, as well as by some natural processes.

Habitat losses Seepage areas on the eastern embankment adjacent to the agricultural fields were severely affected by agricultural run-off. These were hypereutrophic, being almost completely covered by Water Hyacinth

Journal of Threatened Taxa | www.threatenedtaxa.org | August 2011 | 3(8): 2001–2010

2005

Crocodiles in Koshi Tappu

R.K. Goit & K. Basnet

A

B

C

D

E

F

(Eichhornia crassipes) and other microphytes. Many of the wetlands had changed from mesotrophic to eutrophic due to the accumulation of nutrients from natural and human activities. So, there was only the Tetriganchi Tal as a marsh which could be used by the muggers.

downwards most of the juvenile and released crocodiles into the Indian river systems. Downstream movement of crocodiles was also reported from the Koshi River to India. During this study one adult gharial was found in Bhimnagar (Zero kilometer), Bihar, the GPS reading was 86056’39.7”E and 26030’43.9”N where crocodiles were not recorded previously.

Image 3. A & B - The mugger using the same basking platform; C - An adult mugger crawling on the sand bank; D - A mark due to its crawl; E & F - “U” shaped marks due to its crawl

Barrage The Koshi Barrage is not equipped with devices to facilitate the migration of crocodiles. During the monsoon season strong currents of water sweep 2006

Human activities Though there was a lack of conservation awareness among the local people towards the crocodile, illegal

Journal of Threatened Taxa | www.threatenedtaxa.org | August 2011 | 3(8): 2001–2010

Crocodiles in Koshi Tappu

R.K. Goit & K. Basnet

A

C

B

D

Image 4. A - Movement of the livestock along the shoreline; B - People came to collect the firewood; C - Human activities along the bank of the edge of the river; D - Low level of water in the Tetriganchital in summer

poaching was not reported in the Reserve. Since there was no clear Reserve boundary crocodiles were heavily disturbed due to human activities inside the Reserve.

Animals commonly kept by the local people were cows, buffaloes and goats. During winter, more than 30,000 animals including goats were grazed in the Reserve. Over grazing and the movement of livestock along the shoreline contributes to soil erosion which leads to the loss of suitable habitats for crocodiles (Image 4A). Village children and cattle grazers chased the muggers and disturbed them by stoning them from the dam (Tetriganchi Tal) of the Reserve when the muggers were basking.

There were no fences and no regular patrolling, people from the buffer zone and nearby villages came to the reserve illegally to collect firewood, timber, leaf litter and other forest products as well as for illegal hunting of wild animals. More than 1000 people came to the reserve for firewood for personal use or to sell in the nearby market. In the Madhuban area

local inhabitants from the buffer zone of the reserve cut down trees and branches and collect the drooping branches along the riverbanks for firewood. These offer resting and holding, as well as, hiding platforms for crocodiles (Images 4B,C). In the eastern dam of the Reserve more than 1000 people came to collect firewood, timber leaf and to eat/collect bair (Zizyphus mouritiana) in winter. So the disturbances due to people walking caused stress and significant disruption in the basking activity of muggers found in the Tetriganchi Tal and the branch of the river in Madhuban. In spring more than 1000 people with permits entered to the reserve for grass cutting. Most of the areas for cutting grasses were across the river. So during this period muggers were more disturbed.

The other common activity observed in the reserve was the fishing by the indigenous community, from children to adults for subsistence living and selling.

They used different techniques for fish capture, such as net, hook, traps and biological and chemical poisons but the most common method was by using

Journal of Threatened Taxa | www.threatenedtaxa.org | August 2011 | 3(8): 2001–2010

2007

Crocodiles in Koshi Tappu

R.K. Goit & K. Basnet

Figure 1. Responses about constrains for crocodile conservation

the net. The majority of the fish collectors were the Ghongi (including Majhi and Malah) because their poverty and limited land had driven them to do this for subsistence living. Though some had permission from headquarters, most of fishers were fishing illegally. According to the National Parks and Wildlife Conservation Act 1973 no one can hunt fish at night in protected areas, but in the Reserve it was seen that fishermen were fishing at night to sell in the markets early next morning. This type of fishing was increasing everyday and disturbed the muggers in the Reserve.

Crocodile conservation and related issues The respondents from the local community as well as the reserve staff indicated that crocodile conservation in the Reserve was needed to save the crocodile from extinction. Lake of awareness in the community was the main obstacle for crocodile conservation in the Reserve (Fig. 1). Other factors included the lack of release of gharials in the river, regular monitoring and skilled staff.

Ways of crocodile conservation The people of the community suggested that joint efforts for crocodile conservation would be effective, such as sharing conservation and management responsibility and incentives to the local community (Fig. 2). The financial constraints for crocodile conservation could be resolved to some extent by establishing the breeding centers in the Reserve as tourist centers. These could play a role in awareness 2008

Figure 2. Conservation of crocodile according community perceptions

Â

creation and provide extra sources of income.

People participation in crocodile conservation can be obtained by providing some alternative income with awareness creation among local ethnic groups.

By identifying the hotspots of crocodiles in the river, protection of these areas could be handed over to the local communities. They could be responsible for protection, monitoring and egg collection. The Reserve should encourage the local people for participation in the protection of crocodiles.

Discussion and conclusion The only crocodilian confirmed to inhabit the Koshi Tappu Wildlife Reserve was C. palustris. There was a seasonal variation. This might be due to several reasons. First, the season for the crocodile survey was post winter and pre summer months i.e. DecemberFebruary. During this period, the temperature condition was such that the crocodiles basked for longer periods and visibility was good for sighting. This was also the courtship season and breeding groups appeared in the bank in groups (Choudhury & Roy 1982). Second, in spring both the eastern and the western branches of the river and the marshes had low levels of water.

Therefore, the animals shifted from the branches of the river (Sixth Tower and Madhuban) and the marsh (Tetriganchi Tal) to the main river. Some species aestivate by remaining quiescent for days buried in mud, leaf litter or in underground burrows excavated as water levels fell (Whitaker & Whitaker 1984). In the dry season, muggers used their burrows to avoid

Journal of Threatened Taxa | www.threatenedtaxa.org | August 2011 | 3(8): 2001â&#x20AC;&#x201C;2010

Â

Crocodiles in Koshi Tappu

heat during the daytime but at night they came out and wandered over the area in search of food (Mobaraki 1999). Third, crocodiles are cryptic, secretive, and historically hunted populations likely to be wary of humans (Messel, Vorlicek, Wells and Green, 1981 in William et al. 1997). Spring was followed by Kharkhadai (Grass Cutting) season (February) where people were permitted to enter the Reserve for two weeks. Most of the areas for cutting grasses were across the river. During this period mugger habitats were more disturbed and the number of individuals moved out of the study area.

In this study, the numbers of adults seen were easily comparable to the sub-adults because the movement and other activities of the subadult muggers was limited as most of the time they were hiding behind the grasses or the behind the fallen trees.

The highest population of muggers (nine) was found in Madhuban in the winter. In this region, the river course was deep and fast moving with wide width. The riverine vegetation with Dalbergia sissoo– Acacia catechu forest dominated on the western edge of the river. This forest was mainly associated with Saccharum–Phragmitis grassland with other grassland species like Setaria pallidifusca, Cyperus sp., Eclipta prostrata, Alternanthera sessilis, Desmodium sp., which provided a secure shelter to muggers during its seeking, hiding and sometimes resting on submerged tree trunks.

The second highest population (five) was found in the marsh area (locally known as Tetriganchi Tal) situated along the eastern embankment of the Reserve between Kushaha and Shripur. This area was wide with shallow water at the margin and deep water in the middle with elevated patches of land which helped the mugger in its daily activities. This area had adequate fish, mollusks and arthropods which were used as food. In this area, vegetation like Imperata cylindrica and Saccharum spontaneum along with emergent species Fimbristyllis squarrosa, Saccharum spontaneum, Persicaria lapathifolia floating species Nymphoides hydrophyllum and submerged species Hydrilla ceratophyllum were found profusely. This area was also dominated by a large number of wetlands birds. Among them Anser anser, Anser indicus, Dendro cygnajavanica, Tadorna ferruginea, Tadorna tadorna, Anas strepera, Anas falcata, Anas penelope, Anas platyrhynchos dominated. In the spring muggers

R.K. Goit & K. Basnet

migrated to the main river due to the low level of water in the marshes (Image 4D).

The third highest number were found in the Sixth Tower and the Madhuban. Both these are branches of the main river. In these areas, vegetation was composed of tall elephant grasses Imperata cylindria and Saccharum spontaneum along with scattered Dalbergia sissoo.

In winter most sightings were in the sand bank as compared to the other habitats. Most of the animals were found during basking and gaping. According to Whitaker & Basu (1983), gaping has possible significance in the thermoregulation. It is perhaps a device to rid the oral cavity of infection, algae, bacteria, fungus and other pathogens and parasites. Gaping probably has other functions as well (for example a social signal), because it also occurs in the rain and at night (Loveridge 1984; Lang 1987).

Though two batches of captive gharials (42/43) were released in the Koshi River in 1983 and 1986 respectively, no animal was sighted in the study.

Generally released juvenile gharials are highly mobile and very sensitive to external disturbances. Since the Koshi River originates from the high Himalaya and has very high water velocity, it may escalate the downstream mobility of juvenile and young gharials after release in the wild. Downstream movement of crocodiles during the monsoon period has also been reported from the Koshi River to the Ganges River in India (Biswas 1970). The presence of dams allows downstream movement but obstructs upstream movement of the gharials. If collaboration with the Indian Government for mutual aquatic faunal conservation is effective then it might be possible to bring back the animal to the Reserve. Reintroduction of gharial in the river is needed because releasing young gharials has become the only way to improve its distribution.

The constraints for crocodile conservation can be solved to some extent by joint efforts such as sharing conservation and management responsibility and economic incentives to the local community. People’s participation in conservation of crocodiles can be obtained by providing some alternative income along with awareness creation among the local people. By identifying the hotspots of crocodiles in the river, protection of these areas could be handed over to the local communities. They should be responsible for

Journal of Threatened Taxa | www.threatenedtaxa.org | August 2011 | 3(8): 2001–2010

2009

Crocodiles in Koshi Tappu

R.K. Goit & K. Basnet

protection, monitoring and egg collection. The reserve should encourage the local people to participate in the protection of crocodiles.

The crocodiles can be an attraction of visitors and create employment opportunities for the local community. The revenue collected through tourism may contribute to effective conservation. Eco-tourism may be a good solution for involving people with their traditional knowledge about crocodile conservation and will be helpful to uplift the local socio-economic conditions.

Conclusion This study explored the population and distribution of crocodiles, identified the threats associated and mapped out its potential habitat in the KTWR. The only crocodilian confirmed to inhabit the reserve was C. palustris. We recorded 21 muggers in winter but only five in spring. The muggers were observed in the main river and its branches between the Prakashpur and Kushaha and Tetriganchi Tal (the marsh area) in Shripur of the reserve. Muggers were observed during the basking, gaping, seeking and submerged positions on the banks of the river and the marshes as well as running from the bank towards the river.

They preferred mainly sand bank over grass bank, sand grass bank and river channels as their habitat in winter. They were found only on sand grass bank and sand bank in spring.

The Koshi River has been subjected to severe natural and anthropogenic stresses causing pronounced habitat degradation in the reserve. Siltation of river beds during the monsoons, high water velocity of swift current during floods, and change of mesotrophic marshes to eutrophic marshes are the natural factors for the low survival and sighting of crocodiles in the Koshi River. Fishing, firewood collection and grazing significantly disturbed the habitat in the Reserve.

Downward movement of crocodiles during the monsoon period has been reported from Koshi River to Bihar (India) because one Gharial was seen in the marshes in Bhimnagar (Bihar) where there was no previous record.

2010

References Andrews, H.V. (1993). Status and Distribution of the Mugger Crocodile in Tamil Nadu. <http://wiienvis.nic.in/crocodile/ tnadu.htm>. Downloaded on 20 June 2011.

Andrews, H.V. & P. McEachern (1994). Crocodile Conservation in Nepal. IUCN Nepal and USAID NGO Environmental Management Programme, 1–29pp.

Basnet, K. (1998). Biodiversity Inventory of Shey Phoksundo National Park. Wildlife Component. WWF Nepal, Kathmandu, 49pp.

Biswas, S. (1970). A preliminary survey of the gharial in the Kosi River. Indian Forester 96(9): 705–710.

Choudhury, B.C. & R.K. Roy (1982). Status Survey of Crocodile Populations. A field Guide. Central Crocodile Breeding and Management Training Institute. Hyderabad, Andra Pradesh, India, 44–48pp.

DNPWC. (2008). Department of National Parks and Wildlife Conservation. Annual Report. Kathmandu, Nepal.

Lal, S. (1981). Release of gharial in natural habitat. Cheetal 23: 29–32.

Lang, W. (1987). Crocodilian Behaviour: Implications for Management, pp. 278–286. In: Webb, J.W.G., S.C. Manolis & J.W. Peter (eds.). Wildlife Management: Crocodiles and Alligators. Surrey Beatty and Sons Pty Limited, Australia.

