Biodiversitas vol. 10, no. 3, July 2009 by Biodiversitas Unsjournals

ISSN: 1412-033X (printed edition) ISSN: 2085-4722 (electronic)

FIRST PUBLISHED: 2000

ISSN: 1412-033X (printed edition) 2085-4722 (electronic)

EDITOR-IN-CHIEF: Sutarno

MANAGING EDITORS: Abdel Fattah N. Abd Rabou (arabou@iugaza.edu), Abdulaziz Mohammad Assaeed (assaeed@ksu.edu.sa), Abdul Latiff Mohamad (latiff@ukm.my), Akram Abdel-Moneim Hussien Ali (akrama@ksu.edu.sa), Alan J. Lymbery (a.lymbery@murdoch.edu.au), Ali Saad Mohamed (alisaad48@yahoo.com), Bambang Hero Saharjo (prof.saharjo@gmail.com), Charles H. Cannon Jr. (chuck@xtbg.ac.cn), Edi Rudi (edirudi@yahoo.com), Ehsan Kamrani (kamrani@hormozgan.ac.ir), Guofan Shao (shao@purdue.edu), Hassan Poorbabaei (hassan_pourbabaei@yahoo.com), Hwan Su Yoon (hsyoon@bigelow.org), John Stephen Balirwa (firi@firi.go.ug), Joko Ridho Witono (jrwitono@yahoo.com), Joon-Baek Lee (jblee@cheju.ac.kr), Katsuhiko Kondo (k3kondo@nodai.ac.jp), Magdy Ibrahim El-Bana (mag_bana@yahoo.co.uk), Mahendra Kumar Rai (pmkrai@hotmail.com), María de los Ángeles La Torre Cuadros (angeleslatorre@lamolina.edu.pe), Mochamad Arief Soendjoto (masoendjoto@gmail.com), Rami Ahmad Zurayk (rzurayk@aub.edu.lb), Salvador Carranza (salvicarranza@gmail.com), Sameer Ahmad Masoud (smasoud@philadelphia.edu.jo), Shahabuddin (shahabsaleh@gmail.com), Sugiyarto (m.sugiyarto@gmail.com), Suman Sahai (genecamp@vsnl.com), Thaweesakdi Boonkerd (Thaweesakdi.B@chula.ac.th)

ENGLISH LITERARY EDITOR: I Made Sudiana (sudianai@yahoo.com)

SECRETARY AND TECHNICAL EDITOR: Ahmad Dwi Setyawan (unsjournals@gmail.com)

WEBSITE EDITOR: Ari Pitoyo (unsjournals@yahoo.com)

MARKETING AND BANKING: Rita Rakhmawati, Solichatun c.q. BNI KC Sebelas Maret Acc. No. 0033691646

REVIEWERS: Peer reviewers will be mentioned in the last number of each volume.

PUBLISHER: Biology Department, Faculty of Mathematics and Natural Sciences, Sebelas Maret University Surakarta and Society for Indonesian Biodiversity

ADDRESS: Jl. Ir. Sutami 36A Surakarta 57126. Tel. +62-271-7994097, Tel. & Fax.: +62-271-663375.

ONLINE: www.unsjournals.com

ACCREDITED BY DECREE OF “DIRECTORATE GENERAL OF HIGHER EDUCATION, THE MINISTRY OF NATIONAL EDUCATION, REPUBLIC OF INDONESIA” No. 65a/DIKTI/Kep/2008 (valid until October 2011)

BIODIVERSITAS Volume 10, Number 3, July 2009 Pages: 109-114

ISSN: 1412-033X (printed edition) ISSN: 2085-4722 (electronic) DOI: 10.13057/biodiv/d100301

Isolation and Cloning of cDNA of Gene Encoding for Metallothionein Type 2 from Soybean [Glycine max (L.) (Merrill)] cv. Slamet SUHARSONO

1,2,♥

, YASSIER ANWAR , UTUT WIDYASTUTI

1,2

Research Center for Biological Resources and Biotechnology, Bogor Agricultural University (IPB), Bogor 16680. 2 Biologi Department, Faculty of Mathematics and Natural Sciences, Bogor Agricultural University (IPB), Bogor 16680. Received: 10th January 2009. Accepted: 26th May 2009.

ABSTRACT Metallothionein has an important role in the detoxification of metal ions. It has a low molecular weight and contains cysteine-rich residue. The objective of this research is to isolate and clone the cDNA of gene encoding for metallothionein from soybean [Glycine max (L.) (Merrill)] cv Slamet (GmMt2). We had successfully isolated total RNA by reverse transcription and synthesized total cDNA from total RNA as template. cDNA of GmMt2 had been isolated from total cDNA by PCR. It was successfully inserted into pGEM-T Easy plasmid, and the recombinant plasmids were introduced into Escherichia coli strain DH5α. Sequence analysis by using T7 and SP6 primers showed that the length of PCR-isolated fragment was 257 bp containing 246 bp completed sequence of Mt2 cDNA encoding for 81 amino acids. Enzyme restriction analysis showed that GmMt2 did not contain any restriction sites found in the multi cloning sites of pGEM-T easy. Nucleotide and amino acid alignment analysis using BLAST program showed that GmMt2 was similar with completed cDNA of AtMt2A from Arabidopsis thaliana (L.) Heynh. Amino acid sequence analysis showed that the motifs of Cys sequence of GmMT2 are Cys-Cys, Cys-X-Cys, and Cys-X-X-Cys. © 2009 Biodiversitas, Journal of Biological Diversity Key words: soybean, metallothionein, cDNA, isolation, cloning, cysteine.

INTRODUCTION Metallothionein (MT) is low molecular weight proteins (4-8 kDa), containing rich of cysteine, and capable to bind heavy metal ions. Based on the pattern of cysteine residues distribution along the MT sequence, MT proteins of several species of plants are divided into two types, i.e. type 1 and type 2. Type 1 has a motif Cys-X-Cys, whereas type 2 has CysCys, Cys-X-Cys, and Cys-X-X-Cys motifs where X is an amino acid other than Cys. MTs are present in a vast range of organisms including plants, mammals, fungi and procaryotic organisms (Valle, 1991; Cobbett and Goldsbrough, 2002; Coyle et al., 2002). In the animals and the plants, MTs not only have an important role in the homeostatic mechanism and detoxification heavy metal ions (Cobbett and Goldsbrough, 2002; Hall, 2002), but they also involve in the process of physiology, regulation of cell growth, proliferation, the activities of metalloenzymes, transcription factor (Haq et al., 2003; Akashi et al.,

 Corresponding address: Gd. PAU, Jl. Kamper, Kampus IPB Darmaga, Bogor 16680 Tel. +62-251-8621257; Fax.: +62-.251-8621724 email: sony.suharsono@yahoo.com; sony-sh@ipb.ac.id

2004; Wong et al., 2004), and the infection and cell death (Vasak and Hasler, 2000). In addition, the presence of MTs in the nuclear can protect the DNA from the damage induced by oxidative stress (Chubatsu and Meneghini, 1993; Cai et al., 1995). The synthesis of MTs is induced by several metals, growth signals and hormones (Templeton et al., 1985; Andrews et al., 1987; Nartey et al., 1987). In wheat, aluminum stress caused the increase of expression of gene encoding for MT (Snowden and Gardner, 1993). Pilon-Smith and Pilon (2002) showed that the detoxification of Al was due to the binding of Al by cysteine-rich containing proteins as MTs, glutathione (GSH) and phytochelatin. MT type 2 (MT2) is one of MT family protein. Soybean [Glycine max (L.) (Merrill)] cv Slamet is a local cultivar tolerant to acid soil and Al stress. Al can cause oxidative stress by creating radical oxygene species (ROS) (Panda et al., 2003). Since MTs involve in the detoxification of ROS, we suppose that MTs involve also in the detoxification of Al. Therefore the isolation and cloning of cDNA of gene encoding of MT2 from soybean is important. This research has an objective to isolate and clone cDNA of gene encoding for MT2 of soybean cv Slamet.

110

B I O D I V E R S I T A S Vol. 10, No. 3, July 2009, pp. 109-114

MATERIALS AND METHODS Materials Soybean cv Slamet was used as plant material. The primers of ActF (ATGGCAGATGCCGAGGATAT) and ActR (CAGTTGTGCGACCACTTGCA) designed based on cDNA of -actin of soybean (Shah et al., 1982) were used to amplify exon1-exon2 of cDNA of β-actin as a control for the purity of total cDNA. Primers of MF (TCGAGAAAAATGTCTTGCTGTG) and M7R (CTTGCACCTGCAAGTGAAGG) designed based on cDNA of MT2 of Arabidopsis thaliana (L.) Heynh (Acc: NM_1117733) were used to isolate the cDNA of MT2 of soybean (GmMt2). pGEM-T Easy plasmid (Promega) was used as a cloning vector. Escherichia coli strain DH5α was used as a host of recombinant plasmids. Isolation of total RNA The isolation of total RNA was carried out by using Trizol Kit (Invitrogen) as described by Mashuda (2006). For this purpose, 1 g of root tips was ground in the mortar in the presence of liquid nitrogen to become the fine powder. These powder were mixed into suspension with 800 μL Trizol in the 1.5 mL micro tubes. This suspension was then incubated in the room temperature for 5 minutes, and after that added with 200 μL chloroform and vortexed thoroughly. After incubation for 3 minutes in the room temperature, the suspension was centrifuged at 10,000 rpm (Jouan BR4i) at 4°C for 15 minutes. The supernatant was collected and added by 500 μL isopropyl alcohol, then incubated at the room temperature for 10 minutes. After the centrifugation at 10,000 rpm, at 4°C for 10 minutes, the liquid was discarded and the pellet was added by 500 μL ethanol 75%, then the tubes were centrifuged at the same condition as previous step. The liquid was discarded, and the pellet was vacuumdried. The pellet was suspended in 30 μL H2O-DEPC. The quantity and quality of total RNA were determined by spectrophotometer UV-VIS (Cecil CE 2020). The integrity of total RNAs was determined by electrophoresis in the 1% agarose gel (FMC, USA) in -1 -1 the MOPS buffer (4.2 g L MOPS, 0.41 g L Na-1 acetate, 0.37 g L Na2-EDTA). For electrophoresis, 1 μL total RNA was mixed with 12 μL premix solution (MOPS, 50% (v/v) formamide, 17.5% (v/v) formaldehyde and 27.5% (v/v) H2O-DEPC). This suspension was heated at 65°C, 10 minutes, and immediately cooled in the ice for 5 minutes, and added by 1/6 volume loading dye (0.25% blue bromophenol, 0.25% xylene cyanol FF, 30% glycerol). This suspension containing total RNAs was electrophorezed at 100 volt 30 minutes. After -1 submerging in the EtBr solution (0.5 μg mL ) for 30 minutes, and washing by H2O, the total RNAs in the gel were visualized on the UV GelDoc transilluminator (Labquip) and recorded by digital camera.

Synthesis of total cDNA Total cDNA was synthesized from total RNA by using Superscript III Reverse Transcriptase enzyme (Invitrogen). The composition of the synthesis of total cDNA was 5 μg total RNA, 4 μL RT buffer (5x), 20 pmol oligo(dT), 4 mM dNTP mix, 10 mM DTT, 1 U TM SuperScript III RTase (Invitrogen), and ajusted to 20 μL by the addition of H2O-DEPC. The synthesis of total cDNA was carried out at 45°C for 50 minutes. The successful of synthesis of total cDNA and the purity of total cDNA from genomic DNA contaminant were determined by PCR using specific actF and actR primers for exon1-exon2 of β-actin. The composition to amplify cDNA of β-actin was 1 μL total cDNA, 1 µL Taq buffer (10x), 40 mM MgCl2, 4 mM dNTP mix, 10 pmol ActF primer, 10 pmol ActR primer, 4% DMSO, 0.5 U Taq DNA polymerase (Fermentas) and H2O in the final volume of 10 μL. The condition of PCR was pre-PCR at 95°C, 5 minutes, denaturation at 94°C, 30 seconds, primer annealing at 55°C, 30 seconds, and extension at 72°C, 1.5 minutes, with 35 cycles, and post-PCR at 72°C, 5 minutes followed by 15°C, 5 minutes. Isolation of cDNA of GmMt2 The cDNA of GmMt2 was isolated from total cDNA by PCR. The composition of PCR was 2 μL total cDNA, 2 μL Taq buffer (10x), 4 mM dNTP mix, 20 pmol MF primer, 20 pmol M7R primer, 4% DMSO, 1 U Taq DNA polymerase (RBC) and completed to 20 μL by H2O. The condition of PCR was pre-PCR at 95°C, 5 minutes, denaturation at 94°C 30 seconds, primer annealing at 58°C, 30 seconds and extension at 72°C, 1.5 minutes, with 35 cycles, post-PCR at 72°C, 5 minutes followed by 15°C, 5 minutes. Cloning of cDNA of GmMt2 The cDNA of GmMt2 resulted from PCR was ligated to pGEM–T Easy (Promega) by mixing 3 μL of PCR product, 1 μL (10 ng) pGEM-T Easy, 0.5 U T4 DNA ligase (Promega), 1 μL rapid ligation buffer (10x) and adjusted to 10 μL by H2O. This reaction mixture was incubated at 4°C for overnight. The ligation product was introduced into E. coli DH5α as described by Suharsono (2002). Selection of E. coli containing recombinant plasmid E. coli DH5α containing recombinant plasmid was selected by using ampicillin and blue-white selection -1 -1 in the solid LB media (10 g L bacto-trypton, 5 g L -1 yeast extract, 10 g L NaCl, pH7.5, 1.5% bacto agar) -1 containing 100 mg L ampicillin, 10 mM IPTG -1 (isopropyl-β-D-thiogalactopyranoside) and 50 mg L X-gal (5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside). White colony grown in the selection media was used as source of template for PCR to detect the presence of GmMt2 in the transformed bacteria. For this purpose, one white colony was picked up by using toothpick, then suspended in 6.5 μL dH2O and heated at 95°C in the waterbath for 10 minutes and

SUHARSONO et al. – Gene encoding for metallothionein from Glycine max

immediately cooled in the ice for 5 minutes. This suspension was used as the template to amplify the insert GmMt2 with the same composition and condition of PCR as described for isolation of cDNA of GmMt2. Isolation and analysis of recombinant plasmid containing GmMt2 The isolation of recombinant pGEM-T Easy plasmid DNA contained in E. coli DH5α was carried out as described by Suharsono (2002). To excised the insert GmMt2 cDNA, recombinant plasmid DNA was cut by EcoR1 (Fermentas) by mixing 200 ng plasmid DNA, 10 U EcoR1, 1x restriction buffer and dH2O in 20 μL solution. The solution was incubated at 37°C for 2 hours. Sequencing and sequence analysis of GmMt2 Sequencing of GmMt2 cDNA was performed by using DNA sequencer ABI Model 3100/3130 MERCIAN. Local alignment analysis of GmMt2 was carried out by using BLAST (Basic Local Alignment Search Tools) (http://www.ncbi.nlm.nih.gov/BLAST/) program. Amino acid sequence was deduced by using translation program of EXPASY (http://www.expasy.ch/tools/dna.htm). The analysis of open reading frame (ORF) was carried out by using BESTORF program (http://www.softberry/bestorf/htm). Analysis of restriction sites in the GmMt2 cDNA was performed by using NEBCutter program (http://www.firstmarket.com/cutter/cut2.html).

111

Electrophoresis of total RNA in denaturated agarose gel containing formaldehyde resulted two dominant bands. These two bands were 18S and 28S ribosomal RNA (rRNA) (Figure 1). This result indicated that isolated total RNA was in a very good quality. Therefore mRNA contained in the total RNA was also in a very good quality for the integrity. The integrity of mRNA is very important in the synthesis of cDNA. Synthesis of total cDNA. Total cDNA had been successfully synthesized from total RNA as template by reverse transcription method. By using oligo(dT) primer, only mRNA can be used as template for cDNA synthesis because it contains poly-A tail. This poly-A tail can form a complementary pair with oligo(dT) primer. rRNA and tRNA do not have poly-A tail, so they can not be used as template for cDNA synthesis. PCR by using total cDNA as template and spesific primers for cDNA of exon1-exon2 of β-actin gene resulted one band DNA at 450 bp in size (Figure 2). 1

1000 pb

500 pb

RESULTS AND DISCUSSIONS Isolation of total RNA Total RNA of root tips of soybean cv Slamet has been successfully isolated. Quantification of total RNA by using spectrophotometer showed that the efficacy of total RNA isolation was 187 µg of total RNA per g root tips. This result was enough for the synthesis of total cDNA. The OD260/OD280 ratio of total RNA was 1.88 indicating that isolated total RNA had a very good purity from the protein contaminant (Farrel, 1993).

28S

Figure 2. cDNA of exon1-exon2 of β-actin resulted from PCR by using total cDNA as template. 1= 1 kb ladder DNA, 2= exon1-exon2 of β-actin cDNA.

This result showed that the amplified region was cDNA of exon1-exon2 and was not genomic DNA of β-actin. Amplication of exon1-exon2 region of genomic DNA resulted about 550 bp DNA fragment containing intron1. This intron1 was spliced during the synthesis of mRNA. The size of intron1 of actin of soybean is around 90 bp (Shah et al., 1982). The absence of 550 bp DNA band in the agarose gel (Figure 2) showed that the synthesized total cDNA was pure and free from genomic DNA contaminant. Beside showing the purity of cDNA from genomic DNA contaminant, this result showed also that the isolated total RNA had a very good quality.

18S

Figure 1. Total RNA isolated from root tips.

Isolation and cloning of GmMt2 cDNA The isolation of GmMt2 cDNA by PCR by using total cDNA as a template and specific primers for Mt2 resulted cDNA fragment of about 250 bp (Figure 3). This fragment was then called GmMt2 (Glycine max Mt2) fragment. It has the same size as Mt2 cDNA of A. thaliana (AtMt2A).

B I O D I V E R S I T A S Vol. 10, No. 3, July 2009, pp. 109-114

112 1

1000 pb

250 pb

Figure 3. GmMt2 fragment resulted from PCR using total cDNA as template. 1= GmMt2, 2= 1 kb marker DNA.

GmMt2 fragment had been inserted in the middle of lacZ of pGEM-T Easy plasmid and this ligation had been successfully introduced into E. coli strain DH5α. The successful of insertion of GmMt2 into pGEM-T Easy plasmid and introduction of recombinant pGEMT Easy plasmid into E. coli was demonstrated by the presence of white colony grown in the selection LB media containing ampicillin, IPTG and X-gal. Only E. coli strain DH5α containing plasmid can survive in this selection media, and only the colony containing recombinant plasmid had a white color. The blue colonies survived in this selection media contained non-recombinant plasmid. The development of blue color is due to the conversion of uncolored X-gal substrate into blue color by β–galactosidase encoded by lacZ gene. The cloning sites (CS) are located in the middle of lacZ gene. The expression of lacZ is induced by IPTG. The blue color of colonies is developed when in the middle of lacZ does not have an insertion of DNA. If GmMt2 fragment inserts in the lacZ gene, β-galactosidase is not synthesized and the E. coli colonies develop in white color. The presence of GmMt2 inserted in the recombinant plasmid contained in the white colonies of E. coli was confirmed by colony-PCR. Colony-PCR using white colony as source of template resulted 250 bp DNA fragment showing that this white colony contained GmMt2 fragment (Figure 4). To reconfirm that GmMt2 had been inserted in the pGEM-T Easy, recombinant plasmid DNA had been isolated from white colony, and cut with EcoR1 to excise insert GmMt2. Digestion of recombinant plasmid DNA by EcoR1 resulted two DNA fragments, one was 3,000 bp fragment DNA corresponding to pGEM-T Easy vector, and the other was 250 bp DNA fragment being similar in size with GmMt2 fragment (Figure 5). This result showed that the GmMt2 fragment had been inserted into pGEM-T Easy plasmid.

1000 pb

250 pb

Figure 4. The result of PCR using white colony as the source of template. 1= 1 kb DNA marker, 2= GmMt2.

3000 pb

1000 pb

250 pb

Figure 5. Digestion of recombinant plasmid by EcoR1. 1= recombinant plasmid cut by EcoR1, 2= 1 kb DNA marker.

Analysis of GmMt2 fragment DNA sequencing of insert GmMt2 fragment resulted 257 nucleotides containing 246 bp ORF (open reading frame). This ORF encodes 81 amino acids with 14 cysteine residues. Local alignment analysis with BLASTn showed that GmMt2 had similarity 100% with AtMt2A of A. thaliana. Since the nucleotide sequence is the same, so the deduced amino acid sequence of GmMt2 is also the same as AtMt2A. Therefore, GmMT2 apparently has a similar role as AtMT2A in the binding and detoxifying metal ions and avoiding oxidative damage (Zhou and Goldsbrough, 1995). Nucleotide analysis showed that GmMt2 contains start (ATG) and stop (TGA) codons, therefore this isolated GmMt2 is a full length of cDNA of Mt2 (Figure 6). Based on restriction site analysis, GmMt2 fragment does not contain restriction sites located in the CS of pGEM-T Easy, therefore all restriction sites in the CS can be used to excise the insert GmMt2 from pGEM-T Easy. GmMt2 fragment contains BbvI,

SUHARSONO et al. – Gene encoding for metallothionein from Glycine max

atg M ggc G ggc G atg M gat D aag K

tct S aac N gag E aag K gct A tga -

tgc C ggt G aca T aat N tgc C

tgt C tgt C acc T cag Q aag K

gga G gga G aca T tac Y tgt C

gga G ggt G act T gag E gga G

aac N tgc C gag E gct A tct S

tgc C aaa K act T tca S gac D

gga G atg M ttt F ggg G tgc C

tgt C tac Y gtc V gag E aag K

gga G cct P ttg L agt S tgt C

tct S gac D ggc G aac N gat D

ggc G ttg L gtt V aac N cct P

tgc C gga G gca A gct A tgc C

aag K ttc F ccg P gag E acc T

113

tgc C tcc S gcg A aac N tgc C

nuk aa 48 16 96 32 144 48 192 64 240 80 246 81

Figure 6. Nucleotide and deduced amino acid sequences of GmMt2.

recombinant

Figure 7. Orientation of GmMt2 in the CS of pGEM–T Easy.

BsaBI, BtsCI, TseI, FokI, ApeKI, CspCI, HpyCH4III, PshAI, BsrFI, SgrAI, AcuI, BtgZI, MboII, SfaNI, Cac8I and Hpy188I sites, so these sites can not be used to clone this gene because they will cut it into two fragments or more. The restriction site analysis of the DNA fragment is very important for the genetic engineering. The analysis of GmMt2 orientation in the CS based on nucleotide sequence showed that GmMt2 fragment was located in the downstream of T7 primer inserted in the lacZ and in the opposite orientation of

the lacZ gene (Figure 7). The orientation of gene is very important for the gene expression. The analysis of amino acid sequence deduced from nucleotide sequence showed that the motifs of Cys amino acid sequence of GmMT2 are Cys-Cys (3rd – 4th residues), Cys-X-Cys (8-10, 14-16, 67-69, 73-75, 78-80) and Cys-X-X-Cys (20-23). These motifs of Cys sequence of GmMT2 are specific for MT protein type 2 of plant (Robinson et al., 1993; Cobbett and Goldsbrough, 2002).

114

B I O D I V E R S I T A S Vol. 10, No. 3, July 2009, pp. 109-114

CONCLUSIONS Full length of cDNA encoding for metallothionein of soybean cv Slamet (GmMt2) had been isolated and cloned into pGEM-T Easy plasmid. This cDNA has 246 nucleotides encoding for 81 amino acids. GmMt2 has the same sequence as AtMt2 of A. thaliana. The motifs of Cys amino acid sequence of GmMT2 were Cys-Cys, Cys-X-Cys, and Cys-X-X-Cys.

AKNOWLEDGMENT This research was financially supported by Competence Research Grant (Hibah Kompetensi), Directorate Research and Community Services, Directorate General of Higher Education, Ministry of National Education, Republic of Indonesia, by Contract SPK 008/HIKOM/DP2M/2008.

REFERENCES Akashi, K, N. Nishimura, Y. Ishida, and A. Yokota. 2004. Potent hydroxyl radical-scavenging activity of drough-induced type-2 metallothionein in wild watermelon. Biochemical and Biophysical Research Communications 323: 72-78. Andrews, G.K., K.R. Gallant, and M.G. Cherian. 1987. Regulation of the ontogeny of rat liver metallothionein mRNA by zinc. European Journal of Biochemistry 166: 527-531. Cai, L., J. Koropatnick, and M.G. Cherian. 1995. Metallothionein protects DNA from copper-induced but not iron-induced cleavage in vitro. Chemistry and Biology 96: 143-155. Chubatsu, L.S., and R. Meneghini. 1993. Metallothionein protects DNA from oxidative damage. The Journal of Biochemistry 291: 193-198. Cobbett, C., and P. Goldsbrough. 2002. Phytochelatins and metallothioneins: roles in heavy metal detoxification and homeostasis. Annual Review of Plant Biology 53: 159-182. Coyle, P., J.C. Philcox, L.C. Carey, and A.M. Rofe. 2002. Metallothionein: the multipurpose protein. Cellular and Molecular Life Sciences 59: 627-647.

Farrel, R.E. 1993. RNA Methodologies. A Laboratory Guide for Isolation and Characterization. San Diego: Academic Press Inc. Hall, J.L. 2002. Cellular mechanism for heavy metal detoxification and tolerance. Journal of Experimental Botany 53 (366): 1-11. Haq, F, M. Mahoney, and J. Koropatnick. 2003. Signaling events for metallothionein induction. Mutation Research 533: 211-226. Mashuda. 2006. Ekspresi Gen GÎą dan GST pada Kedelai Kultivar Slamet yang Mendapat Cekaman Aluminium. [Tesis]. Bogor: Sekolah Pascasarjana IPB. Nartey, N.O., D. Banerjee, and M.G. Cherian. 1987. Immunohistochemical localization of metallothionein in cell nucleus and cytoplasm of fetal human liver and kidney and its changes during development. Pathology 19: 233-238. Panda, S.K., L.B. Singha, and M.H. Khan. 2003. Does aluminum phytotoxicity induce oxidative stress in greengram (Vigna radiata). Bulgarian Journal of Plant Physiology 29: 77-86. Pilon-Smiths, E., and M. Pilon. 2002. Phytoremediation of metals using transgenic plants. Critical Review of Plant Science 21: 439-456. Robinson, N.J., A.M. Tommey, C. Kuske, and P.J. Jackson. 1993. Plant metallothionein. The Journal of Biochemistry 295: 1-10. Shah D.M., R.C. Hightower, and R.B. Meagher. 1982. Complete nucleotide sequence of a soybean actin gene. Proceeding of the National Academic of Science of the USA 79 (4): 10221026. Snowden, K.C., and R.C. Gardner. 1993. Five genes induced by aluminum in wheat (Triticum aestivum L.) roots. Plant Physiology 103: 855-861. Suharsono. 2002. Konstruksi pustaka genom kedelai kultivar Slamet. Hayati 9 (3): 67-70. Templeton, D.M., D. Banerjee, and M.G. Cherian. 1985. Metallothionein synthesis and localization in relation to metal storage in rat liver during gestation. Biochemistry and Cell Biology 63: 16-22. Valle, B.L. 1991. Introduction of metallothionein. Methods in Enzymology 205: 3-7. Vasak, M., and D.W. Hasler. 2000. Metallothioneins: new functional and structural insight. Current Opinion in Chemical Biology 4: 177-183. Wong, H.L., T. Sakamoto, T. Kawasaki, K. Umemura, and K. Shimamoto. 2004. Down-regulation of metallothionein, a reactive oxygen scavenger, by the small GTPase OsRac I in rice. Plant Physiology 135: 1447-1456. Zhou, J., and P.B. Goldsbrough. 1995. Structure, organization and expression of the metallothionein gene family in Arabidopsis. Molecular and General Genetics 248: 318-328.

BIODIVERSITAS Volume 9, Number 3, July 2009 Pages: 115-119

ISSN: 1412-033X (printed edition) ISSN: 2085-4722 (electronic) DOI: 10.13057/biodiv/d100302

Characterization and Purification a Specific Xylanase Showing Arabinofuranosidase Activity from Streptomyces spp. 234P-16 1,♥

ANJA MERYANDINI , TRIO HENDARWIN

1, ♥♥

, FAHRRUROZI , ALINA AKHDIYA , DEDEN SAPRUDIN , 1 YULIN LESTARI

Biology Department, Faculty of Mathematics and Natural Science, Bogor Agricultural University (IPB), Bogor 16680. Indonesian Center for Agricultural Biotechnology and Genetic Resources Research and Development (ICABIOGRAD), Bogor 16110 3 Chemistry Department, Faculty of Mathematics and Natural Science, Bogor Agricultural University (IPB), Bogor 16680.

Received: 10th May 2009. Accepted: 16th June 2009.

ABSTRACT Streptomyces spp 234P-16 producing xylanase was isolated from soil sample from Padang, West Sumatra, Indonesia. Crude enzyme (produced by centrifuging the culture at 14000 rpm for about 5 minutes) and purified xylanase have an o optimum condition at pH 5 and 90 C. Crude xylanase have half life time of 4 hours, whereas purified xylanase have half life o time of 2.5 hours at 90 C. The molecular mass of purified xylanase was determined to be 42.4 kDa. The Arabinofuranosidase have a Km and Vmax value of 1.98 mg/mL and 523 µmol/minute/mg, respectively © 2009 Biodiversitas, Journal of Biological Diversity Key words: xylanase, xylooligosaccharide, arabinofuranosidase, Streptomyces.

INTRODUCTION The utilization of hemicellulosic sugars is essential for efficient conversion of lignocellulosic materials to ethanol and other value-added products. Xylan, a component of hemicellulose, is a complex heteropolysaccharide comprising a backbone of xylose residues linked by β-1,4 D-xylose glycosidic bond (Saha 2000, 2002; Tseng et al., 2002) with sidechain of O-acetyl, α-L-arabinofuranosyl, D-glucuronyl, and O-methyl-D-glucuronyl residues (Kubata et al., 1994; Silveira et al., 1999; Saha 2003). Xylan degrading enzymes includes endo--1,4 xylanase dan -xilosidase and the side-chain are liberated by -arabinofuranosidase, -D-glucuronidase, galactosidase and asetil xylan esterase. These enzyme system work synergistically in hydrolyzing complex xylan (Sunna et al., 1997; Subramaniyan and Prema, 2002; Ali et al., 2004). Commercial hemicellulase preparation need to be enriched with several accessory enzymes including arabinofuranosidase to be more effectively convert

Corresponding address: Fapet Building, 5th Floor, 1st Wing, IPB Campus at Darmaga, Bogor 16680. Tel. +62-0251-8622833, Fax. +62-0251-8622833 e-mail: ameryandini@yahoo.com  P.T. Sari Husada Tbk., Jl. Kusumanegara No. 173, PO Box 37 Yogyakarta 55002. Tel. +62-0274-498001 Fax. +62-0274-498008 e-mail:trio.hendarwin@sarihusada.co.id 

hemicellulose to simple sugars. Arabinofuranosidases hydrolyze terminal nonreducing residues from arabinose-containing polysaccharides. Arabinofuranosidases warrant substantial research effort because they represent potential rate limiting enzymes in xylan degradation, particularly those substrate from agricultural residues such as corn fiber, corn stover and rice straw. With the increase of enzyme usage in feed formulations, arabinofuranosidase will be important in the enhancement of feed digestibility. In our previous research we identified xylanolytic Streptomyces sp 234P-16 that was isolated from soil sample in Padang West-Sumatra. In the present paper we report characterization and purification of enzyme xylanase.

