Biodiversitas vol. 12, no. 2, April 2011 by Biodiversitas Unsjournals

ISSN: 1412-033X (printed edition) ISSN: 2085-4722 (electronic)

Journal of Biological Diversity Volume

12 – Number 2 – April 2011

FIRST PUBLISHED: 2000

ISSN: 1412-033X (printed edition) 2085-4722 (electronic)

EDITORIAL BOARD (COMMUNICATING EDITORS): Abdel Fattah N.A. Rabou (Palestine), Dato A. Latiff Mohamad (Malaysia), Alan J. Lymbery (Australia), Ali Saad Mohamed (Sudan), Bambang H. Saharjo (Indonesia), Charles H. Cannon Jr. (USA), Edi Rudi (Indonesia), Guofan Shao (USA), Hassan Pourbabaei (Iran), Hwan Su Yoon (USA), Jamaluddin (India), Joko R. Witono (Indonesia), Katsuhiko Kondo (Japan), Livia Wanntorp (Sweden), Mahendra K. Rai (India), María La Torre Cuadros (Peru), Mariela A. Marinoff (Argentine), Mochamad A. Soendjoto (Indonesia), Salvador Carranza (Spain), Shahabuddin (Indonesia), Sonia Malik (Brazil), Sugiyarto (Indonesia), Thaweesakdi Boonkerd (Thailand)

EDITOR-IN-CHIEF: Sutarno

EDITORIAL MEMBERS: English Literary Editor: I Made Sudiana (sudianai@yahoo.com) Technical Editor & Banking: Solichatun (solichatun_s@yahoo.com) Distribution & Marketing: Rita Rakhmawati (oktia@yahoo.com) Webmaster: Ari Pitoyo (aripitoyo@yahoo.com)

MANAGING EDITORS: Ahmad Dwi Setyawan (unsjournals@gmail.com)

PUBLISHER: Department of Biology, Faculty of Mathematics and Natural Sciences, Sebelas Maret University, Surakarta and The Society for Indonesian Biodiversity

ADDRESS: Jl. Ir. Sutami 36A Surakarta 57126. Tel. +62-271-7994097, Tel. & Fax.: +62-271-663375, Email: unsjournals@yahoo.com

BANKING: Solichatun, BNI KC Sebelas Maret, Acc. No. 0033691646

ONLINE: www.unsjournals.com

ACCREDITED BY DECREE OF THE DIRECTORATE GENERAL OF HIGHER EDUCATION, THE MINISTRY OF NATIONAL EDUCATION, REPUBLIC OF INDONESIA No. 65a/DIKTI/Kep/2008 (valid until October 2011)

EXPERTISE AND CORRESPONDING EMAIL OF THE COMMUNICATING EDITORS: GENETIC DIVERSITY: Alan J. Lymbery (a.lymbery@murdoch.edu.au), Hwan Su Yoon (hsyoon@bigelow.org), Mahendra K. Rai (pmkrai@hotmail.com), Salvador Carranza (salvicarranza@gmail.com), Sonia Malik (sonia.unicamp@gmail.com). SPECIES DIVERSITY: Dato A. Latiff Mohamad (latiff@ukm.my), Joko R. Witono (jrwitono@yahoo.com), Katsuhiko Kondo (k3kondo@nodai.ac.jp), Livia Wanntorp (livia.wanntorp@nrm.se), Thaweesakdi Boonkerd (Thaweesakdi.B@chula.ac.th). ECOSYSTEM DIVERSITY: Abdel Fattah N.A. Rabou (arabou@iugaza.edu), Ali Saad Mohamed (alisaad48@yahoo.com), Bambang H. Saharjo (bhsaharjo@gmail.com), Charles H. Cannon Jr. (chuck@xtbg.ac.cn), Edi Rudi (edirudi@yahoo.com), Guofan Shao (shao@purdue.edu), Hassan Pourbabaei (hassan_pourbabaei@yahoo.com), Jamaluddin (jamaluddin_125@hotmail.com), Mochamad A. Soendjoto (masoendjoto@gmail.com), Shahabuddin (shahabsaleh@gmail.com), Sugiyarto (sugiyarto_ys@yahoo.com). ETHNOBIOLOGY: María La Torre Cuadros (angeleslatorre@lamolina.edu.pe), Mariela A. Marinoff (marinoff@fai.unne.edu.ar).

B I O D I V E R S IT A S Volume 12, Number 2, April 2011 Pages: 59-63

ISSN: 1412-033X (printed edition) ISSN: 2085-4722 (electronic) DOI: 10.13057/biodiv/d120201

Genetic variability in apomictic mangosteen (Garcinia mangostana) and its close relatives (Garcinia spp.) based on ISSR markers SOBIRâ&#x2122;Ľ, ROEDHY POERWANTO, EDY SANTOSA, SOALOON SINAGA, ELINA MANSYAH Center for Tropical Fruit Studies, Bogor Agricultural University. Jl. Pajajaran, Bogor 16153, West Java, Indonesia. Tel. +62-251-832688. Fax. +62-2518326881. ď&#x201A;Šemail: sobir@ipb.ac.id Manuscript received: 15 December 2010. Revision accepted: 21 March 2011.

ABSTRACT Sobir, Poerwanto R, Santosa E, Sinaga S, Mansyah E (2011) Genetic variability in apomictic mangosteen (Garcinia mangostana) and its close relatives (Garcinia spp.) based on ISSR markers. Biodiversitas 12: 59-63. In order to reveal phylogenetic relationship of mangosteen and several close relatives (Garcinia spp.), we employed seven ISSR dinucleotide primer systems on eleven close relatives of mangosteen and 28 mangosteen accessions from four islands in Indonesia (Sumatra, Java, Kalimantan and Lombok). ISSR analysis successfully amplified 43 bands on average 6.1 fragments for each primer system, and these all fragments were polymorphic. Seven close relatives of mangosteen were separated with mangosteen accessions at 0.22 level of dissimilarity, while other four including G. malaccensis, were clustered with mangosteen accessions, this results supported proposal that G. malaccensis was allopolyploid derivative of mangosteen. Clustering pattern among mangosteen accessions, however, not represented their origin, indicated that distribution of the accessions was not linked to their genetic properties. Key words: Garcinia spp., ISSR analysis, genetic diversity.

INTRODUCTION Mangosteen (Garcinia mangostana L.) belongs to the Guttiferae family and the genus Garcinia (Verheij 1991). Garcinia is a large genus that consists of about 400 species (Campbell 1966), and based on examination of herbarium collections and literature study, there are 64 species of Garcinia encountered in Indonesia. Twenty-five species were found in Kalimantan, 22 species in Sumatra and Sulawesi respectively, 17 species in Moluccas and Papua respectively, 8 species in Java, and 5 species in Lesser Sunda Island. Six species of those are as cultivation plants (Garcinia atroviridis, G. beccari, G. dulcis, G. mangostana, G. nigrolineata and G. parviflora), 58 species as the wild plants, 22 species as edible fruits, and 21 species as timber plants (Uji 2007). The mangosteen has been hailed as the queen of tropical fruits (Fairchild 1915), due to its exotic visual appearance and taste appeals, and has recently been popularized for its medicinal benefits (Sakagami et al. 2005; Mahabusarakam et al. 2006). Based on morphological and cytological studies, Richard (1990) proposed that mangosteen originated from South East Asia, and is an allotetraploid derivate of Garcinia hombroniana (2n= 48) and Garcinia malaccensis (2n = 42). Almeyda and Martin (1976) proposed that mangosteen is a native of Indonesia. In Indonesia mangosteen is distributed almost throughout the archipelago, with the main populations in Sumatra and Kalimantan (Mansyah et al. 1999). However the production centers of mangosteen are in West Sumatra, West Java, Central Java, East Java, and Bali. Commercial production

has been limited by slow tree growth, and long juvenile periods (10-15 years). Base on its reproductive mode mangosteen has been classified as an apomictic plant (Horn 1940; Richards 1997). This plant propagates trough apomixis seed, which is embryo in seed formed without reduction of the chromosome number and fertilization of the egg (den Nijs and van Dijk 1993). Apomixis in mangosteen implies that same genetics properties of parent spread to its progenies (Koltunow et al. 1995); Apomictic processes occur in the ovule without fertilization, resulting in progeny that are genetically exact copies of the female plant (Koltunow et. al. 1995). Based on this assumption mangosteen Horn (1940) stated that existence of only one variety of cultivated mangosteen. Due to its reproductive manner, mangosteen trees are essentially clonal. However, some distinct variations in morphological characters have been reported. Two type of mangosteen have been identified in terms of shape of fruit, one type producing a round shape with semi-flat bottom end and the other type with oblong shape fruit which cannot stand on its distal end (van Steenis 1981). A wild type containing only four carpels with fully developed seed was also found in north Borneo (Morton 1987). Mansyah et al. (1999) found that mangosteen in West Sumatra show wide variability in leaf length, fruit weight and rind thickness. Mangosteen tree that found in Tembilahan, Sumatra, exhibit flattened fruit shape, verry short peduncle, and elliptic stigma lobe (Mansyah et al. 2005). In recent exploration; we found a new distinctive type of mangosteen in Kalimantan that produces fruit with insignificant size of

B I O D I V E R S IT A S 12 (2): 59-63, April 2011

seed (less than 1 cm in length), and have bigger fruit size, out with thicker rind, more acidic taste, and larger leaf size (two fold to those of common mangosteen). Variation of sepal color was also found in our collection, with yellow, white and pale orange color of petals compared to red color petal of common mangosteen (Sobir and Poerwanto 2007). Genetic studies on apomictic plants generally are conducted, through two approaches, parental plants and their progeny variation analysis or molecular analysis (Koltunow 1995). Since mangosteen has a long juvenile phase, it is difficult to carry out progeny analysis, genetic variability analysis of mangosteen was carried out by utilization of molecular tools, such as isozymes (Sinaga 2008), RAPDs (Mansyah et al. 2003; Ramage et al. 2004), and AFLPs (Sinaga 2008). Review on the use of molecular marker has been published by Sobir and Poerwanto (2007). Other potential markers is PCR primers based the microsatellite sequences, where repeat motifs are anchored either at 5’ or 3’ end with one or few specific nucleotides and amplify the sequences between the two microsatellite loci referred to as inter simple sequence repeat (ISSR) markers. In addition, ISSRs can be targeted towards particular sequences, which are reported to be abundant in the genome and can overcome the technical difficulties of RFLP and RAPD (Rajesh et al. 2002; Petros et al. 2007). Application ISSR has been successfully to reveal genetic variability of mangosteen grown from different Sumatra region (Mansyah et al. 2010)

MATERIALS AND METHODS Plant material and DNA isolation Eleven close relatives of mangosteen and 28 mangosteen accessions from four islands in Indonesia (Sumatra, Java, Kalimantan and Lombok) were used in this study (Table 1). The DNA’s were isolated from approximately 1 g leaf by employed modified CTAB method (Doyle and Doyle 1987), by adding 1% polyvinyl pyrolidone (PVP) and 1% 2-mercaptoethanol to the isolation buffer to inhibit phenolic compound interruption, and extracted DNA was purified with RNase. ISSR Analysis Purified DNA samples were subjected to ISSR analysis by following protocols. PCR reactions were carried out in a 25 L reaction mixture containing approximately 25-50 ng templates DNA, 1X solution buffer (50mM KCL, 10 mM Tris-HCL pH 9, 0.01% Tripton X-100), 2.5 mM MgCl2, 200 uM dNTP, 0.4 mM primer, and 1 unit Taq polymerase DNA. Amplification was performed in GeneAmp PCR system 2400 Perkin Elmer, with 40 cycles after pre PCR for 5 minutes at 94ºC. Each cycle consisted of 1 minute 94ºC for denaturation, 1 minute 55ºC for primer annealing 1 minute 72ºC for DNA fragment elongation and finalized with post PCR for 5 minutes 72ºC. Amplification products were electrophoresed in 1.2% Agarose gel at 60 volt for 1 hour. Primers system used in this study represented dimer repeat, used as single primer (PKBT-2, PKBT-4, PKBT-5,

PKBT-10) and pair of primer (PKBT-2 + PKBT-4; PKBT2 + PKBT-6; PKBT-3 + PKBT-6). Table 1. List of mangosteen accessions and its close relatives subjected analysis. Name G. malaccensis G. xanthochymus G. celebica-1 G. porrecta G. sizygiifolia G. picrorhiza G. bancana G. livingstonei G. dulcis G. celebica-2 G. hombroniana Tasik-BPSB Wanayasa-BPSB Jayanti Kaliagung-Wanayasa Cicurug Cidahu TWM Kaliangger-Wanayasa BungaPutih Bunga3 Bunga4 Kali-Tajur Kaligesing Semarang Trenggalek Ponorogo Tarutung Sibolga Ratu Kamang Kampar RejangLebong-1 RejangLebong-2 Lampung Pontianak Kalteng Malinau Kal-Sel Lingsar

Accession code GM-1 GX-1 GC-1 Gpor GS-1 Gpic GB-1 GL-1 GD-1 GC-2 GH-1 JW-1 JW-2 JW-3 JW-4 JW-5 JW-6 JW-7 JW-8 CT-1 CT-2 CT-3 CT-4 JC-1 JC-2 JE-1 JE-2 SN-1 SN-2 SR-1 SR-2 SB-1 SB-2 SL-1 KW-1 KC-1 KE-1 KS-1 NW-1

Origin Mekarsari Fruit Garden Bogor Botanical Garden Mekarsari Fruit Garden Bogor Botanical Garden Bogor Botanical Garden Bogor Botanical Garden Bogor Botanical Garden Bogor Botanical Garden Bogor Botanical Garden Bogor Botanical Garden Bogor Botanical Garden West Java West Java West Java West Java West Java West Java West Java West Java CETROFS CETROFS CETROFS CETROFS Central Java Central Java East Java East Java North Sumatra North Sumatra Riau Riau Bengkulu Bengkulu Lampung West Kalimantan Central Kalimantan East Kalimantan South Kalimantan West Nusa Tenggara

Data analysis The genetic relationships between 13 were studied by means of scorable bands using 5 different ISSR primers. Since ISSRs are dominant, a locus was considered to be polymorphic if the band was present in one lane and absent in the other. The presence or absence of bands was scored as binary code (1 and 0). The binary data were used to arrange the matrix of genetic similarity based on the formula of Nei and Li (1979). Based on the genetic similarity values, a cluster analysis and phylogenetic tree dendogram were constructed using the method of UPGMA (Unweighted Pair-Cluster Method Arithmetic) with NTSYS (Numerical Taxonomy and Multivariate System) version 2.01.

SOBIR et al. â&#x20AC;&#x201C; Genetic variability in mangosteen based on ISSR

RESULTS AND DISCUSSION ISSR amplification The seven ISSR primer systems used in this study successfully amplified 43 bands. The fragment number of each primer ranging from 5 to 8, on average 6.1 fragments per primer, and these entire fragments showed as polymorphic band (Table 2). DNA fragment amplified by ISSR dimer primers in Garcinia spp. genomic DNA were slightly lower to the those of amplification in Cicer arietinum that average produced 6.7 band for each primer system (Rajesh et al. 2002). Visualization of ISSR fingerprint pattern from primer PKBT-2 presented in Figure 1. Table 2. Sequence of ISSR primers and number of fragment amplification products.

Primer

Sequence

PKBT-2 PKBT-4 PKBT-5 PKBT-10 PKBT-2 + PKBT-4 PKBT-2 + PKBT-6 PKBT-3 + PKBT-6 Total

ACACACACACACACACTT AGAGAGAGAGAGAGAGAA AGAGAGAGAGAGAGAGTA GTGTGTGTGTGTGTGTGTA ACACACACACACACACTT AGAGAGAGAGAGAGAGAA ACACACACACACACACTT AGAGAGAGAGAGAGAGTT AGAGAGAGAGAGAGAGT AGAGAGAGAGAGAGAGTT

Ampli- Polyfied morphic band band 5 5 6 6 8 8 5 5 7 7 6

Clustering pattern of Garcinia spp. Based on ISSR primers amplified bands, a dendogram was generated by UPGMA-link method using Nei and Li similarity (1979), suggesting that genetic diversity among genus Garcinia was 0.61 coefficient similarity or 39% dissimilarity (Figure 2). This results indicated that variability of twelve Garcinia species revealed by ISSR analysis in this study was lower to our previous study using isozyme analysis that showed 62% dissimilarity, and AFLP analysis that reached 79% dissimilarity (Sobir and Poerwarnto 2007; Sinaga 2008), also as detected by Randomly Amplified DNA Fingerprinting (RAF) marker that observed 63-70% dissimilarity among Garcinia spp. (Ramage et al. 2004).

Figure 2. A dendogram based on UPGMA-link method generated from ISSR analysis data using seven ISSR primers system on 28 accessions of mangosteen and 11 its close relatives.

The dendogram also indicated that seven close relatives of mangosteen (G. sizygiifolia, G. hombroniana, G.celebica-2, G. livingstonei, G. bancana, G. picrorhiza, G.porrecta) were separated from G. mangostana accessions, while other four of G. xanthochymus, G.malaccensis, G. celebica-1, and G. dulcis, were grouping in same clustered with mangosteen accessions at 22% dissimilarity level. This results resemble to our previous studies using isozyme and AFLP markers (Sobir and Poerwarnto 2007; Sinaga 2008). However the dendogram also indicated that G. malaccensis flanked G. mangostana accessions with equal genetic distance with other six close relatives (G. hombroniana, G. celebica-2, G. livingstonei, G. bancana, G. picrorhiza, G. porrecta), raised question

Figure 1. ISSR fingerprint pattern 28 accessions of mangosteen and 11 its close relatives generated using PKBT-2 primer. Lanes 1-39: Garcinia malaccensis , G. xanthochymus, G. celebica TWM, G. porrecta, G. sizigyfolia, G. picrorhiza, G. bancana, G. livingstonei, G. dulcis, G. celebica KRB, G. hombroniana, Tasik BPSB, Wanayasa BPSB, Jayanti, Kaliagung Wanayasa, Cicurug, Cidahu, TWM, Kalianger Wanayasa, Bunga Putih, Bunga3, Bunga4, Kali-Tajur, Kaligesing, Semarang, Trenggalek, Ponorogo, Tarutung, Sibolga, Kampar, Rejang Lebong1, Rejang Lebong2, Lampung, Pontianak, Kalteng, Malinau, and Kalsel, respectively. Kb: DNA size marker.

B I O D I V E R S IT A S Volume 12, Number 2, April 2011 Pages: 59-63

regarding the ancestor of the mangosteen. Our analysis using isozyme and AFLP markers suggested that G. porrecta has higher share of genetic properties compare to G. hombroniana (Sobir and Poerwarnto 2007; Sinaga 2008), and supported by higher similarity in fruit morphology of G. mangostana to G. porrecta than to G. hombroniana. Based on obtained molecular data, the proposal of Richard (1990) that mangosteen is an allotetraploid derivate of G. hombroniana and G. malaccensis should be reviewed. Genetic variability of mangosteen A dendogram based on UPGMA-link method generated from ISSR analysis data using seven ISSR primers system on 28 accessions of mangosteen and 11 its close relatives, revealed that all mangosteen accessions clustered at 0.78 coefficient of similarity or 0.22 coefficient of dissimilarity (Figure 2). This results indicated that variability revealed by ISSR analysis was lower to our previous study using RAPD analysis 0.33 (Mansyah 2003), isozyme analysis that showed 0.58 coefficient of dissimilarity, and AFLP analysis that reached 0.58 coefficient of dissimilarity (Sobir and Poerwarnto 2007; Sinaga 2008). However, this result higher as detected by Randomly Amplified DNA Fingerprinting (RAF) that observed only 0.2-1% dissimilarity among G. mangostana accessions (Ramage et al. 2004). Clustering pattern among mangosteen evaluated accessions, however, not following their origin. Mangosteen accessions from East Java (JE-1) shared same ISSR banding pattern with accession from West Nusa Tenggara (NW-1) and two accessions from Bengkulu, Sumatra (SB-1 and SB-2), subsequently accessions from North Sumatra (SN-2) shared same ISSR banding pattern with KS-1 from South Kalimantan and JE-2 from East Java. However, two accessions from same location Wanayasa West Java, JW-2 and JW-4 were separately at 0.22 coefficient of dissimilarity. This results supported by previous observation results using RAPD markers on 92 G.mangostana accessions from Indonesian Archipelago indicated that the clustering pattern not represented their origin (Sinaga 2008). Discussions The results of ISSR analysis in this study confirmed previous study using molecular tools (Mansyah 2003; Ramage et al. 2004; Sobir and Poerwanto 2007; Sinaga 2008), however a question arise what is the source of the variation, since mangosteen is considered as apomixis obligate plant that performs clonally seed reproduction, independent from fertilization (Koltunow et al. 1995). The variation may have arisen from accumulation of natural mutations. Spontaneous somatic mutations have played an essential role in the speciation and domestication of vegetativelly propagated crops such as banana and plantain. Carman (2001) suggests that apomicts result from wide hybridization of ancestral sexual parents having distinct phenotypic traits related to reproduction. It was possible that G. mangostana did not originate from a single hybridization of its ancestral sexual parents, as Southeast

ISSN: 1412-033X (printed edition) ISSN: 2085-4722 (electronic) DOI: 10.13057/biodiv/d120201

Asia, including Indonesia, is a diversity center of Garcinia. Our recent analysis using isozymes, RAPD and AFLP markers revealed a genetic variability among accessions of G. malaccensis that collected from Jambi, Sumatra (Sinaga 2008). The possibility that development of the ancestral mangosteen was not established from a single hybridization, would lead to variation among mangosteen populations. However, this assumption not supported by our results, since clustering pattern of mangosteen accessions in this study was not following the accessions origin. Another possibility of genetic variability in mangosteen could be in ploidy developmental processes. Our research on three groups of parents and progenies of mangosteen indicated genetic variability among the progenies, where their genetic similarity to parent trees ranged from 0.59 to 1.0. (Sinaga 2008). In a previous study (Mansyah et al. 2004), genetic variation occurred between mangosteen mother plants and their offspring. Many forms of genetic variation may have arisen after hybridization of sexual ancestors with divergent reproductive traits (Spillane et al. 2001).

CONCLUSION ISSR analysis on 28 accessions of mangosteen and 11 its close relatives using seven primer system have successfully amplified 43 bands on average 6.1 fragments for each primer system, and these all fragments were polymorphic. Seven close relatives of mangosteen were separated with mangosteen accessions at 0.22 level of dissimilarity, while other four including G. malaccensis, were clustered with mangosteen accessions, this results supported proposal that G. malaccensis was allopolyploid derivative of mangosteen. Clustering pattern among mangosteen accessions, however, not represented their origin, indicated that distribution of the accessions was not linked to their genetic properties

ACKNOWLEDGEMENTS This work was supported by Ministry of Research and Technology through National Strategic Research Initiative (RUSNAS), and Collaborative Research Fund (KKP3T) from Ministry of Agriculture, Republic of Indonesia. The authors are grateful to Sulasih for her contribution on laboratory works.

REFFERENCES Almeyda N, Martin FM (1976) Cultivation of neglected tropical fruits with promise. Part I. The mangosteen. Agricultural Research Service. USDA. Washington, D.C. Carman JG (2001) The gene effect: Genome collision and apomixis. In: Savidan Y, Carman JG, Dresselhaus T (eds.) The flowering of apomixis: from mechanisms to genetic engineering. CIMMYT, IRD, European Commission DG, Mexico, D.F. den Nijs APM, van Dijk GE (1993) Apomixis. In: Hayward MD, Bosemark NO, Romagosa I (eds.) Plant breeding: principles and prospects. Chapman and Hall. London.

SOBIR et al. – Genetic variability in mangosteen based on ISSR Doyle JJ, Doyle JL (1987) Isolation of plant DNA from fresh tissues. Focus 12: 13-15. Farirchild D (1915) The mangosteen, queen of fruits. J Heredity 6: 338347. Horn CL (1940) Existence of only one variety of cultivated mangosteen explained by asexually formed “seed”. Science 92: 237-238. Koltunow AM, Bicknell RA, Chaudhury AM (1995) Apomixis: molecular strategies for the generation of genetically identical seeds without fertilization. Plant Physiol 108: 1345-1352. Mahabusarakam W, Kuaha K, Wilairat P, Taylor WC (2006) Prenylated xanthones as potential antiplasmodial substances. Planta Medica 72: 912-916 Mansyah E, Anwarudinsyah MJ, Sadwiyanti L, Susiloadi A (1999 Genetic variability of mangosteen base on isoenzymes analysis and its relationship to phenotypic variability. Zuriat 10: 1-10. Mansyah E, Baihaki A, Setiamihardja R, Sobir, R Poerwanto. (2003) Phenotypic and genotypic variability in mangosteen in Java and West Sumatra, Indonesia. IPGRI Newsleter for Asia, the Pacific and Oceania 42: 22-23. Mansyah E, Anwarudinsyah MJ, Usman F, Purnama T (2004) Genetic variability between parental tree (Garcinia mangostana L.) and their progenies. J Hortikultura 14: 229-237. [Indonesia] Mansyah E, Sobir, Santosa E, Poerwanto R (2010) Assessment of inter simple sequence repeat (ISSR) technique in mangosteen (Garcinia mangostana L.) grown in different Sumatra region. J Hort For 2: 127134 Mansyah E, Santoso PJ, Anwarudinsyah MJ (2005) Genetic variation of mangosteen (Garcinia mangostana L.) progenies derived from polyembryonic seed based on RAPD markers. Proceeding of 6th National Congress on Genetics, 12-14 May, 2005, Kuala Lumpur, Malaysia. Morton J (1987) Mangosteen (Garcinia mangostana L.). In: Fruits of warm climates. In: Morton JF (ed.). Creative Resources Systems, Inc. Miami, FL.

Nei M, Li WH (1979) Mathematical model for studying genetics variation in terms of restriction endonucleases. Proc Nat Acad Sci USA 74: 5269-5273 Petros Y, Merker A, Zeleke H (2007) Analysis of genetic diversity of Guizotia abyssinica from Ethiopia using inter simple sequence repeat markers. Hereditas 144: 18-24. Rajesh PN, Sant VJ, Gupta VS, Muehlbauer FJ, Ranjekar PK (2002) Genetic relationships among annual and perennial wild species of Cicer using inter simple sequence repeat (ISSR) polymorphism. Euphytica 129: 15-23. Ramage CM, Sando L, Peace CP, Carol BJ, Drew RA (2004) Genetic diversity revealed in the apomictic fruit species Garcinia mangostana L. (mangosteen). Euphytica 136: 1-10. Richards AJ (1990) Studies in Garcinia, dioecious tropical forest trees: the origin of the mangosteen. Bot J Linn Soc 103: 301-308 Richards AJ (1997) Plant breeding systems. 2nd ed. Chapman and Hall. London. Sakagami Y, Iinuma M, Piyasena KG, Dharmaratne HR (2005) Antibacterial activity of alpha-mangostin against vancomycin resistant enterococci (VRE) and synergism with antibiotics. Phytomedicine 12: 203-208. Sinaga S (2008) Morphological and genetic variability analysis of mangosteen (Garcinia mangostana L.) and its close related species. [Dissertation]. Bogor Agricultural University. Bogor. Sobir, Poerwanto R (2007) Mangosteen breeding and improvement. J Pl Breed 2: 105-111. Spillane C, Vielle-Calzada JP, U Grossniklaus (2001) APO 2001: a sexy apomixer in como. Plant Cell 13: 1480-1491. Uji T (2007) Diversity, distribution and potential of genus Garcinia in Indonesia. Hayati 12: 129-135 [Indonesia] van Steenis CGGJ (1981) Flora. Paradnya Paramitha. Jakarta. Verheij EWM (1991) Garcinia mangostana L. In: Verheij EWM (ed) Plant Resources of South East Asia, Edible Fruit and Nuts. Bogor a Selection. Pudoc. Wageningen.

B I O D I V E R S IT A S Volume 12, Number 2, April 2011 Pages: 64-69

ISSN: 1412-033X (printed edition) ISSN: 2085-4722 (electronic) DOI: 10.13057/biodiv/d120202

Genetic variation of Melia azedarach in community forests of West Java assessed by RAPD YULIANTI♥, ISKANDAR ZULKARNAEN SIREGAR, NURHENI WIJAYANTO, IGK TAPA DARMA, DIDA SYAMSUWIDA Department of Silvicuture, Faculty of Forestry, Bogor Agricultural University. Fahutan Bld. Jl. Lingkar Akademik, Darmaga Campus, Bogor 16680, West Java, Indonesia. Tel. +62-251-8621947, Fax. +62-251-8621256, E-mail: yuli_bramasto@yahoo.co.id, deptsilvik@ipb.ac.id. Manuscript received: 18 October 2010. Revision accepted: 20 January 2011.

ABSTRACT Yulianti, Siregar IZ, Wijayanto N, Tapa Darma IGK, Syamsuwida D (2011) Genetic variation of Melia azedarach in community forests of West Java assessed by RAPD. Biodiversitas 12: 64-69. Melia azedarach L. or mindi (local name) is one of the widely planted exotic species in Indonesia, mostly found in community forests in West Java. However, improving and increasing the productivity of mindi commmunity plantation in West Java requires information on patterns of existing genetic diversity. The present work was aimed at estimating the genetic variation of mindi by using RAPD markers. Outcome of the activities was to propose appropriate conservation and management strategies of genetic resources in order to support the establishment of seed sources. Six populations of mindi plantation in the community forests were chosen for this research, i.e Sukaraja (Bogor-1), Megamendung (Bogor-2), Bandung, Purwakarta, Sumedang and Kuningan. Five primers (OPA-07, OPY-13, OPY-16, OPA-09 and OPO-05) producing reproducible bands were analysed for 120 selected mother trees in total, in which 20 trees per locality were sampled. Data were analysed using Popgene ver 1.31, NTSYS 2.02 and GenAlEx 6.3. Based on the analysis, the observed number of alleles per locus ranging from 1.43 to 1.60, and percentage of polymorphic loci (PPL) ranging from 43.33 to 60.00.%. The levels of genetic variation were considered as moderate for all populations (He range from 0.1603 to 0.1956) and the the mean level of genetic diversity between population (Gst) was 0.3005. Cluster analysis and Principal Coordinates showed three main groups, the first group consists of 4 populations i.e Bandung, Kuningan, Purwakarta and Megamendung, the second was Sukaraja and the third was Sumedang. Based on Analysis of Molecular Variance (AMOVA), the Percentages of Molecular Variance within population (69%) is higher than that of between populations (31%). The moderate level of genetic variation in the community plantation forests, might be due to small population size, leading to reduce genetic variability. Further analysis is required to confirm this findings using other genetic marker. Key words: Melia azedarach, RAPD, genetic variation, community forest.

INTRODUCTION Mindi (Melia azedarach L.) is one of the family members of Meliaceae. and categorized as an exotic species because this plant was originated from the Southern Asia and spread to East Africa, Middle East, American continent and Indonesia. Mindi, in West Java can be found in Bogor, Cianjur, Bandung, Sumedang, Purwakarta, Subang, Kuningan, Majalengka and Garut in agriculture lands owned by community members or community forests (Pramono et al. 2008). Mindi grows well in soils with good drainage, deep soil, and sandy clay soils with pH of between 5.5-6.5. Mindi could grow in hills situated in low elevation, up to the high elevation (700-1400 m above sea level), with rainfall between 600-2000 mm/year and climate type A-C (Martawijaya et al. 1989; Soerianegara et al. 1995; Ahmed and Idris 1997; Wulandini et al. 2004). Information on growth site distribution and condition as well as genetic variability of mindi is necessary for developing sound strategies in the establishment of seed sources. One of the factors that influence patterns of genetic variation in nature is the pollination mechanism

(mating system) in plants (Sedgley and Griffin 1989), this mechanism depend on the structure of the flower. Mindi’s flower is a kind of compound or in a series of flowers (spike), known as the panicle, flower structure is closely associated with the pollination, which could be by animals or by wind. Mindi is an individual polygamaous which is each tree consists of male flowers and also a hermaphrodite because each flower posses both male and female reproductive organs (Styles 1972). Development of community forest with mindi requires constant supply of seeds (seed procurement) of high quality, either physically, physiologically or genetically. One of the significant factors determining seed quality is the seed origin which is usually related closely with genetic quality of the seed. Generally, the use of high quality seeds in community forests is not greatly considered as shown by a study of Asmanah (2005) in Grand Forest Park Wan Abdul Rachman Lampung where only 7.8% of the farmers purchased planting stocks from outside, while most of them used any kind of planting stocks originating from stands in the surrounding areas, either in the form of seeds or in the form of uprooted seedlings. In addition. Roshetko et al.

B I O D I V E R S IT A S 12 (2): 64-69, April 2011

(2004) reported that most seeds being used by forest farmers were collected from trees (seed trees) in the farmerâ&#x20AC;&#x2122;s land or in traditional land, and the seeds from such seed sources were usually collected only from few trees (1 to 5 trees) without any knowledge concerning their origin, and it was supposed probably that their genetic variability is narrow (Dhakal et al. 2005). The same phenomena was also hypothesized to occur in mindi community plantation forest in West Java. The status of genetic variability can be determined using several methods such as isoenzymes and other DNA based markers. One of the techniques of DNA analysis that is still used to capture roughly the levels of genetic variabilities is Random Amplified Polimorphic DNA (RAPD). According to Brown et al. (1993) and Saiki et al. (1988), this technique is usually used to show the level of DNA variability among species and also among individuals within species which are closely related, as well as being able to detect the presence of variation of nucleotide arrangement within DNA. This technique has been applied for detecting population genetic variability of species of dukuh (Song et al. 2000), citrus (Karsinah et al. 2002),

cashew (Samal et al. 2003), Melia volkeensii (Runo et al. 2004), sandalwood (Rimbawanto et al. 2006), ulin (Rimbawanto et al. 2006), merbau (Rimbawanto and Widyatmoko 2006), neem (Kota et al. 2006), Pulai (Hartati et al. 2007), sungkai (Imelda et al. 2007), meranti (Siregar et al. 2008), gaharu (Siburian 2009; Widyatmoko et al 2009) and jelutung (Purba and Widjaya 2009). There is an urgent need to initiatie a program of genetic improvement, considering the increasing areas of mindi plantation in West Java. Therefore, this experiments were carried out with aims at determining the patterns of genetic diversities of mindi in West Java community plantation based on DNA marker, i.e. RAPD, to support the improvement program of seed source of mindi.

MATERIALS AND METHODS Materials Materials used in this research were mindi individuals growing in six locations of community plantation forests in West Java, Indonesia as described in Figure 1 and Table 1.

1 2

3 5 6 4

Figure 1. Approximate geographical locations of sampled populations of mindi in West Java community forests: (1) Nagrak village, Sukaraja subdistrict, Bogor, (2) Tegal Mindi, Sukakarya village, Megamendung subdistrict, Bogor, (3) Legok Huni village, Wanayasa subdistrict, Purwakarta, (4) Gambung, Mekarsari village, Pasir Jambu subdistrict, Bandung, (5) Padasari village, Cimalaka subdistrict, Sumedang, (6) Babakan Rema village, Kuningan subdistrict, Kuningan

B I O D I V E R S IT A S 12 (2): 64-69, April 2011

Table 1 Details of sampled locations of mindi community plantation in West Java Name of locations Nagrak village, Sukaraja subdistrict, Bogor Tegal Mindi, Sukakarya village, Megamendung subdistrict, Bogor Legok Huni village, Wanayasa subdistrict, Purwakarta Gambung, Mekarsari village, Pasir Jambu subdistrict, Bandung Padasari village, Cimalaka subdistrict, Sumedang Babakan Rema village, Kuningan subdistrict, Kuningan

In each location, 20 parent trees were selected. For obtaining the DNA extract using standard procedure of CTAB (Doyle and Doyle 1987 ). For analysis of genetic variation, five primers were used, which showing reproducible and polymorphic bands, namely OPA-07; OPY-13; OPY-16; OPA-09 and OPO-05, with DNA sequences as shown in Table 2. Those primer have been selected from twenty five random primers (Table 2) Table 2 Five random primers from selection of twenty five primer for genetic analysis Primer Sequences

Primer Sequences

OPU-08 OPU-09 OPO-11 OPB-13 OPO-05 OPA-09 OPB-09 OPO-10 OPO-16 OPB-08 OPB-20 OPA-03 OPU-04

OPY-20 OPA-14 OPY-16 OPA-16 OPY-18 OPU-14 OPO-13 OPA-05 OPY-12 OPA-07 OPY-13 OPA-12

5’-GGCGAAGGTT-3’ 5’-CCACATCGGT-3’ 5’GACAGGAGGT-3’ 5’-TTCCCCCGCT-3’ 5’-CCCAGTCACT-3’ 5’-GGGTAACGGG-3’ 5’-TGGGGGACTC-3’ 5’-TCAGAGCGCC-3’ 5’-TCGGCGGTTC-3’ 5’-GTCCACACGG-3’ 5’-GGACCCTTAC-3’ 5’-CATCCCCCTG-3’ 5’-ACCTTCGGAC-3’

5’-AGCCGTGGAA-3’ 5’-TCTGTGCTGG-3’ 5’-GGGCCAATGT-3’ 5’-AGCCAGCGAA-3’ 5’-GTGGAGTCAG-3’ 5’-TGGGTCCCTC-3’ 5’-GTCAGAGTCC-3’ 5’AGGGGTCTTG-3’ 5’-AAGCCTGCGA-3’ 5’-GAAACGGGTG-3’ 5’-GGGTCTCGGT-3’ 5’-TCGGCGATAG-3’

Procedures Isolation of DNA from each individual tree was extracted from leaves following a standard CTAB procedure (Doyle and Doyle 1987). PCR reaction (total volume about 13.5 μL) was performed using 2 μL DNA with Go taq green master mix (Promega) as much as 7.5 μL, and 2.5 μL nuclease-free water (H2O) and 1.5 μL primer (0.5-2 M). This mixture was subsequently put into PCR-PTC100 MJ Research with regulated temperature and reaction steps with total cycle of 37 times, namely 1 time pre-denaturation (95ºC for 2 minutes), followed by denaturation at 95ºC for 1 minute, and afterwards annealing at 35ºC for 2 minutes and extension at temperature of 72ºC for 2 minutes. These steps occurred 35 times and the last was 1 time final extension (72ºC for 5 minutes). The replication must be done if the band of DNA still not clear. Results of PCR were subjected to electrophoresis by using agarose 2% at voltage of 100 v for ± 25 minutes and then followed by soaking in EtBr (1%, v/v) for 15 minutes. DNA electropherogram was visualised under observation in UV transluminator and photographed. The photograph results were analyzed using binary scoring of the banding

Geographic position 06º 40’ 472” S, 106º 53’ 615”E 06º 40’ 477” S, 106º 53’ 635”E 06º 39’ 378” S, 107º 32’ 479”E 07º 14’ LS, 107º 5144’ BT 06º 47’ LS, 107º 56’ BT 06º 45’ LS, 105º20’ BT

Elevation (m asl) 250-350 711-721 617 700-1400 600-700 417

Temp. (ºC) 26-27 24-27 28-29 20-28 24-28 30-36

RH (%) 70-75 70-75 70-75 40-50 80-85 50-60

patterns, i.e. presence or absence of band. Estimation of genetic variability within and between populations was computed using softwares of POPGENE ver. 1.31 (Nei 1972), NTSYS 2.02 (Rohlf 1998) and GenAlEx 6.3 (Peakall and Smouse 2006). Genetic variability was estimated using following parameters: percentage of polymorphic loci (PLP); number of observed alleles (na); number of effective alleles (ne); expected heterozygosity (He), genetic differentiation (Gst). In addition, Principal Coordinates Analysis (PCA) and Analysis of Molecular Variance (AMOVA) were also performed to determined the partition of genetic variation.

RESULTS AND DISCUSSION Amplification and DNA polymorphism Examples of DNA polymorphic patterns were shown in Figure 2A, B and C.

C Figure 2. Polymorphic pattern at primer OPA-07 of mindi population from (A) Megamendung (Bogor-2), (B) Sukaraja (Bogor-1) and (C) Sumedang

B I O D I V E R S IT A S 12 (2): 64-69, April 2011

Genetic variation within population Values of genetic variability were shown in Table 4.

was 97.31%, whereas that between population was only 2.69%.

Table 4. Parameter values of genetic variability of mindi population in community forests of West Java

Table 5. Results of Analysis of Molecular Variance (AMOVA)

Bandung 20 53.33 1.533 1.2748 0.1613 Kuningan 20 53.33 1.533 1.2665 0.1603 Megamendung 20 53.33 1.533 1.3007 0.1790 Purwakarta 20 51.67 1.516 1.2933 0.1712 Sukaraja 20 43.33 1.433 1.2922 0.1612 Sumedang 20 60.00 1.600 1.3198 0.1956 Notes: PPL= Percentage of polymorphic loci; na = Observed number of alleles; ne = Effective number of alleles; He = Gene diversity

Genetic variation, within population of mindi, i.e. He, was categorized as moderate ranging between 16-19%. This level of variation can also be observed from other variables such percentage of polymorphic loci (PPL) ranging from 43.3-60.0%, with average value of 52.50 Population which harbored the lowest variability was Kuningan (0.1603), followed in terms of rank by populations of Sukaraja and Bandung (0.1612 and 0.1613), whereas population of Purwakarta and Megamendung exhibited variability of 0.1712 and 0.1790, respectively. Among the six populations being tested, Sumedang population possessed the highest genetic diversity, namely He = 0.1956. There are several drivers that affect the level of genetic diversity of a species within a population, such as effective size of population, mutation, genetic drift, migration, mating system, selection and production of flower and pollen (Siregar 2000; Lemes et al 2003; Finkeldey 2005; Hamid et al. 2008). The moderate level of genetic diversity of mindi at community forest or farmland could be as a consequence of a small population size, this situation have been proved by Milicia excelsa at traditional agroforestry system in Benin, Western Africa (Ouinsavi and Sokpon 2008). This could be due to scattered distribution of trees and plantation boundaries or sparsely grown which could lead to the reduction in population size. The small population size also can increase the possibility of genetic drift, which will reduce the genetic variability as a result of bottlenecking and inbreeding (Hamid et al. 2008) Other genetic parameter being measured was value of genetic differentiation (Gst) and the value of Gst was 0.3005. This implies that average genetic variability between populations of mindi plants in community forests was around 30%. On the basis of AMOVA, as shown in Table 5, genetic variability which was contained within population was as large as 69%, whereas genetic variability between population was 31%. This is in accordance with opinion of Hamrick and Godt (1996) that most genetic variability was stored within population, whereas differences between populations were small. Craft and Ashley (2007) reported that Quercus macrocarpa populations harboured genetic variability within population

Source of variability

Degree of freedom

Sum of Square

5 114 119

265.092 617.150 882.242

Between pop. Within pop. Total

Mean sum of square 53.018 5.414

Est. var.

