JoTT 3(2): 1493-1576 26 Feb 2011 by ZOO-WILD

February 2011 | Vol. 3 | No. 2 | Pages 1493-1576 Date of Publication 26 February 2011 ISSN 0974-7907 (online) | 0974-7893 (print)

Sphingomorpha chlorea

Creative Commons Attribution 3.0 Unported License. JoTT allows unrestricted use of articles in any medium for non-profit purposes, reproduction and distribution by providing adequate credit to the authors and the source of publication.

Journal of Threatened Taxa Published by Wildlife Information Liaison Development Society

Typeset and printed at Zoo Outreach Organisation

9A, Lal Bahadur Colony, Peelamedu, Coimbatore, Tamil Nadu 641004, India Phone: +91 422 2561087, 2561743; Fax: +91 422 2563269 Email: threatenedtaxa@gmail.com, articlesubmission@threatenedtaxa.org Website: www.theatenedtaxa.org EDITORS Founder & Chief Editor Dr. Sanjay Molur, Coimbatore, India Managing Editor Mr. B. Ravichandran, Coimbatore, India Associate Editors Dr. B.A. Daniel, Coimbatore, India Dr. Manju Siliwal, Dehra Dun, India Dr. Meena Venkataraman, Mumbai, India Editorial Advisors Ms. Sally Walker, Coimbatore, India Dr. Robert C. Lacy, Minnesota, USA Dr. Russel Mittermeier, Virginia, USA Dr. Thomas Husband, Rhode Island, USA Dr. Jacob V. Cheeran, Thrissur, India Prof. Dr. Mewa Singh, Mysuru, India Dr. Ulrich Streicher, Oudomsouk, Laos Mr. Stephen D. Nash, Stony Brook, USA Dr. Fred Pluthero, Toronto, Canada Dr. Martin Fisher, Cambridge, UK Dr. Ulf Gärdenfors, Uppsala, Sweden Dr. John Fellowes, Hong Kong Dr. Philip S. Miller, Minnesota, USA Prof. Dr. Mirco Solé, Brazil Editorial Board / Subject Editors Dr. M. Zornitza Aguilar, Ecuador Prof. Wasim Ahmad, Aligarh, India Dr. Giovanni Amori, Rome, Italy Dr. M. Arunachalam, Alwarkurichi, India Dr. Aziz Aslan, Antalya, Turkey Prof. R.K. Avasthi, Rohtak, India Dr. N.P. Balakrishnan, Coimbatore, India Dr. Hari Balasubramanian, Arlington, USA Dr. Maan Barua, Oxford OX , UK Dr. Aaron M. Bauer, Villanova, USA Dr. Gopalakrishna K. Bhat, Udupi, India Dr. S. Bhupathy, Coimbatore, India Dr. Anwar L. Bilgrami, New Jersey, USA Dr. Gill Braulik, Fife, UK Dr. Prem B. Budha, Kathmandu, Nepal Mr. Ashok Captain, Pune, India Dr. Cleofas R. Cervancia, Laguna , Philippines Dr. Apurba Chakraborty, Guwahati, India Dr. Kailash Chandra, Jabalpur, India Dr. Anwaruddin Choudhury, Guwahati, India Dr. Gabor Csorba, Budapest, Hungary

Dr. Paula E. Cushing, Denver, USA Dr. Neelesh Naresh Dahanukar, Pune, India Dr. R.J. Ranjit Daniels, Chennai, India Dr. A.K. Das, Kolkata, India Dr. Indraneil Das, Sarawak, Malaysia Dr. Rema Devi, Chennai, India Dr. Nishith Dharaiya, Patan, India Dr. Ansie Dippenaar-Schoeman, Queenswood, South Africa Dr. William Dundon, Legnaro, Italy Dr. J.L. Ellis, Bengaluru, India Dr. Susie Ellis, Florida, USA Dr. Zdenek Faltynek Fric, Czech Republic Dr. Hemant Ghate, Pune, India Dr. Gary A.P. Gibson, Ontario, USA Dr. M. Gobi, Madurai, India Dr. Stephan Gollasch, Hamburg, Germany Dr. Michael J.B. Green, Norwich, UK Dr. K. Gunathilagaraj, Coimbatore, India Dr. Mohammad Hayat, Aligarh, India Dr. V. B. Hosagoudar, Thiruvananthapuram, India Prof. Fritz Huchermeyer, Onderstepoort, South Africa Dr. Rajah Jayapal, Bengaluru, India Dr. Weihong Ji, Auckland, New Zealand Prof. R. Jindal, Chandigarh, India Dr. Pierre Jolivet, Bd Soult, France Dr. Werner Kaumanns, Eschenweg, Germany Dr. P.B. Khare, Lucknow, India Dr. Vinod Khanna, Dehra Dun, India Dr. Cecilia Kierulff, São Paulo, Brazil Dr. Ignacy Kitowski, Lublin, Poland Dr. Krushnamegh Kunte, Cambridge, USA Prof. Dr. Adriano Brilhante Kury, Rio de Janeiro, Brazil Dr. Carlos Alberto S de Lucena, Porto Alegre, Brazil Dr. Glauco Machado, São Paulo, Brazil Dr. Gowri Mallapur, Mamallapuram, India Prof. Richard Kiprono Mibey, Eldoret, Kenya Dr. Shomen Mukherjee, Jamshedpur, India Dr. D. Narasimhan, Chennai, India Dr. T.C. Narendran, Kozhikode, India Dr. K.A.I. Nekaris, Oxford, UK Dr. Heok Hee Ng, Singapore Dr. Shinsuki Okawara, Kanazawa, Japan Dr. Albert Orr, Nathan, Australia Dr. Geeta S. Padate, Vadodara, India Dr. Larry M. Page, Gainesville, USA Dr. Richard S. Peigler, San Antonio, USA Dr. Rohan Pethiyagoda, Sydney, Australia Mr. J. Praveen, Bengaluru, India Dr. Muhammad Ather Rafi, Islamabad, Pakistan Dr. H. Raghuram, Bengaluru, India continued on the back inside cover

JoTT Communication

3(2): 1493-1505

The current occurrence, habitat and historical change in the distribution range of an endemic tiger beetle species Cicindela (Ifasina) willeyi Horn (Coleoptera: Cicindelidae) of Sri Lanka Chandima Dangalle 1, Nirmalie Pallewatta 2 & Alfried Vogler 3 Department of Zoology, Faculty of Science, University of Colombo, Colombo 03, Sri Lanka Department of Entomology, The Natural History Museum, London SW7 5BD, United Kingdom Email: 1 cddangalle@yahoo.com (corresponding author), 2 nirmalip@yahoo.com, 3 a.vogler@nhm.ac.uk 1,2 3

Date of publication (online): 26 February 2011 Date of publication (print): 26 February 2011 ISSN 0974-7907 (online) | 0974-7893 (print) Editor: K.A. Subramanian Manuscript details: Ms # o2501 Received 02 July 2010 Final received 29 December 2010 Finally accepted 05 January 2011 Citation: Dangalle, C., N. Pallewatta & A. Vogler (2011). The current occurrence, habitat and historical change in the distribution range of an endemic tiger beetle species Cicindela (Ifasina) willeyi Horn (Coleoptera: Cicindelidae) of Sri Lanka. Journal of Threatened Taxa 3(2): 1493-1505. Copyright: ÂŠ Chandima Dangalle, Nirmalie Pallewatta & Alfried Vogler 2011. Creative Commons Attribution 3.0 Unported License. JoTT allows unrestricted use of this article in any medium for non-profit purposes, reproduction and distribution by providing adequate credit to the authors and the source of publication. Author Details, Acknowledments: see end of this article. Author contribution: CD conducted field studies in Sri Lanka and laboratory work in the Natural History Museum, London, U.K. She contributed towards research design and methodology and writing of the paper. NP contributed towards formulating the initial concept, research design and methodology and writing of the paper. AV contributed by formulating the initial concept and molecular sequencing methodology and analyses.

OPEN ACCESS | FREE DOWNLOAD

Abstract: The current occurrence, habitat and historical change in distributional range are studied for an endemic tiger beetle species, Cicindela (Ifasina) willeyi Horn of Sri Lanka. At present, the species is only recorded from Maha Oya (Dehi Owita) and Handapangoda, and is absent from the locations where it previously occurred. The current habitat of the species is explained using abiotic environmental factors of the climate and soil recorded using standard methods. Morphology of the species is described by studying specimens using identification keys for the genus and comparing with specimens available at the National Museum of Colombo, Sri Lanka. The DNA barcode of the species is elucidated using the mitochondrial CO1 gene sequence of eight specimens of Cicindela (Ifasina) willeyi. The study suggests that Maha Oya (Dehi Owita) and Handapangoda are suitable habitats. However, its presence in only two locations and its absence from locations where it previously occurred highlights the need for conserving the natural habitats at Maha Oya (Dehi Owita) and Handapangoda, and the necessity of further studies of this kind. Keywords: Conservation, DNA barcode, habitat preferences, taxonomy, tiger beetles.

INTRODUCTION Tiger Beetles (Coleoptera: Cicindelidae) are a group of attractive, fastflying and fast-running insect predators that occur in many diverse habitats around the world (Pearson & Cassola 2007). The ease with which most species can be found and identified in the field, their habitat specificity and their value as indicators of habitat health and biodiversity have generated considerable interest among amateurs and professional biologists alike (Pearson & Cassola 2007). As a result, a total of 2,559 species have been described world wide since the first eight cicindelid species were identified by Carl Von LinnĂŠ in the 18th century (Pearson & Cassola 2005). Most tiger beetle species (29% of described species) are found in the Oriental (Indo-Malaysian) region of the world, while northeastern India has the highest recorded number of species in a small area which is an 80km stretch between Siliguri and Darjeeling of West Bengal (Pearson 1988; Pearson & Cassola 2005). Sri Lanka is also attributed with a high number of cicindelid species and ranks amongst the top 30 countries of the world with the highest number of species (Cassola & Pearson 2000). The existing literature (Tennent 1860; Horn 1904; Fowler 1912; Naviaux 1984; Acciavatti & Pearson 1989), and collections available at the National Museum of Colombo and Natural History Museum of London, documents 54 species of tiger beetles from Sri Lanka belonging to five genera (Table 1), Cicindela, Tricondyla, Derocrania,

Journal of Threatened Taxa | www.threatenedtaxa.org | February 2011 | 3(2): 1493-1505

1493

Range change of an endemic tiger beetle

C. Dangalle et al.

Table 1. The Cicindelidae of Sri Lanka according to the existing literature Genus: Subgenus

Species

Locality

Collyris

Collyris dohrni Chaudoir, 1860

Trincomalee, Haldummulle, Paranthan, Odduchuddan, Colombo

Neocollyris

Neocollyris planifrons Horn, 1905

Wellawaya

Neocollyris punctatella Chaudoir, 1864

Balangoda

Neocollyris saundersi Chaudoir, 1864

Kanthalai, Bandarawela, Kandy, Wellawaya, Trincomalee, Peradeniya

Neocollyris crassicornis Dejean, 1825

Elephant Pass

Neocollyris plicaticollis Chaudoir, 1864

Urugalla

Neocollyris andrewesi Horn, 1894

Neocollyris ceylonica Chaudoir, 1864

Bogawantalawa

Tricondyla coriacea Chevrolat, 1841

Kanthalai, Horowpatana, Urugalla, Mankulam, Trincomalee, Neerodumunai, Olumadu, Kekirawa, Palatupana, Chilaw, Ella, Wellawaya, Kandy, Tirukkovil

Tricondyla granulifera Motschulsky, 1857

Urugalla, Homagama, Haragam, Nalanda, Kandy

Tricondyla nigripalpis Horn, 1894

Kongawella, Central Ceylon

Tricondyla

10 11 12

Derocrania

Derocrania agnes Horn, 1905 Urugalla, Rakwana, Bulutota, Balangoda, Bandarawela, Bogawantalawa, Nuwara Eliya, Nalanda, Kandy

Derocrania nietneri Motschulsky, 1859

Derocrania fusiformis Horn, 1904

Derocrania gibbiceps Chaudoir, 1860

Urugalla, Nalanda, Central Ceylon

Derocrania concinna Chaudoir, 1860

Urugalla, Kandy, Balangoda, Rakwana, Nalanda, Puttalam

Derocrania schaumi Horn, 1892

Trincomalee, Hambantota, Kandy, Kekirawa

Derocrania halyi Horn, 1900

Anuradhapura, Pankulam, Kanthalai, Trincomalee, Puttalam

Derocrania scitiscabra Walker, 1859

Urugalla, Horowpatana, Trincomalee, Badulla, Tamblegam, Galgamuwa, Uva province, Belihul Oya, Haldummulla, Sigiriya, Nalanda, Kandy

Derocrania nematodes Schaum, 1863

Bogawantalawa, Central Ceylon

Cicindela willeyi Horn, 1904

Central Province, Labugama

Cicindela waterhousei Horn, 1900

Labugama, Kitulgala, Karawanella, Avissawella

Cicindela dormeri Horn, 1898

Kitulgala, Labugama, Kandy, Peradeniya, Haragama, Udawattakele Sanctuary

Cicindela ganglbaueri Horn, 1892

Rakwana, Ratnapura, Kanneliya, Labugama

Cicindela henryi Horn, 1925

Minneriya, Horowpatana, Kala Oya, Kataragama

Cicindela labioaenea Horn, 1892

Wariyapola, Kandy, Horowpatana, Kotte, Battaramulla, Kanneliya forest, Kitulgala, Udugama, Wellawaya, Miyanapalawa, Labugama, Puttalam, Negombo, Yatiyantota, Peradeniya, Nalanda, Weligama, Hatton, Karawanella, Avissawella, Matugama, Opanake, Ratnapura, Kegalla, Weddagala, Nittambuwa, Kurunegala, Udawattakele, Pompakele, Ambalamahena

Cicindela nietneri Horn, 1894

Kurunegala

Cicindela lacunosa Putzeys, 1875

Andankulam, Horowpatana, Mullativu, Koggala, Habarana, Minneriya, Hatton, Wellawaya, Wavuniya, Wilpattu National Park, Anuradhapura, Kandy, Puttalam, Kataragama, Lahugala, Tissamaharama, Kurunegala, Kala Oya

Cicindela paradoxa Horn, 1892

Puttalam, Matale, Negombo, Colombo Museum Garden, Weligama, Hendala, Kitulgala, Matugama, Weddagala, Yatiyantota

Cicindela corticata Putzeys, 1875

Andankulam, Koggala, Minneriya, Habarana, Hambantota, Peradeniya, Kataragama, Uggalkaltota, Wavulpane, Maduvanwala, Angunakolapelessa, Kala Oya

Cicindela: Ifasina

Oligoma

29 30

Jansenia

Cicindela westermanni Schaum, 1861

Cicindela laeticolor Horn, 1904

1494

Trincomalee, Hambantota

Journal of Threatened Taxa | www.threatenedtaxa.org | February 2011 | 3(2): 1493-1505

Range change of an endemic tiger beetle Genus: Subgenus

C. Dangalle et al.

Species

Locality

Cicindela cirrihidia

Cockmuttai, Jaffna, Anuradhapura, Wilpattu National Park

Cicindela stellata

Trincomalee

Cicindela distinguenda Dejean, 1825

Elephant Pass, Hambantota, Anuradhapura, Puttalam, Padaviya, Kilinochchi, Mannar

Cicindela undulata Dejean, 1825

Galgamuwa, Andankulam, Colombo, Tissamaharama, Puttalam, Lahugala, Kala Oya

Monelica

Cicindela fastidiosa Dejean, 1825

Mankulam, Andankulam, Koggala, Elephant Pass, Habarana, Hambantota, Haldummulle, Eppawala, Trincomalee, Wilpattu National Park, Anuradhapura, Tissamaharama, Puttalam, Lahugala, Kala Oya

Lophyridia

Cicindela angulata Fabricius, 1798

Mannar District, Pesalai, Talaimannar, Hendala, Anuradhapura, Chilaw, Sigiriya, Kurunegala, Mahaweli ganga, Kalkudah, Puttalam, Godakewela, Arugam Bay, Deduru Oya, Colombo, Yala

Cicindela cardoni Fleutiaux, 1890

Maduru Oya, Punani, Chilaw, Mahaweli Ganga, East Polonnaruwa, Kurunegala, Kegalla

Cicindela discrepans Walker,1858

Wellawaya, Horowpatana, Kandy, Colombo, Habarana, Sigiriya, Anuradhapura, Badulla, Hambantota, Kataragama, Nalanda, Kitulgala, Kala Oya

Myriochile

Calochroa

Cicindela 1823

Cicindela sexpunctata Fabricius, 1775

Jaffna, Maha Oya, Sigiriya, Puttalam District, Wellawaya

Cicindela aurovittata Audouin & BrullĂŠ, 1839

Maha Oya, Puttalam, Mundal, Kalkudah, Deduru Oya

Cicindela lacrymans Schaum, 1863

Labugama, Kandy, Kelani Valley, Kottawa, Kanneliya, Ratnapura, Udawattakele Sanctuary, Gilimale, Kitulgala

Cicindela ceylonensis Horn, 1892

Wellawaya, Pulmoddai, Moneragala, Trincomalee

Cicindela calligramma Schaum, 1861

Puttalam District, Palugassegama

Cicindela diversa Horn, 1904

Anuradhapura, Giritale, Mannar, Wilpattu National Park, Cockmuttai

Ancylia

46 47 48

Lophyra

haemorrhoidalis

Wiedemann,

Horowpatana, Anuradhapura, Kataragama, Haragama, Eppawala, Wellawaya, Sigiriya

Cicindela fuliginosa Dejean, 1826

Cicindela catena Fabricius, 1775

Miyanapalawa, Colombo, Matale, Kandy, Hendala, Labugama, Kitulgala, Bentota, Matugama, Kurunegala, Puttalam, Kala Oya, Weddagala, Kataragama, Kandachchi, Aluthgama, Jaffna, Dolosbage, Trincomalee, Hambantota

Cosmodela

Cicindela aurulenta Fabricius, 1801

Hypaetha

Cicindela quadrilineata Fabricius, 1781

Marichchakkaddi, Colombo

Cicindela biramosa Fabricius, 1781

Mannar, Mount Lavinia, Colombo Trincomalee, Weligama, Delft, Hendala, Kalutara, Nilaweli, Kalkudah, Pottuvil, Pesalai, Galle, Kelani Valley

52 53

Callytron

Cicindela limosa Saunders, 1834

Puttalam, Iranativu, Chilaw

Eugrapha

Cicindela singalensis Horn, 1911

Hambantota

Collyris and Neocollyris. The majority of species are included in the genus Cicindela which consists of 13 subgenera, Ancylia, Calochroa, Lophyra, Lophyridia, Jansenia, Oligoma, Cosmodela, Eugrapha, Monelica, Myriochile, Hypaetha, Callytron and Ifasina (Table 1). Subgenus Ifasina is attributed with the highest number of species (7) out of which five species are endemic to the island. We report in this paper the first recorded occurrence

of an endemic tiger beetle species, Cicindela (Ifasina) willeyi, from two locations of Sri Lanka and the habitat preferences of the species.

METHODS AND MATERIALS Tiger beetles were surveyed in 94 localities of Sri Lanka from May 2002 to December 2005 (Fig. 1,

Journal of Threatened Taxa | www.threatenedtaxa.org | February 2011 | 3(2): 1493-1505

1495

Range change of an endemic tiger beetle

C. Dangalle et al.

Dry zone Intermediate zone

Wet zone Colombo and Gampha districts

Figure 1. Localities of Sri Lanka surveyed for the occurrence of tiger beetles (Place names of localities are provided in Table 2)

Table 2). The localities for collecting tiger beetles were selected using information based on previous publications of cicindelid species of Sri Lanka and information based on the different habitat types of the family on a global scale. Field studies were conducted at Maha Oya (Dehi 1496

Owita) in August 2003 and 2004, and at Handapangoda in July 2003 and 2004. Study Area: Maha Oya is a stream located at Dehi Owita (6057’91”N & 80016’44”E, elevation 6.7m) in the Kegalle District, Sabaragamuwa Province of Sri Lanka. It covers an area of 17km2 and encompasses

Journal of Threatened Taxa | www.threatenedtaxa.org | February 2011 | 3(2): 1493-1505

Range change of an endemic tiger beetle

C. Dangalle et al.

Table 2. Localities of Sri Lanka surveyed for the occurrence of tiger beetles Location Number

Place Name

Location Number

Place Name

Abhaya Wewa, Anuradhapura

Heen Ela, Waga

Thisa Wewa, Anuradhapura

Kelani Rriver, Kaduwela

Nuwara Wewa, Anuradhapura

Kelani River, Kirielamulla

Mahakanadarawa Wewa, Anuradhapura

Angoda, Colombo

Nachchaduwa Wewa, Anuradhapura

National Museum Garden, Colombo

Talawa Tank, Talawa

Kelani River, Malwana

Turuwila Wewa, Anuradhapura

Pugoda Ferry, Kosgama

Rajangana Reservoir, Tambuttegama

Malabe, Colombo

Tabbowa Wewa, Karuwalagaswewa

Ranwala Ferry, Awissawella

Puttalam Lagoon, Puttalam

Pahuru Wila, Malwana

Mundel Lake, Puttalam

Aswathu Oya, Awissawella

Kurundankulama Tank, Anuradhapura

Mount Lavinia Beach

Kala Wewa, Anuradhapura

Wak Oya, Thummodara

Balalu Wewa, Anuradhapura

Water Canal, Handapangoda

Minneriya Wewa, Polonnaruwa

Water Canal, Horana

Giritale Wewa, Polonnaruwa

Mahabellana Ferry

Parakrama Samudra, Polonnaruwa

Thalpitiya, Wadduwa

Sigiriya, Matale District

Nachchimale, Horana

Kandalama Tank, Dambulla

Kalu Ganga Bank, Horana

Dambulu Oya, Dambulla

Kalu Ganga, Ingiriya

Dewahuwa Wewa, Dambulla

Gammanpila Tank, Bandaragama

Magalla Tank, Nikaweratiya

Katugasella Falls, Ratnapura

Chilaw Coast, Chilaw

Maragalakanda, Moneragala

Deduru Oya, Halawatha

Irahandapana Falls, Ratnapura

Batalegoda Tank, Ibbagamuwa

Katukurunda Coast, Kalutata

Marawila Coast, Marawila

Maggona Coast, Maggona

Porutota Coast, Negombo

Aluthgama Coast, Aluthgama

Ma Oya, Alawwa

Induruwa Coast, Induruwa

Meewatura, Peradeniya

Kosgoda Beach, Kosgoda

Ma Oya, Mawanella

Galle Harbour, Galle

Biyagama, Gampaha

Morampitigoda Coast, Morampitigoda

Kimbulawila Wewa, Malwana

Habaraduwa Beach, Habaraduwa

Seethawaka River, Thalduwa

Kataluwa Coast, Koggala

Maha Oya Falls, Dehi Owita

Matara Beach, Matara

Maha Oya, Dehi Owita

Enselwatta, Sinharaja

Kahanawita Falls, Dehi Owita

Kollewa Dola, Sinharaja

We Oya, Yatiyantota

Chandrika Wewa, Embilipitiya

Ramboda Falls, Ramboda

Ridiyagama Wewa, Ambalantota

Pundalu Oya, Talawakele

Karagan Salterns, Hambantota

Silver Falls, Nuwaraeliya

Hambantota Salterns, Hambantota

Kotmale Oya, Talawakele

Hambantota Beach, Hambantota

Dessford Falls, Talawakele

Tissa Wewa, Tissamaharama

Adams Peak, Ratnapura

Kirinda Beach, Kirinda

Bopath Falls, Ratnapura

Yoda Wewa, Tissamaharama

Water Canal, Labugama

Menik Ganga, Kataragama

Water Canal, Puwakpitiya

Salterns, Yala

Kumari Falls, Thummodara

Sellakataragama, Kataragama

Journal of Threatened Taxa | www.threatenedtaxa.org | February 2011 | 3(2): 1493-1505

1497

Previous and Present Loctions of Cicindela (Ifasina) willeyi H. of Sri Lanka Range change of an endemic tiger beetle

C. Dangalle et al.

the Grama Niladhari divisions of Dehi Owita, Debagama and Thimbiripola. The stream is a branch of the much larger Kelani River which starts from the Sri Pada Mountain range and flows in to the ocean at Colombo. The water of Maha Oya is slow flowing and runs parallel to a large sandy bank with 167m elevation (Fig. 2 & Image 1). The stream at Handapangoda (6047â&#x20AC;&#x2122;05N & 80008â&#x20AC;&#x2122;03E; elevation 23m) is located near a rubber estate in the Kalutara District, Western Province of Sri Lanka. It covers an area of 11km2 and encompasses the Grama Niladhari divisions of Handapangoda, Arakawila, Menerigama and Kurana. It is a branch of Kalu Ganga, which is the second largest river of Sri Lanka and is restricted entirely to the wet zone of the country. The water of the stream is slow flowing and runs parallel to a narrow sandy bank that consists mostly of rocks (Fig. 2 & Image 2). Collection of Beetles: Four visits were made to each site for surveying adult tiger beetles. Three belts of land of 100 to 150 m were selected on the sandy bank of Maha Oya, while two belts were selected on the bank of Handapangoda. All sites were sampled over five hours each day between 1000 to 1400 hr. Beetles were searched for in specific habitats and their immediate surroundings e.g. shrub area near the sandy sections of the stream, rocky substrata, pathways and trails. When encountered tiger beetles were rapidly counted at a given site using a hand tally counter (Wagtech, UK) and a sample was collected using a standard insect net. The number of beetles and the sex ratio of those that could be observed under field conditions and from collected specimens were recorded. Specimens were collected and preserved in 96% ethanol and stored at -200C for subsequent identification. Measuring Habitat Variables: The following habitat variables of the study sites were recorded. (i) Weather variables: The ambient temperature, degree of solar radiation, relative humidity and wind speed of the habitat were recorded using a portable integrated weather station (Health EnviroMonitor, Davis Instrument Corp., Hayward, CA, USA) with optional sensors. (ii) Soil characteristics: These included the soil group (determined by using the generalized soil map of Sri Lanka by Moorman & Panabokke 1961); 1498

Central Province Maha Oya Dehiowita # # #

Handapangoda

Labugama

previous locations Previous and present Locations of Cicindela (Ifasina) willeyi H. of Sri Lanka

present locations

Figure 2. Study area at Maha Oya and Handapangoda with 7 0 7 14 21 28 previous locations

35 Kilometers

Image 1. Maha Oya (Dehi Owita)

Image 2. Stream at Handapangoda

Journal of Threatened Taxa | www.threatenedtaxa.org | February 2011 | 3(2): 1493-1505

Range change of an endemic tiger beetle

soil type / texture (determined by the sedimentation technique using the “soil textural triangle” as the reference (Bierman 2007)); soil colour (measured by comparison with a Munsell soil colour chart); soil temperature (determined by using an insert soil thermometer (SG 680-10) ranging from –10 to 110 0C); soil pH (determined by using a portable soil pH meter (Westminster, No.259)); soil moisture (determined by selecting five random spots of a locality and collecting samples down to a depth of 10cm and estimating the difference in weight before and after oven drying to 107 to 120 0C in the laboratory.); soil salinity (determined by a YSI model 30 hand-held salinity meter). Determination of morphological characteristics of tiger beetles: Morphological characters important in identification and for the purpose of establishing characteristics of this species were also noted as follows. (i) Body weight: Each beetle was weighed to the nearest mg on an analytical balance (Chyo JL180, Chyo Balance Corp., Japan). (ii) Body length: Estimated by measuring the length from the frons of the head to the elytral apex when the head was in the normal feeding position. The spines on the caudal end of the elytra were disregarded. Measurements were taken using a dissecting microscope (Nikon Corporation SE., Japan) with the aid of an eyepiece graticule (Nikon, Tokyo, Japan) calibrated by an objective micrometer (Olympus, Japan). Body lengths of beetles were categorized as follows, based on size classes relevant for this group of insects (Acciavatti & Pearson 1989). 1. very small – less than 8mm 2. small – 8 to 10 mm 3. medium – 10 to 15 mm 4. large – 15 to 20 mm 5. very large – more than 20mm (iii) Mandible length / chord: The distance from the articulation point of the left mandible to the tip were measured under a dissecting microscope (Nikon Corporation SE, Japan) with the aid of an eyepiece graticule (Nikon, Tokyo, Japan) calibrated by an objective micrometer (Olympus, Japan). Only specimens with undamaged or not noticeably worn mandibles were used (Pearson & Juliano 1993; Satoh & Hori 2004). (iv) Other characters: In addition to the above

C. Dangalle et al.

characters the following features were also recorded for each specimen. 1. Colouration – Dorsal and ventral colouration of the body and its metallic or iridescent appearance was noted as was the colour of the elytral maculae, pits, eyes, antennae, mandibles, labrum and legs. 2. Number of rugae between eye and vertex. 3. Labrum – The shape of the labrum and the number of labral setae. 4. Distribution of setae on body. 5. Distribution of pits on body. The above characters were observed under a photomicrographic attachment (Microflex AFX – DX, Nikon Corporation, Tokyo, Japan) which was also used in photographing each specimen (dorsal view, ventral view, lateral view, other important features). Additional photographs of species were also taken by using the computer software programme Auto Montage (facilitated with a SMC Pentax – FA macro camera) available at the entomology laboratory of the Natural History Museum, London. Taxonomic keys of the Cicindela of the Indian subcontinent by Acciavatti & Pearson (1989), descriptions of Horn, (1904) and Fowler (1912) were used to identify the species and confirmation of identification was done through comparisons with specimens available at the National Museum of Colombo. DNA Sequencing: DNA analysis was carried out to determine the DNA barcode of the species. Eight specimens from the two known populations (Maha Oya and Handapangoda) were used for DNA extraction and sequencing. DNA was extracted from the abdominal region of the beetle using the DNeasy protocol (July 2003). Voucher specimens were deposited in the Entomology Collection of the Department of Zoology, University of Colombo. A ~810 bp region of the 3’ end of the cytochrome oxidase 1 (CO1) gene was amplified using primers M202 (forward, 5’ - CAA CAT TTA TTT TGA TTT TTT GG - 3’, alias Jerry; Simon et al. 1994) and M70 (reverse, 5’ - TCC ATT GCA CTA ATC TGC CAT ATT A - 3’, alias Pat; Simon et al. 1994). Standard PCR amplifications included 5µl of NH4 buffer, 0.5µl of each dNTP, 1µl of each primer, 0.1µl of TAQ polymerase and 2.5µl of MgCl2 in a 50µl reaction volume. PCR amplifications were carried out on a GeneAmp PCR System 9700 thermal cycler

Journal of Threatened Taxa | www.threatenedtaxa.org | February 2011 | 3(2): 1493-1505

1499

Elytral humeral spot Range change of an endemic tiger beetle

(Applied Biosystems, California, USA) for one cycle of (940C, 2.5 mins.; 47 0 C, mins.; 72ºC, 11 mins.; E0.5 lytral humeral 40C, α) for 40 cycles. The PCR products were purified spot using the UltraClean PCR clean-up DNA purification kit (MoBio Laboratories Inc., Carlsbad, CA, USA) Elytral humeral according to the manufacturer’s protocol. spot Sequencing was performed for 10µl of cleaned PCR E lytral umeral Elytral product using the ABI Prism Bighhumeral Dye Terminator pot s spot Cycle sequencing kit (PE Applied Biosystems, Foster City, CA, USA). PCR primers were used as sequencing primers and each fragment was sequenced on both strands. The reaction products were purified by ethanol precipitation and sequenced on ABI 373 (version 3.0) automated DNA sequencer. Sequence files were edited using SEQUED version 1.0.3 (Applied Biosystems) and a consensus of bidirectional sequencing was determined.

C. Dangalle et al.

First ePron lytr spot

B A

RESULTS Cicindela (Ifasina) willeyi H. was the only tiger beetle species observed at Maha Oya (Dehi Owita) and Handapangoda. Fifty beetles of Cicindela (Ifasina) willeyi. were observed from Maha Oya (Dehi Owita) and five beetles were collected for morphometric and morphological characterization. Ten specimens of the species were recorded from Handapangoda and three were collected for characterization. Taxonomy of Cicindela (Ifasina) willeyi Horn, 1904: The description given in Horn (1904), Fowler (1912) and Acciavatti & Pearson (1989) and the specimens available at the National Museum,

Image 3. Cicindela (Ifasina) willeyi Horn, 1904 female , habitus, dorsal view (total length = 9.2 mm) (x10 x 1.0) A - Elytral humeral spot; B - Pronotum; C - First elytral spot; D - Second elytral spot; E - Third elytral spot

Colombo matches the features observed in the specimens collected from Maha Oya (Dehi Owita) and Handapangoda sites. Diagnosis: Cicindela (Ifasina) willeyi H. closely resembles the other allied species C. (I.) waterhousei

Table 3. Morphometric parameters of Cicindela (Ifasina) willeyi Horn collected from Maha Oya (Dehi Owita) and Handapangoda

1500

Pronotu

Specimen No.

Body Length (mm)

Body Weight (mg)

Left Mandible Length (mm)

BMNH(E)703891

9.45

32.3

1.63

BMNH(E)703898

8.68

23.4

Damaged

BMNH(E)703899

9.35

27.8

Damaged

BMNH(E)703900

9.40

31.2

1.88

BMNH(E)703901

9.60

31.3

Damaged

BMNH(E)703902

8.88

25.5

Damaged

BMNH(E)703903

9.00

23.1

Damaged

BMNH(E)703904

9.20

24.7

2.20

Average

9.19 ± 0.56

27.45 ± 1.94

1.90 ± 0.54

Journal of Threatened Taxa | www.threatenedtaxa.org | February 2011 | 3(2): 1493-1505

Pro Middle ely spot First e spot Pro Pron Third elytra First e Middl spot spot

First First Third ele Middl spot spot spot

Third e Midd Middl spot spot

Third ee Third

Range change of an endemic tiger beetle

C. Dangalle et al.

Table 4. Climatic conditions at Maha Oya (Dehi Owita) and Handapangoda Parameter

Maha Oya (Dehi Owita)

Handapangoda

Temperature

32ºC

Relative humidity

65%

Solar radiation

132 W/m2

126 W/m2

Barometric pressure

760 Hgmm

Wind speed Wind direction

Table 5. Soil conditions at Maha Oya (Dehi Owita) and Handapangoda Parameter

Maha Oya (Dehi Owita)

Handapangoda

Soil group

Red-Yellow Podzolic soil

Soil type

Sand

760 Hgmm

Soil colour

Yellowish-brown (10YR5/6)

Dark yellowishbrown (10YR4/6)

0ms-1

Soil temperature

28ºC

27ºC

South-West

Soil pH

6.8

6.0

Soil moisture

2.89%

17.96%

Horn, C. (I.) dormeri Horn and C. (I.) ganglbaueri Horn that are also endemic to Sri Lanka. However, the species can be distinguished by the presence of an elytral humeral dot and three spots that lie medially in a line on elytra; more excavate forehead between the eyes; narrow, conical pronotum with a dorsal bulge that is undivided by a short medial line (Image 3). Description: Body small with an average length

of 9.19 ± 0.56 mm and an average body weight of 27.45 ± 1.94 mg (n = 8) (Table 3). Dorsal region of head, pronotum and base of eyes shiny copper green in colour. Elytra metallic brown with a humeral dot, and three spots medially in a line. Spots yellowishwhite in colour. First and third spot circular and small. Middle spot large, ovate or pear-shaped. Ventral side

DNA Barcode (consensus sequence of CO1 gene) of Cicindela (Ifasina) willeyi H. (GenBank Accession Number: HM600780) TTTGGGATAATTTCACATATTATCAGCCAAGAAAGAGGTAAAAAGGAAACATTTGGATCATTG GGYATAATTTACGCTATATTAGCAATTGGRTTATTAGGATTTGTAGTTTGAGCTCATCATATAT TTACTGTAGGAATAGATGTAGACACTCGRGCCTACTTCACCTCTGCCACTATAATTATTGCTGT ACCAACAGGYATTAAAATTTTTTCATGACTMGCCACACTTCATGGATCTCAAATTTCTTACAG ACCYTCTCTATTGTGAGCCTTGGGATTTGTATTCCTATTCACTGTGGGRGGYCTAACTGGRGTA GTATTAGCAAATTCATCAATTGATATTATCCTTCATGATACATATTATGTAGTTGCYCATTTTC ACTACGTTCTATCAATAGGRGCAGTATTCGCAATTATATCAGGATTTATCCAATGATTCCCATT ATTTACAGGATTAACTATGAACAATAGCTTRCTTAAAATTCAATTTATAATTATATTTGTGGGG GTTAATCTTACATTCTTCCCTCAACATTTCCTAGGATTAAGAGGGATACCTCGTCGGTACTCAG ACTACCCTGATGCTTATGTTTCATGAAATATYGTATCATCTATTGGCTCAACTATTTCGTTCAT TGGTGTATTAATGCTAATTTATATTATTTGAGAAAGATTTTCATCTCAACGCCTMGTRCTATTC CCTAATCAAATATCYACATCTATTGAATGATTCCAAAATATTCCCCCCGCTGAGCATAGTTACT CAGAACTT Table 6. Historical change in distribution of Cicindela (Ifasina) willeyi with relevance to decline in geographic range. Species

Cicindela (Ifasina) willeyi

Past Locations Central Province; Labugama, Western Province

Approximate Area (km2)

5575 8.5

Present Locations Maha Oya, Dehi Owita, Sabaragamuwa Province; Handapangoda, Western Province

Approximate Area (km2)

Decline in Geographic Range (km2)

Past Habitats

Present Habitats

Population Size

Unknown

Riparian. On the sandy banks of river / stream.

