Biodiversitas vol. 11, no. 2, April 2010 by Biodiversitas Unsjournals

ISSN: 1412-033X (printed edition) ISSN: 2085-4722 (electronic)

Journal of Biological Diversity V o l u m e

1 1

–

N u m b e r

–

J a n u a r y

2 0 1 0

FIRST PUBLISHED: 2000

ISSN: 1412-033X (printed edition) 2085-4722 (electronic)

EDITORIAL BOARD (COMMUNICATING EDITORS): Abdel Fattah N.A. Rabou (Palestine), Dato A. Latiff Mohamad (Malaysia), Alan J. Lymbery (Australia), Ali Saad Mohamed (Sudan), Bambang H. Saharjo (Indonesia), Charles H. Cannon Jr. (USA), Edi Rudi (Indonesia), Guofan Shao (USA), Hassan Poorbabaei (Iran), Hwan Su Yoon (USA), John Morgan (Australia), Joko R. Witono (Indonesia), Katsuhiro Kondo (Japan), Mahendra K. Rai (India), María La Torre Cuadros (Peru), Mochamad A. Soendjoto (Indonesia), Peter Green (Australia), Salvador Carranza (Spain), Shahabuddin (Indonesia), Sonia Malik (Brazil), Sugiyarto (Indonesia), Thaweesakdi Boonkerd (Thailand)

EDITOR-IN-CHIEF: Sutarno

EDITORIAL MEMBERS: English Literary Editor: I Made Sudiana (sudianai@yahoo.com) Technical Editor & Banking: Solichatun (solichatun_s@yahoo.com) Distribution & Marketing: Rita Rakhmawati (oktia@yahoo.com) Webmaster: Ari Pitoyo (aripitoyo@yahoo.com)

MANAGING EDITORS: Ahmad Dwi Setyawan (unsjournals@gmail.com)

PUBLISHER: Department of Biology, Faculty of Mathematics and Natural Sciences, Sebelas Maret University, Surakarta and The Society for Indonesian Biodiversity

ADDRESS: Jl. Ir. Sutami 36A Surakarta 57126. Tel. +62-271-7994097, Tel. & Fax.: +62-271-663375, Email: unsjournals@yahoo.com

BANKING: Solichatun, BNI KC Sebelas Maret, Acc. No. 0033691646

ONLINE: www.unsjournals.com

ACCREDITED BY DECREE OF THE DIRECTORATE GENERAL OF HIGHER EDUCATION, THE MINISTRY OF NATIONAL EDUCATION, REPUBLIC OF INDONESIA No. 65a/DIKTI/Kep/2008 (valid until October 2011)

EXPERTATION AND CORRESPONDING EMAIL OF THE COMMUNICATING EDITORS: GENETIC DIVERSITY: Alan J. Lymbery (a.lymbery@murdoch.edu.au), Hwan Su Yoon (hsyoon@bigelow.org), Mahendra K. Rai (pmkrai@hotmail.com), Salvador Carranza (salvicarranza@gmail.com), Sonia Malik (sonia.unicamp@gmail.com). SPECIES DIVERSITY: Dato A. Latiff Mohamad (latiff@ukm.my), Joko R. Witono (jrwitono@yahoo.com), Katsuhiro Kondo (k3kondo@nodai.ac.jp), Thaweesakdi Boonkerd (Thaweesakdi.B@chula.ac.th). ECOSYSTEM DIVERSITY: Abdel Fattah N.A. Rabou (arabou@iugaza.edu), Ali Saad Mohamed (alisaad48@yahoo.com), Bambang H. Saharjo (bhsaharjo@gmail.com), Charles H. Cannon Jr. (chuck@xtbg.ac.cn), Edi Rudi (edirudi@yahoo.com), Guofan Shao (shao@purdue.edu), Hassan Poorbabaei (hassan_pourbabaei@yahoo.com), John Morgan (morgan@latrobe.edu.au), Mochamad A. Soendjoto (asoendjoto@telkom.net), Peter Green (p.green@latrobe.edu.au), Shahabuddin (shahabsaleh@gmail.com), Sugiyarto (sugiyarto_ys@yahoo.com). ETHNOBIOLOGY: María La Torre Cuadros (angeleslatorre@lamolina.edu.pe).

B I O D I V E R S IT A S Volume 11, Number 2, April 2010 Pages: 55-58

ISSN: 1412-033X (printed edition) ISSN: 2085-4722 (electronic) DOI: 10.13057/biodiv/d110201

Microsatellite DNA polymorphisms for colony management of longtailed macaques (Macaca fascicularis) population on the Tinjil Island DYAH PERWITASARI-FARAJALLAH1,2,♥, RANDALL C. KYES1,3, ENTANG ISKANDAR1 1

Primate Research Center, Bogor Agricultural University (IPB), Jalan Lodaya II/5, Bogor 16151, West Java, Indonesia, Tel./Fax. +62-251-8320417/ 8360712, e-mail: witafar@ipb.ac.id; witafar@yahoo.com 2 Department of Biology, Faculty of Mathematics and Natural Sciences, Bogor Agricultural University (IPB), Bogor 16680, West Java, Indonesia 3 Department of Psychology, Center for Global Field Study and Washington National Primate Research Center, University of Washington, Seattle, Washington 98195-7330, USA Manuscript received: 26 February 2009. Revision accepted: 17 July 2009.

ABSTRACT Perwitasari-Farajallah D, Kyes RC, Iskandar E (2010) Microsatellite DNA polymorphisms for colony management of long-tailed macaques (Macaca fascicularis) population on the Tinjil Island. Biodiversitas 11: 55-58. Polymorphic genetic markers are the basic requirement for studies on population and conservation genetics of non-human primates. In this paper, we screened microsatellites for their polymorphism and gene typing of DNA samples from blood of wild long-tailed macaques (Macaca fascicularis) from Tinjil Island population. Among the three primer sets tested, two are polymorphic. They were D1S548 and D3S1768. Average observed heterozygosity (Ĥ) within populations ranged between 0.264-0.555. D1S1768 locus was highly polymorphic and 24 alleles were detected among two loci. Estimation of genetic variability for the Tinjil population (Ĥ) was 0.485. The results obtained provide further insight into the long-term viability of the population and help in creating genetic management of both captive and natural habitat breeding colonies of primates. Key words: microsatellite, variations, social groups, long-tailed macaques, Macaca fascicularis.

INTRODUCTION Microsatellite sequences are valuable genetic markers due to their dense distribution in the genome, great variation, co-dominant inheritance and easy genotyping. In recent years, they have been extensively used in parentage testing, linkage analyses, population genetics and other genetic studies (Goldstein and Pollock 1997). They are very useful to analyze the degree and pattern of genetic variability within and between populations. Their variation is mainly explained by factors such as genetic drift, gene flow and mutation, since they are generally considered non-selective markers (Pérez-Lezaun et al. 1997). Although they show some limitations in the analyses of phylogenetically distant organisms, due to their irregular mutation processes involving range constraints and asymmetries (Nauta and Weissing 1996), they have proven very useful in intra-species population studies. At present, many PCR based primers designed for one species are applicable to closely related species. For nonhuman primates in particular, cross species amplification has benefited greatly by the human genome project that cloned far more microsatellite in human than in any other living organisms (Morin et al. 1997; Nurnberg et al. 1998). One can assign sizes to tetranucleotide alleles more reliably than dinucleotide alleles using a variety of instruments. To

accomplish maximal genetic information at the lowest possible costs, the loci included on the test should also exhibit high estimates of gene diversity. These markers also enable one to make unique genetic characteristics. Tinjil Island is located off the south coast of western Java (Banten Province), Indonesia. The island, approximately 600 ha in size, was established as a natural habitat breeding facility (NHBF) for simian retrovirus (SRV)-free longtailed macaques, Macaca fascicularis (Kyes 1993). Between 1988 and 1994, 520 adult macaques (from sites in West Java and South Sumatra; 58 ♂ and 462 ♀) were released onto the island to establish a free-ranging breeding population (Kyes et al. 1998). Over the past few years, an additional 83 macaques (3 ♂ and 80 ♀) have been released to introduce new genetic stock. In 2007 survey data indicated a population of approximately 2000 individuals on the island. The Primate Research Center at Bogor Agricultural University has maintained a long-term study of the socio-ecology and serology of the Tinjil macaques. The present study aimed to generate important baseline information on microsatellite DNAs for genetic management of both captive and natural habitat breeding colonies of primates. We hope to contribute to the development of a standardized genetic management strategy for breeding colonies using well-characterized microsatellite markers.

B I O D I V E R S IT A S

11 (2): 55-58, April 2010

MATERIALS AND METHODS During 2005 a total 55 blood samples were collected from long-tailed macaques, Macaca fascicularis, in seven different social groups on Tinjil Island, Indonesia namely Buntung (n=6), Jambul (n=13), Jebag (n=4), Mata Beruk (n=6), Ranca (n=7), Sipit (n=13), and Topeng (n=6). Genomic DNA was extracted from buffy coat using the modified method of Kan et al. (1977). Amplification of microsatellite The 55 macaque samples were screened for each of the three tetranucleotide repeats. All these loci are located on different chromosomes. The loci were selected based on the results of a preliminary study on long-tailed and pigtailed macaques (Perwitasari-Farajallah et al. 2004, Perwitasari-Farajallah 2007) and research on rhesus macaques, M. mulatta (Smith et al. 2000). PCR amplification of three human microsatellite loci was carried out in 12.5 μL volumes with a reaction mix containing 25 mM MgCl2, 0.83 U Taq polymerase and its buffer (Promega), 2.5 mM dNTP, and 25pM of each forward and reverse primers (Table 1). Amplifications were performed in a GeneAmp PCR System 9600 thermocycler (Applied Biosystems) using the following cycling parameters: 30 cycles of 40 s denaturation at 94oC, 40-60s primer annealing at 48-57oC, and 5 min final extension at 72oC. All PCR products were separated on a 5% polyacrylamide gel and silver-stained following the technique described by Tegelström (1986). Allele sizes were determined using DNA size standard of 20 bp ladder (BioRad). Data analyses Allele frequencies were calculated by direct count. The amount of variation was measured by average heterozygosity (Ho: observed heterozygosity). Estimates of gene diversity were obtained according to Nei (1987) equation as follows:

Ĥ = 1-

m Σ Xi 2 i=1

Xi is the frequency of the i-th allele, m is the number of alleles and average proportion of heterozygosity (Ĥ) is the average over all loci.

Relative proportion of gene diversity between social groups (DST), within social groups (HST), and total gene diversity (HT) were calculated using Hartl and Clark (1997) equations. Genetic distance (D) was estimated by applying the equation of Nei (1987).

RESULTS AND DISCUSSION We were able to reliably amplify DNA from all 55 samples. Of three loci screened, two loci revealed polymorphisms. They were D1S548 and D3S1768. D3S1768 locus was highly polymorphic and 24 alleles were detected. D1S548 and D3S1768 were found to be polymorphic in rhesus macaques, M. mulatta (Kanthaswamy et al. 2006). Additionally the results obtained by Chu et al. (1999) in Taiwanese macaques, M. cyclopis, Nurnberg et al. (1998) in rhesus macaques and Goossens et al. (2000) in chimpanzees, Pan troglodytes troglodytes demonstrated that D1S548 locus was polymorphic. The present study indicated that D2S1777 was monomorphic as observed in our previous study (Perwitasari-Farajallah et al. 2004). In contrast PerwitasariFarajallah (2007) and Ely et al. (1998) demonstrated that this locus was polymorphic in pigtailed macaques (M. nemestrina) and chimpanzees (P. troglodytes troglodytes) respectively. The present results indicate that these two loci are useful for assessing genetic variability in longtailed macaques. Overall average heterozigosity within social groups ranged between 0.26 for Topeng to 0.56 for Sipit (Table 2). An estimate of genetic variability (Ĥ) for the Tinjil population was 0.485. In comparison with previous studies in long-tailed and pig-tailed macaques using D1S548, D2S1777, D3S1768, and D5S820 loci with average heterozygosities (Ĥ) 0.5796 and 0.6141, respectively (Perwitasari-Farajallah et al. 2004; Perwitasari-Farajallah 2007), the present study revealed slightly low genetic variability. The data however suggest high genetic diversity if the Topeng social group is excluded from the analyses. In fact, Topeng social group could be classified as an outlier, at present however we have no detail information including behavior observation to explain the low genetic diversity of Topeng social group. Additionally protein analyses using three protein loci transferrin (Tf), thyroxine binding pre-albumin (TBPA) and albumin (Alb) performed in the same group revealed an average heterozygosity (Ĥ) of 0.23 (Perwitasari-Farajallah,

Table 1. Description of chromosomal location, GenBank Accessions Numbers, and sequences of each primer

D1S548

M. mulatta chromosome 1

GenBank acession number GDB: 228890

Repeat motif tetra

D2S1777

GDB: 693873

tetra

D3S1768

GDB: 228929

tetra

Locus

Note: F: forward; R: reverse

Primer sequences (5’ 3’) F: GAACTCATTGGCAAAAGGAA R: GCCTCTTTGTTGCAGTGATT F: TCCCCAAGTAAAGCATTGAG R: GTATGTAGGTAGGGAGGCAGG F: GGTTGCTGCCAAAGATTAGA R: CACTGTGATTTGCTGTTGGA

Size range (bp) in human 212 242 197

PERWITASARI-FARAJALLAH et al. – Microsatellite variations in long-tailed macaques

unpublished data). Although only two loci showed polymorphisms (Tf and TBPA), it has been showed other in macaque population genetics studies that Tf is the most polymorphic locus (Kondo et al. 1993; Kawamoto et al. 1984, 2008; Perwitasari-Farajallah et al. 1999, 2001), and initially it can be applicable for assessment of allelic diversity.

Genetic differentiation between adjacent groups estimated by Nei’s standard genetic distance in general was less than those between non-adjacent groups (Perwitasari-Farajallah et al. 1999).

Table 2. Estimates of genetic variability within groups

Microsatellite loci which were cloned from the human genome can provide informative genetic markers for studying population structure and genetic differentiation of long-tailed macaques, Macaca fascicularis. D1S548 and D3S1768 were polymorphic loci, and can be applied for estimating allelic diversity.

Social group 1. 2. 3. 4. 5. 6. 7.

Buntung Jambul Jebag Mata Beruk Ranca Sipit Topeng

Ĥ + SE

6 13 4 6 7 13 6

0.54 + 0.27 0.55 + 0.28 0.50 + 0.25 0.53 + 0.26 0.46 + 0.23 0.56 + 0.28 0.26 + 0.13

The total gene diversity (HT = 0.583) of the seven social groups can be distributed into intra- (HS = 0.485) and inter(DST=HT-HS = 0.098) social groups gene diversity. GST (=DST/HT) was 0.167, it represented that 17% of the total gene diversity was attributed to differences between social groups. This result suggested that low differentiation between social groups may result from frequent gene flow by adult male migration among neighboring social groups (Koyama et al. 1981; de Ruiter and Geffen 1998; Perwitasari-Farajallah et al. 1999). Males leave their natal group typically before sexual maturity and may change social groups many times during their lifetime (de Ruiter and Geffen 1998). Changing social groups is associated with high variation in male reproductive success (de Ruiter et al. 1992; Keane et al. 1997) and even mortality (Dittus 1975). This behavior serves as a guard against inbreeding and homogenizes the distribution of genetic variation in the nuclear genome within a deme (Melnick and Hoelzer 1992, 1996). Upon the obtained results further studies were essential due to lack of samples on the present study. The value of the absolute amount of genetic diversity between social groups was calculated by Nei’s standard genetic distance (Nei 1987) as given in Table 3. Table 3. Nei' genetic distance (D) and genetic similarity (I) between social groups 1 2 3 4 5 6 7 1 0.187 0.258 0.196 0.151 0.104 0.167 2 0.829 0.219 0.226 0.183 0.085 0.485 3 0.773 0.803 0.291 0.259 0.211 0.558 4 0.822 0.798 0.748 0.287 0.107 0.332 5 0.860 0.832 0.771 0.750 0.172 0.345 6 0.901 0.919 0.810 0.899 0.841 0.397 7 0.846 0.616 0.572 0.718 0.708 0.672 Note: above diagonal: Nei’s genetic distance (D); below diagonal: genetic similarity; 1-7: social groups as indicated in Table 3.

The largest distance was found between Jebag and Topeng (average of D = 0.558), while Jambul and Sipit revealed the smallest genetic distance (average D = 0.085).

CONCLUSIONS

ACKNOWLEDGMENTS We are grateful to the staff of the laboratory of Biology and Reproduction, Primate Research Center, Bogor Agricultural University for laboratory assistance, and the staff of the Division of Animal Biosystematics and Ecology, Department of Biology, Bogor Agricultural University for valuable advices. We would like to sincerely thank to three anonymous reviewers who provided helpful comments on the manuscript.

REFERENCES Chu J, Wu H, Yang H, Takenaka O, Lin Y (1999) Polymorphic microsatellite loci and low-invasive DNA sampling in Macaca cyclopis. Primates 40: 573-580. de Ruiter JR, Geffen E (1998) Relatedness of matrilines, dispersing males and social groups in long-tailed macaques (Macaca fascicularis). Proc R Soc Lond B (Bio) 265: 79-87. de Ruiter JR, Scheffrahn W, Trommlen GJJM, Uitterlinden AG, Martin RD, van Hooff JARAM (1992) Male social rank and reproductive success in wild long-tailed macaques. In: Martin RD, Dixson AF, Wickings EJ (eds) Paternity in primate: genetic tests and theories. Karger, Basel. Dittus WPJ (1975) Population dynamics of the toque macaque, Macaca sinica. In: Tuttle RH (ed) Socioecology and psychology of primates. Mounton, The Hague. Ely JJ, Gonzales DL, Reeves-Daniel A, Stone WH (1998) Individual identification and paternity determination in chimpanzees (Pan troglodytes) using human short tandem repeat (STR) markers. Int J Primatol 19: 255-271. Goldstein DB, Pollock DD (1997) Launching microsatellites: a review of mutation processes and methods of phylogenetic inferences. J. Hered 88: 335-342. Goossens B, Latour S, Vidal C, Jamart A, Ancrenaz M, Bruford MW (2000) Twenty new microsatellite loci for use with hair and faecal samples in the chimpanzee (Pan troglodytes troglodytes). Folia Primatol 71: 177-180. Hartl DL, Clark AG (1997) Principles of population genetics. Sinauer Associates, Massachusetts. Kan YW, Dozy AM, Trecartin R, Todd D (1977) Identification of a nondeletion defect in -Thalassemia. N Engl J Med 297: 1081-1084. Kanthaswamy S, von Dollen A, Kurushima JD, Alminas O, Rogers J, Ferguson B, Lerche NW, Allen PC, Smith DG (2006) Microsatellite markers for standardized genetic management of captive colonies of rhesus macaques (Macaca mulatta). Am J Primatol 68: 73-95. Kawamoto Y, Kawamoto S, Matsubayashi K, Nozawa K, Watanabe T, Stanley MA, Perwitasari-Farajallah D (2008) Genetic diversity of longtail macaques (Macaca fascicularis) on the island of Mauritius: an assessment of nuclear and mitochondrial DNA polymorphisms. J Med Primatol 37: 45-54.

B I O D I V E R S IT A S

Kawamoto Y, Ischak TbM, Supriatna J (1984) Genetic variations within and between troops of the crab-eating macaques (Macaca fascicularis) on Sumatra, Java, Bali, Lombok, and Sumbawa, Indonesia. Primates 25: 131-139. Keane B, Dittus WPJ, Melnick DJ (1997) Paternigy assessment in wild groups of toque macaques Macaca sinica at Polonnaruwa, Sri Lanka using molecular markers. Mol Ecol 6: 267-282. Kondo M, Kawamoto Y, Nozawa K, Matsubayashi K, Watanabe T, Griffiths O, Stanley MA (1993) Population genetics of crab-eating macaques (Macaca fascicularis) on the island of Mauritius. Am J Primatol 29: 167-182. Koyama NA, Asuan A, Natsir N (1981) Socioecological study of crabeating monkeys in Indonesia. Kyoto University Overseas Research Report of Studies on Indonesian Macaque 1: 1-10. Kyes RC (1993) Survey of the long-tailed macaques introduced into Tinjil island, Indonesia. Am J Primatol 31: 77-83. Kyes RC, Sajuthi D, Iskandar E, Iskandriati D, Pamungkas J, Crockett CM (1998) Management of a natural habitat breeding colony of longtailed macaques. Trop Biodiv 5: 127-137. Melnick DJ, Hoelzer GA (1992) Differences in male and female macaque dispersal lead to contrasting distributions of nuclear and mitochondrial DNA variation. Int J Primatol 13: 379-393. Melnick DJ, Hoelzer GA (1996) Genetic consequences of macaque social organization and behaviours. In: Fa JE, Lindburg DG (eds) Evolution and ecology of macaque societies. Cambridge University Press, Cambridge. Morin P, Kanthaswamy S, Smith DG (1997) Simple sequence repeat (SSR) polymorphisms for colony management and population genetics in rhesus macaques (Macaca mulatta). Am J Primatol 42: 199-213. Nauta MJ, Weissing F (1996) Constraints on allele size at microsatellite loci: implications for genetic differentiation. Genetics 133: 10211032.

11 (2): 55-58, April 2010 Nei M (1987) Molecular evolutionary genetics. Columbia University Press, New York. Nurnberg P, Sauermann U, Kayser M, Lanfer C, Manz E, Widdig A, Berard J, Bercovitch FB, Kessler M, Schmidtke J, Krawczak M (1998) Paternity assessment in rhesus macaques (Macaca mulatta): multilocus DNA fingerprinting and PCR marker typing. Am J Primatol 44: 1-18. PĂŠrez-Lezaun A, FE Calafell, D Mateu, D Coma, R Ruiz-Pacheco, J Bertranpetit (1997) Allele frequencies for 20 microsatellite in a worldwide population survey. Hum Hered 47: 189-196. Perwitasari-Farajallah D (2007) Human short tandem repeats (STRs) markers for paternity testing in colony of pig-tailed macaques (Macaca nemestrina). Hayati 14: 39-43. Perwitasari-Farajallah D, Farajallah A, Kyes RC, Sajuthi D, Iskandriati D, Iskandar E (2004) Genetic variability in a population of long-tailed macaques (Macaca fascicularis) introduced onto Tinjil Island, Indonesia: Microsatellite loci variations. Hayati 11: 21-24. Perwitasari-Farajallah D, Kawamoto Y, Suryobroto B (1999) Variation in blood proteins and mitochondrial DNA within and between local populations of longtail macaques, Macaca fascicularis, on the island of Java, Indonesia. Primates 40: 581-595. Perwitasari-Farajallah D, Kawamoto Y, Kyes RC, Lelana RPA, Sajuthi D (2001) Genetic characterizationof long-tailed macaques (Macaca fascicularis) on Tabuan Island, Indonesia. Primates 42: 141-152. Smith DG, Kanthaswamy S, Viray J, Cody L (2000) Additional highly polymorphic microsatellite (STR) loci for estimating kinship in rhesus macaque (Macaca mulatta). Am J Primatol 50: 1-7. TegelstrĂśm H (1986) Mitochondrial DNA in natural populations: An improved routine for the screening of genetic variation based on sensitive silver staining. Electrophoresis 7: 226-229.

B I O D I V E R S IT A S Volume 11, Number 2, April 2010 Pages: 59-64

ISSN: 1412-033X (printed edition) ISSN: 2085-4722 (electronic) DOI: 10.13057/biodiv/d110202

Examination of uropathogenic Escherichia coli strains conferring large plasmids SUHARTONO♥ Department of Biology, Faculty of Mathematics and Natural Science, Syiah Kuala University (UNSYIAH), Darussalam, Banda Aceh 23111, Aceh, Indonesia, Tel. +62-0651-7428212, Fax. +62-0651-7552291, e-mail: suhartono@unsyiah.ac.id

Manuscript received: 2 June 2009. Revision accepted: 9 July 2009.

ABSTRACT Suhartono (2010) Examination of uropathogenic Escherichia coli strains conferring large plasmids. Biodiversitas 11: 59-64. Of major uropathogens, Escherichia coli has been widely known as a main pathogen of UTIs globally and has considerable medical and financial consequences. A strain of UPEC, namely E. coli ST131, confers a large plasmid encoding cephalosporinases (class C β-lactamase) or AmpC that may be disseminated through horizontal transfer among bacterial populations. Therefore, it is worth examining such large plasmids by isolating, purifying, and digesting the plasmid with restriction enzymes. The examination of the large plasmids was conducted by isolating plasmid DNA visualized by agarose gel electrophoresis as well as by PFGE. The relationship of plasmids among isolates was carried out by HpaI restriction enzyme digestion. Of 36 isolates of E. coli ST 131, eight isolates possessed large plasmids, namely isolates 3, 9, 10, 12, 17, 18, 26 and 30 with the largest molecular size confirmed by agarose gel electrophoresis and PFGE was ~42kb and ~118kb respectively. Restriction enzyme analysis revealed that isolates 9, 10, 12, 17 and 18 have the common restriction patterns and those isolates might be closely related. Key words: large plasmids, uropathogenic E. coli, electrophoresis, RE, PFGE.

INTRODUCTION Urinary tract infections (UTI), the most common infectious diseases triggering significant medical and financial implications, are defined as the presence of microbial pathogens within urinary tracts identified by a wide spectrum of symptoms ranging from mild irritative voiding to bacterimia, sepsis, or even death (Foxman 2002). Many factors are attributed to these infections such as bacterial invasion, anatomical and functional abnormalities of urinary tracts and host immune status. In terms of bacterial invasion, a various uropathogens have been identified as the common causative agents of these infections, namely Escherichia coli, Klebsiella sp., Proteus, Pseudomonas, Staphylococcus saprophyticus and Enterococcus (Barnett and Stephens 1997). Of these uropathogenic bacteria, Escherichia coli is the most widely known accounting for more than half of UTI incidences (Kucheria 2005). These bacteria possess not only virulence factors but also antibiotic resistance in promoting and persisting colonization and infection of the urinary tract (Oelschlaeger 2002; Rijavec et al. 2006). One of the antibiotic resistant features of E. coli that should be concerned is cephalosporinase, a class C lactamase enzyme that hydrolyses cephalosporins, as a result of increasing use of ceftazidime and other thirdgeneration cephalosporins. This enzyme is encoded by ampC genes located on the chromosomes as well as plasmids (Philippon et al. 2002). The location of these

genes in the plasmid potentially allows dissemination among different species by horizontal transfer (Su et al. 2008). A clone of antibiotic uropathogenic E. coli in the northwest of England that its entire genome sequence has been obtained, namely ST 131, carried these genes on its plasmids (Su et al. 2008). Certainly, an examination of the occurrence of the plasmid is crucial since it may be disseminated through horizontal transfer among bacterial populations leading to an increase of the prevalence of cephalosporinases within the strains. The aim of the research is to isolate as well as to purify large plasmids containing cephalosporinase conferred by a panel of uropathogenic E. coli isolates. Restriction enzyme digestion of the large plasmids will be conducted to compare the restriction profile of such isolates, as this will allow a deeper understanding of the relationships of the isolates.

MATERIALS AND METHODS Bacterial isolates A total of 36 routine clinical E. coli isolates designated ST 131 appearing to be resistant to extended-spectrum cephalosporins were used in this study. The source of the isolates were from laboratories across the northwest of England, namely Manchester (isolate 1, 2, 25-32), Preston (isolate 3-6, 13-24 and 33-36), Lancaster (isolate 7 and 8)

B I O D I V E R S IT A S

and Barrow (isolate 9-11). Those isolates were then subcultured on nutrient agar and incubated at 37°C overnight. The antimicrobial susceptibility of each isolate was determined by Vitek 2 system by using the AST-N054 card (BioMerieux). For plasmid isolation purposes, the isolates were inoculated into Luria-Bertani broth followed by aerobic incubation at 37ºC for 18 hours. Before harvesting the cells, the optical density of the culture were measured by spectrophotometer (Cecil Instruments Ltd., Cambridge, UK) at wavelength 600nm. The number of cells was confirmed by total plate count. Plasmid isolation Plasmids were isolated by using Wizard® plus SV minipreps DNA purification system (Promega, Madison, USA) according to manufacturer’s instruction. Briefly, an each overnight culture of E. coli in 1.5 mL LB broth was pelleted in sterile 1.5 mL eppendorf tube by centrifugation at 10.000g for 5 minutes at room temperature. The cells were then resuspended thoroughly and plasmid isolation performed. Plasmid DNA was eluted from spin columns by adding 100µl of nuclease free-water and centrifuging at 14.000g for one minute at room temperature. The eluted plasmid DNA was stored at -20ºC or run in a gel electrophoresis. Gel electrophoresis Gel electrophoresis was performed as described (Voytas 2000). The gel (5 mm thick) containing 0.7% of agarose was used in electrophoresis to resolve the isolated plasmid. In order to facilitate visualization of DNA fragments during the run, 0.5µg/mL of ethidium bromide was added before pouring the melted agarose to the gelcasting platform. After loading the DNA sample and Lambda DNA/EcoR I + HindIII marker (Promega, Madison, USA) mixed with 0.03 mL of 5x loading buffer (Bioline Inc., London, UK), the gel was run in 1x TBE buffer (in g/l: Tris, 10.8; EDTA, 10.3; boric acid, 5.5, pH 8.0) at 10V/cm for 75 minutes. Photographs of the gels followed by molecular weight measurements were taken by video imaging systems (Alpha Innotech Corp., San Leandro, California, USA). Restriction enzyme analysis A set of large plasmids from selected isolates were digested by using HpaI restriction enzyme. For analysis, the enzyme was diluted by mixing 10µl of RE (10u/µl) and 40 µl of 1x RE buffer (buffer J). In a 0.5 mL sterile eppendorf tube, 2µl of 10x buffer J and 0.2µl of acetylated BSA were mixed gently by pipetting. A total of 15.3µl of plasmid DNA sample was then added to the suspension before adding 2.5µl of diluted restriction enzyme yielding a final volume 20µl. The tube was then centrifuged for a few second followed by incubation at 37 ºC for four hours. After adding 3µl of 5x loading buffer, the sample was loaded in agarose gel for electrophoresis. Pulsed Field Gel Electrophoresis (PFGE) The PFGE was conducted as describe previously (Sambrook and Russel 2001) with modification. Briefly,

11 (2): 59-64, April 2010

the PFGE was performed in four steps, namely preparation DNA plugs, washing, electrophoresis and gel staining. Initially, an each overnight selected culture of E. coli in 9 mL of LB was centrifuged at 3,400g for 15 minutes. The supernatant was removed followed by adding 10 mL of TBE buffer and re-centrifuged for 15 minutes at 3.400g at room temperature. The supernatant was once again discarded and 0.5 mL of suspension buffer was added. The bacterial suspension was then gently mixed with 0.75 mL of melted 3% low melting point agarose (maintained at 50ºC) and quickly pipetted into the slots of a plastic plug mould (BIORAD). The plugs were allowed to solidify at 4 ºC for one hour before they were transferred to a sterile glass bijou containing 1 mL RNAse (50µg/mL) followed by incubation at 37ºC for 4 days. RNAse was subsequently replaced by lyses buffer (500µg/mL lysozyme solution) before the plugs were incubated overnight at 37ºC. Having been incubated overnight, the lyses buffer was replaced with 1 mL proteolysis buffer (1% SDS solution) followed by adding proteinase K solution (1mg/mL) per sample. For the digestion to take place, the plugs were incubated overnight at 55ºC at a shaking water bath before the next step, washing, was carried out. The washing step was performed six times every hour at room temperature by replacing the proteinase K solution with 2 mL TE buffer in order to eliminate cell debris and proteinase K activity as well as to equilibrate the agarose plugs. The washing step was carried out carefully without disturbing the plugs. After washing, the plugs were stored at 4ºC prior to using in further steps. In the third step, the DNA plugs were sliced and loaded into appropriate wells of 1.2% agarose gel and sealed with 3% low melting point agarose. A DNA molecular weight marker plug (Sigma-Aldrich, Inc, Missouri, USA) was also loaded in one of the wells. The gel was then placed in electrophoresis chamber of a CHEF Mapper System (BIORAD Laboratories Ltd., Hemel Hempstead, UK) that had been poured with 2 liters of 0.5x TBE buffer. The system was run with parameters: initial switch time, 6s; final switch time, 8s; run time, 24h, angle, 120º; gradient, 4.5V/cm; temperature, 14ºC; ramping factor, linear. Ultimately, in the last step, ethidium bromide (0.5 µg/mL in water) and distilled water were used to stain and wash the gel respectively for 20 minutes for each step followed by visualization of stained gel under UV light with video imaging systems.