2.380 5.414 7.794

31 69 100

Genetic variation between populations Genetic distance was calculated on the basis of Nei (1972) to measure genetic variation between population (Table 6). Table 6. Genetic distances (Nei 1972) between mindi populations in community forests in West Java

Bandung Kuningan Megamendung Purwakarta Sukaraja Sumedang

0.0000 0.0352 0.0626 0.0740 0.0919 0.1459

0.0000 0.0770 0.0718 0.0881 0.1560

Sumedang

Sukaraja

Wanayasa

Megamendung

PPL

Kuningan

Bandung

Population

0.0000 0.0976 0.0000 0.1357 0.1127 0.0000 0.1681 0.1201 0.1920 0.0000

Table 6 shows that populations of Bandung, Kuningan and Megamendung possess genetic distances which are considerably close. The highest genetic distance is seen between population of Sumedang and Sukaraja (0.1920). Genetic relationship and grouping patterns of populations on the basis of genetic distances can be seen in Figure 3 and 4.

Figure 3. UPGMA-dendogram of mindi populations of plantation community forests in West Java. Notes: GBG: Bandung; KNG: Kuningan; WNY: Purwakarta; MGD: Megamendung; NGK: Sukaraja and SMD: Sumedang

B I O D I V E R S IT A S 12 (2): 64-69, April 2011

this population could be used to increase the genetic diversity in other populations, especially at the same site of this seed source.

CONCLUSION

Figure 4. Groupings of mindi populations in community forests of West Java based on Principal Coordinates Analysis (PCA)

Based on dendrogram of genetic distances (Figure 3) and groupings by PCA (Figure 4), it could be seen in general that there are three groupings of mindi populations. First group consists of Bandung, Kuningan, Megamendung and Purwakarta populations. The second cluster comprises only population of Sukaraja, and the third cluster comprises also one single population of Sumedang. These groupings imply that populations of Bandung, Kuningan, Megamendung and Purwakarta have close genetic distances However, in relation with geographic the four populations have considerably far distances. From the historical point of view, it is known that mindi populations were introduced for the first time in tea plantation area. Of the four populations, Bandung, Purwakarta and Megamendung were actually part of and close to the tea plantations. It is most likely that mindi population occurring in community lands were originated from these plantation areas. The situation was different for populations of Sukaraja and Sumedang which are not plantations. This may be a cause of existing genetic structures showing considerably differences from those of other populations. The existing patterns of genetic variation may indicate the current status of genetic resources of mindi in West Java. Moderate genetic variation, i.e. below 20%, observed in all investigated populations indicated that genetic resources of mindi plants in the community forests are still maintained by evolutianary factors. The sustainable utilization of existing resources in particular can be recommended in form of seed sources. This condition is also explained by the fact that mindi is an exotic species. It is very likely that during the initial introduction to Indonesia, seeds used for the initial planting were not originated from many sources. According to Roshetko et al. (2004) and Dhakal et al. (2005), most seeds which were used by forest farmers were collected from trees (seed trees) in farmer’s land or traditional land, and seeds from these seed sources were often collected from only a few trees (1 to 5 trees) without any knowledge concerning the origins of seed. Based on the results of this study, mindi population in Sumedang have the highest diversity, so mindi plantation of this location could become a candidate of seed sources. It is expected that the seeds produced from

Genetic variation of mindi from six populations in community forests in West Java, showed moderate levels ranging from 16-19%. To increase genetic diversity of mindi in community forests in West Java, a population of mindi that has a highest genetic variation can be used as a source of genetic material to other populations to increase genetic diversity. On the basis of genetic distances, there were identified three clusters namely (i) Bandung, Kuningan, Megamendung and Purwakarta, (ii) Sukaraja and (iii) Sumedang. The information of genetic distance among population can be used in the through exchange of genetic material between populations.

ACKNOWLEDGEMENTS This research was supported by a grant of Directorate General of Higher Education (Hibah Pasca), The Ministry of National Education of Indonesia 2009-2010 (Contract No: 78/13.24.4/SPK/BG-PD/2009 and No: 4/13.24.4/SPK/ PD/2010).

REFERENCE Ahmed S, Idris S (1997) Melia azedarach L. In: Hanum F, van der Maesen LJG (eds). Plant resources of South-East Asia No 11. Auxiliary plants. Prosea. Bogor. Asmanah W (2005) Studies on socio-economic and cultural conditions of communities around Wan Abdul Rachman Grand Forest Park, Lampung. J Penelitian Hutan dan Konservasi Alam 2 (3): 215-226. [Indonesia] Brown PTH, Lange FD, Kranz E, Lorz H (1993) Analysis of single protoplast and regenerated plants by PCR and RAPD technology. Mol Gen Genet 237: 321-341. Craft KJ, Ashley M (2007) Landscape genetic structure of bur oak (Quercus macrocarpa) savannas in Illinois. For Ecol Manag 239: 1320. Dhakal LP, Lilleso JPB, Kjaer ED, Jha PK, Arya HL (2005) Seed sources of agroforestry trees in farmland context: A guide to tree seed source establishment in Nepal. Forest and Landscape Development and Environment Series 1. Harsholm. Denmark. Doyle JJ, Doyle JL (1987) Isolation of plant DNA from fresh tissue. Focus 12: 13-15. Finkeldey R (2005) Introduction to tropical forest genetics. Institute of Forest Genetics and Forest Tree Breeding. University of Göttingen. Göttingen, Germany. Hamid AH, Ab-Shukor NA, Senin AL (2008) Morphometric and genetic variation of six seed sources of Azadirachta excelsa (Jack) Jacobs. J Biol Sci 8: 702-712. Hartati D, Rimbawanto A, Taryono, Sulistyaningsih E, Widyatmoko AYPBC. 2007. Estimation of genetic diversity within and between provenances of pulai (Alstonia scholaris (L.) R.Br.) using RAPD markers. J Pemuliaan Tanaman Hutan 1 (2): 89-98. [Indonesia] Imelda M, Estiati A, Sari L, Erlyandari F (2007) Genetic uniformity of sungkai (Peronema canescens Jack) regenerated from tissue culture. Biodiversitas 8 (1): 54-57. [Indonesia] Karsinah, Sudarsono, Setyobudi L, Aswidinnoor H (2002) Keragaman genetik plasma nutfah jeruk berdasarkan analisis penanda RAPD. J Bioteknologi Pertanian 7 (1): 8-16. [Indonesia]

B I O D I V E R S IT A S 12 (2): 64-69, April 2011 Kota SND, Rao R, Cari P (2006) In vitro response of select regions of Azadirachta indica A. Juss (Meliaceae) as elucidated by biochemical and molecular variations. Curr Sci 91 (6): 770-776. Lemes MR, Gribel R, Proctor J, Grattapaglia D (2003) Population genetic structure of mahagony (Swietenia macrophylla King, Meliaceae) across the Brazilian Amazon, based on variation at microsatellite loci: implication for conservation. Mol Ecol (12): 2875-2883. Martawijaya A, Iding K, Mandang YI, Soewanda AP, Kosasih K (1989) Atlas of Indonesian woods. Vol. 2. Forestry Research and Development Agency. Bogor. [Indonesia] Nei (1972) Genetic distance between populations. Am Naturalist 106: 283-292. Ouinsavi C, Sokpon N (2008) Traditional agroforestry systems as tools for conservation of genetic resources of Milicia excelsa Welw. C.C. Berg in Benin. Agroforest Syst 74: 17-26. Peakall R. Smouse PE (2006) GENALEX 6: Genetic analysis in excell. Population genetic software for teaching and research. Mol Ecol Notes 6: 288-295. Pramono AA, Danu, Rohandi A, Royani H, Abidin AZ, Supardi E, Nurokhim N (2008). Distribution of potential seed sources of potential mindi types in Java. LHP No. 498. Research Institute for Seeding Technology. Bogor. [Indonesia] Purba YS, Widjaya EA (2009) Primer screening for Dyera costulata (Miq) Hook.f Random Amplified Polymorphic DNA Analyses. Biodiversitas 10 (1): 12-18. Rimbawanto A, Widyatmoko AYPBC (2006) Genetic diversity of four population of Intsia bijuga revealed by RAPD markers and its implications for the genetic conservation program. J Penelitian Hutan Tanaman 3 (3): 149-154. [Indonesia] Rimbawanto A, Widyatmoko AYPBC, Sulistyowati P (2006) Distribution of genetic diversity of Santalum album population based on RAPD. J Penelitian Hutan Tanaman 3 (3): 175-181. [Indonesia] Rimbawanto A, Widyatmoko AYPBC, Sulistyowati P, Harkingto (2006) The population diversity of Eusideroxylon zwageri of East Kalimantan based on RAPD marker. J Penelitian Hutan Tanaman 3 (3): 201-208. [Indonesia] Rohlf FJ (1998) Numerical Taxonomy and Analysis System (NTSYSpc) Version 2.0. Department of Ecology and Evolution, State University of New York. New York.

Roshetko JM, Mulawarman, Iriantono D (2004) Garden seeds for farmers and NGOs-why and how. Seeds for the people. Suplemen Gedeha. 24th ed. Directorate of Forest Tree Seed, IFSP, World Agroforestry Centre-ICRAF and Bina Swadaya. Bandung. Runo MS, Muluvi GM, Odee DW (2004) Analysis of genetic structure in Melia volkensii (Gurke.) populations using random amplified polymorphic DNA. African J Biotechnol 3 (8): 421-425. Saiki RK. Gelfand DH, Stoffel S, Scarf SJ, Hirguchi R, Horn GT, Mullis KB, Erlich HA (1988) Primer directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 239: 487-491. Samal S, Rout GR, Lenka PC (2003) Analysis of genetic relationship between population of cashew (Anacardium occidentale L.) by using morphological characterization and RAPD markers. Plant Soil Environ 49 (4): 176-182 Sedgley M, Griffin AR (1989) Sexual reproduction of tree crops. Academic Press. Sidney. Siburian RHS (2009) Genetic diversity of Gyrinops verstegii of Papua based on RAPD and microsatellite [M.Sc. Thesis]. School of Graduates, Bogor Agricultural University. Bogor. [Indonesia] Siregar IZ (2000) Genetic aspects of the reproductive system of Pinus merkusii Jungh.et de Vriese in Indonesia. [Dissertation]. Faculty of Forest Sciences and Forest Ecology, Georg-August University of Gรถttingen. Gรถttingen. Soerianegara I, Lemmens J (1995) Plant Resources of South-East Asia No. 2. Auxiliary plants. PROSEA. Bogor. Song BK, Clyde MM, Wickneswari R, Normah MN (2000) Genetic relatedness among Lansium domesticum accessions using RAPD markers. Ann Bot 86: 299-307. Styles BT (1972) The flower biology of Meliaceae and its bearing on tree breeding. Silvae Genetica 21: 175-182. Widyatmoko AYPBC, Afrianti RD, Taryono, Rimbawanto A (2009) Genetic variation of five population of Gyrinops verstegii in Lombok revealed by RAPD markers. J Pemuliaan Tanaman Hutan 3 (1): 1-10. Wulandini R. Widyani N (2004) Melia azedarach Linn. Brief information seed. No. 30. Directorate of Forest Tree Seed and Indonesian Forest Seed Project. Ministry of Forestry. Jakarta. [Indonesia]

BIODIVERSITAS Volume 12, Number 2, April 2011 Pages: 70-75

ISSN: 1412-033X (printed edition) ISSN: 2085-4722 (electronic) DOI: 10.13057/biodiv/d120203

Polymorphic sequence in the ND3 region of Java endemic Ploceidae birds mitochondrial DNA R. SUSANTI♥ Department of Biology, Faculty of Mathematics and Natural Sciences, Semarang State University. Bld. D6, Fl. 1. Sekaran Campus, Gunungpati, Semarang 50229, Central Java, Indonesia. Tel & Fax. +62-24-8508033. ♥email: rsant_ti@yahoo.com; rsant_ti@staff.unnes.ac.id Manuscript received: 22 July 2010. Revision accepted: 14 February 2011.

ABSTRACT Susanti R (2011) Polymorphic sequence in the ND3 region of Java endemic Ploceidae birds mitochondrial DNA. Biodiversitas 12: 7075. As part of biodiversity, Ploceidae bird family must be kept away from extinction and degradation of gene-diversity. This research was aimed to analyze ND3 gene from mitochondrial DNA of Java Island endemic of Ploceidae bird. Each species of Ploceidae birds family was identified based on their morphological character, then the blood sample was taken from the birds nail vein. DNA was isolated from blood using Dixit method. Fragment of ND3 gene was amplified using PCR method with specific primer pairs and sequenced using dideoxy termination method with ABI automatic sequencer. Multiple alignment of ND3 nucleotide sequences were analyzed using ClustalW of MEGA-3.1 program. Estimation of genetic distance and phylogenetic tree construction were analyzed with Neighbor-Joining method and calculation of distance matrix with Kimura 2 –parameter. The result of Java Island endemic of Ploceidae bird family exploration showed that Erythrura hyperythra and Lonchura ferruginosa can not be found anymore in nature, but the Lonchura malacca that are not actually Java island endemic was also found. Nucleotide sequence of mitochondrial ND3 gene of Ploceidae bird family showed a quite high polymorphism, with 122 substitutions from 334 nucleotides analyzed. Phylogenetic tree of nucleotide sequence of Ploceidae bird family formed 2 clusters. One cluster consisted of the Ploceus hypoxanthus, Ploceus philippinus, Ploceus manyar and Passer montanus, and the others species were included in the second cluster. ND3 gene sequence data from this Ploceidae family need to be analyzed further to see possible relationship with a particular phenotype. Key words: Ploceidae, ND3 gene, mitochondrial DNA.

INTRODUCTION Indonesia is rich countries in biodiversity of birds, 1539 species of birds have spread in various regions in Indonesia. Indonesian endemic birds recorded around 494 species spread across the island of Java, consists of 368 species of settlers birds and 126 species visitors (nomads) birds (McKinnon et al. 1993). Latest publication from the International Union for Conservation of Natural Resources (IUCN) in 2000 stated that Indonesia has 324 bird species including the red list of threatened species (Dono 2002). Ploceidae bird family in Indonesia consist of approximately 41 species and 13 species of which was located on the island of Java (Iskandar 1989; McKinnon et al. 1993). Although until now, only Java sparrow (Padda oryzivora) that experienced a shift from an agricultural pest predator, but the decline in the number of the population of other bird species of this family should be considered. As part of biodiversity, Ploceidae birds family needs to be protected from extinction and decline in species diversity. Members of Ploceidae birds family increasingly difficult to find in nature all around us, so it needs to promote conservation. One effort to provide the basis of germplasm conservation strategy is through the study of genetic diversity (Susanto et al. 2004). According Wartono et al. (2000), the concept of conservation today is directed to gene conservation. This is partly because the gene is the

basic unit in natural selection and gene variations are directly related to individual fitness or adaptability to environmental conditions. Animal adaptation to the environment can result in unique combinations of alleles for a particular type, and the circumstances in this difficult re-formed. The types that are different from other types needed to be conserved genes and gene combinations that bring very useful in the future (Christianti et al. 2003). The benefits of genetic diversity in the future, efforts to save biodiversity from extinction should be done immediately. Preservation of biodiversity, including genetic resources will ensure the availability of genetic material for the development of science and technology. Genetic markers used in studies of animal genetic diversity analysis are the conventional genetic markers and DNA markers. Conventional genetic marker is a frequently used marker phenotype, for example markers that are determined on the basis of phenotypic characteristics can be observed, such as color, body color patterns, shape of the feet, beak and morphometric analysis (Rahayu 1998). According Christianti et al. (2003), morphometric analysis is strongly influenced by environmental factors. Progress in biotechnology has made it possible to get other markings other than morphological markers, proteins and DNA (McCouch and Tanksley 1991). Studies of DNA variation are more accurate than the study of proteins, because the

SUSANTI – Polymorphic sequence of ND3 gene of Ploceidae birds

variation of DNA does not necessarily indicate protein variations (Christianti et al. 2003). The use of DNA as a genetic marker, providing more accurate data and can immediately detects the variation in the genetic material. Mitochondrial DNA (mtDNA) are easily extracted, relatively small size (Shadel and Clayton 1997), has a mutation rate ten times faster than nuclear DNA (Christianti et al. 2003), and contain more variation than nuclear DNA (Wood and Phua (1996), so widely used in the analysis of genetic diversity. The variation of human mtDNA variation shows the effect on health-related phenotypes, such as involvement in degenerative diseases, aging and reproduction properties. Pedigree maternal affect growth, reproduction and lactation, even reported that the mtDNA variation associated with milk production in dairy cows. To study the effect of mtDNA on the phenotype required the listing of several generations of phenotypic data (Christianti et al. 2003). Sequences of mtDNA encodes seven subunits of complex I (NADH dehydrogenase), electron transport chain (oxidative phosphorylation), a subunit of complex III (cytochrome b-c1 complex), three subunits of complex IV (cytochrome oxidase) and two subunits of ATP synthase complex. OXPHOS disease is a clinical illness associated with the components of oxidative phosphorylation. Mutations in the gene of NADH dehydrogenase subunit 4 (ND4) reported Wallace et al. (1995) causes the disease's hereditary optic neuropathy leber (LHON). ND3 gene is a gene that encodes the enzyme NADH dehydrogenase subunit 3, which is one of the seven subunits of complex I subunits of oxidative phosphorylation (Marks et al. 1996). Previous research indicates that some birds Java Sparrow (Padda oryzivora) showed the diversity of ND3 gene sequences (Susanti 2008). Diversity of information based on ND3 gene sequence analysis is the underlying basis for detecting the gene mutations that occur from generation to generation, and also genetic diversity is the basis for studying the relationship between diversity ND3 gene sequences with a particular phenotype such as resistance to disease. MATERIALS AND METHODS Ploceidae birds Twelve species birds of the endemic Java island Ploceidae used in this study: Amandava amandava, Erythrura hyperythra, Erythrura prasina, Lonchura ferruginosa, Lonchura leucogastra, Lonchura leucogastroides, Lonchura maja, Lonchura malacca, Lonchura punctulata, Padda oryzivora, Passer montanus, Ploceus hypoxanthus, Ploceus manyar, and Ploceus philippinus. Each species of Ploceidae bird family was identified based on their morphological character, then the blood sample was taken from the birds nail vein. Amplification of ND3 gene DNA was isolated from blood using Dixit method. The polymerase chain reaction (PCR) amplification was prepared at amount of 30 μl with composition of 15 μL 2x

reaction mix buffer (Fermentas), 10 pmol of primers H11151 dan L10775, 0.6 μL of genomic DNA (12 ng/μL), and ultrapure H2O until reaching 30 μL. Primer used was the primer pair that flanking cleavage site region, they are H11151 (5’GATTTGAGCCGAAATCAAC 3’) and L10775 (5’GACCAATCTTTAAAATCTGG 3’). PCR program consists of, pre-denaturation 95oC for 5 minutes, 40 cycles consist of denaturation 95oC for 30 seconds, annealing 58oC for 30 seconds, extension 72oC for 1 minutes, and post-extension 72oC for 10 minutes (Sulandari and Zein 2002). The specific DNA band resulted from PCR was identified by electrophoresis on 2% agarose gel. Sequencing and phylogenetic analysis The PCR products were then sequenced using dideoxy termination method with ABI automatic sequencer (Applied Biosystems). Nucleotide sequence of mitochondrial ND3 gene of Ploceidae birds submitted to GeneBank. Multiple alignment of nucleotide sequences were analyzed using ClustalW of MEGA 3.1 program. Estimation of genetic distance and phylogenetic tree construction were analyzed with Neighbor-Joining method and calculation of distance matrix with Kimura 2parameter. RESULTS AND DISCUSSION The result of Java Island endemic of Ploceidae birds family exploration showed that Erythrura hyperythra and Lonchura ferruginosa were not found anymore in nature, but the Lonchura malacca that was not Java island endemic (McKinnon et al. 1993) was observed. The loss of two birds species are likely due to population changes in bird habitat ecosystem. As one component of the environment, birds can be used directly or indirectly as an environmental bioindicator to detect environmental changes and can reflect the stability of the habitat. Bird life depends on vegetation, soil and water. The diversity of vegetation and its density determines the number and level of diversity of bird species (Hardy et al. 1987; Peakall and Boyd 1987; Rutschke,1987). Plants to be much visited by birds and a comfortable place for birds. In addition to the nest and food sources for birds, plants give birds protection from sunlight intensity, stress, excessive heat, low humidity and predators attack (Soendjoto and Gunawan 2003). The loss of bird populations may also be caused by the arrest by humans, because the Ploceidae bird families are eating seeds that are commonly founded in agricultural land to a height of 1500m so easily captured. This is reinforced by the fact that these birds was traded in bird markets in some regions and exported to Japan, Europe and America (Iskandar 2005). Population might also be due to the limited use of pesticides on agricultural land resulting in lower levels of pesticide contamination due to bird health. ND3 gene that was amplified by PCR using H11151 and L10755 primers have a high specification, because producing a single band (400bp fragment length) (Figure 1). ND3 nucleotide sequences of 12 species of Java endemic Ploceidae bird families can be accessed at

B I O D I V E R S I T A S 12 (2): 70-75, April 2011

1 2 3 4 5 6 7 8 9 10 11 L 13 GenBank with accession numbers EF102496-EF1022485. Nucleotide alignment with ClustalW (MEGA 3.1) indicated that 122 substitution from 334 nucleotides analyzed (Figure 2). ND3 gene nucleotide analysis using ClustalW program (MEGA 3.1) shows that the 334 nucleotide, there were 142 polymorphic sites (Figure 2). Genetic distance and nucleotide sequence phylogeny was analyzed using neighbor-Joining method and calculation of distance matrix with Kimura 2-parameter model (Kimura 1980), successively Figure 1. Electrophoregram of ND3 gene PCR of Ploceidae birds using L10775 and seen in Table 1 and Figure 3. Result H11151 primer (product 400bp). Well M: DNA ladder 100bp. Well 1-11, 13 : sample of of phylogenetic analysis indicated Ploceidae birds that all Ploceidae bird family form two distinct sublineages. One cluster consisted of the Ploceus hypoxanthus, Ploceus philippinus, Ploceus manyar and Passer Erythrura prasina montanus, and the others species Amandava amandava birds of this study include in the Lonchura punctulata seccond cluster (Figure 3). Mitochondrial DNA has a Padda oryzivora mutation rate ten times faster than Lonchura leucogastroides nuclear DNA (Christianti et al. Lonchura leucogastra 2003). Most of the mitochondrial gene coding for a mitochondrial Lonchura maja protein. Subunit of cytochrom-c Lonchura malacca oxidase, cytochrome b, and Passer montanus ribosomal genes are widely used in Ploceus hypoxanthus studies of population genetics and phylogeny (Shearer et al. 2002). Ploceus manyar Genetic diversity based on mtDNA Ploceus philippinus sequence has been successfully Goose(NC004539) carried out on fruit-eating bats (Chinorax Melanochephalus) (Zein and Maharadatunkamsi 2003), bats 0.1 (Wilkinson et al. 1997), woodpekers (Prychitko and Moore 2000), Figure 3. A phylogenetic tree of the Ploceidae mitochondrial ND3 nucleotide sequence mammals (Gemmell et al. 1996) and by using the neighbor-joining method. birds (Tuinen et al. 2000). Polymorphism of mtDNA also occur in horses (Ishida et al. 1994), sheep (Heindleder et al. 1991), goats (Upholt and Dawid 1977), buffalo (Bhat et al. 1990) and base is one causes the shift (frameshift) nucleotide bases cows (Christianti et al. 2003). The variation of fragment behind him so that formed two stop codons in the displacement-loop (D-loop) have been reported between downstream part ND3 gene, resulting in premature species, even within a species (Gemmell et al. 1996; Wood translational stops and produces only 68 amino acids and Phua 1996; Wilkinson et al. 1997). D-loop fragment is (should be 117 amino acids) (Mindell et al. 1998 ). the initiator of transcription and replication (Linberg 1989). Frameshift due to the substitution of one nucleotide bases Christianti et al.( 2003) reported that the D-loop fragment mengasilkan different proteins, which may also influence influence the fertility of livestock, milk production, milk fat its activity as an enzyme in oxidative phosphorylation. ND3 gene sequence data from Ploceidae families need to percentage and health of livestock. Reported that the ND3 gene sequences in 46 species of be analyzed in further research on possible relationship birds have one extra nucleotide at position 174. Excess with a particular phenotype.

SUSANTI – Polymorphic sequence of ND3 gene of Ploceidae birds

Tabel 1. Genetic distance of Ploceidae mitochondrial ND3 nucleotide sequence by using the neighbor-joining method and calculation of distance matrix with Kimura 2 –parameter 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12.

Lonchura leuogastroides Lonchura punctulata Passer montanus Lonchura maja Erythrura prasina Lonchura malacca Lonchura leucogastra Amandava amandava Ploceus hypoxanthus Ploceus manyar Ploceus philippinus Padda oryzivora

0.129 0.039 0.012 0.144 0.027 0.084 0.296 0.380 0.228 0.392 0.108

0.177 0.183 0.021 0.219 0.117 0.183 0.527 0.237 0.476 0.027

0.045 0.231 0.057 0.201 0.443 0.272 0.201 0.296 0.183

0.180 0.003 0.084 0.290 0.290 0.180 0.308 0.180

0.207 0.060 0.081 0.512 0.204 0.452 0.060

0.093 0.296 0.254 0.165 0.275 0.225

0.075 0.440 0.192 0.410 0.132

0.542 0.219 0.464 0.260

0.081 0.009 0.686

0.051 0.371

0.650

#Lonchura leucogastroides #Lonchura punctulata #Passer montanus #Lonchura maja #Erythrura prasina #Lonchura malacca #Lonchura leucogastra #Amandava amandava #Ploceus hypoxanthus #Ploceus manyar #Ploceus philippinus #Padda oryzivora

ATT ... ... ... ... ... ... ... ... ... ... ...

CTA ... ... ... ... ... ... ... ... ... ... ...

GTC ... ... ... ... ... ... ... ... ... ... ...

CTC ... ... ... ... ... ... ... ... ... ... ...

CTT ... ... ... ... ... A.. ... ... ... ... ...

GGG ... ..A ... ... ... ... ... C.A C.A C.A ...

TTC ... ... ... ... ... ... ... ... ... ... ...

ATT ... ... ... ... ... ... ... ... ... ... ...

CGT ... ... ... ... ... ... ... T.. T.. T.. ...

ATA ... ... ... ... ... ... ... ... ... ... ...

CGA .T. ... ... .TC ... ... .TC ... ... ... ...

GTC ... ... ... ... ... ... ... ... ... ... ...

CTA ... .G. ... ... ... ... ... ... ... ... ...

[ [ [ [ [ [ [ [ [ [ [ [

39] 39] 39] 39] 39] 39] 39] 39] 39] 39] 39] 39]

GTG ... .A. ... ... ... ... ... ... ... ... ...

TCA ... .G. ... ... ... ... ... .G. .G. .G. .T.

GGA .T. ... .T. .T. .T. .T. ... .A. .A. .A. .T.

GGA ... .T. ... ... ... ... ... .A. .AT .A. AT.

GGA ... .A. ... ... ... ... ... ... ... ... ...

TTA ... ... ... ... ... ... ... ... ... ... .C.

GTG ... ..A ... ... ... ... .A. ..A ..A ..A ...

TGG ... G.. ... ... ... ... GC. GA. GA. GA. ...

AGG ... .A. ... ... ... ... ... ... ... ... ...

CTC ... ... ... ... ... ... ... ... ... .C. ...

ATG ... .G. ... ... ... ... ... .G. .G. .G. ...

TTA ... .C. C.. .G. C.. C.. .G. A.. A.. A.. ...

GGG ... .A. ... ... ... .T. C.. ... ... ... ...

[ [ [ [ [ [ [ [ [ [ [ [

78] 78] 78] 78] 78] 78] 78] 78] 78] 78] 78] 78]

TGG ... ... ... ... ... ... ... ... ... ... .AT

TGA ... ... ..G ... ..G ..G .AT .TG .TG .TG ..G

TGG ... ... ... ... ... ... ... ... ..A ... .A.

GAG ... .G. ... ... ... ... ... .G. .G. .G. .G.

ATT ... ... ... ... ... ... ... ... ... ... ...

GAA ... .T. ... ... ... ... ... .G. .G. .G. .G.

GTT ..C ... ... ..C ... ... ..C ... ... ... ...

GGA .A. ..G ..G .A. ..G ..G .A. ... ... ... .A.

TGG .T. ... .T. .T. .T. .T. .T. .T. .T. .T. ...

CTC ... ... ... ... ... ... ... ... ... ... ...

ATG ... ... ... ... ... ... ... .C. .C. .C. ...

GTA ... ... ... ... ... ... ... ... ... ... ...

GGG ... .T. ... ... ... ... ... .A. .A. .A. ...

[117] [117] [117] [117] [117] [117] [117] [117] [117] [117] [117] [117]

GCA .T. .T. ... .T. ... ... CT. .A. .A. .A. .A.

GTA ... .G. ... ... ... ... ... .G. .G. .G. ...

GTA ... .C. ... ... ... .A. ... .A. .A. .A. ...

GGG ... ... ... ... ... ... ... ... .C. ... ...

CGA ... ... ... ... ... ... T.. ... ... ... ...

TTT ... ... ... ... ... ... ... ... ... ... ...

CTA ... ... ... ... ... ... ... ... ... ... ...

GGT ... ... ... ... ... ... ... A.. AT. AT. ...

CGA .A. ... ... .A. ... ... .AT ... ... ... .A.

ATA ... ... ... ... ... ... ... ... T.. ... ...

GTA .A. .G. ... .A. ... ... .AC ... ... ... ...

GGA ... ... ... ... ... ... T.. A.. A.. A.. ...

ATA ... ... ... ... ... ... ... .C. .C. .C. ...

[156] [156] [156] [156] [156] [156] [156] [156] [156] [156] [156] [156]

#Lonchura leucogastroides #Lonchura punctulata #Passer montanus #Lonchura maja #Erythrura prasina

GGA .A. ... ... .A.

TAG .G. .G. .G. .G.

CTA ... ... ... ...

GGA ... ... ... ...

AGA .A. ... ... .A.

AGC ... ... ... ...

GAA ... .G. ... ...

TTG ... .G. ... ...

AGA ... ... ... ...

ATG ... .G. ... ...

GTA ... .C. ... ...

GTC ... ... ... ...

[195] [195] [195] [195] [195]

B I O D I V E R S I T A S 12 (2): 70-75, April 2011

74 #Lonchura malacca #Lonchura leucogastra #Amandava amandava #Ploceus hypoxanthus #Ploceus manyar #Ploceus philippinus #Padda oryzivora

... ... .A. ... ... ... .A.

.G. CG. .G. ... ... ... .G.

... ... ... ... ..G ... ...

... ... ... ... ... ... ...

... .C. ... ... ... ... ...

... ... .TC ... ... ... ...

... ... ... .T. .T. .T. .T.

... ... ... .G. .G. .G. ...

... ... ... ... ... ... ...

... ..T ... ... ... ... ...

... ... ... .A. .G. .G. ...

... ... ... .C. .C. .C. ...

... ..A ... ... ... ... ...

[195] [195] [195] [195] [195] [195] [195]

GAG ... ... .G. ... .G. .G. ... .G. .G. .G. .G.

CAG .G. .T. .G. GG. .G. .G. A.. ... ... ... .G.

ATC ... .G. .C. ... .C. .CT ... ... ... ... ...

CCA .T. .T. ... .T. ... ... .T. .T. .T. .T. .T.

GGG ... ... ... ... ... ..C ... ... ... ... ...

GGT ... ... ... ... ... ... ... ... ... ... ...

CAA .G. ... ... .G. ... ... .G. .G. AG. AG. .G.

ATC ... ... ... ... ... ... ... ... ... ... ...

CAC ... .G. ... ... ... ... ... ... ... ... ...

ATT ... ... ... ..C ... ... ..C ... ... ... ...

CGT ... ... ... ... ... ... ... ... ... ... ...

ATG ... ... ... ... ... ... ... ... ... ... ...

GGG ... ... ... ... ... C.. ... ... A.. A.. .A.

[234] [234] [234] [234] [234] [234] [234] [234] [234] [234] [234] [234]

ATA ... ... ... ... .C. ... ... .C. .C. .C. ...

GTT ... ... ... ... ... ... .GG ... ... ... ...

TTC ... ... ... ... ... ... CC. ... ... ... ...

TGC ..A ..G ..A .AA ..A ..A .AA C.G C.G C.G ..G

GTC ... ... ... ... ... T.. ... ... ... ... A..

TGG ... ... ... ... ... ... ... C.. CT. C.. ...

GTT ... ... ... ... ... ... ... ... ... ... ...

TGT GA. .A. AA. GA. AA. AA. GA. .A. .A. .A. .A.

TTG ... ... ... ... ... ... ... ... ... ... ...

GGC ... ... ... ... ... ... ... ... ... ... ...

AAG T.. T.. T.. T.. T.. TC. T.. T.. T.. T.. T..

TCA ... ... ... ... ... ... ... ... ... ... ...

GAG ..A ..A ..A ..A ..A ..A ..A ..A ..A ..A ..A

[273] [273] [273] [273] [273] [273] [273] [273] [273] [273] [273] [273]

GTT .C. ... ... .C. ... ... .C. ... ... ... ...

TAA ... ..G ..G ... ..G ..G ... ..G ..G ..G ..G

CGC G.T GCT G.T G.T G.T G.T GTT G.T G.T G.T G.T

GAT .G. .G. .G. .G. .G. .G. .G. .G. .G. .G. .G.

TAG ... ... C.. ..T C.. C.. ..T ... ... ... ...

GAG ..T T.. ..C C.T ..C ..C C.T .G. .G. .G. .GC

GGT .A. TA. AA. .A. AA. AA. .A. CA. CA. CA. AA.

GCT ... ... ... ... ... .T. ... ... ... ... ...

TAG ... ... ... ... ... ... ... ... ... ... ...

GGC ... .A. ... ... ... ... ... .AA .AA .AA ..T

TGT ... GAA ... ... ... ... ... AAA AAA AAA ..C

GGA T.. T.. ... T.. ... C.. T.. ... ... ... ...

TAG ... A.. ..A ..T ..A ..T ..T ..C ..C ..C ...

[312] [312] [312] [312] [312] [312] [312] [312] [312] [312] [312] [312]

GGT ... TT. ... ... ... ... ... .C. TC. TC. ...

TAG G.A ... G.A G.A G.A G.A G.A CCA GCA CCA G.A

TAT ... ... C.. ... C.. C.. ... G.G G.G G.G ...

GAA ... ... ... .C. ... ... .C. CT. CT. CT. ...

TAT ... ..G ... ... ... ... ... ..G ... ..G ...

AAT ... ... ... ... ... ... ... ... ... ... G..

TAT ... ... ... ... ... ... ... AGG AGG AGG ...

G . . . . . . . . . . .

[334] [334] [334] [334] [334] [334] [334] [334] [334] [334] [334] [334]

Figure 2. Polymorphism of the ND3 fragment gene sequences of Ploceidae birds (GenBank ID: EF1022485-EF102496)

CONCLUSION Nucleotide alignment of Ploceidae ND3 gene fragment have high polymorphism, with 122 substitutions from 334 nucleotides analyzed. Phylogenetic tree of nucleotide sequence of Ploceidae bird family form 2 clusters. One cluster consisted of the Ploceus hypoxanthus, Ploceus philippinus, Ploceus manyar and Passer montanus, and the others were included in the seccond cluster. Nucleotide sequence of ND3 gene of this Ploceidae bird family needs

to be analysed furtherto elucidate the possibility of its relationship with certain phenotype ACKNOWLEDGMENTS The current research was supported by grant from the fundamental research from Directorate General of Higher Education (DGHE), Department of National Education, Republic of Indonesia (No16/SP3/PB/DP2M/II/2006).

SUSANTI â&#x20AC;&#x201C; Polymorphic sequence of ND3 gene of Ploceidae birds

REFERENCES Bath PP, Mishra BP, Bath PN (1990) Polymotphism of mitocondrial DNA (mtDNA) in cattle and buffaloes. Biochem Genet 28: 331-318 Christianti T, Sutarno, Etikawati N (2003) Identification of polymorphism sequence in the D-Loop region of Benggala cow mitochondrial DNA. BioSmart 5: 73-77 [Indonesia] Gemmell NJ, Western PS, Watson JM, Geaves JAM (1996) Evolution of the mammalian mitochondrial control region-comparison of control region sequences between Monotreme and Therian mammals. Mol Biol Evol 13: 798-808. Hardy AR, Stanley PI, Smith PWG (1987) Birds as indicators of the intensity of use of agricultural pesticides in the UK. In: Diamond AW, Fillon FL (eds). The value of birds. ICBP Technical Publication No. 6.: International Council for Bird Protection. Cambridge Heindleder S, Hecht W, Dzapo V, Wassmuth R (1991) Ovine mitochondrial DNA: restriction enzyme analysis, mapping, and sequencing data. Anim Genet 23: 151-160 Ishida N, Hasegawa T, Takeda K, Sakagami M, Onishi A, Inameru S, Komatsu M (1994) Polymorphic sequence in the D-Loop region of equine mitochondrial DNA. Anim Genet 25: 215-221. Iskandar J (1989) The common bird species in Indonesia. Djambatan. Jakarta. [Indonesia] IUCN [International Union for Conservation of Nature and Natural Resources]. 2000. The 2000 IUCN Red list of threatened species. http://www.redlist. org.html Linberg GL (1989) Sequence heterogeneity of bovine mitochondrial DNA. Iowa State University. Iowa Mackinnon J, Phillipps K, van Balen B (1993) The birds in Sumatra, Java, Bali and Kalimantan. Translated by: Rahardjaningtrah W, Adikerana A, Martodihardjo P, Supardiyono EK, vanBalen B. Center of research and Development of Biology LIPI. Jakarta [Indonesia] Marks DB, Marks AD, Smith CM (1996) Basic medical biochemistry. Translated by: Brahm UP. EGC. Jakarta. [Indonesia] McCouch SR, Tanksley SD (1991) Development and use of restriction fragment length polymorphism in rice breeding genetics. CAB International. Wallingford. Mindell DP, Sorenson MD, Dimcheff DE (1998) An extra nucleotid is not translated in mitochondrial ND3 of some birds and tuurtles. Mol Biol Evol 15: 1568-1571. Peakall DB, Boyd H (1987) Birds as bio-indicators of environmental condition. In: Diamond AW and Fillon FL (ed). The value of birds. ICBP Technical Publication No. 6.: International Council for Bird Protection. Cambridge Prychitko TM, Moore WS (2000) Comparative evolution of the mitochondrial cytochrome b gene and nuclear B-fibrinogen intron 7 in woodpeckers. Mol Biol Evol 17: 1101-1111.

Rahayu SE (1998) Phylogenetic of seven species of Familia Columbidae pigeons birds based on morphological characteristics and blood protein polymorphism. [Thesis]. Gadjah Mada University. Yogyakarta. [Indonesia] Rutschke E (1987) Waterfowl as bio-indicators. In: Diamond AW, Fillon FL (eds). The value of birds. ICBP Technical Publication No. 6. International Council for Bird Protection. Cambridge. Shadel GS, Clayton DA (1997) Mitochondrial DNA maintenance in vertebrata. Ann Rev Biochem 66: 409-435 Shearer TL, Oppen MJHV, Romano SL, Worheide G (2002) Slow mitochondrial DNA sequence evolution in the Anthazoa (Cnidaria). Mol Ecol 11:2474-2487. Soendjoto MA, Gunawan (2003) Bird diversity in six types of habitat PT Inhutani I Labanan concession East Kalimantan. Biodiversitas 4: 103111. [Indonesia] Sulandari S, Zein MSA (2002) Preliminary study for DNA sequence characterization of Eagles (Accipitridae). Technical report. Center of Research and Development of Biology LIPI. Bogor. [Indonesia] Susanti R (2008) Molecular analisys of Java Sparrow (Padda oryzivora) ND3 gene. Biosfera 25: 56-65 [Indonesia] Susanto AH, Amurwanto A, Nuryanto A (2004) Fish genetic diversity study of anguilla in the region to support biodiversity conservation efforts. Biosfera 21: 9-16 [Indonesia] Tuinen MV, Sibley CG, Hedges SB (2000) The early history of modern birds inferred from DNA sequences of nuclear and mitochondrial ribosomal genes. Mol Biol Evol 17: 451-457 Upholt WB, Dawid IB (1977). Mapping of mitochondrial DNA of individual sheep and goats rapid evolution in the D-Loop region. Cell. 11: 571-583. Wallace DC, Lott MT, Brown MD, Huoponen K, Torroni A (1995). Human Mitochondrial Genome database. The Human Data Base Project. Department of genetics and Molecular Medicine Emory. University of Atlanta. Emory, USA. Wartono H, Pouyaud L, Hadie LE (2000). Conservation strategy through mtDNA analysis approach: a case study on fish (Clarias batrachus) in Java. Proceeding of national seminary on fish biodiversity. Study Center of Biological Science Bogor Agriculture Institute-Japan International Cooperation Agency (JICA). Bogor, 6 Juni 2000 [Indonesia] Wilkinson GS, Mayer F, Kerth G, Petri B (1997) Evolution of repeat sequence arrays in the D-Loop region of bat mitochondrial DNA. Genetics 146: 1035-1048. Wood NJ, Phua SH (1996) Variation in the control region sequence of the sheep mitochondrial genome. Animal Genetics 27:25-33. Zein MSA, Maharadatunkamsi (2003) Analysis of mitochondrial DNA 12SrRNA gene eaters fruit bats Chinorax melanocephalus (Chiroptera: Pteropodidae) in the Halimun Mountain National Park. Biota 8: 17-26. [Indonesia]

B I O D I V E R S IT A S Volume 12, Number 2, April 2011 Pages: 76-85

ISSN: 1412-033X (printed edition) ISSN: 2085-4722 (electronic) DOI: 10.13057/biodiv/d120204

Hymenopteran parasitoids associated with the banana-skipper Erionota thrax L. (Insecta: Lepidoptera, Hesperiidae) in Java, Indonesia ERNIWATI, ROSICHON UBAIDILLAH♥ Museum Zoologicum Bogoriense, Research Center for Biology, Indonesian Institute of Sciences. Jl. Raya Jakarta-Bogor Km. 46, Cibinong, Bogor 16911, West Java, Indonesia. Tel. +62-21-8765056. Fax. +62-21-8765068. email: ubaidillah003@yahoo.com Manuscript received: 20 November 2010. Revision accepted: 7 February 2011.