Past – Unknown. Maha Oya 50 beetles were observed in the area. Handapangoda 10 beetles were observed in the area.

17 5555.5 11

Journal of Threatened Taxa | www.threatenedtaxa.org | February 2011 | 3(2): 1493-1505

1501

Range change of an endemic tiger beetle

C. Dangalle et al.

of body iridescent bluish-green with white setae. Labrum short, broad and brown in colour with eight or nine submarginal setae. Mandibles dark brown with left mandible having an average length of 1.90 Âą 0.54 mm (n = 3). Pronotum with a medial dorsal bulge that is undivided by a medial line. Legs shiny blue-green in colour (Image 3). Habitat of C. (I.) willeyi: Beetles were found on a sandy bank at Maha Oya (Dehi Owita) which is a shallow stream found in the Sabaragamuwa Province. The periphery of the sandy bank consisted of shrub type vegetation of Gahala Colocasia esculenta, Bamboo Bambusa vulgaris and long grasses that provided shade to the habitat. Climatic and soil conditions of the site are given in Tables 4 and 5. The climatic and soil conditions at Handapangoda were more or less similar to that of Maha Oya (Dehi Owita) (Tables 4 & 5). However, the beetles at Handapangoda were mainly found on the moist rocks on the sandy bank. Further, the habitat at Handapangoda was more better shaded than that at Maha Oya due to the large trees found on the bank. Historical change in distribution of C. (I.) willeyi: The species has been reported from the Central Province of the island and Labugama, Western Province from as far back as 1904 (Horn 1904; Fowler 1912; Acciavatti & Pearson 1989; collection of the National Museum of Colombo, Sri Lanka). However, it has not been studied thereafter, and although itâ&#x20AC;&#x2122;s biology is well known, data on present distribution and habitat is lacking. According to the results of the current study, at present it occupies two habitats in Maha Oya (Dehi Owita) area and Handapangoda area. Investigations in the present study have further revealed that the species is absent from its former locations of Central Province and Labugama which have a geographical area of about 5583.5km2 and is now restricted to an area of about 28km2 in Maha Oya (Dehi Owita) and Handapangoda (Table 6). Therefore, a loss of its present habitats where it is restricted in distribution may threaten the survival of the species and qualify it for a threatened category in the near future.

1502

DISCUSSION Cicindela (Ifasina) willeyi is an endemic tiger beetle species of Sri Lanka that was first described by Horn (1904) from the Central province of Sri Lanka, which was subsequently confirmed by Fowler (1912) and later by Acciavatti & Pearson (1989). The National Museum of Colombo houses a specimen of the species collected from Labugama in the Western Province of the country. However, the present distribution of this endemic species has been uncertain and habitat characteristics and preferences were completely unknown. The present study reveals the species from Maha Oya (Dehi Owita) (Sabaragamuwa Province), and Handapangoda (Western Province), localities from which it had not been previously recorded. Further, extensive field work carried out in riparian habitats of Meewathura, Kandy; Ma Oya, Mawanella; Pundalu Oya, Kotmale Oya, Ramboda and Silverfalls, Nuwara Eliya (Central Province); and Labugama (Western Province) during the study period confirms the absence of the species from its previous localities of occurrence (Fig. 1). This knowledge on the past and present distribution of C. (I.) willeyi indicates the possibility of a historical change in the distributional range of the species. Various factors including urbanization, increased intensity of recreational use of beaches, increased off-road vehicle traffic, conversion of the habitat to a dumping ground for automobile parts and construction material, increased vegetation encroachment that eliminates open areas and inundation of habitat caused by the construction of dams have been used to explain historical range changes in tiger beetles in the United States (Knisley & Hill 1992; Kritsky et al. 1996; Knisley & Fenster 2005; Pearson et al. 2006; Simmons 2007). Therefore, it is possible that C. (I.) willeyi extirpated from the localities in the Central Province and Labugama, and inhabited the area in Handapangoda and Maha Oya (Dehi Owita). Even though, the reason for this is not precisely known, possible events of the past can be suggested. The Mahaweli Development Programme was initiated in Sri Lanka in 1979 to fulfill the water requirements for agriculture, industrial and domestic use, develop hydropower and reduce flood peaks. As a result of this programme, four major reservoirs and

Journal of Threatened Taxa | www.threatenedtaxa.org | February 2011 | 3(2): 1493-1505

Range change of an endemic tiger beetle

dams, namely, Kotmale, Victoria, Randenigala and Rantambe were built along the main stem of the river that lies in the Central Province (Dayawansa 2008). Building of a dam is known to reduce and corrode soil and rock along the river as massive deposits of soil are left within the reservoir. The massive cobblestones, sand and crushed stones held back by the dam and the transformation of the once tortuous riverbank and riverway to a relatively straight river course results in the loss of habitat for many invertebrates who survive in this environment (Mao & Zheng 2006). During reservoir filling the river and any associated wetland areas become inundated. Riffles, runs and pools of the river are lost beneath the rising waters, leading to the extirpation (or extinction) of habitat sensitive riverine species with tightly defined niche requirements (McAllister et al. 2001). Likewise, reservoir and dam construction along the Mahaweli River has resulted a considerable impact on river morphology and has inundated a vast area of land in the Central Province of the island. Aerial photographs obtained in 1985 and 2003, and topographical maps of the Survey Department of Sri Lanka, present encroachments towards the river across its floodplain area in Gohagoda, Central Province. Further, riparian areas in Peradeniya (Central Province) have changed to residential urban areas with considerable impacts of waste disposal (Dayawansa 2008). It is also recorded that gold has been mined in the past from a concordant quartz reef in Central Sri Lanka (Nawaratne & Dissanayake 2001), and several gemming grounds are located in Nuwara Eliya, Horton Plains, Hatton and Kandy (Herath 1984). Therefore, it is strongly possible that C. (I.) willeyi went locally extinct from its historic sites in the Central Province of Sri Lanka and invaded the riparian habitats of Maha Oya (Dehi Owita) (Sabaragamuwa Province) and Handapangoda (Western Province) due to the unsuitability and loss of its former habitats. The presence of populations of the species at Maha Oya and Handapangoda, indicate the suitability of the habitat, climate and soil conditions of these locations. Tiger beetles are known to prefer riverine habitats because of close proximity to food and water resources, safety from predators and reasonably low human disturbance (Bhargav & Uniyal 2008). Shade of the habitat is used as an oviposition cue for many species and clusters of larval burrows were found near

C. Dangalle et al.

the bases of plants in Cicindela cursitans Le Conte, of Ohio Valley, United States (Brust et al. 2005). Further, their activity and density are greatly influenced by daily temperature patterns (Schultz 1983), and adult tiger beetles are known to maintain internal body temperatures that are just below their lethal limits of 390C (Pearson et al. 2006). A ground temperature ranging from 32-33 0C is known to be suitable for the activity and viability of tiger beetle populations, and a temperature of 34-35 0C determined the greatest number of matings in Cicindela (Cephalota) circumdata leonschaeferi Cassola (Eusebi et al. 1989). Tiger beetles prefer sandy soils with minimal vegetation, where periodic disturbance by wind and water removes encroaching vegetation (Warren & Buttner 2008). Colour patterns of adult tiger beetle species closely match the texture and hue of the soil substrate on which the species occurs (Pearson & Vogler 2001), and matching the body colour with that of the soil plays an important role in predator evasion by reducing discovery (Morgan et al. 2000). The habitats at Maha Oya (Dehi Owita) and Handapangoda were both riparian with sparse vegetation that consisted of shrubs. In Handapangoda, ferns and bamboo were found on the stream banks providing shade to the habitat while a similar habitat was also found at Maha Oya. Ground temperature were similar at both sites and were at 320C, while the soil temperature was 280C at Maha Oya, and 270C at Handapangoda. Both river banks consisted of soil with a sandy texture that was yellowish-brown at Maha Oya and dark yellowish-brown at Handapangoda. The colour of soil at both sites closely matched the colour of beetles, that were metallic brown dorsally with yellow-white maculations. As C. (I.) willeyi is an endemic species with limited distribution and is consequently susceptible to local extinction, it is important that these habitats are identified and protected. At present, 99.5% of its distributional range has declined (Table 6). We believe that the most important conservation priority of a country is the protection of areas which house large numbers of endemic species and communities found nowhere else in the world. This study presents first evidence and importance of Maha Oya (Dehi Owita) and Handapangoda locations, as harbouring the only populations of an endemic species of tiger beetles. In

Journal of Threatened Taxa | www.threatenedtaxa.org | February 2011 | 3(2): 1493-1505

1503

Range change of an endemic tiger beetle

C. Dangalle et al.

view of the current human use of all of these sites and habitats and the development pressures exerted on the wet zone of the country, conservation of these sites are essential for future survival of this species.

REFERENCES Acciavatti, R.E. & D.L. Pearson (1989). The Tiger Beetle Genus Cicindela (Coleoptera, Insecta) from the Indian Subcontinent. Annals of Carnegie Museum No. 58, Pensylvania, 353pp. Bhargav, V.K. & V.P. Uniyal (2008). Communal roosting of tiger beetles (Cicindelidae: Coleoptera) in the Shivalik Hills, Himachal Pradesh, India. Cicindela 40(1-2): 1-12. Bierman, P. (2007). Management Solutions to Soil Limitations. State Master Gardener Conference, Department of Soil, Water and Climate, University of Minnesota, 9pp. Brust, M., W.W. Hoback & C.B. Knisley (2005). Biology, habitat preference, and larval description of Cicindela curtisans Leconte (Coleoptera: Carabidae: Cicindelinae). The Coleopterists Bulletin 59(3): 379-390. Cassola, F. & D.L. Pearson (2000). Global patterns of tiger beetle species richness (Coleoptera: Cicindelidae) their use in conservation planning. Biological Conservation 95: 197-208. Dayawansa, N.D.K. (2008). Assessment of changing pattern of the river course and its impact on adjacent riparian areas highlighting the importance of multi-temporal remotely sensed data. Proceedings of the Asian Conference on Remote Sensing, Colombo, Sri Lanka. Eusebi, M.P., L. Favilli & S. Lovari (1989). Some abiotic factors affecting the activity and habitat choice of the tiger beetle Cephalota circumdata leonschaeferi (Cassola) (Coleoptera, Cicindelidae). Italian Journal of Zoology 56(2): 143-150. Fowler, W.W. (1912). Fauna of British India including Ceylon and Burma (Coleoptera General Introduction and Cicindelidae and Paussidae). Today and Tomorrowâ&#x20AC;&#x2122;s Printers and Publishers, New Delhi, 529pp. Herath, J.W. (1984). Geology and Occurrence of Gems in Sri Lanka. The Journal of the National Science Council of Sri Lanka 12(2): 257-271. Horn, W. (1904). The Cicindelidae of Ceylon. Spolia Zeylanica 2(5): 30-45. Knisley, C.B. & M.S. Fenster (2005). Apparent extinction of the tiger beetle, Cicindela hirticollis abrupta (Coleoptera: Carabidae: Cicindelinae). The Coleopterists Bulletin 59(4): 451-458. Knisley, C.B. & J.M. Hill (1992). Effects of habitat change from ecological succession and human impact on tiger beetles. Virginia Journal of Science 43(1): 133-142. Kritsky, G., L. Horner, S. Reidel & A.J. Savage (1996). The status of some tiger beetles (Coleoptera: Cicindelidae: Cicindela spp.) in Southern Ohio. Ohio Journal of Science 1504

96(1): 29-30. Mao, C. & R. Zheng (2006). Analysis of impacts of dams on ecological environment of river ecosystem, pp. 11351142. In: Berga L., J.M. Boil, E. Bofill, J.C. De Cea, J.A.G. Perez, G. Manueco, J. Polimon, A. Soriano, J. Yague (eds.). Dams and Reservoirs, Societies and Environment in the 21st Century. Taylor & Francis Group, London, 1144pp. McAllister, D.E., J.F. Craig, N. Davidson, S. Delany, & M. Seddon (2001). Biodiversity impacts of large dams. IUCN/ UNEP/WCD Background Paper 1: 12-47. Moorman, F.R. & C.R. Panabokke (1961). Soils of Ceylon: a new approach to the identification and classification of the soils of Ceylon. Tropical Agriculture 117: 4-65. Morgan, M., C.B. Knisley & A.P. Vogler (2000). New taxonomic status of the endangered tiger beetle Cicindela limbata albissima (Coleoptera: Cicindelidae): Evidence from mtDNA. Ecology and Population Biology 93(5): 1108-1115. Naviaux, R. (1984). Coleoptera, Cicindelidae. Les CicindelĂŠs de Sri Lanka. Revue Scientifique Du Bourbonnais 57-80. Nawaratne, C.B. & C.B. Dissanayake (2001). Gold occurrences in Madagascar, South India and Sri Lanka: Significance of a possible Pan-African event. Gondwana Research 4(3): 367-375. Pearson, D.L. & F. Cassola (2005). A quantitative analysis of species descriptions of tiger beetles (Coleoptera: Cicindelidae), from 1758 to 2004, and notes about related developments in biodiversity studies. The Coleopterists Bulletin 59(2): 184-193. Pearson, D.L. & F. Cassola (2007). Are we doomed to repeat history? A model of the past using tiger beetles (Coleoptera: Cicindelidae) and conservation biology to anticipate the future. Journal of Insect Conservation 11: 47-59. Pearson, D.L. & A.P. Vogler (2001). Tiger Beetles: The Diversity, Ecology and Evolution of the Cicindelidae. Cornell University Press, Ithaca, New York, 333pp. Pearson, D.L. (1988). Biology of tiger beetles. Annual Review of Entomology 33: 123-147. Pearson, D.L., C.B. Knisley & C.J. Kazilek (2006). A Field Guide to the Tiger Beetles of the United State and Canada: Identification, Natural History and Distribution of the Cicindelidae. Oxford University Press, Oxford, New York, 227pp. Pearson, D.L. & S.A. Juliano (1993). Evidence for the influence of historical processes in co-occurrence and diversity of tiger beetle species, pp. 194-202. In: Ricklefs, R.E. & D. Schulter (eds.). Species Diversity in Ecological Communities. Chicago University Press, Chicago, USA. Satoh, A. & M. Hori (2004). Interpopulation differences in the mandible size of the coastal tiger beetle Lophyridia angulata associated with different sympatric species. Entomological Science 7: 211-217. Schultz, T.D. (1983). Opportunistic foraging of western kingbirds on aggregations of tiger beetles. Auk 100: 496497. Simon, C., F. Frati, A. Beckenbach, B. Crespi, H. Liu & P.

Journal of Threatened Taxa | www.threatenedtaxa.org | February 2011 | 3(2): 1493-1505

Range change of an endemic tiger beetle

Flock (1994). Evolution, weighting and phylogenetic utility of mitochondrial gene sequences and a compilation of conserved polymerase chain reaction primers. Annals of the Entomological Society of America 87: 651-701. Simmons, T. (2007). Natural Heritage & Endangered Species Program. Division of Fisheries & Wildlife, Westborough¸ MA. Tennent, J.E. (1860). Ceylon: An Account of the Island Physical, Historical and Topographical with Notices of its Natural History, Antiquities and Productions. Longman and Roberts, London, 631pp. Warren, S.D. & R. Buttner (2008). Active military training areas as refugia for disturbance-dependent endangered insects. Journal of Insect Conservation 12: 671-676.

C. Dangalle et al. Author Details: Dr. Chandima Dangalle is a senior lecturer in Zoology. Her expertise lies in the fields of entomology and molecular biology. Her research focuses on collecting baseline data on the distribution and habitat preferences of tiger beetles in Sri Lanka and in evolution and phylogeny of the species. Dr. Dangalle conducted her PhD in the Department of Zoology, University of Colombo, Sri Lanka and Department of Entomology, Natural History Museum, London, United Kingdom. Dr. Nirmalie Pallewatta is a senior lecturer and the current head of the Department of Zoology, University of Colombo, Sri Lanka. A zoologist by training Dr. Pallewatta received her Ph.D. in 1986 from the Imperial College of Science, Technology and Medicine at the University of London, U.K. Dr. Alfried Vogler works on the molecular systematics of Coleoptera. He has a joint position at the Natural History Museum and at Imperial College, London, U.K. Together with PhD students and postdocs, he is currently studying basal relationships of Scarabaeinae and Aphodiinae. He is also interested in the factors determining the composition of dung beetle communities and the effect of species interactions on the evolution of ecomorphological diversity. Acknowledgements: We wish to thank the Department of Wildlife Conservation, Ministry of Environment, Sri Lanka for providing permits necessary for field work and export of specimens. We are grateful to Prof. Nimal Dangalle, Department of Geography, University of Kelaniya, Sri Lanka for his assistance in the preparation of maps and locational lists. This work has been supported by grant number RG/2003/ZOO/01 from the National Science Foundation of Sri Lanka.

Journal of Threatened Taxa | www.threatenedtaxa.org | February 2011 | 3(2): 1493-1505

1505

JoTT Communication

3(2): 1506-1513

Two new species of Chalcididae (Hymenoptera: Chalcidoidea) from India T.C. Narendran 1 & F.R. Khan 2 Systematic Entomology Laboratory, Department of Zoology, University of Calicut, Calicut University P.O., Kerala 673635, India Department of Zoology, Aligarh Muslim University, Aligarh, Uttar Pradesh 202002, India Email: drtcnarendran@yahoo.com (corresponding author) 1 2

Date of publication (online): 26 February 2011 Date of publication (print): 26 February 2011 ISSN 0974-7907 (online) | 0974-7893 (print) Editor: Hui Xiao Manuscript details: Ms # o2469 Received 28 May 2010 Final received 19 January 2011 Finally accepted 31 January 2011 Citation: Narendran, T.C. & F.R. Khan (2011). Two new species of Chalcididae (Hymenoptera: Chalcidoidea) from India. Journal of Threatened Taxa 3(2): 1506-1513. Copyright: © T.C. Narendran & F.R. Khan 2011. Creative Commons Attribution 3.0 Unported License. JoTT allows unrestricted use of this article in any medium for non-profit purposes, reproduction and distribution by providing adequate credit to the authors and the source of publication. Author Details: T.C. Narendran is a visiting professor at the Department of Zoology, University of Calicut, and president, TCN Trust for Animal Taxonomy, Kozhikode. His current activities include the study of taxonomy of Chalcidoidea. F.R. Khan is a research associate at the Aligarh Muslim University. His current activities include research on Encyrtidae. Author Contribution: TCN identified the taxa and described the new species and prepared the paper. FRK collected the taxa. Acknowledgements: The senior author of this paper (TCN) is grateful to the authorities of the University of Calicut and to the present Head of the Department of Zoology (Prof. N. Ramani) in particular for facilities to work. He also thanks Dr. M. Nasser of the same department for cooperation and help. We are grateful to Prof. M. Hayat (Aligarh Muslim University) for giving us the specimens for our study and for kindly reviewing the manuscript. TCN thanks Prof. V.V. Ramamurthy, Division of Entomology, Indian Agricultural Research Institute, New Delhi for making available a copy of the publication of Farooqi et al. 1991. We thank Dr. John S. Noyes of the Natural History Museum, London for critically reviewing this paper.

OPEN ACCESS | FREE DOWNLOAD

1506

Abstract: Two new species of Chalcididae viz. Psilochalcis mathuraensis sp. nov. and Brachymeria neoatteviae sp. nov. are described and compared with similar species. Illustrations of important features are provided. Keywords: Brachymeria, Chalcididae, India, new species, Psilochalcis.

INTRODUCTION The family Chalcididae is economically important because several of its species parasitize agricultural insect pests. While the majority of Chalcididae species are primary parasitoids of Lepidoptera, Diptera and Coleoptera, some are hyperparasitic via Hymenoptera or Diptera primary parasitoids. Several workers have contributed to the taxonomy of Chalcididae, with the most significant contributions being: Oriental fauna: Bouček & Narendran (1981), Mani (1989), Narendran (1989) and Wijesekara (1997); Japanese fauna: Habu (1960); Australasian fauna: (Bouček 1988; Naumann 1986); European fauna: Steffan (1951, 1959, 1976), Nikolskaya (1952, 1960) and Bouček (1952); New world fauna: Burks (1960, 1975, 1979), Delvare & Bouček (1992), and Halstead (1990, 1991). We report here two recently discovered species: a new species of Psilochalcis being the first record from India of the benoisti group of Psilochalcis with strongly projecting roof of clypeus; and a new species of Brachymeria that resembles known Brachymeria such as atteviae Joseph, Narendran and Joy, nephantidis Gahan, and hime Habu in the pattern of hind leg colouration and mesosoma structure, but distinct from all known Brachymeria to justify description.

Abbreviations: AOL - distance between front and hind ocelli; OOL - distance between eye and adjacent hind ocellus; LOL - hind ocellar diameter; POL - distance between hind ocelli; PMV - postmarginal vein; MV - marginal vein; SMV - submarginal vein; STV - stigmal vein length; T1-T6 - gastral tergites 1-6; WIOS - width of interocular space; DZCU - Department of Zoology,University of Calicut; ZDAMU - Department of Zoology,Aligarh Muslim University; INPC - National Pusa Collection of Indian Agricultural Research Institute, New Delhi, India. Journal of Threatened Taxa | www.threatenedtaxa.org | February 2011 | 3(2): 1506-1513

New species of Chalcididae

RESULTS

Psilochalcis Kieffer

Psilochalcis Kieffer, 1905: 49: 250. Type species Psilochalci longigena Kieffer, by monotypy. Leptochalcis Kieffer, 1905: 49: 251.Type species Leptochalcis filicornis Kieffer, by Monotypy (synonymy with Psilochalcis Kieffer by Bouček, 1992) . Euchalcidia Masi, 1929: 6: 209. Type species Euchalcidia elongatula Masi, by monotypy (synonymy with Psilochalcis Kieffer by Bouček 1992). Invreia Masi, 1929: 6: 210. Type species: Invreia subaenea Masi by original designation (synonymy with Psilochalcis Kieffer by Bouček 1992). Parinvreia Steffan, 1951: 6: 7. As subgenus of Invereia Masi. Type Species: Invreia frequens Masi by designation of Bouček (1984) (synonymy with Psilochalcis Kieffer by Bouček 1992). Peltochalcidia Steffan, 1948: 53: 121. Type species Peltochalcidia benoisti Steffan, by original designation (synonymy with Psilochalcis Kieffer by Bouček 1992). Hyperchalcidia Steffan, 1951: 67. Type species Hyperchalcidida soudanensis Steffan; by original designation (synonymy with Psilochalcis Kieffer by Narendran 1989). Chalcidiopsis Masi, 1933: 12: 4. Type-species: Chalcidiopsis odontomera Masi, by monotypy (synonymy with Psilochalcis Kieffer by Narendran & Sudheer 2005). For other synonyms see Noyes (2010). So far only eight species of Psilochalcis are known from India. These are Psilochalcis carinigena (Cameron), P. keralensis Narendran (Narendran, 1989), P. adhara (Narendran, 1989) (from Invreia), P. hayati (Narendran, 1989) (from Invreia), P. crassicornis (Masi, 1929) (from Euchalcididia), P. ghanii (Habu, 1970) (from Invreia) and P. erythropus (Cameron, 1897) (from Halticella). Bouček (1992) revised the generic synonymy of Psilochalcis. Diagnosis: Antennae 13 segmented; in female antennae inserted at clypeus; in male, antennae inserted a little distance above it; scape not reaching anterior ocellus; head in front view roundly triangular or subrectangular as in soudanensis group; outer surface of clypeus gradually turns downwards and its upper edge projects slightly to strongly in different species;

T.C. Narendran & F.R. Khan

body densely setose in some species; mesosoma sturdy, in some species propodeum is almost horizontal with very distinct carinae submediae, accessoriae, sublaterales and costae lateralis; scutellum flatly arched, posteriorly broadly rounded or truncated; hind femur with a ventral row of comb of teeth, basal tooth massive in Chalcidiopsis and typical Psilochalcis. Gaster with large, tongue shaped, posteriorly rounded T1. Hosts: Parasites of lepidopterous pupae. Distribution: North and Central America, Europe, Africa, Madagascar, Oriental region and Japan. Psilochalcis mathuraensis sp. nov. (Figs. 1-5) Material examined Holotype: Female, 30.viii.2007, Nagla Chiranji, Mathura, Uttar Pradesh, India, coll. F.R. Khan (DZCU 1001 (pending transfer to INPC)). Description: Length 3.72mm. Black with following parts as follows; scape, pedicel and F1 pale brownish-yellow; all coxae concolrous with body; remaining leg segments pale brownish-yellow with carinae and ventral comb of teeth of hind femur black; eye and ocellus pale grayish yellow; pubescence white; wings hyaline with veins brown; pilosity of wing disc brown. Head: Width in anterior view subequal to its height; width in dorsal view 1.97x its length; frons with close(interstices narrower than diameter of a pit) umbilicate setigerous pits; interstices ecarinate, smooth and shiny; scrobe not clearly marked from frons, not distinctly reaching front ocellus, weakly cross striate; POL a little over 2x OOL; AOL longer than OOL (8:6); WIOS 2.92x POL; vertex similarly pitted as in frons; occiput concave without a cross carina; area immediately below insertion of antenna reduced into a flat quadrangular plate over mouth so that mandible not visible completely in anterior view, this flat lobe a little convex medially; malar ridge distinct, reaching ventral margin of eyes; distance between lower margin of eye to lower margin of gena 0.78x eye height in profile; genotemporal margin carinate, gena with setigerous pits, interstices smooth and shiny, shorter than diameter of a pit; antennal formula 11083; antenna inserted near mouth; scape not reaching near front ocellus; relative length of antennal segments: scape =

Journal of Threatened Taxa | www.threatenedtaxa.org | February 2011 | 3(2): 1506-1513

1507

New species of Chalcididae

T.C. Narendran & F.R. Khan

1 4 5

Figures 1-5. Psilochalcis mathuraensis sp. nov. Female 1- Head anterior view (with enlaged Clypeal roof); 2 - Head dorsal view; 3 - Antenna; 4 - Part of mesosoma dorsal view; 5 - Hind leg

43; pedicel = 13; F1 = 8; F2 = 9; F3 = 9; F4 = 8; F5 = 7; F6 = 7; F7 = 8; F8 = 6; clava = 13. Mesosoma: Pronotum with widely scattered shallow setigerous pits; interstices much wider than diameter of a pit; pronotum including collum longer and wider than mesoscutum; posterior margin of pronotum with a thick row of short setae; lateral panel of pronotum with a deep close umbilicate pits with interstices carinate, area close to lower margin of panel coriaceous; lateral panel separated from fore coxa by a deep furrow; mesoscutum with widely spaced (with interstices wider than a pit) setigerous pits; scutellum with widely spaced pits with interstices wider than a pit; posterior margin of scutellum rounded; propodium in the anterior two thirds subhorizontal, posterior third more sloping; carinae submediae, accessoriae, sublaterale and costae lateales very distinct; secondary transverse carinae short but distinct, bottom of the areola shiny; carina media lacking; metapleuron with close deep umbilicate setigerous pits; mesopleura with distinct anterior ridge, delimited facies femoralis, with transverse, oblique dorsally horizontal wrinkles; fore coxa subrectangular in side view with four to five oblique carinae; mid coxa with a deep concavity in side view; hind coxa densely pubescent on ventral half; hind femur arched 1.83x as long as wide, smooth with 1508

relatively small pits (smaller than pits of scutellum); pubescence moderately dense, longest hairs 0.5x width of hind tibia; ventral margin with a comb of 3334 teeth; forewing 3.4x as long as wide. Gaster: A little shorter than mesosoma (23:25); dorsally oval, broadest distinctly behind the middle, posteriorly not pointed; T1 exceeding beyond middle, smooth and shiny; ovipositor sheath hardly protruding, not visible from dorsal side. Male: Unknown. Host: Unknown. Etymology: The species name is after the place Mathura from the holotype is collected. Remarks: This new species differs from all other oriental species (Narendran 1989) in having protruded roof like clypeus (a character of benoisti group). It comes near Psilochalcis benoisti (Steffan) in general appearance (especially in having projecting clypeus) but differs from P. benoisti in having: (i) Clypeus with transverse projecting roof with median convex lobe (Fig. 1); (in P. benoisti the clypeal roof simply roundly quadrangular without any median convex part); (ii) Hind femur with ventral comb of 33-34 teeth (in P. benoisti hind femur with ventral comb of 45-50 teeth); and (iii) Hind femur 1.83x as long as wide ( in P. benoisti hind femur 2.25x as long as wide). This new

Journal of Threatened Taxa | www.threatenedtaxa.org | February 2011 | 3(2): 1506-1513

New species of Chalcididae

species differs from Psilochalcis adhera Narendran in having; (i) roof of clypeus much more protruded than that of P. adhera; (ii) T1 smooth and shiny (closely pitted in P. adhera) and (iii) POL 2x OOL (in P. adhera POL 3.6x OOL) Brachymeria Westwood Brachymeria Westwood, in Stephens, 1829: 36. Type species Chalcis minuta Fabricius; designated by Westwood, 1939. Thaumatelia Kirby, 1883: 60. Type species: Chalcis separata Walker, by monotypy (synonymy with Brachymeria Westwood by Halstead 1998 ). Onchochalcis Cameron, 1904: 162. Type species: Oncochalcis marginata Cameron, by monotypy (synonymy with Brachymeria Westwood by Nikolskaya 1960). Holochalcis Kieffer, 1905: 258. Type species: Type species: Holochalcis madagascariensis Kieffer, by subsequent designation of, Gahan, A.B.; Fagan, M.M. (1923), (synonymy with Brachymeria Westwood by Narendran (in Subba Rao, B.R. 1987: 438) Tumidicoxa Girault, 1911[88]: 378. Type species Tumidicoxa nigra Girault; by original designation. (synonymy with Brachymeria Westwood by Girault 1913(158)). Thaumatelia Kirby: 1883: 60.Type species Chalcis separate, by monotypy (synonymy With Brachymeria Westwood by Halstead 1991) Thaumateliana Girault, 1912: 160-161. Type species: Thaumateliana bicolor Girault, by monotypy (synonymy with Thaumatelia Kirby by Narendran & Verghese 1989). Pseudepitelia Girault, 1913[136]: 104. Type species Pseudepitelia rubrifemur Girault, by original designation (synonymy with Brachymeria Westwood by Girault 1915 [245]). Brachypitelia Girault, 1913[136]: 106. Type species Brachypetelia rubripes Girault, by original designation and monotypy (synonymy with Brachymeria Westwood by Girault 1915[245]). Tumidicoxoides Girault, 1913[159]: 86. Type species Tumidicoxoides kurandaensis Girault, by original designation (synonymy with Brachymeria Westwood by Girault 1926[399]). Tumidicoxella Girault, 1913[175]: 74. (as a subgenus of Tumidicoxa); Type species: Tumidicoxa

T.C. Narendran & F.R. Khan

(Tumidicoxella) nigra Giralut.by original designation. Microchalcis Girault, 1915[245]: 328. Type species: Microchalcis atricorpus Girault by original designation (synonymy by Bouček, 1988). Dirrhinomorpha Girault & Dodd, 1915[245]: 327. Type species: Dirrhinomorpha angusta Girault & Dodd, by original designation (synonymy with Brachymeria Westwood and treated as subgenus of Brachymeria by Bouček 1988). Meyeriella Krausse, 1917: 95. Type species: Meyeriella indica Krausse, by monotypy (synonymy with Brachymeria Westwood by Narendran 1986). Neobrachymeria Masi 1929: 196-198 (as a subgenus of Brachymeria); Type species: Brachymeria confalonierii Masi by original designation. Matsumurameria Habu, 1960: 209 (as a subgenus of Brachymeria). Type species: Chalcis taiwanus Matsumura, original designation. Gahanula Burks, 1960: 261. Type species: Brachymeria discreta Gahan, original designation (as a subgenus of Brachymeria). Australochalcis Girault, 1939[457]326. Type species: Australochalcis humilicrus Girault, original designation and monotypy (listed as synonym of Brachymeria Westwood by Bouček 1988). The genus Brachymeria Westwood occurring in the Oriental region was revised first by Joseph, Narendran & Joy (1973), and later Narendran (1989) again revised Oriental Brachymeria in his monograph on ‘Oriental Chalcididae’. Since then, Farooqi et al. (1991), described four new species and two new subspecies of Brachymeria. The new species described by these authors are: Brachymeria kurukshetraensis, B. neomegaspila, B. rossicorporis and B.gauhatiensis. From the descriptions of these species it is clear that Brachymeria kurukshetraensis is a junior synonym of B. albicrus (Klug) (syn. nov.) and that B.neomegaspila is a form of B.megaspila (Cameron, 1991) (syn. nov.). Unadilla (1996) later described Brachymeria encarpae Ubaidillah from Indonesia. Joseph, Narendran and Joy (1973) and Narendran (1989) revised oriental Brachymeria and provided keys. Diagnosis: Head oval in profile; scrobe deep with carinate margins; in some species head with preorbital or postorbital carinae or with both carinae present; malar sulcus carinate or ridged; antennal formula 11171 (clava 1 to 3 segmented). Mesosoma with umbilicate punctures; forewing with PMV usually half or about

Journal of Threatened Taxa | www.threatenedtaxa.org | February 2011 | 3(2): 1506-1513

1509

New species of Chalcididae

T.C. Narendran & F.R. Khan

half as long as MV and usually twice as long as STV. Hind coxa in female in some cases with an inner ventromesal tooth; hind femur with a ventral row of irregular teeth and in some species with an inner basal tooth; hind tibia arcuate; gaster sessile, T1 always the longest; ovipositor sheath slightly compressed slightly exerted; in some species gaster elongate. Biology: The species are mostly primary parasitoids in pupae of holometabolous insects, especially of Lepidoptera but some species attack Diptera, Coleoptera and Hymenoptera. Most species are primary parasitoids. Some are hyperparasitoids attacking Lepidoptera through parasitic Hymenoptera or Diptera. Distribution: World wide. Brachymeria (Brachymeria) neoatteviae sp. nov. (Figs. 6-11) Material examined Holotype: Female, 25.v.2008, Mati Khata, Cooch Bihar, West Bengal, India (DZCU 1002; peding

transfer to INPC). Paratypes: 2 females, 22.v.2008, Khocha Barihat, New Alipurduar, West Bengal, India (DZCU 1003 and DZCU 1004); 1 female, 1 male, 21.xi.2007, Bhanpur, Cuttack, Orissa, India (DZCU 1005), (DZCU 1006); 1 female, 15.xii.2007, Sarbahal, Angul, Orissa, India (DZCU 1007); 2 females, 03-04.xii.2007, Kadurai & Harrajpor, Khorda, Orissa, India (DZCU 1008 and DZCU 1009). All paratypes deposited in DZCU pending transfer to ZDAMU. All specimens collected by F.R. Khan. Description: Length 3.75mm. Black, tegula yellow; coxae black; trochanters black; femora black with apex yellow; hind tibiae yellow with median black band; wings hyaline with veins dark brown; pubescence silvery. Head: As wide as mesosoma (excluding tegulae); width in anterior view 1.3x its height; width in dorsal view 2.12x its length; frons and vertex strongly pitted, pits close or shorter than half diameter of a pit and interstices carinate; scrobe smooth and shiny with slightly rugose at apex; almost reaching front ocellus;

8 7

1510

Figures 6-11. Brachymeria neoattevae sp. nov. 6 - Antenna; 7 - Head side view; 8 - cutellum and axillae dorsal view; 9 - Hind leg; 10 - Forewing veins; 11 - Gaster side view

Journal of Threatened Taxa | www.threatenedtaxa.org | February 2011 | 3(2): 1506-1513

New species of Chalcididae

distance between outer margin of hind ocelli (= width of ocellar area) 0.8x WIOS; POL 4x OOL, 2.7x LOL; AOL longer than LOL; preorbital carina weakly represented; postorbital carina reaching genotemporal margin; area below scrobe with a relatively small smooth area below base of interantennal projection; height of malar space 0.19x height of eye in profile, eye height 1.54x its length in profile; front genal angle acute, hind genal angle a little obtuse; right mandible with two teeth and left mandible with two teeth. Antenna stout; scape not reaching front ocellus, almost equal to combined length of F1 to F4; pedicel a little longer than wide; clava a little over 2x as long as preceding segment; relative L:W of antennal segments; scape = 22:5; pedicel = 5:4; F1 = 6:7; F2 = 5:8 ; F3 = 6:9; F4 = 6:9; F5 = 5:10; F6 = 5:10; F7 = 5:10; clava = 12:10. Mesosoma: Provided with umbilicate pits, interstices carinate and rugose; mesoscutum 1.13x as wide as its length; scutellum well high at base, subperpendicularly declined towards apical part; apical flange slightly emarginated at middle, explanate; dorsal margin of lateral panel of pronotum complete and not interrupted anteriorly; hind coxa on ventral side densely pitted and pubescent, without an inner ventromesal tooth, dorsal side smooth; hind femur 1.62x as long as wide; outer disc rather mat like, pubescent, outer ventral margin with a row of 12 differently sized teeth. Forewing 2.56x as long as broad; relative length of SMV = 66, MV = 31, PMV = 14; STV = 6. Gaster: Shorter than mesosoma; not pointed at apex; T1 smooth and shiny; T2 microsculptured all over with dense pubescence on side; T6 with 6 transverse rows of rugose pits; ovipositor a little visible from dorsal side. Male: Similar to female except for a shorter gaster. Etymology: Named after Brachymeria atteviae Joseph,Narendran & Joy for its superficial resembence to the new species. Remarks: This new species comes very close to Brachymeria atteviae Joseph, Narendran and Joy in general appearance and comes close to Brachymeria atteviae in the key to species by Narendran (1989), but differs from B. attevae in having: (i) gaster shorter than mesosoma (in B atteviae gaster longer than mesosoma); (ii) gaster subrounded and not at all pointed at apex (in B. atteviae gaster pointed and not

T.C. Narendran & F.R. Khan

at all subrounded); (iii) front genal angle acute (in B. atteviae front genal angle nearly rectangular); (iv) area below scrobe with a small smooth shiny area (in B. atteviae no such smooth area below scrobe), and (v) MV 2.33x PMV (in B. atteviae MV 2.67x PMV). This new species may also get confused with Brachymeria nephantidis Gahan and Brachymeria hime Habu since both these two species have somewhat similar colour pattern of hind leg, similar punctures on mesosoma and in the nature of scutellum. However, the new species differs from Brachymeria nephantidis Gahan, in having: (i) base of hind tibia yellow ( in B. nephantidis base of hind tibia black or brown with reddish tinge or pale brownish red); (ii) fore and mid tibia yellow completely (in B. nephantidis fore and hind tibia yellow with black band medially); (iii) MV 2.33x PMV (in B. nephantidis MV more than 4x PMV); (iv) metasoma shorter than mesosoma (in B. nephantidis metasoma longer than mesosoma), and (v) gaster not pointed posteriorly (in B. nephantidis gaster pointed posteriorly). This new species differs from Brachymeria hime Habu in having different colour pattern of fore and mid tibiae and black band of hind tibia much shorter than that of B. hime. Besides front genal angle is acute in the new species where as it is almost rectangular in B. hime. In the new species metasoma is shorter than mesosoma where as metasoma is longer than mesosoma and pointed in B. hime. REFERENCES Bouček, Z. (1952). The first revision of the European species of the family Chalcididae (Hymenoptera). Sborník Entomologického Oddeleni Národního Musea v27 (supplement 1): 1-108+17pls. Bouček, Z. & T.C. Narendran (1981). Indian chalcid wasps (Hymenoptera) of the genus Dirhinus parasitic on synanthropic and other Diptera. Systematic Entomology 6: 229-251 Bouček, Z. (1984). On Schwarzella, Invreia and some other Hybothoracini (Hymenoptera: Chalcididae). Bollettino del Laboratorio di Entomologia Agraria ‘Filippo Silvestri’, Portici 41: 57 Bouček, Z. (1988). Australasian Chalcidoidea (Hymenoptera). A Biosystematic Revision of Genera of Fourteen Families, with A Reclassification of Species. CAB International, Wallingford, Oxon, U.K., Cambrian News Ltd., Aberystwyth, Wales, 832pp. Bouček, Z. (1992). The new world genera of Chalcididae.