MATERIALS AND METHODS Stock culture and inoculum preparation Streptomyces 234P-16 isolate was rejuvenated in YM agar-agar media (0.4% yeast extract, 1% malt extract, 1.5% glucose, 1.5% agar-agar). The isolate was then grown in xylan medium (1% yeast extract, 10.3% sucrose, 0.5% Birchwood xylan, 1.5% agaragar). Incubation was done at 30 ˚C for 7 days. Determining the optimum time for xylanase production and activity As much as 2 chokebores of isolate grown in xylan medium was inoculated to 100 mL production

B I O D I V E R S I T A S Vol. 9, No. 3, July 2009, pp. 115-119

medium (the same medium as preparation of inoculum) in 500 mL Erlenmeyer. They were incubated with 140 rpm agitation at 30 ˚C for 10 days. Crude extract of xylanase was yielded every day by centrifuging the culture at 14000 rpm for about 5 minutes. Activity of the crude enzyme was measured by using DNS (Dinitrosalisilic Acid) method by Miller (1959) with xylose used as standard. The yielded reducing-sugar was assessed by spectrophotometer with a wavelength of 540 nm. One unit xylanase activity was defined as the amount of enzyme which produces 1 µmol xylose during 1 minute. Protein concentration (mg/mL) was defined by using Bradford method (Bradford 1976). The standard protein used was bovine serum albumin (BSA). Xylanase characterization Characterization of crude enzyme and the purified enzyme included the determination of optimum temperature and pH, enzyme stability. The assessment with various pH was carried out within pH 3.0-9.0 with intervals of 0.5. The determination of o optimum temperature was done from 30 until 90 C o with the intervals of 10 C. The stability of xylanase was tested by incubating the enzyme without substrate in the optimum temperatures. Hydrolysis analysis using HPLC The enzyme was suspended in 5 mL Birchwood Xylan 0.5% (w/v) and incubated at optimum condition o (50 C, pH 5) for 5 hours, centrifuged at 10.000 rpm, o 4 C and the supernatant was analyzed in HPLC (Waters, USA) with the condition: column: carbohydrate, solvent: 60% (v/v) methanol, detector: refraction index. Precipitation of xylanase crude extract with acetone The xylanase crude extract was precipitated by using several percentage of acetone concentration to know the optimum condition of xylanase fractionation by acetone. Table of acetone precipitation used was based on Scopes (1987). The percentage of the precipitation used varied from 60-90%. Purification The precipitated crude enzyme was purified using DEAE-Sephadex A-50 matrix (Sigma, USA) and Sephadex G-100 matrix. For the DEAE-Sephadex A50 matrix, the washing buffer was 0.02 M buffer TrisHCl pH 8.0, and the elution buffer was 0.0-0.5 NaCl in 0.02 M Tris-HCl buffer pH 8.0. The fraction containing xylanase activity was polled and concentrated using PEG6000 and dialysis for 4 hours with 0.2 M phosphate buffer pH 7 before applied to the gel filtration. For the gel filtration 0.02 M phosphate buffer with pH 7.0 was used. The flow rate for chromatography was 0.5 mL/minute

Analysis of SDS-PAGE and Zymogram Protein electrophoresis was conducted by using Laemmli methods (1970) with acrylamide concentration of 4% for collector gel and 10% for separator gel and 0.5% substrate was added for zymogram. As much as 20 µL of crude extract of the enzyme from acetone 70% precipitation and the purification fraction from gel filtration and anion exchange was inserted to the well of SDS-PAGE. Substrate specificity The substrate specificity of xylanase was assayed using pnitrophenyl--D-xylanopiranoside, pnitrophenyl--L-arabinofuranoside, 4-nitrophenylasetat, 4-nitrophenyl--D-galactopiranoside and pnitrophenyl--D-glucoropiranoside according to Saha (2001). Kinetic parameters Kinetic parameters were determined by incubating the enzyme with different amount of substrate. Xylanase was incubated with Birchwood xylan (0.05o 0.25%) in citrate phosphate buffer pH 5 at 90 C. The value of the Michaelis constant were determined from Lineweaver-Burk plots.

RESULTS AND DISCUSSION Production of xylanase The daily production curve of xylanase Streptomyces spp 234P-16 tested at pH 7.2 and a o temperature of 37 C (Figure 1). The highest xylanase production was reached on Day-5 with the activity of 0.422 Unit/mL. The optimum time of xylanase production was then used as the standard harvest time in the next xylanase production. 0.45 0.4 Activity (unit/ml)

116

0.35 0.3 0.25 0.2 0.15 0.1 0.05 0 2

days

Figure 1. Production curve of Streptomyces sp. 234P-16 o xylanase measured at 37 C and pH 7.2.

Effect of pH on xylanase activity The effect of pH on the crude xylanase activity o measured at 37 C (A) and purified enzyme (B) has been shown in Figure 2.

MERYANDINI et al. â&#x20AC;&#x201C; Xylanase from Streptomyces

0.60

Activity (U/ml)

0.50 0.40 0.30 0.20 0.10 0.00 3

3.5

4.5

5.5

6.5

7.2

7.5

8.5

117

Enzyme stability At the optimum temperature, the crude enzyme have half-life time about 4 hours whereas the purified enzyme about 2.5 hours. Enzyme stability was affected by protein, carbohydrate and cations on the medium. Crude enzyme was more stable than the purified extract perhaps is due to the cations and other protein that function as an stabilizer for the enzyme. Enzyme thermostability is also due to the enzyme ability to maintain its three dimensional structure (Whitaker, 1994).

0.0100

0.0060

% activity

Activity (U/ml)

0.0080

0.0040 0.0020 0.0000 4.0

4.5

5.0

5.5

6.0

6.5

7.0

200 180 160 140 120 100 80 60 40 20 0 1

Crude and purified xylanase had its highest activity at pH 5, but the crude enzyme also demonstrated quite high activity at pH 4.5 to 6. Enzyme has specific optimum pH, which is responsible for maximum enzyme activity (Lehninger, 1982). The characteristic of enzymeâ&#x20AC;&#x2122;s optimum pH is the condition where the catalytic site of the enzyme is at the expected ionization level (Whitaker, 1994). Effect of temperature on xylanase activity Figure 3 shows the effect of temperature on the activity of xylanase tested at pH 5. Xylanase displayed its optimum temperature, which was at o 90 C. Temperature fluctuation can influence the integrity of secondary, tertiary and quaternary structure of enzyme that can affect on enzyme activity (Whitaker, 1994).

purified

Activity (U/ml)

0.30 0.20 0.10 0.00

0.010

Activity (U/ml)

0.008 0.006 0.004 0.002 0.000 70

Crude

purified

xylanase

Purification It is clear that the best condition for precipitation xylanase was 70% acetone as can be seen in Table 2. Acetone concentration of 70% will then used for precipitation xylanase for chromatography application. Table 2. Sedimentation of crude xylanase with acetone.

% acetone

xylanase activity (Unit/mL) 0.07 0.13 0.23 0.07 0.04

protein content (mg/mL) 0.06 0.11 0.05 0.03 0.02

specific activity (Unit/mg) 1.15 1.24 4.76 2.74 2.33

Temperature (o C)

Hydrolysis analysis using HPLC The main product of the xylan hydrolysis was arabinose (96.61 ppm) whereas xylose just 26.55 ppm. One of the enzyme should be arabinofuranosidase.

Crude enzyme 00-60 70 80 90

0.40

Figure 4. Stability of crude and o Streptomyces sp 234P-16 on 90 C

0.60 0.50

3 Time (hours)

Figure 2. Effect of pH on Streptomyces sp 234P-16 crude o xylanase activity measured at 37 C(A) and purified o xylanase activity measured at 90 C (B).

100

Temperature (o C)

Figure 3. Temperature effect on Streptomyces sp 234P-16 crude extract (A) and purified (B) xylanase activity measured at pH 5.

The result of purification using anion exchange column showed two peak for xylanase activity and protein content (fraction 15-27 and fraction 27-33). Fraction 19-23 was collected and concentrated using PEG6000 and then dialysis for 4 hours using 0.2M phosphate buffer pH 7. The purification factor increased 6x (Table 3).The concentrated enzyme was then applied to the gel filtration column. The result of purification using gel filtration showed one peak of xylanase activity and protein content. Using gel filtration increased the purification factor to 17x (Table 3) and the SDS PAGE analysis showed one band with molecular mass of 42.5 kDa (Figure 7).

B I O D I V E R S I T A S Vol. 9, No. 3, July 2009, pp. 115-119

118

0.120

2.50

0.100

2.00

0.080

1.50

0.060

1.00

0.040

0.50

0.020

0.00

Xylanase activity (U/ml)

OD 280 nm

0,5 M 3.00

NaCl (M)

0.000 1

0,0 M

Fraction number OD 280 nm

xylanase activity (U/ml)

1.00

0.090

0.90

0.080

0.80

0.070

OD 280 nm

0.70

0.060

0.60 0.050 0.50 0.040 0.40

Table 3. Substrate specificity of purified o Streptomyces spp. 234P-16 on pH 5 and 90 C. Specific Substrate p-nitrophenyl--D-xilanopiranoside p-nitrophenyl-α-D-arabinofuranoside p-nitrophenyl--D-glucuropiranoside p-nitrophenyl-α-D-galactopiranoside 4-nitrophenyl-acetat

xylanase

Activity (U/mL) 1.0 40.2 0.0 0.0 0.0

Activity (U/ml)

Figure 5. Profile of xylanase anion exchange chromatography elution using DEAE-Sephadex A-50 matrix.

0.030

0.30 0.20

0.020

0.10

0.010

0.00

0.000 1

Fraction number OD 280 nm

Activity

Figure 6. Profile of xylanases chromatography elution with Sephadex G100 matrix.

Table 3. Purification of Streptomyces sp. 234P-16 xylanase. Steps

Substrate specificity Assays with substrate specific showed that this enzyme has an activity on p-nitrophenyl--Larabinofuranosidase and a -xilosidase activity (Table 3). Activity of these two enzymes activity in one protein showed a bifunctional enzyme. This kind of enzyme was also report from Trichoderma reesei, Clostridium stercorarium, Lycopersicon esculentum and Thermomonospora fusca BD25 (Clark et al. 1996; Kaneko et al. 2000; Tuncer 2000; Itai et al. 2003).

Vol Total (mL) Protein (mg) Crude extract 80 4.80 60-70% aceton 20 0.98 Anion exchange 10 0.08 Gel filtration 6 001

Total Activity (Unit) 9.76 4.66 1.05 0.51

Specific Activity (U/mg) 2.03 4.78 12.96 35.42

Yield Purification (%) factor 100 47.75 10.76 5.23

1 2.34 6.38 17.42

Kinetic parameters Reciprocal plots showed apparent Km and Vmax values of 1.98 mg/mL and 523 mmol/minute/mg. Streptomyces sp. S38 that produced one endoxilanase and two arabinofuranosidase have a Vmaks value of 5700 ± 600, 620 ± 30 dan 1050 ± 50 IU/mg with KM = 2.22, 1.05 and 0.97 mg/mL, respectively (Georis et al. 2000). Several Km dan Vmaks value from α-L-arabinofuranosidases Streptomyces have also been reported: α-L-arabinofuranosidase from Streptomyces sp. have Km and Vmaks of 3,3 mg/mL and nilai 302 µmol/minute/mg respectively (Belfaquih et al., 2002). Streptomyces sp. B-12-2 has a Km value of 0,8 and 5,8 mg/mL and a Vmaks value of 162 and 470 µmol/minute/mg, respectively (Elegir et al. 1994). Xylanase from Streptomyces T7 have a Km value of 10 mg/mL and a Vmaks value of 7610 µmol/minute/mg (Kesker, 1992). Xylanase from Streptomyces sp. QG-11-3 have a Km and Vmaks value of 1,2 mg/mL and 158,85 µmol/minute/mg respectively (Beg et al., 2001). 0.120 y = 0.0001x + 0.0898

xilosa content (mg/ml)

0.100 0.080

y = 0.0002x + 0.0697 0.060

y = 0.0003x + 0.0494

0.040 y = 0.0004x + 0.0115

0.020 0.000 0

Time (minute)

Figure 7. Profile of SDS-PAGE of the purified xylanase from: (1) crude extract, (2-3) 60-70% aceton fraction, (4) anion exchange fraction (19-23), (5-7) gel filtration fraction (21-23). (M) marker,

0.05%

0.15%

0.25%

0.35%

Figure 8. Xylose content on several Birchwood xylan o concentration after incubation at pH 5 and 90 C

MERYANDINI et al. – Xylanase from Streptomyces

12000 10000

1/V

8000 y = 1033.8x - 871.67 6000

R2 = 0.9555

4000 2000 0 0.00

2.00

4.00

6.00

8.00

10.00

12.00

1/[S]

Figure 9. Correlation between 1/[S] and 1/[V]

CONCLUSION Streptomyces sp. 234P-16 was able to produce two xylanolytic enzymes α-L-arabinofuranosidase and β-xilosidase. Crude extract of xylanase was precipitated by 60-70% acetone gradually, purified with anion exchange chromatography using Sephadex A-50 and gel filtration chromatography using Sephadex G-100. The molecular mass of the purified xylanase after ion-exchange was 42.456 kDa and 16.903 kDa but gel filtration showed the molecular mass 42.456 kDa. The optimum o temperature and pH was 90 C and 5.0 respectively. o The xylanase could resist of heating at 90 C for 180 minute. The result of kinetic analysis showed that Vmax was 523 µmol/minute/mg and Km was 1.98 mg/ml.

ACKNOWLEDGMENT This research was funded by Competitive Research Grand Project (”Proyek Penelitian Hibah Bersaing”) with a contract number of 026/SPPP/PPPM/DP-M/IV/2005 and 317/SP3/PP/DP2M/II/2006 for Anja Meryandini.

REFERENCES Ali, M.K., F.B. Rudolph and G.N. Bennett. 2004. Thermostable xylanases 10B from Clostridium acetobotylicum ATCC824. Industrial Microbiology and Biotechnology 31: 229-234. Beg Q.K., M. Kapoor, L. Mahajan and G.S. Hoondal. 2001. Microbial xylanases and their industrial applications: a review. Applied Microbiology and Biotechnology 56: 326-338. Belfaquih N., C. Jaspers, W. Kurzatkowski and M.J. Penninckx. 2002. Properties of Streptomyces sp. endo-β-xylanase in relation to their applicability in Kraft pulp bleaching. World Journal of Microbiology and Biotechnology 18: 669-705. Bradford M.M. 1976. A rapid and sensitive method for the quantitation of microgram quantitaties of protein in utilizing the principle of protein-dye binding. Analytical Biochemistry 72: 248-254.

119

Clark E.M., M. Tenkanen, S.T. Nakni, and M. Pentika. 1996. Cloning of gene encoding α-L-arabinofuranosidase and βxylosidase from Trichoderma reesei by expression in Saccharomyces cerevisiae. Applied and Environmental Microbiology 62: 3840-3846. Elegir G., G. Szakacs and T.W. Jeffries. 1994. Purification, characterization and substrate specificities of multiple xylanases from Streptomyces sp. strain B-12-2. Applied and Environmental Microbiology 60: 2609-2615 Georis J., F. Giannotta, E. De Buylb, B. Granier and J.M. Frere. 2000. Purification and properties of three endo-β-1,4-xylanases produced by Streptomyces sp. strain S38 which differ in their ability to enhance the bleaching of kraft pulps. Enzyme and Microbial Technology 26: 178-186 Itai A., K. Ishihara and J.D. Bewley. 2003. Characterization of expression and cloning of ß-D-xylosidase and α-Larabinofuranosidase in developing and ripening tomato (Lycopersicon esculentum Mill.) fruit. Journal of Experimental Botany 54: 2615-2622. Kaneko S., A. Kuno, M. Muramatsu, S. Iwamatsu, I. Kusakabe and K. Hayashi. 2000. Purification and characterization of a family G/11 β-xylanase from Streptomyces olivaceoviridis E-86. Bioscience, Biotechnology and Biochemistry 64: 447-451. Kesker, S.S. 1992. High activity xylanase from thermotolerant Streptomyces T7, cultural conditions and enzyme properties. Biotechnology Letters 14: 481-486 Kubata B.K., T. Suzuki, H. Horitsu, K. Kawal and K. Takamizawa. 1994. Purification and characterization of Aeromonas caviae ME-1 xylanases V, which produces exclusevely xylobiose from xylan. Applied and Environmental Microbiology 60 (2): 531-535. Laemmli U.K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227: 680685. Lehninger A.L. 1982. Dasar-Dasar Biokimia. Jilid ke-1. Thenawidjaja, M., penerjemah. Jakarta: Penerbit Erlangga. Miller G.L. 1959. Dinitrosalisilic assay. Analytical Chemistry 31: 426-428. Saha B.C. 2000. α-L-Arabinofuranosidases: biochemistry, molecular biology and application in biotechnology. Biotechnology Advances 18: 403-423 Saha B.C. 2001. Purification and characterization of an extracellular β-xylosidase from a newly isolated Fusarium verticillioides. Industrial Microbiology and Biotechnology 27: 241-245. Saha B.C. 2002. Production, Purification and Properties of Xylanase from A Newly Isolated Fusarium proliferatum. Process Biochemistry 37: 1279-1284 Saha B.C. 2003. Hemicellulose bioconversion. Industrial Microbiology and Biotechnology 30: 279-291. Scopes R.K. 1987. Protein Purification, Principles and Practice. 2th ed.. New York: Springer-Verlag Silveira F.Q.P., F.A. Ximenes, A.O. Cacais, A.M. Milagres, C.V. Meduros, J. Puls and E.X. Filho. 1999. Hydrolysis of xylans by enzyme systems from solid cultures of Trichoderma harzianum strains. Brazilian Journal of Medical and Biological Research 32: 947-952. Subramaniyan S., and P. Prema. 2002. Biotechnology of microbial xylanases: enzymology, molecular biology, and application. Critical Reviews in Biotechnology 22 (1): 33-64 Sunna A., S.G. Prowe, T. Stoffregen and G. Antranikian. 1997. Characterization of the xylanases from the new isolated thermophilic xylan-degrading Bacillus thermoleovorans strain K-3d and Bacillus flavothermus strain LB3A. FEMS Microbiology Letters 148: 209-216 Tseng M.J., M.N. Yap, K. Ratanakhanokchai, K.L. Kyu and S.T. Chen. 2002. Purification and partial characterization of two cellulase free xylanases from an alkaliphilic Bacillus firmus. Enzyme and Microbial Technology 30: 590-595. Tuncer M. 2000. Characterization of β-Xylosidase and α-LArabinofuranosidase Activities From Thermomonospora fusca BD25. Turkish Journal of Biology 24: 753-767. Whitaker J.R. 1994. Principles of Enzymology for the Food Sciences, 2nd ed. New York: Marcel Dekker Inc.

BIODIVERSITAS Volume 10, Number 3, July 2009 Pages: 120-123

ISSN: 1412-033X (printed edition) ISSN: 2085-4722 (electronic) DOI: 10.13057/biodiv/d100303

Correlations between Degree of Petal Fusion, Leaf Size and Fruit Size: A Case in Syzygium (Myrtaceae) PUDJI WIDODO

1,2,♥

, ALEX HARTANA , TATIK CHIKMAWATI

Post-graduate School, Bogor Agricultural University (IPB), Bogor 16680 2 Faculty of Biology, General Soedirman University (UNSOED), Purwokerto 53122 3 Biology Department, Faculty of Mathematics and Natural Sciences, Bogor Agricultural University (IPB), Bogor 16680 Received: 10th May 2009. Accepted: 26th June 2009.

ABSTRACT Syzygium is one of large genera of the flowering plants. In order to simplify the identification, a classification is required, e.g. based on degree of petal fusion, leaf size and fruit size. Due to variations of vegetative and generative characters, a correlation analysis was carried out. The aim of this research is to know the correlation between degree of petal fusion, leaf length and fruit diameter. The result of this research showed that there is positive correlation between those three variables. The increase of leaf size will increase fruit size and petal lobe depth. © 2009 Biodiversitas, Journal of Biological Diversity Key words: Syzygium, petal fusion, free, intermediate, fused petal, leaf, fruit size.

INTRODUCTION Syzygium is a large genus of flowering plant which consists of over ca 1,040 species (Govaerts et al. 2008), or about 1,200 species (Parnell et al., 2007), widely distributed in the tropics and subtropics of the old world from Africa, mainland Asia, Malesia, Australia, New Zealand and the western Pacific (Biffin, 2005). This genus is one of the largest and most taxonomically difficult genera in the Myrtaceae and there is a considerable dispute as to whether it is possible to split it into sections or even whether it should be recognized as a separate genus (Parnell and Chantaranothai, 2002). Due to large number of species, >1000 species (Frodin, 2004), it should be grouped to simplify and ease for recognition. There has been a lot of ways of grouping e.g. based on the succulency of fruits, leaf shape, number of pairs of lateral veins etc. (Chaffey, 1999), geographical Old World and New World (Schmid, 1980). In Syzygium, the generic concepts of Merrill & Perry were adopted by the majority taxonomists (Craven et al., 2006). The generic concepts have been based upon relatively fine levels of morphological distinction (Craven, 2001). In this concept, Syzygium includes the species with and without an intercotyledonary inclusion, either inflorescence

 Corresponding address: Jl..Dr. Soeparno 63, Purwokerto 53122 Tel.: +62-281 638794, Fax: +62-281 631700 e-mail: pwidodo@unsoed.ac.id

solitary or in cluster, on old trunk, axillary, or terminal, calyx either calyptrate or free. Ashton (2006) accepts the separation of Syzygium Gaertn. from Eugenia L., and the inclusion of Cleistocalyx Blume, now substantiated on both morphological and molecular grounds (Schmid 1972; Harrington and Gadek, 2004; Wilson et al., 2005; Biffin et al., 2006; Craven et al., 2006). Different plant characters may show varying degrees of form diversification or conservatism across phylogenetically related taxa (Herrera, 2004). The present study uses data from a recent systematic study of Sumatran Syzygium to investigate diversity in reproductive and vegetative plant parts. Previous study that had been done include: correlation between the resource status of a flower or individual and the proportion of reproductive resources allocated to female function in Clarkia unguiculata (Mazer and Dawson, 2000), correlation of the proportion of male relative to bisexual flowers in Leptospermum myrsinoides and L. continentale (Myrtaceae) increases among upper and outer branch positions (O'Brien, 1994; Spalik and Woodell, 1994). Correlation between plant age and proportion of plant gender e.g. in Arisaema triphyllum, younger plants are more likely to be male than female (Policansky, 1981). In this paper, Syzygium is grouped based on the degree of petals fusion. In general, there are two groups of Syzygium namely (i) species with free petals (the petals spread open at anthesis), (ii) species with coherent petals (the petals are free from each other but they closely cohere and at anthesis fall as a cap). This is sometimes described as a calyptra but it is not

WIDODO et al. â&#x20AC;&#x201C; Corellation of petal fusion degree

the same as the true calyptras found in Myrtaceae in which the calyx lobes are fused to each other and the component lobes are no longer able to be seen. However, there are a few species that may be intermediate. In general this is a good way of separating the genus into smaller groups. Craven (pers. comm., 2007) stated that although it is an artificial grouping but it can be conducted because of the very large number of species. Although section Jambosa (free petalled Syzygium) tends to have larger pollens with a proportionally larger apocolpium than section Syzygium (coherent petalled Syzygium), it does not appear possible to distinguish the species of Syzygium on the basis of features of pollen visible under SEM (Parnell, 2003). Thus In some cases, the degree of petal fusion may be important. Another reason why choosing petal fusion for the dividing character is that this character makes the division balanced. The use of other characters such as the present of hairs, leaf form, flower bud shape, fruit size, etc. may cause unbalanced divisions namely very large versus small division. This can be interpreted that the small division may be only an exception or deviation. Although scientific achievement has been gained in terms of Syzygium, we have not been able to be ready to anticipate the loss of this genus due to aspects related to environment such as the loss of habitats and ecosystems. Although the development of our understanding on Syzygium grows exponentially, the understanding on the biodiversity of these species is still not enough to plan the future of Syzygium. Therefore, a study into the selection of characters is needed. In practice, there are some problems concerning the variation of petal fusion namely most (66%) of about 2500 specimens of Syzygium at Herbarium Bogoriense are without flowers and or fruits. Difficulties faced in key writing, due to the large number of sterile specimens. The present study examines variations within plants and correlation between the degree of

3.5

3.0

petal fusion with leaf and fruit size. This allows us to seek preliminary evidence for identifying sets of integrated characteristics. Studying part of covariation and phenotypic correlations in phylogenetically related taxa may increase our understanding of plant evolution. MATERIALS AND METHODS Herbarium specimens of Syzygium from Sumatra in the Herbarium Bogoriense (BO), fresh specimens from Bogor Botanical Garden (KRB), and some fresh specimens directly collected from North and West Sumatra were examined. The specimens included 30 described taxa sampled randomly to include the specimens with free petals, free and coherent petals all together at the same specimens (intermediate), and coherent petals. Variables used were the degree of petal fusion, maximum leaf length and the maximum fruit diameter. The degree of petal fusion was scored as coherent (i), intermediate (ii), and free petalled (iii). Organ size covariation and phenotypic correlations were studied among Syzygium species. Scale relationships were investigated by regression analysis.

RESULTS AND DISCUSSION Generally, the leaf length and fruit diameter correlated positively and significantly. The leaf length also correlated positively with the degree of petal fusion and similarly the fruit diameter (Figure 1). Taxonomic studies can be useful to establish major phenotypic correlations in Syzygium. Sometimes it is difficult to determine whether the plants are free or coherent petalled due to the absence of the flowers. However, it can be solved by comparing them with the other materials from the other islands, or by predicting using correlation.

2.5

Fruit

Petal

Fruit

121

2.0

1.5

1.0 0

Leaf

0 0

Leaf

Petal

Figure 1. Positive correlation between leaf length and petal fusion degree, regression: y = 1.55 + 0.0484 x, r = 0.213 (A); positive correlation between leaf length and fruit horizontal diameter, regression: y = - 0.378 + 0.138 x, r = 0.583 (B); Positive correlation between petal fusion degree and fruit horizontal diameter, regression: y = - 0.669 + 1.05 x, r = 0.471 (C).

122

B I O D I V E R S I T A S Vol. 10, No. 3, July 2009, pp. 120-123

Figure 2. Leaves, inflorescence, and fruits of Syzygium zeylanicum (above), Syzygium zippelianum, (middle) and S. samarangense (below). The degree of petal fusion: coherent (above), intermediate (middle), free petal (below).

There is positive correlation between leaf size and the degree of petal fusion. The increase of leaf size will increase the depth of petal lobes. This phenomenon may be explained that the increase of leaf areas will increase assimilation process although lack of sun light and the petals will developed and broken into deep lobes. The leaf size correlated positively with fruit size, which means that equilibrium between leaves and fruits should be reached in order

to produce adequate size of fruits. Up to a certain point, leaf expansion has expanded fruit size. In Syzygium, if leaf length and fruit diameter changes as predicted, then (i) assuming that leaf expansion will increase the petal width due to consequences that some amount of the leaf product will be stored in the petals. (ii) assuming that the increase of petal width will increase the degree of petal fusion or petal tendency to be free because the

WIDODO et al. – Corellation of petal fusion degree

increase of size is not followed equally by the strength of fusion. In addition, the petals will be broken and freed by the stress of stamen during development. (iii) assuming that the increase of leaf area should produce larger fruits, because plants of high resource status need larger place to accumulate the product. The intermediate category of the petal fusion only occurred in a few Syzygium. Normally, plants show the following petal fusion: (i) coherent: petals are connected together, almost no lobes, resembling an operculum that will fall as a cap of the stamens and pistils; (ii) intermediate, in those species of Syzygium that are intermediate between having free or coherent petals, the petals sometimes open out just as they do in species such as S. malaccense or S. aqueum, whereas in other collections of the same species the petals remain coherent and fall as a cap. This is an uncommon feature but it can be seen in S. claviflorum (Craven, pers. comm., 2007) and S. polyanthum; (iii) completely free, the corolla is separated into lobes, normally four lobes (Figure 2).

CONCLUSION In Syzygium, the frequently visible characters such as the leaf size can be used to predict the rarely visible characters such as degree of petal fusion and fruit size. As leaf size, fruit size and degree of petal fusion correlated positively, one of these characters may be used to represent the rest. Free petals indicate large fruits, and broad leaves. Intermediate petals indicate medium sized leaves and fruits, and coherent petals indicate small leaves and fruits.

ACKNOWLEDGEMENTS We would like to thank Prof. Dr. Mien A Rifai, who has given advises and supervision to conduct this research. We acknowledge Dr. Lyn Craven for helps, information, and explanation. We also would like to appreciate some colleagues i.e. Samingan, Eddy Riwidiharso, Ilalqisny Insan, and Indarmawan who have given some suggestions.

REFERENCES Ashton, P.S. 2006. New Syzygium (Myrtaceae) from Northern Borneo. Kew Bulletin 61: 107. Biffin, E. 2005. Sorting out the confusion: Phylogenetics of large genera and the lessons from Syzygium (Myrtaceae).