ABSTRACT Erniwati, Ubaidillah R (2011) Hymenopteran parasitoids associated with the banana-skipper Erionota thrax L. (Insecta: Lepidoptera, Hesperiidae) in Java, Indonesia. Biodiversitas 12: 76-85. Hymenopteran parasitoids of banana-skipper Erionota thrax L. (Insecta: Lepidoptera, Hesperiidae) from Java, Indonesia are reviewed and an illustrated key to 12 species is presented to include Theronia zebra zebra, Xanthopimpla gamsura, Casinaria sp., Charops sp., Cotesia (Apanteles) erionotae, Brachymeria lasus, B. thracis, Ooencyrtus pallidipes, Anastatus sp., Pediobius erionotae, Agiommatus sumatraensis and Sympiesis sp. The surveys of the natural enemies of the banana-skipper were conducted in 1990-2006 in several localities in Java. The aim of this study was to assess the native natural enemies of E. thrax, especially the parasitic Hymenoptera. Infested eggs, larvae and pupae of E. thrax were collected and reared in the laboratory. Emerging parasitoids were preserved in both dry mounting and in 80% alcohol for the species identification. Members of families Braconidae, Ichneumonidae, Encyrtidae, Pteromalidae, Chalcididae, Eupelmidae and Eulophidae were recorded as parasitoids of the banana skipper E. thrax from Java, Indonesia. Species distribution and alternative hosts of the parasitoids are presented. Key words: Hymenoptera, parasitoids, banana skipper, Erionota thrax, identification key, distribution.

INTRODUCTION Erionota thrax L. was classified as a minor pest in Indonesia (Kalshoven 1951), however, very serious infestation occasionally occurs in Java. The pest has also caused economic damage to bananas in new banana plantations in Papua New Guinea (Sands et al. 1991). This study was initially conceived in conjunction with cooperative project in the title “Speciation and population dynamics of insect pests of crops in Indonesia: a basic study for integrated pest control” among Kanazawa University, Hokkaido University and Bogor Zoology Museum in 1992 in Java, Indonesia (Nakamura and Katakura 1992; Matsumoto et al. 1995). The project goal was to understand the seasonal pupulation dynamic of major pest in tropical Indonesia, includes banana-skipper E. thrax. Eventually, the research expanded to document the identities of parasitoids on banana-skipper not only in Java but also in other islands of Indonesia. There have been a few studies on banana-skipper, E. thrax in Indonesia e.g. Kalshoven (1951), especially on its natural enemies. The parasitoids of E. thrax from West Java were studied for the first time by Ashari and Eveleens (1974) who reported 94% of eggs, larvae and pupae were killed by six species of parasitoids. Hasyim et al. (1994) and Hasyim et al. (1999) have reported 14 species of parasitoids which occur in Sumatra including dipteran parasitoids. Okolle et al. (2006) have reported five primary endoparasitoids were recorded: Ooencyrtus erionotae Ferriere, Cotesia erionotae Wilkinson, Brachymeria albotibialis Hoffmann, Elasmus

sp. and Melaloncha sp. The first of three species were, respectively, the major egg, larval and pupal parasitoids. Hymenopteran parasitoids are very important as biological control agents of various agricultural pests and are thus responsible for the sustainable agriculture. The superfamilies Ichneumonoidea and Chalcidoidea are among the largest assemblages within Parasitica. Members of these superfamilies are parasitoids of economically importance insect-pest and have been heavily used in many classical biological control programs (LaSalle 1993). The objectives of this study were to identify the Hymenopteran parasitoids of E. thrax occurring in Java, record their distribution and better understand their biology. This is the first step towards recording the comprehensive parasitic hymenopteran fauna of E. thrax from Java. This paper will present the faunal make up and distribution of parasitic hymenoptera associated with E. thrax, including some new parasitic records from this island. An illustrated key to species is presented and each species is discussed.

MATERIALS AND METHOD The study was carried out in three main provinces of Java Island, between 1990 to 2006. Sixteen localities were selected respectively West Java (Cimanglid, Cimanggu, Sukaraja, Bogor Botanic Garden, Pagelaran, Sindangbarang, Ciomas, Tipar, Cigaru, Tajur-Cianjur), Central Java (Karimunjawa, Wonogiri, Purworejo), and

ERNIWATI & UBAIDILLAH â&#x20AC;&#x201C; Erionota thrax of Java

East Java (Purwodadi, Pasuruan, Southern Malang) to include different climatic and geographic conditions. Samples were collected in dry and wet seasons depending on the time availability. Each locality was sampled intensively when we visited the locality. The material was collected by hand collecting from different banana plantation systems both wild grown and cultivated bananas. Every banana leaf, especially the undersides, was observed carefully to find eggs, larvae, and pupae of banana skipper. All eggs, larvae, and pupae found were then removed from the leaf to plastic bag using scissors or hand picked. All eggs, larvae, and pupae are then transferred into a small plastic container in which only one specimen placed in each container. The plastic containers or plastic cups were all kept in the rearing room with the room temperature of 27-30Â°C, and 80% relative humidity. The size of culture plastic cups was 12 cm in diameter and 9 cm in height. Any parasitoids emerged from the eggs, larvae, and pupae were then killed by ethyl acetate and were removed into vials with 70% alcohol inside. Representative specimens were mounted as pinned specimens, and the minute specimens (less than 5 mm) were mounted on the rectangle card (Noyes 1982). The specimens were then examined under light stereo microscope (Olympus, SZX 12). Hand drawings of the specimens were prepared by second authors (RU) with the help of camera lucida and the required measurements were obtained by means of a calibrated occular micrometer. The voucher specimens are deposited in Entomology Laboratory Museum Zoologicum Bogoriense (MZB), Research Center for Biology, Indonesian Institute of Sciences, Cibinong Bogor, West Java.

RESULTS AND DISCUSSION Twelve species of hymenopteran parasitoids were collected from the eggs, larvae, and pupae of E thrax. Their number and relative abundance of parasitoid species, are given in Table 1. Five species of the parasitoids found in this investigation are members of the superfamily Ichneumonoidea and the remaining seven are members of the superfamily Chalcidoidea. All of the parasitoids reared from the eggs, larvae, and pupae of the E. thrax in Java were documented for the first time. Hasyim et al. (1999) recorded 12 species of hymenopteran parasitoids from Sumatra, in which one species in their list, Elasmus sp. was not found in Java, meanwhile one species Sympiesis that was found in East Java had not been recorded in Sumatra. Those parasitoids have been known to be economically important

species. Five species, namely Sympiesis sp., Agiommatus sumatraensis Crawford, Charops sp., Casinaria sp., Brachymeria thracis Crawford, are recorded for the first time from Java. There are a large number of specimens (i.e. about 347 specimen) from eggs (103 specimens), larvae (59 specimens), and pupae (185 specimens). The samples collected in Java undoubtedly indicate the richness of parasitoids on our agro-ecosystem. These data can play an important role in the biological control programs of the banana-skipper. Four species are known to infest eggs of skippers, i.e. Ooencyrtus pallidipes of the family Encyrtidae, Agiommatus sumatraensis Crawford of Pteromalidae, Pediobius erionotae Kerrich of Eulophidae, and Anastatus sp. of Eupelmidae. The last species was mistakenly included in the family of Encyrtidae by Hasyim et al. (1994) has also noted that Oo. erionatae Ferriee (1931) infested the egg of E. thrax in Sumatra, however, the species had been synonymized to Oo. pallidippes Asmead (1904) by Noyes and Hayat (1984). The P. erionatae which was reared from the eggs of E. thrax are known to be hyperparasitoids of Catesia erionotae Noyes (2002). Four species of parasitoids were found to infest larvae of skippers, i.e. Sympiesis sp. of Eulophidae that was specifically emerged from very early stage of larvae (L2). This species most probably belong to undescribe species and it is only found from East Java. The braconiid, Cotesia (Apanteles) erionotae Wilkinson emerged from the larvae in fourth and fifth instar stage, however ichnemoniids species, Charops sp. and Casinaria sp. emerged in thirds and fourth instar stage. Four species of parasitoids were recorded from pupae of skippers. two species belong to the

Table 1. List of natural enemies of Erionota thrax, host stages and their distributions in Java

Family/species

Ichneumonidae Theronia zebra-zebra Vollenhoven Xanthopimpla gampsura Krieger Casinaria sp. Charops sp. Braconidae Cotesia Apanteles erionotae Wilkinson Chalcididae Brachymeria lasus Walker Brachymeria thracis Crawford Encyrtidae Ooencyrtus pallidippes Ashmead Eupelmidae Anastatus sp. Eulophidae Pediobius erionotae Kerrich Sympiesis sp. Pteromelidae Agiommatus sumatraensis Crawford

Host stages

West Java

Distributions Central East Java Java

Pupa Pupa L3,L4 L3,L4 L3,L4 L3,L4

+ + + +

+ -

+ + + -

L4,L5

Pupa Pupa

+ +

+ -

+ +

Egg

Egg L2

+ -

+ +

Egg

Note: L1...5 = stage of larva, + = present, - = absent

B I O D I V E R S IT A S 12 (2): 76-85, April 2011

family of Ichneumonidae: Xanthopimpla gampsura Krieger and Theronia zebra-zebra Vollenhoven, and two others belong to the family of Chalcididae: Brachymeria lasus Walker and B. thracis Crawford. B. lasus was known to be hyperparasitoids of Casinaria sp. (Hasyim et al. 1994; Noyes 2002).

Key to Javanese species of parasitoids Hymenoptera of Erionota thrax Having known adequate important characters, we tried to construct suitable keys of the adult parasitoids including line drawing to show the habitus and the characters. The key is intended to identify the superfamily, family, and genera in which the species belong to. The following key and the diagnostic characters on the text for each species may prove helpful to recognise the twelve species. 1. Forewing with numerous veins and there are three or more closed cells (Figure 1a); 1st abdominal segment inserted high up on propodeum (= posterior part of thorax which is actually 1st abdominal segment) so that distance between propodeal socket and insertion of hind coxa is ca. equal to or greater than distance between socket and hind margin of metanotum; antennae usually filiform (= thread-like), unspecialized, with 18 or more segments; forewing with costal cell indistinct or absent, veins C, Sc, R and Rs fused between wing base and pterostigma (= opaque spot along costal wing margin) (Figure 1a); sternites of abdomen weakly sclerotized (= hardened); solitary larval parasitoids ..............…… ………………………………… (Ichneumonoidea) 2

semi-triangle areolet, hindwing with first abscissa of Cu1 about 0.3 times length of Cu-a. Gaster usually polished, often punctuate, colour yellow with marked black spots ………………..................……….…...……. ………….. Figure 2b. Xanthopimpla gampsura Krieger Mandible only moderately tapered, not twisted; labrum concealed when mandible closed; clypeus elongate. Forewing with 3r-m present, with small enclosing rhombic areolet; hindwing with first abscissa of Cu1 about 0.3 times length of Cu-a. Propodeal spiracle elliptical; propodeum dorsally with lateral longitudinal and lateromedian carinae discernible. Gaster with tergite one rather slender ……...….........................……. ……… Figure 2a. Theronia zebra-zebra Vollenhoven 5. Forewing with 3r-m absent, cu-a subvertical, 2r-m longer than abscissa of M between 2r-m 2m-cu; hindwing with distal abscissa of Cu1 obsolescent, Cuand cu-a sloping inwards posteriorly. Gaster with first segment very slender and long; clepeus convex with impressed maiginally; mandible short, with a broad ventral flange on basal ………....Figure 3b. Charops sp. Forewing with 3r-m present, areolate petiolate, 2-m-cu joining slightly to center, marginal cell long; hindwing with distal abscissa of Cu1 absent. Gaster with first segment long, petiole slender, compressed ………… ………..………….……........... Figure 3a. Casinaria sp. 6. Fore, mid and hind tarsi with 4 segments .…………… 7 Fore, mid and hind tarsi with 5 segments …………… 8

Forewings with reduced venation and without enclosed cells (Figs.1c and 1d); some metallic species; Abdomen usually cylindrical; antennae with various numbers of segments, if with 14 segments in female and of 13segments in male then ovipositor exposed or antennae attached to a shelf-like process of the face; cerci present; ovipositor opening terminal segments .......... …….……………………………… (Chalcidoidea) 6 2. Vein RS+M absent (Figure 1a: arrow A), vein 2m-cu present (Figure 1a: arrow B) ………………………… ..…………….…………………… (Ichneumonidae) 3 Vein RS+M present (Figure 1a: arrow A), vein 2m-cu absent (Figure 1a: arrow B) …………………………… … Figure 4a (Braconidae) Cotesia erionatae Wilkinson 3. Forewing with 2m-cu with two separate bullae (Pimplinae) (Figure 1b: arrow B) ..….......……….. 4 Forewing with 2m-cu with a single bulla (Figure 1a: arrow A) ….….......….…..…………………………… 5 4. Mandible strongly tapered, twisted; labrum exposed when mandible closed; clypeus transverse and entire; malar space shorter than basal mandibular width. Forewing with 3r-m present, with bigger enclosing

7. Scutellum with one pair of setae; forewing hyaline, submarginal vein with 2 dorsal setae and the vein strongly tapering at apex, not smoothtly joining the parastigma; stigmal vein short, the postmarginal vein shorter than stigmal vein and very difficult to see (Figure 7a); gena very short; flagellum very short; body length about 1.1 mm .............................. …………… … … … ………. Figure 7a. Pediobius erionotae Kerrich Scutellum with two pair of setae; forewing hyaline, submarginal vein with 6 dorsal setae and the vein not tapering at apex, smoothtly joining the parastigma; stigmal relatively long, the postmarginal vein longer than stigmal vein; gena relativelly long; flagellum relatively long; body length about 2.0 mm ……………………………......…………. Sympiesis sp. 8. Hind femur strongly enlarged and with teeth on ventral edge (Figure 5b and 5d), gaster convex; gena posteriorly with strong carina; prepectus very small and tegula only slight longer than broad; body black with yellowish or whitish marking at hind legs. ….............. ……………………………………… (Chalcididae) 9 Hind femur normal not strongly enlarged (Figure 5b and 5d), gaster not convex; gena posteriorly without

ERNIWATI & UBAIDILLAH – Erionota thrax of Java

strong carina; prepectus relatively large at least as broad as the tegula; body black or mettallic, without yellowish or whitish marking at hind legs …………….……. 10 9. Antenna swollen toward apex and taperring on the tip (Figure 5c); Hind femur black with apex yellow; hind tibia black with distinct subbasal and apical yellow patches (Figure 5d); apex of scutellum emarginate ………………..…… Brachymeria thracis Crawford Antena not swollen toward apex and rounded on the tip (Figure 5a); Hind femur black with apex yellow; hind tibia yellow with the base black (Figure 5b); apex of scutellum weakly emarginate and sligthly rounded ……………… Figure 4b Brachymeria lasus Walker 10. Mesopleuron greatly enlarged, convex, tranformed into a large undivided shield posterior margin of prepectus often loose and thin; spur of mid tibia often large and hairy ………………………………………......….. 11 Mesopleuron not enlarged, slightly concave medially, not tranformed into a regular shield and ventrally with distinct transverse crest before mid coxa; prepectus thin, not loose posteriorly; spur of mid tibia normal. Eye very large, with inner orbits strongly diverging downwards; female antenna with 3 anelli, flagellum relativelly short, body colour blackish metallic ……………………………………......……... Figure 7b (Pteromalidae) Agiomatus sumatraensis Crawford 11. Antenna with nine segments flagellomere, anelli one segment very small mid coxa not quite closed to hind one; mesoscutum convex and short; axillae transverse, often meeting in midline; forewing with submarginal vein very long, marginal vein very short and much shorter than stigmal vein …………………………. Figure 6a (Encyrtidae) Ooencyrtus pallidippes Ashmead Antenna with eigh segments flagellomere plus clava; mid coxa much nearer to hind coxa than to fore ones; mesoscutum with notaular depressions; axilla not strongly transverse and mostly wide apart so that scutellum not pointed anteriorly; hind wing with sub marginal vein shorter than marginal vein, marginal vein much longer than stigmal vein ………………………… ………………..... Figure 6b (Eupelmidae) Anastatus sp.

Description Family Ichneumonidae Genus Theronia Holmgren (1859) Species Theronia zebra-zebra Vollenhoven (1879) (Figure 2a). Pimpla zebra Vollenhoven (1879: 133), type species Pimpla zebra Vollenhoven (1879); Orientotheronia maculipes Morley (1913: 531), type species Orientotheronia maculipes Morley (1913), synonymized

with Theronia zebra by Morley (1914), transferred to Theronia zebra by Narayanan and Lal (1953: 319); Theronia callida Tosquinet (1903: 1), type species Theronia callida Tosquinet (1903), synonymized with Theronia zebra by Roman (1913: 1); Theronia maskeliyae Cameron (1905: 67), type species Theronia maskeliyae Cameron (1905), synonymized with Theronia zebra by Meade-Waldo and Morley (1914: 402). Diagnosis. This species can be easily distinguished by the following characters: body length about 12 mm; wing hyaline, stigma dark brown, forewing length about 11 mm; clypeus smooth, with margin slightly concave; frons smooth, with small carina between antennal sockets and with conspicuous black mark near antennal socket; mesoscutum with notauli hardly indicated; scutellum slightly convex; all body markings are black instead of rufous or rufous and black. Biology. This species is also known to be the parasitoids of pupa Atrophaneura alcinous mansonensis; Atrophaneura polyeuctes termessus; Attacus atlas; Caligula japonica; Cricula trifenestrata; Cricula trifenestrata javana; Cryptothelea minuscula; Delias belisama; Dendrolimus punctatus; Eriogyna pyretorum; Euploea leucostictos hobsoni; Hidari irava; Hyblaea puera; Lymantria serva; Olene mendosa; Parnara guttata. This wasp was recorded mainly from West Java and a few specimens were recorded from East Java. Specimens examined. West Java: 3♂, 6♀, MZB, Bogor, Kedung Halang, Sukaraja, 26.iii.1996, 250 m asl., Erniwati, ex. pupa E. thrax; Distribution. Indonesia: Java; India; China: Fujian, Guangdong, Guangxi, Guizhou, Hong Kong, Hunan, Jiangsu, Jiangxi, Sichuan, Taiwan, Xizang, Yunnan, Zhejiang; Japan: Okinawa; Myanmar; Vietnam; Thailand; Malaysia; Singapore. Gupta (1962) regarded that this species was described in 1879 from the type specimen collected from Ambarawa, Central Java and later in 1892 Peiper collected some more specimens from Sukabumi, those all reared from E. thrax, however (Tjoa 1939) collected two specimens from Bogor, both male and female reared from Cricula trifenestrata. Genus Xanthopimpla Saussure (1892) Xanthopimpla gampsura Krieger (1914) (Figure 2b) Xanthopimpla gampsura Krieger (1914: 1), type species Xanthopimpla gamsura Krieger (1914), lectotype by (Townes et al. (1961) female, South Borneo, deposited in Berlin; Xantopimpla gampsura Tjoa (1939: 501), Java: Sarapoh, West Borneo, host: Hidari irava, synonymized by Townes et al. (1961: 56); Xantopimpla gampsura Kalshoven, Sody and Bemmel (1951: 654), host: Hidari irava, synonymized by Townes et al. (1961: 56). Diagnosis. Among the Xanthopimpla complex, the species can be easily recognized by the black body color and yellow stripes on head and thorax, and the abdomen is yellow with marked black spots, the end part of the abdomen is brownish red. Body length about 6.5 mm; clypeus divided into basal and apical parts by transverse suture, clypeal margin transverse; mandible strongly twisted about 90º, slightly narrowed. The antennae are very

B I O D I V E R S IT A S 12 (2): 76-85, April 2011

long (Figure 2b). These diagnostic characters above are partly taken from Gauld (1984) and Gupta (1987). Specimens examined. West Java: 1♀, MZB, Bogor, Cimanglid, 20.vi.1996, 500 m asl, Erniwati, ex pupa E. thrax; 1♂, MZB, Bogor, Kedung Halang, Sukaraja, 21.v.1996, Erniwati, ex pupa E. thrax; Central Java: 1♂, MZB, Temanggung, Kedu, 28.iii.2005, 07°16'36.4″S 110°09'00.4″E, 680 m asl, S. Kahono, Erniwati, ex pupa E. thrax; East Java: 3♂, MZB, Purworejo, Bayan, Candisari and Dukuhrejo, 14.viii.2004, 07°43'36.7″S 109°57'42.8″E, 135 m asl, S. Kahono, Erniwati, Sarino, ex pupa E. thrax. Distribution. Indonesia: Java, Kalimantan, Sumatra; Malaysia. Biology. This species is known to be the parasitoid of Hesperiidae pupa, i.e. Cephrenes chrysozona, E. thrax; and Hidari irava. Casinaria Holmgren (1859) Casinaria sp. (Figure 3a) Diagnosis. Head slightly lenticular; clypeus weakly convex, broad, evently arcuate, mandible short, with a broad flange on ventral margin that abruptly ends about two-third of way along mandible. Pronotum very short; scutellum weakly convex; mesopleuron with speculum distinct, polished and weakly sculptured; mesopleural suture relatively strong; propodeum long, evenly declivous, with a median longitudinal furrow, spiracle oval. First segment of the gaster long, petilole slender. Specimens examined. West Java: 1♀, MZB, Bogor, Kedung Halang, Sukaraja, 23.iv.1996, 250 m asl, Erniwati, ex. larva E. thrax; 1♀, MZB, Bogor, Cipaku, 30.xii.1990, 400 m asl, Erniwati, ex. larva E. thrax; 1♀, MZB, Bogor, Parakan, 22.ii.1991, 250 m asl, Erniwati, ex. larva E. thrax; 1♀, MZB, Bogor, Curug Nangka, 28.ii.1991, 500 m asl, Erniwati, ex. larva E. thrax; 1♂, MZB, Bogor, Curug Nangka, 27.viii.1991, 500 m asl, Erniwati, ex. larva E. thrax; 1♂, MZB, Bogor, Sindangbarang, 12.xii.1990, 250 m asl, Ernwati, ex. larva E. thrax; 1♂, MZB, Bogor, Sindangbarang, 10. ii.1992, 250 m asl, Erniwati, ex. larva E. thrax. Distribution. Indonesia: Java (new record), Sumatra. Biology. This species was reared from pupa of E. thrax (Lepidoptera: Hesperiidae). Charops Holmgren (1859) Charops sp.1 (Figure 3b) Diagnosis. This species has combination characters as follows: head lenticular; clypeus convex, margin impressed, evenly arcuate, mandible rather short, with a broad flange on ventral margin that abruptly ends about two-third of way along mandible. Pronotum very short; scutellum deplanate; msesoscutum iniformly reticulate; mesopleuron with speculum not differentiated; mesopleural furrow not distinctly impressed; propodeum moderately long, abruptly declivous, with fairly evenly reticulate, spiracle elleptical. Gaster with first segment very long and slender. Specimens examined. West Java: 2♀, MZB, Bogor, Curug Nangka, 14.ii.1991, 500 m asl, Erniwati, ex. larva E. thrax; 1♂, MZB, Bogor, Cipaku, 11.ii.1991, 400 m asl,

Erniwati, ex. larva E. thrax; 1♂, MZB, Bogor, Kedung Halang, Sukaraja, 21.v.1996, 250 m asl. Erniwati, ex. larva E. thrax; Central Java: 2♀, MZB, Wonosobo, Garung, Maron, PLTA, 19.vi.2007, 07°17'.34″S, 109°55'16.″E, 1100 m asl, R. Ubaidillah, Rofik, Gianto, sweeping net. Distribution. Indonesia: Java (new record), Sumatra. Biology. This species was reared from pupa of E. thrax (Lepidoptera: Hesperiidae). Family Braconidae Genus Cotesia Cameron (1891) Cotesia erionotae Wilkinson (1928) (Figure 4a) Cotesia erionotae Wilkinson (1928), type species Apanteles erionotae Förster (1862: 225). Diagnosis. Body blackish brown, length about 3.5 mm; length of forewing about 2.5 mm; antenna slender, about as long as body length; mesoscutum and scutellum coarsely punctuate; hind coxa slightly dull and rugose-punctate; metasomal tergites distally to basal area with yellowish brown, legs bright yellowish brown, hind femur slightly darkened apically. Specimens examined. West Java: 4♂, 6♀, MZB, Bogor, Tanah Sareal, Cimanggu, 23.iv.1996, 250 m asl, Erni, ex. larva 4 E. thrax; 6♂, 4♀, MZB, Bogor, Ciomas, Cimanglid, 19.iii.1996. 500 m asl, Erni, ex. larva 4 E. thrax; 3♂, 5♀, MZB, Bogor, Kedung Halang, Sukaraja, 1.v.1996, 250 m asl., Erniwati, ex. larva E. thrax; Central Java: 4♂, 5♀, MZB, Temanggung, Kedu, 28.iii.2005, 07°16'36.4″S, 110°09'00.4″E, S. Kahono, Erniwati, Sarino, ex larva 4 E. thrax. Distribution. Indonesia: Java (new record), Sumatra. Biology. This species was reared from larva of E. thrax (Lepidoptera: Hesperiidae). Superfamily Chalcidoidea Family Chalcididae Genus Brachymeria Westwood (1829) Brachymeria lasus Walker (Figure 4b) Chalcis inclinator Walker (1862: 355), type species Chalcis inclinator Walker, synonymized by Joseph, Narendran and Joy (1973: 33); Chalcis nitator Walker (1862: 356), type species Chalcis nitator Walker; Chalcis obscurata Walker (1874: 399), type species Chalcis obscurata Walker, synonymized by Joseph, Narendran and Joy (1973: 29); Oncochalcis marginata Cameron (1904: 161), type species Oncochalcis marginata Cameron, synonymized by Narendran (1985: 88); Chalcis punctiventris Cameron (1911), type species Chalcis punctiventris Cameron, synonymized by Joseph, Narendran and Joy (1973: 33); Chalcis papuana Cameron (1913), type species Chalcis papuana Cameron, synonymized by Bouček (1988:71); Tumidicoxa regina Girault (1913: 101), type species Tumidicoxa regina Girault, synonymized by Bouček (1988:71); Chalcis dentate Girault 1915: 318), type species Chalcis dentate Girault, synonymized by Bouček (1988:71); Chalcis copernici Girault 1936: 2), type species Chalcis copernici Girault, synonymized by Bouček (1988: 71). Diagnosis. Body length about 6 mm, black; hind coxa black; hind femur black with yellow apically; base of hind

ERNIWATI & UBAIDILLAH – Erionota thrax of Java

tibia black, remaining yellow; apex of scutellum weakly emarginated; hind coxa of female with a distinct ventromesal tooth; first tergite of gaster smooth and not shagreened. Specimens examined. West Java: 12♀, MZB, Bogor, Tanah Sareal, Cimanggu, 23.iv.1996, 250 m asl, Erni, ex. pupa E. thrax; 1♂, 2♀, MZB, Bogor, Ciomas, Cimanglid, 23.iv.1996, 500 m asl, Erni, ex. pupa E. thrax; 3♂, MZB, Gede Pangrango NP, Sukabumi, Bodogol, Resort Office to Research Station, 10.v.2005, 800 m asl, Ubaidillah and Darmawan, sweeping net; 2♂, MZB, Ciamis, Panjalu, Dukuh, Situ Lengkong, 18.vi.2005, 07°09'S 108°16'E, 800 m asl, Sutrisno and Cholik, sweeping net; 2♂, MZB, Ciamis, Panjalu, Panambungan, 19.vi.2005, 07°08'S 108°15'E, 800 m asl, Ubaidillah and Darmawan, sweeping net; 2♂, MZB, Gunung Halimun Salak NP, Sukagalih, Cipeuteuy, rice fields, upland fields, 21.v.2006, 750 m asl, Ubaidillah and Darmawan, sweeping net; 1♂, MZB, Gede Pangrango NP, Sukabumi, Salabintana track to Camp III, 25.v.2006, 06°50'S 106°57'E, 1,130 m asl, Ubaidillah and Darmawan, sweeping net; Central Java: 5♂, 37♀, MZB, Grobokan, Tawangharjo, Mayahan, 8.viii.2004, 07°04'27.8″S 110°57'31.9″E, 90 m asl, S. Kahono, Erniwati, Sarino, ex. pupa E. thrax; 1♂, 6♀, MZB, Temanggung, Kedu, 28.iii.2005, 07°16'36.4″S, 110°09'00.4″E, S. Kahono, Erniwati, Sarino, ex. pupa E. thrax; 1♂, 23♀, MZB, Purworejo, Bayan, Candisari, 14.viii.2004, 07°43'36.7″S, 109°57'42.8″E, S. Kahono, Erniwati, Sarino, ex. pupa E. thrax; 1♀, MZB, Karimunjawa, P. Parang, 27.iii.2006, Erniwati, sweeping net; 2♂, MZB, Purwokerto, Baturraden, Botanic Garden trek to Pancuran Tujuh, 28.iii.2006, 109°11'S 07°17'E, 800 m asl, Ubaidillah and Darmawan, sweeping net; 6♂, MZB, Purwokerto, Baturraden, Botanic Garden trek to Pemalang, 29.iii.2006, 109°15'S 07°17'E, 800 m asl, Ubaidillah and Darmawan, sweeping net; 1♂, MZB, Cilacap, Nusa Kambangan, Sodong, Kali Nyamuk, 31.iii.2006, 07°45'S 108°56'E, 107 m asl, Ubaidillah and Darmawan, sweeping net; 2♂, MZB, Cilacap, Nusa Kambangan, Sodong, Limus Buntu, 31.iii.2006, 07°44'S 108°56'E, 98 m asl, Ubaidillah and Darmawan, sweeping net; 1♂, MZB, Cilacap, Nusa Kambangan, Karang Tengah ke Banteng, 01.iv.2006, 07°43'S 108°34'E, 98 m asl, Ubaidillah and Darmawan, sweeping net; Yogyakarta: 1♀, 8♂, MZB, Sleman, Pakem, Purwobinangun, Turgo Atas, 25.iii.2005 dan 13.vii.2005, 07°35'S 110°25'E, 1.100 m asl, Ubaidillah, Rofik and Darmawan, sweeping net; 2♀, 5♂, MZB, Sleman, Pakem, Purwobinamgun, Turgo Bawah, 14-15.vii.2005, 07°35'S 110°24'E, 910 m asl, Ubaidillah, Rofik and Darmawan, sweeping net; East Java: 1♂, MZB, Mojokerto, Kemlagi, 8.viii.2004, 120 m asl, l07°27'25.5″S, 112°20'31.1″E, S. Kahono, Erniwati, Sarino, ex. pupa E. thrax; 3♂, MZB, Jember, Tempurejo, Andongrejo, from Meru Betiri NP to Bande Alit, 02.v.2005, 08°24'S 113°44'E, 264 m asl, Ubaidillah, Cholik, Darmawan, sweeping net; 1♂, MZB, Jember, Tempurejo, Andongrejo, from Meru Betiri NP to Bande Alit, 03.v.2005, 08°24'S 113°44'E, 264 m asl, Ubaidillah, Cholik, Darmawan, sweeping net.

Distribution. Indonesia: Java, Sumatra, Nusa Tenggara, Sulawesi and Papua; Australasia; Holarctic; Nearctic; North Africa; Oceanic; Oriental; Palearctic. Biology. This species has been known to be parasitoid on about 120 species of other insects. For more detailed information of its host record see Noyes (2002). Brachymeria thracis Crawford Chalcis thracis Crawford (1911: 272), type species Chalcis thracis Crawford, synonymized by Narendran (1989: 257); Brachymeria medicina Joseph, Narendran and Joy (1970: 289-291), type species Brachymeria medicina Joseph, Narendran and Joy, synonymized by Narendran (1989: 257) Diagnosis. This species is closely related to B. euploea, however judging from the antennal character and the color patern on the hind tibia on both sexes this species is more closely related to B. femorata. This species can be distinguished by body length about 5 mm, black; hind coxa black; hind femur black with yellow narrow spot apically; base of hind tibia with small black spot, subbasal and apical yellow; antennae swollen apically; apex of scutellum weakly emarginated; hind coxa of female without ventromesal tooth; first tergite of gaster smooth and not shagreened. Specimens examined. West Java: 2♀, 7♂, MZB, Bogor, Ciomas, Cimanglid, 15.xi.1995, 500 m asl, Erni, ex. pupa E. thrax; 8♀, 7♂, MZB, Bogor, Ciomas, Cimanglid, 23.iv.1996, 500 m asl, Erni, ex. pupa E. thrax; 2♀, 3♂, MZB, Bogor, Ciomas, Cimanglid, 20.vi.1996, 500 m asl, Erniwati, ex. pupa E. thrax; Central Java: 9♀, 3♂, MZB, Klaten, Kebonarum 07°40'57.4″S, 110°32'27,3″E, 252 m asl, 28.iii.2005, S. Kahono, Erniwati, Sarino, ex. pupa E. thrax; 2♀, 3♂, MZB, Karimunjawa, P. Parang, 26.iii.2006, 1 m asl, Erniwati, sweeping net; 3♀, 3♂, MZB, Karimunjawa, Legon Lele, 4.iv.2006, 1 m asl, Erniwati, sweeping net; 3♀, 3♂, MZB, Karimunjawa, P. Nyamuk, 1.iv.2006, 05°44'10″S, 110°311'05″E, 1 m asl, Erniwati, sweeping net; East Java: 3♀, 6♂, MZB, Mojokerto, Kemlagi, 8.viii.2004, 120 m asl, l07°27'25.5″S, 112°20'31.1″E, S. Kahono, Erniwati, Sarino, ex. pupa E. thrax. Distribution. Indonesia: Java (new record), Sumatra; India: Kerala; the Philippines. Biology. This species was reared from the larvae of E. thrax which emerged in the pupal stage. Family Encyrtidae Genus Ooencyrtus Ashmead (1904) Ooencyrtus pallidippes Ashmead (Figure 6a) Aphidencyrtus pallidipes Ashmead (1904: 15), type species Aphidencyrtus pallidipes Ashmead, transferred to Oencyrtus by Noyes and Hayat (1984: 309); Ooencyrtus erionotae Ferriere (1931: 284), type species Ooencyrtus erionotae 1931, synonymized by Huang and Noyes (1994: 51). Diagnosis. This species can be easily distinguished by the following characters: body size about 1 mm, body colour dark metallic brown, legs yellowish brown; antennae yellowish with scape dark brown; fronto vertex less than 1/5 head width; all segments of flagellomere

B I O D I V E R S IT A S 12 (2): 76-85, April 2011

longer than wide; sculpture on anterior scutellum punctuate-reticulate with smooth anteriorly; forewing with marginal vein shorter than stigmal vein. Specimens examined. West Java: 4♂, 4♀, MZB, Bogor, Ciomas, Cimanglid 26.iii.1996; 2♀, MZB, 21. v.1996, 500 m asl, Erniwati, ex. eggs E. thrax; 1♀, Bogor, Bogor Botanic Garden, 250 m asl, Erniwati, ex. eggs E. thrax; East Java: 18♀, MZB, Mojokerto, Kemlagi, Bentro, 8.viii.2004, 07°27'25.5″S 112°20'31.1″E, 120 m asl, S. Kahono, Erniwati, Sarino, ex. eggs E. thrax. Distribution. Indonesia: Java; India: Andhra Pradesh, Assam, Karnataka; Malaysia; the Philippines; USA: Hawaii. Biology. This species was bred from the eggs of E. thrax and other hesperiid species such as, Pelopidas thrax, as well as papilionid eggs of Papilio demoleus and pierid eggs of Delias hyparete. Family Eupelmidae Genus Anastatus Motschulsky (1859) Anastatus sp. (Figure 6b) Diagnosis. This is one of few species of Anastatus sp. recorded from Java in which the antenna has eight segments of flagellomere plus a single annulus; mesoscutum of female impressed, at least posteriorly; mesopleural area slightly convex; middle tibial spur long and hairy. The body is dark blue metallic, and forewing with a long marginal vein and two large darks infumation. The fore and hind coxae are widely separated. Judging from the diagnostic characters above, we predicted this species belong to undescribed species. Specimens examined: East Java: 6♀, 1♂, MZB, South Malang, Sumberejo, Ampel, 19.iv.1995, Erniwati ex, eggs E. thrax. Distribution. This species known only from the specimen localities. Biology. This species was reared from the eggs of E. thrax. Family Eulopidae Genus Pediobius Walker (1846) Pediobius erionotae Kerrich (1973 (Figure 7a) Pediobius erionotae Kerrich (1973: 113), type species Pediobius erionotae Kerrich (1973). Diagnosis. This species is easily distinguished form other members of Pediobius sp. by the combination of characters, body shining and brightly colored, head moderately emarginated behind posterior ocelli, median band of scutellum broad, smooth and shining propodeum and nucha very weakly emarginated at apex. Most specimens were reared from eggs of banana leaf roller E. thrax. Specimens examined. West Java: 3♂, 1♀, MZB, Bogor, Bogor Botanic Garden, 26.iii.1996, 250 m asl, Erniwati, ex. eggs E. thrax; 5♂, 2♀, MZB, Bogor, Kedung Halang, Sukaraja, 21.v.1996, 250 m asl. Erniwati, ex. eggs E. thrax; East Java: 7♂, 11♀, MZB, Mojokerto, Kemlagi, Bentro, 8.viii.2004, 07°27'25.5″S 112°20'31.1″E, 120 m asl, S. Kahono, Erniwati, Sarino, ex. eggs E. thrax.

Distribution. Indonesia: Sumatra, Java; Malaysia: Sabah (Purnamasari and Ubaidillah 2007). Biology. This species was reared from the eggs of E. thrax. also as hyperparasitoid of Cotesia erionotae. Genus Sympiesis Förster (1856) Sympiesis sp. Diagnosis. This species is closely related to the group of S. javanica, in some characters also close to the group of S. dolichogaster, but in the combination of its characters does not allow its placing in any these groups. These combination characters of this species are: both sexes have four funicular flagellomeres; first to third male flagellomeres branched basally. Posterior margin of clypeus slightly concave; mesoscutal notauli incomplete; setae on mesoscutal midlobe usually arranged in regular longitudinal rows (if not, then propodeum without median carina or plicae); scutellum without sublateral grooves, reticulately sculptured; sculpture on mesoscutum, scutellum, and axillae nearly uniform. Postmarginal vein 2x stigmal vein length or longer; disc sometimes infuscate near stigma and/or parastigma; speculum present, basal cell bare; basal and cubital veins setose; 1 long row of admarginal setae present but not entirely exposed by speculum. Body predominantly metallic bluish green; head and mesosoma metallic bluish green; antennal scape pale yellow. Specimens examined. West Java: 5♂, 4♀, MZB, Pasuruan, Sugro 10.viii.2004, 07°54'38″S 112°50'38″E, 1,860 m asl, S. Kahono, Erniwati, Sarino, ex. 2nd instar larvae of E. thrax. Distribution. Indonesia: East Java. Biology. This species was reared from the 2nd instar larvae of E. thrax. Family Pteromalidae Genus Agiommatus Crawford (1911) Agiommatus sumatraensis Crawford (Figure 7b) Agiommatus sumatraensis Crawford (1911: 267), type species Agiommatus sumatraensis Crawford, original description. Diagnosis: This species can be easily recognised by the following characters, body length about 1.5 mm; antennae short, pale, with three annelli; clypeal margin produced, with rather deep and broad emarginated; pronotal end rounded; mesoscutum with notauli not complete; scutellum regularly reticulate, without sternal separation; propodeum with an anterior depression which is subdivided by costula. Specimens examined. West Java: 16♀, MZB, Bogor, Tanah Sareal, Cimanggu, 19.iv.1996, 250 m asl, Erni, ex. eggs E. thrax; ♂, 5♀, MZB, Bogor, Kedung Halang, Sukaraja, 21.v.1996; 15♂ 6♀, 26.v.1996, 250 m asl. Erniwati, ex. eggs E. thrax; East Java: 1♂, 16♀, MZB, Mojokerto, Kemlagi, Bentro, 8.viii.2004, 07°27'25.5″S 112°20'31.1″E, 120 m asl, S. Kahono, Erniwati, Sarino, ex. eggs E. thrax. Biology. This species was reared from the eggs of E. thrax. Distribution. Indonesia: Java (new record), Sumatra.

ERNIWATI & UBAIDILLAH â&#x20AC;&#x201C; Erionota thrax of Java

A B B

B 2a 2.5 mm

1e 2b 1 mm

1 mm 2.5 mm

4b 3b

2 mm

B I O D I V E R S IT A S 12 (2): 76-85, April 2011

5b 6a

1 mm

0.5 mm

6b 6b

Figures: 1. a. Forewing of Xanthopimpla gampsura Krieger; b. Forewing of Apanteles (Cotesia) erionotae Wilkinson; c. Forewing of Ooencyrtus erionotae Ferriere; d. Fore wing of Brachymeria lasus Walker; e. Lateral view, metasoma of Xanthopimpla gamsura Krieger

0.5 mm 0.5 mm

2. a. Theronia zebra-zebra Vollenhoven b. Xanthopimpla gampsura Krieger 3. a. Casinaria sp. b. Charops sp. 4. a. Cotesia erionotae Wilk b. Brachymeria lasus Walker 5. a. Antena of Brachymeria lasus Walker b. Hind leg of Brachymeria lasus Walker c. Antena of Brachymeria thracis Crawford d. Hind leg of Brachymeria thracis Crawford

7b 6. a. Ooencyrtus pallidippes Ashmead b. Anastatus sp. 0.5 mm

7. a. Pediobius erionotae Kerrich b. Agiomatus sumatraensis Crawford

ERNIWATI & UBAIDILLAH – Erionota thrax of Java

CONCLUSION Our results demonstrate that hymenopteran parasitoids of banana-skipper E. thrax L. differentially occurred throughout the three provinces of Java surveyed. However, this may have been influenced by the size of the eggs, larvae, and pupae collected. The Javanese banana-skipper is parasitized by 12 species of hymenopteran parasitoids. There are four species, namely: Oo. pallidippes Ashmead, Anastatus sp., P. erionotae Kerrich and A. sumatraensis Crawford parasitized eggs and four species, namely: Casinaria sp., Charops sp., Cotesia (Apanteles) erionotae Wilkinson, and Sympiesis sp. emerged from larvae; and four other species, T. zebra-zebra Vollenhoven, X. gampsura Krieger, B. lasus Walker and B. thracis Crawford emerged from pupae of E. thrax. Several species such as Oo. pallidippes and Sympiesis sp. have been known as primary parasitoids and some others such as P. erionatae have been noted as hyperparasitoids Noyes (2002). However, further detailed studies needed to clearly understand the tropic of the parasitoids. The presence in Java of an important fauna of parasitoids of the bananaskipper is a serious asset in the perspective of the biological control. It would be necessary to complete this survey by studying the taxonomy of the unknown or undescribed species of hymenopteran parasitoids such as Casinaria sp., Charops sp., Anastatus sp. and Sympiesis sp. This related work will also to provide additional data on the biodiversity of these important insects for the integrated pest management program.

