Biodiversitas vol. 16, no. 2, October 2015

ISSN: 1412-033X E-ISSN: 2085-4722

Journal of Biological Diversity Volume

16 – Number2 – October2015

ISSN/E-ISSN: 1412-033X (printed edition), 2085-4722 (electronic)

EDITORIAL BOARD (COMMUNICATING EDITORS): Abdel Fattah N.A. Rabou (Palestine), Alan J. Lymbery (Australia), Alireza Ghanadi (Iran), Ankur Patwardhan (India), Bambang H. Saharjo (Indonesia), Daiane H. Nunes (Brazil), Ghulam Hassan Dar (India), Guofan Shao (USA), Faiza Abbasi (India), Hassan Pourbabaei (Iran), Hwan Su Yoon (South Korea), I Made Sudiana (Indonesia),Ivan Zambrana-Flores (United Kingdom), Joko R. Witono (Indonesia), Katsuhiko Kondo (Japan),Krishna Raj (India), Livia Wanntorp (Sweden), M. Jayakara Bhandary (India),Mahdi Reyahi-Khoram (Iran), Mahendra K. Rai (India),Mahesh K. Adhikari (Nepal), María La Torre Cuadros (Peru), Maria Panitsa (Greece), Muhammad Akram (Pakistan), Muhammad Iqbal (Indonesia), Mochamad A. Soendjoto (Indonesia), Mohib Shah (Pakistan), Mohamed M.M. Najim (Srilanka), Pawan K. Bharti (India), Paul K. Mbugua (Kenya), Rasool B. Tareen (Pakistan),Seweta Srivastava (India), Seyed Aliakbar Hedayati (Iran), Shahabuddin (Indonesia), Shahir Shamsir (Malaysia), Shri Kant Tripathi (India), Stavros Lalas (Greece), Subhash Santra (India), Sugiyarto (Indonesia), T.N. Prakash Kammardi (India)

EDITOR-IN-CHIEF: Sutarno

EDITORIAL MEMBERS: English Editors: Suranto, Wiryono (wiryonogood@yahoo.com);Technical Editor & Banking: Solichatun (solichatun_s@yahoo.com) Distribution & Marketing: Rita Rakhmawati (oktia@yahoo.com); Webmaster: Ari Pitoyo (aripitoyo@yahoo.com)

MANAGING EDITORS: Ahmad Dwi Setyawan (unsjournals@gmail.com)

PUBLISHER: The Society for Indonesian Biodiversity

CO-PUBLISHER: Department of Biology, Faculty of Mathematics and Natural Sciences, Sebelas Maret University, Surakarta

ADDRESS: Jl. Ir. Sutami 36A Surakarta 57126. Tel. +62-271-7994097, Tel. & Fax.: +62-271-663375, Email: unsjournals@yahoo.com

ONLINE: biodiversitas.mipa.uns.ac.id

EXPERTISE AND CORRESPONDING EMAIL OF THE COMMUNICATING EDITORS: GENETIC DIVERSITY: Alan J. Lymbery (a.lymbery@murdoch.edu.au), Hwan Su Yoon (hsyoon@bigelow.org), Mahendra K. Rai(pmkrai@hotmail.com). SPECIES DIVERSITY: Joko R. Witono (jrwitono@yahoo.com), Katsuhiko Kondo (k3kondo@nodai.ac.jp),Livia Wanntorp (livia.wanntorp@nrm.se), Mahesh K. Adhikari (mkg_adh@wlink.com.np), Maria Panitsa (mpanitsa@upatras.gr), Mohib Shah (mohibshah@awkum.edu.pk), Paul K. Mbugua (paulkmbugua@gmail.com), Rasool B. Tareen (rbtareen@yahoo.com). ECOSYSTEM DIVERSITY: Abdel Fattah N.A. Rabou (arabou@iugaza.edu), Alireza Ghanadi (aghannadi@yahoo.com), Ankur Patwardhan (ankurpatwardhan@gmail.com), Bambang H. Saharjo (bhsaharjo@gmail.com), Daiane H. Nunes (nunesdaiane@gmail.com), Faiza Abbasi (faeza.abbasi@gmail.com), Ghulam Hassan Dar (profdar99@gmail.com), Guofan Shao (shao@purdue.edu), Hassan Pourbabaei (hassan_pourbabaei@yahoo.com), I Made Sudiana (sudianai@yahoo.com),Ivan ZambranaFlores (izambrana@gmail.com), Krishna Raj (krishnarajisec@yahoo.co.uk), Mahdi Reyahi-Khoram (phdmrk@gmail.com),Muhammad Iqbal (kpbsos26@yahoo.com), Mochamad A. Soendjoto (masoendjoto@gmail.com), Mohamed M.M. Najim (mnajim@kln.ac.lk), Pawan K. Bharti (gurupawanbharti@rediffmail.com), Seweta Srivastava (shalu.bhu2008@gmail.com), Seyed Aliakbar Hedayati (Hedayati@gau.ac.ir), Shahabuddin (shahabsaleh@gmail.com), Shahir Shamsir (shahirshamsir@gmail.com), Shri Kant Tripathi (sk_tripathi@rediffmail.com), Stavros Lalas (slalas@teilar.gr), Subhash Santra (scsantra@yahoo.com), Sugiyarto (sugiyarto_ys@yahoo.com), T.N.Prakash Kammardi (prakashtnk@yahoo.com). ETHNOBIOLOGY: M. Jayakara Bhandary (mbjaikar@gmail.com),María La Torre Cuadros (angeleslatorre@lamolina.edu.pe), Muhammad Akram (makram_0451@hotmail.com).

Society for Indonesia Biodiversity

Sebelas Maret University Surakarta

B I O D I V E R S IT A S Volume 16, Number 2, October 2015 Pages: 109-115

ISSN: 1412-033X E-ISSN: 2085-4722 DOI: 10.13057/biodiv/d160201

Potential distribution of Monotropa uniflora as a surrogate for range of Monotropoideae (Ericaceae) in South Asia PRAKASH PRADHAN West Bengal Biodiversity Board, Department of Environment, Government of West Bengal, Salt Lake, Sector-III, FD415A, Poura Bhawan, 4th Floor, Kolkata, West Bengal, India, 700 106. Tel.+91 8013126863, ď‚Šemail: shresthambj@gmail.com.

Manuscript received: 12 February 2015. Revision accepted: 13 May 2015.

Abstract. Pradhan P. 2015. Potential distribution of Monotropa uniflora as a surrogate for range of Monotropoideae (Ericaceae) in South Asia. Biodiversitas 16: 109-115. Monotropoideae is a mycoheterotrophic subfamily of Ericaceae. Its members are highly specific to a particular fungal family, which has attributed to the rarity and limited distribution of Monotropoideae. In the past two decades, there are considerable developments in understanding their biology and biogeography, among which, the distribution of Monotropa uniflora L. and M. hypopitys L. has been extensively studied. In this contribution, Ecological Niche Modeling of M. uniflora has been conducted to test its earlier proposed distribution in South Asia, to test the spatial scale of the said proposal, to test its potential distribution as a surrogate for range of Monotropoideae in South Asia and to prioritize conservation areas for M. uniflora in the region. The model was built with five occurrence details of the rare plant M. uniflora in Western and Eastern Himalaya, in relation to 19 bioclimatic explanatory variables, performed in MaxEnt. The results show the good performance of the model with the training AUC of 0.994.

1,50,316 square Km. of suitable areas have been predicted for the growth of M. uniflora (IHS ≼0.5) in South Asia, many areas of which is in line with earlier distributional reports. The bioclimatic variables are able to predict and suitably justify the spatial distribution of M. uniflora. The predicted range of the species could be established for potential distribution of other Asian Monotropoids like Monotropastrum and Cheilotheca.

Key words: Ecological Niche Modeling, Himalaya, MaxEnt, Mycoheterotrophy, Russulaceae Abbreviations: IHS = Index of Habitat Suitability; Bio = Bioclimatic variable

INTRODUCTION Mycoheterotrophy includes an obligatory reliance of achlorophyllous and non-photosynthetic plants upon specialized mycorrhizal associates for carbon influx (Klooster and Culley 2009). Monotropoideae is a mycoheterotrophic subfamily of Ericaceae, consisting of 10 genera and 15 species (Wallace 1975). Leake (1994) has reported 260 species of Mycoheterotrophic plants as endemic to Palaeotropics, extending from India in the West to Papua-New Guinea and Japan in the East. Endemic taxa of Monotropoideae have been reported from Western North America (seven species) and Asia (two Monotropastrum species and two Cheilotheca species and a variety) (Tsukaya et al. 2008), preferring to grow mostly in shady old growth forests (Min et al. 2012). Their endemism and narrow geographic range have been linked to limited distribution of their taxa specific mycorrhizal fungal partners (Kruckeberg and Rabinowitz 1985; Bidartondo and Bruns 2001), and such trophic structure has left the subfamily with very isolated and rare taxa (Klooster and Culley 2009). Monotropa uniflora L. and M. hypopitys L. though distantly related but are the only species within Monotropoideae which are distributed across Neotropics and Palaeotropics (Leake 1994). Although Leake (1994) has indicated broad range of genus Monotropa in Indian subcontinent, M. uniflora is considered regionally rare in

Indian states of West Bengal (WBBB 2012; FRLHT 2015) and Meghalaya (Mir et al. 2014).

Suitability of climate and presence of dense and shaded forest habitat has been attributed for the evolution of heterotrophy in paleotropics and neotropics (Leake 1994).

Similarly, Ecological Niche/climate modeling has been proposed to act as a successful marker to infer the phylogeographic and demographic histories of mycoheterotrophic plants by Taylor et al. (2013). In this regard, paleo-distribution modeling of M. hypopitys in North America has been successfully conducted in MaxEnt using bioclimatic variables (Beatty and Provan 2011), however no study has been focused on Monotropoideae as a whole or any species therein in South Asia regarding their distribution in bioclimatic envelope. For planning suitable conservation action for Monotropoideae in this region, prime necessity is to prioritize areas for conservation having high suitability of the ecological niche of the taxa.

In this contribution, Ecological Niche Modeling of M. uniflora has been conducted to test earlier proposed distribution of the species in South Asia, to test the spatial scale of the said proposal, to test potential distribution of the species as a surrogate for range of Monotropoideae in South Asia and to prioritize conservation areas for M. uniflora in the region.

110

B I O D I V E R S IT A S 16 (2): 109-115, October 2015

MATERIALS AND METHODS Occurrence records and site characteristics Occurrence records were obtained with the help of Garmin Etrex GPS machine for the locations of Jorepokhari (Figure 1); data from Rachela were obtained from Divisional Forest Office (Research Division), Darjeeling; occurrences in Phedkhal, Jakholi and Mandal of Uttarakhand were derived from Semwal et al. (2014) and in communication with Dr. Semwal (Figure 2). All the occurrence sites have montane topography. Vegetation wise, Rachela and Phedkhal have Oak dominated vegetation, Jakholi has mixed woodlands, Mandal has mixed forest with Oak, Birch and Cedrus, while Jorepokhari has mixed woodlands of Cryptomeria japonica, Oak and Bamboos. The geographical features of the occurrence sites are shown in Table 1.

Figure 2. Monotropa uniflora plants observed in Jorepokhari, Darjeeling District, West Bengal, India

Figure 1. Occurrence records utilized for modelling potential distribution of Monotropa uniflora

PRADHAN – Potential distribution of Monotropa uniflora in South Asia

111

Table 1. Geographical and climatic features of the occurrence sites; Tmin=mean monthly minimum temperature, Tmax=mean monthly maximum temperature, PPT=annual precipitation.

Site

Longitude

Latitude

Jorepokhari Rachela Phedkhal Jakholi Mandal

88.1490 88.7414 78.8704 78.9080 79.4331

26.9877 27.1378 30.1682 30.3862 29.5789

Altitude (m) 2239 3124 1842 1706 1621

Table 2. Range of Index of Habitat Suitability (IHS) along with predicted area and the respective percentage of the total suitable area.

IHS 0.5 - 0.599 0.6 - 0.699 0.7 - 0.799 0.8 - 0.899 0.9 - 1

Predicted area km2 1,50,316 98,045 76,717 63,697 39,968

% of total suitable area 35.06 22.87 17.89 14.86 9.32

Modeling species distribution - Modeling method MaxEnt program version 3.3.3 k (Phillips et al. 2006; Phillips and Dudik 2008) is a maximum entropy based general-purpose machine learning method and it was used for modeling species distribution in geographic space and creation of habitat suitability maps. Entropy in the context of probability theory and statistics measures the amount of information that is contained in a random variable or unknown quantity. MaxEnt uses the basic set of information to model the distribution of a species, i.e., a set of samples (species presence) available from a geographical region, which is linked to a set of explanatory variables (e.g. climatic).

Explanatory variables Climatic variables of monthly precipitation and monthly mean, minimum and maximum temperature at a spatial resolution of 30 arc seconds (~1 × 1 km resolution) were derived from WORLDCLIM (Hijmans et al. 2005) (tile 18, 19, 28 and 29) which includes interpolation of climatic records from global network of 4000 climate stations, with time series of 1950–2000. Current investigation doesn’t incorporate climatic information of tile 110 and 210 of WORLDCLIM, hence geographic space of East Asian countries like Taiwan, Japan etc. are excluded for potential species distribution. Using DIVAGIS version 7.5 (Hijmans et al. 2001), tile data were converted into 19 bioclimatic variables i.e., annual mean temperature [Bio1], mean monthly temperature range [Bio2], isothermality [Bio3], temperature seasonality [Bio4], max temperature of warmest month [Bio5], min temperature of coldest month [Bio6], temperature annual range [Bio7], mean temperature of wettest quarter [Bio8], mean temperature of driest quarter [Bio9], mean temperature of warmest quarter [Bio10], mean temperature

Tmin avg (˚C) 9.3 1.7 10.3 10.9 9.6

Tmax avg (˚C) 16.1 12.8 19.4 20.4 19.5

PPT (mm) 2268 1068 1634 1467 1784

Aspect 351.92 (N) 312.45 (NW) 308.95 (NW) 117.88 (SE) 56.97 (NE)

of coldest quarter [Bio11], annual precipitation [Bio12], precipitation of wettest month [Bio13], precipitation of driest month [Bio14], precipitation seasonality [Bio15], precipitation of wettest quarter [Bio16], precipitation of driest quarter [Bio17], precipitation of warmest quarter [Bio18], precipitation of coldest quarter [Bio19] (Busby 1986; Nix 1986; Hijmans et al. 2005) in ESRI ASC format for use in MaxEnt program. These bioclimatic variables express spatial variation in annual means, seasonality and extreme or limiting climatic factors and represent biologically meaningful parameters for characterizing species distributions (Saatchi et al. 2008) hence they were used as explanatory variables.

Model building and evaluation Presence-only data were used for model building.

However, in order to evaluate models on the basis of error rates, absence details are needed. To overcome this, 25,000 random points throughout the study area were assumed as absence ‘pseudo-absence’ (Zaniewski et al. 2002). Linear regularization feature was used for model building; default value of 1 for β regularization which gives consistent AUC peaks (Phillips et al., 2004) was used; prevalence or the probability of presence was taken to be 0.5.

Threshold-independent analysis In the threshold-independent analysis, model performance/strength (the power to discriminate between sites where a species is present, versus those where it is absent) was evaluated using the Area under the Curve (AUC) of the Receiver Operating Characteristic (ROC) curve (Fielding and Bell 1997; Elith and Burgman 2002).

The AUC statistic ranges from 0 to 1, where a score of 0.5 implies discrimination that is no better than random, and a score of 1 indicates perfect discrimination (Fielding and Bell 1997; Pearce and Ferrier 2000).

Explanatory variable importance The importance of each bioclimatic factors explaining the distribution of species was determined by Jackknife analysis of the average gain with training and test data. 500 iterations were conducted for training algorithm, the increase or decrease in regularized gain was added or subtracted, respectively, to the input of the corresponding variable, giving a heuristic estimate of bioclimatic variable contribution for the model (Phillips et al. 2006).

112

B I O D I V E R S IT A S 16 (2): 109-115, October 2015

Model output and Mapping Logistic format was selected which categorizes estimates of probability of occurrence or Index of Habitat Suitability (IHS) within 0-1 (Anderson et al. 2003; Baldwin 2009). In DIVA-GIS, the logistic output grid was reclassified and exported to raster. IHS regions < 0.5 were discarded as random prediction, > 0.5 IHS were treated as suitable areas of species distribution, ≥ 0.7 IHS were treated as the core areas of species distribution (Kuemmerle et al. 2010), and prioritized areas for conservation were taken for IHS ≥0.9.

RESULTS AND DISCUSSION The potential distribution of Monotropa uniflora in South Asia have been found to be in the longitudinal range of 68.94-117.8 decimal degrees and latitudinal range of 6.76-36.81 decimal degrees, covering 1,50,316 square Km

(Table 2). Suitable areas for the growth of the species (IHS ≥0.5) have been found in the countries of Tajikistan, Afghanistan, Pakistan, India, Nepal, China, Bangladesh, Myanmar, Srilanka, Laos and Vietnam. Whereas, conservation areas that could be prioritized (IHS ≥0.9) have been found in India, Nepal, China, Afghanistan, Sri Lanka, Myanmar and Vietnam covering are of 39,968 square Km (Figure 3).

The model performed well with the training AUC value above 0.9 (0.994) with the training omission rate of zero for evaluation localities. The jackknife test of variable importance showed the environmental variable with the highest gain when used in isolation (which has the most useful information by itself) to be temperature annual range [Bio7] (maximum temperature of the warmest month minimum temperature of the coldest month). The environmental variable that decreases the gain the most when it is omitted is precipitation of driest quarter [Bio17], which therefore appears to have the most information that isn't present in the other variables.

Figure 3. Potential distribution of Monotropa uniflora in South Asia with graded Index of Habitat Suitability; warmer colour are indicative of more suitable areas.

PRADHAN – Potential distribution of Monotropa uniflora in South Asia

Potential conservation areas for M. uniflora (IHS ≥0.9) in India are predicted in Eastern Kathua in the state of Jammu and Kashmir; Charua, Chamba, Dalhousie, Kangra, Brahmaur, Dharmshala, Palampur, Baijnath, Kullu, Mandi, Thunag, Chachyot, Karsog, Banjar, Nermand, Ani, Rampur, Rohru, Kotkhai, Theog, Rajgarh, Chaupal, Renuka, Shilla, Jubbal, Paonta in the state of Himachal Pradesh; Chakrata, Purola, Rajgarhi, Dunda, Tehri Garhwal, Dehradun, Northern Lansdown, Pauri, Pauri Garhwal, Devprayag, Narendranagar, Chamoli, Karnaprayag, Ranikhet, Naini Tal, Almora, Champawat, Bageshwar, Southern Joshimath in the state of Uttaranchal; Darjeeling, Kurseong and Kalimpong subdivisions of Darjeeling District in the state of West Bengal; South Eastern Nongstoin area of West Khasi Hills, South Eastern area of Shillong in the state of Meghalaya.

IHS ≥0.9 have been predicted in the Kuran Wa Munjan and Wakhan areas of Afghanistan; Chitral of N.W.F.P. in Pakistan; Central and Northern Matupi, Southern Thlangtlang areas of Myanmar; Baitadi, Dadeldhura, Doti, Western Darchula, Bajhang, Bajura, Kalikot, Northern Jajarkot, South Eastern Jumla, Mugu, South Eastern Humla, Western Dolpa, Northern Myagdi, Northern Rapti, Southern Manang, Northern Kaski, Eastern Ilam of Nepal; Elahera, Thamankadua, Dimbulagala of Sri Lanka; Eastern Lai Chau and Western Lao Cai areas of Vietnam.

Suitable areas (IHS ≥0.5) in China are predicted mostly in South-Central and South-Western China with IHS ranging upto 0.80 in Yunnan, 0.81 in Sichuan and 0.94 in Xizang provinces. Wenshan, Pingbiang Miao, Hekou Yao, Maguan, Malipo, Jinping Yao, Miao and Dai areas of Yunnan province are predicted in continuum of the potential areas from Northern Vietnam; Zanda, Burang and Zhongba area of Xizang province are in continuum of Western and Central Himalaya; Kangding, Luding, Hongya, Hanyuan, Meishan, Ebian Yi, Meigu, Mabian Yi, Ganluo, Jinkouhe areas of Sichuan have been predicted as potential habitats in central China.

Not only is the present prediction takes into account for high altitude habitats, but also coastal vegetation with IHS ranging upto 0.82 in Sagar Island, West Bengal, India.

Possibility of suitable habitats of the taxa in coastal areas (IHS ≥0.5) which await prioritized inventory are presently predicted along the coast of Western India, Western Ghats, Bay of Bengal, Gujrat in India; Maungtaw, Buthidaung, Sitwe, Chaungzon, Mudon, Paung, Moulmein areas of Myanmar, Patuakhali, Noakhali, Cox’s Bazar, Bandarbon areas of Bangladesh; Thua Thien - Hue, Nghe An, Thai Binh, Hai Phong, Quang Ninh area of Vietnam; Hainan, Haikou, Zhanjiang, Maoming, Yangjiang, Jiangmen, Zhuhai, Zhangzhou areas of China.

Genus Monotropa was represented by Leake (1994) to cover Indian, Nepalese and Chinese part of Western, Central, Eastern Himalaya and coastal Indian Subcontinent including other parts of India and Bangladesh and Japan in the east as well. Some of the Monotropoideae reported from Asia include Cheilotheca malayana from Japan (Matsuda and Yamada 2003); M. uniflora L. from damp deciduous or mixed forests of Anhui, Gansu, Guizhou,

113

Hubei, Jiangxi, Qinghai, Shaanxi, Shanxi, Sichuan, Xizang, Yunnan, Zhejiang regions of China (100-1500 m), Bangladesh, Bhutan, India, Korea, Myanmar, Nepal, Sikkim (FOC 2014; Min et al. 2012); Japan (Bidartondo and Bruns 2001); Murree hills in Pakistan (33.9043˚ N, 73.3942˚ E) (FOP 2014); Monotropa hypopitys L. from India (Barik et al. 2009), Japan (Bidartondo and Bruns 2001); Monotropastrum humile (D. Don) Hara from Himalaya (East Asia) to Japan (Kitamura et al. 1975; Bidartondo and Bruns 2001), Yunnan, China. (Min et al.

2012), M. humile var. humile from Fengshan, Chi-Tou Region of Taiwan, Mt. Mirokusan of Korea, Shioupuri, Kathmandu, Nepal (Tsukaya et al. 2008); Monotropastrum sciaphilum from Yunnan, China (Min et al. 2012); Monotropastrum macrocarpum from Eastern Himalaya (Maheshwari 1969) etc. The potential distribution of M. uniflora is in line with the reported distribution of other Monotropoids. Large tracts of Central and Western Himalayas are predicted to be bioclimatically suitable for M. uniflora, with disjunct distribution in various countries reaffirming previous reports. However, many areas viz.

Zhejiang, Fujian, Guangdong and Hainan of China are predicted in addition to earlier reports (E floras 2014a).

Previously, members of Monotropoideae were reported to grow in coastal dunes in the Pacific North West USA with prostrate Arctostaphylos mats (Leake 1994). Current prediction of M. uniflora in many coastal areas of South Asia therefore necessitates further insight into such habitat of the species. Though temperature annual range have singly important role to play in M. uniflora distribution, precipitation of driest quarter may be important in density dependent feedback of fungal biomass in the substratum of mycorrhizal partner of M. uniflora (Krivtsov et al. 2006).

Monotropastrum humile and Cheilotheca malayana which are distributed in South East Asia from the Himalaya to Japan (Wallace 1975; Kitamura et al. 1975) are similar to M. uniflora regarding specialization to fungal family Russulaceae (Young et al. 2002; Matsuda and Yamada 2003). In fact, M. humile has been shown to be phylogenetically close to M. uniflora, therefore current potential distribution of M. uniflora could be functionally predictive for the said species of Monotropoideae.

However, currently described potential distribution should be carefully applied to derive cross-continent inference for the species, as collections of M. uniflora from Asia, North America, and Central America are indicated to be molecularly diverged and phylogenetically distinct (Bidartondo and Bruns 2001; Neyland and Hennigan 2004).

Monotropa uniflora has been reported in association with Lithocarpus fenestrata (Roxb.) Rehd., from temperate forests of Meghalaya and adjoining forests of Shillong plateau, Nagaland, Mizo and Mikir Hills (1800-3500 m.) during winter season from November to March (Singh et al. 2002). Report of M. hypopitys L. from North Eastern India (Barik et al. 2009) has indicated that this belt might indeed be abode for the Genera. The projected range of Monotropa in Northeast Hills (Meghalaya and MizoramManipur-Kachin forest zones) has also been proposed for

B I O D I V E R S IT A S 16 (1): 115-xxx, April 2015

114

prioritized conservation of amphibians and reptiles, highlighting importance of said areas for conservation, which are yet currently out of protected area network (Pawar et al. 2007). One of the collection sites (Jorepokhari) of M. uniflora in the present study is located within plantation of Cryptomeria japonica (introduced from Japan), while collection of M. humile by Matsuda et al. (2011) from ecotone of natural forests of Cryptomeria japonica in Tateyama, Japan indicates prevalence and competence of Monotropoideae in allelopathic environment.

The climatic relationship of Monotropoid distribution predicted by earlier workers is in line with the present work and the present study is able to justify the same by refining spatial extent of their distribution in climatically suitable areas. The congruence of the potential range of the M. uniflora and other Asian Monotropoids like Monotropastrum and Cheilotheca, indicates that the potential distribution of M. uniflora could act as a surrogate for understanding the range of the Monotropoideae (Ericaceae) in South Asia. The identified novel distributional areas may add to the effective conservation efforts of the subfamily in the region.

One of the prerequisite of realizing niche of a mycoheterotrophic species is the range maps of many ectomycorrhizal host trees, which unfortunately are of limited availability in public domain of a developing nation. Furthermore, modeling species distribution with more occurrence records would be helpful in refining spatial scale of suitable areas. Therefore the currently predicted distribution of Monotropoideae in South Asia has to be further tested with more occurrence records and calibrated with the range maps of ectomycorrhizal fungi and their host trees for consolidation.

ACKNOWLEDGEMENTS Author would like to share his heartfelt gratitude to Dr. K.C. Semwal (Mekelle University, Ethiopia) and S. Suratna Sherpa, IFS (Divisional Forest Officer, Research Division, Darjeeling, India) for providing inputs to the occurrence records of Monotropa uniflora.

REFERENCES Anderson RP, Lew D, Peterson AT. 2003. Evaluating predictive models of species distributions: criteria for selecting optimal models. Ecol Model 162: 211-232.

Baldwin RA. 2009. Use of maximum entropy modelling in wildlife reserve research. Entropy 11: 854-866.

Barik SK, Lakadong NJ, Baishya R, Chettri A, Das P, Kayang H, Marbaniang D. 2009. A New record of Monotropa hypopitys L., A myco-heterotrophic plant from India. J Bombay Nat Hist Soc 106 (1): 127-129.

Beatty GE, Provan J. 2011. Phylogeographic analysis of North American populations of the parasitic herbaceous plant Monotropa hypopitys L. reveals a complex history of range expansion from multiple late glacial refugia. J Biogeogr 38: 1585-1599.

Bidartondo MI, Bruns TD. 2001. Extreme specificity in epiparasitic Monotropoideae (Ericaceae): widespread phylogenetic and geographical structure. Mol Ecol 10: 2285-2295.

Busby JR. 1986. A biogeographical analysis of Nothofagus cunninghamii (Hook.) Oerst. in southeastern Australia. Aust J Ecol 11: 1-7.

Elith J, Burgman M. 2002. Predictions and their validation: rare plants in the central highlands, Victoria, Australia. In: Scott, JM, Heglund, PJ, Morrison, ML, Haufler, JB, Raphael, MG, Wall, WA and Samson, FB (Eds). Predicting Species Occurrences: Issues of Accuracy and Scale. Island Press, Washington, DC. Fielding AH, Bell JF. 1997. A review of methods for the assessment of prediction errors in conservation presence/absence models. Environ Conserv 24 (1): 38-49.

FOC [Flora of China]. 2014. Monotropa uniflora Linnaeus, Sp. Pl. 1: 387.

1753. Flora of China 14: 256 http://www.efloras.org/florataxon.aspx? flora_id=2&taxon_id=200016137 [30.12.2014] FOP [Flora of Pakistan]. 2014. Monotropa uniflora L., Sp. Pl. 387. 1753.

Clarke in Hk. f., I.c. Flora of Pakistan. http://www.efloras.org/ florataxon.aspx?flora_id=5 &taxon_id=200016137 [30.12.2014] FRLHT [Foundation for Revitalisation of Local Health Traditions]. 2015.

Medicinal Plants of West Bengal. Foundation for Revitalisation of Local Health Traditions, Bangalore http://envis.frlht.org/checklist/ WestBengal.pdf [14.01.2015].

Hijmans RJ, Cameron SE, Parra JL, Jones PG, Jarvis A. 2005. Very high resolution interpolated climate surfaces for global land areas. Int J Clim 25: 1965-1978.

Hijmans RJ, Guarino L, Cruz M, Rojas E. 2001. Computer tools for spatial analysis of plant genetic resources data: 1. DIVA-GIS. Plant Genet Resour Newsl 127: 15-19.

Kitamura S, Mutata G, Hori M. 1975. Coloured illustrations of herbaceous plants of Japan (Sympetalae). Osaka: Hoikusha. 297 p.

Klooster MR, Culley TM. 2009. Comparative analysis of the reproductive ecology of Monotropa and Monotropsis: Two mycoheterotrophic genera in the Monotropoideae (Ericaceae). Am J Bot 96 (7): 13371347.

Krivtsov V, Bezginova T, Salmond R, Liddell K, Garside A, Thompson J, Palfreyman JW, Staines HJ, Brendler A, Griffiths B, Watling R. 2006.

Ecological interactions between fungi, other biota and forest litter composition in a unique Scottish woodland. Forestry 79 (2): 201-216.

Kuemmerle T, Perzanowski K, Chaskovskyy O, Ostapowicz L, Halada L, Bashta A-T, Kruhlov I, Hostert P, Waller DM, Radeloff VC. 2010.

European Bison habitat in the Carpathian Mountains. Biol Conserv 143: 908-916.

Leake JR. 1994. Tansley Review No. 69. The Biology of MycoHeterotrophic ('Saprophytic') Plants. New Phytol 127 (2): 171-216.

Maheshwari JK. 1969. The need for Conservation of Flora and Floral Provinces in South East Asia. In: Holloway CW (ed.) Papers and Proceedings: Eleventh technical meeting, Third Session: Survival Service Commission: Problems of Threatened Species. IUCN Publications new series No. 18, New Delhi, India.

Matsuda Y, Okochi S, Katayama T, Yamada A, Ito S-I. 2011. Mycorrhizal fungi associated with Monotropastrum humile (Ericaceae) in central Japan. Mycorrhiza 21: 569-576.

Matsuda Y, Yamada A. 2003. Mycorrhizal morphology of Monotropastrum humile collected from six different forests in central Japan. Mycol 95: 993-997.

Min S, Chang-Qin Z, Yong-Peng M, Welti S, Moreau P-A, Selosse M-A. 2012. Mycorrhizal features and fungal partners of four mycoheterotrophic Monotropoideae (Ericaceae) species from Yunnan, China. Symbiosis. DOI: 10.1007/s13199-012-0180-4 Mir AH, Upadhaya K, Choudhury H. 2014. Diversity of endemic and threatened ethnomedicinal plant species in Meghalaya, North-East India. Int Res J Environ Sci 3 (12): 64-78.

Neyland R, Hennigan MK. 2004. A Cladistic Analysis of Monotropa uniflora (Ericaceae) Inferred from Large Ribosomal Subunit (26S) rRNA Gene Sequences. Castanea 69 (4):265-271.

Nix H. 1986. A biogeographic analysis of Australian elapid snakes. Atlas of Elapid Snakes of Australia. Australian Government Publishing Service, Canberra, Australia.

Pawar S, Koo MS, Kelley C, Ahmed MF, Chaudhuri S, Sarkar S. 2007.

Conservation assessment and prioritization of areas in Northeast India: Priorities for amphibians and reptiles. Biol Conserv 136: 346361.

Pearce J, Ferrier S. 2000. Evaluating the predictive performance of habitat models developed using logistic regression. Ecol Model 133 (3): 225245.

Phillips SJ, Anderson RP, Schapire RE. 2006. Maximum entropy modeling of species geographic distributions. Ecol Model 190 (3-4): 231-259.

PRADHAN â&#x20AC;&#x201C; Potential distribution of Monotropa uniflora in South Asia Phillips SJ, DudĂ­k M. 2008. Modeling of species distributions with Maxent: new extensions and a comprehensive evaluation. Ecography 31: 161-175.

Saatchi S, Buermann W, ter Steege H, Mori S, Smith TB. 2008. Modeling distribution of Amazonian tree species and diversity using remote sensing measurements. Remote Sens Environ 112: 2000-2017.

Semwal KC, Stephenson SL, Bhatt VK, Bhatt RP. 2014 - Edible mushrooms of the Northwestern Himalaya, India: a study of indigenous knowledge, distribution and diversity. Mycosphere 5 (3): 440-461.

Singh MP, Singh BS, Dey S. 2002. Plant Biodiversity and Taxonomy.

Daya Publishing House, New Delhi, India.

Taylor DL, Barrett CF, Beatty GE, Hopkins SE, Kennedy AH, Klooster MR. 2013. Progress and Prospects for the Ecological Genetics of Mycoheterotrophs. In: Merckx VSFT (ed.). Mycoheterotrophy: The Biology of Plants Living on Fungi. Springer Science and Business Media, New York.

Tsukaya H, Yokoyama J, Imaichi R, Ohba H. 2008. Taxonomic status of Monotropastrum humile, with special reference to M. humile var.

115

glaberrimum (Ericaceae, Monotropoideae). J Plant Res 121 (3): 271278.

Wallace GD. 1975. Studies of the Monotropoideae (Ericaceae): taxonomy and distribution. Wasmann J Biol 33: 1-88.

WBBB [West Bengal Biodiversity Board] 2012. Threatened Plants of West Bengal. Official database of West Bengal Biodiversity Board, Department of Environment Government of West Bengal, India, www.wbbb.nic.in.

Young BW, Massicotte HB, Tackaberry LE, Baldwin QF, Egger KN. 2002. Monotropa uniflora: Morphological and molecular assessment of mycorrhizae retrieved from sites in the Sub-Boreal Spruce biogeoclimatic zone in central British Columbia. Mycorrhiza 12: 7582.

Zaniewski AE, Lehmann A, Overton McC J. 2002. Predicting species spatial distributions using presence-only data: a case study of native New Zealand ferns. Ecol Model 157: 261-280.

B I O D I V E R S IT A S Volume 16, Number 2, October 2015 Pages: 116-120

ISSN: 1412-033X E-ISSN: 2085-4722 DOI: 10.13057/biodiv/d160202

Short Communication: A new record of plant parasitic green algae, Cephaleuros diffusus (Trentepohliaceae, Chlorophyta), on Acacia auriculiformis hosts in Thailand ANURAG SUNPAPAO♥, MUTIARA K. PITALOKA Department of Pest Management, Faculty of Natural Resources, Prince of Songkla University. Hatyai, Songkhla, 90110 Thailand. Tel. +66-7428-6108, Fax. +66-7428-8806, email: anurag.su@psu.ac.th,  mutiarakp@gmail.com Manuscript received: 12 January 2015. Revision accepted: 13 May 2015.

Abstract. Sunpapao A, Pitaloka MK. 2015. A new record of plant parasitic green algae, Cephaleuros diffusus (Trentepohliaceae, Chlorophyta), on Acacia auriculiformis hosts in Thailand. Biodiversitas 16: 116-120. Cephaleuros diffusus algae were found to cause leaf spot disease of the host Acacia auriculiformis. The identification was based on morphological and molecular properties. The observed morphology identified the algae as C. diffusus. Transverse sections of the host leaves were used to quantify the disease severity of the host in terms of a four-point necrosis index. The host’s lesions were subcuticular and subepidermal on the upper leaf surfaces. The identification of the algae was confirmed from molecular analysis, and a phylogenetic tree distinguished our samples from other Cephaleuros species. This is the first report of C. diffusus on Acacia auriculiformis in Thailand.

Key words: Cephaleuros, disease severity, morphology, necrosis, phylogenetic analysis

INTRODUCTION The algae in the order Trenthepohliales are subaerial green algae, which are widespread and of diverse forms and habits in the tropical and the subtropical regions. This order is represented by the single family Trenthepohliaceae, which includes six genera: Cephaleuros Kunze, Phycopeltis Millardet, Physolinum Printz, Stomatochroon Palm, Printzina Thompson & Wujek, and Trentepohlia Mauritius. Among these, Cephaleuros is the most common and widespread algae found on vascular plants as well as on several economically important plants (Lopez-Bautista et al. 2002).

In most cases Cephaleuros is mistaken for a fungus, because the symptoms show erect, yellow to red filaments and hairs like a fruiting body that is raised on the leaf surface, which matches the characteristics of rust fungi (Marlatt and Alfieri 1981). The identification of Cephaleuros can be based on morphological characteristics, although they do not provide definitive separation to distinguish between the species. Cephaleuros grow in the subcuticular, subepidermal and intramatical leaf tissues, and necrosis is found beneath the alga thallus infection (Thompson and Wujek 1997). Thompson and Wujek (1997) concluded that the features most valuable in determining the species are: (i) thallus growth habit, (ii) manner of bearing head cell or sporangiate laterals, and (iii) the kinds of lesions produced.

To confirm identification based on such features, molecular characterization is needed. However, pathogenicity tests of Cephaleuros as a plant pathogen have not been completed, probably due to the difficulties with producing zoospores

for reinoculation on synthetic media (Chapman and Good 1983; Holcomb et al. 1998).

Acacia (Acacia auriculiformis) is a woody plant of the genus Acacia, originally from Australia, and spread to several countries including Thailand (Midgley 2007). This woody plant is now mostly found in commercial plantations in Southeast Asia. In Thailand acacia is also common in the wild, and is planted on the road sides to provide shade. The tropical regions where acacia is found are also in the spread range of Cephaleuros. The first report of Cephaleuros on acacia (Marlatt and Alfieri 1981) did not provide a specific species description. Furthermore, various pathological and physiological problems associated with a parasitic Cephaleuros infection still need confirming. Altogether, there is little prior research on the identification of Cephaleuros in Thailand. Therefore, the aim of this research was to characterize the Cephaleuros species on acacia in Thailand, based both on morphology and on molecular properties, and to estimate the disease severity in the acacia hosts using a necrosis index.

Materials and Methods Sample collection and morphological identification Algae: Cephaleuros sp., host: acacia (Acacia auriculiformis); locality: Pest Management field, Prince of Songkla University, Songkhla Thailand; collection: Dec 12, 2013, by Mutiara K. Pitaloka (PSU-A15). Macroscopic features of the parasitic algae were measured under a stereo microscope. The samples were prepared by hand sectioning, a piece of thallus was peeled from the leaf to observe the morphological characters of the thallus and

SUNPAPAO & PITALOKA – Cephaleuros diffusus in Thailand

sporangiophores. Fresh thalli which producing gametangia or sporangia were placed on a drop of sterile water on a glass slide to observe the gametes and zoospore. All of the morphological characteristics were characterized under a light compound microscope. The identification based on morphological characteristics was referred to the descriptions in a monograph by Thompson and Wujek (1997). Specimens were deposited in the Culture Collection of the Pest Management Department, Prince of Songkla University, Thailand.

Algal culture and isolation Algal thalli were isolated from the leaves and cultured on Bold’s basal medium (BBM) (Bischoff and Bold 1963; Andersen 2005). The isolation method followed Suto and Ohtani (2011) with some adaptations. Leaves with fresh thalli were washed under running water for five minutes and soaked in water for one hour, wiped with cotton wool, dipped in 70% ethanol, and rinsed with sterile water three times. For isolation, a small pieced of thalli was peeled from the leaf surface and placed on agar medium.

DNA extraction, PCR amplification and DNA sequencing The filament-like colonies were harvested from BBM and subjected to DNA extraction by the CTAB method.

The amplification of 18s nuclear small subunit rDNA (18s nsu rDNA) by PCR used universal primers PNS1-forward (5’ CCAAGCTTGAATTCGTAGTCATATGCTTGTC 3’) (Hibbett 1996) and NS41-reverse (5’ CCCG TGTTGAGTCAAATTA 3’). The PCR reaction mixture had a final 50 L reaction volume containing 10 pmol of each primer, 2x DreamTaq Green PCR Master Mix (Thermo Scientific), and 50 ng of template DNA. The amplification was carried out in a BIO-RAD T100TM Thermal Cycler (Bio-Rad, Hercules, CA, USA) with the following program: one cycle of denaturation step for 3 min at 95C; 35 cycles of denaturation for 30 s at 95C, annealing for 30 s at 50C, and extension for 1 min at 72C; followed by the final extension step of 10 min at 72C. The PCR products were visualized by agarose gel electrophoresis. The PCR products of 18s rDNA portion were sequenced at the Scientific Equipment Center, Prince of Songkla University, Songkhla, Thailand, by automated DNA sequencing with ABI Prism 377 (Applied Biosystems, USA), using the same primers used in the PCR reaction. The sequences obtained were compared with known sequences of Cephaleuros available in GenBank (The National Center of Biological Information, USA) by using BLAST search. Phylogenetic and molecular evolutionary analyses sequence query results were conducted using CLUSTAL W and the software package MEGA6.

Disease severity A four-point necrosis index (Brooks 2004) was used to assess the disease severity in the acacia hosts of the parasitic algae. The index labeling criteria were: (0) No necrosis, (1) superficial necrosis of the cell layer beneath the algae thallus, with or without tissue hyperplasia, (2) necrosis of > 1 cell layer but not full leaf thickness, with or

117

without tissue hyperplasia, erosion, or suberin formation, and (3) necrosis from upper to lower leaf surface, including “shot hole” symptoms.

Results and Discussion To characterize the algal leaf spot disease causal organism, infected samples were collected. The most obvious symptom was orange tufts found on the upper leaf surfaces, constituting thalli of the green alga. Lesions were raised spots with no discoloration around the spot on the upper leaf surface (Figures 1.A and 1.B). The epidermal cells and palisade cells were necrotic, being brown to dark brown beneath the thalli (Figures 1.G and 1.H). The thalli growth was subcuticular and subepidermal on the upper leaf surfaces, with open narrow filaments. The radial extension of the thalli ranged from random to periodic structures, with equal dichotomy of the marginal apical cell. Filamentous-like ramuli were compacted, raising a thin layer on the upper leaf surface of 1-5 mm diameter.

The filamentous cells ranged from short cylindrical to irregularly shaped, 7.5-42.5 µm long and 5-17.5 µm wide (Figure 1.D). The width to length ratio (W/L) was 1-6, and as the irregular and open filamentous growth becomes congested, the larger cells extended from the filament, while the small cells raised the setae, sporangiophores, or initial gamentangia. Some of the small cells produced a small, dense, irregularly shaped expanse by close dichotomies, which raised one to two celled setae. The setae grew from short cylindrical filaments, one to five celled, 16.5-280 µm long and 5-7.5 µm wide.

Gamentangia were spherical in shape, dark orange, developed in a cluster of 3-7 cells, 12.5-32.5 µm long and 12.5-22.5 µm wide (Figure 1.C). Gametes were obbiconic to spherical, 5-10 µm long and 5-7.5 µm wide, with biflagella 15-20 long. Zoospores were obovoid and some had a bullet shape, 10-16.25 µm long and 5-8.75 µm wide with biflagella 15-25 µm long (Figure 1.F). The sporangiophores were sparsely produced on the upper leaf surface, being cylindrical, erect, solitary or in a tuff of three or more, 250-440 µm long and 10-12.5 µm wide (Figure 1.E). Three to five of head cells developed terminally on the sporangiophores bearing two to four sporangia laterally, with both sporangia and their sulfutory cells. The sporangia were spherical to elliptical, 12.5-27.5 µm long and 10-20 µm wide, yellow to dark orange. Based on the key species referred to in the monograph of Thompson and Wujek (1997), the fifteen collected algal samples were identified as Cephaleuros diffusus.

A Cephaleuros species with a wide range of hosts is C. virescens. In this study, we compared C. virescens to C. diffusus, and their distinguishing characteristics are summarized in Table 1. The thalli of C. diffusus formed raised spots, whereas C. virescens forms circular discs without gaps crenate or entire margin. The thallus growth habit of C. diffusus was open and filamentous, whereas for C. virescens this is pseudoparenchymatous. Both species bear head cells terminally.

B I O D I V E R S IT A S 16 (2): 116-120, October 2015

118

B

A

D

C

E

F

H

G

Figure 1. A. Lesions with C. diffusus parasitic algae on an acacia leaf, B. Thalli on the leaf surface, C. Clusters of gametangia (arrows) along with sporangiophores (Sp) and setae (Se), D. Filaments of C. diffusus with radial expansion, E. Sporangiophores terminally bearing the head cell (Hc) with suffultory cells (Sc) and sporangia (S), F. Zoospores with biflagella (arrows), G. Transverse section of C. diffusus showing thallus growth through to leaf tissue causing necrosis of cuticle and epidermis and of some palisade cells, H. Necrosis on the leaf tissue and protective corky tissue (arrows), Cu: cuticle, Ep: epidermal, Pm: palisade mesophyll, Th: thallus, Ga: gametangia.

To estimate disease severity, assessment on a four-point necrosis index was conducted. Ten transverse leaf sections from different plants were observed. The thalli grew subcuticularly and subepidermally through the leaf tissue, and some thalli colonized beneath the cuticle. Necrosis caused by Cephaleuros only occurred beneath of the thalli,

while some lesions showed tissue hyperplasia without any necrosis. Due to these observed symptom characteristics, the necrosis index of a leaf was scored as 2 with necrosis of > 1 cell layer but not of full leaf thickness, with or without tissue hyperplasia, erosion, or suberin formation.

SUNPAPAO & PITALOKA – Cephaleuros diffusus in Thailand

119

Figure 2. A phylogenetic tree showing genotypic comparison of a current Cephaleuros diffusus (PSU-A15) sample with highly sequence-similar species from GeneBank, using segments of 18s rDNA. The bootstrap values are shown on the branches, and the GenBank accession numbers are shown in parentheses. The comparison indicates that the PSU-A15 sample represents Cephaleuros, as a species distinct from C. virescens and C. parasiticus.

Table 1. Characteristics for distinguishing between Cephaleuros diffusus (PSU-A15) and C. virescens, based on phenotype and behavior.

Characters Host Thalli

Filamentous cells

Setae Gametangia Gametes Sporangiophores Sporangia Zoospores Lesions

Shape Diameter (mm) Growth habit Shape Length  width (µm) L/W ratio Branching manner Shape Shape Length  width (µm) Shape Length  width (µm) Head cell placement Shape Length  width (µm) Shape Length  width (µm) Discoloration

Cephaleuros diffusus (PSU-A15) Acacia auriculiformis Raised spot 1-5 Open filamentous Short cylindrical to irregular 7.5-42.5  5-17.5 1-6 Dichotomous Cylindrical filament Spherical 12.5-32.5  12.5-22.5 Obbiconic to spherical 250-440  10-12.5 Terminally Spherical to elliptical 12.5-27.5  10-20 Obovoid 10-16.25  5-8.75 Absent

The Cephaleuros species are known as plant parasitic algae on several woody plants, attacking leaves, branches, stems, or fruit of the plant. The Cephaleuros on acacia has been recorded in Florida (Marlatt and Alfieri 1981), although while the samples were described as Cephaleuros no taxonomy of the genus was reported. Those samples were reported as Cephaleuros sp. on Acacia auriculiformis.

However, in this current study, we describe the species of

Cephaleuros virescens (Suto and Ohtani 2009) Magnolia grandiflora & Persea thunbergii Circular disk, without gaps, crenate or entire margin 1-8 Pseudoparenchymatous Long cylindrical 22-79  7-24 2.7-4.4 Equal dichotomy 1) Slender filament; 2) short bunt tipped filament Spherical or elliptical 29-58  18-43 Ellipsoidal to fusiform 70-240  12-14 Terminally Elliptical 17-27  15-21 Ellipsoidal to broad fusiform 7-11  4.5-6.5 Absent

Cephaleuros found on the leaves of acacia and identified as C. diffusus.

Thompson and Wujek (1997) concluded that the morphological features most valuable for determining the species of Cephaleuros are the thallus growth habit, the manner of bearing the head cell or sporangia laterally, and the kind of lesion produced. However, they stated that the dimensions of filamentous cell, gametangium, were not always definitive, and the color of algae is unhelpful in

120

B I O D I V E R S IT A S 16 (2): 116-120, October 2015

identification since it varies with exposure. This makes phenotypic identification ambiguous because the characteristics simply are not definitively distinctive in general. Therefore, genotypic observations combined with phylogenetic analysis are important for confidence in the species identification. One colony sample of C. diffusus was harvested from BBM and subjected to DNA extraction, PCR amplification and DNA sequencing.

BLAST searches in GenBank indicated that the present algae were similar to and grouped along with Cephaleuros.

The sequence of the PCR product was deposited in the GenBank database with accession number AB972267. A phylogenetic tree from neighbor joining analysis shows that C. diffusus (PSU-A15) is closely related to Cephaleuros, and well separated from C. virescens and C. parasiticus (Figure 2). This corroborates the tentative identification from morphological observations with a genomics based identification that we consider definitive.

The current research is the first to definitively associate C. diffusus with algal leaf spot on acacia in Thailand. This report constitutes a new record of occurrence, symptomatology, morphology and molecular characterization of C. diffusus associated with algal leaf spot disease on acacia.

ACKNOWLEDGEMENTS The authors would like to thank the Center of Excellence in the Agricultural and Natural Resources Biotechnology (CoE-ANRB), the Faculty of Natural Resources, Prince of Songkla University, Songkla, Thailand for funding and facilities. The copy-editing service of RDO/PSU and the helpful comments of Dr. Seppo Karrila are gratefully acknowledged.

REFERENCES Andersen RA (ed). 2005. Algal culturing techniques, Elsvier Academic Press, London.

Bischoff HW, Bold HC 1963. Phycological studies. IV. Some Soil Algae from Enchanted Rock and Related Algal Species. University of Texas Publication, Dallas, TX. Brooks FE. 2004. Plant-parasitic algae (Chlorophyta: Trentepohliales) in American Samoa. Pacific Sci., 58(3): 419-428.

Chapman RL, Good BH. 1983. Subaerial symbiotic green algae.

Interactions with vascular plant hosts. (pp. 173-204) in Goff, L.J. (ed.)

Algal symbiosis: A continuum of interaction strategies. Cambridge University Press, Cambridge.

Hibbett DS. 1996. Phylogenetic evidence for horizontal transmission of group I introns in the nuclear ribosomal DNA of mushroom-forming fungi. Mol Biol Evol 13: 903-917.

Holcomb GE, Van SR, Buckley JB. 1998. First report of Cephaleuros virescens in Arkansas and its occurrence on cultivated blackberry in Arkansas and Louisiana. Plant Dis 82: 263.

Lopez-Bautista JM, Waters, DA, Chapman, RL. 2002. The Trentepohlliales Revisited. Constancea, 83, 2002. University and Japson Herbaria, P.C. Silva Festschrift. (http://ucjeps.berkeley.edu/constancea/83/lopez_etal/trentepohliales.html) Marlatt RB, Alfieri SA. 1981. Host of Cephaleuros, a parasitic alga in Florida. Proc Florida State Hort Soc 94: 311-317.

Midgley S. 2007. Tropical acacias: Their domestication and contribution to Asiaâ&#x20AC;&#x2122;s wood and pulp Industries. Numero Extraordinario 1: 103120.

Suto Y, Ohtani S. 2009. Morphology and taxonomy of five Cephaleuros species (Trentepohliaceae, Chlorophyta) from Japan, including three new species. Phycologia 48 (4): 213-236.

Suto Y, Ohtani S. 2011. Morphological features and chromosome numbers in cultures of five Cephaleuros species (Trentepohliaceae, Chlorophyta) from Japan. Phycol Res 59: 42-51.

Thompson RH, Wujek DE. 1997. Trentepohlliales Cephaleuros Phycopeltis and Stomatochroon, Morphology, Taxonomy and Ecology. 1st ed. Enfield Publishing and Distribution, USA.

B I O D I V E R S IT A S Volume 16, Number 2, October 2015 Pages: 121-127

ISSN: 1412-033X E-ISSN: 2085-4722 DOI: 10.13057/biodiv/d160203

Short Communication: Traditional dye yielding plants of Tripura, Northeast India BISWAJIT SUTRADHAR1, DIPANKAR DEB2,ď&#x201A;Š, KOUSHIK MAJUMDAR1, B.K. DATTA1 1

Plant Taxonomy and Biodiversity Laboratory, Department of Botany, Tripura University (A Central University), Suryamaninagar 799022, Tripura, India 2 Agroforestry and Forest Ecology Laboratory, Department of Forestry and Biodiversity, Tripura University (A Central University), Suryamaninagar 799022, Tripura, India. Tel. 0381-237-9093, Fax. 0381-237-4807, ď&#x201A;Še-mail: debdip23@gmail.com Manuscript received 27 October 2014. Revision accepted: 14 May 2015.

Abstract. Sutradhar B, Deb D, Majumdar K, Datta BK. 2015. Traditional dye yielding plants of Tripura, Northeast India. Biodiversitas 16: 121-127. This present paper deals with the survey of traditional dye yielding plants, their ethnobotanical usage and cultural practices by the different ethnic communities of Tripura. Field investigation was carried out in different villages and adjacent forest pockets in South and West district of the State. The ethnobotanical information was collected based on semi-structured questioner, personal interviews and group discussion among the major ethnic communities of Tripura. The study reports a checklist of 39 species of dye yielding plants belonging to 35 genera and 26 families documented along with their vernacular name, habit, parts use. The active coloring agents were also listed for each plant based on earlier reports. Natural dye yielding plants have immense significance in the socio-economic and socio-cultural life of indigenous ethnic people and if we promote these products in a managed way then efforts towards preservation of traditional knowledge and local biodiversity will be more fruitfully achieved.

Keywords: Dye yielding plants, indigenous knowledge, natural products, Tripura

INTRODUCTION The relation between man and plants originated with the prehistoric human civilization with early human Neanderthals to modern human civilization. The plants are used not only for maintaining the basic life sustaining needs like food, fuel, shelter, but also for making clothes and natural dye to fabric clothes (Das and Mondol 2012).

Natural dyes occupy an important place in human culture and dye yielding plants were probably discovered early through human curiosity, use, reuse and trials (Canon and Cannon 2003; Dogan et al. 2008).

The first report of natural dye extraction from plant sources dates back to around 2600 BC in China. The Indus valley civilization at Mahenjo-Daro and Harappa (3500 BC) traces of dyeing garments with natural madder (Siva 2007). According to Dogan et al 2008, the use of natural dye stuff in by Phoenicians, Hebrews and Venetians was also started from the beginning of 13th century (Dogan et al. 2008). Later the technology passed across regions and cultures like Greeks, Romans, old world Africans, Mexicans and was also evident in Peru (TRMIC 1991; Dogan et al. 2008). According to Zohary and Hopf (1994), dye yielding plants have been cultivated in southwest Asia since ancient times and earliest persisting indication of textile dyeing comes from an over 5,000-year-old piece of cloth dyed with natural madder (Rubia cordifolia) discovered at Mohenjo-Daro (Singh 2002; Mahanta and Tiwari 2005; Das and Mondol 2012). Natural dyes are colorants derived from plants, invertebrates or minerals, while majority of natural dyes are extracted from vegetable or plant sources like roots, berries, bark,

leaves, wood and other biological sources such as fungi and lichens.

The use of natural dyes has been declining since the discovery of synthetic dyes (Singh 2002). However, many studies have found that synthetic dyes are harmful to human health as well as environment (Kwok et al. 1999; Singh and Singh 2002; Cristea et al. 2003; Mahanta and Tiwari 2005; Seker et al. 2006). Natural dyes are environment and skin friendly; for example, turmeric, the brightest of naturally occurring yellow dye is a powerful antiseptic and revitalizes the skin, while indigo yields a cooling sensation. Hence, there exist a significant justification for the application and promotion of natural dyes as they are harmless both for human and environment (Hartl and Vogl 2003; Kumar and Sinha 2004; Kim and Park 2007). The present study is a comprehensive account of dye yielding plants of Tripura and gathers information on traditional knowledge system of extraction and use of natural dyes by the local ethnic people. Consequently, the study is an attempt to overcome the paucity of documentation of dye plants and to create baseline information on the natural sources of plant based dye.

The significant research on ethnobotany has created a mass awareness among the scientists in India during the last two decades (Rashid 2013). A number of publications have come from different regions of India including the north eastern states related to the traditional health care practices, wild edible plants, ethnoveterinary plants and fiber plants (Borthakur 1976; Tiwary et al. 1978, 1979; Bhattacharjee et al. 1980; Baruah and Sharma 1984; Mahanta and Tiwari 2005; Sawian et al. 2007; Jamir 2008; Kar and Borthakur 2007). In north eastern states some

122

B I O D I V E R S IT A S 16 (2): 121-127, Ocotober 2015

pioneer workers have made a brief note on dye plants (Akimpou et al. 2005; Kar and Borthakur 2007).

Ethnobotanically Tripura has quiet lagged behind rest of India (Deb et al. 2012). However, few workers have made a concise note on traditional ethno medicine and wild edible plants (Deb 1968; Singh 1997; Majumdar and Datta 2007; Das 2009; Roy 2010; Sen et al. 2011, Deb et al 2012). But, none of the workers have made a detailed note of customary dye yielding plants of Tripura used by the ethnic peoples of the state and therefore this is the first such study.

Materials and Methods Study area Tripura is one of the seven states in the north eastern part of India with a geographical area of 10, 491 sq Km. It is located in the south west extreme corner of the north eastern region, between 22° 57' to 24° 33' N latitude and 97° 10' to 92° 20' E longitude (Figure 1). The state is situated between river valley of Myanmar and Bangladesh on the north, west, south and southeast; in the east it has a common boundary with states of Assam and Mizoram.

Tripura is a land locked state and its geographical limits touch both national and international boundary lines.

International boundary with Bangladesh measures 839 km.

Its national boundary with Assam and Mizoram measures 53 km and 109 km respectively. The average minimum temperature is 15°C and maximum temperature is 34°C. The average annual rain fall in the state is 2024.4 mm.

Figure 1. Study site in the State of Tripura, India

The major part of the State is covered by dense forests in which various ethnic groups live close to the forest and are largely dependent on the wild biological resources for their livelihood. The ethnic groups inhabiting different areas of the state have indigenous knowledge systems and have evolved methods for utilizing the vast plant resources available. Floral diversity is the main source of raw materials being used traditionally by the indigenous people of Tripura state as food supplements and for fodder, fibers, construction, handicrafts, beverages, coloring agents (dyes) and more importantly in health care practices. Their knowledge in utilizing these resources is characteristic and differs from community to community.

Field survey Field investigations were conducted during the year 2013-2014 as per well planned schedule and rich pocket of tribal areas were visited for documentation of dye yielding plants. Survey was done by standard procedure (Jain and Rao 1977), through a questionnaire and group discussion with the community heads, old people, women and also village local market (Rao and Hazra 1994). The specimens were collected from the adjacent forest area with the help of local informant. The plant specimens were made into herbarium following the standard herbarium techniques.

Herbarium specimens were identified with the help of Flora of Tripura State (Deb 1983). The reference specimens were deposited in the herbarium of Department of Botany, Tripura University, India.

B I O D I V E R S IT A S Volume 16, Number 2, October 2015 Pages: 121-127

ISSN: 1412-033X E-ISSN: 2085-4722 DOI: 10.13057/biodiv/d160203

Table 1. Traditional dye yielding plants of Tripura, India Scientific name

Family

Local name

Adhatoda vasica (L) Nees.

Acanthaceae

Basak

Alpinia galanga (L) Willd.

Zingiberaceae

Areca catechu Linn.

Arecaceae

Basella alba Linn.

Bauhinia variegata Linn.

Bauhinia purpurea Linn.

Basellaceae Fabaceae Fabaceae

Bixa orellana Linn.

Part used Leaves

Dye color

Dye uses for

Active coloring agent

Yellow

Cotton

Telbanok juknai Root stalk sam (Kok) Supari, Gua Seed

Yellowish green Red color

Cotton, wool

Adhatodic acid, carotein, lutolin, quercetin (Singh et al.

2011) Galangin (Chudiwal et al. 2010)

Cotton

Gallotannic acid (Amudhan et al. 2012)

Fruit Petal Petal

Violet Silk and cotton, food coloring Light pink Cotton Pink Cotton and silk

Gomphrenin-I (Kumar et al. 2013) Anthocyanin (Jash et al. 2014) Chalcone, butein (Gokhle et al. 2004)

Bixaceae

Muifrai (Kok) Kanchan (Beng) Goondilata (Kok) Powassi

Seed

Wool and cotton

Bixin, orellin, beta-carotene (Siva 2007)

Butea monosperma (Lam.) Taub.

Camellia sinensis Linn.

Celosia argentea Linn.

Clerodendrum philippinum Schau.

Clitoria ternatea Linn.

Curcuma domestica Valeton.

Fabaceae

Jong-obi (Kok) Petal

Orange/ Red Orange

Theaceae Amaranthaceae Verbenaceae

Cha Sweet murga Not known

Black Red color Green

Orange dye, which is used for coloring the clothes and other decorative purposes Fishing net, cotton, rope Wool and cotton Silk and cotton

Fabaceae Zingiberaceae

Aparajita (Beng) Flower Haldi Rhizome

Blue Yellow

Butein, butin, isobutrin, coreopsin, isocoreopsin (Sindhia and Bairwa 2010) Phenolic compound, flavonoids (Reto et al. 2007) Betalains pigment (Patel et al. 2010) Phenolic compound (Tiwary and Bharat 2008; Venkatanarasimman et al. 2012) Anthocyanin pigment ternatin (Kazuma et al. 2003) Curcuminoids, curcumin (Revathy et al. 2011)

Curcuma zedoaria Roxb.

Zingiberaceae

Halka

Yellow

Cuscuta reflexa Roxb.

Diospyros peregrina GĂźrke.

Convolvulaceae Ebenaceae

Jirai (Kokborok) Whole plant Yellow Makur (Kok) Fruit Black

Duranta repens Linn.

Verbenaceae

Ban mehendi

Eclipta prostrata Linn.

Asteraceae

Hibiscus rosa sinensis Linn.

Malvaceae

Indigofera tinctoria Linn.

Fabaceae

Erythrina variegate Roxb.

Fabaceae

Leaves Flower Leaves

Rhizome

Wool, cotton, silk Wool, silk and cotton and also a food colorant For the production of Abir powder used in Holi Silk and cotton Fishing net, cotton

Curcumin, arabins and albuminoids (Hamdi et al. 2014)

Leaves/ Seed Manathingsabup Leaves hang (Kok) Jaba Flower petal Nil Green crop

Green/ Orange Black

Cuscutin, quercetin, coumarin (Ramya et al. 2010) Triterpenes, B-sitosterol, betulin, gallic acid (Sinha and Bansal 2008) Silk, cotton and for palm staining of girls Durantosides, c-alkylated flavonoids (Ahmed et al.

2009) Hair blackening and cotton Phenols, coumarins, flavones (Lee et al. 2008)

Red

Wool and cotton

Blue

Silk, wool cotton

Mandar (Beng)

Red

Wool and cotton

Flower

Anthocyanidins, isoflavanol, flavone (Kumar and Singh 2012) Indigotin (Saraswathi et al. 2012) Anthocyanin and betalains pigment (Subhashini et al.

2011)

B I O D I V E R S IT A S 16 (2): 121-127, Ocotober 2015

124

Lawsonia inermis Linn.

Lythraceae

Mehendi

Leaves

Mallotus philippensis (Lam.) Muell. Arg.

Euphorbiaceae

Khurchub (Kok) Seed

Yellow red The dye obtained from macerated or Lawsone (Musa and Gasmelseed 2012) powdered leaves stains skin. Leaves also used for coloring skins, Leather, silk and wool..

Red Silk, cotton, wool Rottlerin, isorottlerin (Sharma and Varma 2011)

Melastoma malabathricum Linn.

Melia azedarach Linn.

Morinda tinctoria Roxb.

Melastomataceae Phutki, Ban Stem/ Seed Red/ Black Cotton and wool padam Meliaceae Ghora neem Leaves Blue Cotton Rubiaceae Haldiruk (Kok) Root Red The dye is used for coloring cotton cloth & other printing materials.

Musa acuminata Colla Musaceae Thailic Pseudostem Black The sap is used for coloring traditional (Kok) attire Nyctanthes arbor-tristis Linn. Nyctanthaceae Hengra Flower tube Orange The dye is used for coloring silk; also (Kok) useful in printing purposes.

Parkia javanica Merr.

Fabaceae Kuki Tetai Fruit peel Brown/ Silk and cotton Black Phyllanthus emblica Linn.

Phyllanthaceae Amla Bark/ fruit Black Cotton, rope, silk (Kok/ Beng) Piper betle Linn.

Piperaceae Fatwi (Kok) Leaves Red brown Cotton Psidium guajava Linn.

Myrtaceae

Gayam

Fruit

Yellow red Silk and cotton

Rubia cordifolia Linn.

Rubiaceae

Fruit

Red

Solanum nigrum Linn.

Solanaceae

Manjistha (Beng) Rummunta (Halam) Not known

Terminalia arjuna (Roxb.) White & Arn. Terminalia belerica Roxb.

Combretaceae

Arjun

Brown black Leaves/ Black & young buds blue Young Red leaves Fruit Brown

Combretaceae

Bahera

Fruit

Black

Silk and cotton

Terminalia chebula Retz.

Combretaceae

Bakhla (Kok)

Fruit

Black

Cotton

Strobilanthes cusia (Nees) O. Acanthaceae Kuntze.

Tectona grandis (Linn. f) Lamiaceae

Segun

Fruit

Wool, cotton and silk Cotton

Not known Catechin, quercetin (Sen and Batra 2012) Morindone (Shanthi et al. 2012) Not known Nyctanthin, carotenoids (Sah and Verma 2012) Carotenoids, flavonoids (Chanu et al. 2012) Flavonoids,kaempferol, ellagic acid and gallic acid (Habib-ur-Rehman et al. 2007) Piperitol, piperbetol, eugenol, piperol (Pradhan et al.

2013) Guajanoic acid,carotenoids, lectins, leucocyanidin (Kamath et al. 2008) Manjistin, Purpurin (Siddiqui et al. 2011)

Silk, cotton, wool

Gallic acid, catechin, caffeic acid, epicatechin, rutin, and niringenin (Gogoi and Islam 2012) Lupeol, betulin, lupenone, indigo, indirubin (Li et al.

1993) Tectoleafquinone (Khera and Bhargava 2013)

Wool and cotton

Arjunic acid (Burapadaja and Bunchoo 1995) Chebulaginic acid, gallic acid, ellagic acid (Meena et al.

2010) Chebulinic acid (Lee et al. 2006)

Silk and cotton

B I O D I V E R S IT A S SUTRADHAR et al. â&#x20AC;&#x201C; Dye yielding plants of Tripura, India Volume 16, Number 2, October 2015 Pages: 121-127

Results and Discussion The study elucidated the 39 dye yielding plants of Tripura which were traditionally used by the tribal of Tripura. Among these plants, many were common to all communities, and their uses were also almost same. The documented natural dye yielding plants with their vernacular name, part used, dye color, specific uses and coloring agent are listed in Table 1.

The listed plant species belong to 3 families of monocotyledons (12% species) and 23 families of dicotyledons (88% species). Among the monocotyledons, Zingiberaceae is represented by 3 species while Musaceae and Arecaceae are represented by single species each.

Among dicotyledons, 7 species (18%) are Fabaceae; 3 species (8%) Combretaceae followed by Acanthaceae, Rubiaceae and Verbenaceae with 2 species (5%) each.

Dyes were produced from different parts of the plants i.e. underground parts (root 5%, rhizome 5%), stem (4%), bark (3%), leaf (26%), flower (21%), fruit (26%), seeds (13%) or even whole plant (5%). More than 2 plant parts were used in7% species of documented plants.

The important dyes extracted from roots or rhizome include Alpinia galanga (L) Willd., Curcuma domestica Valeton., Curcuma zedoaria Roxb., Morinda tinctoria Roxb. Hort. Beng. Stem and bark is the important source of the species Melastoma malabathricum Linn., Phyllanthus emblica Linn. etc. Floral dyes includes Bauhinia variegata Linn., Bauhinia purpurea Linn., Butea monosperma, Celosia argentea Linn., Clitoria ternatea Linn., Hibiscus rosa sinensis Linn., Erythrina stricta Roxb., Nyctanthes arbor-tristis Linn. etc. Commonly used fruit dyes are obtained from Basella alba Linn., Diospyros peregrina GĂźrke., Parkia javanica Merr., Rubia cordifolia Linn., Solanum nigrum Linn., Terminalia belerica Roxb., Terminalia chebula Retz., Terminalia citrina (Gaertn.) Roxb but in some cases tender fruits of Psidium guajava Linn. is used for black coour. The leaf dyes are extracted from Adhatoda vasica (L) Nees., Camellia sinensis Linn., Clerodendrum philippinum Schau., Duranta repens Linn., Eclipta prostrata Linn., Lawsonia inermis Linn., Melia azedarach Linn., Piper betle Linn., Strobilanthes cusia (Nees) O. Kuntze., Tectona grandis (Linn. f) etc. Whole plant is used in case of Cuscuta reflexa Roxb. Green crop of Indigofera tinctoria Linn. is used while sap of pseudostem is used for Musa acuminata Colla.

Dyes extracted from the various plant parts are weak in nature and their permanency varies from plant to plant and traditional techniques of preparation. Use of multiple plants parts in a particular ratio may increase the longevity of dye.

Sometimes special techniques viz. heat and cold treatment may increase dye stability. The selection of plants also depends on the color choice, product type and purpose.

This present study recorded 14 different colors from 12 different plant parts, where black color was yielded by maximum number (26%) of plants. The ethnic communities used their own customary approach to extract and process the natural dye.

Ethnic communities used the dye yielding plants for various day to day activities like coloring food and clothes, making cosmetics and fashion jewelries. The dyes are

ISSN: 1412-033X 125 E-ISSN: 2085-4722 DOI: 10.13057/biodiv/d160203

colored compound capable of being fixed to fabrics which do not washout with soap and water or fade on exposure to light. For dyeing purposes, either fresh extract or paste form were best suited for the communities. Present record of 38 species was very high compared to 10 species reported from West Bengal (Das and Mondol 2012) and 15 species from Manipur (Akimpou 2005) and less than the documentation of 47 species from Assam (Kar and Borthakur 2007). However, documentation of 37 species from Arunachal Pradesh and 33 species from Central India (Tiwari and Bharat 2008) was quite similar to the present study. Thus, the study presents the potential resources of dye plants which have immense scope and small-scale industrial prospects. But the indigenous knowledge of processing and using the natural dyes from plants has to be valued and at the same time has to be upgraded or value added to incorporate with modern product generation.

In conclusion, the indigenous knowledge of extraction, processing and practice of using natural dyes has declined to a great extent among the new generation due to easy availability of cheap synthetic dyes and modern attitude and life style. It has been observed that the traditional knowledge of dye making is now practiced by older people only. Unfortunately, there is lack of fruitful attempts to promote and conserve this immense treasure of traditional knowledge. Typically, most commercial synthetic dyes are attractive in color and are easy and cheap to processes. But, material collection for preparation of natural dye is closely dependent on resource availability, seasons and proper traditional knowledge. Due to lack of precise technical knowledge on the extraction and dyeing procedure, the natural dyes could not compete with commercially successful synthetic dyes. The natural dyes obtained from plant sources are biodegradable and non-toxic. Indigenous traditional knowledge on dye yielding plants is very essential for community based development, future bio prospecting and eco-friendly products.

ACKNOWLEDGEMENTS The authors are grateful to Department of Biotechnology, Government of India for the financial assistance received through Bioresource network Project (No. BT/29/NE/2011). They also indebted to Mantosh Roy and Partha Das for field assistance. Special thanks are due to all the ethnic informants of different communities for their active participation and knowledge sharing during the field investigations.

REFERENCES Ahmed WS, Mohamed MA, El-Did RA, Hamed MM. 2009. New triterpene saponins from Duranta repens L. and their cytotoxic activity. Molecules 14:1952-1965.

Akimpou G, Rongmei K , Yadhava PS. 2005. Traditional dye yeilding plants of Manipur. Indian J Tradit Know 4 (1): 33-38.

Alawa KS, Ray S and Dubey A. 2013. Dye yielding plants used by tribals of Dhar district, Madhya Pradesh, India. Sci Res Rep 3: 30-32.

126

B I O D I V E R S IT A S 16 (2): 121-127, Ocotober 2015

Amudhan MS, Begum VH, Hebber KB. 2012. A review on phytochemical and pharmacological potential of Areca catechu L. seed. IJPSR 3: 4151-4157.

Baruah P, Sharma GC. 1984. Studies of the medicinal uses of plants by Boro tribe of Assam. J Eco Tax Bot 8: 599-604.

Bhattacharjee S, Tiwari KC, Majumder R, Misra AK. 1980. Folklore medicine from district Kamrup (Assam). Bull Medico-Ethnobot.

Res1:447-460.

Borthakur SK. 1976. Less known medicinal uses of plants among tribals of Mikir hills. Bull Bot Surv India 18: 166-171.

Burapadaja S, Bunchoo A. 1995. Antimicrobial activity of tannins from Terminalia citrina. Planta Medica 61: 365-6.

Cannon J, Cannon M. 2003. Dye Plants and Dyeing. Timber press in association with the Royal Botanic Gardens, Kew. Chanu KV, Ali M. Ayub and Kataria Meena. 2012. Antioxidant activities of two medicinal vegetables: Parkia javanica and Phlogacanthus thyrsiflorus. Int J Pharm Pharm Sci 4: 102-106.

Chudiwal AK, Jain DP, Somani RS. 2010. Alpinia galanga Willd. an overview on phyto-pharmacological properties. Indian J Nat Prod Resour 1: 143-149.

Cristea D, Bareau I, Vilarem G. 2003. Identification and quantitative HPLC analysis of the main flavonoids present in weld (Reseda luteola L.). Dyes Pigments 57: 267-272.

Das HB, Majumdar K, Datta BK, Ray D. 2009. Ethnobotanical uses of some plants by Tripuri and Reang tribes of Tripura. Nat Prod Rad 8 (2): 172-180.

Das PK, Mondal AK. 2012. The dye yielding plants used in traditional art of Patchitra in pingla and mat crafts in Sabang with prospecting proper medicinal value in the Paschim Medinipur District, West Bengal, India Int J Life Sci Bio Pharm 1: 158-171.

Deb D, Darlong L, Sarkar A, Roy M, Datta BK. 2012. Traditional ethnomedicinal plants use by the Darlong tribes in Tripura, Northeast India.

Int J Ayurved Herb Med 2 (6): 954-966.

Deb DB. 1968. Medicinal plants of Tripura State. Indian For 94 (10): 753765.

Deb DB. 1983. The Flora of Tripura State. Today & Tomorrows Printers & Publishers.

Dogan Y, Baslar S, Ozturk M, Mert HH. 2008. Plants used as dye sources. (eds. Peter KV) Underutilized and Underexploited Horticultural Crops 3:109-145. from district Tirap of Arunachal Pradesh. Ind J Pharm Sci 40: 206208.

Gogoi P, Islam M. 2012. Phytochemical screening of Solanum nigrum L and S. myriacanthus Dunal from Districts of Upper Assam, India.

OSR J Pharm 2: 55-459.

Gokhle SB, Tatiya AU, Bakliwal SR, Fursule RA. 2004. Natural dye yielding plants in India. Nat Prod Rad 3 (4): 228-234.

Habib-ur-Rehman, Yasin KA, Choudhury MA, Khaliq Naeelam, Atta-urRahaman, Choudhury MI, Malik Sahid. 2007. "Studies on the chemical constituents of Phyllanthus emblica. Nat Prod Res. 21: 77581.

Hamdi OAA, Rahaman SNSA, Awang K, Wahab NA, Looi CY, Thomas NF, Malek SNA. 2014. Cytotoxic Constituents from the Rhizomes of Curcuma zedoaria, The Scientific World J 2014 doi.

10.1155/2014/321943 Hartl A, Vogl CR. 2003. The potential use of organically grown dye plants in the organic textile industry: Experiences and results on cultivation and yields of dyers Chamomile (Anthemis tinctoria L.), dyers Knotweed (Polygonum tinctorium Ait.), and Weld (Reseda luteola L.). J Sustainable Agric 23: 17-40.

Jain SK, Rao RR. 1977. A handbook of field and herbarium methods.

Today & Tomorrows Printers & Publishers.

Jamir, NS, Jungdan, Deb MS. 2008. Traditional knowledge of medicinal plants used by the Yimchunger Naga tribes in Nagaland. Pleione 2 (2): 223-228.

Jash SK, Roy R, Gorai D. 2014. Bioactive constituents from Bauhinia variegata Linn. Int J Pharm Biomed Res 5: 51-54.

Kamath JV, Nair R, Kumar Ashok CK, Lakshmi SM. 2008. Psidium guajava L: a review. Int J Green Pharm 2: 9-12.

Kar A, Borthakur SK. 2007. Dye yielding plants of Assam for dyeing handloom textile products. Indian J Tradit Know 7: 166-171.

Kazuma K, Noda N, Suziki M. 2003. Flavonoid composition related to petal color in different lines of Clitoria ternatea. Phytochemistry 64: 1133-1139.

Khera N, Bhargava S. 2013. Phytochemical and pharmacological Evaluation of Tectona grandis Linn. Int J Pharm Pharm Sci 5: 923927.

Kim H, Park S. 2007. Effects of introduced chemical groups on the dye ability of cotton fabrics with Phellodendron amurense Rupr. Dyes and Pigments 75: 351-355.

Kumar A, Singh A. 2012. Review on Hibiscus rosa sinensis, Int J Res Pharm Bio Sci 3: 534-538.

Kumar JK, Sinha AK. 2004. Resurgence of natural colorants: A holistic view. Nat Prod Let 18: 59-84.

Kumar S, Prasad AK, Iyer SV, Vaidya SK. 2013. Systematic pharmacognostical, phytochemical and pharmacological review on an ethno medicinal plant Basella alba L. J Pharm Phyt 5: 53-58.

Kwok WY, Xin JH, Chong TF. 1999. Environmental compliance for Hong Kong textile dyeing industry. Res J Tex App 3: 9-15.

Lee HS, Jung SH, Yun BS, Lee KW. 2006. Isolation of chebulic acid from Terminalia chebula Retz. and its antioxidant effect in isolated rat hepatocytes. Arc Toxicol 81: 211-218.

Lee MK, Ha NR, Yang H. 2008. Antiproliferative activity of triterpenoids from Eclipta prostrata on hepatic stellate cells. Phytomed 15: 775-80.

Li L, Liang HQ, Liao SX, Qiao CZ, Yang JG, Dong TY. 1993. Chemical studies of Strobilanthes cusia. Acta Pharm Cinica 8 (3): 238-240.

Mahanta D, Tiwari SC. 2005. Natural dye-yielding plants and indigenous knowledge on dye preparation in Arunachal Pradesh, northeast India.

Cur Sci 88: 1474-1480.

Majumdar K, Datta BK. 2007. A study on ethno-medicinal usage of plants among the Tripuri tribes of Tripura state, India. Nat Prod Rad 6 (1): 66-73.

Meena AK, Yadav A, Singh U, Singh B, Sandeep, Kiran, Rao MM. 2010.

Evaluation of physicochemical parameters on the fruit of Terminalia bellirica Roxb. Int J Pharm Pharm Sci 2: 97-99.

Musa AE, Gasmelseed GA. 2012. Characterization of Lawsonia inermis (Henna) as vegetable tanning material. J For Prod Ind 1: 35-40.

Ozturk M, Uysal I, Gucel S, Altundag E, Dogan Y, Balsar S. 2013.

Medicinal uses of natural dye-yielding plants in Turkey. RJTA 17: 69-80.

Patel BA, Patel PU, Patel RK. 2010. Physicochemical and phytochemical investigations of seeds of Celosia argentea Linn. Int J Pharm App Sci 1: 124-126.

Pradhan D, Suri KA, Pradhan DK, Biswasroy P. 2013. Golden Heart of the Nature: Piper betle L. J Pharm Phyt 1: 147-167.

Ramya B, Natarajan E, Vijikumar S, John vasanth J, Muthukkumarasamy S, Muthuramsanjivi VKA. 2010. Isolation and characterization of bioactive metabolites in Cuscuta reflexa Roxb. Ind J Nat Sci 1: 134139.

Rao RR, Hajra PK. 1994. Methods of Research in Ethnobotany: A Manual of Ethnobotany. Scientific Publishers (India), Jodhpur.

Rashid A. 2013. Dye yielding plant diversity of district Rajouri Jammu and Kashmir state-India. Int J Pharm Bio Sci 4 (1): 263 â&#x20AC;&#x201C; 266.

Reto M, Figueira, Fillip HM, Almelda CMM. 2007. Chemical composition of green tea (Camellia sinensis) infusions commercialized in Portugal. Plant Foods Hum Nutr 62: 139-44.

Revathy S, Elumalal S, Benny M, Antony B. 2011. Isolation, Purification and identification of Curcuminoids from Turmeric (Curcuma longa L.) by Column Chromatography. J Exp Sci 2: 21-25.

Roy M, Chakma B, Datta BK, Gupta AK. 2010. Traditional knowledge of medicinal plants used by Chakma tribal community of Tripura, India.

Pleione 4 (1): 105-112.

Sah AK, Verma VK. 2012. Phytochemicals and pharmacological potential of Nyctanthes arbor-tristis : A comprehensive review. Int J Res Pharm Biomed Sci 3: 420-427.

Saraswathi MN, Kartikeyan M, Rajasekar S, Gopal V. 2012. Indigofera tinctoria Linn a phytopharmacological review, Int J Res Pharm Biomed Sci 3: 164-169.

Sawian JT, Solomonnadar J, Febreena GL, Mishra BP, Laloo RC.2007.

Wild edible plants of Meghalaya, North-east India. Nat Prod Rad 6: 410-26.

Seker S, Ileri R, Ozturk M. 2006. Evaluation of activated sludge by white rot fungi for decolorization of textile wastewaters. J World Association Soil Water Conserv 1: 81-87.

Sen A, Batra A. 2012. Chemical composition of methanol extract of the leaves of Melia azedarach L. Asian J Pharm Clin Res 5: 42-45.

Sen S, Chakraborty R, De B, Devanna N. 2011. An ethnobotanical survey of medicinal plants used by ethnic people in West and South district of Tripura, India. J For Res 22: 417-426.

SUTRADHAR et al. â&#x20AC;&#x201C; Dye yielding plants of Tripura, India Shanthi G, Saridha D, Mariappan V. 2012. Pharmacognostical studies on Morinda tinctoria Roxb. Int J Pharm Pharm Sci 4: 636-638.

Sharma J, Varma R. 2011. A Review on endangered plant of Mallotus philippensis (Lam.) M.Arg., Pharmacolog 3: 1256-1265.

Siddiqui A, Tajuddin, Amin KMY, Zuberi RH, Jamal A. 2011.

Standardization of Majith (Rubia cordifolia Linn.). Indian J Trad Know 10: 330-333.

Sindhia VR, Bairwa R. 2010. Plant review: Butea monosperma. Int J Pharm Clinical Res 2: 90-94.

Singh HB, Hynniewta TM, Bora PJ. 1997. Ethno-Medico-Botanical studies in Tripura, India. Ethnobot 9: 56-58.

Singh PT, Singh M, Singh OB. 2011. Adhatoda vasica Nees: Phytochemical and pharmacological profile, The Nat Prod J 1:29-39.

Singh V, Singh RV. 2002. Healthy hues. Down to Earth 11: 25-31.

Sinha BN, Bansal SK. 2008. Phytochemicals from genus Diospyros (L.) and their biological activities. Ethnobot Leaflets 12: 231-244.

Siva R. 2007. Status of natural dyes and dye-yielding plants in India. Curr Sci 92: 916-925.

127

Subhashini N, Purnima S, Devi JAA, Tirupati AT, Lavanya N. 2011.

Anti-Inflammatory activity of Erythrina stricta Roxb. in albino rats.

Int J PharmTech Res 3: 1014-1018.

Tiwari KC, Mazumder R, Bhattacharjee S. 1978. Some medicinal plants Tiwary SC, Bharat Ajay. 2008. Natural dye-yeilding plants and indigenous knowledge of dye preparation in AchanakmarAmarkantak Biosphere Reserve, Central India. Nat Prod Rad 7 (1): 82-87.

TRMIC [Turkish Republic Ministry of Industry and Commerce]. 1991.

Dyeing of woollen yarns with dyes obtained from plants. Ankara, Turkey.

Venkatanarasimman B, Rajeswari T, Padmapriya B. 2012. Antibacterial potential of crude leaf extract of Clerodendrum philippinum Schauer.

Int J Pharm Biol Arch 3:307-310.

Zohary D, Hopf M. 1994. Domestication of Plants in the Old World, Clarendon Press, Oxford.

B I O D I V E R S IT A S Volume 16, Number 2, October 2015 Pages: 128-131

ISSN: 1412-033X E-ISSN: 2085-4722 DOI: 10.13057/biodiv/d160204

Short Communication: Genetic diversity of Rana (Pelophylax) ridibunda and Bufo (Pseudepidalea) viridis in different populations TAYEBEH MOSLEHI, MAJID MAHDIEH, ALIREZA SHAYESTEHFAR, SEYED MEHDI TALEBI Department of Biology, Faculty of Science, Arak University, 38156-88138, Arak, Markazi, Iran. Tel.: +98-86-4173317.email: seyedmehdi_talebi@yahoo.com Manuscript received: 23 February 2015. Revision accepted: 8 June 2015.

Abstract. Moslehi T, Mahdieh M, Shayestehfar A, Talebi SM. 2015. Genetic diversity of Rana (Pelophylax) ridibunda and Bufo (Pseudepidalea) viridis in different populations. Biodiversitas 16: 128-131. In present study, genetic diversity of two genus of Anura order was investigated in Iran. For this reasons, four populations of Rana (Pelophylax) ridibunda (R1-R4) and three populations of Bufo (Pseudepidalea) viridis (B1-B3) were selected from different regions of Arak province. Random Amplified Polymorphic DNA (RAPD) marker was used for molecular investigation. Nine random primers were used that only four of them were suitable and revealing different bands pattern for further analysis. A total of 69 scorable bands (loci) were found. The obtained data were analyzed using MVSP software for clustering. The studied populations were separated from each other in the UPGMA tree as well as PCA and PCO plots. In the mentioned diagrams the populations of B. (Pseudepidalea) viridis were closely together, while the populations of other species were placed far from each other. The results of this study showed that high genetic variations were present among R. ridibunda populations, but this condition was in contrast to B. viridis populations, where these populations were near each other.

Key words: Bufo, genetic variations, population, Rana, RAPD.

INTRODUCTION Amphibians have important roles in food chains and are important as indicators of ecosystem health (Welsh and Ollivier 1998). The amphibians of Iran consists of 13 species and five subspecies of frogs and toads belonging to five genera of four families, in addition eight species of salamanders belonging to four genera of two families (Rastegar-Pouyani et al. 2008). Despite of worthily studies of them in Iran by foreign (Schmidt 1952; Blandford 1876; Anderson 1957; Tuck 1974; Leviton et al. 1992) and native researchers (Hezaveh et al. 2009; Rastegar-Pouyani et al.

2011: Baloutch and Kami 1995), the amphibians still needs to study systematically.

Physiological, morphological and genetically variations were seen in populations of species that occurred in different habitat, these variations were created in response to contrasting environmental conditions (Talebi et al.

2014). Random amplified polymorphic DNA (RAPD) is a multilocus technique which allows obtaining information on the general polymorphism of a genome. Low expense, high efficiency in developing a large number of DNA markers in a short time and requirement for less sophisticated equipment, the simplicity and applicability, requirement of small amount of DNA without the requirement of cloning, sequencing or any other form of the molecular characterization of the genome has made the RAPD technique valuable (Bardakci 2001; Williams et al.

1990).

There was no previous study on genetic variation of amphibians in Arak Province, therefore in this study RAPD technique was used for investigation of genetic variation in some populations of two species namely, Rana (Pelophylax) ridibunda and Bufo (Pseuopidalea) viridis in Arak Province, because these species are dominant ones with more populations in this area. In the other hand, Arak is one of the most important industrial areas that can affect on migration of amphibians to other locations.

Materials and Methods The materials for this study consisted of a total of 47 individuals selected from 7 different populations of Rana (Pelophylax) ridibunda and Bufo (Pseuopidalea) viridis in Arak province (Table 1). Individuals were sampled by using triangular ring frame 30-mesh dip nets and manual picking of substrates with field forceps, then samples dissected in the field and the liver was removed. Genomic DNA was extracted from 100% ethanol preserved liver using a genomic DNA purification protocol (Sambrook and Russel 2001). The isolated DNA was amplified using nine primers that were bought from Sinaclon Company (Table 2). PCR reactions were performed in a volume of 25 μL containing 2.5 μL PCR reaction buffer (10x), 1.5 μL MgCl2 (25 mM), 2.5 μL dNTPs (10 mM), 2 μL primer (10μM), 14 ng of genomic DNA and 0.3 μL Taq polymerase (1 unit) (Kohler et al. 2000). Amplification was done with a programmable thermal cycler (Ependorf, AG, Hamburg, Germany) under following conditions: 94°C for 1.5 min, 45 cycles of 94°C for 30 sec, 42°C for 1 min and 72°C for

MOSLEHI et al. â&#x20AC;&#x201C; Genetic diversity of Rana ridibunda and Bufo viridis

2 min, followed by one cycle of 72ÂşC for 10 min. (Kohler et al. 2000). The amplified fragments were separated on 2% agarose gels and stained with ethidium bromide and photographed under UV light. Fragment sizes were estimated by comparison with 1 kb DNA ladder. Bands were distinguished by Labworks software. The data were used to compute the genetic variation of species. MVSP software was used for statistical analyses. A dendrogram was constructed by the Unweighted Pair Group Method of Arithmetical Average (UPGMA).

Results In this study, the extracted DNA from four populations of R. ridibunda (codes R1-R4) and three populations of B. viridis (codes B1-B3) were amplified by using nine random primers of RAPD technique. Between the nine tested primers, we selected four that yielded clear and repeatable band patterns. Other primers either failed to amplify any fragment or only amplified a few fragments, making them inappropriate for a study on variations. These four primers provided a distinct pattern of amplified fragments. The numbers of fragments were varied among the primers. In total 69 scorable bands (loci) obtained that were varying from 10 to 21 per primer. The primer ROTH-180-08 produced the highest number of bands in comparison with the other primers. This primer amplified 21 bands with molecular weight range from 550-10000 bp. Band at 1800 bp was unique band in B2 population from Delijan area.

Primer ROTH-180-02 and ROTH-180-04 produced 19 bands with molecular weight ranged from 900-10000 bp and 700-8000 bp. In addition primer ROTH-180-05 created 10 polymorphic bands with molecular weight range from 700-7900 bp (Figure 1).

The studied populations of these species were separated from each other in the PCA and PCO plots (Figures 2 and 3) as well as UPGMA tree (Figure 4). As shown in the mentioned diagrams three populations of B. viridis were close together while the populations of R. ridibunda were placed separately. These showed that the genetic similarities were present among populations of B. viridis.

But high genetics variations were found among R. ridibunda populations, so that the R3 population was placed in separate clade. Species studied were different in genetic characters and separated from each other in PCA and PCO plots as well as UPGMA tree (Figures 2 to 4).

129

Table 2. Used RAPD primers with their sequences Primers

Sequences

ROTH-180-01 ROTH-180-02 ROTH-180-03 ROTH-180-04 ROTH-180-05 ROTH-180-06 ROTH-180-08 ROTH-180-09 ROTH-180-10

5'-GCACCCGACG-3' 5'-CGCCCAAGC-3' 5'-CCATGGCGCC-3' 5'-CGCCGATCC-3' 5'-ACCCCAGCCG-3' 5'-GCACGCCGGGA-3' 5'-CGCCCTCAGC-3' 5'-GCACGGTGGG-3' 5'-CGCCCTGGTC-3'

Figure 1. Band patterns on agarose gel (the right band related to ladder).

Table 1. Sampled populations from different locations of Arak province .

Pop. code R1

Species/ populations Rana ridibunda

R2 R3 R4 B1

Rana ridibunda Rana ridibunda Rana ridibunda Bufo viridis

B2 B3

Bufo viridis Bufo viridis

Location Markazi Province, north eastern of Arak Markazi Province, Delijan Markazi Province, Shazand Markazi Province, west of Arak Markazi Province, north eastern of Arak Markazi Province, Delijan Markazi Province, south eastern of Arak

Figure 4. UPGMA tree based on the molecular data (details of symbols were given in Table 1).

B I O D I V E R S IT A S 16 (2): 128-131, October 2015

130

PCO case scores (Euclidean) 4.6 R4 3.7

Axis 2

2.8

1.8

0.9

-1.8

R3

-0.9

0.9

1.8

2.8

3.7

4.6

B1 B3 B2 R1 R2

-0.9

-1.8 Axis 1

Figure 2. PCO plot of populations of R. ridibunda and B. viridis based on the RAPD data (details of symbols were given in Table 1)

PCA case scores 5.5 R4 4.4

Axis 2

3.3

2.2

1.1

R1 B3 B2 B1 -2.2

-1.1

R2 1.1

-1.1

2.2

3.3

4.4

5.5

R3

-2.2 Axis 1

Figure 3. PCA plot of populations of R. ridibunda and B. viridis based on the RAPD data (details of symbols were given in Table 1)

Discussion In this study the intra-specific genomic variations in four R. ridibunda and three B. viridis populations from different regions of Arak province were analyzed by using RAPD technique. The molecular technique RAPD analysis is currently used to differentiate between the genomes of the closely related species in order to determine the genetic distance and genetic diversity (Williams et al. 1990; Camargo et al. 2010). The studied populations of these

species were separated from each other in the UPGMA tree as well as PCA and PCO plots. As shown in the mentioned diagrams populations of B. viridis were closely together while the populations of R. ridibunda were arranged separately.

A low genetic variability was discovered among the different B. viridis populations from various altitudes and located at short geographical distances and high similarity was seen between B1 and B3 populations. We believe that

MOSLEHI et al. – Genetic diversity of Rana ridibunda and Bufo viridis

the explanation for this result is the very short geographical distances (10 km) among the populations, together with the fact that all of the habitats were of the unpredictable type (rain pools), causing the toads to adapt to the wide ecological variations.

While, high genetic variations were found among R. ridibunda populations, so that the R3 population was placed in separate clade. R3 population from Shazand area was almost different genetically from others that may be due to presence of mountains between this area and Arak, different climate and lack of migration make it different from others populations. So it’s a very important point to say that ecological and biological conditions are one of important reasons for genetic differentiation. The results of the present study are very similar to those of Degani and Kaplan (1999), who (s) studied the genetic variation of salamanders from different habitats, using RAPD. They discovered a very low genetic variation between two populations from semi-arid habitats (band sharing was 94%), and in contrast, a high genetic variation between populations from semi-arid and humid habitats (85-86% band sharing). Their results agree with the present study, in which ecological conditions affected genetic variation.

Because one of the main ecological factors is altitude, which differed between populations and this factor influences other ecological factors such as wind, temperature as well as moisture. In study on Triturus vittatus vittatus by Pearlson and Degani (2007) also obtain similar result about relation between DNA variation and different site populations.

RAPD genetic analysis showed that there is molecular variation between different populations of these species in Arak province, because these samples clustered separately.

These conditions hold true for many other species of anurans worldwide (Driscoll 1998; Baptista 2001; Marsh and Trenham 2001; Palo et al. 2004). Although local populations tend to be slightly different, this population differentiation is not strongly structured in geographic space, and the UPGMA tree indicated only a slight significant and relatively weak spatial structure at short geographic distances so it may be difficult to find a general explanation for genetic divergence among local populations across geographic space (Sokal et al. 1986). It is important to stress that even some of very close local populations might tend to be independent in respect to genetic variability. Thus, beyond micro evolutionary and ecological processes, human effects may help explaining patterns of genetic distances in this species (Telles et al.

2007).

REFERENCES Anderson SC. 1957. Synopsis of the turtles, crocodiles, and amphisbaenians of Iran. Proc Calif Acad Sci ser. 4, 41 (22): 501-528.

131

Baloutch M, Kami HG. 1995. Amphibians of Iran. Tehran University Press. Tehran, Iran. [Persian].

Baptista CG. 2001. Estrutura gene´tica populacional de Physalaemus cuvieri Fitzinger 1826 (Lissamphibia: Leptodactilydae) em fragmentos antro´ picos e naturais de Cerrado. [Dissertation].

Universidade de Brasilia, Brasil.

Bardakci F. 2001. Random amplified polymorphic DNA (RAPD) markers. Turk J Bot 25: 185-196.

Blandford WT. 1876. Eastern Persia, an account of the journeys of the Persian Boundary commission, 1870-1872. Zoology and Geology.

Vol. 2, Macmilan, London.

Camargo A, Sinervo B, Sites JW. 2010. Lizards as model organisms for linking phylogeographic and speciation studies. Mol Ecol 19: 32503270.

Degani G, Kaplan D. 1999. Distribution of amphibian larvae in Israeli habitats with changeable water availability. Hydrobiologia 405: 4956.

Driscoll DA. 1998. Genetic structure, metapopulation processes and evolution influence the conservation strategies for two endangered frog species. Biol Conserv 83: 43-54.

Hezaveh N, Ghasemzadeh F, Darvish J. 2009. Biosystematic study (morphology, karyology and morphometry) of anuran amphibia in Markazi Province. [Dissertation]. Ferdowsi University, Iran.

Kohler AC, Kautenburger R, Muller P. 2000. Populations genetichs untersuchungen von mitteleuro paisden Bibern (Castor fiber L.) Institut fur Biogeographie: 1-14.

Leviton AE, Anderson SC, Adler K, Minton S. 1992. Handbook to Middle East amphibians and reptiles. Society for the Study of Amphibians and Reptiles, Oxford, OH. Marsh DM, Trenham PC. 2001. Metapopulation dynamics and amphibian conservation. Conserv Biol 15: 40-49.

Palo JU, Lesbarreres D, Schmeller DS, Primmer CR, Merila J. 2004.

Microsatellite marker data suggest sex-biased dispersal in the common frog Rana temporaria. Mol Ecol 13: 2865-2869.

Pearlson O, Degani G. 2007. Molecular DNA variation among Triturus vittatus vittatus (Urodela) from different breeding sites at the southern limit of its distribution. Acta Herpetol 2 (2): 69-77.

Rastegar-Pouyani N, Kami H G, Rajabizadeh M, Shafiei S, Anderson SC. 2008. Annotated checklist of amphibian and reptiles of Iran. IJAB 4 (1): 24.

Rastegar-Pouyani N, Faizi H, Oraei H, Khosravani A, Fathinia B, Heidari N, Karamiani R, Rastegar-Pouyani E. 2011. A brief history and current status of herpetology in Iran. Amphib Reptile Conserv 5 (1): 37-46.

Sambrook J, Russell DW. 2001. Molecular cloning: A laboratory manual.

Cold Spring Harbor Laboratory Press, New York.

Schmidt KP. 1952. Diagnosis of a new Amphibians and Reptiles from Iran. Nat Hist Misc 93: 1-2 Sokal RR, Smouse PE, Neel JV. 1986. The genetic structure of a tribal population, the Yanomama Indians XV patterns inferred by autocorrelation analysis. Genetics 114: 259-287.

Talebi SM, Salahi Isfahani G, Azizi N. 2014. Inter and intrapopulation variations in Stachys inflata Benth, based on phenotype plasticity (An Ecological and Phytogeographical Review). Int Res J Biological Sci 3 (2): 9-20.

Telles MP, Diniz-Filhob JA, Bastos RP, Soaresb TN, Guimaraes LD, Lima LP. 2007. Landscape genetics of Physalaemus cuvieri in Brazilian Cerrado: Correspondence between population structure and patterns of human occupation and habitat loss. Biol Conserv 39: 3746.

Tuck RG. 1974. Some Amphibians and Reptiles from Iran. Bull Md Herpetol Soc 10: 58-65 Williams J, Kubelik R, Livak J, Rafalski A, Tingey V. 1990. DNA polymorphisms amplified by arbitrary primers are useful as genetic markers. Nucleic Acids Res 18: 6531-6535.

Welsh HHJ, Ollivier LM. 1998. Stream amphibians as indicators of ecosystem stress: A case study from California's redwoods. Ecol Appl 8: 1118-1132.

B I O D I V E R S IT A S Volume 16, Number 2, October 2015 Pages: 132-138

ISSN: 1412-033X E-ISSN: 2085-4722 DOI: 10.13057/biodiv/d160205

Short Communication: Genetic diversity of patchouli cultivated in Bali as detected using ISSR and RAPD markers MADE PHARMAWATI1,♥, I PUTU CANDRA2,♥♥ 1

Biology Department, Faculty of Mathematics and Natural Sciences, Udayana University. Kampus Bukit Jimbaran, Badung 80361, Bali, Indonesia.

Tel./Fax. +62361703137, email: pharmawati@hotmail.com 2 Faculty of Agriculture, Warmadewa University, Jl. Terompong No 24 Tanjung Bungkak, Denpasar 80235, Bali, Indonesia Manuscript received: 2 April 2015. Revision accepted: 9 June 2015.

Abstract. Pharmawati M, Candra IP. 2015. Genetic diversity of patchouli cultivated in Bali as detected using ISSR and RAPD markers.

Biodiversitas 16: 132-138. Patchouli is a bushy herb that has strong scent. Patchouli's oil is extracted from patchouli leaves and used as perfumes, incense and traditional medicines. Centre of patchouli cultivation in Bali is in Badung District, however it is also grown in other area such as Buleleng District. The patchouli plant from Aceh ((Pogostemon cablin (Blanco) Benth) is considered as a better plant species due to its high quality oil. Java patchouli (Pogostemon heyneanus) has lower quality. Molecular marker was used to detect diversity of patchouli grown in Bali. Leave samples of patchouli from 12 areas in Badung and Buleleng District were collected. The areas included Lemukih, Wanagiri, Pupuan, Belok, Mekarsari, Nungnung, Plaga, Sidan, Mengwi, Lukluk, Abiansemal and Jegu.

Patchouli samples of Lhokseumawe, Tapak Tuan, Sidikalang and Java were obtained from Research Institute of Spices and Medicinal Plants, Bogor, Indonesia. DNA was extracted using CTAB buffer. Seven ISSR primers and five RAPD primers produced scorable bands and used for diversity and cluster analyses. The dendrogram showed that patchoulis grown in Bali are group together, separated from Java patchouli. This support observation based on leaf morphology, that they belong to Aceh patchouli. The patchouli grown in Bali showed low genetic diversity with Nei and Li’s similarity in the range of 0.857 to 0.989.

Keywords: Bali, genetic diversity, ISSR, patchouli, RAPD

INTRODUCTION Patchouli (Pogostemon cablin Benth.) belongs to mint family, Lamiaceae. Patchouli is believed to be a native of the Philippines; however it also grows wildly in Indonesia, Malaysia and Singapore (Ramya et al. 2013). Patchouli is also cultivated in India (Kumara and Anuradha 2011). The main product of patchouli plant is essential oil known as patchouli oil. This oil is used as perfume, scents and medicine (Kalra et al. 2006; Yang et al. 2013). Besides that, patchouli oil can be used as insect repellant (Maia and Moore 2011).

The patchouli cultivation in Indonesia was initially developed in Aceh, North Sumatra, West Sumatra and Bengkulu (Haryudin and Maslahah 2011). Cultivation of patchouli then developed to other areas of Indonesia including Java, Kalimantan and Bali (Nuryani 2006). The productivity of patchouli in Indonesia is 87.20 kg/ha, this is a relatively low production mean (Setiawan and Rosman 2013). The low productivity of patchouli is caused by traditional cultivation technology, pest and disease attack, and the use of unidentified patchouli varieties or the used of non superior varieties (Setiawan and Rosman 2013).

Patchouli is best grown in humid climate condition, up to an altitude of 800-1000 m above sea level (m asl.) (Ramya et al. 2013).

In Indonesia, there are three patchouli species which can be differentiated by morphological characters, oil quality and

resistance to biotic and abiotic stress. The three species are P. cablin Benth. or P. patchouli Pellet van Suavis Hook also known as aceh patchouli, P. heyneatus Benth. also known as java patchouli and P. hortensis Becker also known as soap patchouli. Three superior quality of patchouli varieties (Tapak Tuan, Lhokseumawe and Sidikalang) have been resealed by Indonesia Research Institute of Spices and Medicinal Plants, Bogor, Indonesia. The names of those varieties are based on their provenance. Tapak Tuan is superior for its production; Lhokseumawe has high oil content, while Sidikalang is tolerant to bacterial wilt and nematode (Nuryani 2006).

Patchouli has also been cultivated in Bali. It is considered that Bali will become a new production center for patchouli (Setiawan and Rosman 2013). The cultivation of patchouli in Bali is driven by rapid development of spa industries, where there is high demand of patchouli oil. The purity and identity of patchouli varieties is important for germplasm characterization (Kumara and Anuradha 2011).

Common molecular markers used for detection of genetic diversity are RAPD (Random Amplified Polymorphism DNA) and ISSR (Inter Simple Sequence Repeat). The RAPD marker successfully identified variation of Jatropha curcas in India (Ikbal et al. 2010), assess diversity of medicinal plant Catharanthus roseus (Shaw et al. 2009) as well as determine genetic diversity of spice plant Ocimum basilicum (Ibrahim et al. 2013). The ISSR marker was shown to be able to detect genetic variation between Allium

PARMAWATI & CHANDRA – Patchouli’s genetic diversity cultivated in Bali

species (Son et al. 2012), and Capsicum species (Thul et al.

2012).

This study aims to evaluate genetic diversity of patchouli grown in Bali using PCR-RAPD and PCR-ISSR. Patchouli cablin does not flower (Bhaskar and Vasanthakumar 2000), thus it is propagated using stem cutting or in vitro multiplication (Swamy et al. 2010). The diversity may have resulted from a long adaptation time to climatic condition and cultivation system (Chacko 2009).

Information on genetic diversity of patchouli cultivated in Bali will be useful for breeding of patchouli. Patchouli plant with good adaptation to environment can be used as genetic source in patchouli breeding.

Materials and Methods Sample collection Leaves of patchouli were collected from cultivations areas in Bali. Leaf was collected from one plant in each cultivation area. The areas included Lemukih, Wanagiri, Pupuan and Belok which are highland areas with altitude of

133

≥ 1000 m asl, Mekarsari, Nungnung, Plaga and Sidan with altitude of 500-1000 m asl, Mengwi, Lukluk, Abiansemal and Jegu wich are lowland areas with altitude of ≤ 500 m asl. (Figure 1). As comparisons, Aceh patchouli varieties (Sidikalang, Lhokseumawe, Tapak Tuan) and Java patchouli were used and collected from Research Institute of Spices and Medicinal Plants, Bogor, Indonesia. Voucher specimens of all samples were deposited at Herbarium Biology Udayana (HBU) at Biology Department, Faculty of Mathematics and Natural Sciences, Udayana University, Denpasar, Bali, indonesia.

DNA extraction DNA was extracted according to Khanuja et al. (1999).

Leaf samples (0.1 g) were ground using mortar and pestle, and 600 µL of extraction buffer (2% w/v CTAB, 1.4 M NaCl, 50 mM EDTA, 100 mM Tris-HCl (pH 8), 2% (v/v) 2-mercaptoethanol) was added and incubated at 60°C for 1 h. After that, 500 µL chloroform : isoamylalcohol (24:1) was added and vortexed, and centrifuged at 12,000 rpm for

12

11 10 9

8 6 5

7

4 3 2 1

Figure 1. Study sites of sampling collection in Bali Island ( ). Patchouli leaves were collected from 1. Lukluk, 2. Abiansemal, 3.

Mengwi, 4. Jegu, 5. Nungnung, 6. Plaga, 7. Belok, 8. Sidan, 9. Pupuan, 10. Mekarsari, 11. Wanagiri, and 12. Lemukih. Insert is map of Indonesia. Map of Bali was modified from Lansing and Fox (2011).

134

B I O D I V E R S IT A S

16 (2): 132-138, October 2015

10 min. The supernatant was transferred to a new microtube and 250 µL of 5 M NaCl was added and mixed.

Then, 0.6 volume of cold isopropanol was added and incubated at -20ºC for 1 h. Following incubation, the sample was centrifuge at 12,000 rpm for 10 mins. Pellet was washed with 500 µL 70% ethanol and centrifuged at 12,000 rpm for 3 mins. Pellet was air dried for 15 mins and dissolved in 500 µL buffer TE. RNase A (5 µL) was added and incubated at 37 °C for 30 mins. Then same volume of chloroform: isoamylalcohol (24:1) was added and centrifuged. The supernatant was transferred to a new tube and 2 volume of cold ethanol was added. Sample was then centrifuged and pellet was washed with 70% etanol. Pellet was air dried and 100 µL ddH2O was added.

PCR-ISSR and PCR-RAPD The PCR-ISSR and PCR-RAPD were conducted in 25µL PCR reaction. The mixtures contained 20 ng DNA, 1.5 mM MgCl2, 1·x PCR buffer (MoBio), 0.5 µM primer, 200 µM of each dNTP (Promega) and 1 unit of Taq DNA polymerase (MoBio). To reduce background amplification, 5% (final concentration) glycerol was added (Grunenwald 2003). Amplifications were carried out using a thermocycler (MyGenie) with an initial denaturation/ activation step of 4 min at 95oC, followed by 40 cycles of 1 mins at 94oC, 1 min at annealing temperature (36oC for RAPD, 48oC and 50oC for ISSR) and 2 min extension at 72oC. The 40 cycles were followed by a final extension for 10 min at 72oC. Twelve ISSR primers (University of Bristish Columbia, Canada) and seven RAPD primers (Operon Technology, USA and University of British Columbia, Canada) were tested.

The amplification products were analysed using 1.8% agarose electrophoresis in 1 x TAE buffer for 50 min at 100 V, and then stained with ethidium bromide at final concentration of 0.5 μg/mL for 30 min. As a size marker, 1 kb DNA ladder (Fermentas) or 100bp ladder (GeneAid) was included in the gel. Visualization was done using GelDoc UV transilliminator.

Data analysis The presence of the band was scored 1 and the absent of band was scored 0. The genetic differences were calculated using Nei and Li’s coefficient of similarity by Unpaired Group Method of Average (UPGMA) using Multi-Variate Statistical Package (MVSP) software version 3.1. and a dendrogram was developed using the same software.

Results Patchouli is now grown extensively in Bali. Based on leaf morphology, the patchouli grown in Bali is similar to Aceh patchouli. Patchouli samples collected from 12 cultivation areas have leaf shape that is categorized as ovate with pointed apex and double serrate margin. Leaf is green-purple color with smooth surface. These characters are main leaf characters of Aceh patchouli (P. cablin) (Fatriana 2011). The leaf length varied from 5.75-8.25 cm and leaf width varied from 4.70-6.75 cm. In shaded area, the length of leaf is in the range of 9.15-13.70 cm and leaf width is in the range of 4.70-6.75 cm.

Molecular testing of patchouli grown in Bali using ISSR and RAPD markers were conducted to evaluate their genetic diversity. The amplification products of PCR-ISSR using primer UBC 855 is shown in Figure 2, while products of PCR-RAPD using OPB 04 primer are presented in Fugure 3. Among the 12 ISSR primers tested, seven primers resulted in 32 clear and scorable bands, while other primers resulted in smear pattern. From seven scorable primers, 3 primers (UBC 808, UBC 820 dan UBC 888) resulted in monomorphic bands. Among the seven RAPD primers used, five primers produced 32 scorable bands, and all bands were polymorphic. The number of bands, the size of PCR products in each primer as well as the percentage of polymorphism is presented in Table 1 and 2.

Using PCR-ISSR only, low polymorphism was detected (Table 1). Therefore, to analyzed genetic diversity of patchouli cultivated in Bali, combined RAPD and ISSR markers were used. Based on PCR-ISSR and PCR-RAPD profiles, the Nei and Li’s similarity coefficient was performed to group the patchouli samples. The Nei and Li’s similarities of patchouli grown in Bali are in the range of 0.857 to 0.989. The matrix of Nei and Li’s coefficient of patchouli cultivated in Bali as well as Aceh and Java patchouli is shown in Table 3.

Cluster analysis showed that Java patchouli is separated from other patchoulis and form group A, while samples of patchouli grown in Bali and samples of Aceh patchouli are in group B (Figure 3). Based on Nei and Li’s coefficient of similarity of 0.92, group B can be further divided into subgroup B1, B2, B3 and B4. Subgroup B1 consists of patchouli sample from Lukluk. Subgroup B2 consists of samples from Belok and Lemukih, and subgroup B3 consists of samples from Jegu and Wanagiri. Sample from Sidan, Plaga, Mertasari, Tapak Tuan, Pupuan, Sidikalang, Abiansemal, Mengwi Nungnung, Abiansemal and Lhokseumawe are clustered into group B4. When similarity coefficient of 0.94% was used as a baseline, samples become more separated and form smaller groups.

Discussion Leaf morphological characters of patchouli cultivated in Bali were similar to those of Aceh patchouli. However, the size of leaf differed when they grow in open area and in shaded area. This indicates that morphological characters are influenced by environment as stated by Sugimura et al.

(2006) which resulted in difficulty of botanical classification.

Therefore it is hard to determine whether patchoulis cultivated in Bali belong to the three high quality patchoulis (Lhokseumawe, Sidikalang and Tapak Tuan).

Both using PCR-ISSR and PCR-RAPD, Java patchouli showed different banding patterns as compared to other patchoulis tested. For examples, using primer UBC 855, band of 320 bp was present in Java patchouli, while using primer OPB 04, bands of 510 bp and 790 bp were present in Java patchouli but absent in other patchouli samples.

Java patchouli is a different species than Aceh patchouli.

These results showed that both PCR-ISSR and PCR-RAPD were able to differentiate the two species In the dendrogram, Java patchouli was separated from other.

135

1kb ladder

Jegu

Lukluk

Abiansemal

Sidan Mengwi

Plaga

Nungnung

Mekarsari

Belok

Pupuan

Wanagiri

Lemukih

Java*

Tapak* *Tuan* Sidikalang*

Lhoksemawe*

PARMAWATI & CHANDRA – Patchouli’s genetic diversity cultivated in Bali

1000bp 500bp 250 bp

100bp ladder

Lukluk Abiansemal Jegu

Mengwi

Plaga Sidan

Nungnung

Mekarsari

Belok

Wanagiri Pupuan

Lemukih

Java*

Tapak Tuan*

Sidikalang*

Lhoksemawe*

Figure 2. Amplification products of patchouli using UBC 855. Patchouli samples from Research Institute of Spices and Medicinal Plants, Bogor (*) and samples from cultivation areas in Bali were shown across the top of figure

1500bp 1000bp

500bp

Figure 3. Amplification products of patchouli using OPB 04. Patchouli samples from Research Institute of Spices and Medicinal Plants, Bogor (*) and samples from cultivation areas in Bali were shown across the top of figure

Table 1. ISSR primers, numbers and sizes of bands amplified and the polymorphisms produced Primer name

Primer sequence

Bands size (bp)

Number of band

UBC 810 UBC 848 UBC 855 UBC 891 Average

(GA)8T (CA)8 RG (AC)8YT HVH(TG)7

505-792 500-1508 352-810 436-1000

3 9 4 6 5.5

Number of polymorphic band 1 4 2 3 2.5

Polymorphism (%) 33 44.4 50 50 44.35

Table 2. RAPD primers, numbers and sizes of bands amplified and the polymorphisms produced Primer name

Primer sequence

Bands size (bp)

Number of band

OPA 04 OPB 04 OPD 11 OPD 14 UBC 250 Average

AATCGGGCTG GGACTGGAGT GTAGACCCGT TCCGCTCTGG CGACAGTCCC

150-750 500 -1305 178-1030 245-2140 350-895

6 9 5 8 4 6.4

Number of polymorphic band 5 6 4 6 3 4.8

Polymorphism (%) 83.3 66.7 80 75 75 76

136

B I O D I V E R S IT A S

16 (2): 132-138, October 2015

Table 3. Matrix of Nei and Liâ&#x20AC;&#x2122;s Coefficients of patchouli cultivated in Bali as well as Aceh and Java patchouli based on PCR-ISSR and PCR-RAPD 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 1 1.000 2 0.943 1.000 3 0.944 0.909 1.000 4 0.649 0.658 0.667 1.000 5 0.944 0.932 0.889 0.615 1.000 6 0.925 0.891 0.936 0.659 0.894 1.000 7 0.978 0.944 0.954 0.633 0.945 0.947 1.000 8 0.941 0.881 0.884 0.622 0.930 0.867 0.920 1.000 9 0.943 0.930 0.909 0.658 0.909 0.913 0.944 0.881 1.000 10 0.967 0.956 0.935 0.625 0.957 0.938 0.989 0.909 0.956 1.000 11 0.943 0.953 0.886 0.658 0.932 0.913 0.944 0.881 0.977 0.956 1.000 12 0.941 0.929 0.907 0.676 0.884 0.911 0.943 0.878 0.952 0.932 0.929 1.000 13 0.957 0.923 0.946 0.617 0.925 0.928 0.957 0.899 0.945 0.968 0.923 0.921 1.000 14 0.920 0.884 0.909 0.605 0.886 0.870 0.899 0.905 0.860 0.889 0.860 0.857 0.923 1.000 15 0.955 0.897 0.921 0.649 0.899 0.903 0.956 0.894 0.920 0.945 0.897 0.941 0.957 0.920 1.000 16 0.925 0.870 0.936 0.683 0.872 0.939 0.926 0.876 0.891 0.917 0.870 0.889 0.928 0.891 0.925 1.000 Note: 1 = Lhokseumawe, 2 = Tapak Tuan, 3 = Sidikalang, 4 = Java, 5 = Lemukih, 6 = Wanagiri, 7 = Pupuan, 8 = Belok, 9 = Mekarsari, 10 = Nungnung, 11 = Plaga, 12 = Sidan, 13 = Mengwi, 14 = Lukluk, 15 = Abiansemal, 16 = Jegu

Figure 3. Dendrogram of patchouli cultivated in Bali and three superior patchouli varieties based on PCR-ISSR and PCR-RAPD analyses

patchouli samples. This result supported leaf morphological observations which found that patchouli grown in Bali has similar characteristics with Aceh patchouli.

Comparing PCR-ISSR and PCR-RAPD, this study found that PCR-RAPD resulted in more polymorphism.

This is in discordance with several reports which stated the robustness and the highest ability of ISSR to detect variations compared to RAPD (Datta et al. 2010; Yadav et al. 2014). High efficiency of RAPD in detecting polymorphism in plant was reported (Sadeghi and Cheghamirza 2012). According to Sadeghi and Cheghamirza (2012), this may due to the use of primer

with high GC content that resulted in higher stability. This is in agreement with our finding.

The Nei and Liâ&#x20AC;&#x2122;s similarities of patchouli cultivated in Bali were in the range 0.857 to 0.989. This indicates that the patchouli grown in Bali had low genetic diversity. A study of patchouli genetic diversity of Johor variety (Malaysia), Singapore variety (Singapore) and Bangalore variety (India) using 10 RAPD primers found that the varieties have significant diversity (Kumara and Anuradha, 2011). According Kumara and Anuradha (2011), the varieties studied in their research may have originated from different regions.

PARMAWATI & CHANDRA – Patchouli’s genetic diversity cultivated in Bali

Samples of patchouli from Bali did not group into the altitude of their growing locations, for example Mengwi, Lukluk, Abiansemal and Jegu are lowland areas with altitude of ≤ 500 m asl., however, the patchouli samples from those areas were scattered in the dendrogram.

Furthermore, samples from nearby areas did not cluster together. In our study, sample from Belok was far separated with sample from Sidan and Plaga, while those areas are geographically close to one another. A study reported by Wu et al. (2011), using RAPD marker, showed that patchouli from adjacent areas was classified together.

According to Wu et al. (2011), this might have been due to the possibility that the chosen populations lived in the regions for rather a long time and were seldom transplanted. They further explained that patchouli was introduced to China for long time. However, this is not the case for patchouli in Bali. The commercial cultivation of patchouli in Bali only started in 2006 (Bali Post, 8 December 2007).

The diversity of patchouli grown in Bali could be because of different source of seedling or different varieties. The patchouli samples from Plaga and Mekarsari are genetically closer to Tapak Tuan, while patchouli from Nungnung and Pupuan are closer to Lhokseumawe.

Personal communication with patchouli farmers at each location obtained information that seedlings of patchouli grown at Pupuan, Nungnung, Mekar Sari, Mengwi, Sidan and Abiansemal came from Yogyakarta. Patchouli seedlings grown at Lemukih, Plaga, Wanagiri and Jegu came from Bogor, while seedling of patchouli at Belok and Lukluk were from East Java. The diversity could also be due to natural mutation caused by biotic or abiotic stress at plant nursery. Aceh patchouli does not flower, therefore the diversity does not come from hybridization (Swamy et al.

2010).

This study revealed that patchouli cultivated in Bali is Aceh patchouli which is genetically similar to those grown in plantation areas. This study indicates low genetic variation of patchouli in Bali. Genetic improvement of patchouli requires wide variation of germplasm which can be obtained through induced mutation (Rekha et al. 2009) or somaclonal variation (Swamy et al. 2010; Ravindra et al.

2012).

ACKNOWLEDGEMENTS We thank Research Institute of Spices and Medicinal Plants, Bogor, Indonesia, for providing Lhokseumawe, Sidikalang and Tapak Tuan patchouli varieties leaf samples.

REFERENCES Bali Post. 8 December 2007. Farmers at Plaga developed patchouli cultivation [Indonesian] Bhaskar S, Vasanthakumar T. 2000. Agronomic bottle-necks, genetic barriers and marketing impediments in patchouli production. J Med Arom Plant Sci 22 (1B): 396-403 Chacko M. 2009. Characterisation, Evaluation and Micropropagation of Patchouli (Pogostemon patchouli Benth.): An Important Aromatic

137

Plant in South India. [Dissertation]. Mahatma Gandhi University, Kottayan, Kerala, India.

Datta J, Lal N, Kaashyap M, Gupta PP. 2010. Efficiency of three PCR based marker systems for detecting DNA polymorphism in Cicer arietinum L and Cajanus cajan L Mill spaugh. Genet Eng Biotechnol J 5: 1-15.

Fatriana, S. 2011. Efficient Direct Regeneration Of True-To-Type Pogostemon cablin Benth From Leaf Explant And Profile Of Essential Oils. [Thesis]. University Malaysia Pahang, Malaysia.

Grunenwald H. 2003. Optimization of polymerase chain reactions. In: Bartlett JMS, Stirling D. (eds). PCR Protocols. Vol. 226. Humana Press Inc., Totowa, NJ. Haryudin W, Maslahah, N. 2011. Morphological and anatomical characteristics and production of patchouli accession from Aceh and North Sumatera. Bul Littro 22: 115-126 [Indonesian].

Ibrahim MM, Aboud KA, Al-Ansary AMF. 2013. Genetic variability among three sweet basil (Ocimum basilicum L.) varieties as revealed by morphological traits and RAPD markers. World Appl Sci J 24: 1411-1419.

Ikbal, Boora KS, Dhillon RS. 2010. Evaluation of genetic diversity in Jatropha curcas L. using RAPD markers. Indian J Biotechnol 9: 5057.

Kalra A, Rao EVSP, Khanuja SPS. 2006. Cultivation and processing technologies of patchouli (Pogostemon cablin). J Med Arom Plants Sci 28: 414-419.

Khanuja SPS, Shasany AK, Darokar MP, Kumar S. 1999. Rapid isolation of DNA from dry and fresh samples of plants producing large amounts of secondary metabolites and essential oils. Plant Mol Biol Re. 17: 1-7.

Kumara SM, Anuradha. 2011. Analysis of genetic variability in patchouli cultivars (Pogostemon cablin Benth.) by using RAPD Markers. Res Biotech 2: 64-71.

Lansing JS, Fox KM. 2011. Niche construction of Bali: the gods of the countryside. Phil Trans R Soc B 366: 927–934.

Maia MF, Moore SJ. 2011. Plant-based insect repellents: a review of their efficacy, development and testing. Malaria J. 10(Suppl 1): S11.

Nuryani Y. 2006. Characteristics of four patchouli accessions. Bul Plasma Nutfah 12: 45-49. [Indonesian] Ramya HG, Palanimuthu V, Rachna S. 2013. An introduction to patchouli (Pogostemon cablin Benth.)-A medicinal and aromatic plant: It’s importance to mankind. Agric Eng Int 15: 243-250.

Ravindra NS, Ramesh SI, Gupta MK, Jhang T, Shukla AK, Darokar MP, Kulkarni RN. 2012. Evaluation of somaclonal variation for genetic improvement of Patchouli (Pogostemon patchouli), an exclusively vegetatively propagated aromatic plant. J Crop Sci Biotechnol 15: 3339 .

Rekha K, Bhan MK, Dhar AK. 2009. Development of erect plant mutant with improved patchouli alcohol in patchouli [Pogostemon cablin (Blanco) Benth.]. J Essent Oil Res 21: 135-137.

Sadeghi A, Cheghamirza K. 2012. Efficiency of RAPD and ISSR marker systems for studying genetic diversity in common bean (Phaseolus vulgaris L.) cultivars. Ann Biol Res 3: 3267-3273.

Setiawan, Rosman, R. 2013. Decreasing national productivity of patchouli. Warta Penelitian Pengembangan Tanaman Industri 19: 8-11 [Indonesian] Shaw, R.K., Acharya, L., Mukherjee, A.K. 2009. Assessment of genetic diversity in a highly valuable medicinal plant Catharanthus roseus using molecular markers. Crop Breed Appl Biotechnol 9: 52-59.

Son JH, Park KC, Lee SI, Kim JH, Kim NS. 2012. Species relationships among Allium species by ISSR analysis. Hort Environ Biotechnol 53: 256-262.

Sugimura Y, Ichikawa Y, Otsuji K, Fujita M, Toi N, Kamata N, DelRosario RM, Luingas GR, Tagaan GL. 2006. Cultivarietal comparisaon of patchouli plants in relation to essential oil production and quality. Flavour Frag J 5: 109-114.

Swamy MK, Balasubramanya S, Anuradha M. 2010. In vitro multiplication of Pogostemon cablin Benth. through direct regeneration. African J Biotechnol 9: 2069-2075.

Thul ST, Darokar MP, Shasany AK, Khanuja SP. 2012. Molecular profiling for genetic variability in Capsicum species based on ISSR and RAPD markers. Mol Biotechnol 51 (2): 137-47.

Wu L, Wu Y, Guo Q, Li S, Zhou K, Zhang J. 2011. Comparison of genetic diversity in Pogostemon cablin from China revealed by RAPD, morphological and chemical analyses. J Med Plants Res 5: 4549-4559.

138

B I O D I V E R S IT A S

16 (2): 132-138, October 2015

Yadav K, Yadav SK, Yadav A, Pandey VP, Dwivedi UN. 2012.

Comparative analysis of genetic diversity among cultivated pigeon pea (Cajanus cajan (L.) Millsp. ) and its wild relatives (C. albicans and C. lineatus) using randomly amplified polymorphic DNA

(RAPD) and Inter Simple Sequence Repeat (ISSR) fingerprinting. Am J Plant Sci 5: 1665-1678.

Yang X, Zhang X, Yang S-P, Liu W-Q. 2013. Evaluation of the antibacterial activity of patchouli oil. Iran J Pharm Res 12: 307-316.

B I O D I V E R S IT A S Volume 16, Number 2, October 2015 Pages: 139-144

ISSN: 1412-033X E-ISSN: 2085-4722 DOI: 10.13057/biodiv/d160206

Short Communication: Population genetic structure in medicinal plant Lallemantia iberica (Lamiaceae) FAHIMEH KOOHDAR1,♥, MASOUD SHEIDAI1, SEYYED MEHDI TALEBI2, ZAHRA NOORMOHAMMADI3 1

Faculty of Biological Sciences, Shahid Beheshti University, Tehran, Iran, 1983963113. Tel: +98 21 29902111, ♥email: msheidai@yahoo.com 2 Department of biology, faculity of sciences, Arak University, Arak, 38156-8-8349 Iran.

3 Department of Biology, School of Basic Sciences, Science and Research Branch, Islamic Azad University, Tehran, Iran.

Manuscript received: 2 April 2015. Revision accepted: 11 June 2015.

Abstract. Koohdar F, Sheidai M, Talebi SM, Noormohammadi Z. 2015. Population genetic structure in medicinal plant Lallemantia iberica (Lamiaceae). Biodiversitas 16: 139-144. Lallemantia iberica (Bieb.) Fischer and C.A. Meyer (sin. Dracocephalum ibericumM. Bieb.) also named Dragon's head” is an annual plant cultivated for its seeds that contain about 30% -38% drying oil (siccative oil). Its seed oil is used in foods, dye and varnish industry. L. iberica seeds have traditional uses as reconstitute, stimulant, diuretic and expectorant. L. iberica in an important medicinal plant in our country and grows in various regions with different environmental conditions. At present no investigation has been reported about population genetic structure of this valuable plant species in Iran.

Therefore, we carried out population genetic analysis of 11 populations of L. iberica by using ISSR molecular markers for the first time.

Genetic diversity analysis revealed high within population genetic variability. AMOVA test produced significant genetic difference among the studied populations. Mantel test revealed significant correlation between genetic distance and geographical distance of the populations. STRUCTURE analysis and K-Means clustering revealed population genetic fragmentation and the presence of three gene pools for this species. The assignment test revealed the occurrence of limited gene flow among the populations. The results suggested that genetic divergence, limited gene flow, genetic drift and local adaptation have played role in diversification of L. iberica.

Key words: Gene flow, population fragmentation, IBD, Lallemantia iberica.

INTRODUCTION Lallemantia iberica (Bieb.) Fischer and C.A. Meyer (syn. Dracocephalum ibericum M. Bieb.) also named Dragon's head” is a crop cultivated from the prehistoric times in Southwestern Asia and Southeastern Europe. It is an annual plant and has been cultivated for its seeds that contain about 30% -38% drying oil (siccative oil). The iodic index of its seeds oil is between 163 and 203. The oil is used in foods, but especially in dye and varnish industry (Shafiee et al. 2009; Ion et al. 2011).

Lallemantia iberica seeds have traditional uses as reconstitute, stimulant, diuretic and expectorant. It is considered as a linseed substitute in a number of applications including: wood preservative, ingredient of oil-based paints, furniture polishes, printing inks, soap making, and manufacture of linoleum (Samadi et al. 2007; Shafiee et al. 2009). The plant also has high ornamental value and it is used in arid landscaping and urban horticulture at various places in Turkey (Ozdemir et al 2014).

Population genetics analyses can produce important data on the levels of genetic variation, the partitioning of variability within/between populations, gene flow, inbreeding, selfing versus outcrossing rates, effective population size and population bottleneck. These analyses may be of help in developing effective management

strategies for endangered and/or invasive species (Ellis and Burke 2007). Lallemantia iberica in an important medicinal plant in our country and grows in various regions with different environmental conditions (Ozdemir et al 2014). This plant forms several local populations. At present no investigation has been reported about population genetic structure of this valuable plant species in Iran.

Studying genetic variability and gene flow versus genetic fragmentation of local populations can provide valuable information for conservation of this medicinal plant in the country. Therefore, we carried out population genetic analysis in 11 populations of L. iberica for the first time in Iran. Different molecular markers have been used in population genetic studies. We used ISSR (Inter-simple sequence repeats) to study genetic diversity of populations in L. iberica, since these markers are reproducible, cheap, easy to work and are known to be efficient in population genetic diversity studies (Sheidai et al. 2012, 2013, 2014).

Materials and Methods Plant material Ninety plant specimens were collected from 11 populations of Lallemantia iberica. Details of the studied populations are provided in Table 1, Figure 1. Voucher specimens are deposited in Herbarium of Shahid Beheshti University (HSBU), Tehran, Iran.

B I O D I V E R S IT A S

140

16 (2): 139-144, October 2015

Table 1. Populations studied, their locality and ecological features.

Province Zanjan Zanjan West Azerbaijan West Azerbaijan West Azerbaijan West Azerbaijan Markazi Qazvin Kermanshah Mazandran Qazvin

Locality 1.

50 km from Qazvin to Zanjan 2. 23 km from Qazvin to Zanjan 3. Takab 4. 2km from Takab to Shahindej 5. 65 km from Takab to Shahindej 6. Sero 7. Sangak 8. Khereqan 9. Paveh 10. Chalus 11. Abyek

Alt. (m)

Long. Lat.

1839

3619 4905

1785

3634 4843

1729 1751

3627 4703 3628 4701

2047

3630 4658

1680 1929 1980 1533 1605 1263

3743 3511 3519 3502 3616 3602

4449 4948 4955 4621 5114 5031

DNA extraction and ISSR assay Fresh leaves were collected randomly in each of the studied populations and dried in silica gel powder.