Journal of Threatened Taxa | www.threatenedtaxa.org | February 2011 | 3(2): 1506-1513

1511

New species of Chalcididae

T.C. Narendran & F.R. Khan

Memoirs of American Entomological Institute 53: 49-118, 443-446. Burks, B.D. (1960). A revision of the genus Brachymeria Westwood in America north of Mexico (Hymenoptera: Chalcididae). Transactions of the American Entomological Society 86(3): 263 Burks, B.D. (1975). The species of Chalcidoidea described from North America north of Mexico by Francis Walker (Hymenoptera). Bulletin of the British Museum (Natural History) (Entomology) 32(4): 139-170 Burks, B.D. (1979). Torymidae (Agaoninae) and all other families of Chalcidoidea (excluding Encyrtidae), pp. 748749, 768-889, 967-1043. In: Catalog of Hymenoptera in America North of Mexico - 1. Krombein, K.V., P.D. Hurd jr., D.R. Smith, B.D. Burks (eds.). Smithsonian Institute Press, Washington, D.C. Cameron, P. (1904). On some new genera and species of Hymenoptera. Entomologist 37: 162. Farooqi, S.I., T. Husain & S. Ghai (1991). Description of four new species, two new subspecies and new host records of the genus Brachymeria Westwood (Hymenoptera: Chalcididae) from India. Annals of Entomology 9(2): 11-24. Gahan, A.B. & M.M. Fagan (1923). The type species of the genera of Chalcidoidea or Chalcid-flies. Bulletin of the United States National Museum, Washington 124: 72. Girault, A.A. (1911)[88]. Beitrage zur Kenntnis der Hymenopteren fauna von Paraguay auf Grund de Sammlungen und Beobachtungen von Prof. J.D. Anistis. IX New chalcidoid genera and species from Paraguay. Zoologische Jahrbücher, Abteilung für Systematik 31: 378 Girault, A.A. (1913)[158]. On several new genera and species of Australian Hymenoptera Chalcidoidea. Canadian Entomologist 45: 104. Girault, A.A. (1913)[175]. New genera and species of chalcidoid Hymenoptera in the South Australia Museum, Adelaide. Transactions of the Royal Society of South Australia 37: 74. Girault, A.A. (1915)[245]. Australian Hymenoptera Chalcidoidea - XIV. The family Chalcididae with descriptions of new genera and species. Memoirs of the Queensland Museum 4: 314-365. Girault, A.A. (1939)[457]. Five new generic names in the Chalcidoidea (Australia). Ohio Journal of Science 39: 326. Habu, A. (1960). A revision of the Chalcididae (Hymenoptera) of Japan with description of sixteen new species. Bulletin of National Institute of Agricultural Sciences, Tokyo (C) 11: 209. Habu, A. (1970). Description of a new Invreia species parasitic on paddy stem borer in Pakistan (Hymenoptera: Chalcididae). Mushi 43(4): 45-49. Halstead, J.A. (1990). Revision of Hockeria Walker in the Nearctic region with descriptions of males and five new species. Proceedings of the Entomological Society of Washington 92: 619-640. Halstead, J.A. (1991). Thaumatelia Kirby, a generic synonym of Brachymeria Westwood (Hymenoptera: Chalcididae). 1512

Proceedings of the Entomological Society of Washington 93(4): 951-952. Joseph, K.J., T.C. Narendran & P.J. Joy (1973). Oriental Brachymeria (Hymenoptera: Chalcidoidea). Zoological Monograph No. 1: Department of Zoology, University of Calicut publication, 215pp. Kieffer, J.J. (1905). New Eucharinae and Chalcidinae. Berliner Entomologische Zeitschrift 49: 244-265. Kirby, W.F. (1883). Remarks on the genera of the subfamily Chalcidinae, with synonymic notes and descriptions of new species of Leucospidinae and Chalcidinae. Journal of the Linnean Society (Zoology) 17: 60. Krausse, A. (1917). Eine neue südindische chalcididenGattung. Archiv für Naturgeschichte (A) 82(1): 95. Mani, M.S. (1989). The Fauna of India and Adjacent Countries, Chalcidoidea (Hymenoptera. Part I). Agaontidae, Torymidae, Leucospidae, Chalcididae, Eurytomidae, Perilampidae, Eucharitidae, Cleonymidae, Miscogasteridae, Pteromalidae, Eupelmidae and Encyrtidae: Zoological Survey of India, Calcutta, xiv+1067pp. Masi, L. (1929). Contributo alla conoscenza dei Chalcididi Orientali della Sottofaminglia Chalcidinae. Bulletino del Laboratorio di Entomologia del R. istituto Superiore Agrario di Bologna 2: 155-188. Masi, L. (1933). H. Sauters Formosa - Ausbeute. Chalcididae (Hym.). II. Teil. Konowia 12: 4. Narendran, T.C. (1984). Key to Indian genera of the family Chalcididae (Hym.: Chalcidoidea). Entomophaga 29(4) pp. 431-438 Narendran, T.C. (1987). Errata, pp. 438-439. In: Rao, S. & Hayat (eds.). Additions and Corrections to the catalogue of Chalcidoidea (Hymenoptera) of India and Adjacent Countries.Addenta and Errata to Chalcid Catalog, 3pp. Narendran, T.C. (1989). Oriental Chalcididae (Hymenoptera). Zoological Monograph. Department of Zoology, University of Calicut Publication, 440pp. Narendran, T.C. & K. Sudheer (2005). Descriptions of two new species of Antrocephalus Kirby (Hymenoptera: Chalcididae) from Oriental region and notes of the synonymy of a genus and species of Chalcididae. Journal of Ecobiology 17(1): 89-98. Naumann, I.D. (1986). A revision of the Indo-Australian Smicromorphinae (Hymenoptera: Chalcididae). Memoirs of the Queensland Museum 22: 169-187. Nikol’skaya, M.N. (1952). The Chalcid fauna of the USSR (Chalcidoidea) -1593. Originally published in 1952 by Academy of science of USSR (translated from Russian by A. Birron and Z.S.Cole in 1963) Published for National Science Foundation, Washington, D.C. by the Israel programme for scientific translation. Nikol’skaya, M.N. (1960). Hymenoptera 7, 5. Chalcids of fam. Chalcididae and Leucospidae. Fauna SSSR (n.s.) 76: 1-221. Noyes, J.S. (2010). Universal Chalcidoidea data base. http:// www.nhm.ac.uk/entomology.chalcidoidea (Accessed on 2010).

Journal of Threatened Taxa | www.threatenedtaxa.org | February 2011 | 3(2): 1506-1513

New species of Chalcididae

Steffan, J.R. (1948). Deux nouveaux genres d’Haltichellinae (Hym. Chalcididae). Bulletin de la Société Entomologique de France 53: 121. Steffan, J.R. (1951). Les espèces françaises d’Haltichellinae (Hyménoptères Chalcididae). Feuille des Naturalistes 6(1/2): 7. Steffan, J.R. (1959). Revision de la tribu des Cratocentrini (Hymen. Chalcididae). Acta Entomologica Musei Nationalis Pragae 33: 287-325. Steffan, J.R. (1976). Les Euchalcidia Masi du basin méditerranéen (Hym. Chalcididae).Bulletin de la Société Entomologique de France 81(1/2): 52-63. Ubaidillah, R. (1996). A new species of Brachymeria (Hymenoptera: Chalcididae), Parasitic on Cocoa husk borer Crytophlebia encarpa (Lepidoptera: Torticidae) in Malaysia. Bulletin of Entomological Research 86: 481484.

T.C. Narendran & F.R. Khan

Stephens, J.F. (1829). A Systematic Catalogue of British Insects. Baldwin, London, xxxiv+416pp. Westwood, J.O. (1839). Synopsis of the genera of British insects. Order VI. Trichoptera Kirby. Order VII. Hymenoptera Linn. (Piezata Fab.). Introduction to the modern classification of insects founded on the natural habits and corresponding organisation; with observations on the economy and transformations of the different families. 2(XIII) (appendix):49-80 Longman, Orme, Brown, Green, and Longmans, London Wijesekara, G.A.W. (1997). Phylogeny of Chalcididae (Insecta: Hymenoptera) and its congruence with contemporary hierarchical classification. Contributions of the American Entomological Institute 29(3): 61.

Journal of Threatened Taxa | www.threatenedtaxa.org | February 2011 | 3(2): 1506-1513

1513

JoTT Communication

3(2): 1514-1519

Schistura fasciata, a new nemacheiline species (Cypriniformes: Balitoridae) from Manipur, India Y. Lokeshwor 1 & W. Vishwanath 2 Department of Life Sciences, Manipur University, Canchipur, Imphal, Manipur 795003, India Email: lokeyum24@gmail.com 1, wvnath@gmail.com 2 (corresponding author) 1,2

Date of publication (online): 26 February 2011 Date of publication (print): 26 February 2011 ISSN 0974-7907 (online) | 0974-7893 (print) Editor: K. Rema Devi Manuscript details: Ms # o2454 Received 06 May 2010 Final received 10 December 2010 Finally accepted 31 January 2011 Citation: Lokeshwor, Y. & W. Vishwanath (2011). Schistura fasciata, a new nemacheiline species (Cypriniformes: Balitoridae) from Manipur, India. Journal of Threatened Taxa 3(2): 1514-1519. Copyright: ÂŠ Y. Lokeshwor & W. Vishwanath 2011. Creative Commons Attribution 3.0 Unported License. JoTT allows unrestricted use of this article in any medium for non-profit purposes, reproduction and distribution by providing adequate credit to the authors and the source of publication. Author Details: Y. Lokeshwar is a Junior Research Fellow under a project funded by the Ministry of Environment & Forests, New Delhi. He is working on the inventory of the nemacheiline loaches of northeastern India. He is undergoing PhD on a relevant topic in the Department of Life Sciences, Manipur University. W. Vishwanath is a Professor in the Department of Life Sciences, Manipur University. His field of specialization is fish and fisheries. He is presently engaged in taxonomy and systematics of freshwater fishes of northeastern India. Author Contribution: see end of this article. Acknowledgements: We are grateful to the Ministry of Environment & Forests, New Delhi (Project No. 14/11/2006-ERS/RE) for financial assistance and to J. Sylvester, student of Don Bosco College, Maram, Senapati District Manipur for helping in the collection of fishes.

Abstract: A new nemacheiline fish, Schistura fasciata sp. nov. is described here from Barak River (Brahmaputra Drainage) of Manipur, India. The species is characterized by 11-13 dark brown transverse bars on the flank, moderately high adipose crest on dorsal and ventral side of caudal peduncle, three prominent dark spots at the base of dorsal fin, dorsal fin with 8Â˝ branched rays and an incomplete lateral line. Keywords: Barak River, Nemacheilinae, new fish.

Introduction Fishes of the genus Schistura McClelland are small, hill stream fish with medially interrupted lower lip without forming two lateral triangular pads; moderately arched mouth, 2.0-3.5 times wider than long; usually a black bar (sometimes dissociated) on caudal fin base; dorsal fin with one or two black marks along its base (Kottelat 1990; Vishwanath & Laishram 2001). Eight species of the genus Schistura have been described from two major drainages of Manipur, a hilly state in northeastern India, namely, S. manipurensis (Chaudhuri, 1912), S. kangjupkhulensis, S. prashadi, and S. sikmaiensis (Hora, 1921), S. tigrinum (Vishwanath & Nebeshwar, 2005), S. reticulata (Vishwanath & Nebeshwar, 2004), S. khugae (Vishwanath & Shanta, 2004a,b), and S. minutus (Vishwanath & Shantakumar 2005). Collections from the Barak River (Brahmaputra Drainage), draining the western side of Maram Hill, Senapati District, Manipur included specimens of Schistura which do not fit into the hitherto described species of the genus, and is therefore described as a new species, Schistura fasciata.

Material and Methods Fish were collected by electro-fishing technique using a DC battery. Colour in fresh state was noted before fixation and preservation in 10% formalin. Measurements were made point to point with dial calipers to the nearest 0.1mm and expressed as percentages of standard length (SL). Subunits of head are expressed as proportions of the head length. Numbers in parentheses following meristic data indicate number of specimens examined with that count. Counts and measurements were made on the left side of specimens and followed Kottelat (1990). The specimens are deposited in the Manipur University Museum of Fishes (MUMF).

OPEN ACCESS | FREE DOWNLOAD

1514

Journal of Threatened Taxa | www.threatenedtaxa.org | February 2011 | 3(2): 1514-1519

A new nemacheiline fish

Y. Lokeshwor & W. Vishwanath

Image 1. Schistura fasciata sp. nov. a - Side view of Holotype, female, MUMF 11010, 51.5mm SL; b - Paratype, male, MUMF 11020, 68.3mm SL

Schistura fasciata sp. nov. (Image 1 a & b) Material examined Holotype: Female, 21.vi.2009, Barak River at western side of Maram Hill, Senapati District, Manipur (25023’24.66”N & 94004’09.25”E), coll. Y. Lokeshwor, MUMF 11010, 51.5mm SL. Paratypes: 18 females, 37.5-59.9 mm SL, MUMF 11001-11019; 2 males, 59.2-68.3 mm SL, MUMF 11020-11021. Same data as holotype. Diagnosis A species of Schistura with the combination of characters: 11-13 dark brown transverse bars against pale yellow background on the body, bars arranged regularly, often fused on mid-dorsal line, width of bar broader than the interspace width; moderately high adipose crest on dorsal and ventral sides of caudal peduncle; lateral line incomplete, reaching vertical to posterior end of anal fin base; three black spots on base of dorsal fin; head short (12.72-16.41 % SL), dorsal fin with 8½ branched rays; processus dentiformes large. Description Morphometric data are shown in Table 1. Body

small and moderately elongated. Anterior section of the body circular and slightly compressed posteriorly. Head short about 18.6-22.7 %SL, slightly depressed with less inflated cheeks. Male has prominent inflated cheeks (Image 1b). Dorsal adipose crest moderately high extends from posterior extremity of dorsal fin base to caudal origin. Pectoral extends up to half the length of the distance between pectoral and pelvic fin origins. Auxiliary pelvic fin lobe is present; pelvic fin slightly behind the origin of dorsal fin, opposite to the first branched dorsal fin rays. Dorsal fin inserted half way between the origin of pectoral and anal fin. Caudal fin is emarginated. D. 3/ 8½; A. 3/5½; C. 9+8; P. 11; V. 8. Body covered by embedded non-overlapping scales. Lateral line incomplete extends to vertical of the posterior end of anal fin base. Cephalic lateral line system with 10 supraorbital, 4+9 infraorbital, 10 preoperculo-mandibular and three supratemporal pores. Nostril is situated nearer to anterior margin of eye, anterior nostril at the tip of a pointed flap like tube with a deeply notched anterior rim. Mouth moderately arched, upper lip straight with shallow median incision, lower lip with a deep median furrow (Image 2). Strong processus dentiformes present. Inner rostral barbel

Journal of Threatened Taxa | www.threatenedtaxa.org | February 2011 | 3(2): 1514-1519

1515

A new nemacheiline fish

Y. Lokeshwor & W. Vishwanath

Table 1. Morphometric data of Schistura fasciata sp. nov. Holotype MUMF 11010

Paratypes MUMF 11001-21 (N=20)

51.5

49.3 (37.5-68.3) ± 7.4

14.8

14.9 (12.7-16.4) ± 1.2

Mean (Range) ± SD Standard length (mm) % SL Body depth Head depth at supra-occipital

11.9

11.4 (10.2-12.3) ± 0.6

Lateral head length

25.0

23.4 (21.2-25.4) ± 1.1

Dorsal head length

22.7

21.3 (18.6-22.7) ± 1.2

Head depth at eye

10.1

9.7 (8.9-10.8) ± 0.4

Caudal peduncle length

15.2

14.1 (12.3-15.2) ± 0.8

Caudal peduncle height

11.7

12.4 (11.1-13.5) ± 0.6

Pre-dorsal length

52.1

52.5 (49.7-63.7) ± 2.7

Pre-pelvic length

52.0

53.2 (51.1-54.9) ± 1.0

Pre-anus length

72.2

75.1 (72.2-80.3) ± 1.7

Pre-anal length

77.6

78.9 (76.5-80.9) ± 1.1

Dorsal fin height

15.4

13.8 (12.1-15.6) ± 1.1

Pelvic fin length

17.1

15.6 (13.6-17.7) ± 1.0

Anal fin length

16.1

14.2 (12.7-16.1) ± 0.9

Pectoral fin length

19.4

17.3 (14.7-19.4) ± 1.2

Max. head width at cheek

15.7

14.3 (12.6-14.8) ± 0.9

Head width (at nares)

10.7

10.1 (8.4-11.0) ± 1.0

Body width at anal fin origin

6.7

7.2 (6.0-8.4) ± 0.6

Body width at dorsal fin origin

11.6

11.9 (10.5-13.6) ± 0.9

Snout length

45.7

47.6 (40.6-55.5) ± 3.9

Interorbital distance

27.5

28.6 (25.06-34.83) ± 2.5

Eye diameter

19.5

20.2 (17.5-24.0) ± 1.8

Mouth gape width

34.1

36.7 (31.2-45.2) ± 4.1

% HL

shorter than the outer one and reaches half way the distance from the anterior extremities of the body to anterior rim of nostril. The outer rostral barbel reaches the anterior margin of orbit. Maxillary barbel extends to the lower margin of orbit. Head longer than depth of the body, its width at nares is half of its lateral length. Eyes are moderate, dorsal in position and completely invisible from ventral side. Mouth gape is wide and about half of body depth. Intestine is with a small loop just behind stomach (Fig. 1). Sexual dimorphism: Males are with swollen anterior body, triangular head and faintly coloured vertical bars especially visible from the middle of the dorsal fin to the base of the caudal fin whereas females 1516

Image 2. Lips of Schistura fasciata sp. nov.

Figure 1. Intestinal loop of Schistura fasciata sp. nov. Scale bar = 1mm

have well distinct marked vertical bars. The dorsal surface of males is straight horizontally and with a well develop prominent dorsal adipose crest. The anterior dorsal profile of females are well arched and the adipose dorsal crest not prominent as in male. Colouration: In live, body faintly golden to grey with 11 to 13 olivaceous dark brown vertical bars. Colour pattern and number of bars are more or less variable with a unique arrangement. 5-6 bars are on the pre-dorsal, 3 in dorsal and 4-5 bars on the postdorsal. Bars on the pre-dorsal are broader than the posterior ones. They are united mid-dorsally and their inter-bands are wider towards the posterior. All the rays of the dorsal, ventral, pectoral and anal fins are with a row of faintly black elongated marks. A complete dark caudal bar with forward and backward projections present on the base of caudal fin. Three

Journal of Threatened Taxa | www.threatenedtaxa.org | February 2011 | 3(2): 1514-1519

A new nemacheiline fish

Y. Lokeshwor & W. Vishwanath

930E

Nagaland

Rive

Iril R iv

Jir i

Ri ve r

250N

Ba ra kR ive r

Assam

Myanmar

win ind Ch

nip

ur R

ive

Riv

Khug

a Riv

Imph al

Loktak Lake

240N

Mizoram

Figure 2. Map of Manipur showing type locality of Schistura fasciata sp. nov.

940E

prominent black spots on the base of the dorsal fin; respectively extending from simple rays to 1st branched ray, from 3rd to 5th branched rays and from 7th to last branched rays. Distal margin of fins golden. Head dark olivacious dorsally, becoming lighter on sides. In 10% formalin, body becomes lighter with the loss of golden colouration in the interspace of vertical bars and on the distal margin of fins. The olivacious dark brown bars turn to light dark grey colouration. Etymology: The fish has been named after its dark brown bars on body. Latin â&#x20AC;&#x2DC;fasciataâ&#x20AC;&#x2122; = banded. Distribution and Habitat: The species are known only from the type locality, Barak River at the western side of Maram Hill, Senapati District, Manipur (Fig. 2). The fish inhabits the pebbly bottom of large, swift flowing streams (Image 3).

Discussion Schistura fasciata sp. nov. is close to S. khugae, S. tigrinum and S. multifasciatus in colour pattern. But

Image 3. Habitat of Schistura fasciata sp. nov. and electrofishing with locally designed equipment. Journal of Threatened Taxa | www.threatenedtaxa.org | February 2011 | 3(2): 1514-1519

1517

A new nemacheiline fish

Y. Lokeshwor & W. Vishwanath

Key to species of the genus Schistura of Manipur

Lateral line complete ................................................................................................................................ 2 Lateral line incomplete ............................................................................................................................. 4

Lower lip with broad triangular pad ......................................................................................... S. prashadi Lower lip without broad triangular pad ......................................................................................................3

Body with 17-27 bars, reticulated anteriorly ............................................................................ S. reticulata Body with 8-11 bars, not reticulated .................................................................................... S. chindwinica

Branched dorsal fin rays: 8½ ................................................................................................................... 5 Branched dorsal fin rays: 7½ ................................................................................................................... 9

Body with 11-16 bars ................................................................................................................................6 Body with 18-30 bars ................................................................................................................................7

Caudal fin branched rays: 15, bars on body: 10-11, bars wide, interspace: ¼ of the bar width ................ .............................................................................................................................................. S. nagaensis Caudal fin with 17 branched rays, bars on body: 11-16, bars narrow, interspace: ⅔ of the bar width....10

Caudal fin slightly emarginate, bars on body: 18, anal fin with two simple rays ......................... S. minuta Caudal fin forked or deeply emarginate, bars on body: 18-30, anal fin simple rays: 3 ............................ 8

Caudal fin deeply emarginate, bars on body: 18-30, anal fin simple rays: 3 ............................ S. tigrinum Caudal fin forked, bars on body: 17-21, anal fin simple rays: 2 ...........................................S. sikmaiensis

Body with 7-11 regular bars, caudal fin branched rays: 15, no colour spot on fins .....S. kangjupkhulensis Body with 17-21 irregular bars, caudal fin branched rays: 15, dorsal and caudal fins with unevenly arranged spots ..................................................................................................................S. manipurensis

10.

Body with 15-16 bars, a black spot at dorsal fin base, anal fin simple ray: 1 .............................S. khugae Body with 11-13 bars, three black spots at dorsal fin base, Anal fin simple rays three............................... .....................................................................................................................................S. fasciata sp. nov.

it can be distinguished from its congeners in having 11-13 colour bars (vs. 15-30), moderately long caudal peduncle (12.3-15.2) (vs. 12.4-20.0)% of SL, three spots on the base of the dorsal fin (vs. 0-2), moderately long pectoral fin (14.7-19.4) (vs. 15.5-22.7)% of SL, longer pre-anus length 72.2-80.3 (vs. 70.3-75.0)% of SL, moderately high dorsal fin 12.1-15.6 (vs. 11.718.0)% of SL, moderate body depth 12.7-16.4 (vs. 10.0-18.6)% of SL, large eye 17.5-24.0 (vs. 15.120.5)% of HL. Schistura fasciata sp. nov. can be distinguished from S. khugae Vishwanath & Shanta (2004 a,b) of Khuga River (Chindwin Drainage), in having less number of bars on body (11-13 vs. 15-16), three black spots (vs. 2) on dorsal fin base, straight upper lip with median incision (vs. without median incision) and three unbranched simple anal fin rays (vs. 1) and in the extent of lateral line up to posterior end of anal fin (vs. vent or anal fin origin). The new species can easily be distinguished from S. tigrinum Vishwanath & Nebeshwar (2005) of Barak River in having less number of vertical body bar (1113 vs. 17-30), presence of black spots at the dorsal fin base (3 vs. nil) and the number of ventral fin rays (8 vs. 7). 1518

Day (1878) described Nemacheilus multifasciatus (now Schistura) from Darjeeling and Assam. The type in ZSI was examined but found to be in a poor state of preservation and not suitable for comparison. Thus comparison was made based on data of Day (1978) and Menon (1987). Schistura fasciata sp. nov., differs from S. multifasciatus in having three simple dorsal fin rays (vs. 2), 8½ branched dorsal fin rays (vs. 7½), 11 pectoral fin rays (vs.12), three simple anal fin rays (vs. 2), 5½ branched anal fin rays (vs. 5), eight ventral fin rays (vs. 9), 17 branched caudal fin rays (vs. 18) and incomplete lateral line (vs. complete lateral line). The vertical bars in S. fasciata sp. nov. are more or less equal in thickness and fewer in number (11-13) however in S. multifasciatus they are thinner and numerous to the anterior than the posterior and about (18-30). Comparative Materials Schistura tigrinum, holotype, 95.3mm SL, MUMF 4105; 2005, paratypes, 2 specimens, 81.6-86.1 mm SL, Barak River at Khunphung, Tamei subdivison, Tamenglong District, Manipur, India, coll. Nebeshwar Sharma, MUMF 4106/7. Schistura khugae, holotype, 67.0mm SL, MUMF

Journal of Threatened Taxa | www.threatenedtaxa.org | February 2011 | 3(2): 1514-1519

A new nemacheiline fish

5013; 08.iv.2000, 8 specimens, 58.0-96.5 mm SL, Khuga River, Chindwin Drainage, Churachandpur District, Manipur, India, coll. K. Shanta Devi, MUMF 5001-5008. Schistura multifasciatus, holotype, Darjeeling, India, ZSI F2677/1 (poor state of preservation).

Y. Lokeshwor & W. Vishwanath Author Contribution: The study: YL survey, collection, morphometric and anatomic study of nemacheiline fishes of northeastern India and their phylogenetics; WV supervision of taxonomy and phylogeny of freshwater fishes of northeastern India. Current paper: YL detailed examination of the nemacheiline fishes of the Barak and its tributaries in Manipur and comparison with specimens in ZSI, Kolkata and in MUMF. WV supervision in establishing new species and discuss taxonomic status.

References Chaudhuri, B.L. (1912). Description of some new species of freshwater fishes from north India. Records of Indian Museum 7: 437-444. Day, F. (1878). The Fishes of India; Being a Natural History of the Fishes Known to Inhabit the Seas and Fresh Waters of India, Burma, and Ceylon. Bernard Quaritch, London, 778pp+195pls. Hora, S.L. (1921). Fish and fisheries of Manipur with some observations on those of Naga hills. Records of Indian Museum 22: 166-214. Kottelat, M. (1990). Indochinese neamacheilines, A Revision of Nemacheiline loaches (Pisces: Cypriniformes) of Thailand, Burma, Laos, Cambodia and southern Vietnam. Verlag, Dr. Friedrich Pfiel, Munchen, 262pp. Menon, A.G.K. (1987). The Fauna of India and the Adjacent Countries. Pisces, Vol. 4, Teleostei: Cobitoidea, Part I, Homalopteridae. Zoological Survey of India, Calcutta, 259pp+16pls. Vishwanath, W. (2000). Fish Fauna of Manipur. Manipur Association of Science & Society, 143pp. Vishwanath, W. & J. Laishram (2001). Fishes of the subfamily Nemacheiliane Regan (Cyprinidae: Balitoridae) from Manipur. Journal of the Bombay Natural History Society 98(2): 197-216. Vishwanath, W. & K. Nebeshwar (2004). Schistura reticulata, a new species of balitorid loach from Manipur, India with redescription of S. chindwinica. Ichthyological Exploration of Freshwaters 15(4): 323-330. Vishwanath, W. & K. Nebeshwar (2005). A new nemacheiline fish of the genus Schistura McClelland (Cypriniformes: Balitoridae) from Manipur, India. Journal of the Bombay Natural History Society 102(1): 79-82. Vishwanath, W. & K. Shanta (2004a). A new nemacheiline fish of the genus Schistura McClelland (Cypriniformes: Balitoridae) from Manipur, India. Journal of the Bombay Natural History Society 101(1): 138-140. Vishwanath, W. & K. Shanta (2004b). fish of the genus Schistura khugae a new replacement name for S. macrocephalus Vishwanath & Shanta 2004 (Teleostei: Balitoridae). Ichthyological Exploration of Freshwaters 15(4): 330. Vishwanath, W. & M. Shantakumar (2005). A new nemacheiline fish of the genus Schistura McClelland (Cypriniformes: Balitoridae) from Manipur, India. Journal of the Bombay Natural History Society 102(2): 210-213.

Journal of Threatened Taxa | www.threatenedtaxa.org | February 2011 | 3(2): 1514-1519

1519

JoTT Communication

3(2): 1520-1526

Current status of Western Hoolock Gibbon Hoolock hoolock Harlan in West Garo Hills, Meghalaya, India J.P. Sati Zoological Survey of India, Northern Regional Centre, P.O. IIP, Kaulagarh Road, Dehra Dun, Uttarakhand 248195, India Email: jpsatizsi@yahoo.co.in

Date of publication (online): 26 February 2011 Date of publication (print): 26 February 2011 ISSN 0974-7907 (online) | 0974-7893 (print) Editor: Mewa Singh Manuscript details: Ms # o2292 Received 22 August 2009 Final received 26 November 2010 Finally accepted 31 January 2011 Citation: Sati, J.P. (2011). Current status of Western Hoolock Gibbon Hoolock hoolock Harlan in West Garo Hills, Meghalaya, India. Journal of Threatened Taxa 3(2): 1520-1526. Copyright: ÂŠ J.P. Sati 2011. Creative Commons Attribution 3.0 Unported License. JoTT allows unrestricted use of this article in any medium for non-profit purposes, reproduction and distribution by providing adequate credit to the authors and the source of publication. Author Details: J.P. Sati has been working on ecology, behaviour and biology of primates with especial reference to Hoolock Gibbons since the 1980s in the Garo Hills of Meghalaya. Presently, he is working on mammals and birds of this area. He has contributed more than 100 research papers and is a coauthor for three books on wetland birds. Acknowledgements: I am grateful to the Director, Zoological Survey of India, Kolkata for the encouragement throughout the study period. I am thankful to the Officer-in-Charge, Zoological Survey of India, Dehra Dun and Shillong for providing necessary facilities. I am also thankful to the Forest Officials of Meghalaya Governtment for extending various courtesies and help in conducting the field work.

OPEN ACCESS | FREE DOWNLOAD

1520

Abstract: A rapid status survey of Hoolock Gibbon was carried out in 28 localities of West Garo Hills, Meghalaya in March-April 2007. These 28 were among the 32 localities surveyed previously during 1985-1987 by Alfred & Sati (1990). Gibbons were found in only 15 of the 28 localities. Only 25 groups of gibbon totaling 82 individuals were observed, compared to 36 groups with 111 individuals recorded at the same sites 20 years ago. Adults comprised nearly 61% of the total individuals, followed by infants 16%, juveniles 13% and sub-adults 10%. While the proportion in the adult age class had decreased from 67% in 1985-87, the proportion of individuals in all other age classes showed slight increase. The sex ratio of males: females was 1:1 for adults as well as sub-adults, which was the same as in 1985-87 survey. The modal group size was three (44% of groups) as before. However, the next frequent group size was four (28% of groups), whereas previously the second most frequent group size was two (30% of groups). Twenty percent of groups had two individuals and 8% of groups comprised of five individuals. The Hoolock Gibbon population in the West Garo Hills showed a decreasing trend of 26.2% (82 individuals out of 111 individuals) in 28 localities, when compared with the previously documented numbers. The major reasons of their decline are anthropogenic disturbances such as tree felling for domestic and commercial uses; intermittent cutting of new forest patches for fresh jhum cultivation, often resulting into canopy gaps as well as habitat loss; livestock grazing and poaching. Keywords: Current population, decreasing trend, group size, Hoolock Gibbon, status survey, West Garo Hills.

Introduction The Western Hoolock Gibbon Hoolock hoolock Harlan, used to be widely distributed in its range in India, Bangladesh and Myanmar in the recent past (Groves 1972). On the basis of available habitat of 16,250kmÂ˛ in three states of northeastern India, their population was estimated as 78,700 individuals in 24,640 groups. Tilson (1979) estimated 24,500 individuals of Hoolock in 7,650 groups in 3,480km2 of available tropical evergreen forest habitat in Meghalaya. Since then, the total population of Western Hoolock Gibbon in South Asia has drastically dwindled to a meager 3,000 estimated individuals (Walker & Molur 2007). Alfred & Sati (1990) reported a population of 130 individuals in 42 groups from West Garo Hills, Meghalaya. Recently, Gupta & Sharma (2005) recorded 67 individuals in 39 groups from some parts of West Garo Hills, Meghalaya. In recent decades their population has thus decreased sharply primarily due to destruction of their forest habitat. It has been listed as Endangered (EN) by the IUCN (IUCN Red List of Threatened Species 2003) and

Abbreviations: EN - Endangered; IUCN - International Union for Conservation of Nature; CITES - Convention on International Trade in Endangered Species Journal of Threatened Taxa | www.threatenedtaxa.org | February 2011 | 3(2): 1520-1526

Hoolock Gibbon in West Garo Hills

continues to occupy the same threat category at present (Brockelman et al. 2008). It is also on the CITES Appendix I and it is protected under Schedule I of The Wildlife (Protection) Act 1972 (Amended up to 2003) of the Government of India. A status survey of Hoolock Gibbons was undertaken in those localities of West Garo Hills, Meghalaya, where a survey and census was carried out in 1985-1987 by Alfred & Sati (1990). The purpose of this survey was to observe the population trend of this species in those localities after a gap of nearly 20 years.