123

Australian Biological Resources Study, Biology 30. Canberra: CSIRO Plant Industry,. Biffin, E., L.A. Craven, M.D. Crisp and P.A. Gadek. 2006. Molecular systematics of Syzygium and allied genera (Myrtaceae): evidence from the chloroplast genome. Taxon 55 (1): 79-94. Chaffey, C. 1999. The Blooming Lilly Pilly. Goonellabah: The Society for Growing Australian Plants. Craven L.A. 2001. Unravelling knots or platting rope: what are the major taxonomic strands in Syzygium sens. Lat. (Myrtaceae) and what should be done with them? In: Saw L.G., L.S. Chua, and K.C. Koo, (eds.), Taxonomy: The Cornerstone of Biodiversity. Proceedings of the Fourth International Flora Malesiana Symposium, Institut Penyelidikan, Kuala Lumpur, 1998. Craven, L.A, E. Biffin, and P.S. Ashton. 2006. Acmena, Acmenosperma, Cleistocalyx, Piliocalyx and Waterhousea formally transferred to Syzygium (Myrtaceae). Blumea 51: 131-142 Frodin, D.G. 2004. History and concepts of big plant genera, Taxon 53: 753-776. Govaerts, R., M. Sobral, M., Ashton, P., Barrie, F. Holst, B.,Landrum, L., Nic Lughadha, E., Matsumoto, K., Mazine, F., Proença, C., Soares-Silva, L., Wilson, P. and Lucas, E. 2008. World Checklist of Myrtaceae. The Board of Trustees of the Royal Botanic Gardens, Kew. Harrington, M.G. and P.A. Gadek. 2004. Molecular systematics of the Acmena alliance (Myrtaceae): phylogenetic analyses and evolutionary implications with reference to Australian taxa. Australian Systematic Botany 17: 63-72. Herrera, J. 2004. Phenotypic Correlations Among Plant Parts in Iberian Papilionoideae (Fabaceae). Annals of Botany 95 (2): 345. Mazer, S.J. and K.A. Dawson. 2001. Size-dependent sex allocation within flowers of the annual herb Clarkia unguiculata (Onagraceae): ontogenetic and among-plant variation. American Journal of Botany 88: 819-831 O'Brien, S. P. 1994. Andromonoecy and fruit set in Leptospermum myrsinoides and L. continentale (Myrtaceae). Australian Journal of Botany 42: 751-762 Parnell, J.A. and P. Chantaranothai. 2002. Myrtaceae. Flora of Thailand 7 (4): 778. Parnell, J.A.N., L.A. Craven, and E. Biffin. .2007. Matters of scale: dealing with one of the largest genera of angiosperms. In Reconstructing the tree of life: taxonomy and systematics of species rich taxa. In: Hodkinson, T.R. and J.A.N. Parnell. (eds.). Systematics Association Special Volume Series 72. 251-273. Parnell, J.A.N. 2003. Pollen of Syzygium (Myrtaceae) from SE Asia, especially Thailand. Blumea 48 (2): 303. Policansky, D. 1981. Sex choice and the size advantage model in jack-in-the-pulpit (Arisaema triphyllum). Proceedings of the National Academy of Sciences, USA 78: 1306-1308 Schmid, R. 1972. A resolution of the Eugenia-Syzygium controversy (Myrtaceae). American Journal of Botany 59 (4): 423-436. Schmid, R. 1980. Comparative anatomy and morphology of Psiloxylon and Heteropyxis, and the subfamilial and tribal classification of Myrtaceae. Taxon 29: 559-595 Spalik, K., and S.R.J. Woodell. 1994. Regulation of pollen production in Anthriscus sylvestris, an andromonoecious species. International Journal of Plant Science 155: 750-754. Wilson, P.G., M.M. O’Brien, M.M. Helsewood, and C.J. Quinn, 2005. Relationships within Myrtaceae sensu lato based on a matK phylogeny. Plant Systematic and Evolution 251: 3-19.

BIODIVERSITAS Volume 10, Number 3, July 2009 Pages: 124-128

ISSN: 1412-033X (printed edition) ISSN: 2085-4722 (electronic) DOI: 10.13057/biodiv/d100304

Some Notes on Biological Aspects of Captive Javan Warty Pig (Sus verrucosus) ♥

GONO SEMIADI , RADEN TAUFIQ PURNA NUGRAHA Zoology Division, Research Center for Biology, Indonesian Institute of Sciences (LIPI), Cibinong-Bogor 16911. Received: 3rd February 2009. Accepted: 28th May 2009.

ABSTRACT The Javan warty pig (Sus verrucosus) is an endemic pig to Java and Bawean Islands, while population on Madura Island is thought to be extinct. The problem in establishing ex-situ captive breeding is the lack of information on biology or physiology. A study on these aspects was conducted in 16 Javan warty pigs and 2 cadavers in Surabaya Zoo, Surabaya. Birth profile was evaluated and blood collections were conducted, as well as analysis on spermatozoa morphology. Data showed that blood parameters were not different among the age groups (juvenile and adult) or sex and within the range of 3 3 Sus scrofa. Extreme values were only obtained from the palette with the female reaching 14.5 x 10 /mm , while adult male 3 3 and juvenile pigs were 58-75 x 10 /mm . Diameter of both testicles with skin intake was 56.42 mm, with the length of left testicle being 83.29 mm and right testicle 78.88 mm. Javan warty pig spermatozoa had longer size for the head and tail lengths compared to average pigs sperms. Litter size was between two to four, with the average of 2.75 litters (SD 0.98). Low litter size in this species is something that has to be concerned from the conservation point of view, therefore a captive breeding population program needs to be considered. © 2009 Jurusan Biologi FMIPA UNS Surakarta Key words: Javan warty pig, Sus verrucosus, blood parameters, sperm.

INTRODUCTION The Javan warty pig (Sus verrucosus) is an endemic pig to Java and Bawean Islands, while the population on Madura Island is thought to be extinct (Semiadi and Meijaard, 2006). The species is believed to have emerged during the Pleistocene era, almost two millions years ago. Taxonomically, there are still some disagreements on the relation among other pig species (Suripto, 2002; Lucchini et al. 2005), however distinct characters occurred between the Javan warty pig with wild pig Sus scrofa (Suripto, 2002). Presently, in Indonesia, the species is not protected, however at International level, the IUCN Species Survival Commission has put S. verrucosus in ‘endangered’ category (IUCN, 2007). This shows that the species needs priority attention on conservation action regardless of its non protected status under the Indonesian law. To some level, the species has often been blamed as pest due to its stereotype behavior with wild pig S. scrofa.

 Correspondence address: Jl. Raya Jakarta-Bogor Km 46, Cibinong-Bogor 16911 Tel. & Fax.: +62-21-8765056 & 8765068 e-mail: semiadi@yahoo.com

Last field survey indicated that the distribution of the species is now fragmented into several small pockets habitat with unknown size of population. Hence, it is believed the population number has decreased drastically since the past study (Semiadi and Meijaard, 2003; 2006). Those decreases are mainly due to hunting activities in the past 10-20 years ago, along with the expansion of the agricultural lands and production forests. Therefore, a conservation effort is needed to save the species through the development of ex-situ facilities with target populations for re-introduction programs. The main problem in ex-situ development is the limited information on the biology and physiology of the species. Therefore, some observations taken from captive animals were conducted with the aim to gain more information on the biology or physiology of the Javan warty pig.

MATERIALS AND METHODS The study was conducted in Surabaya Zoo, Surabaya, East-Java, using captive Javan warty pigs (Sus verrucosus) that were put in several exhibition and quarantine pens. The majority of the animals were born in captivity, and only two animals were traceable for their origins.

SEMIADI & NUGRAHA – Biology Sus verrucosus in captivity

Birth profile Birth profile was evaluated from the Surabaya Zoo database with the calculation on mean birth date followed Semiadi et al. (1994). Dates of birth were transformed to numerical sequence in Excel (Microsoft Excel 2003) and calculated the mean and standard deviation, and then re-transformed to the actual date.

125

an equivalent value of 9.3 pixel/micrometer. Spermatozoa parameters and area analysis followed Kondracki et al. (2005), whereas spermatozoa head total area was calculated following Révay et al. (2004). Apart from one adult cadaver, one male juvenile (1.5 months) Javan warty pig cadaver was also inspected for any specific characters. All data were processed in Excel (Microsoft Excel 2003) followed by simple statistic calculations.

Blood collection Blood collection was conducted in 16 (♂= 9; ♀= 7) mixed ages (juvenile, adult, old) Javan warty pigs which were captured using net. Blood was collected RESULTS AND DISCUSSION either from jugular vein or fore-legs/hind-legs vein, using 5 cc syringe with a 0.5 inch x 20G needle. Blood parameters analysis revealed that no big Collected blood was split into two portions, half of variations exist among sex or age groups. The only which was transformed into blank vials, and the other extreme value was on a palette parameter (PLT, half into vials filled with ethylene diamenetetraacetic 103/mm3), in which female group had a value of 14.5 acid (EDTA). Within two hours after the collection, all x 103/mm3, compared to the adult male and juvenile blood samples were transported to the designated groups with only 58-75 x 103/mm3. Since the best Surabaya Zoo Medical Laboratory (Laboratorium normal parameters of blood values of any species Medik Prodia) for analysis according to a protocol that collected should be on specific sex and age has been set and calibrated for wildlife animals. categories, the current data are meant as a general Hematological analysis was run on Advia.12.0 seri guidance only until more data are obtained. In 411.OT76011 (USA) and biochemical analysis was general, the range of each parameter was not too run on Modular P.800 (Roche, France). Table 1. Comparisons on blood hematological and biochemical parameters of Since the sample numbers several pig species. were considered minimal, data were pooled and analyzed Parameters S. verrucosusa S. domesticusb S. domesticusc S. scrofac S. s. aferuse descriptively. Spermatozoa morphometry Semen was collected from cauda epididymis through aspiration using 10 μL micropipette in one adult cadaver. Five μL of collected semen was then diluted into 995 μL buffer formolsaline solution and kept in tight vials. In the Reproduction Laboratory, Research Centre for Biology LIPI, Cibinong-Bogor, semen was processed as wet mount and evaluated under phase contrast microscope at 40x magnification (Nikon Optiphot2), attached to a Nikon FDX 35 camera for documentation. The photos were then scanned at 600 dpi. resolution (Canon 3000 F) and analyzed using Image J ver. 3.7 program. To transform the pixel value into metric unit, one pixel produces by the Image J ver. 3.7 program was calibrated using micrometer photo at similar magnification, resulting

Tot Prot (g/dL) 5.80-10.30 5.83-8.32 6.5-9.0 7.7±0.58 8.21±0.38 Albumin (g/dL) 2.30-5.50 2.26-4.04 31-43 4.3±0.36 4.08±0.29 Globulin (g/dL) 3.30-6.90 3.95-6.00 3 3 WBC (10 /mm ) 6.10-7.87 11-22 10.6-24.0 11.5±3.24 9.79±4.27 6 3 RBC (10 /mm ) 7.94-8.90 5-7 5.1-8 5.7±1.06 8.0±0.68 HGB (g/dL) 15.90-18.80 9-13 10-17 12.0±2.15 15.7±1.73 HCT (%) 54.60-68.80 36-43 3 3 PLT (10 /mm ) 12.00-75.00 200-500 310 3 MCV (µm ) 65.20-77.40 52-62 52-63 63.0±4.04 77.5±5.13 MCH (pg) 18.40-22.00 17-24 18-22 21.0±1.38 MCHC (g/dL) 27.10-32.20 29-34 34-380 33.5 CHCM (g/dL) 27.20-30.70 RDW (%) 16.00-17.20 HDW (g/dL) 1.83-2.41 3 MPV (um ) 8.00-11.70 PDW (%) 7.00-68.30 PCT (%) 0.01-0.07 LI (%) 0.00-2.39 NEUT (%) 22.40-37.50 20-70 15.1-59.5 LYM (%) 11.30-23.10 35-75 25.5-71.1 MON (%) 42.30-51.90 0-10 1-14 EOS (%) 0.00-0.60 0-15 1-13 BASO (%) 0.80-15.30 0-3 0-3 LUC (%) 0.70-3.50 3/ 3 # NEUT (10 mm ) 1.37-2.48 2-15 1.9 -10.1 5.7±2.90 3/ 3 # LYM (10 mm ) 0.75-1.67 3.8-16.5 3.7-14.7 5.3±2.29 3/ 3 # MON (10 mm ) 3.11-3.76 0-1 0-2.4 0.203 3/ 3 # EOS (10 mm ) 0.00-0.04 0-1.5 0-2,4 0.139 3/ 3 # BASO (10 mm ) 0.06-0.94 0-0.5 0-0,5 0.150 3/ 3 # LUC (10 mm ) 0.06-0.23 BLAST (%) 0.10-1.20 a b c d Note: Present data; Merck (2006); Brockus et al. (2005); Friendship et al. e (1984); Harapin et al. (2003).

126

B I O D I V E R S I T A S Vol. 10, No. 3, July 2009, pp. 124-128

different from S. scrofa and domesticated pigs (Table 1). The only parameters which gave distinct differences with other pig species were on hematocryte, lympocyte and monocyte. Testicle shape was similar to common pig species, with the diameter of both testicles with skin intake was 56.42 mm, and length for the left part was 83.29 mm and right part was 78.88 mm. Specific character was observed on spermatozoa where head and tail length tended to be longer compared to S. scrofa or S. s. domesticus (Tables 2 and 3). High cytoplasmic droplet was found in almost all spermatozoa being evaluated (Figure 1). Cytoplasmic droplet is a remnant of the germ cell cytoplasm, that remains adherent at the neck region of the elongating spermatid when it is shed as a testicular spermatozoon at spermiation during normal spermatogenesis (Cooper, 2005). In boar and goat, spermatozoa from the cauda epididymis have a high percentage of distal cytoplasmic droplets that can reach more than 93% (Kato et al., 1996). Whereas in the Javan warty pig, the majority cytoplasmic droplets observed were found at midpiece reaching 97%.

Figure 1. Spermatozoa of adult Javan warty pig (S. verrucosus) at 40 x magnification, using phase contrast microscope. Bar= 25 μm (Photo: R.T.P Nugraha).

Table 2. Sperm morphometry of adult S. verrucosus. Head Tail 2 Width (μm) Length (μm) Area (μm ) Length (μm) Means 4.86 9.95 38.54 48.01 Stdev. 0.433 0.488 3.234 2.420 Max. 7 11 32 53 Min. 3 8 46 36

Carpal-gland which was located posteriorly on the fore-legs consisted of four lobes that were arranged in line. (Figure 2). The structure of the carpal gland had been visible since 1.5 months old, but with smaller size compared to that the adult ones. In adult pig, the distance between lobes varied from 9.00 mm to 14.75 mm, and the diameter from 0.15 mm to 0.30 mm, from the lower to the top position, respectively. The function of the lobes gland was believed as scent gland in the defensive behavior of reproductive females or as a communication strategy as it is shown in Sus domesticus (Heise-Pavlov, 2005). The number of lobes in this study was less than other Suidae which has five to seven lobes as stated by Farnesi et al. (1999). Hoof size of adult pig was shown in Table 4, whilst warts and body size was shown in Tables 5 and 6. Necropsy of fresh warts showed no fat deposit and the tissue was firm. Body size of adult cadaver was within the range of common pig species such as S. scrofa (body length 128.7 cm, body weight 56.7 kg, tail length 19.6 cm, ear length 13.1 cm and age 13-18 months; Moretti, 1995). Three years birth profile (2003-2005) showed a mean birth date of 01 May (SD 60.57 days, n=4), with the range of birth month from March to August. Litter size was considered low, only 2-4 individuals, with the mean 2.75 individuals (SD 0.98, n= 4). No sex ratio was able to determine. Local hunters in West Java

B Figure 2. Gland lobes on fore-legs of adult (A) and juvenile (B) Javan warty pig S. verrucosus (Photo: G. Semiadi).

SEMIADI & NUGRAHA – Biology Sus verrucosus in captivity

127

Table 3. Comparison of spermatozoa morphometry in several pig species. Species

References

S. verrucosus S. scrofa S. s. domestica S. s. domestica

Present study Gage (1998) Hirai et al. (2001) Kondracki et al. (2005)

Width (μm) 4.86  0.43 5.0 4.66  0.02 4.88  0.28

noted that litters size of wild Javan warty pigs was 50% less of that the S. scrofa (Semiadi, 2005; unpublished data). Coblentz and Baber (1987) reported that litter size of S. scrofa was between 1-10 individuals, with the mean of 4.7 individuals and mortality rate at 19 weeks old reaching 52%. Whereas Baber and Coblentz (1986) showed the mean of litter size for several pig species were between 4.2-7.4 individuals, with post weaning mortality reaching 12.5-34.7%. This shows that in Javan warty pig, low litter size could be a limitation on the success of captive breeding for the re-introduction program within a short period of time, unless excessive numbers of founders are available. Table 4. Hoof measurements of adult male Javan warty pig S. verrucosus.

Length (mm) Width (mm)

Fore-legs Left Right 46.74 43.96 22.28 22.28

Back-legs Left Right 44.67 41.97 19.39 18.83

Table 5. Warts size of adult male Javan warty pig S. verrucosus. Lateral Distal (Width) (Length) Under the eyes (mm) 28.56 22.43 On cheek (mm) 120.45 Close to eyes 39.45 Centre 15.27 Bottom 23.40 On nose (mm) 37.72 21.88

Table 6. Body measurements of adult male Javan warty pig S. verrucosus. Parameters Body length (nose to tail bone) Tail length Girth diameter Ear length

Size (cm) 125.0 19.5 87.0 10.95

CONCLUSIONS From this study it was shown that normal blood parameters of Javan warty pigs were within the range of commonly found pigs. However, the pig had low number of litter per birth.

Head Length (μm) 9.95  0.49 8.1 9.27  0.05 9.37  0.44

Area (μm ) 38.54  3.23 -35.7  0.22 41.17  2.68

Tail Length (μm) 48.01  2.42 28.8 -46.26  1.75

ACKNOWLEDGEMENTS Authors wish to thank the Head of Surabaya Zoo and the staff for the permit and cooperation in using and handling the animals. Rosita Sulis Tanty was appreciated for her willingness in collecting the blood and Dr. Arjan Boonman for his comments on the manuscript. This study was funded by Proyek DIPA Puslit Biologi LIPI and part of the analysis was funded through Zoologische Gesellschaft für Arten- und Populationsschutz e.V. (ZGAP), München, Germany.

REFERENCES Baber, D.W. and B.E. Coblentz, 1986. Density, home range, habitat use and reproduction in feral pigs on Santa Catalina, Califronia. Journal of Mamalogy 67: 512-525. Coblentz, B.E. and D.W. Baber. 1987. Biology and control of feral pigs on Isla Santiago, Galapagos Equador. Journal of Applied Ecology 24: 403-412. Cooper, T.G. 2005. Cytoplasmic droplets: the good, the bad or just confusing?. Human Reproduction 20: 9-11. Farnesi, R.M., D. Vagnetti, B. Santarella, and S. Tei. 1999. Morphological and ultrastructural study of carpal organ in adult female wild swine. Anatomica, Histologia, Embryologia 28:3138. Gage, M.J.G. 1998. Mammalian sperm morphometry. Proceeding of the Royal Society of London B. 265: 97-103. Heise-Pavlov, S., P. Heise-Pavlov, and A. Bradley, 2005. Carpal glands in feral pigs (Sus domesticus) in tropical lowland rainforest in north-east Queensland, Australia. Journal of Zoology, London. 266:73-80. Hirai, M., A. Boersma, A. Hoeflich, E. Wolf, J. Foll, T.R. Aumuller, and J. Braun. 2001. Objectively measured sperm motility and sperm head morphometry in boars (Sus scrofa): relation to fertility and seminal plasma growth factors. Journal of Andrology 22: 104-110. IUCN. 2007. IUCN Red List of Threatened Species. www.iucnredlist.org. Kato, S., T. Shibukawa, H. Harayama, and Y. Kannan. 1996. Timing of sheding and disintegration of cytoplasmic droplets from boar and goat spermatozoa. Journal of Reproduction Development 42: 237-241. Kondracki, S., D. Bonaszewska, and C. Mielnicka. 2005. The effect of age on the morphometric sperm traits of domestic pigs (Sus scrofa domestica). Cell & Molecular Biology Letter 10: 3-13. Lucchini, V., E. Meijaard, C.H. Diong, C.P. Groves, and E. Randi, 2005. New phylogenetic perspectives among species of Southeast Asian wild pig (Sus sp.) based on mtDNA sequences and morphometric data. Journal of Zoology, Lond. 266: 25-35. Moretti, M. 1995. Biometric data dan growth rate of a mountain population of wild boar (Sus scrofa L.) Tikino Switzerland. IBEX. Journal of Mountain and Ecology 3: 56-59. Révay, T., S. Nagy, A. Kovács, M.E. Edvi, A. Hidas, W. Rens, and I. Gustavsson, 2004. Head area measurements of dead, live, X- and Y-bearing bovine spermatozoa. Reproduction Fertility and Development 16: 681-687.

128

B I O D I V E R S I T A S Vol. 10, No. 3, July 2009, pp. 124-128

Semiadi, G., P.D. Muir, and T.N. Barry. 1994. General biology of sambar deer (Cervus unicolor) in captivity. New Zealand Journal of Agricultural Science 37: 79-85. Semiadi, G. and Meijaard, E. 2003. Survai Keberadaan Babi Kutil (Sus verrucosus) di Pulau Jawa dan Sekitarnya. [Laporan Akhir]. Bogor: Puslit Biologi LIPI & IUCN PPSG.

Semiadi, G. and E. Meijaard. 2006. Declining populations of the Javan Warty pig (Sus verrucosus). Oryx 40: 50-56. Suripto, B.A. 2002. Babi hutan (Sus spp.) di Pulau Jawa, masa lalu, masa kini dan masa mendatang. Prosiding Seminar Nasional Bioekologi dan Konservasi Ungulata. IPB, LIPI & Puslitbanghut, Bogor, 5 Pebruari 2002.

BIODIVERSITAS Volume 10, Number 3, July 2009 Pages: 129-133

ISSN: 1412-033X (printed edition) ISSN: 2085-4722 (electronic) DOI: 10.13057/biodiv/d100305

The Effect of Mulching Technology to Enhance the Diversity of Soil Macroinvertebrates in Sengon-based Agroforestry Systems SUGIYARTO

1,2,3,♥

Biology Department, Faculty of Mathematics and Natural Sciences, Sebelas Maret University (UNS), Surakarta 57126 2 Bioscience Program, Post-Graduate Program, Sebelas Maret University (UNS), Surakarta 57126 3 Research and Development Center for Biotechnology and Biodiversity, Sebelas Maret University (UNS), Surakarta 57126 Received: 28th January 2009. Accepted: 11th March 2009.

ABSTRACT Soil macroinvertebrate are strongly influenced by environmental factors. The change of agronomic technology may affect their role in maintaining soil fertility and crop production. The aim of this study was to know the effect of technology of mulching to enhance diversity of soil macroinvertebrate in sengon-based agroforestry system. Field experiment was arranged in randomized block design with treatment i.e. with and without organic matter mulching. Sweet potato used as tested intercrop. Collection of soil macroinvertebrate was carried out using a hand sorting and pit-fall trap methods. Result of the study showed that application of maize residue as mulch enhanced diversity index of surface and deep soil macroinvertebrate, i.e: 0.215 and 0.214 (by 44% and 73% respectively compared no mulching). Organic mulching technology can support diversity of beneficial soil macroinvertebrates. © 2009 Biodiversitas, Journal of Biological Diversity Key words: agroforestry, soil macroinvertebrates, sengon (Paraserianthes falcataria), mulching.

INTRODUCTION Land degradation is an important part of global crisis. Rising population pressure and urbanization, combined with land degradation, soil salinization, and global warming have been causing food insufficiency. Controlling the land degradation and their rehabilitation programes may enhance land productivity and contribute to human needs (Edgerton, 2009; Kumar, 2008). Soil biodiversity conservation is an important part of agricultural dan silvicultural management to maintain their production. There are intercorrelation between soil biodiversity, especially soil macroinvertebrates with crop production (Sugiyarto, 2004). Soil macroinvertebrates influence soil processes, which may affect both the physical and chemical fertility of soils (Lavelle and Pashanasi, 1989). Soil macroinvertebrates contribute to the maintenance and productivity of agrosystems. Okwakol (1994) observed a declining trend in fauna biomass and soil chemical properties, indicating that soil macrofauna had a direct effect on soil properties. Soil macroinvertebrates maintain soil physical, chemical and biological fertility by immobilization, humification,  Corresponding address: Jl. Ir. Sutami 36A Surakarta 57126 Tel. & Fax.: +62-271-663375 e-mail: sugiyarto_ys@yahoo.com

biocontrol processes and play role as decomposer as well as soil engineer to encourage crop production (Lavelle et al., 1994; Hagvar, 1998). Soil macroinvertebrates belong to soil macrofauna with have no vertebrates. The macrofauna consists of animals with body longer than 4 mm or wider than 2 mm, which are visible to the naked eye (Gorny dan Leszek, 1993). In total, more than 20 taxonomic groups are involved including arthropods, mollusks and earthworms. The Coleopteran or beetles tend to the most diverse (Brown et al., 2001). They can be further divided into three groups, which play different roles in the ecosystem: the epigeics, anecics and endogeics (Lavelle et al., 1994). The epigeics live and feed on surface litter including saprophagous arthropods and pigmented small earthworms, as well as predators of this group (chilopods, ants and some coleopteran). Anecics on the other hand feed on surface litter but build subterranean burrows and nests that provide shelter. They consist of some large pigmented earthworms and the majority of termite species. The endogeics live in the soil and consist mainly of termites and unpigmented earthworms. Based on their behavior and sampling technical, soil macroinvertebrates are differed to below-ground or deep soil macroinvertebrates and above ground or surface soil macroinvertebrates (Adianto, 1993; Sugiyarto, 2004). In organic matter decomposition processes, soil macroinvertebrates contribute to fragmentation/

130

B I O D I V E R S I T A S Vol. 10, No. 3, July 2009, pp. 129-133

comminution and facilitate to bacteria and fungi in mineralization processes (Lavelle et al., 1994). Soil macroinvertebrates also play role in nutrient transportation or distribution, enhancing properties of soil structure and soil forming. So they are important to maintain soil fertility and soil healthy (Adianto, 1993; Foth, 1994; Brown et al., 2001). Soil macroinvertebrates diversity show intercorrelation with ecosystem function, but there little information and no profound interest to their conservation (Lavelle et al., 1994; Hagvar, 1998). Soil communities, especially soil macroinvertebrates, are strongly influenced by environmental factors, and any change in land use may change their communities (Wallwork, 1970). From the moment a natural system is modified by human activities for agricultural purposes, major changes occurred the soil environment and to the flora and fauna populations and community present (Brown et al., 2001). Simple correlation analysis indicates that soil macrofauna diversity was closely related with soil organic content, soil humidity, domination of ground vegetation and level of light penetration (Sugiyarto, 2000). Surface soil macrofauna diversity at forest habitat, especially at pine stands, were higher level than at cultivated plants habitat (Sugiyarto et al., 2002). Schefflera aromatica showed best influence to increase soil mesofauna diversity, compared with other forest stand at Jobolarangan forest area (Sugiyarto et al., 2001). Land-use changes from mixed forest to sengon plantation in monoculture and agroforestry system degrade diversity of macroinvertebrates. The soil macroinvertebrate in sengon plantation (non-agroforestry) system and in sengon-based agroforestry system, i.e: 0.16 and 0.09 (decreased 47% and 70%, respectively, compared with mix forest (Sugiyarto, 2004). The effects of clearing, however, and of change in land use, on soil macroinvertebrates have not been widely quantified (Lal, 1987). The tropical rain forests, for instance, are known for their richness. Soil invertebrates diversity and abundance are strongly depend on environmental factors, especially quality and quantity of organic matter as food source and maintaining physic-chemical environment stability (Maftuâ&#x20AC;&#x2122;ah et al., 2002; Sari et al., 2003). The combination of the various practice adopted by farmers at a particular site are important in determining the soil fauna community and provide an important entry point and opportunity for managing their populations, enhancing their beneficial activities and reducing their negative effects on soil fertility and agricultural production (Brown et al., 2001). Organic matters management system is the key-factor in soil macroinvertebrates conservation. Mulching is one of agronomical technology to ensure organic matter supply. To support organic matter supply in mulching technology, there is important to develop intercropping system, especially agroforestry system, with produce more crops

residue. Agroforestry, or woody perennial-based mixed species production systems, has the potential to arrest land degradation and improve site productivity through interactions among trees, soil, crops, and livestock, and thus restore part, if not all, of the degraded lands. Food production either directly (producing food grains, root crops, fruits, and vegetables) or indirectly (improving soil conditions and thereby promoting understorey crop productivity especially on degraded sites) constitutes the central theme of most smallholder agroforestry practices (Kumar, 2008). There are many intercrop species producing crops residue in sengon (Paraserianthes falcataria)-based agroforestry system at Jatirejo forest resort, district of Kediri, East Java. Maize (Zea mays L.) is the most dominant intercrop potentially as source of crops residue (Sugiyarto et al., 2007). The aim of this research is to study the affectivity of mulching technology in enhancing soil macroinvertebrates diversity at the sengon-based agroforestry system. The source of mulch is maize crop residue. Tested intercrop/ understorey species is sweet potato (Ipomoea batatas).