Genomic DNA was extracted using CTAB with activated charcoal protocol (Sheidai et al. 2013). The quality of extracted DNA was examined by running on 0.8% agarose gel. Ten ISSR primers; (AGC)5GT, (CA)7GT, (AGC)5GG, UBC810, (CA)7AT, (GA)9C, UBC807, UBC811, (GA)9A and (GT)7CA commercialized by UBC (the University of British Columbia) were used. PCR reactions were performed in a 25μl volume containing 10 mM Tris-HCl buffer at pH 8; 50 mM KCl; 1.5 mM MgCl2; 0.2 mM of each dNTP (Bioron, Germany), 0.2 μM of a single primer; 20 ng genomic DNA and 3 U of Taq DNA polymerase (Bioron, Germany). The amplifications’ reactions were performed in Techne thermocycler (Germany) with the following program: 5 min initial denaturation step 94°C, 30 S at 94°C; 1 min at 50°C and 1min at 72°C. The reaction was completed by final extension step of 7 min at 72°C. The amplification products were visualized by running on 2% agarose gel, followed by the ethidium bromide staining.

The fragment size was estimated by using a 100 bp molecular size ladder (Fermentas, Germany). ISSR bands obtained were coded as binary characters (presence = 1, absence = 0). The following genetic diversity parameters were determined in each population: percentage of allelic polymorphism, allele diversity (Weising et al. 2005), Nei’s gene diversity (H), Shannon information index (I), number of effective alleles, and percentage of polymorphism (Freeland et al. 2011).

Data analysis Genetic diversity and population structure. ISSR bands obtained were scored as binary characters. Genetic diversity parameters were determined in each population.

These parameters were Nei’s gene diversity (H), Shannon information index (I), number of effective alleles, and

Figure 1. Distribution map of Lallemantia iberica populations.

Note: Population numbers are according to Table 1.

percentage of polymorphism (Weising et al. 2005; Freeland et al. 2011). Nei’s genetic distance was determined among the studied populations and used for clustering (Weising et al. 2005; Freeland et al. 2011). For grouping of the plant specimens, Neighbor Joining (NJ) clustering method, Neighbor Net method of networking as well as principal coordinate analysis (PCoA) were performed after 100 times bootstrapping/ permutations (Freeland et al. 2011; Huson and Bryant 2006). The Mantel test was performed to check correlation between geographical distance and the genetic distance of the studied species (Podani 2000). PAST ver.

2.17 (Hamer et al. 2012), DARwin ver. 5 (2012) and SplitsTree4 V4.13.1 (2013) programs were used for these analyses.

Significant genetic difference among the studied populations and provinces were determined by: 1AMOVA (Analysis of molecular variance) test (with 1000 permutations) by using GenAlex 6.4 (Peakall and Smouse 2006), and 2- Nei,s Gst analysis of GenoDive ver.2 (2013) (Meirmans and Van Tienderen 2004). The population genetic differentiation was studied by G'st_est = standardized measure of genetic differentiation (Hedrick 2006), and D_est = Jost measure of differentiation (Jost 2008). In order to overcome potential problems caused by the dominance of ISSR markers, a Bayesian program, Hickory (ver. 1.0) (Holsinger et al. 2003), was used to estimate parameters related to genetic structure (theta B value). Three runs were conducted with default sampling parameters (burn-in = 50,000, sample= 250,000, thin = 50) to ensure consistency of results (Tero et al. 2003).

The genetic structure of populations was studied by two different approaches. First by using Bayesian based model STRUCTURE analysis (Pritchard et al. 2000), and second by maximum likelihood-based method of K-Means clustering. For STRUCTURE analysis, data were scored as dominant markers (Falush et al. 2007). The Evanno test was performed on STRUCTURE result to determine proper

KOOHDAR et al. â&#x20AC;&#x201C; Population genetic of Lallemantia iberica

number of K by using delta K value (Evanno et al. 2005).

We performed K-Means clustering as done in GenoDive ver. 2. (2013). Here, the optimal clustering is the one with the smallest amount of variation within clusters. This is calculated by using the within-clusters sum of squares. The minimization of the within-groups sum of squares that is used in K-Means clustering is, in the context of a hierarchical AMOVA, equivalent to minimizing the among-populations-within-groups sum of squares, SSDAP/WG (Meirmans 2012). Two summary statistics, 1pseudo-F (Calinski and Harabasz 1974), and 2- Bayesian Information Criterion (BIC) (Schwarz 1978, provide the best fit for k (Meirmans 2012).

Gene flow. Gene flow was determined by two different approaches. (i) Calculating Nm an estimate of gene flow from Gst by PopGen ver. 1.32 (1997) as: Nm = 0.5(1 Gst)/Gst. This approach considers equal amount of gene flow among all populations. (ii) Population assignment test based on maximum likelihood as performed in Genodive ver. in GenoDive ver. 2. (2013).

Results and discussion Genetic diversity Genetic diversity parameters determined in the studied populations are presented in Table 2. The highest values for gene diversity and percentage of polymorphism occurred in population 6 (0.162 and 63.89, respectively). The lowest values for these parameters were observed in population 10 (0.048 and 12.5, respectively).

Population genetic structure AMOVA test produced significant genetic difference (PhiPT = 0.49, P = 0.010) among the studied populations.

It also revealed that, 59% of total genetic variability was due to within population diversity and 41% was due to among population genetic differentiation. Pairwise AMOVA produced significant difference among the studied populations. Hickory test also produced high Theta B value (0.4) supporting AMOVA. Gst (0.40, P = 0.001), Hedrick, standardized fixation index (G'st = 0.47, P = 0.001) and Jost, differentiation index (D-est = 0.13, P = 0.001), revealed that the studied populations are genetically differentiated.

Neighbor Joining (NJ) tree and PCoA plot produced similar results. Therefore, only PCoA plot is presented and discussed (Figure 2). The studied population was placed in separate group which was in agreement with AMOVA result. It also revealed a higher degree of within population genetic variability in population 6 (as plants in this populations were more scattered than the other populations) which is in agreement with genetic diversity parameters presented before. PCoA plot revealed higher genetic affinity between populations 1, 2 and 3, and between 4, 5 and 6, as well as between 9, 10 and 11.

Neighbor-Net diagram (Figure 3), supported grouping obtained by PCoA and also revealed the presence of three distinct genetic groups. The populations 1-3 formed the first genetic group, populations 4-6 and populations 7-11 comprised second and third genetic groups respectively.

This result was supported by Evanno test based and K-

141

Means clustering that produced the best k = 3 and 2 respectively. Therefore, we have population genetic fragmentation in L. iberica.

STRUCTURE plot (Figure 4) based on k = 3, identified three distinct genetic groups (gene pools) for of L. iberica populations. The first gene pool (populations 1-3) is distributed from Ghazvin to Zanjan and to Takab (West Azerbayejan). The second gene pool (populations 4-6) is distributed from Takab to Shahindej and Orumiyeh, while the third gene pool (populations 7-11) is distributed mainly in West and North-West of the country.

Gene flow The STRUCTURE plot that was based on admixture model, revealed some degree of genetic admixture in the studied populations. For example, populations 1-3 had some alleles from populations 4-6 and vice versa. These shared alleles might be the possible reason for close genetic affinity of these populations as revealed by PCoA plot presented before. Populations 7-11 also had some degree of shared alleles with the other studied populations.

The population assignment test also revealed some degree of gene flow or ancestral shared alleles among the studied populations. This was true particularly for populations 1 and 6, 1 and 2, 2 and 3, 3 and 4, 4 and 6, 7 and 8, 6 and 9, 6 and 10, as well as 6 and 11. Gene flow determined by Nm, produced mean value = 0.60, that is not considered to be high. Therefore, all these results revealed restricted gene flow and strong population differentiation among L. iberica populations. The Mantel test produced significant correlation between genetic distance and geographical distance of the studied populations (r = 0.36, P = 0.01, Figure 5). This indicated the occurrence of isolation by distance (IBD) in L. iberica populations.

LFMM analysis revealed that 20 out of 72 ISSR loci had >1.3 -log 10 value (P <0.05) and may be considered as adaptive loci. Some of these loci had low Nm value, for example ISSR loci 2, 7, 37, 38, 41, 43, 57, 59. 63, and 71 had Nm <1. However, some loci like ISSR loci 14, 18, 22, 26, 34, 47, 51, 65, 66, had nm >1. Therefore, both ISSR loci that were shared by different populations and loci with lower admixture value were used by L. iberica plants to adapt to their environment.

Discussion The extensive use of natural resources to meet the needs of expanding human populations, deforestation and habitat fragmentation could lead to reductions in the rate of gene flow among populations. This in turn increases the genetic differentiation among populations and genetic structuring and reductions in genetic variation within populations due to genetic drift (Setsuko et al. 2007; Hou and Lou 2011).

However, there are cases in which fragmentation did not result in reduced genetic diversity (Prober et al. 1990), due to various reasons, like population size and the time scale of fragmentation. Templeton (1991) stated that â&#x20AC;&#x153;Heterozygosity is not always beneficial, nor does inbreeding always have adverse effects. In some circumstances, a population may be so well adapted to its local circumstances. STRUCTURE analysis and K-Means

B I O D I V E R S IT A S

142

16 (2): 139-144, October 2015

Table 2. Genetic diversity parameters in the studied populations of Lallemantia iberica Pop

N

Na

Ne

I

Pop1 10.000 0.931 1.235 0.217 Pop2 10.000 1.208 1.292 0.267 Pop3 10.000 1.083 1.211 0.211 Pop4 10.000 0.944 1.224 0.204 Pop5 10.000 0.875 1.200 0.179 Pop6 10.000 1.306 1.249 0.260 Pop7 10.000 0.639 1.180 0.152 Pop8 10.000 0.583 1.204 0.162 Pop9 3.000 0.472 1.105 0.101 Pop10 3.000 0.417 1.083 0.071 Pop11 4.000 0.486 1.134 0.119 Note: N = Number of populations, Na = No. of different alleles, Ne = No. of effective Gene diversity, UHe = Unbiased gene diversity, and %P = Percentage of polymorphism.

He

UHe

%P

0.142 0.149 44.44% 0.174 0.183 56.94% 0.133 0.140 50.00% 0.133 0.140 43.06% 0.119 0.125 34.72% 0.162 0.170 63.89% 0.102 0.108 29.17% 0.112 0.118 27.78% 0.066 0.079 19.44% 0.048 0.058 12.50% 0.079 0.090 22.22% alleles, I = Shannon's Information Index, He =

Figure 2. PCoA plot of Lallemantia iberica populations based on ISSR data. Note: Population numbers are according to Table 1.

Figure 4. STRUCTURE plot based on k = 3

KOOHDAR et al. – Population genetic of Lallemantia iberica

Figure 3. Neighbor-Net diagram of Lallemantia iberica populations based on ISSR data. Note: Population numbers are according to Table 1.

143

environmental conditions, and enables change in the genetic composition to cope with changes in the environment (Çalişkan 2012; Sheidai et al. 2013, 2014).

High value of within population genetic diversity was observed in the studied populations (for instance, high percentage of polymorphism in each population).

Moreover, AMOVA test revealed that 59% of total genetic variability was due to within population diversity and 41% was due to among population genetic differentiation. This is possibly related to outcrossing nature of L. iberica.

Mantel test revealed a pattern of isolation-by distance across the distribution range of the studied L. iberica populations. This pattern suggested that the dispersal of these populations might be constrained by distance and gene flow is most likely to occur between neighboring populations. As a result, more closely situated populations tend to be more genetically similar to one another (Slatkin 1993; Hutchison and Templeton 1999; Medrano and Herrera 2008). In fact population assignment test revealed that limited gene flow occurred mostly between neighboring populations, populations 1-3, 4-6, and 7-11.

LFMM analysis revealed that some of the genetic loci were adaptive nature and possibly used by local populations to adapt to their environment. Therefore, combination of genetic divergence, limited gene flow and local adaptation have played role in diversification of L. iberica. In conclusion the present study may provide some useful information about population genetic structure and genetic variability of L. iberica that may be used in conservation of these important species.

REFERENCES

Figure 5. The Mantel test indicated significant correlation between genetic distance and geographical distance

clustering revealed population fragmentation in L. iberica.

However, population assignment and Nm estimation showed some degree of gene flow among the studied populations. These results show that populations achive some new combination of alleles through limitted gene flow. A metapopulation is an assemblage of local populations that usually are small and are linked by loose relationships, i.e., there is some gene flow among them. In such cases, gene flow among local populations could mitigate losses of genetic variation caused by genetic drift in local populations and thus save them from extinction via so-called “genetic rescue” (Richards 2000).

Genetic diversity is of fundamental importance in the continuity of a species as it provides the necessary adaptation to the prevailing biotic and abiotic

Calinski RB, Harabasz J. 1974. A dendrite method for cluster analysis.

Commun Stat 3: 1-27. Çalişkan M (ed). 2012. Genetic Diversity in Plants. InTech Press, Shanghai, China. DOI: 10.5772/2640.

Ellis JR, Burke JM. 2007. EST-SSRs as a resource for population genetic analyses. Heredity 99: 125-132.

Evanno G, Regnaut S, Goudet J. 2005. Detecting the number of clusters of individuals using the software STRUCTURE: a simulation study. Mol Ecol 14: 2611-2620.

Falush D, Stephens M, Pritchard JK. 2007. Inference of population structure using multilocus genotype data: dominant markers and null alleles. Mol Ecol Notes 7: 574-578.

Freeland JR, Kirk H, Peterson SD. 2011. Molecular Ecology (2nd ed).

Wiley-Blackwell, UK. Hamer Øm, Harper DAT, Ryan PD. 2012. PAST: Paleontological Statistics software package for education and data analysis.

Palaeontol Elect 4: 9.

Hedrick P. 2006. Genetic polymorphism in heterogeneous environments: The age of genomics. Ann Rev Ecol Evol Syst 37: 67-93.

Holsinger KE, Lewis PO. 2003. Hickory: a package for analysis of population genetic data V1.0. http: //www.eeb.uconn.edu.

Hou Y, Lou A. 2011. Population genetic diversity and structure of a naturally isolated plant species, Rhodiola dumulosa (Crassulaceae).

PLoS ONE 6, e24497. DOI: 10.1371/journal.pone.0024497.

Huson DH, Bryant D. 2006. Application of phylogenetic networks in evolutionary studies. Mol Biol Evol 23: 254e267. www.splitstree.org.

Hutchison DW, Templeton AR. 1999. Correlation of pairwise genetic and geographic distance measures: inferring the relative influences of gene flow and drift on the distribution of genetic variability.

Evolution 53: 1898-1914.

Ion V, Basa AGh, Sandoiu DI, Obrisca M. 2011. Results regarding biological characteristics of the species Lallemantia iberica in the

144

B I O D I V E R S IT A S

16 (2): 139-144, October 2015

specific conditions from South Romania. Scientific papers UASVM Bucharest, Series A, Vol. LIV. ISSN 1222-5339 Medrano M, Herrera CM. 2008. Geographical structuring of genetic diversity across the whole distribution range of Narcissus longispathus, a habitat-specialist, Mediterranean narrow endemic.

Ann Bot 102: 183-194.

Meirmans PG, Van Tienderen, PH. 2004. GENOTYPE and GENODIVE: two programs for the analysis of genetic diversity of asexual organisms. Molecular Ecology Notes 4: 792-794.

Meirmans PG. 2012. AMOVA-based clustering of population genetic data. J Heredity 103: 744-750.

Ozdemir FA, Yildirim MU, Pourali Kahriz M. 2014. Efficient micropropagation of highly economic, medicinal and ornamental plant Lallemantia iberica (Bieb.) Fisch. and C. A. Mey. BioMed Res Intl 2014: Article ID 476346. DOI: 10.1155/2014/476346 Peakall, R, Smouse, PE, 2006. GENALEX 6: genetic analysis in Excel.

Population genetic software for teaching and research. Molecular Ecology Notes 6: 288-295.

Podani J. 2000. Introduction to the Exploration of Multivariate Data [English translation]. Backhuyes, Leiden, the Netherlands.

Pritchard JK, Stephens M, Donnelly P. 2000. Inference of population structure using multilocus genotype Data. Genetics 155: 945-959 Prober SM, Tompkins C, Moran CG, Bell JC. 1990. The conservation genetics of Eucalyptus paliformis L. Johnson et Blaxell and E. parviflora Cambage, two rare species from south-eastern Australia.

Australian J Bot 38: 79-95.

Richards CM. 2000. Inbreeding depression and genetic rescue in a plant metapopulation. Amer Nat 155: 383-394.

Samadi S, Khaiyamiand M, Goorut Tappe AH. 2007. A comparison of important physical and chemical characteristics of six Lallemantia iberica (Bieb.) Fisch. and Mey. varieties. Pakistan J Nutr 6: 387-390.

Schwarz G. 1978. Estimating the dimension of a model. Ann Stat 6: 461464.

Setsuko S, Ishida K, Ueno S, Tsu mura Y,Tomaru N. 2007. Population differentiation and gene flow within a metapopulation of a threatened tree, Magnolia stellata (Magnoliaceae). Am J Bot 94: 128-136.

Shafiee S, Modares Motlagh A, Minaee S, Haidarbigi K. 2009. Moisture dependent physical properties of dragons head seeds (Lallemantia iberica). Agricultural Engineering International: The CIGR Ejournal.

Manuscript 1192. Vol. XI. April 2009.

Sheidai M, Afshar F, Keshavarzi M, Talebi SM, Noormohammadi Z, Shafaf T. 2014. Genetic diversity and genome size variability in Linum austriacum (Linaceae) populations. Biochem Syst Ecol 57: 2026.

Sheidai M, Seif E, Nouroozi M, Noormohammadi Z. 2012. Cytogenetic and molecular diversity of Cirsium arvense (Asteraceae) populations in Iran. J Jap Bot 87: 193-205.

Sheidai M, Zanganeh S, Haji-Ramezanali R, Nouroozi M, Noormohammadi Z, Ghsemzadeh-Baraki S. 2013. Genetic diversity and population structure in four Cirsium (Asteraceae) species.

Biologia 68: 384-397.

Slatkin M. 1993. Isolation by distance in equilibrium and non-equilibrium populations. Evolution 47: 264-279.

Templeton A. 1991. Off-site breeding of animals and implications for plant conservation strategies. In: Falk DA, Holsinger KE (eds).

Genetics and Conservation of Rare Plants. Oxford University Press, New York.

Tero N, Aspi J, Siikamaki P, Jakalaniemi A, Tuomi J. 2003. Genetic structure and gene flow in a metapopulation of an endangered plant species, Silene tatarica. Mol Ecol 12: 2073-2085.

Weising K, Nybom H, Wolff K, Kahl G. 2005. DNA Fingerprinting in Plants. Principles, Methods, and Applications. (2nd ed.). CRC Press, Boca Raton, USA.

B I O D I V E R S IT A S Volume 16, Number 2, October 2015 Pages: 145-150

ISSN: 1412-033X E-ISSN: 2085-4722 DOI: 10.13057/biodiv/d160207

Within and among-genetic variation in Asian flax Linum austriacum (Linaceae) in response to latitude changes: Cytogenetic and molecular analyses ZAHRA NOORMOHAMMADI1,â&#x2122;Ľ, TINA SHAFAF2, FATEMEH FARAHANI2, MASOUD SHEIDAI2, SEYED-MEHDI TALEBI3, YEGANEH HASHEMINEJAD-AHANGARANI-FARAHANI 2 1

Department of Biology, Science and Research Branch, Islamic Azad University, Tehran, Iran. Tel.: +982144865939, Fax.: +982144865939, â&#x2122;Ľemail: marjannm@yahoo.com, z-nouri@srbiau.ac.ir 2 Faculty of Biological Sciences, Shahid Beheshti University, Tehran, Iran 3 Botany Department, Arak University, Arak, Iran Manuscript received: 31 May 2015. Revision accepted: 24 June 2015.

Abstract. Noormohammadi Z, Shafaf T, Farahani F, Sheidai, Talebi SM, Hasheminejad-Ahangarani-Farahani Y. 2015. Within and among-genetic variation in Asian flax Linum austriacum (Linaceae) in response to latitude changes: Cytogenetic and molecular analyses. Biodiversitas 16: 145-150. Linum austriacum L. (Linaceae) which is known as Asian flax is an herbaceous medicinal plant species that grow in Iran in different latitudes and forms some local populations particularly in the West and North-West of the country.

Within-and between-genetic diversity in response to altitude changes was investigated in geographical populations of L. austriacum by using cytogenetic and ISSR molecular markers. These populations were diploid with 2n = 18 and differed significantly (P<0.05) in their mean chiasma frequency and chromosome pairing. Significant positive correlation (r >0.90, P < 0.05) occurred between latitude and the mean number of quadrivalents. The highest level of genetic diversity parameters as Shanon Information Index and gene diversity occurred in Salavat-abad population. Moreover, the STRUCTURE analysis also identified this population as the most varied population.

This population had medium altitude distribution. Mantel test performed between genetic distance and geographical distance showed no significant correlation (R2 = 0.09, p = 0.39). Pearson coefficient of correlation determined between genetic diversity parameters and altitude, produced a significant negative correlation (r =-0.85, P<0.01) with the number of effective alleles. The present study revealed that Linum austriacum populations do have some cytogenetic and molecular variation in response to altitude.

Key words: Chromosome pairing; Fst; genetic variability; ISSR; wild flax.

INTRODUCTION The genus Linum is the type genus for the flax family, Linaceae DC. (Dumort) comprising 22 genera and about 300 species distributed worldwide. Linum is the largest genus (about 200 species) within the family and is found both in the Mediterranean region and the Americas. It includes both horticultural plants with various flower colors and one field crop (Linum usitatissimum L.), and have been used as a source of fiber (L. usitatissimum), seed oil, fodder, medicine and as ornamentals (Muir and Westcott 2003). Many species are cross-pollinated due to heterostyly. Distyly is widespread and very common in the genus Linum (about 40 % of the Linum species are distylous) (Sheidai et al. 2015). It occurs in Linum pubescens, L. grandiflorum and L. mucronatum, L. perenne, L. grandiflorum, L. alpinum, L. aretioides, L. austriacum, L. album, and L. glaucum (Talebi et al. 2012).

In recent years researchers has been extensively studied to conserve and explore germplasm of crop wild relatives.

Crop wild relatives are species closely related to crops, including their progenitors, which may contain beneficial traits such as pest or disease resistance and yield improvement (Sheidai et al. 2014). Genetic diversity analysis and population structure have been the subject of

several studied in cultivated and wild flax species (see for example, Fu 2006, Fu and Allaby 2010, Abou El-Nasr and Mahfouze 2013, Sheidai et al. 2014).

Linum austriacum L. is an herbaceous medicinal plant containing important lignans such as arylnaphthalene lignan, 3,4-dimethoxy-3',4'-methylenedioxy-2,7'-cycloligna7,7'-dieno-9,9'-lactone (1,0.03-0.73% dry wt), together with justicidin B (2, 0.18-1.69% dry wt) (Mohagheghzadeh et al.

2002). Because elevation is a complex factor, altitudinal gradients comprise an assemblage of environmental variables that influence the distribution of population genetic variation of plant species. Along altitudinal gradients, the genetic differentiation between populations of some plant species results in rapid, elevation-related changes in environmental conditions. However, in other taxa, only a little or no differentiation with respect to altitude occurs (Di et al. 2014).

Species have three options that may allow them to survive rapidly changing environments: dispersal (expansion), phenotypic plasticity, or adaptation (Heather and Freeland 2011). The plant species expansion of the core population is associated with reduced withinpopulation genetic diversity (Austerlitz et al. 2000), and reduced levels of phenotypic variation (Pujol and Pannell 2008).

146

B I O D I V E R S IT A S

16 (2): 145-150, Ocotober 2015

The present study considers cytological and the genetic diversity analysis of some Linum populations distributed in different altitudes and investigates degree of within-and among-population genetic variability and tries to study genetic variability response to altitude changes. For molecular study, we used ISSR markers that are powerful molecular tools to differentiate the species populations and reveal their genetic diversity (see, for example, Sheidai et al. 2012, 2013).

MATERIAL AND METHODS Plant materials For cytological studies, suitable flower buds have been obtained in five populations of L. austriacum (Table 1).

Different flower buds were selected randomly from at least ten plants in each population and used for cytological preparations. For ISSR studies, 70 plants were randomly selected from four populations including, Saleh-abad and Hamekasi Village, from Hamedan Province, Iran, and Salavat-abad and Abidar-Sanandaj, from Kurdistan Province (Table 1). The voucher specimens were deposited in the Herbarium of Shahid Beheshti University (HSBU), Tehran, Iran.

Cytological study The young flower buds collected were fixed and used for cytological investigation by the squash method according to our previous report (Sheidai et al. 2012).

Meiotic characters including polyploidy level, chiasma frequency and distribution, as well as chromosome pairing and segregation were observed in plants collected.

ISSR assay The genomic DNA was extracted from silica gel dried leaves by using CTAB activated charcoal protocol (Krizman et al. 2006). The quality and quantity of extracted DNA were assessed by running on 0.8% agarose gel and NanoDrop® spectrometer respectively. Ten ISSR primers: (AGC)5GT, (CA)7GT, (AGC)5GG, UBC 810, (CA)7AT, (GA)9C, UBC 807, UBC 811, (GA)9A and (GT)7CA commercialized by UBC (the University of British Columbia) were used. PCR reactions were performed in a 25 µl volume containing 10 mM Tris-HCl buffer at pH 8; 50 mM KCl; 1.5 mM MgCl2; 0.2 mM of each dNTP (Bioron, Germany); 0.2 µM of a single primer; 20 ng genomic DNA and 3 U of Taq DNA polymerase (Bioron, Germany). Amplification reactions were performed in Techne thermocycler (Germany) with the following program: 5 min initial denaturation step 94°C, 30 s at 94°C, 1 min at 50°C and 1 min at 72°C. The reaction was completed by a final extension step of 7 min at 72°C. Amplification products as well as No DNA (control sample) were visualized by running on 2% agarose gel, following ethidium bromide staining. Fragment size was estimated by using a 100 bp molecular size ladder (Fermentas, Germany). The experiment was replicated three times and constant ISSR bands were used for further analyses.

Data analyses ANOVA (Analysis of variance) was performed to reveal cytogenetic difference among the studied populations.

Pearson correlation determined among geographical features (longitude and latitude) and meiotic characters.

PCA (Principal Components Analysis) biplot was used to group populations based on cytogenetic similarity.

ISSR bands obtained were treated as binary characters and coded accordingly (presence = 1, absence = 0). The Dentrented correspondence analysis plot was used to check distribution of ISSR loci and their effects on genotypes grouping. The role of each locus in discriminating plant genotypes was checked by Gst analysis performed by POPGENE program ver. 2. (1999). Genetic diversity parameters were determined in each population. These parameters were percentage of allelic polymorphism, allele diversity (Weising et al. 2005), Nei’s gene diversity (H), Shannon information index (I), the number of effective alleles and percentage of polymorphism and polymorphic information content (PIC) (Weising et al. 2005; Freeland et al. 2011).

Jaccard similarity index and Nei’s genetic distance (Freeland et al. 2011), were determined among plants and used for the grouping of the genotypes. Neighbor Joining (NJ) tree followed by 100 times bootstrapping, and Principal Coordinate Analysis biplot (PCoA) (Freeland et al. 2011, Podani 2000) were used for this purpose.

DARwin ver. 5 (2012), was used for these analyses.

Genetic differences among the studied populations were determined by: 1-AMOVA (Analysis of molecular variance) test (with 1000 permutations), and 2-Nei,s Gst analysis of GenoDive ver.2 (2013) (Meirmans and Van Tienderen 2004). Moreover, to avoid possible problem caused by the dominant nature of ISSR markers, Hickory test (Hickory program ver. 1.0) that is a Bayesian approach was used to reveal populations, genetic differentiation (Holsinger et al. 2003).

The genetic structure of geographical populations was studied by Bayesian based model STRUCTURE analysis (Pritchard et al. 2000). Data were scored as dominant markers (Falush et al. 2007).

RESULTS AND DISCUSSION Cytology Linum austriacum populations studied showed n = 9 (2n = 2x = 18) chromosome number (Table 1, Figure 1, AE). The mean value for total chiasmata varied from 16.36 in Tehran-Lashkarak population to 20.38 in Tehran population. These populations had the lowest and highest values of terminal chiasmata too (15.27 and 19.21 respectively). The lowest value of intercalary chiasmata (0.28) occurred in Salavat-abad population, while the highest value of the same parameter occurred in Tehran population (1.17). Although these populations are diploid and mostly formed bivalents (Table 1), they formed few univalent and quadrivalents in metaphase I cells (Figure 1).

The chromosomes mostly showed normal segregation during anaphase and telophase stages, but laggard

NOORMOHAMMADI et al. – Genetic diversity of Linum austriacum

147

chromosomes and micronuclei were formed in some cases (Figure 1).

ANOVA test showed significant difference (p<0.05) for chiasma frequency and chromosome pairing among populations studied. Pearson correlation determined among ecological and meiotic characters showed significant positive correlation between longitude and the mean number of quadrivalents as well as between latitude and mean number of quadrivalents. Significant negative correlation was observed between longitude and the mean number of univalents.

PCA biplot of meiotic characters (Figure 2), separated the populations studied in distinct groups, indicating cytogenetic differences of the populations studied, also supported by ANOVA test. It also showed that, Tehran population was differentiated from the other populations due to its intercalary chiasmata and number of quadrivalents, while Salavat-abad population was differentiated from the others due to mean number of total chiasmata, ring bivalents and terminal chiasmata. The number of rod bivalents differentiated Tabriz-Ahar population, while No. of univalents separated Roodbar population from the other populations studied.

population genetic diversity was investigated by using Jaccard similarity index. In Saleh-abad population of Hamedan (Pop. 1), Jaccard similarity among plants of this population ranged from 0.26-0.94.

Similarly, in Hamekasi Village population of Kordestan (Pop. 2), Jaccard index ranged from 0.43-0.81. In Salavatabad population (Pop. 3), the range of Jaccard index was 0.34-1.00, while the same value in Abidar population of Sanandaj (pop 4) was 0.38-0.90. STRUCTURE analysis (Figure 3) that is based on Bayesian approach also revealed the occurrence of a higher degree of within-population genetic variability in Salavat-abad population (Pop. 3).

Pearson coefficient of correlation determined between genetic diversity parameters and altitude, produced a significant negative correlation (r =-0.85, P<0.01) with the number of effective alleles only (Table 3). Longitude did not show correlation with genetic diversity parameters, but latitude had a significant negative correlation with Shanon Information Index (r =-0.90, P<0.01), mean gene diversity (r =-0.88, P<0.01) and mean unbiased gene diversity (r =0.86, P<0.01 P<0.01; Table 3).

Within-population genetic diversity Genetic diversity parameters determined among 4 populations studied are presented in Table 2. The highest level of genetic polymorphism occurred in Hamekasi Village population of Hamedan Province (Pop. 2) (42.42%), while the lowest value of the same parameter occurred in Saleh-abad, Hamedan Province (Pop. 1) and Salavat-abad population, Kurdistan Province (Pop. 3) (40.40%). The highest value for effective No. of alleles (1.326), I (0.258) and gene diversity (0.179) occurred in Abidar population of Kurdistan Province (Pop. 4). Within-

Pop

Table 2. Genetic diversity parameters in populations studied N

Na

Ne

I

He

UHe

%P

15.000 0.899 1.256 0.210 0.142 0.147 40.40% 1 19.000 0.990 1.264 0.227 0.153 0.157 42.42% 2 20.000 0.859 1.292 0.242 0.166 0.170 40.40% 3 16.000 0.899 1.326 0.258 0.179 0.185 41.41% 4 Abbreviations: Na = No. of different Alleles, Ne = No. of Effective alleles, I = Shannon's Information Index, He = Gene diversity, UHe = Unbiased gene diversity, and % P = Percentage of polymorphism. Populations 1-4 are: Saleh-abad and Hamekasi Village from Hamedan Province and Salavat-abad and AbidarSanandaj from Kurdistan Province respectively.

Table 1. Cytogenetic features of L. austriacum populations studied.

Altitude n TOX IX (ft) Tehran-Lashkarak Tehran 35°15´.50″ 51°34´.00″ 2100 9 11.23 1.00 Roodbar Gilan 36°50´.00″ 49°25´.00″ 544 9 10.65 0.15 Salavat-abad Hamedan 35°08´.00″ 47°52´.00″ 1900 9 12.04 0.82 Tabriz-Ahar East Azarbayejan 38°09´.00″ 46°39´.00″ 3809 9 10.67 0.75 Abidar-Sanandaj Kurdistan 35°19´.00″ 46°57´.00″ 1645 9 10.5 0.64 Abbreviations: TOX = Total chiasmata, TX = Terminal chiasmata, IX = Intercalary bivalents, I = Univalents, IV = Quadrivalents.

Population

Province

Longitude Latitude

TX

ROD RB

10.23 6.70 10.5 7.04 11.23 5.91 9.92 7.33 9.86 7.36 chiasmata, RB

I

IV Voucher No.

1.87 0.10 0.20 1.77 0.19 0.04 2011126 2.91 0.14 0.04 2011108 1.58 0.17 0.00 2011136 1.5 0.28 0.00 2011112 = Ring bivalents, ROD = Rod

Table 3. Correlation between geographical features and genetic diversity parameters N Na Ne I He UHe %P Altitude Longitude Latitude N 0 Na 0.09214 0 Ne -0.01326 -0.41076 0 I 0.22846 -0.28382 0.96518 0 He 0.18355 -0.32895 0.97856 0 0.99813 UHe 0.13186 -0.33415 0.98731 0 0.99446 0.99863 %P 0.21938 0.005495 0.15685 0.10866 0.10047 0 0.90224 altitude 0.5045 0.23777 -0.72148 -0.74822 -0.78166 -0.0634 0 -0.8529 longitude 0.37928 -0.76166 -0.09971 -0.09805 -0.08002 -0.1033 -0.81555 0.429 0 latitude -0.61235 0.22796 -0.78123 -0.11801 0 -0.90863 -0.88952 -0.86438 -0.18283 0.36649 Abbreviations: Na = No. of different Alleles, Ne = No. of Effective alleles, I = Shannon's Information Index, He = Gene diversity, UHe = Unbiased gene diversity, and % P = Percentage of polymorphism.

148

B I O D I V E R S IT A S

16 (2): 145-150, Ocotober 2015

Figure 1. Representative meiotic cells in L. austriacum populations studied. A-E = A: metaphase I cell, B: univalent (arrows), C: laggard chromosome, D and E: metaphase I cells

Figure 2. PCA biplot of meiotic characters. Abbreviations: TOX = Total chiasmata, TX = Terminal chiasmata, IX = Intercalary chiasmata, RB = Ring bivalents, ROD = Rod bivalents, I = Univalents, IV = Quadrivalents.

NOORMOHAMMADI et al. – Genetic diversity of Linum austriacum

149

Figure 3. STRUCTURE plot showing higher degree of withi-population genetic diversity in population. Populations 1-4 are Saleh-abad, Hamekasi village, Salavat-abad and Abidar, respectively

Genetic differentiation of populations AMOVA test showed significant differences among the studied populations (p<0.01). It showed that 63% of total variation is due to, among populations and 37% due to within populations. Irrespective of the good genetic variability observed within each population, Neighbor Joining tree of all 70 plants separated the studied populations from each other (data not shown). The plant specimens of each population were placed close to each other and formed a separate group. Moreover, high values of B (>0.52) showed great genetic difference among pairs of populations which support AMOVA result. These results indicated genetic distinctness of the studied populations.

Mantel test performed between genetic distance and geographical distance showed no significant correlation (R2 = 0.09, p = 0.39). However, Fst values of populations showed negative significant correlation with the Eastern distribution (r =-.92, p = 0.05), and high negative (but not significant) correlation with altitude of populations (r =0.81). Fst values showed high (but not significant) positive correlation with Western distribution and minimum temperature.

Nm values obtained for all ISSR loci in the studied populations ranged from 0.0 to 1.0, with the mean Nm value of 0.44. This is a moderate value and indicates a moderate degree of gene flow among the studied populations.

Discussion Linum austriacum populations studied showed n = 9 (2n = 2x = 18) chromosome number, supporting Öztürk et al. (2009) report. Although these populations are diploid and mostly formed bivalents, they formed a few quadrivalents in metaphase I cells. Quadrivalent were formed due to the occurrence of the heterozygote translocations, which may have adaptive value (Sheidai et al. 2012). Cytogenetic studies performed by Gill and Yermanos (1967) in six 18-chromosome Linum taxa and nine of their interspecific hybrids, also indicated the role of translocations in Linum species diversification. They showed that L. altaicum differs from L. alpinum, L. austriacum, L. julicum, L. narbonense, and L. perenne by one reciprocal translocation. L. austriacum and L. narbonense, and L. julicum and L. narbonense also differed by one translocation, whereas L. perenne and L. narbonense differed by two translocations.

Variation in chiasma frequency and localization is genetically controlled and has been reported in several plant species (Quicke 1993; Sheidai et al. 1999). Such a variation in species or populations with the same chromosome number is considered a means for generating new forms of recombination influencing the variability within natural populations in an adaptive way (Rees and Dale 1974).

Therefore, significant difference observed for chiasma frequency and chromosome pairing among Linum austriacum populations indicate a change in genetic control of chromosome pairing during population diversification.

Significant positive correlation between longitude and the mean number of quadrivalents, as well as between latitude and mean number of quadrivalents, indicate that heterozygote translocations may have played a role in response to these ecological parameters.

ISSR analysis of the studied populations revealed almost high degree of within population genetic variability and significant genetic differentiation among populations (significant AMOVA result). However, in spite of significant genetic difference among populations, we did not observe isolation by distance (IBD) (Mantel test showed no correlation between genetic distance and geographical distance of the studied populations). This result suggested some degree of gene flow among populations that are supported by the fact that Fst values of populations decreased towards Eastern distribution (possibly due to limited occurrence of gene flow).

However, the studied populations become genetically more differentiated towards the western part of the country where the minimum temperature is lower.

Genetic variability of these populations was reduced in response to an increase in altitude (Pearson coefficient of correlation produced a significant negative correlation between altitude and the number of effective alleles). These results reveal complex interaction between genetic diversity distribution of Linum austriacum populations and environmental features.

In the present study, irrespective of the genetic variability observed within each population, NJ tree of all 70 plants separated the studied populations from each other. The plant specimens of each population were placed close to each other and formed a separate group. This clearly reveals that each local population has its own specific genetic contents along the altitude its plants grow.

150

B I O D I V E R S IT A S

16 (2): 145-150, Ocotober 2015

This is particularly true for Salavat-abad population of Kurdistan Province (Pop. 3) that formed a distinct cluster and was placed far from the other studied populations.

Evaluation of within and among-population genetic variations have been considered to prioritize populations for conservation efforts (Petit et al. 1998), high withinpopulation variation. These populations may have increased likelihood of persistence over less variable population and hence the ability of a population to contribute demographically to the species through time, and have increased adaptability in the face of future environmental change.

Genetic diversity within populations can vary along altitudinal gradients. In many cases the populations at intermediate altitudes have greater diversity than populations at lower and higher altitudes (see for example, Gapare et al. 2005; Ohsawa and Ide 2008; Di et al. 2014).

REFERENCES Abou El-Nasr THS, Mahfouze HA. 2013. Genetic Variability of Golden Flax (Linum usitatissimum L.) Using RAPD Markers. World Applied Science Journal 26: 851-856.

Austerlitz F, Mariette S, Machon N, Gouyon PH, Godelle B. 2000. Effects of colonization processes on genetic diversity: differences between annual plants and tree species. Genetics 154: 1309-1321.

Di XY, Liu KW, Hou SQ, Ji PL, Wang YL. 2014. Genetic variation of hazel (Corylus heterophylla) populations at different altitudes in Xingtangsi forest park in Huoshan, Shanxi, China. Plant Omics Journal 7:213-220.

Falush D, Stephens M, Pritchard JK. 2007. Inference of population structure using multilocus genotype data: dominant markers and null alleles. Molecular Ecology Notes 7 (4): 574-578.

Freeland JR, Kirk H, Peterson SD. 2011. Molecular Ecology (2nd ed).

UK: Wiley-Blackwell.

Fu YB. 2006. Redundancy and distinctness in flax germplasm as revealed

by RAPD dissimilarity. Plant Genetic Resources 4: 117–124.

Fu YB, Allaby RG. 2010. Phylogenetic network of Linum species as revealed by non-coding chloroplast DNA sequences. Genetic Resources Crop Evolution 57: 667–677.

Gapare WJ, Aitken SN, Ritland CE. 2005. Genetic diversity of core and peripheral Sitka spruce (Picea sitchensis (Bong.) Carr) populations: implications for conservation of widespread species. Biological Conservation 123:113-123.

Gill KS, Yermanos DM. 1967. Cytogenetic Studies on the Genus Linum II. Hybrids Among Taxa With Nine as the Haploid Chromosome Number. Crop Sciences 7: 627-631.

Heather K, Freeland JR. 2011. Applications and implications of neutral versus non-neutral markers in molecular ecology. International Journal of Molecular Sciences 12: 3966-3988.

Holsinger KE, Lewis PO. 2003. Hickory: a package for analysis of population genetic data V1.0. Available at http://www.eeb.uconn.edu; Accessed 2003.

Krizman M, Jakse J, Baricevic D, Javornik B, Mirko P. 2006. Robust CTAB-activated charcoal protocol for plant DNA extraction. Acta agricultural Slavonia 87: 427 – 433.

Meirmans PG, Van Tienderen PH. 2004. GENOTYPE and GENODIVE: two programs for the analysis of genetic diversity of asexual organisms. Molecular Ecology Notes 4: 792e794.

Mohagheghzadeh A, Schmidt TJ, Alfermann AW. 2002. Arylnaphthalene lignans from in vitro cultures of Linum austriacum. Journal Natural Production 65: 69-71.

Muir AD, Westcott ND (eds.). 2003. Flax: The genus Linum. London, UK: Taylor and Francis, 307 pages.

Ohsawa T, Ide Y. 2008. Global patterns of genetic variation in plant species along vertical and horizontal gradients on mountains. Global Ecology Biogeography 17: 152-163. Öztürk M, Martin E, Dinç M, Duran A, Özdemir A, Çetin Ö. 2009. A Cytogenetical Study on Some Plants Taxa in Nizip Region (Aksaray, Turkey). Turkish Journal of Biology 33: 35-44.

Petit RJ, Mousadik A, Pons O. 1998. Identifying populations for conservation on the basis of genetic markers. Conservation Biology 12: 844-855.

Podani J. 2000. Introduction to the Exploration of Multivariate Data [English translation], Leide, Netherlands: Backhuyes.

Pritchard JK, Stephens M, Donnelly P. 2000. Inference of population structure using multilocus genotype data. Genetics 155: 945-959.

Pujol B, Pannell JR. 2008. Reduced responses to selection after species range expansion. Science 321: 96.

Quicke DLJ. 1993. Principles and techniques of contemporary taxonomy.

Glasgow, Blackie Academic & Professional.

Rees H, Dale PJ. 1974. Chiasma and variability in Lolium and Festuca populations. Chromosoma 47: 335-351.

Sheidai M, Farahani F, Talebi SY, Noormohammadi Z. 2015. Genetic and morphological analyses of distyly in Linum mucronatum (Linaceae).

Phytologia Balcanica 21:13-19.

Sheidai M, Saeed AM, Zehzad B. 1999. Meiotic studies of some Aegilops (Poaceae) species and populations in Iran. Edinburgh Journal of Botany 56: 405-419.

Sheidai M, Seif E, Nouroozi M, Noormohammadi Z. 2012. Cytogenetic and molecular diversity of Cirsium arvense (Asteraceae) populations in Iran. Journal of Japanese Botany 87: 193-205.

Sheidai M, Zanganeh S, Haji-Ramezanali R, Nouroozi M, Noormohammadi Z, Ghsemzadeh-Baraki S. 2013. Genetic diversity and population structure in four Cirsium (Asteraceae) species.

Biologia 68: 384-397.

Sheidai M, Ziaee S, Farahani F, Talebi SY, Noormohammadi Z, Hasheminejad-Ahangarani-Farahani Y. 2014. Infra-specific genetic and morphological diversity in Linum album (Linaceae). Biologia 69(1): 32-39.

Talebi SM, Sheidai M, Atri M, Sharifnia F, Noormohammadi Z. 2012.

Genome size, morphological and palynological variations, and heterostyly in some species of the genus Linum L. (Linaceae) in Iran.

African Journal of Biotechnology 11: 16040-16054.

Weising K, Nybom H, Wolff K, Kahl G. 2005. DNA Fingerprinting in Plants. Principles, Methods, and Applications. (2nd ed.). CRC Press.

Boca Rayton, Fl., USA

B I O D I V E R S IT A S Volume 16, Number 2, October 2015 Pages: 151-155

ISSN: 1412-033X E-ISSN: 2085-4722 DOI: 10.13057/biodiv/d160208

Short Communication: Felids of Sebangau: Camera trapping to estimate activity patterns and population abundance in Central Kalimantan, Indonesia ADUL1,2, BERNAT RIPOLL1, SUWIDO H. LIMIN2, SUSAN M. CHEYNE1,3,♥ 1

The Orangutan Tropical Peatland Project (OuTrop). Jalan Semeru No. 91, Bukit Hindu, Palangka Raya 73112, Kalimantan Tengah, Indonesia Center for International Cooperation in Sustainable Management of Tropical Peatland (CIMTROP), University of Palangka Raya. Jl. Yos Sudarso, Kampus UNPAR Tunjung Nyahu, Palangka Raya 73111, Central Kalimantan, Indonesia 3 Wildlife Conservation Research Unit (WildCRU), Department of Zoology, Oxford University. Recanati-Kaplan Centre, Abingdon Road, Tubney House, Tubney, Oxfordshire OX13 5QL, Inggris. Tel./Fax.: +44 1865 611100. ♥email: scheyne@outrop.com

2

Manuscript received: 2 Juni 2015. Revision accepted: 27 Juni 2015.

Abstract. Adul, Ripoll B, Limin SH, Cheyne SM. 2015. Felids of Sebangau: Camera trapping to estimate activity patterns and population abundance in Central Kalimantan, Indonesia. Biodiversitas 16: 151-155. We present data from a seven year camera trapping project in the Natural Laboratory of Peat-Swamp Forest in the Sebangau Catchment, Central Kalimantan, Indonesia (2008-2015). The project has identified four of the five felids on Borneo: Sunda clouded leopard (Neofelis diardi; macan dahan), flat-headed cat (Prionailurus planiceps; kucing tandang), marbled cat (Pardofelis marmorata; kucing batu) and leopard cat (Prionailurus bengalensis; kucing kuwuk). All of these species are protected by Indonesian Law (PP. 7/1999) and are listed on the IUCN Red List. The four species have clearly defined activity budgets, especially the smaller cats, to allow niche partitioning. We have identified this forest block as an important area for numbers of all four species in the global context of cat populations. The bay cat (Pardofelis badia (kucing merah) has not been found in tropical peat-swamp forest at time of writing.

Keywords: Activity patterns, camera trapping, felids, population abundance, Sebangau

INTRODUCTION Robust population density estimates or estimates of total population size of any of the four threatened Bornean felids are completely lacking and the extent of hunting and trade of these species and their prey in Indonesian Borneo is unclear. Peat-swamp forest is the dominant lowland forest type in Indonesian Borneo and represents 68,000 km2 of land (Page et al. 1999), thus these forests may be of vital importance for the future of felids, in particular the Sunda clouded leopards (Cheyne et al. 2013) and flatheaded cats (Wilting et al. 2010). The Sebangau (sometimes spelled Sabangau) catchment (5,600km2) has a history of disturbance, selective logging (legal and illegal), fire and hunting yet the forest remains relatively contiguous with good forest cover, which is important for the conservation of felids (Nowell and Jackson 1996). The effect of different macro-habitat types, micro-habitat characteristics and disturbance on these felids remains unstudied. Initial data from Sebangau suggest that there is a density of 1.81 clouded leopards/km2 in the forest across all three habitat types (Mixed Swamp Forest (MSF, Low Interior (LIF) and Tall Interior Forest (TIF), but this preliminary study suggests that the Sebangau could hold a substantial population of Sunda clouded leopards (Cheyne et al. 2013).

This research is a joint venture between the Orangutan Tropical Peatland Project (OuTrop), CIMTROP and the

Wildlife Conservation Research Unit, University of Oxford and aims to facilitate the conservation of Borneo’s endangered wild cats by merging pioneering ecological research, host country capacity building and environmental education within Indonesia. Our research activities will provide an insight into the relative abundance of each species, and the long-term impacts of various forest management practices on these little known felids information which is essential to facilitate the development of effective management and conservation measures. This initiative is currently the only research project focusing on the ecology of Borneo’s wild cats in Kalimantan.

Additionally this project is now the longest running felid and prey project in Kalimantan and we hope that with funding to continue this important project in the long-term (>6 years) we can make a significant contribution to the understanding of these elusive and charismatic species as well as facilitating training and capacity building for local scientists and communities.

The objectives of this long-term project are: (i) To study the status, behavior and ecology of the four felid species found in Sebangau. (ii) To investigate the density and population size. (iii) To investigate the community structure, niche partitioning and intra-guild relationships. (iv) To assess the impacts of habitat alteration and habitat requirements of mammals in the study area.

152

B I O D I V E R S IT A S 16 (2): 151-155, Ocotober 2015

MATERIALS AND METHODS Study site This study aims to identify the felid biodiversity, population and behavior in the Natural Laboratory for PeatSwamp Forest (NLPSF) in the Sebangau catchment, Central Kalimantan, Indonesia. The study was initiated in May 2008 and has been running continuously since then in the 50km2 NLPSF. Robust population density estimates or estimates of total population size of any of the threatened Bornean felids are lacking, particularly in Indonesian Borneo. Sebangau is a seasonally flooded forest and is underwater for 9 of 12 months. It is the largest area of contiguous lowland rainforest remaining in Kalimantan (5,600km2, Figure 1; Page 2002).

Methods By using passive infrared camera traps we investigated the distribution, habitat associations, activity and density of cat species. Pairs of camera traps were placed along animal trails, human trails, logging roads and watering areas.

Photographic capture rates of species were used to calculate a Relative Abundance Index of (RAI) for each cat species and capture-recapture techniques will be used to estimate the density of different species in which individuals can be distinguished from one another due to their distinctive pelage patterning. Time of the picture and

date were used to describe the daily activity patterns.

Relative abundance index The capture probability at each location was not uniform (repeated measures analysis of variance, F = 0.68, df = 12, P = 0.942). This does not affect the calculation of the relative abundance index, which discounts all locations where felids have not been captured. The relative abundance index was calculated as

Where i is a trap location and tn is a trap night at the ith location and d is a detection of the species at the ith location. Detection is one capture per location during one trap night (Kawanishi and Sunquist 2004, Azlan and Lading 2006, Azlan and Sharma 2006). This index cannot account for frequency of trail use and degree of arboreality, all of which will affect detection (Giman et al. 2007). To calculate the relative abundance index we assumed that photographs represent independent contacts between animal and camera and that the population is closed (Rowcliffe and Carbone 2008, Rowcliffe et al. 2008). To ensure the assumptions of a closed population were met only data from a 90 day period were analyzed.

Figure 1. Location of the Natural Laboratory for the Study of Peat-Swamp Forest (NLPSF) within Sebangau tropical peat-swamp forest and Borneo. Forest cover is shaded gray, non-forested areas white. Adapted from (Ehlers Smith et al. 2013)

ADUL et al. â&#x20AC;&#x201C; Felids of Sebangau, Central Kalimantan

RESULTS AND DISCUSSION Distribution and population All felids in Sebangau are non-endemic i.e. they have ranges that also extend outside Borneo (Figure 2; IUCN 2013).

Activity patterns Data are presented on the % of total photo captures for each of the four felids. Data are from May 2008 - April 2015.Clouded leopards are active throughout the day though more captures are obtained at night (1700-0500h) thus they are predominantly nocturnal (Figure 3).

Flat-headed cats have a more irregular capture rate though again active throughout the day, more captures are

153

obtained at night thus they are predominantly nocturnal (Figure 4).

Leopard cats have a more regular capture rate. They appear to be active both during the day and night though appears to avoid the hottest time of the day (1100-1300h, Figure 5).

Marbled cats have a regular capture rate with the majority of photos taken during the day (0500-1600h) suggesting they are diurnal (Figure 6).

Relative abundance index all felids Clouded leopards are the most commonly captured cat on the camera traps, followed by leopard cat, flat-headed cat and marbled cat (Figure 7).

A

B

C

D

Figure 2. Natural distribution of Sebangau felids. A. Sunda Clouded Leopard - Neofelis diardi IUCN Vulnerable, B. Flat-Headed Cat Prionailurus planiceps IUCN Endangered, C. Marbled Cat - Pardofelis marmorata IUCN Vulnerable, D. Leopard Cat - Prionailurus bengalensis IUCN Least Concern (IUCN 2013)

154

B I O D I V E R S IT A S 16 (2): 151-155, Ocotober 2015

Table 1. Summary of global populations and records from the NLPSF

Clouded leopard Leopard cat Marbled cat Flat-headed cat

Global population estimates (IUCN 2013) <2,500 >50,000 <10,000 <2,500

NLPSF individuals 1-4 ~200 ~100 ~150

Sebangau individuals (Cheyne et al. 2013) 40-246 NA NA NA

Total independent photos 152 74 41 30

Number of known individuals 9â&#x2122;&#x201A;1â&#x2122;&#x20AC; NA NA NA

Figure 3. Activity patterns of clouded leopards in Sebangau.

Figure 7. RAI of all felids in Sebangau.

Figure 4. Activity patterns of flat-headed cats in Sebangau.

Figure 5. Activity patterns of leopard cats in Sebangau

Figure 6. Activity patterns of marbled cats in Sebangau.

Discussion These data represent almost double the information presented in (Cheyne and Macdonald 2011). The nocturnal activity of the clouded leopards is confirmed from the present dataset but flat-headed cats appear to be more diurnal than reported in Cheyne and Macdonald (2011).

Leopard cats are avoiding the hottest part of the day and we present new information on the marbled cat: based on 41 photos they are predominantly diurnal (more discussion for this information is needed). The clouded leopard is the largest predator in Borneo and a different activity pattern would be expected in the absence of tigers (Seidensticker 1976).

This is the first study for these endangered felids in any tropical peat-swamp forest, although we have been at pains to emphasize the methodological caveats. There is an estimated 68,000 km2 in of tropical peat-swamp forest in Kalimantan (Page et al. 1997, 1999; Cheyne and Macdonald 2011). We conclude that even with these preliminary density range estimates that tropicalpeatswamp forest may be more important to cat conservation than previously supposed. If our evidence is typical then, by extrapolation, the totality of peat forest in Kalimantan might harbor a significant population of clouded leopards, leopard cats, flat-headed cats and marbled cats. No bay cats have been reported in peat-swamp forest and more work is needed to determine if bay cats are present in this habitat type. Local surveys suggest that hunting pressure is relatively low, and thus that habitat loss and fragmentation is likely to be the greatest threat.

In conclusions, density of clouded leopards = 0.72 to 4.41 individuals per 100 km2. (No discussion about this in previous paragraphs); Activity patterns differ for the 4 felid species, especially significant for the Marbled Cat, niche partitioning is related to feeding ecology and activity patterns, but further research and analysis is required to understand this; Population numbers for the small cats are

ADUL et al. â&#x20AC;&#x201C; Felids of Sebangau, Central Kalimantan

estimates only and are the subject of further work; PeatSwamp Forest habitat is critical to preserve populations of the four felid species.

ACKNOWLEDGEMENTS RISTEK, CIMTROP and the University of Palangka Raya for permissions. The people and administrations of Kereng Bangkirai, Kecamatan Sebangau, Kota Palangka Raya and Provinsi Kalimantan Tengah. This work was funded through a grant to the Wildlife Conservation Research Unit, University of Oxford from Panthera as well as Point Defiance Zoo and Aquarium Holly Reed Conservation Fund and the Fresno Chaffee Zoo. We thank all our collaborators, staff, volunteers, interns, and students, without whose efforts this work would not have been possible.

REFERENCES Azlan JM, Lading E. 2006. Camera trapping and conservation in Lambir Hills National Park, Sarawak. Raffles Bull Zool 54: 469-475.

Azlan JM, Sharma DSK. 2006. The diversity and activity patterns of wild felids in a secondary forest in Peninsular Malaysia. Oryx 40: 36-41.

Cheyne SM, Macdonald DW. 2011. Wild felid diversity and activity patterns in Sabangau peat-swamp forest, Indonesian Borneo. Oryx 45: 119-124.

Cheyne SM, Stark D, Limin SH, Macdonald DW. 2013. First estimates of population ecology and threats to Sunda Clouded Leopards (Neofelis diardi) in a Peat-swamp Forest, Indonesia. Endanger Species Res 22: 1-9.

155

Ehlers-Smith DA, Ehlers-Smith YC, Cheyne SM. 2013. Home range use and activity patterns of red langurs in Sabangau Tropical Peat-Swamp Forest, Central Kalimantan, Indonesia. Int J Primatol DOI 10.1007/s10764-013-9715-7.

Giman B, Stuebing R, Megum N, McShea WJ, Stewart CM. 2007. A camera trapping inventory for mammals in a mixed use planted forest in Sarawak. Raffles Bull Zool 55: 209-215.

IUCN. 2013. The IUCN Red List of Threatened Species. http://www.iucnredlist.org/ Kawanishi K, Sunquist ME. 2004. Conservation status of tigers in a primary rainforest of Peninsular Malaysia. Biol Conserv 120: 329344.

Nowell K, Jackson P. 1996. Wild cats. Status survey and conservation action plan. IUCN, Gland Page SE. 2002. The biodiversity of peat swamp forest habitats in S.E. Asia; impacts of land-use and environmental change; implications for sustainable ecosystem management. University of Leicester, United Kingdom.

Page SE, Rieley JO, Doody K, Hodgson S, Husson S, Jenkins P, Morrogh-Bernard H, Otway S, Wilshaw S. 1997. Biodiversity of tropical peat swamp forest: a case study of animal diversity in the Sungai Sebangau catchment of Central Kalimantan, Indonesia. In: Rieley JO, Page SE (eds) Tropical peatlands. Samara Publishing Limited, Cardigan.

Page SE, Rieley JO, Shotyk Ă&#x2DC;W, Weiss D. 1999. Interdependence of peat and vegetation in a tropical peat swamp forest. Phil Trans R Soc London B 354: 1807-1885 Rowcliffe JM, Carbone C. 2008. Surveys using camera traps: are we looking to a brighter future? Anim Conserv 11: 185-186 Rowcliffe JM, Field J, Turvey ST, Carbone C. 2008. Estimating animal density using camera traps without the need for individual recognition. J Appl Ecol 45: 1228-1236 Seidensticker J. 1976. On the ecological separation between tigers and leopards. Biotropica 8: 225-234 Wilting A, Cord A, Hearn AJ, Hesse D, Mohamed A, Traeholdt C, Cheyne SM, Sunarto S, Jayasilan MA, Ross J, Shapiro AC, Sebastian A, Dech S, Breitenmoser C, Sanderson J, Duckworth JW, Hofer H. 2010. Modelling the species distribution of Flat-Headed Cats (Prionailurus planiceps), an endangered South-East Asian small felid.

PLoS ONE 5(3): e9612. doi: 10.1371/journal.pone.0009612

B I O D I V E R S IT A S Volume 16, Number 2, October 2015 Pages: 156-160

ISSN: 1412-033X E-ISSN: 2085-4722 DOI: 10.13057/biodiv/d160209

The nutritional quality of captive sambar deer (Rusa unicolor brookei Hose, 1893) velvet antler GONO SEMIADIď&#x201A;Š, YULIASRI JAMAL Research Centre for Biology, Indonesian Institute of Sciences, Jl. Raya Jakarta-Bogor Km. 46, Cibinong Bogor 16911, West Java, Indonesia.

Tel./Fax.:+62-21-8765056; ď&#x201A;Šemail: semiadi@yahoo.com Manuscript received: 7 May 2015. Revision accepted: 30 June 2015.

Abstract. Semiadi G, Jamal Y. 2015. The nutritional quality of captive sambar deer (Rusa unicolor brookei Hose, 1893) velvet antler.

Biodiversitas 16: 156-160. Deer farming has been a well-developed agriculture diversification worldwide since 1970s. To the present time information concerning the nutrient value of velvet antler of sambar deer (Rusa unicolor brookei Hose, 1893) is limited. Therefore, a study on the nutritional quality of velvet antler of captive sambar deer was conducted. Velvet antlers were obtained from captive sambar deer in Penajam Paser Utara, East Kalimantan, Indonesia, and were analyzed for its nutritional quality from the hard and soft parts. The results showed that fresh weight of a pair of velvet antler (approx. 70 days post hard antler cast) was 523.1 g (SE = 49.99). In the soft part of the velvet antler, ash content was 25.9% DM (SE= 0.78) as compared to 40.4% DM (SE = 1.07) in hard part, whilst the lipid and protein contents from the soft part were 3.3% DM (SE = 0.20) and 70.8% DM (SE = 2.07), respectively, higher compared to those in the hard part being 1.9% DM (SE = 0.12) and 59.5% DM (SE = 1.92), respectively. From the study it can be concluded that the production of velvet antler from captive sambar deer seemed to be far from its genetic potency, and the nutritional qualities of the velvet antler contents were not different from the red deer Cervus elaphus.

Key words: nutritional quality, production, Rusa unicolor brookei, sambar deer, velvet antler

INTRODUCTION Deer farming has been one of the fastest developed new livestock diversification worldwide since 1970s (van den Berg and Garrick 1997, Hoffman and Wiklund 2006). At present, the species being bred are not only limited to temperate origin species, but also from tropical part, such as rusa deer (Rusa timorensis) and sambar deer (Rusa unicolor; Sookhareea et al. 2001; Haigh 2002), although farming the sambar deer is very limited to Australia, Malaysia, and Thailand. The main products of the deer farm are venison and velvet antler, with by-products known as pitzel, dry tail and sinew are still having high market values in oriental markets, such as in Korea and China (Kong and But 1985; Kim 2001; Kim et al. 2004).

The culture of using velvet antler among Chinese medical practitioners as part of their traditional medicine has been known for hundred years. Some claims on those Chinese beliefs on the power of velvet antler in maintaining health, particularly related to rheumatism and the improvement of body vitality have been scientifically proven (Allen et al. 2002; Frolov et al. 2001; Shin et al.

2001; Sim and Sunwoo 2001). Study also showed that the extract of velvet antler of Formosan sambar deer (Rusa unicolor swinhoei) has the potential as the anti-infective activity against pathogenic Staphylococcus aureus (Dai et al. 2011). This accelerates the development of food supplement industry from velvet antler origin in the western part, in the forms of powder, slices, extract or tonic.

Indonesia has three native deer species; the Javan deer, sambar deer and Bawean deer (Axis kuhlii), besides the

deer introduced from India, spotted deer (Axis axis). The distribution of sambar deer in Indonesia is limited to Sumatra and Kalimantan islands (Wilson and Reeder 2013), whereas in Kalimantan the utilization of sambar venison is very high through poaching activities. From one district, no less than 120 heads of sambar per month were poached, providing no less than 234 kg venison that was sold in traditional market. Average of carcass weight from stag was 74.99 kg and from hind was 63.06 kg (Semiadi et al. 2004).

Under the Indonesian Wildlife Law, the native deer species are protected animals. However, they are possible to be utilized once has been bred in captivity. In 2002 a Decree of the Minister of Agriculture was issued concerning the inclusion of deer as prospective livestock.

However, the execution of this regulation is far from the reality. The latest Indonesian Animal Husbandry and Veterinary Law (UU no. 18/2009) has made possible for wildlife animal that has been bred in captivity, specifically for production purposes, to be adopted as a domesticated animal. The development of deer farming in Indonesia was initiated in 1990 by the establishment of a pilot project of sambar deer farm (Rusa unicolor brookei, Hose 1893) in Penajam Paser Utara District, East Kalimantan. At present, the number of deer being bred reaches 301 deer in an area of 15 ha paddock (IG Ngurah, pers. comm.).

To the present time, information related to the production of sambar deer is still very limited (Ismail and Hanoon 2008), and so does with the velvet antler quality (Jamal et al. 2005). Therefore, as part of the development strategy of deer farming in Indonesia, it is necessary that

SEMIADI & JAMAL â&#x20AC;&#x201C; The nutritional quality of captive sambar deer

the information related to the quality of velvet antler of sambar deer and the possibility of utilizing them as a food supplement is available. The purpose of this study was to understand the quality of captive sambar velvet antler from its nutritional values.

MATERIALS AND METHODS The research was conducted in a sambar deer farm in Penajam Paser Utara District, East Kalimantan. Velvet antlers were harvested from eight mature (> 4 years) stags, placed in a drop floor crush while velvet antler cutting was conducted. The cutting time for velvet antler was determined based on the antler physical condition, in which the main beam has not yet branched.

Method of velvet cutting followed Wilson et al. (2000).

On each of velvet antlers, around its ring block, local anesthetic injections were administered using Lidocaine (2% lidocaine hydrochloride) approximately 6-8 ml/antler.

The subcutaneous injections were circled in four to five places using a syringe of 1" x 20 G. After the injection, approximately 3-5 minutes later, tourniquet was placed around each ring block and velvet antler was cut.

Once it had been cut, the harvested velvet antlers were directly turned upside down and slanted 150 for five minutes to avoid excessive blood lost. They were cleaned from dust, weighed, and the length and diameter of the antler were then measured using polypropylene meter tape and digital micro-caliper (Yamato, Japan), respectively, twice each, then were put into plastic bag, labeled and stored in a freezer (-5oC). Velvet antler diameter was measured at the mid-point of the antler length. Prior being transported to the laboratory, the velvet antlers were put into ice boxes containing blue chips ice cooler to maintain their freezing level during the traveling. The time of arrival in laboratory was six hours with the antlers condition were still frozen, and then put into a deep freezer (-20oC) until the laboratory analysis process.

Before the velvet antler being processed, the antlers were thawed and the soft hair was burnt on a pressurized gas Bunsen burner. Left and right parts of the soft velvet antler part were then manually sliced thinly with a sharp knife, with a thickness of 3-5 mm, until it reached the hard part (semi ossified) that could not be cut manually by ordinary knife. The hard part was then cut into small pieces using a chopping knife. All samples that had been cut (soft and hard parts) were freeze dried for 18-24 hours, then ground using hammer mill (Retch Muhle, Germany) to pass through a sieve of 1 mm.

Analyses of nutrient content of antler were only done on the samples taken from the right side of the antler, representing the hard and soft parts. Moisture content was analyzed by putting into a ventilated oven at 105oC for 18 hours. The ash content was determined using a furnace at 550oC for 12 hours (AOAC 2005). All analysis was conducted in Nutrition Laboratory, Zoological Division of the Research Center for Biology, Indonesian Institute of Sciences (LIPI), Cibinong Bogor, West Java.

157

Mineral content analysis was conducted using the Atomic Absorption Spectrometry (AAS), for amino acids with chromatography technique (HPLC), fatty acids with gas chromatography technique (GC), total lipid with soxhlet technique and total nitrogen with Kjehdhal technique (AOAC 2005), conducted at the Integrated Chemical Laboratory, Faculty of Mathematics and Natural Science, Bogor Agricultural Institute (IPB), Bogor, West Java. The conversion to crude protein content was done by a multiplying factor of 6.25 to the nitrogen content.

Analyses of chemical components of antler were done on the samples taken from the left part of the antler, representing the hard and soft parts. Each sample was extracted with ethanol absolute placed in shakers (100 rpm per minute). The addition of alcohol solvent was done three times every 24 hours, 100 ml each, until reaching a total volume of 300 ml for each sample. The result of ethanol extraction was then evaporated using rotating evaporator at 50oC until it was free from the solvent. This process was conducted at the Phytochemistry Laboratory, Botany Division, Research Center for Biology, Indonesian Institute of Sciences (LIPI), Cibinong, West Java, Indonesia.

The analysis on chemical compounds from the extract was carried out at the Department of Natural Product Chemistry, Faculty of Pharmacy and Pharmaceutical Science at Fukuyama University, Hiroshima, Japan using Gas Chromatography Mass Spectrometry (GCMS system electron impact, Shimadzu Qp-5000, Japan), using the TC17 column (L=30 m, ď&#x192;&#x2020;= 0.25 mm, GL Science USA). The injection volume was 0.1 ul. The carrier gas was helium with a gas speed flow of 1.36 ml/minute and a column pressure of 90 kPa. The column temperature was programmed to be 100oC to 270oC with a temperature increase of 3oC per minute. The detector temperature (quadruple) was programmed to be constant at 270oC with energy of 1.25 kV. The injector temperature was 300oC. Identification of each peak was done using spectrum mass authentic from the National Institute Standard of Technology (NIST) library, ver. 6.2. Data were analyzed using the general linear model procedure of SAS ver. 9.0 (SAS 2002). Whenever, appropriate data were analyzed either by regression for the antler morphometry, and T-test or factorial analysis between hard and soft parts against its nutrient values (Steel and Torrie 1980).

RESULTS AND DISCUSSION Due to the lack of good management practice in managing stags for velvet antler production, it was difficult to obtain accurate data concerning the age of velvet antler growth when it was harvested. Therefore, observation on the shape of the main beam which almost to branch was used as an indicator for the optimum cutting time to obtain the best quality of velvet antler. On red deer (Cervus elaphus), cutting age of velvet antler was at 60-65 days post hard antler drop (Sunwoo and Sim 2001), coincided with unbranched condition of the main beam. However, from this study it was predicted that the ages of velvet

158

B I O D I V E R S IT A S 16 (2): 156-160, October 2015

antler of sambar deer that were harvested had never been more than 70 days old post antler cast (A Trasodiharjo pers. comm.)

The fresh mean weight of a pair sambar deer velvet antler was 523.1 g (SE = 49.99; n = 8) with the average overall moisture content of the velvet antler being 74.1 % (SE = 1.78; n= 8). The soft part of the velvet antler had its moisture content of 30.1% (SE = 4.0; n= 8) of the total dry matter weight. The velvet antler dimensions of the right and left parts showed a symmetrical shape, therefore no significant differences were found (Table 1). However, one antler did not have its first tine. The correlation between the length and diameter of the main beam was much higher (R2= 0.75; p<0.001) compared to that of the first tine (R2= 0.55; p<0.008). A symmetrical shape of antler was also showed in majority of wild Javan deer (Semiadi 1997).

The production of velvet antler cut that only reached 0.5 kg fresh weight per cutting time, indicated that the genotype quality of sambar stags as velvet antler producer was far from the expected. In Thailand, sambar deer velvet antler at 74-92 days of harvest age, could weight 820-1,640 g per side, with the length and circumference were 41-63 cm and 11.5-17.2 cm per side, respectively (Liangpaiboon et al. 1996). While in farmed red deer, the velvet antler production can reach up to 2.0 kg/cutting time (Haigh and Hudson 1993; Jeon and Moon 2001) and can be predicted from the age with an average genetic correlation of 0.74 with heritability estimates age from 2 to 8 years being 0.43 to 0.85 (van den Berg and Garrick 1997). Ismail and Jiwan (2013) suggested that the best velvet antler harvest time in sambar deer is at 49-63 days post hard antler casting when the antler length is 25-30 cm.

The low antler production in this study seems to be related with the unselected breeding system of sambar stags being managed in the premises. From the body weight condition, sambar deer were about 30-40% heavier than red deer, therefore it was still possible to have a higher velvet antler production, once the breeding system has been set up. In red deer industry, grading system of velvet antler was based on the combinations between the length, diameter and weight. Similar system must also be started to be developed for the velvet antler of sambar deer.

The results of ash, lipid and protein contents showed a very significant differences between parts of the antler (soft and hard) on the ash and lipid (p<0.001) and protein contents (P<0.005; Table 2). In the soft part, ash content was 36% lower, but lipid and protein contents were approximately 74% and 19%, respectively, higher than those were in the hard part. Values for protein and ash contents in this study were close to that of wapiti, sika and its hybrid deer species velvet antlers, except for ash, the current study tended to have 45% lower (Wang et al. 2004).

While from the Formosan sambar deer, the protein content of velvet antler was reported as 64% DM at the harvesting age of 75 Âą 2 days (Yun et al. 2009).

The best grade of velvet antler under the Korean market system is when the soft part of antler has the ash content below 25% DM (Kang et al. 2001). In this study, the soft part contained 25.9% DM ash, in which it was 30.1% of the antler total dry weight. Therefore, as a starting step, the use of physical parameter in cutting time on the velvet antler in

this study had a practical good indicator and almost fulfilled the quality requirement under the Korean standard.

There was no interactive correlation obtained between parts of antler (hard and soft) and the types of fatty acid, however, the concentrations of fatty acid was significantly different (p<0.001) between the two antler part, as well as the type of fatty acid contents (p<0.1085; Table 3).

Palmitic acid was the highest, while mistiric acid being the lowest concentration.

In term of amino acid contents, a very strong correlation was obtained (p<0.001) between the types of amino acids and antler parts (Table 4). Velvet antler of sambar deer contained 8 out of 9 essential amino acids, with only tryptophan group undetected. There was a tendency that amino acid concentration in the soft part was higher than that in the hard part. Glycine and glutamate groups were the ones with the highest concentration, followed by alanine, arginine and aspartate. Whilst methionine had the lowest concentration.

From Table 3 it can be seen that all fatty acid in velvet antler consisted of long chain fatty acid (14-24 carbon atoms), with the highest concentration was palmitic acid.

Linoleic and linolenic acids are known to function in maintaining cell structure and cell membrane. These two fatty acids are also functioned as the principle materials in synthesizing hormones, for the formation of blood coagulant, blood pressure, blood lipid concentration, immune response, responses on wounds and infections (Mahan and Arlin 1989). In the present study the content of both compounds were relatively low compared to the other fatty acid compounds.

Table 1. Fresh sambar deer velvet antler dimension used in the study.

Parts Right Left

Main beam (mean SE; First tine (mean SE; n=7) n=8) Length Diameter Length Diameter (cm) (mm) (cm) (mm) 22.6 (0.55) 29.9 (0.63) 13.0 (0.63) 22.5 (0.70) 22.9 (0.61) 29.8 (0.60) 12.1 (0.89) 22.4 (0.67)

Table 2. Chemical compositions of sambar deer velvet antler.

Part Hard Soft

Ash (%DM SE; n=16) 40.4 (1.07) 25.9 (0.78)

Fat (%DM SE; n=12) 1.9 (0.12) 3.3 (0.20)

Protein (%DM SE; n=6) 59.5 (1.92) 70.8 (2.07)

Table 3. Fatty acid composition from sambar deer velvet antler.

Fatty acids Behenic acid Lignoseric acid Linoleic acid Linolenic acid Myristic acid Oleic acid Palmitic acid Stearic acid

Hard part (%DM SE; n=6) 2.49 (0.227) 0.81 (0.033) 0.48 (0.113) 0.35 (0.022) 0.22 (0.033) 2.41 (0.496) 8.39 (0.382) 2.96 (0.491)

Soft part (%DM SE; n=6) 2.60 (0.227) 0.74 (0.097) 0.74 (0.088) 0.39 (0.032) 0.26 (0.030) 3.64 (0.561) 8.59 (0.315) 3.01 (0.241)

SEMIADI & JAMAL â&#x20AC;&#x201C; The nutritional quality of captive sambar deer

The essential amino acids concentration showed that the soft part had higher content than that in the hard part. Jeon et al. (2004) showed that feed sources created differences in velvet protein, lipid, amino acid and mineral composition. From this study, glycine was the amino acid with the highest concentration in both parts. Comparing the amino acid composition in velvet antler from red deer and sambar deer, it shows the consistency of glycine as the highest concentration component among all amino acids.

However, the concentration in red deer is higher than in sambar deer (15.58% vs. 9.07%; Sim and Sunwoo, 2001).

It was further reported that the amino acid group of aspartic acid, glycine, alanine and glutamic acid were the major components in temperate deer velvet antler. By observing cholesterol concentration or its derivates, velvet antler contained relatively low cholesterol compounds compared to other saturated fatty acids. The ethanol extract of velvet antler from both the soft and hard parts, consists of unsaturated long chain fatty acids, carboxylic acids with amine chains and one compound of cholesterol derivative.

Minerals content showed that there was a high significant interaction (p<0.001) between antler parts with the types of minerals (Table 5). Iron (Fe) was the microelement with the highest concentration in the velvet antler, in which the concentration in the soft part was 65% higher than that in the hard part. Calcium was the macro mineral with the highest concentration. Bubenik et al.

(2005) had shown that mineralization of temperate deer velvet antler was affected by the role of 17β estradiol (E2).

The analysis of chemical compound using GCMS resulted in unsatisfying outcome, as it was only capable of detecting fatty acid groups, but not the steroid hormone groups. Analysis of both antler parts, showed that both had 14 identical chemical compounds, but in different concentrations (Table 6).

Minerals play important roles in oxygen transportation, nervous system, the formation and maintenance of the bone itself. The range of minerals content in velvet antler of red deer is very wide (Table 7), considering that these very much depend on the calcification level in antler when being cut. Calcium is the most dominant one, considering its role in the formation and maintenance of bone. In sambar deer,

159

the mineral content in the hard part almost twice higher than that in the soft part. However, in general, the minerals content of the present sambar deer velvet antler is within that of the red deer (Table 7)(Haines and Suttie 2001).

From this study it can be concluded that the production of velvet antler of captive sambar deer was still far from its optimum potency. Whereas, the nutrient contents were close to that of red deer velvet antler values.

Table 4. Amino acid compositions from sambar deer velvet antler.

Amino acids Alanine Arginine Aspartate Phenylalanine Glycine Glutamate Histidine I-Leuisine Leusine Lysine Methionine Serine Threonine Tyrosine Valine

Hard part (%DM SE; n=6) 4.24 (0.135) 4.10 (0.122) 3.57 (0.141) 1.57 (0.079) 9.07 (0.226) 5.61 (0.187) 0.86 (0.071) 0.99 (0.039) 2.54 (0.133) 2.37 (0.116) 0.59 (0.022) 2.32 (0.099) 1.86 (0.095) 0.94 (0.052) 1.78 (0.091)

Soft part (%DM SE; n=6) 4.46 (0.208) 4.54 (0.216) 4.63 (0.173) 2.19 (0.097) 8.40 (0.517) 6.95 (0.249) 1.36 (0.097) 1.43 (0.046) 3.77 (0.148) 3.20 (0.141) 0.93 (0.021) 3.04 (0.125) 2.56 (0.107) 1.55 (0.041) 2.52 (0.106)

Table 5. Mineral compositions from sambar deer velvet antler.

Mineral Ca (%) K (%) Mg (%) Na (%) P (%) Co (ppm) Cu (ppm) Fe (ppm) Mn (ppm) Se (ppb)

Hard part (DM SE; n=6) 6.87 (0.504) 0.20 (0.028) 0.35 (0.030) 0.65 (0.04) 0.21 (0.005) 0.05 (0.000) 7.91 (1.082) 147.20 (23.950) 3.72 (0.39) 1.00 (0.289)

Soft part (DM SE; n=6) 3.97 (0.087) 0.45 (0.039) 0.23 (0.019) 0.94 (0.119) 0.20 (0.005) 0.05 (0.00) 9.16 (1.701) 223.73 (28.328) 3.80 (0.413) 0.85 (0.247)

Table 6. Chemical compositions from ethanol extraction of sambar deer velvet antler.

Components Methyl ester decanoic acid Hexadecanoic acid Palmitic acid 12-methyl-methyl ester tetradecanoic acid Methyl ester 13-docosenoic acid Methyl ester 11,14-eicosadienic acid Oleic acid Undeconoic acid 2-methyl-2-(dimethylamino) ethyl ester 2-propenoic 1 acid 2-methyl (dimethylamino) ethyl ester 2-propenoic acid Propyl hexedrine 9-octadecenamide 2-(dimethylamino) ethyl ester Dicholesteryl sucsinate

Molecular structure C11H22O2 C16H32O2 C15H30O2 C16H32O2 C23H44O2 C21H38O2 C18H34O2 C11H20O2 C7H13NO2 C7H13NO2 C10H21N C18H35NO C18H35NO2 C58H94O4

Molecular weight 186 256 256 256 352 322 282 184 157 143 155 281 157 854

Retention time 18.4 19.6 19.8 21.1 21.2 21.4 22.3 22.6 23.4 25.8 26.0 26.4 28.3 43.0

Proportion (%) Soft Hard 2.50 2.47 11.57 5.65 7.93 10.37 7.71 8.22 1.05 0.64 1.86 2.45 17.26 16.86 8.49 10.87 3.86 2.64 7.09 4.85 1.53 1.55 1.42 1.21 1.72 1.94 23.17 25.20

B I O D I V E R S IT A S 16 (2): 156-160, October 2015

160

Table 7. Mineral compositions of red deer velvet antler by infra red spectroscopy technique from freeze dry sample (Haines and Suttie 2001).

Components

Mean

Range

Ash (%) Fat (%) N (%) Ca (%) P (%) Fe (ppm)

37.0 0.56 8.5 12.2 5.9 347

7.6-61.0 0.01-1.72 5.3-12.6 0.1-22.0 0.3-9.6 33-970

ACKNOWLEDGEMENTS Authors wish to thank to Dr. Andria Agusta of Phytochemistry Laboratory, Botany Division, Research Center for Biology, Indonesian Institute of Sciences (LIPI), Cibinong Bogor, West Java, for his generous time in analyzing the samples which could not be done in our laboratory. We are also grateful to the Animal Husbandry Division, East Kalimantan Province c/q Sambar Deer Captive Breeding Project management in Penajam Paser Utara, East Kalimantan for allowing us to conduct the study.

REFERENCES Allen M, Oberle K, Grace M, Russell A. 2002. Elk velvet antler in rheumatoid arthritis: phase II trial. Biol Res for Nurs 3: 111-118.

AOAC [Association of Official Analytical Chemists]. 2005. Official Methods of Analysis. 18th ed. AOAC, Virginia.

Bubenik GA, Miller KLV, Lister AL, Oosborn DA, Bartos L, van Der Kraak GJ. 2005. Testosterone and estradiol concentrations in serum, velvet skin, and growing antler bone of male White-Tailed deer. J Exp Zool 303A:186-192.

Dai TY, Chen KN, Huang IN, Hong WS, Wang SY, Chen YP, Kuo CY, Chen MJ. 2011. The Anti-infective Effects of Velvet Antler of Formosan Sambar Deer (Cervus unicolor swinhoei) on Staphylococcus aureus infected mice.

Evidence-based Complementary and Alternative Medicine. eCAM 2011, 534069. Doi: 10.1155/2011/534069 Frolov NA, Skebalin AI, Letchamo W. 2001. The antler industry in Rusia: Antler nutraceutical development. In: Sim JS, Sunwoo HH, Hudson RJ, Jeon BT (eds). Antler Science and Product Technology, ASPTRC, Edmonton.

Haigh JC, Hudson RJ. 1993. Farming wapiti and red deer. Mosby Year Book. St. Louis.

Haigh JC. 2002. A history of deer farming. In: Wood JB (ed). Proceedings of the 2002 NADeFA Annual Conference & The World Deer Farming Congress III. NADeFA, Austin, Texas USA. Haines SR, Suttie JM. 2001. Near-infrared spectroscopy for antler composition analysis. In: Sim JS, Sunwoo HH, Hudson RJ, Jeon BT (eds). Antler Science and Product Technology, ASPTRC, Edmonton.

Hoffman LC, Wiklund E. 2006. Game and venison - meat for the modern consumer. Meat Sci 74: 197-208.

Ismail D, Jiwan, D. 2013. Growth and reproductive performance of sambar deer in Sabah Forest Reserve of Sarawak, Malaysia. Trop Anim Health Product 45: 1469-1476.

Ismail D, Hanoon NAN. 2008. Chemical composition, palatability and physical characteristics of venison from farmed deer. Anim Sci J 79: 498-503.

Jamal Y, Semiadi G, Nugraha RTP. 2005. The quality of velvet antler of captive sambar deer (Cervus unicolor). Berkala Ilmiah Biologi 4: 325-336. [Indonesian].

Jeon BT, Moon SH, Kim MH. 2004. Research on chemical composition and efficacy of velvet antler in Korea. In: Suttie JM, Haines SR, Li C (eds). Proceedings Advances in Antler Science and Product Technology. Taieri Print, Fairfield, Dunedin.

Jeon BT, Moon SH. 2001. A review of feeding systems for velvet production. In: Sim JS, Sunwoo HH, Hudson RJ, Jeon BT (eds).

Antler Science and Product Technology, ASPTRC, Edmonton.

Kang SJ, Shin JH, Yung YJ, Lee JP, Jang SY, Non DH. 2001. Importerâ&#x20AC;&#x2122;s perspective on velvet antler removal and quality standart. Korean Regulation and Quality Specifications of Velvet Antler. In: Sim JS, Sunwoo HH, Hudson RJ, Jeon BT (eds). Antler Science and Product Technology, ASPTRC, Edmonton.

Kim HY, Park YK, Kang MH. 2004. Effect of deer antler drink supplementation on plasma lipid profiles and antioxidant status in type 2 diabetic patients. J. Korean Soc Food Sci Nutr 33: 1147-1153.

Kim JJ. 2001. Consumerâ&#x20AC;&#x2122;s perspective on production, marketing and consumption of deer and antler in Korea. In: Sim JS, Sunwoo HH, Hudson RJ, Jeon BT (eds). Antler Science and Product Technology, ASPTRC, Edmonton.

Kong YC, But PPH. 1985. Deer-The ultimate medicinal animal. R Soc N Z Bull 22: 311-326.

Liangpaiboon S, Sangkhaloet S, Thongprayun A. 1996. Velvet antler removing of Sambar deer (Cervus unicolor equinus). J Wild Thail 5: 110-115.

Mahan LK, Arlin M. 1989. Food, Nutrition and Diet Therapy 8th ed.

Harcout Brace Jovanovich. Inc., Philadelphia.

SAS. 2002. SAS Language. SAS Institute Inc. Cary.

Semiadi G, Adhi IGMJ, Muchsinin M. 2004. Hunting and utilization of sambar deer (Cervus unicolor) in East Kalimantan. Jurnal Peternakan dan Lingkungan 10: 25-29. [Indonesian].

Semiadi G. 1997. Characteristics of Timorensis deer antler (Cervus timorensis). Biota 2: 82-87 [Indonesian].

Shin KH, Yun-Choi HS, Lim SS, Won DH, Kim JK. 2001. Immunostimulating, anti stress and anti-thrombotic effects of unossified velvet antler. In: Sim JS, Sunwoo HH, Hudson RJ, Jeon BT (eds).

Antler Science and Product Technology, ASPTRC, Edmonton.

Sim JS, Sunwoo HH. 2001. Antler for the newly emerging fungsional food market in North America. In: Sim JS, Sunwoo HH, Hudson RJ, Jeon BT (eds). Antler Science and Product Technology, ASPTRC, Edmonton.

Sookhareea R, Taylor DG, Dryden GMcL, Woodford KB. 2001. Primal joints and hind-leg cuts of entire and castrated Javan rusa (Cervus timorensis russa) stags. Meat Sci 58: 9-15.

Steel RGD, Torrie JH. 1980. Principles and Procedures of Statistics 2nd ed.

McGraw Hill, New York.

Sunwoo HH, Sim JS. 2001. Morphological, chemical and molecular characteristics of active components in velvet antler for biomedicine and nutraceuticals. In: Sim JS, Sunwoo HH, Hudson RJ, Jeon BT (eds). Antler Science and Product Technology, ASPTRC, Edmonton.

Van den Berg GHJ, Garrick DJ. 1997. Inheritance of adult velvet antler weights and live weights in farmed red deer. Livest Prod Sci 49: 287295.

Wang Q, Zhang H, Wang Y, Yang C. 2004. Composition of Chinese velvet antler. In: Suttie JM, Haines SR, Li C (eds). Proceedings Advances in Antler Science and Product Technology. Taieri Print, Fairfield, Dunedin.

Wilson E, Reeder DAM. 2013. Cervidae. Mammal Species of the World.

A Taxonomic and Geographic Reference (3rded). Johns Hopkins University Press, Baltimore.

Wilson PR, Stafford KJ, Thomas DG, Mellor DJ. 2000. Evaluation of techniques for lignocaine hydrochloride analgesia of velvet antler of adult stags. N Z Vet J 48: 182-187.

Yun KC, Ling WM , Ren KS, Hua WC. 2009. Chemical composition analysis of the four part velvets from Formosan sambar deer. J Taiwan Livest Res 42: 245-253.

B I O D I V E R S IT A S Volume 16, Number 2, October 2015 Pages: 161-167

ISSN: 1412-033X E-ISSN: 2085-4722 DOI: 10.13057/biodiv/d160210

Structure of natural Juniperus excelsa stands in Northwest of Iran FARZAM TAVANKAR Department of Forestry, Khalkhal Branch, Islamic Azad University, Khalkhal, Ardabil Province, Iran. P.O. Box 56817 - 31367, Tel.: +98 4532451220-2, Fax: +98 42549050452, email: tavankar@aukh.ac.ir Manuscript received: 7 April 2015. Revision accepted: 1 July 2015.

Abstract. Tavankar F. 2015.Structure of natural Juniperus excelsa stands in Northwest of Iran. Biodiversitas 16: 161-167. Juniperus excelsa M. Bieb. stands are important forest ecosystems in mountain areas of Iran. In this research the structure of J. excelsa stands was studied at altitudes of 1,400 to 1,900 m in northwest of Iran. The results showed that the mean densities of trees and seedling (trees with height up to 1.3 m) were 99.8 ± 32.0 and 70.5 ± 18.3 stem ha-1, respectively. The juniper trees comprise 52.8% of the total tree density, while the juniper seedlings comprise 19.3% of total seedling density. The mean of basal area in this stand was 3.12 ± 0.3 m2 ha-1 and the mean of canopy cover was 42.7 ± 17.9 percent. The mean of trees height was obtained 2.75 ± 1.1 m. The total of 28 woody species belonging to 14 families was recorded from the study area. The juniper trees had the maximum value of species importance value (SIV=87.3). Amygdalus lyciodes and Pistacia atlantica were two tree species that have high SIV values, 34.1 and 27.0, respectively.The distribution of trees density in different tree diameters resemble to a reverse J-shaped indicating uneven-aged structure. The results indicated juniper seedlings were increased by increasing stand crown cover (P< 0.01). Moreover extreme environmental conditions, grazing and timber harvesting for firewood are two important socioeconomic problems in these forests. These valuable stands needs to urgently conservation strategies.

Keywords: Juniperus excelsa, stand structure, species importance value, natural regeneration

INTRODUCTION Junipers (Juniperus spp.), containing 60 species and spreading among many different temperature environments from the northern hemisphere to Southern Africa, are evergreen trees and shrubs (Assadi 1997; Deligoz 2012).

Although most juniper trees are unisexual (dioecious), but there are also monoecious individuals. The seed production is very low in these trees (Javanshir 1981; Ahani et al.

2013). Juniper stands cover an area of 1.3 million ha in Iran (Marvie-Mohadjer 2006), and the genus Juniperus is represented by six species: J. sabina L., J. communis L., J. oxycedrus L., J. foetidissima, J. oblonga M. Bieb and J. excelsa M. Bieb (Javanshir 1981; Korouri et al. 2011). The J. polycarpos and J. excelsa are the most common species among the six juniper species in the Iran (Korouri and Khosnevis 2000; Ahani et al. 2013). The J. excelsa (Cupressaceae) grow naturally over most of the mountainous areas of Iran (south slopes in high mountains of Elburz, Arassbaran, and Northern parts of Khorassan), and have a great ecological importance (Korouri and Khosnevis 2000; Marvie-Mohadjer 2006; Taheri Abkenai et al. 2012). J. excelsa exhibits growth plasticity and can adapt and grow in diverse regimes (shade - light), while, in favorable conditions, it is able to increase its growth rates even at old ages (Milios et al. 2009). Their vital needs are limited (Deligoz 2012; Ramin et al. 2012). The juniper trees can grow from lowland at sea level up to an altitude of 3,600 m depending on latitude, so elevation has an inreverse relation with latitude (Javanshir 1981; Fisher and Gardner 1995; Zangiabadi et al. 2012). J. excelsa usually appears in mountainous areas (Ahmed et al. 1990; Fisher

and Gardner 1995; Sabeti 2006; Milios et al. 2009). J. excelsa is a cold resistant species but their seedling requires a high degree of humidity (Aussenac 2002; Ozkan et al.

2010) and shady conditions (Ahani et al. 2013). J. excelsa can grow not only in harsh abiotic environments such as shallow and stony soils, cold, hot and dry climates, but also have ability to grow in extreme biotic conditions like grazed sites (Ahmed et al. 1989; Fisher and Gardner 1995; Korouri and Khosnevis 2000; Carus 2004; Stampoulidis et al. 2013). They are important food sources for wildlife, several bird species feed on juniper cones (Decker et al.

1991). This species is capable of protecting the soil; it has high resistance against cold weather and can grows in areas where the minimum of temperature reaches to -35° C (Ghahreman 1994; Korouri and Khosnevis 2000; Aussenac 2002; Taheri Abkenai et al. 2012).

In a study by Ahmed et al. (1989) natural regeneration of J. excelsa was investigated in Balouchistan, Pakistan and reported regenerating seedlings ranged from zero to 219 stem ha-1 with a mean of 52 stem ha-1 that the highest seedling density and basal area were recorded on west facing slopes. The researchers also indicated that the seedling density was significantly correlated with tree basal area of the parent trees. An investigation on the distribution and ecology of juniper genus was conducted as a national plan in the Iran (Korouri and Khosnevis 2000). According to previous studies the natural regeneration of juniper trees is very low and difficult due to grazing and tree felling for firewood by villagers in Iranian juniper forests (Ravanbakhsh et al. 2010; Shirzad and Tabari 2011; Ramin et al. 2012; Taheri Abkenai et al. 2012). Shahi et al. (2007) studied age structure and seed characteristics of juniper

162

B I O D I V E R S IT A S 16 (2): 161-167, October 2015

stands in the northwest of Iran and reported that due to high rate of seed production there is no extinction risk for species. The researchers also reported about 13% of individuals were damaged by wild and domestic herbivores. They concluded maintenance of natural juniper regeneration needs to production of good quality seeds.

Juniper is a suitable tree species for afforestation in semi-arid and arid areas (Javanshir 1981; Esmaeelnia et al.

2006; Ozkan et al. 2010; Deligoz 2012). The best age for transferring saplings to natural areas is three years; a 86.9% success rate was achieved in Iran by Koruri et al. (2011).

Ramin et al. (2012) studied properties of J. excelsa stands in northern Iran and reported that average of canopy cover was 7.5%, and the average tree height was 4.9 m. There is some indication from previous studies that Physiographic factors effects on attributes of juniper stands (Pourmajidian and Moradi 2009; Khosrojerdi et al. 2010; Ravanbakhsh et al. 2010; Maghsoudlou Nezhad et al. 2013). Momeni Moghaddam et al. (2012) studied the impact of some physiographic and edaphic factors on quantitative and qualitative characteristics of J. excelsa stands in northeast of Iran. They reported that the elevation has significant effect on density of trees and regeneration, stand basal area, slenderness ratio and crown diameter of trees. It was also indicated that slope gradient has significant effect on trees height and diameter, and pH and texture of soil are important factors in distribution of juniper trees.

Pourmajidian and Moradi (2009) studied site characteristics and silvicultural properties of J. excelsa stands in southern slopes of Alborz Mountain in Iran. They reported site characteristics were different from altitude, slope direction and soil properties. The researchers also indicated that the silvicultural properties of J. excelsa stands such as tree and seedling density, basal area and canopy cover depended to site characteristics. Their results indicated that the seedling density of J. excelsa was increased by increasing stand basal area and canopy cover.

Maghsoudlou Nezhad et al. (2013) studied quantitative

characteristics of J. excelsa stands in Gorgan province in northern Iran. The researchers reported that landform units were different significantly in terms of tree density, canopy cover, tree diameter and stand basal area. They also reported that the slope aspect and soil wetness indices are the best predictors for the density of trees. J. excelsa stands are widespread in Iran, under different environmental conditions. Cataloging silvicultural properties of juniper stands is essential as a basis for monitoring and management of these valuable forests (Gardner and Fisher 1996; Pourmajidian and Moradi 2009).

Preparation and planning for biodiversity conservation and sustainable management of forest ecosystems is needed to identify the exact structure of the forest (Zenner and Hibbs 2000; Haidari et al. 2012; Tavankar 2013). The main objective of the present study was to investigate structure of J. excelsa stands, such as tree density, species compositions, trees height and diameter, stand basal area, canopy cover, regeneration, and stand structure in Northwest of Iran and compare these data with silvicultural properties from other sites.

MATERIAL AND METHODS Study area The study area is located in the Ardebil Province in the northwest of Iran (latitude 37° 27' 14" to 37° 27' 50" N, longitude 48° 22' 25" to 48° 23' 10" E) (Figure 1). The elevation of the study area ranges from 1,400 to 1,900 m above sea level. The mean annual temperature is 12.5°C and the mean annual precipitation is 380 mm for the years 1990 to 2008. The slope aspect is southwestern and the slope gradient ranges from 24 to 63% with an average 37%. The soil type is lithic lithosol and texture varies between clay loam to loam. The original vegetation of this area is natural uneven-aged mixed stands of Juniperus excelsa with the companion species.

Figure 1. Study site in in the Ardebil Province in the northwest of Iran

TAVANKAR –Juniperus excelsa in Northwest of Iran

Data collection and analysis Data were collected in summer 2014, by systematic sample plots with an area of 400 m2 (20 m × 20 m). The number of sample plots was 55. The sample plots were located on the study area (59 ha) through systematic grid (100 m × 100 m) with a random start point. Diameter at breast height (DBH) and heights of all trees (height ≥ 1.3 m) were measured. Individuals of trees with height < 1.3 m were counted by species as seedling (Stampoulidis et al.

2013). Species importance values determine the dominant species in an area and at the same time provide an overall estimate of the influence of these species in the community (Amoroso et al. 2011). Species importance value (SIV) for each tree specious was calculated by: SIV= Relative density (RD) + relative frequency (RF) + relative dominance (RD). Basal area was considered for dominancy and relative dominance (RD) calculated by: RD = (basal area of a species × 100) / total basal area of all species (Amoroso et al. 2011; Pourbabaei et al. 2013; Tavankar and Bonyad, 2015). Confidence intervals on the means calculated as accuracy by: CI% = ( , where CI is confidence interval, is standard error, t95% is t value in 95% confidence level from t table and is mean (Zobeiri 2007). After checking for normality of data distributions (Kolmogorov-Smirnov test) and homogeneity of variances (Levene’s test), regression analysis was applied to test of the relations between DBH and trees density and trees height. The means of juniper seedlings in crown cover classes were compared using Analysis of Variance (ANOVA) test and multiple comparisons were made by Tukey’s test (significant at α < 0.05). SPSS 19.0 software was used for statistical analysis; also the results of the analysis were presented using descriptive statistics.

RESULTS AND DISCUSSION Results The structural properties of the studied juniperstand are shown in Table 1. The mean densities of trees and seedling (trees with height up to 1.3 m) were 99.8 ± 32.0 (SD) and 70.5 ± 18.3 stem ha1, respectively. Juniper trees comprise 52.8% of total trees density, while juniper regeneration comprises 19.3% of total seedling density in the study area.

The means of trees diameter (DBH) and trees height were obtained 10.1 ± 6.5 cm and 2.75 ± 1.1 m, respectively. The means of juniper trees diameter (8.4 cm) and trees height (2.53 m) were lower than the mean diameter (13.7 cm) and height (3.12 m) of other tree species. The mean of basal area in this stand was obtained 3.12 ± 0.3 m2 ha-1 and the mean of canopy cover was obtained 42.7 ± 17.9 percent (Table 1).

A total of 28 woody species belonging to 14 families were recorded from the study area (Table 2).The family of Rosaceae with 9 species had the highest number of woody species in the study area that includes Amygdalus lyciodes, Crataegus songarica, Prunus divaricata, Sorbus torminalis, Malus orientalis, Amygdalus scoparia, Cerasus microcarpa, Cotoneaster nummularia and Rosa canina.

The families of Caprifoliaceae, Rhamnaceae and Aceraceae

163

had 4, 3 and 2 woody species, respectively; and each of other families had only one species.

The density of different tree species is shown in Table 2. The total density of trees was 99.8 stem ha-1. The density of juniper trees (J. excelsa) was 52.7 stem ha-1, which comprise 52.8% of the total tree density. After juniper trees, the species of Amygdalus lyciodes, Pistacia atlantica and Acer monspessulanum have the highest density, (9.1, 7.4 and 5.5 stem ha-1, respectively) in the study area. These species (A. lyciodes, P. atlantica and A. monspessulanum) comprise 22% of the total tree density. Other tree species (24 species) comprise 25.2% of the total tree density.

The total basal area in the study area was 3.12 m2ha-1, that the J. excelsa had the highest value of basal area (0.67 m2ha-1, 21.5%). The basal areas of A. lyciodes, P. atlantica and A. monspessulanum were 0.32, 0.19 and 0.17 m2ha-1, respectively. These species comprise 21.8% of the total basal area. Other tree species (24 species) comprise 56.7% of the total basal area (Table 2).

The total seedling (regeneration) density was 70.5 stem ha-1, that the Amygdalus lyciodes with 14.2 stem ha-1 (20.1%), had the highest frequency of seedlings in the study area. The Pistacia atlantica had 13.8 stem ha-1 (19.6%) and the J. excelsa had 13.6 stem ha-1 (19.3%) of seedling density. The seedling density of Acer monspessulanum was 6.3 stem ha-1 (8.9%). Other tree species (24 species) comprise 32.1% of the total tree density (Table 2).

Species Importance Value (SIV) of different tree species in the natural junipers stands is shown in Table 2.

Eight species (J. excelsa, A. lyciodes, P. atlantica, A. monspessulanum, L. nummulariafolia, R. spathulaefolia, P. spina Christi, A. campestre) have SIV more than 10 and formed over 73% of total SIV. The SIV of J. excelsa was the highest (87.3) in the study area. The SIV of A. lyciodes, P. atlantica and A. monspessulanum were 34.1, 27.0 and 19.6, respectively.

Relation between diameter (DBH) and height of trees are shown in Figure 2. According to this figure, the height of juniper and other tree species were increased by increasing of their DBH. The heights of juniper trees were lower than the heights of other tree species in DBH more than 4 cm. The regression analysis showed that the correlation coefficient (R) between trees height and trees DBH are statistically significant (P < 0.01).

The distribution of trees density in different DBH resemble to a reverse J-shaped indicating uneven-aged structure (Figure 3), so trees density were decreased with increasing DBH. The density of juniper trees was more than the density of other tree species up to DBH of 21 cm.

The regression analysis showed that the correlation coefficient (R) between trees density and trees DBH are statistically significant (P < 0.01).

The abundance of sampling plots in crown-cover classes are shown in Figure 4. According to Fig. 3, the crown-cover class 20 to 30 percent has the highest abundance (29.1%) of sampling plots (n=16). The abundance of sampling plots was decreased by increasing crown cover class more or less than 20-30 percent.

164

B I O D I V E R S IT A S 16 (2): 161-167, October 2015

The results of this study showed that the juniper seedlings were increased by increasing crown-cover percentages (Figure 5). The ANOVA test showed the crown-cover classes had significantly affect on the mean of juniper seedlings (F=3.67, P < 0.01).

Discussion The results of this study showed that the density of trees (height â&#x2030;Ľ 1.3 m) was estimated to be about 100 stem ha-1.

The density of trees in other studies was reported as: 65 to 102 stem ha-1 in different land units of J. excelsa stands by Zangiabadi et al. (2012) and 60 to 200 stem ha-1 by Momeni Moghaddam et al. (2012) in southeast Iran; 32 stem ha-1 by Ramin et al. (2012), 188 stem ha-1 by Pourmajidian and Moradi (2009) and 66 stem ha-1 by Maghsoudlou Nezhad et al. (2013) in Northern Iran; 592 stem ha-1 in protected juniper stands by Rostami kia and Zobeiri (2013) in Northwest Iran. Atta et al. (2012) density of juniper trees (> 6 cm DBH) reported from 29 to 268 stems ha-1 with a mean 176 Âą 77 individuals ha-1 in J. excelsa forests in Balouchestan Pakistan. The density of seedlings (trees with height up to 1.3 m) in this study was estimated 70 stem ha-1.

Pourmajidian and Moradi (2009) reported the mean density of seedlings 71 stem ha-1 in the J. excelsa stands in the Northern Iran. They reported the highest seedlings density on Northwestern facing slopes (102 stem ha -1 )

Table 1. Structural properties of a Juniperus excelsa stand in the northwest of Iran Stand properties

Max. Min. Mean SD

CI%

-1

Tree density (stem ha ) Juniper 68.3 12.6 52.7 12.8 Other 59.0 14.2 47.1 11.5 All 119.7 23.5 99.8 32.0 Seedling density (stem ha-1) Juniper 19.4 2.5 13.6 4.8 Other 78.4 23.6 56.9 11.3 All 103.7 26.6 70.5 18.3 Tree diameter (cm) Juniper 22.5 1.0 8.4 4.4 Other 28.4 1.0 13.7 9.4 All 28.4 1.0 10.1 6.5 Tree height (m) Juniper 3.07 0.55 2.53 0.7 Other 5.33 0.72 3.12 1.1 All 5.33 0.55 2.75 1.1 Basal area (m2 ha-1) Juniper 0.47 0.08 0.67 0.2 Other 0.86 0.15 2.45 0.3 All 1.30 0.32 3.12 0.3 Canopy cover (%) Juniper 35.6 8.0 25.5 13.1 Other 29.3 7.7 17.2 10.5 All 55.2 10.3 42.7 17.9 Note: SD: Standard deviation, CI: Confidence interval

6.5 6.6 8.6 9.5 5.4 7.0 14.2 18.4 17.3 7.5 9.5 10.8 14.6 10.8 7.2 13.8 16.5 11.3

Table 2. Density of trees and seedling, basal area and species importance values (SIV) Tree species

Family

Juniperus excelsa M. Bieb.

Amygdalus lyciodes L. Pistacia atlantica F&M. Acer monspessulanum L. Lonicera nummulariafolia J. Rhamnus spathulaefolia F&M. Paliurus spina christi Mill.

Acer campestre L. Berberis integerrima L. Quercus macranthera Fish & Meyer Carpinus orientalis Mill.

Crataegus songarica C. Koch Prunus divaricata Ledeb.

Sorbus torminalis(L.) Crantz Viburnum opulus L. Viburnum lantana L. Malus orientalis Ugl. Eunymus latifolia(L.) Mill.

Amygdalus scoparia Spach.

Colutea persica Boiss.

Cerasus microcarpa(C.A.Mey) Cotoneaster nummularia Pojark.

Cornus sanguinea L .

Lonicera iberica M.B. Rhamnus pallasii F. M. Rosa canina L. Celtis caucasica Willd.

Jasminum fruticans L. All species

Cupressaceae Rosaceae Anacardiaceae Aceraceae Caprifoliaceae Rhamnaceae Rhamnaceae Aceraceae Berberidaceae Fagaceae Corylaceae Rosaceae Rosaceae Rosaceae Caprifoliaceae Caprifoliaceae Rosaceae Celastraceae Rosaceae Papilionaceae Rosaceae Rosaceae Cornaceae Caprifoliaceae Rhamnaceae Rosaceae Ulmaceae Oleaceae -

Tree (stem ha-1) 52.7 9.1 7.4 5.5 4.0 3.3 3.1 2.4 2.0 1.3 1.0 0.8 0.7 0.6 0.6 0.6 0.6 0.5 0.5 0.5 0.5 0.4 0.4 0.3 0.3 0.3 0.2 0.2 99.8

Basal area (m2 ha-1) 0.67 0.32 0.19 0.17 0.16 0.14 0.13 0.12 0.12 0.14 0.12 0.10 0.12 0.11 0.08 0.10 0.10 0.07 0.05 0.01 0.01 0.01 0.01 0.01 0.01 0.01 0.03 0.01 3.12

Seedling (stem ha-1) 13.6 14.2 13.8 6.3 2.4 2.0 1.3 1.0 1.0 1.0 1.0 1.0 1.0 1.0 1.0 1.0 1.0 1.0 0.8 0.8 0.8 0.5 0.5 0.5 0.5 0.5 0.5 0.5 70.5

SIV 87.3 34.1 27.0 19.6 15.7 14.0 12.8 10.3 7.5 9.4 7.5 6.2 4.6 4.2 4.2 4.1 3.0 3.1 4.0 3.1 2.7 2.5 2.5 2.2 2.2 2.2 2.0 2.0 300

TAVANKAR â&#x20AC;&#x201C;Juniperus excelsa in Northwest of Iran

Figure 2. Relation between diameter and height of trees

Figure 3. Relation between diameter and density of trees

Figure 4. Abundance of sampling plots in crown-cover classes

Figure 5 . Density of juniper seedlings in crown-cover classes

165

and the lowest on Southeastern facing slopes (48 stem ha1 ). The results of this study indicated juniper seedlings were increased by increasing stand crown cover. Ahmed et al.

(1989) also concluded that juniper tree seedlings need shady conditions in the early stages of their growth and development. Reforestation by local tree species in empty areas is necessary. Many studies have been noted that the nurse trees have a major role in the success of juniper regeneration (Ahmed et al. 1989, 1990; Fisher and Gardner 1995; Milios et al. 2007; Stampoulidis et al. 2013). In a study by Khosrojerdi et al. (2010) reported that establishment, growth and survival of juniper seedlings that planted under Cotoneaster sp. and Rosa sp. as nurse trees were more than the juniper seedling that planted in open areas.

The mean basal area in the study area was obtained 3.12 m2 ha-1. The other researchers reported of basal area 4.67 m2ha-1 by Rostami Kia and Zobeiri (2013) in the Northwest Iran, 1.09 m2ha-1 by Momeni Moghaddam et al. (2012) in the Northeast Iran and 10.55 m2ha-1 by Maghsoudlou Nezhad et al. (2013) in the northern Iran.

The mean height of trees was 2.53 m in the study area.

The mean tree height in the other J. excelsa sites were reported 4.51 m by Momeni Moghaddam et al. (2012) in the Northeast Iran, 4.9 m by Ramin et al. (2012) in the Northern Iran, 2.9 m by Rostami kia and Zobeiri (2013) in the Northwest Iran, 4.7 m by Pourmajidian and Moradi (2009) in Northern Iran.

The results of this research showed that the juniper stands are rich for tree species, so 28 tree species from 14 families were present in the study area in the northwest Iran. After the J. excelsa, the three species of Amygdalus lyciodes, Pistacia atlantica and Acer monspessulanum are the important trees that have the highest tree and seedling density and species importance values (SIV) in the study area. Stampoulidis and Milios (2010) reported that in the natural J. excelsa stands in the Greece there are also species such as Quercus macedonica, Juniperus oxycedrus, Quercus pubescens, Pyrus amygdaliformis, Carpinus orientalis, Acer monspessulanum and Juniperus foetidissima. Shirzad and Tabari (2011) reported 16 woody species from 9 families in the J. excelsa stands in the Northeast Iran. Rostami kia and Zobeiri (2013) reported 8 woody species from 7 families in J. excelsa stands in the Northwest Iran. It is widely accepted in forest ecology that different management practices affect species diversity, and high diversity of plant and animal species is needed to ensure more complex forest structure (Bacaro et al. 2014).

Many ecological, pathological, socioeconomic impacts, increased human population, over- grazing, illegal cutting for timber and collection for fuel wood, periodic drought, and effect of climate change have been left adverse affects on regeneration and structure of these forests. These factors also reported as the main impacts on species composition, productivity, structure and dynamics of juniper forests by Atta et al. (2012) in Pakistan.

Considering to the results of this study and comparing with previous studies it can be concluded that the J. excelsa stands are very important forests in Iran. Conservation

166

B I O D I V E R S IT A S 16 (2): 161-167, October 2015

strategies for these stands are urgently needed. The richness of woody species in these forests is high and this issue is very important for conservation biodiversity. These stands are open forests with low regeneration densities.

Forest protection should aim at ensuring that forests continue to perform all their productive, socio-economic and environmental functions in the future. It is widely accepted, that a structurally diverse stand provides living space for a larger number of organisms (Tavankar and Bonyad 2015). Iran is a country with low forest cover (UNFF 2005), so that only 7.3% of it is covered by forest areas (FAO 2005). Therefore, the main objective of forest policy is to protect forests in natural ecosystem. Moreover extreme environmental conditions, grazing and timber harvesting for firewood are two important socioeconomic problems in these forests.

ACKNOWLEDGMENTS This paper is one of the results of a research project that was carried out in the period 2012-2013 in the Ardebil province, North West of Iran. I would like acknowledge the financial support of Islamic Azad University (IAU), Khalkhal Branch for the research project No. 5/719.

REFERENCES Ahani H, Jalilvand H, Hosseini-Nasr SM, Soltani-Kouhbanani H, Ghazi MR, Mohammadzadeh H. 2013. Reproduction of juniper (Juniperus polycarpos) in Khorasan Razavi, Iran. For Sci Pract 15 (3): 231-237.

Ahmed M, Shaukat SS, Buzdar AH. 1990. Population structure and dynamics of Juniperus excelsa in Balouchistan, Pakistan. J Veget Sci 1 (2): 271-276.

Ahmed M, Ahmed I, Anjum PI. 1989. A study of natural regeneration of Juniperus excelsa M.Bieb in Balouchistan. Pak J Bot 21 (1): 118-127.

Amoroso VB, Laraga SH, Calzada BV. 2011. Diversity and assessment of plants in Mt. Kitanglad Range Natural Park, Bukidnon, Southern Philippines. Gard Bull Sing 63 (1): 219-236.

Assadi M. 1997. Plan of the flora of Iran, Gymnosperms. No. 19-22.

Research Institute of Forests and Rangelands (RIFR), Iran, Tehran.

Atta MS, Moinuddin A, Alia A, Lubna T, Seyed UJ. 2012. The ecology and dynamics of Juniperus excelsa forest in Balochestan-Pakistan.

Pak J Bot 44 (5): 1617-1625.

Aussenac G. 2002. Ecology and ecophysiology of circum-Mediterranean firs in the context of climate change. Anna For Sci 59: 823-832.

Bacaro G, Ricotta C, Marignani M, Torri D, Chiarucci A. 2014. Using Shannonâ&#x20AC;&#x2122;s recursivity to summarize forest structural diversity.

Forests, Trees and Livelihoods 23 (3): 211-216.

Decker SR, Pekins PJ, Mautz WW. 1991. Nutritional evaluation of winter foods of wild turkeys. Can J Zool 69 (8): 2128-2132.

Carus S. 2004. Increment and growth in Crimean Juniper (Juniperus excelsa Bieb.) Stands in Isparta-Sutculer region of Turkey. J Biol Sci 4 (2): 173-179.

Deligoz A. 2012. Morphological and physiological differences between bareroot and container Juniperus excelsa seedlings. Turk J Agric for 36 (5): 619-628.

Esmaeelnia M, Jalali SG, Tabari M, Hosseini SM. 2006. Influence of plant growth regulator (IBA) on vegetative propagation of Juniperus excelsa. Iranian J For Pop Res 14 (3): 221-227.

FAO. 2005. Global forest resources assessment, country reports: I. R. of Iran, FAO, Rome.

Fisher M, Gardner AS. 1995. The status and ecology of Juniperus excelsa subsp. polycarpos woodlands in the northern mountains of Oman.

Vegetatio 119: 33-51.

Gardner AS, Fisher M. 1996. The distribution and status of the mountain juniper woodlands of Oman. J Biogeogr 23: 791-803.

Ghahreman A. 1994. Iran Chromophytes (Systematic Plant). Volume 4, Tehran University Press, Tehran.

Haidari M, Shabanian N, Haidari RH, Bazyar M. 2012. Structural diversity of oak forests in Kurdistan Province (Case study: Oak forest). IOSR J Pharmacy Biol Sci 4 (3): 37-43.

Javanshir K. 1981. Research about seed production and method of growth in juniper trees in order to reclamation of juniper forests. No 25.

Publication of Research Institute of Forests and Rangelands (RIFR), Tehran.

Khosrojerdi E, Darroudi H, Namdost T. 2010. Effects of nurse plants and geographical direction on survival and growth of Juniperus excelsa seedlings in the Hezarmasjed forests. Iranian J Biol 21 (5): 760-768.

Korouri SAA, Khoushnevis M, Matinizadeh M. 2011. Comprehensive studies of juniper species in Iran. Forest, Ranges and Watershed Organization of Iran, Tehran.

Korouri SAA, Khoshnavis M. 2000. Ecological and Environmental studies of juniper habitats in Iran. Research Institute of Forest and Rangelands, Iran. Tehran.

Maghsoudlou Nezhad M, Shataee SH, Habashi H, Babanezhad M. 2013.

Spatial and statistical analysis of quantitative characteristics of Juniperus stands in Chahar-bagh of Gorgan regarding to topographic and soil features. Iranian J For 5 (2): 195-206.

Marvie-Mohadjer M. 2006. Silviculture, Tehran University Press, Tehran.

Milios E, Smiris P, Pipinis E, Petrou P. 2009. The growth ecology of Juniperus excelsa Bieb. trees in the central part of the Nestos valley (NE Greece) in the context of anhropogenic disturbances. J Biol Res 11: 83-94.

Milios E, Pipinis E, Petrou P, Akritidou S, Smiris P, Aslanidou M. 2007.

Structure and regeneration patterns of the Juniperus excelsa Bieb.

Stands in the central part of the Nestos valley in the northeast of Greece, in the context of anthropogenic disturbances and plant facilitation. Ecol Res 22 (5): 713-723.

Momeni Moghaddam T, Sagheb-Talebi Kh, Akbarinia M, Akhavan R, Hosseini SM. 2012. Impact of some physiographic and edaphic factors on quantitative and qualitative characteristics of juniper forest (Case study: Layen region -Khorasan). Iranian J For 4 (2): 143-156.

Ozkan K, Gulsoy S, Aerts R, Muys B. 2010. Site properties for Crimean juniper (Juniperus excelsa) in semi-natural forests of south western Anatolia, Turkey. J Environ Biol 31 (1): 97-100.

Pourbabaei H, Haddadi-Moghaddam H, Begyom-Faghir M, Abedi T. 2013. The influence of gap size on plant species diversity and composition in beech (Fagus orientalis) forests, Ramsar, Mazandaran Province, North of Iran. Biodiversitas 14 (2): 89-94.

Pourmajidian MR, Moradi M. 2009. Investigation on the site and silvicultural properties of Juniperus excelsa in natural forests of Ilan in Qazvin province. Iranian J For Pop Res 17 (3): 475-487.

Ramin M, Shataei SH, Habashi H, Khoshnevis M. 2012. Investigation on some quantitative and qualitative characteristics of juniper stands in Aminabad of Firouzkoh. J wood For Sci Tech 19 (3): 21-40.

Ravanbakhsh H, Marvi Mohajer MR, Nourzad Moghadam M. 2010.

Qualitative and quantitative investigation of Juniperus-Cotoneaster forest reserve in Ooshan (Central Alborz, Iran). Iranian J For Pop Res 18 (2): 253-264.

Rostami kia Y, Zobeiri M. 2013. Study on the structure of Juniperus excelsa Beib. Stand in Khalkhal protected forests. J Wood For Sci Tech 19 (4): 151-162.

Sabeti H. 2006. Forests, trees and shrubs of Iran, Yazd University Publication, Yazd.

Shahi A, Movafeghi A, Hekmat-Shoar H. 2007. Demographic study of Juniperus communis L. on Mishu-Dagh altitudes in North West Iran.

Asian J Plant Sci 6 (7): 1080-1087.

Shirzad MA, Tabari M. 2011. Effect of some environmental factors on diversity of woody plants in Juniperus excelsa habitat of Hezarmasjed Mountains. Iranian J Biol 24 (6): 800-808.

Stampoulidis A, Milios E, Kitikidou K. 2013. The regeneration of pure Juniperus excelsa M. Bieb. stands in Prespa National Park in Greece. Sumarski List 137: 163-172.

Stampoulidis A, Milios E. 2010. Height structure analysis of pure Juniperus excelsa stands in Prespa National Park in Greece. Forestry Ideas16 (2): 239-244.

Taheri Abkenai K, Khosh-e-bijari FF, Jahdi R, Foumani BS. 2012.

Structure and Regeneration Patterns of Juniperus polycarpos C.Koch in Alborz Mountains, Iran. J Basic Appl Sci Res 2 (6): 5993-5996.

Tavankar F, Bonyad A. 2015. Effects of timber harvest on structural diversity and species composition in hardwood forests. Biodiversitas 16 (1): 1-9.

TAVANKAR â&#x20AC;&#x201C;Juniperus excelsa in Northwest of Iran Tavankar F. 2013. Woody species diversity and stand types in relict of Hyrcanian lowland forests, north of Iran. Plant Sci Feed 3 (7): 83-87.

UNFF. 2005. National reports of the fifth session of the United Nations Forum on Forests: I. R. of Iran.

Zangiabadi S, Naseri F, Ahmadimoghadam A. 2012. Investigation on silvicultural properties and soil characteristics of Juniperus excelsa

167

M. Bieb in the Southeast of Iran. American-Eurasian J Agric Environ Sci 12 (3): 269-274.

Zenner EK, Hibbs DE. 2000. A new method for modeling the heterogeneity of forest structure. For Ecol Manag 129: 75-87.

Zobeiri M. 2007.Forest Inventory: Measurement of Tree and Forest,2nded., University of Tehran Press, Tehran.

B I O D I V E R S IT A S Volume 16, Number 2, October 2015 Pages: 168-172

ISSN: 1412-033X E-ISSN: 2085-4722 DOI: 10.13057/biodiv/d160211

Phylogeny analysis of Colutea L. (Fabaceae) from Iran based on ITS sequence data LEILA MIRZAEI1,♥, IRAJ MEHREGAN1, TAHER NEJADSATARI1,♥♥, MOSTAFA ASSADI2 1

Department of Biology, Faculty of Basic Science, Tehran Science and Research Branch, Islamic Azad University, Hesarak-1477893855, Tehran, Iran.

Tel. +98-2147911. ♥email: l.mirzaei_2009@yahoo.com, ♥♥ nejadsattari_t@yahoo.com 2 Research Institute of Forest and Rangelands, National Botanical Garden of Iran, P.O. Box 13185-116, Tehran, Iran Manuscript received: 2 May 2015. Revision accepted: 13 July 2015.

Abstract. Mirzaei L, Mehregan I, Nejadsatari T, Assadi M. 2015. Phylogeny analysis of Colutea L. (Fabaceae) from Iran based on ITS sequence data. Biodiversitas 16: 168-172. This study was carried out on the species of Colutea L. that growing in Iran. Some of these species are native to Iran. Internal transcribed spacer (ITS) sequences were obtained from 12 samples representing seven species of Colutea recognized by recent taxonomic treatments from Iran and we used 20 ITS sequences from GenBank to test the phylogeny of Colutea. Phylogenetic analyses were conducted using Bayesian inference and maximum likelihood methods. Our results of cladistic analysis of phylogenetic relationships among Coluteae tribes showed its monophyletic origin and Astragaleae was its sister group. In addition, C. cilicica was a sister group to C. gifana whose separated of other Colutea genus from Iran. Bayesian inference and maximum parsimony analyses confirmed the monophyly of three sections of Colutea in Iran. Our results showed that further investigation including application of larger number of markers and involving all the Iranian Colutea species will be more effective in estimation the relationships of the genus.

Keywords: Colutea, Fabaceae, Iran, ITS, phylogeny

INTRODUCTION Fabaceae is the third largest family of angiosperms with 730 genera and more than 19,000 species that is distributed mainly in the temperate and subtropical parts of the world.

Legumes are second grasses in their agricultural and economical value, and include many important species grown for food, fodder, wood, ornamentals, and raw materials for industry. In addition, they play ecologically important role in biological nitrogen fixation. This family of angiosperm without counting the genus Astragalus contains 429 species is distributed in Iran; among them 173 are rare and 117 species are endemics. About half of the observations in Iran were from the provinces Fars, Hormozgan, Tehran, Bushehr and Mazandaran (Yousefi 2006; Lewis et al. 2005; Mousavi and Khosravi 2010).

Colutea L. (Fabaceae L.) is a small genus included nearly 30 species of shrubs and small trees with inflated fruits and is distributed throughout the Mediterranean region, China, Himalaya, Eastern and North-Eastern Africa, mostly in dry mountains (Mabberley 1997).

Colutea genus includes 13 species from three sections in the Iranian plateau. Seven species of this genus are growing in Iran, that five of them are endemic (Browizc 1959). In current scenario, the DNA markers become the marker of choice for the study of crop genetic diversity to revolutionize the plant biotechnology. The internal transcribed spacer (ITS) of nuclear ribosomal DNA (rDNA) is one of the most extensive sequenced molecular markers (Alvarez and Wendel 2003). The region is part of the rDNA cistron, which consists of 18S, ITS1, 5.8S, ITS2,

26S and present in several hundred copies in most eukaryotes.

The internal transcribed spacer (ITS) contains the signals need to process the rRNA transcript and often used for inferring phylogeny at intra and inter generic levels in many plant families (Baldwin 1992; Baldwin et al. 1995; Wojciechowski et al. 1999; Kazempourosaloo et al. 2005; Ahangarian et al. 2007). The length of the ITS region of flowering seed plants is highly uniform (Baldwin et al.

1995). By contrast, that of non-flowering seed plants shows much variation especially the length of the ITS1 region, which ranges from 630 to 3125 bp, is strikingly more labile in flowering plants (Liston 1995; Maggini et al. 2000).

ITS1 and ITS2 are not equivalent structures, even though they are sometimes convergent in length as well as substitutional patterns; ITS1 evolved from an intergenic spacer and ITS2 from an expansion segment in the rDNA large subunit.

The previous phylogenetic studies of Fabaceae by using analyses of the nrDNA ITS were focused exclusively on Hedysareae tribe (Ahangarian et al. 2007; Lewke et al.

2013), Vicieae (Fabeae) tribe (Foladi et al. 2013), Pogonophaca subgenus (Kang et al. 2003), Phyllolobium genus (Zhang et al. 2012), Genista genus (Hakki et al.

2010), and Astragalus genus (Zarre and Azani 2012) and presented the monophyly of majority of this clades.

Thereby, ITS sequencing provides valuable phylogenetic data for resolving relationships among species and genus of Fabaceae family by molecular markers. Major objective of this paper is to ascertain the taxonomic and phylogenetic relationships within species of Colutea genus in Iran.

MIRZAEI et al. – Phylogeny analysis of Colutea from Iran

MATERIALS AND METHODS Taxon sampling Accessions in the amount of 12 plant sample belonging to seven species of Colutea L. were collected by authors from wild populations in different regions of Iran (see Table 1). All the specimens examined (or its duplicates) are deposited in the Islamic Azad University Avicennia Herbarium (IAUH, without voucher number/in registration process). In this study we used 20 ITS sequence of 17 species obtained from the GenBank: three species of Colutea, three species of Astragalus, three species of Swainsona, Chesneya kotschyi, Lessertia herbacea, Sutherlandia frutescens, Carmichaelia williamsii, Clianthus puniceus, Eremosparton flaccidum, Erophaca baetica subsp. Orientalis and Smirnowia turkestana. The list of non-Iranian taxa used in our analysis with GenBank accession numbers are showed in Table 2.

Table 2. List of non-Iranian taxa with GenBank accession number used in our analysis.

Species Astragalus vogelii A. complanatus A. cysticalyx Carmichaelia williamsii Colutea. abyssinica C. arborescens C. arborescens C. atlantica Chesneya kotschyi Clianthus puniceus C. puniceus Eremosparton flaccidum Erophaca baetica subsp. orientalis Lessertia herbacea Smirnowia turkestana Sutherlandia frutescens Swainsona canescens S. formosa S. pterostylis S. pterostylis

ITS GenBank accession number U50499.1 EU591995.1 AF121682.1 AF113854.1 GQ246039.1 U56010.1 U56009.1 GQ246040.1 GQ246104.1 L10801.1 L10800.1 GQ246035.1 EU070920.1 AF121752.1 GQ246037.1 GQ246033.1 GQ246042.1 U56008.1 U56007.1 GQ246032.1

169

DNA extraction and ITS sequencing The DNA extraction was performed from leaves dried with silica gel by using the NucleoSpin Plant Kit (Macherey-Nagel GmbH & Co. KG, Du ren, Germany) after the manufacturer’s protocol. Concentration and quality of extracted DNAs were checked by 1% agarose gel electrophoresis. We amplified the ITS region (ITS1-5.8SITS2) of the nuclear ribosomal DNA by using primer combinations AB101 and AB102 primers: a forward primer AB101annealing, 5'-ACG AAT TCA TGG TCC GGT GAA GTG TTC G-3', and a reverse primer (AB102) annealing, 5'-TAG AAT TCC CCG GTT CGC TCG CCG TTA C-3' ( Kang et al. 2003).The PCR amplifications were performed in 25µL reaction volumes containing 1µL template DNA, 10.5µL ddH2O, 10× buffer + MgCl2 +Taq polymerase+Tween 20 + dNTP=12.5µLand 0.5µL each of the both primers. Thermal cycles were performed with 2min denaturation step at 95° C, followed by 35 cycles at 95 °C for 1 min, 51.5 °C for 1 min, and 72 °C for 1.5 min, followed by 7-10 min final extension at 72° C for completion of primer extension. PCR products were resolved by electrophoresis in 1% agarose gel and then visualized under UV light.

Phylogenetic analysis Forward and reverse sequences were visually compared and edited, and then initially aligned using Sequencher 4 software (Gene Codes Corporation, Ann Arbor, MI USA).

All ITS sequences were assembled and aligned using Mac Clade 4 (Maddison and Maddison 2010).

Maximum parsimony analyses (MP) Parsimony analyses were implemented by employing PAUP ver. 4.0 (Swofford 2002) using following criteria: 100 heuristic search replicates, random stepwise addition of taxa, and tree-bisection reconnection (TBR) branch swapping. These parsimonious trees were used to calculate the consensus tree. Bootstrap analyses (BS) were applied to determine the clade support. BS for clades was calculated using PAUP with 100 replicates of heuristic searches, and randomly stepwise addition of taxa. Clades with a bootstrap value of 70% or more were considered as robustly supported nodes.

Table 1. List of Colutea species investigated and voucher specimen information (TARI = Herbarium of Research Institute of Forests and Rangelands, IAUH = Islamic Azad University Avicennia Herbarium).

Species

Origin, Voucher

Colutea buhsei (Boiss.) Shapar.

C. buhsei (Boiss.) Shapar.

C. buhsei (Boiss.) Shapar.

C. buhsei (Boiss.) Shapar.

C. buhsei (Boiss.) Shapar.

C. gracilis Fryen & Sin.f.

C. persica Boiss.

C. persica Boiss.

C. porphyrogramma Rech.f.

C. uniflora G .Beck. ex Stap f.

C. cilicica Boiss. & Balansa.

C. gifana Parsa

Iran, Prov. N. Gorgan, 1400 m, (30871 TARI).

Iran, Prov. E. Khorasan, 1550 m, Foroghi, (50312 TARI).

Iran, Prov. S. Ardebil, Khalkhal to chuli, 1000m (1), Ferguson, (000013619 IAUH).

Iran, Prov. Tehran, 1800 m.Trott, (000013617 IAUH).

Iran, Prov. Gorgan, Aliabad, 600 m, Gauba (88858 TARI).

Iran, Prov. N. Gorgan, 20800 m (000013611 IAUH).

Iran, Prov. Kerman, 2300m, Mussavi and Tehrani (16256 TARI).

Iran, Prov. Fars, Dahte arzhan, 2200 m,Foroghi,(45755 TARI).

Iran, Prov. Khorasam, Bojnord, 1350 m,Resh,(000013614 IAUH).

Iran, Prov. Khorasan, Gazvin, 1600 m (000013621 IAUH).

Iran, Prov. Azerbaijan, Kaleibar,vinag, 1000 m, Assadi & Wdb (000013620 IAUH).

Iran, Prov. E Khorasan, Gifan, 1300 m, Parsa (000013623 IAUH).

170

B I O D I V E R S IT A S 16 (2): 168-172, October 2015

Bayesian analysis (BA) The BA analyses of the ITS datasets were performed using MrBayes ver. 3 (Huelsenbeck and Ronquist 2001). In order to find the appropriate model of DNA substitution, the Maximum Likelihood criteria for datasets were determined by the Akaike Information Criterion (AIC; Akaike 1974) as implemented in the software ModelTest v 3.7 (Posada et al. 1998).

Modeltest For the Maximum Likelihood (ML) and MrBayes analyses (MB), the best fit of DNA substitution model should be found. The Akaike information criterion (AIC) and hierarchical likelihood ratio test (hLRT) were calculated based on the log likelihood scores of 56 models using Modeltest 3.7 (Posada et al. 1998). In general, AIC was chosen (Posada 2008). For ITS spacer dataset of this paper, Likelihood settings from best-fit model (TVM+G) were selected by AIC in Modeltest 3.7 with the nucleotide frequencies A = 0.2072, C = 0.2576, G = 0.2751, T = 0.2601, a gamma shape parameter of 0.5955 and an assumed proportion of invariable sites of 0.0.