Study area and methods The present survey was carried out in the West Garo Hills District of Meghalaya covering a total area of 812km2. It is the western most district of the state which links Bangladesh on the south and Assam on the west and north, while the eastern portion connects with east Garo Hills and west Khasi Hills Districts of Meghalaya. It lies between latitude 25-260N & 900E at an elevation of 165-1170 m. The following 28 localities, namely, 1. Jenjalagri, 2. Anogri, 3. Rengsangri, 4. Selbalgri, 5. Gandrak, 6. Misimagri, 7. Bibragri, 8. Rombhagri, 9. Chidekgri, 10. Arbella, 11. Khanthragri, 12. Rombagri, 13. Nakatgri â&#x20AC;&#x201C;E, 14. Agoragri, 15. Megapgri, 16. Manchigri, 17. Chenangpara, 18. Bugonggri, 19. Rongdat, 20. Rongmachuk, 21. Janangpara, 22. Dadenggri, 23. Tura peak, 24. Balpakram National Park, 25. Baghmara Reserve Forest, 26. Siju Wildlife Sanctuary, 27. Mahadeo and 28. Ampatgri were surveyed. The size of the National Park, Wildlife Sanctuary and the Reserve Forest ranged from 61 to 415 km2 while other non protected areas (private lands) ranged from 3.2 to 8.8 km2 (Table 1). Alfred & Sati (1990) have provided detailed information about the study area. The survey was carried out for 14 days in the months of March-April 2007. Two to three localities were covered in a day. The observer would arrive near one of the localities before the territorial call of gibbons began in the morning hours. After locating the group, its size and composition were recorded in the data sheet. The observer would then approach a neighbouring group if its territorial call was heard. The frequency of call duration ranged from 4-32 minutes

J.P. Sati

with an average of 15 minutes a day which is enough to approach the calling group for its population count. Usually the singing is heard in the morning hours and occasionally in the afternoon. At localities where gibbons have disappeared, the possible factors causing their disappearance were assessed through interviews with local villagers and forest officials. Group size and composition were recorded at the time of territorial call of the gibbons or during their movement towards a food tree. The age and sex of the individuals was determined by using the body size, body coat colour, eyebrows and other external characters (Alfred & Sati 1990). The following four age categories were used: (i) infant (0-2 years of age), (ii) juvenile (2-4 years), (iii) sub-adult (4-7 years old) and (iv) adult (>7 years), as established by Alfred & Sati (1990). Due to the time constraints, only 28 of the 32 localities previously surveyed could be covered during this rapid survey. During the present survey, about 8-10 hours were spent using the same trails, tracks, village sacreds and conservation reserves localities.

Results Twenty-five gibbon groups with a total of 82 individuals were found in 15 of the 28 localities surveyed (Table 1, Fig. 1). Their observed absence in the remaining 13 localities (46.4%) (marked with solid triangle in Table 1) was later confirmed by local residents. A solitary individual, a sub-adult female, was encountered only once during the survey. Only six localities had two or more family groups, while the remaining nine localities had one group of gibbons each. Adult males and females (Images 1 & 2) accounted for nearly 61% of the total groups counted, while subadults 10%, juveniles 13% and infants 16% (Image 3) comprised the other age classes. The sex ratio of males: females was 1:1 for adults as well as sub-adults. The infants appeared to be between 3 to 5 months and 1.5 years of age. The mean group size of the current population was observed to be 3.28 (n = 25; range 2-5). Two groups with five individuals, seven groups with four individuals, 11 groups with three individuals and five groups with two individuals were sighted. Nearly 44% of the groups had three individuals, followed by

Journal of Threatened Taxa | www.threatenedtaxa.org | February 2011 | 3(2): 1520-1526

1521

Hoolock Gibbon in West Garo Hills

J.P. Sati

Table1. Current status (2007) of Hoolock Gibbon in Garo Hills, Meghalaya compared with 1985-87 study by Alfred & Sati (1990).

2007

1985-87

2007

1985-87

2007

Total

2007

1985-87

2007

1985-87

2007

1985-87

2007

1985-87

2. Anogri #

2007

▲4.2

1985-87

1. Jenjalagri #

Locality

Area (km2)

Group(s)

▲3.5

3. Rengsangri

4.8

4. Selbalgri

4.5

5. Gandrak #

▲3.2

6. Misimagri #

▲3.5

7. Bibragri #

▲4.3

8. Rombhagri

4.8

9. Chidekgri #

▲4.4

10. Arbella

3.3

11. Khanthragri

4.2

12. Rombagri

4.3

13. Nakatgri –E #

▲4.8

14. Agoragri #

▲3.6

15. Megapgri #

▲4.6

16. Manchigri

3.8

▲4.3

18. Bugonggri

3.7

19. Rongdat #

▲4.6

20. Rongmachuk

4.7

21. Janangpara #

▲4.8

22. Dadenggri #

17. Chenangpara #

▲7.9

23. Tura peak

8..5

? Chokpot

16.3

24. BalpakramNP

180

25. Baghmara RF

415

26. Siju WLS

27. Mahadeo

8.8

?. Kharapara

4.7

?. Nokatgri –W

4.6

28. Ampatgri

4.3

?. Dimapara

13019 = 111

Total %

812

32.3

30.5

32.3

30.5

5.4

4.8

4.6

4.8

10.8

13.6

14.6

15.8

AM - Adult Male; AF - Adult female; SM - Sub-adult male; SF - Sub-adult female; J - Juvenile; I - Infant; * - Solitary individuals; 1985-87 - Alfred & Sati (1990); 2007 - Present survey; ? - Localities could not be surveyed; # - Localities where the gibbons have disappeared; ▲ - Habitat currently degraded.

1522

Journal of Threatened Taxa | www.threatenedtaxa.org | February 2011 | 3(2): 1520-1526

Hoolock Gibbon in West Garo Hills

J.P. Sati 900E

260N

Figure 1. The present sightings of Hoolock Gibbon in West Garo Hills, Meghalaya marked by ( by Alfred & Sati (1990).

) in the locality map plotted

28% with four individuals, 20% with two individuals 87), now five were seen with increased group size Fig.1. The present sightings of Hoolock Gibbon in West Garo Hills, Meghalaya marked by ( ) either with three individuals or more; two were stable; and 8% with five individuals (Table 2). in The results of the present survey indicate that there and three groups have disappeared. the ocality m ap pinlotted by categories Alfred and Sati An(1990). over all decreasing trend was observed when the was an over allldecreasing trend all the age of Hoolock Gibbon between 1985-1987 and 2007 (Fig. population of present survey was compared with that 2). When the percentage of these populations was of 1985-87 (Alfred & Sati 1990). During the present compared with Alfred & Sati (1990), an interesting survey, an increase in the population was observed at trend was observed. Whereas the proportion of adults protected areas like Balphakram National Park, Tura has decreased, the proportion of juveniles and infants Peak Reserve Forest and Arbella Reserve which was has increased. It indicates that the breeding rate of further supported by the records maintained by the these gibbons has not been affected but the rate of State Forest Department Govt. of Meghalaya. The survival and formation of new colonies may have been maximum decrease was reported from the localities with smaller forest patches, ranging from 3.2 to 4.8 severely affected. km2 (either due to habitat degradation or loss of habitat) which was ascertained by local people too (Table 1) (Fig. 2). Discussion The comparison of percent population of juveniles While analyzing the population trend of the present and infants with earlier study brought out an increasing survey with the previous study, it was found that out of trend in their population (Fig. 3). It shows that the eleven groups with two individuals at that time (1985- breeding rate of the existing population has been Journal of Threatened Taxa | www.threatenedtaxa.org | February 2011 | 3(2): 1520-1526

1523

Hoolock Gibbon in West Garo Hills

J.P. Sati

(n=111 for 1985-87 ) and (n=82 for 2007 ) (n = 111 for 1985-87) and (n = 82 for 2007)

45 45 40 40 35 35 30 30 25 25 20 20 15 15 10 10 55 00

(n = 111 for 1985-87) and (n =82 for 2007)

No. of individuals

number of individuals

(n=111 for 1985-87 ) and (n=82 for 2007

30 30

2007

20 20 15 15 10 10

55 Adult Adult male

M ale

Adult Sub-adult Sub-adult Juvenile Adult Sub-adult Sub-adult Juvenile female male female Female M ale Female Age category of individuals

Infant

age category of Individuals Figure 2. Showing population trend of different age classes of Hoolock Gibbon during 1985-87 and 2007

Table 2. Comparison of Hoolock Gibbon group counts in Garo Hills during the 1985-87 study and the present survey. Group size

Frequency *1985-87 **2007

No. of individuals 1985-87 2007

6 5 4 3 2

01 03 04 21 13

Nil 02 07 11 05

06 15 16 63 26

Nil 10 28 33 10

Total

126

* - 1985-87 study by Alfred & Sati (1990); ** - Present Survey (2007)

affected positively, but the groups with two individuals have gone down (Table 1). It seems that the new groups are not being established, probably due to habitat destruction and consequent lack of suitable territories. At the localities (13 numbers), where the gibbons have disappeared, the habitat degradation was very high (15-45% approximately). In these areas the habitat has either been converted to orchards or it is severely degraded. The slash and burn agriculture practice, practiced throughout most of the northeastern India, is also one of the main reasons for habitat loss that directly impacts survival of gibbons. Being arboreal, gibbons are also especially susceptible to predation (by dogs and big cats) and poaching during their long over ground journeys between forest patches (distance between two forest fragments is more than a kilometer or so). This is likely to be an important factor in the decline in their numbers. The major reasons of their depletion are anthropogenic disturbances, habitat loss, hunting and poaching, canopy gaps, livelihood issues, livestock grazing, etc. Molur et al. (2003) point out that gibbons are losing 3-4% of their habitat every year and their population is declining by 1-2% in a year in their distributional range. Mukherjee et al. (2008) 1524

1990

25 25

% individuals individuals %

1990 1990

35 35

Adult Adult male

M ale

Adult Sub-adult Sub-adult Juvenile Adult Sub-adult Sub-adult Juvenile female male female Female M ale Female Age category of individuals age cate gory of individuals

Infant

Figure 3. Showing population trend in percentage of different age classes of Hoolock Gibbon during 1985-87 and 2007

Table 3. Status of forest cover in Meghalaya. Geographical Area 22,429 km2

Forest cover (km2) in the years 1989

1991

1999

2005

15,875

15,920

15,633

16,988

Source: State of Forest Report, 1991, 1999 and 2005, Forest Survey of India, Dehra Dun.

reported that in Garo Hills of Meghalaya, gibbons are localized in small fragmented and discontinuous forests. If these factors continue, the time is not far, when the gibbons will vanish from these 15 localities also. Though the forest cover reports of Forest Survey of India (1991, 1999 and 2005) (Table 3) indicate that there is an over all increase in the forest cover (but not the gibbon habitat), during the recent observations it was found that forest habitat where gibbons live has been destroyed in most areas of the West Garo Hills. Unplanned developmental activities are also a threat to their survival in the wild. In one of the localities (at Misimagri) two young gibbons were reported to have died due to electric shock because of over head electric lines (Sati 2009). A comparison of the observations made during this rapid survey with that of the results of 1985-87 study, it was found that out of 28 localities which were re-surveyed, the gibbons were observed only in 15 localities (53.5%). This indicates that the gibbons have disappeared from remaining 13 localities (46.5%). Among all the gibbonâ&#x20AC;&#x2122;s habitat, the smaller fragments (ranging from 3.2 to 4.8 km2) were found to be more degraded/disappeared due to upcoming of new teagardens, orchards of citreous, betel-nut, cashew-nut, and slash-and-burn/jhum cultivations as compared to the remaining larger sized forests (7.9 to 16.3 and more

Journal of Threatened Taxa | www.threatenedtaxa.org | February 2011 | 3(2): 1520-1526

Hoolock Gibbon in West Garo Hills

J.P. Sati

Image 1. Adult female Hoolock Gibbon

Image 3. Mother Hoolock Gibbon with newly born infant

Image 2. Adult male Hoolock Gibbon

Image 4. A mounting posture in Hoolock Gibbon

than 60km2). Molur et al. (2005) also stated that the isolated forest fragments holding the families of about 2â&#x20AC;&#x201C;4 individuals are insufficient for long-term survival of the western Hoolock Gibbon. To save this species in nature, their habitat must be protected from further degradation and loss. For reviving their population and establishment of new

groups in particular, the corridors between the existing forest patches should be developed by planting tropical semi-deciduous and tropical deciduous tree species such as Grewia desperma, Dalbergia pinnata, Dalbergia assamica, Bauhinia purpurea, Vitex glabata, Artocarpus lakoocha, Ficus benjamina, F. bengalensis, F. concinna, F. pomifera, F. nervosa,

Journal of Threatened Taxa | www.threatenedtaxa.org | February 2011 | 3(2): 1520-1526

1525

Hoolock Gibbon in West Garo Hills

J.P. Sati

F. globella, F. geniculata, Dendrobium bicaneratum, Cephalostachyum latifolium, Dendrocalamus hookerii, etc. References Alfred, J.R.B. & J.P. Sati (1990). Survey and census of the Hoolock Gibbon in West Garo Hills, Northeast India. Primates 31(2): 299-306. Brockelman, W., S. Molur & T. Geissmann (2008). Hoolock hoolock. In: IUCN 2010. IUCN Red List of Threatened Species. Version 2010.4. <www.iucnredlist.org>. Downloaded on 04 February 2011. Groves, C.P. (1972). Systematics and phylogeny of gibbons, pp. 1-89. In: Rumbaugh, D.M. (ed.). Gibbon and Siamang - Vol. I. S. Karger, Basal. Gupta, A.K. & N. Sharma (2005). Conservation of Hoolock Gibbon (Bunopithecus hoolock) in Meghalaya, pp. 87-150. In: Conservation of Hoolock Gibbon in northeastern India. Envis bulletin,WII Envis Bulletin, Wildlife and Protected Areas 8(1), Wildlife Institute of India, Dehra Dun. IUCN (2003). IUCN 2003 Red List of Threatened Species. <http:// www.iucnredlist.org/> Down 20 December 2008. Molur, S., D.B. Jones, W. Dittus, A. Eudey, A. Kumar, M. Singh, M.M. Feroz, M. Chalise, P. Oriya & S. Walker (eds.) (2003). Status of South Asian Primates. 2003: Conservation Assessment and Management Plan (C.A.M.P.) Workshop Report 432pp. Molur, S., S. Walker, A. Islam, P. Miller, C. Srinivasulu, P.O. Nameer, B.A. Daniel and L. Ravikumar (eds.). (2005).

1526

Conservation of Western Hoolock Gibbon (Hoolock hoolock hoolock) in India and Bangladesh: Population and Habitat Viability Assessment (P.H.V.A.) Workshop Report, 2005. Zoo Outreach Organisation/CBSG South Asia, Coimbatore, India, 132pp. Mukherjee, R.P., S. Chaudhuri & A. Murmu (2008). A note on Hoolock Gibbon (Bunopithecus hoolock) in northeast, India. Record Zoological Survey of India 108(1-4): 121123. Sati, J.P. (2009). Death of young Hoolock Gibbons. Zoosâ&#x20AC;&#x2122; Print 24(1): 22. State of Forest Report (1991). Government of India, Ministry of Environment and Forests, Forest Survey of India, Dehra Dun, 70pp. State of Forest Report (1999). Government of India, Ministry of Environment and Forests, Forest Survey of India, Dehra Dun, i-x +1-113pp. State of Forest Report (2005). Government of India, Ministry of Environment and Forests, Forest Survey of India, Dehra Dun, i-xviii+1-171pp. The Wildlife (Protection) Act, 1972 (Amended up to 2003). Wildlife Trust of India, New Delhi. Natraj Publishers, Dehra Dun, 218pp. Tilson, R.L. (1979). Behaviour of Hoolock Gibbon (Hylobates hoolock) during different seasons in Assam. Journal of the Bombay Natural. History Society. 76(1): 1-16. Walker, S. & S. Molur (Comps. & Eds.) (2007). Guide to South Asian Primates for Teachers and Students of All Ages. Zoo Outreach Organisation, PSG South Asia and WILD, Coimbatore, India.

Journal of Threatened Taxa | www.threatenedtaxa.org | February 2011 | 3(2): 1520-1526

JoTT Communication

3(2): 1527-1534

Prevalence of intestinal parasites among captive Asian Elephants Elephas maximus: effect of season, host demography, and management systems in Tamil Nadu, India V. Vanitha1, K. Thiyagesan2 & N. Baskaran3 Postgraduate and Research Department of Zoology and Wildlife Biology, A.V.C. College, Mannampandal, Mayiladuthurai, Tamil Nadu 609305, India. 3 Asian Nature Conservation Foundation, Innovation Centre, Indian Institute of Science, Bengaluru, Karnataka 560012 India. Present address: 1 D.G. Government Arts College (Women), Mayiladuthurai, Tamil Nadu 609001, India. Email: 1 vanithabaskar@rediffmail.com (corresponding author), 2 kthiyagesan1@rediffmail.com, 3 baskar@ces.iisc.ernet.in 1,2

Date of publication (online): 26 February 2011 Date of publication (print): 26 February 2011 ISSN 0974-7907 (online) | 0974-7893 (print) Editor: Heidi S. Riddle Manuscript details: Ms # o2488 Received 21 June 2010 Final received 02 January 2011 Finally accepted 17 January 2011 Citation: Vanitha, V., K. Thiyagesan & N. Baskaran (2011). Prevalence of intestinal parasites among captive Asian Elephants Elephas maximus: effect of season, host demography, and management systems in Tamil Nadu, India. Journal of Threatened Taxa 3(2): 1527-1534. Copyright: ÂŠ V. Vanitha, K. Thiyagesan & N. Baskaran 2011. Creative Commons Attribution 3.0 Unported License. JoTT allows unrestricted use of this article in any medium for non-profit purposes, reproduction and distribution by providing adequate credit to the authors and the source of publication. Author Details & Acknowledgements: see end of this article. Author contribution: VV designed and conducted the present study as a part of her Doctor of Philosophy Research Degree. KT and NB supervised the research work with technical inputs as research advisers.

OPEN ACCESS | FREE DOWNLOAD

Abstract: Maintenance of wild animals in captivity is fraught with numerous challenges, including the control of disease. This study evaluates the effect of season, host demography (age-sex), and differing management systems on the prevalence of intestinal parasites among elephants managed in three captive systems: temple, private, and forest department, in Tamil Nadu. In addition, the study also assessed the availability of veterinary care for elephants in these systems. The parasitic prevalence was evaluated by direct microscopic identification of helminth eggs in faecal samples (n = 115) collected from different age/sex classes of elephants. Of the 115 elephants examined, 37% showed positive results, being infected only with Strongyles sp. The prevalence rate varied significantly across seasons, with the highest rate during summer (49%) followed by monsoon (41%) and the lowest rate during winter (15%). While males had a significantly lower parasite prevalence compared to females (29% vs. 40%), age classes showed no significant difference. Despite the fact that the proportion of animals receiving veterinary care was higher under the forest department system (100%) compared to the private system (26%), parasite prevalence was significantly higher under the former (48%) than the latter (31%) system. The difference in the proportion of animals with parasitic prevalence among the three systems could be due to differing management practices (i.e. in solitary versus groups) and the details are discussed. Keywords: Captive Asian Elephants, forest department, intestinal parasite, management prevalence, private, Temple.

INTRODUCTION Most free-living organisms harbour parasites of several species (Begon & Bowers 1995), which can adversely affect host health, fecundity and foraging, and may also modify host behaviour to facilitate parasite transmission (Wesenberg-Lund 1931; Holmes & Bethel 1972; Moore 1984). Parasitism has been shown to directly affect both the evolution and ecology of hosts through processes such as sexual selection (Hamilton & Zuk 1982) or parasite-mediated competition, which can lead to a reduction in population size, or the extinction of one host (Price et al. 1986). Asian Elephants Elephas maximus are susceptible to gastrointestinal parasitic infection in the wild (Watve 1995; Dharmarajan 2000; Vidya & Sukumar 2002) and in captivity are often confined to small enclosures and/or maintained in isolation (Vanitha 2007) in damp unhygienic conditions that may result in enhanced susceptibility to parasitic disease (Dhungel et al. 1990; Chandrasekaran et al. 1995; Suresh et al. 2001). Tamil Nadu, a southern state of India, manages approximately 150

Journal of Threatened Taxa | www.threatenedtaxa.org | February 2011 | 3(2): 1527-1534

1527

Intestinal parasites in captive Asian Elephants

V. Vanitha et al.

captive elephants under three different management systems: private, temple and forest department (Vanitha 2007; Vanitha et al. 2010). The captive elephants in the temple system are managed with very limited mobility and are used mainly for religious and cultural ceremonies in Hindu temples, while private elephants are used for commercial purposes such as in films and in VIP programmes with extensive travel, in addition to cultural and religious ceremonies in Hindu temples that do not own an elephant. In contrast, captive elephants in the Tamil Nadu forest department are managed mostly in semi-wild conditions at forest camps located in Mudumalai and Anamalai wildlife sanctuaries (presently tiger reserves). While originally used for timber logging, captive elephants under the forest department management are presently used predominantly for ecotourism. Additionally, on a rotational basis, a few elephants from the timber camps are placed by the forest department at the Arignar Anna Zoological Park, Chennai, for education and entertainment (Vanitha et al. 2010). Given the widely differing husbandry conditions in which elephants are managed under the three systems (Vanitha 2007; Vanitha et al. 2008, 2009), it is meaningful to ask whether there is variability in the prevalence of parasites in the different management systems. There have been studies on the prevalence of parasitic infection in captive elephants managed in nature reserves (Arunachalam et al. 2007), zoological gardens (Suresh et al. 2001) and Hindu temples (Saseedran et al. 2003). This paper presents data comparing the occurrence of intestinal parasites among captive elephants in three management systems during various seasons and among various ageâ&#x20AC;&#x201C;sex classes in Tamil Nadu.

MATERIALS AND METHODS Study animals and sampling procedures: Between 2003 and 2005, faecal samples (one/individual) were collected from 115 captive elephants managed by: (i) the Tamil Nadu Forest Department at the elephant camps in Mudumalai and Anamalai wildlife sanctuaries, and Arignar Anna Zoological Park, Vandalur (n = 42), (ii) temples (n = 38: Appendix 1), and (iii) private owners (n = 35: Appendix 2). Dung samples were collected within a few hours of defecation and stored in 10% 1528

formalin. From each dung pile, a representative sample was collected from the outer and inner parts of different boli; parts in contact with soil were avoided. Details of the age and sex of the study animals were recorded by interviewing the mahouts (keepers) as well as by verifying the studbook or register of records. Where proper age records were not available, as in the case of animals caught/rescued from the wild by the forest department or those bought from other states by private and temple authorities, age was estimated by employing the shoulder height method of Sukumar et al. (1988). Considering the diverse climatic conditions that prevail across the study area: the Western Ghats, where the forest department manages most of its captive elephants, and the plains, where the private and temple systems manage their elephants, the year was divided into three seasons - summer, monsoon, and winter and designated according to similarities in climate. For the timber camps of the forest department, the period from February to April was treated as summer, May to November as monsoon, and December to January as winter. In the case of private, temple and Arignar Anna Zoological Park elephants, March to July was classified as summer, August to November as monsoon, and December to February as winter. Parasite prevalence appraisal: The prevalence of intestinal parasites among captive elephants was assessed through coprological analysis using direct microscopic examination, and the sedimentation floatation methods following Watve (1992, 1995), Vidya & Sukumar (2002), and the sedimentation technique standardized by Monson-Bhar & Bell (1982). In the sedimentation floatation method, a known weight of dung sample (in 10% formalin) was strained to remove the coarse debris and the filtrate was centrifuged. The dung that sedimented was dissolved in 10ml of saturated zinc sulphate solution (specific gravity 1.8%) and centrifuged again. In the first centrifugation, nematode eggs sink with the faecal matter. Nevertheless, in the second round they float to the surface due to the high specific gravity of zinc sulphate. Six loopfuls of the solution were removed from the surface using a wire-loop of 5mm diameter and the solution was examined to record presence or absence of eggs. If no eggs were found in a sample, 12 more loopfuls of the solution (six at a time) were scanned for eggs to confirm the absence of parasite infection. In the sedimentation technique (Monson-

Journal of Threatened Taxa | www.threatenedtaxa.org | February 2011 | 3(2): 1527-1534

Intestinal parasites in captive Asian Elephants

Bhar & Bell 1982), a small amount of faecal sample was emulsified with 10ml of water in a centrifuge tube and was centrifuged for two minutes at 3000rpm. The supernatant was poured off carefully and a drop of the sediment was placed on a slide and examined under the microscope. Veterinary care: The availability of professional veterinary care for the elephants in the three management systems was evaluated through a questionnaire survey with the concerned authorities, and also by scrutinizing the register (medical) records of the elephants. Information such as presence or absence of periodic medical check-ups by veterinarians, and the number of medical check-ups per year were obtained for each elephant. Analysis: The prevalence of parasitic infection among captive elephants in three management systems, three seasons, and different sex and age-classes was determined by the presence or absence of data on parasitic infection of individual elephants. Statistical significance for the proportion of elephants infected with parasites out of the total number of individuals examined was tested using the proportion test. A logistic regression analysis using presence or absence of parasites (coded as 1 or 0) at the individual level as the independent variable, and the management system (private, temple, forest department), season (monsoon, summer, winter), age class (calf & juvenile (0-5 yr), sub-adult (5-15 yr), adult (15 yr and above)) and sex (male, female), as dependent variables were coded as 1 to 2 or 3 according to number of categories. Data on the proportion of elephants with periodic medical check-ups in the three management systems was tested using the proportions test.

RESULTS Intestinal parasite prevalence Overall and among seasons: Out of 115 individuals examined for intestinal parasite prevalence, 43 (37%) individuals were found positive (Table 1). All the positive cases were infected only with helminthic parasites (Strongyles sp.). Both eggs and worms of Strongyles sp. were identified from the infected individuals. The eggs were found in all infected cases and worms were found only in one case. The proportion of elephants (43 out of 115) infected

V. Vanitha et al.

Table 1. Number of elephants examined for prevalence of intestinal parasites and the details of individuals infected in different systems and sexes Forest Department

Temple

Private

Overall

Number of individuals examined

115

Number of individuals infected

Number of females examined

Number of males examined

Number of females infected

Number of males infected

Details

with intestinal parasites was significantly lower than uninfected individuals (χ2 = 6.817, df = 1, p = 0.009). Parasite prevalence was significantly different in three seasons (Wald = 9.681, p <0.01) (Table 2), with the highest infection rate found during summer (19 out of 39 or 49%), followed by monsoon (23 out of 61 or 38%), and the lowest infection rate during winter (1 out of 15 or 7%). The rate of infection between monsoon and winter did not vary significantly (B ± SE = 2.089 ± 1.147, Wald = 3.315, p > 0.05), while the infection rate between summer and winter varied statistically (B ± SE = 3.238 ± 1.169, Wald = 7.670, p < 0.01), indicating parasite prevalence was more common during summer. Prevalence among three management systems: The occurrence of intestinal parasites varied significantly among the three management systems (Wald = 8.753, p = 0.01) with the prevalence of parasite infection being higher among captive elephants in the forest department (20 out of 42 or 48%) system than in temple (12 out of 38 or 32%) and private (11 out of 35 or 31%) systems (Table 1). The proportion of infected individuals between the private and forest department systems was not significantly different (B ± SE = -1.300 ± 0.697, Wald = 3.483, p > 0.05) (Table 2), while the infection rate observed between the temple and forest department systems showed a significant difference (B ± SE = - 2.239 ± 0.757, Wald = 8.750, p < 0.01) indicating a higher susceptibility to parasitic diseases for elephants in the forest department system.

Journal of Threatened Taxa | www.threatenedtaxa.org | February 2011 | 3(2): 1527-1534

1529

Intestinal parasites in captive Asian Elephants

V. Vanitha et al.

Table 2. Results of logistic regression analyses carried out to test the significance of intestinal parasite prevalence among systems, seasons, age–classes and between sexes Variables

Coefficient ± SE

Wald

P level

8.753

0.013

Between systems: Private / Forest Department

-1.300 ± 0.697

3.483

0.062

Between systems: Temple / Forest Department

-2.239 ± 0.757

8.750

0.003

9.681

0.008

Between seasons: monsoon / winter

2.089 ± 1.147

3.315

0.069

Between seasons: summer / winter

3.238 ± 1.169

7.670

0.006

1.221

0.543

Between age–classes: calf and juvenile / adult

-0.836 ± 0.922

0.821

0.365

Between age–classes: sub-adult / adult

-0.419 ± 0.590

0.503

0.478

Between sex: female and male

-1.693 ± 0.649

6.811

0.009

Among systems: private (n = 35), temple (n = 38) and forest department (n = 42)

Among seasons: monsoon (n = 61), summer (n = 39) and winter (n = 15)

Among age–classes: calf and juvenile (n = 8), sub-adult (n = 21) and adult (n = 86)

Prevalence between sex and among age–classes: Among the 31 males and 84 females sampled, the prevalence of helminthic infection was significantly higher in females (34 out of 84 or 40%) than in males (9 out of 31 or 29%), (B ± SE = - 1.693 ± 0.649, Wald = 6.811, p < 0.01) (Table 2) suggesting that females are more prone to helminthic infection under captive conditions than males. Among the three major age classes of elephants tested, the prevalence of intestinal parasites was not significantly different (Wald = 1.221, p > 0.05) with 41% individuals in adult class, 29% of individuals in sub–adult class, and 25% of juvenile and calves being infected. Periodic medical care: The data on the veterinary care in the three captive management systems reveal that only one-fourth (26%) of the elephants in the private system, and three-fourths (75%) in the temple system had periodic medical examinations. All the elephants (100%) in the forest department system were checked periodically by veterinarians. A proportions test on the percentage of elephants with periodical medical check-ups in the three systems reveal that the observed difference was statistically significant (Z = -2.54; p < 0.01) indicating that in Tamil Nadu elephants managed in the private system had significantly less access to veterinary care than elephants in the other two systems.

1530

DISCUSSION AND CONCLUSIONS In general, macroparasites (i.e. parasitic species where reproduction usually occurs via transmission of free-living infective stages that passes from one host to the next) aggregate across their host population with most individuals harbouring low number of parasites, but a few individuals play host to higher parasitic burdens (Shaw & Dobson 1995). Such heterogeneity is generated due to variation between individuals in their exposure to infective stages and differences in their susceptibility (Wilson et al. 2002). The intestinal parasite Strongyle sp. was prevalent among 37% of the captive elephants monitored across three management systems in Tamil Nadu during 2003-2005. This parasite infection rate is similar to the prevalence rate of 36% reported for Mudumalai timber camp elephants (Arunachalam et al. 2007), and lower than that reported (majority of the 245 cases) among the captive elephants in Kerala (Chandrasekharan et al. 1995). However, the present estimate was considerably higher than the 10% parasite infection reported for the Guruvayoor Temple elephants (Saseedaran et al. 2004). Such differences among different elephant populations could be attributed to variable treatment levels, husbandry practices, sampling season, and agesex classes. Among the three management systems studied, the parasite prevalence was higher in the captive elephants of the forest department system compared to temple and private systems, while the elephants in the former facility had a higher level of medical attention than

Journal of Threatened Taxa | www.threatenedtaxa.org | February 2011 | 3(2): 1527-1534

Intestinal parasites in captive Asian Elephants

those in the latter two systems. In the forest department system, over 90% of the captive elephants are managed at the timber camps in social groups, sharing the natural habitat of wild elephants which are known to have a high parasite prevalence (Watve 1995; Dharmarajan 2000; Vidya & Sukumar 2002). The social life style, along with the semi-natural environment shared by wild elephants is likely to enhance susceptibility to parasitism from conspecifics both within the system as well as from the wild. In support of this, at the Anamalai timber camp, 14 of the 16 forest department elephants examined for parasites showed positive results. Most of the private and temple elephants are managed in solitary conditions or in small groups, and provided with Astasooranam, a traditional herbal medicine prepared by mahouts, at periodic intervals for digestive ailments (Vanitha 2007). In addition, regular vaccinations and de-worming activities organised by the Tamil Nadu government during the special rejuvenation camps for the temple and private elephants coinciding with this study (2003-2005) may have contributed to the lower prevalence of intestinal parasites among the private and temple elephants. The higher prevalence of helminthic parasite infection during summer and early monsoon could be due to the prevalence of ideal climatic conditions (temperature & humidity) for faster rates of egg hatching and rapid development to the infective stage as reported elsewhere (English 1979), and due to poor hygienic conditions of the resources such as shelter, food and water. Further, the nutritional state of the host is known to affect immuno-competence (Rolston 1992; Lyles & Dobson 1993), and as the rainy season progresses, the increased vegetation growth could reduce nutritional stress and thus improve overall resistance to helminth infection (Dharmarajan et al. 2005). The present study and that from the Nehru Zoological Park, Hyderabad (Suresh et al. 2001) show the prevalence of intestinal parasites was higher in females than males, contradicting the general trend reported for mammals (Poulin 1996; Schalk & Forbes 1997). Such trends among captive elephants could be related to the more social nature of females with frequent physical contacts to various age-sex classes compared to males, and hence more susceptibility to parasitic infection. Besides the above reason, the lesser mobility of female elephants compared to males, observed during the course of grazing in natural

V. Vanitha et al.

habitats at the timber camps in the forest department system (Vanitha 2007), resulted in the same space being more frequently used by females than males. In comparison to free ranging elephants, such a constraint imposed by captivity could also contribute to the higher prevalence of parasitic infection among females. The observed higher (80%) proportion of females with parasitic prevalence at timber camps is in line with the above statement. In general, wildlife medicine has received less interest in India when compared to the western world, and the situation is the same with regard to captive elephant health care (Krishnamurthy & Wemmer 1995; Bist 2002; Vanitha 2007). Lack of clinical facilities with appropriate equipment and financial constraints contribute to inadequate veterinary care in all the captive elephant management systems. The situation is more prominent in private and temple systems, as shown by data on the proportion of elephants receiving veterinary care in the three systems in this study, and elsewhere (Krishnamurthy 1998; Bist et al. 2002; Vanitha 2007). Therefore, due to a lack of exercise, quality and quantity of food, and other appropriate husbandry practices along with inadequately trained veterinary support, elephants in the temple and private systems experience more major health problems (like arthritis, foot rot, skin diseases, overweight and underweight) than the elephants in the forest department system (Vanitha 2007), and this needs immediate redressal. Overall, the study shows that the prevalence of intestinal parasites is higher (i) in cases of captive elephants managed by the forest department in social groups within natural habitats shared with wild conspecifics than those solitarily managed in private and temple facilities, (ii) during summer and monsoon when compared to the winter season, and (iii) among females than males. Therefore, the study suggests more frequent diagnosis and deworming for the forest department captive elephants, especially those managed at the timber camps of Mudumalai and Anamalai wildlife sanctuaries, during summer and monsoon seasons.