Le Foll, P. (1982). Report of Zootechnical and Pathological Problems of Gharial in Gharial Project (Royal Chitwan National Park, Nepal). Eclole Natinale Venterinaire, France, 7pp.

Mishra, N. (2002). Status and distribution of Gharial (Gavialis gangeticus) in Nepal. MSc Thesis. Department of Natural Resources and Sustainable Agriculture. Agriculture University of Norway.

Mobaraki, A. (1999). Crocodile: Their Ecology Management and Conservation. Tehran, Iran. IUCN Newsletter Crocodile Specialist Group 18: 17.

Shrestha, T.K. (2001). Herpetology of Nepal: A Field Guide to Amphibians and Reptiles of Trans-Himalayan Region of Asia. Bimla Shrestha. Kathmandu, Nepal, 200pp.

Whitaker, R. & D. Basu (1983). The Gharial (Gavialis gangeticus): A review. Journal of the Bombay Natural History Society 79: 531–548.

Whitaker, R. & Z. Whitaker (1984). Reproductive biology of the Mugger (Crocodilus palustris). Journal of the Bombay Natural History Society 81: 317.

William S., L. Nachar, A. Mauric, S. Settle & D. Marsh (1997). A search for Estuarine Crocodile at Tarutao National Park, Thailand. Tiger Paper 24(3): 23.

Journal of Threatened Taxa | www.threatenedtaxa.org | August 2011 | 3(8): 2001–2010

JoTT Communication

3(8): 2011–2017

The diet of Indian Eagle Owl Bubo bengalensis and its agronomic significance Satish Pande 1 & Neelesh Dahanukar 2 Ela Foundation, C-9, Bhosale Park, Sahakarnagar-2, Pune, Maharashtra 411009, India Indian Institute of Science Education and Research, Sai Trinity, Sutarwadi Road, Pashan, Pune, Maharashtra 411021, India Email: 1 pande.satish@gmail.com, 2 n.dahanukar@iiserpune.ac.in (corresponding author)

1 2

Date of publication (online): 26 August 2011 Date of publication (print): 26 August 2011 ISSN 0974-7907 (online) | 0974-7893 (print) Editor: Reuven Yosef Manuscript details: Ms # o2536 Received 04 August 2010 Final received 16 March 2011 Finally accepted 29 July 2011 Citation: Pande, S. & N. Dahanukar (2011).

The diet of Indian Eagle Owl Bubo bengalensis and its agronomic significance. Journal of Threatened Taxa 3(8): 2011–2017.

Copyright: © Satish Pande & Neelesh Dahanukar 2011. Creative Commons Attribution 3.0 Unported License. JoTT allows unrestricted use of this article in any medium for non-profit purposes, reproduction and distribution by providing adequate credit to the authors and the source of publication.

Abstract: If the importance of wildlife in agricultural pest control through predation can be conveyed, it can play an important role in the conservation of wildlife. However, such a strategy needs to be backed with convincing data. We studied the habitat preference, diet and reproductive behavior of the Indian Eagle Owl (IEO) Bubo bengalensis in order to understand its role in agricultural pest control. The Owls preferred landscapes with a higher percentage of agriculture and fed on rodents, birds, reptiles, arachnids, insects and other prey species. Despite being a generalist feeder, its diet was dominated by agricultural pests, which contributed 88% of the total prey biomass. Out of the13 rodent prey species, which comprised a major part of the diet, seven were identified as major agricultural pests and were 98% of the total rodent biomass in the diet of the IEO. The dependence of the IEO on rodent pests was further reflected by positive correlation between rodent biomass consumed and the breeding success of the owl. The IEO, therefore, plays a positive role in the biological control of crop pests. However, owls spent a longer duration of time in agricultural habitats, where they also had higher productivity. Thus IEO may be subjected to anthropogenic activities, human contact and interference. Since this owl is still hunted due to superstitious beliefs, scientific evidence elucidating the importance of the IEO in agricultural pest control can be used for its conservation by educating the farming community.

Keywords: Agronomic significance, Bubo bengalensis, crop pests, Indian Eagle Owl, rodent control.

Author Detail: see end of this article.

Author Contribution: SP laid the foundations of the work and collected field data. ND performed statistical analysis. Both SP and ND wrote the paper.

Acknowledgements: The study was supported by Ela Foundation. We are thankful to Amit Pawashe, Dr. M.N. Mahajan, Kumar Pawar, Prashant Deshpande and Shivkumar Pednekar for their assistance in the field work.

We are also grateful to Dr. M.S. Pradhan, Dr. D.B. Bastawade, Dr. S.S. Talmale, Dr. R. Sharma and Dr. Anil Mahabal from Zoological Survey of India, W.R.S. Akurdi, Maharashtra, for their help in identifying the prey species from pellet analysis and prey remains. SP thanks Dr. Hemant Ghate, Head, Department of Zoology, Modern College, Pune and the Head, Department of Environmental Sciences, University of Pune. We thank three anonymous referees for constructive comments on the earlier drafts of the manuscript.

ELA FOUNDATION PUNE

OPEN ACCESS | FREE DOWNLOAD

INTRODUCTION Agriculture is a major source of livelihood in India. Indian agriculture is rapidly shifting from natural subsistence type farming to a managed intensive agricultural practice. Despite the developments in the infrastructure for production and storage of agricultural produce, it is estimated that rodents damage between 2–15 % of the crops annually throughout the country; while severe damage can escalate to 100% (Parshad 1999). As a result, agricultural pest control is a major concern. Chemical control using pesticides and biological control through predators and pathogens have been suggested for pest control (Howard 1976; Parshad 1999). However, chemical pesticides and control of pests using pathogens often affect the environment and human health adversely (Hearn 1973; Wodzicki 1973; Kaukeinen 1982; Littrell 1990; Gillies & Pierce 1999). Hence, utilization of natural predators is an environment friendly solution to pest control (Wodzicki 1973; Singleton 1994; Johnson et al. 1996).

A number of natural predators of the agricultural pests have been identified for their use in pest control. While some of them, such as cats, can be domesticated (Wodzicki 1973), even wildlife can be considered as natural enemies of crop pests (Johnson et al. 1996). If the importance of wildlife in pest control can be backed up with convincing data it will

Journal of Threatened Taxa | www.threatenedtaxa.org | August 2011 | 3(8): 2011–2017

2011

The diet of Bubo bengalensis

S. Pande & N. Dahanukar

serve two purposes. First, predation by wildlife can be promoted as an environment friendly pest control method and second, if the importance of wildlife in pest control is conveyed to the farmers, it can be used as a step towards conflict resolution and conservation of wildlife. This is especially true for predators like owls, which are often killed as they are considered as bad omens and also for their demand for use in black magic (Kasambe et al. 2004; Devkar 2009).

Owls are important for controlling agricultural pests as their diet is dominated with rodents (Neelanarayanan et al. 1999, 2007; Pande et al. 2004, 2007). Even though the potential of owls in agricultural pest management has been suggested earlier (Wodzicki 1973) and the possible importance of natural predators in integrated pest management programs is also recognized (Jain et al. 1993) a strong argument supported by relevant data is still missing.

In this study we elucidate the importance of the Indian Eagle Owl (IEO) Bubo bengalensis as a potential predator of agricultural pests by studying its reproductive output in relation to diet and habitat selection. We propose that such scientific findings based on first hand field data could be used to promote conservation awareness and the eradication of superstition about these biological controllers of agricultural pests.

METHODS Study Area The study was conducted around Pune (18032’N & 0 72 51’E) on the Deccan Plateau, and around Alibag (18028’52”N & 73014’52”E) and Chiplun (1700’2”N & 73018’57”E) in the coastal region of Maharashtra State, India. The average annual precipitation in the study area, which is derived from the southwest monsoon, ranges from 250–1250 mm in the Deccan Plateau and 1500–3500 mm in the coastal region.

The temperature ranges between 60C and 400C during winter and summer respectively. Agricultural cropland consists of seasonal Triticum aestivum, Zea mays, Sorghum vulgarae, Panium miliaceum, Oryza sativa, and open type of cultivation of lentils, pods, leafy vegetables, fruit orchards of figs (Ficus sp.), pomegranate (Punica granatum), custard apple (Annona reticulata) and guava (Psidium sp.) (an open 2012

type of cropland with better visibility). The perennial grassland community in the study area is SehimaDichanthium type arrested in sub-climactic seral stage of succession due to grazing, grass cutting and burning (Roychoudhary 1966; Murthy & Sanjappa 2001). The grasses are Aristida setacea, Aristida adscenscionis and Heteropogon contortus with a presence of bush Xanthium strumerium that has spiny seeds.

Data collection During the breeding season (October–March) of 2004–05 and 2005–06, we identified 44 occupied nest sites. The Eurasian Eagle Owls are known to nest near their preferred hunting areas (Frey 1973; Olsson 1979; Leditznig 1992) and their breeding success depends on the distance between the nest and foraging area.

Hence, we selected an area of 1000m radius centered around the nest in order to analyze the landscape features in all of the nest territories. Following Donázar (1987), Penteriani et al. (2001) and Pande et al. (2007) we categorized each circular plot into six habitat categories: (a) agriculture, (b) scrub, (c) grassland, (d) water body (perennial or seasonal), (e) hills, and (f) rural habitat around human habitation, using ‘look down’ visual surveys conducted from high vantage points and estimated the percentage occurrences of each category (Bibby et al. 1998).

At least five visits were made to each of the nest sites each year during the breeding seasons. Owl pellets and prey remains were collected from all nest sites and were separately analyzed for each nest for every breeding season. Pellets were dried in an oven, dissected and all identifiable prey remains were scrutinized (Penteriani et al. 2002). To avoid duplication, items found in pellets were used only when not found as prey remains in the same visit (Penteriani 1997). We did not encounter separate prey remains that were not found in pellets. Prey in pellets were identified to orders, families, genera or species by using published literature (Tikader & Bastawade 1983; Tikader & Sharma 1992; Daniels 2002; Ramanujam 2004) or by comparing with specimens in the collections of the Zoological Survey of India, Pune. Pellet contents were grouped into six categories, namely insects, reptiles, birds, rodents, bats and other prey species. The number of individuals in each diet category was considered as the abundance for that category. The fresh masses of prey species were

Journal of Threatened Taxa | www.threatenedtaxa.org | August 2011 | 3(8): 2011–2017

The diet of Bubo bengalensis

estimated by weighing specimens in the field using Pesola scales (least count 0.1g) or by using published data (Spillet 1966; Khajuria 1968; Ranade 1989, 1992; Kanakasabai et al. 1998; Pande et al. 2004, 2007).

This was used for calculating the biomass of each prey type in the diet of the owl. Percent biomass for each diet category was calculated by estimating the relative percent contribution of each category to the overall diet.

Breeding time and nest site occupation were monitored to record the dates of egg-laying, to monitor the number of hatchlings and count the number of fledglings (Frank & Lutz 1997; Penteriani et al. 2002).

We considered the date of laying of the first egg as the date for the onset of the breeding season. The incubation period or duration of breeding was calculated as first egg laid till last egg hatched based on the observation that the hatching is asynchronous in IEO (Ramanujam & Murugavel 2009). We determined breeding success or productivity as the number of fledglings per nest.

Statistical analysis We performed the Kruskal-Wallis test and multiple pairwise comparisons using the Mann-Witney U test with Bonferroni correction (Bonferroni corrected significance level used was a = 0.0033) to see if the preference for different habitats was different.

Associations between prey items, habitat preference and breeding success were analyzed using Redundancy Analysis (RDA) assuming that these are interdependent variables. RDA was performed in the freeware Biplot 1.1 (Smith & Lipkovich 2002). To see if the dependent variables were linearly dependent on the independent variables we performed permutation tests with a null hypothesis that dependent and independent variables are not linearly related to each other (Legendre & Legendre 1998).

RESULTS AND DISCUSSION IEO builts terrestrial nests on hill slopes, earth cuttings, rocky outcrops and under bushes, where the surrounding areas, which are its hunting grounds, consisted of agriculture, scrub, grassland, water body, hills and rural habitats. IEO preferred to nest in landscapes with a high percentage of agriculture followed by grassland and scrubs (Fig. 1). Preference

S. Pande & N. Dahanukar

Figure 1. Percentage habitat type of breeding sites of Indian Eagle Owl. Agriculture is a dominant habitat followed by grassland and scrub habitats. Solid line inside the box denotes median and dashed line the mean.

Table 1. Abundance and total biomass of different prey in the diet of the Indian Eagle Owl in the study area.

Prey item

Abundance (%)

Total biomass in g (%)

Rodents

1503 (54.69)

277830 (85.05)

Bats

124 (4.51)

9418 (2.88)

Birds

367 (13.36)

37558 (11.49)

Reptiles

20 (0.73)

42 (0.01)

Insects

712 (25.91)

712 (0.22)

Other unidentified prey

22 (0.80)

1117 (0.34)

for different habitats was significantly different (Kruskal-Wallis K = 141.199, p < 0.0001), with a preference for agriculture dominated habitats than the second most dominant grassland habitat (MannWitney U = 5075.000, p < 0.0001).