RESULTS AND DISCUSSION Colonial morphology and cell density A total of 36 E. coli ST 131 isolates grew well on the nutrient agar showing typical colonial appearance with diameter 2-4mm, circular, slightly convex, gray and moist. Incubation overnight at 37ºC in LB yielded cell numbers of E. coli of 3.7 x 109 colonies with optical density at 600 nm (OD600) of 0.803. LB used in this project has given a profound effect to allow fast growth and good growth yield of E. coli to reach exponential state of bacterial growth. LB is a rich medium

SUHARTONO â&#x20AC;&#x201C; Uropathogenic of Escherichia coli strains

containing catabolizable amino acids as carbon sources accounting for the alkalinisation of the medium during growth. It is important to note that exponential growth of culture in plasmid isolation is crucial since in this rate, the plasmids of E. coli increase rapidly due to replication process in parallel with cell division every 20 minutes (Sezonov et al. 2007). Furthermore, improper time and temperature incubation will yield relatively low amount of plasmid DNA because of insufficient density of bacterial cells. Likewise, overgrown cultures may also result in suboptimal yields as well as impurity yields due to excessive chromosomal DNA contamination as part of autolysis of bacterial cells after reaching stationary phase (Promega 2008)

above the chromosomal DNA artifacts (~21kb). Based on the migration patterns, those large plasmids were classified as plasmid w (~42kb), plasmid x (~40kb), plasmid y (~30kb) and plasmid z (~28kb). Isolate 10 possesses both plasmid w and z, whereas isolate 9, 12 and 17 possess plasmid w only. The remaining isolates which are isolate 18, 26 and 30, posses plasmid x, y and z, respectively. In this agarose gel, small plasmids, possibly with three bands were also detected. Conversely, in particular isolates, there were only chromosomal DNA band that had been detected instead of plasmid i.e. isolate 8 (lanes b), isolate 14 (lanes f), isolate 19 (lanes i), isolate 20 (lanes j) and isolate 27 (lanes l). The resolution of those isolates on the agarose gel is shown in Figure 1.

Antimicrobial susceptibility Antimicrobial agent susceptibilities of E. coli ST131 used in this study is listed in Table 1. It is worth noting that a total of 36 E. coli ST131 isolates, phenotypically, showed resistance to penicillins such as ampicillin, amoxicillinclavulanic acid and piperacilin with rates approximately 89%, 67% and 80% respectively (Table 1). These isolates were also resistant not only to cefalotin (73%), a first generation cephalosporins, but also to quinolone drugs such as nalidixic acid with rates over 83% and ciprofloxacin with rates of 80%. Likewise, the rate of trimethoprim resistance of these isolates was also considerably high (80%).

Restriction enzyme analysis Activity of HpaI is most likely active to digest almost all of the plasmid of E. coli isolates harboring large plasmids yielding some restriction fragments. It is apparent that isolate 9, 10, 12, 17 and 18 have the common restriction patterns yielding 10.000bp, 7.000bp, 5.000bp, 2.750bp, 2.000bp and 1.400bp fragments as shown in Figure 2 lanes b, c, d, e and f respectively. These indistinguishable fragments may indicate that the plasmids among those isolates are closely related. On the other hand, HpaI digested the large plasmid of isolate 26 yielding quite distinct fragments than the previous isolates, namely in base pairs 10.000, 8.500, 7.000, 5.500 and 4.500. The most striking feature of this restriction enzyme digestion, however, was there is no restriction activity on the plasmid of isolate 30 as indicated by no resolved fragments on the gel (lanes h).

Plasmid isolation Of the 36 isolates of E. coli ST 131, eight of them harbored a large plasmid, namely isolate 9 (Figure 1; lane c), 10 (lane d), 12 (lane e), 17 (lane g), 18 (lane h), 26 (lane k) and 30 (lane m) with molecular weight approximately

Table 1. Summarized susceptibilities of E coli ST131 (n = 36) against antimicrobial agents. Antimicrobial agents Ampicillin Amoxicillin/Clavulanic Acid Piperacillin Piperacillin/Tazobactam Cefalotin Cefuroxime Cefuroxime Axetil Cefoxitin Cefotaxime Ceftazidime Cefepime Aztreonam Lmipenem Meropenem Ertapenem Amikacin Gentamicin Tobramycin Nalidixic Acid Ciprofloxacin Nitrofurantoin Trimethoprim

32 24 29 0 26 26 26 22 8 2 1 1 0 0 0 0 5 16 30 29 0 29

Resistant n (%) (88.89) (66.67) (80.56) (0) (72.22) (72.22) (72.22) (61.11) (22.22) (5.56) (2.78) (2.78) (0) (0) (0) (0) (13.89) (44.44) (83.33) (80.56) (0) (80.56)

Intermediate n (%) 0 (0) 2 (5.56) 3 (8.33) 14 (38.89) 5 (13.89) 0 (0) 0 (0) 0 (0) 18 (50) 24 (66.67) 25 (69.44) 25 (69.44) 0 (0) 0 (0) 0 (0) 17 (47.22) 1 (2.78) 1 (2.78) 0 (0) 0 (0) 1 (2.78) 0 (0)

4 10 4 22 5 10 10 14 10 10 10 10 36 36 36 19 30 19 6 7 35 7

Susceptible n (%) (11.11) (27.78) (11.11) (61.11) (13.89) (27.78) (27.78) (38.89) (27.78) (27.78) (27.78) (27.78) (100) (100) (100) (52.78) (83.33) (52.78) (16.67) (19.44) (97.22) (19.44)

Total 36 36 36 36 36 36 36 36 36 36 36 36 36 36 36 36 36 36 36 36 36 36

B I O D I V E R S IT A S

11 (2): 59-64, April 2010

Figure 1. The resolution of some E. coli ST 131 plasmids on the 0.7% agarose gel run at 10V/cm. (M) Lambda DNA/EcoR I + HindIII markers, (a) isolate 3, (b) isolate 8, (c) isolate 9, (d) isolate 10, (e) isolate 12, (f) isolate 14, (g) isolate 17, (h) isolate 18, (i) isolate 19, (j) isolate 20, (k) isolate 26, (l) isolate 27 and (m) isolate 30. The large plasmids with their bands above the chromosomal (chr) artifacts (~17kb) were grouped as plasmid w (~42kb), plasmid x (~40kb), plasmid y (~30kb) and plasmid z (~28kb). Numbers indicate base pairs (bp).

Figure 2. The restriction profiles of E. coli ST131digested by HpaI restriction enzyme on the 0.7% of agarose gel run at 10V/cm for 75 minutes. (M) molecular marker of Hyperladder I (Bioline, UK), (a) isolate 3, (b) isolate 9, (c) isolate 10, (d) isolate 12, (e) isolate 17, (f) isolate 18, (g) isolate 26 and (h) isolate 30. Numbers indicate base pairs (bp).

SUHARTONO – Uropathogenic of Escherichia coli strains

HpaI used in this study is an endonuclease enzyme recognizing as well as digesting in the middle of double stranded DNA at the sequence 5’- GTT ↓ AAC -3’ leaving blunt ends (Ito et al. 1992). Based on the patterns of restriction fragments in Figure 2, isolate 9, 10, 12, 17 and 18 are likely to be closely related as these isolates share the same digestion patterns. Compared to previous works, the restriction patterns of these isolates also shared the similar restriction profile with pTcTN49 (Lavollay et al. 2006), but quite different from the profile of pC15-1a (Boyd et al. 2004). Plasmid of pTcTN49 is a plasmid harboring CTXM-15 that has clonally disseminated in Paris (France), Tunis (Tunisia) and Bangui, Central African Republic (CAR), whereas pC15-1a has disseminated in Toronto, Canada. Isolate 26 and 30, on the other hand, tend to be different strains with the previous isolates as these isolates possessed quite distinguishable digested fragments or no fragments at all respectively. However, the restriction pattern of isolate 26 shared the same profile with pEpTU (Lavollay et al. 2006). Pulsed Field Gel Electrophoresis PFGE patterns of selected E. coli ST131 isolates harboring large plasmids comprised various profiles, designated a-h (Figure 3). Three large plasmids were detected in both isolate 10 (lanes c) and isolate 17 (lanes e). The descending molecular size in of three copies of large plasmids in isolate 10 were ~92kb, ~45kb and ~28kb as

opposed to ~118kb, ~46kb and ~33kb of isolate 17 respectively. Two plasmids were detected in five isolates, namely isolate 9 (lanes b), isolate 12 (lanes d), isolate 18 (lanes f), isolate 26 (lanes g) and isolate 30 (lanes h), whereas single plasmid was only detected in isolate 3 (lanes a). The presence of large plasmids in E. coli ST131 isolates conferring antibiotic resistance may allow ST131 confer virulence genes as well since plasmids encoding adaptive trait genes certainly preceded antibiotic resistance, may contain genes with a role in bacterial colonization and virulence (Martinez and Baquero 2002). These genes are encoded as a response of a local transient adaptation to a wide range of hosts and are able to be fine-tuned in order to allow a degree of genetic flexibility, which would not be available if the relevant genes were located on the chromosomes (Summers 1996). These plasmid-encoded virulence genes have been implicated in adhesions, toxinogenesis, serum resistance and cell invasiveness (Martinez and Baquero 2002). It is imperative to note that the plasmids may also confer plasmid transfer genes to promote the virulence dissemination among bacterial populations. Chen et al. (2006) reported plasmid of uropathogenic E. coli UTI89, namely pUTI89, share conjugative genes and several virulence genes indicating a role of pathogenesis. pUTI89 encodes tra operon involved in conjugative DNA transfer, whereas virulence genes such as cjrA, cjrB, cjrC and senB coding for iron uptake proteins and enterotoxin.

Figure 3. Plasmid bands (triangle) resolved by PFGE of selected E. coli ST131 isolates. (M) molecular marker, (a) isolate 3, (b) isolate 9, (c) isolate 10, (d) isolate 12, (e) isolate 17, (f) isolate 18, (g) isolate 26 and (h) isolate 30; Chr, chromosomal DNA. Numbers indicate kilo-base pairs (kb).

B I O D I V E R S IT A S

64 CONCLUSIONS

Of 36 isolates of E. coli ST131 showing high resistance to penicillins, cephalosporins and trimethoprim, large plasmids have been isolated and detected in eight isolates, namely isolates 3, 9, 10, 12, 17, 18, 26 and 30 with the largest molecular size was ~42kb confirmed by agarose gel electrophoresis and ~118kb by PFGE. There might be close relation among those isolates owing to the common restriction patterns in restriction enzyme analysis. Both agarose gel electrophoresis and PFGE are considerably useful not only to resolve the isolated large plasmids but also to measure their molecular size.

REFFERENCES Barnett BBJ, Stephens DDS (1997) Urinary tract infection: an overview. Am J Med Sci 314: 245-249. Boyd DA, Tyler S, Christianson S, McGeer A, Muller MP, Willey BM, Bryce E, Gardam M, Nordmann P, Mulvey MR (2004) Complete nucleotide sequence of a 92-kilobase plasmid harboring the CTX-M15 extended-spectrum beta-lactamase involved in an uutbreak in longterm-care facilities in Toronto, Canada. Antimicrob Agents Chemother 48: 3758-3764. Chen SL, Hung C-S, Xu J, Reigstad CS, Magrini V, Sabo A, Blasiar D, Bieri T, Meyer RR, Ozersky P, Armstrong JR, Fulton RS, Latreille JP, Spieth J, Hooton TM, Mardis ER, Hultgren SJ, Gordon JI (2006) Identification of genes subject to positive selection in uropathogenic strains of Escherichia coli: a comparative genomics approach. PNAS 103: 5977-5982. Foxman BB (2002) Epidemiology of urinary tract infections: Incidence, morbidity, and economic costs. Am J Med 113 (1 SUPPL. 1): 5S-13S.

11 (2): 59-64, April 2010

Ito H, Shimato H, Sadaok A, Kotani H, Kimizuka F, Kato I (1992) Cloning and expression of the HpaI restriction-modification genes. Nucleic Acids Res 20: 705-709. Kucheria RR (2005) Urinary tract infections: New insights into a common problem. Postgrad Med J 81: 83-86. Lavollay M, Mamlouk K, Frank T, Akpabie A, Burghoffer B, Ben Redjeb S, Bercion R, Gautier V, Arlet G (2006) Clonal dissemination of a CTX-M-15 Î˛-lactamases-producing Escherichia coli strain in the Paris area, Tunis, and Bangui. Antimicrob Agents Chemother 50: 2433-2438. Martinez JL, Baquero F (2002) Interactions among strategies associated with bacterial infection: pathogenicity, epidemicity, and antibiotic resistance. Clin Microbiol Rev 15: 647-679. Oelschlaeger TA (2002) Virulence factors of uropathogens. Curr Opin Urol 12: 33. Philippon AA, Arlet GG, Jacoby GA (2002) Plasmid-determined AmpCtype beta-lactamases. Antimicrob Agents Chemother 46: 1-11. Promega (2008) DNA purification. Protocol and application Ch.9. URL http: //www.promega.com/paguide/chap9.htm] [September 2, 2008]. Rijavec MM, Starcic-Erjavec MM, Ambrozic-Avgustin JJ, Reissbrodt RR, Fruth AA, Krizan-Hergouth VV, Zgur-Bertok DD (2006) High prevalence of multidrug resistance and random distribution of mobile genetic elements among uropathogenic Escherichia coli (UPEC) of the four major phylogenetic groups. Curr Microbiol 53: 158-162. Sambrook J, Russel DW (2001) Molecular cloning: a laboratory manual. CSHL Press, New York. Sezonov G, Joseleau-Petit D, D'Ari R (2007) Escherichia coli physiology in Luria-Bertani broth. J Bacteriol 189: 8746-8749. Su L-H, Chu C, Cloeckaert A, Chiu C-H (2008) An epidemic of plasmids? Dissemination of extended-spectrum cephalo-sporinases among Salmonella and other Enterobacteriaceae. FEMS Immunol Med Microbiol 52: 155-168. Summers DK (1996) The biology of plasmids. Blackwell, Cambridge. Voytas D (2000) Resolution recovery of large DNA fragments. In: Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Struhl K (eds) Current protocols in molecular biology. John Wiley & Sons, New York.

B I O D I V E R S IT A S Volume 11, Number 2, April 2010 Pages: 65-68

ISSN: 1412-033X (printed edition) ISSN: 2085-4722 (electronic) DOI: 10.13057/biodiv/d110203

Bacterial communities associated with white shrimp (Litopenaeus vannamei) larvae at early developmental stages ARTINI PANGASTUTI 1,2,♥, ANTONIUS SUWANTO2, YULIN LESTARI2, MAGGY TENNAWIJAYA SUHARTONO2 1

Department of Biology, Faculty of Mathematics and Natural Sciences, Sebelas Maret University (UNS), Jl. Ir. Sutami 36A, Surakarta 57126, Central Java, Indonesia, Tel. +62-271-663375, Fax.: +62-271-663375, email: pangastuti_tutut@yahoo.co.id 2 Department of Biology, School of Graduates, Bogor Agricultural University (IPB), Bogor 16680, West Java, Indonesia Manuscript received: 22 October 2009. Revision accepted: 14 November 2009.

ABSTRACT Bacterial communities associated with white shrimp (Litopenaeus vannamei) larvae at early developmental stages. Biodiversitas 11 (2): 65-68.Terminal Restriction Fragment Length Polymorphism (T-RFLP) was used to monitor the dynamics of the bacterial communities associated with early developmental stages of white shrimp (Litopenaeus vannamei) larvae. Samples for analysis were egg, hatching nauplii, 24 hours old nauplii, and 48 hours old nauplii which were collected from one cycle of production at commercial hatchery. TRFLP results indicated that the bacterial community associated with early stages of shrimp development might be transferred vertically from broodstock via egg. There was no significant difference between bacterial communities investigated, except the bacterial community of 48 hours old nauplii. Diversity analyses showed that the bacterial community of egg had the highest diversity and evenness, meanwhile the bacterial community of 48 hours old nauplii had the lowest diversity. Nine phylotypes were found at all stages with high abundance. Those TRFs were identified as γ- proteobacteria, α-proteobacteria, and bacteroidetes group. Key words: Litopenaeus vannamei, bacterial community, T-RFLP.

INTRODUCTION White shrimp (Litopenaeus vannamei) is one of the major cultured shrimp species in the world. Since the year 2000, L. vannamei production is growing rapidly. In Indonesia, L. vannamei production increased five fold in five years between 2000 and 2005 and is expected to outpace the other species in the next few years. An increasing demand for white shrimp had forced intensive culture of this species, which brought many problems due to increasing disease outbreaks caused by microorganism that lead to mass mortality. A number of emerging reports indicated that microbial community plays a major role in aquaculture. Microbiota that lived in association with aquatic animal may enhance host growth and survival by producing some digestive enzymes (Sugita et al. 1995; Seeto et al. 1996; Izvekova 2006), out-competing pathogenic bacteria, and supplying essential compound important for host metabolism. Rapid growth of shrimp occurred in unfiltered pond water, which contained organic particle including bacteria (Moss and Pruder 1995). Most of the works to study the microbial community of shrimp were done based on the culture method. This method has limitation, since less than 1% of bacteria that have been successfully cultured in artificial media until now (Amann et al. 1995; Rappe and Giovannoni 2003). Artificial medium and culture condition preferred the growth of particular group of bacteria. Molecular methods based on the amplification of 16S rRNA genes were used to overcome this problem. This gene is ubiquitous and

highly conserved among procaryotic organisms; make it useful as molecular marker for microbial community analyses. One of the techniques that used this approach was terminal restriction fragment length polymorphism analysis (T-RFLP). T-RFLP provides several advantages over other techniques because it saves time and cost especially when there are many samples to be analyzed. T-RFLP has been suggested more sensitive and has a greater resolution than other fingerprinting techniques such as Denaturing Gradient Gel Electrophoresis (Marsh 1999). However, this technique has limitation in accurate identification of species in the community, since one terminal restriction fragment (TRF) can be generated from multiple taxa. This research was aimed to characterize bacterial community associated with white shrimp larvae at early developmental stages. Characterization of typical microorganism profiles will provide a basis for future work to understand the host-microbe interaction and the efficacy of some practices in shrimp farming.

MATERIALS AND METHODS Sample preparation Samples of egg and nauplii were from a single cycle of production, obtained from the hatchery of PT. Central Pertiwi Bahari, Lampung, Indonesia. Nauplii were sampled 3 times, i.e. just after hatching, 24 hours after hatching, and 48 hours after hatching. Prior to DNA extraction, 0.1 g of each egg or larvae samples was washed 3 times in 0.85%

B I O D I V E R S IT A S

11 (2): 65-68, April 2010

sterile NaCl on sterile filter paper to minimize nonassociated microorganisms. DNA isolation Bacterial DNA was extracted from egg/larvae samples. DNA isolation was performed employing UltraClean Soil DNA Isolation kit (MoBio, California). Egg or larvae sample was homogenized in lyses buffer provided in the kit. Lysozyme with final concentration of 10 mg/ml was added to the homogenate and then incubated at 37°C for 1 hour. Further procedure followed the instruction suggested by manufacturer. PCR amplification 63f primer that 5’ end labeled (5’-(6FAM) CAGGCCTAACACATGCAAGTC-3’) and 1387r primer (5’-CCCGGGAACGTATTCACCGC-3’) were used to amplify 16S rRNA gene (Marchesi et al. 1998). Reaction mixtures for PCR contained 100 ng DNA, 1x buffer (NEB, MA), 200 µM of each dNTP, 1 U Taq DNA Polymerase (NEB, MA), 5 pmol of each primer, in a final volume of 50 µl. DNA amplification was performed with specifications as follows: 3 minutes denature step at 94° C; 30 cycles of 1 minute at 94° C, 1 minute at 55° C, 1 minute at 72° C; final extension step at 72° C for 10 minutes. PCR product was treated with mung bean nuclease (NEB, MA) to eliminate pseudo TRF (Egert and Friedrich 2003). Then the PCR product was run on 0,8% agarose gel. The DNA band with approximately 1500 bp in size was excised prior to purification using Qiaquick Gel Extraction Kit (Qiagen, Germany). Restriction enzyme digestion Purified PCR product was single-digested with AluI or RsaI (NEB, MA) in separate tubes. Reaction mixtures contained 5U enzyme, 1x buffer, 100200 ng DNA in total volume of 20 µl and incubated in 37ºC overnight. Digested DNA was then purified with Qiaquick Nucleotide Removal Kit (Qiagen, Germany) and eluted with 30µl elution buffer. T-RFLP analysis 1 µl of digested DNA was mixed with 0.5 µl of HD-400 [ROX] as internal standard and then denatured at 95ºC for 5 minutes then placed on ice. The length of various TRF was analyzed using an ABIprism™ 3100

Vibrio

Automated DNA Sequencer and determined using GeneScan Programme (Perkin Elmer, Norwalk). The sizes of TRFs were compared with the database of Ribosomal Database Project to identify their closest relatives. Diversity analyses Bacterial phylotype richness (S) was expressed as total number of peaks within each sample. Shannon Wiener index (H’) and the evenness (E) were calculated to describe the diversity of community and relative importance of each phylotype within the entire assemblage. H’ was calculated as follows: H’= -Σ (pi) (ln pi) where pi is the relative abundance of fragment i. Evenness was measured based on equation: E = H’/ Hmax where Hmax = ln S (Margalef 1958).

RESULTS AND DISCUSSION Results T-RFLP was employed to monitor the changes in microbial community as the larvae undergo their nauplii developmental stages. Sample data consist of the size in base pair and peak area for each TRF peak in electrophoregram. One TRF is considered as a phylotype while each peak area shows the relative abundance of the TRF. Restriction enzyme AluI yielded greater resolution (produced more TRFs) than RsaI. Therefore, further analyses were conducted based on this enzyme TRFs. The electrophoregram of T-RFLP result was shown in Figure 1. There were only minor changes in bacterial community composition after the hatching process until the larvae reach Nauplii 1 stage (24 hours after hatching). The α-Proteobacteria

D Figure 1. T-RFLP profiles of bacterial communities in early developmental stages of white shrimp larvae: (a) egg, (b) hatching nauplii, (c) 24 h old nauplii, and (d) 48 h old nauplii.

PANGASTUTI et al. – Bacterial communities in Litopenaeus vannamei larvae

most abundant phylotypes in egg, hatching nauplii, and 24 hours old nauplii were the same, but in 48 hours old nauplii, this phylotype was not dominant. Bacterial richness, Shannon-Wiener index, and evenness in every stage were shown in Table 1. Bacterial communities associated with early stage of white shrimp larvae development had high diversity and also had high evenness consistently. This result suggesting that the bacterial community in early larvae development was very diverse. High evenness value meant that all phylotype were distributed evenly. There was no phylotype that was really dominant comparing to the others here. However, the diversity of bacterial community which detected at 48 hours old nauplii was sharply decline. This might be related to the molting stage at which the sampling was conducted. The highest diversity and evenness was observed in egg while the lowest was in 48 hours old nauplii. Table 1. Bacterial diversity in each stage of larvae development. Stage Egg Hatching Nauplii 24 h old nauplii 48 h old nauplii

H’

161 114 139 10

4.24 3.68 3.97 1.59

0.83 0.78 0.81 0.69

Dominant AluI TRF size (bp) 152 152 152 215

Group

Vibrio Vibrio Vibrio α-Proteobacteria Note: S: bacterial richness; H’: Shannon-Wiener index; E: evenness.

