Auburn Speaks: The Oil Spill of 2010

Auburn Speaks

The Oil Spill of 2010

Auburn Speaks: The Oil Spill of 2010 Copyright Š 2012 by Auburn University All rights reserved.

ISBN 978-0-9848658-0-2 Auburn University is a registered trademark.

Auburn Speaks is a project of Auburn University’s Office of the Vice President for Research.

Vice President for Research: John Mason Editors: Allen Furr and Jay Lamar Managing Editor: Jo Mackiewicz Editorial Assistants: Kelsey Loftin, Kelcie Sharp Designer: Al Eiland Photographers: Jeffrey Etheridge, Melissa Humble Intern: Rachel Rimes

Sponsoring offices: Research Program Development Office Executive Director: Larry Fillmer Business Operations, Marketing, Communications, Public Relations: Leslie Parsons Caroline Marshall Draughon Center for the Arts & Humanities Director: Jay Lamar Office of University Writing Director: Margaret Marshall Auburn Speaks is produced in cooperation with the Office of Communications and Marketing.

Project Manager: Lucy LaMar Auburn University is an equal opportunity employer/educational institution.

Auburn Speaks

The Oil Spill of 2010

Office of the Vice President for Research

Contents Foreword: Dr. Jay Gogue, President of Auburn University ......................................................................................................... 1 Preface: Dr. John M. Mason, Jr., Associate Provost and Vice President for Research of Auburn University .................... 3 The Oil That Came and Does Not Leave by Dewey W. English, Jr. ............................................................................................ 4 Editors’ Note by Allen Furr and Jay Lamar ..................................................................................................................................... 6 Timeline of Events Related to the BP Oil Spill ......................................................................................................................... 10 Changing Course: River Systems, Society, and Sustainability by Lindy Biggs ..................................................................... 14 Profile: LaDon Swann by Katie Jackson ......................................................................................................................................... 20 Profile: T. Prabhakar Clement and Joel S. Hayworth by Jo Mackiewicz .................................................................................. 22 Assessing the Damage: Evaluating Oil-Spill Impacts to Alabama Coastal Wetlands by Christopher J. Anderson .......... 26 Profile: Ming-Kuo Lee by Candis Hacker Birchfield ..................................................................................................................... 36 Magnificent and Fragile: Ornithology through Audubon’s Scientific Lens

by Scott Bishop, Barry Fleming, and Geoffrey Hill ............................................................................................................................ 38 Profile: Stephen Szedlmayer by Leslie Parsons .............................................................................................................................. 46 A Forgotten Population: The Southeast Asian Community of Alabama’s Gulf Coast by Christopher Lupoli ................ 48 Profile: Bill Walton by Katie Jackson ............................................................................................................................................... 58

Deep Water: Hurricanes Hold Little Fear for Coastal Alabamians.

The Harm That Men Do? That’s Different by Judith Sheppard ................................................................................................... 62 Profile: Cova Arias by Jo Mackiewicz .............................................................................................................................................. 76 The Risks of Exposure: One Coastal Community’s Experience with Health Symptoms Caused by the BP Oil Spill by Paula Bobrowski and René McEldowney .................................................................................... 78 Profile: Ash Bullard by Jo Mackiewicz ............................................................................................................................................ 82 Help from a Common Inhabitant: Identification of Exposure Biomarkers in an Indigenous Fish Species

by Calvin M. Johnson, Joseph Newton, Ash Bullard, Chad Foradori, and Bernhard Kaltenboeck .............................................. 86 Profile: Dennis DeVries and Russell Wright by Jay Lamar ........................................................................................................ 90 Tiny Sentinels: How the Oil Impacts the Little Guys by Ken Halanych ................................................................................. 92 Profile: Michelle R. Worosz by Jo Mackiewicz .............................................................................................................................. 96 Planning Ahead: The Genesis of a Disaster-Response Plan in Two Parts by Jeana Baker and Derek G. Ross ................. 98 Profile: Yucheng Feng by Katie Jackson ...................................................................................................................................... 104 Toward Recovery: The Economic Impact of the BP Oil Spill on Marine-Based Industries in Coastal Alabama by Terry Hanson and Jeana Baker ........................................................................................... 106 One Year After: Community Response and Use of Mental Health Services by Danilea Werner and Chris Locke ...... 114 Editorial: Special to the Press-Register (Mobile, Alabama), Sunday, July 04, 2010, The Big Lesson

by T. Prabhakar Clement, Michael Kensler, and Michelle R. Worosz ........................................................................................... 122 Addictive Behavior and Faustian Bargains by Conner Bailey .............................................................................................. 124 Glossary ............................................................................................................................................................................................. 126 Works Cited ...................................................................................................................................................................................... 128 Contributor Biographies .............................................................................................................................................................. 132

Foreword

Photo by Rebecca Long

Dr. Jay Gogue President of Auburn University On April 20, 2010, an oil-drilling rig in the Gulf of Mexico exploded, setting off a chain of events that led to the single largest environmental and economic disaster in the history of the region. In the months following the explosion, five million barrels of oil spilled into the Gulf, imperiling not only the offshore and coastal ecosystems but also the economies that depend on them.

Experts at Auburn University, 250 miles inland in east central Alabama, responded immediately.

As part of Alabama’s only land- and sea-grant institution, Auburn researchers and extension professionals had been working in the Gulf region for decades and thus held institutional knowledge about the Gulf Coast’s complex social, environmental, and economic systems. As the tragedy unfolded and its full scope became known, Auburn researchers from nearly every discipline began to direct their expertise to the Gulf of Mexico.

It is in such moments of crisis that the value and power of the land-grant institution are revealed. Auburn is more than a place providing comprehensive, quality education. Auburn is more than a place where good science is applied to practical problems and where extension agents work side by side with farmers, foresters, and entrepreneurs. Auburn is an institution with both the will and capacity to help society solve its most urgent problems.

Because this aspect of Auburn University is little known and often not well understood, I am particularly pleased to introduce Auburn Speaks. Produced jointly by the Office of the Vice President for Research, the Caroline Marshall Draughon Center for the Arts & Humanities, and the Office of University Writing, Auburn Speaks is intended to be an annual book series focusing on a specific research topic. Each year, through Auburn Speaks, we hope to bring you images and articles capturing our role in addressing the increasingly complex issues facing our state, nation, and world.

This, our first edition, is devoted to chronicling Auburn University’s research related to the catastrophic oil spill in the Gulf. As you will discover, our efforts in the Gulf predate the spill and extend far beyond addressing immediate impacts. Already, the work of Auburn University experts has been recognized by the National Science Foundation, by the Gulf of Mexico Alliance’s Gulf Research Institute, and perhaps most important, by the people of the region. Tony Kennon, the mayor of 1 Orange Beach, Alabama, observed, “People want to know what’s really going on and what our future looks like. Auburn responded quickly, assessed and understood the situation, and took action to provide us with the information and data we needed to move forward.”

Mayor Kennon captured the very essence of research at Auburn University—dedicated experts building on land-grant traditions to find out what is really going on and what the future looks like.

Auburn Speaks is their story, and I am pleased to share it with you.

Preface

2

Photo by Jason Adams

Dr. John M. Mason, Jr. Associate Provost and Vice President for Research of Auburn University I am continually struck by the passion with which our award-winning faculty find researchbased, practical solutions to a variety of realworld problems. Our experts add to the store of knowledge—developing new processes, materials, and technologies along the way. They then take this expertise and focus it on real-world challenges and problems. In putting good ideas to work, Auburn researchers improve quality of life, strengthen the economy, and help keep us safe and secure.

When Margaret Marshall, director of University Writing, and Jay Lamar, director of the Caroline Marshall Draughon Center for the Arts & Humanities, approached me about crafting a book series on Auburn’s research faculty, I was delighted.

The goal was not to create an anthology of material about Auburn research taken from the news media, but to tell you the stories behind the headlines.

Thus, Auburn Speaks was born. In the pages that follow, you will be introduced to our experts. You will see firsthand what motivates them, hear about the challenges they face, and gain an understanding of how their commitment and perseverance have led to innovation, discovery and, we hope, recovery.

In considering an appropriate topic for the first edition of Auburn Speaks, we felt that there was only one choice: the Deepwater Horizon oil spill.

Perhaps the most significant environmental and economic disaster in the history of the region, its scope was and is tremendous. Given the breadth and complexity of the catastrophe, faculty from nearly every area of campus were called upon to address a panoply of issues, ranging from the chemical aspects

of mitigation to ecological assessment and environmental and socioeconomic restoration.

Through Auburn Speaks, we now have the opportunity to introduce you to these talented and truly dedicated faculty researchers who are making a difference not only in the Gulf of Mexico but also around the world. Thank you for your interest in our experts and their efforts and, of course, for your support. To learn more about Auburn University research, visit us online at www.auburn.edu/research.

3

Photo by Jeff Etheridge

The Oil That Came and Does Not Leave

by Dewey W. English, Jr.

Fort Morgan

4

It is the most blue-sky August beach day that you ever saw, a perfectly perfect day like back when you were seven and riding the blowup float in the surf with your little sister, and your mother, in her daring two-piece bathing suit, nervous about your fate, stood in the foam.

I pull up to the little guard shack, where the kind woman taking my four dollars from the other side of the car window says that the day’s tar balls are gone. She says, “They come through and got ’em this morning when they washed up.”

I say, “There were 10 million out here last time I was through in March.” And she says, “They got this tractor and they raked ’em in piles.”

And out past the stark and wind-whipped fort, at the end of the old brick boardwalk, past the sign

marking the first Alabama soldier to die in the Civil War (a scholarly fellow who drowned somehow), she is exactly right.

It all seems a miracle.

At the farthest western edge of the Fort Morgan Peninsula, the prettiest place in Alabama, where countless tar balls afflicted the sand not five months ago, the filthy children of the Gulf spill of 2010, they seem to be all gone.

There are just the usual beach trinkets to be had: fish bones, bottle caps, small shells, Styrofoam plates, nylon rope, plastic forks, a right-foot flip-flop.

But it’s back from the water, where the beachgrass sprouts and where the scrub rises, that you find the best stuff at the beach—and the strangest stuff, too—blowing in with the storms. And there on this day tar balls hide.

I see 30, maybe 40, in the first minutes, like copper-brown and grimy coat buttons scattered in the sand and thin brush.

The men who come through missed ’em, I’ll have to tell the lady at the shack.

A tar ball isn’t a ball, but a brittle oil pancake, dredged in sand. The bitsy pieces, when you crush them to nothing with your thumb and forefinger, are sticky like cupcake icing. They bring to mind, when you hold them close to your nose, a bouquet of Quaker State and burned tires.

I wish I could tell you that the great spill is over and done, but I’m a newspaperman down here in Mobile, and know that it’s not. Tar balls at my feet on a lovely Sunday testify to that. So also do the articles in this book, the work of remarkable men and women from my school, Auburn University,

who’ve seen the truth with their own eyes, and who speak on these pages of ways that the Gulf Coast and its people were harmed and ways that they can be made whole.

Here’s a history of the Gulf oil spill, told in a single Faulknerian sentence of 114 words: The explosion of the Deepwater Horizon rig at or before 10:00 p.m. (CDT) on Tuesday, April 20, 2010, 100 miles south of Dauphin Island, killed 11, and shattered pipes linked to the Macondo well on the lightless seafloor nearly a mile below, loosing a torrent of raw oil that spewed at a rate of millions of gallons a day from an opening no bigger than 20 inches across, uncappable by BP and all of Obama’s men until July, unkillable until relief drillers broke through in September; that pushed northward with the winds and the currents—environmental, economic, and social catastrophes bundled into a terrible one—the effects not fully known to the present day, and certainly not healed.

I have a brief private history of the spill, too, from when it sat at my shoulder in the Press-Register newsroom in downtown Mobile all that urgent summer and from when it went with me home across the bay at night. It goes like this:

Reporter Ben said, “Our story’s going to say that it’s 10 times worse than they’ve been telling.”

Front-page editor Chris said, “You hear that?

They’ve got tar balls at Dauphin Island.”

Photographer Bill said, “I’m down here in Gulf Shores watching little kids dipping sticks in it.”

Realtor wife Janet said, “I knew the buyers would walk when we went out on the deck, and Fairhope smelled like lighter fluid.”

The fourth-largest corporation in the world said, “Making This Right.”

Crisis, shock, slime, foreboding, promises: That’s the spill, summed up tight. Oil invaded, tourists fled, the economy tanked, even the wind seemed wronged, and Making Right will take a very long time.

Petit Bois Island We are on Petit Bois Island, a few miles west of Alabama in Mississippi waters, on a gauzy, golden September day.

You have to be trying to come here, to come here. Petit Bois is small and stark, accessible only by boat. Trees shaded the heart of beautiful Petit Bois once, near a pond fed by rain, but now there

are only frail tilting trunks. Katrina did them in, I’m told.

A crew of spill-survey boys have been here this morning—whether from BP or the government, we couldn’t tell—their boot tracks fresh in the sand.

A tropical storm sideswiped the island four days ago. We wonder, like the survey crew, what spill surprises that the storm might have churned up and slung northward.

In a grocery bag, we collect tar balls until it becomes tiresome. One is oddly like a black doughnut filled with black pudding. Another is like a hard dog toy with a rubbery center.

The spill, a Press-Register colleague wisely 5 observes as we walk, is something that he and I and all the other witnesses will never really get past. Every mysterious fish kill, every unexplained sheen, every expansive shadow down below, we’ll remember and wonder and fret.

The spill is part of who we are now on the coast, as people and as a place.

Sun and sandcastles, pelicans arcing upward, croakers on the hook, shrimp on the grill, the bays silvery in the moonlight and, now, tar balls tumbling in with the seashells. There is something so sad about that.

Editors’ Note

by Allen Furr and Jay Lamar

6

Photo by Jeff Etheridge

Welcome to the inaugural edition of Auburn Speaks.

An annual publication featuring research at Auburn University, Auburn Speaks strives to speak clearly and engagingly about issues that impact life and work in our state and beyond.

As a land-grant university, Auburn serves the state and its people as a discoverer of new knowledge and ideas and as a repository of science, literature, history, art, and culture. Because the community at large cannot easily see many of these contributions, Auburn Speaks seeks to translate and make accessible the sometimes dense and mysterious language of research and to show how Auburn University is responsive to the interests and concerns of Alabama.

This first volume of Auburn Speaks focuses on the British Petroleum (BP) oil spill, which has had enormous impact on individuals, communities, and the environment throughout the region. The crisis began with the explosion of the Deepwater Horizon rig on April 20, 2010, which was drilling

on the Macondo Prospect on behalf of BP. The explosion killed 11 men and injured 17 more.

Between April 20 and July 15, the wellhead blowout that caused the explosion dumped approximately 4.9 million barrels of oil into the Gulf of Mexico. Not until September 19 was the well deemed “effectively dead” by the federal government.

Auburn University was a first responder to the Gulf oil spill. In fact, Auburn University researchers had been working in the Gulf—on boats, on the shoreline, and in the towns and wetlands of Alabama’s coastal region—for decades. The baseline data that earlier research provided, as well as a rich familiarity with the region and its people, gave Auburn University faculty, staff, and students unique access to and appreciation of the disaster.

As you will see, Auburn University researchers are not only deeply involved in the academic understanding of the spill and its aftermath, but also are speaking to the practicalities of recovering from the current calamity, preventing future such catastrophes, and bringing attention to the vulnerabilities to which disasters expose us.

The contributions to Auburn Speaks are academically diverse, and this diversity illustrates the depth and scope of the spill. For instance, Lindy Biggs, professor of history and first director of Auburn University’s sustainability initiative, writes compellingly about ecological systems and the importance of understanding and working within them. Civil engineering professors Prabhakar Clement and Joel Hayworth, along with a team of graduate students, investigate “remnant oil” and BP’s Operation Deep Clean, while Chris Anderson 7 from the School of Forestry and Wildlife Sciences explores the presence of oil in wetlands and outlines an experiment in which he and his students measure the toxicity of oil for native plants. An alumni professor in the Department of Biological Sciences, Ken Halanych studies meiofauna, microscopic animals that live in the bottom of the sea.

The answer to his research question—is the community of meiofauna the same before and after the contamination?—will offer significant information about the impact and severity of the spill.

Graduate student Jeana Baker and Derek Ross,

an assistant professor of technical and professional communication in the English Department, detail how crisis information should be disseminated in a way that brings community members and experts together. Along with Michelle Worosz, an assistant professor in the Department of Agricultural Economics and Rural Sociology, they extend research into teaching, encouraging students to address realtime, real-world issues as part of their class work.

For a truly deep historical perspective, Scott Bishop of the Jule Collins Smith Museum of Fine Art, professor of art Barry Fleming, and biological sciences professor Geoffrey Hill compare John James Audubon’s Gulf Coast images and writ8 ing with the contemporary Gulf, almost at the moment of the spill. Forestry graduate student Chris Lupoli visits Bayou La Batre to explore the impact of the spill on that community’s diverse population. Judith Sheppard, faculty member in the Department of Communication & Journalism, teaches advanced writing and reporting courses, feature writing, and literary journalism. Her piece for Auburn Speaks brings to bear the skills of a practicing journalist—interviews and photographs—on capturing the stories of the people who experienced the BP oil spill firsthand.

Fascinating work on oil exposure in fish populations comes from professor of pathobiology and

acting dean of the College of Veterinary Medicine Calvin Johnson and his team of researchers.

Associate professor in the Department of Fisheries and Allied Aquacultures, Terry Hanson, along with research assistant Jeana Baker, investigates the spill’s impact on the economies of Baldwin and Mobile counties. Job losses and industry downturns are but two of the factors that impact mental health of those caught up in the disaster. Danilea Werner and Chris Locke, both assistant professors in the Department of Sociology, Anthropology, and Social Work, look at the effects of disasters on the mental health and well-being of Gulf Coast residents, while College of Liberal Arts associate dean Paula Bobrowski and associate professor René McEldowney, both in the Department of Political Science, consider the injuries and illnesses resulting from both the spill and subsequent cleanup process.

In addition to feature articles written by the researchers themselves, Auburn Speaks profiles faculty, extension specialists, and students who are conducting work on the spill. LaDon Swann, director of the Mississippi–Alabama Sea Grant Consortium and the Auburn University Marine Extension and Research Center, helps leverage federal, state, and local support on behalf of the Gulf ’s natural and human resources. As an exten-

sion specialist and professor in the Department of Fisheries and Allied Aquacultures, Steve Szedlmayer has spent almost two decades studying finfish—enjoyed at the dinner table as red snapper—while his colleague in the department, extension specialist and associate professor Bill Walton, works to keep oysters on the menu. Also from the Department of Fisheries and Allied Aquacultures, Cova Arias, an associate professor, looks at pathogens in the ubiquitous tar balls associated with the spill, and Ash Bullard, an assistant professor, looks at fish parasites—and hopes to overcome their “yuck” factor in the popular imagination.

Yucheng Feng, professor of soil microbiology in the Department of Agronomy and Soils, focuses on the environmental fate and impact of organic pollutants and other contaminants in soil and water.

Fisheries professor Dennis DeVries and associate fisheries professor and extension specialist Rusty Wright have worked in the Mobile–Tensaw River Delta area for almost a decade. Their baseline information provides a nuanced prespill picture of the region and the foundation for postspill analysis.

Ming-Kuo Lee, a professor in the Geology and Geography Department, along with research assistants Mike Natter and Jeff Keevan, monitors such toxic metals as mercury and arsenic, both found in crude oil.

Photo by Jeff Etheridge

Finally, Conner Bailey, professor in the Department of Agricultural Economics and Rural Sociology, brings to bear his many years of observing and participating in environmental issues in Alabama to convey a note of caution—and responsibility—as we go forward after the BP disaster.

In addition to sharing the information and insights growing out of the research and teaching of Auburn University faculty, students, and staff, we also hope that Auburn Speaks will engage its readers in opportunities to learn and discuss its topics. When this edition launches, we will be seeking connections in your community—for reading-discussion programs, lecture series, and public forums that help citizens of the state learn, explore, and share. For more information—including a database of information and readings—please go to the website: www.auburn.edu/auburnspeaks.

Auburn Speaks is a true “Auburn Family” creation. All aspects of Auburn Speaks—the contributors, profile subjects, editors, and designers— involve Auburn University faculty, students, staff, and alumni. For support of Auburn Speaks, we are indebted to Dr. John Mason, Auburn University’s vice president for research. Kudos to Larry Fillmer and Leslie Parsons of the Office of the Vice President for Research and Dr. Margaret Marshall, director of the Office of University Writing. For

bringing it to the page, we thank these folks from the Office of Communications and Marketing: Danna Bradford, photo scheduling; Al Eiland, art direction and graphic design; Jeff Etheridge and Melissa Humble, photography; Lucy LaMar, marketing; and Barbara Webster, photo scheduling. Special thanks go to Dr. Jo Mackiewicz and her graduate students, Kelsey Loftin and Kelcie Sharp, in the Master of Technical and Professional Communication program for their editorial skill and diligence. And, of course, we are most indebted to the many contributors who shared their time, expertise, and commitment to telling Auburn University’s research story.

To date, the BP oil spill is the largest marine oil spill in the history of the petroleum industry. Its impact will continue to be felt for years, perhaps decades. But the story doesn’t end there. In fact, the articles and essays that follow attest to the enormous resilience of the environment and people of the Gulf Coast. They are resources that make the future bright. Every day, through their research, teaching, and outreach, Auburn University faculty, staff, and students dedicate themselves to supporting that resilience and to offering information, understanding, and action that contribute to that brighter future. That is the message of Auburn Speaks.

9

April 20

Timeline of Events Related to the BP Oil Spill 2000–2001 10

Hyundai Heavy Industries in South Korea builds the Deepwater Horizon rig and delivers it to its site in 2000. The rig goes into operation in 2001. The rig can operate in water over 8,000 feet and to a maximum drill depth of 30,000Â feet.

At 9:45 p.m. (CDT), gas, oil, and concrete explode onto the deck of the Deepwater Horizon rig from the wellbore and catch fire. The explosion kills 11 workers and injures 17 others.

2010 April

Photo by Jeffrey Warren

May 7 BP lowers a 125-ton container dome over the largest well leak with the intention of piping the oil to a storage container on the surface.

April 30 April 25 BP sends two floating rigs to drill two relief wells.

Oil comes ashore at Venice, Louisiana.

Governor Riley of Alabama and Governor Barbour of Mississippi declare a state of emergency.

May 6 An oil sheen is discovered in the south Chandeleur Islands.

May

May 8 BP reports that because methane freezes at the top of the container dome, the dome will not work. Tar balls wash ashore on Alabama’s Dauphin Island.

May 2

April 21 Coast Guard Rear Admiral Mary Landry is named the federal on-scene coordinator.

Coast Guard log reports that the potential threat of the spill is “8,000 barrels per day of crude oil, if the well were to completely blow out.” The log also notes that “most of the current pollution has been mitigated by the fire.”

April 29 Governor Jindal of Louisiana and Governor Crist of Florida declare a state of emergency.

April 22 The Deepwater Horizon sinks. Coast Guard Petty Officer Ashley Butler says, “Oil was leaking from the rig at the rate of about 8,000 barrels of crude per day.”

President Obama makes his first visit to the Gulf Coast. He travels by plane, car, and helicopter to reach Venice, Louisiana. Interior Secretary Ken Salazar tells CNN, “Our job basically is to keep the boot on the neck of British Petroleum.”

May 10 BP announces a new strategy involving a containment vessel; the plan is dubbed “top hat.”

May 9 BP announces another strategy, dubbed “junk shot”; it involves pushing mud and debris such as shredded tires into the leak to clog it.

May 15 The Coast Guard and the EPA authorize use of dispersants underwater at the source of the leak.

11

Photo courtesy of Infrogmation of New Orleans

May 30 BP President Tony Hayward apologizes to the people of the Gulf Coast for the spill, then notes that he too would like his life back: “There’s no one who wants this thing over more than I do. You know, I’d like my life back!”

May 19 Oil washes ashore on mainland Louisiana.

After a torrent of criticism, BP President Tony Hayward apologizes for saying on May 30 that he would like his life back.

June 16 Following a meeting with President Obama, the BP board of directors agrees to create a $20-billion fund for assistance.

June May 26

12

June 2

After strategies “top hat” and “junk shot” fail, BP announces a new plan, dubbed “top kill.”

It involves forcing heavy mud into the leak.

May 29 BP states that “top kill” too is a failure and announces another strategy: a cap containment system called the “lower marine riser package.”

June 1

June 4

Oil begins to wash ashore on the Gulf Islands National Seashore. The National Oceanic and Atmospheric Administration (NOAA) extends the limits of the area closed to fishing.

The new boundaries include Alabama and Florida waters and cover 31% of the Gulf of Mexico.

Tar balls wash ashore in Pensacola, Florida.

June 23 Advisories against swimming and fishing are extended for 33 miles east of the state line between Alabama and Florida.

Photo by Jeff Etheridge

July 12 A capping stack is installed, a step that completes the new 40-ton containment cap. Well-integrity tests begin.

July

August 4 BP announces that the static-kill strategy—clogging the well with drilling mud—has worked: the drilling mud is controlling the well pressure.

July 22 NOAA reopens one-third of the waters closed to fishing.

September

August

August 23

July 10 BP begins replacing the old containment cap with a new cap. For 48 hours, oil flows unabated.

Photo by Michelle Worosz

July 15 BP completely cuts off the flow of oil at 2:25 p.m. (CDT).

Gulf Coast Claims Facility Administrator Kenneth R. Feinberg announces the Gulf Coast Claims Facility is functioning and will begin to process payments from BP’s fund to individuals and businesses.

One year later, $5 billion has been paid to people in Louisiana, Alabama, Mississippi, Florida, and Texas.

September 19 Thad Allen, the national incident commander, says that the BP well is “effectively dead.”

13

135

Changing Course

by Lindy Biggs

River Systems, Society, and Sustainability

L

indy Biggs came to Auburn University’s Department of History as a scholar of technology and its social context and consequences. However, as the founding director of the Auburn University Office of Sustainability, she has in recent years found herself drawn increasingly to environmental history. Her essay for Auburn Speaks reflects her discovery that the way we think can make all the difference in how humankind works with, not against, fragile ecosystems. In the following essay, Biggs offers context for the Gulf by considering the history of human activity on the Mississippi River. This larger picture points the way toward a future that encourages responsible decision making for both.

—Allen Furr and Jay Lamar, Editors

“Why, sometimes I’ve believed as many as six impossible things before breakfast.”

—the Queen, in Lewis Carroll’s Through the Looking Glass and What Alice Found There

In 2011, the condition of the Mississippi River and the Gulf of Mexico, into which it drains, is the result of more than a hundred years of human activity driven by a perspective that regarded the river as many things, but rarely as a living ecosystem. Consequently, the river and the Gulf of Mexico have been severely degraded, compromising the communities (human and nonhuman) that depend on it.

A sustainability approach to living with the river would view and respect the river as a natural system. First and foremost, a sustainability approach is realistic in terms of what we can expect of nature.

We must all be ecologists and understand underlying principles: what is the nature of the river, and what are the limits of control? We humans have a hard time thinking in nature’s time framework; we think in terms of days, weeks, and years rather than decades and centuries. We change what seems to be a small piece of natural system—straightening a bend in a river, for instance—and then we are sur-

prised when 10 years later that straightened river’s banks erode or flood [1].

Sustainability, the belief and practice of protecting life on earth by assigning value to the environment and social justice in addition to economics, requires a paradigm shift—a change in how we think about the world. It is a shift from what many have called “business as usual”—using natural 15 resources as if they will be forever renewed and treating growth and profit as though people can eat and drink money. Sustainability offers a new way of thinking, and a good place to start is by understanding systems. A sustainable world is based on new approaches to everything we do—from the way we build our buildings, supply food and water, and provide energy—to radically new problemsolving techniques that use nature as a guide, such as learning how to make industrial ceramics by using sea water and a small amount of electricity.

Sustainability practitioners (engineers, scientists, business people, architects, planners, and more)

are developing new solutions to old problems.

In her introduction to Thinking in Systems, Donella Meadows recounts an experience at Dartmouth College shortly after her research group moved there: “One of the engineering professors watched us in seminars for a while, and then dropped by our offices. ‘You people are different,’ he said. ‘You ask different kinds of questions. You see things I don’t see. Somehow you come at the world in a different way’” [2, p. 6].

What the engineering professor saw was Meadows and her group using systems analysis in problem solving. A system is sometimes hard to define because of its complexity, but it is easy 16 to see when it’s in front of you. According to Meadows, “A system is an interconnected set of elements that is coherently organized in a way that achieves something. . . . [It consists of] three kinds of things: elements, interconnections, and a function or purpose” [2, p. 11]. It’s easy to identify the elements, but it is not so easy to see all of the interconnections and purpose because we humans often like to see the purpose of everything in nature as relevant to our own lives. Understanding the system—on its own terms and through its own parts—results in better problem solving, better organizational development, better everything because it considers connections and causation. It

helps keep us from focusing so narrowly that we miss relationships that will result in unintended consequences that create new problems; a systems approach minimizes the new problems and results in better long-term solutions.

In her final chapter, Meadows offers “systems wisdoms”—things she learned over 40 years of working in systems analysis. I’m going to build on her first wisdom: “Before you disturb the system in any way,” she says, “watch how it behaves . . . [and] study its beat. If it’s a social system, watch it work.

Learn its history” [2, p. 170]. By starting with the behavior of the system, we ask dynamic, not static, questions. We ask not only “what’s wrong” but also “how did we get there?” [2, p. 171].

What’s Wrong, and How Did We Get Here?

The most important river in the United States, the Mississippi, is more than 2,000 miles long, and its watershed covers 40% of the continental United States. It drains water from the Appalachian Mountains to the Rockies and defines the borders often states. To those who do not depend on it daily, the river is best known as a transportation system that ships agricultural goods, coal, and other minerals mined in the Midwest to the Port of New Orleans. To those who live near the river, it sup-

plies water for domestic and industrial use, power generation, aesthetics, and recreation. It also provides ecosystem services of great significance: habitat for fish and other wildlife and cultural services of recreation and tourism. Economics is one way to evaluate the river, and it has been the primary lens through which the river has been viewed. In the interest of a growing economy, the river has been straightened, dammed, contained, and polluted.

The consequences range from increased flood damage to habitat loss and significant damage to the very economy that the river enabled.

The Mississippi is a cantankerous river. In its natural state, regular flooding reshapes the banks, topples trees, builds islands of silt in the river, and cuts new channels. The large amount of silt that drains from the West via the Missouri River makes the river into what Charles Dickens called “running liquid mud . . . choked and obstructed with huge logs and whole forest trees” [3, p. 204]. That is the river’s nature that we have struggled with since the eighteenth century.

The Mississippi is usually discussed as three parts: upper, middle, and lower. For our purposes, it is useful to think about two parts: the upper begins in central Minnesota at Lake Itasca, the source of the Mississippi. The lower flows from St. Louis to the Gulf. The river is as different in these

two portions as are the climates in Minnesota and Louisiana. The upper river was engineered to manage shipping channels. It was a highway of water first for logs from the Midwest forests and later for mining and agricultural products. To move logs downriver in the nineteenth century, log drivers blocked the side channels and built structures to keep logs in the center of the river. Agriculture and mining followed logging in the Midwest economy, and the barges shipping grain and minerals grew larger over the century. To keep the shipping channels open and deep all year, the Army Corps of Engineers dammed side channels, dredged the central channel, and removed any obstruction that created rapids. This engineering work reduced the seasonal flooding and wetlands.

In addition, agriculture changed the river banks.

Farmers removed vegetation and planted crops as close to the river as they could. Removing the riparian buffer (a protective vegetative area) not only destroyed animal habitat, but it also allowed eroding soil to fall into the river. In the twentieth century, significant amounts of pesticides and herbicides went with it. Those chemicals ended up in the Gulf of Mexico, where they stay, in part because the river lost considerable wetlands that would have filtered some of the toxic runoff.

The history of the lower Mississippi, where the

Photo by Jeff Etheridge

river is wider and deeper, is different; its history revolves around levees to control flooding of towns and cotton fields. Throughout history, humans have built settlements next to water and around transportation networks. Before the advent of the railroad in the early nineteenth century, all cities grew on the banks of rivers. Rivers enabled trade, supplied water, and provided habitat for animals that people depended on. The Mississippi was more important than any other river in the United

States because of the length and the breadth of its watershed. It offered abundant economic opportunities in terms of transport in the earliest years of American settlement. Two of the most important cities in nineteenth-century America, New Orleans and St. Louis, were built on the banks of the river, and the river made them what they were. The river’s regular floods also created some of the richest farmland—bottomland—in the country.

The river was an economic engine in the eighteenth century when Midwestern farmers shipped goods to the Port of New Orleans for sale to Europe. Its significance grew after the invention of the steam engine in the early nineteenth century.

Steam power meant faster trips between St. Louis 17 and New Orleans and, most important, made the trip up river almost as easy as the down-river trip.

With the advent of the railroad in the nineteenth century and air travel in the twentieth, the river lost its monopoly on supplying the middle and western parts of the country but continued to be an important shipping lane. Today it continues to ship large volumes of grain from the Midwest and remains vital to the life and economy of the Midwest and South. Some say that the world economy would be affected if the Mississippi and Port of New Orleans ceased to function.

The modern history of the lower river and its

18

Photo by Jeff Etheridge

problems begins with the nineteenth-century debate over flood control. By the time critical decisions were made about reshaping and controlling the river, there was already extensive knowledge of river systems—especially the river system of the Mississippi. Some nineteenth-century reports about the river are still regarded as essential texts.

Even though the science clearly pointed to one set of solutions, others were chosen based on politics and personalities. As told in John Barry’s Rising Tide, the river’s story concerns rival engineers, both brilliant but constitutionally fated to oppose each other. Barry’s book leaves the reader wondering how different the history of the Mississippi would have been if the engineers had followed the science [4].

Flood-control engineering on the lower Mississippi (below St. Louis) has been successful, but not as successful as the Army Corps of Engineers would hope or claim. Continued flooding is obvious, but there is collateral damage— unintended consequences of flood control. Much of the river’s ecosystem has been degraded by the levee system. Some argue that the levees have actually increased flooding intensity, and there is no doubt that they have destroyed coastal wetlands.

The wetlands and bayous are natural defenses against hurricanes, and they are disappearing from

Mississippi to Texas. The bayous of Louisiana do more than protect our cities from hurricanes; historically, they have been the second-most productive fishery in the United States, providing habitat for wildlife that makes “the Florida Everglades look like a petting zoo” [5]. Since the late 1970s, the National Wetlands Research Center has been researching land loss in coastal Louisiana. In 1981, the center first indicated that coastwide rates of land loss from 1956 to 1978 approached 44 square miles per year [6]. Louisiana continues to lose about 25 square miles of land each year. The delta lands naturally compact and sink over time; they depend on spring flooding to deposit new layers of sediment. Without the flooding, nothing keeps the land from sinking. Many coastal communities are now several feet under water.