The IEO showed high versatility in the choice of food depicting its feeding habit as a dietary generalist (Table 1). It fed on rodents, birds, reptiles, arachnids, insects and other prey species. Rodent prey included Lesser Bandicoot Rat (Bandicota bengalensis), Large Bandicoot Rat (B. indica), Indian Bush Rat (Golunda ellioti), Soft-furred Field Rat (Millardia meltada), House Mouse (Mus musculus), Field Mouse (M. booduga), Elliot’s Spiny Mouse (M. saxicola), House Rat (Rattus rattus), Indian Gerbil (Tatera indica), Longtailed Tree Mouse (Vandelura olivacea), Common House Shrew (Suncus murinus), Pigmy Shrew (S.

Journal of Threatened Taxa | www.threatenedtaxa.org | August 2011 | 3(8): 2011–2017

2013

The diet of Bubo bengalensis

S. Pande & N. Dahanukar

etruscus) and Andersonâ&#x20AC;&#x2122;s Shrew (S. stolizcanus).

Bat prey included Indian Fulvus Fruit Bat (Rousettus lesheanaulti) and Lesser Dog-faced Bat (Cynopterus sphinx). Bird prey included Ashy-crowned SparrowLark (Eremopterix grisea), Rufous-tailed SparrowLark (Ammomanes phoenicura), Blue Rock Pigeon (Columba livia), Common Myna (Acridotheres tristis), Jungle Myna (A. fuscus), Egret species (Egretta sp.), Asian Koel (Eudynamys scolopacea), Large Grey Babbler (Turdoides malcolmi), Painted Francolin (Francolinus pictus), Quail species (Coturnix sp.), Eurasian Collared Dove (Streptopelia decaocto), Common Kingfisher (Alcedo atthis), Little Green Bee-eater (Merops orientalis), House Sparrow (Passer domesticus), Sunbird species and House Crow (Corvus splendens). Reptiles included lizards (Calotes sp.), geckos, skinks and snake (Coelognathus helena).

Arachnids included Mesobuthus tamulus, Heterometrus xanthopus, Heterometrus granulomanus, Galeodus orientalis and Galeodus indica. Insect prey included Rhinoceros Beetle (Oryctes rhinoceros), Long-horned Beetle (Batocera rufomaculata), Stag Beetle (Lucanus cervus) and Grasshoppers and Mantids. Other unidentified prey items included juveniles of Fellidae and Leporidae (Lepus nigricolis) and amphibians.

Even though our analysis of the diet suggests that the Indian Eagle Owl is a dietary generalist, which concurs with published literature (Ali & Ripley 1969; Ramanujam 2006), the abundance and total biomass of different groups of prey in the diet showed that rodents were the most important prey followed by birds and bats (Table 1). Abundance of insect prey was also very high but the biomass of insect diet was minute. Of all prey items, 73% of relative abundance and 81% of prey biomass was of pests of agricultural significance (Table 2). Thus, the IEO is an important predator of agricultural crop pests, particularly rodents. Owls also feed on a variety of other agricultural pests like insects and bats and venomous organisms like snakes and scorpions (Table 2).

Of 13 species of rodent prey, which formed the major part of the diet of the IEO (55% relative abundance and 85% total biomass), seven were agriculturally important pests (Jain et al. 1993; Parshad 1999).

Agriculturally important rodent pests contributed 88% of the abundance and 98% of the biomass of the total rodent in the owl diet. To understand whether the rodents actually came from the agriculture dominated 2014

Table 2. Abundance and total biomass of agriculturally important pests and other prey venomous for man in the diet of the Indian Eagle Owl. Abundance (%)*

Total biomass (%)*

Lesser Bandicoot Rat Bandicota bengalensis

397 (14.5)

108,381 (33.100)

Large Bandicoot Rat Bandicota indica

207 (7.5)

72,450 (22.100)

Indian Bush Rat Golunda ellioti

153 (5.6)

11,475 (3.500)

Soft-furred Field Rat Millardia meltada

154 (5.6)

15,400 (0.050)

House Mouse Mus musculus

8 (0.3)

120 (0.040)

House Rat Rattus rattus

208 (7.5)

33,280 (10.200)

Indian Gerbil Tatera indica

196 (7.1)

31,752 (9.700)

Indian Fulvus Fruit Bat Rousettus lesheanaulti

88 (3.2)

6,336 (1.900)

328 (11.9)

328 (0.100)

Prey item Agriculturally important pest

Rhinoceros Beetle Oryctes rhinoceros Long-horned Beetle Batocera rufomaculata

21 (0.8)

21 (0.008)

Grasshoppers and Mantids

249 (9.1)

249 (0.080)

Snake: Coelognathus helena

2 (0.1)

550 (0.170)

Scorpion: Mesobuthus tamulus

10 (0.4)

20 (0.007)

Scorpion: Heterometrus xanthopus

3 (0.1)

9 (0.003)

Scorpion: Heterometrus granulomanus

2 (0.1)

6 (0.002)

Venomous prey

* Percentage is calculated considering all the prey items encountered during the study.

habitats we performed Redundancy Analysis (RDA) with relative abundance of different prey items as dependent variables and percent habitat types as the independent variables (Fig. 2). There was a significant relationship between dependent and independent variables (permutation test pseudo-F = 0.380, p < 0.0001). The relative abundance of rodents in the diet was significantly correlated with increase in the agricultural habitat (correlation coefficient r = 0.3996, p = 0.0001). Although bats and birds were also positively correlated with the agricultural habitat, they were more strongly correlated with the increase in rural and scrub habitats respectively (Fig. 2).

We also performed RDA to understand how habitats and relative abundance and percent biomass of different prey types affected the productivity and duration of

Journal of Threatened Taxa | www.threatenedtaxa.org | August 2011 | 3(8): 2011â&#x20AC;&#x201C;2017

The diet of Bubo bengalensis

Figure 2. Redundancy analysis (RDA) depicting the canonical correlations between relative abundance of prey and habitat types. Percentage in parenthesis is the percentage variation explained by each canonical axis.

Key: RR, relative abundance of rodents; RA, birds; RB, bats; RI, insects; and RO, other prey items.

S. Pande & N. Dahanukar

Â

breeding in the IEO (Fig. 3). Our analysis suggests that both productivity and duration of the breeding of IEO was high in agriculture and scrub dominated habitats (Fig. 3a, permutation test pseudo-F = 0.166, p = 0.006). Productivity was strongly correlated to the high relative abundance (Fig. 3b, permutation test pseudo-F = 0.309, p < 0.0001) and percentage biomass (Fig. 3c, permutation test pseudo-F = 0.302, p < 0.0001) of rodents and birds followed by bats.

Our findings of RDA point to two important outcomes. First, owls have a high productivity in the agriculture habitat (Fig. 3a), which could be attributed to the increased access to rodents (Fig. 2) which alleviates their productivity (Fig. 3b and 3c). As a result, owls are not just the predators of rodents, important agricultural pests, but are in turn dependent on them to increases their productivity. Therefore, there appears to be a delicate interdependence between owls and rodent populations. However, this interdependence points to another alarming threat to the owls. Chemical pesticides are used for rodent pest control which can affect the non-targeted wildlife (Kaukeinen 1982; Littrell 1990; Gillies & Pierce 1999; Newton & Wyllie 2002). Because the IEO has shown a dependence on the rodents, use of these rodent pesticides could affect IEO populations because of secondary poisoning.

Second, since the productivity of owls is higher in the agricultural lands, the duration of breeding in the agricultural land is greater (Fig. 3a). As a result, owls may be prone to detection and anthropogenic activities

Figure 3. Redundancy analysis (RDA) depicting the canonical correlations between productivity and duration of breeding of the owls and (a) habitat, (b) relative abundance of prey and (c) percent biomass of different prey items. Percentage in parenthesis is the percentage variation explained by each canonical axis. Key: R_PER_ BM, percentage biomass of rodents; A_PER_BM, birds; B_PER_BM, bats; I_PER_BM, insects; O_PER_BM, other prey items. Other abbreviations are as per Figure 3.

including persecution and interference.

Unfortunately, the IEO is often subject to indiscriminate hunting, out of superstition or fear (Pande et al. 2005) or trapping for use in black magic (Kasambe et al. 2004; Devkar 2009). If we can promote the importance of owls in the control of agricultural

Journal of Threatened Taxa | www.threatenedtaxa.org | August 2011 | 3(8): 2011â&#x20AC;&#x201C;2017

2015

Â

The diet of Bubo bengalensis

S. Pande & N. Dahanukar

pests, especially rodents, then such a strategy will help reduce human persecution of the owls. We believe that interactive educational programs based on scientific data, like this study, can be used to remove superstitions and further owl conservation.

REFERENCES Ali, S. & S.D. Ripley (1969). Handbook of the Birds of India and Pakistan together with those of Bangladesh, Nepal, Bhutan and Sri Lanka—Vol. 3. New Oxford University Press, Delhi, 327pp.

Bibby, C., M. Jones & S. Marsden (1998). Expedition Field Techniques: Bird Surveys. Expedition Advisory Center, London, 137pp.

Daniels, J.C. (2002). The Book of Indian Reptiles and Amphibians. Bombay Natural History Society and Oxford University Press, Mumbai, 238pp.

Devkar, R.V. (2009). Episodes of unnatural injury and death of Barn Owls (Tyto alba); a warning call. Current Science 96: 209–210.

Donázar, J.A. (1987). Geographic variations in the diet of the eagle owls in western Mediterranean Europe, pp. 220–224.

In: Biology and Conservation of Northern Forest Owl. General Technical Report RM-142.

Frank, R.A. & R.S. Lutz (1997). Great Horned Owl (Bubo virginianus) productivity and home range characteristics in a shortgrass praire, pp. 185–189. In: Duncan, J.R., D.H. Johnson & T.H. Nicholls (eds.). Biology and Conservation of Owls of the Northern Hemisphere.

Frey, H. (1973). Zur Okologie niederosterreichischer Uhupopulationen. Egretta 16: 1–68.

Gillies, C.A. & R.J. Pierce (1999). Secondary poisoning of mammalian predators during possum and rodent control operations at trounson Kauri Park, Northland, New Zealand.

New Zealand Journal of Ecology 23(2): 183–192.

Hearn, C.E.D. (1973). A review of agricultural pesticide incidents in man in England and Wales, 1952-71. British Journal of Industrial Medicine 30: 253–258.

Howard, W.E. (1976). A philosophy of vertebrate pest control, pp. 116–120. In: Proceedings of the 7th Vertebrate Pest Conference.

Jain, A.P., R.S. Tripathi & B.D. Rana (1993). Rodent Management: The State of Art. Technical Bulletin No. 1.

Indian Council of Agricultural Research, New Delhi, 38pp.

Johnson, R.J., J.R. Brandle, N. Sunderman, R. Fitzmaurice, N.A. Beecher, R.M. Case, M. Dix, L. Young, M.O. Harrell, R.J. Wright & L. Hodges (1996). Wildlife as natural enemies of crop pests, pp. 112–116. In: 8th Triennial National Extension Wildlife and Fisheries Specialists Conferences.

Kanakasabai, R., P. Neelanarayanan & R. Nagarajan (1998).

Quantifying Barn Owl Tyto alba stertens prey frequency 2016

and biomass, pp. 153–157. In: Dhindsa, M.S., P.S. Rao & B.M. Parasharya (eds.). Birds in Agricultural Ecosystem.

AICRP on Economic Ornithology, Rajendranagar, New Delhi, 196pp.

Kasambe, R., S. Pande, A. Pawashe & J. Vadatkar (2004).

Additional records of Forest Spotted Owlet Athene blewitti in Melghat. Newsletter for Ornithologists 1: 12–14.

Kaukeinen, D. (1982). A review of the secondary poisoning hazard potential to wildlife from the use of anticoagulant rodenticides, pp. 151–158. In: Marsh, R.E. (ed.).

Proceedings of the Tenth Vertebrate Pest Conference.

University of California, Davis, 245pp.

Khajuria, H. (1968). The young of the Indian Long-tailed Tree Mouse Vandeleuria o. oleracea (Bennet) (Rodentia: Muridae). Cheetal 2: 52.

Leditznig, C. (1992). Telemetric study in the Eagle Owl (Bubo bubo) in the foreland of the Alps in Lower Austria - methods and first results. Egretta 35: 69–72.

Legendre, P. & L. Legendre (1998). Numerical Ecology.

Second Edition. Elsevier Sciences, Amsterdam, 853pp.

Littrell, E.E. (1990). Effects of field vertebrate pest control on nontarget wildlife (with emphasis on bird and rodent control), pp. 59–61. In: Davis, L.R., R.E. Marsh & D.E. Beadle (eds.). Proceedings of the Fourteenth Vertebrate Pest Conference. University of California, Davis, 372pp.

Murthy, G.V.S. & M. Sanjappa (2001). Grasslands, pp. 149– 163. In: Alfred, J.R.B., A.K. Das & A.K. Sanyal (eds.).

