Biodiversitas vol. 12, no. 4, October 2011

ISSN: 1412-033X (printed edition) ISSN: 2085-4722 (electronic)

Journal of Biological Diversity Volume

12 – Number 4 – October 2011

FIRST PUBLISHED: 2000

ISSN: 1412-033X (printed edition) 2085-4722 (electronic)

EDITORIAL BOARD (COMMUNICATING EDITORS): Abdel Fattah N.A. Rabou (Palestine), Dato A. Latiff Mohamad (Malaysia), Alan J. Lymbery (Australia), Ali Saad Mohamed (Sudan), Bambang H. Saharjo (Indonesia), Charles H. Cannon Jr. (USA), Edi Rudi (Indonesia), Guofan Shao (USA), Hassan Pourbabaei (Iran), Hwan Su Yoon (USA), Jamaluddin (India), Joko R. Witono (Indonesia), Katsuhiko Kondo (Japan), Livia Wanntorp (Sweden), Mahendra K. Rai (India), María La Torre Cuadros (Peru), Mariela A. Marinoff (Argentine), Mochamad A. Soendjoto (Indonesia), Salvador Carranza (Spain), Shahabuddin (Indonesia), Sonia Malik (Brazil), Sugiyarto (Indonesia), Thaweesakdi Boonkerd (Thailand)

EDITOR-IN-CHIEF: Sutarno

EDITORIAL MEMBERS: English Literary Editor: I Made Sudiana (sudianai@yahoo.com) Technical Editor & Banking: Solichatun (solichatun_s@yahoo.com) Distribution & Marketing: Rita Rakhmawati (oktia@yahoo.com) Webmaster: Ari Pitoyo (aripitoyo@yahoo.com)

MANAGING EDITORS: Ahmad Dwi Setyawan (unsjournals@gmail.com)

PUBLISHER: Department of Biology, Faculty of Mathematics and Natural Sciences, Sebelas Maret University, Surakarta and The Society for Indonesian Biodiversity

ADDRESS: Jl. Ir. Sutami 36A Surakarta 57126. Tel. +62-271-7994097, Tel. & Fax.: +62-271-663375, Email: unsjournals@yahoo.com

BANKING: Solichatun, BNI KC Sebelas Maret, Acc. No. 0033691646

ONLINE: biodiversitas.mipa.uns.ac.id

ACCREDITED BY DECREE OF THE DIRECTORATE GENERAL OF HIGHER EDUCATION, THE MINISTRY OF NATIONAL EDUCATION, REPUBLIC OF INDONESIA No. 65a/DIKTI/Kep/2008 (valid until October 2011)

EXPERTISE AND CORRESPONDING EMAIL OF THE COMMUNICATING EDITORS: GENETIC DIVERSITY: Alan J. Lymbery (a.lymbery@murdoch.edu.au), Hwan Su Yoon (hsyoon@bigelow.org), Mahendra K. Rai (pmkrai@hotmail.com), Salvador Carranza (salvicarranza@gmail.com), Sonia Malik (sonia.unicamp@gmail.com). SPECIES DIVERSITY: Dato A. Latiff Mohamad (latiff@ukm.my), Joko R. Witono (jrwitono@yahoo.com), Katsuhiko Kondo (k3kondo@nodai.ac.jp), Livia Wanntorp (livia.wanntorp@nrm.se), Thaweesakdi Boonkerd (Thaweesakdi.B@chula.ac.th). ECOSYSTEM DIVERSITY: Abdel Fattah N.A. Rabou (arabou@iugaza.edu), Ali Saad Mohamed (alisaad48@yahoo.com), Bambang H. Saharjo (bhsaharjo@gmail.com), Charles H. Cannon Jr. (chuck@xtbg.ac.cn), Edi Rudi (edirudi@yahoo.com), Guofan Shao (shao@purdue.edu), Hassan Pourbabaei (hassan_pourbabaei@yahoo.com), Jamaluddin (jamaluddin_125@hotmail.com), Mochamad A. Soendjoto (masoendjoto@gmail.com), Shahabuddin (shahabsaleh@gmail.com), Sugiyarto (sugiyarto_ys@yahoo.com). ETHNOBIOLOGY: María La Torre Cuadros (angeleslatorre@lamolina.edu.pe), Mariela A. Marinoff (marinoff@fai.unne.edu.ar).

B I O D I V E R S IT A S Volume 12, Number 4, October 2011 Pages: 187-191

ISSN: 1412-033X (printed edition) ISSN: 2085-4722 (electronic) DOI: 10.13057/biodiv/d120401

Leaf endophytic fungi of chili (Capsicum annuum) and their role in the protection against Aphis gossypii (Homoptera: Aphididae) HENY HERNAWATI, SURYO WIYONO♥, SUGENG SANTOSO Department of Plant Protection, Faculty of Agriculture, Bogor Agricultural University. Jl Kamper, IPB Campus, Darmaga, Bogor 16680, West Java, Indonesia, Tel.: +62-251-8423064, Fax: +62-251-8629364, ♥email: suryow@hotmail.com Manuscript received: 11 April 2011. Revision accepted: 5 August 2011.

ABSTRACT Hernawati H, Wiyono S, Santoso S (2011) Leaf endophytic fungi of chili (Capsicum annuum) and their role in the protection against Aphis gossypii (Homoptera: Aphididae). Biodiversitas 12: 187-191. The objectives of the research were to study the diversity of leaf endophytic fungi of chili, and investigate its potency in protecting host plants against Aphis gossypii Glov. Endophytic fungi were isolated from chili leaves with two categories: aphid infested plants and aphid-free plants, collected from farmer’s field in Bogor, West Java. Abundance of each fungal species from leave samples was determined by calculating frequency of isolation. The isolated fungi were tested on population growth of A. gossypii. The fungal isolates showed suppressing effect in population growth test, was further tested on biology attributes i.e. life cycle, fecundity and body length. Five species of leaf endophytic fungi of chili were found i.e.

Aspergillus flavus, Nigrospora sp., Coniothyrium sp., and SH1 (sterile hypha 1), SH2 (sterile hypha 2). Even though the number of endophytic fungi species in aphid-free and aphid-infested plant was same, the abundance of each species was different. Nigrospora sp., sterile hyphae 1 and sterile hyphae 2 was more abundant in aphid-free plants, but there was no difference in dominance of Aspergillus flavus and Coniothyrium sp. Nigrospora sp., SH1 and SH2 treatment reduced significantly fecundity of A. gossypii. Only SH2 treatment significantly prolonged life cycle and suppress body length, therefore the fungus had the strongest suppressing effect on population growth among fungi tested. The abundance and dominance of endophytic fungal species has relation with the infestation of A. gossypii in the field.

Key words: leaf endophytic fungi, chili, biological control, resistance, Aphis gossypii.

INTRODUCTION Endophytic fungi are fungi colonize internally plant tissue, without giving detrimental effect to the host plant (Petrini 1992; Avezedo 2000). They act as symbiont, mediated plant resistance against biotic stress i.e. pests and diseases and abiotic stress such as drought and extreme of temperature. The previous research in temperate region showed that endophytic fungi have detrimental effect on some insects from various taxonomic groups. For instance, endophytic fungi on grasses have been reported to inhibit the growth and development of the feeding insects. The colonization of an endophytic fungus Acremonium coenophialum Morgan-Jones et. Gams in tall fescue (Festuca arundinacea Schreb.) deterred the feeding of Rhopalosiphum padi Rondani and Schizaphis graminum Rondani (Johnson et al. 1985). In addition, Sabzalian et al.

(2004) reported the significant inhibition of population growth of mealybug Phenacoccus solani Ferris and barley aphid, Sipha maydis Passerini, on fungal endophyteinfected tall and meadow fescues. Moreover, the larval growth of Popillia japonica beetle larvae also inhibited in infected Taraxacum laxum by an endophyte Neotyphodium sp. (Richmond et al. 2004).

However up to now, study on this field is conducted mostly in grasses and in some more recent research works,

are on trees. The research on dicotyl-annual plant such as chili, is not available. System chili-Aphis gossypii Glov. was chosen due to the importance of chili as main vegetable crops in Indonesia and A. gossypii is a vector of various viral diseases. The objectives of the research were to study the diversity of leaf endophytic fungi of chili, and to examine their effect on the population growth and some biological aspects of Aphis gossypii.

MATERIALS AND METHODS Location and time The research was carried out in Laboratory of Plant Mycology and Laboratory of Insect Ecology, Department of Plant Protection, Faculty of Agriculture, Bogor Agricultural University on April-October 2007.

Isolation, identification and quantification of leaves fungal endophyte Isolation leaf fungal-endophytes of was carried out by modified technique of Petrini (1992). Sample of chili leaves without necrotic symptom was obtained from two category i.e. aphids-free plant, and plant with aphids, each 40 samples, originated from farmers field in Cibungbulang, Bogor, West Java, Indonesia (ca. 150 m asl). The leaves

188

B I O D I V E R S IT A S 12 (4): 187-191, October 2011

were disinfected two times with 70% ethanol and 1% sodium hypochloride, each for three minutes, then rinsed by sterilized water and excessive water tapped by towel paper and plated on medium potato dextrose agar (PDA) pH 5.5. Endophytic fungi were then purified by reculturing on PDA. After colony age of one week, the isolated fungi was purified and collected. The sporulated fungal isolates were directly identified. Non-sporulating fungal-isolates were induced the sporulation by growing in S-medium (CaCO3, sucrose 10 g/L, aquadest 1000 ml) ( Hanada et al. 2010), and incubated under near ultra violet (NUV) for 14 days. Identification was conducted up to genus level using identification books of Barnett and Hunter (1988) and Hanlinn (1990).

Non sporulating endophytic fungi i.e. SH 1 and SH2 were molecular identified based on 18 S rDNA. Extraction of DNA was conducted based on methods of modified Orozco-Castillo et al. (1994). Amplification of fungal DNA using pair of primer ITS1 5’ TCCGTAGGTGAACCTGCGG 3’ and ITS4 5’ TCCTCCGCTTATTGATATGC 3’ that amplify region internal transcribed spacer (ITS) ribosomal DNA (rDNA) (White et al. 1990). DNA resulted from PCR then sequenced and examined the homology with reference collections of Genebank using BLAST program (www.ncbi.nlm.nih.gov). Species or genus was determined based on percentage of similarity (Arnold and Lutzoni 2007; Crozier et al. 2006).

Abundance of leaf endophytic fungi was depicted by frequency of isolation, in which calculated by the percentage of samples with certain endophyte. The frequency of isolation then compared between aphid free plants and plant with aphids. The collected endophytic fungi were stored on test tube containing PDA and store at 5°C. Propagation was carried out by reculturing this isolate on PDA. The 14-days old colony of endophyte was used for inoculation.

Rearing of aphids An adult of A. gossypii from the chili plant in the field in Bogor was kept on free insect potted chili plant. After species determined using identification book Blackman and Eastop (2000), the progeny was reared on chili plant to obtain homogenous population. First nymph of the population was then used for experiment of biology and also population growth.

Inoculation of endophytic fungi Suspension of conidia was used as inoculum for sporulating fungi, and mycelial fragment was applied for non-sporulating fungi. Conidia of fungi were harvested from 14-days old culture. A PDB-based 14-days old colony of non-sporulating fungi, filtered, washed with sterilized water then mixed with sterilized water and blended with medium speed for two minutes. Both are assessed the density by direct count with a haemacytometer under light microscope with 10 x 10 magnification. Both types of suspension were adjusted to 10 4 cfu/mL. Inoculation was done twice, first by seed treatment, second by propagules spraying. Before treatment the seed was treated with hot water at 52°C for 20 minutes to eliminate possible existing fungi on and inside the seeds. Seeds of chili cv. Hot pepper

was soaked by conidia suspension for 6 hours, then grown in sterilized soil in pot. Conidial spraying was conducted at 10 days after transplanting, aided by hand sprayer with application volume of 50 mL/individual plants. For control, seeds was only soaked and then the plants sprayed by sterilized water.

Endophyte colonization study The aim of this test was to investigate whether the isolated fungi are able to colonize leaves of chili. Endophyte treatment was carried out by seeds application and spraying plants leaves at 10 days after transplanting, each treatment consisted of ten plants. Leaves of each plant were plated on PDA pH 5.5 at 20 days after transplanting. The growth of the fungi the same as inoculated in media indicating that the tested fungi are able to colonize the leaves.

The effect of leaf-endophytic fungi on the population growth of A. gossypii Two first nymph of A. gossypii were inoculated on chili potted plant. The plant was grown in a cheesecloth cages to avoid migration and attack of natural enemies and laid under greenhouse. Five plants as replication were used in this study. Treatment consists of endophytic fungi i.e. Aspergillus flavus, Nigrospora sp., Coniothyrium sp., sterile hypha 1 (SH1) and sterile hypha 2 (SH2), control (water). One plant was considered as one replication. The observation was done each 3 days with aided by hand counter for 30 days.

The effect of fungal endophyte on the biology of A. gossypii Treatment consisted of endophytic fungus i.e. Aspergillus flavus, Nigrospora sp., Coniothyrium sp., sterile hypha 1 and sterile hypha 2, and control (water). The detached leaves of endophyte inoculated plants and control plants were laid on petridish diameter 9 cm and the basal of petiole was covered by moistened cotton. A first nymph of A. gossypii was laid on leaf, and each 3 days the leaf was replaced by the new and similar size from the same plants.

The observation was made on the periods of each nymph, pre-natal periods, life cycle, and fecundity. In addition, body length was also measured microscopically using micrometer. If the insect produce progeny then its progenies was killed. The 20 petridishes were used; one petridish was considered one replication. The experiment was designed in randomized complete design.

The effect of leaf-endophytic fungi on body size of A. gossypii The aphid treatment was same as in biology experiment.

Each instars of aphid’s nymph was measured longitudinally using micrometer, under a compound microscope with 40 x 10 magnifications.

Data analysis Frequency of isolation of endophytic fungi was arranged in cross tabulation, and compared the value for assessing abundance of each fungus. Variables such as life cycle, fecundity and body length were statistically analyzed using analysis of variance (ANOVA). When ANOVA resulted significant different, Duncan Multiple Range Test (DMRT) was applied for comparing mean of each variables.

HERNAWATI et al. – Leaf endophytic fungi of Capsicum annuum

RESULTS AND DISCUSSION Based on the sample number used in the research (40 plants from the field of Bogor), the species diversity of fungal endophyte was low. Only five species found i.e.

Aspergillus flavus, Nigrospora sp., Coniothyrium sp. and sterile hypha 1 (SH1), and sterile hypha 2 (SH2) (Table 1).

SH1 and SH2 did not produce conidia to allow further species identification morphologically. Further molecular identification based on 18 S rDNA resulted that SH1 similar (99%) to Accession FJ524323 of GeneBank refer to Unculture endophytic fungus clone R3-63, obtained from wild rice root in China (Yuan et al. 2010) (Table 2). SH2 was similar to Accession No FJ612897 of GeneBank, Fungal sp ARIZ B031, endophytic fungus of tree Cecropia insignis (U’Ren et al. 2009). The rank of species from the most abundant to the least was Nigrospora, SH2, SH1, Coniothyrium sp. and A. flavus respectively. Low species diversity of chili plants may be related to high rate of fungicide frequency application in this area (once per week). Gaitan et al. (2005) noted that fungicide application reduced the diversity of endophytic leaf fungi of a tropical tree Guarea guidonia L. Table 1. Frequency of isolation of leaf endophytic fungi on chili from bogor Isolation frequency (%) Aphid-free plant Plant with aphid Aspergillus flavus 10 10 Nigrospora sp.

30 15 Coniothyrium sp.

25 20 SH1 55 25 SH2 60 15 Note: number of leaves with aphid and aphid-free, each 40 from 40 plants.

Endophytic fungi

Table 2. Molecular identification of non-sporulating endophytic fungi Isolate number SH1 SH2

Category Unculture endophytic fungus clone R3-63 Fungal species ARIZ B031

GeneBank Maximum reference identity (%) accession FJ524323 99 FJ612897

99

Even though there was no difference on the species number of fungi between aphid-infested and aphid-free plants, the abundance of each fungus was greatly different.

Abundance (indicated by frequency of isolation) of Nigrospora sp., SH 1 and SH2 was higher in aphid-free plants than of aphid-infested plants (Table 1). Other endophytic fungi: Aspergillus flavus, Coniothyrium sp. has no different abundance between aphid-infested and aphidfree plants.

All isolated fungi can act as endophytes proven by their colonization ability-lowest frequency was A. flavus and

189

other fungi reached more then 80% frequency of reisolation (Table 3). All of isolated fungi have no potency to be pathogens, indicated by negative result of pathogenicity tests (data not shown). Aspergillus has rarely been reported as leaf endophyte, but this work resulted that this species as leaf endophyte of chili and proven by colonization test. The role of Aspergillus as leave endophyte has been reported in soybean and neem trees (Pimentel et al. 2006; Verma et al.

2007). Other fungal endophytes isolated in this study were Coniothyrium sp. and Nigrospora sp., the two genera had been reported as leave endophyte in various plants such as Quercus alba L, neem tree, banana tree Ulmus davidiana var. japonica and Parthenium hysterophorus (Fisher et al.

1994; Romero et al. 2001; Tomita et al. 2003; Photita et al.

2004; Verma et al. 2007). The presence of sterile hypha as endophyte in this research is also common in other endophyte research on various host plants (Fisher et al.

1994; Pimentel et al. 2006; Verma et al. 2007).

Table 3. Frequency of reisolation of leaf endophytic fungi on chili Endophytic fungi Control Aspergillus flavus.

Coniothyrium sp.

Nigrospora sp.

SH1 SH2

Frequency of reisolation 0 70 80 90 80 80

Further test showed that Nigrospora sp., SH1 and SH2 reduce population growth of A. gossypii, with SH2 provide highest suppression (Figure 1). This was indicated by delaying peak of population growth curve and reducing population density by these fungi treatments. Untreated or control had peak of population growth at 18 days. Population growth curve reached a peak at 18, 20 and 20 days for Nigrospora sp. SH1 and SH2 respectively. Nigrospora sp. SH1 and SH2 suppressed population density at average rate of 29.05%, 40.36% and 54.37% respectively.. Population growth curve reach a peak at 16 and 18 days and suppressing rate of 0.00%and 19.23% for Aspergillus flavus and Coniothyrium sp. respectively. It can be said that Aspergillus and Coniothyrium sp. has minor effect on population growth of A. gossypii, consequently those fungi were not further used in life cycle and fecundity test.

In life cycle test, only SH2 showed the effect i.e. prolonging life cycle by 10.77%. The endophyte SH2 treatment prolonged significantly nymph periods, pre-oviposition periods and life cycle of A. gossypii (Table 4). Other tested endophytic fungi did not affect these parameters.

All of tested fungi reduced significantly the fecundity of A. gossypii (Table 5). The reduction of fecundity was 41.36%, 49.32%, and 53.11% for SH1, SH2 and Nigrospora sp. respectively. Aside from suppressing fecundity and prolonged life cycle, SH2 endophyte reduced A. gossypii body length. Other tested fungal endophyte, even though tended to reduce this parameter too, but not significant. Again, SH2 endophyte showed the strongest inhibitory effect on A. gossypii.

B I O D I V E R S IT A S 12 (4): 187-191, October 2011

190

1000 Control Aspergillus flavus Coniothyrium sp.

Nigrospora sp.

SH1 SH2

Number of aphids/plant

800

600

400

200

0 0

5

10

15

20

25

30

Day

Figure 1. Population growth of A. gossypii on endophyte-infected chili plants.

Table 4. Life cycle of A. gossypii on endophyte-treated leaves Treatment

Nymph periods

Pre-oviposition periods (days)

Life cycle (days)

Control 5.25±0.13 b 1.25±0.46 a 6.45±0. 31 b Nigrospora sp. 5.13±0.05 b 1.35±0.34 a 6.45±0.43 b SH1 5.32±0.12 b 1.25±0.57 a 6.55±0. 27 b SH2 5.85±0.16 a 1.35±0.63 a 7.20±0. 19 a Note: number followed by different symbol in the same column is significantly different according DMRT test with P<0.05

Table 5. Fecundity of A. gossypii on endophyte-treated leaves Treatment

Total

Control 29.62±3.58 a Nigrospora sp.

13.89±5.84 b SH1 17.37±3. 88 b SH2 15.31±4.65 b Note: number followed by different symbol in the same column is significantly different according DMRT test with P<0.05

endophytic fungi play important role on the protection of chili plant against aphid in the field.

Previous worker reported that some endophytic fungi has mediated plant resistance on phytophagous insects from various taxa i.e., aphid, grasshopper, cotton ballworm and beetle (Johnson et al. 1985; McGee et al. 2003; Richmond et al. 2004; Sabzalian et al. 2004; Avezedo 2000). However, most of research was done with grasses in temperate region. Our finding show for the first time in cultivated annual crops i.e. chili that endophytic fungi is able to suppress the growth, development and population growth of A. gossypii. One isolate SH2, beside prolonged life cycle, also decreased fecundity, therefore had strongest effect on decreasing population growth of A. gossypii.

Other tested endophytic fungi (SH1, SH2 and Nigrospora sp.) decreased fecundity but had no effect on life cycle. The other important point was some endophytic fungi i.e.

Nigrospora sp. and SH2, suppressed the body length of aphids (Table 6). The reduction of body size of aphids due to endophyte treatment was also reported on aphid Rhopalosiphum padi on ryegrass inoculated by endophyte Neotyphodium lolii (Meister et al. 2006). Thus, the fungi affected not only the development but also growth of A. gossypii.

The experiment showed obviously that some fungal leaf endophyte treatments play a role in protecting chili against A. gossypii. It is known that non preference and antixenosis are main mechanism in increasing host resistance against insects mediated by fungal endophyte (Johnson et al. 1985; Faeth et al. 2002; Lehtonen et al. 2005). Antixenosis is proven in this research showed by suppression of fecundity, prolonged life cycle and decreased body size.

Non-preference was not elaborated in this study, therefore needs further investigation.

Inhibitory effect of endophyte on feeding insects is mostly due to toxin produced by fungal endophyte.

Endophytic fungi alone or in association with host plant are able to produce toxin (Petrini 1992; Sumarah and Miller 2009). Highly diverse groups of toxin produced by fungal endophyte i.e. alkaloids, terpenoid, steroid, quinone, and flavonoid, phenylpropanoids and lignans, peptides, phenol, phenolic acids and aliphatic compounds (Tan and Zou 2001). Siegel et al. (1990) stated that toxin produced in grasses infected by endophyte Acremonium coenophialum and Epichloe typhina is peramine, lolitrem B and ergovaline. Moreover reported that endophytic fungus Phyllosticta sp. and Hormonema dematioides in balsam fir

By comparing exploratory data and experimental data, it can be said that there is relation between the abundance of endophytic fungi and anti insect activity of fungi. Fungi having no different abundance between aphid-free and aphid-infested, such as Aspergillus flavus and Coniothyrium sp., have minor effect on the suppression of Table 6. Effect of endophyte-treated leaves on body length of A. gossypii aphid population. On the contrary endophytic fungi with high Body length (mm) dominance in aphid-free plant, have Treatment Nymph-instar Adults significant suppressing effect on 1 2 3 4 aphid population, and inhibit some Control 0.42±0.15 a 0.58±0.25 a 0.73±0.16 a 0.94±0.09 a 1.17±0.06 a other aphid biological attributes i.e.

SH1 0.42±0.24 a 0.58±0.22 a 0.76±0.18 a 0.91±0.073 a 1.12±0.04 ab fecundity, life cycle, body size, even SH2 0.41±0.22 a 0.57±0.23 a 0.71±0.11a 0.89±0.15 a 1.08±0.03 b Nigrospora sp.

0.41±0.19 a 0.61±0.20 a 0.75±0.24 a 0.89±0.11 a 1.12±0.03 ab though the inhibitory effect varied Note: number followed by different symbol in the same column is significantly different among species. Thus, the facts show according DMRT test with P<0.05 that colonization of later groups of

HERNAWATI et al. â&#x20AC;&#x201C; Leaf endophytic fungi of Capsicum annuum

produce toxic compounds, mainly heptelidic acid and rugulosine (Avezedo 2000; Sumarah et al. 2008).

Nodulisporic acid, benzofuran derivates and naphthalene are also insecticidal substances produced by endophytic fungi (Sumarah and Miller 2009). Possible mechanism other than toxin production is the change of plant metabolism such as sterol metabolism which not favors the insects (Avezedo 2000). The exact mechanism and the type of toxin associated with the increasing chili resistance against A. gossypii mediated by fungal endophyte need further investigation.

CONCLUSION Endophytic fungi isolated from chili in Bogor are Aspergillus favus, Coniothyrium sp., Nigrospora sp., sterile hypha 1 (SH1) and sterile hypha 2 (SH2). Colonization of some endophytic fungi has important role in the protection of chili plants against Aphis gossypii. Some of those fungi i.e. SH1, SH2, and Nigrospora sp. are able to increase resistance chili against A. gossypii, in which SH2 has the strongest effect. This plays an initial basis for using fungal leaf endophytes as biocontrol agent against pests of chili.

Better understanding on the aspects related to endophytic fungi of chili leaves, such as mechanism involve, type of produced toxin, mode of transmission, spectrum of affected insect pests, host-environment relation, should be furthermore elaborated to obtain appropriate strategy and technique for the use in biological control.

ACKNOWLEDGMENT Second author acknowledge to Damayanti and Efi T. Tondok member of Laboratory of Plant Mycology Department of Plant Protection Bogor Agricultural University for their assistance in molecular work on identification of endophytic fungi.

REFERENCES Arnold AE, Lutzoni F. (2007) Diversity and host range of foliar fungal endophytes: are tropical leaves biodiversity hotspots? Ecology 88: 541-549.

Avezedo JL (2000). Endophytic microorganisms: a review on insect control and recent advances on tropical plants. E J Biotech3: 40-65 Barnett J, Hunter B (1988) Illustrated genera of imperfect fungi. Burges Publishing Company. Virginia Blackman RL, Eastop VF (2000) Aphids on the world crops: An identification and information guide. John Wiley and Sons. New York Crozier J, Thomas SE, Aime MC, Evans HC and Holmes KA (2006) Molecular characterization of fungal endophytic morphospecies isolated from stems and pods of Theobroma cacao. Plant Pathol 55: 783-791 Faeth SH (2002) Are endophytic fungi defensive plant mutualists? Oikos 98:25-36.

Fisher PJ, Petrini O, Petrini E, Sutton BC (1994) Fungal endophytes from the leaves and twigs of Quercus ilex L. from England, Majorca and Switzerland. New Phytol 127:133-137

191

GaitĂĄn MAG, Wen S, Fetcher N, Bayman P (2005). Effects of fungicides on endophytic fungi and photosynthesis in seedlings of a tropical tree, Guarea guidonia (Meliaceae). Acta Biol Colombiana 10: 41-47 Hanada RE, Pomella AWV, Costa HS, Bezerra JL, Loguercio LL, Pereira JO (2010) Endophytic fungal diversity in Theobroma cacao (cacao) and T. grandiflorum (cupuacu) trees and their potential for growth promotion and biocontrol of black-pod disease. Fungal Biol 114: 901910 Hanlinn T (1990). Illustrated genera of Ascomycetes. APS Press. Minnesota Johnson MC, Dahlman DL, Siegel MR, Bush LP, Latch GCM, Potter DA, Varney DR (1985). Insect feeding deterrents in endophyte-infected tall fescue. App Environ Microbiol 49:568-571 Lehtonen P, Helander M, Saikkonen K (2005) Are endophyte-mediated effects on herbivores conditional on soil nutrients? Oecologia 142:38-45 McGee P, Dingle J, Mac Arthur D, Creighton N, Istifadah N (2003) Endophytic fungi add to plant defenses. Microbiol Australia 24: 42-47 Meister B, Krauss J, Harri SA, Schneider MV, Mueller CB (2006) Fungal endosymbionts affect aphid population size by reduction of adult life span and fecundity. Basic App Ecol 7: 244-252 Orozco-Castillo C, Chalmers KJ, Waugh R, Powel W (1994) Detection of genetic diversity and selective gene introgression in coffee using RAPD markers. Theor App Gen 93:934-940 Petrini O (1992) Fungal endophytes of tree leaves. In: Andrews JH, Hirano SS (eds). Microbiology of leaves. Springer. New York.

Photita W, Lumyong S, Lumyong P, McKenzie EHC, Hyde KD (2004) Are some endophytes of Musa acuminata latent pathogens? Fungal Div 16: 131-140.

Pimentel IC, Glienke-Blanco C, Gabardo J, Stuart RM, Azevedo JL (2006) Identification and colonization of endophytic fungi from soybean (Glycine max (L.) Merril) under different environmental conditions. Braz Arch Biol Technol 49: 705-711 Richmond D, Parwinder S, Grewal S, Cardina J (2004) Influence of japanese beetle Popillia japonica larvae and fungal endophytes on competition between turfgrasses and dandelion. Crop Sci 44:600-606 Romero A, Carrion G, Rico-Gray V (2001) Fungal latent pathogens and endophytesfrom leaves of Parthenium hysterophorus (Asteraceae).

Fungal Div 7: 81-87.

Sabzalian MR, Hatami B, Mirlohi, A (2004). Mealybug, Phenacoccus solani, and barley aphid, Sipha maydis, response to endophyteinfected tall and meadow fescues. Entomol Exp App 113: 205-209 Siegel MR, Latch GCM, Bush LP, Fannin FF, Rowan DD, Tapper BA, Bacon CW, Johnson MC. 1990. Fungal endophyte-infected grasses: alkaloid accumulation and aphid response. J Chem Ecol 16: 33013315.

Sumarah MW, Adams GW, Berghout J, Slack GJ, Wilson AM, Miller JD (2008) Spread and persistence of a rugulosin-producing endophyte in Picea glauca seedlings. Mycol Res 112: 731-736 Sumarah MW, Miller JD (2009) Anti-insect secondary metabolites from fungal endophytes of conifer trees. Nat Prod Commun 4:1497-504.

Tan RX, Zou, WX (2001) Endophytes: a rich source of functional metabolites Nat Prod Rep 18: 448-459 Tomita, F. (2003). Endophytes in Southeast Asia and Japan: their taxonomic diversity and potential applications. Fungal Div 14: 187-204.

U'Ren JM, Dalling JW, Gallery RE, Maddison DR, Davis EC, Gibson CM, Arnold AE (2009) Diversity and evolutionary origins of fungi associated with seeds of a neotropical pioneer tree: a case study for analysing fungal environmental samples. Mycol Res 113: 432-449 Verma VC, Gond SK, Kumar A, Kharwar R (2007) The endophytic mycoflora of bark, leaf, and stem tissues of Azadirachta indica A. Juss (Neem) from Varanasi (India). Microbial Ecol 54:119-125 White T J, Bruns T, Lee S, Taylor J (1990) Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis M, Gelfand DH, Sninsky JJ, White TJ (eds). PCR Protocols.

Academic Press, San Diego.

Yuan ZL, Zhang CL, Lin FC , Kubicek CP (2010) Identity, diversity, and molecular phylogeny of the endophytic mycobiota in the roots of rare wild rice (Oryza granulate) from a nature reserve in Yunnan, China.

Appl Environ Microbiol 76 : 1642-1652

B I O D I V E R S IT A S Volume 12, Number 4, October 2011 Pages: 192-197

ISSN: 1412-033X (printed edition) ISSN: 2085-4722 (electronic) DOI: 10.13057/biodiv/d120402

Isolation and identification of an agar-liquefying marine bacterium and some properties of its extracellular agarases FATURRAHMAN1,3,♥, ANJA MERYANDINI1, MUHAMMAD ZAIRIN JUNIOR2, IMAN RUSMANA1 1

Department of Biology, Faculty of Mathematics and Natural Sciences, Bogor Agricultural University, Darmaga, Bogor 16680, West Java, Indonesia 2 Department,of Aquaculture, Faculty of Fisheries, Bogor Agricultural University, Darmaga, Bogor 16680, West Java, Indonesia 3 Departement of Biology, Faculty of Mathematics and Natural Sciences, Mataram University. Jl.Majapahit 62, Mataram 83125, West Nusa Tenggara, Indonesia. Tel./fax +62-370-646506, email:faturjr@gmail.com Manuscript received: 23 June 2011. Revision accepted: 23 August 2011.

ABSTRACT Faturrahman, Meryandini A, Junior MZ, Rusmana I (2011) Isolation and identification of an agar-liquefying marine bacterium and some properties of its extracellular agarases. Biodiversitas 12: 192-197. A new agar-liquefying bacterium, designated Alg3.1, was isolated from Gracilaria samples collected from the Kuta Coast at Central Lombok in West Nusa Tenggara and was identified as Aeromonas sp. on the basis of morphology, biochemical-physiological character and 16S rDNA gene sequencing. The bacterium appeared capable of liquefying agar in nutrient agar-plate within 48 hours of incubation and the agar was completely liquefied after l5 days at 29oC. When the isolate was grown in basal salts solution medium B supplemented with peptone and yeast extract, produced extracellular agarases within a short period of time (4-16 h) and the maximum agarase activity was 0.489 nkat/mL at 36h after incubation.

Key words: Gracilaria, agarase, agar-liquefying, Aeromonas.

INTRODUCTION Indonesia is rich country with various kinds of algae.

The results of Sibolga expedition shows that there are 782 species of algae in Indonesia which consist of 179 green algae, 134 brown algae and 452 species of red algae (Nontji 2007). One group of red alga, agarophyte produce agar-agar, a complex polysaccharide present in the cell walls, up to 47.34% (Soegiarto and Sulistijo 1985).

Agar-agar can be degraded by several bacterial strains from marine environments and other sources. Agarolytic bacteria are ubiquitous in coastal and estuarine regions; however, they are not exclusively autochthonous in the marine environment, since some reports have shown that they also occur in freshwater, sewage and soil (von Hoffsten and Malmqvist 1974; van der Meulen et al. 1976; Agbo and Moss 1979). Some of bacteria isolates have been identified and classified in to Actinomyces, Agarivorans, Alterococcus, Alteromonas, Microbulbifer, Cellulophaga, Cytophaga, Streptomyces, Vibrio, Pseudomonas, Saccharophagus, Pseudoalteromonas, Zobellia, and Bacillus (Macian et al.

2001; Yoon et al. 1996; Jean et al. 2006; Khambhaty 2008). It is possible to utilize of bacteria which can produced agarase enzymes, which can degrade agar into amount of oligosaccharides and D-galactose.

D-galactoses can be catabolytic into piruvic acid via Tagatosa or Leloir pathway by yeast or other bacteria, furthermore the fermented of piruvic acid produce large amounts of alcohol, acetic and formic acids. Beside that, agarase can be used to degrade the cell walls of marine algae for extraction of labile substances with biological

activities and for the preparation of protoplasts, as well as isolation of monoclonal hybrids. The polysaccharide fractions can be applied for functional foods. Agarase have applications in food, cosmetics, and medical industries by degrading agar. The polysaccharides produced by hydrolysis of agar can promote immunity in mice by abdominal injection or feeding. Some researches have shown that adding 5% agaropectin to diet suppressed significantly the increasing in cholesterol level in plasma of rats. Anti-hypercholesterolemic effect of rats also was observed (Sie et al. 2009) In our laboratory, we have isolated a few agar-softening and agar-liquefying bacteria strains from the Kuta Coast of Central Lombok to characterize their extracellular agarases.

We describe here the identification of a new agarolytic bacteria strain, Aeromonas sp. strain Alg3.1, and identification of hydrolysis product from agarase, and to asses their possibility to produce bioethanol.

MATERIALS AND METHODS Sampling. Seaweed samples were collected from the Kuta Coast at Central Lombok, West Nusa Tenggara, Indonesia.

Enrichment and isolation of agarolytic bacteria.

Erlenmeyer flasks (250 mL) containing sterile river water (100 mL), to which 0.1% (w/v) Oxoid agar had been added, were inoculated with samples and incubated at 29oC on a rotary shaker for 4 d (Agbo and Moss 1979). Samples (0.1 mL) of the cultures were then plated on nutrient agar (with sea water) and a basal salt solution medium B (Hofsten and

FATURRAHMAN et al. – Agar-liquefying marine bacterium

Malmqvist 1975) containing (%): NaNO3 (0.2); K2HP04 (0.05); MgS04.7H20 (0.02); MnS04.7H20 (0.002); FeS04.7H20 (0.002); CaCl2.2H2O (0.002); Oxoid no. 3 agar (15); adjusted to pH 7.2 before autoclaving at 121oC for 15 min. Plates were incubated at 28oC and examined daily for agarolytic activity, assessed by liquefaction or shallow depressions appearing around the colonies. After 7 d, plates were flooded with Iodine and the appearance of pale-yellow zones around colonies against a brown-violet background was considered indicative of some agar-degrading activity in the absence of the visible signs already referred to. All colonies showing liquefaction or depressions in the agar were picked off and purified by streaking out on mineral or nutrient agar (Agbo and Moss 1979).

Representative agar-degrading strains were maintained in Dubos' solution containing (g L-l): NaNO3 (0.5); K2HPO4 (0.1); MgS04.7H2O (0.5); FeSO4.7H2O (0.01); adjusted to pH 7.2, dispensed into bijou bottles and sterilized at 121 oC for 15 min.

Colonial and cell morphology. Colonial characteristics and pigmentation were studied on plates of nutrient agar, on marine agar, medium B agar and medium TCBS. Motility (hanging drop), Gram-staining isolates were done on bacteria grown in peptone (1.5%, w/v) water for 48 h.

Physiological biochemical tests. Strain Alg3.1 was characterized and indentified using standard physiological and biochemical plate and test tube, API 20E kits (ATB system, Biomerieux SA, Marcy-I’Etoile, France). The ability of isolate hydrolyze Starch and cellulose (CMC) was examined by incubating plates of yeast extract agar (Difco) containing 0.2% (w/v) soluble starch for 48h and then flooding with Lugol's iodine or congo red. Antibiotic sensitivity was tested to ampicillin (10 and 30 µg), tetracycline (10µg), vancomycin (30µg), erythromycin (15µg) and rifamicin (5µg) by using paper disk method by Johnson and Case (2007).

Phylogenetic analysis of isolates based on 16S rDNA sequencing. For DNA extraction, bacteria were grown for 2 days at 29oC on MA medium. A single colony of isolate was took with a sterile toothpick, resuspended in 20 mL of sterile distilled water, and heated at 95oC for 10 min to lyses the cells. The lysate was then cooled on ice, briefly centrifuged with a microcentrifuge, and used for PCR amplification.

The DNA coding for the 16S rRNA of isolate was amplified with 63f primer (5’-CAG GCC TAA CAC ATG CAA GTC-3’) and 1387r primer (5’-GGG CGG WGT GTA CAA GGC-3’) (Marchesi et al. 1998). Amplification was done as follows: each mixture consisted of 2.0 µL of 10x Taq reaction buffer (100 mM Tris-HCl, pH 8.3; 500 mM KCl, 20 mM MgCl2), 1.2mM of each primer, 0.2mM of each deoxynucleoside triphosphate (Sigma, St. Louis, MO, USA) and 2.5 units of Taq DNA polymerase (Takara, Cina), and 1 µg of DNA template in a total reaction volume of 50µL. The reaction mixtures were incubated in a thermocycler GeneAmp PCR System 2400 Perkin Elmer, (New Jersey) at 95oC for 5 min and then put through 30 cycles of 92oC for 30s, 55oC for 30s, and 72oC for 1 min.

Successful amplification were confirmed by electrophoresis of 5 µL PCR products on a 1% agarose agar. Finally, the

193

amplified 16S rDNA was purified by using a Qiaquick PCR Purification Kit (Qiagen, Inc., Calif., USA) according to the manual instructions. The amplified 16S rDNA were sequenced directly with an automatic DNA sequencer (ABI PRISM 3700 DNA analyzer, Applied Biosystem, Foster City, CA, USA) by using the same primers. The 16S rRNA gene sequence was compared with sequences in GenBank databases (http://www.ncbi.nlm.nih.gov./BLAST) to obtain closely matched species. The phylogenetic tree of the strain Alg3.1 was constructed using biological software MEGA4.