ACKNOWLEDGEMENTS The authors wish to thank Prof. Koji Nakamura of the Kanazawa University, Japan for his encouragement to do this study and for his financial support. We thank Dr. Djunijanti Peggie of Museum Zoologicum Bogoriense, RCB, IIS, Cibinong Bogor, West Java for her kind comments that improved the manuscript. We also thank Prof. Dr. Woro Angraitoningsih and Dr. Sih Kahono from MZB, RCB, IIS, Cibinong Bogor, West Java for their assistance in field study and many suggestions in methodology of the specimen collection. We deeply thank to Sarino and Endang Cholik for collecting, rearing and preparing specimens.

REFERENCES Ashari, Aveleens KG (1974) The banana leaf roller (Erionata thrax): Population dynamics natural biological control by parasites and timing of chemical control. Agricultural cooperation Indonesia-the Natherland. Reserach Report Indonesia, Ministry of Agriculture. Jakarta. Ashmead WH (1904) A list of Hymenoptera of the Philippine Islands with descriptions of new species. J New York Entomol Soc. 12 (1): 1-22. Bouček Z (1988) Australasian Chalcidoidea (Hymenoptera). A biosystematic revision of genera of fourteen families, with a reclassification of species. CAB International, Wallingford, U.K.

Crawford JC (1911) Descriptions of new Hymenoptera. 3. Proc United States Nat Mus 41: 267-282. Gauld ID (1984) An Introduction to the Ichneumonidae of Australia. Br Mus (Nat His) Pub No. 895: 1-413. Gupta VK (1962) Taxonomy, zoogeography, and evolution of IndoAustralian Theronia (Hym.: Ichneumonidae). Pac Insects Monograph 4: 1-142. Gupta VK (1987) The Ichneumonidae of the Indo-Australian area (Hymenoptera). Mem Amer Entomol Inst No. 41 (Part 1): 1-597. Hasyim A, Hasan N, Syafril, Harlion, Nakamura K (1994) Parasitoids of the Banana Skipper Erionota thrax (L.) in Sumatera Barat, Indonesia, with notes on their life history, distribution and abundance. Tropics 3 (2): 131-142. Hasyim A, Hasan N, Syafril, Harlion, Nakamura K (1999) Detection of egg parasitism and its mortality on the banana skipper, Erionota thrax (L.) eggs in the province of West Sumatera (Indonesia). J Hortikultura 8 (4): 1278-1283. Huang DW, Noyes JS (1994) A revision of the Indo-Pacific species of Ooencyrtus (Hymenoptera: Encyrtidae), parasitoids of the immature stages of economically important insect species (mainly Hemiptera and Lepidoptera). Bull Nat His Mus (Entomol Ser) 63 (1): 1-136. Joseph KJ, Narendran TC, Joy PJ (1973) Oriental Brachymeria. A monograph on the oriental species of Brachymeria (Hymenoptera: Chalcididae). Department of Zoology, University of Calicut. Kerala, India. Kalshoven LGE, Sody, Bemmel (1951) De plagen van de cluturrgewassen in Indonesië 2: 654, 897. Kerrich GJ (1973) A revision of the tropical and subtropical species of the eulophid genus Pediobius Walker (Hymenoptera: Chalcidoidea). Bulletin of the Br Mus (Nat His) (Entomol) 29 (3): 113-199. LaSalle J (1993) Parasitic Hymenoptera, biological control and biodiversity. In: LaSalle J, Gauld ID (ed) Hymenoptera and Biodiversity. CAB International. Wallingford, UK. Matsumoto K, Erniwati, Rosichon U, Nakamura K (1995) Head Capsule width of larva and duration of developmental stages of the Banana Skipper, Erionota thrax (L.), (Lapidoptera: Hesperiidae) in Bogor Indonesia. Tropics 4 (2/3): 247-252. Nakamura K, Katakura H (1992) Evolotionary biology and population dynamics of herbivorous ladybeetles in Indonesia. Report of the 1990-1991, Saporo, Japan. Narendran TC (1989) Oriental Chalcididae (Hymenoptera: Chalcidoidea). Zoological Monograph. Department of Zoology, University of Calicut, Kerala, India. Narendran TC (1986) Family Chalcididae. In: Subba Rao BR, Hayat M (eds) The Chalcidoidea (Insecta: Hymenoptera) of India and the adjacent countries). Oriental Insects 20: 11-41, 307-310. Noyes JS (1982) Collecting and preserving chalcid wasps (Hymenoptera: Chalcidoidea). J Nat Hist 16: 315-334. Noyes JS (2002). Interactive catalogue of World Chalcidoidea (2001second edition) CDrom: Taxapad, Vancouver and Natural History Museum. London. Noyes JS (2003) Universal Chalcidoidea Database [database on the Internet]. http: //nhm.ac.uk/research-curation/projects/chalcids/ Noyes JS, Hayat M (1994) Oriental mealybug parasitoids of the Anagyrini (Hymenoptera: Encyrtidae). CAB International. Oxford. UK. Noyes JS, Hayat M (1984) A review of the genera of Indo-Pacific Encyrtidae (Hymenoptera: Chalcidoidea). Bull Br Mus (Nat His Entomol) 48: 131-395. Purnamasari H, Ubaidillah R (2007) Notes on parasitic wasps Genus Pediobius Walker (Hymenoptera: Eulophidae) of Java, Indonesia with five new records. Treubia 35: 117-136. Sands DPA, Sands MC, Arura M (1991) Banana skipper, Erionota thrax (L.) (Lepidoptera: Hesperiidae) in Papua New Guinea: a new pest in the south Pacific region. Micronesia Suppl 3: 93-98. Tjoa TMo (1939) Aateekeningen over de parasieten van Hidari iava in verband met de oekologie dezer plaag. Landbouw Buitenzorg 15: 493-509 Townes H, Townes M, Gupta VK (1961) A Catalogue and reclassification of Indo-Australian Ichneumonidae. Mem Amer Entomol Inst 1: 1522.

BIODIVERSITAS Volume 12, Number 2, April 2011 Pages: 86-91

ISSN: 1412-033X (printed edition) ISSN: 2085-4722 (electronic) DOI: 10.13057/biodiv/d120205

Plant community establishment on the volcanic deposits following the 2006 nuées ardentes (pyroclastic flows) of Mount Merapi: Diversity and floristic variation SUTOMO1,♥, RICHARD HOBBS2, VIKI CRAMER2 1

Bali Botanic Garden, Indonesian Institute of Sciences, Candikuning, Baturiti, Tabanan, Bali 82191, Indonesia. Tel. +62-368-21273. Fax. +62-36822051. ♥email: tommoforester@yahoo.com 2 School of Plant Biology the University of Western Australia, 35 Stirling Hwy, Crawley, Perth 6009, Western Australia. Manuscript received: 29 October 2010. Revision accepted: 20 January 2011.

ABSTRACT Sutomo, Hobbs R, Cramer V (2011) Plant community establishment on the volcanic deposits following the 2006 nuées ardentes (pyroclastic flows) of Mount Merapi: diversity and floristic variation. Biodiversitas 12: 86-91. Species establishment and composition changes in a substrate with little or no biological legacy is known as primary succession, and volcanoes, erosion, landslides, floodplains and glaciers are some type of disturbances that can create this kind of environment. Mount Merapi with its Merapi-type nuées ardentes or pyroclastic flows provides excellent opportunities to study primary succession. Using chronosequence approach, plant establishment and succession was studied, and thus five areas that were affected by nuées ardentes deposits between 1994 and 2006 were chosen as study sites. Results showed that there was a rapid colonization by vascular plants in primary succession as the sites aged. Imperata cylindrica, Eupatorium riparium, Anaphalis javanica, Athyrium macrocarpum, Brachiaria paspaloides, Dichantium caricosum, Selaginella doederleinii, Eleusine indica, Cyperus flavidus, Calliandra callothyrsus and Acacia decurrens were the species mainly responsible in explaining the differences between sites. Furthermore, the species richness and diversity reach their peak 14 years after disturbance. Key words: plant establishment, primary succession, chronosequence, Mount Merapi.

INTRODUCTION Species establishment and composition changes in a substrate with little or no biological legacy is known as primary succession, and volcanoes, erosion, landslides, floodplains and glaciers are some type of disturbances that can create this kind of environment (Walker and del Moral 2003). Volcanic eruption still poses a significant challenge in the study of primary succession compared with other disturbances because of the absence of the remaining biological legacy following the eruption (Franklin et al. 1985). One type of volcanic disturbance is nuées ardentes or pyroclastic flows. Nuèes ardentes are hot turbulent gas and fragmented material resulting from a collapsed lava dome that rapidly moves down the volcanic slope (Dale et al. 2005b). The accumulation of this material is called a nuées ardentes deposit and it may be up to ten meters thick (Franklin et al. 1985). Such purely mineral deposits preserve no “memory” of previous vegetation indicated by the absence of a seed bank (Thornton 2007). Hence, colonization must occur from other undisturbed places. Disturbance and recovery are two factors that play a significant role in the dynamics of a community and its species diversity (Connell and Slatyer 1977; Crain et al. 2008). Establishment of invasive plant is interceded by disturbance (Hobbs and Huenneke 1992). Vegetation establishment on volcanic deposits has been documented in many parts of the world such as in USA, Italy and Japan, with rates of establishment shown to vary (Aplet et al.

1998; Dale et al. 2005c; Eggler 1959; Tsuyuzaki 1991). For example, plant establishment and spread on the debrisavalanche deposit of Mount St. Helens in USA were slow during the first years after eruption (Dale et al. 2005c). In contrast, Taylor (1957) reported that six years after Mt Lamington in West Papua erupted, vegetation regeneration was very rapid, and included species such as Saccharum spontaneum, Imperata cylindrica, Pennisetum macrostachyum, Vitaceae and several ferns. Mt Krakatau had at least 64 vascular plant species (dominated by grasses species such as S. spontaneum and I. cylindrica) which colonized the island 3 years after the eruption (Thornton 2007). There are several methods to examine a succession trajectory. A commonly used method is the chronosequence approach (space for time substitution). An alternative approach is to establish permanent plots to do such research (del Moral 2007; del Moral and Wood 1993; Hobbs et al. 2007; Simbolon et al. 2003). Although there have been some criticism of the chronosequence approach (Herben 1996; Johnson and Miyanishi 2008), it is still a useful method, especially when timing and logistics are a problem (Aplet et al. 1998; Myster and Malahy 2008). The nuées ardentes deposits found in Mt Merapi are relatively young, with the last known eruptions occurring between 1994 and 2006. The objective of this study was to describe the patterns of plant recovery in the early successional stage of the nuées ardentes deposits on Mount Merapi using chronosequence approach. The research

SUTOMO et al. – Plant community on the volcanic deposit of Mount Merapi

questions were: (i) do species composition and diversity vary across deposits of different ages? (ii) Which species contribute most to the differences in composition between different aged deposits? MATERIAL AND METHOD Study sites This research was conducted in June 2008 and the research sites were located in the south-west flank forests of Mount Merapi, in the zone of the Mount Merapi National Park (Central Java and Yogyakarta provinces, Indonesia). These sites are the most prone to, and most often affected by, volcanic disturbance, due to the nuées ardentes that tend to flow down the hills in this direction. We chose five areas that were affected by nuées ardentes deposits between 1994 and 2006. The five deposit sites were located in a lower montane zone (Montagnini and Jordan 2005). The summary of the study sites characteristics can be found in Table 1 and Figure 1.

Table 1. Summary of the sampling site characteristics on Mount Merapi. Age of Mean altitude deposits* (m) (years) 2006 2 1,220 2001 7 2,002 1998 10 1,579 1997 11 1,207 1994 14 1,180 Note: * Aged of the deposits at the time of sampling Year of last nuées ardentes

Mean slope (°) 12.2 28.26 25.33 6.53 6.23

Sampling Vegetation on the five nuées ardentes deposits was sampled in 2008. Due to the difficulty of the areas and the similarity of substrates condition on the sites, we sampled ten circular plots (with 5 m radial) in each deposit (50 plots in total), assigned at random to grid cells on a map (Dale et al. 2005a). Each plot was located in the field with reference to a compass and a handheld Global Positioning System (GPS Garmin E-Trex Legend). We measured plant

Scale 1:25.000

Figure 1. Sampling location on Mount Merapi National Park, Java.

B I O D I V E R S I T A S 12 (2): 86-91, April 2011

abundance as density, a count of the numbers of individuals of a species within the plot (Endo et al. 2008; Kent and Coker 1992). Local plant name and Latin name, when known, was noted. Whenever there was any doubt about species name, a herbarium sample was made. Drying and sample identification were done in Dendrology Laboratory, Faculty of Forestry, Universitas Gadjah Mada. Vascular plant nomenclature is based on Backer and Bakhuizen van den Brink (1963). Although homogeneity of the sites was taken into account when choosing sample sites, differences in site conditions were likely to occur. Hence, for each circular plot, site characteristics (altitude and slope) were measured. Altitude was measured using GPS and cross checked with 1:25,000 topographic maps. A clinometer (Suunto PM-5 clinometer) was used to determine the slope (in degrees) (Le Brocque 1995). Data analysis Species diversity The Shannon-Wiener Index of Diversity (H') is the index of diversity that is more broadly used by ecologists because it integrates species richness and evenness, and is not influenced by sample size (Isango 2007; Ludwig and Reynolds 1988; Magurran 1988). Shannon-Wiener species diversity on each deposit was then calculated. Changes in these values across the deposits were tested for significance using one-way ANOVA and Tukey’s HSD test using SPSS package V.11.5. Floristic variation We tested differences in community composition between deposits using data on species abundance per plot. The data was square root transformed (Valessini 2009) prior constructing resemblance matrix based on BrayCurtis similarity. Non metric Multi Dimensional Scaling (NMDS) ordination diagram was then generated based on the resemblance matrix. This ordination method is best to apply when we want to test the a priori that there is differences in terms of species composition in each deposits by calculating Bray-Curtis Similarity Index and visually ordinate them in a 2-d space (Clarke 1993). Variation in community composition between deposits was subsequently tested for significance using one-way ANOSIM (analysis of similarity). A zero (0) indicates that there is no difference among groups, while one (1) indicates that all samples within groups are more similar to one another than any samples from different groups (Clarke 1993). The SIMPER analysis was then used to explore the relative contribution of individual species to dissimilarity among deposits. All of these analyses were conducted using PRIMER V.6 (Clarke and Gorley 2005) RESULTS AND DISCUSSION Species richness and diversity of the deposits In the first decade of primary succession, plant recolonization on Mount Merapi nuées ardentes deposits was rapid, with fifty six species belonging to 26 families recorded. The highest number of species belonged to the

Asteraceae, then Poaceae, followed by Fabaceae and Rubiaceae. The number of species present varied as the deposit aged, with a rising trend of species richness and diversity over time (Table 2). Significant differences in species richness were found (ANOVA, P < 0.05, Table 2), with the two youngest deposits having lower richness than the three oldest deposits. Species richness decreased with time at first, and then increased to become more or less stable after more than 10 years. However, species diversity in the youngest and oldest deposits was not significantly different. This phenomenon might be due to the loss of pioneer species in the oldest deposit. In the youngest deposit the site was still relatively poor of tolerant species and as time goes, pioneer species abundantly invade the sites. As the site aged in the oldest deposit, these abundant of pioneer species were started to die out and replaced by subsequent more tolerant species. Table 2. Differences in species richness and diversity between groups of nuées ardentes deposit. Superscript letters (a-b) after mean values (±SD) indicates significant different assessed with Tukey’s HSD test. ANOVA Group Deposit 2006 Deposit 2001 Deposit 1998 Deposit 1997 Deposit 1994

Mean species richness 4.1 ±1.59a 2.9 ±0.56a 6.5 ±1.26b 6.6 ±1.26b 6.4 ±1.35b F(4, 47) = 18.26

Mean species diversity 1.03 ± 0.3ab 0.95 ± 0.29a 0.95 ± 0.34a 1.38 ± 0.16b 1.3 ± 0.35ab F(4, 47) = 4.651

The decline in species richness from the 2006 deposit to 2001 contradicts the expectation that species richness would increase over early successional time. Beside time since disturbance, species composition in each of the deposits would also be influenced by site attributes or characteristics. Located at the highest altitude (± 2000 m asl.) compared with the other deposits, vegetation in the 2001 deposit would likely be influenced by the natural zonation and microclimate (van Steenis 1972; Whitten et al. 1996). Vegetation in high altitude are usually comprises of dwarf plants and because of the more hostile environment (i.e. winds intensity, lower temperature and steep slopes), less variability in the species composition is observed (van Steenis 1972; Whitten et al. 1996). High altitude and also steep slope has shaped the characteristic of the vegetation. Imperata cylindrica appear, but in much less abundance than any other species such as Anaphalis javanica and Eupatorium riparium. According to Heyne (1987) , E. riparium is a fast growing species, usually found in steep slope in a wide range of soil conditions. Beside pioneer shrubs and grasses, there was also seedling of woody species that was found occur only in the 2001 deposit. It was the seedling of Dodonaea viscosa. D. viscosa is a small shrub to a small tree up to 8 m height and distributed throughout the southern hemisphere. D. viscosa was also found on poor soils and rocky sites on Mount Tambora, an active volcano in Sumbawa, Indonesia at 1,800 m asl altitude (de Jong Boers 1995).

SUTOMO et al. â&#x20AC;&#x201C; Plant community on the volcanic deposit of Mount Merapi

Floristic variation among deposit ages Non metric Multi Dimensional Scaling (NMDS) ordination analysis confirmed the a priori that there were differences between plots with a clear separation between younger and older deposits, except for deposit of 1997 and 1994, which were grouped together and some plots of the 1998 deposit that were in the same group cluster with the 1997 and 1994 deposits (Table 3, Figure 3). This indicated the similar floristic composition in these deposits. Two plots from the 2006 deposit fell into their own group. These two plots have more similarity to each other compared with the rest of the plots from the 2006 deposit. By checking the raw data in each plot we found that Polygala paniculata was the species that responsible for this result by occurring only in the two grouping plots. For one plot grouping in the 1994 deposit, Stachytarpheta jamaicensis was found to be the differentiating species. The global test of analysis of similarity showed a significance level of P = 0.1% and a global R-value of 0.861, which indicated that there were significant differences in Bray-Curtis species similarities between deposits on Mount Merapi. ANOSIM also showed that differences between 1997 and 1994 were not statistically significant, confirming the NMDS ordination analysis. Table 3. ANOSIM pairwise test of significance differences between deposits. Global test of NMDS plots ordination: Sample statistic (Global R) 0.861. Significance level of sample statistic (P = 0.1%) Groups 2006 and 2001 2006 and 1998 2006 and 1997 2006 and 1994 2001 and 1998 2001 and 1997 2001 and 1994 1998 and 1997 1998 and 1994 1997 and 1994

R statistic 0.92 0.964 0.908 0.884 0.966 0.939 0.92 0.898 0.875 0.34

P (%) 0.1 0.1 0.1 0.1 0.1 0.1 0.1 0.1 0.1 0.1

Figure 3. Two dimensional plot ordinations derived from NMDS for species abundance and composition. Symbols correspond to the year of eruption. Plots at greater distances were more dissimilar in composition. Ellipses indicate groups resulting from cluster analysis. A low stress value (0.14) indicates good representation of data.

The top eight species that contributed most to the dissimilarity among deposits was determined using SIMPER analysis (Table 4). In general, comparisons between deposits showed dissimilarity of more than 90%, except for the comparisons of the 1997-1998, 1994-1998 and 1994-1997 deposits, which had average dissimilarity values of 83.08, 86.57 and 71.08 %, respectively. Results also showed that species that had the highest contribution percentage (i.e. the most contributed species in differentiating between deposits) were not always the most consistent in their contribution to the dissimilarity (which indicates by the ratio of average dissimilarity with the standard deviation) (Table 4). In the 2001-2006 deposits, Athyrium macrocarpum was the most differentiating species but appears less consistently compared with Paspalum conjugatum. Similarly, Cyperus flavidus was the most differentiating species between groups 1994-1998 but Polytrias amaura was the most consistent one. Some species, such as A. macrocarpum and E. riparium, were present in all five deposits. A. macrocarpum fluctuated in abundance. It was abundant at first in the youngest deposit then decreased sharply in the 2001 deposit. It then increased in the older deposits, only to decrease again in the oldest deposit. E. riparium abundance was lowest at the youngest deposit where it was started to increase throughout older deposit and then decreased in the oldest deposit. Different species have their peak abundance at different times during these early stages of succession. A. macrocarpum was paramount in the earliest stage (i.e. 2006 deposit), I. cylindrica reached its peak in the more or less middle stages of the successional time range (deposit 1998) whereas E. riparium, Calliandra callothyrsus and Polyosma ilicifolia peaked at the intermediate stage (1997 deposit). All species abundance decreased in the oldest deposit. Establishment of plant from seeds on volcanic deposits depends on a range of factors. Plant establishment in Mount St. Helens USA was influenced by factors such as distance from seed sources, species-specific dispersal capabilities, germination and growth characteristics of colonizing species and the substrate condition (Dale et al. 2005a; Dale et al. 2005c). Plant establishment in primary succession is also largely influenced by the development of the sites physical environment. Generally, nitrogen and phosphates are the most limiting essential macro nutrient in new volcanic soil materials (del Moral 2007). By means of physical weathering of the materials in the new substrates through time, phosphorus will become available for plants (Walker and Syers 1976). For nitrogen, N2 fixing organisms such as those form Leguminoceae made this nutrients available for the subsequent plant species in the succession (Bellingham et al. 2001; Walker et al. 2003). Furthermore, the role of organic matters is also prominent in the water and nutrients retention to support the growth of the occurring species (Hodkinson et al. 2002). If the process and mechanism of recovery and establishment in primary succession on Mount Merapi is to be investigated, a long term vegetation dynamics study is needed. Long term vegetation dynamics studies are essential complement to chronosequence studies hence

B I O D I V E R S I T A S 12 (2): 86-91, April 2011

establishment of permanent sampling plots and or resampling the chronosequence sites are recommended to do such study (Foster and Tilman 2000; Myster and Malahy 2008). However, the results found in this study highlight the continuing need and importance of research on community dynamics in succession with regards to volcanic disturbances in Indonesia with 130 active volcanoes lies on its region.

Contrib%

Groups 2001 and 2006 Athyrium macrocarpum 2.69 Paspalum conjugatum 2.75 Pinus merkusii 1.67 Dodonaea viscosa 0 Polygonum chinense 0 Anaphalis javanica 0 Saprosma arboreum 0 Eupatorium riparium 0.1 Average dissimilarity = 97.35%

0.2 0 0 1.89 1.57 0.41 0.34 0.34

18.99 15.39 13.11 12.03 10.93 3.37 2.76 2.66

1.3 1.62 1.9 1.04 1.52 0.58 0.59 0.65

19.51 15.81 13.47 12.35 11.23 3.46 2.84 2.73

Groups 1998 and 2006 Cyperus flavidus 0 Imperata cylindrica 0 Panicum reptans 0 Athyrium macrocarpum 2.69 Paspalum conjugatum 2.75 Eupatorium riparium 0.1 Pinus merkusii 1.67 Anaphalis javanica 0 Average dissimilarity = 98.21%

6.92 5.31 3.98 0.24 0 2.18 0 1.32

22.09 14.65 12.34 8.16 7.4 6.39 5.31 3.66

1.78 1.05 1.54 1.28 1.34 1.67 2.2 1.2

22.49 14.92 12.56 8.31 7.54 6.51 5.41 3.73

Groups 1997 and 2006 Anaphalis javanica 0 Polytrias amaura 0 Eupatorium riparium 0.1 Athyrium macrocarpum 2.69 Paspalum conjugatum 2.75 Imperata cylindrica 0 Polyosma ilicifolia 0 Pinus merkusii 1.67 Average dissimilarity = 94.05%

4.19 3.52 2.77 1.1 0 2.04 1.89 0

13.91 11.06 8.29 7.98 7.8 6.5 6.13 5.64

1.63 1.61 0.95 1.28 1.36 0.84 1.12 2.2

14.79 11.77 8.81 8.48 8.29 6.91 6.52 6

Groups 1994 and 2006 Polytrias amaura 0 Athyrium macrocarpum 2.69 Paspalum conjugatum 2.75 Pinus merkusii 1.67 Anaphalis javanica 0 Imperata cylindrica 0 Polygala paniculata 0.65 Setaria sp. 0 Average dissimilarity = 94.00%

3.78 0.38 0.56 0 2.06 1.8 1.7 1.17

12.8 9.98 8.55 6.67 6.47 5.92 5.57 4.61

2.12 1.15 1.28 1.81 0.94 1.2 0.77 1.12

13.61 10.62 9.1 7.09 6.89 6.29 5.92 4.9

Av.Diss

Diss/SD

Av.Abund

Table 4. Similarity percentages (SIMPER) of top eight differentiating species among deposit site similarity comparison.

Groups 2001 and 1998 Cyperus flavidus 0 Imperata cylindrica 0.1 Panicum reptans 0 Eupatorium riparium 0.34 Dodonaea viscosa 1.89 Polygonum chinense 1.57 Ageratum conyzoides 0 Anaphalis javanica 0.41 Average dissimilarity = 95.49%

6.92 5.31 3.98 2.18 0 0 1.18 1.32

26.04 16.87 14.48 6.9 6.3 5.47 4.16 4.01

1.82 1.09 1.57 1.56 1 1.57 1.32 1.28

27.27 17.66 15.16 7.23 6.6 5.73 4.36 4.2

Groups 2001 and 1997 Anaphalis javanica 0.41 0 Polytrias amaura Eupatorium riparium 0.34 Imperata cylindrica 0.1 Polyosma ilicifolia 0.1 Dodonaea viscosa 1.89 Cyperus rotundus 0 Polygonum chinense 1.57 Average dissimilarity = 93.84%

4.19 3.52 2.77 2.04 1.89 0 1.54 0

15.46 13.01 9.43 7.64 6.98 6.71 6.06 5.85

1.74 1.68 0.97 0.89 1.12 1 1.04 1.58

16.48 13.86 10.05 8.14 7.44 7.15 6.46 6.23

Groups 2001 and 1994 Polytrias amaura 0 Dodonaea viscosa 1.89 Anaphalis javanica 0.41 Polygonum chinense 1.57 Imperata cylindrica 0.1 Setaria sp. 0 Polygala paniculata 0 Borreria alata 0 Average dissimilarity = 95.03%

3.78 0 2.06 0 1.8 1.17 1.7 1.26

15.46 8.04 7.35 7.1 7.01 5.73 5.5 5.24

2.23 0.96 0.98 1.42 1.2 1.14 0.66 1.12

16.26 8.46 7.73 7.47 7.38 6.03 5.79 5.52

Groups 1998 and 1997 Cyperus flavidus 6.92 Imperata cylindrica 5.31 Panicum reptans 3.98 Anaphalis javanica 1.32 Polytrias amaura 0 Eupatorium riparium 2.18 Polyosma ilicifolia 0.32 Cyperus rotundus 0 Average dissimilarity = 83.08%

0 2.04 0 4.19 3.52 2.77 1.89 1.54

16.06 10.79 9.05 7.9 7.76 5.44 4.01 3.51

1.93 1.27 1.62 1.66 1.63 1.2 1.11 1.05

19.33 12.99 10.89 9.51 9.34 6.55 4.83 4.23

Groups 1998 and 1994 Cyperus flavidus 6.92 Imperata cylindrica 5.31 Panicum reptans 3.98 Polytrias amaura 0 Eupatorium riparium 2.18 Anaphalis javanica 1.32 Polygala paniculata 0 Average dissimilarity = 86.57%

0.2 1.8 0 3.78 1.28 2.06 1.7

17.14 11.54 9.9 8.58 4.77 4.32 3.4

1.7 1.24 1.52 2.27 1.57 1.06 0.64

19.8 13.33 11.44 9.91 5.51 4.99 3.93

Groups 1997 and 1994 Anaphalis javanica 4.19 Eupatorium riparium 2.77 Polytrias amaura 3.52 Imperata cylindrica 2.04 Polyosma ilicifolia 1.89 Cyperus rotundus 1.54 Polygala paniculata 0 Calliandra callothyrsus 1.23 Average dissimilarity = 71.08%

2.06 1.28 3.78 1.8 0.24 0.3 1.7 0.24

9.11 6.68 6.2 5.52 4.45 3.82 3.54 3.12

1.51 1.01 1.45 1.16 1.06 1.05 0.65 0.87

12.81 9.4 8.72 7.77 6.27 5.38 4.98 4.39

SUTOMO et al. – Plant community on the volcanic deposit of Mount Merapi

CONCLUSION The observation of plant establishment pattern in primary succession on Mount Merapi revealed that there was a rapid colonization by vascular plants on the nuées ardentes deposits with fifty six species belonging to 26 families recorded. Species diversity was also increased significantly with time since nuées ardentes. Species abundance and composition in Mount Merapi nuées ardentes deposits were significantly different between the younger and the older sites. Younger deposits in Mount Merapi were dominated by species such as Athyrium macrocarpum, Polygonum chinense, Paspalum conjugatum and Cyperus flavidus whereas the older deposits were dominated by species such as Anaphalis javanica, Imperata cylindrica, Polytrias amaura and Eupatorium riparium. ACKNOWLEDGEMENTS This research was part of a master’s project funded by the AusAid. We would like to thanks to Soewarno HB from the Faculty of Forestry, Gadjah Mada University Yogyakarta, Professor Franck Lavigne, from the Universite´ Blaise Pascal, France, Tri Prasetyo, the head of the Mount Merapi National Park (TNGM) for permission to enter the national park and conduct the field data collections, and to Mbah Maridjan, the caretaker and gatekeeper of the Merapi Mountain, and lots of other kind helps that could not be mention here. REFERENCES Aplet GH, Hughes RF, Vitousek PM (1998) Ecosystem development on Hawaiian lava flows: biomass and species composition. J Veg Sci 9: 17-26. Backer CA, Bakhuizen van den Brink RC (1963) Flora of Java. Vol. 1. The Rijksherbarium, Leiden. Bellingham PJ, Walker LR, Wardle DA (2001) Differential facilitation by a nitrogen-fixing shrub during primary succession influences relative performance of canopy tree species. J Ecol 89: 861-75. Clarke KR (1993) Non-parametric multivariate analyses of changes in community structure. Aust J Ecol 18: 117-143. Clarke KR, Gorley RN (2005) PRIMER: Plymouth Routines In Multivariate Ecological Research. PRIMER-E Ltd., Plymouth. Connell JH, Slatyer RO (1977) Mechanisms of succession in natural communities and their role in community stability and organization. Amer Nat 111: 1119-1144. Crain CM, Albertson LK, Bertness MD (2008) Secondary succession dynamics in estuarine marshes across landscape-scale salinity gradients. Ecology 89: 2889-2899. Dale VH, Swanson FJ, Crisafulli CM (2005a) Disturbance, survival, and succession: understanding ecological responses to the 1980 eruption of Mount St. Helens. In: Dale VH, Swanson FJ, Crisafulli CM (eds) Ecological responses to the 1980 eruption of Mount St. Helens. Springer. New York. Dale VH, Acevedo JD, MacMahon J (2005b) Effects of modern volcanic eruptions on vegetation. In: Marti J, Ernst G (eds) Volcanoes and the environment. Cambridge University Press. New York. Dale VH, Campbell DR, Adams WM, Crisafulli CM, Dains VI, Frenzen PM, Holland RF (2005c) Plant succession on the Mount St. Helens Debris-Avalanche deposit. In: Dale VH, Swanson FJ, Crisafulli CM (eds) Ecological responses to the 1980 eruption of Mount St. Helens. Springer. New York. de Jong Boers B (1995) Mount Tambora in 1815: A volcanic eruption in Indonesia and its aftermath. Indonesia 60: 36-60.

del Moral R (2007) Limits to convergence of vegetation during early primary succession. J Veg Sci 18: 479-88. del Moral R, Wood DM (1993) Early primary succession on the volcano Mount St. Helens. J Veg Sci 4: 223-234. Eggler WA (1959) Manner of invasion of volcanic deposits by plants, with further evidence from Parricutin and Jorullo. Ecol Monographs 29: 267-284. Endo M, Yamamura Y, Tanaka A, Nakano T, Yasuda T (2008) Nurseplant effects of a dwarf shrub on the establishment of tree seedlings in a volcanic desert on Mt, Fuji, central Japan. Arctic Antarctic Alp Res 40: 335-342. Foster BL, Tilman D (2000) Dynamic and static views of succession: Testing the descriptive power of the chronosequence approach. Plant Ecol 146: 1-10. Franklin JF, MacMahon JA, Swanson FJ, Sedell JR (1985) Ecosystem responses to catastrophic disturbances: Lesson from Mount St. Helens. Nat Geog Res 1: 198-216. Herben T (1996) Permanent plots as tools for plant community ecology. J Veg Sci 7: 195-202. Heyne K (1987) Useful plants of Indonesia. Yayasan Sarana Wana Jaya. Jakarta. [Indonesia] Hobbs RJ, Huenneke LF (1992) Disturbance, diversity and invasion: Implication for conservation. Conserv Biol 6: 324-336. Hobbs RJ, Yates S, Mooney HA (2007) Long-term data reveal complex dynamics in grassland in relation to climate and disturbance. Ecol Monographs 75: 545-568. Hodkinson ID, Webb NR, Coulson SJ (2002) Primary community assembly on land - the missing stages: why are the heterotrophic organisms always there first? J Ecol 90: 569-577. Isango JA (2007) Stand structure and tree species composition of Tanzania Miombo Woodlands: A case study from Miombo Woodlands of Community Based Forest Management in Iringa District. In: Management of indigenous tree species for ecosystem restoration and wood production in semi-arid Miombo Woodlands in Eastern Africa. MITMIOMBO. Tanzania. Johnson EA, Miyanishi K (2008) Testing the assumptions of chronosequence in succession. Ecol Lett 11: 419-431. Kent M, Coker P (1992) Vegetation description and analysis, a practical approach. John Wiley and Sons. New York. Le Brocque AF (1995) Vegetation and environmental patterns on soils derived from Hawkesbury Sandstone Narrabeen substrata in Ku-ringgai Chase National Park, New South Wales. Aust J Ecol 20: 229-238. Ludwig JA, Reynolds JH (1988) Statistical ecology: A primer on methods and computing. John Wiley and Sons. Singapore. Magurran AE (1988) Ecological diversity and its measurement. Princeton University Press. Princeton, NJ. Montagnini F, Jordan CF (2005) Tropical forest ecology: The basis for conservation and management. Springer. Berlin. Myster RW, Malahy MP (2008) Is there a middle way between permanent plots and chronosequences? Canadian J For Res 38: 3133-3138. Simbolon H, Siregar M, Wakiyama S, Sukigara N, Abe Y, Shimizu H (2003) Impacts of dry season and forest fire 1997-1998 episodes on mixed Dipterocarp Forest at Bukit Bangkirai, East Kalimantan. Berita Biologi 6: 737-747. Taylor BW (1957) Plant succession on recent volcanoes in Papua. J Ecol 45: 233-243. Thornton I (2007) Island colonization the origin and development of island communities. Ecological Reviews. Cambridge University Press. Cambridge. Tsuyuzaki S (1991) Species turnover and diversity during early stages of vegetation recovery on the volcano Usu, northern Japan. J Veg Sci 2: 301-306. Valessini F (2009) NBIO528 multivariate techniques and community ecology: Course handout. Centre for Fish and Fisheries Research Murdoch University. Perth. van Steenis CGGJ (1972) The mountain flora of Java. E.J Brill. Leiden. Walker LR, Clarkson BD, Silvester WB, Clarkson BR (2003) Colonization dynamics and facilitative impacts of a nitrogen-fixing shrub in primary succession. J Veg Sci 14: 277-290. Walker RL, del Moral R (2003) Primary succession and ecosystem rehabilitation. Cambridge University Press. Cambridge. Walker TW, Syers JK (1976) The fate of phosphorus during pedogenesis. Geoderma 15: 1-19. Whitten T, Soeriaatmadja RE, Afiff SA (1996) The ecology of Indonesia series volume II: The ecology of Java and Bali. Periplus. Hongkong.

BIODIVERSITAS Volume 12, Number 2, April 2011 Pages: 92-98

ISSN: 1412-033X (printed edition) ISSN: 2085-4722 (electronic) DOI: 10.13057/biodiv/d120206

Coral diversity indices along the Gulf of Aqaba and Ras Mohammed, Red Sea, Egypt MOHAMMED SHOKRY AHMED AMMAR♥

National Institute of Oceanography and Fisheries (NIOF), P.O. Box 182, Suez, Egypt. Tel. +20 11 1072982, Fax. +20 623360016, ♥ email: shokry_1@yahoo.com Manuscript received: 18 October 2010. Revision accepted: 18 January 2011.

ABSTRACT Ammar MSA (2011) Coral diversity indices along the Gulf of Aqaba and Ras Mohammed, Red Sea, Egypt. Biodiversitas 12: 92-98. Eight sites extending from Ras Mohammed to the northern tip of the Gulf of Aqaba were surveyed for seven different indices of diversity. These sites are: Ras Ghozlani, Marsa Breika, Temple, Katy, Islands, Canyon, South Nuweiba and Marsa Muqabela. The study proved that the healthy condition can be expressed either by a high value of Shannon index or low value of these other indices. Canyon, having effective management, is considered as the healthiest site (based on Shannon species diversity H`) while South Nuweiba is the least healthiest of all sites because of the illegal destructive fishery overexploitation. Sites having old damage with improved values of richness indices and low values of dominance indices (healthy conditions) like Ras Ghozlani and Marsa Breika had enough time and effective management to improve their diversity, while sites with non improved diversity like Temple and Katy are characterized by sponge and ascidian domination representing potent competitors with corals beside the increased nutrients in those sites. Islands and Marsa Muqabela have low values of richness indices because Marsa Muqabela has the highest value of boring worms and considerable sediments. Key words: Coral reefs, diversity, Gulf of Aqaba, Red Sea, Egypt.

INTRODUCTION Although many indices estimate diversity, species richness recently has been used as a surrogate for diversity in many studies in ecology, biogeography, and conservation. Underlying assumptions of this approach are that all diversity indices, including those that weight species importance by their relative abundance (e.g., evenness), are correlated positively, and that richness accounts for a large proportion of the variance in diversity (Wilsey et al. 2005; Mellin et al. 2006; Franceska and Perrin 2008). As a Union, IUCN seeks to influence, encourage and assist societies throughout the world to conserve the integrity and diversity of nature and to ensure that any use of natural resources is equitable and ecologically sustainable. However, the IUCN Global Marine Programme works on issues such as integrated coastal and marine management, fisheries, marine protected areas, large marine ecosystems, coral reefs, marine invasives and protection of high and deep seas. Ecological and socioeconomic monitoring of coral reefs and their associated communities is a crucial management tool. Ecological monitoring focuses on the physical and biological parameters of coral reefs, while socio-economic monitoring aims to understand how people use and interact with coral reefs (Wilkinson et al. 2003; Scopélitis et al. 2010). Coral reefs occupy only 0.1% of the ocean’s surface, yet they are the world’s richest repository of marine

biodiversity, however coral reefs have survived over the course of more than 400 million years of evolution, and possess richness, diversity of life and structure that are integral foundations for humanity. Coral reef communities are in a state of change throughout their geographical range, factors contributing to this change include bleaching (the loss of algal symbionts), physical damage, and disease and increasing abundance of macroalgae (Ostrander et al. 2000; Raymundo et al. 2007; Andrew et al. 2008). Overfishing and nutrient loading have altered interactions among macroalgae and their herbivores, leading to significant increases in macroalgal cover (Hatcher 1990; Jackson 1997; Done 1999; Barile and Lapointe 2005; Yñiguez et al. 2008; Bahartan et al. 2010; Lapointe and Bedford 2010). The increased abundance of macroalgae negatively affects coral growth and recruitment, and this has long-term consequences on the physical structure of the reef (Miller 1998; Littler et al. 2006; Costa et al. 2008). Long-term studies have documented transitions in reef community structure (McClanahan et al. 1999; Lambo and Ormond 2006; Tam and Ang 2009) to a state where macroalgae are dominant, but the data are largely comparative over time scales measured in years and do not indicate the actual time scale of the transition. We have shown that transitions in reef community structure can be rapid and such changes may have long term consequences. Coral reefs are among the most diverse ecosystems on earth; however, coral reefs in different parts of the world

AMMAR – Coral diversity along the Gulf of Aqaba, Egypt

support different levels of biodiversity coral reef ecosystems are the pinnacle of biodiversity in the natural world, approximately 25% of all marine species inhabit coral reefs, where the number of individual species may be as high as one million (Davidson 1998; Meixia et al. 2008). The same author pointed out that although coral reef ecosystems cover only 1% of the total earth surface, the areas of the world in which they are found are also the areas of the world where the greatest growth in human population is occurring. These ecosystem services include biodiversity, maintenance, production of food such as sea food and fish, coastal protection, aesthetic and cultural benefits, recreation and tourism (Daily 1997; Moberg and Folke 1999; Mumby et al. 2008). Shehata (1998) pointed out that although the Gulf of Aqaba is relatively small body of water, it hosts an extraordinary diversity of corals and related marine life, the same author indicated that approximately 210 scleractinian hard coral species and 120 species of soft coral have been recorded in the Gulf. The purpose of the present study was to quantify the different diversity indices along a broad area extending

from Ras Mohammed (Northern Red Sea) to the northern tip of the Gulf of Aqaba, Egypt. MATERIALS AND METHODS Eight sites extending from Ras Mohammed to the northern tip of the Gulf of Aqaba were surveyed. These sites are indicated in Table 1 and Figure 1. Figure 2-5 indicate recent site research condition. Table 1. Latitudes and longitudes of the study sites Sites 1. Ras Ghozlani 2. Marsa Breika 3. Temple 4. Katy 5. Islands 6. Canyon 7. South Nuweiba 8. Marsa Muqabela

Latitudes

Longitudes

27° 47.527` N 27° 50.827` N 27° 50.827` N 27° 50.930` N 28° 28.634` N 28° 33.297` N 28° 56.481` N 29° 21.995` N

34° 15.752` E 34° 18.533` E 34° 18.533` E 34° 18.001` E 34° 30.682` E 34° 31.229` E 34° 38.395` E 34° 47.071` E

PALESTINE

6 5

4 2

3 1

Figure 1. Map of the studied sites. 1. Ras Ghozlani, 2. Marsa Breika, 3. Temple, 4. Katy, 5. Islands, 6. Canyon, 7. South Nuweiba, 8. Marsa Muqabela.