Ecosystems of India, Envis - Zoological Survey of India, 410pp.

Neelanarayanan, P. (2007). Diet of Barn Owl Tyto alba stertens Hartert, 1929 in a portion of Cauvery Delta, Tamil Nadu, India. Zoos’ Print Journal 22(8): 2777–2781.

Neelanarayanan, P., R. Nagarajan & R. Kanakasabi (1999).

The common Barn Owl Tyto alba stertens Hartert, 1929: an effective bio-control agent of rodent pests, pp. 153–163. In: Kaul, B.L. & Y.R. Malhotra (eds.). Advances in Fish and Wildlife Ecology and Biology—Volume 2. Daya Publishing House, Delhi, 281pp.

Newton, I. & I. Wyllie (2002). Rodenticides in British Barn Owls (Tyto alba), pp. 280–289. In: Newton, I., R. Kavanagh, J. Olsen & I. Taylor (eds.). Ecology and Conservation of Owls. Csiro Publishing, Australia, 598pp.

Olsson, V. (1979). Studies on a population of eagle owls Bubo bubo (L.), in south Sweden. Viltrevy 11: 1–99.

Pande, S., A. Pawashe, D.B. Bastawade & P.P. Kulkarni (2004). Scorpions and molluscs: some new dietary records for Spotted Owlet Athene brama in India. Newsletter for Ornithologists 1: 68–70.

Pande, S., A. Pawashe, U. Karambelkar & S. Shrotri (2005).

Salvage, relocation and in-nest behaviour of Barn Owl Tyto alba stertens Hartert, chicks. Indian Birds 1: 5–6.

Pande, S., A. Pawashe, M.N. Mahajan, C. Joglekar & A. Mahabal (2007). Effect of food and habitat on breeding success in Spotted Owlets (Athene brama) nesting in villages and rural landscapes in India. Journal of Raptor Research 41: 26–34.

Journal of Threatened Taxa | www.threatenedtaxa.org | August 2011 | 3(8): 2011–2017

The diet of Bubo bengalensis

Parshad, V.R. (1999). Rodent control in India. International Pest Management Reviews 4: 97–126.

Penteriani, V. (1997). Long-term study of goshawk breeding population on a Mediterranean mountain (Abruzzi Apennines, Central Italy): density, breeding performances and diet. Journal of Raptor Research 31: 308–312.

Penteriani, V., M. Gallardo & P. Roche (2002). Landscape structure and food supply affect Eagle Owl (Bubo bubo) density and breeding performance: a case of intrapopulation heterogeneity. Journal of Zoology, London 257: 365–372.

Penteriani, V., M. Gallardo, P. Roche & H. Cazassus (2001). Effects of landscape spatial structure and composition on the settlement of the Eagle Owl Bubo bubo in a Mediterranean habitat. Ardea 89: 331–340.

Ramanujam, M.E. (2004). Methods of analyzing rodent prey of the Indian Eagle Owl Bubo bengalensis (Franklin) in and around Pondicherry. Zoos’ Print Journal 19(6): 1492–1494.

Ramanujam, M.E. (2006). On the prey of the Indian Eagle Owl Bubo bengalensis (Franklin, 1831) in and around Pondicherry, southern India. Zoos’ Print Journal 21(5): 2231–2240.

Ramanujam, M.E. & T. Murugavel (2009). A preliminary report on the development of young Indian Eagle Owl Bubo bengalensis (Franklin, 1831) in and around Puducherry, southern India. Journal of Threatened Taxa 1(10): 519–524.

Ranade, R.V. (1989). The Pygmy Shrew Suncus etruscus. Journal of the Bombay Natural History Society 86: 238–239.

Roychoudhary, S.P. (1966). Land and Soil. National Book Trust, New Delhi, 171pp.

Singleton, G.R. (1994). The prospects and associated challenges for the biological control of rodents, pp. 301–307. In: Proceedings of the 16th Vertebrate Pest Conference, 353pp.

Smith, E.P. & I.A. Lipkovich (2002). Biplot 1.1: Excel Addin freeware. Statistics Department of Virginia Tech, http://www.stat.vt.edu/facstaff/epsmith.html Spillet, J.J. (1966). Growth of three species of Calcutta Rats, Bandicota bengalensis, B. indica and Rattus rattus (Linn.), pp. 177–196. In: Proceedings of Indian Rodent Symposium, Johns Hopkins University Centerfor Medical Research and Training and United States Agency for International Development, Calcutta, India, 314pp.

Tikader, B.K. & D.B. Bastawade (1983). Fauna of India: Scorpions. Scorpionida: Arachnida Vol. III. Zoological Survey of India, Calcutta, 668pp.

Tikader, B.K. & R.C. Sharma (1992). Handbook of Indian Lizards. Published by Director, Zoological Survey of India, Calcutta, 249pp.

Wodzicki, K. (1973). Prospects for biological control of rodent populations. Bulletin of World Health Organization 48: 461–467.

Journal of Threatened Taxa | www.threatenedtaxa.org | August 2011 | 3(8): 2011–2017

S. Pande & N. Dahanukar Author Detail: SatiSh Pande is a Fellow of Maharashtra Academy of Sciences. He is an Interventional Vascular Radiologist and Assoc.

Professor of Radiology at B.J. Medical College, Pune. He works in ecology and field ornithology and has made several video films on raptor ecology, marine ecosystem and conservation.

He has published more than 40 papers and has authored several field guides and popular books on ornithology, nature education, orchids and other subjects for popularization of science and to promote conservation. neeleSh dahanukar works in ecology and evolutionary biology with an emphasis on mathematical and statistical analysis.

2017

JoTT Short Communication

3(8): 2018–2022

Conservation status of Hildegardia populifolia (Roxb.)

Schott & Endl. (Malvaceae: Sterculioideae: Sterculieae), an endemic of southern peninsular India Boyina Ravi Prasad Rao 1, Madha Venkata Suresh Babu 2, Araveeti Madhusudhana Reddy 3, S. Sunitha 4, A. Narayanaswamy 5, G. Lakshminarayana 5 & M. Ahmedullah 6 Biodiversity Conservation Division, Department of Botany, Sri Krishnadevaraya University, Anantapur, Andhra Pradesh 515003, India 3 Department of Botany, Yogi Vemana University, Kadapa, Andhra Pradesh 516003, India 6 Botanic Garden of Indian Republic, Noida, District G.B. Nagar, Uttar Pradesh 201303, India Email: 1 rao_rp@rediffmail.com (corresponding author), 2 mvs.ced2010@gmail.com, 3 grassced@yahoo.com, 4 sunitha_s2011@rediffmail.com, 5 m.ahmed@nic.in 1,2,4,5

Abstract: Hildegardia populifolia (Roxb.) Schott & Endl. an endemic tree of southern peninsular India is assessed in terms of the IUCN Red List status. New data from field surveys indicated Vulnerable species categorization for H. populifolia.

Keywords: Hildegardia populifolia, Red List status, Vulnerable.

Conservation status of a species is an indicator of the likelihood of that species continuing to survive in nature. The International Union for the Conservation of Nature (IUCN) is the world’s main authority on the conservation status of species (Mrosovsky 1997) and the IUCN Red List provides an objective evidencebased system for classifying species in terms of the risk

Date of publication (online): 26 August 2011 Date of publication (print): 26 August 2011 ISSN 0974-7907 (online) | 0974-7893 (print) Editor: N.P. Balakrishnan Manuscript details: Ms # o2733 Received 20 March 2011 Final received 16 June 2011 Finally accepted 07 July 2011 Citation: Rao, B.R.P., M.V.S. Babu, A.M. Reddy, S. Sunitha, A. Narayanaswamy, G. Lakshminarayana & M. Ahmedullah (2011).

Conservation status of Hildegardia populifolia (Roxb.) Schott & Endl.

(Malvaceae: Sterculioideae: Sterculieae), an endemic of southern peninsular India. Journal of Threatened Taxa 3(8): 2018–2022.

Copyright: © Boyina Ravi Prasad Rao, Madha Venkata Suresh Babu, Araveeti Madhusudhana Reddy, S. Sunitha, A. Narayanaswamy, G. Lakshminarayana & M. Ahmedullah 2011. Creative Commons Attribution 3.0 Unported License. JoTT allows unrestricted use of this article in any medium for non-profit purposes, reproduction and distribution by providing adequate credit to the authors and the source of publication.

Acknowledgements: We thank University Grants Commission (3-49/98 SR II-1998) for financial assistance. We also acknowledge the support received from the Forest Department of Andhra Pradesh, Karnataka and Tamil Nadu during our field visits from time to time.

OPEN ACCESS | FREE DOWNLOAD

2018

of extinction. Such conservation assessments are useful tools to prioritize species for conservation action and to monitor the change in status of species over time. The IUCN system assesses the threat to a species based on five core criteria: decline in populations over a period that is relevant for the species (based on generation time); the distribution of the species together with factors that may influence ongoing survival within its current distribution; small population size and continuing decline; very small populations or small distribution area; and quantitative assessment of extinction risk (e.g. modeling) (IUCN 2001). Assessments are always done using the best available information, but often only partial information is available for many taxa. Recently, Babu & Rao (2009) and Rao et al. (2009, 2010) provided valuable field data for the current global population status of Cycas beddomei Dyer and categorized it as Endangered. In the present study, we attempt to assess the current population status of Hildegardia populifolia (Roxb.) Schott & Endl., a southern Indian endemic (Ahmedullah & Nayar 1987).

Hildegardia populifolia, a deciduous forest tree species belongs to the family Malvaceae, subfamily Sterculoideae, tribe Sterculieae. The species was earlier known to be represented by a sole surviving population comprising about 20 trees in Kalarayan Hills of Tamil Nadu (Ahmedullah 1990). It is an enigmatic species in that its conservation status has been variously assessed as Critically Endangered (Sarcar & Sarcar 2002), Endangered (Ahmedullah 1990; Walter & Gillet 1998; Rao et al. 2003). Rao et al. (1998) recognized five subpopulations of this Endangered species in Rayalaseema District of Andhra Pradesh. Jadhav et al. (2001) categorized it as Vulnerable. The World

Journal of Threatened Taxa | www.threatenedtaxa.org | August 2011 | 3(8): 2018–2022

Conservation status of Hildegardia populifolia

Conservation Monitoring Centre (1998) assessed the conservation status of this species as Critically Endangered. After conducting intensive explorations for the past 15 years, our research team located the species in Anantapur, Kadapa and Chittoor districts in southern Andhra Pradesh, Salem Hills in northern Tamil Nadu and a small patch in Karnataka bordering Anantapur District of Andhra Pradesh. The present study focuses on a critical evaluation of the H. populifolia population and revision of the current conservation status based on the latest IUCN Red List Criteria (version 3.1; IUCN 2001).

Materials and Methods Hildegardia populifolia is a deciduous tree growing up to 20m (Image 1). The plant is recognizable for its pale green bark. Leaves are ovate-cordate, 3–5-lobed and digitately 7-nerved. Flowers are purple, and erect with leathery perianth. Follicles are winged, erect, thinly woody, falcately ovate-reniform and inflated, with 1 or 2 seeds, affixed from base of the follicle and conspicuously wrinkled when dry. The species is locally known as Galibuduga, Pichipoliki, Buddapoliki in Telugu and Malaipuvarasu in Tamil.

The study area cover all the known localities of the species distribution, i.e., southern Anantapur, western Kadapa, and northern Chittoor districts of Andhra Pradesh; Devikunta area in Karnataka and Salem Hills in Tamil Nadu (Fig. 1). The study area was stratified into grids of 6.25×6.25 km using IRS-1C satellite data.

The whole study area falls in the hill ranges of southern Eastern Ghats (11052’–14016’N & 77045’–78059’E) with an altitudinal variation of 420–982 m. Preliminary explorations revealed the presence of H. populifolia in 29 grids in the study area comprising 354 grids. Transects of 1000×5 m were laid down in all the 29 grids. This amounts to approximately 0.019% of the total area, an adequate sampling intensity according to Shivaraj et al.

(2000). In all the 29 grids, the plants of ≥30cm gbh were counted and considered for the analysis. Wherever the species was found in the grids, geographic coordinates were recorded and the shortest continuous boundary for the species population was been drawn on the grid map.

The assessment is carried out as per the IUCN Red List Categories and Criteria (IUCN 2001). The Extent of Occurrence (EOO) is estimated as a minimum convex polygon containing all the localities of species

B.R.P. Rao et al.

occurrence. Area of Occupancy (AOO) of the species within the grids is studied taking into account the terrain features with respect to altitude. The population size of the species is estimated by extrapolating the recorded individuals in the individual transect.