The best medium for growth and agarase production.

To maximize producing of extracelluler agarase, growth and production medium was chosen and the culture conditions were adjusted. The growth and production medium were used marine broth (MB, Merck: Yeast extract 0.1%, Casamino acid 0.5%, NaCl 3.0%, MgCl2.6H2O 0.23%, and KCl 0.03%), sea water medium (SWM : bactopeptone 1.0%, filtered sea water 750 mL, aquadest 250 mL, pH 7.2-7.3), basal salt solution medium B (BSM) and BSM which supplemented with bacto peptone (0.5%, w/v) and yeast extract (0.1%, w/v). Each of medium supplemented with 0.2%, (w/v) agar (Oxoid) and incubated at 29oC for 1 to 5 d on a rotary shaker (120 rev. min-l). Cultures were then centrifuged to remove bacteria, the supernatant was used for qualitative activity test. Qualitative agarase activity was measured based on clearance zone of free cellsupernatant of the strain Alg3.1 incubated at 4h on agar plate after that flooding with iodine.

Assay of agarase activity. Selected isolates were cultured in 250 mL Erlenmeyer flasks containing 150 mL basal salt medium B supplemented with 0.2%, (w/v) agar (Oxoid) and incubated at 29oC for 1 to 5 d on a rotary shaker (120 rev. min-l). Cultures were then centrifuged to remove bacteria, the supernatant was treated with 0.2 vol.

2.5% (w/v) Cetrimide and the resulting precipitate was removed by centrifuging. The supernatant was treated with 2 vol. acetone at 4oC for 30 min. The precipitate was collected by centrifuging and redissolved in 5mM KH2PO4/Na2HPO4 buffer (pH 7.4).

The activity of this crude extracellular agarase was assayed with a solution of agarose (Sigma; 0.2% w/v) in 5mM KH2PO4/Na2HPO4 buffer (pH 7.4). The agarase preparation (0.5 mL) was mixed with 0.5 mL agarose solution and 2 mL 10mM KH2PO4/Na2HPO4 buffer (pH 7.4) and incubated at 29oC for 1 h. The reaction was stopped by adding 1 mL copper reagent and the reducing sugars were measured colorimetrically by the method of Dygert et al.

(1965) except that any precipitate of undegraded agarose was removed by centrifuging (2600g) for 15 min. Blanks of substrate with no enzyme and enzyme with no substrate were treated in the same way. One unit of agarase activity was defined as the release of reducing groups equivalent to 1µmol D-galactose in 1 h at 29oC, pH 7.4.

Thin-Layer Chromatography (TLC). Reactions with purified agarase and agarose were performed in 50 µL reactions containing 40 µL of partial purified agarase and 5 µL of 1% agarose. Galactooligosaccharide, fructooligosaccharide, and D-galactose (5 µg) were used as standards.

The reactions were incubated at 29°C for two hours. The reaction mixture was performed on a Silica Gel 60 glass

194

B I O D I V E R S IT A S 12 (4): 192-197, October 2011

plate (F254 Merck, Damstadt, Germany). The plates were developed with 2:1:1 n-butanol:acetic acid:water solution.

Degradation products were visualized by using Handy UV Lamp AS ONE 254nm (Japan).

RESULTS AND DISCUSSION Identification of Gracilaria-associated agarolytic bacterium Alg3.1 A bacterial strain that could produce extracellular agarase was isolated from the marine seaweed, Gracilaria sp., of the Kuta Coast in Central Lombok, West Nusa Tenggara, Indonesia, based on its capability in liquefying of agar or exerting clearance zone on nutrient agar plate containing agar 1.5%. in the bacteriology laboratory. The strain Ag3.1 was Gram-negative rods, non-fermentative and highly motile, encapsulated, pleomorphic, highly motile, which grows singly or in short chains. colonies, The colony of agarolytic strain Alg3.1 was yellow in TCBS (Figure 1A), flat and large, grayish white in nutrients agar medium (data not shown), appear to like Vibrio species. But strain Alg3.1 can utilize lactose so that can not be grouped into Vibrio.

Cell-free supernatant of strain Alg3.1 produced 42 mm halos of clearing in diameter after 6 h of incubation at 29oC (Figure 1B). This strain rapidly produced a crater of digested agar on nutrient agar plates, in the manner illustrated by v. Hofsten and Malmqvist (1975) (Figure 1C). Moist nutrient agar plates was completely liquefied in about l5 day at 29oC (Figure 1D). Agarolytic bacteria produce visible changes on agar because of the cleavage of polysaccharide chains, ranging from softening of gel to agar pitting and extensive liquefaction (Agbo and Moss 1979). Colonies did not produce diffusible pigment and growth occurred over a wide temperature range (4 to 40oC) with the optimum at 29oC. The results of several biochemical and physiological test for strain Alg3.1 are shown in Table 1. The strain was susceptible to ampicillin, tetracycline, vancomycin, erythromycin and rifamicin. The strain Alg3.1 was aerobic, oxidase positive, arginine dihydrolase positive, urease and gelatinase positive, utilized D-glucose, D-galactose, D-

manitol, D-fructose, sucrose, lactose, agar, agarose, carrageenan, arabinogalactan, galactomannan, and starch as sole carbon source, and reduced nitrate to nitrite. Strain Alg3.1 can be distinguished from Aeromonas salmonicida subsp. pectinolytica MEL and A. salmonicida subsp. salmonicida by its utilization of N-acetyl glucosamine, citrate and indole production.

Phylogenetic analysis of 16S rRNA Partial 16S rDNA sequence of Alg3.1 could be used for identification taxonomic of isolate. Alignment of nucleotide sequence of the 16S rDNA with sequence in GenBank database showed maximum homology with those of Aeromonas species and appeared to be 98% identical to Aeromonas salmonicida subsp. salmonicida strain VA-K2V5 (Figure 2). However, we must point out that strain Alg3.1 differs from the type strain of this strain in some properties. Based on Gram staining, morphology, biochemical, physiology and 16S rDNA sequence analysis, the agarolytic strain Alg3.1 was grouped into the genus of Aeromonas. There has not been report on agarase production from this genus. Searching agarolytic bacteria in GenBank database showed that there is not discover Aeromonas species, and phylogenetic tree of some agarolytic bacterium presented in Figure 3. Consequently, these result indicated that the Gracilaria-associated bacteria strain Alg3.1 is a novel agarolytic bacteria producing extracellular agarase enzyme.

Agarolytic activity of strain Alg3.1 Most of the reported agar-degrading enzyme producers are marine microorganisms active in algae cell wall decomposition. Because agarases are the enzymes that hydrolyzes agar, they have been isolated from the surface of rotted red algae in the South China Sea coast in Hainan Island, decomposing algae in Niebla in Chile and in Halifax in Canada, and decomposing Porphyra in Japan (Fu and Kim 2010). Curiously, decomposition of agar by microorganisms appears to be performed almost entirely by gram-negative bacteria, although few if any gram-positive bacteria have been identified as producers of alginate degrading enzyme (Khambhaty et al. 2008).

A B C D Figure 1. Agarolytic bacterial colonies on TCBS medium with 2% agar (A), clearance zone of free cell-supernatant of the strain Alg3.1 incubated at 4h on agar plate after flooding with iodine (B), and agar liquefying by agarolytic bacterium strain Alg3.1 after incubated 3 d (C) and 15 d (D) in solid medium.

FATURRAHMAN et al. â&#x20AC;&#x201C; Agar-liquefying marine bacterium

195

Table 1. Phenotypic characteristics of Aeromonas strain Alg3.1 Characteristics Morphology Gram-reaction Motility Aerobic growth Anaerobic growth Optimum pH Optimum temperature Oxidase Urease Elastase PNPG Indole production Hydrolysis of Gelatin Starch Esculine Nitrate

Aeromonas strain Alg3.1 Rods + + 7.5 25-29oC + + Nd -

A. salmonicida subsp. pectinolytica MEL Rods + -

+ + + +

Nd Nd + Nd

Nd + + Nd +

Characteristics Substrate utilization: Glucose Mannitol Sucrose Maltose Mannose Arabinose Sorbitol Lactose NAceG K-glukonat Capric acid Adipic acid Malic acid Citrate Phenilacetat acid

Aeromonas strain Alg3.1

A. salmonicida subsp. pectinolytica MEL

+ + + Nd + + + -

Nd Nd + Nd Nd Nd + + + + Nd Nd Nd + Nd

Alg3.1

70

23 As strain VA K2-V5 22 89 99 100

As strain N20 As strain N8 As strain VA K2-M7

As strain 8 57 As strain C22

A hydrophila strain M-1 Shewanella sp. VA C1-3 V alginolyticus strain CIFRI V-TSB1 0.02

Figure 2. Phylogenetic tree based on 16S rDNA gene sequencing showing the relationships between the agar-degrading strain Alg3.1, Aeromonas spp. and related genera. Their GenBank accession numbers for the bacteria in the tree are: Aeromonas salmonicida subsp. salmonicida strain VA_K2-V5, GQ869652.2; A salmonicida strain N20, HM244937.1; A salmonicida strain 8, HQ533268.1; A salmonicida strain 8, HQ533268.1; A salmonicida strain C22, HQ259698.1; A salmonicida strain N8, HM244936.1; A. hydrophila strain M-1, HQ609947.1; and Shewanella sp. VA_C1-3, GQ869648.1 and V. alginolyticus, JF784015.1 were used as outgroup.

To clarify the level of agar degradation, the cell growth during the batch fermentation of the strain Alg3.1 to produce agar-degrading enzyme and the change of agardegrading enzyme activity in the supernatants of the culture broth were investigated. Figure 4 shows the growth curve of Aeromonas Alg3.1 and the production of agarase in the presence of agar, where is growth and production agarase walk successive. The strain Aeromonas Alg3.1 readily released agarase into the medium yielding monosaccharide or agarooligosaccharide. The biomass reached maximum and the agar-degrading enzyme activity was 0.425 nkat/mL after cultivation for 44 h and the maximum activity was 0.489 nkat/mL at 36h after incubation. During the logarithmic phase of growth the enzyme activity showed a rapid increase. But the activity decreased before cell entering to the stationary and decline phase.

Figure 4. Time courses for cell growth of strain Alg3.1 and agardegrading enzyme activity change in culture broth. Cells were grown in a BSM supplemented peptone and yeast extract at 120 rpm at 29oC, pH 7.5. Cell growth was estimated by optical density at 620 nm (OD).

B I O D I V E R S IT A S 12 (4): 192-197, October 2011

196

74 27

Simiduia areninigrae strain M2-5 Microbulbifer maritimus strain MTM147

36

Cellvibrio sp. KY-YJ-3 Alteromonas sp. KMAB2

9

100

Alteromonas sp. QM65 Alg3.1

9 19 16

Halomonas sp. KMAB1 Vibrio agarivorans strain 289 Thalassomonas sp. M-M1

76

98

Thalassomonas agarivorans strain TMA1 Agarivorans sp. QM34 Pseudoalteromonas sp. QM47

44 99

Pseudoalteromonas antarctica Flavobacteriaceae bacterium ZC1 Agarivorans albus strain QM38 (agarase gen)

Figure 3. The genetic relationship between Alg3.1 with other genera of agarolytic bacteria

The activity of agarase crude extract of Alg3.1 is 2.9 fold higher than P. antartica N-1, 0.1667 nkat/mL (Vera et al. 1998). Numerous reported data indicate that agarases purified from genus of Vibrio have lower specific activities, which are 7.54 and 20.8 U/mg from strain PO303 (Araki et al. 1998) and 6.3 U/mg from strain JT0107 (Sugano et al. 1993). Agarases from genus Agarivorans show medium specific activities, which are 57.45 and 76.8 U/mg from strain HZ105 (Hu et al. 2008) and 25.54 U/mg from strain YKW-34 (Fu et al. 2008). Agarases from genus Alteromonas and Pseudoalteromonas exhibit high specific activities, which are 83.5 U/mg from Alteromonas sp.

SY37-12 (Wang et al. 2006), 234 U/mg from Alteromonas sp. C-1 (Leon et al. 1992).

To maximize producing intracellular agarase, growth and production medium was chosen and the culture conditions were adjusted. Table 2 showed that the best medium for produce intracellular agarase is basal salt solution medium (Medium B) which supplemented with bacto peptone (0.5%, w/v) and yeast extract (0.1%, w/v). Strain Alg3.1 needs growth factor such as bacto peptone and yeast extract to grow optimum, and the production of agarase influenced by salt concentration. In medium B, we can regulate salt concentration as according to need of the bacteria.

Table 2. Growth and qualitative agarase activity of Alg3.1 strain in various medium for 24h incubation. Qualitative activity was measured based on diameter of clearing zone by using cell-free supernatant which incubated in solid medium for 4 h at 29oC Growth media Marine broth Sea water medium Basal salt solution medium B BSM + peptone + yeast extract

Growth (cfu/mL) 6.0 x 107 7.4 x 107 4.1 x 107 1.1 x 108

Clearing zone (mm) 26.5 32.5 21 38

Identification of reaction product The result of visualization with UV 254 nm shows a large amount of two kind of agarooligosaccharide as major product (Figure 5). These result indicated that this strain have multi extracellular agarase enzymes, which could cleavage agarose into neoagarotetraose by agarase I, then, neoagarotetraose is cleaved at by neoagarotetraose hydrolase-or agarase II-to yield neoagarobiose. Finally, neoagarobiose is degraded by periplasmic ď Ą-neoagarobiose hydrolase to the D-galactose and 3,6-anhydro L-galactose, which are metabolized by intracellular enzymes.

Figure 5. TLC of the products of agarose hydrolyzed by the partial purified agarase enzyme. Standard (1,2), Abn1.2 (3), Alg3.1 (4), neoagarooligosaccharide (5), fructooligosaccharide (6) and D-galactose (7)

Numerous reports show that agarolytic bacteria can produce agarase enzyme that vary. A part of these strains only produce agarase type I like Pseudomonas SK38, other has only agarase II like Agarivorans JAMB-A11, there also that can to produce agarase I and II like in P. atlantica.

FATURRAHMAN et al. – Agar-liquefying marine bacterium

Possibility to produce bioethanol from agarophyte Increase on world’s energy demand and the progressive depletion of oil reserves motivate the search for alternative energy resources, especially for those derived from renewable materials such as biomass (Saxena et al. 2009).

Global concern about climate change and the consequent need to diminish greenhouse gases emissions have encouraged the use of bioethanol as a gasoline replacement or additive (Balat et al. 2008). Bioethanol may also be used as raw material for the production of different chemicals, thus driving a full renewable chemical industry.

Substitution bioethanol as one of energy source has been selected as an alternative source for the fossil fuel substitution. The marine seaweed, such as Agarophyte, can be used for the production of bioethanol. The main component of agarophyte such as Gracilaria consists of a complex biopolymer cellulose, hemicelluloses, agar or carrageenan (Abbot and Dawson 1978). Agar is composed of two fractions, agarose and agaropectin. Agarose, the main constituent, is a neutral polysaccharide that forms a linear chain structure consisting of repeating units of agarobiose, which is an alternating polymer of D-galactose and 3,6-anhydro L-galactose linked by alternating β-(1, 4) and -(1,3) bonds (Allouch et al. 2003; Flament 2007). The product of agar-degradation consist of neoagarotetraose as the major end product, neoagarobiose, D-galactose and 3,6anhydro L-galactose (Hosoda et al. 2003; Michel et al. 2006).

This strain can degrade and utilized several complex polysaccharides, such as agar, agarose, starch, and carrageenan. Although Alg3.1 can hydrolyze carboxy methyl cellulose but can not utilize it as carbon source solely (Table 3). These results suggest that agar-liquefying Alg3.1 might be a good candidate as a producer bioethanol from agarophyte, because if we mix this strain with other bacteria or yeast so D-galactoses can be catabolytic into piruvic acid via Tagatosa or Leloir pathway, furthermore the fermented of piruvic acid produce large amounts of alcohol, acetic and formic acids.

Table 3. Polysaccharides degradation and utilization by the strain Alg3.1 Polysaccharides Agar Agarose Soluble Starch carrageenan CMC

Degradation

Utilization

+ + + + +

+ + + + -

CONCLUSION The Gracilaria-associated bacteria strain alg3.1 is a new report of agarolytic bacteria from Aeromonas genera which can produce extracellular agarase enzyme. This strain have two kind of agarooligosaccharides as major product and can degrade and utilized various of complex polysaccharides, such as agar, agarose, starch, and carrageenan.

197

REFERENCES Abbot IA, Dawson EY (1978) How to know the seaweed. McGraw-Hill, Boston.

Agbo JAC, Moss MO (1979) The isolation and characterization of agarolityc bacteria from a Lowland river. J General Microbiol 115: 355-368 Allouch J, Jam M, Helbert W, Barbeyron T, Kloareg B, Henrissat B, Czjzek M (2003) The three-dimensional structures of two β-agarases.

J Biol Chem 278: 47171-47180 Araki T, Lu Z, Morishita T (1998) Optimization of parameters for isolation of protoplasts from Gracilaria verrucosa (Rhodophyta). J Mar Biotechnol 6:193-197.

Balat M, Balat H, Öz C (2008) Progress in bioethanol processing.

Progress in Energy and Combustion Science 34: 551-573.

Dygert S, Li L, Florida D, Thoma JA (1965) Determination of reducing sugar with improved precision. Anal Biochem 13: 367-374.

Flament D. 2007. Alpha–agarase define a new family of glycoside hyrolases, distinct from beta-agarase families. J Appl Environ Microbiol 73: 4691-4694 Fu XT, Kim SM (2010) Agarase: Review of major sources, categories, purification method, enzyme characteristics and applications. Mar Drugs 8: 200-218 Fu XT, Lin H, Kim SM (2008) Purification and characterization of a novel β-agarase, AgaA34, from Agarivorans albus YKW-34. Appl Microbiol Biotechnol 78:265-273 Hoffsten B, Malmqivst M (1974) Degradation of agar by gram-negatrive bacteria. J General Microb 87:150-158 Hosoda A, Sakai M, Kanazawa S (2003) Isolation and characterization of agar-degrading Paenibacillus spp. associated with the rhizosphere of spinach. Biosci Biotechnol Biochem 67: 1048-1055 Hu Z, Lin BK, Xu Y, Zhong MQ, Liu GM (2008) Production and purification of agarase from a marine agarolytic bacterium Agarivorans sp. HZ105. J Appl Microbiol 106:181-190 Jean WD, Shieh WY, Liu TY (2006) Thalassomonas agarivorans sp. nov., a marine agarolytic bacterium isolated from shallow coastal water of An-Ping Harbour, Taiwan, and emended description of the genus Thalassomonas. Int J Syst Bacteriol 56: 1245-1250.

Johnson TR, Case CL (2007) Laboratory experiment in microbiology.

Pearson Benjamin Cummings, Singapore.

Khambhaty Y, Modi K, Jha B (2008) Purification, characterization and application of a novel extracellular agarase from a marine Bacillus megaterium. Biotechnol Bioprocess Engineer 13: 584-591 Michel G, Nyval-Collen P, Barbeyron T, Czjzek M, Helbert W (2006) Bioconversion of red seaweed galactans: a focus on bacterial agarases and carrageenases. J Appl Microbiol Technol 71:23-33 Macian MC, Ludwig W, Schleifer KH, Pujalte MJ, Garay E (2001) Vibrio agarivorans sp. nov., a novel agarolytic marine bacterium. Int J Syst Bacteriol 51: 2031-2036.

Marchesi JR (1998) Design and evaluation of usefull bacterium-specific PCR primers that amplify gens coding for bacterial 16S rRNA. J Appl Environ Microbiol 64 : 795-799 Nontji A (2007) Ocean of Nusantara. Djambatan, Jakarta. [Indonesia] Saxena RC, Adhikari DK, Goyal HB (2009) Biomass-based energy fuel through biochemical routes: a review. Ren Sust Ener Rev 13: 167-178.

Sie YF, Yang HC, Lee Y (2009) The Discovery of agarolytic bacterium with agarase gene containing plasmid, and some enzymology characteristics. Int J Appl Sci Engineer 1:25-41 Soegiarto A, Sulistijo (1985) The potential of marine algae for biotechnology products in Indonesia. In: Workshop on marine algae biotechnology; Jakarta, 11-13 December 1985. [Indonesia] Sugano Y, Terada I, Arita M, Noma M (1993) Purification and characterization of a new agarase from a marine bacterium, Vibrio sp. strain JT0107. Appl Environ Microbiol 59:1549-1554 Van der Meulen HJ, Harder W (1976) Characterization of the neoagarotetrase and neoagarobiase of Cytophaga flevensis. Antonie van Leeuwenhoek 42:81-94.

Vera J, Alvares R, Murano E, Slebe JC, Leon O (1998) Identification of a marine agarolityc Pseudoalteromonas isolate and characterization of its extracellular agarase. J Appl Environ Microbiol 64: 4374-4383 Wang JX, Mou HJ, Jiang XL, Guan HS (2006) Characterization of a novel β-agarase from marine Alteromonas sp. SY37-12 and its degrading products. Appl Microbiol Biotechnol 71:833-839.

Yoon JH, Kim IG, Kang KH, Oh TK, Park YH (1996) Alteromonas sp. nov. isolated from sea water of the East Sea in Korea. Int J Syst Bacteriol 23: 1625-1630.

B I O D I V E R S IT A S Volume 12, Number 4, October 2011 Pages: 198-203

ISSN: 1412-033X (printed edition) ISSN: 2085-4722 (electronic) DOI: 10.13057/biodiv/d120403

Soil microorganisms numbers in the tailing deposition ModADA areas of Freeport Indonesia, Timika, Papua IRNANDA AIKO FIFI DJUUNA1,â&#x2122;Ľ, MARIA MASORA2, PRATITA PURADYATMIKA3 1

Department of Soil Science, Faculty of Agriculture and Agriculture Technology, State University of Papua, Amban Campus, Manokwari 98314, West Papua, Indonesia. Tel.: +62-986-211974. Fax. +62-986-211455. â&#x2122;Ľemail: irnanda_afd@yahoo.com 2 Department of Biology, Faculty of Mathematics and Science, State University of Papua, Manokwari98314, West Papua, Indonesia.

3 Department of Environmental, Freeport Indonesia, Timika, Papua, Indonesia.

Manuscript received: 21 April 2011. Revision accepted: 20 August 2011.

ABSTRACT Djuuna IAF, Masora M, Puradyatmika P (2011) Soil microorganisms numbers in the tailing deposition ModADA areas of Freeport Indonesia, Timika, Papua. Biodiversitas 12: 198-203. The objective of this study was to examine the number and distribution of bacteria, fungi and actinomycetes in the inactive tailing deposition areas of Freeport Indonesia Mining and Gold Company, Timika. One hundred ninety eight composite samples (0-20 cm) were taken from four location of inactive tailing ModADA (Modification Aijkwa Deposition Areas) namely double levee-bottom (fine texture); double levee-middle (medium texture); double levee-top (coarse texture); Mile 21 and transmigration areas of I to V. The conventional method of dilution and Plate Count Agar were used to examine the population of soil bacteria, fungi and actinomycetes. pH and moisture content were also analyzed. The numbers of bacteria in the tailing deposition areas are in the range from 3.48x105 CFU/g soil to 102.83x105 CFU/g soil, soil fungi from 1.51x105 CFU/g soil to 106.61x105 CFU/g soil and actinomycetes range from 0.32x104 CFU/g soil to 113.74x104 CFU/g soil. While in some transmigration areas, the number of soil bacteria, fungi and actinomycetes were lower than in the tailing areas. The number of soil bacteria and fungi were higher than actinomycetes. However, the coefficient of variation of actinomycetes (107%) was higher than soil fungi (89%) and bacteria (68%). Tailing deposition areas are considered as a good habitat for soil microorganisms. Overall, the number of soil organism in the tailings areas are considered medium to high, however to understand their functioning in each location under different land use system, more research are needed to evaluate their roles especially in the decomposition of soil organic matter.

Key words: tailing deposition, soil bacteria, fungi, actinomycetes.

INTRODUCTION Tailings are small sized residue of mined material that generated from the separation process of copper, gold and silver by flotation technique of the concentrate rock (Mahler and Sabirin 2008). The production of copper, gold and silver of Freeport Indonesia Company produce a big amount of tailing in average of 230,000 tons/day which are deposited in the lowland area called Modified Ajkwa Deposition Area (ModADA) (PTFI 2003, 2005, 2007).

Tailing deposit has a particle size varies from coarse to fine, with less organic matter and contains very little nutrients. Taberima et al. (2011) has reported that tailing deposited in ModADA areas deficient in some macro nutrients, while base cations and some micro nutrients are abundant. Some of the nutrients from tailing deposit areas are generally not in the available form for plants, therefore its fertility level is very low. The availability of natural organic matter is very low affected by climate factor (rainfall, temperature, sunlight, humidity), organic matter availability, soil reaction, and the variety of decomposer microorganism. Soil microorganism especially decomposer microorganism is very important to the stability of organic matter weathering.

The information about the variation and status of soil microorganism such as bacteria, fungi and actinomycetes is needed to improve the fertility and productivity of tailing.

These microorganisms are the largest group of soil microorganism (micro biota living in the natural habitat including tailing area. Bacteria is a dominant group of microorganisms in the soil with population of >108 CFU per gram soil and 104-106 units? number of species.

Actinomycetes is the second largest group of microorganisms with density of population about 106-107 CFU per gram soil, while fungi in the third position with population density of 104-106 CFU per gram soil (Celentis Analytical 2003; Handayanto and Hairiah 2007). These groups of organisms are useful as quality and healthy indicator of soil. They have ecosystem function as one of sensitive biological marker and useful to identify the disturbance and damage of ecosystem (Roper and OphelKeller 1997).

Therefore, basic data about soil microorganism biodiversity especially the group of soil decomposer which is beneficial for plant growth in tailing deposition area is very important in the management and reclamation planning of tailing area. This information will be used as an important factor in the evaluation and identification of alterations occurred in the tailing deposition area.

DJUUNA et al. – Soil microorganisms of Freeport tailing deposition

As an effort to identify the availability of bacteria, fungi, and actinomycetes from the tailing deposition areas, the isolation and identification of this micro biota group from the tailing aiming to find out the micro biota population and distribution from several locations in inactive tailing deposit area (ModADA) and transmigration agricultural area as a standard of comparison.

Coordinate point of each sample point was determined by Global Positioning System (GPS). The number of the whole samples taken was 198 points, or as many as 1980 composed auger samples.

Isolation and identification of bacteria, fungi and Actinomycetes The isolation of soil bacteria, fungi and actinomycetes was conducted by dilution method using NaCl 0.85% as a solvent with the dilution series of 10-1-10-7. Sample (100 μL) was poured into a petridish contained Nutrient Agar (NA) for bacteria, Potato Dextrose Agar (PDA) media for fungi and Starch-Casein Agar (SCA) media for actinomycetes which was then incubated in the incubator of temperature at 27-300C. After 2-3 days incubation (bacteria); 3-5 days (fungi); and 5-7 days (actinomycetes), observation was conducted based on 30-300 colony/plate thinning. The amount of colonies was counted by using Plate Count Method (Lay 1994).

All microorganisms were identified by isolating each microorganism by using universal media as a growing media for soil microorganism. Each microorganism could be purified in a special media. Afterward, the microorganism in pure culture was identified microscopically by Wet mounts and Gram stain, and biochemical test.

Morphological observation of the microorganism found by microscope included cell size, form of mycelia and other characteristics, and then it was identified based on the characteristics of microorganism found and followed by Bergey’s Manual Handbook of identification for bacteria; identification of fungi using the method of Cappuccino and Sherman (2001) and Atlas (1995), and for actinomycetes using the method from Sembiring (2000), Sembiring et al.

(2000) and Prescott et al. (1999).

MATERIALS AND METHODS Soil sampling and analysis Inactive tailing sample is taken from the depth of 0-20 cm in 8 locations of ModADA areas and Transmigration Area i.e. lower-ADA (fine deposit); middle-ADA (medium deposit); upper-ADA (coarse deposit); old-ADA (inactive deposit area); Double Levee; Mil 21; and transmigration area SP I, II, IV and V. Research site and point of sample taken is presented on Figure 1A. The laboratory analysis was conducted in Timika Environmental Laboratory (TEL) Freeport Indonesia Company, for soil pH and soil moisture content. For the observation of microorganism population, it was conducted in Water Microbiology Laboratory, Public Health and Malaria Control, Freeport Indonesia Company, Kuala Kencana, Timika and continued in Soil Biology Laboratory Faculty of Agriculture and Agricultural Technology) and Microbiology Laboratory of Faculty of Mathematics and Natural Sciences of University of Papua Manokwari.

Soil samples were taken compositely in the depth of 020 cm by using a soil auger in each 200 m interval, but in the location which its width was smaller than the distance between points, was 50-100 m. In each point, sample was taken as many as 10 augers with 1 meter distance circularly in order to get composite sample from each point.

A

199

B

C

Figure 1. Research site map and point of sample taken in tailing deposition area of PT. Freeport Indonesia, Timika (A); and distribution map of soil pH (B) and soil moisture content (C).

B I O D I V E R S IT A S

200

12 (4): 198-203, October 2011

Microbial Biomass Carbon (MBC) with FummigationExtraction method (Vance et al. 1987; Sparling 1990).

The distribution of soil pH and moisture content in the tailing areas is presented in Figure 1B and 1C. It showed that most of the tailing areas have high value of soil pH, however only few locations have had lower soil pH (4.64.9). In contrast, only few areas in Mile 21 and 23 have >45.7 % of soil moisture content. This might be caused by high level of rain and the areas were located nearby river.

Data analysis All data were then analyzed by using statistic analysis which consists of two stages: (i) data distribution was done by using conventional statistic (mean, minimum, maximum, median, standard deviation, skewness, kurtosis and coefficient of variation, and histogram), which was assumed implicitly that observation conducted was independent to every sample point; and (ii) Geostatistical Analysis was used to analyze the distribution of soil microorganisms, based on the location the samples was taken. Krigging interpolation was used to estimate data on one or more points not taken as a sample.

Microorganism distribution map was created by using GIS software ArcView/ArcMap ÂŽ (version 9.2 ESRI), with Spatial Analyst and Geostatistical Analyst extensions.

Population and distribution of soil microorganisms Isolation result showed that bacteria, fungi and actinomycetes population in all study location were varied and ranged between 3.48x105-102.83x105 CFU/g (bacteria), 1.51x105-106.61x105 CFU/g (fungi) and 0.32x104113.74x104 CFU/g (actinomycetes). If it is compared between these three microorganisms, it can be seen that bacteria and fungi population were higher than actinomycetes. However, the Coefficient of Variation (CV) of actinomycetes was higher (107%) than fungi (89%) and bacteria (68%) (Table 2). In other words, the higher the coefficient of variation values the more the number of variation in the soil.

The comparison of soil microorganism population in tailing area and transmigration area (SP I, II, IV and V) was presented in Table 2. The total number of soil microorganism in tailing area tended to be higher than the average population of soil microorganism in transmigration area. The average population of microorganism in tailing area was 16.84x105 CFU/g (bacteria), 11.83x105 CFU/g (fungi), and 9.94x10 5 CFU/g (actinomycetes). While the

RESULTS AND DISCUSSION Soil characteristics (pH and moisture content) Data on soil pH and moisture content in the tailing areas is presented in Table 1. In general, the range of soil pH in the tailing areas was from 4.61 to 8.67 with the mean of 7.00. While the moisture content ranged from 2.40 to 62.00% with the mean of 20.13%. Soil pH and moisture content were factors that affected the number and distribution of soil microorganism in the soil.

Table 1. Mean of soil pH and moisture content in the tailing and transmigration areas

Variable Soil moisture content (%) pH H2O (1:2)

Mean (x105CFU/g dried soil) 20.13 7.00

Median (x105 CFU/g dried soil 17.95 7.42

SD

Kurtosis

Skewness

11.05 1.13

0.40 -0.93

0.81 -0.64

Min (x105 CFU/g dried soil) 2.40 4.61

Max (x105 FU/g dried soil) 62.00 8.67

CV (%) 54.92 16.09

Table 2. The average population of bacteria, fungi and actinomycetes (0-20cm) in PTFI tailing area and transmigration area SP I, II, IV and V, Mimika District Median (x105 CFU/g dried soil

SD

Kurtosis

Skewness

Min (x105 CFU/g dried soil)

Max (x105 FU/g dried soil)

CV (%)

PTFI tailing area (n=190) Bacteria 16.84 Fungi 11.83 Actinomycetes 9.94

12.82 8.44 7.01

11.34 10.45 10.53

16.19 34.95 49.57

2.73 4.39 5.55

3.48 1.51 0.32

102.83 106.61 113.74

67.36 88.35 105.91

Transmigration areas (n=8) Bacteria 7.37 Fungi 5.47 Actinomycetes 5.63

7.04 4.83 5.80

2.37 1.90 2.41

0.76 -0.92 -1.73

0.56 0.50 -0.26

3.88 2.92 2.47

11.70 8.31 8.52

32.14 34.67 42.90

PTFI tailing area and transmigration area (n=198) Bacteria 16.46 12.38 11.28 Fungi 11.57 8.12 10.32 Actinomycetes 9.77 6.95 10.36 Note: SD= Standard Deviation, CV= Coefficient of Variation

16.23 35.71 51.17

2.74 4.44 5.64

3.48 1.51 0.32

102.83 106.61 113.74

67.99 89.06 106.83

Variable

Mean (x105CFU/g dried soil)

DJUUNA et al. â&#x20AC;&#x201C; Soil microorganisms of Freeport tailing deposition

average population of microorganism in transmigration area was 7.37x105 CFU/g (bacteria), 5.47x105 CFU/g (fungi), and 5.63x105 CFU/g (actinomycetes).

Kriging interpolation result showed that the distribution of bacteria, fungi and actinomycetes in tailing area tended to be the same that was following the distribution of vegetation and soil characteristics such as pH and soil moisture content. Generally, soil pH and soil moisture content were the factors which could affect the total number, activity and distribution of microorganism in soil (Figure 2A, 2B, and 2C). The population of bacteria, fungi and actinomycetes was higher on secondary forest vegetations and natural succession area compared with the location planted by some agricultural crops.

Microbial Biomass Carbon (MBC) The MBC in tailing deposition areas of ModADA ranged from 26.25 to 4957.29 ppm with the mean of 1774.61 ppm. Microbial Biomass C is one parameter that has been used to determine the amount of C in the soil microbe, therefore the MBC value has been indirectly correlated to soil C. The MBC in the tailing areas was tend to follow the distribution of soil texture, which is on the fine texture areas, the MBC was higher compare to coarse texture areas. This pattern can be affected the number of microorganisms in the tailing areas.

Based on the isolation result of the amount of soil microorganism found, therefore identification result of soil microorganism in tailing area and its surrounding was found 10 species of bacteria i.e. Nitrosomonas sp., Clostridium sp., Bacillus cereus, Bacillus subtilis, Thiobacillus sp., Arthrobacter sp., Desulfovibrio sp., Serratia marcescens, Chromobacterium violaceum, and Pseudomonas sp.; four species of fungi i.e. Aspergillus fumigatus, Aspergillus sp., Aspergillus niveus, and Penicillium chrysogenum; and also

A

201

three species of actinomycetes i.e. Micrococcus, Mycobacterium, and Arthrobacter.

Results of soil microorganism population showed that the high number of soil microorganism in tailing area and its surrounding was not followed by range of this soil microorganism species in all of sample taken points.

Population and distribution of soil organisms are highly varied in the soil depended on soil types and characteristics, land cultivation and vegetation growing on it. Differences of land use resulted in different population of bacteria, fungi and actinomycetes (Gofar et al. 2007).

There were three main factors which influenced population and biodiversity of soil microorganisms i.e. (i) weather, especially precipitation and humidity; (ii) soil condition/characteristic, particularly the acidity, humidity, temperature and the availability of soil nutrients; and (iii) type of vegetation such as forests, bushes and grass field (Hanafiah et al. 2005). In general the number of bacteria in the soil was higher compared to the number of other microfloras such as fungi, actinomycetes and algae, however individually the number was lower (Alexander 1977). This also could be seen toward comparison of the number of bacteria, fungi, and actinomycetes in tailing area and its surroundings. Bacteria were a group of microorganism in the soil which was the most dominant and included half of microbe biomass in the soil (Subba Rao 1944). Number of bacteria in the soil usually ranged between 108-109 CFU/g soil, while number of fungi and actinomycetes respectively ranged between 107-108 and 105-106 CFU/g soil.

Number and activity of soil microorganism was influenced by climate, vegetation and habitat of its surroundings including the soil characteristics and land use pattern. Vegetation difference and land use pattern in tailing area and transmigration area resulted the difference

B

C

Figure 2. Distribution map of soil (A) bacteria, (B) fungi and (C) Actinomycetes in tailing area PT Freeport Indonesia, Timika.

202

B I O D I V E R S IT A S

12 (4): 198-203, October 2011

on number of soil microorganism, because generally lands used for agricultural crops conservation, some treatments such as the continual application of chemical fertilizer and pesticide could influence the number and distribution of soil microorganism. In the contrary, in some location in tailing area, the number and distribution of soil microorganism was low. It could be happened due to the organic matter content of the soil was low. Generally soil with highly sand content has low organic matter content.

The species of soil microorganism found in all points of sample taken generally could exist and grow mostly in several species of soil such as Pseudomonas sp and Bacillus sp; however, their normal population in the soil was categorized as low. These bacteria were also known as zymogene and fermentative microorganism that needed energy from outside the soil (Subba Rao 1994). Included in this bacteria group was cellulose decomposed bacteria, nitrogen consumption bacteria and bacteria which could break ammonium into nitrate. Besides, among the bacteria species found in the study location, it was also found several colonies of bacteria resembling Chromobacterium violaceum (natural antibiotics producer bacteria â&#x20AC;&#x153;violaceinâ&#x20AC;?), and Thiobacillus and Desulfovibrio which are also species of bacteria which could oxidize and reduce sulfur so they were called the group of sulfur bacteria.

Majority, these bacteria exist and grow well in waterlog or anaerobe areas, but Thiobacillus bacteria group could also exist in aerobe condition. Thiobacillus is a type of bacteria that could oxidize inorganic sulfur compound so it was called special bacterium. This bacterium could produce sulfate acid if sulfur element was added in the soil to decrease soil pH as low as 2.0 long after it was incubated with the bacteria (Subba Rao 1994). In addition to this, Thiobacillus commercially played very important role in mining industry in the process of acid waste (Horan 1999).

Another type of sulfur bacteria like Desulfovibrio, was reducing inorganic sulfate into sulfide hydrogen so the existence of this bacterium could reduce sulfur content for plantâ&#x20AC;&#x2122;s nutrient and because of that it could influence agriculture production. This bacterium mostly live and grow well in anaerobe condition and could produce sulfide hydrogen. Some tailing areas which covered by waterlog condition could potentially be occupied by this type of bacteria, therefore regular monitoring in this areas can reduce the population of this bacteria.

Generally, the existence of other soil microorganisms such as fungi and actinomycetes was influenced by quality and quantity of organic substance in the soil. Fungi lived dominantly in the acid soil and monopolize the use of natural substrate in the soil. Group of soil fungi and actinomycetes found in the study location was the group of soil fungi and actinomycetes which was generally found in the soil such as Aspergillus sp. and Streptomyces sp.

Aspergillus sp. was one of soil fungi type which produced substance which was similar to humic substance in soil and because of that it was somewhat important in maintaining soil organic substance (Subba Rao 1994).

Different with fungi, actinomycetes was not tolerant to acid and their number would decrease at pH 5.0. Usually, actinomycetes would grow well at pH between 6.5 and 8.0.

