Online sample issue Int. Journal for Vitamin and Nutrition Research by Hogrefe

Volume 90 / Number 1–2 / 2020

International Journal for

Vitamin and Nutrition Research Editor-in-Chief Torsten Bohn Associate Editors Alex Brito Joana Corte-Real Manfred Eggersdorfer Lei Hao Luigi Schiavo Claus Vögele

International Journal for

Vitamin and Nutrition Research

Volume 90 / Number 1–2 / 2020

Editor-in-Chief Torsten Bohn Associate Editors Alex Brito Joana Corte-Real Manfred Eggersdorfer Lei Hao Luigi Schiavo Claus Vögele

Editor-in-Chief

Dr. Torsten Bohn Luxembourg Institute of Health L-1445 Strassen Luxembourg torsten.bohn@lih.lu

Associate Editors

Dr. Alex Brito, Strassen Dr. Joana Corte-Real, Esch-sur-Alzette Dr. Manfred Eggersdorfer, Kaiseraugst

Publisher (European Address)

Hogrefe AG, Laenggass-Strasse 76, 3012 Bern, Switzerland Phone +41 (0)31 300 45 00, Fax +41 (0)31 300 45 90 zeitschriften@hogrefe.ch, www.hogrefe.com

(US Address)

Hogrefe Publishing Corp., 7 Bulfinch Place, Suite 202, Boston, MA 02114, USA Phone +1 866 8234726, Fax +1 617 3546875 customerservice@hogrefe.com

Media Manager

Josef Nietlispach, Hogrefe AG, Laenggass-Strasse 76, 3012 Bern, Switzerland Phone +41 (0)31 300 45 69, Fax +41 (0)31 300 45 91 inserate@hogrefe.com

Printing

jetoprint GmbH, VS-Villingen, Germany

ISSN

0300–9831 (ISSN-L), 0300–9831 (Print), 1664–2821 (Online)

Frequency

6 issues per volume

Subscriptions

Subscription rates per volume: Libraries / Institutions: US $ 1212.– / CHF 908.– / € 692.– (print only; for information on online subscriptions, please consult the journals catalogue on www.hgf.io/zftkatalog) Individuals: US $ 544.– / CHF 427.– / € 332.– + postage and handling: – Switzerland: CHF 18.– – European countries: € 21.– – Other countries: US $ 27.– / CHF 26.–

Dr. Lei Hao, Lubbock Dr. Luigi Schiavo, Salerno Prof. Claus Vögele, Esch-sur-Alzette

Single issue: US $ 109.– / CHF 105.50 / € 82.– + postage and handling Indexing

Science Citation Index Expanded (SCIE, Sci-Search), Current Contents/Agriculture, Biology, and Environmental Sciences, Science Citation Index, Current Contents/Life Sciences, Prous Science Integrity, Journal Citation Reports/Science Edition, Biological Abstracts, BIOSIS Previews, Medline, AGRICOLA, EMBASE, BIOBASE, EMBASE Biology, EMCARE, Scopus, CAB Abstracts and CAB Health.

No part of this journal may be reproduced, stored in a retrieval system, or transmitted, in any form or by any means, electronic, mechanical, photocopying, microfilming, recording or otherwise, without written permission from the publisher and the author. The journal serves as the scientific organ of the Swiss Society for Nutrition.

Contents News and Views

Vitamin D: Insufficiency, Uncertainty and Achievability

Meghan McGee Original Communications

Optimization the formulation parameters in preparation of α-tocopherol nanodispersions using low-energy solvent displacement technique

Naghmeh Jaberi, Navideh Anarjan, and Hoda Jafarizadeh-Malmiri

The Effect of Vitamin D on Serum Asymmetric Dimethylarginine in Patients with Mild to Moderate Ulcerative Colitis

Mohammad Javad Hosseinzadeh-Attar, Amrollah Sharifi, Saharnaz Nedjat, Ashraf Mohamadkhani, and Homayoon Vahedi Consuming Diet Supplemented with Either Red Wheat Bran or Soy Extract Changes Glucose and Insulin Levels in Female Obese Zucker Rats

Alexis D. Stamatikos, Jeremy E. Davis, Neil F. Shay, Kolapo M. Ajuwon, Farzad Deyhim, and William J. Banz Q10 Coenzyme Supplementation can Improve Oxidative Stress Response to Exercise in Metabolic Syndrome in Rats

Bogdan Augustin Chis, Ana Florica Chis, Adriana Muresan, and Daniela Fodor Maximal dose-response of vitamin-K2 (menaquinone-4) on undercarboxylated osteocalcin in women with osteoporosis

Tusar K Giri, David Newton, Opal Chaudhary, Elena Deych, Nicola Napoli, Reina Armamento-Villareal, Kathy Diemer, Paul E Milligan, and Brian F Gage Efficacy of Vitamin D on Chronic Heart Failure Among Adults A Meta-analysis of Randomized Controlled Trials

Wang Chunbin, Wang Han, and Cai Lin Strong association between serum Vitamin D and Vaspin Levels, AIP, VAI and liver enzymes in NAFLD patients

Azimeh Izadi, Fereshteh Aliasghari, Bahram Pourghassem Gargari, and Sara Ebrahimi Low-Dose Omega-3 Fatty Acid and Vitamin D for Anthropometric, Biochemical Blood Indices and Respiratory Function. Does it work?

Arturas Sujeta, Sandrija Capkauskiene, Daiva Vizbaraite, Loreta Stasiule, Mindaugas Balciunas, Arvydas Stasiulis, and Edmundas Kadusevicius Vitamin C improves liver and renal functions in hypothyroid rats by reducing tissue oxidative injury

Mahdi Esmaeilizadeh, Mahmoud Hosseini, Farimah Beheshti, Vajihe Alikhani, Zakieh Keshavarzi, Mohsen Shoja, Mozhgan Mansoorian, and Hamid Reza Sadeghnia

Int J Vitam Nutr Res (2020), 90 (1–2)

Contents

Ramadan fasting improves liver function and total cholesterol in patients with nonalcoholic fatty liver disease

Sara Ebrahimi, Bahram Pourghassem Gargari, Fereshteh Aliasghari, Foad Asjodi, and Azimeh Izadi 103

Inhibition of Pro-Inflammatory Cytokine Secretion by Selected Antioxidants in Human Coronary Artery Endothelial Cells Michael J. Haas, Marilu Jurado-Flores, Ramadan Hammoud, Victoria Feng, Krista Gonzales, Luisa Onstead-Haas, and Arshag D Mooradian Supplementation with beta-hydroxybeta-methylbutyrate impacts glucose homeostasis and increases liver size in trained mice

113

Ines Schadock, Barbara G. Freitas, Irae L. Moreira, Joao A. Rincon, Marcio Nunes Correa, Renata Zanella, Evelise Sampaio Silva, Ronaldo Carvalho Araujo, Marcia Rubia D Buchweitz, Elizabete Helbig, Fabricio B Del Vecchio, Augusto Schneider, and Carlos Castilho Barros 124

No Relation Between Zinc Status and Inflammatory Biomarkers in Adolescent Judokas Artemizia Francisca de Sousa, Laiana Sepúlveda de Andrade Mesquita, Kyria Jayanne Clímaco Cruz, Ana Raquel Soares de Oliveira, Jennifer Beatriz Silva Morais, Juliana Soares Severo, Jéssica Batista Beserra, Nadir do Nascimento Nogueira, and Dilina do Nascimento Marreiro

131

The Vitamins Involved in One-Carbon Metabolisms are Associated with Reduced Risk of Breast Cancer in Overall and Subtypes Mahshid Hatami, Farhad Vahid, Mohammad Esmaeil Akbari, Mahya Sadeghi, Fatemeh Ameri, Hassan Eini-Zeinab, Yasaman Jamshidi-Naeini, and Sayed Hossein Davoodi Hydro-ethanolic extract of Curcuma longa affects tracheal responsiveness and lung pathology in ovalbuminsensitized rats

141

Farzaneh Shakeri, Nama Mohamadian Roshan, and Mohammad Hossein Boskabady 151

Homologous G776G Variant of Transcobalamin-II Gene is Linked to Vitamin B12 Deficiency Khalid M. Al-Batayneh, Mazhar Salim Al Zoubi, Bahaa Al-Trad, Emad Hussein, Wesam Al Khateeb, Alaa A. A. Aljabali, Khaldon Bodoor, Murad Shehab, Mohammad A. Al Hamad, Greg J. Eaton, and Christopher T. Cornelison Neuroprotective and long term potentiation improving effects of vitamin E in juvenile hypothyroid rats

156

Yousef Baghcheghi, Somaieh Mansouri, Farimah Beheshti, Mohammad Naser Shafei, Hossien Salmani, Parham Reisi, Akbar Anaeigoudari, Alireza Ebrahimzadeh Bideskan, and Mahmoud Hosseini Reviews

Thylakoids: A Novel Food-Derived Supplement for Obesity

169

Sahar Foshati and Maryam Ekramzadeh Effects of Astaxanthin Supplementation on Oxidative Stress

179

Di Wu, Hao Xu, Jinyao Chen, and Lishi Zhang

Int J Vitam Nutr Res (2020), 90 (1–2)

News and Views

Vitamin D: Insufficiency, Uncertainty and Achievability Meghan McGee Nutritional Sciences, Faculty of Medicine, University of Toronto, Toronto, Canada Received: November 10, 2016; Accepted: December 31, 2016

Abstract: Vitamin D is a prohormone that is essential to good health. As very few foods (fish, egg yolks, milk) are rich in vitamin D, the main source of the vitamin is synthesized in the skin in the presence of ultraviolet B rays from sunlight. However, due to Canada’s northern latitude, sufficient amounts of vitamin D cannot be synthesized using sunlight during the fall and winter months and, consequently, there is a concern that many Canadians are not achieving adequate levels of vitamin D. A wide array of inconsistent evidence derived from serum and dietary assessments has been published and the results are inconclusive. This paper serves to outline the issues and challenges regarding nationwide intervention strategies such as fortification to increase vitamin D intake in the Canadian population. Given the potential for excessive intakes and the lack of informed Canadian data, implementing an intervention to increase vitamin D intake in the entire population may be irresponsible; however, further investigation of vitamin D intakes in certain subgroups of the Canadian population is warranted.

Introduction Vitamin D is a prohormone that, in its active form, is essential for serum calcium and phosphate homeostasis and, consequently, bone health [1]. Poor vitamin D status is associated with an increased risk of type 1 diabetes mellitus [2], type 2 diabetes mellitus [3], the metabolic syndrome [4], frailty and all-cause mortality [5] and may influence epigenetic regulation [6]. As very few foods contain vitamin D, the principal source of the vitamin is synthesized in the skin in the presence of ultraviolet B rays from sunlight. However, due to Canada’s northern latitude, sufficient amounts of vitamin D cannot be synthesized using sunlight during the fall and winter months [7]. Following the updated Dietary Reference Intakes (DRIs) in 2010 where Estimated Average Requirements (EARs) and standards for assessing inadequacy were established for vitamin D (Table 1), several recent studies have been conducted on vitamin D status in the Canadian population [9–11]. A wide array of conflicting evidence derived from serum and dietary assessments has been published and the results are inconclusive. This paper will outline the significance and concerns of using the DRI principles of planning to develop a strategy to increase vitamin D intake in the Canadian population.

Ó 2019 Hogrefe

Assessing Vitamin D Inadequacy in Canada Understanding and sufficiently measuring the adequacy of vitamin D status in the Canadian population is crucial as too little vitamin D can cause osteomalacia or osteoporosis, whereas high levels of vitamin D can cause calcification of the kidney, heart, lungs and blood vessels [8]. When using the EARs for dietary planning, it must be made clear that they are estimates based on data from a select number of individuals, whose specific nutrient requirements are unknown, yet are assumed to follow a normal distribution [12]. The EARs have been extrapolated from population groups to others who differ in sex and gender and a degree of uncertainty has not yet been specified. In addition, there is a possibility for error in the estimates of participants’ vitamin D intakes and requirements since multiple diet recalls or clinical measurements are needed to determine an accurate measure of usual intake [13]. Finally, because the EAR value for vitamin D is an estimate, having a proportion of the population below the EAR does not necessarily mean that they are consuming inadequate vitamin D or that they will experience any symptoms of deficiency. There is a disturbing discrepancy in measurements of the prevalence of vitamin D inadequacy in the Canadian

Int J Vitam Nutr Res (2020), 90 (1–2), 1–4 https://doi.org/10.1024/0300-9831/a000500

M. McGee, Vitamin D: Insufficiency, Uncertainty and Achievability

Table 1. Dietary Reference Intakes for Vitamin D Age group

Recommended Dietary Allowance (RDA)

Estimated Average Requirement (EAR)

Tolerable Upper Intake Level (UL)

Infants 0-6 months

400 IU*

No Data

1000 IU

Infants 7-12 months

400 IU*

No Data

1500 IU

Children 1-3 years

600 IU

400 IU

2500 IU

Children 4-8 years

600 IU

400 IU

3000 IU

Children and Adults 9-70 years

600 IU

400 IU

4000 IU

Adults > 70 years

800 IU

400 IU

4000 IU

Pregnancy and Lactation

600 IU

400 IU

4000 IU

*Adequate Intake (AI) rather than Recommended Dietary Allowance. Adapted from Health Canada. Vitamin D and Calcium: Updated Dietary Reference Intakes - Nutrition and Healthy Eating - Health Canada. (2012). Available at: http://hc-sc.gc.ca/fn-an/nutrition/vitamin/vita-d-eng.php.

population. Dietary and supplement data show a large prevalence of inadequacy (defined as intake below the 400 IU EAR value) among Canadians [14, 15], yet clinical measures suggest otherwise [16, 17]. Presently, serum 25-hydroxy vitamin D (25(OH)D) reflects vitamin D2 + D3 intake from both food and sunlight and is believed to be the best clinical indicator of vitamin D status [8]. Using this method, it has been shown that roughly 13% of Canadians are below the EAR (40 nmol/L 25(OH)D) for vitamin D year-round, rising to 16% in winter [16]. This is inconsistent with dietary and supplement data that show a very high prevalence of inadequate intakes (ranging from 54–84% depending on age and gender) [14]. However, dietary and supplement data ignore vitamin D obtained through sunlight [8] and are ripe with the potential for reporting error. In addition, there is a lack of consistency among measurements of 25(OH)D with remarkably different results being obtained from laboratories (mean range: 17.1–35.6 ng/ml) [18]. Therefore, further research should be carried out using liquid chromatography-mass spectrometry, termed the gold standard for assessing vitamin D status [19, 20], to determine the baseline distribution of vitamin D intake before concluding there is a significant problem with Canadians’ consumption. Certain subgroups of the population including pregnant women [21], children [22], the institutionalized [23, 24], non-Western immigrants [25, 26] and those suffering from specific diseases may be at a higher risk for vitamin D inadequacy [27–29]. It is well-known that individuals who limit their exposure to the sun, are over the age of 50 or have darker skin are less likely to obtain sufficient vitamin D through sunlight [16, 30]. In addition, overweight or obese Canadians have been shown to have lower, on average, blood levels of vitamin D when compared to normal or underweight individuals, yet were still found to consume levels of vitamin D above the EAR value, on average [10]. However, a significantly higher proportion of non-whites (33% in winter) when compared to whites (11% in winter) failed to meet the EAR for 25(OH)D for year-round, winter and summer vitamin D concentrations [16]. Therefore, because certain Int J Vitam Nutr Res (2020), 90 (1–2), 1–4

subgroups may be less likely to achieve adequate levels of vitamin D, further research into estimating vitamin D intakes in these groups is needed before using the DRI principles of planning to increase vitamin D intake in the entire Canadian population.

Assessing an Intervention to Increase Vitamin D Intakes When determining if Health Canada should use the DRI principles of planning to shift the usual intakes of vitamin D, the goal should be defined: to prevent deficiency or to reduce the risk for chronic diseases. Based on the most recent data, the prevalence of rickets, which is caused by vitamin D deficiency, is generally low (2.9 cases per 100,000) in Canada [31]. However, the influence of vitamin D on the prevention of chronic diseases is less understood. Poor vitamin D status is associated with increased mortality [32]. In fact, a review of 159 randomized clinical trials concluded that vitamin D may reduce mortality, but supplementation would have to occur for over 5 years in order to see the benefit [33]. The authors also found harmful effects of vitamin D supplementation when combined with calcium, such as renal stone formation and increased calcium blood levels [33]. Moreover, hypervitaminosis D results in confusion, slurred speech, fatigue and acute kidney injury [34]. Therefore, further epidemiological studies are needed to determine the effects of vitamin D on the prevention of chronic diseases before shifting the distribution of intakes. There is insufficient evidence to conclude that usual intakes for vitamin D in the Canadian population pose a serious problem and, therefore, an intervention to shift the usual intakes for vitamin D is unjustified. It is evident that a large proportion of the Canadian population falls into the subgroups of individuals who are at a greater risk of being below the EAR for vitamin D; however, shifting the distribution of vitamin D intake in the Canadian population Ó 2019 Hogrefe

M. McGee, Vitamin D: Insufficiency, Uncertainty and Achievability

could lead to a significant proportion of Canadians consuming high amounts of vitamin D. Because a large part of the Western diet consists of fortified, processed foods [35–37], it is possible that increasing fortification could increase the vitamin D intake in some Canadians such that their intakes meet or exceed the Tolerable Upper Intake Level (UL, 4000 IU or 125 nmol/L per day), which is the highest level of intake that is unlikely to pose any adverse health risks [8]. Therefore, rather than increasing vitamin D intake in the entire Canadian population, Health Canada should focus its efforts on assessing inadequacy and potentially establishing fortification and supplementation strategies to target certain subgroups at higher risk of inadequate vitamin D intake. In conclusion, it is not appropriate for Health Canada to expand food fortification or increase supplementation of vitamin D for the entire Canadian population. Due to the nature of dietary and supplement data, the prevalence of inadequacy is likely lower than estimated and the proportion of intakes above the UL is likely higher [38]. Given the potential for excessive intakes, further studies measuring vitamin D status in Canadians is recommended to confirm that nutrient deficiencies actually exist [38]. Separate from scientifically-established subgroups at greater risk of deficiency, Canadians should be cautious of vitamin D supplementation [38]. Finally, implementing an intervention to increase vitamin D intake in the entire population may be irresponsible given the available data, but further investigation of vitamin D intakes in certain subgroups of the Canadian population is warranted.