Maximum likelihood Maximum search was performed on the basis of the result of Modeltest in PAUP. The parameters of best model, such as the base frequency, the mean relative substitution rates, proportion of invariable sites, Gamma distribution shape, were all employed. The heuristic search and bootstrap were implemented as in parsimony analysis in PAUP above mentioned.

Bayesian inference Bayesian inference of phylogenetic trees was analyzed by some parameters from the Modeltest, and included in the analysis. The option was set up using 1,000,000 generations of Markov Chain Monte Carlo (MCMC) searches and a sample frequency of 1000. Saturation was reached after a burn-in of 1000 generations. The clade support was assessed using Bayesian posterior probabilities employing MrBayes version 3.0 (Huelsenbeck and Ronquist 2001).

RESULTS AND DISCUSSION The data set of the ITS region included 432 characters with 270 including variable positions within the ingroup; 82 were parsimony informative. The Bayesian 50% majority- rule consensus tree for ITS contained 11 internal nodes with a posterior probability (PP) of 1.0 (Fig. 2).

Strict consensus phylogeny trees, with 256 steps was included consistency index (CI) = 0.791, retention index (RI) = 0.799. Using the data of Figure 1, Clianthus puniceus and Carmichaelia williamsii taken as an outgroup form a separate clade, and Swainsona canescens species form a group which is sister to other Swainsona species.

The ingroup consists of two main clades that labeled as A and B. In clade A, Swainsona formosa and S. pterostylis

form a separate group. The support was occurred in clade A (PP=1; BS 96%). Clade B comprises two clades including BI and BII. Clade BI comprises two subclades including BI1 (Astragalus complanatus, Chesneya kotschyi and Erophaca baetica forming a separate group) and BI2 clades included a single species Astragalus vogelii. Clade BII, recognized in three subclades, BII1, BII2 and BII3, respectively. Within BII1 subclade Astragalus vogelii separated of Eremosparton flaccidum + Smirnovia turkestana subclade. Clade BII2 involves BII2a and BII2b that consisting of Colutea species. In clade BII2a Colutea cilicica and C. gifana grouped together separately from the other Iranian species of Colutea. The species of Colutea arborescens and C. atlantica recognize in BII2b subclades.

In BII3 subclade, Lessertia herbacea and Sutherlandia frutescens are grouped together. The support was occurred in clade B for two sister-group BI and BII (PP=1; BS 98%). Best support relationship between three sister-group clades BII (PP =1; BS = 93%) and relationship between two sister group clade BII2a and BII1 was supported by (PP=1; BS= 99%). Clade BII2b was contain the Colutea species genus supported with pp=1, BS=74%. Clade BII2b divided into two sister groups BII2a and BII2b. Within the Colutea species three major clades were identified and named as D, E and F clade (12 species; PP = 0.90; BS = 56%). Clade D comprising 10 accessions of C. buhsei, C. gracilis, C. uniflora and C. porphyrogramma (PP = 0.97; BS = 74%) constitutes the unresolved group and shows polytomy. C. gifana in clade F together with its sister C. cilicica in clade E separated of other species of Colutea from Iran was sister group to C. gifana in clade E. Actually sampled species in three clade D, E, F included to Sect.

Rostrata (five accessions of C. buhsei), two species of Sect.

Armata (C. uniflora, C. porphyrogramma) and four species of Sect. Colutea (C. gracilis, C. persica, C. cilicica) from Iran that little supported relationships among main clades were existed. On the other side, relationships among D clades remained indefinite in our results. So our results show that Astragalus cysticalyx from Astragaleae tribe is close to Colutea tribe (Ahangarian et al. 2007).

According to the other studies, all species examined in our study nested within coluteoid clade in large astragalean clade; Carmichaelia williamsii and Clianthus puniceus species were basal group in sub tribe Coluteinae, and among members of the sub tribe closely relation existed (Polhill 1981; Lavin et al. 1990; Sanderson and Liston 1995; Wojciechowski 2005; Zhang et al. 2012).

Wojciechowski et al. (2000) represented Colutea istria which is sister to the Lessertia+Sutherlandia complex plus Eremosparton + Smirnowia. As can be concluded from the phylogenetic study performed by Lock and Schrire (2005), Swainsona formed the monophyletic group sister to Astragalus cysticalyx, Colutea istria and Colutea arborescens. The results of the present work are consistent with those of Wagstaff et al. (1999) showing the genera Carmichaelia and Clianthus nested within the Swainsona, and thus the monophyly of Carmichaelia was reported by these authors. Therefore, our study supported these results.

In the same study based on a matK, trnL and ITS molecular markers Astragalus epiglottis was shown as the sister group

MIRZAEI et al. â&#x20AC;&#x201C; Phylogeny analysis of Colutea from Iran

for Colutea persica (Liston 1995; Amirahmadi et al. 2014).

Our results of cladistic analysis the phylogenetic relationships among Coluteae tribes showed its monophyletic origin and Astragaleae was its sister group.

In addition, C. cilicica was a sister group to C. gifana whose separated of other Colutea genus from Iran.

However, ITS marker could not sufficiently informative to provide adequate resolution for Colutea genus and the

171

relationships between some of the major groups remained unresolved. According to our results, we can assume that further investigation insufficiently resolved nodes within the Colutea genus will provide important insight into the relationships between the species and, consequently, the genera of Coluteae tribe. The combined approach including application of different markers would increase the resolutions and supports of the clades in Colutea.

Figure 2. Bayesian consensus phylogram for combined data (Numbers above branches are Bayesian posterior probabilities. Numbers below branches are maximum likelihood percentage bootstrap values).

172

B I O D I V E R S IT A S 16 (2): 168-172, October 2015

ACKNOWLEDGMENTS This article is extracted from Ph.D. dissertation of the first author. We finally thank Islamic Azad University, Tehran Science and Research Branch for providing the facilities necessary to carry out the work.

REFERENCES Ahangarian S, Kazempourosaloo S, Maassoumi AA. 2007. Molecular phylogeny of the tribe Hedysareae with special reference to Onobrychis (Fabaceae) as inferred from nrDNA ITS sequences.

Iranian J Bot 13: 64-74.

Akaike H. 1974. A new look at the statistical model identification. IEEE Transactions on Automatic Control 19, 718-723.

Alvarez I, Wendel JF. 2003. Ribosomal ITS sequences and plant phylogenetic inference. Mol Phylogenet Evol 29: 417- 434.

Amirahmadi A, Kazempourosaloo S, Moein F, Kaveh A, Maassoumi AA. 2014. Molecular systematics of the tribe Hedysareae (Fabaceae) based on nrDNA ITS and plastid trnL-F and matK sequences. Plant Syst Evol 300: 729-747.

Baldwin BG. 1992. Phylogenetic utility of the internal transcribed spacer of nuclear ribosomal DNA in plants: an example from the Compositae. Mol Phylogenet Evol 1: 3-16.

Baldwin BJ, Sanderson MJ, Markprter J, WojciechowskiMF, Campbell C, Donoghue JM. 1995. The ITS region of nuclear ribosomal DNA: a valuable source of evidence of Angiosperm phylogeny. Ann Miss Bot Gard 82: 247-277.

Browizc K. 1959. In: Rechinger KH (ed): Flora Iranica vol. 157, Fabaceae. AkademischeDruck- und Verlagsanstalt, Graz.

Foladi FZ, Salimpour F, Sharifnia F, Ghanavati F. 2013. Phylogenetic study of tribe Vicieae based on Internal Transcribed Spacer (ITS).

Ann Biol Res 4 (1): 75-79.

Hakki E, Bekir D, Duran A, Martin E, Dinc M. 2010. Phylogenetic relationship analysis of Genista L. (Fabaceae) species from Turkey as revealed by inter simple sequence repeat amplification. African J Biotechnol 9 (18): 2627-2632.

Huelsenbeck JP, Ronquist F. 2001. MrBayes: Bayesian inference of phylogeny. Bioinformatics 17: 754-755.

Kang Y, Zhang ML, Chen ZD. 2003. A preliminary phylogenetic study of the subgenus Pogonophaca (Astragalus) in China based on ITS sequence Data. Acta Botanica Sinica 45 (2): 140-145.

Kazempourosaloo S, Maassoumi AA, Murakami N. 2005. Molecular systematics of the Old World Astragalus (Fabaceae) as inferred from nrDNA ITS sequence data. Brittonia 57: 367-381.

Lavin M, Doyle JJ, Palmer JD. 1990. Evolutionary significance of the loss of the chloroplast-DNA inverted repeat in the Leguminosae subfamily Papilionoidae. Evolution, 44: 390-402.

Lewis G, Schrire B, Mackinder B, Lock M (eds). 2005. Legumes of the World. The Royal Botanic Gardens, Kew. Lewke BN, Papini A, Mosti SB, Mary Josephine SL. 2013. A phylogenetic analysis of genus Onobrychis and its relationships within the tribe Hedysareae (Fabaceae). Turk J Bot. 37: 981-992.

Liston A. 1995. Use of the polymerase chain reaction to survey for the loss of the inverted repeat in the legume chloroplast genome.

Advances in Legume Systematics 7: Phylogeny. Royal Botanic Gardens; Kew. Lock M, Schrire BD. 2005. Galegeae. In: Lewis GP, Schrire BD, Mackinder BA, Lock M (eds.). Legumes of the World. Royal Botanic Gardens, Kew. Mabberley DJ. 1997. The Plant Book, a Portable Dictionary of the Higher Plants. Cambridge Univ. Press, Cambridge.

Maddison WP, Maddison DR. 2010. Mesquite (version 2. 74): A modular system for evolutionary analysis. http://mesquiteproject. org/ Maggini F, Frediani M, Gelati MT. 2000. Nucleotide sequence of the internal transcribed spacers of ribosomal DNA in Picea abies Karst.

DNA Seq. 11: 87-89.

Mousavi TS, Khosravi AR. 2010. Patterns of distribution in the Family Fabaceae (Except Astragalus) in Iran. Iranian J Bot 16 (2): 303-313.

Polhill RM. 1981. Galegeae. In: Polhill RM, Raven PH (eds). Advances in Legume Systematics, part 1. Royal Botanical Gardens, Kew, U. K. Posada D, Crandall KA. 1998. Modeltest: testing the model of DNA substitution. Bioinformatics 14 (9): 817-818.

Posada D. 2008. jModelTest: Phylogenetic Model Averaging. Mol Biol Evol 25: 1253-1256.

Sanderson MJ, Liston A. 1995. Molecular phylogenetic systematics of Galegeae, with special reference to Astragalus. In: Advances in Legume Ssystematics, Part 7, Royal Botanical Gardens, Kew, UK..

Swofford DL. 2002. Phylogenetic analysis using parsimony (PAUP). Ver. 4. Sinauer Associated Sunderlandm Massachusetts.

Wagstaff SJ, Heenan PB, Sanderson MJ. 1999. Classification, origins, and patterns of diversification in New Zealand Carmichaelinae (Fabaceae). Amer J Bot 86: 1346-1356.

Wojciechowski MF, Sanderson MJ, Hu JM. 1999. Evidence on the monophyly of Astragalus (Fabaceae) and its major subgroups based on nuclear ribosomal DNA ITS and chloroplast DNA trnL intron data. Syst Bot 24: 409-437.

Wojciechowski MF, Sanderson MJ, Steele KP, Liston A. 2000. Molecular phylogeny of the â&#x20AC;&#x153;Temperate Herbaceous Tribesâ&#x20AC;? of Papilionoid legumes: a supertree approach. In: Herendeen PS, Bruneau A. (eds).

Advances in Legume Systematics 9. Royal Botanic Gardens, Kew. Wojciechowski MF. 2005. Astragalus (Fabaceae): A molecular phylogenetic perspective. Brittonia 57: 382-396.

Yousefi M. 2006: Irans Flora. Publication of Payam Nour University, Iran, Tehran.

Zarre S, Azani N. 2012. Perspectives in taxonomy and phylogeny of the genus Astragalus (Fabaceae): a review. Prog Biol Sci 3 (1): 1-6.

Zhang M, Kang Y, Zhou L, Podlech D. 2012. Phylogenetic origin of Phyllolobium with a further implication for diversifiction of Astragalus in China. Acta Botanica Yunnanica 25 (1): 25-32.

B I O D I V E R S IT A S Volume 16, Number 2, October 2015 Pages: 173-178

ISSN: 1412-033X E-ISSN: 2085-4722 DOI: 10.13057/biodiv/d160212

Study of the digestive tract of a rare species of Iranian blind cave fish (Iranocypris typhlops) ALI EBRAHIMI Department of Biology, College of Science, Malard Branch, Islamic Azad University, Malard, Tehran, Iran. Tel./Fax.: +98-21-65672964 email: ebrahimibal@gmail.com Manuscript received: 7 April 2015. Revision accepted: 16 July 2015.

Abstract. Ebrahimi A. 2015. Study of the digestive tract of a rare species of Iranian blind cave fish (Iranocypris typhlops). Biodiversitas 16: 173-178. The Iranian blind cave fish (Iranocypris typhlops) is a unique taxon which only lives within a cave in Lorestan Province in southwest of Iran. Regardless of its enormous genetic interest, this species faces an imminent risk of extinction as no conservation efforts have been done for its protection. This study aimed to analyze the morphology of the digestive tract of this interesting fish using a histological approach. Detailed examinations of the fishes showed that the mouth is horseshoe-shaped and located in an inferior situation (ventral side) of the head. In it, there are three rows of pharyngeal teeth including inner, middle and outer rows, which bear 5, 3 and 3 teeth respectively. The esophagus is very short and lined with an epithelium containing numerous mucous folds. The stomach is not present.

The anterior segment of the intestine is S-shaped which comprises about one half the gut. In this part, there are mucosal folds which show different sizes and mucous layer is thicker than other layers (submucosa, muscle layer and serosa). The distal portion of the intestine is straight (rectal) and terminates to the anal region. In general, the ratio of intestine length is 1.2, as compared to the body length. This study showed that the liver in this taxon is composed of two lobes, the right lobe being two-parts and bigger than the left one. The gall bladder is clear and spherical in appearance. The pancreas is red or orange and observed as scattered masses of cells on the mesentery of the digestive system. To our best knowledge, this is the first study to analyze the morphological characteristics of the digestive tract of the Iranian blind cave fish, and its unique characteristics here found confirmed its singularity and so, the urgent need for its conservation.

Keywords: Blind cave fish, digestive system, digestive tract, histology, morphology

INTRODUCTION

MATERIALS AND METHODS

The fishes are very diverse taxa; weighing from a few grams to several tones and with a length of several centimeters to several meters. As well as, the variety of fish is abundant in Iran. Some species are not yet fully known.

For example, there are few sources about one of the most unique species in Iran called the “Iranian blind cave fish” – Iranocypris typhlops (Figure 1) – which is limited to a cave in “Lovan” Village located at Lorestan Province, Iran.

This species is threatened to extinction mostly because no conservation actions were taken to the moment and virtually no attentions have been paid to it. The Iranian blind cave fish (its characteristics are the same as the taxon) was first identified by Bruun and Kaiser (1944).

This is the only blind fish species known in Iran and its unique morphology, grants it an enormous genetic interest.

The Iranian blind cave fish is mentioned in the 1996 Red List of IUCN as one of the fish species threatened to extinction. The information on the species is scarce and many of its biological aspects are still unknown (IUCN 2015).

The fish’s digestive tracts are as diverse as the species themselves, sometimes with differences occurring within the same species (Coad 1996; Sheybani 2005). Knowing the feeding ecology of a species is a key aspect to understand its role and positioning in the prey/predator relationships, therefore, this study aimed to analyze the morphology of the digestive tract of Iranian blind cave fish as a step ahead to the knowledge of this evasive species.

After obtaining the necessary permits from the Environmental Protection Organization of Iran as a necessity for fishing, ten fishes were fished collected from the wild habitat and were transferred to laboratory. The water temperature was about 17◦C at the time of fishing.

The average of total length of fish’s body was 41 mm and the average of their weight 1.5 g. The fishes were immediately processed and placed in a saline Formalin 10% fixative solution. Through a processing and embedding process in Paraffin, tissue sections were then prepared from the obtained samples. The thickness of sections was about 7 m. The sections were stained through Hematoxylin & Eosin techniques (Slack 1995). After they were prepared, tissue sections were examined through Leica microscope and then the required pictures with various microscopic magnifications were prepared by a digital “Canon” camera attached to the microscope. This study included the morphological and histological studies analysis of the digestive tract.

1 cm

Figure 1. A total dorsal view of Iranian blind cave fish

174

B I O D I V E R S IT A S

16 (2): 173-178, October 2015

RESULTS AND DISCUSSION Morphology of digestive tract The mouth of fish is located in lower position (Figure 2) and the mandibles have no teeth in it.

Three rows of pharyngeal teeth located at 5th gill arch (Figure 4) are present. These teeth are extremely small and can only be seen using a loupe. Pharyngeal teeth are situated in 3 inner, middle and outer rows and the numbers of teeth are: 4 in 3 specimens, 5 in 7 specimens on the inner row, 3 in middle row in all specimens, and 3 in outer row in all specimens (Figure 3).

The esophagus is quite short between 1 to 2mm in length of and it is not as thick as the intestine. This species is similar to carp fishes as they have no stomach.

The intestine consists of three distinct sections of variable thickness between them. The first section located next to esophagus is darker in contrast to the other sections and comprises half of the intestine. This section has an S-

shaped form and the intestine is thicker in this part. The joint part of bile duct is also located in this part. In the second third, the intestine is less thick and lighter in color.

In the last third, the intestine becomes thicker. The total ratio of intestine to body length in this species is about 1.2 and the pylorus appendage is absent.

Liver, gallbladder, pancreas and swim bladder are the attached and joint parts of digestive tract. The liver consists of two separate lobes. The right lobe is larger and consists of two parts. The color of the liver is slightly different in specimens but its usual color is light cream. Gallbladder has a spherical shape and has a thin and clear wall. It is located at right part and under the liver.

Pancreas has a scattered structure located on mesentery peritoneum. Its color is between orange and red. In average, 3 to 7 scattered parts of pancreas can be found at this species locating on mesentery and extends from esophagus to intestine last part (Figure 7).

Figure 2. Moth and Barbels position in cave fish, (ventral view), oc (oral cavity), ul (upper lip, ll (lower lip), b 1-4 (barbells)

Figure 3. Pharyngeal tooth, inner row (I), middle row (M), outer row (O). Tip of tooth is cone or round

Figure 4. Initial part of digestive tract: Pharyngeal tooth (Pt), Esophagus (E), Intestine (I) and folds of mucous (F)

Figure 5. Cross-section of esophagus; Lumen (L), Epithelium (E), Parine (P), Longitudinal muscles (M1), Circular muscles (M2), Serous (S), H & E, Ă&#x2014;10

EBRAHEMI â&#x20AC;&#x201C; The digestive tract of a rare species of Iranocypris typhlops

175

Digestive tract histology Regarding histology, esophagus structure is clearly distinguishable from the other parts of the digestive tract.

The esophagus mucosal contains many longitudinal mucosal folds that extend into lower cavity (Figure 5) but esophagus is thinner than other parts of digestive tract. Its epithelium is simple, stratified, squamous, and the number of cellular layers differ in various areas.

The longitudinal mucosal folds vary, both in shape and length.Two flat inner and outer muscle layers can be found which are longitudinal and circular respectively.

Esophagus muscular layers are thicker than other parts of digestive tract. Squamous cells of serous membrane surround the esophagus (Figure 5).The cells located on the base membrane of the esophagus contain one row of cylindrical cells with oval nucleus. A row of polyhedral cells are located on the surface of them. The cells of top layer are squamous and include elongated nucleus. In some parts of esophagus, between epithelium cells and the cells directed to the top of epithelium, there are some round, large and sub mucosal secretory cells that include foamy and nuclear cytoplasm near to base. These cells are similar to goblet cells and are not evenly distributed (Figure 6).

By means of serial sections of intestine, three parts of tissue can be distinguished. Part 1 is from beginning of intestine, the part to which the bile duct is attached to end of dilatation and includes half of intestine length. In this part, there are intestine mucosal folds in various sizes and the mucosal layer is thicker than other layers and muscular layers (inner and circular, outer and longitudinal) are thinner (Figure 7). Intestine epithelium is simple cylindrical and Paryn loose connective tissue is clearly recognizable in the mucosal folds (Figure 8).

In second part, intestine is thinner but there are more mucosal folds. In this part, the mucosa is quite thick and there is a thin muscular layer that is present but cannot be seen as a double layer.

Regarding histology, the distal part of intestine has a few intestine mucosal folds; the mucosa, sub mucosa and muscular layer which are thinner. In addition, the diameter of intestine increases in this part.

In liver, cells are arranged like irregular columns and form a mixed matrix which is not similar to mammals liver structure. There are no central veins. Liver exposures are seen between liver irregular columns in various shapes and Kupffer cells are located in their wall (Figure 10).

Gallbladder has some distinguished layers including simple cylindrical epithelium, Paryn connective tissue, very delicate muscular layer and serous membrane (Figure 9). In this specimen, the gallbladder is so clear because the constituent layers of its wall are so thin.

Pancreas is located throughout the digestive tract from esophagus to end of intestine and next to digestive tract; it is as scattered mass of cells on the peritoneum (Figure 7).

The cells of pancreas exocrine part include a round nucleus and acidophilic cytoplasm that imply the presence of Zymogen granules. Among Acinar cells, there are a mass of cells containing smaller nucleus which are endocrine part of the glands (Figure 11).

Figure 6. Cross-section of esophagus; Lumen(L), Epithelium (E), Parine (P), Gobllet cell (G), H & E,Ă&#x2014;20

Figure 7. Cross-section of intestine in first part; Lumen(L), Epithelium (E), parine (P), muscular layer (M), Pancreas (Pa), Gall bladder (Ga) , H & E,Ă&#x2014;10

Discussion The mouth location in the fish is soleues and when located in a lower and more ventral position, it is a clear indication that it is a bottom feeding fish. Pharyngeal teeth in carps are different in various species regarding shape, number and their location on 5th gill arch. Therefore, they are used to identify the different carp species (Vosoghi and Mostajir 1994; Coad 1996; Bastani 1999).

Regarding the number of rows of pharyngeal teeth of blind cave fish, 2 rows (Bruun and Kaiser 1944) and 3 rows have been reported. In each row, inner, middle and outer teeth were reported to vary between 1-3, 3-4, 3-5 teeth (Humason 1979). The present study agrees with those finding as 3, 3 and 5 teeth were respectively found in those rows.

176

B I O D I V E R S IT A S

16 (2): 173-178, October 2015

Figure 8. A plica mucous of midgute; Lumen(L), Epithelium (E), Parine (P), muscular layer (M), Pancreas (Pa), Gall bladder (Ga), H & E,×10

Figure 9. Cross - section of Gall bladder; Lumen (L), Epithelium (E), Parine (P), muscular layer (M), serous (S) , H & E,×40

Figure 10. Liver tissue; cords of liver cells(C) are very erratic and kupffer cells (K) are seen in sinusoids, H & E, ×40

Figure 11. Pancreas tissue; Acini cells (Ac) and Endocrine cells (Ec), H & E, ×40

In the carp fishes, esophagus is shorter and morphologically in some of the species (e.g. Amur fish, silver carp and common carp) there is no difference between esophagus and intestine and it is hard to distinguish between them (Bastani 1999). In the present study, due to small size of fish, it was impossible to visually identify the esophagus which was only possible through histology. In some fish species such as white fish (Cyprinidae family), esophagus wall includes a thick muscular layer and it is easy to distinguish between esophagus and intestine (Bastani 1999). Regarding the esophagus epithelium cells, large and round secretory cells are identifiable. The same is true of Acipenser stellatus esophagus (Acipenser stellatus is one species of sturgeon that produces the caviar) (Ghavami 2000). The carp fish

esophagus are a simple and twisty tube in the abdominal cavity (Bastani 1999) a characteristic also seen in Iranian blind cave fish.

Intestine is in S shaped curve and intestines’ epithelium is a simple cylindrical structure. The existence of brush border in intestine epithelium is a main mechanism in absorbing and consuming food and intestinal absorption process in fishes and mammals (Kapoor et al. 1975).

Since the body of Iranian blind cave fish is virtually transparent, intestines can be seen from the outside.

Depending on the fish diet, the length and diameter of the intestine differ. In carnivorous fishes, the esophagus length is shorter than herbivorous fishes (they have no stomach) that have long esophagus including many folds (Coad 1996).

EBRAHEMI – The digestive tract of a rare species of Iranocypris typhlops

The ratio of intestines’ total length to body length varies in Cyprinidae. For example, this ratio in silver carp is approximately 6 (Vosoghi and Mostajir 1994), in Aspius aspius, the ratio is 0.7 to 0.9 (Bastani 1999). In Persian sturgeon, the esophagus constitutes 40-50% of the digestive tract length (Sheybani 2005). In blind cave fish, the average ratio of intestine length to body length was 1.2.

The fish’s intestine is divided into four parts: ventral, anterior, middle, posterior. The ventral part includes oral cavity and gill (pharyngeal). Anterior part is from gills’ posterior edge to esophagus, stomach and pylorus (Coad 1996). In Persian Sturgeon, the intestine constitutes two distinguished parts including anterior intestine and posterior intestine (Sheybani 2005). In carp fishes which have no stomach or pylorus (Vosoghi and Mostajir 1994), middle intestine begins from back of pylorus to posterior esophagus with no clear border. Middle intestine includes a number of pyloric caeca which are not present in fishes which have no stomach. Middle intestine is the longest part of intestine and since it is longer than body length, is in shape of complex loops (Coad 1996). This loop is also seen in S shape in the blind cave fish.

Main function of liver as a digestive gland is producing and secreting bile. Color of fishes’ liver ranges from dark brown to light cream (Navarro et al. 2006) and blind cave fish liver is light cream (Alboghabish and Khaksari 2005).

The liver of blind cave fish is divided into two (right and left) lobes. Carp species have two-part liver. In the blind cave fish, like the carp species, a large part of liver is located in the right part of abdominal cavity (Alboghabish and Khaksari 2005). Liver parenchyma is surrounded by a delicate capsule of loose connective tissue (Alboghabish and Khaksari 2005; Navarro et al. 2006). Liver cells secrete bile which flow to extracellular capillary tubes. The liver cells are hepatocytes containing spherical and central nucleus including different quantities of heterochromatin (Abbasi and Gharzi 2000).

Herbivorous carps as well as African lungfish have liver cells with two nucleuses (Alboghabish and Khaksari 2005), but in present study, those were not identified. In this taxon the liver cells are arranged like columns and form liver cords a morphological characteristic also reported in Japanese salmon, too. The fish liver cells willingness to create liver cords is lower in contrast to mammals (Alboghabish and Khaksari 2005). Liver cells including this particular morphology were identified in the present study, but they do not form regular columns as liver cords.

The main stored materials in fish’s liver are glycogen and fat. The fat is present in organelles of cellular cirrhosis forming small to average drops which occupy the cytoplasm of these cells. Due to this fact, these cells are commonly referred as fat storage cells. Since fat and glycogen are not so chromophil through Hematoxylin and Eosin staining techniques, many vacuole structures are seen in the hepatocytes (Poosti and Sedighmarvdasti 2000; Navarro et al. 2006). These two substances can however be distinguished regarding the vacuole shape. Fat drops are spherical, single or in a mass, while glycogens are irregular

177

in form (Poosti and Sedighmarvdasti 2000). These vacuoles were also identified in the liver of blind cave fish.

Kupffer cells belong to macrophage cells which comprise reticuloendothelial system (Navarro et al. 2006).

Some researchers believe that fish liver has no Kupffer cells, but these cells were reported in catfish (Alboghabish and Khaksari 2005) and carps (Alboghabish and Khaksari 2005). Kupffer cells including triangle nucleus and heterochromatin were observed among the endothelial cells of the liver exposure wall of the blind cave fish.

Gallbladder is present in many fishes and is divided into three parts: mucosa (epithelium and Paryn connective tissue), muscular part and serous part (Abbasi and Gharzi 2000). In the present study, the blind cave fish gallbladder appeared to be crystalline, spherical and clearly segmented in the showing the three tissue parts of gallbladder.

Nonetheless, its muscular part was particularly thin.

In many fishes, pancreas tissue gradually lies next to portal vein branches and the result is called hepatopancreas tissue (Abbasi and Gharzi 2000; Dabrowski et al. 2003; Dyk et al. 2005). A part of pancreas of carp herbivorous fish is located within the liver (Alboghabish and Khaksari 2005) a singularity that was not observed in blind cave fish.

The pancreas of teleosts is an organ is scattered around the digestive tract peritoneum or other limbs and is present among fat tissues (Dyk et al. 2005). Exocrine cells in immature fish as well as that part of pancreas which scattered in fat tissue of adult fish have acinar form (Poosti and Sedighmarvdasti 2000; Dyk et al. 2005).

In the study on blind cave fish it was observed that the pancreas is present in the mesentery peritoneum as scattered parts in red to orange. Observing the pancreas parts through light microscope, it was found that secretory cells include a strongly basophilic cytoplasm and acidophilic spherical particles called zymogen (Poosti and Sedighmarvdasti 2000; Dabrowski et al. 2003; Alboghabish and Khaksari 2005; Dyk et al. 2005). This can be easily observed in the tissue section of blind cave fish pancreas. Islets of Langerhans were identified forming light cellular masses in exocrine part of pancreas, but for more accurate identification of these organelles it is necessary to use specialized staining methods to identify all types of present cells.

ACKNOWLEDGEMENTS I have taken efforts for accomplishing this project.

However, it would not have been possible without the kind support and help of many individuals and organizations. I would like to express my sincere thanks to all of them, in particular, the Mallard Branch of Islamic Azad University, Iran.

REFERENCES Abbasi M, Gharzi A. 2000. Veterinary Comparative Histology, Preclinical Relation. Partoovaghee Publisher, Tehran.

Alboghabish N, Khaksari R. 2005. Structural study of liver and pancreas of Cyprinidea family fishes. Iranian Vet J 11: 25-33.

178

B I O D I V E R S IT A S

16 (2): 173-178, October 2015

Bastani P. 1999. Comparative study of digestive system in Cyprinidea fish with different diet. [M.Sc. Thesis]. Tarbiat Modares University, Tehran.

Bruun AF, Kaiser EW. 1944. Iranocypris typhlops n.g., n.sp., the first true cave fish from Asia., Danish scientific investigations in Iran. Part 4.

Copenhagen, 4: 1-8.

Coad BW. 1996. Threatened fishes of the world: Iranocypris typhlops Bruun & Kaiser, 1994 (Cyprinidae). Environ Biol Fish 46: 374.

Dabrowski K, Lee K, Rinchard J. 2003. The smallest vertebrate, Teleost fish, can utilize synthetic dipeptide-based diets. J Nutr 133: 42254229.

Dyk J, Pieterse G, Vuren J. 2005. Histological changes in the liver of Oreochromis mossambicus (Cichlidae) after exposure to cadmium and zinc. Ecotoxicol Environ Saf 66: 432-440.

Ghavami SM. 2000. Study of Pharynx, Esophagus and Prestomach, of Oozoonbooroon Fish. [Ph.D. Dissertation]. Veterinary Department, Tehran University, Tehran.

Humason GL. 1979. Animal Tissue Techniques. 4th ed. W. H. Freeman, New York.

IUCN. 2015. Iranocypris typhlops (Zagros cave garra), Status: Vulnerable D2 ver 2.3. In: The IUCN Red List of Threatened Species. Version 2015.2. www.iucnredlist.org. [13 July 2015].

Kapoor B, Smith H, Verghina A. 1975. The alimentary canal and digestion in telosts. Adv Mar Biol 13: 109-239.

Navarro M, Lozano M, Agulleiro B. 2006. Ontogeny of the endocrine pancreatic cells of the gilthead sea bream, Sparus aurata (Teleost).

Gen Comp Endocrinol 148: 213-226.

Poosti I, Sedighmarvdasti S. 2000. Fish Histology Atlas. Tehran University Publisher, Tehran.

Sheybani M. 2005. Microscopic Study of Iranian Sturgeon Fish, Acipenser persicus [Ph.D. Dissertation]. Department of Veterinary, Tehran University, Tehran.

Slack J. 1995. Developmental biology of the pancreas. Development 121: 1569-1580.

Vosoghi G. Mostajir B. 1994. Freshwater Fishes. Tehran University Publisher, Tehran.

B I O D I V E R S IT A S Volume 16, Number 2, October 2015 Pages: 179-187

ISSN: 1412-033X E-ISSN: 2085-4722 DOI: 10.13057/biodiv/d160213

Bayesian and Multivariate Analyses of combined molecular and morphological data in Linum austriacum (Linaceae) populations: Evidence for infraspecific taxonomic groups FATIMA AFSHAR1, MASOUD SHEIDAI2, SEYED-MEHDI TALEBI3,â&#x2122;Ľ, MARYAM KESHAVARZI1 1 Department of Biology, Alzahra University, Tehran, Iran.

Faculty of Biological Sciences, Shahid Beheshti University, Tehran, Iran.

3 Department of Biology, Faculty of Sciences, Arak University, Arak, 38156-8-8349 Iran. Tel. +98-863-4173317. â&#x2122;Ľe-mail: seyedmehdi_talebi@yahoo.com.

2

Manuscript received: 10 May 2015. Revision accepted: 31 July 2015.

Abstract. Afshar F, Sheidai M, Talebi SM, Keshavarzi M. 2015. Bayesian and Multivariate Analyses of combined molecular and morphological data in Linum austriacum (Linaceae) populations: Evidence for infraspecific taxonomic groups. Biodiversitas 16: 179187. Plant specimens of Linum austriacum (Linaceae) were collected from 16 geographical populations of nine provinces in Iran and used for morphological and molecular (ISSR) analyses. Different multivariate and Bayesian methods were used to study interpopulations differences. Analysis of variance test and Principal coordinate analysis plots indicated morphological difference of the populations. Mantel test revealed positive significant correlation between morphological and geographical distance of these populations.

Pearson, coefficient of correlation showed significant correlations between basal leaf length, width and length/width ratio with latitude and altitude of the studied populations. Bayesian analysis of combined molecular and morphological features revealed divergence of the studied populations and consensus tree showed separation of 6 populations in different clusters. Canonical Variate Analysis plot of these populations showed that Sang Sefid and Salmas populations differed greatly from the other populations. New ecotypes are suggested for these populations.

Keywords: Infraspecific variation, morphology, Iran, ISSR, population.

INTRODUCTION The presence of intraspecific variation in organisms is a source of natural variation and is a way of response of organisms to their environment. Intraspecefic variation brings about biodiversity and is thought as the main origin and storage of speciation (Christine and Monica 1999; Hufford and Mazer 2003).

Many plant species have wide geographical distribution and face a wide range of climatic and edaphic conditions.

Individuals of these species are able to give appropriate response to a tremendous variety of different conditions.

These responses or adaptations change the descents of these individuals of a species, genotypically, phenotypically and physiologically and led to infraspecific diversity. Therefore, descents of these individuals tend to appear as new ecotypes, ecophenes, chemotypes, cytotypes and even subspecies (Christine and Monica 1999).

Habitat heterogeneity, combined with natural selection, often results in multiple, genetically distinct ecotypes within a single species. In addition, the populations of a given species facing different environmental conditions may undergo genetic changes to adapt to their local conditions (Linhart and Grant 1996; Hufford and Mazer 2003).

Infraspecific variation, difference between individuals or populations of a given species, is responsible for a relation of functionally relevant niche space occupation in

biological communities (Albert et al. 2010; Fridley and Grime 2010; Violle et al. 2010). It is confirmed that plants occupy different space to forbear competitive interactions by means of variations in morphological and physiological characteristics. In addition, same plant species elude competition with each other and variegate their biological strategies by means of feature variation.

Linum L. genus (Linaceae) contains about 180 species that are source of fiber (Smeder and Liljedahl 1996), seed oils (Diederichsen and Raney 2006), and fodder (Bhathena et al. 2002). Some species are of medicinal value and contain Omega-3 fatty acids and potential anti-cancer compounds (Rogers 1982) as well as Lignans (Schmidt et al. 2010). Linum species grow in temperate and subtropical regions of the world (Rogers 1982; Muir and Westcott 2003). Linum austriacum L. is an herbaceous medicinal plant containing important lignans such as arylnaphthalene lignan and justicidin (Mohagheghzadeh et al. 2002), with antifungal, antiprotozoal, cytotoxic and piscicidal properties (Gertsch et al. 2003).

Although extensive biosystematics and phylogenetic studies have been carried out in the genus Linum (see for example, Velasco and Goffman 2000; Everaert et al. 2001; Sharifnia and Albouyeh 2002; Hemmati 2007; Rogers 2008; Schmidt et al. 2010; Soto-Cerda et al. 2011, Talebi et al. 2012a,b), little is known about the infraspecific diversity and taxonomic forms of wild Linum species (Sheidai et al.

2014b).

180

B I O D I V E R S IT A S 16 (2): 178-187, October 2015

The neutral molecular data have been extensively used to study the speciation process (see for example, CasselLundhagen et al. 2009; Pampoulie et al. 2011), the genetic diversity (Sheidai et al. 2012, 2013), the populations, genetic structure (Sheidai et al. 2012, 2014), and the genetic drift (Heather and Freeland 2011). In particular, ISSR (Inter simple Sequence Repeats) markers have been applied in genetic characterization and taxonomy studies on cultivated flax as well as on wild flax species.

Recently we reported inter-population genetic diversity in L. austriacum L. (Sheidai et al. 2014). Furthermore, we also encountered morphological variability among these geographical populations. The aim of present study was to illustrate if genetic variability of populations is associated with morphological variability and if combined effects of these variation lead to the formation of infra-specific taxonomic forms.

Therefore, in the present study randomly collected plants of L. austriacum from 16 geographical populations were studied from morphological and molecular (ISSR) points view. Bayesian and multivariate analyses were performed on combined data set obtained to identify potential infraspecific forms. The genetic data employed in this current manuscript has been entirely taken from the former Sheidai et al. (2014).

Figure 1. Distribution map of the studied populations in northwest Iran.

Table 1. Locality and herbarium voucher number of the studied populations.

MATERIALS AND METHODS Plant materials Plant specimens of L. austriacum (Linaceae) were collected from 16 geographical populations of nine provinces in Iran (Figure 1) and used for morphological and molecular (ISSR) analyses. In order to acquire data of the studied populations, four plant samples were selected of each population.

Samples were identified based on the descriptions provided in accessible references such as Flora Iranica (Rechinger 1974) and Flora of Iran (Sharifnia and Assadi 2001). The voucher specimens were deposited in the herbarium of Shahid Beheshti University (HSBU), Iran (Table 1). Detail of DNA extraction and molecular study is provided in our previous report (Sheidai et al. 2014). In short, genomic DNA was extracted using CTAB activated charcoal protocol (Križman et al. 2006). Ten ISSR primers; (AGC) 5GT, (CA) 7GT, (AGC) 5GG, UBC810, (CA) 7AT, (GA) 9C, UBC807, UBC811, (GA) 9A and (GT) 7CA commercialized by UBC (the University of British Columbia) were used. PCR reactions were performed in a 25μl volume containing 10 mM Tris-HCl buffer at pH 8; 50 mM KCl; 1.5 mM MgCl2; 0.2 mM of each dNTP (Bioron, Germany); 0.2 μM of a single primer; 20 ng genomic DNA and 3 U of Taq DNA polymerase (Bioron, Germany). The amplifications, reactions were performed in Techne thermocycler (Germany) with the following program: 5 minutes initial denaturation step 94°C, 30 S at 94°C; 1 minutes at 50°C and 1 minute at 72°C. The reaction was completed by final extension step of 7 minutes at 72°C.

Habitat address Zanjan, Abhar, 1785 m Kurdistan, Sanandaj, Abidar Mountain, 1645 m East Azerbaijan, Ahar, 1593 m Guilan, Darestan Forest, 544 m Hamedan, Famenin, 1761m East Azerbaijan, Kalibar, 1460 m Kermanshah, Kangavar,1564 m Markazi, Nobaran, 1654 m Qazvin 1, Highway, 1476 m Qazvin 2, Cargo Terminal, 1205 m Hamedan, Razan,1898 m Guilan, Rudbar, 228 m Zanjan, Saeen Qaleh, 1805 m West Azerbaijan, Salmas, 1700 m Markazi, Arak, Sang Sefid, 2084 m East Azerbaijan, Tabriz, 1552 m

Collector

Herbarium No.

Talebi Talebi

HSBU2011133 HSBU2011112

Talebi Talebi Talebi Talebi Talebi Talebi Talebi Talebi Talebi Talebi Talebi Talebi Talebi Talebi

HSBU2011134 HSBU2011126 HSBU2011103 HSBU2011135 HSBU2011116 HSBU2011102 HSBU2011124 HSBU2011122 HSBU2011118 HSBU2011125 HSBU2011131 HSBU2011138 HSBU2011151 HSBU2011136

Data analyses In total thirty two, nine qualitative and twenty three quantitative, morphological characteristics were studied.

Four plants were measured or scored of each population and for each characteristic one measurement was taken per each flowering stem. The used terminologies for qualitative morphological traits were on the basis of descriptive terminology provided by Stearn (1983). Qualitative characters were: petal color, basal leaf shape, floral leaf shape, apex, margin and base shape of floral and basal leaf blade. While, basal leaf width, basal leaf length, stem height, branch number, basal leaf length/width ratio, floral leaf width, floral leaf length, floral leaf length/width ratio,

AFSHAR et al. â&#x20AC;&#x201C; Infraspecific variations in Linum austriacum

calyx length, calyx width, calyx length/width ratio, sepal length, sepal width, sepal length/width ratio, capsule length, capsule width, capsule length/width ratio, stem diameter, leaf diameter, pedicle length, corolla length, corolla width and corolla length/width ratio were quantitative features.

Mean as well as standard deviation of the quantitative traits were determined. The analysis of variance (ANOVA) test was performed to show significant morphological difference between the studied populations. Principal coordinate analysis (PCoA) and Correspondence Analysis (PCA) were performed to group the plants specimens based on morphological characters. Morphological data were standardized (mean = 0, variance = 1) for these analyses (Podani 2000). Non-metric Multidimensional Scaling (MDS) and Canonical Variate Analysis (CVA), were used to illustrate populations, morphological distinctness.

For combined morphological and molecular analyses, the characters were coded as binary and multistate characters. Grouping of the populations was done by two methods. First we carried out structure analysis (Pritchard et al. 2000). For this analysis, data were scored as dominant markers (Falush et al. 2007). Second, we performed KMeans clustering as done in GenoDive ver. 2. (2013).

In order to identify the populations that are genetically and morphologically differentiated from the others, a consensus tree was constructed from morphological and genetic obtained trees. The Mantel test was performed to check correlation between geographical, morphological and genetic distances of the populations (Podani 2000). PAST ver. 2.17 (Hamer et al. 2012), DARwin ver. 5 (2012) programs were used for these analyses.

181

morphological characters.

PCA analysis of morphological features revealed that the first three PCA components comprised about 73% of total variability of the studied populations. In the first PCA axis with about 35% of total variation, morphological traits like sepal length and basal leaf diameter possessed the highest correlation (r >0.90) while in the second PCA axis, characters like stem diameter, sepal length/width ratio, and pedicel length, possessed the highest correlation (r>0.80).

Therefore, these morphological characters were the most variable morphological characteristics among the studied populations. The obtained data showed that characteristics such as floral leaf width as well as corolla width had lowest correlation, this mean that the mentioned traits were the most stable morphological features between the studied samples.

PCA biplot (Figure 3) revealed that morphological characters of sepal length and basal leaf diameter separated Famenin population from the other populations, while morphological characters like stem diameter, sepal length/width ratio, and pedicel length separated Sang Sefid population.

Pearson, s coefficient of correlation determined between morphological characters and geographic traits of the studied populations (longitude, latitude and altitude) produced significant positive correlations between basal leaf length and latitude, and between basal leaf width and basal leaf length/width ratio with altitude.

The Mantel test performed between morphological distance and geographical distance of the studied populations produced significant correlation (P = 0.01, Figure 4), indicating that with an increase in geographical distance of these populations they showed a higher magnitude of morphological difference.

RESULTS AND DISCUSSION Morphological analysis In present study thirty two quantitative and qualitative morphological features of the both vegetative as well reproductive organs were investigated (Table 2). Among the studied qualitative traits, the shapes of blade apex, margin and also base of basal and floral leaves were stable among the studied sample, and were in the shapes of acute, entire and cuneate respectively, furthermore the petal color was invariable inter-populations and presented as blue.

While other characteristics such as floral and basal leaf shape varied between populations and were recorded in the shapes of linear, lanceolate or linear-lanceolate.

In addition, quantitative traits differed between populations and the performed ANOVA test for these characters showed significant difference (p = 0.05) for all the studied traits with the exception of basal and floral leaf length/width ratio, calyx length/width ratio, capsule length as well as capsule length/width ratio among the studied populations (Table 3). Moreover, PCoA plots of all morphological characters separated these populations from each other (Figure2). These results indicated that the studied populations differed significantly in their

Combined molecular and morphological results A combined data matrix of 44 Ă&#x2014; 91 was formed from ISSR and morphological data and used for further analyses.

MDS plot of combined data is presented in Figure 5.

Almost complete separation of the studied population indicated genetic and morphological distinctness of these populations. STRUCTURE plot of the combined data that is based on Bayesian method is presented in Figure 6.

Although it showed some degree of similarity between Abidar and Darestan populations (populations numbers 2 and 4, respectively), and Rudbar and Salmas populations (populations numbers 12 and 14, respectively), complete difference was observed among the other studied populations. This indicates populations, divergence in both genetic and morphological features.

Delta K results of Evanno test that is based on STRUCTURE analysis is presented in Figure 7. It produced K value of 13 as the optimum K number and indicated that the studied populations were placed in 13 different groups. Therefore L. austriacum populations are highly stratified with regard to their morphological and genetic features.

B I O D I V E R S IT A S 16 (2): 178-187, October 2015

182

Table 2. The most important morphological traits of the studied populations (all values were in cm).

Population

Stem Branch Basal leaf high no. shape

Abhar

Mean 43.87 N 4 SD 8.74

Abidar

Mean N SD Mean N SD Mean N SD Mean N SD Mean N SD Mean N SD Mean N SD Mean N SD Mean N SD Mean N SD Mean N SD Mean N SD Mean N SD Mean N SD Mean N SD

Ahar

Darestan

Famenin

Kalibar

Kangavar

Nobaran

Qazvin1

Qazvin2

Razan

Rudbar

Saeen Qaleh Salmas

Sang Sefid Tabriz

3.00 4 .81

Linear

50.05 2.50 Lanceolate 4 4 3.24 .57 57.25 6.75 Linear 4 4 2.25 1.25 33.50 2.25 Linear4 4 Lanceolate 6.28 .50 38.30 4.50 Lanceolate 4 4 6.27 .57 54.25 10.25 Linear 4 4 8.14 3.30 54.75 6.00 Lanceolate 4 4 4.34 2.44 31.87 12.75 Linear 4 4 8.29 7.41 44.72 9.99 Linear 4 4 6.28 .00 56.00 3.25 Linear4 4 Lanceolate 8.75 1.25 62.12 7.00 Lanceolate 4 4 4.40 3.55 53.62 7.00 Linear 4 4 3.22 1.63 49.37 4.50 Lanceolate 4 4 5.02 1.29 58.00 17.50 Linear 4 4 9.09 4.50 62.25 6.75 Lanceolate 4 4 7.07 1.50 63.62 5.00 Linear 4 4 4.71 .81

Basal Basal Floral Floral Floral leaf Calyx Calyx Pedicle Sepal Sepal Corolla Corolla leaf leaf leaf leaf shape length width length length width length width length width length width 1.52 .10 Lanceolate .82 .09 .38 .37 .10 .12 .16 0.74 0.74 4 4 4 4 4 4 4 4 4 4 4 .25 .01 .14 .015 .02 .04 .005 .05 .02 4.98 4.99 1.90 4 .21 1.50 4 .32 1.22 4 .17 1.73 4 .67 1.45 4 .36 1.55 4 .19 1.02 4 .20 1.12 4 .26 2.10 4 .11 1.87 4 .34 1.15 4 .12 1.67 4 .30 1.67 4 .35 1.27 4 .22 1.30 4 .29

.11 4 .01 .197 4 .00 .10 4 .00 .30 4 .08 .16 4 .03 .17 4 .04 .07 4 .04 .12 4 .02 .20 4 .04 .23 4 .04 .14 4 .04 .18 4 .08 .21 4 .06 .15 4 .05 .12 4 .02

Linear

Linear

Lanceolate Lanceolate

Lanceolate

Lanceolate

Lanceolate

Lanceolate

Linear

Linear

Lanceolate

Lanceolate

Linear

Linear

Lanceolate

Finally, in order to identify those populations that are differentiated in both morphological and genetic tree, a consensus tree was obtained which is presented in Figure 8.

It revealed that 6 populations, Sang Sefid, Salmas, Darestan, Qazvin 1, Abhar, and Razan were separated from the others and were differentiated in both morphological and NJ trees. Therefore, although all studied populations differed in their morphological and genetic content as indicated by STRUCTURE plot and MDS plot of

.97 4 .12 1.05 4 .10 .85 4 .17 1.05 4 .129 .67 4 .09 .87 4 .09 .80 4 .20 .72 4 .09 1.00 4 .08 .90 4 .29 .82 4 .09 1.12 4 .35 .75 4 .12 .72 4 .15 .90 4 .08

.10 4 .00 .10 4 .00 .07 4 .02 .14 4 .04 .08 4 .01 .08 4 .02 .08 4 .01 .09 4 .02 .12 4 .02 .10 4 .00 .09 4 .01 .12 4 .04 .09 4 .02 .08 4 .00 .10 4 .05

.38 4 .04 .40 4 .01 .40 4 .00 .37 4 .06 .31 4 .03 .40 4 .00 .32 4 .05 .40 4 .00 .35 4 .05 .38 4 .03 .43 4 .04 .46 4 .04 .40 4 .00 .30 4 .08 .38 4 .04

.34 4 .05 .40 4 .00 .38 4 .02 .40 4 .00 .30 4 .00 .39 4 .00 .37 4 .05 .40 4 .00 .33 4 .04 .37 4 .05 .42 4 .05 .49 4 .02 .38 4 .02 .35 4 .05 .47 4 .12

.08 4 .01 .12 4 .05 .08 4 .01 .10 4 .00 .05 4 .01 .10 4 .00 .06 4 .02 .06 4 .01 .09 4 .01 .10 4 .00 .10 4 .00 .10 4 .00 .09 4 .01 .05 4 .00 .27 4 .20

.10 4 .01 .10 4 .01 .16 4 .03 .15 4 .05 .16 4 .04 .10 4 .00 .10 4 .00 .20 4 .08 .12 4 .05 .10 4 .00 .20 4 .00 .13 4 .04 .13 4 .04 .15 4 .05 .42 4 .04

.19 4 .01 .23 4 .04 .20 4 .00 .25 4 .05 .18 4 .00 .21 4 .02 .18 4 .04 .22 4 .05 .19 4 .01 .23 4 .02 .26 4 .02 .20 4 .00 .20 4 .00 .23 4 .04 .26 4 .11

1.05 4 .05 1.47 4 .35 1.32 4 .17 1.22 4 .22 1.20 4 .14 1.41 4 .46 1.20 4 .18 1.53 4 .19 1.35 4 .129 1.60 4 .34 1.25 4 .12 2.15 4 .12 1.40 4 .35 1.09 4 .08 1.10 4 .00

.80 4 .08 1.20 4 .08 .98 4 .19 1.10 4 .20 .82 4 .09 .96 4 .30 .90 4 .15 1.17 4 .27 .82 4 .20 1.10 4 .24 1.05 4 .09 1.15 4 .05 1.05 4 .19 .91 4 .09 1.05 4 .00

combined data, only these 6 populations were placed in a similar position on the constructed tree in both analyses and formed a distinct cluster.

Detailed analysis of morphological characters in these 6 populations revealed that Sang Sefid population possessed highest value of stem diameter, pedicel length, sepal length and sepal length/width ratio. Similarly, Salmas population contained the largest basal leaf length and largest floral leaf length. It had the shortest calyx leaf length, shortest corolla

AFSHAR et al. â&#x20AC;&#x201C; Infraspecific variations in Linum austriacum

width, shortest sepal length, and the lowest corolla length/width ratio.

These two populations with maximum number of morphological characters which were significantly different from the other studied populations.

Qazvin 1 population had the shortest calyx width and the lowest pedicel length, while Abhar population had the highest floral leaf length, the shortest sepal length and the lowest pedicel length. Razan population had the longest calyx length. This suggestion is supported by CVA plot of combined data in these 6 populations (Figure 9). These Figures showed that Sang Sefid and Salmas populations were placed far from the other 4 populations and took position in different corners of this plot. The other 4 populations were placed close to each other. Therefore Sang Sefid and Salmas populations are much more differentiated from the other studied populations. These populations may be considered as different ecotypes.

Table 3. ANOVA test of quantitative morphological features of the studied populations Characteristics Stem height

Sum of Squares

df

Mean Square

BG 5923.677 15 394.912 WG 1953.062 48 40.689 Total 7876.740 63 Basal leaf BG 5.754 15 .384 length WG 4.497 48 .094 Total 10.251 63 Basal leaf width BG .205 15 .014 WG .103 48 .002 Total .308 63 Floral leaf BG 1.050 15 .070 length WG 1.299 48 .027 Total 2.349 63 Floral leaf BG .021 15 .001 width WG .031 48 .001 Total .053 63 Calyx length BG .103 15 .007 WG .079 48 .002 Total .182 63 Calyx width BG .139 15 .009 WG .106 48 .002 Total .245 63 Pedicle length BG .156 15 .010 WG .139 48 .003 Total .295 63 Sepal length BG .364 15 .024 WG .083 48 .002 Total .447 63 Sepal width BG .056 15 .004 WG .080 48 .002 Total .136 63 Capsule length BG .127 12 .011 WG .183 34 .005 Total .310 46 Capsule width BG .203 12 .017 WG .224 34 .007 Total .427 46 Note: BG = Between Groups, WT = Within Groups

F

Sig.

9.706 .000

4.094 .000

6.357 .000

2.589 .006

2.154 .023

4.194 .000

4.168 .000

3.587 .000

14.042 .000

2.220 .019

1.967 .061

2.569 .015

183

Discussion Ellison et al. (2004), stated that geographic variations in morphological characters of plants is a function of changes in phenotypic characters in response to local ecological conditions, variations in genetic structure as well as evolution between populations, and the biogeographic history of an individual species.

Although some qualitative morphological features such as petal color as well as leaf apex, margin and base fixed among the studied populations, but floral and basal leaf shape varied between the studied populations, so different shapes of leaves were recorded. Different studies showed that morphological characteristics such as leaf shapes are constrained genetically, but they also can be affected greatly by the local environment in which they develop (Thompson 1991; Schlichting and Pigliucci 1998).

In addition, most of quantitative morphological traits varied between populations and ANOVA test as well as PCA analysis of morphological traits confirmed these conditions. Some of these variations had either taxonomical or ecological (adaptive) importance. For example, foliar features were used in identification keys of this genus in different references such as Flora Iranica (Rechinger 1974) and Flora of Iran (Sharifnia and Assadi 2001).

Furthermore, PCA biplot revealed that some quantitative feature had diagnostic value and were useful in identification of populations.

The obtained results of Mantel test confirmed that, in the studied L. austriacum populations, morphological distance (difference) of these populations was not correlated to their genetic distance, but morphological distance was positively correlated with their geographical distance. It showed that morphological changes of these populations were not merely under influence of genetic difference and other factors along with genetic variation affect morphological differences.

Moreover, some of the morphological characters like basal leaf length, basal leaf width and basal leaf length/width ratio were correlated to latitude and altitude.

Because results of this study showed that populations that grow in higher latitude possess larger basal leaf length, while populations that grow in eastern parts of the country have larger basal leaf width, and bigger basal leaf length/width ratio.

Since the ecological and environmental conditions varied between populationâ&#x20AC;&#x2122;s habitats, it might be possible that floristical composition of neighboring plants of L. austriacum samples, ecological factors, pollinator species as well as nature of dominant species differed between populations, these conditions were seen in Linum album populations (Talebi et al. 2014a). In order to adaptation to these conditions, different morphological traits of L. austriacum adapted to ecological factors of habitat, therefore morphological variations occurred between populations. Infraspecific studies on various species of this genus or other genera such as Linum album (Talebi et al.

2014 a), Linum glaucum (Talebi et al. 2015) as well as Stachys inflata (Talebi et al. 2014b) confirmed these findings.

184

B I O D I V E R S IT A S 16 (2): 178-187, October 2015

Figure 5. MDS plot of L. austriacum populations based on combined morphological and molecular data. Note: 1. Abhar, 2.

Abidar, 3. Ahar, 4. Darestan, 5. Famenin, 6. Kalibar, 7. Kangavar, 8. Nobaran, 9. Qazvin 1, 10. Qazvin 2, 11. Razan, 12. Rudbar, 13.

Saeen Qaleh, 14. Salmas, 15. Sang Sefid, 16. Tabriz.

Figure 2. Representative PCoA plots of morphological data showing distinctness of the studied populations. Note: 1. Abhar, 2. Abidar, 3. Ahar, 4. Darestan, 5. Famenin, 6. Kalibar, 7.

Kangavar, 8. Nobaran, 9. Qazvin 1, 10. Qazvin 2, 11. Razan, 12.

Rudbar, 13. Saeen Qaleh, 14. Salmas, 15. Sang Sefid, 16. Tabriz.

Figure 7. Delta K results of Evanno test based on the combined data.

Figure 3. PCA biplot of populations based on the morphological characters. Note: 1. Abhar, 2. Abidar, 3. Ahar, 4. Darestan, 5.

Famenin, 6. Kalibar, 7. Kangavar, 8. Nobaran, 9. Qazvin 1, 10.

Qazvin 2, 11. Razan, 12. Rudbar, 13. Saeen Qaleh, 14. Salmas, 15. Sang Sefid, 16. Tabriz.

Figure 4. Mantel test result between morphological and geographical distance of the studied populations.

Figure 9. CVA plot of reduced data.

AFSHAR et al. â&#x20AC;&#x201C; Infraspecific variations in Linum austriacum

185

Figure 6. STRUCTURE plot of the combined data. Note: 1. Abhar, 2. Abidar, 3. Ahar, 4. Darestan, 5. Famenin, 6. Kalibar, 7.

Kangavar, 8. Nobaran, 9. Qazvin 1, 10. Qazvin 2, 11. Razan, 12. Rudbar, 13. Saeen Qaleh, 14. Salmas, 15. Sang Sefid, 16. Tabriz.

Figure 8. Consensus tree of molecular and morphological characters.

Different studies (for example, Bradshaw 1965; Travis 1994; Schmitt et al. 1999) showed that the phenotypic responses to various environments may also consist of highly special physiological, developmental as well as reproductive adaptive that multiply plant function in those environments. Sultan (1995), believed that capability for particular functionally appropriate environmental answer is called adaptive plasticity, as differentiated from the inevitable effects of resource restricts and other suboptimal environments on phenotypic expression. Both adaptive and inevitable natures of developmental plasticity are basic to ecological development, because they influence the success of organisms in their natural contexts. However, functionally adaptive plasticity is of particular interest because it allows individual genotypes to successfully grow and reproduce in many different habitats. Consequently, such plasticity can play a major pert in both the organismâ&#x20AC;&#x2122;s ecological distribution and also its evolutionary diversifications (Sultan 2003).

In our earlier study (Sheidai et al. 2014 a), we reported a significant positive correlation between genetic distance and geographical distance of these populations. However, Mantel test did not show significant correlation between morphological and genetic distance of the studied populations.

Linum austriacum is a widespread species which its different populations occur in different regions of the word, and also this species grow naturally in different parts of Iran in wide ranges of environmental conditions. Sample collecting by authors as well as herbarium vouchers mentioned in different flora such as Flora Iranica (Rechinger 1974) as well as Flora of Iran (Sharifnia and Assadi 2001) confirmed this condition and showed that this species finds in various phytogeographical regions. There are several reasons for such distribution; one of the most important factors for this ability is plasticity in genomic structure of this species. Various studies (Such as Baker 1974; Oliva et al. 1993) confirmed that taxa consisting of adaptively plastic genotypes may inhabit a wide range of ecological conditions; many widespread generalist species may upon examination show this property. Williams et al.

(1995), suggested that the adaptive plasticity may also contribute specifically to species invasiveness by allowing rapid colonization of diverse new habitats without the need to undergo local selection. As Sultan and Spencer (2002) believed, plasticity of individual may influence evolutionary diversification models at the population level by precluding selective divergence in environmentally distinct habitats.

186

B I O D I V E R S IT A S 16 (2): 178-187, October 2015

Losos and Glor (2003), believed that morphological variation and geographical separation among populations are important and considered as the prerequisite to the formation of new taxonomic ranks such as subspecies and species. It is suggested that phylogeographic analysis can be used to illuminate the interplay of climate, geographical history, and evolutionary dynamics in generating new taxa (Avise et al. 1987; Arbogast and Kenagy 2001). Similarly, the Bayesian and consensus tree obtained in the present investigation produced the results that suggested the presence of potential subspecies and ecotypes in L. austriacum. Moreover, population studies on the pattern of variation in many plant species have revealed the existence of localized populations each adapted to the particular environmental conditions of their habitat (Christine and Monica 1999).

“The term ecotype is defined as: distinct genotypes (or populations) within a species resulting from adaptation to local environmental conditions; capable of interbreeding with other ecotypes or epitypes of the same species (Hufford, and Mazer 2003)”. This definition suits morphological and genetic discontinuities observed in 4 populations of L. austriacum species.

Ockendon (1968), studied morphological diversity in several geographical populations of the L. perenne group in Europe. He reported that most of these characters vary continuously and no sharp differences existed among populations. However, significant difference was observed in some of the quantitative characters and therefore, different geographical populations were considered to be ecotypes within each subspecies. In a similar investigation, Nicholls (1986), carried out multivariate analysis of morphological characters in populations of L. tenuifolium and recognized sub-specific taxa in this species. The same argument holds true for Sheidai et al. (2014b), who based on molecular and morphological difference of the studied population in Linum album, considered them as ecotypes within this species.

REFERENCES Albert CE, Thuiller W, Yoccoz NG, Douzet R, Aubert S, Lavorel S. 2010.

A multi-trait approach reveals the structure and the relative importance of intra-vs. interspecific variability in plant traits. Funct Ecol 24: 1192-1201.

Arbogast BS, Kenagy GJ. 2001. Comparative phylogeography as an integrative approach to historical biogeography. J Biogeogr 28: 819825.

Avise JC, Arnold J, Ball RM, Berminham E, Lamb T, Neigel JE, Reeb CA, Saunders NC. 1987. Intraspecific phylogeography: the mitochondrial DNA bridge between population genetics and systematics. Ann Rev Ecol Syst 18: 489-522.

Baker HG. 1974. The evolution of weeds. Ann Rev Ecol Syst 5: 1-24.

Bhathena SJ, Ali AA, Mohamed AI, Hansen CT, Velasquez MT. 2002.

Differential effects of dietary flaxseed protein and soy protein on plasma triglyceride and uric acid levels in animal models. J Nutr Biochem 13: 684-689.

Bradshaw AD. 1965. Evolutionary significance of phenotypic plasticity in plants. Adv Genet 13: 115-155.

Cassel-Lundhagen A, Ronnås C, Frauenfelder N. 2009. Characterization and crossamplification of 13 microsatellite loci in the northern pine processionary moth, Thaumetopoea pinivora (Lepidoptera: Notodontidae). Mol Ecol Resour 9: 1074-1075.

Christine SJ, Monica AG.1999. Variation among population of Clarkia unguiculata (Onagraceae) along altitudinal and latitudinal gradients.

Am J Bot 86 (3): 333-343.

Diederichsen A, Raney JP. 2006. Seed colour, seed weight and seed oil content in Linum usitatissimum accessions held by plant gene resources of Canada. Plant Breed 125: 372-377.

Ellison AM, Buckley HL, Miller TE, Gotelli NJ. 2004. Morphological variation in Sarracenia purpurea (Sarraceniaceae): Geographic, environmental, and taxonomic correlates. Am J Bot 91: 1930-1935.

Everaert I, de Riek J, de Loose M, van Waes J, van Bockstaele E. 2001.

Most similar variety grouping for distinctness evaluation of flax and linseed (Linum usitatissimum L.) varieties by means of AFLP and morphological data. Plant Var Seeds 14: 69-87.

Falush D, Stephens M, Pritchard JK. 2007. Inference of population structure using multilocus genotype data: dominant markers and null alleles. Mol Eco Notes 7: 574-578.

Fridley JD, Grim JP. 2010. Community and ecosystem effects of intraspecific genetic diversity in grassland microcosms of varying species diversity. Ecology 91: 2272-2283.

Gertsch J, Tobler RT, Brun R, Sticher O, Heilmann J. 2003. Antifungal, antiprotozoal, cytotoxic and piscicidal properties of Justicidin B and a new arylnaphthalide lignan from Phyllanthus piscatorum. Planta Med 69: 420-424.

Hamer Ø, Harper DAT, Ryan PD. 2012. PAST: paleontological statistics software package for education and data analysis. Palaeontol Electron 4 (1): 1-9.

Heather K, Freeland JR. 2011. Applications and Implications of Neutral versus Non-neutral Markers in Molecular Ecology. Int J Mol Sci 12: 3966-3988.

Hemmati SH. 2007. Biosynthesis of Lignans in Plant Species of the Section Linum: Pinoresinol-Lariciresinol Reductase and Justicidin B 7-Hydroxylase.

[Dissertation].

Heinrich-Heine University, Düsseldorf, Düsseldorf. [Germany].

Hufford KM, Mazer SJ. 2003. Plant ecotypes: genetic differentiation in the age of ecological restoration. Trends Ecol Evol 18: 147-155.

Križman M, Jakse J, Baricevic D, Javornik B, Prošek M. 2006. Robust CTAB-activated charcoal protocol for plant DNA extraction. Acta Agri Slov 87 (2): 427-433.

Linhart YB, Grant MC. 1996. Evolutionary significance of local genetic differentiation in plants. Annu Rev Ecol Syst 27: 237-277.

Losos JB, Glor RE. 2003. Phylogenetic comparative methods and the geography of speciation. Trends Ecol Evol 18: 220-227.

Mohagheghzadeh A, Schmidt TJ, Alfermann AW. 2002. Arylnaphthalene lignans from in vitro cultures of Linum austriacum. J Nat Prod 65: 6971.

Muir AD, Westcott ND. (eds.). 2003. Flax: The genus Linum. Taylor and Francis, London.

Nicholls MS. 1986. Variation and evolution in Linum tenuifolium (Linaceae). Plant Syst Evol 153: 243-258.

Ockendon DJ. 1968. Biosystematic studies in Linum perenne group. New Phytol 67: 787-813.

Oliva G, Martinez A, Collantes M, Dubcovsky J. 1993. Phenotypic plasticity and contrasting habitat colonization in Festuca pallescens.

Can J Bot 71: 970-977.

Pampoulie C, Danielsdottir AK, Storr-Paulsen M, Hovgard H, Hjorleifsson E, Steinarsson BA. 2011. Neutral and non-neutral genetic markers revealed the presence of inshore and offshore stock components of atlantic cod in greenland waters. Trans Am Fish Soc. 140, 307-319.

Podani J. 2000. Introduction to the Exploration of Multivariate Data.

Backhuys Publishers, Leiden.

Pritchard JK, Stephens M, Donnelly P. 2000. Inference of population structure using multilocus genotype Data. Genetics 155: 945-959.

Rechinger KH. 1974. Flora Iranica no.106 Linaceae. Akademische drucku.verlag sanstalt, Graz.

Rogers CM. 1982. The Systematics of Linum sect. Linopsis (Linaceae).

Plant Syst Evol 140: 225-234.

Rogers CM. 2008. A revision of the genus Linum in southern Africa. Nord J Bot 1 (6): 711-722.

Schlichting CD, Pigliucci M.. 1998. Phenotypic Evolution: A Reaction Norm Perspective. Sinauer Associates, Sunderland, MA. Schmitt J, Dudley SA, Pigliucci M. 1999. Manipulative approaches to testing adaptive plasticity: phytochrome-mediated shade-avoidance responses in plants. Am Nat 154: S43-S54.

Schmidt TJ, Hemmati S, Klaes M, Konuklugil B, Mohagheghzadeh A, Ionkova I, Fuss E, Wilhelm Alfermann A. 2010. Lignans in flowering

AFSHAR et al. â&#x20AC;&#x201C; Infraspecific variations in Linum austriacum aerial parts of Linum species chemodiversity in the light of systematics and phylogeny. Phytochemistry 71 (14-15): 1714-1728.

Sharifnia F, Albouyeh RM. 2002. Anatomical Studies in Relation to Taxonomy of Persian Linum species. Pakistan J Biol Sci 5: 12401245.

Sharifnia F, Assadi M. 2001. Flora of Iran. No. 34: Linaceae. Islamic Republic of Iran. Ministry of Jahad-e-Sazandegi. Research Institute of Forests and Rangelands, Iran.

Sheidai M, Afshar F, Keshavarzi M, Talebi SM, Noormohammadi Z, Shafaf T. 2014.Genetic diversity and genome size variability in Linum austriacum (Linaceae) populations. Biochem Syst Ecol 57: 2026.

Sheidai M, Seif E, Nouroozi M, Noormohammadi Z. 2012. Cytogenetic and molecular diversity of Cirsium arvense (Asteraceae) populations in Iran. J Jap Bot 87: 193-205.

Sheidai M, Zanganeh S, Haji-Ramezanali R, Nouroozi M, Noormohammadi Z, Ghsemzadeh-Baraki S. 2013. Genetic diversity and population structure in four Cirsium (Asteraceae) species.

Biologia (Bratisl) 68: 384-397.

Sheidai M, Ziaee S, Farahani F, Talebi SM, Noormohammadi Z, Hasheminejad-Ahangarani Farahani Y. 2014b. Infra-specific genetic and morphological diversity in Linum album (Linaceae). Biologia (Bratisl) 69: 32-39.

Smeder B, Liljedahl S. 1996. Market oriented identification of important properties in developing flax fibers for technical uses. Ind Crop Prod 5: 149-162.

Soto-Cerda BJ, Saavedra HU, Navarro CN, Ortega PM. 2011.

Characterization of novel genic SSR markers in Linum usitatissimum (L.) and their transferability across eleven Linum species. Plant Biotech14: 0717-3458.

Stearn WT. 1983.Botanical Latin, 3rd ed. David and Charles, Devon, UK. Sultan SE. 1995. Phenotypic plasticity and plant adaptation. Acta Bot Neerl 44: 363-383.

187

Sultan SE. 2003. Phenotypic plasticity in plants: a case study in ecological development. Evol Dev 5 (1) 25-33.

Sultan SE, Spencer HG. 2002. Metapopulation structure favors plasticity over local adaptation. Am Nat 160: 271-283.

Talebi SM, Atri M, Sheidai M, Sharifnia F, Noormohammadi Z. 2014a.

Infraspecific variations in Linum album based on the determination of special stations approach method in Iran. Phytol Balc 20 (1): 9-22.

Talebi SM, Salahi Esfahani G, Azizi N. 2014b. Inter and intrapopulation variations in Stachys inflata Benth. Based on phenotype plasticity (an ecological and phytogeographical review). Int Res J Biological Sci 3 (2): 9-20.

Talebi SM, Sheidai M, Atri M, Sharifnia F, Noormohammadi Z. 2012a.

Palynological study of the genus Linum in Iran (a taxonomic review).

Phytol Balcan 18 (3): 293-303.

Talebi SM, Sheidai M, Atri M, Sharifnia F, Noormohammadi Z. 2012b.

Seed micromorphology study of the genus Linum L. (Linaceae) in Iran. Ann Biol Res 3 (6): 2874-2880.

Talebi SM, Sheidai M, Atri M, Sharifnia F, Noormohammadi Z. 2015.

Infraspecific morphological and genome size variations in Linum glaucum in Iran. Biodiversitas 16: 69-78.

Thompson JD. 1991. Phenotypic plasticity as a component of evolutionary change. Trends Ecol Evol 6: 246-249.

Travis J. 1994. Ecological genetics of life-history traits: variation and its evolutionary significance. In: Real L (ed.) Ecological Genetics.

Princeton University Press, Princeton, NJ. Velasco L, Goffman FD. 2000. Tocopherol, plastochromanol and fatty acid patterns in the genus Linum. Plant Syst Evol 221: 77-88.

Violle C, Enquist BJ, McGill BJ, Jiang L, Albert C, Hulshof C, Jung V, Messier J. 2010. The return of the variance: intraspecific variability in community ecology. Trends Ecol Evol 27: 244-252.

Williams DG, Mack RN, Black RA. 1995. Ecophysiology of introduced Pennisetum setaceum on Hawaii: the role of phenotypic plasticity.

Ecology 76: 1569-1580.

B I O D I V E R S IT A S Volume 16, Number 2, October 2015 Pages: 188-195

ISSN: 1412-033X E-ISSN: 2085-4722 DOI: 10.13057/biodiv/d160214

Impact of Gujjar Rehabilitation Programme on the group size of Asian elephants (Elephas maximus) in Rajaji National Park, North-West India RITESH JOSHI Conservation and Survey Division, Ministry of Environment, Forest and Climate Change, Indira Paryavaran Bhawan, Jor Bagh Road, New Delhi110003, India. Tel./Fax.: +91-24695359,♥email: ritesh_joshi2325@yahoo.com Manuscript received: 13 July 2015. Revision accepted: 1 August2015.

Abstract. Joshi R. 2015.Impact of Gujjar Rehabilitation Programme on the group size of Asian elephants (Elephas maximus) in Rajaji National Park, North-West India. Biodiversitas 16: 188-195. A comparative study has been done to assess the impact of the Gujjar Rehabilitation Programme on the group’s size of Asian elephants (Elephas maximus) in Rajaji National Park, north-west India. Field surveys were carried outbefore the Gujjar’s rehabilitation during 1999-2001 and after the Gujjar’s rehabilitation during 2006-2008 in Chilla and Haridwar forest ranges of the park. A total of 833 groups of elephants were sighted, varying from 2-5 (mean value±SD=28.5±24.7) to 21-25 animals (mean value±SD=8.2±4.6). The number of groups sighted in Haridwar forest after the Gujjars’ rehabilitation were significantly low in summer and winter as compared before the Gujjars’ rehabilitation. However, the number of groups sighted in Chilla forest before and after the Gujjars’ rehabilitation in both the seasons was found to be same. Results indicated that elephant’s group’s size and movement was shrinking/reducing in Haridwar forest, however, in Chilla forest it was found to be slightly expanding/increasing. The impact of Gujjar Rehabilitation Programme has not brought any drastic change in restoring the larger population of elephants and in increasing their group’s size, however, this has increased the frequent movement and activities of elephants within their home range. Restoration of large fragmented forest stretches/corridors for elephant’s migration and habitat management are of paramount importance in providing elephants a wider way to move across entire landscape in large herds. As increase in human population in the nearby areas and developmental activities, with increase in vehicle traffic pressure on national highways and railway track existing across the park were found to be creating negative impacts on the overall movement of large groups of the elephants.

Keywords: Asian elephant, group size, Gujjar Rehabilitation Programme, Rajaji National Park, Shivalik Elephant Reserve

INTRODUCTION Group formation is a widespread phenomenon throughout the social mammals, and the problem of animal grouping is one of the most fundamental ones in biology (Durand et al. 2007). Most of the vertebrates, including humans, are gregarious to a certain degree and tend to form groups of conspecific individuals, which build up a major component of their environment thereby influencing major aspects of their lives, such as predation pressure, pathogen pressure, aggression, foraging success, metabolism and sexual selection (Reiczigel et al. 2008). The size and composition of social groups have diverse effects on morphology and behavior, ranging from the extent of sexual dimorphism to brain size, and the structure of social relationships (Silk 2007). Elephants are known to live in large herds, which generally depend upon the availability of feeding grounds and suitable habitats. Besides, availability of adequate water sources (rivers, reservoirs, etc.) is another important factor, which influences grouping in elephants. Elephant’s group sizes are probably determined by factors such as forage abundance, seasonality, animal density and numbers, human disturbance, natural predation pressure, genetic relatedness; and among all these factors, food resource availability probably plays important role in determining family or group size (Sukumar 2008).

A larger group of elephants is generally called herd, which is a large family unit. In elephants, single groups generally consists an adult cow and few individuals, however large herds consists several small groups making it a larger clan, especially during migrations or adverse environmental condition. Sukumar (1994) proposed that the term ‘family’ should be restricted to a single adult female plus off springs, and the term ‘joint family’ is used in the Asian tradition to describe groups with more than one adult female, even if these are reasonably stable.

Elephant populations are composed of several clans, which represent large extended families; different clans or members of different clans do not associate with each other, however, members of a clan can mingle and form associations with others in the clan (Desai 1997).

North-western Shivalik landscape is one of the most crucial elephant’s habitats, which holds nearly 1346 elephants, distributed within 14 protected areas (records of the 2007s elephant census, Uttarakhand Forest Department). During the last 3-4 decades, rapid rate of developmental activities, especially after the establishment of Uttarakhand state in 2000, had disconnected a long chain of elephant’s habitat, which earlier was known to spread across river Yamuna in the west to Sharda in the east, as a result of which elephants were pocketed in smaller forest patches, and thus their larger herds were converted into smaller groups. Rajaji National Park (RNP), one of the

JOSHI –Effects of Gujjars’ rehabilitation on elephants in Rajaji, Northwest India

crucial elephant’s habitat in Shivalik Elephant Reserve serves as the north-western limit to the distribution range of the Asian elephants. It holds a healthy population and sex ratio of elephants as well. A total of 416 elephants were recorded in RNP during the elephant’s census carried out in 2007. In a study carried out in Shivalik Elephant Reserve, the male-female sex ratio of the elephants in Rajaji and Corbett National Parks was recorded as 1:1.8 male:females in RNP and 1:1.5-2.1 male:females in Corbett National Park (Williams 2002). However, in a study carried out in Chilla, Motichur and Haridwar forests of the RNP, the elephant’s sex-ratio was recorded as 100 females:22.4 males (male:female ratio=1:4.4), which revealed on a healthy elephant’s sex ratio (Joshi et al. 2007).

Gujjars are a nomadic pastoral community, arrived in the Shivalik hills from Jammu and Kashmir State nearly 200 years ago, as part of the dowry of a princess of Nahan (at present, a part of the Himachal Pradesh State). In Shivaliks, they raised domestic buffalos and practiced pastoralism, spending winter and beginning months of summer (from October to April) in the Shivalik foothills and peak summer and monsoon (from May to September) in the Himalayan alpine pastures. These traditional migrations generally take 20 days to complete one side journey from lower to higher altitude areas or from higher to lower altitude areas. Gujjar’s livelihood is primarily based on rearing buffalo and cattle, and selling milk in local markets. In view of achieving the objectives of the provisions of the Wildlife (Protection) Act 1972, Gujjar Rehabilitation Programme (GRP) commenced effectively in 1980s, especially after the establishment of Uttarakhand State in November 2000. Initial attempts were made in 1984 to resettle Gujjars (by the then Uttar Pradesh State Government) but the program could not succeed, because of non-participation of Gujjars in the program. Besides, the fear of divesting of their traditional rights was another reason, which encouraged them not to leave the forest.

With the passage of time, program was made more effective because of sincere and dedicated efforts of Government and Gujjars’ understanding about the benefits of urban life and in this way, nearly 93.3% Gujjars were resettled to two different rehabilitation sites, namely Pathri and Gaindikhatta.

As a result of effective implementation of the Wildlife (Protection) Act, out of total nine forest ranges, seven ranges are completely free from Gujjars so far, which has reduced anthropogenic pressure from the park. GRP has motivated Gujjars to live urban life, which considerably enhanced their livelihood and socio-economic status. Nowa-days, maximum of their children are gaining education from schools, established by the State Government at rehabilitation sites. Besides, they are cultivating few of the cash crops and vegetables in the land provided to each family at rehabilitation sites. GRP in RNP can be considered as a model demonstration to showcase effective conservation programs of the country, which has facilitated in achieving the objectives of the provisions of the Act on one hand, and has provided better livelihood options to the pastoral Gujjars on the other hand. Program has also ensured our priorities of wildlife conservation and is a

189

milestone to showcase the successful rehabilitation and ecological restoration model and to share conservation lessons with other range countries (Joshi and Pande 2007; Joshi 2012). Overall, substantial increases in the encounter rates of several species were apparent from 2002 onwards.

This study illustrates the impact of GRP on the group’s size of elephants in Chilla and Haridwar forest ranges of the RNP.

MATERIALS AND METHODS Rajaji National Park (RNP) is located in Uttarakhand, north-west India at 29º15'-30º31' N 77º52'-78º22' E, and falls under the Gangetic plains biogeographic zone and upper Gangetic plains province (Figure 1). Maximum portion of the park lies under Shivalik’s bio-geographic sub-division. RNP was established in 1983 with the aim of maintaining a viable Asian elephant’s population in the Shivalik landscape and is designated a reserved area for ‘Project Elephant’ by the Ministry of Environment, Forest and Climate Change. The total geographical area of the park is 820.21 km2. The dominant vegetation of the area comprises Sal (Shorea robusta), Kamala (Mallotus philippensis), Cutch (Acacia catechu), Kadam (Adina cordifolia), Bahera (Terminalia bellirica), Indian Banayan (Ficus benghalensis) and Indian Rosewood (Dalbergia sissoo). However, dominant fauna of the park consists of Tiger (Panthera tigris), Leopard (Panthera pardus), Himalayan Black Bear (Ursus thibetanus), Sloth Bear (Melursus ursinus), Hyaena (Hyaena hyaena), Barking Deer (Muntiacus muntjak), Goral (Naemorhedus goral), Spotted Deer (Axis axis), Sambar (Rusa unicolor) and Wild Boar (Sus scrofa) and among reptilian fauna the Mugger Crocodile (Crocodylus palustris) and King Cobra (Ophiophagus hannah) represents Rajaji’s faunal diverseness.

The datasets for this article have been extracted from the field studies, which were carried out from 1999 to 2011 on the ecology and behavior of elephants in RNP and adjoining protected areas. Haridwar and Chilla forests were selected for this study, because Haridwar forest was the site where anthropogenic activities were higher, whereas Chilla forest was the site where anthropogenic activities were quite lesser, except of the Gujjars’ activities during their stay in the park area up to 2004. A comparative study on elephant’s group composition, before the GRP (from June 1999 to May 2001) and after the program (from June 2006 to May 2008) was attempted to address the impact of Gujjar’s rehabilitation on the grouping pattern of elephants in RNP.Chi-square test was used to determine differences in the group’s size of elephants. In addition, information on the elephant’s group’s size was also collected from the forest officials, Gujjars residing in HFD and local people to cross check the datasets. Field binocular (Nikon Action Series, 10x50 CF) was used to observe the elephants in forests and Nikon Coolpix 8700 Camera was used to produce photographic evidence. Geographical coordinates of each observation were taken (Garmin GPS 72).

190

B I O D I V E R S IT A S

16 (2): 188-195, October 2015

Figure 1. Location map of the Rajaji National Park, Uttarakhand, north-west India

RESULTS AND DISCUSSION Considering the records of direct sightings of elephants in between 1999-2001 in Chilla forest, maximum sightings occurred were of 11-15 animals (24.54%, sighted 54 times in summer), followed by 2-5 animals (22.27%, sighted 49 times in summer). However, maximum sightings occurred in between 2006-2008 were of 11-15 animals (26.16%, sighted 62 times in summer), followed by 6-10 animals (24.05%, sighted 57 times in summer). On the other hand, maximum sightings of elephant’s group recorded in Haridwar forest in between 1999-2001 were of 2-5 animals (27.46%, sighted 78 times in summer), followed by 6-10 and 16-20 animals, respectively (15.84%, sighted 45 times in summer). However, maximum sightings occurred in between 2006-2008 were of 11-15 animals (21.81%, sighted 24 times in summer), followed by 6-10 animals (17.27%, sighted 19 times in summer) (Figure 2A-D).

In contrast, minimum sightings occurred in Chilla forest in between 1999-2001 and 2006-2008 were of 21-25 animals (0.90%, sighted twice in winter), followed by 1620 animals (1.26%, sighted thrice in winter). Similarly, minimum sightings occurred in Haridwar forest in between 1999-2001 and 2006-2008 were of >25 animals (0.35%, sighted once in summer), followed by 16-20 animals (2.72%, sighted thrice in winter) (Table 1). The largest group of elephants, comprising of 37 individuals was sighted in May 2007 in Luni river in Chilla forest, however, another group comprising of 28 elephants was sighted in June 2006 in Ghasiram water stream, while moving across Ganges. In respect of Haridwar forest only a large group, comprising of 26 elephants was sighted in June 2000 in Kharkhari forest.

A total of 833 groups were sighted in between 19992001 and 2006-2008 in Chilla and Haridwar forests respectively, which varied from 2-5 (mean value±SD=28.5±24.7) to 21-25 animals (mean value±SD=8.2±4.6). Significant changes were not observed in the number of groups sighted in Chilla forest during summer before the Gujjars’ rehabilitation outside from the park area (mean value±SD=30.4±20.5) as compared after the Gujjars’ rehabilitation (mean value±SD=32.2±23.4; One-sample goodness-of-fit test χ2=7.4; df=5; p=0.19521).

Similarly, during the winter significant changes were not observed in the number of groups sighted before the Gujjars’ rehabilitation (mean value±SD=6.4±5.05) as compared after the Gujjars’ rehabilitation (mean value±SD=7.4±5.2; One-sample goodness-of-fit test χ2=14.1; df=4; p=0.00724).

Significant changes were observed in the number of groups sighted in Haridwar forest during summer, before the Gujjars’ rehabilitation (mean value±SD=35.0±27.7) as compared after the Gujjars’ rehabilitation (mean value±SD=13.2±9.0; One-sample goodness-of-fit test χ2=13.2; df=4; p=0.01053). Similarly, during the winter significant changes were observed before the Gujjars’ rehabilitation (mean value±SD=12.7±8.4) as compared after the Gujjars’ rehabilitation (mean value±SD=5.2±4.9; One-sample goodness-of-fit test χ2=4.9; df=4; p=0.30432).

Noticeably, the number of groups sighted in Haridwar forest after the Gujjars’ rehabilitation were significantly low in summer and winter as compared before to the Gujjars’ rehabilitation. However, the number of groups sighted in Chilla forest before and after the Gujjars’ rehabilitation in both the seasons was almost same (Figure 3A-D).

JOSHI –Effects of Gujjars’ rehabilitation on elephants in Rajaji, Northwest India

Population dynamics Social factors such as territoriality, average group size, seasonality of breeding etc. have a profound influence on the population dynamics of many large mammals and are important in their management (Caughley and Walker 1983). Population dynamics has been widely studied in African elephants (Loxodonta africana), which has given a higher insight on their social life, however, only few studies have been conducted on this aspect in Asian elephant range countries and more information on their families’ bond and group’s interaction is still needed to be studied. GRP has strengthened the frequent movements and activities of elephants in RNP, however, has not placed any drastic impact on their grouping pattern. In between 19992001 and 2006-2008, maximum sightings of elephant’s groups occurred in Chilla forest was of 11-15 individuals.

In contrast, maximum sightings of elephant’s groups occurred in Haridwar forest was of 2-5 and 6-10 individuals respectively. It is evident from the data sets that elephant’s group’s sizes were slightly shrinked and their movements were reduced in Haridwar forest. However, elephant’s group’s sizes were slightly expanded and their movements were slightly increased in Chilla forest.

In between 2007-2009, tremendous wildfires destroyed the natural forest in Haridwar and Chilla ranges and adjoining habitats. The Kharkhari and Chilla forests were affected severely by the wildfires and thus disrupted elephant’s seasonal movement. Wildfires occurred in between 2006-2009 in Chilla and Haridwar forests and shrinkage of natural water sources has affected the frequent movement of free-ranging elephants within the RNP (Joshi and Singh 2010). Since last 15 years, vehicle’s traffic pressure on two national highways (Haridwar-Bijnor and Haridwar-Dehradun) has increased almost two folds and elephants were observed not in the situation to cross the road easily, especially during evening hours. It was exposed in a study that nearly 9,900 and 14,100vehicles moves across the Haridwar-Bijnor and Haridwar-Dehradun national highways per day, except only 3 hours, from 12 am to 3 am (Joshi et al. 2010). Besides, train’s traffic has also increased in the Haridwar-Dehradun railway track. In 2000, establishment of State Industrial Development Corporation of Uttarakhand in nearly 10 kilometers long stretch, spread along the Haridwar forest range had severely affected the movement of elephants, especially in

191

the buffer zone of the park. Anthropogenic activities were also observed enhanced mainly because of increased human population along the periphery of the park.

In eastern part of the park, bigger groups of elephants were observed maximum at the onset of summer (MarchApril), when elephants were observed arriving to RNP from Lansdowne forest division and when elephant’s movements were found confined towards the riparian corridors of Ganges. At the onset of monsoon, elephants were observed migrating towards Lansdowne forest division and in some higher ridges of the park in closed family groups. However, in the south-western part of the park, bigger groups were observed maximum during summer and monsoon, when elephant’s movements were found confined nearer to the natural water sources.

Occasional splitting of herds was also recorded; especially when elephants reached in the lower patches of the park, however, composition of most of the herds were observed remained same. Generally, large herds used to split into smaller groups, after reaching to the new feeding grounds and stay there nearly for 3-4 months. Environmental factors affect elephant’s population dynamics, home range, migration patterns, diet, group size and composition, all of which can vary tremendously, in turn influences the dynamics of elephants and their habitats (Poole 1996). The dynamics of a population may be affected through changes in group’s size or other social disruptions such as the removal of age classes, which are important to the group’s social structure and functioning (Dublin and Taylor 1996).

In African elephant’s ranges, larger elephant’s groups were reported during wet season when resources are abundant (Western and Lindsay 1984; Poole and Moss 1989), however, in Asian elephant ranges, larger groups were reported during dry season, when elephants congregate around scarce water sources and chances of their social contact and association are high (Sukumar 1989). Studies in East Africa revealed that elephants used to enter forests in large groups, but leave in small groups, thereby implying that the large groups break up into smaller units within the forests (Laws et al. 1975). In RNP, pronounced elephant’s mating season was recorded as warm period, therefore one of the important reasons behind such gathering particularly in summer might also be for mating needs (Joshi et al. 2009).

Table 1.Sighting of elephant’s groups during summer and winter seasons in Chilla and Haridwar forests of the Rajaji National Park in between 1999-2001 and 2006-2008 Number of individual in groups 2-5 6-10 11-15 16-20 21-25 > 25 Total

Chilla 1999-2001 Summer Winter 49 05 43 11 54 07 11 13 14 02 11 182 38

Total 54 54 61 24 16 11 220

2006-2008 Summer Winter 36 14 57 09 62 11 19 03 12 07 07 193 44

Haridwar Total 50 66 73 22 19 07 237

1999-2001 Summer Winter 78 18 45 21 30 13 45 17 12 04 210 73

Total 96 66 43 62 16 283

2006-2008 Summer Winter 18 10 19 11 24 07 12 03 06 79 31

Total 28 30 31 15 06 110

B I O D I V E R S IT A S

192

16 (2): 188-195, October 2015

A

B

C

D

Group size

A

Group size

B

Group size

C

>25

21-25

16-20

11-15

2-5

6-10

>25

21-25

16-20

6-10

11-15

2-5

>25

21-25

16-20

11-15

2-5

6-10

>25

21-25

16-20

11-15

2-5

6-10

Figure 2.A. An elephant’s herd during migration from Rajaji National Park to Lansdowne forest division, B. Elephant’s group at Chilla forest with a newly born infant, C. A small family of elephants, consisting of five members; mother elephants are taking their calves with care, D. Members of a group greeting each other by inter-twining their trunks in Haridwar forest.

Group size

D

Figures 3 A-B. Number of elephants observed in different group sizes (with standard error) during summer and winter seasons in Chilla forest in between 1999-2001 and 2006-2008 (before and after the Gujjars’ rehabilitation), C-D. Number of elephants observed in different group sizes (with standard error) during summer and winter seasons in Haridwar forest in between 1999-2001 and 2006-2008 (before and after the Gujjars’ rehabilitation).

JOSHI –Effects of Gujjars’ rehabilitation on elephants in Rajaji, Northwest India

Sukumar (1994) recorded elephant’s aggregation ranging from 50 to 200 in southern India. In a study carried out in the same area, elephant’s group size was recorded ranging from 1 to 26 individuals with mean group size 4.32±3.2; it was also revealed from this study that elephants have skewed group size with smaller group sizes being more common than larger groups (Ashokkumar et al.

2010). However, in a similar study carried out in the same area, it has been exposed that elephant’s group size varied from 1 to 22 individuals with mean group size 4.6±0.16 and 6.8 respectively (Ramesh et al. 2012). Vance et al.

(2008) have illustrated on the social networks in African elephants and pointed out that social groups tend to be less cohesive and smaller, families are often divided into small subgroups in dry season, and they rarely fuse with other families to form larger aggregations, which is mainly due to scarcity of fodder resources. Further, during wet season, families often travel in intact groups and whole families often fuse with other families, constituting a bigger continuous aggregation, which occurs mainly because of availability higher resources.

Scientific reasons behind conversion of large groups into smaller ones Habitat fragmentation and disconnectivity of large migratory corridors were observed as prime cause, which had converted large elephant’s herds into smaller ones.

Four crucial wildlife corridors namely, Motichur-Chilla, Motichur-Gohri, Motichur-Kansrao-Barkot and RawasanSonanadi, which exists across RNP and connect this protected area with Corbett Tiger Reserve, were found almost blocked, mainly because of expansion of human settlements, national highways/motor roads and agriculture lands and increasing traffic in Haridwar-Dehradun railway track. The presence of traffic on the road, construction of steep retaining walls and the presence of human population along the entire Rajaji-Corbett wildlife corridor area have almost restricted the migration of elephants in between the Rajaji-Corbett National Parks (Johnsingh and Williams 1999).

Nandy et al. (2007) carried out the assessment of Chilla-Motichur wildlife corridor using temporal satellite imagery from years 1972, 1990 and 2005, which exposed that an area of 17.56 Km2 has been lost in between 19722005 mainly because of various developmental activities.

Another study carried out in between June 2009 to May 2011 exposed that a total of 352 individuals of 39 species were killed on Haridwar-Bijnor and Haridwar-Dehradun national highways and on an ancillary road (HaridwarChilla-Rishikesh) existing across RNP (Joshi and Dixit 2012). Noticeably, 23 elephants were killed in collision with train on Haridwar-Dehradun railway track since 1987.

Besides, few cases of collision of elephants with the speeding vehicles on national highways were also observed, during the study period.

In 1970s, the establishment of Chilla hydro-electric power plant/channel had almost divided RNP into two major parts, the eastern and western fringe. Further, after the establishment of Uttarakhand state in 2000, vehicle traffic pressure on Haridwar-Dehradun national highway

193

and railway track, which exists in between the park area has increased many folds, which restricted elephants to inter-change the forests frequently. In south-western part of the park, elephant’s access to river Ganges, which is flowing in between the park area was found restricted, mainly because of presence of a national highway, railway track and human settlements. Some recognized bulls (~2-3) were observed visiting Ganges occasionally by crossing the populated area and national highway and railway track, however group’s movement was found almost restricted in this part. In eastern part of the park, elephant’s were found visiting Ganges, especially in summer when their movements were confined nearer to the riparian corridors.

However, elephant’s frequent movement towards Ganges was observed affected because of the presence of the Chilla power channel.

Non availability of large grasslands was recorded another reason, which compels the elephants to aggregate in smaller groups. In addition to some small patches of grasslands, Mundal grassland in Chilla forest is only a vast patch (tentatively 500 hectares), where large groups of elephants were recorded in summer. This grassland was developed across the Mundal river after the relocation of Gujjars in 2003-2004, consisting mainly Wild Sugarcane (Saccharum spontaneum) and Kans Grass (Saccharum munja) species.

Anthropogenic activities were observed affecting frequent movement of elephants within their home range and thus their group’s size. More than 20 villages are situated along the south-western boundary of RNP, 20 villages along the eastern fringe and nearly 15 villages are situated along the northern axis of the park. Noticeably, most of the villagers were found dependent on forest resources for their livelihood, which primarily includes collection of fuelwood and fodder. Spreading of invasive species like Lantana Weed (Lantana camara) and Parthenium Weed (Parthenium hysterophorus), and native weeds like Malabar Nut (Adhatoda vasica), Indian Hemp (Cannabis sativa) and Wild Senna (Cassia tora)was also recorded affecting the regeneration of various species of grasses. Spreading of these invasive species was found occurring mainly because of cattle’s grazing across the boundary of the park. Besides, annual/torrential rivers were also noted as cause of spreading of these species.

Few previous records Evidences of sighting of large herds of elephants in the park were mostly noticed sporadic and specifically during dry period. In between 1999-2011, I had seen the largest herd of elephants in May 2000, consisting of ≈50 individuals in Gohri forest of the RNP, while moving across the Ganges, which embraces the peak of dry season.

In between 2004-2008, largest herd of elephants, comprising of 47 individuals was sighted in 2005 in Chilla forest of the RNP in summer (Pande GS 2015, personal communication) months. Since last two decades, only a large herd of elephants was sighted in 1997 during summer in Rawasan river in Chilla forest, which consisted nearly 78 elephants and later on, such a large herd was never sighted (Negi MS 2015, personal communication).

194

B I O D I V E R S IT A S

16 (2): 188-195, October 2015

Management guidelines Three small bridges (±3.5 meter wide) were constructed during 1970s over to the Chilla power channel during the establishment of Chilla hydro-electric power plant, one in Chilla forest, named Soni water source bridge, and two other in Gohri forest, one near to Kaudia village (Kaudia village bridge) and another at Kunao forest (Kunao water source bridge). Elephants were found utilizing only two bridges, one in Chilla and another in Gohri forest (Soni and Kunao water source bridges), however, not utilizing Kaudia bridge mainly because of presence of Kaudia and Ganga-Bhogpur villages across the bridge. Soni water source and Kaudia village bridges are connected with Chilla-Motichur and Motichur-Gohri corridor, whereas, Kunao water source bridge is connected to MotichurKansrao-Barkot corridor. All these corridors link RNP with Corbett Tiger Reserve area. It is needed to widen all these bridges tofacilitate the movement of elephants in between RNP and Corbett Tiger Reserve. Besides, two more bridges could also be constructed over to the power channel, one at Ram water source, in between Chilla power house and Kaudia village and another at Kunao, in between Binj river and Kunao bridge, which would be feasible approaches to give elephants wider way to move across Ganges and corridors as well.

It is not easy to count elephants directly when moving in large herds or groups, especially in foothills and vegetation dominant landscapes. Further, there are chances of ground-based errors during estimating their numbers.

Generally, elephant’s large groups maintain a range while feeding or drinking, which ranges tentatively from 50-200 meter. Sometimes, some members of the group used to arrive in open areas or river beds from dense forest to drink, however some companions remain inside the forest, which can emerge out of the forest area after a while.

Elephant is a giant animal and if some individual assembles at a place, it covers large space and looks like a large group. Similarly, pugmarks impressions of few individuals give an impression of movement of a big group. These are some examples which should be taken into account while estimating elephant’s numbers in forests.

Some villages, which are situated across the crucial elephant’s corridor, should be rehabilitated outside the protected area. In addition, Gujjars from Shyampur and Chiriapur forest ranges of the Haridwar forest division and Gohri forest of the RNP should also be rehabilitated outside from the protected area. In addition to the relevant provisions of the Wildlife Protection Act and Project Elephant, this could be achieved with the help of conservation actions, which were identified for development of site-specific management plans, securing identified corridors and connectivity areas for the integration of the protected areas, participatory wildlife monitoring for strengthening management and conducting targeted studies on protected areas valuation assessment as well as on climate change resilience and adaptation assessment in selected protected areas, under India's Action Plan for Convention on Biological Diversity's Programme of the Work on Protected Areas (Pande and Arora 2014).

Some important natural water reservoirs, which spread across the Bagro, Ranipur, Ravli, Chirak and Harnaul annual rivers in Haridwar forest and Ghasiram, Mitthawali, Mundal, Luni and Rawasan annual rivers in Chilla forest should be restored. Besides, water sources which are connected with the Chilla power channel should also be managed.

Riparian corridors of Ganges should be restored from anthropogenic activities, especially from mining activities.

Scientific studies on elephant’s ecology and behaviour and its implementation would ensure the future survival of elephants in entire Shivalik Elephant Reserve.

In conclusion, the impact of GRP has not placed any drastic change in restoring elephant’s population and increasing their group’s size, however, has restored the wilderness of the park, which has increased the frequent movement and activities of elephants within their home range, and thus facilitated in ensuring the effective implementation of Wildlife (Protection) Act 1972.

Catastrophic increase in human population, developmental activities, and increasing rate of vehicle traffic on national highways existing across the landscape were observed reinforcing negative impact on the movement of large groups and herds of the elephants. Since last 15 years vehicle-traffic pressure on the national highways and a railway track existing across RNP has increased drastically.

Besides, developmental and anthropogenic activities have also increased across maximum of the forest edges and in some crucial corridors. Moreover, the establishment of State Industrial Development Corporation of Uttarakhand in 2000 has affected the frequent movement of elephants, especially in park’s buffer zone. All these activities have reduced the connectivity between different protected areas, thus affected the elephant’s movement across large undisrupted landscapes in large herds. Understanding how elephant populations acclimatize to such unwanted changes in their habitat, is essential for addressing future challenges in elephant’s management and conservation. Since the extent to which elephant’s aggregate in a particular area is relevant to their management, restoring the crucial wildlife corridors, facilitating the Ganges’ access and ensuring community participation would strengthen the elephant’s traditional migration across entire Shivalik Elephant Reserve.

ACKNOWLEDGEMENTS The author would like to acknowledge the anonymous reviewers, who had provided valuable inputs and comments on the previous versions of the manuscript and contributed significantly to improve the manuscript to its present form. The author would like to acknowledge G.B. Pant Institute of Himalayan Environment and Development, Garhwal Unit, Srinagar-Garhwal, Uttarakhand, India and the Doon Institute of Management and Research, Rishikesh, Uttarakhand, India, as the author was associated with these institutions during the study period. Author would also like to acknowledge the Uttarakhand Forest Department, especially the

JOSHI –Effects of Gujjars’ rehabilitation on elephants in Rajaji, Northwest India

administration of the RNP for providing permission to conduct research on elephant’s ecology and behavior. The author would like to also thank Shanti Prasad, Field Assistant, field staff of the RNP and various Gujjars and locals, who had provided assistance and inputs during collection of the field data.

REFERENCES Ashokkumar M, Nagarajan R, Desai AA. 2010. Group size and age-sex composition of Asian elephant and gaur in Mudumalai Tiger Reserve, Southern India. Gajah 32: 27-34.

Caughley G, Walker B. 1983. Working with ecological ideas. In: Ferrar AA (ed) Guidelines for the Management of Large Mammals in African Conservation Areas. South African National Scientific Programme, Report Series No.69.

Desai A. 1997. The Indian Elephant. Vigyan Prasar, New Delhi & Sanctuary Magazine (NCSTC-Hornbill Natural History Series), Mumbai Joint Publication, India.

Dublin HT, Taylor RD. 1996. Making management decisions from data.

In: Kangwana K (ed) Studying Elephants. AWF Technical Handbook Series 7, African Wildlife Foundation, Nairobi, Kenya.

Durand E, Blum MGB, Francois O. 2007. Prediction of group patterns in social mammals based on a coalescent model. J Theor Biol 249: 262270.

Johnsingh AJT, Williams AC. 1999. Elephant corridors in India: lessons for other elephant range countries. Oryx 33 (3): 210-214.

Joshi R, Joshi BD, Singh R. 2007. Population composition of Asian elephant (Elephas maximus) in the Rajaji National Park, Uttarakhand, India. Him J Environ Zool 21 (2): 189-202.

Joshi R, Pande GS. 2007. Rehabilitation of Gujjar community from the Rajaji National Park: An approach for biological diversity conservation through restoration ecology. Natl Acad Sci Lett 30 (9&10): 263-267.

Joshi R, Singh R, Pushola R, Negi MS. 2009. Reproductive behaviour of wild Asian elephants Elephas maximus in the Rajaji National Park, north-west India. Researcher 1 (5): 77-84.

Joshi R, Singh R. 2010. Impact of forest fires and shrinking water sources on the elephants of Rajaji National Park, north-west India. Iranica J Energy Environ 1 (4): 305-314.

Joshi R, Singh R, Dixit A, Agarwal R, Negi MS, Pandey N, Pushola R, Rawat S. 2010. Is isolation of protected habitats the prime conservation concern for endangered Asian elephants in Shivalik landscape? Global J Environ Res 4 (2): 113-126.

195

Joshi R. 2012. Gujjar community resettlement from Rajaji National Park, Uttarakhand, India. Conserv Evid9: 3-8.

Joshi R, Dixit A. 2012. Wildlife mortality on national highway 72 and 74 across the Rajaji National Park and the Haridwar conservation area, north India. Int J Conserv Sci3 (2): 127-139.

Laws RM, Parker ISC, Johnstone RCB. 1975. Elephants and their habitats: The ecology of elephants in North Bunyoro, Uganda.

Clarendon Press, Oxford.

Nandy S, Kushwaha SPS, Mukhopadhyay S. 2007. Monitoring the ChillaMotichur wildlife corridor using geospatial tools. J Nat Conserv 15: 237-244.

Pande HK, Arora S. 2014. India’s Fifth National Report to the Convention on Biological Diversity. Ministry of Environment & Forest, New Delhi, India.

Poole JH, Moss CJ. 1989. Elephant mate searching: Group dynamics and vocal and olfactory communication. In: Jewell PA, Maloiy GMO (eds) The Biology of Large African Mammals in their Environment.

Proceedings of Symposium of the Zoological Society of London.Clarendon Press,Oxford.

Poole J. 1996. The African elephant. In: Kangwana K (ed) Studying Elephants. AWF Technical Handbook Series 7, African Wildlife Foundation, Nairobi, Kenya.

Ramesh T, Sankar K, Qureshi Q, Kalle R. 2012. Group size and population structure of megaherbivores (gaur Bos gaurus and Asian elephant(Elephas maximus) in a deciduous habitat of Western Ghats, India. Mammal Stud 37: 47-54.

Reiczigel J, Lang Z, Rozsa L, Tothmeresz B. 2008. Measures of sociality: two different views of group size. Anim Behav 75: 715-721.

Silk JB. 2007. The adaptive value of sociality in mammalian groups.

Philos Trans RSoc Lond B Biol Sci 362: 539-559.

Sukumar R. 1989. The Asian Elephant: Ecology and management.

Cambridge Studies in Applied Ecology & Resource Management, Cambridge University Press, Cambridge.

Sukumar R. 1994. Elephant days and nights: Ten years with the Indian elephant. Oxford University Press, New Delhi, India.

Sukumar R. 2008. Elephant in time and space: Evolution & Ecology. In: Wemmer CM, Christen CA (eds) Elephants and Ethics: Toward a Morality of Coexistence. Johns Hopkins University Press, Baltimore, USA. Vance EA, Archie EA, Moss CJ. 2008. Social networks in African elephants. Comput Math Organ Th 15 (4): 273-293.

Western D, Lindsay WK. 1984. Seasonal herd dynamics of a savanna elephant population. Afr J Ecol22: 229-244.

Williams AC. 2002. Population age-sex ratios of elephants in RajajiCorbett National Parks, Uttarakhand, Technical Report, Operation Eye of the Tiger, Dehradun, India.

B I O D I V E R S IT A S Volume 16, Number 2, October 2015 Pages: 196-204

ISSN: 1412-033X E-ISSN: 2085-4722 DOI: 10.13057/biodiv/d160215

Diversity of butterflies in four different forest types in Mount Slamet, Central Java, Indonesia IMAM WIDHIONO Faculty of Biology, Jenderal Soedirman University. Jl. Dr. Soeparno No. 68, Purwokerto, Banyumas 53122, Central Java, Indonesia. Tel. +62-281638794, Fax: +62-281-631700, email: imamwidhiono@yahoo.com Manuscript received: 26 May 2015. Revision accepted: 20 August 2015.

Abstract. Widhiono I. 2015. Diversity of butterflies in four different forest types in Mount Slamet, Central Java, Indonesia.

Biodiversitas 16: 196-204. The study was carried out in four different habitat types (secondary forest, plantation forest, agroforest, and tourist area) on the southern slope of Mount Slamet, Baturaden Forest, Central Java, Indonesia from July 2009 to August 2010. A total of 99 species belonging to eight families showed a dominance of Nymphalidae (30 species) followed by Pieridae (17 species), Lycaenidae (15 species), Papilionidae (13 species), Satyridae (11 species), Danaidae (6 species), Amathusidae (4 species), and Riodinidae (3 species). From the 99 butterflies species found on the southern slope of Mount Slamet, 32 species (30%) were specific to the forest, whereas 63 species (60.6%) were common to all habitats sampled, and the last 10 species (9.4%) were endemics species with one protected species (Troides helena). The present results was showed that butterflies diversity, abundance, and endemism is still relatively high, representing 18% of all butterfly species found in Java and supporting 71.4% endemic species found in Central Java.

The plantation forest were contributed the highest diversity and abundance of butterfly species, whereas the agroforest showed the lowest diversity, abundance, and endemism. Among all habitats surveyed, the secondary forest represented the most suitable habitat for biodiversity conservation and maintenance of rare and endemic species.

Keywords: Butterfly, Central Java, diversity, endemism, Mount Slamet

INTRODUCTION Mount Slamet is the second largest volcanic mountain in Java, located in the western region of Central Java Province, with an altitude of 3,432 m above sea level. A large area of Mount Slamet is covered by a variety of forests, including secondary, plantation, agroforests and tourist areas (SFC 1999). Ecologically, forests on Mount Slamet are divided into three types of forest, i.e.: lowland, montane, and subalpine that has diverse vegetation (Sumarno and Girmansyah 2012). The forest areas on Mount Slamet are managed by the State Forest Management Agency (Perum Perhutani). From an ecological viewpoint, forest areas on Mount Slamet is a transition from tropical rainforests in western Java to monsoon forests in eastern Java, which significantly impact on the conservation of biodiversity in Java.

Secondary and plantation forests are usually monocultures of exotic tree species, meaning that they provide poorer habitats than original forests for native butterfly species. Both secondary and plantation forests are expected to play positive roles in biodiversity restoration (Matsumoto et al. 2015), especially when reforestation and natural regeneration are allowed. These secondary and plantation forests can be considered additional conservation areas, as they are in close proximity to natural forests that are known to house of a large population of butterflies.

Secondary and plantation forests can also act as buffers and connections between natural forests and other lands, like agroforests and tourist areas. They may improve

connectivity among forest patches, which is important for the maintenance of butterfly diversity.

Java island is a suitable places hosts a diverse butterfly population (583 species, Yukawa 1984; and 629 species, Whitten et al. 1997) with 46 endemic species (Matsumoto et al. 2015), most or all of which depend to some extent upon closed forests (Bonebrake et al. 2010; Sodhi et al.

2010; Vu et al. 2015). From a conservationist viewpoint, patterns in the richness of geographical restricted or endemic butterflies are of particular interest. The diversity of butterfly communities has been studied in different habitat types in different part of Java, such as Gunung Halimun National Park, West Java (Ubaidillah 1998), Mount Tangkuban Perahu, West Java (Subahar et al. 2007), Gunung Salak, West Java (Tabadepu et al. 2008), Gunung Halimun-Salak National Park, West Java (Murwitaningsih and Dharma 2014), and Bromo-Tengger-Semeru National Park, East Java (Suharto et al. 2005). However, few studies have been performed on the diversity of butterfly communities on Mount Slamet. The study was examined the diversity, abundance, and endemism of butterfly on Mount Slamet and to address the importance of secondary and plantation forests for butterfly conservation.

MATERIALS AND METHODS Study area The study was conducted in Baturaden Forest, East Banyumas Forest Management Unit on the southern slope

WIDHIONO – Butterflies of Mount Slamet, Central Java

of Mount Slamet, Central Java, Indonesia. Geographically, this region lies between 70 18’23 72” S and 1090 14’ 06 51” at 600-800 m above sea level. The total study area is 267.5 ha, and the forest types are mainly classified as secondary forest (SF, 50 ha), plantation forest (PF, 50 ha), agroforest (AF, 50 ha), and tourist area (AF, 117.5 ha) (Figure 1).

Description of the study site Secondary forest (SF) Vegetation in SFs are tropical, rainforest-type vegetation that consists of 19-20 tree species, such as Palaquium rostratum, Turpinia sphaerocarpa, Xanthophyllum excelsum, Terminalia catappa, Tarenna incerta, Sterculia campanulata, Spathodea campanulata, Semecarpus heterophyllus, Planchonia valida, Macaranga rhizinoides, Litsea angulata, Hernandia peltata, Helicia javanica, Gluta renghas, Ficus variegata, F. benjamina, Fagraea crenulata, Euodia roxburghiana, Erythrina variegata, Elaeocarpus glaber, Dipterocarpus gracilis, Dendrocnide sinuata, Artocarpus elastica, Antidesma tetrandum, and Aglaia elliptica.

197

Plantation forest (PF) PFs are dominated by resin plants (Agathis dammara); other tree species are used for secondary products such as firewood, animal forage, site amelioration, and fodder.

Some are planted as border trees, including Leucaena leucocephala, L. glauca, Calliandra californica, and Acacia villosa. Other trees were planted to increase the heterogeneity of the forest, such as Schima noronhoe, Pterospermum javanicum, Magnolia blumei, Tarenna incerta, Antidesma bunius, Macadamia ternifolia, Swietenia spp., Michelia montana, Mesua ferrea, Machilus rimosa, Cinnamomum burmanii, and Santalum album.

Agroforest (AF) AFs were established as soon as the land was clear-cut and the forest management was performed by Perhutani (State Forest Company/SFC), adopting the Taungya system from Myanmar and involving local people (Whitten et al.

1997). Each family of forest farmers received 2 ha of forest land for a duration 3-5 years. On this land, farmers were to plant the main tree species (A. dammara) and food plants, primarily dry land rice, corn, and certain vegetables.

Figure 1. Location of Baturaden Forest, southern slope of Mount Slamet, indicating the sampling sites.

B I O D I V E R S IT A S 16 (2): 196-204, October 2015

198

Tourist area (TA) In addition to forest management techniques that SFC created, tourist or recreational areas to increase the quality of life and prosperity of local people were created.

Originally, TAs functioned as campgrounds, but at present, more than 50% of all TAs consist of open gardens with white exotic plant species.

Climatology The study site receives an annual rainfall of approximately 4500 mm3, representing one of the highest precipitation areas in Indonesia. The long rainy season with precipitation of more than 100 mm3/month ranges from October to May/June. The very short dry season with precipitation of less than 60 mm3/month ranges from July to September. Day light temperatures range from 20 to 28°C. Sampling procedure Field surveying of butterfly was conducted from July 2009 to August 2010, following the Modified Pollard Walk Method with kite netting in four distinct habitats of Mount Slamet. Five permanent lines of transects (PLTs) (~ 0.5 km long and 5 m wide) were laid in the four habitat types.

Butterflies were captured during sunny days at a constant speed in each transect from 8 am to 12 am local time for four consecutive days. This process was repeated at 30-day intervals, maintaining the same spatial scale in each of the five sampling sites. Identification of butterfly species was used the method described by D’ Abrera (1982, 1985 and 1986). Collected specimens are maintained in the entomology laboratory at Jenderal Soedirman University, Purwokerto, Banyumas, Central Java, Indonesia.

Data analysis The Shannon diversity index was applied to estimate butterfly diversity along the habitats. This index was calculated using the equation: Hs =-Σpi In p, where, pi is the proportion of individuals found in the ith species and ‘In’ denotes the natural logarithm. Species dominance across habitats was estimated using the Simpson’s dominance index to determine the proportion of more

A

common species in a community or an area with the following formula: Ds = Σsi=1 [ni (ni-1)]/[N (N-1)], where ni is the population density of the ith species, and N is the total population density of all component species in each site. Comparisons of butterfly species composition between different forest habitats was estimated using single linkage cluster analysis based on Bray-Curtis similarity.

Biodiversity Pro version 2 (McAleece et al. 1997) was used for data analysis.

To classify the status of species, the rare species, as defined in this study, are those species represented by fewer than 10 individuals, while the endemic species defined as species which is only found in Java and nowhere else in the world.

RESULTS AND DISCUSSION The butterfly community at Mount Slamet A total of 99 butterfly species were recorded at the study site: the southern slope of Mount Slamet (Table 1).

The species recorded were obtained from July 2009 to August 2010.

The butterfly species belong to eight families with a dominance of Nymphalidae (30 species, 28.7%) followed

by Pieridae (17 species, 16.6%), Lycaenidae (15 species, 15,1%), Papilionidae (13 species, 12.3%), Satyridae (11 species, 10.1%), Danaidae (6 species, 5.5%), Amathusidae (4 species, 3.7%), and Riodinidae (3 species, 3.7%) (Figure 2). This result represents only 18% of the 583 species recorded from Java (Yukawa 1984); 13 species of Papilionidae represent 37.4% of the total species in Java (35 species). Pieridae were represented by 18 species (30%) of a total of 52, and Nymphalidae were represented by by 30 species (15%) from 226 species found in Java.

Additionally, Satyridae were represent by 11 species (30%) from 44 species, Danaidae were represented by 6 species (16.6%) from 36 species, Amathusidae were represented by 4 species (30%) from 13 species, Riodinidae were represented by 4 species, and Lycaenidae were represented by 18 species (10.6%) from 179 species found in Java.

B

Figure 2. A. Species composition of 8 butterfly families. B. Number of individuals of 8 butterfly families

WIDHIONO â&#x20AC;&#x201C; Butterflies of Mount Slamet, Central Java

199

Table 1. Butterfly species captured on Mount Slamet from July 2009 to August 2010 in different forest types.

Atrophaneura coon Atrophaneura nox Atrophaneura priapus Graphium sarpedon Papilio acheron Papilio demolion Papilio helenus Papilio memnon Papilio paris Papilio polytes Chilasa paradoxa Troides helena

SF 27 8 9 1 1 0 21 15 11 18 9 8

PF 13 6 6 29 7 5 30 12 6 1 1 1

Habitat AF 1 0 0 3 0 2 0 14 0 0 0 0

TA 3 2 6 19 6 7 0 23 0 0 0 0

Appias lyncida Appias cardena Catopsilia pomona Catopsilia pyranthe Catopsilia florella Cepora iudith Eurema ada Eurema andersonii Delias belisama Delias descombesi Delias crithoe Delias hyparete Delias pasithoe Delias periboea Leptosia nina Prioneris autothisbe Gandaca harina

5 0 1 2 0 0 0 39 21 2 4 0 12 2 32 1 0

9 5 3 6 13 3 14 119 56 51 13 1 10 19 47 6 107

96 1 152 148 112 115 32 125 11 37 47 0 35 77 17 0 123

84 15 134 113 135 112 98 129 68 57 90 0 3 0 0 0 88

194 21 290 269 260 230 144 412 156 147 154 1 60 98 96 7 318

Amnosia decora Amnosia decora endamia Athyma cama Athyma pravara Cethosia munjava Cethosia penthesilea Chersonesia peraka Cirrochroa clagia Cirrochroa emalea Cupha arias Cynitia iapsis Cyrestis lutea Eulaceura osteria Rhinopalpa polynice Rohana nakula Symbrenthia anna Symbrenthia hypselis Tanaecia trigerta Junonia atlites Junonia hedonia Junonia orithya Junonia almana Lasippa heliodore Lasippa tiga Hypolimnas bolina Hypolimnas misippus Stibochiona coresia Euthalia monina Vanessa cardui Neptis nisea Euploea gamelia

35 42 3 5 3 5 2 12 12 3 8 4 28 2 3 0 0 3 1 2 2 0 46 0 5 1 14 1 0 9 0

72 31 42 12 5 12 52 30 60 21 44 4 23 1 18 1 19 91 21 64 11 0 50 24 48 89 3 84 221 83 0

0 0 19 54 0 0 97 22 22 8 0 0 24 0 0 188 64 12 22 62 0 82 57 100 3 6 0 36 405 0 7

0 0 36 57 0 0 33 1 3 7 8 0 0 0 4 104 51 54 27 23 0 93 124 15 38 20 17 49 0 66 0

107 73 100 128 8 17 184 65 97 39 60 8 75 3 25 293 134 160 71 151 13 175 277 139 94 116 34 170 626 158 7

Family

Genera

Species

Papilionidae

Atrophaneura

Graphium Papilio

Chilasa Troides Pieridae

Appias Catopsilia

Cepora Eurema Delias

Leptosia Prioneris Gandaca Nymphalidae

Amnosia Athyma Cethosia Chersonesia Cirrochroa Cupha Cynitia Cyrestis Eulaceura Rhinopalpa Rohana Symbrenthia Tanaecia Junonia

Lasippa Hypolimnas Stibochiona Euthalia Vanessa Neptis Euploea

â&#x2C6;&#x2018; individuals 44 16 21 52 14 14 51 64 17 19 10 9

B I O D I V E R S IT A S 16 (2): 196-204, October 2015

200 Danaidae

Danaus

Danaus aspasia Danaus vulgaris Euploea climena Euploea gamelia Parantica albata Parantica pseudomelaneus

5 7 5 3 10 3

15 97 11 3 16 82

0 30 2 7 6 0

0 11 7 103 6 0

20 145 25 116 38 85

Elymnias casiphone Elymnias ceryx Elymnias hypermnestra Elymnias nesaea Lethe europa Melanitis leda Melanitis zitenius Mycalesis sudra Ypthima nigricans Ragadia makuta Neorina krishna

12 1 6 6 64 45 25 25 111 89 32

25 2 13 15 182 267 199 413 536 45 29

12 5 0 9 48 12 1 78 561 0 0

16 0 78 22 62 54 47 86 296 0 0

65 8 97 52 356 378 272 602 1504 134 61

Zemeros

Abisara kausambi Abisara savitri Zemeros flegyas

17 1 2

55 1 8

0 0 0

0 0 0

72 2 12

Amathusiidae

Faunis Thaumantis Amathusia Zeuxidia

Faunis canens Thaumantis odana Amathusia taenia Zeuxidia luxerii

90 37 30 2

314 79 101 32

0 0 0 0

0 0 0 0

407 116 131 149

Lycaenidae

Arthopala Prosotas Dacalana Nacaduba

Arthopala sp.

Prosotas dubiosa Dacalana vidura Nacaduba angusta Nacaduba kurava Nacaduba sp.

Surendra vivarna Stiboges calycoides Heliophorus epicles Jamides alecto Jamides celeno Jamides cunilda Jamides cyta Jamides pura Poritia eryconoides

2 0 2 0 0 0 0 1 28 12 3 6 2 15 0 1203

3 26 8 48 109 4 9 1 41 116 96 20 16 52 59 5088

12 11 3 22 57 17 0 0 0 68 4 8 5 19 21 3469

17 21 2 23 69 3 7 0 44 79 20 5 10 93 28 3234

34 58 15 93 235 24 16 2 113 275 123 39 33 179 108 12994

Euploea Parantica

Satyridae

Elymnias

Lethe Melanitis Mycalesis Ypthima Ragadia Neorina Riodinidae

Abisara

Surendra Stiboges Heliophorus Jamides

Poritia

Table 2. Butterfly on Southern slope of Mount Slamet compared to other Indo-Malayan region

Region Oriental Region Indo-Malayan Borneo Java Krakatau Island Sumba Island Buru Island (Molucas) Halimun-Salak Mountains National Park (West Java) Bromo-Tengger-Semeru Mountains National Park (East Java) Mount Slamet (Central Java)

Species known number

Reference

4103 1043 937 629 60 50 49 173

Whitten et al.1997 Whitten et al.1997 Whitten et al.1997 Whitten et al.1997 Bush and Whitaker 1991 Hammer et al. 1997 Hill et al. 1995 Ubaidillah 1998

31

Suharto et al. 2005

105

This study

Species richness at Mount Slamet was quite low compared to the expected richness of butterflies in Java and that found at Gunung Halimun National Park, West Java (Ubaidillah et al. 1998) but was quite similar to the results at Ujung Kulon and nearby islands (New et al. 1987).

Compared to studies done at Mount Tangkuban Perahu, West Java (Subahar et al. 2007), Gunung Salak, West Java (Tabadepu et al. 2008), West Java (Murwitaningsih and Dharma 2014), Bromo-Tengger-Semeru National Park, East Java (Suharto et al. 2005), the SF in Kendal, Central Java (Rahayuningsih et al. 2012) and the open area in Malang, East Java (Khoirun-Nisa et al. 2013), the species number found on Mount Slamet during this study was relatively high. The species composition recorded at Mount Slamet was similar was recorded in Ujung Kulon, West Java (Tabadepu et al. 2008), Krakatau island, West Java (Bush and Whitaker 1991), Gunung Halimun National Park, West Java (Ubaidillah 1998), and Sumba Island

WIDHIONO – Butterflies of Mount Slamet, Central Java

201

(Hammer et al. 1997). The fact indicating that the species assemblages of butterflies at Mount Slamet are dominated by common and widely distributed species in the IndoMalayan region (Table 2).

The general low species richness found at Mount Slamet in comparison to other parts of Java might also due to the sampling methods used. Net capture methods were used as described by Corbet (1941). One limitation of this method is the restriction to capture of understorey butterflies only, as indicated by the fact that the most abundant species captured were understorey species within the families of Satyridae with 3,924 individuals, followed

by Nymphalidae (with 3,737 individuals), Lycaenidae (with 1.290 individuals), and Amathusidae (with 969 individuals). Some canopy fliers might be present but were possibly not captured, as shown by the low abundance of the family Danaidae with 406 individuals and Papilionidae with only 306 individuals. The higher number of individuals of species belonging to family Pieridae might be explained by the fact that several species usually come down to the ground in open habitats. Tropical butterfly communities are divide naturally into two adult feeding guilds (De´ Vries et al. 2012). One guild is composed of species that obtain the majority of their nutritional requirements from flower nectar and include most species of the families Papilionidae, Pieridae, Lycaenidae, Riodinidae, and some groups within Nymphalidae. The second guild is composed of certain genera within Nymphalidae, Satyridae, and Amathusidae, whose adults gain virtually all of their nutritional requirements by feeding on juices of rooting fruits and plant sap (Luk et al.

2011). As the numbers of flower-visiting butterflies increased, fruit-feeding butterflies decreased in abundance towards the canopy. A significant negative relationship between trap height and abundance, as well as the number of recorded species, was found among Satyridae and Nymphalidae (Houlihan et al. 2013). Both the Satyridae and Nymphalidae families were showed decreasing abundance and species number with trap height (Schulze et al. 2001; Fermon et al. 2000). Compared to the count walk method, kite netting results in lower species abundance during research done in Brazil (Caldasa and Robbins 2003).

Habitat preference From the 99 butterfly species found on the southern slope of Mount Slamet, 32 species (30%) were specific to the forest (Houlihan et al. 2013; Majumder et al. 2013), whereas 63 species (60.6%) were commonly distributed to all habitats sampled, and the last 10 species (9.4%) were endemic to the area. Butterfly species richness between habitats was showed PFs have the highest abundance (97 species) followed by TAs with 71 species, SFs with 64 species, and AFs with only 59 species (Figure 3).

The higher species composition in PFs was due to the variability in environmental factors that affect butterfly movement. High species richness of butterflies in PFs revealed that habitat specificity is directly linked to the availability of host plants for larvae and adults. This results was also in agreement with the prediction that highest diversity should occur in situations of intermediate disturbances when both climax and pioneer species can coexistent (Basset, et al. 2011). This finding contradicted that of Mihindukulasooriya et al. (2014) who found that SFs have the highest species diversity compared to regenerative forests in Sri Lanka, but was in line with other research (Peer et al. 2011; Bergerot et al. 2012; Kumar 2012; Lee et al. 2015). The present study revealed that although SFs had fewer species than PFs, SFs were excellent sites for unique species, which i important from a conservation point of view.

The diversity index (H) was highest in PFs (1.647), followed by TAs (1.655), SFs (1.52), and AFs (1.441). The index dominance (1/D) was highest in TAs and lowest in AFs. The evenness index (J’) was relatively similar in all habitats (0.814-0.894).

Forested habitats, like SFs and PFs were dominated by Nymphalidae, Satyridae, and Amathusidae, whereas open habitats like AFs and TAs were dominated by Pieridae. The dominance of Nymphalidae, Satyridae, and Amathusidae in forested areas may be correlated with the availability of host plants, adult food resources, and microclimate conditions. Many studies have documented the dominance shown by members of Nymphalidae in tropical regions, owing to its polyphagous nature, which helps in all habitats (Sarkar 2011; Harsh et al. 2015).

A

B

Figure 3. A. Number of species at four habitats type. B. Number of individuals at four habitats type

202

B I O D I V E R S IT A S 16 (2): 196-204, October 2015

A high proportion of nymphalid species indicates high host plant richness in the study area (Majumder et al.

2013). The dominance of Nymphalidae in SFs and PFs may also be due to the fact that this family needs a larger spectrum of food resources in both closed and open habitats. Fermon et al. (2005) indicated that nymphalid butterflies have a much higher diversity of phenotypes when larval food plants are more evenly distributed across all habitats.

Species of the Satyridae and Amathusidae families, such as those in subfamilies Morphinae and Satyrinae, exclusively feed on monocotyledonous food plants (Vu et al. 2015). In Southeast Asian rainforests, these plants are restricted to the lower forest layer, which may be one reason why the abundance of Satyrinae and Morphinae is highest in the understorey of closed canopy forests (Harsh et al. 2015). Vu (2007) found that fruit-feeding Satyrinae and Morphinae with relatively uniform phenotypes and a comparatively small set of larval food plants are basically restricted to lower vegetation layers, and many are known to be sensitive to changes in humidity. In this research, it was also found that several species of satyrids are restricted to forested habitats, including Ragadia makuta, Melanitis leda, M. zitenius, Neorina chrisna, Elymnias casiphone, and E. ceryx, whereas other species, such as Lethe europa, Mycalesis sudra, and Ypthima nigricans, are abundant in both forest and agriculture areas. The former group primarily feeds upon a small set of larval foods plants, such as R. makuta, which depends only upon Selaginella and is distributed in closed forests only and is very sensitive to humidity (Vu 2007). The latter group exclusively depends on grasses as food plants, which tend to be abundant in all habitats, and especially open areas.

The abundance of the family Amathusidae decreased in SFs and PFs, preferring more heavily disturbed, open areas, like AFs and TAs. For example, Faunis canens occurred with similar abundance in all habitats, whereas Thaumantis odana, Amathusia taenia, and Zeuxidia luxerii occurred at similar abundances in SF and PF habitats. Elliot (1992) expected that adult amathusids butterflies to show a conspicuous preference for the understorey layer of closed forests (Barlow et al. 2007). In Borneo, most amathusids species were recorded near the ground, and 87.9% of the specimens were trapped in the understorey at 0 to 10 m above ground level (Schulze 2001). Amathusid butterflies might be constrained to understorey layers of tropical forests by their food resource requirements. First, their larva are typically bound to grasses (mainly Poaceae), palms (Arecaceae), and others monocotyledonous (Ackery 1988; Elliot 1992). Secondly, the adult butterfly exclusively uses fruits and related food sources that are generally more common on the closed forest floor.

Butterfly species restricted to undisturbed forests often have narrower geographical ranges than species found in disturbed habitats (Posa et al. 2008).

Most Pieridae species showed the highest abundance in open areas; significant differences were found for the species Appias cardena, A. libythea, Delias belisama, D. periboea, Catopsilia pyranthe, C. pomona, C. florella, and Cepora iudith. Both Pieridae species, Eurema andersonii

and Leptosia nina were equally abundant in all habitats except for SFs, where lower capture frequencies were found. Since members of Pieridae are nectar feeding, they rarely penetrate into the dense forest understorey (Sundufu and Dumbuya 2008). Both open and disturbed forest formations that are present in the AFs and TAs appear to support butterfly species that are more commonly associated with ruderal habitats, primarily from the family Pieridae. Widely ranging heliophilous species, which are typical of ruderal habitats, are most likely to successfully establish viable populations in open areas than in closed canopy forests (Chinaru and Joseph 2011). The preference of Pieridae species for open habitats may be correlated with the host plant distribution (Sarkar 2015). Records of species from the Papilionidae, Danaidae, and Pieridae families, all assumed originally to be canopy fliers, may be due to the habits of males to come down to moist floor sites. Many tropical butterfly species (mainly males) take up water and nutrients at moist ground sites, including a number of canopy species (Lawson et al. 2014). Almost all Pierid species found at Mount Slamet were also found at other sites in the Indo-Malayan region, such as Singapore, Malaysian, Thailand, and the Philippines (Matsumoto et al.

2015). This finding indicates that most species dominating open habitats are generalist species distributed throughout the Indo-Malayan region. Generalist species should be simultaneously locally abundant and widely distributed, as a consequence of their ability to exploit a wide range of resources on both local and regional scales. Species with wider geographical distributions may be inherently more adaptable and better able to exploit a wider range of ecological niches; they may therefore be less sensitive to land use changes than are species with narrower distributions (Vu 2007).

Cluster analysis based on the Bray-Curtis single linkage similarity value revealed the percent similarity between species composition across the four habitat types. SFs stood out clearly from the other three habitats and showed a linkage of 28.23%, which represents the lowest similarity.