So was with the level of moisture quite high, the number of actinomycetes was decreased.

Soil pH was one of soil chemical characteristics which very influenced to the number and distribution of microorganism in the soil. Population and distribution of this microorganism in tailing area and its surroundings were influenced by soil pH; however the relationship between pH and the soil microorganism was significantly negative. In general, number of soil microorganism would increase at soil pH nearly neutral. But several soil microorganism species could be also tolerant to the soil which was so acid or alkaline. Soil pH which was a little bit low (4.6-4.9) in several locations of sample taken, could impact in the increasing of metal solubility so that observation was needed if location of low pH was found.

Besides soil pH, soil moisture was one of environmental factors that influenced the number and activity of microorganism in the soil. Generally soil microorganism preferred the environment which was nearly moist, but several organisms were tolerant to dry condition and stagnation. This was the same with the observation result that soil moisture level influenced significantly negative to the population and distribution of soil microorganism in tailing area and its surroundings. The higher the level of soil moisture content in tailing area, the number of the distribution of the soil microorganism was low.

Soil organic matter is an important fraction that can support population of microorganism in the soil especially for those microorganisms in the organic matter. Microbial biomass is a living component in the organic matter which contains 2-7% from C organic in the soil (Gupta and Roget 2003). The total Microbial Biomass C in the tailing areas was in the range of 26.25-4957.29 ppm (very low to very high). Generally, the total number of MBC on the soil surface is 250 mg C/kg in the sandy soils and 1100 mg C/kg in the clay soils and high of organic matter. Although the MBC is only small part of organic matter (2-7%), its live and dynamic properties has been made sensitivity to most of land management compared to the total organic matter (Gupta and Roget 2003). Microbial biomass C in the soil can be used as an indicator to predict the soil fertility especially the status of organic matter in the soil (Sparling 1992).

Soil microorganism variation comprised number, distribution and species of existed microorganism in tailing area and its surroundings showed that the tailing area was one of good habitats for soil microorganism that was not different with other habitats. Because generally the number and distribution of soil microorganism in this area was categorized as middle-high from the average number of most organisms found in other types of soil. By the existence of soil microorganism population and distribution in the tailing area also showed that tailing areas was not the toxic habitat for this microorganism group. But the number of organism found in the tailing area was not followed by high variety of the species. This was caused by the characteristic of each organism that was number and distribution in the soil which was highly influenced by several soil characteristics such as physical, chemical and biological characteristic and other ecologycal factors. Soil

DJUUNA et al. â&#x20AC;&#x201C; Soil microorganisms of Freeport tailing deposition

organic matter was one of the factors that highly determined the survival of soil microorganism, so that the increasing of soil organic matter in tailing area was really needed to maintain, to keep and to increase the number and the type of soil organism. In addition, planting some plants which was easily decomposed in tailing area was one of the alternatives that could increase the number and the species of soil microorganism and also to keep its balance and stability.

CONCLUSION Number of soil organism in tailing area and its surroundings was categorized as middle-high. The average number and population of soil microorganism in tailing area and its surroundings were 16.46x105 (bacteria), 11.57x105 (fungi) and 9.78x104 (actinomycetes) CFU/g soil. There were 10 species of bacteria i.e. Nitrosomonas sp, Clostridium sp, Bacillus cereus, Bacillus subtilis, Thiobacillus sp., Arthrobacter sp., Desulfovibrio sp., Serratia marcescens, Chromobacterium violaceum, and Pseudomonas sp.; four fungi species i.e. Aspergillus fumigatus, Aspergillus sp., Aspergillus niveus, and Penicillium chrysogenum, and also three species of actinomycetes i.e. Micrococcus, Mycobacterium, and Arthrobacter. Majority of bacteria and fungi found was decomposer microorganism of organic matter particularly cellulose decomposers and phosphate solubilizers. The biodiversity of soil microorganism comprised number, distribution and species of organisms in tailing area and its surroundings showed that tailing area was also one of a good habitat and was not toxic for soil microorganism which was not different with other natural habitats.

ACKNOWLEDGEMENTS Our gratefulness goes to PT Freeport Indonesia for all of kind helps given in this research through a Cooperation of PT Freeport Indonesia (PTFI) and the State University of Papua (UNIPA) Manokwari, West Papua, Indonesia.

REFERENCES Alexander M (1977) Introduction to soil microbiology. John Wiley & Sons, New York.

Atlas RM (1995) Handbook of media or environmental microbiology.

CRC Press. New York.

Cappuccino GJ, Sherman N (2001) Microbiology: A Laboratory Manual.

Cummings Publishing Company Inc, New York.

203

Celentis Analitical (2003) Biological soil test-definitions. www.lifestyleblock.co.nz/general/sfs/213 Soil biological Testdefinition.htm Gofar N, Amin-Diha M, Napoleon A (2007) Diversity of soil microbes in cultivated swamp land. J Akta Agrosia 1: 5-10. [Indonesia] Gupta WSR, Roget DK (2003) Understanding soil biota and biological functions: Management of soil biota for improved benefits to crop production and environmental health. In: Abbott LK , Murphy DV (eds). Soil Biological Fertility-A key to sustainable land use in agriculture. Kluwer, The Nederland.

Hanafiah KA, Anas I, Napoleon A, Ghoffar N (2005) Soil biology: Ecology and soil macrobiology. Raja Grafindo Persada, Jakarta.

[Indonesia] Handayanto, Hairiah K (2007) Soil biology: The fundamental of soil health. Pustaka Adipura, Yogyakarta. [Indonesia] Holt JG (1994) Bergeyâ&#x20AC;&#x2122;s Manual of determination of bacteriology, 9 th ed.

William & Wilkins, Baltimore, Md. Horan J (1999) Acid mine drainage experiments. Department of Chemistry and Geochemistry, Colorado School of Mines, Golden, CO, USA. Lay BW (1994) Analysis of microorganisms in laboratory. Raja Grafindo Persada, Jakarta. [Indonesia] Mahler A, Sabirin N (2008) From Grasberg to Amamapare: The process of copper and gold mining from highland to lowland. Gramedia, Jakarta. [Indonesia] PCARD [The Phillipines Council for Agriculture and Resources Research] (1980) Standard methods of analysis for soil, plant tissue, water and fertilizer. Farm Resources and Systems Research Division, Los Banos, The Philippines.

Prescot ML, Harley JP, Klein DA (2005) Microbiology. 6th ed. Mc Graw Hill, New York.

PTFI [PT Freeport Indonesia] (2003) Report on environmental monitoring and management. Environmental Department of PT Freeport Indonesia, Kuala Kencana, Mimika, Papua. [Indonesia].

PTFI (2006) Report on environmental monitoring and management of 1st quarterly January, February, March 2006. PT Freeport Indonesia, Jakarta. [Indonesia].

PTFI (2007) Report on environmental monitoring and management of 1st quarterly 2007. PT Freeport Indonesia, Jakarta. [Indonesia].

Roper MM, Ophel-Keller KM (1997) Soil microflora as bioindicators of soil health. In: Pankhurst C, Doube BM, Gupta VVSR (eds).

Biological indicators of soil health. CAB International, New York.

Sembiring L (2000) Selective isolation and characterization of Streptomyces assosiated with the rhizosphere of the tropical legume, Paraserianthes falcataria (L) Nilesen. [Ph.D. Dissertation] University of Newcastle. Newcastle, UK. Sembiring L, Ward AC, Goodfellow M (2000) Selective isolation and characterization of members of the Streptomyces violaceusniger clade associated with the roots of Paraserianthes falcataria. Antonie van Leeuwenhoek 78: 353-366.

Sparling GP (1990) Soil biomass evaluation. Proceeding of PACIFICLAND Workshop on the Establishment on Sloping Land.

IBSRAM Technical Notes No.4, Bangkok.

Subba-Rao NS (1994) Soil microorganisms and plant growth. 2nd ed.

University of Indonesia Press, Jakarta [Indonesia] Taberima S, Mulyanto B, Gilkes R, Husin Y (2010) Fertility status of soils developed on an inactive mine tailings deposition area in Papua [P1094]. 19th World Congress of Soil Science; Soil Solution for A Changing world. Brisbane Australia, 1-6 August 2010.

Vance ED, Brookes PC, Jenkinson DS (1987) An extraction method for measuring soil microbial biomass C. Soil Biol Biochem 19:703-707.

B I O D I V E R S IT A S Volume 12, Number 4, October 2011 Pages: 204-211

ISSN: 1412-033X (printed edition) ISSN: 2085-4722 (electronic) DOI: 10.13057/biodiv/d120404

Inventorying the tree fern Genus Cibotium of Sumatra: Ecology, population size and distribution in North Sumatra TITIEN NGATINEM PRAPTOSUWIRYO♥, DIDIT OKTA PRIBADI, DWI MURTI PUSPITANINGTYAS, SRI HARTINI Center for Plant Conservation-Bogor Botanical Gardens, Indonesian Institute of Sciences. Jl. Ir. H.Juanda No. 13, P.O. Box 309 Bogor 16003, Indonesia.

Tel. +62-251-8322187. Fax. +62-251- 8322187. ♥e-mail: tienpferns@yahoo.com Manuscript received: 26 June 2011. Revision accepted: 18 August 2011.

ABSTRACT Praptosuwiryo TNg, Pribadi DO, Puspitaningtyas DM, Hartini S (2011) Inventorying the tree fern Genus Cibotium of Sumatra: Ecology, population size and distribution in North Sumatra. Biodiversitas 12: 204-211. Cibotium is one tree fern belongs to the family Cibotiaceae which is easily differentiated from the other genus by the long slender golden yellowish-brown smooth hairs covered its rhizome and basal stipe with marginal sori at the ends of veins protected by two indusia forming a small cup round the receptacle of the sorus. It has been recognized as material for both traditional and modern medicines in China, Europe, Japan and Southeast Asia.

Population of Cibotium species in several countries has decreased rapidly because of over exploitation and there is no artificial cultivation until now. The aims of this study were: (i) To re-inventory the species of Cibotiun in North Sumatra, (ii) to record the ecology and distribution of each species, and (iii) to assess the population size of each species. Field study was carried out by using random search with belt transect. Two species were recorded, namely C. arachnoideum dan C. barometz. The geographical distribution of the two species in North Sumatra is presented. Cibotium is commonly growing terrestrially on opened or rather opened areas in secondary forest and primary forest at hills or lower mountains with a relatively high humidity at 30-90º slopes. C. arachnoideum has a strict distribution and only found at 1740-1770 m a.s.l. in primary forest, whereas C. barometz has a broad distribution in secondary forest at elevation range from 650-1200 m.

Key words: Cibotium, ecology, distribution, tree fern, Sumatra.

INTRODUCTION It is now widely recognized that current extinction rates of plant and animal species are between hundred and a thousand times higher than back rates throughout life’s history of Earth (May 2002). Therefore the world’s biodiversity should be inventoried and monitored.

As defined by Stork and Samways (1995) biodiversity inventorying is the surveying, sorting, cataloging, quantifying and mapping of entities such as genes, individuals, populations, species, habitats, biotypes, ecosystem and landscapes or their components, and the synthesis of the resulting information for the analysis of pattern and processes. Inventory refers to a listing of all the species of plants, animals, fungi, protest and microbes in a defined area. Survey refers to methodical exploration of an area in order to discover the species that live there (Wheeler 1995). Inventories for rare plants may be designed to: (i) Locate populations of species; (ii) Determine total number of individuals of species; (iii) Locate all population of rare species within a specific area (often a project area); (iv) Locate all rare species occurring within a specific habitat type; (v) Asses and describe the habitat of rare species (associated species, soils, aspect, elevation); (vi) Asses existing and potential threats to a population (Elzinga et al. 2005) There are three levels of monitoring for plant population:

distribution, population size and demographic monitoring.

These can be applied to species according to theirs protection and management objectives (Menges and Gordon 1996). Hutching (1991) described that the status and trends of plant population may be studied on four levels: population distribution, quantitative monitoring of population size and (or) condition, monitoring of population structure, and demographic study the population. Basic information about the distribution and regional dynamics of different species is essential for practical conservation management of rare species, i.e. species with low relative abundance or distribution at continental, and particularly at regional and local levels.

Cibotium Kaulfuss is a genus of about 12 species of tropical tree fern (Holttum 1963; Hassler and Swale 2002) which is subject to much confusion and revision. Therefore it is treated in different family, such as in subfamily Cibotioideae of Cyatheaceae (Holttum 1963), Cibotiaceae (Hassler and Swale 2002; Smith 2006). This genus is distributed in Central America and Mexico, Hawaii, Assam to southern China, southwards to Western Malesia and Philippines (Holttum 1963).

Cibotium comprises large ferns with usually prostrate or erect trunk-like rhizome and large bipinnate fronds. The apex of rhizome is protected by a thick cover of long slender golden yellow-brown hairs. These hairs are also long at the base of the stipe and often matted in appearance.

PRAPTOSUWIRYO et al. – Inventorying of the tree fern Genus Cibotium

Sori are marginal, at the ends of veins, protected by two indusia which are alike in texture and diffrent from the green lamina of lobes on which they are borne, the outer indusium deflexed so that the sorus appears to be on the side of the lobe, the inner indusium at maturity bending back towards the costule and elongating, usually becoming oblong, the two indusia joined together for a short distance at the base, thus forming a small cup round the receptacle of the sorus (Holttum 1963; Large and Braggins 2004).

One species of Cibotium, namely C. barometz, has been recognized as material for the traditional medicine and modern medicines in China, Japan and France (Zamora and Co 1986, Praptosuwiryo 2003). In China the species has important value for medicinal purpose which is known in medicinal trade as ‘gou ji’ (Jia and Zhang 2001, Smith 2009). The gold yellowish-brown hairs on its rhizome and stipes have been used in S.E. Asia and China as a styptic for a bleeding wound (Zamora and Co 1986, Jia and Zhang 2001). The extract of the rhizome (‘gouji’) is also used by Chinese and Japanese as an antirheumatic, to stimulate the lever and kidney, to strengthen the spinal, to expel wind and damppnesss, and as a prostatic remedy (Zamora and Co 1986).

Population of Cibotium species in several countries has decreased rapidly because of over exploitation and there is no artificial cultivation until now. The species has been included in Appendix II of the Convention on International Trade in Endangered Species (CITES) since 1976. In order to utilize it in sustainable use, NDF (Non Detriments Finding) system has to be applied for determining the annual quotas. Biological aspect is one of the important information that is needed to be known, including the ecology, population size and distribution. To obtain those data, inventories and monitoring of the population need to be done.

Based on the specimens examined housed at Herbarium Bogoriense (BO) there was only one record of Cibotium collected from North Sumatra. It was collected by H. Surbeck in on 30 May 1941 (No. Coll.: H. Surbeck 114) Sibuctan south, Lae Pondom (the correct name is Lao Pondom), 1100 m, edge of primary forest, and identified as C. barometz. The correct name of this record is C. arachnideum. This paper presents the recently data on ecology, population size and distribution of Cibotium species in North Sumatra. For practical consideration, in this study, populations were defined as spatially distinct assemblages of plants at certain sites, without considering the genetic structure of the population. Following those defined by Landi and Angiolini (2008) populations were defined as discrete clusters of plants, separated from other cluster by at least 500 m.

Most studies on the ecology, population and distribution of ferns were based on quantitative methodological approaches, such as Landi and Angiolini (2008; 2010), Banaticla and Buot (2005). However these studies can also be approached by using qualitative methodology (Nitta 2006; Boonkerd et al. 2008; Rusea et al. 2009). The aims of the study were: (i) to re-inventory the species of Cibotium in North Sumatra, (ii) to record the ecology and distribution of each species, and (iii) to assess the population size of

205

each species by using random search methodology using belt transect.

MATERIALS AND METHODS Site studies Nine localities of Cibotium habitats included in six subdistrict of three district, Dairi District, Karo District and Deli Serdang District, were successfully surveyed (Table 1). There is only one locality of Cibotium population found in Dairi District, namely Bukit Kota Buluh, Kota Buluh Village, Tanah Pinem subdistrict. Three localities are situated at Karo District, namely: (i) Bukit Butar, Butar Village, Tiga Binanga Subdistrict; (ii) Aik Batu Forest-Lau Pondom, Aik Hotang Village, Merek Subdistrict; (iii) Samperen Secondary Forest, Bukit Layang, Negeri Juhar Village, Juhar Village. Four localities are included in Sibolangit subdistrict, Deli Serdang district, namely: (i) Tikungan Amoi forest, Tahura Bukit Barisan, Bandar Baru Village; (ii) Betimus River, Wely forest, Sukamakmur Village, and (iii) Kataruman Forest, Takur-Takur Hill, Negeri Suah Village; (iv) Gunung Sibayak II, Treck Mata Air Petani, Bandar Baru Village. One locality situated in Kota Limbare Subdistrict of Deli Serdang District, namely Sungai Sae Binge Forest. Habitat characteristics of the nine localities are summarized in Table 2.

Procedures Data on ecology and distribution was based on observation during field studies and also derived from herbaria sheet information or collection notes of specimens deposited at BO (Herbarium Bogoriense). Field studies were carried out in October-December 2009 in North Sumatra province, Indonesia. Voucher specimens are deposited at BOHB (Herbarium of Bogor Botanic Gardens).

Random search with belt transect is set up to estimate the population size or the abundance of adult plant of C. barometz in a certain area. Belt transect is very commonly used in studies on population biology of plants (see Lutes 2002; Shenoy et al. 2011). In the study of C. barometz the belt transect was set up in 20x125 m2 or 20 x 250 m2 with 20 x 25 m2 subplots (Figure 1). The position and number of transect were determined based on the spatial distribution pattern of C. barometz in each distribution areas. In general C. barometz reveals in the same direction of the contour of hills. Therefore, in this study the belt transect was established in the line of hills contour as this transect method is usually very suitable to be applied on the field areas having hilly or mountainous contour. One transect was set up if the population of C. barometz in a certain areas was only found in certain slope. Minimally 3 transects were set up in the situation in which C. barometz distributed from lower slopes to upper slope, viz. lower, middle and upper slopes. Population size data generated from transects were used to estimate the population size of C. barometz in a certain areas in which its population performance were almost similar to the population performance in transect. Transects commonly cover 2530% of the total distribution areas of C. barometz.

206

B I O D I V E R S IT A S 12 (4): 204-211, October 2011

Figure 1. Basic sampling unit of C. barometz survey, a long, 20 x 250 m belt-transect, with subplots (20 x 25 m).

The activities that have been carried out in this survey could be described as follows: (i) exploring the habitat of C. barometz; (ii) morphological diversity observation; (iii) collecting population data; (iv) recording the associated plants with C. barometz and environmental condition around C. barometz vegetation (elevation, slope, air temperature and humidity, soil type in general, pH and humidity of soil, the thickness of litter and humus soil).

In collecting population data only the mature plants were recorded for each species which was determined by the following categories: (i) rhizome at least 10 cm height, 8 cm diam. or more; (ii) lamina more than 60 cm long and (iii) presence of fertile fronds. Cibotium is usually growing solitary or in a clump (consisted of 2-20 individuals). In this research population size was determined by counting individual plant not clump.

5 2 1

6 3 4

Figure 4. Distribution map of Cibotium in North Sumatra. 1. Tanah Pinem Subdistrict; 2. Tiga Binanga Subdistrict; 3. Juhar Subdistrict; 4.

Merek Subdistrict; 5. Kuta Limbare Subdistrict; 6. Sibolangit Subdistrict.

Table 1. The geographical distribution of Cibotium species in North Sumatra

PRAPTOSUWIRYO et al. – Inventorying of the tree fern Genus Cibotium

207

District

Subdistrict

Locality

Species

Dairi Deli Serdang

Tanah Pinem Kota Limbare Sibolangit Sibolangit Sibolangit Sibolangit Tiga Binanga Juhar Merek

Bukit Kota Buluh, Kota Buluh Village Sungai Sae Binge forest Tikungan Amoi forest, Tahura Bukit Barisan, Bandar Baru Village Betimus River, Wely forest, Sukamakmur Country, Kataruman Forest, Takur-Takur Hill, Negeri Suah Village Gunung Sibayak II, trek Mata Air Petani, Bandar Baru Village Bukit Butar, Butar Village, Samperen Secondary Forest, Bukit Layang, Negeri Juhar Village Aik Batu Forest-Lau Pondom, Aik Hotang Village

C. baromertz C. baromertz C. baromertz C. baromertz C. barometz C. baromertz C. barometz C. baromertz C. arachnoideum

Karo

RESULTS AND DISCUSSION Floristic There are only two species found in North Sumatra, viz.

C. arachnoideum and C. barometz (Table 1, 2; Figure 2, 3).

The two species are distinguished by three characters combinations: (i) the existence the hairs on costa and costule of the adult fronds; (ii) the incision of pinnulae segments, (iii) the pair number of sori. Cibotium barometz differs from C. arachnoideum by combination of diagnostic characters as follows: C. barometz has sori 2 or more pairs on each pinnule-lobe of larger fronds, largest pinnules 2035 mm wide, pinnules on the two sides of a pinna not greatly different in length, hairs on lower surface of costae and costules almost always thin and flaccids and never spreading. Meanwhile C. arachnoideum always has two pairs of sori on large fronds, largest pinnules 15-26 mm wide, pinnules on basiscopic side of lower pinnae much shorter than those on acroscopic side, spreading hairs lacking, but rigid (often red) appressed hairs always present and sometimes abundant, small flaccid hairs present on lower surface of lamina between vein. Those characters combinations are met those specimens described by Holttum (1963).

Distribution Geographical distribution of Cibotium in North Sumatra is presented in Table 1. and Figure 4. Holttum (1963) reported that C. arachnoideum was only distributed in Malesian region in Central and South Sumatra, Sarawak, and N. Borneo. There was one locality of this species found in North Sumatra, namely Lau Pondom (Table 1.) Based on the notation of the specimen examined from BO (Herbarium Bogoriense), this species was found at the margin primary forest in Lau Pondom at 1100 m a.s.l In North Sumatra C. barometz is more widely distributed than C. arachoideum (Table 1.). The geographical distribution data of C. barometz in North Sumatra is a new record for science. It would give important information in defining the current and future options available to meet human needs, especially for North Sumatra society, in future, and guiding immediate and long term management, policy and decision-making concerning the sustainable uses of C. barometz.

In the biogeographic point of view Cibotium provides an excellent example combining several kinds of distributional change as well as speciation (Barrington, 1993). Cibotium is a Pacific-rim genus of about eight extant species, one in southeastern Mexico (C. schiedei Schlect. & Cham.), one or perhaps two (C. barometz (L.) J. Sm. and C. cumingii Kze.) in the Old-World tropics from Assam to China to Western Malesia region) and the Philippines (Holttum, 1954; Copeland, 1958) and about six in Hawaiian islands (Becker, 1984; Wagner 1990). Holttum (1963) reported three species of Cibotium in Malesian region, namely C. arachnoideum (C.CHR.) Holttum, C. barometz (L.) J. SM. and C. cumingii Kze. Holttum (1963) stated that in Malesia C. barometz distributes in Malay Peninsula, Sumatra and Java, but there is no new record of this species in Java after Backer and Posthumus (1939).

Habitat characteristics The habitat characteristics of two species of Cibotium are relatively different (Table 1). Cibotium arachnoideum in Lao Pondom is found at elevation range from 1740-1770 m. This species grows on a range temperature of 2323.5ºC, moist condition (RH ± 80%), soil type of sandy quartz-rockery with dust or clay soil, soil acidity of 5.8, humus soil depth 3-4 cm, leaves litter depth 2.5-12.5 cm. It grows on the hill with 0-80 % of slopes. C. arachnoideum is found among the terrestrial fern species of Dipteris conjugata, Dicranopteris linearis, Blechnum sp., Pyrrosia sp., Hymmenophyllum sp., Hystiopteris stipulaceae., Phymatodes sp. and Elaphoglossum sp. In Mt. Kinabalu, Borneo, C. arachnoideum usually grows in cultivated areas. This species survives burning when land is cleared for cultivation and persist on steep lading (fields) at 9001200 m asl. (Parris et al. 1992).

Cibotium barometz has a wide range of habitat, at elevation range from 600-1165 m. It prefers growing on opened areas or shaded areas of secondary forest and margin primary forest. The optimum canopy coverage of C. barometz is usually in a range from 40-60%. The localities with a relatively high population size, such as in secondary forest of Butar Hill and secondary-primary forest of Kataruman Forest (Takur-takur Hill), the canopy coverage is on a range from 40-60% and 50-70%, respectively. This species needs warm temperature, 23-30ºC with humidity range from 30-90%.

208

B I O D I V E R S IT A S 12 (4): 204-211, October 2011

C

A

B

D

Figure 2. Cibotium arachnoideum. a. Rhizome with stipes; b. Lamina; c. Part of pinnulae with fertile lobes showing one row of sori on each pinnule-lobe; d. Transversal section of basal stipe covered by brown shining hairs and showing the vascular bundles.

C

A

B

D

Figure 3. Cibotium barometz. a. Rhizome with stipes; b. Lamina; c. Part of pinnulae with fertile lobes showing one row of sori on each pinnule-lobe; d. Transversal section of basal stipe covered by brown shining hairs and showing the vascular bundles.

Soil type is main factors which affect on the distribution of C. barometz. It is mainly found on yellow podzolik and red inceptisol with soil acidity 5.2-6.6. Nguyen (2009) stated that C. barometz is an acid soil indicator species in tropical and subtropical area, but rare in the limespone areas. This species can grow on hard-rock with very thin humus soil or litter to humus rich soil with a depth range from 2-15 cm.

In seconday forest C. barometz usually grows with fern pioneer species such as Nephrolepis hirsutula, Dicranopteris linearis, Gleichenia truncate, Blechnum orientale, Pteridium aquilinum, Histiopteris stipulace, Taenitis blechnoides and Dipteris conjugata. In the margin of primary forest this species can be found among the light shady ferns as well as the opened area ferns. The light

shady ferns which are usually found among the C. barometz are Cyathea recomuttata, Diplazium bantamense, D. cordifolium, D. crenatoserratum, D. tomentosum, Selaginella spp. While the opened area ferns grow with this species are almost similar to those found in secondary forest areas. C. barometz also survives on burning areas when land is cleared for cultivation by producing new shoots from the rhizome. In this condition this species is usually found among and at the margin thicket of P. aquilinum (Figure 3).

Cibotium in the secondary forest community of North Sumatra can be included in the key species. In North Sumatra Cibotium often dominates an area where this species occurs, such as in Aik Batu Forest of Lao Pondom, Kataruman Forest of Bukit Takur-Takur, Samperen Forest

PRAPTOSUWIRYO et al. – Inventorying of the tree fern Genus Cibotium

11

Table 2. Distribution, population size and habitat characteristics of Cibotium in North Sumatra Habitats characteristics of species Leaves Humus Air Canopy Soil TempeMajor litter soil humi- coverage acidity Terrestrial fern species and seed plants commonly associated depth depth ratures soil type dity (%) (pH) (cm) (cm) 23-23.5 8050-70 Sandy 2.5-12.5 3-4 5.8 Dipteris conjugata, Dicranopteris linearis, Blechnum sp., Pyrrosia sp., 80.5 quartzHymmenophyllum sp., Hystiopteris stipulaceae., Phymatodes sp. dan Elaphoglossum. rockery with Leptospermum flavescens, Dacrycarpus imbricatus,, Podocarpaceae, Myrtaceae, dust or clay Ericaceae, Melastomataceae, Pandanaceae, Nephentaceae soil 24-25 75-80 40-60 Yellow 3-10 2.5-4 5.8 Pteriudium aquilinum, Adiantum sp., Taenintis blechnoides, Selaginella sp., podzolid Drypteris sp., Dicarnopteris linearis, Davallia sp. Gleichenia sp, Gleichenia truncate Schima wallichii, Sloanea sigun, Zingiberaceae,, Apocynaceae, Fagaceae, Theaceae 24-25.5 8050-70 Red 6.5-12.5 2-6.5 6.4-6.5 Diplazium simplicivenium , Pleocnemia irregilaris, Tectaria sp., Nephrolepis sp., 80.5 inseptisol Diplazium crenatoserratu, Eurya nitida, Arenga pinnata, Arecaceae, Theaceae, Moraceae

23-24

80-85

60-70

Yellow podzolid

2-4

6-10

24-25

80-85

50-60

Yellow podzolid

10-15

10-12.5 6.4

Diplazium betimusense, Cyathea contaminans, Cyathea sp., Thelypteridaceae, Sellaginela sp., Syzygium sp., Artocarpus sp., Araceae, Moraceae, Myrtaceae, Theaceae, Fagaceae

23.325.0

80-96

60-70

Yellow podzolid

5

5-10

5.0

27

72

50-75

Red Inseptisol

3-7

2-3

6.2

29.4

78

30-40

Red Inseptisol

3-10

2.5-4

5.5

Selaginella sp, Cyathea contaminans, Cyathea sp., Dydimochlaena truncatula, Pleocnemia sp., Thelypteridaceae, Asplenium cf. laserpitiifolium, Diplazium bantamense var. bantamense, D. bantamense var. alternifolium, D. subserratum, D. betimusense, D. tomentosum, D. xiphophyllum dan D. sorzogonense.

Araceae, Moracceae, Myrtaceae, Rubiaceae Pteridium aquilinum, Woodwardtia sp., Lindsaea sp., Cheiopleura biscupsis, Taenitis blechnoides Araceae, Myrtaceae, Dicranopteris linearis, Gleichenia truncata, Pteridium aquilinum, Nephrolepis hisutula.

Piper aduncum, Moraceae,

40-45

Yellow podzolid

3

3

5.2-5.8.

25-26.4 83-88

6.0-6.4

Cyathea recomuttata, Diplazium bantamense, D. cordifolium, D. crenatoserratum, D. pallidum, D. simplicivenium, D. tomentosum, Selaginella sp, Nephrolepis acuminata, Histiopteris stipulaceae, Araceae, Fagaceae, Elaeocarpaceae

PRAPTOSUWIRYO et al. – Inventorying of the tree fern Genus Cibotium

Blechnum orientale, Lindsaea sp., Taenitis blechnoides Araceae, Arecaceae, Myrtaceae,

209

Population size Locality, forest type, (Σmature Slope Altitude and Species individual/ ( º ) (m) ha) Aik Batu Forest, Lao 372/0.25 30-80 1740-1770 Pondom Primary forestsecondary forest C. arachnoideum Bukit Butar 1128/1 45-80 Ca. 875Secondary forest 900 C. barometz Kataruman Forest of 1464/1 30-70 650-817 Takur-takur Hill Primary forestsecondary forest C. barometz Tekungan Amoi Forest 17/2 25-35 650-700 (TAHURA Bukit Barisan I) Secondary forest C. barometz Wely Forest-Betimus 13/2 760-780 River Secondary forest C. barometz Gunung Sibayak II 4/1 35-40 980-1090 (Trek Mata Air Petani).

Primary-secondary forest C. barometz Samperen Forest, Bukit 385/0.5 45-50 1110-1165 Layang C. barometz Forest of Bukit Kuta 402/0.5 30-40 800 Buluh Secondary forest C. barometz Sungai Sae Binge 163/0.5 0-90 740-760 Forest Secondary forest C. barometz

B I O D I V E R S IT A S 12 (4): 204-211, October 2011

210

A

B

C

D

Figure 5. Habitat characteristics of Cibotium barometz. a. and b. Margin of primary forest at Bukit Layang; c. Burning areas of secondary forest of Bukit Layang showing three plants of C. barometz; d. Margin of secondary forest at Bukit Butar showing the associated fern species of C. barometz, Dicranopteris linearis and Gleichenia truncate. White arrow showing individual or clump of C. barometz

of Bukit Layang and Bukit Butar. The species which is usually the dominants or more robust ones in the community, in particular they are those whose population dynamics has a strong effect on other species in the community is included in key species (Mueller-Dombois 2005). In the mature Hawaiian rainforest Cibotium spp revealed the characteristic of key species.

Population size Population size data of Cibotium species in North Sumatra is presented in Table 2. These are new potential distribution of Cibotium in Sumatra. Secondary forest of Bukit Butar and Kataruman Forest, Bukit Takur-Takur, showed a relatively high population size of C. barometz , more than 1000 adult plants in one hectare areas. Bukit Layang and Bukit Kuta Buluh were also revealed a high enough population size as the two localities showed an estimation population size of 350-400 individuals of adults plant in 0.5 hectare areas. The relative density of C. barometz per hectare is usually determined by distance among the individual plants or clumps, clumps size, the dominance of the habit whether solitary or forming a clump.

In comparison with the population of C. barometz the population size C. rachnoideum in Lao Pondom is very small as it was only 372 individuals in 2500 m2. Habit type appears significant in determining the population size of the two species. In North Sumatra C. arachnoideum is usually grows solitary or forms a clump which is only consisted of 2-3 plants whereas C. barometz in can form a cl u mp i n a r a n g e fr o m 2 -5 i nd i v id ual s. Hab it at characteristics are also significant factors on the population size (Table 2). Referring the categories the criteria of the IUCN Standarts and Petition Subcommittee (2010) used to evaluate if a taxon belongs in threatened categories (Critically Endangered, Endangered or Vulnerable) C. arachnoideum in North Sumatra is vulnerable as there is only one population found and the size of population is less than 500 individuals in 2500 m2 of the areas occupancy.

CONCLUSION Two species of Cibotium are recorded in North Sumatra, namely C. arachnoideum and C. barometz.

Cibotium arachnoideum has a strict distribution and is only

PRAPTOSUWIRYO et al. – Inventorying of the tree fern Genus Cibotium

found in one locality (Aik Batu Forest, Pondom Stream (Lao Pondom), Aik Hotang Village, Merek Subdistrict, Karo District) and strictly distributed at 1740-1770 m s.l.

C. barometz is more widely distributed and found at eight localities, namely Butar Hill, Tikungan Amoi Forest, Betimus River, Kataruman Forest, Gunung Sibayak II, trek Mata Air Petani, Samperen secondary forest (Bukit Layang), Bukit Kota Buluh and Sungai Sae Binge secondary forest from elevation 650 until 1200 m.

Cibotium is commonly growing in open areas and rather opened areas of secondary forest and primary margin forest of hills and lower montane with a relatively high humidity with a range from 30-90º slope in acid soil. In North Sumatra, the two species of Cibotium reveal a relatively different habitat characteristic. The two species will not growing together on the same areas because they are living in different altitudes. Population size of C. barometz in North Sumatra showed a relatively high population size in four localities (Bukit Butar, Bukit Takur-takur, Bukit Layang, Bukit Kuta Buluh) with the estimation of 7001500 individuals in 10,000 m2. Cibotium arachnoideum in North Sumatra is vulnerable as there is only one population found and the size of population is less than 500 individuals with an area of occupancy less than 3000 m2.

Further studies on spatial distribution and habitat characteristics of C. barometz and C. arachnoideum in Sumatra are needed. Further studies on biological characteristics and mechanism triggering the rarity of C. arachnoideum in Sumatra are also very important.

ACKNOWLEDGEMENTS This research was supported by Center for Plant Conservation-Bogor Botanical Gardens, Indonesian Institute of Science and North Sumatra Conservation Agency (Balai Besar Konservasi Sumber Daya Alam, Sumatra Utara). We wish to thank the Director of the Herbarium Bogoriense (BO) which allowed us use material and facilities. The present study was supported by a Grant-in-Aid for Scientific Research from Directorate General of Higher Education, Ministry of National Education, GoI, 18/SU/SP/Insf.-DIKTI/VI/09, under the Program Insentif Peneliti dan Perekayasa LIPI TA 2009.

REFERENCES Backer CA, Posthumus O (1939). Varenflora voor Java. Uitgave van’s Lands Plantetuin, Buitenzorg.

Banaticla MCN, Buot Jr IE (2005) Altitudinal zonation of pteridophytes on Mt Banahaw de Lucban, Luzon Island, Philippines. Plant Ecol 180: 135-151.

Barrington DS (1993) Ecological and historical factors in fern biogeography. J Biogeogr 20: 275-280.

Becker R (1984) The identification of Hawaiian tree ferns of the genus Cibotium. Am Fern J 74: 97-100.

Boonkerd T, Chantanaorrapint S, Khwaiphan W (2008) Pteridophyte diversity in the tropical lowland rainforest of Khao Nan National

211

Park, Nakhon Si Thammarat Province, Thailand. Nat Hist J Chulalongkorn Univ 8 (2): 83-97.

Copeland EB (1958) Fern flora of the Philippines. Vol I. Bureau of Printing, Manila.

Elzinga CL, Salzer DW, Willoughby JW (2005) Measuring and monitoring: Plant populations. Nature Conservation, U.S. Department of the Interior, Bureau of Land Management. Washington DC. Hassler M, Swale B (2002) Family Dicksoniaceae genus Cibotium; world species list. http://homepages.caverock.net.nz/~bj/fern/cibotium.htm [Accesed 17 Mei 2008].

Holttum RE (1954) Fern of Malaya. Goverment Printing Office, Singapore.

Holttum RE (1963). Cyatheaceae. Flora Malesiana Ser II. Vol 1 (2): 164-166.

Hutchings MJ (1991) Monitoring plant populations: cencus as an aid to conservation. In: Goldsmith EB (ed) Monitoring for conservation and ecology. Chapman & Hall, London.

IUCN Standarts and Petition Subcommittee (2010). Guidelines for using the IUCN Red List Catagories and Criteria. Version 8.1. http://intranet.iucn.org/webfiles/doc/SSC/RedListGuidelines.pdf Jia J-S, Zhang X-C (2001) Assessment of resources and sustainable harvest of wild Cibotium barometz in China. Med Pl Conserv 7: 25-27.

Landi M, Angiolini C (2008) Habitat characteristics and vegetation context of Osmunda regalis L. at the southern edge of its distribution in Europe. Botanica Helvetica 118: 45-57.

Landi M, Angiolini C (2010) Population structure of Osmunda regalis in relation to environmental and vegetation: An example in the Mediterranean area. Folia Geobot. DOI 10.1007/s12224-010-9086-1 Large MF, Braggins JE (2004) Tree ferns. Timbers Press, Portland.

Lutes DC (2002) Assessment of line transect method: An examination of the spatial patterns of down and standing dead wood. USDA Forest Service Gen.Tech. Rep. PSW-GTR-181, Washington DC. May RM (2002) The future of biological diversity in a crowded world.

Curr Sci 82 (11): 1325-1331.

Menges ES, Gordon DR (1996). Three levels of monitoring intensity for rare plant. Nat Areas J 16:227-237.

Mueller-Dombois D (2005) A silviculture approach to restoration of native Hawiian Rainforest. Lyonia 8(1): 61-65.

Nguyen T, Le TS, Ngo DP, Nguyen QN, Pham TH, Nguyen TH (2009) Non-detriment finding for Cibotium barometz in Viet Nam. NDFworkshop case studies (in English), Mexico, SC58 Doc. 21.1. Annex 2.

Nitta JH (2006) Distribution, ecology, and systematic of the filmy ferns (Hymenophyllaceae) of Moore, French Polynesia. UCB Moorea Class: Biology and Geomorphology of Tropical Islands, Berkeley Natural History Museum, UC Berkeley. http://escholarship.org/uc/item/6vt6p2w8 Parris BS, Beaman RS, Beaman JH (1992) The plants of Mount Kinabalu.

I. Ferns and fern allies. Royal Botanic Gardens, Kew. Praptosuwiryo TNg (2003) Cibotium barometz. (L.) J. Smith. In: de Winter WP, Amoroso VB (eds) Plant resources of South-East Asia 15 (2) Cryptogams: Ferns and ferns allies. Prosea, Bogor.

Rusea G, Claysius K, Runi S, Joanes U, Haja Maideen KM, Latiff A (2009) Ecology and distribution of Lycopodiaceae Mirbel in Malaysia. Blumea 54: 269-271.