B I O D I V E R S I T A S 12 (2): 92-98, April 2011

1 2

Figure 2. Effective management in Canyon including guidance signs, patrolling, and fixing a pass to deep water to avoid damage of shallow water reefs. Note: 1. A fixed pass for passage to deep water, 2. A guidance sign, 3. Patrolling car of EEAA (Egyptian Environmental Affairs Agency)

Figure 3. Interlacing fishing nets due to illegal fishing activities causing reef damage in South Nuweiba

Figure 6. Bray-Curtis cluster analysis (single link) of different diversity indices

Figure 4. Improved diversity in Ras Ghoslani

The list of study sites are graphically represented in Figure 1. SCUBA diving and the camera frame (as a quadrat) were used for surveying the benthic coral reef communities. Ten frames, one meter intervals and one meter from the object were surveyed along a transect fixed horizontally along the reef contour at the depths 1m, 5m, 10 m, 15 m, 20 m, 30 m, 40 and 50 m (when found) or till the end limit of coral growth at each of the studied sites. A FinePix F50, 12 Mega Pixels Digital Camera, was used for taking a series of underwater photos to help identification of species and other taxa habitats. The computer software

Figure 5. Non improved diversity in Katy. A moray is shown living in caves

Photogrid 1.0 beta Acad was used for ecological analysis of digital photographs of corals and other taxa or habitats Different indices of coral diversity were calculated using the computer software Biodiversity Professional Version 2 (McAleece et al. 1997). Diversity was measured by seven different indices (Shannon diversity index (H`), Shannon evenness index (J`), Berger-Parker dominance (d), Simpson diversity D, Margalef M Base, Mackintosh diversity (D) and Mackintosh evenness (E).

AMMAR â&#x20AC;&#x201C; Coral diversity along the Gulf of Aqaba, Egypt

RESULTS AND DISCUSSION

old breakage but the richness values of diversity seem to have not been improved. However, Islands and Marsa Muqabela have slightly lower values of richness indices. Percent cover of live corals and other habitats in the study sites is shown in Table 4 while the coral species list is shown in Table 5. Canyon has the highest percent cover of live corals (42.38%) while South Nuweiba has the lowest one. Katy has the highest values of both sponges and ascidians while South Nuweiba has the highest values of broken corals, dead corals, sediments, echinoderms and anemones. Marsa Ghozlani has the highest value of bare rocks and rubbles while Marsa Breika has the highest value of sands.

Results Averages of different indices of diversity are shown in Table 2. Shannon diversity index H` are all beyond 0.70 ranging from 0.74 at South Nuweiba to 0.95 at Canyon; however, Shannon evenness index J` is in the range between 0.70 at Marsa Muqabela and 0.80 at Canyon. Berger-Parker dominance d represents higher variations between sites ranging from 0.25 at Canyon to 0.42 at South Nuweiba. Simpson diversity D has lower values ranging from 0.13 at Ras Ghozlani and Canyon to 0.25 at Temple and South Nuweiba. Margalef diversity M has higher values of diversity but in contrast to other indices, it is lowest in South Nuweiba and highest in Ras Ghozlani Table 2. Average of different indices of diversity in the studied sites and Marsa Breika respectively. Although Mackintosh diversity D Sites Index and Mackintosh evenness index E 1 2 3 4 5 6 7 8 has values lower than those of Shannon H' Log Base 10. 0.94 0.91 0.75 0.75 0.86 0.95 0.74 0.82 Margalef, they have a similar Shannon J' 0.78 0.73 0.70 0.79 0.76 0.80 0.77 0.70 variation between sites having lowest Berger-Parker Dominance (d) 0.30 0.35 0.40 0.41 0.35 0.25 0.42 0.32 values in Marsa Breika and highest Simpsons Diversity (D) 0.13 0.19 0.25 0.23 0.21 0.13 0.25 0.19 value in South Nuweiba. Margalef M Base 10. 38.45 38.86 30.33 26.30 28.38 33.16 23.75 28.23 Similarity matrix of different Mackintosh Diversity (D) 1.23 1.17 1.21 1.19 1.20 1.17 1.28 1.18 diversity indices is shown in Table 3 Mackintosh Eveness (E) 1.13 1.12 1.14 1.15 1.14 1.14 1.16 1.15 and the Bray-Curtis cluster analysis Note: 1. Ras Ghozlani, 2. Marsa Breika, 3. Temple, 4. Katy, 5. Islands, 6. Canyon, 7. of different indices of diversity is South Nuweiba, 8. Marsa Muqabela shown in Figure 6. Mackintosh D and Mackintosh E are grouped together having the highest % similarity Table 3. Similarity matrix of different indices of diversity (97.33%), followed by Shannon H` and Shannon J` which are grouped Shannon Shannon Berger-Parker Simpson Margalef Mackintosh Mackintosh together (93.49%). However, H` J` d D M D E Simpson D and Berger-Parker are Shannon H` 93.4902 58.8235 38.0723 5.2876 82.2018 84.795 grouped together having a % Shannon J` 63.4202 41.5243 4.7576 77.0115 79.5515 similarity of 72.15%, finally Berg-Parker d 72.1461 2.2377 45.0523 46.9405 Margalef index is separated in one Simpson D 1.2689 28.1891 29.5051 group having the lowest % similarity Margalef 7.4915 7.1164 with other groups. Mackintosh D 97.3348 Values of indices for richness in Mackintosh E general are lowest where indices for dominance are highest, however, all indices of richness are lowest in Table 4. Percentage cover of live corals and other habitats in the studied sites. South Nuweiba while indices of dominance are highest in the same Live corals and their habitats Sites site. Richness indices are highest in A B C D E F G H I J K L M N Canyon for H` and J` and highest in 1 26.97 3.17 58.82 2.28 4.91 0.00 0.52 0.56 0.35 2.42 0.00 0.00 0.00 0.00 Marsa Breika for Margalef M. 2 39.78 9.13 35.75 0.00 14.11 0.00 0.04 0.00 0.29 0.00 0.04 0.39 0.00 0.00 Dominance indices are all lowest in 3 36.04 1.35 55.56 0.00 2.85 0.00 0.00 0.00 0.95 1.50 0.00 3.25 0.00 0.00 Canyon except Mackintosh eveness 4 28.29 3.79 44.31 0.00 11.71 0.00 0.00 2.14 3.81 0.00 0.00 5.36 0.00 0.00 (E) which which is lowest in Marsa 5 40.06 0.00 23.42 1.78 8.07 1.51 0.03 0.94 0.16 0.00 0.00 17.11 0.00 0.00 Breika. 6 42.38 6.00 36.78 0.73 12.73 0.00 0.00 0.13 0.00 0.00 0.00 0.00 0.50 0.00 Results of the present study 7 18.77 17.29 20.50 0.29 26.29 1.54 0.00 0.00 0.00 0.00 0.00 0.00 1.53 6.71 indicate that, sites having old damage 8 42.06 7.28 23.44 0.09 21.56 0.19 0.00 0.00 0.00 0.00 0.16 3.91 0.13 0.03 like Ras Ghozlani and Marsa Breika Note: 1. Ras Ghozlani, 2. Marsa Breika, 3. Temple, 4. Katy, 5. Islands, 6. Canyon, 7. seem to have improved values of South Nuweiba, 8. Marsa Muqabela. A. Live Corals, B. Dead Corals, C. Bare Rocks, D. richness indices and low values of Rubbles, E. Sands, F. Echinoderms, G. Molluscs, H. Ascidians, I. Sponges, J. Crevices, dominance indices, contrary the two K. Boring Worms, L. Algae, M. Anemones, N. Broken Corals. sites Temple and Katy suffered also

B I O D I V E R S I T A S 12 (2): 92-98, April 2011

96 Table 5. Species list in the study sites. Species and habitats Hexacorallia Stony corals Acanthastrea echinata Acanthastrea faviaformis Acanthastrea maxima Acropora aculeus Acropora digitifera Acropora eurystoma Acropora formosa Acropora formosa Acropora forskali Acropora gemmifera Acropora granulosa Acropora hemperichi Acropora humilis Acropora hyacinthus Acropora maryae Acropora nasuta Acropora pharaonis Acropora robusta Acropora sp. (new) Acropora squarrosa Acropora tenuis Acropora valida Acropora valida Alveopora daedalea Alveopora lizardi Alveopora tizardi Asteriopora myriophthalma Asteriopora myriophthalma Coscinaraea monile Ctenactis echinata Cyphastrea microphthalma Cyphastrea serailea Echinopora forskaliana Echinopora fruticulosus Echinopora gemmacea Echinopora lamellosa Echinopora trianensis Favia amicorum Favia favus Favia lacuna Favia lacuna Favia laxa Favia laxa Favia mtthai Favia pallida Favia rotundata Favia sp. (new) Favia veroni Favites abdita

Site 12345678

* * * * ** * * * ** * ** ** **

** ** *

*** * ** * * *** * *

* ** * * * **

* *

** *

* * * * * * * *

* *

* **

* ** **** * * ** * ** * * * * **

* ** *

* * * *

***

* *

* * **

Species and habitats Favites chinensis Favites complanata Favites flexusa Favites halicora Favites pentagona Favites vasta Galaxea fascicularis Gardineroseris planulata Goniastrea cf. aspera Goniastrea pectinata Goniastrea persi Goniastrea retiformis Goniopora ciliatus Goniopora stokesi Gyrosmilia interrupta Hydnophora exesa Hydnophora microconus Leptastrea purpurea Leptoseris explanata Leptoseris incrustans Leptoseris mycetoseroides Lobophyllia cf pachysepta Merulina ampliata Montipora aequituberculata Montipora cocosensis Montipora informis Montipora informis Montipora meandrina Montipora stilosa Montipora tuberculosa Montipora verrucosa Mycedium elephantotus Mycedium umbra Oxypora lacera Pachyseris rugosa Pachyseris speciosa Pavona cactus Pavona clavus Pavona decussata Pavona varians Platygyra acuta Platygyra carnosus Platygyra crosslandi Platygyra daedalea Platygyra lamellina Plesiastrea versipora Pocillopora damicornis Pocillopora verrucosa Porites columnaris Porites lichen Porites lobata

Site 12345678 * *

* *

** ******* * * * * * *** * * * *** * * ******* * * ** ** * * ** ** * ** * * * * *** * ** * * * * ** * *

* * *

Porites lutea * Porites mayeri Porites nodifera * Porites rus Porites solida * Porites sp. Psammocora hemispherica Psammocora profundacella Psammocora profundacella Seriatopora caliendrum * Seriatopora hystrix Siderastrea savignyana Stylocoeniella guentheri Stylophora mamillata * Stylophora pistillata Stylophora wellsi Symphillia sp. * Trachyphyllia geoffroyi Tubastrea aurea Tubastrea coccinea Tubestrea micranthus * Turbinaria informis Turbinaria mesentrina Black corals Antipathes sp. (black coral) Protoptilum sp. Hydrocorals Millepora dichotoma Millepora platyphylla Millepora alcicorrnis

Site 12345678 ** ** * ** * ****** * * * ** *** ** * ** * * * ** ****** * * * * * * * *

* ** ** *

** **

* * **

* ** **** *

* *

* * * * **** * ** *

* *

* * **

Species and habitats

* **

* * * * * * * *

* ** * ** *** * * * * ** * *

Octocorallia Soft corals Anthelia glauca Briareum hamra Cladiella sp. Heteroxenia fuscescens Heteroxenia ghardaqensis Lithophyton arboreum Lithophytun sp. Lobophytum sp. Rhytisma sp. Sarcophyton sp. Sinularia sp. Sympodium caeruleum Xenia macrospeculata Xenia sp. Xenia umbellata Gorgonians Paraplexaura sp. Anella sp.

**** * ** * **** *** * * * * **** ** * *** **** * **

** ** *

*** * * * ** * * * *

* *

Note: 1. Ras Ghozlani, 2. Marsa Breika, 3. Temple, 4. Katy, 5. Islands, 6. Canyon, 7. South Nuweiba, 8. Marsa Muqabela. * . Rcorded in that site

Discussion Seven different indices of diversity were used to compare their values with each other and with the healthy status of sites. However, Stirling and Wilsey (2001), Reitalu et al. (2009) and Johnston and Roberts (2009) indicated that Shannon index is better for analysis as it

reflects effects of evenness and richness components along with their intercorrelations. In the present study, there are some differences in diversity between sites, these differences can be explained by the different stresses the sites are exposed to (Boumeester 2005). Canyon is considered as the healthiest site (based on Shannon species

AMMAR â&#x20AC;&#x201C; Coral diversity along the Gulf of Aqaba, Egypt

diversity H`) while South Nuweiba is the least healthiest of all. Surprisingly, sites like Canyon, Ras Ghozlani and Marsa Breika, having considerably high values of Shannon index H`, have also high number of divers (beyond the diver carrying capacity, DCC). A possible explanation of that result is that divers in these sites became more ecoconcious and the damage caused in these sites during low protection in the past creates enough substrates (of dead corals and rocks) beside recruiting fragments that initiates the increase in diversity. Fragmentation could be the most important form of regeneration for many major reefbuilding corals (Highsmith 1982; Garrison and Waed 2008) and may help to mitigate some of the diver damage effects (Hawkins and Roberts 1992; Work et al. 2008). It is not surprising that sites like Canyon, with highest Shannon index H`, has the lowest value of other diversity indices like Berger-Parker dominance d, Simpson diversity D and Mackintosh diversity D because Shannon index depends on the informationa theory (complicated computation) while Simpson, MacIntosh and Berger-Parker depends on the species dominance measures (simple computation). The lowest values of richness indices and highest values of dominance indices in South Nuweiba is associated with the recent physical damage arising mainly from illegal destructive fishery overexploitation which destroys the reef assemblage in that site. Physical forces and bioerosion degrade the reef's structural framework (Sammarco 1996; Glynn 1997; Ammar and Mahmoud 2006; Ammar et al. 2006; Ammar 2009), leading in turn to a decline in coral diversity. The highest values of richness indices and lowest values of dominance indices (a healthy condition) in Canyon is associated with the low amount of sediments beside the effective management (Acevedo et al. 1989; Ammar and Emara 2004). The improved values of richness indices and low values of dominance indices (healthy conditions) in the sites having old damage like Ras Ghozlani and Marsa Breika mean that they had enough time and effective management to improve their diversity, also this is associated with low values or absence of sponges, ascidians, anemones, broken corals, echinoderms and algae (De Voogd et al. 2004; Pawlik et al. 2007). Although the two sites Temple and Katy suffered also old breakage, diversity was not improved because of the sponge and ascidian domination that represent potent competitors with corals beside the high amount of nutrients (nitrates) in those sites. Sponges and ascidians dominate in areas of high particulate organic nitrogen (Ribes et al. 2005; Yahel et al. 2005; Ribes et al. 2005; Shenkar et al. 2008) and have negative effects on developing coral embryos and larvae (Sammarco, 1996). Lack of significant predators makes ascidians very successful competitors (Lambert 2002). Islands and Marsa Muqabela have low values of richness indices because Marsa Muqabela has the highest value of boring worms and considerable sediments while Islands has the highest amount of algae, considerable echinderms (mainly the urchin, Diadema) and considerable ascidians. Sedimentation may lead to reef degradation by causing coral mortality through sediment smothering and burial, and then by suppressing the re-growth of surviving

adult colonies through increased competition with algae (Nugues and Roberts 2002). Bioerosion can be extensive, being caused by grazing fish, sea urchins, boring bivalves, etc., resulting in a net loss of calcium carbonate from the reef (Sammarco 1996; Baker et al. 2008). Reefs with high inputs of sediments are often dominated by algal turfs which are known to inhibit coral settlement (Aerts and van Soest 1997; Birrell et al. 2005; Ammar 2007). CONCLUSION The study proved that; sites like Canyon, with highest Shannon index H`, has the lowest value of other diversity indices because Shannon index depends on the information theory (complicated computation) while Simpson, MacIntosh and Berger-Parker indices depend on the species dominance measures (simple computation). Thus, the healthy condition can be expressed either by a high value of Shannon index or low value of these other indices. Canyon has the highest values of richness indices and lowest values of dominance indices (a healthy condition) due to the low amount of sediments beside the effective management while South Nuweiba has the lowest values of richness indices and highest values of dominance indices because of the illegal destructive fishery overexploitation. Sites having old damage with improved values of richness indices and low values of dominance indices (healthy conditions) like Ras Ghozlani and Marsa Breika had enough time and effective management to improve their diversity, while sites with non improved diversity like Temple and Katy is characterized by sponge and ascidian domination representing potent competitors with corals beside the increased nutrients in those sites. Islands and Marsa Muqabela have low values of richness indices because Marsa Muqabela has the highest value of boring worms and considerable sediments while Islands has the highest amount of algae, considerable echinderms (mainly the urchin Diadema) and considerable ascidians. REFERENCES Acevedo R, Morelock J, Palaios R (1989) Modification of coral reef zonation by terrigenous sediment stress. PALAIOS 4: 92-100. Aerts LAM, van Soest RWM (1997) Quantification of sponge/coral interactions in a physically stressed reef community, NE Colombia. Mar Ecol Prog Ser 148: 125-134. Ammar MSA (2007). Recovery patterns of corals at Shabror Umm Gam'ar, Hurghada, Red Sea, Egypt, after the 1998 outbreak of Acanthaster planci. Zoolog Mid East 40: 97-104. Ammar MSA (2009) Coral reef restoration and artificial reef management, future and economics. Open Environ Engineer J 2: 37-49. Ammar MSA and Emmara AM (2004) Population studies on corals and other macrobenthic invertebrates in two flooded sites and a sheltered site around Ras Baghdadi, Red, Egypt. J Egyptian German Soc Zoolog 45(D): 217-232. Ammar MSA and Mahmoud MA (2006) Effect of physico-chemical factors and human impacts on coral distribution at Tobia Kebir and Sharm El-Loly, Red Sea, Egypt. Egypt J Aquat Res 32 (1): 184-197. Ammar MSA, Boumeester J, Riegl B, Hausser J, keck A (2006) Possible causes, consequences of changes and future of coral reefs in Dahab, Gulf of Aqaba, Red Sea, Egypt. Egypt J Aquat Res 32 (Special Issue): 160-179.

B I O D I V E R S I T A S 12 (2): 92-98, April 2011

Andrew CB, Peter WG, Riegl B (2008) bleaching: An ecological assessment of long-term impacts, recovery trends and future outlook. Estuar Coast Shelf Sci 80 (4): 435-471. Australian Museum (2003) www.amonline.net.au/factsheets/coral_reef_ conserving.htm. Bahartan K, Zibdah M, Ahmed Y, Israel A, Brickner I, Abelson A (2010) Macroalgae in the coral reefs of Eilat (Gulf of Aqaba, Red Sea) as a possible indicator of reef degradation. Mar Poll Bull 60 (5):759-764. Bak RPM, Sybesma J, van Duyl FC (1981) The ecology of the tropical compound ascidian Trididemnum solidum. II. Abundance, growth and survival. Mar Ecol Prog Ser 6: 43-52. Baker AC, Glynn PW, Riegl B (2008) Climate change and coral reef bleaching: An ecological assessment of long-term impacts, recovery trends and future outlook. Estuar Coast Shelf Sci 80 (4): 435. Barile PJ, Lapointe BE (2005) Atmospheric nitrogen deposition from a remote source enriches macroalgae in coral reef ecosystems near Green Turtle Cay, Abacos, Bahamas. Mar Poll Bull 50 (11): 12621272. Birrell CL, McCook LJ, Willis BL (2005) Effects of algal turfs and sediment on coral settlement. Mar Poll Bull 51 (1-4): 408. Boumeester J. (2005) What determine the quality and attractiveness of coral reefs? A study on the reefs of Dahab, South Sinai, Egypt. [Thesis]. Faculty of Biology and Medicine, University of Lausanne. Switzerland. Costa OS, Nimmo M, Attrill MJ (2008) Coastal nutrification in Brazil: A review of the role of nutrient excess on coral reef demise. J South Amer Earth Sci 25 (2): 257-270. Daily A. (1997) Nature's services: societal dependence on natural ecosystem. Island Press. Washington. Davidson OG (1998) The enchanted braid: Coming to terms with nature on the coral reef. John Wiley & Sons. New York. Done TJ (1999) Coral community adaptability to environmental change at the scale of regions, reefs and reef zones. Am Zool 39: 66-79. Franceska RB, Perrin C (2008) Estimating Mediterranean OligoceneMiocene sea-surface temperatures: An approach ased on coral taxonomic richness. Palaeogeograph, Palaeoclimatol, Palaeoecol 258 (1): 71-88. Garrison V, Waed G (2008) Storm-generated coral fragments-A viable source of transplants for reef rehabilitation. Biol Conserv 141 (12): 3089. Glynn PW (1997) Bioerosion and coral reef growth: a dynamic balance. In: Birkeland C (ed.) Life and Death of Coral Reefs. Chapman & Hall. New York. Hatcher BG (1990) Coral reef primary productivity: a hierarchy of pattern and process. Trends Ecol Evol 5: 149-155. Hawkins JP and Roberts CM (1992) Effect of recreational SCUBA diving on the fore-reef slope communities of coral reefs. Biol Conserv 62: 171-178. Highsmith RC (1982) Reproduction by fragmentation in corals. Mar Ecol Prog Ser 7: 207-226. Jackson JBC (1997) Reefs since Columbus. Coral Reefs Suppl 16: 23-32. Johnston EL, Roberts DA (2009) Contaminants reduce the richness and evenness of marine communities: A review and meta-analysis. Environ Poll 157 (6): 1745 Lambert G (2002) Nonindigenous ascidians in tropical waters. Pac Sci 56: 291-298. Lambo AL, Ormond RFG (2006) Continued post-bleaching decline and changed benthic community of a Kenyan coral reef. Mar Poll Bull 52 (12): 1617. Lapointe BL, Bedford BJ (2010) Ecology and nutrition of invasive Caulerpa brachypus f. parvifolia blooms on coral reefs off southeast Florida, U.S.A. Harmful Algae 9 (1): 1-12. Littler MM, Littler DS, Brooks BL, Lapointe BE (2006) Nutrient manipulation methods for coral reef studies: A critical review and experimental field data. J Exp Mar Biol Ecol 336 (2): 242-253. McAleece N, Lambshead PJD, Paterson GLJ, Gaje JD (1997) Biodiversity Profissional, Version2, Written by McAleece N, revised by Lambshead PJD, Paterson GLJ and Gaje JD. The Natural History Museum and The Scottish Association for Marine Science. Edinburg. McClanahan TR, Aronson RB, Precht WF, Muthiga NA (1999) Fleshy algae dominate the remote coral reefs of Belize. Coral Reefs 18: 61-62 . Meixia ZM, Kefu Y, Qiaomin Z, Qi S (2008) Spatial pattern of coral diversity in Luhuitou fringing reef, Sanya, China. Acta Ecologica Sinica 28 (4): 1419.

Mellin C, Ferraris J, Galzin R, Kulbicki M, Ponton D (2006) Diversity of coral reef fish assemblages: Modelling of the species richness spectra from multi-scale environmental variables in the Tuamotu Archipelago (French Polynesia) Ecol Modell 198 (3): 409-425. Miller MW (1998) Coral/seaweed competition and the control of reef community structure within and between latitudes. Oceanogr Mar Biol Annu Rev 36: 65-96. Moberg F, Folke C (1999) Ecological goods and services of coral reef ecosystems. Ecol Econ 29: 215-533. Mumby PJ, Broad K, Brumbaugh DR, Dahlgren CP, Harborne AR, Hastings A, Holmes KE, Sanchirico JN (2008) Coral reef habitats as surrogates of species, ecological functions, and ecosystem services. Conserv Biol 22 (4): 941-951. Nugues MM, Roberts CM (2003) Coral mortality and interaction with algae in relation to sedimentation. Coral Reefs 22 (4): 507-516. Ostrander GK, Armstrong KM, Knobbe ET, Gerace D, Scully EP (2000) Rapid transition in the structure of a coral reef community: The effects of coral bleaching and physical disturbance. Proc Natl Acad Sci USA 97 (10): 5297-5302. Pawlik JR, Steindler L, Henkel TP, Beer S, Ilan M (2007) Chemical warfare on coral reefs: Sponge metabolites differentially affect coral symbiosis in situ. Limnol Oceanogr 52 (2): 907-911. Raymundo LJ, Maypa AP, Gomez ED, Cadiz P (2007) Can dynamiteblasted reefs recover? A novel, low-tech approach to stimulating natural recovery in fish and coral populations. Mar Poll Bull 54 (7): 1009-1019. Reitalu T, Sykes MT, Johansson LJ, Lönn MHK, Vandewalle M, Prentice HC (2009) Small-scale plant species richness and evenness in seminatural grasslands respond differently to habitat fragmentation. Biol Conserv 142 (4): 899. Ribes M, Coma R, Atkinson MJ, Kinzie RA (2005) Sponges and ascidians control removal of particulate organic nitrogen from coral reef water. Limnol Oceanogr 50: 1480-1489. Sammarco PW (1996) Comments on coral reef regeneration: Bioerosion, biogeography, and chemical ecology: Future directions. J Exp Mar Biol Ecol 200: 135-168. Scopélitis J, Andréfouët S, Phinn S, Arroyo L, Dalleau M, Cros A, Pascale CP (2010) The next step in shallow coral reef monitoring: Combining remote sensing and in situ approaches. Mar Poll Bull 60 (11): 1956-1968. Shehata A. (1998) Protected areas on the Gulf of Aqaba, Egypt: A mechanism of integrated coastal management. In: Dight I, Kenchington R, Baldwin J (eds). Proceedings International Tropical Marine Ecosystems Management Symposium (ITMEMS), November 1998, Townsville Australia. Shenkar N, Bronstein O, Loya Y (2008) Population dynamics of a coral reef ascidian in a deteriorating environment. Mar Ecol Prog Ser 367: 163-171. Stirling G, Wilsey B (2001) Empirical relationships between species richness, evenness and proportional diversity. Am Natur 158: 286299. Tam T, Ang PO (2009) Catastrophic regime shifts in coral communities exposed to physical disturbances: Simulation results from objectoriented 3-dimensional coral reef model. J Theor Biol 259 (2): 193. Voogd NJ, Becking LE, Hoeksema BW, Noor A, van Soest RWM (2004) Sponge interactions with spatial competitors in the Spermonde Archipelago. Boll Mus Ist Biol Univ Genova 68: 253-261. Wilkinson C, Green A, Almany J, Dionne S (2003) Monitoring coral reef marine protected areas: version 1. A practical guide on how monitoring can support effective management of MPAs. AIMS and IUCN: Townsville (Australia) and Gland (Switzerland). Wilsey BJ, Chalcraft DR, Bowles CM, Willig MR (2005) Relationships among indices suggest that richness is an incomplete surrogate for grassland biodiversity. Ecology 86 (5): 1178-1184. Work TM, Aeby GS, Maragos JE (2008) Phase shift from a coral to a Corallimorph-Dominated reef associated with a shipwreck on Palmyra Atoll. PLoS ONE 3 (8) www.plosone.org/article/info:doi/10.1371/journal.pone.0002989 Yahel G, Marie D, Genin A (2005) A direct in situ method to measure filtration rates, nutrition, and metabolism of active suspension feeders. Limnol Oceanogr Methods 3: 46-58 Yñiguez AT, McManus JW, DeAngelis DL (2008) Allowing macroalgae growth forms to emerge: Use of an agent-based model to understand the growth and spread of macroalgae in Florida coral reefs with emphasis on Halimeda tuna. Ecol Modell 216 (1): 60-74.

BIODIVERSITAS Volume 12, Number 2, April 2011 Pages: 99-106

ISSN: 1412-033X (printed edition) ISSN: 2085-4722 (electronic) DOI: 10.13057/biodiv/d120207

Population analysis of the javan green peafowl (Pavo muticus muticus Linnaeus 1758) in Baluran and Alas Purwo National Parks, East Java JARWADI BUDI HERNOWO1,♥, HADI SUKADI ALIKODRA2, ANI MARDIASTUTI2, CECEP KUSMANA3 1

Forestry Science Program, School of Graduates, Bogor Agricultural University. Bogor 16680, West Java, Indonesia. Tel. +62-251-8621947 Fax. +62251-8621947, ♥email jblina11@yahoo.com 2 Department of Forest Resources Conservation and Ecotourism, Faculty of Forestry, Bogor Agricultural University, Bogor 16680 3 Department of Silviculture, Faculty of Forestry, Bogor Agricultural University, Bogor 16680 Manuscript received: 16 January 2011. Revision accepted: 11 March 2011.

ABSTRACT Hernowo JB, Alikodra HS, Mardiastuti A, Kusmana C (2011) Population analysis of the javan green peafowl (Pavo muticus muticus Linnaeus 1758) in Baluran and Alas Purwo National Parks, East Java. Biodiversitas 12: 99-106. The javan green peafowl (Pavo muticus muticus) have high pressure to the population and the habitat. The distribution of the bird at Java Island is clumped randomly at several types in condition of fragmented and isolated habitat and it has small individual number every unit population. Baluran and Alas Purwo National Parks are one of distribution javan green peafowl; it was chosen for study on the population analysis. The research was aimed to gain data and information on demographic population of javan green peafowl. The individual number of the bird was counted by call count transect method and councentration count. The population demographic parameter (individual number, age structure and sex ratio) of javan green peafowl was analyzed. The result shown that individual number of the javan green peafowl at Baluran National Park (BNP) was 69.1 birds (in 2006) and 70.5 birds (in 2007) not much differ, but it compared with the observation in1995 approximately was 117.7 birds had significant different. The green peafowl population at BNP declined around 47.50% during 12 years. Meanwhile the population at Alas Purwo National Park (APNP) was 80.7 birds (in 2006) and 73.5 birds (in 2007), if compared to observation in 1998 only 43 birds and in 2006 was 80.0 birds, the population grow up 86.05% during 8 years. The age structure of population indicated that both population (BNP and APNP) tend to unbalance pyramidal, where adult birds more abundance than sub adult or juvenile. The birds sex ratio at both (APNP and BNP) indicated that the peafowl life in polygyny system 1 male: 4 female > 1 male: 2.5 female. Key words: population, javan green peafowl, Baluran, Alas Purwo.

INTRODUCTION The population of javan green peafowl (Pavo muticus muticus) have small size (around 30-50 individuals) on every site of their local distribution. The distributions of the birds are clumped and the habitat condition was fragmented (patchly). Van Balen et al. (1995) reported that distribution of javan green peafowl randomly fragmented and isolated at several types of habitat. The population is small and fragmented also isolated; it is called metapopulation (Gilpin and Hanski 1991). Baluran National Park (BNP) and Alas Purwo National Park (APNP) are as one of distribution site of javan green peafowl at tip of the eastern of Java Island. BNP have typically savanna and monsoon forest habitat, but APNP have habitat type more diverse like; low land tropical rain forest, grazing area, and teak plantation with intercropping. Hernowo (1997) mentioned that the javan green peafowl population abundancies at BNP has related with habitat types. The javan green peafowl population was more abundance at savanna habitat. The problems in relation to the peafowl population are poaching (eggs, chicks, peacock, peahen and their feathers), disturbed habitat, and habitat conversion. Impact

from poaching activities influenced directly on decreased and local extinct of the population. Meanwhile knowledge in relation to the green peafowl population is limited, because most studies did not themed population dynamics. Still few studies on javan peafowl demographic population, because sufficient data. In many cases population data of green peafowl were not available. Population data is main parameter for conservation effort of this bird as basic information like population demographic data. The paper was aimed to analized demographic population of javan green peafowl such as: individual number, sex ratio and age structure. Beside that aspect, the bird abundances and the population growth in relation to the habitat types are important to know population health and strategy for conserving the birds. MATERIALS AND METHODS Study sites Baluran National Park (BNP) Baluran National Park (BNP) is located at tip of northeastern of Java Island (7º29`10”-7º55`55” S and 114º29`10”-114º39`10” E), cover an area of about 25,000

100

B I O D I V E R S I T A S 12 (2): 99-106, April 2011

ha. The national park is bordered by Madura Strait to the north and by the Bali Strait to east. At southern west of park was bordered with Bajulmati and Klokoran Rivers (BNP 2007). The geological situation of BNP is described as part of small volcano with Plio-Pleistocene deposits. Baluran Mountain is 1247 m high, and near the centre of the national park. Most of area in the national park is flat (010 m), except near Gunung Baluran, Gunung Priok, Gunung Montor and Gunung Glengseran are wavy and hilly. The two major soil types in BNP are of volcanic and marine origin. Most important are volcanic soils, rich in minerals but poor in organic materials. They have a high chemical but a low physical fertility because of them are very porous and do not keep water well. Black soil covers about half of the lowland including most of the monsoon forest and savanna grassland (BNP 2007). Baluran has a typical monsoon climate with a long dry season. This climate is heavily influenced by the southeast wind during the period of April to October, with less precipitation. The average dry period covers about 7-8 month of the year. The annual precipitation ranges from 900 to 1600 mm per year. Due to the dry period being quite longer, water is most limiting factor in BNP. The local distribution of wild animal is influenced by availability of water. During the dry season, animals can easily be

Figure 1. Map of Baluran National Park, East Java

observed near the water hole, but in rainy season they spread everywhere (Hernowo 1995). The vegetation types have developed in BNP, like savanna grassland, beach forest, mangrove, deciduous forest or monsoon forest, evergreen forest, swampy area and sub mountain forest. Mangroves occur at Bilik, Lempuyangan, Mesigit, Tanjung Sedano and Kelor. Typical vegetation at mangrove is Avicennia alba, Sonneratia caseolaris, Ceriops tagal, Rhizophora apiculata, Bruguiera gymnorrizha, and Luminitzera racemosa. Beach forest present between Pandean and Tanjung Candibang and some places such as Labuan Merak, also east of Gatal. These types of forest are dominated by Barringtonia racemosa, Terminalia cattapa, Pandanus tectorius and Hibiscus tilliaceus. The savanna grassland with fire-climax is strongly influenced by man. Tree species dominant in that area are Acacia nilotica (an introduced African exotic species) a few Acacia leucophloea, Schleichera oleosa, Zizyphus rotundifolia and Corypha utan. Dominant grass species are Dichantium coricosum, Brachiaria mutica and Sorgum nitidus. Monsoon forest is characterized by dominant tree species of Tamarindus indica, Schoutenia ovata, Grewia eriocarpa, Flacortia indica, Cordia abligua Azadirachta indica and Sterculia foetida. Mountain forest and evergreen forest are signed leave do not fall in the dry season. Typically trees growth in that forest is Mallotus

HERNOWO et al. – Pavo muticus muticus in Baluran and Alas Purwo National Parks

101

Figure 2. Map of Alas Purwo National Park, East Java

philippensis, Homalium foetidum, Emblica officinale and Aleurites moluccana (Partomihardja 1989). Wild animal which present at BNP have relation with green peafowl such as leopard (Panthera pardus), civet (Viverra malacensis, Paradoxurus hermaphroditus), mongoose (Herpestes javanica), red dog (Cuon alpinus), piton (Phyton reticulatus), monitor (Varanus salvator) and crested serpent eagle (Spilornis cheela) (Hernowo 1995). Alas Purwo National Park (APNP) Alas Purwo National Park (APNP) is cover an area of about 43,420 ha. The national park is located at tip of southeastern of Java Island (8º26`45”-8º47`00” S and 114º20`16”-114º36`00” E). At eastern of the national park was bordered with Bali Strait and in the south also west direction were boundaries by India Ocean. Intensive study was focused at Sadengan grazing area, low land tropical forest and teak forest plantation Rowobendo. Topography at the national park is consist of flat area with slope (0-8%) of about 10,554 ha, undulating area at the slope (8-15%) of about 19,474 ha, meanwhile rolling part (15-25% slope) at around 11,901 ha and small portion with hilly area about 2 301 ha. Four type soil groups at study area e.g mediterran red litosol complex about 2,106 ha, grey regosol 6,238 ha, grey grumusol 379 ha and alluvial hydromorf at around 34,697 ha. Numerous small streams flow at APNP, with radial pattern. All of the rivers flow to Indian Ocean.

Several underground rivers occur at karsts complex such as Pancur River (APNP 2007). According to Smith and Ferguson the rainfall type at the study area has classified as B, with annual precipitation ranges from 1079-1554 mm per year with 79-112 rainfall days. The annual average temperature is around 27.1ºC and relatively humidity is about 85%. Five type vegetation have developed in APNP, e.g. beach forest, mangrove, low land tropical forest, bamboo forest and teak plantation. Besides those vegetation types, man made grazing area occur at Sadengan. Hernowo (1999), mentioned that abundance of green peafowl was connected to availability of habitat to fulfill feeding sites, roosting site, sheltering site and nesting site. Beach forest occurs at the southern park from Grajagan to Plengkung about 30 km and Plengkung to Tanjung Slakah around 50 km. It is present about 40 km at northern park. The dominant species at the beach forest were ketapang (Terminalia catapa), waru (Hibiscus tiliaceus), keben (Barringtonia asiatica) and nyamplung (Calophyllum inophyllum). Mangrove is present at Grajagan with species vegetation such as bakau (Rhizophora spp.), tanjang (Bruguiera spp.), api-api (Avicenia sp.), pedada (Sonneratia caseolaris) and nyirih (Xylocarpus granatum). Tropical low land forest was big portion at the park. The vegetation occur at those forest such as Ficus spp., bendo (Artocarpus elastica), rao (Dracontomelon mangiferum),

102

B I O D I V E R S I T A S 12 (2): 99-106, April 2011

pule (Alstonia spp.), santen (Lannea grandis), gintungan (Bischovia javanica), and pohpohan (Buchanania arborescens). But at more dry condition at the forest is present kepuh (Sterculia foetida), asam (Tamarindus indica), and randu alas (Bombax valetoni). Besides these forest, bamboo formation also consociation of sawo kecik (Manilkara kauki) occurs at the park (APNP 2007). Several wild animal which occur at APNP might be have relation to green peafowl such as leopard (Panthera pardus), wild boar (Sus scrofa), palm civet (Paradoxurus hermaphroditus), mongoose (Herpestes javanica), red dog (Cuon alpinus), phyton (Phyton reticulatus), monitor (Varanus salvator), crested serpent eagle (Spilornis cheela) and white bellied sea eagle (Haliaeetus leucogaster) (APNP 2007).

in each habitat types in both transect and concentration methods. Demographic population was analyzed on parameter of individual number, sex ratio age structure and health of the population during year 2006 and 2007. Proportional approach on sex ratio parameter was used with percentage. Age structure was analyzed by pyramidal structure approach. Population health analysis used abundances, sex ratio, age structure parameter. Compared population study was done at the same area with other researcher in different time observation was aimed to get information of trend of green peafowl population development.

The observation Research was conducted in Baluran and Alas Purwo National Parks, at least ten month from June to October 2006 and August to December 2007. The study was focused at the local distribution of javan green peafowl in BNP at Bekol resort (savanna, beach forest and monsoon forest) and APNP at Rowobendo resort (Sadengan grazing area, low land forest, mixed plantation forest with intercropping area and teak plantation forest with intercropping area and teak plantation forest). Counting on individual number of javan green peafowl at BNP, was done by transect call count method follow Hernowo (1997). The sample area cover an area around 4 km x 3 km (1200 ha). Four transect was observed at sample area approximately 3 km length of each transect. Census was carried out in ten days every observation time and it was done simultaneously every year (in 2006 and 2007). The census started every morning at 5:00 am and lasted until 8:00 am. Four observers went through the transect route. The walking speed was about one hour per km in each transect. The individual number was counted based on the number of javan green peafowl in fixed area (1200 ha) and direct visual contact with the birds during the census. Each calling of a javan green peafowl was recorded the type and number of call, the time and direction from observers to the bird. After the census, the observers came together to make correction to avoid double counting. Besides that census, additional observation was done at water holes, roosting site and feeding site to know age structure, and sex ratio of javan green peafowl. In APNP, census for javan green peafowl was done by councentration count method follow Yuniar (2007). The sample area for concentration of the birds was focused at five places such as Sadengan grazing area, Rowobendo intercropping area, Guntingan intercropping area, Sumber Gedang teak plantation forest, and Ngagelan teak plantation forest. Five observers recorded on number of green peafowl at concentration area in each observation time. Census was carried out in ten days every observation time and it was done simultaneously every year (in 2006 and 2007). The census started every morning at 5:00 am and lasted until 8.00 am. Data analysis was done for counting the green peafowl population with statistical average and their confident limit

Population abundance at BNP and APNP The individual number of javan green peafowl was counted at every habitat type in Baluran National Park (BNP) showed that the total average number of individual at sample area in year 2006 and 2007 was 69.8 birds (Table 1). The Chi-square test showed that the peafowl abundances significant differ by habitat type (χ2 = 29.05, P< 0.01). The highest abundance of the birds was found at Bekol savanna which, representative savanna habitat type approximately 61.6-73.5% of javan green peafowl population at sample area.

RESULTS AND DISCUSSION

Table 1. The individual number of javan green peafowl found at habitat types in year 2006 and 2007 in BNP with observation (n = 20)

Habitat type Bekol Savanna Bama-Manting beach forest Berkol monsoon forest Bekol evergreen forest Total Total average

Coverage (ha)

Average individual number (bird)

2006 SD 2007 SD 323.99 50.8 ±8.05 43.4 ±1.65 167.46 6.8 ±3.58 8.5 ±1.08 645.41 5.3 ±1.42 0.3 ±1.16 30.00 6.2 ±1.93 8.3 ± 0.95 1166.86 69.1 ±22.52 70.5 ±17.38 69.8 ± 19.77

Figure 3. Individual number of javan green peafowl in-relation to habitat type of BNP. A. Savanna Bekol, B. Beach forest BamaManting, C. Monsoon forest Bekol, D. Evergreen forest Bekol.

Base on Figure 3, the javan green peafowl has abundance more at savanna habitat, although at other habitat type the

HERNOWO et al. – Pavo muticus muticus in Baluran and Alas Purwo National Parks

bird were present such as at monsoon forest, beach forest and evergreen forest, but the size is small (5.3-10.3 bird). Savanna habitat type was coverage area approximately 27.80% from total habitat type, but the abundances of the javan green peafowl more than 60%. There is indication that the birds have preference to habitat type at BNP. Meanwhile in Alas Purwo National Park (APNP) the individual number of javan green peafowl was counted at every habitat type, showed that the total average number of individual at sample area in year 2006 and 2007 was 78.6 birds (Table 2). The Chi-square test showed that the peafowl abundances significant differ by habitat type (χ2 = 38.92, P< 0.01). The highest abundance of the birds was found at Gunting intercropping area of teak plantation habitat type which representative approximately 57.4% the bird population in year 2006, but in year 2007 the bird abundance was shifted to grazing area of Sadengan which representative 39.8% of the population. Figure 4, showed that the javan green peafowl abundances more concentred at habitat type of teak plantation with intercropping area and grazing area approximately 78.6-85.7% of javan green peafowl population in APNP. The bird abundances at other habitat type was relatively small (2.4-11.9 bird). The grazing area and teak plantation and intercropping area were coverage reprentative 30.3% of total habitat tipe the javan green peafowl at sample area of APNP, but reprentative 78% population. These is fact indicated that the bird prefer on certaint habitat type at APNP.