Systems Analysis and Sustainability The loss of the bayous was not a planned outcome of the levee system. It happened because the engineers weren’t looking at the whole system. The levees are not the only pressure on the bayous; the oil industry has taken a huge toll. But that’s a topic for another article.

How can we use dynamic systems analysis and sustainable practices to restore the bayous? Highly functioning systems, human communities or

ecosystems, have three essential characteristics: resilience, self-organization, and hierarchy. Healthy systems are resilient. They bounce back after being stressed. Resilience is the opposite of brittle or rigid. As Meadows says, “People often sacrifice resilience for stability, or for productivity” [2, p.

77]. When we apply this idea to the Mississippi, we can see that the goal was to have an unchanging river—no flooding, no filling of the shipping channel. But that isn’t how a river works. When we make a river into something resembling an engineered canal, we lose the life of the river.

Healthy systems self-organize: they move from simplicity (a seed) to complexity (the adult organism). It is a function of all life that we tend to take for granted. As a small stream becomes a larger river system, it develops complexity as an ecosystem. Complex systems are more resilient than simple systems because they have more options for dealing with stresses. We often sacrifice complexity for short-term productivity and predictability.

All systems have hierarchy: some parts are more important than others, and every system is part of a larger system. A tree is a system in and of itself.

Some parts of the tree are more important than others. Cut off a branch and the tree survives; strip its bark as beavers do and the tree will die. The tree is part of the forest system, which is part of a larger

ecosystem. The river system of the Mississippi is one of the most complex river systems in the world because it is so large and because it crosses climates and ecosystems, or subsystems. Yet in the end, everything in the system is connected. Hierarchies evolve from the bottom up. The upper layers of the hierarchy must work to serve the purposes of the lower layers. When one subsystem dominates or when there is too much central control, the system is weakened. In our story of the Mississippi, two parts of the system were prioritized—flood control and channelization—at the expense of other parts of the system.

We have to ask ourselves these questions: what have we sacrificed to obtain the sense of security that levees provide? What do we pay in the long run?

Conclusion The story of the river is not about the river alone, but about the entire watershed, which includes the population, urban and suburban development, and agricultural and industrial growth. The story that we must tell today is about the compromised resilience of an ecosystem—of people working against nature instead of with it. Imagine the story we might tell in the future: a story of people living alongside the river, learning to listen to it, and using it as a guide rather than an adversary.

Engineers controlled flooding with levees only in carefully selected stretches near cities. In other areas, the river was allowed to overflow its banks.

When it did so, it renewed wetlands, which in turn brought life back to the riverbanks, the bayous, and the communities. This is not a fairy tale but is instead the path that is currently being considered.

The history of the river and the watershed that feeds it can be told as the natural history of river system, but it is also the social and economic history of the Midwest and the South. By looking at the river as part of this larger history, we can see that the story is also the history of American engineering, the Army Corps of Engineers, American agriculture, the oil industry, and the science of river 19 ecology. Critical decisions changed the Mississippi River and the Gulf; these decisions will be difficult—but not impossible—to reverse.

If nothing is done, the river will cease to support the economy that depends on it. But what do we do? Doing more of the same will get us more of what we’ve already got. The good news is that nature is resilient. Given a chance, ecosystems recover. But they must be given a chance to recover. Thus, we must reconsider our use and abuse of nature’s resources. The river needs some new ideas.

Maybe we need to step back and think about how we can live with the river as the river.

P

R

O

F

I

L

E

LaDon Swann

Directing Collaborative Efforts to Help Mend the Gulf Coast

by Katie Jackson

“Looking into my crystal ball, I’d say that the future is what we make of it,” says LaDon Swann, director of the Mississippi–Alabama Sea Grant Consortium (MASGC) and director of the Auburn University Marine Extension and Research Center (AUMERC). Swann has been helping to guide oil-spill recovery efforts for Alabama and Mississippi by listening—and responding—to the voices of Gulf Coast residents.

In addition to these two positions, Swann is an associate research professor in Auburn University’s Department of Fisheries and Allied Aquacultures.

He studies topics that range from oyster production and environmental impacts to socioeconomic issues. As an administrator and a researcher, Swann leverages resources of federal, state, and local programs focused on helping protect and support the Gulf Coast’s natural and human resources.

MASGC, which is administered by the National Oceanic and Atmospheric Administration, is a federal and state partnership that works with

20

Photo by Jeff Etheridge

Auburn University as well as the Dauphin Island Sea Lab, Jackson State and Mississippi State universities, and the universities of Alabama, Alabama at Birmingham, Mississippi, Southern Mississippi, and South Alabama. MASGC’s work focuses on the 900-plus miles of estuarine shoreline and 3,200 square miles of inland water in Alabama and Mississippi.

Located in Mobile, AUMERC is part of Auburn’s Department of Fisheries and Allied Aquacultures and is home to marine scientists and experts from the Alabama Agricultural Experiment Station and the Alabama Cooperative Extension System. AUMERC staff members also operate and maintain the Auburn University Shellfish Laboratory on Dauphin Island.

Through his various positions, Swann has gained a broad perspective on the postdisaster needs of the Gulf Coast and sees great benefits in leveraging the expertise and resources of MASGC members, as well as many other entities. According to Swann,

Photo provided by LaDon Swann

MASGC has had a wide range of projects under way for years—projects that have helped to sustain the Gulf Coast in the best and worst of times.

Currently, efforts are focused on oil-spill recovery and address four major areas: • sustainable seafood supplies, • healthy coastal ecosystems, • sustainable coastal communities, and • hazard-resilient coastal communities.

All four of these areas are important for the Gulf Coast to thrive, and when disasters such as hurricanes hit, these areas are vital to any recovery effort.

In his 11 years as a resident of Alabama, Swann has seen more than a few storms. After every storm, the partnerships and interconnectedness of MASGC, AUMERC, and Auburn’s Department of Fisheries and Allied Aquacultures work as part of a team that helps coastal communities recover.

While the spill is a different kind of disaster, the lessons learned from storms and the partnerships formed in the past have already proven extremely valuable in the spill-recovery process. In response to the spill, interagency and interdisciplinary committees are working on regional research planning and are serving as a clearinghouse for research related to Gulf of Mexico oil. These committees also have organized working groups to provide guidance and coordination regarding

Steve Picou (left), from the University of South Alabama, and LaDon Swann talk with a group of volunteers during a peer-listening training session in Gulf Shores, Alabama.

seafood safety, fisheries closures, and approaches to reopening closed fisheries. In addition, these committees have engaged with local communities and residents’ fishing interests, connecting legal and extension specialists with fishing communities, sharing information online, conducting training for food-safety and environmental-cleanup personnel, and hosting and organizing public forums. Swann also has helped with recovery as a member of the Coastal Recovery Commission.

All of these efforts are important in the recovery process, but for Swann, human recovery on the Gulf Coast is most important. “My number-one concern,” says Swann, “is that the great damage done to the human side is going to be forgotten in the long term.”

With that in mind, he is especially proud of the success of peer-listening sessions in communities along

the Gulf Coast. Peer listening involves training local residents to serve as sounding boards for their neighbors. Though peer listeners are not counselors and are not intended to replace mental health professionals, Swann says listeners can help community residents articulate concerns, needs, fears, and emotions they are experiencing and can help identify warning signs of depression and other postspill reactions.

“Peer listening is effective because many people who need help may be reluctant to seek out mental health professionals after a technological disaster,” explains Swann, who adds that peer listening helps create a social safety net in communities.

“Everyone needs a friend, and a friend properly trained to be a peer listener is a tremendous asset 21 in their neighborhood,” he says.

According to Swann, the Gulf Coast will forever be changed by the spill, but if lessons can be learned from this disaster, affected communities may emerge stronger and better prepared for the future. “One of the most important lessons we can learn from this is that we must do a better job of being engaged, accessible, responsive, and transparent,” he says—all goals he will continue to strive for in his own work and all of which can prepare the Gulf Coast for a brighter, more prosperous future in which communities are better able to deal with storms and oil spills.

Photo by Melissa Humble

P

R

O

F

I

L

E

T. Prabhakar Clement and Joel S. Hayworth

Working to Keep Alabama’s Beaches Pristine

by Jo Mackiewicz

22

T. Prabhakar Clement (left) and Joel S. Hayworth.

How much oil is present in Alabama’s beaches?

What is the chemical makeup of the oil deposited on Alabama’s beaches? How is this makeup changing over time? How is the beach ecosystem adapting to these changes? How much of this remnant oil has infiltrated the beaches? How deep and how far inland does the oil reach?

Prabhakar Clement and Joel Hayworth, along with their team of graduate student researchers in the Department of Civil Engineering, have focused their attention on these questions since May 2010—a few days after the oil began to wash onto Alabama’s coast [1, p. 4,201].

Clement points out that the term “remnant oil” is really a kind of shorthand for raw crude oil that has been transformed through human interventions and natural processes; for example, the use of dispersants, as well as natural weathering processes. By analyzing the chemical makeup of remnant oil samples, says Clement, “we can deci-

pher the chemistry of remnant oil, understand how fast these changes occur, and begin to understand their potential toxicity to organisms living in the beach and nearshore ecosystem.” Clement and Hayworth’s team is examining the chemical evolution of polycyclic aromatic hydrocarbons (PAHs) in remnant oil, compounds that the Environmental Protection Agency classifies as “priority pollutants” [2, p. 6,727].

The team’s research suggests that the chemical makeup of remnant oil is a definite concern: some PAHs found in beach samples are comparable to those in raw crude oil. Testing again in September 2011, the team found little difference in the PAH levels of the samples. These findings correspond with those from prior research, such as studies of the interiors of submerged oil mats left after the 1970 Arrow spill off Nova Scotia. This earlier research showed that many essentially unaltered PAHs were present in submerged oil mats more than 20 years after the spill. These findings from Clement and Hayworth’s team suggest that submerged oil mats in Alabama’s nearshore system “could serve as long-term sources of remnant oil and PAHs to the beach ecosystem” [2, p. 6,730].

In addition to studying the chemical composition of remnant oil in Alabama’s beaches, Clement and Hayworth’s team is also working to determine

Photo by T. Prabhakar Clement

Oil on the beach at Orange Beach, Alabama.

the amount and distribution of the oil in the beach and near shore in order to better understand the potential impacts to these systems. The researchers explain that beaches are dynamic systems, where remnant oil is continuously transformed and redistributed as sand and water move through the beach system. And because some of the remnant oil consists of large, submerged, less-mobile mats from the nearshore continental shelf to the intertidal zone and into the backshore dunes, it is not possible to know the amount of oil remaining in Alabama’s beach system. Indeed, Clement and Hayworth’s team has found that such mats—ranging in thickness from inches to feet—may be more

prevalent than indicated in the government report issued by the Operational Science Advisory Team of the Unified Area Command [2, p. 6,729].

While investigating the volume and distribution of the remnant oil in Alabama’s beach sand, Clement and Hayworth’s team has also examined the effects of BP’s 2011 cleanup effort, called Operation Deep Clean. This cleaning process consisted of excavating sand containing remnant oil to depths ranging from six to twelve feet, sifting the sand through large sieves, and then placing the sifted sand back into the beach [1, p. 4,201]. BP took this new and untested approach to cleanup in an attempt to get Gulf Shores and Orange Beach ready for spring break 2011 [1, p. 4,201]. Clement and Hayworth’s team, through observations and tests of beach sand samples, has concluded that Photo by Melissa Humble

A large tar ball collected on Dauphin Island, Alabama.

23

Photo by Melissa Humble

analogy to explain the situation—the potential risk—we all face: Let’s say I have a spoonful of some nasty contaminant. We know this is dirty stuff that we don’t want to mess around with. “How about we let someone sneak it into your swimming pool.” Guess what? You can use any instrument you want: the swimming pool will look pretty clean if the stuff is fully mixed with your pool water. But would you like to swim in it? What will it take before

the pool looks contaminated? One spoon?

Two spoons? Three spoons? What we are doing now is simply slipping small quantities of nasty stuff into a big swimming pool called the Gulf. Not a good idea. It’s going to come back and haunt us one day.

The research objective of Clement and Hayworth’s team is to help Alabamians understand the long-term consequences of the oil-spill problem—even when the sand appears to be sparkly white and clean.

Clement and Hayworth and their research team.

24

while Operation Deep Clean did remove large pieces of oil–sand matrix, it also fragmented some into smaller pieces and then dispersed the pieces over a wider area. Hayworth says, “To a certain extent, BP’s cleanup sped up the degradation process and removal of chemicals. But it also had an unintended consequence: it homogenized a fraction of the oil over a bigger volume so that there is a higher probability that organisms will encounter it—particularly small microorganisms that don’t have any place to go.”

Both Clement and Hayworth point out that the effects of dispersed, homogenized remnant oil are not known, but Clement uses the following

Photo by Melissa Humble

Collected tar balls and emulsified oil mousse that washed ashore on Alabama beaches.

T

H

E

G

U

L

F Photo by Michelle Worosz

B

eachgoers could not be deterred from fun in the sun in the wake of the spill. With tar balls washed ashore, cleanup crews worked alongside visitors enjoying the beach. Cleanup efforts involved a variety of methods to most effectively restore beaches.

25

Assessing the Damage

135

by Christopher J. Anderson

Photo by Jeff Etheridge

Evaluating Oil-Spill Impacts to Alabama Coastal Wetlands

T

he explosion of the Deepwater Horizon rig in April 2010 led to the worst oil spill in United States history. For 86 days, oil gushed unchecked out of the Deepwater Horizon well and into the Gulf of Mexico. The environmental and economic fallout from the event is still being investigated, but the effects are expected to continue into the future. While oil flowed into the Gulf of Mexico, strategies to manage the oil washing ashore were debated. There are still many unknowns regarding the impact of oil spills and how to best mitigate the damage. For coastal wetlands along the Gulf of Mexico shores—vital natural resources—important questions remain about how oil spills damage these ecosystems and how resilient they are to oil.

These questions are not trivial given the importance of wetlands to the ecology and economy of the Gulf of Mexico region.

Tidal wetlands are exposed to many chemicals and pollutants that move through coastal waters.

This exposure is largely because of their location.

Wetlands are often described as ecotonal, meaning they occur in between aquatic and dry-land environments. When oil spills off the coast, it often washes into these ecotonal environments. To date, considerable research has been conducted on wetlands exposed to oil that has provided important information and guided our present treatment of wetlands impacted by oil. Wetland plants and animals are affected by a combination of the physical

Photo by Jeff Etheridge

and chemical properties related to oil. Our current understanding of oil impacts has improved some of our decision-making abilities about how to manage spills. For instance, to minimize further damage to wetlands, the best strategy is often to avoid any physical removal of oil and simply to allow it to degrade naturally.

Past research has shown that it is difficult to 27 generalize or predict exactly how oil will affect wetlands. Its effects are uncertain because of the variables factoring into oil impacts: • What is the type of marsh? What is the type

of oil?

• What is the condition of the oil? Is it highly

weathered? Is it refined?

• How much oil entered the wetland?

• How much or what part of the marsh was

exposed? Just the plants? Did oil seep into

the soil?

Asking these questions and others is ultimately important for gauging how much of a threat an oil

spill is to coastal wetlands.

As researchers, our goal is to better understand how these factors may affect wetlands. For instance, much of the research on oil impacts to wetlands has focused on saltwater marshes in the Louisiana region—rightfully so, given the frequency of wetland impacts from oil in this part of the Gulf. The Louisiana Delta region is where petroleum production in the United States is greatest and wetlands are most abundant. As oil in shallow-water wells becomes depleted, exploration and drilling shift farther from shore and into deeper waters. One lesson from the Deepwater Horizon oil spill was that once oil reached the water surface 28 approximately 50 miles from the coast, no one was completely certain where it would eventually go. At the mercy of currents and weather patterns, shorelines far away from traditional petroleum activities (such as Alabama’s) were impacted by this spill.

The events from the Deepwater Horizon oil spill have underscored the need to consider the risk of oil to shorelines, beaches, and wetlands beyond the traditional boundaries.

The Importance of Coastal Marshes An estimated 2.5 million acres of tidally influenced marshes (tidal marshes) exist along the Gulf Coast of the United States. Approximately

two-thirds of those are part of the Mississippi River Delta. An estimated 25,000 acres of tidal marsh exist along Alabama shorelines, a significant feature of our coastal environment. These marshes do not occur along beaches or other high-energy environments, but along the fringe of sheltered barrier islands, river mouths, lagoons, and creeks. Because they occur in the intertidal zone and are influenced by saltwater, tidal marshes are normally dominated by species adapted to live in saline aquatic environments (salt marshes), although in some cases tidal marshes can have significant freshwater influence, for example, from an upstream river. In such cases, the marsh remains tidal but with a lower salinity (less than 5 parts per 1,000).

Once thought of as wastelands, wetlands have gained appreciation and protection from society because of the environmental services they provide. These lands have been shown to improve water quality, provide critical habitat, and play an important role in water storage and flood abatement. In coastal areas, wetlands provide all of these services and others. For instance, tidal marshes are extremely important breeding grounds for many species. Approximately 75% of the commercial fish and shellfish caught in the United States rely on estuaries for part of their life cycles; wetlands provide important water quality,

structure, and a food base for the development of these organisms. Wetlands are also used by several commercially important species such as brown shrimp (Farfantepenaeus aztecus), white shrimp (Litopenaeus setiferus), blue crab (Callinectes sapidus), and numerous pelagic (open-ocean) fish.

Further, they provide important habitat for species making up the food base for other commercially important fish species and species of conservation interest, such as wading birds.

Tidal marshes are distinguished from other wetlands by the plant communities they sustain.

Tidal marshes vary around the world, but in all cases, plants in these environments have adapted to continuous flooding and at least periodic exposure to saltwater—both significant stresses for most plants. Along the northern Gulf of Mexico, smooth cordgrass (Spartina alterniflora) is a perennial grass that is the area’s most dominant plant species, often occurring in near monocultures (see figure 1).

In Alabama, however, most tidal marshes are dominated by black needlerush (Juncus roemerianus), reflecting regional differences in salinity and flooding with Spartina marshes (see figure 2).

These marshes occur in the intertidal zone, where they are subjected to daily tidal fluctuations. As a result, these marshes may alternate from drained to submerged. The exposure to saltwater and the

Photo by Christopher J. Anderson

out of estuaries and controlling water fluctuations.

Salt marshes are also influenced by the following factors: • Substrate type (mud, sand, peat) • Climate (temperature, rainfall, hurricane patterns) • Freshwater flow • Biological competition • Surrounding land use and human activities

Fig. 1. Smooth cordgrass (Spartina alterniflora).

tendency for regularly shallow flooding are general conditions that promote salt marshes.

Other tidal marshes—those with greater freshwater influence—may become dominated by several brackish species such as sawgrass (Cladium jamaicense) or arrowhead (Sagittaria lancifolia). In the northern Gulf of Mexico, tides are usually small (less than three feet); however, because of the flat topography along the coast, intertidal zones can be extensive. In addition to tides, seasonal winds may be even more important in moving water in and

In addition to plant communities, these wetlands also provide important habitat. They promote a sheltered environment for juvenile fish to develop and mature. Because these wetlands are highly productive, they often support algae and small invertebrates that provide an important

Photo by Christopher J. Anderson

Fig. 2. Black needlerush (Juncus roemerianus).

energy source for developing fish. In estuaries, the structure of wetland plants also provides an environment that protects small fish from waves and larger predatory fish. Many aquatic organisms using wetlands are transients, meaning they use the wetlands only during certain phases of life, such as the juvenile stage; however, many species are permanent residents of these wetlands. Resident fish and organisms such as killifish and grass shrimp have a more direct connection with wetlands over their lifetime. These wetlands and the organisms they support provide an important food base for larger predatory fish. The role that wetlands play makes them vitally important for sustaining both recreational and commercial fisheries.

29 Wetlands also protect our coastal zones by reducing shoreline erosion and storm surge; marsh plants along the shoreline essentially absorb the energy of storms as they come ashore. As stormgenerated waves (or other sources of waves, such as boat wake) move through marshes, the friction between water and plant stems reduce wave velocity, height, and overall energy. The plants essentially function as a baffle and reduce wave erosion along coastal shorelines.

During hurricanes and tropical storms, marshes have been shown to reduce wave heights as storms pass and provide important protection for human

life and property. At the mouth of the Mississippi River, the Louisiana Delta has been losing coastal wetlands at a rate of approximately 25 square miles per year. The failure of many levees during Hurricane Katrina in 2005 was partially attributed to wetland loss in the Gulf. Where marshes have disappeared, the energy from waves coming ashore was more severe and more likely to compromise protective levees.

Coastal wetlands also provide unique habitat for many species of wildlife considered valuable for hunting and conservation. Numerous bird species in particular depend upon coastal marshes because these marshes are critical stopover points 30 along migration routes over the Gulf of Mexico.

Species with strong ties to coastal marshes along the northern Gulf of Mexico include the clapper rail, seaside sparrow, marsh wren, Virginia rail, sora rail, and least bittern. Wading birds such as snowy egrets and tricolored heron are also common in these marshes. Many birds that frequent these marshes are also relatively rare and important for conservation. Wood storks and seaside sparrows are among the species that use these marshes and are listed as threatened or endangered on various state and federal lists.

Tidal marshes are also habitat for a variety of mammals, reptiles, and amphibians. Mammals

such as deer, fox, rats, muskrats, nutria, raccoons, nine-banded armadillos, and others either live in the marsh interior or on the edges along upland habitat. Reptiles that live in these habitats include American alligators, diamondback terrapins, Alabama red-bellied turtles, and Gulf salt-marsh snakes. Amphibians are least common in these environments, but green tree frogs and leopard frogs have been reported in the tidal marshes with greater freshwater influence.

Oil Spills and Oil Weathering Although major oil spills are uncommon, smaller spills frequently occur during all phases of petroleum production (drilling, storing, refining, and transporting). Further, oil drains into coastal waterways from a variety of other sources such as parking lots, roads, and marinas. Because smaller oil spills are common, our approach to managing impacts has evolved over time. However, each spill represents a unique set of circumstances, making it difficult to implement a general contingency plan.

Just as managing each oil spill is different, so are the effects of each spill on the environment. The type of oil, amount spilled, location, environments affected, climate, weather, and a variety of other factors all dictate the eventual fate of oil and the level of its impact on the environment.

Coastal wetlands often accumulate spilled oil because of their location along shorelines and their unique attributes. Wetlands occur along the aquatic–terrestrial edge, and their emergent plant stems naturally retain materials and pollutants that wash into them. Further, wetland soils contribute to the accumulation of pollutants in marshes.

Wetland soils are normally waterlogged, with little to no oxygen. When materials or pollutants accumulate in these soils, the lack of oxygen significantly reduces their decomposition and can result in the persistence of material for years or decades.

The ability of wetlands to retain and accumulate pollutants is a desirable feature that improves water quality beyond the wetland and is another reason that they are considered valuable.

When oil is spilled in coastal waters, several processes contribute to its weathering. Oil weathering is a combination of processes that affect the physical and chemical composition of oil.

These processes include evaporation, dissolution, photochemical oxidation, water-oil emulsification, biodegradation, sinking, and sedimentation. In terms of oil removal, evaporation is considered the most important weathering process. Evaporation begins immediately after the spill occurs and can remove significant volumes of oil from the water.

Lighter and more refined oils that contain smaller,

more volatile compounds such as alkanes are more prone to evaporation; nearly 35% of the volume of spilled sweet crude oil can evaporate in the first three to four days of a spill. After the first few days, however, evaporation of crude oil normally slows considerably, and other weathering processes become more prominent.

Oil can take on a variety of conditions as it continues to weather. Emulsification is a process in which one liquid disperses into another. In the case of oil spills, water-in-oil emulsions are common after spills at sea and result in a mousse-like consistency. These were frequently reported after the Deepwater Horizon spill. Emulsification is thought to occur after evaporation has removed many of the aromatic compounds of oil that have a low molecular weight. Other important weathering processes include biodegradation (microbial breakdown), photooxidation (transformation of composition via solar energy), and natural dispersion. All these processes influence the composition of oil as it weathers and its potential impact on aquatic environments.

Oil Impacts on Coastal Wetlands Determining the impact of oil on wetlands is often difficult. For tidal marshes, the most obvious barometers of wetland health are plant size,

density, and composition. Unlike many animals, plants cannot move out of a wetland when oil is washed in. When plants are exposed to oil, they may respond in a variety of ways. In cases where exposure is minimal or brief, the wetland may show no visual evidence of impact. If the impact is more severe, involving a significant amount of oil or long-term exposure, widespread plant mortality and permanent loss of marsh can result. The oil itself can be a major consideration, with the type of oil, the amount, and the oil condition as factors that affect the impact to wetlands. Some species of wetland plants show more resistance to oil exposure than others. Vegetation type, geographic location, and existing stress can also influence a wetland’s susceptibility to an oil spill.

How does oil damage wetlands? Oil impacts on wetlands can be both physical and chemical.

Physical impacts are caused when oil becomes coated on plants and soil surfaces, which are critical areas for gas exchange. Stomata on plant leaves and stems are where plants exchange important gases such as carbon dioxide and oxygen and where water is transpired from the plant. When plant surfaces become coated, the oil reduces gas exchange, disrupts photosynthesis and transpiration, and ultimately reduces plant health. Rising tides and storm surges can coat plants completely

with oil. In those cases, plants often shed their coated parts and regenerate new shoots.

Impacts to the soil can have a more lasting effect.

Most tidal marsh plants are perennials that develop extensive rhizomes that grow new shoots each year.

A plant may lose its aboveground biomass, but as long as the belowground rhizomes are intact, the plant can usually recover. Oil that penetrates into the soil has the potential to impact roots and rhizomes because of its toxicity, possibly resulting in plant mortality. The amount of oil in the soil may depend on where the oil settles and the circumstances of the spill. Closer to the water edge, where tides frequently pass through marshes, significant flushing may preclude oil from seeping deep into soils. Marshes 31 farther from the water edge may be less prone to flushing and, as a result, oil may be more likely to accumulate and penetrate into the soil.

The type and duration of oil exposure can eventually lead to permanent loss of wetlands.

Prolonged or severe oil exposure can result in extensive mortality of marsh plants. As marsh plants die off, the extensive rhizomes underneath the ground begin to decay and break down. The space these organs occupy underground is significant, and when the rhizomes decompose, the soil above them can subside, often lowering the marsh elevation relative to sea level and resulting in

permanent loss of marsh land.

Numerous factors influence just how damaging oil can be to wetlands and other shoreline environments. Clarifying the importance of these factors is important for future management decisions. Through a combination of field surveys and experimental work, our goal is to improve our understanding of how oil from a major spill may affect wetlands farther from the spill site.

Researching Oil in Alabama Wetlands Just days after the Deepwater Horizon spill occurred, I traveled to Baldwin County, Alabama, with two volunteers to assess tidal wetlands and 32 collect baseline data. Because of the delay between the Deepwater Horizon oil first spilling and its arrival on shore, we had the opportunity to visit numerous wetlands prior to oil washing ashore.

We deliberately examined a wide range of wetland locations throughout the county and visited 14 wetlands between Perdido Pass and Mobile Bay. To determine future environmental impacts from the spill, we collected baseline samples and documented salt marsh conditions. Our study involved measuring plant heights, determining species composition, and estimating plant cover in the marsh.

We also collected soil and plant tissue samples from each marsh and returned them to Auburn for

future chemical and hydrocarbon analysis.

The trip created some memorable occasions. At the time, the nation was gripped by the disaster that was slowly unfolding as millions of gallons of crude oil began flowing into the Gulf of Mexico.

Thinking back, I recall how completely grim that trip was. Wetland field work is normally hard work, but it is very enjoyable; however, on this trip, our work was related to an impending environmental disaster. Most of the wetlands we visited were located behind someone’s home or business, so we often knocked on doors and requested permission to access them. After explaining our purpose, many residents talked with us at great length about their thoughts and feelings about the spill. Many of them spoke emotionally about their personal connection with the region. Fortunately, many of the worst-case environmental scenarios never materialized, although oil certainly washed ashore along the Alabama coast. The liberal use of chemical dispersants at sea seemed to be effective at breaking down oil and reducing the amount that came ashore.

At the end of 2011, we received funding as a Gulf of Mexico Research Initiative project to revisit these wetlands and others in Alabama. Our intent was to see how much oil could be detected a year after the spill. As of September 2011, labora-

tory results are still pending; however, based on our surveys, marsh conditions in 2011 appeared very similar to baseline conditions seen in 2010.

Similarly, we saw no evidence of oil in soils or on plants during our return trip in 2011, although some of the people we interviewed reported seeing oil on the water after the spill.

Although early indications from our survey (and from people throughout Alabama to whom we have spoken) indicated that wetland oil exposure from the Deepwater Horizon event was minimal, the spill did expose the potential for major impacts. In response, we initiated a second study to better understand the potential ramifications of a major oil spill reaching Alabama shorelines.

Collaborating with Prabhakar Clement, a professor in the Auburn University Department of Civil Engineering, we received a second grant from the Gulf of Mexico Research Initiative to conduct research on oil impacts along Alabama wetlands and shorelines. Related to this, Clement and his lab have been actively looking at the transformation and fate of oil that reached Alabama beaches after the spill.

In studying potential wetland impacts, our goal is to better understand how oil weathering and concentration would influence typical salt marshes of Alabama. Experimental research on wetland oil

impacts can be difficult. Because oil is toxic and difficult to transport, researchers rarely propose or receive permission to put oil into wetlands for the sake of an experiment. This type of approach has been done but only with small amounts of oil, over very small areas, and under very controlled conditions. More often, researchers have taken advantage of accidental spills to do wetland research. For instance, several wetland areas in Louisiana that were affected by the Deepwater Horizon spill had been studied previously. These sites will be important to demonstrate important before-and-after effects of oil exposure; however, they also carry some uncertainties. For instance, no one knows how much oil the wetlands were exposed to before, what the initial composition of the oil was, or how the effects would compare if the oil had impacted a different wetland. For more conclusive results, researchers strive for greater control of experimental factors.

How then do we design an experiment that can evaluate the effects of oil on wetlands in a controlled environment? Often, scientists have created miniwetlands called mesocosms. A mesocosm is a smaller, simplified version of a natural ecosystem.

Although mesocosms lose some realism because of their size, they have the benefit of being easily replicated—important for scientific work that requires

statistical analyses to test hypotheses. Wetland mesocosms have been designed for a variety of experiments and have ranged in size from large pots to small ponds.

For oil research, the other benefit of using mesocosms is that oil can be completely contained in the mesocosm environment, allowing researchers to gain some testable control of different factors that may influence wetlands. For instance, researchers can test how different doses of oil may affect wetlands in ways that would be unfeasible and detrimental to natural wetlands. For our study, our first goal was to devise a mesocosm that would mimic a salt marsh along the Gulf of Mexico. To do this, we needed to replicate a critical feature of a marsh: its hydrology. That is, we had to mimic the tidal rise and fall of water levels. In terms of hydrology, salt marshes are considered open ecosystems; that is, they are continuously exchanging materials, water, and energy from outside sources. This characteristic is crucial to how these wetlands function and likely an important feature for determining how they respond to oil exposure.

For our study, mesocosms were created using 30-gallon trash cans (see figure 3). Inside each mesocosm, substrate was layered with gravel (at the bottom), sand, and marsh sod. Marsh sod was collected from three black needlerush marshes

along Weeks Bay, Alabama, in March 2011. We harvested 75 pieces of sod that were about 10 inches deep and transported them using 5-gallon paint buckets. To implement a tidal hydrology, we developed a gravity-fed flow-through system that would mimic the rise and fall of tidal waters into the wetlands. As detailed in figure 4, a cistern (in this case, a 50-gallon trash can) was used to mix seawater, which then flowed into each mesocosm via a spigot valve.

These wetlands naturally have some freshwater influence, so for this experiment, we mixed water with a salinity between 5 and 10 parts per 1,000.

Photo by Christopher J. Anderson

Fig. 3. Mesocosms used in the experiment.

33

Brackish Water (about 7 parts per 1,000)

Note: Each cistern drains to eight mesocosms

Plants Marsh Sod Sand Gravel 34

Cistern

Mesocosm

Effluent

Fig. 4. Experimental mesocosm. Used with permission of the author.

For each tidal pulse, water was released from the cisterns and gradually filled the mesocosms with standing water. Each mesocosm also had a spigot valve placed just below the soil surface that was set to release the incoming water (the tide) out of the mesocosm and into a 5-gallon collection bucket.

By adjusting valves, we were able to achieve the gradual rise and fall of water in our mesocosms and achieve an artificial tidal pulse. Unlike other areas of the world, tidal marsh flooding along the northern Gulf of Mexico can be fairly irregular;

therefore, our wetlands were set up to flood three to four times every week.

Because of its prevalence in Alabama, we used black needlerush as our focal species. We put marsh sod in place near the end of March 2011 and gave it three months to become established.

The plants took very well to their mesocosm environments, and we saw growth patterns consistent with natural wetlands. We even noted the successful transport and survival of other associated marsh fauna such as fiddler crabs and clams. We

interpreted their continued survival as an indication that we had achieved a certain level of realism.

In mid-July, we began preparations for experimental dosing of wetlands with oil. Goodway Refining, LLC, in Atmore, Alabama, generously provided a barrel of oil. The oil in this case was Louisiana sweet crude oil, commonly extracted from the Gulf of Mexico region. One of our primary interests was to determine how the duration of oil weathering would change its impact on wetland ecosystems. Using large metal tubs, we made two batches of a fifty-fifty mix of seawater and crude oil, and left it exposed to the summer sun. One batch was exposed for three weeks and the other for three days. Oil was introduced into the mesocosms on July 16, 2011. In addition to the weathered oil batches, we also applied oil straight from the barrel (nonweathered oil), while the reference mesocosms received no oil. We used a total of 32 wetland mesocosms.

Weathering can affect oil’s toxicity to plants, as does the amount of exposure. We used three different dosages in the mesocosms. We mixed oil with seawater and poured it directly into mesocosms based on low (6 liters per square meter), medium (12 liters per square meter), or high (24 liters per square meter) doses and allowed each dose to pass through the wetlands via a tidal pulse. We repeated

Photo by Christopher J. Anderson

Fig. 5. Measuring needlerush photosynthetic rates at the experimental mesocosms.

this procedure on four successive days. By using multiple mesocosms, we replicated all combinations of oil-weathering types (three-day, threeweek, full strength) and dosage (high, medium, low, and none).

Because research shows that oiled wetlands often induce the die-off of aboveground plant

parts, we have counted living and dead needlerush stems in each mesocosm to examine changes.

Marsh impacts from oil exposure may also be reflected by a variety of plant physiological stresses.