Results and Discussion The overall distribution of the species falls within an area of ca. 228x90 km. A conservative approach would therefore be to consider this as one location, however, since the threats could vary between different populations, it cannot be considered so. Observations in the field indicated that at least 12 locations identified for the species are separated by reasonably unoccupied areas (Fig. 2). In total, 376 individuals of H. populifolia were counted in all the sampled transects of 29 grids (Table 1). It was observed that the species was found mostly above 420m, restricted to top hills and rock boulders, growing in sandy red soil. Taking these observations into consideration, a grid map has been prepared for measuring the EOO of the species. The EOO is calculated as 14,160km2 (Fig. 2). The species has a patchy distribution within the grids and substantial areas in the individual grids (more than 95% area) do not have this species (Fig. 2). The AOO thus is calculated to about 14.6km2 (1460ha). The population size of the species is estimated to comprise 23,100 individuals.

Results pertaining to the AOO and the number of individuals recorded in transects extrapolation for the whole estimated population is presented in Table 1.

Applying IUCN criteria Criterion A: The available data does not provide any indicators of change in population size over time and hence this criterion is not applied to H. populifolia.

Criterion B: Criterion B1: The EOO of H. populifolia is estimated to be 14,160km2 and considered to occur at more than 10 locations (sub-criterion a). Further, there are no extreme fluctuations observed with respect to any of (i) to (iv). It qualifies only under the sub-criterion (b) for continuing decline in terms of (iii) area, extent and quality of habitat. Hence, it does not qualify for any of the threatened categories under B1.

Criterion B2: The AOO is 14.6km2. However, it does not qualify for either (a) and (c). It qualifies only for the sub-criterion (b) for continuing decline in terms of (iii) area, extent and quality of habitat. Hence, it is

Journal of Threatened Taxa | www.threatenedtaxa.org | August 2011 | 3(8): 2018–2022

2019

Conservation status of Hildegardia populifolia

B.R.P. Rao et al.

Image 1. Hildegardia populifolia A - Habit; B - Wild population; C - Fruits; D - Seeds

Figure 1. Distribution pattern of Hildegardia populifolia

2020

Journal of Threatened Taxa | www.threatenedtaxa.org | August 2011 | 3(8): 2018–2022

Conservation status of Hildegardia populifolia

B.R.P. Rao et al.

Table 1. Grid-wise population of Hildegardia populifolia Locations

Location-1

Location-2

Location-3

Location-4

Grid number

Location

Average altitude of the grid

No. of individuals

AOO (in km2) within the grid (40 km2)

Estimated individuals in the whole grid 2268

57F16NW3

Bukkapatanam

630

14

0.9

57F16NW4

Vengalammmacheruvu

622

12

0.4

384

57F16NE1

Yerlampalli

650

16

0.8

2048

57F16NE2

Tummalamala

655

13

0.4

416

57F16NE3

Narsampalli

633

16

0.5

800

57F16NE4

Tummalamala

654

14

0.6

1008

57F16SW1

Amagondapalem

652

9

0.3

162

57F16SW3

Amagondapalem

666

16

0.8

2048

57F16SE1

Amagondapalem

643

12

0.5

600

57G13NE1

Gounuvaripalli

754

15

0.4

480

57G13NE2

Devikunata

642

22

0.4

352

57J3SE4

Chinapalli

459

35

0.2

280

57J4NE1

Nigidi RF

674

18

0.9

2916

57J4NE3

Batrepalli

680

18

0.7

1764

57K1NW3

Tummala RF

579

12

0.3

216

Location-5

57K1NW4

Tummala RF

620

16

0.7

1568

57K1NE2

Tummala RF

592

13

0.7

1274

Location-6

57K5NW1

Kokkanty RF

544

15

0.6

1080

Location-7

57K5NW3

Ishwaramala

640

12

0.5

600

57K9NW1

Papepalli

624

8

0.4

288

57K9NW3

Kalibanda

650

9

0.5

400

Location-9

57K9NW4

Rekkalakonda

672

8

0.6

576

Location-10

57K9NE1

Kalibanda

596

4

0.4

128

57K14NW3

Kottala

620

4

0.2

32

57K14NW4

Nagiripalli

522

12

0.4

384

57K14NE1

Ankalammagudi

622

11

0.2

88

57K14NE2

Kanchamvaripalli

630

8

0.2

64

58I13NW3

Mulakkadu

458

8

0.6

576

58I13NW4

Pudupalapatti

423

6

0.5

300

376

14.6

23100

Location-8

Location-11

Location-12

Total

not threatened under subcriterion B2.

Criterion C: Small population size and decline. The total estimated population of H. populifolia is >23100 mature individuals. Since the number of mature plants exceed the requirements for Vulnerable status (i.e. <10 000), the species is not considered as threatened under this criterion.

Criterion D: Very small or restricted populations.

Although the species population comprises a large number of individuals, it is found restricted to < 20km2 and is prone to human activities in terms of fire hence qualifying for Vulnerable category under D2.

Criterion E: No demographic modeling has been undertaken for the species and hence this criterion does not apply for the species.

The final assessment for Hildegardia populifolia based on the present study is: VU D2.

Hildegardia populifolia assessed under three threatened categories in different works, is currently categorized as Vulnerable based on primary data from the field. The present study also provides significant data pertaining to its distribution in peninsular Indiain the states of Andhra Pradesh (Anantapur, Kadapa and Chittoor districts) Tamil Nadu (Salem Hills) and Karnataka (in areas bordering Anantapur District of Andhra Pradesh).

Journal of Threatened Taxa | www.threatenedtaxa.org | August 2011 | 3(8): 2018–2022

2021

Conservation status of Hildegardia populifolia

B.R.P. Rao et al.

Figure 2. Minimum convex polygon of Hildegardia populifolia

REFERENCES

Ahmedullah, M. & M.P. Nayar (1987). Endemic Plants of the Indian Region—Volume 1. Botanical Survey of India, Calcutta.

Babu, M.V.S. & B.R.P. Rao (2009). Studies on the distribution pattern of a Critically Endangered taxon, Cycas beddomei (Cycadaceae). Encephalartos 96: 28–30.

IUCN Species Survival Commission (2001). IUCN Red List Categories, Version 3.1. www.iucn.org/themes/ssc/redlists/ ssc-rl-c.htm.

Jadhav, S.N., D.K. Ved, U. Ghate, K.N. Reddy & S. Reddy (2001). Proceedings of the Workshop in Conservation Assessment and management planning for Medicinal plants of Andhra Pradesh (CAMP) MPCC. Hyderabad.

Mrosovsky, N. (1997). IUCN’s credibility critically endangered.

Nature 389: 436.

Rao, B.R.P., S. Sunitha & A.M. Reddy (1998). Notes on Hildegardia populifolia (Roxb.) Schott & Endl.

(Sterculiaceae), an endemic and endangered species.

Eighth Annual conference of IAAT and National Seminar on Biodiversity, conservation and taxonomy of tropical flowering plants, Calicut, 47pp.

Rao, R.P.B., M.V.S. Babu, B. Sadasivaih, S.K. Basha, & K.N. Ganeshaiah (2009). Current threat status of Cycas beddomei Dyer, an endemic species of the Tirupati-Kadapa Hills, Andhra Pradesh, India. Encephalartos 97: 21–25.

Rao, R.P.B., M.V.S. Babu & J. Donaldson (2010). A Reassessment of the conservation status of Cycas beddomei Dyer (Cycadaceae), an endemic of the Tirupati-Kadapa Hills, Andhra Pradesh, India, and comments on its CITES Status.

Encephalartos 102: 19–24.

Rao, C.K., B.L. Geetha & G. Suresh (2003). Red List of Threatened Vascular Plant Species in India. BSI, Calcutta, 144pp.

Sarcar & Sarcar (2002). Status, botanical description, natural distribution zone, propagation practices and conservation efforts of Hildegardia populifolia (Roxb.) Schott & Endl.:A threatened tree species of dry tropical forests in India. Indian Forester 128(7): 757-770.

Shivaraj, B., K.M.C. Narayanibarve, R.U. Shankaar & K.N. Ganeshaiah (2000). Mapping of forests based on biological diversity to identify conservation sites: a case study from Udupi and South Canara districts of Karnataka. Journal of the Indian Institute of Science 80: 531–536.

Walter, K.S & H.J. Gillet (1998). 1997 IUCN Red List of Threatened Plants. IUCN Publishing service, Cambridge. www.unep-wcmc.org.

World Conservation Monitoring Centre (1998). Hildegardia populifolia. In: IUCN 2011. IUCN Red List of Threatened Species. Version 2011.1. <www.iucnredlist.org>.

Ahmedullah, M. (1990). Hildegardia populifolia, pp. 251–253.

In: Nayar, M.P & A.R.K. Sastry (eds.). Red Data Book of Indian Plants—Volume 3. Botanical Survey of India, Calcutta.

2022

Journal of Threatened Taxa | www.threatenedtaxa.org | August 2011 | 3(8): 2018–2022

JoTT Short Communication

3(8): 2023–2027

Western Ghats Special Series

Discovery and first description of male Cnemaspis heteropholis Bauer, 2002 (Reptilia: Gekkonidae) from Agumbe, central Western Ghats, India S.R. Ganesh 1, Rachakonda Sreekar 2, Saunak P. Pal 3, Gautam Ramchandra 4, C. Srinivasulu 5 & Bhargavi Srinivasulu 6 Agumbe Rainforest Research Station, Agumbe, Shimoga, Karnataka 577411, India Chennai Snake Park, Chennai, Tamil Nadu 600022, India 2 Biodiversity Research and Conservation Society, G4, MRK Towers, Swarnadhamanagar, Old Bowenpally, Secunderabad, Andhra Pradesh 500011, India 3 Centre for Ecological Sciences, Indian Institute of Science, Bengaluru, Karnataka 560012, India 5,6 Wildlife Biology Section, Department of Zoology, University College of Science, Osmania University, Hyderabad, Andhra Pradesh 500007, India 1,2,4 1

Email: 1 snakeranglerr@gmail.com, 2 sreekar1988@gmail.com, 3 herps.saunak@gmail.com, 4 gautham1112@gmail.com, 5 hyd2masawa@gmail.com (corresponding author), 6 bharisrini@gmail.com

Cnemaspis Strauch, 1887 is one of the most speciose paleotropical gekkonid genera with around 100 recognised species (Smith 1935). In India, Cnemaspis species are recorded from the hilly regions of southern India and from northeastern India (Smith Date of publication (online): 26 August 2011 Date of publication (print): 26 August 2011 ISSN 0974-7907 (online) | 0974-7893 (print)

Abstract: Cnemaspis heteropholis Bauer, 2002 was hitherto defined based only on its holotype, an adult female collected from Gund hill range, Western Ghats, India. Recently we observed adult male and juvenile specimens of this species at Agumbe, ca. 200km south of its type locality and consequently we recharacterize and expand the definition of this species by providing information about intraspecific variation based on the new specimens. Colouration in life and natural history data are also provided.

Keywords: Agumbe, Cnemaspis heteropholis, expanded characterization, juvenile, male, natural history, pores.

Editor: Aaron Bauer Manuscript details: Ms # o2614 Received 25 October 2010 Final received 13 June 2011 Finally accepted 01 August 2011 Citation: Ganesh, S.R., R. Sreekar, S.P. Pal, G. Ramchandra, C. Srinivasulu & B. Srinivasulu (2011). Discovery and first description of male Cnemaspis heteropholis Bauer, 2002 (Reptilia: Gekkonidae) from Agumbe, central Western Ghats, India. Journal of Threatened Taxa 3(8): 2023–2027.

Copyright: © S.R. Ganesh, Rachakonda Sreekar, Saunak P. Pal, Gautam Ramchandra, C. Srinivasulu & Bhargavi Srinivasulu 2011. Creative Commons Attribution 3.0 Unported License. JoTT allows unrestricted use of this article in any medium for non-profit purposes, reproduction and distribution by providing adequate credit to the authors and the source of publication.

Acknowledgements: We acknowledge The Gerry Martin Project for financial support. We thank Karnataka Forest Department for permission; Romulus Whitaker, Gowri Shankar, Gerry Martin and colleagues at the Agumbe Rainforest Research Station for their support and encouragement; the Head, Osmania University, Hyderabad and Chennai Snake Park for encouragement and facilities. This paper is part of CEPF-funded Reptile Assessment of the Western Ghats Project and we duly acknowledge the help from CEPF for publication of this article. We thank anonymous referees for comments on an earlier draft of the manuscript.

OPEN ACCESS | FREE DOWNLOAD

1935; Sharma 2002). From Karnataka eight species of Cnemaspis - C. heteropholis Bauer, 2002, C. indica (Gray, 1846), C. indraneildasii Bauer, 2002, C. jerdoni (Theobald, 1868), C. littoralis (Jerdon, 1854), C. mysoriensis (Jerdon, 1853), C. ornata (Beddome, 1870) and C. tropidogaster sensu Smith, (1935) (Boulenger, 1885) - have been reported (Smith 1935; Bauer 2002; Biswas 2006; Ganesh et al. 2007; Manamendra-Arachchi et al. 2007). C. tropidogaster sensu stricto is currently believed to be a Sri Lankan

This article forms part of a special series on the Western Ghats of India, disseminating the results of work supported by the Critical Ecosystem Partnership Fund (CEPF), a joint initiative of l’Agence Française de Développement, Conservation International, the Global Environment Facility, the Government of Japan, the MacArthur Foundation and the World Bank. A fundamental goal of CEPF is to ensure civil society is engaged in biodiversity conservation. Implementation of the CEPF investment program in the Western Ghats is led and coordinated by the Ashoka Trust for Research in Ecology and the Environment (ATREE).