7. Gill, P., & Kalia, S. (2015) Assessment of the feasibility of using sunlight exposure to obtain the recommended level of vitamin D in Canada. CMAJ Open 3, E258–263. 8. Health Canada. (2012) Vitamin D and Calcium: Updated Dietary Reference Intakes - Nutrition and Healthy Eating Health Canada. Available at: http://hc-sc.gc.ca/fn-an/nutrition/vitamin/vita-d-eng.php. (Accessed: 6th October 2016). 9. Veugelers, P.J., Pham, T.-M., & Ekwaru, J.P. (2015) Optimal Vitamin D Supplementation Doses that Minimize the Risk for Both Low and High Serum 25-Hydroxyvitamin D Concentrations in the General Population. Nutrients 7, 10189–10208. 10. Teresa, Janz, & Caryn, Pearson (2015) Vitamin D blood levels of Canadians. Available at: http://www.statcan.gc.ca/pub/ 82-624-x/2013001/article/11727-eng.htm. (Accessed: 6th October 2016). 11. Munasinghe, L.L., Willows, N., Yuan, Y., & Veugelers, P.J. (2015) Dietary reference intakes for vitamin D based on the revised 2010 dietary guidelines are not being met by children in Alberta, Canada. Nutr. Res. 35, 956–964. 12. Institute of Medicine. (2006) Dietary Reference Intakes: The Essential Guide to Nutrient Requirements. National Academies Press. 13. Barr, S.I. (2006) Applications of Dietary Reference Intakes in dietary assessment and planning. Appl. Physiol. Nutr. Metab. 31, 66–73. 14. Health Canada. (2012) Vitamin D: Usual intakes from food and supplement sources. Available at: http://hc-sc.gc.ca/fn-an/ nutrition/vitamin/tab_vit_d-eng.php. (Accessed: 6th October 2016). 15. Health Canada. (2012) Do Canadian Adults Meet their Nutrient Requirements through Food Intake Alone? Available at: http://hc-sc.gc.ca/fn-an/alt_formats/pdf/surveill/nutrition/ commun/art-nutr-adult-eng.pdf. (Accessed: 6th October 2016). 16. Whiting, S.J., Langlois, K.A., Vatanparast, H., & GreeneFinestone, L.S. (2011) The vitamin D status of Canadians relative to the 2011 Dietary Reference Intakes: an examination in children and adults with and without supplement use. Am. J. Clin. Nutr. 94, 128–135. 17. Langlois, K., Greene-Finestone, L., Little, J., Hidiroglou, N., & Whiting, S. (2010) Vitamin D status of Canadians as measured in the 2007 to 2009 Canadian Health Measures Survey. Health Reports 21, 47–55. 18. Binkley, N., et al. (2004) Assay variation confounds the diagnosis of hypovitaminosis D: a call for standardization. J. Clin. Endocrinol. Metab. 89, 3152–3157. 19. Jones, G. (1978) Assay of vitamins D2 and D3, and 25-hydroxyvitamins D2 and D3 in human plasma by highperformance liquid chromatography. Clin. Chem. 24, 287–298. 20. Gilbertson, T.J., & Stryd, R.P. (1977) High-performance liquid chromatographic assay for 25-hydroxyvitamin D3 in serum. Clin. Chem. 23, 1700–1704. 21. Karras, S., et al. (2016) Hypovitaminosis D in pregnancy in the Mediterranean region: a systematic review. Eur. J. Clin. Nutr. 70, 979–986. 22. Robinson, C., Chiang, M., Thompson, S.N., & Sondike, S.B. (2012) Occurrence of vitamin D deficiency in pediatric patients at high risk in West Virginia. South. Med. J. 105, 504–507. 23. Thomas, M.K., et al. (1998) Hypovitaminosis D in medical inpatients. N. Engl. J. Med. 338, 777–783. 24. Hochwald, O., Harman-Boehm, I., & Castel, H. (2004) Hypovitaminosis D among inpatients in a sunny country. Isr. Med. Assoc. J. IMAJ. 6, 82–87.

References 1. Jones, G., Strugnell, S.A., & DeLuca, H.F. (1998) Current Understanding of the Molecular Actions of Vitamin D. Physiol. Rev. 78, 1193–1231. 2. Hyppönen, E., Läärä, E., Reunanen, A., Järvelin, M.-R., & Virtanen, S.M. (2001) Intake of vitamin D and risk of type 1 diabetes: a birth-cohort study. The Lancet 358, 1500–1503. 3. Deleskog, A., et al. (2012) Low serum 25-hydroxyvitamin D level predicts progression to type 2 diabetes in individuals with prediabetes but not with normal glucose tolerance. Diabetologia 55, 1668–1678. 4. Gagnon, C., et al. (2012) Low Serum 25-Hydroxyvitamin D Is Associated with Increased Risk of the Development of the Metabolic Syndrome at Five Years: Results from a National, Population-Based Prospective Study (The Australian Diabetes, Obesity and Lifestyle Study: AusDiab). J. Clin. Endocrinol. Metab. 97, 1953–1961. 5. Smit, E., et al. (2012) The effect of vitamin D and frailty on mortality among non-institutionalized US older adults. Eur. J. Clin. Nutr. 66, 1024–1028. 6. Hossein-nezhad, A., & Holick, M.F. (2012) Optimize dietary intake of vitamin D: an epigenetic perspective. Curr. Opin. Clin. Nutr. Metab. Care 15, 567–579.

Ó 2019 Hogrefe

Int J Vitam Nutr Res (2020), 90 (1–2), 1–4

M. McGee, Vitamin D: Insufficiency, Uncertainty and Achievability

25. Huibers, M.H.W., et al. (2014) Vitamin D deficiency among native Dutch and first- and second-generation non-Western immigrants. Eur. J. Pediatr. 173, 583–588. 26. van Schoor, N.M., & Lips, P. (2011) Worldwide vitamin D status. Best Pract. Res. Clin. Endocrinol. Metab 25, 671–680. 27. Lansing, A.H., et al. (2015) Vitamin D deficiency in pediatric patients with cystic fibrosis: associated risk factors in the northern United States. South. Med. J. 108, 164–169. 28. Sloan, D.J., et al. (2015) Vitamin D deficiency in Malawian adults with pulmonary tuberculosis: risk factors and treatment outcomes. Int. J. Tuberc. Lung Dis. Off. J. Int. Union Tuberc. Lung Dis. 19, 904–911. 29. Frighi, V., et al. (2014) Vitamin D deficiency in patients with intellectual disabilities: prevalence, risk factors and management strategies. Br. J. Psychiatry J. Ment. Sci. 205, 458–464. 30. Tsiaras, W.G., & Weinstock, M.A. (2011) Factors influencing vitamin D status. Acta Derm. Venereol. 91, 115–124. 31. Ward, L.M., Gaboury, I., Ladhani, M., & Zlotkin, S. (2007) Vitamin D-deficiency rickets among children in Canada. CMAJ Can. Med. Assoc. J. J. Assoc. Medicale Can. 177, 161–166. 32. Ströhle, A., & Bohn, T. (2016) Vitamin D Status and Mortality: Meta-Analysis of Individual Participant Data Confirms Strong Association. Int. J. Vitam. Nutr. Res. Int. Z. Vitam. – Ernahrungsforschung J. Int. Vitaminol. Nutr. 1–4. doi: 10.1024/0300-9831/a000267 33. Bjelakovic, G., et al. (2014) Vitamin D supplementation for prevention of mortality in adults. Cochrane Database Syst. Rev. doi: 10.1002/14651858.CD007470.pub3 34. Jacobsen, R. B., Hronek, B. W., Schmidt, G. A., & Schilling, M. L. (2011) Hypervitaminosis D associated with a vitamin D dispensing error. Ann. Pharmacother. 45, e52.

35. Berner, L. A., Keast, D. R., Bailey, R. L., & Dwyer, J. T. (2014) Fortified foods are major contributors to nutrient intakes in diets of US children and adolescents. J. Acad. Nutr. Diet. 114, 1009–1022.e8. 36. Moubarac, J.-C., et al. (2014) Processed and ultra-processed food products: consumption trends in Canada from 1938 to 2011. Can. J. Diet. Pract. Res. Publ. Dietit. Can. Rev. Can. Prat. Rech. En Diet. Une Publ. Diet. Can. 75, 15–21. 37. Monteiro, C.A., Moubarac, J.-C., Cannon, G., Ng, S.W., & Popkin, B. (2013) Ultra-processed products are becoming dominant in the global food system. Obes. Rev. 14, 21–28. 38. Shakur, Y.A., Tarasuk, V., Corey, P., & O’Connor, D.L. (2012) A Comparison of Micronutrient Inadequacy and Risk of High Micronutrient Intakes among Vitamin and Mineral Supplement Users and Nonusers in Canada. J. Nutr. 142, 534–540.

Int J Vitam Nutr Res (2020), 90 (1–2), 1–4

Conflicts of Interest The author declares no conflict of interest.

Meghan McGee Nutritional Sciences Faculty of Medicine University of Toronto 555 University Ave 10.9701 Toronto Ontario, M5G 1X8 Meghan.mcgee@mail.utoronto.ca

Ó 2019 Hogrefe

Original Communication

Optimization the formulation parameters in preparation of α-tocopherol nanodispersions using low-energy solvent displacement technique Naghmeh Jaberi1, Navideh Anarjan1, and Hoda Jafarizadeh-Malmiri2 1

Faculty of Engineering, Tabriz Branch, Islamic Azad University, Tabriz, Iran

Faculty of Chemical Engineering, Sahand University of Technology, Tabriz, Iran Abstract: α-Tocopherol is the main compound of vitamin E with great antioxidant activity. However, like other functional lipid bioactive compounds, it suffers from low bioavailability due to its low water solubility and liable chemical structure. A bottom-up procedure based on a solvent-displacement method was constructed for fabrication of α-tocopherol nanodispersions using response surface methodology (RSM). The effects of main formulation parameters, namely, weight ratio of emulsifier to α-tocopherol and volumetric percent of acetone to water on the average particle size (nm), polydispersity index, concentration of α-tocopherol loss (% w/w) and turbidity of the nanodispersions were evaluated and optimized to gain the most desirable nanodispersions (least particle size, polydispersity index, turbidity and highest αtocopherol concentrations). Second order regression equations, holding quite high coefficients of determination (R2 and adjusted R2 > 0.882), were significantly (p-value < 0.05) fitted for predicting the α-tocopherol nanodispersion characteristics variations as functions of studied formulation parameters. A multiple optimization analysis offered 6.5 and 10% for weight ratio of Tween 20 to α-tocopherol and volume percent of acetone, respectively, as overall optimum values for studied parameters. Statistically insignificant differences between experimental and predicted values of studied responses, verified the satisfactoriness of presented models for explaining the response characteristics as a function of formulation parameters. Thus, the employed solvent-displacement technique may provide the most desired water dispersible αtocopherol nanoparticles for several water-based foods, cosmetic nutraceutical formulations. Keywords: nanodispersion, α-tocopherol, solvent displacement

Introduction α-Tocopherol is one of the major abundant vitamin E active compounds. It can trap two peroxyl radicals causing lipid oxidation initiation and protect them against oxidative deterioration [1]. Furthermore, it is healthful for immune system, cardiovascular diseases and cancer prevention [2]. Therefore, as other bioactive functional lipid compounds, it is being widely used in numerous foods, cosmetic and pharmaceutical formulations, either for promoting their health effects, or preserving them against oxidative deteriorations, enhancing their quality by impeding the rancidity, production of off-flavor compounds, polymerization and other undesired reactions [1, 3]. However, like other functional lipid bioactive compounds, its uses are presently Ó 2019 Hogrefe

limited because of either its less chemical stability particularly against heat and oxygen or its water insolubility and low cellular uptake and bioavailability [3–5]. Therefore, incorporation of these compounds into various delivery systems has been received great interest to solubilize, protect, control release and increase their bioavailability [6]. The nano-sized delivery systems which decrease the particle size of active compounds to the nano-metric range (less than 500 nm), is a prevalent technique for the delivery of water insoluble components, as the dissolution rate is proportionate to the surface area. Likewise, the saturation solubility increases with decreasing their particle sizes [2, 5]. Nanodispersions are nano-sized colloidal delivery systems which can be attained via either top-down or bottom-up techniques [3]. The top-down methods which start with Int J Vitam Nutr Res (2020), 90 (1–2), 5–16 https://doi.org/10.1024/0300-9831/a000441

larger solid particles are capable of producing fine particles through size reduction process and can be simply used in industrial scales. However, these procedures are time consuming and include high energy consumptions to the system leading to an extensive rise in their process costs [4, 7]. Contrary, the bottom-up methods assemble nanosized particles by starting on the atomic level. Thus, better control over size, morphology and crystallinity of nanodispersion systems would be possible in this technique. Furthermore, less energy during the process is required in bottom-up which also known as nano-precipitation processes. In this process the water insoluble compound is dissolved in water soluble solvent such as ethanol or acetone and added to aqueous system containing dissolved suitable emulsifier or surface active biopolymers. After mixing two phases, supersaturation is occurred in system and the nucleation will be started by solvent evaporation process. Although controlled process and formulation parameters lead to production the fine nano and uni-sized particles, the particles can be grown through coagulation, condensation, or agglomeration under uncontrolled conditions [8]. Stabilizers play a key role in the creation of nanodispersions in aqueous solutions by reducing the interfacial tension between the lipid-based bioactive compounds and the aqueous phases, decreasing the energy extend needed to disrupt the droplets into smaller sizes. Furthermore, they prevent the coalescence of droplets by creating a protecting layer adjoining them [9]. Polyoxyethylene sorbitan monolaurate (Tween 20) is a non-ionic emulsifier that can be adsorbed quickly at the oil–water interface in nanodispersion systems, and shown good results in stabilization of small nano-sized organic particles for various applications [10]. This study motivated on earlier studies reported by Cheong et al., and targeted on replacing the top-down high energy process of α-tocopherol nanodispersions by a bottom-up low energy technique [11]. In our previous study the mixing parameters namely, mixing rate and time were optimized in order to obtain the α-tocopherol nanoparticles with least particle size, polydispersity and highest α-tocopherol concentration [12]. Then the evaporation parameters were optimized (unpublished data). Finally, in this study, the effects of formulation factors, namely, weight ratio of emulsifier to α-tocopherol and volume percent of acetone, on physicochemical characteristics of α-tocopherol nanodispersions were evaluated and optimized in order to get the most desirable nanoparticles. The GC analysis confirmed that the acetone was totally removed from the samples after evaporation step (unpublished data). Therefore, the produced α-tocopherol nanoparticles are food grade and can be easily used in different food and pharmaceutical formulations without any toxicity due to presence of used solvent. Int J Vitam Nutr Res (2020), 90 (1–2), 5–16

N. Jaberi et al., Preparation of α-tocopherol nanodispersions

Materials and Methods Materials α-Tocopherol (95% w) were purchased from Sigma-Aldrich (Sigma-Aldrich Co. MO, USA). Polyoxyethylene sorbitan mono-laurate (Tween 20) and analytical or HPLC grade acetone, methanol, Hexane and acetonitrile were provided by Merck (Merck Co. Darmstadt, Germany) and Fisher Scientific (Leicestershire, UK), respectively.

Preparation of α-tocopherol nanodispersions The aqueous phase composed of dissolved Tween20 in double deionized water was dispersed into acetone containing 0.5% w/w dissolved α-tocopherol, using a conventional mixer (VOSS Instruments LTD, Maldon, UK) at 380 rpm and 70 s [12]. The emulsifier (Tween 20) concentration in aqueous phase and acetone volume percentage were set as Table 1. The acetone was then removed from the system by an evaporation process using a rotary evaporator (Heidol ph 2000, Germany). At reduced pressure of 0.5 atm by rotating speed of 400 rpm during 13 min at 45 °C (unpublished data). The volume of samples was set at 50 mL by addition of water.

