Afuco™ Platform
a “AAAC” was added into the 5’ of the antisense strand. Besides a starting with G in gRNA sequence is necessary.
Synthesize two oligos as below. Bak-gRNA1-Sense: CACCGTCTCGAACGCAGAATGAAAG Bak-gRNA1-Antisense: AAACCTTTCATTCTGCGTTCGAGAC Bak-gRNA2-Sense: CACCGTGATGACCCTTCTTTGTTAA Bak-gRNA2-Antisense: AAACTTAACAAAGAAGGGTCATCAC Sequences in blue: complementary to the BbsI - digested vector Yellow highlighted sequence: G added artificially.
Anneal the synthesized single strand oligos to form dsDNA. The annealing reaction is as follows:
Sense Oligo (10 μM)
10 μl
Antisense Oligo (10 μM)
10 μl
ddH2O
16 μl 4 μl
Annealing Buffer (10x)
40 μl
Total Volume
Subclone the annealed dsDNA into pGK1.1 vector. The ligation reaction is as follows: linearized pGK1.1 vector
1 μl
Annealed dsDNA
1 μl
T4 DNA Ligase 10xT4 DNA ligase Buffer
3)
0.5 μl 1 μl
ddH2O
6.5 μl
Total Volume
10 μl
Transform into G10 competent cells and screen for the positive clones
Selection of positive clones by PCR Perform PCR with VSP and Fut8-antisense primers, and the expected PCR products is about 100bp. VSP primer (near U6 promoter): CATATGCTTACCGTAACTTGAAAG Fut8-Antisense primer: Reverse complement sequence of the Fut8-gRNA target site
Lane M: DNA marker Lane 1-3: positive clones for Fut8-gRNA1 Lane 4-6: positive clones for Fut8-gRNA2
Fig 3. PCR verification of positive clones. 1-631-357-2254 | info@creative-biolabs.com | CREATIVE BIOLABS INC
6