Some phylotypes could be found all stages of larval development that had been analyzed (Table 2). Nine AluI phylotypes were found consistently throughout the entire nauplii stages of larval development, i.e. 37 bp, 149 bp, 152 bp, 213 bp, and 215 bp, which were grouped into γproteobacteria class, while 36 bp belonged to bacteroidetes class. Three TRF, 58 bp, 259 bp, 357 bp did not match any species in database. Phylotype that was represented by 152 bp TRFd was the most abundant phylotype in bacterial communities of egg and nauplii until 24 hour after hatching. Table 2. Phylotypes found in all stages of larval development that were analyzed. TRF size (bp) 36 37 58 149 152 213 215 259 357

Group Bacteroidetes Pseudomonas No match in database Vibrio Vibrio α-Proteobacteria α-Proteobacteria Bacteroidetes No match in database

Discussion Until now, studies about bacteria that lived associated with white shrimp were only conducted based on culture techniques. The bacteria that were commonly found in this organism were Vibrio, Staphylococcus, Brevibacterium, and Micrococcus (Goodwin 2005). Moss et al. (2000) found that Vibrio, Aeromonas, and Pseudomonas

dominated the gut of juvenile L. vannamei, but according to Vandenberghe et al. (1999), Vibrio was not the dominant group in L. vannamei. To our knowledge, this is the first study to investigate the dynamics of microbial community associated with shrimp larvae employing molecular-based technique. Each TRF could be identified by matching the size of TRF with database. Not all of TRFs could be unambiguously identified employing RDP database. The limitation of T-RFLP is its ability to identify phylotypes since only a small fragment of the 16S rRNA gene that is analyzed, i.e. the 5’ terminal. Many genus of bacteria share the same TRF sizes, makes it difficult to obtain the real identity of TRF. The use of two or more restriction enzymes can reduce the possible identities of each TRF. In this study, the use of two restriction enzymes still gave many possibilities for phylotype identity, at the species level. Therefore, we identified the TRF at class level. In bacterial community of egg, hatching nauplii, and 24 hours old nauplii, the dominant phylotype belonged to while the dominant phylotype in bacterial community of 48 hours old nauplii belonged to. Overall, Proteobacteria group seemed to be dominant in bacterial community associated with white shrimp larvae. However, since all samples in this study were originated from single hatchery, the results obtained in this study might not necessarily reflect bacterial communities associated with white shrimp larvae derived from other hatcheries. Different environment and culture conditions could lead to different bacterial communities established in other places. The composition of bacterial community was not significantly different between egg and nauplii stages of larvae. At early stages of development, the gut and immune system of shrimp larvae have not fully developed. The molting process of the host may also have a direct influence on the composition of bacterial community. Dempsey et al. (1989) found high individual variability in the types and the numbers of colony forming units that could be isolated from penaeid shrimp gut that might be attributed to the molting stage of the shrimp. During molting, the exoskeleton and also the chitinous hindgut lining is replaced. A study in millipede showed that the new hindgut lining was devoid of microbes (Crawford et al. 1983). After molting processes, new bacterial communities were established and the environment has great influence to determine the composition of new communities. This could explain why in 48 hours nauplii the diversity was very low. Possibly, the nauplii were sampled just after they undergo the molting process that only a small number of bacteria in the bacterial community newly established. The establishment of bacterial community in L. vannamei larvae is still unclear. The composition of bacterial community at early developmental stages was very similar to the community at egg (sharing 83 phylotype which were the same), suggesting that there had been a vertical transmission from broodstock to larvae. The inner part of egg is sterile, but the surface might be colonized by bacteria that originated from broodstock during spawning process. In this case, the bacteria at the surface of egg are being transferred to nauplii when they hatch. Bacteria from

B I O D I V E R S IT A S

broodstock determine the composition of bacterial community of larvae, especially at early developmental stages where the additional feed has not introduced yet to the larviculture system. Even though we did not examine the status of bacterial community in broodstock, vertical transmission of bacteria might be one of the important processes for the establishment of bacterial community in L. vannamei. It is also possible that the bacteria in the community associated with larvae at early developmental stage were originated from the water, since the shrimp larvae is a filter feeder. Large amount of water is always taken into the larval gut, makes it an important source of bacteria to occupy the gut. On the other hand, larval feces are continuously released to the water, bringing bacteria from larval gut into rearing water. TRFLP analysis showed that two phylotypes were very dominant in comparison to other phylotypes in communities, i.e. 152 bp, 213 bp, and 215 bp. Those phylotypes represented γ-Proteobacteria, α-Proteobacteria, and α-Proteobacteria group respectively. The dominant phylotypes in early developmental stages of larvae could play key roles in determining the survival of shrimp larvae. The 152 bp TRF identified as genus Vibrio, which is usually pathogenic to shrimp. However, in this study, the dominant phylotypes apparently did not harm their host as shown by high survival rate of the larvae (data not shown). This finding suggested that not all of Vibrio species are pathogenic to shrimp. The role of the diversity in shrimp bacterial community is to maintain the balance between harmful bacteria and the beneficial ones. High diversity could prevent the opportunistic bacteria to growth and cause the disease. Despite of its limitation in precise identification, TRFLP proved to be a useful tool for monitoring the population dynamics in complex bacterial community. This technique could be used to detect changes in bacterial community due to specific treatment, such as introduction of feed supplement or probiotics to improve the growth or survival of L. vannamei larvae. T-RFLP had been used to monitor the effect of Lactobacillus acidophilus NCFM supplementation in rats (Kaplan et al. 2001) or changes in human microbiota after antibiotic treatment and probiotic supplementation (Jernberg et al. 2005). We initiated to study on microbial community in the development of L. vannamei larvae employing T-RFLP technique. This study will provide critical data of bacterial community associated with L. vannamei larvae for future work in order to increase shrimp production and minimize problems associated with microorganism in aquaculture. CONCLUSIONS Terminal Restriction Fragment Length proved to be a useful tool to reveal the complex bacterial community which information about the establishment of community in early development of white Bacterial community associated with early

Polymorphism diversity in a might give this bacterial shrimp larvae. developmental

11 (2): 65-68, April 2010

stage of white shrimp larvae was very diverse and contained phylotypes that were evenly distributed. Most bacteria in the bacterial community were acquired from vertical transmission via egg. ACKNOWLEDGEMENT This research was funded by PT. Charoen Phokphand Indonesia. We thank Yepy Hardy Rustam for bioinformatics analyses. REFERENCES Amann RI, Ludwig W, Schleifer KH (1995) Phylogenetic identification and in situ detection of individual microbial cells without cultivation. Microbiol Rev 59: 143-169. Crawford CS, Minion GP, Boyers MD (1983) Intima morphology, bacterial morphotypes, and effect of annual molt on microflora in the hindgut of the dessert millipede, Orthoporus ornatus (Girard) (Diplopoda: Spirostreptidae). Int J Insect Morphol Embryol 12: 301-312. Dempsey AC, Kitting CL, Rosson RA (1989) Bacterial variability among individual Penaeid shrimp digestive tracts. Crustaceana 56: 267-278. Egert M, Friedrich MW (2003) Formation of pseudo-TRF, a PCR related bias affecting Terminal Restriction Fragment Length Polymorphism analysis of microbial community structure. Appl Environ Microbiol 69: 2555-2562. Goodwin S (2005) Polyphasic characterization of bacteria isolated from shrimp larva. J Young Investigator 12: 1-4. Izvekova GI (2006) Hydrolytic activity of enzyme produced by symbiotic microflora and its role in digestion process of bream and its intestinal parasites Caryophyllaeus laticeps (Cestoda, Caryophyllidea). Biol Bull 33: 287-292. Jernberg C, Sullivan A, Edlund C, Jansson JK (2005) Monitoring of antibiotic induced alteration in the human intestinal microflora and detection of probiotic strains by use of terminal restriction fragment length polymorphism. Appl Environ Microbiol 71: 501-506. Kaplan CW, Astaire JC, Sanders ME, Reddy BS, Kitts CL (2001) 16S Ribosomal DNA terminal restriction fragment pattern analysis of bacterial communities in faeces of rats fed Lactobacillus acidophilus NCFM. Appl Environ Microbiol 67: 1935-1939. Marchesi JR, Sato T, Weightman AJ, Martin TA, Fry JC, Hiom SJ, Dymock D, Wade WG (1998) Design and evaluation of useful bacterium-specific PCR primers that amplify genes coding for bacterial 16S rRNA. Appl Environ Microbiol 64: 795-799. Margalef R (1958)) Information theory in ecology. Gen Syst 3: 56-71. Marsh TL (1999) Terminal restriction fragment length polymorphism (TRFLP): An emerging method for characterizing diversity among homologous population of amplification products. Curr Opin Microbiol 2: 323-327. Moss SM, Pruder GD (1995) Characterization of organic particles associated with rapid growth in juvenile white shrimp, Penaeus vannamei Boone, reared under intensive culture condition. J Exp Marine Biol 187: 175-191. Moss SM, LeaMaster BR, Sweeney JN (2000) Relative abundance and species composition of gram negative, aerobic bacteria associated with the gut of juvenile white shrimp L. vannamei reared in oligotrophic well water and eutrophic pond water. J World Aquacult Soc 31: 255-263. Rappe MS, Giovannoni SJ (2003) The uncultured microbial majority. Ann Rev Microbiol 57: 369-394. Seeto GS, Veivers PC, Clements KD, Slaytor M (1996) Carbohydrate utilization by microbial simbionts in the marine herbivorous fish Odax cyanomelas and Crinodus lophodon. J Comp Physiol 165: 571-579. Sugita H, Kawasaki J, Deguchi Y (1995) Production of amylase by the intestinal microflora in cultured freshwater fish. Lett Appl Microbiol 24: 105-108 Vandenberghe J, Verdonck L, Robles-Arozarena R, Rivera G, Bolland A, Balladares M, Gomez-Gil B, Calderon J, Sorgeloos P, Swings J (1999) Vibrios associated with Litopenaeus vannamei larvae, postlarvae, broodstock, and hatchery probionts. Appl Environ Microbiol 65: 2592-2597.

B I O D I V E R S IT A S Volume 11, Number 2, April 2010 Pages: 69-74

ISSN: 1412-033X (printed edition) ISSN: 2085-4722 (electronic) DOI: 10.13057/biodiv/d110204

Intervention of Genetic Flow of the Foreign Cattle toward Diversity of Phenotype Expressions of Local Cattle in the District of Banyuwangi MOHAMAD AMIN♥ Department of Biology, Faculty of Mathematics and Natural Sciences, State University of Malang (UM), Jl. Surabaya 6, Malang 65145, East Java, Indonesia, Tel. +62-3415-88077, Fax. +62-341-588077, e-mail: rizalamin@yahoo.com Manuscript received: 22 February 2009. Revision accepted: 21 June 2009.

ABSTRACT The aims of the present research are two folds: to know the phenotypic diversity and to reconstruct the cross-breeding pattern of local cattle in Banyuwangi. Based on three sampling areas, it was found that there were 32 phenotypic cattle (10 in the sub districts of Rogojampi, 16 in Tegaldlimo and 6 in Glagah areas). The phenotypic varieties were caused by two factors, namely the flow of genetic intervention of the other local cattle (Bali, Ongole, and Brahman cattle) and the artificial insemination program using the semen of Limousine, Simmental, Aberdeen Angus and Santa Gertrudis cattle. © 2010 Biodiversitas, Journal of Biological Diversity Key words: flow of genetic intervention, local cattle, phenotypic variation.

INTRODUCTION One of national assets in husbandry fields in Indonesia is beef cattle which has economic potentials to be developed. The existence of beef cattle can be intensified to create job opportunities, to meet national meat production, increase breeders’ income and farmer prosperity, and finally it is importance source of government’s income generating units. Besides that it will also reduce the dependency on meat import. In Indonesia, Bos sp. is one kind of cattle which gives a significant contribution to national meat supplies to fulfill animal protein needs of peoples. But, the addition of cattle population is not balanced with the national needs (Putu et al. 1997). Table 1 is a list of cattle which gives the biggest contribution among five kinds of key livestock in meat supplies at a national scale. Since the economic crisis that happened in 1997, a significant decrease in the population of cattle has happened in some areas, so that the cattle population is now believed to be less than before. As a consequence, the beef cattle potential from year to year have decreased significantly. For example, in Nusa Tenggara, the case is shown at the figure of 15.92% (Sumadi 2002). If this condition is uncontrolled, there is a chance that in about 10 years later the existence of beef cattle will be drained. By then, we will have lost germplasms which are one of the national assets in the husbandry field. This problem becomes more serious because, on one side, there has still been a lack of accurate observations in the breeding of the local cattle; and on the other side, efforts for production increase are not yet optimum. Negative selections by the breeders and the lack of observation in the breeding of local cattle cause the rest of

local cattle to be the cattle with a bad quality, which let alone, commonly will serve as the cattle seed on which further cattle is to be produced. This happens because of the practice of conventional husbandry by the local people. If this case happens continuously, it is predicted that one day local cattle extinction will happen and we will lose the benefit because of losing germplasms (Hardjosubroto 2000, 2002; Mahaputra 2002). Setiadi (1997) states that a ‘friendly’ cross-breeding program can threaten the local cattle source which has not been renewed. Table 1. Fluctuation of big livestock production from 1995-1998 (in thousands). Livestock 1995 Cattle 11,534 Dairy milk 341 Goat 3,136 Buffalo 13,167 Sheep 7,168 (Yudhohusodo 2003)

1996 11,816 348 3,171 13,890 7,724

1997 11,938 335 3,064 14,164 7,698

1998 11,663 321 2,829 13,560 7,114

In the effort to conserve the pure genetic traits and the local cattle, the government makes development programs, for example to keep the purity of Bali cattle. The government has stated four areas that develop pure breeds of Bali cattle, namely Bali, South Sulawesi, West Nusa Tenggara, and East Nusa Tenggara (Pane 1991; Handiwirawan 2003). According to statistics in the Banyuwangi district (BAPPEDA Kabupaten Banyuwangi 2007), the potential of agriculture land in Banyuwangi is in the third rank after Malang and Jember, so that Banyuwangi becomes one of food rice bran in East Java Province. Besides of the potential of agriculture fields, Banyuwangi is a place that

B I O D I V E R S IT A S

has the potential for cattle production. The development of husbandry in this region has the same line with the history of Banyuwangi. This can be seen from the pluralism of Banyuwangi people. The majority is the Osingese, but there are Javanese and Madurese who are significant enough and there are minority Balinese and Buginese. The Osingese is the indigenous inhabitants of Banyuwangi, and they can be considered as a sub ethnic group of the Javanese. The culture from ethnic groups which are pluralistic is very colorful in the living of cattle breeding. The Osingese as a sub ethnic group of Javanese will defend their breeding culture utilizing the local Java cattle. The Balinese will defend Bali cattle. Two of major ethnic groups besides the Osingese (Javanese and Madurese), of course will influence in terms of the presence of the husbandry model in Banyuwangi. Besides, to make the government program in the cattle production development successful, in 1990s the Banyuwangi government introduced the artificial insemination (AI) with the excellence of the cattle from Australia, Switzerland and the Netherlands (Simmental, Limousine, Angus, Brahman and Ongole). The AI program which is also a genetic intervention directly will influence the genetic diversity in Banyuwangi cattle breeding practices. As a consequence of this, tracing and identification needs to be performed on phenotype diversity of the Banyuwangi cattle as a result of genetic intervention from the AI program and culture which is brought by different ethnic groups who live in this area. The aims of the research are to examine the phenotypic diversity and to reconstruct the cross-breeding pattern of the local cattle in Banyuwangi and to predict factors that influence these phenotypes.

11 (2): 69-74, April 2010 Table 2. Sample of field collecting data table. Sub district area: .......................................................... Phenotype *) Sample number

Color (head, body, leg)

Shape/direction Ear Mouth Hump of horn growth shape color

1 2 3 ...... Note: *) this phenotype decision is based on principal characteristic cattle in Kabupaten Banyuwangi. Notice: Body color: Bali cattle (brown), Ongole (white), Brahman (white), Simmental (brown), Angus (black), Limousine (brown). Shape of horn growth: Bali cattle (no horn/very small horn), Ongole (grow long and make 45o angle with body, Brahman (grow long and make 45o angle with body, Simmental (grow short), Angus (grow short), Limousine (grow short). Ear shape: Bali cattle (grow straight parallel with horn), Ongole (hanging), Brahman (hanging), Simmental (make 90o angle with body’s axis, Limousine (make angle with body’s axis). Mouth color: Bali cattle (black), Ongole (black), Brahman (black), Simmental (white), Angus (black), Limousine (brown).

The results of analyzing the phenotype data provide evidence of the pattern of the crossbreeding of the local cattle sample which was examined. Phenotype data recording will be analyzed descriptively to decide the crossing pattern so that the ancestor of sample cattle which is researched can be traced.

RESULTS AND DISCUSSION MATERIAL AND METHODS This research is a survey which aims to examine the phenotype of the local cattle in Banyuwangi, to study the phenotype expression variation including fur color (head, body and leg), shape of horn growth, ear shape, absence of growth, hump, mouth color (Fries and Ruvinsky 2004). This research was conducted from February to April 2008, in three phases taking out samples including those located in sub district areas as Rogojampi, Tegaldlimo, and Glagah. The decision to include these three areas is based on the central husbandry development for the Banyuwangi area. Tegaldlimo sub district area serves as a central artificial insemination with local cattle Java and Bali descent; Rogojampi sub district area is a central artificial insemination with local cattle Madura cattle, Java and Bali, Ongole hybrid and Brahman. Glagah sub district functions as a central artificial insemina-tion with local cattle crossing resulting from Java and Bali cattle. Sampling was conducted by following the schedule of health services set up by husbandry department for breeder on every Wednesday. This research is divided into two phases. The first is field research which is field data collecting in the form of phenotype data and the second is the data tabulation using the observation matrix as shown in Table 2.

Based on research in three research area sampling were found 42 cows in Rogojampi area, 48 cows in Tegaldlimo area and 18 cows in Glagah area. Research finding local cattle phenotype in Rogojampi area from 42 samples investigated, it could be found 11 kinds of phenotype (variation). For cattle from Rogojampi area was given R initial, and number series was a kind of number of phenotype cattle with detail as follow: R1 (Simmental), R2 (Java-PO), R3 (Java-Limousine), R4 (Java), R5 (Madura), R6 (Java-Simmental), R7 (Java Limousine Simmental), R8 (Limousine), R9 (Brahman Angus Limousine), R10 (Simmental) (Figure 1). There were 6 cows from 18 cows that were researched in Glagah area (with “G” initial, the ordinal number is the number of cow’s phenotype variety) with detail as G1 (Java-Ongole-Bali), G2 (RambonLimousine), G3 (Rambon Keling), G4 (Rambon-Java), G5 (Rambon-Java (Java horn) and G6 (Bali-Limousine) (Figure 2). The result of phenotype research in Tegaldlimo area shows there are 17 kinds of phenotype (with “T” initial and the ordinal number is the number of cows’ phenotype variety) with the detail as follow: T1 (Simmental), T2 (Java-Limousine), T3 (Java-Ongole), T4 (Limousine), T5 (Java-PO-Simmental), T6 (Java-PO), T7 (Java-Ongole), T8 (Rambon Keling-Ongole), T9 (Rambon Manis-Ongole), T10 (Simmental-Angus), T11 (Simmental-Limousine), T12

AMIN â&#x20AC;&#x201C; Genetic diversity of local cattle in Banyuwangi

Figure 1. Phenotypic variation of cattle from Rogojampi (R): R1 (Simmental), R2 (Java-PO), R3 (Java-Limousine), R4 (Java), R5 (Madura), R6 (Java-Simmental), R7 (Java-Limousine-Simmental), R8 (Limousine), R9 (Brahman-Angus-Limousine), R10 (Simmental) (left to right, above to bottom).

Figure 2. Phenotypic variation of cattle from Glagah (G): G1 (Java-Ongole-Bali), G2 (Rambon-Limousine), G3 (Rambon Keling), G4 (Rambon-Java), G5 (Rambon-Java/Java horn) and G6 (Bali-Limousine) (left to right, above to bottom).

B I O D I V E R S IT A S

11 (2): 69-74, April 2010

Figure 3. Phenotypic variation of cattle from Tegaldlimo (T): T1 (Simmental), T2 (Java-Limousine), T3 (Java-Ongole), T4 (Limousine), T5 (Java-PO-Simmental), T6 (Java-PO), T7 (Java-Ongole), T8 (Rambon Keling-Ongole), T9 (Rambon Manis-Ongole), T10 (Simmental-Angus), T11 (Simmental-Limousine), T12 (Simmental), T13 (Limousine-Brahman-Angus), T14 (Ongole-Limousine), T15 (Ongole), T16 (Bali-Limousine) (left to right, above to bottom).

(Simmental), T13 (Limousine-Brahman-Angus), T14 (Ongole-Limousine), T15 (Ongole), T16 (Bali-Limousine) (Figure 3). Based on observation, there were 31 phenotype variations, namely the color of fur (head, body, leg), the shape of the horn growth, the shape of ear, the humps, the

color of mouth. Banyuwangi cattle history background is explained below (Figure 5). In the beginning of the Banyuwangi cattle development, many people breeded the local Java and Bali cows according to the peopleâ&#x20AC;&#x2122;s social conditions. In the Dutch

AMIN – Genetic diversity of local cattle in Banyuwangi

cattle. Based on the characteristic, the appearance of the Rambon is explained as follow: Rambon Java is a crossbreed of Bali and Ongole cattle. The offspring (F1) is crossed by Bali cattle. Rambon Manis is a crossbreed of Bali and Brahman cattle (no horn) and Rambon Rambon Rambon Rambon Rambon Keling is a crossbreed of Rambon Java manis keling Manis and Bali cattle and Keling cattle (Ongole or PO (Ongole breed). Rambon is a crossbreed Figure 4. The pattern of Rambon cow varieties. Rambon Manis and Bali cattle. A lot of Rambon cattle breeder by Osing people practiced according to this cattle quality or Ongole/PO and Java/Bali cattle ability to help the farmer in the Brahman field. This practiced can be understood because of the whole life of Osing people is farmer. Rambon cattle known to has a strong slim leg that help farmer to Rambon Rambon Rambon cultivate plant in the field. The Rambon Java manis keling formed pattern of Rambon cow varieties is shown in Figure 4. In the beginning of 70’s, the Government of the Republic of Indonesia introduced a program to Limousine, Simmental, Aberdeen Angus, increase cattle quality through an Santa Getrudis artificial insemination program. The program invited imported semen from the best quality of cattle from abroad, namely 32 cattles variants Limousine, Simmental and Aberdeen cattle. This program Figure 5. The general pattern of forming the thirty two cattle variants enriched the number of phenotype of the local cattle. The structure of the phenotype variation is shown in Figure 2. A study conducted by Colonial era, they imported a lot of Ongole and Brahman MacHugh et al. (1999) studied five extant Nordic and Irish cows. This gave an opportunity for the three kinds of cows cattle breeds and suggested that the cattle used by the to mingle and as a result, a new phenotype variant was born Vikings of the early medieval Dublin were similar to the (produced). This represents the characteristic of the three modern cattle population found in the northern Europe. The kinds of cows, the local Java cow, the Bali cow, Ongole medieval population displayed similar levels of mtDNA characteristics (including PO or Ongole breed) and the diversity to the modern European breeds. Brahman cow. In general, the appearances of the phenotype variations The crossbreeding of local Java and Bali cow is called are seen in the hair of body color. Based on research result, Rambon cattle. It can be finding in Osing people’s area it is shown that there is a variation of the body color (as a (Glagah sub-district). Rambon is the breed of Java and color parameter) signed by 31 kinds of cattle. For Indonesia Bali; it has phenotype expression of them (Java and Bali as a tropical area, the adaptive color for the cattle to obtain cattle). Rambon divided into many kinds of variety; they the fitness is a bright color with a pigmented darker skin. are Rambon, Rambon Java, Rambon Manis and Rambon The basis of the coat color and cattle and all mammals is Keling. Rambon Java (“Java” describes the characteristic of Bali cattle especially the pinkish fur and white leg the presence of melanin in the hair (Searle 1968). Melanin (Banyuwangi people call it “sock”, it is not characteristic of is found in the melanosomes of the cytoplasm of the local Java cattle cow. But this cattle shows the Java cattle’s melanocytes. These melanosomes are transferred to the hair horn that grows same way as the body. Bali cattle show the as it grows through a process exocytosis. The melanocytes same characteristic with local Java cattle. Rambon Manis migrate from the neural crest during embryonic has brown furs as Bali cattle and it does not have white legs development and only areas of the body in which they are (socks). The other is Rambon Keling. It has brighter fur found are pigmented. White spotting occurs in the area and legs, but it has the same type of horn with local Java where the skin or hair lacks melanocytes. Java/Bali cattle

Ongole/PO and Brahman

B I O D I V E R S IT A S

The expression of the observed pigmentation in the cattle is caused by pigmentation that is controlled by genes. The Extension (E) locus is responsible for most of the variation in the cattle coat color. Three alleles present at this locus include: ED, dominant black, E+ responsible for most combination of red or reddish brown and black, and e, recessive, red (Olson 2004). Based on the observation there is the color change from normal which is gene mutation expression. The normal color is red and darker black (brown black) and the modification in the three basic colors is brown, black and red. Here genes that control hair color in the cattle breed reflect on the variety of the cattle that is discovered in Banyuwangi. The extension locus encodes the melanocytestimulating hormone receptor (MSHR; also known as MC1R1). This receptor controls the level of tyrosinase within melanocytes. Tyrosinase is the limiting enzyme involved in synthesis of melanin: high levels of tyrosinase result in the production of eumelanin (dark color, e.g. brown or black) while low levels result in the production of phaeomelanin (light color, e.g. red or yellow). When melanocyte-stimulating hormone binds to its receptor, the level of tyrosinase is increased, leading to production of eumelanin. The wild-type allele at the extension locus corresponds to a functional MSHR, and hence to dark pigmentation in the presence MSH. The wild-type allele (E+) encodes the normal functional receptor for MSH. The ED allele contains a mis-sense mutation, changing the 99th amino acid from leucine to proline. The e allele contains a single base deletion (a frame-shift mutation), which gives rise to a non-functional receptor, and hence to low levels of tyrosinase, resulting in production of phaeomelanin (red coat color) (Nicholas 2004). Of the cattle body gen controlling the color of body furs identified by Olson (2004), the variety of cattle body color in Banyuwangi is controlled by gene on all the alleles except ED. It can be understood because black is rare to be found in all observed population. The rest of black color is caused by the crossbreeding between the local and the Angus cattle at the beginning of 70â&#x20AC;&#x2122;s in which a program to increase the cattle quality by government through artificial insemination program was introduced. Genetic variation that is discussed is a general characteristic in population among individuals. Appearance of variation is caused by some variables, e.g. migration, mutation, natural selection process and breeding (Drent 1995). Breeding has a purpose to enrich the genetic variation of population. The gene frequency from one generation to the next generation is defended. The condition without changing gene frequency is called genetic balance. It means the number of variety is constant. It seems in big population which has random breeding (Caughiey and Gunn 1996). Individual breed with family member (relationship population member) in a small population is called inbreeding. If it happens continuously, an increase in the number of homozygote individual in that population will take place (Klug and Cummings 2002). Some researches about inbreeding on fish showed the phenotype production decreasing, e.g. growth, immunity and abnormality (Tave 1993; Tamarin 2002).

11 (2): 69-74, April 2010

CONCLUSION There are 32 kinds of phenotypes in Banyuwangi based on the color of furs (head, body, and leg), the shape of the horn growth, shape of ear, the humps and the color of mouth. The pattern of breeding which causes the phenotype variation of cattle in Banyuwangi can be stated as follows: there are interactions between Java cattle, Bali cattle, Ongole cattle and Brahman cattle. This result is supported by an artificial insemination program with Limousine, Simmental, Aberden Angus and Santa Gertrudis cattle sperms. So, the research on genotype is suggested to explore the genetic variation and it will be useful in the conservation and the genetic tracing of population of cattle in Banyuwangi. REFERENCES BAPPEDA Kabupaten Banyuwangi (2007) Kabupaten Banyuwangi dalam Angka. Dinas Infokom Kabupaten Banyuwangi, Banyuwangi. Caughiey G, Gunn A. (1996) Conservation Biology in Theory and Practice. Blackwell Science, Cambridge, Massachusetts. Drent A (1995) DNA and Genetic Variation in DNA Fingerprinting Plant Pathology: an Introduction. Lincoln University, Lincoln, New Zealand:. Fries R, Ruvinsky A.(2004) The Genetics of Cattle. CAB International, Cambridge, MA. Handiwirawan E (2003) Penggunaan Mikrosatellite HEL9 dan INRA035 sebagai Penciri Khas Sapi Bali. [Tesis]. Program Pasca Sarjana IPB, Bogor. Hardjosubroto W (2000) Seleksi sapi bali berdasarkan penampilan dan sifat genetik. Seminar Sapi Bali. Denpasar, 25-26 Mei 2000. Hardjosubroto W (2002) Arah dan sasaran penelitian dan pengem-bangan sapi potong di Indonesia: tinjauan dari segi pemuliaan ternak. Workshop Sapi Potong. Malang, 11-12 April 2002. Klug WS, Cummings MR (2002) Essentials of Genetics. 4th ed. Prentice Hall, New Jersey. MacHugh DE, Troy CS, McCormick F, Olsaker I, Eythrsdttir E, Bradley DG (1999) Early medieval cattle remains from a Scandinavian settlement in Dublin: genetic analysis and comparison with extant breeds. Phil Trans Royal Soc B: Biol Sci 354: 99-109. Mahaputra L (2002) Arah dan Sasaran Penelitian Reproduksi Sapi Potong di Indonesia. Workshop Sapi Potong. Malang, 11-12 April 2002. Nicholas FW (2004) Introduction to Veterinary Genetics. In: Freis R, Ruvinsky A (eds.). Genetic of Cattle. CABI, Wallingford. Olson TA (2004) Genetics of Colour Variation. In: Freis R, Ruvinsky A (eds.). Genetic of Cattle. CABI, Wallingford. Pane I (1991) Productivitas dan Breeding Sapi Bali. Proceeding Seminar Nasional Sapi Bali. Fakultas Peternakan Universitas Hasanudin, Ujung Pandang, 2-3 September 1991. Putu LG, Dewyanto P, Sitepu TD (1997) Ketersediaan dan kebutuhan teknologi produksi sapi potong. Proceeding Seminar Nasional dan Veteriner. Bogor, 7-8 Januari 1997. Searle AG (1968) Comparative Genetics of Coat Color in Mammals. Logos Press, London. Setiadi (1997) Plasma Nutfah pada Domba dan Kambing. Modul dan Bimbingan Teknis Manajemen Penelitian pada Pengkajian Bidang Peternakan. Bogor: Puslitbang Peternakan dan Balitbang Pertanian. Departemen Pertanian. Sumadi (2002) Aspek peningkatan mutu genetik dan reproduksi ternak dalam perspektif agribisnis. Seminar Nasional. Pengem-bangan Peternakan Rakyat dalam Perspektif Agribisnis. Fakultas Peternakan Undana, Kupang, 29 Oktober 2002. Tamarin RH (2002) Principle of Genetics. 7th ed. McGraw-Hill, New York. Tave D (1993) Genetic for Fish Hatchery Managers. 2nd ed. Van Nostrand Rheinhold, New York. Yudhohusodo S (2003) Keynote Speech. International Conference on Redesigning Sustainable Development on Food and Agricultural System for Development Countries. Gajah Mada University, Yogyakarta.

B I O D I V E R S IT A S Volume 11, Number 2, April 2010 Pages: 75-81

ISSN: 1412-033X (printed edition) ISSN: 2085-4722 (electronic) DOI: 10.13057/biodiv/d110205

Diversity of tree communities in Mount Patuha region, West Java DECKY INDRAWAN JUNAEDI♥, ZAENAL MUTAQIEN♥♥ Bureau for Plant Conservation, Cibodas Botanic Gardens, Indonesian Institutes of Sciences (LIPI), Sindanglaya, Cianjur 43253, West Java, Indonesia, Tel./Fax.: +62-263-51223, email: decky.indrawan.junaedi@lipi.go.id; zaenal.mutaqien@lipi.go.id Manuscript received: 21 March 2009. Revision accepted: 30 June 2009.

ABSTRACT Junaedi DI, Mutaqien Z (2010) Diversity of tree communities in Mount Patuha region, West Java. Biodiversitas 11: 75-81. Tree vegetation analysis was conducted in three locations of Mount Patuha region, i.e. Cimanggu Recreational Park, Mount Masigit Protected Forest, and Patengan Natural Reserve. Similarity of tree communities in those three areas was analyzed. Quadrant method was used to collect vegetation data. Morisita Similarity index was applied to measure the similarity of tree communities within three areas. The three areas were dominated by Castanopsis javanica A. DC., Lithocarpus pallidus (Blume) Rehder and Schima wallichii Choisy. The similarity tree communities were concluded from relatively high value of Similarity Index between three areas. Cimanggu RP, Mount Masigit and Patengan NR had high diversity of tree species. The existence of the forest in those three areas was needed to be sustained. The tree communities data was useful for further considerations of conservation area management around Mount Patuha. Key words: Mount Patuha, tree communities, plant ecology, remnant forest.