Determination of particle size and polydispersity Mean particle size and size distribution of prepared nanodispersions were determined using a dynamic light scattering particle size analyzer (Nano Wave, Microtrac., Montgomeryvill, PA, US), on undiluted samples one day after sample preparation. Light scattering is a result of the interaction of nanoparticles with light in electric field. Dynamic light scattering is a non-destructive method for particle size measurement in suspension system in which it relates the Brownian movement speed of particles to their size, in certain viscosity and temperature using StokesEinstein equation. The polydispersity is also a dimensionless index of the width of the size distribution obtained from the cumulants analysis. It ranged from 0 (mono dispersed) to 1 (highly broad distribution) in used instrument [12].

Sample preparation for α-tocopherol determination The α-tocopherol concentration measurements of nanodispersions were performed using a Shimadzu high pressure liquid chromatography system (HPLC, CT-10A VP, Ó 2019 Hogrefe

N. Jaberi et al., Preparation of α-tocopherol nanodispersions

Table 1. Central composite design 556 and response variables (experimental and predicted values) for α-tocopherol nanodispersions Particle size (nm) Sample Number

Tween 20/α-tocopherol1 (% w/w)

Polydispersity

Acetone (% v)

Exp1

Cal2

Exp1

Cal2

α-tocopherol loss (% w)

Turbidity

Exp1

Cal2

Exp1

Cal2

10.98

18.99

0.195

0.2

14.96

13.84

0.005

5.5

31.30

32.49

0.282

0.279

1.33

1.23

0.237

0.240

5.5

53.80

48.34

0.215

0.207

10.33

10.75

0.060

0.602

2.32

47.23

51.42

0.187

0.215

17.50

17.01

0.456

0.396

5.5

46.80

48.34

0.222

0.207

10.99

10.75

0.059

0.602

5.5

45.80

48.34

0.218

0.207

10.88

10.75

0.058

0.602

5.5

49.80

48.34

0.211

0.207

11.33

10.75

0.060

0.602

57.10

50.91

0.215

0.214

20.11

20.93

0.231

0.312

8.68

15.42

9.89

0.327

0.351

6.11

6.95

0.016

0.014

5.5

45.40

48.34

0.209

0.207

10.22

10.75

0.058

0.602

8.68

38.70

32.35

0.155

0.161

8.15

8.98

0.033

0.034

5.5

26.02

26.57

0.378

0.349

5.55

5.37

0.187

0.019

2.32

33.10

37.12

0.298

0.308

9.86

9.27

0.406

0.039

Experimental values of studied responses. 2 Predicted values of studied response.

Shimadzu, Kyoto, Japan), equipped with SPD-10AV UV-Vis detector, a LC-10A pump system, and a CT-10A oven, at 295 nm. The separation was performed on a Nova-PakÒ C18 (4 μm, 3.9 300 mm) waters PLC column, using an isocratic mobile phase of methanol: water (99:1 v/v) at 1 ml/ min, injection volume of 40 μL and oven temperature of 40 °C. The sample extraction procedures prior to injection were carried out according to Anarjan et al. [12]. The calibration of peak area versus α-tocopherol concentration was linear in the concentration range of 0.05–0.5 mg/ml. All the results were expressed in mg/ml [11]. The concentration of α-tocopherol in each sample was measured after the evaporation process, and the loss (percentage) of αtocopherol was obtained using equation 1 (eq. 2).

α tocopherol loss ð% w=wÞ ¼ ½ðC CÞ=C 100

ð1Þ

where C and C* were the α-tocopherol content of samples after evaporation step and theoretical concentration of αtocopherol, respectively. C* was different for each sample and calculated as:

C ¼ z1 =ð100 z2 Þ

ð2Þ

z1 and z2 were the α-tocopherol and acetone concentrations in each sample, in turn.

Turbidity measurements A turbidity technique was used to describe the optical characteristics of the prepared nanodispersions. Spectrophotometers have a scale that reads in O.D. (absorbance) Ó 2019 Hogrefe

units. The turbidity at 600 nm was determined using a UV-visible spectrophotometer (Ultraspec pharamacia biotech 2000 England, Biochrom Ltd Cambridge, UK). Water was used as references for each treatment [13].

Experimental design Response surface methodology (RSM) was used to find out suitable relationships between selected independent parameters, namely, weight ratio of emulsifier to α-tocopherol (x1) and volume percent of acetone (x2), on particle size (y1), PDI (y2), α-tocopherol loss percentage (y3) and turbidity (y4). Generation large amount of information based on small number of experiments and the opportunity of assessing the interaction effects between independent variables are some advantages of RSM over one factor at a time statistical process [12]. Central composite design (CCD) is the most prevalent design of experiment applied in RSM, which was used in experimental design of this study [4, 12]. Each independents parameters were studied at five levels, specifically, central points (x1:5.5%, x2:28%), level 1 (x1:10%, x2:50%), level 1 (x1:1%, x2:5%), level α (x1:8.68%, x2:43%), and level α (x1:2.32%, x2:12%). α is the distance of star point from the center where, k is the number pffiffiffiffiof factors. The α value was obtained from the equation K and for K = 2 (two independent variables) it corresponded to 1.4142. The central point, which replicated five times for the assessment of pure error, was the point in which the independent parameters were set at their middle levels. Since during experimental design the defined levels were set as axial points, at factorial points (levels 1 and +1), the Int J Vitam Nutr Res (2020), 90 (1–2), 5–16

N. Jaberi et al., Preparation of α-tocopherol nanodispersions

Table 2. Regression coefficients, R2, adjusted R2 (R2-adj) and probability values for the final reduced models suggested for characteristics of α-tocopherol nanodispersions Regression coefficientsa

Particle size (nm)

α-tocopherol loss (%w/w)

Polydispersity

Turbidity

β0 (constant)

44.874

0.1973

24.0089

0.77083

β1 (main effect)

1.4964

0.0386

5.7800

0.117680

1.1436

0.0052

0.45

0.018562

β2 (main effect) β11 (quadratic effect)

0.6610

β22 (quadratic effect)

0.3277

0.0370

0.0002

0.0148

β12 (interaction effect)

0.1865

0.0014

0.0495

0.896

0.943

0.984

R2-adj

0.882

0.915

0.972

p-value (regression)

0.002

<0.001

ns 0.000343 ns 0.910 0.8381 <0.001

a β0 is a constant, βi, βii and βij are the linear, quadratic and interaction coefficients of the quadratic polynomial equation, respectively. 1: weight ratio of tween 20 to α-tocopherol; 2: volume percent of acetone. ns Not significant (p > 0.05).

Table 3. The significance probability (p-value, F-ratio) of regression coefficients for the final reduced models suggested for characteristics of α-tocopherol nanodispersions Main effects Response variablesa

Quadratic effects x2

x12

Interaction effects x22

x1x2

Particle size (Y1, nm) p-value F-ratio

0.001 29.06

0.368

0.023

0.93

8.41

16.15

0.005

0.019

0.005

<0.001

57.73

59.21

9.16

Polydispersity (Y2) p-value

0.682ns

F-ratio

0.18

14.26

α-Tocopherol loss (Y3, %w) p-value

<0.001

F-ratio

77.56

0.002 24.29

<0.001 110.5

<0.001 137.92

0.001 34.55

(Y4)Turbidity p-value F-ratio

0.0022 10.876

0.049

0.044

6.703

7.2029

1: weight ratio of tween 20 to α-tocopherol, 2: volume percent of acetone. ns Not significant (p-value > 0.05).

factors were set at their defined minimum and maximum levels. The positions of star points ( α, +α) were denoted by α as normalized levels ± α, which lied between the axial and central points. Thus, a total of 13 experiments, including four factorial points, four star points, and five central points were created by the software Minitab V.14 statistical package (Minitab Inc., PA, USA) (Table 1). All samples were fabricated in one day [1].

Statistical analysis Second-order polynomial equations were used to describe the response variables as a functional of the independent variables, as follows:

yi ¼ β0 þ β1 x1 þ β2 x2 þ β11 x21 þ β22 x22 þ β12 x1 x2 ½14 ð3Þ where yi symbolizes the response variable, β0 is the constant, βi, βii and βij are the linear, quadratic and Int J Vitam Nutr Res (2020), 90 (1–2), 5–16

interaction coefficient, correspondingly. The coefficients of regression equations were determined using regression analysis. Analysis of variance (ANOVA) were also performed to estimate the significance of models and significant terms in selected model using p-value and F-ratio from the pure error obtained from replicates at the central point. The terms with p-values less than 0.05 were considered as statistically significant. The final reduced models were attained after removing the insignificant terms from initial model (eq. 3). However, even with insignificant main effect of studied concentration parameters on some responses, they were reserved in final models due to their either quadratic or interaction significant (p-value < 0.05) effects (Tables 2 and 3) [4]. The Anderson-Darling normality tests were also performed for the responses’ residuals (residual = predicted value – experimental value) and the results were shown in Ó 2019 Hogrefe

N. Jaberi et al., Preparation of α-tocopherol nanodispersions

Figure 1. The responses residual probability plots for normality tests.

Figure 1. As can be seen in this figure, the p-values of all residual probability plots were more than 0.05. Then the assumption of normal distribution for all responses residuals can be verified. Furthermore, the equality of variances were confirmed by F-tests and given p-values (0.85, 0.92, 0.88 and 0.06 for mean particle size, PDI, α-tocopherol loss and turbidity, respectively), which were higher than 0.05. The adequacy of model was examined from coefficient of determination (R2) and adjusted coefficient of determination (R2-adj) values. Higher R2 values (approximate to 1) corresponds to more ability to prediction the response variation based on independent parameters’ changes. For the graphical analysis of the independent variable interaction, 3D surface plots of the regression models were used successfully [14]. The single and multiple optimizations were conducted to find optimum levels of two formulation parameters resulting in the desirable response variables purpose. In the numerical optimization, the exact best level of independent variables leading to the most desirable response variables was attained using response optimizer (Minitab V.14 statistical package). The graphical optimization was also Ó 2019 Hogrefe

performed using overlaid counter plots of independent factors in desired ranges of responses. The suitability of predicted models was proved by comparison of experimental data with calculated ones. Moreover, optimum sample was prepared and their response variables were compared with their predicted value, in order to check the validity of the models.

Results and discussions Fitting models Response-surface analysis offered empirically significant (p-value < 0.05) models to estimate the variations of particle size (p-value = 0.002), polydispersity (p-value < 0.001), α-tocopherol loss (p-value < 0.001) and turbidity (p-value = 0.009) as a function of emulsifier to α-tocopherol weight ratio and volume ratio of acetone to water. All regression coefficients, corresponding R2 and R2-adj, individual significance F-ratio and p-value of the independent variables are shown in Tables 2 and 3. Int J Vitam Nutr Res (2020), 90 (1–2), 5–16

The high obtained coefficients of determinations (R2 > 0.896, R2-adj > 0.8381) (Table 2) have also shown that more than 83% of variability of the studied physicochemical characteristics of the prepared nanodispersions can be predicted by recommended models in this study. In significance determination of terms, lower p-value and higher F-ratio corresponds to more significance of terms on studied response variations. Furthermore, it should be noted that the suggested models, might be significant (p-value < 0.05) only in studied ranges and may not be generalized outside of these ranges [12]. As shown in Table 3, the concentration parameters had significant (p-value < 0.05) effects on all selected characteristics of produced nanodispersions. The main effect of the weight ratio of emulsifier to α-tocopherol was the most significant (p-value < 0.05) on both particle size and turbidity of nanodispersions. On the other hand, the interaction effect of two parameters was the most significant on polydispersity variation and the quadratic effect of acetone to water (%v/v) was the most significant term on prediction of α-tocopherol loss changes. It also can be seen that the quadratic effect of aceton to water (%v/v) affected all selected responses significantly (p-value < 0.05).

Particle size The mean particle size of prepared α-tocopherol nanodispersions was significantly (p-value < 0.05) described by a full quadratic regression model (R2 = 0.896), because all main, quadratic and interaction effects of selected formulation parameters were significant on this response (Table 2). The negative coefficients of both main and quadratic terms of emulsifier to α-tocopherol weight ratio indicated a decrease in particle size by increasing of this independent factor, especially at low levels. Furthermore, the positive main and negative quadratic coefficients of acetone to water also revealed the increases of particle size by increasing the acetone concentration up to certain levels. Further increases in acetone concentration caused the particle size to decrease (Table 2, Figure 2). As previously stated, the most significant term on mean particle size variation was the main effect of Tween 20/αtocopherol (w/w), because of its less p-value and higher F-ratio (Table 3). The negative interaction effect of the concentration parameters revealed that instantaneously increasing (or decreasing) of the independent variables led to production of bigger nanodispersions, compared to using high emulsifier and low acetone concentrations or contrariwise (Table 2 and Figure 2). Consequently, the smallest particles could produce in middle to high levels of emulsifier to α-tocopherol weight ratio and low levels acetone to water volume percent. Int J Vitam Nutr Res (2020), 90 (1–2), 5–16

N. Jaberi et al., Preparation of α-tocopherol nanodispersions

As most emulsion system, nanodispersions are thermodynamically unstable but kinetically stable systems. Nanoemulsions or nanodispersions are transparent dispersion systems having great stability against destabilization mechanisms such as creaming, sedimentation, coalescence or flocculation. The exceptional stability of nanodispersions is attributed to their very small particle sizes and their Brownian motion enables an inordinate reduction of gravitational effects [14]. However, gravity is the main cause of sedimentation and creaming occurring during storage of microemulsions, the major cause of instability in nanodispersion systems is claimed to be the Ostwald ripening mechanism [4, 12, 15]. The formation of nanodispersions with small particle sizes is depended on the balance among the physical process of particle disruption, coalescence and the interfacial forces that tend to keep the particles together [4, 12]. Therefore, surface active molecules play key roles in the creation and stability of nanodispersions. The adsorbed emulsifier molecules decrease the interfacial tension between the phases and form a protective coat around the particles to prevent aggregation. By depressing the interfacial tension, less energy is necessary through homogenization process to splitting up the particles [15]. According to the results reported by Chu et al. [16] and Mainardes and Evangelista [17], an increase in concentration of emulsifier caused a decrease in particle size of dispersed phase in all emulsion systems. However, other researchers such as Lobo and Svereika [18] and Anarjan et al. [14], established two opposite effects for emulsifier concentrations on the particle size of dispersed phase in emulsions; an emulsifier-poor regime, in which particle size decreases with increasing emulsifier content, and emulsifier-rich regime, in which particle size does not depend on emulsifier concentration or grow with increasing the concentration of emulsifier [10]. As can be seen in Figure 2, at low solvent concentrations, particle size was decreased by raising the emulsifier concentration, which was expected due to stabilizing function of an emulsifier [10, 14]. However, this trend was soften and inversed by increasing the acetone concentration. These observations were in good agreement with our previous study reported by Anarjan et al. [14]. Mainardes and Evangelista [17] also found that an increase in the organic phase concentration led to a slight decrease in particle size; contrary, Anarjan et al. [14] and Chu et al. [16] reported an increase in particle size with increasing organic phase concentrations. The results of this study presented a growth in particle size of nanodispersions by increasing the solvent phase, at high emulsifier concentrations. However, this effect was inversed at low levels of emulsifier concentrations (Figure 2). After evaporation of solvent, at high acetone samples, the concentrated system was more prone to particle coalescence through bridging Ó 2019 Hogrefe

N. Jaberi et al., Preparation of α-tocopherol nanodispersions

Figure 2. Contour (a) and response surface (b) plots for mean particle size of α-tocopherol nanodispersions as function of significant (p<0.05) interaction effects between weight ratio of Tween 20 to α-tocopherol and volume percent of acetone.

Figure 3. Contour (a) and response surface (b) plots for polydispersity of α-tocopherol nanodispersions as function of significant (p<0.05) interaction effects between weight ratio of Tween 20 to α-tocopherol and volume percent of acetone.

flocculation, depletion flocculation, and other mechanisms, particularly at high emulsifier contents [14]. The individual optimum optimization procedure showed that the minimum particle size (< 20 nm) would be obtained by 10% w/w emulsifier (to α-tocopherol) and 28% v/v acetone (to water).