Journal of Threatened Taxa | www.threatenedtaxa.org | August 2011 | 3(8): 2023–2027

2023

Male of Cnemaspis heteropholis

S.R. Ganesh et al.

Image 1. Distribution of Cnemaspis heteropholis in Karnataka, India, depicting locations of 1. Gund, Uttara Kannada (Type Locality); 2. Pushpagiri, Dakshina Kannada; and 3. Agumbe, Shimoga (from where the male is described).

endemic species known only from the type specimens and C. littoralis (type lost) is treated as incertae sedis (Manamendra-Arachchi et al. 2007).

Bauer (2002) described Cnemaspis heteropholis based only on the holotype ZMH R06158 (Zoologisches Museum Hamburg, Germany), an adult female, 40.19mm long, collected by G.A. von Maydell, on 20 January 1956 from Gund [hill range] (15015’N & 74036’E; 480m elevation), Uttara Kannada District, Karnataka State, Western Ghats, India (Image 1).

Subsequently, Biswas (2006) observed this species in Pushpagiri (12040’N & 75039’E; 833m), a locality that is ca. 500km south of the type locality (Image 1). Unfortunately, no morphological data of the individuals appeared in his work, therefore this species is still relatively poorly characterized. Bauer (2002) remarked “Comparisons of Cnemaspis indraneildasii and C. heteropholis are hindered by the fact that only females are known for the two new species.

The condition of preanal and femoral pores, useful diagnostic characters that are present only in the males in this genus (Smith 1935), are thus unknown. The absence of the male also hinders the interpretations of the possible affinities of the new species”. The present 2024

Table 1. Measurements (in mm) of the four newly documented individuals, arranged in increasing size and identified by their maturity, sex and year of sighting. ‘-’ indicates non availability of data; ‘?’ indicates missing part of the tail.

Juvenile 2 (yr. 2010) CESL 097

Adult male 2 (yr. 2010)

Adult male 1 (yr. 2008)

18.2

28.0

44.3

45.1

19.8

19.86 +?

41.2

47.1

BW

-

4.38

9.75

-

HL

8.9

9.26

13.1

14.0

HW

5.1

5.12

8.2

7.6

HD

3.2

2.82

-

5.9

ED

1.6

1.34

3.45

3.1

EL

-

0.77

1.5

-

E-E

1.4

2.70

3.6

3.3

E-S

3.0

4.02

6.0

7.2

Characters

Juvenile 1 (yr. 2008)

SVL TL

IN

0.8

1.28

1.7

2.1

IO

2.0

2.97

4.8

4.7

A-G

9.8

12.09

19.5

20.2

UAL

3.5

2.83

-

8.5

LAL

3.7

4.85

-

8.8

FEL

4.8

5.03

-

11.2

TBL

4.3

4.22

-

9.1

Journal of Threatened Taxa | www.threatenedtaxa.org | August 2011 | 3(8): 2023–2027

Male of Cnemaspis heteropholis

communication expands the external morphological characterization of this poorly known, endemic species by providing intraspecific variations from male conspecifics observed in Agumbe, Karnataka, Western Ghats, India.

Materials and Methods Our observations are based on two live adult males and two juvenile C. heteropholis sighted in the wild by the first four authors in Agumbe (13050’N & 75009’E; 557m) (Image 1) Karnataka State, Western Ghats, India on 02 May 2008, 12 November 2008, 05 May 2010 and 09 July 2010. These live individuals were examined, photographed in life in situ and released (Table 1).

Only one voucher specimen (CESL 097) was collected by the third author (SP) and deposited in the collection of the Centre for Ecological Sciences, Indian Institute of Science, Bengaluru, India. All measurements were recorded using a slide vernier calliper and are given to the nearest 0.1mm. Morphometric abbreviations are as follows: SVL, snout to vent length; TL, tail length; BW, maximum body width; HL, head length from posterior axis of the jaw to the tip of the snout; HW, head width at its widest point; HD, head depth at its parietal region; ED, horizontal eye diameter; EL, maximum ear diameter; E-E, distance from posterior edge of eye to anterior edge of ear; E-S, anterior edge of eye to snout tip; IN, internarial distance; IO, transverse distance between anterior most supraciliaries; LAL, lower-arm length measured as distance from elbow to wrist; UAL, upper-arm length measured as distance between axilla and angle of elbow; FEL, femur length measured as distance between groin and knee; TBL, tibia length measured as distance between knee and heel; and A-G, axilla to groin distance. Sex was determined on the basis of the presence of enlarged hemipenal bulges and femoral pores.

Observations Cnemaspis heteropholis Bauer, 2002 Description: Snout-vent length 18.2–45.1 mm.

Head oblong, large (HL/SVL ratio 0.33), wide (HW/ SVL ratio 0.19) and distinct from neck. Snout long (E-S/HW ratio 0.77), much longer than eye-diameter (ED/E-S ratio 0.46). Scales on the canthus-rostralis larger than the scales on the forehead and dorsum. Eye small (ED/HL ratio 0.20). Ear-opening oval and small (EL/HL ratio 0.09). Eye-ear distance slightly larger

S.R. Ganesh et al.

than eye diameter (EE/ED ratio 1.16). Rostral wide as long, completely divided by the rostral groove.

Nostrils oval, not in contact with the first supralabial, three postnasals. Mental enlarged, triangular, longer and wider than rostral; the first pair of postmentals separated by three enlarged scales (Image 2d); outer postmentals smaller than the inner. Supralabials to the angle of jaws 9, infralabials to the angle of jaws 8 (Image 2c). Body relatively wide (BW/SVL ratio 0.11) not elongate (A-G/SVL ratio 0.45), ventro-lateral fold absent. Six femoral pores on either side separated by 16–18 non pore-baring scales (Image 2b). Porebearing scale enlarged relative to the adjacent scales.

Original as well as regenerated tail oval in crosssection, almost equal to snout-vent length (TL/SVL ratio 0.95). No enlarged post-cloacal spurs. Scales on post-cloacal region slightly larger than those on the rest of the dorsum of the tail. Upper arm slightly shorter than lower arm (UAL/LAL ratio 0.95). Femur shorter than tibia (FEL/TBL ratio 1.17).

Colour in life: Dorsum of head, limbs and vertebral region mottled light brown with dark blotches along the dorsal midline larger than those on the head, either side of this dorsal midline are an additional dorsolateral row of light brown spots. Flanks dark brown with light yellow spots (tubercles; Image 2). Digits with alternating white and black bands, white at joints.

Original and regenerated tail brown with dark spots.

Throat buff interspersed with yellow, unpigmented abdomen and bright yellow on the scales between the femoral pores. Two yellowish-white stripes on the dorsolateral side of the head from the rostrum to the eye, and three stripes running after the eye to the ear.

Difference between the sexes: No variation in meristic characters was observed among the sexes except for the presence of six femoral pores on either side in males. Though there are variations in the measurements between the sexes, they should be treated with caution as a live specimen is being compared with a preserved specimen. Shrinkage commonly occurs in geckos following fixation and preservation.

Natural History: During May 2008, a juvenile was observed at 1630hr on a drying stream-bed, among moss-clad rocks, carpeted with thick leaf litter.

During October 2008, an adult male was observed at 1120hr inside the upper arch of a small cave within a forest patch. Several (n > 5) individuals were sighted

Journal of Threatened Taxa | www.threatenedtaxa.org | August 2011 | 3(8): 2023–2027

2025

Male of Cnemaspis heteropholis

S.R. Ganesh et al.

a

c

f

b

d

e

g

h

Â

Image 2. Cnemaspis heteropholis adult male. a - dorsal view; b - portraying the number of femoral pores; c - head profile; d - gular; e - venter (juvenile); f - entire - adult male; g - entire - juvenile; h - preserved juvenile specimen with incomplete tail.

2026

Journal of Threatened Taxa | www.threatenedtaxa.org | August 2011 | 3(8): 2023â&#x20AC;&#x201C;2027

Male of Cnemaspis heteropholis

together and darted inside small crevices at the least sign of our approach. During May 2010, an adult male was found resting on a mesh fence in the Agumbe Rainforest Research Station at 2100hr. Opportunistic sightings since 2008 suggest that the lizard is not common and is somewhat crepuscular in habit and were observed foraging in the night. Other lizard species found syntopic were Hemidactylus cf. brookii, Hemidactylus frenatus, Ristella beddomii, Calotes rouxii and Cnemaspis indraneildasii.

Comparisons: Presence of six femoral pores on each side and the absence of preanal pores distinguish C. heteropholis from C. boiei (Gray, 1842), C. ornata (Beddome, 1870), C. beddomei (Theobald, 1876), C. littoralis (Jerdon, 1853), C. otai Das & Bauer, 2000, C. nairi Inger et al., 1984 and C. australis ManamendraArachchi et al., 2007; absence of spine-like tubercles on flanks distinguishes it from the newly described C. nilagarica Manamendra-Arachchi et al., 2007 and C. monticola Manamendra-Arachchi et al., 2007. It may be distinguished from the morphologically similar C. sisparensis (Theobald, 1876) by its heterogenous (vs. homogenous) dorsal scalation and the presence of six femoral pores on each side (vs. 7–8) and C. wynadensis (Beddome, 1870) from having three (vs. 1–2) scales between the enlarged postmentals, weakly conical (vs. keeled) dorsal head scales and subcaudals on median series divided.

Discussion Our specimens are consistent with the original description of Bauer (2002) in morphology and colour.

J.C. Daniel collected “C. wynadensis” from the current locality in 1965 (CAS 104211, Herpetology collection catalogue, California Academy of Sciences). The specific epithet “wynadensis” refers to its original collection locality in Wynaad District, Kerala State and its surrounding localities (Smith 1935; Bauer 2002) and there have been no other records of it occurring in Karnataka. It might be possible that this specimen

S.R. Ganesh et al.

might actually be a C. heteropholis misidentified as C. wynadensis due to external morphological similarities and that C. heteropholis has been described only in the recent past. This explains the cause as to why this species has remained relatively obscure. Biswas’ (2006) record from Pushpagiri reveals that this species occurs further south and in potential sympatry with several, morphologically similar-looking congeners like C. wynadensis and C. sisparensis. But nonetheless, its unique, intermixed, prominent large tuberculate dorsal scalation clearly gives away this species. It is likely that C. heteropholis occupies a wide range of biotopes between the Palghat and the Goa gaps in the Western Ghats, at altitudes ranging from 480m (Bauer 2002) to up to 833m (Biswas 2006). More sightings are needed to better understand its characterization, distribution and biology.

References Bauer, A.M. (2002). Two new species of Cnemaspis (Reptilia: Squamata: Gekkonidae) from Gund, Uttara Kannada, India. Mitteilungen aus dem Hamburgischen Zoologischen Museum und Institut 99: 155–167.

Biswas, S. (2006). A possible occurrence of regional integumentary loss in Cnemaspis heteropholis from southern India. Gekko 5(2): 28–30.

Ganesh, S.R., S.R.C. Mouli & S.L. Edward (2007). A study on herpetofaunal assemblages in the rain forests of Western Ghats, Karnataka, India. Journal of Scientific Transactions in Environment and Technovation 1(2): 95–103.

Manamendra-Arachchi, K., S. Batuwita & R. Pethiyagoda (2007). A taxonomic revision of the Sri Lankan day-geckos (Reptilia: Gekkonidae: Cnemaspis), with description of new species from Sri Lanka and southern India. Zeylanica 7 (1): 9–122.

Sharma, R.C. (2002). Fauna of India, Reptilia - Volume II, Sauria. Zoological Survey of India, Calcutta, 430pp.

Smith, M.A. (1935). Fauna of British India including Ceylon and Burma. Reptilia and Amphibia - Volume II, Sauria.

Today and Tomorrow’s Printers & Publishers, New Delhi, Indian Reprint 1974, 440pp.

Journal of Threatened Taxa | www.threatenedtaxa.org | August 2011 | 3(8): 2023–2027

2027

JoTT Short Communication

3(8): 2028–2032

Natural range extension, sampling artifact, or human mediated translocations? Range limits of Northern type Semnopithecus entellus (Dufresne, 1797) (Primates: Cercopithecidae: Colobinae) in peninsular India Krishnaswamy Sudarshan Chetan Nag 1, Pramod Padmanabhan 2 & Kota Praveen Karanth 3 Centre for Ecological Sciences, Indian Institute of Science, Bengaluru, Karnataka 560012, India Salim Ali Centre for Ornithology and Natural History, Anaikatty Post, Coimbatore,Tamil Nadu 641108, India Email: 1 chetan@ces.iisc.ernet.in, 2 pramodpalakkad@gmail.com, 3 karanth@ces.iisc.ernet.in (corresponding author) 1,3 1,2

Faunal range expansions are dynamic and are of great relevance as they often indicate important changes in habitats due to the profound influence of human intervention, climate change or other environmental variables (Ehrlich et al. 1988; Ohmart 1994; Wehtje 2003; Oden et al. 2004). Variations in species distributions can alter important ecological interactions.