PFs were linked at 44.67% similarity to the cluster habitats of TAs and AFs; a close similarity was found between TAs with AFs, with a linkage of 63.4298%. This result indicates that SFs had the highest diversity of butterflies with a restricted distribution, making it an important butterfly habitat for future conservation efforts (Figure 4).

Tourist area

Agroforest

Plantation forest

Secondary forest

Figure 4. Bay-Curtis similarity between habitat

WIDHIONO – Butterflies of Mount Slamet, Central Java

Endemic and rare species The 99 species of butterfly was found on the southern slope of Mount Slamet, 10 were endemic to Java Island with 542 individuals from three families: Nymphalidae (Cynitia iapsis, Cyrestis lutea, Rohana nakula, Tanaecia trigerta, Neptis nisea, and Euploea gamelia), Satyridae (Elymnias ceryx, Y. nigricans, and M. sudra) and Pieridae (Prioneris autothisbe) (Table 3). Species richness of endemic butterflies in different habitats showed that SFs have the highest species richness with eight species (80%), PFs have six species (60%), TAs have five species (50%), and AFs have the lowest at four species (40%). Abundance of endemic species in the different habitats showed that the most abundant were found in PFs (158 individuals) and the lowest was in SFs (112 species). The 10 endemic species, five were specific to the forest and very rare, indicating that endemic species mostly depend upon forest vegetation and suggesting the need for strict conservation measures. The other five species found in all habitats and were very abundance, especially Y. nigricans and M. sudra (Widhiono 2015). This result indicates that forests on Mount Slamet support the existence of endemic Java butterflies (30.43%). Then 14 endemic species found in this location amount 71.4%.

Rabinowitz (1981) suggested an eight cell model of abundance or rarity involving large/small habitat range, wide/narrow habitat specificity, and large/small populations where present. Rare species, as defined in this study, are those represented by fewer than 10 individuals.

In total, 10 butterfly species were found with fewer than 10 individuals during the entire period and at a different study site (Table 3). They are therefore classified in this study as “rare species”. For example Abisara savitri and Stiboges calycoides (Riodinidae). The rarity of A. savitri is due to Table 3. Endemic and rare species of butterfly found on Mount Slamet.

Endemics species

Number of individuals

Cynitia iapsis Cyrestis lutea Elymnias ceryx Euploea gamelia Rohana nakula Tanaecia trigerta Mycalesis sudra Ypthima nigricans Neptis nisea Prioneris autothisbe

20 6 8 7 25 160 156 358 8 7

Rare species Cyrestis lutea Elymnias ceryx Prioneris autothisbe Troides helena (protected species) Cethosia munjava Delias hyparete Euploea gamelia Rhinopalpa polynice Abisara savitri Stiboges calycoides

Number of individuals 6 8 6 9 8 1 7 3 2 2

203

fact that this species mainly inhabits primary forests and is most abundant at the height of rainy period, a time when little collecting is normally done (Callaghan 2009). Only one species (Troides helena (Papilionidae) is a protected species based on Government Regulation (Peraturan Pemerintah) No. 7/1999 and CITES Appendix II. The result showed that butterfly diversity, abundance, and endemism on Mount Slamet is relatively high, representing 18% of butterfly species found in Java and supporting 71.4% of endemic species and one protected species (T. helena) found in Central Java. PFs contributed the highest diversity and abundance of butterfly species, and AFs showed the lowest butterfly diversity, abundance, and endemism. Among all forest habitats surveyed, the SFs represent the most suitable habitats for biodiversity conservation and the maintenance of rare and endemic species.

REFERENCES Ackery PR. 1988. Hostplant and classification: a review of Nymphalid butterflies. Biol J Linn Soc 33: 95-203.

Barlow J, Overal W, Araujo IS, Gardner ST, Peres CA. 2007. The value of primary, secondary and plantation forests for fruit-feeding butterflies in the Brazilian Amazon. J Appl Ecol 44, 1001-1012.

Basset Y, Eastwood R, Sam L, Lohman DJ, Novotny V, Treuer T, Miller S, Weiblen DJ, Pierce NE, Ewin BS, Oowong WS, Kongnoo P, Osorio-arenas MA. 2011. Comparison of rainforest butterfly assemblages across three biogeographical regions using standardized protocols. J Res Lepid. 44: 17-28.

Bergerot B, Merck T, Van Dyck H, Baguette M. 2012. Habitat fragmentation impacts mobility in a common and widespread woodland butterfly: do sexes respond differently? BMC Ecol 12: 5.

Bonebrake TC, Ponisio LC, Boggs C, Ehrlich PR. 2010. More than just indicators: A review of tropical butterfly ecology and conservation.

Biol Conserv 143: 1831-1841.

Bush MB, Whittaker RJ. 1991. Kraktau: colonization patterns and hierarchies. J Biogeogr 18: 341-356.

Caldasa C, Robbins RK. 2003. Modified Pollard transects for assessing tropical butterfly abundance and diversity. Biol Conserv 110: 211219.

Callaghan CJ. 2009. The Riodinid butterflies of Vietnam (Lepidoptera). J Lepidop Soc 63 (2): 61-82.

Chinaru NL, Joseph IC. 2011. A comparative study of diversity of species of butterflies In protected and unprotected habitats of Okwu Ogbaku Forest reserve in Mbaitoli l.g.a., Imo State, Nigeria. JIADC 3 (1): 129-137.

CITES. 2015. Appendices. https: //www.cites.org/eng/disc/text.php.

Corbet AS. 1941. The distribution of butterflies in Malay Peninsula (Lepidoptera). Proc.R.Ent.Soc. London. A.16.101-116.

D’Abrera B. 1982. Butterfly of the Oriental Region. Part I. Papilionidae, Pieridae and Danaidae. Hill-House, Victoria.

D’Abrera, B. 1985. Butterfly of the Oriental Region. Part II. Nymphalidae ,Satyridae and Amathusidae. Hill-House, Melbourne.

D’Abrera, B. 1986. Butterfly of the Oriental Region. Part III. Lycaenidae and Riodinidae. Hill-House, Melbourne.

De Vries PJ, Alexander GL, Chacon IA, Fordyce JA. 2012. Similarity and difference among rainforest fruit-feeding butterfly communities in Central and South America. J Anim Ecol 81: 472-482.

Elliot JN. 1992. The Butterflies of the Malay Peninsula. 4th ed. Malayan Nature Society, Kuala Lumpur.

Fermon H, Waltert M, Larsen TB, Dall Asta U, Muhlenberg M. 2000.

Effects of forest management on diversity and abundance of fruit feeding Nymphalids butterflies in South Eastern Cote d Ivory. J Insect Conserv 4: 177-183.

Fermon H, Waltert M, Vane-Wright RI, Muhlenberg M. 2005. Forest use and vertical stratification in fruit-feeding butterflies of Sulawesi, Indonesia: impacts for conservation. Biodiv Conserv 14: 333-350.

204

B I O D I V E R S IT A S 16 (2): 196-204, October 2015

Government Regulation (Peraturan Pemerintah) Number 7 Year 1999 concerning the Preservation of Wild Plants and Animals [Indonesian] Hamer KC, Hill JK, Lace LA, Langan AM. 1997. Ecological and biogeographical effects of forest disturbance on tropical butterflies of Sumba, Indonesia. J Biogeogr 24: 67-75.

Harsh S, Jena J, Sharma T, Sarkar PK. 2015. Diversity of butterflies and their habitat association in four different habitat types in Kanha-pench corridor, Madhya Pradesh, India. IJAR 3 (1): 779-785.

Hill CJ, Kramer KC, Lace LA, Banham, WMT. 1995. Effects of selective logging on tropical forest butterflies on Buru, Indonesia. J Appl Ecol 32: 754-760.

Houlihan PR, Harrison, ME, Cheyne, SM. 2013. Impacts of forest gaps on butterfly diversity in a Bornean peat-swamp forest. J Asia Pac Entomol 16: 67-73.

Khoirun-Nisa AR, Mukti M, Hamzah MH, Mustakim A, Abidin Z. 2013.

Butterflies diversity ingreen open space of Malang City, East Java Province, Indonesia. JTLS 3 (2): 104-107.

Kumar A. 2012. A report on the butterflies in Jhansi (u.p.) India. J Appl Nat Sci 4 (1): 51-55.

Lawson CR, Bennie J, Hodgson JA, Thomas CD, Wilson RJ. 2014.

Topographic microclimates drive microhabitat associations. At the range margin of a butterfly. Ecography 37: 732-740.

Lee CN, Park JW, Kwon TS, Kim SS, Ryu JW, Jung SJ, Lee SK. 2015.

Diversity and density of butterfly communities in urban green areas: an analytical approach using GIS. Zoo Stud 54: 4.

Luk, CL, Kesumawati UH, Ziegler T, Waltert M. 2011.Vertical and horizontal habitats of fruit-feeding butterflies (Lepidoptera) on Siberut, Mentawai Islands, Indonesia. Ecotropica 17: 79-90.

Majumder J, Lodh R, Agarwala BK. 2013. Butterfly species richness and diversity in the Trishna wildlife sanctuary in South Asia. J Insect Sci 13: 79. DOI: 10.1673/031.013.7901.

Matsumoto K, Noerdjito WA, Fukuyama A. 2015. Restoration of butterflies in Acacia mangium plantations established on degraded grasslands in east kalimantan. J Trop For Sci 27 (1): 47-59.

McAleece N, Lambshead PJD, Paterson GLJ. 1997. Biodiversity Pro. The Natural History Museum, London.

Mihindukulasooriya MWDM, Ranawana KB, Majer JD. 2014.

Comparison of butterfly diversity in natural and regenerating Forest in a biodiversity conservation site at Maragamuwa, Sri Lanka. J Biol Environ Sci 5 (3): 387-391.

Murwitaningsih S, Dharma AP. 2014. Species diversity of butterflies at Suaka Elang (Raptory Santuary) at Gunung Halimun Salak National Park in West Java. Asian J Conserv Biol 3 (2): 159-163.

New TR, Bush MB, Sudarman HK. 1987. Butterflies from the Ujung Kulon National Park, Indonesia. J Lepidop Soc 41 (1): 29-40.

Peer G, van Maanen C, Turbe A, Matsinos Y, Kark S. 2011. Butterfly diversity at the ecotone between agricultural and semi-natural habitats across a climatic gradient. Divers Distrib 17: 1186-1197.

Posa MRC, Diesmos AC, Sodhi NS, Brooks TM. 2008. Hope for threatened tropical biodiversity: lessons from the Philippines.

Bioscience 58: 231-240.

Rabinowitz D. 1981. Seven forms of rarity. In: Synge H (ed) The Biological Aspects of Rare Plant Conservation. Wiley, New York.

Rahayuningsih M, Oqtariana R, Priyono B. 2012. Species diversity of butterflies superfamily Papilionoidae in Hamlet of Banyuwindu, Limbangan Village, Limbangan Sub-district, Kendal District. Jurnal Mipa 35 (1): 11-20. [Indonesian] Sarkar VK, Sukumar DD, Balakrishnan VC, Kunte, K. 2011. Validation of the reported occurrence of Tajuria maculata, the spotted royal butterfly (Lepidoptera: Lycaenidae), in the Western Ghats, Southwestern India, on the basis of two new records. JoTT 3 (3): 1629-1632.

Schulze CH, Linsenmair KE, Fiedler K. 2001. Understorey versus canopy-patterns of vertical stratification and diversity among Lepidoptera in a Bornean rainforest. Plant Ecol 153: 133-152 SFC [State Forest Corporation/Perhutani] 1999. Management Plan of forest Conservation. Forest class Agathis: Forest Plan Section II, Yogyakarta [Indonesian].

Sodhi NS, Rose M, Posa C, Lee TM, Bickford D, Koh LP, Brook, BW. 2010. The state and conservation of Southeast Asian biodiversity.

Biodiv Conserv 19: 317-328.

Soemarno S, Girmansyah D. 2012. Natural forest area conditions of Mount Slamet, Central Java. In: Maryanto I, Noerdjito M, Partomihardjo T. (eds). Ecology of Mount Slamet: Geology, Climatology, Biodiversity and Social Dynamics. LIPI Press, Jakarta.

[Indonesian] Subahar T, Anzilni F, Amasya D, Choesin N. 2007. Butterfly (Lepidoptera: Rhopalocera) distribution along an altitudinal gradient on mount Tangkuban Parahu, West Java, Indonesia. Raffles Bull Zool 55 (1): 175-178.

Suharto, Wagiyana, Zulkarnain R. 2005. A survey of the butterflies (Rhopalocera: Lepidoptera) in Ireng-Ireng Forest of Bromo Tengger Semeru National Park . Jurnal Ilmu Dasar 6 (1): 62-65. [Indonesian] Sundufu AB, Dumbuya R. 2008. Habitat preferences of butterflies in the Bumbuna Forest, Northern Sierra Leone. J Insect Sci 8 (64): 1-17.

Tabadepu H, Buchori D, Sahari B. 2008. Butterfly record from Salak Mountain, Indonesia. J Entomol Indon 5 (1): 10-16.

Ubaidillah R, Sofyan MR, Kojima H, Kamitani S, Yoneda M. 1998.

Survey on butterflies in Gunung Halimun National Park. Res Cons Div Indon 4: 155-161.

Vu VL, Bonebrake TC, Vu MQ, Nguyen NT. 2015. Butterfl y diversity and habitat variation in a disturbed forest in northern Vietnam. PanPac Entomol 91 (1): 29-38.

Vu VL. 2007. Ecological indicator role of butterfly in Tam Dao National Park, Vietnam. Russian Entomol J 16 (4): 479-486.

Whitten T, Soeriaatmadaja RE, Alief SA. 1997. The Ecology of Java and Bali. The Ecology of Indonesia Series. Vol. II. Oxford University Press.

Widhiono I. 2015. Diversity and abundance of Java endemics butterfly (Lepidoptera: Rhopalocera) at Mount Slamet, Central Java.

Biospecies 7 (2): 59-67. [Indonesian] Yukawa J. 1984. Geographical ecology of the butterfly fauna of the Krakatau Islands, Indonesia. Tyo to Ga 35: 47-74.

B I O D I V E R S IT A S Volume 16, Number 2, October 2015 Pages: 205-212

ISSN: 1412-033X E-ISSN: 2085-4722 DOI: 10.13057/biodiv/d160216

Recovery of plant diversity and soil nutrients during stand development in subtropical forests of Mizoram, Northeast India SH. B. SINGH1, B.P. MISHRA2, S.K. TRIPATHI1,ď&#x201A;Š

Department of Forestry, Mizoram University, Aizawl-796004, Mizoram, India. Tel. +91-389-2330394, Fax. +91-389-2330834, ď&#x201A;Šemail: sk_tripathi@rediffmail.com 2 Department of Environmental Science, Mizoram University, Aizawl-796004, Mizoram, India

1

Manuscript received: 4 January 2015. Revision accepted: 28 August 2015.

Abstract. Singh ShB, Mishra BP, Tripathi SK. 2015. Recovery of plant diversity and soil nutrients during stand development in subtropical forests of Mizoram, Northeast India. Biodiversitas 16: 205-212. The present study assessed the recovery of tree species diversity and soil nutrient dynamics with stand development in subtropical semi-evergreen forest of Mizoram. The study was carried out in two regenerating forest stands following disturbance and one undisturbed forest. Schima wallichii was the dominant species in all stands showing IVI of 63.8, 83.3 and 75.9 in undisturbed, moderately disturbed and highly disturbed stands, respectively. Castanopsis tribuloides was co-dominant species in the undisturbed and the moderately disturbed but this species was replaced by Sterculia villosa in the highly disturbed stand. The shift in position of species and families from undisturbed to highly disturbed stands could be linked with degree of disturbance. Log-normal dominance-distribution curves in the undisturbed and moderately disturbed stand indicating the stability of community, while short hooked curve in the highly disturbed stand indicates unstable nature of the community. The soil properties (organic C, total nitrogen, and available phosphorus) increased significantly during the course of stand development, whereas, decrease with the depth in these forest stands.

Keywords: Community, disturbance, plant diversity, tropical semi-evergreen forest

INTRODUCTION Biodiversity provides many essential goods and services to the mankind particularly in densely populated tropical ecosystems. Rapid decrease in tropical biodiversity is recorded in many forest ecosystems over the world as a result of human activities like habitat destruction, over exploitation, pollution and species introduction (Pimm et al. 1995; Pragasan and Parthsarthy 2010). These human activities have led to the conversion of natural forest areas into different stages of forest degradation that exhibited significantly different structural and functional characteristics at local and regional levels (Sapkota et al.

2010). Therefore, proper species diversity along with other characteristics need to recorded in different ecosystems to account multi-dimensional aspect of biodiversity that should take into account the variation in environmental factors, taxonomic variations among species, compositional diversity and functional diversity (Roy et al. 2004). The extents of deforestation in recent years in tropical regions draw attention to the urgent need for intervention to restore and protect biodiversity, ecological functioning and the supply of goods and services used by poor rural communities (Lamb et al. 2005; Cayuela et al. 2006).

The North-east India is known for its rich biodiversity with high level of endemism (Khan et al. 1997). Several studies have been carried out to quantify plant diversity and to understand the ecology of forest communities of

different areas (Mishra et al. 2004; Laloo et al. 2006; Mishra 2010; Tynsong and Tiwari 2010, 2011). The plant inventory and community characteristics of tropical semievergreen forest of Mizoram have been studied by some workers (Lalramnghinglova 2003; Singh et al. 2011, 2012).

In Mizoram, one of the states of North-east India, an extensive sandstone quarry has been carried out for the many developmental activities like construction of roads and buildings in the last few decades that converted large tract of forest area into degraded forest and created an unfavorable habitat conditions for plant growth and development. The unfavorable habitat conditions prevailing in the mined areas have reduced the chances of regeneration of many species, thereby reducing the number of species in mined areas.

Anthropogenic disturbance is one of the significant impacts arising out of mining and quarrying activities and is mainly in the form of alteration of land structure due to excavation, stacking of top soil and loss of fertile soil due to dumping of mined overburden on top soil. Sandstone mining causes damage to property, depletion of forest land, adverse effects on the aquatic biodiversity and public health. The present study aimed to determine the recovery of plant community characteristics and soil nutrients in secondary successional forests with stand development in relation to a reference forest in semi-evergreen tropical region of Mizoram, Northeast India.

206

B I O D I V E R S IT A S 16 (2): 205-212, October 2015

MATERIAL AND METHODS The study was conducted during 2009 to 2011 in the forest patches within and outside the Mizoram University campus situated in Tanhril area (23o45’25” N-23o43’37” N latitude and 92o38’39’’E-92o40’23”E longitude) of Aizawl District, Mizoram, India (Figure 1). For detailed investigation, a total of three study sites were selected along age gradient after disturbance in terms of sandstone quarry, representing undisturbed (UD), moderately disturbed (MD) and highly disturbed (HD) stands. The natural forest stand where no sandstone mining activity was done in the past referred to as undisturbed stand. The moderately disturbed forest stand is a secondary forest developed naturally after the abandonment of sandstone quarry (mining operation about 7 years back in 2002). The highly disturbed forest stand is an open mining area where sandstone mining is continued. Tree species (≥15 cm girth at breast height, GBH, i.e. 1.3 m above ground) were recorded using 70 quadrats of 10 x 10m size at each site.

The plant species were identified with the help of herbarium of the concerned University Department; herbarium of the Botanical Survey of India (BSI), Eastern circle, Shillong, and counter checked with the help of regional floras (Kanjilal et al. 1934-1940; Haridasan and Rao 1985). The field data on vegetation was quantitatively analyzed for phyto-sociological attributes namely, frequency, density and abundance as proposed by Curtis and Mclntosh (1950). The Importance value index (IVI) was determined as per Philips (1959). Species diversity and dominance indices were determined following the methods as outlined in Misra (1968); Mueller-Dombois and

Figure 1. Map of Mizoram, India showing the study area

Ellenberg (1974). The soil samples were collected with the help of soil corer for top-soil (0-10 cm depth) and subsoil (10-20 cm depth). The physico-chemical characteristics of soil have been analyzed by the methods outlined by Allen et al. (1976) and Anderson and Ingram (1993). Correlation was also developed between different vegetational and soil parameters across different sites.

RESULTS AND DISCUSSION Plant diversity and community characteristics Altogether, a total of 71 woody plant species belonging to 59 genera and 33 families of angiosperms were recorded from undisturbed, moderately disturbed and highly disturbed forest stands. Of this, 50 species representing 43 genera and 29 families, 49 species belonging to 41 genera and 22 families and 24 species belonging to 21 genera and 17 families were reported from the undisturbed, moderately disturbed and highly disturbed stand, respectively. It was found that Wendlandia tinctoria (Roxb.) DC., Schima wallichii (DC.) Korthals., Emblica officinalis Gaertn., Callicarpa arborea Roxb., Castanopsis tribuloides DC, and Sterculia villosa Roxb. ex Smith species were common in all three stands, and Acacia farnesiana, Debregeasia velutina, Murraya koenigii, Turpinia nepalensis and species Cassia laevigata, Melia azedarach, Pterospermum acerifolium and species Lepionurus oblongifolius, Ficus virens, Grewia macrophylla were restricted to undisturbed, moderately disturbed and highly disturbed stand, respectively. There was shift in dominance of plant species and families from undisturbed to highly disturbed

SINGH et al. – Plant diversity and soil nutrients during forests development

stand. S. wallichii was the dominant species (IVI 63.76) in the undisturbed stand. The co-dominant species were C. tribuloides (IVI 19.99) and C. arborea (IVI 19.44). In the moderately disturbed stand, S. wallichii was dominant species (IVI 83.31) and it was followed by co-dominant species namely, C. tribuloides (IVI 39.81) and C. arborea (IVI 17.54). In the highly disturbed stand, S. wallichii was recorded as a dominant species (IVI 75.87), and it was followed by co-dominant species namely, S. villosa (IVI 39.04) and C. arborea (IVI 24.89). S. wallichii, the dominant species in all three stands, contributed maximum tree density in the undisturbed stand (225 ind. ha-1 and basal area 5.04 m2ha-1), moderately disturbed stand (222 ind. ha-1 and basal area 3.28 m2ha-1) and highly disturbed stand (105 ind. ha-1 and basal area 1.59 m2ha-1) (Table 1).

The distribution pattern of species differed from undisturbed to the highly disturbed stand. There was preponderance of contagious distribution. Whereas, few species namely, C. arborea and E. officinalis showed random distribution.

Euphorbiaceae was the dominant family with maximum number of species in the undisturbed (5) and moderately disturbed (5) stands. However, it was replaced by Mimosaceae (3) in the highly disturbed stand. The codominant families were Fagaceae (4), Lauraceae (4), Mimosaceae (4) in the undisturbed stand; Caesalpinaceae (4), Fagaceae (4), Lauraceae (4) in the moderately disturbed stand; Anacardiaceae (2), Rubiaceae (2), Papilionaceae (2) in the highly disturbed stand (Table 2).

There was sharp decline in tree density from the undisturbed stand (970±3.2 ind. ha-1) to the moderately disturbed stand (742±3.4 ind. ha-1) and finally to the highly disturbed stand (410±3.2 ind. ha-1). A similar trend in results was also observed for total tree basal area which was highest in the undisturbed stand (20.8 m2 ha-1) followed by moderately disturbed stand (9.85 m2 ha-1) and highly disturbed stand (5.38 m2 ha-1). Shannon-Wiener diversity index was maximum (3.3) in the undisturbed stand and minimum in the highly disturbed stand (2.6). The species richness Index was highest in moderately disturbed stand followed by undisturbed stand and highly disturbed stands. The Evenness Index did not show much variation in results with respect to the degree of disturbance. The Sorenson’s Index of similarity for tree species was maximum (0.58) between undisturbed and moderately disturbed stands. On contrary, value was minimum (0.46) between moderately disturbed and highly disturbed stands (Table 3).

Findings on the girth class distribution of trees showed a decreasing trend in the number of individuals from lower to higher girth classes, irrespective of stands, except in case of the undisturbed stand where number of individuals was highest in girth classes 50-70 cm and 30-50 cm. The moderately disturbed stand showed maximum number of adult trees (girth classes 30-50 cm). However, mature trees (girth classes 50-70 cm) were maximum in the undisturbed stand. There was a sharp decline in the number of individuals in the higher girth classes with increase in degree of disturbance (Figure 2).

207

The log-normal dominance-diversity curve (based on IVI) was found in the undisturbed and moderately disturbed stands; however, it was short hooked in case of highly disturbed stand (Figure 3).

Soil characteristics The average soil moisture on different stands ranged from 23.66 to 28.84%. pH ranged from 4.45 to 6.18 which indicated that the soils on all stands were acidic. Compared to the moderately disturbed and highly disturbed stands, the undisturbed stand has the highest values of soil in organic carbon, total nitrogen, available phosphorus, exchangeable potassium as given in Table 4.

Correlation between vegetation and soil parameters The correlation between different vegetation parameters along disturbance gradient is given in Figure 4. The tree density was positively correlated with the tree basal area, tree diversity and tree richness (Figure 4 A, B, D), whereas, tree basal area was negatively correlated with concentration of dominance (Figure 4). Tree richness was positively correlated with diversity and negatively with concentration of dominance but the relationship was rather weak (Figure 4 E, F).

Figure 2. Distribution of tree species in different girth classes in the undisturbed (UD), moderately disturbed (MD) and highly disturbed (HD) forest stands

Figure 3. Dominance-diversity curves of tree species along disturbance gradient

B I O D I V E R S IT A S 16 (2): 205-212, October 2015

208

A

B

C

D

E

F

Figure 4. Correlation between various vegetational parameters along disturbance gradient

A

B

C

D

E

F

Figure 5. Correlation between various soil parameters for top-soil along disturbance gradient

The correlation between various soil parameters for topsoil and sub-soil along disturbance gradient is given in Figure 5 and 6. The soil moisture content showed a positive correlation with soil organic carbon and negative correlation with pH (Figure 5 A, B). However, soil organic carbon showed significant and positive correlation with total nitrogen and exchangeable potassium (Figure 5 C, E).

Available phosphorus showed positive and significant correlation with exchangeable potassium, and the total nitrogen showed positive correlation with available phosphorus (Figure 5 D, F). Correlation among different nutrients showed similar trends in top-and sub-soil with varying degree of coefficients (Figure 5, 6).

SINGH et al. â&#x20AC;&#x201C; Plant diversity and soil nutrients during forests development

209

A

B

C

D

E

F

Figure 6. Correlation between various soil parameters for sub-soil along disturbance gradient

Discussion The sandstone mining impacted vegetation composition, community organization to a great extent, and there was decrease in species richness, tree density and basal area from undisturbed to the highly disturbed stand. S. wallichii was the dominant tree species in all the stands. However, C. tribuloides, the co-dominant species of the undisturbed and moderately disturbed stands was replaced by S. villosa in the highly disturbed stand. Moreover, the species tolerant to stress showing better growth and survival under disturbed condition, such species express greater IVI in the disturbed stand. Similarly, Euphorbiaceae was the dominant family in both undisturbed and moderately disturbed stands, whereas, it was replaced by Mimosaceae that was the dominant family in the highly disturbed stand.

The shift in position of the species and families along the disturbance gradient could be linked with the levels of anthropogenic disturbance and similar trends was also reported by number of workers in the past (Kadavul and Parthasarathy 1999; Mishra et al. 2003, 2004, 2005; Mishra and Laloo 2006).

During present investigation, it has been found that majority of the species showed contagious distribution pattern and few were distributed randomly. Similar, distribution pattern has also been reported by other workers (Singh and Yadav 1974; Metha et al. 1997). The trend in tree population structure observed during present study is similar to those reported from the forest at Costa Rica (Nadakarni et al. 1995), Brazalian Amazon (Campbell et al.

1992), Eastern Ghats (Kadavul and Parthasarathy 1999) and sub-tropical humid forest of Meghalaya (Mishra et al.

2004). The log-normal dominance distribution curve in the

undisturbed and moderately disturbed stands indicates stable community. However, short hooked curve in the highly disturbed stand depicts un-stabile community. The past workers have also reported a similar trend in results (Khera et al. 2001; Tripathi et al. 2004; Mishra et al. 2004, 2005).

The soil properties greatly varied from undisturbed to highly disturbed stand. High pH value in highly disturbed stand could be due to low accumulation of decomposed organic matter and extraction of sand stone. The soil organic carbon, total nitrogen, available phosphorus and exchangeable potassium varied greatly along disturbance gradient and decreased from undisturbed to highly disturbed stand and higher values were reported from topsoil. This could be linked with presence of thick humus layer on forest floor of the undisturbed stand. Litter accumulation on forest floor is positively linked with litter decomposition and plays a significant role in maintenance of soil moisture content and other micro-environmental conditions (Arunachalam and Pandey 2003; Reddy 2010; Mishra 2010; Tripathi et al. 2012). Nayak and Srivastava (1995) have also reported a similar trend in results from the humid sub-tropical soils in north east India.

A positive correlation of species richness with diversity index was observed with few exceptions, and findings are in conformity with the report of Tripathi et al. (1989) that the species richness is positively correlated with Shannon diversity index in majority of cases in western Himalayan forests. Various diversity indices also followed similar trend (Jha et al. 2005; Yu-Hai et al. 2009). A positive correlation was observed between total basal area and organic carbon in top-soil and sub-soil. The findings are supported by Sharma et al. (2009).

B I O D I V E R S IT A S 16 (2): 205-212, October 2015

210

Table 1. Phyto-sociological attributes of tree species along disturbance gradient Species Acacia auriculiformis A. Cunn. ex Benth.

Acacia farnesiana (L.) Willd.

Albizia chinensis Osb. Merr.

Albizia lebbeck (L.) Benth.

Albizia procera (R.) Benth.

Antidesma diandrum B.Hey. ex (Roxb.)

Aporosa roxburghii Baill Artocarpus heterophyllus Lam Bauhinia purpurea L. Beilschmiedia assamica Meisn.

Bombax ceiba L. Bridelia cuneata Gehrm Bridelia stipularis Bl. Bursera serrata Wall.ex Colebr.

Callicarpa arborea Roxb.

Callicarpa macrophylla Vahl.

Cassia laevigata Willd Castanopsis hystrix A.DC. Castanopsis tribuloides A.DC. Clausena excavata Burn.f.

Colona floribunda (Wall.ex Kurz) Craib Combretum dasystachyum Kurz.

Crotalaria linifolia L. Debregeasia velutina Gaud.

Delonix regia (Boj)Rafin.

Derris robusta Roxb.exDC. Dipterocarpus turbinatus Gaertn.

Emblica officinalis Gaertn.

Engelhardia spicata Lechen ex Bl. Erythrina stricta Roxb.

Eucalyptus globulus Labill.

Eugenia macrocarpa Schltdl. & Cham.

Eugenia malaccensis L. Ficus elastica Roxb.ex Hornem Ficus virens Ait. Glochidion velutinum Wt. Grevillea robusta A.Cunn.ex R.Br. Grewia macrophylla G.Don Lagerstroemia parviflora Roxb.

Lepionurus oblongifolius (Griff.) Mast Litsea chinensis (Lour.) C.B.Rob. Litsea citrata Bl. Macaranga denticulata (Bl.) Mull. Arg. Machilus bombycina King ex Hook.f.

Mangifera indica Linn.

Melia azedarach Linn.

Meliosma pinnata Roxb.

Michelia champaca Linn.

Michelia panduana Hook.Thamn.

Micromelum integerrimum (B-Ht.ex Can.)Wt. Murraya koenigii (L.)Spreng.

Oroxylum indicum Benth.ex Kurz.

Phoebe cooperiana Pc. Kanj. & Das. Plumeria acutifolia Poir.

Psidium guajava Linn.

Pterospermum acerifolium Linn.

Quercus semiserrata Roxb.

Quercus spicata Sm. Rhus succedanea Linn.

Sarcochlamys pulcherrima Roxb.

Saurauia napaulensis D.C. Schefflera wallichiana (Wight & Arn.) Harms Schima wallichii (DC.) Korthals.

Sterculia villosa Roxb.ex Smith.

Syzygium cumini Linn.

Tapiria hirsuta Hook.f Taxus wallichiana Zucc.

Terminalia arjuna Roxb.W & A Toona ciliata M.Roem.

Turpinia nepalensis Wall.ex Wight & Arn. Wendlandia paniculata (Roxb.) DC. Wendlandia tinctoria (Roxb.) DC.

Undisturbed Density (Ind. ha-1) IVI 5 1.17 8 10 18 3 4 3 7 7 15 20 2 58 4

2.37 3.73 6.39 0.88 1.53 1.21 1.53 2.24 4.99 6.3 0.78 19.44 1.32

31 62

10.41 19.99

18 13 11

4.92 3.5 4.96

7 32 2 15 20

2.26 10.45 0.72 5.17

Moderately disturbed Density (Ind. ha-1) IVI 3 1.36 4 2.04 13 4.95 12 6.39 2 0.96

Highly distrubed Density (Ind. ha-1) IVI 15 6 12

10.19 4.78 9.38

4

3.48

6

2.56

42

17.54

32

24.89

5 8 102 5

1.73 3.2 39.81 2.95

24

18.05

7

6.23

6 1 20

4.44 1.77 13.78

4

2.96

5 1

4.83 1.77

5 5 8

3.22 4.19 5.09

7

5.04

21

14.67

105 58

75.87 39.04

9

6.7

4

2.45

1 2

0.86 0.93

30

11.87

1

0.75

5 6

2.18 2.83

15 2

6.14 0.75

2

0.91

14 8 2 4 4 5 5 3 5 5 17

5.83 3.63 1.06 1.57 2.29 2.07 2.09 1.36 1.95 1.78 7.11

8 2 5

4.09 1.42 3.08

10 2 22 2 12 2 222 24 2 2

3.84 0.86 8.11 1.29 5.07 1.5 83.31 10.15 0.61 0.86

12

6.02

12

10.33

28 36

10.02 12.49

26 17

17 12.3

6.05

6 5

2.45 1.53

2 2 8 6 15

0.54 1.17 2.42 1.75 4.73

18

5.04

11 15 9 14

3.8 3.35 2.33 4.98

4 9 14 32 21

1.48 3.38 4.63 8.72 7.44

18 225 57

5.76 63.76 17.07

17 12 3 15 7 26 33

6.18 3.35 1.27 5.24 1.83 7.34 9.53

SINGH et al. – Plant diversity and soil nutrients during forests development

211

Table 2. Ranking of families of angiosperm in the undisturbed, moderately disturbed and highly disturbed forest stands Family rank 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29

Undisturbed Family No. of species Euphorbiaceae 5 Fagaceae 4 Lauraceae 4 Mimosaceae 3 Caesalpiniaceae 2 Combretaceae 2 Moraceae 2 Myrtaceae 2 Verbenaceae 2 Anacardiaceae 2 Papilionaceae 2 Bombacaceae 2 Rubiaceae 2 Rutaceae 2 Tiliaceae 1 Urticaceae 1 Olacaceae 1 Lythraceae 1 Juglandaceae 1 Meliaceae 1 Sapindaceae 1 Dipterocarpaceae 1 Sterculiaceae 1 Taxaceae 1 Theaceae 1 Burseraceae 1 Araliaceae 1 Bignoniaceae 1 Sabiaceae 1

Forest stands Moderately disturbed Family No. of species Euphorbiaceae 5 Fagaceae 4 Mimosaceae 4 Lauraceae 4 Myrtaceae 4 Caesalpiniaceae 4 Anacardiaceae 3 Rubiaceae 3 Rutaceae 2 Meliaceae 2 Sterculiaceae 2 Papilionaceae 2 Theaceae 1 Lythraceae 1 Magnoliaceae 1 Verbenaceae 1 Apocynaceae 1 Araliaceae 1 Sabiaceae 1 Proteaceae 1 Saurauiaceae 1 Moraceae 1

Highly disturbed Family No. of species Mimosaceae 3 Anacardiaceae 2 Fagaceae 2 Papilionaceae 2 Rubiaceae 2 Tiliaceae 2 Verbenaceae 1 Dipterocarpaceae 1 Euphorbiaceae 1 Sterculiaceae 1 Caesalpiniaceae 1 Bombacaceae 1 Lythraceae 1 Theaceae 1 Meliaceae 1 Olacaceae 1 Moraceae 1

Table 3. Tree community structure in the undisturbed, moderately disturbed and highly disturbed forest stands Parameter No. of family No. of genera No. of species Tree density (Indv.ha-1) Tree basal area (m2h-1) Shannon-Wiener index Simpson dominance index Simpson index of diversity Simpson reciprocal index Species richness (Margalef's index) Evenness index (Pielou)

Forest stands Moderately disturbed 22 41 49 742±3.4 9.85 2.9 0.12 0.8 8.2 7.7 0.74

Undisturbed 29 43 50 970±3.2 20.83 3.3 0.07 0.9 13.3 7.5 0.84

Highly disturbed 17 21 24 410±3.2 5.38 2.6 0.1 0.8 9.1 4 0.81

Table 4. Physico-chemical characteristics of soil along the disturbance gradient Stands Undisturbed

Moderately disturbed

Highly disturbed

Depth ( cm) 0-10 Mean SE ± 10-20 Mean SE ± 0-10 Mean SE ± 10-20 Mean SE ± 0-10 Mean SE ± 10-20 Mean SE ±

Moisture content (%) 30.45 2.47 27.23 2.65 27.28 1.56 24.15 1.57 25.79 2 21.53 2.28

pH (H20) 4.57 0.08 4.34 0.09 5.5 0.04 5.1 0.04 6.35 0.04 6.01 0.05

Org-C (%) 2.5 0.14 1.89 0.15 1.8 0.16 1.55 0.12 1 0.14 0.76 0.06

TN (%) 0.26 0.02 0.2 0.02 0.2 0.02 0.16 0.01 0.29 0.17 0.48 0.23

Avail P µg g-1 26.08 1.36 17.41 1.88 14.41 1.16 12.16 1.15 10.25 1.43 6.75 0.49

K µg g-1 210 12.85 171.58 7.44 163.33 10.56 133.25 11.24 88.33 9.93 75.83 9.39

212

B I O D I V E R S IT A S 16 (2): 205-212, October 2015

Present investigation showed that there is a considerable reduction in the number of species from natural forest to disturbed sites due to unfavorable habitat conditions for plants created by disturbance. The disturbance adversely affected the juvenile stage, leading to arrested survival and growth of seedlings and saplings. The findings of the present study would be an important tool for formulation of appropriate strategies for management of abandoned mined areas through re-vegetation with suitable dominant and co-dominant species of the present study for effective management strategy. Such site-specific selection of species will add a new dimension for rehabilitating of abandoned land and conservation of biodiversity.

ACKNOWLEDGEMENTS Authors are grateful to the University Grants Commission, New Delhi, India for financial assistant and to the various communities for extending facilities to complete this piece of work desirably.

REFERENCES Allen SE, Grimshaw HM, Rowland AP. 1976. Chemical analysis. In: Moore PD, Chapman SB (eds). Methods in Plant Ecology. Blackwell, Oxford.

Anderson JM, Ingram JSI. 1993. Tropical Soil Biology and Fertility. A Handbook of Methods. 2nd ed. CAB International, Wallingford, U.K. Arunachalam A, Pandey HN. 2003. Ecosystem restoration of jhum fallows in northeast India: microbial C & N along altitudinal and successional gradient. Restor Ecol 11: 168-173.

Campbell DG, Stone JL, Rosas A Jr 1992. A comparison of the phytosociology and dynamics of three floodplain (Varzea) forest of known ages, Rio Jurua, Western Brazilian Amazon. Bot J Linn Soc 108: 213-237.

Cayuela L, Golicher DJ, Benayas, JMR, Gonzalez-Espinosa MG, RamirezMarcial N. 2006. Fragmentation, disturbance and tree diversity conservation in tropical montane forests. J Appl Ecol 43: 1172-1181.

Curtis JT, McIntosh RP. 1950. The interrelations of certain analytic and Synthetic phytosociological characters. Ecology 31: 434-455.

Haridasan K, Rao PR. 1985-1987. Forest Flora of Meghalaya. Vol. 1 and 2. Bishen Singh Mahendra Pal Singh, Dehra Dun. Jha CS, Goparaju L, Tripathi A, Gharai B, Raghubanshi AS, Singh JS. 2005. Forest fragmentation and its impact on species diversity: an analysis using remote sensing and GIS. Biodiv Conserv 14: 1681-1698.

Kadavul K, Parthasarathy N. 1999. Structure and composition of woody species in tropical semi evergreen forest of Kalrayan hills, Eastern Ghats, India. Trop Ecol 40 (2): 247-260.

Kanjilal UN, Kanjilal PC, Das A, De RN, Bor NL. 1934-1940. Flora of Assam. 5 vols. Government Press, Shillong.

Khan ML, Menon S, Bawa KS. 1997. Effectiveness of the protected area network in biodiversity conservation: a case study of Meghalaya, India. For Ecol Manag 14: 293-304.

Khera N, Kumar A, Ram J, Tewari A. 2001. Plant biodiversity assessment in relation to disturbance in mid-elevational forest of central Himalaya, India. Trop Ecol 42 (1): 83-95.

Laloo RC, Kharlukhi L, Jeeva S, Mishra BP. 2006. Status of medicinal plants in the disturbed and the undisturbed scared forest of Meghalaya North-east India: Population structure and regeneration efficacy of some important species. Curr Sci 90 (2): 225-231.

Lalramnghinglova H. 2003. Enthnomedicinal Plants of Mizoram. Bishen Singh Mahendra Pal Singh, Dehradun.

Lamb D, Erskine PD, Parrotta JA. 2005. Restoration of degraded tropical forest landscapes. Science 310: 1628-1932.

Metha JP, Tewari SC, Bhandari BS. 1997. Phytosociology of woody vegetation under different management regimes in Garhwal Himalaya. J Trop For Sci 10: 24-34.

Mishra BP. 2010. A study on the micro-environment, litter accumulation

on forest floor and available nutrients in the soils of broad-leaved, mixed pine and pine forests at two district altitude in Meghalaya, northeast India. Curr Sci 90 (12): 1829-1833.

Mishra BP, Laloo RC. 2006. A comparative analysis of vegetation and soil characteristics of montane broad-leaved, mixed pine and pine forests of northeast India. In: Trivedi PC (ed) Advances in Plant Physiology. I.K. International Publishing House, New Delhi.

Mishra BP, Tripathi OP, Laloo RC. 2005. Community characteristics of a climax subtropical humid forest of Meghalaya and population structure of ten important tree species. Trop Ecol 46: 241-251.

Mishra BP, Tripathi OP, Tripathi RS, Pandey HN. 2004. Effects of anthropogenic disturbance on plant diversity and community structure of a sacred grove in Meghalaya, North-east India. Biodiv Conserv 13: 421-436.

Mishra BP, Tripathi RS, Tripathi OP, Pandey HN. 2003. Effects of disturbance on the regeneration of four dominant and economically important woody species in a broad-leaved subtropical humid forest of Meghalaya, Northeast India. Curr Sci 84 (11): 1449-1453.

Misra R. 1968. Ecology Workbook. IBH Publishing Co., Calcutta.

Mueller-Dombois D, Ellenberg H. 1974. Aims and Methods in Vegetation Ecology. John Wiley & Sons, New York.

Nadakarni NM, Matelson TJ, Haber WA 1995. Structure characteristics and floristic composition of neotropical cloud forest, Montenerde, Costa Rica. J Trop Ecol 11: 482-495.

Nayak DC, Srivastava R. 1995. Soil of shifting cultivated areas in Arunachal Pradesh and their suitability for land use planning. J Indian Soc Soil Sci 43: 246-251.

Odum EP. 1971. Fundamentals of Ecology. W.B. Saunders, Philadelphia.

Phillips EA. 1959. Methods of Vegetation Study. Henery Holt and Co., Inc. Pimm SL, Russell GJ, Gittleman JL, Brooks TM. 1995. The Future of Biodiversity. Science 269: 347-350.

Pragasan A, Parthasarathy N. 2010. Landscape-level tree diversity assessment in tropical forests of southern Eastern Ghats, India. Flora 205: 728-737.

Reddy MBK. 2010. Vegetation types and their influence on some secondary nutrients and micro nutrients in soils of Meghalaya forests.

Indian Forester 1445-1459.

Roy A, Tripathi SK, Basu SK. 2004. Formulating diversity vector for ecosystem comparison. Ecol Mod 179: 499-513.

Sapkota IP, Tigabu M, Oden PC. 2010. Changes in tree species diversity and dominance across a disturbance gradient in Nepalese Sal (Shorea robusta Gaertn.f.) forests. J For Res 21: 25-32.

Sharma CM, Ghildyiyal SK, Gairola S, Suyal S. 2009. Vegetation structure, composition and diversity in relation to soil characteristics of temperate mixed broad-leaved forest along an altitudinal gradient in Garhwal Himalaya. Indian J Sci Technol 2 (7): 39-45.

Singh BS, Mishra BP, Tripathi SK. 2011. Changes in phytosociological attribute and plant species diversity in secondary successional forests following stone mining in Aizawl Districts of Mizoram India. NeBio 2: 20-25.

Singh BS, Mishra BP, Tripathi SK. 2012. Status of ethnomedicinally important plants sampled from different forest patches of Mizoram University campus. NeBio 3: 15-19.

Singh JS, Yadav PS. 1974. Seasonal variation in composition plant biomass and net primary productivity of tropical grassland at Kurukshetra. India. Ecol Monographs 44: 351-376.

Tripathi OP, Pandey HN, Tripathi RS. 2004. Distribution, community characteristics and tree population structure of subtropical pine forest of Meghalaya, Northeast India. Intl J Ecol Environ Sci 29: 207-214.

Tripathi SK, Kushwaha CP, Basu SK. 2012. Application of fractal theory in assessing soil aggregates in Indian tropical ecosystems. J For Res 23 (3): 355-364.

Tripathi SK, Singh RS, Upadhyay VP, Singh RP. 1989. Population structure of Pinus roxburghii and Quercus leucotrichophora forests of Almora Hills of Kumaun Himalaya. J Tree Sci 8: 78-80.

Tynsong H, Tiwari BK. 2010. Plant diversity in the homegardens and their significance in the livelihoods of war khasi community of Meghalaya, Northeast India. J Biodiv 1 (1): 1-11.

Tynsong H, Tiwari BK. 2011. Diversity and population characteristics of woody species in natural forests and arecanut agroforestry of south Meghalaya, Northeast India. Trop Ecol 52 (3): 243-252.

Yu-Hai Y, Ya NC, We-Hong L. 2009. Relationship between soil properties and plant diversity in a desert Riparian Forest in the lower reaches of the Tarim river, Xinjiang, China. Arid Land Res Manag 23: 283-296.

BIODIVERSITAS Volume 16, Number 2, October 2015 Pages: 213-224

ISSN: 1412-033X E-ISSN: 2085-4722 DOI: 10.13057/biodiv/d160217

Conservation status of the Family Orchidaceae in Mt. Sinaka, Arakan, North Cotabato, Philippines 1

CHERRY LEE T. PANAL1,♥, JENNIFER G. OPISO2,♥♥, GUILLER OPISO3,♥♥♥ Agusan del Sur State College of Agriculture and Technology, San Teodoro, Bunawan-8506, Agusan del Sur, Philippines Tel.: +63-099177183449, ♥ email: lengkay22@gmail.com 2 Biology Department, Central Mindanao University, Musuan, Maramag, Bukidnon-8710, Philippines. ♥email: mcgalvz@gmail.com 3 Philippine Eagle Foundation, Davao City, Philippines. ♥email: guilleropiso@gmail.com Manuscript received: 28 February 2015. Revision accepted: 16 September 2015.

Abstract. Panal CLT, Opiso JG, Opiso G. 2015. Conservation status of the Family Orchidaceae in Mt. Sinaka, Arakan, North Cotabato, Philippines. Biodiversitas 16: 213-224. This study determines the conservation status of the family Orchidaceae, as present on Mt. Sinaka, Arakan, North Cotabato, Philippines. A thorough survey and alpha taxonomy was done, from base to peak of the mountain. Identification of the specimens and assessment of their conservation status was based on the IUCN Red List of Threatened Plants 2013.2 and National List of Threatened Philippine Plants of Fernando et al. (2008). Based on the result conducted on October 2013-March 2014, out of 59 identified species found in the area, 12 species are widespread, 22 are endemic, 1 vulnerable, 1 critically endangered (Paphiopedilum adductum), 1 endangered (Corybas sp.), 2 least concerned species, and 20 unassessed species (not yet assessed by the IUCN). It has been also noted that there are probably some new species, which need thorough study for further identification. The result calls for a desperate need for conservation. Facts from this study helps in addition to the existing wildlife conservation of flora in Mt. Sinaka and to the other forested mountains in Mindanao, the Philippines.

Keywords: Alpha taxonomy, threatened, endangered, endemic

INTRODUCTION The orchid family (Orchidaceae) contains an estimated 25,000 species (Gravendeel et al. 2004). Orchids exist as epiphytes, terrestrials, lithophytes, and aquatics making conservation a concern when trying to protect this family.

This is the largest group of flowering plants (Huynh et al.

2009). More than 1,100 species of orchids are found in the Philippines, 80% of which are endemic (Cootes 2001).

According to the National List of Threatened Philippine Plants of Fernando et al. (2008), the family Orchidaceae has 19 species categorized as critically endangered, 35 endangered species, and 3 vulnerable species.

Mt. Sinaka has an elevation of 1,448 meters above sea level and approximately 3,000 hectares of land area located at Arakan, North Cotabato, Philippines. This mountain is part of the Mt. Apo mountain range. Located east of barangays Marilog of Davao City, San Miguel and west of barangays Tumanding, Salasang, Lanao Koran, and Datu Ladayon of Arakan, North Cotabato (Estremera 2011).

This mountain has been threatened by unscrupulous human activities. The secondary forest of this mountain has been destroyed by the entry of palm oil and banana plantations.

Both flora and fauna in the area has been destroyed.

Because of the charismatic blooms of orchids they become one of the economic sources of the natives living near the mountains. This group of species becomes more prone to extinction because of their economic importance (ornamental, medicinal, flavoring and perfume). Ecologically, these species are bio-indicator and it has being forgotten that they also provide habitat for microscopic

organisms. Many more species await scientific description, but with the rapid destruction of the remaining forests, many species will never be known to the scientific community, or orchid enthusiasts. Thus, there is a need to assess their conservation status for protection and conservation of these species. This will enhance the existing conservation management of the area.

MATERIALS AND METHODS The sampling site is located on Mt. Sinaka, Arakan Valley, North Cotabato, Philippines (Figure 1). This study was done from October 2013 to March 2014. The species were just photographed for conservation purposes, and the characteristics (petals, sepals, rachis, pseudobulbs if present) were measured and described. Only species that were not identified were collected for further identification.

Species located above 5 meters high on tree trunks were excluded. A standard alpha taxonomy (5m both sides) was done from the base to the peak of the mountain.

Preliminary identification of the species was based on the book Philippine Native Orchid Species by Cootes (2011a) and other published scientific articles and journals.

Identification of orchids was further verified by Jim Cootes during his visit to the Central Mindanao University on February 21-22, 2014. The assessment of the collected species was based on Fernando et al. (2008), IUCN (2014), AO-DENR (2007), and from published floristic works and books like that of Cootes (2011a, b).

214

B I O D I V E R S I T A S 16 (2): 213-224, October 2015

Figure 1. Study site in Mt. Sinaka, Arakan Valley, North Cotabato, Philippines

RESULTS AND DISCUSSION Diversity The Table 1 reveals that locally, 15 species were found to be abundant, 14 species are common, 30 species found to be rare. This means that there is a high rate of rarity among the orchid species in the area. This might be because of human intervention. As observed, some natives living near the mountain have been selling orchids as one of their economic sources. It has been also observed that the species in the wild, which captures their attention, has been brought to their gardens and been grown.

Mt. Sinaka harbored endemic, vulnerable, widespread and endangered species of Orchidaceae. There are more endemic species found in this study when compared to the study done by Buenavista (2014) in the five LTER sites in Mindanao (Mt. Kitanglad, Mt. Musuan, Mt. Malindang, Mt. Apo, Mt. Kiamo). But the result of both studies reflects that the family Orchidaceae is not well studied, though it harbors a great percentage of the flowering plants. It has also been noted that some of the species found in the area have not yet been described, nor cited in the list of Fernando et al. (2008) and IUCN (2014) which suggests

that there is a need for further identification of these species.

Table 1. Number of endemic, widespread, and critically endangered species found in Mt. Sinaka, Arakan, North Cotaboto.

Status

No. of species

I. Local status A. Abundant 15 B. Common 14 C. Rare 30 II. Conservation status A. Endemic 22 B. Endangered 1 C. Critically endangered 1 D. Widespread 12 E. Vulnerable 1 F. Least Concerned 2 III. Unassessed 20 Note: Assessment of local conservation status was done by counting the number of individuals, per species, both in the sampling plots and in the transect walk. It was categorized using the following criteria: (i) 1-3 individual/s-rare, (ii) 4-9 individuals-common, (iii) 10 or >10 individuals-abundant.

PANAL et al. â&#x20AC;&#x201C; Orchids of Mt. Sinaka, Philippines Table 2. Conservation Status of each Species found in Mt. Sinaka, Arakan, North Cotabato, Philippines.

Genus/species

Conservation status

Agrostophyllum inocephallum Agrostophyllum saccatilabium Anoectochilus sp.

Vulnerable Appendicula alba Widespread Appendicula malindangensis Endemic Appendicula micrantha Endemic Appendicula torta Bulbophyllum acutum Bulbophyllum alsiosum Endemic Bulbophyllum alagense Endemic Bulbophyllum dearei Bulbophyllum flavescens Bulbophyllum unguiculatum Calanthe macgregorii Endemic Calanthe pulchra Ceratostylis retisquama Endemic Ceratostylis subulata Widespread Chrysoglossum ornatum Widespread Coelogyne chloroptera Endemic Corybas sp.

Endangered Crepidium ramosii Cryptostylis sp.

Dendrobium auriculatum Endemic Dendrobium diffusum Dendrobium milaniae Endemic Dendrobium stricticalcarum Endemic Dendrochilum arachnites Endemic Dendrochilum glumaceum Dendrochilum mindanaense Endemic Dendrochilum serratoi Dendrochilum wenzelii Widespread Epipogium roseum Widespread Euphlebium josephinae Endemic Flickingeria sp.

Goodyera sp.

Habenaria sp.

Liparis condylobulbon Widespread Liparis dumaguetensis Endemic Liparis terrestris Oberonia sp.

Octarrhena amesiana Endemic Oxystophyllum cultratum Widespread Paphiopedilum adductum Critically endangered Peristylus spiralis Phaius tankervilleae Widespread Widespread Phalaenopsis amabilis Phreatia sp.

Least concerned Pinalia cylindrostachya Endemic Plocoglottis bicallosa Endemic Podochilus plumosus Endemic Robiquetia compressa Endemic Schoenorchis paniculata Widespread Spathoglottis plicata Widespread Spathoglottis tomentosa Endemic Stichorkis amesiana Endemic Taeniophyllum gracillimum Least concerned Thelasis micrantha Widespread Thrixspermum linearifolium Endemic Note: (-) not yet assessed by IUCN (2014).

215

Description Anoectochilus sp. Blume Growth habit: upright, sympodial, terrestrial. Rhizomes are succulent. Leaves are petiolate, relatively broad, brownish purple with coppery veins (Figure 2.A).

Distribution: It was found in the montane and mossy forest of Mt. Sinaka at an elevation of 1200-1400 meters asl. It has been recorded in Leyte based on Wenzel 286; also in Malaysia and Indonesia (Cullen 1992).

Appendicula malindangensis (Ames) Schlechter Growth habit: upright to semi-pendulous, sympodial (Figure 2.B).

Inflorescence: pendulous, up to 3 cm long, bearing numerous 7 mm flowers. Flower is blue to purplish; dorsal sepal is lanceolate, hooded, about 4.5 mm long by 2mm wide; petals are oblong, about 4.5 mm long by 1.5 mm wide; lateral sepals are triangular to lanceolate, about 4.5 mm long by 4 mm wide, forming a short spur; labellum is oblong, without side lobes, about 5 mm long by 2 mm wide (Figure 2.C,D).

Distribution: It was found in the mossy forest of Mt. Sinaka at an elevation of 1400-1500 meters asl. It has been recorded from Bukidnon, Misamis, Negros and is endemic to the Philippines (Cootes 2011a).

Appendicula micrantha Lindley Growth habit: semi-pendulous, sympodial, epiphyte (Figure 2.E).

Inflorescence: short, bearing up to 6 blooms, 4 mm in diameter. The flower is creamy white in color; dorsal sepal and petals are similar, triangular about 2 mm long by 1.5 mm wide; lateral sepals are elliptic-ovate, 2 mm long by 1.5 mm wide; labellum is oblong, about 3 mm long by 2 mm wide.

Distribution: It was found on Mt. Sinaka at an elevation of 1100-1400 meters asl. It has been recorded from Agusan, Bukidnon, Davao, Surigao, and Zamboanga, Leyte, Negros, and Panay, in the Visayas and Albay, Bataan, Laguna, Mindoro, Pampangga, Polillo, Quezon, Rizal and is endemic to the Philippines (Cootes 2011a).

Bulbophyllum alagense Ames Growth habit: sympodial, epiphyte (Figure 2.F) .

Inflorescence: arising from the rhizome; flower is light yellow to pale orange; dorsal sepal is triangular to lanceolate, up to 8 mm long by 2 mm wide; petals are small, triangular, up to 3 mm long by 1.5 mm wide; lateral sepals: triangular to lanceolate, up to 8 mm long by 2 mm wide; labellum is curved and three-lobed, 2.5 mm long by 1.5 mm wide (Figure 2.G, H).

Distribution: It was found in the montane forest of Mt. Sinaka at an elevation of 1200-1300 meters asl. It was also recorded throughout Mindanao, Leyte, Mindoro, Benguet, Camarines Sur, Laguna, and Rizal on Luzon (Cootes 2011a; Pelser 2012).

216

B I O D I V E R S I T A S 16 (2): 213-224, October 2015

Bulbophyllum alsiosum Ames Growth habit: upright, sympodial, epiphytic (Figure 2.I).

Inflorescence: single flowered, appearing from the rhizome; the color of the outer surface of the dorsal and lateral sepals is cream to greenish; inner surface is marked with pink to purple, petals are pink, spotted with purple; labellum is pink; dorsal sepal is lanceolate, obtuse at the apex, keeled, to 2.3 cm long by 1.3 cm wide; petals are broadly ovate, to 1.4 cm long by 1 cm wide; lateral sepals are oblong to lanceolate keeled, to 2 cm long by 1.1 cm wide; labellum is thick and fleshy, tongue-shaped, to 9 mm long by 6 mm wide (Figure 2.J).

Distribution: It was found in the mossy forest of Mt. Sinaka at an elevation of 1300-1400 meters asl. It has been found in Leyte, Negros and Rizal and is endemic to the Philippines (Cootes 2011a).

Calanthe mcgregorii Ames Growth habit: upright, sympodial, terrestrial.

Inflorescence: upright, up to 1 m in length, flowers opening successively; each bloom is backed by a green recurving bract about 1 cm long; flower is white and a yellow spot on the labellum at the junction of the mid lobe; dorsal sepal is reflexing, elliptic to lanceolate, 7 mm long by 3 mm wide; petals are not reflexing; linear to oblong, 6.5 mm long by 2 mm wide; lateral sepals are reflexing; 7 mm long by 3 mm wide; labellum is three lobed; mid-lobe divided into four spreading lobes; side lobes are wedgeshaped being widest at the apex; spur is straight; without hairs (Figure 2.K, L, M).

Distribution: It was found in the Dipterocarp forest of Mt. Sinaka at an elevation of 1100-1200 meters asl. It has been found in Lanao, Leyte, Mindoro, Polillo, Quezon and Rizal and is endemic to the Philippines (Cootes 2011a).

Ceratostylis retisquama Reichenbach f.

Growth habit: upright to semi-pendulous, sympodial, epiphyte (Figure 2.N).

Inflorescence: bear blooms that appear from the base of the plant and are up to 4 cm in diameter; flower is bright reddish orange; labellum white; dorsal sepal is lanceolate, up to 2 cm long by 6 mm wide; petals are oblanceolate, pointed, up to 2 cm long by 5 mm wide; lateral sepals are oblong-lanceolate, pointed, up to 2 cm long by 5 mm wide; labellum is tiny, pointed, 3 mm long by 1.5 mm wide (Figure 2.O).

Distribution: It was found in dipterocarp and montane forests in Mt. Sinaka at an elevation of 1200-1300 meters asl. It has been found in Agusan, Lanao, Bataan, Camarines, Ilocos Norte, Quezon, Rizal, Zambales and is endemic to the Philippines (Cootes 2011a).

Coelogyne chloroptera Reichenbach f.

Growth habit: upright, sympodial, epiphyte (Figure 2.Q).

Inflorescence: upright, appear with the new growth and can reach 25 cm in length. Each inflorescence can carry up to 12 flowers. Blooms are up to 4 cm in diameter; flower is apple-green, labellum is white and brown; dorsal sepal is

lanceolate, hooded over the column, up to 2 cm long by 7 mm wide; petals are linear, up to 2 cm long by 2 mm wide.

They reflex towards the pedicel; lateral sepals are lanceolate, up to 2 cm long by 7 mm wide; labellum: threelobed, about 1.9 cm long by 1.2 cm wide (when flattened), lateral lobes rounded, mid-lobe semi-circular, three ridges run lengthways along the labellum (Figure 2.R, S).

Distribution: It was found in the montane forest of Mt. Sinaka at an elevation of 1200-1300 meters asl. It has been found in Mindoro, Negros, Bataan, Benguet, Cagayan, Kalinga-Apayao, the Mountain Province, Nueva Ecija, Nueva Vizcaya, Pampanga, Pangasinan, Quezon and is endemic to the Philippines (Cootes 2011a).

Corybas sp. Salisb, Parad, Lond.

Growth habit: sympodial epiphyte. Leaf solitary, circular to cordate, some are lobed (Figure 2.P).

Distribution: It was found in the mossy forest of Mt. Sinaka at an elevation of 1200-1300 meters asl. It has also been recorded from India, South China, Taiwan, Peninsular Malaysia, Borneo, New Caledonia, Vanuatu, Ponape, Indonesia, New Guinea, Solomon Islands, Australia, New Zealand, Tahiti, and Samoa (Pridgeon et al. 2001).

Dendrobium auriculatum Ames & Quisumbing.

Growth habit: upright, sympodial, epiphyte (Figure 2.T).

Inflorescence: single flowered, blooms very showy, about 3.5 cm in diameter; flower is milky white with a short green spur when fresh; dorsal sepal is ovate, up to 2.2 cm long by 1.1 cm wide; petals are oblong, up to 2 cm long by 8 mm wide; lateral sepals are oblong-lanceolate and are joined at their base to form a spur about 1 cm long, overall length 3.3 cm by 1.1 cm wide; labellum is simple, 3.4 cm long by 1.7 cm wide (at the widest point when flattened), lower third circular, the front portion is broadly heartshaped when flattened (Figure 2.U,V).

Distribution: It was found on Mt. Sinaka at an elevation of 1200-1300 meters asl. It has been found in Davao, Mindoro, Bulacan, Mountain Province, Nueva Ecija, Nueva Vizcaya, Quezon and is recorded as endemic to the Philippines.

Dendrobium milaniae Fessel & Luckel Growth habit: semi-pendulous; sympodial, epiphyte (Figure 2.W).

Inflorescence: pendulous, bearing up to 4 blooms that are about 1.5 cm in diameter with a short spur; flower is white; labellum has yellow in the center surrounded by purple markings; dorsal sepal: linear, acute, 1 cm long by 5 mm wide; petals are linear, tip rounded, 1.1 cm long by 3.5 mm wide; lateral sepals are triangular, 9 mm long, labellum is about 1.2 cm long with a wavy margin, the middle of the labellum has three ridges, which are short, central part of the labellum is round (Figure 2.X, Y).

Distribution: It was found in montane forest of Mt. Sinaka at an elevation of 1260 meters asl. It is recorded from Leyte and is endemic to the Philippines (Cootes 2011a).

PANAL et al. â&#x20AC;&#x201C; Orchids of Mt. Sinaka, Philippines

Dendrobium stricticalcarum W. Suarez & Cootes Growth habit: slightly pendulous to upright, sympodial, epiphyte (Figure 2.Z).

Inflorescence: appear from the leafless pseudobulbs; usually near the apex; to 1.4 cm long, bearing between 3 and 12 flowers. Flowers are about 5 mm across the lateral sepals by 2.3cm long from the tip of the mentum to tip of the dorsal sepal. The flowers of this species do not open widely; flower is pink, anther cap is purplish, odorless.

Pollinia are brown in color; dorsal sepal is ovatelanceolate, acuminate, reflexing slightly, 7 mm long by 3.2 mm wide; petals is narrowly lanceolate to linear, acuminate 7 mm long by 1.5 mm wide; lateral sepals are triangular, together with the mentum 2.5 cm long by 3.5 mm wide; labellum is ovate-elliptic; 1 cm long by 3 mm wide (when flattened); edges rolling around the column (Figure 2.AA).

Distribution: It was found in montane forest of Mt. Sinaka at an elevation of 1200-1300 meters asl. It was also found in Leyte, Mindoro, Laguna and recorded as endemic in the Philippines (Cootes 2011a).

Dendrochilum arachnites Reichenbach f.

Growth habit: upright, sympodial, epiphyte. This species is a bit of a rambler having a distance of about 5 cm between its pseudobulbs (Figure 2.AB).

Inflorescence: arching, appearing with the new growths.

The flowers are about 2 cm across the lateral sepals, which is their widest point. Each inflorescence can carry up to 30 blooms; flower is yellow; dorsal and lateral sepals are linear-lanceolate extending into acute tips, up to 1 cm long by 2 mm wide; petals are lanceolate up to 7 mm long by 3 mm wide; labellum is oblong, 4 mm long by 1.5 mm wide, three ridges run its length (Figure 2.AC, AD).

Distribution: It was found in both montane and mossy forest of Mt. Sinaka at an elevation of 1200-1500 meters asl. It has been recorded from Agusan, Bukidnon, Davao, Misamis, Zamboanga, Leyte, Mindoro, Benguet, Ifugao, Mountain Provinces, Nueva Ecija, Nueva Vizcaya, Pampanga, Quezon, Rizal and is endemic to the Philippines (Cootes 2011a).

Dendrochilum mindanaense (Ames) L.O. Williams Growth habit: upright, sympodial, epiphyte (Figure 2.

AE).

Inflorescence: semi-pendulous, bearing minute blooms; color is cream. Labellum is dark orange; dorsal sepal is oblong, about 1.5 mm long by 0.5 mm wide; petals are narrowly elliptic-oblong; lateral sepals are elliptic about 1.5 mm long by 0.5 mm wide; labellum is three-lobed, side lobes are oblique measures 0.5 mm long by 1 mm wide; mid-lobe is subquadrate and has three dentate apex (Figure 2.AF, AG).

Distribution: It was found on Mt. Sinaka at an elevation of >1400 meters asl. It has also been recorded from Cabadbaran, Agusan del Norte. No other information has yet been published other than the Philippines localities (Pedersen 1997).

217

Liparis dumaguetensis Ames Growth habit: upright, sympodial, terrestrial (Figure 2.AH).

Inflorescence: upright, to 20 cm long, bearing numerous blooms about 1.3 cm in diameter; sepals and petals are a dull purple. Labellum is yellow when the flower first opens. As the flower ages the labellum goes purplish-red; dorsal sepal is linear to narrowly lanceolate, to 9 mm long by 3 mm wide, reflexing; petals are linear, to 9 mm long by 1 mm wide; lateral sepals are narrowly lanceolate, to 9 mm long by 3 mm wide; labellum is heart-shaped; edges erose, to 1 cm long by 8 mm wide (Figure 2.AI, AJ).

Distribution: It was found in montane forest of Mt. Sinaka at an elevation of 1200-1300 meters asl. It was also found on Camiguin, Negros, Panay, Mindoro, Benguet, Laguna, Nueva Vizcaya, Quezon, Rizal, and recorded is endemic to the Philippines (Cootes 2011a).

Liparis terrestris J.B. Comber Growth habit: upright, sympodial, terrestrial (Figure 2.AK).

Inflorescence: upright, peduncle: 14 cm long by 1 mm in diameter bearing blooms with 1 cm apart. Pedicel: about 9 mm long by 0.5 mm in diameter. Bracts are linear, about 7 mm long by 1 mm wide; flower is green, yellow column; dorsal sepal is linear, about 5.5 mm long by 0.5 mm wide; petals are linear, about 6 mm long by 0.5 mm wide; lateral sepals are linear, about 5.5 mm long by 0.5 mm wide; labellum is cordate, erose edge, 4 mm long by 5 mm wide (Figure 2. AL, AM).

Distribution: It was found in the montane forest of Mt. Sinaka at an elevation of 1200-1300 meters asl. It is also recorded from Sumatra (Renz 2012).

Paphiopedilum adductum Asher Growth habit: upright, sympodial, terrestrial (Figure 2.AN).

Inflorescence: upright, bearing up to three blooms; dorsal sepal is creamy-white with dark red vertical striping.

Petals are yellowish dark red stripes. Labellum is reddishbrown with darker striping. Synsepalum is creamy-white with dark red vertical striping; dorsal sepal is ovate, pointed tip, up to 5.5 cm long by 3 cm wide; petals are narrowly linear, gradually tapering, drooping, about 10 cm long by 8 mm wide; labellum is up to 4.5 cm long by 2 cm wide; synsepalum is oblanceolate, up to 6 cm long by 3 cm wide.

Distribution: It was found in montane forest of Mt. Sinaka at an elevation of 1200-1300 meters asl. It is also found in Bukidnon and recorded as endemic to the Philippines (Cootes 2011a).

Pinalia cylindrostachya (Ames) W. Suarez and Cootes Growth habit: upright, sympodial, epiphyte (Figure 2.AO).

Inflorescence: arching, up to 18 cm long, and there can be several per pseudobulb, bearing many. Flowers are about 7 mm in diameter; flower is pale-yellow, almost translucent. Labellum is bright yellow. The outer surfaces, of the dorsal and lateral sepals are covered with very short

218

B I O D I V E R S I T A S 16 (2): 213-224, October 2015

reddish-brown hairs. The anther cap is dark red; dorsal sepal is elliptic-oblong, up to 6 cm long by 3.5 mm wide; petals are obovate, 6 mm long by 3 mm wide; lateral sepals are triangular, 7 cm long by 5 mm wide; labellum is threelobed; wedge-shaped; side lobes oblong; mid lobe is squarish; overall about 7 mm long by 4 mm wide (Figure 2.AP, AQ).

Distribution: It was found in the mossy forest of Mt. Sinaka at an elevation of >1400 meters asl. It was recorded from Bukidnon, Davao, Misamis, Negros, Mindoro, Bataan, Benguet, Rizal and is endemic to the Philippines (Cootes 2011a).

Plocoglottis bicallosa Ames Growth habit: upright, sympodial, terrestrial (Figure 2.AR).

Inflorescence: upright, longer than the leaves, hairy, bearing numerous attractive blooms; sepals and petals are greenish-yellow, blotched basally with reddish-brown.

Labellum is cream with a deep yellow spot between the ridges; dorsal sepal is lanceolate, slightly concave, hairy on the outer surface, 1.6 cm long by 4.5 mm wide; petals are upright, linear, 1.6 cm long by 2 mm wide; lateral sepals are lanceolate, falcate, slightly concave, hairy on the outer surface, to 1.6 cm long by 4.5 mm wide, reflexing backwards; labellum is to 1 cm long by 1.3 cm wide, fanshaped, edges toothed, apex pointed and curved under, two distinct ridges (calli) under the column, which is curved (Figure 2.AS, AT).

Distribution: It was found in montane forest of Mt. Sinaka at an elevation of 1100-1200 meters asl. It has been recorded from Camiguin, Mindoro, Negros, Sorsogon, Rizal and is endemic to the Philippines (Cootes 2011a).

Podochilus plumosus Ames Growth habit: upright to semi-pendulous, sympodial, epiphyte (Figure 2.AU).

Inflorescence: appear dorsally near the tip of the stem bearing 4-5; flower is milky white. Dorsal sepal has a patch of purple at the apex Lateral sepals have shades of purple near its apex; dorsal sepal is ovate to lanceolate, up to 2.5 mm long by 1.5 mm wide; petals are oblong to lanceolate, pointing forward, up to 2 mm long by 1 mm wide; lateral sepals are ovate to lanceolate, up to 2.5 mm long by 1.5 mm wide; labellum is triangular, 3 mm long by 1.5 mm (Figure 2.AV, AW).

Distribution: It was found in the montane forest of Mt. Sinaka at an elevation of 1100-1200 meters asl. It has been recorded from Agusan, Cotabato, Surigao, Zamboanga, Basilan in the Sulu archipelago, Bohol, Leyte, Panay, Samar, Camarines Sur, Laguna, Nueva Ecija, Quezon, Zambales and is endemic to the Philippines (Cootes 2011a).

Robiquetia compressa (Lindley) Schlechter Growth habit: upright to semi-pendulous, monopodial, epiphyte (Figure 2.AX).

Inflorescence: appear opposite the leaf, sometimes branching, up to 20 cm long, bearing many small flowers; flower white with patches of red, side lobes of the labellum are yellow and dark red; dorsal sepal is ovate, concave, up to 4.5 mm long by 2 mm wide; petals are broadly ovate, 3.5 mm long by 2.5 mm wide; lateral sepals are obovate, wedge-shaped, tip broad, 4 mm long by 3 mm wide; labellum is three lobed, side lobes erect, squarish, mid-lobe fleshy, spur curved forward, about 1 cm long (Figure 2.AY, AZ).

Distribution: It was found in the mossy forest of Mt. Sinaka at an elevation of 1300-1400 meters asl. It has been recorded from Davao, Misamis, Zamboanga, Leyte, Panay, Mindoro, Bataan, Camarines Sur, Catanduanes, Quezon, Rizal, Sorsogon and is endemic to the Philippines (Cootes 2011a).

Thrixspermum linearifolium Ames Growth habit: pendulous, monopodial, epiphyte (Figure 2.BA).

Inflorescence: appear opposite the leaf; 10 cm long; rachis flattened bearing the short-lived blooms in succession; sepals and petals yellow, white to cream; labellum white or cream with brown blotches on the inner surface; dorsal sepal is elliptic, concave, 8 mm long by 5 mm wide; petals are obovate, 7 mm long by 4 mm wide; lateral sepals are elliptic, slightly concave, 8 mm long by 5 mm wide; labellum is pouch-shaped; three lobed, side lobes crescent-shaped, 2.5 mm long by 2 mm wide; midlobe short and fleshy; pouch 3 mm long, hairy on inner front surface (Figure 2.BB, BC).

Distribution: It was found in the montane forest of Mt. Sinaka at an elevation of 1200-1300 meters asl. It has been recorded from Bukidnon, Misamis, Zamboanga and is endemic to the Philippines (Cootes 2011a).

Habitat, loss and over-collection of species in the wild, can result in the extinction of species. This suggests that there is a desperate need to protect the habitat. Habitat loss is usually the cause of endangerment of species, while habitat protection is the key to species conservation.

Considering also the economic uses, and the restricted distribution of endemic species, continuous habitat degradation somehow imposes a high risk of these species becoming threatened and even extinct before they are described. Furthermore, the result suggests that Mt. Sinaka must be given priority in protection and conservation to ensure that orchid habitats will remain intact.

The facts presented in this study serve as supplemental information for the conservation organizations, and agencies, not only in Mt. Sinaka but throughout the world, which will save a myriad of species.

PANAL et al. â&#x20AC;&#x201C; Orchids of Mt. Sinaka, Philippines

A

C

219

B

E

D

F

G

I

H

J

B I O D I V E R S I T A S 16 (2): 213-224, October 2015

220

K

L

M

N

Q

T

O

R

P

S

U

V

PANAL et al. â&#x20AC;&#x201C; Orchids of Mt. Sinaka, Philippines

W

AB

AE

221

X

Y

Z

AA

AC

AD

AF

AG

B I O D I V E R S I T A S 16 (2): 213-224, October 2015

222

AH

AI

AK

AN

AO

AR

AJ

AL

AM

AP

AQ

AS

AT

PANAL et al. â&#x20AC;&#x201C; Orchids of Mt. Sinaka, Philippines

AU

AV

AX

BA

223

AY

BB

AW

AZ

BC

Figure 2.A. Anoechtochilus sp.Blume, B, C, D. Appendicula malindangensis (Ames) Schlechter, E. Appendicula micrantha Lindley, F, G, H. Bulbophyllum alagense Ames, I, J. Bulbophyllum alsiosum Ames, K, L, M. Calanthe mcgregorii Ames, N, O. Ceratostylis retisquama Reichenbach f., P, Corybas sp. Salisb, Parad, Lond,.Q, R, S. Coelogyne chloroptera Reichenbach f., T, U, V. Dendrobium auriculatum Ames and Quisumbing, W, X, Y. Dendrobium milaniae Fessel and Luckel, Z, AA. Dendrobium stricticalcarum W. Suarez & Cootes, AB, AC, AD. Dendrochilum arachnites Reichenbach f., AE, AF, AG. Dendrochilum mindanaense (Ames) L.O. Williams, AH, AI, AJ. Liparis dumaguetensis Ames, AK, AL, AM. Liparis terrestris J.B. Comber, AN. Paphiopedilum adductum Asher, AO, AP, AQ. Pinalia cylindrostachya (Ames) W. Suarez and Cootes, AR, AS, AT. Plocoglottis bicallosa Ames, AU, AV, AW. Podochilus plumosus Ames, AX, AY, AZ. Robiquetia compressa (Lindley) Schlechter, BA, BB, BC. Thrixspermum linearifolium Ames. (photos by J. Opiso)

224

B I O D I V E R S I T A S 16 (2): 213-224, October 2015

REFERENCES AO-DENR. 2007. Rules and Regulations Governing the Issuance of Permit over Reclamation Projects and Special Patents over Reclaimed Lands. www.denr.gov.ph. [15 April 2015] Buenavista DP. 2014. Alpha and Beta Diversity Assessment of Orchidaceae in Five Long-Term Ecological Research (LTER) Sites, Mindanao, Philippines. [Thesis]. Central Mindanao University, Mindanao.

Cootes J. 2001. The Orchids of the Philippines. Times Editions, Singapore.

Cootes J. 2011a. Philippine Native Orchid Species. Katha Publishing, Philippines Cootes J. 2011b. A Selection of Orchid Species of the Philippines. www.eurobodalla.ord.au. [15 April 2015] Cullen J. 1992. The Orchid Book: A Guide to the Identification of Cultivated Orchid Species. Cambridge University Press, Cambridge, UK.

Estremera SA. 2011. Protecting their land. Sun Star Davao Yearbook, Aquamarine Protection and Preservation Alliance Inc., Davao City.

Fernando EL, Co D, Lagunzad D, Gruezo W, Barcelona J, Madulid D, Lapis A, Texon G, Manila A, Zamora P. 2008. Threatened Plants of the Philippines: A Preliminary Assessment. Asia Life Sci Suppl 3: 152.

Gravendeel B, Smithson A, Slik FJW, Schuiteman A. 2004. Epiphytism and pollinator specialization: drivers for orchid diversity. Phil Trans R Soc London 359: 1523-1535.

Huynh TT, Thomson R, McLean CB, Lawrie AC. 2009. Functional and genetic diversity of mycorrhizal fungi from single plants of Caladenia formosa (Orchidaceae). Ann Bot 104: 757-765.

IUCN. 2014. IUCN Red List on Threatened Plants. 2014.3. http://www.iucnredlist.org/search. [15 April 2015] Pedersen H. 1997. The Genus Dendrochilum (Orchidaceae) in the Philippines â&#x20AC;&#x201C; A taxonomic Revision. Opera Botanica, Denmark.

B I O D I V E R S IT A S Volume 16, Number 2, October 2015 Pages: 225-237

ISSN: 1412-033X E-ISSN: 2085-4722 DOI: 10.13057/biodiv/d160218

Taxonomy and distribution of species of the genus Acanthus (Acanthaceae) in mangroves of the Andaman and Nicobar Islands, India P. RAGAVAN1, ALOK SAXENA2, P.M. MOHAN1, R.S.C. JAYARAJ3, K. RAVICHANDRAN4 1

Department of Ocean studies and Marine Biology, Pondicherry University, Brookshabad Campus, Port Blair, A & N Islands, India Tel.: +91-3192213126/261566. Fax +91-3192-261568,ď&#x201A;Šemail: van.ragavan@gmail.com 2 Indira Gandhi National Forest Academy, Dehradun, Uttarakhand, India 3 Rain Forest Research Institute, Jorhat, Assam, India 4 Department of Environment and Forests, Andaman and Nicobar Administration, Port Blair, A & N Islands, India Manuscript received: 3 September 2015. Revision accepted: 16 September 2015.

Abstract. Ragavan P, Saxena A, Mohan PM, Jayaraj RSC, Ravichandran K. 2015. Taxonomy and distribution of species of the genus Acanthus (Acanthaceae) in mangroves of the Andaman and Nicobar Islands, India. Biodiversitas 16: 225-237. A recent floristic survey revealed the occurrence of three species of Acanthus in mangroves of the Andaman and Nicobar Islands, India. Of these Acanthus ilicifolius and A. ebracteatus are shrubs, whereas A. volubilis is a climbing shrub. All the three Acanthus species were recorded from the Andaman Islands, but only A. ilicifolius from the Nicobar Islands. A. volubilis is easily distinguished from other two species by its unarmed and twining delicate sprawling stems, un-serrated elliptical leaves, white corolla and absence of bracteoles. A. ilicifolius and A. ebracteatus are differentiated based on the presence and absences of bracteoles, corolla color, and position of Inflorescence and direction of stem axial spines. A key for the species of Acanthus of the Andaman and Nicobar Islands is also provided.

Keywords: Acanthus, Andaman and Nicobar Islands, India, taxonomy

INTRODUCTION The genus Acanthus L. belonging to the family Acanthaceae is an Old World genus native of tropics and subtropics with about 30 species. It is often distinguished from the related genera by spiny leaves, spicate terminal inflorescences, two bracteoles and uniform anthers (Duke 2006). Four species viz., A. ebracteatus Vahl, A. ilicifolius L., A. volubilis Wall. and A. xiamenensis are known from mangrove communities and are classified as true mangrove species (Polidoro et al. 2010). Of these A. xiamenensis is endemic to China and all the other species are common in Indo West Pacific (IWP) region. However, the taxonomical identity of A. xiamenensis in China is not clear; for instance Wang and Wang (2007) have treated A. xiamenensis and A. ilicifolius as the same species. In India all the three Acanthus species are reported in the Andaman and Nicobar Islands (ANI). Generally Acanthus species occur either as an under storey in inner mangrove area or frontal thickets on edges of the tidal creek in middle to upper estuarine areas, although they do occur in lower estuarine position (Duke 2006).

Among the three species of Acanthus the taxonomical distinction between A. ilicifolius and A. ebracteatus still not clear in India (Kathiresan 2010). For instance, Remadevi and Binojkumar (2000) contended that many specimens identified and indexed as A. ilicifolius in Indian herbaria are actually A. ebracteatus, but their identification has been questioned by Anupama and Sivadasan (2004). Further Mandal and Naskar (2008) noted that A. volubilis considered as extinct in India has been recorded again with

its very limited population from Sundarbans. Kathiresan (2008) has not included this species in his report. Thus the taxonomy and distribution of Acanthus spp., is not well understood in India as well as in the ANI. Species of Acanthus were first reported from the ANI by Parkinson (1923). He recognized all the three species discussed in this account, however he did not provide the detailed taxonomical description. He noted that A. ilicifolius was common and that a few A. ebracteatus were found along with A. ilicifolius and that A. volubilis was uncommon found in Bomlungta and Yeratilajig. By the description and the key given by him it is understood that he identified the Acanthus species based on serration in the leaves and flower color, but these two characters are variable in Acanthus spp. After that all the three Acanthus species were listed in the mangrove floral list of the ANI

by Sahni (1958), Dagar (1987), Mall et al. (1987), Das and Dev Roy (1989), Dagar et al. (1991), Singh and Garge (1993), Dagar and Singh (1999), Singh (2003), Debnath (2004), and Dam Roy et al. (2009). Among them Dagar et al. (1991) described the species of Acanthus with locality data. Mall et al. (1987) and Singh and Garge (1993) described two species and noted that A. volubilis was not encountered in the ANI but included it based on the reports of Parkinson (1923) and Thothathri (1962). Thothathri (1962) reported A. volubilis from Campbell Bay, Great Nicobar Island but the specimen deposited by him shows that he had misidentified spineless form of A. ilicifolius as A. volubilis. Dam Roy et al. (2009) also described all the three Acanthus species but later it was found that they misidentified spineless form of A. ilicifolius as A. volubilis

226

B I O D I V E R S IT A S 16 (2): 225-236, October 2015

(Goutham Bharathi et al. 2014; Ragavan et al. 2014).

Recently Goutham Bharathi et al. (2014) reported two species viz., A. ilicifolius and A. ebracteatus, and further noted that A. volubilis was recorded nearly three decades ago as a rare species. Ragavan et al. (2014) reported the

occurrence all the three species of Acanthus in the ANI but they did not provide detailed taxonomical description.

Hence, in the present study Acanthus spp., in the ANI are described, illustrated and compared to provide the taxonomical distinction and to document their distribution.

Figure 1. Map showing surveyed sites in the ANI. South Andaman: 1. Chidiyatapu, 2. Burmanallah, 3. Beadonabad, 4. Corbynâ&#x20AC;&#x2122;s Cove, 5. Sippighat, 6. Manjeri, 7. Guptapara, 8. Manglutan, 9. Wandoor, 10. Ograbraj, 11. Bambooflat Creek, 12. Wright Myo creek, 13. Shoal Bay Creek, 14. Jirkatang, 15. Tirur; Baratang: 16. Middle Strait, 17. Wrafterâ&#x20AC;&#x2122;s Creek, 18. Baludera; Middle Andaman: 19.

Kadamtala Creek, 20. Yerrata Creek, 21. Shyamkund Creek, 22. Dhaninallah Creek, 23. Rangat Bay, 24. Panchawati; Mayabunder: 25.

Austin Creek, 26. Mohanpur Creek, 27. Karmatang Creek, 28. Chainpur Creek, 29. Rampur, 30. Danapur, 31. Tugapur; Diglipur: 32.

Parangara Creek, 33. Kishorinagar Creek, 34. Kalighat Creek, 35. Smith Island, 36. Ariel bay, 37. Radhanagar, 38. Lakshmipur, 39.

Durgapur,, 40. Ramnagar; Havelock: 41. Govindnagar, 42. Radhanagar, 43. Neil Island; Little Andaman: 44. V.K Pur creek, 45.

Dugong Creek, 46. Jackson Creek; Nicobar islands: 47. Car Nicobar, 48. Kamorta, 49. Katchal, 50. Campbell Bay, 51. Trinket island

RAGAVAN et al. – Acanthus species of the Andaman and Nicobar Islands, India

MATERIALS AND METHODS During 2009-2013 qualitative survey was carried out randomly over 51 sites in 8 forest divisions of the ANI to record the species occurrences in the mangroves of the ANI (Figure 1). All sites have been visited at least once at the time of flowering of the different species to crosscheck identification with flower-based diagnostic features. Site access was achieved using a combination of road plus small boat transport to gain access to the extensive range of mangrove area.

Plant collections were made of all Acanthus taxa encountered from the range of sites visited. For each Acanthus species both numeric and multistate attributes of a wide range of vegetative and reproductive morphological characters were observed from one or two individuals at each site. All measurements and observations were made from fresh material for making key for Acanthus spp. The morphological measures and observations were developed and standardized during prior assessments of this genus.

For each species 2-5 specimens were sampled with flowers and fruits for herbarium preparation. Herbarium specimen has been prepared and deposited to the National Botanical Collection of Andaman Nicobar Regional Centre, Botanical Survey of India, Port Blair.

RESULTS AND DISCUSSION Key to Acanthus species in ANI 1. Bracteoles present ............................................................ 2 Bracteoles absent or minute …......................................…. 3 2. Inflorescences terminal and axial, flowers light blue to dark or violet (rarely white), stem axial present or absent, if present always facing upward ......................... A. ilicifolius 3. Inflorescences terminal, flowers white, stem axial spine absent .................................................................... A. volubilis 4. Inflorescences terminal, flowers white, stem axial spines facing downwards ............................................ A. ebracteatus

Acanthus ilicifolius L.-Linnaeus C. 1753. Sp. Pl. 2: 639.

(Figure 2) Acanthus doloarin Blanco-Blanco, F.M. 1837. Fl. Filip. 487.

Acanthus neoguineensis Engl.-Engler, H.G.A. 1886. Bot. Jahrb. Syst. 7: 474.

Dilivaria ilicifolia (L.) Juss.-Jussieu, A.L. 1789.Gen. Pl. 103.

Shrub: height up to 3 m (Figure 2A). Stem: thick, green, light green or purple, sparsely branched and stem axial spine either present or absent, if present always facing upward (Figure 2E). Roots: occasionally above ground or prop roots on lower parts of reclining stem (Figure 2D).

Leaves: simple, opposite, lanceolate to broadly lanceolate, margin either entire or spiny and dentate, leaf base attenuate, leaf tip acute and narrowly pointed with or without spiny edge, presence of spines with greater sunlight and exposure, size variable, 6-30 x1.5-6 cm, ratio of length to width is greater than 2; petiole short, green, 0.5-2 cm long. Inflorescences: both terminal (Figure 2B)

227

and axial (Figure 2C), terminal inflorescences longer than axial, up to 15 cm long, axial inflorescence smaller than terminal, 5-10 cm long. Mature flower bud: ellipsoidal, 33.5 cm long; bract single, 0.8-1 x 0.5-0.7cm (Figure 2H); bracteoles 2, lateral, 0.5-0.8 x 0.2-0.4 cm (Figure 2H); calyx four lobed, outer two lager in size, 1.3-1.5 x 0.8-1.2 cm, enclosing the flower bud, inner lateral lobes narrow, 1 by 0.5-0.8 cm, enclosed by upper and lower lobes; corolla purple or deep purple, rarely white with dark blue median band (Figure 1B and 1I), 3-4 cm x 2-2.5 cm; stamens 4, 22.5 cm long, sub equal with thick hairy connectives; anther medifixed each with 2 cells aggregated around the style, 0.8-1cm long, densely ciliated (Figure 2F); ovary bi-locular with 2 superimposed ovules in each loculus; style enclosed by stamens, 2.5-3 cm long, capitate to pointed stigma exposed (Figure 2G and 2I). Mature fruits: 4 seeded capsule, ovoid, green, shiny, smooth, 3-3.5 x 1 cm (Figure 2J).

Distribution. Found from India to southern China, tropical Australia and the western Pacific islands, including New Caledonia and the Solomon Islands. Occurs throughout Southeast Asia. In India it is common in both east and west coast. In ANI it is found common in both Andaman Islands and Nicobar Islands.

Habitat and Ecology. Common in landward edges of mangroves just above the high tide mark, also occurs in inner mangroves as understorey. Individuals under shade are not serrated.

Phenology. Flowering February to March; fruiting April to May. Specimen examined. India, Andaman and Nicobar Islands, South Andaman, Shoal Bay Creek (11° 47′ 58.4″N, 92° 43′ 03.2″E), P. Ragavan, PBL 30965 and 30966.

Acanthus ebracteatus Vahl-Vahl, M. 1791. Symb. Bot. 2: 75. (Figure 3) Acanthus ilicifolius Lour-Loureiro, J. 1790. Fl. Cochinch. 2: 375.

Dilivaria ebracteata (Vahl) Pers.-Persoon, C.H. 1806. Syn. Pl. 2: 179.

Acanthus ilicifolius var. ebracteatus (Vahl) Benoist-Benoist, R. 1910. Acanthacea nouvelle de Madagascar. Notul. Syst. (Paris) 1: 224-225.

Shrub: height up to 2 m (Figure 3A). Stem: thick, grey color, sparsely branched, stem axial spines always present and facing downward (Figure 3C). Roots: occasionally above ground or prop roots on lower parts of reclining stem (Figure 3B). Leaves: simple, opposite, broadly elliptic to lanceolate, 10-20 x 3-6 cm, leaf tip acute to obtuse with or without spiny edge, base attenuate, margin either/ or spiny and dentate, presence of spines with greater sunlight and exposure; petiole short 0.5-1.5 cm long. Inflorescence: terminal always (Figure 3D), never axial. Mature flower bud: ellipsoidal, 1.8-2.2 cm long; bract single not persistent (Figure 3E, K), 0.3-0.5 cm, apex obtuse, bracteoles absent or obscure, 0.3-0.5 cm, apex acute (Figure 3F); calyx four lobed (Figure 3L), 0.6-0.8 cm long, upper lobe larger than lower lobe (Figure 3I), enclosing the flower bud, lateral lobes narrow, enclosed by upper and lower lobes; corolla white, with purple stripe in middle of lower lip (Figure 3H), 0.9-1.5 cm long; stamens 4, 1.2-1.5 cm long, sub

228

B I O D I V E R S IT A S 16 (2): 225-236, October 2015

equal with thick hairy connectives; anther medifixed each with 2 cells aggregated around the style, 0.3-0.5 cm (Figure 3M); ovary bilocular with 2 superimposed ovules in each loculus; style enclosed by stamens, 0.8-1.2 cm long, capitate to pointed stigma exposed (Figure 3G). Mature fruit: 4 seeded capsule, ovoid, green, shiny, smooth, 2-2.5 x 1 cm (Figure 3J).

Distribution. From India to tropical Australia, Southeast Asia and the west Pacific islands (e.g. Solomon Islands). In Southeast Asia it has been recorded in Cambodia, Myanmar, the Philippines, Vietnam, Malaysia, Singapore, Indonesia and Papua New Guinea. In India A. ebracteatus occurs in Kerala, Puducherry and ANI. In ANI it is recorded from Sippighat and Shoal Bay Creek in South Andaman Island.

Habitat and Ecology. Common in landward edges of mangroves just above the high tide mark, also occur in inner mangroves as under-storey. Individuals under shade are less serrated Phenology. Flowering and fruiting occurs throughout the year apparently.

Specimen examined. India, Andaman and Nicobar Islands, South Andaman, Sippighat (11°36′ 50.1″N, 92° 41′ 22.2″E), P. Ragavan, PBL 30969 and 30970.

Acanthus volubilis Wall-Wallich, N. 1831. Pl. Asiat. Rar. 2: 56. (Figure 4) Dilivaria scandens Nees-Nees von Esenbeck CGD.1847.

Prodr. 11: 269.

Dilivaria volubilis (Wall.)Nees-Nees von Esenbeck, C.G.D. 1832. Pl. Asiat. Rar. 3: 98.

Twining shrub: length to 2-4 m (Figure 4A). Stem: thin, green, branched, smooth, stem axial spines absent (Figure 4I). Roots: occasionally above ground or prop roots on lower parts of reclining stem (Figure 4G). Leaves: simple, opposite, without spines, succulent, elliptic or oblong lanceolate, leaf tip acute to obtuse with spiny edge, leaf base attenuate, margin entire without spines and dentate (Figure 4B), 5-10 x 2.5-4 cm, ratio of length to width greater than 2; petiole short 0.5-2 cm long, green.

Inflorescence: always terminal (Figure 4C), 8-12 cm long; Mature flower bud: ellipsoidal, 2-2.8 cm long; bract single not persistent; bracteoles absent (Figure 4H); calyx 1-1.3 cm long, four lobed, upper lobe 1.3 by 0.5 cm, lower lobe 1 x 0.4 cm, enclosing the flower bud, lateral lobes narrow, 0.5-0.7 cm long, enclosed by upper and lower lobes (Figure 4J); corolla white, 1.5-2 x 2-2.5 cm (Figure 4D); stamens 4, 1.5 cm long, sub equal with thick hairy connectives; anther medifixed each with 2 cells aggregated around the style (Figure 4E); ovary bilocular with 2 superimposed ovules in each loculus; style enclosed by stamens, 1-1.5cm long, capitate to pointed stigma exposed (Figure 4F). Mature Fruit: 4 seeded capsule, ovoid, green, shiny, smooth, 2-2.5 x 1cm (Figure 4K).

Distribution. Found from South to Southeast Asia.

Recorded in eastern India (Odisha), Sri Lanka and the Andaman Islands, to Myanmar, Indonesia, Cambodia, Malaysia, Singapore, Thailand and Papua New Guinea. In India Acanthus volubilis occurs in ANI and Sundarbans. In ANI it is recorded from Shoal Bay Creek and Jirkatang in South Andaman at confined location.

Habitat and Ecology. Observed in landward edges of mangroves just above the high tide mark flooded during spring tides Phenology. Flowering March to April; fruiting May to June.

Specimen examined. India, Andaman and Nicobar Islands, South Andaman, Shoal Bay Creek (11° 47′ 58.4″N, 92° 43′ 03.2″E), P. Ragavan, PBL 30967 and 30968.

Discussion Among the three Acanthus species described in this account A. volubilis can be easily distinguished from other two species by its unarmed and twining with delicate sprawling stems, un-serrated elliptical leaves, white corolla and absence of bracteoles. However it was found from this study that A. ilicifolius also exhibits un-serrated leaves, stem without axial spines but presence of bract and bracteoles is consistent in A. ilicifolius. So without flower it is difficult to distinguish A. volubilis and A. ilicifolius in the ANI. Specimen deposited by Thothathri (1962) and photographs shown in Dam Roy et al. (2009) for A. volubilis possess un-serrated leaves and stem without axial spines but flowering and fruiting was not reported by them.

This supposes that the only character of the observed specimen used by them to identify the species as A. volubilis was spineless leaves and stem. Parkinson (1923) reported A. volubilis from Middle Andaman whereas Dagar et al. (1991) reported it from Baratang Island. In the present study A. volubilis was not observed in the above mentioned sites; instead wide variation in A. ilicifolius was observed there. In this study it was recorded from Shoal Bay Creek and Jirkatang in South Andaman, though in past no records are available for the presence of A. volubilis in these two sites.

In this study A. ebracteatus was recorded from South Andaman at two sites viz., Shoal Bay and Sippighat. The species status of A. ebracteatus is often doubted by the botanists since the two species viz., A. ilicifolius and A. ebracteatus have similar vegetative characteristics and the difference between them is the presence or absence of bracteoles which are often lost at anthesis, and many people have been wary when making identifications (Barker 1986). The taxonomical identity of A. ebracteatus was mainly based on the absence of bracteoles, white color corolla and smaller size of flower and fruits. During the present study it was found that position of inflorescences and direction of stem axial spines at nodes aid the rapid differentiation of A. ilicifolius from A. ebracteatus apart from flower color and presence of bracteoles in the ANI. In A. ebracteatus inflorescences are always terminal and stem axial spines face downwards whereas in A. ilicifolius inflorescences are both terminal and axial and stem axial spines face upwards. Bract and bracteoles are always present and persistent in A. ilicifolius whereas in A. ebracteatus bracteoles are absent or minute and bracts are present and both are lost before or at anthesis. Diagnostic characters of Acanthus spp. in the ANI are given in Table 1.

RAGAVAN et al. â&#x20AC;&#x201C; Acanthus species of the Andaman and Nicobar Islands, India

A

D

H

C

B

E

229

G

F

I

J

Figure 2. Diagnostic characters of A. ilicifolius. A. Habitat, B. Terminal infloresences, C. Axial inflorescences, D. Stem based with above ground roots, E. Stem axial spines facing upwards, F. Densely ciliated anther, G. Style, H. Presences of bract and bracteoles, I. Blue color corolla, J. Fruit

B I O D I V E R S IT A S 16 (2): 225-236, October 2015

230

B

A

D

C

E

F

H

G

I

K

J

L

M

Figure 2. Diagnostic characters of A. ebracteatus: A. Habitat, B. Prop roots, C. Stem axial spine faring downwards, D. Terminal infloresences, E. Flower bud with only bract, F. Flower bud with bract and minute bracteoles, G. Style, H. White corolla with purple stripe in middle of lower lip, I. Calyx lobes, J. Fruits, K. Removal of bract before anthesis, L. Mature fruit without bract and bracteoles, M. Small stamens with densely ciliated anther

RAGAVAN et al. â&#x20AC;&#x201C; Acanthus species of the Andaman and Nicobar Islands, India

B

F

I

C

D

A

231

E

H

G

J

K

Figure 4. Diagnostic characters of A. volubilis: A. Habitat, B. Leaves, C. Terminal inflorescences, D. White corolla, E. Stamens with densely ciliated anther, F. Style, G. Stilt root, H. Prominent bract, I. Twining smooth stem, J. Calyx lobes, K. Fruits

232

B I O D I V E R S IT A S 16 (2): 225-236, October 2015

A

B

C

D

E

F

G

H

I

Figure 5. Variation in A. ilicifolius: A. Light blue flower, B. Flower with white margin and median dark blue band, C. Purplish flower, D. Smooth stem without axial spines, E. Stem with axil spines, F. Reddish bract and bracteoles with acute tip, G. Bract and bracteoles with obtuse apex, H. Fruit with persistence bracteoles with obtuse tip, I. Large sized flower

Most of the A. ilicifolius population observed in this study have lanceolate bract and bracteoles with mucronate tip, ciliated margin and medial vein whereas the population observed in Great Nicobar Island possessed ovate bract and bracteoles with ciliated margin and flowers are comparatively larger than that of others (Figure 5G-I) A. ilicifolius specimens have been recorded with stems that are green, purple or of colors in between with or without stem axial spines (Figure 5D and 5E) and color of bract and bracteoles also varied (Figure 5F). Flowers and fruits of A. ebracteatus are smaller than that of A. ilicifolius, but flower color of A. ilicifolius varied from light to dark blue or violet with dark blue median band (Figure 4A-C). In both A. ilicifolius and A. ebracteatus degree of serration in leaves varied with respect to exposure to sun, individuals under shade being less serrated particularly in A. ilicifolius, and

wide variation in leaf shape was recorded in the ANI (Figure 6 and 7).

In Table 2 Characters of A. ilicifolius and A. ebracteatus described from Malesia, Java, Australia and New Guinea are compared with characters of A. ilicifolius and A. ebracteatus observed in the ANI. This indicates that presence of both terminal and axial inflorescences in A. ilicifolius and direction of stem axial spine (downward in A. ebracteatus and upward in A. ilicifolius) are new observation and not recorded for these species. There are marked differences in the size of flower and fruit between A. ilicifolius and A. ebracteatus in the ANI as in Malesia.

Axillary thorns are variable in A. ilicifolius of the ANI whereas axillary thorns are more consistent in others places and flower color is variable in all the places. Bract and bracteoleâ&#x20AC;&#x2122;s apex is acute and mucronate in most of the

RAGAVAN et al. â&#x20AC;&#x201C; Acanthus species of the Andaman and Nicobar Islands, India

B

A

C

D

E

F

H

I

K

233

G

J

L

M

Figure 6. Variation in leaves of A. ilicifolius: A. Smooth needle like leaf, B. Smooth lanceolate like leaf, C and D. Smooth broadly elliptic leaves with acuminate tip, E. Leaves serrated at base only, F. Highly dentate leaves, G. Smooth leaf with acute tip, G. Obovate leaves with rounded tip, I. Moderately serrated and dentate leaves, J. Highly serrated leaves, K. Stem with axial spines, L. Stem with axial spine, M. Smooth leaves with spine axial spines

B I O D I V E R S IT A S 16 (2): 225-236, October 2015

234

A

B

D

C

Figure 7. Variation in leaves of A. ebracteatus. A. Leaf with smooth margin, B. Leaf with moderately serrated and denate, C. Leaf with less serrated, D. L with highly serrated and dentate

Table 1. Diagnostic characters of Acanthus species of the ANI Components

Characters

A. ilicifolius

A. ebracteatus

A. volubilis

Leaves

Leaf shape Leaf apex

Highly variable lanceolate to obovate Acute to acuminate or rounded with or without spiny edge Attenuate Entire to spiny and dentate

Oblong elliptic Acute with or without spiny edge Attenuate Spiny and dentate

Elliptic Acute with or without spiny edge Cuneate Entire

Thick Mostly purple, green also

Thin, twine like Greenish brown

Axial spines Position Bud length Bract

Thick Variable green, purple or colors in between Present or absent, if present always facing upwards Terminal and axial 3-3.5 cm long Present, single and persistent

Always resent facing downward

Absent

Terminal always 1.8-2.2 cm long Present, single fall before anthesis

Bracteoles

Two, lateral, persistent

Petal

Mostly purple, blue or dark blue, rarely white Four, 2-2.5 cm long 2.5-3 cm long Capsule like 3-3.5 cm Four seeded

Absent or minute, lateral, two, fall before anthesis White with purple stripe in middle of lower lip Four, 1.2-1.5 cm long 0.8-1.2 cm long Capsule like 2-2.5 cm Four seeded

Terminal always 2-2.8 cm long Present, single, fall before anthesis Absent

Stem

Inflorescences Mature flower

Mature fruit

Leaf base Leaf margin Texture Color

Stamens Style Shape Fruit length Seed

White Four 1.2-1.5 cm long 1-1.5 cm long Capsule like 2-2.5 cm Four seeded

B I O D I V E R S IT A S Volume 16, Number 2, October 2015 Pages: 225-237

ISSN: 1412-033X E-ISSN: 2085-4722 DOI: 10.13057/biodiv/d160218

Table 2. Comparison of characteristics for A. ilicifolius and A. ebracteatus from Malesia, Australia, New Guinea and ANI

Characters

Axillary thorns

Inflorescences Bracteoles

Bract size Bracteole size Bract/bracteole apex

Acanthus ilicifolius Java Malesia (Backer and Australia ANI (Bremekamp Bakhuizen van (Barker (This study) 1955) den Brink 1986) 1965) Present or Present Present Usually absent, if present present always facing upwards Both terminal Terminal Terminal Terminal and axial Present and Present Present Present persistent

Acanthus ebracteatus Java Malesia (Backer and Australia New Guinea ANI (Bremekamp Bakhuizen van (Barker (Barker 1986) (This study) 1955) den Brink 1986) 1965) Usually Present always, Present or not Present or not Absent present facing downwards

0.8-1 cm 0.5-0.8 cm

0.65-0.8 cm 0.6-0.8 cm

0.65-0.82 cm 0.55-0.65 cm

Often spinetipped

Acute to obtuse

Acute and mucronate mostly, obtuse also Corolla length 3-4 cm Filament/stamen length 2-2.5 cm Anther length 0.8-1 cm Style length 2.5-3 cm Calyx length 1.3-1.5 cm Suture of anther Densely ciliate

Corolla color

0.7-0.9 cm 0.7-0.9 cm More or less equal 0.6-0.8 cm to bracts Spinose mucronate -

3.5-4 cm 1.5-2 cm 0.8-0.85 cm 2.5 cm 1.3 cm Densely ciliate

3-4.5 cm 1.3-1.6 cm 2.25-2.5 cm 1.2-1.5 cm -

2.2-3 cm 1.1-1.3 cm 0.63-0.65 cm 1.7-1.8 cm 1.1-1.2 cm Ciliate along one of both sides Violet, light to Dark blue or violet, Violet with Blue, mauve, dark blue with rarely white yellow median whitish edged dark blue band, rarely with lilac median band white

Present or not

Terminal

Terminal

Terminal

Terminal

Present

Absent or minute if present, not persistent 0.3-0.5 cm 0..3-0.5 cm

Usually absent

Usually absent Usually absent

Usually absent

0.3-0.6 cm -

0.3-0.4 cm 0.3-0.4 cm

Bract apex is obtuse and bracteoles apex is acute 0.9-1.5cm 1.2-1.5cm 0.3-0.5cm 0.8-1.2 cm 0.6-0.8 cm Hairy

-

-

0.65-0.82 cm Only 1 seen 0.4 cm Obtuse

0.65-8 cm Only 1 seen 0.33 cm Obtuse

1.5-3 cm 0.7-1.2 cm 0.4-0.6 cm 1-1.5 cm 0.7-1.1 cm Densely ciliate

2-3 cm 0.75-1.25 cm 2 cm 0.75-1.25 cm -

2.2-2.6 cm 1-1.1 cm 0.6 cm 1.2 cm 1-1.05 cm Glabrous along both sides Blue-purple, dark blue, purple, lilac,

2.2-2.4 cm 1-1.1 cm 0.5-0.65 cm 1.2-1.8cm 1-1.05 cm Ciliate along one side White with blue margins: scented or not

2.8 cm c. 1.3 cm 0.62 cm 1.5-1.8 1.1-1.3 cm Ciliate along one of both sides Bright blue to White violet, becoming white, internally with yellow spot

White or pale blue White

Terminal

New Guinea (Barker 1986)

Terminal

B I O D I V E R S IT A S 236

Volume 16, Number 2, October 2015 Pages: 225-237

B I O D I V E R S IT A S 16 (2): 225-237, October 2015

population of A. ilicifolius in the ANI as in other places however bract and bracteoles with obtuse apex are also observed in A. ilicifolius from Great Nicobar Islands.

Axillary thorns and flower color in A. ebracteatus are consistent in the ANI but variable in other places. A. ebracteatus of the ANI have similar characteristics with specimen described in Java, but bracteoles are absent in Java but are minute in the ANI. Bract apex is obtuse in ANI and apexes of the bracteoles are acute. Most importantly two subspecies of A. ebracteatus described from Australia are more similar to A. ilicifolius described in this account except in the presence of glabrous anthers and flower color. It was reported that flower color of A. ilicifolius is rarely white (Jayatissa et al. 2002). In the present study A. ilicifolius with white flowers was not observed in the ANI, whereas flowers color in A. ilicifolius varied between light to dark violet. Recently Debnath et al.

(2004) reported a new mangrove species Acanthus albus from Sundarbans. This new species is similar to A. ilicifolius except in flower color and smaller size of leaves, fruits and flowers. Similar kind of specimen was reported from Sri Lanka by Liyanage (1997) as A. volubilis, and later that it was confirmed as whitish flowered form of A. ilicifolius (Jayatissa et al. 2002). So the species status of A. albus has to be checked to avoid further complication in the identity of A. ilicifolius.

Acanthus ilicifolius was recorded at 46 sites out of 51 sites surveyed and observed in both Andaman Islands and Nicobar Islands whereas A. ebracteatus and A. volubilis were recorded at confined locations in the Andaman Islands. So it is reported that A. ebracteatus and A. volubilis are rare in these Islands. Earlier Dagar et al.

(1991) reported the occurrence of A. ilicifolius and A. ebracteatus from Nicobar Islands but, in the present study, A. ebracteatus was not observed there. It has been reported that 62-70% of the mangrove forests of Nicobar Islands were destroyed by the submergence of coastal lands by about 1 m following the massive earthquake that occurred on 26th December 2004 (Ramachandran et al. 2005; Sridhar et al. 2006; Nehru and Balasubramanium 2011). It is suspected, therefore, that permanent submergence might have led to the extinction of A. ebracteatus from the Nicobar Islands, although this needs to be validated by more extensive and thorough surveys for Acanthus species in the Nicobar Islands.

Acanthus species has long been used as a traditional folk remedy for treating various ailments in Indian traditional medicine, traditional Tai medicine and Chinese traditional medicine (Wostmann and Liebezeit 2008; Saranya et al. 2015). Various parts of A. ilicifolius have been used as crude drug for treatment of asthma, diabetes, dyspepsia, leprosy, hepatitis, paralysis, snake bite, rheumatoid arthritis and diuretic (Bandaranayake 1998).

The leaves of A. volubilis are used for dressing boils and wounds whereas powdered seeds are taken with water as a blood cleansing medicine and against ulcers (Das et al.

2013). The leaves of A. ebracteatus used for making Tai herbal tea in Thailand and Indonesia, as it has antioxidant properties (Chan et al. 2012). Capsule from A. ebracteatus, named Sea Holly Capsule, is a certified product of ministry

ISSN: 1412-033X E-ISSN: 2085-4722 DOI: 10.13057/biodiv/d160218

of Public Health Thailand and has been used for relief of allergies and rashes (Saranya et al. 2015). In addition Acanthus species possess wide range of anti microbial activities (Ganesh and Vennila 2010) and various bioactive components have also been extracted (Bandaranayake 2002).

As per the IUCN Red data list all the three species of Acanthus are considered as of least concern. However, in India only A. ilicifolius is known to occur in all mangrove habitats except Lakshadweep, whereas A. ebracteatus and A. volubilis have very restricted distribution. A. ebracteatus was earlier known to occur only from Kerala and ANI (Kathiresan 2008), but Saravanan et al. (2008) reported its occurrence in Puducherry. But in recent times A. ebracteatus is not reported from Kerala. A. volubilis is present in ANI and Sundarbans, but in both the places its distribution is confined to a few locations. Hence A. ebracteatus and A. volubilis are confirmed as rare in India.

So measures have to be taken to conserve these two species on priority basis.

ACKNOWLEDGEMENTS We are extremely grateful to the Principal Chief Conservator of Forests, Andaman and Nicobar Islands for his guidance and ensuring necessary support from the field.

We appreciate the cooperation and support provided by the CCF (Research and Working Plan), CCF, Territorial Circle and all the Divisional Forest Officers and their staff in the Department of Environment and Forests, Andaman and Nicobar Administration. Thanks are due to Dr. N. Krishnakumar, IFS, Director, Institute of Forest Genetics and Tree Breeding, Coimbatore for his support and encouragement. Special thanks are extended to DFO Campbell Bay for constant support.

REFERENCES Anupama C, Sivadasan M. 2004. Mangroves of Kerala, India. Rheedea 14: 9-46 Backer CA, Bakhuizen van den Brink RC. 1965. Acanthaceae. In: Flora of Java, vol. 2:5 44-593. P. Noordhof, Groningen, The Netherlands.

Bandaranayake WM, 1998. Traditional and medicinal uses of mangroves.

Mangroves and Salt Marshes 2: 133-148.

Bandaranayake WM. 2002. Bioactivities, bioactive compounds and chemical constituents of mangrove plants. Wetlands Ecol Manag, 10: 421-452.

Barker RM. 1986. A taxonomic revision of Australian Acanthaceae. J Adelaide Bot Gard 9: 1-286.

Bremekamp CEB. 1955. The Acanthaceae of the Malesian area. Proc Kon Nederl Akad Wetensch , Ser C, 58:1. General Considerations: 162171. II. Special Part: 295-306.

Chan EWC, Eng SY, Tan YP, Wong ZC, Lye PY, Tan LN. 2012.

Antioxidant and Sensory Properties of Thai Herbal Teas with Emphasis on Thunbergia laurifolia Lindl. Chiang Mai J Sci 39 (4): 599-609.

Dagar JC, Mongia AD, Bandhyopadhyay AK. 1991. Mangroves of Andaman and Nicobar Islands. Oxford and IBH, New Delhi.

Dagar JC, Singh NT. 1999. Plant Resources of the Andaman and Nicobar Islands. Introduction, General Features, Vegetation and Floristic Elements Vo. 1 and 2. Bishen Singh Mahendra Pal Singh, Dehra Dun. Dagar JC. 1987. Mangrove vegetation, its structure, ecology, management and importance with special reference to Andaman and Nicobar

RAGAVAN et al. – Acanthus species of the Andaman and Nicobar Islands, India Islands. In: Proceedings of the Symposium on Management of Coastal Ecosystems and Oceanic Resourcesof the Andamans, 17-18 July 1987, Andaman Sci Assoc, Central Agricultural Research Institute, Port Blair, India.

Dam Roy S, Krishnan P, George G, Kaliyamoorthy M, Goutham Bharathi MP. 2009. Mangroves of Andaman and Nicobar Islands, A field guide. Central Agricultural Research Institute, Port Blair, India.

Das AK, Dev Roy MK. 1989. A General Account of the Mangrove Fauna of Andaman and Nicobar Islands. Fauna and Conservation Areas: 4.

Published by the Director, Zoological Survey of India, Kolkata, India.

Das SS, Das S, Ghosh P. 2013. Optimization of DNA isolation and RAPD-PCR protocol of Acanthus volubilis Wall., a rare mangrove plant from Indian Sundarban, for conservation concern. Eur J Exp Biol 3 (6): 33-38.

Debnath HS. 2004. Mangroves of Andaman and Nicobar Islands; Taxonomy and Ecology A Community Profile. Bishen Singh Mahendra Pal Singh, Dehradun.

Duke NC. 2006. Australia’s mangroves: the Authoritative Guide to Australia’s Mangrove Plants. University of Queensland and Norman C. Duke, Brisbane.

Ganesh S, Vennila JJ. 2010. Screening for antimicrobial activity in Acanthus ilicifolius. Arch Appl Sci Res 2: 311-315.

Goutham-Bharathi MP, Dam Roy S, Krishnan P, Kaliyamoorthy M, Immanuel T. 2014. Species diversity and distribution of mangroves in Andaman and Nicobar Islands, India. Botanica Marina 57: 421-432.

Jayatissa LP, Dahdouh-Guebas F, Koedam N. 2002. A review of the floral composition and distribution of mangroves in Sri Lanka. Bot J Linn Soc 138: 29-43.

Kathiresan K. 2008. Biodiversity of mangrove ecosystems. Proceedings of Mangrove Workshop. GEER Foundation, Gujarat, India.

Kathiresan K. 2010. Importance of mangrove forest of India. J Coast Environ 1: 11-26.

Liyanage S. 1997. Mangrove plant communities in Sri Lanka. Forest Department, Colombo, Sri Lanka. [Original language: Sinhala; English translation].

Mall LP, Singh VP, Pathak SM, Garge A, Jat MS, Laskari M. 1987.

Ecological studies of mangrove forest ecosystem of Andaman and Nicobar Islands. Final Technical Report. MAB project No.F 20/3/79 ENV., Vikaram University, Ujjain, India.

Mandal RN, Naskar KR. 2008. Diversity and classification of Indian mangroves: a review. Trop Ecol 49: 131-146.

Nehru P, Balasubramanian P. 2011. Re-colonizing mangrove species in tsunami devastated habitats at Nicobar Islands, India. Check List 7: 253-256.

237

Parkinson CE. 1923. A Forest Flora of the Andaman Islands. Bishen Singh and Mahendrapal Singh, Dehradun.

Polidoro BA, Carpenter KE, Collins L, Duke NC, Ellison AM et al. 2010.

The loss of species: Mangrove extinction risk and geographic areas of global concern.

PLoS ONE 5: e10095.

DOI: 10.1371/journal.pone.0010095 Ragavan P, Saxena M, Saxena A, Mohan P.M, Sachithanantham V, Coomar T. 2014. Floral composition and taxonomy of mangroves of Andaman and Nicobar Islands. Indian J Geo Mar Sci 43:1031-1044.

Ramachandran S, Anitha S, Balamurugan V, Dharanirajan K, Vendhan KE, Divien MIP, Vel AS, Hussain IS, Udayaraj A. 2005. Ecological impact of tsunami on Nicobar Islands (Camorta, Katchal, Nancowry and Trinkat). Curr Sci 89: 195-200.

Remadevi S, Binoj Kumar MS. 2000. Acanthus ebracteatus Vahl-An addition to the flora of Mainland of India. J Econ Taxon Bot 24 (1): 241-242.

Sahni KC. 1958. Mangrove forest in Andaman and Nicobar Islands.

Indian Forester 84: 544-562.

Saranya A, Ramanathan T, Kesavanarayanan, Adam A. 2015. Traditional medicinal uses, chemical constituents and biological activities of a mangrove plant, Acanthus ilicifolius Linn.: A brief review. AmericanEurasian J Agric Environ Sci 15 (2): 243-250.

Saravanan KR, Ilangovan K, Khan AB. 2008. Floristic and macro faunal diversity of Pondicherry mangroves, South India. Trop Ecol 49: 9194.

Singh VP, Garge A. 1993. Ecology of Mangrove Swamps of the Andaman Islands. International Book Distributors, Dehradun, India.

Singh VP. 2003. Biodiversity, community pattern and status of Indianmangroves. In: Alsharhan AS, Fowler A, Goudie AS, Abdellatif EM, Wood WW (eds.) Desertification in the Third Millennium. Proceedings of an International Conference, Dubai.

Taylor & Francis,New York.

Sridhar R, Thangaradjou T, Kannan L, Ramachandran A, Jayakumar S. 2006. Rapid assessment on the impact of tsunami on mangrove vegetation of the Great Nicobar Island. J Indian Soc Rem Sens 34: 89-93.

Thothathri K. 1962. Contribution to the flora of Andaman and Nicobar Islands. Bull Bot Surv India 4: 281-296.

Wang WQ, Wang M. 2007. The Mangroves of China. Science Press, Beijing [Chinese].

Wostmann R, Liebezeit G. 2008. Chemical composition of the mangrove holly Acanthus ilicifolius (Acanthaceae)-review and additional data.

Senckenbergiana Maritime 38: 31-37.

B I O D I V E R S IT A S Volume 16, Number 2, October 2015 Pages: 238-246

ISSN: 1412-033X E-ISSN: 2085-4722 DOI: 10.13057/biodiv/d160219

Isolation and characterization of a molybdenum-reducing and SDSdegrading Klebsiella oxytoca strain Aft-7 and its bioremediation application in the environment NORAZLINA MASDOR1, MOHD SHUKRI ABD SHUKOR2, AFTAB KHAN3, MOHD IZUAN EFFENDI BIN HALMI4,, SITI ROZAIMAH SHEIKH ABDULLAH4, NOR ARIPIN SHAMAAN5,MOHD YUNUS SHUKOR6 1 Biotechnology Research Centre, MARDI, P. O. Box 12301, 50774 Kuala Lumpur, Malaysia Snoc International Sdn Bhd, Lot 343, Jalan 7/16 Kawasan Perindustrian Nilai 7, Inland Port, 71800, Negeri Sembilan, Malaysia.

3 Department of Biochemistry & Health Science, Hazara University Mansehra, KPK, Pakistan.

4 Department of Chemical and Process Engineering, Faculty of Engineering and Built Environment, Universiti Kebangsaan Malaysia, 43600 UKM Bangi, Selangor, Malaysia. Tel.: +60-3-89216428; Fax: +60-3-89118345, email: zuanfendi@ukm.edu.my, zuanfendi88@gmail.com 5 Faculty of Medicine and Health Sciences, Islamic Science University of Malaysia, 55100 Kuala Lumpur, Malaysia.

6 Department of Biochemistry, Faculty of Biotechnology and Biomolecular Sciences, Universiti Putra Malaysia, UPM 43400 Serdang, Selangor, Malaysia.

2

Manuscript received: 15 August 2015. Revision accepted: 18 September 2015.

Abstract. Masdor N, Shukor MSA, Khan A, Halmi MIE, Abdullah SRS, Shamaan NA, Shukor MY. 2015. Taxonomy and distribution of species of the genus Acanthus (Acanthaceae) in mangroves of the Andaman and Nicobar Islands, India. Biodiversitas 16: 238246.Pollution as a result of anthropogenic activities is a severe global issue. These activities including inappropriate disposal, industrial and prospecting activities and unnecessary use of agricultural chemicals have triggered international initiatives to eliminate these contaminants. In this work we screen the ability of a molybdenum-reducing bacterium isolated from contaminated soil to grow and reduce molybdenum on various detergents. The bacterium was able to grow on SDS as a carbon source although the compound did not support molybdenum reduction. The bacterium reduces molybdate to Mo-blue optimally between pH 5.8 and 6.3 and between 25 and 34oC. Glucose was the best electron donor for supporting molybdate reduction followed by sucrose, D-mannitol, D-sorbitol, lactose, salicin, trehalose, maltose and myo-Inositol in descending order. Other requirements include a phosphate concentration between 5.0 and 7.5 mM and a molybdate concentration between 5 and 20 mM. The absorption spectrum of the Mo-blue produced was similar to previous Mo-reducing bacterium, and closely resembles a reduced phosphomolybdate. Molybdenum reduction was inhibited by mercury (ii), silver (i) and copper (ii) at 2 ppm by 62.1, 33.9 and 33.6%, respectively. Biochemical analysis resulted in a tentative identification of the bacterium as Klebsiella oxytoca strain Aft-7. The ability of this bacterium to detoxify molybdenum and degrade detergent makes this bacterium an important tool for bioremediation.

Keywords: Bioremediation, isolation, Klebsiella oxytoca, molybdenum, SDS

INTRODUCTION Pollution due to anthropogenic activities is a serious global problem. These activities such as improper disposal, industrial and mining activities and excessive use of agricultural chemicals have resulted in global efforts to remove these pollutants (Rieger et al. 2002). Molybdenum is one of the essential heavy metals that are required at trace amount and is toxic to a variety of organisms at elevated levels (Ahmad-Panahi et al. 2014). The estimated global molybdenum reserve base in 2008 was 19,000,000 metric tonnes. It has many uses in industries such as molybdenum grade stainless steels, high-temperature steel, tool and high speed steel, molybdenum grade cast irons, automobile engine anti-freeze component, component of corrosion resistant steel and as lubricant in the form of molybdenum disulphide. Widespread use of molybdenum in industry has resulted in several soil and water pollution cases all around the world such as in the Tokyo Bay, Tyrol in Austria, the Black Sea, where molybdenum level reaches in the hundreds of ppm (Davis 1991; Neunhäuserer et

al.2001). In addition terrestrially, it has been recognized as a significant pollutant in sewage sludge (Lahann 1976).

Molybdenum is very toxic to ruminants at levels of several parts per million being the most affected are cows (Underwood 1979; Kincaid 1980). Molybdenum toxicity in inhibiting spermatogenesis and arresting embryogenesis in organisms such as catfish and mice at levels as low as several parts per million have been reported (Meeker et al.

2008; Bi et al. 2013; Zhai et al. 2013; Zhang et al. 2013).

Aside from heavy metals, detergents are often present as co pollutants, especially in water bodies. Detergents have detrimental effects to aquatic life (Liwarska-Bizukojc et al. 2005). Anionic surfactants such as Sodium Dodecyl Sulfate (SDS) and Sodium Dodecyl Benzene Sulfonate (SDBS) (Figure 1) exhibited toxic effects at concentrations ranging from 0.0025 to 300 mg/L (Pettersson et al. 2000).

Toxicity towards invertebrates and crustaceans has been documented in vivo and in vitro due to the massive amount of anionic surfactants continuously released into water bodies. For instance, a study on oyster digestive gland indicated that exposure to SDS has a detrimental effect.

MASDOR et al. –Potential bioremediation of Klebsiella oxytoca

The detrimental effects include perturbation of the metabolic and nutritional functions. All of these negative effects have a direct influence on oyster survival (Rosety et al. 2000). Detergents could also modify the behavior of the fish such as muscle spasms, erratic movement, and body torsion (Cserháti et al. 2002).

A

B Figure 1.The structure of SDS (A) and SDBS (B).

Some microbes are able to degrade a variety of xenobiotics and detoxify heavy metals at the same time (Anu et al. 2010; Chaudhari et al. 2013; Bhattacharya et al.

2014) and the versatility of these microbes are in great demand in polluted sites where the presence of several contaminants are the norm (Ahmad et al. 2014). Heavy metals reduction coupled with azo dye decolorization have been reported (Chaudhari et al. 2013).

In the present work, we screen for the ability of a novel molybdenum reducing bacterium isolated from contaminated soil to grow on several detergents and hydrocarbons such as diesel and crude petroleum. Here we report on a novel molybdenum-reducing bacterium with the capacity to grow on the detergent SDS, isolated from a contaminated soil. The characteristics of this bacterium would make it suitable for future bioremediation works involving both the heavy metal molybdenum and dye as an organic contaminant.

MATERIALS AND METHODS Chemicals All chemicals used were of analytical grade and purchased from Sigma (St. Louis, MO, USA), Fisher (Malaysia) and Merck (Darmstadt, Germany).

Isolation of molybdenum-reducing bacterium Soil samples were taken (5 cm deep from topsoil) from the grounds of a contaminated land in the province of Khyber Pakhtunkhwa, Pakistan, in 2013. One gram of soil sample was suspended in sterile tap water. 0.1 mL aliquot of the soil suspension was pipetted and spread onto agar of low phosphate media (pH 7.0), and incubated for 48 hours at room temperature. The composition of the low phosphate media (LPM) were as follows: glucose (1%), (NH4)2.SO4 (0.3%), MgSO4.7H2O (0.05%), yeast extract (0.5%), NaCl (0.5%), Na2MoO4.2H2O (0.242% or 10 mM)

239

and Na2HPO4 (0.071% or 5 mM) (Yunus et al. 2009). The formations of blue colonies indicate molybdate reduction by molybdenum-reducing bacteria. Colony forming the strongest blue intensity was isolated and restreaked on low phosphate media (LPM) to obtain pure culture.

Molybdenum reduction in liquid media (at pH 7.0) was carried out in 100 mL of the above media in a 250 mL shake flask culture at room temperature for 48 hours on an orbital shaker set at 120 rpm with the same media above but the phosphate concentration increased to 100 mM. Molybdenum blue (Mo-blue) absorption spectrum was studied by taking out 1.0 mL of the Mo-blue formed from the liquid culture above and then centrifuged at 10,000 xg for 10 minutes at room temperature. Scanning of the supernatant was carried out from 400 to 900 nm using a UV-spectrophotometer (Shimadzu 1201).The low phosphate media was utilized as the baseline correction.

Morphological, physiological and biochemical characterization of the isolated strain Identification of the bacterium was carried out biochemically and phenotypically using standard methods such as colony shape, gram staining, size and color on nutrient agar plate, motility by the hanging drop method, oxidase (24 h), ONPG (beta-galactosidase), catalase production (24 h), ornithine decarboxylase (ODC), arginine dihydrolase (ADH), lysine decarboxylase (LDC), nitrates reduction, Methyl red, indole production, Voges-Proskauer (VP), hydrogen sulfide (H2S), acetate utilization, malonate utilization, citrate utilization (Simmons), esculin hydrolysis, tartrate (Jordans), gelatin hydrolysis, urea hydrolysis, deoxyribonuclease, lipase (corn oil), phenylalanine deaminase, gas production from glucose and production of acids from various sugars were carried out according to the Bergey’s Manual of Determinative Bacteriology (Holt et al. 1994). Interpretation of the results was carried out via the ABIS online system (Costin and Ionut 2015).

Preparation of resting cells for molybdenum reduction characterization Characterization works on molybdenum reduction to Mo-blue such as the effects of pH, temperature, phosphate and molybdate concentrations were carried out statically using resting cells in a microplate or microtiter format as previously developed (Shukor and Shukor 2014).Cells from a 1 L overnight culture grown in High Phosphate media (HPM) at room temperature on orbital shaker (150 rpm) with the only difference between the LPM and HPM was the phosphate concentration which was fixed at 100 mM for the HPM. Cells were harvested by centrifugation at 15,000 x g for 10 minutes and the pellet was washed several times to remove residual phosphate and resuspended in 20 mls of low phosphate media (LPM) minus glucose to an absorbance at 600 nm of approximately 1.00. In the low phosphate media, a concentration of 5 mM phosphate was optimal for all of the Mo-reducing bacteria isolated so far and hence this concentration was used in this work. Higher concentrations were found to be strongly inhibitory to molybdate

240

B I O D I V E R S IT A S 16 (2): 238-246, October 2015

reduction (Campbell et al. 1985; Shukor et al. 2007, 2008, 2009a, b,2010a, b; Rahman et al. 2009; Yunus et al.

2009;Lim et al. 2012; Ghani et al. 1993; Abo-Shakeer et al.

2013; Ahmad et al. 2013; Halmi et al. 2013; Othman et al.

2013;Khan et al. 2014). Then 180 µL was sterically pipetted into each well of a sterile microplate. 20 µL of sterile glucose from a stock solution was then added to each well to initiate Mo-blue production. A sterile sealing tape that allows gas exchange (Corning® microplate) was used for sealing the tape. The microplate was incubated at room temperature. At defined times absorbance at 750 nm was read in a BioRad (Richmond, CA) Microtiter Plate reader (Model No. 680). The production of Mo-blue from the media in a microplate format was measured using the specific extinction coefficient of 11.69 mM.-1.cm-1 at 750 nm as the maximum filter wavelength available for themicroplate unit was 750 nm (Shukor et al. 2003).

Effect of heavy metals on molybdenum reduction Seven heavy metals namely lead (ii), arsenic (v), copper (ii), mercury (ii), silver (i), chromium (vi) and cadmium (ii) were prepared from commercial salts or from Atomic Absorption Spectrometry standard solutions from MERCK. The bacterium was incubated with heavy metals in the microplate format at various concentrations. The plate was incubated for 24 hours at 30ºC. The amount of Mo-blue production was measured at 750 nm as before.

Screening of molybdenum reduction using detergents and hydrocarbon as source of electron donors and for growth The ability of detergents such as Sodium Dodecyl Sulfate (SDS) and Sodium Dodecyl Benzene Sulfonate (SDBS) and the hydrocarbon diesel to support growth to support molybdenum reduction as electron donors was tested using the microplate format above by replacing glucose from the low phosphate medium with these xenobiotics at the final concentration of 200 mg/L for detergents. Diesel was initially added to the final concentration of 0.5 g/L in 10 mL media and sonicated for 5 minutes. Then 200 uL of the media was added into the microplate wells. The microplate was incubated at room temperature for three days and the amount of Mo-blue production was measured at 750 nm as before. The ability of these xenobiotics to support bacterial growth independent of molybdenum reduction was tested using the microplate format above using the following media at the final concentration of 200 mg/L. The ingredients of the growth media (LPM) were as follows: (NH4)2.SO4 (0.3%), NaNO3 (0.2%), MgSO4.7H2O (0.05%), yeast extract (0.01%), NaCl (0.5%), Na2HPO4 (0.705% or 50 mM) and 1 mL of trace elements solution. The trace elements solution composition (mg/L) was as follows: CaCl2 (40), FeSO4·7H2O (40), MnSO4·4H2O (40), ZnSO4·7H2O (20), CuSO4·5H2O (5), CoCl2·6H2O (5), Na2MoO4·2H2O (5). The media was adjusted to pH 7.0.