Polydispersity The result showed that concentration variables had also significant (p-value < 0.05) effects on the polydispersity changes (Tables 2 and 3). Thus the polydispersity of produced nanodispersions could be described as a function of emulsifier to α-tocopherol weight ratio and volume percent of acetone. The final reduced model showed a relatively high coefficients of determination (R2 = 0.943), revealed that more than 94% of polydispersity behavior of system could be predicted by presented regression model. Ó 2019 Hogrefe

It was shown that the single and quadratic effects of emulsifier concentration in studied system were not significant on polydispersity value of produced nanodispersions. However, its interaction with acetone content was significantly negative on this response variation (Tables 2, 3). The negative interaction effects as well as the negative single and positive quadratic effects of solvent content indicated that using simultaneously less (or high) concentrations of emulsifier and solvent would lead to production of less polydisperse nanodispersions. As shown in Figure 3, at low emulsifier concentrations, an increase in the organic phase concentration increased the polydispersity, while at high emulsifier concentrations, it operated inversely. Previous researchers have reported various results for the effect of emulsifier concentrations on polydispersity; Chu et al. [16] and Mainardes and Evangelista [17] recounted that the polydispersity of nanodispersions was reduced by increasing the emulsifier content. Anarjan et al. [14] reported inverse trend for variation of Int J Vitam Nutr Res (2020), 90 (1–2), 5–16

N. Jaberi et al., Preparation of α-tocopherol nanodispersions

Figure 4. Contour (a) and response surface (b) plots for α-tocopherol loss (%w/w) of freshly produced nanodispersions as function of significant (p<0.05) interaction effects between weight ratio of Tween 20 to α-tocopherol and volume percent of acetone.

polydispersity by emulsifier content. Moreover, they observed less variations of this response by changes the solvent content, which was not agreed to our results. The observed difference may be related to selected dissimilar nanoparticle formation technique in these two works. It was shown that in high energy techniques, homogenization parameters played important role on homogeneity of systems, while in low energy techniques phase separation parameters affects more considerably the homogeneousness of nanodispersions [19]. In solvent displacement process, less acetone content, at less emulsifier concentrations caused a rapid supersaturation and less crystal growth, resulting uniform particle formation [14, 19]. However, decreasing the polydispersity with increasing the solvents content at high emulsifier concentrations has not explained yet. The individual optimum concentrations for the production of more uniform and uni-sized nanodispersions were predicted to be in 8.68% weight ratio of emulsifier to α-tocopherol and 43% the volume percent of acetone.

content caused an increase in chemical stability of nanodispersions. However, further increase of emulsifier content affected this response, reversely. On the other hand, increasing the acetone content of system caused a decrease in α-tocopherol content of nanodispersions, and this effect was moderated at high levels of acetone concentrations. The reduction in α-tocopherol loss with increasing emulsifier concentration (Figure 4) was due to protective effect of the emulsifier against lipid oxidation of the active compound by modifying the particle interface characteristics [10]. Increasing the α-tocopherol loss of nanodispersions by increasing the solvent content is related to needed severer evaporation condition (higher time or temperature) for solvent removal process, leading to more degradation of α-tocopherol that is sensitive to heat, light and oxygen exposure [4, 12, 14]. The individual optimization predicted that using Tween 20 to α-tocopherol with weight ratio of 5.5 and 50% acetone can produced the α-tocopherol nanodispersions with the least α-tocopherol loss.

α-tocopherol loss

Turbidity

As shown in Tables 2 and 3, the variation of α-tocopherol loss in produced nanodispersions was significantly (p-value < 0.05) fitted to nonlinear second-order regression equation with relatively high coefficient of determination (R2 = 0.984). All single, quadratic and interaction effects of selected independent variables were significant on α-tocopherol loss of nanodispersions during mixing and evaporation processes. As clearly observed in Table 3, the emulsifier concentration affected α-tocopherol loss more pronounced compared to acetone content (less p-value and higher F-ratio). The negative main and positive quadratic effects of emulsifier to α-tocopherol ratio revealed that increasing the emulsifier

One of the main differences between nanodispersions and conventional dispersions are their transparency, which is related to extent of their light scattering [7]. However, there has been a lack of studies describing the appearance of these systems. The nanodispersions with less turbidity were desired in most applications such as fortifying the food formulations such as clear fruit juices [7, 18]. Turbidity of produced α-tocopherol nanodispersions were also significantly (p-value < 0.05) fitted to nonlinear polynomial regression model like other studied response variables with acceptable high coefficient of determination (R2 = 0.910). As shown in Tables 2 and 3, the main effect of emulsifier to α-tocopherol ratio (w/w) on turbidity of nanodispersions

Int J Vitam Nutr Res (2020), 90 (1–2), 5–16

Ó 2019 Hogrefe

N. Jaberi et al., Preparation of α-tocopherol nanodispersions

Figure 5. Contour (a) and response surface (b) plots for turbidity of freshly produced α- tocopherol nanodispersions as function of significant (p<0.05) interaction effects between weight ratio of Tween 20 to α-tocopherol and volume percent of acetone.

was significantly negative. Therefore, the increasing of emulsifier content caused the turbidity to decrease (Figure 5). Furthermore, the negative main and positive quadratic effects of used acetone volume percent showed that increasing the solvent phase caused a decrease in turbidity up to certain value. Further increase in this formulation parameter affected the turbidity, inversely. When light passes through nanodispersions, light scattering in the visible region by α-tocopherol controls their turbid appearance. The degree of light scattering depends on particle size, particle concentration and the refractive index difference between the particles continuous phase. The free emulsifier content of system affects the refractive index of phases [7, 20]. It was shown that a colloidal dispersion with particle size less than 100 nm looks transparent or semitransparent depending on either particle size and concentration or the concentration of free emulsifier molecules. Thus, one way to reduce the turbidity is to reduce the particle size [20]. The comparison between the particle size and turbidity changes of nanodispersions in current research (Figures 2 and 5) showed that generally the nanodispersions with less particle size were less turbid. These results are in reasonable agreement with previous researches [7, 20]. Decreasing the turbidity with increasing the emulsifier concentration can also be related to decrease of differences between refractive indices of two phases in produced nanodispersions. Unlike previous studied it was not shown any linear relationship between particle size and turbidity of produced nanodispersions [20].

Optimization of Concenteration Parameters for the Production of α-tocopherol Nanodispersions The α-tocopherol nanodispersions would be considered as best product if it hold the smallest mean particle size, Ó 2019 Hogrefe

polydispersity, α-tocopherol loss (% w/w) and turbidity. Therefore, an overlaid contour plot as a graphical optimization approach was used to find the optimum region for selected formulation variables in order to produce the most desirable α-tocopherol nanodispersions (Figure 6). The best ranges for selected independent variables to gain the optimum product were shown as white colored area in Figure 6. It can be seen that the most desirable αtocopherol nanodispersions would be obtained at weight ratio of emulsifier to α-tocopherol ranges around 5–7 and the volume percent of acetone about 10 to 45. Numerical multiple optimization was also performed to find the exact optimum levels of studied mixing variables. The results predicted 6.5 and 10 for emulsifier to αtocopherol weight ratio and acetone volume percent, respectively, as optimum levels for production the best

Figure 6. Overlaid contour plot of particle size, polydispersity, αtocopherol loss and turbidity with acceptable levels as function of weight ratio of Tween 20 to α-tocopherol and volume percent of acetone. Int J Vitam Nutr Res (2020), 90 (1–2), 5–16

Figure 7. Particle size distribution for optimum suggested α-tocopherol nanodispersions (Prepared with 6.5 and 10 of tween 20 to αtocopherol weight ratio and acetone volume percent, respectively.

nanodispersions with 27 nm, polydispersity of 0.329, 6.52% α-tocopherol loss (% w/w) and turbidity of 0.1099. The particle size distribution of prepared triplicated optimum nanodispersions were presented in Figure 7. It can be seen that the suggested optimum nanodispersions had mono-modal distribution with good consistency of replications. Moreover, the insignificant differences found between the predicted and experimental values of the best

N. Jaberi et al., Preparation of α-tocopherol nanodispersions

sample were re-confirmed the suitability of final reduced models fitted by the RSM for all responses. The adequacy of the presented regression models obtained was checked by plotting the experimental values versus predicted ones. For all responses the linear plots with intercepts of zero and slope of and high coefficients of variations (R2 > 0.896) confirmed the similarity of predicted and experimental values (Figure 8). Therefore the adequacy of the models was confirmed. The overall closeness between the predicted and experimental values of the responses could also be concluded from the p-values of t-test analysis between them (p-value = 1.00 for all four responses).

Stability evaluation of prepared optimum α-tocopherol nanodispersion over time The mean particle size, polydispersity, α-tocopherol loss and turbidity of the optimum α-tocopherol nanodispersion were monitored over four weeks of storage at 4 °C to evaluate its physical and chemical stabilities. The results were reported in Table 4. While no significant changes were

Figure 8. Fitted line plot between the experimental and predicted values of particle size, polydispersity, α-tocopherol loss (%w/w) and turbidity. Int J Vitam Nutr Res (2020), 90 (1–2), 5–16

Ó 2019 Hogrefe

N. Jaberi et al., Preparation of α-tocopherol nanodispersions

Table 4. The changes on characteristics of optimum α-tocopherol nanodispersions during four week storage at 4 °C Fresh sample Mean particle size (nm) Polydispersity α-tocopherol loss (% w/w) Turbidity

29±5.5

26±6.2

0.33±0.080 5.9±1.12

After 2-week storage

0.105±0.008

31±4.5a

0.36±0.095 7.9±0.90

After 4-week storage

0.108±0.005

0.38±0.055a 9.5±1.05b

0.107±0.010a

Values are mean ± standard deviation (n = 3). a–b Different letters indicate statistically difference (p-value < 0.05) between response values in which comparison tests were performed between similar responses of each row (storage time).

observed for mean particle size, polydispersity and turbidity of optimum α-tocopherol nanodispersion, the α-tocopherol loss of sample were increased significantly (p-value < 0.05) during 4 weeks storage. Thus, no coalescence occurred in the optimum nanodispersion over studied storage time. Consequently, the physical stability of sample could be confirmed. But, the significant (p-value = 0.015) decrease in α-tocopherol content (α-tocopherol loss) of the prepared nanodispersion revealed its limited chemical stability during storage. α-Tocopherol is sensitive to light and oxygen like carotenoids [1, 7]. Therefore, the presence of light and oxygen in storage environment caused the α-tocopherol loss in studied nanodispersions. Consequently, either any modification of atmosphere such as storage under nitrogen or storage at dark room can preserve the α-tocopherol content of prepared nanodispersions, considerably [7, 14].

Conclusion RSM was used in this study to acquire empirically significant (p-value < 0.05) models predicting the most important physicochemical characteristics of α-tocopherol nanodispersions, namely, mean particle size, polydispersity, α-tocopherol loss and turbidity, as a function of emulsifier to αtocopherol weight ratio and volume percent of acetone. The results revealed the usefulness of CCD for studying the effects of the main formulation parameters on the selected responses and optimizing them with the intention of getting the most desirable nanodispersions with minimum particle size, polydispersity, α-tocopherol loss and turbidity. Therefore, second order polynomial regression models were offered to express the correlations between selected the most important concentration variables and nanodispersions’ characteristics. It was demonstrated that using Tween 20 to α-tocopherol with the weight ratio of 6.5 and acetone to water with the volume percent of 10 would provide the α-tocopherol nanodispersions with minimum particle size (27 nm), polydispersity (0.329) and α-tocopherol loss (6.52%) and turbidity (0.1099). Ó 2019 Hogrefe

No significant differences between the experimental and predicted values of responses confirmed the suitability of models. Therefore, the bottom-up solvent-displacement technique could successfully produce the water dispersed α-tocopherol nanoparticles with the most desirable characteristics (minimum particle size, PDI, α-tocopherol loss and turbidity) for e.g. water-based food, cosmetic and pharmaceutical uses.

References 1. de Carvalho, S.M., Noronha, C.M., Floriani, C.L., Lino, R.C., Rocha, G., & Bellettini, I.C., et al. (2013) Optimization of αtocopherol loaded solid lipid nanoparticles by central composite design. Ind. Crop. Prod. 49, 278–285. 2. Khayata, N., Abdelwahed, W., Chehna, M.F., Charcosset, C., & Fessi, H. (2012) Preparation of vitamin E loaded nanocapsules by the nanoprecipitation method: from laboratory scale to large scale using a membrane contactor. Int. J. Pharmaceut. 423, 419–427. 3. Silva, H.D., Cerqueira, M.A., Souza, B.W.S., Ribeiro, C., Avides, M.C., & Quintas, M.C., et al. (2011) Nanoemulsions of β-carotene using a high-energy emulsification–evaporation technique. J. Food Eng. 102, 130–135. 4. Anarjan, N., Mirhosseini, H., Baharin, B.S., & Tan, C.P. (2010) Effect of processing conditions on physicochemical properties of astaxanthin nanodispersions. Food Chem. 123, 477–483. 5. Geyer, J., Netzel, M., Bitsch, I., Frank, T., Bitsch, R., & Krämer, K., et al. (2000) Bioavailability of water- and lipid-soluble thiamin compounds in broiler chickens. Int. J. Vit. Nutr. Res. 70, 311–316. 6. Yang, Y., & McClements, D.J. (2013) Encapsulation of vitamin E in edible emulsions fabricated using a natural surfactant. Food Hydrocolloid. 30, 712–720. 7. Soukoulis, C., & Bohn, T. (2018) A comprehensive overview on the micro- and nano technological encapsulation advances for enhancing the chemical stability and bioavailability of carotenoids. Crit. Rev. Food Sci. Nutr. 58, 1–36. 8. Thorat, A.A., & Dalvi, S.V. (2012) Liquid antisolvent precipitation and stabilization of Nanoparticles of poorly water soluble drugs in aqueous suspensions: Recent developments and future perspective. Chem. Eng. J. 181–182, 1–34. 9. McClements, D.J. (2004). Food emulsions: Principles, practice, and techniques, pp. 632. CRC Press, Boca Raton, Florida. 10. Anarjan, N., & Tan, C.P. (2013) Effects of selected polysorbate and sucrose ester emulsifiers on the physicochemical properties of astaxanthin nanodispersions. Molecules. 18, 768–777.

Int J Vitam Nutr Res (2020), 90 (1–2), 5–16

11. Cheong, J.N., Tan, C.P., Man, Y.B.C., & Misran, M. (2008) αTocopherol nanodispersions: Preparation, characterization and stability evaluation. J. Food Eng. 89, 204–209. 12. Anarjan, N., Jaberi, N., Yeganeh-Zare, S., Banafshehchin, E., Rahimirad, A., & Jafarizadeh-Malmiri, H. (2014) Optimization of mixing parameters for α-tocopherol nanodispersions prepared using solvent displacement method. J. Am. Oil Chem. Soc. 91, 1397–1405. 13. Ziani, K., Fang, Y., & McClements, D.J. (2012) Fabrication and stability of colloidal delivery systems for flavor oils: Effect of composition and storage conditions. Food Res. Int. 46, 209– 216. 14. Anarjan, N., Nehdi, I.A., & Tan, C.P. (2013) Influence of astaxanthin, emulsifier and organic phase concentration on physicochemical properties of astaxanthin nanodispersions. Chem. Cent. J. 7, 127. 15. Anarjan, N., Mirhosseini, H., Baharin, B.S., & Tan, C.P. (2011) Effect of processing conditions on physicochemical properties of sodium caseinate-stabilized astaxanthin nanodispersions. LWT-Food Sci. Tech. 44, 1658–1665. 16. Chu, B.-S., Ichikawa, S., Kanafusa, S., & Nakajima, M. (2007) Preparation of protein-stabilized β-carotene nanodispersions by emulsification-evaporation method. J. Am. Oil Chem. Soc. 84, 1053–1062. 17. Mainardes, R.M., & Evangelista, R.C. (2005) PLGA nanoparticles containing praziquantel: effect of formulation variables on size distribution. Int. J. Pharmaceut. 290, 137–144.

Int J Vitam Nutr Res (2020), 90 (1–2), 5–16

N. Jaberi et al., Preparation of α-tocopherol nanodispersions

18. Lobo, L., & Svereika, A. (2003) Coalescence during emulsification. 2. Role of small molecule surfactants. J. Colloid Interface Sci. 261, 498–507. 19. Joye, I.J., & McClements, D.J. (2013) Production of nanoparticles by anti-solvent precipitation for use in food systems. Trends Food Sci. Tech. 34, 109–123. 20. Chen, C.C., & Wagner, G. (2004) Vitamin E nanoparticle for beverage applications. Chem. Eng. Res. Des. 82, 1432–1437. History Received July 9, 2015 Accepted January 28, 2016 Published online November 14, 2019 Conflict of interest The authors declare that there are no conflicts of interest. Publication ethics This work didn’t include human subjects or animals. Navideh Anarjan, PhD Assistant Professor Tabriz Branch-Islamic Azad University Pasdaran Highway Tabriz Iran anarjan@iaut.ac.ir

Ó 2019 Hogrefe

Original Communication

The Effect of Vitamin D on Serum Asymmetric Dimethylarginine in Patients with Mild to Moderate Ulcerative Colitis Mohammad Javad Hosseinzadeh-Attar1, Amrollah Sharifi2, Saharnaz Nedjat3, Ashraf Mohamadkhani4, and Homayoon Vahedi4 1

Department of Clinical Nutrition, School of Nutritional Sciences and Dietetics, Tehran University of Medical Sciences, Tehran, Iran

Golestan Research Center of Gastroenterology and Hepatology, Golestan University of Medical Sciences, Gorgan, Iran

Epidemiology and Biostatistics department, School of Public Health, Knowledge Utilization Research Center, Tehran University of Medical Sciences, Tehran, Iran

Digestive Diseases Research Center, Shariati Hospital, Tehran University of Medical Sciences, Tehran, Iran