Shenoy A, Johnstone JF, Kasischke ES, Kielland K. (2011) Persistent effects of fire severity on early successional forests in interior Alaska.

For Ecol Manag 261: 381-390.

Smith AR, Pryer KM, Schuettpelz E, Korall P, Schneider H, Wolf PG (2006) A classification for extant fern. Taxon 55: 705-731.

Smith DM (2009) Osteoporosis treatment with Chinese herb Gou Ji? Cibotium or Vegetable Lamb Plant May Help Reduce Bone Density Loss. http://www.suite101.com/content/osteoporosis-treatment-withchinese-herb-gou-ji-a163821.

Stork NE, Samways MJ (1995) Inventorying and monitoring. In: Heywood VH, Watson RT (eds) Global biodiversity assessment.

United Nations Environment Programme and Cambridge University Press, Cambridge.

Wagner WH (1990) Hawaii’s satchel-sorus tree ferns, Cibotium species: What is their taxonomic status? Fiddlehead Forum 17 (1): 7-8.

Wheeler OD (1995) Systematic, the scientific basis for inventory of biodiversity. Biodiv Conserv 4: 476-489.

Zamora PM, Co L. (1986) Economic ferns. In: Guide to Philippines flora and fauna. Vol. II. National Resources Management Centre, Ministry of Natural Resources and University of the Philippines, Manila.

BIODIVERSITAS Volume 12, Number 4, October 2011 Pages: 212-217

ISSN: 1412-033X (printed edition) ISSN: 2085-4722 (electronic) DOI: 10.13057/biodiv/d120405

Species composition and interspecific association of plants in primary succession of Mount Merapi, Indonesia 1

SUTOMO1,♥, DINI FARDILA2, LILY SURAYYA EKA PUTRI2

Bali Botanic Garden, Indonesian Institute of Sciences, Candikuning, Baturiti, Tabanan 82191, Bali, Indonesia. Tel. +62-368-21273. Fax. +62-36822051. ♥email: sutomo.uwa@gmail.com 2 Biology Department, Faculty of Science and Technology, Syarif Hidayatullah State Islamic University, South Tangerang 15412, Banten, Indonesia.

Manuscript received: 12 April 2011. Revision accepted: 24 August 2011.

ABSTRACT Sutomo, Faradila D, Putri LSE (2011) Species composition and interspecific association of plants in primary succession of Mount Merapi, Indonesia. Biodiversitas 12: 212-217. Primary succession refers to the establishment of plant species and subsequent changes in composition following major disturbance such as volcanic activity. The study of succession may assist in recognizing the possible effects of species interactions (i.e. facilitation or inhibition). The barren landscapes created by volcanic disturbance on Mount Merapi, Java, Indonesia, provide excellent opportunities to study primary succession. Fifty-six species belonging to 26 families were recorded in the five nuées ardentes deposits. The highest number of species belonged to the Asteraceae, then Poaceae, followed by Fabaceae and Rubiaceae. In Mount Merapi primary succession, the ecosystem may be developing with time as indicated by the increase in the number of species associations. The number of positive associations was generally higher than the number of negative associations, except in the 2001 deposit where it was equal. Native and alien invasive species had different patterns of interspecific associations. This research demonstrates that in primary succession sites on Mount Merapi, positive interspecific association increased as time progressed, which may support the view that facilitation is more prominent in a severely disturbed habitat as compared to competition.

Key words: primary succession, interspecific association, interaction, facilitation, pioneer, Mount Merapi.

INTRODUCTION Volcanoes has shape many of the Earth landscapes (Dale et al. 2005a). More than half of the active terrestrial volcanoes encircle the Pacific Ocean and are known as the ‘ring of fire’. Hence, there are many parallel situations in the world where volcanic activity has become a major disturbance such as in Hawaii (Mount Mauna Loa), New Zealand (Mount Ruapehu), USA (Mount St. Helens), and Indonesia (Mount Krakatau). Indonesia is particularly unique because of a series of active volcanoes which stand in line from the Sumatran Island to Java Island. With 130 active volcanoes lies on its region, Indonesia has become the most volcanic country on Earth (Weill 2004).

Primary succession refers to establishment of plant species and their changes in composition following major disturbance such as volcanic disturbance (Walker and del Moral 2003). One type of volcanic disturbance is nuées ardentes or pyroclastic flows. Nuèes ardentes are hot turbulent gas and fragmented material resulting from a collapsed lava dome that rapidly moves down the volcanic slope (Dale et al. 2005b). The accumulation of this material is called a nuées ardentes deposit and it may be up to 10 m thick (Franklin et al. 1985). Volcanic eruptions are strongly linked to depositions of volcanic materials avalanche to form “un-vegetated” barren areas which started primary succession. Primary succession commence on a barren substrate that does not have any biological legacies and

does not support any organism (Walker and del Moral 2003). Vegetation establishment on volcanic deposits has been documented in many parts of the world such as in USA, Italy and Japan and their rates have been shown to vary (Eggler 1959; Tsuyuzaki 1991; Aplet et al. 1998; Dale et al. 2005c). For example, plant establishment and spread on the debris-avalanche deposit were slow during the first years after eruption of Mt St Helens in USA (Dale et al.

2005c).

Species interactions are of central importance in the study of succession. The study of succession may assist in recognizing the possible effects of species interactions (i.e. facilitation or inhibition) (Connell and Slatyer 1977; Walker et al. 2007). Facilitation promotes establishment and in the context of succession, facilitation can be defined as any role of plants that influences a change in species composition to the next stage (Walker and del Moral 2003). Previous studies have shown that in a severely disturbed habitat, the role of facilitation will be more prominent for species change and restoration, whereas competition tends to be significant in a more productive and established habitat (Callaway and Walker 1997; Walker et al. 2007). The barren landscapes created by volcanic disturbance provide excellent opportunities to examined the role of pioneer species in facilitating or inhibiting later species in succession (Morris and Wood 1989; Walker and del Moral 2003). However, initial interactions occurring during primary succession that drive

SUTOMO et al. – Species composition and plants association of Mount Merapi

the subsequent community composition remain studied in only a few locations (Connell and Slatyer 1977; Bellingham et al. 2001).

The nuées ardentes deposits found in Mount Merapi are relatively young, with the last known eruptions occurring between 1994 and 2006. Here we examine whether or not early interaction patterns among species can be identified by examining their interspecific association and test the hypothesis that positive association will more apparent compared with negative association over time.

MATERIALS AND METHODS Study sites Merapi is one of the most active volcanoes in Indonesia which is located 30 km North of Yogyakarta Province in Java Island at 7º35’ S and 110º24’ E (Figure 1).

213

Climatologically, based on Schmidt and Fergusson’s climate classification, the Merapi area is classified as a type B, tropical monsoon area, which is characterized by high intensity of rainfall in the wet season (November-April) and then the dry season (April-October). Its annual precipitation varies from 1,500-2,500 mm. The variation of rainfall on Merapi slope is influenced by orographic precipitation. Like in many other tropical monsoon areas, there are minor temperature and humidity variations.

Merapi’s relative humidity varies from 70-90% with daily average temperatures varying from 19-30° C (Forest Office of Yogyakarta 1999).

The research sites were located in the southwest flank forests of Mount Merapi within Merapi National Park.

These sites are the most prone to and most often affected by volcanic disturbance due to the nuées ardentes that tend to flow down the hills in this direction. Using chronosequence (space for time substitution) method, we

Scale 1:25.000

Figure 1. Map of Mt. Merapi National Park’s eruption deposits. Circular symbols refer to the position of sampling sites in each deposit.

The rectangle refers to the site position of an undisturbed forest in Kaliurang, Yogyakarta.

B I O D I V E R S I T A S 12 (4): 212-217, October 2011

214

chose five areas that were affected by nuées ardentes deposits between 1994 and 2006 (Figure 1). The five deposit sites were located in a lower montane zone (Montagnini and Jordan 2005). The 1994 sampling site or the late primary succession site is located in an area surrounding the Kuning River, at an altitude of ± 1,180 m.

In this late primary successional site the vegetation is generally composed of Eupatorium odoratum (Asteraceae) and Imperata cylindrica (Poaceae).

Sampling Vegetation on the five nuées ardentes deposits was sampled in 2008. We sampled ten 250 m2 circular plots in each deposit (50 plots in total), assigned at random to grid cells on a map Dale et al. 2005c). Each plot was located in the field with reference to a compass and a handheld Global Positioning System GPS (Garmin E-Trex Legend).

We measured plant abundance as density, a count of the numbers of individuals of a species within the quadrate (Kent and Coker 1992; Endo et al. 2008). We noted both local plant name and scientific name (when known).

Whenever there was any doubt about species name, a herbarium sample was made. Drying and sample identification were done in Laboratory of Dendrology, Faculty of Forestry, Universitas Gadjah Mada, Yogyakarta.

Vascular plant nomenclature is based on Backer and Bakhuizen van den Brink (1963). Although homogeneity of the sites was taken into account when choosing sample sites, differences in site conditions were likely to occur.

Hence, for each circular plot, site attributes (altitude and slope) were measured. Altitude was measured using a GPS and referenced against 1:25,000 topographic maps. A clinometer (Suunto PM-5) was used to determine the slope (in degrees) (Le Brocque 1995).

Data analysis Species composition Plant community composition between deposits was described by Curtis and McIntosh’s Importance Value Index or IVI (1950).

IVI = RD+RF IVI = Importance Value Index RD = Relative Density Relative Density of A species =

Number of individual of A species x 100% Total number individual of all species RF = Relative Frequency Relative Frequency of A species = Frequency value of A species x 100% Total frequency value of all species

Interspecific association Interspecific association between species was measured using the chi-square (χ2) test of the species presence/ absence data on a 2 × 2 contingency table (Ludwig and Reynolds 1988; Kent and Coker 1992; Supriyadi and Marsono 2001).

Species A

Present Absent ∑

Present a c a+c

Species B Absent ∑ b a+b d c+d b+d N = a+b+c+d

a = the number of sampling unit (SU) where both species occur b = the number of SUs where species A occur but not B c = the number of SUs where species B occur but not A d = the total number of SUs Then a chi square test statistic is employed to test the null hypotheses of independence in the 2 × 2 table: x2 =

( ad - bc ) 2 N ( a + b) (a + c) (b + d) (c + d)

The significance of the chi-square test statistic is determined by comparing it to the theoretical chi-square distribution (P = 0.05, df = 1) There are two type of association: Positive, if x2 test > x2 theoretical and observed a > expected a, Where expected a = (a + b) (a + c) , that is the N pair of species occurred together more often than expected.

Negative, if x2 test > x2 theoretical and observed a < expected a, that is to say that the pair of species occurred together less often than expected.

The strength level of the association was measured using the Ochiai index, which is equal to 0 at ‘no association’ and to 1 at ‘complete/maximum association’(Kent and Coker 1992).

Ochai Index =

a (a + b) (a + c)

RESULTS AND DISCUSSION Fifty-six species belonging to 26 families were recorded in the five nuées ardentes deposits which mostly comprise of species belonged to the Asteraceae (herbs), then Poaceae (grasses), followed by Fabaceae (N2 fixing tree seedling) and Rubiaceae (shrub). Based on vegetation analysis with IVI computation, we found that each deposit has almost similar set of species composition except for the latest deposits sites namely 2006 and 2001 (Figure 2).

Some species such as Anaphalis javanica, Eupatorium riparium and I. cylindrica showed consistency of their appearance in almost all of the deposits (Figure 3). It is interesting to see that these species have fluctuated over time except for invasive pioneer I. cylindrica which was

SUTOMO et al. â&#x20AC;&#x201C; Species composition and plants association of Mount Merapi

2006

2001

1998

Melastoma

Imperata

Eupatorium

Polygala

Polytrias

Anaphalis

Athyrium

Cyperus

1997

Calliandra

Imperata

Polytrias

Eupatorium

Anaphalis

Anaphalis

Panicum

Eupatorium

Cyperus

Imperata

Athyrium

Anaphalis

Eupatorium

Polygonum

Pinus

Dodonae

Athyrium

0.9 0.8 0.7 0.6 0.5 0.4 0.3 0.2 0.1 0 Paspalum

IVI

declining in IVI index. This phenomenon may reflect that the abundance and domination of I. cylindrica decreasing as the community developed over time. The presence of other pioneer species such as A. javanica and invasive species such as E. riparium may have suppressed the domination of I. cylindrica in more developed sites.

1994

Deposits and Species

Figure 2. Dominant species based on Importance Value Index in each deposits of primary succession on Mount Merapi

0.5 0.45 0.4 0.35

Athyrium macrocarpum

IVI

0.3

Anaphalis javanica

0.25

Eupatorium riparium

0.2

Imperata cylindrica

0.15 0.1 0.05 0 2006

2001

1998

1997

1994

Deposits

Figure 3. Changes in IVI of some pioneer species of interest in each deposits of primary succession on Mount Merapi.

35 Number of association

30 25 20 15 P o sitiv e a sso cia tio n

10 5

N e g a tiv e a sso cia tio n

0 2006

2001

1998

1997

1994

D e p o sits

Figure 4. Interspecific association of species in each deposit at primary succession sites of different age.

The number of positive associations was generally higher than the number of negative associations, except in the 2001 deposit, where it was equal (Figure 4). Positive associations were highest in 1994, lowest in 2001 and 1998 and intermediate value in 2006 and 1997 deposits.

Generally, the number of negative associations for each deposit was less than positive associations. Less variability occurred in the negative associations. Negative associations were lowest in 2001 and 1998, but almost similar for 2006, 1997 and 1994 deposits.

215

Native and invasive species had different patterns of interspecific associations (Table 2). Among the native species, A. javanica possessed the highest number of negative associations with other species, followed by Pinus merkusii. In contrast, Calliandra calothyrsus had the highest number of positive interspecific association compare to Athyrium macrocarpum. A. macrocarpum had the most tendencies to co-occur (or to absent together) with Polygala paniculata as shown by their strongest positive association. Among the invasive species however, I. cylindrica is very aggressive and may become dominant in the site as indicated by the absence of other co-occurring species in all deposit sites. E. riparium was more likely to occur together with Melastoma affine, whereas the presence of Calliandra calothyrsus is more likely with Cyperus rotundus (Table 2).

The nitrogen fixing legume, C. calothyrsus showed the highest number of positive associations with other species, mostly grasses such as C. rotundus and Eleusine indica.

Native from Mexico, this species is now widely introduced in many tropical regions. C. calothyrsus is able to grow on a wide range of soils types, including the moderately acidic volcanic origin soils that are a common feature in the Southeast Asia (Palmer et al. 1994). This species is now naturalized in Asia including Indonesia (Palmer et al. 1994) The mistflower (E. riparium) had a higher number of positive associations as compared to negative associations (Table 2). This species is also the dominant groundcover species in Kaliurang, an intact forest on the southern slope of Mount Merapi (Sutomo 2004). This species may have indirectly facilitated co-occurring species such as Gnaphalium japonicum and M. affine by assisting in stabilizing and preventing erosion on the deposit site (Heyne 1987). However, over domination by this invasive species could be a problem itself. Eupatorium is native to South America, and this unpalatable and highly competitive species has become a problem elsewhere, such as in Nepal (Kunwar 2003).

Cogon grass (Imperata cylindrica) did not exhibit any association with other species in any deposits (Table 2). I. cylindrica is an aggressive alien invader that has a long record of colonizing cleared lands in Indonesia (A. Hamblin, personal communication, 28 May 2009). I. cylindrica domination in Mount Merapi nuĂŠes ardentes deposits is presumably due to its wide-spread rhizomes and its wind-dispersed seeds (Jonathan and Hariadi 1999). I. cylindrica may have contributed indirectly to the increase in the number of species colonizing the deposits, especially in the early stages, by altering the soil properties (Walker and del Moral 2003; Collins and Jose 2009).

Species changes are do not only occurring in response to changes in physical environment, but can also be the result of interaction with another species, thus species interactions are also an important indicating factor in succession and ecosystem development (Walker and del Moral 2003; Muller 2005). Species co-occurrence observations may be seen as the first attempt to detect species interaction (i.e. facilitation and inhibition) and niche processes that structure a community (Walker and del Moral 2003; Widyatmoko and Burgman 2006).

B I O D I V E R S I T A S 12 (4): 212-217, October 2011

216

While the general explanation of why two species are positively associated is because they favor the same environmental conditions, this explanation is not always as apparent as might first appear and may be over-simplistic (Kent and Coker 1992; Belyea and Lancaster 1999; Ruprecht et al. 2007). There are other factors such as plant species strategies, competition and interaction that also need to be considered (Belyea and Lancaster 1999; Dukat 2006). Facilitation may have a more vital role in species change and restoration in a severely disturbed habitat, whereas competition will tend to be important in a more productive and established habitat (Callaway and Walker 1997; Walker et al. 2007). Furthermore, one of the most important questions in plant community assembly rules may be generated from this observation: “which combination of species occurs together and why?” (Bond and Wilgen 1996).

In primary succession on Mount Merapi, the primary succession ecosystem may be developing to later stages with time as indicated by the increase in the number of species associations. Differences in the number of occurrences of positive associations with the negative associations were also recorded. Generally positive association was more apparent as compared with negative association as time progressed. This observation might support the view that in a severely disturbed habitat where primary succession is occurring, the role of facilitation will have a stronger role in species change as compared to

competition (Callaway and Walker 1997). Primary succession on Mount St. Helen was reported to be very slow due to isolated and physically stressful habitat however, facilitation by nitrogen fixing species such as Lupinus lepidus may have also occurs (del Moral and Wood 1993). Positive interaction in plant communities is more common than negative interaction in high-elevation ecosystems (Callaway 1998; Endo et al. 2008). However, there has been accumulating evidence that stated facilitation is the dominant form of interaction in many ecosystems (Callaway 2007).

Plant association has also been found in other volcanic sites across the globe. Early associations comprised of Honckenya peploides, a low-growing, sand-binding pioneer, lyme grass, Elymus arenarius, and the lungwort, Mertensia maritima, have contributed to the development of a relatively unstable ecosystem on Surtsey, a volcanic island in Iceland 30 years after eruption (Thornton 2007).

On the volcanic island of Krakatau in Indonesia, the beachcreepers Ipomoea pes-caprae and Canavalia rosea, and the grasses I. cylindrica (alang-alang) or Saccharum spontaneum (glagah), have been found to form association related to the slowly growing sand dunes community on the island (Thornton 2007). Furthermore, on a volcanic desert of Mount Fuji, Japan, a dwarf pioneer shrub Salix reinii was clumped together and positively associated with the tree seedling Larix kaempferi and has shown its role as nurse-plant in primary succession (Endo et al. 2008).

Table 2. Association tests using chi-squared test statistic (χ2) between discriminating native and invasive pioneer species.

Species

Paired species

Result of chisquared test

Type of Ochiai assoIndex ciation 0 0 0 + 1 0.4 + 0.84 + 1 + 0.84 0.4 + 0.77 + 0.70 0.4 + 0.84 0 + 1 n.a. n.a.

Associated Associated Associated Associated Associated Associated Associated Associated Associated Associated Associated Associated Associated Associated Associated Not associated Pinus merkusii Polygala paniculata Associated 0.28 Shuteria vestita Associated 0 Note: Association is significant at 0.05 levels. Values of the Ochiai Index (strength of association) are equal to 0 at ‘no association’ and to 1 at ‘complete/maximum association’. An asterisk (*) indicates an invasive species.

Debregeasia longifolia Humata repens Rubus fraxinifolius Athyrium macrocarpum Polygala paniculata Polygonum chinense Calliandra calothyrsus Crassocephalum crepidioides Cyperus rotundus Polygala paniculata Panicum reptans Eleusine indica Polytoca bracteata Polytrias amaura Eupatorium riparium* Gnaphalium japonicum Stachytarpheta jamaicensis Melastoma affine Imperata cylindrica* n.a.

Anaphalis javanica

CONCLUSION This research has demonstrated that in Mount Merapi primary succession sites, positive interspecific association increased as time progressed, which supports already establish view that facilitation is more prominent in a severely disturbed habitat as compared to competition. This result could have important value for restoration programs, which could concentrate on re-planting subsequent species that have positive association with native pioneer species, perhaps preferably focusing on legume species to enhance the barren substrates.

ACKNOWLEDGEMENTS We would like to thank Dr. Viki Cramer and Prof. Richard Hobbs from the University of Western Australia for insightful discussion, Soewarno HB from the Faculty of Forestry, Gadjah Mada University, Tri Prasetyo, the head of the Merapi

SUTOMO et al. – Species composition and plants association of Mount Merapi

National Park (BTNGM) for permission to enter the national park and conduct the field data collections, Mbah Maridjan, the late caretaker and gatekeeper of the Merapi Mountain, and also the fieldwork team: Gunawan, Ali, Iqbal, and Indri, many thanks for the kind help.

REFERENCES Aplet GH, Hughes RF, Vitousek, PM (1998) Ecosystem development on Hawaiian lava flows: biomass and species composition. J Veg Sci 9 (1): 17-26.

Backer CA, Bakhuizen van den Brink RC (1963) Flora of Java (Vol. 1).

The Rijksherbarium, Leiden.

Bellingham PJ, Walker LR, Wardle DA (2001) Differential facilitation by a nitrogen-fixing shrub during primary succession influences relative performance of canopy tree species. J Ecol 89 (5): 861-875.

Belyea LR, Lancaster J (1999) Assembly rules within a contingent ecology. Oikos 86 (3): 402-416.

Bond WJ, Wilgen BWV (1996) Fire and plants (1st ed.). Chapman and Hall, London.

Callaway RM (1998) Are positive interactions species-specific? Oikos 82: 202-207.

Callaway RM (2007) Positive interac tions and interdependence in plant communities. Springer, Dordrecht.

Callaway RM, Walker LR (1997) Competition and facilitation: a synthetic approach to interactions in plant communities. Ecology 78: 19581965.

Collins AR, Jose S (2009) Imperata cylindrica, an exotic invasive grass,changes soil chemical properties of forest ecosystems in the Southeastern United States. In: Kohli RK, Jose S, Singh HP, Batish DR (eds.) Invasive plants and forest ecosystems. CRC Press, London.

Connell JH, Slatyer RO (1977) Mechanisms of succession in natural communities and their role in community stability and organization.

Amer Nat 11: 1119-1144.

Curtis JT, McIntosh RP (1950) The interrelations of certain analytic and synthetic phytosociological characters. Ecology 31(3): 435-455.

Dale VH, Swanson FJ, Crisafulli CM (2005a) Disturbance, survival and succession: understanding ecological responses to the 1980 eruption of Mount St. Helens. In: Dale VH, Swanson FJ, Crisafulli CM (eds.)

Ecological responses to the 1980 Eruption of Mount St. Helens.

Springer, New York.

Dale VH, Acevedo JD, MacMahon J (20053) Effects of modern volcanic eruptions on vegetation. In: Marti J, Ernst G (eds.) Volcanoes and the environment. Cambridge University Press, New York.

Dale VH, Campbell DR, Adams WM, Crisafulli CM, Dains VI, Frenzen PM (2005c) Plant succession on the Mount St. Helens DebrisAvalanche deposit. In: Dale VH, Swanson FJ, Crisafulli CM (eds.)

Ecological responses to the 1980 eruption of Mount St. Helens.

Springer, New York. del Moral R, Wood DM (1993) Early primary succession on the volcano Mount St. Helens. J Veg Sci 4: 223-234.

Dukat BZ (2006) Analysing associations among more than two species.

Appl Ecol Environ Res 4 (2): 1-19.

Eggler WA (1959) Manner of invasion of volcanic deposits by plants, with further evidence from Parricutin and Jorullo. Ecol Monogr 29(3): 267-284.

Endo M, Yamamura Y, Tanaka A, Nakano T, Yasuda T (2008) Nurseplant effects of a dwarf shrub on the establishment of tree seedlings in

217

a volcanic desert on Mt, Fuji, Central Japan. Arctic, Antarctic Alpine Res 40 (2): 335-342.

Forest Office of Yogyakarta (1999) general plan of protected area management. Special Province of Yogyakarta, Yogyakarta.

Franklin JF, MacMahon JA, Swanson FJ, Sedell JR (1985) Ecosystem responses to catastrophic disturbances: lesson from Mount St. Helens.

National Geographic Res 1: 198-216.

Heyne K (1987) Tumbuhan berguna Indonesia (Vol. 1). Yayasan Sarana Wana Jaya, Jakarta.

Jonathan J, Hariadi BPJ (1999) Imperata cylindrica (L.) RaeuschelIn. In: de Padua LS, Bunyapraphatsara N, Lemmens RHMJ (eds.) Plant resources of South-East Asia No. 12 (1): medicinal and poisonous plants 1. Backhuys Publisher, Leiden.

Kent M, Coker P (1992) Vegetation description and analysis: a practical approach. John Wiley and Sons, New York.

Kunwar RM (2003) Invasive alien plants and Eupatorium: biodiversity and livelihood. Him J Sci 1(2): 129-133.

Le Brocque AF (1995) Vegetation and environmental patterns on soils derived from Hawkesbury Sandstone Narrabeen substrata in Ku-ringgai Chase National Park, New South Wales. Australian J Ecol 20: 229-238.

Ludwig JA, Reynolds JH (1988) Statistical ecology: a primer on methods and computing. John Wiley and Sons, Singapore.

Montagnini F, Jordan CF (2005) Tropical forest ecology: the basis for conservation and management. Springer, Berlin.

Morris WF, Wood DM (1989) The role of Lupine in succession on Mount St. Helens: facilitation or inhibition? Ecology 70(3): 697-703.

Muller F (2005) Ecosystem indicators for the integrated management of landscape health and integrity. In: Jørgensen SE, Costanza RE, Xu FL (eds.) Ecological indicators for assessment of ecosystem health. CRC Press, London.

Palmer B, Macqueen DJ, Gutteridge RC (1994) Calliandra calothyrsus: a multipurpose tree legume for humid locations. In: Gutteridge RC, Shelton MH (eds.) Forage tree legumes in tropical agriculture.

Queensland Tropical Grassland Society of Australia Inc., Brisbane.

Ruprecht E, Bartha S, Botta-Dukát Z, Szabó A (2007) Assembly rules during old-field succession in two contrasting environments. Comm Ecol 8 (1): 31-40.

Supriyadi, Marsono D (2001) Manual laboratory of forest ecology.

Laboratory of Forest Ecology, Department of Forest Resources Conservation, Faculty of Forestry, Gadjah Mada University, Yogyakarta. [Indonesia] Sutomo (2004) Biomass and community structure of below ground plant in Kaliurang protected forests: studies at plot 7 RPH Kaliurang.

Gadjah Mada University, Yogyakarta. [Indonesia] Thornton I (2007) Island colonization, the origin and development of island communities: ecological reviews. Cambridge University Press, Cambridge.

Tsuyuzaki S (1991) Species turnover and diversity during early stages of vegetation recovery on the volcano Usu, Northern Japan. J Veg Sci 2: 301-306.

Walker LR, Walker J, del Moral R (2007) Forging a new alliance between succession and restoration. In: Walker LR, Walker J, Hobbs RJ (eds.)

Linking restoration and ecological succession. Springer, New York.

Walker RL, del Moral R (2003) Primary succession and ecosystem rehabilitation. Cambridge University Press, Cambridge.

Weill A (2004) Volcanoes. Saddleback Educational Publishing, California.

Widyatmoko D, Burgman MA (2006) Influences of edaphic factors on the distribution and abundance of a rare palm (Cyrtostachys renda) in a peat swamp forest in Eastern Sumatra, Indonesia. Austral Ecol 31: 964-974.

B I O D I V E R S IT A S Volume 12, Number 4, October 2011 Pages: 218-224

ISSN: 1412-033X (printed edition) ISSN: 2085-4722 (electronic) DOI: 10.13057/biodiv/d120406

Establishing a long-term permanent plot in remnant forest of Cibodas Botanic Garden, West Java ZAENAL MUTAQIEN♥, MUSYAROFAH ZUHRI♥♥ Cibodas Botanic Garden- Indonesian Institute of Sciences (LIPI), Sindanglaya, Cipanas, Cianjur 43253, West Java, Indonesia, Tel./Fax.: +62-263512233, email:  zaenal.mutaqien@lipi.go.id,  ova_zuhri@yahoo.com Manuscript received: 4 December 2010. Revision accepted: 5 September 2011.

ABSTRACT Mutaqien Z, Zuhri M (2011) Establishing a long-term permanent plot in remnant forest of Cibodas Botanic Garden, West Java.

Biodiversitas 12: 218-224. Cibodas Botanic Garden (CBG) has unique characters; almost 10% of which is forested area adjacent to the natural forest of Mt. Gede Pangrango National Park. The area is a transition between natural forest and artificial habitat which mostly consists of exotic plant species. The permanent plot in CBG was established in 2007-2009. Two hundred and eighty four units of 10x10 square meters sub-plot were established in four locations, i.e. Wornojiwo, Kompos, Jalan Akar, and Lumut forest. Vegetation analyses were conducted for trees, saplings, shrubs, and herb species. The inventory found 137 species plants consisting of 74 tree species dominated by Villebrunea rubescens (Bl.) Bl. and Ostodes paniculata Bl., 30 shrub species dominated by Strobilanthes hamiltoniana (Steud.), 24 herb species dominated by Cyrtandra picta Bl., 6 fern species mainly consisted of Diplazium pallidum Moore, and 3 climber species dominated by Calamus reinwardtii Mart. In comparison with the natural forest of Mt. Gede Pangrango National Park, the CBG permanent plot showed a good representative of the vegetation of lower montane forest. A regular monitoring during the successive years is needed to maintain diversity, monitor forest dynamics and anticipate the spread of invasive plant from CBG. Key words: Cibodas Botanic Garden, permanent plots, remnant forest.

INTRODUCTION Cibodas Botanic Garden (CBG) was used as an experimental plot for the introduction of Cinchona to Indonesia.

When it was stated as a biological station and forest reserve, the area was extended up to 1,200 ha covering from Cibodas to the summit of Mount Gede and Pangrango (Dakkus 1945; van Leeuwen 1945; Soerohaldoko et al. 2006). It was a well-known area for classical spot of botanical investigation. More than 8,000 studies were conducted in this area. Some of them were conducted by famous botanist such as; Reinwardt, Blume, Junghuhn, Treub, Zollinger, Teysmann, Koorders, Backer, Bakhuizen van den Brink Jr., von Faber, van Leeuwen and van Steenis (Meijer 1959; van Steenis 1972; Arrijani 2008).

CBG is managed by the Indonesian Institute of Sciences (LIPI) at present. It conserves about 6,764 individual plants from 1,270 species and 204 families. Ten percent of CBG is a forested area. It consists of fragmented forest and border forest adjacent to the natural forest of Mount Gede Pangrango National Park. The forested area is important to maintain genetic diversity which uncovered by the small number of plant collection of botanic garden (Hurka et al.

2004). Remnant forest of CBG also played important role as buffer zone between the garden and Mount GedePangrango National Park to restrict the alien species plant possibly escape from CBG collection. Some researchers have been addressed non-native species colonization at the interface between protected areas and human-dominated

systems (Pysek et al. 2003; Alston and Richardson 2006).

The establishment of buffer zones around protected areas is often included on management strategy of plant invasions (Llewellyn et al. 2010).

The remnant forest of CBG has a potential to be developed as a field laboratory and environmental education. The composition and the dynamic of the forest are interesting to be studied. The 2.84 hectare plot was build in 2007 to 2009. It was set to monitor plant diversity and to collect long-term data on the growth, mortality, regeneration, and dynamics of forest. Ten years observation is needed to state it as a long term permanent plot (Bakker et al. 1996).

This paper aims to assess the eligibility of permanent plot in CBG which presented by the preliminary forest inventory data and it comparison with the natural forest vegetation. Hopefully our permanent plot will be a model for lower montane tropical forest vegetation dynamics.

MATERIALS AND METHODS Cibodas Botanic Garden is located on the foothill of Mount Gede, Cipanas, Cianjur, West Java. CBG is situated at lower montane zone (1,300-1,425 m asl.). The annual rainfall is 2,950 mm/year, average temperature is 20o C and relative humidity is 80%. Permanent plots were established on four of remnant forests sites inside CBG, i.e. Wornojiwo (PW), Kompos (PK), Jalan Akar (PJA), and Lumut Forest (PL). Wornojiwo and Kompos are fragmented forests

MUTAQIEN & ZUHRI – Permanent plot in forest of Cibodas Botanic Garden

inside the CBG and two others are forest border of Mount Gede Pangrango National Park (Figure 1).

The plots are divided into 10x10 m2 sub-plots. Total area and number of sub-plots on each site are presented on Table 1. Sub-plot numbers on each site were limited by large area and topographical aspect.

A rapid vegetation assessment was conducted in AprilJune 2010. Vegetation data was collected using purposive random sampling. Stands were classified into trees, saplings, shrubs, and herbs. Each tree were identified, marked, tagged, and measured (diameter at breast height (dbh), height, and canopy size). Saplings, shrubs, and herbs were identified and their abundance were measured.

Table 1. Total area and number of sub-plots Site Wornojiwo Forest (PW) Kompos Forest (PK) Jalan Akar Forest (PJA) Lumut Forest (PL) Total

Area (ha)

Number of sub-plots

3.934 2.555 1.086 0.855 8.43

180 60 32 12 284

The result of plot inventory data was compared to two plots (1 ha in each) of natural forest vegetation. One plot was located at the edge of the Mount Gede-Pangrango National Park (200 m from the garden) and another one

2nd plot

219

was located at the interior of the national park forest (1 km from the garden). Parameter such as species richness, Shannon-Wienner diversity index (Odum 1971), species evenness (Heip 1974) and similarity index (Krebs 1999) was used to compare it.

RESULTS AND DISCUSSION Vegetation of CBG’s remnant forest There are 137 plant species at the remnant forest, which consists of 74 tree species, 30 shrub species, 23 herb species, 6 fern species, and 4 climber species (Table 2).

Only 36 tree species reach more than 10 cm in diameter, while 61 species were found as sapling (dbh<10 cm). Tree density was reached 306 tree/ha and tree biomass was achieved 699.24 ton/ha.

Table 2. Total species in the life form classes of CBG’s remnant forest Life form Tree Shrub Herb Fern Climber Total

Number of species 74 30 23 6 4 137

Figure 1. Location of permanent plot on Cibodas Botanical Garden

220

B I O D I V E R S IT A S 12 (4): 218-224, October 2011

Table 3. Class diameter of trees of CBG’s remnant forest

Tree number

> 80 cm

71-80 cm

61-70 cm

51-60 cm

41-50 cm

31-40 cm

21-30 cm

10-20 cm

high abundance is related to colonization and turnover rate in the disturbed forest Class diameter (Whitmore 1975).

Furthermore, hurricane occurring in 1976 (Yamada Tree species 2010. pers. comm. 17 July) and 1984 in Cibodas (Whitten and Whitten 1996) might change the dynamics and increase Villebrunea rubescens (Bl.) Bl. 33 3 1 1 38 the abundance of typical species of Ostodes paniculata Bl. 7 11 3 3 24 secondary forest (V. rubescens) and the Macropanax dispermum (Bl.) Kuntze 8 5 5 18 pioneer species (i.e. O. paniculata).

Castanopsis argentea (Bl.) A. DC. 1 1 1 2 1 7 13 Disturbance in secondary forest would Ficus ribes Reinw. Ex Bl. 8 1 9 be advantageous for short-lived, light Saurauia pendula Bl. 2 2 4 demanding, and fast growing species as Decaspermum sp.

4 4 Cestrum aurantiacum Lindl.

3 1 4 well as for most pioneer species at gap Ficus fistulosa Reinw. Ex Bl. 2 1 3 sites in mature forests (Brokaw 1985).

Elaeocarpus oxypirens Koord. & Val. 2 1 3 These growth traits affect largely the Dysoxylum nutans Miq 1 1 1 3 stand structure (Yoneda 2006).

Castanopsis javanica (Bl.) A.DC 3 3 Castanopsis argentea (chestnut) is Altingia excelsa Noronha 2 1 3 presents almost in all class diameter and Saurauia reinwardtiana Bl. 1 1 2 relatively easy to be found. This plant is Lithocarpus indutus (Bl.) Rehder 2 2 relatively big and has heavy fruit which Ficus variegata Bl. 2 2 makes it poorly adapted for longFicus heterophylla Blanco 2 2 Viburnum sambucinum Reinw. ex Bl. 1 1 distance dispersal. It is typical of Turpinia sphaerocarpa Hassk.

1 1 laurophyl forest dominated by evergreen Trema orientalis Bl. 1 1 Fagaceae. Heriyanto et al. (2007) stated Toona sureni Merr.

1 1 that the highest distribution of C. Schima wallichii Choisy 1 1 argentea is around 1,400 m asl.

Saurauia cauliflora DC. 1 1 Altingia excelsa is one of the Rauvolfia javanica Koord. & Val. 1 1 emergent trees in the lower montane Prunus arborea (Bl.) Kalkman 1 1 forest. The biggest A. excelsa founded in Persea rimosa Zoll. Ex Meissner 1 1 this study reaching 170 cm diameter and Neonauclea obtusa Bl. 1 1 Lithocarpus pallidus (Bl.) Rehder 1 1 laid in C. argentea canopy. A. excelsa is Helicia serrata Bl. 1 1 major trees species in the altitude 1,500Fagraea sp.

1 1 1,800 m asl and give the highest Ficus lepicarpa Bl. 1 1 contribution to its community (Seifriz Eurya sp.

1 1 1923; Arrijani 2008). Therefore, Seifriz Elaeocarpus sphaericus Schum.

1 1 (1923) was divided the vegetation of Elaeocarpus angustifolius Bl. 1 1 Mount Gede into 5 zone, one of which Bridelia sp.

1 1 was rasamala (A. excelsa) sub-zone.

Acer laurinum Hassk.

1 1 Distribution of tree diameter is a tool 81 30 11 8 5 5 2 14 156 to describe the forest regeneration through age structure of tree. In our study, the distribution of tree in the CBG’s remnant forest based on class diameter follows J-inverse curve (Figure 2).

This shape showed the common patterns of tropical forest dynamics (Ogawa et al. 1965), similar to Meijer plot on lower mountain forest of Mount Gede (Meijer 1959), natural forest of Mount Papandayan (Setiawan and Sulistyawati 2008), lowland forest of Batang Gadis National Park (Kartawinata et al. 2004), lowland forest in Northern Siberut (Hadi et al. 2009) and lowland forest in Batanta Island, Raja Ampat (Mirmanto 2009).

Strobilanthes hamiltoniana (Steud), Dichroa febrifuga Lour., Polyalthia subcordata (Bl.) Bl., and Dendrocnide stimulans (L.f.) Chew are the most common species in Figure 2. Distribution of tree class diameter of CBG’s remnant forest shrub layer (Table 4). In the herb layer, Cyrtandra picta Bl., Calathea lietzei E. Morren, Elatostema nigrescens Villebrunea rubescens and Ostodes paniculata are the Miq, and E. cuneatum Wight are abundant. Diplazium two most common trees, but they never reach more than 50 pallidum (Bl.) T. Moore and Calamus reinwardtii Mart. are cm in diameter (Table 3). As the small diameter trees, their also abundant at the fern and climber life form, respectively.

MUTAQIEN & ZUHRI – Permanent plot in forest of Cibodas Botanic Garden

Table 4. Species of shrub, herb, fern, and climber, as well as saplings of CBG’s remnant forest Shrub Allophylus cobbe (L.) Raeusch Ardisia crenata Sims A. villosa Roxb.

A. fuliginosa Bl. Ardisia sp.

Bocconia frutescens L. Breynia microphylla (Kuzweil ex Teijsm. & Binn.) Müll. Arg. Bridelia multiflora Zipp. ex Scheff.

Clerodendrum eriosiphon Schau Coffea sp.

Dichroa febrifuga Lour.

Ficus ampelas K.D. Koenig ex Roxb.