REFERENCES Arunachalam, K., M. Raman & T.J. Harikrishnan (2007). Incidence of helminth ova in Indian elephants Elephas

Journal of Threatened Taxa | www.threatenedtaxa.org | February 2011 | 3(2): 1527-1534

1531

Intestinal parasites in captive Asian Elephants

V. Vanitha et al.

Appendix 1. List of temple elephants from different places of Tamil Nadu examined for intestinal parasites

Appendix 2. List of private elephants from different places of Tamil Nadu examined for intestinal parasites Elephant name

Place/District

Ambika+

Swamimalai, Thanjavur

Thirukkadaiyur, Nagapattinam

Ammukutti

Srirangam, Tiruchirapplli

Azhagar Koil, Madurai

Beham

Madurai

Srirangam, Tiruchirapplli

Eswari

Srirangam, Tiruchirapplli

Madurai

Faseela

Srirangam, Tiruchirapplli

Fathima

Nagur, Nagapattinam

Elephant name

Place and District

Abaiyambal

Mayiladuthurai, Nagapattinam

Abirami+

Andal

Ankaiyarkanni

Athinayagi

Alwarthirunagari, Tuticorin

Avai

Thiruperunkundram, Madurai

Geethavalli

Peraiyur, Madurai

Gulabhi

Kumbakonam, Thanjavur

Bavani

Rameswaram

Boomadevi

Uppiliappan Koil, Thanjavur

Gulebahawali

Venkatachalapuram, Madurai

Chooligambal

Thirupugalur, Thiruvarur

Indra

Palani, Dindugul

Dharmambal

Thiruvaiyaru, Thanjavur

Jaini

Kadayanallur, Madurai

Durga

Swamimalai, Thanjavur

Jothi

Tuticorin

Gomathi

Thiruvidaimaruthur, Thanjavur

Kamala

Kalyani

Perur, Coimbatore

Kushma

Madurai

Lakini

Padavedu, Tiruvannamalai

Samayapuram, Tiruchirapplli

Kasturi

Palani, Dindugul

Kothai

Sriperumpathur, Kanchipuram

Lakshmi

Coimbatore

Lakshmi+

Palani, Dindugul

Kumuthavalli

Thirukkolur, Tuticorin

Kurunkudinachiyar

Thirukurunkudi, Tirunelveli

Lakshmi+

Salem

Lakshmi

Rettai Thirupathi, Tuticorin

Lakshmi+

Madurai

Lakshmi+

Malaikottai, Tiruchirappalli

Lakshmi Priya

Madurai

Maduravalli

Madurai

Malolan

Tambaram, Kanchipuram

Mangalam

Kumbakaonam, Thanjavore

Meenakchi

Samayapuram, Tiruchirapplli

Mohan Prasad

Thiruverkadu, Thiruvallur

Nalan

Perungulam, Tuticorin

Periyanayagi

Vaitheswaran Koil, Nagapattinam

Madurai

Prasanna

Chennai

Salem

Seetha

Thallakulam, Madurai

Kodumudi, Erode +

Thirvidaimaruthur, Thanjavur

Mariyappam

Masiniyamma

Muthulakshmi

Parvathy

Rajeswari

Rowthilakshmi

Peraiyur, Madurai

Shiyamala+

Swamimalai, Kumbakonam

Rukku

Thiruvannamalai

Sita

Srirangam, Tiruchirappalli

Sengamma

Mannargudi, Thiruvarur

Sulochana+

Viruthunagar

Shanthi

Thiruchendur, Tuticorin

Suma

Srirangam, Tiruchirappalli

Sivakami+

Tiruppattur, Sivaganga

Sumathi

Venkatachalapuram, Madurai

Sornavalli

Kalaiyar Koil, Sivaganga

Sumithra

Samayapuram, Tiruchirapplli

Subbulakshmi

Kundrakudi, Sivaganga

Thulari

Madurai

Sumathi

Vijayan

Samayapuram, Tiruchirapplli

Valli

Vedanayagi

Vellaiyammal

+ +

Palani, Dindugul

Thiruthani, Thiruvallur

Dharmapuram, Nagapattinam

indicates infected individual

Bhavani, Erode +

Thanjavur

indicates infected individual

1532

Journal of Threatened Taxa | www.threatenedtaxa.org | February 2011 | 3(2): 1527-1534

Intestinal parasites in captive Asian Elephants

maximus at Theppakadu Nilgiris, Tamil Nadu. Zoos’ Print Journal 22(11): 2898–2899. Begon, M. & R.G. Bowers (1995). Beyond host-pathogen dynamics, pp. 478-509. In: Grenfell, B.T. & A.P. Dobson, (eds.). Ecology of Infectious Diseases in Natural Populations. Cambridge, Cambridge University Press. Bist, S.S. (2002). An overview of elephant conservation in India. Indian Forester 128(2): 121-136. Bist, S.S., J.V. Cheeran, S. Choudhury, P. Barua & M.K. Misra (2002). The domesticated Asian Elephants in India, pp. 129-148. In: Giant in our Hands. Proceedings of the International workshop on the domesticated Asian Elephants. Bangkok, Thailand, February 2001. Chandrasekharan, K., K. Radhakrishnan, J.V. Cheeran, K.N. Muraleedharan & T. Prabhakaran (1995). Review of the incidence, ecology and control of common diseases of Asian Elephants with special reference to Kerala, pp. 439–449. In: Daniel, J.C. & H.S. Datye (eds.). A Week with Elephants: Proceedings of the International Seminar on the Conservation of Asian Elephant. June 1993; Oxford University Press, Oxford. Dharmarajan, G. (2000). Epidemiology in wild and domestic herbivores at the Mudumalai Wildlife Sanctuary, Tamil Nadu. M.V.Sc Thesis submitted to Tamil Nadu University of Veterinary and Animal Sciences, Chennai, Tamil Nadu, 75pp. Dharmarajan, G., M. Raman & M.C. John (2005). Effect of season on helminth loads of wild herbivores and cattle in the Mudumalai Wildlife Sanctuary, southern India. Zoos’ Print Journal 20(2): 1766-1769. Dhungel, S., C. Browner & S. Yoder (1990). Elephant training and management in Nepal. Tigerpaper 17:1-6. English, A.W. (1979). The epidemiology of equine Strongylosis in southern Queensland 1. The Bionomics of the Free-Living Stages in Faeces and on Pasture. Australian Veterinary Journal 55(7): 299-305. Hamilton, D.G. & M. Zuk (1982). Heritable true fitness and bright birds: a role for parasites? Science 218: 384-387. Holmes, J.C. & W.M. Bethel (1972). Modification of intermediate host behaviour by parasites. Zoological Jounral of the Linnean Society supplemnt 1: 123-149 Krishnamurthy, V. (1998). Captive elephant management in India under different systems: Present trends. Zoos’ Print 13: 1-4. Krishnamurthy, V. & C. Wemmer (1995). Veterinary care of Asian timber elephants: Historical accounts and current observations. Zoo Biology 14: 123-133. Lyles, A.M. & A.B. Dobson (1993). Infectious disease and intensive management: population dynamics, threatened hosts and their parasites. Journal of Zoo Wildlife Medicine 24: 315–326. Monson–Bhar, P.E.C. & D.R. Bell (1982). Manson’s Tropical Diseases. English language book society/Bailliere, Tindall, London, xvii+1557pp. Moore, J. (1984). Parasites that change the behaviour of the hosts. Scientific American 250: 108–115.

V. Vanitha et al.

Price, P.W., M. Westoby, B. Rice, P.R. Atsatt, R.S. Fritz & J.N. Thomson (1986). Parasite mediation in ecological interaction. Annual Review of Ecology and Systematics 17: 487-505. Poulin, R. (1996). Sexual inequalities in helminthic infections: a cost of being male? American Naturalist 147: 287-295. Rolston, H. (1992). Ethical responsibilities towards wildlife. Journal of American Veterinary Association 200: 618-622. Saseedran, P.C., S. Rajendran, H. Subramanian, M. Sasikumar, G. Vivek & K.S. Anil (2003). Incidence of helminthic infection among annually de-wormed captive elephants. Zoos’ Print Journal 19(3): 1422. Schalk, G. & M.R. Forbes (1997). Male biases of parasitism in mammals: effects of study type, host age and parasite taxon. Oikos 78: 67-74. Shaw, D.J. & A.P. Dobson (1995). Patterns of macro-parasite abundance and aggregation in wildlife populations: a quantitative review. Parasitology 111: 111-133. Sukumar, R., N.V. Joshi & V. Krishnamurthy (1988). Growth in the Asian Elephants. Proceeding of the Indian Academy of Science. (Animal Science) 97(6): 561-571. Suresh, K.P., C. Choudhuri, K. Nalini Kumari, Md. Hafeez & P.A. Hamza (2001). Epidemiological and clinicotherapeutic studies of strongylosis in elephants. Zoos’ Print Journal 16(7): 539-540. Vanitha, V. (2007). Studies on the status and management of captive Asian Elephants (Elephas maximus) at Tamil Nadu in southern India. PhD Thesis. Bharathidasan University, Tiruchirapalli, India, 130+xpp. Vanitha, V., K. Thiyagesan & N. Baskaran (2008). Food and feeding of captive Asian Elephants (Elephas maximus) in the three management facilities at Tamil Nadu, south India. Journal of Scientific Transactions in Environment and Technovation 2(2): 87–97. Vanitha, V., K. Thiyagesan & N. Baskaran (2009). Socioeconomic status of elephant keepers and human–captive elephant conflict: A case study from three management systems from Tamil Nadu, southern India. Gajah 30: 8–12. Vanitha, V., K. Thiyagesan & N. Baskaran (2010). Demography of captive Asian Elephants (Elephas maximus) in three management systems in Tamil Nadu, India. Journal of the Bombay Natural History Society 107(1): 30-37. Vidya, T.N.C. & R. Sukumar (2002). The effect of some ecological factors on the intestinal parasite loads of the Asian Elephant (Elephas maximus) in southern India. Journal of Bioscience 27: 521–528. Watve, M.G. (1992). Ecology of host-parasite interactions in wild mammalian host community in Mudumalai, southern India. PhD Thesis. Indian Institute of Science, Bangalore, India. Watve, M.G. (1995). Helminthes parasites of elephant’s ecological aspects, pp. 289-295. In: Daniel, J.C. & H.S. Daty (eds.). A week with elephants: Proceedings of the International Seminar on the Conservation of Asian Elephants. June 1993; Oxford University Press, New Delhi.

Journal of Threatened Taxa | www.threatenedtaxa.org | February 2011 | 3(2): 1527-1534

1533

Intestinal parasites in captive Asian Elephants

V. Vanitha et al.

Wesenberg–Lund, C. (1931). Contributions to the development of the Trematoda Digenea. Part I. The biology of the Leucochloridium paradoxum. Kongelige Danske Videnskabernes Biology Selskab 4: 89–142. Wilson, K., O.N. Bjornstad, A.P. Dobson, S. Merler, G. Poglayen, S.E. Randolph, A.F. Read & A. Skorping (2002). Heterogeneities in macro-parasite infections: patterns and processes, pp. 6-44. In: Hudson, P.J., A. Rizzoli, B.T. Grenfell, H. Heesterbeek & A.P. Dobson (eds.). The Ecology of Wildlife Diseases. Oxford University Press, New York, United States, xii+197pp.

Author detail: Dr. V. Vanitha is presently an assistant professor in zoology. She obtained her PhD in 2008 for the study on ‘Status and management of captive Asian Elephants in Tamil Nadu, India from Bharathidasan University, Tiruchirapalli. Dr. K. Thiyagesan is an associate professor, working on ornithology and is the research adviser to number of PhD students. Dr. N. Baskaran is a scientist at the Asian Elephant Research and Conservation Centre, working on wild Asian Elephants across Eastern, and Western Ghats and Eastern Himalaya for more than two decades. His research interest includes behavioural ecology of various mammalian fauna, and assessment of population, habitats, biodiversity and impact of development activities. Acknowledgements: We thank the Tamil Nadu Forest Department, Hindu Religious Endowment Charity and private elephant owners for permitting this study and providing access to the register of records maintained for the captive elephants. We also thank AVC College for providing laboratory for analyzing the dung samples. We acknowledge the critical comments and inputs by Dr. Guha Dharmarajan, Purdue University, Indiana, U.S.A. and Susan Mikota, DVM, Elephant Care International, Hohenwald, TN, U.S.A. that shaped this manuscript significantly.

1534

Journal of Threatened Taxa | www.threatenedtaxa.org | February 2011 | 3(2): 1527-1534

JoTT Short Communication

3(2): 1535-1541

Faunal diversity of rotifers (Rotifera: Eurotatoria) of Nokrek Biosphere Reserve, Meghalaya, India B.K. Sharma 1 & Sumita Sharma 2 Freshwater Biology Laboratory, Department of Zoology, North-Eastern Hill University, Permanent Campus, Shillong, Meghalaya 793022, India 2 North Eastern Regional Centre, Zoological Survey of India, Risa Colony, Fruit Gardens, Shillong, Meghalaya 793003, India Email: 1 profbksharma@gmail.com (corresponding author), 2 sumitasharma.nehu@gmail.com 1

Abstract: Plankton samples collected from the Nokrek Biosphere Reserve of Meghalaya (Northeast India) revealed 70 species of Rotifera belonging to 24 genera and 15 families. Eight species are new records from the state of Meghalaya. The Oriental Lecane blachei and the palaeotropical L. unguitata are biogeographically interesting elements. The Rotifera taxocoenosis of Nokrek Biosphere Reserve is characterized by a distinct richness of the ‘tropic-centered’ genus Lecane, paucity of Brachionus species, greater diversity of littoral-periphytonic elements and a general ‘tropical’ character with cosmopolitan (71.4%) > tropicopolitan (17.1 %) species. Keywords: Faunal diversity, India, Nokrek Biosphere Reserve, Rotifera.

Rotifera or ‘Rotatoria’ comprise an important group of freshwater invertebrate as well as an integral component of aquatic food-webs. Taxonomic studies on Rotifera from India began more than one century ago (review by Sharma 1998a). Sharma & Sharma

Date of publication (online): 26 February 2011 Date of publication (print): 26 February 2011 ISSN 0974-7907 (online) | 0974-7893 (print) Editor: Hendrik Segers Manuscript details: Ms # o2527 Received 26 July 2010 Final received 15 December 2010 Finally accepted 28 December 2010 Citation: Sharma, B.K. & S. Sharma (2011). Faunal diversity of rotifers (Rotifera: Eurotatoria) of Nokrek Biosphere Reserve, Meghalaya, India. Journal of Threatened Taxa 3(2): 1535-1541. Copyright: © B.K. Sharma & Sumita Sharma 2011. Creative Commons Attribution 3.0 Unported License. JoTT allows unrestricted use of this article in any medium for non-profit purposes, reproduction and distribution by providing adequate credit to the authors and the source of publication. Acknowledgements: This study is undertaken under the “University with Potential for Excellence Program (Focused Area: Biosciences)” of NorthEastern Hill University, Shillong. Thanks are due to the Head, Department of Zoology, North-Eastern Hill University, Shillong for laboratory facilities. One of the authors (SS) is also thankful to the Director, Zoological Survey of India and the Officer-in-charge, North Eastern Regional Centre, Zoological Survey of India, Shillong. Finally, the permission granted by the Conservator of Forests, Meghalaya is sincerely acknowledged. The authors are thankful to one reviewer for valuable suggestions. OPEN ACCESS | FREE DOWNLOAD

(2005a, 2008) analyzed the progress in studies in the northeastern India region. The Indian literature shows a paucity of works on the faunal diversity of phylum Rotifera from aquatic biotopes of conservation areas of India in particular. The relevant works from northeastern India are limited to studies from the Pobitra Wildlife Sanctuary of Assam (Sharma 2006) and two Ramsar sites, namely Deepor Beel (Sharma & Sharma 2005b) and Loktak Lake (Sharma 2009). On the other hand, Rotifera inhabiting water bodies of various biosphere reserves of this region are yet to be examined. The present study on the faunal diversity of rotifers of the Nokrek Biosphere Reserve Meghalaya, hence, assumes special importance in view of the stated lacunae. Various species examined from this biodiversity hotspot are listed. Comments are made on the nature and composition of the rotifer fauna and on the distribution of interesting species. Materials and Methods Study site: The Nokrek Biosphere Reserve (25020’0 25 29’N & 90013’-90035’E) spreads (Fig. 1) over parts of West, East and South Garo Hills districts of the state of Meghalaya. It was declared as a national park in 1997 (47.48km2) and was designated as biosphere reserve (82.0km2) in May 2009. It abounds in various wildlife including elephants, Western Hoolock Gibbon, rare varieties of birds and pheasants, beside rare orchids. It is also a national citrus gene sanctuary to a very rare endemic species of Citrus indica which the locals call memang narang (‘orange of the spirits’). Methods of study: One-hundred-and-ten plankton samples were collected from different water bodies of the Nokrek Biosphere Reserve in July and September 2009, and January 2010, with a nylobolt plankton net (mesh 25µm) and were preserved in 5% formalin. All the samples were screened with a Wild

Journal of Threatened Taxa | www.threatenedtaxa.org | February 2011 | 3(2): 1535-1541

1535

Rotifers of Nokrek

B.K. Sharma & S. Sharma

Figure 1. District map of Meghalaya showing location of Nokrek (inset map of India showing locationof Meghalaya State)

stereoscopic binocular microscope and the rotifer taxa were isolated. Permanent slides of different species mounted in Polyvinyl-alcohol lactophenol mixture and deposited in the holdings of the senior author (BKS) were examined with Leica DM 1000 image analyzer. In addition, specimens in the holdings of NERC, ZSI, Shillong were examined by one of the authors (SS). Rotifera species were identified following the works of Koste (1978), Sharma (1998b), Segers (1995), and Sharma & Sharma (1999, 2000, 2008). The system of classification of the Rotifera followed in this account is after Segers (2002). Systematic list of the examined species Phylum: Rotifera Class: Eurotatoria Subclass: Monogononta Order: Ploima Family: Brachionidae 1. Anuraeopsis fissa Gosse, 1851 2. A. navicula Rousselet, 1911 3. Brachionus angularis Gosse, 1851 4. B. bidentatus Anderson, 1889 5. B. calyciflorus Pallas, 1766 1536

6. B. falcatus Zacharias, 1898 7. B. mirabilis Daday, 1897 * 8. B. quadridentatus Hermann, 1783 9. Keratella tropica (Apstein, 1907) 10. Platyias quadricornis (Ehrenberg, 1832) 11. Plationus patulus (O.F. Muller, 1786) P. patulus macracanthus (Daday, 1905) Euchlanidae 12. Euchlanis dilatata Ehrenberg, 1832 13. Dipleuchlanis propatula (Gosse, 1886) 14. Tripleuchlanis plicata (Levander, 1894)* 15. Beauchampiella eudactylota (Gosse, 1886) Mytilinidae 16. Lophocharis salpina (Ehrenberg, 1834) 17. Mytilina bisulcata (Lucks, 1912) 18. M. ventralis (Ehrenberg, 1830) Trichotriidae 19. Trichotria tetractis (Ehrenberg, 1830)

Lepadellidae 20. Colurella obtusa (Gosse, 1886) 21. C. sulcata (Stenroos, 1898) 22. C. uncinata (O.F. Muller, 1773) 23. Lepadella minuta (Weber & Montet, 1918)

Journal of Threatened Taxa | www.threatenedtaxa.org | February 2011 | 3(2): 1535-1541

Rotifers of Nokrek

24. L. ovalis (O.F. Muller, 1786) 25. L. patella (O.F. Muller, 1773) 26. L. rhomboides (Gosse, 1886) Lecanidae 27. Lecane aculeata (Jakubski, 1912) 28. L. arcula Harring, 1914* 29. L. crepida Harring, 1914 30. L. curvicornis (Murray, 1913) 31. L. haliclysta Harring & Myers, 1926 32. L. hornemanni (Ehrenberg, 1834) 33. L. inermis (Bryce, 1892) 34. L. leontina (Turner, 1892) 35. L. ludwigii (Eckstein, 1883) 36. L. luna (O.F. M端ller, 1776) 37. L. papuana (Murray, 1913) 38. L. nitida (Murray, 1913) 39. L. signifera (Jennings, 1896) 40. L. ungulata (Gosse, 1887) 41. L. blachei Berzins, 1973* 42. L. bulla (Gosse, 1851) 43. L. closterocerca (Schmarda, 1859) 44. L. hamata (Stokes, 1896) 45. L. furcata (Murray, 1913) 46. L. lunaris (Ehrenberg, 1832) 47. L. monostyla (Daday, 1897) 48. L. quadridentata (Ehrenberg, 1830) 49. L. stenroosi (Meissner, 1908) 50. L. unguitata (Fadeev, 1925) Notommatidae 51. Cephalodella forficula (Ehrenberg, 1830) 52. C. gibba (Ehrenberg, 1830) 53. C. mucronata Myers, 1924 54. Monommata longiseta (O.F. M端ller, 1786) 55. M. maculata Harring & Myers, 1930 Scaridiidae 56. Scaridium longicaudum (O.F. M端ller, 1786) Trichocercidae 57. Trichocerca insignis (Herrick, 1885) 58. T. pusilla (Jennings, 1903) 59. T. similis (Wierzejski, 1893) Synchaetidae 60. Polyarthra vulgaris Carlin, 1943 Dicranophoridae 61. Dicranophorus forcipatus (O.F. M端ller, 1786) Flosculariaceae Floscularidae 62. Sinantherina socialis (Linne, 1758)* 63. S. spinosa (Thorpe, 1893)*

B.K. Sharma & S. Sharma

Conochilidae 64. Conochilus unicornis Rousselet, 1892 Testudinellidae 65. Testudinella emarginula (Stenroos, 1898) 66. T. parva (Ternetz, 1892) 67. T. patina (Hermann, 1783) Digononta Bdelloidea Philodinidae 68. Philodina citrina Ehrenberg, 1832* 69. Rotaria macroceros (Gosse, 1851)* 70. R. neptunia (Ehrenberg, 1830) * New records from Meghalaya

Discussion This pioneering study on aquatic biodiversity of the Nokrek Biosphere Reserve records 70 species of Rotifera. Eight species namely Brachionus mirabilis, Tripleuchlanis plicata, Lecane arcula, L. blachei, Sinantherina socialis, S. spinosa, Philodina citrina and Rotaria macroceros are new records from the state of Meghalaya. The present report raises the number of rotifer species known from Meghalaya (vide Sharma & Sharma 1999) to 138 species. In addition, a couple of new species await description. The richness, in turn, comprises 31.7% of the species known from northeastern India and 50.7% of the rotifer fauna of the state of Meghalaya. Amongst 22 families and 43 genera of phylum Rotifera recorded from northeastern India (B.K. Sharma unpublished), 15 families and 24 genera are represented in our collections. Although the examined samples reflect a low rotifer diversity of Nokrek Biosphere Reserve, the fauna appears to be fairly speciose when compared with overall rotifer richness known from northeastern India in general and the state of Meghalaya in particular. The documented species, however, present a significant contrast to only 27 species belonging to nine families and 12 genera identified by one of the authors (S. Sharma unpublished) from this biosphere reserve based on limited samples deposited in the holdings of NERC, ZSI, Shillong. Incomplete Rotifera inventories from the conservation areas of India may not permit meaningful comparisons with our report; this generalization is affirmed by only 14 species reported from the Nilgiri Biosphere Reserve (Patil 2001). The diversity in

Journal of Threatened Taxa | www.threatenedtaxa.org | February 2011 | 3(2): 1535-1541

1537

Rotifers of Nokrek

B.K. Sharma & S. Sharma

Nokrek Biosphere Reserve is marginally higher than 64 species noticed in summer rotifer communities of 12 floodplain lakes of the Pobitora Wildlife Sanctuary, Assam (Sharma 2006) while it broadly concurs with 74 species examined from some floodplain lakes of Kaziranga National Park (Sharma & Sharma 2008) of Assam. On the other hand, the richness is distinctly lower than the reports of 110 (Sharma & Sharma 2005b) and 120 (Sharma 2009) species known from two Ramsar sites of India namely Deepor Beel (Assam) and Loktak Lake (Manipur), respectively as well as the 207 species from floodplain lakes in River Niger Delta, Nigeria, Africa (Segers et al. 1993), 106 taxa from Thale-Noi Lake, a Ramsar site in Thailand, Asia (Segers & Pholpunthin 1997) and 114 species from the wetlands of the Rio Pilcomayo National Park, Ramsar site of Argentina, South America (Jose de Paggi 2001). However, we caution against overemphasizing the importance of the stated comparisons without considering sampling intensity and the nature of different ecosystems, particularly the floodplains of Assam and Manipur and elsewhere. Biogeographically interesting elements include the Oriental endemic Lecane blachei (Image 1). This lecanid was described from Cambodia (Berzins 1973) and thereafter recorded from Thailand (Sanoamuang 1998) and India (Sharma 2004) while it is recently

re-recorded (Seanghun & Sanoamuang 2010) from Cambodia from the Mekong River basin. L. blachei exhibits a disjunct occurrence in India with records from Assam and West Bengal (Sharma & Sharma 2008). Lecane unguitata (Image 2), another palaeotropical species (Segers 1996) as well as eastern hemispheric element (Savatenalinton & Segers 2005), shows a relatively wider distribution in India but is rare

Image 2. Lecane unguitata (Fadeev), ventral view

Image 1. Lecane blachei Berzins, dorsal view 1538

Image 3. Brachionus mirabilis Daday, ventral view

Journal of Threatened Taxa | www.threatenedtaxa.org | February 2011 | 3(2): 1535-1541

Rotifers of Nokrek

B.K. Sharma & S. Sharma

Image 4. Lophocharis salpina (Ehrenberg), lateral view

Image 5. Mytilina bisulcata (Lucks), lateral view

Image 6. Lecane haliclysta Harring & Myers, dorsal view

Image 7. Lecane furcata (Murray), ventral view

in the collections from the Nokrek Biosphere Reserve. Besides, Brachionus mirabilis (Image 3), Lophocharis salpina (Image 4), Mytilina bisulcata (Image 5), Lecane haliclysta (Image 6), L. furcata (Image 7), L. stenroosi (Image 8), Tripleuchlanis propatula, Testudinella parva (Image 9) and T. emarginula (Image 10) are examples of regional distributional interest. Lecane nitida is presently retained as a distinct species in L.

curvicornis group following Segers & Sanoamuang (2007). Lecanidae, one of the largest families of monogonont rotifers (Segers 1995), shows a distinct quantitative importance (34.3%); Brachionidae > Lepadellidae > Notommatidae form notable components (15.7, 10 and 7.1% respectively) of the rotifer fauna of the Nokrek Biosphere Reserve. Amongst different genera, the

Journal of Threatened Taxa | www.threatenedtaxa.org | February 2011 | 3(2): 1535-1541

1539

Rotifers of Nokrek

B.K. Sharma & S. Sharma

Image 8. Lecane stenroosi (Meissner), dorsal view

Image 10. Testudinella emarginula (Stenroos), ventral view

‘tropic-centered’ Lecane shows high richness (24 species) while our collections are characterized by a relative paucity of species of another ‘tropic-centered’ genus, Brachionus; the latter is attributed to the lack of typical limnetic habitats in the sampled area. Cosmopolitan species (71.2%) distinctly dominate the rotifer fauna, tropicopolitan species (16.5 %) are well represented while pantropical (5.6%) elements are relatively fewer. In general, the rotifer taxocoenosis 1540

Image 9. Testudinella parva (Ternetz), ventral view

of the Nokrek Biosphere Reserve reflects a ‘tropical character’. This generalization is in conformity with identical reports from other tropical faunas (Green 1972; Fernando 1980; Dussart et al. 1984; Segers 1996, 2001, 2008; Sharma 1998a; Sharma & Sharma 2008). On the other hand, our results differ by lacking the quantitative dominance of Brachionidae, depending on ecological conditions, reported in quite a few of the listed works. Our collections exhibit interesting variations in Rotifera richness in individual samples (2-23, 11 ± 5 species). Further, the rotifer communities are characterized by more littoral-periphytonic species and a paucity of planktonic elements. The present study shows the common occurrence of Plationus patulus, Euchlanis dilatata, Lecane bulla, L. leontina, L. luna, L. quadridentata and Testudinella patina while Brachionus bidentatus, B. calyciflorus, B. falcatus, Cephalodella forficula, C. gibba, C. mucronata, Sinantherina socialis, S. spinosa and Testudinella parva are rare species. Monogonont rotifers comprise the bulk of the recorded diversity (67 species) and in turn, show a higher richness of the members of order Ploima while the Bdelloidea include only three species. To sum up, the Rotifera fauna of the Nokrek Biosphere Reserve reveals 70 species belonging to 24 genera and 15 families including eight new records

Journal of Threatened Taxa | www.threatenedtaxa.org | February 2011 | 3(2): 1535-1541

Rotifers of Nokrek

from the state of Meghalaya, It is characterized by the occurrence of certain biographically interesting species, quantitative importance of tropic-centered’ Lecane, paucity of Brachionus spp., richness of cosmopolitan species, general ‘tropical’ character and dominance of littoral-periphytonic species. The present species inventory, however, still requires updating based on more extensive collections as well as specific sampling of benthic and bdelloid rotifers. Nevertheless, this study is an important contribution to aquatic biodiversity of the biosphere reserves or conservation areas of India.

REFERENCES Dussart, B.H., C.H. Fernando, J. Matsumura-Tundisi & R. J. Shiel (1984). A review of systematics, distribution and ecology of tropical freshwater zooplankton. Hydrobiologia 113: 77‑91. Fernando, C.H. (1980). The freshwater zooplankton of Sri Lanka, with a discussion of tropical freshwater zooplankton composition. Internationale Revue Hydrobiologie 65: 411426. Green, J. (1972). Latitudinal variation in associations of planktonic Rotifera. Journal of Zoology 167: 31‑39. Paggi, S.J. (2001). Diversity of Rotifera (Monogononta) in wetlands of Rio Pilcomayo National Park, Ramsar site (Formosa, Argentina). Hydrobiologia 462: 25-34. Koste, W. (1978). ROTATORIA. Die Rädertiere Mitteleuropas, begründet von Max Voigt. Überordnung Monogononta. Gebrüder Borntraeger, Berlin, Stuttgart. I. Text U. II. Tafelbd. (T. 234), 673pp. Patil, S.G. (2001). Rotifera, pp. 25-28. In: Fauna of Nilgiri Biosphere Reserve: Fauna of Conservation Area Series No. 11: Zoological Survey of India, Calcutta. Sanoamuang, L. (1998). Rotifera of some freshwater habitats in the floodplains of the river Nan, northern Thailand. Hydrobiologia 387/388: 27-33. Savatenalinton, S. & H. Segers (2005). Rotifers from Kalasin province, Northeast Thailand, with notes on new and rare species. Zoological Studies 44(3): 361-367. Seanghun, M. & L. Sanoamuang (2010). New records of rotifer fauna in the Cambodian Mekong River basin. Cambodian Journal of Natural History 1: 48-62. Segers, H. (1995). Rotifera 2: Lecanidae. 6: 1-226. In: Dumont, H.J. & T. Nogrady (eds.) Guides to identification of the Microinvertebrates of the Continental waters of the world. SPB Academic Publishing, Amsterdam, The Netherlands. Segers, H. (1996). The biogeography of littoral Lecane Rotifera. Hydrobiologia 323:169-197. Segers, H. (2001). Zoogeography of the Southeast Asian Rotifera. Hydrobiologia 446/447: 233-246.

B.K. Sharma & S. Sharma

Segers, H. (2002). The nomenclature of the Rotifera: annotated checklist of valid family- and genus-group names. Journal of Natural History 36: 621-640. Segers, H. (2008). Global diversity of rotifers (Rotifera) in freshwater. Hydrobiologia 595:49-59. Segers, H. & P. Pholpunthin (1997). New and rare Rotifera from Thale Noi Lake, Pattalang Province, Thailand, with a note on the taxonomy of Cephalodella (Notommatidae). Annals of Limnology 33: 13-21. Segers, H. & L. Sanoamuang (2007). Note on a highly diverse rotifer assemblage (Rotifera: Monogononta) in a Laotian rice paddy and adjacent pond. Internationale Revue Hydrobiologie 92(6): 240-146. Segers, H., C.S. Nwadiaro & H.J. Dumont (1993). Rotifera of some lakes in the floodplain of the River Niger (Imo State, Nigeria) II. Faunal composition and diversity. Hydrobiologia 250: 63-71. Sharma, B.K. (1998a). Faunal diversity of India: Rotifera, pp. 57-70. In: Alfred, J.R.B., A.K. Das & A.K. Sanyal (eds.). Faunal Diversity of India. A Commemorative Volume in the 50th Year of India’s Independence. ENVIS Centre, Zool. Surv. India, Calcutta Sharma, B.K. (1998b). Freshwater Rotifers (Rotifera: Eurotatoria), pp. 341-461. In: Fauna of West Bengal. State Fauna Series. Zoological Survey of India, Calcutta. Sharma, B.K. (2004). Rare and interesting monogonont rotifers (Rotifera, Eurotatoria) from North-Eastern India. Mitteilungen aus dem Museum für Naturkunde Berlin, Zoologische Reihe 80: 33-40. Sharma, B.K. (2009). Diversity of Rotifers (Rotifera: Eurotatoria) of Loktak lake, North- Eastern India. Tropical Ecology 50(2): 277-285. Sharma, B.K. & S. Sharma (1999). Freshwater Rotifers (Rotifera: Eurotatoria), pp. 11-161. In: State Fauna Series: Fauna of Meghalaya. Zoological Survey of India, Calcutta. Sharma, B.K. & S. Sharma (2000). Freshwater Rotifers (Rotifera: Eurotatoria), pp. 163-224. In: State Fauna Series: Fauna of Tripura. Zoological Survey of India, Calcutta. Sharma, B.K. & S. Sharma (2005a). Biodiversity of freshwater rotifers (Rotifera: Eurotatoria) from North -Eastern India. Mitteilungen aus dem Museum für Naturkunde Berlin, Zoologische Reihe 81: 81-88. Sharma, B.K. & S. Sharma (2005b). Faunal diversity of Rotifers (Rotifera: Eurotatoria) of Deepor beel, Assam (N. E. India)- a Ramsar site. Journal of the Bombay Natural History Society 102(2): 169-175. Sharma, S. (2006). Rotifer diversity (Rotifera : Eurotatoria) of floodplain lakes of Pobitora Wild-Life Sanctuary, Assam. Records of the Zoological Survey of India 106(3): 76-89 Sharma, S. & B.K. Sharma (2008). Zooplankton diversity in floodplain lakes of Assam. Records of the Zoological Survey of India, Occasional Paper No. 290:1-307.

Journal of Threatened Taxa | www.threatenedtaxa.org | February 2011 | 3(2): 1535-1541

1541

JoTT Short Communication

3(2): 1542-1547

3rd Asian Lepidoptera Conservation Symposium

Special Series

Chromolaena odorata (L.) King & H.E. Robins (Asteraceae), an important nectar source for adult butterflies P. Vara Lakshmi 1 & A.J. Solomon Raju 2 Department of Environmental Sciences, Andhra University, Visakhapatnam, Andhra Pradesh 530003, India Email: 1 varalakshmi83@gmail.com, 2 ajsraju@yahoo.com (corresponding author)

Abstract: Chromolaena odorata is a seasonal weed and grows like a cultivated crop. It flowers during October-December. The floral characteristics such as white to purple colour of florets, short-tubed narrow corolla with deep seated nectar, the morning anthesis and the flat-topped head inflorescence providing a standing platform are important attractants for visitation by butterflies. The florets attract butterflies of five families and sphingid hawk moths. Among the butterflies, nymphalids are diverse and visit the florets consistently; their visits effect pollination. The diurnal hawk moths, Macroglossum gyrans and Cephonodes hylas also visit the florets during dawn and dusk hours for nectar, and effect pollination. Therefore, C. odorata, being an exotic is an important nectar source for adult butterflies. Keywords: psychophily.