Thus, we have monitored changes in photosynthetic rates within each mesocosm using a photosynthesis system (see figure 5). We have collected soil

samples to analyze for total percentage of hydrocarbons and for concentration of various oil constituents immediately after oil exposure. Similarly, we have analyzed soils to evaluate potential biodegradation and export of oil in the marsh root zone.

Early results have shown that the needlerush plants are sensitive to oil. After just two weeks, some plant stems began to yellow. Based on our initial observations, the number of plant stems affected was clearly related to the amount of oil put into the mesocosm. Weathering effects seemed more subtle: the full-strength oil mesocosms seemed to be more affected than either of the weathered treatments. Our reference wetlands remained stable and healthy during this time 35 period. Formal analysis later will reveal whether these observations are statistically supported.

Using the results of this and other studies, we will continue to answer questions related to tidal marshes and oil pollution. Given our dependence on energy, oil exploration and petroleum production will assuredly continue to be important activities in the Gulf of Mexico. Our responsibility as a society is to learn from the Deepwater Horizon event and to improve our ability to minimize and effectively respond to major spill events. Research stemming from the Deepwater Horizon spill should represent significant advances in both areas.

Photo by Jeff Etheridge

P

R

O

F

I

L

E

Ming-Kuo Lee

Carrying Out Oil-Spill Forensics in Gulf Salt Marshes

by Candis Hacker Birchfield

36

Ming-Kuo Lee, along with graduate research assistants Mike Natter and Jeff Keevan, monitors the release and concentration of toxic metals such as mercury and arsenic—among others found in salt marshes contaminated by the BP oil spill.

Lee, a professor in the Department of Geology and Geography, explains that “coastal wetlands are efficient traps of trace metals derived from diverse sources of atmospheric deposition, riverine transport, and crude oil. . . . Those metals are not biodegradable; thus, they can remain in the marine and coastal ecosystems longer than oil.” That is, long after the obvious signs of the spill have been cleaned up, elevated levels of metals will persist in the wetlands. These persistent concentrations of such trace metals above toxic levels pose concerns for wildlife and humans.

Lee, Natter, and Keevan have conducted sediment coring and chemical analyses to investigate the range of oil and trace metal levels in Louisiana coastal wetlands. They have found that although

most of the crude oil’s light compounds have been volatilized or degraded by natural microbes, heavy and complex compounds persist in sediments.

They have also found trace metals such as nickel, cobalt, copper, zinc, vanadium, barium, mercury, and arsenic to be higher in heavily oiled sediments.

Their results suggest that not all the spilled oil may have risen to the water surface, but that oil plumes Photo by Melissa Humble

(Left to right) Ming-Kuo Lee, Mike Natter, and Jeff Keevan.

Photos by Ming-Kuo Lee

37

Mike Natter, Jeff Keegan, and Joel Abrahams conducted sediment coring and sampling at the heavily oiled Bay Jimmy site in Louisiana. Marsh plants were killed and suppressed by oil drifting ashore.

may have spread in water columns and adsorbed, or adhered to, to wetland sediments.

A Rapid Response Research grant from the National Science Foundation—a grant designed to find swift answers to questions requiring immediate study—partially funded Lee’s research. The grant involved researchers not only at Auburn

University but also a microbiologist at Auburn University Montgomery and a geochemist at Vassar College. The team plans to continue its work in heavily oiled wetlands in Louisiana. Says Lee, “Because salt marshes contain high organicsolid content, they provide primary adsorptive surface for spilled oil and associated metals. For

this reason, we consider oil contamination in salt marshes as the worst-case scenario—much worse than beach contamination.” Lee, therefore, points out that “more research is needed for assessing the long-term effects of persistent oil compounds on ecosystems and biological and chemical transformation of trace metals in Gulf salt marshes.”

Magnificent and Fragile 135

by Scott Bishop, Barry Fleming, and Geoffrey Hill

I

Ornithology through Audubon’s Scientific Lens

n April 2010, Professor Geoffrey Hill of Auburn University’s Department of Biological Sciences took his ornithology class on an annual field trip to Dauphin Island. “As always,” he said, “the Gulf Coast was spectacularly beautiful. Blue surf pounded the brilliant white sand as flocks of birds settled and took off. The bird diversity was so great I scarcely had time to call out the species that paraded before us.” The class watched snowy plovers, as ghostly gray as the dunes, run between the tufts of sea oats. They marveled at a reddish egret, wings spread for balance, dancing a ballet as it pursued baitfish in the shallows. The class laughed while least terns screamed and chased before they plunged from twenty feet into three inches of water, more often than not coming up with a fish.

Five hundred miles away and 178 Aprils before, another ornithologist, John James Audubon (1785–1851), looked out on the Gulf of Mexico from the Florida Keys and set down in words his impressions:

With what delightful feeling did we gaze on the objects around us!—the gorgeous flowers, the singular and beautiful plants, the luxuriant trees. The birds which we saw were almost all new to us: their lovely forms appeared to Photo by Melissa Humble

Above: (left to right) Geoffrey Hill, Scott Bishop, and Barry Fleming.

Opposite page: Detail of figure 3 on page 43.

be arrayed in more brilliant apparel than I had ever seen before, and as they fluttered in happy playfulness among the bushes, or glided over the light green waters, we longed to form a more intimate acquaintance with them [1, p. 451].

Audubon’s intention was to study the birds’ habits, sketch their living forms, and then shoot them 39 so he could study them more closely, measuring wingspans, legs, beaks, and feathers. His ultimate goal was to paint life-sized portraits of every bird and to have the paintings transferred to handcolored, engraved prints for publication in his book The Birds of America.

Audubon’s name is familiar, if only because it appears in the name of the National Audubon Society, which was founded by George Bird Grinnell (1849–1938) in memory of John James Audubon and his wife, Lucy (1787–1874). Lucy was Grinnell’s tutor years after J. J. Audubon’s

death. Audubon’s most widely known achievement is The Birds of America, the largest ornithological book ever published. Audubon’s ambition was to record all the birds in North America; the final project was a four-volume set containing 435 lifesize etchings depicting 1,065 birds. These original volumes are called the Havell edition, named after Robert Havell, the London-based printer who worked with Audubon and his sons from 1827 until the completion of the project in 1838. Besides the exquisite craftsmanship of the prints and the beauty of the compositions and their subjects, the book was remarkable for its size. Each sheet measures 26.5 by 39.5 inches. The images are widely known; 40 they have been reproduced in smaller formats hundreds of times in books, as single prints, and in calendars. The aesthetic appeal of the prints has perhaps colluded with history to obscure a central fact: Audubon was above all else a naturalist, a nineteenth-century scientist using his artistic skills to capture the vivacity of his scientific subjects.

Audubon’s The Birds of America was sold by subscription. Included in the subscription was a second set of volumes that accompanied the prints. Known as the Ornithological Biographies, the complete title is Ornithological Biography, or An account of the habits of the birds of the United States of America; accompanied by descriptions of

the objects represented in the work entitled The Birds of America, and interspersed with delineations of American scenery and manners. Published in five volumes, the biographies described each bird’s environment, diet, mating and parenting habits, population numbers, migratory schedules, and other behavioral details of interest to naturalists.

In his copious notes, Audubon also included extremely detailed descriptions of dissected birds.

Consider the brown pelican his assistant shot on November 27, 1821, on Lake Barataria near New Orleans. Audubon ends a 700-word detailed description with facts about the bird’s entrails: “The Stomack Very Long and slender, fleshy— Containing only about 50 slender Blue Worm all alive about 2 1/2 Inches Long—the Gut Measured 10 feet about the size of a Moderate Swans quill” [2, pp. 134–36].

Audubon was a dedicated scientist, an artist, and an entrepreneur. He had lost everything in bad business ventures, and he depended on the success of The Birds of America to restore economic stability to his family. He was surely also interested in fame, but his credibility rested on his scientific credentials, which are listed on the title pages of Ornithological Biographies, and in abbreviation next to his name on the prints. He was a fellow of the Linnean and Zoological Societies of London; he

was a member of the Lyceum and Linnean Society of New York, the Natural History Society of Paris, and the Wernerian Natural History Society of Edinburgh; he was an honorary member of the Society of Natural History of Manchester and the Scottish Academy of Painting, Architecture, and Sculpture.

During the years that Audubon dedicated himself to his research for The Birds of America, he made three extended visits to the Gulf of Mexico, first in 1821 when he lived in New Orleans, again in 1832 when he visited the Florida Keys, and the third time in 1837 when he traveled through Alabama to Mobile, where he took a boat to tour the coast as far east as Pensacola and as far west as Galveston. In every journal, he notes the multiplicity of species.

In April 2010, when Geoff Hill was helping Auburn University students put names to the birds before them at Dauphin Island, a flock of pelicans—the many acting as a single self—rose up from their perches and headed east. Dark clouds rose to the south. A storm was coming. They had to move back toward their vans, but Hill wanted his students to appreciate what a treasure the Gulf is.

“Look at how incredibly beautiful this coastline is,” he implored them. The explosion of the Deepwater Horizon oil rig had just happened off the coast of Louisiana a few days before, but reports said there

was no significant oil spill. Hill told his students, “We dodged a bullet with the latest oil-rig mishap.

If we are going to extract oil from the Gulf we have to spare no expense at safeguarding this magnificent and very fragile coast.” Hill finished his speech, and the clouds grew darker. The storm was bigger than expected.

What actually unfolded between April 20 and July 15, 2010, was devastating. Approximately 4.9 million gallons of oil flowed into the Gulf. Within days, what had been described as “no significant spill” was revealed to be a gushing and unstoppable oil flow, spawning a black, suffocating monster that was destined to consume the entire northern Gulf.

The ecological and economic disaster that we had been told could never happen was here.

This tragedy was particularly hard on birds. Birds live at the interface of air, land, and water—the same interface where oil floats. In order to feed, seabirds must spend a large part of every day on the surface of the water.

Following the oil spill, birds became feathered sponges, each absorbing a few ounces of oil.

Waterbirds critically depend on clean, impervious plumage; an ounce of oil on the feathers of a seabird means almost certain death for the bird.

As water breaches its plumage, the bird becomes waterlogged and helpless.

The oil spill was not the first time that humans took a heavy toll on coastal birds. In the late nineteenth and early twentieth centuries, plume hunters killed untold thousands of herons, egrets, gulls, and terns to feed a fashion industry fixated on feathers. Herons and egrets were so diminished from unregulated shooting that they were in danger of going extinct.

In 1832, however, when Audubon was in the Florida Keys, he described “thousands,” and on a particular day, “multitudes” of brown pelicans close to a “thick shrubbery of Mangroves” [1, p. 453].

Having shot many specimens, he made a drawing of a pelican that became the original from which plate CCLI of The Birds of America was drawn (see figure 1). He placed it on a mangrove branch, showing it in profile, its feet turned toward the viewer to fully illustrate their shape.

Though it is a stately bird, it has none of the plumage that endangered other species. Audubon describes brown pelicans as “good weather prophets” that are able to “judge weather changes more accurately than can men” [4, p. 4]. But what humans could contribute to the demise of the pelican was perhaps more unnatural than plume hunting.

As the bird populations began to rebound from shooting in the 1950s and 1960s, dichlorodiphenyltrichloroethane (DDT) began to

41

Fig. 1. Brown Pelican, by John James Audubon; plate 423 (chromolithograph) in The Birds of America, 2nd ed.

All Audubon images are from the Jule Collins Smith Museum of Fine Art at Auburn University, the Louise Hauss and David Brent Miller Audubon Collection.

be sprayed on water to kill mosquitoes, and birds that ate fish disappeared. Brown pelican numbers plummeted along the Alabama, Mississippi, and

Louisiana coasts. By 1962, no breeding birds could be found in Louisiana (which called itself the pelican state). The bird also disappeared entirely from Alabama shores. Besides DDT, another major culprit was chlorinated hydrocarbons found in fertilizers that washed into waterways feeding the Gulf Coast. Chlorinated hydrocarbons caused eggshells to become fragile. Before the 2010 oil spill, the status and distribution of the brown pelican had returned to pre-1950 levels, but the oil spill is a reminder of the vulnerability of even the most conspicuous and common species.

A remarkable example of wildlife’s susceptibility to human intervention is the passenger pigeon.

42 Once an abundant migrant resident of the Gulf, it has been extinct since 1914. Audubon reported in his Ornithological Biographies that “the multitudes of Wild Pigeons [passenger pigeons] in our American woods are astonishing” [3, p. 157]. He tells of a time in 1813 that he observed flocks of them passing overhead all day. In an attempt to count them, he recorded 163 flocks passing over in 21 minutes. Giving up the task of counting, Audubon “traveled on, and still met more the farther [he] proceeded. The air was literally filled with pigeons; the light of noon-day was obscured as by an eclipse” [3, pp. 157–58]. Yet by a combination of loss of habitat and overhunting, the last of the

Fig. 2. Passenger Pigeon, by John James Audubon; plate 62 (hand-colored etching, aquatint, and line engraving) in The Birds of America, 1st ed.

passenger pigeons died in the Cincinnati Zoo, 101 years after Audubon observed unbelievable multitudes of them. Audubon’s scientifically accurate rendering of the male and female is poignant in that, coincidentally, Audubon chose to place them on a dead tree limb, a sad foreshadowing of the species’ extinction (see figure 2).

The whooping crane might very well have gone

the way of the passenger pigeon had it not been for benevolent human intervention. Audubon reported seeing them in Kentucky, Mississippi, Louisiana, and Florida, but because of their habits, never in great numbers [3, pp. 130–31].

The whooping crane was fairly common along the barrier islands of the Gulf Coast in the nineteenth century, but it nearly became extinct in the 1940s, wintering only in coastal Texas. Until recently it had last been seen in Alabama in 1899. Since 2001, ultralight aircraft has led young birds from breeding grounds in Wisconsin to a barrier island off coastal Florida, reintroducing and establishing an eastern path of migration.

These assisted birds have been very successful in finding their way back to the breeding grounds and then back to their wintering territory in Florida.

The species is now being recorded annually in Alabama. Audubon’s representation of the whooping crane was drawn from a specimen he collected in New Orleans in 1821 (see figure 3). He added baby alligators to the composition later, in 1822, when he saw a flock of nine attacking a band of young alligators. In showcasing the whooping crane’s diet (the alligators), he depicts one with its underside facing the viewer so that it is possible to observe both sides of the alligator’s body.

It has been argued that Audubon was an early

Fig. 3. Hooping Crane, by John James Audubon; plate CCXXVI (hand-colored etching, aquatint, and line engraving) in The Birds of America, 1st ed.

conservationist, despite his propensity to kill hundreds of birds of a single species in service to his project. Such arguments are hard to sustain given that so many of his journals have been revised

and edited by his granddaughter, who wanted to craft a pleasing legacy for her famous ancestor [4].

Audubon was a marvelous naturalist, artist, and writer. He recorded almost obsessively his observations about the American landscape and its inhabitants. The Birds of America is more than a beautiful book; it is also the record of a keen and intelligent eye on the nineteenth-century American landscape.

Auburn University’s art museum, the Jule Collins Smith Museum of Fine Art ( JCSM), is fortunate to have a large collection of prints from The Birds of America. In 1992, Susan Phillips gave Auburn University her late grandparents’ Audubon collection. The collection, named The Louise Hauss and David Brent Miller Audubon Collection, honors her grandparents’ memory. Along with the collection, Phillips and her brother provided JCSM with an endowment for the care, study, and conservation of the collection; for galleries dedicated to the exhibition of the prints; and for the Louise Hauss and David Brent Miller Works on Paper study room, the space in which the collection is housed and available for study when not on exhibition.

In the wake of the 2010 oil spill, JCSM responded by exploring the Miller Audubon collection as a means of examining the environment of the Gulf Coast and its avian inhabitants. Reaching out to those on campus who could speak to Audubon

as naturalist, scientist, and artist, JCSM brought together Barry Fleming from the Department of Art (a master birder) and Geoffrey Hill from the Department of Biological Sciences to develop an exhibition. The exhibition responded to the horrific devastation of the spill by looking back to Audubon’s time and to the birds and environment of the Gulf Coast before oil drilling. What emerged is the realization that the span between Audubon and the present is a brief one, but it is one that has seen much thoughtless destruction of the

43

Photo by Melissa Humble

44

Photo by Jeff Etheridge

environment. The oil spill gives us pause to consider this larger issue.

Most of the water in the eastern United States moves steadily to the Gulf. Even the pristine white beaches of Destin, Florida, and Gulf Shores, Alabama, are formed by quartz crystals produced by the weathering of the Appalachian Mountains and washed through rivers to the Gulf. The eastern river system carries whatever is washed into it, including all that humans add to the water. In 1965, a Memphis, Tennessee, chemical plant producing Endrin, a compound used primarily as an insecticide, was closed as a result of fish and bird die-offs along the Gulf. Potential dangers such as oil drilling and shipping pollution are great, but the major, ongoing threats to the diversity of bird and animal species along the coast are the pollutants carried by the Mississippi River, the reduction of rain forests in Central America, and the melting ice in the Arctic.

The biggest threat to the birds of the Gulf Coast is, of course, the human species. Our only hope to maintain environmental diversity is a commitment to understanding and preserving the rich and varied habitat on which the many species depend.

To see a virtual exhibition of Birds of the Gulf Coast: Selections from the Louise Hauss and David Brent Miller Audubon Collection, visit www.jcsm.auburn.edu.

T

H

E

G

U

L

F

T

he majestic brown pelican became the icon to illustrate the impact of the spill on Gulf wildlife. Pelicans consume huge amounts of seafood and water, making them particularly vulnerable to oil contamination.

As a result, the eggshells of their offspring become weak and crack easily.

45

Photo by Michelle Worosz

Photo by Jeff Etheridge

P

R

O

F

I

L

E

Stephen Szedlmayer

Evaluating the Oil Spill’s Impacts on Finfish in the Northern Gulf of Mexico

by Leslie Parsons

46

BP has pledged to assess and address the longterm environmental and health impacts of the spill on the Gulf Coast. On the part of BP and others, there is a stated interest in restoration and damage assessment of the area’s natural resources.

However, assessing the changes that have occurred means being able to accurately and technically describe the state of the environment before it was impacted. Auburn University’s Stephen Szedlmayer, a professor in the Department of Fisheries and Allied Aquacultures, is a critical source for this data.

For more than two decades, Szedlmayer has worked in the northern Gulf of Mexico studying finfish. In particular, he studies Lutjanus campechanus, commonly known as red snapper.

His studies have chronicled the life history of the species over a 20-year period, and his baseline data enable highly accurate assessments of the effect

Photo by Jeff Etheridge

that changing environments (including major disturbances) have on the species.

Szedlmayer’s specific research interests relate to evaluating the effects that artificial reefs and other offshore structures such as petroleum platforms have on red snapper. Szedlmayer and his team have evaluated hundreds of artificial structures to determine how their presence impacts red snapper productivity. They have used methods such ultrasonic telemetry, fish traps, diver surveys, and mark-and-recapture studies.

The data Szedlmayer has collected during these studies allow him to reliably and accurately describe the prespill population status of the red snapper off coastal Alabama. The information Szedlmayer and his team have amassed will serve as an invaluable baseline for measuring both the impacts of the spill and the effectiveness of related restoration efforts.

Going forward, Szedlmayer’s long-term baseline data will allow assessments of postspill ecosystem responses. He and fellow investigators will attempt to quantify oil-spill impacts using a variety of indices, focusing on changes in particular species at the community and individual levels to help explain observed changes across a range of Gulf locations. Specifically, Szedlmayer and his team will examine the effects of polycyclic

aromatic hydrocarbons and other spill-related contaminants. They will also consider communitylevel responses, especially changes in community structures and food webs in estuarine, shelf, and deep-slope ecosystems that were covered in oil.

Further, Szedlmayer is laying the groundwork to examine economically and ecologically important target species in both field and laboratory settings from molecular to wholeanimal levels. In relation to key species from the northern Gulf estuarine and marine ecosystems, Szedlmayer and his team will study—among other matters—life-history parameters, reproductive functions, and behaviors.

Szedlmayer’s contributions to our understanding of northern Gulf ecosystems are making it possible to determine with considerable accuracy and reliability the extent to which the spill has caused long-term impacts to multiple species across a range of spatial and temporal scales. Through his continued research, these impacts can be quantified and addressed, thus improving our ability to understand and respond to the environmental effects of oil spills.

47

135

A Forgotten Population

by Christopher Lupoli

Photo by Amanda Younce

The Southeast Asian Community of Alabama’s Gulf Coast

T

he 2010 Deepwater Horizon Oil Spill conjures up images of massive oil slicks creeping across vast areas of the Gulf of Mexico: marshes and wildlife coated in toxic black slime and precious beaches covered in oil and tar balls. Just a few months after the spill, however, these catastrophic images all but disappeared from mainstream media. Beaches reopened soon thereafter, and most of the oil seemed to have sunk to the ocean floor, vaporized, decomposed, or otherwise ceased to exist in the eyes of many. Most Alabama beaches now appear clean and welcoming, and while some may still be hesitant about consuming Gulf seafood, this industry is slowly making a comeback. However, beyond the white sand beaches, bustling hotels, and sparkling waters, other stories have been sadly overlooked, one of which I’d like to share.

The setting is Bayou La Batre, a sleepy fishing village located on Alabama’s Gulf Coast. It has no alluring beaches or tourist facilities, but it does

Photo by Amanda Younce

Above: Drivers entering town are reminded that Bayou La Batre is the “Seafood Capital of Alabama.” What is significantly less visible is the devastation that the town’s residents have suffered following the oil spill.

Opposite page: Hoang Huynh (at far right) is the daughter of a Vietnamese mother and an American serviceman. Ostracized in her native Vietnam for being of mixed race, she was forced to leave school at an early age. She came to the United States through the Amerasian Homecoming Act, and has worked in the oyster industry in Bayou La Batre since her arrival. From left to right are her children: Toan, Thao, and Thang. Hoang has been working fewer hours due to the impact of the oil spill, yet still has a family that depends on her wages.

have the reputation, as its welcome sign attests, as the “Seafood Capital of Alabama.” As I drove through this tiny community, the most memorable sight was crossing a moveable bridge over a thin inlet, the bayou, which was impressively packed with commercial shrimping boats. This brought to my mind the romantic image of the rugged shrimper, as was glorified in Forrest Gump (which referenced Bayou La Batre as the home of Forrest Gump in his shrimping days). Putting the glamour aside, I would have had no idea of the complex drama that played out here during the crisis of the oil spill, much of which continues today, had I not thoroughly searched for any and all media reports during the past year that had mentioned Bayou La Batre in the context of the oil spill.

The sight of one small Vietnamese food mart adjacent to the town’s only major avenue hints at the ethnic diversity in Bayou La Batre.

Approximately one-third of the population here is of Southeast Asian descent, mostly Vietnamese,

49

Photo by Amanda Younce

50

A shrimping boat enters the Bayou La Batre harbor.

Shrimping has long been an important economic livelihood for Bayou La Batre’s residents.

Cambodian, and Laotian, the majority having arrived as refugees of the Vietnam War. The seafood-processing industry here is now dependent on their labor, as they play major roles in the catching and processing of shrimp, oysters, and crabs. The Southeast Asian population in Bayou La Batre is representative of much of the Gulf

Coast of the United States: some estimates claim that one-third or more of the Gulf Coast fishing industry is Vietnamese, and that approximately 40,000 Vietnamese, Cambodians, and Laotians live along the Gulf coast of Louisiana, Mississippi, and Alabama [1, p. 2], [3].

Bayou La Batre is not just a major processing center for locally caught seafood. Much is imported from Louisiana, Mississippi, Florida, and even other countries, and is transported to Bayou La Batre to be opened, peeled, shelled, deheaded, deveined, cleaned, and packaged by skilled and hard-working hands. The crab and oyster processing plants are particularly dependent on the labor of Vietnamese, Cambodian, and Laotian workers (according to one estimate, 70% of the workers in the crab processing industry here are Southeast Asian, and they are regarded as skilled laborers) [4]. Due to their work ethic, efficiency, and agile hands, the Southeast Asian immigrants have been credited with saving the declining crab-processing industry of the late 1970s and revolutionizing the oyster industry [4], [5].

The oil spill severely impacted the seafoodprocessing industry here in a number of ways. It led to long-term closures in seafood harvesting, it contaminated or killed oyster beds and crabs, and it led to a steep drop in demand and price, as the mere

thought of contaminated seafood simply turned off many consumers. (Cheap, imported shrimp have also caused prices to drop and have hurt the industry here.) Immediately following the oil spill, many seafood-processing plants closed. While some have yet to reopen, others are functioning at low-volume levels, providing former full-time employees just one or two days of work per week. This has amounted to severe economic consequences that

Photo by Amanda Younce

Visitors to Bayou La Batre are reminded of the town’s cultural diversity with the presence of a Vietnamese food market on the main street.

Photo by Amanda Younce

translate into lost jobs for virtually every aspect of the seafood industry.

The hard reality is that most of the Southeast Asian workers who are employed in this industry have little to no mastery of the English language.

Jobs in seafood processing require no English skills, and most of the immigrant workers here have had difficulty learning English, having arrived in the United States as adults and having found employment where English is rarely spoken, or even necessary, at the workplace. Many were also fishermen in their home countries and discovered a livelihood here well suited to their previous life experiences.

Most of these workers have few alternatives available to them because their training and experience in seafood processing is highly specific and because they lack the language and cross-cultural competencies to seek employment in other industries.

The problem is simple: if you’ve earned a living by shucking oysters or peeling crabs for the past three decades, speak little English and have no formal education, and then lose your source of income due to the mishap of a multinational petroleum behemoth, what else can you do?

Before I set foot in Bayou La Batre, I was intrigued by the fact that almost nobody in the media seemed to care very much about the plight of this unique population. In fact, nearly a year after

51

Cho Tran, a native of Vietnam and resident of Bayou La Batre, earns a living by shucking oysters. She has been out of work since the oil spill and dependent on cash compensation from BP. She hopes that jobs will soon return at the local oyster processing facilities. The mountain of oyster shells in the background reflects the importance of this industry for Bayou La Batre.

the spill, I struggled to find 20 substantial articles (out of thousands of articles covering the oil spill nationwide) that discussed the impact of the oil spill on the Southeast Asian communities of the Gulf Coast, though these communities constitute a substantial portion of the fishing community.

This lack of coverage is not surprising: the media

focus on the most immediate and visible aspects of an issue—those that are readily consumed by the public. In the case of the oil spill, coverage consisted of the iconic images of beach cleanup, harmed wildlife, oily marshes, and stained oceans.

The few articles that did discuss the community and social impacts of the spill were written just two

to three months after the spill. By September 2010, this topic virtually disappeared from the media, despite the fact that these are the very issues that continue to linger and remain unsolved to this day [6]. Furthermore, only about one-fourth of the articles that were written about the impact on communities reached a national audience. The few articles I did encounter in the print media indicated what I had apprehensively expected: dire consequences for a marginalized and vulnerable population. Then I found something even scarier: the struggles of these minority communities were largely eliminated from public discourse and virtually ignored. History has taught us that this offense 52 is no surprise, as social justices regarding natural disasters are often ignored because the media favor sensationalism and action clips while neglecting issues such as mental health and ethnic minority communities [7], [8].

To better understand the impacts of the oil spill on the Southeast Asian communities of Alabama’s Gulf Coast, I went there to experience it firsthand.

With no personal contacts and unable to speak Vietnamese, Laotian, or Cambodian, I found this venture to be a challenge. I was fortunate to forge a relationship with Boat People SOS (BPSOS), a national Vietnamese-American organization with an office in Bayou La Batre. With its support and

an interpreter, I conducted several interviews with Vietnamese oyster shuckers, as well as community leaders representing the Vietnamese, Cambodian, and Laotian communities. The story unfolded as they retold their personal accounts of how severely they and their communities have been affected by the oil spill.

What I found, to begin with, was an obvious language and cultural barrier. Imagine that language barrier multiplied by three—to account for the three principal Southeast Asian languages spoken in the community—and it becomes apparent that BP faced a formidable challenge in relaying information to such a community about extremely important matters, such as monetary compensation, claims, and cleanup. It is not surprising that some informants spoke of the many recreational and out-of-state fishers who capitalized on the Vessels of Opportunity cleanup program, while most of the Southeast Asian community members here had yet to be informed of this opportunity.

According to those I spoke with, this barrier was never significantly breached. BP made little outreach into the community and offered little culturally appropriate communication that would have made the population aware of the details and intricacies of the compensation process. Extensive paperwork can be daunting to those who can’t

understand what it says, and even documents translated into Vietnamese, Cambodian, or Laotian would have offered little help to community members because many are illiterate in their native language. Many people could not provide much of what BP requested (such as three previous years of W-2 forms) because people who could not read the forms never understood the importance of saving them. Those who work for themselves, such as shrimp-boat owners, couldn’t produce much of the required documentation that was required in lieu of W-2 forms. The mountains of red tape became nearly insurmountable to a populace that has a minimal understanding of the English language and our legal and political systems. My observations are not unique; a recent study of the Vietnamese communities of the Gulf Coast found a high degree of mistrust of higher institutions within the Vietnamese fishing communities affected by the oil spill. The study also found that they are extremely vulnerable due to language and cultural barriers, lack of experience in alternate employment, and lack of economic investments [9].

Excessive wait times for cash compensation (often for unknown reasons) further increased economic stress. There were many accounts of insufficient, unfair compensation and errors in income calculations. Information was unclear, and

Photo by Amanda Younce

Vinh Tran and other staff members of Boat People SOS have been instrumental in providing support to the Vietnamese, Cambodian, and Laotian residents of Bayou La Batre, particularly in the recovery process following the oil spill.

there were discrepancies between what was said by local BP claims adjusters and information provided over the telephone. Many are now dependent on unemployment benefits and food stamps to cover some (but not all) of their daily expenses. Jobs are returning slowly, though many workers in Bayou

La Batre’s seafood-processing industry are finding just one or two days of employment per week— hardly enough to support their families.

The recovery process has posed significant obstacles to this little-known (but substantial) segment of the Gulf seafood industry: how does

a multinational conglomerate like BP provide outreach to and communicate with this marginalized population? This is a question that BP may not have pondered sufficiently, because many of these people are desperate for the cash compensation that BP has been distributing to those economically impacted by the oil spill. Language and cultural barriers run amuck in this wish-wash of paperwork, (mis)communication, and chaos of answering the questions: who gets compensated, how much, when, and for how long? The picture grows fuzzier as many Southeast Asian seafood harvesters here work on a subsistence level, saving a large part of their catch for consumption and bartering—for which there is no documentation 53 and, therefore, no compensation.

While language and cultural barriers have hampered communication with BP, they have also become an unfortunate green light to lawyers and legal firms. I heard the same familiar story from several people: distant law firms were quick to act on an opportunity, gaining multitudes of signatures of those affected by the spill, capitalizing on the inability of their clients to read and speak English, and promising quick money. What was overlooked in the fine print (which could not be read by most who signed) was that their signatures not only gave such law firms the authority to represent their

Photo by Amanda Younce

clients and seek the compensation that they were “promised,” but that up to 40% of any compensation would be seized by the law firm. Moreover, it cut the communication channel between affected individuals and BP. I was told stories of people calling the BP hotline to question the status of their payouts, which had yet to materialize, and no information could be provided because it could only be shared with the client’s authorized legal representative. To make matters worse, many were not aware that there was a lawyer on their case, having clearly misunderstood documents that they had felt pressured to sign. Most did not know who their representatives were, essentially barring them 54 from acquiring any information about their claims.

If it weren’t for organizations like BPSOS, many residents of Bayou La Batre would have remained in the dark: unable to communicate with BP, unable to understand the requirements being asked of them to receive monetary compensation for lost income, unable to understand the paperwork they had to complete, and unable to obtain information about their claims after having signed legal forms they could not understand. Even applying for food stamps and unemployment benefits would have been a daunting task given the language barrier and requiring a venture into Mobile and an unfamiliar Anglophone world.

The Gulf Coast Claims Facility has been very slow and ineffective in responding to the needs of the Vietnamese-, Cambodian-, and Laotian-speaking residents of Bayou La Batre who were economically impacted by the oil spill. So intense is resentment towards BP that a security guard is stationed permanently at the office.

BPSOS perceived a pressing need. Immediately following the oil spill, its office grew from one staff member to a fully functioning office of three full-time staff, several AmeriCorps volunteers, and a contracted translator. Its service to the community was extensive, responding to a multitude of

needs and cultural and language barriers. Because most workers in the seafood industry immediately lost some or most of their income, there was an urgent need to file claims with BP and recover lost income. BPSOS helped to bridge the language barrier and provide assistance in the claims pro-

cess. While services were initially targeted at the Vietnamese community, BPSOS quickly realized that its services were needed by the Cambodian and Laotian communities as well, and the effort soon became a three-culture initiative.

When BP eventually opened a claims facility in Bayou La Batre, services were offered only in English. While one Vietnamese-speaking staff member was later added (although this person was from outside the community and unfamiliar with its unique needs), no Cambodian- or Laotianlanguage services have been offered there. It wasn’t until about four months after the spill that information was provided in Vietnamese, Cambodian, and Laotian (in paper and internet format), although some of this was incorrectly translated and of little use. Moreover, considering the illiteracy and lack of computer skills of much of the Southeast Asian population, the information did not effectively reach the intended population. For example, one Cambodian informant described to me how in many cases Cambodian community members used their children to read online information (in English) and then explain it in Cambodian for their parents. This may seem simple, but relying on a child to translate legal and complex documents is risky business and an act of desperation for unemployed parents who, virtually overnight, went from

steady employment to having no source of income to feed their families.

Monetary compensation from BP didn’t come overnight—in fact, some are still waiting for their money. Despite an almost total loss of employment for a significant number of workers in the industry, many people—out of desperation and growing debt—have been forced to accept just a few small payments of $5,000 (far less than their lost income) as final offers from BP. After having received final payments, the only thing left to do is pray that the jobs come back soon.

Because compensation payments from BP have come late or not at all, and have frequently been insufficient, many families in Bayou La Batre remain unable to support themselves. As such, the urgency for assistance in the form of food stamps and unemployment benefits has skyrocketed.

BPSOS coincidentally became a de facto satellite office for the Department of Human Resources and Department of Health. Instead of venturing into the English-speaking offices of Mobile, the BPSOS staff provided interpreters to help any nonEnglish-speaking community member fill out necessary forms, which could then be faxed to Mobile, and interviews could be conducted via telephone with an interpreter in the BPSOS office.

While the Vietnamese, Cambodian, and

Laotian communities of Bayou La Batre are often categorized as “Southeast Asians,” they are three distinct ethnic groups with distinct languages and cultures. Each is organized differently and has its own faith-based organizations (mostly Buddhist and Christian). There is little unity among the three groups. One recent article speaks of an antagonistic relationship among the three groups, referencing a crab processor who employs onethird Vietnamese, one-third Laotian, and one-third Cambodian workers just to prevent unification among the workforce [4]. However, the oil spill may have actually helped to form a bond among the three cultural groups when a common need was recognized. As described by a BPSOS repre55 sentative, “For the first time in probably ever, the three communities in our area finally were in the same room. We finally acknowledged we all had the same issues, and we all assisted each other.