Received: October 20, 2016; Accepted: February 21, 2017 Abstract: Purpose: In inflammatory bowel disease increased asymmetric dimethylarginine (ADMA) levels could inhibit nitric oxide (NO) synthase. Vitamin D may increase activity and expression of endothelial NO synthase, which could be done through its possible mechanism of decreasing ADMA levels. The aim of this study is to investigate the possible effect of Vitamin D3 on serum ADMA levels in ulcerative colitis (UC) patients. Methods: Ninety mild to moderate UC patients were randomized. Each patient received one single muscular injection of 300,000 IU (7500 μg) Vitamin D3 (Vitamin D group) or 1 ml normal saline (Placebo group). At baseline and 90 days after the intervention measurements were done. Data were analyzed using independent t-test and analysis of covariance. Baseline correlations were assessed by Pearson and Spearman correlation coefficients. Results: Following data analysis of 86 participants (40 in placebo and 46 in vitamin D group), there was no correlation between baseline ADMA with baseline vitamin D, ESR and hs-CRP at baseline (p = 0.77) and at the end of study (p = 0.82). Serum ADMA levels were not statistically different between two groups. Adjustment for baseline ADMA levels and baseline body mass index (BMI) did not change the results. With subgroup analyses based on gender and vitamin D level no statistical differences in ADMA levels between two groups were found. Conclusions: In this study, we found no significant changes in serum ADMA levels 3 months following a high dose vitamin D administration in mild to moderate UC patients. Further studies in vitamin D deficient patients are needed. Keywords: Asymmetric dimethylarginine, vitamin D, inflammatory bowel diseases, ulcerative colitis

Introduction Ulcerative colitis (UC) and Crohn’s disease (CD) are two forms of relapsing-remitting inflammatory bowel diseases (IBD) that cause ulcers and inflammation in the alimentary tract. Bloody diarrhea with or without mucus is the hallmark feature of UC and the inflammation and ulcers are limited to the large intestine [1, 2]. There are evidences of microvascular endothelial dysfunction in IBD patients [3]. Impaired vasodilation has been demonstrated in intestinal microvessels in this group of patients [4]. Furthermore, the microcirculation of uninvolved parts of the intestine remained unaffected, Ó 2019 Hogrefe

indicating that the local endothelial dysfunction is not related to systemic inflammation [5]. Later studies showed that the endothelial dysfunction is generalized in IBD, not limited to the alimentary tract [6, 7]. It has already been shown that L-arginine metabolism is altered in the alimentary tract of IBD animal models [8] with beneficial effect of L-Arg supplementation [9, 10] suggesting that L-Arg uptake by inflamed colon cells might be defected, which could be a part of the UC pathogenesis [11]. Asymmetric dimethylarginine (ADMA) is a competitive antagonist of endothelial conversion of L-arginine to nitric oxide that inhibits the nitric oxide synthase (NOS) [12]. Serum ADMA levels are increased in various inflammatory Int J Vitam Nutr Res (2020), 90 (1–2), 17–22 https://doi.org/10.1024/0300-9831/a000303

M.J. Hosseinzadeh-Attar et al., Vitamin D effect on ADMA in UC patients

diseases [13–15]; There are also enhanced ADMA levels in IBD that might be associated with oxidative stress and endothelial dysfunction [16]. Vitamin D is unique fat soluble vitamin among hormones and vitamins that can be made in the skin from the precursor 7-dehydrocholesterol by the effect of sunlight. It is also present in some foods like oil-rich fishes and mushrooms [17]. Serum vitamin D levels show seasonal fluctuation, with highest in autumn, while ADMA levels show a reciprocal pattern [18]. Low 25(OH) vitamin D3 levels are associated with increases in ADMA and high-sensitivity C-reactive protein (hs-CRP) concentrations in normal population [18]. It is not clear if there is a real relationship between vitamin D and ADMA. The aim of this study was to evaluate the effect of Vitamin D3 on serum ADMA levels in patients with mild to moderate ulcerative colitis.

Method and materials This study was a double-blind randomized controlled trial with 1:1 ratio parallel design. The methods and materials have been explained in detail before [19]. Briefly the calculated total sample size with 80% power using a 2-sided test at the 5% significance level and considering 5% loss to follow-up was 90 persons [16, 20]. One hundred and sixty five patients were invited for assessing eligibility to participate in the trial between December 2014 and January 2015; of which 39 persons declined to participate and 36 persons did not meet the criteria. Ninety UC patients were randomized manually using Stratified Blocked Randomization method. Strata were based on age (equal or lower than 35 years/higher than 35 years) and BMI (equal or lower than 25/higher than 25 kg/m2) with blocks of 4. All the patients were previously diagnosed by standard clinical, radiographic, endoscopic, and histopathologic criteria. Based on Truelove and Witts’ severity index, their disease statuses were mild to moderate at the beginning of study [21]. Exclusion criteria were: Body Mass Index (BMI) lower than 18.5 or higher than 30 Kg/m2; age less than 18 and more than 50 years; taking any form of Vitamin D3 supplement in the 3 months preceding the study; AntiTNF-alpha therapy; pregnancy and breastfeeding; history of various diseases including hyperparathyroidism, nephrolithiasis, malignancy or renal or hepatic failure. Each patient received one muscular injection of 1 ml 300,000 IU (7500 μg) Vitamin D3 – SunVit 300000 U AMP, Iran hormone (Vitamin D group) or 1 ml normal saline (Placebo group). Investigators and participants were kept masked to allocation. Intervention staff who delivered the intervention did not take outcome measurements. At baseline and 90 days after the intervention blood samplings and measurements were done. Serum ADMA levels Int J Vitam Nutr Res (2020), 90 (1–2), 17–22

were measured using commercial ELISA kit (Bioassay Technology, Shanghai, China). Statistical analyses were performed using STATA version 12 (Stata Statistical Software, College Station, TX, USA). The results are expressed as mean ± standard deviation (SD) or number (%). Independent T-test was done to compare the variables after test for normality using Kolmogorov-Smirnov test. Analysis of covariance was done for adjustment of covariates. Baseline correlations were assessed by Pearson and Spearman correlation coefficients. The study was approved by Tehran University of Medical Sciences Ethics Committee, and written informed consent was obtained from all participants before enrolment. This clinical trial was registered at the Iranian registry of Clinical trials (IRCT): IRCT2014062318207N1.

Results Baseline comparisons were done for all 90 participants. Four patients in placebo group withdrew the study; there were no significant differences between these four patients and the others regarding baseline characteristics. At the end study, data of 86 participants (40 from the placebo and 46 from vitamin D group) were analyzed (Fig. 1). Intention-to-treat (ITT) analyses were also performed, but it did not change the results regarding statistical significancy. Clinical and demographic characteristics of participants were comparable for intervention vs. control group at baseline (age: 37.5 ± 9.0 vs. 35.0 ± 9.2 years, p = 0.19; Disease duration: 8.4 ± 5.6 vs. 8.3 ± 5.7 years, p = 0.98; Body Mass Index: 25.0 ± 3.5 vs. 25.6 ± 3.5 Kg/m2, p = 0.45; Heart rate: 80.3 ± 9.7 vs. 80.9 ± 8.0 beats/min, p = 0.73; Systolic blood pressure: 114.6 ± 10.7 vs. 115.7 ± 11.3 mmHg, p = 0.63; Diastolic blood pressure: 76.5 ± 10.1 vs. 76.6 ± 10.2 mmHg, p = 0.97; Body temperature: 36.3 ± 0.4 vs. 36.3 ± 0.5 Celsius, p = 0.94; respectively); and also there were no significant statistical differences between intervention and control groups regarding gender (26 men and 20 women vs. 25 men vs. 19 women respectively, p = 0.98) and type of drugs. Additional baseline characteristics have already been discussed [19]. Baseline serum 25-OH-Vitamin D3 (33.3 ± 7.0 vs. 32.9 ± 9.6 ng/ml respectively, p = 0.82), Calcium (9.15 ± 0.40 vs. 9.07 ± 0.39 mg/dl respectively, p = 0.34) and PTH levels (35.3 ± 14.2 vs. 35.6 ± 12.0 pg/ml respectively, p = 0.90) were not statistically different between two groups. Following vitamin D intervention, its level increased significantly in vitamin D group (p < 0.001) but not in placebo group (p = 0.13). There were also significant increases in Calcium levels only in Vitamin D group (p < 0.001). On the other hand, PTH levels decreased significantly in vitamin D group (p < 0.001) but not in placebo group [19]. Ó 2019 Hogrefe

M.J. Hosseinzadeh-Attar et al., Vitamin D effect on ADMA in UC patients

Figure 1. Consort flow diagram of the study.

Serum ADMA levels were not statistically different between two groups at the baseline (Placebo group 0.85 ± 0.30, Vitamin D group 0.84 ± 0.26; p = 0.77) and at the end of study (Placebo group 0.84 ± 0.27, Vitamin D group 0.25 ± 0.83; p = 0.82). Adjustment for baseline ADMA levels and baseline body mass indexes using analysis of co-variance did not change the results (p = 0.63). There were no significant statistical correlations between baseline ADMA and vitamin D levels (r = 0.11, p = 0.30) as well as baseline ADMA and hs-CRP (r = 0.14, p = 0.18) and ESR (r = 0.02, p = 0.82) as markers of inflammation. We also performed further subgroup analyses. First we compared before and after serum ADMA levels in men and women separately (Fig. 2); and secondly we divided the patients into 2 groups based on their baseline 25(OH) D levels lower or equal to and higher than 30 ng/ml as the current cutoff of vitamin D sufficiency [22] (Fig. 3). No significant statistical differences in ADMA levels were seen between vitamin D and placebo groups in each subgroup.

Discussion In this study the serum levels of ADMA did not change 90 days following single injection of 300000 IU 25-hydroxyvitamin D3 in patients with mild to moderate Ulcerative Colitis. Ó 2019 Hogrefe

To the best of our knowledge, this study is the first clinical trial investigating the effect of Vitamin D3 on serum ADMA levels in human, in which Vitamin D has no effect on serum ADMA concentrations. In addition baseline ADMA was not associated with vitamin D levels which showed that their levels might be independent of each other. Previous studies suggest that vitamin D may increase activity and expression of endothelial nitric oxide synthase (eNOS) [23, 24]. A possible mechanism is the lowering effect of vitamin D on ADMA; nevertheless in our study administration of vitamin D had no effect on ADMA concentrations. Similarly, in an experimental study, 10 week oral administration of 500 IU/kg cholecalciferol in male Wistar rats did not alter serum ADMA levels. Cholecalciferol also did not prevent the elevation of serum ADMA levels in streptozotocin induced diabetic rats [25]. It is supposed that vitamin D might have a simultaneous increasing effect on both protein arginine type I N-methyltransferase (PRMT I) and dimethylarginine dimethylaminohydrolase (DDAH) expression; however to date there is no evidence to confirm this hypothesis and further investigations are needed. Another possible hypothesis for increased activity of NOS without any alteration in ADMA level has been explained in the experimental studies; The changes in tumor necrosis factor-α (TNF-α) can affect NOS activity [26, 27] and binding of TNF-α to its receptor (TNFR) leads to decrease in eNOS expression [5, 26, 27]. For example in a trial of Int J Vitam Nutr Res (2020), 90 (1–2), 17–22

M.J. Hosseinzadeh-Attar et al., Vitamin D effect on ADMA in UC patients

Figure 2. Subgroup comparison of serum ADMA levels between two groups regarding gender of patients. Forty nine men (26 in vitamin D and 23 in placebo groups) and 37 women (20 in vitamin D and 17 in placebo groups) were analyzed. There was no statistical difference between groups before and after the intervention for men (p = 0.93) and women (p = 0.66). Data are presented as Mean ± sd and the error bars represent standard errors.

ankylosing spondylitis patients, ADMA levels were significantly lower in anti-TNF-α group compared to the conventional therapy group [28]. It has been shown that vitamin D may decrease TNF-α levels [29]. Subsequently vitamin D probably indirectly increase the NOS activity. In our study despite a significant decrease in TNF-α following administration of vitamin D (data not shown), no significant changes in ADMA concentrations were seen. Possibly, since all the patients were in remission and the baseline TNF-α levels were not as much high as in active state of the disease, the percentage decreases in TNF-α levels might be insufficient to alter ADMA levels. In a study in normal aging population, low serum vitamin D level was related to increased level of both ADMA and high-sensitivity C-reactive protein (hs-CRP) [18], However the association between hs-CRP and vitamin D was independent of ADMA, indicating that different pathways might contribute [18]. Similarly in our study, despite a significant reduction in hs-CRP [19] ADMA levels did not change significantly. In addition, there was no Int J Vitam Nutr Res (2020), 90 (1–2), 17–22

significant correlation between baseline ADMA with hs-CRP and ESR which means that inflammatory status in UC patients might be independent of ADMA levels. Therefore, ADMA may not be considered as a marker of inflammation in mild to moderate UC patients, and possibly other potent mechanisms hide the inflammatory effects of ADMA. However further studies to assess the correlations between ADMA and histological markers of inflammations are needed. There are some limitations in this study. We did not screen the participants for vitamin D deficiency; although subgroup analyses were done but low statistical power of subgroup analyses should be considered. We did not measure ADMA in colon biopsy of the patients; while vitamin D might have a significant local effect on ADMA and changes in ADMA following vitamin D treatment might be detectable in colon tissue without considerable effect on serum levels. In addition further studies using different doses and longer follow-up, and measuring ADMA in colon biopsies Ó 2019 Hogrefe

M.J. Hosseinzadeh-Attar et al., Vitamin D effect on ADMA in UC patients

Figure 3. Subgroup comparison of serum ADMA levels between two groups regarding basic serum 25(OH)D3 levels. Thirty three patients with serum 25(OH)D3 < 30 ng/ml (15 in vitamin D and 18 in placebo groups) and 53 patients with serum 25(OH)D3 30 ng/ml (31 in vitamin D and 22 in placebo groups) were analyzed. There was no statistical difference between groups before and after the intervention for whom that their baseline 25(OH)D levels were lower or equal and higher than 30 ng/ml (p = 0.34 and p = 0.87 respectively). Data are presented as Mean ± sd and the error bars represent standard errors.

or in vitro studies using active form of vitamin D (Calcitriol) may reveal possible effects of vitamin D on ADMA.

Conclusion Briefly in this study baseline ADMA was not correlated with vitamin D and serum markers of inflammation, and no significant changes in serum ADMA levels were found 90 days following a high dose vitamin D administration in mild to moderate UC patients. Further studies in vitamin D deficient patients are needed.

References 1. Loftus, E.V. Jr. (2004) Clinical epidemiology of inflammatory bowel disease: Incidence, prevalence, and environmental influences. Gastroenterology. 126, 1504–1517. 2. Danese, S., & Fiocchi, C. (2011) Ulcerative colitis. N Engl J Med. 365, 1713–1725. doi: 10.1056/NEJMra1102942 3. Roifman, I., Sun, Y.C., Fedwick, J.P., et al. (2009) Evidence of endothelial dysfunction in patients with inflammatory bowel Ó 2019 Hogrefe

10.

disease. Clin Gastroenterol Hepatol. 7, 175–182. doi: 10.1016/ j.cgh.2008.10.021 Hatoum, O.A., Binion, D.G., Otterson, M.F., et al. (2003) Acquired microvascular dysfunction in inflammatory bowel disease: Loss of nitric oxide-mediated vasodilation. Gastroenterology. 125, 58–69. Steyers, C.M., & Miller, F.J. Jr. (2014) Endothelial dysfunction in chronic inflammatory diseases. Int J Mol Sci. 15, 11324–11349. doi: 10.3390/ijms150711324 Principi, M., Mastrolonardo, M., Scicchitano, P., et al. (2013) Endothelial function and cardiovascular risk in active inflammatory bowel diseases. J Crohns Colitis. 7, e427–433. doi: 10.1016/j.crohns.2013.02.001 Aloi, M., Tromba, L., Di Nardo, G., et al. (2012) Premature subclinical atherosclerosis in pediatric inflammatory bowel disease. J Pediatr. 161, 589–594 e581. doi: 10.1016/j.jpeds. 2012.03.043 Goggins, M.G., Shah, S.A., Goh, J., et al. (2001) Increased urinary nitrite, a marker of nitric oxide, in active inflammatory bowel disease. Mediators Inflamm. 10, 69–73. doi: 10.1080/ 09629350120054536 Gobert, A.P., Cheng, Y., Akhtar, M., et al. (2004) Protective role of arginase in a mouse model of colitis. J Immunol. 173, 2109–2117. Cheng, Y.L., Xu, H.X., Forman, J.S., et al. (2003) Inhibition of colitis by the arginase-ODC pathway. Gastroenterology. 124, A473–A473. doi: 10.1016/S0016-5085(03)82395-8 Int J Vitam Nutr Res (2020), 90 (1–2), 17–22

M.J. Hosseinzadeh-Attar et al., Vitamin D effect on ADMA in UC patients

11. Hong, S.K., Maltz, B.E., Coburn, L.A., et al. (2010) Increased serum levels of L-arginine in ulcerative colitis and correlation with disease severity. Inflamm Bowel Dis. 16, 105–111. doi: 10.1002/ibd.21035 12. Sydow, K., & Munzel, T. (2003) ADMA and oxidative stress. Atheroscler Suppl. 4, 41–51. 13. Yilmaz, M.I., Sonmez, A., Saglam, M., et al. (2008) ADMA levels correlate with proteinuria, secondary amyloidosis, and endothelial dysfunction. J Am Soc Nephrol. 19, 388–395. doi: 10.1681/ASN.2007040461 14. Teerlink, T., Nijveldt, R.J., de Jong, S., et al. (2002) Determination of arginine, asymmetric dimethylarginine, and symmetric dimethylarginine in human plasma and other biological samples by high-performance liquid chromatography. Anal Biochem. 303, 131–137. doi: 10.1006/abio.2001.5575 15. Yasuda, S., Miyazaki, S., Kanda, M., et al. (2006) Intensive treatment of risk factors in patients with type-2 diabetes mellitus is associated with improvement of endothelial function coupled with a reduction in the levels of plasma asymmetric dimethylarginine and endogenous inhibitor of nitric oxide synthase. European Heart Journal. 27, 1159–1165. doi: 10.1093/eurheartj/ehi876 16. Owczarek, D., Cibor, D., & Mach, T. (2010) Asymmetric dimethylarginine (ADMA), symmetric dimethylarginine (SDMA), arginine, and 8-iso-prostaglandin F2alpha (8-iso-PGF2alpha) level in patients with inflammatory bowel diseases. Inflamm Bowel Dis. 16, 52–57. doi: 10.1002/ibd.20994 17. Holick, M.F. (2011) Photobiology of vitamin D. Vitamin D. 1, 13–22. 18. Ngo, D.T., Sverdlov, A.L., McNeil, J.J., et al. (2010) Does vitamin D modulate asymmetric dimethylarginine and C-reactive protein concentrations? Am J Med. 123, 335–341. doi: 10.1016/ j.amjmed.2009.09.024 19. Sharifi, A., Hosseinzadeh-Attar, M.J., Vahedi, H., et al. (2016) A randomized controlled trial on the effect of vitamin D3 on inflammation and cathelicidin gene expression in ulcerative colitis patients. Saudi J Gastroenterol. 22, 316–323. doi: 10.4103/1319-3767.187606 20. Sakpal, T.V. (2010) Sample size estimation in clinical trial. Perspect Clin Res. 1, 67–69. 21. Truelove, S.C., & Witts, L.J. (1955) Cortisone in ulcerative colitis; final report on a therapeutic trial. Br Med J. 2, 1041–1048. 22. Holick, M.F. (2009) Vitamin D status: measurement, interpretation, and clinical application. Ann Epidemiol. 19, 73–78. doi: 10.1016/j.annepidem.2007.12.001 23. Talmor, Y., Golan, E., Benchetrit, S., et al. (2008) Calcitriol blunts the deleterious impact of advanced glycation end products on endothelial cells. Am J Physiol Renal Physiol. 294, F1059–1064. doi: 10.1152/ajprenal.00051.2008 24. Aihara, K., Azuma, H., Akaike, M., et al. (2004) Disruption of nuclear vitamin D receptor gene causes enhanced thrombogenicity in mice. J Biol Chem. 279, 35798–35802. doi: 10.1074/ jbc.M404865200 25. Salum, E., Kampus, P., Zilmer, M., et al. (2012) Effect of vitamin D on aortic remodeling in streptozotocin-induced

Int J Vitam Nutr Res (2020), 90 (1–2), 17–22

26.