INTRODUCTION Forest vegetation has important roles to climate, soil formations, prevention of erosion and landslides, and establishment of ecological niche for variety of living forms. Forests vegetation also holds an important role in managing the water systems including ground water system (van Steenis 1972). Forest communities stability will be assured by the diversity of the forest communities it selves, especially on the producer level such as plants (McNaughton 1977). According to Whitmore (1984) and Whitten et al. (1996), vegetation zoning system in Southeast Asia shows the distribution of plants based on the elevation of the forests. It consists of lower zone which occurred on 0-1200 m asl., lower montane forest zone on 1200-1800 m asl., montane forest zone between 1800-3000 m asl. and subalpine forest zone on more than 3000 m asl. Mountain forests are a good laboratory for research on ecophysiology of the reciprocal relationships between the plants and their environments (Whitmore 1986). Smith (1989) mentioned that mountain rain forests vegetation is mostly dwarf, because of the limitation on their growth by combination of a low temperature, fluctuative rainfall and the lack of soil nutrition. Thus, the mountain forests play an important role in maintaining their resources. Furthermore, this forests formation are habitat for a large numbers of endemic species, and possibly many aspects of this forests still lack of scientific understanding (Aldrich et al. 1997). Most of endemic plant species in Java can only be found in the mountain forests, although some of them may be found in lowland forests. The diversity of plant species in the western part of Java was higher than the middle and eastern Java (Whitten and Whitten 1996). Morrison (2001)

stated that the conservation status of tropical mountain rainforests of West Java has reached threatened conditions. At this time, from totally 25 conservation areas of West Java covering 3,410 km2 are mostly consist of mountainous forest. Mount Patuha is one of the mount in Java with highest diversity of plant species (van Steenis 1972). Mt. Patuha was divided in several local areas management. It were Cimanggu conservation area (CA) and production forest of Perhutani in Mt. Patuha, non production forest area of Perhutani around Ranca Upas consist of several small mountain including Mt. Masigit. It was located north side of Mt. Patuha. Last, Patengan NR forest located west side of Mt. Patuha. The aims of this research are to determine the actual condition of the three research site which assumed represent forest area around Mt. Patuha, especially the tree species diversities, abundances and similarities of the tree communities: Taman Wisata Alam Cimanggu (Cimanggu Recreational Park, RP), Hutan Lindung Gunung Masigit (Mount Masigit Protected Forest, PF), and Cagar Alam Patengan (Patengan Natural Reserve, NR).

MATERIAL AND METHODS Methods Quadrant method (Point Center Quadrant Method) (Cottam and Curtis 1956) was used to conducting vegetation analysis. Sampling taken at three locations: Cimanggu RP, Mt. Masigit and Patengan NR. Sampling points were considered from the area that representing the condition of each location. Number of sampling points was determined based on the species area curve analysis

B I O D I V E R S IT A S

(Muller-Dumbois and Ellenberg 1974) to be made before the sampling was taken. Vegetation data collection only measured tree habits, which defined as plants with dbh > 10 cm (Roberts-Pichette and Gillespie 2001). Total relative dominance in one type of a community was stated by Important Value Index (IVI), which is the sum of Relative Dominance (RDo), Relative Density (RDe) and Relative Frequency (RF) (Muller-Dumbois and Ellenberg 1974). Furthermore, Simpson Dominance Index was used to determine the dominant species in the three communities analyzed. Vegetation community similarity was analyzed based on Morisita (1959) with the formula: Im = {2(ΣXa.Xb)} / {[((ΣXa/(ΣXa)(ΣXa-1)) + ((ΣXb/(ΣXb)(ΣXb-1))] ΣXa.ΣXb}

11 (2): 75-81, April 2010

Locations Brief information about three research locations was showed in Table 1. Data showed based on Anonymous (2004a,b) and Anonymous (2008). Table 1. Size and altitude of research locations. Research location Cimanggu RP Mt. Masigit Patengan NR

Altitude ( m asl ) 1600- 2200 1600- 2000 1600

Research was conducted in June 2008. Sampling points was located in the west slopes of Mt. Patuha, Patengan NR, and the south slopes of Mt. Masigit (Figure 1).

Xa: total basal area of species X in location a Xb: total basal area of species X in location b Other supplementary data, such as location coordinates and altitude, air temperature, air relative humidity (RH), soil acidity and soil RH were taken. Understorey plants species was observed also. Herbarium specimens was made for identification and ecological prove which identified in Cianjur Herbarium Tjibodasensis (CHTJ)

Size ( hectares ) 154 43.595 121

RESULTS AND DISCUSSION Species area curve Based on the species curve area, it shows that a minimum amount of sampling needed is 20 points. Coefficients value of logarithmic regression is 0.9849 (√ 0.9701) (Figure 2). This was quite significant; as a result validity of the equation was accepted.

MT. MASIGIT

RANCA UPAS

CIMANGGU RP

PATENGAN LAKE MT. PATUHA

PATENGAN NR PUTIH CRATER

Figure 1. Map of research locations: Cimanggu RP, Mt. Masigit, and Patengan NR (www.google-earth.com).

JUNAEDI & MUTAQIEN â&#x20AC;&#x201C; Tree communities in Mount Patuha

jumlah spesies pohon

30 25 20

y = 8.6458Ln(x) + 1.2487 R2 = 0.9701

15 10 5 0 1

2 3

4 5

7 8

9 10 11 12 13 14 15 16 17 18 19 20

area (x 400 m2)

Figure 2. Species area curve with the number of sampling point 20 x 400 m2 at research location. Analysis was taken in Mt. Masigit with the assumption of the tree communities condition with the least threat intensity than two other locations, i.e. Cimanggu RP and Patengan NR.

Vegetation analysis Based on vegetation analysis, there were 49 tree species obtained from three research locations. There were 26 tree species in Cimanggu RP, 31 tree species in Mt. Masigit and 20 tree species in Patengan NR. Furthermore, list of tree species that found in three locations along with the observed value of IVI is summarized in Table 2. Understorey plants observed from three locations consist of 51 species, 43 genus and 36 families (Table 3). From the total number of species, 11 of them was seedling of tree species. Most of the understorey plants were member of Asteraceae, Euphorbiaceae, Rubiaceae and Urticaceae.

Table 2. Tree species found in three research locations: Cimanggu RP, Mt. Masigit and Patengan NR with its Important Value Index (IVI). IVI values with bold type indicate that the value is one of the three largest values in the mentioned locations. Species Acer laurinum Hassk. ex Miq. Rauvolfia javanica Koord. & Valeton Macropanax dispermum Kuntze Vernonia arborea Buch. Ham Viburnum sambucinum Reinw. ex Blume Elaeocarpus oxypyren Koord. & Valeton Elaeocarpus sp. Elaeocarpus stipularis Blume Sloanea sigun (Blume) K.Schum. Claoxylon indicum (Reinw. ex Blume) Hassk. Glochidion cyrtostylum Miq. Homalanthus populneus Pax Castanopsis javanica A. DC. Castanopsis tungurrut A. DC. Lithocarpus pallidus (Blume) Rehder Lithocarpus sp. Altingia excelsa Noronha Engelhardia spicata Blume Cinnamomum rhynchophyllum Miq. Cryptocarya lanceolata Merr. Litsea tomentosa Blume Neolitsea cassiaefolia (Blume) Merr. Neolitsea javanica (Blume) Backer Magnolia blumei Prantl. Astronia spectabilis Blume Ficus cuspidata Reinw. ex Blume Ficus fistulosa Reinw. ex Blume Ficus ribes Reinw. ex Blume Myrsine hasseltii Blume ex Scheff Decaspermum fruticosum J.R.Frost & G.Frost Syzygium antisepticum (Blume) Merr.& L.M.Perry Syzygium rostratum DC. Syzygium sp. Podocarpus neriifolius D.Don. Polyosma integrifolia Blume Polyosma sp. Helicia robusta (Roxb.) R.Br.ex Wall. Prunus arborea (Blume) Kalkman Cinchona pubescens Vahl. Wendlandia densiflora DC. Acronychia pedunculata Miq. Casearia sp. Turpinia Montana (Blume) Kurz Turpinia sphaerocarpa Hassk. Sterculia sp. Symplocos costata Choisy ex Zoll. Eurya acuminata DC. Gordonia excelsa Blume Schima wallichii Choisy

Family Aceraceae Apocynaceae Araliaceae Asteraceae Caprifoliaceae Elaeocarpaceae Elaeocarpaceae Elaeocarpaceae Elaeocarpaceae Euphorbiaceae Euphorbiaceae Euphorbiaceae Fagaceae Fagaceae Fagaceae Fagaceae Hamamelidaceae Juglandaceae Lauraceae Lauraceae Lauraceae Lauraceae Lauraceae Magnoliaceae Melastomataceae Moraceae Moraceae Moraceae Myrsinaceae Myrtaceae Myrtaceae Myrtaceae Myrtaceae Podocarpaceae Polyosmaceae Polyosmaceae Proteaceae Rosaceae Rubiaceae Rubiaceae Rutaceae Salicaceae Staphyleaceae Staphyleaceae Sterculiaceae Symplocaceae Theaceae Theaceae Theaceae

Important Value Index (IVI) Cimanggu RP Mt. Masigit Patengan NR 3.14 5.7 11.4 10.22 12.06 6.38 2.09 18.58 1.83 8.49 2.29 10.03 9.99 2.09 26.99 2.98 9.7 1.93 5.55 2.98 43.06 46.58 32.33 2.78 31.18 33.98 20.46 13.08 25.93 4.24 44.53 32.59 2.87 2.53 1.84 2.85 14.73 3.87 3.89 10.45 5.81 3.8 3.39 2.77 3.03 1.84 2.1 8.64 33.79 12.09 3.15 4.18 2.03 3.72 4.3 2.97 1.81 6.69 11.61 11.31 56.94 2.84 6.25 2.9 9.53 2.91 4.32 3.47 3.77 6.09 10.67 2.85 2.83 7.66 44.55 34.13 41.11

B I O D I V E R S IT A S

11 (2): 75-81, April 2010

Table 3. Understorey plants observed from three research locations: Cimanggu RP, Mt. Masigit and Patengan NR. Presence and absent of the species was limited to the subplots analyzed. Species Family Cimanggu RP Strobilanthes paniculata T. Anders. Acanthaceae + Saurauia sp.* Actinidiaceae + Curculigo sp. Amaryllidaceae + Parameria sp. Apocynaceae + Urophyllum sp. Araceae Calamus sp. Arecaceae + Eupatorium riparium Regel Asteraceae + E. inulaefolium H. B. K. Asteraceae + Vernonia arborea Buch.-Ham* Asteraceae + Impatiens platypetala Lindl. Balsaminaceae + Begonia robusta Blume Begoniaceae + Euonymus javanicus Blume* Celastraceae Perrottetia sp.* Celastraceae Cyathea junghuhniana Copel Cyatheaceae Cyperus sp. Cyperaceae Lindsaea sp. Dennstaedtiaceae Glochidion sp.* Euphorbiaceae + Homalanthus populneus Pax* Euphorbiaceae + Sauropus sp. Euphorbiaceae + Dichroa sp. Hydrangeaceae + Magnolia liliifera (L.) Baill. Magnoliaceae + Melastoma malabathricum Linn. Melastomataceae + Ficus cuspidata Reinw. ex Blume* Moraceae + Ardisia javanica A. DC. Myrsinaceae Ardisia villosa Roxb. Myrsinaceae + Passiflora edulis Sims Passifloraceae Polygala sp. Polygalaceae + Polygonum chinense L. Polygonaceae + Lysimachia biflora C.Y. Wu Primulaceae Pteris ensiformis Burm. Pteridaceae + Rubus sp. Rosaceae + Michelia sp. Rubiaceae + Mussaenda sp. Rubiaceae + Psychotria montana Blume Rubiaceae + Toddalia asiatica (L.) Lam. Rutaceae Zanthoxylum sp. Rutaceae + Symplocos sp.* Symplocaceae + Smilax macrocarpa Blume Smilacaceae + Solanum grossum C.V. Morton Solanaceae Turpinia sphaerocarpa Hassk* Staphyleaceae + Eurya acuminata DC.* Theaceae + Cyclosorus sp. Thelypteridaceae Elatostema sp. Urticaceae + Pilea sp. Urticaceae + Procris sp. Urticaceae Diplazium sp. Woodsiaceae + Hedychium coronarium J.Kรถnig Zingiberaceae + Note: *Seedlings of tree species; +, presence in plot analyzed; - , absent in plot analyzed

Simpson dominance index shows that dominant trees in three research location consist of several species and there were no tree species with absolute dominance. This was taken from the value of dominance index which relatively small (Table 4) from all location. All indexes are smaller than 1. Simpson dominance index is reflecting the distribution dominance. Smaller value reflects more species number dominating the communities. Dominance index value of 1 indicates that communities were dominated by a single species (Heriyanto et al. 2006). Schima wallichii is one of dominant tree species in the Cimanggu RP. Based on the RDe values, this species has

Mt. Masigit + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + +

Patengan NR + + + + + + + + + + + + + + + + + + -

the largest density in Cimanggu RP with 64 individual/ha. It means, S. wallichii has the largest population in the location. Schima is usually abundant in the forest up to high altitude of 2400 m asl. The small size and winged seeds makes it easy to spread by the wind (Sosef et al. 1995). Other dominant species in this location is Engelhardia spicata. Based on the IVI, this species has biggest size which reflected from the highest RDo with 22.01% (Table 5). Jacobs (1960) stated that E. spicata was grown with gregarious size in the tropical forests up to 2000 m asl. Other dominant trees in this location are Castanopsis javanica, Lithocarpus pallidus and Altingia excelsa.

JUNAEDI & MUTAQIEN â&#x20AC;&#x201C; Tree communities in Mount Patuha Table 4. Simpson dominance index of tree species from three research locations: Cimanggu RP, Mt. Masigit and Patengan NR. Research locations Cimanggu RP Mt. Masigit Patengan NR

Simpson dominance index 0.09178 0.08310 0.09424

Tree species in Mt. Masigit is generally dominated by Castanopsis javanica. However, the species is only dominating the density in Mt. Masigit with 121 individual/ha. This tree usually occurs in the primary and old secondary forest and highland area (Lemmens et al. 1995). Furthermore, Syzygium antisepticum is the biggest tree in this location with highest RDo value with 19.78 %. However, Lithocarpus pallidus has the largest probability to found in G. Masigit with highest RF value (Table 5). Tree communities domination pattern in Patengan NR was similar to Cimanggu RP. Tree with largest IVI value does not have the largest value of RDo. The dominant tree species in TWA Patengan is Cinchona pubescens. This species has the highest value on the parameters of RF and RDe. Population density of C. pubescens in TWA Patengan is 222 individuals/ha. This is the highest density of tree population in all three research locations. Furthermore, the highest RDo in this location was gained by Schima wallichii (Table 5). Generally, tree communities of research locations dominated by Castanopsis javanica, Lithocarpus pallidus and Schima wallichii with exception in Patengan NR. Cinchona pubescens dominating tree communities in Patengan NR. The history of quinine (kina) cultivation in this area since its first introduction of Cinchona by Junghuhn is the main factors that affecting dominance of Cinchona pubescens in Patengan NR. Kina specimen

which planted in Indonesia was the result of the botany expedition to South America by Hasskarl in 1852. It was planted in 1854 in Java, including southern area of Bandung by Junghuhn (de Padua et al. 1999). This species was one of cultivation plants that have become invasive to natural forest ecosystems (Richardson 1998). Cinchona pubescens can dominate Patengan NR tree communities because of its invasiveness, especially in the highland forest ecosystem (Lowe et al. 2000; Buddenhagen et al. 2004; McDonald et al. 1988). Main factor of it invasiveness was small seed size with wings modification. Rejmanek (2000) stated that invasiveness of woody species in disturbed land were caused by small seed mass (< 50 mg), short juvenile period (< 10 years) and short interval between large seed crops (1-4 years). Similarity analysis Similarity analyses of tree communities in three locations show relatively high similarities (Table 6). Highest similarity occurs from Cimanggu RP and Mt. Masigit. In contrast, the lowest one occurs from Mt. Masigit and Patengan NR. Castanopsis javanica, Lithocarpus pallidus, Prunus arborea, Schima wallichii and Vernonia arborea occurs in all three locations. This five tree species represent three families: Fagaceae (Castanopsis javanica and Lithocarpus pallidus), Theaceae (Schima wallichii) and Rosaceae (Prunus arborea). Van Steenis (1972) stated that Fagaceae, Theaceae and Rosaceae were dominant families in sub-montana zone in Java at the elevation of 1000-2000 m asl. It was interesting to notice that three of those five species were dominant species in all three locations. It was Castanopsis javanica, Lithocarpus pallidus and Schima wallichii (Table 5). Dispersion and distribution pattern of the species may explain this phenomenon. This entire species has clumped distribution type (Arrijani et al. 2006).

Table 5. Five dominant tree species in three research location: Cimanggu RP, Mt. Masigit and Patengan NR based on Relative Dominance (RDo), Relative Frequency (RF) and Relative Density (RDe). Important Value Index (IVI) is the sum of RDo, RF, and RDe. The highest value in each parameters has shown with bold type. Research locations Cimanggu RP

Species

Family

Schima wallichii Choisy* Theaceae Engelhardia spicata Blume Juglandaceae Castanopsis javanica A. DC.* Fagaceae Lithocarpus pallidus (Blume) Rehder* Fagaceae Altingia excelsa Noronha Hamamelidaceae Mt. Masigit Castanopsis javanica A. DC.* Fagaceae Schima wallichii Choisy* Theaceae Lithocarpus pallidus (Blume) Rehder* Fagaceae Syzygium antisepticum (Blume) Merrill & Perry Myrtaceae Engelhardia spicata Blume Juglandaceae Patengan NR Cinchona pubescens Vahl Rubiaceae Schima wallichii Choisy* Theaceae Castanopsis javanica A. DC.* Fagaceae Sloanea sigun (Blume) K. Schum. Elaeocarpaceae Lithocarpus. pallidus (Blume) Rehder* Fagaceae Note: * Species found in all locations generally dominating the tree communities

RDo

RDe

IVI

15.46 22.01 16.64 12.73 12.80 18.82 11.45 6.89 19.78 17.75 8.09 32.43 10.78 6.72 7.60

14.08 11.27 12.68 8.45 5.63 11.93 11.01 13.76 7.34 7.34 19.35 4.84 11.29 11.29 6.45

15.00 11.25 13.75 10.00 7.50 15.80 11.70 13.30 6.70 7.50 29.49 3.85 10.26 8.97 6.41

44.54 44.53 43.07 31.18 25.93 45.93 34.16 33.95 33.82 32.59 56.93 41.12 32.33 26.98 20.46

B I O D I V E R S IT A S

Table 6. Morisita similarity index of three research location: Cimanggu RP, Mt. Masigit and Patengan NR. Cimanggu RP Cimanggu RP Mt. Masigit

0,92719

Patengan NR

0,83445

Mt. Masigit

Patengan NR

0,92719

0,83445 0,756116

0,756116

Fragmentation of forest communities (forest remnants) Based on the tree composition and similarity analysis, Patengan NR tree communities was different from the natural conditions even there was lack of former studies on plant communities in this location. This was concluded from two assumptions: (1) Patengan NR tree communities have been fragmented and formerly it was a unity with Cimanggu RP and Mt. Masigit. This assumption was supported by similarity value among three locations that have a range of values 0.5 <x <1, (2) Value of similarity index between Patengan NR with two other locations are relatively small. This value indicates a small difference between Patengan NR with two other locations (Table 6). High value of similarity index between Cimanggu RP and Mt. Masigit (0.92) indicate that these two areas share the similar community, which is represented by dominant tree species composition. Castanopsis javanica and Schima wallichii are dominant trees in Cimanggu RP and Mt. Masigit. Simberloff (1998) stated plants species populations that locally abundant play an important role in their habitat. It population fluctuation can be used as indicators for other species in same communities. Patengan NR has relatively low similarity index value compared either with Cimanggu RP or Mt. Masigit. The dominance of C. pubescens in Patengan NR which is known as an introduced species explains this low value. However, this value does not indicate a significant difference in the community with the other two locations. Looking at accessibility and area perspective, Patengan NR was most accessible location compared to two other locations. Therefore, Patengan NR was very fragile to disturbance. This particular disturbance comes from human activity, this is happening because the site is adjacent to Telaga Patengan tourism area, a low slope land contour and accessibilities. Ross et al. (2002) stated that there is a relationship between fragmented areas with tree species composition in tropical forests. Main factors which can affect composition of plant species in a fragmented area are the size itself and external interference. The Smaller size area of plant communities is more sensitive to the interference experienced. Patengan NR area is relatively small compared to Cimanggu RP and Mt. Masigit. The sensitivity of Patengan NR tree communities reflected from the composition of tree species that existed. We face difficulties to explain the effects of fragmentation to the structure of tree communities of

11 (2): 75-81, April 2010

Patengan NR, because the limited time of observation and lack of previous data. Fragmentation effects to the structure of tree communities can be explained with the data covering the entire life cycle of tree species (Lienert and Fischer 2003). Generally, the age of a tree life cycle is more than ten years. The aspects that can be analyzed are the discrepancy of dominant tree species between Patengan NR as forest fragments with two other locations that considered as a forest ecosystem with has relatively natural conditions. An option to learn the composition of species in the fragmented forest is to compare them with the larger forest fragments (Vormisto et al. 2004). Cinchona pubescens dominance in Patengan forest shows the influence of fragmentation to the previous condition of community. Dos Santos et al. (2007) states that the composition of plant species in forest fragments is the result of the influence of various factors with different intensity and duration varies in times and area sizes. Habitat fragmentation effects on abundant plant species are still not many examined and need further research (Lienert 2004). Studies on the effects of fragmentation on abundant species in wetland in Switzerland showed that habitat fragmentation is not only threatening a small population of plants, but also threaten the population abundant species (Lienert and Fischer 2003).

CONCLUSIONS The tree species composition in the area around Mount Patuha which consists of Cimanggu RP, Mt. Masigit, and Patengan NR are assumed as one community that can be seen from the dominant vegetation in all three areas, i.e. Castanopsis javanica, Lithocarpus pallidus and Schima wallichii. It also showed by relatively high value of Morisita similarity index between those three locations. Tree species composition in Patengan NR tree community shows that it was more sensitive to external interference than the two other locations. This tree communities data was useful for further considerations of conservation area management around Mt. Patuha.

ACKNOWLEDGMENTS This study was supported by Floral Research and Exploration of Montane Rain Forest Project 2008. We would like to say thank you to staff of Perum Perhutani Unit III West Java and Banten and BBKSDA West Java for a lot of help during the field research and Fassa Faisal for English proof read. Thank you also addressed to Rustandi from Cibodas Botanic Gardens who have assisted in the plants identification.

REFERENCES Aldrich M, Billington C, Edwards M, Laidlaw R (1997) Tropical montane cloud forest: an urgent priority for conservation. WCMC Biodiversity Bulletin No. 2. World Conservation Monitoring Center, Cambridge.

JUNAEDI & MUTAQIEN – Tree communities in Mount Patuha Anonymous (2004a) Taman Wisata Alam Cimanggu. Resort Patengan dan Cimanggu Seksi Wilayah III BBKSDA Jabar II, Bandung. Anonymous (2004b) Wana Wisata Kawah Putih. KPH Bandung Selatan Perum Perhutani Unit III Jabar dan Banten, Bandung. Anonymous (2008) Pemantapan kawasan hutan Jawa Barat. www.dephut.go.id/files/Dishut jabar05_pemantapan_kws_htn.pdf. Arrijani, Setiadi D, Guhardja E, Qayim I (2006) Analisis vegetasi hulu DAS Cianjur-Taman Nasional Gunung Gede-Pangrango. Biodiversitas 7: 147-153. Buddenhagen CE, Renteria JL, Gardener M, Wilkinson SR, Soria M, Yanez P, Tye A, Valle R (2004) The control of a highly invasive tree Cinchona pubescens in Galapagos. Weed Tech 18: 1194-1202. Cottam G and JT Curtis (1956) The use of distance measures in phytosociological sampling. Ecology 37: 451-460. Heriyanto NM, R Sawitri, E Subiandono (2006) Kajian ekologi dan potensi pasak bumi (Eurycoma longifolia Jack.) di kelompok hutan sungai Manna-sungai Nasal, Bengkulu. Bul Plasma Nutfah 12: 69-75. Image © 2007 Terra Metrics © 2007 Europa Technologies Images © 2007 Digital Globe. http://www.google-earth.com. Jacobs M (1960) Juglandaceae. Flora Malesiana Series I 6 (1): 143-154. Lemmens RHMJ, Soerianegara I, Wong WC (1995) Plant resources of South East Asia no. 5 (2), timber trees: minor commercial timbers. Leiden: Backhuys. Lienert J (2004) Habitat fragmentation effects on fitness of plant populations-a review. J Nat Cons 12: 53-72. Lienert J, Fischer M (2003) Habitat fragmentation affects the common wetland specialist Primula farinosa in north-east Switzerland. J Ecol 91: 587-599. Lowe S, Browne M, Boudjelas S, DePoorter M (2000) 100 of the world’s worst invasive alien species: a selection from the global invasive species database. The Invasive Species Specialist Group (ISSG), Auckland. McDonald IAW, Ortiz L, Lawesson JE, Nowak JB (1988) The invasion of highland in Galapagos by the red quinine-tree Cinchona succirubra. Environ Cons 15: 215-220. McNaughton SJ (1977) Diversity and ecology communities: a comment on the role of empiricism in ecology. Amer Nat 111: 515-525. Morisita M (1959) Measuring of interspesific association and similarity between communities. Mem Fac Sci Kyushu Univ Ser Ecol (Biol) 3: 65-80.

Morrison J (2001) Western Java montane forest (IM0167). World Wildlife Fund for Nature. www.worldwildlife.org. Mueller-Dumbois D, Ellenberg H (1974) Aims and methods of vegetation ecology. John Wiley & Sons, New York. Richardson DM (1998) Forestry trees as invasive aliens. Conserv Biol 12:18-26. Ross KA, Fox BJ, Fox MD (2002) Changes to plant species richness in forest fragments: fragment age, disturbance and fire history may be as important as area. J Biogeography 29: 749-765. de Padua LS, Bunyapraphatsara N, Lemmens RHMJ (1999) Plant resources of South East Asia no. 12 (1), medicinal and poisonous plants 1. Backhuys, Leiden. Rejmanek M (2000) Invasive plant: approaches and predictions. Aust Ecol 25: 497-506. Roberts-Pichette P, Gillespie L (2001) Terrestrial vegetation biodiversity monitoring protocols. http://www.eman-rese.ca/eman/ecotools/ protocols/terrestrial/vegetation/page22.html#target1. dos Santos K, Kinoshita LS, dos Santos AM (2007) Tree species composition and similarity in semi deciduous forest fragments of southeastern Brazil. Biol Cons 135: 268-277. Simberloff D (1998) Flagships, umbrellas, and key-stone, is single-species management passed in the landscape era? Biol Cons 83: 247-257. Smith JD (1989) South East Asian tropical forests. In: Lieth, Werger. Ecosystem of the world 14 B. Amsterdam, Elsevier. Sosef MSM, Hong LT, Prawirohatmodjo S (eds) (1995) Plant resources of South East Asia No. 5 (3), timber trees: lesser-known timbers. Backhuys, Leiden. van Steenis CGGJ (1972) The mountain flora of java. EJ Brill, Leiden. Vormisto J, Tuomisto H, Oksanen J (2004) Palm distribution patterns in Amazonian rainforests: what is the role of topographic variation? J Veg Sci 15: 485-494. Whitten T, Whitten AJ, Soeriaatmadja RE, Afiff SA (1996) The ecology of Java and Bali. Periplus, Singapore. Whitten T, Whitten J (1996) Indonesian heritage: PLANT. Archipelago Press, Singapore. Whitmore TC (1984) Tropical rain forests of Far East. Clarendon Press, Oxford. Whitmore TC (1986) Montane forest. In: Vuilleumier F, Monasterio M. High altitude tropical biogeography. Oxford University Press, New York.

B I O D I V E R S IT A S Volume 11, Number 2, April 2010 Pages: 82-88

ISSN: 1412-033X (printed edition) ISSN: 2085-4722 (electronic) DOI: 10.13057/biodiv/d110206

Vegetation analyses of Sebangau peat swamp forest, Central Kalimantan EDI MIRMANTO♥ Botany Division, Research Centre for Biology, Indonesian Institute of Sciences (LIPI), Jl. Raya Bogor-Jakarta km 46, Cibinong-Bogor 16911, West Java, Indonesia, Tel.: +62-21-8765066/7, Fax.: +62-21-8765063, email: emirmanto@yahoo.co.id Manuscript received: 24 June 2009. Revision accepted: 16 September 2009.

ABSTRACT Mirmanto E (2010) Vegetation analyses of Sebangau peat swamp forest, Central Kalimantan. Biodiversitas 11: 82-88. The vegetation analysis study has been made in Sebangau peat-swamp forest, Central Kalimantan. Eight permanent plots of 50-m x 50-m were set-up distribute from close to the river with shallow peat-layer up to the inland with relatively deep peat-layer. Enumeration of trees (GBH > 15 cm) was conducted in all of 8 plots. Overall there are 133 species (taxa) were recorded within 8 plots belong to 34 families where Dipterocarpaceae, Clusiaceae, Myrtaceae and Sapotaceae were the most dominant family. Out of all species recorded, Combretocarpus rotundatus, Palaquium leiocarpum, Stemonurus scorpioides and Tristania whittiana were the most dominant species. Two community’s types namely Combretocarpus rotundatus-Shorea balangeran community and Palaquium leiocarpum-Eugenia densinervium community were recognized and they distributed in slightly different habitat condition. The sequence of these two communities’ shows significantly related to both distances to river and peat-depth. In addition there was indication the presence of habitat preference among tree species. Key words: vegetation, peat-swamp, community, Sebangau, Central Kalimantan.

INTRODUCTION The peat-swamp forests dominate in Central Kalimantan characterized by poor nutritional conditions. This is a unique and important ecosystem, but they fragile and sensitive for development. Indonesia covered by a large area of peat-swamp and heath forests, which mainly distributed in Sumatra, Kalimantan and Irian Jaya. So far, the data and information of their occurrence, range and total area are still not properly known. In fact the wetland forests (peat-swamp and heath forest) in Malesia region have been studied for more than three decades (Anderson 1961; 1963; 1964; 1972; 1983; Sambas et al. 1994; Sambas and Suhardjono 1994; Ibrahim 1997; Saribi and Riswan 1997; Shepherd et al. 1997; Siregar and Sambas 1999; Mansur 1999; Page et al. 1999; Suzuki et al., 1999; Yusuf 1999; Purwaningsih and Yusuf 2000). However, the knowledge of the peat-swamp forest especially for their biodiversity, ecological function and dynamics of this forest is still limited. Most of those previous studies reported on the floristic composition and the structure, and there was big variation among study sites. This may indicate that local environment condition play an important role in development of vegetation. Some previous studies such as Brady (1997), Shepherd et al. (1997), Stoneman (1997), and Page et al. (1999), in general reported the presence of relationship between vegetation type and peat-depth, and sequence of vegetation type from the river to the inland. However little is known about the relationship between vegetation type and distance to river and peat-depth. Aim of this study is to understand, the structure, floristic composition and communities patterns of

Sebangau peat swamp forest, and their relation to the habitat conditions. For that reason, long term ecological studies have been made by established some permanent plots on some different habitat condition sites. The present report is a part result of those long-term studies, which concern to the vegetation analyses, based on data collected from eight permanent plots.