F. cuspidata Reinw. ex Bl. Dendrocnide stimulans (L. f.) Chew Lasianthus laevigatus Bl. L. stercorarius Bl. L. rigidus Miq. Lasianthus sp.

Magnolia candollei Link Maoutia diversifolia Bl. Maoutia sp.

Mycetia cauliflora Reinw Pavetta montana Reinw. ex Bl. Polyalthia subcordata (Bl.) Bl. Psychotria angulata Korth Saprosma dichotomum (Korth.) Boerl.

Solanum ferox L. S. verbascifolium L. Strobilanthes hamiltoniana (Steud.)* Strobilanthes sp.

Herb Achyranthes bidentata Bl. Alpinia sp.

Amomum coccineum (Bl.) K. Schum.

Boehmeria rugosissima Miq. Calathea lietzei E. Morren Commelina sp.

Curculigo capitulata (Lour.) Kuntze Curculigo recurvata W.T. Aiton Elatostema cuneatum Wight E. nigrescens Miq. Cyclosorus sp.

Cyrtandra picta Bl.* Forrestia mollisima (Bl.) Koord.

Impatiens chonoceras Hassk.

I. platypetala Hassk.

Musa acuminata Colla Nervilia punctata Makino Pilea angulata (Bl.) Bl. P. melastomoides (Poir.) Wedd.

Schismatoglottis acuminatissima Schott Zingiber inflexum Bl. Z. odoriferum Bl. Fern Cyathea contaminans (Wall. ex Hook.) Copel.

Diplazium bantamense Bl. D. javanicum Makino D. pallidum* (Bl.) T.Moore D. repandum Bl. Nephrolepis biserrata (Sw.) Schott

Sapling Acer laurinum Hassk.

Alangium rotundifolium (Hassk.) Bloemb.

Alangium sp.

Antidesma tetrandrum Bl. Bonnetia sp.

Casearia coriacea Vent.

Castanopsis argentea (Bl.) A. DC. C. javanica (Bl.) A.DC C. tungurrut (Bl.) A.DC Cestrum aurantiacum Lindl.** Cryptocarya ferrea Bl. Decaspermum sp.

Dysoxylum excelsum Bl. D. nutans Miq Elaeocarpus obtusus Bl. E. oxypyren Koord. & Val. E. pierrei Koord. & Val. E. sphaericus Schum.

Euonymus javanicus Bl. Ficus alba Reinw. Ex Bl. F. fistulosa Reinw. Ex Bl. F. ribes Reinw. Ex Bl. Ficus sp.

Flacourtia rukam Zoll. & Moritzi Glochidion cyrtostylum Miq. Glochidion sp.

Helicia serrata Bl. Lithocarpus indutus (Bl.) Rehder L. pseudomoluccus (Bl.) Rehder Litsea noronhae Bl. Macropanax dispermum (Bl.) Kuntze Mastixia trichotoma Bl. Meliosma ferruginea Bl. Michelia montana Bl. Mischocarpus fuscescens Bl. Neonauclea lanceolata (Bl.) Merr.

Ostodes paniculata Bl. Persea rimosa Zoll. Ex Meissner Phoebe grandis (Nees) Merr.

Platea latifolia Bl. Polyalthia subcordata (Bl.) Bl. Polyosma sp.

Pygeum sp.

Pyrenaria serrata Bl. Rauvolfia javanica Koord. & Val. Saurauia cauliflora DC. S. pendula Bl. S. reinwardtiana Reinw. Ex Bl. Schima wallichii Choisy Sloanea sigun (Bl.) K. Schum.

Symplocos cochinchinensis (Lour.) S. Moore Symplocos sp.

Syzygium pycnanthum (Bl.) Merr. & L.M. Perry S. racemosum (Bl.) DC. Toona sureni Merr.

Trevesia sundaica Miq. Turpinia montana (Bl.) Kurz T. sphaerocarpa Hassk.

Viburnum lutescens Bl. Villebrunea rubescens (Bl.) Bl.

Climber Calamus reinwardtii Mart. * Plectocomia elongata Mart. ex Bl. Tetrastigma papillosum Planch.

Smilax zeylanica L. Note: * dominant/abundant species; ** alien species

221

Forest stratification was described by tree height.

Figure 3 shows five strata on Wornojiwo forest.

The emergent species is Castanopsis argentea. Its stratification is correlated with stand basal area which is almost a half of percentage basal area occupied by Fagaceae (Table 5). This value, 32.67 m2 ha-1, was higher than the basal area occupied by Fagaceae in a tropical montane forest of Doi Inthanon National Park, Northern Thailand; 8.17 m2 ha-1 (Noguchi 2007). The percentage of Facaeae in CBG remnant forest (49.95%) is much higher than in Padang at the elevation above 700 m; >10% (Nishimura et al. 2006; Fujii et al. 2006). The dominance of Fagaceae is resulting from its vigorous growth rate and low logging impact because of its low timber quality (Yoneda et al.

2006).

The complexity of Wornojiwo forest described by 5 strata of plant i.e. 0-10 m, 10-20 m, 20-30 m, 30-40 m and above 40 m. Richards (1952) consider the tropical rain forest to be the most complex and highly organized terrestrial community in the world, has five or six distinct strata. It is similar with the montane humid forests in Meghalaya, northeast India, which have five-layered distribution of plant species in the community (Jamir et al.

2006). In the second layer Macropanax dispermum relatively abundant in the maximum height achieves 40 m. It is similar to the vegetation layer of Mount Manglayang, West Java (Mutaqien et al. 2008).

The canopy with relatively continuous gap occurring in several places was important for regeneration.

Forest regeneration showed a good result, indicated by almost all

B I O D I V E R S IT A S 12 (4): 218-224, October 2011

222

tree species had the sapling stage. Our detailed survey found 61 sapling species as pointed out in Table 4. Sapling can be found easily especially in Jalan Akar and Lumut forest which adjacent to natural forest of Mount Gede Pangrango National Park as seed source.

Table 5. Basal area in tree family of CBG’s remnant forest Rank 1 2 3 4 5 6 7 8 9 10

Family Fagaceae Euphorbiaceae Urticaceae Araliaceae Hamamelidaceae Moraceae Meliaceae Lauraceae Aceraceae Actinidiaceae

Basal area (m2 ha-1) 32.67 12.3 10.25 5.09 1.87 1.24 0.34 0.29 0.28 0.28

% Basal area 49.95 18.81 15.69 7.79 2.86 1.90 0.52 0.45 0.44 0.43

Is the CBG’s permanent plot representing the natural vegetation?

Forest inventory on CBG permanent plot were compared to natural forest vegetation at the edge and the interior of Mount Gede Pangrango National Park to get evidence of its representation of lower montane vegetation (Table 6). Although the vegetation of both CBG’s permanent plot and the natural forest vegetation plot on Mount Gede Pangrango National Park are located at the same vegetation zone i.e. lower montane zone (Whitmore 1984), the natural forest vegetation has lower number of

species than CBG’s permanent plot but have higher value of H’ and species evenness. It may be caused by; (i) natural factor, such as in the tropical regions tree species richness (trees > 10 cm dbh in 1 ha plot), decreases with increasing altitude (summarized in Aiba et al. 2002), (ii) logging which occurs in national park, although it is a protective area but some people living around this area are collecting forest natural resource easily. As found for forest islands in Wisconsin, disturbance contributes significantly to variability in the number of species (Dunn and Loehle 1988); (iii) effect of the existence of CBG which conserves many non-native plant species which could escape into forest; and (iv) edge effect which may increase biodiversity in adjacent area (CBG permanent plot). Natural forest closer to CBG has the highest value of tree density and H’, but the % basal area is lower than the farther of natural forest plot. This points out that the first plot of natural forest has younger succession stage than the second one.

Species composition of the CBG permanent plot represented the lower montane forest vegetation of Java. In Java, the lower montane are dominated in terms of abundance by the Oaks (Lithocarpus and Quercus), Chestnuts (Castanopsis), and numerous species of Laurels (Fagaceae and Lauraceae, respectively) but the Magnoliaceae, Hamamelidaceae and Podocarpaceae are also well represented (Sukardjo 1978; Mukhtar and Pratiwi 1991; van Steenis 1972). Only Castanopsis javanica present in the all plot (Table 7). Cestrum aurantiacum as invasive alien species is dominant spread in the CBG permanent plot only. Their canopy would inhibit native sapling growth (Galbraith-Keith and Handel 2008).

Figure 3. Profile diagram of Wornojiwo forest of CBG’s remnant forest

MUTAQIEN & ZUHRI – Permanent plot in forest of Cibodas Botanic Garden

223

Table 6. Comparison of tree stand of CBG permanent plot and plots in the natural forest vegetation of Mount Gede Pangrango National Park CBG permanent plot Distance from CBG Altitude (m asl) Number of tree species Tree density (tree/ ha) Basal area (%) Shannon’s Diversity Index (H’) Species Evenness

Inside CBG 1,300-1,425 74 306 0.447 2.84 1.52

First plot of natural forest 200 m (edge forest) 1,450-1,500 63 408 0.428 3.29 1.82

Second plot natural forest 1 km (interior of the forest) 1,594-1,611 51 314 0.347 3.20 1.87

Table 7. Comparison the tree stand important value index (IVI) of the CBG permanent plot and natural forest vegetation in Mount Gede Pangrango National Park CBG permanent plot Species Villebrunea rubescens Ostodes paniculata Macropanax dispermum Castanopsis argentea Ficus ribes Cestrum aurantiacum** Decaspermum sp.

Saurauia pendula Altingia excelsa Castanopsis javanica Note: ** alien species

IVI 49.70 43.02 29.90 37.31 16.21 7.40 5.84 7.36 9.39 9.33

First plot of natural forest Species IVI Castanopsis tungurrut 26.88 Villebrunea rubescens 18.94 Sloanea sigun 14.92 Altingia excelsa 14.33 Ostodes paniculata 14.09 Castanopsis argentea 13.29 Laportea stimulans 11.06 Macropanax dispermum 10.13 Castanopsis javanica 9.60 Turpinia sphaerocarpa 9.11

In general, plant composition of the remnant forest of CBG’s plot is more similar to the first plot of natural forest rather than the second one. Table 8 shows that CBG permanent plot has 39% similarity to first plot of natural forest and only 31% similar to the second plot of natural forest. Both plots located in natural forest have the higher similarity, i.e. 52%. Jacob (1981) said that no two hectares have exactly the same species composition in the rain forest. It is indicated the remnant forest of CBG showed good representative of Mount Gede Pangrango forest vegetation. The representation will be best if the alien species (C. aurantiacum) removed from the permanent plot.

Table 8. Similarity index among the remnant forest of CBG’s plot and the plots at natural forest of Mount Gede Pangrango National Park

CBG’s remnant forest plot First plot of natural forest Second plot of natural forest

CBG permanent plot 1

First plot Second plot of natural of natural forest forest 0.39 0.31

0.39

1

0.52

0.31

0.52

1

Second plot of natural forest Species Schima wallichii Turpinia sphaerocarpa Vernonia arborea Saurauia pendula Macaranga rhizinoides Manglietia glauca Persea rimosa Lithocarpus pseudomoluccus Saurauia blumiana Castanopsis javanica

IVI 57.13 32.55 12.48 11.09 9.72 9.53 9.28 5.93 5.72 5.35

Due to the small size and high degree of fragmentation, the CBG’s remnant forest is susceptible to abiotic and biotic disturbance. Edge effects increased susceptibility to invasions by exotic plants and animals (Ross et al. 2002; Ecroyd and Brockerhoff 2005). In spite of climatic change, the presence of invasive species is one of the greatest threats to biodiversity (Primack and Miller-Rushing 2009).

It refers to their adaptability to disturbance and to a broader range of biogeographic conditions and environmental controls (Burgiel and Muir 2010). The presence of invasive alien species i.e Cestrum aurantiacum and Brugmansia candida 100 m away from CBG proved the spread of invasive species from CBG was out of control. Monitoring in the successive years is needed to maintain diversity, monitor forest dynamics and also the spread of invasive plant from CBG.

CONCLUSION There were 137 plants species consisting of 74 tree species, 30 shrub species, 24 herb species, 6 fern species, and 4 climber species present in CBG permanent plot. The dominance of fagaceous (Castanopsis argentea), Villebrunea rubescens and Ostodes paniculata indicated the remnant forest of CBG is secondary lower montane forest. In comparison with natural forest, the remnant forest

224

B I O D I V E R S IT A S 12 (4): 218-224, October 2011

of CBG showed good representative of Mount Gede Pangrango forest vegetation. It is indicated by 39% of its species composition are similar with the edge forest and 31% are similar with the forest interior.

ACKNOWLEDGEMENTS We would like to express gratitude to DIPA Tematik 2009 for funding this research. Sincerely thanks are also conveyed to Yati Nurlaeni, Emus, Nudin, Wagino, Sopian, Wiguna Rahman and Eka A.P. Iskandar whose help us a lot in the fields and the preparation of this manuscript.

REFERENCES Aiba S, Kitayama K, Repin R (2002) Species composition and speciesarea relationships of trees in nine permanent plots in altitudinal sequences on different geological substrates of Mount Kinabalu.

Sabah Parks Nat J 5: 7-69.

Alston KP, Richardson DM (2006) The roles of habitat features, disturbance, and distance from putative source populations in structuring alien plant invasions at the urban/wildland interface on the Cape Peninsula, South Africa. Biol Conserv 132: 83-198.

Arrijani (2008) Montane zone vegetation structure and composition of Gunung Gede Pangrango National Park. Biodiversitas 9 (2): 134-141 [Indonesia] Bakker JP, Olff H, Willems JHM, Zobel M (1996) Why do we need permanent plots in the study of long-term vegetation dynamics? J Veg Sci 7: 147-156.

Brokaw NVL (1985) Treefalls, regrowth, and community structure in tropical forests. In: Pickett STA, White PS (eds.) The ecology of natural disturbance. Academic Press, Seattle.

Burgiel SW, Muir AA (2010) Invasive species, climate change and ecosystem-based adaptation: Addressing multiple drivers of global change. Global Invasive Species Programme (GISP), Washington DC and Nairobi.

Dakkus IV (1945) The botanical garden at Tjibodas. In: Honig P (eds) Science and scientists in the Netherlands Indies. Board for the Netherlands Indies. New York City.

Dunn CP, Loehle C (1988) Species-area parameter estimation: testing the null model of lack of relationship. J Biogeogr 15; 721-728.

Ecroyd CE, Brockerhoff EG (2005) Floristic changes over 30 years in a Canterbury Plains Känuka forest remnant, and comparison with adjacent vegetation types. N Z J Ecol 29 (2): 279-290.

Fujii S, Nishimura S, Yoneda T (2006) Altitudinal distribution of Fagaceae in West Sumatra. Tropics 15 (2): 154-163.

Galbraith-Kent SL, Handel SN (2008) Invasive Acer platanoides inhibits native sapling growth in forest understorey communities. J Ecol 96: 293-302.

Hadi S, Ziegler T, Waltert M, Hodges JK (2009) Tree diversity and forest structure in Northern Siberut, Mentawai Islands, Indonesia. Trop Ecol 50 (2): 315-327.

Heip C (1974) A new index measuring evenness. J Mar Biol Assoc UK 54: 555-557.

Heriyanto NM, Sawitri R, Subandinata D (2007) Studies on the regeneration ecology of Saninten (Castanopsis argentea (Bl.) A.DC.) Mount Gede Pangrango National Park, West Java. Bul Plasma Nutfah 13(1): 34-42. [Indonesia] Hurka H, Neuffer B, Friesen N (2004) Plant genetic resources in botanical gardens. In: Forkmann G Michaelis S (eds) Proc 21st IS on Breeding Ornamentals, Part II. Acta Hort 651: 35-44.

Jacobs M (1981) The last tropical rain forest, a first encounter. Springer, Leiden.

Kartawinata K, Samsoedin I, Heriyanto M, Afriastini JJ (2004) A tree species inventory in a one-hectare plot at the Batang Gadis National Park, North Sumatra, Indonesia. Reinwardtia 12 (2): 145-157.

Krebs CJ (1999) Ecological methodology, 2nd ed. Addison-Wesley, New York.

Llewellyn C, Foxcroft , Jarocic V, Pysek P, Richardson DM, Rouget M (2010) Protected-area boundaries as filters of plant invasions.

Conserv Biol 25 (2): 400-405 Mirmanto E (2009) Vegetation analyses of Dipterocarpaceae forest in Pulau Batanta, Raja Ampat, Papua. J Biol Indon 6 (1): 79-96 [Indonesia] Meijer W (1959) Plantsociological analysis of montane rainforest near Tjibodas, West Java. Acta Botanica Nederlandica 8: 277-291.

Mukhtar AS, Pratiwi (1991) Diversity of tree species and its problems in Situ Gunung forest, Gunung Gede-Pangrango National Park West Java Indonesia. Bul Penel Hutan 533:1-12.

Mutaqien Z, Santoso P, Kusmoro J (2008) Vegetation study of montane rain forest of Mt. Gunung Manglayang, West Java. Widyariset 11 (2): 157-164. [Indonesia] Nishimura S, Yoneda T, Fujii S, Erizal M, Abe H, Kubota D, Tamin R, Watanabe H (2006) A study of altitudinal zonation of vegetation in the Padang region, West Sumatra, Indonesia. Tropics 15 (2): 137-152.

Noguchi H, Itoh A, Mizuno T, Sri-ngeryuang K, Kanzaki M, Teejuntuk S, Sungpalee W, hara M, Ohkubo T, Sahunalu P, Dhanmmanonda P, Yamakura T (2007) Habitat divergence in sympatric Fagaceae tree species of a tropical montane forest in northern Thailand. J Trop Ecol 23: 549-558.

Odum BP (1971) Fundamental of ecology. 3rd ed. W.B. Saunders, New York.

Ogawa H, Yoda K, Ogino K, Shidei T, Ratnawongse D, Apasutaya C. (1965) Comperative ecological study on three main types in S.E. Asia of forest vegetation in Thailand. I. Structure and floristic composition.

Nat Life 4: 13-48.

Primack RB, Miller-Rushing AJ (2009) The role of botanical gardens in climate change research. New Phytologist 182: 303-313.

Pysek P, JarosÄąk V, Kucera T (2003) Inclusion of native and alien species in temperate nature reserves: an historical study from Central Europe.

Conserv Biol 17 (14): 14-24.

Richards PW (1952) The tropical rain forest: An ecological study.

Cambridge University Press, Cambridge.

Ross KA, Fox BJ, Fox MD (2002) Changes to plant species richness in forest fragments: fragment age, disturbance and fire history may be as important as area. J Biogeogr 29: 749-765.

Seifriz W (1923) The altitudinal distribution of plants on Mt. Gedeh, Java.

Bull Torrey Bot Club 50 (9): 283-306.

Setiawan NN, Sulistyawati E (2008) Succession following reforestation on abandoned fields in Mount Papandayan, West Java. Proceeding of International Conference on Environmental Research and Technology (ICERT) 2008. Penang, 28 April-30 May 2008.

Soerohaldoko S, Naiola BP, Nasution RE, Danimihardja S, Purwantoro RS, Soegiarto KA, Supena, Mardi D, Saputra DS, Nurdin DA, Suryana N, Suhatman A, Solihin, Supriyadi H, Hidajat A, Amiruddin (2006) The history of Cibodas Botanic Garden. UPT BKT Kebun Raya Cibodas-LIPI, Cianjur.

Sukardjo S (1978) Introducing the forest of Mt. Tilu. Bul Kebun Raya 3:153-156. [Indonesia] van Leeuwen WM (1945) The Tjibodas Biological Station and Forest Reserve III, The Flora of Tjibodas. In: Honig P, Verdoonn (eds.)

Science and scientist in the Nederlands Indies. Board for Netherland Indies, Suriname and Quaracao, New York City van Steenis CGGJ (1972) The mountain flora of Java. E. J. Brill, Leiden Whitten T, Whitten J (1996) Determinants of vegetation. Indonesian Heritage: Plants. Archipelago Press, Singapore.

Whitmore TC (1975) Tropical rain forests of Far East. Clarendon Press, Oxford.

Yoneda T, Mizunaga H, Nishimura S, Fujii S, Tamim R (2006) Stand structure and dynamics of a tropical secondary forest-A rural forest in West Sumatra, Indonesia. Tropics 15 (2): 189-199

B I O D I V E R S IT A S Volume 12, Number 4, October 2011 Pages: 225-228

ISSN: 1412-033X (printed edition) ISSN: 2085-4722 (electronic) DOI: 10.13057/biodiv/d120407

Analysis of epiphytic orchid diversity and its host tree at three gradient of altitudes in Mount Lawu, Java NINA DWI YULIA♥, SUGENG BUDIHARTA, TITUT YULISTYARINI Purwodadi Botanic Garden, Indonesian Institute of Sciences, Jl. Raya Surabaya-Malang Km. 65, Purwodadi, Pasuruan 67163, East Java, Indonesia.

Tel./Fax.: +62-341-426046; email: ndyulia@yahoo.com Manuscript received: 10 December 2010. Revision accepted: 3 May 2011.

ABSTRACT Yulia ND, Budiharta S, Yulistyarini T (2011) Analysis of epiphytic orchid diversity and its host tree at three gradient of altitudes in Mount Lawu, Java. Biodiversitas 12: 225-228. The aim of this study was to observe epiphytic orchid diversity and their host trees at three different altitudes (1796, 1922 and 2041 m asl.) at southern part of Mount Lawu, District of Magetan, East Java. Line transect of 10 x 100 m was set up and then divided into ten plots (as replicates) of 10 x 10 m. At each plot, species name and number of individual of epiphytic orchids, and species name, number of individual and diameter at breast height (dbh) of host trees were recorded. The result showed that there were 19 species of epiphytic orchid recorded at the study sites. There were significantly different among gradient altitude in number of epiphytic orchid species (F = 3.7; df = (2, 27); P < 0.05). The highest number of species of epiphytic orchid was recorded at the altitude of 1922 m asl. (6.6 species/100 m2) while the highest number of individual was recorded at the altitude of 1796 m asl. (1337.7 individuals/100 m2). The study site at altitude of 1922 m asl. was recognized as the denser and richer in species of host trees (2.3 species/100 m2 and 3.5 individuals/100 m2 respectively). However, the highest basal area of host tree was recorded at the altitude of 2041 m asl. (4558 cm2/100 m2).

Key words: orchid diversity, host trees, gradient of altitudes, southern part, Mount Lawu.

INTRODUCTION Epiphytic plant is one component of forest vegetation that still requires much research to maximize its potential uses (Setyawan 2000). Epiphytic plant needs other type of plants either tree or herb as its host (Dressler 1990; Hietz 1997). Despite by micro climate, the diversity of epiphytic plant is also influenced by typical condition of its host tree species such as canopy type, bark characteristic, and biochemistry processes (Setyawan 2000). In tropical forest, epiphytic plant is an important element since it contributes up to 25% of all vascular plant species in the tropics and represents 10% of plant diversity worldwide (Hietz 1997; Nieder 2001; Gravendeel 2004). According to Annaselvam and Parthasarathy (2001), epiphytic plants in Varagalair tropical evergreen forest include are Orchidaceae (54%), Piperaceae and Araceae (each 8%).

Kindlmann and Vergara (2009) highlight the importance of research in orchid especially in the topics of species diversity, such as species-area and species-abundance relationships. Two important factors for predicting orchid diversity and endemism in large and montane islands in West Indies are area and elevation (Ackerman et al. 2007).

Van Steenis (1972) mentioned that generally, orchids grow well in mountain areas with altitude ranging from 500 to1500 m asl, and their variation decreases in out site of this range (below 500 m asl. or above 2000 m asl).

According to Setyawan (2001) forest vegetation in Mount Lawu is relatively stable since there is no volcanic activity

for long period and the low level of disturbances either caused by human or nature (such as forest fire, storm and landslide). The aim of this study is to observe the diversity of epiphytic orchids and their host trees at three gradient of altitudes (1796, 1922 and 2041 m asl.) in southern part of Mount Lawu, District of Magetan, East Java, Indonesia.

MATERIALS AND METHODS Study sites Mount Lawu is located along the border of East Java and Central Java with 5.719,4 ha in extent and the highest peak is 3.265 m asl. It is divided into two zones which are production zone and buffer zone (Perum Perhutani 2010).

This study was conducted between 1 and 8 October 2010 at forest areas in Mount Lawu, Sub-district of Plaosan, District of Magetan (S 07º39’28.7”-07º39’42.1” and E 111º 11’39.6”-111º 13’02.5”). Purposive sampling was used by determining three study sites representing different altitude, were Mojosemi (1796 m asl; S 07°39’42.1” and E111°13’ 02.5”), Tirtogumarang (1922 m asl; S 07°40’03.5” and E 111º11’30.2”) and Cemorosewu (2041 m asl; S 07°39’28.7” and E 111°11’39.6”) (Figure 1). These three sites are reserve forests managed by Kesatuan Pemangkuan Hutan or Forest Management District (KPH/FMD) Southern Lawu under Perum Perhutani (State Owned Forest Company). The climate at these sites is relatively cool and dry with temperature 19-26ºC and humidity 70-80%.

226

B I O D I V E R S IT A S 12 (4): 225-228, October 2011

A

3 1 2

B

C

Figure 1. Location of study site at Mount Lawu, Sub-district of Plaosan, District of Magetan (B) and detailed map of three sites (C): 1.

Mojosemi (1796 m asl), 2. Tirtogumarang (1922 m asl), 3. Cemorosewu (2041 m asl).

Vegetation types at the study areas are natural sub-montane forest, mixed secondary forest and agricultural lands. Some dominant tree species are Casuarina junghuhniana (cemara gunung), Pinus merkusii (tusam), Altingia excelsa (rasamala), Lithocarpus sundaicus (pasang), Acer laurinum and Acmena sp.

Data collection and analysis Line transect of 10x100 m2 were made at three study sites (Mojosemi, Tirtogumarang and Cemorosewu) and then divided into ten plots (and treated as replicates) of 10x10 m2 (Annaselvam and Parthasarathy 2001; Focho et al. 2010). At each plot, species name and number of individual of epiphytic orchids, and species name, number of individual and diameter at breast height (dbh) of host trees were recorded. All living collections were then collected at Purwodadi Botanic Garden for identification.

All data recorded were calculated for average number of orchid species and individuals, and average number of host tree species, individual and basal area. These parameters were then analyzed using one-way Analysis of Variance (ANOVA) to test the difference among three gradients of altitudes. The ANOVA test was performed using PopTools version 3.0.6 (Hood 2008) and alpha was set at 0.05.

RESULTS AND DISCUSSION Epiphytic orchid The result showed that the highest number of species of epiphytic orchid was recorded at Tirtogumarang (1922 m asl) with average 6.6 + 3.57 species/plot, followed by Mojosemi (1796 m asl) and Cemorosewu (2041 m asl) with average 4.7+3.27 and 3+1.7 species/plot respectively (Figure 2A). The ANOVA test showed that there was significant difference among three gradient of altitudes in term of species number of epiphytic orchid (F = 3.7; df = (2, 27); P < 0.05). The result of this test suggested that elevation is an important factor that influences species richness of epiphytic orchid.

The composition of orchid species changes incessantly with increasing elevation. The result of this study is in accordance with Van Steenis (1972) that the variation of epiphytic orchid will decreased up to elevation above 2000 m asl. In addition, Jacquemyn et al. (2005) stated that elevation also influenced species evenness in negative relation (species evenness decreased signiďŹ cantly with increasing altitude). In sub-montane forest in Mount Lawu, the altitude of 2000â&#x20AC;&#x2122;s m asl. seems as a critical point in term of relation between species richness of epiphytic orchid and elevation as noted in this study. However,

YULIA et al. – Epiphytic orchid of Mount Lawu, Java

another study stated that the tropical orchids largely distributed below 1600 m asl. and reach maximum richness on the altitudes between 400 and 800 m asl. (Jacquemyn et al. 2005). Another factor affecting orchid diversity is human disturbance. At low elevation with high level of human disturbances, the species richness of orchid is likely lower than species richness at higher altitude since most human activities are concentrated at low elevation (Tian et al. 2008).

The composition of orchid species is influenced by neighboring elevation belts that similarity index tends to be higher between sites with closer distant and more similar altitude. In this study, total species of epiphytic orchid at three gradients of altitudes was 19 species (Table 1).

Orchid species recorded on the study sites are typical orchid for elevation 500-2000 m asl. (Mahyar and Sadili 2003; Puspitaningtyas et al, 2003) and known as euryecious orchids (kind of orchid that is usually adaptable to various types of environment and has wide-ranging geographic distribution). There were three species orchid that recorded at three study sites, which are Bulbophyllum angustifolium, Coelogyne miniata and Eria multiflora.

The highest number of individual was noted at Mojosemi (1796 m asl) with average 1337.7±1626.20 individuals/plot, followed by Cemorosewu (2041 m asl) and Tirtogumarang (1922 m asl) with average 1278.1±1296.87 and 536.1±465.82 respectively (Figure 2B). The high value of standard deviation indicates that there is high variation of orchid abundances at the study sites. The one-way ANOVA test resulted that there is no significant difference on orchid abundance among three gradient of altitudes (F = 2.97; df = (2, 27); P-value >0.05).

This means that altitude ranging from 1800’s to 2000’s is not a key factor on the abundance of epiphytic orchids in Mount Lawu.

The high abundances of epiphytic orchid at Mojosemi are due to environmental condition that favorable for specific orchid to grow. Orchid grow is mainly influenced the micro site condition such as light, temperature, wind speed and water availability (Parnata 2005). Beside those factors, the establishment of epiphytic orchid also depends on altitude, the existence of lower plants that ease orchid seeds to trap and aerial fallouts, providing suitable micro sites for growth (Focho et al. 2010).

Table 1. The composition of epiphytic orchid recorded at three gradients of altitudes in southern part of Mount Lawu (Mojosemi = 1796 m asl, Tirtogumarang = 1922 m asl. and Cemorosewu = 2041 m asl) Altitude (m asl) 1796 1922 2041 Bulbophyllum angustifolium + + + Bulbophyllum mutabile + Bulbophyllum sp.1 + Bulbophyllum flavidiflorum + + Bulbophyllum ovalifolium + Bulbophyllum sp.2 + Coelogyne miniata + + + Dendrochilum longifolium + Dendrochilum sp.1 + Dendrochilum sp.2 + + Eria multiflora + + + Eria moluccana + + Eria lamonganensis + Flickingeria luxurians + Liparis pallida + Pholidota globosa + + Pholidota ventricosa + + Luisia zollingeri + Tuberolabium odoratissimum + Note: + = found;-= not found; all habitus: epiphytic; Distribution status: widespread

Host tree In this study, total species of host tree at three gradients of altitudes is 11 species (Table 2). The highest number of species of host tree was recorded at Tirtogumarang (1922 m asl) with average 2.3±1.5 species/plot, followed by Mojosemi (2041 m asl) and Cemorosewu (1796 m asl) with average 2.8±1.93 and 1.3±0.95 species/plot respectively (Figure 2C). The similar pattern also showed in the result of individual number of host tree that Tirtogumarang has the highest densities with average 2.8±1.93 individuals/plot, followed by Mojosemi with 3.5±2.8 individuals/plot and Cemorosewu with 1.3±0.95

7

3.5

6

6 4 2 0

2500 2000 1500 1000

3 2.5 2 1.5 1

500

0.5

0

0

10000

Basal area (cm2/plot)

4

3000

Number of individual/plot

3500

10

Number of species/plot

12 Number of individual/plot

Number of species/plot

Species name

8

227

5 4 3 2

8000 6000 4000 2000

1 0

0

2041 m asl 1922 m asl 1796 m asl

2041 m asl 1922 m asl 1796 m asl

2041 m asl 1922 m asl 1796 m asl

2041 m asl 1922 m asl 1796 m asl

2041 m asl 1922 m asl 1796 m asl

Altitude

Altitude

Altitude

Altitude

Altitude

A

B

C

D

E

Figure 2. Average number of species of epiphytic orchid (A); Average number of individual of epiphytic orchid (B); Average number of species of host tree (C); Average number of individual of host tree (D); Average basal area of host tree (E). Three gradients of altitudes are Cemorosewu (2041 m asl), Tirtogumarang (1922 m asl) and Mojosemi (1796 m asl). Stacked bars indicate standard deviation.

B I O D I V E R S IT A S 12 (4): 225-228, October 2011

228

individuals/plot (Figure 2D). These results suggest that either species richness or abundance of host trees in the study sites is relatively low. One-way ANOVA test resulted that gradient of altitudes ranging between 1800’s and 2000’s m asl. did not influence significantly either on species number of host tree (F= 2.94; df = (2, 27); P-value > 0.05) or its individual number (F= 3.04; df = (2, 27); P-value > 0.05) Table 2. The composition of host tree recorded at three gradients of altitudes in southern part of Mount Lawu (Mojosemi = 1796 m asl, Tirtogumarang = 1922 m asl. and Cemorosewu = 2041 m asl) Species name Acmena acuminatissimum Acer laurinum Astronia spectabilis Canthium glabrum Castanopsis javanica Glochidion littorale Lithocarpus sundaicus Lupinus sp.

Macropanax concinnus Schima wallichii Tree stump Note: + = found;-= not found

Altitude (m asl) 1796 1922 2041 + + + + + + + + + + + + + + + + + + +

All three study sites are located in buffer zone of forest area in Mount Lawu. The most dominant host tree at three sites is pasang (Lithocarpus sundaicus). The high abundances of host trees at Tirtogumarang is probably due to the succession process at this site has not reach the climax level yet which is indicated by lowest basal area 2975.23±1931.43 cm2/plot, compared to Cemorosewu 4558.01±4525.40 cm2/plot and Mojosemi 4295.73± 3875.18 cm2/plot (Figure 2E). The result of one-way ANOVA showed that basal area of host tree was not significantly different among three gradient of altitudes (F = 0.55; df = (2, 27); P-value > 0.05).

Local micro site factors, such as soil, as well as macro environmental factors, such as precipitation and elevation are the key variables that influence tree species distribution in the Albertine rift forests (Eilu et al. 2004).

CONCLUSION In sum, our study suggests that elevation ranging between 1796 m asl. and 2041 m asl. is an influence factor on epiphytic orchid species richness but not on their abundance. The number of host tree species and their abundance are not influenced by the altitude on this range.

Our result showed that there was 19 epiphytic orchid species at three gradients of altitudes in southern part of Mount Lawu. The number of species is significantly lower at higher altitude. The highest number of epiphytic orchid species (6.6 species/100 m2) was recorded at site with altitude 1922 m asl, while the highest number of individual (1337.7 individual/100 m2) was noted at site with altitude 1796 m asl. Altitude of 1922 m asl. was noted as the site with the highest number of species and individual of host trees (2.3 species/100 m2 and 3.5 individuals/100 m2

respectively). However, the highest basal area of host tree was recorded at the altitude of 2041 m asl. (4558 cm2/100 m2).

ACKNOWLEDGEMENTS This research is funded by ‘Incentive Program Activity for Researcher and Engineer, Indonesian Institute of Science 2010’ on project entitled ‘Evaluation of orchid in southern part of East Java’. We acknowledge the contributions of exploration team members (Pa’i and Suhadinoto), local farmer (Pamuji) and Perhutani’s forest rangers during fieldwork.

REFERENCES Ackerman JD, Trejo-Toress JC, Crespo-Chuy Y (2007) Orchids of the West Indies: predictability of diversity and endemism. J Biogeogr 34: 779-786.

Annaselvam J, Parthasarathy N (2001) Diversity and distribution of herbaceous vascular epiphytes in a tropical evergreen forest at Varagalaiar, Westren Ghats, India. Biodiv Conserv 10: 317-329.

Dressler RL (1990) The Orchid: natural history and classification. Harvard University Press. USA. Eilu G, David LN, Hafashimana, Kasenene JN (2004) Density and species diversity of trees in four tropical forests of the Albertine rift, western Uganda. Diversity Distrib 10: 303-312.

Focho DA, Fonge BA, Fongod AGN, Essomo SE (2010) A study of the distribution and diversity of the family Orchidaceae on some selected lava flows of Mount Cameroon. Afr J Environ Sci Technol 4 (5): 263273.

Gravendeel B, Smithson A, Silk FJW, Schuiteman A (2004) Epiphytism and pollinator specialization: drivers for orchid diversity? Phil Trans R Soc Lond B 359: 1523-1535.

Hietz P (1997) Diversity and conservation of epiphytes in a changing environment. The International Conference on Biodiversity and Bioresources: Conservation and Utilization, IUPAC, Phuket, Thailand. 23-27 November 1997.

Hood GM (2008) PopTools version 3.0.6. Commonwealth Scientific and Industrial Research Organisation (CSIRO). Canberra, Australia. [http://www.cse.csiro.au/poptools].

Jacquemyn H, Micheneau C, Roberts DL, Pailler T (2005) Elevational gradients of species diversity, breeding system and floral traits of orchid species on Reunion Island. J Biogeogr 32: 1751-1761.

Kindlmann P, Vergara C (2009) Objective measures of orchid species diversity. In: Pridgeon AM, Suarez JP (eds) Proceedings of the Second Scientific Conference on Andean Orchids. Universidad Técnica Particular de Loja, Loja, Ecuador.

Mahyar UW, Sadili A (2003) Orchid of Gunung Halimun National Park.

Biodiversity Conservation Project LIPI-JICA-PHKA. Bogor.

[Indonesia] Nieder J, Prosperí J, Michaloud G (2001). Epiphytes and their contribution to canopy diversity. Plant Ecol 153: 51-63.

Parnata AS (2005) Guidance on propagation and treatment of orchid.

Agromedia Pustaka. Jakarta. 23-39. [Indonesia] Perum Perhutani (2010) General Data of BKPH Lawu Selatan, KPH Lawu DS [http://www.kphlawuds.perumperhutani.com/index.php] [Indonesia] Puspitaningtyas DM, Mursidawati S, Sutrisno, Asikin D (2003) Wild orchid in conservation areas in Java Island. Bogor Botanic GardenLIPI. Bogor. [Indonesia] Setyawan AD (2000) Epiphytic plants on stand of Schima wallichii (D.C.) Korth. at Mount Lawu. Biodiversitas 1 (1): 14-20. [Indonesia] Setyawan AD (2001) Review: Possibilities of Mount Lawu to be a National Park. Biodiversitas 2 (2): 163-168. [Indonesia] Tian H, Zing F (2008) Elevational diversity patterns of orchids in Nanling National Nature Reserve, northern Guangdong Province. Biodiversity Science 16 (1): 75-82.

Van Steenis CGGJ (1972) Mountain Flora of Java. EJ Brill. Leiden, The Netherland.

B I O D I V E R S IT A S Volume 12, Number 4, October 2011 Pages: 229-234

ISSN: 1412-033X (printed edition) ISSN: 2085-4722 (electronic) DOI: 10.13057/biodiv/d120408

Valuing quality of vegetation in recharge area of Seruk Spring, Pesanggrahan Valley, Batu City, East Java TITUT YULISTYARINIâ&#x2122;Ľ, SITI SOFIAH Purwodadi Botanic Garden, Indonesian Institute of Sciences, Jl. Raya Surabaya-Malang Km. 65, Purwodadi, Pasuruan 67163, East Java, Indonesia.

Tel./Fax.: +62-341-426046; ď&#x201A;Šemail: tyulistyarini@yahoo.com Manuscript received: 12 July 2010. Revision accepted: 9 June 2011.

ABSTRACT Yulistyarini T, Sofiah S (2011) Valuing quality of vegetation in recharge area of Seruk Spring, Pesanggrahan Valley, Batu City, East Java. Biodiversitas 12: 229-234. A Seruk spring is one of the springs in Batu city which has water debit less than 1 liter per second.