27.

28.

29.

diabetes. Cardiovasc Diabetol. 11, 58. doi: 10.1186/14752840-11-58 Neumann, P., Gertzberg, N., & Johnson, A. (2004) TNF-alpha induces a decrease in eNOS promoter activity. Am J Physiol Lung Cell Mol Physiol. 286, L452–459. doi: 10.1152/ ajplung.00378.2002 Kleinbongard, P., Heusch, G., & Schulz, R. (2010) TNFα in atherosclerosis, myocardial ischemia/reperfusion and heart failure. Pharmacology & therapeutics. 127, 295–314. Inci, U., Yildiz, A., Batmaz, I., et al. (2015) Assessment of serum asymmetric dimethylarginine levels and left ventricular diastolic function in patients with ankylosing spondylitis. Int J Rheum Dis. n/a–n/a. doi: 10.1111/1756-185X.12608 Noyola-Martinez, N., Diaz, L., Avila, E., et al. (2013) Calcitriol downregulates TNF-alpha and IL-6 expression in cultured placental cells from preeclamptic women. Cytokine. 61, 245–250. doi: 10.1016/j.cyto.2012.10.001

Acknowledgments This work was supported by Tehran University of Medical Sciences and Health Services grant (No. 27089). Conflict of interest The authors declare that there are no conflicts of interest. Authorship Mohammad Javad Hosseinzadeh-Attar: design of the study; interpretation of data; drafting the manuscript; revising it critically for important intellectual content; final approval of the version to be submitted. Amrollah Sharifi: literature search; the conception and design of the study; carry out the study, perform the laboratory experiments and acquisition of the data; analysis and interpretation of data; drafting the manuscript. Saharnaz Nedjat: design of the study, Analysis of data, revising it critically for important intellectual content; final approval of the version to be submitted. Ashraf Mohamadkhani: perform the laboratory experiments and acquisition of the data, drafting the manuscript. Homayoon Vahedi: design of the study; interpretation of data; revising it critically for important intellectual content; final approval of the version to be submitted; clinical supervision.

Homayoon Vahedi, M.D. Digestive Disease Research Center Digestive Research Institute Shariati Hospital Tehran University of Medical Sciences North Kargar Street Tehran 14117-13135 Iran vahedi@ams.ac.ir

Ó 2019 Hogrefe

Original Communication

Consuming Diet Supplemented with Either Red Wheat Bran or Soy Extract Changes Glucose and Insulin Levels in Female Obese Zucker Rats Alexis D. Stamatikos1, Jeremy E. Davis1, Neil F. Shay2, Kolapo M. Ajuwon3, Farzad Deyhim4, and William J. Banz1 1

Department of Animal Science, Food and Nutrition, Southern Illinois University, Carbondale, IL 62901, USA

Department of Food Science and Technology, Oregon State University, Corvallis, OR 97331, USA

Department of Animal Sciences, Purdue University, West Lafayette, IN 47907, USA

Department of Human Sciences, Texas A&M University-Kingsville, Kingsville, TX 78363, USA

Received: November 20, 2016; Accepted: January 31, 2017

Abstract: Type 2 diabetes mellitus is characterized by the inability to regulate blood glucose levels due to insulin resistance, resulting in hyperglycemia and hyperinsulinemia. Research has shown that consuming soy and fiber may protect against type 2 diabetes mellitus. We performed a study to determine whether supplementing diet with soy extract (0.5% weight of diet) or fiber (as red wheat bran; 11.4% weight of diet) would decrease serum insulin and blood glucose levels in a pre-diabetic/metabolic syndrome animal model. In our study, female obese Zucker rats were fed either a control diet (n = 8) or control diet supplemented with either soy extract (n = 7) or red wheat bran (n = 8) for seven weeks. Compared to rats consuming control diet, rats fed treatment diets had significantly lower (p-value < 0.05) fasting serum insulin (control = 19.34±1.6; soy extract = 11.1±1.54; red wheat bran = 12.4±1.11) and homeostatic model assessment of insulin resistance values (control = 2.16±0.22; soy extract = 1.22±0.21; red wheat bran = 1.54±0.16). Non-fasted blood glucose was also significantly lower (p-value < 0.05) in rats fed treatment diets compared to rats consuming control diet at weeks four (control = 102.63±5.67; soy extract = 80.14±2.13; red wheat bran = 82.63±3.16), six (control = 129.5±10.83; soy extract = 89.14±2.48; red wheat bran = 98.13±3.54), and seven (control = 122.25±8.95; soy extract = 89.14±4.52; red wheat bran = 84.75±4.15). Daily intake of soy extract and red wheat bran may protect against type 2 diabetes mellitus by maintaining normal glucose homeostasis. Keywords: Fiber, hepatic steatosis, hyperinsulinemia, hyperglycemia, type 2 diabetes mellitus

Introduction Type 2 diabetes mellitus (T2DM) is a global epidemic [1]. The economic burden of T2DM in the United States alone is enormous, accounting for > 100 billion dollars in direct medical costs annually [2]. T2DM is known to reduce quality-of-life [3] and shorten life expectancy [4]. Complications of T2DM are numerous and include retinopathy, nephropathy, neuropathy, and cardiovascular disease [5]. The hallmark of T2DM is insulin resistance [6]. Markers for insulin resistance include hyperinsulinemia [7] and hyperglycemia [8]. Indeed, normal glucose homeostasis in humans involves tight regulation of both insulin and blood glucose [9]. Preventing or delaying hyperinsulinemia and/or hyperglycemia in patients susceptible to developing Ó 2019 Hogrefe

T2DM may also prevent or delay T2DM in these patients. This may be achieved through dietary modifications. Soy and fiber consumption may protect against T2DM. Epidemiological data has shown populations that consume diets high in soy or fiber have lower incidence of developing T2DM compared to populations that consume diets low in soy or fiber [10–13]. Unfortunately, a high daily consumption of healthy soy and fiber rich foods consistently may be too difficult, costly, and/or impractical for certain populations who are at risk for developing T2DM. For example, low-income populations, people living on food deserts, and individuals suffering from edentulism may have difficulties consuming soy and fiber rich foods regularly [14–16]. A more appropriate means of protecting against T2DM in these individuals may be to supplement the diet Int J Vitam Nutr Res (2020), 90 (1–2), 23–32 https://doi.org/10.1024/0300-9831/a000547

with soy or fiber instead, which may promote normal glucose homeostasis via stabilizing both blood glucose and serum insulin levels. We hypothesize that soy extract or fiber protects against T2DM by combating insulin resistance. Therefore, we conducted a study to test the hypothesis that adding soy extract or fiber (in the form of red wheat bran) to control diet would decrease serum insulin and blood glucose levels in obese Zucker rats (OZR) fed these diets when compared to a control diet.

Materials and Methods Animals and Diets Female OZR were purchased from Charles Rivers Laboratories (Wilmington, MA) at six weeks of age then individually caged. OZR were fed either a control diet (n = 8) or control diet supplemented with either soy extract (n = 7) or red wheat bran (n = 8) formulated by Research Diets, Inc. (New Brunswick, NJ) for seven weeks ad libitum. Study design is provided in Figure 1. Due to illness and failure to thrive, one rat in the soy extract group was euthanized before completion of the study. The soy extract used was NovasoyÒ [17, 18] provided by Archer Daniels Midland Company (Decatur, IL). Red wheat bran was obtained from Star of the West Milling Company (Frankenmuth, MI). Composition of diets is provided in Table I. The supplemental amount of soy extract and wheat bran used in our study has been shown to be safe and effective by us and others [19–23]. Baseline and weekly body weights and weekly food intake was measured for OZR. Baseline and weekly lateral tail vein nicks using a clean scalpel were performed on OZR to collect blood for measuring non-fasting blood glucose (Glucometer EliteÒ; Mishawaka, IN). An oral glucose tolerance test (OGTT) was performed after an overnight fast approximately one week prior to sacrifice [24]. For blood glucose, we measured glucose concentration in triplicates and then recorded the mean. OZR were fasted overnight then sacrificed by decapitation after approximately seven weeks on diets. After rats were sacrificed, liver and kidneys were dissected then weighed. All animal experiments were approved by the Institutional Animal Care and Use Committee of Southern Illinois University Carbondale.

Fasting Serum Insulin and Glucose Quantifying terminal fasting serum insulin and glucose concentrations was adapted from the protocol using plasma previously described [25]. After OZR were decapitated, trunk blood was collected in untreated tubes, the whole Int J Vitam Nutr Res (2020), 90 (1–2), 23–32

A. D. Stamatikos et al., Anti-Diabetic Effects of Wheat Bran and Soy

blood was allowed to clot at room temperature [26, 27], and then placed on wet ice [28, 29] until all rats were sacrificed. Serum was collected after centrifuging blood to use for measuring insulin concentrations. An ALPCO Ultrasensitive Insulin ELISA (Catalog # 008-10-1121-01; Windham, NH) was used to quantify serum insulin levels. Serum glucose levels were quantified using Glucose Reagent (Beckman Coulter, Fullerton, CA; Catalog # 442640) along with the Synchron CX Systems CX Multi Calibrator (Beckman Coulter; Catalog # 442600) and Synchron Multi-Level Controls (Beckman Coulter; Catalog # 657365). Serum glucose and insulin analyses were performed by PreClinOmics (Indianapolis, IN) [30].

Body Composition The protocol used to examine body composition in OZR is previously described [31, 32]. Briefly, rat carcasses were weighed and then autoclaved. After autoclaving, carcasses were blended in distilled water. After blending, the mixture was homogenized and the homogenized blend was weighed before adding chloroform and methanol, then vortexed. Samples were incubated at room temperature before adding potassium chloride and chloroform and then vortexed and placed on ice. Samples were centrifuged, then top aqueous layer and pellet removed and bottom liquid poured into pre-weighed, sterile disposable pans. The liquid was allowed to evaporate and pans were weighed to assess rat total body lipids.

Statistical Analysis Data are presented as ± SEM. A Shapiro-Wilk test and Brown-Forsythe test were used to test normality and equal variance respectively. One-way ANOVA and Dunnett’s post hoc testing was used to test for differences between control and treatment groups (SigmaPlot Version 13; Systat Software Inc., San Jose, CA). Significance was set at a p-value of < 0.05.

Results Feeding female OZR diets supplemented with either red wheat bran or soy extract increased both food consumption and body weight in these animals. Rats ingesting red wheat bran ate significantly more food from week three onward, while rats consuming soy extract ate significantly more food from week four onward (Figure 2a). For body weight, rats ingesting red wheat bran weighed significantly more than rats consuming control diet starting at week two. Soy extract Ó 2019 Hogrefe

A. D. Stamatikos et al., Anti-Diabetic Effects of Wheat Bran and Soy

Weeks

Female Obese Zucker Rats (n = 8) Fed Control Diet

Female Obese Zucker Rats (n = 7) Fed Control Diet Supplemented with Soy Extract (0.5% weight of diet)

Six Weeks of Age

Female Obese Zucker Rats (n = 8) Fed Control Diet Supplemented with Red Wheat Bran (11.4% weight of diet)

BWT NFBG

BWT FI NFBG

BWT FI NFBG OGTT

BWT FI FSG FSINS KWT LWT NFBG TBL

Figure 1. Experimental design. Abbreviations are as follows: BWT, body weight; FI, food intake; FSG, fasting serum glucose; FSINS, fasting serum insulin; KWT, kidney weight; LWT, liver weight; NFBG, non-fasting blood glucose; OGTT, oral glucose tolerance test; TBL, total body lipids.

fed rats weighed significantly more than the control diet fed rats from week five onward (Figure 2b). Due to differences measured in both body weight and food intake, we next wanted to determine if percent body lipids and liver and kidney weight were changed from supplementing the diet with red wheat bran or soy extract in female OZR. No significant difference in percent body lipids was observed between treatment groups and control (Figure 3a). Moreover, while no significant difference was observed with kidney weight and kidney weight relative to body weight among treatment groups versus control group (Figures 3b, 3c), liver weight and liver weight relative to body weight was significantly lower in red wheat bran fed rats when compared to control fed rats (Figure 3d, 3e). While supplementing the diet with either soy extract or red wheat bran increased both body weight and food intake in female OZR, it also improved glucose homeostasis in these animals. Non-fasting blood glucose levels during weeks four, six, and seven significantly increased in rats consuming control diet when compared to the treatment Ó 2019 Hogrefe

groups (Figure 4a). Oral glucose tolerance testing (Figure 4b) showed rats ingesting soy extract had significantly lower blood glucose one-hour post-glucose gavage compared to the control group, while blood glucose area under the curve [33–35] showed no significant changes between control group and treatments (Figure 4c). Fasting terminal serum insulin concentrations were quantified to determine if female OZR fed red wheat bran or soy extract prevented hyperinsulinemia, a marker for insulin resistance. Rats in the treatment groups had significantly lower fasting serum insulin levels compared to control rats (Figure 5a). Interestingly, fasting terminal serum blood glucose was significantly higher in red wheat bran fed rats compared to control rats (Figure 5b). However, when homeostatic model assessment of insulin resistance (HOMA-IR) was calculated, which is a method used to assess insulin resistance and β-cell function from fasting insulin and glucose concentrations [36, 37], it showed rats fed control diet having significantly higher HOMA-IR values compared to treatment groups (Figure 5c). Int J Vitam Nutr Res (2020), 90 (1–2), 23–32

A. D. Stamatikos et al., Anti-Diabetic Effects of Wheat Bran and Soy

Table I. Composition of diets Control

Soy Extract

Red Wheat Bran

grams

kcal

grams

kcal

grams

kcal

200

800

197.25

789

185.58

742

397.49

1590

395.99

1584

371.91

1488

Maltodextrin 10

132

528

132

528

132

528

Sucrose

100

400

100

400

100

400

Cellulose

49.73

Soybean Oil

630

69.95

630

63.61

572

0.01

Vitamin Mix

Choline Bitartrate

2.5

116.28

217

Casein L-Cystine Corn Starch

tBHQ* Mineral Mix

Red Wheat Bran Soy Extract

FD&C Red Dye #40

0.05

FD&C Blue Dye #1 Totals

0.05

1000

4000

1000.48

4000

1019.94

4000

*Tert-Butylhydroquinone

(A)

(B)

Figure 2. Adding soy extract or red wheat bran to control diet increases both food intake and body weight. (a) Weekly food intake and (b) weekly body weight was measured for female OZR fed either a control (CON) diet or diet supplemented with either soy extract (SE) or red wheat bran (RWB) for seven weeks. * show a p-value < 0.05 for RWB versus CON. + show a p-value < 0.05 for SE versus CON. Error bars represent ± SEM.