MATERIAL AND METHODS Study site The study has been made in the Sebangau peat-swamp forest, situated at 2o18’ 24” S and 113o 55’ 4.1” E, at about 10 m above sea level. The study area is belong to Kereng Bangkirai village about 20-km southwest of Palangka Raya, Central Kalimantan. The vegetation here is characteristic of peat-swamp forest, with condition in general was flooded and with the peat layer depth varied from 2 to 10 m up. In general the sites relatively undisturbed forest, except for some places was damage due to the selective logging with varied in forest disturbance depending on the intensity of logging. According to Schmidt and Ferguson (1957) classification, the climates in those three study areas are belonging to type of A, with mean annual rainfall of about 2400 mm. The mean daily temperature varied from 25o up to 33o C, with high in humidity (up to 90%). Field survey Eight plots of 50-m x 50-m were established on a relatively undisturbed forest which is distributed along the trail from about 1 km from the river to the inland, with peat

MIRMANTO – Vegetation of Sebangau peat swamp forest

layer depth varied from 0.6 to 5 m. The distance between plots was about 500 m to 1000 m; depend on the physiognomic change of the vegetation. Within each plot the tentative species name, girth at 1.3 m above the ground (GBH) and the position of each individual were recorded for the trees with GBH > 15 cm. The voucher specimens of each tentative species name were collected for further identification.

species were observed in only 1 plot. Gymnacranthera eugeniifolia was the most frequent species (distributed in 8 plots), followed by Horsfieldia crassifolia, Stemonurus scorpioides, Nephelium maingayi and Tristania whittiana (distributed in 7 plots respectively). The species-area curves for 8 plots and Barito Ulu and Tanjung Puting plots as comparison shown in Figure 1. The most three dominant family were Clusiaceae, Sapotaceae and Myrtaceae, which occupies almost 50% of the total basal area (Table 1). However there were some variation between plots with the Sapotaceae, Rhizophoraceae, Dipterocarpaceae and Polygalaceae each leading in the basal area at some plots. Palaquium leiocarpum was the most dominant species with basal area of 6.5 m2/ha or about 12% of total basal area, followed by, Combretocarpus rotundatus, Eugenia castaneum, and Eugenia densinervium (Table 2). Those first three species were also recorded as common species in several peat-swamp forest study sites but not always become abundant species. On the other hand, Shorea balangeran and Xanthophyllum eurhynchum apparently were only distributed in a specific habitat. In Table 3, the Shannon’s diversity index in all the 8 plots was lower then in lowland mixed dipterocarp forest in Barito Ulu, but comparable to Tanjung Putting. The mean tree density was 2689 ha-1 (range 1660-3064) and the mean tree basal area was 31.5-m2 ha-1 (range 20.4-44.6). Only 0.14% of trees with a dbh > 50 cm (Figure 2) and the biggest tree was Combretocarpus rotundatus reach up to 95.5 cm in dbh.

Data analyses The vegetation data were analysis by multivariate analysis (MVSP version 3-1, Kovach Computing Service, UK) and multiple regression analysis (Statistica version 5, Stat soft, CA). Shannon’s diversity index method was used to calculate the species diversity of each plot and in addition the Tanjung Puting and Barito Ulu data (Mirmanto, unpublished data) was also including in calculation for comparison. The principal component analysis (PCA) was used in order to determine the distribution among 8 plots based on the BA. Multiple regression analysis was used to examine the relation between 2 principal component (axes) and environmental factors (peat-depth and distance to river), species richness (number of species and diversity index) and biomass (density and basal area) as independent variables. The multiple regression analysis was also used to predict the variant of PCA-score of uncommon species. Forty-eight species, which distributed in at least in 3 plots was selected for this analysis. Four factors were mean peat-depth; mean distance to Table 1. Total basal area (m2/ha) of some dominant families recorded in the study area. river; standard deviation of peat-depth and standard deviation of distance to river were used in this analysis. The Family S7 S8 S1 S2 S3 S4 S5 S6 (m2/ha) (% ) mean and standard deviation of peatClusiaceae 0.50 0.80 0.80 0.90 1.10 1.00 1.30 1.60 8.00 14.04 Sapotaceae 0.40 0.90 1.80 2.40 2.00 0.50 8.00 14.04 depth and distance to river were Myrtaceae 0.60 1.00 1.00 0.70 1.20 1.00 0.80 1.60 7.90 13.86 calculated from the data of peat-depth Rhizophoraceae 0.80 1.00 0.30 0.20 1.80 5.90 10.35 and distance to river of each plot. Based Dipterocarpaceae 0.50 0.70 0.10 0.50 0.30 0.30 0.60 0.40 3.40 5.96 on the environment data (distance to Polygalaceae 1.00 0.60 0.30 0.40 0.30 0.30 0.10 0.20 3.20 5.61 river and peat-depth) of each plot, we Euphorbiaceae 0.50 0.50 0.50 0.30 0.80 0.30 2.90 5.09 classify the study area into to 3 class of Others (27) 1.60 2.00 1.60 2.80 2.20 2.90 2.70 1.90 17.70 31.05 peat-depth (shallow < 2 m, medium 2-3 m and deep > 3 m), and 3 class of distance to river (close < 2 km, medium Table 2. Total basal area (m2/ha) of some dominant species recorded in the study area. 2-3 km and far > 3 km). The habitat preference of each species to each Species S7 S8 S1 S6 S2 S3 S4 S5 (m2/ha) (% ) habitat type was tested using Palaquium leiocarpum 0.4 0.6 1.5 2.1 1.9 6.5 11.7 Kolmogorov-Smirnov’s (K-S) test and Combretocarpus rotundatus 0.8 1.8 1.0 1.8 0.3 0.2 3.3 5.9 goodness fit test for continuous data. Eugenia densinervium 0.3 0.5 0.8 0.3 0.6 0.5 0.5 3.2 5.8 RESULTS AND DISCUSSION Floristic and forest structure Out of all trees (GBH > 15 cm) recorded in the 8 plots, there were 103 taxa belonged to 51 families. There were variations in species composition among the plots, and only 7 species of all species recorded were distributed in more than 6 plots and more then 30

Eugenia castaneum Calophyllum teysmannii Xanthophyllum palembanicum Calophyllum biflorum Gonystylus bancanus Neoscortechinia philippinensis Xanthophyllum eurhynchum Calophyllum inophyllum Acronychia porteri Horsfieldia crassifolia Blumeodendron elateriospermum Shorea guiso Other species (88)

0.1 0.2 0.3 0.6 0.1 0.3 0.2 0.1 0.1 0.3 0.2 0.2 0.1 1.0 0.2 0.5 0.1 0.3 0.2 0.9 0.3 0.2 0.2 0.1 0.1 0.1 0.2 0.1 0.2 2.9 3.4 1.8 2.6

0.2 0.4 0.4 0.2 0.1 0.7 0.4 0.1 0.4 0.3 0.1 0.1 0.6 0.4 0.1 0.1 0.2 0.3 0.2 0.2 0.4 0.2 0.6 0.1 0.4 0.1 0.1 0.1 0.7 0.3 0.3 0.2 0.1 0.2 0.3 0.1 0.3 0.3 0.2 0.3 0.2 2.9 2.1 2.7 2.7

2.1 1.6 1.3 1.6 1.4 1.6 0.2 1.3 1.2 1.1 1.2 1.2 21.1

3.8 2.9 2.3 2.9 2.5 2.9 0.4 2.3 2.2 2.0 2.2 2.2 38.0

B I O D I V E R S IT A S

11 (2): 82-88, April 2010

80 BU

S6 S5 S2 S4 S3

Sum of trees (%)

Number of species

S8 S7 S1

0 0,05

0,10

0,15

0,20

Diameter class (cm)

0,25

Unit area (ha)

Figure 1. Species-area curve of 8 plot in Sebangau (S1,..., S8), Barito Ulu (BU) Tanjung Puting (TP).

Figure 2. Diameter class distribution of trees recorded within 8 plots in the study area.

Area Forest NS D BA SDI (ha) type Barito Ulu 0.25 MDF 73 720 32.60 1.90 Tanjung Puting 0.25 PSF 62 1660 44.60 1.64 Sebangau-1 0.25 PSF 33 2160 22.80 1.68 Sebangau-2 0.25 PSF 47 2876 26.80 1.66 Sebangau-3 0.25 PSF 45 3172 30.80 1.58 Sebangau-4 0.25 PSF 46 3740 33.60 1.50 Sebangau-5 0.25 PSF 47 3680 33.20 1.47 Sebangau-6 0.25 PSF 48 3136 33.20 1.59 Sebangau-7 0.25 PSF 35 2940 20.00 1.53 Sebangau-8 0.25 PSF 39 3064 20.40 1.62 Notes: MDF=mixed dipterocarp forest; PSF= peat swamp forest Study sites

Deep <----- Axis-2 -----> Shallow Deep<----------Axis-2 ----------Shallow

0,9

Table 3. Number of species (NS), density (D=trees/ha), basal area (BA=m2/ha) and Shanon Indek Diversity (SDI) of 8 plots in Sebanagu, Barito Ulu and Tanjung Puting

0,7

0,5

0,3 S1

0,1

-0,1

S2 S3

S5 S4

-0,3 0

0,1

0,2

0,3

0,4

0,5

0,6

RiverRiver <--------------Axis-1 -----> ---------------> <----- Axis-1 Inland Inland

Ordination The contribution rate of the first principal component PCA (Axis-1) was 55.4%, and the second (Axis-2) was 10.5%. Thus the first two axes explained 65.9% of variation. Therefore, we investigated the vegetation patterns by the two axes. Figure 3 shows the distributions of plots along the two axes, which tended to correspond to both gradient of distance to river and peat-depth. The results of multiple regression analysis suggested that the Axis-1 was strongly correlated with distance to river, tree density and basal area whereas Axis-2 was more related to peat-depth (Table 4). In addition, positive correlation (R= 0.67) between distance to river and peatdepth, indicated that the peat-depth increased with increasing distance to river. On the other hand species richness (number of species and diversity index) was not significantly correlated to both Axis-1 and Axis-2. The multiple regressions of selected species provided the results that Axis-1 was significantly related with peatdepth, and Axis-2 was correlated with distance to river (Table 5). These results mean the existence of those species influenced by both peat-depth and distance to river.

Figure 3. PCA loadings of 8 plots on the coordinates of PC axes 1 and 2 in Sebangau peat-swamp forest

Table 4. Standardized coefficients of multiple regression value in order to determining variant of PCA score of 8 plots using two environmental factors (peat-depth and distance to river) and four parameters (density, basal area, number of species and diversity index) Dependent variable Axis-1 Axis-2 Peat-depth (m) 0.534* 0.714** Distance to river (km) 0.896*** 0.623* Density (tree/0.25 ha) 0.947*** 0.635* Basal area (m2/0.25 ha) 0.884*** 0.477 Number of species 0.333 0.251 Shanon Index Diversity 0.242 0.368 F 16.374*** 6.12** Note: P * <0.05; ** P < 0.01; *** P < 0.001 Independent variable

MIRMANTO â&#x20AC;&#x201C; Vegetation of Sebangau peat swamp forest Table 5. Standardized coefficients of multiple regression value in order to determining variant of PCA score of some dominant species using four environmental factors. Dependent variable Axis-1 Axis-2 Mean of peat-depth (m) 0.387*** 0.241* Standard deviation of peat-depth 0.326** 0.113 Mean distance to river (km) 0.246 0.429* Standard deviation of distance to river 0.097 0.317*** F 17.86*** 24.38*** Note: P * <0.05; ** P < 0.01; *** P < 0.001 Independent variable

Out of all selected species, almost all species showed significant habitat preference to both peat-depth and distance to river class, except for 1 species was not significant for peat-depth class and 3 species was not significant for distance to river classes (Table 6). This indicates that the distribution of species in general affected by those two environmental factors. However there are any differences in species associated to habitat preferences. The Figure 4 illustrated the distribution of some dominant species along the two axes of PCA. In general there were two main groups can be differentiated. The first group is consists of species, which distributed on shallow to medium peat-layer and close to medium distance to river; while the second group consists of species on medium to deep peat-layer and medium to far distance to river. 0,4 X.eur

S.bal

Axis-2

C.rot

E.cla

X.pal C.bif

H.crs G.ban C.ino S.gui

C.tey

N.phi

A.por

E.den

B.ela

P.lei

-0,4 -0,25

0,1

0,45

Axis-1

Figure 4. Distribution of some selected species two PCA Axis. X.eur = Xanthophyllum eurhynchum, S.bal = Shorea balangeran, C.rot = Combretocarpus rotundatus; E.cla = Eugenia clavatum, C.bif = Calophyllum biflorum, N.phi = Neoscortechinia philippinensis, H.crs = Horsfieldia crassifolia, E.den = Eugenia densinervium, G.ban = Gonystylus bancanus, A.por = Acronychia porteri, C.tey = Calophyllum teysmannii, C.ino = Calophyllum inophyllum, S.gui = Shorea guiso, B.ela = Blumeodendron elateriospermum, P.lei = Palaquium leiocarpum.

The results show that species diversity in the study area was relatively similar to others study in peat swamp forest

in Kalimantan (Table 7), but it was still lower compared to lowland mixed-dipterocarp forest at Barito Ulu (Table 2, Figure 1). Out of 133 species recorded, almost dominant species were representing characteristic of peat-swamp (cf. Anderson 1961; 1963: Simbolon and Mirmanto 2000). However there were non-indigenous species of peat-swamp recorded within some plots. The presence of nonindigenous species indicated that there was any changing in environmental condition, that to open possibility for species from out-side were able to grow and develop there. Non-indigenous species such as Macaranga caladiifolia, Macaranga spp., and Glochidion littorale were recorded within and around the shallow-peat close to river plots. Those species recognize as secondary species, which usually adaptable to various conditions such as open and disturbed forests. In addition the Glochidion littorale was also recorded as a component of the riverside disturbed mangrove forest community (Mirmanto et al. 1989), and expected as sea-dispersed species. So the occurrence of this non-indigenous species in the study area may be able to be considered as the consequence of environment change and flooding. The flooding is one factor to damage vegetation, but it depends on the frequency of flood and nature of vegetation. The period of flooding is one importance factors to stimulate habitat segregation in riparian forest (Robertson et al. 1978), which result in several of vegetation type (Inoue and Nakagoshi 2000). The presence of floodtolerance species resulted in differences species composition from riverside to the inland (Oliver and Larson 1990). In this study, as indicated by multiple regression analysis (Table 4), show that there were significant effect of both distance to river and peat-depth to distribution of vegetation patterns. Distance to river may to explain incidence of flood, with assumption that flooding usually more frequent in closer to river area. By this assumption there were at least three kind of vegetation in relation to incidence of flooding were recognized, i.e. vegetation on the frequent flood area, on infrequent flood area and on seasonally flood area. There were significantly different in floristic composition between vegetation on frequent flood area to others (ANOVA, p <0.01). Studies in flood-plain forest reported that flooding reduce the species richness (Yanoski 1982; Hupp 1992) because swept away source of recruitments. Other study (Robertson et al. 1978) however, reported that flooding is as stimulator to create the new habitat type. That means the various habitat types will be built up on the areas where the most frequent of flood occur. Consequence the most frequent flood areas should be more heterogeneous in species composition. In this study, while there was no significantly correlated between distance to river and species richness (Table 4), but indicated that species richness (expressed by diversity index) was lower in close to river plots. On the other hand, there was significant correlation between biomass (expressed by density and basal area) and distance to river. Some studies in laboratory scale (Jackson 1979; Tang and Kozlowski 1982; Save and Serrano 1986; Hurng et al. 1994; Ismail and Noor 1996) reported that for species level

B I O D I V E R S IT A S

11 (2): 82-88, April 2010

In addition, there was not too strong in correlation between basal area and distance to river Peat-depth Distance to river (R: 0.67). This indicates that any Species n Habitat Habitat other factors such as peat-depth, KS-d+ KS-d classes++ classes geography, micro-topography Combretocarpus rotundatus 53 0.273** MP 0.261* MD and perhaps disturbance also Tetramerista glabra 64 0.238** MP 0.154 F involve influencing this Shorea balangeran 52 0.273** S 0.349*** MD phenomenon. However previous Diospyros dajakensis 100 0.235** D 0.242*** F study (Suzuki et al. 1999) Horsfieldia crassifolia 158 0.191** MP 0.219*** F reported that there is close Lithocarpus elegans 76 0.217* MP 0.239*** F similarity between two Ternstroemia magnifica 64 0.117 MP 0.224** F Cratoxylum glaucum 157 0.259*** MP 0.186** F geographically different sites. Stemonurus scorpioides 196 0.352*** MP 0.194** MD Therefore, combination Gymnacranthera eugeniifolia 157 0.294*** MP 0.182*** F geographic and habitat factor Xanthophyllum palembanicum 129 0.265*** MP 0.257*** F may be better to explain the Campnosperma coriaceum 97 0.291*** MP 0.367*** MD effects of geography. In the Syzygium clavatum 115 0.269*** MP 0.277*** MD study area the effects of Blumeodendron elateriospermum 161 0.259*** MP 0.205*** F geographic was clear as Calophyllum teysmannii 143 0.239*** MP 0.211*** F expressed in cluster analysis Garcinia lateriflora 82 0.258*** MP 0.333*** F (Mirmanto, unpublished data). Acronychia porteri 205 0.366*** D 0.148 F Lithocarpus leptogyne 61 0.369*** D 0.316*** F On the other hand, the SC Sandoricum emarginatum 104 0.264*** D 0.228*** F community it was exactly Gonystyllus bancanus 97 0.272* S 0.159 MD different to other community, Nephelium maingayi 66 0.325*** S 0.249** C but there was slight difference in Xanthophyllum eurhyncum 206 0.258*** S 0.266*** C species composition among plots Notes: +) The maximum difference between the value of observed and expected relative in this community. Graniero and frequencies. Significance was tested by Kolmogorov-Smirnov goodness of fit test for Price (1999) reported that continuous data. ++) Abbreviations of habitat class as follow: D: deep peat-depth; MP: medium topography play a relatively peat-depth; S: shallow peat-depth; C: close to river; MD: medium distance to river; F: far from small role in constructing forest river. community, but topography complexity increase species Table 7. Number of species (NS), density (D), basal area (BA= m2/ha) of Sebangau plots and richness. Studies in mixedsome other studies sites. *) PSF= peat swamp forest; SPSF= shallow peat swamp forest; HF= dipterocarp forest (Baillie et al. heath forest; DPSF= deep peat swamp forest). 1987) and neotropical lowland forest (Becker and Rabenold Plot 1988) stated that Locality Site NS D BA Authors (ha) microtopograhic variation have Lahei (PSF*) 0.25 47 1612 45.40 This study an effect on water availability Sebangau (comb. of 4 SPSF*) 1.00 86 2783 12.58 This study and aeration status of soil. So, Tanjung Puting (SPSF*) 0.25 87 1660 44.60 This study the microtopographic factor Lahei (comb. of 2 HF*) 0.50 104 2290 30.75 This study perhaps is more efficient to any Sebangau (comb. of 6 DPSF*) 1.50 130 3110 31.55 This study studies in a relatively small-scale Gunung Palung (PSF*) 1.00 122 433 28.03 Sudarmanto 1994 area. Mensemat (PSF*) 1.05 86 698 24.29 Siregar et al. 1999 Multiple regression analysis Nyaru Menteng (PSF*) 0.50 64 1004 52.40 Saribi and Riswan 1997 for some selected species Ketapang (PSF*) 1.00 61 513 17.67 Sambas et al. 1994 explained the significant effects Ketapang (PSF*) 0.20 42 535 14.27 Sambas and Suhardjono 1994 of peat-depth were stronger than Tanjung Puting (PSF*) 0.75 108 812 40.03 Hamidi 1991 distance to river (Table 5). The species-habitat preference test show that almost (94%) all species were consistent flooding decrease the primary biomass productivity. This is significant to class of peat-depth (Table 7). This is similar probably physiologically of mechanism and processes in results to those reported by Newberry and Proctor (1984) plant-tissue was not working properly under water stress and Miyamoto et al. (2003) for heath forests, that condition. In fact the basal area and density in the study edaphically (soil) factor play importance role in area was also lower in closer to river plots than in the distribution of species. The influence of other variables inland. However, there was no significant effect of flooding such as micro-topographic and geographic on distribution on physiological processes for some dominant species of of vegetation patterns is not too small to be ignored. Indeed peat-swamp forest in Sebangau area (Naiola 1999). among vegetation on the same class of peat-depth and/or Table 6. Habitat classification based on species preference for peat-depth and distance to river in the study area.

MIRMANTO – Vegetation of Sebangau peat swamp forest

distance to river but geographically different were dissimilar in floristic composition. The availability of nutrient and efficiency of nutrient cycling is important factor in the distribution of forest community (Page et al. 1999). Consequently, the riverside vegetation that should be receiving more nutrients from the river flow, and the growth will be faster than inland vegetation. In addition the nutrient cycling efficiency in peat-swamp forest is relatively higher among poor nutrient soil study sites (Mirmanto 1999). The results however show that the basal area and density of closer to river community were lower than other community. A comparative study on nutrient cycling along gradient both peat-depth and distance to river is a good topic in order to explain the existence of peat swamp forest.

CONCLUSIONS The species diversity in the study area was lower compared to lowland mixed-dipterocarp forest at Barito Ulu, but it was similar to some other Kalimantan peat swamp forest studies. Almost dominant species, such as Combretocarpus rotundatus, Palaquium leiocarpum, Stemonurus scorpioides and Tristania whittiana were representing characteristic of peat-swamp. There were two communities type namely Combretocarpus rotundatusShorea balangeran community and Palaquium leiocarpumEugenia densinervium community, where their sequence shows significantly related to both distances to river and peat-depth. The results suggested that the presence of habitat preference among tree species which almost all species tested were consistent significant to class of peatdepth.

ACKNOWLEDGMENTS This work was financed by counterpart budget of Research Center for Biology under LIPI-JSPS Core University Program on Environmental Management of Wetland Ecosystems in Southeast Asia conducted under research program of “Valuation of peat-swamp forest in Central Kalimantan”. I wish to thank Dr. Herwint Simbolon, Dirman, Wardi, and Aden Muhidin of Herbarium Bogoriense; Dr. Suwido H. Limin (Director of CIMTROP, Palangka Raya University (UNPAR), Palangka Raya) and his staffs Patih, Agung, and Adi; and anonymous for much help.

REFERENCES Anderson JAR (1961) The ecological type of the peat swamp forest of Sarawak and Brunei in relation to their sylviculture [Ph.D. dissertation]. University of Edinburgh, Edinburg, Scotland. Anderson JAR (1963) The flora of peat swamp forest of Sarawak and Brunei including a catalogue of all recorded species of flowering plants, ferns and fern allies. Gard Bull Sing 29: 131-228. Anderson JAR (1964) The structure and development of the peat swamps of Sarawak and Brunei. J Trop Geogr 18: 7-16.

Anderson JAR (1972) Trees of Peat Swamp Forest of Sarawak. Forest Department of Sarawak, Kuching. Anderson JAR (1983) The tropical peat swamps of Western Malesia. In: Gore AJP (ed) Ecosystem of the world, vol. 4B: mires: swamp, bog, fen and moor. Elsevier, Amsterdam. Baillie IC, Ashton PS, Court MN, Anderson JAR, Fitzpatrick EA, Tinsley J (1987) Site characteristics and the distribution of tree species in Mixed Dipterocarp Forest on tertiary sediment in Central Sarawak, Malaysia. J Trop Ecol 3: 201-220 Becker P, Rabenold PE (1988) Water potential gradient for gaps and slope in a Panamanian tropical moist forest dry season. J Trop Ecol 4: 173184 Brady M (1997) Effects of vegetation changes on organic matter dynamics in three coastal peat deposit in Sumatra, Indonesia. In: Rieley JO, Page SE (eds) Biodiversity and sustainability of tropical peatland. Samara Publishing, Cardigan. Graniero PA, Price JS (1999) The importance of topographic factors on the distribution of bog and heath in a Newfoundland blanket bog complex. Catena 36: 233-254. Hurng WP, Lur HS, Liao CK, Kao CH (1994) Role of abcisic acid, ethylene and polymines in flooding-promoted senescence of tobacco leaves. J Plant Physiol 143: 102-105. Hupp CR (1992) Riparian vegetation recovery pattern following stream channelization: a geomorphic perspective. Ecol 73: 1209-1226. Ibrahim S (1997) Diversity of tree species in peat swamp forest in Peninsular Malaysia. In: Rieley JO, Page SE (eds) Tropical peatlands. Cardigan: Samara Publishing. Inoue M, Nakagoshi N (2000) The effects of human impact on spatial structure of the riparian vegetation along the Ashida river, Japan. Landscape Urban Plan 53: 111-121. Ismail MR, Noor KM (1996) Growth and physiological processes of young starfruit (Averhoa carambola L.) plants under soil flooding. Sci Hort 65: 229-238. Jackson MB (1979) Rapid injury to peas by soil waterlogging. J Sci Food Agric 30: 143-152. Mansur M (1999) Analisa vegetasi hutan rawa gambut di Bengkalis dan Kampar, Riau. Prosiding seminar hasil-hasil penelitian bidang ilmu hayat. Puslitbang Biologi-LIPI, Bogor. Mirmanto E, Kartawinata K, Suriadarma A (1989) Mangrove and associated plant communities in the Barito River estuary and its vicinity, South Kalimantan. Ekol Indonesia 1: 42-54. Mirmanto E (1999) Status hara daun dan serasah di hutan rawa gambut di Taman Nasional Tanjung Puting, Kalimantan Tengah. J Biol Indonesia 2: 267-275. Miyamoto K, Suzuki E, Kohyama T, Seino T, Mirmanto E, Simbolon H (2003) Habitat differentiation among tree species with small-scale variation of humus depth and topography in a tropical heath forest of Central Kalimantan, Indonesia. J Trop Ecol 19: 43-54. Naiola BP (1999) Water potential at turgor loss point of peat land forest plant species during flooding stress in Sebangau, Central Kalimantan (in Indonesian). Berita Biol 5: 341-348. Newberry DM, Proctor J (1984) Ecological study in four contrasting lowland rain forest in Gunung Mulu National Park, Sarawak. J Ecol 72: 475-493. Oliver CD, Larson BC (1990) Forest stand dynamics. McGraw-Hill, New York. Page SE, Rieley JO, Shotyk ØW, Weiss D (1999) Interdependence of peat and vegetation in a tropical peat swamp forest. Philos Trans R Soc London [Biol] 354: 1885-1897. Purwaningsih, Yusuf R (2000) Vegetation analysis of Suaq Balimbing peat swamp forest, Gunung Leuser National Park-South Aceh. Proceeding of the international symposium on tropical peatlands. Bogor, 22-23 November 1999. Robertson PA, Weaver GT, Cavanaugh JA (1978) Vegetation and tree species patterns near the northern terminus of the southern floodplain forest. Ecol Monograph 48: 249-267. Sambas EN, Susiarti S, Suhardjono (1994) Struktur dan komposisi hutan gambut di kabupaten Sanggau, Kalimantan Barat. Prosiding seminar hasil penelitian dan pengembangan sumberdaya hayati. Puslitbang Biologi-LIPI, Bogor. Sambas EN, Suhardjono (1994) Struktur dan komposisi pohon hutan gambut primer dan sekunder di kabupaten Ketapang, Kalimantan Barat. Prosiding seminar hasil penelitian dan pengembangan sumberdaya hayati. Puslitbang Biologi-LIPI, Bogor. Saribi AH, Riswan S (1997) Peat swamp forest in Nyaru Menteng Arboretum, Palangkaraya, Central Kalimantan, Indonesia: Its tree

B I O D I V E R S IT A S

species diversity and secondary succession. Seminar on tropical ecology. Shiga, 21-22 June 1997. Save R, Serrano L (1986) Some physiological and growth responses to kiwi fruit (Actinidia chinensis) to flooding. Physiol Plant 5: 301-309. Schmidt FR, Ferguson JA (1957) Rain fall types based on wet and dry period ratios for Indonesia with New Guinea. Verhandelingen 42. Shepherd PA, Rieley JO, Page SE (1997) The Relationship between forest vegetation and peat characteristics in the upper catchment of Sungai Sebangau, Central Kalimantan. In: Rieley JO, Page SE (eds) Tropical peatlands. Samara Publishing Limited, Cardigan. Simbolon H, Mirmanto E (2000) The plants of peat swamp forest in Central Kalimantan, Indonesia. Proceeding of the International symposium on tropical peatlands. Bogor, 22-23 November 1999. Siregar M, Sambas EN (2000) Floristic composition of management of Mensemat peat swamp Forest (MPSF) in Sambas, West Kalimantan.

11 (2): 82-88, April 2010 Proceeding of the international symposium on tropical peatlands. Bogor, 22-23 November 1999. Stoneman R (1997) Ecological studies in the Badas peat swamps, Brunei Darussalam. In: Rieley JO, Page SE (eds) Tropical peatlands. Samara Publishing Limited, Cardigan. Suzuki E, Kohyama T, Simbolon H (1999) Vegetation of fresh water swampy areas in West and Central Kalimantan. Berita Biol 5: 273276. Tang ZC, Kozlowski TT (1982) Some physiological and growth reponses of Betula papyrifera seedling to flooding. Physiol Plant 55: 415-420. Yanoski TM (1982) Effects of flooding upon woody vegetation along parts the Potomac River flood plain. U.S. Geological Survey Professional Paper 1206. U.S. Geological Survey, Washington DC. Yusuf R (1999) Analisis vegetasi dan degradasi jenis hutan rawa gambut bekas terbakar di Taman Nasional Tanjung Puting, Kalimantan Tengah. Berita Biol 5: 277-284.