MATERIAL AND METHODS The research was carried out in sengon plantation at Jatirejo forest resort, district of Kediri, East Java. The field experiment was arranged in randomized complete block design with treatment i.e: with and without organic matter mulching in four replicates. Dry maize crop residue was used as mulch with doses be equally 15 mg/ha. Soil was plowed and made pile in the same direction with sengon plantation line. The 2 experiment block area was (3 x 5) m . Distance of these block area were 100 cm. Sweet potato used as test intercrop arranged in population be equally 67.134 plant/ha. Collection of soil macroinvertebrate was carried out using a hand sorting method for deep soil macroinvertebrates and pit-fall trap method for th th th th surface soil macroinvertebrates in 4 , 8 , 12 , 16 , th and 20 weeks after planted. Samples which be collected was quantified and identified in laboratory of Biology, Faculty of Mathematics and Natural Sciences, Sebelas Maret University, Surakarta, Central Java referred to Burges and Raw (1967), Wallwork (1970), Borror et al., (1992), Gorny and Leszek (1993), and (Suin, 1997). Soil macroinvertebrates diversity value found expression in modified Simpson diversity index (Sugiyarto, 2004) with equation: 2

D = (1-ÎŁ (pi) (qi); D: diversity index pi: sum of individual in one species/sum of individual in total species qi: sum of species in one observation unit / sum of species in all observation unit

SUGIYARTO – Diversity of soil macroinvertebrates in sengon stand

RESULTS AND DISCUSSION Soil is a living entity, comprising an inseparable mixture of solid, liquid and gaseous phases, and diverse fauna and flora, the below ground biodiversity. It is capable of supporting biological growth, and is in equilibrium with its environment. Soil macroinvertebrates is little part of below ground biodiversity but take important role in soil function, especially in organic matter decomposition processes and fixed up soil physical properties. Their existence showed different response to their environment, but their population tend to increase by rising of organic matter available (Crossley et al., 1992). High soil macroinvertebrate diversity and quantity were showed in complex/mixture of different organic matter or low quality (high C/N ratio) of organic matter. Sugiyarto et al. (2007) stated that maize, sengon and elephant grass residue affected higher population of soil macroinvertebrates than sweet potato and papaya residue application. Result of this research showed that age of sweet potato as intercrop in sengon-based agroforestry system affected soil macroinvertebrates diversity (Figure 1). Increasing of sweet potato age is followed by enhancing of soil macroinvertebrates diversity index, especially on mulching application. Diversity index of surface soil macroinvertebrates increase from 0.092 on fourth week after planted to 0.228 on twentieth week after planted (enhancing 148% respectively). In the same case diversity index of deep soil macroinvertebrates increase from 0.107 on fourth week after planted to 0.210 on twentieth week after planted (enhancing 96% respectively). At without mulch application treatment showed that after twelfth week after planted both surface and deep soil macroinvertebrates diversity index tended to stable or decreased. Covering level of intercrop at different age and mulching may be act as the major factor supported

soil macroinvertebrates existence. This phenomenon explained that soil macroinvertebrates need aboveground vegetation and mulch as source of food and to protect from environmental disruption, i.e: predator, high light intensity, high temperature, force of rainfall and running off, etc. Brown et al. (2001) mentioned that common agricultural practices giving positive effect on the soil biota, i.e. organic matter (mulch, manure, etc.), less physical disturbance (tillage), green manure, soil covers, crop rotations, liming, fertilization and organic agriculture. Sugiyarto et al. (2007) showed that most of soil macroinvertebrates tend to avid risk of open space or high light intensity. Faunal populations often decline when natural habitats are cleared (Watanabe et al., 1983). Work in the Mabira Forest Reserve in Uganda showed that forest clearance and cultivation have deleterious effects on soil macrofauna communities (Okwakol, 1994, 2000). In a few instances, however, faunal densities and diversity increase following clearing of forest or woodland. Okwakol (1994) reported soil −2 macrofaunal density of 1247 m in cleared and −2 uncultivated site compared with 863 m in the natural forest. Most of the gain was attributed to a dramatic increase in the density of termites as well as increase in the density of predatory surface-active fauna such as spiders, ants and centipedes. This trend was partly attributed to the abundant food supply for wood and litter feeding species. Collins (1980) has showed that type of vegetation has often been shown to be a major determining factor of soil fauna abundance. As land conversion occurs, the above-ground biodiversity is reduced. This impacts the associated soil macrofauna thus lowering the biological capacity of the ecosystem for self regulation. Zake et al. (1994) noted that banana plantations also supported −2 estimated weight biomass of 4.55 g m and macrofauna biomass formed a relatively similar trend to that of organic matter and banana yield.

without mulching

mulching

Diversity index

without mulching

131

Age (weeks after planting) A

Age (weeks after planting) B

Figure 1. Surface (A) and deep (B) soil macroinvertebrate diversity index in sengon-based agroforestry system with and without mulching application.

132

B I O D I V E R S I T A S Vol. 10, No. 3, July 2009, pp. 129-133

This research showed that surface soil macroinvertebrates more responsive to the environment alteration than deep soil macroinvertebrates one. Differ with surface macroinvertebrates, beside be protected by above-ground material, deep soil macroinvertebrates also protected by soil itself. More, the surface soil macroinvertebrates, especially most of insects, chilopods and arachnids, can migrate to another habitat to escape or avoid some disruption. In a survey of termites in natural forest, a cleared but not cultivated site and six sites cultivated for over different periods distinct differences between systems were observed. Twenty-four species, including Odontotermes amanicus (Sjostedt) and Microtermes luteus (Harris), both not previously identified in Uganda, were recorded in natural forest (Okwakol, 2000). Forest clearance resulted in drastic reduction in the number of species to about 40% of what existed in natural forest while cultivation led to further reduction to <20%. Clearance of forests has both direct and indirect effects on termites as disturbance removes vegetation, destroys nest sites, alters the soil environment and food sources and leads to exposure to predators and parasites (Black and Okwakol, 1997). Scientists have begun to quantify the causal relationships between (i) the composition, diversity and abundance of soil organisms, (ii) sustained soil fertility and associated crop production, and (iii) environmental effects, including soil erosion, greenhouse gas emissions and soil carbon sequestration (Lavelle et al., 1997). This research result showed that mulching technology with maize residue enhanced both surface-and deep soil macroinvertebrates diversity index in sengon-based agroforestry system (Table 1). By mulching application surface soil macroinvertebrate diversity index enhanced from 0.149 to 0.215 (increase 44% respectively), and deep soil macroinvertebrate diversity index enhance from 0.124 to 0.214 (increase 73% respectively). This results reflected multifunction of mulch. It enhance soil macroinvertebrates directly, and also supported more expansive sweet potato growth giving good protection and source of food for soil macroinvertebrates. This showed the important role of mulch to support existence of most species of soil macroinvertebrates like the previous researcher finding (Maftuâ&#x20AC;&#x2122;ah et al., 2002; Sari et al., 2003). Maize residue is a low quality organic matter that decomposed slowly. Their supplies as mulch give longtime protective function for soil macroinvertebrates. On the contrary, sweet potato and sengonâ&#x20AC;&#x2122;s residue on this system supplied a lot of food for soil macroinvertebrates and nutrient to ensure the vegetation growth. All of this service factors created suitable environment for soil macroinvertebrates (Sugiyarto et al., 2007).

Table 1. Soil macroinvertebrates diversity index in sengonbased agroforestry system with and without mulching application treatments. Treatment

Soil macroinvertebrates diversity index Without mulch 0.149 (Surface) 0.124 (Deep) With mulch 0.215 (Surface) 0.214 (Deep)

Dominate soil macroinvertebrates Odontomachus sp. Pontoscolex corethrurus Lobopelta ocellifera Pontoscolex corethrurus

By mulching technology, diversity index of deep soil macroinvertebrates enhanced more dramatically than surface soil macroinvertebrates (Table 1). These indicated that mulch give long-term beneficial to amelioration of soil environment by food-web regulation. Like the previous discussion that deep soil macroinvertebrates are more stable community than surface soil macroinvertebrate. Beside creating a suitable physic-chemical environment, mulching increased surface soil macroinvertebrate potentially as food source for various deep soil predators. So directly, the increasing of surface soil macroinvertebrates population and diversity enhance diversity of deep soil macroinvertebrate. Sugiyarto (2004) concluded that there was positive intercorrelation between surface-and deep soil macroinvertebrate diversity index. Earthworm (Pontoscolex corethrurus) as a soil fertility indicator dominated to deep soil macroinvertebrate community, both with and without mulching application. This species is a decomposer as well as soil engineer. On other hand, there was a difference dominancy of surface soil macroinvertebrate in mulch treatment (Lobopelta ocellifera) and no mulch treatment (Odontomachus sp.) (Table 1). Odontomachus sp. is a phytophage species potentially as pest, but L. ocellifera is a predator species potentially as biocontrol agent. These gave evidence that mulching can support to the diverse of beneficial soil macroinvertebrates. Brown et al. (2001) mentioned two main types of classification of soil macrofauna according their function in the soil and crop system, i.e: beneficial group (sapro-, copro-, and necrophages as decomposers or mineralizer; geophages as bioturbators and predators as biocontrol agents) and adverse group (phytophages as parasites or pests). Availability of crop residues as mulch, in other hand, may be able to be alternative food source for some phytophages so it can reduce the intensity of pest herbivory activity. CONCLUSIONS Enhancing soil macroinvertebrate diversity on sengon-based agroforestry system can be optimized by returning of intercrop residue in mulching

SUGIYARTO â&#x20AC;&#x201C; Diversity of soil macroinvertebrates in sengon stand

technology. Application of maize residue as mulch enhanced diversity index of surface-and deep soil macroinvertebrate, i.e. from 0.149 and 0.124 to 0.215 and 0.214 (by 44% and 73% respectively compared no mulching). Organic mulching technology can support to the diverse of beneficial soil macroinvertebrates.

REFFERENCE Adianto. 1993. Biologi Pertanian Pupuk Kandang, Pupuk Organik dan insektisida. Bandung: Penerbit Alumni. Black, H.I.J. and M.J.N. Okwakol, 1997. Agricultural intensification, soil biodiversity and agroecosystem function in the tropics: the role of termites. Applied Soil Ecology 6: 37-54. Borror, D.J., C.A. Triplehorn, and N.F. Johnson, 1992. Pengenalan Pelajaran Serangga. Penerjemah: Soetiyono, P. dan D.B. Mukayat. Yogyakarta: Universitas Gadjah Mada Press. Brown, G.G., Pasini, A., Benito, N.P., de Aquino, A.M. and M.E.F. Correia. 2001. Diversity and functional role of soil macrofauna communities in Brazilian no-tillage agroecosystems: a preliminary analysis. International Symposium on Managing Biodiversity in Agricultural Ecosyatems. Montreal, 8-10 November 2001. Burges, A., and F. Raw. 1967. Soil Biology. London: Academic Press. Collins, N.M. 1980. The distribution of soil macrofauna on the west ridge of Gunnung (mount) Mulu, Sarawak. Ecologia 44: 275283. Crossley, Jr. D.A., B.R. Mueller, and J.C. Perdue. 1992. Biodiversity of microarthopds in agricultural soil: relations to processes. Agriculture, Ecosystems & Environment 40: 37-46. Edgerton, M.D. 2009. Increasing crop productivity to meet global needs for feed, food, and fuel. Plant Physiology 149: 7-13. Foth. H.D. 1994. Dasar-dasar Ilmu Tanah. Penerjemah: Soemarto, S.A. Jakarta: Penerbit Erlangga. Gorny, M. and G. Leszek. 1993. Methods in Soil Zoology. Warsaw: Polish Scientific Publishers. Hagvar, S. 1998. The relevance of the Rio Convention on Biodiversity to conserving the biodiversity of soil. Applied Soil Ecology 9: 40-45. Kumar, B.M. 2008. Agroforestry: the new old paradigm for Asian food security. Journal of Tropical Agriculture 44 (1-2): 1-14. Lal, R. 1987.Typical Ecology and Physical Haplology. John Wiley & Sons, New York. Lavelle, P. and B. Pashanasi. 1989. Soil macrofauna and land management in. Peruvian Amazonia (Yurimaguas, Loreto). Pedobiologia, 33:283-291 Lavelle, P., D. Bignell, M. Lepage, V. Wolters, P. Roger, P. Ineson, S. Dhillion. 1997. Soil function in a changing world: the role of invertebrate ecosystem engineers. European Journal of Soil Biology. 33: 159-193.

133

Lavelle, P., M. Dangerfield, C. fargoso, V. Eschenbremer, D. Lopez-haernandes, B. Pashanashi, and L. Brussard. 1994. The relationship between soil macrofauna and tropical soil fertility. In: Woomer, P.L., and N. Swift (eds.). The Biological Management of Tropical Soil Fertility. Chichester: John Wiley and Sons. Maftuâ&#x20AC;&#x2122;ah, E., E. Arisoesiloningsih, dan E. Handayanto. 2002. Studi potensi diversitas makrofauna sebagai bioindikator kualitas tanah pada beberapa penggunaan lahan. Biosain 2 (2): 34-47. Okwakol, J.M.N. 1994. The effect of change in land use on macro fauna communities in Mabira Forest, Uganda. African Journal of Ecology 32: 273-282. Okwakol, M.J.N. 2000. Changes in termite (Isoptera) communities due to the clearance and cultivation of tropical forest in Uganda. African Journal of Ecology 38: 1-7. Sari, S.G., E.A. Soesiloningsih, dan A.S. Leksono. 2003. Peningkatan diversitas fauna tanah kritis berkapur di lahan jagung melalui sistem tumpangsari DAS Brantas Kabupaten Malang. Dalam: Agustina, L., D.A. Syekhfani, U. Sunarto, Setyobudi, H. Tarno, dan M. Muhtar (ed.). Memasyarakatkan Pertanian Organik sebagai Jembatan Menuju Pembangunan Pertanian Berkelanjutan. Prosiding Lokakarya Nasional Pertanian Organik. Malang: Penerbit Fakultas Pertanian, Universitas Brawijaya. Sugiyarto, D. Wijaya, dan S.Y. Rahayu. 2002. Biodiversitas Hewan Permukaan Tanah pada Berbagai Tegakan Hutan di Sekitar Goa Jepang, BKPH Nglerak, Lawu Utara, Kabupaten Karanganyar. Biodiversitas 3 (1): 196-200. Sugiyarto, M. Effendi, E. Mahajoeno, Y. Sugito, E. Handayanto, dan L. Agustina. 2007. Preferensi berbagain jenis makrofauna tanah terhadap sisa bahan organik tanaman pada intensitas cahnaya berbeda. Biodiversitas 8 (2): 96-100. Sugiyarto, Pujo M, dan Nursihmiati. 2001. Hubungan Keanekaragaman Mesofauna Tanah dengan Vegetasi Bawah pada Berbagai Tegakan Hutan Jobolarangan. Biodiversitas 2 (2): 140-145 Sugiyarto. 2000. Keanekaragaman Makrofauna Tanah pada Berbagai Umur Tegakan Sengon di RPH Jatirejo, Kabupaten Kediri. Biodiversitas 1 (2): 47-54. Sugiyarto. 2004. Keanekaragaman Makroinvertebrata Tanah dan Produktivitas Tanah dan Produktivitas Tanaman Sela pada Sistem Agroforestri berbasis Sengon. [Disertasi]. Malang: Program Pasacasarjana UNIBRAW. Suin, N.M. 1997. Ekologi Hewan Tanah. Cetakan Pertama. Jakarta: Penerbit Bumi Aksara. Wallwork, J.B. 1970. Ecology of Soil Animals. London: Mc GrawHill. Watanabe, H., S. Ruaysongnern, and H. Taheda. 1983. Soil animal. In: Kyuma, K. and C. Pairntra (eds.). Shifting Cultivation. Bangkok: Ministry of Science, Technology and Energy, Thailand. Zake, J.Y.K., C. Nkwiine, S. Sesanga, J. Tumuhairwe, M. Okwakol, and D. Bwamiki. 1994. Soil management for sustainable banana production on a ferroalloy in Uganda. In: Adipala, E., M.A. Bekunda, J.S. Tenywa, M.W. Ogenga-Latigo, and J. O. Mugali. (eds.). Proceedings of African Crop Science Conference. Kampala, Uganda: African Crop Science Society.

BIODIVERSITAS Volume 10, Number 3, July 2009 Pages: 134-138

ISSN: 1412-033X (printed edition) ISSN: 2085-4722 (electronic) DOI: 10.13057/biodiv/d100306

Grazing Habitat of the Rusa Deer (Cervus timorensis) in the Upland Kebar, Manokwari 1,

FREDDY PATTISELANNO ♥, AGUSTINA YOHANA SETYARINI AROBAYA 1

Animal Production Laboratory, Animal Science, Fishery & Marine Sciences (FPPK) State University of Papua (UNIPA), Manokwari 98314 2 Biodiversity Research Center (PPKH), State University of Papua (UNIPA), Manokwari 98314 Received: 8th April 2009. Accepted: 12th May 2009.

ABSTRACT The general objective of the study was to provide current information on grassland communities as deer habitat and its future development plan for a sustainable forage management in upland Kebar, Papua. Quantitative estimation of forage production was carried out by measuring a biomass harvest in fresh weight bases, while occasional observations on ranging deer were done within habitat range with the aid of 7x50 binoculars verified by actual visitation of grazed area. The study indicated Kebar, as the only grazing area of deer varies in low layer vegetation composition that comprised of eleven grass species and five legume species. Imperata cylindrica, Paspalum conjugatum, Themeda arguens, Melinis minutiflora and Cyperus rotundus were identified as food plant of deer in Kebar. Among these species T. arguens, M. minutiflora, C. rotundus and I. cylindrica were the most preferred species consumed by deer. The biomass harvest (species productivity) was 30.36 kg/ha fresh weight, while deer food productivity in the grassland was slightly lower (26.70 kg/ha) than total productivity of the grassland. The major drainage area is Kasi River, but two other rivers across this valley (Api River, Apriri River) are also supply water to the swampy area. © 2009 Biodiversitas, Journal of Biological Diversity Key words: grazing, habitat, Rusa, Kebar, Manokwari.

INTRODUCTION Grasslands are mostly found in arid and semi-arid zones where rainfall is sparse and unpredictable, or in humid zones where topography is steep or temperatures are low. Their existence is also determined by cultural factors, distance to markets or the presence of low fertility or stony soils, salinity or seasonal flooding (Harris, 2000) Grassland Conservation Group (2004) indicates that the grassland biome covers about one quarter of the Earth’s land surface. Unique from most other biomes, grasslands are relatively simple in structure but rich in number of species. However, most areas of the prairie have experienced serious declines in biodiversity. In Indonesia, large areas of grassland are found in Sumatra, Kalimantan, Sulawesi, Nusa Tenggara, and Irian Jaya (Ivory and Siregar, 1984). The pasture consists of many grasses and legumes, with the commonest genera being Imperata, Paspalum, Chloris, Eleusine, Themeda, Tetrapogon, Polytrias, and Desmodium. During dry season, the land is

 Corresponding address: PO BOX 153, Manokwari Tel. +62-986-212156, Fax. +62-986-211455. e-mail: pattiselannofreddy@yahoo.com

almost bare because of overgrazing and uncontrolled burning. In fact, grassland areas were identified as one of several factors that significantly contributed to attract the presence of deer as an important animal protein source and income generating in the rural areas in Papua (Pattiselanno, 2003). With the development of the Papua Province, more remote areas are being opened and most forestlands are competing with other intensified land use purposes (logging concessionaires, mining, agriculture development, new infrastructure improvement and transmigration), these also influence the grasslands including in the upland Kebar in Manokwari, Papua. In other side, climatic conditions also pressure on grazing land in some areas. As a consequence, the sustainability of use of much grassland is being questioned. Facts show grassland was utilized as places for deer hunting by local communities in the remote areas in Papua (Pattiselanno, 2004). In order to prepare suitable information on sustainable management of grassland community, assessment is required to document current condition of grassland in the upland Kebar, Manokwari, Papua. The general objective of the study was to provide current information on grassland communities as deer habitat and its future development plan for a sustainable forage management in upland Kebar,

PATTISELANO & AROBAYA – Grazing habitat of Cervus timorensis

Papua. Specifically, the study aimed to analyze the potency of grassland area as deer grazing habitat in upland Kebar, West Papua.

MATERIALS AND METHODS Time and place The study was conducted in the upland areas of Kebar district, during the dry season from August to October 2003. Upland Kebar is known to be a natural grassland area in Manokwari where a large concentration of deer species could be found. The settlement area is situated about 500-1000 m above sea level. At 1000-2000 m above sea level are forested areas. The central part of Kebar district, where the center of local government office, school, health center, and settlement areas are located, occupies about 510 hectares. The topography varies from plain to mountainous areas, which are predominantly Imperata cylindrica areas. Botanical composition analysis Quantitative estimation of forage production was carried out by measuring a biomass harvest in fresh 2 weight bases assisted by 100x100 cm as the sampling frame and laid every 2m interval along the transect line within the plots. The presence of all vascular species in each sampling frame was recorded and collected by clipping to the ground about 6-7 cm in height, and separated to plant species then weighed. In the present observation, 565 times quadrat (sampling frame) was investigated in the 375 ha of the study site. Abundance of a species was calculated as the percentage of the quadrats in which the species is present or to be determined as a proportion (percentage frequency) of each plot (Kirby et al., 1997; Hopkins et al., 1999; Conventry et al., 2000). Occasional observations on ranging deer were done within habitat range with the aid of 7x50 binoculars. Grazed-over and browsed-over plants were verified by actual visitation of grazed area. This permits the identification of practically everything that was eaten, including items that might not have been noticed from distant observations of the vegetation. Identification of vegetation species eaten by deer was done in the grassland because it is the only grazing area in upland Kebar. Herbarium specimens were collected. Descriptions were accomplished in the field for further investigation in the Manokwariense Herbarium, Biodiversity Research Center, The State University of Papua (UNIPA) in Manokwari. Deer was reported to seek refuge for shelter during the day especially in the dry season. The cover plants utilized for shelter by the deer were monitored, and identified as well. This was done through the presence of hoof marks of deer and other species (wild pig) that might be present in the study site.

135

Deer habitat characterization Field work was commenced with a comprehensive reconnaissance of the 510 hectares pasture area with the aid of 7x50 binoculars and a district situation map. Likewise, identification of habitat range and water source distribution was conducted by taking into consideration the distribution of trails and hoof marks, browsed-over and grazed-over plants or feeding areas, bedding, hiding or resting places, mating and playing areas, fecal droppings and deer physical presence. Distribution of all existing water sources (rivers, creeks, springs and lakes) within the identified deer habitat range were documented. Interviews were conducted among the hunters and local people around the study sites to validate field findings with theirs experiences. All observations and notes from the interviews were recorded. Data on major environmental variables (temperature, humidity and rainfall) were gathered from the meteorology station closest to the study site. Soil characteristics were obtained from previous researches conducted at the same sites.

RESULTS AND DISCUSSIONS Description of the study site Upland Kebar (Kebar Valley) is a long easttrending pleistocene/holocene intermontane basin, which is enclosed by fault-bounded mountains up to 2 2000 m high, and 2,703 km wide. Geographically, it o is located at 500-600 m above sea level (132 35’o o o 134 45’E and 0 15’-3 25’S) or about 150km southwest from Manokwari City. The valley floor is leveled or gently tilted (up to three degrees) and is interrupted by narrow east-trending ridges. Along its margins are several small alluvial cones, and terrace remnants of high level lake or alluvial deposits rest along the north side of the valley. At the eastern end of the valley, the quaternary basin sediments are cut by the Kasi River and exposed in terraces up to 30 m high. Approximately, Kebar valley covers a total area of 21,841 ha, while the natural pasture comprises 5,391 ha. Generally, the topography of deer habitat in Kebar is the area with degree of elevation between 0 to 3% and 3% to less than 30%. In the study site, the movement of deer was mostly found close to the flat territory encompassing the grassland and forest site. However, it is common to find deer across the grassland and looking for shelter in the hilly forest block. The hilly grassland territory can be described as the pathway of water from top to the flat areas through the gullies. Encompassing “The Vogelkop Mountain Rainforest Ecoregion,” Kebar valley has a wet, tropical climate and is subject to seasonal influence of northwest monsoon from November to March and the southeast trade winds from June to September. Limited meteorological observations indicate a

136

B I O D I V E R S I T A S Vol. 10, No. 3, July 2009, pp. 134-138

relatively dry season along the north coast when winds are blowing from the southeast. Rainfall is higher probably up to 3,500 mm per year. Temperatures are uniformly high in the o o lowlands, which range from about 23 C to 30 C, decreasing with elevation to a mean daily o temperature of about 16 C and 2000 m. Relative humidity is also uniformly high, ranging from 80 to 100 percent. Morning cloud or ground fog may hamper aircraft operations in intermontane valleys like Kebar during dry season. The physical characteristic of soil in Kebar is described as sandy in texture with little coherence structure in Central Kebar. Meanwhile, sandy clay loam in coherent plastic bolus structure is found in Eastern Kebar (Imbiri et al., 1998). Soil pH is about 4.6 (more acidic) to 5.6 (acidic). Characteristics of deer habitat Botanical composition Primary forest includes large trees such as Intsia bijuga, with canopy dominated by epiphyte. Almost all the ground was covered by shrubs, ferns and mosses. Secondary forest is mostly dominated by small diameter trees like matoa (Pometia pinnata), binuang (Octomeles sumatrana), damar (Araucaria, sp.) planted during the Dutch colonization era. Other trees found are: kayu merah (Homalium foetidum), pulai (Alstonia spp.), sukun (Artocarpus communis), rattan (Calamus spp and Korthalsia sp.), pandan (Pandanus sp.), bamboo (Bambusa sp), kayu raja (Endospermum moluccanum), pala hutan (Myristica, spp), sirih hutan (Piper aduncum), sagu (Metroxylon sp.), enau (Arenga pinnata), lansat (Lansium domesticum), kedondong hutan (Spondias dulcis), genemo (Gnetum gnemon), and linggua (Pterocarpus indicus). Certain epiphytes and ferns are also well distributed in the area. Swampy area includes forest, dominated by Sago (Metroxylon sago) and other aquatic plants. This area is also important as habitat for fresh water fishes, which are utilized by the local people as animal protein sources for the family. Natural pasture known as grazing areas, in particular location dominated by Imperata cylindrica, and it was easily burned during the dry season. Several studies conducted in this area identified some potential forages that grow and distribute fairly within the valley such as: Melinis minutiflora, Cynodon dactylon, Cyperus rotundus, Themeda arguens, Pennisetum purpureum, Phragmites karka, Tridax procumbens, Panicum maximum, Indigofera hirsuta, Leersia hexandra, Cenchrus ciliaris, Setaria geniculata, Paspalum conjugatum, Digitaria ciliaris, and Paspalum orbiculare. There are leguminous plants found in the pasture such as Crotalaria juncea, Centrosema plumeria, Leucaena leucocephala, and Desmodium sp.

Result of analysis revealed that most of the species were the low layer vegetation found in five sampling plots in 375 ha grassland areas. Eleven grass species and five legume species were identified during the observation in the grassland areas in Kebar (Table 1). Table 1. Low layer vegetation species found in the upland Kebar grassland. Species

Occurrence B C D

Grass Imperata cylindrica* + + Paspalum conjugatum* + + Eragrostis brownii Themeda arguens* + + Melinis minutiflora* + + Setaria geniculata + + Cenchrus ciliaris + + Leersia hexandra + + Cyperus rotundus* + + Indigofera trifoliata + Tridax procumbens + Legumes Biophytum petersianum + + Crotalaria juncea + + Centrosema plumieri + + Desmodium sp + + Mimosa pudica + + Note: (*) Observed species consumed Present in the area; - Absent in the area.

+ + + + + + + -

+ + + + + + + + + -

E + + + + + + + + + -

+ + + + + + + + + + + by the deer; +

Potential forage for deer Identification of low layer vegetation species eaten by deer was undertaken to identify potential source of food. In this study, identification was carried out in the grassland dominated by I. cylindrica since it is the only grazing area for deer in Kebar. During the observation, evidences by tracing trails and hoof marks, browsed-over and graze-over plants or feeding areas were established. Among the eleven species of low layer vegetation found in the grassland of Kebar, five were found to be eaten by deer. These include I. cylindrica, P. conjugatum, T. arguens, M. minutiflora, and C. rotundus. It was observed that T. arguens, M. minutiflora, C. rotundus and I. cylindrica were the most preferred feeds of deer. Some previous species recognized in Kebar such as I. cylindrica, Pennisetum purpureum, M. minutiflora and Pennisetum purpureophoides were also preferred by deer kept in backyard model in Manokwari (Pattiselanno et al., 2008). Wirdateti et al. (2005) noted approximately 40 species, and mostly from Euphorbiaceae, Leguminoceae, Fabaceae, Poaceae and Convolvulaceae were consumed by Cervus timorensis in captivity area in PT Kuala Tembaga, in Bitung, North Sulawesi. Similarly, Garsetiasih (2005) cited that certain forages have been eaten by deer in captivity for example: Setaria sp., Brachiaria decumbens, Andropogon

PATTISELANO & AROBAYA â&#x20AC;&#x201C; Grazing habitat of Cervus timorensis

contortus, Eragrostis bahiensis, Scleria lithosperma and Andropogon fastigiatus. Therefore, P. purpureophoides was fed to the deer in the captive breeding at Taman Safari, Cisarua, Bogor (Wirdateti et al., 1997). Different species consumed by deer in different habitat showed that food was not limited factor to breed deer under captivity condition (Semiadi, 1986; Subekti, 1995). Kencana (2000) explained that T. arguens, C. rotundus and I. cylindrica are the food plants of deer in the Rumberpon Island. In Wasur, Merauke, potential forages identified as food plants for deer were Setaria sp., Panicum maximum, P. purpureum, Setaria sphacelata, Brachiaria decumbens and Melinis minutiflora (Environment Study Center of Papua University, 2000). Sutrisno (1993) indicated that among the eleven species eaten by Javan Deer in Menipo Island, the most preferred were Microlaena stipoides, Danthonia pilosa, I. cylindrica, and Paspalum scrobiculatum. In Kebar, the bedding site is dominated by I. cylindrica approximately 75-100 cm tall. While the bedding site in Wasur, Merauke is dominated by Acacia species (Pattiselanno, 2002). In Rumberpon Island, the main species are Gleichenia linearis and Dacrydium sp. (Murwanto et al., 2000). Biomass harvest Results of clipping of grassland vegetation showed that the total biomass harvest averaged 30.36 kg/ha fresh weight, with the highest account is by I. cylindrica (16.92 kg/ha) followed by P. conjugatum (6.73 kg/ha) fresh weight. Biomass harvest in this study is also considered as species productivity expressed in kg/ha fresh weight. Four species considered to be the most dominant in the study site were I. cylindrica (55.74%), P. conjugatum (22.18%), E. brownii (9.37%), and T. arguens (8.94%). Others were found in fairly low percentages. As cited by Imbiri et al. (1998) five dominant species in the natural pasture in Kebar were I. cylindrica, P. conjugatum, M. minutiflora, C. rotundus, and T. procumbens. Water sources availability The major drainage area is the Kasi River. However, there are two other rivers across this valley (Api River, Apriri River) that also supply water to the swampy area. During the rainy season, deer were mostly concentrated in the forest belt (as shelter) during daytime (from 0800 to about 1600 h), to utilize the water flowing from the stream inside the area. However, since the study was conducted in a dry season, flocks expanded their movement closer to water source (swampy areas, and rivers) to find water. Pellet, trail, and hoof marks were some evidences during the sighting in the grassland and swampy sites.

137

CONCLUSIONS Kebar, as the only grazing area of deer varies in low layer vegetation composition that comprised of eleven grass species and five legume species. Imperata cylindrica, Paspalum conjugatum, Themeda arguens, Melinis minutiflora and Cyperus rotundus were identified as food plant of deer in Kebar. Among these species T. arguens, M. minutiflora, C. rotundus and I. cylindrica were the most preferred species consumed by deer. The biomass harvest (species productivity) was 30.36kg/ha fresh weight, while deer food productivity in the grassland was slightly lower (26.70kg/ha) than total productivity of the grassland. The major drainage area is Kasi River, but two other rivers across this valley (Api River, Apriri River) are also supply water to the swampy area.

ACKNOWLEDGEMENT This article is partly of small grant research granted by the Nagao Natural Environment Foundation, Japan fiscal year 2002 to the first author.