Discussion In this study we tested whether supplementing a rodent diet with red wheat bran or soy extract could influence blood glucose and insulin levels in OZR, an established model representing a pre-diabetic (i.e. metabolic syndrome) phenotype, which includes insulin resistance [38–41]. Research has shown that in female OZR aged six to ten weeks, insulin resistance as well as other symptoms associated with prediabetes/metabolic syndrome have improved after various treatments and interventions ranging from five to eight weeks [42–46]. In our study, when six-week old female OZR were fed diets containing either soy extract or red wheat bran for seven weeks, it resulted in improved Int J Vitam Nutr Res (2020), 90 (1–2), 23–32

non-fasting blood glucose levels and prevented hyperinsulinemia observed in OZR consuming control diet. Treatment diets also prevented insulin resistance that occurred in OZR fed control diet based on HOMA-IR values. High intake of fiber-rich and/or soy-based foods and lower incidence of T2DM is well established [10–13]. Soy may protect against T2DM by being rich in isoflavones. These phytoestrogens act as alpha-glucosidase inhibitors [47, 48], which may lower blood glucose by preventing intestinal dietary carbohydrate digestion, reducing the total amount of glucose absorbed from the intestines. The soy extract used in this study was NovasoyÒ 400, which contains 40% total isoflavones [17, 18]. Diets rich in Ó 2019 Hogrefe

A. D. Stamatikos et al., Anti-Diabetic Effects of Wheat Bran and Soy

(A)

(B)

(D)

(C)

(E)

Figure 3. Consuming red wheat bran decreases liver weight. (a) Total body lipids, (b) kidney weight, (c) kidney weight relative to body weight, (d) liver weight, and (e) liver weight relative to body weight were measured after sacrifice in OZR ingesting (CON) diet or diet supplemented with either soy extract (SE) or red wheat bran (RWB). In (a), n = 3 technical replicates. * show a p-value < 0.05 for fiber versus control. Error bars represent ± SEM.

isoflavones have also been shown to increase insulin sensitivity [49–51], which may explain significantly lower fasting serum insulin levels in OZR ingesting soy extract compared to control fed rats as well as improved non-fasted blood glucose. OZR consuming red wheat bran also had significantly lower fasting insulin and non-fasted blood glucose levels compared to control fed rats. Certain soluble fibers produce viscous gels in the gastrointestinal tract. This may provide benefits related to optimal glucose homeostasis, such as delaying gastric emptying and intestinal transit time, lowering glucose absorption, and reducing postprandial plasma glucose concentrations [52]. Fiber viscosity may have contributed to improving non-fasted blood glucose and preventing hyperinsulinemia in OZR fed red wheat bran. However, the predominant fiber in wheat bran is insoluble [53–55], so this fiber type may therefore play a larger role in attenuating plasma insulin and glucose levels instead. Indeed, insoluble fiber in wheat bran is slowly fermentable and capable of generating short-chain fatty acids [56]. Short-chain fatty acid production from fiber fermentation benefits health in numerous ways, including positively affecting glucose metabolism [57]. Wheat bran also has a low glycemic index [58, 59]. Therefore, adding red wheat bran would reduce the glycemic index of the control diet, Ó 2019 Hogrefe

which may have impacted glucose homeostasis in female OZR, too [60–62]. An interesting result from our study was that OZR ingesting soy extract or red wheat bran ate more food and weighed more than OZR consuming control diet. However, OZR fed treatment diets had no difference in total percent body lipids compared to control fed OZR. While a limitation to our study is not applying a more robust method for measuring body composition, our values are still similar to what has been previously reported in our lab [63] when using MRI to measure total percent body lipids [64]. The observation that OZR fed treatment diets weighing more but having no difference in total percent body lipids compared to control fed OZR is likely due to the addition of soy extract and red wheat bran to the diets, since all diets used were nearly identical to macronutrient content and ratios (Table II). A possible explanation for these findings may be due to compounds in soy extract and red wheat bran positively influencing body fat partitioning by acting as nutrient partitioning agents [65, 66]. Indeed, these compounds may effectively act as nutrient partitioning agents by facilitating in the process of mobilizing excess energy to be stored in subcutaneous adipose tissue instead of being stored as visceral/ectopic fat. Therefore, future studies should examine whether components in soy extract or red wheat bran act as Int J Vitam Nutr Res (2020), 90 (1–2), 23–32

A. D. Stamatikos et al., Anti-Diabetic Effects of Wheat Bran and Soy

(A)

(B)

(C)

Figure 4. Soy extract consumption improves glucose intolerance. (a) Weekly average non-fasting blood glucose was measured in rats fed control (CON) diet or diet supplemented with either soy extract (SE) or red wheat bran (RWB). (b) OGTT was performed after fasting OZR overnight one week before sacrifice. (c) OGTT area under the curve was calculated from values collected during OGTT. In (a) and (b), n = 3 technical replicates. * show a p-value < 0.05 for RWB versus CON. + show a p-value < 0.05 for SE versus CON. Error bars represent ± SEM.

nutrient partitioning agents. Additionally, more robust methods to measure total and visceral/ectopic lipids should be implemented. A significant decrease in liver weight was observed in OZR fed diets containing red wheat bran when compared to control fed OZR. However, there was no difference in OZR consuming soy extract when compared to OZR ingesting the control diet. While the increase in liver weight is likely from higher lipid content within the liver, a limitation of our study is not specifically examining liver composition to test whether the increase in weight is actually from lipids. There are two possible explanations for the significant decrease observed in liver weight from the red wheat bran fed group. One is that the unique fiber composition within red wheat bran may protect against fatty liver. This is plausible to assume since the overall fiber content between groups was nearly identical. Fiber from wheat bran has been shown to dramatically increase short-chain fatty acid production [67]. Short-chain fatty acids are largely thought to protect against fatty liver [57, 68], which may explain the reduction in liver weight in our study. Another possibility Int J Vitam Nutr Res (2020), 90 (1–2), 23–32

is that red wheat bran may protect against fatty liver independent of its fiber content. Wheat bran contains many different compounds (e.g. polyphenols) other than fiber that are known to be beneficial to health [69, 70]. Both possibilities may actually partially attribute to the decrease in liver weight observed in OZR. Future studies should be performed to test which components in red wheat bran may in fact protect against fatty liver, a condition that has been shown to be highly corrected with T2DM and other metabolic abnormalities [71, 72]. If certain components are shown to be safe and effective in treating fatty liver, then they demonstrate potential to be used as nutraceuticals to protect against hepatic steatosis [73]. More direct measurements of lipid content within the liver (e.g. ectopic fat content) also need to be conducted to determine if the development of fatty liver is prevented by supplementing the diet with fiber derived from red wheat bran. Other limitations for our study are not measuring enough markers associated with metabolic syndrome, which include blood lipids to assess atherogenic dyslipidemia [74, 75], inflammatory markers to measure systemic Ó 2019 Hogrefe

A. D. Stamatikos et al., Anti-Diabetic Effects of Wheat Bran and Soy

(A)

(B)

Figure 5. Ingesting soy extract and red wheat bran prevents hyperinsulinemia and insulin resistance. Trunk blood was collected after sacrifice in fasted rats fed control (CON) diet or diet supplemented with either soy extract (SE) or red wheat bran (RWB) to measure (a) serum insulin and (b) glucose. (c) HOMA-IR was calculated using fasting terminal serum insulin and glucose concentrations. In (a) and (b), n = 3 technical replicates. * show a p-value < 0.05 for RWB versus CON. + show a p-value < 0.05 for SE versus CON. Error bars represent ± SEM.

Table II. Macronutrient content and ratios of diets Control grams Protein

Soy Extract kcal

grams

Red Wheat Bran kcal

grams

kcal

203

812

203

812

203

812

639.5

2558

639.5

2558

639.5

2558

Fat

630

Fiber

% grams

% kcal

% grams

% kcal

% grams

% kcal

Carbohydrate

Protein

20.3

19.9

20.3

Carbohydrate

63.9

62.7

64.0

Fat

7.0

15.8

7.0

15.8

6.9

15.8

Fiber

5.0

4.9

kcal/gram

4.0

inflammation [76], and total antioxidant capacity [77–79] to analyze oxidative stress [80]. Additionally, adiponectin should be measured in following studies as it has been shown to be inversely correlated with metabolic syndrome [81-83]. Lastly, having a larger number of rats per group in future studies should strengthen our findings. Ó 2019 Hogrefe

4.0

0 3.9

Our findings support the notion that high consumption of red wheat bran or soy extract protects against T2DM. Future studies should be performed to test if there may be an additive or possibly synergistic protective effect against T2DM from ingesting a diet containing both soy extract and red wheat bran. Int J Vitam Nutr Res (2020), 90 (1–2), 23–32

References 1. Herman, W.H., & Zimmet, P. (2012) Type 2 diabetes: an epidemic requiring global attention and urgent action. Diabetes Care. 35, 943–944. 2. American Diabetes Association. (2013) Economic costs of diabetes in the U.S. in 2012. Diabetes Care. 36, 1033–1046. 3. Huang, E.S., Brown, S.E., Ewigman, B.G., Foley, E.C., & Meltzer, D.O. (2007) Patient perceptions of quality of life with diabetes-related complications and treatments. Diabetes Care. 30, 2478–2483. 4. Leal, J., Gray, A.M., & Clarke, P.M. (2009) Development of lifeexpectancy tables for people with type 2 diabetes. Eur Heart J. 30, 834–839. 5. Stolar, M. (2010) Glycemic control and complications in type 2 diabetes mellitus. Am J Med. 123, S3–S11. 6. DeFronzo, RA. (2010) Insulin resistance, lipotoxicity, type 2 diabetes and atherosclerosis: the missing links. The Claude Bernard Lecture 2009. Diabetologia. 53, 1270–1287. 7. Shanik, M.H., Xu, Y., Skrha, J., Dankner, R., Zick, Y., & Roth, J. (2008) Insulin resistance and hyperinsulinemia: is hyperinsulinemia the cart or the horse? Diabetes Care. 31, S262–S268. 8. Bansilal, S., Farkouh, M.E., & Fuster, V. (2007) Role of insulin resistance and hyperglycemia in the development of atherosclerosis. Am J Cardiol. 99, 6B–14B. 9. Gerich, J.E. (2000) Physiology of glucose homeostasis. Diabetes Obes Metab. 2, 345–350. 10. Schulze, M.B., Schulz, M., Heidemann, C., Schienkiewitz, A., Hoffmann, K., & Boeing, H. (2007) Fiber and magnesium intake and incidence of type 2 diabetes: a prospective study and meta-analysis. Arch Intern Med. 167, 956–965. 11. Consortium, InterAct (2015) Dietary fibre and incidence of type 2 diabetes in eight European countries: the EPIC-InterAct Study and a meta-analysis of prospective studies. Diabetologia. 58, 1394–1408. 12. Mueller, N.T., Odegaard, A.O., Gross, M.D., Koh, W.P., Yu, M.C., Yuan, J.M., et al. (2012) Soy intake and risk of type 2 diabetes in Chinese Singaporeans [corrected]. Eur J Nutr. 51, 1033–1040. 13. Villegas, R., Gao, Y.T., Yang, G., Li, H.L., Elasy, T.A., Zheng, W., et al. (2008) Legume and soy food intake and the incidence of type 2 diabetes in the Shanghai Women’s Health Study. Am J Clin Nutr. 87, 162–167. 14. Nowjack-Raymer, R.E., & Sheiham, A. (2003) Association of edentulism and diet and nutrition in US adults. J Dent Res. 82, 123–126. 15. Moore, L.V., Diez Roux, A.V., Nettleton, J.A., & Jacobs, D.R. Jr. (2008) Associations of the local food environment with diet quality–a comparison of assessments based on surveys and geographic information systems: the multi-ethnic study of atherosclerosis. Am J Epidemiol. 167, 917–924. 16. Leung, C.W., Ding, E.L., Catalano, P.J., Villamor, E., Rimm, E.B., & Willett, W.C. (2012) Dietary intake and dietary quality of lowincome adults in the Supplemental Nutrition Assistance Program. Am J Clin Nutr. 96, 977–988. 17. Morton, M., Arisaka, O., Miyake, A., & Evans, B. (1999) Analysis of phyto-oestrogens by gas chromatography-mass spectrometry. Environ Toxicol Pharmacol. 7, 221–225. 18. Renouf, M., & Hendrich, S. (2011) Lesser in vitro anaerobic cecal isoflavone disappearance was associated with greater apparent absorption of daidzein and genistein in Golden Syrian hamsters. Food Funct. 2, 273–278. 19. Shay, N.F., Ricketts, M.L., Medrano, T.I., & Shiverick, K.T. (2010) Microarray analysis reveals effects on important biological pathways in the liver of mice fed a dietary soy isoflavone concentrate. The FASEB Journal. 24, 924.

Int J Vitam Nutr Res (2020), 90 (1–2), 23–32

A. D. Stamatikos et al., Anti-Diabetic Effects of Wheat Bran and Soy

20. Watkins, D.W., Jahangeer, S., Floor, M.K., & Alabaster, O. (1992) Magnesium and calcium absorption in Fischer-344 rats influenced by changes in dietary fibre (wheat bran), fat and calcium. Magnes Res. 5, 15–21. 21. Edwards, C.A., & Eastwood, M.A. (1992) Comparison of the effects of ispaghula and wheat bran on rat caecal and colonic fermentation. Gut. 33, 1229–1233. 22. Kestell, P., Zhao, L., Zhu, S., Harris, P.J., & Ferguson, L.R. (1999) Studies on the mechanism of cancer protection by wheat bran: effects on the absorption, metabolism and excretion of the food carcinogen 2-amino-3-methylimidazo [4, 5-f]quinoline (IQ). Carcinogenesis. 20, 2253–2260. 23. Luo, T., Snyder, S.M., Zhao, B., Sullivan, D.K., HamiltonReeves, J., Guthrie, G., et al. (2016) Gene Expression Patterns Are Altered in Athymic Mice and Metabolic Syndrome Factors Are Reduced in C57BL/6J Mice Fed High-Fat Diets Supplemented with Soy Isoflavones. J Agric Food Chem. 64, 7492–7501. 24. Strader, A.D., Clausen, T.R., Goodin, S.Z., & Wendt, D. (2009) Ileal interposition improves glucose tolerance in low dose streptozotocin-treated diabetic and euglycemic rats. Obes Surg. 19, 96–104. 25. Banz, W.J., Davis, J., Steinle, J.J., Adler, S., Oitker, J., Winters, T.A., et al. (2005) (+)-Z-Bisdehydrodoisynolic acid ameliorates obesity and the metabolic syndrome in female ZDF rats. Obes Res. 13, 1915–1924. 26. Tuck, M.K., Chan, D.W., Chia, D., Godwin, A.K., Grizzle, W.E., Krueger, K.E., et al. (2009) Standard operating procedures for serum and plasma collection: early detection research network consensus statement standard operating procedure integration working group. J Proteome Res. 8, 113–117. 27. Lee, G., & Goosens, K.A. (2015) Sampling blood from the lateral tail vein of the rat. J Vis Exp.. doi: 10.3791/52766 28. World Health Organization. (2012) Annex 3 Collection, storage and shipment of specimens for laboratory diagnosis and interpretation of results. In WHO Regional Office for Europe. (Eds.), Surveillance Guidelines for Measles, Rubella and Congenital Rubella Syndrome in the WHO European Region Available from: https://www.ncbi.nlm.nih.gov/books/ NBK143256/. Geneva: WHO 29. World Health Organization. (2005) Manual on the management, maintenance and use of blood cold chain equipment. Geneva, Switzerland. 30. Davis, J.E., Cain, J., Banz, W.J., & Peterson, R.G. (2013) AgeRelated Differences in Response to High-Fat Feeding on Adipose Tissue and Metabolic Profile in ZDSD Rats. ISRN Obes.. doi:10.1155/2013/584547 31. Harris, R.B., & Martin, R.J. (1984) Specific depletion of body fat in parabiotic partners of tube-fed obese rats. Am J Physiol. 247, R380–R386. 32. Hartsook, E.W., & Hershberger, T.V. (1963) A simplified method for sampling small animal carcassess for analyses. Proc Soc Exp Biol Med. 113, 973–977. 33. Le Floch, J.P., Escuyer, P., Baudin, E., Baudon, D., & Perlemuter, L. (1990) Blood glucose area under the curve. Methodological aspects. Diabetes Care. 13, 172–175. 34. Andrikopoulos, S., Blair, A.R., Deluca, N., Fam, B.C., & Proietto, J. (2008) Evaluating the glucose tolerance test in mice. Am J Physiol Endocrinol Metab. 295, E1323–E1332. 35. Ghezzi, A.C., Cambri, L.T., Ribeiro, C., Botezelli, J.D., & Mello, M.A. (2011) Impact of early fructose intake on metabolic profile and aerobic capacity of rats. Lipids Health Dis.. doi: 10.1186/1476-511X-10-3 36. Matthews, D.R., Hosker, J.P., Rudenski, A.S., Naylor, B.A., Treacher, D.F., & Turner, R.C. (1985) Homeostasis model assessment: insulin resistance and beta-cell function from

Ó 2019 Hogrefe

A. D. Stamatikos et al., Anti-Diabetic Effects of Wheat Bran and Soy

37.

38.

39.

40.

41.

42.

43.

44.

45.

46.

47.

48. 49.

50.

51.

52.

53.