B I O D I V E R S IT A S Volume 11, Number 2, April 2010 Pages: 89-92

ISSN: 1412-033X (printed edition) ISSN: 2085-4722 (electronic) DOI: 10.13057/biodiv/d110207

Taxonomic diversity of macroflora vegetation among main stands of the forest of Wanagama I, Gunung Kidul WIDODO1,♥, SUTARNO2, SRI WIDORETNO3, SUGIYARTO2,♥♥ 1

Faculty of Science and Technology, State Islamic University (UIN) Sunan Kalijaga, Jl. Marsda Adisucipto No. 1, Yogyakarta 55281, Indonesia, Tel. +62-274-519739, Fax. +62-274-540971, ♥ email: widodolsumarno@rocketmail.com 2 2 Department of Biology, Faculty of Mathematics and Natural Sciences, Sebelas Maret University (UNS), Jl. Ir. Sutami 36A, Surakarta 57126, Central Java, Indonesia, Tel. & Fax.: +62-271-663375, ♥♥ email: sugiyarto_ys@yahoo.com 3 3 Biology Program, Faculty of Education and Pedagogic, Sebelas Maret University (UNS), Jl. Ir. Sutami 36A, Surakarta 57126, Central Java, Indonesia Manuscript received: 29 March 2009. Revision accepted: 28 September 2009.

ABSTRACT Widodo, Sutarno, Widoretno S, Sugiyarto (2010) Taxonomic diversity of macroflora vegetation among main stands of the forest of Wanagama I, Gunung Kidul. Biodiversitas 11: 89-92. The objective of this study is to determine the diversity of taxonomy of macro flora vegetation in the main stands of the forest of Wanagama I in Gunung Kidul, Yogyakarta, Indonesia. Vegetation diversity data can be used as a recommendation for conserving the local biodiversity as well as other planned conservation activities. The nested square sampling method was applied to collect the data required in the research. The size of the nested square was based on species-area curves, as well as theories of other studies. The seven main stands studied were: pine (Pinus merkusii), mahogany (Swietenia mahagoni), kesambi (Schleichera oleosa), teak (Tectona grandis), cajuput (Melaleuca leucadendron), Gliricidia (Gliricidia sepium), and a mixed stand. Each stand was observed four times. The square location was randomly determined based on a contour map of the area. The variables of the study of diversity in terms of taxonomy consist of species, genus, family, and order richness. The results were, then, analyzed statistically using one-way Analysis of Variance (ANOVA) and Turkey’s test. The result of the study shows that the species of the main stands was affected very significantly by the diversity of all level: species, genus, family, and order total richness. The Pine stand has the highest rank in terms of number of species, genus, family, and order richness. Key words: taxonomic diversity, main stands, Wanagama.

INTRODUCTION The lost of our biological diversity in the forms of genetic erosion and species extinction is the very fundamental problem that should be addressed immediately. Basically, there are two types of conservation strategy; in-situ and ex-situ (Primack et al. 1998). The forest of Wanagama I in Gunung Kidul, Yogyakarta is a representative sample of ex-situ conservation of plants and genetic diversity (Fakultas Kehutanan UGM 2001). This artificial forest functions as conservation area of local and endemic plants of Gunung Kidul. This role is important for reducing human’s negative influences towards the nature, habitats, and wild species. The conservation efforts -whether in a big scale or a small scale- always need the data of species diversity. Nowadays, at least 1.4-1.8 million species of 30 million predicted species have been named (Soeriaatmadja 2000). There are discontents related to data inadequacy about forest organism from many researchers (Groombridge 1992; Whitmore and Sayer 1994). Biodiversity conservation and development requires a clear measurement database. IUCN/UNC/ WWF notes that in various extinction cases the measurement of losing genetic potentials is related to the hierarchy of taxonomy, because the differences in terms of position within the hierarchy reflects the size of genetic

differences (Groombridge 1992). Measuring diversity that has now been recommended is measuring genetic variation by using the hierarchy directly or indirectly. According to many scientists, the indirect ways are more practical, because the hierarchy is an easily observable measurement. Conducting biodiversity measurement of a conservation area is important to asses whether the conservation process succeeds or fails. Reports on the studies of the pattern of taxonomy of forest vegetation by counting the number of genus, family, order and other high taxa have been conducted by Foster and Hubbell (1986), Beaman and Beaman (1990), Sukristijono (1990), and Sohmer (1990). Taxon species is most often applied as the foundation of evaluating and analyzing organism distribution. In this case, the higher level of taxon like genus and family is required. The methods of measuring biodiversity that have now been developed also considers some genetic differences of species at its relative position vis a vis other taxa within the classification hierarchy. Vane-Wright (1992a,b) is a pioneer in measuring the diversity which is based on cladistic hypothetic information (evolutive ramification patterns) as a measurement of taxonomic difference. Bibby et al. (1992) applied a simple method of recognizing taxonomic uniqueness to endemic species based on diversity of genus and family, in addition to species diversity. Those various methods are important

B I O D I V E R S IT A S

applied to plant conservation. Identifying a conservation area requires such steps. Planning and organizing a conservation process also needs to conserve various populations in order to reduce organism extinction in an area (Groombridge 1992). The importance of taxonomic status in an evaluation process of species scarcity or ecology studies has long been addressed and conducted by Foster and Hubbell (1986).

11 (2): 89-92, April 2010

P1 4m

4m 8m P2

16 m

8m P3

MATERIALS AND METHODS 16 m Place and time of the field research The research has been conducted in the forest of Wanagama I, in Playen and Patuk sub-districts, Gunung Kidul district, Yogyakarta, Indonesia, from October 2002 to July 2003. Wanagama I consists of an area of 600 hectares divided into 8 main fields in which each has approximately 70 hectares. Some of the forest functions are as a conservation area of plant germplasm, especially trees. The functions are as tree recovery development; as a forest pioneer in terms of industrial plants; as multipurpose tree species, agroforestry development and so on. Materials The tools have been used to take the samples from the field consist of roll meter to determine the distance and plot wide. Plastic bags and vasculums were used as temporary containers of various unidentified plants. Other equipments were field testers, hatchets, scythes, knifes, scissors, pinsets, stationary, field books, compass, and a binocular. Label, newsprint paper, plant press, and type were used to make herbarium from unknown species. A hand counter was to count the number of individuals, while flags were used to mark the plotsâ&#x20AC;&#x2122; size. The data obtained were, then, consulted to books to identify species and taxon hierarchy determination. Methods Sampling methods Firstly, a field orientation was conducted by the help of a location map and by getting information from the forest officials. The observation areas include some plots or subplots in which the vegetations underneath were allowed to live naturally. The main stands were treated as independent variables. The wide of the main stands, numbers and types of species, family, class, macro flora vegetation underneath the forest were the dependent variables. The field of each stand having been determined as places of observation was functioned as observation stations and was used as main stand sampling and vegetation underneath the forest integrally by the method of nested quadrate double model (Soegianto 1994). The minimal plot size was based on area-species curves. The procedures refer to Sunarto (1991) and Barbour (1987). Each observation plot sizes 16x16 m2 in the case of main stands, 8x8 m2 in the case of shrubs; and 4x4 m2 in the case of herbal plants, seedlings, and saplings (Figure 1). The scheme is visualized as follows:

Figure 1. A nested-quadrat plot (Soegianto 1994).

The determination of plot locations was conducted systematically to minimize bias by considering the detail of the stands. There were a process of identifying and detailed-counting of individuals, life forms and the breasthigh diameter of trees and every plant in the plots. Observation, identification and preservation of the specimens in the laboratory The sample of plants or specimens which had not been recognized in the field were, then, identified in the laboratory by matching them to some literatures, such as Valeton (1918), Kooders (1924a,b), Meril (1949), Steenis (1954), Backer (1924, 1973), Soedarsono and Rifai (1975), Samingan (1982), Soerjani (1987), Battacarya (1992), Tjitrosoepomo (1994), and Soeryowinoto (1997). Vegetation analyses Taxonomic diversity of inter-area stands was determined for species, genus, family class taxonomic category and possibly those from higher levels. Taxon diversity was counted based on a number of particular taxon (species, genus, family, order and so on) or taxonomic richness. The method refers to Foster and Hubbell (1986), Beaman and Beaman (1990), Sohmer (1990). Data analyses Data from every parameter was analyzed statistically using Analyses of Variance (ANOVA) to determine whether there was any influence from particular stands on every dependent variable. The differences in terms of influences and response sequences by independent variable were discovered by Turkeyâ&#x20AC;&#x2122;s test to find out whether the result has any meaning (Subali 1990; Gaspersz 1991; Fry 1996).

RESULTS AND DISCUSSION Species taxon The types of the main stands had an influence on the number of plant species within the whole vegetation of the forest (Table 1). As the forest of Wanagama I is a secondary conservation forest, the result shows that the types of stand species for the pioneer of forest vegetation would consequently determine the numbers of species that

WIDODO et al. â&#x20AC;&#x201C; Macroflora taxonomy in the forest of Wanagama I

would live within. Every plant or tree species which has become the stands has particular characters of morphology, physiology, and biochemistry. Those characters have two kinds of influences; on physico-chemistry environment and on biotic environment. The physico-chemistry environment consists of soil stone structure, soil erosion, the structure of soil texture, nutrient types and component of soil, soil similarity, soil humidity, light intensity, and other microclimate components. The biotic environment consists of microflora and microfauna richness, flora and fauna distribution. According to Polunin (1990), plants (vegetations) have particular influences on various types of soil changes and other plants (allogenic influence). The existence of certain species would influence the presence or the absence of other species. The fact resulted from the research supports an assumption that there was a species richness variation within a local variation. It is very well supported by Kohyama (1997) that spatial heterogeneity of vegetation is a resultant of micro resources and environment which then forms vegetation architectures, including the compiler species (Table 1). Pine stands contain the highest number of species, while Gliricidia stands have the lowest one. Pine stands have a canopy structure which enables light to reach the soil, hence it is possible for other plants to grow, i.e. trees, shrubs, and herbs. On the contrary, Gliricidia stands have a canopy structure that enables only a part of light to reach the soil. Consequently, these kinds of stands have the lowest species richness. The ability of high dispersal and density of sapling in the form of blush and clamp at the main stands is assumed to have been the cause of the shortage of other species. Genus taxon The number of genus among the stands also shows some differences. It means that there was an influence of the types of stands on the vegetation profile of the forest as a whole (Table 1). Pine stands have the highest number of genus diversity. Statistical evidence confirms that the pine stands were different significantly to other stands. Gliricidia stands have the lowest genus diversity compared to other stands. Mahogany, kesambi and mixed stands show indifferent genus diversity. While teak stands were similar to cajuput stands. Generally, plant species found in the field are heterogeneous, consisting of various genera. Only some of them are from the same genus, for instance salam and jambu air. They are the members of Eugenia genus and

from acacia type. This makes the data of the number of genus between stands is relatively same as the data of the number of species. Between plants in a genus, the morphological character was relatively similar, although there were many species in a genus. Foster and Hubbell (1986) stated that species diversity is parallel to genus diversity in a natural forest. Stuessy et al. (1998) counted the number of flowering plants in Juan Fernadez Island and found that there were 73 families, 234 genus, 383 species. From this study, it is understood that the number of the genus is similar to the number of species. Family taxon This study shows that the number of family found in the stands influences the number of family of the forest vegetation as a whole (Table 1). As the data confirmed, the pine stands have the highest number of family diversity, while the Gliricidia stands have the lowest one. This fact is due to a big number of families found in the forest is monogeneric (consists of only one genus or one species). As a consequence, the number of family diversity is parallel to the number of the genus and species diversity. From the conservation perspective, the pine has the highest potential of genetic conservation because they contain a relatively high number of species, genus, and family diversity. In addition, the patterns of family, genus, and species diversity in the stands are similar to those of the whole forest because Wanagama I is a secondary forest. As a secondary forest, some stands are actually introduced by species brought from other areas and even other continents. Human influences on the forest are a significant factor that determines the dynamics of the forest community, although these influences had begun since a long time ago.

Order taxon The type of stands influences the number of order diversity in the forest (Table 1). The pine stand contains the highest number of order diversity, while the Gliricidia has the lowest one. The mahogany, teak, cajuput, and mixed stands have the similar number of order diversity. Kesambi stand was in the second after the pine stand. The statistics confirms that the kesambi stand was significantly different to any other stands. The result of this study shows that the type of main stands influences the size/ the diversity/ the density of vegetations in the level of species, genus, family, and order. As a comparison, Foster and Hubbell (1986) found that high level of taxonomy, such as family is not parallel with species and genus. The presence of Table 1. Average number of macroflora taxon (species, genus, family, order) between stands taxon (species, genus, family, in Wanagama I. order) in an area is related to abiotic components of the Stands Taxon Pine Mahogany Kesambi Teak Cajuput Glerecidae Mix environment, like precipitation Species 33.25a 22.25 b 23.50 b 17.00 bc 21.00 bc 14.50 c 23.50 b rate, humidity, daily and seasonal a b b bc bc Genus 33.00 22.25 21.00 16.50 18.25 14.00 c 22.75 b temperature changes, and elevation Family 22.00 a 16.25 b 17.25 b 14.00 bc 14.00 bc 11.50 c 17.25 b (Stuessy 1990). Geological Order 17.25a 10.75 b 14.50 b 12.25 bc 11.75 bc 9.25 c 10.75 b characteristics may also influence Information: the same letter from the same line shows that there is no real different at the distribution of a taxon. In Turkeyâ&#x20AC;&#x2122;s test. Îą= 0.05.

B I O D I V E R S IT A S

addition, the biotic factors contribute to the dynamics of the organisms living in the area. In general, Stuessy et al. (1998) describes factors that determine the proportion of taxon in an area. Those are: spatial (geographic) factors, environmental (ecologic) factors, internal reproductive factors (incompatibility, hybrid problems), and external reproductive factors (temporal/phenologic factors and mechanism of reproduction factors, e.g. flower structures and autogamy).

CONCLUSIONS AND SUGGESTIONS The number of species, genus, family and order of macroflora vegetation within the forest of Wanagama I, was affected by the types of the main stands. The Pine stands have the highest number compared to any other main stands. The fields within the forest should be used as sources of germplasm or genetic variation of local and wild plants by means of allowing them to live (without intensive cutting and so on). It requires further research to discover the benefits of genetic advantages owned by the wild plants, especially from the group of local shrubs, local clumps and local trees exploratively.

REFERENCES Backer CA (1924) Exkursions flora von Java. Verlag von Gustav Fischer, Jena. Backer CA (1973) Weed flora of Javanese sugar cane fields. vol. 7. atlas. Ysel Press, Deventer. Barbour MG (1987) Terrestrial plant ecology. Benjamin Cummings, Singapore. Battacarya B (1992) Taxonomy of flowering plant. Benjamin Cummings, New Delhi. Beaman JH, Beaman RS (1990) Diversity and distribution patterns in the flora of Mount Kinabalu. In Baas P (ed) The plant diversity of Malesia. Kluwer, Dordrecht. Bibby JC, Crosby MJ, Heath MF, Johnson TH, Long AJ, Stattersfield AJ, Thirgood SJ (1992) Putting biodiversity on the map: global priorities for conservation. ICBP, Cambridge. Fakultas Kehutanan UGM (2001) Peringatan 35 tahun hutan Wanagama I. Fakultas Kehutanan UGM, Yogyakarta. Foster RB, Hubbell S (1986) Commonest and rarity in Neotropical forest: implications for tropical trees conservation. In: Soule ME (ed) Conservation biology, the science of scarcity and diversity. Sinaeur, Massachusetts.

11 (2): 89-92, April 2010 Fry JC (1996) Biological data analysis, a practical approach. Oxford University Press, Oxford. Gaspersz V (1991) Metode perancangan percobaan untuk ilmu-ilmu pertanian, teknik, biologi. Armico, Bandung. Groombridge B (1992) Global biodiversity, status of earthâ&#x20AC;&#x2122;s living resources. Chapman and Hall, London. Kohyama T (1997) The Role of Architecture in Enhancing Plant Species Diversity. In: Higashi M (ed) Biodiversity. Springer, New York. Kooders SH ( 1924a) Exkursionsflora von Java. Alias 4. Ableilung: I. Halfle: Familie 50. Verlag von Gustav Fischer, Jena. Kooders SH (1924b) Exkursionsflora von Java. Alias 4. Ableilung. 2. Halfte: Familie 50. Verlag von Gustav Fischer, Jena. Polunin N (1990) Pengantar geografi tumbuhan. Gadjah Mada University Press, Yogyakarta. Primack RB, Indrawan M, Prayitno B (1998) Biology konservasi. Gadjah Mada University Press, Yogyakarta. Samingan T (1982) Dendrologi. Gramedia, Jakarta. Soedarsono A, Rifai MA (1975) 50 Gulma di perkebunan. Balai Pustaka, Jakarta. Soegianto A (1994) Ekologi kuantitatif. Usaha Nasional, Surabaya. Soeriaatmadja RE (2000) Pelestarian keanekaragaman hayati pulau Jawa dan Bali. Dalam: Setyawan AD, Sutarno (ed) Menuju Taman Nasional Gunung Lawu; prosiding semiloka nasional konservasi biodiversitas untuk perlindungan dan penyelamatan plasma nutfah di pulau Jawa. Jurusan Biologi FMIPA UNS, Surakarta. Soerjani M, Jahja A, Koostermans GH, Tjitrosoepomo G (1987) Weeds of rice in Indonesia. Balai Pustaka, Jakarta. Soeryowinoto SM (1997) Flora eksotik tanaman hias berbunga. Kanisius, Yogyakarta. Sohmer SH (1990) Elements of Pacific phytodiversity. In Baas P (ed) The plant diversity of Malesia. Kluwer, Dordrecht. Steenis CGGJ van (1954) Flora Malesiana Seris I. Spermatophyta. Noordhoff-Kolff NV, Djakarta. Stuessy TF, Crawford D, Carera CM (1998) Isolating mechanism perm of the Juan Fernandez Island. In: Stuessy TF, Ono M (eds) Evolution and speciation of island plants. Cambridge University Press, London. Stuessy TF (1990) Plant taxonomy, the systematic evaluation of comparative data. Columbia University Press, New York. Subali B (1990) Rancangan percobaan dan analisis statistika. Jurusan Pendidikan Biologi, FPMIPA IKIP, Yogyakarta. Sukristijono S (1990) The secondary forest of Tanah Grogot, East Kalimantan Indonesia. In: Baas P (ed) The plant diversity of Malesia. Kluwer, Dordrecht. Sunarto H (1991) Praktikum ekologi tumbuhan, petunjuk untuk pelatihan dosen LPTK. Universitas Gadjah Mada, Yogyakarta. Tjitrosoepomo G (1994) Taksonomi tumbuhan. Gadjah Mada University Press, Yogyakarta. Valeton T (1918) New notes on the Zingiberaceae of Java and Malaya. Curcuma. Bull Jard Bot Buitenzorg Ser 2 (27): 1-81. Vane-Wright RI (1992a) Systematics and diversity. In: Groombridge B (ed) Global biodiversity: status of the earth's living resources. Chapman and Hall, London. Vane-Wright RI (1992b) Systematics and the global biodiversity strategy. Antenna 16: 49-56 Whitmore TC, Sayer JA (1994) Tropical deforestation and species extinction. Chapman and Hall, London.

B I O D I V E R S IT A S Volume 11, Number 2, April 2010 Pages: 93-96

ISSN: 1412-033X (printed edition) ISSN: 2085-4722 (electronic) DOI: 10.13057/biodiv/d110208

Diversity of parasitoid Lepidopterans larvae on Brassicaceae in West Sumatra NOVRI NELLYâ&#x2122;Ľ, RUSDI RUSLI, YAHERWANDI, FENI YUSMARIKA Department of Plant Protection, Faculty of Agriculture, Andalas University (UNAND), Limau Manis, Padang 25163, West Sumatra, Indonesia, Tel. +62-751-7059580, Fax.: +62-751-7270, e-mail: novrinelly@yahoo.com Manuscript received: 5 May 2009. Revision accepted: 22 October 2009.

ABSTRACT Nelly N, Rusli R, Yaherwandi, Yusmarika F (2010) Diversity of parasitoid Lepidopterans larvae on Brassicaceae. Biodiversitas 11: 9396. Diversity of parasitoid lepidopterans larvae on Brassicaceae was conducted in several Brassicaceae areas in West Sumatra. The objective of the research was to study the diversity of parasitoid lepidopterans larvae on Brassicaceae. Sampling was conducted on Brassicaceae plants: cabbage, cauliflower, petsai and sawi. It was taken five samples in every plot, by using W method. Collection technique was done by direct collecting larvae, by using yellow trap and insect net. Adult of parasitoids was identified until family. The result of the research indicated that there was the diversity of parasitoid lepidopterans, the highest diversity was found on sawi. The number of parasitoid Lepidopterans larvae found was 566, 83 species, 9 families. The degree of parasitation on the three plants was low. Key words: Brassicaceae, diversity of parasitoid, Lepidoptera.

INTRODUCTION Some of Brassicaceae family is cabbage (Brassica oleraceae L var capitata L), cauliflower (Brassica oleraceae var botrytis L), sawi (Brassica juncea) and petsai (Brassica chinensis). These plants are a kind of an important vegetable in West Sumatra and as vitamin resources for human. Brassicaceae is a host of Lepidopteran pests, such as Crocidolomia pavonana Fabricius (Lepidoptera: Pyralidae), Spodoptera litura Fabricius (Lepidoptera: Noctuidae) and Plutella xylostella Linn (Lepidoptera: Plutellidae) (Sudarmo 2001; Nelly 2006). Disaster that is emerged by Lepidoptera in several host plants are depended on part of attacked plant. C. pavonana larvae eat the young green leaves first and crop center, this larvae eat all of crop center. The heavy attack causes plant die, due to crops are not able to make the new buds (Prijono and Hasan 1992). S. litura larvae attack affected host plants, and the hosts are not capable to produce owing to heavy attack, only leafâ&#x20AC;&#x2122;s veins are left (Permadi and Sudarwohadi 1993). To control Lepidoptera, farmers only used pesticide, whereas using insecticide affect pest natural enemies, which may result in pest resistant, pest resurgence, exploding secondary pest, health problem and environmental contamination (Untung 2006). Integrated Pests Management (IPM) is an alternative strategy to control pests, through effectively using insecticide, and environmentally sound. Biopest management is a technique to manage the population of pests by predators, parasitoids, and pathogens (Untung 2006). Some of parasitoids that can handle population of pests in Brassicaceae are parasitoids of larvae. Parasitoids of larvae are effective to control Lepidoptera in

Brassicaceae (Nelly et al., 2008). Parasitoids of larvae which have been invented include Tachinidae family (Diptera), Ichneumonidae (Hymenoptera), Braconidae (Hymenoptera) (Kalshoven 1981). Information about parasitoids of larvae in West Sumatra are limited, to support IPM for specific location needs a research about variety aspect of parasitoids of Lepidopterans larvae in West Sumatra. Based on that, this research was done to observe the diversity parasitoids of Lepidopterans larvae in some species of Brassicaceae in West Sumatra. MATERIALS AND METHODS Study site Parasitoid was collected from Brassicaceae plants in Aia Angek, Tanah Datar District and Bukit Tinggi, Agam District, West Sumatra Province; at February to April 2007. Plotting sample Parasitoids Lepidopterans larvae were taken from 4 plots, those plots were cabbage, cauliflower, sawi, and petsai. Plots wide were about 300-400 m respectively. In each plot, sub plots (2x2 m2) were made, from which sample was taken. These sub plots were arranged systematically by line with W method. Larvae were collected 4 times with interval 2 weeks. Collecting parasitoid of Lepidopterans larvae Collecting parasitoid directly from host larvae Larvae were collected from plot sample and all larvae kept in a box 35x27x7 cm3. Larvae were reared in

B I O D I V E R S IT A S

11 (2): 93-96, April 2010

laboratory until emerging all parasitoids. All adults parasitoid were collected in micro tube with alcohol 70% for identification.

Diversity index of parasitoid larvae Diversity index of parasitoid larvae species calculated by Shanon Wienner formula with used by Krebs (2000).

Using yellow trap Yellow trap was made from a plastic tray with size 15x25 cm2 and height 7 cm. This trap was set in free place, so insects can reach it easily. That trap was filled up with soap solution 2/3 part of trap height. This solution was used to decrease the surface strain so the insects are trapped and die. There was a trap in each sample plot, and the traps were putted there for 24 hours. All trapped insects were collected in film tubes filled with alcohol 70%, for preservation, and the insects were further identified.

H = Index of diversity S = Amount parasitoid larvae species Pi = Proportion morphospecies parasitoid larvae to total populations

Using insect net Adult insects were trapped by insect net in field. Insect net was a cone net with a circle of wire which diameters 30 cm. Samples were collected from each sample plots by swinging the insect net left and right for 20 times. All trapped insects were collected in film tubes filled with alcohol 70% for preservation, and the insects were then identified. Identification Adult parasitoid collections that emerged from larvae and traps were identified until family level. And then, identification was done based on morphospecies or code only. Identification followed by Goulet and Huber (1993) and CAB International (1999). In this research was used amount of individual, species, family, diversity, and species disseminating of parasitoid lepidopterans larvae. Especially for degree of parasitation, index of diversity, and species disseminating are analyzed in sub chapter data analysis. Data analysis Degree of parasitation (%) Degree of parasitation were calculated by

P = Degree of parasitation n = Amount of emerging adult parasitoid N = Amount each kind Lepidoptera larvae collected

RESULTS AND DISCUSSION Amount of individual, species, family of parasitoid larvae Lepidoptera in several species of Brassicaceae Observation result about amount of species and family parasitoid are showed by Table 1. The biggest individual and species amount were found in cauliflower. It was because cauliflower has bigger Lepidoptera attack than the others. Some pests attacked cauliflower were C. pavonana, S. litura, and P. xylostella, it was compatible with the result of Cahyonoâ&#x20AC;&#x2122;s research (2001) and Nelly et al. (2008). If the larvae populations are high, the parasitoids are a lot too. The dominant parasitoid larvae were from Hymenoptera and Diptera (Goulet and Huber 1993). Tachinidae was the biggest individual amount and Braconidae was the biggest species amount. Tachinidae can attack 8 insect orders, and Lepidoptera is the common host. Tachinidae is a family in order of Diptera which has the biggest parasitoid species; it is about 8000 species in the world (Habazar and Yaherwandi 2006). Sturmia sp. is a species of Tachinidae family which often find in West Sumatra. Populations of these parasitoids are increasing as the increase of host population (Nelly 2006). High population of parasitoids in field was predicted as the ability to survive on insecticide. Cocoon of pupa is predicted as a protecting factor on insecticide too. Braconidae is a family of order Hymenoptera which has the biggest parasitoid species; it is about 40.000 species and 18 subfamilies. Braconidae has been used for biopest management, mainly for aphids (Homoptera), Lepidoptera, Coleoptera and Diptera (Goulet and Huber 1993). The smallest individual amount was found in petsai. This could be due to petsai has short life period, about 4-5 weeks. So only a little larvae attacked this plant and parasitoids too.

Table 1. Idividual amount, species, and family parasitoid larvae of Lepidoptera in several species of Brassicaceae Order Hymenoptera Hymenoptera Diptera Hymenoptera Hymenoptera Hymenoptera Hymenoptera Diptera Diptera Total

Family Bethylidae Braconidae Cecidomyiidae Encyrtidae Eulophidae Ichneumonidae Mutillidae Phoridae Tachinidae

Cabbage Individual Species 0 0 30 5 10 1 4 1 18 1 24 7 5 2 1 1 33 1 125 19

Plant Cauliflower Sawi Individual Species Individual Species 1 1 0 0 37 7 38 5 8 1 5 1 8 1 17 1 23 1 15 1 34 10 24 0 5 1 4 1 2 1 0 0 52 1 46 1 170 24 149 20

Petsai Individual Species 0 0 32 7 6 1 6 1 11 1 13 5 2 2 3 1 49 2 122 20

NELLY et al. â&#x20AC;&#x201C; Parasitoid lepidopterans larvae on Brassicaceae

Percentage parasitoid larvae in several species of Brassicaceae showed by Figure 1. Tachinidae was a dominant parasitoid larva, which attack Lepidoptera in some species of Brassicaceae. In cabbage, Tachinidae attacked 27%, cauliflower 30%, sawi 31%, and petsai 40%.

Larvae C. pavonana were the smallest individual and species amount which were parasited by parasitoid larvae. To control C. pavonana, farmers still use synthetic insecticide. They thought this is the easiest way to against pests. According to Sahari (1999) using insecticide can kill pestâ&#x20AC;&#x2122;s larvae and parasitoids around the farm. Percentage amount of parasitoid larvae that were collected with some collecting techniques showed by Figure 3. The dominant parasitoid larvae in yellow trap were Braconidae (31%). In insect net, the dominant family was Tachinidae (56%). According to larval collection, the dominant parasitoid in C. pavonana were Ichneumonidae and Tachinidae, it were 50% respectively. In S. litura, the dominant family parasitoid larvae were Braconidae (37%), whereas in P. xylostella, the dominant family parasitoid larvae were Ichneumonidae (77%).

Individual and species amount of parasitoid larvae with some collecting techniques Result of observation about individual and species amount showed by Table 2. Yellow trap could trap more individual than insect net. Most of insects interest to yellow. Yaherwandi (2005) and Yaherwandi et al. (2006) stated that yellow trap is an effective tool for collecting parasitoid from Hymenoptera. Most of Hymenoptera parasitoid is interested to yellow, so this tool is effective to use in parasitoid diversity study. Larvae of P. xylostella is a big host of parasitoid larvae. P. xylostella is not only attacked by Ichneumonidae, but Braconidae too. According to Kalshoven (1981) parasitoid larvae of P. xylostella which has been invented as Diadegma eucerophaga Horst or Diadegma semiclausum Hellen (Hymenoptera, Ichneumonidae). This Parasitoid was introduced in 1950 for the first time to control P. xylostella. This parasitoid can grow, because it has easy character to find the host, and the high parasitation ability even though in low population. This parasitoid can attack larvae P. xylostella from instart first to fourth in field (Sastrosiswojo 1996).