Then 200 uL of the media was added into the microplate wells and incubated at room temperature for 72 hours. The increase of bacterial growth after an incubation period of 3 days at room temperature was measured at 600 nm using the microplate reader (Bio-Rad 680).

Statistical analysis Values are means ± SE. Data analyses were carried out using Graphpad Prism version 3.0 and Graphpad In Stat version 3.05 available from www.graphpad.com. A Student's t-test or a one-way analysis of variance with post hoc analysis by Tukey’s test was employed for comparison between groups. P < 0.05 was considered statistically significant.

RESULTS AND DISCUSSION Identification of molybdenum reducing bacterium strain AFt-7 was a rod-shaped, non-motile, gramnegative and facultative anaerobe bacterium. The bacterium was identified by comparing the results of cultural, morphological and various biochemical tests (Table 1) to the Bergey’s Manual of Determinative Bacteriology (Holt et al. 1994) and using the ABIS online software (Costin and Ionut 2015). The software gave three suggestions for the bacterial identity with the highest similarity or homology (96%) and accuracy (100%) as Klebsiella oxytoca. However, more work in the future especially molecular identification technique through comparison of the 16srRNA gene are needed to identify this species further. However, at this juncture the bacterium is tentatively identified as Klebsiella oxytoca strain Aft-7.

Previously, two molybdenum-reducing bacterium from this genus; Klebsiella oxytoca strain Dr.Y14 (Halmi et al. 2013) and Klebsiella oxytoca strain hkeem (Lim et al. 2012) have been isolated.

Table 1. Biochemical tests for Klebsiella oxytoca strain Aft-7 Motility ‒ Acid production from: Pigment ‒ Catalase production (24 h) + α-methyl-D-glucoside Oxidase (24 h) ‒ D-Adonitol ONPG (beta-galactosidase) + L-Arabinose Arginine dihydrolase (ADH) ‒ Cellobiose Lysine decarboxylase (LDC) + Dulcitol Ornithine decarboxylase (ODC) ‒ Glycerol Nitrates reduction + D-Glucose Methyl red + myo-Inositol Voges-Proskauer (VP) + Lactose Indole production + Maltose Hydrogen sulfide (H2S) ‒ D-Mannitol Acetate utilization + D-Mannose Malonate utilization + Melibiose Citrate utilization (Simmons) + Mucate Tartrate (Jordans) + Raffinose Esculin hydrolysis + L-Rhamnose Gelatin hydrolysis ‒ Salicin Urea hydrolysis + D-Sorbitol Deoxyribonuclease ‒ Sucrose (saccharose) Lipase (corn oil) ‒ Trehalose Phenylalanine deaminase ‒ D-Xylose Note: + positive result,− negative result, d indeterminate result

+ + + + + + + + + + + + + + + + + + + + +

MASDOR et al. –Potential bioremediation of Klebsiella oxytoca

In this work using this bacterium, a rapid and simple high throughput method involving microplate format was used to speed up characterization works and obtaining more data than the normal shake-flask approach (Iyamu et al. 2008; Shukor and Shukor 2014). The use of resting cells under static conditions to characterize molybdenum reduction in bacterium was initiated by (Ghani et al. 1993).

Resting cells have been used in studying heavy metals reduction such as in selenate (Losi and Frankenberger 1997), chromate (Llovera et al. 1993), vanadate (Carpentier et al. 2005) reductions and xenobiotics biodegradation such as diesel (Auffret et al. 2014), SDS (Chaturvedi and Kumar 2011), phenol (Sedighi and Vahabzadeh 2014), amides (Raj et al. 2010) and pentachlorophenol (Steiert et al.

1987).

Molybdenum absorbance spectrum The absorption spectrum of Mo-blue produced by Klebsiella oxytoca strain Aft-7 exhibited a shoulder at approximately 700 nm and a maximum peak near the infrared region of between 860 and 870 nm with a median at 865 nm (Figure 2). The identity of the Mo-blue is not easily ascertained as it is complex in structure and has many species (Shukor et al.2007). Briefly It has been suggested

by Campbell et al. (Campbell et al. 1985) that the Mo-blue observed in the reduction of molybdenum by Escherichia coli K12 is a reduced form of phosphomolybdate but did not provide a plausible mechanism. The Mo-blue spectrum from the phosphate determination method normally showed a maximum absorption around 880 to 890 nm and a shoulder around 700 to 720 nm (Hori et al. 1988). This spectrum is different from other heteropolymolybdates such as molybdosilicate and molybdosulphate (Figure 3).

We hypothesize that microbial molybdate reduction in media containing molybdate and phosphate must proceed via the phosphomolybdate intermediate and the conversion from molybdate to this structure occurs due to the reduction of pH during bacterial growth, in other words the reduction of molybdenum to Mo-blue requires both chemical and biological processes. The absorption spectrum of the Mo-blue from this bacterium if it goes through this mechanism should show a spectrum closely resembling the phosphate determination method. To be exact, the spectrum observed showed a maximum absorption in between 860 and 870 nm and a shoulder at approximately 700 nm. We have shown previously that the entire Mo-blue spectra from other bacteria obey this requirement (Shukor et al. 2007). In this work the result from the absorption spectrum clearly implies a similar spectrum and thus provides evidence for the hypothesis.

Exact identification of the phosphomolybdate species must be carried out using n.m.r and e.s.r. due to the complex structure of the compound (Chae et al. 1993). However, spectrophotometric characterization of heteropolymolybdate species via analyzing the scanning spectroscopic profile is a less cumbersome and accepted method (Glenn and Crane 1956; Sims 1961; Kazansky and Fedotov 1980; Yoshimura et al. 1986). Although the maximum absorption wavelength for Mo-blue was 865 nm, measurement at 750 nm, although was approximately 30% lower, was enough

241

for routine monitoring of Mo-blue production as the intensity obtained was much higher than cellular absorption at 600-620 nm (Shukor and Shukor 2014). Previous monitoring of Mo-blue production uses several wavelengths such as 710 nm (Ghani et al. 1993) and 820 nm (Campbell et al. 1985).

Effect of pH and temperature on molybdate reduction Klebsiella oxytoca strain Aft-7 was incubated at different pH ranging from 5.5 to 8.0 using Bis-Tris and Tris.Cl buffers (20 mM). Analysis by ANOVA showed that the optimum pH for reduction was between 5.8 and 6.3.

Inhibition of reduction was dramatic at pH lower than 5 (Figure 4). The effect of temperature (Figure 5) was observed over a wide range of temperature (20 to 60°C) with an optimum temperature ranging from 25 to 34°C with no significant different (p>0.05) among the values measured as analyzed using ANOVA. Temperatures lower than 30°C and higher than 37oC were strongly inhibitory to Mo-blue production from Klebsiella oxytoca strain Aft-7.

Temperature and pH play important roles in molybdenum reduction, since this process is enzyme mediated, both parameters affect protein folding and enzyme activity causing the inhibition of molybdenum reduction. The optimum conditions would be an advantage for bioremediation in a tropical country like Malaysia which have average yearly temperature ranging from 25 to 35oC (Shukor et al. 2008). Therefore, Klebsiella oxytoca strain Aft-7 could be a candidate for soil bioremediation of molybdenum locally and in other tropical countries. The majority of the reducers shows an optimal temperature of between 25 and 37ºC (Shukor et al. 2008, 2009a,2010a, b, 2014; Rahman et al. 2009; Yunus et al. 2009; Lim et al.

2012; Abo-Shakeer et al. 2013; Othman et al. 2013; Halmi et al. 2013; Khan et al. 2014)as they are isolated from tropical soils with the only psychrotolerant reducer isolated from Antartica showing an optimal temperature supporting reduction of between 15 and 20ºC (Ahmad et al. 2013).

The optimal pH range exhibited by Klebsiella oxytoca strain Aft-7 for supporting molybdenum reduction reflects the property of the bacterium as a neutrophile. The characteristics neutrophiles are their ability to grow between pH 5.5 and 8.0. An important observation regarding molybdenum reduction in bacteria is the optimal pH reduction is slightly acidic with optimal pHs ranging from pH 5.0 to 7.0 (Campbell et al. 1985; Ghani et al.

1993; Shukor et al. 2008,2009a,2010a, b,2014; Rahman et al. 2009; Lim et al. 2012; Abo-Shakeer et al. 2013; Ahmad et al. 2013; Halmi et al. 2013; Othman et al. 2013; Khan et al. 2014). It has been suggested previously that acidic pH plays an important role in the formation and stability of phosphomolybdate before it is being reduced to Mo-blue.

Thus, the optimal reduction occurs by balancing between enzyme activity and substrate stability (Shukor et al. 2007).

Effect of electron donor on molybdate reduction Among the electron donor tested, glucose was the best electron donor for supporting molybdate reduction followed by sucrose, D-mannitol, D-sorbitol, lactose, salicin, trehalose, maltose and myo-Inositol in descending

242

B I O D I V E R S IT A S 16 (2): 238-246, October 2015

order (Figure 6). Other carbon sources did not support molybdenum reduction. Previous works by Shukor et al. demonstrated that several of Mo-reducing bacteria such as Enterobacter cloacae strain 48 (Ghani et al. 1993), Serratia sp. strain Dr.Y5 (Rahman et al. 2009), S. marcescens strain Dr.Y9 (Yunus et al. 2009) and Serratia marcescens strain DRY6 (Shukor et al. 2008) showed sucrose as the best carbon source. Other molybdenum reducers such as Escherichia coli K12 (Campbell et al. 1985), Serratia sp. strain Dr.Y5 (Rahman et al. 2009), Pseudomonas sp. strain DRY2 (Shukor et al. 2010a), Pseudomonas sp. strain DRY1 (Ahmad et al. 2013), Enterobacter sp. strain Dr.Y13 (Shukor et al. 2009a), Acinetobacter calcoaceticus strain Dr.Y12 (Shukor et al. 2010b), Bacillus pumilus strain lbna (Abo-Shakeer et al. 2013) and Bacillus sp. strain A.rzi (Othman et al. 2013) prefer glucose as the carbon source while Klebsiella oxytoca strain hkeem prefers fructose (Lim et al. 2012). In the presence of carbon sources in the media, the bacteria could produce electron donating substrates, NADH and NADPH thorough metabolic pathways such as glycolysis, Krebâ&#x20AC;&#x2122;s cycle and electron transport chain. Both NADH and NADPH are responsible as the electron donating substrates for molybdenum reducing-enzyme (Shukor et al. 2008,2014).

Effect of phosphate and molybdate concentrations to molybdate reduction The determination of phosphate and molybdate concentrations supporting optimal molybdenum reduction is important because both anions have been shown to inhibit Mo-blue production in bacteria (Shukor et al. 2008, 2009b, 2010a, 2014; Yunus et al. 2009; Lim et al. 2012; Ahmad et al. 2013; Othman et al. 2013). The optimum concentration of phosphate occurred between 5.0 and 7.5 mM with higher concentrations were strongly inhibitory to reduction (Figure 7). High phosphate was suggested to inhibit phosphomolybdate stability as the complex requires acidic conditions of which the higher the phosphate concentration the stronger buffering power of the phosphate buffer used. In addition, the phosphomolybdate complex itself is unstable in the presence of high phosphate through an unknown mechanism (Glenn and Crane 1956;

Sims 1961; Shukor et al. 2000). All of the molybdenumreducing bacterium isolated so far requires phosphate concentration not higher than 5 mM for optimal reduction (Campbell et al. 1985; Ghani et al. 1993; Shukor et al.

2008, 2009b, 2010a, b, 2014; Rahman et al. 2009; Lim et al. 2012; Abo-Shakeer et al. 2013; Ahmad et al. 2013; Halmi et al. 2013; Othman et al. 2013; Khan et al. 2014).

Studies on the effect of molybdenum concentration on molybdenum reduction showed that the newly isolated bacterium was able to reduce molybdenum as high as 60 mM but with reduced Mo-blue production. The optimal reduction range was between 5 and 20 mM (Figure 8).

Reduction at this high concentration into an insoluble form would allow the strain to reduce high concentration of molybdenum pollution. The lowest optimal concentration of molybdenum reported is 15 mM in Pseudomonas sp strain Dr.Y2 (Shukor et al. 2010a), whilst the highest molybdenum required for optimal reduction was 80 mM in Escherichia coli K12 (Campbell et al. 1985) and Klebsiella oxytoca strain hkeem (Lim et al. 2012). Other Mo-reducing bacteria such as EC48 (Ghani et al. 1993), S. marcescens strain Dr.Y6 (Shukor et al. 2008), S. marcescens. Dr.Y9 (Yunus et al. 2009), Pseudomonas sp. strain Dr.Y2 (Shukor et al. 2010a), Serratia sp. strain Dr.Y5 (Rahman et al.

2009), Enterobacter sp. strain Dr.Y13 (Shukor et al. 2009a) and Acinetobacter calcoaceticus (Shukor et al. 2010b) could produce optimal Mo-blue using the optimal molybdate concentrations at 50, 25, 55, 30, 30, 50 and 20 mM, respectively. In fact the highest concentration of molybdenum as a pollutant in the environment is around 2000 ppm or about 20 mM (Runnells et al. 1976).

Effect of heavy metals Molybdenum reduction was inhibited by mercury (ii), silver (i) and copper (ii) at 2 ppm by 62.1, 33.9 and 33.6%, respectively (Figure 9). The inhibition effects by others metal ions and heavy metals present a major problem for bioremediation. Therefore it is important to screen and isolate bacteria with as many metal resistance capability.

As described previously (Shukor et al. 2002), mercury is a physiological inhibitor to molybdate reduction. A summary

Table 2. Inhibition of Mo-reducing bacteria by heavy metals Bacteria

Heavy metals that inhibit reduction

Author

Acinetobacter calcoaceticus strain Dr.Y12 Bacillus pumilus strain lbna Bacillus sp. strain A.rzi Enterobacter cloacae strain 48 Enterobacter sp. strain Dr.Y13 Escherichia coli K12 Klebsiella oxytoca train hkeem Pseudomonas sp. strain DRY1 Pseudomonas sp. strainDRY2 Serratia marcescens strain Dr.Y9 Serratia marcescens strain DRY6 Serratia sp. strain Dr.Y5 Serratia sp. strain Dr.Y8

Cd2+, Cr6+, Cu2+, Pb2+, Hg2+ As3+, Pb2+, Zn2+, Cd2+, Cr6+, Hg2+, Cu2+ Cd2+, Cr6+, Cu2+,Ag+, Pb2+, Hg2+, Co2+,Zn2+ Cr6+, Cu2+ Cr6+, Cd2+, Cu2+, Ag+, Hg2+ Cr6+ Cu2+, Ag+, Hg2+ Cd2+, Cr6+, Cu2+,Ag+, Pb2+, Hg2+ Cr6+, Cu2+, Pb2+, Hg2+ Cr6+, Cu2+, Ag+, Hg2+ Cr6+, Cu2+, Hg2+* n.a.

Cr, Cu, Ag, Hg

Shukor et al. (2010b) Abo-Shakeer et al. (2013) Othman et al. (2013) Ghani et al. (1993) Shukor et al. (2009a) Campbell et al. (1985) Lim et al. (2012) Ahmad et al. (2013) Shukor et al. (2010a) Yunus et al. (2009) Shukor et al. (2008) Rahman et al. (2009) Shukor et al. (2009b)

MASDOR et al. –Potential bioremediation of Klebsiella oxytoca

3.0

48 h

243

0.5

0.3 C

32 h B

Abs

Abs

0.25

0.3

0.2

Abs Abs

0.4

24 h

2.0

A

8h 1.0

0.2

0.15

0.1

0.0 600

650

700

750

800

850

900

0.1 500

950

600

800

900

1000

Wavelength (nm) Wavelength (nm)

Wavelength (nm)

Figure 2. Scanning absorption spectrum of Mo-blue from Klebsiella oxytoca strain Aft-7 at different time intervals.

Figure 3. Scanning spectra of Mo-blue from molybdosilicate (A), molybdosulphate (B) and molybdophosphate (C) (from Shukor et al. 2000).

3.0

3.0

2.0

2.0

Abs 750 nm

Abs 750 nm

700

1.0

1.0

0.0

0.0 5.5

6.0

6.5

7.0

7.5

10

8.0

20

30

40

50

60

o

Temperature ( C)

pH

Figure 4. Effect of pH on molybdenum reduction by Klebsiella oxytoca strain Aft-7. Resting cells of the bacterium were incubated in a microtiter plate under optimized conditions for 48 hours. Error bars represent mean ± standard deviation (n=3).

Figure 5. Effect of temperature on molybdenum reduction by Klebsiella oxytoca strain Aft-7. Resting cells of the bacterium were incubated in a microtiter plate under optimized conditions for 48 hours. Error bars represent mean ± standard deviation (n=3).

Abs 750 nm

3.0

2.0

1.0

LAr ab in C ose el lo bi L-Arabinose os D e ul Cellobiose cit o G ly l Dulcitol D cer -G ol l m uco Glycerol yo s -In e os D-Glucose i to La l ct myo-Inositol os M e a Lactose D l tos -M e a Maltose D nn -M i to an l D-Mannitol n M os e el ib D-Mannose R i ose a L- ffi n Melibiose o R ha se m Raffinose no se Sa L-Rhamnose D l ic in -S or Salicin b Su ito l cr D-Sorbitol Tr ose eh Sucrose al os D -X e Trehalose yl os C e on D-Xylose tro l

Control

0.0

Figure 6. Effect of different electron donor sources (1% w/v) on molybdenum reduction. Klebsiella oxytoca strain Aft-7 was grown in low phosphate media containing 10 mM molybdate and various electron donors. Resting cells of the bacterium were incubated in a microtiter plate under optimized conditions for 48 hours. Error bars represent mean ± standard deviation (n = 3).

Figure 9. Effect of metals on Mo-blue production by Klebsiella oxytoca strain Aft-7. Resting cells of the bacterium were incubated in a microtiter plate under optimized conditions for 48 hours. Error bars represent mean ± standard deviation (n = 3).

B I O D I V E R S IT A S 16 (2): 238-246, October 2015

2.0

2.0

1.5

1.5

Abs 750 nm

Abs 750 nm

244

1.0

0.5

0.5

0.0

0.0 0

10

20

30

40

0

50

Figure7. Effect of phosphate concentration on molybdenum reduction by Klebsiella oxytoca strain Aft-7. Resting cells of the bacterium were incubated in a microtiter plate under optimized conditions for 48 hours. Error bars represent mean ± standard deviation (n = 3).

1.2 1.0 0.8 0.6 0.4 0.2

Crude petroleum

se l pe tr ol Diesel eu m de

C chloride D Benzalkonium ru ie

on SD iu S m en ch za loSDS lk rid on e iu m ch lo Benzethonium chloride ri de B

S B

SDBS

en ze th

SD

Witconol 2301

B

on tr ol

Te rg Control ito lN P Te 9 rg ito NP9 Tergitol l1 5S W 9 itc Tergitolon15 ol S9 23 01

0.0 C

20

40

60

80

Molybdate (mM)

Phosphate (mM)

Abs 600 nm

1.0

Figure 10. Growth of Klebsiella oxytoca strain Aft-7 on xenobiotics independent of molybdenum reduction. Resting cells of the bacterium were incubated in a microtiter plate under optimized conditions for 48 hours. Error bars represent mean ± standard deviation (n = 3).

of the type of heavy metals that inhibited Mo-reducing bacteria showed that almost all of the reducers are inhibited by toxic heavy metals (Table 2). Heavy metals such as mercury, cadmium, silver and copper usually target sulfhydryl group of enzymes (Sugiura and Hirayama 1976).

Chromate is known to inhibit certain enzymes such as glucose oxidase (Zeng et al. 2004) and enzymes of nitrogen metabolism in plants (Sangwan et al. 2014). Binding of heavy metals inactivated metal-reducing capability of the enzyme(s) responsible for the reduction.

Detergents and hydrocarbons as electron donor sources for molybdenum reduction and independent growth Screening of detergents and hydrocarbons as electron donors supporting molybdenum reduction failed to give

Figure 8. Effect of molybdate concentration on molybdenum reduction by Klebsiella oxytoca strain Aft-7. Resting cells of the bacterium were incubated in a microtiter plate under optimized conditions for 48 hours. Error bars represent mean ± standard deviation (n = 3).

positive results (data not shown). However, the bacterium was able to grow on the detergent SDS (Figure 10). SDSdegrading bacteria are ideal for SDS remediation due to economic factors. Microbes are known for their ability to degrade organics including SDS and their use as bioremediation agents is important for economical removal of xenobiotic pollutants (Syed et al. 2010). Biodegradation of anionic surfactant under aerobic conditions by the bacterium Pseudomonas sp. strain C12B was among the first to be studied (Payne and Feisal 1963), and to date quite a number of SDS-degrading bacteria have been isolated and characterized (Thomas and White 1990; Lee et al. 1995; Kostal et al. 1998; Roig et al. 1998; Dhouib et al.

2003; Ke et al. 2003; Yin et al. 2005; Wu 2006; Khleifat et al. 2010; Asok and Jisha 2013; Chaturvedi and Kumar 2013,2014; Cortés-Lorenzo et al. 2013; Halmi et al. 2013; Venkatesh 2013; Yilmaz and Icgen 2014). Works on coldadapted microbes with ability to degrade SDS are rare, and were first reported by Margesin and Schinner (1998).The existence of multitude of bacteria with detergent-degrading ability makes bioremediation the more ideal method for detergent degradation. However, very few bacteria have been reported to be able to degrade xenobiotics and detoxify heavy metals, and the ability of this bacterium to do both suggest that this bacterium will be very useful as a bioremediation agent in polluted sites co-contaminated with xenobiotics and heavy metals.

In conclusion, a local isolate of Mo-reducing bacterium with the novel ability to degrade SDS has been isolated.

This is the first report of a molybdenum reducing bacterium with the ability to degrade SDS. The ability of this bacterium to detoxify multiple toxicants is a sought after property, and this makes the bacterium an important tool for bioremediation. Currently, work is underway to purify the molybdenum-reducing enzyme from this bacterium and to characterize the detergent degradation studies in more detail.

MASDOR et al. –Potential bioremediation of Klebsiella oxytoca

ACKNOWLEDGEMENTS This project was supported by funds from Snoc International Sdn. Bhd., Malaysia

REFERENCES Abo-Shakeer, LK.A, Ahmad SA, Shukor MY, Shamaan NA, Syed MA. 2013. Isolation and characterization of a molybdenum-reducing Bacillus pumilus strain lbna. JEMAT 1 : 19-14.

Ahmad SA, Shukor MY, Shamaan NA, Mac Cormack WP, Syed MA. 2013. Molybdate reduction to molybdenum blue by an antarctic bacterium. Biomed Res Int DOI: 10.1155/2013/871941.

Ahmad-Panahi H, Hosseinzadeh M, Adinehlo H, Moniri E, Manoochehri M. 2014. Removal of molybdenum from environmental sample by adsorption using modified aniline-formaldehyde with salicylic acid.

World Appl Sci J 30: 1892-1898.

Anu M, Gnana TVS, Reshma JK. 2010. Simultaneous phenol degradation and chromium (VI) reduction by bacterial isolates. Res J Biotechnol 5: 46-49.

Asok AK., Jisha MS. 2013. Molecular characterization of linear alkylbenzene sulphonate degrading Pseudomonas nitroreducens (MTCC 10463) and P. Aeruginosa (MTCC 10462). Indian J Biotechnol 12: 514-522.

Auffret MD, Yergeau E, Labbé D, Fayolle-Guichard F, Greer CW. 2014.

Importance of Rhodococcus strains in a bacterial consortium degrading a mixture of hydrocarbons, gasoline, and diesel oil additives revealed by metatranscriptomic analysis. Appl. Microbiol Biotechno 99: 2419-2430.

Bhattacharya A, Gupta A, Kaur A, Malik D. 2014. Efficacy of Acinetobacter sp. B9 for simultaneous removal of phenol and hexavalent chromium from co-contaminated system. Appl. Microbiol Biotechno 98: 9829-9841.

Bi CM, Zhang YL, Liu FJ, Zhou TZ, Yang ZJ, Gao SY, Wang S. 2013.

The effect of molybdenum on the in vitro development of mouse preimplantation embryos. Syst Biol Reprod Med 59: 69-73.

Campbell AM, Campillo-Campbell AD, Villaret DB. 1985. Molybdate reduction by Escherichia coli K-12 and its chl mutants. Proc Natl Acad Sci 82: 227-231.

Carpentier W, Smet LD, Beeumen JV, Brigé A. 2005. Respiration and growth of Shewanella oneidensis MR-1 using vanadate as the sole electron acceptor. J Bacteriol 187: 3293-3301.

Chae HK., Klemperer WG, Marquart TA. 1993. High-nuclearity oxomolybdenum(V) complexes'. Coord Chem Rev 128: 209-224.

Chaturvedi V, Kumar A. 2011. Diversity of culturable sodium dodecyl sulfate (SDS) degrading bacteria isolated from detergent contaminated ponds situated in Varanasi city, India. Int Biodeterioration Biodegrad 65: 961-971.

Chaturvedi V, Kumar A. 2013. Presence of SDS-degrading enzyme, alkyl sulfatase (SdsA1) is specific to different strains of Pseudomonas aeruginosa. Process Biochem 48: 688-693.

Chaturvedi V, Kumar A. 2014. Metabolism dependent chemotaxis of Pseudomonas aeruginosa N1 towards anionic detergent Sodium Dodecyl Sulfate. Indian J Microbiol 54: 134-138.

Chaudhari AU, Tapase SR, Markad VL, Kodam KM. 2013. Simultaneous decolorization of reactive Orange M2R dye and reduction of chromate by Lysinibacillus sp. KMK-A. J Hazard Mater 262: 580588.

Cortés-Lorenzo C, Sánchez-Peinado MDM, Oliver-Rodríguez B ,Vílchez JL, González-López JJ, Rodríguez-Díaz M. 2013. Two novel strains within the family Caulobacteraceae capable of degradation of linear alkylbenzene sulfonates as pure cultures. Int Biodeter Biodegr 85: 6265.

Costin S, Ionut S. 2015. ABIS online-bacterial identification software, http: //www.tgw1916.net/bacteria_logare.html, database version: Bacillus 022012-2.10. [March 2015].

Cserháti T, Forgács E, Oros G. 2002. Biological activity and environmental impact of anionic surfactants. Environ Int 28: 337-348.

Davis GK. 1991. Molybdenum. In: Merian E (ed.), Metals and their Compounds in the Environment, Occurrence, Analysis and Biological Relevance. VCH Weinheim, New York.

245

Dhouib A, Hamad N, Hassaïri I, Sayadi S. 2003.Degradation of anionic surfactants by Citrobacter braakii. Process Biochem 38: 1245-1250.

Ghani B, Takai M, Hisham NZ, Kishimoto N, Ismail AKM, Tano T, Sugio T. 1993. Isolation and characterization of a Mo6+-reducing bacterium. Appl Environ MicroB 59: 1176-1180.

Glenn JL, Crane FL. 1956. Studies on metalloflavoproteins. V. The action of silicomolybdate in the reduction of cytochrome c by aldehyde oxidase. Biochim Biophys Acta 22: 11-115.

Halmi MIE, Hussin WSW, Aqlima A, Syed MA., Ruberto L, MacCormack WP, Shukor M. Y. 2013. Characterization of a sodium dodecyl sulphate-degrading Pseudomonas sp. strain DRY15 from Antarctic soil. J Enviro Biol 34: 1077-1082.

Halmi MIE, Zuhainis SW, Yusof MT, Shaharuddin NA, Helmi W, Shukor Y, Ahmad SA. 2013. Hexavalent molybdenum reduction to Mo-blue by a Sodium-Dodecyl-Sulfate-degrading Klebsiella oxytoca strain DRY14. Biomed Res Int 2013, e384541. DOI: 10.1155/2013/384541 Holt JG, Krieg NR, Sneath PHA, Staley JT, Williams ST. 1994. Bergey’s Manual of Determinative Bacteriology. Williams & Wilkins, Baltimore.

Hori T, Sugiyama M, Himeno S. 1988. Direct spectrophotometric determination of sulphate ion based on the formation of a blue molybdosulphate complex. The Analyst 113: 1639-1642.

Ianieva OD, Smirnova GF. 2014. Vanadate reduction by Pseudomonas aeruginosa strains. Mikrobiolohichnyi Zhurnal (Kiev, Ukraine : 1993) 76: 31-35.

Iyamu EW, Asakura T, Woods GM. 2008. A colorimetric microplate assay method for high-throughput analysis of arginase activity in vitro. Anal Biochem 383: 332-334.

Kang C, Wu P, Li Y, Ruan B, Zhu N, Dang, Z. 2014. Estimates of heavy metal tolerance and chromium(VI) reducing ability of Pseudomonas aeruginosa CCTCC AB93066: chromium(VI) toxicity and environmental parameters optimization. World J Microb Biot 30: 2733-2746.

Kazansky LP, Fedotov MA. 1980. Phosphorus-31 and oxygen-17 N.M.R. evidence of trapped electrons in reduced 18-molybdodiphosphate(V), P2Mo18O62 8-. J Chem Soc Chem Commun 14: 644-646.

Ke N, Xiao C, Ying Q, Ji S. 2003. A new species of the genus Phenylobacterium for the degradation of LAS (linear alkylbenzene sulfonate). Acta Microbiologica Sinica 43: 1-7.

Khan A, Halmi MIE, Shukor MY 2014. Isolation of Mo-reducing bacterium in soils from Pakistan. J Enviro Microbiol Toxicol 2: 3841.

Khleifat KM, Halasah RA, Tarawneh KA, Halasah Z, Shawabkeh R, Wedyan MA. 2010. Biodegradation of linear alkylbenzene sulfonate

by Burkholderia sp.:Effect of some growth conditions. Int J Agr Biol 12: 17-25.

Kincaid RL. 1980. Toxicity of ammonium molybdate added to drinking water of calves. J Dairy Sci 63: 608-610.

Kostal, J, Suchanek M, Klierova H, Demnerova K., Kralova B, McBeth DL. 1998. Pseudomonas C12B, an SDS degrading strain, harbours a plasmid coding for degradation of medium chain length n-alkanes. Int Biodeter Biodegr 42: 221-228.

Lahann RW. 1976. Molybdenum hazard in land disposal of sewage sludge. Water, Air, Soil Poll, 6: 3-8.

Lee C, Russell NJ, White GF. 1995. Modelling the kinetics of biodegradation of anionic surfactants by biofilm bacteria from polluted riverine sites: A comparison of five classes of surfactant at three sites. Water Res 29: 2491-2497.

Lim HK., Syed MA, Shukor MY. 2012. Reduction of molybdate to molybdenum blue by Klebsiella sp. strain hkeem. J. Basic Microbiol 52: 296-305.

Liwarska-Bizukojc E, Miksch K., Malachowska-Jutsz A, Kalka J. 2005.

Acute toxicity and genotoxicity of five selected anionic and nonionic surfactants. Chemosphere 58: 1249-1253.

Llovera S, Bonet R, Simon-Pujol MD, Congregado F. 1993. Chromate reduction by resting cells of Agrobacterium radiobacter EPS-916.

Appl Environ Microbiol 59: 3516-3518.

Losi ME, Frankenberger Jr WT. 1997. Reduction of selenium oxyanions

by Enterobacter cloacae strain SLD1a-1: Reduction of selenate to selenite. Environ Toxicol Chem 16: 1851-1858.

Margesin R, Schinner F. 1998. Biodegradation of the anionic surfactant sodium dodecyl sulfate at low temperatures. Int Biodeter Biodegr 41: 139-143.

Meeker JD, Rossano MG, Protas B, Diamond MP, Puscheck E, Daly D, Wirth JJ. 2008. Cadmium, lead, and other metals in relation to semen

246

B I O D I V E R S IT A S 16 (2): 238-246, October 2015

quality: Human evidence for molybdenum as a male reproductive toxicant. Environ Health Persp 116: 1473-1479.

Neunhäuserer C, Berreck M, Insam H. 2001. Remediation of soils contaminated with molybdenum using soil amendments and phytoremediation. Water Air Soil Poll 128: 85-96.

Othman AR, Bakar NA, Halmi MIE, Johari WLW, Ahmad SA, Jirangon H, Shukor MY. 2013. Kinetics of molybdenum reduction to molybdenum blue by Bacillus sp. strain A.rzi. Biomed Res Int 2013.

DOI: 10.1155/2013/371058.

Payne WJ, Feisal VE. 1963. Bacterial utilization of dodecyl sulfate and dodecyl benzene sulfonate. Appl Microbiol 11: 339-344.

Pettersson A, Adamsson M,, Dave G. 2000. Toxicity and detoxification of Swedish detergents and softener products. Chemosphere 41: 16111620.

Rahman MFA, Shukor MY, Suhaili Z, Mustafa S, Shamaan NA, Syed MA. 2009. Reduction of Mo(VI) by the bacterium Serratia sp. strain DRY5. J Enviro Biol 30: 65-72.

Raj J, Prasad S, Sharma NN, Bhalla TC. 2010. Bioconversion of acrylonitrile to acrylamide using polyacrylamide entrapped cells of Rhodococcus rhodochrous PA-34. Folia Microbiol 55: 442-446.

Rieger PG, Meier HM, Gerle M, Vogt U, Groth T, Knackmuss HJ. 2002.

Xenobiotics in the environment: Present and future strategies to obviate the problem of biological persistence. J Biotechnol 94: 101123.

Roig MG, Pedraz MA, Sanchez JM, Huska J, TĂłth D. 1998. Sorption isotherms and kinetics in the primary biodegradation of anionic surfactants by immobilized bacteria: II. Comamonas terrigena N3H. J. Mol. Catal - B Enzymatic 4: 271-281.

Rosety M, Ribelles A, Rosety-Rodriguez M, Carrasco C, Ordonez FJ, Rosety JM,, Rosety Plaza M. 2000. Morpho-histochemical study of the biological effects of sodium dodecyl sulphate on the digestive gland of the Portuguese oyster. Histol Histopathol 15: 1137-1143.

Runnells DD, Kaback DS, Thurman EM, Chappel WR, Peterson KK. 1976. Geochemistry and sampling of molybdenum in sediments, soils, and plants in Colorado. In: Chappel WR, Peterson KK (eds).

Molybdenum in the Environment. Marcel Dekker, New York, NY, USA. Sangwan P, Kumar V, Joshi UN. 2014. Effect of chromium(VI) toxicity on enzymes of nitrogen metabolism in clusterbean (Cyamopsis tetragonoloba L.).

Enzyme Research 2014.

DOI: 10.1155/2014/784036 Sedighi M, Vahabzadeh F. 2014. Kinetic Modeling of cometabolic degradation of ethanethiol and phenol by Ralstonia eutropha.

Biotechnol Bioprocess Eng 19: 239-249.

Shukor MS, Shukor MY. 2014. 'A microplate format for characterizing the growth of molybdenum-reducing bacteria. J Environ Microbiol Toxicol 2 (2): 1-3.

Shukor MY, Ahmad SA, Nadzir MMM, Abdullah MP, Shamaan NA, Syed MA. 2010a. Molybdate reduction by Pseudomonas sp. strain DRY2. J Appl Microbiol 108: 2050-2058.

Shukor MY, Habib SHM, Rahman MFA, Jirangon H, Abdullah MPA, Shamaan N.A, Syed MA. 2008. Hexavalent molybdenum reduction to molybdenum blue by S. marcescens strain Dr. Y6. Appl Biochem Biotechnol 149: 33-43.

Shukor MY, Halmi MIE, Rahman MFA, Shamaan NA., Syed MA. 2014.

Molybdenum reduction to molybdenum blue in Serratia sp. strain DRY5 is catalyzed by a novel molybdenum-reducing enzyme.

Biomed Res Int 2014. DOI: 10.1155/2014/853084 Shukor MY, Lee CH, Omar I, Karim MIA, Syed MA, Shamaan NA. 2003. Isolation and characterization of a molybdenum-reducing enzyme in Enterobacter cloacae strain 48. Pertanika J. Sci. Technol 11: 261-272.

Shukor MY, Rahman MF, Shamaan NA, Syed MS. 2009a. Reduction of molybdate to molybdenum blue by Enterobacter sp. strain Dr.Y13. J. Basic Microbiol 49: 43-54.

Shukor MY, Rahman MF, Suhaili Z, Shamaan NA, Syed MA. 2009b.

Bacterial reduction of hexavalent molybdenum to molybdenum blue.

World J Microbiol Biotechnol 5: 1225-1234.

Shukor MY, Rahman MF, Suhaili Z, Shamaan NA, Syed MA. 2010b.

Hexavalent molybdenum reduction to Mo-blue by Acinetobacter calcoaceticus. Folia Microbiol 55: 137-143.

Shukor MY, Rahman MFA, Shamaan NA, Lee CH, Karim MIA, Syed MA. 2008. An improved enzyme assay for molybdenum-reducing activity in bacteria. Appl Biochem Biotechnol 144: 293-300.

Shukor MY, Shamaan NA, Syed MA, Lee CH, Karim MIA. 2000.

Characterization and quantification of molybdenum blue production in Enterobacter cloacae strain 48 using 12-molybdophosphate as the reference compound. Asia Pac J Mol Biol Biotechnol 8: 167-172.

Shukor Y, Adam H, Ithnin K, Yunus I, Shamaan NA, Syed A. 2007.

Molybdate reduction to molybdenum blue in microbe proceeds via a phosphomolybdate intermediate. J Biol Sci 7: 1448-1452.

Sims RPA. 1961. Formation of heteropoly blue by some reduction procedures used in the micro-determination of phosphorus. Analyst.

86: 584-590.

Steiert JG, Pignatello JJ, Crawford RL. 1987. Degradation of chlorinated phenols by a pentachlorophenol-degrading bacterium. Appl Environ Microbiol 53: 907-910.

Sugiura Y, Hirayama Y. 1976. Structural and electronic effects on complex formation of copper(II) and nickel(II) with sulfhydrylcontaining peptides. Inorg. Chem 15: 679-682.

Syed MA, Mahamood M, Shukor MY, Shamaan NA. 2010. Isolation and characterization of SDS-degrading Pseudomonas aeruginosa sp. strain D1. Aust. j. basic appl. sci. 4: 5000-5011.

Thomas ORT, White GF. 1990. Immobilization of the surfactantdegrading bacterium Pseudomonas C12B in polyacrylamide gel. II. Optimizing SDS-degrading activity and stability. Enzyme Microb Tech 12: 969-975.

Underwood EJ. 1979. Environmental sources of heavy metals and their toxicity to man and animals. In: International Conference on Development in Land Methods of Wastewater Treatment and Utilization 11: 33-45.

Venkatesh C. 2013. A plate assay method for isolation of bacteria having potent Sodium Dodecyl Sulfate (SDS) degrading ability. Res J Biotechnol 8: 27-31.

Wu C. 2006. Isolation and characterization of a sodium dodecyl benzene sulfonate degrading bacterial strain. Acta Microbiol Sin 46: 988-993.

Yilmaz F, Icgen B. 2014. Characterization of SDS-degrading Delftia acidovorans and in situ monitoring of its temporal succession in SDScontaminated surface waters. Environ Sci Pollut Res 21: 7413-7424.

Yin J, Li J, Wang X, Wang F, Wang J, Zhang B, Chao F. 2005. Isolation of linear alkylbenzene sulfonate(LAS)-degrading bacterium and its degrading characters. Chin J Appl Environ Biol 11 : 483-485.

Yoshimura K, Ishii M, Tarutani T. 1986. Microdetermination of phosphate in water by gel-phase colorimetry with molybdenum blue.

Anal Chem 58: 591-594.

Yunus, SM, Hamim HM, Anas OM, Aripin SN, Arif SM. 2009. Mo (VI) reduction to molybdenum blue by Serratia marcescens strain Dr. Y9.

Pol J Microbiol 58: 141-147.

Zeng GM, Tang L, Shen GL, Huang GH, Niu CG. 2004. Determination of trace chromium(VI) by an inhibition-based enzyme biosensor incorporating an electropolymerized aniline membrane and ferrocene as electron transfer mediator. Int. J Environ Anal Chem 84: 761-774.

Zhai XW, Zhang YL, Qi Q, Bai Y, Chen XL, Jin LJ, Liu FJ. 2013. Effects of molybdenum on sperm quality and testis oxidative stress. Syst Biol Reprod Med 59: 251-255.

Zhang YL, Liu FJ, Chen XL, Zhang ZQ, Shu R Z, Yu XL, Liu ZJ. 2013.

Dual effects of molybdenum on mouse oocyte quality and ovarian oxidative stress. Syst Biol Reprod Med 59: 312-318.

B I O D I V E R S IT A S Volume 16, Number 2, October 2015 Pages: 247-253

ISSN: 1412-033X E-ISSN: 2085-4722 DOI: 10.13057/biodiv/d160220

Assessment of genetic diversity among soursop (Annona muricata) populations from Java, Indonesia using RAPD markers SURATMANâ&#x2122;Ľ, ARI PITOYO, SRI MULYANI, SURANTO Department of Biology, Faculty of Mathematics and Natural Sciences, Sebelas Maret University. Jl. Ir. Sutami 36A Surakarta 57126, Central Java, Indonesia. Tel./Fax. +62-271-663375, ď&#x201A;Šemail: suratmanmipauns@yahoo.com Manuscript received: 21 April 2015. evision accepted: 19 September 2015.

Abstract. Suratman, Ari Pitoyo, Sri Mulyani, Suranto. 2015. Assessment of genetic diversity among soursop (Annona muricata) populations from Java, Indonesia using RAPD markers. Biodiversitas 16: 247-253. The objective of this study was to determine genetic diversity of the soursop (Annona muricata L.) populations from Java (Indonesia) using RAPD markers. A total of 70 individuals were collected from 7 soursop populations, distributed along the geographical range of natural distribution in Java. Genetic diversity was estimated by RAPD technique using 6 arbitrary selected primers. Those primers produced 151 polymorphic bands with the percentage of polymorphism for each primer ranged from 95% to 100%. The genetic diversity value (h) within each population ranged from 0.0418 to 0.0525. The highest h value (0.0525) was found in the KRA population whereas the lowest h value was observed in the PCT population. The highest genetic distance value (0.0410) was observed in SKH-GKD populations pair whereas the lowest genetic distance value (0.02448) was estimated in KRA-PCT populations pair. Based on the dendogram, the seven soursop populations were segregated into three major clusters. The first cluster consisted of SKH, KRA, PCT, NGW, and KPG populations. The GKD population was then grouped into second cluster. In the third cluster, the BGR population was grouped separately and more genetically distant than the others. However, the relationship dendrogram showed that the grouping did not always indicate the geographical origins similarity, but possibly showed the genetic similarity.

Key words: assessment, genetic diversity, Java, RAPD, soursop

INTRODUCTION Soursop (Annona muricata L.) is a species of the genus Annona belonging to family Annonaceae, which is known mostly for its edible fruit. Soursop is distinguished by its conspicuous spiny fruit and its obovate leaves with domatia on the underside (Kerrigan et al. 2011). Soursop is native to the Caribbean and Central America but is now widely distributed in the tropics and subtropics of the world, so it can be found in the West Indies, North and South America, lowlands of Africa and Pacific islands (Badrie and Schauss 2009). Today the soursop has spread throughout the world so it is also grown in Southeast Asia included Malaysia and Indonesia (Hasni 2009).

This species was recorded not only useful in the food industries but also for medical purposes. Soursop can be eaten freshly and also used as raw material for puree, juice, jam, jelly, powder fruits bars and flakes. It is also excellent for making refreshing drinks, sherbets and flavoring/ topping for ice-cream and dessert (Bates et al. 2001; Abbo et al. 2006; Hasni 2009). For medical purpose, soursop is used as an antispasmodic, emetic, and sudorific in herbal medicine. A decoction of the leaves is used to kill head lice and bed bugs while a tea from the leaves is well known to have sedative properties. The juice of the fruit is taken orally for hematuria, liver complaints, and urethritis (Badrie and Schauss 2009).

Information about the extent of genetic diversity of soursop in Java (Indonesia) is still incompletely

understood. Better understanding of genetic diversity and its distribution is essential for rational utilization of germplasm in crop improvement (Piyasundara et al. 2009).

Evaluation of genetic diversity among various accessions of crop species is fundamental for plant breeding programs (Tanksley 1983; Ikbal et al. 2010). This information can provide a predictive estimation of genetic variation within crop species thus facilitating breeding material selection (Qi et al. 2008).

A variety of molecular, chemical and morphological markers are used to characterize the genetic diversity among and within crop species (Ozkaya et al. 2006).

Morphological markers are routinely used for estimating genetic diversity but are not successful due to strong influence of environment. Hence, the use of molecular markers has complemented the classical strategies (Tanksley 1983). Molecular markers provide a better estimation of genetic diversity than morphological marker that is dependent of effect of various environmental factors.

Various molecular markers techniques based on Polymerase Chain Reaction (PCR) amplification have become increasingly important at the study of genetic diversity. Random Amplified Polymorphic DNA (RAPD) is one of various approaches which available for DNA fingerprinting (Lakshmi et al. 2011).

The development of RAPD markers, generated by the PCR using arbitrary primers, has provided a rapid and easy tool for the detection of DNA polymorphism. RAPD assay is one of the suitable methods for identifying the genotypes

B I O D I V E R S IT A S

248

16 (2): 247-253, October 2015

within a short period. The DNA amplification with RAPD does not require any previous knowledge of natural target DNA sequence, any digestion by restriction enzymes or radioactive probes. This technique also has been widely used to ascertain the genetic diversity in many crops by high levels of polymorphism with only limited amount of genomic DNA (Williams et al. 1990). It has been proved that RAPD can be used as an efficient tool for genetic characterization of many plant species (Hu et al. 1999).

The use of RAPD markers in the applied breeding programs can facilitate plant breeders to identify appropriate parents involved for crosses (Abd El-Hady et al. 2010).

The objective of this research was to determine genetic diversity of the soursop populations in Java (Indonesia) using RAPD markers. This is the first report on the assessment of genetic diversity in seven soursop populations originating from Java (Indonesia) using RAPD markers. Thus, information about genetic diversity through RAPD markers obtained in this study could be valuable for breeding strategies of soursop in Java.

MATERIALS AND METHODS Plant materials A total of 70 individuals were collected from 7 soursop populations, distributed along the geographical range of natural distribution of A. muricata in Java (Table 1 and Figure 1). The material collected consisted of young and healthy leaves of each individual, which were placed in plastic bags and kept in ice box, while transported to the laboratory. In laboratory, samples were subsequently stored at-20°C until DNA extraction.

DNA extraction Genomic DNA was extracted by the CTAB extraction procedure (Dellaporta et al. 1983) with some modifications. The extracted DNA was quantified in a spectrophotometer measuring absorbance at 260 and 280 nm. The integrity of the DNA was determined by electrophoresis on a 1% (w/v) agarose gel and photographed under ultraviolet (UV) light. The extracted DNA was then kept at-20°C for RAPD analysis.

Table 1. The location of soursop (Annona muricata L.) populations studied in Java with climatic data for each locality.

Population

Code

Sukoharjo, Central Java Karanganyar, Central Java Kulonprogo, Yogyakarta Gunungkidul, Yogyakarta Ngawi, East Java Pacitan, East Java Bogor, West Java

SKH KRA KPG GKD NGW PCT BGR

Latitude and longitude S 07041’22,1”, E 110054’33,5” S 07041’28,16”, E 110054’38,5” S 07043’24,8”, E 110046’28,6” S 07089’23,2”, E 110071’29,7” S 07032’67,1”, E 111012’05,7” S 08008’94,4”, E 111001’38,7” S 06020’58”, E 106004’68”

Altitude (m a.s.l.)

148 617 77,3 235 735 581 155

Temp. (oC) 34 31 32 37,5 32 34 33

Humidity (%) 58 59 62 49 42 55 60

Light intensity (lux) 358 5.153 2.592 16.900 4.156 17.240 237

BGR

KPG

GKD

KRA SKH

NGW

PCT

Figure 1. Map of the collection areas for 7 natural populations of soursop (Annona muricata L.) in Java. Note: SKH: Sukoharjo, KRA: Karanganyar, NGW: Ngawi, PCT: Pacitan, GKD: Gunung Kidul, KPG: Kulonprogo and BGR: Bogor

SURATMAN et al. – Genetic diversity of soursop based on RAPD marker

RAPD analysis RAPD reaction and procedures through PCR were carried out as described by Williams et al. (1990). Each amplification reaction was conducted with one unique primer. A total of 15 RAPD primers were purchased from commercial source (1st BASE Custom Oligos, Singapore) and screened initially to find specific diagnostic markers in the tested soursop populations (Table 2).

Electrophoresis The amplified PCR products were separated by electrophoresis on a 1.5% (w/v) agarose gel in 1×TAE buffer at 80 V for 2 h. A 100 bp DNA ladder (Geneaid Biotech Ltd, Taiwan) was included in all gels as a reference, to estimate the size of the amplified bands. Gels were then stained with 0.5 µg/mL ethidium bromide and amplification products were visualized and photographed under UV light. The obtained profile image was then saved on a magnetic disc.

Data analysis All distinct bands (RAPD markers) were analyzed according to their position on gel and visually scored on the basis of their presence (1) or absence (0), separately for each individual and each primer. The scores obtained using selected primers initially in the RAPD analysis were then pooled to create a single data matrix. In order to estimate polymorphic loci, genetic diversity, and genetic distance (Nei 1978), a computer program, POPGENE (Version 1.31), was used in this study (Yeh et al. 1999, Ghosh et al.

2009). A dendrogram among populations was constructed based on the genetic distance matrix by applying an Unweighted Pair Group Method with Arithmetic Averages (UPGMA) cluster analysis using a computer program, Numerical Taxonomy and Multivariate Analysis System (NTSYS) Version 2.00 (Rohlf 1998).

RESULTS AND DISCUSSION A total of 15 primers were screened initially for their ability to generate amplified band patterns and to assess polymorphism in the tested populations (Table 2).

Arbitrary primers used in the present study were 10 bp in size, had a GC content of 60% to 70% and did not contain any palindromic sequence.

Six random primers (A18, A20, P04, P06, P10, P11) gave optimal results, which yielded comparatively maximum number of amplification products with high intensity and minimal smearing, good resolution and also clear bands. The selected primers were then used to produce RAPD profiles for the references soursop populations. DNA bands resulted by PCR amplification using one of the selected RAPD primers in this study were shown in Figure 1.

Six random primers that we used generated a number of amplified DNA bands. A total of 152 bands were generated, ranging 23 to 31 bands per primer, corresponding to an average of 25.3 bands per primer. The size of bands ranged between approximately 200 and 2950

249

bp. Six random primers also produced 151 polymorphic bands, with an average of 25.2 polymorphic bands per primer. The degree of polymorphism within each population varied depending on the primer tested. The percentage of polymorphism for each primer ranged from 95% to 100% with an average of 99.3% polymorphism per primer. In all 5 primers (A20, P04, P06, P10, P11) produced 100% polymorphism while primer A18 showed least polymorphism (95.8%) (Table 3). The obtained data indicates that all selected random primers produced high level of polymorphism.

As a comparison, Cota et al. (2011) used 15 selected primers to evaluate genetic diversity of Annona crassiflora.

These primers generated 140 bands of which 123 (87.8%) were polymorphic. In contrast, Ronning et al. (1995) reported 15 selected primers to analyze genetic variation between A. cherimola, A. squamosa and their hybrids. A total of 92 bands were produced while 86 bands (93.5%) were polymorphic. Although our study used a lower number of selected primers compared than Ronning et al.

(1995) and Cota et al. (2011) but the total bands produced (152) and the average of percentage of polymorphism (99.3%) were comparable. In all cases, both the total bands produced and the average of percentage of polymorphism of Ronning et al. (1995) and Cota et al. (2011) were a bit lower than our results. Thus, the number of random primers and polymorphic bands generated were not similar range for species. They can vary significantly in different plant species.

According to Upadhyay et al. (2004), this is understandable that product amplification depends upon the sequence of random primers and their compatibility within genomic DNA. The number of markers detected by each primer depends on primer sequence and the extent of genetic variation, which is genotype specific. Poerba and Martanti (2008) described that each primer has its own attaching site, so the DNA band resulted by each primer was different, both in size of multiple basa pairs and in amount of DNA bands. Due to this fact, the selection of primers in RAPD analysis then affected the resultant band polymorphism.

Table 2. Parameters of the random primers used in the present study for initial screening.

Nucleotide GC sequences content References (5’-3’) (%) AGTCAGCCAC 60 Ronning et al. 1995 A3 AGGTGACCGT 60 Ronning et al. 1995 A18* GTTGCGATCC 60 Ronning et al. 1995 A20* CCACAGCAGT 60 Ronning et al. 1995 B18 AAAGCTGCGG 60 Ronning et al. 1995 C11 GTGTGCCCCA 70 Ronning et al. 1995 D8 AGCGCCATTG 60 Ronning et al. 1995 D11 AGATGCAGCC 60 Cota et al. 2011 P02 ATGGCTCAGC 60 Cota et al. 2011 P03 CAGGCCCTTC 70 Cota et al. 2011 P04* CTCTTGGGCT 60 Cota et al. 2011 P05 ACCACCCGCT 70 Cota et al. 2011 P06* ACCCCCACAC 70 Cota et al. 2011 P07 GGCTCATGTG 60 Cota et al. 2011 P10* GTCAGGGCAA 60 Cota et al. 2011 P11* Note: * Selected for RAPD analysis for all samples of the seven soursop populations in Java Primers code

B I O D I V E R S IT A S

250

16 (2): 247-253, October 2015

SKH

KRA

M 1 2 3 4 5 6 7 8 9 10

NGW

M 1 2 3 4 5 6 7 8 9 10 M 1 2 3 4 5 6 7 8 9 10

3 kb 1.5 kb 1 kb 0.5 kb

0.1 kb

PCT

GKD

M 1 2 3 4 5 6 7 8 9 10

M 1 2 3 4 5 6 7 8 9 10

KPG M 1 2 3 4 5 6 7 8 9 10

3 kb 1.5 kb 1 kb 0.5 kb 0.1 kb

BGR M 1 2 3 4 5 6 7 8 9 10 3 kb 1.5 kb 1 kb 0.5 kb

0.1 kb

Figure 1. Profile of the RAPD bands amplified by primer P04 for soursop (Annona muricata L.) individuals belonging to seven populations in Java. M indicated as Marker (100 bp Ladder) and the number well (1 to 10) in each population indicated number of soursop samples. Note: SKH: Sukoharjo, KRA: Karanganyar, NGW: Ngawi, PCT: Pacitan, GKD: Gunung Kidul, KPG: Kulonprogo and BGR: Bogor

Table 3. Numbers of bands and polymorphic bands, their size range and percentage of polymorphism detected by 6 selected RAPD primers

Primers

Number of bands

A18 A20 P04 P06 P10 P11 Total Average

24 23 27 31 23 24 152 25.3

Size range (bp) 350-2820 500-2950 400-2950 400-2840 200-2040 400-2820

Number of polymorphic bands 23 23 27 31 23 24 151 25.2

Polymorphism (%) 95.8 100 100 100 100 100 595.8 99.3

Results showed that each soursop population collected from different localities in Java seemed to have variability in RAPD profiles by using different primers. All RAPD primers selected in this study also showed more than 90% of polymorphism. Percent polymorphism reflects the number of total bands from each primer that distinguish at least one individual. Polymorphism detected by RAPD was determined by the different DNA sequence of the sites, which the primer bound (Lay et al. 2001). It is generally reported that polymorphism between populations also can arise through nucleotide changes that prevent amplification by introducing a mismatch at one priming site; deletion of a priming site; insertions that render priming site too distant to support amplification and insertions or deletions that change the size of the amplified product (Powell et al. 1996).

SURATMAN et al. – Genetic diversity of soursop based on RAPD marker

251

Table 5. Summary of Nei’s (1978) genetic distance values (below diagonal) between soursop population in Java Population

SKH

KRA

NGW

PCT

GKD

KPG

BGR

SKH **** KRA 0.0330 **** NGW 0.0367 0.0298 **** PCT 0.0288 0.0260 **** 0.02448 GKD 0.0366 0.0391 0.0316 **** 0.0410 KPG 0.0347 0.0293 0.0335 0.0269 0.0351 **** BGR 0.0406 0.0389 0.0382 0.0343 0.0400 0.0323 **** Note: SKH: Sukoharjo, KRA: Karanganyar, NGW: Ngawi, PCT: Pacitan, GKD: Gunung Kidul, KPG: Kulonprogo and BGR: Bogor

Cluster I

0.02448 0.0279

0.0333 0.0299

0.03668

Cluster II

0.03738

Cluster II

Cluster III

Figure 3. Dendrogram produced using UPGMA cluster analysis based on Nei’s (1978) genetic distance indicating genetics relatedness among 7 soursop populations in Java using 6 selected RAPD primers. The average of genetic distance value of the nodes are indicated

Table 4. Genetic diversity on soursop population in Java using 6 selected RAPD primers Code

Population

h ± SD

SKH KRA NGW PCT GKD KPG BGR

Sukoharjo 0.0454 ± 0.1105 Karanganyar 0.0525 ± 0.1095 Ngawi 0.0440 ± 0.1158 Pacitan 0.0418 ± 0.1079 Gunung Kidul 0.0439 ± 0.1184 Kulonprogo 0.0474 ± 0.1162 Bogor 0.0459 ± 0.1128 Average 0.0458 ± 0.1130 Note: h: gene diversity (Nei 1978); SD: Standard Deviation

Genetic diversity measures were calculated according to Nei’s index using POPGENE software and results were depicted in the Table 4. Within each population, the genetic diversity was limited, as indicated by the genetic diversity

value (h) that ranged from 0.0418 to 0.0525 with an average of 0.0458 per population. The lowest genetic diversity value (0.0418) was observed in population Pacitan (PCT) whereas the highest genetic diversity value (0.0525) was found in population Karanganyar (KRA).

According to Stansfield (1991), the intra-population genetic diversity value (h) was considered low if the value of h was below point two (<0.2). Thus, the soursop populations originated from Java was exhibited low levels of genetic diversity within populations. This occurrence may possibly due to the very limited chances of gene flows among populations.

The existence of low genetic diversity within soursop population possibly has been mostly attributed to self pollination (Archak et al. 2002). Although soursop flowers are apparently adapted to cross pollination despite being anatomically hermaphrodite, the bunched arrangement of stamens does not result in available fertile pollen. There is a period from 36 to 48 hours in which both sexual organs

252

B I O D I V E R S IT A S

16 (2): 247-253, October 2015

are ripe simultaneously. However, soursop flowers function as physiologically protogyneous where its pistil and pollen are not ripen in the same time. No insect genera has any influence on pollination because insects unlike the scent of soursop flowers. It is assumed that generally fruits are formed by autogamy after stigmas get in contact with stamens retained by lower petals. Due to those facts, Escobar et al. (1986) argued that pollination would rather sporadic occurred and sometimes stigmas shed after pollination.

Inter-population genetic distance value also were calculated and ranged from 0.02448 to 0.0410 as shown in Table 5. The highest Nei’s (1978) genetic distance values (0.0410) was observed in Sukoharjo (SKH)-Gunungkidul (GKD) population pair whereas the lowest genetic distance (0.02448) was estimated in Karanganyar (KRA)-Pacitan (PCT) population pair.

In order to study the relationship between populations, UPGMA algorithm based on Nei’s (1978) genetic distance was used to predict a dendrogram for the soursop populations in Java using NTYSYS software. Based on the dendogram, it showed distinct separation of the collected sample from seven soursop populations into three major clusters (Figure 3). The first cluster consisted of Sukoharjo (SKH), Karanganyar (KRA), Pacitan (PCT), Ngawi (NGW), and Kulonprogo (KPG) populations. It was interested that within first cluster, the KRA population from Central Java and the PCT population from East Java, which were separated by geographical position, showed very closed relationship, with 0.02448 of their genetic distance. The NGW population from East Java, the KPG population from Yogyakarta and the SKH population from Central Java which were originated from different provinces also grouped in this cluster. The Gunungkidul (GKD) population was then grouped into second cluster.

Geographically, the GKD population from Yogyakarta was far away from West Java and East Java. In the third cluster, the Bogor (BGR) population was grouped separately and more genetically distant than the others. The grouping in the third cluster was very good because the geographical position of the BGR population was separated with another population in Java. However, the relationship dendrogram showed that the grouping was inappropriate with geographical origins in the first cluster. At least, the second and third clusters were grouped in accordance with the geographical consideration. In our study, the grouping did not always indicate the geographical origins similarity, but possibly showed the genetic similarity.

One of the main applications of these clusters is the estimation of the genetic distance among populations and the identification of parents to perform appropriate crosses, and reaching maximum heterosis in hybridization programs. In this study, RAPD markers show that this method is informative and can be used to determine the relationships among populations. The data obtained here confirmed the efficiency of the RAPD technique as a valuable DNA marker for determination and estimation of genetic similarity among different plant genotypes in some populations. The information about genetic similarity will be helpful to avoid any possibility of elite germplasm

becoming genetically uniform (Fadoul et al. 2013).

Information on genetic diversity and relationship among and between individuals, populations, varieties, and species of plant are also important for plant breeders in guiding the improvement of crop plants (Dharmar and De Britto 2011).Thus, information about genetic diversity through RAPD markers obtained in this study could be valuable for breeding strategies of soursop in Java. This information also indicates that RAPD markers are a suitable marker to assess genetic diversity of crop species.

ACKNOWLEDGEMENTS The authors acknowledge gratefully to University of Sebelas Maret (UNS) for the financial support. This study was supported by a grant from University of Sebelas Maret through DIPA BLU Grant 2012 (No. Grant 01/UN27.9/PL/2012).

REFERENCES Abbo ES, Olurin T, Odeyemi G. 2006. Studies on the storage stability of Soursop (Annona muricata L.) juice. Afr J Biotechnol 5:108-112.

Abd El-Hady EAA, Haiba AAA, Abd El-Hamid NR, Rizkalla AA. 2010.

Phylogenetic diversity and relationships of some tomato varieties by electrophoretic protein and RAPD analysis. J Amer Sci 6 (11): 434441 Archak S, Karihaloo JL, Jain A. 2002. RAPD markers reveal narrowing genetic base of Indian tomato cultivars. Curr Sci 82: 1139-1143 Badrie N, Schauss AG. 2009. Soursop (Annona muricata L.): composition, nutritional value, medicinal uses, and toxicology. In: Watson RR, Preedy VR (eds.). Bioactive Foods in Promoting Health.

Academic Press, Oxford.

Bates RP, Moris JR, Candall PG. 2001. Principles and Practices of Small and Medium Scale Fruit Juice Processing. FAO United Nations Newsletter, Rome.

Cota LG, Vieira FA, Melo Júnior AF, Brandão MM, Santana KNO, Guedes ML, Oliveira DA. 2011. Genetic diversity of Annona crassiflora (Annonaceae) in northern Minas Gerais State. Genet Mol Res 10 (3): 2172-2180.

Dellaporta SL, Wood J, Hicks JB. 1983. A plant DNA miniprepration: Version II. Plant Mol Biol Rep 1: 19-21.

Dharmar K, De Britto AJ. 2011. RAPD analysis of genetic variability in wild populations of Withania somnifera (L.) Dunal. International J Biol Technol 2 (1):21-25.

Escobar TW, Zarate RRD, Bastidas A. 1986. Floral biology and artificial pollination of the soursop Annona muricata L. under the conditions of the cauca valley Colombia. Acta Agronomica (Palmira) 36 (1): 7-20.

Fadoul HE, El Siddig MA, El Hussein AA. 2013. Assessment of genetic diversity among Sudanese wheat cultivars using RAPD markers. Int J Curr Sci 6: E 51-57.

Ghosh KK, Haquei ME, Parvin MS, Akhter F, Rahim MM. 2009. Genetic diversity analysis in Brassica varieties through RAPD markers.

Bangladesh J Agric Res 34 (3): 493-503.

Hartati D. 2006. Genetic diversity of sengon (Albizia falcataria L. Fosberg) through DNA markers. Research and Development Center for Forest Plantation (P3HT), Yogyakarta. [Indonesian] Hasni K. 2009. Physical Properties of Soursop (Annona muricata) Powder Produced by Spray Drying. [Dissertation]. Faculty of Chemical and Natural Resources Engineering Universiti Malaysia Pahang, Malaysia Hu J, Li G, Struss D, Quiros CF. 1999. SCAR and RAPD markers associated with 18-carbon fatty acids in rape seed, Brassica napus.

Plant Breed 118: 145-150.

Ikbal, Boora KS, Dhillon RS. 2010. Evaluation of genetic diversity in Jatropha curcas L. using RAPD markers. Indian J Biotechnol 9: 5057.

Kerrigan RA, Cowie ID, Dixon DJ. 2011. Annonaceae. In: Short PS, Cowie ID (eds). Flora of the Darwin Region. Vol. 1. Northern

SURATMAN et al. â&#x20AC;&#x201C; Genetic diversity of soursop based on RAPD marker Territory Herbarium, Department of Natural Resources, Environment, the Arts and Sport, Darwin.

Lakshmi PTV, Annamalai A, Ramya C. 2011. A Study on the genetic diversity analysis of a medicinally potential herb-Enicostemma littorale Blume (Gentianaceae). Intl J Pharma Bio Sci 2 (4): 438-445.

Lay HL, Liu HJ, Liao MH, Chen CC, Liu SY, Sheu BW. 2001. Genetic identification of Chinese drug materials in Yams (Dioscorea spp.) by RAPD analysis. J Food Drug Anal 9 (3): 132-138.

Nei M. 1978. Estimation of average heterozygosity and genetic distance from a small number of individuals. Genetic 89: 583-590.

Ozkaya MT, Cakir E, Gokbayrak Z, Ercan H, Taskin N. 2006.

Morphological and molecular characterization of Derik Halhali Olive (Olea europaea L.) accessions grown in Derik-Mardin province of Turkey. Scientia Horticulturae 108: 205-209.

Piyasundara JHN, Gunasekare MTK, Wickramasinghe IP. 2009.

Characterization of tea (Camellia sinensis L.) germplasm in Sri Lanka using morphological descriptors. Sri Lanka J Tea Sci 74 (1): 31-39.

Poerba YS, Martanti D. 2008. Genetic variability of Amorphophallus muelleri Blume in Java based on Random Amplified Polymorphic DNA. Biodiversitas 9 (4): 245-249. [Indonesian] Powell W, Morgante M, Andre C, Hanafey M, Vogel J, Tingey S, Rafalski A. 1996. The comparison of RFLP, RAPD, AFLP and SSR

253

(microsatellite) markers for germplasm analysis. Mol Breed 2: 225238.

Qi XH, Yang JH, Zhang MF. 2008. AFLP-based genetic diversity assessment among Chinese vegetables mustards (Brassica juncea (L.) Czern.). Genet Resour Crop Evol 55: 705-711.

Rohlf SJ. 1998. NTSYS-pc Numerical Taxonomy and Multivariate Analysis System. Exeter Software, New York.

Ronning CM, Schnell RJ, Gazit S. 1995. Using Randomly Amplified Polymorphic DNA (RAPD) markers to identify Annona cultivars. J Amer Soc Hort Sci 120 (5): 726-729.

Stansfield WD. 1991. Schaum's Outline of Theory and Problems of Genetics. McGraw-Hill, Singapore.

Tanksley SD. 1983. Molecular markers in plant breeding. Plant Mol Biol Rep 1: 3-8.

Upadhyay A, Jayadev K, Manimekalai R, Parthasarath VA. 2004. Genetic relationship and diversity in Indian coconut accessions based on RAPD markers. Scientia Hortic 99: 353-362.

Williams JG, Kubelik AR, Livak KJ, Rafalski JA, Tingey SV. 1990. DNA polymorphisms amplified by arbitrary primers are useful as genetic markers. Nucleic Acid Res 18: 6531-6535.

Yeh FC, Yang RC, Boyle TBJ, Ye ZH, Mao JX. 1999. POPGENE, the user-friendly shareware for population genetic analysis. Molecular Biology and Biotechnology Centre, University of Alberta, Canada

B I O D I V E R S IT A S Volume 16, Number 2, October 2015 Pages: 254-263

ISSN: 1412-033X E-ISSN: 2085-4722 DOI: 10.13057/biodiv/d160221

Molecular phylogeny inferred from mitochondrial DNA of the grouper Epinephelus spp. in Indonesia collected from local fish market EDWIN JEFRI, NEVIATY P. ZAMANI, BEGINER SUBHAN, HAWIS H. MADDUPPA♥ Department of Marine Science and Technology, Faculty of Fisheries and Marine Science, Bogor Agricultural University (IPB). Jl. Darmaga Raya, Bogor 16680, West Java, Indonesia. Tel./Fax. +62 85693558653, ♥email: hawis@ipb.ac.id Manuscript received: 21 May 2015. Revision accepted: 21 September 2015.

Abstract. Jefri E, Zamani EP, Subhan B, Madduppa HH. 2015. Molecular phylogeny inferred from mitochondrial DNA of the grouper Epinephelus spp. in Indonesia collected from local fish market. Biodiversitas 16: 254-263. Groupers are widely distributed in the tropical and subtropical coastal waters, and are globally one of the most commercially important groups of marine fish, commanding high market price and are being heavily targeted in fisheries. Over fishing in Indonesia becomes a pivotal factor, which is seriously threatening the grouper biodiversity, as separate catch statistics are not reported for most species, and landings are often summarized as ‘serranids’ or ‘groupers’. This lack of species-specific catch data is due to the difficulty of identifying many of the species. The focus of this study was the tracking of molecular phylogeny of Epinephelus spp. of the family Serranidae. DNA amplification using mitochondrial cytochrome oxidase I resulted in 526-base pairs long sequences all samples. A total of seven species were characterized that are (Epinephelus areolatus, E. merra, E. fasciatus, E. longispinis, E. coioides, E. ongus and E. coeruleopunctatus). All of which were found to belong to 7 different clades in the constructed phylogenetic tree. E. ongus is genetically closest to E. coeruleopunctatus with genetic distance 0.091 (9%), whereas the farthest genetic distance was successfully identified between E. ongus and E. merra with genetic distance 0.178 (18%). Migration activity on spawning and movement of larvae that are affected by Indonesian Through flow suspected as the cause of the closeness between species grouper Epinephelus spp. in the phylogeny tree from several Indonesian seas, although information about the location and time of Epinephelus spp. spawning activity sometimes difficult to obtain certainty. Fish identification using molecular phylogenetic approach has been successfully applied in this study. It seems need further application on this method to avoid misidentification and due to high variety of species landing at local fish market. Nevertheless, this study would be an important data in the genetic management for the sustainable conservation and trade of grouper (Epinephelus spp.) in Indonesia.

Key words: Coral triangle, DNA barcoding, phylogeny, taxonomy, seafood

INTRODUCTION Grouper are generally found on coral and rocky reefs, but some species (e.g., Epinephelus aeneus) are commonly found on sandy, silty or muddy bottoms. The subfamily Epinephelinae includes 159 species in 15 genera (Allen and Adrim 2003). They can grow up to 2.5 m in length and 400 kg in weight (Heemstra and Randall 1993). Their desirable taste and high market value make them the most important mariculture fish species in Asia and around the world (Chiu et al. 2008). Groupers are also among the most important resources targeted by coastal fisheries in tropical and subtropical areas and they exhibit behavioral characteristics that make them vulnerable (Heemstra and Randall 1993).

Since 1980, Indonesia is known as the third largest supplier of groupers with export destination countries such as Singapore, Hong Kong and China. The fishermen caught the groupers in almost all coral reef seas in Indonesia. This is because the trade of live grouper is highly profitable (Nuraini and Hartati 2006). However, One-third of the Epinephelinae, particularly the genera Epinephelus and Mycteroperca, have been listed as a threatened species, thereby emphasizing the threat faced by groupers worldwide (Morris et al. 2000).

The phylogenetic relationships among the fishes in the perciform tribe Epinephelinae (Epinephelus, Serranidae)

are poorly understood because of the very numerous taxa that must be considered and the large, circumtropical distribution of the group. Knowledge of relationships within the Serranidae has been equally tenuous (Craig and Hastings 2007). Recently few questions were raised on the Epinephelus species on their morphological similarities and the species had extensive phonetic similarities, suggesting that some species in Epinephelus spp. might belong to a same species and group (Zhu and Yue 2008).

Over the last decade, the development of fish identification using molecular phylogenetic approach has been widely conducted. One of the molecular phylogenetic approaches that can be used is the mitochondrial DNA barcoding intended to distinguish species and identify specimens that are difficult to identify, such as larval stage, organ pieces or morphologically incomplete materials, using short gene sequences (Hebert et al. 2003).

Mitochondrial DNA is a crucial marker allowing researchers to recognize and identify this Serranid species for the many advantages that it offers, Mitochondrial DNA has a high mutation rate than nuclear genome, inherited solely from the mother, present in large numbers in every cell. In that it allows researchers to elucidate the evolutionary relationship among species of groupers, without looking at the entire life cycle of grouper (Waugh 2007). For evaluating genetic diversity and phylogeny,

JEFRI et al. – Molecular phylogeny of the Indonesia grouper

modern molecular biology has enabled comparisons between nucleotide and amino acid sequences of different populations. Many studies were carried out in this filed, such as this of (Ilves and Taylor 2008) on Osmeridae, (Sembiring et al. 2015) on sharks, (Akbar et al. 2014) on Thunnus albacares, (Ku et al. 2009) on E. quoyanus, and (Merritt et al. 1998) on Epinephelus and Mycteroperca species. Even some countries such as Egypt and South Africa also have been doing mithocondrial DNA to fish in some supermarkets. This is done to keep out of concern because of the high incidence of substitution and regulation of the circulation of species of fish, including grouper at the International level (Galal-Khallaf et al. 2014) and (Cawthorn et al. 2012). However, the Epinephelus spp. are often incorrectly identified in the field because of their closely related to the morphological features.

This study was aimed to identify the genetic and phylogenic structures of Epinephelus spp. collected from local fish market in Indonesia as inferred from mitochondrial DNA. By the results of this study we intended to support Indonesian government in their efforts in conservation of fish resources, particularly the genetic diversity, in accordance to the Indonesian Government Regulation No. 60/2007 (The Government of the Republic of Indonesia 2007), before groupers complete wiping-out from the Indonesian seas.

MATERIALS AND METHODS Tissue sampling A total of 39 groupers (Epinephelus spp.) muscle tissues or fin clip were collected from local fishermen and fish landing sites, or purchased from seven local fish market in Indonesia since January-April 2014. Lombok (n=12 samples) in January, Karimunjawa (n=11) in May, Lampung (n=4) in February, Kendari (n=3) in January,

255

Madura (n=3) in April, Tanakeke (n=3) in February, and Numfor (n=3) in May (Fig.1). Fish were photographed and identified at species level and fin clip was sampled and preserved in 95% ethanol at -20oC for further analysis.

Grouper (Epinephelus spp.) samples were identified according to Heemstra and Randall (1993) based on morphometric characters (i.e. shapes, colors and fins).

DNA extraction and PCR reaction DNA extraction was done based on commercial kit (DNeasy Blood & Tissue Kit, Qiagen Cat. No. 69504) with some modification according to the tissues (blood, fin or liver), or using 10% Chelex solution (Walsh et al. 1991) at 95oC. Some tissue samples are not in good shape, and sometimes hard in the extraction process so it must be combine the best of both these techniques. The segment of mtDNA COI was amplified with the primer Fish F1-5’ TCA ACC AAC CAC AAA GAC ATT GGC AC-3’ and Fish R1-5’ TAG ACT TCT GGG TGG CCA AAG AAT CA-3’ (Sachithanandam et al. 2012). Polymerase Chain Reaction (PCR) was used to amplify approximately 526bp fragment of the mtDNA CO1 gene. The procedure was performed in 24 μL reaction mixture containing 2 μL 25 mM MgCl2, 2 μL 8μM dNTPs, 1.25 μL each primer pair 10 mM, 0,125 μL Taq DNA polymerase, 2.5 μL 10xPCR Buffer, 3 μL DNA template, 12.875 μL deionize water (ddH2O), The thermo cycler conditions were: predenaturation at 94oC for 5 min, denaturation at 94oC for 30 sec, annealing at 56oC for 60 sec, extension at 72oC for 60 sec and final extension at 72oC for 7 min with 40x cycles (Sachithanandam et al. 2012). PCR products were separated on a 1% agarose gel, which had been stained with ethidium bromide and viewed under UV Transilluminator and documented. Sequence reactions were performed in both directions using the BigDye terminator v3.1 cycle sequencing kit (Applied Biosystems), 8-10 μL purified PCR product, and 4-5 μL of either primer (3 μM)

Figure 1. The sampling sites in Indonesia; 1. Lampung, 2. Karimunjawa, 3. Madura, 4. Lombok, 5. Tanakeke 6. Kendari 7. Numfor

B I O D I V E R S IT A S 16 (2): 254-263, October 2015

256

per reaction. Sequence-reaction products were loaded into an ABI 3130xl automated sequencer (Applied Biosystems) at the Berkeley Sequencing Facility located in the United States (Sanger et al. 1977).

evolution model and 1000x bootstrap replications (Tamura et al. 2004). Cephalopholis cyanostigma was used as an out-group when constructing the phylogenetic tree.

Data analysis Sequences data were analyzed using MEGA 6.0.5 program edited and aligned using Clustal W to see the diversity of their nucleotide bases (Tamura et al. 2013).

Sequence analysis was done along with reference sequences of various species belonging to the family Serranidae retrieved from NCBI (National Center for Biotechnology Information) GenBank. Aligned sequences were also subjected to nucleotide BLAST (Basic Local Alignment Search Tool) search to know the identity.

Phylogeny tree was constructed using phylogenetic analysis of Neighbor Joining (NJ) and Maximum Likelihood (ML) methods with Kimura 2-parameter

RESULTS AND DISCUSSION Molecular characteristics The processes of extracting and sequencing were conducted on 39 Epinephelus spp. Sequences that have been aligned were then followed by BLAST analysis on the National Center for Biotechnology Information (NCBI).

The results obtained seven species, namely Epinephelus areolatus, Epinephelus merra, Epinephelus ongus, Epinephelus fasciatus, Epinephelus coioides, Epinephelus coeruleopunctatus and Epinephelus longispinis, each species showed 99%-100% similarity value (Table 1).

Table 1. Summary of identified species at specific locations after BLAST in National Center for Biotechnology Information (NCBI), and their IUCN status. Number of samples per location is shown in bracket. LN is Least Concern.

Species

Locations (number)

Code

Epinephelus areolatus

Karimunjawa (5)

EJ-KRM-01-Epinephelus areolatus EJ-KRM-02-Epinephelus areolatus EJ-KRM-03-Epinephelus areolatus EJ-KRM-04-Epinephelus areolatus EJ-KRM-05-Epinephelus areolatus EJ-LBK-12-Epinephelus areolatus EJ-LBK-13-Epinephelus areolatus EJ-LBK-14-Epinephelus areolatus EJ-LBK-15-Epinephelus areolatus EJ-LBK-16-Epinephelus areolatus EJ-MDR-01-Epinephelus areolatus EJ-MDR-02-Epinephelus areolatus EJ-MDR-05-Epinephelus areolatus EJ-KDR-03-Epinephelus areolatus EJ-LPG-04-Epinephelus areolatus EJ-KRM-27-Epinephelus merra EJ-KRM-28-Epinephelus merra EJ-KRM-29-Epinephelus merra EJ-TNK-01-Epinephelus merra EJ-TNK-03-Epinephelus merra EJ-KDR-13-Epinephelus merra EJ-KDR-14-Epinephelus merra EJ-LBK-01-Epinephelus merra EJ-LBK-02-Epinephelus merra EJ-LBK-03-Epinephelus merra EJ-LBK-11-Epinephelus merra EJ-NMP-03-Epinephelus merra EJ-NMP-05-Epinephelus merra EJ-TNK-02-Epinephelus ongus EJ-KRM-58-Epinephelus ongus EJ-LBK-10-Epinephelus ongus EJ-LBK-08-Epinephelus fasciatus EJ-LBK-09-Epinephelus fasciatus EJ-LPG-03-Epinephelus fasciatus EJ-LPG-05-Epinephelus fasciatus EJ-KRM-45-Epinephelus coioides EJ-KRM-46-Epinephelus coioides EJ-NMP-02-Epinephelus coeruleopunctatus EJ-LPG-02-Epinephelus longispinis

Lombok (5)

Madura (3)

E. merra

Kendari (1) Lampung (1) Karimunjawa (3)

Tanakeke (2) Kendari (2) Lombok (4)

Numfor (2) E. ongus

E. fasciatus

Tanakeke (1) Karimunjawa (1) Lombok (1) Lombok (2) Lampung (2)

E. coioides

Karimunjawa (2)

E. coeruleopunctatus E. longispinis

Numfor (1) Lampung (1)

BLAST (%)

IUCN Status

100 100 100 99 99 100 99 100 99 99 99 99 99 99 100 99 99 100 100 100 100 99 99 99 99 99 99 99 100 100 100 99 99 99 99 100 99 99 100

LN LN LN LN LN LN LN LN LN LN LN LN LN LN LN LN LN LN LN LN LN LN LN LN LN LN LN LN LN LN LN LN LN LN LN LN LN LN LN

JEFRI et al. â&#x20AC;&#x201C; Molecular phylogeny of the Indonesia grouper

Genetic distance Genetic distance data obtained from seven species ranged from 0.091 (9%) to 0.178 (18%) (Table 2).

According to Nei (1972), the closer the genetic distance of a species with other species means that the COI gene similarity is closer and the value of genetic distance is still at the middle limits. The results of data analysis showed that the closest genetic distance was E. ongus with E. coeruleopunctatus at 0.091 (9%) and the farthest genetic distance was E. merra with E. ongus at 0.178 (18%).

Phylogeny tree Phylogeny tree was constructed from 39 sequences obtained from the Indonesian seas and added with

257

GeneBank sequences of 31 individuals presented in Table 1 and 3. The addition of 31 sequences from other countries was aimed to strengthen the position of the sequences from Indonesia in the phylogeny tree. Phylogenetic is a description of relationship based on DNA sequence composition or protein which resembles to that of a tree to estimate the past evolution process (Baldauf 2003). The reconstruction of Epinephelus spp. phylogeny tree was conducted using MEGA 6.0.5 software with the bootstrap NJ and ML methods. Both tree construction methods showed similar topologies with only minor differences at deeper nodes. The results showed seven clades; Epinephelus areolatus, E. merra, E. fasciatus, E. longispinis, E. coioides, E. ongus and E. coeruleopunctatus.

Table 2. Genetic distance between the 7 species identified in the study No. 1 2 3 4 5 6 7

Species Epinephelus areolatus E. merra E. coioides E. ongus E. fasciatus E. coeruleopunctatus E. longispinis

1

2

3

4

5

6

7

0.152 0.163 0.166 0.145 0.160 0.151

* 0.176 0.178 0.148 0.150 0.160

* * 0.117 0.144 0.123 0.165

* * * 0.168 0.091 0.178

* * * * 0.163 0.157

* * * * * 0.135

* * * * * * -

Table 3. GeneBank data information of the Epinephelus spp. included in this analysis, location and accession number from National Center for Biotechnology Information (NCBI) Species

Locations

Epinephelus areolatus E. areolatus E. areolatus E. merra E. merra E. merra E. coioides E. coioides E. coioides E. coioides E. coioides E. ongus E. ongus E. ongus E. ongus E. ongus E. fasciatus E. fasciatus E. fasciatus E. fasciatus E. fasciatus E. coeruleopunctatus E. coeruleopunctatus E. coeruleopunctatus E. coeruleopunctatus E. coeruleopunctatus E. longispinis E. longispinis E. longispinis E. longispinis E. longispinis

Luzon, Philippines South China Sea, China South China Sea, China Luzon, Philippines Queensland, Australia French Polynesia Pangasinan, Philippines Andaman, India Andaman, India Andaman, India Queensland, Australia Queensland, Australia Queensland, Australia Queensland, Australia Cuba Okinawa, Japan Luzon, Philippines Queensland, Australia Arabian Sea Arabian Sea India Pomene, Mozambique Madagascar Madagascar Viti Levu Island, Fiji Andaman, India India Kerala, India Kerala, India South Africa Pomene, Mozambique

Access number KC970469 FJ237757 FJ237756 KC970471 DQ107898 JQ431721 KF714940 JX674987 JX674982 JX674983 DQ107891 DQ107858 DQ107859 DQ107872 FJ583398 JF952725 KC970470 DQ107874 FJ459562 FJ459561 EU392208 JF493438 JQ349962 JQ349961 KF929848 JX674991 KJ607970 EF609521 EF609522 HM909800 HQ945868

References Alcantara and Yambot 2014 Zhang and Hanner 2012 Zhang and Hanner 2012 Alcantara and Yambot 2014 Ward et al. 2005 Hubert et al. 2012 Alcantara and Yambot 2014 Sachithanandam et al. 2012 Sachithanandam et al. 2012 Sachithanandam et al. 2012 Ward et al. 2005 Ward et al. 2005 Ward et al. 2005 Ward et al. 2005 Steinke et al. 2009 Zhang and Hanner 2012 Alcantara and Yambot 2014 Ward et al. 2005 Lakra et al. 2011 Lakra et al. 2011 Lakra et al. 2011 Steinke et al. 2009 Hubert et al. 2012 Hubert et al. 2012 Bentley and Wiley 2013 Sachithanandam et al. 2012 Mandal et al. 2014 Lakra et al. 2011 Lakra et al. 2011 Steinke et al. 2009 Steinke et al. 2009

258

B I O D I V E R S IT A S 16 (2): 254-263, October 2015

The seven clades formed grouping and showed solid phylogeny tree, each clade indicated the bootstrap value of 100% both on the NJ method and ML method (except; E. coeruleopunctatus at 99%) (Figures 2 and 3). Each group; E. merra clade formed from Numfor, Karimunjawa, Tanakeke, Kendari and Lombok, with additional samples from Philippines (KC970471), Australia (DQ107898) and French Polynesia (JQ431721). E. fasciatus clade formed from Lombok and Lampung as well as additional samples from Philippines (KC970470), Australia (DQ107874), India (EU392208) and the Arabian Sea (FJ459561 and FJ459562). E. areolatus clade formed from Lombok, Lampung, Karimunjawa, and Madura and additional samples from Philippines (KC970469) and China (FJ237756 and FJ237757), there is also a sample from Lombok and Lampung formed a separate sub-clade (EJLBK-13 and EJ-LPG-04). E. longispinis clade formed from Lampung with additional samples from India (KJ607970, EF609522 and EF609521), South Africa (HM909800) and Mozambique (HQ945868) with bootstrap value of 100%. A similar case also occurred in E. coioides clade, the sample comes from Karimunjawa with additional samples from Philippines (KF714940), Australia (DQ107891) and India (JX674982, JX674983 and JX674987). Then E. ongus clade formed from Karimunjawa, Tanakeke and Lombok with additional samples from Australia (DQ107858, DQ107859 and DQ107872), Japan (JF952725) and Cuba (FJ583398). And the latter with bootstrap value 99% in both methods NJ and ML. The last E. coeruleopunctatus clade formed from Numfor with additional samples from Mozambique (JF493438), Madagascar (JQ349961 and JQ349962), Fiji (KF929848) and India (JX674991).

Discussion The fragment length from PCR amplification using COI with Fish R1 and Fish F1 primers from 39 samples was 526bp (basepairs). Previous research has also conducted studies and obtained a fragment length of 582bp on Epinephelus septemfasciatus (Guan et al. 2014), Epinephelus longispinis at 516bp Epinephelus ongus at 522bp and Epinephelus areolatus at 318bp (Sachithanandam et al. 2012). The different sequence length is determined by the difference of quality DNA in each sample collected, but it does not affect the results of the sequence analysis in each sample. In fact, several DNA barcoding studies using fish samples obtained from some supermarkets also show good sequence results (300-600bp) as long as the collection and storage processes are well conducted (Filonzi et al. 2010). Shark tissues were collected from three fisheries landing site in Java Islands, Indonesia also showed 600-700bp a total of seven species from 59 individuals was identified (Prehadi et al. 2014) and other part in Indonesia (Sembiring et al. 2015). Even, the tissue from the museum also showed the base pairs length although shorter than fresh tissue (Zein et al. 2013).

Fish identification is traditionally based on morphological features. However, in many cases, fish and their diverse developmental stages are difficult to identify using morphological characteristics alone. Molecular DNA

identification techniques have been developed and proven to be analytically powerful. As a standardized and universal method, DNA barcoding will correct an error in grouper identification based on morphological analysis (Zhang and Hanner 2012). In addition to E. merra, this species has a relatively small body (grow up to 28 cm in length) and live up to 25 m in depth, while E. ongus can grow to nearly 1 m in 100 m depth (Heemstra and Randall 1993) (Figure 4). The current classification of the Epinephelus genera is primarily based on different morphological traits: the number of anal fin rays (7-10), the shape of caudal fins (rounded and truncate) and the head length (2.1-2.5 in standard length) (Table 4). The use of morphological characteristics to identify grouper species and then reconstruct phylogenetic relationships is very complex and not always satisfactory (Maggio et al. 2004).

Morphological analysis of seven species in this study showed a difference; although there are some species nearly as visually and size, but with the analysis of mitochondrial DNA is very helpful correcting genetic distance between species, especially of each species.

Heemstra and Randall (1993) stated that E. merra can be distinguished from the other reticulated groupers by its pectoral-fin pattern of conspicuous black dots that are largely confined to the rays of the fin. E. areolatus has often been confused with E. chlorostigma, which is also covered with brown spots and has a truncate or emarginate caudal fin with a white posterior margin. E. ongus also sympatric with E. coeruleopunctatus has a similar color pattern, but the caudal and anal fins have only a few white spots (confined mainly to proximal part of these fins).

Genetic distance and phylogenetic tree also showed a strong proximity between both.

Groupers (Epinephelus spp.) are distributed in the tropical and subtropical regions of African to Indo-Pacific oceans. Madduppa et al. (2012) stated that the diversity of grouper in the reef slope was higher than in the lagoon.

This shows that the characteristics of the habitat were instrumental in shaping the fish community. Their distribution territory is limited, they live in solitary, sedentary and territories in the coral reef ecosystem that cause the genetic distance of Epinephelus spp. is not too far.

Although sometimes they are found to migrate several kilometers for the spawning process to a more conducive seas for 1 to 2 weeks aggregation, Epinephelus spp. migrate to form massive spawning aggregations at specific locations and during specific periods (Erisman et al. 2014).

It is not surprising that Epinephelus spp. exhibits considerable intraspecific variation based on scale counts and color pattern.

Phylogeny tree A strong clade indicated by the bootstrap value of 100% both on the NJ method and on the ML method (except for E. coeruleopunctatus at 99%) (Figures 2 and 3). In E. areolatus clade, there were sub-clades with the bootstrap value of 99% (EJ-LBK-13 and EJ-LPG-04), in which geographically the species belonged to Lombok and Lampung seas but has a close phylogeny with a bootstrap

JEFRI et al. â&#x20AC;&#x201C; Molecular phylogeny of the Indonesia grouper

259

Figure 2. Neighbor-Joining tree using 39 Epinephelus spp. grouper sequences from Indonesia based on the mtDNA CO1 and added 31 sequences from GeneBank with Cephalopholis cyanostigma as out-group. Note: KDR = Kendari, LPG = Lampung, LBK = Lombok, TNK = Tanakeke, KRM = Karimunjawa, MDR = Madura, NMP = Numfor.

260

B I O D I V E R S IT A S 16 (2): 254-263, October 2015

Figure 3. Maximum Likelihood tree using 39 Epinephelus spp. grouper sequences from Indonesia based on the mtDNA CO1 and added 31 sequences from GeneBank with Cephalopholis cyanostigma as out-group. Note: KDR = Kendari, LPG = Lampung, LBK = Lombok, TNK = Tanakeke, KRM = Karimunjawa, MDR = Madura, NMP = Numfor.

JEFRI et al. – Molecular phylogeny of the Indonesia grouper

261

↔ 22 cm adult

A

0.091 (9%)

0.178 (18%).

↔ 43 cm adult

B

↔ 17 cm adult

C

Figure 4. Three species of grouper Epinephelus spp. The closest genetic distance (0.091 or 9%) between Epinephelus ongus (A) and Epinephelus coeruleopunctatus, and furthest genetic distance (0.178 or 18%) between Epinephelus ongus (A) and Epinephelus merra (C) (after Heemstra and Randall 1993)

Table 4. The main morphological characters to identify grouper (Epinephelus spp.) based on Heemstra and Randall (1993) Species Epinephelus areolatus E. merra E. coioides E. ongus E. fasciatus E. coeruleopunctatus E.longispinis

Head length (inch)

Anal fin rays

2.4 to 2.8 2.3 to 2.6 2.3 to 2.6 2.3 to 2.5 2.3 to 2.6 2.3 to 2.5 2.4 to 2.6

III spines and 8 rays III spines and 8 rays III spines and 8 rays III spines and 8 rays III spines and 8 rays III spines and 8 rays III spines and 8 rays

value of 99%. Other samples from the Philippines (KC970469) and China (FJ237757 and FJ237756) were also joined in one large clade, indicating that several groupers of E. areolatus species from Indonesia, the Philippines and China were still have a close kinship. No significant differences from these seas were due to the limited distribution and territorial-nature of this grouper species in accordance with the results of (Heemstra and Randall 1993).

The other clades, E. longispinis showed the existence of two sub-clades. EJ-LPG-02 and KJ607970 from Lampung and India were formed their own sub-clade, whereas EF609522, EF609521, HM909800 and HQ945868 from India, South Africa and Mozambique formed other subclades. Sachithanandam et al. (2012) stated that E. longispinis of Andaman India also showed almost similar character of South African as well as Arabian sea species.

The existence of a large sub-clade is suspected because of

Shape of caudal fins Truncate or slightly Rounded Rounded Rounded.

Slightly to moderately rounded Rounded Convex

the considerable differences in geography, even though E. longispinis is a geographically distributed species in the continental areas and islands in the Indian Ocean region from Kenya to South Africa and the Banda Sea, including Madagascar, Comoros, Maldives, India to Sri Lanka (Heemstra and Randall 1993). Spawning migration activity for a long time and affected by Indonesian Through flow that suspected for causing the phylogeny tree has proximity of some of these seas. It is known that grouper species is a protogynous hermaphrodite (Craig et al. 2011), although the location and timing of grouper spawning activity is sometimes difficult to find the information (Golbuu and Friedlander 2011).

The results of phylogeny tree either using NJ or ML methods were also strengthened the data from the analysis of genetic distance, whereas the closest (E. ongus and E. coeruleopunctatus) were on the same branch (with the bootstrap values of 72% (ML) and 73% (NJ)) with a

262

B I O D I V E R S IT A S 16 (2): 254-263, October 2015

different clade. Meanwhile, the farthest E. ongus and E. merra were in a different clade and the same large branch (with the bootstrap values of 73% (ML) and 82% (NJ)). E. fasciatus and E. coioides clades also showed no significant differences in the position of the phylogeny tree from the results obtained in the analysis of genetic distance, even though they had merged with several sequences from outside Indonesian seas. Craig and Hastings (2007) also corroborate that Epinephelus spp. are monophyly of the remaining tribes.

The present study suggested that event morphologically the species Epinephelus spp. are difficult to differentiate due to key features are quite similar, but they were confirmed by the molecular analysis results. Mitochondrial COI gene, as an ideal region for species barcode, DNA barcode may be used for the rapid analysis for the commercial purposes especially confirmation for the particular species. This study would be an important data in the genetic management for the sustainable conservation and trade of grouper (Epinephelus spp.) in Indonesia.

ACKNOWLEDGEMENTS The current research was funded by Directorate General of Higher Education, Indonesia (DIKTI), and Marine Biodiversity and Biosystematics Laboratory, Department of Marine Science and Technology, Bogor Agricultural University, Bogor, Indonesia.

REFERENCES Akbar N, Zamani NP, Madduppa HH. 2014. Genetic diversity of yellowfin tuna (Thunnus albacares) from two populations in the Moluccas Sea, Indonesia. Depik 3 (1): 65-73.

Alcantara SG, Yambot AV. 2014. DNA barcoding of commercially important grouper species (Perciformes, Serranidae) in the Philippines. Mitochon DNA J DNA Map Sequen Anal 19: 1-9.

Allen GR, Adrim M. 2003. Coral reef fishes of Indonesia. Review Article.

Zool Stud 42: 1-72.

Baldauf SL. 2003. Phylogeny for the faint of heart: a tutorial. Volume XIX. Department of Biology, University of York and Elsevier, New York.

Bentley AC, Wiley EO. 2013. University of Kansas Biodiversity Institute barcoding initiative. Submitted (05-DEC-2013) Biodiversity Institute, University of Kansas, Dyche Hall, 1345 Jayhawk Boulevard, Lawrence, KS 66045, USA Cawthorn DM, Steinman HA, Witthuhn RC. 2012. DNA barcoding reveals a high incidence of fish species misrepresentation and substitution on the South African market. Food Res Intl 46: 30-40.

Chiu ST, Tsai RT, Hsu JP, Liu CH, Cheng W. 2008. Dietary sodium alginate administration to enhance the non-specific immune responses, and disease resistance of the juvenile grouper Epinephelus fuscoguttatus. Aquaculture 277: 66-72.

Craig MT, Hastings PA. 2007. A molecular phylogeny of the groupers of the subfamily Epinephelinae (Serranidae) with a revised classification of the Epinephelini. Ichthyol Res 54: 1-17.

Craig MT, Pondella DJ, Franck JPC, Hafner JC. 2011. On the status of the Serranid Fish Genus Epinephelus: Evidence for paraphyly based upon 16S rDNA sequence. Mol Phylogenet Evol 19: 121-130.

Erisman BE, Apel AM, MacCall AD, Roman MJ, Fujita R. 2014. The influence of gear selectivity and spawning behavior on adata-poor assessment of a spawning aggregation fishery. Fish Res 159: 75-87.

Filonzi L, Chiesa S, Vaghi M, Marzano FN. 2010. Molecular barcoding reveals mislabelling of commercial fish products in Italy. Food Res Intl 43: 1383-1388.

Galal-Khallaf G, Ardura A, Mohamed-Geba K, Borrell YJ, Vazquez EG. 2014. DNA barcoding reveals a high level of mislabeling in Egyptian fish fillets. Food Control 46: 441-445.

Golbuu Y, Friedlander AM. 2011. Spatial and temporal characteristics of grouper spawning aggregations in marine protected areas in Palau, western Micronesia. Estuar Coast Shelf Sci 92: 223-231.

Guan S, Liu H, Zheng Y, Yu D, Nie A, Liu M. 2014. Inference of phylogenetics and evolution of Epinephelus septemfasciatus and 48 other species of Epinephelus Genus using mitochondrial CO1 fragment sequences. Pakistan J Zool 46: 67-74.

Hebert PDN, Ratnasingham S, deWaard JR. 2003. Barcoding animal life: cytochrome c oxidase subunit 1 divergences among closely related species. Proc R Soc 270: 96-99.

Heemstra PC, Randall JE. 1993. Grouper of the world (family Serranidae, subfamily Epinephelinae): an annotated and illustrated catalogue of the grouper, rockcod, hind, coral grouper and lyretail species: known to date. Food and Agriculture Organization of the United Nations, Rome.

Hubert N, Meyer CP, Bruggemann HJ, Guerin F, Komeno RJ, Espiau B, Causse R, Williams JT, Planes S. 2012. Cryptic diversity in IndoPacific coral-reef fishes revealed by DNA-barcoding provides new support to the centre-of-overlap hypothesis. PLoS ONE 7 (3): e28987.

Ilves KL, Taylor EB. 2008. Molecular resolution of the systematic of a problematic group of fishes (Teleostei: Osmeridae) and evidence for morphological homoplasy. Mol Phylogenet Evol 50: 163-178.

Ku CC, Teng YC, Wang CS, Lu CH. 2009. Establishment and characterization of three cell lines derived from the rockfish grouper Epinephelus quoyanus: Use for transgenic studies and cytotoxicity testing. Aquaculture 294:147-151.

Lakra WS, Verma MS, Goswami M, Lal KK, Mohindra V, Punia P, Gopalakrishnan A, Singh KV, Ward RD, Hebert P. 2011. DNA barcoding Indian marine fishes. Mol Ecol Resour 11 (1): 60-71.

Madduppa HH, Agus SB, Farhan AR, Suhendra D, Subhan B. 2012. Fish biodiversity in coral reefs and lagoon at the Maratua island, East Kalimantan. Biodiversitas 13: 145-150.

Maggio T, Andaloro F, Hemida F, Arculeoa M. 2004. A molecular analysis of some Eastern Atlantic grouper from the Epinephelus and Mycteroperca genus. J Exp Mar Biol Ecol 321: 83- 92.

Mandal A, Anjali KM, Thampi Samraj YC. 2014. Molecular identification of commonly available grouper species in Indian coastal waters.

Submitted (21-MAR-2014) Central Genetics Lab, Rajiv Gandhi Centre for Aquaculture, 3/197, Poompuhar Road, Sirkazhi, Tamilnadu 609109, India.

Merritt TJS, Shi L, Chase MC, Rex MA, Etter RJ. 1998. Universal cytochrome b primers facilitate intraspecific studies in molluscan taxa. Mol Mar Biol Biotechnol 7: 7-11.

Morris AV, Roberts CM, Hawkins JP. 2000. The threatened status of groupers (Epinephelinae). Biodiv Conserv 9: 919-942.

Nei M. 1972. Genetic distance between population. Amer Nat 106: 283292.

Nuraini S, Hartati ST. 2006. Type groupers (Serranidae) Bubu catch in the seas of the Saleh Bay, Sumbawa. Proceedings of the National Seminar on Fish IV, Jatiluhur, 29-30 Agustus. Indonesia, 2006.

[Indonesian] Prehadi, Sembiring A, Kurniasih AM, Rahmad, Arafat D, Subhan B, Madduppa H. 2014. DNA barcoding and phylogenetic reconstruction of shark species landed in Muncar fisheries landing site in comparison with Southern Java fishing port. Biodiversitas 16: 55-61.

Sachithanandam V, Mohan PM, Muruganandam N, Chaaithanya IK, Dhivya P, Baskaran R.. 2012. DNA Barcoding, Phylogenetic Study of Epinephelus spp. from Andaman Coastal Region, India. Indian J GeoMar Sci 41: 203-211.

Sanger F, Nicklen S, Coulson AR. 1977. DNA sequencing with chainterminating inhibitors. Proc Nat Acad Sci USA 74: 5463-5467.

Sembiring A, Pertiwi NPD, Mahardini A, Wulandari R, Kurniasih EM, Kuncoro AW, Cahyani NKD, Anggoro AW, Ulfa M, Madduppa H, Carpenter KE, Barber PH, Mahardika GN. 2015. DNA barcoding reveals targeted fisheries for endangered sharks in Indonesia. Fish Res 164: 130-134.

Steinke D, Zemlak TS, Hebert PD. 2009. Barcoding nemo: DNA-based identifications for the ornamental fish trade. PLoS ONE 4 (7): e6300.

Tamura K, Nei M, Kumar S. 2004. Prospects for inferring very large phylogenies by using the neighbor-joining method. Proc Nat Acad Sci USA 101: 11030-11035.

JEFRI et al. â&#x20AC;&#x201C; Molecular phylogeny of the Indonesia grouper Tamura K, Stecher G, Peterson D, Filipski A, Kumar S. 2013. MEGA 6.0.5 Molecular Evolutionary Genetics Analysis Version 6.0. Mol Biol Evol 30: 2725-2729.

The Government of the Republic of Indonesia. 2007. Government Regulation No. 60 of 2007 on the Conservation of Fish Resources, Secretary of State. Indonesia.

Walsh PS, Metzger DA, Higuchi R. 1991. Chelex-100 as a medium for Simple extraction of DNA for PCR based typing from forensic material. Biotechniques 10: 506-513.

Ward RD, Zemlak TS, Innes BH, Last PR, Hebert PD. 2005. DNA barcoding Australia's fish species. Phil Trans R Soc Lond B, Biol Sci 360 (1462): 1847-1857.

263

Waugh J. 2007. DNA barcoding in animal species: progress, potential and pitfalls. BioEssays 29: 188-197.

Zein M, Arifin S, Prawiradilaga DM. 2013. DNA Barcode of Fauna Indonesia. Kencana Prenadamedia Group Publisher, Jakarta, Indonesia.

Zhu ZY, Yue GH. 2008. The complete mitochondrial genome of red grouper Plectropomus leopardus and its applications in identification of grouper species. Aquaculture 276: 44-49.

Zhang J, Hanner R. 2012. Molecular approach to the identification of fish in the South China Sea. PLoS ONE 7: e30621. DOI: 10.1371/journal.pone.0030621.

B I O D I V E R S IT A S Volume 16, Number 2, October 2015 Pages: 264-268

ISSN: 1412-033X E-ISSN: 2085-4722 DOI: 10.13057/biodiv/d160222

Short Communication: Microfungal diversity on leaves of Eusideroxylon zwageri, a threatened plant species in Sarawak, Northern Borneo A. LATEEF ADEBOLA1,2,, MUID SEPIAH1, MOHAMAD H. BOLHASSAN1, MANSOR WAN ZAMIR1 1

Department of Plant Science and Environmental Ecology, Faculty of Resource Science and Technology, Universiti Malaysia Sarawak, Kota Samarahan-94300, Sarawak, Malaysia. Tel./fax.: +60-146902928, email: lateef.aa@unilorin.edu.ng 2 Department of Plant Biology, Faculty of Life Science, University of Ilorin, Nigeria Manuscript received: 16 August 2015. Revision accepted: 27 September 2015.

Abstract. Adebola AL, Sepiah M, Bolhassan MH, Wan Zamir M. 2015. Microfungal diversity on leaves of Eusideroxylon zwageri, a threatened plant species in Sarawak, Northern Borneo. Biodiversitas 16: 264-268. A survey of the microfungal communities on green leaves and leaf litters of an endangered plant species, Eusideroxylon zwageri Teijsm. & Binn. (belian) was carried out for the first time.

A total of 200 leaf segments were plated on both water agar and malt extract agar. 74 fungal species were identified from both leaf types with more fungal taxa found on the green leaves, with a Shannon diversity index of 3.85 compared to that on litters, 2.63 and the similarity between the microfungal communities on both leaf types was low with a Bray-Curtis similarity index of 0.366. The most dominant species on both leaf types includes Aphanocladium areanarum, Trichoderma koningii, Nectria sp., Chalara pteridina, Hyphomycetes sp.3, hyaline Mycelia sterilia, Circinotrichum sp., Phoma sp., Acremonium macroclavatum, Chaetopsina sp., Physarum sp., Beltrania rhombica and Colletotrichum acutatum.

Keywords: Endophytic, green leaves, leaf litters, new record, saprophytic

INTRODUCTION General knowledge on the microfungal diversity and distribution is still inadequately understood. More studies have been done on fungal diversity and their spatial distribution in the temperate regions as compared to the tropics (Hawksworth 2001; Hawksworth and Rossman 1997). Many areas and substrates still remain unstudied in the world, most especially in the tropics and same applies to many plant species which are not yet studied for their associated microfungal communities. The most accepted fungal estimate of 1.5 million by Hawksworth (1991, 2001) was considered as too small by some authors (Cannon 1997; O’Brien et al. 2005) on the basis that the used plant to fungus ratio of 1:6 used by Hawksworth, which assumed the plant diversity as 270,000, was too low, pointing out that there are about 300,000-320,000 plant species (Prance et al. 2000), 420,000 spp. (Govaerts 2001) and 117,734575,320 spp. (Wortley and Scotland 2004). An important area of global fungal diversity which has been often overlooked is microfungi on vulnerable, threatened and endangered plant species. There is a wide gap of data on microfungi associated with many rare plant species, in terms of host-specific fungi and also fungal disease caused to the plants (Buchanan et al. 2002).

Eusideroxylon zwageri Teijsm. & Binn. (belian tree), is a typical case study of unstudied rare plants. E. zwageri is the only accepted species in the genus Eusideroxylon which belongs to the family Lauraceae. This plant species, also called the Borneo Ironwood, is native to the Southeast

Asian forest and has been listed in the IUCN Global Red List of Threatened Species as an endangered species due to over logging and habitat destruction (IUCN 1998). To the best of our knowledge, no studies have been found in literature on microfungal communities on belian tree. At the plant family level (Lauraceae), comparatively few studies have been done on plant species belonging to the family Lauraceae, an example is the study done by (Paulus et al. 2006) on Cryptocarya mackinnoniana from which 81 fungal taxa were identified using direct observation method and on Chlorocardium rodiei by Cannon and Simmons (2002) in which only 10 endophytic fungi were identified.

This study aims at revealing the microfungal communities on green leaves and leaf litters of E. zwageri (belian tree) from Kubah National Park in Sarawak, Malaysia. The implications of this study will be far reaching in the understanding, protection and conservation of the belian tree.

MATERIALS AND METHODS Sampling Green leaves and leaf litters were collected in March, 2014 from under a belian tree (N 01o36’760, E 110o11’794), 127 m above sea level, at the base of the camp in Kubah National Park in Sarawak, Malaysia. In this Park, this is the only known location of belian tree and this area has a very rough terrain. Coupled with this, collection of belian samples is restricted by the Park officials. Leaf

ADEBOLA et al. – Microfungi on Eusideroxylon zwageri

Colletotrichum acutatum

Beltrania rhombica

Physarum sp.

Chaetopsina sp.

Phoma sp.

Circinotrichum sp.

Mycelia sterilia

Hyphomycetes sp.3

Chalara pteridina

Acremonium macroclavatum

The diversity indices such as Shannon and Simpson’s diversity indices as well as the Bray-Curtis similarity index were calculated using the software Estimates (Colwell 2013).

Nectaria sp.

Freq. of isolation = Total no. of leaf segments a fungal taxa was present × 100 Total no. of leaf segments observed

Trichoderma koningii

Data analysis The frequencies of occurrence of each microfungal taxa observed was calculated and the frequency of isolation was determined according to (Hata and Futai 1995; Osono 2008) as follows:

The total of 74 taxa were identified from 200 leaf segments of E. zwageri on WA and MEA, comprising 11 Ascomycetes, 55 anamorphic taxa, 3 Basidiomycetes, and 3 Zygomycetes. Non-sporulating mycelia (Mycelia sterilia), both hyaline and melanized were also documented. 67 taxa were identified from green leaves while 20 taxa were from leaf litters (Table 1). The most dominant species observed from both leaf types were Aphanocladium aranearum, Trichoderma koningii, Nectria sp., Chalara pteridina, Hyphomycetes sp.3, Hyaline Mycelia sterilia, Circinotrichum sp., Phoma sp., Acremonium macroclavatum, Beltrania rhombica, Chaetopsina sp. and Physarum sp. (Figure 1).

Other species identified includes Speiropsis pedatospora (Figure 2.A-C.), Subulispora longirostrata (Figure 2.E), Isthmotricladia sp., Fusarium solani, Cylindrocladium sp., Dactylaria obtriangularia and Monacrosporium sp (Figure 2G-H). The Shannon and Simpson’s diversity indices were higher for the microfungal assemblage on green leaves, 3.85 and 35.93 respectively, than on leaf litters, 2.63 and 11.11 respectively (Tabel 2). This result indicates that leaves of belian support a high diversity of fungi when compared to that recovered from other endangered plant species (Sadaka and Ponge 2003; Shanthi and Vittal 2010; Goveas et al.

2011; Grbić et al. 2015). 41 endophytic fungal taxa were identified from Coscinium fenestratum (Goveas et al.

2011)and 49 taxa from Nepetartanjensis (Grbić et al.

2015). Also, Sadaka and Ponge (2003) and Shanthi and Vittal (2010) identified 36 and 54 fungal taxa from Quercus Rotundifolia and Pavetta indica respectively.

Green leaves are usually richer in nutrients than leaf litters (Lodge et al. 2014), thus supporting a more diverse species of microfungi. Green leaves of belian are thick and leathery in texture making it to last longer before decomposing. The high number of fungal taxa from leaves of belian tree altogether shows that this plant species supports the growth of many microfungal species.

Aphanocladium aranearum

Isolation of microfungi Isolation of microfungi was based on the methods of Rakotoniriana et al. (2008) and Lateef et al. (2014) for endophytic fungi and saprobic fungi respectively, with some modifications. For endophytic fungi, the leaves were washed under running tap water to remove dust and debris adhering to them. The leaves were then cut into 1 cm2 with and without the midribs under aseptic conditions using a sterile scalpel. They were then surface sterilized with 70% ethanol for one minute, then in 10 % hydrogen peroxide (H2O2) solution for five minutes, rinsed with 70% ethanol for one minute and finally rinsed with deionized sterile distilled water five times to remove the sterilants and blotted on sterile filter paper to remove excess water. Five segments were plated separately on water agar (WA) and malt extract agar (MEA). The Petri dishes were sealed with parafilm and incubated at room temperature. Observation and isolation of the growing microfungi starts from the third day of incubation for MEA and four weeks for WA. For saprophytic microfungi, the leaf samples were washed with double sterilized distilled water, cut into 1 cm2 into a 500 mL conical flask, washed again with sterile distilled water for 5 times and then blotted on sterilized filter paper. The leaf segments were then plated as done for the endophytic microfungi. A total of 200 leaf segments were plated, 100 each for green leaves and leaf litters. 20 replicate petridishes were used for the green leaves and leaf litters separately.

Frequencies of occurrence of each microfungi on the leaf segments were recorded. A Motic stereo microscope (MZ 168) and an Olympus compound microscope (CX-31) were used for monitoring of fungal reproductive structures and pictures were taken with a hand-held Samsung camera model ES91. Identification of the observed microfungi were made to genus level, and wherever possible, to species level.

RESULTS AND DISCUSSION

Number of occurence

samples were collected randomly under the belian tree, green leaves as just fallen green leaves and litters as already brown and weak leaves. The belian trees were very tall and it is practically impossible to detach a leaf from it.

The samples collected were put in plastic bags, labeled and transported to the laboratory for processing.

265

Figure 1. Most dominant microfungal taxa on both green leaves and leaf litters of Eusideroxylon zwageri (belian)

266

B I O D I V E R S IT A S 16 (2): 264-268, October 2015

Table 1. Percent dominance of microfungi on green leaves and leaf litters of Eusideroxylon zwageri (belian)

Microfungal species

Green leaves (%) 1.56 3.91 5.86 1.17

Acladium state of Botryobasidium consperum Acremonium macroclavatum Ts. Watan.

Aphanocladium aranearum (Petch) W. Gams Aspergillus nomius Kurtzman, B.W. Horn & Hesselt.

Aureobasidium pullulans (de Bary & 1.17 Löwenthal) G. Arnaud Aureobasidium sp.

0.39 Basidiomycetes 0.39 Beltrania rhombica Penz.

1.95 Bipolaris sp.

0.39 Bispora sp.

1.17 Melanized Mycelia sterilia 1.17 Botryodiplodia sp.

0.39 Botrytis sp.

0.39 Brachyphoris sp.

1.17 Calonectria pyrochroa (Desm.) Sacc.

0.39 Calosphaeria cyclospora (Kirschst.) Petr.

0.78 Camposporium sp.

0.78 Ceriospora polygonacearum (Petr.) Piroz. & 0 Morgan-Jones Chaetendophragmia sp.

0.39 Chaetomium sp.

0.78 Chaetopsina sp.

3.91 Chaetosphaeria sp.

0.39 Chalara pteridina Syd. & P. Syd. 3.13 Chrysosporium merdarium (Ehrenb.) J.W. Carmich 0.39 Circinotrichum sp.

4.69 Colletotrichum acutatum J.H. Simmonds 3.52 Cryptosporium tami Grove 1.17 Cylindrocladium camellia Venkataram. & 0.39 C.S.V. Rame Cylindrocladiella parva (P.J. Anderson) Boesew. 0 Cylindrocladium sp.

1.17 Dactylaria obtriangularia Matsush.

0.78 Didymella effusa (Niessl) Sacc.

1.56 Didymella sp.

0.39 Diplodia sp.

0.39 Drechslera sp.

0.39 Epicoccum nipponicum Matsush.

0.39 Fusarium merismoides Corda 0.39 Fusarium solani (Mart.) Sacc.

1.56 Gonytrichum sp.

0.78 Harpographium sp.

1.17 Hyphomycetes sp.1 0.78 Hyphomycetes sp.2 1.56 Hyphomycetes sp.3 3.13 Isthmotricladia sp.

1.56 Metacapnodium juniperi (W. Phillips & Plowr.) 0.39 Speg.

Monacrosporium sp.

0 Mortierella sp.1 0.39 Mortierella sp.2 1.17 Calonectria colhounii Peerally 2.73 Nectria sp.

1.17 Neottiosporella sp.

0 Oidiodendron sp.

0.39 Periconia sp.

3.13 Pestalotiopsis sp.

0.78 Pestalotiopsis versicolor (Speg.) Steyaert 0.78

Leaf litters (%) 3.68 0 11.03 0 0 0 0.74 3.68 1.47 1.47 0 0 0 0 0 0 0 1.47 0 0 0 0 11.03 0 0 0 0 0 2.94 0 0 1.47 0 0 0 0 0 0 0 0 0 0 10.29 0 0 0.74 0 0 0 16.18 2.94 0 0 0 0

Phaeostalagmus sp.

Phoma sp.

Physarum sp.

Piricauda cochinensis (Subram.) M.B. Ellis Rhinocladiella cristaspora Matsush.

Septonema sp.

Sordaria fimicola (Roberge ex Desm.) Ces. & De Not. Speiropsis pedatospora Tubaki Hyaline Mycelia sterilia Subulispora longirostrata Nawawi & Kuthub.

Subulispora procurvata Tubaki Tetrabrunneospora ellisii Dyko Thielavia sp.

Thozetella sp.

Trichoderma koningii Oudem.

Trichosporiella sp.

Vermispora sp.

Veronaea indica (Subram.) M.B. Ellis Volutella ciliata (Alb. & Schwein.) Fr.

0.39 0.78 3.91 1.95 3.52 0.78 0.39

0 7.35 0 0 0 0 0

1.17 4.30 0.39 2.34 0 1.56 0.78 6.25 1.95 0 0.78 0

0 3.68 0 1.47 1.47 0 0 9.56 0 2.94 0 4.41

Table 2. Diversity indices and Similarity index of the microfungal communties on green leaves and leaf litters of Eusideroxylon zwageri (belian) Diversity index

Green leaves

Leaf litters

Number of isolates Observed species Number of Singletons Number of Doubletons ACE species estimate ± SD Chao 1 species estimate ± SD Shannon Index ± SD Simpson Inv Index ± SD

256 67 21 12 83.09 83.09 3.85 35.93

132 20 2 6 20.14 20.14 2.63 11.11

Table 3. Similarity index of microfungi on green leaves and leaf litters of Eusideroxylon zwageri (belian) Samples

Index numbers

Species observed on green leaves Species observed on leaf litters Shared Species Observed Sorensen Classic Morisita-Horn Bray-Curtis

67 20 14 0.322 0.442 0.366

Fourteen taxa were commonly identified from both green leaves and leaf litters with a Bray-Curtis similarity index of 0.366 (Table 3). Consequently, there were a total of 53 fungal taxa exclusively identified on green leaves while 7 taxa were from the leaf litters (Figure 3). There were more species exclusively on the green leaves than on the leaf litters which further suggests that the green leaves are more suitable for fungal growth. Furthermore, Metacapnodium juniperi, Phaeostalagmus sp. and Monacrosporium sp. were identified from green leaves and leaf litters respectively, of which these species are not

ADEBOLA et al. â&#x20AC;&#x201C; Microfungi on Eusideroxylon zwageri

267

B

C

A

D

E

H

F

G

I

J

Figure 2. Some microfungal diversity on green leaves and leaf litters of Eusideroxylon zwageri (belian). A. Speiropsis pedatospora, B C. Conidia of S. pedatospora, D. Physarum sp., E. Conidia of Subulispora longirostrata, F. Circinotrichum sp.,G. Conidiophores of Monacrosporium sp., H. Conidia of Monacrosporium sp., I. Conidia of Beltrania sp., J. Chalara sp.

Figure 3. Number of microfungi exclusively observed only on green leaves and leaf litters of Eusideroxylon zwageri (belian)

usually frequently isolated from other plant species. Many rare fungal species have been identified on endangered plant species in New Zealand (Buchanan et al. 2002) and also in Sarawak (Hughes 1977). This occurrence signifies the microfungal loss which can be suffered with the extinction of such endangered plant species including belian.

Also, comparison of the fungal communities observed on belian leaves with other plant species in the family Lauraceae showed some similarity in their microfungal communities, in which Acremonium sp., Beltrania sp., Chaetopsis sp., Chalara sp., Dactylaria sp., Pestalotiopsis spp, Rhinocladiella cristaspora, Subulispora sp., Thozetella sp. and Volutella sp. have been recorded on leaves of Cryptocarya mackinnoniana (Paulus et al. 2006) as saprobic species. Colletotrichum acutatum have previously been isolated from Chlorocardium rodiei (Cannon and Simmons 2002) and Cinnamomum bejolghota

268

B I O D I V E R S IT A S 16 (2): 264-268, October 2015

(Suwannarach et al. 2012) as an endophyte. Fusarium solani, Nectria sp., Oidiodendron sp., Periconia sp., Pestalotiopsis sp., Phoma sp. and Trichoderma sp. were also recovered from Cinnamomum bejolghota (Suwannarach et al. 2012). Other taxa recorded in this study are reported for the first time in the family Lauraceae.

The high demand for wood materials from belian and its slow growth, coupled with its habitat destruction makes it vulnerable to extinction. This study is the first report of microfungal communities on belian leaves in Sarawak.

Green leaves supported a higher number of microfungi than the leaf litters. This observation contributes to the understanding of the biology of E. zwageri and can be used to strengthen its conservation importance.

ACKNOWLEDGEMENTS The first author is grateful to Universiti Malaysia Sarawak (UNIMAS) for the Zamalah scholarship awarded.

We are also grateful to the Sarawak government and to Sarawak Forestry Co-operation (SFC) for permission to collect samples from the National Park.

REFERENCES Buchanan P, Johnston P, Pennycook S, McKenzie E, Beever R. 2002.

Data-deficient 2002, Rare and endangered fungi, Landcare Research. www.landcareresearch.co.nz/science/plants-animals-fungi/fungi/rareand-endangered-fungi/data-deficient-2002 [Aug 8, 2015].

Cannon PF. 1997. Strategies for rapid assessment of fungal diversity.

Biodiv Conserv 6: 669-680.

Cannon PF, Simmons CM. 2002. Diversity and host preference of leaf endophytic fungi in the Iwokrama Forest Reserve, Guyana.

Mycologia 94: 210-220.

Colwell RK. 2013. EstimateS: Statistical Estimation of Species Richness and Shared Species from Samples. Version 9 and earlier. User’s Guide and Application. http://purl.oclc.org/estimates. [Aug 8, 2015].

Govaerts R. 2001. How many species of seed plants are there? Taxon 50: 1085-1090.

Goveas SW, Madtha R, Nivas SK, D’Souza L. 2011. Isolation of endophytic fungi from Coscinium fenestratum (Gaertn.) Colber. a red listed endangered medicinal plant. Bulg J Agric Sci 17: 767-772.

Grbić ML, Stupar M, Unković N, Vukojević J, Stevanović B, Grubišić D. 2015 May 9. Diversity of microfungi associated with phyllosphere of endemic Serbian plant Nepeta rtanjensis Diklić & Milojević. Braz J Bot 38 (3): 597-603.

Hata K, Futai K. 1995. Endophytic fungi associated with healthy pine needles and needles infested by the pine needle gall midge, Thecodiplosis japonensis. Can J Bot 73: 384-390.

Hawksworth DL. 1991. The fungal dimension of biodiversity magnitude, significance, and conservation. Mycol Res 98: 641-655.

Hawksworth DL. 2001. The magnitude of fungal diversity: the 1.5 million species estimate revisited. Mycol Res 105: 1422-1432.

Hawksworth DL, Rossman AY. 1997. Where are all the undescribed fungi? Phytopathology 87: 888-891.

IUCN. 1998. Eusideroxylon zwageri. Asian Regional Workshop on Conservation & Sustainable Management of Trees, Viet Nam, August 1996: The IUCN Red List of Threatened Species 1998: e.T31316A9624725. http://dx.doi.org/10.2305/IUCN.UK.1998.

RLTS. T31316A9624725.en [Sep 25, 2015].

Lateef AA, Sepiah M, Bolhassan MH. 2014. Microfungi on green leaves and leaf litters from Santubong National Park, Sarawak. In: Microbes for the Benefits of Mankind, Proceedings of the International Conference on Beneficial Microbes (ICOBM), School of Industrial Technology, Universiti Sains Malaysia 2014, Sarawak.

Lodge DJ, Cantrell SA, González G. 2014. Effects of canopy opening and debris deposition on fungal connectivity, phosphorus movement between litter cohorts and mass loss. For Ecol Manag 332: 11-21.

O’Brien HE, Parrent JL, Jackson JA, Moncalvo J-M, Vilgalys R. 2005.

Fungal community analysis by large-scale sequencing of environmental samples. Appl Environ Microbiol 71: 5544-5550.

Osono T. 2008. Endophytic and epiphytic phyllosphere fungi of Camellia japonica: seasonal and leaf age-dependent variations. Mycologia 100: 387-391.

Paulus BC, Kanowski J, Gadek PA, Hyde KD. 2006. Diversity and distribution of saprobic microfungi in leaf litter of an Australian tropical rainforest. Mycol Res 110: 1441-1454.

Prance GT, Beentje H, Dransfield H, Johns R. 2000. The tropical flora remains undercollected. Ann Mo Bot Gard 87: 67-71.

Rakotoniriana EF, Munaut F, Decock C, Randriamampionona D, Andriambololoniaina M et al. 2008. Endophytic fungi from leaves of Centella asiatica: occurrence and potential interactions within leaves.

Antonie van Leeuwenhoek 93: 27-36.

Sadaka N, Ponge J-F. 2003. Fungal colonization of phyllosphere and litter of Quercus rotundifolia Lam. in a holm oak forest (High Atlas, Morocco). Biol Fertil Soils 39: 30-36.

Shanthi S, Vittal BPR. 2010. Fungi associated with decomposing leaf litter of cashew (Anacardium occidentale). Mycology 1: 121-129.

Suwannarach N, Bussaban B, Nuangmek W, McKenzie EHC, Hyde KD, Lumyong S. 2012. Diversity of endophytic fungi associated with Cinnamomum bejolghota (Lauraceae) in Northern Thailand. Chiang Mai J Sci 39: 389-398.

Wortley AH, Scotland RW. 2004. Synonymy, sampling and seed plants.

Taxon 53: 478-480.

B I O D I V E R S IT A S Volume 16, Number 2, October 2015 Pages: 269-280

ISSN: 1412-033X E-ISSN: 2085-4722 DOI: 10.13057/biodiv/d160223

Leguminicolous fungi associated with some seeds of Sudanese legumes SOHAIR A. ABDULWEHAB1, SAIFELDIN A. F. EL-NAGERABI2,, ABDULQADIR E. ELSHAFIE3 1 Department of Botany, Faculty of Science, University of Khartoum, P.O. Box 321, Khartoum, Postal Code 11111, Sudan Department of Biological Sciences and Chemistry, College of Arts and Science, University of Nizwa, Birkat Al Mouz, Nizwa, P. O. Box 33, PC 616, Oman. Tel.: + 968-9636-5051, Fax.: +968-25443050, email: nagerabi@unizwa.edu.om 3 Department of Biology, College of Science, Sultan Qaboos University, P.O. Box 36, AlKhoudh, Postal Code 123, Oman

2

Manuscript received: 29 July 2015. Revision accepted: 28 September 2015.

Abstract. Abdulwehab SA, El-Nagerabi SAF, Elshafie AE. 2015. Leguminicolous fungi associated with some seeds of Sudanese legumes. Biodiversitas 16: 269-280. The mycoflora associated with seeds evidently deteriorate seed viability, germination, emergence and plant growth performance leading to apparent losses in production and productivity. In the present investigation, seedborne fungi of six legumes were screened. Twenty six species of fungi from 14 genera were isolated from this seeds. Of these isolates, 6 species are new reports to the mycoflora of Sudan, whereas some species are new records to the mycoflora of these legumes. These include 6 species for Cajanus cajan, Cicer arietinum (10 species), Dolichos lablab (7 species), Medicago sativa (8 species), Phaseolus vulgaris (10 species), and Vigna unguiculata (11 species). The seeds are obviously contaminated with saprophytic and pathogenic fungi (1764%) which evidently inhibited seed germination (41-86%), and seedling emergence (29-81%). The Alternaria, Aspergillus and Fusarium (4 species each) were the most prevalent fungi followed by Curvularia, Drechslera (3 species), Fusariella, Ulocladium (2 species) and one species for the remaining genera (Aureobasidium, Acremonium, Memnoniella, and Rhizopus). Hence, there is a high need for establishment of standard seed testing methods with strong legislations in order to meet the international quarantine regulations.

The use of certified seeds by the farmers is recommended.

Key words: Cajanus cajan, Cicer arietinum, Dolichos lablab, Medicago sativa, Phaseolus vulgaris, Vigna unguiculata, seedborne, Sudan

INTRODUCTION Legumes of the family Fabaceae are one of the most important plants cultivated as pulse or forage crops in many tropical and temperate regions. They are rich sources of plant protein and oil as human food and animals feed (Embaby and Abdel-Galil 2006; Swami and Alane 2013; Saleem and Ebrahim 2014). In Sudan, several leguminous crops such as Cajanus cajan, Cicer arietinum, Dolichos lablab, Medicago sativa, Phaseolus vulgaris, and Vigna unguiculata are cultivated as green manure for improving the soil fertility and reduced the amount of the expensive nitrogen fertilizer. Cajanus cajan (L.) Millsp. belong to the family Fabaceae and is placed in Papilionaceae of semiarid tropics is grown as grain crops with high levels of important amino acids and proteins. It is cultivated for consumption of its dry seeds and the unripe green seeds serve as a cooked vegetable. The forage of this plant fed to livestock, and the stems are used for firewood and as hedgerow for windbreak (Pal et al. 2011; Singh and Kaur 2012). Cicer arietinum L. (Chickpea, Gram) also known as “Humus, Kabkabeik” in Arabic, is important pulse legume throughout the globe (Duke 1981).

The green immature pods and dry seeds are used as green vegetable or dry pulse boiled or fried, where the green and dried stems and leaves are used for feeding livestock. Dolichos lablab (Hyacinth lablab, Bonavista, and Egyptian bean) and “Lubia Afin” in Arabic is grown for food where young immature pods are cooked and eaten like

green bean. Young leaves are used in salads and older leaves are cooked like Spinach. Starchy root tubers, immature and dried seeds can be boiled and eaten (Sarwatt et al. 1991). Medicago sativa L. (Medic, Alfalfa, Lucerne, Queen of Forage) which is also known as “Barsim hegazi” in Arabic was originated near Iran and endemic to Mediterranean region. It is extensively grown in warm temperate and cool subtropical regions as the most widely adapted agronomic crop. It is highly valued as forage legume having highest feeding values (Duke 1981). The seeds are used in many folk medicines and as lactigenic.

Phaseolus vulgaris L. is known as common bean, kidney bean or “Fasulia” in Arabic is one of the five cultivated species of this genus as major grain legume crop, third in importance after soybean and peanuts, but first in direct human consumption (Broughton et al. 2003). It is grown for its green leaves, green pods, and immature and dry seeds. The dry bean are eaten in cooked dishes, bean flour, whereas the dry leaves, threshed pods and stalks are fed to animals and used as fuel for cooking in Africa and Asia.

Vigna unguiculata (L.) Walp. which is known as cowpea, black-eyed pea or “Lubia helo” in Arabci is an annual legume that was domesticated in West Africa.

It is important grain legume and leaf vegetable in much of Africa and part of Asia. It is used as human diet, forage, cover, and green manure crop in many part of the world.

Tender shoot tips, leaves, immature pods and seeds can be consumed as well as dry seeds for making flour.

Nonetheless, the seeds of these legumes are susceptible to

270

B I O D I V E R S IT A S

16 (2): 269-280, October 2015

fungal contamination, resulting in seeds deterioration (Rathod et al. 2012; Swami and Alane 2013). These fungi are of saprophytic or pathogenic nature which affects seed germination, emergence from soil, plant growth vigor and storability (Saleem and Ebahim 2014). Worldwide, many studies have reported about the biology of the seedborne and plant diseases associated with these leguminous crops (Nath et al. 1970; Deo and Gupta 1980; Nakkeeran and Devi 1997; Rathod et al. 2012).