REFERENCE Conventry, R., B. Jackes, W. Edwards, C. Gardiner, and J. Landsberg. 2000. Structure and Dynamics of Tropical Savannas (Laboratory and Field Manual and Lecture Supplements). James Cook University, Australia. Environment Study Center University of Papua. 2000. Survey kawasan lindung di Merauke Irian Jaya. Report to the Provincial Plan and Development Institute of Irian Jaya. Manokwari: University of Papua. Garsetiasih, R. 2005. Small scale deer breeding for rural forest communities. Buletin Konservasi Alam 5 (4): 33-37 Grassland Conservation Group. 2004. Grassland: Lecture Series. Ducks Unlimited E-newsletter March 17, 2004. Harris, P.S. 2000. Grassland resource assessment for pastoral systems. FAO Plant Production and Protection. Paper 162. Rome: FAO UN. Hopkins, A., F.F. Pywell, S. Peel, R.H. Johnson, and P.J. Bowling. 1999. Enhancement of botanical diversity of permanent grassland and impact on hay production in Environmentally Sensitive Areas in the UK. Grass and Forage Science 54 (2): 163-173 Imbiri, A.N.N.H., F. Wanggai and R.A. Maturbongs. 1998. An ecological aspect of Biophytum petersianum Klotzhch in Kebar District Manokwari. Beccariana 1 (2): 8-11. Ivory, D.A. and M.E. Siregar. 1984. Forest research in Indonesia, past and present. Asian Pasture. FFTC Book Series No. 25: 12-29 Kencana, S. 2000. Habitat Rusa Timor (Cervus timorensis) dan kapasitas tampung padangan alam Taman Buru Pulau Rumberpon Manokwari. [Thesis]. Manokwari: Universitas Cenderawasih. Kirby, D.R., T.P. Hanson and C. Hull. 1997. Diets of Angora Goats leafing spurge Euphorbia ecula infested rangeland. Weed Technology 11: 734-738 Murwanto, A.G., R.A. Maturbongs and F. Pattiselanno. 2000. Estimation of population of the Timor Deer (Cervus timorensis) in Natural Pasture Rumberpon Island. Media Konservasi 7 (1): 17-20 Pattiselanno, F. 2002. The ecological study and estimating Rusa Deer (Cervus timorensis) number in Wasur National Park

138

B I O D I V E R S I T A S Vol. 10, No. 3, July 2009, pp. 134-138

Merauke, West Papua, Indonesia. [Report]. Tokyo: Nagao Natural Environment Foundation, Japan. Pattiselanno, F. 2003. Deer (Cervidae: Artiodactyla: Mammalia) wildlife potential with future expectations. Tigerpaper 30 (3): 1316 Pattiselanno, F. 2004. Berburu Rusa di rimba Papua? Majalah Pertanian Berkelanjutan SALAM (September 2003) 8: 33 Pattiselanno, F., D. Iisir, A. Takege dan D. Seseray. 2008. Kajian awal penangkaran Rusa Timor (Cervus timorensis) system Back Yard di Manokwari, Papua Barat. Biosfera 25 (2): 95-100. Semiadi, G. 1986. Beberapa tinjauan kemungkinan budidaya rusa. Bulletin Peternakan 10 (1): 11-13

Subekti, D.T. 1995. Mengenal usaha peternakan rusa. Ruminansia 9 (3): 34-35 Sutrisno, E. 1993. Population Ecology of the Javan Deer (Cervus timorensis) in Menipo Island, East Nusa Tenggara, Indonesia. [Thesis] Los BaĂąos: The University of Philippines Los BaĂąos. Wirdateti, M. Mansur and A. Kundarmasno. 2005. Behavioral study of Timor Deer (Cervus timorensis) in PT Kuala Tembaga, Aertembaga Village, Bitung-North Sulawesi. Animal Production 7 (2): 121-126 Wirdateti, W.R. Farida and M.S.A Zein. 1997. The daily behavior of Java Deer (Cervus timorensis) in captive breeding at Taman Safari Indonesia. Biota 2 (2): 78-81.

BIODIVERSITAS Volume 10, Number 3, July 2009 Pages: 139-145

ISSN: 1412-033X (printed edition) ISSN: 2085-4722 (electronic) DOI: 10.13057/biodiv/d100307

Population Dynamics of Banteng, Buffalo and Deer in Bekol Savannah, Baluran National Park SUHADI

â&#x2122;Ľ

Biology Department, Faculty of Mathematics and Natural Sciences, State University of Malang (UM), Malang 65145. Received: 14th January 2009. Accepted: 17th May 2009.

ABSTRACT Baluran National Park give contribution at regional development to draw tourist and fascination provided is savannah in area. Savannah circumstance, forest, landscape, climate, vegetation and wild animal is represent experienced attraction. Research method use population dynamics perception of banteng, buffalo and deer in savannah of Bekol year 2004 and year 2005 as primary data, while secondary data year population dynamics 2003, 2004, and year 2005 outside savannah of Bekol, year population dynamics 2003 in savannah of Bekol. Secondary data obtained from daily report of Controller ecosystem Forest Worker animal discovery Baluran National Park from Section Bekol. Research location of outside savannah Bekol were Balanan, Perengan, Bitakol, Karangtekok, Pandean, Pondok jaran, Bama, Curah uling, Gunung Montor, Lempuyang, Bilik, Batangan, Labuhan Merak, Kramat, Semiang, Sirokoh, Lemah bang, Gunung Krasak, and Glengseran. The populations of banteng and buffalo in the savannah were unstable compared to the populations of them outside Bekol savannah. The populations of banteng and buffalo in Bekol savannah decreased, whereas the populations of them outside the Bekol savannah increased. The population of deer in Bekol savannah in 2004 was better than population of 2003, 2005, and 2006, whereas the population of deer outside Bekol savannah in 2006 increase significantly. The populations of banteng, buffalo, and deer decreased from year to year, in which the reductions of banteng and buffalo populations were obviously significant. ÂŠ 2009 Biodiversitas, Journals of Biological Diversity Key words: banteng, buffalo, deer, Bekol savannah, Baluran National Park.

INTRODUCTION Indonesia is one of countries which have not professionally developed the potentials of wildlife either for the purpose of export, hunting or recreations in the national park. The circumstances are connected to current government policies (Alikodra, 1983). The national park gives a contribution to regional development in order to increase the tourist attendance. Savannah circumstances, forest, landscape, climate, vegetation, and wildlife are natural attractions. An everlasting conception of tourism development is designed to manage tourist, growth, conditions which do not destroy attractions and also to create tourist objects. Visitors and also attractions remain to be taken care by preserving the permanency of the tourist objects and by developing high awareness of the tourists. The savannah is destined to manage totally disappeared endangered, vulnerable animals by protecting natural ecosystem,

ď&#x201A;Š Corresponding address: Jl. Surabaya 6, Malang 65145 Tel. +62-0341-562180, Fax. +62-0341-566936 e-mail: suhadi@bio.um.ac.id

grazing or browsing wildlife which represent important target. This matter can be used for research purpose for example wildlife behavior, wildlife interactions, and source of germplasm used livestock breeding. Management of savannah that guaranteed the continuity life of endangered species, and vulnerable animals is one of the bio-diversity conservation (MacKinnon et al., 1988). Biodiversity is an expression of the existence of miscellaneous variations of the forms, presentations, number and characteristics which are clearly seen in the level of social interaction, ecosystem, species, and genetics (Sastrapradja et al., 1989). Problems in management of savannah are: (i) competitions between animal food plants and nonanimal food plants, (ii) invasion of dominant exotic plants, (iii) competitions between crops due to water availability and soil nutrition, (iv) decrease of stamina vitality and movement activity of wildlife, and (v) low productivity of animal food (McIlroy, 1964). Bekol savannah area is black young alluvial covering between 1500-2000 hectares (Alikodra, 1987). The success of Cervidae family living in a new habitat is due to the plasticity in devouring species of crops supplied in the habitat (Klein, 1985), and so other herbivore do Acacia nilotica Willd ex. Del

140

B I O D I V E R S I T A S Vol. 10, No. 3, July 2009, pp. 139-145

dominates Bekol savannah (Saraswati, 2002; Djufri, 2004a,b, 2005). The population of A. nilotica in Bekol savannah from 1960 to 2005 continually increases, and brings to a climax in 1990 covering 464,882 hectares. A. nilotica aging more than 5 years decreases the diversity and biomass of herbage (Suhadi, 2008a,b), whereas the trampling of banteng, buffaloes, and deer increases the herb seed bank on the trample (Suhadi, 2003). The trampling by banteng decreases number of crops species around 38,88%, trampling by buffaloes decreases number of crops species around 27,27%, and trampling by deer decreases number of crops species around 18,18% (Suhadi, 2004). Bekol savannah is habitat of wildlife for example banteng, buffaloes, and deer (Sabarno, 2002). The estimated amount of bantengs population was 16, buffaloes 338, and deers 400 (Santoso, 1984), whereas in Bama area bordering on Bekol savannah the population of bantengs is 72 (Alikodra, 1987). The interaction between bantengs and wild buffaloes in Baluran National Park, East Java impact the dynamic population of banteng (Ashby et al., 1986), therefore in 1985/1986 number of buffaloes which move to other areas is 635 (Report data on the distribution of buffaloes). The purpose of this research are: (i) to carefully examine the dynamic population bantengs, buffaloes, and deers in the Bekol savannah or outside Bekol savannah, (ii) to carefully examine the population variables within 3 years which can be used to improve the wildlife management in Baluran National Park. MATERIAL AND METHODS The research used to calculate population is a concentrated method (Alikodra, 1989). The observation applied is the observation of bantengs, buffaloes, and deers populations in Bekol savannah in 2004 and 2005 as primary data, and the secondary data is the population of 2003, 2004, 2005, and 2006 in the area outside Bekol savannah, and the population of 2003 and 2006 in Bekol Bekol savannah. Locations outside Bekol savannah are Balanan, Perengan, Bitakol, Karangtekok, Pandean, Pondok Jaran, Bama, Curah Uling, Gunung Montor, Lempuyang, Bilik, Batangan, Labuhan Merak, Kramat, Semiang, Sirokoh, Lemahbang, Gunung Krasak and Glengseran (19 points of observation). To compare the difference species of wildlife, location, and population dynamics of 2003, 2004, 2005 and 2006 used ANOVA and GenStat Release 4.24DE program.

RESULT AND DISCUSSION The population of wildlife in 2003 The population of bantengs in May and June 2003 is 22, in August 11, and September 17. In January,

February, March, April, July, October, November, and December the population of bantengs in Bekol savannah was not found. The population of banteng in May, June, July, August, and September outside Bekol savannah is 23, 9, 22, 7, and 13 (Table 1). This condition was caused by the decline of rainy days which influence grass growth (Figure 1). According Lekagul et al. (1977) banteng has more characteristic of grazers than browsers and like open space. The appearance of banteng in Bekol savannah was low, namely 33% and the average monthly population was 6, outside the savannah 66% and the average monthly population is 7 (Table 1). Human activities may be done in Bekol savannah. In Bekol savannah is the habitat for wildlife which provides animal food, social communication protects/brings up, raises their children (Alikodra, 1983). Research of Suhadi (1996) indicates that in the location which has more human activities the bull has more guarding activities and less grazing activities, whereas bull has more grazing activities. Similar condition occurs in Bekol savannah which has a roadway going to Bama out savannah, through which the tourist go for a recreation in Baluran. Population of buffaloes in Bekol savannah during 2003 remains stable, outside Bekol savannah in April and August 3 respectively (Table 1). In Baluran National Park buffaloes are found mostly in water mudholes. In Bekol savannah the mudholes were dry, water mudholes were only found side of Bekol savannah and outside Bekol savannah. The buffaloes like open forest or meadow/grass place (Lekagul et al., 1977). The home range of buffaloes in Australia consist of forest, savannah, muddy area, well, mineral salt (Tulloch, 1978). The population of buffaloes in 1984 reaches 1293 and decreased from year to year and in 1999, 11 were still left. Buffaloes brought illegally to the outside of Baluran National Park from 1980/1981 fiscal year to 1998/1999 fiscal year were 731. The population of deers in Bekol savannah in May, June, August, and September are 114, 206, 154, and 172 respectively. The population of deer outside Bekol savannah from April to December the highest in April reaches 238 (Table 1). From May to December the group of deer becomes divided equally. The average population from May to December was 66 per month. There was no rain from July to October (Figure 1). The amount of deer in Bekol savannah in August and September are 154 and 172 respectively (Table 1). The population of deer in Bekol savannah in the dry season remains high because most of the animal food was obtained by browsing A. nilotica. Grazing done excessively by wildlife will reduce fire and invasion of wooden crops (Bucher, 2000). The population of deer in Bekol savannah may help distribution of A. nilotica. LSD 5% test shows that the bantengs and buffaloes populations in the savannah compared to the population outside Bekol savannah indicate no significant difference. Similarly, the population of banteng and deer in the savannah compared to

SUHADI â&#x20AC;&#x201C; Banteng in Bekol savannah Baluran NP

outside Bekol savannah indicates no significant difference, but the deers, bantengs, and buffaloes shows no significant difference (Table 2 and 3). The interaction between location of banteng and location of buffalo shows no significant difference, whereas the location of deer indicates significant difference. This condition shows that the area of Bekol savannah 420 hectares and the area outside of Bekol 9600 hectares with total number of banteng and buffalo may provide enough room for home range and may have animal food. Interaction location of deer obviously differs because deer have wider home range than home range of banteng and buffalo at the same time. The population of wildlife in 2004 The population of banteng reaches the peak in July in the amount of 30, but in October, November, and December no banteng is found (Table 1). The average population of banteng in Bekol savannah 8, the presence frequency was 75% per month, whereas outside Bekol savannah 4 and the presence frequency was 83% per month. In October 2004 no banteng is found either outside Bekol savannah. This October is the peak of dry season (Figure 2). Grass in the savannah mostly dry therefore banteng go into the forest (Lekagul et al., 1977). In 2004 the presence

141

frequency of bantengs is 75% whereas the presence frequency in 2003 is only 33%. There are three dry months in 2004 namely August, September, and October, whereas in 2003 there are 4 dry months, namely July, August, September, and October (Figure 1A and 1B). The short dry months in 2004 Bekol savannah provides sufficient animal food so the presence frequency of in 2004 is higher than the presence frequency in 2003. The population of buffalo in Bekol savannah in March, July, August, and September 2004 are 5, 46, 31, and 31. The monthly average population is 10 and presence frequency 33%. The population outside Bekol savannah in March and September in the same year is 1 and 4 respectively (Table 1). The average population of buffalo per month is less than 1 and the presence frequency 16%. The average population of buffalo per month in Bekol savannah is higher than the population outside Bekol savannah. According to Tulloch (1978) buffaloes browsing dry crop leaves. The presence of buffaloes in Bekol savannah is higher the occurrence outside the savannah. If we compare the 2003 and 2004 data the presence of buffaloes increase from 0% to 33%. This condition is caused by the rainfall; in 2004 there are 3 dry months, whereas in 2003 there are 4 dry months, whereas in 2003 there are 4 dry months (Figure 1B).

2004 In the Outside the savannah savannah

Buffalo

Deer

Banteng

Buffalo

Banteng

Deer

Banteng

Buffalo

Deer

0 0 0 0 22 22 0 11 17 0 0 0

0 0 0 0 0 0 0 0 0 0 0 0

0 0 0 0 114 206 0 154 172 0 0 0

0 0 0 6 23 9 22 7 13 1 4 0

0 0 7 0 55 0 0 2 0 36 0 0 5 5 245 3 238 6 0 79 0 31 3 0 102 0 59 8 0 92 0 43 36 46 112 3 47 17 31 60 0 33 4 18 116 0 74 0 0 0 0 4 0 0 90 0 62 0 0 0

4 3 5 26 0 6 3 1 4 0 1 2

0 0 1 0 0 0 0 0 4 0 0 0

139 62 11 135 39 65 161 77 26 29 46 65

2005 In the Outside the savannah savannah

2006 In the Outside the savannah savannah

Banteng

2003 In the Outside the savannah savannah Banteng

Table 1. Population of wildlife in the savannah and outside Bekol savannah, Baluran National Park 2003, 2004, 2005, and 2006.

Banteng

Buffalo

Deer

Banteng

Buffalo

Deer

Banteng

Buffalo

Deer

14 1 74 0 0 0 1 1 190 3 2 242 0 22 9 1 0 70 2 13 50 3 6 0 1 0 0 0 0 0 3 2 0 1 0 0

2 0 1 0 2 3 1 0 2 3 0 2

1 4 5 2 40 0 0 7 13 13 11 11

139 57 207 68 9 36 56 290 360 397 211 211

0 1 0 0 0 0 2 1 1 3 3 1

0 0 0 0 0 0 0 73 0 2 0 0 10 0 6 0 6 0 2 0 0 0 0 0

3 2 3 3 3 3 1 2 2 0 0 2

13 13 13 13 13 13 3 7 7 11 13 13

210 158 168 36 395 219 311 213 321 217 58 68

Buffalo

Deer

January Pebruary March April May June July August September October November December

Deer

Months

Table 2. Variance analysis of wildlife population in the savannah and outside Bekol savannah Baluran National Park 2003, 2004, 2005, and 2006. Source of variation Location Species Location_Species Replication Residual Total

2003 2004 2005 2006 d.f. s.s. m.s. v.r. F. pr. d.f. s.s. m.s. v.r. F. pr. d.f. s.s. m.s. v.r. F. pr. d.f. s.s. m.s. v.r. F. pr. 1 18 18 0,01 0,921 1 939 939 0,84 0,363 1 29322 29322 6,87 0,011 1 81272 8127237,54<0,001 2 37563 1878210,45<0,001 2 82017 4100836,74<0,001 2 1846469232321,63<0,001 2 1540957704735,59<0,001 2 117 58 0,03 0,968 2 209 104 0,90 0,911 2 53203 26601 6,23 0,004 2 1394456972332,20<0,001 11 23276 2116 1,18 11 14924 1357 1,22 11 29039 2640 0,62 11 19191 1745 0,81 55 98865 1798 55 61387 1116 55 234758 4268 55 119079 2165 71 159840 71 159476 71 530969 71 513082

B I O D I V E R S I T A S Vol. 10, No. 3, July 2009, pp. 139-145

142

Table 3. Test of LSD 5% of wildlife population in the savannah and outside Bekol savannah Baluran National Park 2003, 2004, 2005, and 2006. 2003 2004 2005 Average Average Average a a b Location Bekol savannah 19,9 32,6 19,8 a a a Outside Bekol savannah 18,9 25,4 60,1 a b b Species Banteng 6,5 6,0 1,9 a b b Buffalo 0,3 4,4 6,4 b a a Deer 51,5 76,7 111,5 a b b Location_Species Bekol savannah_Banteng 6,0 7,3 2,4 a b b Bekol savannah_ Buffalo 0,0 8,3 3,9 b a a Bekol savannah_ Deer 53,8 82,2 52,9 a b b Outside Bekol savannah_Banteng 7,1 4,6 1,3 a b b Outside Bekol savannah_ Buffalo 0,5 0,4 8,9 b a a Outside Bekol savannah_ Deer 49,2 71,2 170,1 Note: Figure followed by the same character in the column indicated no significant differences on LSD 5% test Source of variation

600

2006 Average b 3,1 a 70,3 b 1,5 b 6,5 a 102,0 b 1,0 b 2,0 b 6,2 b 2,0 b 11,0 a 97,8

300

18 500

300

200 5

200

12 10

150

8 100

6 4

100

R ainfall (m m )

N um ber of rainy days

400

R ainfall (m m )

N um ber of rainy days

250

2 0

0 J a n . P e b r. M a rc h A p ril

M ay

June

J u ly

A u g . S e p t. O c t.

N ov. D ec.

0 J a n . F e b r. M a rc h A p ril

M ei

June

M o n th s

J u ly

Aug. Sep.

O c t.

N ov. D ec.

M o n th s

N u m b e r o f ra in y d a ys

M o n th v s R a in fa ll, m m M o n th v s H ig h e s t ra in fa ll, m m

M o n th v s R a in fa ll,m m M o n th v s H ig h e s t ra in fa ll,m m

300

200 180

250

8 150 6 100 4 50

140 120

100 6

R ainfall (m m )

200

N um ber of rainy days

160

R ainfall (m m )

N um ber of rainy days

40 2 20

0 J a n . F e b r. M a rc h A p ril

M ei

N u m b e r o f ra in y d a ys

June

J u ly

Aug. Sep.

O c t.

N ov. D ec.

M o n th s

M o n th v s R a in fa ll, m m M o n th v s H ig h e s t ra in fa ll,m m

0 Jan.

F e b r.

M a rc h

N u m b e r o f ra in y d a ys

A p ril

M ei

June

J u ly

Aug.

M o n th s

M o n th v s R a in fa ll, m m M o n th v s H ig h e s t ra in fa ll, m m

Figure 1. Distribution of rainfall in Baluran National Park. A. 2003, B. 2004, C. 2005, D. 2006.

The monthly average population of deer in Bekol savannah in 2004 is 72 and the presence frequency 83%, outside savannah is 71 and the presence frequency 100% (Table 1). The presence of deer outside savannah is higher than in the savannah because of the evenly spread of animal food even skin, leaves, and crown of A. nilotica are browsed by the deer. The exploration of deer in very short time is higher than those of banteng and buffalo, therefore

deer can easily move from one place to another in very short time. In August, September, and October in 2004 there is no rain (Figure 2), and November there are 3 amounts of rain and the amount of rainfall is 67 mm. In December 2004 herbage in Bekol savannah is grown over but does not spread evenly. In October and December 2004 no deer was found because the spread of herbage was uneven and the movement of deer to search for food is high enough. Outside Bekol

SUHADI â&#x20AC;&#x201C; Banteng in Bekol savannah Baluran NP

savannah the presence frequency of the deer is 100% because herbage can be still be found at the location close by the well. Based on LSD 5% test of the locations in the savannah and outside Bekol savannah in 2004 indicate no significant difference. The population of deer compared to the population of banteng and buffalo indicates significant difference (Table 1 and 2). The interaction of banteng location and buffalo location shows difference, but interaction of deer location indicates significant difference (Table 3). The condition of 2003 population and 2004 population remain stable. The population of wildlife in 2005 The population of banteng in Bekol savannah the highest in January 2005 number in 14 with the monthly average population is 2, whereas outside Bekol savannah is 1 (Table 1). The amount of rainfall from January to June 2005 is 7-274 mm (Figure 1C). The condition indicated that Bekol savannah has sufficient animal food and water availability, but the presence frequency of banteng is only 66,66%. It happen because of human activity disturbance consequently the amount of banteng from year to year degrades. If we make a comparison, the monthly average number of banteng outside Bekol savannah is higher than the number in the savannah. According to Alikodra (1989) the ideal banteng environment composition are, (i) primary forest border on meadow as shelter to protect them from predator attack, a place to sleep and take a stand a place to breed and (ii) coast forest or tidal forest which has a function as a buffer zone, consisting wind shield, to prevent it from salt intrusion and a shelter or place to take a rest, a place to hunt for food and also to avoid banteng hunter entering forest preserve from the sea. The presence frequency of banteng in the savannah and outside Bekol savannah remains low which enable banteng to take shelter in the primary forest or tidal forest. The highest population of buffalo in Bekol savannah in 2005 is in May amounting to 22 and monthly average population is 4 and the presence frequency is 66.66%. Outside Bekol savannah the highest population is 40, the monthly average population is 8 and presence frequency 16.66% (Table 1). The population of buffalo outside savannah is higher because well can still be found in the savannah. In May rainfall is 9 mm, number of rainy days is 2 and the highest rainfall is 5 mm (Figure 1C). In May number of buffalo in Bekol savannah degrades. It shows that the quantity of water decreases so the buffaloes in the savannah can only be found water stream and mudholes. Outside Bekol savannah a lot of water stream can still be found thus the population of buffaloes in May reaches 40. The population of deer in Bekol savannah in 2005 the high in April reaches 242, and monthly average population is 52 and the presence frequency is 50%.

143

The population of deer outside Bekol savannah the highest in October is 397, monthly average population is 86 and presence frequency is 100% (Table 1). The average population of deer per month in Bekol savannah is higher than outside savannah because herbage is sufficient enough for the need of deer and deer activities are not disturbed by human activities. In May the population of deer in the savannah and outside of the savannah is very low because the amount of rainfall is 9 mm, number of rainy days are 2, and the highest rainfall is 5 mm (Figure 1C) lower than the rainfall in another months. Rainfall of 5 mm per month after 14 days increases the growth of herb up to 52%, whereas rainfall of 132 mm per month will increase herb up to 70% (McIvor and Gardener, 1985). In January, February, March 2004 the monthly rainfall is high, but number of deer fluctuates, it is likely that number of deer in the savannah does not depend on the grass supply. Base on LSD 5% test, the location in the savannah and outside Bekol savannah in 2005 indicated significant difference. The population of banteng and buffalo differ significantly (Table 2). The interaction among location of banteng and location of buffalo and location deer differ significantly (Table 3). The population of wildlife in 2006 The population of banteng in 2006 in Bekol savannah the highest in October and November is 3 and monthly average population less than 1, whereas outside of the savannah of Bekol is 2 (Table 1). Number of rainfall from January to June is between 15 and 177 mm (Figure 1D). Such condition indicates that Bekol savannah has sufficient water for the need of herbage. The low presence frequency of bantengs which is only 58.33% is caused by human activities; therefore number of banteng from year to year degrades. If we make a comparison, the monthly average number of banteng in the savannah is lower than the number of banteng outside of Bekol savannah because of the significant difference between the existence of forest and the savannah. The presence frequency of bantengs in the savannah and outside the Bekol savannah is still low because banteng possibly takes a shelter in primary forest and tidal forest. In 2006 number of banteng population is lower than the number of bantengs population in 2005, it is possible that banteng is in a place outside the points of observation. The highest population of buffalo in Bekol savannah takes place in July amounting to 10 and monthly average population is 2 and the presence frequency is 33,33%.The highest population of buffalo outside Bekol savannah is 13, and the monthly average population is 11 and the presence frequency is 100,00%. The population of buffalo outside the savannah is higher because many wells can still be found there. In May number of rainfall is 15 mm, number of rain days are 3 and the highest rainfall is 8 mm (Figure 1D). In May number of buffalo is high

B I O D I V E R S I T A S Vol. 10, No. 3, July 2009, pp. 139-145

144

Table 4. LSD test 5% population of wildlife in the savannah and outside Bekol savannah Baluran National Park 2003, 2004, 2005, and 2006. Source of variation Bekol savannah Outside Bekol savannah Banteng Buffalo Deer

Average b 18.9 a 43.7 b 4.0 b 4.4 a 85.5

Year

2003 2004 2005 2006

19.4 ab 29.0 a 39.9 a 36.7

Location_ Species

Bekol savannah_Banteng Bekol savannah_Buffalo Bekol savannah_Deer Outside the savannah_Banteng Outside the savannah_Buffalo Outside the savannah_Deer

4.2 c 3.6 b 48.8 c 3.7 c 5.2 a 122.1

Location_ Year

Bekol savannah_2003 Bekol savannah_2004 Bekol savannah_2005 Bekol savannahl_2006 Outside Bekol savannah_2003 Outside Bekol savannah_2004 Outside Bekol savannah_2005 Outside Bekol savannah_2006

19.9 c 32.6 bc 19.7 b 3.1 bc 18.9 c 25.4 a 60.1 a 70.3

Species_ Year

Banteng_2003 Buffalo_2003 Deer_2003 Banteng_2004 Buffalo_2004 Deer_2004 Banteng_2005 Buffalo_2005 Deer_2005 Banteng_2006 Buffalo_2006 Deer_2006

6.5 c 0.3 b 51.5 c 6.0 c 4.4 b 76.8 c 1.9 c 6.4 a 111.5 c 1.5 c 6.5 ab 102.0

Location_ Species_ Year

Bekol savannah_Banteng_2003 Bekol savannah_Banteng_2004 Bekol savannah_Banteng_2005 Bekol savannah_Banteng_2006 Bekol savannah_Buffalo_2003 Bekol savannah_Buffalo_2004 Bekol savannah_Buffalo_2005 Bekol savannah_Buffalo_2006 Bekol savannah_Deer_2003 Bekol savannah_Deer_2004 Bekol savannah_Deer_2005 Bekol savannah_Deer_2006 Outside Bekol savannah_Banteng_ 2003 Outside Bekol savannah_Banteng_ 2004 Outside Bekol savannah_Banteng_ 2005 Outside Bekol savannah_Banteng_ 2006 Outside Bekol savannah_Buffalo_ 2003 Outside Bekol savannah_Buffalo_ 2004 Outside Bekol savannah_Buffalo_ 2005 Outside Bekol savannah_Buffalo_ 2006 Outside Bekol savannah_Deer_2003 Outside Bekol savannah_Deer_2004 Outside Bekol savannah_Deer_2005 Outside Bekol savannah_Deer_2006

6.0 c 7.3 c 2.4 c 1.0 c 0.0 c 8.3 c 3.9 c 2.0 b 53.8 b 82.2 b 52.9 c 6.3 c 7.1 c 4.6 c 1.3 c 2.0 c 0.5 c 0.4 c 8.9 c 11.0 bc 49.2 b 71.2 a 170.1 a 197.8

Location Species

which indicates that the quantity of water especially in savannah of Bekol degrades therefore buffaloes can only be found in the water stream can still be found therefore the population of buffalo in May reaches 13. From July to August number of buffalo degrades and so buffaloes possibly search for watery areas. The population of deer in 2006 Bekol savannah the highest in April amounting to 73, monthly average population is 6 and presence frequency is 16,66%. The population of deer outside the savannah of Bekol the highest in May amounting to 395, monthly average population is 197 and the presence frequency is 100% (Table 1). The population outside the savannah per month is higher because animal food is sufficient for the need of deer and also the activities of deer are not disturbed by human activities. From January to December remains stable except in April and May the population number of deer are 73 and 2 respectively because A. nilotica are chop down in the population of deer in Bekol savannah. Based on LSD 5% test locations in the savannah and outside Bekol savannah in 2006 indicate significant differences (Table2). The population of deer, banteng, and buffalo are significantly different. The interaction among banteng, buffalo, and deer outside Bekol savannah show significant differences (Table 3). This condition is caused by the frequent chop down of A. nilotica in Bekol savannah. Based on LSD 5% test locations in the savannah and outside of the savannah of Bekol 2003, 2004, 2005, and 2006 indicate significant differences. During 4 years the population of wildlife outside Bekol savannah is better than population in the savannah. In 2003, 2004, 2005, and 2006 the population of the banteng and buffalo differ significantly (Table 3 and 4). During 4 years the population of deer is better than the population of banteng and buffalo. The population of deer in Bekol savannah in 2004 is the best population of all 2003, 2005, 2006 population, whereas outside Bekol savannah the 2006 population of deer is the best. During 4 years the populations of banteng and buffalo in Bekol savannah decline, on the contrary the populations of banteng and buffalo outside Bekol savannah increase although LSD 5% test shows no significant differences (Table 4).