Diversity index, disseminating, and variety of species Observation result for diversity, disseminating, and variety of species in Brassicaceae showed by Table 3. Diversity in some Brassicaceae species was not different significantly. The highest diversity was found in sawi. In general, diversity rate of parasitoid larvae Lepidoptera were heterogenic. This was clearly shown by four of those plants were found 3 families parasitoid larvae, which their numbers were more than the other family. The families were Ichneumonidae, Braconidae, and Tachinidae. They were the biggest family which attacked Lepidoptera.

21%

24%

27%

26%

Bethyl i dae 26%

31%

30%

Ceci domyi i dae 40%

Encyr ti dae Eul ophi dae

5% 1%

4% 3%

3% 14%

19%

14%

Ichneumoni dae Muti l l i dae

11%

3% 16%

20%

Br aconi dae

10%

2%2%

Phor i dae Tachi ni dae

11%

Figure 1. Percentage individual and family parasitoid larvae of Lepidoptera in several species of Brassicaceae: A. cabbage, B. cauliflower, C. sawi, D. petsai.

Table 2. Individual and species amount of parasitoid larvae which were collected by some collecting techniques. Technique Yellow trap Insect net Individual Species Individual Species Hymenoptera Bethylidae 1 1 0 0 Hymenoptera Braconidae 105 7 22 5 Diptera Cecidomyiidae 9 1 20 1 Hymenoptera Encyrtidae 27 1 4 1 Hymenoptera Eulophidae 62 1 5 1 Hymenoptera Ichneumonidae 48 10 24 9 Hymenoptera Mutillidae 11 3 5 1 Diptera Phoridae 6 1 0 0 Diptera Tachinidae 70 2 104 1 Total 339 27 184 19 Note: CP = C. pavonana, SL = S. litura, PX = P. xylostella Order

Family

Larvae collection CP SL PX Individual Species Individual Species Individual Species 0 0 0 0 0 0 0 0 4 4 6 3 0 0 0 0 0 0 0 0 4 1 0 0 0 0 0 0 0 0 3 1 0 0 20 6 0 0 0 0 0 0 0 0 0 0 0 0 3 1 3 1 0 0 6 2 11 6 26 9

B I O D I V E R S IT A S

Table 3. Diversity index, disseminating, and variety of species Cabbage Cauliflower Sawi Diversity index Disseminating index Species variety

3.36 0.12 36.00

3.40 0.11 42.00

3.64 0.15 42.00

Petsai 3.42 0.12 43.00

The highest disseminating species was found in sawi. Diversity rate influenced disseminating degree. Disseminating rate in four of plants was low because the spreading of insects was not spread evenly. Disseminating value was about zero to one. If the value is near to zero, it means distribution of insects in ecosystem does not spread evenly, but if it near to one, it means more disseminated (Elkie et al. 1999). The highest variety of species was found in petsai, it was 43 species. It was because in petsai was found fixtitious hosts for parasitoid larvae. Planting system that was used by farmer in petsai was an emerging factor of fixtitious host. The lowest variety species was found in cabbage, it was 36. It was caused by disturbing on ecosystem in each planting seasons, agronomy activities, and harvest. The heavy disturbing showed low species and short food net. So only a little species can adapting and it influence to species amount of parasitoid larvae (Landis and Haas 1992; Marino and Landis 2000).

CONCLUSIONS Diversity parasitoid larvae in West Sumatra in several Brassicaceae species are heterogenic. The highest diversity was found in sawi, it was 3.64. The highest disseminating species was found in sawi, it was 0.15. Petsai was the highest in variety of parasitoid larvae species, it was 43. Parasitoid larvae Lepidoptera which found in some species of Brassicaceae in West Sumatra were 566 individual and 83 species in 9 families. The most parasitoid larvae in field were family Tachinidae. Parasitation rate of parasitoid larvae in three of Lepidoptera was low. The most pests from Lepidoptera in Brassicaceae are Crocidolomia pavonana with parasitoid larvae from Ichneumonidae and Tachinidae family. Average parasitation for both of them were 0.56% and 0.53%, respectively. Spodoptera litura was parasited by larvae Braconidae, Tachinidae, and Encyrtidae with average parasitation rate were 0.65%, 1.07%, and 1.26%, consecutively. Plutella xylostella was parasited by parasitoid larvae Ichneumonidae and Braconidae with average parasitation rate were 18.77% and 6.53%, respectively.

11 (2): 93-96, April 2010

ACKNOWLEDGMENTS Thank to the Director of DP2M Directorate General of Highest Educations (Dikti). This project was funded by Directorate General of Highest Educations through Fundamental research on behalf of Novri Nelly. Contract number: 023/SP2H/ PP/DP2M /III/2007.

REFERENCES CAB International (1999) International compedium of entomology. CAB International, New York. Cahyono B. 2001. Kubis Bunga dan Brokoli Teknik Budaya dan Analisis Usaha Tani. Kanisius, Yogyakarta. Elkie PC, Rempel RS, Carr AP (1999) Patch analyst userâ&#x20AC;&#x2122;s manual: a tool for quantifying landscape structure. Queenâ&#x20AC;&#x2122;s Printer for Ontario, Ontario. Goulet H, Huber JT (1993) Hymenoptera of the world: an identification guide to families. Research Branch Agriculture Canada Publication, Ottawa. Habazar T, Yaherwandi (2006) Pengendalian hayati hama dan penyakit tumbuhan. Andalas University Press, Padang. Kalshoven LGE (1981) The pest of crop in Indonesia. PT Ichtiar Baru Van Hoeve, Jakarta. Krebs CJ (2000) Program for ecological methodology [software]. 2nd ed. Addison Wesley Longman, New York. Landis DA, Haas MJ (1992) Influence of landscape structure on abundance and within-field distribution of European corn borer (Lepidoptera: Pyralidae) larval parasitoids in Michigan. Environ Entomol 21: 409-416. Marino PC, Landis DA (2000) Parasitoid community structure: implication for biological control In: Ekbom B, Irwin M, Robert Y (eds) Interchanges of insects. Kluwer, Amsterdam. Nelly N, Yaherwandi, Gani S, Apriati (2008) Kajian parasitoid Eriborus argenteopilosus Cameron (Hymenoptera: Ichneumonidae) asal Nagari Aie Angek, Kabupaten Tanah Datar, Sumatera Barat pada Spodoptera litura Fabricius (Lepidoptera: Noctuidae). J Saintek 11: 53-58. Nelly N (2006) Kelimpahan populasi Sturmia sp parasitoid larva Crocidolomia pavonana F. (Lepidoptera: Pyralidae) di daerah Alahan Panjang, Sumatera Barat. J Manggaro 4: 14-19. Permadi AH, Sudarwohadi S (1993) Kubis. Balai Penelitian Hortikultura, Lembang Bandung. Prijono D, Hasan E (1992) Life cycle and demografi of Crocidolomia binotalis Zeller (Lepidoptera: Pyralidae) on brocolli in laboratory. Indonesian J Trop Agric 4: 18-24. Sahari B (1999) Studi enkapsulasi parasitoid Eriborus argenteopilosus (Cameron) (Hymenoptera: Ichneumonidae) dalam mengendalikan Crocidolomia binotalis Zeller (Lepidoptera: Pyralidae) dan Spodoptera litura Fabricius (Lepidoptera: Noctuidae) [Skripsi]. Fakultas Pertanian Institut Pertanian Bogor, Bogor. Sastrosiswojo S (1996) Biological control of the diamondback moth in IPM system. Asia BCPC Symposium Proceeding no. 67: Biological Control Introduction Sudarmo (2001) Effect of ectract Aglaia odorata Lour. (Meliaceae) to Crocidolomia binotalis Zell. (Lepidoptera:Pyralidae) and parasitoid E. argenteopilosus Cameron (Hymenoptera: Ichneumonidae) [Tesis]. Program Pasca Sarjana Institut Pertanian Bogor, Bogor. Untung K (2006) Pengantar pengelolaan hama terpadu. Gadjah Mada University Press, Yogyakarta. Yaherwandi, Manuwoto S, Buchori D, Hidayat P, Budiprasetyo L (2006) Analisis spasial lanskap pertanian dan keanekaragaman Hymenoptera di Daerah Aliran Sungai Cianjur, Bogor. Akta Agrosia 10: 76-86. Yaherwandi (2005) Keanekaragaman Hymenoptera parasitoid pada beberapa tipe lanskap pertanian di Daerah Aliran Sungai (DAS) Cianjur, Kabupaten Cianjur Jawa Barat [Disertasi]. Sekolah Pasca Sarjana Institut Pertanian Bogor, Bogor.

B I O D I V E R S IT A S Volume 11, Number 2, April 2010 Pages: 97-101

ISSN: 1412-033X (printed edition) ISSN: 2085-4722 (electronic) DOI: 10.13057/biodiv/d110209

Tapping into the edible fungi biodiversity of Central India ALKA KARWA, MAHENDRA K. RAI♥ Department of Biotechnology, Sant Gadge Baba Amravati University, Amravati 444602, Maharashtra, India, Tel.: +91-721-2662208-9, ext. 267, Fax.: +91-721-2662135, 2660949, e-mail: pmkrai@hotmail.com Manuscript received: 9 July 2009. Revision accepted: 24 August 2009.

ABSTRACT Karwa A, Rai MK (2010) Tapping into the edible fungi biodiversity of Central India. Biodiversitas 11: 97-101. Melghat forest in Central India was surveyed for occurrence of wild edible fungi and their prevalent favorable ecological factors. Studies were carried out for three consequent years in the months of June to February (2006-2008). A total of 153 species of mushrooms were recorded, collected, photographed and preserved. The enormous biomass in the forest favors variety of edible and medicinal mushrooms. Dominating species belong to genera Agaricus, Pleurotus, Termitomyces, Cantharellus, Ganoderma, Auricularia, Schizophyllum, Morchella, etc. The biotechnological potential of these important mushrooms is needed to be exploited. These studies will open new avenues in improvement of breeding programs of commercially cultivated mushroom species. Key words: biodiversity, mushrooms, Agaricus, Pleurotus, Ganoderma, medicinal.

INTRODUCTION Fungi are considered the largest biotic community after insects (Sarbhoy et al. 1996). Yet only a small fraction of total fungal wealth has been subjected to scientific scrutiny and the new generation hi tech mycologists have to unravel the unexplored and hidden wealth. Out of 1.5 million fungi around the globe, only 50% are characterized until now and one third of total fungal diversity of the globe exists in India (Butler and Bisby 1960; Bilgrami et al. 1979, 1981, 1991; Manoharachary 2002; Manoharachary et al. 2005). Mushrooms comprise largely the group of fleshy fungi, which include bracket fungi, fairy clubs, toadstools, puffballs, stinkhorns, earthstars, bird’s nest fungi and jelly fungi. Generally they live as saprophytes however some are serious agents of wood decay. All types of mushrooms are important in decomposition processes, because of their ability to degrade cellulose and other plant polymers. Besides they serve as natures trash burners and soil replenishers and thus help in rejuvenating the ecosystem. Ample species of wild edible and medicinal mushrooms occur in all the biodiversity rich regions during the rainy season. India being the top ten mega diversity has innumerable mushroom species and their ethno mycological importance. The wood of living or dead trees, or the leaf litter or the soil produces mushroom through the branching mycelial infiltration. Some mushrooms are found growing in association with trees of a particular family or genus. Though India has rich macro fungal biodiversity, most traditional knowledge about mushrooms come from the far East countries like China, Japan, Korea, Russia where mushrooms like Ganoderma, Lentinus, Grifola and others were collected and used since time immemorial. Most of the mushrooms grow abundantly in nature and their

commercial harvest is being undertaken for benefit in these countries. Recent reports show a tradition of wild mushroom picking, their consumption and sale in the market in countries like Mexico, Italy, Australia and many others (Arora 2008; Guzman 2008; Sitta and Floriani 2008). However, the ecological data available on some of the taxa is still not enough and systematics of wild mushrooms has received more attention than other threatened aspects like conservation. Melghat forest is a Tiger Reserve situated in Satpuda mountain ranges in Maharashtra State in India and is located on longitude 76o 54 'E to 77o 33 'E and latitude 21o15' N to 21o 45' N and altitude 350 m to 1178 m above sea level. Being a reserve forest much part of it is undisturbed and hence unrevealed. The biodiversity of the region is unique and is attributable to intermingling forests of medicinal plants like Tectona grandis, Dendrocalamus strictus, Shorea robusta, Terminalia belerica, T. arjuna, and Emblica officinalis. The diversity of geographical and climatic conditions prevalent in this forest makes the region a natural habitat of a number of edible and medicinal mushrooms. In this paper major groups of fungi of Central India are discussed briefly to highlight the extent of diversity and this is followed by the examples of habitats that are unique and deserve greater attention.

MATERIALS AND METHODS Frequent visits to the Melghat forest of Maharashtra, India were made during the late summers, pre-monsoon, monsoon and post-monsoon times from June to February for three consecutive years (2006-2008). Mushrooms were carefully picked and primary identifications based on

B I O D I V E R S IT A S 11 (2): 97-101, April 2010.

morphology were carried out. Fruit bodies of different stages were collected for better understanding and identification. The location, vegetation around and period of the year were noted down for convenience of repeated visits. Since different species of fungi and their fruiting bodies are associated with certain plants soil porosity, soil type and pH as well as nutrient availability also help determine the species of edible fungus growing in a location. So, all the minute details were recorded. After returning to the laboratory, macroscopic and microscopic examinations were performed for assigning systematic nomenclature to the collection. Help of eminent mycologists/taxonomists were taken in identification of a species when in doubt. Fruit bodies at young stage were used for regeneration of mycelial culture in synthetic medium. Spore prints were taken, dried and preserved. All the basidiomycetes fruit body collection was preserved mostly dried and a few were kept in formalin-glycerol-ethanol. The successful mycelial cultures were maintained.

RESULT AND DISCUSSION As mushrooms make micronutrients available as food for the trees and other plants with which they co exist, and since those trees and other plants provide nutrients for the fungi, acid rain and the changes that occur in ecosystems, because of the acidity seem to create problems for these fungi. In the top four to eight inches of the forest floor acid rain adversely affects the natural pH of the environment, which in turn adversely affects the fungiâ&#x20AC;&#x2122;s ability to convert nutrients into useful forms. Radically changing an ecosystem as is done with clear cutting and so many other financially driven environmental policies also adversely affect the survival of fungi and their fruiting bodies. Fungal ecology as concerns the majority of species has more to do with sustainable land use practices than it does with currently fashionable agricultural and forest methodologies. A majority of fungal species including many good edible ones have not been successfully cultivated because it is not feasible to re-create their growing conditions in isolation from their normal environment. Mushrooms act as a sponge holding water for forest. As the forest covers sod and diverse biological associations in which they are living is altered, then their ability to reproduce and survive is jeopardized. Mushrooms are a nutritionally functional food and a source of physiologically beneficial and non-inventive medicines. In nature, mushrooms grow wild in almost all types of soils, on decaying organic matter, wooden stumps, etc. They appear in all seasons; however rains favor rapid growth when organic matter or its decomposition products are easily available. About 10,000 species within the overall fungal estimates of 1.5 million belong to this group. Mushrooms alone are represented by about 41,000 species, of which approximately 850 species are recorded from India (Manoharachary et al 2005). More than 2000 species of edible species are reported in the literature from different parts of the world. Singer (1989) had reported 1320 species belonging to 129 genera under Agaricales.

Deshmukh (2004) has compiled the folk medicine value of the Indian Basidiomycetes besides recording nearly 60 wild mushrooms, representing 54 species in 36 genera around Mumbai. Among fungi, basidiomycetes in particular have attracted considerable attention as a source of new and novel metabolites with antibiotic, antiviral, phytotoxic and cytistatic activity. Among the new targets used in the medicinal value are antitumour and immunomodulatory actions of unusual polysaccharides of these macrofungi (Berochers 1999; Ooi and Liu 2000). Besides extensive surveys of the Himalayan region that are compiled by Lakhanpal (1996), records from Punjab, Kerala and Western Ghats have been published during the last decade (Pradeep et al. 1998; Atri et al. 2000). What is noteworthy is the component of macro fungi that is mycorrhizal and therefore determines ecosystem dynamics of forests. For example, Lakhanpal (1997) has recorded that in a survey conducted in the North-Western Himalayas during 19761987, 300 species of mushrooms and toadstools were recovered; of these, nearly 72 species in 15 fungal genera were observed to enter into mycorrhizal relationship with Abies pindrow Royle, Betula utilis D.Don, Cedrus deodara (Roxb.) Loud, Picea smithiana (Wall.) Boiss, Pinus roxburghii Sarg, Pinus wallichiana A.B. Jackson, Rhododendron arboreum Smith, Quercus incana Roxb. and Quercus semecarpifolia Smith. As many as 24 fungal species were found to be associated with Q. incana alone. In terms of the relative number of species, Ectomycorrhizal genera declined in the order; Amanita > Boletus > Lactarius > Hygrophorus > Cortinarius. There was clearcut host specificity as well, with Amanitas primarily associated with conifers and Boletus and Russula with oaks; forests exhibiting dominance of Ectomycorrhizal hosts, however, had low tree diversity. While many mushrooms have a cosmopolitan distribution (Suryanarayanan and Hawksworth 2004), certain species of mushroom producing fungi are associated with particular kinds of trees and plants (Hawksworth 1991; Ananda et al. 2002). Little explored and extreme habitats are the good places to search for edible and medicinal mushrooms. During our surveys, looking for a certain type of mushroom, we commonly seeked out associated trees or forest types of Central India as good hunting locations, e.g. Cantharellus cibarius was always found in mossy sloping hardwood forests. The thick-footed morel was typically found in rich hardwood forests especially in flood plains. Field mushrooms Agaricus campestris and fairy ring mushrooms or scotch bonnets Marasmius oreades were found growing in fertilized meadows and pastures, lawns often abundant and forming fairy rings or arcs from early monsoons to winter. Agaricus species could be found throughout the monsoons scattered in grassy areas and lawns. Boletus edulis was found during late summer and early rains as sparsely distributed and generally associated with pines. Scattered to gregarious Lycoperdons are widely distributed typically under hardwoods and occasionally with pine and found during the late summer throughout the monsoon and extending to winters.

KARWA & RAI â&#x20AC;&#x201C; Edible fungi in Central India

Figure 1. Mushroom collection showing mostly basidiomycetes and a group of Lycoperdons on top right.

Figure 2. Mushroom collection showing species belonging to different families

100

B I O D I V E R S IT A S 11 (2): 97-101, April 2010.

The diversity spectrum of mushrooms varies greatly as Morels do not generally occur in dry weather and low altitude. A number of morel species are recorded all over the north western Himalayas. Morchella occurs at an altitude of 1100-2700 m from sea level. Such area is an excellent location for collecting fresh specimens in early rainy season. Here in Central India the Melghat forest region Morchella conica was collected from two sites during late monsoons. The wild edible gasteromycetous mushroom species like Podaxis pistillaris and Phellorina inquinans thrive well in North western arid part of Rajasthan (Doshi and Sharma 1997). Podaxis pistillaris was abundantly spotted during the pre-monsoon climate in Melghat region and is eaten raw by some people. Calvatia cyathiformis is widely distributed in meadows, grassy areas lawns and open woods during late summer to early winter. Cantharellus cibarius is often found in groups in mixed woods, or in association with Dendrocalamus strictus. The duration of occurrence of Cantharellus is only for 15 days during mid-August. Four species of Termitomyces are found during the heavy and thundering rains widely distributed and often abundant scattered or in arcs on the ground in deciduous and mixed woods, as well as in fields. These are Termitomyces heimii, T. microcarpus, T. medius and T. species. Pleurotus ostreatus or the oyster mushroom is found through rainy season throughout winters during cool wet weather and is widely distributed in dense clusters or in shelving masses on a variety of hardwoods both living and dead. Hericium erinaceus the Hedgehog mushroom was located usually solitary arising from trees stumps and logs of broad leaved trees during late winter. Lactarius is found during hot weather in late summer scattered to gregarious in deciduous and pine woods in shaded lawns as well as in deciduous or mixed woods. Volvariella volvacea was found in early monsoon during hot weather and is solitary to gregarious often growing from wounds on living trees as well as on dead trees and logs of hardwood or on piles of decaying vegetable matter or piles of leaves and compost heaps. Medicinal mushrooms like species of Ganoderma, Trametes, Daldinia, Geastrum, Scleroderma, Ramaria, Auricularia, Schizophyllum and many other Polypores were collected in different seasons. This region of Central India has a rich mycobiodiversity that is yet to be fully explored. This study was an attempt to survey and collect valuable wild forms of mushrooms to know the mycotreasure in association and on surface of the forest lands. A total of 153 mushrooms were located at different places, collected and taxonomically identified, some of them being reported for the first time. These were keyed to 47 genera and 26 families (paper communicated). This paper deals with few important of them indicating the richness of the region. The important mushrooms are shown in Figures 1 and 2. Toadstools, which are associated with trees, form mycorrhiza, a symbiotic association (Harley 1969) while others are severe parasites, e.g. Armillaria mellea that destroys a wide range of woody and herbaceous plants. A few fleshy fungi are notorious in being poisonous, however, a majority is harmless and many are good to eat

(Ramsbottom 1953). Mushrooms occur in various shapes, size and color and have attracted the attention of naturalists and are thus prized as drawings, paintings, sculptures, etc. Despite of all the interesting features little space is given to study of extent of mushroom biodiversity and the need for its conservation. The distribution of edible fungi through out the world is closely related to the distribution of green plants. These fungi in combination with bacteria play an active part in the natural decomposition of organic matter. In addition, soil fungi store carbon dioxide and cause various chemical reactions and water fungi help purify polluted waters (Kumaresan and Satyanarayanan 2001; Maria and Sridhar 2002). Mushrooms grow in diverse environments of soil as well as water. All species of mushrooms reduce ground water and moisture. Different mushrooms grow on organic matter in different stages of decay. Thus a species that can be found in a certain location depends greatly upon the type of decomposing matter available and its current state of decomposition. CONCLUSIONS It was strongly felt that amongst the vast number of living forms very little attention has been paid to conservation of fungal biodiversity. Many fungal species are on threat due to loss of natural habitats, soil and air pollution, expansion of mono-cropping and loss of genetic diversity. For the smooth functioning of this terrestrial ecosystem, the conservation of mushroom diversity is critical. Keeping in view this enormous mushroom treasure it is the high time to fully conserve this biodiversity. And hence a timely research regarding isolation, identification and characterization of the existing mushroom flora is essential. Biotechnological tools can be employed in order to achieve the in situ and ex situ conservation of many of the mushroom species. This region of Central India has a rich mycodiversity that is yet to be fully explored. This study was an attempt to survey and collect valuable wild forms of mushrooms to know the mycotreasure in association and on surface of the forest lands. At the same time there are certain mushroom species that can be cultivated on a variety of substrates. For example due to its ability to degrade lignin, cellulose and hemi cellulose, Pleurotus sajor-caju is grown on a variety of agro waste. This biodegradation of lignocelluloses is mediated through the production of extracellular degradative enzymes like laccase, polyphenol oxidase, peroxidase, exoglucanase, endoglucanase, Î˛-glucoxidase, xylanases and laminarinase. Thus, there is need to develop indigenous technologies for utilizing the residues which originate from agricultural, industrial and municipal sources and serious efforts are essential for achievement of biodegradation through mushroom cultivation. ACKNOWLEDGEMENTS The first author is thankful to Department of Science and Technology, Government of India, New Delhi for the financial assistance obtained to carry out this study.

KARWA & RAI – Edible fungi in Central India

REFERENCES Ananda K, Sridhar KR (2002) Diversity of endophytic fungi in the roots of mangrove species on west coast of India. Can J Microbiol 48: 871878. Arora D (2008) Notes on economic mushrooms: Xiao Ren Ren: the little people of Yunnan. Econ Bot 62: 541-544. Atri NS, A Kaur, SS Saini (2000) Taxonomic studies on Agaricus from Punjab plains. Indian J Mushroom 18: 6-14. Berochers AT, Stem JS, Hackman RM, Keen CL, Gershwin ME (1999) Mushrooms, tumours and immunity. Proc Soc Exp Biol Med 221: 281-293. Bilgrami KS, Jamaluddin, Rizvi MA (1979) The fungi of India part I (list and references). Today and Tomorrow’s Printers and Publishers, New Delhi. Bilgrami KS, Jamaluddin, Rizvi MA (1981) The fungi of India part II (list and references). Today and Tomorrow’s Printers and Publishers, New Delhi. Bilgrami KS, Jamaluddin, Rizvi MA (1991) The fungi of India part III (list and references). Today and Tomorrow’s Printers and Publishers, New Delhi. Butler EJ, Bisby GR (1960) The fungi of India. (Revised by RS Vasudeva). ICAR, New Delhi. Deshmukh SK (2004) Biodiversity of tropical basidiomycetes as sources of novel secondary metabolites. In: Jain PC (ed) Microbiology and biotechnology for sustainable development. CBS Publishers and Distributors, New Delhi. Doshi A, Sharma SS (1997) Wild mushrooms of Rajasthan. In: Rai D, Verma (eds) Advances of mushroom biology and production. Mushroom Society of India, Solan, India. Guzman G (2008) Hallucinogenic mushrooms of Mexico: an overview. Econ Bot 62: 404-412. Harley JL (1969) The biology of mycorrhiza. 2nd ed. Leonard Hill, London. Hawksworth DL (1991) The fungal dimension of biodiversity: magnitude and significance and conservation. Mycol Res 95: 641-655.

101

Kumaresan V, Suryanarayanan TS (2001) Occurrence and distribution of endophytic fungi in a mangrove community. Mycol Res 105: 13881391. Lakhanpal TN (1996) Mushrooms of Indian Boletaceae. Vol. I. In: Mukherji KG (ed). Studies in cryptogamic botany. APH Publishing Corporation, Delhi. Lakhanpal TN (1997) Diversity of mushroom mycoflora in the NorthWest Himalaya. In: Sati SC, Saxena J, Dubey RC (eds) Recent researches in ecology, environment and pollution. Today and Tomorrow’s Printers and Publishers, New Delhi. Manoharachary CS (2002) Biodiversity, conservation and biotechnology of fungi. Presidential Address, Section-Botany, The 89th Session of Indian Science Congress, Indian Science Congress Association, Lucknow, India, January 3-7, 2002. Manoharachary CS, Singh KR, Adholeya A, Suryanarayanan TS, Rawat S, Johri BN (2005) Fungal biodiversity: distribution, conservation and prospecting of fungi from India. Curr Sci 89: 58-71. Maria GL, Sridhar KR (2002) Richness and diversity of filamentous fungi on woody litter of five mangroves along the west coast of India. Curr Sci 83: 1573-1580. Ooi VE, Liu F (2000) Immunomodulation and anticancer activity of polysaccharide-protein complexes. Curr Med Chem 7: 715-729. Pradeep CK, Virinda KB, Mathew S, Abraham TK (1998) The genus Volvariella in Kerala state, India. Mushroom Res 7: 53-62. Ramsbottom J (1953) Mushrooms and toadstools - a study of activities of fungi. Colling, London. Sarbhoy AK, Agarwal DK, Varshney JL (1996) Fungi of India 19821992. CBS Publishers and Distributors, New Delhi. Singer R (1989) The Agaricales in modern taxonomy. 4th ed. J. Cramer, Weinheim. Sitta N, Floriani M (2008) Nationalization and globalization trends in the wild mushroom commerce of Italy with emphasis on Porcini (Boletus edulis and allied species). Econ Bot 62: 307-322. Suryanarayanan TS, Hawksworth DL (2004) Fungi from little explored and extreme habitats. In: Deshmukh SK, Rai MK (eds) The biodiversity of fungi: aspects of the human dimension. Science Publishers, Enfield.

BIODIVERSITAS Volume 11, Number 2, April 2010 Pages: 102-106

ISSN: 1412-033X (printed edition) ISSN: 2085-4722 (electronic) DOI: 10.13057/biodiv/d110210

Structural development and bioactive content of red bulb plant (Eleutherine americana); a traditional medicines for local Kalimantan people EVI MINTOWATI KUNTORINI1,♥, LAURENTIUS HARTANTO NUGROHO2 1

Biology Program, Faculty of Mathematics and Natural Sciences, Lambung Mangkurat University (UNLAM), Jl. Ahmad Yani Km 35.8, Banjarbaru 70714, South Kalimantan, Indonesia, Tel./Fax.: +62-511-4773868, e-mail: evimintowati@yahoo.com 2 Faculty of Biology, Gadjah Mada University (UGM), Yogyakarta 55284, Indonesia Manuscript received: 23 September 2009. Revision accepted: 21 October 2009.

ABSTRACT Kuntorini EM, Nugroho LH (2010) Structural development and bioactive content of red bulb plant (Eleutherine americana); a traditional medicines for local Kalimantan people. Biodiversitas 11 (2): 102-106. Red bulb plant or “bawang dayak” (Eleutherine americana Merr.) is commonly used as a traditional medicine especially for anti breast cancer of Kalimantan people, because it contains bioactive naphtoquinone-derivatives. Naphtoquinones is usually used as antimicrobial, antifungal, antiviral and antiparasitic agents. This study was aimed to complete the investigation of Red bulb plant as a traditional medicine from anatomical and phytochemical point of view, especially the anatomical structure of bulb and leaf of red bulb plants during their development and their naphtoquinone derivative contents. The anatomical structures of bulb and leaf were analyzed by paraffin embedding method and naphtoquinone derivative contents were analyzed using HPLC. During plant development, the diameter and the length of bulbs as well as the thickness of mesophyll and epidermis layers of the leaves increased significantly. The size of vascular bundles increased and so did phloem and xylem components. The content of bioactive compounds in bulbs increased significantly as the size of parenchymal cells increased. There was no significant difference in the content of bioactive compounds of leaves during development, despite the rise in the thickness of mesophyll and the constituting cells as the location of synthesis. Key words: development, bulb, leaf, Eleutherine americana, naphtoquinone.