The Alternaria, Aspergillus, Curvularia, Drechslera, Eurotium, Fusarium, Mucor, Penicillium, Rhizoctonia, Rhizopus, Sclerotium, and Gliocladium were the most common fungal genera isolated from different legume seeds: broad bean (Vicia faba), kidney bean (Phaseolus vulgaris), lupine (Lupinus termis), cowpea (Vigna sinensis), chickpea (Cicer arietinum) and pea (Pisum sativum) under different environmental conditions throughout the World (Tseng et al. 1995; Ruiz et al. 1996; El-Nagerabi and Elshafie 2000; Kritzinger et al. 2003; Castillo et al. 2004; Kumar et al. 2004; Domijan et al.

2005; Embaby and Abdel-Galil 2006; Attitalla et al. 2010).

Fusarium semitectum, F. graminearum, F. chlamydosporum, F. equiseti, F. proliferatum and F. subglutinans were the most dominant fungal species in the seeds of Phaseolus vulgaris and Vigna sinensis from Argentina and South Africa (Castillo et al. 2004; Kritzinger et al. 2003). Alternaria alternata, Sclerotinia sclerotiorum, Rhizoctonia solani, F. semitectum, and Acremonium strictum were the dominant species in black bean whereas A. alternata, Lasiodiplodia theobromae, Drechslera spicifera and F. moniliforme were isolated from cowpea (Castillo et al. 2004). The most common seedborne fungi isolated from Phaseolus vulgaris were from Alternaria, Aspergillus, Penicillium, Rhizopus, Cladosporium, and Trichothecium genus (Domijan et al. 2005).

In Sudan, many leguminous crops are cultivated under different climatic conditions. These seeds are locally produced or imported and stored by the farmers under poor quarantine regulations and legislations. Therefore, seed contamination can occur by seedborne fungi which adversely affect the production and productivity of these crops. There is a high possibility for isolation of many saprophytic and pathogenic fungi from various substrates including seeds (Elshafie 1985, 1986). A few studies were conducted on some of the seedborne fungi associated with locally produced leguminous crops such as peas, soybean (El-Nagerabi et al. 2000a, 2000b), guar, lupine (ElNagerabi and Elshafie 2000, 2001a, 2001b), faba bean (ElNagerabi et al. 2001), and fenugreek (El-Nagerabi 2000).

Therefore, the present study was designed to investigate the quality and the incidence level of the seedborne fungi from six leguminous crops namely Cajanus cajan, Cicer arietinum, Dolichos lablab, Medicago sativa, Phaseolus vulgaris, Vigna unguiculata and to assess their effect on seed germination and seedling emergence. These information may improve knowledge about invading fungi and control measures and good management practices to prevent some fungi in legumes.

MATERIALS AND METHODS Collection of the seed samples Ninety seed samples from six leguminous crop namely Cajanus cajan, Cicer arietinum, Dolichos lablab, Medicago sativa, Phaseolus vulgaris, and Vigna unguiculata were purchased from seed companies in Khartoum State, Sudan. The samples were collected and tested as recommended by the rules of the International Seed Testing Association (ISTA 1966).

Seed germination In this study, the blotter method was used according to the procedure adopted by the International Seed Testing Association (ISTA 1966). For this, 400 seeds from each sample were inoculated on sterilized moistened filter paper in Petri plates (Blotter). The seeds were aseptically spaced according to their size at equal distance. The inoculated plates were incubated in Gallenkamp illuminated incubator at 28ºC under alternating cycle of 12 hours near ultraviolet light and darkness to enhance sporulation of many of the seedborne fungi. The seeds were kept moistened by adding sterile distilled water throughout the incubation period of two weeks and the percentage of seed germination was recorded.

Emergence of seeds in soil The emergence levels of the seeds from the soil was tested by sowing 200 seeds from each type of the selected legumes in pots filled with uniform mixture of sand and silt (2: 1). The seeds were covered with soil layer of 1-3 cm deep depending on the seed size. The seeds were sown at the rate of 20 seeds per pot and were kept in the Botanical garden of the Department of Botany, University of Khartoum, which is of partial shade and average temperature of between 27ºC and 29ºC. The average percentage of seed emergence was recorded for each vegetable crop.

Isolation and estimation of fungi The seedborne fungi were isolated using agar plate method (ISTA 1966). Four hundred seeds from each sample were surface disinfected with 1% sodium hypochlorite for 5 min and washed with several changes of sterile distilled water. The treated seeds were then inoculated aseptically on Potato Dextrose Agar (PDA) and incubated at 28ºC ±2ºC for two weeks. The fungal colonies developed around the seeds were examined, and identified microscopically. The average levels of contamination and incidence were reported.

Identification of isolated fungi The isolated fungi were identified using macroscopic features based upon colony morphology and microscopic observations of mycelia and asexual/sexual spores (Barnett 1955; Raper and Fennell 1965; Pitt 1979; Ellis 1971, 1976; Sutton 1980; Webster 1980; Nelson et al. 1983; Samson et al. 1995; Barnett and Hunter 1998, 2003; Barac et al.

2004). For non-sporulating fungi, mycelial fragments were inoculated on Malt Extract Agar (MEA) and incubated at

ABDULWEHAB et al. – Fungi of Sudanese seeds legumes

28ºC ± 2ºC to stimulate their sporulation and were then identified to species level. Some of these fungi were illustrated (Figures 1-18).

RESULTS AND DISCUSSION Twenty six species of fungi which belong to 14 genera were recovered from 90 seed samples of six leguminous crops namely Cajanus cajan (pigeon pea), Cicer arietinum (chickpea), Dolichos lablab (hyacinth), Medicago sativa (alfalfa), Phaseolus vulgaris (kidney bean), and Vigna unguiculata (cowpea). From these isolates, 6 species are new records to the mycoflora of Sudan, whereas different fungal species were reported for the first time in the seeds of the tested legumes (Table 1). The seeds were evidently contaminated with both saprophytic and pathogenic fungi (17-64%) and displayed variable levels of seed germination (41-86%), and seedling emergence from the soil (29-81%) (Table 2). The genera of Alternaria, Aspergillus and Fusarium (4 species each) were the most dominant species followed by Curvularia, Drechslera (3 species), Fusariella, Ulocladium (2 species) and one species for the remaining genera (Aureobasidium, Acremonium, Memnoniella, and Rhizopus).

Worldwide, many researchers investigating the biology of the seedborne mycoflora from numerous crops such as fruits, vegetables, cereals, and legumes (Nath et al. 1970; Deo and Gupta 1980; Nakkeeran and Devi 1997; Rathod et al. 2012). The seeds of legumes were found to be heavily infested with numerous mycoflora (Swami and Alane 2013). However, published results on seedborne fungi of leguminous cops are very few to negligible. Many fungi are serious parasites of the seed primordial, maturing and stored seeds and grains. Their invasion is associated with various damages such as seedling growth and yield loss.

Twelve genera of fungi (Alternaria, Aspergillus, Ascochyta, Chaetomium, Cladosporium, Fusarium, Geotrichum, Penicillium, Pythium, Rhizoctonia, Rhizopus, and Verticillium) were isolated from different legume seeds in Iraq (Sarhan 2009). Twenty four seedborne fungi belonging to different genera were detected from 145 seed samples of major legume cops in Pakistan (Rauf 2000). Of these fungi, Alternaria alternata, Ascochyta spp., Colletotrichum spp., Fusarium spp., and Macrophomina phaseolina were the most frequent and common pathogens of these crops. Alternaria, Aspergillus, Curvularia, Drechslera, Eurotium, Fusarium, Penicillium, Rhizoctonia, Mucor, Rhizopus, Sclerotium, and Gliocladium were the most common fungal genera isolated from various legume seeds (Tseng et al. 1995; Ruiz et al. 1996; El-Nagerabi and Elshafie 2000; Kritzinger et al. 2003; Castillo et al. 2004; Kumar et al. 2004; Domijan et al. 2005; Embaby and Abdel-Galil 2006; Attitalla et al. 2010). Fusarium, Penicillium, Rhizopus, Cladosporium and Alternaria were the main seedborne pathogens on the surface of five major seeds of leguminous plants from Ningxia, China (Liu et al.

2002).

In Saudi Arabia, 46 fungal species belonging to 26 genera were isolated from the seeds of 5 legumes (broad

271

beans, chickpeas, cowpeas, kidney beans, and peas) (Saleem and Ebrahim 2014). The most prevalent genera were Aspergillus, Emericella, Mucor, Mycosphaerella, Penicillium, and Rhizopus, whereas the most common species were A. flavus, A. fumigatus, A. niger, A. ochraceus, A. terreus, Emericella nidulans, Mucor racemosus, Mycosphaerella tassiana, Penicillium chrysogenum, and Rhizopus stolonifer. In the present study, the seeds of the six legume crops were highly infested with different types of fungi (17-64%) which evidently affected the seed germination (41-86%), and seedling emergence (29-81%) (Table 2). Of the few studies on the seedborne mycoflora of Cajanus cajan (pigeon peas), Alternaria tenuissima (seed or seedling rot, pod spot or rot), Botryosphaeria xanthocephalus, Cercospora cajani, C. instabilis (spotting), Colletotrichum cajani (seed or seedling rot, spotting, blight, pod spot or rot), Creonectria grammicospora, Fusarium semitectum, and Megalonctria pseudotrichia (seedling rot) were reported (Kaiser 1981).

The diseases of economic importance at the present are Fusarium wilt (F. udum), and Phytophthora blight (P. drechsleri f. sp. cajani) (Marley and Hillocks 1996; Kumar et al. 2010). Cladosporium species has been reported by Tarr (1963) as the main cause of sooty mould of pigeon peas in Sudan. In the present study, Alternaria alternata, A. tenuis, Aureobasidium pullulans, Curvularia brachyspora, C. pallescens, Drechslera rostrata, and Fusarium solani were isolated for the first time as seedborne fungi of pigeon peas (Table 1). Cladosporium spp. (18%) and Alternaria alternata (4.5%) which were associated with sooty mould of this crop are encountered in high levels of incidence comparable to other fungal isolates. The remaining isolates were recorded before in similar studies carried on the seedborne fungi of pigeon pea (e.g. Malone and Muskett 1964; Singh and Khapre 1978). Chickpea (Cicer arietinum) has been found attacked by 172 pathogens including 67 species of fungi (Nene et al. 1996). The plants are infected with a large number of fungal diseases viz. blight (Ascochyta rabiei, A. alternata, Colletotrichum dematium, Stemphylium sarciniforme), wilt (Fusarium oxysporum), powdery mildew (Leveillula taurica), dry root rot (Rhizoctonia bataticola), stem rot (Sclerotinia sclerotiorum), wet root rot (R. solani), and foot rot (Operculella padwickii) (Kaur 1995; Singh and Sharma 2005; Dubey et al. 2007).

Twenty six fungal species belonging to 15 genera were isolated from 14 seed samples of chickpea collected from different areas of Pakistan (Ahmed et al. 1993; Dawar et al.

2007). In India, Alternaria alternata, Chaetomium spp., Penicillium citrinum, A. niger, A. flavus, Rhizopus stolonifer, and Fusarium oxysporum were isolated from the seeds of this crop (Agarwal 2011). In the present investigations, 18 species of fungi belonging to 12 genera were recovered from the seeds of highly contaminated chickpea (40%). Of these isolates, A. tenuis, A. tenuissima, A. nidulans, A. terreus, Acremonium strictum, Curvularia lunata, Drechslera papendorfii, D. spicifera, Fusariella aegyptiaca, and Ulocladium atrum are considered new to the seeds of this crop (Table 1). Some of the previously reported as seedborne fungi and pathogenic to this plant

B I O D I V E R S IT A S

272

16 (2): 269-280, October 2015

Table 2. Incidence percentage (I%), number of cases isolation (NCI, out of 90 samples), and occurrence remarks (OR) of seedborne fungi of leguminous plants

Alternaria alternata (Figure 1) 4.5 N1 8.25 1.5 1.0 N 6.25 4.0 N A. dianthi (Figure 2) -3 2.5 N 0.25 N A. tenuis (Figure 3) 1.75 N 2.25 N 1.5 N 3.75 N 2.0 A. tenuissima (Figure 4) 1.25 3.0 N 4.0 N Aspergillus flavus 2.5 4.5 3.75 0.75 N 2.0 3.0 A. nidulans 1.0 0.25 N 0.5 2.75 A. niger 13.5 22.5 32.5 0.5 N 7.5 2.5 A. terreus 1.5 2.5 N 1.25 N 1.0 1.5 Aureobasidium pullulans (Figure 5) 1.25 N 0.5 N 0.1 Acremonium strictum 1.25 N 2.3 N 2.0 N Cladosporium spp.

18.0 7.3 2.0 3.5 5.0 3.5 Curvularia brachyspora (Figure 6) 2.75 N 1.5 N C. lunata (Figure 7) 1.0 N 0.5 N C. pallescens (Figure 8) 1.25 N 2.5 N 2.0 N Drechslera papendorfii (Figure 9) 3.0 N 1.5 D. rostrata (Figure 10) 2NS 1.5 N 2.75 N 2.25 N D. spicifera (Figure 11) 2.0 3.5 N 1.75 N 0.25 N 3.3 1.75 Fusariella aegyptiaca (Figure 12) NS 0.25 N 0.25 N Fusariella intermedia (Figure 13) NS 2.0 N Fusarium equiseti (Figure 14) 1.5 3.25N F. moniliforme 10.25 F. semitectum (Figure 15) 2.5 2.25 N 3.0 2.0 N F. solani (Figure 16) 2.0 N 0.75 Memnoniella echinata NS 1.0 1.75 Myrothecium roridum 0.25 N Penicillium spp.

3.0 4.25 5.0 Rhizopus stolonifer 8.25 6.5 4.5 0.5 19.5 30.0 Ulocladium atrum (Figure 17) NS 1.75 N 0.25 N Ulocladium botrytis (Figure 18) NS 2.25 N 2.75 N Note: 1N: New record to the crop, 2NS: New record to the mycoflora of Sudan, 3-: Not detected, OR: Occurrence remarks, samples, H: High, more than 45 samples, M: Moderate, between 30-45 samples, L: Low, between 15-29 samples, R: Rare, less than 15 samples.

Table 2. The percentage of seed germination and contamination of different leguminous crops Legume species Cajanus cajan (pigeon pea) Cicer arietinum Dolichos lablab Medicago sativa Phaseolus vulgaris Vigna unguiculata

Contamination % 31 40 64 17 44 47

Germination % 68 86 41 86 66 57

Emergence% 54 73 29 81 52 45

were recovered from the present seeds (Ahmed et al. 1993; Kaur 1995; Nene et al. 1996; Singh and Sharma 2005; Dawar et al. 2007; Dubey et al. 2007; Agarwal 2011). Of the few studies on the seedborne mycoflora of Dolichos

NCI/OR

Vigna unguiculata

Phaseolus vulgaris

Medicago sativa

Dolichos lablab

Cicer arietinum

Fungal isolates

Cajanus cajan

Incidence percentage (I%)

87H 36M 49H 41H 88H 32M 92H 34M 27L 18L 72H 30M 27L 39M 25L 33M 76H 12R 9R 13R 10R 31M 15L 11R 5R 38M 89H 26L 21L out of 90

lablab (Lablab purpureus), the genera of Aspergillus, Fusarium, and Penicillium were the most important fungi (Chalaut and Perris 1994). In India, Trichothecium roseum, Alternaria sp., and Fusarium sp. were linked to severe multiple infections of lablab resulting in discolored pods, and shrunken disfigured seeds (Siddaramaiah et al. 1980).

Seed germination was suppressed by A. niger while A. chevalieri, A. flavus, A. candidus, A. niveus, and A. alternata caused staining and necrosis of 23-37% of cotyledons and twisting in 19-27% (Prasad and Prasad 1987). According to Tarr (1963), many diseases of Dolichos lablab were caused by fungal species such as leaf spot (A. alternata, Cladosporium sp.), wilt (Macrophomina phaseolina, Phyllosticta spp.). In the present study, 12 species of fungi were isolated from the seeds of this crop and of these isolates Alternaria dianthi, A. tenuis, Aureobasidium pullulans, Curvularia pallescens,

ABDULWEHAB et al. â&#x20AC;&#x201C; Fungi of Sudanese seeds legumes

Drechslera spicifera, Fusarium equiseti, and F. semitectum are considered new to the mycoflora of this crop (Table 1).

Some of the previously reported as seedborne and/or pathogenic fungi were recovered from the current seed samples of D. lablab (Tarr 1963; Siddaramaiah et al. 1980; Prasad and Prasad 1987; Chalaut and Perris 1994). For Lucerne (Medicago sativa), Mycosphaerella pinodes, Botrytis cinerea, Phoma herbarum (Phoma exigua var. exigua) var. medicaginis, Fusarium roseum and Stemphylium botryosum (Pleospora tarda, Pleospora herbarum) were the most frequently encountered seedborne fungi (Leach 1960). Fusarium avenaceum was detected for the first time on the seed of Lucerne by Kellock et al.

(1978). Fusarium acuminatum, F. avenaceum, F. equiseti, F. fusarioides, F. oxysporum, F. poae, Diaporthe phaseolorum and Phoma sorghina were proven pathogenic to a range of pasture legumes including Lucerne (Trenteva 1974; Nik and Parbery 1977). Many fungal species isolated from the seeds of this plant by many authors in similar mycological investigations. These include Cercospora dematium f.sp. truncata, C. zebrina (C. medicaginis), Colletotrichum trifolii (anthracnose), F. sporotrichoides, F. oxysporum, F. sambucinum, F. avenaceum, Ascochyta infectoria, Stemphylium spp. (leaf spot), Pleospora herbarum, Stemphylium loti, S. sarciniforme, Sclerotinia sclerotiorum, and S. trifoliorum (crown rot), Verticillium albo-atrum (wilt) (Leach 1960; Maloy 1968; Trenteva 1974). In the present research, Alternaria alternata, Aspergillus flavus, A. niger, A. terreus, Curvularia lunata, Drechslera rostrata, D. spicifera, and Ulocladium botrytis were newly isolated from the seeds samples of Lucerne (Table 1). In similar studies on seedborne fungi of common bean (Phaseolus vulgaris) collected from Riyadh region, Saudi Arabia, various fungi from 11 genera were isolated such as A. alternata, A. flavus, A. flavus var. columnaris, A. niger, A. ochraceus, A. ustus, Botrytis sp., Chaetomium sp., Cladosporium sp., Fusarium spp., Penicillium chrysogenum, Phoma sp., Rhizopus stolonifer, Stemphylium sp., and Ulocladium sp. (El-Samawaty et al.

2014).

The most common seedborne fungal species isolated from common bean crops grown in 13 counties of the Republic of Croatia belong to genera of Cladosporium (98%), Alternaria (75%), Aspergillus (75%), Rhizopus (72%), Penicillium (69%), Fusarium (38%), Botrytis (27%), Trichothecium (24%), and Chaetomium (18%) (Domijan et al. 2005). In Egypt, A. niger (43.2%), A. ochraceus (2.4%), A. parasiticus (0.8%), A. flavus (0.8%), Aspergillus spp. (4.8%), Epicoccum sp. (0.8%), Fusarium oxysporum (2.4%), Fusarium spp. (5.6%), and Trichoderma spp. (11.2%) were isolated from common bean seeds (Embaby and Abdel-Galil 2006). Various seedborne fungi were isolated from the seed of this crop such as Alternaria brassicicola, Ascochyta phaseolina, A. boltshauseri (leaf spot), Aspergillus glaucus, Botrytis cinerea (chocolate spot), Rhizoctonia solani (damping off), Fusarium solani f.sp. phaseoli (stem rot), F. solani, Phyllosticta phaseolina, Aspergillus flavus (rot), F. oxysporum (wilt), A. glaucus, Colletotrichum dematium, Drechslera tetramera, F. equiseti, F. oxysporum, F.

273

moniliforme, F. semitectum, Phoma solani, Phoma sp., Phomopsis sojae, Colletotrichum lindemuthianum, Macrophomina phaseolina, Sclerotinia sclerotiorum, Rhizoctonia sp., Botrytis cinerea, Uromyces appendiculatus, Trichothecium roseum, Phytophthora sp., Diaporthe sp., Elsinoe phaseoli, Rhizoctonia solani, and Alternaria alternata, (e.g. Winter et al. 1974; Gomes and Dhingra 1983; Sesan and Dumitras 1979). In the present results, 18 species were recovered from the seeds of this crop. Of these isolates, Alternaria dianthi, A. tenuissima, A. tenuis, Acremonium strictum, Curvularia brachyspora, Drechslera papendorfii, Fusariella aegyptiaca, F. intermedia, Myrothecium roridum, and Ulocladium atrum were recovered for the first time from the seed of common bean (Table 1). In similar mycological investigations on the seedborne fungi of cowpea (Vigna unguiculata), A. niger (62.2%), A. parasiticus (6.7%), Aspergillus spp. (15.6%), and Fusarium spp. (4.4%) were the most frequently isolated from this crop (Embaby and Abdel-Galil 2006).

Cowpea seeds collected from Riyadh region, Saudi Arabia were found contaminated with Alternaria alternata, A. flavus, A. flavus var. columnaris, A. niger, A. parasiticus, A. ustus, Cladosporium sp., Curvularia sp., Fusarium sp., Mucor sp., Nigrospora sp., Penicillium spp., Rhizopus stolonifer, and Ulocladium sp. (El-Samawaty et al. 2014). In Benin, West Africa, A. flavus, a fungus that produces aflatoxins, was the most frequently encountered (Houssou et al. 2009). Many fungi were isolated from the seeds of cowpea by several authors such as Myrothecium leucotrichum, Rhizoctonia solani, Ascochyta sp., Colletotrichum lindemuthianum, C. truncatum, Fusarium oxysporum, Corticium rolfsii, Colletotrichum capsici, Cercospora canescens, Aspergillus spp., A. flavus, A. niger, Botrytis cinerea, Cacumisporum sp., Cephalosporium sp., Chaetomium sp., Curvularia verruculosa, Diaporthe phaseolorum, Drechslera hawaiiensis, D. spicifera, Fusarium equiseti, F. fusarioides, Memniella sp., Nigrospora sp., Penicillium spp., Phoma sp., Pithomyces sp., Alternaria infectoria, Stachybotrys sp., Cencephalastrum racemosus, Pestalotiopsis nagniferae, A. terreus, C. lunata, Pleospora infectoria, Rhizoctonia bataticola, and Rhizopus stolonifer (e.g. Singh and Khapre 1978; Enechebe and McDonald 1979; Sesan and Dumitras 1979).

Different pathogenic fungi were associated with many devastating diseases of cowpea plant including Ascochyta phaseolorum (leaf and pod spot), Cladosporium vignae (Leaf spot), Cercospora canescens, C. cruenta, C. lunata, Phyllosticta phaseolorum, Sporidesmium bakeri, Uromyces vignae, Capnodium spp., and Cladosporium herbarum (sooty mould), Fusarium oxysporum f. sp. tracheiphilum (wilt), Rhizoctonia solani, Myrothecium leucotrichum, Aspergillus terreus (brown lesions), Curvularia lunata, Rhizoctonia bataticola and F. concolor (post-emergence death and stem lesions), Oidium sp., and Sphaerotheca fuliginea (powdery mildew), and Macrophomina phaseoli (wilt) (Singh and Khapre 1978; Enechebe and McDonald 1979; Siddaramaiah et al. 1980). In the present research, Alternaria alternata, A. terreus, A. flavus, A. nidulans, A. niger, Acremonium strictum, Cladosporium spp., Curvularia

B I O D I V E R S IT A S

274

16 (2): 269-280, October 2015

A

A

C

B

B

Figure 1. Alternaria alternata (A) Conidia, (B) Conidiophores. Bar = 50 µm

Figure 2. Alternaria dianthi (A) Conidia, (B) Conidiophores, (C) Chlamydospores. Bar = 50 µm

A A B

B

Figure 3. Alternaria tenuis (A) Conidia, (B) Conidiophores. Bar = 50 µm

Figure 4. Alternaria tenuissima Conidiophores. Bar = 50 µm

(A)

Conidia,

(B)

ABDULWEHAB et al. – Fungi of Sudanese seeds legumes

275

A A

B

B

Figure 5. Aureobasidium pullulans (A) Conidia, (B) Conidiophores.

Bar = 50 µm

Figure 6. Curvularia brachyspora Conidiophores. Bar = 25 µm

(A)

Conidia,

(B)

A

A

B B

Figure 7. Curvularia lunata (A) Conidia, (B) Conidiophores. Bar = 25 µm

Figure 8. Curvularia pallescens (A) Conidia, (B) Conidiophores.

Bar = 25 µm

B I O D I V E R S IT A S

276

16 (2): 269-280, October 2015

A

A

B

B

Figure 9. Drechslera papendorfii (A) Conidia, (B) Conidiophores.

Bar = 25 µm

Figure 10. Drechslera rostrata (A) Conidia, (B) Conidiophores.

Bar = 50 µm

A

A

B

B

Figure 11. Drechslera spicifera (A) Conidia, (B) Conidiophores.

Bar = 50 µm

Figure 12. Fusariella aegyptiaca (A) Conidia, (B) Phialides. Bar = 25 µm

ABDULWEHAB et al. – Fungi of Sudanese seeds legumes

277

A A

B

B

Figure 13. Fusariella intermedia (A) Conidia, (B) Phialides. Bar = 25 µm

Figure 14. Fusarium equiseti Chlamydospores. Bar = 25 µm

(A)

Macroconidia,

(B)

(A)

Macroconidia,

(B)

A

A

B B

Figure 15. Fusarium semitectum (A) Primary microconidia, (B) Secondary macroconidia. Bar = 25 µm

Figure 16. Fusarium solani Chlamydospores. Bar = 25 µm

B I O D I V E R S IT A S

278

16 (2): 269-280, October 2015

A A

B B

Figure 17. Ulocladium atrum (A) Conidia, (B) Conidiophores. Bar = 25 Âľm

Figure 18. Ulocladium botrytis (A) Conidia, (B) Conidiophores.

Bar = 25 Âľm

pallescens, Drechslera rostrata, D. spicifera, F. semitectum, Rhizopus stolonifer, and Ulocladium botrytis were recovered from the seeds of cowpea (Table 1). Of these isolates, 6 species are considered new to this crop including A. alternata, Acremonium strictum, Curvularia pallescens, D. rostrata, F. semitectum, Ulocladium botrytis (Table 1).

Numerous saprophytic fungal genera were linked with hazardous plant diseases to many plants. The main genera of Alternaria, Aspergillus, Chaetomium, Cladosporium, Curvularia, Drechslera, Fusarium, Penicillium, Rhizopus, Ulocladium, are commonly known as saprophytes, however, some species of these genera can cause destructive plant diseases (Kamble et al. 1999; El-Nagerabi and Elshafie 2002). In our results, many species of these genera were isolated from the seed samples of the tested legumes (Table 1) and showed high levels of contamination (17-64%), which apparently affected seed germination (4186%) and seedling emergence (29-81%) as concluded by many authors (Kamble et al. 1999; El-Nagerabi and Ahmed 2001; Abdelwehab et al. 2014). In similar pathogenicity studies on different plants, some of these fungi were considered pathogenic and caused various plant diseases; leaf lesion of Poa pratensis (Curvularia pallescens), seed rot of Sorghum bicolor (Drechslera spicifera), leaf spot (D. rostrata), seedling blight (C. lunata), and Fusarium solani wilt (Richardson 1997; Abdelwehab et al. 2014).

The fungal flora invaded the seeds of six leguminous crops and their evident effect on seed germination and seedling emergence were investigated. The seeds were evidently contaminated with both saprophytic and pathogenic mycoflora (17-64%) which apparently reduced seed germination (41-86%), and seedling emergence (2981%). These fungal isolates are natural contaminant on different seeds whereas some of them are new reports to the mycoflora of these legumes and to the fungal flora of Sudan. Therefore, their devastating effects on seed germinations, plant growth and vigor and eventually losses in production and productivity together with suitable control measures need further intensive investigations and evaluation. Setting proper seed testing method, and proper quarantine regulations and legislations is urgently required.

ACKNOWLEDGEMENTS We thank the Department of Botany, Faculty of Science, University of Khartoum, Department of Biological Sciences and Chemistry, College of Arts and Sciences, University of Nizwa, and Department of Biology, College of Science, Sultan Qaboos University for providing space and facilities to carry this research. We thank the University of Nizwa Writing Center for proof reading the English of this article.

ABDULWEHAB et al. â&#x20AC;&#x201C; Fungi of Sudanese seeds legumes

REFERENCES Abdelwehab SA, El-Nagerabi SAF, Elshafie AE. 2014. Mycobiota associated with imported seeds of vegetable crops in Sudan. Open Mycol J 8: 156-173.

Agarwal T, Malhotra A, Trivedi PC. 2011. Fungi associated with chickpea, lentil and blackgram seeds of Rajasthan. Intl J Pharm Biosci 2 (4): 478-483.

Ahmed I, Iftikhar S, Bhutta AR. 1993. Seed borne microorganism in Pakistan. A checklist 1991. Pakistan Agricultural Research Council, Islamabad, Pakistan.

Attitalla I, Al-Ani LKT, Nasib MA, Balal IAA, Zakaria M, El-Maraghy SSM, Karim SMR. 2010. Screening of fungi associated with commercial grains and animal feeds in Al-Bayda governorate, Libya.

World Appl Sci J 9 (7): 746-756.

Barac T, Tghavi S, Borremans B, Provoost A, Oeyen L, Colpaert JV, Vangronsveld J, van der Leile D. 2004. Engineered endophytic bacteria improve phytoremediation of water-soluble, volatile, organic pollutants. Nat Biotechnol 22: 583-588.

Barnett HL. 1955. Illustrated Genera of Imperfect Fungi. Burgess Publishing Company, Minneapolis.

Barnett HL, Hunter BB. 1998. Illustrated Genera of Imperfect Fungi.

Prentice-Hall, Inc., New York.

Barnett HL, Hunter BB. 2003. Illustrated Genera of Imperfect Fungi.

Burgess Publishing Company, Minneapolis..

Broughton WJ, Hernandez G, Blair MW, Beebe SE, Gepts P, Vanderleyden J. 2003. Beans (Phaseolus spp.)-Model food legumes.

Plant Soil 252: 55-128.

Castillo MD, Gonzulez HHL, Martinez EJ, Pacin AM, Resnik SL. 2004.

Mycoflora and potential for mycotoxin production of freshly harvested black bean from the Argentinean main production area.

Mycopathologia 158 (1): 107-12.

Chalaut MMde, Perris S. 1994. Pathogenic fungi in seeds of tropical forage species. Pasturas Tropicales 16 (1): 41-43.

Dawar S, Syed F, Ghaffar A. 2007. Seed borne fungi associated with chickpea in Pakistan. Pakistan J Bot 39 (2): 637-643.

Deo PP, Gupta JS. 1980. A note on the mycoflora associated with seeds of grain (Cicer arietinum L.) during storage. Seed Res 8 (1): 83-84.

Domijan AM, Peracia M, Zlender V, Cvjetkovic B, Jurjevic Z, Topolovec- Pintaric S, Ivic D. 2005. Seed-borne fungi and ochratoxin A contamination of dry beans (Phaseolus vulguris L.) in the Republic of Croatia. Food Chem Toxicol 43 (3): 427-432.

Dubey SC, Singh B, Bahadur P. 2007. Diseases of pulse crops and their ecofriendly management. In: Ahamad S, Narain U (eds.). Ecofriendly Management of Plant Diseases. Daya Publishing House, Delhi, India.

Ellis MB. 1971. Dematiaceous hyphomycetes. Commonwealth Mycological Institute, Kew, England.

Ellis MB. 1976. More dematiaceous hyphomycetes. Commonwealth Mycological Institute, Kew, England.

El-Nagerabi SAF. 2002. Determination of seedborne fungi and detection of aflatoxins in Sudanese fenugreek seeds. Phytoparasitica 30 (1): 6166.

El-Nagerabi SAF, Ahmed AHM. 2001. The effect of black mould (Aspergillus niger) on two Sudanese cultivars of onion. Trop Sci 41: 95-99.

El-Nagerabi SAF, Elshafie AE. 2000. Composition of mycoflora and aflatoxins in lupine seeds from the Sudan. Phytopathologia Mediterranea 39 (2): 257-262.

El-Nagerabi SAF, Elshafie AE. 2001a. Determination of seedborne fungi and aflatoxins in Sudanese guar seeds. Trop Sci 41 (1): 31-35.

El-Nagerabi SAF, Elshafie AE. 2001b. Incidence of seed-borne fungi and aflatoxins in Sudanese lentil seeds. Mycopathologia 149 (3): 151-156.

El-Nagerabi SAF, Elshafie AE, Abdalla AH. 2000a. Composition of mycoflora and aflatoxins in pea seeds from the Sudan. Kuwait J Sci Eng 27 (1): 109-121.

El-Nagerabi SAF, Elshafie AE, Abdalla AH. 2001). Incidence of fungi and aflatoxins in Sudanese faba bean seeds. Univ Khartoum J Agric Sci 9 (1): 82-95.

El-Nagerabi SAF, Elshafie AE, Abdalla AH. 2000b. Studies on mycoflora and aflatoxins of soybean seeds from the Sudan. Sudan J Sci Res 7 (1): 55-74.

El-Samawaty AMA, Moslem MA, Sayed SRM, Yassin MA. 2014. Fungal endophytes survey of some legume seeds. J Pure Appl Microbiol 8: 153-160.

279

Elshafie AE. 1985. Taxonomic studies of seed borne fungi of the Sudan I: Drechslera. Sudan J Sci 1: 62-85.

Elshafie AE. 1986. Taxonomic studies on seed borne fungi of Sudan II: Curvularia. Sudan J Sci 2: 51-70.

Embaby EM, Abdel-Galil MM. 2006. Seed borne fungi and mycotoxins associated with some legume seeds in Egypt. J Appl Sci Res 2 (11): 1064-1071.

Enechebe A, McDonald D. 1979. Seed-borne pathogenic fungi and bacteria of cowpea in North Nigeria. Proc Nat Acad Sci USA 25 (4): 401-404.

Gomes JL, Dhingra OD. 1983. Alternaria alternata a serious pathogen of white colored snap bean (Phaseolus vulgaris) seeds. Rev Pl Pathol 63: Abstract 2588.

Houssou PA, Ahohuendo BC, Fandohan P, Kpodo K, Hounhouigan DJ, Jakobsen M. 2009. natural infection of cowpea (Vigna unguiculata (L) Walp.) by toxigenic fungi and mycotoxin contamination in Benin, West Africa. J Stor Prod Res 45: 40-44.

ISTA. 1966. International rules for seed testing. Seed Sci Technol 4: 3-49.

Duke JA. 1981. Handbook of Legumes of World Economic Importance.

United States, Department of Agriculture, Beltsville, Maryland, USA. Liu X, Wang H, Li J, Zhang L. 2002. Testing of seed borne fungi of major leguminous plants from China and disinfection effect of several fungicides to seed pathogens. Seed 1: 006.

Kaiser WT. 1981. Diseases of chickpea, lentil, pigeon pea, and tepary bean in continental United States and Puerto Rico. Econ Bot 35 (3): 300-320.

Kamble P, Borkar GM, Patil DV. 1999. Study on seedborne pathogens of pumpkin, cucumber, watermelon and muskmelon. J Soil Crops 9 (2): 234-238.

Kaur S. 1995. Phytotoxicity of solanapyrones produced by the fungus Ascochyta rabiei and their possible role in blight of chickpea (Cicer arietinum). Plant Sci 109: 23-29.

Kellock AW, Stubbs LL, Parbery DG. 1978. Seed-borne Fusarium species on subterranean clover and other pasture legumes. Australian J Agric Res 29 (5): 975-982.

Kritzinger Q, Aveling TAS, Marasas WFO, Rheeder JP, Westhuizen L, Shephard GS. 2003. Mycoflora and fumonsis mycotoxins associated with cowpea (Vigna unguiculata L Walp) seeds. J Agric Food Chem 51 (8): 2188-2192.

Kumar H, Bajpai VK, Dubey RC, Maheshwari DK, Kang SC. 2010. Wilt disease management and enhancement of growth and yield of Cajanus cajan (L) var. Mank by bacterial combinations amended with chemical fertilizer. Crop Prot 29: 591-598.

Kumar K, Singh J, Ratan V. 2004. Seedborne fungi of cowpea, their parasitism and control. Ann Plant Protect Sci 12 (1): 80-82.

Leach CM. 1960. Phytopathogenic and saprophytic fungi associated with forage legume seed. Plant Dis Rep 44 (5): 364-369.

Malone JF, Muskett ME. 1964. seed-borne fungi description of 77 fungus species. Proc IntL Seed Testing Assoc 29: 179-382.

Maloy RN. 1968. Alfalfa anthracnose in Washington. Plant Dis Rep 52 (12): 983.

Marley PS, Hillocks RJ. 1996. Effect of root-knot nematodes (Meloidogyne spp.) of Fusarium wilt in pigeon pea (Cajanus cajan).

Field Crops Res 46: 15-20.

Nakkeeran S, Devi R. 1997. Seed borne mycoflora of pigeon pea and their management. Plant Dis Res 12 (2): 197-199.

Nath R, Mathur SB, Neergaard p. 1970. Seed borne fungi of mung bean from India and their significance. Proc Intl Seed Testing Assoc 35: 225-247.

Nelson PE, Toussoun TA, Marasas WFO. 1983. Fusarium species. An illustrated manual for identification. The Pennsylvania State University Press, University Park and London, London.

Nene YL, Sheila VK, Sharma SB. 1996. A World List of Chickpea and Pigeon pea Pathogens. 5th ed. ICRISAT, Patancheru, India.

Nik WZ, Parbery DG. 1977. Studies of seed-borne fungi of tropical pasture legume species. Australian J Agric Res 28 (5): 821-841.

Pal D, Mishra P, Sachan N, Ghosh A. 2011. Biological activities and medicinal properties of Cajanus cajan (L) Millsp. J Advan Pharmaceut Technol Res 2 (2): 207-214.

Pitt JI. 1979. The Genus Penicillium and its Teleomorphic States Eupenicillium and Talaromyces. Academic Press, New York.

Prasad A, Prasad BK. 1987. Seedborne fungi of stored lablab bean and their significance. Indian J Mycol Plant Pathol 17 (3): 262-266.

Raper KB, Fennell DI. 1965. The Genus Aspergillus. Williams and Wilkins, Baltimore.

280

B I O D I V E R S IT A S

16 (2): 269-280, October 2015

Rathod LR, Jadhav MD, Mane SK, Muley SM, Deshmukh PS. 2012. Seed borne mycoflora of legume seeds. Intl J Advan Biotechnol Res 3 (1): 530-532.

Rauf BA. 2000. Seed-borne disease problems of legume crops in Pakistan.

Pakistan J Sci Industr Res 43 (4): 249-254.

Richardson MJ. 1997. An Annotated List of Seed-borne Diseases. 3rd ed.

Phytoapthological Paper, No. 23, and ISTA Handbook, section1.1.

Commonwealth Mycological Institute, Kew, England.

Ruiz JA, Bentabol A, Gallego C, Angulo R, Jodral M. 1996. Mycoflora and aflatoxin-producing strains of Aspergillus falvus in greenhousecultivated green bean (Phaseolus vulgaris L.). J Food Protect 59 (4): 433-435.

Saleem A, Ebrahim MKH. 2014. Production of amylase by fungi isolated from legume seeds collected in Almadinah Almunawarah, Saudi Arabia. J Taibah Univ Sci 8 (2): 90-97.

Samson RA, Hoekstra ES, Frisval JC, Filtenborg O. 1995. Introduction to Food-Borne Fungi. Holland Centraalbureau voor Schimmelcultures, Baarn.

Sarhan ART. 2009. Remove from marked records identification of the seed borne fungi associated with some leguminous seeds and their biological control in Iraq. Arab J Plant Protect 27 (2): 135-144.

Sarwatt SV, Katule AM, Lugendo AJH. 1991. Effects of substituting dolichos bean meal with soya bean meal on the performance of broiler chicken. Lives Res Rural Dev 3 (1): 1-5.

Sesan T, Dumitras C. 1979. The effect of some fungicides on some seedborne fungi and nodule formation in kidney bean. Rev Plant Pathol 60 (2): Abstract 1147.

Siddaramaiah AL, Bhat RP, Desai SA. 1980. Mycoflora of cultivar Dolichos lab-lab. Curr Res 9 (2): 24.

Singh B, Kaur S. 2012. Review of Cajanus cajan as important medicinal plant. Intl J Nat Prod Sci SpI 1: 140.

Singh G, Sharma YR. 2005. Diseases of chickpea and their management.

In: Diseases of Field Crops and Their Management. 3rd ed. Daya Publishing House, Delhi, India.

Singh, OK, Khapre MN. 1978. Seed-borne fungi of cowpea and their significance. Indian Phytopathol 30 (4): 469-472.

Sutton BC. 1980. The Coelomycetes. Commonwealth Mycological Institute, Kew, England.

Swami CS, Alane SK. 2013. Efficacy of some botanical against seedborne fungi of green gram (Phaseolus aureus Robb.). Biosci Discov 4 (1): 107-110.

Tarr SAJ. 1963. A Supplementary List of Sudan Fungi and Diseases.

Mycological Paper No. 85. Commonwealth Mycological Institute, Kew, England.

Trenteva MN. 1974. Deep infection of seeds and its connection with pathogen of root rot of Lucerne. Rev Plant Pathol 54: Abstract 1783.

Tseng TC, Tu JC, Tzean SS. 1995. Mycoflora and mycotoxins in dry bean (Phaseolus vulgaris) produced in Taiwan and in Ontario, Canada. Bot Bull Acad Sin 36 (4): 229-234.

Webster J. 1980. Introduction to Fungi. Cambridge University Press, Melbourne.

Winter WE, Mathur SB, Neergaard P. 1974. Seed-borne organisms of Argentina. Plant Dis Rep 58 (6): 507-511.

B I O D I V E R S IT A S Volume 16, Number 2, October 2015 Pages: 281-287

ISSN: 1412-033X E-ISSN: 2085-4722 DOI: 10.13057/biodiv/d160224

Diversity in antioxidant properties and mineral contents of Allium paradoxum in the Hyrcanian forests, Northern Iran SEDIGHEH KHODADADI1, TAHER NEJADSATTARI1,, ALIREZA NAQINEZHAD2, MOHAMMAD ALI EBRAHIMZADEH3 Department of Biology, Science and Research Branch, Islamic Azad University, P.O. Box: 14515-775, Tehran, Iran, Tel. +9844865323, email: nejadsattari_t@yahoo.com 2 Department of Biology, Faculty of Basic Sciences, University of Mazandaran, P.O. Box: 47416-95447, Babolsar, Iran 3 Pharmaceutical Sciences Research Center, School of Pharmacy, Mazandaran University of Medical Sciences, P.O. Box: 48471-93698 Sari, Iran

1

Manuscript received: 19 July 2015. Revision accepted: 5 October 2015.

Abstract. Khodadadi S, Nejadsattari T, Naqinezhad A, Ebrahimzadeh MA. 2015. Diversity in antioxidant properties and mineral contents of Allium paradoxum in the Hyrcanian forests, Northern Iran. Biodiversitas 16: 281-287. The knowledge about variation of antioxidant properties from local medicinal plant can be achieved by investigating all natural habitats of it. To reach this goal, a comprehensive survey on eight populations of Allium paradoxum (M. B.) G. Don, was conducted in the Hyrcanian forests. A. paradoxum (Amaryllidaceae) is a perennial, local plant, native to the northern Iran. Different parts of it, is largely used in food preparation and traditional medicine. Plants were collected randomly from different altitudes and forest sites of Iranian northern provinces ranging from west to east (Guilan, Mazandaran and Golestan Provinces). Samples were divided into aerial and bulbous parts.

The antioxidant activities of the extracts were investigated with 1, 1-diphenyl-2-picrylhydrazyl (DPPH) and reducing power assays.

Total flavonoid content was determined by a colorimetric aluminum chloride method. The highest antioxidant activities and flavonoid contents in A. paradoxum were related to Varaki and Zarinabad sites (Mazandaran province) with relatively higher humidity, in the central part of the Hyrcanian area and in altitudinal range between 462-860 m asl. The content of total phenolics in the extracts was determined according to the Folin-Ciocalteu reagent method, and calculated as gallic acid equivalents (GAE). With respect to total phenolic contents, aerial parts of plants of Jahannama, the lowest elevation site (Golestan province), had the highest amount. Elemental composition (Fe++, Mn++) and total sulphur were also determined using Atomic Absorption Spectroscopy and digestion method, respectively. Higher contents of two elements, particularly Fe, and total sulphur can be found in bulbous part of Zarinabad and Kiasar populations (Mazandaran province) compared to other sites. The results of the current study indicated that there is a remarkable and significant variation of antioxidant activities among different studied populations of A. paradoxum in the Hyrcanian forests.

Key words: Allium paradoxum, antioxidant activity, medicinal plant, mineral contents

INTRODUCTION The natural antioxidants present in dietary plants have great importance in favoring health and resistance to oxidative stress in humans (Dimitrios 2006). The total antioxidant potential (TAP) in food products is related to the different molecules present in foods. Antioxidant capacities are considerably modulated by numerous factors including biological and environmental factors, as well as their interaction (Lisiewska et al. 2006; Moore et al. 2006).

Plant materials contain various forms of antioxidants.

Phenolic compounds are found in plants, have multiple biological effects. Flavonoids and other phenolics have been suggested to play a protective role against damages caused by disease (Kähkönen et al. 1999; Mammadov et al. 2011).

Nutrients play a significant role in improving productivity and quality of plants. Sulphur supply influences bulb yield, plant dry matter, bulb pungency and flavor intensity in Allium crops (Durenkamp and De Kok 2004). Sulphur insufficiency will result in the loss of plant health, the plant’s resistance to environmental stress, and in decreased food quality and safety (De Kok et al. 2002; Durenkamp and De Kok 2004). Micronutrients are

involved in numerous biochemical processes and adequate intake of certain micronutrients related to the prevention of deficiency diseases (Ebrahimzadeh et al. 2011).

The genus Allium, a member of Amaryllidaceae family, contains more than 900 species (APG III 2009; Li et al.

2010; Tojibaev et al. 2014). The most important diversity source of the genus is considered in the mountainous areas of southwest and central Asia including the territory of Iran (Fritsch and Friesen 2002). Allium comprises many economical, ornamental and medicinal species that have been used as a remedy for treatment of certain diseases (Fritsch and Friesen 2002; Putnoky et al. 2013). Among the different medicinal plants, some endemic species may be used for phytochemicals with significant antioxidant capacities and health benefits (Exarchou et al. 2002).

Allium paradoxum (M.B.) G. Don is a perennial species of shady woods in the Caucasus, northern Iran and neighboring parts of central Asia (Vvedenskii 1935; Wendelbo 1971; Stearn 1992). This plant is one of locally vegetables that was known as “Alezi”, and is used as a healthy vegetable in raw or cooked form for people who are living in northern provinces of Iran. The populations of the plant are obvious during late February to early April in

282

B I O D I V E R S IT A S

16 (2): 281-287, October 2015

the Hyrcanian forests. The Hyrcanian forest is a temperate deciduous forest ecosystem in the southeastern part of the Caucasus biodiversity hotspot, that are located in three northern provinces of Iran, namely, Guilan, Mazandaran and Golestan with a total surface area of 1.84 million hectares (Bobek 1951; Takhtajan 1986; Naqinezhad et al. 2015).

So far, most studies about Allium relating to cysteine sulphoxides and alliinase activity (Krest et al. 2000; Fritsch and Keusgen 2006), antioxidant activity of several Allium members (Yin and Cheng 1998) or have focused only on whole species such as A. paradoxum (Ebrahimzadeh et al.

2010; Nabavi et al. 2012; Elmi et al. 2014), A. sativum L. and A. cepa L. (Benkeblia 2005; Lawrence and Lawrence 2011), A. ursinum L. (Putnoky et al. 2013). Ghasemi et al.

(2015) investigated properties of garlic under selenium and humic acid treatments. The results of their study show the positive effects of applied treatments. Ebrahimzadeh et al.

(2010) reported trace elemental analysis in A. paradoxum and among them, higher contents related to Fe and Mn. There is no report about total sulphur content in A. paradoxum.

The purpose of this study is to provide the first report about variation in phytochemical properties of A. paradoxum and potential sources of natural habitats in Northern provinces of Iran. Moreover, we aim to estimate total sulphur and trace element (Fe, Mn) contents in the studied populations.

MATERIALS AND METHODS Chemicals Barium chloride, 1,1-diphenyl-2-picryl hydrazyl (DPPH), Magnesium nitrate, Perchloric acid and potassium ferricyanide were purchased from Sigma Chemicals Co. (USA). Gallic acid, Quercetin and Ferric chloride were purchased from Merck (Germany).

Study areas, plant material and preparation of extract We selected eight forest sites (Zarinabad, Varaki, Kalaleh, Jahannama, Haftkhal, Asalem, Savadkooh and Kiasar) from northern provinces of Iran namely Guilan, Mazandaran and Golestan. These sites were located in the Hyrcanian area along an altitudinal gradient from 198 to 1980 m asl. (Figure 1, Table 1). Three Meteorological stations, i.e. Astara in Guilan province, Gharakhil in Mazandaran province and Hashemabad in Golestan province were the closest stations to the current studied sites. According to bioclimatic classification of Iran (Djamali et al. 2011), the climate of area varies from temperate oceanic in Astara (Guilan) to Mediterranean pluviseasonal oceanic in Hashemabad site (Golestan).

Samples were randomly collected from aforementioned sites during March to April 2014. The materials (aerial and bulbous parts) were dried at room temperature for two

6 3 4 1 7

5

2

8

Figure 1. Studied sites of Allium paradoxum populations in the Hyrcanian forest. Climatic diagrams are shown from the nearest stations in each of three provinces (from left: Guilan, Mazandaran and Golestan, respectively).

KHODADADI et al. – Antioxidant properties and minerals of Allium paradoxum

Table 1. The characteristics of eight sites for Allium paradoxum sampling.

Forest site Province Zarinabad Varaki Kalaleh Jahannama Haftkhal Asalem Savadkooh Kiasar

Mazandaran Mazandaran Golestan Golestan Mazandaran Guilan Mazandaran Mazandaran

Longitude

Latitude

E 053°12′ 19.2″ E 53°07′ 29.6″ E 055°36′ 52.1″ E 54°07′ 23.5″ E 53°23′ 59.2″ E 048°49′ 07″ E 52°48′ 29.9″ E 053°36′ 39.5″

N 36°29′ 44.4″ N 36°17′ 13.9″ N 37°24′ 35.2″ N 36°44′ 37.8″ N 36°17′ 22.1″ N 37°39′ 32.8″ N 36°06′ 27.8″ N 36°06′ 27.8″

Altitude (m a.s.l) 462 860 698 198 897 1200 1980 1825

weeks (bulbs were oven dried at 35°C, for 2 days). Dried materials were coarsely ground (2-3 mm) before extraction.

Each part (100 g) was extracted by percolation using methanol/water (80/20 w/w) for 24 h at room temperature.

The extracts were then separated from the sample residues by filtration through Whatman No.1 filter paper. The extractions were repeated three times. The resultant extracts were concentrated in a rotary evaporator until crude solid extracts were obtained which were then freezedried for complete solvent removal (Ebrahimzadeh et al.

2010). The yields of each sample were presented in Tables 2 and 3.

DPPH radical-scavenging activity The stable 1, 1-diphenyl-2-picrylhydrazyl radical (DPPH) was used for determination of free radicalscavenging activity of the extracts (Yamaguchi et al. 1998; Nabavi et al. 2009). Different concentrations of each extract (100, 200, 400, 800 and 1600 µg mL-1) were added, at an equal volume, to a methanolic solution of DPPH (100 μM). After 15 min at room temperature, the absorbance was measured at 517 nm. Methanol with DPPH was used as control. The experiment was repeated three times.

Vitamin C and butylated hydroxyanisole (BHA) were used as standard controls. IC50 values denote the concentration of sample which is required to scavenge 50% of DPPH free radicals. The scavenging activity was estimated based on the percentage of DPPH radical scavenged as the following equation: Scavenging effect (%) = [(A0- As)/A0] × 100, where A0 is the absorbance without extract and As is the absorbance of extracts or standards.

Reducing power determination The reducing power of extracts was determined according to the method of Yen and Chen (1995) (Nabavi et al. 2008). Different amounts of each extract (50-800 μg mL-1) in water were mixed with phosphate buffer (2.5 mL, 0.2 M, pH 6.6) and potassium ferricyanide [K3Fe (CN)6] (2.5 mL, 1%). The mixtures were incubated for 20 minutes at 50°C. 2.5 mL of trichloroacetic acid (10%) was added to the mixture to stop the reaction, then centrifuged at 3000 rpm for 10 min. The supernatant of solution (2.5 mL) was mixed with distilled water (2.5 mL) and FeCl3 (0.5 mL, 0.1%), and the absorbance measured at 700 nm. Vitamin C was used as positive control.

283

Total phenol and flavonoid contents Total phenolic contents were determined by the FolinCiocalteu reagent method (Ebrahimzadeh et al. 2008; Singleton et al. 1999). The extract samples (0.5 mL) were mixed with 2.5 mL of 0.2 N Folin-Ciocalteu reagent for 5 min and 2.0 mL of 75 g l-1 sodium carbonate then added.

The absorbance was measured at 760 nm after 2 h of incubation at room temperature. The standard curve was prepared by 0, 50, 100, 150, 200 and 250 mg mL-1 solutions of gallic acid in methanol: water (50: 50, v/v). Results were expressed as mg gallic acid equivalents (GAE) g-1 of extract.

Total flavonoid content was determined by a colorimetric method (Chang et al. 2002; Ghasemi et al. 2009). 0.5 mL solution of each plant extract in methanol was separately mixed with 1.5 mL of methanol, 0.1 mL of 10% aluminum chloride, 0.1 mL of 1 M potassium acetate and 2.8 mL of distilled water and left at room temperature for 30 min. The absorbance of the reaction mixture was measured at 415 nm with a double beam spectrophotometer (Perkins Elmer AAS 100).The calibration curve was prepared by preparing quercetin solutions at concentrations 12.5 to 100 mg mL-1 in methanol. The total flavonoids were expressed as mg quercetin equivalent (QE) g-1 of extract powder.

Determination of total sulphur content and mineral analysis Total sulphur of aerial parts and bulbs were measured in the digest as described by Quin and Wood (1976). Samples (0.1 g) were analyzed for sulphur after magnesium nitrate and perchloric digestion. Barium chlorate was added to the mixture and it was left overnight, following which the absorbance of the final reaction mixture was measured at 420 nm (Ghasemi et al. 2015). Results are expressed as µg in g dry matter. Iron and manganese were analyzed in the samples. Briefly, the properly dried and ground plant samples were ash-dried overnight at 400-420°C in a Vitreosil crucible. The inorganic residue was kept in a desiccator until needed for analysis. Two-tenths of a gram of ash was dissolved in a 1: 3 mixture of hydrochloric and nitric acids (Han et al. 2008) diluted to 50 mL with distilled water and analyzed with an atomic absorption spectrometer (Perkins Elmer AAS 100) (Wellesley, MA). The results were expressed in mg g-1 of sample.

Statistical analysis Experimental results are expressed as means ± SD. All measurements were replicated three times. The data was analyzed by one-way ANOVA and the means separated by Tukeyʼs post-hoc test (P <0.05).

RESULTS AND DISCUSSION DPPH radical-scavenging activity Scavenging of the stable DPPH radical is a widely used method to evaluate the free radical scavenging ability of various samples (Ebrahimzadeh et al. 2009). Results of our study show that scavenging effect of samples is increased by increasing their concentrations. Among these samples,

284

B I O D I V E R S IT A S

16 (2): 281-287, October 2015

the aerial parts generally had the strongest radical scavenging activity than bulbous parts (Tables 2 and 3).

The lowest IC50 (the highest activity) for DPPH radicalscavenging activity was 0.96 µg mL-1 for Varaki aerial parts (Mazandaran). The IC50 values for Vitamin C and BHA were 3.7 ± 0.1 and 29.3 ± 5.9 μg mL-1, respectively.

Reducing power of extracts The reducing power capacity of compounds may serve as a significant indicator of its potential antioxidant activity (Meir et al. 1995). This reducing power capacity was determined using a Fe3+ to Fe2+ reduction system. The amount of Fe2+ complex can be monitored by measuring the formation of Perl’s Prussian blue at 700 nm. Increasing absorbance at 700 nm indicates an increase in reductive ability. Figures 2 and 3 show the dose-response curves for the reducing power of extracts (at 50-800 μg mL-1 concentration). The reducing power of extracts also increased with increasing their concentrations. There were significant differences between extracts and vitamin C (P < 0.01). The highest reducing power activity was observed in aerial parts of Varaki site (1.32, at 800 μg mL-1). The aerial part extracts showed higher reducing power than bulb extracts.

Extraction yield, total phenol and flavonoid contents The extraction yield of different fractions of A. paradoxum was varied from 4.7 to 26.1% (Tables 2 and 3).

The extraction of aerial parts resulted in the higher amount of total extractable compounds than bulb extracts. The amount of total phenolics varied in different populations and ranged from 5.7±0.5 to 112.4±7.5 mg GAE g-1 of extract. The highest total phenolic contents were 112.4±7.5 and 111.2±5.4 mg GAE g-1 of extract, bulbs and aerial parts of “Jahannama” and “Varaki” samples, respectively. The content of flavonoid varied from 1.3 to 294.33±11.3 mg QE g-1 of extract powder (Tables 2 and 3). Aerial part extracts had significantly higher flavonoid contents than bulb extracts. Plants of “Zarinabad” site (Mazandaran province) showed the highest amount of flavonoid contents followed by Varaki (294.33±11.3 and 173±4.4, respectively).

Total sulphur and mineral analysis The results of the current study showed that bulbous parts had higher total sulphur than aerial parts. According to Tables 2 and 3, total sulphur content in A. paradoxum ranged from 69-210 g in g dry matter. The highest sulphur content was found in bulbs of Kiasar (Mazandaran province). Results of elemental analysis were presented in Tables 2 and 3. The comparative study showed that the bulbous part of Zarinabad sample had the maximum value of Fe and Mn contents.

Discussion Investigation on antioxidant properties with particular concern of geographical distribution of plant populations has become of interest of current relevant studies (Pisoschi and Negulescu 2011). This kind of research can be also very important particularly on endemic and other restricted-range plants.

Figure 2. Reducing power of aerial parts extracts of Allium paradoxum populations. Vitamin C used as control. Numbers show studied sites. For names of 1-8 see Figure 1.

Figure 3. Reducing power of bulbous parts extracts of Allium paradoxum populations. Vitamin C used as control. Numbers show studied sites. For names of 1-8 see Figure 1.

Antioxidant agents of natural origin have attracted special interest because of their free radical scavenging abilities. Because of this, the antioxidant activities of A. paradoxum populations were determined by two spectrophotometric methods. The DPPH method rely on the reaction of 1, 1-diphenyl-2-picrylhydrazyl radical with an antioxidant molecule. It decolorizes the DPPH solution and the degree of color change is proportional to amount of the antioxidants (Saeed et al. 2012). In reducing power test, the presence of the reductants in the solution causes the reduction of the Fe3+/ferricyanide complex to the ferrous form. Therefore, Fe2+can be monitored by absorbance measurement at 700 nm. In the present study, the results of two antioxidant tests showed that the aerial part extract of Varaki population in Mazandaran province had higher antioxidant action than other populations. Based on altitudinal range of current survey (198- 1980 m a.s.l) (Table 1), this site is located in the middle of the cited range.

Although phenolic acids and flavonoids are not essential for survival, may provide protection against a number of chronic diseases over the long term consumption (Bravo 1998). Variation of total phenol and flavonoids in our study area showed that the plant extracts of all populations had the potential for accumulating phenol and flavonoids. Bulbous part of Jahannama population (eastern part of our study area with low rainfall) possessed the

B I O D I V E R S IT A S Volume 16, Number 2, October 2015 Pages: 281-287

ISSN: 1412-033X E-ISSN: 2085-4722 DOI: 10.13057/biodiv/d160224

Table 2. Yield, total phenolic and flavonoid contents of methanolic extract, total sulphur and trace elements from aerial part of different populations of Allium paradoxum in Iran.

Parameters

Zarinabad -1

a

Total phenol content (mg GAE g )

64.4 ± 3.2

-1

a

Varaki b

111.2 ± 5.4 b

Kalaleh

Jahannama

Haftkhal

Asalem

c

54.4 ± 3.2

af

62.6 ± 2.6

d

c

47.4 ± 3.6

56.4 ± 2.8

c

d

e

c

Savadkooh e

5.7 ± 0.5 f

Kiasar f

60.6 ± 2.2 g

F 2325.84*

Flavonoid content (mg QE g )

294.3 ± 1.3

173 ± 4.4

80.3 ± 3.5

51.0 ± 1.3

31.7 ± 2.2

77.8 ± 3.4

61.3 ± 1.1

103.7 ± 5.1

29300.50*

DPPH radical cavenging, IC50 (μg mL-1)

1.50 af± 0.01

0.96 b± 0.00

1.43 acf± 0.01

1.56 adf±0.01

1.38 c± 0.01

1.46 acf± 0.01

1.66 df± 0.01

1.57 adf± 0.00

101.83*

a

81 ± 3.2

Total sulphur (g in g dry matter) -1

a

b

99 ± 3.1 a

c

110 ± 5.2 bc

d

120 ± 3.7 bc

c

110 ± 5.1 a

e

69 ± 1.9 ab

f

88 ± 2.3 b

d

120 ± 5.8 a

1056.80*

Fe (mg g )

0.93 ± 0.03

0.82 ± 0.03

3.35 ± 0.11

3.19 ± 0.17

0.54 ± 0.01

1.41 ± 0.10

2.40 ± 0.16

0.77 ± 0.02

25.04*

Mn (mg g-1)

0.05 a± 0.01

0.05 a± 0.01

0.07 ab± 0.01

0.08 b± 0.01

0.03 ac± 0.00

0.05 a± 0.01

0.05 a± 0.00

0.04 ac± 0.00

7.50*

Extraction yield (%) 18 21.2 19.8 18.2 21.2 20.1 26.1 23.2 Note: IC50 of BHA was 29.3 ± 5.9 μg mL-1. Each value in Table 2 is represented as mean SD (n=3) and F-ratio (*) based on one-way ANOVA of studied variables. Values in the same row followed by a different letter are significantly different (p<0.05).

Table 3. Yield, total phenolic and flavonoid contents of methanolic extract, total sulphur and trace elements from bulbous part of different populations of Allium paradoxum in Iran.

Parameters

Zarinabad -1

a

Varaki a

Kalaleh a

Jahannama b

Haftkhal c

Asalem d

Savadkooh e

Kiasar f

F

Total phenol content (mg GAE g )

47.2 ± 2.1

46.8 ± 1.7

49.2 ± 2.2

112.4 ± 7.5

30.2 ± 1.5

36.4 ± 1.9

59 ± 1.6

80.8 ± 4.1

2088.90*

Flavonoid content (mg QE g-1)

4.3 a± 0.2

1.3 ac± 0.0

1.7 ac± 0.0

7.7 b± 1.2

4.0 a± 0.1

5.3 ab± 1.2

3.3 a± 0.0

6.0 ab± 0.2

11.93*

-1

acd

DPPH radical cavenging, IC50 (μg mL )

2.32

Total sulphur (g in g dry matter)

120 a± 4.4

-1

Fe (mg g ) -1

Mn (mg g )

± 0.01

a

17.30 ± 0.24 a

0.1 ± 0.01

3.19

abcdf

± 0.02

81 b± 1.2 b

2.50 ± 0.09 a

0.05 ± 0.00

2.34

acd

± 0.02

120 a± 4.9 2.25

bcd

± 0.13

a

0.07 ± 0.00

1.78

acde

± 0.01

150 c± 6.6 bd

2.80 ± 0.18 a

0.06 ± 0.01

4.21

bcf

± 0.02

2.89

abcd

± 0.02

180 d± 6.4

110 e± 5.7

c

bc

0.92 ± 0.04 a

0.02 ± 0.00

1.05 ± 0.15 a

0.02 ± 0.00

b

acde

3.51 ± 0.02

1.72

112 e± 4.1

210 f± 6.4

1.95

bcde

± 0.18

a

0.01 ± 0.00

1.43

± 0.01

14.67* 5311.66*

bcde

28.21*

a

2.20

± 0.1

0.05 ± 0.01

Extraction yield (%) 9.8 8.1 6.4 4.7 6.1 11.6 11.0 12.3 -1 Note: IC50 of BHA was 29.3 ± 5.9 μg mL . Each value in Table 3 is represented as mean SD (n=3) and F-ratio (*) based on one-way ANOVA of studied variables. Values in the same row followed by a different letter are significantly different (p<0.05).

B I O D I V E R S IT A S 286 Volume 16, Number 2, October 2015 Pages: 281-287

B I O D I V E R S IT A S 16 (2): 269-280, October 2015

highest amount of total phenol. In most measurements of the current experimental analysis, aerial parts had higher contents than bulbs that are compatible with the results of Ebrahimzadeh et al. (2010).

Minerals are usually divided in two groups macro- and micro- minerals (or trace elements), and also classified as either essential or nonessential, depending on whether or not they are required for human nutrition and have metabolic roles in the body (Reilly 2002). Sulphur content of plant varies from 0.03-2 mmol g-1 dry weight (DW) in different species (Durenkamp and De Kok 2004). In the current study, total sulphur content of bulbs showed higher amounts than in aerial parts. Study of Ghasemi et al. (2015) showed that total sulphur of A. sativum is in higher amount than in A. paradoxum. Moreover, the results of our study revealed that iron concentration is higher than manganese.

However, this result can be varied in aerial and bulbous parts. Fe and Mn play vital roles in biochemical processes (Ebrahimzadeh et al. 2010, 2011). Element composition differs strongly between plant organs (Minden and Kleyer 2013). Variability may also come from differences in size, age, ontogenetic state and reproductive status between plant individuals (Agren 2008).

The results of this study demonstrated variation of antioxidant properties and mineral contents in plant organs of A. paradoxum populations along the Hyrcanian forests.

The results generally indicated that populations of A. paradoxum in Mazandaran province had good capacity to utilize in medicine and food industry. Further field studies are needed to explain precise correlation between variation of mentioned properties in A. paradoxum and the environmental factors.

ACKNOWLEDGEMENTS We thank M. Khalili (Mazandaran University of Medical Sciences, Iran), Dr. S. Kelij and M. Bordbar (University of Mazandaran, Iran) for their support and helps during the laboratory works.

REFERENCES Agren G. 2008. Stoichiometry and nutrition of plant growth in natural communities. Annu Rev Ecol Evol Syst 39: 153- 170.

APG III. 2009. An update of the Angiosperm Phylogeny Group classification for the orders and families of flowering plants: APG III. Bot J Linn Soc 161: 105-121.

Benkeblia N. 2005. Free-radical scavenging capacity and antioxidant properties of some selected onions (Allium cepa L.) and garlic (Allium sativum L.) extracts. Braz Arch Biol Techn 48 (5): 753- 759.

Bobek H. 1951. Die naturliechen Walder und Geholzfluren Iran. Bonner Geogr Abh 8: 1-62.

Bravo L.1998. Polyphenols: Chemistry, dietary sources, metabolism, and nutritional significance. Nutr Rev 56 (11): 317-333.

Chang C, Yang M, Wen H, Chern J. 2002. Estimation of total flavonoid content in propolis by two complementary colorimetric methods. J Food Drug Anal 10: 178-182.

De Kok LJ, Westerman S, Stuiver CEE, Weidner W, Stulen I, Grill D. 2002. Interaction between atmospheric hydrogen sulphide deposition and pedospheric sulphate nutrition in Brassica oleracea L. Phyton 42: 35-44.

ISSN: 1412-033X E-ISSN: 2085-4722 DOI: 10.13057/biodiv/d160224

Dimitrios B. 2006. Sources of natural phenolic antioxidants. Trends Food Sci Tech 17: 505-512.

Djamali M, Akhani H, Khoshravesh R, Andrieu-Ponel V, Brewer S. 2011.

Application of the global bioclimatic classification of Iran: implications for understanding the modern vegetation and biogeography. Ecologia Mediterranea 37: 91-114 Durenkamp M, De Kok LJ. 2004. Impact of pedospheric and atmospheric sulphur nutrition on sulphur metabolism of Allium cepa L., a species with a potential sink capacity for secondary sulphur compounds. J Exp Bot 55 (404): 1821-1830.

Ebrahimzadeh MA, Pourmorad, F, Hafezi S. 2008. Antioxidant activities of Iranian Corn Silk. Turk J Biol 32: 43-49 Ebrahimzadeh MA, Nabavi SF, Nabavi SM. 2009. Essential oil composition and antioxidant activity of Pterocarya fraxinifolia. Pak J Biol Sci 12: 957-963.

Ebrahimzadeh MA, Nabavi SF, Nabavi SM, Eslami B. 2010.

Antihemolytic and antioxidant activities of Allium paradoxum. Cent Eur J Biol 5: 338-345.

Ebrahimzadeh MA, Eslami SH, Nabavi SM, Nabavi SF, Hajizadeh Moghaddam A, Bekhradnia AR. 2011. Estimation of essential and toxic mineral elements in Mentha species. Asian J Chem 23 (4): 1648-1650.

Elmi T, Gholami SH, Azadbakht M, Rahimi-Esboei B, Geraili Z. 2014.

The effects of hydroalcoholic extract of leaves and onion of Allium paradoxum on Giardia lamblia in mice. J Shahrekord Univ Med Sci 16 (5): 13-22 (In Persian).

Exarchou V, Nenadis N, Tsimidou M, Gerothanassis IP, Troganis A, Boskou D. 2002. Antioxidant activities and phenolic composition of extracts from Greek oregano, Greek sage and summer savory. J Agric Food Chem 50 (19): 5294-5299.

Fritsch RM, Friesen N. 2002. Evolution, domestication and taxonomy. In: Rabinowitch HD, Currah L (eds). Allium crop science: recent advances. CABI Publishing, Wallingford, UK. Fritsch RM, Keusgen M. 2006. Occurrence and taxonomic significance of cysteine sulphoxides in the genus Allium L. (Alliaceae). Phytochem (67): 1127-1135 Ghasemi K, Ghasemi Y, Ebrahimzadeh MA. 2009. Antioxidant activity, phenol and flavonoid contents of 13 Citrus species peels and tissues.

Pak J Pharm Sci 22: 277-281.

Ghasemi K, Bolandnazar S, Tabatabaei SJ, Pirdashti H, Arzanlou M, Ebrahimzadeh MA, Fathi H. 2015. Antioxidant properties of garlic as affected by selenium and humic acid treatments. NZ J Crop Hort Sci 43 (3): 173-181.

Han C, Li J, Hui Q. 2008. Determination of trace elements in Jinqi, a traditional Chinese medicine. Biol Trace Elem Res 122: 122-126.

Jafari SM, Zarre SH, Alavipanah SK, Ghahremaninejad F. 2015.

Functional turnover from lowland to montane forests: evidence from the Hyrcanian forest in northern Iran. iForest 8: 359-367.

Kähkönen MP, Hopia AI, Vuorela HJ, Rauha JP, Pihlaja K, Kujala TS, Heinonen M. 1999. Antioxidant activity of plant extracts containing phenolic compounds. J Agric Food Chem 47 (10): 3954-3962.

Krest I, Glodek J, Keusgen M. 2000. Cysteine sulfoxides and alliinase activity of some allium species. J Agric Food Chem 48 (8): 37533760.

Lawrence R, Lawrence R. 2011. Antioxidant activity of garlic essential oil (Allium sativum) grown in north Indian plains. Asian Pac J Trop Biomed 1 (1): S51-S54.

Li QQ, Zhou ZD, He XJ, Yu Y, Zhang YC, Wei XQ. 2010. Phylogeny and biogeography of Allium (Amaryllidaceae: Allieae) based on nuclear ribosomal internal transcribed spacer and chloroplast rps16 sequences, focusing on the inclusion of species endemic to China.

Ann Bot 106: 709-733.

Lisiewska Z, Kmiecik W, Korus A. 2006. Content of Vitamin C, carotenoids, chlorophylls and polyphenols in green parts of dill (Anethum graveolens L.) depending on plant height. J Food Comp Anal 19: 134-140.

Mammadov R, Ili P, Ertem Vaizogullar H. 2011. Antioxidant Activity and Total Phenolic Content of Gagea fibrosa and Romulea ramiflora. Iran J Chem Chem Eng 30 (3): 57-62.

Meir S, Kanner J, Akiri B, Hadas SP, Hadas J. 1995. Determination and involvement of aqueous reducing compounds in oxidative defense systems of various senescing leaves. J Agric Food Chem 43: 18131817.

Minden V, Kleyer M. 2014. Internal and external regulation of plant organ stoichiometry. Plant Biology 16 (5): 897- 907.

KHODADADI et al. â&#x20AC;&#x201C; Antioxidant properties and minerals of Allium paradoxum Moore J, Liu JG, Zhou K, Liangli Y. 2006. Effects of genotype and environment on the antioxidant properties of hard wheat bran. J Agric Food Chem 54: 5313-5322.

Nabavi SM, Ebrahimzadeh MA, Nabavi SF, Hamidinia A, Bekhradnia AR. 2008. Determination of antioxidant activity, phenol and flavonoids content of Parrotia persica Mey. Pharmacologyonline 2: 560-567.

Nabavi SM, Ebrahimzadeh MA, Nabavi SF, Fazelian M, Eslami B. 2009.

In vitro antioxidant and free radical scavenging activity of Diospyros lotus and Pyrus boissieriana growing in Iran. Phacog Mag 4: 123127.

Nabavi SF, Nabavi SM, Hajizadeh Moghaddam A, Naqinezhad A, Bigdellou R, Mohammadzadeh S. 2012. Protective effects of Allium paradoxum against gentamicin-induced nephrotoxicity in mice. Food Funct 3: 28-29.

Naqinezhad AR, Zare-Maivan H, Gholizadeh H. 2015. A ďŹ&#x201A;oristic survey of the Hyrcanian forests in Northern Iran, using two lowlandmountain transects. J For Res 6 (1): 187-199.

Pisoschi MA, Negulescu GP. 2011. Methods for total antioxidant activity determination: a review. Biochem Anal Biochem 1: 1: 106. doi: 10.4172/2161-1009.1000106 Putnoky S, Caunii A, Butnariu M. 2013. Study on the stability and antioxidant effect of the Allium ursinum watery extract. Chem Cent J 7: 21.

Quin BF, Wood PH. 1976. Rapid manual determination of sulfur and phosphorous in plant material. Comm Soil Sci Plant Anal 7: 415-426.

287

Reilly C. 2002. Minerals. In: Henry CJK, Chapman C (eds.). The nutrition Handbook for Food Processors. CRC Press, Boca Raton, CA. Saeed N, Khan MR, Shabbir M. 2012. Antioxidant activity, total phenolic and total flavonoid contents of whole plant extracts Torilis leptophylla L. BMC Compl Altern Med 12: 221.

Singleton VL, Orthofer R, Lamuela-Raventos RM. 1999. Analysis of total phenols and other oxidation substrates and antioxidants by means of Folin-Ciocalteu reagent. Meth Enzymol 299: 152-178.

Stearn WT. 1992. How many species of Allium are known? Kew Mag 9: 180-182.

Takhtajan A. 1986. Floristic regions of the World. University of California Press, Berkeley, CA. Tojibaev KSH, Turginov O, Karimov F. 2014. A new species and new records of Allium (Amaryllidaceae) for Uzbekistan (Central Asia).

Phytoyaxa 177 (5): 291-297.

Vvedenskii AI. 1935. Allium. In: Komarov VL (ed). Flora U.S.S.R. 4: 254-255. Leningrad, USSR. Wendelbo P. 1971. Alliaceae. In: Rechinger KH (ed). Flora Iranica 76: 66-67. Acad Druck-u Verlasanstalt.Graz, Austria.

Yamaguchi T, Takamura H, Matoba T, Terao Y. 1998. HPLC method for evaluation of the free radical scavenging activity of food by using 1, 1-diphenil,-2- picrylhydrazil. Biosci Biotechnol Biochem 62: 12011204.

Yen GC, Chen HY. 1995. Antioxidant activity of various tea extracts in relation to their antimutagenicity. J Agr Food Chem 43: 27-32.

Yin MC, Cheng WS. 1998. Antioxidant activity of several Allium members. J Agric Food Chem 46 (10): 4097- 4101.

B I O D I V E R S IT A S Volume 16, Number 2, October 2015 Pages: 288-294

ISSN: 1412-033X E-ISSN: 2085-4722 DOI: 10.13057/biodiv/d160225

Genetic and morphological diversity in Cousinia cylindracea (Asteraceae) populations: Identification of gene pools AMIR ABBAS MINAEIFAR1,â&#x2122;Ľ, MASOUD SHEIDAI1, FARIDEH ATTAR2 1

Faculty of Biological Sciences, Shahid Beheshti University, Central Campus, Tehran-1983963113, Iran. Tel.: +98 21 22434501, +98 21 29902721, â&#x2122;Ľ email: aaminaeifar@gmail.com 2 Faculty of Biology, Tehran University, Tehran, Iran Manuscript received: 1 August 2015. Revision accepted: 16 September 2015.

Abstract. Minaeifar AA, Sheidai M, Attar F. 2015. Genetic and morphological diversity in Cousinia cylindracea (Asteraceae) populations: Identification of gene pools. Biodiversitas 16: 288-294. Cousinia is one of the largest genera in the Asteraceae family. It contains 600 to 700 species distributed in Southwest and Central Asia. In Iran with 270 species it is the largest genus after Astragalus,.

Cousinia probably is unique in the degree of diversification of all its parts and high numbers of species in restricted area. In this investigation 90 plant specimens of 10 geographical populations of Cousinia cylindracea Boiss. were studied from morphological and genetic (ISSR) points of view. Both intra and inter-population morphological and genetic variability was observed in the studied populations. ANOVA and CVA tests revealed significant morphological difference among these populations. Similarly, AMOVA tests revealed significant molecular difference among geographical populations. Mantel test produced significant positive correlation between genetic distance and geographical distance of the studied populations. Networking, STRUCTURE analysis and population assignment test revealed low degree of gene flow among these populations. The results identified two different gene pools of C. Cylindracea in Iran, supporting Rechinger suggestion that C. cylindracea might have two varieties in Iran.

Key words: Asteraceae; Cousinia; genetic variability; gene pools; ISSR; morphological diversity

INTRODUCTION Cousinia Cass. is one of the largest genera in the family Asteraceae and the largest genus in tribe Cardueae (Frodin 2004). It contains 600 to 700 species in Southwest and Central Asia. The distribution area of Cousinia is nearly identical with the Irano-Turanian region (Knapp 1987). In Iran, after Astragalus, Cousinia is the largest genus with over than 270 species and 43 sections. Cousinia species are distributed in mountainous parts of Iran. Some of the Cousinia species have medicinal values, and used as diuretic, antiseptic and antibacterial (Joudi et al. 2011).

Cousinia cylindracea Boiss., is distributed in more than 10 provinces of Iran from Alborz and Zagros ranges (Zar et al. 2012). It is a perennial herb, with decurrent stem leaves, and small head bearing a few florets (Rechinger 1979).

Cytological study on C. cylindracea shows chromosome number of 2n=2x=26 (Djavadi 2012).

One of the main concerns of mankind is the conservation of biodiversity at present time. Increasing human population and more extensive use of natural resources and space, cause damage to plant biodiversity. To conserve biological diversity, we must first understand the distribution of organisms and how and why these organisms are geographically distributed as they are (Sigrist and Carvalho 2008). Population genetic investigation is one of the main steps for understanding the population genetic structure and fragmentation, inter-

population gene flow and diversification (Sheidai et al.

2014).

Habitat fragmentation generally is expected to reduce genetic diversity and to increase inter-population genetic divergence by restricting gene flow among fragmented populations, increasing inbreeding and increasing random genetic drift within populations (Hou and Lou 2011). An examination of the genetic diversity among populations within a species is crucial for a better understanding of evolutionary processes and the nature of the species.

Cousinia cylindracea is a species that grow in different geographical regions of Iran and forms several local populations. Therefore, the present study was performed to identify the population genetic structure, gene flow and morphological diversity of C. cylindracea populations and to identify probable gene pools of this species in the country. This information can be used in conservation program of this plant species.

Molecular markers that have been used in plants' investigations in general, consist almost exclusively of markers deemed to be neutral or nearly neutral. These data have been used to study the speciation process, genetic diversity analysis as well as populations' genetic structure (Sheidai et al. 2014). We used ISSR (Inter simple sequence repeats) molecular markers for genetic diversity analysis, as these molecular markers are reproducible, easy to work, cheap and also provide useful data for evolutionary and population genetic studies (Sheidai et al. 2014).

MINAEIFAR et al. – Diversity in Cousinia cylindracea populations

MATERIAL AND METHODS Plant materials Extensive field visits and collections were undertaken during 2013-2014 from the North-West to South- West of Iran and several geographical populations were identified for Cousinia species including C. cylindracea (Figure 1).

Many plant specimens were randomly collected from 10 geographical populations (Table 1). We used 90 randomly collected plant specimens for genetic and morphological studies. The fresh leaves were used for DNA extraction.

The voucher specimens were deposited in Herbarium of Shahid Beheshti University (HSBU) and Central Herbarium of Tehran University (TUH).

Morphometry Forty-seven morphological characters were studied (38 quantitative and 9 qualitative characters) such as: the basal, apical and stem leaves length and width, length and width and number of head, number and length of florets, seeds length and width, bracts shape and etc. (Table 2).

ISSR assay DNA was extracted from the fresh leaves that were randomly collected from 9 plants in each population and dried in silica gel powder. The genomic DNA was extracted using CTAB-activated charcoal protocol (Murray and Thompson 1980). The extraction procedure was based on activated charcoal and Polyvenyl Pyrrolidone (PVP) for binding of polyphenolics during extraction and on mild extraction and precipitation conditions. This promoted high-molecular weight DNA isolation without interfering contaminants. Quality of extracted DNA was examined by running on 1% Agarose gels.

289

Ten ISSR primers; (AGC)5GT, (CA)7GT, (AGC)5GG, (GA)9A, (GA)9C, UBC 807, UBC810, UBC 811, UBC 823 and UBC 834 commercialized by UBC (the University of British Columbia) were used. PCR reactions were performed in a 25µL volume containing 10 mM Tris- HCl buffer at pH 8; 50 mM KCl; 1.5 mM MgCl2; 0.2 mM of each dNTP ; 0.2 µM of a single primer; 20 ng genomic DNA and 3 U of Taq DNA polymerase. Amplification reactions were performed in Techne thermocycler (Germany) with the following program: PCR was carried out with an initial denaturing step (94oC/5 min), followed by 45 cycles of 94oC/30 s, 52-58oC/30 s, 72oC/1 min, and a final incubation at 72oC for 10 min. the amplification products were visualized by running on 1.5% Agarose gel, followed by Ethidium bromide staining. The fragments size was estimated by using a 100 bp molecular size ladder (Fermentas, Germany). The experiment was replicated 3 times and constant ISSR bands were used for further analyses.

Data analyses Morphological studies The analysis of variance (ANOVA) test was performed to show significant morphological difference among the studied populations. For grouping of the plant specimens, UPGMA (Unweighted paired group with arithmetic average) and CVA (Canonical variate analysis) were used.

Morphological data were standardized (mean = 0, variance = 1) for these analyses (Podani 2000). Principal components analysis (PCA) was performed to identify the most variable morphological characters among the studied populations.

Figure 1. Distribution map of the studied Cousinia cylindracea populations in Iran

B I O D I V E R S IT A S 16 (2): 288-294, October 2015

290

Table 1. Cousinia cylindracea populations and their localities Pop.

Locality

1 2 3 4 5 6 7 8 9 10

Iran: Hamadan, Alvand Iran: Hamadan, Asadabad Pass.

Iran: Zanjan, Abhar Iran: Zanjan, Soltania Iran: Zanjan, Zanjan Iran: Tehran, Firoozkooh Iran: Kohgiluyeh and Boyer-Ahmad, Bijan pass.

Iran: Kohgiluyeh and Boyer-Ahmad, Dejgerd Iran: Fars, Eqlid Iran: Isfahan, Semirom

Altitude (m) 2038 2150 2145 1975 1850 2152 2950 2335 2410 2250

Longitude

Latitude

48o 26' 51" 48o 11' 45" 48o 58' 57" 48o 43' 03" 48o 22' 06" 52o 32' 13" 51o 30' 45" 51o 55' 49" 52o 36' 29" 51o 48' 02"

34o 48' 07" 34o 49' 55" 36o 07' 11" 36o 22' 39" 36o 26' 30" 35o 41' 06" 30o 52' 21" 30o 39' 21" 30o 53' 34" 31o 45' 53"

Temperature (oC) 10 9 10 9 9 8 9 10 12 11

Rainfall (mm) 350 400 350 350 350 400 800 700 350 400

Table 2. Morphological characters in the studied populations R

Characters

R

Characters

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15

Stem length (mm) Basal leaves length (mm) Basal leaves width (mm) Basal leaves length/Width Ratio Basal leaves petiole length (mm) Basal leaves terminal spin length (mm) Basal leaves marginal spins length (mm) Basal leaves teeth number Stem leaves number Stem leaves length (mm) Stem leaves width (mm) Stem leaves length/width ratio Stem leaves terminal spin length (mm) Stem leaves marginal spins length (mm) Stem leaves teeth number

25 26 27 28 29 30 31 32 33 34 35 36 37 38 39

16 17

Uppermost leaves number Uppermost leaves length (mm)

40 41

18 19

Uppermost leaves width (mm) Uppermost leaves length/widthr

42 43

20 21

Uppermost leaves terminal spin length (mm) Uppermost leaves marginal spins length (mm)

44 45

22

Uppermost leaves teeth number

46

23 24

Head number Head length (mm)

47

Head width (mm) Head length/width Ratio Involucral bracts number Bracts seriate number Florets number Florets length (mm) Corolla limb length (mm) Corolla tube length (mm) Limb length / tube length ratio Receptacle bristles length (mm) Seed number Seed length (mm) Seed width (mm) Seed length / Width Ratio Stem indumentum (0: Glabrous; 1: Low density; 2: Medium density; 3: High density) Basal leaves form (0: Dentate; 1: Pinnatifid; 2: Pinnatisect) Basal leaves indumentum (0: Glabrous; 1: Low density; 2: Medium density; 3: High density) Stem leaves form (0: Dentate; 1: Pinnatifid; 2: Pinnatisect) Stem leaves indumentum (0: Glabrous; 1: Low density; 2: Medium density; 3: High density) Uppermost leaves form (0: Dentate; 1: Pinnatifid; 2: Pinnatisect) Uppermost leaves indumentum (0: Glabrous; 1: Low density; 2: Medium density; 3: High density) Head indumentum (0: Glabrous; 1: Low density; 2: Medium density; 3: High density) Bract shape (0: Spreading; 1: Curved)

Molecular analyses Genetic diversity and population differentiation.

ISSR bands obtained were coded as binary characters (presence = 1, absence = 0). Genetic diversity parameters were determined for dominant molecular markers in each population. These parameters were Nei's gene diversity (H), Shannon information index (I), number of effective alleles, and percentage of polymorphism (Freeland et al.

2011). Nei's genetic distance was determined among the studied populations and used for clustering. Significant genetic differences among the studied populations were

determined by: 1-AMOVA (Analysis of molecular variance) test (with 1000 permutations) for dominant molecular markers as implemented in GenAlex 6.4 (Peakall and Smouse 2006), 2- Nei,s Gst analysis of dominant markers as implemented in GenoDive ver.2 (2013) (Meirmans and Van Tienderen 2004). Furthermore, populations, genetic differentiation was studied by G'st_est = standardized measure of genetic differentiation (Hedrick 2005), and D_est = Jost measure of differentiation (Jost 2008).

MINAEIFAR et al. â&#x20AC;&#x201C; Diversity in Cousinia cylindracea populations

In order to overcome potential problems caused by the dominance of ISSR markers, a Bayesian program, Hickory (ver. 1.0) was used to estimate parameters related to genetic structure (Theta B value) (Tero et al. 2003).

Grouping of the populations. For grouping of the plant specimens, we used Neighbor Joining (NJ) clustering and Neighbor Net method of networking after 100 times bootstrapping (Huson and Bryant 2006). The Mantel test was performed to check correlation between geographical distance and genetic distance of the studied populations (Podani 2000). PAST ver. 2.17 (Hamer et al. 2012), DARwin ver. 5 (Cirad 2012) and SplitsTree4 V4.13.1 (Huson and Bryant 2013) programs were used for these analyses.

Population genetic structure. The genetic structure of geographical populations was studied by two methods; First we carried out structure analysis (Pritchard et al., 2000), for dominant markers (Falush et al. 2007). Second, we performed K-Means clustering as done in GenoDive ver. 2. (2013). Model-based clustering was performed by STRUCTURE software ver. 2.3 (Pritchard et al. 2000). The Markov chain Monte Carlo simulation was run 20 times for each value of K (2-10) for 20 iterations after a burn-in period of 105. Evanno test was carried out to identify the proper number of K (Evanno et al. 2005). We used two summary statistics to present K-Means clustering; 1pseudo-F (Calinski and Harabasz 1974) and 2- Bayesian Information Criterion (Schwarz 1978).

Gene flow. The occurrence of gene flow among populations was checked by different methods. First we performed indirect Nm analysis of POPGENE ver. 2 for ISSR loci studied according to the following formulae: Nm = 0.5 (1 - Gst)/Gst. Then we used STRUCTURE plot based on admixture model. Finally, the population, assignment test was performed by using maximum likelihood method as implemented in GenoDive ver.2 (2013) (Meirmans and Van Tienderen 2004). Frichot et al. (2013) latent factor mixed models (LFMM) was used to check if ISSR markers show correlation with environmental features of the studied populations. The analysis was done by LFMM program Version: 1.2 (2013).

RESULTS AND DISCUSSION Morphometry ANOVA test revealed significant difference in quantitative morphological characters among the studied populations (P <0.05). Moreover, CVA plot (Figure 2) separated the studied populations based on all morphological characters including both quantitative and qualitative characters, supporting ANOVA result. In general, two major clusters were formed in UPGMA tree (Figure not given), populations 1, 2, 7, 8, 9 and 10 showed morphological similarity and were placed in the first major cluster, while populations 3, 4, 5 and 6 formed the second major cluster.

PCA plot supported the grouping made by UPGMA tree and

291

also revealed some degree of intra-population morphological variability. Therefore, combination of UPGMA and PCA plot indicated morphological divergence among the studied populations.

Genetic diversity analysis AMOVA test revealed significant genetic difference among the studied populations (P = 0.01). It also revealed that 58% of total genetic variability occurred among populations while, 42% occurred within populations. These results indicated the presence of high level of genetic variability both within and among C. cylindracea populations. This conclusion was supported by Gst and Hickory analyses. The Gst value obtained among populations after 999 permutations was 0.557 (P = 0.001) and Theta B value = 0.40, which is significant. Population genetic differentiation was shown by high values obtained for Hedrick's standardized fixation index after 999 permutation (G'st=0.66, P=0.001) and Jost's differentiation index (D-est = 0.232, P = 0.001).

Populations grouping based on genetic data The Population grouping based on ISSR data by NJ tree and Neighbor-Net diagram produced similar results.

Therefore, Neighbor-Net diagram (Figure 3) is presented and discussed here. In general two major clusters were formed. Neighbor Net diagram revealed closer genetic affinity between populations No. 3-6, and also between population No. 1, 2, 7-10.

Population's genetic structure and gene flow K-Means clustering and Evanno test performed on STRUCTURE analysis produced the best number of gentic groups as k=2. This genetic grouping is in agreement with NJ tree result, presented before. Therefore, two gene pools are identified for C. cylindracea in the country.

STRUCTURE plot (Figure 4) revealed close genetic affinity between populations No. 3-6 (the first gene pool) and also between population numbers 1, 2, 7-10 (the second gene pool). This is in agreement with NeighborNet diagram. STRUCTURE plot also indicated very low degree of genetic admixture between the two gene pools.

Moreover, mean Nm value of 0.40 was obtained for the studied populations that showed low value of gene flow, supporting STRUCTURE plot result. LFMM analysis revealed that many of the studied ISSR loci were significantly (P<0.05) correlated with the environmental features studied. These may have adaptive values and being used by plants of either gene pools for local adaptation.

Among these loci, some had low Nm value (<0.50) such as ISSR loci 3, 5, 6, 7, 11, 12, 14, 16, 17, 24, 31-35, 48, and 50-52. However, some other loci had high Nm value of >1.00 or even much higher. For example, ISSR loci 22, 23, 27, 49, and 54.

Discussion Genetic diversity is an important factor for adaptation of plants to the environmental changes they encounter. In general those populations that have high level of genetic variability may have better chance of survival compared to

292

B I O D I V E R S IT A S 16 (2): 288-294, October 2015

Figure 2. CVA plot of populations based on morphological characters. numbers indicate the plant specimens (Numbers 1-10) studied from each geographical population

Figure 4. STRUCTURE plot of in Cousinia cylindracea populations studied

Figure 3. Neighbor Net diagram of ISSR data

the ones with lower degree of genetic diversity (Sheidai et al. 2012, 2013).

The present study revealed a high level of within population and among population genetic variability in C. cylindracea. The occurrence of high within population genetic diversity has been reported in other plant species and outcrossing nature of these species has been suggested to be the reason for that (Bodo-Slotta et al. 2010). The same may holds true for C. cylindracea populations.

An examination of the genetic diversity among populations within a species is crucial for a better understanding of evolutionary processes and the nature of the species. AMOVA and Hickory tests revealed significant genetic difference among the studied populations. Moreover, the low value of Nm (0.40) obtained for the studied populations showed low value of gene flow. Due to limited gene flow among populations, genetic differentiation increases. In situations with complete absence or very limited amount of gene flow, genetic drift is a strong evolutionary force and brings about high degree of within populations genetic homogeneity.

MINAEIFAR et al. â&#x20AC;&#x201C; Diversity in Cousinia cylindracea populations

This may lead to adaptation to local habitats (Hou and Lou 2011). In fact, many plant species grow within a range of different habitats and have developed adaptive strategies suited to their particular habitat (Schneller and Liebt 2007).

STRUCTURE analysis revealed population genetic fragmentation in C. cylindracea and identified the presence of two gene pools for this species in Iran. Amongpopulation differentiation in phenotypic traits and allelic variation is expected to occur as a consequence of genetic fragmentation, isolation, drift, founder effects and local selection (Jolivet and Bernasconi 2007). In fact the populations of the two gene pools in C. cylindracea differed in their morphological characters too. The populations 3-6 are different from other population in some characters such as: bract shape, stem leaves, uppermost leaves, head indumentums and head number. This finding is in agreement with Rechinger suggestion, that the C. cylindracea may contain two different varieties (Rechinger 1979). Therefore, genetic fragmentation followed by local adaptation might be the reason for the presence of two different taxonomic forms (varieties) in C. cylindracea. In many studies different ecotypes were identified and formed due to among populations genetic differentiation followed by population morphological divergence (Sheidai et al.

2012, 2013).

It is interesting to mention that populations 1 and 2 in close-by geographical locations (Figure 1), but they showed completely different genetic make up and belonged to two different gene pools. It seems they are genetically isolated by ranges of mountains such as: Kharagan mountain, Cheragi mountain, Ozonbolag mountain. The presence of strong isolation by distance and genetic differentiation of the studied populations was evidenced by significant Mantel test and population differentiation indices presented before. The populations growing on mountains not only are differentiated on the mountains along vertical axes, but genetic changes can also occur along horizontal axes. For instance, ridges may provide geographical barriers to gene flow between populations on their opposite sides, so genetic differentiation may occur across ridges (Taberlet et al. 1998).

Assessments of levels of within- and among-population genetic variation have been used to prioritize populations for conservation efforts (Petit et al. 1998) with, all else being equal, more weight given to those exhibiting higher levels of within-population variation, and to those that are more genetically divergent from others. These populations may have increased likelihood of persistence over less variable population and hence the ability of a population to contribute demographically to the species through time, and have increased adaptability in the face of future environmental changes. LFMM result showed that along with genetic drift, low degree of gene flow and migration, adaptive loci also helped populations to diverge and adapt these plants to their local condition. Therefore we have a new taxonomic group bellow the species level that can be considered as a new variety for C. cylindracea based on morphological and genetic data. We shall publish details of this new variety in future publication.

293

REFERENCES Bodo-Slotta TA, Foley ME, Chao S, Hufbauer RA, Horvath DP. 2010.

Assessing genetic diversity of Canada thistle (Cirsium arvense) in North America with microsatellites. Weed Sci 58: 387-394.

Calinski RB, Harabasz J. 1974. A dendrite method for cluster analysis.

Comm Stat 3: 1-27.

Cirad. 2012. DARwin Ver. 5 - Dissimilarity Analysis and Representation for Windows. http://darwin.cirad.fr/ Djavadi SB. 2012. New chromosome counts in Cousinia (Asteraceae, Cardueae) sections Cynaroideae and Stenocephalaeae from Iran.

Iranian J Bot 18 (1): 86-93.

Evanno G, Regnaut S, Goudet J. 2005. Detecting the number of clusters of individuals using the software STRUCTURE: a simulation study. Mol Ecol 14: 2611-2620.

Falush D, Stephens M, Pritchard JK. 2007. Inference of population structure using multilocus genotype data: dominant markers and null alleles. Mol Ecol Notes 7: 574-578.

Freeland JR., Kirk H, Peterson SD. 2011. Molecular Ecology. (2nded).

Wiley-Blackwell, UK. Frichot E, Schoville SD, Bouchard G, Francois O. 2013. Testing for associations between loci and environmental gradients using latent factor mixed models. Mol Biol Evol 30: 1687-1699.

Frodin DG. 2004. History and concepts of big plant genera. Taxon 53 (3): 753-776.

Hamer Ă&#x2DC;, Harper DA, Ryan PD. 2012. PAST: Paleontological Statistics software package for education and data analysis. Paleontol Elec 4: 9.

Hedrick PW. 2005. A standardized genetic differentiation measure.

Evolution 59 (8): 1633-1638.

Hou Y, Lou A. 2011. Population genetic diversity and structure of a naturally isolated plant species, Rhodiola dumulosa (Crassulaceae).

PLoS ONE 6, e24497. DOI: 10.1371/journal.pone.0024497.

Huson DH, Bryant D. 2006. Application of phylogenetic networks in evolutionary studies. Mol Biol Evol 23 (2): 254-267.

Huson DH, Bryant D. 2013. SplitsTree4 V4.14.1. www.splitstree.org Jolivet C, Bernasconi G. 2007. Molecular and quantitative genetic differentiation in European populations of Silene latifolia (Caryophyllaceae). Genetics 177: 1239-1247.

Jost L. 2008. GST and its relatives do not measure differentiation. Mol Ecol 17: 4015-4026.

Joudi L, Habibi bibalani Gh, Shadkami H.2011. Introduction the medicinal species of Asteraceae family in regions of East Azerbaijan in Iran. J Amer Sci 7 (5): 455-458.

Knapp HD. 1987. On the distribution of genus Cousinia (Composite).

Plant Syst Evol 155: 15-25.

Meirmans PG, Van Tienderen PH. 2004. GENOTYPE and GENODIVE: two programs for the analysis of genetic diversity of asexual organisms. Mol Ecol Notes 4: 792-794.

Murray MG, Thompson WF. 1980. Rapid isolation of high molecular weight plant DNA. Nucleic Acid Res 8: 4321-4325.

Peakall R, Smouse PE. 2006. GENALEX 6: genetic analysis in Excel.

Population genetic software for teaching and research. Mol Ecol Notes 6: 288-295.

Petit RJ, Mousadik A, Pons O. 1998. Identifying populations for conservation on the basis of genetic markers. Conserv Biol 12: 844855.

Podani J. 2000. Introduction to the Exploration of Multivariate Data English translation. Backhuyes Publisher, Leiden.

Pritchard JK, Stephens M., Donnelly P. 2000. Inference of population structure using multilocus genotype data. Genetics 155: 945-959.

Rechinger KH. 1979. Cousinia In: Rechinger, K. H. (ed.), Flora Iranica.

No. 139. Compositae IIICynareae. Cousinia. Graz, Austria: Akademische Druck-u. Verlagsanstalt.

Schneller J, Liebst B. 2007. Patterns of variation of a common fern (Athyrium filix-femina; Woodsiaceae): population structure along and between altitudinal gradients. Amer J Bot 94 (6): 965-971.

Schwarz G. 1978. Estimating the dimension of a model. Ann Stat 6: 461464.

Sheidai M, Afshar F, Keshavarzi M, Talebi M, Noormohammadi Z, Shafaf T. 2014. Genetic diversity and genome size variability in Linum austriacum (Lineaceae) populations. Biochem Syst Ecol 57: 20-26.

Sheidai M, Ahmad-Khanbeygi M. and Attar F. 2012. New chromosome number reports in Cousinia species (Compositae). Cytologia 77 (1): 11-16.

294

B I O D I V E R S IT A S 16 (2): 288-294, October 2015

Sheidai M, Zanganeh S, Haji-Ramezanali R, Nouroozi M, Noormohammadi Z, Ghsemzadeh-Baraki S. 2013. Genetic diversity and population structure in four Cirsium (Asteraceae) species. Biologia 68 (3): 384-397.

Sigrist MS, Carvalho CJB. 2008. Detection of areas of endemism on two spatial scales using Parsimony Analysis of Endemicity (PAE). The Neotropical region and the Atlantic Forest. Biota Neotropical 8 (4): 33-42.

Taberlet P, Fumagalli L, Wust-Saucy AG, Cosson J-F. 1998. Comparative phylogeography and postglacial colonization route in Europe. Mol Ecol 7: 453-464.

Tero N, Aspi J, Siikamaki P, Jakalaniemi A, Tuomi J. 2003. Genetic structure and gene flow in a metapopulation of an endangered plant species, Silene tatarica. Mol Ecol 12: 2073-2085.

Zar M, Khosravi AR, Joharchi M.R. 2012. Distribution patterns of the genus Cousinia (Asteraceae) in Iran. Iranian J Bot 19 (1): 127-141.

B I O D I V E R S IT A S Volume 16, Number 2, October 2015 Pages: 295-302

ISSN: 1412-033X E-ISSN: 2085-4722 DOI: 10.13057/biodiv/d160226

Threats and conservation of Paris polyphylla an endangered, highly exploited medicinal plant in the Indian Himalayan Region ASHISH PAUL1,, PADMA RAJ GAJUREL2, ARUP KUMAR DAS1 1

Department of Botany, Rajiv Gandhi University, Rono Hills, Doimukh-791112, Arunachal Pradesh, India.

Tel.: +91-9862035885, email: ashishpaul1@gmail.com Department of Forestry, North Eastern Regional Institute of Science and Technology, Deemed University, Nirjuli-791109, Arunachal Pradesh, India

2

Manuscript received: 29 August 2015. Revision accepted: 23 October 2015.

Abstract. Paul A, Gajurel PR, Das AK. 2015. Threats and conservation of Paris polyphylla an endangered, highly exploited medicinal plant in the Indian Himalayan Region. Biodiversitas 16: 295-302. The Indian Himalayan Region is home of numerous globally significant medicinal plants. Paris polyphylla Smith is an important medicinal perennial herbaceous species used mostly in traditional medicine, having medicinal properties like anticancer, antimicrobial, antioxidant, anti-tumor, cytotoxicity, steroid saponins etc. The present study highlights the uses, population status and threats to P. polyphylla in Arunachal Pradesh. P. polyphylla is distributed in tropical to temperate region of South East Asia, particularly in Bhutan, China, India, Laos, Myanmar, Nepal, Thailand and Vietnam. In India it is distributed in the state of Arunachal Pradesh, Himachal Pradesh, Jammu and Kashmir, Manipur, Meghalaya, Mizoram, Nagaland, Sikkim and Uttarakhand. In the Eastern Himalayan state of Arunachal Pradesh, the species found to be occurring with distinct morphological interspecific variations. In the past 5 years the market demand of the species increased tremendously, which ultimately led to the over exploitation of the species and traded illegally in heavy quantities. The present study showed very poor population density, which ranged between 0.42 individuals m-2 to 1.48 individuals m-2. While, Importance Value Index of the species ranged between 3.37 to 8.45. Because of the unsustainable extraction and poor natural regeneration of the species, wild populations are at risk of extinction and accordingly it has been listed as an endangered species. The rhizome is the primary mode of regeneration, although it regenerate from seeds. Because of the commercial demand of the rhizome, the population of the species may entirely be wiped out if proper conservation initiatives have not been taken. Effective conservation strategies both in situ and ex situ may help to protect the species from its extinction. Inclusion of the species under the priority species list of both the National and State Medicinal Plant Boards for cultivation may be helpful for its long term management and conservation. Mass awareness and active involvement of local people for large scale cultivation may reduce the pressure on wild populations. This will meet the market demand and boost the rural economy and will also help in conservation of the species.

Keywords: Paris polyphylla, Himalayan region, Arunachal Pradesh, economic value, over exploitation, population status, conservation

INTRODUCTION Forests play a significant role in life and wealth of human beings. It provides natural resources like fuel, timber, industrial forest products, wildlife habitat, animal products, etc. and also food (fruits, tubers, leaves, meat), medicines and many other commercial products. However, increasing anthropogenic disturbances and unsustainable extraction have caused the extinction of many species with ecological and economic importance. Conservation and management of these species have become a major concern to the scientific community in this 21st century. Human activities associated with deforestation, fragmentation, habitat loss, habitat degradation, over exploitation, unsustainable extraction, etc. have collectively built up the pressure on existence of many aromatic, medicinal, ethnobotanical, economically important plant species such as Aconitum spp., Coptis teeta, Cordyceps sinensis, Embelia ribes, Gymnocladus assamicus, Gynocardia odorata, Homalomena aromatica, Illicium griffithii, Panax spp., Podophyllum hexandrum, Rhododendron spp., Swertia chirayita, Taxus wallichiana, etc. in the Himalayan region which have been regarded as home of many valuable aromatic and medicinal plant species. Present

rapid loss of genetic resources due to various anthropogenic activities will not only affect the local/regional biodiversity but also affect the various ecosystem services.

Taxus wallichiana Zuccarini provides an example which, become endangered due to unsustainable extraction for its anti-cancerous chemical Paclitaxel (Taxol®), the most effective drug used for a variety of cancers (Cragg et al. 1993; Goldspiel 1997). In recognition of its anticancerous properties during 1980s the species has suffered large scale unsustainable extraction, which led to its present status (Paul et al. 2013). It is the most threatened species and has been categorized as endangered by the IUCN (Thomas and Farjon 2011). Today history is again repeating for many other species, including Paris polyphylla Smith because of its high commercial demand.

The genus Paris L. belongs to the family Liliaceae of monocots comprises rhizomatous herbaceous species. The genus comprises 24 species which are distributed in Bhutan, China, India, Japan, Korea, Laos, Mongolia, Myanmar, Nepal, Russia, Thailand, Vietnam and Europe (Liang and Soukup 2000). China has the highest number of species (22 species) with 12 endemic species. In India the genus is represented by 2 species, namely P. polyphylla

296

B I O D I V E R S IT A S 16 (2): 295-302, October 2015

and P. thibetica with about 6 intraspecific taxa (Liang and Soukup 2000). The P. polyphylla has been widely known specifically with different subspecies and varieties. It is distributed in Bhutan, China, India, Laos, Myanmar, Nepal, Thailand and Vietnam (Liang and Soukup 2000). In India the species have been recorded from the Himalayan states like Arunachal Pradesh (Chowdhery et al. 2009), Himachal Pradesh (ENVIS 2010; Goraya et al. 2013), Jammu and Kashmir (ENVIS 2010), Manipur (Gogoi 2010), Meghalaya (Mao et al. 2009; Mir et al. 2014), Mizoram (Lalsangluaii et al. 2013), Nagaland (Jamir et al. 2012), Sikkim (Maity et al. 2004) and Uttarakhand (ENVIS 2010).

It is a rhizomatous herb grows up to a height ranging from 10-100 cm and distributed in an altitudinal range between 100-3500 m asl. The whorled leaves number ranging from 5-12 with a long petiole (stalk) and flower with leafy bracts on a long stalk are the main identifying characters. The fruit is berry in nature, oval or round in shape with many seeds and become red on ripening. Seeds are enveloped by red, succulent aril. Flowering and fruiting occur during March to November (Liang and Soukup 2000). The species P. polyphylla has got much attention in recent times owing to its important medicinal properties, biological activities and pharmaceutical demand.

Rhizome of various species of the genus Paris is the major source of raw material for ‘Yunnan Baiyao’, a very famous Yi ethno-medicine used against various diseases and injuries like back pain, bleeding, fractured bones, fungal diseases, poisonous snakes or insect bites, skin allergy, tumors and a variety of cancers (Long et al. 2003).

The rhizome of the species P. polyphylla is used in various Chinese traditional medicine, including analgesic, antiphlogistic, antipyretic, antitussive and depurative (Duke and Ayensu 1984; Yeung 1985) whereas, the whole plant is used for the treatment of febrifuge, liver and lung cancer and laryngeal carcinoma (Khanna et al. 1975; Ravikumar et al. 1979; Sing et al. 1980; 1982). In Nepal, the rhizome is indigenously used against snake bites, insect bites, alleviate narcotic effects, internal wounds, external wounds, fever, food poisoning and are fed to cattle during diarrhea and dysentery (Dutta 2007; Baral and Kurmi 2006). It is also used to treat headache, vomiting and worms (Uprety et al.

2010). A drug called as Gong Xue Ning (GXN) capsule has been developed from the saponin extract of P. polyphylla var. yunnanensis in China for the treatment of abnormal uterine bleeding (AUB) (Zhao and Shi 2005; Guo et al.

2008). Rhizome of the species is also used against uterine contractile effects (Tian et al. 1986; Zhou 1991). P. polyphylla is a folk medicinal plant in the Indian Himalayan Region, traditionally used against analgesic, antibacterial, antiphlogistic, antispasmodic, antitussive, any poisonous bites, burn, cut or injury, depurative, detoxification, diarrhea, dressing, dysentery, febrifuge, fever, gastric, gastritis, intestinal wounds, narcotic, poisoning, rashes or itching, scabies, skin diseases, sleeplessness, snake bite, stomach pain, typhoid, ulcer and wounds (Farooquee et al. 2004; Maity et al. 2004; Tiwari et al. 2010; Jamir et al. 2012; Lalsangluaii et al. 2013; Pfoze et al. 2013; Mir et al. 2014; Sharma and Samant 2014). Further Shah et al. (2012) reviewed the various medicinal properties of the P. polyphylla

and categorized the species as the ‘jack of all trades’.

Several pharmacological properties including antibacterial, anticancer/anti-tumor, antimicrobial, antiviral, antifungal, antioxidant, cytotoxic, steroid saponin etc.

(Khanna et al. 1975; Ravikumar et al. 1979; Singh et al.

1980; 1982; Zhou 1991; Yu and Yang 1999; Mimaki et al.

2000; Lee et al. 2005; Wang et al. 2006; Yun et al. 2007; Zhang et al. 2007; Guo et al. 2008; Yan et al. 2009; Xuan et al. 2010; Zhao et al. 2010; Chan et al. 2011; Wang et al.

2011; Zhu et al. 2011; Kang et al. 2012; Li et al. 2012; Zhao et al. 2012; Shen et al. 2014) have been reported from the rhizomes of many species of the genus Paris.

Arunachal Pradesh in the Eastern Himalayan Region of India is very rich in biological and socio-cultural diversity.

However, anthropogenic disturbances in the recent past have led to the depletion of many life forms. Besides, there is a lack of adequate information about the status and importance of the species in this Eastern Himalayan Region. With the large extent of decreasing green cover, many species, including the genus Paris are facing the impact of ecological disturbances. Rampant and reckless extraction in the Indian Himalayan Region owing to high market demand has put the pressure on the existence of the species particularly in Arunachal Pradesh. Many studies have been carried out around the world while, no study has been done in Arunachal Himalaya. Therefore, the present study has been undertaken to enumerate the present status of uses, population and threats of this important medicinal plant species.

MATERIALS AND METHODS During the survey of medicinal plant diversity in the Eastern Himalayan state of Arunachal Pradesh in the past few years, specific observation has been made on some of the selected species which are commercially exploited.

Discussion and consultation with local communities have been undertaken to find out the uses and market potential of the species. All the relevant records on the species were also analyzed. Based on the available secondary informations and primary field data from the state of Arunachal Pradesh, an attempt has been made to highlight the taxonomic diversity, distribution, medicinal importance, status of occurrence, threats and conservation strategies.

The present scenario of harvesting and trade has also been discussed.

To assess the population status of P. polyphylla, three study stand viz., Bomdila, Mayudia and Talle Valley were selected from West Kameng, Lower Dibang Valley and Lower Subansiri districts, respectively. The study sites were selected based on the availability of the species. To study the community characteristics the sampling of the vegetation was carried out using the quadrate method.

Twenty five quadrates of 1 m x 1 m were laid randomly in each study stands. Community characteristics of each of the stands were studied using quantitative analytical methods.

Important ecological parameters like density, frequency, Importance Value Index (IVI) were worked out by following Misra (1968) and Mueller-Dombois and Ellenberg (1974).

PAUL et al. â&#x20AC;&#x201C; Paris polyphylla of the Indian Himalayan Region

RESULTS AND DISCUSSION Paris polyphylla in Arunachal Pradesh In Arunachal Pradesh, the species P. polyphylla is distributed in subtropical to temperate forests in most of the districts. It grows mainly in moist and shady areas of forests, thickets, bamboo forests, grassy or rocky slopes and nearby water channel in rich humus soil. Total number of occurrences of taxa of the genus Paris in Arunachal Himalaya has not been assessed till date. In the present survey, distribution of four distinct variances of P. polyphylla has been recorded from Arunachal Pradesh, which is harvested from the wild (Figure 1 A-E). Authentic identification of the variability of the species and further study is under process. Locally the species is known as Mungong (Monpa dialect), Orpo (Adi dialect) and Aiichangmu (Sherdukpen dialect). The P. polyphylla and other distinct variety of the species are found to be growing in an altitudinal range between 1000-3500 m asl. Till date, except P. polyphylla no detail taxonomic enumeration of other taxa of the genus has been described in the flora references of Arunachal Pradesh.

Utilization, harvesting and population status Indigenous medicinal uses of P. polyphylla are very limited in Arunachal Pradesh. The rhizome is used against fever by the Adi tribe in the Upper Siang district. Rhizomes of the species are also consumed as fresh while ripen fruits (Figure 2 A, B) are eaten sometime. The fruits are also preferred by deer. The paste of the rhizome is used against snake bites by the Sherdukpen tribe in West Kameng district. Till recent past the commercial value of the species was not known in the state and the species were found abundantly in wild. However, mostly after 2005 the commercial exploitation of the rhizome started in large scale from most of the districts owing to its high commercial demand in the international markets. Large quantity of rhizomes from wild (Figure 3 A) is harvested, particularly during the month of April to July from various places like Baishaki, Bomdila, Chaglagam, Dirang, Lumla, Manigong, Mechuka, Muktur, Mayudia, Pasighat, Senge, Shakti, Tawang, Zimithang and many other places of the state. Collected rhizomes are sold either in dry or raw form (Figure 3 B) to the middlemen. Middlemen who collect the rhizomes from the local people sell it to outside traders and finally it goes to international market. The local people (Figure 3 C) sell fresh rhizomes at a rate ranging from about Rs. 700-800 kg-1 while dried rhizomes at a rate ranging from Rs. 3500-4000 kg-1. Although it is an offfarm income resource or livelihood of the local communities, but they are not aware of its important

297

medicinal properties. Moreover, the species has not much utilized in the indigenous medicinal systems of the state, unlike other Indian Himalayan states and also Himalayan countries. Local people reported that although the rhizome of the species has high market potential, but they are not even aware about the importance and uses of the species.

In the present pilot study, the population status of P. polyphylla was assessed in three selected study stands (i.e., Bomdila, Mayudia and Talle Valley) of West Kameng, Lower Dibang Valley and Lower Subansiri districts, respectively. Highest density (1.48 individuals m-2) was recorded in Talle Valley and lowest (0.42 individuals m-2) in Mayudia. While, maximum frequency (32%) was observed in Bomdila and minimum (10%) in Mayudia (Table 1). The present frequency and density of the species was found to be very low than the reported average frequency (60.83%) and density (1.78 individuals m-2) from Nepal (Madhu et al. 2010). The Importance Value Index showed the highest (8.45) in Talle Valley and lowest (3.37) in Mayudia (Table 1). The main dominant associated species which sharing the maximum IVI includes Anaphalis busua (5.51), Arisaema sp. (5.85), Fragaria vesca (21.09), Galearis spathulata (6.78), Gnaphalium affine (9.13), Grass sp. (8.23), Pteris sp. (7.11), Plantago major (6.78), Rubia manjith (7.34), Rubus calycinus (6.44), Rubus nepalensis (5.07), Senecio wallichii (5.36) and Swertia chirayita (11.77) in Bomdila. Species like Artemisia nilagirica (11.29), Coptis teeta (28.46), Carduus edelbergii (6.32), Crassocephalum crepidioides (5.93), Cyperus cyperoides (13.10), Hemiphragma heterophyllum (9.96), Hydrocotyle asiatica (10.15), Geranium pratense (6.96), Grass sp. (10.17), Plantago asiatica (11.61), Polygonatum verticillatum (9.39), Pteris sp. (28.48), Rumex nepalensis (10.47), Selaginella sp. (5.07) and Senecio raphanifolius (9.14) were dominant in Mayudia.

While Anaphalis busua (9.29), Arisaema sp. (9.95), Artemisia sp. (13.29), Centella sp. (19.79), Carduus edelbergii (10.68), Fragaria nubicola (13.86), Hydrocotyle himalaica (11.12), Impatiens sp. (9.72), Podophyllum hexandrum (5.40), Polygonum hydropiper (9.28), Potentilla plurijuga (11.56) and Viola sp. (6.26) were the dominant species in Talle Valley. The natural populations of P. polyphylla are affected because of anthropogenic activities like extraction and habitat destruction which leading to its endangerment. Mao et al. (2009) also reported that the species has become rare due to over harvesting from the wild. Owing to unsustainable extraction and illegal trade the species had already been categorized as endangered in Himachal Pradesh, Jammu and Kashmir and Uttarakhand (ENVIS 2010).

Table 1. Frequency, density and Importance Value Index of Paris polyphylla in the selected study stands of Arunachal Pradesh Study sites Bomdila Mayudia Talle Valley

District West Kameng Lower Dibang Valley Lower Subansiri

Frequency (%) 32 10 22

Density (individuals m-2) 1.32 0.42 1.48

IVI 6.07 3.37 8.45

298

B I O D I V E R S IT A S 16 (2): 295-302, October 2015

B

A

C

E

D Figure 1. The genus Paris in Arunachal Himalaya. A. Paris polyphylla, B-E. Distinct variances of Paris polyphylla

A

B

Figure 2. Paris polyphylla fruits. A. Young, B. Ripen fruit

Trade and marketing Based on the conversation with the local people, all the harvested rhizomes of the P. polyphylla are traded to Myanmar and other South East Asian countries illegally routed through Assam and Manipur. Illegal trading occurred either at local or directly to the regional level through middlemen and then outside of the country. The

rhizomes harvested from Dibang and Lower Dibang Valley district are traded to Tinsukia/Dibrugarh via Roing. Upper Siang and East Siang district are traded to Dibrugarh/ Tezpur via Pasighat. West Siang district is traded to Tezpur via Silapathar. While harvested rhizomes from Tawang and West Kameng district are traded to Tezpur via Bomdila.

Illegal exporting of rhizomes of the P. polyphylla from

PAUL et al. â&#x20AC;&#x201C; Paris polyphylla of the Indian Himalayan Region

A

B

299

C

Figure 3. Rhizomes of Paris polyphylla. A. Freshly collected rhizomes, B. Drying, C. Ready to sell

Arunachal Pradesh to China via Myanmar has been reported by Basar (2014). Illegal trade of the rhizomes to Myanmar through Indo-Myanmar border by the local traders have been reported (The Sangai Express 17/08/2008). Trafficking of the rhizomes from the Indian states of Arunachal Pradesh, Manipur, Meghalaya and Nagaland to Myanmar have also been reported (Mao et al.

2009).

Major threats to the species Most of the population of P. polyphylla is depleted due to rampant and reckless extraction. In Arunachal Pradesh the species is facing tremendous pressure because of over exploitation due to its high market demand. Unsustainable extraction of the species owing to its high commercial demand has led to decline in populations and becoming rare in its natural habitat. Developmental activities like broading of road, urbanization and habitat destruction, etc. collectively put pressure on the existence of the species.

Other anthropogenic activities like shifting agriculture, forest resource collection, logging, etc. are affecting habitat and wild populations of the species. Heavy rainfall leading to the land erosion/landslides, etc. is also causing the habitat loss and population depletion of the species.

Grazing is also one of the factors for loss of habitat/population of the species. The rhizome is the main mode of regeneration though it regenerates from seeds.

Uncontrolled and indiscriminate harvesting of whole plant without leaving any part of the rhizome, harvesting before reproductive/flowering or seed maturity period etc. are causing regeneration failure in its natural habitat.

Conversely, regeneration of P. polyphylla from seed in wild, green house, laboratory is very poor because of long dormancy period and very slow growing nature (Madhu et al. 2010; Qi et al. 2013) which is affecting the growth and survival of the species. Over harvesting has caused the decrease in natural population of the species. The over exploitation, rampant illegal extraction and trade, wild populations of P. polyphylla are at risk of extinction from its natural habitat. Though the species has not yet been assessed by the IUCN Red List however, if the present

trend continues, the species will be wiped out from the wild and thus suitable conservation measures/strategies are of utmost important. Very recently Arunachal Pradesh State Medicinal Plants Board (APSMPB) expressed concern over the rampant and reckless extraction of P. polyphylla from most of the districts of the state. The Board has also urged the local administration (Deputy Commissioner, Superintendent of Police and Divisional Forest Officers) of most of the districts to check the exploitation of the rare, endangered and threatened species before being extinct from the state (The Arunachal Times 22/08/2015).

Management and conservation The present study on the population status revealed very low population density (Table 1) that warrant immediate conservation action. For effective management the following strategies may be adopted: (i) Detailed exploration and documentation for identification of major distribution areas with mapping or ecological niche modeling is needed to save this natural resource. (ii) Critical studies on population structure and regeneration status covering both the open and protected areas provide the useful data for conservation action. Evaluation of species specific or area specific threat is essential for management of this species. (iii) Inclusion of the species under the priority species list of both the National and State Medicinal Plant Boards for large scale cultivation and conservation. (iv) Cultivation and conservation through community involvement. Out of total recorded forest areas, about 60.22% of the forest land (FSI 2013) of the state are traditionally controlled by the communities as per the customary rights called Unclassed State Forest (USF) or community forests, are ideal for large scale cultivation and conservation. This will be accomplished only when local communities are involved. Mass awareness regarding the declining population of the species, its high medicinal properties and economic importance is required. (v) Sustainable harvesting practices must be adopted as the rhizome of the species is used. The whole plant is uprooted to collect the rhizome leading to the destruction of the plant. Hence, appropriate technique should be used for

300

B I O D I V E R S IT A S 16 (2): 295-302, October 2015

B

A Figure 4. Cultivation of Paris polyphylla in homesteads. A. Monpa villager busy in cultivation, B. Cultivated Paris polyphylla

harvesting the mature rhizome without effecting the population like viable portion of the rhizome may be left in its natural habitat, so that it can regenerate naturally. (vi) Local/regional level management approaches with active community involvement and benefits sharing should be undertaken. On-farm and off-farm management and scientific studies of the species is urgently needed. Legal restriction on harvesting or trade of rhizome may be imposed to stop further genetic loss. (vii) Legal protection of habitat that are not covered in the protected area of the sate as it has only 11.68% of the total geographical area (FSI 2013) under protected area network that may not be enough for conservation. The selected habitat with a good viable population may be brought under legal protection like Medicinal Plants Conservation Area (MPCA) for in situ conservation.

Commercial cultivation for conservation and economic development The habitat of P. polyphylla distributed with an attitudinal range between 100 to 3500 m asl (Liang and Soukup 2000) which is one of the important characteristics for large scale cultivation under the suitable climatic condition. To meet the need of high market demand for its important medicinal, biological and pharmaceutical purposes the species can be cultivated commercially with active community participation. Most of the local communities in this Himalayan region of Arunachal Pradesh can be engaged for large scale cultivation (Figure 4 A, B) in community land, nurseries, homesteads, etc. will boost the economy and income generation of the tribal people of the state. Like Curcuma longa L. (turmeric), Elettaria cardamomum (L.) Maton (cardamom) and Zingiber officinale Rosc. (ginger), P. polyphylla can be cultivated in large scale through rhizome in its natural habitat. Domestication and inclusion in Agroforestry and social forestry program with community participatory management will further enhance the rural economy, which contributes towards the conservation and meet the market

demand. For instance, in Yunnan of China, people have already been started cultivation of P. polyphylla in their Agroforestry systems to meet the commercial demand (Long et al. 2003). Departments like Agriculture, Horticulture, the State Biodiversity Board, State Forest Research Institute and State Medicinal Plant Board may take active participation for promotion of large scale cultivation. A detail taxonomic study on the genus Paris is utmost important to find out the taxonomic diversity as the high variability among the populations have been observed that may lead the discovery of more new species. Although the occurrence of eight taxa of Paris from India has been mentioned (Liang and Soukup 2000) while only one species, i.e., P. polyphylla has been reported from Arunachal Pradesh (Chowdhery et al. 2009). There is an urgent need for our scientific community to pay their ample attention to this valuable herbaceous species for conservation and further scientific studies in the Indian Himalayan Region particularly in Arunachal Pradesh.

ACKNOWLEDGEMENTS The authors wish to express their deepest thanks to all the local field guides Chenjeer Dree, Dipu Goyiak, Jamba, Jam Tsering, Kejang Serthipa, Nima Dondu, Pem Dakpa, Rabi Mekula, Tado, all the village headmen and villagers for help and support during the field survey. The first author is thankful to University Grants Commission, Government of India, New Delhi for UGC-Dr. D.S. Kothari Post Doctoral Fellowship. Authors deeply acknowledge the help and support of Dr. Sanjeeb Bharali, Amal Bawri and Lobsang Tashi during the field study. The authors also express their sincere thanks to the various Forest Officials, Department of Environment and Forests, Government of Arunachal Pradesh for permitting us to work in forest areas of the state. We are also thankful to all, those who extended their cooperation during the field study. The authors are thankful to anonymous reviewers for

PAUL et al. â&#x20AC;&#x201C; Paris polyphylla of the Indian Himalayan Region

sparing their valuable times for corrections and suggestions.

REFERENCES Baral SR, Kurmi PP. 2006. A compendium of medicinal plants in Nepal.

Mrs. Rachana Sharma, 281 Maiju Bhal, Chabahil, Kathmandu, Nepal.

534 pp.

Basar E. 2014. Urgent need to conserve and promote Paris polyphylla in Arunachal. The Arunachal Times. http://www.arunachaltimes.in. [26 August 2014].

Chan Judy Yuet-Wa, Koon Johnny Chi-Man, Liu Xiaozhou, Detmar M, Yu B, Kong Siu-Kai, Fung Kwok-Pui. 2011. Polyphyllin D, a steroidal saponin from Paris polyphylla, inhibits endothelial cell functions in vitro and angiogenesis in zebrafish embryos in vivo. J Ethnopharmacol 137: 64-69.

Chowdhery HJ, Giri GS, Pramanik A. 2009. Materials for the Flora of Arunachal Pradesh. Vol. 3. Hydrocharitaceae-Poaceae. Flora of India, Series 2. Botanical Survey of India, Kolkata, India. 349 pp.

Cragg GM, Schepartz SA, Suffness M, Grever MR. 1993. The Taxol supply crisis. New NCI policies for handling the large-scale production of novel natural product anticancer and anti-HIV agents. J Nat Prod 56: 1657-1668.

Duke JA, Ayensu ES. 1984. Medicinal plants of China. Vol. I-II. Reference Publications, Inc., Algonac, Michigan, USA.705 pp.

Dutta IC. 2007. Non timber forest products of Nepal: identification, classification, ethnic uses and cultivation. Hill Side Press, Kathmandu, Nepal. 484 pp.

ENVIS. 2010. Medicinal Plants of Conservation Concern. ENVIS Centre on Conservation of Medicinal Plants, FRLHT, Bangalore. http://envis.frlht.org/medicinal-plants-conservation-concernspecies.php. [15 October 2015].

Farooquee NA, Majila BS, Kala CP. 2004. Indigenous knowledge systems and sustainable management of natural resources in a high altitude society in Kumaun Himalaya, India. J Hum Ecol 16: 33-42.

FSI. 2013. State of Forest Report 2013. Forest Survey of India. Ministry of Environment and Forests. Government of India, Dehradun, India.

276 pp.

Gogoi R. 2010. The family Liliaceae in Manipur, India. Bull Arunachal Forest Res 26: 73-81.

Goldspiel BR. 1997. Clinical overview of the taxanes. Pharmacotherapy 17: 110S-125S. Goraya GS, Jishtu V, Rawat GS, Ved DK. 2013. Wild medicinal plants of Himachal Pradesh: An assessment for their conservation status and management prioritisation. Himachal Pradesh Forest Department, Shimla, Himachal Pradesh, India.

Guo L, Su J, Deng BW, Yu ZY, Kang LP, Zhao ZH, Shan YJ, Chen JP, Ma BP, Cong YW. 2008. Active pharmaceutical ingredients and mechanisms underlying phasic myometrial contractions stimulated with the saponin extract from Paris polyphylla Sm. var. yunnanensis used for abnormal uterine bleeding. Hum Reprod 23: 964-971.

Jamir NS, Lanusunep, Pongener N. 2012. Medico-herbal medicine practiced by the Naga tribes in the state of Nagaland (India). Indian J Fund Appl Life Sci 2: 328-333.

Kang Li-Ping, Liu Yi-Xun, Eichhorn T, Dapat E, Yu He-shui, Zhao Y, Xiong Cheng-Qi, Liu C, Efferth T, Ma, Bai-Ping. 2012.

Polyhydroxylated steroidal glycosides from Paris polyphylla. J Nat Prod 75: 1201-1205.

Khanna I, Seshadri R, Seshadri TR. 1975. Constitution of pariphyllin-A and pariphyllin-B, the saponins isolated from the tubers of Paris polyphylla. Indian J Chem 13: 781-784.

Lalsangluaii F, Chinlampianga M, Shukla AC. 2013. Efficacy and potency of Paris polyphylla Smith, an ethno-medicinal plant of Mizoram. Sci Technol J 1: 36-40.

Lee MS, Yuet-Wa JC, Kong SK, Yu B, Eng-Choon VO, Nai-Ching HW, Chung-Wai TM, Fung KP. 2005. Effects of polyphyllin D, a steroidal saponin in Paris polyphylla, in growth inhibition of human breast cancer cells and in xenograft. Cancer Biol Ther 4: 1248-1254.

Li FR, Jiao P, Yao ST, Sang H, Qin SC, Zhang W, Zhang YB, Gao LL. 2012. Paris polyphylla Smith extract induces apoptosis and activates cancer suppressor gene connexion 26 expression. Asian Pac J Cancer Prev 13: 205-209.

301

Liang SJ, Soukup VG. 2000. Paris Linnaeus. In: Chen Sing-chi, Liang Song-jun, Xu Jiemei, Tamura MN. (eds) Flora of China. Vol. 24.

Flagellariaceae through Marantaceae. Science Press (Beijing), China and Missouri Botanic Garden Press (St. Louis), USA. pp. 88-95.

Long CL, Li H, Ouyang Z, Yang X, Li Q, Trangmar B. 2003. Strategies for agrobiodiversity conservation and promotion: a case from Yunnan, China. Biodivers Conserv 12: 1145-1156.

Madhu KC, Phoboo S, Jha PK. 2010. Ecological study of Paris polyphylla Sm. Ecoprint 17: 87-93.

Maity D, Pradhan N, Chauhan AS. 2004. Flock uses of some medicinal plants from North Sikkim. Indian J Tradit Know 3: 66-71.

Mao AA, Hynniewta TM, Sanjappa M. 2009. Plant wealth of Northeast India with reference to ethnobotany. Indian J Tradit Know 8: 96-103.

Mimaki Y, Kuroda M, Obata Y, Sashida Y, Kitahara M, Yasuda A, Naoi N, Xu ZW, Li MR, Lao AN. 2000. Steroidal saponins from the rhizomes of Paris polyphylla var. chinensis and their cytotoxic activity on HL-60 cells. Nat Prod Lett 14: 357-364.

Mir AH, Upadhaya K, Choudhury H. 2014. Diversity of endemic and threatened ethnomedicinal plant species in Meghalaya, north-east India. Int Res J Environment Sci 3: 64-78.

Misra R. 1968. Ecology work book. Oxford and IBH Publishing Company, New Delhi, India. 244 pp.

Mueller-Dombois D, Ellenberg H.1974. Aims and methods of vegetation ecology. John Wiley and Sons, New York, USA. 547 pp.

Paul A, Bharali S, Khan ML, Tripathi OP. 2013. Anthropogenic disturbances led to risk of extinction of Taxus wallichiana Zuccarini, an endangered medicinal tree in Arunachal Himalaya. Nat Area J 33: 447-454.