It’s beautiful.”

Although the livelihood of any person dependent on the seafood industry in Bayou La Batre is in a moment of struggle and uncertainty, we must not overlook the dire situation of those who have worked most of their adult lifetimes processing seafood, have minimal English skills, have never had a chance for formal education, and have literally no other options. I asked my interviewees what

they might do if the jobs didn’t come back, and their answers all converged around the same point: there really are no other options, particularly with the cultural and language barriers present for many of the middle-aged and older Southeast Asian residents employed in the seafood industry.

On a more positive note, the economic vulnerability of this population and lack of alternative employment is beginning to be noticed. The community recently created the Business Support Center, designed to assist displaced workers and small businesses challenged by the Gulf oil crisis.

The Business Support Center offers Cambodian, Laotian, and Spanish translators and is helping to 56 provide the community outreach and multilingual support that BP hasn’t offered. The Business Support Center has also acquired a grant to offer free career training and English classes to Bayou La Batre residents.

One critical and mistaken assumption in the recovery process is that monetary compensation will solve any and all problems for individuals who were impacted. Yes, money pays the bills and puts food on the table; yes, the seafood processors and fishermen of Bayou La Batre are suffering because the oil spill has severely impacted the industry and caused jobs to disappear; and yes, these people need money. What has been overlooked, however,

is how the oil spill has affected more than just pocketbooks: depression, stress, and marital problems are now more widespread than ever. Such impacts are less visible (but potentially far more devastating) to families and communities.

One research study found that Gulf shrimpers suffer mental disorders at twice the rate of the general male population and that they are especially vulnerable to mood and anxiety disorders, which can lead to domestic conflict and abuse, divorce, and suicide [10]. A parent’s inability to provide for the family can take a toll on his or her mental well-being, and the roller-coaster, hit-and-miss process of BP compensation has not provided the stability that these families need. The situation is worsened by a cultural stigma among Southeast Asians regarding mental illness, as few affected individuals are willing to confront the issue or seek professional help. Counselors are available in the community, but the language barrier has also made this service infreqently used. These issues are often too personal for one to divulge via an interpreter, a person who is likely to be a friend, relative, or neighbor in this tightly knit community.

In my examination of the print media, I noticed a pervasive tendency to show the Southeast Asians of the Gulf Coast as a resilient people who have endured extreme hardships in their past and,

therefore, will also recover from this catastrophe.

Surely this cannot be a justification for ignoring their plight. I ask myself, what would have happened were it not for BPSOS and now the Business Support Center, which provide services to the Asian-Alabamians in and around Bayou La Batre?

Little effort was made by BP or any governmental agency to provide similar support. I spoke with many kindhearted, hardworking individuals, who by no fault of their own grew up in war-torn Southeast Asia in the 1970s. As refugees of war and calamitous economic and social conditions, they crossed the ocean in search of a better life. With no English skills, formal education, or familiarity with their new country, they found work in an industry that properly suited their situation and abilities: opening oysters, catching shrimp, and shelling crabs. And they do it well, which is part of the reason that they have succeeded and come to dominate much of this industry. It is thanks to their hard work that seafood lovers in Alabama and throughout the country can enjoy these delicacies of the sea in fine hotels, restaurants, and their own homes. Having survived several hurricanes (most recently Ivan and Katrina, from which many are still recovering), the people of Bayou La Batre now face a human-induced disaster that has come to threaten, or perhaps destroy, their livelihoods.

Photo by Amanda Younce

A beautiful entrance to the Wat Lao (Laotian) Buddhist temple just outside Bayou La Batre, one of three Buddhist temples in the area, reflects the unique and little-known cultural diversity of coastal Alabama.

resonate with the worries and fears of an uncertain future. The media have all but forgotten these communities of ethnic minority groups who have disproportionately suffered the impacts of the oil spill and the ensuing decline of the seafood industry.

I found value in learning about the reality of the Bayou La Batre community, and I hope others will too. Here live the people who toil long hours to produce delicious Gulf seafood for us, so let’s not forget about them. There’s no reason to turn a blind eye to a population in need just because they are different or speak another language. We are all unique, and our multicultural society must learn to appreciate and embrace its diversity and learn from it. The words of one of my informants from BPSOS 57 still ring in my head. I asked him the question, “What is the most important message that you would like for the Alabama public to know about the effect of the oil spill in your community?” His response was simple: “It’s not over.”

Acknowledgments Surrounded by cultural and linguistic barriers that have inhibited their integration into society, for residents of this community, everything to do with this oil spill and the recovery process has become a web of confusion—difficult to imagine for those who have never lived such an experience.

It would be all too easy for a misinformed public to believe that times are good again on the Gulf Coast, as the media now provide images of clean beaches and tourists who once again tread the beaches and bring in dollars. Yet many voices of the Gulf continue to go unheard, and these voices

I would like to give a special thanks to the staff of Boat People SOS in Bayou La Batre for their generous support, including coordinating my interviews, providing an interpreter, and reviewing this article for accuracy. I am also thankful to the Business Support Center in Bayou La Batre for its input and support.

Photo by Katie Jackson

P

R

O

F

I

L

E

Bill Walton

Revitalizing the Gulf Community by Strengthening the Oyster Industry

by Katie Jackson

58

As Gulf Coast communities struggle to rebuild their economies after the BP oil spill, the oyster may well be the phoenix of the recovery, rising from the ashes of the spill. At least that’s the view of Bill Walton, an assistant professor in the Department of Fisheries and Allied Aquacultures.

Walton is stationed at Auburn University’s Marine Extension and Research Center in Mobile and specializes in marine invertebrate fisheries, restoration, and aquaculture. He is helping the oyster industry rise from the ashes of the spill.

Walton joined the lab’s staff in January 2009, arriving in Alabama from Massachusetts with big plans to strengthen the state’s oyster industry. In his dual role as a researcher in the College of Agriculture and specialist for the Alabama Cooperative Extension System, he immediately set to work establishing research and outreach efforts to build this industry.

Then the oil began to spill.

Photo by Jeff Etheridge

59

Almost immediately, Walton’s job shifted from aquaculture researcher to oil-spill biologist. He spent his days (and nights) trying to answer questions about how the oil, dispersants, and spill-related activities would affect oysters and other seafood species. Three of his oyster research sites, located in waters off the Mobile and Baldwin County shorelines, were also used to monitor and document the

day-to-day impacts of the oil spill on oysters.

Today, however, Walton’s days are once again focused on building an oyster industry rather than surviving a catastrophe, giving him a sense of hope for the industry he bases in part on the resiliency of Alabama oysters: “So far we are relieved to say that we have not observed any ill effects in oysters from the spill,” says Walton. Testing indicates

that concentrations of oil or other spill-related pollutants are below or barely above detectable levels and thus are far below levels of concern.

What’s more, Walton’s research indicates that the growth and survival rates of oysters were not affected by the spill. That said, Walton points out that ongoing research and testing will monitor any long-term effects.

Photo by Katie Jackson

Walton and his colleagues have worked with local oystermen to develop oyster-farming techniques.

Routine inspection of oysters for growth, survival, and condition are part of the job.

60

Another reason for Walton’s optimism is the response of local residents to his ideas; in the immediate aftermath of the spill, people are embracing Walton’s way of thinking. When Walton first arrived in Alabama, one of his specific ambitions was to help oystermen produce premium oysters for the half-shell market. “The goal,” he says, “is to produce a consistently beautiful oyster that will bring a higher price than oysters intended for the shucked market.” Producing such high-quality oysters requires exceptional oyster management.

Such management is best accomplished using intensive oyster farming, a form of aquaculture

common along the Northeast and Northwest coasts and used to some degree in the waters off Louisiana’s shore. Walton saw intensive oyster farming—which involves growing oysters in bags suspended or anchored in marine waters—as a way for Alabama oystermen to augment, not necessarily replace, their incomes from wild-caught oysters.

Though Walton’s educational efforts related to oyster farming took a backseat during the spill, those ideas and techniques are again front and center: “In the aftermath of the oil spill, people are looking for ways to strengthen the area’s seafood industry,” Walton says. Oyster farming is one such

option, and local residents are exploring it through efforts funded by the Mississippi–Alabama Sea Grant Consortium and the National Sea Grant College Program. At the time of the spill, only one intensive oyster farm was operating in Alabama.

Since the spill, that farm is going strong, two new private operations have started up, and a 50-acre oyster farm park has been established.

In collaboration with a group of commercial fishermen known as the Organized Seafood Association of Alabama, Walton helped establish this oyster park, a prepermitted area of water much like a business park or incubator, where would-be oyster farmers can borrow equipment and try their hands at oyster farming before they fully invest in it. Currently, three potential growers are being

Photo by Katie Jackson

Photo by Jeff Etheridge

selected to learn the ropes at the park, and more are applying for access to the park’s resources: “We have been told that interest in oyster farming will far exceed this park,” says Walton. Indeed, plans are under way to establish two large private oyster farms along Alabama’s Gulf Coast, each of which could produce 500,000 or more oysters per year.

But what’s caused this increased interest in oyster culture?

Walton believes the spill played a major part in this growing interest: “I think the oil spill was a catalyst for this because it pushed people to think more creatively.” Oystering families are beginning to view aquaculture as a way to bring their sons and daughters into the business. Traditional oystering is a physically demanding business that offers no guarantees of a steady income; thus, fewer and

fewer young people get into the business. Oyster farming and other new aquacultural enterprises may make the oyster business more appealing to a new generation.

Another reason for the increased interest in oysters may be related to the recovery and restoration money available as a result of the spill: “It has people along the Gulf Coast, including folks in the oyster industry, thinking about how they improve their situation,” says Walton. He continues, “We can’t ensure there will never be another oil spill, but people here are looking for ways to make themselves more resilient if another spill or a storm happens. They understand how important it is to improve the seafood industry, improve profits, and create jobs.”

Intensive oyster farming for the restaurant market can help do just that, but it is not the only idea that Walton and other Auburn faculty and staff are exploring to help with restoration. In addition to producing premium half-shell delicacies for restaurants, oyster farms can produce oyster seed, often called spat, that can be used to rebuild wild oyster reefs and that will, in turn, help with environmental restoration. Walton is also looking at ways to use precision farming technologies, much like the GPS-guided tractors of terrestrial agriculture, to map and manage private oyster beds. He is even

working with Alma Bryant High School in Bayou La Batre to create a program to train students in aquaculture so those students can take highly developed skills straight to work for oyster farms.

All these efforts and others, along with the commitment of local residents to rise from the ashes of the oil spill, bode well for Alabama’s Gulf Coast, which pleases Walton immensely. “I love my job,” he says. “I know it could have gone a lot of other ways, and I am very lucky to be able to do what I am doing.” In particular, Walton appreciates being able to further Auburn University’s service to Alabama: “Auburn is good at building industry and looking at how we get someplace better, and that will be an important role for us into the future. 61 I like the idea that Auburn was here before the spill for the commercial fishermen and seafood industry, and Auburn will be here for them long after the spill.”

Photo by Katie Jackson

by Judith Sheppard

Deep Water

135

Photo by Judith Sheppard

Hurricanes Hold Little Fear for Coastal Alabamians.

The Harm That Men Do? That’s Different

L

ife at land’s end is perilous.

Yes, you may say, life anywhere is a gamble.

But odds vary. In most places where human beings dwell, natural disasters are so inexplicable, so unexpected, that we can only call them acts of God. Not so on the Gulf Coast. Catastrophe season opens every June 1. A tropical wave off Africa, maybe, curves back on itself in the far-off Atlantic, and by the time it is a white-capped wheel on a satellite map, the watch begins. If enough wind and water gather in, that wheel earns a name. And if that wheel becomes a hurricane and rolls toward land, and that hurricane’s eye slowly swivels toward the great blue bowl of the Gulf of Mexico, residents are ready: they pull in, nail down, stock up, board up.

Imminent peril makes people different. Resilient.

They believe they can beat the odds. They do not leave, some of them, because of love of the water, the South, their history. Some stay because they are stubborn; some stay because they have nowhere else to go.

That’s why, when disaster struck in April 2010,

Photo by Jeff Etheridge

a human-made disaster for which coastal wisdom and long experience could not have prepared them, they got angry.

It wasn’t just the appalling video of oil gushing out of a BP oil rig into the waters week after week, or the infuriating impotence of experts to stop it, or even the economic and environmental devastation they dreaded. No. The fact is, coastal Alabamians 63 are some of the proudest, most fiercely territorial, catastrophe-hardened people in the country. They hate it when their lives are wrenched out of their control. Historically, they really hate it when the federal government does it. Put the government alongside a huge foreign corporation (British, yes, but foreign nonetheless) that seems completely clueless about their pride and their fears, and it’s no wonder people felt confused.

And angry and suspicious of each other. (Who got money from BP? Why didn’t I get any?) Maybe paranoid. (What really happened that we’re not being told? What unseen horrors lie beneath the

Photo by Amanda Younce

surface?) And anxious: no one, not even the scientists, knows what will happen when a hurricane, even a big storm, roars close to the coast. But some people, even some of the same people, went further. They looked harder at how much there was to be done to save the coast’s economy. They reexamined some old beliefs. And they saw with new eyes not just the beauty and bounty of the environment on which they’d built their lives, but its fragility.

I



t smells like heaven in Hope’s Cheesecakes, a little bakery run by Bob and Jeanne Donald in Gulf Shores. People come in to buy by the slice 64 or the cake, choosing from varieties that stun the senses: chocolate Kahlúa, pineapple, all kinds of berry, pecan praline, lemon, key lime, amaretto.

On the walls are Christian paintings, lighthearted sayings (“Eat Well, Stay Fit, Die Anyway”), and a plaque with a gilded chunk of tar—a souvenir from the Exxon Valdez spill.

Yes, the Donalds were living in the tiny town of Valdez, Alaska, when that oil spill occurred on Good Friday 1989. The situations are very different, they say: “Here, it was like one bowl of misery.

It was shared by everybody,” says Jeanne. That is, it was very different except for one truth they hold

Judith Sheppard (left) with Bob and Jeanne Donald.

inalienable: an oil company has no soul.

“I met with [town officials], and I told them, don’t trust BP any farther than you can throw a truck,” says Bob. “They are not in the business of

passing out money. Anything they say to you, it’s not that it might be a lie. It will turn out it is a lie.

But I couldn’t really tell people anything. It was almost as though—and I guess I’m going to wax

philosophical here—almost as if people had to make their own mistakes.”

Talk to the couple a while, and you see the lingering anguish of what happened to their friendships and the landscape 22 years ago, also because of an oil company’s carelessness. Bob describes life in Alaska as so beautiful that to step out in the morning was “almost mystical.”

“Everybody got along,” Jeanne remembers.

“Fishermen, environmentalists, oil executives. We went to dinner with them. After the oil spill, people who were good friends of ours, we never speak to them. A lot of people made money, and a lot of people didn’t.”

They tell this grim joke: people ask the Donalds if they are planning to move to their town so that they can get ready to move somewhere else. Ha, ha. Like most businesses on the Alabama beach, Hope’s Cheesecakes lost a third of its customers in 2010. And, like almost everybody else, the Donalds had expected a good year. “We were gradually building up. We were on our goal,” says Bob. “We’d had several years of no hurricanes. Business was getting better.”

Yet it’s now as if the spill and its effects are over.

“This summer is the best we ever had,” he says. “It’s like [the spill] never happened—like a mirage.”

“It’s probably going to affect people [later],” says

Jeanne. “You’ll have more divorces, more domestic violence, all of that. It just comes with the disruption of people’s lives.”

None of that mutes the message they’ve delivered to oil spill victims. Says Jeanne, “I told them, ‘Remember, get what you can now. As soon as the lights and cameras go out, they’re gone.’”

W



e will get this done.

We will make this right.

—BP, national advertising-campaign slogan

By the time BP’s mile-deep oil well was capped four months after the explosion, 4.9 million barrels of oil had gushed into the Gulf. And 11 men, whose names few of us ever even heard, were dead.

Make that 12: a few months later, a charter boat captain shot himself in the cabin of his boat. His family said he feared losing the family business.

Social services, including Project Rebound—a cluster of agencies created to deal with Ivan’s aftermath and then revived after the spill—reported spikes in domestic violence, depression, truancy, and homelessness.

No one can guess the final financial cost. For one thing, it’s almost unbelievably complicated: BP quickly created a $20 billion escrow account

to pay for cleanup costs and “legitimate” claims of personal and financial loss. President Obama tapped Ken Feinberg’s law firm, which had directed compensation to the families of 9/11 victims, to distribute that money through the Gulf Coast Claims Facility. Many don’t like the fact that BP is essentially paying Feinberg’s salary, which started out at $850,000 per month and was raised to $1.25 million in early 2011. In fact, Feinberg has few defenders. BP complains that Feinberg gives money to anybody. Many residents agree, even as they fume over their own claims being refused over and over again on technicalities. It begs the question: how much is a year in someone’s working life worth? By September 2011, Feinberg had awarded 65 only about $4 billion in claims—a fifth of that $20 billion pot.

“There’s a lot of resentment,” says Todd Bishop.

Bishop directed the 2011 Dauphin Island Deep Sea Fishing Rodeo, a rodeo that this year won a spot in the Guinness record book as the world’s largest fishing tournament. Last year, the tournament had to be cancelled. “I’ve seen—firsthand—claims processed and paid that people probably didn’t deserve. I can tell you, as somebody looking at the process from the outside, it looks more or less like a completely random process.”

In July, Alabama also received $16 million in BP

funds for concerts and events, national advertising, and business incentives to promote tourism and recovery. Millions have been used to fund national advertisements to entice tourists back to the beaches and to buy Gulf Coast seafood. BP had hired many of those it put out of work for shortterm jobs such as turning their boats into “Vessels of Opportunity” that were sent out to spot oil on the water. Money flowed into charities and foundations to help people pay rent, get counseling, find jobs, and receive free food.

In 2011, a national commission issued a report blaming BP, Halliburton, and Transocean—the entities involved in drilling the well—about 66 equally. The Justice Department formed a task force to look into possible criminal charges, but legal experts say it’s unlikely anyone will serve jail time. They point to the fact that, after the 2005 BP refinery explosion, which killed 15 workers in Texas, BP paid $50 million to the federal government and $21 million in fines for the hundreds of safety violations at the site.

This time, the company’s most visible casualty was Tony Hayward, BP’s CEO, who stepped down after complaining that he wanted his pre-oil-spill life back. He left with a year’s salary—over $1 million—and kept his pension, about $17 million.

Predictions were dire for BP in spring 2010; many

economists doubted the company could survive.

Yet in spring 2011, BP reported a 17% increase in profits even though it had produced 11% less oil.

In July 2011, almost the same day Attorney General Eric Holder visited Mobile and announced an independent audit of the claims process, BP sent a letter asking Feinberg’s operation to reassess its decisions. BP’s letter said that people initially thought the spill would affect people for years, the so-called “future factor,” but it pointed out that tourism and the seafood industry had rebounded to record heights. In short, BP said, it was time for the Gulf Coast to be on its own.

T



he mayors of Gulf Shores and Orange Beach are more different than alike, but they have this in common: the most disappointing year in their lives, thanks to BP, was 2010.

Robert Craft, 60, the mayor of Gulf Shores, is a tanned, trim businessman who runs marathons and builds golf courses. He has survived a brain tumor, two brain surgeries, and decades of diabetes. He speaks in understatement. For instance, he did not accuse BP of lying when he spoke at a symposium in Orange Beach in October 2010. What he said was: “I simply cannot believe that a company this

big and successful could be this inept.”

Tony Kennon, 55, Orange Beach’s mayor, runs several clinics for physical therapy in the county. A ruddy man with a quick smile under a gray moustache, Kennon is a fireplug of a man so charged with energy and emotion that he sometimes seems to vibrate in place. Understatement is not his way.

What he’s seen since the oil spill has “shaken my confidence in the way things work today,” Kennon says in his office one stormy day in July. “A multibillion company exists to make money. I get that. I’m in support of that. But there should be a moral compass. They spent $40 million (in advertising) to show us they’re a caring, loving company. And that’s the biggest bunch of garbage I’ve ever heard.

I do not believe a true free-market system can exist in a moral vacuum.”

Ironically, when 2010 dawned, both mayors were more optimistic than they’d been in years.

Hurricane Ivan had hammered the shore in 2004.

In 2005, Katrina, though not as devastating as it was to the west, was more trouble. Then came a series of heartaches that kept tourists away: overbuilding that left condos unfinished on the beach, record-breaking gasoline prices, two of the busiest hurricane seasons since 1941 back-to-back.

Summer 2008 was a good and promising season.

But then the economy imploded. The fact that

The T-shirt Ladies

Photo by Judith Sheppard

Webb: There weren’t any tourists. The

houses were empty, but BP rented

some of them.

Williams: My business was OK. A lot of

people have messed-up boats. Yes,

I did file a claim. (How much?)

You’re not going to get any more

from me.

Gray: She won’t even tell me!

Williams: It covered what I lost last year, but

each year we grew, so there was no

growth last year.

Webb: With a hurricane, FEMA helps

you. They’re on the ground in 24

hours. Not with this.

From left: Kaye Webb, Angela Gray, and Margaret Williams of J&W Sales. These women were selling print-to-order t-shirts at the Dauphin Island Deep Sea Fishing Rodeo in July 2011.

Photo by Judith Sheppard

A t-shirt that reads, “Here’s a story about a man named Jed, a poor fisherman that barely kept his family fed. Then one day he was fishing for some food, when up on his hook came a bubbling crude!! Oil, that is.”

67

Photo by Judith Sheppard

Bruce Coker

68

Coker, 40, remodels houses and lives on Dauphin Island.

“It didn’t hurt me. Well, it hurt the people I worked for, so I guess it did. I just bought a boat. Seems like they could have paid the notes on it. I don’t want them to pay for the boat, but that was a whole year it sat out in the yard.”

He jokes, “I’m hoping, if I keep eating the seafood, they’ll find out something’s wrong with me and they’ll pay me a big check.”

defined 2009: people without jobs and houses don’t take vacations at the beach.

But 2010—everyone was wide-eyed with anticipation. The economy had leveled out, people yearned to get away, and the sticker shock of gas prices had waned. The spring-break crowds arrived on cue in March. Memorial Day—the traditional opening day of the summer season—would be like a ribbon-cutting on a new era.

Two weeks into April, the Deepwater Horizon rig exploded. Weeks ahead of any sign of oil, tourists fled.

“If it weren’t such a travesty, it would be funny,” says Kennon. He recalls watching workers at Perdido Pass, the little neck of water at the Alabama–Florida line that joins the Gulf to myriad inland lagoons and canals, simultaneously putting up booms to soak up oil and removing them to allow pleasure craft through. Not surprisingly, oil escaped. “I was at my wit’s end, screaming. I was screaming: ‘Why did you not understand this was going to happen?’”

The mayors’ reactions were different. Craft tried to avoid press conferences and the public meetings that drew angry citizens and television cameras.

“We don’t need that kind of presence here,” he says.

Even when he is angry, he is quiet. “I’m typically not vocally critical,” he told a Mobile television station reporter in July 2011, “but people should at

least return phone calls.”

Kennon held 23 meetings in those first months.

Hundreds came. “I didn’t want to be the mayor in Jaws, but I didn’t want hysterics, either,” he says.

“My purpose was to tell people everything I knew.

The way I see it, if I’m a public servant, the best way to be a public servant is to show what we were doing, that we were being honest.” And it let them “express their anger and disgust.”

He didn’t appreciate a lot of what he saw on the television screens, but he was practical about it.

“The day I got on CNN,” recalls Kennon, “was the day I started getting my phone calls returned.”

Craft agreed: “It didn’t take long to figure out we weren’t going to be able to depend on BP or government entities. We were going to have it do it on our own,” he says. “We have proven to ourselves and others that we can survive anything. But the pain and suffering and stress—how do you gauge that?

Everything we depend on—our livelihood—was threatened. Go through a year carrying that around.”

Kennon has stayed angry. “I carry that anger between me and BP,” he said in July. “Here we are, and they’re still nickel-and-diming us.” He felt forced into continuing to publicize the catastrophe, when he wanted instead to publicize the beach’s comeback: “I’m having to fight to get paid for something I didn’t want to talk about!”

“I support drilling. I believe in a free-market system. I thought we lived in a moral society. But where is the principle? Whose fault is it? It’s everybody’s. There’s no one to blame but the man, or the woman, in the mirror. Look in the mirror. We vote our pocketbooks. We don’t vote on principle.”

B



ayou La Batre, a fishing town on the west side of Mobile Bay, has been in the midst of hard times for decades. The oil spill just pushed it nearer to the brink. This is a reality that weighs on Stan Wright, or “Bubba Stan,” as the staffers in the municipal building call their mayor.

69 “You know what? All these media, you come in here, you get in my face, and you aggravate the hell out of me,” says Wright in his paneled office on a July afternoon. He is a big, sun-weathered, slightly grizzled man. The license plate on his red pickup sums up his life’s work: OYSTERS. Even today, though he’s agreed to talk to a journalist, he makes it clear he’d rather not. He looks out under the brim of his camouflage cap warily.

“I’m tired of talking about it,” he says. “This oil spill, it’s like a hurricane. It’s like a 10-month hurricane.”

Wright is an unusual mayor of an unusual town.

People call Bayou La Batre one of the last authentic

Photo by Amanda Younce

70

Judith Sheppard interviews Tim Johnson, who owns five shrimp boats in Bayou la Batre.

fishing villages in the South. That means it is mostly poor and that most people do backbreaking work either on boats or processing whatever comes off them—oysters, shrimp, and fish. So many people wear the white plastic boots made for traction on crushed ice and fish guts that the footwear

is called Bayou La Batre Reeboks. “They don’t get rich,” says writer Frye Gaillard of the people, “but they do get by.”

The city’s history is rich and surprising, including resort hotels, hurricanes, shipyards that built a vessel for Pirates of the Caribbean, a clinic founded

by the woman who is now surgeon general, and the site where Forrest Gump moved to run his fallen friend’s company. Much of the Gulf ’s shrimp floods through the processing plants here. American Indians, the French, the Spanish lived here; in the 1970s, when Saigon fell, a flood of Southeast Asian fishermen and their families came in. They account for 40% of the population. The area is beautiful—great oaks, winding waterways, and views of Mobile Bay—but it is not picturesque.

“This is a working community. People move here to work. They live off what they make,” says Wright. He thinks the BP claims money is going to the more visible, more appealing places, like Gulf Shores and Orange Beach. “Now, they’ve got their white sand beaches, their pretty blue water, I’m not against that. But I’ve got people who can’t put food on the table.”

“One thing about this community I want you to understand,” says Wright, rubbing his hand over his face and, now and then, discreetly spitting tobacco juice into a cup. “They don’t want anybody to give them anything. They’ve been independent. And now they’re dependent on this big oil company that’s screwing them around.”

First, BP caused the spill. That meant closed waters, idle and unpaid shrimpers, and a halt to a common, age-old practice: “People couldn’t even

Gilligan

Photo by Judith Sheppard

On a clear, hot day in Bayou La Batre, T. J. Whitley sits on a yellow Press-Register newspaper box outside the local grocery store, cell phone and Bic lighter in his hands.

Two friends standing near him laugh, walk away, and say they don’t want to answer questions, but one suggests this: “Talk to Gilligan.”

Whitley is lean, sunburned, and unsmiling, with an “Irish Pride” tattoo on one arm and a “Mama” tattoo on the other. He speaks in cryptic sentences. Several girls go by in a truck and yell, “Hey, Gilligan!” Yes, he nods, that is his nickname.

He consents to talk about this past year.

Q: Are you from this area?

A: Born and raised. Been working on a shrimp boat since I was 18. I’m 29 now.

Q: Have you felt any effects from the oil spill?

A: Pretty good amount of effect. They closed a lot of waters. They shut down

everything at one point for about three months.

Q: So what happened to your job?

A: We went out [shrimping] farther. Farther west.

Q: West?

A: Around Texas. We do that every year.

Q: What else? What about your life off the boat?

A: Couldn’t make certain payments. . . . You got to do what you got to do. I’m

okay. I don’t worry about it. I don’t deal much with people. I don’t rely much

on people.

Q: What was different about this disaster from, say, a hurricane?

A: With a hurricane, there’s more on the federal government and state government.

This oil spill is all on BP. Apathy makes the world go round. It’s the root of evil.

71

Photo by Judith Sheppard

Andy Andreasen Andy Andreasen is a native of south Alabama, a Fort Morgan volunteer firefighter, and a technician with a Gulf Shores air conditioning and heating service: I tell you what. My kids ask me, “Daddy, you going to eat that seafood?” I tell them, “I’m going to take one for the team. I’m going to eat as much seafood as I can between now and when I die. And if I die under suspicious circumstances, get an autopsy, and sue the hell out of them.”

72

Seafood is a big part of our survival here. It’s practically free. You catch what you eat. You catch the crabs; you eat them. Shrimp, you eat them. Flounder, you eat them. You can do that three nights a week, you save $50, and it’s good, too. Last year, I worked 12 hours a week. This year, it’s been 60 to 80 hours a week. If I hadn’t had a really good boss, I don’t know what I’d done. He paid me 30 hours a week all through the oil spill. He kept up my insurance. He kept up my benefits.

I don’t think we’re through with the oil yet. If you go out at night—you can’t see it right now because there’s too much seaweed—and use a flounder light, you can see plenty of oil on the bottom. They hid as much oil as they picked up. You go 30 or 40 feet off the water’s edge, dig down there, that’s where the oil is. The tidal effect—it pushes, and pulls, and stretches, so it could be clear right here and oil over there.

One night, me and my buddy were down there, and I was digging in the sand for bait—I like to use sand fleas—and I’m just digging and talking, digging and talking, and my buddy says, “Look at your hand.” It was just dark. Just covered with oil.

go down and rod-and-reel fish for their supper.”

The real problem is bigger than the spill, he says.

“The number-one endangered species right now is the commercial fisherman,” he says. “People just take, take, take. [They] put the net fishermen out of business, want new regulations, new mandates.

They got our fishermen with their backs against the wall.”

Then came layoffs and cutbacks on land too.

Unable to pay bills, people crowded in with families and friends. In fact, the first three people a writer encounters on walking into Rx Express Drugs, a store in the same dispirited strip mall where BP has put its area claims center, tell the same story.

Behind the counter is Amanda Horn, a shy, sweet-faced young woman. She says her in-laws have moved in; they lost their jobs oystering and had their power cut off. Waiting at the cash register is Tasha Gaut, a cheerful new mother who wears a t-shirt that says, “If idiots could fly, this would be a freaking airport.” She says her house is crowded, too: her third baby arrived a few weeks after the oil spill and, soon after, her mother-in-law and her husband moved in, too. People sleep wherever they fall, she says, on couches and air mattresses. When they can’t pay the power bill, neighbors across the street come stay, too.

Good neighborliness isn’t always the rule, she says. “The oil spill was a lot worse than Katrina.

People just went off the deep end. If people just keep getting [their claims] denied, I don’t know how it’s going to go down.”

Evelyn Roberson is sitting in a nearby chair, waiting patiently for a prescription she wasn’t sure she could afford. “The town is in a whirl,” she says. She kept her job as a cashier at a Raceway gas station, but her hours were cut in half. “When the seafood workers can’t work, it’s a domino falling down. It hurts all the businesses.

“People are angry,” she says, though it’s exhaustion that shows in her voice and face. “They still are. They thought, because we’re uneducated, they didn’t have to worry about us here.”

There’s been no violence here, as was threatened in Mississippi and Louisiana. But BP is playing it safe. Next door, outside BP’s claims center, a Mobile County sheriff ’s patrol car is parked all day. Its driver, an off-duty deputy, uniformed and armed, sits at a desk near the door.

A few more doors down, Alvin and Penny Bosarge have just finished shopping at a local discount store. He wears a stained undershirt and a blue bandanna decorated with crawfish. Her t-shirt shows the United States flag. They’ve been married 20 years.

Bosarge is a common name here. It comes from the town’s French founders. These Bosarges say they lost their Dauphin Island jobs at a sno-cone shop when tourists dried up last year. Their truck is now in title pawn, so they pay $73 a week to use it. Of course, says Penny, gas is too high to go anywhere.

These days, Penny signs up on Tuesdays to receive the free food one of the churches collects and gives away. On Fridays, she picks up 10-pound bags of chicken parts, jars of peanut butter, and the like.

Like many, they mourned the blow to their self-sufficiency. “It used to be nothing for us to go fishing, and we’d catch mullet, trout,” says Penny.

But then the waters were closed. So, like many people on the edge, they took the $5,000 “quick 73 pay” settlement offered to individuals with minimal documentation of loss. “Everybody took it. They had to live. We had to,” says Alvin, who says he worked on shrimp boats for 20 years. “Everything was due.

I took it so I ain’t going to worry about the power being paid or them taking my car.”

“We sold everything,” says Penny. “Our flat screen TV, my jewelry.”

“We got nothing of value anymore,” says Alvin.

“Just the house. And I’ve been tempted to sell that.

But then we’d be out on the street.”

Penny says they’re pretty sure they’re going to get jobs as cooks at a pizza place on Highway 90. Not a

minute too soon. “Me and Alvin are both on blood pressure medicine and anxiety medicine,” she says.

Things are even worse for the Cambodians, Laotians, and Vietnamese who live and work here.

A national commission on the oil spill found that the language barrier has kept many minorities from filing and receiving claims. (BP eventually brought in translators.)

Wright says that he has made it one of his jobs to help that group: “I have diverse populations. We got to be sure to work with everyone—all the nonprofits, the Asians, the Hispanics. I just ask them that question: what can I do to help you?”

He shakes his head. “The last thing you want to see is a Cambodian on TV with Ann Curry,” 74 he says. “All I’m asking—everything should be on an even keel. I want everybody to get treated the same, Democrat or Republican, white or black.

BP did a good job of dividing people against each other, group against group, brother against brother, brother against sister.”

B



y the time you read this, a hurricane may have swept on shore and spread disaster— including whatever the Gulf might hold in its depths, particularly the tar mats formed by sunken

oil on the sandy bottom—all over the coast.

It’s possible that the optimism of scientists and residents will be proven wrong. And it is entirely possible that poor people in places like Bayou La Batre or Bon Secour will just get poorer.

Still, in summer 2011, the Alabama beaches were so beautiful they looked a little unreal.

Dauphin Island and Fort Morgan, the two narrow arms of land that curve toward each other at the bottom of Mobile Bay, looked as if nothing had happened at all.

It was like deja vu, only better.

Recovery—in Alabama, at least—seemed so perfect that conspiracy theories thrived, including ones involving evil environmentalists, foreign submarines, and secret government plots.

