Creative Biolabs- Afuco™ platform

Page 1

Afuco™ Platform

a “AAAC” was added into the 5’ of the antisense strand. Besides a starting with G in gRNA sequence is necessary.

Synthesize two oligos as below. Bak-gRNA1-Sense: CACCGTCTCGAACGCAGAATGAAAG Bak-gRNA1-Antisense: AAACCTTTCATTCTGCGTTCGAGAC Bak-gRNA2-Sense: CACCGTGATGACCCTTCTTTGTTAA Bak-gRNA2-Antisense: AAACTTAACAAAGAAGGGTCATCAC Sequences in blue: complementary to the BbsI - digested vector Yellow highlighted sequence: G added artificially.

Anneal the synthesized single strand oligos to form dsDNA. The annealing reaction is as follows:

Sense Oligo (10 μM)

10 μl

Antisense Oligo (10 μM)

10 μl

ddH2O

16 μl 4 μl

Annealing Buffer (10x)

40 μl

Total Volume 

Subclone the annealed dsDNA into pGK1.1 vector. The ligation reaction is as follows: linearized pGK1.1 vector

1 μl

Annealed dsDNA

1 μl

T4 DNA Ligase 10xT4 DNA ligase Buffer

3)

0.5 μl 1 μl

ddH2O

6.5 μl

Total Volume

10 μl

Transform into G10 competent cells and screen for the positive clones 

Selection of positive clones by PCR Perform PCR with VSP and Fut8-antisense primers, and the expected PCR products is about 100bp. VSP primer (near U6 promoter): CATATGCTTACCGTAACTTGAAAG Fut8-Antisense primer: Reverse complement sequence of the Fut8-gRNA target site

Lane M: DNA marker Lane 1-3: positive clones for Fut8-gRNA1 Lane 4-6: positive clones for Fut8-gRNA2

Fig 3. PCR verification of positive clones. 1-631-357-2254 | info@creative-biolabs.com | CREATIVE BIOLABS INC

6


Turn static files into dynamic content formats.

Create a flipbook
Issuu converts static files into: digital portfolios, online yearbooks, online catalogs, digital photo albums and more. Sign up and create your flipbook.