Pfoze NL, Kumar Y, Myrboh B. 2013. Screening of bioactive phytochemicals obtained from lesser known ethnomedicinal plants of Senapati district of Manipur, India. Pleione 7: 489-500.

Qi J, Zheng N, Zhang B, Sun P, Hu S, Xu W, Ma Q, Zhao T, Zhou L, Qin M, Li X. 2013. Mining genes involved in the stratification of Paris Polyphylla seeds using high-throughput embryo Transcriptome sequencing. BMC Genomics 14: 358.

Ravikumar PR, Hammesfahr P, Sih CJ. 1979. Cytotoxic saponins from the Chinese herbal drug Yunnan Bai Yao. J Pharm Sci 68: 900-903.

Shah SA, Mazumder PB, Choudhury MD. 2012. Medicinal properties of Paris polyphylla Smith: a review. J Herbal Med Toxicol 6: 27-33.

Sharma P, Samant SS. 2014. Diversity, distribution and indigenous uses of medicinal plants in Parbati Valley of Kullu district in Himachal Pradesh, Northwestern Himalaya. Asian J Adv Basic Sci 2: 77-98.

Shen S, Chen D, Li X, Li T, Yuan M, Zhou Y, Ding C. 2014.

Optimization of extraction process and antioxidant activity of polysaccharides from leaves of Paris polyphylla. Carbohydr Polym 104: 80-86.

Singh SB, Thakur RS, Schulten H-R. 1980. Spirostanol saponins from Paris polyphylla, structures of polyphyllin C, D, E and F. Phytochemistry 21: 2925-2929.

Singh SB, Thakur RS, Schulten H-R. 1982. Furostanol saponins from Paris polyphylla: structures of polyphyllin G and H. Phytochemistry 21: 2079-2082.

The Arunachal Times 22/08/2015. Concern on extraction and trading of Paris polyphylla. http://www.arunachaltimes.in. [23 August 2015].

The Sangai Express 17/08/2008. Anti-tumor action plant found at Senapati smuggling threatens rare species. http://www.thesangaiexpress.com. [18 August 2008].

Thomas P, Farjon A. 2011. Taxus wallichiana. The IUCN Red List of Threatened Species 2011: e.T46171879A9730085.

DOI: 10.2305/IUCN.UK.2011-2.RLTS.T46171879A9730085.en.

Tian Y, Zheng LH, Xu ZY, Sun LQ, Gao CK, Zheng QZ, Zhang ZH, Shu Y. 1986. Clinical and pharmacological study of the hemostatic action of rhizoma paridis by contraction of uterus. J Trad Chin Med 6: 178182.

Tiwari JK, Ballabha R, Tiwari P. 2010. Ethnopaediatrics in Garhwal Himalaya, Uttarakhand, India (Psychomedicine and Medicine). New York Sci J 3: 123-126.

Uprety Y, Asselin H, Boon EK, Yadav S, Shrestha KK. 2010. Indigenous use and bio-efficacy of medicinal plants in the Rasuwa district, Central Nepal. J Ethnobiol Ethnomed 6: 1-10.

Wang Y, Gao W, Liu X, Zuo Y, Chen H, Duan H. 2006. Anti-tumor constituents from Paris polyphylla. Asian J Tradit Med 1: 7-10.

Wang Yuan-Chuen, Yi Tsu-Yi, Lin Kuei-Hsiang. 2011. In vitro activity of Paris polyphylla Smith against enterovirus 71 and coxsackievirus B3 and its immune modulation. Am J Chin Med 39: 1219-1234.

302

B I O D I V E R S IT A S 16 (2): 295-302, October 2015

Xuan Q, Bao FK, Pan HM, Liu AH. 2010. Isolating fungal endophyte from Paris polyphylla Smith var. yunnanensis and identifying their antibacterial ability. Afr J Microbiol Res 4: 1001-1004.

Yan LL, Zhang YJ, Gao WY, Man SL, Wang Y. 2009. In vitro and in vivo anticancer activity of steroid saponins of Paris polyphylla var. yunnanensis. Exp Oncol 31: 27-32.

Yeung HC. 1985. Handbook of Chinese Herbal Formulas. 2nd Edition.

Institute of Chinese Medicine. Los Angeles, California, USA. 431 pp.

Yu DQ, Yang JS. 1999. Handbook of Analytical Chemistry, Nuclear Magnetic Resonance Spectroscopy. Vol. VII. 2nd Edition. Chinese Chemical Industry Press, Beijing, China. 872 pp.

Yun H, Lijian C, Wenhong Z, Yuhong D, Yongli W, Qiang W, Ding Z. 2007. Separation and identification of steroidal compounds with cytotoxic activity against human gastric cancer cell lines in vitro from the rhizomes of Paris polyphylla var. chinensis. Chem Nat Compd 43: 672-677.

Zhang SQ, Zhang JS, Wang CZ. 2007. Extraction of steroid saponins from Paris polyphylla Sm. var. yunnanensis using novel ultrahigh pressure extraction technology. Pharm Chem J 41: 424-429.

Zhao J, Mou Y, Shan T, Li Y, Zhou L, Wang M, Wang J. 2010.

Antimicrobial metabolites from the endophytic fungus Pichia guilliermondii isolated from Paris polyphylla var. yunnanensis.

Molecules 15: 7961-7970.

Zhao J, Sun W, Shan T, Mou Y, Lou J, Li Y, Wang M, Zhou L. 2012.

Antimicrobial metabolites from the endophytic fungus Gliomastix murorum Ppf8 associated with the medicinal plant Paris polyphylla var. yunnanensis. J Med Plants Res 6: 2100-2104.

Zhao L, Shi Q. 2005. Analysis on the therapeutic effect on colporrhagia due to drug abortion (240 cases) treated by Gongxuening. J Pract Tradit Chin Med 21: 455-456.

Zhou J. 1991. Bioactive glycosides form Chinese medicines. Mem Inst Oswaldo Cruz 86: 231-234.

Zhu L, Tan J, Wang B, Guan L, Liu Y, Zheng C. 2011. In-vitro antitumor activity and antifungal activity of pennogenin steroidal saponins from Paris polyphylla var. yunnanensis. Iran J Pharm Res10: 279-286.

B I O D I V E R S IT A S Volume 16, Number 2, October 2015 Pages: 303-310

ISSN: 1412-033X E-ISSN: 2085-4722 DOI: 10.13057/biodiv/d160227

Growth, development and morphology of gametophytes of golden chicken fern (Cibotium barometz (L.) J. Sm.) in natural media TITIEN NGATINEM PRAPTOSUWIRYO1,♥, DIDIT OKTA PRIBADI1, RUGAYAH2 Center for Plant Conservation-Bogor Botanical Gardens, Indonesian Institute of Sciences. Jl. Ir. H.Juanda No. 13, P.O. Box 309 Bogor 16003, Indonesia.

Tel. +62-251-8322187. Fax. +62-251-8322187. ♥email: tienpferns@yahoo.com Herbarium Bogoriense, Botany Division , Biology Research Center, Indonesian Institute of Sciences, Cibinong Sciences Center, Cibinong, West Java, Indonesia Manuscript received: 28 July 2015. Revision accepted: 26 October 2015.

Abstract. Praptosuwiryo TNg, Pribadi DO, Rugayah. 2015. Growth, development and morphology of gametophytes of golden chicken fern (Cibotium barometz (L.) J. Sm.) in natural media. Biodiversitas 16: 303-310. The golden chicken fern, Cibotium barometz (L.) J. Sm., is an important export commodity for both traditional and modern medicine. To understand the reproductive biology of this species, spore germination, gametophyte development, morphological variation, and sex expression were studied by sowing spores on sterilized natural media consisting of the minced roots of Cyathea contaminans and charcoaled rice husks (1: 1) mix. Spores of C. barometz are trilete, tri-radially symmetrical, non chlorophyllous, and golden-yellow with a perine. Six stages of gametophyte development (rhizoid stage, rhizoid/protochorm stage, filament stage, spatulate stage, young heart stage, mature heart stage) were observed between 24-45 days after sowing. Spore germination of C. barometz is Vittaria-type. Prothallial development of C. barometz is Drynaria-type. Five morphological types of adult gametophyte were recorded: (i) irregular spatulate shape (male), (ii) fan shape (male), (iii) elongated heart-shape (male), (iv) short heart or butterfly shape (female), and (v) normal heart shape (bisexual). The presence of morphological variations is presumed to be related to the population density, which significantly affects the sexual expression of gametophytes. The variation of sex expression in C. barometz also indicates that this species may has a mixed mating systems that resulted in genetic diversity within population and among populations.

Keywords: Cibotium barometz, gametophytes, golden chicken fern, spore germination, prothallial development

INTRODUCTION Cibotium is a genus of 12 species (Hassler and Swale 2002) or 11 species of tropical tree fern (Zhang and Nishida 2013), which is subject to much confusion and revision. Two species of them occur in Indonesia, namely Cibotium barometz (L.) J. Sm and C. arachnoideum (C. CHR.) Holttum (Holttum 1963). The Golden Chicken Fern, C. barometz, is easily recognized because of the gold yellowish-brown, smooth and shining hairs covering its rhizome and basal stipe. The rhizome is usually prostrate or erect and rarely more than 1 m high.

Cibotium barometz differs from C. arachnoideum by a number of diagnostic characters as follows: C. barometz has sori 2-6 or more pairs on each pinnule-lobe of larger fronds, largest pinnules 20-35 mm wide, pinnules on the two sides of a pinna not greatly different in length, hairs on lower surface of costae and costules flaccid and never spreading. In contrast C. arachnoideum always has two pairs of sori on each pinnule-lobe of larger fronds, largest pinnules 15-26 mm wide, pinnules on basiscopic side of lower pinnae much shorter than those on acroscopic side, hairs on lower surface of costae and costules rigid and spreading (Holttum 1963; Praptosuwiryo et al. 2011).

Economically, C. barometz is an important export commodity for both traditional and modern medicine in

China, Japan and France (Zamora and Co 1986; Praptosuwiryo 2003). The golden hairs on its rhizome and stipes have been used as a styptic for treating bleeding wounds (Dan and Nhu 1989). An extract from the rhizome (‘gouji’) is also used as an anti-rheumatic, to stimulate the liver and kidney, to strengthen the spine, as a remedy for prostatic disease, and to treat various other illnesses, including flatulence (Praptosuwiryo 2003; Yao 1996; Ou 1992). Although this species has many uses, it has not yet been cultivated for commercial trade. Therefore this species has been included in Appendix II of the Convention on International Trade in Endangered Species (CITES) since 1976. In order to utilize it, the NDF (Non Detriment Findings) system must be applied to determine the annual quotas. Biological aspects, such as reproductive biology, are some of the most information needed for the NDF. Reproductive biology determines plant adaptation and species evolution (Farrar et al. 2008). Many traits are used to infer the reproductive biology of ferns, such as the mating system; the number of spores in each sporangium; sporogenesis; spore size; the lifespan of the gametophyte generation; gametophyte morphology and development; and reproductive systems (Manton 1950; Masuyama 1979, 1986; Walker 1979; Haufler et al. 1985; Lin et al. 1990; Kawakami et al. 1996; Huang et al. 2006, 2009).

304

B I O D I V E R S IT A S 16 (2): 303-310, October 2015

Studies on the reproductive biology of C. barometz have been reported by some researchers from China. Chen et al. (2007) studied gametophyte development and its diversity in C. barometz from China by culturing spores in Knop's solution and solid medium. Li et al. (2010) reported in vitro culture and plant regeneration of C. barometz using Murashige & Skoog (MS) media. Deng et al. (2007) observed the gametophyte development of C. barometz from China by culturing the spores both in inorganic medium and in soil from the original habitat.

This paper reports the reproductive biology of Cibotium from Sumatra, Indonesia. The aims of this study were: (i) to verify the reproductive characteristics of C. barometz of Sumatra, including spore germination, gametophyte development and morphology; (ii) to study morphological variation and sex expression, and (iii) to show that a sterilized natural media consisting of the minced roots of Cyathea contaminans and charcoaled rice husks (1: 1) mix can be used as an alternative to study the gametophyte development and morphology of tree fern.

MATERIALS AND METHODS Spore collection. Spores of Cibotium barometz were collected from Riau, Sumatra in June 2011. Spore-bearing pinnae of mature sporophylls were cleaned in running water to avoid spore contamination from other species.

Spore-bearing pinnulae were dried and folded in a newspaper and then placed in an envelope (22 x 11 cm2).

The specimens were kept at room temperature in a dry place. A few days later (7-10 days) most of spores had been released from their sporangia and were lying in the envelope. The spores were separated off from the sporangia by tilting the envelope paper and removing them from the envelope to a piece of glassine weighting paper which was folded into a pocket. The spore collections were kept at room temperature until the sowing day (not more than two month).

The spores (10 mg) were sown on a sterilized, mixed natural media of Cyathea contaminans roots and charcoaled rice husks ( 1: 1) mix in a transparent plastic box (7 cm height, 11 cm diam.) with the media layer 2.5-3 cm high. Preparation of the media was as follows: the mix media was boiled in water for 2.5-3 hours for sterilization.

The sterilized media was kept in a sealed transparent plastic box (7 cm height, 11 cm diam.) for 24 hours at room temperature before it was used to sow spores. The plastic boxes were kept in a glasshouse at 25-32.5ยบC with 68-85% relative humidity. Watering was done once every week to maintain the humidity of the media.

Observations. Periodically, spore germination, gametophyte growth and differentiation and sex expression were observed under an Olympus trinocular fitted with Nikon Camera SMZ 10A 1.5X. Every 4-5 days 100-300 selected prothallus or gametophytes were observed. First observations using microscope were carried out 24 days after sowing. Photographs were taken using the microscope combined with a computer monitored camera (Olympus CX 31).

RESULTS AND DISCUSSION Spore germination Spores of C. barometz are perinate, trilete, tri-radially symmetric, non chlorophyllous and golden yellow in colour (Figure 1.A.). After 23 days from sowing, five stages of the gametophyte development were found (Figure 1-2.), viz. rhizoid stage, rhizoid/protochorm stage, filament stage, spatulate stage and young heart stage. The sixth stage of gametophyte development, mature heart stage, was first appeared 45 days after sowing. First germination occurred two weeks after sowing. Deng et al. (2007) also reported that spores of C. barometz of China germinated about 1-2 weeks after being sowed.

The first cell produced on germination of the spores was rhizoid (Figure 1.B.). This is called the rhizoid stage.

The rhizoid cell usually does not contain chloroplasts. It is produced on the upper surface of the basal cell or sometimes at one corner of the basal cell. The second stage of gametophyte development is the rhizoid/protochorm stage in which the spore bears both rhizoid and the first cell of a filament.

The filamentous phase of C. barometz occurred within about 10-15 after sowing and is indicated by formation of a 3-12-celled filament. Every cell of the filament contains chloroplasts. As stated by Nayar and Kaur (1971) spore germination results in a uniseriate, elongated, germ filament composed of barrel-shaped chlorophyllous cells and bearing one or more rhizoids at the basal end.

Spore germination in C. barometz of Sumatra is of the Vittaria-type, producing a slender, uniseriate germ filament four to twelve cells long. The Vittaria-type is apparently common in Cibotium. Chen et al. (2007) reported Vittariatype and Cyathea-type spore germination of this golden chicken fern from China. The spore germination of C. barometz reported by Deng et al. (2007) also belonged to the Vittaria-type, the first division giving rise to the rhizoid initial is perpendicular to the polar axis of the spore and the second division yielding the protonema initial that is perpendicular to the first (Nayar and Kaur 1968) (Figure 1.B-E).

Prothallial development The young prothallus plate of C. barometz was initiated in the terminal cell of the filament in about 14-30 days by perpendicular divisions. It had two phases, namely a spatulate phase which had 10-21 cells and an early heart shape stage which had 13-42 cells (Figure 2). The meristematic cells of the spatulate stage and early heart shape stage are occurred in margin of the distal gametophytes. After repeated divisions these became mature thallus (Figure 3.A, 4.C-H.). Typically, the gametophyte of C. barometz is a heart-shaped monolayer of cells with an apical cell as the meristem. The spores took about 30-40 days after sowing to differentiate into a cordate thallus. Usually, a prothallus plate did not form reproductive organs until 40 days after sowing. The period of prothallial development of C. barometz of Sumatra is not different from that observed by Deng et al. (2007) for C. barometz of China, as its prothallial plates formed in 25 days after being sowed.

PRAPTOSUWIRYO et al. – Gametophytes of Cibotium barometz

305

B

A A

C

D

E Figure 1. A. Spores of Cibotium barometz (SEM photograph). B. Germinated spore, about 5-7 days after showing. C-E. Filamentous phase, 3-10-celled filament, about 10-15 after showing. Bar = 30 µm for A, 60 µm for B and C, 100 µm for D, 40 µm for E

Cibotium barometz is a homosporous fern species, producing only one type of spores with both male and female reproductive organs in the resulting gametophyte.

Nayar and Kaur (1971) showed that the prothallus of homosporous ferns follows a definite pattern of development leading ultimately to the characteristic adult form. This pattern is constant for each species and common to taxa of higher order under normal conditions of growth.

Nayar and Kaur (1971) recognized seven different patterns of prothallial development among homosporous ferns, viz.

Adiantum-type, Aspidium-type, Ceratopteris-type, Drynaria-type, Kaulinia-type, Marattia-type, and Osmunda-type. These types differ in the sequence of cell divisions; in the stages of development and the region at

which a meristem is established; and in the resultant form of the adult thallus. Prothallial development of C. barometz is of the Drynaria-type (Nayar and Khaur (1971): The spores germinate into a germ filament composed of barrelshaped chlorophyllous cells with one or more rhizoids at the base cell; One of the cells at the top margin of the prothallus (the anterior marginal cells) then divides obliquely when it has 5-10, or more cells across its width; This results in an obconical meristematic cells; Division by this type of cell is parallel to each other and perpendicular to the rest of the cells, forming rows. This results in the formation of a notch at the anterior edge of the prothallus, giving it a roughly heart-shaped appearance.

B I O D I V E R S IT A S 16 (2): 303-310, October 2015

306

r

r A

mc pc

mc

pc

C

pc

B

mc

D Figure 2. A-B. Young plate phase (spatulate plate), 27 days; B. Enlargement of A. C-D. Young gametophyte in elongated heart shape, after one month (38 days); D. Enlargement of C. Rhizoid (r), meristematic cells (mc), prothallial cell (pc). Bar = 120 Âľm for B and D

PRAPTOSUWIRYO et al. – Gametophytes of Cibotium barometz

307

ar

ar A

ar

B

s an

ar

C

D

Figure 3. A. Normal heart-shape, adult gametophyte, bisexual (175 days after sowing); B. Archegonium (ar); C. Antheridium (an) releasing spermatozoid (s); D. Young sporophyte growing from gametophyte (178 days after sowing). Bar = 0.7 mm for A and D, 100 µm for C

Morphological diversity of mature gametophytes and sex expression of Cibotium barometz Mature gametophytes first appeared at around 45 days after sowing. They were male gametophytes. Mature gametophytes were indicated by the formation of reproductive organs, viz. male organ or antheridium and female organ or archegonium (Figure 3). Both unisexual and bisexual prothalli produced antheridia earlier than archegonia. The antheridia walls were composed of 5 cells.

Mature archegonia appeared within 150-165 days after sowing.

Within two to six months after sowing spores we found the gametophyte populations in the culture consisting of male, female and hermaphroditic gametophytes. Moreover, five morphological types of adult gametophyte in C. barometz were observed as shown in Figure 4 and Table 1.

These morphological types are clearly correlated with the gametophytes’ sexual expression. Male gametophytes were of three shapes, namely scoop shaped, fan shaped and long heart shaped. On the other hand, female and bisexual gametophytes had only one shape. They were normal heart shaped.

As reported by Chen et al. (2007), normally the mature gametophytes of C. barometz are found to be symmetrically cordate. The presence of morphological variations of the gametophyte in the Sumatran fern of this study is presumed to be related to population density, which significantly affects gametophytes’ sexual expression. As reported by Huang et al. (2004), the gametophyte size of Osmunda cinnamomea (Osmundaceae) is negatively related to the population density. A similar case is observed in Woodwardia radicans (De Soto et al. 2008). Under low density, the gametophytes of W. radicans mature sexually at a relatively large size and turn into females and subsequently into bisexuals. Under crowded conditions, the gametophytes of this species mature sexually at a smaller size and turn into males. How gametophyte population densities effect the shape of gametophyte? Huang et al.

(2004) stated that gametophyte population density is one of the factors affecting sexual expression and growth in gametophyte communities. In overcrowded populations resources are limited by competition, and gametophytes are often asexual or male, and narrow (usually spathulate

B I O D I V E R S IT A S 16 (2): 303-310, October 2015

308

an

an B

A

ar ar

ar an

D

C

ar

an ar

an F

E

ar an em

G

H

Figure 4. Morphological diversity of adult gametophytes of C. barometz. A. Irregular shape (male, type A); B. Fan shape (male, type B); C. Short heart shape or butterfly shape (Female, type C); D. Normal heart shape (bisexual, type D); E. Normal heart shape (bisexual, type D); F. Normal heart shape (bisexual, type D); G. Normal heart shape (bisexual) showing embryo; H. Elongated heart shape (male).

Bar = 0.6 mm for all. an = antheridium. ar: archegonium. em: embryo

PRAPTOSUWIRYO et al. â&#x20AC;&#x201C; Gametophytes of Cibotium barometz

309

Tabel 1. Description of mature gametophyte types in C. barometz Type A B C D

E

Description Irregular scoop shape with filamentous branches: antheridia dispersed everywhere (Figure 4.A).

Fan shape: antheridia dispersed one third from margin of wings area (Figure 4.B).

Short heart shape or butterfly shape: archegonia were formed at thick cushion, on the anterior part of the midrib (Figure 4.C).

Normal heart shape: Archegonia were produced on the anterior part of the midrib as it approaches the meristem; antheridia were produced on the wings and midrib of the ventral side (Figure 4.D. and 4.E-G).

Long heart shape: antheridia dispersed irregularly on the ventral side of wings (Figure 4.H).

shape). Female and hermaphroditic gametophytes, on the other hand, often occur in sparse populations (Klekowski and Lloyd 1968; Cousens and Horner 1970; Lloyd and Gregg 1975; Cousens 1979). The effects of high gametophytes population density were summarized by Smith and Rogan (1970). Crowded conditions may alter the normal sequence of development of fern gametophytes.

Increasing population density leads to an increase in gametophyte length and delay in the transition to two dimensional growths.

The variation of sex expression in C. barometz also indicates that this species may has a mixed mating systems (self-fertilization, intergametophytic selfing and intergametophytic crossing). However, some species of ferns do show mixed mating systems (Soltis and Soltis 1987, 1988), and by now several studies have indicated that mating systems on some species may vary greatly even between different genotypes within species (Peck et al. 1990; Suter et al. 2000; Wubs et al. 2010). The existence of mixed mating systems in this species will result in genetic diversity within population and among populations. As reported by You and Deng (2012), C. barometz in China showed 41.06% of genetic diversity among populations and 58.94% of genetic diversity within populations. Rugayah et al. (2009) also confirms the existence of genetic variation in C. barometz of Sumatra three morphological variants of C. barometz were reported from West Sumatra.

Most studies on gametophyte development and reproductive biology of tree ferns, including C. barometz, are carried out in vitro, using agar media in petri dishes (see Khare and Srivastava 2009; Khare et al. 2005; Chen et al. 2007; Li et al. 2010). Our study, using sterilized natural media, shows that all stages from spore germination to development of gametophyte, and from rhizoid stage to mature prothallial stage, are not significantly different from those obtained in studies using agar media in petridishes in vitro. The results of this study gives proof that a sterilized natural media consisting of minced roots of Cyathea contaminans with charcoaled rice husks (1: 1) mix can be used as an alternative medium for studying the development and morphology of gametophytes of a tree fern. This information is very important for ex situ conservation of ferns In conclusion, six stages of gametophyte development (rhizoid stage, rhizoid/protochorm stage, filament stage, spatulate stage, young heart stage, mature heart stage) were

Average size (mm) 2 x 1.5 2x2 2.5 x 1.5

Sex expression Male Male Female

4x4

Female, bisexual

5x3

Male

observed 24-45 days after sowing. The first cell produced after spore germination was rhizoid. Spore germination of C. barometz is Vittaria-type, producing a slender, uniseriate germ filament, four to twelve cells long.

Prothallial development of C. barometz is Drynaria-type.

The young prothallus plate was initiated in the terminal cell of the filament, approximately 14-30 days after sowing, by perpendicular division. Antheridia and archegonia were first observed at 45 and 150 days after sowing, respectively. Five morphological types of adult gametophyte were recorded: (i) irregular spatulate shape (male), (ii) fan shape (male), (iii) elongated heart-shape (male), (iv) short heart or butterfly shape (female), and (v) normal heart shape (bisexual). The presences of morphological variations on the gametophyte are presumed to be related to the population density, which significantly affects gametophytesâ&#x20AC;&#x2122; sexual expression. Cibotium barometz may has a mixed mating systems (selffertilization, intergametophytic selfing and intergametophytic crossing) that resulted in genetic diversity among population and within population. A sterilized natural media consisting of the minced roots of Cyathea contaminans with charcoaled rice husks (1: 1) mix can be used as an alternative medium for studying the development and morphology of gametophytes of the tree fern. The present study contributes to the understanding of the full life-cycle of C. barometz, providing information for cultivation, management and conservation of the species.

ACKNOWLEDGEMENTS This research was funded by a Grant-in-Aid for Scientific Research from The Ministry of Research and Technology, GoI, 03/SU/SP/Insf-Ristek/III/11, under The Program Insentif Peneliti dan Perekayasa LIPI TA 2011 and Program Kompetitif LIPI TA 2013-2014. We thank to Prof. Dr. I Made Sudiana, Biology Research Center, Indonesian Institute of Sciences, and Prof. Dr. Ryoko Imaichi, Department of Chemical and Biological Sciences, Japan Womenâ&#x20AC;&#x2122;s University, for reading and giving some comments and suggestion to improve this manuscript. We would also like to thank Dr. Graham Eagleton and Lyndle Hardstaff for reading and correcting the English manuscript.

310

B I O D I V E R S IT A S 16 (2): 303-310, October 2015

REFERENCES Chen SM, Deng HP, Liu GH, Han M. 2007. Gametophyte development and its diversity in Cibotium barometz. Xibei Zhiwu Xuebao 27 (3): 460-463.

Cousens MI, Horner Jr HT. 1970. Gametophyte ontogeny and sex expression in Dryopteris ludoviciana. Amer Fern J 60: 13-27.

Cousens MI. 1979. Gametophyte ontogeny, sex expression, and genetic load as measures of population divergence in Blechnum spicant.

Amer J Bot 66 (2): 116-132.

Dan NgV, Nhu DT. 1989. Medicinal Plants in Vietnam. World Health Organizaion, New York.

De Soto L, Quintanilla LG, Mendez M. 2008. Environmental sex determination in ferns: effects of nutrient availability and individual density in Woodwardia radicans. J Ecol 96: 1319-1327.

Deng HP, Liu GH, Wu L, Liao XM, Chen SM, Cui YQ. 2007.

Observation on gametophyte development of Cibotium barometz.

Zhongguo Zhong Yao Za Zhi 32 (18): 1850-1853.

Farrar DR, Dassler C, Watkins JE Jr , Skelton C. 2008. Gametophyte ecology. In: Ranker TA, Haufler CH (eds) Biology and Evolution of Ferns and Lycophytes. Cambridge University Press, Cambridge.

Hassler M, Swale B. 2002. Family Dicksoniaceae genus Cibotium; world species list. http: //homepages.caverock.net.nz/~bj/fern/cibotium.htm [17 May 2008].

Haufler CH, Windham MD, Britton MD, Robinson SJ. 1985. Triploidy and its evolutionary significance in Cystopteris protrusa. Can J Bot 63: 1855-1863.

Holttum RE. 1963. Cyatheaceae. In: Steenis CGGJ van (ed) Flora Malesiana Ser. II. Vol. 1 (2). Noordhoff-Kolff, Leiden.

Huang YM, Chou HM, Chiou WL. 2004. Density affects gametophyte growth and sexual expression of Osmunda cinnamomea (Osmundaceae: Pteridophyta). Annals Bot 94: 229-232.

Huang YM, Chou HM, Hsieh TH, Wang JC, Chiou WL. 2006. Cryptic characteristics distinguish diploid and triploid varieties of Pteris fauriei (Pteridaceae). Can J Bot 84: 261-268.

Huang YM, Hsu SY, Huang MH, Chiou WL. 2009. Reproductive biology of three cheilanthoid ferns in China. J Plant Repro Biol 1 (2): 109116.

Kawakami SM, Ito M, Kawakami S. 1996. Induced apogamous sporophytes in Pteris dispar and P. semipinnata, and meitototic behavior in their sporophytes. J Plant Res 109: 369-373.

Khare BK, Behera SK, Srivastava R, Shukla SP. 2005. Studies on reproductive biology of a threatened tree fern, Cyathea spinulosa Wall. Ex Hook. Curr Sci 89 (1): 173-177.

Khare BP, Srivastava R. 2009. Studies of the gametophyte development and rproductive biology of an endemic tree fern Cyathea nigrescens Holttum. J Plant Repro Bio 1 (1): 59-62.

Klekowski Jr EJ, Lloyd RM. 1968. Reproductive biology of the Pteridophyta. I. General considerations and a study of Onoclea sensibilis L. Bot J Linn Soc 60: 315-324.

Li X,Ye Q-M, Zhan QC, Kang B-L, Jian L-G, Huang M-L. 2010. In vitro culture and plant regeneration of Cibotium barometz (L.) J.Sm. Northern Hort 2010 (6): 152-155.

Lin SJ, Kato M, Iwatsuki K. 1990. Sporogenesis, reproductive mode, and cytotaxonomy of some species of Sphenomeris, Lindsaea, and Tapeinidium (Lindsaeaceae). Amer Fern J 80: 97-109.

Lloyd RM, Gregg TL. 1975. Reproductive biology and gametophyte morphology of Acrostichum danaeifolium from Mexico. Amer Fern J 65: 105-120.

Manton I. 1950. Problems of Cytology and Evolution in the Pteridophyta.

Cambridge Univiversity Press, Cambridge.

Masuyama S. 1979. Reproductive biology of the fern Phegopteris decursive-pinnata. I. The dissimilar mating systems of diploids and tetraploids. Bot Mag Tokyo 92: 275-289.

Masuyama S. 1986. Reproductive biology of the fern Phegopteris decursive-pinnata. II. Genetic analysis of self-sterility in diploids. Bot Mag Tokyo 99: 107-121.

Nayar BK, Kaur S. 1968. Spore germination in homosporous ferns. J Palynol 4: 1-14.

Nayar BK, Kaur S. 1971. Gametophytes of homosporous ferns. Bot Rev 37: 295-396.

Ou M. (chief ed). 1992. Chinese-English Manual of Common-used Traditional Chinese Medicine. Guangdong Science and Technology Press, Guangzhou.

Peck JH, Peck CJ, Farrar DR. 1990. Influences of life history attributes on formation of local and distant fern populations. Amer Fern J 80: 126142.

Praptosuwiryo TNg, Pribadi DO, Puspitaningtyas DM, Hartini S. 2011.

Inventorying of the tree fern genus Cibotium of Sumatra: Ecology, population size and distribution in North Sumatra. Biodiversitas 12 (4): 204-211.

Praptosuwiryo TNg. 2003. Cibotium barometz. (L.) J. Smith. In: de Winter W.P, Amoroso VB. (eds.) Plant Resources of South-East Asia 15 (2) Cryptogams: Ferns and Ferns Allies. Prosea, Bogor.

Rugayah, Praptosuwiryo TNg, Puspitaningtyas DM. 2009. Morphological variation of Cibotium barometz from West Sumatra. Proceedings on the International Conference on Biological Science. Faculty of Biology, Universitas Gadjah Mada, Yogyakarta-Indonesia, 16-17 October 2009.

Smith DL, Rogan PG. 1970. The effects of population density on gametophyte morphogenesis in Polypodium vulgare L. New Phytol 69: 1039-1051.

Soltis DE, Soltis PS. 1987. Breeding system of the fern Dryopteris expansa: evidence for mixed mating. Amer J Bot 74: 504-509.

Soltis PS, Soltis DE. 1988. Genetic variation and population structure in the fern Blechnum spicant (Blechnaceae) from western North America. Amer J Bot 75: 37-44.

Suter M, Schneller JJ, Vogel JC. 2000. Investigations into the genetic variation, population structure, and breeding systems of the fern Asplenium trichomanes subsp. quadrivalens. Int J Plant Sci 161: 233244.

Walker TG. 1979. The cytogenetics of ferns. In: Dyer AF (ed) The Experimental Biology of Ferns. Academic Press, London.

Wubs ERJ, De Groot GA, During HJ, Vogel JC, Grundmann M, Bremer P, Schneider H. 2010. Mixed mating system in the fern Asplenium scolopendrium: implications for colonization potential. Ann Bot 106: 583-590.

Yao DM (chief ed). 1996. Pharmacopoeia Commission of the Ministry of Public Health, P.R. China, A Coloured Atlas of the Chinese Materia Medica Specified in Pharmacopoeia of the Peopleâ&#x20AC;&#x2122;s Republic of China (1995 ed). Guangdong Sciences and Technology Press, Guangzhou.

You YF, Deng HP. 2012. Analysis of genetic diversity of the rare and endangered species Cibotium barometz by SRAP markers. Acta Botanica Boreali-Occidentalia Sinica 32 (4): 688-692.

Zamora PM, Co L. 1986. Guide to Philippines flora and fauna. Vol. II. National Resources Management Centre, Ministry of Natural Resources and University of the Philippines, Manila.

Zhang XC, Nishida H. 2013. Cibotiaceae. In: Wu ZY, Raven PH, Hong DY (eds) Flora of China. Vol. 2-3 (Pteridophytes). Science Press, Beijing.

B I O D I V E R S IT A S Volume 16, Number 2, October 2015 Pages: 311-319

ISSN: 1412-033X E-ISSN: 2085-4722 DOI: 10.13057/biodiv/d160228

Spatial point pattern analysis of the Sumatran tiger (Panthera tigris sumatrae) poaching cases in and around Kerinci Seblat National Park, Sumatra FARID RIFAIE1,ď&#x201A;Š, JITO SUGARDJITO2, YULI SULISTYA FITRIANA1 1

Research Center for Biology, Indonesian Institute of Sciences, Cibinong Bogor 16911, West Java, Indonesia. Tel.: +62-21-8765056, Fax.: +62-218765068,ď&#x201A;Šemail: farid.rifaie@lipi.go.id.

2 Centre for Sustainable Energy and Resources Management, UniversitasNasional, Jl. Sawo Manila, PasarMinggu, Jakarta 12520, Indonesia.

Manuscript received: 26 August 2015. Revision accepted: 28 October2015.

Abstract.Rifaie F, Sugardjito J, Fitriana YS. 2015.Spatial point pattern analysis of the Sumatran tiger (Panthera tigris sumatrae) poaching cases in and around Kerinci Seblat National Park, Sumatra. Biodiversitas 16: 311-319.Wild Sumatran tigers are in a critical state with around 250 adult tigers remain in their habitat in Sumatra Island. Despite the fact that this subspecies is an elusive animal with very wide home range, Sumatran tigers are facing two serious threats, the depletion of its habitats and preys in one side and the increase of tiger hunt for illegal wildlife market. Improving the capacity and effectiveness of law enforcement in reducing poaching of tigers is an immediate priority protecting the remaining wild populations in their habitat. Enforcement monitoring was established under the Tiger conservation program. During their patrols, the anti-poaching team recorded various data including poaching incidents. We analyzed secondary data of Sumatran tiger poaching cases around Kerinci Seblat National Park that have been documented from 2000 to 2012. Georeferencing process was performed to transform locality data of 87 poaching cases into geographic position. The Nearest Neighbor (NN) analysis suggested a strong clustering pattern with the observed mean distance was 4.9 km, much lower than the expected mean distance (10.9 km).Similarly, The Ripley's K analysis also showed the aggregation of the points along the observed distances. On the other hand, about 35.6% of points were located outside the standard deviational ellipse. The pattern indicated that poaching incidents were spread in all corner of the region but excessive cases were observed in the center of the park.

Keywords: Kerinci Seblat National Park, Panthera tigris sumatrae, poaching, spatial statistic, Sumatran tiger

INTRODUCTION Sumatran tiger (Panthera tigris sumatrae) is the only tiger subspecies that live outside the continent (Tilson et al.

1994), following the extinction of the Bali tiger (P. t. balica) in 1940s and the Javan tiger (P. t. sondaica) in 1980s (Seidensticker et al. 1999). Similar to its relatives in the mainland, this subspecies existence is threatened and the International Union for Conservation of Nature (IUCN) has categorized it as critically endangered (Tilson et al.

1994). Indonesian government has passed Law No.5/1990, Government Regulation No.7/1999 and Government Regulation No.8/1999 which stipulated that Sumatran tiger is a protected animal. Although its presence is still observed across the Sumatra Island (Wibisono and Pusparini 2010), but the exact population has never been revealed since it is almost impossible to census this solitary, cryptic animal. The latest assessment estimated that at least there are 250 adult tigers inhabit Sumatra Island (Wibisono and Pusparini 2010).

The fundamental impediment for Sumatran tiger survey is the secretive nature of this animal combines with the low density and very large home range (Wibisono et al. 2011).

This makes the detection of its presence a very difficult task. The tiger existence was mostly exposed by their scats, tracts, urine smell and growl (Tilson and Nyhus 2010).

Sumatran tiger population assessments have been

conducted by mean of questionnaire surveys (Wibisono et al. 2011), occupancy surveys and camera trap surveys (Linkie et al. 2010).

Twelve Tiger Conservation Landscapes (TCL) have been recognized across Sumatra Island to determine habitats that support tiger populations (Wikramanayake et al. 1999; Sanderson et al. 2010; Seidensticker 2010).

However, there are only two landscapes (Kerinci Seblat and Bukit Tigapuluh) that are included in global priority TCL, while three other landscapes, i.e. Leuser, Sibolga and Berbak, are categorized to class IV TCL (insufficient information) due to lack of data (Sanderson et al. 2010).

Furthermore, Wibisono and Pusparini (2010) evaluated 33 forest patches in Sumatra to understand their distribution and revealed that tigers present in 27 forest patches. Those patches are mainly located in the western parts of the island that have mountainous terrain. Only several patches are expanding eastward, reach the east coast of Sumatra Island in Riau and Jambi Provinces. These forests are covering area of 140,226 km2, where only 29% are protected (Wibisono and Pusparini 2010).

Despite their elusive behavior, Sumatran tigers are facing two serious threats, the depletion of its habitats and preys in one side and the increase of tiger hunt due to body parts trade or retaliation of predation cases (Nyhus and Tilson 2004; Nugraha and Sugardjito 2009; Wibisono et al.

2009). The habitat loss and fragmentation in Sumatra

312

B I O D I V E R S IT A S 16 (2): 301-319, October 2015

Island have reached an alarming rate, varied between 0.8% and 9.8% per year (Wibisono et al. 2011). Oâ&#x20AC;&#x2122;Brien et al.

(2003) found numerous types of poaching signs in Bukit Barisan Selatan National Park (BBSNP), such as snares, cartridges, discarded batteries, gunshots, bush meat and wildlife parts market. One hundred and seventy two snare traps that were mainly targeted for muntjac, mouse deer, sambar and serow, were also spotted in Kerinci Seblat National Park (KSNP) (Linkie et al. 2003).

This top predator actually has no natural enemy, only human beings that disproportionately hunt and kill them to sell their body parts or to take revenge. The pressure of their habitats creates conflicts between human and tigers across the island. Between 1978 and 1997, the conflicts caused 146 people died, 30 people injured and more than 870 cattle became prey (Nyhus and Tilson 2004).During these 20 years period, 265 tigers were killed and 97 others were captured as a result of the retaliation (Nyhus and Tilson 2004). Additionally, 16 others became victims of retaliation between 2000 and 2004 in which later investigations revealed the involvement of professional hunters/poachers on some cases (Nugraha and Sugardjito 2009). This big cat is also hunted due to their body parts value (Plowden and Bowles 1997) and a police officer was involved in an organized poacher (Tilson and Nyhus 2010).

More importantly, these poaching activities took place inside national park and almost no law enforcement for the offenders (Linkie et al. 2003; Oâ&#x20AC;&#x2122;Brien et al. 2003; Tilson and Nyhus 2010).

This illicit act has long been recognized as the most imminent threat for tiger survival and appropriate measures could halt the declining trend of tiger populations (Galster and Elliot 2000; Damania et al. 2003; Gopal et al. 2010).In Sumatra, anti-poaching unit has been established in KSNP since 2000 (Hartana and Martyr 2001; Linkie et al. 2003), named the Tiger Protection and Conservation Unit (TPCU).

The main objective of this unit is to assist the national park management to detect, prevent and deter tiger poaching activities in and around KSNP (Hartana and Martyr 2001).

This unit also records tiger signs, arrests illegal loggers and wildlife poachers, confiscates chainsaws and dismantles wildlife traps (Linkie et al. 2003).

Most studies about tiger poaching investigated the relation of this illicit activity with tiger population or its survival. There has not been any research about the tiger poaching incidents related to their spatial context. The location where poaching cases occur can be plotted into map.

The arrangement of the points can be studied spatially. One method for the study of spatial configuration of observed events within a two-dimensional space is point pattern analysis (Gatrell et al. 1996; Loosmore and Ford 2006).

This analysis has been widely utilized for epidemiology studies (Gatrell et al. 1996; Siqueira et al. 2004; Ngowi et al. 2010; Liebman et al. 2012; Simarro et al. 2012). This technique was successfully applied to understand clumping pattern of morbidity and mortality, spatial and temporal dynamic and modeling the raised incidence of diseases (Gatrell et al. 1996). This method is also popular in studies of spatial patterns of plant communities (Haase 1995; Loosmore and Ford 2006; Perry et al. 2002, 2006).

Applications range from seed dispersal (Seidler and Plotkin 2006), plants coexistence (Liu et al. 2014), plants competition (Gray and He 2009) and plant disease (Dallot et al. 2003). Even though almost all animals are nonsedentary, but this analysis has been used to study the occurrences, lethal incidences and stationary constructions such as ant hills or birds' nests (Ramp et al. 2005; Hengl et al. 2009; CogÄ&#x192;lniceanu et al. 2013; Iosif et al. 2013). Other disciplines that harness benefits from this method include soil science (Huo et al. 2012), volcanology (Bishop 2007) and urban studies (Zhang et al. 2014).

With the increasing awareness of importance of spatial pattern in biology, a variety of statistical tests have emerged (Haase 1995, Perry et al. 2006). Researchers with limited experience must carefully explore suitable approaches base on the characteristic of their data and the relevant questions regarding the spatial information (Perry et al. 2002, 2006). Consequently, it is a good practice employing different techniques so that they will complement each other and avoid partial conclusion about the spatial data (Perry et al. 2002, 2006). Edge effects are other pitfalls in spatial statistic and needs some form of correction. The cause of the edge effect is the assumption of an unbounded area for spatial point distributions, but observed distributions are calculated from a defined region (Dixon 2002a; Wiegand and Moloney 2004; Perry et al.

2006). Edge effects should not be neglected because can lead to overestimation and alter the conclusion (Dixon 2002a). The addition of a buffer zone around the plot is a popular method to account for edge effects (Dixon 2002a; Haase 1995).

This paper aimed to investigate the tiger poaching pattern by analyzing the spatial point pattern of the tiger poaching incidents in KSNP and surrounded area. The main objective of this study was to evaluate the capability of spatial analysis in exploring the pattern of tiger poaching cases.

MATERIALS AND METHODS Tiger poaching data The tiger poaching data were obtained from the Fauna & Flora International (FFI), a non-governmental organization focus on biodiversity conservation across the globe. They compiled tiger poaching incidents in and around KSNP reported monthly by the field manager of TPCU to the head of KSNP. The data was stored in a spreadsheet file format and contains date of the incident, location, poaching methods, detail of the case and enforcement actions. There were 87 incidents recorded between October 2000 and September 2012. The record only reported the administrative locations of the incidents.

Twenty-six cases revealed the locations up to village level, 59 records only reported the sub district and two others only mentioned the name of the district.

Georeferencing spatial data The process of transforming text base locality information into geographic coordinates is called

RIFAIE et al. – Spatial pattern analysis of Sumatran Tiger poaching

georeferencing (Garcia-Milagros and Funk 2010).

Common sources of reference of geographic coordinates for georeferencing process include gazetteers and maps.

However, assigning a single point to a locality is commonly neglecting the quality of the representation of a point over actual locality (Wieczorek et al. 2004).

Wieczorek et al. (2004) proposed point radius method to calculate the potential errors or uncertainties adhered to descriptive localities.

Georeferencing locality data is time consuming particularly on the error checking and correcting processes.

Numerous tools have been developed to make this process become less tedious. Garcia-Milagros and Funk (2010) proposed the use of Google Earth© to georeference biological specimen locality data. Google Earth displays high-resolution satellite imagery with WGS84 datum as the coordinate system and NASA Shuttle Radar Topography Mission (SRTM) data as Digital Elevation Model (DEM).

The advantage of utilizing this application is that the interface allows overlying maps, drawing paths, adding information marks, measuring distances, checking the elevation of a point and moving a point to another position (Garcia-Milagros and Funk 2010).

In order to determine the position of a poaching incident and calculate the uncertainty, administrative map of the study area was first uploaded into Google Earth. The administrative map was only up to sub-district level because the lack of reliable village map. The determination of the position of a poaching incident was done by following steps. Firstly, the point was placed in the middle of an administrative region if the locality was a sub district or district. Next, the case were located near or on the point of a village indicated by Google Earth when the locality indicates the name of a village. Lastly, the position of the poaching was placed in a forested area when the data specifies the habitat is the national park or the tiger conservation landscape.

The uncertainty calculation on the Google Earth application was adapting Garcia-Milagros and Funk (2010) based on steps described by Wieczorek et al. (2004). The points was then exported into shapefile format and processed into open source GIS software, QGIS (QGIS Development Team 2014).

Spatial point pattern analysis Every point process has a basic property called intensity (λ(s)). It can be described as the expected number of events per unit area at the point s (Perry et al. 2006; Stoyan and Penttinen 2000).The simplest spatial process is complete spatial randomness (CSR), named the homogeneous Poisson Process with intensity λ. CSR is commonly used as null model, and a disproving event would exhibit either (i) clustering (aggregation in the bivariate case), or (ii) regularity (segregation) (Wiegand and Moloney 2004; Perry et al. 2006).

The behavior of a general spatial stochastic process can be characterized in terms of its first-order and second-order properties (Gatrell et al. 1996; Wiegand and Moloney 2004; Perry et al. 2006). First-order properties are described in term of intensity of a point pattern, in which

313

intensity is defined as the mean value of the distribution at locations throughout the region of interest (Gatrell et al.

1996; Zhang et al. 2014). On the other hand, second-order properties of a spatial point process define the small-scale spatial correlation structure of the point pattern and they are based on the distribution of distances of all pairs of points (Gatrell et al. 1996; Wiegand and Moloney 2004; Perry et al. 2006; Zhang et al. 2014).

Numerous spatial statistic methods have been developed to study the point pattern characteristic. Perry et al. (2006) compared six types of univariate analyses in order to provide a guidance concerning the appropriate selection and use of each method. Each analysis has its own strengths and weaknesses, and the application of these tests should complement each other (Perry et al. 2006).

They also added that the tests generally could be divided into first-order and refined for those derived from Nearest Neighbor (NN) and second-order summary statistics.

NN test is a simple first-order analysis that determined the intensity based on distances between two closest points (Stoyan and Penttinen 2000; Perry et al. 2006). This test represents a logical first step in analysis and useful for analyzing spatial point patterns (Perry et al. 2006).

However, this method has limitation to the scale in which events beyond nearest neighbors are ignored (Stoyan and Penttinen 2000). Nearest neighbor index (r) can be explained with the following formula: [1] Where is the observed mean distance to nearest neighbor and is the expected mean distance to nearest neighbor for a random distribution. Furthermore, the observed and expected mean nearest distances can be explained as follow: [2]; [3] Where, is total distance to nearest neighbor, n is the number of points and A is the size of the area. Finally, the Z score of the observed mean distance to nearest neighbor is: [4] where SE is the standard deviation. The index will show a statistically significant at level 5% when the Z score is less than -1.96 or bigger than 1.96.

On the contrary, Ripley's K function is one of most commonly use second-order statistic which able to detect mixed pattern due to difference of the distance scale. This test considers all inter-point distances and produces more information on the scale of the pattern (Wiegand and Moloney 2004). The K function represents the expected number of points within radius r from a randomly chosen point (Dixon 2002b; Zhang et al. 2014), and is defined as:

314

B I O D I V E R S IT A S 16 (2): 301-319, October 2015

[5] Where, λ is the density (number per unit area) of points, and E is the expected other points within distance r of a randomly chosen event. The expected other points within distance r from a randomly chosen point in a process with no spatial dependency is also expressed as λπr2, K(r) for a homogeneous Poisson process can be defined as: [6] In addition, the empirical function is a ratio of numeration and the density of events, λ. The density of events is the ratio between the number of events and the size of the area. The estimation of numerator should consider the edge effects. These effects appear when the numerator does not consider points outside the boundary.

One of commonly used estimator that count in the edge correction (Haase 1995; Dixon 2002b; Zhang et al. 2014) is: [7] This study examined the applicability of these two spatial statistic tests for tiger poaching incidents. QGIS and R spatstat (Baddeley and Turner 2005; R Development Core Team 2012), were used to perform these analyses.

Most freeware are modular where new additional packages can be attached to the main program as a library, add on or plug-in. Two different free programs can also be combined performing a series of operations as has been demonstrated

A

by Hengl et al. (2010). Unlike their work, which optimized a scripting language, this study used a combination between QGIS as the main software and R packages as plug-ins so that all the work can be done in a graphical user interface (GUI) environment.

RESULTS AND DISCUSSION There have been 87 poaching cases recorded by the TPCU between 2000 and 2012. Most cases were dominated by snare traps (72 cases) in which 166 tiger snares were found and destroyed. This record revealed that there were 33 tiger casualties because of poaching activities. While most of the active traps were found and destroyed by the team, around thirteen traps took victims. In addition, one tiger were poisoned in 2000 and three other were shot in 2010 and 2012. On the contrary, body parts (smoked flesh, skeleton, pelts or skins) from 16 tigers were discovered during investigations, either on poaching sites or in poachers stash houses, without exact information about how the tigers were killed. However, when the TPCU found the tiger body part from a poacher, their investigation revealed where the location of the poaching was. For example, on January 2005 the team observed tiger skins and skeleton from poachers in Batang Merangin, Kerinci. Nevertheless, the TPCU team revealed that the poaching took place in Gunung Raya, Kerinci.

Unfortunately, most of the identified poachers could not be arrested. Table 1 shows the summary of poaching cases reported by the TPCU team.

B

Figure 1. A. Case number one (October 2000) was placed on the Renah Kayu Embun Village indicated by Google Earth with uncertainty of 5 km. B. The record only indicates that case number 72 (January 2010) occurred in Malin Deman Sub district and the habitat is the national park. It was then placed in the forested area of this sub district and shows uncertainty of 9.2 km. The bright lines are sub district’s boundaries.

RIFAIE et al. â&#x20AC;&#x201C; Spatial pattern analysis of Sumatran Tiger poaching

315

Figure 2.The distribution map of tiger poaching incidents between 2000 and 2012 in Kerinci Seblat National Park and surrounding area.

The coordinate reference system (CRS) of the map is WGS 84/UTM zone 47S.

Table 1. Tiger poaching incidents recorded by the TPCU between 2000 and 2012 and compiled by TRAFFIC. Year 2000 2001 2002 2003 2004 2005 2006 2007 2008 2009 2010 2011 2012 Total

Poaching cases 1 12 3 8 8 8 9 5 4 12 9 5 3 87

Snares found 0 27 0 4 21 21 31 6 7 18 11 12 8 166

Tiger poisoned 1 0 0 0 0 0 0 0 0 0 0 0 0 1

Tigers shot 0 0 0 0 0 0 0 0 0 0 1 0 2 3

Tigers killed 1 6 4 6 1 3 0 0 0 2 2 6 2 33

The georeferencing of all 87 poaching locations were successfully done by using the Google Earth. Almost all locality names listed in the report were easily found and plotted; only several locations could not be determined promptly. For example, the report mentioned several incidents were occurred in Lempur area, Gunung Raya Sub District, Kerinci. However, there are four localities started with Lempur found from Google Earth website, i.e.

Lempur Danau, Lempur Tengah, Lempur Hilir and Lempur Mudik. Since these villages were closely located, the points were located in the middle of these villages. The inclusion of a more specific locality detail was another example that made Google Earth could not identify the exact position.

One case was reported to take place in an area that belongs to a government institution property in Curup, Bengkulu.

Two other incidents happened in a concession forest belong

316

B I O D I V E R S IT A S 16 (2): 301-319, October 2015

Figure 3. The mean center and standard deviational ellipse of the tiger poaching cases showing that the poaching incidents were occurred along the national park, and there were many outliers especially in the southeast and northwest of the ellipse. This forest cover map in 2011 was obtained from the Ministry of Forestry GIS website (http://appgis.dephut.go.id/appgis/download.aspx).

to a private company. When a locality was unsuccessfully determined based on the most specific location, it would be plotted based on the higher administrative region. The uncertainty of points determination were varied between 5 and 20 km and mostly caused by the extent of administrative boundaries. Uncertainty in mapping is something that cannot be avoid due to the complexity of the nature and measurement methods and should be taken into account (Rocchini et al. 2011). Figure 1 illustrates two examples of points determination and uncertainty calculation.

Garcia-Milagros and Funk (2010) demonstrated the use of expedition map to decrease the uncertainty from 7.5 km to only 0.85 km. unfortunately, such data could not be obtained because of concerns that tiger occurrence will be exposed to hunter syndicates. Other spatial data that could decrease the uncertainty are village maps. However, accurate village maps have not been readily available in Indonesia. The uncertainties may seem showing low

accuracy of point mapping, but these values indicate overestimation (Wieczorek et al. 2004). Moreover, the uncertainties are relatively small figures when it is compared to the study area which extent about 39.000 km2.

It is more likely that the statistical analysis would not change significantly when more precise positions can be identified. Figure 2 shows the distribution of the points where tiger poaching incidents in KSNP area occurred.

The tiger poaching incidents took place in 9 out of 13 districts that surround KSNP. The districts where incidents were found were distributed in three provinces of West Sumatra, Jambi and Bengkulu. The mean center of the 87 points were located at 101° 43' 21.62"E and 2° 24' 16.45" S, with the standard distance of 71.7 km. This center point is located in Jangkat, Merangin, Jambi only about 55 km South East of Sungai Penuh where the national park office is situated. Standard deviational ellipse (SDE) calculated from the poaching incidents indicates the main orientation

RIFAIE et al. â&#x20AC;&#x201C; Spatial pattern analysis of Sumatran Tiger poaching

Figure 4.Plot of versus distance up to 50 km for all poaching locations. The difference between values and K(r) rise as the distance increases.

Table 2. The cumulative poaching cases recorded in each districts District

Total incidents

Bengkulu Utara Bungo Kerinci Lebong Merangin Mukomuko Pesisir Selatan Rejanglebong Solok Selatan

5 5 28 6 20 11 5 6 1

of the poaching distribution (Gong 2002). The bearing of the major axis of this ellipse was 147° South East with the length of 184.3 km. There were 56 points or only 64.4% of total points that were situated inside the SDE area. Most of outliers (16 points) were located in Bengkulu Province (see Figure 3).

The NN test applied to this data showed that the distribution of tiger poaching incidents had the NN index of 0.451973869542. The observed mean distance was 4,967.646 m, while the expected mean distance was 10,991.003 m, with the Z-score -9.77893987179 far less than the critical value of -1.96. This suggested that the cases distribution were significantly clustered. The second order test, Ripley's K, verified this clustering pattern.

Figure 4shows that the empirical K function (solid line) was constantly higher than the expected value representing a homogenous Poisson process (dashed blue line). It can be viewed that the K value soared significantly from the finest scale (0-20 km). The slope was then noticeably ascending as the distance rose. This rise can be observed at the medium scale (about 25 km) and at the longer scale (35 km).

317

The spatial statistic analysis of secondary data of Sumatran tiger poaching incidents in and around KSNP area showed the extent and pattern of the tiger poaching.

This vast extent of areas where this illicit activity took place can be seen from the outlier points and administrative distribution. The furthest outlier point in Air Duku, Rejang Lebong District was 62 km away from the SDE boundary.

The outliers were not only scattered in both ends of the SDE but also in northwest and northeast of the standard deviational area. The hunt for tigers by poachers were stretched from Sangir Sub district, Solok Selatan, West Sumatra in the north to Air Duku, Bengkulu in the south, and Muara Sako Village, Pancung Soal, Pesisir Selatan in the west to Tabir Hulu, Merangin, Jambi in the east. This vast extent of outliers illustrated how pervasive the threat of Sumatran tiger in this region.

On the other hand, both NN and Ripley's K tests that represent first and second-order spatial statistic analyses indicated that the poaching incidents were significantly clustered. There were three reasons why this pattern was appeared in this region. First, the georeferencing procedure was merely based on the administration data. This made some data were georeferencing in the same or very close position. The clustering points were visibly apparent in some districts with several incidents found. Secondly, the limited resources forced the TPCU to manage their patrol carefully (Linkie et al. 2003). The TPCU teams put more focus on areas that have been recognized as the prime tiger habitat and area with imminent threat of illegal logging and encroachment (Fauna & Flora International 2008). Several sub-districts, Gunung Raya and Jangkat sub-districts in Jambi for instance, were areas where TPCU teams seized more poaching activities than any other regions. Finally, the conspicuous clustering point pattern in this area was as a result of the poachers activities pattern. They commonly set tiger traps on the animal trails and on certain time when they think the anti-poaching team did not guard the park intensively (Fauna & Flora International 2008). On August 2004, TPCU team recorded two snares have been replaced by poachers in Tapus, Lebong, Bengkulu. One of previously found snares (July 2004) in the same area took one tiger life. Moreover, the aggregation of the poaching cases was also clearly observed from the districts level.

Table 2 shows the accumulation of the recorded poaching in each district during this 12 years period. This table shows that there were three districts, which had high poaching incidents. There were 28, 20 and 11 cases recorded in Kerinci, Merangin and Mukomuko districts respectively. These administrative regions are located in the center of this national park. In contrast, administrative regions that are located in the fringe of the protected park such as Solok Selatan, Pesisir Selatan, Bungo and Bengkulu Utara had very low poaching cases.

As can be seen, statistical analysis performed in this paper suggested that rampant poaching activities occurred in the heart of this national park. Even though the antipoaching team has been established since 2000 and actively patrolling the park, this has not been stopping poachers hunting Sumatran tigers. Strengthening the TPCU is an urgent measure. Two simple mechanisms of the TPCU

318

B I O D I V E R S IT A S 16 (2): 301-319, October 2015

enhancement are adding more personnel and increasing the frequency of patrols. The addition of patrolling team members will expand the area covered with regular patrol.

Correspondingly, the intensification of patrols will reduce the possibility of tigers being trapped, poisoned or shot.

However, it is more critical improving the law enforcement for any illegal act toward wildlife in Indonesia. Very weak law enforcement and government commitment to conservation made Indonesia fell far behind than other developing countries in term of protecting wildlife (Meijaard 2014).

This study has shown the applicability of two spatial point pattern analyses for Sumatran tiger poaching pattern study. Both first-order (NN) and second-order (Ripley's K) tests were chosen among other spatial statistics based on their simplicity and popularity to use (Perry et al. 2006).

Perry et al. (2006) elaborated the strengths and weaknesses of both techniques. The employment of different tests in a study is not only to combine various results but also to avoid false deduction due to the weakness of a method (Perry et al. 2002, 2006). These two purposes of applying different tests have been reflected by the congenial results from the two statistics.

As shown above, spatial statistics are robust tools for animal ecology study especially in Indonesia. Nevertheless, the collection of point position is the first major problem that scientists must deal with (Stoyan and Penttinen 2000).

Enormous species occurrences which can be gathered from museum collections, published data or field records (Cogălniceanu et al. 2013) have assorted level of locality precision. Even with most recent locality data acquired with GPS devices, certain amount of uncertainty occurred because of GPS inaccuracy, unknown datum and coordinate imprecision (Wieczorek et al. 2004). This most likely happened when biologists with limited GPS knowledge copy coordinates data manually, ignoring the datum information.

Correspondingly, the exploration of statistical tests to answer different questions will advance the adoption of this method in Indonesia. New approaches have also gained significant consideration to link the spatial structure to process (Perry et al. 2006).Perry et al. (2006) suggested that we should use a priori hypotheses and generate testable hypotheses as an outcome of the spatial analyses. More importantly, a good multidisciplinary teamwork between ecologists and spatial statisticians must be established to attain the goals (Stoyan and Penttinen 2000).

Two spatial point pattern analyses performed in this paper showed a significant clustered pattern of Sumatran tiger poaching. Although the points were generated from georeferencing process and have some degree of uncertainty, they represent the position of the poaching incidents quite well. The aggregation of the tiger poaching demonstrates the enormous pressure to this subspecies especially in the central parts of the park. On the contrary, the extent of the points suggests that poachers were lurking for any opportunity to catch and kill this majestic animal.

While the subject of this study is the poaching activity of an endangered species, the occurrence of a species itself should become the target of investigations in the future. It

would be very valuable to perform point pattern analysis of Sumatran tiger presence based on their scats, scratch marks, tracks and other signs. In addition, species occurrence records from museum collections provide immense opportunity to be explored. Finally, the point pattern analysis is multivariate in nature, therefore bivariate and multivariate analyses are potential approaches to study inter-species coexistence or competition.

ACKNOWLEDGMENTS The authors thank Deborah J. Martyr (FFI) for the Sumatran tiger poaching cases data around Kerinci Seblat National Park. We also thank Dr. Gono Semiadi for helpful comments on the manuscript. Two anonymous referees greatly improved the paper by their constructive comments.

REFERENCES Baddeley A, Turner R. 2005. Spatstat: an R package for analyzing spatial point patterns. J Stat Softw 12: 1-42.

Bishop MA. 2007. Point pattern analysis of eruption points for the Mount Gambier volcanic sub-province: a quantitative geographical approach to the understanding of volcano distribution. Area 39: 230-241.

Cogălniceanu D, Székely P, Samoilă C, Ruben I, Tudor M, Plăiaşu R, Stănescu F, Rozylowicz L. 2013. Diversity and distribution of amphibians in Romania.ZooKeys296: 35-57.

Dallot S, Gottwald T, Labonne G, Quiot JB. 2003. Spatial pattern analysis of Sharka disease (Plum pox virus strain M) in peach orchards of southern France. Phytopathology 93: 1543-1552.

Damania R, Stringer R, UllasKaranth K, Stith B. 2003. The economics of protecting tiger populations: linking household behavior to poaching and prey depletion. Land Econ 79: 198-216.

Dixon PM. 2002a. Nearest neighbour methods. In: El-Shaarawi AH, Piegorsch WW (eds) Encyclopedia of Environmetrics, vol. 3. John Wiley & Sons, New York, USA. Dixon PM. 2002b.Ripley’s K-function. In: El-Shaarawi AH, Piergorsch WW (eds). Encyclopedia of Environmetrics, vol. 3.John Wiley & Sons, New York, USA. Fauna & Flora International. 2008. Protection and Conservation of Sumatran Tigers in and around Kerinci Seblat National Park, Sumatra, Indonesia. Sungai Penuh.

Galster S, Elliot V. 2000. Roaring back: Anti poaching strategies for the Russian Far East. In:Seidensticker J,Christie S, Jackson P (eds).

Riding the Tiger: Tiger Conservation in Human-dominated Landscapes.Cambridge University Press, Cambridge.

Garcia-Milagros E, Funk VA. 2010. Improving the use of information from museum specimens: Using Google Earth© to georeference Guiana Shield specimens in the US National Herbarium. Front Biogeogr 2: 71-77.

Gatrell AC, Bailey TC, Diggle PJ, Rowlingson BS. 1996. Spatial point pattern analysis and its application in geographical epidemiology.

Trans Inst Br Geogr 21: 256-274.

Gong J. 2002. Clarifying the standard deviational ellipse.Geogr Anal 34: 155-167.

Gopal R, Qureshi Q, Bhardwaj M, Jagadish Singh R,Jhala YV. 2010.

Evaluating the status of the endangered tiger Panthera tigris and its prey in Panna Tiger Reserve, Madhya Pradesh, India. Oryx 44: 383389.

Gray L, He F. 2009. Spatial point-pattern analysis for detecting densitydependent competition in a boreal chronosequence of Alberta. For Ecol Manage 259: 98-106.

Haase P. 1995. Spatial pattern analysis in ecology based on Ripley’s Kfunction: introduction and methods of edge correction. J Veg Sci 575-582.

Hartana AT, Martyr DJ. 2001. Kerinci Seblat Tiger Protection Project PelestarianHarimau Sumatera Kerinci Seblat - Report on activities

RIFAIE et al. – Spatial pattern analysis of Sumatran Tiger poaching and progress 2000-2001.Kerinci Seblat National Park and Fauna & Flora International, Sungai Penuh.

Hengl T, Heuvelink G,Van Loon E. 2010. On the uncertainty of stream networks derived from elevation data: the error propagation approach.

Hydrol Earth SystSci 14: 1153-1165.

Hengl T, Sierdsema H, Radović A, Dilo A. 2009. Spatial prediction of species’ distributions from occurrence-only records: combining point pattern analysis, ENFA and regression-kriging. Ecol Mod 220: 34993511.

Huo XN, Li H, Sun DF, Zhou LD, Li BG. 2012. Combining geostatistics with Moran’s I analysis for mapping soil heavy metals in Beijing, China. Int J Environ Res Public Health 9: 995-1017.

Iosif R, Rozylowicz L, Popescu VD. 2013. Modeling road mortality hotspots of Eastern Hermann’s tortoise in Romania. AmphibiaReptilia 34: 163-172.

Liebman KA, Stoddard ST, Morrison AC,Rocha C, Minnick S, Sihuincha M, Russell KL, Olson JG, Blair PJ, Watts DM. 2012. Spatial dimensions of dengue virus transmission across interepidemic and epidemic periods in Iquitos, Peru (1999-2003). PLoSNegl Trop Dis 6: e1472. DOI: 10.1371/journal.pntd.0001472 Linkie M, Guillera-Arroita G, Smith J, Rayan DM. 2010. Monitoring tigers with confidence. Integr Zool 5: 342-350.

Linkie M, Martyr DJ, Holden J, Yanuar A, Hartana AT, Sugardjito J, Leader-Williams N. 2003. Habitat destruction and poaching threaten the Sumatran tiger in Kerinci Seblat National Park, Sumatra. Oryx 37: 41-48.

Liu Y, Li F, Jin G. 2014. Spatial patterns and associations of four species in an old-growth temperate forest. J Plant Interact 9: 745-753.

Loosmore NB, Ford ED. 2006. Statistical inference using the G or K point pattern spatial statistics. Ecology 87: 1925-1931.

Meijaard E. 2014. Why Is Conservation So Much Harder in Indonesia Than Elsewhere?

Jkt. Globe.http://thejakartaglobe.beritasatu.com/opinion/conservationmuch-harder-indonesia-elsewhere/ [December 15, 2014].

Ngowi HA, Kassuku AA, Carabin H, Mlangwa JE, Mlozi M, Mbilinyi BP, Willingham AL. 2010. Spatial clustering of porcine cysticercosis in Mbulu district, northern Tanzania.PLoSNegl Trop Dis 4: e652.

Nugraha RT,Sugardjito J. 2009. Assessment and Management Options of Human-Tiger Conflicts in Kerinci Seblat National Park, Sumatra, Indonesia. Mammal Study 34: 141-154.

Nyhus PJ, Tilson R. 2004. Characterizing human-tiger conflict in Sumatra, Indonesia: implications for conservation. Oryx 38: 68-74.

O’Brien TG, Kinnaird MF, WibisonoHT. 2003. Crouching tigers, hidden prey: Sumatran tiger and prey populations in a tropical forest landscape. AnimConserv 6: 131-139.

Perry GL, Miller BP, Enright NJ. 2006. A comparison of methods for the statistical analysis of spatial point patterns in plant ecology. Plant Ecol 187: 59-82.

Perry J, Liebhold A, Rosenberg M, Dungan J, Miriti M, Jakomulska A, Citron-Pousty S. 2002.Illustrations and guidelines for selecting statistical methods for quantifying spatial pattern in ecological data.Ecography 25: 578-600.

Plowden C, Bowles D. 1997. The illegal market in tiger parts in northern Sumatra, Indonesia. Oryx 31: 59-66.

QGIS Development Team. 2014. Quantum GIS Geographic Information System. Open Source Geospatial Foundation Available at: http://qgis. osgeo. org [September 3, 2014].

R Development Core Team. 2012. R: A language and environment for statistical computing. R Foundation for Statistical Computing, Vienna, Austria. http://www.r-project.org/. [August 6, 2016] Ramp D, Caldwell J, Edwards KA, Warton D, Croft DB. 2005. Modelling of wildlife fatality hotspots along the snowy mountain highway in New South Wales, Australia. BiolConserv 126: 474-490.

319

Rocchini D, Hortal J, Lengyel S, Lobo JM, Jimenez-Valverde A, Ricotta C, Bacaro G, Chiarucci A. 2011. Accounting for uncertainty when mapping species distributions: the need for maps of ignorance.

ProgPhysGeogr 35: 211-226.

Sanderson E, Forrest E, Loucks C, Ginsberg J, Dinerstein E, Seidensticker J, Leimgruber P, Songer M, Heydlauff A, O’Brien TG, Bryja G, Klenzendorf S, Wikramanayake E. 2010. Setting priorities for the conservation and recovery of wild tigers: 2005-2015.In: Tilson P, Nyhus PJ (eds). Tigers of the World: The Science, Politics and Conservation of Panthera tigris. Academic Press, London.

Seidensticker J, Christie S, Jackson P. 1999. Preface. In: Seidensticker J, Christie S, Jackson P, Editor. Riding the Tiger: Tiger Conservation in Human Dominated Landscape. Cambridge University Press, Cambridge.

Seidensticker J. 2010. Saving wild tigers: a case study in biodiversity loss and challenges to be met for recovery beyond 2010.IntegrZool 5: 285299.

Seidler TG, Plotkin JB. 2006. Seed dispersal and spatial pattern in tropical trees. PLoSBiol 4: e344. DOI: 10.1371/journal.pbio.0040344.

Simarro PP, Cecchi G, Franco JR, Paone M, Diarra A, Ruiz-Postigo JA, Fèvre EM, Mattioli RC, Jannin JG. 2012. Estimating and mapping the population at risk of sleeping sickness. PLoSNegl Trop Dis 6: e1859.

DOI: 10.1371/journal.pntd.0001859.

Siqueira JB, Martelli CM, Maciel IJ, Oliveira RM, Ribeiro MG, Amorim FP, Moreira BC, Cardoso DD, Souza WV, Andrade ALS. 2004.

Household survey of dengue infection in central Brazil: spatial point pattern analysis and risk factors assessment. Am J Trop Med Hyg 71: 646-651.

Stoyan D, Penttinen A. 2000. Recent applications of point process methods in forestry statistics. Stat Sci 61-78.

Tilson R, Nyhus PJ. 2010. The biology and politics of Sumatran tigers: Crash of the Conservation Garuda. In:Tilson P, Nyhus PJ (eds).Tigers of the World: The Science, Politics and Conservation of Panthera tigris. Academic Press, London.

Tilson R, Soemarna K, Ramono W, Lusli S, Traylor-Holzer K, Seal US. 1994. Sumatran Tiger Populations and Habitat Viability Analysis.

Indonesian Directorate General of Forest Protection and Nature Conservation, and IUCN/SSC Conservation Breeding Specialist Group, Apple Valley, MN. Wibisono HT, Figel JJ, Arif SM, Ario A, Lubis AH. 2009. Assessing the Sumatran tiger Panthera tigris sumatrae population in BatangGadis National Park, a new protected area in Indonesia. Oryx 43: 634-638.

Wibisono HT, Linkie M, Guillera-Arroita G, Smith JA, Pusparini W, Baroto P, Brickle N, Dinata Y, Gemita E, Gunaryadi D. 2011.

Population status of a cryptic top predator: an island-wide assessment of tigers in Sumatran rainforests. PloS One 6: e25931. DOI: 10.1371/journal.pone.0025931.

Wibisono HT, Pusparini W. 2010. Sumatran tiger (Panthera tigris sumatrae): A review of conservation status. IntegrZool 5: 313-323.

Wieczorek J, Guo Q, Hijmans R. 2004. The point-radius method for georeferencing locality descriptions and calculating associated uncertainty. Int JGeogrInfSci 18: 745-767.

Wiegand T, Moloney KA. 2004. Rings, circles, and null-models for point pattern analysis in ecology. Oikos 104: 209-229.

Wikramanayake ED, Dinerstein E, Robinson JG, Karanth KU, Rabinowitz A, Olson D, Matthew T, Hedao P, Conner M, Hemley G. 1999.

Where can tigers live in the future? A framework for identifying high priority areas for the conservation of tigers in the wild. In: Seidensticker J, Christie S, Jackson P (eds). Riding the Tiger: Tiger Conservation in Human Dominated Landscape. Cambridge University Press, Cambridge.

Zhang Z, Xiao R, Shortridge A, Wu J. 2014. Spatial point pattern analysis of human settlements and geographical associations in eastern coastal China - a case study.Int J Environ Res Public Health 11: 2818-2833.

B I O D I V E R S IT A S Volume 16, Number 2, October 2015 Pages: 320-326

ISSN: 1412-033X E-ISSN: 2085-4722 DOI: 10.13057/biodiv/d160229

Potential in bioethanol production from various ethanol fermenting microorganisms using rice husk as substrate WOOTTICHAI NACHAIWIENG1,, SAISAMORN LUMYONG2, RONACHAI PRATANAPHON1, KOICHI YOSHIOKA3, CHARTCHAI KHANONGNUCH1, 1

Division of Biotechnology, School of Agro-Industry, Faculty of Agro-Industry, Chiang Mai University, Mueang, Chiang Mai 50100, Thailand Tel: +6686-923-5172. email: woot072@hotmail.com,  chartchai.k@cmu.ac.th 2 Department of Biology, Faculty of Science, Chiang Mai University, Mueang, Chiang Mai 50200, Thailand 3 Laboratory of Forest Resource Circulatory System, Division of Environmental Science, Graduate School of Life and Environmental Science, Kyoto Prefectural University, Hangi-cho, Shimogamo, Sakyo-ku, Kyoto 606-8522 Japan Manuscript received: 7 August 2015. Revision accepted: 29 October 2015.

Abstract. Nachaiwieng W, Lumyong S, Pratanapol R, Yoshioka K, Khanongnuch C. 2015. Potential in bioethanol production from various ethanol fermenting microorganisms using rice husk as substrate. Biodiversitas 16: 320-326. Rice husk was investigated as the potential substrate for bioethanol fermentation. It was collected from five locations in northern Thailand and found that the main component of rice husk approximately 51-54% (w/w) was holocellulose. The sugar composition in rice husk holocellulose was glucose, xylose and arabinose in the ratio 66.68, 27.61 and 5.71%, respectively. Before further fermentation, acid and alkali pretreatment of rice husk were prior investigated and 2% (w/v) NaOH at 130oC for 30 min was proved to be the most suitable pretreatment method without fermenting inhibitors generation. Then, rice husk hydrolysate obtained by enzymatic saccharification with Meicelase enzyme was used as carbon sources for ethanol fermentation in comparison among 11 ethanol fermenting microorganisms including 3 strains of Saccharomyces cerevisiae, 3 strains of Zymomonas mobilis, 3 strains of Kluyveromyces marxianus and 2 strains of pentose sugar fermenting microbes, Candida shehatae TISTR 5843 and Pichia stipitis BCC 15191. All three strains of Z. mobilis exhibited the best ethanol fermentation yield, giving the ethanol yield of 0.48 g g-1 available monosaccharides and fermentation profile of each individual genus was also demonstrated. However, some unutilized sugars still remained in rice husk fermenting medium, therefore, conversion to valuable products or optimization of co-culture ethanol fermentation needs to be further investigated.

Keywords: bioethanol, pretreatment, ethanol, fermentation, Meicelase, rice husk

INTRODUCTION Due to rapid increasing of gasoline price and depletion of readily available oil resource, renewable resources alternative to oil, such as biomass, wind, solar, geothermal and hydroelectric energy have gained increasing attention in recent years. Bioethanol (C2H5OH) is widely accepted as an important source for transportation fuel and energy. It reduces CO2 emission and pollutants when replacing gasoline in modified engine (De Oliveira et al. 2005). Since ethanol produced from edible materials caused high production cost and created ethical problem regarding competitiveness to food supply, bioethanol from lignocellulosic material has gathered keen attention (Nigam and Singh 2011). Although the bioethanol from lignocellulosics could not replace all gasoline, its importance is still widely recognized. Over the past decade, the number of bioethanol plant from lignocellulosic materials have begun to increase (Eisentraut 2010), and its production level, 21 billion gallons from cellulosic feedstock by 2022 was described in law of USA (Nigam and Singh 2011). In addition, as expected by Limayem and Ricke (2012), one billion tons of various lignocellulosic feedstocks and an additional cultivation of high yielding energy crops on Conservation Reserve Program (CRP) lands that are efficiently managed are expected to meet a

30% petroleum-based gasoline displacement in 2030.

As previously reports, ethanol are widely produces from various lignocellulosic residues such as agricultural crops i.e. wheat and paddy straws, corn stover, groundnut shell, sunflower stalks, alfalfa fiber, cotton stalks and agricultural by-products i.e. sugarcane bagasse, corncobs, palm bagasse, barley and sunflower hulls, wheat barn and especially rice husk (Arora et al. 2015). Rice husk is an agricultural waste abundantly available in rice producing countries including Thailand. Thailand was reported to be the Asia 3th rice production as the productivity approximately 4% of world rice’s production was gained (Gadde et al. 2009). The annual world rice production amounts to approximately 400 million metric tons, of which more than 10% is husk (Conradt et al. 1992). In addition, rice husk contains around 50% (w/w) of cellulosic component (Wannapeera et al. 2008; Mansaray and Ghaly 1999). Industrial use of rice husk is mostly burning as a source of heat for generation of electricity, which causes environmental problems owing to a large quantity of CO2 emission (Bharadwaj et al. 2004). Due to the environmental problem and availability as an agricultural residue in Thailand, conversion of rice husk into bioethanol is an important subject.

Due to the presence of lignin and hemicellulose in lignocellulosic structure, the access of cellulolytic enzymes

NACHAIWIENG et al. – Ethanol production from rice husk

to cellulose for hydrolysis and finally ferment to ethanol is difficult. Therefore, the lignocellulose needed to be delignified by pretreatment processes which various available including physical, physico-chemical, chemical and biological pretreatment (Sun and Cheng 2002) and all having their specific advantages and disadvantages. However, the chemical pretreatment was selected in this study because of no expensive equipment required and their availability.

Both acid and alkaline pretreatment are able to increase accessible surface area and alter lignin structure, moreover, alkaline pretreatment has a strong effect to remove lignin which lead to easier access of cellulolytic enzyme to cellulose structure (Mosier et al. 2005).

Until now, various ethanol producing microorganisms have been discovered. Saccharomyces cerevisiae, a good brewer yeast, is found to be the most popular and produce high ethanol yield from 6-carbon atom sugars such as glucose (Piškur et al. 2006). In contrast to S. cerevisiae, Zymomonas mobilis is another candidate which capable of grows and produces high concentration of ethanol from higher initial sugar and more tolerate to ethanol concentration with lower biomass formation (Rogers et al.

1979). However, the processes of ethanol fermentation by both strains described above are favorable working under 30-35ºC which is not suitable for tropical countries and incompatible when using in Simultaneous Saccharification and Fermentation (SSF) process. Therefore, Kluyveromyces marxianus, a thermotolerant ethanol fermenting yeast, has been chosen for ethanol fermentation at high temperature condition instead, in particular for SSF (Ballesteros et al.

2004). Not only glucose, various 5-carbon atom sugars such as xylose and arabinose are consisted in hemicelluloses component of lignocellulosic residues.

Unfortunately, S. cerevisiae, Z. mobilis and some strains of K. marxianus could not utilize those sugars as their carbon source. Potential strains which capable of fermenting these sugars such as Pichia stipitis and Candida shehatae are called pentose fermenter. Therefore, to complete and efficient conversion of both 5- and 6- carbon atom sugars, co-culture fermentation between both hexose and pentose fermenter should be carried out, even though few experiments were succeeded (Fu and Peiris 2008; Fu et al.

2009).

This manuscript describes a rice husk compositions and the most suitable chemical pretreatment method for obtaining the highest rice husk sugar yield. Moreover, this is the first report demonstrated the comparison in ethanol fermentation profile of various ethanol fermenting microorganism groups including common yeast, thermotolerant yeast, pentose fermenter yeast and ethanol fermenting bacteria. This could be helpful for further strain selection when using rice husk as substrate for ethanol production.

MATERIALS AND METHODS Microorganisms Fermenting microorganisms, Saccharomyces cerevisiae TISTR 5088 [S5088], S. cerevisiae TISTR 5169 [S5169],

321

S. cerevisiae TISTR 5339 [S5339], Zymomonas mobilis TISTR 405 [Z405], Zymomonas mobilis TISTR 548 [Z548], Z. mobilis TISTR 551 [Z551] and Candida shehatae TISTR 5843 [C5843] were purchased from Thailand Institute of Scientific and Technological Research (TISTR). Pichia stipitis BCC 15191 [P15191], Kluyveromyces marxianus BCC 7025 [K7025] and Kluyveromyces marxianus BCC 7049 [K7049] were purchased from Biotech Culture Collection (BCC), Thailand. Kluyveromyces marxianus CK8 [KCK8] was previously isolated from rotten fruit in Chiang Mai (Amaiam and Khanongnuch 2015).

Sample preparation Rice husk samples were randomly collected from Northern provinces of Thailand including Chiang Mai, Chiang Rai, Lamphun, Lampang and Nan without rice variety consideration. Samples were washed thoroughly with tap water and dried at 60oC for 3 days. Dried samples were milled with hammer mill and size screened by sieving through 16 mesh aluminium sieve. All samples were kept in the desiccators until the experiments.

Analysis of rice husk composition and sugar components The ground rice husk samples from all 5 sources were subjected to composition analyses including holocellulose, hemicellulose, lignin, ash, protein, lipid and soluble carbohydrate according to the protocols of acid chlorite method (Browning 1963), TAPPI T203 om-88 (TAPPI, 1992), TAPPI T222 om-88 (TAPPI, 1988), TAPPI T211 om-85 (TAPPI, 1985), Kjeldahl method (Conklin-Brittain et al. 1999), Soxhlet extractor method (Wren and Mitchell 1959) and phenol sulfuric method (Dubois et al. 1956), respectively.

For sugar component analysis, approximately 0.5 g of rice husk was hydrolyzed with 8 ml of 72% (w/w) sulfuric acid, gentle mixed and incubated at 30oC for 1 h. The sample was then diluted with 300 ml of distilled water to adjust a final concentration of sulfuric acid to be 2% (w/w).

The solution was then autoclaved at 121oC for 30 min and neutralized by addition of Ba(OH)2. A clear supernatant was obtained by centrifugation at 4290 x g for 20 min and subjected to quantitative analysis of neutral sugars by High Performance Liquid Chromatography (HPLC) Shimadzu LC 20A system (Shimadzu Corp., Kyoto, Japan) equipped with Aminex HPX-87P (300 mm×7.8 mm) (BioRad, USA) using deionized distilled water as an eluent at a flow rate of 0.3 ml min-1 and the column temperature, 58oC. Glucoheptose was used as an internal standard. Detection was carried out with a Fluorescent Detector (FLD) at 420 nm by post reaction with a mixture of arginine and boric acid (1:3, v/v) at 150oC. Pretreatment of rice husk samples Dried rice husk sample was pretreated by 0.5, 1.0, 1.5 and 2.0 % (w/v) of diluted sulfuric acid and sodium hydroxide solution with ratio 1:10. Pretreatment process was carried out in autoclave machine at 130oC for 30 min and allowed to cool down overnight. Solid fractions were

322

B I O D I V E R S IT A S

16 (2): 320-326, October 2015

obtained by filtration through Whatman No.1 filter paper and then washed by excess volume of tap water for neutralization. Pretreated rice husk sample was dried at 60oC for 2 days before enzymatic saccharification.

Enzymatic saccharification of pretreated rice husk Approximately 0.2 g of chemical pretreated rice husk samples were hydrolyzed by 40 FPU g-1 substrate of commercial cellulolytic enzyme “Meicelase” (510 FPU g-1 enzyme powder, from Trichoderma viride, Meiji Seika Company, Tokyo, Japan) dissolved in sodium succinate buffer (pH 4.8), in the presence of 0.1% sodium azide. A saccharification was carried out in a shaking incubator at 45oC, 150 rpm for 48 h and the reducing sugars liberated were finally quantified by dinitrosalicylic acid (DNS) method (Miller 1959).

Rice husk fermenting medium preparation Rice husk hydrolysate was prior prepared by hydrolyzing the 2.0% (w/v) NaOH pretreated rice husk sample with Meicelase (40 FPU g-1 of substrate) at 45ºC for 48 h as previously described without sodium azide added.

The liquid portion was obtained by filtered through Whatman No.1 filter paper and used as a carbon source for fermenting medium preparation. The sugar concentration was adjusted to approximately 20 g L-1 by rotary evaporator. The concentrates were supplemented with yeast extract, (NH4)2HPO4 and MgSO4.7H2O at the final concentration of 3.0, 0.25 and 0.025 g L-1, respectively (Gupta et al. 2009), and sterilization by autoclaving at 121oC for 15 min.

Determination of fermenting inhibitor in rice husk fermenting medium Fermenting inhibitors which may generate during pretreatment process are very important factors for ethanol yield and need to be investigated before further fermentation. Furfural, 5-hydroxy methyl furfural (5-HMF) and acetic acid were determined by HPLC (Shimadzu LC 20A system) equipped with Aminex HPX-87H column (300mm×7.8mm with guard cartridge). Separation was carried out at 35oC using 8 mM sulfuric acid as a mobile phase with flow rate 0.6 mL min-1. Peaks were detected by Photo Diode Array (PDA) detector. Lignin degradation products, vanillin, syringaldehyde and 4-hydroxybenzaldehyde, were also analyzed by HPLC (Shimadzu LC

20A system) equipped with Imtakt Unison UK-Phenyl (150×4.6 mm, 3μm) without guard cartridge. Separation was performed at 40oC using gradient between 10mM ammonium acetate buffer and acetonitrile as mobile phase with flow rate 1 mL min-1 and peaks were also detected by PDA detector.

Comparison of fermentative ability of various microorganisms The comparative fermentation experiment by fermenting microorganisms were preliminary carried out with 3 strains of common ethanol fermenting yeast S. cerevisiae, 3 strains of thermotolerant ethanol fermenting yeast K. marxianus, 3 strains of ethanol fermenting bacteria Z. mobilis and 2 strains of pentose fermenter, C. shehatae and P. stipitis, by inoculated 5% (v/v) of inoculum (108 CFU) into 125 mL-Duran bottle containing of 50 ml of rice husk fermenting medium. The fermentation was carried out at 30oC, except for K. marxianus which carried out at 45oC for 96 h, and the samples were collected 12-h interval.

Ethanol concentration was analyzed by gas chromatography (GC-17A; Shimadzu, Tokyo, Japan) using a flame ionization detector and stainless steel column with 15.0 m in length, 0.53 mm of diameter and 0.5 µm of film thickness. The column, injection and detector temperature were maintained at 40°C, 230oC and 250oC, respectively.

Nitrogen was used as carrier gas at a flow rate of 30 mL min-1. Reducing sugar was determined by DNS method.

Concentration of glucose and xylose were measured by Autokit Glucose (Wako Chemicals, Osaka, Japan) and Dxylose assay kit (Megazyme, Wicklow, Ireland), respectively.

Cell density was measured by spectrophotometer at wavelength 600 nm.

RESULTS AND DISCUSSION Rice husk composition analysis There were slightly significant differences in compositions among 5 rice husk samples at p-value < 0.05.

Variation of rice husk component could occur due to the varieties of paddy sown, watering, geographical conditions, fertilizer used, climate, soil chemistry, age of paddy and growth conditions (Foo and Hameed 2009). Holocellulose, alpha cellulose, hemicelluloses and lignin content were 5154%, 20-25%, 28-32% and 28-30% (w/w), respectively

Table 1. Compositions of 5 different sources rice husk samples collected from Northern Thailand Holo Alpha Hemi Soluble Lignin Ash Lipid Protein cellulose Cellulose Cellulose Carbohydrate (%) (%) (%) (%) (%) (%) (%) (%) ab** a a a a a a CM 52.86 20.86 32.00 30.01 18.73 1.63 0.07 2.34a a b c b b b a CR 51.28 22.26 29.02 28.92 20.21 2.04 0.10 2.55a LPo 54.14b 25.50c 28.64d 30.30a 18.79a 1.47a 0.25b 2.49a ab a a b a a a LPa 52.73 20.87 31.86 28.81 18.67 1.53 0.09 2.47a a a b ab a a a NN 51.16 20.17 30.99 29.72 19.03 1.71 0.12 2.36a Note: * CM, CR, LPo, LPa and NN were rice husk sample collected from Chiang Mai, Chiang Rai, Lamphun, Lampang and Nan Provinces. ** Superscript letters represented a significant at p < 0.05 Samples*

NACHAIWIENG et al. – Ethanol production from rice husk

(Table 1). Rice husk sample (LPo) was selected for further study due to its highest holocellulose content. The holocellulose content (>50% w/w) of rice husk was comparable to previous studies (Saha, Badal C. and Cotta 2008; Banerjee et al. 2009; Hsieh et al. 2009). The ash content was 18-20%, interestingly 95% of ash in rice husk is silicon (Della et al. 2002) and use for silicon-based materials after bioethanol production is also attractive. The neutral sugar composition in rice husk was glucose, xylose and arabinose in ratio 66.68 ± 0.97, 27.61 ± 1.06 and 5.71 ± 0.17%, respectively. This result was similar to previous result which was analyzed the neutral sugar, glucose, xylose and arabinose, from rice husk in ratio 61.62, 34.23 and 4.15%, respectively (Nabarlatz et al. 2007). These results indicated that cellulose and xylan are the major polysaccharides in rice husk and arabinan is also present in the sample but only in trace amount.

To optimize a chemical pretreatment process, the ability of enzymatic saccharification after pretreatment was crucial in the evaluation of the best pretreatment process for rice husk. Sulfuric acid and sodium hydroxide were widely used as pretreatment substances as referred to the previous reports (Saha, Badal C et al. 2005; Singh et al. 2011).

Concerning to environmental friendly policy and the high quantity of chemical usage in rice husk pretreatment with sulfuric acid and sodium hydroxide, the maximum concentration of each pretreatment substance was assigned at maximum of 2.0% with implementation by conventional autoclave. The highest yield of liberated sugars from enzymatic saccharification based on 2.0% sodium hydroxide pretreatment process was 37.35 ± 2.11% (w/w) of rice husk dry weight and significantly different at p < 0.05 from pretreatment by the other concentrations of sodium hydroxide (Figure 1). In contrast, the highest yield of liberated sugars from enzymatic saccharification after pretreatment by 0.5% sulfuric acid was only 0.96 ± 0.41% of rice husk weight. These indicated that acid pretreatment was not suitable for rice husk pretreatment and hemicellulose might be lost during pretreatment process with the formation of a toxic hydroxymethylfurfural (Lee et al. 1999).

Moreover, even though, both acid and alkaline pretreatment could increase accessible surface area and alter lignin structure, but lignin was only removed in case of alkaline pretreatment (Mosier et al. 2005) especially sodium hydroxide pretreatment on rice husk residue (Nikzad et al. 2015) which allow cellulolytic enzyme to penetrate and hydrolyze cellulose structure, lead to high amount of sugar released. Therefore, alkaline pretreatment process based on 2.0% sodium hydroxide was selected to be the most appropriate chemical pretreatment for rice husk in this experiment. In addition, after pretreatment rice husk by 2% (w/v) NaOH solution, glucose, xylose and arabinose contents were non-significantly decreased, the total sugar loss during pretreatment process was calculated as 6.04% (Table 2) without any detection of fermenting inhibitors such as furfural, 5-hydroxy methyl furfural (5-HMF), acetic acid, lignin degradation products, vanillin, syringaldehyde and 4-hydroxybenzaldehyde. Because of low removal of hemicellulose and cellulose structure by

323

alkaline pretreatment (Mosier et al. 2005; Ang et al. 2013), there was slightly sugar released during pretreatment process as presented in this study. Low sugar released and no sugar degradation during pretreatment is key factors for effective pretreatment method as described by Yang and Wyman (2008). As the result, the alkaline pretreatment was chosen in this study for further ethanol fermentation without concerning of fermenting inhibitor and sugar loss during pretreatment.

Furthermore, our results were compatible with previous studies, alkaline pretreatment with 120oC was sufficient to increase the digestibility of low lignin containing lignocellulosic biomass (Kaar and Holtzapple 2000) without any fermenting inhibitors generation (Chang et al. 2001). Even though liquid fractions from various kinds of biomass from acid hydrolysis method are widely used for ethanol production, however, time consuming and complicated detoxification processes are needed because of the presence of various fermenting inhibitors (Larsson et al. 1999).

Comparison of ethanol fermentation of rice husk sugar by various fermenting microorganisms According to previous study of fermentation, all fermenting strains could grow and ferment in the presence of succinic acid but some microorganisms could not grow in the presence of acetic and citric acid (Nachaiwieng et al.

2015). Therefore, sodium succinate buffer was used in saccharification process to avoid some inhibitors from acid mentioned above. With this buffer and under a static condition, all fermenting strains could grow well except for K. marxianus. This strain need more oxygen to grow and ferment, thus 150 rpm shaking condition was then applied for this strain as previously described by Limtong et al.

(2007). Furthermore, an anaerobic bacteria Z. mobilis, which could not grow well under aerobic condition needed a sterilized liquid paraffin to make a layer for absorbing oxygen (Li et al. 2000; Yoshida et al. 1970). When the fermentation was terminated, the ethanol yield obtained from the same genus was similar. The highest ethanol yield was obtained from Z. mobilis with 0.48 g g-1 available monosaccharides or 94.12% of theoretical yield (Table 3).

Z. mobilis is found to be the highest ethanol yield producing strain because of less biomass is produced and a

Figure 1. Percentage of liberated sugars per rice husk weight from enzymatic saccharification after acid and alkaline pretreatment of rice husk

B I O D I V E R S IT A S

324

16 (2): 320-326, October 2015

Figure 2. HPLC based sugar analysis of rice husk hydrolysate, before and after ethanol fermentation by hexose fermenting strain (Glc, Xyl, Ara and Man were glucose, xylose, arabinose and mannose, respectively)

Table 2. The amount of rice husk monosaccharide (g L-1) loss after pretreatment rice husk by 2% (w/v) NaOH at 130oC for 30 min

Monosaccharides Glucose Xylose Arabinose

Untreated rice husk (g L-1)

2% (w/v) NaOH pretreated rice husk (g L-1)

0.356a ± 0.03 0.085a ± 0.01 0.039a ± 0.01

0.347a ± 0.04 0.074a ± 0.01 0.030a ± 0.01

Note: Significant at p < 0.05

Table 3. Ethanol yield production from comparative fermentation by various fermenting microorganisms on each microorganism optimum fermenting condition

Microorganisms

Ethanol yield (g g-1 available monosaccharides)*

Ethanol yield (g g-1 available sugar)

S. cerevisiae TISTR 5088 S. cerevisiae TISTR 5169 S. cerevisiae TISTR 5339 Z. mobilis TISTR 405 Z. mobilis TISTR 548 Z. mobilis TISTR 551 K. marxianus BCC 7025 K. marxianus BCC 7049 K. marxianus CK8 C. shehatae TISTR 5843 P. stipitis BCC 15191

0.45 0.45 0.45 0.48 0.48 0.48 0.43 0.42 0.42 0.40 0.42

0.27 0.27 0.26 0.29 0.28 0.28 0.24 0.24 0.25 0.24 0.25

Note: *Hydrolyzed rice husk sugar contained unidentified oligomers and could not utilize by microorganisms

higher metabolic rate of glucose is maintained through its special Entner-Doudoroff pathway (Bai et al. 2008).

Ethanol yield produced by Z. mobilis strains in this study are corresponding to previous reports that ethanol yield from Z. mobilis ATCC 10988 and Z. mobilis ATCC 31821 at 0.472 and 0.468 g g-1 available glucose, respectively (Rogers et al. 1982; Tao et al. 2005). Other fermenting strains, S. cerevisiae, K. marxianus, P. stipitis and C. shehatae TISTR 5843, produced ethanol 0.45, 0.42-0.43, 0.42 and 0.40 g g-1 available monosaccharides, respectively. Interestingly, ethanol yield obtained from all S. cerevisiae strains in this study were significantly higher than 0.41 g g-1 obtained from S. cerevisiae ITV-01 (Ortiz‐ Muniz et al. 2010) and also higher than those strains mentioned by Hahn-Hägerdal et al. (2006) from various source of agricultural hydrolysate fermenting media.

Moreover, comparing ethanol yield from rice husk hydrolysate, ethanol yield obtained from this study is better than 0.43 g g-1 sugar obtained using commercial S. cerevisiae as fermenter yeast (Dagnino et al. 2013). As previous results, various strains used in this study, especially Z. mobilis and S. cerevisiae, seemed to be suitable strains for producing ethanol from rice husk hydrolysate although the fermentation process has not yet optimized in this study. In addition, possible highest ethanol yield from rice husk in this study was 0.26-0.28 g g-1 of dry rice husk which is potential substrate when compared to barley straw, corn stover, oat straw, rice straw, sorghum straw, wheat straw and bagasse which gave an ethanol yield at 0.26-0.31 g g-1 of dry biomass (Kim and Dale 2004). However, this ethanol yield was calculated from rice husk holocellulose and maximum ethanol yield (0.51 g g-1 sugar), therefore, further study of optimization on fermentation process and co-culture fermentation between hexose and pentose fermenter should be carried out to reach to expecting target of ethanol yield.

As presented in Figure 3, the fermentation profile was unique in each genus. Highest ethanol yield from S. cerevisiae, Z. mobilis and pentose fermenter was obtained after 24 h and continued constant. In contrast, the highest ethanol yield from K. marxianus was obtained after 12 h and gradually decreased as similar due to high temperature used in fermentation process (Teixeira and Vicente 2013) as presented in previous study (Signori et al. 2014).

Interestingly, there were some sugars remaining after fermentation by all microorganisms and were detected by HPLC as xylose, arabinose and unidentified oligomers (Figure 2) while all of glucose was utilized within 24 h.

Except for C. shehatae TISTR 5843 and P. stipitis BCC 15191 which could utilized both glucose and a little amount of xylose (Figure 3). Unfortunately, even both strains could utilize both glucose and xylose but ethanol yield obtained from these strains were lower than others.

Therefore, a fermentation of rice husk medium with high potential ethanol producing strain and the conversion of remaining pentose and its oligomer to high valued substances such as xylooligosaccharide or xylitol, or optimize a co-culture ethanol fermentation between pentose and hexose fermenter have to be further investigated.

NACHAIWIENG et al. – Ethanol production from rice husk

325

Figure 3. Comparative study of ethanol fermentation from various fermenting microorganism strains, S. cerevisiae (A); Z. mobilis (B); K. marxianus (C) and Pentose sugar fermenter (D)

ACKNOWLEDGEMENTS

REFERENCES

This study was partially supported by The Graduate School, Chiang Mai University, Thailand and Tetra Pak Company, Thailand. Authors also acknowledge the scientist exchange programs of the project, “Towards Sustainable Humanosphere in Southeast Asia,” organized by the Center for Southeast Asian Studies (CSEAS) of Kyoto University, Japan.

Am-aiam S, Khanongnuch C. 2015. Medium optimization for βgalactosidase production by thermotolerant yeast. Chiang Mai J Sci 42: 480-489.

Ang TN, Ngoh GC, Chua ASM. 2013. Comparative study of various pretreatment reagents on rice husk and structural changes assessment of the optimized pretreated rice husk. Bioresour Technol 135: 116-119.

Arora R, Behera S, Kumar S. 2015. Bioprospecting thermophilic/ thermotolerant microbes for production of lignocellulosic ethanol: A future perspective. Renew Sustain Ener Rev 51: 699-717.

326

B I O D I V E R S IT A S

16 (2): 320-326, October 2015

Bai F, Anderson W, Moo-Young M. 2008. Ethanol fermentation technologies from sugar and starch feedstocks. Biotechnol Adv 26 (1): 89-105.

Ballesteros M, Oliva JM, Negro MJ, Manzanares P, Ballesteros I. 2004.

Ethanol from lignocellulosic materials by a simultaneous saccharification and fermentation process (SFS) with Kluyveromyces marxianus CECT 10875. Process Biochem 39 (12): 1843-1848.

Banerjee S, Sen R, Pandey RA, Chakrabarti T, Satpute D, Giri BS, Mudliar S. 2009. Evaluation of wet air oxidation as a pretreatment strategy for bioethanol production from rice husk and process optimization. Biomass Bioenergy 33 (12): 1680-1686.

Bharadwaj A, Wang Y, Sridhar S, Arunachalam V. 2004. Pyrolysis of rice husk. Curr Sci 87 (7): 981-986.

Browning B. 1963. The Chemistry of Wood. Wiley Interscience, New York.

Chang VS, Kaar WE, Burr B, Holtzapple MT. 2001. Simultaneous saccharification and fermentation of lime-treated biomass. Biotechnol Lett 23 (16): 1327-1333.

Conklin-Brittain N, Dierenfeld E, Wrangham R, Norconk M, Silver S. 1999. Chemical protein analysis: a comparison of Kjeldahl crude protein and total ninhydrin protein from wild, tropical vegetation. J Chem Ecol 25 (12): 2601-2622.

Conradt R, Pimkhaokham P, Leela-Adisorn U. 1992. Nano-structured silica from rice husk. J Non-Cryst Solids 145: 75-79.

Dagnino E, Chamorro E, Romano S, Felissia F, Area M. 2013.

Optimization of the acid pretreatment of rice hulls to obtain fermentable sugars for bioethanol production. Ind Crop Prod 42: 363368.

De Oliveira MED, Vaughan BE, Rykiel EJ. 2005. Ethanol as fuel: energy, carbon dioxide balances, and ecological footprint. Bioscience 55 (7): 593-602.

Della V, Kühn I, Hotza D. 2002. Rice husk ash as an alternate source for active silica production. Mater Lett 57 (4): 818-821.

Dubois M, Gilles KA, Hamilton JK, Rebers P, Smith F. 1956.

Colorimetric method for determination of sugars and related substances. Anal Chem 28 (3): 350-356.

Eisentraut A. 2010. Sustainable Production of Second-generation Biofuels; Potential and Perspectives in Major Economies and Developing Countries. International Energy Agency, Paris, France.

Foo K, Hameed B. 2009. Utilization of rice husk ash as novel adsorbent: a judicious recycling of the colloidal agricultural waste. Adv Colloid Interface Sci 152 (1): 39-47.

Fu N, Peiris P. 2008. Co-fermentation of a mixture of glucose and xylose to ethanol by Zymomonas mobilis and Pachysolen tannophilus. World J Microbiol Biotechnol 24 (7): 1091-1097.

Fu N, Peiris P, Markham J, Bavor J. 2009. A novel co-culture process with Zymomonas mobilis and Pichia stipitis for efficient ethanol production on glucose/xylose mixtures. Enzyme Microb Technol 45 (3): 210-217.

Gadde B, Bonnet S, Menke C, Garivait S. 2009. Air pollutant emissions from rice straw open field burning in India, Thailand and the Philippines. Environ Pollut 157 (5): 1554-1558.

Gupta R, Sharma KK, Kuhad RC. 2009. Separate hydrolysis and fermentation (SHF) of Prosopis juliflora, a woody substrate, for the production of cellulosic ethanol by Saccharomyces cerevisiae and Pichia stipitis-NCIM 3498. Bioresour Technol 100 (3): 1214-1220.

Hahn-Hägerdal B, Galbe M, Gorwa-Grauslund M-F, Lidén G, Zacchi G. 2006. Bio-ethanol–the fuel of tomorrow from the residues of today.

Trends Biotechnol 24 (12): 549-556.

Hsieh Y, Du Y, Jin F, Zhou Z, Enomoto H. 2009. Alkaline pre-treatment of rice hulls for hydrothermal production of acetic acid. Chem Eng Res Des 87 (1): 13-18.

Kaar WE, Holtzapple MT. 2000. Using lime pretreatment to facilitate the enzymic hydrolysis of corn stover. Biomass Bioenergy 18 (3): 189199.

Kim S, Dale BE. 2004. Global potential bioethanol production from wasted crops and crop residues. Biomass Bioenergy 26 (4): 361-375.

Larsson S, Palmqvist E, Hahn-Hägerdal B, Tengborg C, Stenberg K, Zacchi G, Nilvebrant N-O. 1999. The generation of fermentation inhibitors during dilute acid hydrolysis of softwood. Enzyme Microb Technol 24 (3): 151-159.

Lee WG, Lee JS, Shin CS, Park SC, Chang HN, Chang YK Ethanol production using concentrated oak wood hydrolysates and methods to detoxify. In: Twentieth Symposium on Biotechnology for Fuels and Chemicals, 1999. Springer, Berlin.

Li G, Huang W, Lerner D, Zhang X. 2000. Enrichment of degrading microbes and bioremediation of petrochemical contaminants in polluted soil. Water Res 34 (15): 3845-3853.

Limayem A, Ricke SC. 2012. Lignocellulosic biomass for bioethanol production: current perspectives, potential issues and future prospects.

Prog Energy Combust Sci 38 (4): 449-467.

Limtong S, Sringiew C, Yongmanitchai W. 2007. Production of fuel ethanol at high temperature from sugar cane juice by a newly isolated Kluyveromyces marxianus. Bioresour Technol 98 (17): 3367-3374.

Mansaray KG, Ghaly AE. 1999. Determination of kinetic parameters of rice husks in oxygen using thermogravimetric analysis. Biomass Bioenergy 17 (1): 19-31.

Miller GL. 1959. Use of dinitrosalicylic acid reagent for determination of reducing sugar. Anal Chem 31 (3): 426-428.

Mosier N, Wyman C, Dale B, Elander R, Lee Y, Holtzapple M, Ladisch M. 2005. Features of promising technologies for pretreatment of lignocellulosic biomass. Bioresour Technol 96 (6): 673-686.

Nabarlatz D, Ebringerová A, Montané D. 2007. Autohydrolysis of agricultural by-products for the production of xylo-oligosaccharides.

Carbohydr Polym 69 (1): 20-28.

Nachaiwieng W, Kanpiengjai A, Watanabe T, Khanongnuch C. 2015.

Influences of Buffer Systems on Enzymatic Saccharification of Rice Husk Holocellulose and Fermenting Ability of Various Ethanol Producing Microorganisms. Chiang Mai University, Thailand.

Nigam PS, Singh A. 2011. Production of liquid biofuels from renewable resources. Prog Energy Combust Sci 37 (1): 52-68.

Nikzad M, Movagharnejad K, Talebnia F, Aghaiy Z, Mighani M. 2015.

Modeling of alkali pretreatment of rice husk using response surface methodology and artificial neural network. Chem Eng Commun 202 (6): 728-738.

Ortiz‐Muñiz B, Carvajal‐Zarrabal O, Torrestiana‐Sanchez B, Aguilar ‐Uscanga MG. 2010. Kinetic study on ethanol production using Saccharomyces cerevisiae ITV‐01 yeast isolated from sugar cane molasses. J Chem Technol Biotechnol 85 (10): 1361-1367.

Piškur J, Rozpędowska E, Polakova S, Merico A, Compagno C. 2006.

How did Saccharomyces evolve to become a good brewer? Trends Genet 22 (4): 183-186.

Rogers PL, Lee KJ, Skotnicki ML, Tribe DE 1982 Ethanol production by Zymomonas mobilis. In: Microbial Reactions, vol 23. Advances in Biochemical Engineering. Springer, Berlin.

Rogers PL, Lee KJ, Tribe DE. 1979. Kinetics of alcohol production by Zymomonas mobilis at high sugar concentrations. Biotechnol Lett 1 (4): 165-170.

Saha BC, Cotta MA. 2008. Lime pretreatment, enzymatic saccharification and fermentation of rice hulls to ethanol. Biomass Bioenergy 32 (10): 971-977.

Saha BC, Iten LB, Cotta MA, Wu YV. 2005. Dilute acid pretreatment, enzymatic saccharification, and fermentation of rice hulls to ethanol.

Biotechnol Prog 21 (3): 816-822.

Signori L, Passolunghi S, Ruohonen L, Porro D, Branduardi P. 2014.

Effect of oxygenation and temperature on glucose-xylose fermentation in Kluyveromyces marxianus CBS712 strain. Microbi Cell Fact 13 (1): 51.

Singh A, Tuteja S, Singh N, Bishnoi NR. 2011. Enhanced saccharification of rice straw and hull by microwave–alkali pretreatment and lignocellulolytic enzyme production. Bioresour Technol 102 (2): 1773-1782.

Sun Y, Cheng J. 2002. Hydrolysis of lignocellulosic materials for ethanol production: a review. Bioresour Technol 83 (1): 1-11.

Tao F, Miao JY, Shi GY, Zhang KC. 2005. Ethanol fermentation by an acid-tolerant Zymomonas mobilis under non-sterilized condition.

Process Biochem 40 (1): 183-187.

Teixeira JA, Vicente AA. 2013. Engineering Aspects of Food Biotechnology. CRC Press, USA. Wannapeera J, Worasuwannarak N, Pipatmanomai S. 2008. Product yields and characteristics of rice husk, rice straw and corncob during fast pyrolysis in a drop-tube/fixed-bed reactor. Songklanakarin J Sci Technol 30 (3): 393.

Wren J, Mitchell HK. 1959. Extraction methods and an investigation of Drosophila lipids. J Biol Chem 234 (11): 2823-2828.

Yang B, Wyman CE. 2008. Pretreatment: the key to unlocking low-cost cellulosic ethanol. Biofuels Bioprod Biorefin 2 (1): 26-40.

Yoshida F, Yamane T, Miyamoto Y. 1970. Oxygen absorption into oil-inwater emulsions. A study on hydrocarbon fermentors. Industr Eng Chem Proc Design Dev 9 (4): 570-577.

B I O D I V E R S IT A S Volume 16, Number 2, October 2015 Pages: 327-354

ISSN: 1412-033X E-ISSN: 2085-4722 DOI: 10.13057/biodiv/d160230

Review: Genetic diversity of local and exotic cattle and their crossbreeding impact on the quality of Indonesian cattle SUTARNO♥, AHMAD DWI SETYAWAN Department of Biology, Faculty of Mathematics and Natural Sciences, Sebelas Maret University. Jl. Ir. Sutami 36A Surakarta 57126, Central Java, Indonesia. Tel./Fax. +62-271-663375, email: nnsutarno@yahoo.com; volatileoils@gmail.com Manuscript received: 3 September 2015. Revision accepted: 30 October 2015.

Abstract. Sutarno, Setyawan AD. 2015. Genetic diversity of local and exotic cattle and their crossbreeding impact on the quality of Indonesian cattle. Biodiversita16: 327-354.Several species of cattle had been domesticated around the world, but only two species were farmed extensively, zebu cattle (Bos indicus) of the tropics and taurine cattle (Bos taurus) of the subtropical areas. Both of them had hundreds variety of offspring in the worlds. The third species of cattle that most widely farmed was Bali cattle (Bos javanicus), an indigenous cattle from Indonesia that was domesticated from wild banteng (Bos javanicus javanicus). Besides Bali cattle, Indonesia had also some local cattle as direct descendants of or as Crossbreeds of those three cattle. These cattle had been adapted to climatic conditions, feeds and diseases in Indonesia. Local zebu cattle that relatively pure were Peranakan Ongole (PO) or Ongole breeds and Sumba Ongole (SO). The main Crossbreed between zebu and Bali cattle was Madura cattle. The other well-known cattle of this were Aceh cattle, Pesisir cattle, Rancah cattle, Jabres cattle, Galekan cattle and Rambon cattle. Crossbreeds of taurine and zebu cattle generally produced calf that declining reproductive ability in generations. One fairly successful was Grati cattle or Holstein Freisian Indonesia (FHI) which was a crossbreed of Holstein Friesian and PO cattle. In recent decades, there were many crossbreed activities through artificial insemination between local cattle and taurine cattle to produce excellent beef cattle, mainly Simmental and Limousin.

This activity was carried out widely and evenly distributed throughout Indonesia. It was conducted on all local cattle breeds and was strongly supported by local farmers. This crossbreeding activity was feared to change the genetic diversity of local Indonesia cattle, where the descendants could not adapt to the climatic conditions, feeds and localized diseases; and the ability of reproduction continues to decline in generations, there fore the availability of parental cattle should be maintained continuously. This crossbreed had produced some new breeds, among others Simpo (Simmental x PO), Limpo (Limousin x PO), Simbal (Simmental x Bali cattle), Limbal (Limousin x Bali cattle), and Madrasin or Limad (Limousin x Madura cattle). Male offsprings were sterile, while female offsprings had lower reproductive capacity than of the parent’s. This lead to uncertainty over the guarantee of meeting the needs of protein (meat and milk) of Indonesian in the future, thus there was a need of regulation. On the other hand, in the grasslands of North Australia, the breeder had produced an eminent cattle breeds, namely Australian Commercial Cattle (ACC), from uncontrolled crossbreeds between different breedsof taurine and zebu cattle in the pasture, therefore this concerns ignored.

Key words: Crossbreeding, exotic cattle, genetic, local cattle, quality

INTRODUCTION Cattle raising activities have been widely practiced in Indonesia since immemorial time. In the era of Hindu kingdoms, cattle is commonly awarded by kings to the Brahmin priests as an expression of gratitude, as shown in some inscriptions, such as the inscription of Muara Kaman, Kutai, East Kalimantan (4th century AD), the inscription of Tugu, Jakarta (mid-5thcenturyAD), and the inscription of Dinaya, Malang, East Java (760 AD). Cattle have long been used as draught animals in Indonesia. A relief on the wall of Borobudur temple, Magelang, Central Java (750 AD) showed a pair of zebu cattle (Bos indicus) is being used for plowing, while in Sukuh, Karanganyar, Central Java (mid-15th century AD), it is found a relief of cattle without humps or Bali cattle (Bos javanicus) with a big bells on the neck (Java: klonengan) as a characteristic of draught animals (Sutarno and Setyawan 2015). In the Islamic era, the need for cattle is increasing as the time of Eid al-Adha celebration by slaughtering livestock.

Moreover, in some areas the fasting of Ramadan and Eid al-Fitr were also celebrated by consuming livestock, for example Meugang tradition of Aceh which has been traced back to Sultan Iskandar Muda (1607-1636), thus encouraging the development of local Aceh cattle (Yunita 2012).

Cattle are the most important livestock commodities as a source of milk (dairy cattle), meat and leather (beef cattle), as well as draught animals. Cattle meet most of the world's needs for meat (50%), leather (85%) and milk (95%) (Bappenas 2007; Umar 2009). In Indonesia, demand for meat and dairy cattle cannot be met from domestic stockbreeding, which can only fulfill approximately 75% and 20% of overall need respectively, so that Indonesia becomes a net importer of both commodities. From year to year, dependence on imports is increasing and without significant breakthrough, it is predicted that in the next 10 years the production of cattle in the country is only able to meet the half of needs. In the last three years (2013, 2014, 2015), before and after Eid al-Fitr is always turmoil in the

328

B I O D I V E R S IT A S 16 (2): 327-354, October 2015

domestic market related to the soaring price of beef cattle, due to lack of supplies. Demand for beef cattle increased because of the population growth, improved living standards, changing consumption patterns, and the presence of expatriates and foreign tourists who demand beef cattle with certain quality (DGLS 2010a; Khasrad and Ningrat 2010). The government has taken a long-term policy to achieve self-sufficiency in beef cattle based on domestic resources, but the effort is failed though it has been launched three times, in 2000, 2010, and 2014. The lack of breed quality, limited pastures and limited cattle feed are considered as the primary reason for the cause of this failure (DGLS 2010b; Mahbubi 2014).

This paper aims to review the genetic diversity of local and exotic cattle in Indonesia, the crossbreeds impact and conservation effort.

whilst the Bali cattle is relatively pure (Mohamed et al.

2009), except for Bali cattle in Malaysia which is a mixture of zebu and banteng with relatively balanced proportion (Nijman et al. 2003).

Domestication of the other cattle species was also conducted in Asia (Ho et al. 2008; Achilli et al. 2009). In Tibet, yak cattle (Bos grunniens) had been domesticated and able to adapt to high altitudes (Qiu et al. 2012) since c.a. 4500 BP (Payne and Hodges 1997). Gayal or mithun cattle (Bos frontalis) had been domesticated from wild gaur (Bos gaurus) (Uzzaman et al. 2014) on the border of northeast India, Bangladesh and Myanmar (Mason 1988; Payne and Hodges 1997). These species of Asia cattle hybridize with taurine and zebu cattle that are spreading more widely, resulting mixtures species that give a unique contribution to the world of livestock resources (Felius et al. 2014).

WORLDWIDE CATTLE DOMESTICATION INDONESIAN LOCAL CATTLE The domestication of wild banteng (Bos javanicus javanicus) into Bali cattle, which continue to be the main cattle in Indonesia until now, is a native of Indonesia's cultural heritage that should be preserved. The yielding of Bali cattle shows the potential of Indonesia to be an independent and sovereign country in terms of food. Cattle domestication process is mostly done in Europe and Asia but yields no sustainable offspring, except for only two species namely taurine cattle (Bos taurus) and zebu cattle (Bos indicus). Both are descendants of wild aurochs cattle (Bos primigenius), which is widespread in Asia, Europe, and North Africa at the end of the last glacial period (12,000 BP) (Felius et al. 2014). Taurine cattle domesticated between 10,300-10,800 BP at the border country of Turkey, Syria and Iraq (Helmer et al. 2005; Vigne 2011; Bollongino et al. 2012), while the zebu cattle domesticated in the Indus Valley on the desert edge of Mehrgarh, Baluchistan, Pakistan around 8000 BP (AjmoneMarsan et al. 2010; Chen et al. 2010). Domestication of species and a long history of migration, selection and adaptation have created a wide variety of breeds (Groeneveld et al. 2010). Based on the place of origin of domestication, the taurine cattle (without the hump) are sub-tropical cattle, with the main populations in Europe, North America and Australia. While, the zebu cattle (with the hump) are tropical cattle, with the largest population in India, Africa and Brazil. Each species of cattle have had hundreds of breeds, including the descent of its crossbreeds.

Bali cattle have been domesticated from wild banteng since c.a. 5000 BP (Payne and Hodges 1997). Bali cattle are the most successful domestication of cattle outside taurine and zebu cattle. When taurine and zebu cattle are the main world livestock, Bali cattle are the main livestock in Indonesia. However, the selection process of Bali cattle is relatively under-developed, that it has relatively same genetic as a wild banteng. Although, many Bali cattle is crossed with zebu cattle and, now, with taurine cattle, but the genetic proportion of its offspring is dominated by the exotic cattle, so it is no longer classified as Bali cattle,

Indonesian local cattle has experienced a selection of various pressures of wet tropical climate, and an adaptation to low quality of feed, local parasitic and diseases, so it is a new adaptive phenotypes (Sutarno 2006). Besides Bali cattle, Indonesia has also several local cattle which are direct descendants of the Indian zebu cattle, the result of crossbreeding between zebu and Bali cattle, as well as crossbreeding with taurine cattle which is introduced latter (Martojo 2003; Johari et al. 2007). Primary crossbreeds between zebu or taurine cattle with banteng (or Bali cattle) produce fertile female and male sterile breeds (Lenstra and Bradley 1999). The Indonesian local cattle are generally a hybrid of zebu cattle with Bali cattle. Kikkawa et al. (2003) and Mohamad et al. (2009) found mtDNA of banteng on Indonesian zebu cattle, especially Madura cattle (56%) and Galekan cattle (94%). While Nijman et al. (2003), based on analysis of mtDNA and other genes, showed that Bali cattle in Indonesia comes purely from a banteng, while Bali cattle in Malaysia is a mixture of zebu and banteng.

Some local cattle belonging to zebu group are Peranakan Ongole (PO) cattle in Java, Pesisir cattle in West Sumatra, Aceh cattle in Aceh, and Sumba Ongole cattle on the island of Sumba. India is the center of zebu cattle genes (Nozawa 1979). Local cattle deriving from crossbreeds between zebu and Bali cattle includes Madura cattle in Madura and surroundings, Jabres cattle in Brebes, Rancah cattle in Ciamis and surroundings, Rambon cattle in Bondowoso and surroundings and the rare Galekan cattle in Trenggalek. In Indonesia, there are also local cattle which are considered as a crossbreed of two exotic cattle, zebu and taurine, namely Grati cattle in Pasuruan and surroundings, and now are more commonly known as Holstein Friesian (FH) Indonesia, which is a cross between FH male and PO female (Blakely and Bade 1998; Williamson and Payne 1980; Johari et al. 2007). According to Sutarno et al. (2015), based on studies of DNA microsatellites, Madura cattle have most different genetic characteristics than Bali cattle population (of Lombok and Sumbawa) and zebu cattle population (Aceh cattle and PO

SUTARNO & SETYAWAN â&#x20AC;&#x201C; Genetic diversity of Indonesian cattle

cattle).

Bali cattle, PO cattle, and Madura cattle become a mainstay to meet the needs of meat in Indonesia, while the Holstein Friesian cattle become a mainstay to meet the needs of milk (Okumura et al. 2007). Beef cattle population in Indonesia is currently about 12.3 million (BPS 2014), and dairy cattle is about 500,000 (DGLSAH 2014). These cattle consist of Bali cattle (33.73%), PO cattle (23.88%), Madura cattle (5.16%), and others (13.45%) (DGLS 2010b). The main concentration of the population of cattle is in Java (45%), Sumatra (22%), Bali and Nusa Tenggara (13%), Sulawesi (13%), and the rest in other islands (7%).

The population of cattle is slightly decreased after the financial crisis at the end of 1990s, as many local cattle are consumed to replace the imported one. The consumption rate of local cattle exceeds the natural reproduction ability rate; there is a decrease in the number of calf born in the following years (Pamungkas et al. 2012).

Local cattle have proved that it can adapt to the local environment, including feed, water availability, climate and disease, but it generally has a lower productivity than the exotic cattle (ILRI 1995). Adapted animals have a production and reproduction regulating gene which are superior to environmental stress. Conservation of local cattle got a lot of challenges, especially since the rise of improving the calf quality by crossbreeding using frozen semen of exotic cattle, mainly Simmental and Limousin.

Hybrid offsprings are high favorite for breeders because it is relatively high in daily weight gaining, although it requires higher production costs (Sutarno 2006; Sullivan and Diwyanto 2007). The efforts of crossbreeds are relatively successful for the same species of cattle, such as zebu and zebu, or taurine and taurine, but in crossbreeds of different species, it will produce calves of sterile males and fertile females with the ability of reproduction decreasing from generation to generation, thus the breeders must provide a new breeding male and female from time to time.

The crossbreeding of local cattle with exotic cattle spreads widely without evaluation, control and ignoring the importance of local cattle as a unique germplasm. It is feared that it can lead to erosion of genetic resources towards extinction. Loss of important genes in cattle that have been locally adapted to local environmental conditions would be difficult, or even impossible, to be replaced. This has happened to many local cattle in India that have become extinct before it have been identified and utilized due to the many crossbreeds (Sodhi et al. 2006).

The weakness of cattle development in Indonesia is the poor quality of cattle genetics, lack of superior bulls, lack of farmersâ&#x20AC;&#x2122; ability in dealing with cattle breeding, and traditional method of stock raising (Atmakusuma et al.

2014). The development of local cattle is also facing challenges due to the rise of uncontrolled crossbreeding especially using artificial insemination methods and the pressures of other local cattle that are more superior, for example, the development of Pesisir cattle of West Sumatra is suppressed by superior Bali cattle. FAO (2000) has warned that livestock with the risk of extinction are in developing countries due to the high market demand, crossbreeding, breeds replacing and mechanization of

329

farming activities where the use of cattle as draught animals is decreased (Figure 1).

Bali Cattle Origin and distribution. Bali cattle (Bos javanicus) are the result of a direct domestication of wild banteng in Bali or Blambangan, East Java (MacHugh 1996; Verkaar et al. 2002; Martojo, 2003, 2012; Hardjosubroto 2004). Bali cattle spread widely throughout Indonesia, especially in South Sulawesi, Bali, East Nusa Tenggara, West Nusa Tenggara, Southeast Sulawesi and Lampung (Entwistle and Lindsay 2003; Sutarno 2010). These cattle are major genotypes in Eastern Indonesia (Pribadi et al. 2014). Bali cattle is not much raised in Central Java and West Java where the breeders prefers to raise goats (Capra hircus), which are an intermediary agent of malignant catarrhal, a deadly disease in Bali cattle calf. Bali cattle population is about 4.1 million (DGLS 2010b). These cattle are also found in northern Australia and Malaysia (Toelihere 2003).

In northern Australia, Bali cattle live in wild as a banteng.

They were from the 20 Bali cattle that were imported from Bali in 1849, and now the number is around 8,000-10,000 (Bradshaw and Brook 2007). In comparison to Bali cattle, the genetic purity of these cattle comes near to the genetic purity of wild banteng in Java, since Bali cattle is allegedly received genetic mixing of zebu cattle (and now taurine). In Malaysia, Bali cattle began to be developed on a large scale and replace the local cattle of Kedah-Kelantan that has low productivity (Somarny et al. 2015). Bali cattle are the ancestor of most local cattle breeds in Indonesia. In fact, PO cattle which were considered as pure zebu cattle also have a gene introgression of Bali cattle, as well as Pesisir and Aceh cattle. Cattle that clearly and phenotypically pick Bali cattle gene are Madura, Rambon, Galekan, Jabres and Rancah cattle. But these cattle are genetically more close to the zebu cattle (Mohamed et al. 2009).

Physical characteristics. Bali cattle has similar physical characteristics to a wild banteng (Handiwirawan and Subandriyo 2004), but banteng is larger and more aggressive (Martojo 2003, 2012). The study of genetic diversity in Bali cattle and banteng is still limited (Kikkawa et al. 1995, 2003; Namikawa 1981; Nijman et al. 2003; Verkaar et al. 2003). Bali cattle have a great frame and solid muscle; adult male can weigh 600-800 kg, while the female weigh is 500-600 kg (Martojo 2003). At the time of calf, cattleâ&#x20AC;&#x2122;s body is brick red or golden red. Meanwhile, when adult, female cattle remain red brick, while the male cattle change to blackish at the age of 12-18 months. There are white on all four legs, from the knee to toes, buttock is white with clear boundaries and oval with black on tail tip (Williamson and Payne 1980). They have no humps, a small wattle and compact body. It has wide head, short, flat forehead and standing ears. The female horn is short and small, and the male horn is long and large heading to the front upper side and taper, with a slender neck. It has deep chest with powerful legs (Pane 1991; Susilorini 2010).

Advantages and disadvantages. Bali cattle has a very high reproductive ability, able to give birth every year, able to adapt to the marginal environment with dry climates, able to digest low quality of forage for example during the

B I O D I V E R S IT A S 16 (2): 327-354, October 2015

330

A

B

C

D

E

F

G

H

I

J

K

L

M

N

O

SUTARNO & SETYAWAN â&#x20AC;&#x201C; Genetic diversity of Indonesian cattle

331

P

Q

R

S

T

U

V

W

X

Y

Z

AA

AB

AC

AD

B I O D I V E R S IT A S 16 (2): 327-354, October 2015

332

AE

AF

AG

AH

AI

AJ

AK

AL

AM

Figure 1.The diversity of cattle in Indonesia. A-C. Banteng (males, females, herds); D-F. Bali cattle (bulls, cows, herds); G-I. Peranakan Ongole cattle (bulls, cows, herds); J-L. Madura cattle (bulls, cows, herds); M-O. Aceh cattle (bulls, cows, herds); P-R. Pesisir cattle (male, puppies, herds); S. Jabres cattle; T. Rancah cattle; U. Rambon-Bali cattle; V. Rambon-Madura cattle; W. Galekan cattle; X. Brahman Cross cattle; Y-AA. Brahman cattle (male, female, herds); AB-AD. Simmental cattle (bulls, cows, herds); AE-AG. Limousine cattle (bulls, cows, herds); AH-AJ. Holstein Friesian cattle (bulls, cows, herds); AK-AM. The appearance of various types of cattle at the feedlot enterprise (feedlofter) originating from northern Australia

dry season and able to be immediately restored to its original state if there is enough fodder; it can be kept as draught animals or beef cattle. Carcass percentage is higher than zebu and taurine cattle, with high-quality of low-fat beef. The quality of skin is good and rather thin. Bali cattle is the most suitable for farming in the traditional production system with low-input and high environmental stress which is widely practiced by Indonesian breeders (Wirdahayati 1994; Copland 1996; Diwyanto and Praharani 2010; Sutarno 2010; Zulkharnaim et al. 2010 ; Noor et al.

2011). Bali cattle have various disadvantages, namely slow growth, low milk production that lead to the high calf mortality (Susilorini 2010). These cattle are known as resistant to many diseases and parasites, but there are two very deadly diseases, namely malignant catarrhal that attack calves, and jembrana viral disease that attacks the brain (Budiarso and Hardjosworo 1976). Malignant

catarrhal is detected in Denpasar, Banyuwangi, Mataram and Kendari (Damayanti 1995). First, jembrana viral disease infected the population on the island of Bali, and is allegedly as a result of long-term isolation that causes a lot of inbreeding and produce low resilient offspring (Tenaya 2010; Wilcox et al. 1992, 1995). It is quite alarming, as in some other places, Bali cattle has lower genetic variability than the one in Bali, for example, on the island of Lombok (Winaya et al. 2009). Jembrana viral disease has also been detected in Bali cattle population in West Sumatra, Jambi, Riau and Riau Islands. Previously, the disease has been successfully handled in Bali, East Java and Lampung (BPPV Bukittinggi 2013).

Breeding and conservation. Bali cattle have not experienced an advanced selection as zebu and taurine cattle have. However, the genetic purity of Bali cattle is now threatened by negative selection and crossbreeding.

SUTARNO & SETYAWAN â&#x20AC;&#x201C; Genetic diversity of Indonesian cattle

A

B

333

C

Figure 2. The quality depletion of Bali cattle from Kupang due to negative selection of poor quality cows mating. A. The bulls; B. The cows; C. Cattle herds.

Negative selection on the Timor island by shipping of highquality cattle and let the low quality ones to breed, causing the cattleâ&#x20AC;&#x2122;s weight become progressively low (Wirdahayati 2010; Sudarma 2013)(Figure 2). The crossbreeding begins to be done even on the island of Bali, especially with frozen semen of Simmental and Limousin cattle. In the era of Klungkung kingdom to the colonial period, the island was set specifically for the development of Bali cattle. But today, specific areas for Bali cattle development is only on a small island of Nusa Penida (DGLSAH 2015), while in Bali Island, crossbreeding of Bali cattle with other cattle breeds has been allowed. However, there is a Bali Governor Regulation No. 45/2004 and Regional Regulation of Bali Province No. 2/2003 which prohibits shipping female breeds of Bali cattle out of Bali province. Genetic purity of banteng as a source domestication of Bali cattle is also threatened by interbreeding. Utilization zone of national parks in Baluran, Alas Purwo and Meru Betiri which are natural habitat for banteng, are used by local residents as domestic cattle grazing, particularly in TN Baluran (Tempo 27.6.2013), so there is possibility of wild banteng mating to domestic cattle and disturbing the genetic purity. The Indonesian government has made a banteng conservation action plan (Regulation of the Minister of Forestry No. P.58/Menhut-II/2011), but the results have not been much of an effect. In addition to the island of Nusa Penida, Bali cattle breeding are also concentrated in Siak, Central Lombok, Barito Kuala, Barru and West Pasaman districts (DGLSAH 2015).

Peranakan Ongole and Sumba Ongole cattle Origin and distribution. Zebu cattle of Indonesia has been known for centuries as Java cattle, but the quality is steadily declining due to lack of new genes input, so at the early of the 19th century, it was brought here different breeds of the Indian zebu cattle for genetic improvement and it gave satisfactory results. In the early of the 20th century, the government took the initiative to bring Ongole cattle to Sumba Island and were able to breed and adapt well, they were known as Sumba Ongole cattle (Hardjosubroto 2004). Peranakan Ongole (PO) (Bos indicus) or Benggala is a crossbreed of uncontrolled mating of Java cattle and Sumba Ongole cattle (Suyadi et al.

2014). PO cattle population is estimated at about 2,9 million and almost 90% is in Java (DGLS 2003,2010b).