Nonbelievers pointed to government figures that say more than five million barrels of oil were spilled, but only 265,000 barrels of oily water and 92 tons of solid waste were collected, and 265,450 barrels of oil were burned. Do the math, they say.

But even Ben Raines, one of the Press-Register’s award-winning environmental reporters, says the worst fears have not come to pass. He’s not one to soften the truth. For years, he’s been proving the federal government and industries have given faulty information to the public, and he’s been forcing them to admit it. His “crowning

achievement,” he says with a laugh, is the threeinch file that Exxon reportedly keeps on him.

He also took the underwater photo that, when the oil was worst, became a symbol of the degradation of the coast: seen dimly through murky yellow water, a sludge-coated crab lying on the sea bottom next to a small American flag.

“I am very optimistic,” he says, though “I would not want to be a fish around a wellhead or in the Louisiana marshes.”

The aftermath, though, continues to confound him. He shares the same puzzlement as Robert Craft, who was stunned when he realized that the federal government and BP not only weren’t planning to let locals lead the recovery, but also didn’t seem to want them to help at all.

And like Tony Kennon, who watched dumbfounded as workers in alarming hazmat suits combed the sand, he dismisses with contempt Hayward’s promise to the coast that BP will “make you whole.”

“It was strange to watch, incident after incident,” says Raines of the recurring scenes of government officials having to retract and revise information over and over. “Why didn’t they come out and tell the truth?”

T

H

E

G

U

L

F

Photo by Jeff Etheridge

A

ll life is fragile. Like other invertebrates, sea stars suffer dire consequences from ingesting oil, including impaired respiration, digestion, reproduction, and mobility. Reduced mobility leaves them vulnerable to predators.

75

Photo by Melissa Humble

P

R

O

F

I

L

E

Cova Arias

Looking for the Human Pathogen Vibrio vulnificus in Oil-Spill Tar Balls

by Jo Mackiewicz

76

When Cova Arias first arrived at the Gulf shore after the spill, one of her first observations was the dense peppering of tar balls across the beach: “The first thing I saw on Dauphin Island were tar balls. . . . There were a lot of them.” Arias’s experience as a microbiologist in Auburn University’s Department of Fisheries and Allied Aquacultures told her that these reminders of the spill 50 miles away were not only unsightly, but they could also be harmful to beachgoers who encounter them.

Tar balls are one variety of weathered oil—oil that has been exposed to water and air. And as a type of oil, tar balls contain a large amount of carbon, which is an ideal energy source for bacteria.

In fact, researchers working on oil-spill cleanup efforts have investigated the possibility of using bacteria to consume oil.

Arias, who has spent much of her career studying human-pathogenic bacteria in oysters and other seafood, understood the potential for tar balls to

Photo by Ash Bullard

harbor and feed dangerous bacteria. In particular, Arias’s research has focused on the dangerous human pathogen Vibrio vulnificus (V. vulnificus).

Standing on the tar-ball-laden beach on Dauphin Island, Arias decided to focus her expertise on a new research question: to what extent do tar balls in the Gulf contain V. vulnificus? In addition, she decided to conduct a preliminary study to examine the possibility that V. vulnificus, like some other bacteria, biodegrades weathered oil.

Such research questions about a potential increase in human pathogens are critically important. V. vulnificus has the potential to wreak much havoc on people who come into contact with it— particularly when people consume it in seafood.

V. vulnificus generates more seafood-borne fatalities than any other human pathogen and can be responsible for septicemia, or bacteria in the blood, which can lead to fevers and rapid heart rate, among other symptoms [1]. More relevant to the presence and quantity of V. vulnificus in tar balls, however, is its potential to cause infections upon contact with a wound; such infections can generate secondary septicemia, which has a fatality rate of 20% to 30% [2].

The potential capability of tar balls to act as a source of human pathogens, including infectious V. vulnificus, has in large part been overlooked. The National Oceanic and Atmospheric Administration

website, for example, describes tar balls as a nuisance, warning only of their potential to cause topical (such as allergic) reactions [3]. In addition, when reviewing the existing literature to prepare for her study, Arias found just one study that examined bacteria in tar balls. And that study, examining tar balls from an oil spill off the coast of Nigeria, looked only at bacteria that are native to that region [4].

To answer her first question, Arias attempted to isolate V. vulnificus from tar balls scattered across five of the Gulf ’s beaches. She collected samples of tar balls, along with samples of water and sand around the tar balls, from three Alabama beaches—Dauphin Island, Fort Morgan, and Gulf Shores—as well as two Mississippi beaches—Ship Island and Gulfport—from July to October 2010.

(Around October, dropping water temperature causes levels of bacteria to fall naturally.)

The results were quite clear. Arias found that

counts of V. vulnificus from all five beach locations were significantly higher than the counts in the samples of surrounding water and sand: over one million V. vulnificus cells per gram were present.

According to Arias, one might expect about one thousand V. vulnificus cells per gram in the sand and water of Gulf intertidal zones. Thus, Arias’s findings strongly suggest that the sampled tar balls were not just part of a V. vulnificus hot spot [5].

To answer her second research question, Arias tested whether V. vulnificus, as a carbon-feeding bacterium, biodegraded the sampled tar balls. To do this, she attempted to culture V. vulnificus by leaving cells in seawater agar that she had enriched with tar balls. After seven days, the V. vulnificus cells had not 77 multiplied. This finding, says Arias, probably means that V. vulnificus does not consume carbon from tar balls directly but instead consumes the byproducts of other microbes that do.

Tar balls are difficult to clean up. They stick. And people with compromised immune systems— those who know they have a health problem and those who do not—can come into contact with tar balls while wading ankle-deep in the water of the intertidal zone. Arias’s research findings have implications for all who love to stroll along the Gulf ’s beaches. To see tar balls on the beach is sad and unpleasant: to touch them may very well be unsafe.

The Risks of Exposure

by Pau l a B o b row s k i and RenĂŠ McEldowney

135

Photo by Michelle Worosz

One Coastal Community’s Experience with Health Symptoms Caused by the BP Oil Spill

T

he BP oil spill affected approximately 520 miles of the Gulf Coast’s shoreline, including some of Alabama’s most treasured beaches and coastline communities. The full consequences of the spill remain unknown, and while there has been a great deal of media coverage about the adverse effect of the disaster on Alabama’s economy and wildlife, comparatively little attention has been given to the potential physical health effects on this area’s working poor.

We investigated potential adverse health effects from the BP oil spill in one small Alabama fishing community by interviewing area health-care providers and local officials. Bayou La Batre is typical of the working-class communities that dot the Gulf Coast [1]. It is an area of immense natural beauty pocketed with sections of great deprivation.

Towns like Bayou La Batre struggle to provide even basic services to their citizens, which, at the time of the spill, had just begun to recover from hurricanes Katrina and Ivan. Many residents of

Bayou La Batre simply do not have enough money for such basics as food and utilities, let alone health care. Eighty percent of people in the work force are connected to the seafood industry; they work long hours but receive little or no health insurance coverage. According to local unemployment figures, since the oil spill, 44% of Bayou La Batre residents are either unemployed, living on supplemental security incomes, or receiving food stamps [2].

Photo by Jeff Etheridge

Paula Bobrowski (left) and René McEldowney.

Complicating this difficult economic situation is the broad ethnic mix of the work force; it comprises African Americans, Cambodians, Hispanics, Laotians, non-Hispanic whites, and Vietnamese.

In a December 23, 2010, interview with National Public Radio, the mayor of Bayou La Batre, Stan Wright, stated that the people of the community “have been independent all their life.

We have the highest dropout rate anywhere in the state of Alabama because the people here went fishing with their poppa or their daddy since they could walk. So, therefore, they are very proud. You know, they’re used to going out and utilizing this water on a daily basis, and a lot of them live from day to day. This is a very different, isolated fishing village of very proud people” [3].

Area health-care providers confirm that the oil spill has impacted the health of those who live and work in the areas near the spill. Several toxins found in oil spills are troublesome. Oil contains heavy metals, particularly zinc, as well as nickel,

79

aluminum, and vanadium in lesser amounts. In addition, it contains such volatile organic compounds as benzene, toluene, ethyl benzene, xylene, and sulfur and polycyclic aromatic hydrocarbons (PAHs) [4, p. 147]. Furthermore, dispersants used to absorb the oil contain toxins that are also potentially harmful. The three leading ways that people are exposed to hazardous chemicals and toxins are by direct contact on the skin, by breathing it in, and by ingesting or eating food contaminated with the chemicals. According to the International Agency for Research on Cancer in Lyon, France, heavy fuels such as those found in the oil spill have type 2B cancer potential. PAHs might cause cancer after 80 prolonged exposure [5]. That is, there is evidence of their carcinogenic activity in animals, though studies in humans are as yet insufficient.

As the oil arrived on shore, regional, local, and federal authorities organized cleaning teams. A vast number of people become involved in the cleanup, including volunteers, seamen, bird cleaners, and personnel specifically hired for the purpose.

Cleaning activities create the risk of contact with the oil and dispersants, and create other job-related injuries that are specific to cleanup work.

Health problems among people involved in cleaning up spilled oil are very common. We have learned much about the negative health effects

from previous spills such as the 1989 Exxon Valdez in Alaska’s Prince William Sound, the 1993 Braer off the Shetland Islands, and the 1996 Sea Empress off the coast of Wales. Since the BP spill, several health symptoms have appeared among people in Alabama and surrounding coastal states. The common symptoms include the following three types [6, pp. 306–10], [7, pp. 413–24].

• Injuries

Lesions include bruises, erosions, blisters, superficial cuts or deep wounds, sprains, broken bones, knee pain, and broken teeth. Bird cleaners generally register the highest risk of lesions, with those who perform more than one cleanup activity and tearing of protective garments and gloves coming in second. The risk of lesions increases after working more than 20 days in polluted areas and in locations with floating containment barriers. In addition to lesions, lowback pain is frequently reported by women after working more than 20 days in cleanup efforts.

• Toxic Effects

Seamen generally present the highest frequency of headaches, sore throat, respiratory problems, and mouth soreness. Workers who spend more than 20 days in highly polluted areas also frequently experience these effects. People

involved in cleaning up the spill report itchy eyes and perception of disturbing odors. Workers who have cleaned in highly polluted areas for more than three days, who did not wear protective gear, or whose hands came into contact with oil experienced nausea, vomiting, diarrhea, and dizziness more frequently than others.

• Psychological Effects

Populations exposed to oil spills report significantly more anxiety and depression than comparison groups. Residents from high-exposure communities are 3.6 times as likely to experience generalized anxiety disorder, 2.9 times as likely to have posttraumatic stress disorders, and 2.1 times as likely to have high depression scores. In a 2010 interview, Riki Ott, a marine toxicologist who studied the Exxon Valdez spill, estimated that four to five million Gulf Coast residents have been exposed to dangerous levels of oil and dispersants [8].

Reported Injuries and Illnesses from the Gulf Oil Spill According to a June 2010 report from the National Institute of Occupational Safety and Health (NIOSH) [9], BP safety officials reported 491 worker injuries and 461 worker illnesses.

The report shows that those working in Mobile, Alabama, were heavily affected; workers and volunteers in the Mobile area reported 183 injuries and 181 illnesses. The most common injuries reported were lacerations and puncture wounds, sprains and strains, contusions and hematomas, traumatic injuries, and burns. Cases of illness include those for which patients received first aid and those that Occupational Safety and Health Administration defines as illness cases. The latter include cases that led to a missed day of work, those that restricted duties, and those that required medical treatment beyond first aid. Figure 1 shows the most common injuries, and figure 2 shows the most common illnesses.

Although NIOSH cannot yet report the long-term health effects of the spill, our interviews with healthcare providers in the area confirm the NIOSH report and give us a deeper understanding of how injuries and illnesses will impact people’s lives.

Area health-care workers that we interviewed told us that they experienced a noticeable increase in the number of patients being treated during the weeks and months following the oil spill. Most patients, they said, had relatively minor complaints such as skin rashes. But other patients presented a mix of more complicated symptoms, ranging from intermittent headaches and difficulty in breathing

4%

Lacerations & Punctures

10% 36% 22%

Sprains & Strains Contusions & Hematomas Traumatic Injuries

28%

Burns

Conclusion

Fig. 1. Types of injuries [10].

12% 32%

14%

Heat Stress & Heat Effects Multiple Symptoms Dermatologic

15% 27%

comprehended; in addition, adequate translating services were either absent altogether or in very short supply. Thus, important communication was not fully understood. One individual we interviewed noted that many workers “simply did not understand what precautions they needed to take when helping with the cleanup.”

Gastrointestinal Headache

Fig. 2. Types of illnesses [10].

to chest pain and diarrhea. And while the majority of these patients were readily treated and released, one official did indicate that at least some of the injuries might have been prevented. The initial lack of adequate communication among officials in charge of the cleanup and the ethnically diverse fishermen who were hired to help with the cleanup was notable. In the beginning, officials had no way to gauge the extent to which their directives were

The explosion of the Deepwater Horizon and the ensuing oil spill constitute a catastrophic event that is likely to affect both the environmental and physical health of Alabama residents and coastal communities for decades. Though the symptoms reported in this study are relatively minor and seemingly short lived, the reality is that scientists know far too little about the effects of oil spills on human health to have any confidence in the long-term ramifications. A summary report from the Institute of Medicine’s 2010 conference states that of 400 post-1960s oil spills, only seven have been adequately studied. The results of these seven studies provide reason for caution [9]. We must commit to monitoring the health of spill workers and coastal residents in the long term to ensure that we preserve for future generations one of the state’s most treasured cultural areas.

81

Photo by Jeff Etheridge

P

R

O

F

I

L

E

Ash Bullard

Keeping an Eye on the Gulf

by Watching Its Parasites

by Jo Mackiewicz

82

Ash Bullard’s primary scholarly goal as a faculty member in Auburn University’s Department of Fisheries and Allied Aquacultures is to ask and answer questions about how parasites affect the lives of aquatic animals and what their relationships can teach us about the environment. His second scholarly goal, it seems, is to change our minds about parasites.

Bullard’s current research, supported by the National Science Foundation, Marine Environmental Science Consortium, and Gulf of Mexico Research Initiative, explores whether and how the oil spill has impacted the Gulf ’s aquatic resources. Bullard has focused on parasites, analyzing and monitoring host–parasite relationships.

His published studies have examined relationships between fishes such as red snapper, red drum, spotted seatrout, pompano, invasive lionfish, and freshwater and marine catfishes and the parasites that infect their guts, hearts, skin, and gills. His research examines changes in parasites, including

changes in their prevalence (the proportion of potential hosts that they infect) and intensity (the number of parasites in infected hosts). Parasites are elegant, interesting, and actually quite useful, says Bullard, because they act as bioindicators, or sentinels, of ecosystem functioning (what some call ecosystem health). Along with his research team, Bullard monitors the ecological functioning of the Gulf—including the Gulf ’s functioning after a major toxic event like the BP oil spill.

To understand how parasites can act as sentinels, one has to let go of the common negative connotation of the word “parasite.” A parasitic relationship is in fact a subcategory of symbiosis—a state we think of as healthy and desirable, or at least not harmful to either party. Indeed, parasitic relationships in the wild are for the most part benign: “The vast majority of parasites don’t seem to cause much harm to their hosts,” Bullard points out.

“And some of them don’t even feed directly on their hosts—like tapeworms. They actually feed on what you feed on. They’re not eating you. They’re just soaking up what you’re eating, hanging out in your gut, having sex with themselves, and making little tapeworms. They don’t even have mouths, so they can’t even bite you. . . . It’s damn hard to find well-documented examples of fish parasites that are routinely causing disease in the wild.” Parasitic

relationships tend to evolve toward the benign, says Bullard, and this process makes sense: if a parasite kills its host, it would not have much of a future itself. But when toxic events like the spill (and other ecological problems too) alter the natural balance and weaken an infected host, the host may become diseased.

To conduct such studies, Bullard notes, parasitologists must be able to identify and understand the species that they encounter: “Much of what we do as biologists fundamentally starts with taxonomy. Because if you don’t know what species you’re working with, it’s hard to make predictions or form hypotheses; not to mention it’s hard to write papers or apply for grants. . . . Very similar looking or acting animals can be different species. . . . You can really make big mistakes if you don’t

Photo provided by Ash Bullard

Ash Bullard with cast net.

know what species you’re working with.”

For example, some parasite species have a direct, or simple, life cycle. They tend to live on the outside of aquatic animals and require just a single species to host them. Other species have indirect life cycles. They require several hosts, infecting, for example, the gonads of an estuarine snail, then the gills of a minnow that happens to swim nearby the snail, then the gut of a bird that eats the minnow.

Bullard explains, “The presence of that one species of parasite—if you know its life cycle—tells you that there are all these other animals that are present in that system.” Indeed, some of Bullard’s recent taxonomic research played a role in his postspill analyses of parasites. When parasitologists 83 know a parasite’s identity—its species—they better understand what its presence might mean for an ecosystem’s functioning.

But the research carried out by Bullard and his team—observing and monitoring perturbations in the Gulf ecosystem via aquatic parasites—is perhaps even more important in relation to ongoing, chronic environmental problems. As Bullard notes, few people want to talk about what it would take to solve the big problems caused by fertilizerladen agricultural runoff in the Mississippi River or overdevelopment of coastal areas. Bullard puts it this way:

“Nobody’s going to seriously talk about population control, not building buildings on sand dunes and marshes. . . .That’s the kind of thing that I haven’t seen anyone talk about too much. People like talking about the easy problems to solve but not the hard problems. . . . But what we don’t talk about—and these are the issues that really matter most to the

Gulf of Mexico—are coastal development, water usage, conservation of wetland resources. Estuaries are nursery grounds for nearly all the fisheries resources in the Gulf—shrimp, oyster, crab, and many of the fish that are commercially valued . . . and at the rate we’re going, we’re losing a lot of estuaries.

With an eye toward these bigger problems and

their implications, Bullard continues to study parasites, their relationships with their hosts, and ongoing changes in those relationships in order to understand the Gulf ’s functioning. He also continues to advocate for parasites, those misunderstood sentinels that alert us to dangers—even those that we inflict upon ourselves.”

Photo provided by Ash Bullard

84

Photo provided by Ash Bullard

Ash Bullard (principal investigator, left) and Carlos Ruiz (graduate student) baiting minnow traps and preparing to collect killifish in Barataria Bay, Louisiana.

Bullard in the field using stereo dissecting microscope to collect parasites.

T

H

E

G

U

L

F

A

nglers regularly catch king mackerel, redfish, and cobia off the pier at Gulf State Park, but in June 2010, the pier closed to fishing. With a letter t crossed out by someone with a dark sense of humor, the sign announcing the closure read: “The Pier will remain open for sigh seeing.�

85

Photo by Jeff Etheridge

Help from a Common Inhabitant

135

by Calvin M. Johnson, Joseph Newton, Ash Bullard, Chad Foradori, and Bernhard Kaltenboeck

Photo provided by Ash Bullard

Identification of Exposure Biomarkers in an Indigenous Fish Species

O

ver an 86-day interval, the uncapped wellhead of the Deepwater Horizon drilling rig released approximately nearly five million barrels of crude oil into the northern Gulf of Mexico, jeopardizing the marine and estuarine ecosystems of the region. In response to the release, BP applied unprecedented volumes of a chemical dispersant over the sea surface and directly into the oil plume [1]. The impacts of the release of crude oil and dispersants on the marine resources of the north central Gulf of Mexico are complex and, some fear, might be detectable in the ecosystem long after the surface oil is gone.

The Mississippi–Alabama Sea Grant Consortium estimates that the dockside value of commercial fish landings in Alabama and Mississippi in 2008 exceeded $88 million, with more than 257 million pounds landed [2].

Moreover, Alabama hosts an extensive seafoodprocessing industry that ranks among the most active of the northeastern Gulf States. Saltwater

fishing alone accounted for more than 4,800 jobs with a total economic impact of more than $480 million. With the oil well capped and the fishing waters reopened, perhaps the greatest challenge to reviving the Gulf seafood industry is to restore public confidence in seafood’s safety.

We propose to address this challenge by developing a panel of biomarkers that can detect and assess the impact of oil exposure on an abundant and common fish species indigenous to the Gulf of Photo provided by Ash Bullard

Above: The gulf killifish, Fundulus grandis.

Opposite page: Oiled marsh in Barataria Bay, Louisiana, October 2010. The black band indicates areas that were inundated with oil.

Mexico. This work is a vital first step in the development of an effective long-term plan to assess the impact of hydrocarbons and heavy metals on the coastal ecosystem.

Can Oil Components Cause Biological Changes?

There are at least three potentially dangerous 87 toxins associated with the oil spill: the hydrocarbons of the oil itself, heavy metals contained in the oil, and the dispersant used during the cleanup.

The hydrocarbons that make up the oil, under the appropriate concentration and duration of exposure, are well-known carcinogens. They have also been shown to impact fish reproduction by damaging reproductive organs and reducing egg output.

Hydrocarbons have more recently been shown to affect the endocrine system. A number of heavy metals, such as nickel, copper, cadmium, lead, and zinc, have been found in crude oil. These metals, particularly lead, can inhibit reproduction of fish

by interfering with the endocrine system. Lead can reduce egg size, the number of eggs produced, and reproductive capacity and, thus, may ultimately lead to a decline in large-scale reproductive output in fish. Such a decline would alter the fish population and the community structure.

The main dispersant used in the cleanup is called Corexit, which can emulsify, or break up, clumps of oil and disperse it. Some of the chemicals in dispersants are toxic to the liver and blood-making systems of rats and mice [3] and are considered by the EPA to be acute health hazards. In general,

dispersants may make hydrocarbons more toxic by making them more absorbable into the body and more available (via broader dispersal) [4].

Our study focuses exclusively on oil exposure, but our future studies will address the toxicity of the combination of oil and dispersants.

The Test Subject: Gulf Killifish (Fundulus grandis) The killifish is a geographically widespread and abundant marsh species that holds promise as a model for hydrocarbon toxicity studies [5]. The

Photo by Jeff Etheridge

killifish, which grows to about seven inches, is a common inhabitant of the bay shores and tidal marshes of the Gulf of Mexico. Commonly known as mud minnows or chubs, killifish serve as a primary food source in marsh ecosystems and are an important predator of mosquito larvae.

Killifish are adaptable to environmental changes such as fluctuating saline levels and hydrocarbon concentrations, and they have been widely used for marine toxicity testing. They are commonly used in both laboratory and field settings to understand the impact of environmental toxins such as

Photo provided by Ash Bullard

88

(Left to right) Joseph Newton, Bernhard Kaltenboeck, Calvin Johnson, Stephen “Ash� Bullard, and Chad Foradori.

A restoration site in Barataria Bay. Note the air cannons in the middle of the frame to frighten birds away. These cannons were completely ineffective. Blackened areas are areas where oil has inundated marsh grass.

AAAACATTTTTTTTTCTGTTGTTGGACACGCATCTCTGGAATTAGAGTGTTCGTC TTCTTTTTATCATTCAGCTAAAGGTAAGGTGATTACCTGCATGATAAAAGTTATT TCTAAGAAAGGATTGAGATGATTATTTAAGACGTAGATTTACTGTTAATCAGTCA TATGTACATACTATATGCAATCTTTTAAACTGAAAGTTATGAATTATGACCTAGA CATACACACTATTGTGTATATTCTTAAAGTGTGCTAAGATCACCAAAGTGCAGCA AGTCTAGATTAAAGTTCTCACTTGGGACCTCGCTGTGTAATCACTATGTTGCACA ACACTTCTTTCTTCTCTCTGTCAACACTGATCTAATTCCCTCCTATTTAATTTAC AGGTTGAGCAGAGAACAGAGAAAAGTTGTCATCATGGCATTAATGATACTGCCAT TCATTGGAGCACTCTCAGTGTCTGAGGGTTTGATAGCCTTG

of the marine environment after a spill. This knowledge will help to determine the geographic extent of the oil’s influence and provide scientific evidence for the effects of the oil spill on Alabama’s marine resources.

Photo provided by Ash Bullard

Fig. 1. Nucleotide sequence of the partial Fundulus grandis CYP-1A gene, a biomarker for oil exposure. The colored boxes indicate the specific regions used to quantify gene expression. Used with permission of the authors.

hydrocarbons on disease prevalence and severity.

Despite their acceptance as a suitable model for marine research studies, Gulf killifish are poorly characterized at the genetic level. The first step in our research was to define the genetic sequence of the CYP-1A gene, a metabolic enzyme that is produced after oil exposure, and to develop a method to quantify its expression under experimental conditions (see figure 1).

replicate a genuine oil spill.

We will then study the biological changes that occur following low levels of hydrocarbon exposure. We expect that fish exposed to oil will express the CYP-1A gene at a higher level than unexposed fish. The idea is to identify the specific body changes in the fish so that we can then move to natural settings, study the fish, and monitor the effects of toxin exposure in the water.

The Research Plan

Potential Impact of the Study

Our plan is to establish a colony of killifish in artificial sea water and divide them into two groups. The control group will not experience any treatment, but the experimental group will be exposed to hydrocarbons in amounts estimated to

The goal of the research is to look for the changes in killifish metabolism and health that indicate the presence of oil-derived toxins. Once we identify the biomarkers of exposure, these fish can serve as sentinels that indicate the health

Dead marsh grass surrounded by crude oil likely from the BP Deepwater Horizon. The oil is melting in the mid-day sun.

Photo provided by Ash Bullard

Oil sheen on surface waters of oiled reference sites in Barataria Bay, Louisiana.

89

Photo by Melissa Humble

P

R

O

F

I

L

E

Dennis DeVries and Russell Wright

Examining the Resiliency of Largemouth Bass in the Mobile-Tensaw River Delta

by Jay Lamar

90

Russell Wright (left) and Dennis DeVries.

“The problem with research,” says Dennis DeVries, professor of Fisheries and Allied Aquacultures, “is that it takes a long time.” But it is the longevity of a project he conducted with Russell “Rusty” Wright, extension specialist and associate professor, that underpins their current research on the spill. For eight years, DeVries and Wright regularly sampled fish populations in the Mobile–Tensaw River Delta. A question posed by many sports fishermen and staff of the Division of Wildlife and Freshwater Fisheries of the Alabama Department of Conservation and Natural Resources became the focus of their study: why are largemouth bass in the Delta smaller than those in other areas?

DeVries and Wright started by confirming that largemouth bass in the Delta are in fact smaller than those from inland populations. After collecting about 10,000 largemouth bass over eight years, DeVries and Wright could conclude with authority that few largemouth bass in the Delta grow larger

than three pounds or live longer than six or seven years, making them different from bass in other areas, which grow much larger and live significantly longer. The researchers then set out to determine exactly what causes such differences.

First DeVries and Wright discovered that the decreased weight and life expectancy did not stem from a lack of food. Food is plentiful in the Delta. Rather, the fish gravitate toward low calorie, less nutritionally rich diets. In addition, during the summer months, the Delta is subject to high salinity. When salt water creeps into marshes and streams—and when summer temperatures spike— the Delta becomes a high-stress zone: “If you’re living in the Delta,” says Wright, “you better plan on periods of high stress. And the bigger you are, the more stressful those periods can be.”

Largemouth bass in the Delta have adapted to cope with this high stress by staying small, storing a lot of fat, and reproducing earlier rather than later in life. These adaptive strategies mean

the population of largemouth bass in the Delta is unlikely to respond to management strategies such as increased length limits, even though such strategies can be used to produce larger fish in some freshwater reservoirs. Thus, anglers in the Delta are unlikely to catch a largemouth bass that is larger than five pounds, but they can continue to land three-pound fish.

The findings that DeVries and Wright reported to the Division of Wildlife and Freshwater Fisheries contributed to improved management of freshwater areas. Now, instead of stocking streams and marshes with Florida largemouth bass, fish that cannot thrive in the Delta, the division uses native fish. “It is exciting,” says DeVries, “when our research provides ecological information that helps make better decisions.”

DeVries and Wright’s work in the Delta put them in a unique position when the oil spill occurred: their multiyear work in the region meant they had a deep understanding of the ecology of the Delta, giving them the techniques and skills to address the effects of the spill on fish populations. Their newest research project, funded by BP, focuses on part of the Delta and extends to the marshes and tidal creeks on the coastal shoreline. The researchers are currently sampling largemouth bass, southern flounder, Gulf killifish, and blue

crab—all important to fishing on the Gulf.

The researchers’ overarching research question is rather easily articulated: what are the direct and indirect impacts of the spill on fish? Even so, many aspects of the spill make the work involved in answering this question especially challenging.

For example, although eight years of consistent sampling data are available for the Delta, the same is not true for the shoreline areas. Also, it is difficult to identify oil sources; outboard motors and freighters lose oil, and naturally occurring oil seeps. And even though BP oil can be identified, doing the work of identifying the oil represents another layer of time-consuming inquiry. Finally, no obvious oil from the spill has been documented in the Delta. To the best of anyone’s knowledge, the region could only reflect indirect impacts of the spill. Wright notes, “If we were going to design an experiment to test the effects of oil, this is definitely not how we would do it.”

Lacking the controls, research design, and other elements typical of long-term, planned investigations, DeVries and Wright are responding to a crisis with the best tools and knowledge they can muster.

Their current research, which involves quarterly and bimonthly sampling, focuses on the physiology of the animals themselves.

The current research examines the structure

and chemical makeup of the tiny inner-ear bones (otolith, or ear stone) of the fish. DeVries and Wright note that for fish younger than about 100 days, one ring per day appears on the otolith.

These rings can be seen under a microscope. In the case of older fish, one ring appears each year.

Not unlike rings on a tree, these rings provide a way to understand changes in environment, diet, and growth over time. DeVries and Wright, working with researchers in Windsor, Ontario, can determine a fish’s age, growth rate, movement (from exposure to salinity, for example), diet, and oil signature (a chemical indication of oil’s presence and source) from the otolith and other tissues. These factors provide insight into whether 91 the spill disrupted the growth of an animal, whether its food source changed and, perhaps most important, whether there is a missing year class, which would indicate a serious impact.

It is too early in the project for DeVries and Wright to announce specific answers, but so far their fish collecting has been successful. They know that the spill did not result in the wholesale loss of populations. That good news—and DeVries and Wright’s faith in the ecological resiliency of the Delta and the Gulf—compels them to continue their search for findings that facilitate good decisions in the future.

Photo by Jeff Etheridge

135

Tiny Sentinels

by Ken Halanych

How the Oil Impacts the Little Guys

W

hen the BP oil spill happened, larger animals were impacted in one of two ways: either they were impacted heavily and died, or they were able to move and escape further harmful effects of the contamination. Smaller, microscopic invertebrates (animals without backbones), whose well-being is essential to the life and energy of the ocean, were unable to move away from the oil and were subjected to the full force of contaminants. Working with colleagues in New Hampshire, San Antonio, Dauphin Island, as well as at Troy University, Jackson State University, and Auburn University, and funded by the National Science Foundation and Alabama’s collaboration with the Marine Environmental Science Consortium, Ken Halanych, an Auburn University biology professor, has focused his research on the “little guys.” That is, he looks at the tiny organisms living at the bottom of the ocean that we cannot easily see or touch, but that are critically important to human interaction with the sea.

—Allen Furr and Jay Lamar, Editors

Our research investigates an important group of invertebrates that live among sand grains in what is called the benthos, or the bottom of the sea.

These organisms are called meiofauna, and these creatures are tiny—less than one millimeter long.

In the context of an oil spill, these animals can potentially act as important sentinels of change.

We focused on these organisms because they could not run away from the hydrocarbons released into their environment by the BP oil spill. If oil came and settled on top of them, they were stuck. Our research question, then, is simple: is the community of microscopic animals the same after the contamination as it was before?

Conducting the Study When an environment is hit by a toxin, you can start asking questions about how the contamination changes the ecological community. There are a couple of different ways to get some answers by looking at these small sedentary invertebrates.

One way is to take samples of sediment and look at them through a microscope, but this is a timeintensive process. The other way is to use genetic tools, and this is the route we took.

Instead of having to look through all the sediment physically, genetic tools allow us to take a scoop of sediment and extract and sequence either DNA or RNA. Because we continue to learn about the genetic sequence of organisms and the makeup of their DNA, we can take that information and go to public databases and ask, “Who’s there?”

To explain this process a bit farther, think back to the Human Genome Project. The challenges with the Human Genome Project were the high expense and long length of time necessary to sequence the full genome of humans. The technology has changed so much, however, that what once took 10 years and $3 billion can now be done in a matter of hours or days, and for about $4,000.

After collecting sediment and organisms from

93

the Gulf of Mexico, we extracted and sequenced DNA and then began to analyze that information.

If we see a sequence with a certain motif or characteristic, we know that a particular organism is there. With this procedure, we can process more samples much faster to get an idea of which organisms are present. Is this a perfect method?

No. Ground truthing, confirming data via direct means, still needs to be done so that we know that this DNA sequencing matches a particular organism. We know enough, however, that when we get the sequences back, we can tell if they belong to a specific group of, say, nematodes (roundworms). Not only can we determine 94 whether an organism belongs to a certain phylum, or general group, but we can also determine whether it belongs to a particular family and genus.

Then we can identify its species if that organism has been previously sequenced.

The Research Data We have largely focused on collecting samples from intertidal areas close to shore; however, we had an excellent opportunity to sail near the wellhead in the middle of December 2010, and we collected soil samples there as well. We are also collecting soil samples in the Dauphin Island area, and we have expanded our data collection into the

Gulf. This expansion will allow us to take samples from knee-high to 1,400 meters deep.

Thus far our work has been quite interesting.

By analyzing the DNA data, we have seen shifts in organisms that are there. Although this is an important finding, it actually constitutes bad news: it means that many of the small meiofaunal animals—the small invertebrates that live among the sand grains and that we know were there before the spill—were knocked way back in number.

Other small organisms have moved in and taken their place. We cannot say definitively what is happening just yet, but we have seen a huge shift in community structure. We are following the DNA changes over time to determine with certainty who has moved in and who has moved out because of the oil spill.

In addition to studying which organisms are present, we are also looking at RNA, which is an indicator of the genes that are “turned on” in the organism.

For example, a whole suite of genes are involved in stress response, and by looking at the RNA, we can determine if more of these types of genes are present after the spill than before the spill. Some organisms have very specific genetic responses to hydrocarbons, so we can see these arise, and those responses show us that hydrocarbon is still there several months or a year down the road.

Another area we were examining before the spill was tubeworm communities in the Gulf. What makes these communities interesting is that they live in an environment where there is natural seepage of hydrocarbons. Tubeworms get all of their energy from a symbiotic relationship with these naturally occurring hydrocarbons. A few months before the spill, it just so happened that colleagues here at Auburn and I went to sites just two miles from the well and collected samples of these worms. Now that we also have postspill tubeworm samples, we intend to ask the same question— have the genes that the tubeworms are expressing changed since the spill?