Land use changes of Seruk spring recharge area was occurred in 2001. Recharge area of Seruk Spring consists of anthropogenic forest, eucalypts plantation, bamboo forest, pines plantation, horticulture and housing. The aim of this research was to valuing the quality of vegetation which supported ground water recharge in Seruk spring. Quality of vegetation was determined by vegetation structure, diversity, the thickness of litter and C-stock of each land use systems. Forests, eucalypts plantation and bamboo forests had almost same quality of vegetation.

Key words: tree species, diversity, composition of vegetation, anthropogenic forest.

INTRODUCTION Batu City located at the Brantas watershed has many water springs. An inventory in this area showed that there are 107 springs in Batu City, East Java. More than half of them have decreasing water debit, some even produce no more discharge (Environmental Impact Management Agency 2007). The decrease of spring discharge is often caused by degradation of the ecosystems which due to land use change from forests to agricultural lands. Forest conversions which changed structure and composition of vegetation have been implicated in reducing biophysical soil properties.

The presence of tree vegetation on a landscape will have positive impact on balancing the ecosystem in a wider scale. In general, the role of vegetation in an ecosystem is associated with carbon dioxide balance and generates oxygen in the air, improved physical, chemical and biological soil properties, ground water hydrology and others (Arrijani 2008). High coverage tree canopies, basal area, understorey species and litter layer were very helpful in maintaining the number of soil macroporosity and ground water infiltration.

Influence coverage of trees on water flow are through: (i) interception of rain water, (ii) protect soil aggregate: vegetation and litter layer protect the soil surface from the rain drop that can destroys soil aggregates, resulting in soil compaction. Crushed soil particles will cause blockage of soil macropore thus inhibit the infiltration of groundwater, consequently surface runoff will increase, (iii) water infiltration: infiltration depends on surface layer on the soil structure and various layers in the soil profile. Soil structure is also influenced by the activity of the soil biota which its energy depends on the organic material (litter layer on the surface, organic exudates by the roots and dead

roots), (iv) uptake of water (van Noordwijk et al. 2004).

Seruk springs had debit less than 1 liter/second. The water of this spring is resource for drinking water, washing, cooking, irrigating and fish farming. Based on geoelectric data, a Seruk spring occurs where surface topography causes the water table to intersect the land slope. This spring is fed from a shallow aquifer consist of sand which has more permeable layer underlain by a less permeable layer. A Seruk spring can be identified as a contact spring which is naturally supported by local ground water flow spring (Yulistyarini et al. 2009). A Seruk spring is composed in the geological formation of Volcanic Rocks Panderman (Qvp), these units belong to the quaternary volcanic rocks of breccia composed of volcanic material, lava, tuff, tuff breccia, agglomerate and lava. Volcanic rocks are predicted Late Pleistocene-Holocene age (Santosa and Sumarti 1992).

The recharge area of Seruk spring was estimated in Seruk hill, which is located at the foot of Mount Panderman. Previously, the recharge area was mountain forests with the various types of vegetation and bamboo species. In the early 2000s, the forests were damaged by illegal logging and fires. Recharge area of Seruk Spring covers an area of 20.04 hectares consists of forests (2.18%), eucalypts (Eucalyptus alba) plantation (9.91%), bamboo forests (9.08%), pine (Pinus merkusii) plantations (51.72%), horticulture (5.88%) and housing (22.17%). The information from local people noted that Seruk spring discharge decreased when the degradation of the forests occurred in 2001. However, measurement of the actual spring discharge has never been done, so how much the decrease in discharge was still unknown. Based on measurement of debit in 2009, the maximum discharge of

B I O D I V E R S IT A S 12 (4): 229-234, October 2011

230

this spring 1.28 l.sec.-1 and the minimum 0.57 l.sec.-1 (Yulistyarini et al. 2009).

Spring debit depends on the large of recharge area and the quantity of water infiltrating the soil (Todd and Mays 2005). Seruk springs that tend to be affected by more local groundwater flow systems and thus are at risk from activities that threaten the shallow water table. From the reason, debit of this spring are depended on the characteristics of recharge area. Besides geophysics and biophysical soil data, the characteristics of recharge area were determined by quality of vegetation. This study was aimed to value the quality of vegetation which supports ground water recharge in Seruk spring of Batu, East Java.

were made by overlay topography (scale 1: 25.000), contour and drainage maps (Figure 1). Then, land use of this recharge area was delineated based on the result of location surveys. There were six Land Use Systems (LUS) in the recharge area, consisting of anthropogenic forests, eucalypts plantations, bamboo forests, pines plantations, horticulture and housing land uses (Table 1.) (Yulistyarini et al. 2009). However, vegetation analyses were only in four land use systems which have potency as recharge area, i.e. anthropogenic forests, Eucalypt plantations, bamboo forests and pine plantations.

Table 1. Land use systems in recharge area of Seruk Spring Land use systems

MATERIALS AND METHODS

Anthropogenic forests Eucalypt plantations Bamboo forests Pine plantations Horticulture Housing Total

Seruk springs is located in Batu City, East Java, at the geographical position of 07⁰53’02,7” latitude, 112⁰30’ 15,4” longitude and altitude of 1233 meters above sea level. Delineation the recharge area of Seruk spring could be estimated using the Micro Watershed Area maps that

Large of area (ha) 0.44 1.97 1.80 10.27 1.17 4.40 20.04

Percentage (%) 2.18 9.91 9.08 51.72 5.88 22.17

A

B

C 200 m

Figure 1. Location of Seruk spring on upstream Brantas watershed, Batu City, East Java (B) and delineation of Seruk Spring recharge area (C).

YULISTYARINI & SOFIAH – Quality of vegetation in recharge area of Seruk Springs

Vegetation in a sampling unit were classified into three classes, e.g. trees, small trees and groundcovers. Trees with a diameter at breast height (dbh) of more than 30 cm were registered within plots 100 m x 20 m. Whereas small trees with dbh less than 30 cm and groundcovers species were sampled in sub plots of 40 m x 5 m and sub plots of 0.5 m x 0.5 m, respectively (Hairiah and Rahayu 2007).

Quality of vegetation was shown by composition and structure of vegetation, plant diversity and thickness of litter. Vegetation structure was described by vertical stratification of plants. Vertical stratification was determined based on trees canopy height, consisted of five strata. Strata A were height trees greater than 30 m, strata B (20-30 m in height), strata C (4 to 20 m in height), strata D (1-4 m in height) and strata E (ground cover 0-1 m in height) (Indriyanto 2005). Structure and composition of vegetation across LUS also have been compared in terms species richness, density and domination species. Species richness indicated the number of species per area unit.

Whereas, domination of species was determined by Important Value Index (IVI). Species names, individuals’ height and dbh as well as abundance were recorded in each plot. IVI of each species (tree, small tree and ground cover) for each plot was calculated by summing the relative frequency and relative density cover. The species diversity was calculated by Shannon-Wiener diversity index (H’).

The formula Diversity Index is H’= Σpi.2log pi (Ludwig and Reynolds 1988). While the thickness of litter was sampled on the plot size of 0.5 m x 0.5 m in the plot 40 x 5 m2, in accordance with the instructions used by a TSBF (Tropical Soil Biology and Fertility). Litter thickness was measured 10 times by pressing the litter then shove thrust slowly (Hairiah and Rahayu 2007).

The quality of vegetation was also determined by the capacity of vegetation to store and emit carbon. All tree and small tree diameters at breast height were measured, and data were converted into aboveground biomass with an allometric equation as presented in Table 2. C-stock of trees was counted with formula C = 0.46 x trees biomass (Hairiah and Rahayu 2007).

Table 2. List of allometric equations used to estimate biomass of various land use systems (Hairiah and Rahayu 2007) Biomass category Branching trees

Allometric equations Biomass = 0.11 ρ D 2.62 2

Non branching trees Biomass = π ρ H D / 40 Pines ρ data are not available

Biomass = 0.0417 D Biomass = 0.118 D

2.6576

2,.53

Source Ketterings 2001 Hairiah 2002 Waterloo 1995 Brown 1997

All variable quality of vegetation were compared between anthropogenic forest and other land uses type using analysis of variance (F-test). Statistical analyses conducted with Minitab 14.0. program, only values of P < 0,05 were consider significant.

231

RESULTS AND DISCUSSION Structure and composition of vegetation The canopy height was graphed for each land uses, which height of trees varied to 37 m. Five vertical strata were identified in two LUS, namely anthropogenic forests and eucalypts plantation. Both land uses were dominated by woody plants which had a height of 1 to 19.9 m (stratum C). The density of plants in forest was highest in stratum C and D (Figure 2A). In anthropogenic forests could still found some trees with a height of more 30 m as much as 7 individual, i.e. Tremna orientalis (6 individual) and Ficus racemosa (1 individu). Bamboo and pine plantations had four vertical strata. Bamboo forests were dominated by stratum C and D, whereas pine plantations were dominated by stratum B. From the above results are known that forests, eucalypts and Bamboo had stratification systems nearly complete, so that infiltration and ground water recharge more rapidly.

Infiltration rate of forest (50.2 cm jam-1) was higher than pines plantation (39.9 cm jam-1) in Ngantang Subdistrict, Malang District, East Java (Saputra 2008). While bamboo forests had highest infiltration rate (60.8 cm jam-1 ).

Anthropogenic forests had significantly the highest species richness of tree and small trees (P< 0,05), about 65 species.ha-1 and 600 species.ha-1, respectively (Figure 2B).

There were founded some native species like Trema orientalis (anggrung), Ficus virens (iprik), F. racemosa (elo), F. hispida, Artocarpus heterophyllus (jack fruit), Microcos tomentosa, Dysoxylum gaudichaudianum (kedoya) and Arenga pinnata (aren). Eucalypt plantations were planted with about 10 tree species.ha-1 such as cajuputih (Eucalyptus alba), Albizia falcataria and Erythrina subumbarn. Whereas the small tree species richness of this LUS reached 213 species.ha-1. There were not any tree species in Bamboo forest, the species richness of small trees achieved 288 species.ha-1. Otherwise pine plantations had no small tree species.

Tree density between the LUS showed no significant difference (P = 0.069) (Figure 2C). However, small tree density was significantly different among the four LUS (P = 0.001). Anthropogenic forests had highest densities (2050 ± 612.4 SD) trees.ha-1, consequently canopy cover of this land use was highest. Bamboo forests were dominated

by Dendrocalamus asper (bambu petung), Gigantochloa atter (bambu jawa) and G. apus (bambu apus). Bamboos species in land use systems belongs to native species. This land use had no trees, but the density of small trees were high (1550 ± 655.7 SD). Whereas small tree density of Eucalypt plantation (925 ± 590.9 SD) was lower than small tree density of bamboo. Pine plantations had high tree density 392.5 trees.ha-1 (± 215.7 SD), but this land use had no small trees. Consequently, pine plantations had lower canopy cover which allowed rain drop hitting the soil surface, thus damaging the structure of soil and decreasing macroporosity soil.

The land use changes that decrease a vegetation density could increase the soil degradation. Consequently, the degradation of soils results in increased run off and reduced infiltration. Clearing natural forest causes tremendous

B I O D I V E R S IT A S 12 (4): 229-234, October 2011

232

A

B

C

Figure 2.A. Vertical stratification of vegetation each land use systems in recharge area of Seruk Springs. Different letters above the bars within each strata indicate significance difference between four LUS (p < 0.05). B. Species richness of vegetation each LUS in recharge area of Seruk Spring. C. Mean density of vegetation each LUS in recharge area of Seruk Spring.

increase of runoff and erosion. Cumulative surface runoff from the natural forest plot was only 27 mm, about one third from that of newly cleared forest (75 mm). But the highest surface runoff was obtained from 3 years coffee plots (124 mm). Beyond that age, runoff decreases with the increase of the age of coffee. Soil loss due to erosion peaked in the 1-year old coffee gardens. The presence of soil physical properties becomes inseparable part of the mechanism of water movement, especially the flow of water into the soil (Widianto et al. 2004).

Trema orientalis (anggrung) was identified as a dominant tree species in the anthropogenic forests because of its highest IVI (41.03). Small tree species in this area were dominated by reforestation plants namely Swietenia mahagoni, E. subumbarn and Litsea firma, which had IVI 25.22, 16,59 and 11.42, respectively. Alangium javanicum was one of the native species had high IVI (13.15).

Similarly, small trees in eucalypt plantations and bamboo forests were mostly reforestation plants such as Persea americana, S. mahagoni, Mangifera indica, Diospyros kaki and Senna spectabilis.

To improve the physical properties of soil and hydrological function of forests not only the role of tree species, but also the role of understorey species.

Understorey analyses resulted in pine plantations had the highest of species number, i.e. 19 species. While, bamboo forests only had 6 species. Based on the high IVI value, Eupatorium riparium and grass species Oplosminus burmanii dominated the forests. E. riparium also dominated the bamboo forests, with IVI values reached more than 100. Whereas, pines and eucalypt plantations were dominated by grass species (Pennisetum purpureum), wedusan (Ageratum conyzoides) and E. riparium. Besides protecting the soil surface, understorey species also input various type of litter as a source of soil organic matter.

Hairiah et al. (2004a,b) mentions three things that can explain the low runoff in the forest is (i) the amount of interception by the canopy-covered vegetation and meetings, (ii) thick litter layer that can accommodate large amounts of water as surface storage and (iii) the number of

macro pores in soil surface that encourages high infiltration rate.

Vegetation diversity Anthropogenic forests had highest Diversity Index (H’) for tree and small tree species i.e 3.31 and 4.15, respectively (Table 3).

Table 3. Index Diversity and litter thickness of various Land Use System in recharge area of Seruk Spring

Land use systems Forests Eucalypts Bamboo Pine

Index diversity (H') trees small trees 3.31 4.15 1.29 3.34 0 3.83 0 0

Litter thickness (cm) 3.03± 1.26 1.53± 0.09 7.61± 0.72 0.65± 0.17

The high diversity caused by its high species richness and density in this land use. While eucalypts and Bamboo had high small trees diversity too (H’ Eucalypt = 3.34 and H’ Bamboo = 3.83). That high H’ of small trees was caused by many reforestation vegetations in both land uses. The stability of ecosystems could assess from the high H’, so that these land uses had ecosystems more stable and higher resilience to disturbance or succession (UNCED 1992).

Thickness of litter Quality vegetation was also be assessed from the thickness of litter each LUS, where the bamboo forests had the highest thickness of litter (7.61 ± 0,72 SD) cm. Pine plantations had the lowest thickness of litter (0.65 ± 0.17 SD) cm (P = 0.006) (Table 3).

The number and quality of litter inputs determined the thickness and thin layer of litter in the surface soil (Hairiah et al. 2004a,b). Total litter inputs in wet tropical forest in West Sumatra approximately 4.11 Mg ha-1 yr-1 (Hermansah et al. 2002), with a very high diversity of flora. The high plant diversity caused varied quality litter inputs, resulted in layers litter of the forest was thicker than the agricultural system (Hairiah et al. 2004a,b). The thicker litter of forest would increase soil biota activities resulted in increasing

YULISTYARINI & SOFIAH – Quality of vegetation in recharge area of Seruk Springs

soil macroposrosity. Results of research in West Lampung showed there was a decline macroporosity in forests which converted to monoculture coffee three years, namely from 83.1% to 63.7% (Suprayogo et al. 2004).

Bamboo leaves have a high silicate content, so the bamboo decomposition is slow. Slow decomposition process will cause the litter to stay longer in the soil surface (Hairiah et al. 2004a,b). Litter plays an important role in supporting the balance of ecosystem functions, including hydrological functions. The litter plays in land cover function through reduction surface runoff rate on slope land and enhancement soil porosity and permeability. In addition, the litter can supply soil organic matter from its decomposition (Sofiah and Lestari 2009). Suhara (2003) indicated that canopy closure was increasingly meeting encourage the improvement of biological activity on the surface because of the availability of soil organic matter and environmental improvement (micro-climate and humidity). Soil biological activity was also positively impact towards improving soil structure and porosity and increase in infiltration rate. Consequently, bamboo forests could be expected to have high infiltration rate. In the dry season, litter can reduce evaporation by soil, so the soil remains moist and protected from dryness. The role of litter on carbon stocks through the C-sequestration process of decomposition and mineralization (Basuki et al. 2004).

Carbon stock Land use change not only accelerates land degradation but also accelerates carbon emission and loss of biological resources (Kremen et al. 2000). The results showed that the C-stock was not significantly different among the four LUS (P = 0.088).

Table 4. Biomass and carbon stock estimate of various Land Use System in recharge area of Seruk Spring Land use systems Forests Eucalypts Bamboo Pines Total

Biomassa (Mg ha-1)

C stock (Mg ha-1)

443.02 132.09 64.16 105.10 744.37

203.79 60.76 29.51 48.34 342.41

Large area (ha) 0.44 1.97 1.80 10.27 14.47

C stock/ large area (Mg ha-1) 88.87 119.54 53.18 496.29 757.88

Even though anthropogenic forests resulted C-stock highest about 167.17 (± 66.20 SD) Mg ha-1. Eucalypts plantations, bamboo forests and pine plantations stored carbon in almost the same amount about 60.76 (± 6.36 SD), 48.34 (± 27.89 SD) and 71.50 (± 13.07 SD) Mg ha-1, respectively (Table 4). Forests have highest C stock because some native tree species were more than 20 years old and had a wider diameter, thus the plants had ability to sequestrate the high carbon. Perennial plants are greater as C- sink than the annual crops (Hairiah and Rahayu 2007).

Based on the C stock of each LUS which multiplied by the area of each LUS obtained the total C stock in Seruk spring recharge area about 757.88 Mg per 14.47 ha.

233

Discussion Every land use system has various environmental services, depending on the density and diversity of vegetation, soil type and its management. In the spring recharge area, the vegetation is not only a role in the diversity of land use, but also as one of the components of the ecosystem that supports aspects of the ecological balance. From above the result of valuing the vegetation quality, forests, eucalypt plantations and bamboo forests had high vegetation quality. The high diversity of vegetation and thickness of litter on both land use systems could be maintaining hydrological function of recharge area and protecting debit of water spring. Results of research on Sumberjaya, West Lampung mention that forests have a higher infiltration of 5.09 mm min-1 compared with coffee and coffee agroforestry monoculture (1.01 mm min-1) (Hairiah et al. 2004a,b). For exceptions, although eucalypts plantation had high vegetation quality, but the expansion of this plant should be considered. This is because these plants are exotic plants.

Besides having high vegetation quality, bamboo species also are known as bookmark plant springs. This plants often grow around springs. Bamboo forests had a high constant infiltration, because bamboo has many fine roots, which are concentrated on spreading 0-30 cm soil depth (Saputra 2008) As consequence, water flows horizontally result in subsurface flows which discharge as spring (2008). The abundance of fine roots at Makino bamboo is not only a source of organic material that helps the development of soil structure, but also form channels for water movement (Lu et al. 2007).

However, based on the decreasing the large forests and bamboo forests compared with eucalypts, pines and Horticulture land use systems, it is necessary to think about policy to manage this area in relation to its function as a recharge area. This is mainly because the eucalypt, pine and horticulture had a higher economic value than forests and bamboo forest. Besides, the ecological functions should still take precedence in the management of this area.

In fact, pine plantations that dominated this region (51.72 %) be known to have high evapotranspiration. So the expansion of this land use systems was feared to decrease ground water supply. Similarly, the expansion of Eucalypt plantations must be considered, because Eucalypt species have relatively deep-rooted, evergreen, and high rates of total annual evapotranspiration. Rasul (2009) presented that the existence of endemic species is an indicator of the quality of an ecosystem because endemic species have a role in increasing the complexity of food webs as one of the requirements to create a balance between ecosystems.

Besides that, reforested programs have the advantage of high environmental services and carbon sequestration.

Cooperation between local people and Perhutani as the manager of recharge area of Seruk springs to conserve the ecosystems and debit of this spring. Agroforestry and farm forestry become other alternatives land use systems. Agroforestry and farm forestry provide many environmental services such as soil conservation, carbon sequestration, biodiversity conservation and regulation of volumes of water in river and streams (Montagnini and Nair 2004).

234

B I O D I V E R S IT A S 12 (4): 229-234, October 2011

CONCLUSION Forests, Eucalypt plantations and bamboo forests had almost the same quality of vegetation. While quality of vegetation in pines plantations was lowest. The high density, diversity of vegetation and thickness of litter on three land use systems could be maintaining hydrological function of recharge area and spring debit continuously.

Besides that the high C-stock of forests, Cajuputih plantations and bamboo forests to be expected increasing the environmental services of the land use systems.

ACKNOWLEDGEMENTS This research is funded by ‘Incentive Program Activity for Researcher and Engineer, Indonesian Institute of Science 2009’ on project entitled ‘Evaluation on the relationship between quality of vegetation, biogeophysical soil and debit of some topography springs in Malang Raya, East Java’. We acknowledge the contributions of exploration team members (Kiswojo, Matrani, Suhadinoto and Irfan Sulistyo) and a local people (Sardi) during fieldwork.

REFERENCES Arrijani (2008) Vegetation structure and composition of the montane zone of Mount Gede Pangrango National Park. Biodiversitas 9 (2): 34-141.

[Indonesia] Basuki TM, Adi RN, Sukresno (2004) Technical information of organic carbon stock in under clusster of Pinus merkusii, Agathis loranthifolia and soil expose. Prosiding BP2TPDAS-IBB Surakarta, Kebumen, August 3th 2004.

Environmental Impact Management Agency (2007) Preparatory studies: planning springs conservation in upper Brantas Watershed. Final Report. East Java Provincial Government. Surabaya. [Indonesia] Hairiah K, Rahayu S (2007) Practical guidance of “Carbon-Sink Measurement” in various land use. World Agroforestry Centre.

Bogor.

Hairiah K, Widianto, Suprayogo D, Widodo RH, Purnomosidhi P, Rahayu S, van Noordwijk (2004a). The thickness of litter as an indicator of healthy watershed areas. World Agroforestry Centre. Bogor.

[Indonesia] Hairiah K, Suprayogo D, Widianto, Berlian, Suhara E, Mardiastuning A, Widodo RH, Prayogo C, Rahayu S (2004b) Forests conversion into agricultural land: litter thickness, earthworm populations and soil macroporosity. Agrivita 26 (1), 68–80. [Indonesia] Hermansah, Masunaga T, Wakatsuki T and Aflizar (2002) Micro spatial distribution pattern of litterfall and nutrient flux in relation to soil

chemical properties in a super wet tropical rain forest plot, West Sumatra, Indonesia. Tropics, Japan Soc Trop Ecol 12 (2): 132-146.

Indriyanto. 2005. Forest Ecology. PT Bumi Aksara, Jakarta. [Indonesia] Kremen C, Niles JO, Dalton MG, Daily GC, Ehrlich PR, Fay JP, Grewal D, Guillery RP (2000) Economic incentives for rain forest conservation across scales. Science 288: 1828-2000.

Lu SY, Liu CP, Hwang LS, Wang CH (2007) Hydrologycal characteristics of a Makino Bamboo woodland in Central Taiwan.

Taiwan J For Sci 22 (1): 81-93.

Montagnini F, Nair PKR (2004) Carbon sequestration: an underexploitated environmental benefit of agroforestry systems.

Agrofor Syst 61: 281-295.

Prijono S, Wahyudi HA (2009) A role of agroforestry in maintaining of soil macroporosity (Studies on the effect of thickness of litter to increase worm biomass of P. corethrurus and soil macroporosity).

Primordia 5 (3): 2003-2012. [Indonesia] Rasul G (2009) Valuing ecosystem services for promoting sustainable agricultural land use systems in hills and mountains. Sustain Sci Pract Pol J 5 (2): 15-27.

Santosa S, Suwarti T (1992) Geology maps Malang sheet, Java.

Geological Research and Development. Bandung.

Saputra D (2008) Role of agroforestry in maintaining soil infiltration rate: the effect of macro pores and soil aggregate stability of infiltration rate. [Thesis]. Brawijaya University. Malang.

Sofiah S, Lestari DA (2009) Services in-situ forest area in Purwodadi Botanical Garden: carbon stock in plant biomass, understorey, litter and soil organic matter. Proceeding of Biology Congress XIV and National Seminar XX, Indonesian Biology Association. Islamic University of Malang. July 24-24th, 2010.

Suhara E (2003) Earthworm population relationships with soil porosity on agroforestry system coffee-based. [Thesis]. Brawijaya University.

Malang.

Suprayogo D, Widianto, Purnomosidhi P, Widodo RH, Rusiana F, Aini ZZ, Khasanah N, Kusuma Z (2004). Degradation of soil physical properties as due to forest convert into coffee mono-culture system: study of change soil macroporosity. Agrivita 26 (1): 60-68.

[Indonesia] Todd DK, Mays LW (2005) Groundwater Hydrology. John Willey & Son, Singapore.

United Nations Conference on Environment and Development (UNCED) (1992) UN Convention on Biological Diversity (CBD). Rio de Janeiro. van Noordwijk M, Agus F, Suprayogo D, Hairiah K, Pasya G, Verbist B, Farida (2004) Role of agroforestry in maintenance of hydrological in water catchment areas. In: Agus F, Farida, van Noordwijk M. (eds) Hydrological impacts of forest, agro-forestry land upland cropping as a basis for rewarding environmental service providers in Indonesia).

Proceeding of a Workshop in Padang/Singkarak, West Sumatra, Indonesia, February 25-28th, 2004.

Widianto, Noveras H, Suprayogo D, Widodo RH, Purnomosidhi P, van Noordwijk M (2004) Conversion of forests into agricultural land: is the forest hydrological functions can be replaced by monoculture coffee system? Agrivita 26 (1): 47-52. [Indonesia] Yulistyarini T, Solikin, Fiqa AP, Irawanto R (2009) Evaluation on the relationship between quality of vegetation, biogeophysical soil and debit of some topography springs in Malang Raya, East Java [Final Report]. Incentive Program Activity for Researcher and Engineer, Indonesian Institute of Science. Jakarta. [Indonesia]

B I O D I V E R S IT A S Volume 12, Number 3, July 2011 Pages: 235-240

ISSN: 1412-033X (printed edition) ISSN: 2085-4722 (electronic) DOI: 10.13057/biodiv/d120409

Termites community as environmental bioindicators in highlands: a case study in eastern slopes of Mount Slamet, Central Java TEGUH PRIBADI1,♥, RIKA RAFFIUDIN2, IDHAM SAKTI HARAHAP3 1

Program of Forestry, Faculty of Agriculture, PGRI University of Palangka Raya. Jl. Hiu Putih-Tjilik Riwut km. 7, Palangka Raya73112, Central Kalimantan, Indonesia. Tel./Fax. +62-536-3220778.email:tgpribadi@gmail.com 2 Departement of Biology, Faculty of Mathematics and Natural Sciences, Bogor Agricultural University, Bogor 16980, West Java, Indonesia.

3 Departement of Plant Protection, Faculty of Agriculture,Bogor Agricultural University, Bogor 16980, West Java, Indonesia.

Manuscript received: 23 November 2010. Revision accepted: 1 July 2011.

ABSTRACT Pribadi T, Raffiudin R, Harahap IS (2011) Termites community as environmental bioindicators in highlands: a case study in eastern slopes of Mount Slamet, Central Java. Biodiversitas 12: 235-240. Termites ecological behavior is much affected by land use change and disturbance level. Their variation in diversity can be used as bioindicator of environmental quality. However, termite community response to land use changes and habitat disturbance in highland ecosystems remains poorly understood. This study was conducted to investigate the response of termite community to land use intensification and to explore their role as environmental bioindicator in Mount Slamet. A standard survey protocol was used to collect termites in five land use types of various disturbance levels, i.e. protected forest, recreation forest, production forest, agroforestry, and urban area. It was found two termite families i.e. Rhinotermitidae and Termitidae with seven species, i.e. Schedorhinotermes javanicus, Procapritermes sp, Pericapritermes semarangi, Macrotermes gilvus, Microtermes insperatus, Nasutitermes javanicus, and N. matangensis. Termite species’ richness and evenness, Shannon-Wiener index, relative abundance, and biomass of termite were declined along with the land use types and disturbance level from protected forest to urban area. Habitat disturbance was the main declining factor of termite diversity. Termite composition changed along with the land use disturbance level. Soil feeding termites were sensitive to the disturbance – they were not found in urban area. Hence, their presence or absence can be used as environmental bioindicator to detect habitat disturbance.

Key words: termite community, bioindicator, land use, environmental disturbance, Mount Slamet.

INTRODUCTION Land use is a major cause of human ecological change in an ecosystem (NRC 2000). Changes in land use and intensity play major role on the destruction of habitat and biodiversity decline (Dale 1997; NRC 2000). Destruction of habitat and decline in biodiversity affect the ecosystem health and functions. Therefore, early detection mechanism that rapidly identifies changes in ecosystem conditions must be made. Early detection can be performed using a group of organisms in an ecosystem or habitat that describes the response to these changes.

An organism that can give respond (Weissman et al.

2006), indication (McGeoch 1998), early warning (Jones and Eggleton 2000; Dale and Bayeler 2001), or representation (Hilty and Merenlender 2000; Vanclay 2004), reflection (Noss 1990; Vanclay 2004), and information (McGeoch 1998) and also evaluation (Burger and Gochfeld 2001; Carignan and Villard 2002) of the condition and/ or changes that occur in an ecosystem called bioindicator. Bioindicator is an important component in ecosystem management and biodiversity conservation (Andersen 1999). The rationale of the existence of a bioindicator is the close relationship between the presence of these indicator organisms with biotic and abiotic parameters of an ecosystem (McGeoch et al. 2002). In

general, organisms that are promoted to be used as a bioindicator in terrestrial ecosystems are insects (Andersen 1999; McGeoch 2007).

One group of insects that could potentially be used as a bioindicator to assess the condition of ecosystems is termite. Termites have a key role in tropical ecosystems function (Bignell and Eggleton 2000). Termites are one of the main decomposer in tropical terrestrial ecosystems (Bignell and Eggleton 2000), and ecosystem engineers through their activities which help improve soil structure and nutrient cycling (Jones et al. 1994: Lavelle et al. 1997).

In addition, termite species richness showed a high correlation to the diversity of other taxon groups in the same habitat (Vanclay 2004), and the complexity of vascular plants (Gillison et al. 2003). Termites also showed high sensitivity to environmental conditions, both biotic and abiotic that exposed them, as well as on ecosystem processes (Jones and Eggleton 2000).

Termite species richness declined due to land use (Eggleton et al. 2002; Jones and Prasad 2002; Jones et al.

2003; Attignon et al. 2005), habitat disturbance (Eggleton et al. 1995, 2002) and habitat fragmentation (Davies 2002).

Relative abundance of termites has decreased due to land use (Jones et al. 2003), and fragmentation of habitat (Davies 2002). The structure of termite species composition was changed due to land use and habitat

B I O D I V E R S IT A S

236

12 (3): 235-240, July 2011

disturbance. The group was a group of soil-eating termites which is the most sensitive group to habitat disturbance (Eggleton et al. 1995, 2002; Davies 2002; Jones and Prasad 2002; Jones et al. 2003). However, information on termite response to habitat disturbance or land use in the highlands (> 1000 ASL) was still lacking. In general, research on termite community response to land use was mostly conducted in the lowlands.

This study investigated the response of termites to landuse in Mount Slamet, the second largest mountain in Java.

Eastern slopes of Mount Slamet (ESMS), is one of the areas with high variation of land use. In this area, there are protected forests, ecotourism, limited production forest managed by the Perum Perhutani, dry farmland, and settlements. This study aims to investigate the response of termite communities in ESMS of land use and review its role as a bioindicator of environmental quality.

MATERIALS AND METHODS Location of the study. The research was conducted in the region eastern slopes of Mount Slamet (ESMS), from June to September 2008. Five locals were chosen for observation diversity of termites based on the level of habitat disturbance due to land use activities as defined by Bickel and Watanasit (2005) and Koneri (2007). The assessment was based on the level of habitat disturbance, namely: (i) the number of trees with large diameter (ø ≥ 20 cm), (ii) the existence of lower plants, (iii) the amount of canopy stratification, (iv) the direct exposure of sunlight to the ground, and (v) the level of accessibility to the region.

Characteristics of each type of land use are presented in Table 1.

Termite sampling technique. The method used to observe the termites in the study was a method developed

by Jones and Eggleton (2000). Data obtained from this procedure was the taxonomic composition and functional groups of termites (eating or feeding groups) (Eggleton et al. 2002; Jones et al. 2005). Two termite transect was placed at each site, transects were placed in a purposive reason (placed on habitats that were invisible uniform) and cut the contour lines. Termites transect size of 100 m x 2 m, consisting of 20 sections (sections) with a size of 5 m x 2 m. Each section was examined and termites were caught on their microsite. The explored microsites were ground (inside and surface), litter, logs, and trees. Time needed to explore the existence of termites in each section was 30 minutes per person for two collectors (Jones and Eggleton 2000).

The observation points in every part of the termite transect consists of twelve areas on the surface of the land with an area of ± 50 cm2. Each area was excavated at a depth of approximately 5 cm and the termites were collected. Dead wood with a diameter ≥ 1 cm found in every part of transect were dismantled and the termites in it were collected. Banir and pepagan layer were opened and termites found at the height of up to ± 2 m were collected.

Nest and mound (mound) in the open ground and termites that are found there were also collected (Jones and Eggleton 2000).

The collected termites were inserted in a tube containing 70% alcohol and labeled. The next step was specimens sorting and identifying. Initial identification was done until the level of morphospecies genus. Identification of termite specimens refer to the identification key of Ahmad (1958), Tho (1992) and Sornnuwat et al. (2004).

Relative Abundance (KR) was calculated based on the number of termites from the same species caught in each section along transect, so the KR values ranged from 0-20 for each transect. Relative abundance was compared with other locations. Termite biomass was measured by wet weight of 20 termites.

Table 1. Descriptions of each type of habitat of study sites.

Location

Plants

Canopy Belowground plants Accessibility

Protected forests HL (I) Gunung Keris, 07015’22.9” S, 109016’71,6” E. 1152 m asl 3050/ha, LBD 115.95 m2/ha.

Dominated by puspa stands 3 layers, tight Land tightly covered, belowground plants high,168.5/m2 Veryrare; hunting and looking for grass

Wanawisata WW (II) Pesanggrahan, 07014’70.6” S, 109017’50.5” E. 1012 m asl 1200/ha, LBD 76.06 m2/ha.

Dominated by stands of dammar 2 layers, tight Land tightly covered, but belowground plants small,90.5/m2 Rarely; look for grass, an alternative route 1980

Forest production HP (III) Brubahan, 07014’50.3.9” S, 109017’71.7” E. 1124 m asl 850/ha, LBD 92.20 m2/ha.

Dominated by stands of pinus 2 layers, open Land tightly covered, but belowground plants small,133.0/m2 Often; tapping pine, there is a field, near the settlement (± 200 m) 1980

Agroforestry AF (IV) Kali Pring, 07015’18.1” S, 109017’0.59” E. 1087 m asl 1050/ha, LBD 21.98 m2/ha.

Dominated by stands of dammar 2 layers, more open Land openly covered, belowground plants small,270.5/m2 Often; seasonal agricultural land

Availability Unknown 1995 (early opening of the habitat) Note: roman numerals on the types of land use information indicates the level of habitat dependence.

Settlements PM (V) Brubahan, 07014’84.6” S, 109017’86,6” E. 1001 m asl 900/ha, LBD 9.17 m2/ha.

1-2 layers, very open Land mostly opened, belowground plants small,155.3/m2 Very often; agriculture and settlement Unknown

PRIBADI et al. –Termites community as bioindicator in highlands

237

Table 2. Relative abundance of species of termites in five different types of land use in ESMS. Species

Land use type HP AF

Note

WW

Pericapritermes semarangi Holmgren

16

3

6

6

0

31

TE, Te1, T

Schedorhinotermes javanicus Kemner

9

4

8

1

1

23

RH, Rh1, K*

Nasutitermes javanicus Holmgren

10

4

1

2

4

21

TE, Te3, K

Macrotermes gilvus Hagen

0

0

0

0

5

5

TE Te2, K

Microtermes insperatus Kemner

0

1

2

0

0

3

TE, Te2, K

Procapritermes sp.

2

0

1

0

0

3

TE, Te1, T* TE, Te3, K

Nasutitermes matangensis Haviland Total

PM

∑

HL

2

0

0

0

0

2

39

12

18

9

10

88

Note of land use type codes refer to Table 1. RH (Rhinotermitidae), Rh1 (Rhinotermitinae), TE (Termitidae), Te1 (Termitinae), Te2 (Macrotermitinae), Te3 (Nasutitermitinae). K (wood-eaters), T (feeds the soil). * Termite functional groups based on the classification of Donovan et al. (2000a). Signs (0) means not found termite species.

Analysis of data. Termite species richness (S) was calculated based on the number of species found per transect. Shannon-Wiener Index (H), Smith and Wilson evenness index (E) calculated with the help of the software Ecological Methodology (Krebs 1999). The relationship between land use (PL) and the level of habitat disturbance (TG) of the termite community (S, KR, H, E, and BM) were analyzed by ordination of Redundancy Analysis (RDA). Environmental parameters on the RDA which were most influential to the termite community structure were analyzed using Forward Selection method and were tested using Monte Carlo Permutation with 199 random permutations. The second analysis was conducted using Canoco Version 4.5 software (Ter Braak and Smilauer 2002). Log (x + 1) transformation was used to meet the parametric assumptions.

Figure 1. Biomass of termites in each of the different types of land use in ESMS. The value shown is the average value (x) with standard errors.

RESULTS AND DISCUSSION The structure and composition of termite communities Of the five sampling sites, there were totally seven species from two families of termites (Table 2).

Rhinotermitidae Family was represented by the subfamily Rhinotermitinae, while Termitidae family was by three subfamilies, namely Termitinae, Nasutitermitinae and Macrotermitinae.

Nasutitermes javanicus and Schedorhinotermes javanicus were found in all types of land use. While the termite species found only in one location was M. gilvus (settlements) and Pericapritermes sp. (Protected forest). The highest relative abundance of termites was in forest protection with 39 findings and lowest was in the settlements (10 findings). Termites biomass of on the type of land use of HL, WW, HP, AF and AM in a row was 1.33 ± 1.09, 0.31 ± 0.15, 0.81 ± 0.36, 12.49 ± 0.20 and 0.34 ± 0.35 gr.m-2 (Figure 1). At PM location, there were no eating soil termites and they were mostly found in HL and HP (Figure 2).

Figure 2. Comparisons between groups of wood-eating termites (K) with land eater (T) in each of the different types of land use in ESMS.

238

B I O D I V E R S IT A S

Termite species richness found in this study was much less compared to some researches on the diversity of termites in Sunda shelf biogeography for the plateau ecosystem conducted by Jones (2000) and Gathorne-Hardy et al. (2001). This was assumed to be caused by the reduction of natural forest existence and the effect of altitude. Gathorne-Hardy et al. (2001) suggested that the higher the location of the termite species, the richness decreased. Decline in termite species richness was due to reduced environmental temperature so that it slowed metabolism of termites. Extreme environmental conditions caused less species to survive. This was evidenced by the unavailability of Kalotermitidae Family in ecosystems at an altitude over 1000 m asl (Gathorne-Hardy et al. 2001) as well as in this research. In addition, the pool species theory could explain this phenomenon (Donovan et al. 2000b).

Tho (1992) mentioned that the species of termites in Java (54 species) was less than in Borneo (90 species) and Sumatra (89 species). This was supported by research of Gathorne-Hardy et al. (2001) which stated that the size of an island contributed to the composition of termite species.

Subfamily of Rhinotermitidae, Macrotermitidae, Termitidae, subfamily Nasutitermitidae were commonly found in the Sunda Shelf (Tho 1992; Jones 2000; Gathorne-Hardy et al. 2001). Groups of soil-eating termites in the plateau were generally much less than in the lowlands. Groups of soil-eating termites on the plateau were Genus Pericapritermes and Procapritermes (Jones 2000; Gathorne-Hardy et al. 2001). Both genera were usually found in forested areas and it was different with M. gilvus which was associated with open or disturbed habitats (Gillison et al. 2003).