CONCLUSION AND SUGGESTION The populations of banteng and buffalo in the savannah are unstable compared to the populations of them outside Bekol savannah. The populations of banteng and buffalo in Bekol savannah decrease, whereas the populations of them outside the Bekol savannah increase. The population of deer in Bekol savannah in 2004 is better than population of 2003, 2005, and 2006, whereas the population of deer outside Bekol savannah in 2006 increase significantly. The populations of banteng, buffalo, and deer decrease

SUHADI – Banteng in Bekol savannah Baluran NP

from year to year, in which the reductions of banteng and buffalo populations are obviously significant. Bekol savannah has not yet attracted the wildlife to graze. The wildlife especially banteng are annoyed by human being activities, roadway heading to Bama beach which also cuts Bekol savannah which disturbs the movement of wildlife requires to be studied furthermore, the direction of roadway which cuts the savannah should be changed to the outskirt of savannah. The low frequency of banteng and buffalo in Bekol savannah is due to the fact that the savannah has not fulfilled the criteria for banteng and buffalo to live in for example, human being activities which annoy them, insufficient limited number of herbage for their food and availability of water. Qualitative research should be done to verify the exact number of wildlife smuggled outside of Baluran National Park because number of wildlife which are died, missing, and given to the retired government officials are not properly recorded without any officials report.

REFERENCES Alikodra, H.S. 1983. Ekologi Banteng (Bos javanicus d’Alton) di Taman Nasional Ujung Kulon. [Disertasi]. Bogor: Fakultas Pascasarjana Institut Pertanian Bogor. Alikodra, H.S. 1987. Tanaman eksotik akasia (Acacia nilotica) dan masalahnya bagi ekosistem savana di Taman Nasional Baluran. Duta Rimba 79-80 (13): 30-34. Alikodra, H.S. 1989. Pengelolaan Satwaliar. Bogor: Fakultas Kehutanan, Institut Pertanian Bogor. Ashby, K.R. and C. Santiapillai. 1986. The Ecology of Free Living Water Buffalo (Bubalus bubalis L.) in Sri Lanka and with Particular Reference to Ruhuna National Park. Tigerpaper 10 (11): 20-26. Bucher, E.H. 2000. Chaco and Caatinga-South American Arid Savannas, Woodlands and Thickets. In: Huntley, B.J. and B.H. Walker (ed). Ecology of Tropical Savannas. Berlin: SpringerVerlag. Djufri. 2004a. Invasi spesies eksotik akasia berduri (Acacia nilotica) (L.) Willd ex Del. di Taman Nasional Baluran Jawa Timur: ancaman terhadap eksistensi savana. ENVIRO 4 (2): 88-99. Djufri. 2004b. Acacia nilotica (L.) Willd. ex Del. dan permasalahannya di Taman Nasional Baluran Jawa Timur. Biodiversitas 5 (2): 96-104.

145

Djufri. 2005. Pola distribusi dan asosiasi tumbuhan bawah pada tegakan akasia (Acacia nilotica) (L.) Willd. ex. Del. di Savana Kramat Taman Nasional Baluran JawaTimur. ENVIRO 5 (1): 48-54. MacKinnon, J., K. MacKinnon, G. Child, and J. Thorsell (eds). 1988. Managing Protected Areas In the Tropics. Gland, Switzerland: International Union for Conservation of Nature and Natural Resources. McIlroy, R.J., 1964. An Introduction to Tropical Grassland Husbandry. London: Oxford University Press. Klein, D.R. 1985. Population ecology the interaction between deer and their food supply in biology of deer production. Bulletin New Zealand 22: 23-32. Lekagul, B. and J.A. McNeely. 1977. Mammals of Thailand. Bangkok: Sahakarnbhat Co. McIvor, J.G. and C.J. Gardener. 1985. Germination of introduced pasture species in the semi-arid tropics. In: Tothill, J.C. and J.J. Mott (eds). Ecology and Management of the World’s Savannas. Canberra: The Australian Academy of Science. Sabarno. 2002. Savana Taman Nasional Baluran. Biodiversitas 3 (1): 207-212. Santoso, N. 1984. Studi Populasi Banteng dan Kerbau Air di Padang Penggembalaan Bekol Taman Nasional Baluran. [Skripsi]. Bogor: Fakultas Kehutanan Institut Pertanian Bogor. Saraswati, A. 2002. Daya dukung Savana Bekol terhadap keberadaan rusa timor (Cervus timorensis). Prosiding Seminar Nasional Taman Nasional Baluran I. Jember, 11 Agustus 2002. Sastrapradja, D.S., S. Adisoemarto, K. Kartawinata, S. Sastrapradja, dan M.A. Rifai. 1989. Keanekaragaman Hayati untuk Kelangsungan Hidup Bangsa. Bogor: Puslitbang Bioteknologi LIPI Suhadi. 1996. Perilaku Banteng (Bos javanicus d'Alton) di Padang Penggembalaan Sadengan Taman Nasional Alas Purwo. [Tesis]. Jakarta: Program Pascasarjana Universitas Indonesia. Suhadi. 2003. Seeds bank dispersal on trampled by banteng (Bos javanicus d’Alton), water buffalo (Bubalus bubalis), large deer (Cervus timorensis) in the Baluran National Park. AGRITEK 11 (3): 469-476. Suhadi. 2004. Sebaran tumbuhan bawah bekas injakan banteng (Bos javanicus d’Alton), kerbau liar (Bubalus bubalis), dan rusa (Cervus timorensis) di Taman Nasional Baluran. Biota 9 (2): 78-83. Suhadi. 2008a. Kajian Invasi Acacia nilotica Willd ex. Del dan Injakan Satwa terhadap Diversitas dan Biomassa Herba di Savana Bekol Taman Nasional Baluran. [Disertasi]. Malang: Program Pascasarjana Fakultas Pertanian Universitas Brawijaya. Suhadi. 2008b. Perkembangan tumbuhan Acacia nilotica Willd ex. Del di Savana Bekol Taman Nasional Baluran. Prosiding Lokakarya Nasional Herbarium Seminar dan Konggres PTTI Ke VIII. Cibinong-Bogor, 21-23 Oktober 2008. Tulloch, D.G. 1978. The Water Buffalo (Bubalus bubalis) in Australia; Grouping and Home Range. Melbourne: Australian Wildlife Research.

BIODIVERSITAS Volume 10, Number 3, July 2009 Pages: 146-150

ISSN: 1412-033X (printed edition) ISSN: 2085-4722 (electronic) DOI: 10.13057/biodiv/d100308

Ethnobotanical study on the Genus Pandanus L. f. in certain areas in Java, Indonesia ♥

WARDAH , FRANCISCA MURTI SETYOWATI "Herbarium Bogoriense", Botany Division, Research Center for Biology, Indonesian Institute of Sciences (LIPI), Cibinong-Bogor 16911 Received: 23rd February 2009. Accepted: 4th May 2009.

ABSTRACT There were two species of Pandanus recorded in Java, Pandanus amaryllifolius Roxb. and Pandanus tectorius Sol. The leaf of P. tectorius is commonly harvested as source of handicraft materials, while P. amaryllifolius is for culinary aromatic purposes only. The pandan kunyit (P. tectorius Sol.) in Bangkalan and pandan jeksi (P. tectorius Sol. var. samak Werb.) in Kebumen (Central Java) are the best resource for plaiting industry. Prospect of Pandanus plaiting can rise the income of farmers in the village and rise foreign exchange depend on how to fulfill the best pandan and its processing. It is hoped the good relation between farmers and government to sustain and develop the pandan production. © 2009 Biodiversitas, Journal of Biological Diversity Key words: ethnobotany, Pandanus, uses, Java.

INTRODUCTION Pandanaceae is plants family which geographically distributed from seaside to high mountains. Pandanaceae consists of 3 genera, namely Sararanga Hemsl. (2 spp.), Freycinetia Gaidich. (175 spp.), and Pandanus Parkinson (600 spp.) (Stone 1976). Distribution area of genus Freycinetia spp. are Java, Sumatra, Maluku; Pandanus spp. in Java, Sumatra, Bali, Sulawesi, Kalimantan, Little Sunda Islands, Maluku, and Papua, whereas Sararanga spp. currently was found in eastern Indonesia (Sulawesi). The diversity of Pandanaceae gave inspiration to inventory use and its potential for Indonesian people. Backer and Bakhuizen van den Brink Jr. (1968) stated that there are 15 types of Pandanus in Java, namely P. andamanensium (southern coast of W. and on Nusakambangan), P. labyrinthicus (W. coast of Sumatra; might also occur in Java), P. faviger (Lamongan and Bali), P. pygmaeus, P. amaryllfolius, P. vandermeeschii, P. utilis, P. boninensis, P. kurzii Merr., P. tectorius Soland ex Park, P. polycephalus Lamk, P. furcatus Roxb., P. bidur Jungh ex Miq, P. nitidus Kurz, and P. hasskarlii Merr. Based on herbarium specimen belongs to Herbarium Bogoriense (BO), LIPI there are 11 types of Pandanus. Pandanus is valuable in either its benefit or  Corresponding address: Jl.Raya Jakarta-Bogor Km 46, Cibinong-Bogor 16911 Tel. & Fax.: +62-21-8765066, +62-21-8765062 e-mail: wardah_etnobio@yahoo.com

ecology Pandanus is useful for ritual, ornamental plants, fragrance, and as industrial material, such as bag, rope, hat, plaited, mat, house and building roofs. From ecology aspect, Pandanus can be used as restraining material for wind, sand erosion and tsunami wave, especially in coastal areas with mangrove. Besides wild and cultivated Pandanus species correlated with development of community culture currently, the shifting is occurred because of using other products, such as plastic, coconut husks, “mendong” and iron. Some references stated that Pandanaceae has various uses such as foodstuffs, traditional medicine, building material or roof, fiber material, local technology and other uses (Powell, 1976a,b; Stone, 1982, 1983, 1984; Rose, 1982; Silltoe, 1983, Hyndman, 1984; French, 1986; Haberle, 1991a,b; Milliken, 1994; Leigh, 2002; Walter and Sam, 2002). In Java, handicrafts made from Pandanus are found in East Java (Madura, Lamongan) and Central Java (Karanganyar sub-district, Kebumen). Pandan handicrafts came from Banten (Bojong Manik subdistrict, Rangkasbitung) are sold as local product markets at West Java and surrounding areas. Pandanus in East Java (Madura, Lamongan) and Central Java (Karanganyar sub-district, Kebumen) has good prospect, but the quality should be improved, so the pandan handicrafts communities can fulfill demand at foreign market. Pandan handicrafts were exported to several countries, such as plaited mat from East Java (Lamongan) were exported to China, whereas from Central Java (Karanganyar sub-district, Kebumen) were exported to Canada, China, German, France, and Japan.

WARDAH & SETYOWATI â&#x20AC;&#x201C; The use of Pandanus in Java

Pandan handicrafts from Banten (Bojong Manik subdistrict, Rangkasbitung) were sold for local products at West Java and its surroundings. The pandan handicrafts has good prospects in increasing devise (foreign exchange), so collaboration of communities and government are needed to preserve and develop pandan products. The objective of this research was to discover and describe the potential of Pandanaceae as foodstuff, local technology material, traditional medicines, ornamental plants, building materials (roofs), sociocultural roles (tradition ritual and other social values), etc. Socioeconomic roles of Pandanaceae for communities life was also analyzed, i.e. domestication aspects (evolution of extractivisme activities to cultivation to development), post harvest technology, art and crafts techniques (indigenous technology) of Pandanaceae, its management and preservation.

MATERIALS AND METHODS Area study. Data collecting were conducted at several villages in East Java, Central Java and Banten as follows: (i) Galis Dajah village, Konang sub-district, Bangkalan, East Java, (ii) Durjan village, Kokop sub-district, Bangkalan, East Java, (iii) Aeng Tabar village, Tanjung Bumi sub-district, Bangkalan, East Java, (iv) Saplasan village, Sepulu sub-district, Bangkalan, East Java, (v) Sumber Dadi village, Mantup sub-district, Lamongan, East Java, (vi) Grenggeng village, Karanganyar sub-district, Kebumen, Central Java, (vii) Kalirejo village, Kebumen sub-district, Kebumen, Central Java, (viii) Kebon Cau village, Bojong Manik sub-district, Rangkasbitung, Banten. Procedures. The research used method which commonly used in anthropology, ecology, physiology, phytochemistry, socio-economy and ethnobiology research. Direct participation in communities life was essential method to obtain information. Information was obtained by open-ended interviewing, free, direct observation at communities and arranging questionnaire. Interview was carried out with customary head, traditional healers, craftsmen, labor, and communities having knowledge on Pandanaceae. Information were also obtained from direct observation at communities location, sample collection (plants and artifact), literature and its analyses.

RESULTS AND DISCUSSION Use of pandan Although pandan has long been used by communities in Java for various uses from plaiting mat to medication, and there are previous report on pandan ethnobotany in Java, completed scientific

147

record which specifically assess pandan use at industry scale at Java was reported by Hofstede (1925), where Tangerang (Banten Province now) is considered as one of pandan industry center at Java. The pandan type which most used as raw material for handicrafts industry is Pandanus tectorius (Keim et al., 2006). The products of pandan industry in Java Islands itself were marketed to throughout Indonesia (at that time Netherlands East Indies), even to foreign countries; such as several countries in Europe (Netherlands, France, Italy), Egypt, USA, Canada, Australia, Singapore and with export volume reached 4,8 million pandan hat of 1.049.000 guilder in production year of 1920 which considered as huge export value at that time. However, since Indonesia Independence, export volume of pandan industry was continuously decreasing and at that time pandan industry was dominated by Philippines, which has long been major competitor in Indonesia pandan industry (Hofstede, 1925). After Hofstede until present, study on pandan industry in Java, such as at Banten, Central Java particularly Kebumen, and East Java has not much been done, and also information of current pandan ethnobotany. Observation of Pandanaceae in East Java, especially Bangkalan district, was carried out at 4 villages of 4 sub-districts. The communities used pandan as plaiting material. Survey result showed that the best quality of plaiting product was handicrafts made by communities of Galis Dajah village, Konang sub-district. Pandan handicrafts produced by communities from Sumber Dadi village, Mantup sub-district, Lamongan district have various types, such as plaited mat, slipper, trash box, tissue box, hat, shopping bag, party bag, laundry box, jewelry box, wallet, etc. Thus pandan plaiting crafts from Kalirejo village and Grenggeng village, Kebumen district has good quality for export, because the communities has good knowledge in pandan processing and making pandan plaiting crafts, from cultivation, maintaining, and use of each pandan species. The processing of raw material into pandan plaiting products was complicated, so the making of pandan plaiting crafts should be managed professionally with involving private sector (local entrepreneurs). Pandan traditionally is used by communities in Malesia and Pacific for various daily uses. Use of pandan at western part of Malesia (including western part of Indonesia) was not as broader as eastern part of Malesia or eastern part of Indonesia and Pacific (Powel, 1976a,b; Stone, 1982, 1983, 1984; Jebb, 1992; Leigh, 2002). At western part of Indonesia, pandan leaves generally was used as food flavorings (P. amaryllifolius Roxb.) and other uses was only for households appliances purposes, such as plaited mat, hat and traditionally ceremony (pandan samak P. odoratissimus; pandan bidur P. dubius Speng. and cangkuang P. furcatus Roxb.). At Lombok (West Nusa Tenggara) pandan leaves were used for war

148

B I O D I V E R S I T A S Vol. 10, No. 3, July 2009, pp. 146-150

traditional ceremony which related to soil fertility procession (Keim, 2007). There are two species of Pandanus recorded from areas understudy: Pandanus amaryllifolius Roxb. and P. tectorius Sol. This finding is in accordance with Hofstede (1925) that the two species are among the most cultivated species of Pandanus in Java, in which the leaves of P. tectorius is most commonly harvested for source of handicraft materials, while P. amaryllifolius for culinary aromatic purposes only Species diversity At Galis Dajah village (Konang sub-district), Durjan village (Kokop sub-district), and Aeng Tabar village (Tanjung Bumi sub-district), the communities only know one pandan species that are pandan kunyit (Pandanus tectorius Sol.), whereas at Saplasah village (Sepulu sub-district) it is known 4 pandan species, those are: (i) “Pandan langka” (the rare pandan, Pandanus tectorius Sol.). The plants are small and short; leaves are also small and short with length 60-90 cm, width 3-4 cm, spiny. The plants are used to make plaited mat but not preferable because of poor quality. (ii) “Pandan panjang” (the long pandan, Pandanus tectorius Sol.). The plants are big and tall, leaves with length 150-250 cm, width 5-8 cm, spiny. This plants are preferred by villagers for making plaited mat. (iii) Spineless pandan (Pandanus tectorius Sol.). This taxon was previously identified as Pandanus tectorius Sol. var. laevis by Backer and Bakhuizen van den Brink Jr. (1968). However, according to Keim (2009, pers. comm.) the infraspecific classification in P. tectorius is best avoided as P. tectorius is known for its morphological variability, thus the variety infraspecific category is tentative. The plants are big and tall until 10 m, spineless leaves edge. This pandan species are not used for making plaited mat, but as feedstuffs. (iv) “Pandan wangi” (the odorous pandan, Pandanus amaryllifolius Roxb.). The plants grow in clumps and have thin and sharp leaves at edge like sword, fragrant odor. Pandan wangi is used for traditional food preparation, especially at Melayu communities, it is used as dye, perfume, and appetite. Its extract has been used in food industries, such as bread and biscuit factories as dye materials, and also soya beverage and coconut milk. Pandan wangi has used for traditional medicines for morbili fever, gonorrhea, syphilis, and anemia. The communities of Kebumen, Central Java have known 5 pandan species, those are: (i) “Pandan jeksi” (Pandanus tectorius Sol.). Its leaves are green, thin and limp, glossy, length of 75-125 cm, flexible, short and soft spiny, fast growing. This species is used more for making

plaiting materials because the product is glossy white and has good export quality. (ii) “Pandan sari” (Pandanus tectorius Sol.). The leaves are not too long only 100-160 cm, soft spiny, slow growing. This species was more used for sewing plaiting border of various crafts. (iii) “Pandan jaran” (the horse pandan, Pandanus tectorius Sol.). The leaves are longer than pandan jeksi (150-190 cm), rigid and easy to break. This species is seldom used for plaiting because of yellow spotted leaves. (iv) “Pandan pantai” (the beach pandan, Pandanus tectorius Sol.). Grow at coastal areas, the tree was tall, its leaves are rigid, less used for plaiting. (v) “Pandan wangi” (Pandanus amaryllifolius Roxb.). The plants grow in clumps and have thin wide 4.5 cm and length of 40-80 cm and also sharply at the edge like sword. In Java, the plants can be found at home yard because of fragrant odor and generally used for fragrant and food colorants (Heyne 1927). Based on data collected on pandan types used at Java with same local names compare to data recorded by Heyne (1927), it showed that until present the pandan types are still used by communities. This proved that pandan was considered as commodity which can support daily living of rural communities. Processing of pandan Generally processing of pandan at each village was similar, but there are several differences at boiling, soaking, and shaving stages. The processing of pandan was done without boiling, through soaking process, and without soaking process. Besides, duration of soaking process and shavings process also differ based on quality of processed pandan products. The processing stages will affect the quality of plaiting materials. The processing stages of pandan plaiting crafts are as follows: (i) Taking pandan leaves at planting fields (garden, backyard, rice field) using knife. (ii) Removing thorn using string. (iii) Dividing one leaf into 4-8 based on leaves width and its uses, using glass-thread/string. (iv) Boiling pandan leaves for 1 hour and then air-dried. (v) Soaking in cold water for 2 days and the water was changed every day to get pandan color into white and glossy. (vi) Sun-drying of pandan leaves. (vii) Leaves shavings using bamboo. (vii) Sun-drying of pandan leaves. (viii) Leaves shavings using bamboo. (ix) Plaiting pandan leaves. At plaiting stages, it is requires skill and patient. It 2 takes 2 days to make plaited mat with size 1x2 m , if it is done continuously, but if it is done in leisure time it will take longer. For size of plaited mat, it is used “cengkol” term. One cengkol is measured from elbow to middle finger. Plaited mat with size 5x3 cengkol is sold at price Rp 20,000. At Durjan village, Kokop sub-district. There are traditional market every Wednesday where villagers

WARDAH & SETYOWATI – The use of Pandanus in Java

buy and sell their daily basic needs, such as foods, medicine, materials for ritual, crafts materials and handicrafts (plaited mat). Raw pandan plaited mat or 2 without boiling process with size 1.2x2 m and colored brown was sold at Rp 15,000 per sheet., while plaited mat with same size but with boiling process was sold at Rp. 30,000 and colored glossy white. Plaiting materials in ribbon form, boiled, and unshaved was sold at Rp. 7,000/bound. One bound was enough to make small size plaited mat. The estimation of length of pandan leaves and plaiting product are as follows: Table 1. .Length of pandan leaves and plaiting product Length of pandan leaves 70 cm 85-90 cm 100 cm

Plaiting product 40 cm 50 cm 60 cm

149

product is glossy white and has good export quality. (ii) Pandan sari (Pandanus tectorius Sol.). The leaves are not too long only 100-160 cm, soft spiny, slow growing. This species was more used for sewing plaiting border of various crafts. (iii) Pandan jaran (Pandanus tectorius Sol.). The leaves are longer than pandan jeksi (150-190 cm), rigid and easy to break. This species is seldom used for plaiting because of yellow spotted leaves. (iv) Pandan pantai (Pandanus tectorius Sol.). Grow at coastal areas, the tree was tall, its leaves are rigid, less used for plaiting. (v) Pandan wangi (Pandanus amaryllifolius Roxb.). The plants grow in clumps and have thin wide 4.5 cm and length of 40-80 cm and also sharply at the edge like sword. In Java, the plants can be found at home yard because of fragrant odor and generally used for fragrant and food colorants (Heyne, 1927).

CONCLUSION At Kalirejo village (Kebumen) and Sumber Dadi (Lamongan), pandan plaiting products was dyed using synthetic dyes. Diversity of pandan species At Galis Dajah village (Konang sub-district), Durjan village (Kokop sub-district), and Aeng Tabar village (Tanjung Bumi sub-district), the communities only know one pandan species that are pandan kunyit (Pandanus tectorius Sol.), whereas at Saplasah village (Sepulu sub-district) it is known 4 pandan species, those are: (i) Pandan langka (Pandanus tectorius Sol.). The plants are small and short, leaves are also small and short with length 60-90 cm, width 3-4 cm, spiny. The plants are used to make plaited mat but not preferable because of poor quality. (ii) Pandan panjang (Pandanus tectorius Sol.). The plants are big and tall, leaves with length 150-250 cm, width 5-8 cm, spiny. These plants are preferred by villagers for making plaited mat. (iii) Pandan tidak berduri (Pandanus tectorius Sol. var. laevis). The plants are big and tall until 10 m, spineless leaves edge. This pandan species are not used for making plaited mat, but as feedstuffs. (iv) Pandan wangi (Pandanus amaryllifolius Roxb.). The plants grow in clumps and have thin and sharp leaves at edge like sword, fragrant odor. Pandan wangi is used for traditional food preparation, especially at Melayu communities; it is used as dye, perfume, and appetite. Its extract has been used in food industries, such as bread and biscuit factories as dye materials, and also soya beverage and coconut milk. Pandan wangi has used for traditional medicines for morbili fever, gonorrhea, syphilis, and anemia. The communities of Kebumen, Central Java have known 5 pandan species, those are: (i) Pandan jeksi (Pandanus tectorius Sol.). Its leaves are green, thin and limp, glossy, length of 75-125 cm, flexible, short and soft spiny, fast growing. This species is used more for making plaiting materials because the

The communities of Konang, Kokop and Tanjung Bumi sub-districts, East Java province only know one pandan species, that are pandan kunyit (Pandanus tectorius Sol.), whereas at Saplasah village, Sepuluh sub-district the communities know 4 Pandanus species, those are pandan langka (Pandanus tectorius Sol.), pandan panjang (Pandanus tectorius Sol.), spineless pandan (Pandanus tectorius Sol. Var. laevis) and pandan wangi (Pandanus amaryllifolius Roxb.). In Central Java, pandan Jeksi (Pandanus tectorius Sol. var. samak Werb.) has good quality and good prospect as plaiting materials, because the plants are big, tall, green-colored and long leaves; pandan sari (Pandanus tectorius Sol.), pandan jaran (Pandanus tectorius Sol.), pandan pantai (Pandanus tectorius Sol.), and pandan wangi (Pandanus amaryllifolius Roxb.). In West Java, there is one pandan species that are Pandanus tectorius Sol.

REFERENCES Backer, C.A. and R.C. Bakhuizen van den Brink Jr. 1968. Flora of Java (Spermatophytes only) vol. 3 Groningen: Nv.P. Noordhoff. French, B.R. 1986. Food Plants of Papua New Guinea: A Compedium. Tasmania: Sheffield. Haberle, S.G. 1991a. Ethnobotanical research in the Tari Basin. Papua New Guinea Program & Abstract of New Perspectives on the Papua New Guinea Highlands, An interdisciplinary Conference on the Duna, Huli and Ipili Peoples. Canbera: Australian National University. Haberle, S.G. 1991b. Ethnobotanical Research in the Tari Basin. Southern Highlands Provinci, Papua New Guinea. Monograph, Biogegraphy and Geomorphology. Canberra: Australia National University. Heyne, K. 1927. De Nuttige Planten van Nederlandsch Indië. 2nd ed. Vol. 1. Batavia: Department van Landbouw, Nijverheid en Handel in Nederlandsch Indië. Hofstede, H.W. 1925. Het Pandanblad: Als grondstof voor de Pandan hoedenindustrie op Java. Eibergen: H. Heinen. Hyndman, D.C. 1984. Ethnobotany of Wopkaimin Pandanus: significant PNG Plant Resources. Economic Botany 38 (3): 287-303.

150

B I O D I V E R S I T A S Vol. 10, No. 3, July 2009, pp. 146-150

Jebb, M. 1992. A Field Guide to Pandanus in New Guinea, the Bismarck Archipelago & the Solomon Islands. Madang: Christensen Research Institute. Keim, A.P., Rugayah, S. Prawiroatmodjo, M. Rahayu, F.I. Windadri, S. Sunarti, K. Kramadibrata, Y. Santika, Dewi, Sunardi, dan Hamzah. 2006. Keanekaragaman suku pandan (Pandanaceae) di beberapa wilayah terpilih dalam lingkup Taman Nasional Ujung Kulon, Banten. Laporan Perjalanan Eksplorasi dan Pengungkapan Pemanfaatan Flora untuk Revisi Suku-suku Terpilih, Taman Nasional Ujung Kulon-Banten. Herbarium Bogoriense, Bogor. Bogor: Puslit Biologi LIPI. Keim, A.P. 2007. 300 tahun Linnaeus: Pandanaceae, Linnaeus dan Koneksi Swedia.Memperingati 300 tahun Carolus Linnaeus. Pusat Penelitian Biologi-LIPI. Bogor, 24 Mei 2007. Leigh, C. 2002. Baining Dances and Bark Cloth Masks. East Britain Province-Papua New Guinea. Tucson. A: Art-Pacific. Milliken W. 1994. Ethnobotany of the Yali of West Papua. Edinburgh: Royal Botanic Garden. Powell, J.M. 1976a. Ethnobotany. In: Paijmans, K. (ed.). New Guinea Vegetation. Amsterdam: Elsevier.

Powell, J.M. 1976b. Some useful wild and domesticated plants of the Huli of Papua. Science in New Guinea 4: 173-201. Rose, C.J. 1982. Preliminary observation on the Pandanus nut (Pandanus julianetti Marteli). Proceedings of the Second Papua New Guinea Food Crops Conference. Port Moresby: Departement of Primary Industry, PNG. Stone, B.C. 1976. On the biogeography of Pandanus (Pandanaceae). Société de Biogéographie 458: 69-90. Stone, B.C. 1982. New Guinea Pandanaceae. First approach to ecology and biogeography. In: Gressitt. J.L (ed). Biogeography and Ecology of New Guinea. Vol.1 Monograhiae Biologicae 42. The Hague: Dr. W. Junk Publ. Stone, B.C. 1983. A guide to collecting Pandanaceae (Pandanus, Freycinetia and Sararanga). Annals of the Missouri Botanical Garden. 70: 137-145. Stone, B.C. 1984. Pandanus from Ok Tedi Region, PNG collected by Debra Donoghue. Economic Botany 38 (3): 304-313. Walter, A. and C. Sam. 2002. Fruits of Oceania. ACIAR Monograph No 85 Canberra: ACIAR.

BIODIVERSITAS Volume 10, Number 3, July 2009 Pages: 151-157

ISSN: 1412-033X (printed edition) ISSN: 2085-4722 (electronic) DOI: 10.13057/biodiv/d100309

Extraction of Coconut Oil (Cocos nucifera L.) through Fermentation System ♥

RINI HANDAYANI , JOKO SULISTYO, RITA DWI RAHAYU Microbiology Division, Research Center for Biology, Indonesian Institute of Sciences (LIPI), Cibinong-Bogor 16911 Received: 28th October 2008. Accepted: 4 December 2008.

ABSTRACT Coconut oil (Cocos nucifera L.) has a unique role in the diet as an important physiologically functional food. The health and nutritional benefits that can be derived from consuming coconut oil have been recognized in many parts of the world for centuries. There are few techniques for coconut oil extraction, such as physical, chemical, and fermentation or enzymatic processes using microbial inoculum as enzymatic starter. Starter with different concentration (1.0; 2.5; 5.0; and 10%) of microbial strains were added into coconut cream and allowed to be fermented for over night. The extracted oil was analyzed for further experiment, especially on its antibacterial activity. The maximum yield of 27.2% was achieved by adding 5.0% starter. Water content, acid value, FFA, and peroxide value of the fermented coconut oil were 0.3%, 0.45%, 0.22% and 2.54% respectively. A gas chromatogram showed that this fermented oil contained high lauric acid (46.82%), and 6.01% caprylic, 7.5% capric, 17.02% miristic, 7.21% palmitic, 3.11% palmitoleic, 5.41% stearic, and 1.3% linoleic acid, respectively. An inhibitory effect of such kind coconut oil which contains potential fatty acid against bacterial growth was further examined. It was found that this edible oil exhibited antibacterial activity to inhibit the growth of Bacillus subtilis, Escherichia coli, Pseudomonas fluorescence, Bacillus cereus and Salmonella; however it showed slightly inhibitory effect when it was exposed to Bacillus cereus and Escherichia coli. © 2009 Biodiversitas, Journal of Biological Diversity Key words: coconut oil, inoculum, fermentation, lauric acid, antibacterial.