Physical characteristics. PO cattle has a white or gray colored skin, fan tail and fur around the eyes is black, short curved shape of the head, short horns, long hanging ears, and a rather large belly. On male cattle, sometimes, there is black splotches on the knees, big bright eyes encircled with black spot about 1 cm from the eye; big body, big hump, short neck, long legs, strong muscle, wattle loose, hanging from the bottom of the head, neck to stomach. Male cattle can reach a weight of about 600 kg and female cattle are 450 kg. PO cattle weight gain range between 0.4-0.8 kg per day, but in unfavorable conditions only reached 0.25 kg per day (Wiyatna et al. 2012). Meanwhile, SO cattle had reached the body weight gain of 1.18 kg per day, the percentage of carcass is more than 50% and meat production had reached 77% (Ngadiyono 1995).

Advantages and disadvantages. PO cattle are known as beef cattle and draught cattle. They are suitable as draught animals due to a big and strong body, docile and quiet, tolerant to heat, have high adaptability over different environmental conditions, able to grow in limited forage conditions, and high reproductive activity. The female quickly returned to normal condition after giving birth.

However, the percentage of carcass is generally lower than other Indonesian local cattle.

Breeding and conservation. In addition to PO cattle and SO cattle, in Indonesia it is also developed other species of zebu cattle, particularly breeds of Brahman and Brahman Cross, which is bigger than the PO. Pure PO cattle began rare because many breeders cross them with Brahman cattle. Their mating produces fertile calf and usually is also called PO because of its smaller size. In Kebumen, Central Java, PO cattle are also known as Madras cattle which are the origin of zebu cattle in East India. In Kebumen, zebu cattle genetic improvement efforts have been done long before Ongolisation program in 1930s, therefore the PO cattle (Madras) in this region are known to have qualities like pure Ongole cattle (Utomo et al. 2015). Kebumen, Gunungkidul and South Lampung have been chosen as the breeding center of PO cattle (DGLSAH 2015).

334

B I O D I V E R S IT A S 16 (2): 327-354, October 2015

Madura cattle Origin and distribution. Madura cattle (Bos javanicus x Bos indicus) are the result of a crossbreed between Bali cattle and zebu cattle from India in the island of Madura, but the time is unknown. Some sources say that the process occurs about 1,500 years ago (Meijer 1962; NRC 1983; Nijman et al. 2003). Given the Madura cattle also dominant on the northern coastal region of East Java where there are many Madurese immigrants, then certainly these cattle were already present before the migration. The area is experiencing depopulation of Javanese because of war continuing from the 15th to 18th centuries. The Madurese fill these abandoned lands because the previous owners are victims of war or escape. At the beginning of the 20th century, Madura cattle are distributed to Flores and East Kalimantan. But, they are replaced by Bali cattle which are brought in later for the better quality (Omerling 1957; Hardjosubroto 2004). In 2002, the total population of Madura cattle is approximately 900,000 (DGLS 2003). In 2008 on the island of Madura, the population is approximately 400,000 (Office of Animal Husbandry East Java Province 2009), and in 2010, it is about 635,000(DGLS 2010b).

Physical characteristics. Madura cattle is brick red or brownish red with distinctive white markings on the back and below. It has small horns, short and heading outside.

The uniformity of breeding is developed through selection conducted by the breeders.

Advantages and disadvantages. Madura cattle has good growth in poor quality of forage, the percentage of carcasses is high with meat quality is good; it has high adaptability to tropical environments, and can run fast, so it is usually used for racing (karapan), and have a good body appearance, so it is also used as displayed cattle (sonok).

Karapan cattle require high energy metabolism to get physical strength, hard work of skeletal muscle, and the aggressiveness. On the other hand, sonok cattle need to withstand muscle framework stretching and emotions (tamed). Cattle that do not have these properties are categorized as common beef cattle. Madura cattle breeders keep them as draught animals, life savings, producer of organic fertilizer, source of revenue and for the karapan and sonok cattle (Siswijono et al. 2010). Compared to Bali cattle, Madura cattle are relatively resistant to jembrana viral diseases (Suwitri et al. 2008).

Breeding and conservation. Karapan race and sonok festival are instrument of Madura cattle selection, which can only be attended by the selected cattle with excellent performance and condition. It can be affected by genetic and environmental factors, including feed and health. The selection of cattle having performance appropriate to the tastes of society needs to be considered, if it affects variations in genes involved in energy metabolism or not (Siswijono et al. 2010; Febriana et al. 2015). In the colonial era, Madura Island is specialized for Madura cattle development and the introduction of other cattle breeds is prohibited. This was stated in Staatsblad (Gazetted) No. 226/1923, No. 57/1934, and No. 115/1937. Even it implied in Indonesian Law No. 18/2009, on Animal Husbandry and Animal Health. However, development of other cattle is

allowed in the later. In 1957, the crossbreeds of Madura cattle with dairy cattle Red Danish (a taurine cattle) was carried out, but the calves are less than desirable, and in recent decades Madura cattle are crossed with Limousin through artificial insemination with the results of considerable interest, because have larger body size and higher selling price (Siswijono et al. 2010). The crossbreeds of Madura and Limousin cattle are the belle for traditional breeders. This process is carried out directly in the field and is not controlled exclusively, so that in the long term, there is a concern that it will change the genetic composition of Madura cattle and affect the durability of the dry climate and limited fodder. Furthermore, it can disturb the continuing of local culture of karapan and sonok cattle (Widi et al. 2013) as well as reduce the ability of self-sufficiency in beef cattle. Sapudi Island is pointed as pure Madura cattle conservation area in order to avoid the uncontrolled genetic changes (Decree of the East Java Governor No. 188/Kpts/013/2010; DGLSAH 2015).

However, in this island are also reared PO cattle and its breed (Kutsiyah 2012).

Aceh cattle Origin and distribution. Aceh cattle (Bos indicus) are a small-sized local cattle developed in Aceh (Martojo 2003; Dahlanuddin et al. 2003). Aceh cattle allegedly were imported by Indian merchants in the past (Abdullah et al.

2007).

Physical characteristics. Aceh cattle are predominantly red-brownish for male and red brick for female; the color around the eyes, the inner ear and upper lip is whitish, neck is darker in males; it has a dorsal blackish brownish stripe, red brick hamstrings, light brownish buttocks, whitish legs, black tail tip, generally concave face, generally concave back, horn leads to the side and curved upwards, small ears leading to the side and do not droop. Body weight is 253 Âą 65 kg of male, 148 Âą 37 kg of female. Carcass percentage is 49-51%. Aceh cattle have good adaptability, employability and disease resistance. They are very productive, with the parent fertility of 86-90%, birth rate of 65-85%, age of puberty of 300-390 days, estrus cycle of 18-20 days and 275-282 days old pregnancy (Abdullah et al. 2007).

Advantages and disadvantages. Aceh cattle are used as beef cattle and draught animals. Most local farmers utilize Aceh cattle to plow the field. Aceh cattle breeding business is generally done by individuals, there has been no industrial-scale livestock enterprises (Abdullah et al. 2007; 2008). Although relatively small in size, some Aceh cattle have the ability to give birth to twin calf.

Breeding and conservation. In Indrapuri, Aceh, there is a special institution that develops Aceh cattle breeding.

Raya Island of Aceh Jaya is designated as specific areas for the breeding and development of Aceh cattle (DGLSAH 2015).

Pesisir cattle Origin and distribution. Pesisir cattle (Bos indicus) are local cattle breeds that have the smallest body size.

These cattle are widely kept in Pesisir Selatan district, and

SUTARNO & SETYAWAN – Genetic diversity of Indonesian cattle

on a small portion in the districts of Padang Pariaman and Agam, West Sumatra (Anwar 2004; Hosen 2006).

Population of Pesisir cattle continues to decline. In Pesisir Selatan, it only reached 76,111 heads in 2011 (OAHAHP Pesisir Selatan District 2012). The decline of Pesisir cattle population is allegedly associated with high slaughtering of productive livestock, forage limitations, pasture depreciation, and decreased genetic quality (Adrial 2010).

Physical characteristics. Pesisir cattle have small bodies, short stature, slender legs, small hump, and benign.

Male cattle has a short head, short and large neck, wide at the back of the neck, a big hump, short and round steering.

Female cattle has a rather long head and a thin, sloping tail, short and thin, small horns and head for outside such as goat horns (Saladin 1983). Adult male cattle (age 4-6 years) has only a weight of 160 kg (Adrial 2010). The high diversity of skin color with a single pattern and is grouped into five dominant colors, namely red brick (34.3%) yellow (25.5%), chocolate (20%), black (10.9%), and white (9.3%) (Anwar 2004).

Advantages and disadvantages. Pesisir cattle have a high reproductive efficiency (Sarbaini 2004), high birth rates, birth weight of 14-15 kg, average daily weight gain from birth to calf about 0.32 to 0.42 kg per day (Saladin 1983). Carcass percentage is 50.6%. They are able to survive in adverse environmental conditions and poor forage. The ability to convert fibrous feed into meat is high (Saladin 1983). Pesisir cattle traditionally are maintained by relying on pasture grass, vacant lots, and rain fed; are resistant to disease and able to adapt to a tropical environment (Hendri 2013). Improvement in forage quality can increase the growth rate and carcass percentage, although it will increase the percentage of fat (Khasrad and Ningrat 2010).

Breeding and conservation. Development of the Pesisir cattle is exposed to the genetic deterioration. Body weight and body size of these cattle are much smaller than before. For 22 years (1982-2004), the body weight and body size of Pesisir cattle have decreased around 35%. For 25 years (1980-2005), body weight of adult male of Pesisir cattle have decreased from 275 kg to 237.5 kg, while female cattle have decreased from 256 to 172 kg (Sulin 2008). Today, breeders prefer exotic cattle such as Brahman and Simmental, as well as Bali cattle, especially since the government introduces thousands of Bali cattle to West Sumatra since 1985 (Wilcox et al. 1996; Mariani 2013) and introduce artificial insemination later. In 2009, Pesisir cattle population is still dominant, reaching 70% of cattle population, but in 2011 it is only 25% (Hendri 2013).

Since there are no Pesisir cattle conservation efforts, in the long term, these breeds will be allegedly replaced by Bali cattle which are more superior. Pasaman Barat, one of the original distributions of Pesisir cattle, was chosen to be the center of Bali cattle breeding (DGLSAH 2015). However, in Padang Mengatas, District of Limapuluhkota, there are breeding of various cattle breeds, including Pesisir cattle.

Jabres cattle Origin and distribution. Jabres cattle (Bos javanicus x Bos indicus) (Jabres = Java Brebes) are allegedly to be a

335

crossbreed between Madura cattle or Bali cattle with Peranakan Ongole cattle (Minister of Agriculture Decree No. 2842/Kpts/LB.430/8/2012). This cattle thrive in the highlands of southern Brebes, Central Java at an altitude800 m asl. (Lestari 2012). According to Munadi (2010), Jabres cattle are found in five sub-districts, namely Bantarkawung (5,757 heads), Salem (543 heads), Banjarharjo (1,994 heads), Ketanggungan (2,900 heads), and Larangan (890 heads).

Physical characteristics. Jabres cattle have similar characteristics to Bali cattle, but Bali cattle has a white color on the legs and buttocks that contrasts with the body color of red-brownish, on the Jabres cattle, that color becomes gradation and has no visible boundary between red-brownish and white. The color varies from brownish, white brownish, white, dark-brownish and black; white feet, white upper lip, white lower lip; in the head, it is often found signs of a small white rhombus, black tip. The cattle have rump, white hind legs, and the black stripe from the back to the tail. Male cattle horns curved upward, the female curved downward. In general, there is no hump.

Body shape is slim and compact with dense flesh structure.

Male cattle body weight is 350 ± 25 kg, female cattle is 286 ± 20 kg. Fertility of parent is 82-85%, with 40-85% of birth rate and estrus cycles of 18-24 days, pregnancy period of 9-10 months, 21-28 months of the first estrus, first birth age of 30-36 months (Decree of the Minister of Agriculture No. 2842/Kpts/LB.430/8/2012; Lestari 2012).

Advantages and disadvantages. Jabres cattle have the ability to work and high adaptability to extreme climate conditions, are able to utilize lower quality feed, not susceptible to disease, insect-resistant, and have good reproducibility. One female of Jabres cattle able to give birth up to 15-20 times; with calving interval is only 12 months. It can be pregnant by 45 days after birth. The average birth weight is 16 kg to facilitate calving, whereas the weight of adult males ranged between 195-269 kg and females 168-296 kg. Cattle meat has a solid structure; carcass percentage can reach 52% (Lestari 2012).

Breeding and conservation. Jabres cattle traditionally are maintained with fellow cattle grazing systems (Adiwinarti et al. 2011; Lestari 2012). Mating system of Jabres cattle occur naturally. Breeding through artificial insemination with exotic cattle have not done for reasons of cost, so that the genetic purity is relatively maintained.

Jabres cattle are the only local cattle of Central Java, and are chosen as a local cattle based on the Decree of the Ministry of Agriculture No. 2842/Kpts/LB.430/8/2012.

Rambon cattle Origin and distribution. Rambon cattle (Bos javanicus x Bos indicus) are local cattle in the eastern part of East Java, especially in Bondowoso, Situbondo, Jember and Banyuwangi. In the past, there were three cattle breeds in this area, namely PO cattle, Madura cattle and Bali cattle.

Rambon cattle are natural crossbreeding of the three breeds so that their genetic composition is quite diverse (Susilawati et al. 2002; Susilawati 2004). Rambon cattle living in Situbondo and Bondowoso have characteristics which are predominant to Madura cattle and PO, while

336

B I O D I V E R S IT A S 16 (2): 327-354, October 2015

Rambon cattle in Jember and Banyuwangi have characteristics which are predominant to Bali cattle and PO (Susilawati et al. 2002; Susilawati 2004). It is strongly associated with the geopolitical history of the region in the past. Until the 18th century, there was still existing Hindu kingdom of Blambangan in Banyuwangi which periodically obtains the influence of Bali (Margana 2007).

The Balinese allegedly bring in Bali cattle from Bali island, but the other opinion says that Bali cattle were domesticated in this region since, until now, there is still a wild banteng, such as in Baluran National Park, Alas Purwo National Park and Meru Betiri National Park. In the 18th century, the region fell to the kingdom of Mataram and Madurese began migrating mainly on the north coast, bringing Madura cattle with them. Bali cattle are dominant in the south and Madura cattle dominate the north area.

Consequently, the breeds of Rambon cattle in the north tend to resemble Madura cattle, while the cattle in the southern part resemble to Bali cattle. According to Amin (2010), Rambon cattle of Banyuwangi experienced natural crossbreeding with Bali cattle, PO cattle and Brahman, and underwent cross through artificial insemination with Limousin, Simmental, Aberdeen Angus and Santa Gertrudis cattle.

Physical characteristics. Rambon cattle have a weight of about 300-400 kg. Rambon cattle in Situbondo and Bondowoso has a dominant varied skin color; brick red, red-brownish, red without clear color boundary; white rump; long tail with black fur; diverse foot fur, clear white, white, red brick; diverse shape of backs, straight or curved, with or without the back line; varies direction of the horn, forwards, upwards, sideways and backwards; the existence of hump varied, with hump, no hump and unclear hump.

On the other hand, Rambon cattle in Banyuwangi and Jember are predominantly of red brick; thin wattle; black back line; white leg fur; specific white rump; the horn direction is to the side; tail with black fur; no hump (Susilawati et al. 2002; Susilawati 2004).

Advantages and disadvantages. Rambon cattle are composite that have high resistance to climate, feed and disease in the eastern of East Java. However, as the descendants of Bali cattle, these cattle are not resistant to jembrana viral diseases, so the local government has banned the cattle-shipping from Bali to East Java (Circular of East Java Governor No. 524/8838/023/2010).

Breeding and conservation. Rambon cattle are a natural crossbreeding and need no efforts for conservation.

Rambon cattle experience a lot of genetic mixing, including artificial insemination with Simmental and Limousin as the main stud, so there are dozens breeds of these cattle (Amin 2010).

Rancah cattle Origin and distribution. Rancah cattle or Pasundan cattle (Bos javanicus x Bos indicus) are local cattle in West Java. The naming is based on the location of initial development, namely Rancah, Ciamis, West Java. These cattle are often called kacang (bean) cattle because it is relative small in size (Hilmia et al. 2013). Distribution area includes Ciamis, Tasikmalaya, Pangandaran, Garut,

Cianjur, Sukabumi, Purwakarta, Majalengka and Kuningan (Indrijani et al. 2012).

Physical characteristics. Rancah cattle have physical characteristics as Madura cattle and Bali cattle. The females have no hump; body size is relatively small, mostly red brick and white on the pelvis and on the four lower legs (tarsus and carpus) with no clear restrictions. There is a stripe along the back with the older color of the dominant colors. Male cattle are similar to females, but mostly with darker body color. Some Rancah cattle male may experience changes in color from brick red to black according to sexual maturity (such as Bali cattle).

Rectangular shape with long small legs and has a short horn but not uniform and varies from small to large. Body size is with an average shoulder height of 115 cm to 109 cm in males and females. Male cattle body weight on average 240 kg and 220 kg in females (Payne and Rollinson 1973; Huitema 1986; Decree of the Minister of Agriculture No. 1051/Kpts/SR.120/10/2014). In Rancah, Ciamis, these cattle are relatively small compared to other breeds which are also kept by cattle breeders, such as PO, Simpo and Limpo (Derajat 2014).

Advantages and disadvantages. Their behavior is not wild and easy to adapt to the surrounding environment.

Reproductive ability is quite efficient; it can be re pregnant within 2.5-5 months after birth (Hilmia et al. 2013). They have superior carcass percentage reaching 50% of the live weight, the fat content in meat is low, the meat is more abrasive, does not contain a lot of water; the meat color is brighter because of the high pigment content, so the price is more expensive than imported beef cattle. In addition, these cattle have high resistant to tropical diseases; practicality in taking care of; resistant to extreme weather. Rancah cattle growth is relatively slow, although it can live with a low quality feed, but the fostering costs are much cheaper, about 25-30% of crossbreed cattle.

Breeding and conservation. Pure Rancah cattle populations have decreased, there were only about 3001000 heads, their existence is marginalized by other cattle.

By 2015, at Rancah Animal Market, 70 cattle are sold every day, but only 30% which is a Rancah cattle or its crossbreed. The decreasing of Rancah cattle population leads to an increase of inbreeding so that it lowers the quality of these cattle. In 1990, one of Rancah cattle could produce 500-700 kg of carcass, but at present, it is only able to produce 300-350 kg of meat carcasses. Genetic improvement efforts to restore the quality of Rancah cattle as in the past are relatively difficult, because of the difficulty in finding good (pure) quality Rancah cattle. In addition, these efforts require a long time commitment (about 25 years), high cost and there is no serious institution that handles Rancah cattle breeding, all produced naturally to breeders. This genetic decline is responded by breeders by crossing it with other local cattle, especially PO cattle. In 2014, there were 52,540 heads of Rancah cattle, but it is mostly the result of crossbreeding with other local cattle. Artificial insemination is also conducted intensively in this region, causing introgression from other cattle gene (Hilmia et al. 2013). Genetic improvement can be done by inserting the wild banteng

SUTARNO & SETYAWAN â&#x20AC;&#x201C; Genetic diversity of Indonesian cattle

gene back to Rancah cattle. These species still found in West Java, namely in Leuweng Sancang forest, Garut. The mating is expected to restore the performance of Rancah cattle as the original which is more robust and meaty. In addition, certain areas need to be protected since it is the source of Rancah cattle breeds, mostly scattered in the forest area in the district of Ciamis, Pangandaran, Garut and Cianjur. The protection can be done by, for example, banning Rancah cattle interbreed with other breeds of cattle. It should also be supported by breeding policies so that the quality of cattle is maintained well, such as sperm banks and embryo transfer. Rancah cattle have been classified as newest Indonesian local cattle based on Decree of the Minister of Agriculture No. 1051/Kpts/SR.120/10/2014.

Galekan cattle Origin and distribution. Galekan cattle (Bos javanicus x Bos indicus) are one of the cattle germplasm which needs to be conserved due to a sharp population decline. This cattle breed is allegedly as a crossbreed of Java(PO) cattle and Bali cattle.

Physical characteristics. Skin color is light brownish, dark brownish to blackish red brick, and while white or light brownish on the buttocks and the edge of wattles with an undefined border, lower legs are white with defined borders. Tail is long with black hair; has a dark eye circles and straight back striped with black dorsal stripe. These cattle are humped and horned with black striped ears and long little horn which initially came out sideways, then out onto the front. Habitat is in dry lowland usually grazing in the seashore, 66-322 kg body weight; performance is 3-5 months of anoestrus post partus; services per conception are 1.3 times and calving interval is 14-18 months (Aryogi and Romjali 2009).

Advantages and disadvantages. Galekan cattle have a larger body size than most of the local cattle, thus it becomes popular beef cattle that it is to threaten its sustainability.

Breeding and conservation. Galekan cattle are local cattle from Trenggalek, East Java. Galekan cattle belong to type of superior cattle, but its presence is very critical because of being pressured by the development of PO cattle breeding and from new species of cattle that comes out from artificial insemination. The continuous natural processes of crossbreeding with PO cattle cause genetic purity to be blurred and difficulty to identify the descendants as Galekan cattle breeds. At this time, the number of pure Galekan cattle is in estimation of 20-500 heads. These cattle have distribution in coastal area of Trenggalek district, East Java (Aryogi and Romjali 2009).

Grati cattle (FH Indonesia) Origin and distribution. Grati cattle (Bos taurus x Bos indicus) are the only local dairy cattle that are still raised by breeders. At the beginning of the 20th century, various taurine dairy cattle were imported into Grati, Pasuruan and were mated with local cattle, to get dairy cattle that are resistant to tropical climate (Sudono et al. 2003; Siregar 1995; Soehadji 2009). But from the physical appearance,

337

Grati cattle are the result of a mating of males FH cattle with PO females. These cattle have gained international recognition as local dairy cattle of Indonesia (Payne 1970).

These cattle were once widely kept in highland of Pasuruan and Malang (Pujon, Nongkojajar, Batu and surroundings) (AAK 1995), but the quality is declining and a back crossbreed of a pure FH male cattle with PO females needs to be done. Grati cattle are now known by the name of FH Indonesia (FHI). Unlike its predecessor whom quality is steadily declining and is abandoned by many breeders, FHI cattle are still being developed and the semen is widely used for artificial insemination program (BBIBS 2015).

The population of old Grati cattle had reached less than 10,000, while the number of new Grati cattle (FHI) has not been recorded (Sariubang1992; DGLS 2003).

Physical characteristics. Grati cattle has a color similar to the FH cattle, namely striped black and white skin, but not as bright as FH, on the forehead are white triangles and on the chest, lower abdomen, tail and legs are white; wide long and straight head, small and short horns heading to the front; body size and milk production is lower than FH. Advantages and disadvantages. At first, Grati dairy cattle were able to produce milk with average of 15 liters per day, but since there is no further genetic improvement, milk production capacity has decreased to only 12.3 liters per day with lactation period of 9 months. These cattle are able to adapt to the hot tropical environments, and are easily controlled, docile and quiet. With intensive feeding, weight can increase to 0.9 kg per day (Syarif and Harianto 2011). Grati cattle on the plateau show better yields than the one in the lowlands (Ratnawati et al. 2008).

Breeding and conservation. Grati cattle will experience a loss of quality, especially milk production, in line with the increasing generation, so FH male cattle is always needed to maintain the quality.

EXSOTIC LIVESTOKS In 1970-1980, various zebu and taurine cattle breeds live or their frozen semen were introduced from Europe, USA, Australia and New Zealand and crossed with the local cattle. Zebu cattle breeds imported mainly Brahman and Brahman Cross, while the breeds of taurine cattle imported mainly Simmental, Limousin, Holstein Friesian, and the Australian Commercial Cross (ACC). The imported cattle have very high daily body weight gain, but it is not suitable to be maintained in hot tropical regions, except for Brahman and Brahman Cross. In Indonesia, there are also several other exotic cattle, but not much developed. Since the 1990s, the production of beef cattle in the country is insufficient and each year continues to increase imports of beef cattle, mainly from Australia and the United States. In the end, imported feeder cattle to be fattened mainly Brahman Cross and the Australian Commercial Cross breeds of Australia. By 2015, as many as 650,000 head of Australian cattle entry in Indonesian feedlofter, unfortunately these cattle lasted only 3-6 months in fattening and slaughter, not bred. Today, often found

338

B I O D I V E R S IT A S 16 (2): 327-354, October 2015

crossbreeds between taurine cattle breeds of Simmental and Limousin with local cattle, especially with Peranakan Ongole, through artificial insemination (Pamungkas et al.

2012). However, this breeds has not been naturalized well where pregnancy process almost through artificial insemination, produce offspring of male sterile and fertile females, but steadily declining reproduction from generation to generation. In the long term, this concern will change the genetic composition of local cattle Indonesia (Putro 2009).

Friesian Holstein Friesian Holstein (FH) or Holstein Friesian (Bos taurus) have been developed since the 13th century in the Netherlands (North Holland and Friesland) and Germany (Schleswig-Holstein). A century after the breeding effort produced the best dairy cattle in the world in typical black and white colors, this color is preferred than the original brownish color that is also found in this breeds. In Indonesia, the first FH cattle imported from the Netherlands in the 19th century, the next imported cattle came from Australia, New Zealand, USA, Japan and Canada. These cattle have a good performance in producing milk and meat, and have good reproducibility.

These cattle are generally maintained in the highlands of Java, at an altitude of 700 m asl., but its crossbreeds with PO can live at an altitude of 300 m asl. In 2002, the population of FH cattle in Indonesia was approximately 354,000 heads (DGLS2003) and now about 500,000 heads (DGLSAH 2014). This stock is generally a relatively pure Holstein Friesian breeds, because in descendant of FH cattle, the production of milk and beef are far less than of pure breeds. However, there is still an offer of FH cattle descendant as the result of crossbreeding between FH cattle males and PO cattle females. These cattle was formerly known as Grati cattle, but is now named Indonesian FH cattle. These breeds have high genetic quality i.e. high milk production (about 20 liters per day) and have high adaptability to tropical environment, birth weight average of 35 kg and have a rapid growth, giving birth ability at the age of around 25 months, with a calving interval of about 12.6 months. Pure FH cattle are generally black and white patterns, sometimes red with white streaks and clear color boundaries. The head is long, wide, and straight, with relatively short horns and curved toward the front (Sudono et al. 2003; Siregar 1995); Mouth of FH cattle is wide, nostrils are wide open, powerful jaws, bright eyes, medium ears, wide forehead, long and thin neck; the location of the shoulder is a good deal on the chest wall and forming relationships neatly with the body, strong back and flat with vertebrae associated in good way, long and wide steering, rectangle, short nails with a good circle, low heels with flat palms, big udder and hanging down at the back of belly between the thighs (Samad and Soeradji 1990).

Simmental Simmental cattle (Bos taurus) are originated from Simme valley, Switzerland. These cattle have been developed since the 13th century, and became the female broodstock for various newer breeds of cattle. In 1985,

Indonesia got live cattle and frozen semen of Simmental from Australia and New Zealand. Simmental cattle are subtropical cattle. In Indonesia, the pure breeds are only being kept in government-owned research or large breeder located in the highlands to take the semen. Stocky and muscular body shape, a very good muscle development; high carcass yield with less fat, adultâ&#x20AC;&#x2122;s body weight can reach over 1,000 kg. Simmental cattle of the United States are black due to selection, but the breeds developed in Indonesia is yellow-brownish or red face, knees down and the tail tip are white as the original characteristics of this breeds. In Indonesia, it is only used as beef cattle and many crossed with the local cattle through artificial insemination, especially with Peranakan Ongole cattle, but also Madura cattle, Bali cattle, and even FH cattle. The result of crossbreeds male is preferred because it grows faster, while female calf less satisfactory growth and yield little milk. At the age of 2.5 years the weight has reached 1,000 kg.

Artificial insemination performed directly in the field and produce offspring with untested ability to adapt to the climate, feed and local diseases. But breeders like this business because young cattle are having a larger size and faster growth than the local cattle, and it continues. In the long term this needs attention due to genetic changes in local cattle of Indonesia.

Limousin Limousin cattle (Bos taurus) that originated from Limousine and Marche, France have been developed since the 17th century. These cattle have a long, large, compact body, as well as a large chest, shallow ribs, thick and fleshy, with a pattern of meat better than Simmental. Its eyes are sharp; well-built legs. In males, the horns grow out and slightly curved. Its skin is dark red, brownish, or yellow rather gray, but white around the udder and the knee down and the color around the eyes are lighter. At this time, it has been developed Limousin cattle without horns and black. Male cattle weights can reach 1400 kg, while females 850 kg. The productive period of female cattle is between 10-12 years old. They are the most rapid cattle in weight gain, i.e. 1.1 kg per day. Because they come from the sub-tropical climate, they are only suitable to be maintained in the highlands that have a high rainfall. These cattle are resistant to attacks of various diseases.

Worldwide, the cattle are widely used for crossbreeding with various other breeds of cattle. In Indonesia, the cattle semen is used for insemination in local cattle, especially PO cattle, even with Brahman cattle.

Brahman and Brahman Cross (BC) Brahman Cross cattle (Bos indicus x Bos taurus) are the result of crossbreeds between zebu cattle of Brahman breeds with some taurine cattle breeds in Australia.

Brahman breeds were first developed in the United States since 1849 and became genetic sources for some new breeds. Brahman cattle have a large body, long and deep, humped over the shoulders; and the loose-skinned, wattle bark from the lower jaw to the tip of the front chest with many folds. Elongated head, large ears and a pointed-toe hang. It has big thighs, thick and loose skin. The skin color

SUTARNO & SETYAWAN â&#x20AC;&#x201C; Genetic diversity of Indonesian cattle

is varied, generally white and gray, but there are also black, brownish, red, yellow, and striped. These cattle are the best pieces to be developed in the lowlands because it is resistant to high heat and parasites (Banerjee 1978; Gunawan 2008). Brahman Cross cattle come from crossbreeds between Brahman cattle and various taurine cattle in Australia since 1933, so that the genetic mixture in every offspring varies widely (Banerjee 1978; Turner 1977; Friend and Bishop 1978). This cattle have good growth (1.0 to 1.8 kg per day), high carcass yield (45-55%), resistant to tropical climates, and resistant to various diseases, mites or ticks. In 1973, the Brahman Cross cattle being imported into Sulawesi, Indonesia (Gunawan 2008) to be used as a draught cattle and cut in old age. In 2006, they massively distributed throughout Indonesia to support the acceleration of self-sufficiency in beef cattle program.

Artificial insemination with semen of Brahman or Brahman Cross with PO cattle is preferred because it produces fastgrowing livestock and able to adapt to local conditions.

Today in Indonesia, especially in West Java, Banten and Lampung many emerging fattening companies (feedlofters) are intensively fatten Brahman Cross breeds. Maintenance is ideal for fattening cattle for 60-70 days for females, and for 80-90 days for male cattle.

Australian Commercial Cross (ACC) Australian Commercial Cross (ACC) cattle (Bos indicus x Bos taurus) have unclear genetic origins, they are from open crossbreed between various cattle in pastures which are raised in Northern Australia and Queensland. In the pasture, Brahman, Shorthorn and Hereford cattle are raised (Beattie 1990). Thus, allegedly ACC is a cross between zebu cattle of Brahman breeds with Shorthorn and Hereford taurine cattle (AMLC 1991; Ngadiyono 1995).

However, in contrast with the Brahman Cross, these cattle have characteristics more like Hereford and Shorthorn, the body is shorter and dense, large head, small ears and do not hang up, do not have a hump and wattle, fur around the head, the color pattern varies between Hereford and Shorthorn cattle. These mixed genetic cattle is very promising for fattening program, because it is easy to adapt to suboptimal environments like Brahman breeds and has a rapid growth like Shorthorn and Hereford. If a small and young ACC cattle is fattened in a short time (60 days) it would be very beneficial because it produces daily weight gain Âą 1.61 kg per day with a feed conversion 8:22 (Hafid 1998). Along with Brahman Cross, ACC cattle are excellent for large cattle fattening companies (feedlofters) in Indonesia.

Therefore, there are indigenous cattle, local cattle and exotic cattle in Indonesia. The only native cattle of Indonesia is Bali cattle. Local cattle of Indonesia is an exotic cattle that has long been nurtured in Indonesia and even mixed genetically with Bali cattle, namely Peranakan Ongole cattle, Sumba Ongole and Madura cattle, as well as Aceh cattle, Pesisir cattle, Jabres cattle, Rancah cattle, Rambon cattle, Galekan cattle, and Grati cattle (FHI).

Several exotic cattle had been introduced to Indonesia, but the main cattle include Brahman, Brahman Cross, Simmental, Limousin, Holstein Friesian, and ACC cattle.

339

Indonesian cattle distribution and density in each province is shown in Figure 3 and 4, respectively. The relationship between Indonesian local cattle with several major world breeds of zebu cattle shown in Figure 5.

QUALITY IMPROVEMENT Development of cattle in Indonesia has been practiced for thousands of years and is still being done until now to improve the quality and quantity of cattle population.

Livestock production is influenced by environmental and genetic factors. Environmental factors include feed, both forage and concentrate, water, climate, facilities maintenance, and is controlled by the gene (Sutarno 2006).

Both can be manipulated, but genetics plays a larger role because it determines the level of reproduction, productivity of meat or milk, carcass percentage, growth rate, feed efficiency, resistance to climate and disease, physical strength as draught animals, etc. (Frankham et al.

2002). The main obstacles to the sustainable use of cattle are a lack of information about the population of local cattle, geographical distribution and genetic characteristics (Long 2008). Phenotype and genetic characterization in cattle population is still limited (Hannotte and Jianlin 2005). Almost all cattle in the world are descendants of two bovine species, namely zebu (humped) and taurine (without hump). The history of formation of both cattle from wild aurochs ancestors have been traced through mitochondrial DNA (mtDNA) (Baig et al. 2005). Bali cattle are the only other breeds of bovine significantly raised.

Cattle diversities are formed through mutations, genetic drift and artificial selection of species from wild ancestor (Long 2008). Genetic studies are necessary to prevent loss of quality cattle. One threat to the sustainability of livestock is inbreeding and loss of genetic variation. To ensure a population can multiply in a sustainable manner, the level of genetic variation in a population needs to be known. Genetic variation is often correlated with fitness; reduced genetic variability may limit the success of population to respond to environmental changes, such as climate change, disease or parasites (Frankel and Soule 1981). Inbreeding causes decreased genetic variation resulting in lower livestock resistance to environmental change and disease. Inbreeding generally occurs in small isolated populations without the input of new genes from the outside. Isolation of Bali cattle in Bali, by preventing the entry of new gene suspected to have caused decreased resistance to disease that jembrana viral disease can infect them (Tenaya 2010).

Growth is the most important indicator in the meat production of cattle, so it has important economic value in livestock raising (Sutarno 2006). The inserting of new genes through hybridization with other related cattle breeds may threaten the purity and the specific characteristics of one breed of livestock. In the colonial era, the island of Madura declared to be closed to other cattle breeds and only devoted to the development of Madura cattle; while Bali Island is devoted to the development of Bali cattle, even has started since the Klungkung kingdom. However,

B I O D I V E R S IT A S 16 (2): 327-354, October 2015

340

K

A

B

I

L

J

H

C

D

E

F

G

Figure 3.Distribution of local Indonesian cattle. A. Aceh cattle; B. Pesisir cattle; C. Rancah cattle; D. Jabres cattle; E. Galekan cattle; F. Rambon cattle; G. Sumba Ongole cattle; H. Holstein Friesian cattle; I. Grati cattle; J. Madura cattle; K. Peranakan Ongole cattle; L. Bali cattle (All Indonesia except for Central Java, West Java and Banten)

Livestock density: â&#x2030;Ľ 1,650,000 1,070,001-1,650,000 409,001-1,070,000 159,001-409,000 â&#x2030;¤ 159,000

Figure 4.Population density of livestock in Indonesia

Figure 5. The relationship of Bali cattle, Indonesian local cattle and main zebu cattle of India (Mohamed et al. 2009)

SUTARNO & SETYAWAN â&#x20AC;&#x201C; Genetic diversity of Indonesian cattle

at present these two islands, as well as other places that became the center of cattle development, became the target of improving the quality of livestock through artificial insemination, which is widely used frozen semen from zebu cattle (Brahman and Brahman Cross) and taurine cattle (Simmental, Limousin, etc.). This crossing is done on the fields in an uncontrolled manner and the impact is difficult to predict in the long term. PO cattle development is a success story about improving the quality of livestock in Indonesia, which gained a new hybrid with strong adaptability to climate, feed availability, and diseases in Indonesia, and is very suitable as draught animals.

However, due to daily weight gain inferior compared to other cattle, PO cattle have now also become the target of crossbreeding. While Madura cattle crossbreeding with various dairy taurine cattle show reproductive failure which offspring do not have the endurance and the production of milk as desired and descendants are no longer found.

Quality improvement through crossbreed between same cattle species is generally successful, for example PO (Bos indicus) and Brahman (Bos indicus) or Brahman Cross (Bos indicus x Bos taurus). Meanwhile, a cross between cattle of different species are not always successful, because it produces male sterility and even if successful performance of reproductive females will suffer a loss of quality after a few generations, so it should always supplied the male semen purely to crossed, for example, Madura cattle (Bos javanicus x Bos indicus) with Red Danish (Bos taurus) failed to give offspring that will grow, reproduce and adapt to the local environment. Similarly, a cross between FH cattle (Bos taurus) and PO cattle (Bos indicus) that produce Grati breeds, where after a few generations the quality is much lower, so it should always be provided new stocks. Same things happens to gynecological Simpo and Limpo, where the pregnancy rate of female calf with Simmental or Limousin semen has a lower success than PO females. However, in the case of beef cattle, breeders are generally not too concerned with long-term conditions for the calves produced that are intended to be cut, not bred, so it always need to provide the frozen sperm of pure male. In the present time, the commonly males used for crossbreeding are Simmental and Limousin breeds, whereas females are from PO cattle breeds, but also has reported success with female cattle of Bali and Madura cattle. In some cases, a cross between species of cattle may also produce offspring that remain qualified after several generations, such as Madura cattle, Brahman Cross, and the ACC. Before conservation and management, it is important to recognize the level of genetic variation in cattle populations.

Another aspect that is less favorable for the development of Indonesian local cattle is the lack of effort to improve descent with the right technology. Efforts to select and get rid of unsatisfying cattle from its group are never being done, and the growth rate was never recorded.

This is in addition to less favorable economic terms, can also worsen next generation. By improving the quality and quantity of Indonesian local cattle production, it is expected that the interest of local cattle breeders to maintain both will be increased, so that the Indonesian

341

local cattle extinction can be avoided and at the same time dependence of Indonesia for beef cattle from other countries may be reduced (Sutarno 2006).

Indonesian local cattle, such as Bali cattle, have the advantage of reproduction capability and high adaptability to the local environment, but the quality and quantity of production is lower than the imported cattle (Sutarno 2006). Various government programs to improve the local cattle population so that it becomes the main source of beef cattle which include reduction of slaughtering on productive local cattle, and expand the range of interbreeding programs of local female cattle through artificial insemination (DGLS 2010c). However, the latter program became controversial because it is done directly in the field, that it triggered an uncontrolled genetic mixing, and produced offspring that have not been proven their adaptability to climate, natural feed and local disease as well as their reproductivity. Artificial insemination also reduced the period of open days (Siregar et al. 1993).

Genetic studies provide insight about the loss of genetic diversity due to inbreeding and the implications on natural populations. Conservation of genetic diversity is very important because it represents the potential evolution of a species (Frankham et al. 2002). In the case of Indonesian local cattle, especially Bali and zebu cattle, Mohamad et al.

(2009) have revealed the origins of Bali cattle, as well as the level of genetic variation, inbreeding and genetic purity to determine the sub-populations that are more suitable for conservation.

GENETIC MARKERS BASED SELECTION Cattle breeding have now reached a new scene with the nearly completed genome map of taurine cow (Elsik et al.

2009). QTLs facilitate understanding of the level of production and the behavior characteristics of beef and dairy cattle, thus providing a definite guide to selection (Friedrich et al. 2015). Meat and milk production can be increased through artificial selection. Improved genetic quality of cattle can be done with conventional methods of performance-based selection (PBS) or growth, and direct selection on the DNA by using marker assisted selection (MAS) that can recognize certain genes such as growth hormone gene and mitochondrial DNA (Sutarno 2010).

Until a few years ago, the selection to obtain quality breeds was generally performed only by external appearance (phenotype). Individuals having a good phenotype are led to mate each other to obtain offsprings with good phenotype. However, this technique is not appropriate because of the environment factors, such as feed, water maintenance and management, able to affect the body appearance, but not inherited. While genetic factors that codes growth properties is inherited, so it is appropriate for the selection (Sutarno 2006).

Selection is done with a guide marker gene, which variations of DNA sequences that characterize variations in the nature of phenotype, both of which directly affect the trait (candidate gene marker approach), or indirectly through a linkage with DNA sequences which affect the

342

B I O D I V E R S IT A S 16 (2): 327-354, October 2015

nature of phenotype (random marker approach). Candidate gene markers approach is based on the knowledge that the selected genes involved in desirable traits, such as growth hormone gene. However, this approach is limited to characteristics known on physiological and biochemical relationships. Instead, in the random marker approach, genotypes measurements are performed on a number of loci of whole genome without knowing the influence of phenotype, with the hope that there is locus relating to the desired characteristic, so this approach is less valuable than the candidate approaches (Sutarno 2006).

Specific genes have a significant influence on growth, milk production or other specific targets. Edwards and Page (1994) and Lande and Thompson (1990) stated that the increase in the genetic trait to 50% will occur with MAS technique. This increase occurred due to greater control of the MAS technique in the selection, thereby reducing the selection time between generations because the genes can be identified early during birth or still in the uterus. Gene markers approach have been widely used successfully for the characteristics of disease resistance, the quality and quantity of carcasses, fertility and reproduction, milk production, and the performance of growth (Sutarno 2006).

Growth is controlled by several genes, either genes with big influence (major gene) or genes with small influence (minor gene). One of the genes thought to be key genes in affecting growth is the growth hormone genes. In addition, mitochondrial DNA which is located outside the nucleus (the cytoplasm) is also considered affecting the growth since mtDNA is the controller of energy formation process (Sutarno 2010).

Growth hormone gene Growth hormone in cattle (bovine growth hormone) has a major role in the growth, milk production, animal body composition, and is associated with a higher average growth (Winkelmann et al. 1990; Hoj et al. 1993; Cunningham 1994). Administration of growth hormone may increase the average growth of cattle (Burton et al.

1994). Increased growth is influenced by the performance of IGF-I (Armstrong et al. 1995), so the variation of these genes leads to variations in growth (Ballard et al. 1993), for example, observed in PO cattle (Sutarno 2003) as well as Composite and Hereford (Sutarno 1998). According to Schlee et al. (1994b) polymorphism in the growth hormone gene (GHG) cause differences in hormone synthesis, resulting in differences in the concentration/circulation of these hormones. This difference causes the growth variation among individuals. Thus, DNA variations on growth hormone gene can serve as a potential candidate as cattle growth feature gene markers (Sutarno 2006) (Figure 6).

Variations in the growth hormone gene locus of Composite cattle in Western Australia significantly affect variation of the mean growth (Sutarno et al. 1996; Sutarno 1998). Schlee et al. (1994b) found that differences in the genotype of a growth hormone gene influence circulating concentrations of growth hormone and IGF-I in the Simmental cattle. Rocha et al. (1992) found a significant

association between alleles of growth hormone with weight at birth and the ridge width at birth in Brahman cattle.

These variations have been reported in taurine cattle, but is still limited to a local Indonesian beef cattle (Sutarno and Junaidi 2001; Sutarno 2003).

To obtain superior Indonesian local cattle in the production of meat, it is important to acquire the marker gene from the population of local cattle thorough analysis of the combination of phenotype data (growth), genotype data (allele), as well as all supporting data which may affect growth (cattle species, sex, age, the concentration of circulating growth hormone, etc.). Cattle growth hormone gene which has been mapped is located on chromosome 19 with location-qtr Q26 (Hediger et al. 1990). This gene sequence consists of 1793 bp which was divided into five exons and is separated by four introns (Sutarno 2006).

Variations of the gene encoding growth hormone has been reported in taurine cattle, for example, Red Danish dairy cattle (Hoj et al. 1993), Simmental beef cattle (Schlee et al 1994a), Hereford and Composite beef cattle (Sutarno et al.

1996; Sutarno 1998) as well as PO cattle, Bali cattle and Madura cattle (Sutarno et al. 2002, 2003). Such variations are generally caused by the deletion, substitution or insertion (Sutarno 1998, 2003).

In Simmental cattle breeds, Schlee et al. (1994a) showed that individuals which have LV (leucine/valine) genotype on their growth hormone gene is superior in achieving weight of carcass and meat quality.

Polymorphisms which were detected by TaqI on its growth

A

B Figure 6. A. The role of growth hormone in regulating metabolites material for fuel regulation and growth; B. The structure of growth hormone gene in cattle; The letters A, B, C and D show the introns, while the Roman numerals I, II, III, IV and V show the exons (Sutarno 1998).

SUTARNO & SETYAWAN â&#x20AC;&#x201C; Genetic diversity of Indonesian cattle

343

Figure 7. The mitochondrial DNA of mammals, including cattle (St John et al. 2004)

hormone gene were reported to be associated with birth weight in Brahman cattle (Rocha et al. 1992) and with growth in Korean cattle (Choi et al. 1997). Research conducted by Sutarno (1998) against Hereford cattle and Composite showed that MspI polymorphism in the growth hormone gene region between exons III and IV significantly affect the growth, in which individuals that have allele MspI (-) are superior. At PO cattle, individuals who have MspI +/- heterozygous genotype has higher weight, chest circumference and body length than MspI genotype homozygous +/+ or MspI -/- (Sutarno 2003; Paputungan et al. 2013). The relationship of genotype variations in growth hormone locus with a total growth of cattle is probably caused by differences of growth hormone circulation as a result of the growth hormone gene variation (Sutarno 2006). Study of gene polymorphisms of growth hormone has also been done on some Indonesian local cattle such as Pesisir cattle (Jakaria et al. 2007), Bali cattle (Jakaria et al. 2009; Jakaria and Noor 2011), Madura cattle (Purwoko et al. 2003; Hartatik et al. 2013), PO cattle (Sutarno et al. 2005; Sutarno 2010; Paputungan et al. 2013; Rahayu et al. 2014), Sumba Ongole cattle (Anwar et al.

2015), Aceh cattle (Putra et al. 2013, 2014) and Grati dairy cattle (Maylinda 2011).

Selection to obtain superior descendants based on DNA markers such as DNA polymorphisms can provide a more accurate and efficient result (Schlee et al. 1994b). Gene variations in growth hormone gene are related to variations in growth hormone and insulin-like growth factor (IGF-I).

Then, variations of growth hormone and IGF-I have caused differences in growth, so that the encoding growth hormone gene can be used as a potential starting point as DNA markers for Indonesian local cattle breeding(Sutarno 2006).

Mitochondrial DNA Mitochondrial DNA (mtDNA ) is a genetic marker that is very useful to study the origin, genetic diversity and descendant differentiation because it has unique characteristics inherited from the female broodstock, the fast rate of evolution and the less level of recombination (Bailey et al. 1996; Liu et al. 2006; Galtier et al. 2009).

Mitochondrial DNA is located outside the nucleus and is responsible for the energy formation. It affects the growth, reproduction and production characteristics in cattle (Schutz et al. 1994). MtDNA gene is a marker that is efficient, because the segments of genes that evolved differently (Zardoya and Meyer 1996; Kikkawa et al. 1997; Hassanin and Ropiquet 2004; Kartavtsev and Lee 2006).

Variations on mtDNA cattle have been reported (Sutarno and Lymbery 1997; Sutarno 2002a). MtDNA evolved faster than nuclear DNA, and even though there are thousands of copies of mitochondrial genome in each cell, nucleotide substitution occurred about five to ten times faster than the same mutation in the DNA core.

Modifications and variation in mtDNA will affect the phenotype. Schutz et al. (1994) reported that there is effect of various mtDNA sequences on milk production, while

344

B I O D I V E R S IT A S 16 (2): 327-354, October 2015

Schutz et al. (1993) found a significant effect of substitution at nucleotide pairs (bp) no. 169 D-loop sequences in the percentage of milk fat. MtDNA variations on D-loop segment significantly affected the reproductive feature of Hereford and Composite cattle (Sutarno et al.

2002a; 2002b) (Figure 7).

Mitochondrial DNA is a marker based on the maternal pedigree that may show the family history (Ascunce et al.

2007). Research on the D-loop region of mtDNA on several breeds cattle have shown that taurine cattle ancestors came from Syria, and then spread throughout Europe (Edwards et al. 2007). MtDNA D-loop region in cattle may show hybridization to the banteng and Madura cattle (Nijman et al. 2003). Based on the sequence of mtDNA D-loop region, Aceh cattle is one cluster with Pesisir cattle and PO is zebu cattle, while Bali cattle and Madura cattle form its own separate cluster. The base composition of mtDNA D-loop region nucleotide of Aceh cattle is different from other local cattle with difference sequence from smallest to largest, i.e. from Pesisir cattle, PO cattle, Bali cattle and Madura cattle. It can be used as a marker for distinguishing and grouping of Indonesian local cattle. Aceh cattle have similarity base arrangement of nucleotide for about 94.36% with the zebu cattle, so based on the maternal line, Aceh cattle is originated from zebu cattle (Abdullah et al. 2008).

MtDNA analysis can also be used to trace relationship and genetic purity of the female parent lines. Bali cattle in Malaysia generally contain genes of other cattle, such as China's Yellow cattle, Kedah-Kelantan and Brakmas, while Bali cattle in Indonesia tend to be pure (Somarny et al.

2015). This happens because in Malaysia the Bali cattle is raised together with other breeds of cattle, while in Indonesia they are not generally raised together with other cattle (Nijman et al. 2003). Instead, Chinese Yellow cattle which are believed to be descendants of crossbreeding of taurine and zebu (Mao et al. 2006) actually contain Bali cattle genes or banteng (Chang et al. 1999). An understanding of the origin, differentiation and genetic relationships between offspring cattle is very important for the genetic management, sustainable usage and cattle conservation (Somarny et al. 2015).

However, cattle with the same genetic traits can have the performance of a much different because of differences in the management of maintenance. In Madura, Madura cattle function as beef cattle, racing cattle (karapan) and displayed cattle (sonok), each of which has different physical character and behavior, but all three were taken from generally same calf. Diversity analysis of BCKDH (Branched-chain Îą-ketoacid dehydrogenase), the main enzyme complex in the inner membrane of mitochondria that metabolize valine, leucine, and isoleucine, showed no mutations associated with differences in the allotment of Madura cattle (Febriana et al. 2015).

Analysis of molecular data from mtDNA and growth hormone gene, combined with the phenotype data of cattleâ&#x20AC;&#x2122;s growth, it is known that genotypes of cattle that is superior in the production of meat that can be used as a marker gene. Gene markers approach can be used in animal breeding to obtain superior breeds through planned

crossbreed that sets parent genotype. Further development of the marker gene is that it can be used in DNA recombinant to produce growth hormone. This hormone can be used temporarily to induce growth, and furthermore towards the establishment of transgenic animals, an early detection of diseases and other phenotypic traits (Sutarno 2006).

CROSSBREEDING Crossbreeding is an important part of cattle improvement because of the variability of environment and market demand that need to be addressed. Crossbreeds bring out heterosis effect in which to collect the new advantageous characteristics, for example crossbreeds between zebu cattle that are impervious to hot climates and taurine cattle that can grow faster. Refinement on breeding governance can improve the performance of livestock, but these characteristics are not inheritable, on the other hand, genetic improvement can be inherited. Cattle productivity is influenced by genetic and environmental factors; cattle can reach their genetic potential conditions when supported by an optimal environment (Talib et al. 2002).

Environmental conditions and the livestock breeds affect the rate of growth, calving production and reproduction ability (Nugroho 2012). Cattle which are raised on the traditional system generally will experience a forage shortage due to the limited and low quality of feed, and rarely given additional feed such as concentrates and grains, so they rarely reach the optimum conditions (Wiyatna et al. 2012).

Breeders prefer crossbreeding because of the effect of heterosis where offspings will have more superior characteristic than the parentâ&#x20AC;&#x2122;s. In crossbreeding through artificial insemination, the breeder can set all female broodstocks to give birth at relatively the same time to obtain calves of the same age. Crossbreeding can be designed to establish certain cattle breeds, according to market needs. Cattle crossbreeding cannot be done haphazardly but it must be done with clear objectives and will last over the long term from generation to generation.

Because of weak control in crossbreeding, the entry of additional genetic from other cattle may frustrate the achievement of goals because too much variability in the offspring (Comerford 2014). However, a crossbreed may lead to the loss of adaptability to the local environment (Mohapatra 2004), so, ideally, an assessment of the impact of introduced livestock before it becomes a realization (Mastuti 2014). Crossbreeding to get superior calf must begin by characterizing all the characteristic of local cattle which have adapted to the local environment and predict the results to be obtained.

Performance of cattle reproduction is influenced by environmental conditions. In the semi-arid or tropical climates, zebu cattle show more superior reproductive performance than taurine cattle (Meirelles et al. 1991), but in highland or temperate zones taurine cattle have better reproductive performance (Duarte and Barbosa 1989).

Some studies have reported a close relationship between

SUTARNO & SETYAWAN â&#x20AC;&#x201C; Genetic diversity of Indonesian cattle

genotype and environmental factors on the productive performance and reproduction of beef and dairy cattle (Mulder and Bijma 2005; Hammack 2009; Hammami et al.

2009). The characteristics of reproduction, first mating age, number of service per conception, open days and calving interval are the basis for determining the profitable cattle ranch (Enyew et al. 1999; Tavirimirwa et al. 2013). Age of mating and first calving is significantly affected by height (in relation to the ambient temperature), where cattle age of mating and first calving is slower in lowland (Suyadi et al.

2014). Heritability of these traits is usually low, so, including conditions and feed management; environmental factors play an important role in the variability (Olori et al.

2002).

In Indonesia, crossbreeding cattle are mostly done through artificial insemination. This activity has been known in Indonesia since 1953, and since 1980-1990, it has widely performed using semen of some foreign taurine cattle that the growth and body weight is relatively higher.

However, until now the purpose of artificial insemination program is not clear yet, it will be towards the formation of a composite cattle, terminal cross, or commercial livestock.

Many breeders helped the officer to the quality of livestock by crossing local cattle with Simmental or Limousin cattle.

Cattle breeders like this, because the price of male offspring is very high, even though the local cattle turned into large cattle type that needs a lot of feed. In the forage shortage conditions, cattle crossbreeding be thin, poor body condition, and decline in reproductive performance, such as high number of services per conception, long time of calving interval, and low quality calf. This condition is accompanied by low production of milk and high calf mortality. On the condition of good maintenance, reproductive performance of crossbreeding cattle remains good. While on the local cattle, forage shortage conditions only lead to thin body, but still capable of estrus, ovulation and pregnant. In quantity and quality, forage is one of the important keys to the condition of crossbreeding cattle to remain good and productive (Diwyanto and Inounu 2009).

The interaction of genotype and environmental factors can be observed from the age of first calving and the first lactation in dairy cattle (Suyadi et al. 2014; Sahin et al.

2012). Nugroho (2013) reported that PO cattle showed lower feed intake, lower growth rates and lower body condition score (BCS) than Limpo crossbreed cattle. It shows that in tropical conditions, the breeds of cattle affect the growth rate. On the other hand, the chewing ability of Limousin crossbreed is better than the PO (Purnomoadi et al. 2003). In the FH dairy cattle, the age of first lactation affects total milk production during the second and third lactation. Earlier age of first calving and first breastfeeding cause lower milk production in the next lactation (Madani et al. 2008). Cattle species have no effect on this variable, even the PO cattle in lowland shows slower age of mating and age of first calving. This is due to the different levels of genetic response to environmental conditions which are critical due to lower feed intake and BCS. Bridges and Lemenager (2008) states that the low BCS in cattle causing low reproductive performance including age of first mating and first calving (Figure 8).

345

Bali cattle Increased production of Bali cattle has been done through artificial insemination using frozen semen from taurine cattle such as Simmental, Limousin, Hereford, and Charolais as well as zebu cattle of Brahman breeds, up to now the best result for the rate of growth is Simmental (Diwyanto and Inounu 2009). Crossbreeding systems to improve livestock meat production utilize heterosis and exploit differences among cattle in certain characteristics (Tang et al. 2011), in the different environmental conditions (Dadi et al. 2002). However, these efforts may not have a positive impact if it is not followed by the environmental improvement. Replacement of local cattle with exotic cattle could create new problems, such as obstructed birth due to increased birth weight, low tolerance to harsh environmental conditions, and increased forage demand due to higher growth rates and larger body size (McCool 1992).

Performance of breed of cattle or its crossbreeding is not always the same in different environmental conditions.

Environmental factors that most affect the livestock production are heat and humidity (Yeates et al. 1975). In tropical countries, air temperature varies depending on the altitude (Williamson and Payne 1980). Lowland is hotter than highlands. Sub-tropical taurine cattle only produce well in the highlands, while the highland area in Indonesia is relatively limited. In West Nusa Tenggara, Bali cattle calf raise in lowland and highland (> 700 m) had a relatively same growth rate, while Simbal crossbreeds (Simmental x Bali cattle) have a higher growth rate in the highlands. The offspring which backcross with Simmental has a higher growth rate in the highlands and lower growth rate in the lowland, while the offspring which backcross with male Bali cattle has a higher growth rate in the lowlands (Pribadi et al. 2014).

Therefore, it is important to evaluate the factors that affect the economical properties of diverse environments to understand the proper management in hybrid system, because interaction can affect the productive efficiency (Pribadi et al. 2014). Growth characteristics such as weight at birth, weaning and yearling are economically very important in cattle production systems. Birth weight and weaned weight are affected by the parentâ&#x20AC;&#x2122;s genetic (Meyer 1992). Weaning calf and yearling cattle are the main products of beef cattle, body weight greatly affect the selling price, as well as an important criterion in cattle breeding (Bazzi and Alipanah 2011; Ashari et al. 2012).

Peranakan Ongole Peranakan Ongole (PO) derived from the uncontrolled crossing between Sumba Ongole cattle with local cattle in Java since the 1930s. PO cattle are a tropical species that have adapted in Indonesia, especially in East Java. Since the 1990s, many PO cattle crossed with taurine cattle, mainly Simmental and Limousin, through artificial insemination without considering the genetic composition of descendant, so it is feared that it will affect their adaptation, reproduction and growth. But, breeders support this effort, because it gave them good calves, with faster

B I O D I V E R S IT A S 16 (2): 327-354, October 2015

346

A

B

C

D

E

F

G

H

I

J

K

L

Figure 8. The diversity of cattle crossbreeds from artificial insemination in Indonesia. A-B. Simpo cattle (Simmental bull x PO cow) in Central Java; C. Simpo cow and its calf that produced from artificial insemination with Simmental bull in Boyolali, Central Java; D. Simpo calf and its Simpo cow that produced from artificial insemination with Simmental bull in Klaten, Central Java; E. Limbal calf (Limousin male x Bali cattle female) in Nunukan, North Borneo; F. Limousin crossbreed in Jember, East Java; G. Limad calf (Limousine bull x Madura cow) in Rote, East Nusa Tenggara; H. Limad bull in the island of Madura or locally known as Madrasin; I. Limpo cattle in Sukoharjo, Central Java; J. Calf of Simbal (Simmental bull x Bali cattle cow) in Nunukan, North Borneo; K. Calf of Simpo in Dairi, North Sumatra; L. Crossbreed calf of Brahman and local cattle in South Tapanuli, North Sumatra

growth. At the age of three years, hybrid cattle (Simpo or Limpo) are able to reach a weight of 800 kg, while the PO cattle reach less than half of it. Conversely, PO cattle production costs less than half of the hybrid cattle (Sutarno 2006). Endrawati et al. (2010) showed that consumption of

green fodder and concentrate on Simpo cattle than the POâ&#x20AC;&#x2122;s, but if it is calculated based on body weight, it makes no different. Digestibility Simpo and PO is not different, as well as the estrous cycle.

is greater metabolic of feed in BCS and

SUTARNO & SETYAWAN – Genetic diversity of Indonesian cattle

Limpo and Simpo cattle are widespread across Java, in the lowlands and highlands. PO cattle’s first mating age is higher than Limpo cattle’s. In the highlands, service per conception (S/C) is higher for Limpo and there was no significant different for open days period (DO) and calving interval period (CI), making it both more efficient to be maintained in the lowlands. Yulyanto et al. (2014) showed that the value of S/C, DO and CI between PO cattle and Limpo differ significantly, where the reproduction performance of PO cattle is better than Limpo. At PO cattle and Limpo, calving interval period and first mating are around 99-137 days. Environmental conditions and the breeds of cattle affect calving interval period and first mating (Suyadi et al. 2014). Cattle species and the average daily temperature resulted in a different interval between calving and mating. This interval is longer in the dry season than the wet season, probably because of the low quantity and quality of feed during the dry season which result of low BCS (body condition score) (Kebede et al.

2011). Service per conception ranged from 1.64 to 2.01 is affected more by climate than by species of cattle that in a tropical climate it shows higher service per conception (Kebede et al. 2011). Limpo cattle containing genetic of zebu and taurine cattle show high service per conception (Suyadi et al. 2014). The period of open days and calving interval was not significantly influenced by the breeds of cattle and environmental conditions (Suyadi et al. 2014).

Performance of reproduction based on the reproduction cycle (first mating after calving, service per conception, open days and calving interval) of PO cattle is more efficient than Limpo. Altitude and breeds of cattle affect age of first mating and first calving, the first mating after calving and the number of services per conception, but not on open days and calving interval. Based on the reproduction performance, PO cattle and Limpo cattle are more efficient to be raised in the lowlands than highlands (Suyadi et al. 2014).

Simpo and Limpo cattle have a better growth than PO cattle’s in traditional breeding. Male PO and Limpo’s consumption with rice straw and concentrate in the ratio of 60: 40 is 2.8% live weight (DM basis), but the growth of PO is less than half compared to Limpo (0.47 kg per day) (Purnomoadi et al. 2003). According to Pamungkas et al.

(2012), feed quality can reduce the possibility of differences in daily weight gain. For comparison, Moran (1985) recorded a daily weight gain of 0.65 kg per day for male PO cattle fed by fiber-based (70% grass and 30% concentrate, DM basis) and 0.81 kg per day with concentrates. Cruz de Carvalho et al. (2010) reported lower growth rate of PO cattle than the Simpo given high concentrate diet. Simpo cattle have higher carcass weight and higher carcass percentage and feed cost per gain is more efficient than PO cattle’s. The low rate of growth is often due to the high proportion of poor quality of forage in the diet such as straw (as the main feed, 48% in the dry season and 78% in the rainy season). Small breeder cannot afford to give fodder with energy content and high protein.

But actually, legumes, grass, bran and remains of cassava is a feed of high quality and low cost (Pamungkas et al.

2012). Under the unfavorable fodder conditions, to raise

347

PO cattle is more profitable than Simpo or Limpo cattle (Hartati et al. 2005).

The difference in average daily gain (weight) of PO cattle, Simpo and Limpo in wet and dry seasons is not significant, although the growth rate tends to be higher in the wet season than the dry season. In contrast, the thickness of body circumference (girth) and body weight were higher in the rainy season for all cattle, where the BCS increased by 5% during the rainy season and decreased by 9% during the dry season (Pamungkas et al.

2012). Body weight was higher in the rainy season than the dry season due to provide the feed contains more protein in the rainy season than the dry season (Evitayani et al. 2004).

On the other hand, the body weight of cattle at the traditional breeding is much lower than at the research station, so it has great potential to be increased (Pamungkas et al. 2012).

Madura cattle Madura cattle quality improvement is generally done by crossbreeding between the Madura cattle with stud of Limousin cattle through artificial insemination (Wijono 2004; Hartatik 2009). These crossbreed cattle have better quality of meat production and are known locally as Madrasin or Limad cattle. Madrasin cattle’s size and body weight is higher than Madura cattle. This condition is certainly less favorable primarily related to the effort of maintaining the existence of pure Madura cattle as one of Indonesian native germplasm cattle (Siswijono et al. 2014; Decree of the Director General of Livestock No. 18020/Kpts/PD.420/F2.3/02/2013 ).

Madura cattle maintained by small breeder for a variety of purposes including draught animals, life savings, producer of organic fertilizer, source of income and means of cultural celebrations such as cattle races (karapan) and beauty contest (sonok). Karapan involving livestock cattle compete with muscle strength and speed, while a beauty contest in the form of cattle dance to the traditional music beat on a long catwalk. Since 1993, Madura cattle crossed with Limousin to increase live weight. Such efforts are slowly adopted by farmers and supported by localgovernment, especially when decentralization policies implemented in Indonesia. To increase the income of farmers, local governments are now trying to stimulate cross cattle because calves from crossbreeds have high selling price. Though, it is contrary to the efforts of a national policy to preserve Madura cattle as indigenous genetic resources. Also, the result of crossbreeding will experience the possibility of losing the characteristics of livestock needed for cultural celebrations such as karapan and sonok cattle. However, Madura breeders felt that Limousin cattle crossed with Madura (Limad or Madrasin) increase body weight and more profitable than Madura cattle (Siswijono et al. 2010; Rahmawati et al. 2015). At this time the cattle Limad is an excitement for breeders who have long seen the development of Madura cattle breeding was stagnant. There is no definite count of Limad cattle population, but the number is believed to be a lot, especially in Bangkalan and Sumenep. In every exhibition of agriculture, Madrasin cattle have always been a star.

B I O D I V E R S IT A S 16 (2): 327-354, October 2015

348

A

B

C

D

E

F

Figure 9.The diversity of cattle on island of Madura, East Java. A. Karapan (race) bulls; B. Sonok cattle (displayed cow); C. Madura superior cattle; D. Madura superior cattle in festivals; E. Madrasin (Limad) superior cattle in festivals; F. Performance of Madrasin bulls.

Breeding programs should include controls for crossed male cattle to avoid the possibility of uncontrolled mating; especially Madura cattle reproductive performance is greater than Madrasin, while the production of performance in Madrasin crossbreed is greater than Madura cattle. Feed conditions greatly affect calves growth, so that good quality of local feed and continuity of provision should be maintained in order to prevent negative effects on growth (Kutsiyah et al. 2003) (Figure 9).

CONCLUDING REMARKS Self-sufficiency in beef cattle will be met if the local production and cattle population is sufficient, but the facts, the ability of Indonesian cattle population to meet the demands continues to decline, year by year. Crossbreeding between exotic cattle and Indonesian local cattle is a shortcut to increase beef production. These crossbreeding cattle have size and weight gain higher than local cattle but needs higher cost of maintenance, that the economic benefits are not much different. On the other hand, the crossbreeds have not a clear direction, and it is feared that it is not sustainable because the cattle produced has lower climate durability and lower reproductive capacity than the existing local cattle. Scientists believe that the sustainability of beef and dairy cattle supply is highly dependent on an understanding of the diversity, characteristics and use of local genetic resources in developing countries that have not been developed.

Indonesia has enough local cattle, some of which have the

performance of a very satisfactory and well adapted to the dry climate, to limited fodder, and to various tropical diseases, namely Bali cattle, PO and Madura cattle, in addition there are also local cattle with more limited population, namely: Aceh cattle, Pesisir cattle, Rancah cattle, Jabres cattle, Rambon cattle, Galekan cattle and dairy Grati cattle. However, along with the broader and easier service of artificial insemination, the pattern of breeds began to change, which initially the cattle are traditionally raised as draught animals and as life savings turned into semi-intensive system with orientation for beef cattle (meat), so that the performance of crossbreeds descendant of local cattle crossed with male Simmental and Limousin cattle are preferred because of the growth rate and maximum weight is much higher.

Theoretically, crossbreeds between different species of cattle would produce sterile males, while females would decrease the ability of reproduction from generation to generation. This crossbreed cattle descent proved to be less able to adapt to the tropical climate conditions, natural feed and local diseases. Thus, allowing the continuation of crossbreeding with cattle stud taurine, for example, Simmental and Limousin, against the local female cattle is the gamble for the future of Indonesian meat supply.

However, proponents of these programs argue that such concerns are exaggerated, as evidenced in northern Australia, the uncontrolled genetic mixing in pasture among the various breeds of taurine and zebu cattle generate sustainable calf and become one of the main cattle which were exported in the last 30 years, namely Australian Commercial Cross (ACC) cattle. The desire to

SUTARNO & SETYAWAN – Genetic diversity of Indonesian cattle

maintain crossbreeding cattle, such as Simpo and Limpo, continues to rise. Studies in 2008 showed that in Central Java the population ratio of local PO cattle with crossbreeding cattle (Simpo and Limpo) is 51.93% and 48.07%, while in Yogyakarta is 25.75% and 74.25%. This shows that the PO cattle population tends to decrease drastically, while the crossbreeding cattle population increased. In terms of meat production, to maintain Simpo and Limpo cattle is quite positive, but from the aspect of environmental capacity, increase in population, and the conservation of local cattle as national germplasm, it is very detrimental. If this continues, then in 20 years to come, PO cattle which proved adaptive to climate conditions and tropical environment are expected to become extinct. Ironically, PO cattle itself is the result of uncontrolled crossbreed between Sumba Ongole cattle and old Java cattle. The presence of SO cattle caused extinction of the old Javanese cattle, but this mating produces PO’s offspring sustainable cattle, because both species is zebu.

Extinction of local cattle will cause full dependence of breeding stock of imported cattle. At this time, the deficit of beef cattle population in Indonesia is only 25-30%, but in the next 10 years, it will increase to about 50%.

Currently, feeder of Brahman Cross and the Australian Commercial Cross cattle imported from Australia dominate the market for fattening ranch. This leads to the ideals of Indonesian people to be independent and sovereign in food demand will be far from reality.

REFERENCES AAK. 1995. Practical Guide of Cattle Farming. Kanisius, Yogyakarta.

[Indonesian] Abdullah MAN, Noor RR, Martojo H, Solihin DD, Handiwirawan E. 2007. Phenotypic diversity of Aceh cattle in Nanggroe Aceh Darussalam. J Indon Trop Anim Agric 32 (1): 11-21. [Indonesian] Abdullah MAN. 2008. Genetic Characterization of Aceh cattle using Phenotypic Diversity Analysis on D-loop region of Mitochondrial DNA and DNA Microsatellite. [Dissertation].School of Graduates.

Bogor Agricultural University. Bogor. [Indonesian] Achilli A, Bonfiglio S, Olivieri A, Malusà A, Pala M, Kashani BH et al.

2009. The multifaceted origin of taurine cattle reflected by the mitochondrial genome. PLoS ONE 4 (6): e5753. DOI: 10.1371/journal.pone.0005753 Adiwinarti R, Fahira UR, Lestari CMS. 2011. The growth of Java bulls fed rice straw and concentrates containing different levels of protein.

JITV 16 (4): 260-265. [Indonesian] Adrial. 2010. Potential and development efforts of Pesisir cattle in West Sumatra. Jurnal Penelitian dan Pengembangan Pertanian 29 (2): 6672. [Indonesian] Ajmone-Marsan P, Garcia JF, Lenstra JA. 2010. On the origin of cattle: how aurochs became cattle and colonized the world. Evol Anthropol 19: 148-157.

Amin M. 2010. Intervention of genetic flow of the foreign cattle toward diversity of phenotype expressions of local cattle in the District of Banyuwangi. Biodiversitas 10: 69-74.

AMLC [Australian Meat and Livestock Corporation]. 1991. A Workshop for tropical feedlot managers: An Introductory Workshop for Feedlot Managers in the Philippines. Australian Meat and Livestock Corporation, Perth Western, Australia.

Anwar S, Agung PP, Wulandari AS, Sudiro A, Said S, Tappa B. 2015.

Detection of growth hormone (GH-MspI) gene polymorphism in Sumba Ongole (SO) cattle. Pros Sem Nas Masy Biodiv Indon 1: 398403. [Indonesian] Anwar. 2004. Diversity of External Character and Microsatellite DNA of Pesisir Cattle West Sumatra. [Dissertation]. School of Graduates.

349

Bogor Agricultural University. Bogor. [Indonesian] Armstrong JD, Harvey RW, Poore MA, Simpson RB, Miller DC, Gregory GM, Hartnell GF. 1995. Recombinan bovine somatotropin increases milk yield and calf gain in diverse breeds of beef cattle: associated changes in hormones and indices of metabolism. J Anim Sci 73: 3051-3061.

Aryogi, Romjali E. 2009. Potential, utilization and development constraints of the local beef cattle as a germplasm wealth of Indonesia. National Workshop on the Management and Conservation of Genetic Resources in Indonesia: Economic Benefits to Achieve National Defense. Centre for Research and Development of Animal Husbandry, Bogor. [Indonesian] Ascunce MS, Kitchen A, Schmidt PR, Miyamoto MM, Mulligan CJ. 2007. An unusual pattern of ancient mitochondrial DNA haplogroups in northern African Cattle. Zool Stud 46 (1): 123-125 Ashari M, Busono W, Nuryadi, Nurgiatiningsih A. 2012. Analysis of chromosome and karyotype in Bali cattle and Simmental-Bali (Simbal) crossbred. Pak J Biol Sci 15: 736-741.

Atmakusuma J, Harmini, Winandi R. 2014. Is it possible be realized meat self-sufficiency? Risalah Kebijakan Pertanian dan Lingkungan 1 (2): 105-109. [Indonesian] Baig M, Beja-Pereira A, Mohammad R, Kulkarni K, Farah S, Luikart G. 2005. Phylogeography and origin of Indian domestic cattle. Curr Sci 89: 38-40.

Bailey JF, Healy B, Jianli H, Sherchand L, Pradhan SL, Tsendsuren T, Foggin JM, Gaillard C, Steane D, Zakharov I, Bradley DG. 1996.

Genetic variation of mitochondrial DNA within domestic yak populations. Proceedings of the Third International Congress on Yak held in Lhasa, P.R. China, 4-9 September 2000 Bali Governor Regulation No. 45/2004 about: Conservation of Bali cattle Ballard FJ, Francis GL, Walton PE, Knowles SE, Owens PC, Read LC, Tomas FM. 1993. Modification of animal growth with growth hormone and insulin-like growth factors. Aust J Agric Res 44: 567577.

Banerjee GC. 1978. Animal Husbandry. Oxford and IBH Publishing Co, New Delhi.

Bappenas. 2007. Animal Feed. Rural Community Economic Development Project-Bappenas, Jakarta. [Indonesian] Barbosa PF, Duarte FAM. 1989. Cross breeding and new cattle breeds in Brazil. Braz J Genet 12, Suppl 3: 257-301.

Bazzi H, Alipanah M. 2011. The effects of some environment factors on the weaning weight of Sistani beef calves. J Anim Vet Advan 10 (11): 1480-1483.

BBIBS. 2015. Freisian Holstein (FH) Catalogues. Singosari National Artificial Center, Malang. http://bbibsingosari.com/katalog/ friesien_holstein_(fh)/ [October 2, 2015] Blakely J, Bade DH. 1998. The Science of Animal Husbandry. 8th ed.

Prentice-Hall, Inc. New York.

Bollongino R, Burger J, Powell A, Mashkour M, Vigne JD, Thomas MG. 2012. Modern taurine cattle descended from small number of NearEastern founders. Mol Biol Evol 29 (9): 2101-2104.

BPPV Bukittinggi. 2013. Monitoring Reports and Jembrana Disease Diagnosis in the Working Area of the Research Center for Veterinary of Bukittinggi in 2013. Research Center for Veterinary, Bukittinggi.

[Indonesian] BPS. 2014. Preliminary figures of 2013 Agricultural Census Results. BPS, Jakarta. st2013.bps.go.id [2 Oktober 2015] [Indonesian] Bradshaw CJA, Brook BW. 2007. Ecological-economic models of sustainable harvest for an endangered but exotic megaherbivore in northern Australia. Nat Res Mod 20 (1): 129-156.

Bridges A, Lemenager R. 2008.Impact of Body Condition at Calving on Reproductive and Productivity in Beef Cattle. Extension Specialist, Reproduction, Dept. Anim. Sci, Purdue University and Extension Beef Specialist, Department of Animal Sciences, Purdue University, Purdue.

Budiarso IT, Hardjosworo S. 1976.Jembrana disease in Bali cattle. Aust Vet J 52 (2): 97.

Burton JL, McBride BW, Block E, Glimm DR, Kennelly JJ. 1994. A review of bovine growth hormone. Canadian J Anim Sci 74: 167-201.

Chang H, Miao Z.R, Geng S.M, Wu B, Hashiguchi T, Meada Y. 1999.Studies on phylon of native cattle populations in East and South of Central Asia. Jiangsu Agric Res 20: 42-47.

Chen S, Lin BZ, Baig M, Mitra B, Lopes RJ, Santos AM, Magee DA, Azevedo M, Tarroso P, Sasazaki S et al. 2010. Zebu cattle are an exclusive legacy of the South Asia Neolithic. Mol Biol Evol 27: 1-6.

Choi YJ, Yim DS, Cho JS, Cho BD, Na KJ, Balk MG. 1997. Analysis of

350

B I O D I V E R S IT A S 16 (2): 327-354, October 2015

Restriction Fragment Length Polymorphism in the Bovine Growth Hormone Gene related to growth performance and carcass quality of Korean Native Cattle. Meat Sci 45: 405-410.

Circular of East Java Governor No. 524/8838/023/2010 about: Prohibition of Importation and Distribution of Cattle, Meat and Offal imports.

[Indonesian] Comerford J. 2014. Crossbreeding is a Good Idea. PennState Extention http://extension.psu.edu/animals/beef/reproduction/articles/crossbreed ing-is-a-good-idea [2 October 2015] Copland J. 1996. Bali Cattle: Origins in Indonesia. In: Wilcox GE, Soeharsono S, Darma DMN, Copland JW. ACIAR Proceeding. 75: 29-33.

Cruz de Carvalho M, Soeparno, Ngadiyono N. 2010. Growth and carcass production of Ongole crossbred cattle and Simmental Ongole crossbred cattle reared in a feedlot system. Buletin Peternakan 34 (1): 38-46.

Cunningham EP. 1994. The use of bovine somatotropin in milk production-a review [Review]. Irish Vet J 47: 207-210.

Dadi H, Jordan GF, Schoeman SJ, van der Westhuizen J. 2002. The effect of Charolis and Hereford sires and stright bred and crossbred dams on pre weaning growth of calves. S A J Anim Sci 32 (1): 38-43.

Dahlanuddin DV, Liang TJB, Adams DB. 2003. An exploration of risk factors for bovine spongiform encephalopathy in ruminant production system in the tropics. Rev Sci Tech Off Int Epiz 22: 271-281.

Damayanti R. 1995. Subclinical malignant catarrhal fever cases in Bali cattle detected in some abattoirs by means of histopathological examination. Jurnal Ilmu Ternak dan Veteriner 1 (2): 129-135.

[Indonesian] Decree of the Director General of Livestock No. 18020/Kpts/PD.420/F2.3/02/2013 about: Guidelines for Implementation of Beef Cattle Breeding in Pulo Raya, Sapudi Island, and Nusa Penida Island. [Indonesian] Decree of the East Java Governor No. 188/Kpts/013/2010.The location for the Conservation and Utilization of Genetic Resources of Madura Cattle. [Indonesian] Decree of the Minister of Agriculture of the Republic of Indonesia No. 1051/Kpts/SR.120/10/2014 about: Determination of Pasundan Cattle Clumps. [Indonesian] Decree of the Minister of Agriculture of the Republic of Indonesia No. 2842/Kpts/LB.430/8/2012 about: Determination of Jabres Cattle Clumps. [Indonesian] Derajat MG. 2014. Appearance of Body Conformation Characteristics in Beef Cattle based on Gender in Rancah Sub-District, Ciamis District.

[Hon. Thesis]. Faculty of Animal Husbandry, Padjadjaran University, Sumedang [Indonesian] DGLS [Director General of Livestock Services]. 2003. National Report on Animal Genetic Resources Indonesia; A Strategic Policy Document.

Director General of Livestock Services, Jakarta. [Indonesian] DGLS [Director General of Livestock Services]. 2010a. General Guidelines for Self-Sufficiency Beef Program in 2014. Director General of Livestock Services, Jakarta. [Indonesian] DGLS [Director General of Livestock Services]. 2010b. Blue Print of Self-Sufficiency Beef Program in 2014. Director General of Livestock Services, Jakarta [Indonesian] DGLSAH [Director General of Livestock Services and Animal Healts].

2015. Guidelines for the Implementation of Strengthening Native/Local Cattle Breeding in Selected Island (Pulau Raya, Sapudi Island and Nusa Penida Island) and the Strengthening of Beef Cattle Breeding in Selected Districts (Siak, West Pasaman, South Lampung, Kebumen, Barito Kuala, Barru, Gunung Kidul, and Central Lombok).

Director General of Livestock Services and Animal Healts, Jakarta.

[Indonesian] DGLSAH [Director General of Livestock Services and Animal Healts].

2014. Preliminary figures of Population and Livestock Production in Indonesia in 2014. Director General of Livestock Services and Animal Healts, Jakarta. [Indonesian] Diwyanto K, Inounu I. 2009.The impact of crossbreeding on productive performance of beef cattle. Wartazoa 19 (2): 93-102 [Indonesian] Diwyanto K, Praharani L. 2010. Reproduction management and breeding strategies to improve productivity and quality of cattle.Proceeding of the Conservation and Improvement of World Indigenous Cattle. Bali, 3-4 September 2010.

Edwards C. J, R. Bollongino, A. Scheu, A. Chamberlain, A. Tresset et al.

2007. Mitochondrial DNA analysis shows a Near Eastern Neolithic origin for domestic cattle and no indication of domestication of European aurochs. Proc R Soc B 274: 1377-1385.

Edwards MD, Page NJ. 1994. Evaluation of marker assisted selection through computer simulation. Theor Appl Genet 88: 376-382.

Elsik CG, Tellam RL, Worley KC. 2009. The genome sequence of taurine cattle: A window to ruminant biology and evolution. Science 324 (5926): 522-528.

Endrawati E, Baliarti E, Budhi SPS. 2010. Performance of SimmentalOngole crossbreed cow and Ongole crossbreed cow feed with forage and concentrate feed. Buletin Peternakan 34 (2): 86-93.

Entwistle K, Lindsay DR (ed). 2003. Strategies to improve Bali cattle in eastern Indonesia. ACIAR Proceedings No. 110, Aciar, Canberra.

Enyew N, Bränänag E, Rottmann OJ, 1999. Reproductive performance and herd life of crossbred dairy cattle with different levels European inheritance in Ethiopia. Proceedings of the 7th annual conference of Ethiopian Society of Animal Production (ESAP), Addis Ababa, Ethiopia, 65-76.

Evitayani, Warly L, Fariani A, Ichinohe T, Fujihara T. 2004. Seasonal changes in nutritive value of some grass species in West Sumatra, Indonesia. Asian-Aust J Anim Sci 17: 1663-1668.

FAO [Feed and Agriculture Organization]. 2000. World Watch List for Domestic Animal Diversity. 3rd ed. FAO, Rome.

Febriana A, Farajallah A, Perwitasari D. 2015. Indel incident simultaneously on the intron 7 Gen branched-chain α-keto acid dehydrogenase E1a (BCKDHA) in Madura cattle. Jurnal Ilmu Pertanian Indonesia 20 (2): 97-102. [Indonesian] Felius M, Beerling ML, Buchanan DS, Theunissen B, Koolmees PA, Lenstra JA. 2014. On the history of cattle genetic resources. Diversity 6: 705-750.

Frankel O, Soule M. 1981.Conservation and Evolution. Cambridge University Press, Cambridge.

Frankham R, Briscoe DA, Ballou JD. 2002. Introduction to conservation genetics. Cambridge University Press, New York, New York, USA. Friedrich J, Brand B, Schwerin M. 2015.Genetics of cattle temperament and its impact on livestock production and breeding-a review. Archiv Fur Tierzucht 58: 13-21.

Friend J, Bishop D. 1978. Cattle World. Blandford Press, Dorset.

Galtier N, Nabbholz B, Glemin S, Hurst G.D.D. 2009. Mitochondrial DNA as a marker of molecular diversity: a reappraisal. Mol. Ecol. 18: 4541-4550.

Groeneveld LF, Lenstra JA, Eding H, Toro MA, Scherf B, Pilling D, Negrini R, Finlay EK, Jianlin H, Groeneveld E et al. 2010. Genetic diversity in farm animals: A review. Anim Genet 41: 6-31.

Gunawan (ed). 2008. Maintenance Instructions for Brahman Cross Cattle.

BPTU Sembawa, Directorate General of Livestock, Palembang.

[Indonesian] Hafid HH. 1998. Production Performance of Australian Commercial Cross Cattle Reared in Feedlots with Different Conditions of Calves Age and Fattening Time [M.Sc. Thesis]. Program of Graduates, Bogor Agricultural University, Bogor. [Indonesian] Hammack SP. 2009. Texas Adapted Genetic Strategies for Beef Cattle II: Genetic-Environmental Interaction. Agrilife Extention.Texas A & M System. No. E-187.

Hammami H, Rekik B, Gengler N. 2009. Genotype by environment interaction in dairy cattle.Biotechnol.Agron. Soc. Environ. 13 (1): 155-164.

Handiwirawan E, Subandriyo. 2004. Potential diversity of genetic resources of Bali cattle. Wartazoa 14 (3): 107-115. [Indonesian] Hannotte O, Jianlin H. 2005. Genetic characterization of livestock populations and its use in conservation decision making. In: Ruane J, Sannino A (eds.). The Role of Biotechnology in Exploring and Protecting Genetic Resources. FAO, Rome.

Hardjosubroto W. 2004.Alternative policy of sustainable management of genetic resources of local beef cattle in the local livestock breeding system. Wartazoa 14 (3): 93-97. [Indonesian] Hartati, Mariyono, Wijono DB. 2005. The response of growing Peranakan Ongole Cattle and the crossbred at feed low external input based.

Proceedings of the National Seminar on Technology of Animal Husbandry and Veterinary 2005.Research Center for Veterinary, Bogor. [Indonesian] Hartatik T, Volkandari SD, Rachmana MP, Sumadi. 2013. Polymorphism leu/val of growth hormone gene identified from Limousin cross local cattle in Indonesia. The 3rd International Conference on Sustainable Future for Human Security SUSTAIN 2012. Procedia Environ Sci 17: 105-108.

Hassanin A, Ropiquet A. 2004. Molecular phylogeny of the Tribe Bovini (Bovidae, Bovinae) and the taxonomic status of the Kouprey, Bos sauveli Urbain 1937. Mol Phylogenet Evol 33: 896-907.

SUTARNO & SETYAWAN â&#x20AC;&#x201C; Genetic diversity of Indonesian cattle Hediger R, Johnson S. E, Barendse W, Drinkwater R. D, Moore S. S, Hetzel J. 1990.Assignment of the growth hormone gene locus to 19q26-qter in cattle and to 11q25-qter in sheep by in situ hybridization. Genomics 8 171-174.

Helmer D, Gourichon L, Monchot H, Peters J, SaĂąa Segui M. 2005.Identifying early domestic cattle from prepottery Neolithic sites on the middle Euphrates using sexual dimorphism. In: Vigne JD, Peters J, Helmer D (eds.). The First Steps of Animal Domestication.Oxbow Books, Oxford, UK. Hendri Y. 2013. Development of Pesisir Cattle as a local bred of West Sumatra. J Litbang Pert 32 (1): 39-45 [Indonesian] Hilmia N, Noor RR, Sumantri C, Gurnadi RE, Priyanto R. 2013.

Productivity and genetic diversity of local cattle in Ciamis West Java.

J Indon Trop Anim Agric 38 (1): 10-19.

Ho SY, Larson G, Edwards CJ, Heupink TH, Lakin KE, Holland PW, Shapiro B. 2008. Correlating Bayesian date estimates with climatic events and domestication using a bovine case study. Biol Lett 4: 370374.

Hoj S, Fredholm M, Larsen NJ, Nielsen VH. (1993). Growth hormone gene polymorphism associated with selection for milk fat production in lines of cattle. Anim Genetics 24: 91-96.

Hosen N. 2006. Developmental prospects of local beef cattle in West Sumatra. Proceedings of the National Seminar on Revitalization of Local Potential to Achieve Self-Sufficiency of Meat 2010, in the framework of Sustainable Animal Husbandry Development and Improvement of Public Welfare, Padang, 11-12 September 2006.

[Indonesian] Huitema H. 1986. Animal Husbandry in the Tropics, Economic Meaning and Ability. Yayasan Obor Indonesia and PT Gramedia, Jakarta.

[Indonesian] ILRI [International Livestock Research Institute]. 1995. Global Agenda for Livestock Research. Proceedings of the Consultation for the South-East Asia Region. 10-13 May 1995 IRRI, Los Banos, The Philippines.

Indonesian Law No. 18/2009 on Animal Husbandry and Animal Health.

[Indonesian] Indrijani, Arifin J, Dudi, Wendry SP, Romi Z, Hilmia. 2012. Study on Identification of Local Cattle of West Java to Support SelfSufficiency Beef. [Research Report].Office of Animal Husbandry of West Java Province, Bandung. [Indonesian] Jakaria, Duryadi D, Noor RR, Tappa B, Martojo H. 2007. The relationship of MspI Growth Hormone Gene polymorphism and body weight and body measurements of West Sumatera Pesisir Cattle.J Indon Trop Anim Agric 32 (1): 33-40. [Indonesian] Jakaria, Noor RR. 2011. Analysis on Alu-I growth hormone (GHAlu-I) gene in Bali cattle. J Indon Trop Anim Agric 36 (2): 77-82.

Johari S, Kurnianto E, Sutopo, Aminah S. 2007. Diversity of blood protein as biogenetic parameter in Java cattle. J Indon Trop Anim Agric 32 (2): 112-118. [Indonesian] Kartavtsev YP, Lee JS. 2006. Analysis of nucleotide diversity at the cytochrome b and cytochrome oxidase 1 genes at the population, species, and genus levels. Genetica 4: 437-461.

Kebede G, Kebede M, Midexa T, Eshetu S. 2011. Comparative reproductive performance of Horro (Zebu) with Horro x Friesian and Horro x Jersey females in sub humid environments of Bako.Livestock Res for Rural Development, 23 (8). http://www.lrrd.org/lrrd23/8/Kebe23171.htm.

Khasrad, Ningrat RWS. 2010. Improving carcass quality of indigenous cattle of West Sumatra fed local feed resources. Pakistan J Nutr 9 (8): 822-826.

Kikkawa Y, Amano T, Suzuki H, 1995: Analysis of genetic diversity of domestic cattle in East and Southeast Asia in terms of variations in restriction sites and sequences of mitochondrial DNA. Biochem Genet 33 51-60.

Kikkawa Y, Takada T, Sutopo, Nomura K, Namikawa T, Yonekawa H, Amano T. 2003. Phylogenies using mtDNA and SRY provide evidence for male-mediated introgession in Asian domestic cattle.

Anim Genet 34 96-101.

Kikkawa Y, Yonekawa H, Suzuki H, Amano T. 1997. Analysis of genetic diversity of domestic water buffaloes and anoas based on variations in the mitochondrial gene for cytochrome b. Anim Genet 28: 195-201.

Kutsiyah F, Kusmartono, Susilawati T. 2003. Comparative study of the productivity of Madura Cattle and Its crossbreed with Limousin in Madura island. JITV 8 (2): 98-106. [Indonesian] Kutsiyah F. 2012. Analysis of beef cattle breeding on the island of Madura. Wartazoa 22 (3): 113-126. [Indonesian]

351

Lande R, Thompson R. 1990. Efficiency of marker-assisted selection in the improvement of quantitative traits. Genetics 124, 743-756.

Lenstra JA, Bradley DG. 1999. Systematics and phylogeny of cattle. In: Fries R, Ruvinsky A (eds) The Genetics of Cattle. CAB International, Wallingford.

Lestari CMS. 2012. Exploration Potential of Jabres Cattle Production, as Local Beef with Method of In vivo and Non-invasive to the In situ and Ex situ Maintenance. [Dissertation].School of Graduates, University of Diponegoro, Semarang. [Indonesian] Liu RY, Yang GS, Lei CZ. 2006. The genetic diversity of mtDNA DLoop and the origin of Chinese goats. Acta Genetica Sinica33: 420428.

Long JA. 2008. Reproductive biotechnology and gene mapping: Tools for conserving rare breeds of livestock. Reprod. Dom. Anim. 43: 83-88.

MacHugh D.E. 1996. Molecular biogeography and genetic structure of domesticated cattle [M.Sc. Thesis]. Department of Genetics. Trinity College, Univ. Dublin, Dublin.

Madani T, Yakhlef H, Marie M. 2008. Effect of age at first calving on lactation and reproduction of dairy cows reared in semi arid region of Algeria. Livest Res Rural Dev 20 (6): 121-129.

Mahbubi A. 2014. Madura development program as a cattle island; perspective of sustainable cattle supply chain management.

Agronomika 3 (2): 98-109. [Indonesian] Maintenance of Dairy Cow Lactation in Lowlands Area Mao YJ, Chang H, Yang ZP, Xu M, Zhang L, Chang GB. 2006. The genetic diversity and phylogenetics status of Luxi cattle. Agric Sci in China. 5: 629-634.

Margana S. 2007. Java's last frontier : the struggle for hegemony of Blambangan, c. 1763-1813. [Ph.D. Dissertation]. Faculty of Arts, Leiden University, The Nederland.

Mariani R. 2013. Prospects and Challenges of Pesisir Cattle Development.

Harian Padang Ekpress. http://padangekpress.co.id/ 2news=nberita&id.2862. [17 Februari 2013. [Indonesian] Martojo H. 2003. Indigenous Bali Cattle: The Best Suited Cattle Breed for Sustainable Small Farms in Indonesia. Laboratory of Animal Breeding and Genetics, Faculty of Animal Science, Bogor Agricultural University, Bogor. [Indonesian] Martojo H. 2012. Indigenous Bali Cattle is Most Suitable for Sustainable Small Farming in Indonesia. Reprod Domest Anim 47: 10-14.

Mason IL. 1988. World Dictionary of Livestock Breeds. 3rd edn. CAB International; Wallingford, CT, USA. Mastuti WTS. 2014. Impact Assessment of Exotic Cattle Breeds on Indigenous Cattle Genetic Resources, Farming Systems, and Rural Livelihoods in Indonesia. [Ph.D. Dissertation]. Wageningen University, Wageningen.

Maylinda S. 2011. Genetic polymorphism of growth hormone locus and its associations with body weight in Grati dairy cows. Int J Biotechnol Mol Biol Res 2: 117-120.

McCool C, 1992: Buffalo and Bali cattle-exploiting their reproductive behaviour and physiology. Trop Anim Health Prod 24: 165-172.

Meijer W. C. P. 1962. Das Balirind. A. Ziemsen Verslag, Wittenberg Lutherstandt. Meirelles FV, Rosa AJM, Garcia JM, Lobo RB, Smith LC, Duarte FAM. 1999. Is the American Zebu really a Bos indicus?

Genet Mol Biol 22: 543-546.

Meyer K. 1992. Variance components due to direct and maternal effects for growth Traits of Australian beef cattle. Livest Prod Sci 31: 179204.

Mohamad K, Olsson M, van Tol HTA, Mikko S, Vlamings BH, Andersson G, Rodriguez-Martinez H, Purwantara BE, Paling RW, Colenbrander B, Lenstra JA. 2009. On the origin of Indonesian cattle.

PLoS ONE 4 (5): e5490. http://doi.org/b65mtp Mohapatra SC. 2004. Social and economic implications of biodiversity in livestock. In: Kornel, D, S.C. Mohapatra, S.P.S Alhawat, A .Tripathy (eds) Biodiversity of Livestock in Orissa and its role (2004). Swiss Agency for Development and Cooperation, New Delhi, India.

Moran J. 1985.Comparative performance of five genotypes of Indonesian large ruminants. 1. Effect of dietary quality on liveweight and feed utilization. Aust J Agic Res 36 (5): 743-752.

Mulder HA, Bijma P. 2005. Effects of genotype x environment interaction on genetic gain in breeding programs. J. Anim. Sci. 83: 49-61.

Munadi 2010.Potential and alternative development of Brebes typical Javanese cattle (Jabres).Proceedings of the National Seminar on Agribusiness Development Perspectives in Indonesia. Faculty of Animal Husbandry, Universitas Jenderal Soedirman, Purwokerto.

[Indonesian] Namikawa T. 1981. Geographic distribution of bovine Hemoglobin-beta

352

B I O D I V E R S IT A S 16 (2): 327-354, October 2015

(Hbb) alleles and the phylogenetic analysis of the cattle in Eastern Asia. Z Tierzuchtg Zuchtgsbiol 98 151-159.

Ngadiono N. 1995. Growth and Qualities of Carcass and Beef of Sumba Ongole, Brahman Cross and the Australian Commercial Cross intensively reared at Various Cut Weight. [Ph.D. Dissertation]. Bogor Agricultural University, Bogor. [Indonesian] Nijman IJ, Otsen M, Verkaar E.L.C, Ruijter C.D, Hanekamp E et al. 2003.

Hybridization of banteng (Bos javanicus) and zebu (Bos indicus) revealed by mitochondrial DNA, satellite DNA, AFLP and microsatellites. Heredity 90: 10-16.

Noor RR, Farajallah A, Karmita M. 2011. The purity test of Bali cattle by haemoglobin analysis using the isoelectric focusing method. J Hayati 8: 107-111 Nozawa K. 1979. Phylogenetics studies on the native Domestic animals in East And Southeast Asia. Proceeding of Workshop Animals Genetics Resources in Asia and Oceania. Tsakuba, 3-7 September 1979.

Society for the Advancement of Breeding Researches in Asia and Oceania (SABRAO) 23-43.

NRC [National Research Council]. 1983. Little-Known Asian Animals with a Promising Economic Future. National Academic Press, Washington, D.C. Nugroho H. 2012. Productive Performances of PO cattle and its crosses at Small Holders Conditions at Different Altitudes of East Java.[PhD Dissertation]. Post Graduate Program in Animal Science. University of Brawijaya, Malang, Indonesia.

OAHAHP Pesisir Selatan District. 2012. Report of the Office of Agriculture, Horticulture, Plantation and Livestock of Pesisir Selatan district. Office of Agriculture and Horticulture, Animal Husbandry and Plantation, Pesisir Selatan District, Painan. [Indonesian] Office of Animal Husbandry East Java Province. 2009. Animal Husbandry in Figures. Office of Animal Husbandry East Java Province, Surabaya. [Indonesian] Okumura T, Saito K, Sakuma H, Nade T, Nakayama S, Fujita K, Kawamura T. 2007. Intramuscular fat deposition in principal muscles from twenty-four to thirty months of age using identical twins of Japanese Black steers. J Anim Sci 85 (8): 1902-1907.

Olori VE, Monwissen TH, Veerkamp H. 2002. Calving interval and survival breeding values as measure of cow fertility in a pasture-based production system with seasonal calving. J Dairy Sci 85 (3): 689-696.

[Indonesian] Omerling FJ. 1957. The Timor Problem. A Geographical Interpretation of an Underdeveloped.Island.2nd ed. J. B. Wolters, Groningen, Netherlands.

Pamungkas D, Antari R, Mayberry DE, Poppi DP. 2012. A Growth Comparison of Ongole and European Cross Cattle kept by Smallholder Farmers in Indonesia. Proceeding of the 15th AsianAustralian Animal Production (AAAP) Congress, Bangkok, Thailand, Bangkok, Thailand, November 2012.

Pane I. 1991. Produktivity and Breeding of Bali Cattle. Faculty of Animal Science, University of Hasanuddin, Ujung Pandang. [Indonesian] Paputungan U, Hakim L, Ciptadi G, Lapian HNF. 2013. Polymorphism of growth hormone MspI enzyme-restriction associated with production performance of Ongole-Crossbred cattle mated by artificial insemination technique. J Basic Appl Sci Res 3 (6): 581-589.

Payne WJA, Hodges J. 1997. Tropical Cattle: Origin, Breeding and Breeding Policies. Blackwell Science, Oxford, UK, Payne WJA, Rollinson DHL. 1973. Bali cattle. World Anim Rev 7: 13-21.

Payne WJA. 1970. Cattle Production in the Tropics. Logman, London.

Pribadi LW, Maylinda S, Nasich M, Suyadi S. 2014. Prepubertal growth rate of Bali cattle and its crosses with Simmental breed at lowland and highland environment, IOSR J Agric Vet Sci 7 (2): 52-59.

Purnomoadi A, W. Bela, S. Dartosukarno. 2003. Eating behavior of Ongole crossbred and Limousin crossbred steers fed fermented rice straw and concentrate. Jurnal Ilmu Ternak dan Veteriner 8 (4): 276280.

Purwoko A, Sutarno, Etikawati N. 2003. DNA polymorphism at locus-2 growth hormone gene of Madura cattle growth. Biodiversitas 4: 7-11.

Putra WPB, Hartatik T, Sumadi. 2013. Growth hormone gene genotyping

by MspI restriction enzyme and PCR-RFLP methods in Aceh cattle breed at Indrapuri district of Aceh province. J Indon Trop Anim Agric 38 (4): 207-211.

Putra WPB, Hartatik T, Sumadi. 2014. Growth hormone genotyping by MspI restriction enzyme and PCR-RFLP method in Aceh cattle breed at Indrapuri District, Aceh Province, Indonesia. Biodiversitas 15: 1-5.

Putro P. 2009.Crossbreeding Impact on the Reproduction of Parent Offspring, Clinical Study Results. Workshop on Crossbreeding Cattle

in Indonesia: Applications and Implications for Development of Cattle in Indonesia, Lustrum VIII, Faculty of Animal Science, Gadjah Mada University, Yogyakarta 8 August 2009. [Indonesian] Qiu Q, Zhang G, Ma T, Qian W, Wang J et al. 2012. The yak genome and adaptation to life at high altitude. Nat Genet 44: 946-949.

Rahayu S, Susiati, Ciptadi G, Dikman DM. 2014. The MspI Polymorphism of the BMP-15 Gene in Indonesian PO Cattle. Res J Pharmaceut Biol Chem Sci 5 (2): 1832-1837.

Rahmawati SA, Harijani N, Lamid M. 2015. Analysis revenue of Madura and Madrasin cattle ranchers in the village of Taman Sereh, Sampang Sub-District. Agroveteriner 3 (2): 107-113. [Indonesian] Ratnawati D, Rasyid A, Affandhi L.2008. The Capable Productivity of Imported and Derivative Dairy Cattle in East Java: Case Study in Low Land and Up Land of Pasuruan. Prosiding Semiloka Nasional Prospek Industri Sapi Perah Menuju Perdagangan Bebas-2020.

Indonesia Research Central for Veterinary Science, Bogor, 21 April 2008. [Indonesian] Regional Regulation of Bali Province No. 2/2003 about Expenditure of Bali Beef Cattle Regulation of the Minister of Forestry of the Republic of Indonesia No. P.58/Menhut-II/2011 about: Strategy and Action Plan for Conservation of Banteng (Bos javanicus) in 2010-2020. [Indonesian] Rocha JL, Baker JF, Womack JE, Sanders JO, Taylor JF. 1992. Statistical associations between restriction fragment length polymorphism and quantitative traits in beef cattle. J Anim Sci 70: 3360-3370.

Sahin A, Ulutas Z, Adkinson AY, Adkinson RW. 2012. Genetic and environmental parameters and trends for milk production of Holstein cattle in Turkey. Italian J Anim Sci 11 (e44): 242-248.

Saladin R. 1983. The Performance of Production and Reproduction Properties of Pesisir Selatan Local Cattle of West Sumatra.[Dissertation].School of Graduates. Bogor Agricultural University, Bogor. [Indonesian] Samad MS, Soeradji.1990. General Animal Husbandry. CV. Yasaguna.

Jakarta. [Indonesian] Sarbaini. 2004. Study on Diversity of External Characteristics and DNA Microsatellite o Pesisir cattle, West Sumatra. [Ph.D. Dissertation].School of Graduates, Bogor Agricultural University, Bogor. [Indonesian] Sariubang M. 1992. Feedloting system of Grati cattle. Sub Research Center for Animal Production Grati, Pasuruan. [Indonesian] Schlee P, Graml R, Rottmann O, Pirchner F. 1994a. Influence of GrowthHormone genotypes on breeding values of Simmental Bulls.

Zeitschrift fur Tierzuchtung und Zuchtungsbiologie 111: 253-256.

Schlee P, Graml R, Schallenberger E, Schams D, Rottmann O, Olbrichbludau A, Pirchner F. 1994b. Growth Hormone and insulin like growth Factor I concentrations in bulls of various growth hormone genotypes. Theor Appl Genet 88: 497-500.

Schutz MM, Freeman AE, Lindberg GL, Beitz DC. 1993. Effects of maternal lineages grouped by mitochondrial genotypes on milk yield and composition. J Dairy Sci 76: 621-629.

Schutz MM, Freeman AE, Lindberg GL, Koehler CM, Beitz DC, Bradley DG, Machugh DE, Cunningham P, Loftus RT. 1994. The effect of mitochondrial DNA on milk production and health of dairy cattle mitochondrial diversity and the origins of African and European cattle. Livest Prod Sci 37: 283-295.

Siregar AR. 1995. Potential and characteristics of Madura cattle. Jurnal Penelitian dan Pengembangan Pertanian 4 (2): -. [Indonesian] Siregar SB, Tambing SN, Sitorus P. 1996. Efforts to accelerate increasing of beef cattle population through implementation of artificial insemination in Ciamis, West Java. Jurnal Penelitian Peternakan Indonesia 2 (2): 31-35. [Indonesian] Siregar SB. 1996. Maintenance of Dairy Cow Lactation in Lowlands areas. Center for Agricultural Research and Development, Ministry of Agriculture, Bogor. [Indonesian] Siswijono SB, Subagiyo I, Nurgiartiningsih VMA, Kusmartono, Hartutik, Tadjuddin. 2010. Perception of Madurese community on crossbreeding program of limousine and native Madura beef cattle in Madura Island of Indonesia. 9th World Congress on Genetics Applied to Livestock Production, Leipzig, Germany, August 1-6, 2010 Sodhi M, Mukesh M, Prakash B, Ahlawat SPS, Sobti RC. 2006.

Microsatellite DNA typing for assessment of genetic variability in Tharparkar breed of Indian zebu (Bos indicus) cattle, a major breed of Rajasthan. Genetics 85: 165-170.

Soehadji. 2009. History of Milk industry. Directorate General of Agro and Chemical Industry, Ministry of Industry, Jakarta. [Indonesian] Somarny WWMZ, Ruzainah, Aslinda A, K. Mohd. Hafiz AW, Md Tasol

SUTARNO & SETYAWAN â&#x20AC;&#x201C; Genetic diversity of Indonesian cattle S et al. 2015. MtDNA diversity and genetic lineages of four cattle breeds in Malaysia. Mal J Anim Sci 18 (1): 23-33 St John JC, Lloyd REI, Bowles EJ, Thomas EC, Shourbagy SE. 2004.The consequences of nuclear transfer for mammalian foetal development and offspring survival. A mitochondrial DNA perspective.

Reproduction 127: 631-641 Sudarma IAI. 2013. Production Problems of Pastoral Livestock in East Nusa Tenggara. Graduate Program, University of Nusa Cendana, Kupang. [Indonesian] Sudono A, Rosdiana F, Setiawan BS. 2003. Intensive Dairy Cattle Farming. Agromedia Pustaka. Jakarta. [Indonesian] Sullivan GM, Diwyanto K. 2007. A Value Chain Assessment of the Livestock Sector in Indonesia. United States Agency for International Development, Washington DC. Susilawati T, Subagyo I, Budiarto A, Ciptadi G, Kuswati. 2002.

Phenotype and Genotype Identification of Local Breed for Conservation and Improvement Strategies of Local Cattle Production in East Java. Faculty of Animal Husbandry, Brawijaya University, Malang and Office of Livestock Production, East Java Province, Surabaya. [Indonesian] Susilawati T. 2004. Local Cattle of Indonesia.[Research Report].Faculty of Animal Husbandry, Brawijaya University, Malang. [Indonesian] Susilorini. 2010. Farming of 22 Potential Livestock. Penebar Swadaya, Jakarta. [Indonesian] Sutarno, Cummins JM, Greeff J, Lymbery AJ. 2002a. Mitochondrial DNA polymorphisms and fertility in beef cattle. Theriogenology 57: 16031610.

Sutarno, Junaidi A, Purwoko A, Lelana NI. 2012. Identification and characterisation of the polymorphic growth hormone gene of the Bali cattle, the Madura cattle and Ongole cattle. Biodiversitas 3 (1): 169173.

Sutarno, Junaidi A, Tapa B. 2003 Selection to Acquire Local Beef of Indonesia, which Superior in Meat Production (growth) through a Selection based on the Gene Markers of Growth Hormone Gene.

Reports of RUT-VIII, Research Institute, University of Sebelas Maret, Surakarta. [Indonesian] Sutarno, Junaidi A, Tappa B. 2002b. Growth hormone gene variations and meat production (growth) of Indonesian local cattle. Proceeding of the 3rd International Seminar on Tropical Animal Production, October 15-16, 2002, Faculty of Animal Science, Gadjah Mada University, Yogyakarta.

Sutarno, Junaidi A. 2001. Identification and characterization of bovine growth hormone gene and mitochondrial DNA variations of Indonesian native cattle. Proceeding of ITSF One Day Seminar on Science and Technology January 29 th 2001, Hilton International Hotel, Jakarta.

Sutarno, Lymbery AJ, Thompson RCA, Cummins JM. 1996. Associations Between Growth Hormone Genotypes and Estimated Breeding Values for Pre weaning Growth of Beef Cattle. Proceeding of the 13th International Congress on Animal Reproduction, Darling Harbour Convention Centre, Sydney, Australia, June 30-July 4, 1996.

Sutarno, Setyawan AD, Lymbery AJ. 2015. Genetic diversity of five Indonesian native cattle breeds at microsatellite loci. Asian J Anim Sci 9: 57-64.

Sutarno, Setyawan AD. 2015. Diversity of local Indonesian cattle and effort to development the superior cattle. International Conference of Biodiversity and Sustainable Industry, University of Sebelas Maret, Surakarta, 5-6 November 2015.

Sutarno. 1998. Candidate Gene Marker for Production Traits in Beef Cattle. [Ph.D. Dissertation], Murdoch University, Perth, Australia.

Sutarno. 2003. Selection for obtaining Local Beef Cattle of Indonesia types of Benggala that Superion in Meat Production through Molecular Genetic Technology. Final Research Reports of RUT-IX, Research Institute, Sebelas Maret University, Surakarta. [Indonesian] Sutarno. 2006. Use of Molecular Techniques for Improving Nature of Animal Production. Inaguration of Professorship speech in the field of Molecular Genetics, Faculty of Mathematics and Natural Sciences, University of Sebelas Maret in the Senate Open Meeting of University of Sebelas Maret, on March 18, 2006. [Indonesian] Sutarno. 2010. Genetic variation among Indonesian native cattle breeds based on polymorphisms analysis in the growth hormone loci and mitochondrial DNA. Biodiversitas 11: 1-5.

Suwiti NK, Rantam FA, Besung INK. 2008. Detection of the class I and class II proteins of bovine major histocompatibility complex in Madura cattle. Jurnal Veteriner 9 (3): 147-151. [Indonesian] Suyadi S, Hakim L, S. Wahjuningsih, H. Nugroho. 2014. Reproductive

353

performance of Peranakan Ongole (PO)-and Limousin x PO Crossbred (Limpo) cattle at different altitude areas in East Java, Indonesia. J Appl Sci Agric 9 (11): 81-85.

Syarif EK, Harianto B. 2011. Farming and Business of Dairy Cattle.

Agromedia Pustaka, Jakarta. []Indonesian] Talib C, Entwistle K, Siregar A, Budiarti-Turner S, Lindsay D. 2002.

Survey of population and production dynamics of Bali cattle and existing breeding programs in Indonesia. In: Proceeding of an ACIAR Workshop on Strategies to Improve Bali Cattle in Eastern Indonesia, Denpasar, Bali, Indonesia.

Tang G, Stewart J, Plastow G, Moore S, Wang Z. 2011. Optimizing a beef production system using specialized sire and dam lines. Can J Anim Sci 91: 353-361.

Tavirimirwa B, Mwembe R, Ngulube B, Banana NYD, Nyamushamba GB, Ncube S, Nkomboni D. 2013. Communal cattle production in Zimbabwe: A review. Livest Res Rural Dev 25 (12). http://www.lrrd.org/lrrd25/12/tavi25217.htm. [2 October 2015] Tempo 27.06.2013. Thousands of Cattle Disturb Banteng Habitat in Baluran. http://nasional.tempo.co/read/news/2013/06/27/206491636/ribuansapi-ganggu-habitat-banteng-baluran [2 October 2015] Tenaya IWM. 2010. Studies of the pathogenesis of Jembrana disease virus infection in Bos javanicus [Ph.D. Dissertation]. Murdoch University, Perth, Australia.

Toelihere MR. 1981. Artificial Insemination in Livestock. P.T. Angkasa, Bandung. [Indonesian] Turner HL. 1977. The Tropical Adaptation of Beef Cattle an Australian Study. In: Animal Breeding: Selected Articles from The World Animal Review. FAO Animal Production and Health Paper 1: 92-97.

Umar S. 2009. Potential of Oil Palm Plantations for Development Centre of Beef Cattle in Revitalizes and Accelerate Sustainable Development of Animal Husbandry. Inauguration of Professorship speech in the field of Animal Reproduction Science, Faculty of Agriculture, University of North Sumatra, Medan. [Indonesian] Utomo B, Oelviani R, Subiharta. 2015. Enhancing perfomance of weaned Ongole calf through management improvement using local resources.

Pros Sem Nas Masy Biodiv Indon 1: 838-842. [Indonesian] Uzzaman MR, Bhuiyan MSA, Edea Z, Kim KS. 2004. Semi-domesticated and Irreplaceable Genetic Resource Gayal (Bos frontalis) Needs Effective Genetic Conservation in Bangladesh: A Review. Asian Austr J Anim Sci 27 (9): 1368-1372 Verkaar ELC, Nijman IJ, Boutaga K, Lenstra JA. 2002. Differentiation of cattle species in beef by PCR-RFLP of mitochondrial and satellite DNA. Meat Sci. 60: 365-369.

Vigne JD. The origins of animal domestication and husbandry: A major change in the history of humanity and the biosphere. C R Biol 334: 171-181.

Widi TSM, Udo HMJ, Oldenbroek K, Budisatria IGS, Baliarti E, van der Zijpp AJ. 2013. Unique cultural values of Madura cattle: is Crossbreeding a threat?

Anim Genet Resour.

DOI: 10.1017/S2078633613000349 Wijono DB, Bambang S. 2004. Potential and Diversity of Genetic Resources of Madura Cattle.National Workshop on Beef Cattle.Livestock Research Center, Pasuruan. [Indonesian] Wilcox G.E, Chadwick B.J, Kertayadnya G. 1995. Recent advances in the understanding of Jembrana disease. Vet Microbiol 46: 249-255.

Wilcox GE, Kertayadnya G. Hartaningsih N. Dharma DMN, Soeharsono S, Robertson T. 1992. Evidence for viral aethology of Jembrana disease in Bali cattle. Vet Microbiol 33: 367-374.

Williamson G, Payne WJA. 1980. An introduction to animal husbandry in the tropics. Tata McGrow-Hill Pub.Co.Ltd, New Delhi, India.

Winaya A, Muladno, Gurnadi RE, Saefuddin A. 2009. Y chromosome microsatellites variation in Bali cattle (Bos sondaicus) population.

Anim Prod 11 (3): 149-154.

Winkelmann DC, Querengesser LD, Hodgetts RB. 1990. Growth hormone restriction fragment length polymorphisms that segregate with 42-day live weight mice. Genome 33 (2): 235-239.

Wirdahayati RB. 1994. Reproductive characteristics and productivity of Bali and Ongole cattle in Nusa Tenggara, Indonesia. [Ph.D. Dissertation].Depatment of Farm Ainmal Medicine and Production.The University of Queensland, Brisbane, Australia.

Wirdahayati RB. 2010. The application of technology to improve productivity of beef cattle in East Nusa Tenggara. Wartazoa 20 (1): 12-20. [Indonesian] Wiyatna MF, Gurnadi E, Mudikdjo K. 2012. Productivity of Peranakan Ongole cattle on the community husbanry in Sumedang District.

Jurnal Ilmu Peternakan 12 (2): 22-25. [Indonesian]

354

B I O D I V E R S IT A S 16 (2): 327-354, October 2015

Yeates NT, Schmidt PJ, Young JS. 1975. Beef Cattle Production.

Butterworths Pty. Limited, Brisbane.

Yulyanto CA, Susilawati T, Ihsan MN. 2014. Reproductive performance of Peranakan Ongole (PO) and Limousin Crossbreeds cattle in the sub-district Sawoo, Ponorogo and sub-district Tugu, Trenggalek.

Jurnal Ilmu-Ilmu Peternakan 24 (2): 49-57. [Indonesian] Yunita ARE. 2012. Existence of Peunuwo Meugang by New Bride in the village of Nigan, Seunagan sub-District, Nagan Raya. Studies

Program of Anthropology Education, State University of Medan, Medan. [Indonesian] Zardoya R, Meyer A. 1996. Phylogenetic performance mitochondria protein coding genes in resolving relationship among vertebrates.

Mol. Biol. Evol. 13: 933-942.

Zulkharnaim, Jakaria, Noor RR. 2010. Identification of genetic diversity of growth hormone receptor (GHR/Alu I) gene in Ba li cattle. Media Peternakan 33: 81-87.

ISSN: 1412-033X E-ISSN: 2085-4722

Potential distribution of Monotropa uniflora as a surrogate for range of Monotropoideae (Ericaceae) in South Asia PRAKASH PRADHAN

109-115

A new record of plant parasitic green algae, Cephaleuros diffusus (Trentepohliaceae, Chlorophyta), on Acacia auriculiformis hosts in Thailand ANURAG SUNPAPAO, MUTIARA K. PITALOKA

116-120

Traditional dye yielding plants of Tripura, Northeast India BISWAJIT SUTRADHAR, DIPANKAR DEB, KOUSHIK MAJUMDAR, B.K. DATTA

121-127

Genetic diversity of Rana (Pelophylax) ridibunda and Bufo (Pseudepidalea) viridis in different populations TAYEBEH MOSLEHI, MAJID MAHDIEH, ALIREZA SHAYESTEHFAR, SEYED MEHDI TALEBI

128-131

Genetic diversity of patchouli cultivated in Bali as detected using ISSR and RAPD markers MADE PHARMAWATI, I PUTU CANDRA

132-138

Population genetic structure in medicinal plant Lallemantia iberica (Lamiaceae) FAHIMEH KOOHDAR, MASOUD SHEIDAI, SEYYED MEHDI TALEBI, ZAHRA NOORMOHAMMADI

139-144

Within and among-genetic variation in Asian flax Linum austriacum (Linaceae) in response to latitude changes: Cytogenetic and molecular analyses ZAHRA NOORMOHAMMADI, TINA SHAFAF, FATEMEH FARAHANI, MASOUD SHEIDAI, SEYED MEHDI TALEBI, YEGANEH HASHEMINEJAD-AHANGARANI-FARAHANI

145-150

Felids of Sebangau: Camera trapping to estimate activity patterns and population abundance in Central Kalimantan, Indonesia ADUL, BERNAT RIPOLL, SUWIDO H. LIMIN, SUSAN M. CHEYNE

151-155

The nutritional quality of captive sambar deer (Rusa unicolor brookei Hose, 1893) velvet antler GONO SEMIADI, YULIASRI JAMAL

156-160

Structure of natural Juniperus excelsa stands in Northwest of Iran FARZAM TAVANKAR

161-167

Phylogeny analysis of Colutea L. (Fabaceae) from Iran based on ITS sequence data LEILA MIRZAEI, IRAJ MEHREGAN, TAHER NEJADSATARI, MOSTAFA ASSADI

168-172

Study of the digestive tract of a rare species of Iranian blind cave fish (Iranocypris typhlops) ALI EBRAHIMI

173-178

Bayesian and Multivariate Analyses of combined molecular and morphological data in Linum austriacum(Linaceae) populations: Evidence for infraspecific taxonomic groups FATIMA AFSHAR, MASOUD SHEIDAI, SEYED-MEHDI TALEBI, MARYAM KESHAVARZI

179-187

Impact of Gujjar Rehabilitation Programme on the group size of Asian elephants (Elephas maximus) in Rajaji National Park, North-West India RITESH JOSHI

188-195

Diversity of butterflies in four different forest types in Mount Slamet, Central Java, Indonesia IMAM WIDHIONO

196-204

Recovery of plant diversity and soil nutrients during stand development in subtropical forests of Mizoram, Northeast India SH. B. SINGH, B.P. MISHRA, S.K. TRIPATHI

205-212

Conservation status of the Family Orchidaceae in Mt. Sinaka, Arakan, North Cotabato, Philippines CHERRY LEE T. PANAL, JENNIFER G. OPISO, GUILLER OPISO

213-224

Taxonomy and distribution of species of the genus Acanthus (Acanthaceae) in mangroves of the Andaman and Nicobar Islands, India P. RAGAVAN, ALOK SAXENA, P.M. MOHAN, R.S.C. JAYARAJ, K. RAVICHANDRAN

225-237

Isolation and characterization of a molybdenum-reducing and SDS-degrading Klebsiella oxytoca strain Aft-7 and its bioremediation application in the environment NORAZLINA MASDOR, MOHD SHUKRI ABD SHUKOR, AFTAB KHAN, MOHD IZUAN EFFENDI BIN HALMI, SITI ROZAIMAH SHEIKH ABDULLAH, NOR ARIPIN SHAMAAN, MOHD YUNUS SHUKOR

238-246

Assesment of genetic diversity among soursop (Annona muricata) populations from Java, Indonesia using RAPD markers SURATMAN, ARI PITOYO, SRI MULYANI, SURANTO

247-253

Molecular phylogeny inferred from mitochondrial DNA of the grouper Epinephelus spp. in Indonesia collected from local fish market EDWIN JEFRI, NEVIATY P. ZAMANI, BEGINER SUBHAN, HAWIS H. MADDUPPA

254-263

Short communication: Microfungal diversity on leaves of Eusideroxylon zwageri, a threatened plant species in Sarawak, Northern Borneo A. LATEEF ADEBOLA, MUID SEPIAH, MOHAMAD H. BOLHASSAN, MANSOR WAN ZAMIR

264-268

Leguminicolous fungi associated with some seeds of Sudanese legumes SOHAIR A. ABDULWEHAB, SAIFELDIN A. F. EL-NAGERABI, ABDULQADIR E. ELSHAFIE

269-280

Diversity in antioxidant properties and mineral contents of Allium paradoxum in the Hyrcanian forests, Northern Iran SEDIGHEH KHODADADI, TAHER NEJADSATTARI, ALIREZA NAQINEZHAD, MOHAMMAD ALI EBRAHIMZADEH

281-287

Genetic and morphological diversity in Cousinia cylindracea (Asteraceae) populations: Identification of gene pools AMIR ABBAS MINAEIFAR, MASOUD SHEIDAI, FARIDEH ATTAR

288-294

Threats and conservation of Paris polyphylla an endangered, highly exploited medicinal plant in the Indian Himalayan Region ASHISH PAUL, PADMA RAJ GAJUREL, ARUP KUMAR DAS

295-302

Growth, development and morphology of gametophytes of golden chicken fern (Cibotium barometz (L.) J. Sm.) in natural media TITIEN NGATINEM PRAPTOSUWIRYO, DIDIT OKTA PRIBADI, RUGAYAH

303-310

Spatial point pattern analysis of the Sumatran tiger (Panthera tigris sumatrae) poaching cases in and around Kerinci Seblat National Park, Sumatra FARID RIFAIE, JITO SUGARDJITO, YULI SULISTYA FITRIANA

311-319

Potential in bioethanol production from various ethanol fermenting microorganisms using rice husk as substrate WOOTTICHAI NACHAIWIENG, SAISAMORN LUMYONG, RONACHAI PRATANAPHON, KOICHI YOSHIOKA, CHARTCHAI KHANONGNUCH

320-326

Review: Genetic diversity of local and exotic cattle and their crossbreeding impact on the quality of Indonesian cattle SUTARNO, AHMAD DWI SETYAWAN

327-354

GUIDANCE FOR AUTHORS Aims and Scope Biodiversitas, Journal of Biological Diversity or abbreviated as Biodiversitas encourages submission of manuscripts dealing with all biodiversity aspects of plants, animals and microbes at the level of the gene, species, and ecosystem as well as ethnobiology.

Article types The journal seeks original full-length research papers, reviews, and short communication. Manuscript of original research should be written in no more than 8,000 words (including tables and picture), or proportional with articles in this publication number. Review articles will be accommodated, while, short communication should be written in about 2,000 words, except for pre-study.

Submission The journal only accepts online submission, through email to the editors at unsjournals@gmail.com. Submitted manuscripts should be the original works of the author(s). The manuscript must be accompanied by a cover letter containing the article title, the first name and last name of all the authors, a paragraph describing the claimed novelty of the findings versus current knowledge. Submission of a manuscript implies that the submitted work has not been published before (except as part of a thesis or report, or abstract); and is not being considered for publication elsewhere. When a manuscript written by a group, all authors should read and approve the final version of the submitted manuscript and its revision; and agree the submission of manuscripts for this journal. All authors should have made substantial contributions to the concept and design of the research, acquisition of the data and its analysis; drafting of the manuscript and correcting of the revision. All authors must be responsible for the quality, accuracy, and ethics of the work.

Ethics Author(s) must obedient to the law and/or ethics in treating the object of research and pay attention to the legality of material sources and intellectual property rights.

Copyright If and when the manuscript is accepted for publication, the author(s) automatically agree to assign exclusive copyright of the accepted manuscript to Biodiversitas. Author(s) shall no longer be allowed to publish manuscript elsewhere, in whole or part, without permission. For the new invention, the authors suggested to manage its patent before publishing it.

Open access The journal is committed to free-open access that does not charge readers or their institutions for access. Users are entitled to read, download, copy, distribute, print, search, or link to the full texts of articles, as long as not for commercial purposes.

Acceptance The only articles written in English (U.S. English) are accepted for publication. Manuscripts will be reviewed by editors and invited reviewers according to their disciplines. Authors will generally be notified of acceptance, rejection, or need for revision within 1 to 2 months of receipt. The manuscript is rejected if the content does not in line with the journal scope, does not meet the standard quality, inappropriate format, complicated grammar, dishonesty (i.e. plagiarism, duplicate publications, fabrication of data, citations manipulation, etc.), or ignoring correspondence in three months. The primary criteria for publication are scientific quality and biodiversity significance. Uncorrected proofs will be sent to the corresponding author by email as .doc or .docx files for checking and correcting of typographical errors. To avoid delay in publication, corrected proofs should be returned in 7 days. The accepted papers will be published online in a chronological order at any time, but printed in April and October.

A charge There is free of charge for members of Society for Indonesian Biodiversity (SIB) and/or non-Indonesian author(s). The cost of each manuscript is IDR 450,000,- for Indonesian non-SIB members. However, starting on January 1, 2016, every submitted manuscript will be charged USD 250 when publishing (not for previously submitted manuscripts).

Reprints The sample journal reprint is only available by special request.

Additional copies may be purchased when ordering by sending back the uncorrected proofs by email.

Manuscript preparation Manuscript is typed on A4 (210x297 mm2) paper size, in a single column, single space, 10-point (10 pt) Times New Roman font. The margin text is 3 cm from the top, 2 cm from the bottom, and 1.8 cm from the left and right. Smaller lettering size can be applied in presenting table and figure (9 pt). Word processing program or additional software can be used, however, it must be PC compatible and Microsoft Word based (.doc or .docx). Scientific names of species (incl. subspecies, variety, etc.) should be written in italic, except for italic sentence. Scientific name (genera, species, author), and cultivar or strain should be mentioned completely for the first time mentioning it in the body text, especially for taxonomic manuscripts. Name of genera can be shortened after first mentioning, except generating confusion. Name of the author can be eliminated after first mentioning. For example, Rhizopus oryzae L. UICC 524, hereinafter can be written as R. oryzae UICC 524. Using trivial name should be avoided, otherwise generating confusion. Biochemical and chemical nomenclature should follow the order of the IUPAC - IUB. For DNA sequence, it is better used Courier New font. Symbols of standard chemical and abbreviation of chemistry name can be applied for common and clear used, for example, completely written butilic hydroxyl toluene (BHT) to be BHT hereinafter.

Metric measurement use IS denomination, usage other system should follow the value of equivalent with the denomination of IS first mentioning.

Abbreviations set of, like g, mg, mL, etc. do not follow by dot. Minus index (m-2, L-1, h-1) suggested to be used, except in things like "per-plant" or "perplot". Equation of mathematics does not always can be written down in one column with text, in that case can be written separately. Number one to ten are

expressed with words, except if it relates to measurement, while values above them written in number, except in early sentence. The fraction should be expressed in decimal. In the text, it should be used "%" rather than "percent".

Avoid expressing ideas with complicated sentence and verbiage, and used efficient and effective sentence.

Title of the article should be written in compact, clear, and informative sentence, preferably not more than 20 words. Name of author(s) should be completely written. Name and institution address should also be completely written with street name and number (location), postal code, telephone number, facsimile number, and email address. Manuscript written by a group, author for correspondence along with address is required. First page of the manuscript is used for writing above information.

Abstract should not be more than 200 words. Keywords is about five words, covering scientific and local name (if any), research theme, and special methods which used; and sorted from A to Z. All important abbreviations must be defined at their first mention. Running title is about five words.

Introduction is about 400-600 words, covering the background and aims of the research. Materials and Methods should emphasize on the procedures and data analysis. Results and Discussion should be written as a series of connecting sentences, however, for manuscript with long discussion should be divided into subtitles. Thorough discussion represents the causal effect mainly explains for why and how the results of the research were taken place, and do not only re-express the mentioned results in the form of sentences.

Concluding sentence should be given at the end of the discussion.

Acknowledgments are expressed in a brief; all sources of institutional, private and corporate financial support for the work must be fully acknowledged, and any potential conflicts of interest are noted.

Figures and Tables of maximum of three pages should be clearly presented. Title of a picture is written down below the picture, while title of a table is written above the table. Colored figures can only be accepted if the information in the manuscript can lose without those images; chart is preferred to use black and white images. Author could consign any picture or photo for the front cover, although it does not print in the manuscript. All images property of others should be mentioned source. There is no appendix, all data or data analysis are incorporated into Results and Discussions. For broad data, it can be displayed on the website as a supplement.

References Author-year citations are required. In the text give the authors name followed by the year of publication and arrange from oldest to newest and from A to Z. In citing an article written by two authors, both of them should be mentioned, however, for three and more authors only the first author is mentioned followed by et al., for example: Saharjo and Nurhayati (2006) or (Boonkerd 2003a, b, c; Sugiyarto 2004; El-Bana and Nijs 2005; Balagadde et al. 2008; Webb et al. 2008). Extent citation as shown with word "cit" should be avoided. Reference to unpublished data and personal communication should not appear in the list but should be cited in the text only (e.g., Rifai MA 2007, pers. com. (personal communication); Setyawan AD 2007, unpublished data). In the reference list, the references should be listed in an alphabetical order (better, if only 20 for research papers). Names of journals should be abbreviated. Always use the standard abbreviation of a journal's name according to the ISSN List of Title Word Abbreviations (www.issn.org/222661-LTWA-online.php). The following examples are for guidance.

Journal: Saharjo BH, Nurhayati AD. 2006. Domination and composition structure change at hemic peat natural regeneration following burning; a case study in Pelalawan, Riau Province. Biodiversitas7: 154-158.

Book: Rai MK, Carpinella C. 2006. Naturally Occurring Bioactive Compounds.

Elsevier, Amsterdam.

Chapter in book: Webb CO, Cannon CH, Davies SJ. 2008. Ecological organization, biogeography, and the phylogenetic structure of rainforest tree communities. In: Carson W, Schnitzer S (eds) Tropical Forest Community Ecology. Wiley-Blackwell, New York.

Abstract: Assaeed AM. 2007. Seed production and dispersal of Rhazya stricta. 50th annual symposium of the International Association for Vegetation Science, Swansea, UK, 23-27 July 2007.

Proceeding: Alikodra HS. 2000. Biodiversity for development of local autonomous government. In: Setyawan AD, Sutarno (eds) Toward Mount Lawu National Park; Proceeding of National Seminary and Workshop on Biodiversity Conservation to Protect and Save Germplasm in Java Island.

Sebelas Maret University, Surakarta, 17-20 July 2000. [Indonesian] Thesis, Dissertation: Sugiyarto. 2004. Soil Macro-invertebrates Diversity and Inter-Cropping Plants Productivity in Agroforestry System based on Sengon. [Dissertation].

Brawijaya University, Malang. [Indonesian] Information from internet: Balagadde FK, Song H, Ozaki J, Collins CH, Barnet M, Arnold FH, Quake SR, You L. 2008. A synthetic Escherichia coli predator-prey ecosystem.

Mol Syst Biol 4: 187. www.molecularsystemsbiology.com

Front cover: Monotropa uniflora

(PHOTO: SIMON EADE)

Published semiannually

PRINTED IN INDONESIA ISSN: 1412-033X

E-ISSN: 2085-4722