Butterflies,

Chromolaena

odorata,

nectar,

Chromolaena odorata is a perennial weed in many parts of the world from sea level to over 1,000m in elevation (Binggeli 1999). It was introduced into India from tropical America during the Second World War and since then it has spread widely and has become a dominant weed of wastelands, roadsides and other exposed areas (Kushwaha et al. 1981). Disturbance

is a pre-requisite for the colonization of an area by this plant and once colonized, it competes aggressively with herbs, grasses, and shrubs in open areas. It is not shade-tolerant and does not grow under a closed forest stand (Francis 2001). It possesses an underground organ which ensures its survival in case of fire, drought or mechanical damage through coppicing (Schmidt & Schilling 2000). Its reproduction is exclusively by seeds (Coleman 1989). Sexual reproduction starts when the plant is one-year old and this observation agrees with Schmidt & Schilling (2000) who reported similarly. In the present study sites, this weed occurs in open, sunny areas of forest margins and open gaps in the forest at an elevation of over 700m. The regular disturbance in the forest due to various human activities facilitates colonization of exposed areas by this plant. C. odorata grows like a crop during the active growth period and suppresses the growth of native low ground herbaceous flora. This paper describes the importance of C. odorata as a nectar source for adult butterflies. Materials and Methods Chromolaena odorata occurring at the Seshachalam Hills of southern Eastern Ghats of Andhra Pradesh was used for the study during the summer season of 2009. Twenty-five tagged mature buds were followed for recording the time of anthesis and anther dehiscence. The details of flower morphology such as flower sex, shape, size, colour, odour, sepals, petals, stamens and

Date of publication (online): 26 February 2011 Date of publication (print): 26 February 2011 ISSN 0974-7907 (online) | 0974-7893 (print) Editor: K.R. Sasidharan Manuscript details: Ms # o2504 Received 06 July 2010 Final received 30 October 2010 Finally accepted 10 February 2011 Citation: Lakshmi, P.V. & A.J.S. Raju (2011). Chromolaena odorata (L.) King & H.E. Robins (Asteraceae), an important nectar source for adult butterflies. Journal of Threatened Taxa 3(2): 1542-1547. Copyright: ÂŠ P. Vara Lakshmi & A.J. Solomon Raju 2011. Creative Commons Attribution 3.0 Unported License. JoTT allows unrestricted use of this article in any medium for non-profit purposes, reproduction and distribution by providing adequate credit to the authors and the source of publication. OPEN ACCESS | FREE DOWNLOAD

1542

This article is part of the peer-reviewed Proceedings of the 3rd Asian Lepidoptera Conservation Symposium (3ALCS-2010) jointly organized by the IUCN SSC South Asian Invertebrate Specialist GroupÂ (SAsISG); Department of Zoology, Bharathiar University; Zoo Outreach Organisation and Wildlife Information Liaison Development, held from 25 to 29 October 2010 at Coimbatore, Tamil Nadu, India. http://www.zooreach.org/3alcs2010.html

Journal of Threatened Taxa | www.threatenedtaxa.org | February 2011 | 3(2): 1542-1547

Exotic nectar source

ovary were described. Regular observations were made on the butterflies visiting the flowers for forage. They were observed for their foraging behaviour such as mode of approach, landing, probing behaviour for nectar collection, contact with essential organs to result in pollination, inter-plant foraging activity in terms of cross-pollination, etc. The foraging visits of each butterfly species for the entire day on the selected number of flowering heads were recorded to know the relative percentage of visits of each butterfly family. Three to five specimens of each butterfly species collected at different times of the day were brought to the laboratory for examining their proboscis under a microscope for the presence of pollen grains in order to assess their role in pollen transfer and pollination. Results Floral biology: The plant is a free standing shrub and grows up to 1m. It is maintained by a system of abundant, yellowish, fine lateral roots. The opposite, three-nerved leaves are ovate-lanceolate, usually with a dentate margin and a long pointed tip. Seed germination starts in May-June and active growth occurs during June-October. The plant possesses underground organs which ensure its survival during drought or mechanical damage or in case of fire. Flowering does not occur in the first year but it occurs in the consecutive years during October-December. The inflorescences consist of corymbs of cylindrical heads; they arise at the terminal part of the branches (Image 1a). A cylindrical head consists of 21 to 28 tubular florets per head (Image 1b,c). The florets open during 0600-0800 hr (Image 1d-g). They are very small, white to light purple, bisexual, and zygomorphic. The calyx is reduced to pappus and represented by hairs. The corolla is tubular with five teeth at the tip. The stamens are five, epipetalous, arise from the base of the corolla, filaments are free but anthers are united representing syngenesious condition. The anthers are dithecous, have their connective prolonged into hood and their bases produce hairy outgrowths, which in turn form a protective envelope for the nectary. The pollen grains are very small, round, ornamented, 196 Âą 14.6 per anther and the total pollen output per floret is 980 (Image 1h). The narrow anthers form a hollow space and pollen is liberated into this space. The ovary is bicarpellary and syncarpous, unilocular with a single basal ovule (Image 1i,j). The style is surrounded

P.V. Lakshmi & A.J.S. Raju

by the nectary at the base and it is forked into two parts. The receptive surfaces of the stylar branches stay in the closed state and as they grow through the hollow space brush out the pollen liberated in the hollow space. Further, the style stretches out beyond the anthers, spreads out its branches to receive pollen. The nectar is secreted in traces only; for this reason nectar analysis was not carried out. The florets remain in place for about 3-4 days. The fruits are small and one-seeded. The seeds are dry, light and 4mm long brownish gray to black achene with a small hook and tipped with pale brown 5-6 mm long pappus (Image 1k). Foraging activity of butterflies and hawkmoths: The florets were visited during day time by butterflies and hawkmoths for nectar collection. The butterflies included 23 species representing the families: Papilionidae, Pieridae, Nymphalidae, Lycaenidae and

Table 1. List of butterflies on Chromolaena odorata Family

Scientific Name

Common Name

Pachliopta hector

Crimson Rose

Papilio polytes

Common Mormon

Papilio demoleus

Lime Butterfly

Catopsilia pyranthe

Mottled Emigrant

Anaphaeis aurota

Pioneer

Delias eucharis

Common Jezebel

Ariadne ariadne

Angled Castor

Junonia lemonias

Lemon Pansy

Junonia hierta

Yellow Pansy

Precis iphita

Chocolate Pansy

Acraea violae

Tawny Coster

Euploea core

Common Indian Crow

Phalanta phalantha

Common Leopard

Danaus genutia

Striped Tiger

Danaus chrysippus

Plain Tiger

Ypthima asterope

Common Three- Ring

Melanitis leda

Common Evening Brown

Tirumala limniace

Blue Tiger

Parantica aglea

Glassy Tiger

Neptis hylas

Common Sailer

Everes lacturnus

Indian Cupid

Lepidoptera Papilionidae

Pieridae

Nymphalidae

Lycaenidae

Tarucus nara

Rounded Pierrot

Hesperiidae

Borbo cinnara

Rice Swift

Sphingidae

Cephonodes hylas

Coffee Hawk-Moth

Journal of Threatened Taxa | www.threatenedtaxa.org | February 2011 | 3(2): 1542-1547

1543

Exotic nectar source

P.V. Lakshmi & A.J.S. Raju

h l

Image 1. Chromolaena odorata a - flowering inflorescences; b - individual cylindrical head; c - mature head; d & e - mature florets; f - open floret; g - l.s. floret; h - pollen grain; i - ovary; j - ovule; k - mature seeds ready for dispersal; l - Pachliopta hector; m - Papilio polytes; n - Acraea violae; o - Ariadne ariadne; p - Junonia lemonias 1544

Journal of Threatened Taxa | www.threatenedtaxa.org | February 2011 | 3(2): 1542-1547

P.V. Lakshmi & A.J.S. Raju 70

Percentage of visits

rii da

e ni da ae Ly c

e id a pi lio n

pe es H

Family of butterflies

rii da

e ni da ae

al id a ph ym

Ly c

e Pi er id a N

pi lio n

id a

al id a

Pi er id a

No. of species

Exotic nectar source

Family of butterflies

Figure 1. Family-wise number of butterfly species foraging for nectar on Chromolaena odorata

Figure 2. Family-wise percentage of foraging visits of butterflies on Chromolaena odorata

Hesperiidae (Table 1). The Papilionidae and Pieridae each was represented by three species, Nymphalidae by 14 species, Lycaenidae by two species and Hesperiidae by one species (Fig. 1). The papilionids were Pachliopta hector (Image 1l), Papilio polytes (Image 1m) and P. demoleus. The pierids were Catopsilia pyranthe (Image 2g), Anaphaeis aurota and Delias eucharis (Image 2f). The nymphalids were Danaus genutia (Image 2c), D. chrysippus (Image 2d), Junonia lemonias (Image 1p), Precis iphita, Junonia hierta, Euploea core (Image 2a), Ariadne ariadne (Image 1o), Acraea violae (Image 1n), Phalanta phalantha (Image 2b), Ypthima asterope (Image 2i), Melanitis leda, Tirumala limniace (Image 2e), Parantica aglea and Neptis hylas. The lycaenids were Everes lacturnus and Tarucus nara (Image 2h). The hesperid was Borbo cinnara of these, the individuals of nymphalid butterflies foraging at the florets were found to be more than those of other families throughout the flowering season (Fig. 1). The data collected on the foraging visits of butterflies of each family showed that nymphalids made 61%, papilionids 17%, pierids 11%, lycaenids 8% and hesperiids 3% of the total visits (Fig. 2). The cylindrical heads equipped with a cluster of florets provide a convenient landing place for butterflies and also this arrangement enables them to probe several flowers in each visit in succession for nectar before their departure. The flowering heads borne terminally stand out prominently and the butterflies were found to be attracted to them even from a long distance. A sample of 3-5 specimens of all butterfly species was used to examine the pollen carrying capacity of their proboscises. The results indicated that the proboscises invariably contained pollen grains ranging from 15-35

in papilionids, 14-23 in pierids, 29-189 in nymphalids, 8-17 in lycaenids and 9-21 in hesperiids. All these butterflies stretched out their proboscises to reach the floret base to access nectar; while doing so the proboscis invariably contacts the stylar surfaces and hence effects pollination. They frequently moved between individual plants of C. odorata which has patchy distribution along the forest margins and in the open gaps of the forest interior; this inter-plant foraging activity within the patch and between patches situated nearby and far away promotes cross pollination. The study showed that nymphalids play an important role in the pollination of C. odorata. The diurnal hawk moths included Macroglossum gyrans (Image 2j) and Cephonodes hylas (Image 2k). These hawk moths showed intense foraging activity during dawn hours when the florets offer fresh nectar and reduced activity during dusk hours when the florets offer only the leftover nectar which is not fresh; they rarely foraged during daytime. They hovered at the floret heads, inserted the proboscis, and collected nectar quickly from as many florets from several flowering heads in quick succession. Their proboscis gained contact with the stylar surfaces of each floret they visited and this contact results in pollination. Discussion The floral characteristics of C. odorata such as white to purple colour of florets, short-tubed narrow corolla with deep seated nectar, the flat-topped head inflorescence providing a landing platform and morning anthesis suggest that the plant is psychophilous (Faegri & van der Pijl 1979). Galetto & Bernardello (2003) reported that hexose nectars are characteristic

Journal of Threatened Taxa | www.threatenedtaxa.org | February 2011 | 3(2): 1542-1547

1545

Exotic nectar source

P.V. Lakshmi & A.J.S. Raju

b f

d j

Image 2. Chromolaena odorata visited by a - Euploea core; b - Phalanta phalantha; c - Danaus genutia; d - Danaus chrysippus; e - Tirumala limniace; f - Delias eucharis ; g - Catopsilia pyranthe; h - Tarucus nara ; i - Ypthima asterope; j - Macroglossum gyrans; k - Cephonodes hylas

of Asteraceae. Baker & Baker (1983) also stated that hexose sugars dominate in the nectars of Asteraceae and the nectars are also relatively strong in amino acids to compensate for the low sucrose-hexose ratio in the members of this family which attract butterflies. Since C. odorata is a member of Asteraceae, hexoserich sugars and high amino acid concentration could be expected in the nectar. The retention of florets for 1546

extended periods may enhance the attractiveness of flowering heads to visiting butterflies. C. odorata with these floral structural and functional characteristics attract butterflies and hawk moths. The butterflies of all families collect nectar from the flowering heads as soon as the florets are open and in doing so effect both self- and cross-pollination. Since the florets secrete traces of nectar, the butterflies in quest of nectar visit

Journal of Threatened Taxa | www.threatenedtaxa.org | February 2011 | 3(2): 1542-1547

Exotic nectar source

as many florets and flowering heads as possible in a single foraging visit, this foraging behaviour promotes cross-pollination. The patchy distribution of the plant with numerous flowering heads facilitates frequent movement of butterflies between different individuals and such movements promote cross-pollination. Since the florets are short-tubed, the butterflies with any length of proboscis collect nectar without any difficulty. The florets borne in cylindrical heads collectively offer considerable quantities of nectar and are energetically profitable for butterflies and such an arrangement reduces search and flight time. The proboscises of butterflies carry pollen and the quantity recorded may be related to the length of the proboscis and the contact extent between the proboscis and the dehisced anthers. Among the butterflies, Nymphalids frequent the flowers consistently throughout the season in individual numbers and species, and hence play a prime role in the pollination, more than other butterflies. In another exotic species, Tridax procumbens, an Asteraceae member, danaid and pierid butterflies have been shown to be the main pollinators by Balasubramanian (1989). Therefore, psychophily is adaptive and advantageous for the plant to maximize pollination with specialized florets and nectarivory of butterflies. The diurnal hawk moths, Macroglossum gyrans and Cephonodes hylas also visit C. odorata flowering heads during dawn and dusk hours. The dawn foraging activity is energetically profitable for them while the foraging at dusk period may not be as profitable as the florets by that time are likely to be emptied of nectar by butterflies and other insects during the day. They collect nectar on clear sunny and rainy days and utilize this floral source until exhausted. Balasubramanian (1989) reported that hawk moths visit the florets of Tridax procumbens during rainy weather when most butterflies take shelter among foliage in nearby bushes. In the present study, it is found that the butterflies do not visit C. odorata on rainy days and hence they effect pollination only on clear sunny days. The study shows that C. odorata being an exotic weed is

P.V. Lakshmi & A.J.S. Raju

psychophilous and its prevalence in the forest areas is a potential source of nectar for butterflies for a period of three months. Although it is a menace due to its prevalence and suppressive activity on the growth of certain native low ground herbs, its flowers are most attractive to butterflies throughout its distribution range and act as a provisioning post for the butterflies. Its abundant growth everywhere in the tropics might also be depriving the pollination services to native flora, which are butterfly pollinated.

References Baker, H.G. & I. Baker (1983). Floral nectar sugar constituents in relation to pollinator type. pp. 117-141, In: Jones,

C.E. & R.J. Little (eds.). Handbook of Experimental Pollination Biology. Scientific and Academic Editions, New York. Balasubramanian, M.V. (1989). Studies on the ecology of butterfly pollination in South India. Annals of Entomology 7: 31-41. Binggeli, P. (1999). Chromolaena odorata (L.) King & Robinson (Asteraceae). http://members.tripod.co.uk/ WoodyPlantEcology/docs/web-sp4.htm. Coleman, J.R. (1989). Embryology and cytogenetics of apomictic hexaploid Eupatorium odoratum L. (Compositae). Review of Brasilian Genetics 12: 803817. Faegri, K. & L. van der Pijl (1979). The Principles of Pollination Ecology. Pergamon Press, Oxford, 244pp. Francis, E. (2001). Butterflies on Mimosa. The Pleasures and Pitfalls on Owning A Gite. Leonie Press, UK, 184pp. Galetto, L. & G. Bernardello (2003). Nectar sugar composition in angiosperms from Chaco and Patagonia (Argentina): an animal visitorâ&#x20AC;&#x2122;s matter? Plant Systematics & Evolution 238: 69-86. Kushwaha, S.P.S., P.S. Ramakrishnan & R.S. Tripathii (1981). Population dynamics of Eupatorium odoratum in successional environments following slash and burn agriculture. Journal of Applied Ecology 18: 529-535. Schmidt, G.J. & E.E. Schilling (2000). Phylogeny and Biogeography of Eupatorium (Asteraceae: Eupatorieae) based on nuclear ITS Sequence. American Journal of Botany 87: 716-726.

Journal of Threatened Taxa | www.threatenedtaxa.org | February 2011 | 3(2): 1542-1547

1547

JoTT Note

3(2): 1548-1549

Flemingia tuberosa Dalz. (Fabaceae) - a new addition to the flora of Kerala, India K. Subrahmanya Prasad 1, P. Biju 2 & K. Raveendran 3 Department of P.G. Studies & Research in Botany, Sir Syed College, Taliparamba, Kannur, Kerala 670142, India 2 Department of Botany, Government College, Vidyanagar, Kasaragod, Kerala 671123, India Email: 1 prasadks.1090@rediffmail.com (corresponding author) 1,3

During a survey of flowering plants along the proposed thermal power plant area of Cheemeni, Kasaragod District, Kerala, the authors collected one interesting Fabaceae member with trailing stem and lilac flowers. On detailed examination of the specimen, it turned out to be Flemingia tuberosa Dalz., a plant earlier known from Concan (Hooker 1876), Maharashtra (Dalzel & Gibson 1861; Cooke 1908), Goa (Rao 1985) and districts of North Kanara (Talbot 1909) and Udupi (Bhat 2003) in Karnataka. This species is hitherto not recorded from the state of Kerala (Nayar et al. 2006). Brief description, economic importance and photographs of this species are given to facilitate its easy identification.

Date of publication (online): 26 February 2011 Date of publication (print): 26 February 2011 ISSN 0974-7907 (online) | 0974-7893 (print) Editor: N.P. Balakrishnan Manuscript details: Ms # o2524 Received 25 July 2010 Final received 05 January 2011 Finally accepted 17 January 2011 Citation: Prasad, K.S., P. Biju & K. Raveendran (2011). Flemingia tuberosa Dalz. (Fabaceae) - a new addition to the flora of Kerala, India. Journal of Threatened Taxa 3(2): 1548-1549. Copyright: © K. Subrahmanya Prasad, P. Biju & K. Raveendran 2011. Creative Commons Attribution 3.0 Unported License. JoTT allows unrestricted use of this article in any medium for non-profit purposes, reproduction and distribution by providing adequate credit to the authors and the source of publication. Acknowledgements: Authors are thankful to Dr. Gopalakrishna Bhat, Poornaprajna College, Udupi for confirming the identity of plant specimen. Thanks are also due to the principal and management, Sir Syed College, Taliparamba for providing facilities. First author is grateful to KSCSTE for financial support. OPEN ACCESS | FREE DOWNLOAD

1548

Flemingia tuberosa Dalz. (Images 1-3) in Hooker’s J. Bot. Kew Gard. Misc. 2: 34. 1850; Hook.f., Fl. Brit. India 2: 230. 1876; Dalz. & Gibs., Bombay Flora 75.1861; Woodr., J. Bomb. Nat. Hist. Soc. 11: 426.1897; Cooke. Fl. Pres. Bombay 1: 230. 1908; Bhat, Fl. Udupi 150. 2003. Moghania tuberosa (Dalz.) Kuntze, Rev. Gen. Plant. 1: 199. 1891. Under shrubs; stems 0.9-1.2 m long, scandent or trailing; branches terete; roots tuberous, oblong, tapering at one end, 5-6.25 cm long, dark brown outside, white inside. Leaves 3-foliolate; leaflets 1.83.5 x 0.4-0.8 cm, linear–oblong, oblong–elliptic or lanceolate, acute, hairy along the nerves, ciliate on margins; nerves 8-11 pairs; petioles ca 1.4x2.6 cm long; stipules minute, acute, caducous. Flowers solitary, in few-flowered lax axillary racemes; peduncles distinct, exceeding the leaves; bracts and bracteoles rigid, minute. Calyx 1-1.2 cm, prominently ribbed, covered with yellowish hairs; teeth sub equal. Corolla lilac, slightly exerted; keel very narrow, incurved at the tip. Stamens 9 + 1. Pod oblong, 1-2-seeded, slightly exceeding the calyx, glabrous. Specimen examined: 17.x.2010, Cheemeni, Kasaragod District, Kerala, India, coll. K.S. Prasad, 01650 Sir Syed College Herbarium, Taliparamba, Kannur (SSC). Distribution: Konkan, Dakshina Kannada, Uttara Kannada, Goa, and Maharashtra. Recorded for the first time in Kerala. Habitat: Growing in grassy slopes. Flowering and fruiting: September - October. Notes: This species is known for its edible tuberous roots, which are often offered for sale in country fairs and markets. In Marathi it is known as Birmova (Dymock et al. 1890), and Jaambula Gadde in Kannada (Bairy 2007). Tubers are sweet and astringent, people consume them either raw or roasted which removes astringency. Fresh tubers contain 40.12% starch, 25.47% sugar and gum, 13.04% albuminoids, 12.16% cellulose, 4.13% asparagin, 3.44% ash, 1.16% yellow resin and are used as a remedy for dysentery and diarrhoea (Dymock et al. 1890). Dalzel & Gibson (1861) reported it from Malwan District of erstwhile Bombay Presidency. Talbot (1909) considered it as ‘apparently endemic’ to

Journal of Threatened Taxa | www.threatenedtaxa.org | February 2011 | 3(2): 1548-1549

Flemingia tuberosa new record

K.S. Prasad et al.

Image 2. Fleminga tuberosa flower

Image 1. Herbarium of Flemingia tuberosa

Concan and North Kanara. Bhat (2003) reported it as ‘very rare’ in Udupi District of Karnataka. Rao (1985) included it from Goa without giving location and status. However, Kothari (2000) reported it as ‘rare’ in moist deciduous forests of Raigad, Ratnagiri and Thane of Maharashtra. The present collection is from a proposed thermal power station site, which makes this plant highly vulnerable in Kerala. Since, it is rare elsewhere there is a call for urgent attention for conservation of this rare, palatable and medicinally important plant.

References Bairy, T.S. (2007). Ethnomedico-botanical Survey of Kadoor and Nadoor Village and a study on Leucas biflora(Vahl.) R. Br. PhD Thesis. Mangalore University, Mangalagangothri, Mangalore. Bhat, K.G. (2003). Flora of Udupi. Indian Naturalist (R), Udupi, 150pp.

Image 3. Fleminga tuberosa fruit

Cooke, T. (1908). The Flora of the Presidency of Bombay, Vol. I. Taylor & Francis, London, 394pp. Dalzel, N.A. & A. Gibson (1861). The Bombay Flora. Education Society Press, Bombay, 75pp. Dymock, W., C.J.H. Warden & D. Hooper (1890). Pharmacographia indica, Vol. I. Kegan Paul, Trench, Trubner & Co., London, 423pp. Hooker, J.D. (1876). The Flora of British India, Vol. II. Reeve & Co., London, 230pp. Kothari, M.J. (2000). Fabaceae in Flora of Maharashtra State, Dicots Vol. I, edited: N.P. Singh and S. Karthikayan. Botanical Survey of India, 689pp. Nayar, T.S., A.R. Beegam, K.V. Mohanan & G. Rajkumar (2006). Flowering Plants of Kerala. TBGRI, Palode, Thiruvananthapuram, 1069pp. Rao, R.S. (1985). Flora of Goa Diu Daman Dadar and Nagarhaveli, Vol. I. Botanical Survey of India, 120pp. Talbot, W.A. (1909). Forest flora of Bombay Presidency and Sind. Vol. I, Poona, (Reprint-1976, New Delhi), 421pp.

Journal of Threatened Taxa | www.threatenedtaxa.org | February 2011 | 3(2): 1548-1549

1549

JoTT Note

3(2): 1550-1552

A note on Diploprora championii (Lindl. ex Benth.) Hook. f. (Orchidaceae) - an interesting orchid from Karnataka, India A.N. Sringeswara ¹ & Sahana Vishwanath ² ¹ Department of Forestry and Environmental Science, University of Agricultural Sciences, GKVK Campus, Bengaluru, Karnataka 560065, India. ² Tree Improvement and Propagation Division, Institute of Wood Science and Technology, 18th Cross Malleswaram, Bengaluru, Karnataka 560003, India. Email: ¹ ansringesh@gmail.com (corresponding author), 2 sahana_ans@yahoo.com

During the floristic exploration in and around Sringeri Taluk (Fig. 1) of Chikmagalur District, adjacent to Kudremukh National Park, an interesting orchid species was collected. After the critical examination of the specimens, it has been identified as Diploprora championii (Image 1). The lip of this species is peculiar in being semi-cymbiform with its long forked setiform tip resembling the tongue of snake (see arrow in the Image 1). The voucher specimen has been deposited at the Herbarium, Botanical Garden, University of Agricultural Sciences, GKVK Campus, Bengaluru (Coll. No. ANS 187; Acc. No. 3806) (Image 2). This species was first described in 1855 by George Bentham as Cottonia championii, from specimens collected from Hong Kong. J.D. Hooker (1890) gives

Date of publication (online): 26 February 2011 Date of publication (print): 26 February 2011 ISSN 0974-7907 (online) | 0974-7893 (print) Editor: N.P. Balakrishnan Manuscript details: Ms # o2445 Received 24 March 2010 Final received 12 January 2011 Finally accepted 22 January 2011 Citation: Sringeswara, A.N. & S. Vishwanath (2011). A note on Diploprora championii (Lindl. ex Benth.) Hook. f. (Orchidaceae) - an interesting orchid from Karnataka, India. Journal of Threatened Taxa 3(2): 1550-1552. Copyright: © A.N. Sringeswara & Sahana Vishwanath 2011. Creative Commons Attribution 3.0 Unported License. JoTT allows unrestricted use of this article in any medium for non-profit purposes, reproduction and distribution by providing adequate credit to the authors and the source of publication. Acknowledgements: We would like to thank anonymous referees for their valuable suggestions and corrections. OPEN ACCESS | FREE DOWNLOAD

1550

the distribution of this species from Bhutan Himalaya, Khasi Mountains, Tennasserim, Ceylon and Hong Kong. Jayaweera (1981), gives its distribution from the Himalayan region, Khasia Hills and Sikkim in India and from Burma and China. Rao (1996) reported this as new record for Arunachal Pradesh. Recent compilation of orchids of Eastern Ghats by Reddy et al. (2005) report the occurrence of this species form Mayurbhanj District of Orissa. Saldanha (Saldanha & Nicolson 1976) reported this species from Hassan District, Karnataka and it forms the first report to southern India. The species has been reported from Andaman Islands and Banasuranmala in Wayanad District of Kerala (Rao 1982; Kumar & Manilal 1994, 2004). Recent compilation on orchids of Karnataka by Rao & Sridhar (2007) refers to the Saldanha’s collections only, as they have not collected this species. Our collection is second report of this species in Karnataka after a gap of 35 years. Diploprora championii (Lindl. ex Benth.) Hook. f. Fl. Brit. India. 6(1): 26. 1890 (as championi); Hook.f., Icon. Pl. 22: t. 2120. 1892; King & Pantl. in Ann. R. Bot. Gard. Calc. 8: t. 2120. 1898; Saldanha & Nicolson, Fl. Hassan 824. 1976; Liu & Su, Fl. Taiwan 5: 975. 1978. Cottonia championii Lindl. ex Benth. in Hooker’s J. Bot. Kew Gard. Misc. 7: 35. 1855 Luisia bicaudata Thw., Enum., Pl. Zeyl. 302. 1861. D. bicaudata (Thw.) Schltr., Fedde Rep. Beih. 4: 281, in obs. 1919. Pendulous epiphytes, roots long, vermiform. Stems non-pseudobulbous, leafy, 5-35 cm long; internodes 0.5-2 cm long, surrounded by persistent leaf sheaths. Leaves sessile, twisted, falcate or linear-oblong, 8-12 cm long, ca. 2cm wide, apex acute or sometimes unequally 2-lobed; sheath tubular, oblique at mouth. Racemes 5-8 cm long, zigzag, leaf-opposed, bracts scale-like, 2mm long. Flowers 3-5, pale yellow, ca. 1.5cm in diam. Sepals oblong or oblong-oblanceolate, 7-9 mm long, 3-4 mm wide, obtuse or rounded at apex. Petals linear-oblong, 8mm long, 2-3 mm wide, rounded at apex, 5-veined. Lip white or pale yellow, sometimes with yellowish or brownish stripes or hues, semi-cymbiform with a process at the extremity ending in two setiform forks. Anther terminal, 2-loculed,

Journal of Threatened Taxa | www.threatenedtaxa.org | February 2011 | 3(2): 1550-1552

Diploprora championii orchid

A.N. Sringeswara & S. Vishwanath

• Collection localities 1 - Kigga (10km from Sringeri - 13025’20.76”N & 75010’48.79”E) 2 - Holekoppa (6km from Sringeri, Agumbe Road - 13027’11.77”N & 75014’48.80”E) 3 - Alugodu (6.5km from Sringeri 13027’21.63”N & 75013’51.50”E) 4 - Hosuru (7km from Sringeri - 13027’30.24”N & 75014’14.85”E) 5 - Nallur (9km from Sringeri, Agumbe Road 13028’41.73”N & 75012’36.50”E) 6 - Begar Handpost (12km from Sringeri, Agumbe Road - 13029’58.77”N & 75012’14.09”E)

Figure 1. Collection localities of Diploprora championii (Lindl. Ex Benth.) Hook. f. in Sringeri Taluk, Karnataka.

Image 1. Diploprora championii (Lindl. ex Benth.) Hook. f. A - plant habit; B - Single flower; C - Fruit Journal of Threatened Taxa | www.threatenedtaxa.org | February 2011 | 3(2): 1550-1552

1551

Diploprora championii orchid

A.N. Sringeswara & S. Vishwanath

this species grows predominantly on Memecylon umbellatum trees in semi-evergreen forests and thickets in Sringeri Taluk. The leaves of this species have resemblance to the leaves of Pothas scandens. The fast disappearing thickets in Malnad region poses serious threat to its existence and sustainability in the region. It needs immediate attention for conserving this rare species.

References

Image 2. Herbarium specimen of Diploprora championii (Lindl. ex Benth.) Hook. f. deposited in the Herbarium, University of Agricultural Sciences, Bengaluru.

beaked, pollinia globose, bipartite, appressed to the flat inner surface. Ovary with pedicel 8mm long. Fruit a capsule, linear-fusiform, 4-5 cm long, 6-ribbed. Flowering and fruiting: March to June (flowering was observed even during late August in the plants collected and growing in author’s residence). Habit and habitat: Growing on branches of small trees overhanging in thicket (disturbed by frequent cutting of the plant into bushes for manure dominated by Memcylon and Hopea species) and semi-evergreen forests. In the present investigation, we found that

1552

Hooker, J.D. (1890). Flora of British India - Vol. 6. L. Reeve & Co., London, 224pp. Jayaweera, D.M.A. (1981). Orchidaceae, pp. 263–266. In: Dassanayake, M.D. & F.R. Fosberg (eds.). A Revised Handbook to the Flora of Ceylon, Vol. 2. Amerind Publishing Co., New Delhi, 511pp. Kumar, C.S. & K.S. Manilal (1994). A Catalogue of Indian Orchids. Bishen Singh Mahendra Pal Singh, Dehra Dun, 162pp. Kumar, C.S. & K.S. Manilal (2004). Orchids of Kerala, India, pp. 155-237. In: Manilal, K.S. & C. Sathish Kumar (eds). Orchid Memoirs – A tribute to Gunnar Seidenfaden. Mentor Books, Calicut, xiii+256 pp.+plates, figs, tables. Rao, M.K.V. (1982). Additions to the Orchidaceae of Andaman and Nicobar Islands. Bulletin of Botanical Survey of India 22: 212-213 (1980 publ. 1982). Rao, N.A. (1996). Five new records of orchids from Arunachal Pradesh, India. Journal of Economic and Taxonomic Botany 20(3): 707-709. Rao, T.A. & S. Sridhar (2007). Wild Orchids in Karnataka – A Pictorial Compendium. Institute of Natural Resources, Conservation, Education, Research and Training (INCERT), Bangalore, xiv+152pp.+80 colour plates. Reddy, C.S., C. Pattanaik, M.S.R. Murthy & K.N. Reddy (2005). Orchids of Eastern Ghats, India. EPTRI-ENVIS News Letter 11(4): 6-12. Saldanha, C.J. & D.H. Nicolson (1976). Flora of Hassan District, India. Amerind Publishing Co. Pvt. Ltd., New Delhi, viii+915pp.

Journal of Threatened Taxa | www.threatenedtaxa.org | February 2011 | 3(2): 1550-1552

JoTT Note

A new larval host record for Sphingomorpha chlorea (Cramer) (Insecta: Lepidoptera: Noctuidae) from Karnataka, India Ankita Gupta 1 & Peter Smetacek 2 National Bureau of Agriculturally Important Insects, Post Bag No. 2491, H.A. Farm Post, Bellary Road, Hebbal, Bengaluru, Karnataka 560024, India 2 Butterfly Research Centre, The Retreat, Jones Estate, P.O. Bhimtal, Nainital, Uttarakhand 263136, India Email: 1 drankitagupta7@gmail.com (corresponding author), 2 petersmetacek@rediffmail.com 1

Sphingomorpha chlorea (Cramer, 1777) is a widespread noctuid, known to occur over most of the mainland Old World Tropics. It belongs to a group of moths that are known to indulge in the habit of fruit piercing, a practice that causes considerable damage to orchards in Southeast Asia and Africa. In addition to its fondness for fruit on the tree, it is also attracted to fermented fruit, beer, spirits and other sources of sugars. As a result, it is called the Sundowner Moth and the Banana Hawk in parts of Africa. The moth is of minor importance to agriculture on account of its abovementioned habits. Besides this, the larva is eaten in many parts of its African range. Unlike other edible larvae, it is not an article of commerce since it loses flavour when it is dried. Hence, it is eaten fresh in rural areas where it occurs

3(2): 1553-1554

in large numbers in some years (Silow 1976). Although the possibility exists that this moth’s larva forms a part of the diet of humans in parts of Asia where lepidopteran larvae are routinely consumed, it has not been reported in the literature so far. Materials and Methods In the course of searching for egg and larval parasites of Lepidoptera in the forest of Savandurga, Karnataka (12055’10.75”N & 77017’34.37”E) a fleshy green caterpillar was discovered feeding on Lantana camara Linnaeus (Verbenaceae) on 07 June 2010 (Image 1). It was collected and reared in the laboratory where, in due course it pupated (Image 2) and on 15 July 2010, a noctuid moth emerged. It was identified as Sphingomorpha chlorea (Cramer) (Image 3). The specimen is in the collection of National Bureau of Agriculturally Important Insects, Bangalore (Reg.No. Lep/Sph/ch-6/10). Perusal of the literature (Sevastopulo 1941;

Date of publication (online): 26 February 2011 Date of publication (print): 26 February 2011 ISSN 0974-7907 (online) | 0974-7893 (print) Editor: B.A. Daniel Manuscript details: Ms # o2564 Received 09 September 2010 Final received 09 December 2010 Finally accepted 21 December 2010

Image 1. Sphingomorpha chlorea caterpillar, lateral view

Citation: Gupta, A. & P. Smetacek (2011). A new larval host record for Sphingomorpha chlorea (Cramer) (Insecta: Lepidoptera: Noctuidae) from Karnataka, India. Journal of Threatened Taxa 3(2): 1553-1554. Copyright: © Ankita Gupta & Peter Smetacek 2011. Creative Commons Attribution 3.0 Unported License. JoTT allows unrestricted use of this article in any medium for non-profit purposes, reproduction and distribution by providing adequate credit to the authors and the source of publication. Acknowledgements: The first author is grateful to Dr. R.J. Rabindra, Director, NBAII, Bengaluru for providing the necessary facilities for carrying out this research work. OPEN ACCESS | FREE DOWNLOAD

Image 2. Sphingomorpha chlorea pupa

Journal of Threatened Taxa | www.threatenedtaxa.org | February 2011 | 3(2): 1553-1554

1553

New larval host of Sphingomorpha chlorea

A. Gupta & P. Smetacek

Image 3. Adult moth of Sphingomorpha chlorea (Cramer)

Sevastopulo 1949; Robinson et al. 2001) clarified that this was an unreported host plant for the moth. Hence, it is reported here. Discussion This species is widespread and common in tropical Africa, whereas it is more local and rarer in Asia. Therefore, the economic importance may be different in the two continents. The distribution in the southern parts of the Arabian Peninsula indicates a more or less coherent distribution over these two continents. It is unlikely that Sphingomorpha chlorea was introduced in Asia quite recently, as a closely related species occurs in Java (Sphingomorpha hemia). Sphingomorpha chlorea has been recorded on four different larval host plants in the Oriental Region. These are Sclerocarya caffra (Anacardiaceae), Acacia (Leguminosae), Malus pumila (Rosaceae) and Citrus (Rutaceae) (Robinson et al. 2001). The present record thus not only adds a new larval host plant species, but also represents an addition to the known plant families that this species feeds upon, Verbenaceae. The adaptation of this moth to an exotic plant like Lantana camara, which is a native of tropical America (Polunin & Stainton 1984) is of interest, since L. camara is now a widespread naturalized plant in India. It occurs in many places from where S. 1554

chlorea (Cramer) has not been reported, like the plains of Uttar Pradesh, Uttarakhand, Himachal Pradesh, etc. It remains to be seen whether the moth spreads to the above mentioned sub-tropical localities in the years to come or whether it is indeed restricted to the tropics by other factors, perhaps climatic.

REFERENCES Polunin, O. & A. Stainton (1984). Flowers of the Himalaya. Oxford University Press, Delhi, 579pp+128pl. Robinson, G.S., P.R. Ackery, I.J. Kitching, G.W. Beccaloni & L. Hernandez (2001). Hostplants of the Moth and Butterfly Caterpillars of the Oriental Region. The Natural History Museum and Southdene Sdn Bhd., London and Kuala Lumpur, 744pp. Sevastopulo, D.G. (1941). On the food-plants of Indian Agaristidae and Noctuidae (Heterocera). Journal of the Bombay Natural History Society 42: 421-430. Sevastopulo, D.G. (1949). A supplementary list of the food-plants of the Indian Bombycidae, Agaristidae and Noctuidae. Journal of the Bombay Natural History Society 48: 265-276. Silow, C.A. (1976). Edible and Other Insects of Mid-western Zambia. Studies in Ethno-entomology II. Occasional Papers V. Institutionen för Allmän och Jämförande Etnografi vis, Uppssala Universitet. Uppsala, Sweden: Almqvist & Wiksell, 223pp.