INTRODUCTION A novel method on improving quality of coconut oil (Cocos nucifera L.) to produce best quality of coconut oil for industrial application is increased. One of them is a method of extraction through fermentation or enzymatic system (Rosenthal et al. 1996). Virgin coconut oil (VCO) is made from fresh coconuts, not copra. Since high temperatures and chemicals solvent are not used, the oil retains its naturally occurring phyto-chemicals which produce a distinctive coconut taste and smell. The oil is pure white when the oil is solidified, or crystal clear like water when liquefied. The oil contained high lauric acid (C-12, c.a. 50%) as saturated fatty acid and has known well as medium chain fatty acid (MCFA). MCFAs are burned up immediately after consumption and therefore the body uses it immediately to make energy rather than store it as body fat (Enig, 1996; Kabara, 1984). Studies have revealed that populations who traditionally consume large quantities of coconut as a

 Corresponding address: Jl. Raya Bogor Km. 46 Cibinong-Bogor 16911 Tel. +62-21-8765066. Fax. +62-21-8765063/62 e-mail: handayanirini@yahoo.co.uk

part of their diet have a low incidence of health problems associated with blood clotting, including heart disease and stroke (Prior et al., 1981). Coconut oil is very stable and does not need to be refrigerated since it contains a saturated fatty acid, because all the carbon-atom linkages are filled or saturated with hydrogen. This means that they do not normally go rancid, even when they heated, degraded, irradiated, oxygenated for cooking or other purposes (Issacs, 1986; Rindengan and Novarianto, 2004). The VCO processed by fermentation or enzymatic system has more beneficial and safety effect rather than traditional methods from copra, since they often infected by insects or aflatoxin producing molds that caused potential toxicity problem during manufacturing. Traditional coconut oils are considered to be low quality products which indicated by high moisture and free fatty acid content. It was therefore easily to rancid and turned to brown and exhibited relatively short life-time by sensory test (Soeka et al., 2008). Extraction process of coconut oil through fermentation or enzymatic system involved microbial starter inoculums or enzymatic starter that play a role on breaking of coconut milk emulsion, while through traditional processes the oil extraction were carried out physically by using of heating or mechanical

152

B I O D I V E R S I T A S Vol. 10, No. 3, July 2009, pp. 151-157

expelling (Ketaren, 1986). Activities of enzymes were affected by substrate and enzyme concentration, pH, temperature, and incubation time (Pelczar and Chan, 1986). Microbial starter was utilized as their shown on proteolytic, amylolytic and lipolytic capacities. These kinds of enzymes are required to hydrolyze protein, carbohydrate and lipid components contained in the coconut kernel. Basically, the purpose of the fermentation or enzymatic processes is to make the coconut emulsion into unstable condition and therefore easily to separate into oil phase on upper layer and carbohydrate, protein and water phase on below layer (Soeka et al., 2008; Rahayu et al., 2008). The purpose of research was to develop the extraction method of coconut oil to produce high quality virgin coconut oil (VCO) and expectedly useful for improving technology on extraction of VCO naturally. MATERIALS AND METHODS Microbial strains The strains used in this experiment were Lactobacillus bulgaricus, Saccharomyces cerevisiae, Candida rugosa, Aspergillus oryzae, Salmonella, Pseudomonas fluorescens, Escherichia coli, and Bacillus substilis, soy-sauce starter (Aspergillus oryzae), bake yeast (Saccharomyces sp), tempeh starter (Rhizopus oligosporus), and beverage yeast (Candida utilis) obtained from the collection of Microbiology Division of Research Center for Biology, Indonesian Institute of Science (LIPI) Cibinong-Bogor. Chemical reagents Bacto-peptone, yeast extract, agar, potatoes dextrose agar (PDA), KH2PO4, MgSO4.7H2O, soluble starch were purchased from Sigma and Merck. Steps of experiment The experiment was carried out on five steps, i.e.: (i) strains selection, (ii) starter production, (iii) coconut oil extraction, (iv) qualitative and quantitative analysis of oil product, (v) assay on antibacterial activity of coconut oil. Coconut oil preparation The coconut type used for making virgin coconut oil was according to method of Rindengan and Novarianto (2004). The coconut cultivars used in this experiment were kelapa dalam, genjah salak, and genjah kuning. Matured coconut was grated and the grated coconut was then mixed with hot tap water (1:1, w/v). After squeezing and filtering, coconut milk was pooled into a clean jar and stayed for 1h. After separating into two layers those were cream on upper part which riched in oil content while skim layer riched in protein on below part was drained off, and the remained cream one was then fermented overnight to prepare virgin coconut oil.

Agar media preparation Potatoes dextrose agar (PDA) media and nutrient agar (NA) media containing 0.75 g yeast extract, 1.25 g peptone, 5g agar and 10g potato or malt extracts, respectively, were prepared according to Cappuccino and Sherman (1983). These ingredients were dissolved into 250 mL distilled water, and then melted using microwave for 3 min to accelerate their solubility. The melted media were poured into tubes and autoclaved for 15 min at 121ยบC and cooled down onto elevate rack to prepare slant culture media. Microbial screening To prepare enzymatic starter for extracting virgin coconut oil, both of yeast and mold strains were inoculated onto PDA and bacterial strain onto NA and then incubated for 3 days at room temperature. Stock cultures were transferred into liquid media containing coconut water, coconut skim, pineapple or malt extract, urea and molasses. Assay for enzymatic activities Selected media for assaying proteolytic and amylolytic activities was referred to a method of Sulistyo et al. (1999). One ose-needle of stock culture of bacterial strain was inoculated into nutrient broth o (NB) and incubated for 24h at 37 C. One mL of culture was added into 9.0 mL of NB media and o incubated for 24h at 37 C. One mL of respective stock cultures were inoculated into 9.0 mL NB, and o incubated at 37 C for 2 days. Proteolytic activity was measured semi quantitatively on the media containing 1% KH2PO4, 2% MgSO4.7H2O, 1% yeast extract, 5% agar and 2% skim milk. Qualitatively analysis was done based on activity tested on agar media grown with 3 days-old microbial strains. The proteolytic activity was indicated by present of clear zone surrounded colonies of strains. Amylolytic activity was measured as by measuring proteolytic activity when 1% soluble starch was applied to the media rather than 2% skim milk. Observation was carried out on present of clear zone after employing iodine reagent (Mestecky et al., 2004). Enzymatic starter preparation The media for production of starter containing coconut water, coconut skim, pineapple or malt extract, urea and molasses in 500mL Erlenmeyer flask was sterilized using autoclave for 15 min at 121ยบC. After cooling down to a room temperature, the media were inoculated by Lactobacillus bulgaricus, Aspergillus oryzae, Candida rugosa and Saccharomyces cerevisiae, respectively. The respective starters those were incubated with different cultures were then employed to the coconut cream o and incubated at 40 C for overnight. The oil was obtained through this process were then measured and analyzed. Influence of strains growth toward o incubation temperature at 25, 30, 35, 40 and 45 C and pH of media at 3, 4 , 5, and 6 during incubation

HANDAYANI et al. – Extraction of virgin coconit oil

on the shaker for 5 days and employed concentration of starter at 1%, 3%, and 5% toward the yield of obtaining coconut oil were studied to determine capacity of respective microbial strains those were suitable for preparing an effective starter in producing high yield of VCO (Sulistyo et al., 1999). The strain that exhibited high yield on oil production was selected and examined further in comparison to the capacities of commercial starter products on extracting coconut oil through fermentation system, such as soy-sauce starter mold (A. oryzae), bake yeast (Saccharomyces sp.), tempeh starter (R. oligosporus), and alcoholic beverage yeast (C. utilis). The obtaining oils derived from different coconut type were then filtered through activated charcoal and analyzed using gas chromatography (GC). Yield measurement Yield of obtaining coconut oil was determined by using the method of gravimetric (v/v) as follows: Yield = Volume of obtaining oil (mL) x 100% Volume of coconut cream (mL) Fatty acid analysis Sample of VCO was analyzed according to the method of Rietschel et al. (1972). Approximately 2030 mg of sample was placed into a tube with cap and added with 1.0 mL 0.5 N NaOH in methanol and hydrolyzed for 20 min. After addition with 2.0 mL of 16% BF3 in methanol and 2.0 mL of saturated NaCl to remove emulsion, the reaction mixture was then extracted with hexane. The hexane layer was then transferred into a flask containing anhydrate 0.1g Na2SO4 as moisture absorbent. The prepared sample was injected onto GC using internal standard of fatty acids, under GC condition at 190-200ºC, flow rate 1.0 cm/s, fused silica capillary column (3 m length), flame ionization detector and volume of sample injection was 4.0 µL. Proximate analysis According to the method of Suminar et al. (2001), the proximate analysis for determining acid value, free fatty acid, moisture and peroxide content of VCO was carried out by preparing 2.5 g of sample onto erlenmeyer flask. A titration reagent of 25 mL alcoholbenzene (1:1, v/v) was pre-heated on a water bath at 70ºC for 10 min after addition with 3 drops of phenolphtalein as indicator and the mixture was titrated with 0.01 N NaOH up to the solution just turned to slight red. The solution was mixed with sample and heated for 5 min and titrated again with 0.01 N NaOH at least for 10 min. Acid value = A x N x 40 Sample weight (g) FFA (%) = A x N x M x 100% Sample weight (mg)

A N M

153

= Quantity of NaOH = Normality of NaOH = MW of lauric acid

Moisture content Moisture content was determined by weighing 10g of sample and placed onto a petri dish that had already determined for its blank weight. The sample was heated at 105ºC for 2h in an oven and cooled it down in a desiccator for approximately 15 min and weighed again. Moisture content = A - B x 100% A Assay on antibacterial activity Antibacterial activity was assayed by preparing nutrient broth (NB) in some reaction tubes. The media containing 0.3 g yeast extract and 0.5 g peptone in o distilled water was sterilized by autoclaving at 121 C for 15 min. The NB media was incubated on the shaker after inoculating with 1ose of tested bacteria for 2 days. One mL of pre-incubated media which containing the tested bacteria was then diluted into the tubes containing 9.0 mL of sterilized distilled water and more over diluted gradient up to obtaining -3 -3 dilution at 10 . Finally, 0.1 mL of the 10 diluting sample was transferred onto the petri dish containing NA media. To determine the activity of VCO against bacterial growth, a smeared paper dish with VCO was placed onto the media, and the activity of antibacterial was assayed by observing the present of clear zone surrounding the colony that had grown by tested strains after 2 days incubation (Carson and Riley, 1995). RESULTS AND DISCUSSION Amylolytic and proteolytic activity To determine the capacity of some microbial strains in producing enzymatic starter that was suitable for extraction of VCO, we had employed four selected microbial strains were L. bulgaricus, S. cerevisiae, C. rugosa and A. oryzae. The enzymatic activities of these strains were investigated according to the method of gel diffusion on the media containing starch for amylolytic activity or skim milk for proteolytic activity as mentioned in the Methods and Materials. The strain of L. bulgaricus showed the highest activity for amylolytic and proteolytic enzymes as indicated by formation of colony surrounding clear zones. Diameter of clear zone ( 2.0 cm) was undoubtedly illustrated that the strain of L. bulgaricus capable to produce amylase and protease those were availably important to digest protein and carbohydrate which contained in coconut cream as its substrate. The strain L. bulgaricus was furthermore selected to be employed as potential starter for extracting VCO, while the other strains, S. cerevisiae, C. rugosa and A. oryzae, respectively. A. oryzae had not been

B I O D I V E R S I T A S Vol. 10, No. 3, July 2009, pp. 151-157

154

employed as starter since their proteolytic and amylolytic activities given are lower than L. bulgaricus (Table 1). Table 1. Proteolytic and amylolytic activities of the selected strains. Diameter of clear zone (cm) LB K-1A SC CR Proteolytic 2.0 1.6 1.3 1.6 Amylolytic 2.1 1.4 1.4 1.5 Note: LB: Lactobacillus bulgaricus; K-1A: Aspergillus oryzae; SC: Saccharomyces cerevisiae; CR: Candida rugosa. Activity/Strain

Fermentation system The fermentation of coconut cream occurred when the enzymatic starter had been employed for processing. Crude coconut oil was formed due to a phenomenon of protein digestion that plays a role to stabilize emulsion of the coconut cream into a soluble material. The enzymatic starter with high capacity of amylolytic and proteolytic could hydrolyze carbohydrate and protein which contained in the coconut the cream as its substrate into soluble sugar and amino acid and peptide (Soeka et al., 2008). The extraction process of coconut oil via fermentation or enzymatic system involved microbial cell and enzymes those could solve the emulsion; however, their activities were influenced by some conditions of substrate, enzyme, pH, temperature, and incubation period (Pelczar and Chan 1986). Preliminary step on extraction process of VCO was initiated after separating the coconut cream which higher in lipid content from coconut skims which higher in carbohydrate and protein content as shown on Figure 1.A. After addition with starter followed by overnight fermentation of the coconut cream at room temperature, the starter containing enzymes were stimulated to digest starch and ferment it into alcohol and organic acids that

coagulate protein in consequence of phases formation of oil on upper part, protein in the middle and water layer on lower part (Rindengan and Novarianto, 2004). Due to a lower molecular weight, the oil part formed through the process could be directly separated from protein and water part by draining off both of them through a valve (Figure 1.B). To reduce interference of water content or insoluble materials into the oil part, a further process of obtaining oil by refining through filter paper or vacuum filter and rinse with hot water following by vacuum evaporation was required to avoid chemically processing to achieve the virgin state of oil as shown on Figure 1.C. Fermented coconut oil has been known well as virgin coconut oil (VCO) since high temperatures, chemicals or other physical treatment are not used in its processing. As it had been naturally and traditionally processed through enzymatic fermentation, unhydrogenated, undeodorized, and unbleached, the component of fatty acids, especially lauric acid of this coconut oil is not change since it is least vulnerable of all the dietary oils to oxidation and free-radical formation, and it is therefore the safest to use in cooking. It does not become polymerized and form by-products as do other oils when heated to normal cooking temperatures (Kaunitz and Dayrit, 1992; Rindengan and Novarianto, 2004; Sulistyo, 2004). Structurally, coconut oil is very rare amongst all the other dietary lipids. As a different class of saturated fat that behaves very differently in the body from each other, since it is composed almost entirely of medium chain fatty acids (MCFA), a powerful antimicrobial, where mother's milk is very high in them. Coconut oil is composed of an incredible 64% MCFA. The body metabolizes MCFA and absorbed directly from the intestine into the portal vein, and sent straight on to the liver, where they are burned for

Figure 1. A. Coconut milk separation, B. Fermentation process, C. Purified coconut oil.

HANDAYANI et al. â&#x20AC;&#x201C; Extraction of virgin coconit oil

155

fuel, almost like a carbohydrate. Rather than produce fat, they are used to produce immediate energy. And, the body uses much less energy to digest MCFA. They are easily digested by saliva and stomach enzymes and do not require pancreatic enzymes. This relieves stress on both the pancreas and the digestive system. For this reason, MCFA are essential in baby formulas, and are routinely used in hospitals for patients with digestive, metabolic and malabsorption problems. Also, the MCFA in VCO are used to improve insulin secretion and the utilization of glucose, and therefore greatly helps relieve the symptoms and reduce the health risks of diabetes (Enig, 1996).

the concentration of substrate achieves optimal condition since the enzyme is saturated by the substrate binding enzyme complexes.

Screening on microbial strains Influence of employing pH (Figure 2), temperature (Figure 3) and starter concentration (Fig 4) on the yield of extracting coconut oil exhibited that the strain of L. bulgaricus could effectively extract the oil higher than the tested microbial strains when the starter was employed to incubate the coconut cream under the Âş fermentation condition at pH 5.0, 45 C and 5% starter concentration. Figure 2 showed the influence of incubation pH on the yield of extracting oil. It was found that the highest yield of oil (27.0%) could be obtained after incubating the starter at pH 5.0. It is probably that the strain of L. bulgaricus which employed as the starter is a facultative aerobic strain that had optimal proteolytic capability at pH 5.0. This pH value is affected on occurring toward substrate binding enzyme since the + concentration of H potentially affected a linkage between active site of enzyme and its substrate which led to conform the active site into optimal condition for binding the substrate based on the principal of Lock and Key. Figure 3 showed the influence of incubation temperature on the yield of extracting oil. It was found that the highest yield of oil (27.2%) could be obtained o after incubating the starter at 45 C. It is probably that the strain of L. bulgaricus behaves at optimal o condition between 40-45 C. The binding of enzyme to its substrate and rising temperature up to a certain degree had increased kinetic energy and promoted movements of reacted molecules. It was therefore increasing bumping occurrence between enzyme and its substrate optimally. The enzyme exhibited its activity at certain optimal condition of temperature, and therefore when the temperature is over than its optimal condition, the enzyme would certainly be denaturated. Figure 4 showed the influence of starter concentration on the yield of extracting oil. It was found that the highest yield of oil (26.8%) could be obtained after incubating the starter at 5.0% (v/v). At low concentration rate of reaction was too low, however, the rate would be higher as increasing of substrate concentration which catalyzed by the enzyme. Increasing of enzyme is not effective when

Figure 2. Effect of pH of starter on yield of extracting oil.

Yield of Oil (%)

30 25 20 15 10 5 0 LB 3

K-1A 4

5 SC

Yield of Oil (%)

pH of Starter

30 20 10 0 25

30 LB CR

35 K-1A SC

45 0

Incubation Temperature ( C)

Yield of Oil (%)

Figure 3. Effect of temperature on yield of extracting oil.

30 20 10 0 LB

1K-1A

CR 3

Starter Concentration (%)

Figure 4. Effect of starter concentration on yield of extracting oil.

Moreover the starter capability of L. bulgaricus in extracting of VCO was investigated furthermore in the comparison to other strains contained in soy-sauce starter mold (A. oryzae), bake yeast (Saccharomyces sp), tempeh starter (R. oligosporus), and alcoholic beverage yeast (C. utilis). To produce kinds of VCO products, the coconut milk was prepared by different strain of coconut cultivars such as kelapa dalam of Cianjur Regency, genjah salak and genjah kuning of Bogor Regency. The yield of oil derived from each types of coconut were then purified by filtration and absorption using absorbent of activated charcoal as shown on Table 2. The Table showed that the highest yield of oil was obtained by using coconut cream of kelapa dalam

156

B I O D I V E R S I T A S Vol. 10, No. 3, July 2009, pp. 151-157

Table 2. Yield (mL) of VCO derived from different type of coconut. Coconut VCO Kecap Tempeh Beverage Bake Cultivars starter starter starter yeast yeast Kelapa dalam 25.5 28.0 21.0 Genjah salak 21.5 23.0 18.0 Genjah 15.5 17.0 15.0 kuning Note: (-) none oil formed after processing.

(24.83 mL) while using genjah salak and genjah kuning gave lower yield of oil was 20.83 mL and 15.83 mL, respectively. It was apparent that initial composition of coconut cream significantly influence on final yield of extraction oil. The coconut cream of kelapa dalam exhibited calories (359 cal) and lipid by means of oil content (34.7%) higher than both of the genjah types of coconut cultivar those were 180 cal and 13.0% on the average (Palungkun, 1993). It was found that the oil layer was formed on the coconut cream was incubated by the starter of L. bulgaricus, A. oryzae of soy-sauce and R. oligosporus of tempeh inoculum, while there was none of oil layer found on the coconut cream was incubated by Saccharomyces sp. of bake and C. utilis of beverage starters. Apparently, the enzyme of these kinds of starters had been inactivated or not appropriated as the starter for enzymatic fermentation process of coconut oil, and resulted in none oil formation since the coconut cream as the substrate was not agreed with the enzymes contained in such starters. Fatty acid analysis of VCO To determine fatty acid composition of the virgin coconut oil (VCO) obtained by the enzymatic fermentation, sample of the oil was then analyzed by using GC. It was found that the highest yield of lauric acid of oil (42.95%) was obtained by employing the starter of L. bulgaricus into coconut cream derived from kelapa dalam strain as shown on Table 3. Table 3. Analysis of lauric acid of extracting VCO. Fatty Acid Lauric acid

Lauric acid concentration (%) VCO-LIPI AOâ&#x20AC;&#x201C;D LB-D AO-GS LB-GS 46.82 41.46 42.95 40.68 35.08

Table 3 showed that the VCO obtained by employing the starter of L. bulgaricus into coconut cream of kelapa dalam (LB-D) yielded higher lauric acid content (42.95%) rather than by employing the starter of A. oryzae with strain of kelapa dalam (AOD, 41.46%) and the starter A. oryzae with the strain of genjah salak (AO-GS, 40.68%) or the starter of L. bulgaricus with the strain of genjah salak (LB-GS, 35.08%). It was found somehow; the yield of obtaining oil still lower yet rather than the oil had been obtained by using the starter of VCO-LIPI as the standard of comparison of previous experiment

(Soeka et al., 2008). Quantitative analysis of VCO To determine the content of FFA, moisture content, peroxide value, the extracting VCO obtained by using of the starter of L. bulgaricus was then analyzed and showed as Table 4. Table 4. Analysis of VCO according to SII. 0150-72 for edible oil. Component of Analysis Moisture content Acid value Free fatty acid Peroxide value

Reference Value of SII

Concentration (%)

Max 0.5 % Max 0.5 % Max 2.5 % Max 3.0 %

0.30 0.45 0.22 2.54

Table 4 showed that characteristic of obtaining VCO for edible oil referred to the moisture content, acid value FFA and peroxide values was agreed with a range of value in accordance to the Standard International of Indonesia (SII) 0150-72 for edible oil. It was suggested that our VCO which was extracted through enzymatic fermentation process by employing the starter of L. bulgaricus was appropriated to be consumed as safety and healthy edible oil. The quality of the obtaining oil was corresponded to requirement for quality standard of good edible oil. One of spoiled edible oil indicator is high in acid and peroxide values, since their existences in the product indicate an alteration caused by oxidation on chemical content is being occurred and resulted frequently in a problem of rancid. Assay of antibacterial activity The antimicrobial properties lauric acid and its derivative monolaurin from coconut oil have shown promise in this study. Lauric acid, which is present in high concentration in coconut oil, forms monolaurin in the animal body and this derivative of lauric acid can inhibit the growth of pathogenic microorganisms (Kabara, 1984). The research focused on Pseudomonas fluorescence, Bacillus substilis, Salmonella and Escherichia coli. To determine potential of lauric acid contained in this extracting oil obtained through enzymatic fermentation, this oil was then studied furthermore against microbial growth. Its antimicrobial activity was observed by the existence of clear zone formed surrounding paper-disc that had pre-submerged into this oil on the media grown with colonies of tested microbial strains. It was found that the clear zone surrounding the paper disc on the media fully grown with strain of Salmonella, indicated that this oil had activity against the growth of tested strain as shown on Figure 5. It is now clear and scientifically validated that the inclusion of coconut oil in the diet could and should be utilized for its preventive and healing properties.

HANDAYANI et al. – Extraction of virgin coconit oil

157

REFFERENCES

Figure 5. Assay of antibacterial activity of VCO. (1), VCOLB; (2), VCO-CR; (3), Copra oil; (4), Palm oil; (5), traditional coconut oil.

CONCLUSION The strain of Lactobacillus bulgaricus could effectively extract the virgin coconut oil higher than the other tested microbial strains when it was employed into the coconut cream under the º enzymatic fermentation condition at pH 5.0, 45 C and 5% starter concentration. The highest yield of oil was obtained by using coconut cream derived from coconut strain of kelapa dalam while using genjah salak and genjah kuning gave only lower yield. It was found that the highest lauric acid (42.95%) was obtained by employing the starter of L. bulgaricus into coconut cream of kelapa dalam strain. Characteristic of obtaining VCO as edible oil that had been referred to the moisture content, FFA, acid and peroxide values was in a good agreement in accordance to the Standard International of Indonesia (SII) 0150-72. To determine potential of lauric acid contained in this oil, the study was focused on some microbial strains and It was found that there were clear zone surrounding the paper disc after submerging into this oil, onto agar media grown with strain of Salmonella, indicating that this oil exhibited activity against the growth of the tested microbial strain.

Carson, C.F., and T.V. Riley. 1995. Antimicrobial activity of the major components of the essential oil of Melaleuca alternifolia. Journal Applied Bacteriology 78 (3): 264-269. Cappuccino, J.G. and N. Sherman. 1983. Microbiology a Laboratory Manual. New York: Addison-Wesley Publishing Company. Enig, M.G. 1996. Health and nutritional benefits from coconut oil: an important functional food for the 21st century. AVOC Lauric Oils Symposium, Ho Chi Min City, Vietnam, 25 April 1996. Issacs, C.E. 1986. Membrane-disruptive effect of human milk: inactivation of enveloped viruses. Journal of Infectious Diseases 154: 966-971. Kabara, J.J. 1984. Medium-chain Fatty Acids and Esters as antimicrobial agents. In: Kabara, J.J. (ed.). Cosmetic and Drug Presentation: Principles and Practice. New York: Marcel Dekker, Inc. Kaunitz, H., C.S. Dayrit. 1992. Coconut oil consumption and coronary heart disease. The Philippine Journal of Internal Medicine 30:165-171. Ketaren S. 1986. Minyak dan Lemak Pangan. Jakarta: UI Press. Mestecky, J., F.W. Kraus, D.C. Hurst, and S.A. Voight. 2004. A simple quantitative method for α-amylase determinations. Analytical Biochemistry 30 (2): 190-198. Palungkun, R. 1993. Aneka Produk Olahan Kelapa. Jakarta: Penebar Swadaya. Pelczar, M.J. dan E.C.S. Chan. 1986. Dasar-dasar Mikrobiologi. Jakarta: UI Press. Prior, I.A., F. Davidson, C.E. Salmond, and Z. Czochanska. 1981. Cholesterol, coconuts, and diet on Polynesian atolls: a natural experiment: the Pukapuka and Tokelau Island studies. American Journal of Clinical Nutrition 34: 1552-1561. Rahayu, R.D., J. Sulistyo, and A. Dinoto. 2008. Enzymatic properties of microbial solid starters on coconut oil recovery. Proceeding of the International Seminar on Chemistry. 679686. Rietschel, E.T., H. Gottert, O. Luderitz, and O. Westphal. 1972. Nature and linkages of the fatty acids presents in the lipid A component of Salmonella lipopolysaccharides. European Journal of Biochemistry 28: 166-173. Rindengan, B. dan H. Novarianto. 2004. Minyak Kelapa Murni: Pembuatan dan Pemanfaatan. Edisi ke-1. Jakarta: Penebar Swadaya. Rosenthal, A., D.L. Pyle, and K. Niranjan. 1996. Aqueous and enzymatic processes for edible oil extractin. Journal of Enzymology Microbial Technology 19: 402-420. Sulistyo, J., Y.S. Soeka, E. Triana, dan R.N.R. Napitulu. 1999. Penerapan teknologi fermentasi pada bioproses fermentasi minyak kelapa (fermikel). Berita Biologi 4 (5): 273-279. Sulistyo, J. 2004. Pemasyarakatan, Penerapan, dan Pengembangan TTG. Lokakarya TTG-Badan Pemberdayaan Masyarakat dan Penanggulangan Sosial Pemerintah Kota Bogor. Bogor, 4 November 2004. Soeka, Y.S., J. Sulistyo, dan E. Naiola. 2008. Analisis biokimia minyak kelapa hasil ekstraksi secara fermentasi. Biodiversitas 9 (2): 91-95. Suminar, S., Purwatiningsih, D. Tohir, dan M. Farid. 2001. Kimia Organik II. Bogor: Jurusan Kimia, Fakultas Matematika dan Ilmu Pengetahuan Alam, Institut Pertanian Bogor.

BIODIVERSITAS Volume 10, Number 3, July 2009 Pages: 158-162

ISSN: 1412-033X (printed edition) ISSN: 2085-4722 (electronic) DOI: 10.13057/biodiv/d100310

Potency of Lobak Leaves (Raphanus sativus L. var. hortensis Back) as Anticancer and Antimicrobial Candidates ♥

RITA RAKHMAWATI , ENDANG ANGGARWULAN, ESTU RETNANINGTYAS Biology Department, Faculty of Mathematics and Natural Sciences, Sebelas Maret University (UNS), Surakarta 57126. Received: 11th November 2008. Accepted: 18th December 2008.

ABSTRACT One of vegetables can preventive cancer and have been used traditionally to cure infection, such as lobak (Raphanus sativus L.). Ineffectiveness antibiotics against microbial infections were still problem until now. Types of antibiotics and anticancer agents from natural resources should be explored and developed. This study was aimed to know toxicity effect and antimicrobial activity of active fractions from lobak leaves. Toxicity study was conducted using Brine Shrimp Lethality Test (BST). Samples were prepared at the concentration of 100, 500, and 1000μg/mL. Antibacterial study against Staphylococcus aureus was conducted using agar-well diffusion method at concentration 30, 40, 50, 60, 70, 80, 100%. Ethyl acetate fraction from methanol extract is the most active that had larger clear zone in S. aureus culture (10,64 mm) and insoluble ethyl acetate fraction from methanol extract is the most active against A. salina (84% death A. salina at 100 µg/mL). Bioactive compounds at active fraction were identified to contain polar compounds. © 2009 Biodiversitas, Journal of Biological Diversity Key words: Raphanus sativus L., BST, Staphylococcus aureus, active fraction.

INTRODUCTION Based on epidemiological evidences, consumption of vegetables, belonging to the Brassicaceae family, has been associated with a decreased incidence of various cancers (Duthie et al., 2000; O’Hare al., 2006). On the basis of this information, researchers recently have estimated that vegetable consumption prevent 20% to 50% of all cases of cancer (Nestle, 1997). Lobak (Raphanus sativus L.) is not only vegetables but in many countries, lobak is used in traditional medicines (Shoeb, 2006). There were three species of lobak variety in Java, var. hortensis Back., var. niger Willd. and var. radicula Pers. Lobak var. hortensis have white sprouts and long cylinder. Lobak var. niger have black sprouts, meanwhile var. radicula with red skins or pure white throughout (Backer and Bakhuizen v.d. Brink, 1968). In this study, we focus on lobak var. hortensis. Lobak is reported as good remedy used for treatment of anti tumor, anti infection, chemoprevention for breast cancer, and immunomodulator (Wijayakusuma, 2005). Lobak has been traditionally used for medicinal purposed, therefore further research is needed. The current study was carried out to determine the toxicity of  Alamat korespondensi: Jl. Ir. Sutami 36A Surakarta 57126 Tel. & Fax.: +62-271-663375 e-mail: oktia@yahoo.com

lobak against A. salina, and the antimicrobial activity of lobak leaves against S. aureus.