Expectations for the Research Our studies of meiofauna have two likely outcomes. One possibility is no change; however, we are not seeing that. We are indeed seeing that changes have occurred. Now that we know that some organisms were affected, the question becomes this: do they recover? And if they recover, do they go back to the way they were, or do they go to something different?

When you think about communities, you think about what the natural population is. You think about what organisms are there, how they interact, and what the ecosystem functions are. In other

Photo by Jeff Etheridge

words, how do they act as a part of a larger whole?

Before the spill, maybe there was sort of a steady state. The question is whether or not the Gulf ’s ecosystem will go back to that steady state or shift to a different state in which perhaps another organism, or group of organisms, dominates.

Implications of the Study When an oil spill occurs, it’s easy to put up a picture of a pelican or a fish covered in oil or a dead porpoise. Many people, however, are more concerned with what are called sublethal effects.

These are the consequences of an oil spill that may not kill an organism outright but may impair its ability to act normally and reproduce. For example, some fish may normally lay 10,000 eggs, but after exposure to the oil they may lay only 1,000 eggs.

A tenfold difference can have huge effects on that community.

When most people think about classic ecology, they think of things at different trophic, or nutritional and feeding, levels. People envision, for instance, plants getting energy from the sun, small animals eating the plants, bigger animals eating the smaller animals, and bigger animals eating them.

Many organisms that we are studying serve as a food base for larger organisms. They also serve as a way of turning over the benthos, or the mud. Thus,

Ken Halanych and Pamela Brannock at work in the lab.

they play an important role in getting nutrients moving between the water column and the mud.

Therefore, if these little animals are killed off, the way energy flows to larger animals will be altered—perhaps irreparably. If the energy is cut off to larger animals, those larger animals will not grow and reproduce. This concern is a critical one for the Gulf of Mexico. We know that after the spill microbial activity increased and that the energy that flows through the system to microbes may have changed; these are changes that could impact larval fish. If larval fish cannot survive, the adult fishery population will decrease within a few years.

So the main importance of these little guys is that they are part of the food chain.

Second, we can use these tiny invertebrates and microorganisms, especially in the nearshore situations, as environmental indicators. They can tell us whether the situation has improved or not. Many microorganisms are like the classic example of the canary in the coal mine. Canaries are very sensitive to carbon dioxide. When the canary in the mine died, the miners knew to get out.

As humans who live onshore, we are mostly concerned with nearshore damage—damage in salt marshes and to fisheries like those for shrimp and snapper. Much of the oil, however, dropped to the bottom of the ocean. Many months after the spill, 95 droplets of oil and other clear indications of oil’s presence were still there. So one of the challenges in the larger picture of the spill is determining what happened to the deep sea. Because the deep ocean is hard to see and difficult to sample, investigations of the ocean’s depths are challenging. The restoration process is even more challenging. How do you restore the deep sea? How do you go there to skim weathered oil off miles and miles of mud and put the sediment back the same way it was? Such a process is just impossible. When it comes to deep-sea damage in the long term, we simply do not know what to expect.

Photo by Jeff Etheridge

P

R

O

F

I

L

E

Michelle R. Worosz

Engaging Students with a Close-to-Home Case

by Jo Mackiewicz

96

When the oil spill began in April 2010, Michelle Worosz made up her mind to use this case of environmental disaster as the focus of study for her spring 2011 class, Sociology of Natural Resources and the Environment. Students in this course, which is taught at the upper-division and the graduate levels, typically examine how environmental problems originate and how individuals, communities, and organizations respond to those problems. Worosz, a faculty member in the Department of Agricultural Economics and Rural Sociology, wanted to engage students in a contemporary and important problem; the oil-spill disaster fit the bill. It had the entire country tuned in to find out whether one of BP’s seemingly weekly strategies for stopping the oil flow had finally worked.

For the course’s major project, Worosz asked students to choose a natural resource or environmental problem that arose out of the spill and then to study the public conversation

Photo by Jeff Etheridge

surrounding that problem by analyzing its coverage in the media. Worosz asked students, who would work in small groups, to follow these steps: define and develop the project, collect and analyze data systematically via content analysis, and present the findings of the analysis in a public poster session. By using content analysis, says Worosz, students could examine how the print news framed the spill-related problem that their project group had chosen.

Students delved into the assignment. Their project topics examined coverage of south Alabama ecotourism (particularly birding and fishing), economic growth in coastal Alabama, the hospitality industry on Alabama’s coast, and the resilience of coastal communities (including Southeast Asians, see pages 48–57). One of the first results from students’ research was the finding that most of the news sources available for analysis were local: “While the spill was an enormous event for Southern Alabama, at the regional, national, and international levels, the oil spill received from relatively little to almost no attention.”

Students also found that the media largely ignored certain segments of the population in south Alabama. For example, says Worosz, “In the case of Southeastern fishers . . . the print news made it very clear that there was a language barrier,

and [the media] used that barrier as an excuse not to cover their struggles.” Worosz points out that the media could have broken through the language barrier and into these communities if they had tapped resources such as bilingual children and teens, nongovernmental organizations, and faithbased community leaders.

Students’ research also revealed that most of the coverage from the print news media focused on economic issues. Worosz explains, “While there was some focus on the potential health consequences from exposure to hydrocarbons and consumption of contaminated seafood, there was much less coverage of the consequences to

the biophysical environment.” Indeed, Worosz notes, students in her 2009 and 2010 Sociology of Natural Resources and the Environment classes examined environmental issues of coastal Alabama more broadly and found that “the biophysical environment tended to be promoted as a tool for economic development, rather than something that had intrinsic value.”

The value of analyzing media coverage, says Worosz, is that it makes students think about “the ways in which information is socially constructed, which is a very difficult concept to grasp. It is easy to present what’s in the news and to think of it as fact. . . . Thus, it was eye opening for students to see what stories rise to a particular level so as to be seen as worthy of telling, and which stories do not; what information is used in telling a story and what is not; how information can be organized, framed, manipulated, and presented to tell the same story, and to present it as a singular Truth.”

Worosz intends to use the oil-spill case in Sociology of Natural Resources and the Environment again. She says, “Following the oil spill, I believe some of the voices of coastal residents who are deeply interested and concerned about the environment rose above some who primarily valued economic development. It will be quite interesting to see what students find next year.”

97

Planning Ahead

135

Photo by Melissa Humble

by Jeana Baker and Derek G. Ross

The Genesis of a Disaster-Response Plan in Two Parts Part 1: Risk Communication and a Summer Class on Environmental Rhetoric, Ethics, and Policy

by Derek G. Ross

O

n April 20, 2010, an explosion on BP’s Deepwater Horizon oil-drilling platform claimed the lives of 11 workers and initiated an unprecedented flow of oil into the Gulf of Mexico.

The explosion and subsequent oil spill rapidly gained international attention and promised to be one of the worst environmental disasters in memorable history [1]. As agencies struggled to mitigate the disaster, multiple methods were employed to stop the spread of oil. Some of these methods were either entirely new or untested for situations of this scale, including the creation of sand berms, the use of chemical and biological dispersants, and the use of materials such as hair (human and animal) and kenaf (an Egyptian hibiscus plant) to soak up oil (see, for example, [2], [3]). Local and federal

agencies worked as rapidly as possible to preserve and protect the natural environment and quality of life for living organisms destined to be affected by the spill, but time and energy spent on unsuccessful measures may have unnecessarily prolonged negative environmental impact.

The rapidly progressing nature of the disaster

Photo by Melissa Humble

meant no time for quantitative assessment of response measures. As a result, billions of dollars were spent on measures that were either ineffective (such as the sand berms [4]) or may have created new and unforeseen risks toward quality of life, as in the case of dispersants, where the “biological impact of the dispersant-oil mixture in the water column remains unknown� [5]. In some cases, 99 measures such as the use of human hair to soak up oil were simply rejected by empowered organizations, such as BP, though these measures were employed by local organizations [2].

Hindsight allows us to see that some decisions made to reduce risk were more effective than others.

The public must temper outrage at what may be perceived to be wasted time and energy, however, with an understanding of the urgency of the situation. As Schwartzman, Ross, and Berube argue: In crisis, decision makers must base their choices on what they know, what they can learn, and what their discourse communities

can provide. They must do all of this while communicating the potential value of their decisions to a public that, ultimately, must trust experts and agencies to work in their best interests. [6, p. 4] Risk communicators often note that local publics affected by crisis should not be left out of the policy making and response process. There are some who disagree. The former president of the National Academy of Sciences, for example, argued that “most members of the public usually don’t know enough about any given complicated technical matter to make meaningful judgments” [7]. We believe, however, that public involvement 100 may allow a more locally specialized and fully realized response to risk. Involving the public in risk-response situations may help ameliorate unsuccessful responses while accounting for local needs and expectations.

Facilitated, or participatory, models of public involvement address these needs. A facilitated model of policy making and risk response, for example, involves technical experts, independent scientists, citizen groups, citizens, and federal and state agencies, among others, working alongside a facilitator or spokesperson to create responses to potentially catastrophic situations such as the oil spill [8, pp. 102–107]. A more unified participa-

tory approach [8, p. 118] may take public–specialist collaboration further by using participatory design (e.g., [9]) or usability testing (see [10]). In participatory design, end-users work with designers to create a product (or policy) with which they are comfortable. In usability testing, an end-product is examined by the audience for which it is designed before going into widespread production or use.

Both of these strategies involve collaboration between designers and users, or specialists and nonspecialists, in order to “identify ethical and political issues present in risk communication/environmental policy situations and to consider approaches that grant more power to citizens” [8, p. 117].

All of these complex communication strategies are based in a single overwhelming imperative: the public should have a voice in the creation of policies and procedures designed to inform and protect it. This concept—establishing the right and ability to influence public policy—is one which my summer 2011 class, Environmental Rhetoric, Ethics, and Policy, worked through in great detail.

Overview of Environmental Rhetoric, Ethics, and Policy During the first summer semester of 2011, I taught this graduate-level English course in the Master of Technical and Professional

Communication program here at Auburn University. The class was designed to engage students through civic engagement and ethicsbased decision making by having them work with environment-related policy issues with which they felt a personal connection. The students’ final projects began with proposals, transitioned to the construction of informational reports, and culminated with written public comments that had to be both submitted to an outside decision maker and presented in class. My teaching model for the class stemmed from Wendell Berry’s words in his essay on environmental activism, “Think Little”: “I would rather go before the government with two people who have a competent understanding of an issue, and who therefore deserve a hearing, than with two thousand who are vaguely dissatisfied” [11, p. 84].

One of my students, Jeana Baker, directed her research and writing toward an examination of and comment on local disaster planning and responses to the oil-spill incident. Her work offers an important and vital call to action for those communities affected by the oil spill and suggests that local citizens have expertise that may be of infinite value in a time of crisis. As sociologist Brian Wynne has noted, layperson and specialist interactions, particularly in times of crisis, are complex: “Trust and credibility,” he notes, “are dependent upon …

Photo by Melissa Humble

evolving relationships and identities� [12, p. 282].

We present Jeana’s work here in two parts: (1) an informational report and (2) a call to action directed toward the Coastal Alabama Leadership Council. Her work seeks the creation of an institution where negotiating the complex interplay between specialists and nonspecialists in times of crisis is everyday business. In doing so, she has called for a level of expert and community involvement that may be of benefit to us all.

Part 2: Citizen Involvement, the Need for a Disaster-Response Plan, and a Call to Action 101

by Jeana Baker

A

s a graduate assistant researching the economic damages from the oil spill on coastal Alabama, I found Derek Ross’s course, Environmental Rhetoric, Ethics, and Policy, complemented my economic research project. This class taught me how ethics and behaviors affect many parties and can become a messy entanglement in the world in which we live. I used ethics analysis to further understand the underpinnings of the oil spill, which presented copious obstacles for coastal communities that were unprepared to respond immediately to the oil that washed onto

their pristine beaches. While attending several Coastal Alabama Leadership Council meetings, I witnessed phenomenal civic engagement among coastal residents. This community-driven synergy carried over into the Leadership Council, a strong civic organization for the region.

Realizing that coastal Alabama lacked risk communication, I decided to focus my research on that area. In my research, I found that local involvement in disaster-response planning is essential to community resiliency. I have crafted an informative report and public comment letter designed to encourage

the Coastal Alabama Leadership Council to adopt a disaster-response plan. The opportunity to learn about effective risk communication and offer recommendations that I hope will improve coastal resiliency has been a rewarding undertaking.

The Need for a Disaster-Response Plan When the BP incident gravely impacted residents in the Gulf of Mexico, public discourse became central to coastal Alabamians, who saw the disaster as an opportunity to strengthen community resiliency [13]. Hurricanes Katrina and Rita are

Photo by Melissa Humble

testaments to chaos that exceeded human capabilities. The Deepwater Horizon spill created a similar commotion, albeit technological in origin. The solidarity among residents enlivened the concept of regionalism and synergy [14]. According to Wes Tunnell of the Harte Institute, “Resilient coastal communities, like resilient natural populations, are those that are healthy and diverse, and able to rebound after natural or anthropogenic [humanmade] catastrophes” [15]. Being able to rebound has been the major thrust of community collaboration, bringing diverse groups together in their sharing of a common goal on common ground. In this case, the missing component from coastal Alabama 102 was a comprehensive plan for disaster response that would have prepared and enabled locals to respond to such catastrophe quickly. This research suggests that community disaster-response plans are effective strategies that foster civic engagement and coastal resiliency.

A Local and Unified Approach At the Road to Restoration forum, sponsored

by Auburn University, Brock Long, director of Alabama Emergency Management Agency, claimed that the federal government failed to respond immediately to the disaster. He called it a “reactive approach” [16]. The limited role that local

communities played in responding to the largest oil spill in history underscored the very principle of community democracy. The belief that locals know their landscape best and thus can make viable management decisions that affect their resources suggests more public discourse is needed [17].

Drawing from place-based knowledge, locals oftentimes feel that they are the experts of their milieu [18]. This idea suggests that local participants deserve a place at the table.

Ray Mabus, secretary of the United States Navy, reiterated the importance of a Gulf-wide community empowerment to ensure long-term recovery in his report to Congress [19]. Arguably, natural disasters such as hurricanes increase citizen-based collaboration, empowering locals to lead cleanup and restoration efforts. Yet, when there is a hierarchical structure in place, the public feels a sense of powerlessness because the experts are considered to be the authority [20], [21]. Experts perceive lay people to be lacking “knowledge, attitude, or trust” [22]. This perception creates a deficit in understanding the public. In the advent of the spill, coastal Alabamians were quick to orchestrate their voice. According to Tony Kennon, mayor of Orange Beach: In no way are we looking at what’s best (only) for us. We’re thinking about what’s best for

our neighbor. If it’s reciprocal, we’re both going to be elevated beyond what we’re going to be able to ever do trying to compete with each other. [13]

The Road to Resiliency Since the spill was considered a technological disaster, it presented a host of uncertainties that interrupted the participatory process of the community. Insufficient and unavailable data during the spill presented a slew of risk-communication problems from environmental and health standpoints [6]. In an interview on October 15, 2010, LaDon Swann, the director of Mississippi– Alabama Sea Grant Consortium and the leader of several peer-listening seminars during the spill, expressed the need for better risk communication on the coast. A participatory approach involves multiple stakeholders and engages the public in the planning process and can lead to effective, interactive policy making [8]. Had local governments from Baldwin and Mobile Counties been properly trained and equipped to handle this response, they could have reacted immediately to the situation [16]. To ensure preparedness for future disasters, a comprehensive disaster plan would not only empower locals to respond faster but would also enhance coastal resiliency.

Coastal Alabama Leadership Council P. O. Box 881, Mobile, AL 36601–0881 Re: Coastal Alabama Disaster Preparedness and Response Plan Dear Ricky Mathews, Shelia Hodges, and members of the Coastal Alabama Leadership Council: As a research assistant at Auburn University studying the economic impacts associated with the Deepwater Horizon incident, I have closely followed the progress of Alabama’s Coastal Recovery Commission (CRC). Your continued efforts to build synergy and regionalism in lower Alabama truly resonate with me. I believe local residents are the experts of their milieu and that they should be entitled to prepare, plan, and respond to disasters themselves.

From the moment the blowout occurred to the perilous weeks leading up to the oil washing onto Alabama’s shore, I saw how powerless local governments and citizens, who were left out of the response and cleanup process, felt. I agree with Brock Long, director of Alabama Emergency Management, who claimed that the government’s response was a “reactive approach.” Had communities in coastal Alabama been properly equipped and prepared to respond to this technological disaster, it is possible more immediate action would have prevailed.

The Deepwater Horizon incident has ultimately shown us that local citizens belong on the response front line. I strongly urge your newly formed organization to advocate a citizen-led, comprehensive disaster preparedness and response plan. In going forward, the implementation of such a well-crafted plan, for the people, by the people of lower Alabama, will improve our capabilities and coastal resiliency, and ensure that we take necessary action on future disasters.

If you are interested in learning more about my research, I will gladly send you a copy of my report.

Sincerely, Jeana L. Baker

103

Photo by Melissa Humble

P

R

O

F

I

L

E

Yucheng Feng

Looking for Ways to Clean the Gulf Coast’s Land and Water

by Katie Jackson

104

In spring 2010, Yucheng Feng was using the Exxon Valdez oil spill as an example to teach her soil microbiology class about bioremediation and biodegradation. Before the semester was over, she had an example much closer to home—the BP oil spill in the Gulf of Mexico. She says, “When the BP spill occurred, I thought, ‘I can’t believe this is happening so close to us.’” But close it was. Feng, a professor of soil microbiology in the Department of Agronomy and Soils who researches the microbial processes involved in soil and water quality, was soon directly involved in the BP spill response.

Feng studied soil and agricultural chemistry for her undergraduate degree at Beijing Agricultural University in her native China. She came to the United States in 1989 with a special interest in soil pollution and remediation. She says, “I was really interested in this because I noticed when I was taking soil science classes as an undergraduate that, while everybody knows there are a lot of bad things

in soil, no one would talk about it, and I thought that was a missing piece.”

Feng was able to focus her master’s and doctoral degrees at Pennsylvania State University on this issue as well as work on it during her postdoctoral research at Michigan State University. Since joining the College of Agriculture at Auburn University in 1998, Feng has continued that research, concentrating in particular on the environmental fate and impact of organic pollutants and other contaminants in soil and water.

According to Feng, scientists have long known that native microorganisms living in soil and water help break down many pollutants, though the effectiveness of this biological cleansing varies widely depending on the types of soil or water, the climate, and the kinds of pollutants involved.

When the call went out to Auburn faculty to help with problems stemming from the BP spill, Feng signed up. In December 2010, she and her research team conducted their first sampling of sediment and seawater on the western side of Mobile Bay. Back in the laboratory, they have been analyzing those samples, in addition to others collected by Auburn University geologists.

“Basically,” she says, “we are trying to answer the question: How clean is clean?”

Feng explains, “Some of the components of the

oil break down fairly quickly and easily through weathering and natural biodegradation. But other components have more complicated chemical structures and are much harder to break down.

These are also the components that are more toxic to humans and other living organisms.”

Feng and others on the Auburn team are trying to determine what was left behind after that initial degradation of the BP oil and how these components can be further degraded. “We want to find out whether the indigenous organisms can handle this and what we can do better and faster,” she says.

With that in mind, Feng and her team are isolating and identifying the microorganisms present in the natural environment. They are also determining how successfully these organisms can degrade the more resistant chemicals and what kind of degradation genes they carry.

“We are still in the discovery phase of this research,” she adds. “We have isolated the natural degrading organisms in the sediment samples.

The next thing is to figure out how much of the chemicals can be broken down by these natural organisms and how much they are leaving behind.

We also want to find out what happens to those chemicals that are left behind.”

Feng is also working with faculty in civil

engineering at Auburn University to develop nanoparticles that may be able to remove the more resistant chemical residues. “The microbes do a good job. They eat the chemicals for dinner and turn them into carbon dioxide and water, but they have their limitations, especially if the concentration of contaminants is high,” she says. “We are trying to combine the biological approach with a chemical approach to speed things up.”

Though Feng and her colleagues know they won’t find answers overnight, they see this basic research as vital. “The ultimate goal is to find ways to make the Gulf Coast as clean as possible and prepare for the next spill,” she says. “It is important to figure this out because, with as many oil wells as we have in the Gulf, it could happen again.”

After all, said Feng, it’s now more than 20 years since the Exxon Valdez spill, and no one yet knows how to clean that Alaskan shore thoroughly. “We must invest in this fundamental science to answer those questions and build for the future. We need to do better this time.”

105

Photo by Jeff Etheridge

135

by Terry Hanson and Jeana Baker

Toward Recovery

The Economic Impact of the BP Oil Spill on Marine-Based Industries in Coastal Alabama

W

e know that the 2010 BP oil spill will impact coastal communities in the Gulf of Mexico region for years. What needs attention now is assessment of the impact and deliberation about what can be done to help communities recover. Toward that end, on July 15, 2010, state extension systems in Alabama, Florida, Louisiana, and Mississppi created a task force for response and recovery that would operate in affected states.

One successful task-force endeavor is a website for marine-resources assessment. The portal site disseminates information about marine-related industries to researchers, policymakers, and the general public. A second endeavor consists of tracking the short-term economic impacts of the spill within the context of broader macroeconomic changes that arose out of Hurricane Katrina (in August 2005) and Hurricane Rita (in September 2005), as well as the recent recession (December 2007–June 2009).

The economic assessment we report here relates to this second endeavor. We begin by taking a

long-term view of three marine-related industries as they relate to Alabama’s coastal economy: commercial fishing (including shellfish and finfish fishing), seafood processing (including fresh and frozen seafood) and seafood wholesaling, and

tourism (including marinas, accommodations, and food services). In particular, we focus on data from Baldwin and Mobile counties. Then we discuss findings from our analysis of prespill and postspill impacts on (1) jobs, (2) employee earnings, and (3) sales generated per employee for each of the three industrial sectors during the last two years.

In this assessment, we rely heavily on secondary government-generated data sources, which unfortunately often lag months or even years. To supplement this data, we also rely on input–output analysis using quarterly updates of employment statistics from the United States Department of Labor. We find that initial impacts and recovery of jobs, employee earnings, and sales generated per employee varied by industry sector.

Commercial Fishing

Photo by Melissa Humble

The biodiversity, richness, and abundance attributed to coastal Alabama’s fisheries directly correlates to a healthy ecosystem and economy.

107

For instance, brown and white shrimp, which alone account for 80% of Alabama’s commercial fishing revenue, need quality water for breeding [1].

In his report to Kenneth Feinberg (the Claims Administrator for the BP oil spill), John W. Tunnell of the Harte Research Institute for Gulf of Mexico Studies stated that “shrimp catches for the brown, white, and pink shrimp in the northern Gulf of Mexico will likely continue along the same harvest trends in recent years by 2011, and even more likely by 2012” [2, p. 40]. In relation to oysters, which received media attention after the spill, Tunnell stated, “In areas where oysters died as a result of freshwater diversion and flooding, oyster 108 reefs should be recolonized by young oysters in 2011 (assuming there are no large-scale flooding events in 2011), but they will not likely be of harvestable size until late 2012 or 2013. In areas where oyster reefs were heavily oiled, oyster reefs may not recover for six to eight, or even ten years” [2, p. 41]. In short, while the closure of Alabama and Gulf of Mexico offshore waters to commercial fishing severely disrupted the 2010 fishing season, shellfish (shrimp) fishing has remained relatively stable one year after the oil spill. Indeed, Tunnell also stated that finfish fishing appears to be continuing a long-term decline, as opposed to being in a spill-generated decline.

We used Economic Modeling Specialists, Inc. (EMSI) and North American Industry Classification System (NAICS) industry-sector codes to track commercial fishing jobs for 2001 through 2011 for Baldwin and Mobile counties.

Jobs in commercial fishing fell: in 2001, 1,135 people in the combined Mobile–Baldwin County area worked in commercial fishing. In 2010, just 867 people did—a 24% decline.

The two prominent sectors in commercial fishing are shrimp (shellfish) and finfish fishing, but shrimp fishing dominates. The Mobile County shrimp-fishing sector included 534 jobs in 2001 but just 455 jobs in 2011 (−15%). Even worse, jobs in finfish fishing declined from 318 in 2001 to 113 in 2011 (−64%). Jobs in wholesale of fish and seafood dropped from 423 in 2001 to 77 in 2011 (−82%).

Between 2001 and 2011, Baldwin County encountered a sharp decline in finfish fishing jobs—a 70% decrease from 86 in 2001 to 26 in 2011. However, shrimp fishing maintained an 8% growth rate with 198 jobs in 2001 and 213 jobs in 2011.

Seafood Processing Alabama has more than 80 seafood processor and wholesaler establishments—a substantial portion of processing on the United States’ Gulf of Mexico (Nan Steedley, Seafood Specialist,

Alabama Department of Public Health, personal communication, November 30, 2010). Annual values for Alabama’s seafood landing decreased in the early 2000s but remained relatively steady from 2003 to 2009. Landing quantities declined over this period but had no sharp changes from year to year.

The Alabama Department of Public Health requires seafood inspection permits for seafood companies that add value to raw fish and shellfish.

Seafood-processing permits in Mobile County substantially decreased from the start of the permitting period, October 1, 2010, which is postspill, compared to the same period in 2009. Shellfish permits decreased from 19 to 7 (−63%); blue-crab permits decreased from 9 to 2 (−78%); and permits for value-added seafood processing, including products such as dips and spreads sold in supermarkets, decreased from 18 to 8 (−56%) (Nan Steedley, Seafood Specialist, Alabama Department of Public Health, personal communication, March 21, 2011).

In 2009, Bayou La Batre (in Mobile County) ranked second in the nation as a commercial fishery port. In that city, 19 million pounds of seafood with a value of $36 million were landed annually. Also in 2009, Bon Secour Fisheries brought in 5 million pounds, which was worth more than $7 million [3].

We tracked seafood-processing and merchantwholesaler jobs from 2001 through 2011 for both

1,000 900 800

Number of Jobs

Baldwin and Mobile counties. Between 2001 and 2011, Mobile County seafood-processing jobs declined by 25%, from 873 jobs in 2001 to 656 jobs in 2011. Seafood-processing jobs in Baldwin County remained relatively constant during this same time period, but there was an 11% decline from 247 in 2001 to 221 in 2011. In Mobile County, merchant-wholesaler jobs declined from 423 in 2001 to 77 in 2011 (−82%). The number of these jobs in Mobile County declined to the same level as Baldwin County after 2006 (see figure 1).

Consumers who eat seafood more than once per week are considered to be heavy seafood consumers. They tend to be 55 years or older and are highly educated [5]. Results from a recent survey about seafood from the Gulf indicate that even before the spill, consumption of seafood was declining, likely because of high costs [6]. The seafood supply chain for the Gulf experienced setbacks even before the oil spill. Disturbances such as lack of product availability and the effects of hurricanes undermined the seafood market [6]. On the whole, seafood harvesting fell below average as rising costs reduced processors’ purchasing power [6]. These results suggest that the spill likely had only a short-run impact; the high price of seafood was beginning to curtail consumer demand even before the oil spill.

700 600 500 400 300 200 100 0 2001

2002

2003

2004

2005

2006

2007

2008

2009

2010

2011

Mobile Seafood Processing

Mobile Seafood Wholesalers

Baldwin Seafood Processing

Baldwin Seafood Wholesalers

Fig. 1. Seafood-processing and wholesaler jobs in Baldwin County and Mobile County, Alabama, 2001–2011 [4].

Coastal Tourism Twenty-one million travelers visited Alabama in 2009; the Gulf Coast received 35% of the tourism dollars [7]. That is, in 2009, 4.6 million guests visited Alabama’s Gulf Coast and spent $2.3 billion.

The Gulf region had the largest total travel expenditures, travel-related earnings, and travel-related employment in the state [7]. Tourism generated

40,000 travel-related jobs that accounted for $915 million in wages and salary [8].

The marine-related tourism industry in Baldwin County strongly felt the initial economic shock from the oil spill. From May through August 2010, Baldwin County lost $58 million (−33%) of its lodging revenue when compared to the same months in 2009 [8]. Retail sales for the

109

30

$ Millions

0 -10

0.1 Hancock, MS

5.2 Jackson, MS

-7.3 Escambia, FL

6.7 Harrison, MS

-3.2 Santa Rosa, FL

-20

-9.5 Bay, FL -19.8 Walton, FL

-30

-31.4 Okaloosa, FL

-40 -50 -60 -70

110

Number of Wildlife Viewers x 1,000

10

450

18.7 Mobile, AL

20

400 350 300 250 200 150 100 50 0

-58.3 Baldwin, AL

Fig. 2. May to August 2010 lodging revenues by coastal counties in Mississippi, Alabama, and Florida compared to the same period in 2009 [7], [10]–[12].

same region and time period dropped 28%. While Baldwin County saw a sharp decline in lodging revenue, Mobile County gained revenue because BP lodged its crews in hotels there (see figure 2).

Coastal tourism recovery got a kick start when BP funded free public concerts late in the 2010 summer season. These concerts brought crowds exceeding 30,000 for each concert to the coast to see artists such as Jimmy Buffet, Bon Jovi, and Brad Paisley [9]. These events temporarily stimulated economic activity.

2000 2001 2002 2003 2004 2005 2006 2007 2008 2009 2010

Fig. 3. Nature tourism in Baldwin County, Alabama, 2000–2010 [13].

Alabama’s coast is home to more than 300 species of saltwater fish [3]. In 2008, 1.67 million sport fisherman set out on fishing trips on Alabama’s coast. Fishing (except for shrimp fishing) in 351 square miles of Alabama’s 777 square miles of marine waters shut down for 81 days, starting on June 10, 2010. The closure hit recreational fishing hard. Although Alabama does not have the Gulf ’s highest value for tourism related to recreational fishing, the $455 million it brings in is vital to local businesses.

Also, increasingly important to Alabama’s economy are wildlife viewers. Of the 1.3 million visitors who came to Baldwin County from 2008 to 2009, 400,000 participated in nature tourism activities, and they spent $50 million (Joanne McDonough, Nature Tourism Specialist, Mississippi–Alabama Sea Grant Consortium, personal communication, May 5, 2011).

The number of such visitors dropped substantially in 2010 (see figure 3).

We tracked job changes in tourism from 2001 through 2011 for Baldwin County and Mobile

County. Mobile County had greater numbers of jobs in the full- and limited-service restaurant category compared to Baldwin County, and job numbers grew during the 10-year period for both counties in each restaurant sector. Hotels and motel jobs declined during 2004 to 2006 for Baldwin County, but these jobs have come back in 2011.

There was a large increase in jobs in the passenger transportation category: from 0 in 2003 to 172 in 2011 in Mobile County. Baldwin County remains at 0 jobs in this sector. Marina jobs in Mobile County increased from 22 in 2001 to 61 in 2011; in Baldwin County, marine jobs declined slightly. Mobile County and Baldwin County boat dealers have seen declines in job numbers recently.

The Oil Spill’s Impact on Marine-Related Industries We analyzed data from Baldwin County and Mobile County to assess the economic changes since the oil spill. We used an EMSI 2011 dataset (second quarter) to derive changes in (1) jobs, (2) employee earnings, and (3) sales generated between 2009 and 2011. The data set represented prespill and postspill economic activity. We analyzed the data for differences in terms of gains and losses for (1) commercial fishing; (2) seafood processing and seafood wholesaling; and (3) tourism,

including accommodations, food service, boating, sightseeing transportation, and marinas.

Jobs

Seafood-processing saw the sharpest decline in jobs, losing 126 jobs in 2009–2011. More jobs were lost during in 2009–2010 (−75, −5.9%) than in 2010–2011 (−51, −4.3%) period. The decrease in 2010–2011 likely stems from harvest closures in spring 2010, whereas job losses in 2010–2011 likely stemmed from decreased demand arising out of consumer uncertainty about product safety.

Tourism experienced a gain of 425 jobs (+1.7%) from 2009 to 2011. The spill disrupted accommodations and food-service sectors less than other marine-related sectors. Hotels and full-service restaurants gained 176 (+5%) and 174 (+2%) jobs respectively from 2009 to 2011.

Limited-service restaurants and drinking places had the most job losses; they lost 38 (−0.5%) and 22 (−4%) jobs respectively for the same two-year period. Boating, transportation, and marina sectors lost 34 jobs (−6%).

Earnings

Commercial fishing (finfish and shellfish) earnings increased $1 million from 2009 to 2010, but decreased $1.5 million from 2010 to 2011. Seafood processing fared worse with an employee-earnings

decline of $2.2 million from 2009 to 2010 and $1.6 million from 2010 to 2011 for a total loss of $3.8 million. Employee earnings in the tourism, accommodation, lodging, food service, recreation, boating, and marina sectors increased by $8.5 million from 2009 to 2011. Full-service restaurants had a $3.1 million increase in earnings from 2009 to 2011 while limited-service restaurants saw an overall loss of $600,000 for the combined two-year period. The hotel sector saw the biggest gain: $4.3 million from 2009 to 2011. From these findings it is clear that employee earnings in the tourism sectors responded and recovered much more quickly than the sectors of seafood harvest, processing, 111 and wholesale. The long-term trends for tourism (increasing) and fishing and processing (decreasing) were exacerbated by the oil spill.

Sales

Commercial-fishing sales, generated off jobnumber changes, declined more during the 2010 to 2011 period than in the 2009 to 2010 period. The largest sales losses occurred in the seafood-processing and seafood-wholesaling sectors. Sales declined $15.8 million over the two-year period. The greatest losses occurred in the seafood-processing category, which saw a decline of $11.3 million. Fish and seafood merchant wholesalers lost $5 million.

The tourism sector saw gains in sales each year.

Over the two-year period, tourism-related sales increased $25 million. The hotel and motel sector had the highest sales gain: $13 million. Again, we see the oil spill hastening the long-term trend of declining commercial fishing and seafood processing and wholesaling sales. Tourism-sector sales rebounded quickly from initial scares of polluted beaches. Beaches were effectively cleaned and promotional events brought people back to see with their own eyes that the oil spill’s initial effect on the beaches and waters was not as dire as expected one year after the oil spill.

112

Concluding Remarks We have discussed some of the most recent economic information pertaining to Alabama’s coastal economy, particularly the counties of Baldwin and Mobile. The short-term employment impacts illustrate the sectors that the spill hit hardest. For instance, the spill gravely impacted commercial fishing and boating. While consumers’ perceptions of Gulf seafood have improved, the seafoodprocessing industry continues to struggle with decreased demand.

Coastal tourism, however, is showing signs of recovery. An informal survey of Gulf Shores and Orange Beach accommodations, carried out just

before July 4, 2011, found positive indications that the occupancy rates over the holiday weekend would outpace previous levels, setting an all-time high [10]. As Kim Chapman relates in her press release of June 29, 2011, Herb Malone, the president of the Alabama Gulf Coast Convention & Visitors Bureau, stated, “With 2011 holiday weekend figures projected to exceed the 2009 figures for the same comparable period, we are continuing to make positive strides thanks to the strong loyalty of our consumer base” [10]. That said, the continuing sluggish economic recovery is having an impact on the speed of this industry’s recovery.