Figure 4. Individual number of javan green peafowl in-relation to habitat type at APNP. A. Teak plantation forest and intercropping area (Gunting), B. Grazing area and lowland forest (Sadengan), C. Mix plantation forest and intercropping area (Rowobendo), D. Beach forest and teak plantation forest (Ngagelan), E. Teak plantation forest-back mangrove (Sumber Gedang).

103

Age structure and sex ratio The age structure and sex ratio of javan green peafowl at BNP representative base on observation to the birds visited the water hole. The average individual number of peafowl can be found at water hole was recorded at Table 3. Base on age classification, population structure of the birds showed that population dominated by adult bird. The age structure indicated that unbalance pyramidal population. Sub adult male bird was 59.43% and adult male approximately 40.57%, but sub adult female was 31.12% and adult female 68.88%. The age structure of the javan green peafowl at BNP will influenced to the future population. Table 3. Average individual number of javan green peafowl visited water hole Bekol resort in BNP Water hole

Male Adult

Female

Sub adult

Adult

Total

Sub adult

Bekol

3.0±0.64 5.7±0.47 26.6±1.00 12.6±0.81 47.9

Bama

0.7±0.53 0.6±0.50

0.6±0.56

1.9

Manting

0.6±0.50

0.7±0.65

1.3

4.3

6.3

27.9

12.6

Total

10.6

40.5

51.1

Figure 3. The pyramidal age structure of javan green peafowl in BNP

Table 2. The individual number of javan green peafowl found at habitat types in year 2006 and 2007 in APNP with observation (n = 20) Consentration area Gunting Sadengan Rowobendo Ngagelan Sumber Gedang

Habitat type Teak plantation forest and intercropping area Grazing area and lowland forest Mix plantation forest and intercropping area Beach forest and teak plantation forest Teak plantation forest-back mangrove Total Total average

Coverage area (ha) 220.41 147.00 252.54 296.94 294.25 1211.16

Average individual number (bird) 2006 SD 2007 SD 44.1 ±11.97 29.7 ±5.48 25.1 ± 1.66 30.5 ±5.58 6.2 ±3.58 11.9 ±3.48 2.9 ±1.10 1.8 ±0.79 2.4 ±1.17 2.6 ±1.07 80.7 ±18.44 76.5 ±14.24 78.6±15.75

B I O D I V E R S I T A S 12 (2): 99-106, April 2011

104

The population sex ratio was 10.6 male bird: 40.5 female bird or 1 male: 3.8 female. But sex ratio for adult birds was 4.3 male bird: 27.9 female bird or 1 male: 6.5 female. The sex ratio was quite normal for polygyny mating system birds like peafowl. Polygyny system at javan green peafowl population is the population strategy in order to enssure the best gen flow at the population. Base on observation to the javan green peafowl which gathering at concentration area (feeding ground) in APNP, age structure and sex ratio of the bird can be expressed as shown Table 4. The age structure of the bird showed that population dominated by adult bird. The age structure of the bird indicated that unbalance pyramidal population. Sub adult male bird was 45.33% and adult male aproximatelly 54.67%, and adult female was 85.06% and 14.94% sub adult female. Table 4. Average individual number of javan green peafowl gathering at feeding area in APNP Consentration area Sadengan

Male Adult

Female

Sub adult

Adult

Sub adult

Total

4.8±0.41 2.3±0.47 16.5±0.97 4.0±0.87 27.6

Rowobendo

1.0±0.18 1.0±0.18 7.0±0.83

Gunting

1.0±0.18 3.5±0.51 27.0±0.74 5.5±0.51 37.0

Sumber Gedang 0.8±0.41

0.0

1.5±0.68

Ngagelan

0.6±0.50

0.0

8.2

6.8

Total

15.0

9.0

2.3

2.1±0.55

2.7

54.1

9.5 63.6

78.6

Natality and mortality Data of natality and mortality the green peafowl very difficult were found direct from the field observation in APNP and BNP, but the bird census data in 2006 and 2007 showed that the population fluctuation data has indicated on expression direct of natality and mortality. The population data in BNP from census in year 2006 was 69.1 birds, but in year 2007 became 70.5 birds, so it was growth 1.4 birds or approximatelly 2.07% of the natality and mortality (increased). Meanwhile the population of the javan green peafowl census year 2006 in APNP was 80.7 bird but year of 2007 only 76.5 bird, so the population was declined 4.2 bird or 5.49% of the natality and mortality (increased). Comparison analysis of javan green peafowl population development Comparison study was used to know the development of javan green peafowl population in BNP, in 1995, 2006 and 2007 (Table 5). The individual number of javan green peafowl at different time observation with transect call count method at sample area of BNP was used on comparison. Base on chi-square test, showed that population abundances of the javan green peafowl in BNP with difference of observation time (year 1995, 2006 and 2007) has significantly differ (χ2 = 17.89, P<0.01). Result of the analysis showed that the javan green peafowl population was declined approximately 66.95% during 12 years. But in year 2006 to years 2007 the population was growth from 69.1 birds to 70.5 bird approximately 2.03%. Table 5. The individual number of javan green peafowl at different time observation with transect call count method at sample area of BNP. Habitat type Savanna

Figure 4. The pyramidal age structure of javan green peafowl at APNP

The sex ratio of the green peafowl in APNP was 15.0 male birds: 63.6 female birds or 1 male: 4.2 female. But for adult bird sex ratio was 8.2 male: 54.1 female or 1 male: 6.6 female. The bird sex ratio was indicated that the green peafowl life at polygyny system. Choising polygyny system on the javan green peafowl mating system is the population strategy to make assure the best gen flow at the population.

Hernowo 1995 51.10

Curren study in 2006 50.80

Curren study in 2007 43.40

Monsoon forest

23.40

5.30

10.30

Evergreen Forest

25.07

6.20

8.30

Beach Forest

18.23

6.80

8.50

Total

117.80

69.10

70.50

The javan green peafowl study was held in APNP in year 1998, 2005, 2006 and 2007 (Table 6). To know the development of javan green peafowl population, comparation population analysis was used. The individual number of javan green peafowl at different time observation with concentration count method at sample area of APNP was compared. Base on chi-square test, showed that population abundances of the javan green peafowl in APNP with difference of observation time (year 1998, 2006 and 2007) has significantly differ (χ2 = 19.71, P<0.01) The results showed that total the green peafowl population at sample area has raising up around 87.67%.

Table 6. The individual number of javan green peafowl at different time observation with concentration count method at sample area of APNP.

HERNOWO et al. – Pavo muticus muticus in Baluran and Alas Purwo National Parks

Concentration area Sadengan Rowobendo Guntingan Sumber Gedang Ngagelan Total

Habitat type Grazing area and lowland forest Mix plantation forest and intercropping area Teak plantation forest and intercropping ar Teak plantation forest-back mangrove Beach forest and teak plantation forest

The javan green peafowl population abundances do not significant different (69.10-70.50 individuals) between year 2006 and 2007 in BNP, but if it compared to Hernowo (1995), the population abundances have significant different (117.70 individuals). The population development declined approximately 66.95%, but in year 2006 to years 2007 the population was growth from 69.1 birds to 70.5 birds, approximately 2.03%. Several reasons the declined green peafowl population in BNP during 1995-2006 were caused by poaching and Acacia nilotica invation to savanna habitat. The notorious problem which caused declined of the javan green peafowl population was poached activities (van Balen et al. 1995). Discussion Meanwhile the green peafowl populations in APNP have grown up around 87.67% from year 1998 to year 2006 (Supratman 1998; Wasono 2005; Yuniar 2007; Risnawati 2008). The javan green peafowl population grow up has fantastically in APNP. The reasons were relatively do not occur poaching activities in the park and developing area of intercropping at teak plantation forest as new habitat the peafowl. Developing of the new habitat at intercropping teak plantation forest has created new places for the javan green peafowl living. It means that the new habitat can support more individually or sub population at that place. The green peafowl population more abundant at savanna habitat types in Bekol BNP. The savannas have availability of food resources, water supply, roosting site and nesting site at whole years (Pattaratuma 1977; Mulyana 1988; Winarto 1993; Hernowo 1995, 1999). In APNP, the birds were more distributed at Sadengan grazing area and intercropping teak plantation forest of Gunting. The abundance of the javan green peafowl have relation with availability of resources mainly food resources (Hernowo 1995). In general sex ratio of green peafowl population in BNP and APNP shown that 1 male: 4 female. These conditions indicated that the bird life in polygyny system (Perrins and Birkhead 1983). If unsuitable the sex ratio will influence to the birds reproduction process. The javan green peafowl population’s structures in BNP and APNP have adult more abundance (55-75%) than sub adult or young bird. The age structure indicated that formed opposite pyramidal population. Ponsena (1988), give same phenomenon that population age structure and sex ratio of green peafowl in Huai Kha Khaeng Wildlife Sanctuary, Thailand have age structure 1 adult male: 2.82 adult female: 1.47 immature

Supratman 1998 31 12

Wasono 2005 31 8 11

Curren Study 2006 25.1 6.2 44.1 2.4 2.9 80.7

105

Curren Study 2007 30.5 11.9 29.7 2.6 1.8 76.5

and at others area of sanctuary have age structure 1 adult male: 4.47 adult female: 0.22 immature. The age structure of the javan green peafowl population in BNP and APPNP was opposite pyramidal condition. Those condition was same phenomenon at several places of the javan green peafowl local distribution shown such as the observation in BNP by Hernowo (1995), in APNP by Hernowo and Wasono (2006), in Buah Dua Sumedang teak plantation by Hernowo and Hernawan (2003). The age structure of javan green peafowl population as ”opposite pyramidal” is still discussable because many factors may influence to the population such mortality, natality factors and detail of classified on age structure take account which the adult productive and not productive should know or may be the age structure remain as naturaly. The javan green population’s development in BNP decreased during year 1995 to 2006 but in year 2007 has little grown. That condition supposed that poaching activities decreased in BNP. The javan green peafowl populations in APNP year 1998 to 2006 fantastically grow approximately 87.67%. But in 2007 the population decreased approximately 5.49%. That phenomenon was caused by new habitat for the javan green peafowl at intercropping teak plantation forest has been created. In over all of population health of green peafowl in BNP and APNP are good, it has vigority and quite well sex ratio. CONCLUSION The javan green peafowl population in BNP decleaned during year 1995-2006. The population has abundances at savanna habitat in BNP. The population in APNP increased fantastically during in year 1998 to 2006. Those populations were more concentred at sadengan grazing area and intercropping teak plantation of APNP. The birds sex ratio composition in BNP and APNP were 1 male: 4 female, the condition indicated that the green peafowl life at polygyny system. The age structure indicated that population opposite pyramidal structure, around 67.70% adult bids. The population health of javan green peafowl in BNP and APNP relatively good. REFERENCES APNP [Alas Purwo National Park] (2007) Alas Purwo National Park. http:// www.dephut.go.id [Indonesia]

106

B I O D I V E R S I T A S 12 (2): 99-106, April 2011

BNP [Baluran National Park] (2007) Baluran National Park. http://www.dephut.go.id [Indonesia] Gilpin ME, Hanski I (1991) Metapopulation dynamics: empirical and theoretical investigations. Biol J Linn Soc 42: 73-78. Hernowo JB (1995) Ecology and behaviour of the green peafowl (Pavo muticus Linnaeus 1766) in the Baluran National Park. East Java, Indonesia. [M.Sc. Thesis]. Faculty of Forestry Science, Goerg August University Gottingen. Germany. Hernowo JB (1997) Population study of javan green peafowl (Pavo muticus muticus Linnaeus 1758) with three different methods in Baluran National Park, East Java Indonesia. Media Konservasi 5 (2): 61- 66. [Indonesia] Hernowo JB (1999) Habitat and local distribution of javan green peafowl (Pavo muticus muticus Linnaeus 758) in Baluran National Park, East Java. Media Konservasi 6 (1): 15-22. [Indonesia] Hernowo JB, Hernawan E (2003) Population and habitat study of javan green peafowl (Pavo muticus muticus Linnaeus 1958 ) at Ciawitali teak forest plantation of BKPH Buahdua and BKPH Songgom, KPH Sumedang. Media Konservasi 8 (3): 117-126. [Indonesia] Hernowo JB, Wasono WT (2006) Population and habitat of javan green peafowl (Pavo muticus muticus Linnaeus 1958) in Alas Purwo National Park. Media Konservasi 9 (3): 83-88. [Indonesia] Mulyana (1988) Habitat study of green peafowl (Pavo muticus Linnaeus 1766) at Bekol Resort, Baluran National Park, East Java. [Honor Thesis]. Department of Forest Resources Conservation, Faculty of Forestry, Bogor Agricultural University. Bogor [Indonesia] Partomihardja T (1989) Check-list of plant species in the Baluran national park, East Java. RCB LIPI. Bogor. Pattaratuma A (1977) An ecological study on the green peafowl, â&#x20AC;?Burung Merakâ&#x20AC;? (Pavo muticus Linn.) in the Game Reserve Baluran Banyuwangi, East Java, Indonesia. Technical Paper No 2. Department of Forest Biology. Faculty of Forestry, Kasetsart University Bangkok. Bangkok.

Perrins CM, Birkhead TR (1983) Avian ecology. Chapman & Hall. New York. Ponsena P (1988) Biological characteristic and breeding behaviours green peafowl (Pavo muticus Linnaeus) in Huai Kha Khaeng Wildlife Sanctuary. Thai J For 7: 303-313. Risnawati R (2008) Population and habitat analysis of green peafowl (Pavo muticus Linnaeus, 1766) in Alas Purwo and Baluran National Park, East Java. [Honor Thesis]. Department of Forest Resources Conservation and Ecotourism, Faculty of Forestry, Bogor Agricultural University. Bogor [Indonesia]. Supratman A (1998) Distribution and habitat characteristic study of green peafowl (Pavo muticus Linnaeus 1766) at non breeding season in Rowobendo Resort Alas Purwo National Park, East Java. [Honor Thesis]. Department of Forest Resources Conservation, Faculty of Forestry, Bogor Agricultural University. Bogor [Indonesia]. van Balen S, Prawiradilaga DM, Indrawan M (1995) The distribution and status of green peafowl In Java. Biol Conserv J 71: 289-297. Warsono WT (2005) The population and habitat of green peafowl (Pavo muticus Linnaeus 1766) in Alas Purwo National Park, East Java. [Honor Thesis]. Department of Forest Resources Conservation, Faculty of Forestry, Bogor Agricultural University. Bogor [Indonesia]. Winarto R (1993) Some ecological aspect of green peafowl (Pavo muticus Linnaeus 1766) at breeding season in Baluran national park, East Java. [Honor Thesis]. Department of Forest Resources Conservation, Faculty of Forestry. Bogor Agricultural University. Bogor [Indonesia]. Yuniar A (2006) Population and habitat study of green peafowl (Pavo muticus Linnaeus 1766), in Alas Purwo National Park and Baluran National Park, East Java. [Honor Thesis]. Department of Forest Resources Conservation and Ecotourism, Faculty of Forestry, Bogor Agricultural University. Bogor [Indonesia]

B I O D I V E R S IT A S Volume 12, Number 2, April 2011 Pages: 107-111

ISSN: 1412-033X (printed edition) ISSN: 2085-4722 (electronic) DOI: 10.13057/biodiv/d120208

Status and diversity of arbuscular mycorrhizal fungi and its role in natural regeneration on limestone mined spoils ANUJ KUMAR SINGH1,♥, JAMALUDDIN2,♥♥ ¹ Department of Forestry, College of Agriculture, Orissa University of Agriculture and Technology, Bhubaneswar 751003, Orissa, India. Tel. +91-674402677. Fax. +91-674-407780. email: ksanuj@live.com ² Department of Bioscience, RD University, Jabalpur 4820010, Madhya Pradesh, India. email: Jamaluddin_125@hotmail Manuscript received: 28 September 2010. Revision accepted: 14 December 2010.

ABSTRACT Singh AK, Jamaluddin (2011) Status and diversity of arbuscular mycorrhizal fungi and its role in natural regeneration on limestone mined spoils. Biodiversitas 12: 107-111. Limestone mined spoils are devoid of adequate population of beneficial microbial flora. Arbuscular mycorrhizal fungi (AMF) are very important constituent of plant- soil-microbe system. In mined spoils the population of AMF is greatly reduced and hence the spoils become very inhospitable for establishment of vegetation. In the present investigation, status of AMF population and its effect on natural regeneration process is studied. It is well known fact that the arbuscular mycorrhizal fungi play very important role in establishment of vegetation in degraded lands. Plantation of seedlings inoculated with arbuscular mycorrhizal fungi provide favorable soil conditions for naturally growing vegetation in the mined overburden spoils. Physico-chemical properties of soil are converted suitable for planted species and thus it allows other species to grow and also provide shade to protect the herbaceous vegetation. Introduction of plant species attracts immigration of other species and if they established, may result into a very distinctive floral cover on disturbed lands. Thus, invasion of native plant species along with planted species may play a significant role in increasing the plant diversity on mined spoils. Key words: Arbuscular mycorrhizal fungi, diversity, inoculation, lime stone, mine spoils, natural regeneration.

INTRODUCTION Limestone mine sopils are generally hostile to plant growth. as these spoils are devoid of essential soil nutrients and beneficial microbial flora particlarly arbuscular mycorrhzal fungi (AMF). AMF are very important for the development of long term plant community structure. The absence of AMF may account for poor survival of plants on disturbed lands like mined out spoils. AMF play a crucial role in plant nutrient uptake, water relations, ecosystem establishment, plant diversity, and productivity of plants. Mycorrhizas also protect plants against root pathogens and toxic stresses. The fundamental importance of the arbuscular mycorrhizal association in restoration and to improve revegetation of disturbed mined lands is well recognized (Mukhopadhyay and Maiti 2009). Arbuscular Mycorhizal fungi have great potential in establishment and survival of plants under natural as well as stressed condition of mined out lands (Quoreshi 2008). The limestone mined spoils also exhibit reduced level of infectivity of AMF due to soil disturbance while AMF have been advocated for successful restoration of different mine spoils (Misra et al. 1990; Parihar 2007). Poor AMF population and reduced infectivity inhibits nutrients mineralization and immobilization, consequently the establishment of plants and ultimately affects the process of ecological succession. In the present investigation, an effort is made to study the status and diversity of AMF on

limestone mined out spoils of differnt age groups. Study also endeavours to reveal the importance of AMF inoculation in natural regeneration calcarious mined out spoil material.

MATERIALS AND METHODS Physico-chemical analysis of soil Soil samples of overburden materials were collected from limestone mined overburden dumps of different age groups including 10 years old, 5 years old and 0 year old (fresh spoil) unvegetated dumps. The soil samples were carefully collected in polyethylene bags and their openings were tied with rubber bands. The soil samples so collected were used for the study of status of AMF, nutrients status and physico-chemical characteristics of limestone mined spoils of different ages soil. For the purpose of estimation of the concentration of trace elements (Ni, Pb, Mn, Zn, Fe, Cu and Co) in the limestone mines spoil, DTPA extraction method prescribed by Lindsay and Norvell (1978) was applied. Soil physico-chemical analysis was made by using methods of Black (1965). Isolation and identification AMF Soil samples were collected and processed for isolation of AMF spores. To extract AMF spores, wet - sieving and decanting technique of Gerdemann and Nicolson (1963)

108

B I O D I V E R S IT A S 12 (2): 107-111, April 2011

was applied. Genera and species of AMF were identified on the basis of morphology of their resting spores by consulting taxonomic manual of Schenck and Perez (1990). In order to study the natural regeneration on limestone mined overburden dumps, quadrates of size 2 m x 2 m were laid randomly. Vegetational data were then quantitatively processed for frequency, relative frequency and abundance according to the formulae given by Curtis and McIntosh (1950). Statistical analysis The observation data were subjected to analysis of variance (ANOVA). One way analysis of variance was carried out to compare the means of different treatments. Means separation tests were performed using least significant difference (LSD) at the P<0.05 level after significant F values were obtained.

RESULTS AND DISCUSSION Soil characteristics Table 1 reveals that there was a significant variation (p<0.05) in the available nitrogen content among the mined spoils of different age groups. Available nitrogen increased significantly with the age of spoils. Vimmersted et al. (1989) also reported an increase in nitrogen concentration in calcareous mined spoils. Several others workers such as Wali (1987) in North Dakota, Russel and La Roi (1986) in Alberta also recorded an increase in N with the ageing of the mined spoils. Jencks et al. (1982) also found increase in nitrogen concentration with age in coal mine spoils. Available phosphorus (P2O5) concentration also followed the same trend with maximum concentration in 10 years old spoils, which was followed by 5 years old spoils. The concentration of available phosphorus was minimum in 0 years old spoils. Available phosphorus concentration increased significantly (P<0.05) with the age of spoils. Available potassium (K2O) estimated maximum in 10 years spoils while it showed its minimum concentration in 0 year old spoils. Banerjee et al. (2001) have also reported an increase in available phosphorus (P2O5) and potassium (K2O) with the age of mined spoils. This increase was possibly due to increase in the vegetational cover due to natural succession of herbs, shrubs and a few tree species. The microbes in the rhizosphere of these plants enhanced these nutrients possibly through rock weathering and made available to the growing vegetation. The physico-chemical status of limestone mined spoils is presented in Table 2. The spoils of all age groups showed alkaline soil reaction. The pH was highest (8.5) in 0 year old over burden material and lowest (8.2) in 10 years old mined spoil. Similarly the electric conductivity (EC) also followed more or less the same trend. Organic matter was maximum in 10 years old mined overburdens and minimum in 0 year old (fresh) overburdens. Organic carbon content was also maximum in 10 years old spoil and minimum in 0 year old (fresh) spoil dump. It is notaable that this trend in increase of organic carbon was due to natural regeneration, which contributed litter thereby, raising the organic matter and

organic carbon content in 10 years old dumps. Thus from the physicochemical characteristics it is evident that the spoil were alkaline in reaction, highly calcareous and nutritionally very poor. Percent CaCO3 decreased with the age of mine spoils. It was highest (18.8%) in 0 year old spoil and lowest (7.3%) in 10 years old spoil. The plant roots and microbes in the rhizosphere may secrete certain secondary metabolites, which possibly dissolve the CaCO3 in the older dumps. The concentration of different heavy metals in spoil of different age groups is presented in Table 3. The concentration of Ni, Pb, Fe and Cu decreased with the aging of the spoils while the concentration of Mn, Zn and Co increased with the age of spoil. All such variations may be due to interaction between plant roots of growing vegetation and the microbial succession occurring in the mined spoils. The increasing concentrations of heavy metals in mine spoils are considered to pose potentially serious hazards in the soil-plant system. Toxic level of concentration of heavy metals in mine spoil constitute an important threat for establishment and further growth, survival and development of plants on mine spoils. Table 1. Status of N, P and K in limestone mined spoils of different ages. Age of spoils (year) 10 5 0 (Fresh spoil) CD (0.05) SE Âą

Available (kg/ha) N

P c

64.78 62.12b 32.80a 3.0968 1.3429

K c

14.92 4.96b 3.46a 1.0202 0.44242

239.7c 188.0b 173.9a 7.9767 3.4591

Table 2. Physico-chemical properties of lime stone mined spoils of different ages.

Properties Organic matter (%) Organic carbon (%) CaCo3 equivalence (%) Exchangeable Mg++ (me/100g) Exchangeable Ca++ (me/100 g) pH Soil: H2O (1:5) EC (mmhos/cm)

10 years 0.22 0.13 7.3 11.8 27.8 8.2 0.12

Spoil age 5 years 0.20 0.11 9.2 10.0 26.4 8.4 0.15

0 year 0.10 0.05 18.8 9.4 37.6 8.5 0.19

Status of arbuscular mycorrhizal fungi (AMF) The efforts for biological rejuvenation of mined spoils need the evaluation of the arbuscular mycorrhizal status of the spoil. Thus it becomes imperative to study the arbuscular mycorrhizal status of the mined spoil, so that further rehabilitation strategy can be formulated and thus the technology may be applied in the field. It investigates the occurrence and status of AMF occurring in limestone mined areas. It is evident from the Table 4 that the population of AMF spores increased with the age of overburden dumps which was in high frequency in the older dumps. It was observed that there was a considerable difference in the population of AMF spores in the soil of

SINGH & JAMALUDDIN â&#x20AC;&#x201C; Arbuscular mycorrhizal fungi on limestone spoils

limestone mined overburden dumps of different age groups with a maximum spore density in 10 years old overburden dump. Chandra and Jamaluddin (1999) reported increase in spore densiy and diversity of AMF with increase in the age of mine spoil. They also explained relative spore density and distribution of different AMF species.They found the genera Glomus and Acaulospora dominant on spoil of all age groups.

109

Table 3. Status of trace elements in limestone mined spoils of different age group dumps Age of spoil Ni (Year) 10 0.028 5 0.11 0 0.13

Concentration of trace elements (ppm) Pb 0.36 0.57 1.3

0.75 0.41 0.17

0.41 0.24 0.20

0.43 0.48 0.57

0.21 0.38 0.45

Co 0.24 0.17 0.02

CD (0.05) 0.082363 0.037019 0.0065932 0.0087675 0.018891 0.0087367 0.029970 SE Âą 0.029665 0.013333 0.0023747 0.0031578 0.0068041 0.0031467 0.010794 Table 4. Status of AM fungi in limestone mine spoils

Age of spoil 10 years old 5 years old 0 year old (fresh) Un-sterilized nursery soil

AMF spore density (100g-1 soil) 760 540 240 850

Genera of AMF Glomus, Acaulospora, Gigaspora, Scutellospora Glomus, Acaulospora, Gigaspora Glomus, Acaulospora, Glomus, Acaulospora, Gigaspora, Scutellospora

Table 5. Relative spore density of different AMF species in different aged spoils Relative AMF spore density (%) 10 years 5 years old 0 year old Nursery old spoil spoil spoil (fresh) soil

AMF species Glomus Glomus mosseae Glomus deserticola Glomus intraradices Glomus fasciculatum Glomus arborense Acaulospora Acaulospora denticulata Acaulospora scrobiculata Acaulospora delicata Gigaspora Gigaspora rosea Gigaspora margarita Gigaspora gigantea Scutellospora Scutellospora persica Scutellospora heterogama Scutellospora verrucosa

11.2 9.9 7.2 5.3 5.9

12.0 10.2 9.2 7.4 7.4

10.0 11.5 8.3 7.9 10.4

7.1 4.7 8.2 6.8 5.9

7.9 8.5 6.6

9.2 10.4 9.2

14.6 20.0 17.5

7.3 5.9 7.6

5.5 5.9 7.9

9.2 8.5 7.4

ND ND ND

8.2 8.8 8.2

6.6 7.1 4.5

ND ND ND

7.1 7.6 6.5

Table 6. Natural regeneration in planted and unplanted area of limestone mined spoil

0.0305 0.036 0.025 0.037 .05 0.057 0.025

30 40 30 40 20 20 20

15.8 15.8 15.8 21.09 10.5 10.5 10.5

1.7 1.5 1.0 1.5 1.0 1.0 1.5

A/F

Abundance

1.8 1.8 1.3 2.2 1.0 1.7 1.0

Relative freq. (%)

19.35 16.12 16.12 19.35 6.45 9.7 12.9

Frequency (%)

60 50 50 60 20 30 40

Unplanted area

A/F

Phyllanthus niruri Tridax procumbens Ocimum gratissimum Argemone mexicana Zizyphus mauritiana Acacia nilotica Parthenium hysterophorus

Abundance

Species

Relative freq. (%)

Planted area Frequency (%)

Relative AMF spore density and diversity The extent of indigenous AMF in lime stone mined spoil was determined. The distribution of AMF provides a generalization of the occurrence of AMF in the lime stone mined spoils of different age groups. The relative spore density provided a general idea about the AMF species, which reflect its tolerance and adaptability towards the calcareous soil and other edaphic conditions of mined spoil. AMF species belonged to the genera Glomus and Acaulospora were dominant as compared to others. This fact must be related to their sporogenous characteristics, i.e. Glomus and Acaulospora species usually take a short time to produce small spores, compared with the large spores of Gigaspora and Scutellospora species in the same environment (Nandakwang et al. 2008) Relative spore density of different AMF isolated from lime stone mined overburden of different age group is presented in the Table 5. Ten years old spoil was represented by Glomus mosseae with maximum relative spore density of 11.2% of the total isolate of 10 years old spoil. Glomus deserticola scored second with 9.9% relative density. Acaulospora scrobiculata was found third with 8.5% relative spore density, which was followed, by Acaulospora denticulata (7.9%), Gigaspora gigantea (7.9%), Glomus intraradices (7.2%), Scutellospora heterogama (7.1%), Scutellospora persica (6.6%), Acaulospora delicata (6.6%), Glomus arborense (5.9%), Gigaspora margarita (5.9%), Gigaspora rosea (5.5%), Glomus fasciculatum (5.3%) and Scutellospora verrucosa (4.5%). Acaulospora denticulata and Gigaspora gigantea showed the same status of occurrence with 7.9% relative spore density. Likewise Acaulospora

0.055 0.037 0.033 0.037 0.05 0.05 0.05

110

B I O D I V E R S IT A S 12 (2): 107-111, April 2011

delicata and Scutellospora persica shared equal spore density of 6.6%. Five-year old spoil was represented by Glomus mosseae which occurred with 12.0% of relative spore density followed by Acaulospora scrobiculata (10.4%), Glomus deserticola (10.2%), Glomus intraradices, Acaulospora denticulata, Gigaspora rosea (9.2% each), Gigaspora margarita (8.5%) while Gigaspora gigantea, Glomus fasciculatum and Glomus arborense occurred with minimum relative spore density of 7.4% (each). The occurrence of Genus Scutellospora was not detected. In 0 year old (fresh spoil) spores of Genus Gigaspora and Scutellospora were not detected. Acaulospora scrobiculata exhibited maximum relative spore density, i.e. 20% which was followed by Acaulospora delicata (17.5%), Acaulospora denticulata (14.6%), Glomus deserticola (11.5%), Glomus arborense (10.4%), Glomus mosseae (10.0%), Glomus intraradices (8.3%) and Glomus fasciculatum with minimum relative density of 7.9%. 0 year old spoil was represented by Genus Acaulospora. The nursery soil harboured different species of genera Glomus, Acaulospora, Gigaspora and Scutellospora, which were fairly distributed. Natural regeneration in planted and unplanted area of mined spoil Plantation of suitable species accelerated the invasion of native herbaceous flora on mined spoils. In the present study experimental plantation of Jatropha curcas, Pongamia pinnata, Ailanthus excelsa and Withania somnifera was carried out. The planted seedlings were boosted up by inoculating a consortium of AMF. It was observed that the plantation of inoculated seedlings has remarkably accelerated the natural regeneration process in the planted area of the mined spoil. The pioneering species which occurred in the planted area of spoil were Phyllanthus niruri, Tridax procumbens, Ocimum gratissimum, Argemone mexicana, Zizyphus mauritiana, Acacia nilotica and Parthenium hysterophorus which established through successional process in mined spoil (Table 6). In planted area, the regeneration of Phyllanthus niruri and Argemone mexicana was recorded highest with frequency (60% each) and abundance value of 1.8 and 2.2 respectively which was followed by Tridax procumbens, Ocimum gratissimum, Parthenium hysterophorus, Acacia nilotica and Zizyphus mauritiana. In planted area the abundance value was recorded highest (2.2) for Argemone mexicana.The results in same trend were also recorded by Singh (2004). He observed higher density of herbaceous vegetation on naturally revegetated mine spoils as compared to unvegetated one. In unplanted area, the occurrence of colonizing species was less frequent. Tridax procumbens and Argemone mexicana represented in higher frequency (40%) followed by Phyllanthus niruri, Ocimum gratissimum, Zizyphus mauritiana, Parthenium hysterophorus and Acacia nilotica. The abundance was recorded maximum (1.7) for Phyllanthus niruri which was followed by A. mexicana, P. hysterophorus, T. procumbens, O. gratissimum, Z. mauritiana, and A. nilotica. Though all the species

occurred in both planted and unplanted area but frequency of occurrence and abundance of particular species were higher in the planted one. This is quite obvious that plantation played a catalytic role on immigration of surrounding species on mined out spoils. The plants which were pre-inoculated with arbuscular mycorrhizal consortia established well in the mined spoils and modified the soil characteristic, created favorable conditions for plants growth which led to start and accelerate natural regeneration process on spoils.

CONCLUSION Arbuscular mycorrhizal fungi due to their widespread occurrence and distribution constitute a significant part of every natural and cultivated ecosystem and play a major role in plant species diversity and survival. Distribution of AMF is related to soil and environmental condition and density of AMF species may vary from site to site. AMF play a pivotal role in the establishment and growth of plants under natural as well as stress conditions, particularly in nutrient deficient soils. The occurrence of different AMF species was expressed in terms of relative spore density. The occurrence and distribution of AMF varied with physico-chemical properties of soil. The density of spores also varied accordingly. In the present investigation although each species occurred in both planted and unplanted area but the frequency of their occurrence and abundance was greater in planted area as compared to unplanted area of the overburden dump. This is due to effect of plantation and inoculation of AMF to the planted species which promoted the colonizers for establishment. The AMF population in rhizosphere possibly contributed in the availability of nutrients needed by the growing vegetation. Thus, incoulation of AMF boosted up the growing seedlings and also altered the soil conditions which resulted into accelerated natural regeneration process on limestone mined out spoil. This also indicates that merely plantation on mine spoil does not guarantee the development of a well structured plant community but it needs a biological balance between above ground flora and below ground microbial flora for sustainability of vegetation on degraded lands.

RFERENCES Banerjee SK, Singh AK, Shukla PK (2001) Eco-restoration of mined area. Ann Forest 9 (1): 108-127. Black CA (1965) Methods of soil analysis 2. American Society of Agronomy. Madison, WI. Chandra KK, Jamaluddin (1999) Distribution of vesicular arbuscular mycorrhizal fungi in coal mine overburden dumps. Ind Phytopathol 52 (3): 254-258. Curtis JT, Mc Intosh RP (1950) The inter-relations of certain analytic and synthetic phytosociological characters. Ecology 31: 434-455. Gerdemann JW, Nicolson TH (1963) Spores of mycorrhizal endogone species extrcted from soil by wet sieving and decanting. Trans Br Mycol Soc 46: 235-244. Jencks EM, Tryon EH, Contri M (1982) Accumulation of nitrogen in mine soils seeded to black locust. Soil Sci Soc Amer J 64:1290-1293.

SINGH & JAMALUDDIN â&#x20AC;&#x201C; Arbuscular mycorrhizal fungi on limestone spoils Lindsay WL, WA Norvell (1978) Development of a DTPA soil test for zinc, iron, manganese and copper. Soil Sci Soc Amer J 42: 421-428. Misra AK, Patnaik R, Thatoi HN, Padhi GS (1990) Assessment of beneficial soil microflora of iron and chromite mine over burdened mine area of Orissa- an index of study of heavy metal toxicity of soil fertility. In: Patnaik LN (ed.) Environmental impact of industrial and mining activity. New World Environmental Series, Ashish Publishing House. New Delhi. Mukhopadhyay S, Maiti SK (2009) Biofertiliser:VAM fungi-Future prospect for biological reclamation of mine degreaded lands. Ind J Environ Protect 29 (9): 801-808. Nandakwang P, Elliot S, Lumyang S (2008) Diversity of arbusular mycorrhizal fungi in forets restoration area of Doi Suthep-Pui National Park, North Thailand. J Microsc Soc Thai 22: 60-64. Parihar AKS (2007) Studies on indicator microbes occurring in limestone mined overburden dumps and their role in biological rejuvenetio of the spoils. [Dissertation]. Forest Research Institute University. Dehradun, India

111

Quoreshi AM (2008) The use of mycorrhizal biotechnology in restoration of disturbed ecosystem. In: Mycorrhizae: Sustainable agriculture and forestry. Springer. Oxford. Russel WB, La Roi GB (1986) Natural vegetation and ecology of abandoned coal mined land, Rocky Mountain Foothills, Alberta, Canada. Can J Bot 64: 1286-1298. Schenck NC, Perez Y (1990) Manual for the identification of VA mycorrhizal fungi. University of Florida. Gainesville, FL. Singh A (2004) Herbaceous biomass yield on age series of naturally revegetated mine spoils in a dry tropical environment. J Ind Inst Sci 84: 53-56. Vimmersted JP, House MC, Larson MM, Kasile JD, Bishop BL (1989) Nitrogen and carbon accretion on Ohio coal mine spoils: influence of soil forming factors. Landsc Urb Plan 17: 99-111. Wali MK (1987) The structure, dynamics and rehabilitation of drastically disturbed ecosystems. In: Khosoo TN (ed). Perspectives in environmental management. Oxford University Press. New Delhi.

B I O D I V E R S IT A S Volume 12, Number 2, April 2011 Pages: 112-124

ISSN: 1412-033X (printed edition) ISSN: 2085-4722 (electronic) DOI: 10.13057/biodiv/d120209

Review: Recent status of Selaginella (Selaginellaceae) research in Nusantara AHMAD DWI SETYAWAN♥ Department of Biology, Faculty of Mathematics and Natural Sciences, Sebelas Maret University, Surakarta 57126. Jl. Ir. Sutami 36A Surakarta 57126, Tel./fax. +62-271-663375, ♥email: volatileoils@gmail.com Manuscript received: 11 November 2010. Revision accepted: 12 February 2011.

ABSTRACT Setyawan AD. 2011. Recent status of Selaginella (Selaginellaceae) research in Nusantara. Biodiversitas 12: 112-124. Selaginella Pal. Beauv. (Selaginellaceae Reichb.) is a cosmopolitan genus that grows in tropical and temperate regions. Some species of Selaginella have widely distribution and tend to be invasive, but the others are endemics or even, according to IUCN criteria, endangered. Nusantara or Malesia (Malay Archipelago) is the most complex biogeographic region and rich in biodiversity. It is one of the biodiversity hotspot of Selaginella, whereas about 200 species of 700-750 species are exist. Selaginella has been survived for 440 mya without any significant morphological modification, but extinction of tree-shaped species. Selaginella have similar morphological characteristics, particularly having heterospore form and loose strobili; and is classified as one genus and one family. However, individual species has high morphological variation caused by different edaphic and climatic factors. Genetic studies indicate high polymorphism among Selaginella species. Selaginella had been used as complementary and alternative medicines treated to postpartum, menstrual disorder, wound, etc. Biflavonoid – the main secondary metabolites – gives this benefit and is especially used as anti oxidant, anti-inflammatory, and anti cancer in modern pharmaceutical industry. The other metabolites, trehalose, potentially act as molecular stabilizer in biological based industry. Metabolite profiles can also be used to identify Selaginella by its species, time and harvest age, and locations. Since most of Selaginella grows on moist, organically rich, and well drained soils, which is vulnerable to forest degradation and global warming, it needs more conservation priority. Biosystematics and ethnobotanical researches of Nusantara Selaginella is needed to expand taxonomic status and bioprospecting of this bioresources. Key words: biosystematics, ethnobotany, research, Nusantara, Selaginella.

INTRODUCTION The word Nusantara is firstly used officially by the Kingdom of Majapahit, to name their sovereignty including most of Island of Southeast Asia (ISEA) and Malay Peninsula. Later, this archipelago is also named Malesia or Malay Archipelago refers to Malay Language which acts as lingua franca. Now, Nusantara or Malesia is a biogeographic region including Sumatra, Malay Peninsula, Kalimantan, and Java in the western; the Philippines, Sulawesi and the Lesser Sunda Islands in the middle; and Maluku and Papuasia (New Guinea and the Solomons) in the eastern. This archipelago is developed in accordance with the breakup of Gondwana and the end of the last glaciations. In the perspective of Gondwana separation, Asia mainland is withstand in the original place and compose Sunda shelf, whereas another fission, nowadays Australia and New Guinea floating away to the north, compose Sahul shelf, and uplifted islands between two continent. At the end of ice age, the two shelves sink and generate Nusantara as seen nowadays. Sunda, Sahul and the islands between them have different historical evolution and generate different flourish biological diversity. Tropical Nusantara is one of the major mega biodiversity centers of the world, together with tropical South America and tropical Central Africa. Unfortunately, habitat

degradation is quite high, both land and oceanic areas, which threatens sustainability of this biological resource. Selaginella Pal. Beauv. (Selaginellaceae Reichb.) is one of the biological resources of Nusantara. This ancient plants can survive from natural selection without significant morphological modification, and sometimes called spike moss or resurrection plants (especially for incurling-drought ones). This plant has been grown in humid and warm climate regions from the early Carboniferous period, which having dichotomic branch and dimorphic leaves (especially in Nusantara species); and differing from another allied lycophytes by loose, free and open strobili. Selaginella is potent medicinal plants, which contain phenolics (flavonoids), alkaloids, as well as terpenoids; however biflavonoid – a dimeric form of flavonoid – is the main bioactive compounds of Selaginella, which comprising of 13 compounds, especially amentoflavone and ginkgetin. Biflavonoids have several medicinal properties, especially as antioxidant, anti-cancer, and anti-inflammatory. Since most of Nusantara Selaginella naturally grow in humid and cool areas, which threatened by natural degradation and global warming, it insists conservation effort to ensure sustainability supply of this biological resources. Selaginella has been existed since 440 mya and grown in all biome types, except in Antarctica. This plant

SETYAWAN â&#x20AC;&#x201C; Selaginella research in Nusantara

generates several characteristics for fading competition, reducing herbivory, pest and disease, optimizing growth and capturing sunlight, etc. Selaginella can grow in the most extreme habitat such as in cold tundra and alpine (S. selaginoides, S. rupestris) or in drought dessert (S. lepidophylla, S. sartorii); however most of them grows in tropical rain forest. Those species are only remaining herbs-form and leaving tree-form; have minute dimorphic leaves, forming bizonoplast (S. erythropus) and iridescent schemochromic tydall-blue color (S. willdenowii, S uncinata); generate more chlorophyll a than b (S. willdenowii); and produce several secondary metabolites, mainly bioflavonoid, as well as trehalose, a molecular stabilization of drought conditions. This adaptation induces continuation of Selaginella through time, and triggers the diversity. Biosystematics of Selaginella is used for analyzing data obtained from morphological, ecological, genetic, biochemical, etc. to assess the taxonomic relationships, especially within an evolutionary framework. Since research on Nusantara Selaginella is rarely conducted, it is needed to review all research progress and compared to global researches. This review explains current condition of Nusantara Selaginella which cover all aspect of investigation, such as biogeography, morphology and anatomy, genetics or molecular biology, natural products, ecology, paleobotany, ethnobotany, as well as Nusantara population which can impact on biodiversity. This matter is needed to improve conservation effort and is used to solve biosystematics problems of this bioresources.