Therefore range contractions or expansions may also have economic, management, and safety implications in wildlife management (Darimont et al. 2005). Here we report the range limits of one of

Keywords: Anthropogenic activity, hybrid zone, peninsular India, range limit, river, tail carriage, under sampling.

Date of publication (online): 26 August 2011 Date of publication (print): 26 August 2011 ISSN 0974-7907 (online) | 0974-7893 (print) Editor: Mewa Singh Manuscript details: Ms # o2740 Received 29 March 2011 Final received 15 June 2011 Finally accepted 18 July 2011 Citation: Nag, K.S.C., P. Padmanabhan & K.P. Karanth (2011). Natural range extension, sampling artifact, or human mediated translocations?

Range limits of Northern type Semnopithecus entellus (Dufresne, 1797) (Primates: Cercopithecidae: Colobinae) in peninsular India. Journal of Threatened Taxa 3(8): 2028–2032.

Copyright: © Krishnaswamy Sudarshan Chetan Nag, Pramod Padmanabhan & Kota Praveen Karanth 2011. Creative Commons Attribution 3.0 Unported License. JoTT allows unrestricted use of this article in any medium for non-profit purposes, reproduction and distribution by providing adequate credit to the authors and the source of publication.

Acknowledgements: The study was financially supported by the Department of Biotechnology, Government of India (BT/PR-7127/ BCE/08/445/2006) and Ministry of Environment and Forest. We are grateful to the forest departments of Maharashtra, Karnataka, and Andhra Pradesh forest for permissions and cooperation. Special thanks to Chaitra, Achyuthan, Anjana Shenoy, Rishikesh Bahadur Desai, Rishi Kumar, Santosh Shanbhag, Sridhar Gadiyar, Kushal Kamble, Harish Bhat, Laurens Verwijs, Martin Zaruba, Hanka Svobodova, affiliates of Karanth laboratory for their generous support during the study. We like to thank K.V. Gururaja who helped us with drawing the maps. We also like to thank the reviewers for their constructive comments on the manuscript.

OPEN ACCESS | FREE DOWNLOAD

2028

Abstract: The Semnopithecus entellus can be broadly classified into two morphotypes based on tail carriage, namely the northern and the southern types (NT & ST). The borderline between these morphotypes runs along the Tapti-Godavari rivers in peninsular India. However there have been anecdotal reports of range extension of NT in peninsular India. To investigate this scenario we undertook an intensive survey of S. entellus morphotypes along the borderline districts in the states of Gujarat, Maharashtra, Karnataka and Andhra Pradesh. The GPS coordinates of the two morphotypes were mapped using MapInfo professional software and the resulting map was compared with the map generated

by Roonwal. Results indicate that NT S. entellus range limit fall further south of Roonwal’s borderline. This incongruence in NTs distribution between the present study and Roonwal’s might be due to natural range extension of NTs in some areas or a product of sampling artifact. Furthermore in parts of Andhra Pradesh and Karnataka human mediated translocations might have also contributed to this range extension.

the morphotypes of Hanuman Langur Semnopithecus entellus, one of the most widely distributed common species of primate in India.

The Hanuman Langur is a well-known, revered, and extensively studied non-human primate of India.

These langurs are known for their habituation to humans and show varied adaptations to urbanization (Pirta et al. 1997; Chauhan & Pirta 2010; Sharma et al.

2011). They are dispersed throughout most of India and Sri Lanka (Ellerman & Morrison-Scott 1966; Oates et al. 1994) and are also found in parts of Pakistan, Nepal (Roonwal 1984; Oates et al. 1994; Minhas et al. 2010), Bhutan and Bangladesh (Choudhury 2007). Hanuman langurs are well adapted to a wide range of habitats: from arid regions of Rajasthan to the rainforests of the Western Ghats and in altitudes ranging from the sea level (Nag et al. 2011) to 4270m in the Himalaya (Hrdy 1977; Bishop 1978).

Based on tail carriage, Roonwal (1979, 1984) identified two distinct morphotypes among Hanuman

Journal of Threatened Taxa | www.threatenedtaxa.org | August 2011 | 3(8): 2028–2032

Range limits of Semnopithecus entellus

Langur, namely Northern type (NT) and Southern type (ST). The NT has a tail that loops forward towards the head and is distributed north of the Tapti-Godavari rivers. The ST has a tail that loops backward away from the head and is distributed south of these rivers in peninsular India and Sri Lanka (Roonwal, 1979; 1984) (Fig. 1). These tail loop variations have been reported earlier by Hill (1938) and Rowell (1972).

Nevertheless, Roonwal (1984), for the first time gave the exact borderline (here after referred to as Roonwal’s line) between the NT and ST which according to him runs along the Tapti-Godavari rivers (see Fig. 1).

There have been several anecdotal evidences suggesting that the range of NT has extended beyond the Roonwal’s line but no systematic study has been undertaken to confirm this scenario. Thus to fill this gap we attempted to map the southern limits of the distribution of NTs in peninsular India. Here we report new information that suggests the range limits of NTs in peninsular India and discuss the possible reasons and implications of these range extensional limits.

Methods We conducted our survey in peninsular India in the states of Gujarat, Andhra Pradesh, Maharashtra and Karnataka such that the states on either side of the borderline given by Roonwal (1984) were included.

Every district along the borderline in each of the states mentioned above was intensively surveyed on foot along roads and trails between June to December 2009 for approximately six months. Surveys were also carried out in jeep and a two wheeler along major roads. All the surveys were carried out by the first author of this paper along with local field assistants provided by the respective state forest departments.

In these districts langur troops were located based on information from past surveys (Roonwal 1979, 1984; Kurup 1981, 1984; Srinivasulu & Nagulu 2001) and also by conversing with the local people. On locating a troop the tail carriage information along with GPS location of the troop were recorded. Tail carriage characters were recorded when the animal was walking casually and not when it was standing or running (as per Roonwal 1984). Troops were typed as NT or ST when all adult members of the troop exhibited either northern or southern type tail carriage respectively. Whereas when both morphotypes were observed in the same troop (mixed troops) they were

K.S.C. Nag et al.

entered as mostly NT (mNT) or mostly ST (mST) depending on the predominant tail carriage observed.

For example a troop was typed as mNT when >50% of its adult members had NT tail carriage. Additionally tail carriage information for troops from adjoining state were also collated from published material (Srinivasulu & Nagulu 2001; Kumara & Singh 2004; Kumar et al. 2010; Nag et al. 2011) and information and photographs provided by other researchers in the field. The approximate distributions of these morphotypes were determined by plotting the sampling locations of each morphotype on a map using MapInfo Professional and DIVA-GIS software (Hijmans et al.

2004). On this map Roonwal’s line was traced using MapInfo Professional software.

Results Results from our survey are shown in Fig. 1, wherein the locations of all NT and ST troops are given by black circles and rectangles respectively. Mixed troops are represented by open circles for mNT and open triangles for mST. The GPS locations of troops up to 200km on either side of Roonwal’s line are given in Table 1. As is apparent from Fig. 1, there are up to ten troops to the south of Roonwal’s line that consist of langurs with NT tail carriage. Among them two troops in the eastern parts of the range, south of the Krishna River were NTs. Five troops were mNTs and three troops were mSTs. These results suggest that the southern limit of the NT morphotype is further south of Roonwal’s line. Furthermore this “range extension” is more pronounced in the south-central and southeastern parts of the NT’s distribution. For example according to Roonwal (1979; 1984) the southern most limit of NTs along the east coast was Godavari delta north of Krishna River, whereas our observations indicate that they are distributed south of Krishna River in Guntur District of Andhra Pradesh (Fig. 1).

However, up to six troops to the north of Roonwal’s line consisted of langurs with ST tail carriage, but these were predominantly mNT. Interestingly these troops were largely restricted to the western end of Roonwal’s line near the mouth of Tapti and Narmada rivers (See inset in Fig. 1). In this part of Gujarat, Roonwal (1984) reported the northernmost populations of STs near Surat (bank of Tapti River) and southernmost populations of NT at Bharuch (bank of Narmada River).

Journal of Threatened Taxa | www.threatenedtaxa.org | August 2011 | 3(8): 2028–2032

2029

Range limits of Semnopithecus entellus

K.S.C. Nag et al.

Figure 1. Locations of troops up to 200km on either side of Roonwal’s line and the tail type observed in these troops.

Underlined numbers show locations of areas wherein human mediated translocations of langurs were reported.

See Table 1 for the names of these locations.

Our field observations indicate that northernmost population of ST occurs 85km north of Surat, in and around Bharuch. Thus Narmada River in the northwest and Krishna River in the southeast form the borderline between the southern and northern types in peninsular India.

Discussion Interestingly, there were twice as many troops (n=10) south of Roonwal’s line with at least one NT individual than there were troops (n=6) north of this line with at least one ST individual. Moreover this change in the range of these morphotypes is more extensive in the case of NT, whereas in the STs it is largely confined to western end of Roonwal’s line. Additionally in most of the mixed troops (n=14) the predominant tail type is NT (mNT=10, mST=4). Preliminary observations also suggest that these mixed troops represent a hybrid zone between NT and ST (Nag et al. 2011). Taken together these patterns are indicative of introgression 2030

of NTs into the range of ST. There are three possible explanations for the incongruence between our observations and those of Roonwal (1984). The first possible scenario is that NTs were always distributed south of Roonwal’s line but these areas were poorly /under sampled by Roonwal (1984). Thus our results might reflect the natural range of NTs. Alternately the results reported here might be indicative of range extension of NTs, in some parts, into areas where formerly STs were distributed. This scenario is supported by the largely unidirectional introgression discussed above. Thirdly in parts of Andhra Pradesh and Karnataka the range extension of NTs might be due to human mediated translocations.

Translocations of “problem langurs” were reported by forest department and local people around places like Guntur, Nalgonda, Warangal and Medak districts of Andhra Pradesh, and Bidar and Gulbarga districts of Karnataka (see underlined location in Fig. 1). We have also observed two instances of translocations wherein

Journal of Threatened Taxa | www.threatenedtaxa.org | August 2011 | 3(8): 2028–2032

Range limits of Semnopithecus entellus

K.S.C. Nag et al.

Table 1. The GPS locations of troops up to 200 km on either side of Roonwal’s line and the tail type observed in these troops (NT, Northern type; mNT mostly Northern type; ST, Southern type; mST mostly Southern type) No

Place, District

State

1

Pipalgaon, Adilabad

Andhra Pradesh

2

Bhongir, Nalgonda

Andhra Pradesh

3

Narasimha Jharna, Bidar

4

Ellora caves, Aurangabad

5

Longitude

Tail carriage type

19.838

78.238

mNT

17.51

78.888

mST

Karnataka

17.956

77.463

mST

Maharashtra

20.026

75.179

mNT

Eluru, West Godavari

Andhra Pradesh

16.717

81.150

NT

6

Kotapakonda, Guntur

Andhra Pradesh

16.142

80.039

NT

7

Kabirvad, Bharuch

Gujarat

21.76

73.14

mST

8

Lonar, Buldhana

Maharashtra

19.977

76.508

mNT

9

Wailpally, Nalgonda

Andhra Pradesh

17.158

78.788

mST

10

Savar Keda, Nanded

Maharashtra

18.976

77.362

mNT

11

Mahur, Nanded

Maharashtra

19.858

77.928

mNT

12

Nareshwar, Bharuch

Gujarat

21.87

73.23

mNT

13

Nikora, Bharuch

Gujarat

21.77

73.14

mNT

14

Rajamundry, East Godavari

Andhra Pradesh

16.983

81.783

NT

15

Sattenapalle, Guntur

Andhra Pradesh

16.415

80.153

NT

16

Srisailam, Kurnool

Andhra Pradesh

16.087

78.874

mST

17

Tanuku, West Godavari

Andhra Pradesh

16.745

81.616

NT

18

Pakhal Dam, Warangal

Andhra Pradesh

17.95

79.988

NT

19

Baroda, Baroda

Gujarat

22.306

73.187

NT

20

Vansda National Park, Navsari

Gujarat

20.715

73.553

ST

21

Devalimadi Mataji Nandir, Surat

Gujarat

21.088

73.531

ST

22

Dharmabad, Nanded

Maharashtra-Andhra Pradesh

18.9

77.85

mNT

23

Rajpardi, Bharuch

Gujarat

21.77

73.221

mST

24

Anjaneri, Nashik

Maharashtra

19.913

74.59

ST

25

Koilkonda, Mahbubnagar

Andhra Pradesh

16.742

77.723

ST

26

Tadoba, Chandrapur

Maharashtra

20.266

79.163

NT

27

Indravati National Park, Dantewada

Chattisgarh

19.233

81.011

NT

28

Kasar Sirsi, Latur

Maharashtra

17.95

76.746

ST

29

Kothlapur, Medak

Andhra Pradesh

17.675

77.951

ST

30

Mahur, Nanded

Maharashtra

19.847

77.923

NT

31

Sedam, Gulburga

Karnataka

17.376

77.585

ST

NTs were caught around Guntur and later released into Srisailam forests.