Negative effect of altitude on the presence of species had an association with soil-eating termites foraging strategy of each group of termites (Gathorne-Hardy et al.

2001). Soil-eating termites obtained energy from a mixture of mineral soil and humus and it brought to a result of less energy for a lower metabolic activity than the one obtained by wood-eating termites (Jones 2000). The increase of height correlated with the low temperature and it became the limiting factor in the metabolism of termites. Eating land termites had lower reserve of energy than the woodeating termites so that soil-eating termites were more sensitive to the altitude change (Jones 2000; GathorneHardy et al. 2001).

This study showed that different types of land use had caused a decrease in termite species richness, relative abundance of termites and termite biomass gradually from protected forest to the settlement area. Shannon-Wiener index did not correlate with the type of land use (Figure 3).

Some studies also reported a decrease in species richness and relative abundance of termites (e.g. Eggleton and Bignel 1995; Eggleton et al. 1995; 1996; 1999; 2002; Jones and Prasad 2002; Gillison et al. 2003; Jones et al. 2003) and biomass termites (Eggleton et al. 1996; 1999) in response to changes in land use. However, in this study the response of land use on community structure (biodiversity) of termites did not show any significant effect (Îť = 0.00, p = 0.965, F = 0.07) (Table 3). This was also suit with the study of Gathorne-Hardy et al. (2002) who concluded that

12 (3): 235-240, July 2011

the decline in biodiversity termites are not influenced by the type of land use. But monoculture cropping systems (high habitat disturbance) significantly caused a decrease in termite species richness. Monoculture cropping system caused a decrease in the diversity of termites because it lowered microhabitat diversity to support the life of termites (Jones et al. 2003).

Figure 3. RDA ordination between levels of habitat disturbance (TG), types of land use (PL) with species evenness (E), biomass (BM), relative abundance (KR) and species diversity (H) and species richness (S) termites in five types of usage different land in ESMS. Description: The long arrows indicate the strength of correlation between parameters. Parameters with the same direction arrows mean positive correlation, whereas in the opposite direction of arrows means negative correlation and the direction perpendicular arrows between the parameter mean not correlated. The smaller the angle formed between two parameters means that the higher correlation (Ter Braak and Smilauer 2002).

Table 3. Summary results of the RDA ordination of environmental parameters influence the structure of termite communities in five different types of land use in ESMS.

Characteristic roots (eigen value) Correlation termite community structure-environmental Total inertia = 1.000 Percentage variation (%) Environmental parameters The level of habitat disturbance (TG) Types of land use (PL)

1 0.268 0.825

Axis 2 3 4 0.080 0.303 0.192 0.656 0.000 0.000

77.0 100.0 Îť P F 0.38 0.038* 4.84 0.00 0.965 tn 0.07

The level of habitat disturbance and its influence had significant negative correlation to the structure of termite communities (Îť = 0.38, p = 0.038, F = 4.84) (Table 3). This was agreeing with research of Gathorne-Hardy et al.

(2002). Disturbance of habitat is the main cause of decline of termites diversity in the Sunda Shelf . The mechanisms causing a decrease in diversity due to termite habitat disturbance were: (i) depreciation of canopy closure which

PRIBADI et al. â&#x20AC;&#x201C;Termites community as bioindicator in highlands

could lead to direct sunlight on the soil surface. These changes resulted in a decrease in humidity and an increase in environmental temperature so they formed a more extreme microclimate. The variation between daily temperature and high humidity affected the activity of termites; (ii) habitat disturbance affecting the decrease in the number and quality of the microhabitat. Reduced micro-habitats of termites might reduce the food supply of termites and their ability to nest; (iii) bulk density increase causing the soil to be denser and lowering the activity of termites, particularly subterranean termites. If more and more disturbed habitats, which have been affected first were the group of soil-eating termites (Eggleton et al. 1995, 1996, 1999; Jones and Prasad 2002; Jones et al. 2003).

Groups of soil-eating termites required more stability of moist soil conditions and soil temperatures than woodeating termites. The ideal habitat condition for groups of soil-eating termites was a tropical rain forest with dense canopy closure (Eggleton et al. 2002).

Termites community as a bioindicator The group of soil-eating termites was the most sensitive one to habitat disturbance. Disturbed habitats reduced the proportion of soil-eating termites to wood-eating termites.

In habitats with a high level of disturbance, the soil-eating termites did not exist at all. Some same studies also reported that the group of soil-eating termites was the group mostly affected by level of habitat disturbance such as termites group of genus Procapritermes, Pericapritermes and Termes (Eggleton and Bignel 1995; Eggleton et al. 1995, 1996, 1999, 2002; Gathorne-Hardy and Jones 2000; Gahtorne-Hardy et al. 2002; Jones and Prasad 2002; Davies et al. 2003; Gillison et al. 2003; Jones et al. 2003). Thus, the response of soil-eating termites group on the level of habitat disturbance could be used as a bioindicator of environmental quality.

This was in accordance with the opinion of McGeoch (1998) which has stated that the bioindicator was an organism (or group of organisms) showing the sensitivity or tolerance to environmental conditions that make it possible to be used as an assessment tool of environmental conditions. Indicator species was a species that had amplitude on one or several influences of narrow environmental factors.

The proposal to use termites as a bioindicator has been proposed by Speight et al. (1999), Jones and Eggleton (2000), and Vanclay (2004). Basic information of termites has also been obtained as a comparison with other levels of disturbance. Hilty and Merenlender (2000) stated that organisms that serve as a bioindicator should show changes in response to pressure changes that occur. However, if the response was too strong it would provide inappropriate information. Groups of soil-eating species of termites had a response to a gradual level of pressure change. It is characterized by decreasing relative abundance and number of species of soil-eating termites that decreased gradually in response to changes in the level of habitat disturbance.

The determination of termites as a bioindicator was also supported by the standard method of observation (i.e. transect method) that could be used widely (Jones et al.

239

2006), and easily, and the results could be analyzed statistically (Hilty and Merenlender 2000; Hodkinson and Jackson 2005). Termites were easily measured, abundant, and had clear taxonomy.

CONCLUSION Termite community was potential to be used as a bioindicator of habitat disturbance. The improvement of habitat disturbance was responded by the termite community with a decrease of termite community parameters (species richness, relative abundance, termite composition, termite biomass, termite species distribution and termite species diversity). However, the tendency was not detected significantly. The tendency that could be observed from this study was the absence of land-eating termite species in residential areas (most disturbed habitat).

The absence of land-eating termite species in a habitat could be used as bioindicator for disturbed habitats (environmental quality).

ACKNOWLEDGEMENTS This research was funded by the scholarship program, Researcher, Creator, Writer, Artist, Athlete, and People (P3SWOT), Bureau of Planning and International Cooperation, Ministry of National Education in 2007.

REFERENCES Ahmad M (1958) Key the Indomalaya termite. Biologia 4: 33-198.

Andersen AN (1999) My bioindicator or your? making the selection. J Insect Cons 3: 61-64.

Attignon SE, Lachat T, Sinsin B, Nagel P, Peveling R (2005) termite assemblages in West-African semi-deciduous forest and teak plantation. Agric Ecosyst Environ 110: 318-326.

Bickel TO, Watanasit S (2005) Diversity of leaf litter ant communities in Ton Nga Chang Wildlife sanctuary and rubber plantation Nearby Songkhla, Southern Thailand. Songklanakarin J Sci Technol 27: 943955.

Bignell DE, Eggleton P (2000) Termites in ecosystems. In: Abe T, Higashi M, Bignell DE (eds) Termites: evolution, sociality, symbioses, ecology. Kluwer, Dordrecht.

Ter Braak CJF, Smilauer P (2002) CANOCO Reference manual and CanoDraw for Windows user's guide software for canonical community ordination (version 4.5). Microcomputer Power, Ithaca.

Burger J, Gochfeld M (2001) On developing bioindicators for human and ecological health. Monit Environ Assess 66: 23-46.

Carignan V, Villard MA (2002) Selecting indicators of species to monitor ecological integrity: a review. Monit Environ Assess 76: 45-61.

Dale VH, Bayeler SC (2001) Challenges in the development and use of ecological indicators. Ecol Indicat 1: 30-10.

Dale VH (1997) The relationship between land-use change and climate change. Ecol Appl 7: 753-769.

Davies RG (2002) Feeding group responses of Neotropical termite assemblage to rain forest fragmentation. Oecologia 133: 233-242.

Davies RG, Eggleton P, Jones DT, Gathorne-Hardy FJ, Hernandez LM (2003) Evolution of termite functional diversity: analysis and synthesis of local ecological and regional influence richness on local species. J Biogeogr 30: 847-877.

Donovan SE, Jones DT, Sands WA, Eggleton P (2000a) Morphological phylogenetics of termites (Isoptera). Biol J Linn Soc 70: 467-513.

240

B I O D I V E R S IT A S

Donovan SE, Eggleton P, Bignell DE (2000b) Gut content analysis and new feeding group classification of termites. Ecol Entomol 26: 356366.

Eggleton P, Bignell DE, Sands WA, Waite B, Wood TG, Lawton JH (1995) The Richness of species of termites (Isoptera) under differing levels of forest disturbance in the Mbalmayo Forest Reserve, Southern Cameroon. Tropic J Ecol 11: 85-98.

Eggleton P, Bignell DT (1995) Monitoring the response of tropical Insects to changes in the environment: troubles with termites. In: Harrington R, Stroks NE (eds) Insects in changing environments. Academic Pr, London.

Eggleton P, Bignell DE, Sands WA, Mawdsley NS, Lawton JH, Wood TG, Bignell NC (1996) The Diversity, Abundance and biomass of termites under differing levels of disturbance in the Mbalmayo Forest Reserve, Southern Cameroon. Phil Trans Royal Soc Lon B 351: 5168.

Eggleton P, Homathevi R, Jones DT, MacDonald JA, Jeeva D, Bignell DE, Davies RG, Maryati M (1999) Termite assemblages, forest disturbance and greenhouse gas fluxes in Sabah, East Malaysia. Phil Trans Royal Soc Lon B 354: 1971-1802.

Eggleton P, Bignell DE, Hauser S, Dibog L, Norgrove L, Madong B (2002) termite diversity is a cross an anthropogenic disturbance gradient in humid forest zone of West Africa. Agric Ecosyst Environ 90: 189-202.

Gathorne-Hardy FJ, Jones DT (2000) The recolonization of the Krakatau islands by termites (Isoptera), and Their Origins biogeographical. Biol J Linn Soc 71: 251-267.

Gathorne-Hardy FJ, Syaukani, Eggleton P (2001) The effects of altitude and rainfall on the composition of termites (Isoptera) of the Leuser Ecosystems (Sumatra, Indonesia). Tropic J Ecol 17: 379-393.

Gathorne-Hardy FJ, Jones DT, Syaukani (2002) A regional perspective on the effects of human disturbance on the termites of Sundaland. Biodiv Conserve 11: 1991-2006.

Gillison AN, Jones DT, Susilo FX, Bignell DE (2003) Vegetation indicates diversity of soil macroinvertebrates: a case study with termites along a land-use intensification gradient in lowland Sumatra.

Org Divers Evol 3: 11-126.

Hilty J, Merenlender A (2000) Faunal indicator taxa selection for monitoring ecosystem health. Conserv Biol 92: 185-197.

Hodkinson ID, Jackson JK (2005) Terrestrial and aquatic invertebrates as bioindicatos for environmental monitoring, with particular reference to Mountain. Ecosyst Manag Environ 35: 649-666 Jones CG, Lawton JH, Shachak M (1994) Organisms as ecosystem engineers. Oikos 69: 373-386.

Jones DT (2000) termite assemblages in two distinct montane forest types at 1000 m elevation in the Maliau Basin, Sabah. Tropic J Ecol 16: 271-286.

12 (3): 235-240, July 2011 Jones DT, Davies RG, Eggleton P (2006) Sampling termites in forest habitats: a replay to Roisin and Laponce. Austral Ecol 31: 429-431.

Jones DT, Eggleton P (2000) Sampling termite assemblages in tropical forest: testing a rapid biodiversity assessment protocol. J Appl Ecol 37: 191-203.

Jones DT, Prasetyo AH (2002) A survey of termites (Insecta: Isoptera) of Tabalong distric, South Kalimantan, Indonesia. Raffles Bull Zoo 50: 117-128.

Jones DT, Susilo FX, Bignell DE, Hardiwinoto S, Gillison AN, Eggleton P (2003) termite assemblage collapse along a land-use intensification gradient in lowland central Sumatra, Indonesia. J Appl Eco 40: 380391.

Jones DT, Verkerk RHJ, Eggleton P (2005) Methods for sampling termites. Leather SR (eds) Insect sampling in forest ecosystems.

Blackwell, Malden.

Koneri R. 2007. Bio-ecology and Conservation of Lucanid Beetles (Coleoptera: Lucanidae) in the Forest of Mount Salak, West Java [Dissertation]. SPS IPB, Bogor. [Indonesian] Krebs JC (1999) Ecological methodology. Harper and Row. New York.

Lavelle P, Bignell D, Lepage M, Wolters V, Roger P, Ineson P, Heal OW, Dhillion S (1997) Soil function in changing world: the role of invertebrate ecosystem engineers. Eur J Soil Biol 33: 159-193.

McGeoch MA, van Rensburg BJ, Botes A (2002) The verification and application of bioindicators: a case study of dung beetles in savanna ecosystem. J Appl Ecol 39: 661-672.

McGeoch MA (1998) The selection, testing, and application of terrestrial Insects as bioindicator. Biol Rev 73: 181-201.

McGeoch MA (2007) Insects and bioindication: theory and progress. In: Stewart AJA, New TR, Lewis OT (eds). Insect conservation biology.

CABI, Amsterdam.

Noss RF (1990) Indicators for monitoring biodiversity: a hierarchical approach. Conserv Biol 4: 355-364.

NRC (National Research Council) (2000) Ecological indicators for the nation. National Academic Pr, Washington.

Speight MR, Hunter MD, Watt AD (1999) Ecology of Insects concepts and applications. Blackwell, Oxford.

Sornnuwat Y, Vongkaluang C, Takematsu Y (2004) A systematic key to termites of Thailand. Kasetsart J Nat Sci 38:349-368.

Tho YP (1992) Termites of Peninsular Malaysia. Malay Forest Rec 36.

FRIM (Forest Research Institute of Malaysia), Kepong.

Vanclay JK (2004) Indicator groups and faunal Richness. Fbmis 1: 105113.

Weissman L, Fraiber M, Shine L, Garty J, Hochman A (2006) Responses of antioxidants in the lichen Ramalina lacera May serve as a warning Nearly bioindication systems for detection of water pollution stress.

Fems Microbiol Ecol 58: 41-53.

B I O D I V E R S IT A S Volume 12, Number 4, October 2011 Pages: 241-245

ISSN: 1412-033X (printed edition) ISSN: 2085-4722 (electronic) DOI: 10.13057/biodiv/d120410

Community-based sustainable rattan conservation: a case study in Lore Lindu National Park, Central Sulawesi HAMZARIâ&#x2122;Ľ Department of Forestry, Faculty of Forestry, Tadulako University. Bumi Tadulako Tondo, JI. Soekarno Hatta km. 9, Palu 94118, Central Sulawesi, Indonesia. Tel.: +62-451-422611â&#x20AC;&#x201C;422355, Ext. 311, 313. Fax. +62-451-422844. â&#x2122;Ľemail: hpalaguna@yahoo.com Manuscript received: 12 December 2010. Revision accepted: 28 April 2011.

ABSTRACT Hamzari (2011) Community-based sustainable rattan conservation; a case study in Lore Lindu National Park, Central Sulawesi.

Biodiversitas 12: 241-245. The following research study focused on community-based rattan conservation and was conducted in a community located in the buffer zone of Lore Lindu National Park. The aims of the study were to generate a model for communitybased rattan conservation and estimate the economic value of rattan management for the community. The results were expected to provide justification for the development of rattan management systems and strategies. The research was conducted using a combination of community education and evaluation of educational outputs. As a result, the research may be characterized as descriptive experimentation with a participative approach of andragogy. Data was collected through the employment of questionnaires, interviews, PRAs, and FGD techniques. Data were analyzed using quantitative and qualitative analysis. Based on result of analysis, inferential that community asses the effort of rattan conservation as a positive effort and its development requires additional support. The community has a desire to conduct efforts of rattan conservation continuously. The forms of rattan conservation that can be developed are rattan cultivation and selective rattan harvesting. The research developed conservation models in collaboration with rattan farming groups and involving community forestry approaches.

Key words: rattan, conservation, community based, sustainability.

INTRODUCTION Rattan is a potential non-timber forest product that has the potential to be developed as a commodity, both to meet national and international demands (Dominic and Camille 2001; Supriadi et al. 2002). Central Sulawesi uniquely located in such a manner that its ample natural forests are able support a various rattan varieties (Alrasyid 1980). The quality and prevalence of rattan has greatly decreased as a result of exploitation. The variables responsible for decreasing rattan populations include the lack of conservation efforts on the part of the government, private sector, and rattan farmers themselves. The lack of conservation efforts can be attributed to a lack of knowledge and skill held by rattan organizers, especially rattan farmers whom continue to employ simplistic techniques (Nasendi 1995).

Rattan conservation is a strategy that must be systematically developed in order to provide the best possible practices for rattan conservation on an ongoing basis. This will allow for rattan productivity to be more sustainable. Earnings generated by the community through the utilization of rattan have the potential to contribute to not only the local economy, but the national economy as well. Stakeholders involved in rattan industry claim to have special knowledge and skill about rattan conservation techniques, especially concerning rattan cultivation methods.

The exploitation of rattan and rise of rattan conservation awareness has promoted an initiative to employ trade certification for cultivated forests. It it expected that by 2010 all commercial forest products, including rattan, must be the result of cultivation. As a result, it is expected that by 2010 all forest products will be derived from commercialized sources and not the result of natural forest extraction.

In order to conduct research on conservation and management strategies for rattan in the rainforest margins of Lore Lindu National Park (LLNP), we have to know first know the value of rattan to the community. According to Bennett and Barichello (2006), aside from the physical components, the economic and social values of rattan must also be accounted for as an important variable in the calculation of total economics value. The result of the investigation is expectable to assure stakeholders involving for giving support to the conservation effort. This is an important aspect faced in sustainable forest management.

The dynamics and stability of rainforest margins is a central issue in the bio-conservation and sustainability of plant germplasm (Renuka 2004). The rate of degradation experienced in forest and biodiversity is a serious challenge facing in the current conservation efforts. Degradation is also becoming a big problem in the management of national parks, including Lore Lindu National Park. As a result of these issues and other, a comprehensive study on the conservation of rattan was considered of critical importance.

242

B I O D I V E R S IT A S

12 (4): 241-245, October 2011

In general, this research aimed to produce a model of community-based rattan conservation and management, and evaluate the total economic value of rattan management for the community. So that, if a variety of potential rattan types increases economically, it can increase earnings and prosperity for community. Specifically, this research aimed to: (i) calculate the earnings of rattan farmers over the last 10 years; (ii) compare and contrast the attitudes and desires of rattan farmer to the expansion of efforts in the area of rattan conservation; (iii) determine strategies for conservation that can be undertaken by communities for the expansion of rattan conservation; (iv) determine strategies for rattan conservation that can be rapidly undertaken by rattan farmer.

MATERIALS AND METHODS The research was conducted utilizing a combination of community education and analysis of educational result.

The research can be categorized as descriptive experimentation. The research was undertaken utilizing an andragogy approach. Data was collected using questionnaires, structured interviews, Participatory Rural Appraisal (PRE) and focus group discussions (FGD) (Tellu 2006). The data collection techniques were adjusted to accommodate the following: First phase: Rattan farmer training utilizing an andragogy approach. Second phase: Utilizing the PRE, RRA and FGD techniques to collect information on the potential types of conservation strategies that may be used by rattan farmers. Third phase: implementing rattan conservation strategies in the field, largely accomplished by the FGD method. Fourth phase: Evaluation and follow-up. This phase was jointly undertaken by researchers, rattan farmers and stakeholders, to ensure comprehensive and community-based rattan conservation strategies.

Respondents included those individuals living around the TNLL, primarily those undertaking rattan farming and in direct contact with the TNLL. In each of the eight village located in the buffer zone, 15 to 20 individuals were selected to participate. Besides, it also is taken some stakeholders involving direct in management and rattan commerce. Estimating the economics value of rattan management was accomplished with structural interviews and filling inquiries. The observation of research implementation was done step by step according to the development stages of the activity of research in the field.

productive age, that is, young and strong enough to be able to yield goods and services for living. Rattan collection is a viable manner to provide added economic gain for a family as a means of secondary or tertiary income, and generates much enthusiasm/interest from people living near forests.

Men dominate rattan collection, however, women can sometimes be found in the practice as well. As a rule of thumb, for every man found in the practice of rattan, there are two women involved in some context. Women tend to exist in the capacity of support, cooking for rattan collection crews. So the women do not make activity as within reason the men takes rattan. Harvesting and collecting rattan is a form of work that does not demand education or special skills, thereby allowing it to be undertaken by a variety of individuals from varying backgrounds and training (or lack thereof) (Rachman and Supriadi 2001). Most rattan farmers have a basic level of education; generally this involves only elementary school (including this category is which have never gone to school or not finish basic school (Sekolah Dasar) and junior high school (Sekolah Menengah Pertama).

According to Januminro (2002), the engagement of individuals in rattan harvesting as a side job has existed in the region for a long time. Frequently, these individuals are full time workers of the farming trade, although occasionally individuals can also originate from carpentry, commerce and public servant (pegawai negeri sipil). The harvesting and collection of rattan is predominantly undertaken when there is little or no activity on the farm.

For example, if the farmer has free time or is in between cultivate periods; the individual will carry out rattan collection and harvesting. A similar trend is exhibited by rattan merchants; when there is excess rattan harvested and brought to market, the price of rattan will decrease. For most individuals, rattan farming is not the main source of income. While it does provide supplemental income, many confess that the money generated from the harvesting and collection of rattan is very small.

Activity of taking rattan Although rattan collection is in most cases a side activity, it is frequently practiced by individuals for a long period of time. Generally, individuals have been collecting rattan for between 6-15 years, although some have been collecting for less than five years and some more than 16 years. Based on information collected from informants, the amount of rattan taken from the forest is not influenced by the duration of the involvement the farmer in the activity (Table 1).

RESULTS AND DISCUSSION Table 1. Average rattan collection patterns of farmers

Based on the results of questionnaire analysis, PRA and FGD, results can be grouped into four groups: rattan farmer identity; activity of taking rattan; expense and earnings components of rattan farmer; and rattan conservation.

Rattan farmer identity Rattan farmers whom are involved in the harvesting and collection of rattan tend to be categorized as being a

1

Number of years farmer has been involved in rattan collection (yr) > 10-8

2-3

8-6

80

14

<6

61-80

Number of days involved in collection per year

Total amount of rattan collected (kg) 80 <

HAMZARI – Rattan conservation in Lore Lindu National Park

The number of days required by every rattan farmer to collect and harvest rattan varies. The amount of rattan that can be removed is strongly influenced by the distance between the location of the rattan and the location of the farmer’s residence, the geographic makeup of the area (topography) and the population of favorite rattan present.

The number of days required by rattan farmers to harvest and collect rattan year to year is dependent on the time required to travel between the forests and residences.

The ability of rattan farmers to bring a number of rattans each time to forest decreases. In the time category 8 to 10 years, rattan farmers are able to collect 80 or more kgs of rattan. This trend decreases with time; in the time category less than eight years, rattan farmers are only able to collect between 61-80 kgs. These results exhibit the decreasing trend in the amount of rattan that is able to be harvested and collected from year to year. The variables largely responsible for this trend include the distance between the farmer’s home and the location of rattan, the level geographic difficulty (topography), and the population of favorite rattan species.

According to Duran (2001), rattan farmers possess specific selection methods for rattan. They apply criteria specified by merchant. These criteria generally include the vision of morphology of the rattan and its type. Additional criterion applied include the rattan species, level of bar maturity, bar length, bar diameter, other bar color and other criterion, usual of vision of bar like path depth or bar shine.

However, these criteria hardly influence the price of rattan at the rattan farmer level.

Common rattan species taken by rattan farmer in the Kulawi District include species of rotan batang (Calamus zollingeri Becc.), rotan lambang (Calamus ornatus var. celebicus Blume ex Schult.f.), rotan tohiti (Calamus inops Becc.) and rotan noko (Daemonorops robusta Warb.). The selection of rattan species is based on those found in the buffer zone of Lore Lindu National Park. When compared to other species of rattan, those found in LLNP receive a high price at market. The harvesting and collection of rattan from the forest is generally done by groups of rattan farmers, although some individuals collect on their own.

Groups of rattan farmers divide their sales revenue among all group members, while individual formation accompany one another into the forest, but undertake and manage their own harvesting separately (Sinaga 1986).

Factors, time, and cost Costs borne by rattan farmers include those associated with equipment, the cost of living and others. The level of cost bourn by each rattan farmer varies and usually increases time to time. Variations in cost may be caused by the duration of time spent residing in the field collecting rattan, and increases to everyday living cost; meanwhile, the price of rattan does not increase significantly. During the last eight to ten years the price of rattan has been estimated at Rp. 10.000 to Rp. 20.000. At the time of research, the price of rattan was estimated at between Rp. 50.000 to Rp. 100.000.

The selling price of rattan varies, although it is hardly dependent on rattan criterion from in forest (MoC 2001).

243

When all rattan criterion are met, the seller shall receive the maximum price for their product; however, is some criterion are not met, the price of the rattan will decrease according to the number of criterion left unfulfilled. The highest selling prices are received for C. zollingeri, C. ornatus and C. inops. Rattan selling prices from year experiences improvement, but doesn't give improvement of income significant because the operating expenses also increase.

According to INBAR (1999), the level of income generated by each rattan farmer varies. That is highly dependent on the amount collected and the rattan species itself. The value of rattan collected six to ten years ago was high when compared to the average income at the time; however, the current value of rattan is lower when compared with the current average income. This exemplifies the general trend of decreasing earnings seen annually. This trend is caused especially by the quantity of rattan harvested and collected. The selling price of rattan has not increased to the same degree as the increasing costs associated with harvesting and collecting rattan.

Conservation aspect of rattan According to MoF (2006), the harvesting and collection of rattan requires a permit from government through the Regency Forestry Department. Permits may be issued to (i) individuals with optimum 100 tons, and (ii) co-operations with optimum 500 tons.

Legal permits given directly to co-operations and individuals only applied by 33 rattan farmer, while the other is form of legal permit that wrong opening of target because it was given to big merchant generally resides in Palu city. The permit owner looks for extension of hand in countryside to use their permit, with a note of result obtained from forest must be sold to the permit owner. As a result the price of at farmer level often made a fool by permit owner so that rattan farmer gets a minimum real advantage. Rattan permits should be government regulated, which would enable direct representation and protection of the farmer’s rights and allow for easier access to individual permits.

Based on provisions accompanying the issuance of permits for rattan, whether they are for co-operation or for individual, all permit holders are obliged to undertake some of conservation activity, especially replanting of rattan (MoF 2002). In reality, rattan farmers do not always follow this rule, especially if a rattan farmer is only using the permit from merchant. This demonstrates a lack of attention from merchant and rattan farmer about the importance of rattan conservation.

Technical knowledge and skill of rattan, especially rattan farmer about rattan conservation is low. Rattan farmers generally have never heard about rattan conservation; only a small schema of rattan farmers has ever heard about rattan conservation concepts. Although there is ample space, conservation practices traditionally have not been undertaken. Referring to the condition, required training about rattan conservation technique for rattan farmer (Siebert 1991).

244

B I O D I V E R S IT A S

12 (4): 241-245, October 2011

Information about terms or concepts associated with rattan conservation was obtained from various informants.

Rattan farmers whom have heard terms or conservation concepts of rattan are obtained especially from nongovernmental organization (NGO), Ministry of Forestry, rangers of LLNP and researchers/high education.

A lack of information received by rattan farmer proves that there is still a weak socialization process of rattan conservation concepts, especially in anticipating the application of commerce certification result of forest cultivation, including result of forest in form non timber forest products such as rattan. This is also one of the root causes for the decline in population and production of favorite rattan species.

The population and production of rattan decline every year. Some of the root causes responsible for this trend include: a lack of conservation effort by rattan farmer and government, and the slow rate at which rattan grows (Unhas 1996). The reason for a lack of conservation efforts may be attributed to the lack of socialization and knowledge about rattan conservation. Generally rattan farmer cannot undertake conservation effort for rattan because they simple do not know how to do it.

Additionally, there is a lack of willingness and time to undertake conservation activities. There is a great need for a revitalization of efforts to generate awareness of the importance of rattan conservation and activities.

There are many actions that can be taken to maintain rattan productivity. In the long term, conservation processes can involve many local individuals. While in the short term, rattan farmers shall apply collection principles of rattan selective harvesting and wise use. To execute the effort, is the involvement of government and all stakeholders associated with rattan commerce is critical.

According to Barkmann et al. (2004), rattan conservation that can be undertaken by rattan farmer themselves, include the nursery bed process and cultivation, seedling split and cultivation (seedling scarce). This can be done if rattan farmer is supplied with adequate knowledge and skills about the rattan cultivated process. By embarking on the conservation process, rattan farmers will receive various benefits in return.

The results of the final observations and discussions during the PRA and FGD processes form the basis of the conservation activities that can be done by the rattan farmer (seedling split and seedling cultivation). These were selected for several reasons, namely: (i) easier to be done, (ii) time required to complete the activity is relative brief, (iii) the level of viability is high, (iv) easier to collect specimens from the forest than from matured fruit, and (v) the care process is relatively easier.

Based on the reasons mentioned before, it can be explained that if form of the conservation developed by rattan farmer is through seedling split and the cultivation, need to pay attention: (i) Seed which spitted must be known the type surely and prerequisite of good seed conditions, (ii) In doing split should not destroy the mains crop, (iii) Seedling care done to be continual and periodical.

The conservation process itself can be insufficient, especially if it will be done in bigger number. In consequence, thought needs to be put into the diversification of conservation processes besides split and seed cultivation. Processes that are more accurate may be accomplished through the use of nursery beds and cultivation of seed Astuti et al. (2001). Therefore, rattan farmers shall step by step do nursery bed process from seed (rattan seed) and next step is planting safely and keeping well based on conservation method of rattan.

Besides the processes recommended above, rattan farmers also need to carry out strategic steps in the form of attitude and wise behavior concerning the harvesting and collection of rattan. One of the most important actions to be followed by rattan farmers is to not take rattan that is flowering or is bearing fruit. The attitude like this will guarantee sustainability of produce of rattan, especially rattan type having barred unique.

There are various obtainable benefits by rattan farmer, especially about defensible rattan productivity on an ongoing basis. If defensible rattan productivity on an ongoing basis, hence earnings rattan farmer can be improved and in the end can increase prosperity rattan farmer. To support the need to maintain rattan productivity, the role of government is required. The Government is expected to regulate actively in so many thing, especially in the case of execution of rattan conservation on an ongoing basis, of rattan commercial system and prohibition of raw rattan export. This arrangement is very importance because the government has the power and resources to adequately develop efforts relating to conservation and rattan commercial arrangements.

Stands at conservation effort which can be done by rattan farmer, the government shall thought of correct strategic steps of which can support rattan conservation effort to base-community. One strategic step that must be undertaken is to give amenity to obtain area concession of rattan conservation and incentive to rattan farmers to conservation rattan.

Based on the results of problems synthesized during the PRA and FGD activities, it was identified that some problems that require solutions: (i) problem of land supply and preparation, (ii) land permission, (iii) rattan garden security, (iv) cost of maintenance, (v) education, (vi) traditional forest and community forest, and (vii) the relationship of with Lore Lindu National Park

CONCLUSION AND RECOMMENDATION Based on the analysis of result and discussions of this research, several conclusions have been made: (i) The total economic value of rattan management to finite at rattan farmer level is Rp. 100.000 to Rp.150.000. This number consists of a nature value of Rp. 50.000 to Rp. 100.000, and an added value (income) for rattan farmer of Rp. 25.000 to Rp. 50.000; (ii) The level of earnings by rattan farmers from year to year is increasing quantitatively, but from the angle of value it doesn't increase; (iii) The community, especially rattan farmers, assess conservation

HAMZARI – Rattan conservation in Lore Lindu National Park

efforts for rattan as a positive effort and need to be supported to undertake conservation activities. In consequence, they have a mind to carry out conservation efforts for rattan for improving rattan productivity on an ongoing basis; (iv) There are a number of forms of rattan conservation which can be developed by the community; particularly rattan farmers may carry out nursery and cultivation, carry out seedling split (thinning) and cultivation, and take rattan selectively and wise; (v) Conservation model which can be developed by community, especially rattan farmer is constructing a collaboration in the form of group of rattan farmer and conduct conservation through traditional forest and social forest approaches; (vi) The conservation model which has been employed by rattan farmer as result from this establishment process and research is processing split and cultivation of seed.

Based on the conclusions formulated above, it is recommended that although rattan farmers have chosen the conservation techniques of split and cultivation of seed developed during research, with consideration of amenity of the execution, but for the sake of larger ones, it recommended that rattan farmer can develop step by step and sustainability of conservation process through the nursery technique and cultivation of seed. In conclusion, the involvement of all stakeholders involved in the commerce of rattan, especially the government, is critical so that rattan conservation can be done systematically and sustainable.

REFERENCES Alrasyid H (1980) Rattan planting guidelines. Forest Research Institute.

Bogor. [Indonesia] Astuti S, Sandara R, Bachrun Z (2001) Quality test and cultivation of some species of rattan in order to improve community in come in the vicinity of Kerinci Seblat National Park Bengkulu. Taman Nasional Kerinci Seblat. Bengkulu. [Indonesia] Bennett C, Barichello R (2006) Value-added and resource management policies for Indonesian rattan. Forest Products and Forestry SocialEconomics Research and Development Centre, Forestry Research and Development Agency. Bogor, Indonesia.

MoC [Ministry of Commerce] (2001) Potential rattan supplay in Central Sulawesi. Regional Office of the Department of Commerce Central Sulawesi. Palu. [Indonesia]

245

MoF [Ministry of Forestry] (2002) Guidelines for development of rattan cultivation. Directorate General of Forest Utilization, Department of Forestry R.I. [Indonesia] MoF [Ministry of Forestry] (2006) Prospect of rattan cultivation in Sulawesi: A case study of South Sulawesi and Central Sulawesi provinces. Agency for Forestry Research and Development, Department of Forestry and the Faculty of Agriculture and Forestry, Hasanuddin University. Makassar. [Indonesia] Dominic M, Camille B (2001) The valuation of biological diversity for National Biodiversity Action Plans and Strategies. A guide for trainers. United Nations Environment Programs (UNEP). New York.

Duran P (2001) Collaborative development-oriented research on conservation of rattan biodiversity in Malaysia. NWFPs; Social, Economic and Cultural Dimensions: 323-326.

INBAR [International Network for Bamboo and Rattan] (1999) Socioeconomic issues and constraints in the bamboo and rattan sectors: INBAR's assessment. INBAR Working Paper No. 23. Multiplexus.

New Delhi, India.

Januminro (2002) Indonesian rattan. Kanisius. Yogyakarta. [Indonesia] Barkmann J, Glenk K, Marggraf R (2004) Biological diversity at the rainforest margin as an economic good. 17th Annual Meeting of the Society for Tropical Ecology “Biodiversity and Dynamics in Tropical Ecosystems”, 18.-20. Februar 2004, University of Bayreuth, Bayreuth.

Nasendi BD (1995) Development of rattan cultivation: constraints, challenges and expectation. Agency for Forestry Research and Development, Department of Forestry RI. Jakarta. [Indonesia] Rachman O, Supriadi A (2001) Processing of rattan after harvesting.

Prosea Indonesia. Bogor. [Indonesia] Renuka C (2004) Genetic diversity and conservation of rattans. Bamboo and Rattan Genetic Resources and Use. IPGRI – INBAR Pub. Serdang, Malaysia.

Siebert SF (1991) Forest management. Rattan for forest conservation and development: ecological studies of Calamus exilis in Kerinci-Seblat national park, Indonesia. La foret, patrimoine de l'avenir, Paris (France), 17-26 September 1991.

Sinaga VM (1986) Pattern of development of rattan cultivation.

Proceeding of National Workshop on Rattan. Jakarta, 15-16 December 1986. [Indonesia] Supriadi A, Martono D, Puspitodjati T, Rachman O (2002) Technical and economical analysis of rattan processing. Bul Penel Hasil Hutan 20 (2): 127-141. [Indonesia] Tellu AT (2006) Inventory of potential and pattern distribution of the rattan species in Lore Lindu Protected Forest. Research Institute of Tadulako University. Palu [Indonesia] Unhas [Hasanuddin University] (1996) Prospects cultivation of rattan in Sulawesi: a case study of South Sulawesi and Central Sulawesi provinces. In: Nasendi BD, Masud AF (eds) Assessment of local and national issues of forests and forestry in Indonesia: a review of prospects and strategies towards forest management and sustainable forestry development. Research and Development Agency of Forestry, Ministry of Forestry, R.I., Jakarta.