Journal of Threatened Taxa | www.threatenedtaxa.org | February 2011 | 3(2): 1553-1554

JoTT Note

Four new lycaenid butterfly records from the Kumaon Himalaya, India Peter Smetacek The Retreat, Jones Estate, Bhimtal, Nainital, Uttarakhand 263136, India Email: petersmetacek@rediffmail.com

During the last two decades, there have been reports of range extensions for several species of butterflies to the western Himalaya. Almost all of these reports have resulted from work in the Indian state of Uttarakhand, comprising the administrative divisions of Kumaon and Garhwal that lie to the west of Nepal. These include Plebejus eversmanni Staudinger (Smetacek 1992), Rapala pheretima Hewitson (Smetacek 1995), Talicada nyseus GuérinMenéville (Singh 2005a), Poritia hewitsoni Moore (Singh 2003a), Ampittia dioscorides Fabricius (Singh 2003b), Delias acalis Godart (Smetacek 2001), Pontia daplidice and Pontia glauconome (Smetacek 2002) and Zesius chrysomallus Hübner (Singh 2005b). In addition, populations of some butterflies like Pazala mandarinus garhwalica Katayama (Katayama 1986) and Meandrusa lachinus Fruhstorfer (Singh 2006) have been discovered recently. In the present paper, four species are reported for the first time from the Kumaon Himalaya. All were recorded at low elevation at the base of the outermost Date of publication (online): 26 February 2011 Date of publication (print): 26 February 2011 ISSN 0974-7907 (online) | 0974-7893 (print)

3(2): 1555-1558

range, in a predominantly sal (Shorea robusta) forest biotype. Of these, one (Talicada nyseus Guérin-Menéville) has already been reported from Dehra Dun (Singh 2005a), yet I report it since the first specimen from Kumaon was recorded a year and a half before Singh’s (2005a) specimens, which were recorded in May and June 2003. Red Pierrot Talicada nyseus nyseus GuérinMenéville (Image 1) Material Examined: 9 exs: 21.i.2002 (female), Haldwani, 29012’48”N & 79034’17”E, 400m, JoTT 2011-01, JoTT 2011-02, JoTT 2011-03, JoTT 201104, JoTT 2011-05, JoTT 2011-06, JoTT 2011-07, JoTT 2011-08, JoTT 2011-09; 31.i.2006, Haldwani, 400m; 7.vii.2003, Chandadevi 800m; 12.vii.2006, Chandadevi, 800m; 23.vii.2003 Chandadevi, 800m; 9.viii.2003, Chandadevi, 800m; 2.ix.2003, Celery, 1000m; 21.ii.2004, Jones Estate, Bhimtal, 29021’17”N & 79032’34”E, 1500m; 5.vi.2006, Jones Estate, Bhimtal, 1500m. Legit et collectavit (Leg. et Coll.) P. Smetacek. Forewing length: 14-20 mm. Distribution: Sri Lanka, southern India, Dehra Dun to Thailand. Delhi (Smetacek 2009). Remarks: In addition to the above specimens, the species was recorded at Gethia Sanatorium 1500m elevation (25.ii.2006); Bohrakoon 1300m (22.ix.2005; 14.xi.2005); Jones Estate, Bhimtal 1500m (2.xi.2008;

Editor: Krushnamegh Kunte Manuscript details: Ms # o2224 Received 30 May 2009 Final received 30 April 2010 Finally accepted 22 December 2010 Citation: Smetacek, P. (2011). Four new lycaenid butterfly records from the Kumaon Himalaya, India. Journal of Threatened Taxa 3(2): 15551558. Copyright: © Peter Smetacek 2011. Creative Commons Attribution 3.0 Unported License. JoTT allows unrestricted use of this article in any medium for non-profit purposes, reproduction and distribution by providing adequate credit to the authors and the source of publication. Acknowledgements: A part of this work was funded by the Rufford Small Grants Foundation, for which the author is very grateful. OPEN ACCESS | FREE DOWNLOAD

Image 1. Red Pierrot Talicada nyseus nyseus

Journal of Threatened Taxa | www.threatenedtaxa.org | February 2011 | 3(2): 1555-1558

1555

New lycaenid records

P. Smetacek

Gethia Sanatorium Jones Estate

Celery

Bhujiaghat

Chandadevi

Image 2. Areas of collection of lycaenids.

18.ix.2005) and Haldwani 400m (11.viii.2004). The species occurs along the Himalaya from Dehra Dun eastwards and also in Delhi (Smetacek 2009). There are no reports of the species from the area between Dehra Dun and Delhi and the possibility that the distribution is disconnected cannot be ruled out. All the locations mentioned above, except Gethia Sanatorium, are on the motor road between Haldwani and Bhimtal. Jones Estate is in the Bhimtal Valley. Gethia Sanatorium is on the road between Haldwani and Bhowali. The earliest report of this butterfly from the Kumaon Himalaya was by Atkinson (1882), who added an interrogation mark, suggesting that he was uncertain of the record. This report was subsequently ignored by authors (Hannyngton 1910; Evans 1932; Peile 1937; Wynter-Blyth 1957) who did not find the butterfly. The first specimen of this butterfly, a female, was recorded in the middle of Haldwani Town (400m) on 21.i.2002 as it crossed a busy road and dived into a fruit seller’s pile of oranges. Numerous records followed, as it ascended the hills during the succeeding years, from Haldwani 400m, 21.i.2002; Chandadevi 800m, 7.vii.2003; Celery 1000m, 2.ix.2003; Jones Estate 1500m 21.ii.2004. It is now well established in the 1556

area and is on the wing during January, February, June, July, August, September and November. The species bears a large orange area on the distal half of the hindwing recto. Evans (1932) noted that this orange area is extensive, with a width of ¼ inch, in the southern Indian subspecies nyseus, while it is restricted, well under ¼ inch, in the east Himalayan subspecies khasiana Swinhoe. In addition, the markings on the hindwing verso are reduced in nyseus, with most of the discal band absent. In khasiana, these markings are large and complete. The specimens examined have a wide orange area on the hindwing recto, ¼ inch or more. On the hindwing verso, all the specimens examined except one (Jones Estate 21.ii.2004) have an incomplete discal band. This latter specimen is not as heavily marked on the verso surface as the specimen depicted in Evans (1932), so it is reasonable to place it under ssp. nyseus. This suggests that the present infiltration originated in southern India. It is possible, as Singh (2005a) suggests, that the species was carried in succulent plants brought from southern India and, finding the climate conducive, managed to colonise the area. This, however, overlooks Atkinson’s (1882) record and the fact that its known larval foodplant, Kalanchoë

Journal of Threatened Taxa | www.threatenedtaxa.org | February 2011 | 3(2): 1555-1558

New lycaenid records

Image 3. Transparent Six-line Blue Nacaduba kurava

spathulata DC, is indigenous to the area. This, in turn, suggests that the butterfly existed all along in the area, albeit at very low densities and has now become commoner, enabling it to be recorded again. The specimens recorded from Chandadevi were part of a colony thriving in a small patch of Kalanchoë growing on the hillside bordering the road. There were usually four to five individuals about at any given time. When the Public Works Department cleared the undergrowth bordering the road in September 2003, the Kalanchoë plants were cut, following which the population of T. nyseus was wiped out and neither the plants nor the butterfly ever recovered. Transparent Six-line Blue Nacaduba kurava Moore (Image 3) Material Examined: 2 exs.: Bhujiaghat 700m, JoTT 2011-10, JoTT 2011-11, 5.vi.2003 female; Bhujiaghat 700m, 26.iv.2004 female. Leg. et coll. P. Smetacek. Forewing Length: 12-15 mm. Distribution: Sri Lanka, southern India and from Nepal to Australia. Remarks: The present records constitute a westward extension to the known distribution of this species. There were several females about, of which I took one on each occasion. Unfortunately, I could not find a male, so it is not possible to ascertain the subspecies to which this population belongs, since the distinction is based on males.

P. Smetacek

Image 4. Spangled Plushblue Flos asoka (underside)

Spangled Plushblue Flos asoka de Nicéville (Image 4) Material Examined: 4 exs.: Bhujiaghat 700m, JoTT 2011-12, JoTT 2011-13, JoTT 2011-14, JoTT 201115, 31.v.2003 x2 males; Bhujiaghat 700m, 2.vi.2003 male; Bhujiaghat 700m, 20.v.2005 male. Leg. et coll. P. Smetacek. Forewing Length: 20-21 mm. Distribution: Nepal eastwards along the Himalaya to Thailand and Hong Kong. Remarks: A rather common butterfly in Bhujiaghat. It keeps to the tree tops and descends occasionally to drink at damp mud. The flight is swift. In flight, the pale underside serves to distinguish this species from members of the Arhopala Boisduval genus. Aberrant Bushblue Arhopala abseus indicus Riley (Image 5) Material Examined: 1 ex.: Bhujiaghat 750m, JoTT 2011-16, 31.v.2003 male. Leg. et coll. P. Smetacek. Forewing Length: 15mm. Distribution: Southern India and from Nepal to Tavoy. Other subspecies are found in South East Asia, the Philippines and Sulawesi. Remarks: This is a westward extension to the known distribution of this species. The specimen recorded descended from the rather high canopy and settled briefly on a leaf some 3m above the ground. It is likely that the species is commoner at the canopy level than it is at ground level.

Journal of Threatened Taxa | www.threatenedtaxa.org | February 2011 | 3(2): 1555-1558

1557

New lycaenid records

P. Smetacek

Image 5. Aberrant Bushblue Arhopala abseus indicus

Discussion Visits at the same season in subsequent years to the site yielded no further records of A. abseus, although Flos asoka was observed in 2004. In the summer of 2008, the entire area was devastated by a major forest fire and no butterflies were visible in the months following the fire. Barring Talicada nyseus, for which nothing certain can be construed one way or another, the present records do not seem to be recent range extensions. It is likely that these butterflies have always been in the area, but the season at which they occur, the height of summer, prevented earlier surveys. Suffice it to say that these butterflies were on the wing around noon on sunny days, a time when the temperature was extremely uncomfortable, even in the shade.

REFERENCES Atkinson, E.T. (1882). The Himalayan Districts of the North West Provinces of India. Vol. 2, Chapter 2, Zoology (Invertebrata). Government Press, Allahabad, 87-266pp. Evans, W.H. (1932). The Identification of Indian Butterflies 2nd Edition. Bombay Natural History Society, Bombay, 10+454pp+32pl. Hannyngton, F. (1910). The butterflies of Kumaon. Journal of the Bombay Natural History Society 20: 130-142; 361372.

1558

Katayama, T. (1986). Notes on Pazala glycerion (Gray), with description of a new subspecies from northwest India. Gekkan-Mushi 203: 8-9, pl.1. Peile, H.D. (1937). A Guide to Collecting Butterflies of India. Staples Press, London, 14+361pp+25pl. Singh, A.P. (2003a). New records on the distribution and ecology of Common Gem Butterfly Poritia hewitsoni hewitsoni Moore from the lower western Himalayas: a lesser known taxa. Journal of the Lepidopteristsâ&#x20AC;&#x2122; Society 37 (4): 295-298. Singh, A.P. (2003b). Distribution range extension of bush hopper butterfly, Ampittia dioscorides Fabricius (Lepidoptera: Hesperidae) into the lower western Himalayas. Indian Forester 129(8): 1046-1048. Singh, A.P. (2005a). Initial colonization of Red Pierrot butterfly, Talicada nyseus nyseus Guerin (Lycaenidae) in the lower western Himalayas: an indicator of the changing environment. Current Science 89: 41-42. Singh, A.P. (2005b). Recent records on the distribution, seasonality and occurrence of Redspot butterfly, Zesius chrysomallus HĂźbner from the lower western Himalayas. Journal of the Bombay Natural History Society 102(2): 238-239. Singh, A.P. (2006). Range extension of Brown Gorgon butterfly, Meandrusa gyas gyas Westwood into Kedarnath Musk Deer Reserve, Western Himalayas: A lesser known species from north-east India. Indian Forester 132(12a): 187-189. Smetacek, P. (1992). Record of Plebejus eversmanni (Staudinger) (Lepidoptera: Lycaenidae) from India. Journal of the Bombay Natural History Society 89: 385-386. Smetacek, P. (1995). A new altitudinal and range record for the Copper Flash butterfly Rapala pheretimus Hewitson (Lepidoptera: Lycaenidae). Journal of the Bombay Natural History Society 92: 127-128. Smetacek, P. (2001). Resolution of the controversial western limit of the range of Delias acalis Godart (Lepidoptera: Pieridae). Journal of the Bombay Natural History Society 98: 298-300. Smetacek, P. (2002). The genus Pontia Fabricius (Lepidoptera: Pieridae) in the Kumaon Himalaya. Journal of the Bombay Natural History Society 99: 224-231. Smetacek, P. (2009). Additions to the butterflies of Delhi. Bionotes 11(1): 15. Wynter-Blyth, M.A. (1957). Butterflies of The Indian Region. Bombay Natural History Society, Bombay, 20+523pp+72pl.

Journal of Threatened Taxa | www.threatenedtaxa.org | February 2011 | 3(2): 1555-1558

JoTT Note

Changing biodiversity scenario in the Himalayan ecosystem: Mussoorie, Uttarakhand, India, as revealed by the study of blue butterflies (Lycaenidae) Avtar Kaur Sidhu High Altitude Regional Centre, Zoological Survey of India, Saproon, Solan, Himachal Pradesh 173211, India Email: avtarkaur2000@rediffmail.com

An area rich in biodiversity is of great importance for conservation. Butterflies form an important component of biodiversity. Apart from their aesthetic appeal, they are good pollinators. As butterflies are highly sensitive to any environmental change and are delicate creatures, they act as good bio-indicators of the health of a habitat. However these creatures are under a real threat due to various developmental activities leading to habitat changes. The protection of these creatures should be given priority. Since the conservation of butterflies essentially means the conservation of their habitat, the spots rich in butterfly diversity are high conservation priority areas. In general, areas with undisturbed vegetation and high floral diversity support large butterfly communities. Few places in India can rival the abundance, both in

Date of publication (online): 26 February 2011 Date of publication (print): 26 February 2011 ISSN 0974-7907 (online) | 0974-7893 (print) Editor: Peter Smetacek Manuscript details: Ms # o2349 Received 20 November 2009 Final received 05 May 2010 Finally accepted 17 January 2011 Citation: Sidhu, A.K. (2011). Changing biodiversity scenario in the Himalayan ecosystem: Mussoorie, Uttarakhand, India, as revealed by the study of blue butterflies (Lycaenidae). Journal of Threatened Taxa 3(2): 1559-1563. Copyright: © Avtar Kaur Sidhu 2011. Creative Commons Attribution 3.0 Unported License. JoTT allows unrestricted use of this article in any medium for non-profit purposes, reproduction and distribution by providing adequate credit to the authors and the source of publication. Acknowledgements: The author is thankful to the editor for critically scrutinizing the manuscript besides giving useful suggestions in improving it. Thanks are also due to Director, Zoological Survey of India, Kolkata for giving research facilities and financial assistance to undertake these studies. OPEN ACCESS | FREE DOWNLOAD

3(2): 1559-1563

terms of species and sheer numbers of individuals, of butterflies as found in Mussoorie. Mussoorie is located at 30027’N and 7805’E in the Garhwal Hills and is known as the ‘Queen of Hills’ for its immense natural beauty. In 1820, Captain Young was enchanted by its beauty and made it his home. Mussoorie is named after the Mansur shrub, which used to grow in abundance here. Mussoorie is at a height of 2112m. It is rich in flora and fauna. Mackinnon & de Nicéville (1897), Ollenbach (1929), Shull (1958, 1962), and Rose & Sidhu (1994) made checklists of butterflies of Mussoorie and reported it as one of the richest areas in butterfly diversity. But due to excessive tourism coupled with various developmental activities, this hill station in recent times has undergone severe environmental degradation. In the present paper, a checklist of 66 species of lycaenid butterflies of Mussoorie, Uttarakhand has been prepared and compared with the lists made by the above mentioned earlier workers (Table 1). The nomenclature for naming various taxa, has been followed from Bridges (1988) and Varshney (1997). Material and Methods A literature search resulted in the collation of the various lists mentioned above. Mussoorie was visited by the author from June 2005 to September 2006. During this period, a total of 25 days was spent observing butterflies in the area. During these visits, 38 species of butterflies were recorded (Sidhu & Narender 2010). These specimens are presently in the collection of the Zoological Survey of India, Kolkata. Observations and Discussion The checklist of lycaenid butterflies has been made from the collections made by different Zoological Survey of India workers between 2000 and 2006. The observations and studies were made in Mussoorie in the first week of June 2006 and again in September 2006 in areas like Bhilaru Pumping Station (30028.068’N and 78004.095’E), one of the richest butterfly spots in India (located at 1737.4m) (Ollenbach 1929). While listing butterflies of Mussoorie, Mackinnon and de Nicéville (1897) reported 316 species of butterflies from Mussoorie and its neighbouring

Journal of Threatened Taxa | www.threatenedtaxa.org | February 2011 | 3(2): 1559-1563

1559

Lycaenids in Mussoorie

A.K. Sidhu

Table 1. Checklist of lycaenid butterflies of Mussoorie, Uttarakhand Species of Lycaenidae

Ollenbach (1929)

Shull (1962)

Rose & Sidhu (1994)

In Uttarakhand other than Mussoorie (2000-2006)

In Mussoorie (Presently 20052006)

Curetis bulis (Westwood)

Horaga albimacula viola Moore

Horaga onyx (Moore)

Chrysozephyrus ataxus (Westwood)

Chrysozephyrus birupa (Moore)

Chrysozephyrus syla (Kollar)

Esakiozephyrus icana (Moore)

Eusapa ziha (Hewitson)

Euaspa milionia (Hewitson)

10.

Chaetoprocta odata (Hewitson)

11.

Spindasis vulcanus (Fabricius)

12.

Spindasis nipalicus (Moore)

13.

Iraota timoleon (Stoll)

14.

Surendra vivarna (Horsfield)

15.

Arhopala pseudocentaurus (Doubleday)

16.

Arhopala rama (Kollar)

17.

Arhopala dodonaea (Moore)

18.

Arhopala atrax (Hewitson)

19.

Arhopala amantes (Hewitson)

20.

Panchala ganesa (Moore)

21.

Deudorix epijarbas (Moore)

22.

Deudorix isocrates (Fabricius)

23.

Deudorix perse (Hewitson)

24.

Rapala selira (Moore)

25.

Rapala nissa (Kollar)

26.

Rapala manea schistacea (Moore)

27.

Rapala iarbus (Fabricius)

28.

Tajuria diaeus (Hewitson)

29.

Tajuria illurgis (Hewitson)

30.

Loxura atymnus (Cramer)

31.

Pratapa icetas (Hewitson)

32.

Pratapa ctesia (Hewitson)

33.

Lycaena pavana (Westwood)

34.

Lycaena phlaeas (Linnaeus)

35.

Heliophorus androcles (Westwood)

36.

Heliophorus sena (Kollar)

37.

Heliophorus oda (Hewitson)

38.

Udara albocaerulea (Moore)

39.

Celastrina argiolus (Linnaeus)

40.

Celastrina huegelii (Moore)

41.

Celastrina gigas (Hemming)

42.

Acytolepis puspa (Horsfield)

43.

Celatoxia marginata (de Nicéville)

44.

Arletta vardhana (Moore)

45.

Chilades lajus (Cramer)

46.

Chilades pandava (Horsfield)

47.

Catochrysops strabo (Fabricius)

1560

Journal of Threatened Taxa | www.threatenedtaxa.org | February 2011 | 3(2): 1559-1563

Lycaenids in Mussoorie

Species of Lycaenidae

A.K. Sidhu

Ollenbach (1929)

Shull (1962)

Rose & Sidhu (1994)

In Uttarakhand other than Mussoorie (2000-2006)

In Mussoorie (Presently 20052006)

48.

Castalius rosimon (Fabricius)

49.

Lampides boeticus (Linnaeus)

50.

Aricia agestis (Denis & Schiffermüller)

51.

Zizina otis (Fabricius)

52.

Zizeeria karsandra (Moore)

53.

Zizula hylax (Fabricius)

54.

Pseudozizeeria maha (Kollar)

55.

Everes argiades (Pallas)

56.

Everes lacturnus (Godart)

57.

Everes huegelii (Gistel)

58.

Jamides bochus (Stoll)

59.

Tarucus hazara Evans

60.

Tarucus alteratus Moore

61.

Leptotes plinius (Fabricius)

62.

Azanus ubaldus (Stoll)

63.

Prosotas nora ardates (Moore)

64.

Euchrysops cnejus (Fabricius)

65.

Freyeria putli (Kollar)

66.

Freyeria trochylus (Freyer)

areas. Ollenbach (1929) while listing 144 species of butterflies, described in detail the butterfly-rich spots of Mussoorie. It includes the Electric Pumping Station (1671.5m); Mossy Falls (1676.2m); Bhilaru Pumping Station; a spring on the eastern slope of Vincent’s Hill (1981.2m) and a spring on the eastern side of the Kincraig Estate (1706.9m). While describing the pumping station spots, Ollenbach (1929) reported, “In my collection trips throughout India, Burma and the Andaman Islands, I have come across places where butterflies were to be seen in large numbers, but these could not approach the multitudes that visit the pumping station”. Shull (1958) reported 68 species from Mussoorie. Subsequently, Shull (1962) published a paper on butterflies of Mussoorie in which he reported five persons with nets catching 101 species in a single day (03 June 1961), the majority of them from Bhilaru Pumping Station and a few from the Municipal Park. On that day, 26 species of lycaenids were recorded, mostly from Bhimaru Pumping Station. These species are compared with the lycaenids recorded in the same location in June and September 2006, when only four of these species were recorded (Table 2). According to Shull (1962), “The hill station of Mussoorie in north-west India is probably one of the best places in the world for collecting a large number of species”.

Rose & Sidhu (1994) while listing the 34 species of lycaenid butterflies from Mussoorie collected from different spots, namely, Bhilaru Pumping Station, Murray Pumping Station, Mossy Falls, Savoy Hotel and Municipal Park in the first weeks of June 1992 and 1993, commented on the state of butterfly rich spots of Mussoorie reported by Ollenbach (1929) and Shull (1962). They observed that the springs on the eastern slope of Vincent’s Hill (Image 1) and on east of the Kincraig Estate have dried up due to urbanization and other developmental activities; Mossy Falls was not very rich in butterfly species diversity but the Murray Pumping Station was comparatively better. According to Shull (1962) and Rose & Sidhu (1994), the Bhilaru Pumping Station is the richest in butterfly species diversity as well as in number of individuals. Rose & Sidhu (1994) commented that the butterfly habitat around Bhilaru Pumping Station was shrinking and needed to be effectively conserved. They also added that this spot was being contaminated and was stinking due to sewage effluents, besides blocking of water flow by the accumulation of waste, mainly polythene bags. H.S. Rose, who was a member of the party during the 1992-1993 visits (Rose & Sidhu 1994) to various butterfly collecting spots in Mussoorie, had observed that a fairly large number of individuals belonging to a

Journal of Threatened Taxa | www.threatenedtaxa.org | February 2011 | 3(2): 1559-1563

1561

Lycaenids in Mussoorie

A.K. Sidhu

Table 2. List of lycaenids recorded from Bhilaru Pumping Station in a single day by Schull (1962) and the present survey between 2005 and 2006 Species of Lycaenidae

In Mussoorie (Presently 2005-2006)

Shull (1962)

Chrysozephyrus syla (Kollar)

Eusapa ziha (Hewitson)

Euaspa milionia (Hewitson)

Chaetoprocta odata (Hewitson)

Spindasis nipalicus (Moore)

Arhopala rama (Kollar)

Arhopala dodonaea (Moore)

Arhopala amantes (Hewitson)

Panchala ganesa (Moore)

10.

Rapala selira (Moore)

11.

Rapala nissa (Kollar)

12.

Pratapa icetas (Hewitson)

13.

Lycaena pavana (Westwood)

14.

Lycaena phlaeas (Linnaeus)

15.

Heliophorus sena (Kollar)

16.

Celastrina argiolus (Linnaeus)

17.

Celastrina huegelii (Moore)

18.

Acytolepis puspa (Horsfield)

19.

Arletta vardhana (Moore)

20.

Chilades lajus (Cramer)

21.

Lampides boeticus (Linnaeus)

22.

Aricia agestis (Denis & Schiffermüller)

23.

Zizina otis (Fabricius)

24.

Everes huegelii (Gistel)

25.

Jamides bochus (Stoll)

26.

Freyeria trochylus (Freyer)

variety of species were seen engaged in mud-puddling near the spring of Bhilaru Pumping Station from 0930 to 1400 hr and the spot was full of butterflies (Images 2 & 3). In the first week of June, 2006 and again in the second week of September, 2006, the Bhilaru Pumping Station, was visited by the present author. This spot was on the outskirts of Bhilaru Village in 1993 and a narrow unpaved foot path connected it to the main Mussoorie road. But now the spot has been totally devastated from the point of view of butterfly habitats. Bhilaru Village has expanded. The spring has dried up (Image 4). The paved road has been built up to the Pumping Station. Bordering the favourite butterfly spot, shops have been built and are conducting business (Image 5). Only four species viz., Celastrina argiolus, 1562

Image 1. Vincents Hills Spring, Mussoorie 1994

Celastrina huegelli, Everes huegelli and Lampides boeticus could be collected from this spot. Keeping in view the richness of the butterfly diversity of this spot noted by previous workers, it is brought to the notice of concerned authorities that these butterfly rich spots should be conserved on a priority basis or else the provisions of the Wildlife (Protection) Act, 1972 will be meaningless, for while many of the wildlife species that inhabit the vicinity of Bhilaru Pumping Station are protected under provisions of the Act, the extermination of entire populations of these species is being countenanced in the ongoing developmental activities in the area and a unique heritage site is being lost due to ignorance on the part of the authorities, despite being well recorded in the literature (Mackinnon & de Nicéville 1897; Ollenbach 1929; Schull 1962; Rose & Sidhu 1994). Mussoorie and especially the vicinity of Bhilaru Pumping Station, being a good habitat for a great variety of butterflies in particular and biodiversity in general, must be given special status and care for conservation. This will also ensure a pure drinking water supply for Mussoorie in the years to come.

Journal of Threatened Taxa | www.threatenedtaxa.org | February 2011 | 3(2): 1559-1563

Lycaenids in Mussoorie

A.K. Sidhu

Image 4. Dried up Bhilaru Puming Station spring, Mussoorie, 2006

Image 2. Bhilaru Pumping Station spring, Mussoorie, 1994

Image 5. Shops bordering Bhilaru Pumping Station spring, Mussoorie, 2006

Image 3. Butterflies mud-puddling site close to Bhilaru Pumping Station spring, 1994

References Bridges, C.A. (1988). Catalogue of Lycaenidae & Riodinidae (Lepidoptera : Rhopalocera). U.S.A. Lincoln Bookbindry, Urbana, Illinois, published by Charles A. Bridges: vii+ (I.ii + I.377) + (II.ii + II.115) + (III.ii + III.140) + (IV.ii + IV.101) + (V.ii+V.37) + (V.ii + VI.12) + Appen. I & II. Mackinnon, P.W. and L. de Nicéville (1897). A list of butterflies of Mussoorie in the western Himalayas and neighbouring region. Journal of the Bombay Natural History Society 11: 205-221; 368-389; 585-605.

Ollenbach, O.C. (1929). Butterfly collecting grounds at Mussoorie. Journal of the Bombay Natural History Society 34 : 836-840. Rose, H.S. & A.K. Sidhu (1994). Lycaenid butterfly diversity of Mussoorie (Uttar Pradesh) along with some comments on Wildlife (Protection) Act, 1972. Cheetal 33(3-4): 10-16. Shull, E.M. (1958). My highest catch of butterfly species in a single day (4th June, 1957) Mussoorie, India. Journal of the Lepidopterists’ Society 11 :167-168. Shull, E.M. (1962). Over one hundred butterfly species caught in a single day (3rd June, 1961) at Mussoorie, India. Journal of the Lepidopterists’ Society 16 : 143-145. Sidhu, A.K. & N. Sharma (2010). Insecta: Lepidoptera: Lycaenidae, Libytheidae and Acraeidae: Fauna of Uttarakhand, State fauna Series, Zoological Survey of India 18(Part-2) :531-552. Varshney, R.K. (1997). Index Rhoplocera Indica Pt III. Genera of butterflies from India and neighbouring countries [Lepidoptera: (C) Lycaenidae]. Oriental Insects 31: 83138.

Journal of Threatened Taxa | www.threatenedtaxa.org | February 2011 | 3(2): 1559-1563

1563

JoTT Note

3(2): 1564-1566

Comparative account on icthyofauna of Pocharam and Wyra lakes of Andhra Pradesh, India C.A. Nageswara Rao 1, J. Deepa 2 & Md. Hakeel 3 1,2,3 Zoological Survey of India, Freshwater Biology Regional Centre, Plot 366 / 1, Attapur (V), Ring Road, Hyderguda P.O, Hyderabad, Andhra Pradesh 500048, India Email: 1 fbrczsi@gmail.com, 2 deepajzsi@gmail.com (corresponding author)

Andhra Pradesh has a long tradition of constructing big dams and reservoirs. Some of the oldest man-made lakes in the country are situated in the state: Hussain sagar (500yr old), Saroornagar (275yr), Mir Alam (170yr), Pocharam (90yr), Wyra (77yr) and so on. In the present study two historic lakes of Andhra Pradesh have been selected for taxonomic comparison of fishes. Projects “Limnological and Faunistic Studies on Pocharam Lake, Medak Dist. A.P.” (2003-05) and “Limnological and Faunistic Studies on Wyra Lake, Khammam Dist. A.P.” (2005-07), were conducted by the Fresh Water Biological Station, Zoological Survey of India/Hyderabad. As a part of the work the faunal diversity of fish fauna of these lakes have been studied. Fishes are very important from the biodiversity point of view enjoying different ecosystems, habitats, and niches of aquatic environment. A limited number of Date of publication (online): 26 February 2011 Date of publication (print): 26 February 2011 ISSN 0974-7907 (online) | 0974-7893 (print) Editor: K. Rema Devi Manuscript details: Ms # o1933 Received 28 January 2008 Final received 04 January 2011 Finally accepted 17 January 2011 Citation: Rao, C.A.N., J. Deepa & M. Hakeel (2011). Comparative account on icthyofauna of Pocharam and Wyra lakes of Andhra Pradesh, India. Journal of Threatened Taxa 3(2): 1564-1566. Copyright: © C.A. Nageswara Rao, J. Deepa & Md. Hakeel 2011. Creative Commons Attribution 3.0 Unported License. JoTT allows unrestricted use of this article in any medium for non-profit purposes, reproduction and distribution by providing adequate credit to the authors and the source of publication. Acknowledgements: The authors are grateful to the Director, Zoological Survey of India (ZSI), Kolkata for providing facilities and encouragement to carry out this work. OPEN ACCESS | FREE DOWNLOAD

1564

studies have also been carried out on ichthyofauna of some specific wetlands of Andhra Pradesh (Chacko 1949; David 1963; Dutt & Reddy 1979; Barman 1993 & Chandrasekhar 2003). The fish fauna of Medak District has been studied by Rahimullah (1944). The fish fauna of Khammam District was partially studied by Barman (1993). Pocharam Lake: The largest and the most important reservoir of the Medak District is the Pocharam Reservoir (water spread area 16.835km2, with a depth of about 6-7m) formed by damming the Aleru River. It was constructed between 1916 and 1922 (18008’N & 77057’E) about 100km north-west of Hyderabad in Medak and Nizamabad districts. Owing to its unique location and the presence of forested tracts, the vertebrate faunal diversity is rich in comparison to other lakes. Wyra Lake: Wyra Lake is located to the north of Wyra Town, about 25km south of Khammam between Khammam and Kothagudem towns in Khammam District. It was constructed in 1930. The lake is located 2km off the Hyderabad-Visakhapatnam highway, and is surrounded by greenery. Its water is unpolluted and potable and serves nearly 20,000 acres for cultivation and provides drinking water for 70 villages. The water spread area of the lake is about 19.166km2. Material and Methods During the course of quarterly surveys in connection with the faunistic studies of the Pocharam and Wyra lakes, fish collections were made with the help of hand operated nets of varying sizes by randomly netting different areas of the wetland. Fishermen were engaged to operate cast-nets to collect the fishes. Some fish were collected from fishermen when they were fishing, and also at the time of harvesting. Fish from various sublocalities of Pocharam Lake (Pocharam Village, Pochammaralu, Rajpet, burugupalle, Polkampet, Wadalaparthy and Kottapalle, were collected during three quarterly surveys from July 2003 to April 2005.) From Wyra Lake (Siddiq Nagar, Singarayepalem, Lallurigudem, Mallavaram, Narayanapuram, Reddigydem and Brahmanapalle) fish were collected during three quarterly surveys from April, 2006-March, 2008). The specimens were fixed in 10% formalin. Fishes were identified with the aid of

Journal of Threatened Taxa | www.threatenedtaxa.org | February 2011 | 3(2): 1564-1566

Icthyofauna of Pocharam & Wyra lakes

standard literatures on the groups viz. Jayaram (1999), Talwar & Jhingran (1991), and Menon (1999). Systematic account: From Pocharam Lake 24 species under 12 families and six orders were recorded from a total of 755 specimens collected and from Wyra Lake 22 species of fishes under 17 genera, 11 families and six orders from a total of 808 specimens were collected (Table 1). Discussion The icthyofauna of both lakes are dominated by cyprinid and cobitid species (Cypriniformes) followed by the species of perches (Perciformes) and species of other orders. Geographically both lakes are in the Deccan Plateau and are natural tributaries of the Godavari River which are meant for agriculture, fish harvesting and drinking water supply to nearby villages. These two lakes are not influenced by urban sewage and are surrounded by semi-deciduous forest with sugar cane, cotton and paddy fields. Physicochemical parameters of both lakes show similarities like temperatue (26-32 0C), pH (7.5-7.8), DO (2.53.9mg/l), etc. Because of the many similarities, the ichthyofaunal diversity is found to be similar with a few exceptions. The seedlings of commercially important fishes like Catla and Labeo are introduced by the fisheries society. Most of the fishes are common to both lakes with some exceptions like Etroplus suratensis, Channa striatus and Rhinomugil corsula which are are found only in Wyra Lake. Etroplus suratensis, a shoaling fish, is very common in the estuaries and thrives well where luxuriant growth of aquatic vegetation is available. Dense vegetation, many water plants, hiding places and open swimming areas are suitable for this species in Wyra Lake. Another fish which is reported only in Wyra Lake, Rhinomugil corsula which thrives well in estuarine waters, is also reported from the Krishna River basin. The mixing of waters of the Krishna-Godavari river basins explains the occurrence of Rhinomugil corsula in Wyra. Whereas, one specimen of Ompok bimaculatus was reported in Pocharam Lake. This is generally not cultured in lakes but might have made its entry through the Godavari River system. Some of the riverine fishes such as Sperata seenghala, Wallago attu and Rhinomugil corsula are found to be inhabiting lentic waters such as lakes and reservoirs, so the maintenance of healthy environment of lentic

C.A.N. Rao et al.

Table 1. List of fish species occurring in Pocharam and Wyra lakes. Species

Pocharam Lake

Wyra Lake

Notopteridae 1. Notopterus notopterus (Pallas) Cyprinidae 2. Salmostoma bacaila (Hamilton)

3. Chela laubuca (Hamilton)

4. Parluciosoma.daniconius (Hamilton)

5. Osteobrama vigorsii (Hamilton)

6. Puntius sophore (Hamilton)

7. Puntius ticto (Hamilton)

8. Catla catla (Hamilton)

Labeo rohita (Hamilton)

Balitoridae 10. Schistura d. denisoni (Day) Bagridae 11. Mystus vittatus (Hamilton)

12. Mystus cavasius (Hamilton)

13. Sperata seenghala (Sykes)

Siluridae 14. Ompok bimaculatus (Bloch)

15. Wallago attu (Schneider)

17. Macrognathus pancalus (Bloch)

18. Mastacembelus armatus (Hamilton)

19. Chanda nama (Hamilton)

20. Parambassis ranga (Hamilton)

21. Etroplus maculatus (Bloch)

22. Etroplus suratensis (Bloch)

26. Channa punctatus (Bloch)

27. Channa striatus (Bloch)

Belonidae 16. Xenentodon cancila (Hamilton) Mastacembelidae

Ambassidae

Cichlidae

Mugilidae 23. Rhinomugil corsula Gobiidae 24. Glossogobius giuris (Hamilton) Belontidae 25. Polyacanthus fasciatus (Schneider) Channidae

Journal of Threatened Taxa | www.threatenedtaxa.org | February 2011 | 3(2): 1564-1566

1565

Icthyofauna of Pocharam & Wyra lakes

C.A.N. Rao et al.

waters helps in the conservation of some riverine fishes. In recent times, fishes, especially freshwater fishes of the Indian region, are being threatened due to loss of habitat, as rivers are being dammed or diverted and wetlands are cleared for agriculture and for other purposes. Deleterious effects also result from over fishing, catching of breeding fish and fry, pollution of rivers and streams. Protection and conservation of lakes helps in maintaining the freshwater ichthyofaunal diversity to some extent.

REFERENCES Barman, R.P. (1993). Pisces: Freshwater fishes, India: State fauna series 5, Fauna of Andhra Pradesh, Part-I, ZSI Publication, 89-334pp. Chacko, P.I. (1949). The Krishna River and its fishes. Proceedings of 36th National Science Congress 3: 165

1566

Chandrasekhar, S.V.A. (2003). Ichthyo Fauna of Kondakarla Lake, Andhra Pradesh. Records of the Zoological Survey of India 101(1-2): 179-187. David, A. (1963). Studies on Fish and Fisheries of the Godavari and the Krishna river systems. Part I, Proceedings of the National Academic Science, Section B 33(2): 263:286. Devi K.R. & T.J. Indra (2003). An Updated Checklist of Icthyofauna of Eastern Ghats. Zoos’ Print Journal 18(4): 1067-1070. Dutt, S. & P.B. Reddy (1979). On the Snake head fishes of Andhra Pradesh. Memoirs of the Society of Zoology (Guntur) 1: 103-108 Jayaram, K.C. (1999). The Freshwater Fishes of the Indian Region. ZSI, Govt of India, xxvii+509pp. Menon, A.G.K. (1999). Check List- Freshwater Fishes of India, Records of the Zoological Survey of India Occaional Paper 175: i-xxix+366pp. Rahimullah, M. (1944). Fish Survey of Hyderabad State Part III – Fishes of the Medak District. Journal of the Bombay Natural History Society XIV: 73-77. Talwar, P.K. & A. Jhingran (1991). Inland Fishes. Vol. I, Oxford-IBH, New Delhi, 542pp.