Interestingly, the range of NT Hanuman Langur overlaps with that of Rhesus Macaque Macaca mulatta in India and among Rhesus Macaques too there have been reports of range extension. Here again, the range extension of Rhesus Macaques is mostly into the northern parts of the state of Andhra Pradesh in and around Srisailam (Kumar et al. 2011). These observations hint at a common underlying mechanism driving range extensions in these two sympatric primate species. Interestingly, Kumar et al. (2011) also

Latitude

invoke natural process as well as human introductions for range extension in Rhesus Macaques. We believe that a detailed behavioral, ecological and genetic study of the hybrid zone between the two morphotypes of Hanuman Langurs might help us better understand this pattern.

References Bishop, N.H. (1978). Langurs living at high altitudes. Journal of the Bombay Natural History Society 74: 518–520.

Chauhan, A. & R.S. Pirta (2010). Socio-ecology of two

Journal of Threatened Taxa | www.threatenedtaxa.org | August 2011 | 3(8): 2028–2032

2031

Range limits of Semnopithecus entellus

K.S.C. Nag et al.

species of non-human primates, Rhesus Monkey (Macaca mulatta) and Hanuman Langur (Semnopithecus entellus), in Shimla, Himachal Pradesh. Journal of Human Ecology 30(3): 171–177.

Choudhury, A.U. (2007). The eastern limit of distribution of the Hanuman Langur Semnopithecus entellus Dufresene.

Journal of the Bombay Natural History Society 104: 199– 200.

Darimont, C.T., P.C. Paquet, T.E. Reimchen, V. Crichton (2005). Range expansion by moose into coastal temperate rainforests of British Columbia, Canada. Diversity & Distribution 11: 235–239.

Ellerman, J.R. & T.C.S. Morrison-Scott (1966). Checklist of Palaearctic and Indian Mammals, pp. 1758-1946, 2nd Edition. Trustees of the British Museum (Natural History), London, 810pp.

Elrcih, P.R., D.S. Dobkin & D. Wheye (1988). Range Expansion. University of Stanford. (Essay available at http://www.stanford.edu/group/stanfordbirds/text/essays/ Range_Expansion.html).

Hrdy, S.B. (1977). The Langurs of Abu-Female and Male Strategies of Reproduction. Harvard University Press, Cambridge, 361pp.

Hill, W.C. (1938). The mode of carrying the tail in leafmonkeys. Ceylon Journal of Science (B) 21: 66–67.

Hijmans, R.J., L. Guarino, C. Bussink, P. Mathur, M. Cruz, I. Barrentes & E. Rojas (2004). DIVA-GIS. Vsn. 5.0. A geographic information system for the analysis of species distribution data. (manual available at: http://www.divagis.org).

Kumar, R., S. Radhakrishna & A. Sinha (2011). Of Least Concern? Range Extension by Rhesus Macaques (Macaca mulatta) Threatens Long-Term Survival of Bonnet Macaques (M. radiata) in Peninsular India. International Journal of Primatology 32: 945–959.

Kumara, H.N. & M. Singh (2004). Distribution and abundance of primates in rain forests of the Western Ghats, Karnataka, India and the conservation of Macaca silenus. International Journal of Primatology 25(5): 1001–1018.

Kumara, H.N., S. Kumar & M. Singh (2010). Of how much concern are the ‘least concern’ species? Distribution and conservation status of Bonnet Macaques, Rhesus Macaques and Hanuman Langurs in Karnataka, India. Primates 51: 37-42.

Kurup, G.U. (1981). Report on the census surveys of rural and urban populations of Non-Human Primates of south India, Zoological Survey of India, Calicut.

Kurup, G.U. (1984). Census survey and population ecology

2032

of Hanuman Langur, Presbytis entellus (Dufresne, 1797) in south India. Proceedings of Indian National Science Academy 50: 245–256.

Minhas, R.A., K.B. Ahmed., M.S. Awan & N.I. Dar (2010).

Social organization and reproductive biology of Himalayan Grey Langur (Semnopithecus entellus ajax) in Machiara National Park, Azad Kashmir (Pakistan). Pakistan Journal of Zoology 42(2): 143–156.

Nag, K.S.C., P. Pramod & K.P. Karanth (2011). Taxonomic implications of a field study of morphotypes of Hanuman Langurs (Semnopithecus entellus) in peninsular India.

International Journal of Primatology 32: 830–848.

Oates, J.F., A.G. Davies & E. Delson (1994). The diversity of living colobines, pp. 45–73 In: Davies, A.G. & J.F. Oates (eds.). Colobine Monkeys: Their Ecology, Behaviour and Evolution. Cambridge University Press, Cambridge, 415pp.

Oden, J.D., N.L. Poff, M.R. Douglas, M.E. Douglas & K.D. Fausch (2004). Ecological and evolutionary consequences of biotic homogenizations. Trends in Ecology and Evolution 19: 18–24.

Ohmart, R.D. (1994). The effects of human-induced changes on the avifauna of western riparian habitats. Studies in Avian Biology 15: 273–185.

Pirta, R.S., M. Gadgil & A.V. Kharshikar (1997).

Management of the Rhesus Monkey Macaca mulatta and Hanuman Langur Presbytis entellus in Himachal Pradesh, India. Biological Conservation 79: 97–106.

Roonwal, M.L. (1979). Field study of geographical, sub specific and clinal variations in tail carriage in the Hanuman Langur, Presbytis entellus (primates) in South Asia. Zoologischer Anzeiger, Jena 202: 235–255.

Roonwal, M.L. (1984). Tail form and carriage in Asian and other primates, and their behavioral and evolutionary significance, pp. 93–151. In: Roonwal, M.L., S.M. Mohnot & N.S. Rathore (eds.). Current Primate Research. Jodhpur University Press, India, 627pp.

Rowell, T. E. (1972). Social Behaviour of Monkeys. Cox and Wyman, London, 203pp.

Srinivasulu, C. & V. Nagulu (2001). Status of Primates in Andhra Pradesh. Envis Bulletin: Wildlife and Protected Areas 1(1): 109–112.

Sharma, G., C. Ram, Devilal & L.S. Rajpurohit (2011).

Study of man-monkey conflict and its management in Jodhpur, Rajasthan (India). Journal of Evolutionary Biology Research 3(1): 1–3.

Wehtje, W. (2003). Range expansion of the Great-tailed Grackle. Journal of Biogeography 30: 1593–1607.

Journal of Threatened Taxa | www.threatenedtaxa.org | August 2011 | 3(8): 2028–2032

Dr. Shinsuki Okawara, Kanazawa, Japan Dr. Albert Orr, Nathan, Australia Dr. Geeta S. Padate, Vadodara, India Dr. Larry M. Page, Gainesville, USA Dr. Malcolm Pearch, Kent, UK Dr. Richard S. Peigler, San Antonio, USA Dr. Rohan Pethiyagoda, Sydney, Australia Mr. J. Praveen, Bengaluru, India Dr. Robert Michael Pyle, Washington, USA Dr. Muhammad Ather Rafi, Islamabad, Pakistan Dr. H. Raghuram, Bengaluru, India Dr. Dwi Listyo Rahayu, Pemenang, Indonesia Dr. Sekar Raju, Suzhou, China Dr. Vatsavaya S. Raju, Warangal, India Dr. V.V. Ramamurthy, New Delhi, India Dr (Mrs). R. Ramanibai, Chennai, India Dr. M.K. Vasudeva Rao, Pune, India Dr. Robert Raven, Queensland, Australia Dr. K. Ravikumar, Bengaluru, India Dr. Luke Rendell, St. Andrews, UK Dr. Anjum N. Rizvi, Dehra Dun, India Dr. Leif Ryvarden, Oslo, Norway Dr. Yves Samyn, Brussels, Belgium Dr. K.R. Sasidharan, Coimbatore, India Dr. Kumaran Sathasivam, India Dr. S. Sathyakumar, Dehradun, India Dr. M.M. Saxena, Bikaner, India Dr. Hendrik Segers, Vautierstraat, Belgium Dr. Subodh Sharma, Towson, USA

Prof. B.K. Sharma, Shillong, India Prof. K.K. Sharma, Jammu, India Dr. R.M. Sharma, Jabalpur, India Dr. Arun P. Singh, Jorhat, India Dr. Lala A.K. Singh, Bhubaneswar, India Prof. Willem H. De Smet, Wilrijk, Belgium Mr. Peter Smetacek, Nainital, India Dr. Humphrey Smith, Coventry, UK Dr. Hema Somanathan, Trivandrum, India Dr. C. Srinivasulu, Hyderabad, India Dr. Ulrike Streicher, Danang, Vietnam Dr. K.A. Subramanian, Pune, India Mr. K.S. Gopi Sundar, New Delhi, India Dr. P.M. Sureshan, Patna, India Dr. Karthikeyan Vasudevan, Dehradun, India Dr. R.K. Verma, Jabalpur, India Dr. W. Vishwanath, Manipur, India Dr. Gernot Vogel, Heidelberg, Germany Dr. Ted J. Wassenberg, Cleveland, Australia Dr. Stephen C. Weeks, Akron, USA Prof. Yehudah L. Werner, Jerusalem, Israel Mr. Nikhil Whitaker, Mamallapuram, India Dr. Hui Xiao, Chaoyang, China Dr. April Yoder, Little Rock, USA English Editors Mrs. Mira Bhojwani, Pune, India Dr. Fred Pluthero, Toronto, Canada

Journal of Threatened Taxa is indexed/abstracted in Zoological Records, BIOSIS, CAB Abstracts, Index Fungorum, Bibliography of Systematic Mycology, EBSCO and Google Scholar.

Journal of Threatened Taxa ISSN 0974-7907 (online) | 0974-7893 (print)

August 2011 | Vol. 3 | No. 8 | Pages 1961–2032 Date of Publication 26 August 2011 (online & print) Paper Taxonomic status of the arboreal Skink Lizard Dasia halianus (Haly & Nevill, 1887) in Sri Lanka and the redescription of Dasia subcaeruleum (Boulenger, 1891) from India -- L.J. Mendis Wickramasinghe, Nethu Wickramasinghe & Lalith Kariyawasam, Pp. 1961–1974 Review Emerging trends in molecular systematics and molecular phylogeny of mayflies (Insecta: Ephemeroptera) -- K.G. Sivaramakrishnan, K.A. Subramanian, M. Arunachalam, C. Selva Kumar & S. Sundar, Pp. 1975–1980 Communications Conservation status of the only Lungless Frog Barbourula kalimantanensis Iskandar, 1978 (Amphibia: Anura: Bombinatoridae) -- Biofagri A. Rachmayuningtyas, David P. Bickford, Mistar Kamsi, Sujatha N. Kutty, Rudolf Meier, Umilaela Arifin, Angga Rachmansah & Djoko T. Iskandar, Pp. 1981–1989 Restinga lizards (Reptilia: Squamata) at the Imbassaí Preserve on the northern coast of Bahia, Brazil -- Danilo Couto-Ferreira, Moacir Santos Tinôco, Magno Lima Travassos de Oliveira, Henrique Colombini Browne-Ribeiro, Cecil Pergentino Fazolato, Ricardo Marques da Silva, Gilvana Santos Barreto & Marcelo Alves Dias, Pp. 1990–2000

The diet of Indian Eagle Owl Bubo bengalensis and its agronomic significance -- Satish Pande & Neelesh Dahanukar, Pp. 2011–2017 Short Communications Conservation status of Hildegardia populifolia (Roxb.) Schott & Endl. (Malvaceae: Sterculioideae: Sterculieae), an endemic of southern peninsular India -- Boyina Ravi Prasad Rao, Madha Venkata Suresh Babu, Araveeti Madhusudhana Reddy, S. Sunitha, A. Narayanaswamy, G. Lakshminarayana & M. Ahmedullah, Pp. 2018–2022 CEPF Western Ghats Special Series Discovery and first description of male Cnemaspis heteropholis Bauer, 2002 (Reptilia: Gekkonidae) from Agumbe, central Western Ghats, India -- S.R. Ganesh, Rachakonda Sreekar, Saunak P. Pal, Gautam Ramchandra, C. Srinivasulu & Bhargavi Srinivasulu, Pp. 2023–2027 Natural range extension, sampling artifact, or human mediated translocations? Range limits of Northern type Semnopithecus entellus (Dufresne, 1797) (Primates: Cercopithecidae: Colobinae) in peninsular India -- Krishnaswamy Sudarshan Chetan Nag, Pramod Padmanabhan & Kota Praveen Karanth, Pp. 2028–2032

Status and conservation of crocodiles in the Koshi Tappu Wildlife Reserve, eastern Nepal -- Rajesh Kumar Goit & Khadga Basnet, Pp. 2001–2010

Creative Commons Attribution 3.0 Unported License. JoTT allows unrestricted use of articles in any medium for non-profit purposes, reproduction and distribution by providing adequate credit to the authors and the source of publication.