Like many other business sectors along the coast, marine-related industries have experienced economic ripple effects from the oil spill.

While these impacts have and will continue to affect coastal Alabama’s economies and communities, the major challenge for the economy of coastal Alabama lies in economic diversification.

Ultimately, community resiliency strengthens, stabilizes, and protects economies from epic shocks, be they natural or human made.

Acknowledgments This material is based upon work supported by the National Institute of Food and Agriculture, United States Department of Agriculture under

award number 2010-41210-21185. Any opinions, findings, and conclusions or recommendations expressed in this publication are those of the authors and do not necessarily reflect the views of United States Department of Agriculture.

The authors would like to thank the the United States Department of Agriculture (award number 2010-41210-21185) and all the people from the state extension systems in Alabama, Florida, Louisiana, and Florida (the multistate Recovery Task Force) for their impassioned and dedicated work after this tragedy.

In addition, the following people kindly dedicated their time and resources without compensation from the project: Amelia Stehouwer, Auburn University’s Economic Community Development Institute; David Williams and Larson Hicks, Economic Modeling Specialists, Inc.; Herb Malone, Alabama Gulf Coast Convention & Visitors Bureau; Joanne McDonough, Mississippi–Alabama Sea Grant Consortium; Nan Steedley, Alabama Department of Public Health; Chris Denson, Alabama Department of Conservation and Natural Resources; Chris Nelson, Bon Secour Fisheries; James McCoy, Auburn University; and Troy Hahn, Auburn University’s Department of Fisheries and Allied Aquacultures.

T

H

E

G

U

L

F

R

113

esearchers at the Auburn University Shellfish Laboratory on Dauphin Island produce and study oysters in support of the regional seafood industry. These Auburn University scientists continue to work toward restoration of aquaculture and recovery of the oyster industry.

Photo by Michelle Worosz

135

One Year After

by Danilea Werner and Chris Locke

Photo by Jeff Etheridge

Community Response and Use of Mental Health Services

T

he Alabama Gulf region was devastated by the Deepwater Horizon oil spill in April 2010. As a major source for the shipping, tourism, fishing, and energy industries, the Gulf of Mexico region supports many people and took major losses as a result of the oil spill. This disaster caused distress physically, emotionally, psychologically, and spiritually, yet most of the preparedness and recovery efforts continue to be directed at physical preparation and restoration such as environmental cleanup [1]. A crucial, yet often ignored, aspect of recovery is emotional [2, pp. 314–21]. In fact, the emotional collateral of disaster is commonly higher than the physical collateral, making psychological resilience one of the most important basic survival needs in fostering recovery across the lifespan [1], [3, pp. 23–26]. Local social-service agencies are often the catalyst for psychological recovery. This article explores how providers in the Gulf region have fostered psychological and emotional recovery one year after the devastating spill.

Background Disasters are defined by four categories: cause, impact, size, and frequency—all of which can impact the psychological and emotional recovery of the community [4], [5]. First, disasters are either naturally occurring or human made.

Naturally occurring disasters are most often forces of nature such as tornadoes, hurricanes, and earthquakes that cannot be controlled by human ingenuity. Human-created disasters fall into two categories: intentional and accidental. The former include terrorist attacks while the latter usually

Photo by Danilea Werner and Chris Locke

Above: Billboard advertising Project Rebound.

Opposite page: Werner and Locke (third and fourth from left) reviewing research results with colleagues.

result from some type of human negligence or material malfunction. The Deepwater Horizon oil spill is a human-caused disaster; BP has accepted responsibility for the oil-rig explosion.

Researchers also define disasters in terms of degree of impact [4], [5], asking how many people, communities, and industries are personally impacted by the disaster. Two counties in Alabama, 115 Baldwin and Mobile, were directly affected by the spill, and two areas within them were particularly hard hit: Gulf Shores in Baldwin County and Bayou La Batre in Mobile County. A significant portion of the Gulf Shores community is supported by tourism. Over 30% of employees in Gulf Shores work in accommodation services such as travel and food services [6]. The majority of those employed in Bayou La Batre work in the manufacturing, wholesale, and retail trades [7]. Most of these jobs are directly related to the food service and fishing industries, industries that were significantly affected by the Deepwater Horizon spill.

The degree of personal impact is also influenced by the size and scope of the disaster [4], [5]. Size and scope are determined by how many people are directly affected, the length of the disaster, and the visible impact of the damage. The oil spill in the Gulf has been called the worst environmental disaster in the history of the United States and one of the worst spills in world history. Oil spilled into the Gulf of Mexico at an uncontrolled rate for 86 days, and the flow was not completely sealed until September 19, 2010—four months after the explosion [8]. In terms of longevity alone, the spill counts as a significant disaster.

Finally, disasters are categorized by the prob116 ability of their recurrence [4], [5]. The probability of recurrence varies based on the cause: natural versus human made. Natural disasters can often be counted on to be repeated. Many communities have prepared for the likelihood of the recurrence of tornadoes, for instance, by adding early warning systems. Human-made disasters present a more difficult task when determining the likelihood of recurrence. While communities and individuals should be prepared for all emergences regardless of cause, impact, size, or frequency, the scope and intensity of these elements will determine the reaction and response [9]–[11, pp. 39–51].

Theory

Photo by Danilea Werner and Chris Locke

Gerald Caplan’s 1961definition of crisis as a state of disequilibrium and disorganization is still accepted today. Caplan contends that people function in a steady balance, going about their lives, solving problems as they arise. Once crisis occurs, the individual must (at least temporarily) alter her or his balance in an attempt to readjust. A person in crisis is anxious to solve the problem (the crisis) and return to precrisis life. Without adequate resources, the individual cannot overcome the problem with traditional problem-solving methods. New patterns and behaviors must be created.

It is this struggle to return to the precrisis life and the inability to quickly solve the crisis that can result in mental distress [9].

Project Rebound To mitigate mental distress and promote recovery, the Alabama Department of Mental Health implements Project Rebound when disasters strike. Project Rebound is a program designed to work in collaboration with local community organizations to offer recovery assistance in the aftermath of disasters. The program was initiated after Hurricane Ivan and has been reactivated in response to the Gulf Coast oil spill. The goal

of the Gulf Coast Project Rebound is to serve people directly or indirectly impacted by the spill, dispatching teams of trained crisis counselors in Mobile and Baldwin counties to deliver individual services, classroom presentations, and public education and to provide support to community organizations. Teams were deployed beginning in the summer of 2010.

Our study examines the ways that mental health services have been delivered and used in two Gulf Coast communities one year after the oil spill.

We are particularly interested in how the Gulf Shores and Bayou La Batre communities have been affected and how Project Rebound clinicians have delivered services to those in need. We are also interested in how the use of services has changed over the year since the beginning of the oil spill.

In addition, we examine how the community perceived the disaster and the recovery efforts.

Methods Participants

The study participants were 17 mental health clinicians employed by Project Rebound to work in collaboration with Gulf Shores and Bayou La Batre community organizations to offer recovery assistance. In addition to the Project Rebound clinicians, four counselors from two Gulf Coast school districts were also interviewed. Of the 21 study participants, 13 served the Gulf Shores area and 8 served the Bayou La Batre community.

Participants representing both communities were primarily female (Gulf Shores, 54%; Bayou La Batre, 75%) and white (Gulf Shores, 77%; Bayou La Batre, 57%). The average age of participants

was 52 in Gulf Shores and 40 in Bayou La Batre.

Additionally, most participants had at least a bachelor’s degree (Gulf Shores, 92%; Bayou La Batre, 63%), had worked in the mental health field at least 10 years (Gulf Shores, 69%; Bayou La Batre, 100%), and had assisted with at least one prior disaster (Gulf Shores, 73%; Bayou La Batre, 33%).

Data Collection Techniques

We collected data through seven focus groups.

The primary selection criterion for mental health professionals was that they were employed by Project Rebound to provide mental health services to individuals and families impacted by the Gulf oil spill or that they were school counselors employed by school districts in Gulf Shores or Bayou La Batre. We conducted the focus groups at the Project Rebound offices in both communities and at the respective schools. All participants were at least 19 and were served lunch or breakfast (as appropriate). Participation was contingent upon a standard protocol of informed consent; Auburn University’s IRB approved the study.

The content of the questions for the focus groups varied slightly across target populations, but all were similarly related to the study’s key issues. We, the investigators, led all of the focus groups. One of us led the discussion while the

other recorded the responses and took notes. Each focus group lasted from 60 to 90 minutes, was audio-recorded (with participant consent), and transcribed. Three focus groups (two with Project Rebound staff and one with school counselors) were held in Gulf Shores with 13 participants.

Four focus groups (three with Project Rebound Staff and one with school counselors) were held in Bayou La Batre with eight participants.

Results Analyzing the data yielded six core themes related to mental health recovery efforts after the spill: (1) unique characteristics of the disaster, (2) identification of clients, (3) mental health response 117 and outreach efforts, (4) impact on the school climate, (5) challenges in responding to the oil spill, and (6) recommendations for communities in future disasters.

Unique Characteristics of the Oil Spill

Participants described the oil spill as differing from disasters such as hurricanes, tornadoes, or earthquakes in many ways. Two main subthemes were the duration of the spill and the cause of the spill. These differences contributed to the complex nature of how to best help those affected in Baldwin and Mobile counties.

Duration: Unlike a tornado, hurricane, or earthquake, which may last seconds or minutes, the oil spill lasted 86 days, and its effects are still being felt one year later: • “It wasn’t an immediate, major impact,

but now, over time . . . it’s been there,

whittling away, whittling away, a lot of panic,

a lot of frustration, a lot of worry about the

future, and it’s a constant worry.”

The unprecedented length of the spill was covered by all forms of media including 24-hour footage of the oil spilling into the ocean: • “It was on television 24 hours a day, every day,

[and] on the front of the newspaper.”

• “Every day, people were picking up the news 118

paper [asking] ‘Is it going to be today [that

the oil spill ends]?’”

Human Caused: One major difference from other disasters was the human-made nature of the oil spill. The spill generated feelings of blame directed toward BP, as if community members were personally attacked by BP: • “You’ve got someone to point the finger at.

Tornado: it happens. BP: that’s what happened.”

• “[The clients] seem to have this heightened

sense of, you know, [BP is] doing this

to me.”

Catch 22: The heavy reliance on tourism in the Gulf presented a challenge for people who wanted to advocate for more assistance and funding to restore the area yet also did not want to scare off potential tourists: • “The catch 22 was if we really broadcast that

this is a real disaster, then it will hurt tourism.

So, on the one hand, people wanted to say,

‘Oh, it’s horrible’ and, on the other hand, people

wanted to say, ‘Oh, but the beaches are fine.’”

Silent Disaster: Participants noted that there was no visible evidence of distress among community members that neighbors could detect. The lack of visible damage left many people dealing with the disaster in isolation: • “[There was] not a lot of physical

evidence as in a tornado [where] there

are a lot of things torn down. This is a

silent disaster.”

• “This is the difference between the hurricane

[Katrina] and what we’re facing down

here. With a hurricane, you see a neighbor’s

house down, and my house is down. So

everybody’s in a bad boat. But [with this

disaster] there’s no visible destruction,

and I don’t know that my neighbor is as bad

off as me. And I’m certainly not going to

tell them.”

The silent nature of this disaster also contributed to community members feeling unsure of how to help: • “I was looking for anywhere to volunteer to

do anything, and you couldn’t do anything.

There was nothing you could do to help at

that point.”

Sense of Community: One critical difference between the clinicians’ responses in Gulf Shores compared to the responses of those in Bayou La Batre was in regard to a sense of community.

Clinicians in Gulf Shores reported that their clients felt tension with one another, especially related to the distribution of BP relief money. Clients questioned why individuals in the same industry were getting different treatment and amounts of money from BP, and clients in both communities described frustration with the lack of a standardized claims process. However, in contrast to Gulf Shores, clinicians in Bayou La Batre reported that the community members pulled together, working to help each other and uniting in animosity toward BP: • [from Gulf Shores] “With a hurricane or

tornado, people help each other out. With this

[disaster], it was like each person was looking

out for themselves. They weren’t neighborly.”

• [from Bayou La Batre] “I do not see

[animosity] as much. It just makes them

more angry at BP.”

• [from Bayou La Batre] “This community gets

along very well. We just flow together.”

The disaster’s unique characteristics impacted how the clinicians identified clients. As clinicians mentioned in the focus groups, there was no visible damage to help them identify who might be in need. Therefore, they had to employ different strategies.

How Clients Were Identified

Clients identified themselves by calling a 1-800 number posted on billboards, by watching TV commercials featuring Project Rebound, and by word of mouth. Interestingly, clinicians described how they would get numerous calls from people in need who stated their neighbor, friend, or family member was receiving services from Project Rebound: • “And it’s still not unusual or uncommon for

us to hear clients say, ‘Well, I need this, but I

know some folks that are a lot worse off than

I am.’”

• “Clients are referring clients to us directly.

Yeah, yeah, we’re getting them from every

corner. The word has spread.”

In addition to a call center, the 1-800 number, and media, participants went into the community to identify those in need. They reported using a vari-

ety of outreach efforts to seek out individuals and families who were impacted by the oil spill.

Mental Health Response and Outreach Efforts

Clinicians reported doing whatever was necessary to identify clients. Many went to marinas or local gathering places, including religious organizations, worked with food pantries, and set up booths at community centers: • “[We] do a food pantry. Part of what we do

is take their groceries out. And we kind

of talk to them, and kind of get a feel for them,

and we offer services if needed.”

• “If I can get them immediate access to food,

they are going to be more comfortable

speaking with me. And if I can help them

immediately with something, then I am going

to be able to call on them.”

Participants stated that a lot of their clients just needed someone to listen to them so they could vent or cry. Often times, participants found themselves assisting clients with basic needs, which led to the discovery of mental health needs: • “For the first 40 to 45 minutes, he just cried,

did not say a word.”

Some clinicians described mental health difficulties

that were clinically significant: • “We’re seeing an enormous spike in anxiety,

depression, [and] panic attacks.”

Clients who already had mental health concerns were a focus of concern: • “We’re seeing people that have some sort of a

diagnosis of a mental health issue that was

kind of, sort of managed before. Now

it’s rampant. I would say 70% of [clients]

had some sort of mental health issue, and

this [disaster] has exacerbated the

whole thing.”

Project Rebound workers learned that using the title “counselor” or references to “counseling” were often not well received by clients: 119 • “And you quickly learn to not say, ‘Oh, I’m

a mental health counselor. No, we’re not

doing counseling. We’re just talking,

just talking.’”

Unfortunately, clinicians reported that the effects of the oil spill on the mental health of individuals and families were still significant one year later.

Moreover, the number of people seeking services was increasing, but the circumstances seem to be more dismal.

• “They’ve reached the panic point. Before,

they’d had enough money in savings to get by.

And if they’ve got money from BP, that’s

gone. So now they’re starting to panic.”

• “[Clients have] run out of resources, and they

kept waiting and hoping and thinking that it

was going to turn. And they were going

to get the job. And they were going to be

able to get themselves out. They’ve gone

through several different stages, and now it’s,

it’s just now peaking.”

Impact on the School Climate

School counselors and Project Rebound staff discussed the impact of the oil spill on students, their families, and teachers. Some of the issues that arose were those described below.

Transiency: Counselors described the fluid 120 nature of enrollment at the local schools: • “Transiency in this area has always been an

issue, but it’s become a bigger issue. A lot

of people are moving down here, having to

live with other family members, households

joining together. Our absence list here is just

unbelievable. That’s a real issue.”

Basic Needs: Clothing, food, and supplies are much needed at the local schools: • “School supplies . . . they don’t have any

uniforms . . . [I was] buying clothes for

students when I really should have been

here at school.”

Stress: Students are presenting increased stress levels that are contributing to behavioral problems: • “Kids are stressed. . . . There’s a lot more anger.”

• “We also did an anger management group for

those who were witnessing things at home

and carrying it over into the school system.”

• “We have made reports of kids to DHR.

Several of [the reports] have been [about]

physical abuse against themselves.”

• “[We’re seeing] more of the meanness . . .

making fun of other people, putting people

down. The verbal stuff. Talking back

to teachers.”

Family System: The parents’ financial and interpersonal struggles have affected the children in the home: • “It’s a money thing. And so when parents, you

know, don’t have funds to pay for their basic

needs, it filters down to the kids because they

hear it all.”

• “There’s more fighting and domestic violence.

We know that’s happening.”

Suicide: Both students and teachers have committed suicide since the oil spill began: • “We had one [suicide] at the middle school

before [the spill]. [A local school] had two

teachers and a student [commit suicide].”

Child Focused: Parents are more likely to attend

school functions or parenting events if the event’s goal is framed in terms of the child’s well-being: • “In our community, sometimes [parents]

won’t reach out [for themselves], but they will

for the kids.”

Challenges in Responding to the Gulf Oil Spill

The participating clinicians listed many challenges to providing mental health services. Pride was often reported as a barrier to those who needed services. Clinicians stated that many of the individuals in need prided themselves on their self-sufficiency. To seek mental health and other community services was beyond humbling: • “And there are even certain communities that

won’t even admit that any of the citizens there

are even having problems and won’t even

admit there are problems . . . [such as]

suicides and things going on, but [they say]

‘We don’t need any help.’”

• “The people that are asking for help are

the people that were donating to help

other people.”

Community Recommendations for Future Disasters

Clinicians identified several critical elements that would improve responses to future disasters,

such as using funding more effectively, identifying appropriate community resources, and creating collaborations such as Project Rebound in advance of disasters: • “We’re constantly striving to come up with

new resources or new ways to fund, you

know, people’s needs.”

According to the participants, one of the best ways to disseminate mental health services is to employ clinicians who are dedicated to the field: • “I wake up every morning and can’t wait to

get on the road and, you know, do this

because the need is . . . so there.”

• “If you work in this field, you have to really

want to be here to help people. It is not

because it is money here, or a paycheck,

or whatever.”

Discussion The uniqueness of the oil spill in the Gulf created a number of challenges, including the ongoing efforts to identify those in need. However, the effects of a disaster on a community and its mental health are not exclusive to the spill. Disasters can produce chronic stressors such as work overload, job loss or forced job change, family disruption from displacement, financial problems for individuals and communities, and bureaucratic hassles.

Such stressors can lead to long-term, disasterrelated stress, which can manifest as anxiety, anger, resentment, conflict, hopelessness, and other mental health problems. The clinicians and school personnel working with Gulf communities noted such problems.

Clinicians spoke of many new clients who sought help after all other measures had failed and after they were out of options. This description illustrates Caplan’s theory [9]: Individuals use all known resources and problem-solving techniques after a disaster in order to regain their precrisis lives. Only after exhausting all possible coping skills did the individuals seek help from Project Rebound clinicians to resolve these chronic stressors.

One year after the spill, clinicians reported that families were still experiencing disruption—mostly related to job loss and changes in economic conditions. Many of those interviewed discussed the spill as a catalyst for the “loss of a season,” referring to the loss of job opportunities and tourism during the summer of 2010. As a result of these losses, Gulf Coast families and communities reported increased financial pressures. Project Rebound staff stated that these financial pressures constitute the biggest challenge resulting from the oil spill.

The Project Rebound staff and the individuals

and families they assist serve as a reminder of the important role of mental health providers during recovery. As seen in the Gulf, the providers must work in collaboration with community organizations and emergency responders to identify people at risk for psychological distress. These providers work in nontraditional settings such as individuals’ homes, fishing marinas, and community centers to help all those involved understand that people who are experiencing disaster-related stress are reacting normally to an abnormal situation. As communities prepare for future disasters, they can learn from the experiences of the Gulf Coast communities, building collaborations and integrating efforts to create an effective and efficient response to disasters.

Acknowledgments We would like to thank AltaPointe Health Systems and the Project Rebound staff for allowing us access to their dedicated clinicians and their meaningful work. We would also like to thank the Auburn University College of Liberal Arts for providing the grant funding to complete this important research.

121

Editorial: Special to the Press-Register (Mobile, Alabama), Sunday, July 04, 2010. Reprinted with permission.

The Big Lesson

by T. Prabhakar Clement, Michael Kensler, and Michelle R. Worosz

T

he continuing man-made catastrophe in the Gulf of Mexico is the latest event in a long-established pattern of systemic “disconnects” between the way that nature works and the way our society perceives and utilizes natural resources.

Our history is replete with crises that have arisen from overextended efforts to generate power, extract nonrenewable resources, indiscriminately harvest renewable resources, synthesize toxic chemicals, and transform the landscape for the purpose of social and economic development.

The Three Mile Island accident, the Bhopal gas tragedy, destruction of tropical rainforests, New Orleans levee breaches, and the draining of the

122

Photo by Jeff Etheridge

Aral Sea are a few examples of man-made naturevs.-society conflicts. In each case, there is sufficient evidence that we think and act in ways that eventually violate nature’s laws and limits, and some of us inevitably and inequitably suffer the consequences.

As a society, we still have not recognized this pattern of anthropogenic overreach and nature’s kickback.

On April 20, a drilling platform in the Gulf of Mexico exploded, resulting in the discharge of millions of barrels of crude oil. Its aftermath presents urgent social, economic, ecological, biological and technological problems that require immediate and extensive remediation.

President Obama has since created a National Commission on the BP Deepwater Horizon Oil Spill and Offshore Drilling. The commission is tasked with determining the root causes of this disaster, developing options for guarding against and mitigating the impact of offshore drillingrelated oil spills, and recommending reforms of federal agencies and processes.

No doubt, these are issues of great consequence.

But we must not lose sight of the larger lessons that ought to be learned from this technological disaster.

While the commission must address immediate harm to nature and society, it must also put this event into a broader context and look at a larger, more systemic picture.

A fragmented, piecemeal approach to resolving the immediate economic and environmental issues, without serious consideration of the intimately interconnected cultural, political, ecological, and technological systems, is doomed to fail.

Without the courage to think and act beyond the immediate concerns, we will be repeatedly blindsided by a continuous cycle of overreach and kickback that will be increasingly destructive to both nature and society.

So, what should be learned from the Deepwater Horizon and its aftermath?

For one thing, we must take stock of our propensity to think and act suboptimally to solve these problems.

Depending on our perspective and our programmatic and operational priorities, we make isolated and narrow decisions to maximize outcomes, without sufficient consideration for other highly interdependent natural and human factors.

In economic terms, we habitually maximize benefits and certainty for some, and externalize costs and risks to nature and other people, regardless of the consequences. What is missing is a sufficiently powerful framework that gives us a more holistic context for decision making so that we better understand the broader consequences of our actions.

With this in mind, our recommendation to the president’s commission is to take a two-track approach.

First, tackle the immediate and urgent issues as mandated. And second, the commission can start a process for creating a long-term, holistic framework for decision making that breaks the cycle of sector-specific overreach and the unintended systemic consequences that inevitably result.

This means resolving nature–society conflicts by bringing human behavior in line with the laws and

limits of nature.

We must make decisions which allow the Gulf ecosystem to provide the greatest benefit ecologically, economically, socially, and culturally to the greatest number of people over the course of many generations.

We recommend that the commission work with a team of experts, scholars, citizens, and other Gulf stakeholders to create a vision of what a sustainable and healthy Gulf of Mexico would look like and develop a comprehensive multistate rehabilitation plan that reflects a broader vision.

Then it will be up to citizens and local, state, and federal leaders to debate and codify the vision and bring it to fruition.

123 Until a plan is in place, extreme caution should be exercised when considering any environmentally sensitive activities in the Gulf.

The laws and limits of a healthy, functioning Gulf ecosystem set the context and define the boundaries within which we can sustainably operate. Understanding this ecological context and designing human uses accordingly will bring us closer to resolving nature–society conflicts and ensuring we do not repeat the disaster that confronts us today.

In our view, this is the lesson we most need to learn.

Photo by Melissa Humble

Addictive Behavior and Faustian Bargains

by Conner Bailey

O

ur society is built around the calculation and management of risk. Nowhere is this more obvious than in our production and use of the ener124 gies that light our homes, drive our industries, and fuel our transportation systems. Life without abundant energy is unimaginable to most Americans, and we have come to accept that there are certain risks associated with this energy dependence.

Indeed, what risk will we not take to make sure energy—the lifeblood of our economy—is cheap and abundant? We know that offshore oil exploration leads to chronic leaks and spills from large numbers of oil rigs and pipelines that run from rig to shore. We are all right with this. We also know from bitter experience the risks of major disasters such as Deepwater Horizon and the PEMEX oil rig that spilled 30,000 barrels of oil per day into the Gulf of Mexico over

a 10-month period in 1979. As we push farther out into the Gulf into deeper and deeper waters—which will continue because all the easily drilled oil has already been exploited—the risks of disaster increase.

We seem to be all right with this as well.

Who bears the weight of these risks? In the case of the Deepwater Horizon disaster, the 11 men who were killed on the drilling rig and their families were the first ones affected. Coastal residents and coastal businesses from commercial fishers to t-shirt vendors were also affected. Local, county, and state government agencies simultaneously shouldered burdens and suffered declining revenues, putting strain on their ability to meet normal demands.

BP, Halliburton, and Transocean—the three firms responsible for the disaster—bore financial costs, and the oil industry as a whole was affected by the

temporary halt of petroleum exploration and development in the Gulf’s deep water. But the permit process has restarted, tourism has rebounded and, over time, this disaster will fade into distant memory for most Alabamians and even coastal residents.

This return to what is accepted as normalcy is a symptom of what a colleague of mine, the late Bill Freudenburg, referred to as addictive behavior [1].

When the oil patch is booming and both oil and money are flowing, everyone involved feels on top of the world. When a crisis strikes—the unexpected bust or the predictable disaster—people are hurt. But they are unwilling to turn away from the source of their addiction—the high that comes from boom times that are assumed to be just around the corner again.

Local economies based on natural resources often go through boom and bust periods from

fluctuations in resource availability, cost of exploitation, or the price that the resource brings at market.

In the Gulf, boom years of the 1970s were followed by bust years of the 1980s, and periodic upswings and downswings ever since. During the upswings, people were living high, and during the downswings, they were waiting for the next upswing. On the Gulf Coast, oil-patch workers returned to shrimping, fishing, or other traditional coastal trades during downswings, and they entered back into the oil and gas industry when jobs were available. In addition to the skilled workforce of people who knew their way around water and boats, local investments in boat building and repair, maritime supply, and other businesses tied to the oil patch have made their home on the Gulf Coast and become part of the locally addicted economy.

What is remarkable about the BP disaster is that in the face of this unprecedented event, addictive behavior is still manifest. When the federal government imposed a ban on further deep-water exploration, a chorus of opposition arose from the Gulf. Local and state political leaders, chambers of commerce, and oil-industry workers rose up in protest. Big Oil may have encouraged opposition to the ban, but it did not have to take the lead publicly in this campaign because such a broad cross-spectrum of supporters was available. Few arguments were

offered to counter the Big Oil position that a return to business as usual was the best way to assure economic recovery of the Gulf. Even in the immediate aftermath of the disaster that affected commercial and recreational fisheries and coastal tourism, Gulf Coast communities in Alabama, Mississippi, and Louisiana were unwilling to abandon their addiction to oil. However, Florida prohibits petroleum production in state waters, and this prohibition forestalled exploration in the eastern Gulf. Alabama, Mississippi, and Louisiana are committed to oil and gas production for the jobs and tax revenues generated. According to the Alabama Treasury Department, oil and gas royalties have created a $2.5 billion trust fund for Alabama [2]. The federal government shares a similar economic incentive to ensure that the oil and gas industries keep pumping, and it has the added incentive of promoting the Gulf as a source of domestic energy.

When does addictive behavior take an ugly turn and become something else? We have already turned that corner by agreeing to increase risk by drilling in deeper and deeper waters to ensure we get our petroleum fix. Big Oil is not out front pushing this agenda, but rather local and state political leaders and oil-patch workers who are addicted to oil have taken the lead. The rest of us, myself included, are hooked on cheap energy and can barely imagine

life without it. So the cries of coastal addicts resonate broadly throughout society, and we embrace the Faustian bargain made with Big Oil. A Faustian bargain involves selling one’s soul to the devil for immediate gratification at the expense of long-term pain. Not everyone who lives on the Gulf Coast is a party to such bargains, but the list of those who have willingly agreed to this bargain is extensive. At the top of the list would be the state and federal governments that lease drilling rights even though they know that petroleum entails risks that are becoming increasingly serious now that the easily accessible oil has been taken. Lease sales and royalties generate a large amount of money, assuring political support for pushing the envelope of safety and 125 encouraging uncritical trust in promises of increased technological proficiency and regulatory oversight to protect public interest. But as Charles Perrow pointed out in Normal Accidents, technological advance is no guarantee that humans and their organizations (corporate and regulatory) will behave as expected [3]. The result: accidents happen. This is indeed the normal state of affairs. Our leaders wave their hands and promise reform, our corporations express remorse and promise to do better next time, and we the public believe them because we are blinded by our addiction and are willing participants in this Faustian bargain upon which our economy is based.

Photo by Linda Bailey

delta

estuary

intertidal zone

Glossary coastal zone. The area around continents that lies between the shoreline (the interface point of land, water, and air) and the outer edge of the continental shelf [1].

126 Coastal Zone

Continental Shelf Coast

Continental Slope

Continental Rise

Ocean

continental shelf. The zone that borders a continent, extending from the line at which land is immersed to a depth of about 650 feet. At about 650 feet, the land shifts; it steeply slopes to greater depths—the continental slope [2]. continental slope. The downward slope— markedly steeper than the slope of the continental shelf—from the shelf to the ocean depths [3].

Photo by Liam M. Higgins

marsh

Photo by Graham D. Schuster

salt marsh

delta. A triangle-shaped deposit of alluvial soil at a river’s mouth. Deltas form because tides and currents do not remove sediment as quickly as it is deposited [4]. estuary. The part of a river that is affected by tides. Here, river freshwater mixes with ocean saltwater; estuary water tends to be brackish (somewhat salty) [5]. intertidal zone. The area that is above water at low tide and under water at high tide. That is, it is the area between the low- and high-water marks.

Photo by Simon Huguet

tidal marsh

It is also known as the littoral zone. Typical habitat varieties include beaches and wetlands [6], [7]. marsh. A wetland, common at the mouths of rivers, where plant and animal communities have adapted to periodic flooding (either seasonal or tidal). Typical plants include grasses, rushes, reeds, and other herbaceous (nonwoody) plants. [8]. salt marsh. A marsh for which the salinity of the tide determines the plant and animal communities. Salt marshes occur in the intertidal zone [9].

wetlands

tidal marsh. A marsh for which flooding is determined by a tide from an adjacent estuary, sea, or ocean. In the United States, tidal marshes are present down the coast from Maine to Florida and from Florida around the Gulf of Mexico to Texas [8]. wetlands. Land for which water saturation dominates soil development, as well as the varieties of plant and animal communities that live in and on the soil. Wetlands include swamps, bogs, and marshes [10].

127

Works Cited Biggs, pages 14–19

Bishop et al., pages 38–44

1. Paul Hawken, Amory Lovins, and L. Hunter Lovins, Natural Capitalism: Creating the Next Industrial Revolution (Boston: Little, Brown and Company, 1999).

1. John James Audubon, “The Florida Keys,” in John James Audubon: Selected Journals and Other Writings, ed. Ben Forkner (New York: Penguin Books, 1996), 451–55.

2. Donella H. Meadows, Thinking in Systems: A Primer (White River Junction, VT: Chelsea Green Publishing, 2008).

2. John James Audubon, Mississippi River Journal in Audubon: Writings and Drawings, ed. Christopher Irmscher (New York: Literary Classics of the United States, 1999).

3. Charles Dickens, American Notes, in The Works of Charles Dickens, eds. Charles Dickens, John Forster, and Andrew Lang (London: Chapman & Hall, 1898), 1–303.

128

4. John M. Barry, Rising Tide: The Great Mississippi Flood of 1927 and How It Changed America (New York: Simon and Schuster, 1997).

5. Joel K. Bourne, “Gone with the Water,” National Geographic, October 2004, http://environment.nationalgeographic.com/ environment/habitats/gone-with-wetlands/#page=1 6. National Wetlands Region Center, National Wetlands Research Center Open File Report 94-01, accessed November 12, 2011, lacoast.gov/new/Pubs/Report_data/NWRC-OFR94.aspx.

Profile: Clement and Hayworth, pages 22–24 1. Joel S. Hayworth and T. Prabhakar Clement, “BP’s Operation Deep Clean—Could Dilution Be the Solution to Beach Pollution?” Environmental Science & Technology 45 (April 2011): 4201–02.

2. Joel. S. Hayworth, T. Prabhakar Clement, and John F. Valentine, “Deepwater Horizon Oil Spill Impacts on Alabama Beaches,” Hydrology and Earth System Sciences Discussions 8 (2011): 6721–47.

3. John James Audubon, “Brown Pelican,” in The Bird Biographies of John James Audubon, ed. Alice Ford (New York: MacMillan Co., 1957), 3–6.

4. Daniel Patterson, ed., John James Audubon’s Journal of 1826: The Voyage to The Birds of America, (Lincoln, NE: University of Nebraska Press, 2011).

Lupoli, pages 48–57 1. Douglas Kysar, “When Claims Clash With Culture,” PressRegister (Mobile, AL), January 2, 2011.

2. My-Thuan Tran, “Oil Spill May Be Sinking His Ship; From the Coast of Vietnam to the Waters of Louisiana, All Kha Van Nguyen Needed Was Shrimping and the Sea. But Now What?”

Los Angeles Times, August 16, 2010.

3. Chua Chin Hon, “Neglected Victims of the Oil Spill,” The Straits Times (Singapore), August 1, 2010.

Path of the Storms: Bayou La Batre, Coden and the Alabama Coast (Auburn, AL: Pebble Hill Books, 2008).

6. Christopher Lupoli and E. McDade, “An Assessment of the Resilience of Alabama Coastal Communities Affected by the 2010 Deepwater Horizon Oil Spill.” Poster presented at the 3rd Annual Poster Session of the Mobile Bay Watershed Project, Auburn, AL, May 5, 2011, http://www.ag.auburn.edu/agec/agrifood/teaching/MobileProject/documents/Resilience%20%282011%29.pdf.

7. John Hannigan, Environmental Sociology, 2nd ed. (London: Routledge, 2006).

8. Patricia Widener and Valerie J. Gunter, “Oil Spill Recovery in the Media: Missing an Alaska Native Perspective,” Society & Natural Resources 20 (2007): 767–83.

9. Jeffrey L. Levin, Karen Gilmore, Ann Carruth, Matthew W. Nonnenmann, William Evert, and Denae King, “An Interview With Vietnamese Fishermen of Louisiana in the Wake of the Oil Spill,” Journal of Agromedicine 15 (2010): 337–42.