750 species (Tryon and Tryon 1982; Jermy 1990). This ascertainment is not only supported by common taxonomic data, but also supported by newest biomolecular data. The word Selaginella is firstly introduced by Palisot de Beauvois (1805) as a name of a genus, but previously this word has been used by Linnaeus (1754) to denominate species of Lycopodium selaginoides L.; word of selaginoides mean like selago, an ancient name for Lycopodium. The name of this species has been revised and nowadays the valid name is Selaginella selaginoides (Heidel and Handley 2006). The use of molecular markers

A 2

PHYLOGENETICS AND CLASSIFICATION Phylogenetics Selaginella has approximately occurred since 440 mya (Banks 2009); far before Nusantara reside in the present days location. Selaginella is estimated congeneric with genus Selaginellites Zeller which nowadays remains to fossil (Fairon-Demaret 1989). Molecular based research indicates that Selaginellaceae also has close relationship to Lycopodiaceae and Isoetaceae (Tryon and Tryon 1982), which is chemotaxonomically indicated by the flavonoid patterns (Voirin and Jay 1978). This family has divergence from Isoetaceae at Upper Devonian period (370 mya) (Korall et al. 1999). Selaginellaceae has only one genus, Selaginella (Jermy 1986 1990b; Tryon and Tryon 1982), that consist of 700-

113

Figure 1. Morphological comparison of anisophyllous and isophyllous of Selaginella. All Nusantara Selaginella has anisophyllous leaves and including in subgenus Stachygynandrum. (1) Habit. (2) Close-up of upper side of vegetative branch shows dimorphic leaves, decussately arranged in four rows. (3) Close-up of branch dichotomy shows rhizophore originating on the ventral side of the branch. While several others has isophyllous leaves such as subgenus Tetragonostachys. (4) Habit, note the uncurling vegetative branch tips. (5) Close up of vegetative branch shows uniform spirally arranged leaves. (6) Close-up of branch dichotomy shows rhizophore originating on the dorsal side of the branch (after Korall and Kenrick 2002).

114

B I O D I V E R S IT A S 12 (2): 112-124, April 2011

that are relatively resistant to evolution such as cpDNA is very important to clarify phylogenetics of this taxon. This will be strengthened when more species are studied. Classification Palisot de Beauvois (1805) classifies Selaginellaceae into four genera, but Spring (1850) unites it all into one genus, Selaginella, and then Jermy (1986) divides it into five sub-genera, namely Selaginella Pal. Beauv. (2 spp.), Ericetorum Jermy (3 spp.), Tetragonostachys Jermy ( 50 spp.), Stachygynandrum (Pal. Beauv.) Baker ( 600 spp.), and Heterostachys Baker ( 60 spp.). The first tree of subgenus has similar leaf measure and shape (isophyllous), while the other two have different leaf measure and shape (anisophyllous). According to Korall and Kenrick (2002), subgenus Selaginella and Tetragonostachys have monophyletic character, Stachygynandrum and Heterostachys have polyphyletic character, while character of Ericetorum is still unknown. Previously Korall et al. (1999) suggest that subgenus Selaginella closely ties to other subgenus though its morphological form rather differing, whereas has leaf whorl and has not rhizophores. Korall and Taylor (2006) indicate that Selaginella is monophyletic genus base on rbcL map, however at subgenus level it is monophyletic or paraphyletic. Modern and fossil of Selaginella species is monophyletic in Selaginellaceae family base on ultrastructure of megaspore. According to Camus (1997), all Nusantara Selaginella is member of subgenus Stachygynandrum, particularly featured by its dimorphic leaves (Figure 1); until now we have never found any anisophyllus Selaginella in the archipelago, so the study on this matter is needed. Diversity Nusantara is one of the center researches of world biogeography that is considered as natural biogeographical unit. Nusantara has very high plant diversity and endemicity that is estimated to reach 42,000 species (Roos 1993), whereas 70% is endemic plant. However, most study is only conducted in western part, though many taxa spread in all over areas (Brown et al. 2006). Selaginella is fern with cosmopolitan distribution, especially at subtropical and tropical areas (Tryon and Tryon 1982; Jermy 1990; Kramer and Green 1990). This plant can be found in ninth bioregions of Nusantara, which diversity depends on the island width. A lot of species is naturally distributed in all over regions, such as S. wildenowii; but several species are spreaded by human introduction, such as S. plana. These species originally came from the western part of Nusantara, but now are distributed throughout the archipelago, even to North, Central and South America (Hassler and Swale 2002). Nusantara has about 200 species of Selaginella, amount of total and endemic species in each bioregion as follow: Malaya 32 (6), Sumatra 28 (9), Kalimantan 57 (42), Java 24 (5), Sulawesi 18 (7), Maluku 16 (4), Lesser Sunda Islands (10 (0), Philippine 54 (41), and Papuasia 59 (48) (Camus 1997; Hassler and Swale 2002; Setyawan 2008a). In Bahasa Indonesia, Selaginella is called as “cakar ayam” (scrawl) referring to the position of scale leaves which

adhere to stem which is similar to the scales of chicken foot (Dalimartha 1999); or “rane”, an absorption word from Sundanese word (Sastrapradja and Afriastini 1985). Since taxonomy of Nusantara Selaginella is still based on old research, such as Alderwereld van Rosenburgh (1915a, b; 1916, 1917, 1918, 1920, 1922) and Alston (1934, 1935a, b, 1937, 1940), it is needed to re-evaluate the taxonomic classification for reducing misidentification and covering new species, new record or new naturalization of non native species. Check list of Papuasian and Kalimantan Selaginella diversity have not been conceived yet. But for the Malay Peninsula, the revision has been conducted twice by Wong (1982, 2010). Setyawan (2009) showed that from 40 species of Selaginella found throughout Indonesia in his ethnobotanical research, 18 species are not identified and are alleged to be a new species or new records. With more intensive research, it is believed that more unidentified species will be found.

MORPHOLOGICAL AND ANATOMICAL DESCRIPTION Selaginella is the largest genus of heterospore fern, the sporangium is modified from reproductive leaves on tip of branch that forming loose, free and open groups called strobili (Hitchcock et al. 1969). It has dichotomous branch and minute scale-like leaves that are generally in two different sizes, where median is smaller than lateral ones (Jermy 1990). This morphological characteristic is only little change since Carboniferous period, when this plant lives in tropical wetland (Thomas 1992, 1997). Nusantara Selaginella has generally perennial herbs form (in north hemisphere there are also annual herbs). Stem is dichotomous branch with or without certain pattern (Wong 1982). Stele is generally protostele type, but there is also siphonostele or actino-plectostele. Stem is erect, creeping, climbing, or rosette root. Basal part is usually without branch. Rhizophore which is a sui generis organ emerges at ramification or basal rhizome (Jernstedt and Mansfield 1985; Jernstedt et al. 1994), which is combination of stem and root (Goebel 1905). Rhizophore is present or not, leafless, colorless, positively geotropic, elongated, growing downwards from point of bifurcation stem, emerges at ramification stem, entire or only at basal ramification stem. Rhizophores are unique to the Selaginella genus. Both rhizophores and roots have dichotomous branch, forming a multibranch rhizophore– root system (Otreba and Gola 2011). Leaf is small, single with single vein, and always has ligulae at base of adaxial leaf (only in the early leaf forming) (Valdespino 1993), some species of Central America have hair on the leaves (Caluff and Shelton 2009), as well as S. biformis of Java (Alston 1935a). In Nusantara, vegetative leaf is always dimorphic (isophyllous), and usually lap over in two median lane and two lateral lane; median leaf usually smaller and has different shape from lateral ones (Camus 1997), however the most outstanding Selaginella in northern hemisphere namely S. selaginoides is anisophyllous ones (Heidel and Handley 2006).

SETYAWAN â&#x20AC;&#x201C; Selaginella research in Nusantara

Strobili (set of sporophylls) does not always exist, it usually emerges at branch tip, is generally uncompact and open; cylindrical, longitudinal quadrangle, or flatten, with basal megasporangia and apical microsporangia. Sporophylls or reproductive leaf is rather or very different from vegetative leaf, and generally anisophyllous (S. rothertii), or isophyllous (S. plana) or resupinatanisophyllous (S. alutacia). It has two spore types (heterospore); microsporophyll has one microsporangium which contains hundreds of microspore; while megasporophyll has one megasporangium containing four megaspores. Microspore is much smaller than megaspore and usually has different color. Sporangium has short petiole, solitary, in sporophyll base, oval or circular, and opening across transversal aperture (Valdespino 1993; Tsai and Shieh 1994; Camus 1997). Megasporangia lays at lowest sporophyll of strobilus, but sometime lays at tip of strobilus, while microsporangia lays above megasporangia (Valdespino 1993). In different habitat, ornamentation of megaspore can harsher or softer (Cronquist et al. 1972). Schulz et al. (2010) chooses S. apoda as an appropriate model species to understand its morphology, anatomy, and life cycle in detail. Development and growth patterns indicate that each segment is an independent module consisting of a section of the stem, leaves, rhizophores, and roots. A comparison of different leaf types (dorsal and ventral leaves, dorsal and ventral sporophylls) shows similar stomata and papillae distributions but type-specific forms and sizes. In the transition from vegetative to reproductive growth, the small dorsal leaves do transition to small dorsal sporophylls bearing microsporangia, and the large ventral leaves do transition to large ventral sporophylls bearing either microsporangia or megasporangia. Selaginella has various pigmentations, such as blue chromatic, crimson red, variegate, yellow gold, and silver. Morphological diversity and pigmentation are important characteristic in taxonomy of Selaginella (Dahlen 1988; Czeladzinski 2003). Shape of stele (Hieronymus, 1901) and structure of sporangium (Horner and Arnott 1963; Fraile and Lap 1981; Quansah 1988) are also used as distinguishing characteristics. Single base megasporangium is used for grouping articulate species (Hieronymus, 1901; Somers, 1978), but the newest research indicates that it indicates no certain group (Korall and Kenrick 2002). Depth research on morphology, anatomy and life cycle of Nusantara Selaginella is necessary, as research of Schulz et al. (2010) in S. apoda.

115

dichotomous branching, and small dimorphic leaf begin to widespread and constitute of coal (Thomas 1992, 1997). Selaginella is generally abundant in forest floor; its dimorphism leaf is an adaptation to low light intensity (Hebant and Lee 1984). Some species can modify chloroplast to boost exploitation of sunshine by forming bizonoplast, such as S. erythropus (Sheue et al. 2007) or non-pigment optical structure of schemochromic tydallblue iridescent, such as S. willdenowii and S. uncinata (Fox and Wells, 1971; Hebant and Lee 1984; Lee 2001; Thomas 2010), and S. singalanensis (Setyawan 2009), which loose in open place (Hebant and Lee 1984). S. willdenowii also adapt to grow under shade, with ratio of chlorophyll a:b equal to 2,2 (Nasrulhaq and Duckett 1991). This adaptation increases in line with progressive dense of forest canopy through increasing tree fern high at Westphalian period (303-320 mya) (DiMichele et al. 1992). Morphological similarity of fossil and modern Selaginella indicate that some tropical species which live in wet area is possibility direct offspring of ancient species from Carboniferous period (Korall et al. 1999), but rbcL topology of tropical Selaginella is not paraphyletic or basal to species from dry area or sub-tropical climate (Koral and Kenrick 2002). Selaginella adaptability that can survive the environmental changes over millions of years need to be examined to determine the superior characteristics of plants. Morphological plasticity Species concept of Selaginella is hard to determine because of morphological plasticity of some species, resulting difference of edaphic and climatic factors, age, genotypes, etc. Sunshine intensity can cause difference morphological form and chemical content. Soil fertility and humidity can influence forming of root and rhizophores. Ground water content and individual age can also influence morphological appearance. At certain species, old individual or drough cause the color become darker than young ones or humid ones, such as S. plana (Lu and Jernstedt 1996). In one species, sometimes there are various shapes and shades of leaves, for example S. ornata, so that in the past this species was divided into several species (Setyawan 2009). This morphological variation causes difficulty in classification of Selaginella; and a challenge in systematics research, because until now the morpho-species concept is still a major cornerstone in plant systematics.

ECOLOGY MORPHOLOGICAL ADAPTATION AND PLASTICITY Morphological adaptation The earliest fossil of Selaginellaceae is Selaginellites resimus Rowe (Rowe 1988) coming from early Carboniferous period (440 mya) (Banks 2009); it is a uniform leaf herbs (isophyllous) and grows in tropical wet area (Fairon-Demaret 1989). In the late Carboniferous period (290-323 mya), Selaginella that has herb form,

Selaginella is a cosmopolitan genus and grows at various climate and soil types. Some species grow at very extreme climate such as cool alpine or artic circle (S. selaginoides, S. rupestris), and also barren and dry desert (S. lepidophyta, S. sartorii) (Tryon and Tryon 1982; Zoller 2005), but highest diversity is in tropical area. Selaginella grows in all Nusantara bioregions, because it has been existed before the breaking of the great continent of Gondwana. Some species are believed existing in tropical

116

B I O D I V E R S IT A S 12 (2): 112-124, April 2011

area since late Paleozoic (Korall and Kenrick 2002). Most of Selaginella grow under forest canopy and are protected from direct sunshine. It also found at forest floor, marsh, river bank, around waterfall, and water spring. Selaginella can grow at marginal soil which is lack of nutrient to lessen competition. This plant is rarely feed by herbivores because contains secondary metabolite that harsh most animals, except for several insect (Mound et al. 1994), wild pig, Sus barbatus (KĂźsters 2001) and snail. Livestock grazing and competitor plants that absorb much water can make environment drier which influence the growth of Selaginella (Heidel and Handley 2006). It can lessen the density of Selaginella, for example at S. densa (van Dyne and Vogel 1967). Since Selaginella is heterosporic fern, the microspore and megaspore must grow in adjacent site to generate microgametophyte and megagametophyte, then fertilizing to generate sporophyte. Selaginella megaspore is larger and heavier than other lycophytes, causing tighter distribution. Root system of gametophyte is very shallow and requires water for moving the sperm to egg cell, causing most Selaginella grows in moist place (Cronquist et al. 1972). S. lepidophylla can withstand in seasonally dry conditions, adapt to extremely arid climates and depend on infrequent wet periods for growth and reproduction (Cantrill and Webb 1998). Megagametophyte is long life autotrophic plant, which can conduct photosynthesis (Cronquist et al. 1972) and absorb nutrient without mycorrhiza (Heidel and Handley 2006), however mycorrhiza can be found in sporophyte (Strobel and Daisy 2003). Spreading mechanism of megaspore and microspore is conducive for cross-breeding, though it is rarely happened in Selaginella (Soltis and Soltis 1988). In cultivation, Selaginella is multiplied by dissociating mature corps, however it can also use spore (Carolina Biological Supply 1998). It needs moist and porous media, which enable water and air emitting (Heidel and Handley 2006). Nusantara Selaginella can exist and abundantly grow in moist, organically rich, and well drained soils, in shade or half shade, often near streams, a long trail and at the edge of clearing areas, in lowland and mid-montane primary or secondary forest (Winter and Jansen 2003). S. tamariscina is only plant grows in dry and rocky habitats found in Wallacea, i.e. the Philippines (Alston 1935b), Sulawesi and Lesser Sunda Islands, and may be also introduced by Chinese in West Kalimantan (ADS 2007-2008, personal observation to BO collections). In dry period, S. tamariscina rolls inwards and turns into ball, while S. plana turns to darker reddish brown. Study on Selaginella community in Nusantara species is rarely conducted, while this is generally conducted in northern hemisphere for S. selaginoides and S. rupestris (=S. sibirica), including abundance of spores in several paleo-environmental era. They are light-demanding and able to grow in poor soils and in extremely frost (dry and cool) environment. They are commonly found in steppe, open larch and pine forests, and even in grass shrub tundra with shrubby pine (Molozhnikov, 1986; Lozhkin et al. 1993; Baker et al. 2002). During the last glacial maximum (LGM), abundance of the spore indicates increasing open habitat (Tobolski and

Ammann 2000; Schirrmeister et al. 2002) and the vegetation is still fairly open and the soil is poorly developed (Heiri et al. 2003). It also suggests that the climate is colder and drier than today (Ikehara 2003), such as cold boreal and sub arctic conditions. According to the pollen spectra, the maximum warming is about 12,000 BP (Schirrmeister et al. 2002), that causes ice melting of LGM and then the climate becomes warm again (Ruddiman 2005). Selaginella spores can be used as bioindicator of paleoclimatic in ancient time, whereas the distribution in past and present time can be used for modeling future climate. In Nusantara, there is no research related to the global warming and the existing or losing of Selaginella.

MOLECULAR BIOLOGY Karyomorphology In the evolutionary history, fern perform several polyploidy and hybridization causing a large chromosome number (Walker 1984), but it is rarely happened in heterosporic fern such as Selaginella (Soltis and Soltis 1988; Marcon et al. 2005). Hybridization has been reported between S. ludoviciana and S. apoda in United States (Somers and Buck, 1975) and between S. firmula and S. laxa in Fiji (Gardner 1997). Moreover, Hassler and Swale (2002) indicated that only one from 691 species of world Selaginella is proven to be hybrids. Morphological karyotype of Selaginella is firstly published by Manton (1950). Chromosome number of Selaginella has been investigated on several species of Europe (Reese 1951; Love and Love 1961; Borgen 1975), North America (Tryon 1955; Love and Love 1961, 1976), India (Kuriachan 1963; Loyal 1976, 1984; Ghatak 1977; Vasudeva and Bir 1983), China (Wang et al. 1984; Weng and Qiu 1988), Taiwan (Tsai and Shieh 1983, 1988), Japan (Takamiya 1993), and other countries (Tchermak-Woes and DolezaI-Janish 1959; Zhukova and Petrovsky 1975). Jermy et al. (1967) made extensive investigation on chromosome numbers of 76 species of Selaginella collected from the Malay Peninsula, Borneo, New Guinea, Australia, Trinidad, Puerto Rico, and Brazil, as well as on cultivated plants. Those are the only karyomorphological investigation which include Nusantara Selaginella. In almost all other Nusantara bioregion, the study of chromosomal morphology of Selaginella has never been conducted. Selaginella has variation of diploid chromosome number, 2n = 14-60, with basic chromosome number is x = 7, 8, 9, 10, 11, and 12 (Kuriachan, 1963; Jermy et al. 1967; Takamiya 1993). This matter originate from x = 9, which later grouping with x = 10, 11, 12, and the other grouping with x = 7, 8 (Takamiya 1993; Mukhopadhyay 1998). Diploid chromosome number in each subgenus is possibility formed through different evolutionary pathway (Takamiya 1993). Variation of chromosome number and rDNA amount and size of Selaginella indicate that the chromosome evolution is very complicated, whereas each basic chromosome number emerge twice or more (Marcon et al. 2005).

SETYAWAN â&#x20AC;&#x201C; Selaginella research in Nusantara

Isozyme Research on diversity of Selaginella base on isozymic marker for population dynamics or classification is rarely conducted. Several studies are generally related to physiological characteristic. Selaginella is known to have two isozymic bands of chorismate mutase able to be measured clearly. This isozyme and other isozymic shikimate have potent as diagnostic characteristic (Woodin et al. 1978). Preliminary study indicate that enzyme system of esterase (EST), peroxidase (PER, PRX), malate dehydrogenase (MDH), aspartate aminotransferase (AAT), and acid phosphatase (ACP) can be used as diagnostic characteristic for more than 20 species of Nusantara Selaginella (ADS 2008, data not be shown). DNA marker Research on diversity of Selaginella based on DNA/RNA marker is relatively still limited. Kolukisanoglu et al. (1995) indicate that Selaginella and Equisetum emerge earlier than Psilotum based on phytochrome gene. This result corresponds to chloroplast gene (Raubeson and Jansen 1992); and supported by ribulose-bisphosphate carboxylase gene (rbcL) (Korall et al. 1999; Korall and Kenrick 2002). Korall and Kenrick (2002, 2004) prove that subgenera Selaginella and Tetragonostachys are monophyletic, Stachygynandrum and Heterostachys are polyphyletic; while the nature of Ericetorum is still unknown yet. This research is relied on chloroplast gene of rbcL from 62 species (ď&#x201A;ą 10%), which selected by morphological, ecological and geographical diversity. Besides those above, monophyletic of Tetragonostachys is also proved by nuclear internal transcribed spacer (nr ITS) (Therrien et al. 1999; Therrien and Haufler 2000). Research by Korall and Kenrick (2002) with rbcL sequence indicates that classification by using DNA marker is not always compatible to morphological characteristic. Some classification can be referred by morphological characteristic, such as existence of rhizophores, growth of rhizophores, and morphology of leaf and stem. Some other can be referred by ecological characteristic such as wet or dry habitat. But the most classification is not related to morphological, ecological, and physiological characteristics. Research on amplified fragment length polymorphism (AFLP) of 10 species of Nusantara Selaginella indicated that high polymorphic variation among species (Setyawan 2008b). In addition, Li et al. (2007) indicate that random amplification of polymorphic DNA (RAPD) can be used as marker to differentiate Selaginella both species and population from different habitats. Investigation of Selaginella diversity base on another DNA marker has not apparently been done.

NATURAL PRODUCTS Biflavonoid Major secondary metabolite of Selaginella is biflavonoid, which only found at Selaginellales, Psilotales, Gymnosperm (Seigler 1998), several Bryophytes and several Angiosperm (DNP 1992). Selaginella also contains

117

alkaloid, phenolic (flavonoid, tannin, saponin), dan terpenoid (triterpene, steroid) (Chikmawati and Miftahudin, 2008; Chikmawati et al. 2008). S. lepidophylla is also reported contains volatile oils (Andrade-Cetto and Heinrich 2005); and some species of Japan have ekdisteroid (Takemoto et al. 1967; Hikino et al. 1973; Yen et al. 1974). The different species of Selaginella shows different HPLC fingerprint characteristic. The samples of the similar species but collected in different period, different environment or different locations shows certain difference in fingerprints. However, it also generate "main fingerprint peaks", which can be used to evaluate and distinguish the different species or infra species (Li et al. 2007). Biflavonoid which has been identified from Selaginella is only 13 compounds and/or its derivatives, namely amentoflavone, 2',8''-biapigenin, delicatulaflavone, ginkgetin, heveaflavone, hinokiflavone, isocryptomerine, kayaflavone, ochnaflavone, podocarpusflavone A, robustaflavone, sumaflavone, and taiwaniaflavone (Setyawan and Darusman 2008; Setyawan 2011). Some biflavonoid are easily found at various species of Selaginella, but the other only found at certain species. Amentoflavone is biflavonoid compound of several Selaginella, while sumaflavone is only reported from S. tamariscina (Yang et al. 2006; Lee et al. 2008). Preliminary study shows that amentoflavone is found at high content (> 20%) at two of about 35 species of Nusantara Selaginella, namely S. subalpina and S. involvens (ADS 2008, data not be shown). Biflavonoid of Selaginella has various bioactivities, such as antioxidant, anti-inflammatory, anti cancer, antimicrobials (antivirus, antibacterial, anti fungi, antiprotozoan), neuroprotective, vasorelaxant, anti UVirradiation, antispasmodic, anti allergy, antihaemorrhagic, antinociceptive, etc. Amentoflavone, the commonest biflavonoid of Selaginella has bioactivity as antioxidant, anti-inflammatory, anti cancer, antimicrobials, antivirus, vasorelaxant, anti stomachic, anti depression, anxiolityc, and analgesic. Additional group of hydroxylation, methoxylation, methylation, and glycosilation very influence the bioactivity properties (Setyawan and Latifah 2008). The widely use of Selaginella in complementary and alternative medicine is usually conducted in traditional Chinese medicine (TCM). S. tamariscina is the most used species in TCM, which supported by high variety of biflavonoid, include amentoflavone, hinokiflavone, 2',8''biapigenin, isocryptomerine, sumaflavone, and taiwaniaflavone. S. tamariscina extract has various usefulness, such as anti cancer, antioxidant, antiinflammatory, antifungal, anti UV irradiation, anti allergy, vasorelaxant, anti diabetic, and influence reproduction cycle (Setyawan and Latifah 2008). In the present days, study of Selaginella biflavonoid and other natural products are still limited to certain species, biflavonoid type, and solvent type. Trehalose S. lepidophylla often mentioned as resurrection plant or rose of Jericho able to survive on long drought and recover

118

B I O D I V E R S IT A S 12 (2): 112-124, April 2011

through rehydration (Crowe et al. 1992), even almost all of body water has been evaporated (van Dijck et al. 2002). Several Selaginella have high rate of trehalose, a simple sugar, which is responsibility to endurance of heat stress and drought (Avigad 1982), such as S. lepidophylla (Adams et al. 1990; Mueller et al. 1995; Zentella et al. 1995) and S. sartorii (Iturriaga et al. 2000). Drought can change pigmentation and fluorescence, but generally can not cause dying (Casper et al. 1993). Trehalose is potent for molecular stabilizer (Roser 1991; Kidd and Devorak 1994). Secondary metabolite content can vary depend on environmental factors such as habitat location, climate, and soil type; harvesting and extraction procedure (Nahrstedt and Butterweck 1997); and also intrinsic factor such as species or variety, part of extracted and age (Setyawan and Latifah 2008). Research on trehalose constituent of Nusantara Selaginella species has never been done; considering the high potential as bio-stabilizer in the industry, this research is urgently needed. In general, species that contain trehalose will roll up its leaves in dry conditions. S. involvens and S. tamariscina estimated to contain this compound.

ETHNOBOTANY One of the primary factors influencing biodiversity is human culture. Relation of human with plant known as ethnobotany, while if related to market known as economic botany. Ethnobotany means the study of traditional plant use, or the scientific study of the traditional classification and uses of plants in different human societies (Harshberger 1896). Exploration of plant which has medicinal or food usage is the most interesting ethnobotanical study, because this matter becomes the basis for modern development. Since Nusantara has very high variation of culture and plants species, it has various exploitation types, including traditional medicine (jamu) and culinary (Setyawan 2009). In Southeast Asia, Selaginella is generally used as medicine, food, ornaments, and handicrafts (Winter and Jansen 2003). Most Selaginella species have not been used as medicinal plants or other purposes of economic potent, and there are at least 10 species that have been used with varying intensity. S. involvens, S. ornata, S. willdenowii, and S. plana are used as medicinal ingredients. S. ciliaris, S. singalanensis, and Selaginella sp.1 are used as an ornamental plant. S. opaca, S. plana and S. wildenowii are used as a vegetable. S. caudata and Selaginella sp.4 are used as a wrapping of fruits and vegetables from the garden (Setyawan 2009). Medicinal usage Selaginella is traditionally used to cure several diseases such as: wound, postpartum, menstrual disorder, skin disease, headache, fever, infection of exhalation channel, infection of urethra, cirrhosis, cancer, rheumatism, bone fracture, etc. Part to be used is entire plant, though it only refers to leaf or herb (Setyawan and Darusman 2008; Setyawan 2009). The usage can be conducted single or

combination, fresh or dried, direct eaten or boiled (Dalimartha 1999; Wijayakusuma 2004). This plant has sweet taste and gives warm effect on the body (Bensky et al. 2004). The use of Selaginella as medicinal matter is occurred in the entire world. The largest usage is conducted by Chinese, especially for S. tamariscina, S. doederleinii, S. moellendorffii, S. uncinata, and S. involvens (Chang et al. 2000; Lin et al. 1991; Wang and Wang 2001). Selaginella is rarely exploited in Nusantara. Traditional jamu of Java, the most advanced traditional medication system in Nusantara, uses more cultivated rhizomes and spices than wild herbs or grasses. In Kalimantan, Dayaks of Kayan Mentarang NP, East Kalimantan use S. plana to cure hemorrhage (Uluk et al. 2001), while Dayaks of Bukit Baka-Bukit Raya NP, West Kalimantan use S. magnifica and some other Selaginella to cure headache, fewer, and skin diseases (Caniago and Siebert 1998). In Sabah, Dayaks use S. argentea and S. plana to treat high fever and headache (Ahmad and Raji 1992). In northern Borneo, dry leaves of S. padangensis is smoked like tobacco and is also used as poultice for vertigo and for toothache treatment (Winter and Jansen 2003). In West Java, Sundanese at Mount Halimun-Salak NP, West Java use several S. ornata, S. wildenowii, S. involvens, and S. intermedia to cure wound, postpartum, menstrual disorder, and tonic (Nasution, 1993; Harada et al. 2002; Setyawan and Darusman 2008). S. plana leaves is drunk in decoction as tonic for treatment postpartum (Harada et al. 2002). S. intermedia is given in decoction for stomach-ache and is applied as poultice over the whole body for asthma. In Java, young leaves of S. ornata and S. wildenowii are eaten as vegetable and also as depurative or stomachic. S. wildenowii is also used in decoction as a protective medicine postpartum and as an ingredient of tonic as well as to treat skin disease such as itches and ringworm (Winter and Jansen 2003). In Sumatra and Java, several species of Selaginella is used to neutralize poison, fever, purify the blood, menstrual disorder, eczema and postpartum (Warintek 2002). In Sumatra, Kalimantan, and Malaya, S. padangensis is used as poultice for vertigo and for toothache treatment (Winter and Jansen 2003). In Sumatra and Malaya, S. stipulate is used in decoction as protective medicines postpartum. In Sumatra, Malaya, and southern Thailand, S. wallichii is used in decoction as protective medicines postpartum. In Malaya, S. wildenowii is also given internally as an infusion to treat fever and the ashes is used in liniment for backache (Winter and Jansen 2003). In Kedah, Malaya, Selaginella is used as tonic to increase body endurance (Abu-Shamah et al. 2000; Batugal et al. 2004). In the Philippines S. tamariscina is used to cure wound, hemorrhage resulting stomachic, menstrual disorder, or pile (Pam 2008). In Papua New Guinea, S. flabellate is treated to fever and headache (Kambuou 1996). In mainland of Southeast Asia, S. doederleinii is used to cure various disease and supplementary food, while in Laos S. delicatula is used for sedative (ARCBC 2004).

SETYAWAN â&#x20AC;&#x201C; Selaginella research in Nusantara

Food source In Nusantara, the usage of Selaginella for food is very limited, but there are noted that young leaves of S. plana can be eaten as raw dishes (Heyne 1927), especially by Sundanese in West Java. While bitter young leaves of S. willdenowii is eaten by Javanese within food for medicinal purposes (Ochse 1931). In West Java, S. plana is sometimes eaten as dishes from lowland Bogor till around Mount Halimun-Salak, while in the mountainous areas they also eat S. wildenowii (Setyawan 2009). In the Philippines, young leaf of S. tamariscina can be cooked for vegetable (PAM 2008). In Papua, several Selaginella which have the wide leaf is sometimes used to pack sago, fruits, or other crop from forest (Setyawan 2009). Ornamentals and other usages In West Java, S. ornata and S. intermedia is used as ornamental plant in moist and shaded area (Sastrapradja el al. 1979). In India, S. rupestris is used as a decorative crop (Khare, 2007). In Taiwan, aboriginal Taiwan use S. involvens as ornamental plant, while S. delicatula as medicines (EDTA 2009). In Japan, S. involvens, S. tamariscina and S. uncinata is cultivated in garden (Michishita et al 2004). In Western countries, some species of Selaginella is very famous as ornamental plant, particularly as below ground vegetation, although it is potent to be invasive, such as S. erythropus, S. kraussiana (many varieties), S. moellendorfii, S. uncinata, S. plana, etc (Blooming Nursery 2009; Casa Flora 2009; Germania Seed Company 2009). The usage of Selaginella for traditional ceremony or rituals is not recorded in Nusantara, while in Gabon, S. myosurus is used for the sake of ritual or cultural (Sassen and Wan 2006).

THREAT AND CONSERVATION Major threat to sustainability of Selaginella is habitat conversion and fragmentation. Habitat conversion can cause the totally loss of Selaginella due to microclimatic changes, as a result of water way changes, road-works, husbandry, fire-burning, deforestation, and development of recreation area (Heidel and Handley 2006). Habitat fragmentation can induce inbreeding depression that degrading offspring endurance (Barrington 1993), which observed at fragmented spots of S. selaginoides communities. However, global warming is the recent threat that can change diversity and sustainability of organism in the longer time period. It might change macro- and microclimatic of an area that impact to plant distribution, migration and extinction, and even invasiveness. Selaginella grow at various climatic and soil types, but generally require humidity for better growing and need water for fertilization; its presence in an area becomes indicator of habitat condition, including global warming and global cooling. Several species of Selaginella growing in new habitat, evermore tend to be invasive. Nowadays, S. plana that originally from West Nusantara is naturalized in almost entire tropical Asia and America. S. lepidophylla of

119

Mexican desert grow in Arabia and exploit for traditional drug (Ambrosiani and Robertsson 1992; Al-Wahaibi 2004). S. martensii that imported as ornamental crop has potent to be invasive in Victoria, Australia (Blood 2003). S. biformis, S. moellendorfii and S. uncinata is recognized as alien species to be established in Japan or found in the Japanese wild (Mito and Uesugi 2004). Global warming has been caused S. kraussiana of mountainous African and subtropical Azores (van Leeuwen et al. 2005) to be invasive in several sub-tropical areas, even can also be found in montane zone of Mount Kilimanjaro, Tanzania which initially too cool for the growth (Hemp 2008). S. kraussiana that introduced for ornamental crop become invasive in the British Islands (Stokes et al. 2006), the United States (Stapes et al. 2004), Australia (Carr et al. 1992; Groves 2003), and New Zealand (Bannister 1984; Esler 1988; Timmins and Braithwaite 2002; West 2002). This species becomes serious weeds in New Zealand, though sensitive to intense sunshine and drought (Thetford et al. 2006). S. kraussianaâ&#x20AC;&#x2122;s ability in adapting new environment is possibly caused by diversity of the chromosomal number, i.e. 2n = 20, 30, 40 (Love et al. 1977; Kenton et al. 1993; Obermayer et al. 2002). Although, S. kraussiana which is potential to be invasive in new habitat, is still continuously sold in several Western countries (Blooming Nursery 2009; Casa Flora 2009; Germania Seed Company 2009). In Nusantara, invasion of non native Selaginella is not reported yet, though it is possibly occurred due to the introduction of new species for gardening and medicinal purposes. Several species of Selaginella can be used as bioindicator of environmental changes. It usually grows in wet and humid or moist areas such as riparian vegetation of water spring and tributaries, wet escarpment at road side, below ground vegetation in mountainous forest, etc; however, some species can grow in hot and dry areas. Since S. selaginoides is a typical plant for cold area, the presence and abundance of it on ancient time indicates the occurrence of global cooling, while tree vegetations decrease, and cooler and barer areas increase (Heusser and Peteet 1988; Baker et al. 1989; Garry et al. 1990; Ambrosiani and Robertsson 1992; Demske et al. 2002). Microspore fossil of S. selaginoides can be identified until species level without significant difference with modern species, which still have facultative tetrads spores (Tryon and Lugardon 1991). In northern hemisphere, the abundance of this species is continuously high between 10,000 and 47,000 BP, and it decreases after LGM caused by global warming that initiate a habitat fragmentation and degradation (Heusser and Igarashi 1994). S. selaginoides fossil in peat bog and lake sediment can be used as an indicator of historical climate changes in those areas (Heusser and Peteet 1988). The losing of S. selaginoides indicates the occurrence of global warming, because it needs cool areas for growing. Nowadays, global warming has been insisted S. selaginoides to high mountain and/or high longitude (toward polar circle); and remains in relic habitat (Hornbeck et al. 2003). Some of the best evidence for global climate change has come from biogeography and community ecology, which make document of shifts of

120

B I O D I V E R S IT A S 12 (2): 112-124, April 2011

species composition and geographical ranges through time. In general, particular ecological communities are expected to move upward in both elevation and latitude (Walther et al. 2002). As with other species, montane and higherlatitude populations are mostly at risk (Root et al. 2003). Concerning with Selaginella conservation, it is not always similar in every Nusantara countries. In Indonesia, there is no protected species of Selaginella (Lampiran PP RI No. 7/1999), though field survey shows several species that formerly found in Java and has become the collection of Herbarium Bogoriense (BO). Nowadays, it is difficult to find that species again in nature (Setyawan 2009). In Philippines, S. atimonanensis and S. pricei are categorized as endangered, while S. magnifica and S. tamariscina are categorized as vulnerable (DERN RP 2003); these four species are protected, though the last species is common in China and is sold as medicinal plant. In India, S. adunca, S. cataractum, and S. coonoriana is listed as threatened (RDBIP 2008). In Equador, S. carinata is categorized as vulnerable, while S. sericea is categorized as near threatened (IUCN 2009). In several states of the USA, S. selaginoides, S. rupestris, S. apoda, S. eclipse, S. watsonii are listed as threatened and endangered species, but those are not protected by federal legislature (FWS 2009). In Greenland, S. rupestris is also categorized as vulnerable (Jensen and Christensen 2003); while in Nova Scotia it is listed as endangered (Keddy 1978). In Sri Lanka, several Selaginella is listed as threatened species of vascular plants, namely S. calostachya, S. cochleata, S. praetermissa, and S. wightii (Ganashan et al. 1996). In Japan, S. involvens is listed as vulnerable by Chiba City (Nakamura and Short 2001). The inventory of Nusantara Selaginella is urgently needed for the high habitat destruction and the threat of global warming; in future, it can be used to arrange conservation measures.

genetic (protein, DNA) evidences are not always congruent; phenotype is controlled by many genotypes, and genotypic change is not always directly expressed in phenotype. Other challenge in taxonomy of Selaginella is high morphological plasticity caused by climate, soil, biogeographic factors, as well as age and variety of species. This matter causes the importance of genetic research to find out the existence of Selaginella diversity more detail. Genetic diversity is needed for further cultivation or breeding improvement. It is also necessary to answer the question how Selaginella adapt to environmental changes, and survive for millions of years. Taxonomy of Selaginella can also be strengthened using variability of natural product (secondary metabolite). Selaginella has varied pigmentation depends on environmental and intrinsic factors, which especially reflects diversity of natural products. Main secondary metabolite of Selaginella is biflavonoid, which is expected to be able to give contribution to taxonomy (chemotaxonomy). This study can also become scientific base to traditional usage of Selaginella as traditional medicine and its development as modern drug.

CONCLUSION Nusantara Selaginella has a very high diversity and is prospective natural resources, but research on this species is very limited. A large number of species believed to still deposite in nature, waiting to be discovered. To preserve and reveal the efficiency of this plant, it is necessary to do thorough biosystematics research, accompanied by profound ethnobotany (ethnopharmacology) research. By showing the obvious economic benefits, it is expected to meet the conservation demands to maintain the sustainability of this biological resource.

SYSTEMATIC PROBLEMS OF SELAGINELLA ACKNOWLEDGEMENTS Since Nusantara is formed from two continental plates bringing different diversity, and tends to insulate and adapts to islands habitat, the diversity and endemicity is very high. This matter is challenge to specify taxonomic concept of species and genus. One of main problems in biosystematics study of Selaginella is the importance of more coherent definition to morphological species concept (morpho-species). Some Selaginella have very high morphological diversity such as shape-form, size-measure and pigmentation that complicate the classification. This matter is related to intrinsic factor such as age/maturity and genetics and also environmental factors such as climate and soil condition. In Nusantara, taxonomy of Selaginella is generally base on old reference compiled in first-half of 20th century, which require revising because of the possibility of finding new species, introducing alien species, changing species concept, etc. Originally, taxonomy of Selaginella is relied on morphological characteristic of herbaria that used for identifying, nomenclaturing, and classifying. However, it has limitation because evolution rate of morphological and

The author would like to thank Prof. Wong Koon Meng (Malaya University) and Dr. Tatik Chikmawati (Bogor Agricultural University) for valuable discussion and suggestions on the early manuscripts. Grateful thank also to Herbarium Bogoriense (BO) which permitted to observe the collection, and SEAMEO-BIOTROP Bogor which promote publication of this manuscript, and also thank to anonymous reviewer for valuable comments and suggestions.