INTRODUCTION Red bulb plant or “bawang dayak” (Eleutherine americana Merr.) has been widely used as traditional medicine. Bulbs of the plants have been used against breast cancer by local people of Kalimantan, against heart diseases, and function as immunostimulant, antiinflammation, anti-tumor and, anti-bleeding agent (Sa’roni et al. 1987; Saptowalyono 2007). Studies demonstrated that bulbs of Eleutherine (E. bulbosa and E. americana) contain naphtoquinones (elecanacine, eleutherine, eleutherol, eleutherinone) (Hara et al. 1997; Alves et al. 2003; Jinzhong et al. 2006; Nielsen and Wege 2006; Han et al. 2008). Naphtoquinones, recognized to exhibit antimicrobial, antifungal, antiviral, and antiparasitic properties, and to demonstrate bioactivity as anti-cancer and antioxidant, are usually located within cell vacuoles in the form of glycosides (Herbert 1995; Robinson 1995; Babula et al. 2005). Biosyntheses of secondary metabolites may take place in any cell and tissue. However, the syntheses usually occur in specific cell or tissue and depend on the level of differentiation and development of the plant. Consequently, plant structures play important roles in various aspects of life (Wink 1990; Utami 2007). During a preliminary study, microscopic examination of leaves and bulbs of red bulb

failed to reveal any secretory cell. Presumably, the bioactive compounds were hidden within vacuoles or cytosol. This study aimed to learn more about the use of red bulb plant as a traditional medicine especially in the structure and development of leaves and bulbs of red bulb, describe and quantitatively analyze bioactive compounds in leaves and bulbs during plant development, and reveal the relationship between structural development and bioactive content in leaves and bulbs of red bulb.

MATERIALS AND METHODS Red bulb plant used in the study originated from Banjarbaru, South Kalimantan, and was grown in a glass house. Leaf-less seedlings with bulb diameter of 0.3-0.5 cm were individually transferred to a polybag containing 3 kg of soil. Seedlings were also grown on open site, directly on the soil without polybag. Samples of leaves and bulbs were taken from glass-house plants every two weeks for six times: 2-12 weeks after planting (wap), representing treatments (observations) T1-T6. Control plants on open site were sampled at 4 (T2) and 12 (T6) wap. Samples T2 and T6 from open site and glass house were compared for bioactive contents. Single-stain paraffin embedding method

KUNTORINI & NUGROHO – Structural development and bioactive of Eleutherine americana

(Ruzin 1999) was applied in preparation of microscopic slides for examination of leaf mesophyll thickness, number of stomata, lower and upper epidermis thickness, as well as xylem and phloem of bulbs. Leaf clearing method of Berlyn and Miksche (1976) was applied in slide preparation for observation of the number of stomata. Bulb diameter and length and number of leaf were also recorded as supplementary data. The quantity of overall naphtoquinone-derived compounds was analyzed with High Performance Liquid Chromatography (HPLC), using vitamin K (phyloquinone) as a model. Qualitative data was described and displayed as figures, while quantitative data was exposed to ANOVA, followed by Duncan’s Multiple Range Test (DMRT) with 5% significance level, or its equivalent nonparametric test.

RESULTS AND DISCUSSION Leaf structure and development On average, new shoots appeared within 14 days (Table 1). Insignificant difference between T3 (3.4) and T4 (3.8) was possibly due to inappropriate environmental condition which hindered the initiation of new leaves and delayed leaf initiation process. In a constant environment, leaf primordia appeared on the stem tip in a constant rate for a certain genotype. Time interval between successive leaf primordia is called plastochron. Temperature, light, and other factors have been demonstrated to affect plastochron development (Gardner et al. 1985). Among treatments for mean thickness of both upper and lower epidermis revealed significant differences with Kruskal Wallis test (Table 1). They could be inferred the increase of the thickness on upper and lower epidermis layer during plant development. Leaf cross section showed uneven thickness in the two layers, thicker in some part but thinner in other part (Figure 1). Mauseth (1988) suggested that in Monocotyledoneae, e.g. Iridaceae and Liliaceae, leaves need longer time to develop. While the distal part of the leaf has fully developed and showed active photosynthesis, the basal part was still growing and developing. That indicates that during observation the epidermis was still growing, increasing in thickness as the plant getting older.

103

Mean number of stomata per mm2 in upper epidermis showed significant difference (i.e. a decrease), during development (Table 1). This was related to the elongated shape of the cells of upper epidermis and to the cell growth. Cells of upper epidermis increased more in length rather than thickness (Akan et al. 2007; Satil and Selvi 2007). During cell extension up to T4, no stoma was formed, and consequently the mean number of stomata per mm2 was altered. However, during T4-T6 cell length was constant and accordingly the number of stomata was not significantly different. Cell elongation is a part of cell extension in which growth tends to occur towards one direction, usually along the plant axis (Fosket 1994). The number of stomata in lower epidermis differed significantly only between T1 (177.78/mm2) and T2 (262.22/mm2), while later observations did not show significant difference (Table 1). This indicated that as T1 stomata were formed, subsequently epidermal cells grew through division and extension. The mean number of stomata in lower epidermis was higher than that in upper epidermis with univariate t-tests, except at T1. Leaves of terrestrial plants usually have stomata only in lower epidermis. In herbs stomata can be found in both upper and lower surfaces, but higher quantity occurs in the lower epidermis. This represents an adaptation for prevention of excessive water loss due to exposure to sunlight. To control water loss through transpiration, plants tend to have fewer stomata in upper surface and more in lower surface (Tjitrosomo 1985; Salisbury and Ross 1995). No significant difference was found between T1 and T2 in terms of mesophyll thickness (43.9 µm and 46.7 µm, respectively) (Table 1). This implies that cell division at the leaf basal meristem was still on going and more dominant than leaf cells enlargement. Mesophyll thickness did not differ significantly either between T3 (52.3 µm) and T4 (52.2 µm). During leaf development, red bulb plants could take some time to proceed from active division at basal meristem to enlargement of the cells. On the other hand, an increase in mesophyll thickness was observed between T5 (58.5µm) and T6 (66.9 µm) indicating cell enlargement. In Monocotyledoneae, such as Iridaceae and Liliaceae, leaf growth takes a relatively long time. While distal part of leaf reaches maturity and hosts active photosynthesis, the basal part is still growing and meristematic (Mauseth 1988; Westhoff et al. 1998).

Table 1. Mean number of leaves, thickness of upper and lower epidermis, number of stomata on upper and lower epidermis, and thickness of mesophyll during red bulb plant development in glass house. Thickness of Thickness of Number of stomata on Number of stomata on Thickness of upper epidermis lower epidermis upper epidermis per lower epidermis per mesophyll (µm)* (µm)* (mm2) (mm2) (µm) T1 2 1.2a 20.0 16.6 137.38a 177.78a 43.9a T2 4 2.2b 18.8 18.6 115.56ab 262.22b 46.7a T3 6 3.4c 17.7 21.0 93.33bc 235.56b 52.3b T4 8 3.8c 17.5 21.9 66.67cd 244.44b 52.2b T5 10 4.6d 21.5 21.8 62.22d 240.00b 58.5c e d b T6 12 5.8 24.3 26.2 57.78 244.44 66.9d Note: Numbers followed by similar alphabet within the same column are not significantly different in DMRT with α = 5%; *: nonparametric Kruskal Wallis test Weeks after planting (wap)

Number of leaves

B I O D I V E R S IT A S 11 (2): 102-106, April 2010

104

sc st x f

m bs

c st

st sc

Figure 1. Cross section of a leaf of 12 wap plant grown in glass house. bs: bundle sheath; ue: upper epidermis; le: lower epidermis; f: phloem; c: crystal; st: stomata; sc: sclerenchym; x: xylem; m: mesophyl. Bar = 100 um.

x f

f T1

x f T4

x f

f T5

Figure 2. Cross section of vascular bundle in bulbs during plant development in a glass house. x: xylem; f: phloem; p: parenchymal cells; c: styloid crystall. T1: 2 wap; T2: 4 wap; T3: 6 wap; T4: 8 wap, T5: 10 wap; T6: 12 wap. (wap: weeks after planting). Bar = 100 um.

Bulb structure and development Observable development of anatomical structure in bulbs showed differences in the size of vascular bundle and the constituent cells, particularly among T1, T2, and T3 (Figure 2). During T4-T6 the size of vascular bundle did not noticeably differ, but there was an increase in the quantity of cells making up xylem and phloem. The vascular bundle was of collateral type where xylems are parallel with phloem without cambium. Enlargement of cells of bulbs was predominantly towards one direction, i.e. elongation of bulb. Cell elongation is a part of cell extension in which growth proceeds towards one direction, usually along plant axis. Direction of the cell extension is also controlled by the orientation of cellulose microfibrils of the cell wall (Fosket 1994; Westhoff et al. 1998). Bulbs are derived from thickening petioles in which the vascular bundles are similar to those in leaves. No

supportive tissue or schlerencyma was found in bulbs. Between main vascular bundles in each layer of a bulb smaller vascular bundles were found with simpler structure and cell arrangement, parallel to each other in a cross section. Microscopic examination of bulbs disclosed styloid crystals similar to those in leaves. Various shapes of crystal were found in plant cells. In higher plants, the most common crystal is calcium oxalate. Styloid crystals have long prismatic shape with two ends pointed. In cells, these crystals are solitary. Styloid is usually found in plants of the family Iridaceae, Agavaceae, Liliaceae and several others (Dickison 2000). Bioactive compounds The quantity of bioactive compounds in leaves did not differ significantly between T2 and T6, but so did in bulbs (Table 3).

KUNTORINI & NUGROHO â&#x20AC;&#x201C; Structural development and bioactive of Eleutherine americana Table 3. Mean quantity of bioactive compounds in leaves and bulbs at 4 (T2) and 12 (T6) wap Bioactive compounds in Bioactive compounds leaves in bulbs Observation (area) (area) Glass Glass Open site Open site house house a a a T2 (4 wap) 1528348 2336205 2830361 2670425a T6 (12 wap) 1722076a 2888872a 6278518b 3876370b Note: Numbers followed by similar alphabet within the same column are not significantly different with Îą = 5%.

HPLC analysis confirmed that naphtoquinone-derived bioactive compounds were already detectable in leaves and bulbs since the first observation (T1) with a retention time of 4.731 min. Biosyntheses of the naphtoquinone-derived bioactive compounds are chloroplast-related. In the present study, vitamin K (phyloquinone) was used as the benchmark compound. Phyloquinone is produced by higher plants and plays important role in photosynthesis (as the second electron acceptor in photosystem I). Photosystem I is located in thylacoid membrane, as a light-dependent system (Salisbury and Ross 1995; Sansuk 2002; Verberne et al. 2007). It is then assumed that phyloquinone synthesis begins during differentiation of chloroplast-forming cell to mesophyll tissue. Factorial experiment proved that the titer of bioactive compounds in leaves at 4 wap (T2) and 12 wap (T6) were not significantly different both in glass house and open site (Table 3). The experiment showed no interaction between planting site and time of observation factors in their effect on the syntheses of the bioactive compounds. That means that during plant development, despite an increase in the thickness of mesophyll tissue, the quantity of the bioactive compounds remains insignificantly different. Then, the naphtoquinone-derived compounds are synthesized in leaves and subsequently transported to storage organs. Sansuk (2002) and Gross et al. (2006) pointed out that phyloquinone biosynthesis takes place in chloroplast membrane. Wink (1990) suggested that in most plant species biosynthesis takes place in a specific organ, and the product is then accumulated in different organs or throughout the plant body. Biosynthesis of secondary metabolites may take place in any tissue and cell; however most occur in a specific tissue or cell and largely depending on the level of differentiation and development. Manitto (1981) pointed out that a substance may be produced and used almost simultaneously, so that the concentration in an organ or organism remains constant. Descriptive examination on anatomical structure of bulbs revealed that cells of parenchymal tissue at T1, T2, and T3 were somewhat small with few starch granulecontaining vacuoles (Figure 2). The structure of xylem and phloem vascular bundles was comparably simpler than that at later observations. That means that bulbs as storage organs were still in their early development. The cell size and the simplicity of vascular tissue components as the transport system for products of assimilation and other compounds explained the low accumulation of bioactive compounds. With increasing age of the plant at T4, T5 and

105

T6, the size of parenchymal cells of bulbs increased, the size of vacuoles also increased, the vacuolar starch granules were more numerous and more variable, and the number of cells composing xylem and phloem vascular bundles likewise raised (Figure 2). Factorial experiment involving two times of observation (T2 and T6) in glass house and open site disclosed significant difference in overall level of bioactive compounds in bulbs (Table 3). That indicated that in both glass house and open site there was an increase in bioactive compound contents of bulbs during plant development, although the maximum level was still unknown. The increase in the size of parenchymal cells of bulbs might be related to their function as the storage place for naphtoquinone-derived bioactive compounds. As no secretory cell was found in leaves and bulbs, it can be assumed that the bioactive compounds are synthesized in cytosol and subsequently stored in vacuoles. Babula et al. (2005) suggested that naphtoquinone is usually stored in vacuoles of plant cells in the form of glycoside, and can be found in a number of plants of the family Plumbaginaceae, Juglandaceae, Ebenaceae, Boraginaceae, and Iridaceae. Difference in planting site did not affect the synthesis of the bioactive compounds as the content was similar between those grown in glass house and open site at T2 and T6. Robbers et al. (1996) highlighted that synthesis of bioactive compounds in plants is influenced by 3 main factors: heredity (genetic make up), ontogeny (developmental stages) and environment. The hereditary factor causes quantitative and qualitative changes, while the other two factors cause mainly quantitative change. Synthesis of secondary metabolites is not a simple process; rather it is a complex process involving interaction among biosynthesis, transport, storage, and degradation processes. Those processes are gene-regulated. The influence of ontogeny is clearly visible on secondary metabolite syntheses in plants; usually there is an increase in the content with age of the plant. However, that also depends on the stage of the plant development. Finally, environmental conditions that may have an effect on secondary metabolite productions among others are climate, growing site, other plants, and planting method. During plant development bioactive compounds are formed in leaf chloroplasts. The bioactive compounds are used in photosynthesis process at photosystem I. A certain amount of the photosynthesis product is used as precursors in syntheses of naphtoquinone-derived bioactive compounds which are accumulated in bulbs during development of the plant. It can be concluded that the syntheses and storage of secondary metabolites take place in different locations.

CONCLUSIONS Between 2 and 12 weeks after planting, anatomical structure of leaves and bulbs of red bulb showed an increase in the diameter and the length of bulb, the thickness of leaf mesophyll as well as upper and lower epidermis layers, and the size of cells of parenchyma and

B I O D I V E R S IT A S 11 (2): 102-106, April 2010

106

vascular bundles of bulbs. In addition to an increase in size, vascular bundles also showed an increase in the number of cells composing xylem and phloem. Upper epidermis of leaves hosts fewer stomata than the lower layer. The level of naphtoquinone-derived bioactive compounds in bulbs increased significantly during plant development, as the size of parenchymal cells increased. Meanwhile the level of naphtoquinone-derived bioactive compounds in leaves remained stable during plant development, despite the increase in thickness of mesophyll and the composing cells

ACKNOWLEDGEMENTS The authors wish to thank Prof. Dr. Issirep Sumardi and Abdul Gafur for their supervision during the experiment and useful comments on the manuscript.

REFERENCES Akan H, Ismail E, Satil F (2007) The morphological and anatomical properties of endemic Crocus leichtlinii (D. Dewar) Bowles (Iridaceae) in Turkey. Pak J Bot 39: 711-718. Alves TMA, Helmut K, Carlos LZ (2003) Eleutherinone a novel fungitoxic naphtoquinone from Eleutherine bulbosa (Iridaceae). Mem Ins Oswaldo Cruz Rio de Janeiro 98: 709-712. Babula P, Mikelova R, Patesil D, Adam V, Kizek R, Havel L, Sladky Z (2005) Simultaneous determination of 1,4 naphtoquinone, lawsone, juglone and plumbagin by liquid chromatography with UV detection. Biomed Paper 149: 25. Berlyn GP, Miksche JP (1976) Botanical microtechnique and cytochemistry. Iowa State University Press, Ames. Dickison WC (2000) Integrative plant anatomy. Harcourt Academic Press, New York. Fosket DE (1994) Plant growth and development, a molecular approach. Academic Press, San Diego. Gardner FP, Pearce RB, Mitchell RL (1985) Physiology of crop plants. Susilo H (transl). UI Press, Jakarta. Gross J, Cho WK, Lezhneva L Falk, J, Krupinska K, Shinozaki K, Seki M, Herrman RG, Meurer J (2006) A plant locus essential for phylloquinone (vitamin K1) biosynthesis originated from a fusion of four eubacterial genes. J Biol Chem 281: 17189-17196. Han AR, Min HY, Nam JW, Lee NY, Wiryawan A, Suprapto W, Lee SK, Lee KR, Seo EK (2008) Identification of a new naphthalene and Its

derivatives from the bulb of Eleutherine americana with inhibitory activity on lipopolysaccharide-induced nitric oxide production. Chem Pharm Bull 56: 1314-1316. Hara H, Maruyama N, Yamashita S, Hayashi Y, Lee KH, Bastow KF, Chairul, Marumoto R, Imakura Y (1997) Elecanacin, a novel new naphthoquinon from the bulb of Eleutherine americana. Chem Pharm Bull 45: 1714-1716. Herbert RB (1995) Biosintesis metabolit sekunder. edisi dua. Srigandono B. (transl). IKIP Semarang Press, Semarang. Jinzhong X, Feng Q, Wenjuan D, Gexia Q, Naili W, Xinsheng Y (2006) New bioactive constituents fom Eleutherine americana. Chem J Chin 26: 320-323. Manitto P (1981) Biosynthesis of natural products. Ellis Horwood, London. Mauseth JD (1988) Plant anatomy. Benjamin/Cummings, Menlo Park. Nielsen LB, Wege D (2006) The enantioselective synthesis of elecanacin through an intramolecular naphtoquinone-vinyl ether photochemical cycloaddition. Org Biomol Chem 4: 868-876. Robbers JE, Speedle MK, Tyler VE (1996) Pharmacognosy and pharmacobiotechnology. Williams & Wilkins, Baltimore. Robinson T (1995) Kandungan organik tumbuhan tinggi. Penerbit ITB, Bandung. Ruzin SE (1999) Plant microtechnique and microscopy. Oxford University Press, Oxford. Saâ&#x20AC;&#x2122;roni P, Nurendah, Adjirni (1987) Penelitian efek anti inflamasi beberapa tanaman obat pada tikus putih. Konggres Biologi Nasional VIII. Purwokerto, 8-10 Oktober. Salisbury BF, Ross CW (1995) Fisiologi tumbuhan. Jilid 2. Diah L, Sumaryono (transl). Penerbit ITB, Bandung. Sansuk K (2002) Method development for determination of phylloquinone in tobacco plants [Thesis]. Division of Pharmacognosy, Leiden University, Leiden. Saptowalyono CA (2007) Bawang dayak, tanaman obat kanker yang belum tergarap. www.kompas.com. [15 June 2007]. Satil F, Selvi S (2007) An anatomical and ecological study of some Crocus L. taxa (Iridaceae) from the west part of Turkey. Acta Bot Croat 66: 25-33. Tjitrosomo SS (1985) Botani umum 2. Angkasa, Bandung. Utami D (2007) Menjadikan struktur dan perkembangan tumbuhan sebuah kajian yang menarik. Pidato Purna Tugas Guru Besar Anatomi Tumbuhan. Universitas Jenderal Soedirman, Purwokerto. Verberne MC, Bol JF, Lithorst HJ, Verpoorte R, Sansuk K (2007) Vitamin K1 accumulation in tobacco plant overexpressing bacterial genes involed in the biosynthesis of salicylic acid. J Biotech 128: 72-79 Westhoff P, Jeske H, Jurgen G, Kloppstech K, Link G (1998) Molecular plant development from gene to plant. Oxford University Press, Oxford. Wink M (1990) Physiology of secondary product formation in plant. In Charwood BV, Rodes MJC (eds) Secondary products from plant tissue culture. Clarendon Press, Oxford.

GUIDANCE FOR AUTHORS BIODIVERSITAS, the Journal of Biological Diversity publishes scientific articles, i.e. original research and review in all biodiversity aspects of plants, animals and microbes at the level of gene, species, and ecosystem. Scientific feedback (short communication) is only received for manuscript, which criticize published article before. Manuscripts will be reviewed by managing editor and invited peer review according to their disciplines. The only articles written in English (U.S. English) are accepted for publication. This journal periodically publishes in January, April, July, and October. In order to support reduction of global warming as a consequence of transportation vehicles emission and forest degradation for paper manufacturing, management of the journal prefer receiving manuscripts via e-mail rather than in hard copy. Manuscript and its communications can only be addressed to the managing editor; better to “CC” to one of the communicating editor for accelerating evaluation. A letter of statement expressing that the author (s) is responsible for the original content of manuscript, the result of author(s)’s research and never been published must be attached. Manuscript is typed at one side of white paper of A4 (210x297 mm2) size, in a single column, double space, 12-point Times New Roman font, with 2 cm distance step aside in all side. Smaller letter size and space can be applied in presenting table. Word processing program or additional software can be used, however, it must be PC compatible and Microsoft Word based. Names of sub-species until phylum should be written in italic, except for italic sentence. Scientific name (genera, species, author), and cultivar or strain should be mentioned completely at the first time mentioning it, especially for taxonomic manuscripts. Name of genera can be shortened after first mentioning, except generating confusion. Name of author can be eliminated after first mentioning. For example, Rhizopus oryzae L. UICC 524, hereinafter can be written as R. oryzae UICC 524. Using trivial name should be avoided, otherwise generating confusion. Mentioning of scientific name completely can be repeated at Materials and Methods. Biochemical and chemical nomenclature should follow the order of IUPAC-IUB, while its translation to Indonesian-English refers to Glossarium Istilah AsingIndonesia (2006). For DNA sequence, it is better used Courier New font. Symbols of standard chemical and abbreviation of chemistry name can be applied for common and clear used, for example, completely written butilic hydroxytoluene to be BHT hereinafter. Metric measurement use IS denomination, usage other system should follow the value of equivalent with the denomination of IS first mentioning. Abbreviation set of, like g, mg, mL, etc. do not follow by dot. Minus index (m-2, L-1, h-1) suggested to be used, except in things like “per-plant” or “per-plot”. Equation of mathematics does not always can be written down in one column with text, for that case can be written separately. Number one to ten are expressed with words, except if it relates to measurement, while values above them written in number, except in early sentence. Fraction should be expressed in decimal. In text, it should be used “%” rather than “gratuity”. Avoid expressing idea with complicated sentence and verbiage, and used efficient and effective sentence. Manuscript of original research should be written in no more than 25 pages (including tables and picture), each page contain 700-800 word, or proportional with article in this publication number. Invited review articles will be accommodated. Title of article should be written in compact, clear, and informative sentence preferably not more than 20 words. Name of author(s) should be completely written. Running title is about five words. Name and institution address should be also completely written with street name and number (location), zip code, telephone number, facsimile number, and e-mail address. Manuscript written by a group, author for correspondence along with address is required. First page of the manuscript is used for writing above information. Abstract should not be more than 200 words, written in English. Keywords is about five words, covering scientific and local name (if any), research theme, and special methods which used. Introduction is about 400600 words, covering background and aims of the research. Materials and Methods should emphasize on the procedures and data analysis. Results and Discussion should be written as a series of connecting sentences, however, for manuscript with long discussion should be divided into sub titles. Thorough discussion represents the causal effect mainly explains for why and how the results of the research were taken place, and do not only reexpress the mentioned results in the form of sentences. Concluding sentence should preferably be given at the end of the discussion. Acknowledgments are expressed in a brief. Figures and Tables of maximum of three pages should be clearly presented. Title of a picture is written down below the picture, while title of a table is written in the above the table. Colored picture and photo can be accepted if information in manuscript can lose without those images. Photos

and pictures are preferably presented in a digital file. JPEG format should be sent in the final (accepted) article. Author could consign any picture or photo for front cover, although it does not print in the manuscript. There is no appendix, all data or data analysis are incorporated into Results and Discussions. For broad data, it can be displayed in website as Supplement. Citation in manuscript is written in “name and year” system; and is arranged from oldest to newest and from A to Z. The sentence sourced from many authors, should be structured based on the year of recently. In citing an article written by two authors, both of them should be mentioned, however, for three and more authors only the family (last) name of the first author is mentioned followed by et al., for example: Saharjo and Nurhayati (2006) or (Boonkerd 2003a, b, c; Sugiyarto 2004; El-Bana and Nijs 2005; Balagadde et al. 2008; Webb et al. 2008). Extent citation as shown with word “cit” should be avoided, and suggested to refer an original reference. APA style in double space is used in the journal reference as follow: Journal: Carranza S, Arnold EN (2006) Systematics, biogeography and evolution of Hemidactylus geckos (Reptilia: Gekkonidae) elucidated using mitochondrial DNA sequences. Mol Phylogenet Evol 38: 531-545.

Saharjo BH, Nurhayati AD (2006) Domination and composition structure change at hemic peat natural regeneration following burning; a case study in Pelalawan, Riau Province. Biodiversitas 7: 154-158. Book: Rai MK, Carpinella C (2006) Naturally occurring bioactive compounds. Elsevier, Amsterdam. Chapter in book: Webb CO, Cannon CH, Davies SJ (2008) Ecological organization, biogeography, and the phylogenetic structure of rainforest tree communities. In: Carson W, Schnitzer S (eds) Tropical forest community ecology. Wiley-Blackwell, New York. Abstract: Assaeed AM (2007) Seed production and dispersal of Rhazya stricta. 50th annual symposium of the International Association for Vegetation Science, Swansea, UK, 23-27 July 2007. Proceeding: Alikodra HS (2000) Biodiversity for development of local autonomous government. In: Setyawan AD, Sutarno (eds) Toward mount Lawu national park; proceeding of national seminary and workshop on biodiversity conservation to protect and save germplasm in Java island. Sebelas Maret University, Surakarta, 17-20 July 2000. [Indonesia] Thesis, Dissertation: Sugiyarto (2004) Soil macro-invertebrates diversity and inter-cropping plants productivity in agroforestry system based on sengon. [Dissertation]. Brawijaya University, Malang. [Indonesia] Information from internet: Balagadde FK, Song H, Ozaki J, Collins CH, Barnet M, Arnold FH, Quake SR, You L (2008) A synthetic Escherichia coli predator-prey ecosystem. Mol Syst Biol 4: 187. www.molecularsystemsbiology.com Publication manuscript “in press” can be cited and mentioned in reference (bibliography); “personal communications” can be cited, but cannot be mentioned in reference. Research which not be published or “submitted” cannot be cited. Some annotation. Manuscript typed without sign link (-) (except repeated word in Indonesian). Usage of letter “l” (el) to “1” (one) or “O” (oh) to “0” (null) should be avoided. Symbols of D, E, F, etc. included through facility of insert, non altering letter type. No space between words and punctuation mark. Progress of manuscript. Notification of manuscript whether it is accepted or refused will be notified in about three months since the manuscript received. Manuscript is refused if the content does not in line with the journal mission, low quality, inappropriate format, complicated language style, dishonesty of research authenticity, or no answer of correspondence in a certain period. Author or first authors at a group manuscript will get one original copy of journal containing manuscript submitted not more than a month after publication. Offprint or reprint is only available with special request. NOTE: Author(s) agree to transfer copy right of published paper to BIODIVERSITAS, Journal of Biological Diversity. Authors shall no longer be allowed to publish manuscript completely without publisher permission. Authors or others allowed multiplying article in this journal as long as not for commercial purposes. For the new invention, authors suggested to manage its patent before publishing in this journal.

NOTIFICATION: All communications are strongly recommended to be undertaken through email.

ISSN: 1412-033X (printed edition) ISSN: 2085-4722 (electronic)

GENETIC DIVERSTY

Microsatellite DNA polymorphisms for colony management of long-tailed macaques (Macaca fascicularis) population on the Tinjil Island DYAH PERWITASARI-FARAJALLAH, RANDALL C. KYES, ENTANG ISKANDAR

55-58

Examination of uropathogenic Escherichia coli strains conferring large plasmids

59-64

SUHARTONO Bacterial communities associated with white shrimp (Litopenaeus vannamei) larvae at early developmental stages ARTINI PANGASTUTI, ANTONIUS SUWANTO, YULIN LESTARI, MAGGY TENNAWIJAYA SUHARTONO

65-68

SPECIES DIVERSTY

Intervention of genetic flow of the foreign cattle toward diversity of phenotype expressions of local cattle in the District of Banyuwangi MOHAMAD AMIN

69-74

ECOSYSTEM DIVERSTY

Diversity of Tree Communities in Mount Patuha Region, West Java DECKY INDRAWAN JUNAEDI, ZAENAL MUTAQIEN

75-81

Vegetation analyses of Sebangau peat swamp forest, Central Kalimantan EDI MIRMANTO

82-88

Taxonomic diversity of macroflora vegetation among main stands of the forest of Wanagama I, Gunung Kidul WIDODO, SUTARNO, SRI WIDORETNO, SUGIYARTO

89-92

Diversity of Parasitoid Lepidopterans Larvae on Brassicaceae in West Sumatra NOVRI NELLY, RUSDI RUSLI, YAHERWANDI, FENI YUSMARIKA

93-96

ETHNOBIOLOGY (CULTURAL DIVERSITY)

Tapping into the edible fungi biodiversity of Central India ALKA KARWA, MAHENDRA K. RAI

97-101

Structural development and bioactive content of red bulb plant (Eleutherine americana); a traditional medicines for local Kalimantan people EVI MINTOWATI KUNTORINI, LAURENTIUS HARTANTO NUGROHO

102-106

Front cover: Macaca fascicularis (PHOTO: TEGAR ADHI NUGROHO)

Published four times in one year

PRINTED IN INDONESIA ISSN: 1412-033X (printed)

ISSN: 2085-4722 (electronic)