MATERIALS AND METHODS Material Lobak leaves (Raphanus sativus L.) were collected from Tawangmangu in August 2008. Chemicals such as silica gel GF254, ethanol, nhexane, methanol, chloroform, and ethyl acetate were purchased from Merck (Darmstadt, Germany), aquadest, sea water, Artemia salina egg, yeast (Fermipan®), cerium (IV) sulfate, Staphylococcus aureus (Rosenbach) colony, Nutrient Agar (NA) and Muller Hinton (MH), amoxicillin, rotary evaporator (Heidolph vv 2000, Germany), micropipette, lamp 5 watt, aerator, micro syringe, oven, spray, laminar air flow and UV detector. Extraction Extraction was carried out by simple maceration process. The powdered leaves (600 g) were initially macerated with 1700 mL chloroform (24 hours x 3) at room temperature. Macerate were filtered and distilled in rotary evaporator and concentrated to obtain the crude chloroform extract. Residue were remacerated (24 hours x 3) with methanol (1700 mL) for 24 hours, then filtered. Procedure was done as above mentioned and the crude methanol extract obtained. Sample was prepared by dissolving 50 mg

RAKHMAWATI et al. – Raphanus sativus leaves as anticancer and anti microbes

of each sample in 5 mL of chloroform: methanol (1:1) v/v and obtained stock solution 10 µg/mL. The extract of chloroform and methanol were examined their toxicity and antimicrobial activity against S. aureus. The most active extract was partitioned with ethyl acetate and obtained fraction to form insoluble and soluble ethyl acetate fraction. Both of them were further examined with reduced concentration. Larvae A. salina hatching Artemia salina eggs were hatched in a container filled with aerated sea water and illuminated with 5 watt light source. The container was compartmentalized into dark compartment and lightened one with several holes. After 24 hours, brine shrimp larvae were collected by pipette from the lightened side through the holes; then 48 hours of A. salina larvae were ready for toxicity test. Assay for antibacterial activity S. aureus with agarwell diffusion method All the stock cultures were obtained from Faculty of Medicine, Sebelas Maret University, Surakarta, Central Java. Stock cultures were regenerated on o nutrient agar (NA) slants and incubated at 37 C for 24 hours for bacterial proliferation. Muller Hilton Medium o was sterilized at 121 C for 15 minutes, then cool o down until 50 C. After that MH medium were inoculated with cultures (1-2 ose) and homogenized. Active cultures used for experiments were prepared by transferring a loopful of culture to 10 mL of nutrient agar in petri dish. The medium seeded with test organism were punctured with sterile cork borer to make wells. Methanol extract and chloroform extract at 60, 70, 80,100%; insoluble and soluble ethyl acetate fraction at 30, 40, 50% were transferred to each well under aseptic condition and incubated for 24 hours. The antimicrobial activity was detected as clear zone of inhibition around wells and it was measured in millimeter (mm). Each experiment was replicated three times. Amoxicillin was used as control. Brine Shrimp Lethality Test (BST) From this stock solution, 1000, 500 and 100 μg/mL was transferred to 5 vials and 5 vials were kept as control having chloroform: methanol (1:1) v/v. Brine shrimp (A. salina larvae) eggs were hatched in a shallow rectangular plastic dish, filled with sea water. An unequal partition was made in the plastic dish with the help of a perforated device. Eggs were sprinkled into larger compartment, which was placed under the dark condition while the smaller compartment was opened to ordinary light. After two days naupils were collected. A sample of the test extract and fraction were prepared and transferred to vials. Some vials were kept as control having solvent only. The solvent was allowed to evaporate overnight. When shrimp Larvae were ready, 1 mL of sea water was added to each vial along with 10 shrimps and the volume was

159

adjusted with sea water to 5 mL per vial and give yeast 1 pipettes. After 24 hours the number of surviving shrimps was counted. Each experiment was replicated thrice. Thin Layer Chromatography (TLC) Extract and fraction obtained then speckled on plate TLC silica gel GF254 and developed with appropriate mobile phase. Detection with UV254, UV366, and cerium (IV) sulphate was conducted to monitoring bioactive compounds.

RESULTS AND DISCUSSION Extraction and activity test with BST The fresh lobak leaves were dried under sunlight and covered with black cloth. This was carried out to protect compounds from oxidation or enzymatic reactions such as decomposition, change on the pH stimulate hydrolysis of iridoid and glycoside flavonoid compounds (Cannell, 1998). Drying process stopped when the leaves can be easily broken. There was effort to maintain the water level in raw material to 510%. It was expected at that water level, most fungi can not grow. The raw material then powdered to easily assist the penetration of solvent onto cellular structure of plant, in other to help secondary metabolite dissolution and broaden extraction field (Cannell, 1998). Bioassay guided extraction using BST was aimed to determine the activity of chloroform and methanol extract. BST was simple, fast, reliable, inexpensive, reproducible and can be used to gain depiction of toxicity from one compound or substance (Carballo et al, 2002) by counting the total death of A. salina (Meyer et al., 1982). Brine shrimp bioassay results (Table 1) clearly indicated that methanol extract has more toxic effect than chloroform extract. Table 1. Results of BST using chloroform extract and methanol extract of lobak leaves.

Sample Methanol extract

Chloroform extract

Control

Concentration (g/mL) 1000 500 100 1000 500 100

Replication (% death) 1 2 3 80 84 80 64 70 64 10 0 34 6 28 14 10 26 8 12 20 4 0 8 6

According to Lee et al. (2006), the activity of a methanol extract of radish (R. sativus) sprouts for the induction of nicotinamide adenine dinucleotide (phosphate) NAD(P)H/quinone reductase (QR), which plays critical roles in protection against chemical carcinogens and other toxic xenobiotics, was

B I O D I V E R S I T A S Vol. 10, No. 3, July 2009, pp. 158-162

160

examined in murine Hepa1c1c7 cells. Active substance indole-3 carbinole in lobak can be use as anti tumor, preventing carcinogenesis against cell line estrogen responsive, serves as immunomodulator and increase TNF (tumor necrosis factor) (Irma and Gilang, 2005). The methanol extract was found to be the most active extract, and then partitioned using liquid-solid partition with ethyl acetate, and result in two fractions. The two fractions obtained were then tested with BST. TLC was conducted on every stages of partition process to monitor the content of compounds and to ensure that there is no overlapping compound between the two extracts or fractions. The result shows that insoluble ethyl acetate fraction caused a higher percent death than soluble ethyl acetate fraction (Table 2.).

(84% death) was higher than that of the other fractions, so this fraction could be potential as anticancer candidate. The antioxidant properties of radish (Raphanus sativus L.) sprouts (Kaiware Daikon) extract, in which the glucosinolate glucoraphasatin (GRH), showing some antioxidant activity, is present at 10.5% w/w. (Barillari et al., 2006; Salah-Abbès, et al., 2007; Yee et al., 2007). Sulforaphan (SFN) from Brassicaceae family especially broccoli (Brassica oleacea italica), was reported could induce apoptosis in cancer cell. SFN has been identified as potent inducers of phase 2 enzymes in human (Alessio, 2008). Duthie et al. (2000) reported that free radicals cause damage to the DNA and other molecules. Over time, such damage may become irreversible and lead to disease including cancer. Antioxidants have been used as important protective agents for human health (Poon et al., 2004). Because antioxidants can neutralize free radicals as the natural by-product of normal cell processes, daily consumption antioxidant was suggested to prevent cancer.

Table 2. Results of BST from soluble ethyl acetate fraction and insoluble ethyl acetate fraction of lobak leaves.

Concentration (g/mL)

Percent death (%) Soluble ethyl Insoluble ethyl acetate acetate fraction fraction

100

Antimicrobial bioassay Staphylococcus aureus local strain was used to test antibacterial activity. Cultures for experiments were regenerated into Nutrient agar (NA) slants and o incubated at 37 C for 24 hours for bacterial proliferation. Mueller Hinton (MH) was used to test antibacterial activity because it has complete nutrition. Agar-well bioassay was employed for testing antibacterial activity of lobak leaves. The medium seeded with test organism were punctured with sterile cork borer to make wells (6 mm diameter) (Ali et al., 2006). Each extracts were made to a final concentration of 60, 70, 80, and 100%. Antimicrobial activity of chloroform and methanol extract lobak leaves as shown in Table 3.

According to Meyer et al., (1982) several naturally extracted products which had LC50 < 1000 µg/mL using brine shrimp bioassay were known to contain physiologically active principles. Although toxicity test using BST does not give a clear depiction on cytotoxicity against cancer cell, however this method has been reported useful for screening anticancer test. Seventy plants collected from Central Kalimantan shown that 17 plants were potential as bioactive compound resources (Wahyuningsih et al., 2008). This result showed that the toxicity activity of the insoluble ethyl acetate fraction of lobak leaves

Figure 1. Result of zone of inhibition of soluble ethyl acetate fraction against S. aureus at (A) 30 %, (B) 40%, (C) 50%.

RAKHMAWATI et al. â&#x20AC;&#x201C; Raphanus sativus leaves as anticancer and anti microbes

Table 3. Antimicrobial activity of chloroform and methanol extract lobak leaves. Sample Chloroform extract Methanol extract DMSO control CMC control

0,1% 0

Zone of inhibition (mm) 60% 70% 80% 100% 0 0 0 0 7,78 7,29 9,86 12,68 0 -

Methanol extract shown to be more toxic than chloroform extract. The polarity from methanol extract showed by growth inhibition against positive-gram bacteria (Hartini, 2006). Table 3 shows increase zone of inhibition by methanol extract from various concentration. Antibacterial compound in lobak leaves tend to be polar. This can be shown from Table 3 that the inhibitory activity (measured by zone of inhibition) of chloroform extract was not pronounced against S. aureus. Saponin, flavonoid and polyphenol in lobak leaves and sprouts are potential as antimicrobial. Methanol extract of lobak sprouts contain isothiocyanate compound which can inhibit bacterial activity in mouth (Ervina et al., 2007). Several researchers have reported that methanol extracts have potential activity against bacteria. Methanol extract of Tectona grandis, Asphaltum punjabianum, and Valeriana wallichii have been reported inhibit Alternaria cajani, Curvularia lunata, Fusarium sp., Bipolaris sp. and Helminthosporium sp. in various concentration (1000, 2000, 3000, 4000, 5000 Îźg/mL) (Shalini and Srivastava, 2008). The methanol extract of Piper ribesioides root was effective on S. aureus. The minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) values of the methanol extract of P. ribesioides were 3.125 mg/mL and 6.250 mg/mL, respectively (Zakaria et al., 2007). Methanol extract of Cassia nigricans Vahl. is also reported potential as antimicrobial candidate (Ayo and Amupitan, 2004). Furthermore, methanol extract was partitioned with ethyl acetate to yield 2 fractions, soluble and insoluble ethyl acetate fraction. Soluble ethyl acetate has more polar compounds. On the other hand, insoluble ethyl acetate has semi polar compounds. Each extracts were made to a final concentration of 30, 40 and 50% (Figure 1 and Table 4). Table 4. Antimicrobial activity (Zone of inhibition) of soluble and non-soluble ethyl acetate lobak leaves methanol extract. Sample Insoluble ethyl acetate Soluble ethyl acetate CMC control Ethyl acetate control

Zone of inhibition (mm) 30 % 40% 50% 0 0 0 5,21 7,58 10,64 0 0

161

The current work has shown that soluble ethyl acetate is a potential source of antimicrobial agents and it is active against S. aureus (gram-positive bacteria). We assumed that this due to the existence of polar compounds in soluble ethyl acetate fraction. Based on the cell wall structure; gram-negative bacteria have an outer cell wall that is rich in lipopolysaccharides, preventing the polar compounds from penetrating the membrane causing cell lyses, whereas gram-positive bacteria do not have lipopolysaccharides that decorate the membrane, therefore the compound can easily destroy the protein porins and cause cell lyses (Jawetz et al., 2005; More, 2007). This finding demonstrated that the higher concentration of sample, result in larger zone of inhibition due to higher amount of bioactive compound to be applied. Amoxicillin is a member of the penicillin antibiotic group, used as positive control, which is effective against gram-positive bacteria. Amoxicillin inhibits transpeptidase, preventing cross-linking of bacterial cell wall and leading to cell death. Amoxicillin is sufficiently lipophilic to cross through the membranes of gram positive bacteria. The presence of the polar side chain on the 6 position also confers amoxicillin suitable for entrance into gram negative bacteria through their polar porins (Siswandono and Soekardjo, 2000). This result showed that zone of inhibition amoxicillin is 26.7 mm. This research is opened up the potential use of lobak leaves as anticancer and antimicrobial agents which to our knowledge, is the first report. Bioactive compounds at both of fractions were identified to contain polar compounds. In our study, lobak leaves are not only vegetables, but it san be exploited as used medicinal plant so it can be considered as nutraceuticals which have a nutritional role in the diet and phytochemical constituents of this plant have long term health promoting due to long term use in the daily diet.

CONCLUSION Insoluble ethyl acetate fraction from methanol extract was the most active (100 Âľg/mL, 84% death) against A. salina. On the other hand, the soluble ethyl acetate fraction from methanol extract exhibited strong inhibitory activity against S. aureus (10.64 mm).

ACKNOWLEDGMENT The authors thank to Yustin Nur Khoiriyah, Tahan Ristiningsih, and Jenny Virganita for assistance this research. This research was supported by PHK A-2 Biology Department, Faculty of Mathematics and Natural Sciences, Sebelas Maret University, Surakarta, fiscal year 2008.

162

B I O D I V E R S I T A S Vol. 10, No. 3, July 2009, pp. 158-162

REFERENCES Alessio, P., O. Marina, B. Giovanna, B. Jessica, R. Iori, M. Paolini, F. Ferroni, F.M. Grazia, G.F. Pedulli, and L. Valgimigli. 2008, Cytotoxic and antioxidant activity of 4-methylthio-3-butenyl isothiocyanate from Raphanus sativus L. (kaiware daikon) sprouts. Journal of Agricultural and Food Chemistry 56 (3): 875-883. Ali, A., H. Yusminah, dan Darminto. 2006. Penapisan dan karakterisasi parsial senyawa antimikroba dari siput bakau dan profil kromatografi lapis tipis fraksi aktif. Hayati 12: 63-68. Ayo, R.G. and J.O. Amupitan. 2004. Antimicrobial activity screening of crude extract from leaves of Cassia nigricans Vahl. ChemClass Journal 1: 24-26. Backer, C.A. and Bakhuizen v.d. Brink, Jr. 1968. Flora of Java. Volume 1. Groningen: N.V. Noordhof. Barillari, J., R. Cervellati, S. Costa, M.C. Guerra, E. Speroni, A. Utan, and R. Loril. 2006. Antioxidant and choleretic properties of Raphanus sativus L. Sprout (kaiware daikon) extract. Journal Agriculture and Food Chemistry 54 (26): 9773-9778. Cannel, R.J.P. 1998. Natural Products Isolation. New Jersey: Humana Press. Carballo, J.L., Z.L.H. Inda, P. Perez, and M.D. Gracia-Gravalos. 2002. A comparison between two brine shrimp assays to detect in vitro cytotoxicity in marine natural products. BMC Biotechnology 2 (17): 1-5. Duthie, G.G, S.J. Duthie, and J.A.M. Kyle. 2000. Plant polyphenol in cancer and heart disease; implications as nutritional antioxidant. Nutrition Research Rreview 13: 79-106. Ervina, M., I.S. Soediro, and S. Kusmardiyani. 2007. Telaah Fitokimia Akar Lobak (Raphanus sativus L. var. hortensis Back.) sebagai Penangkap Radikal Bebas. [Thesis]. Bandung: Sekolah Farmasi ITB. Hartini, Y.S., Soegihardjo, Maria, dan K. Kurniawan. 2006. Daya antibakteri campuran ekstrak etanol buah adas (Foeniculum vulgare Mill) dan Kulit Pulosari (Alyxia reinwardtii Bl.). [Laporan Penelitian]. Yogyakarta: Fakultas Farmasi UGM. Irma dan Gilang. 2005. Tanaman Obat Untuk Penderita Kanker. www.pdpersi. co.id. Jawetz. E., J.L. Melnick, and E.A. Adelberg. 2005. Microbiology untuk Profesi Kesehatan. Penerjemah: Huriati dan Hartanto. Jakarta: Penerbit Buku Kedokteran EGC. Lee, S.O. and I.S. Lee. 2006. Induction of Quinone Reductase, The Phase 2 anticarcinogenic marker enzyme, in Hepa1c1c7 cells by radish sprouts, Raphanus sativus L. Journal of Food Science 71 (2): 144-148. Meyer, B.N., N.R. Ferrigni, J.E. Putnam, L.B. Jacobsen, D.E. Nichols, and J.L. McLaughlin. 1982. Brine shrimp: a convenient

general bioassay for active plant constituents. Planta Medica 45 : 31-34. More, F.N. 2007. Antimicrobial properties of Conifer Essential Oils, CUEF Report, Department of Biological Science, Thompsons Rivers University Nestle, M. 1997. Broccoli sprouts as inducers of carcinogendetoxifying enzyme systems: clinical, dietary, and policy implications. Proceeding of the National Academic Science of the USA 21: 11149-11151 O’Hare, T., L. Force, L. Wong and D. Irving. 2006. Anti-cancer Potential of Asian Brassicas Glucosinolates & Chemoprevention. Kingston: Rural Industries Research and Development Corporation Publication. Poon, H.F., V. Calabrese, and D.A. Butterfield. 2004. Free radicals and brain aging. Clinical Geriatri Medical 20: 329-359. Salah-Abbès, J.B., S. Abbès, Z. Ouanes, Z. Houas, M.A. AbdelWahhab, H. Bacha, and R.Oueslati. 2007. Tunisian radish extract (Raphanus sativus) enhances the antioxidant status and protects against oxidative stress induced by zearalenone in Balb/c mice. Journal of Applied Toxicology 28 (1): 6 -14 Shalini and R. Srivastava. 2008. Antifungal activity screening and HPLC analysis of crude extract from Tectona grandis, shilajit, Valeriana wallichii. The Internet Journal of Alternative Medicine 5 (2). http://www.ispub.com/journal/the_internet_journal_of_alternativ e_medicine/volume_5_number_2_3/article/antifungal_activity_s creening_and_hplc_analysis_of_crude_extract_from_tectona_g randis_shilajit_valeriana_wallachi.html. Shoeb, M. 2006. Anticancer agents from medicinal plants. Bangladesh Journal Pharmacology 1: 35-41. Siswandono dan B. Soekardjo. 2000. Kimia Medisinal. Surabaya: Airlangga University Press Wahyuningsih, M.S.H., S.Wahyuono, Dj. Santosa, J. Setiadi, Soekotjo, S.M. Widiastuti, R. Rakhmawati, and D.S.C.Wahyuni. 2008. Eksplorasi tumbuhan dari hutan kalimantan tengah sebagai sumber senyawa bioaktif. Biodiversitas 9: 169-172. Weng, J., C. Tsai, S.K. Kulp., C. Chen. 2008. Indole-3-carbinol as a chemo-preventive and anti-cancer agent, Cancer Letters 262 (2): 153-163. Wijayakusuma, H. 2000. Ensiklopedia Milenium: Tumbuhan Berkhasiat Obat Indonesia. Jakarta: Prestasi Insan Indonesia Yee, L.W., E.H.K. Ikram, A.M.M. Jalil, and A. Ismail. 2007. Antioxidant capacity and phenolic content of selected commercially available cruciferous vegetables. Malaysian Journal of Nutrition 13 (1): 71-80. Zakaria, Z., S. Sreenivasan, and M. Mohamad. 2007. Antimicrobial activity of Piper ribesioides root extract against Staphylococcus aureus. Journal of Applied Biological Sciences 1 (3): 87-90.

GUIDANCE FOR AUTHORS B I O D I V E R S I T A S , the J o u r n a l o f B i o l o g i c a l D i v e r s i t y publishes scientific articles, i.e. original research and review in all biodiversity aspects of plants, animals and microbes at the level of gene, species, and ecosystem; especially in (i) molecular biology and genetics, (ii) taxonomy, biosystematic, and phylogenetics, (iii) ecology and conservation biology (wildlife), as well as (iv) ethnobiology. Manuscripts will be reviewed by managing editor and invited peer review according to their disciplines. The only articles written in English are accepted for publication. This journal periodically publishes in January, April, July, and October. In order to support reduction of global warming as a consequence of transportation vehicles emision and forest degradation for paper manufacturing, management of the journal prefer receiving manuscripts via e-mail rather than in hard copy. Manuscript and its communications can only be addressed to one of the managing editor (until first acceptance); better to “CC” to the secretary editor for monitoring.. A letter of statement expressing that the author (s) is responsible for the original content of manuscript, the result of author(s)’s research and never been published must be attached. Manuscript is typed at one side of white paper of A4 (210x297 mm2) size, in a single column, double space, 12-point Times New Roman font, with 2 cm distance step aside in all side. Smaller letter size and space can be applied in presenting table. Word processing program or additional software can be used, however, it must be PC compatible and Microsoft Word based. Scientific name (genera, species, author), and cultivar or strain should be mentioned completely at the first time mentioning it. Name of genera can be shortened after first mentioning, except generating confusion. Name of author can be eliminated after first mentioning. For example, Rhizopus oryzae L. UICC 524, hereinafter can be written as R. oryzae UICC 524. Using trivial name should be avoid, otherwise generating confusion. Mentioning of scientific name completely can be repeated at Materials and Methods. Biochemical and chemical nomenclature should follow the order of IUPAC-IUB, its translation to Indonesian-English refers to Glossarium Istilah Asing-Indonesia (2006). Symbols of standard chemical and abbreviation of chemistry name can be applied for common and clear used, for example, completely written hydroxytoluene butilic to be BHT hereianafter. Metric measurement use IS denomination, usage other system should follow the value of equivalent with the denomination of IS first mentioning. Abbreviation set of, like g, mg, mL, etc. do not follow by dot. Minus index (m-2, L-1, h-1) suggested to be used, except in things like “per-plant” or “per-plot”. Equation of mathematics does not always can be written down in one column with text, for that case can be written separately. Number one to ten are expressed with words, except if it relates to measurement, while values above them written in number, except in early sentence. Fraction should be expressed in decimal. In text should use “%” rather than “gratuity”. Avoid expressing idea with complicated sentence and verbiage, and used efficient and effective sentence. Manuscript of original research should be written in no more than 25 page (including tables and picture), each page contain 700-800 word, or proportional with article in this publication number. Invited review articles will be accommodated. Title of article should be written in compact, clear, and informative sentence preferably not more than 20 words. Name of author(s) should be completely written. Running title is about five words. Name and institution address should also completely written with street name and number (location), zip code, telephone number, facsimile number, and email address. Manuscript written by a group, author for correspondence along with address is required. Abstract should not more than 200 words, written in English. Keywords is about five words, covering scientific and local name (if any), research theme, and special methods which used. Introduction is about 400-600 words, covering background and aims of the research. Materials and Methods should emphasize on the procedures and data analysis. Results and Discussion should be written as a series of connecting sntences, however, for manuscript with long discussion should be divided into sub titles. Thorough discussion represents the causal effect mainly explain for why and how the results of the research were taken place, and do not only re-express the mentioned results in the form of sentences. Concluding sentence should preferebly be given at the end of the discussion. Acknowledgments are expressed in a brief. Figures and Tables of maximum of three pages should be clearly presented or printed in laser printer. Title of a picture is written down below the picture, while title of a table is written in the above the table. Photo should be printed in a glossy paper with explanation. Colored picture can be accepted if information in manuscript can lose without picture. Photos and pictures are preferebly presented in a digital file. Author could consign any picture or photo for front cover, although it does not print in the manuscript. There is no appendix, all data or data analysis are incorporated into Results and Discussions. For broad data, it can be displayed in website as Supplement. Citation in manuscript is written in “name and year” system; and is arranged from oldest to newst. The sentence sourced from many authors, should be structured based on the year of recency. In citing an article written by two authors, both of them should be mentioned, however, for

three and more authors only the family name of the first author is mentioned followed by et al., for example: Saharjo and Nurhayati (2006) or (Boonkerd, 2003a, b, c; Sugiyarto, 2004; El-Bana and Nijs, 2005; Balagadde et al., 2008; Webb et al., 2008). Extent citation as shown with word “cit” should be avoided, and suggested to refer an original reference. CBE-ELSE-VANCOUVER style in double space are used in this journal with the following modification: Journal: Carranza, S. and E.N. Arnold. 2006. Systematics, biogeography and evolution of Hemidactylus geckos (Reptilia: Gekkonidae) elucidated using mitochondrial DNA sequences. Molecular Phylogenetics and Evolution 38 (2): 531-545. Saharjo, B.H. and A.D. Nurhayati. 2006. Domination and composition structure change at hemic peat natural regeneration following burning; a case study in Pelalawan, Riau Province. Biodiversitas 7 (2): 154-158 Book: Rai, M.K. and C. Carpinella. 2006. Naturally Occurring Bioactive Compounds. Amsterdam: Elsevier Shao, G. and K.M. Reynolds (eds.). 2006. Computer Applications in Sustainable Forest Management: Including Perspectives on Collaboration and Integration. Berlin: Springer. Chapter in book: Boonkerd, T. 2003. Loxogramme involuta, Lycopodium carinatum and L. complanatum. In: Jansen, P.C.M. and N.W. Soetjipto (eds.). PROSEA, Plant Resources of South-East Asia No. 12: Cryptogams. Leiden: Backhuy Publishers. Webb. C.O., C.H. Cannon, and S.J. Davies. 2008. Ecological organization, biogeography, and the phylogenetic structure of rainforest tree communities. In: Carson, W. and S. Schnitzer (eds.). Tropical Forest Community Ecology. New York: Wiley-Blackwell. Abstract: Assaeed, A.M. 2007. Seed production and dispersal of Rhazya stricta. 50th Annual Symposium,The International Association for Vegetation Science, Swansea, UK, 23-27 July, 2007. El-Bana, M.I. and I. Nijs. 2005. The potential of phytogenic mounds (Nebkhas) for rehabilitation of degraded arid ecosystems in Sinai Peninsula. World Conference on Ecological Restoration: A Global Challenge. Zaragoza, Spain, 11-18 September 2005. Proceeding: Alikodra, H.S. 2000. Biodiversity for development of local autonomous government. In: Setyawan, A.D. and Sutarno (eds.). Toward Mount Lawu National Park; Proceeding of National Seminary and Workshop on Biodiversity Conservation to Protect and Save Germplasm in Java Island. Sebelas Maret University, Surakarta, 17-20 Juli 2000. [Indonesia] Thesis, Dissertation: Sugiyarto. 2004. Soil Macro-invertebrates Diversity and Inter-Cropping Plants Productivity in Agroforestry System based on Sengon. [Dissertation]. Malang: Post-graduate Program, Brawijaya University. [Indonesia] Information from internet: Balagadde, F.K., H. Song, J. Ozaki, C.H. Collins, M. Barnet, F.H. Arnold, S.R. Quake, and L. You. 2008. A synthetic Escherichia coli predatorprey ecosystem. Molecular Systems Biology 4: 187. www.molecularsystemsbiology.com Publication manuscript “in press” can be cited and mentioned in reference (bibliography); “personal communications” can be cited, but cannot be mentioned in reference. Research which not be published or “submitted” cannot be cited. Some annotation. Manuscript typed without sign link (-) (except repeated word in Indonesian). Usage of letter “l” (el) to “1” (one) or “O” (oh) to “0”(null) should be avoided. Symbols of α, β, χ, etc. included through facility of insert, non altering letter type. No space between words and punctuation mark. Progress of manuscript. Notification of manuscript whether it is accepted or refused will be notified in one to two months since the manuscript received. Manuscript is refused if the content does not in line with the journal mission, low quality, inappropriate format, complicated language style, dishonesty of research authenticity, or no answer of correspondency in a certain perriod. Author or first authors at a group manuscript will get one original copy of journal containing manuscript submitted not more than a month after publication. Offprint or reprint is only available with special request. NOTE: Author(s) agree to transfer copy right of published paper to BIODIVERSITAS, Journal of Biological Diversity. Authors shall no longer be allowed to publish manuscript completely without publisher permission. Authors or others allowed to multiply article in this journal as long as not for commercial purposes. For the new invention, authors suggested to manage its patent before publishing in this journal.

ISSN: 1412-033X (printed edition) ISSN: 2085-4722 (electronic)

MOLECULAR BIOLOGY AND GENETICS

Isolation and Cloning of cDNA of Gene Encoding for Metallothionein Type 2 from Soybean [Glycine max (L.) (Merrill)] cv Slamet SUHARSONO, YASSIER ANWAR, UTUT WIDYASTUTI

109-114

Characterization and Purification a Specific Xylanase Showing Arabinofuranosidase 115-119 Activity from Streptomyces spp. 234P-16 ANJA MERYANDINI, TRIO HENDARWIN, FAHRRUROZI, ALINA AKHDIYA, DEDEN SAPRUDIN, YULIN LESTARI TAXONOMY, BIOSYSTEMATICS, PHYLOGENETICS

The Correlations between the Degree of Petal Fusion and the Size of Leaf and Fruit: A Case in Syzygium (Myrtaceae) PUDJI WIDODO, ALEX HARTANA, TATIK CHIKMAWATI

120-123

Some Notes on Biological Aspects of Captive Javan Warty Pig (Sus verrucosus) GONO SEMIADI, RADEN TAUFIQ PURNA NUGRAHA

124-128

ECOLOGY AND BIOLOGICAL CONSERVATION

Enhancing Diversity of Soil Macroinvertebrates in Sengon-based Agroforestry Systems by Mulching Technology SUGIYARTO

129-133

Grazing Habitat of the Rusa Deer (Cervus timorensis) in the Upland Kebar, Manokwari FREDDY PATTISELANNO, AGUSTINA YOHANA SETYARINI AROBAYA

134-138

Population Dynamics of Banteng, Buffalo and Deer in Bekol Savannah, Baluran National Park 139-145 SUHADI ETHNOBIOLOGY

Ethnobotanical Study on the Genus Pandanus L. f. in Certain Areas in Java, Indonesia WARDAH, FRANCISCA MURTI SETYOWATI

146-150

OTHERS

Extraction of Coconut Oil (Cocos nucifera L.) through Fermentation System RINI HANDAYANI, JOKO SULISTYO, RITA DWI RAHAYU

151-157

Potency of Lobak Leaves (Raphanus sativus L. var. hortensis Back) as Anticancer and Antimicrobial Candidates RITA RAKHMAWATI, ENDANG ANGGARWULAN, ESTU RETNANINGTYAS

158-162

Front cover: Sus verrucosus (PHOTO: GONO SEMIADI)

Published four times in one year

PRINTED IN INDONESIA ISSN: 1412-033X (printed)

ISSN: 2085-4722 (electronic)