REFERENCES Abu-Shamah Z, Faridz ZF, Rizal MK, Fadhilah ZW, Abdullah I (2000) Ethnobotanical study in Kuala Nerang, Kedah. In: Chang YS, Mohtar M, Bramaniam V, Abu-Samah Z (eds) Towards bridging science and herbal industry; Proceedings of the Seminar on Medicinal and Aromatic Plants. Forest Research Institute Malaysia, Kepong, Kuala Lumpur, 12-13 September 2000 Adams RP, Kendall E, Kartha KK (1990) Comparison of free sugars in growing and desiccated plants of Selaginella lepidophylla. Biochem Sys Ecol 18: 107-110

SETYAWAN – Selaginella research in Nusantara Ahmad F bin, Raji H (1992) Medicinal Plants of the Murut Community in Sabah. In: Ghazzaly I, Siraj O, Murtedza M (eds) Forest biology and conservation in Borneo. Centre for Borneo Studies, Kota Kinabalu Alderwereld van Rosenburgh CRWK van (1915a) Malayan Fern Allies. Department of Agriculture, Industry and Commerce, Batavia Alderwereld van Rosenburgh CRWK van (1915b) New or interesting Malay ferns 7. Bull Jard Bot Buitenzorg 2 (20): 1-28 Alderwereld van Rosenburgh CRWK van (1916) New or interesting Malay ferns 8. Bull Jard Bot Buitenzorg 2 (23): 1-27. Alderwereld van Rosenburgh CRWK van (1917) New or interesting Malay ferns 9. Bull Jard Bot Buitenzorg 2 (24): 1-8 Alderwereld van Rosenburgh CRWK van (1918) New or interesting Malay ferns 10. Bull Jard Bot Buitenzorg 2 (28): 1-66 Alderwereld van Rosenburgh CRWK van (1920) New or interesting Malay ferns 11. Bull Jard Bot Buitenzorg 3 (2): 129-186 Alderwereld van Rosenburgh CRWK van (1922) New or interesting Malay ferns 12. Bull Jard Bot Buitenzorg 3 (5): 179-240 Alston AHG (1934) The genus Selaginella in the Malay Peninsula. Gard Bull Strait Settl 8: 41-62 Alston AHG (1935a) The Selaginella of the Malay Islands: I. Java and the Lesser Sunda Islands. Bull Jard Bot Buitenzorg 3 (13): 432-442 Alston AHG (1935b) The Philippines species of Selaginella. Philip J Sci 58: 359-383 Alston AHG (1937) The Selaginella of the Malay Islands: II. Sumatra. Bull Jard Bot Buitenzorg 3 (14): 175-186 Alston AHG (1940) The Selaginella of the Malay Islands: III. Celebes and the Moluccas. Bull Jard Bot Buitenzorg 3 (16): 343-350 Al-Wahaibi M bin H (2004) Saudi Arabia J Biological Science 11 (2): 1123 Ambrosiani KG, Robertsson A (1992) Early Weichselian interstadial sediments at Härnösand, Sweden. Boreas 21: 305-317 Andrade-Cetto A and Heinrich M (2005) Mexican plants with hypoglycaemic effect used in the treatment of diabetes. J Ethnopharmacol 99: 325-348 ARCBC (2004) Checklist of medicinal plants in Southeast Asia. ASEAN Regional Centre for Biodiversity Conservation, Manila www.aseanbiodiversity.org/medicinal_plants/page7.htm Avigad G (1982) Sucrose and other disaccharides. In: Loewus FA, Tanner W (eds) Encyclopedia of plant physiology. Springer, New York Baker RG, Bettis EA III, Denniston RF, Gonzalez LA, Strickland LE, Krieg JR (2002) Holocene paleoenvironments in southeastern Minnesota chasing the prairie-forest ecotone. Palaeogeog Palaeoclim Palaeoecol 177: 103-122 Baker RG, Sullivan AE, Hallberg GR, Horton DG (1989) Vegetational changes in western Illinois during the onset of late Wisconsinan glaciations. Ecology 70 (5): 1363-1376 Banks, J. (2009). Selaginella and 400 million years of separation. Ann Rev Pl Biol 60: 223-238. Bannister P (1984) The seasonal course of frost resistance in some New Zealand pteridophytes. N Z J Bot 22: 557-563 Barrington DS (1993) Ecological and historical factors in fern biogeography. J Biogeography 20: 275-280 Batugal, PA, Kanniah J, Young LS, Oliver JT (eds) (2004) Medicinal plants research in Asia, Vol 1: The framework and project workplans. International Plant Genetic Resources Institute-Regional Office for Asia, the Pacific and Oceania (IPGRI-APO). Serdang, Selangor DE, Malaysia Bensky D, Clavey S, Stöger E (2004) Chinese herbal medicine-materia medica, 3rd ed. Eastland Press, Seattle, W.A Bergen AW, Wang C-Y, Tsai J, Jefferson K, Dey C, Smith KD, Park S-C, Tsai S-J, Goldman D(1999) An Asian-Native American paternal lineage identified by RPS4Y resequencing and by microsatellite haplotyping. Ann Hum Genet 63:63-80 Blood K (2003) Weed Report: Melbourne International Flower and Garden Show 2003; 2-6 April 2003, Royal Exhibition Building and Carlton Gardens, Melbourne. Weedscene 14 (3): 3 Blooming Nursery (2009) Takes light foot traffic. Blooming Nursery, Inc. Ph: 503.357.2904 Fax: 503.357.2932 Email: sales@bloomingnursery.com Borgen L (1975) Chromosome numbers of vascular plants from Macaronesia. Norw J Bot 22: 71-76 Brown GK, Nelson G, Ladiges PY (2006) Historical biogeography of Rhododendron section Vireya and the Malesian. J Biogeography 33: 1929-1944

121

Caluff MG, Shelton G (2009) Review of hairy species of Selaginella (Selaginellaceae) of the West Indies, with description of two new species from Cuba. Willdenowia 39 (1): 107-119. Camus JM (1997) The genus Selaginella (Selaginellaceae) in Malesia. In: Dransfield J (ed.). Plant Diversity of Malesia III: 59-69 Caniago I and Siebert SF (1998) Medicinal plant ecology, knowledge and conservation in Kalimantan, Indonesia. Econ Bot 52 (3): 229-250 Cantrill DJ, Webb JA (1998) Permineralized pleuromeid lycopsid remains from the Early Triassic Arcadia Formation, Queensland, Australia. Rev Palaeobot Palynol 102: 189-211 Carolina Biological Supply (1998) Information on living organisms: Selaginella. www2.carolina.com Carr GW, Yugovic JV, Robinson KE (1992) Environmental weed invasions in Victoria: conservation and management implications. 1st ed. Department of Conservation & Environment, Melbourne Casa Flora (2009) Casa Flora availability as of 3/16/2009. Casa Flora, Inc. Texas & Florida, USA Casper C, Eickmeier WG, Osmond CB (1993) Changes of fluorescence and xanthophyll pigments during dehydration in the resurrection plant Selaginella lepidophylla in low and medium light intensities. Oecol 94: 528-533 Chang C-Y, Chen X-D, Xiao X-Y, Lin R-C (2000) Studies on micromorphology and its significance in anatomy and identification of Selaginella. J Med Anal 20 (2): 75-78 Chikmawati T, Miftahudin. 2008. Biodiversitas dan potensi marga Selaginella sebagai anti oksidan dan anti kangker. LPPM IPB, Bogor. Chikmawati T, Setyawan AD, Miftahudin. 2008. Kandungan fitokimia ekstrak tumbuhan Selaginella di pulau Jawa. Seminar dan Konggres PTTI ke-VIII. Cibinong Science Center, Bogor-Indonesia, 21-23 October 2008 CIA [Central Intelegence Agency] (2009) CIA-The World Factbook. www.cia.gov/library/publications/the-world-factbook/geos/pp.html [Jul-21-2009]. Cronquist A, Holmgren AH, Holmgren NH, Reveal JL, Holmgren PK (1972) The vascular Cryptogams and the Gymnosperms. Intermountain flora: vascular plants of the intermountain West, USA. Volume 1. Geological and botanical history of the region, its plant geography and a glossary. New York Botanical Garden, New York Crowe JF, Hoekstra FA, Crowe LM (1992) Anhydrobiosis. Ann Rev Physiol 54: 579-599 Czeladzinski S (2003) Selaginella at the Barbican. Pl Heritage 10 (2): 472-476 Dahlen MA (1988) Taxonomy of Selaginella: a study of characters, techniques, and classification in the Hong Kong species. Bot J Linn Soc 98 (4): 277-302 Dalimartha S (1999) Atlas tumbuhan obat Indonesia. Yogyakarta: Trubus Agriwidya Demske D, Mohr B, Oberhansli H (2002) Late Pliocene vegetation and climate of the Lake Baikal region, southern East Siberia, reconstructed from palynological data. Palaeogeog Palaeoclim Palaeoecol 184: 107-129 DENR RP (2003) Establishing the national list of threatened Philippine plants and their categories, and the list of other wildlife species. Department of Environment and Natural Resources, Republic of the Philippines, Quezon City, Manila DiMichele WA, Hook RW, Beerbower R, Boy JA, Gastaldo RA, Hotton N III, Phillips TM, Scheckler SE, Shear WA, Sues H-D (1992) Paleozoic terrestrial ecosystems. In: Behrensmeyer AK, Damuth JD, DiMichele WA, Potts R, Sues H-D, Wing SL (eds) Terrestrial ecosystems through time: evolutionary paleoecology of terrestrial plants and animals. University of Chicago Press, Chicago DNP (1992) Dictionary of natural products. Chapman and Hall, New York EDTA (2009). Ethnobotanical Data of Taiwan Aborigines. NTU. Taipei. Esler AE (1988) The naturalisation of plants in urban Auckland, New Zealand: 6. alien plants as weeds. N Z J Bot 26: 585-618 Fairon-Demaret M (1989) Selaginellites resimus Rowe, une Lycophyte herbacee du viseen (Warnantien) de Vise. Ann Soc Geol Belg 112 (1): 57-60 Fan X-L, Wan D-R, Ye C-J, Chen K-L (2007) Study on HPLC fingerprint characteristics of Selaginella plants. Zhongguo Zhong Yao Za Zhi. 32 (20):2102-2106 Farnsworth NR (1994) Ethnobotany and the search for new drugs. John Wiley and Sons, New York Fox DL, Wells JR (1971) Schemochromic blue leaf-surfaces of Selaginella. Amer Fern J 61 (3): 137-139

122

B I O D I V E R S IT A S 12 (2): 112-124, April 2011

Fraile E, Riba R (1981) Distribucion esporangial en estrobilos de especies de Selaginella. Bol Soc Bot Méx 41: 33-40 FWS (2009) Threatened and endangered species (TESS) http://www.fws.gov/endangered/bulletin.html Ganashan P, Balendira S, Dassanayake MD (1996) Sri Langka: Country report. FAO International Technical Conference on Plant Genetic Resources, Leipzig, Germany, 17-23 June 1996 Gardner RO (1997) A concise account of Selaginella in Fiji. N Z J Bot 35: 269-281 Garry CE, Schwert DP, Baker RG, Kemmis TJ, Horton DG, Sullivan AE (1990) Plant and insect remains from the Wisconsinan interstadial/stadial transition at Wedron, north-central Illinois. Quat Res 33: 387-399 Germania Seed Company (2009) Hardy and tropical ferns. Germania Seed Company. Dallas, TX. Ghatak J (1977) Biosystematic survey of pteridophytes from Shevaroy hills, south India. Nucleus 20: 105-108 Goebel K (1905) Morphologische und biologische bermerkungen. 16. die knollen der dioscoreen und die wurzelträger der selaginellen, organe, welche zwischen wurzeln und sprossen stehen. Flora 95: 167- 212 Groves RH, Hosking JR, Batianoff GN, Cooke DA, Cowie ID, Johnson RW, Keighery GJ, Lepschi BJ, Mitchell AA, Moerkerk M, Randall RP, Rozefelds AC, Walsh NG, Waterhouse BM (2003) Weed categories for natural and agricultural ecosystem management. Bureau of Rural Sciences, Canberra, Australia Harada K, Rahayu M, Muzakkir A (2002) Medicinal plants of Gunung Halimun National Park, West Java, Indonesia. Biodiversity Conservation Project JICA, PHPA & LIPI, Bogor Harshberger JW (1896) The purpose of ethnobotany. Bot Gaz 21: 146158. Harvey A (2000) Strategies for discovering drugs from previously unexplored natural products. Drug Discov Today 5 (7): 294-300 Hassler M, Swale B (2002) Checklist of world ferns on CDROM. http://homepages.caverock.net.nz; bj@caverock.net.nz Hébant C, Lee DW (1984) Ultrastructural basis and developmental control of blue iridescence in Selaginella leaves. Amer J Bot 71: 216-219 Heidel B, Handley J (2006) Selaginella selaginoides (L.) Beauv. ex Mart. & Schrank (club spikemoss): a technical conservation assessment. USDA Forest Service, Rocky Mountain Region Heiri O, Wick L, van der Knaap JFN van LWO, Lotter AF 2003) Holocene tree immigration and the chironomid fauna of a small Swiss subalpine lake (Hinterburgsee, 1515 m asl). Palaeogeog Palaeoclim Palaeoecol 189: 35-53 Hemp A (2008) Introduced plants on Kilimanjaro: tourism and its impact. Pl Ecol. 197 (1): 17-29. Heusser CJ, Igarashi Y (1994) Quaternary migration pattern of Selaginella selaginoides in the North Pacific. Arctic Alpine Res 26: 187-192 Heusser CJ, Peteet DM (1988) Spores of Lycopodium and Selaginella of North Pacific America. Can J Bot 66: 508-525 Heyne K (1927) De Nuttige planten van Nederlands-Indie. 2nd ed. Vol. 1. Departement van Landbouw, Nijverheid en Handed in NederlandsIndie, ‘s-Gravenhage Hieronymus G (1901) Selaginellaceae. In: Engler A, Prantl K (eds) Die naturlichen pflanzenfamilien, vol. 1, part. 4. W. Engelmann, Leipzig Hikino H, Okuyama T, Jin H, Takemoto T (1973) Screening of Japanese ferns for phytoecdysones. I. Chem Pharm Bull 21: 2292-2302 Hornbeck JH, Reyher DJ, Sieg C, Crook RW (2003) Conservation assessment for groundcedar and stiff clubmoss in the Black Hills National Forest, South Dakota and Wyoming. USDA Forest Service, Black Hills National Forest Horner HTJ, Arnott HJ (1963) Sporangial arrangement in North American species of Selaginella. Bot Gaz (Crawfordsville) 124: 371-383. Hsieh Y-S (2006) The study of Chinese medicinal herbs inhibits cancer cell migration/invasion. A collective of abstracts in Chinese and English version from the achievement reports of TCM research program 2005; research and development achievement series (3). Committee on Chinese Medicine and Pharmacy, Department of Health, PRC, Beijing Ikehara K (2003) Late Quaternary seasonal sea-ice history of the northeastern Japan Sea. J Oceanography 59: 585-593 Iturriaga G, Gaff DF, Zentella R (2000) New desiccation-tolerant plants, including a grass, in the central highlands of Mexico, accumulate trehalose. Aust J Bot 48: 153-158 IUCN (2009) IUCN red list of threatened species. Version 2009.1. www.iucnredlist.org. (August 15, 2009)

Jensen DB, Christensen KD (eds) (2003) The biodiversity of Greenland a country study. Technical Report No. 55, December 2003. Grønlands Naturinstitut, Pinngortitalerifik Jermy AC (1986) Subgeneric names in Selaginella. Fern Gaz 13: 117-118 Jermy AC (1990) Selaginellaceae. In: Kubitzki K, KU Kramer and PS Green (eds) The families and genera of vascular plants, 1. pteridophytes and gymnosperms. Springer, Berlin Jermy AC, Jones K, Colden C (1967) Cytomorphological variation in Selaginella. Bot J Linn Soc 60: 147-158 Jernstedt JA, Cutter EG, Lu P (1994) Independence of organogenesis and cell pattern in developing angle shoots of Selaginella martensi. Ann Bot 74: 343-355 Jernstedt JA, Mansfield MA (1985) Two dimensional gel electrophoresis of polypetides from stems, roots, leaves and rhizophores of Selaginella krausiana. Bot Gaz 146: 460-465 Joy PP, Thomas J, Mathew S, Skaria BP (1998) Medicinal plants. Kerala Agricultural University, Kerala Kambuou RN (1996) Papua New Guinea: Country report. FAO International Technical Conference on Plant Genetic Resources, Leipzig, Germany, 17-23 June 1996 Keddy P (1978) Endangered wild plants of Nova Scotia. Conservation 3 (2). http://www.gov.ns.ca/natr/wildlife/conserva/03-02-5.htm Kenton A, Parokonny A, Bennett ST, Bennett MD (1993) Does genome organization influence speciation? A reappraisal of karyotype studies in evolutionary biology. In: Lees DR, Edwards D (eds) Evolutionary patterns and processes. Academic Press, London. Khare CP (ed) (2007) Indian medicinal plants; an illustrated dictionary. Springer, Berlin Kirch PV (2000) On the road of the wings: an archaeological history of the Pacific Islands before European contact. University of California Press, London Kolukisaoglu HU, Marx S, Wiegmann C, Hanelt S, Schneider-Poetsch HA (1995) Divergence of the phytochrome gene family predates angiosperm evolution and suggests that Selaginella and Equisetum arose prior to Psilotum. J Mol Evol 41: 329-337 Korall P, Kenrick P (2002) Phylogenetic relationships in Selaginellaceae based on rbcL sequences. Amer J Bot 89: 506-517 Korall P, Kenrick P (2004) The phylogenetic history of Selaginellaceae based on DNA sequences from the plastid and nucleus: extreme substitution rates and rate heterogeneity. Mol Phylo Evol 31: 852-864 Korall P, Kenrick P, Therrien JP (1999) Phylogeny of Selaginellaceae: evaluation of generic/subgeneric relationships based on rbcL gene sequences. Int J Plant Sci. 160: 585-594 Korall P, Taylor WA (2006) Megaspore morphology in the Selaginellaceae in a phylogenetic context: A study of the megaspore surface and wall structure using scanning electron microscopy. Grana 45: 22-60 Kramer KU, Green PS (1990) The families and genera of vascular plants. Vol. I. Pteridophytes and gymnosperms. Springer-Verlag, Berlin Kuriachan PI (1963) Cytology of the genus Selaginella. Cytologia 28: 376-380 Küsters S (2001) Preliminary research results on bearded pig feeding ecology in Kayan-Mentarang National Park, East Kalimantan. Asian Wild Pig News 1 (2): 20-26 Lampiran Peraturan Pemerintah Republik Indonesia Nomor 7 Tahun 1999 Tanggal 27 Januari 1999, tentang: jenis-jenis tumbuhan dan satwa yang dilindungi Lee C-W, Choi H-J, Kim H-S, Kim DH, Chang I-S, Moon HT, Lee S-Y, Oh WK, Woo E-R (2008) Biflavonoids isolated from Selaginella tamariscina regulate the expression of matrix metalloproteinase in human skin fibroblasts. Bioorg Med Chem 16 (2): 732-738 Lee DW (2001) Leaf colour in tropical plants: some progress and much mystery. Malay Nat J 55: 117–131. Li J, Wan D-R, Chen K-L (2007) RAPD analysis of 8 medicinal species of Selaginella. Zhong Yao Cai 30 (4): 403-406 Lin L-G, Zhang Q-Q, Huang Y-Q (1991) Pteridophyta. In: Lin L-G (ed) Flora Fujianica. 2nd ed. Fujian Science and Technology Press, Fuzhou PRC Linnaeus C (1754) Genera plantarum. 4th ed. With introduction by William T. Stearn (1960). Wheldon & Wesley Ltd, Weinheim Love A, Love A, Pichi-Sermolli REG (1977) Cytotaxonomical atlas of the Pteridphyta. J. Cramer, Valdus Love A, Love D (1961) Some chromosome numbers of Icelandic ferns and fern-allies. Amer Fern J 51: 127-128 Love A, Love D (1976) IOPB chromosome number reports Lift. Taxon 25: 483-500

SETYAWAN – Selaginella research in Nusantara Loyal DS, Kumar V (1984) Cytotaxonomic observations on three Selaginella species from north-western Himalayas. Indian Fern J 1: 59-62 Loyal. DS (1976) Chromosome counts in north-western Himalayan species of Selaginella. Proc Indian Sci Congr Assoc 63: 127-128 Lozhkin AV, Anderson PM, Eisner WR, Ravako LG, Hopkins DM, Brubaker LB, Colinvaux PA, Miller MC (1993) Late quaternary Lacustrine pollen records from southwestern Beringia. Quat Res 39 (3): 314-324 Lu P, Jernstedt JA (1996) Rhizophores and root development in Selaginella martensii: meristem transitions and identity. Int J Plant Sci 157: 180-194 Manton I (1950) Problems of cytology and evolution in the Pteridophyte. Cambridge University Press, Cambridge Marcon AB, Barros ICL, Guerra M (2005) Variation in chromosome numbers, CMA bands and 45S rDNA sites in species of Selaginella (Pteridophyte). Ann Bot 95: 271-276) Michisita Y, Umemoto S, Yamaguchi H (2004) Vascular plant flora in home gardens in Southern part of Kii-peninsula, Japan. Sci Rep Grad Sch Agric & Biol Sci Osaka Pref Univ 56:29-44 Mito T, Uesugi T (2004) Invasive alien species in Japan: the status quo and the new regulation for prevention of their adverse effects. Global Environ Res 8 (2): 171-191 Mound LA, Martin JH, Polaszek A (1994) The insect fauna of Selaginella (Pteridophyte: Lycopsids), with descriptions of three new species. J Natural History 28: 1403-1415 Mueller J, Boller T, Wiemken A (1995) Trehalose and trehalase in plants: recent developments. Plant Sci 112: 1-9 Mukhopadhyay R (1998) Cytotaxonomic observations on Selaginella Beauv. Phytomorpho 48: 343-347 Nahrstedt A, Butterweck V (1997) Biologically active and other chemical constituents of the herb of Hypericum perforatum L. Pharmacopsychiatry 30: 129-134 Nakamura T, Short K (2001) Land-use planning and distribution of threatened wildlife in a city of Japan. Landscape Urban Plan 53: 1-15 Nasrulhaq-Boyce A, Haji Mohamed MA (1987) Photosynthetic and respiratory characteristics of Malayan sun and shade ferns. New Phytol 105: 81-88 Nasution RE (1993) Prosiding Seminar dan Lokakarya Nasional Etnobotani II. Yogyakarta 24-25 Jan (1995) Buku 1: Tumbuhan Obat. Jakarta: Puslitbang Biologi LIPI, Fakultas Biologi UGM, Ikatan Pustakawan Indonesia dan Ikatan Pustakawan Indonesia (IPI). Obermayer R, Leitch IJ, Hanson L and Bennett MD (2002) Nuclear DNA C-values in 30 species double the familial representation in Pteridophytes. Ann Bot 90: 201-217 Otreba P, Gola EM (2011) Specific intercalary growth of rhizophores and roots in Selaginella kraussiana (Selaginellaceae) is related to unique dichotomous branching. Flora 206 (3): 227-232. Palisot de Beauvois AM (1805) Mag. Encyclopaedia (Paris) 9 (5): 478 PAM [Philippine Alternative Medicines] (2008) Pakong tulog, Selaginella tamariscina, resurrection fern: Herbal medicinal plants. Manila: Philippine Alternative Medicines. www.stuartxchange.com/Pakongtulog.html Pavlides C, Gosden C (1994) 35,000-year-old sites in the rainforests of West New Britain, Papua New Guinea. Antiquity 68:604-610 Quansah N (1988) Sporangial distribution patterns in the strobili of African and Madagascan Selaginella. Ann Bot 61: 243-247 Raubeson LA, Jansen RK (1992) Chloroplast DNA evidence on the ancient evolutionary split in vascular land plants. Science 255: 16971699 RDBIP (2009) The red data books of Indian plants. http://www.envfor.nic.in/bsi/research.html Reese G (1951) Erganzende mitteilungen uber die chromosomenzahlen mitteleuroplischer gefasspflanzen I. Ber Dtsch Bot Ges 64: 240-255 Roos MC (1993) State of affairs regarding Flora Malesiana: progress in revision work and publication schedule. Flora Malesiana Bull 11: 133-142 Root TL, Price JT, Hall KR, Schneider SH, Rosenzweig C, Pounds JA (2003) Fingerprints of global warming on wild animals and plants. Nature 421: 57-60. Rowe NP (1988) A herbaceous lycophyte from the Lower Carboniferous Drybrook sandstone of the forest of Dean, Gloucestershire. Palaeontology 31: 69-83 Ruddiman WF (2005) How did humans first alter global climate? Sci Am (March 2005): 46-53

123

Sassen M, Wan M (2006) Biodiversity and local priorities in a community near the Ivindo National Park Makokou, Gabon. Project IRET/CENAREST and CIFOR Makokou/Ipassa, Gabon Sastrapradja S, Afriastini JJ (1985) Kerabat paku. LBN-LIPI, Bogor Sastrapradja S, Afriastini JJ, Darnaedi D, Widjaja EA (1979) Jenis paku Indonesia. LBN-LIPI, Bogor Schulz C, Little DP, Stevenson DW, Bauer D, Moloney C, Stützel T (2010) An overview of the morphology, anatomy, and life cycle of a new model species―the lycophyte Selaginella apoda (L.) Spring. Intl J Pl Sci 171 (7): 693-712. Seigler DS (1998) Plant secondary metabolism. Kluwer, Dodrecht Setyawan AD (2008a) Species richness and geographical distribution of Malesia Selaginella. 8th Seminary and Congress of Indonesian Plant Taxonomy Association (“PTTI”), Cibinong Science Center, BogorIndonesia, 21-23 October 2008 Setyawan AD (2008b) Biodiversity of Malesia Selaginella (Selaginellaceae) based on amplified fragment length polymorfism (AFLP). Southeast Asian Regional Center for Tropical Biology (SEAMEO-BIOTROP), Bogor Setyawan AD, Darusman LK (2008) Review: biflavonoid compounds of Selaginella Pal. Beauv. and its benefit. Biodiversitas 9 (1): 64-81 Setyawan AD. 2009. Traditionally utilization of Selaginella; field research and literature review. Nusantara Bioscience 1: 146-158. Setyawan AD. 2011. Natural products from Genus Selaginella (Selaginellaceae). Nusantara Bioscience 3: 44-58. Sheue C-R, Sarafis V, Kiew R, Liu H-Y, Salino A, Kuo-Huang L-L, Yang Y-P, Tsai C-C, Lin C-H, Yong JWH, Ku MSB (2007) Bizonoplast, a unique chloroplast in the epidermal cells of microphylls in the shade plant Selaginella erythropus (Selaginellaceae). Amer J Bot 94:19221929 Soltis PS, Soltis DE (1988) Estimated rates of intragametophytic selfing in Lycopods. Amer J Bot 75: 248-256 Somers P (1978) A systematic survey of the articulatae series of the genus Selaginella and monographic treatment of the S. sulcata Group (Sensu Str.). [Dissertation]. University of Tennessee, Knoxville Somers P, Buck WR (1975) Selaginella ludoviciana, S. apoda and their hybrids in the southeastern United States. Amer Fern J 65: 76-82 Spring AF (1850) Monographie de la famille des Lycopodiacees, 2nd partie. Mem Acad R Sci Lett Belg 24: 1-358 Stapes GW, Herbst DR, Imada CT (2004) Survey of invasive or potentially invasive cultivated plants in Hawaii. Hawaii Biological Survey, Bishop Museum, Honolulu Stokes K, O'Neill K, McDonald RA (2006) Invasive species in Ireland. Queens University, Belfast Strobel G, Daisy B (2003) Bioprospecting for microbial endophytes and their natural products. Microbiol Mol Biol Rev 67 (4): 491-502 Su B, Xiao J, Underhill P, Deka R, Zhang W, Akey J, Huang W, Shen D, Lu D, Luo J, Chu J, Tan J, Shen P, Davis R, Cavalli-Sforza L, Chakraborty R, Xiong M, Du R, Oefner P, Chen Z, Jin L (1999) Ychromosome evidence for a northward migration of modern humans into eastern Asia during the last Ice Age. Am J Hum Genet 65:17181724 Takamiya M (1993) Comparative karyomorphology and interrelationships of Selaginella in Japan. J Plant Res 106: 149-166 Takemoto T, Ogawa S, Nishimoto N, Arihara S, Bue K (1967) Insect moulting activity of crude drugs and plants. Yakugaku Zasshi 87 1414-1418 Tchermak-Woes E and Dolezal-Janish, R (1959) Uber die karyogische anatomie einiger Pteridophyten sowie auffallende unterschiede im kernvolumen bei Cyrtomium falcatum. Osterr Bot Zeit 116: 315-324 Therrien JP, Haufler CH (2000) Phylogeny and biogeography of Selaginella subg. Tetragonostachys based on nuclear ribosomal ITS sequence data. Amer J Bot 87: 98 (Abstract) Therrien JP, Haufler CH, Korall P (1999) Phylogeny and biogeography of Selaginella subg. Tetragonostachys. XVI International Botanical Congress. Missouri Botanical Garden, St. Louis, Missouri, USA Thetford M, Gibson JL, Ballard BO, Groninger JK (2006) Ferns for sun and shade in northwest Florida. SNA Research Conference 51: 602606 Thomas BA (1992) Paleozoic herbaceous lycopsids and the beginnings of extant Lycopodium sens. lat. and Selaginella sens. lat. Ann Miss Bot Gard 79: 623-631 Thomas BA (1997) Upper Carboniferous herbaceous lycopsids. Rev Palaeobot Palynol 95: 129-153)

124

B I O D I V E R S IT A S 12 (2): 112-124, April 2011

Thomas KR, Kollel M, Whitney HM, Glover BJ, Steiner U (2010). Function of blue iridescence in tropical understorey plants. J. R. Soc. Interface 7 (53): 1699-1707. Timmins SM, Braithwaite H (2002) Early detection of invasive weeds on islands. In: Veitch CR, Clout MN (eds) Turning the tide: the eradication of invasive species. IUCN SSC Invasive Species Specialist Group, Gland, Switzerland Tryon AF, Lugardon B (1991) Spores of the Pteridophyta. Springer, New York. Tryon RM (1955) Selaginella rupestris and its allies. Ann Missouri Bot Gard 42: 1-99 Tryon RM, Tryon AF (1982) Fern and allied plants, with special reference to tropical America. Springer, New York Tsai JL, Shieh WC (1983) A Cytotaxonomic survey of the Pteridophytes in Taiwan. J Sci Engi 20: 137-159 Tsai JL, Shieh WC (1988) Cytotaxonomic studies on the Selaginellaceae in Taiwan. J Sci Engi 25: 83-92 Tsai JL, Shieh WC (1994) Selaginellaceae. In: Huang TC (ed) Flora of Taiwan. Vol. 1. 2nd ed. Department of Botany, National Taiwan University, Taipei Uluk A, Sudana M, Wollenberg E (2001) Ketergantungan masyarakat Dayak terhadap hutan di sekitar Taman Nasional Kayan Mentarang. Cifor, Bogor Valdespino IA (1993) Selaginellaceae. In: Pteridophytes and Gymnosperms. Flora of North America. Vol. 2. Oxford University Press, New York van Dyne GM, Vogel WG (1967) Relation of Selaginella densa to site, grazing, and climate. Ecology 48:438-444 van Leeuwen JFN, Schäfer H, van der Knaap WO, Rittenour T, Björck S, Ammann B (2005) Native or introduced? Fossil pollen and spores may say; An example from the Azores Islands. Neobiota 6: 27-34 Vandenberg N, van Oorschot RAH, Tyler-Smith C, Mitchell RJ (1999) Ychromosome-specific microsatellite variation in Australian Aborigines. Hum Biol 71:915-931 Vasudeva SM, Bir SS (1983) Chromosome numbers and evolutionary status of ferns and fern allies of Pachmarhi Hills (Central India). In Bir SS (ed) Aspects of plant sciences. Vol. 6. Today and Tomorrow's Printers & Publishers, New Delhi Voirin B, Jay M (1978) Etude chimiosystematique des lycopodiales, isoetales, selaginellales et psilotales. Biochem Sys Ecol 6 (2): 99-102 Walker TG (1984) Chromosomes and evolution in pteridophytes. In: Sharma AK and A Sharma (eds) Chromosome evolution of Eukaryotic groups. Vol. 2. CRC Press, Boca Raton, FL Walther GR, Post E, Convey P, Menzel A, Parmesan C, Beebee TJC, Fromentin JM, Hoegh-Guidberg O, Bairlein F (2002) Ecological responses to recent climate change. Nature 416: 389-395.

Wang P-S, Wang X-Y (2001) Pteridophyte. In: Wang P-S (ed) Flora of Guizhou. Guizhou Science and Technology Press, Guiyang Wang Z, Xia Q, Zhang Z (1984) Cytological observations on twenty-five species of Chinese ferns. Acta Bot Sin 26: 595-604 Warintek (2002) CD-ROM Mencerdaskan bangsa seri kedua. http://ftp.ui.edu/bebas/v12/data/top.htm Weng R-F, Qiu S-P (1988) Chromosome counts of some ferns from Zhejiang. Invest Stud Nat 8: 43-52 West CJ (2002) Eradication of alien plants on Raoul Island, Kermadec Islands, New Zealand. In: Veitch CR, Clout MN (eds) Turning the tide: the eradication of invasive species. IUCN SSC Invasive Species Specialist Group. IUCN, Gland, Switzerland Wijayakusuma HM (2004) Mengatasi dan mencegah kanker paru-paru secara alamiah. http://cybermed.cbn.net.id Winter WP de, Jansen PCM (2003) Selaginella Pal. Beauv. In: Winter WP de, Amoroso VB (eds.) Plant resources of south-east Asia No. 15 (2) Cryptogams: fern and fern allies. Bakhuys Publisher, Leiden Wong KM (1982) Critical observations on Peninsular Malaysian Selaginella. Gard Bull Sing 35 (2): 107-135 Wong KM (2010) Selaginellaceae. In Parris BS, Kiew R, Chung RKC, Saw LG, Soepadmo E (eds) Flora of Peninsular4 Malaysia Series 1. Ferns and Lycophytes. Malayan Forest Records No. 48. FRIM Kepong, Selangor. Woodin TS, Nishioka L, Hsu A (1978) Comparison of chorismate mutase isozyme patterns in selected plants. Pl Physiol 61: 949-952 Yang JW, Pokharel YR, Kim M-R, Woo E-R, Choi HK, Kang KW (2006) Inhibition of inducible nitric oxide synthase by sumaflavone isolated from Selaginella tamariscina. J Ethnopharmacol 105 (1-2): 107-113 Yen K-Y, Yang L-L, Okuyama T, Hikino H, Takemoto T (1974) Screening of Formosan ferns for phytoecdysones. 1. Chem Pharm Bull 22: 805-808 Zentella R, Mascorro-Gallardo JO, van Dijck P, Folch-Mallol J, Bonini B, van Vaeck C, Gaxiola R, Covarrubias AA, Nieto-Sotelo J, Thevelein JM, Iturriaga G (1999) A Selaginella lepidophylla trehalose-6phosphate synthase complements growth and stress-tolerance defects in a yeast tps1 mutant. Pl Physiol 119: 1473-1482 Zhukova PG, Petrevsky VV (1975) Chromosome numbers of some western Chukotka plant species. Bot Zurn SSSR 60: 395-401 Zoller H (2005) Zum endemismus in der extratropischen zone der südhemisphäre, speziell im dreieck Cape Town - Natal - Namibia. Bauhinia 19: 43-66

GUIDANCE FOR AUTHORS BIODIVERSITAS, the Journal of Biological Diversity publishes scientific articles, i.e. original research and review in all biodiversity aspects of plants, animals and microbes at the level of gene, species, and ecosystem. Scientific feedback (short communication) is only received for manuscript, which criticize published article before. Manuscripts will be reviewed by managing editor and invited peer review according to their disciplines. The only articles written in English (U.S. English) are accepted for publication. This journal periodically publishes in January, April, July, and October. In order to support reduction of global warming as a consequence of transportation vehicles emission and forest degradation for paper manufacturing, management of the journal prefer receiving manuscripts via e-mail rather than in hard copy. Manuscript and its communications can be addressed to the managing editor; better to forward to one of the communicating editor for accelerating evaluation. A letter of statement expressing that the author (s) is responsible for the original content of manuscript, the result of author(s)’s research and never been published must be attached. Manuscript is typed at one side of white paper of A4 (210x297 mm2) size, in a single column, double space, 12-point Times New Roman font, with 2 cm distance step aside in all side. Smaller letter size and space can be applied in presenting table. Word processing program or additional software can be used, however, it must be PC compatible and Microsoft Word based. Names of sub-species until phylum should be written in italic, except for italic sentence. Scientific name (genera, species, author), and cultivar or strain should be mentioned completely at the first time mentioning it, especially for taxonomic manuscripts. Name of genera can be shortened after first mentioning, except generating confusion. Name of author can be eliminated after first mentioning. For example, Rhizopus oryzae L. UICC 524, hereinafter can be written as R. oryzae UICC 524. Using trivial name should be avoided, otherwise generating confusion. Mentioning of scientific name completely can be repeated at Materials and Methods. Biochemical and chemical nomenclature should follow the order of IUPAC-IUB, while its translation to Indonesian-English refers to Glossarium Istilah AsingIndonesia (2006). For DNA sequence, it is better used Courier New font. Symbols of standard chemical and abbreviation of chemistry name can be applied for common and clear used, for example, completely written butilic hydroxytoluene to be BHT hereinafter. Metric measurement use IS denomination, usage other system should follow the value of equivalent with the denomination of IS first mentioning. Abbreviation set of, like g, mg, mL, etc. do not follow by dot. Minus index (m-2, L-1, h-1) suggested to be used, except in things like “per-plant” or “per-plot”. Equation of mathematics does not always can be written down in one column with text, for that case can be written separately. Number one to ten are expressed with words, except if it relates to measurement, while values above them written in number, except in early sentence. Fraction should be expressed in decimal. In text, it should be used “%” rather than “gratuity”. Avoid expressing idea with complicated sentence and verbiage, and used efficient and effective sentence. Manuscript of original research should be written in no more than 25 pages (including tables and picture), each page contain 700-800 word, or proportional with article in this publication number. Invited review articles will be accommodated. Title of article should be written in compact, clear, and informative sentence preferably not more than 20 words. Name of author(s) should be completely written. Running title is about five words. Name and institution address should be also completely written with street name and number (location), zip code, telephone number, facsimile number, and e-mail address. Manuscript written by a group, author for correspondence along with address is required. First page of the manuscript is used for writing above information. Abstract should not be more than 200 words, written in English. Keywords is about five words, covering scientific and local name (if any), research theme, and special methods which used. Introduction is about 400600 words, covering background and aims of the research. Materials and Methods should emphasize on the procedures and data analysis. Results and Discussion should be written as a series of connecting sentences, however, for manuscript with long discussion should be divided into sub titles. Thorough discussion represents the causal effect mainly explains for why and how the results of the research were taken place, and do not only reexpress the mentioned results in the form of sentences. Concluding sentence should preferably be given at the end of the discussion. Acknowledgments are expressed in a brief. Figures and Tables of maximum of three pages should be clearly presented. Title of a picture is written down below the picture, while title of a table is written in the above the table. Colored picture and photo can be accepted if information in manuscript can lose without those images. Photos

and pictures are preferably presented in a digital file. JPEG format should be sent in the final (accepted) article. Author could consign any picture or photo for front cover, although it does not print in the manuscript. There is no appendix, all data or data analysis are incorporated into Results and Discussions. For broad data, it can be displayed in website as Supplement. Citation in manuscript is written in “name and year” system; and is arranged from oldest to newest and from A to Z. The sentence sourced from many authors, should be structured based on the year of recently. In citing an article written by two authors, both of them should be mentioned, however, for three and more authors only the family (last) name of the first author is mentioned followed by et al., for example: Saharjo and Nurhayati (2006) or (Boonkerd 2003a, b, c; Sugiyarto 2004; El-Bana and Nijs 2005; Balagadde et al. 2008; Webb et al. 2008). Extent citation as shown with word “cit” should be avoided, and suggested to refer an original reference. APA style in double space is used in the journal reference as follow: Journal: Carranza S, Arnold EN (2006) Systematics, biogeography and evolution of Hemidactylus geckos (Reptilia: Gekkonidae) elucidated using mitochondrial DNA sequences. Mol Phylogenet Evol 38: 531-545.

Saharjo BH, Nurhayati AD (2006) Domination and composition structure change at hemic peat natural regeneration following burning; a case study in Pelalawan, Riau Province. Biodiversitas 7: 154-158. Book: Rai MK, Carpinella C (2006) Naturally occurring bioactive compounds. Elsevier, Amsterdam. Chapter in book: Webb CO, Cannon CH, Davies SJ (2008) Ecological organization, biogeography, and the phylogenetic structure of rainforest tree communities. In: Carson W, Schnitzer S (eds) Tropical forest community ecology. Wiley-Blackwell, New York. Abstract: Assaeed AM (2007) Seed production and dispersal of Rhazya stricta. 50th annual symposium of the International Association for Vegetation Science, Swansea, UK, 23-27 July 2007. Proceeding: Alikodra HS (2000) Biodiversity for development of local autonomous government. In: Setyawan AD, Sutarno (eds) Toward mount Lawu national park; proceeding of national seminary and workshop on biodiversity conservation to protect and save germplasm in Java island. Sebelas Maret University, Surakarta, 17-20 July 2000. [Indonesian] Thesis, Dissertation: Sugiyarto (2004) Soil macro-invertebrates diversity and inter-cropping plants productivity in agroforestry system based on sengon. [Dissertation]. Brawijaya University, Malang. [Indonesian] Information from internet: Balagadde FK, Song H, Ozaki J, Collins CH, Barnet M, Arnold FH, Quake SR, You L (2008) A synthetic Escherichia coli predator-prey ecosystem. Mol Syst Biol 4: 187. www.molecularsystemsbiology.com Publication manuscript “in press” can be cited and mentioned in reference (bibliography); “personal communications” can be cited, but cannot be mentioned in reference. Research which not be published or “submitted” cannot be cited. Some annotation. Manuscript typed without sign link (-) (except repeated word in Indonesian). Usage of letter “l” (el) to “1” (one) or “O” (oh) to “0” (null) should be avoided. Symbols of α, β, χ, etc. included through facility of insert, non altering letter type. No space between words and punctuation mark. Progress of manuscript. Notification of manuscript whether it is accepted or refused will be notified in about three months since the manuscript received. Manuscript is refused if the content does not in line with the journal mission, low quality, inappropriate format, complicated language style, dishonesty of research authenticity, or no answer of correspondence in a certain period. Author or first authors at a group manuscript will get one original copy of journal containing manuscript submitted not more than a month after publication. Offprint or reprint is only available with special request. NOTE: Author(s) agree to transfer copy right of published paper to BIODIVERSITAS, Journal of Biological Diversity. Authors shall no longer be allowed to publish manuscript completely without publisher permission. Authors or others allowed multiplying article in this journal as long as not for commercial purposes. For the new invention, authors suggested to manage its patent before publishing in this journal.

NOTIFICATION: All communications are strongly recommended to be undertaken through email.

ISSN: 1412-033X (printed edition) ISSN: 2085-4722 (electronic)

GENETIC DIVERSTY

Genetic variability in apomictic mangosteen (Garcinia mangostana) and its close relatives (Garcinia spp.) based on ISSR markers SOBIR, ROEDHY POERWANTO, EDY SANTOSA, SOALOON SINAGA, ELINA MANSYAH Genetic variation of Melia azedarach in community forests of West Java assessed by RAPD YULIANTI, ISKANDAR ZULKARNAEN SIREGAR, NURHENI WIJAYANTO, IGK TAPA DARMA, DIDA SYAMSUWIDA Polymorphic sequence in the ND3 region of Java endemic Ploceidae birds mitochondrial DNA R. SUSANTI

59-63

64-69

70-75

SPECIES DIVERSTY

Hymenopteran parasitoids associated with the banana-skipper Erionota thrax L. (Insecta: Lepidoptera, Hesperiidae) in Java, Indonesia ERNIWATI, ROSICHON UBAIDILLAH

76-85

ECOSYSTEM DIVERSTY

Plant community establishment on the volcanic deposits following the 2006 nuÃ©es ardentes (pyroclastic flows) of Mount Merapi: diversity and floristic variation SUTOMO, RICHARD HOBBS, VIKI CRAMER Coral diversity indices along the Gulf of Aqaba and Ras Mohammed, Red Sea, Egypt MOHAMMED SHOKRY AHMED AMMAR Population analysis of the javan green peafowl (Pavo muticus muticus Linnaeus 1758) in Baluran and Alas Purwo National Parks, East Java JARWADI BUDI HERNOWO, HADI SUKARDI ALIKODRA, ANI MARDIASTUTI, CECEP KUSMANA Status and diversity of arbuscular mycorrhizal fungi and its role in natural regeneration on limestone mined spoils ANUJ KUMAR SINGH, JAMALUDDIN

86-91

92-98 99-106

107-111

REVIEW

Review: Recent status of Selaginella (Selaginellaceae) research in Nusantara AHMAD DWI SETYAWAN

112-124

Front cover: Corals of Sinai coast (PHOTO: MOHAMMED SA AMMAR)

Published four times in one year

PRINTED IN INDONESIA ISSN: 1412-033X (printed)

ISSN: 2085-4722 (electronic)