10. G. David Johnsonn, Cecelia Formichella, J. Stephen Thomas, Dulal Bhaumik, Frank Verlion Degruy III, and Catherine A. Riordan, “Stress and Distress among Gulf of Mexico Shrimp Fishermen,” Human Organization 15, no. 4 (1998): 404–13.

Profile: Arias, pages 76–77

4. Mark Moberg and J. Stephen Thomas, “Class Segmentation and Divided Labor: Asian Workers in the Gulf of Mexico Seafood Industry,” Ethnology 31 (1993): 87.

1. Paul S. Mead, Laurence Slutsker, Vance Dietz, Linda F. McCaig, Joseph S. Bresee, Craig Shapiro, Patricia M. Griffin, and Robert V. Tauxe, “Food-related Illness and Death in the United States,” Emergent Infectious Diseases 5 (1999): 607–25.

5. Frye Gaillard, Sheila Hagler, and Peggy Denniston, In the

2. Mark S. Strom and Rohinee N. Paranjpye, “Epidemiology

and Pathogenesis of Vibrio vulnificus,” Microbes and Infection 2 (2000): 177–88.

3. NOAA, “Tarballs: What are they and how do they form?”

(November 2006), accessed October 15, 2008, http://sero.nmfs.noaa.gov/sf/deepwater_horizon/tarballs.pdf.

4. Alfred Young Itah and Joseph P. Essien, “Growth Profile and Hydrocarbonoclastic Potential of Microorganisms Isolated from Tarballs in the Bight of Bonny, Nigeria,” World Journal of Microbiology & Biotechnology 21 (2005): 1317–22.

5. Zhen Tao, Stephen Bullard, and Covadonga Arias, “High Numbers of Vibrio vulnificus in Tar Balls Collected from within Oiled Areas of the North-Central Gulf of Mexico following the 2010 BP Deepwater Horizon Oil Spill,” EcoHealth 8 (November 2011), DOI: 10.1007/s10393-011-0720-z.

Bobrowski and McEldowney, pages 78–81 1. “2010 Demographic Profile: AL–Bayou La Batre City,” United States Census Bureau, accessed June 29, 2011, http://www. census.gov/popfinder/index.php?fl=0104684.

2. “Unemployment Statistics: Mobile County Civilian Labor Force,” Alabama Department of Industrial Relations, accessed June 29, 2011, http://www2.dir.state.al.us/LAUS/CLF/ALUS.aspx.

3. Tanner Lathan, “Alabama and the Oil Spill: Bayou La Batre,” NPR podcast audio, December 23, 2010. Accessed June 29, 2011, http://wbhm.org/News/2010/bayoufoodpantry.html.

4. Xavier Bosch, “Exposure to Oil Spill Has Detrimental Effect on Clean-up Workers’ Health,” Lancet 361 ( January 2003): 147.

5. National Commission on the BP Deepwater Horizon Oil Spill and Offshore Drilling, Report to the President, Deep Water: The Gulf Oil Disaster and the Future of Offshore Drilling (2010), accessed March 14, 2011, http://www.oilspillcommission. gov/sites/default/files/documents/DEEPWATER_ ReporttothePresident_FINAL.pdf.

6. Ronan A. Lyons, J. Mark Temple, Daphne Evans, David L. Fone, and Stephen R. Palmer, “Acute Health Effects of the Sea Empress Oil Spill,” Journal of Epidemiology and Community Health 53 (1999): 306–10.

7. Berta Suárez, Virginia Lope, Beatriz Pérez-Gómez, Nuria Aragonés, Fernando Rodríguez-Artalejo, F. Marqués, Asunción Guzmán, José Luis Viloria, José Miguel Carrasco, José M. Martín-Moreno, et al., “Acute Health Problems among Subjects Involved in the Cleanup Operation Following the Prestige Oil Spill in Asturias and Cantabria (Spain),” Environmental Research 99 (2005): 413–24.

8. Riki Ott, “Bio-Remediation or Bio-Hazard? Dispersants, Bacteria, and Illness in the Gulf,” HuffPost Green (blog), The Huffington Post, September 17, 2010, http://www.huffingtonpost.com/riki-ott/bio-remediation-or-bio-ha_b_720461.html.

9. Margaret A. McCoy and Judith A. Salerno, Assessing the Effects of the Gulf of Mexico Oil Spill on Human Health: A Summary of the June 2010 Workshop (Washington DC: National Academies Press, 2010).

10. National Institute for Occupational Safety and Health, NIOSH Report of Deepwater Horizon Response/Unified Area Command Illness and Injury Data (April 23–July 27, 2010) (August 2010), accessed March 14, 2011, http://www. cdc.gov/niosh/topics/oilspillresponse/pdfs/NIOSHrotBPilnessAndInjuryDataApril23-july27-2010.pdf.

Johnson et al., pages 86–89 1. Elana Schor, “Ingredients of Controversial Dispersants Used on Gulf Spill Are Secrets No More,” New York Times, June 9, 2010.

2. “Safe and Sustainable Seafood Supply,” Mississippi–Alabama Sea Grant Legal Program, accessed October 23, 2011, http://www.masgc.org/page.asp?id=189.

3. Michael P. Dieter, NTP Technical Report on Toxicity Studies of Ethylene Glycol Ethers 2-Methoxyethanol, 2-Ethoxyethanol,

2-Butoxyethanol (CAS Nos. 109-86-4, 110-80-5, 111-76-2) Administered in Drinking Water to F344/N Rats and B6C3F1 Mice (Research Triangle Park, NC: NIH, 1993).

4. Shahunthala D. Ramachandran, Peter V. Hodson, Colin W. Khan, and Ken Lee, “Oil Dispersant Increases PAH Uptake by Fish Exposed to Crude Oil,” Ecotoxicology and Environmental Safety 59, no. 3 (2004): 300–08.

5. Karen G. Burnett, Lisa J. Bain, William S. Baldwin, Gloria V. Callard, Sarah Cohen, Richard T. Di Giulio, David H. Evans, et al., “Fundulus as the Premier Teleost Model in Environmental Biology: Opportunities for New Insights Using Genomics,” Comparative Biochemistry and Physiology Part D: Genomics and Proteomics 2, no. 4 (2007): 257–86.

Ross and Baker, pages 98–103 1. Richard Kerr, Eli Kintisch, and Erik Stokstad, “Will Deepwater Horizon Set a New Standard for Catastrophe?” Science 328 (May 2010): 674–675.

2. “Gulf Spill Hair Boom Program 2010,” Matter of Trust, accessed July 18, 2011, http://matteroftrust.org/630/gulf-spillhair-boom-program-2010-closed-see-our-hair-fur-fleece-boomsfree-kits-for-schools-program-above.

3. Michael Keating, “Product with Long History Is Fighting Gulf Spill,” GovPro, last modified June 24, 2010, accessed July 18, 2011, http://govpro.com/public_works/content/oil-absorbentbooms-20100624/.

4. Erik Stokstad, “Politics Buried Science in Louisiana Sand Berms,” Science, last modified December 17, 2010, accessed December 20, 2010, http://news.sciencemag.org/scienceinsider/2010/12/politics-buried-science-in-louisana.html.

5. Erik Stokstad and Richard A. Kerr, “Government Chided for Poor Planning and Communication,” Science, last modified October 15, 2010, accessed December 20, 2010, http://www.erf. org/system/files/GOM.gov_.chided.in_.reports.pdf.

129

6. Roy Schwartzman, Derek G. Ross, and David M. Berube, “Rhetoric and Risk,” POROI 7 (2011).

7. Frank Fischer, “Risk Assessment and Environmental Crisis: Toward an Integration of Science and Participation,” in Readings in Planning Theory, eds. Scott Campbell and Susan Fainstein (Malden, MA: Blackwell, 1992), 485–506.

8. W. Michele Simmons, Participation and Power: Civic Discourse in Environmental Policy Decisions (New York: State University of New York Press, 2007).

9. Clay Spinuzzi, “The Methodology of Participatory Design,” Technical Communication 52, no. 4 (2004): 163–174.

10. Carol M. Barnum, Usability Testing Essentials (New York: Elsevier/Morgan Kaufman, 2011).

11. Wendell Berry, “Think Little,” in The Art of the Commonplace: The Agrarian Essays of Wendell Berry, ed. Norman Wirzba (Washington, DC: Counterpoint, 2002), 81–90.

130

12. Brian Wynne, “Misunderstood Misunderstanding: Social Identities and Public Uptake of Science,” Public Understanding of Science 1 (1992): 281–304.

17. Daniel Kemmis, “Fostering Citizen Participation Towards a Culture of Cooperation: Barn Building and the Economy of the West,” National Civic Review 76 (1987): 142–146.

18. Fikret Berkes, “Rethinking Community-Based Conservation,” Journal of Conservation Biology 18, no. 3 (2004): 621–630.

19. Ray Mabus, “America’s Gulf Coast: A Long Term Recovery Plan after the Deepwater Horizon Oil Spill,” accessed November 12, 2010, http://www.restorethegulf.gov/sites/default/files/ documents/pdf/gulf-recovery-sep-2010.pdf.

20. John Gaventa, Power and Powerlessness: Quiescence and Rebellion in an Appalachian Valley (Urbana, IL: University of Illinois Press, 1980).

21. Iris Marion Young, Justice and the Politics of Difference (Princeton: Princeton University Press, 1990).

22. Martin W. Bauer, Nick Allum, and Steve Miller, “What Can We Learn from 25 Years of PUS Survey Research? Liberating and Expanding the Agenda,” Public Understanding of Science 16, no. 6 (2007): 79–95.

Hanson and Baker, pages 106–112

13. Coastal Recovery Commission, “A Roadmap to Resilience: Towards a Healthier Environment, Society and Economy for South Alabama,” accessed December 30, 2010, http://www.masgc.org/gmrp/documents/oilcrc.pdf.

1. Mobile Bay National Estuary Program, State of Mobile Bay: A Status Report on Alabama’s Coastline from the Delta to Our Coastal Waters, accessed October 17, 2011, http://www.mobilebaynep. com/images/uploads/library/State-of-Mobile-Bay-Final.pdf.

14. Shelia Hodges, Full Coastal Recovery Commission Meeting, October 26, 2010.

2. John W. Tunnell, An Expert Opinion of When the Gulf of Mexico Will Return to Prespill Harvest Status Following the BP Deepwater Horizon MC 252 Oil Spill, accessed October 17, 2011, from http://www.harteresearchinstitute.org/images/oil_spill/ gccf_final_report.pdf.

15. John W. Tunnell, “An Expert Opinion of When the Gulf of Mexico Will Return to Prespill Harvest Status Following the BP Deepwater Horizon MC 252 Oil Spill,” accessed February 10, 2011, http://www.harteresearchinstitute.org/images/oil_spill/ gccf_final_report.pdf.

16. Brock Long, Road to Restoration: Oil Spill Forum, October 5, 2010.

3. Alabama Waterfront Access Study Committee, Final Report to the Alabama State Legislature, accessed October 17, 2011, http://www.masgc.org/pdf/workwater/WASC2011.pdf.

4. Economic Modeling Services, Inc., accessed October 17, 2011, http://www.economicmodeling.com.

5. R. Wes Harrison and Dennis Degeneffe, Tracking Consumer Attitudes Toward Seafood Safety Resulting from the Gulf Oil Spill, accessed October 17, 2011, http://louisianaseafood.com/pdf/ LSPMBSeafoodPhaseI-FinalVersion.pdf.

6. Oil Disaster Recovery Program Advisory Committee, Summary Report on Seafood Industry and Consumer Study, accessed October 17, 2011, http://www.aces.edu/dept/fisheries/aquaculture/marine-assessment/reports.php.

7. Alabama Tourism Department, Travel Economic Impact Report 2009, accessed October 17, 2011, http://www.alabama.travel/ media/media_room/Report/2009TourismReport.pdf.

8. “Alabama Gulf Coast Center for Visitor’s Bureau Statistics,” Alabama Gulf Coast Convention & Visitors Bureau, accessed October 17, 2011, http://www.agccvb.org/stats/.

9. Michael Dumas, “Bon Jovi ‘Lays His Hands’ on Tens of Thousands at Gulf Shores,” Alabama Live, last modified October 15, 2010, accessed October 17, 2011, http://blog.al.com/ entertainment-press-register/2010/10/bon_jovi_lays_his_ hands_on_ten.html.

10. Kim Chapman, “Occupancy Figures Suggest Robust July 4th Weekend for Alabama Beaches,” Gulf Shores & Orange Beach Tourism, accessed October 17, 2011, http:// www.gulfshores.com/pressroom/releases_print_topframe. aspx?ID=535&type=press.

11. Mississippi Development Authority, accessed October 17, 2011, http://www.mississippi.org/.

12. Haas Center for Business Research & Economic Development, accessed October 17, 2011, http://haas.uwf.edu/.

13. Klages Group, accessed October 17, 2011, http://www.cvbsurvey.com/Market%20Research.htm.

Werner and Locke, pages 114 –121

Bailey, pages 124–125

1. Rosemary A. Thompson, Crisis Intervention and Crisis Management: Strategies That Work in Schools and Communities (New York: Brunner-Routledge, 2004).

1. William R. Freudenburg, “Addictive Economies: Extractive Industries and Vulnerable Localities in a Changing World Economy,” Rural Sociology 57, no. 3 (1992): 305–32.

2. Julia S. Chibbaro and C. Marie Jackson, “Helping Students Cope in an Age of Terrorism: Strategies for School Counselors,” Professional School Counseling 9, no. 4 (2006): 314–21.

2. State Treasurer of Alabama, “Alabama Trust Fund 101,” accessed October 20, 2011, http://www.treasury.state.al.us/ content/Documents/Alabama%20Trust%20Fund%20101.pdf.

3. Noriko Kawana, Shin-ichi Ishimatsu, and Katsuya Kanda, “Psycho-physiological Effects of the Terrorist Sarin Attack on the Tokyo Subway System,” Military Medicine 166, no. 2 (2001): 23–26.

3. Charles Perrow, Normal Accidents: Living with High-Risk Technologies (New York: Basic Books, 1984).

4. James Halpern and Mary Tramontin, Disaster Mental Health: Theory and Practice (Belmont, CA: Brooks/Cole, 2007).

5. Diane Myers and David F. Wee, Disaster Mental Health Services, Psychological Stress Series (New York: Brunner-Routledge, 2005).

6. “36542 Zip Code Detailed Profile,” City-Data.com, accessed October 26, 2011, http://www.city-data.com/zips/36542.html.

7. “36509 Zip Code Detailed Profile,” City-Data.com, accessed October 26, 2011, http://www.city-data.com/zips/36509.html.

8. Laura Moss, “The 13 Largest Oil Spills in History,” Mother Nature Network, accessed July 16, 2010, http://www.mnn.com/ earth-matters/wilderness-resources/stories/the-13-largest-oilspills-in-history.

9. Gerald Caplan, Principles of Preventive Psychiatry (New York: Basic Books, 1964).

10. Kendal Johnson, School Crisis Management: A Hands-on Guide to Training Crisis Response Teams (Alameda, CA: Hunter House, 1993).

11. J. Barry Mascari, “The Best Laid Plans: Will They Work in a Real Crisis?” in Terrorism, Trauma and Tragedies: A Counselor’s Guide to Preparing and Responding, eds. Debra Bass and Richard Yep (Alexandria, VA: American Counseling Association Foundation, 2002), 39–51.

Glossary, pages 126–127 1. Glossary of Coastal Terminology, s.v. “coastal zone,” accessed November 4, 2011, http://www.ecy.wa.gov/programs/sea/ swces/products/publications/glossary/words/A_C.htm#C. 2. Glossary of Coastal Terminology, s.v. “continental shelf,” accessed November 4, 2011, http://www.ecy.wa.gov/programs/ sea/swces/products/publications/glossary/words/A_C.htm.

3. Glossary of Coastal Terminology, s.v. “continental slope,” accessed November 4, 2011, http://www.ecy.wa.gov/programs/ sea/swces/products/publications/glossary/words/A_C.htm.

4. Glossary of Coastal Terminology, s.v. “delta,” accessed November 4, 2011, http://www.ecy.wa.gov/programs/sea/ swces/products/publications/glossary/words/D_G.htm.

5. Glossary of Coastal Terminology, s.v. “estuary,” accessed November 4, 2011, http://www.ecy.wa.gov/programs/sea/ swces/products/publications/glossary/words/D_G.htm#E 6. Glossary of Coastal Terminology, s.v. “intertidal,” accessed November 4, 2011, http://www.ecy.wa.gov/programs/sea/ swces/products/publications/glossary/words/H_M.htm#I. 7. Dictionary.com, s.v. “intertidal zone, ” accessed November 4, 2011, http://en.wikipedia.org/wiki/Intertidal_zone.

Photo for intertidal zone by Linda Bailey. Licensed for reuse

under the Creative Commons Attribution-ShareAlike 2.0 License, http://creativecommons.org/licenses/by-sa/2.0/deed.en.

8. “Marshes,” United States Environmental Protection Agency, last modified September 29, 2011, accessed November 4, 2011, http://water.epa.gov/type/wetlands/marsh.cfm#tidal.

Photo for tidal marsh by Simon Huguet. Licensed for reuse under the Creative Commons Attribution-ShareAlike 2.0 License, http://creativecommons.org/licenses/by-sa/2.0/deed.en.

9. Ecomii Science Encyclopedia, s.v. “salt marsh,” accessed November 4, 2011, http://www.ecomii.com/science/encyclopedia/salt-marsh.

Photo for salt marsh by Graham D. Schuster. Licensed for reuse under the Creative Commons Attribution-ShareAlike 3.0 License, http://creativecommons.org/licenses/by-sa/3.0/deed.en.

10. Glossary of Coastal Terminology, s.v. “wetlands,” accessed November 4, 2011, http://www.ecy.wa.gov/programs/sea/ swces/products/publications/glossary/words/U_Z.htm#W.

Captions for “The Gulf” pictures Pelicans at Fort Morgan, p. 45, Laura Tangley, “Oil Spill Puts Pelicans at Risk,” National Wildlife Federation, last modified July 16, 2010, http://www.nwf.org/News-and-Magazines/NationalWildlife/Birds/Archives/2010/Pelicans-Oil.aspx.

Sea Star, p. 75, Earth Gauge, “Gulf Oil Spill Series: Effects on Invertebrates,” accessed February 2, 2012, http:// www.earthgauge.net/wp-content/EG_Gulf_Invertebrates.pdf.

Pier at Gulf State Park, p. 85, Jeff Amy, “Oil Spill Attracts Some People to the Gulf State Park Pier,” Press-Register (Mobile, Alabama), June 13, 2010.

Auburn University Shellfish Laboratory, p. 113, Larry Filmer, Pat Curtis, and Leslie Parsons, Auburn University Response Capabilities Regarding Deepwater Horizon Oil Spill, accessed February 15, 2012, last modified July 6, 2010, http://ocm.auburn.edu/news/gulf_oil_spill_response.pdf.

131

Contributor Biographies Christopher J. Anderson is an assistant professor in the School of Forestry and Wildlife Sciences and the associate director of the Center for Forest Sustainability at Auburn University. He received his PhD in natural resources from The Ohio State University. His research is focused on how urban land use and other human activities influence wetland and riparian function.

Cova Arias is an associate professor in the 132 Department of Fisheries and Allied Aquacultures.

Her research focuses on the interactions between aquatic pathogens and their hosts, including freshwater and marine organisms. Some of her recent work has been published in Marine Biotechnology, Journal of Fish Diseases, International Journal of Food Microbiology, and Journal of Food Protection.

Conner Bailey is a professor of rural sociology in the College of Agriculture and president of the Rural Sociological Society. His research focuses on problems of persistent poverty associated with resource dependence as well as the emergence

of grassroots social movements related to environmental and natural-resource issues. He has been working on coastal wetlands restoration in Louisiana with the Army Corps of Engineers, the United States Geological Survey, the National Audubon Society, the National Wildlife Society, and the Environmental Defense Fund.

Jeana Baker is a graduate research assistant in applied economics in the College of Agriculture.

She joined the task force for disaster assistance in the wake of the BP oil spill. Baker’s background in natural-resource economics has led to her work on sustainable outreach programs in her hometown of Salmon, Idaho, and tropical beekeeping in Benin, West Africa.

Lindy Biggs teaches the history of technology and environmental history in Auburn University’s Department of History. She is also the founding director of the university’s Office of Sustainability, which she directed for nine years. She earned her PhD from Massachusetts Institute of Technology

and has degrees in psychology, sociology, history, and urban planning. Thus, she has a background well suited for the interdisciplinary work of sustainability.

Scott Bishop is the curator of education and the university liaison at Auburn University’s Jule Collins Smith Museum of Fine Art, where she also curates the Louise Hauss and David Brent Miller Audubon collection. She studied philosophy and English at Auburn University and art history at Emory University.

Paula Bobrowski is a professor in the Department of Political Science and the associate dean of research, faculty development, and graduate studies in the College of Liberal Arts.

She holds a BSN from Oregon Health & Science University, an MBA from the University of Oregon, and a PhD from Syracuse University. Some of her recent work can be found in Journal of Technology Transfer, Journal of Technological Forecasting and Social Change, and Journal of Leadership Studies.

Ash Bullard is an assistant professor in the Department of Fisheries and Applied Aquacultures at Auburn University. He loves parasites. He and his students observe how aquatic animals and their symbionts interact with one another to study biodiversity patterns and how ecosystems function.

Lately, they have focused their efforts on assessing the environmental impacts of the BP oil spill.

T. Prabhakar Clement is a full professor and holds the Arthur H. Feagin chair in the Department of Civil Engineering at Auburn University. He has served as associate editor of four leading groundwater and hydrology journals, and some of his most recent work can be found in Advances in Water Resources Journal, Water Resources Research, and Journal of Hydrology.

Dennis DeVries is a professor in the Department of Fisheries and Allied Aquacultures at Auburn University. He received a PhD from The Ohio State University. His research interests lie at the interface between the basic field of ecology and the applied fields of fisheries and natural-resource management. For more than 20 years, he has conducted research in all types of water bodies in Alabama, and he has published nearly 70 scientific papers on his research.

Dewey W. English, Jr. earned a journalism degree from Auburn University in 1979 and since then has served in reporting and editing roles at newspapers including the Jackson Daily News/ The Clarion-Ledger of Jackson, Mississippi; The Morning Advocate of Baton Rouge, Louisiana; The Courier-Journal of Louisville, Kentucky; and the Press-Register of Mobile, Alabama. In 2011, the journalism awards program at Auburn University honored him as a distinguished alumnus.

Yucheng Feng is a professor in the Department of Agronomy and Soils. Her research program focuses on microbial processes that are important to environmental quality and soil productivity.

She studies microbial degradation of organic pollutants, fecal contamination in surface waters, and soil-microbial community structure in agricultural and forest ecosystems.

Barry Fleming is an associate professor in the Department of Art. He served as the department chair for three years. For 13 years, as the director of the department’s exhibition and lecture program,��������������������������������������������� he curated, originated, and �������������������� provided exhibition design for more than 300 art exhibitions. He also brought numerous scholars and artists to Auburn University’s campus. His paintings have

been exhibited in solo, invitational, and competitive exhibitions.

Chad Foradori is an assistant professor in the Department of Anatomy, Physiology, and Pharmacology. He received a PhD from the College of Medicine at the University of Cincinnati. His research focuses on the neuroendocrine control of reproduction, specifically the factors that mediate the release of hormones and gonadotropins from the anterior pituitary.

He has published in journals such as Biology of Reproduction and Endocrinology.

Allen Furr is a professor in and the chair of the Department of Sociology, Anthropology, and Social Work. He holds graduate degrees in sociology from Stephen F. Austin University and Louisiana State University. He also holds a master’s degree in social work from the University of Louisville. In 2005, he was awarded a Fulbright scholarship to teach at Punjabi University in Patiala, India. His research focuses on the sociology of health, particularly mental health, and his work has been published in journals of psychiatry, medicine, nursing, social work, as well as sociology. Furr is coeditor of the 2012 issue of Auburn Speaks.

133

Jay Gogue began his tenure as Auburn University’s eighteenth president in July 2007. The Waycross, Georgia, native is a two-time Auburn graduate, receiving a bachelor’s degree in 1969 and a master’s degree in 1971. In 1973, he earned a doctorate from Michigan State University. Prior to arriving at Auburn, he served as president of New Mexico State University (beginning in 2000), and in 2003, he was named president of the University of Houston and chancellor of the University of Houston System.

Candis Hacker Birchfield is an Auburn University graduate and the communications edi134 tor for the College of Sciences and Mathematics, or COSAM. Birchfield has written numerous feature articles on the scientific research, events, and personalities found in COSAM. She is also the college’s official photographer and designer. The daughter of an English teacher, Birchfield’s true passion is writing, so in addition to working for COSAM, she is a freelance writer.

Ken Halanych received his PhD from the University of Texas and is an alumni professor in the Department of Biological Sciences. His research focuses on molecular systematics, phylogeography, and evolution of marine invertebrates.

His ongoing research investigates the response of organisms to the oil and dispersants left in the Gulf of Mexico after the BP oil spill. To date, he has authored nearly 80 articles in publications such as Science, Evolution and Development, Annual Reviews of Ecology and Systematics, and Systematic Biology.

He is also the faculty coordinator and liaison for marine biology.

Terry Hanson is an extension specialist and associate professor in the Department of Fisheries and Allied Aquacultures. He is interested in economic analysis applied to aquaculture production and marketing, reservoir management and valuation, and marine coastal economies. Some of his recent work can be found in Natural Hazards Review, Journal of Food Distribution Research, Journal of the World Aquaculture Society, and Resource Economics Review. He currently teaches a variety of special-problem courses and aquaculture economics at Auburn University.

Joel S. Hayworth is an associate research professor in the Department of Civil Engineering.

Before joining Auburn University, he spent seven years as a research scientist at the United States Air Force Research Laboratory. There he conducted basic and applied research related to

petroleum hydrocarbons, chlorinated solvents, and surfactants in environmental systems. His current research program is focused on the environmental fate of oil released as a result of the Deepwater Horizon accident, focusing on sandy-beach and nearshore systems in the Gulf of Mexico.

Geoffrey Hill is an ornithologist and professor of biology. He is coeditor of two scholarly volumes on bird coloration and the author of three other books: A Red Bird in a Brown Bag, Ivorybill Hunters and, most recently, National Geographic Bird Coloration. He earned his PhD from the University of Michigan. He was recently awarded the Creative Research Award for his achievements in biology research.

Katie Jackson is the chief editor for the College of Agriculture and the Alabama Agricultural Experiment Station. She has more than 25 years of experience reporting on science, agriculture, and the environment. She is author or coauthor of four books and has published many articles in both newspapers and magazines. She holds a bachelor’s degree in agricultural journalism and a master’s degree in public administration, both from Auburn University.

Calvin M. Johnson is a professor in and the acting dean of the College of Veterinary Medicine.

His research interests include infectious diseases, immunology, and anatomic pathology. His laboratory investigates the pathogenesis of natural and experimental diseases, including those related to environmental toxins and infectious diseases.

He has published in journals such as the Journal of Infectious Diseases, American Journal of Veterinary Research, and Veterinary Pathology.

Bernhard Kaltenboeck, a professor in the College of Veterinary Medicine, received his PhD from Louisiana State University. In 1994, he joined the faculty at Auburn University.

His research focuses on the development of vaccines to combat chlamydial infections and diseases in both livestock and humans. His studies of cattle and mice have led to the identification of vaccine-candidate genes. In 2006, he established the College of Veterinary Medicine’s Molecular Diagnostics Laboratory.

Mike Kensler is the director of Sustainability Operations at Auburn University. He works to cultivate an ethic and practice of sustainability at Auburn and beyond. He is committed to an aspirational, future-focused approach and has a

strong interest in helping organizations of learning achieve a sustainable future. He has worked on a wide range of watershed, land-use, habitat, and other water-related issues, and he currently serves as the president of the board of directors for the Alabama Water Watch Association.

Jay Lamar is the director of the Caroline Marshall Draughon Center for the Arts & Humanities. The center strengthens the bonds between the College of Liberal Arts and the public by creating and implementing arts and humanities programs that explore our individual and collective experiences, values, and identities through the past, in the present, and for the future. The center also creates occasions and space for dialogue, intellectual community, and cross-disciplinary scholarship. Lamar is a member of the Auburn Speaks editorial board, and the coeditor of the 2012 issue of Auburn Speaks.

Ming-Kuo Lee is a professor of geology at Auburn University. He holds a PhD in geology from the University of Illinois at Urbana– Champaign. His research interests focus on hydrology, environmental geochemistry, and global climate change. He is the principal investigator of the National Science Foundation RAPID project

for assessing chemical changes in Gulf salt marshes resulting from the BP oil spill.

Chris Locke is an assistant professor in the Department of Sociology, Anthropology, and Social Work. He received a PhD in social work in 2010 from The Ohio State University. He focuses his research on treatment for domestic-violence offenders as well as the stigma of mental illness, particularly the impact of the media on stigma and recovery.

Kelsey Loftin is a graduate assistant in the Master of Technical and Professional Communication program in Auburn University’s Department of English. She holds a degree in English with a minor in creative writing from Huntingdon College. She serves as an editorial assistant for Auburn Speaks.

Christopher Lupoli is a PhD student in the School of Forestry and Wildlife Sciences. His primary research focuses on the social and ecological impacts of conservation-oriented volunteer tourism, with a particular emphasis on Latin America.

He has worked and volunteered in numerous conservation, ecotourism, and community-development programs in Panama, Ecuador, Nicaragua, Brazil, and Dominica. He has been involved with

135

numerous immigrant communities in the United States, and he now provides support to Spanishspeaking residents of Auburn and Opelika.

Jo Mackiewicz earned a PhD in applied linguistics from Georgetown University. She teaches technical editing in the Master of Technical and Professional Communication program at Auburn University. Her research applies linguistics to technical communication and focuses on politeness and credibility in texts such as online reviews.

She was editor-in-chief of IEEE Transactions on Professional Communication. She is the editor of the ATTW Book Series on Technical and Professional 136 Communication. She is the managing editor of the 2012 issue of Auburn Speaks.

John M. Mason, Jr. joined Auburn University in September 2008 as associate provost and vice president for research. He is also the president of the Research and Technology Foundation at Auburn University. He is responsible for researchprogram development, sponsored programs, and technology transfer and commercialization. Prior to joining Auburn University, he was the associate dean for graduate studies, research, and outreach in the College of Engineering at Penn State University. He was a tenured professor of

civil engineering and had served as the director of the Thomas D. Larson Pennsylvania Transportation Institute and as the executive director for the Mid-Atlantic University Transportation Center.

RenĂŠ McEldowney is the director of the Health Administration program, a faculty member in the College of Liberal Arts, and an associate professor in the College of Business at Auburn University. She holds a PhD from Virginia Tech University and an MBA from Marshall University.

Her primary teaching areas are international health-care systems and administration, healthcare reform, insurance and reimbursements, and teaching pedagogy.

Joseph Newton is an associate professor of pathology and received his PhD from Auburn University. He served on the faculty of Louisiana State University School of Veterinary Medicine from 1987 to 1993. In 1993, he returned to Auburn University as a pathologist for aquatic animal species. His main research interest is infectious disease in farm-raised channel catfish. He has published in journals such as Journal of Equine Veterinary Science and Medical Mycology.

Leslie Parsons is a member of the editorial board of Auburn Speaks. She is the director of business operations for the Auburn University Natural Resources Management & Development Institute. Additionally, she is responsible for the marketing, communications, and public-relations activity associated with the Research Program Development Office at Auburn University. She holds a BS in economics from Auburn University.

Derek G. Ross is an assistant professor in the Master of Technical and Professional Communication program. His research interests include perceptions of environment-related rhetoric, audience analysis, and student understanding of research and research methods. Some of his recent work can be found in The Journal of Technical Writing and Communication, Mother Pelican, and Present Tense. He teaches courses in technical writing, document design, and environmental rhetoric at Auburn University.

Kelcie Sharp is a graduate assistant in the Master of Technical and Professional Communication program in the Department of English. She serves as an editorial assistant for IEEE Transactions on Professional Communication and for Auburn Speaks. She holds a BA in English from the University of Tennessee at Chattanooga.

Judith Sheppard is an associate professor of journalism in the Department of Communication & Journalism. She teaches literary journalism and advanced writing and reporting. She has written for 25 years on the arts, crime, and politics for national and regional newspapers and journals and has won numerous awards for fiction and nonfiction. Currently, she is writing a book about courageous Alabama newspaper editors during the civil rights movement.

LaDon Swann is the director of the Mississippi– Alabama Sea Grant Consortium (MASGC) and the director of the Auburn University Marine Extension and Research Center (AUMERC). He is an associate research professor in the Department of Fisheries and Allied Aquacultures. There, he conducts research on and administers extension programs for oyster aquaculture, habitat restoration, and community resilience.

Stephen Szedlmayer is a professor in the Department of Fisheries and Allied Aquacultures.

He studies the ecology and fishery dynamics of marine fish in the northern Gulf of Mexico. He has published many articles on marine fish, ranging from small blennies to large costal sharks. He has been particularly interested in the study of artificial

reefs and their effects on fish populations. His new research projects examine the potential effects of the BP oil spill on marine fish.

Bill Walton is an assistant professor in the Department of Fisheries and Allied Aquacultures and is an extension specialist with Alabama Cooperative Extension. He earned his PhD in fisheries science from the University of Maryland.

His research interests include marine-invertebrate fisheries, restoration, and aquaculture. He is stationed at the Auburn University Marine Extension and Research Center in Mobile, Alabama, and conducts research at the Auburn University Shellfish Laboratory on Dauphin Island, Alabama.

Danilea Werner joined the Department of Sociology, Anthropology, and Social Work in 2009 as an assistant professor of social work after completing her PhD in counseling and family therapy at Saint Louis University. Prior to joining Auburn University, she worked in disaster preparedness and public-health education. She also worked as a clinical therapist. Her research interests include health and wellness issues of older adults and adolescents as well as mental-health disaster preparedness.

Michelle R. Worosz is an assistant professor in the Department of Agricultural Economics and Rural Sociology. She is interested in the interactions between nature and society, and her research is in the areas of food, agriculture, and environment. Some of her recent work can be found in Agriculture and Human Values and Journal of Rural Social Sciences. She currently teaches the courses Food, Agriculture, and Society and Sociology of Natural Resources and Environment.

Russell (Rusty) Wright is an associate professor and extension specialist in the Department of Fisheries and Allied Aquacultures.

He earned a PhD from the University of Wisconsin–Madison. His extension program focuses on pond management, aquatic-resource education, and sport fisheries. His research efforts range from basic aquatic ecology and limnology to fisheries science and management in diverse aquatic systems, including estuaries, rivers, lakes, large reservoirs, and farm ponds.

137

Photo by Jeff Etheridge

138