Journal of Threatened Taxa | www.threatenedtaxa.org | February 2011 | 3(2): 1564-1566

JoTT Note

Birds of Osmanabad District of Maharashtra, India Sujit Narwade 1 & M.M. Fartade 2 Scientist-in-Charge, ENVIS Centre on Avian Ecology, Bombay Natural History Society, Mumbai, Maharashtra 400001, India 2 Principal, Shree Sivaji Mahavidhyalaya, Barshi, Solapur District, Maharashtra 413401, India Email: 1 sujitsnarwade@gmail.com (corresponding author), 2 ssmb_barshi@rediffmail.com 1

Pioneering study of the birds of the Deccan has been done by Davidson & Wenden (1878). Through an annotated checklist of the birds of western Maharashtra, Prasad (2003) compiled one for Solapur District which is the neighbouring area of our interest. Bharucha & Gogte (1990) studied the avian profile of a man-modified aquatic ecosystem in the backwaters of the Ujjani Dam while separate lists of birds of Solapur District are available in Rahmani (1989) and Mahabal (1989). Avian ecology of Solapur District, has been well studied, but the Marathwada region of Maharashtra has not yet been explored thoroughly. Through this paper we would like to draw attention towards the least known avifauna of the Osmanabad District. Study area The study area comes under the Marathwada region of Maharashtra (Fig. 1). The forest types are semi arid biotope, open scrublands and southern tropical thorn forest (Champion & Seth 1968). It

Date of publication (online): 26 February 2011 Date of publication (print): 26 February 2011 ISSN 0974-7907 (online) | 0974-7893 (print) Editor: Nishith Dharaiya Manuscript details: Ms # o2462 Received 21 May 2010 Final received 28 December 2010 Finally accepted 07 January 2011 Citation: Narwade, S. & M.M. Fartade (2011). Birds of Osmanabad District of Maharashtra, India. Journal of Threatened Taxa 3(2): 1567-1576. Copyright: © Sujit Narwade & M.M. Fartade 2011. Creative Commons Attribution 3.0 Unported License. JoTT allows unrestricted use of this article in any medium for non-profit purposes, reproduction and distribution by providing adequate credit to the authors and the source of publication. OPEN ACCESS | FREE DOWNLOAD

3(2): 1567-1576

lies on the Deccan plateau at an average of 600m above sea level. Osmanabad District comes under the low rainfall region, with about 600mm annual precipitation. We covered a total of 300km2 area in three blocks of 10x10 km2 areas at the following selected places. (i) Yedshi grassland: This includes grassland area spread between northeast of Osmanabad City and Yedshi Town (18015’N & 75059’E). (ii) Terna Lake: One of the largest dams of Osmanabad District, located 20km northwest of Osmanabad City, near Dhoki Town (18019’N & 76005’E). (iii) Masla: This village is located 38km northeast from Solapur City and 20km south from Osmanabad City. Data was collected from a small wetland, agricultural area as well as from near human habitation (17058’N & 76005’E). We also covered the areas of adjoining villages named Dahivadi, Pangardarwadi, Savargaon, Kemwadi and Malumbra. Methods Bimonthly surveys were carried out in the above mentioned selected areas from March 2007 to July 2008. The areas were surveyed using binoculars and digital cameras for proper bird records. Direct observations and species noting was made by walking on the roads, tracks, grassland and agriculture areas. The observations were carried out at different points around the large wetland. Birds were identified following Ali & Ripley (1983), Grimmett et al. (2000), and Rasmussen & Anderton (2005). The list of birds was arranged family wise following Manakadan & Pittie (2001). Current status of threatened categories was adopted from BirdLife International (2000). Habitat wise species count was carried out in four different habitats such as agriculture, wetland, grassland and near human habitation. Results A total of 165 bird species were recorded during the above mentioned survey. Out of them 109 were resident birds species, 15 were local migratory, 41 species were migratory and eight species were under the threatened category. Fifty families represent the 165 bird species with Muscicapidae comprising small birds at the top,

Journal of Threatened Taxa | www.threatenedtaxa.org | February 2011 | 3(2): 1567-1576

1567

Birds of Osmanabad District

S. Narwade & M.M. Fartade

Osmanabad District

N W

Study area

E S

Terna Lake Yedshi

Masla

Figure 1. Study area

following Accipitridae (raptors) and Anatidae (mainly ducks), showing a healthy bird diversity in the region (Table 1). Relative commonness of a species has been given as commonÂ if species was sighted 7-8 times out

of eight visits, fairly common if sighted 4-5 times, uncommon if sighted 2-3 times and rare if sighted 0-2 times out of eight visits. It was observed that out of 165 species, 112 found were common, 11 fairly common, 31 uncommon and 11were rare (Table 2). The detailed information on the threatened birds observed during the surveys has been provided separately in Table 3. General observations: Threatened birds such as Pallied Harrier Circus macrourus and European Roller Coracias garrulous (Image 1) were found over all the areas in winter. The Great Indian Bustard Ardeotis nigriceps, an endangered and endemic bird of India and Pakistan was also observed. Three bustards were seen feeding in a farmland area on the boundary of Kemwadi and Savargaon villages in November 2007. This area is just 8-10 km away from the Great Indian Bustard Sanctuary, Nannaj, Solapur. The sanctuary covers an area of 150km from Nannaj towards Ahmednagar District, but part of Osmanabad which is just 10km from the core area is still unprotected. A couple of nests and juveniles of ibises and storks found on large trees in Masla Village hinted at a heronry nearby (Images 2 & 3). We observed a colony of 12 nests of Little Tern Sterna albifrons within a 200m2 area in the summer of 2007 at Masla Lake. It is important to note that only two confirmed breeding records of Little Tern in Maharashtra are available till

No. of species

Family

No. of species

Podicipedidae

Laridae

Hirundinidae

Phalacrocoracidae

Pteroclididae

Campephagidae

Anhingidae

Columbidae

Laniidae

Ardeidae

Psittacidae

Muscicapidae

Ciconiidae

Cuculidae

Paridae

Threskiornithidae

Tytonidae

Motacillidae

Anatidae

Strigidae

Dicaeidae

Accipitridae

Caprimulgidae

Nectariniidae

Phasianidae

Apodidae

Zosteropidae

Turnicidae

Alcedinidae

Emberizidae

Rallidae

Meropidae

Estrildidae

Otididae

Coraciidae

Passeridae

Recurvirostridae

Upupidae

Sturnidae

Burhinidae

Bucerotidae

Oriolidae

Charadriidae

Capitonidae

Dicruridae

Scolopacidae

Picidae

Corvidae

Glareolidae

Alaudidae

Family

1568

Family

No. of species

Table 1. Family wise bird species information

Journal of Threatened Taxa | www.threatenedtaxa.org | February 2011 | 3(2): 1567-1576

Birds of Osmanabad District

S. Narwade & M.M. Fartade

Image 2. Painted Stork with juveniles Image 1. European Roller Coracias garrulous

Image 3. Black-headed Ibis Threskiornis aethiopica

date (Ali & Ripley 1983; Bharucha & Gogte 1990). Habitat wise seasonal changes in species count: A pie chart of habitat wise species count was prepared (Fig. 2) which indicates the use of the habitats by the

birds. The highest number of bird species was found in wetland areas following agricultural and grassland areas. Eleven species were found using all four habitats commonly. The highest number of species i.e. 130 in winter, indicates that the area provides suitable ground for many migratory birds. In summer many birds found in the afternoon, roosting near the edge of the water body to escape from the high temperatures, used to disperse into nearby areas in the evening. Juveniles and subadults of the ground nesting birds observed in winter indicate that the period of late summer and monsoons was the major breeding season. The population of some of the birds such as Blackwinged Stilt Himantopus himantopus was found high in winter, but a couple of birds observed in summer and the monsoons confirmed that some of the birds are residents. Birds such as lapwings and larks were found using wetland habitat extensively for nesting in their breeding season (Narwade et al. in press). In winter,

Table 3. Observation of the threatened birds of Osmanabad District Habitat

No. of birds

Activity

Devkuruli-Katgaon area Kemwadi-Savargaon

G A

1 3

Flying Feeding

Summer

Terna

Soaring

Summer

Terna

Basking

Painted Stork Mycteria leucocephala (NT)

Summer Monsoon

Masla, Terna Masla, Terna

W W

45 7

Resting Feeding

Black-headed Ibis Threskiornis aethiopica (NT)

Monsoon

Terna

Feeding

G G

14 4

Flying

Species

Season

Area

Great Indian Bustard Ardeotis nigriceps (EN)

Monsoon Winter

Indian Spotted Eagle Aquila hastate (VU) Oriental DarterÂ Anhinga melanogaster (NT)

Pallid HarrierÂ Circus macrourus (NT)

Winter

Yedhsi, Masla

European Roller Coracias garrulous (NT)

Winter

Masla

G/A

Feeding

Black-tailed Godwit Limosa limosa (NT)

Winter

Terna

Feeding

EN - Endangered; NT - Near Threatened; VU - Vulnerable; A - Agriculture; G - Grassland; W - Wetland.

Journal of Threatened Taxa | www.threatenedtaxa.org | February 2011 | 3(2): 1567-1576

1569

Birds of Osmanabad District

No. of species

ALL

5 G/A/W

G/A

A/W

A A/NH

22 20

Figure 2. Number of bird species observed in various habitats A - Agriculture; G - Grassland; W - Wetland; NH - Near Human habitation; / - Sign indicates and.

large flocks of small birds such as buntings, larks, weavers and sparrows were observed in agricultural areas. Seasonal variations observed in the species count at different habitats needs to be studied in detail for the bird conservation. Discussion The major cropping season here is during the monsoon, from July onwards and harvesting is carried out in October-November. Farmers cultivated short term crops such as Urid in monsoon followed by Jowar Sorghum vulgare as one of the major Kharif crops. Harvesting was carried out during JanuaryFebruary after which a large area of cropland becomes fallow due to the high temperatures and scarce water supply. This lean time was used by the people for social interactions such as weddings, which thus resulted in fewer disturbances to the wildlife. But the hunting communities got active in summer because of poor income resources which again put pressure on the wildlife. It was observed that hunters usually hunt for blackbuck, hare, quail and partridge. Rapid developmental activities are continuing to increase the crop yield, as well as, the sources for income. Factors such as use of machines in farming activities, irrigation facilities, use of fertilizers and pesticides are responsible for rapid changes in the cropping patterns throughout the area. Agricultural practices in the study area were found affecting the breeding success of ground nesting birds (Narwade et al. 2010). Due to the developmental activities the entire habitat of this district has become vulnerable to the upcoming changes. The ambitious lake linking programmes by the Godavari Marathwada Irrigation Development 1570

S. Narwade & M.M. Fartade

G/A/W Corporation (GMIDC) has been launched by the Government of Maharashtra. This may be beneficial G/A to the farmers and wetland birds, but the existing A grassland avifauna is under great threat. The area still provides some potential habitats for A/NH the declining population of the threatened birds. It is the A/W need of the hour to monitor these areas systematically in W the rapidly changing environment with a focused study NH on status, distribution and conservation of the avifauna of the region. This can be achieved only ALL strengthening public participation in the through study of status, distribution and conservation of birds of Marathwada region, Maharashtra. Once recorded as common birds of the Deccan, the Lesser Florican (EN), Black-necked Stork (NT), Red-headed Vulture (CR), White-rumped Vulture (CR), Sociable Lapwing (CR), Greater Adjutant, Lesser Adjutant (VU) were not sighted during our surveys. There is a great need to carry out proper and systematic surveys in the large geographical area of the Marathwada region of Maharashtra, India.

References Ali, S. & S.D. Ripley (1983). Compact Edition of Handbook of the Birds of India and Pakistan. Bombay Natural History Society and Oxford University Press, Bombay, 737pp. Bharucha, E.K. & P.P. Gogte (1990). Avian profile of a manmodified aquatic ecosystem in the backwaters of the Ujjani Dam. Journal of the Bombay Natural History Society 87: 73-90. BirdLife International (2000). Threatened Birds of the World. Barcelona and Cambridge, U.K. Lynx Edicions and BirdLife International, xii+852pp. Champion, H.G. & S.K. Seth (1968). A Revised Survey of the Forest Types of India. Government of India, Delhi, 402pp. Davidson, C.S. & C.E. Wenden (1878). A contribution to the avifauna of the Deccan. Stray Feathers 7: 68-95. Grimmett, R., C. Inskipp & T. Inskipp (2000). Birds of the Indian Subcontinent. Oxford University Press, New Delhi, 384pp. Mahabal, A. (1989). Avifauna of Sholapur district, Maharashtra, a semi arid biotope. Records of the Zoological Survey of India 85(4): 589-607. Manakadan, R. & A. Pittie (2001). Standardised common and scientific names of the birds of the Indian Subcontinent. Buceros (ENVIS Newsletter) 6(1): i-ix, 1-37. Narwade, S.S., K.M. Fartade & M.M. Fartade (2010). Effect of agricultural activities on breeding success of Redwattled Lapwing Vanellus indicus. National Journal of Life Sciences 7(1): 31-34.

Journal of Threatened Taxa | www.threatenedtaxa.org | February 2011 | 3(2): 1567-1576

Birds of Osmanabad District

S. Narwade & M.M. Fartade

Table 2. List of birds of Osmanabad District, Maharashtra, India Common and scientific names

Habitat

R/LM/ M

Site name

Activity

Season

Abundance

Terna

Breeding (chicks)

Monsoon

Fairly common

Terna

Drying wings

All

Common

Terna

Swimming

Winter

Rare

Terna, Masla

Feeding

Summer

Fairly common

Terna, Masla

Feeding

All

Common

All areas

Feeding

All

Common

Podicipedidae 1

Little Grebe Podiceps ruficollis Phalacrocoracidae

Little Cormorant Phalacrocorax niger Anhingidae

Darter Anhinga melanogaster Ardeidae

Grey Heron Ardea cinerea

Indian Pond Heron Ardeola grayii

Cattle Egret Bubulcus ibis

Intermediate Egret Egretta intermedia

Terna

Roosting

Winter

Uncommon

Great Egret Egretta alba

Terna

Roosting

Summer

Uncommon

Little Egret Egretta garzetta

All areas

Feeding

All

Fairly common

Purple Heron Ardea purpurea

Terna

Feeding

Winter

Rare

W/A

Ciconiidae 11

Painted Stork Mycteria leucocephala

Terna, Masla

Roosting along with Juveniles

Summer

Fairly common

Asian Openbill Anastomus oscitans

Terna

Feeding

Summer

Uncommon

Woolly-necked Stork Ciconia episcopus

All areas

Breeding (Nest, chick), Feeding

All

Common

W/A/G

LM R

Threskiornithidae 14

Black-headed Ibis Threskiornis aethiopica

W/A

Terna

Feeding with a Juveniles

Summer

Uncommon

Black Ibis Pseudibis papillosa

W/A

Masla

Feeding

Summer

Common

Eurasian Spoonbill Platalea leucorodia

Masla

Breeding

All

Common

Anatidae 17

Ruddy Shelduck Tadorna ferruginea

Terna

Swimming

Winter

Common

Northern Pintail Anas acuta

Terna

Swimming

Winter

Common

Common Teal Anas crecca

Terna

Swimming

Winter

Uncommon

Spot-billed Duck Anas poecilorhyncha

All wetland areas

Breeding, Feeding

All

Common

Gadwall Anas strepera

Terna

Swimming

Winter

Fairly common

Eurasian Wigeon Anas penelope

Terna

Swimming

Winter

Fairly common

Garganey Anas querquedula

Terna

Swimming

Winter

Common

Northern Shoveler Anas clypeata

Terna

Swimming

Winter

Common

Common Pochard Aythya ferina

Terna

Swimming

Winter

Uncommon

Comb Duck Sarkidionlis melanotos

Terna, Masla

Roosting

Summer

Common

All

All areas

Perching

All

Common

G/W/A/ NH

All areas

Feeding, breeding

All

Common

Accipitridae 27

Black-shouldered Kite Elanus caeruleus

Black Kite Milvus migrans

Brahminy Kite Haliastur indus

W/A

All areas

Perching

All

Common

Shikra Accipiter badius

A/G

Masla

Perching

All

Common

White-eyed Buzzard Butastur teesa

A/G

Yedshi

Perching

All

Uncommon

Pallid Harrier Circus macrourus

A/G

Masla

Roosting

Winter

Common

Oriental Honey Buzzard Pernis ptilorhynchus

A/G

Yedshi

Perching

All

Uncommon

Journal of Threatened Taxa | www.threatenedtaxa.org | February 2011 | 3(2): 1567-1576

1571

Birds of Osmanabad District

S. Narwade & M.M. Fartade

Common and scientific names

Habitat

Montagu's Harrier Circus pygargus

Eurasian Marsh Harrier Circus aeruginosus

36 37

Site name

Activity

Season

Abundance

R/LM/ M

Masla

Roosting

Winter

Uncommon

W/G

Terna

Feeding

Winter

Common

Crested Serpent Eagle Spilornis cheela

Terna

Perching

Winter

Rare

Short-toed Eagle Circaetus gallicus

Yedshi

Perching

Winter

Rare

Red-necked Falcon Falco chicquera

A/G

Masla

Perching

Monsoon

Common

Common Kestrel Falco tinnunculus

Masla

Perching

Winter

Rare

Bonelliâ&#x20AC;&#x2122;s Eagle Hieraaetus fasciatus

Masla

Perching

Monsoon

Common

R LM

Phasianidae 41

Painted Francolin Francolinus pictus

A/G

All areas

Calling, Breeding

All

Common

Grey Partridge Francolinus pondicerianus

A/G

All areas

Calling, Breeding

All

Common

Rain Quail Coturnix coromandelica

A/G

All areas

Calling

Monsoon

Common

Rock Bush Quail Perdicula argoondoh

A/G

Masla

Moving

Monsoon

Uncommon

Jungle Bush Quail Perdicula asiatica

A/G

Masla

Moving

Monsoon

Common

Indian Peafowl Pavo cristatus

A/G

All areas

Calling, Feeding

All

Common

A/G

Turnicidae 47

Barred Buttonquail Turnix suscitator

All areas

Calling

All

Common

Yellow-legged Buttonquail Turnix tanki

Yedshi

Moving

Monsoon

Rare

Small Buttonquail Turnix sylvaticus

Yedshi

Moving

Monsoon

Rare

Rallidae 50

White-breasted Waterhen Amaurornis phoenicurus

Masla, Terna

Feeding

All

Common

Purple Swamphen Porphyrio porphyrio

Terna

Feeding

Monsoon

Common

Common Moorhen Gallinula chloropus

Terna

Feeding

All

Uncommon

Eurasian Coot Fulica atra

Terna

Feeding

All

Common

Brown Crake Porzana akool

A/W

Masla

Moving

Monsoon

Rare

A/G

***

Flying

Monsoon

Uncommon

Masla, Terna

Feeding

Summer, Winter

Common

Masla

Feeding

Summer

Common

A/G

Masla

Feeding

Monsoon

Common

G/W/A

All areas

Breeding (23 nests)

Summer

Common

G/W

All areas

Breeding (14 nests)

Summer

Common

Masla, Terna

Breeding (one nest)

Summer

Common

Otididae 55

Great Indian Bustard Ardeotis nigriceps

Recurvirostridae 56

Black-winged Stilt Himantopus himantopus Burhinidae

Eurasian Thick-knee Burhinus oedicnemus

Eurasian Stonecurlew Burhinus oedicnemus Charadriidae

Red-wattled Lapwing Vanellus indicus

Yellow-wattled Lapwing Vanellus malabaricus

Little Ringed Plover Charadrius dubius Scolopacidae

Common Redshank Tringa totanus

Masla, Terna

Feeding

Winter

Uncommon

Spotted Redshank Tringa erythropus

Masla, Terna

Feeding

Winter

Common

Wood Sandpiper Tringa glareola

Masla

Feeding

Winter

Common

Common Sandpiper Actitis hypoleucos

Masla

Feeding

Winter

Common

Greater Painted Snipe Rostratula bengalensis

Terna

Feeding

Winter

Uncommon

Common Greenshank Tringa nebularia

Terna

Feeding

Winter

Uncommon

1572

Journal of Threatened Taxa | www.threatenedtaxa.org | February 2011 | 3(2): 1567-1576

Birds of Osmanabad District

Common and scientific names

S. Narwade & M.M. Fartade

Habitat

Site name

Activity

Season

Abundance

R/LM/ M

Marsh Sandpiper Tringa stagnatilis

Terna

Feeding

Winter

Rare

Black-tailed Godwit Limosa limosa

Terna

Feeding

Winter

Rare

Glareolidae 70

Indian Courser Cursorius coromandelicus

Masla

Feeding

Monsoon

Common

Little Stint Calidris minuta

Terna

Feeding

Winter

Uncommon

Small Pratincole Glareola lactea

Terna

Feeding

Summer

Common

Masla

Feeding

Summer

Common

Summer

Common

Laridae 73

Indian River Tern Sterna aurantia

Little Tern Sterna albifrons

Masla

Breeding (8 nests)

Whiskered Tern Chlidonias hybrida

Terna

Roosting

Winter

Fairly Common

Pteroclididae 76

Chestnut-bellied Sandgrouse Pterocles exustus

Masla

Breeding

All

Common

Painted Sandgrouse Pterocles indicus

Yedshi

Breeding

All

Common

A/NH

Masla

Feeding

All

Common

A/NH/G

All areas

Perching

All

Common

A/NH

All areas

Feeding

All

Common

All areas

Calling

All

Common

Columbidae 78

Blue Rock Pigeon Columba livia

Eurasian Collared Dove Streptopelia decaocto

Little Brown Dove Streptopelia senegalensis Psittacidae

Rose-ringed Parakeet Psittacula krameri Cuculidae

Pied Cuckoo Clamator jacobinus

A/NH

Masla

Perching

Monsoon

Uncommon

Grey-bellied Cuckoo Cacomantis passerinus

Terna

Perching

Monsoon

Uncommon

Common Hawk Cuckoo Hierococcyx varius

A/NH

Terna

Perching

Monsoon

Common

Indian cuckoo Cuculus micropterus

Terna

Perching

Monsoon

Uncommon

Asian Koel Eudynamys scolopacea

A/NH

All areas

Calling

All

Common

Southern Coucal Centropus sinensis

All areas

Feeding

All

Common

Sirkeer Malkoha Taccocua leschenaultii

Masla

Feeding

Summer

Rare

All areas

calling

All

Common

A/W/NH

Masla

Perching

All

Common

Masla

Perching

Winter

Uncommon

W/A

Terna

Perching

All

Common

A/G

Yedshi, Terna

Calling

Winter

Common

A/NH

Yedshi

Flying

All

Common

Masla

Feeding

All

Common

All areas

Perching

All

Common

Tytonidae 89

Barn Owl Tyto alba

Strigidae 90

Spotted Owlet Athene brama

Short-eared Owl Asio flammeus

Indian Eagle-owl Bubo bengalensis Caprimulgidae

Indian Nightjar Caprimulgus asiaticus Apodidae

Little Swift Apus affinis Alcedinidae

Pied Kingfisher Ceryle rudis

White-breasted Kingfisher Halcyon smyrnensis

A/W

Journal of Threatened Taxa | www.threatenedtaxa.org | February 2011 | 3(2): 1567-1576

1573

Birds of Osmanabad District

S. Narwade & M.M. Fartade

Common and scientific names

Habitat

R/LM/ M

Site name

Activity

Season

Abundance

A/G

All areas

Perching, calling

Winter

Common

Meropidae 97

Green Bee-eater Merops orientalis Coraciidae

European Roller Coracias garrulous

A/G

Masla

Perching, calling

Winter

Common

Indian Roller Coracias benghalensis

A/G

Masla

Perching, calling

All

Common

A/G

All areas

Perching, calling

Winter

Common

Masla

Perching, calling

All

Common

Masla

Perching

All

Common

A/G

Yedshi

Perching

All

Common

Upupidae 100

Common Hoopoe Upupa epops Bucerotidae

101

Indian Grey Hornbill Tockus birostris Capitonidae

102

Coppersmith Barbet Megalaima haemacephala Picidae

103

Yellow-crowned Woodpecker Dendrocopos mahrattensis Alaudidae

104

Indian Bush Lark Mirafra erythroptera

A/G

All areas

Perching, calling

All

Common

105

Ashy-crowned Sparrow Lark Eremopterix grisea

All areas

Calling, Breeding

All

Common

106

Rufous-tailed Lark Ammomanes phoenicurus

All areas

Calling, Breeding

All

Common

107

Sykes's Lark Galerida deva

All areas

Calling, Breeding

All

Common

108

Eastern Skylark Alauda gulgula

Terna

sighting

All

Uncommon

Hirundinidae 109

Barn Swallow Hirundo rustica

A/NH

Masla

Near water

Winter

Common

110

Wire-tailed Swallow Hirundo smithii

A/W

Terna

Flying

Winter

Fairly common

111

Streak-throated Swallow Hirundo fluvicola

Masla, Terna

Flying

Winter

Fairly common

112

Red-rumped Swallow Hirundo daurica

A/G

Masla

Perching

All

Common

Terna

Perching

Winter

Uncommon

Masla

Calling

All

Common

Masla, Terna

Perching

All

Common

A/W

Terna

Perching

All

Uncommon

Campephagidae 113

Common Woodshrike Tephrodornis pondicerianus

114

Common Iora Aegithina tiphia

A/W/G/ NH

115

Red-vented Bulbul Pycnonotus cafer

116

Red-whiskered Bulbul Pycnonotus jocosus Laniidae

117

Southern Grey Shrike Lanius meridionalis

A/G

Masla

Perching

All

Common

118

Bay-backed Shrike Lanius vittatus

A/G

Masla

Perching

All

Uncommon

119

Long-tailed Shrike Lanius schach

A/G

Masla

Calling

Winter

Common

W/NH

Terna

Feeding

All

Common

Muscicapidae 120

Oriental Magpie-Robin Copsychus saularis

121

Black Redstart Phoenicurus ochruros rufiventris

Terna

Bathing

Winter

Common

122

Common Stonechat Saxicola torquata

Masla, Terna

Perching

Winter

Common

123

Pied Bushchat Saxicola caprata

Masla, Terna

Perching

All

Common

124

Indian Robin Saxicoloides fulicata

A/G/NH

Masla, Terna

Breeding

All

Common

125

Bluethroat Luscinia s. svecica

A/W/NH

Masla

Perching

Winter

Common

126

Small Minivet Pericrocotus cinnamomeus

A/NH

Masla

Feeding

All

Common

1574

Journal of Threatened Taxa | www.threatenedtaxa.org | February 2011 | 3(2): 1567-1576

Birds of Osmanabad District

Common and scientific names

S. Narwade & M.M. Fartade

Habitat

Site name

Activity

Season

Abundance

R/LM/ M

127

Large Grey Babbler Turdoides malcolmi

A/NH

All areas

Calling, breeding

All

Common

128

Yellow-eyed Babbler Chrysoma sinense

Terna, Masla

Feeding

All

Common

129

Zitting Cisticola Cisticola juncidis

Masla

Perching

Winter

Fairly Common

130

Blue Rockthrush Monticola solitarius

Masla

Perching

Winter

Uncommon

131

Plain Prinia Prinia subflava

A/NH

Masla

Calling

All

Common

132

Ashy Prinia Prinia socialis

A/NH

Masla

Breeding

All

Common

133

Grey-breasted Prinia Prinia hodgsonii

A/NH

Masla

Calling

All

Common

134

Jungle Prinia Prinia sylvatica

135

Common Tailorbird Orthotomus sutorius

136

Lesser Whitethroat Sylvia curruca

Masla

On ground

All

Uncommon

A/NH

Masla

Calling

All

Common

Terna

Water Bath

Winter

Uncommon

A/NH

Masla

Feeding

Winter

Common

Paridae 137

Great Tit Parus major Motacillidae

138

Yellow-headed Wagtail Motacilla citreola

Terna

Feeding

Winter

Common

139

Yellow Wagtail Motacilla flava

A/W

Terna

Feeding

Winter

Common

140

Grey Wagtail Motacilla cinerea

Terna

Feeding

Winter

Uncommon

141

White Wagtail Motacilla alba

Terna

Feeding

Winter

Common

143

White-browed Wagtail Motacilla maderaspatensis

Masla, Terna

Feeding

All

Common

143

Tree Pipit Anthus trivialis

Terna

Perching

Winter

Common

144

Paddyfield Pipit Anthus rufulus

Masla, Terna

Feeding

All

Common

Masla

Perching

All

Uncommon

Dicaeidae 145

Pale-billed Flowerpecker Dicaeum erythrorhynchos Nectariniidae

146

Purple Sunbird Nectarinia asiatica

Masla, Terna

Feeding

All

Common

147

Purple-rumped Sunbird Nectarinia zeylonica

Masla, Terna

Feeding

All

Common

Masla, Terna

Feeding

Winter

Uncommon

Zosteropidae 148

Oriental White-eye Zosterops palbebrosa Emberizidae

149

Red-headed Bunting Emberiza bruniceps

A/G

Masla

Perching

Winter

Uncommon

150

Grey-necked Bunting Emberiza buchanani

A/G

Masla

Feeding

Winter

Common

151

Black-headed Bunting Emberiza melanocephala

A/G

Terna

Perching

Winter

Common

A/G

Masla, Terna

Feeding

Winter

Common

Estrildidae 152

Indian Silverbill Lonchura malabarica

153

Red Avadavat Amandava amandva

Masla, Terna

Feeding

All

Common

154

Black-headed Munia Lonchura malacca

Masla, Terna

Feeding

Winter

Common

155

Scaly-breasted Munia Lonchura punctulata

Masla, Terna

Feeding

All

Common

Passeridae 156

House Sparrow Passer domesticus

A/NH

All areas

Breeding

All

Common

157

Baya Weaver Ploceus philippinus

A/W

All areas

Breeding

Monsoon

Common

A/G

Sturnidae 158

Rosy Starling Sturnus roseus

Masla

Feeding

Winter

Common

159

Brahminy Myna Sturnus pagodarum

A/NH

Masla, Terna

Feeding

All

Common

160

Common Myna Acridotheres tristis

A/NH

All areas

Feeding

All

Common

Journal of Threatened Taxa | www.threatenedtaxa.org | February 2011 | 3(2): 1567-1576

1575

Birds of Osmanabad District

S. Narwade & M.M. Fartade

Common and scientific names

Habitat

R/LM/ M

Site name

Activity

Season

Abundance

A/NH

Terna

Perching

Winter

Fairly Common

A/G

Masla

Feeding

Summer

Common

Terna, Masla

Feeding

All

Common

A/NH

Terna

Calling

All

Common

Terna

Calling

All

Common

Oriolidae 161

Eurasian Golden Oriole Oriolus oriolus Dicruridae

162

Black Drongo Dicrurus adsimilis Corvidae

163

House Crow Corvus splendens

164

Long-billed Crow Corvus macrorhynchos

165

Rufous Treepie Dendrocitta vagabunda

A - Agriculture; G - Grassland; W - Wetland; NH - Near human habitation Note - Breeding activity includes records such as display by male birds, nest, hatchlings, chicks and juveniles.

Narwade, S.S., K.M. Fartade & M.M. Fartade (in press). Nesting ecology of Red-wattled Lapwing in agricultural landscape. Accepted by Life Science Bulletin. Prasad, A.Â (2003). Annotated checklist of Birds of Western Maharashtra. Buceros 8(2&3): 174

1576

Rahmani, A.R. (1989). The Great Indian Bustard. Final report. Bombay, BNHS, 234pp. Rassmusen, P.C. & J.C. Anderton (2005). Birds of South Asia - The Ripley Guide. Vols.1: Field Guide. Smithsonian Institution and Lynx Edicions, Washington, D.C. & Barcelona, 378pp.

Journal of Threatened Taxa | www.threatenedtaxa.org | February 2011 | 3(2): 1567-1576

Dr. Sekar Raju, Suzhou, China Dr. Vatsavaya S. Raju, Warangal, India Dr. V.V. Ramamurthy, New Delhi, India Dr (Mrs). R. Ramanibai, Chennai, India Dr. Robert Raven, Queensland, Australia Dr. K. Ravikumar, Bengaluru, India Dr. Luke Rendell, St. Andrews, UK Dr. Anjum N. Rizvi, Dehra Dun, India Dr. Yves Samyn, Brussels, Belgium Dr. K.R. Sasidharan, Coimbatore, India Dr. Kumaran Sathasivam, India Dr. S. Sathyakumar, Dehradun, India Dr. M.M. Saxena, Bikaner, India Dr. Hendrik Segers, Vautierstraat, Belgium Dr. Subodh Sharma, Towson, USA Prof. B.K. Sharma, Shillong, India Prof. K.K. Sharma, Jammu, India Dr. R.M. Sharma, Jabalpur, India Dr. Arun P. Singh, Jorhat, India Dr. Lala A.K. Singh, Bhubaneswar, India Prof. Willem H. De Smet, Wilrijk, Belgium

Mr. Peter Smetacek, Nainital, India Dr. C. Srinivasulu, Hyderabad, India Dr. Ulrike Streicher, Danang, Vietnam Dr. K.A. Subramanian, Pune, India Mr. K.S. Gopi Sundar, New Delhi, India Dr. P.M. Sureshan, Patna, India Dr. Karthikeyan Vasudevan, Dehradun, India Dr. R.K. Verma, Jabalpur, India Dr. W. Vishwanath, Manipur, India Dr. Gernot Vogel, Heidelberg, Germany Dr. Ted J. Wassenberg, Cleveland, Australia Dr. Stephen C. Weeks, Akron, USA Prof. Yehudah L. Werner, Jerusalem, Israel Dr. Hui Xiao, Chaoyang, China English Editors Mrs. Mira Bhojwani, Pune, India Ms. Mary Regen Jamieson, Massachusetts, USA Dr. Fred Pluthero, Toronto, Canada Dr. Krishnan Srinivasan, Chennai, India

Journal of Threatened Taxa is indexed/abstracted in Zoological Records, CAB Abstracts, Index Fungorum, Bibliography of Systematic Mycology, EBSCO and Google Scholar.

Journal of Threatened Taxa ISSN 0974-7907 (online) | 0974-7893 (print)

February 2011 | Vol. 3 | No. 2 | Pages 1493-1576 Date of Publication 26 February 2011 (online & print) Communications

Notes

Flemingia tuberosa Dalz. (Fabaceae) - a new addition to the flora of Kerala, India -- K. Subrahmanya Prasad, P. Biju & K. Raveendran, Pp. 1548-1549

Two new species of Chalcididae (Hymenoptera: Chalcidoidea) from India -- T.C. Narendran & F.R. Khan, Pp. 1506-1513 Schistura fasciata, a new nemacheiline species (Cypriniformes: Balitoridae) from Manipur, India -- Y. Lokeshwor & W. Vishwanath, Pp. 1514-1519 Current status of Western Hoolock Gibbon Hoolock hoolock Harlan in West Garo Hills, Meghalaya, India -- J.P. Sati, Pp. 1520-1526 Prevalence of intestinal parasites among captive Asian Elephants Elephas maximus: effect of season, host demography, and management systems in Tamil Nadu, India -- V. Vanitha, K. Thiyagesan & N. Baskaran, Pp. 1527-1534

Short Communications

Faunal diversity of rotifers (Rotifera: Eurotatoria) of Nokrek Biosphere Reserve, Meghalaya, India -- B.K. Sharma & Sumita Sharma, Pp. 1535-1541

A note on Diploprora championii (Lindl. ex Benth.) Hook. f. (Orchidaceae) - an interesting orchid from Karnataka, India -- A.N. Sringeswara & Sahana Vishwanath, Pp. 15501552 A new larval host record for Sphingomorpha chlorea (Cramer) (Insecta: Lepidoptera: Noctuidae) from Karnataka, India -- Ankita Gupta & Peter Smetacek, Pp. 1553-1554 Four new lycaenid butterfly records from the Kumaon Himalaya, India -- Peter Smetacek, Pp. 1555-1558 Changing biodiversity scenario in the Himalayan ecosystem: Mussoorie, Uttarakhand, India, as revealed by the study of blue butterflies (Lycaenidae) -- Avtar Kaur Sidhu, Pp. 1559-1563 ComparativeÂ account on icthyofauna of Pocharam and Wyra lakes of Andhra Pradesh, India -- C.A. Nageswara Rao, J. Deepa & Md. Hakeel, Pp. 1564-1566 Birds of Osmanabad District of Maharashtra, India -- Sujit Narwade & M.M. Fartade, Pp. 1567-1576

3rd ALCS Symposium Special Series

Chromolaena odorata (L.) King & H.E. Robins (Asteraceae), an important nectar source for adult butterflies -- P. Vara Lakshmi & A.J. Solomon Raju, Pp. 1542-1547