THIS PAGE INTENTIONALLY LEFT BLANK

A-1

Authors Index Adjie B Alikodra HS Amarantini C Ammar MSA Arisoesilaningsih E Asmara W Budiharta S Cramer V Djuuna IAF Erniwati Fardila D Faturrahman Fegan M Hadiwiyono Hamzari Harahap IS Hartini S Helmiati S Hernawati H Hernowo JB Hobbs R Indriyani S Ingole SN Jamaluddin Junior MZ Kurniawan A Kushadiwijaya H Kusmana C Lestari DA Mansyah E Mardiastuti A Masora M Meryandini A Mumu MI Mutaqien Z Peristiwady T Poerwanto R Praptosuwiryo TN Prasetyo D Pribadi DO Pribadi T Puradyatmika P Purnobasuki H

7 99 1 92 45 1 22, 225 86 198 76 212 192 12 12 241 235 204 34 187 99 86 45 146 107 192 7 1 99 28 59 99 198 192 171 218 136 59 204 164 204 235 198 45

Puspitaningtyas DM Putranto HD Putri LSE Raffiudin R Riyanto A Roesma DI Rusiyantono Y Rusmana I Saharjo BH Santosa E Santoso P Santoso S Santoso W Sembiring L Setyawan AD Setyobudi E Shahabuddin Sinaga S Singh AK Siregar IZ Sobir Soeparno Sofiah S Subandiyah S Sugardjito J Susanti R Sutomo Syamsuwida D Tanari M Tapa-Darma IGK Ubaidillah R Wardiyati T Wibawa IPAH Widada J Widawati S Wijayanto N Wiyono S Yulia ND Yulianti Yulistyarini T Yulita KS Zuhri M

204 131 212 235 38 141 171 192 182 59 141 187 28 1 112 34 177 59 107 64 59 34 229 12 164 70 86, 212 64 171 64 76 45 7 12 17 52, 64 187 22, 225 64 225, 229 125 218

A-2

Subject Index 16S rRNA gene sequences actinomycetes Aeromonas agarase agar-liquefying agroforestry system Alas Purwo Amorphophallus paeoniifolius amphibians Amravati Anisakis sp Anthiinae anthropogenic forest Aphis gossypii arbuscular mycorrhizal fungi (AMF) Baluran banana skipper banana bioindicator biological control biosystematics blood disease bacterium carbon stock catchment area chili chronosequence Cibodas Botanic Garden Cibotium climate

coastal ecosystem community based community forest community

composition of vegetation conservation

coral reefs corm cpDNA

1, 2, 6 198, 199, 200, 201, 202, 203 192, 194, 197 192, 193, 194, 195, 196, 197 192, 197 52, 55, 57, 58, 67, 69, 177, 178, 181, 234 99, 101, 105, 106 7, 8, 9, 10, 11 38, 39, 40, 41, 44 146, 147, 155 34, 35, 36, 37 136, 140 292, 231, 233 187, 188, 189, 190, 191 107, 108, 109, 110 99, 100, 102, 106 76, 77, 85, 12, 15, 16, 39, 62, 76, 77, 82, 85, 130, 189 235, 236, 239, 71, 116, 119 76, 77, 85, 187, 191 85, 112, 113, 120, 122 12, 15, 16 182, 183, 184, 185, 186, 233, 234 52, 234, 187, 188, 189, 190, 191 86, 89, 90, 91, 213 218 204, 205, 206, 207, 208, 209, 210, 211 28, 42, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 55, 64, 88, 91, 98, 100, 112, 115, 116, 118, 120, 172, 180, 182, 186, 197, 201, 213, 224, 225, 233, 239 17 57, 241, 242 64, 65, 67, 166, 241, 244 1, 38, 40, 42, 44, 51, 52, 53, 54, 55, 57, 58, 64, 65, 66, 67, 68, 86, 88, 90, 91, 92, 97, 98, 107, 110, 116, 119, 121, 123, 165, 166, 167, 168, 171, 177, 179, 180, 181, 208, 210, 213, 214, 215, 216, 217, 220, 221, 224, 235, 236, 237, 238, 239, 241, 242, 244, 245 292, 231 22, 28, 32, 38, 55, 57, 64, 70, 92, 99, 112, 113, 119, 120, 136, 137, 141, 169, 171, 172, 177, 180, 183, 201, 204, 233, 235, 241, 242, 243, 244, 245 92, 93, 94, 97, 98, 140 45, 46, 47, 48, 49, 50, 51 7, 9, 10, 114, 161

daily gain degraded forests distribution

disturbance

diversity

duku dung beetles ecology

ecosystem function Egypt emission environment

enzyme immunoassay (EIA) epiphytic orchid Erionota thrax ethnobotany explorative facilitation

171, 172, 175 164, 165, 166, 167, 169 2, 3, 5, 6, 10, 11, 15, 21, 24, 25, 33, 34, 36, 37, 38, 40, 42, 44, 51, 58, 59, 62, 63, 64, 67, 69, 76, 77, 79, 80, 81, 82, 85, 99, 100, 105, 106, 109, 110, 112, 114, 115, 116, 119, 123, 125, 127, 138, 146, 148, 149, 150, 151, 152, 153, 154, 155, 156, 170, 176, 178, 198, 199, 200, 201, 202, 203, 204, 205, 207, 208, 209, 210, 211, 214, 217, 220, 221, 224, 227, 228, 234, 239, 245 38, 86, 87, 88, 89, 107, 165, 166, 167, 177, 180, 198, 212, 213, 220, 222, 223, 225, 227, 235, 236, 237, 238, 239 1, 3, 4, 6, 7, 8, 9, 10, 12, 13, 15, 16, 17, 21, 22, 23, 24, 25, 27, 31, 33, 38, 39, 40, 42, 44, 52, 53, 56, 57, 58, 59, 61, 62, 63, 64, 67, 68, 69, 70, 71, 72, 75, 86, 87, 88, 91, 92, 93, 94, 95, 96, 97, 98, 107, 109, 110, 111, 112, 113, 114, 115, 117, 118, 119, 120, 121, 125, 127, 130, 141, 144, 145, 146, 156, 162, 177, 178, 179, 180, 181, 187, 189, 191, 198, 203, 206, 217, 218, 219, 223, 224, 225, 227, 228, 229, 231, 232, 233, 234, 235, 236, 238, 239, 240, 245 125, 126, 127, 128, 129, 130 177, 178, 179, 180, 181, 240 12, 92, 113, 115, 119, 148, 149, 150, 151, 152, 153, 154, 155, 156, 204, 205 55, 177, 178, 179, 180, 181, 185, 198, 233 92, 93, 94, 97, 98 182, 183, 185, 186, 197, 233 12, 13, 15, 18, 23, 24, 25, 30, 31, 32, 38, 39, 45, 46, 50, 52, 55, 56, 57, 70, 71, 86, 88, 89, 94, 109, 110, 115, 116, 117, 118, 119, 120, 141, 144, 161, 172, 173, 175, 177, 179, 180, 182, 183, 185, 186, 191, 192, 199, 202, 215, 218, 223, 227, 228, 229, 233, 234, 235, 236, 237, 238, 239 131, 132, 133, 135 22, 23, 24, 25, 27 76, 77, 78, 79, 80, 81, 82, 85 112, 113, 118, 120, 121, 122 28, 29, 212, 215, 216

A-3 feces feed conversion female tiger fish

Flickingeria angulata fungi

Garcinia genetic diversity

genetic variation GHG Gracilaria gradient of altitudes Gulf of Aqaba Gunung Ciremai habitat utilization hatching host tree host trees HPLC Hymenoptera identification key Indonesia infection inoculation integrated interaction

interspecific association inventory

ISSR javan green peafowl Kulon Progo District Lamedai Nature Reserve land use change land use

Lansium domesticum leaf endophytic fungi lime stone maleo medicinal plants Melghat Melia azedarach meristic mine spoils mitochondrial DNA model

131, 132, 133, 134, 135 171, 172, 175, 176 131, 132, 133, 134 34, 35, 36, 37, 92, 93, 94, 97, 136, 137, 138, 139, 140, 141, 142, 144, 183, 189, 191, 229 22, 23, 24, 25, 26 107, 108, 109, 117, 187, 188, 189, 190, 191, 198, 199, 200, 201, 202 59, 61, 62, 63 6, 10, 12, 13, 15, 16, 59, 61, 63, 64, 67, 69, 70, 71, 72, 75, 120, 125, 127, 130, 191, 218, 245 7, 8, 10, 62, 63, 64, 67, 69, 125, 127, 130, 161, 162 182, 185 192, 194, 197 225, 227, 228 92, 93, 97, 98 38, 38, 39, 41, 44 38, 40, 42, 164 171, 172, 173, 174, 175, 176 22, 27, 28, 29, 30, 31, 32, 33, 165, 225, 227, 228, 22, 23, 24, 25, 26, 28, 29, 30, 31, 32, 33, 165, 225, 227, 228 117, 121, 131, 132, 133, 135 76, 77, 78 76, 142, 236 1, 7, 8, 9, 11, 12, 14, 15, 17, 24, 28, 34, 36, 37, 38 1, 16, 34, 35, 36, 37, 118 107, 110, 188, 12, 21 52, 56, 57, 76, 85, 92, 98, 162, 180, 217 13, 15, 50, 55, 92, 108, 172, 178, 179, 180, 212, 213, 215, 216 212, 213, 214, 215, 216, 27, 28, 29, 33, 53, 120, 145, 204, 205, 211, 218, 219, 222, 224, 229, 245 59, 60, 61, 62, 63, 130 99, 105, 106 34, 35, 36, 37 28, 29, 30, 31, 32, 33 53, 177, 182, 186, 229, 231, 233, 235, 139 53, 55, 56, 57, 164, 165, 177, 178, 179, 180, 182, 185, 198, 201, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238 69, 125, 126, 127, 128, 129, 130 187, 188, 189 107, 108, 109 171, 172, 173, 174, 175, 176 112, 118, 120, 146 146, 147, 148, 150, 151, 154, 155, 162 54, 64, 69 38, 141, 142 107, 108, 109, 110, 111 70, 71, 72, 75 37, 45, 46, 47, 48, 49, 51, 58, 63, 72, 98, 115, 116, 123, 145,

172, 176, 186, 218, 224, 241, 242, 245 molecular phylogenetic analysis 1 morphometric 70, 138, 141, 142, 172, 173 Mount Lawu 225, 226, 227, 228 Mount Merapi 86, 87, 88, 89, 91, 212, 212, 213, 215, 216 Mount Slamet 235, 236 natural regeneration 107, 108, 109, 110 ND3 gene 70, 71, 72, 73, 75 new record 9, 80, 81, 82, 85, 114, 136, 140, 207 Nusantara 112, 113, 114, 115, 116, 117, 118, 119, 120, 123, 197 Odontanthias unimaculatus 136, 137, 138, 139, 140 oil palm 58, 164, 182, 183, 184, 185, 186 orangutan density 164, 167, 169 orchid diversity 22, 24, 25, 225, 227, 228 orchid 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 130, 225, 226, 227, 228 Osteochilus hasselti 141, 142, 143, 144, 145 oxalate 17, 20, 45, 46, 47, 48, 49, 50, 51 parasitoids 76, 77, 78, 79, 80, 81, 82, 85 peat 119, 164, 166, 167, 168, 169, 170, 182, 183, 185, 186, 217 permanent plots 86, 218, 219, 222, 223 PFGE 12, 13, 14, 15 phosphate solubilization 17, 19, 21 pioneer 7, 55, 88, 110, 208, 212, 214, 215, 216, 220 plant establishment 86, 89, 91, 212 Ploceidae 70, 71, 72, 73, 74 Pongo pygmaeus wurmbii 164, 169 population 13, 15, 17, 18, 19, 20, 21, 22, 31, 35, 37, 38, 39, 52, 57, 59, 62, 64, 65, 67, 68, 69, 70, 71, 72, 76, 85, 93, 97, 98, 99, 103, 104, 105, 106, 107, 108, 110, 113, 117, 120, 127, 130, 131, 141, 142, 143, 144, 145, 161, 164, 165, 167, 169, 170, 171, 177, 178, 179, 180, 187, 188, 189, 190, 191, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 209, 210, 211, 224, 234, 241, 243, 244, 245, porang 45, 46, 47, 48, 50, 51 primary succession 86, 88, 89, 91, 212, 214, 215, 216, 217 17, 20, 21 Pseudomonas fluorescens RAPD 15, 60, 62, 63, 64, 65, 68, 69, 117, 122, 125, 127, 128, 129, 130, 191 rattan 178, 241, 242, 243, 244, 245 Red Sea 92, 93, 97, 98 remnant forest 218, 219, 220, 221, 222, 223 reproductive status 131, 132, 135 reptiles 38, 39, 40, 41, 44 Salmonella typhi 1, 2, 3, 4, 5, 6 Selaginella 86, 112, 113, 114, 115, 116, 117, 118, 119, 120, 1121, 122, 123, 124, 208, 209 sequential 38, 42, 44, 47, 52, 55, 57 Serranidae 136, 140

A-4 Serratia marcencens smartPLS soil bacteria soil

southern coast southern part strains Sulawesi

17 45, 46, 47, 51 198, 199 12, 16, 17, 18, 19, 20, 28, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 64, 69, 71, 88, 89, 91, 100, 107, 108, 109, 110, 111, 112, 115, 116, 118, 119, 120, 156, 171, 177, 178, 179, 181, 182, 183, 184, 185, 186, 188, 182, 198, 199, 200, 201, 202, 203, 204, 206, 207, 208, 209, 211, 215, 217, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239 34, 35, 36, 37 27, 38, 225, 227, 228 1, 2, 3, 4, 5, 6, 13, 15, 16, 17, 130, 192, 193 7, 9, 12, 14, 15, 28, 29, 30, 31, 32, 33, 59, 81, 112, 114, 116,

Sumatra

sustainability tailing deposition taxonomy termite community tree fern tree species

typhoid fever Verbenaceae Wilis Mountain

136, 137, 138, 139, 140, 141, 171, 172, 177, 178, 180, 241, 52, 53, 59, 60, 62, 76, 77, 80, 81, 82, 112, 114, 118, 125, 126, 127, 129, 131, 133, 141, 142, 204, 177, 182, 204, 205, 206, 207, 208, 209, 210, 211, 212, 238 28, 55, 56, 57, 110, 112, 113, 119, 120, 241, 144, 145 198, 199, 201 39, 136, 239 235, 236, 237, 238, 239 115, 204 25, 31, 57, 108, 165, 166, 167, 218, 219, 220, 222, 223, 225, 226, 228, 292, 231, 233 1, 6 31, 146, 147, 156, 158, 161, 162 22, 23, 25

A-5

List of Peer Reviewers Aamir Ali Joko Ridho Witono Agung Budiharjo Ahmad Dwi Setyawan Alan J. Lymbery Alison Styring Alka Grover Andre Pascal Koch Anil Kumar Gupta Anita S. Tjakradidjaja Ari Pitoyo Artini Pangastuti Bambang Hero Saharjo Barahima Abbas Bayu Ajie Bhoj Kumar Acharya Carolina MartĂ­nez Ruiz Charis Amarantini Charlie D. Heatubun Chuan, Chao Dai Diah Sulistiarini DĂśrte Goertz Dwi Murti Puspitaningtyas Edi Rudi Ender Makineci Evy Arida Faisal Anwar Ali Khan Fasheng Zou Fetrina Oktavia Freddy Pattiselanno Frederick H. Sheldon Gesine Bradacs Gilliah Dean Gonzalo J. Marquez Gratiana E. Wijayanti Gregory R. Goldsmith Guanjun Chen Gunanidhi Sahoo Gustavo Santoyo Hassan Sher Heri Dwi Putranto Hety Herawati Himmah Rustiami I. Usha Rao Intan Ahmad

University of Sargodha, Sargodha, Pakistan Center for Plant Conservation, Bogor Botanical Garden, Indonesian Institute of Science, Bogor, West Java, Indonesia Sebelas Maret University, Surakarta, Central Java, Indonesia Sebelas Maret University, Surakarta, Central Java, Indonesia Murdoch University, Murdoch, Australia The Evergreen State College, Olympia, Washington, USA Central Potato Research Institute, India Zoologisches Forschungsmuseum A. Koenig, denauerallee 160, 53113 Bonn, Germany Indian Institute of Technology, Kharagpur, West Bengal, India Bogor Agricultural University, Bogor, Indonesia Sebelas Maret University, Surakarta, Central Java, Indonesia Sebelas Maret University, Surakarta, Central Java, Indonesia Bogor Agricultural University, Bogor, West Java, Indonesia State University of Papua, Manokwari, West Papua, Indonesia Bali Botanic Garden, Indonesian Institute of Science, Tabanan, Bali, Indonesia Sikkim Government College, Tadong, Sikkim, India Universidad de Valladolid, Madrid, Spain Duta Wacana Christian University, Yogyakarta, Indonesia State University of Papua, Manokwari, Indonesia College of Life Science, Nanjing Normal University, Nanjing, PR China Research Center for Biology, Indonesia Institute of Science, Cibinong, Bogor, West Java, Indonesia University of Natural Resources and Applied Life Sciences (BOKU), Vienna, Ostereich Center for Plant Conservation, Bogor Botanic Garden, Bogor, West Java, Indonesia.

Syiah Kuala University, Banda Aceh, Aceh Darussalam, Indonesia Istanbul University, Istanbul, Turkey Research Center for Biology, Indonesian Institute of Science, Cibinong, Bogor, West Java, Indonesia Texas Tech University, Lubbock, TX, USA South China Institute of Endangered Animals, Guangzhou PR China Indonesian Rubber Research Institute, Palembang, Indonesia State University of Papua, Manokwari, West Papua, Indonesia LSU Museum of Natural Science, LA, USA University of Zurich, Zurich, Switzerland University of British Columbia, Vancouver, Canada Univercidad Nacional de La Plata (UNLP), La Plata, Argentina University of General Soedirman, Purwokerto, Central Java, Indonesia University of California Berkeley, Berkeley, California, USA Shandong University, Jinan, P.R. China North Orissa University, Baripada, Orissa, India Universidad Michoacana de San Nicolas de Hidalgo, Morelia, Michoacan, Mexico University of Swat, Pakistan University of Bengkulu, Bengkulu, Indonesia Center for International Forestry Research, Bogor, Indonesia Research Center for Biology, Indonesia Institute of Science, Cibinong, Bogor, West Java, Indonesia University of Delhi, Delhi, India Bandung Institute of Technology, Bandung, West Java, Indonesia.

A-6 Institute of the North Ecological Problems, Kola Science Centre, Russian Academy of Sciences, Murmansk Region, Russia Institute of the North Ecological Problems, Kola Science Centre, Russian Academy of Sciences, Galina Evdokimova Murmansk Region, Russia Mulawarman University, Samarinda, East Kalimantan, Indonesia Iwan Suyatna Makerere University, Kampala, Uganda John Robert Stephen Tabuti James Cook University, Townsville, QLD, Australia Joshua Eli Cinner University National of Colombia, Bogota, Colombia Juan Carlos Loaiza Usuga University of Bergen, Norway Kamal Prasat Acharya Leibniz Institute for Zoo and Wildlife Research, Berlin, Germany Katja Rex Egyptian National Research Centre, Dokki, Cairo, Egypt Khalid Ali Khalid Ahmed University of Ulm, Ulm, Germany Konstans Wells Research Center for Biology, Indonesia Institute of Science, Cibinong, Bogor, West Java, Indonesia Kusumadewi Sri Yulita University of Illinois, Urbana, IL, USA Leellen Solter Department of Phanerogamic Botany, Swedish Museum of Natural History, Stockholm, Sweden Livia Wanntorp Istituto per l'Ambiente Marino Costiero-CNR, Napoli, Italy Luciana Ferraro Islamic State University of Sunan Kalijaga, Yogyakarta, Indonesia M. Ja’far Luthfi University of Madras, Chennai , India M. Suresh Gandhi ICRAF Southeast Asia Regional Office, Bogor, West Java, Indonesia Made Hesti Lestari Tata SGB Amravati University, Amravati, India Mahendra Kumar Rai Nueva Vizcaya State University, Bayombong, The Philippines.

Marilyn S. Combalicer Lethbridge Research Centre, Agriculture and Agri-Food Canada, Alberta, Canada Mark S. Goettel Oregon State University, Corvallis, OR, USA Matthew G. Betts Lambung Mangkurat University, Banjarbaru, South Kalimantan, Indonesia Mochamad Arief Soendjoto FM University, Baleswar, Orissa, India Monali Goswami Kurukshetra University, Haryana, India.

Narender Singh Andalas University, Padang, West Sumatra, , Indonesia Novri Nelly Academy of Sciences of the Czech Republic, Trebon, Czech Republic Ondrej Mudrak RMIT University, Bundoora, Victoria, Australia Peter M. Smooker USDA/ARS Invasive Insect Biocontrol and Behavior Laboratory, Beltsville, MD, USA Phyllis A.W. Martin Indian Institute of Horticultural Research, Bangalore, India Pious Thomas Indian Forest Research Institute, Dehradun, India.

Prafulla Soni Prasit Wangpakapattanawong Chiang Mai University, Chiang Mai, Thailand General Soedirman University, Purwokerto, Indonesia Pudji Widodo Norwegian University of Life Sciences, Ås, Norway Rafael L. de Assis Missouri Botanical Garden, St. Louis, MO , USA, Rainer W. Bussmann Japan Agency for Marine-Earth Science and Technology (JAMSTEC), Tokyo, Japan Renata Szarek University of Greifswald, Greifswald, Germany René Dommain Research Center for Biology, Indonesia Institute of Science, Cibinong, Bogor, West Java, Indonesia Ristiyanti M. Marwoto University of Trieste, Trieste, Italy Roberto Rizzo Purwodadi Botanical Garden, Indonesian Institute of Science, Pasuruan, East Java, Indonesia Rony Irawanto University of New South Wales, Sydney, NSW, Australia Ruiting Lan Arag Biotech Pvt. Ltd., Nagpur, India.

Ruparao T. Gahukar Wilfrid Laurier University, Waterloo, Ontario, Canada Samantha M. Berdej Netherlands Centre for Biodiversity Naturalis, Leiden, The Netherlands Sancia E.T. van der Meij Sandra M. Carmello, Guerreiro State University of Campinas, Campinas, SP, Brazil Seoul National University, Seoul, Korea Sanha Kim Central Institute of Medicinal and Aromatic Plants (CIMAP-CSIR), Lucknow, India Sanjog T. Thul Tamil Nadu Agricultural University, Tamil Nadu, India Sankar Harish Pablo de Olavide University, Sevilla, Spain Santiago Martin, Bravo Tadulako University, Tondo, Palu, Central Sulawesi, Indonesia Shahabuddin US Food and Drug Administration, College Park, MD, USA Socrates Trujillo Purwodadi Botanic Garden, Indonesian Institute of Science, Pasuruan, Indonesia Sugeng Budiharta Irina V. Zenkova

A-7 Sugiyarto Supachitra Chadchawan Sutarno Sutomo Suwarno T. Alief Aththorick Taher Ghadirian Tati Suryati Syamsudin Thamasak Yeemin Vaclav Mahelka Xiuyun Zhao Yelda Ozden, Tokatli Yohanes Y. Rahawarin Yulianti Z.A. Muchlisin Zbynek Polesny Zulfahmi

Sebelas Maret University, Surakarta, Central Java, Indonesia Chulalongkorn University, Bangkok, Thailand Sebelas Maret University, Surakarta, Central Java, Indonesia Bali Botanic Garden, Indonesian Institute of Science, Tabanan, Bali, Indonesia University of Syiah Kuala, Banda Aceh, Aceh, Indonesia North Sumatra University, Medan, North Sumatra, Indonesia Plan for the Land Society, Tehran, Iran Bandung Institute of Technology, Bandung, Indonesia Ramkhamhaeng University, Bangkok, Thailand Academy of Sciences of the Czech Republic, Trebon, Czech Republic Huazhong Agricultural University, Wuhan, Hubei, PR China Gebze Institute of Technology, Kocaeli, Turkey State University of Papua, Manokwari, West Papua, Indonesia Research Institute for Forest Tree Seed Technology, Forest Research and Development Agency, Ministry of Forestry, Bogor, West Java, Indonesia Syiah Kuala University, Banda Aceh, Indonesia Czech University of Life Sciences, Prague, Czech Republic State Islamic University of Sultan Syarif Kasim Riau, Pekanbaru, Riau

A-8

Table of Contents Vol. 12, No. 1, Pp. 1-58, January 2011 GENETIC DIVERSTY Identification and characterization of Salmonella typhi isolates from Southwest Sumba District, East Nusa Tenggara based on 16S rRNA gene sequences CHARIS AMARANTINI, LANGKAH SEMBIRING, HARIPURNOMO KUSHADIWIJAYA, WIDYA ASMARA

1-6

Species diversity of Amorphophallus (Araceae) in Bali and Lombok with attention to genetic study in A. paeoniifolius (Dennst.) Nicolson AGUNG KURNIAWAN, I PUTU AGUS HENDRA WIBAWA, BAYU ADJIE

7-11

Pulsed Field Gel Electrophoresis (PFGE): a DNA finger printing technique to study the genetic diversity of blood disease bacterium of banana HADIWIYONO, JAKA WIDADA, SITI SUBANDIYAH, MARK FEGAN

12-16

ECOSYSTEM DIVERSTY Diversity and phosphate solubilization by bacteria isolated from Laki Island coastal ecosystem SRI WIDAWATI Epiphytic orchids and host trees diversity at Gunung Manyutan Forest Reserve, Wilis Mountain, Ponorogo, East Java NINA DWI YULIA, SUGENG BUDIHARTA Inventory and habitat study of orchids species in Lamedai Nature Reserve, Kolaka, Southeast Sulawesi DEWI AYU LESTARI, WIDJI SANTOSO Infection of Anisakis sp. larvae in some marine fishes from the southern coast of Kulon Progo, Yogyakarta EKO SETYOBUDI, SOEPARNO, SENNY HELMIATI Herpetofaunal community structure and habitat associations in Gunung Ciremai National Park, West Java, Indonesia AWAL RIYANTO A model of relationship between climate and soil factors related to oxalate content in porang (Amorphophallus muelleri Blume) corm SERAFINAH INDRIYANI, ENDANG ARISOESILANINGSIH, TATIK WARDIYATI, HERY PURNOBASUKI ETHNOBIOLOGY (CULTURAL DIVERSITY) Species identification and selection to develop agroforestry at Lake Toba Catchment Area (LTCA) NURHENI WIJAYANTO

17-21 22-27

28-33 34-37 38-44

45-51

52-58

Vol. 12, No. 2, Pp. 59-124, April 2011 GENETIC DIVERSTY Genetic variability in apomictic mangosteen (Garcinia mangostana) and its close relatives (Garcinia spp.) based on ISSR markers SOBIR, ROEDHY POERWANTO, EDY SANTOSA, SOALOON SINAGA, ELINA MANSYAH Genetic variation of Melia azedarach in community forests of West Java assessed by RAPD YULIANTI, ISKANDAR ZULKARNAEN SIREGAR, NURHENI WIJAYANTO, IGK TAPA DARMA, DIDA SYAMSUWIDA Polymorphic sequence in the ND3 region of Java endemic Ploceidae birds mitochondrial DNA R. SUSANTI SPECIES DIVERSTY Hymenopteran parasitoids associated with the banana, skipper Erionota thrax L. (Insecta: Lepidoptera, Hesperiidae) in Java, Indonesia ERNIWATI, ROSICHON UBAIDILLAH

59-63

64-69

70-75

76-85

A-9

ECOSYSTEM DIVERSTY Plant community establishment on the volcanic deposits following the 2006 nuées ardentes (pyroclastic flows) of Mount Merapi: diversity and floristic variation SUTOMO, RICHARD HOBBS, VIKI CRAMER Coral diversity indices along the Gulf of Aqaba and Ras Mohammed, Red Sea, Egypt MOHAMMED SHOKRY AHMED AMMAR Population analysis of the javan green peafowl (Pavo muticus muticus Linnaeus 1758) in Baluran and Alas Purwo National Parks, East Java JARWADI BUDI HERNOWO, HADI SUKARDI ALIKODRA, ANI MARDIASTUTI, CECEP KUSMANA Status and diversity of arbuscular mycorrhizal fungi and its role in natural regeneration on limestone mined spoils ANUJ KUMAR SINGH, JAMALUDDIN REVIEW Review: Recent status of Selaginella (Selaginellaceae) research in Nusantara AHMAD DWI SETYAWAN

86-91

92-98 99-106

107-111

112-124

Vol. 12, No. 3, Pp. 125-186, July 2011 GENETIC DIVERSTY Genetic variations of Lansium domesticum Corr. accessions from Java, Sumatra and Ceram based on Random Amplified Polymorphic DNA fingerprints KUSUMADEWI SRI YULITA A non, invasive identification of hormone metabolites, gonadal event and reproductive status of captive female tigers HERI DWI PUTRANTO SPECIES DIVERSTY First record of Odontanthias unimaculatus (Tanaka 1917) (Perciformes: Serranidae) from Indonesia TEGUH PERISTIWADY

125-130

131-135

136-140

Morphological divergences among three sympatric populations of Silver Sharkminnow (Cyprinidae: Osteochilus hasseltii C.V.) in West Sumatra DEWI IMELDA ROESMA, PUTRA SANTOSO

141-145

Diversity and useful products in some Verbenaceous member of Melghat and Amravati regions, Maharashtra, India SHUBHANGI NAGORAO INGOLE

146-163

ECOSYSTEM DIVERSTY Nest density as determinants for habitat utilizations of Bornean orangutan (Pongo pygmaeus wurmbii) in degraded forests of Gunung Palung National Park, West Kalimantan DIDIK PRASETYO, JITO SUGARDJITO Conservation of maleo bird (Macrocephalon maleo) through egg hatching modification and ex situ management YOHAN RUSIYANTONO, MOBIUS TANARI, MUHAMAD ILYAS MUMU Effect of land use change on ecosystem function of dung beetles: experimental evidence from Wallacea Region in Sulawesi, Indonesia SHAHABUDDIN Carbon baseline as limiting factor in managing environmental sound activities in peatland for reducing greenhouse gas emission BAMBANG HERO SAHARJO

164-170

171-176 177-181

182-186

Vol. 12, No. 4, Pp. 187-245, October 2011 GENETIC DIVERSTY Leaf endophytic fungi of chili (Capsicum annuum) and their role in the protection against Aphis gossypii (Homoptera: Aphididae) HENY HERNAWATI, SURYO WIYONO, SUGENG SANTOSO

187-191

A-10 Isolation and identification of an agar, liquefying marine bacterium and some properties of its extracellular agarases FATURRAHMAN, ANJA MERYANDINI, MUHAMMAD ZAIRIN JUNIOR, IMAN RUSMANA ECOSYSTEM DIVERSTY Soil microorganisms numbers in the tailing deposition ModADA areas of Freeport Indonesia, Timika, Papua IRNANDA AIKO FIFI DJUUNA, MARIA MASORA, PRATITA PURADYATMIKA

192-197

198-203

Inventorying of the tree fern Genus Cibotium of Sumatra: Ecology, population size and distribution in North Sumatra TITIEN NGATINEM PRAPTOSUWIRYO, DIDIT OKTA PRIBADI, DWI MURTI PUSPITANINGTYAS, SRI HARTINI

204-211

Species composition and interspecific association of plants in primary succession of Mount Merapi, Indonesia SUTOMO, DINI FARDILA, LILY SURAYYA EKA PUTRI

212-217

Establishing a long, term permanent plot in remnant forest of Cibodas Botanic Garden, West Java ZAENAL MUTAQIEN, MUSYAROFAH ZUHRI

218-224

Analysis of epiphytic orchid diversity and its host tree at three gradient of altitudes in Mount Lawu, Java NINA DWI YULIA, SUGENG BUDIHARTA, TITUT YULISTYARINI

225-228

Valuing quality of vegetation in recharge area of Seruk Spring, Pesanggrahan Valley, Batu City, East Java TITUT YULISTYARINI, SITI SOFIAH

229-234

Termites community as environmental bioindicators in highlands: a case study in eastern slopes of Mount Slamet, Central Java TEGUH PRIBADI, RIKA RAFFIUDIN, IDHAM SAKTI HARAHAP

235-240

ETHNOBIOLOGY Community, based sustainable rattan conservation: a case study in Lore Lindu National Park, Central Sulawesi HAMZARI

241-245

GUIDANCE FOR AUTHORS BIODIVERSITAS, the Journal of Biological Diversity publishes scientific articles, i.e. original research and review in all biodiversity aspects of plants, animals and microbes at the level of gene, species, and ecosystem.

Scientific feedback (short communication) is only received for manuscript, which criticize published article before. Manuscripts will be reviewed by managing editor and invited peer review according to their disciplines. The only articles written in English (U.S. English) are accepted for publication.

This journal periodically publishes in January, April, July, and October. In order to support reduction of global warming as a consequence of transportation vehicles emission and forest degradation for paper manufacturing, management of the journal prefer receiving manuscripts via e-mail rather than in hard copy. Manuscript and its communications can be addressed to the managing editor; better to forward to one of the communicating editor for accelerating evaluation. A letter of statement expressing that the author (s) is responsible for the original content of manuscript, the result of author(s)’s research and never been published must be attached.

Manuscript is typed at one side of white paper of A4 (210x297 mm2) size, in a single column, double space, 12-point Times New Roman font, with 2 cm distance step aside in all side. Smaller letter size and space can be applied in presenting table. Word processing program or additional software can be used, however, it must be PC compatible and Microsoft Word based.

Names of sub-species until phylum should be written in italic, except for italic sentence. Scientific name (genera, species, author), and cultivar or strain should be mentioned completely at the first time mentioning it, especially for taxonomic manuscripts. Name of genera can be shortened after first mentioning, except generating confusion. Name of author can be eliminated after first mentioning. For example, Rhizopus oryzae L. UICC 524, hereinafter can be written as R. oryzae UICC 524. Using trivial name should be avoided, otherwise generating confusion. Mentioning of scientific name completely can be repeated at Materials and Methods. Biochemical and chemical nomenclature should follow the order of IUPAC-IUB, while its translation to Indonesian-English refers to Glossarium Istilah AsingIndonesia (2006). For DNA sequence, it is better used Courier New font.

Symbols of standard chemical and abbreviation of chemistry name can be applied for common and clear used, for example, completely written butilic hydroxytoluene to be BHT hereinafter. Metric measurement use IS denomination, usage other system should follow the value of equivalent with the denomination of IS first mentioning. Abbreviation set of, like g, mg, mL, etc. do not follow by dot. Minus index (m-2, L-1, h-1) suggested to be used, except in things like “per-plant” or “per-plot”. Equation of mathematics does not always can be written down in one column with text, for that case can be written separately. Number one to ten are expressed with words, except if it relates to measurement, while values above them written in number, except in early sentence. Fraction should be expressed in decimal.

In text, it should be used “%” rather than “gratuity”. Avoid expressing idea with complicated sentence and verbiage, and used efficient and effective sentence. Manuscript of original research should be written in no more than 25 pages (including tables and picture), each page contain 700-800 word, or proportional with article in this publication number. Invited review articles will be accommodated.

Title of article should be written in compact, clear, and informative sentence preferably not more than 20 words. Name of author(s) should be completely written. Running title is about five words. Name and institution address should be also completely written with street name and number (location), zip code, telephone number, facsimile number, and e-mail address. Manuscript written by a group, author for correspondence along with address is required. First page of the manuscript is used for writing above information.

Abstract should not be more than 200 words, written in English.

Keywords is about five words, covering scientific and local name (if any), research theme, and special methods which used. Introduction is about 400600 words, covering background and aims of the research. Materials and Methods should emphasize on the procedures and data analysis. Results and Discussion should be written as a series of connecting sentences, however, for manuscript with long discussion should be divided into sub titles. Thorough discussion represents the causal effect mainly explains for why and how the results of the research were taken place, and do not only reexpress the mentioned results in the form of sentences. Concluding sentence should preferably be given at the end of the discussion. Acknowledgments are expressed in a brief.

Figures and Tables of maximum of three pages should be clearly presented. Title of a picture is written down below the picture, while title of a table is written in the above the table. Colored picture and photo can be accepted if information in manuscript can lose without those images. Photos

and pictures are preferably presented in a digital file. JPEG format should be sent in the final (accepted) article. Author could consign any picture or photo for front cover, although it does not print in the manuscript. There is no appendix, all data or data analysis are incorporated into Results and Discussions. For broad data, it can be displayed in website as Supplement.

Citation in manuscript is written in “name and year” system; and is arranged from oldest to newest and from A to Z. The sentence sourced from many authors, should be structured based on the year of recently. In citing an article written by two authors, both of them should be mentioned, however, for three and more authors only the family (last) name of the first author is mentioned followed by et al., for example: Saharjo and Nurhayati (2006) or (Boonkerd 2003a, b, c; Sugiyarto 2004; El-Bana and Nijs 2005; Balagadde et al. 2008; Webb et al. 2008). Extent citation as shown with word “cit” should be avoided, and suggested to refer an original reference.

APA style in double space is used in the journal reference as follow: Journal: Carranza S, Arnold EN (2006) Systematics, biogeography and evolution of Hemidactylus geckos (Reptilia: Gekkonidae) elucidated using mitochondrial DNA sequences. Mol Phylogenet Evol 38: 531-545.

Saharjo BH, Nurhayati AD (2006) Domination and composition structure change at hemic peat natural regeneration following burning; a case study in Pelalawan, Riau Province. Biodiversitas 7: 154-158.

Book: Rai MK, Carpinella C (2006) Naturally occurring bioactive compounds.

Elsevier, Amsterdam.

Chapter in book: Webb CO, Cannon CH, Davies SJ (2008) Ecological organization, biogeography, and the phylogenetic structure of rainforest tree communities. In: Carson W, Schnitzer S (eds) Tropical forest community ecology. Wiley-Blackwell, New York.

Abstract: Assaeed AM (2007) Seed production and dispersal of Rhazya stricta. 50th annual symposium of the International Association for Vegetation Science, Swansea, UK, 23-27 July 2007.

Proceeding: Alikodra HS (2000) Biodiversity for development of local autonomous government. In: Setyawan AD, Sutarno (eds) Toward mount Lawu national park; proceeding of national seminary and workshop on biodiversity conservation to protect and save germplasm in Java island.

Sebelas Maret University, Surakarta, 17-20 July 2000. [Indonesian] Thesis, Dissertation: Sugiyarto (2004) Soil macro-invertebrates diversity and inter-cropping plants productivity in agroforestry system based on sengon. [Dissertation].

Brawijaya University, Malang. [Indonesian] Information from internet: Balagadde FK, Song H, Ozaki J, Collins CH, Barnet M, Arnold FH, Quake SR, You L (2008) A synthetic Escherichia coli predator-prey ecosystem.

Mol Syst Biol 4: 187. www.molecularsystemsbiology.com Publication manuscript “in press” can be cited and mentioned in reference (bibliography); “personal communications” can be cited, but cannot be mentioned in reference. Research which not be published or “submitted” cannot be cited.

Some annotation. Manuscript typed without sign link (-) (except repeated word in Indonesian). Usage of letter “l” (el) to “1” (one) or “O” (oh) to “0” (null) should be avoided. Symbols of α, β, χ, etc. included through facility of insert, non altering letter type. No space between words and punctuation mark.

Progress of manuscript. Notification of manuscript whether it is accepted or refused will be notified in about three months since the manuscript received. Manuscript is refused if the content does not in line with the journal mission, low quality, inappropriate format, complicated language style, dishonesty of research authenticity, or no answer of correspondence in a certain period. Author or first authors at a group manuscript will get one original copy of journal containing manuscript submitted not more than a month after publication. Offprint or reprint is only available with special request.

NOTE: Author(s) agree to transfer copy right of published paper to BIODIVERSITAS, Journal of Biological Diversity. Authors shall no longer be allowed to publish manuscript completely without publisher permission.

Authors or others allowed multiplying article in this journal as long as not for commercial purposes. For the new invention, authors suggested to manage its patent before publishing in this journal.

NOTIFICATION: All communications are strongly recommended to be undertaken through email.

ISSN: 1412-033X (printed edition) ISSN: 2085-4722 (electronic)

GENETIC DIVERSTY Leaf endophytic fungi of chili (Capsicum annuum) and their role in the protection against Aphis gossypii (Homoptera: Aphididae) HENY HERNAWATI, SURYO WIYONO, SUGENG SANTOSO Isolation and identification of an agar-liquefying marine bacterium and some properties of its extracellular agarases FATURRAHMAN, ANJA MERYANDINI, MUHAMMAD ZAIRIN JUNIOR, IMAN RUSMANA ECOSYSTEM DIVERSTY Soil microorganisms numbers in the tailing deposition ModADA areas of Freeport Indonesia, Timika, Papua IRNANDA AIKO FIFI DJUUNA, MARIA MASORA, PRATITA PURADYATMIKA Inventorying of the tree fern Genus Cibotium of Sumatra: Ecology, population size and distribution in North Sumatra TITIEN NGATINEM PRAPTOSUWIRYO, DIDIT OKTA PRIBADI, DWI MURTI PUSPITANINGTYAS, SRI HARTINI Species composition and interspecific association of plants in primary succession of Mount Merapi, Indonesia SUTOMO, DINI FARDILA, LILY SURAYYA EKA PUTRI Establishing a long-term permanent plot in remnant forest of Cibodas Botanic Garden, West Java ZAENAL MUTAQIEN, MUSYAROFAH ZUHRI Analysis of epiphytic orchid diversity and its host tree at three gradient of altitudes in Mount Lawu, Java NINA DWI YULIA, SUGENG BUDIHARTA, TITUT YULISTYARINI Valuing quality of vegetation in recharge area of Seruk Spring, Pesanggrahan Valley, Batu City, East Java TITUT YULISTYARINI, SITI SOFIAH Termites community as environmental bioindicators in highlands: a case study in eastern slopes of Mount Slamet, Central Java TEGUH PRIBADI, RIKA RAFFIUDIN, IDHAM SAKTI HARAHAP ETHNOBIOLOGY Community-based sustainable rattan conservation: a case study in Lore Lindu National Park, Central Sulawesi HAMZARI

187-191

192-197

198-203

204-211

212-217

218-224

225-228

229-234

235-240

241-245

Front cover: Cibotium barometz (PHOTO: TITIEN NGATINEM PRAPTOSUWIRYO)

Published four times in one year

PRINTED IN INDONESIA ISSN: 1412-033X (printed)

ISSN: 2085-4722 (electronic)