54.

fasting plasma glucose and insulin concentrations in man. Diabetologia. 28, 412–419. Berglund, E.D., Li, C.Y., Poffenberger, G., Ayala, J.E., Fueger, P. T., Willis, S.E., et al. (2008) Glucose metabolism in vivo in four commonly used inbred mouse strains. Diabetes. 57, 1790–1799. Kurtz, T.W., Morris, R.C., & Pershadsingh, H.A. (1989) The Zucker fatty rat as a genetic model of obesity and hypertension. Hypertension. 13, 896–901. Hakkak, R., Holley, A.W., Macleod, S.L., Simpson, P.M., Fuchs, G.J., Jo, C.H., et al. (2005) Obesity promotes 7, 12-dimethylbenz(a)anthracene-induced mammary tumor development in female zucker rats. Breast Cancer Res. 7, R627–R633. de Artiñano, A. A., & Castro, M. M. (2009) Experimental rat models to study the metabolic syndrome. Br J Nutr. 102, 1246–1253. Lehnen, A.M., Rodrigues, B., Irigoyen, M.C., De, A.K., & Schaan, B.D. (2013) Cardiovascular changes in animal models of metabolic syndrome. J Diabetes Res.. doi: 10.1155/2013/ 761314 Cortez, M.Y., Torgan, C.E., Brozinick, J.T. Jr., & Ivy, J.L. (1991) Insulin resistance of obese Zucker rats exercise trained at two different intensities. Am J Physiol. 261, E613–E619. Alemzadeh, R., Slonim, A.E., Zdanowicz, M.M., & Maturo, J. (1993) Modification of insulin resistance by diazoxide in obese Zucker rats. Endocrinology. 133, 705–712. Alemzadeh, R., Jacobs, W., & Pitukcheewanont, P. (1996) Antiobesity effect of diazoxide in obese Zucker rats. Metabolism. 45, 334–341. Standridge, M., Alemzadeh, R., Zemel, M., Koontz, J., & Moustaid-Moussa, N. (2000) Diazoxide down-regulates leptin and lipid metabolizing enzymes in adipose tissue of Zucker rats. FASEB J. 14, 455–460. Pan, S.J., Hancock, J., Ding, Z., Fogt, D., Lee, M., & Ivy, J.L. (2001) Effects of clenbuterol on insulin resistance in conscious obese Zucker rats. Am J Physiol Endocrinol Metab. 280, E554–E561. Dendup, T., Prachyawarakorn, V., Pansanit, A., Mahidol, C., Ruchirawat, S., & Kittakoop, P. (2014) alpha-Glucosidase inhibitory activities of isoflavanones, isoflavones, and pterocarpans from Mucuna pruriens. Planta Med. 80, 604–608. Lee, D.S., & Lee, S.H. (2001) Genistein, a soy isoflavone, is a potent alpha-glucosidase inhibitor. FEBS Lett. 501, 84–86. Palanisamy, N., Viswanathan, P., & Anuradha, C.V. (2008) Effect of genistein, a soy isoflavone, on whole body insulin sensitivity and renal damage induced by a high-fructose diet. Ren Fail. 30, 645–654. Noriega-Lopez, L., Tovar, A.R., Gonzalez-Granillo, M., Hernandez-Pando, R., Escalante, B., Santillan-Doherty, P., et al. (2007) Pancreatic insulin secretion in rats fed a soy protein high fat diet depends on the interaction between the amino acid pattern and isoflavones. J Biol Chem. 282, 20657– 20666. Wagner, J.D., Cefalu, W.T., Anthony, M.S., Litwak, K.N., Zhang, L., & Clarkson, T.B. (1997) Dietary soy protein and estrogen replacement therapy improve cardiovascular risk factors and decrease aortic cholesteryl ester content in ovariectomized cynomolgus monkeys. Metabolism. 46, 698–705. Lattimer, J.M., & Haub, M.D. (2010) Effects of dietary fiber and its components on metabolic health. Nutrients. 2, 1266–1289. Asp, N.G., Johansson, C.G., Hallmer, H., & Siljestrom, M. (1983) Rapid enzymatic assay of insoluble and soluble dietary fiber. J Agric Food Chem. 31, 476–482. Prosky, L., Asp, N.G., Schweizer, T.F., DeVries, J.W., & Furda, I. (1988) Determination of insoluble, soluble, and total dietary

Ó 2019 Hogrefe

55.

56.

57.

58.

59.

60.

61.

62.

63.

64.

65. 66.

67.

68.

69.

70.

71. 72.

73.

fiber in foods and food products: interlaboratory study. J Assoc Off Anal Chem. 71, 1017–1023. Chen, H.L., Haack, V.S., Janecky, C.W., Vollendorf, N.W., & Marlett, J.A. (1998) Mechanisms by which wheat bran and oat bran increase stool weight in humans. Am J Clin Nutr. 68, 711–719. Eswaran, S., Muir, J., & Chey, W.D. (2013) Fiber and functional gastrointestinal disorders. Am J Gastroenterol. 108, 718–727. den Besten, G., van Eunen, K., Groen, A.K., Venema, K., Reijngoud, D.J., & Bakker, B.M. (2013) The role of short-chain fatty acids in the interplay between diet, gut microbiota, and host energy metabolism. J Lipid Res. 54, 2325–2540. Atkinson, F.S., Foster-Powell, K., & Brand-Miller, J.C. (2008) International tables of glycemic index and glycemic load values: 2008. Diabetes Care. 31, 2281–2303. Foster-Powell, K., Holt, S.H., & Brand-Miller, J.C. (2002) International table of glycemic index and glycemic load values: 2002. Am J Clin Nutr. 76, 5–56. Jenkins, D.J., Wolever, T.M., Taylor, R.H., Barker, H., Fielden, H., Baldwin, J.M., et al. (1981) Glycemic index of foods: a physiological basis for carbohydrate exchange. Am J Clin Nutr. 34, 362–366. Wolever, T.M., & Jenkins, D.J. (1986) The use of the glycemic index in predicting the blood glucose response to mixed meals. Am J Clin Nutr. 43, 167–172. Wolever, T.M., & Bolognesi, C. (1996) Prediction of glucose and insulin responses of normal subjects after consuming mixed meals varying in energy, protein, fat, carbohydrate and glycemic index. J Nutr. 126, 2807–2812. Casey, J.M., Banz, W.J., Krul, E.S., Butteiger, D.N., Goldstein, D.A., & Davis, J.E. (2013) Effect of stearidonic acid-enriched soybean oil on fatty acid profile and metabolic parameters in lean and obese Zucker rats. Lipids Health Dis.. doi: 10.1186/ 1476-511X-12-147 Cornier, M.A., Despres, J.P., Davis, N., Grossniklaus, D.A., Klein, S., Lamarche, B., et al. (2011) Assessing adiposity: a scientific statement from the American Heart Association. Circulation. 124, 1996–2019. Bray, G.A. (1991) Treatment for obesity: a nutrient balance/ nutrient partition approach. Nutr Rev. 49, 33–45. Morris, A.M., Calsbeek, D.J., & Eckel, R.H. (2004) Lipid metabolism and nutrient partitioning strategies. Curr Drug Targets CNS Neurol Disord. 3, 411–430. Topping, D.L., Illman, R.J., Clarke, J.M., Trimble, R.P., Jackson, K.A., & Marsono, Y. (1993) Dietary fat and fiber alter large bowel and portal venous volatile fatty acids and plasma cholesterol but not biliary steroids in pigs. J Nutr. 123, 133–143. Byrne, C.S., Chambers, E.S., Morrison, D.J., & Frost, G. (2015) The role of short chain fatty acids in appetite regulation and energy homeostasis. Int J Obes. 39, 1331–1338. Stevenson, L., Phillips, F., O’Sullivan, K., & Walton, J. (2012) Wheat bran: its composition and benefits to health, a European perspective. Int J Food Sci Nutr. 63, 1001–1013. Manach, C., Scalbert, A., Morand, C., Remesy, C., & Jimenez, L. (2004) Polyphenols: food sources and bioavailability. Am J Clin Nutr. 79, 727–747. Paschos, P., & Paletas, K. (2009) Non alcoholic fatty liver disease and metabolic syndrome. Hippokratia. 13, 9–19. Shibata, M., Kihara, Y., Taguchi, M., Tashiro, M., & Otsuki, M. (2007) Nonalcoholic fatty liver disease is a risk factor for type 2 diabetes in middle-aged Japanese men. Diabetes Care. 30, 2940–2944. Rios-Hoyo, A., Cortes, M.J., Rios-Ontiveros, H., Meaney, E., Ceballos, G., & Gutierrez-Salmean, G. (2014) Obesity,

Int J Vitam Nutr Res (2020), 90 (1–2), 23–32

74.

75.

76.

77.

78.

79.

80. 81.

A. D. Stamatikos et al., Anti-Diabetic Effects of Wheat Bran and Soy

Metabolic Syndrome, and Dietary Therapeutical Approaches with a Special Focus on Nutraceuticals (Polyphenols): A MiniReview. Int J Vitam Nutr Res. 84, 113–123. Grundy, S.M. (2006) Atherogenic dyslipidemia associated with metabolic syndrome and insulin resistance. Clin Cornerstone. 8, S21–S27. Manjunath, C.N., Rawal, J.R., Irani, P.M., & Madhu, K. (2013) Atherogenic dyslipidemia. Indian J Endocrinol Metab. 17, 969–976. Das, U.N. (2010) Metabolic syndrome is a low-grade systemic inflammatory condition. Expert Review of Endocrinology & Metabolism. 5, 577–592. Potter, A.S., Foroudi, S., Stamatikos, A., Patil, B.S., & Deyhim, F. (2011) Drinking carrot juice increases total antioxidant status and decreases lipid peroxidation in adults. Nutr J.. doi: 10.1186/1475-2891-10-96 Foroudi, S., Potter, A.S., Stamatikos, A., Patil, B.S., & Deyhim, F. (2014) Drinking orange juice increases total antioxidant status and decreases lipid peroxidation in adults. J Med Food. 17, 612–617. Peluso, I., & Raguzzini, A. (2016) Salivary and Urinary Total Antioxidant Capacity as Biomarkers of Oxidative Stress in Humans. Patholog Res Int.. doi: 10.1155/2016/5480267 Roberts, C.K, & Sindhu, K.K. (2009) Oxidative stress and metabolic syndrome. Life Sci. 84, 705–712. Ryo, M., Nakamura, T., Kihara, S., Kumada, M., Shibazaki, S., Takahashi, M., et al. (2004) Adiponectin as a biomarker of the metabolic syndrome. Circ J. 68, 975–981.

Int J Vitam Nutr Res (2020), 90 (1–2), 23–32

82. Okamoto, Y., Kihara, S., Funahashi, T., Matsuzawa, Y., & Libby, P. (2006) Adiponectin: a key adipocytokine in metabolic syndrome. Clin Sci. 110, 267–278. 83. Lara-Castro, C., Fu, Y., Chung, B.H., & Garvey, W.T. (2007) Adiponectin and the metabolic syndrome: mechanisms mediating risk for metabolic and cardiovascular disease. Curr Opin Lipidol. 18, 263–270. Acknowledgments Funding was provided by the Kellogg Company in 2007. The authors would like to thank Bryce James for his assistance in conducting experiments. Conflict of Interest The authors state there are no conflicts of interest.

William J. Banz, Ph.D., R.D. Professor and Chair Animal Science, Food & Nutrition Agriculture Building Room 127 - Mail Code 4417 College of Agricultural Sciences Southern Illinois University 1205 Lincoln Drive Carbondale IL 62901 banz@siu.edu

Ó 2019 Hogrefe

Original Communication

Q10 Coenzyme Supplementation can Improve Oxidative Stress Response to Exercise in Metabolic Syndrome in Rats Bogdan Augustin Chis1, Ana Florica Chis2, Adriana Muresan3, and Daniela Fodor1 1

2nd Department of Internal Medicine, Iuliu Hatieganu University of Medicine and Pharmacy, Cluj Napoca, Romania

Department of Pulmonology, Iuliu Hatieganu University of Medicine and Pharmacy, Cluj Napoca, Romania

Physiology Dept., Iuliu Hatieganu University of Medicine and Pharmacy, Cluj Napoca, Romania

Received: October 9, 2016; Accepted: July 17, 2017 Abstract: Background: The metabolic syndrome leads to high morbidity and mortality. Almost all pathological states are associated with oxidative stress (OS) disorders. This study evaluates the effects of Coenzyme Q10 (CoQ10) supplementation on different lifestyles, in relation to serum and tissue OS parameters. Materials and methods: Twelve Wistar rat groups (10 rats/group) were equally divided in three types of diets: standard (St), high fat (HF), high sugar (HS); within each diet group there was one sedentary group with CoQ10 supplementation (100 mg/kg body weight), one sedentary without CoQ10, one trained group with CoQ10 and one trained group without CoQ10 supplementation. After 28 days blood samples were collected as follows: after 12 hours of fasting (T0), 1 hour postprandial (T1) and after 1 hour of exercise (T2) or sedentary postprandial time (T3). Thiol groups (SH) and malondialdehyde (MDA) were determined from serum and liver homogenate. Results: Significant changes were observed in fasting MDA for HF (p = 0.024 for training, 0.028 for CoQ10). Postprandial, OS status altered, with highest MDA in HF sedentary non-CoQ10 group (3.92 ± 0.37 vs 2.67 ± 0.41 nmol/ml in St trained CoQ10). At T2 the untrained and non-CoQ10 groups had the highest MDA levels (up to 22.3% vs T1, p < 0.001 in HF) as SH dropped (34.4% decrease vs T1, p < 0.001 in HF). At T3 high MDA levels were observed, correlated with low SH (Pearson r = 0.423 overall), irrespective of the CoQ10 supplementation. CoQ10 improved the liver OS status (MDA and SH decreased), but not the exercise, in all diets. Conclusions: CoQ10 supplementation accompanied by chronic exercise improved the OS serum profile, irrespective of the daily diet. CoQ10 lowered liver MDA and SH concentrations. Keywords: Metabolic syndrome, Q10 coenzyme, malondialdehyde, thiol groups, chronic exercise

Introduction Oxidative stress (OS), which has been an important research domain over the past years, has a proven involvement in all pathological states, from neurologic disorders (degenerative as Alzheimer’s and Parkinson’s diseases [1] or diabetes mellitus-related diseases [2]) to metabolic changes [3] and cardio-vascular diseases [4, 5]. Natural antioxidants can be found in all foods, but they are not always well balanced or sufficient. Oxygen reactive species are involved in physiological reactions, contributing to antimicrobial fight, phagocytosis and ageing [6]. Antioxidant (AO) supplementation is controversial, as no significant role has been proven so far. Although some pharmaceutical companies encourage the use of AO even in acute states [7], other meta-analysis showed different effects, a synergism with other micronutrients Ó 2019 Hogrefe

supplementation being concluded. Anticariogenic effects have been questioned, as high doses of beta- cryptoxanthin (a synthetic beta-carotene) supplementation increases lung-cancer prevalence in smokers [8]. Metabolic syndrome (MetS) became a serious problem of this century, with a prevalence of 10% to 84%, at its highest in developed countries, where a sedentary lifestyle is an important cause of obesity [9]. Eating habits have also changed in the last decades, with diets becoming rich in calories and low in nutritional components. This fact led the World Health Organization to consider overfeeding malnutrition as well, especially when a minimum standard of quality is not reached. Postprandial dysmetabolism, as a major component of MetS, is linked to a big number of cardiovascular diseases and comorbidities [10], as both postprandial hyperglycemia and hyperlipidemia are associated with OS increase [11]. A meta-analysis on 5 studies regarding diet Int J Vitam Nutr Res (2020), 90 (1–2), 33–41 https://doi.org/10.1024/0300-9831/a000301

and cardiovascular risk showed an advantage to low-carbohydrate diets compared to low-fat ones, even if the latter lead to weight loss [12]. Exercise can contribute to reactive oxygen species (ROS) production, as it involves high oxygen consumption (oxygen debt at the beginning of the exercise, which is “paid” soon after the exercise), muscle fatigue (in high intensity exercising, with calcium ions being released through type I ryanodine receptors) [13], dehydration and increased heart rate. Exercise-related oxidative stress effects are less important in trained people, along with joint and muscle direct effect [14]. The energy required in muscle contraction can be produced either by aerobic or anaerobic pathways; the latter is the fastest but the least efficient and leads to high reactive oxidative species production rate [15]. Q10 coenzyme (CoQ10) is one of the most powerful natural antioxidants. Even if OS markers found in MetS patients were high and associated with waist circumference and blood pressure, CoQ10 levels failed to show any correlation [16]. However, other studies found that small doses of CoQ10 can improve insulin resistance and pancreatic β-cells function, but not the fasting glucose and the lipids profile [17]. Only low doses of CoQ10 were used on humans, up to 400 mg/day. On animals, doses up to 2400 mg/kg of body weight were used and no behavioral, biochemistry or histological alterations were observed. The latest studies show a moderate effect of CoQ10 supplementation on heart failure [18] and maybe higher doses would be necessary for serum efficient concentrations [19]. Several diets were studied, such as Mediterranean, fishbased – with proven beneficial effect on OS status – but there was no consensus on the necessary amount of antioxidants, as any antioxidant can act as an oxidant in high amounts. However, the effects of antioxidant supplementation are not well known when lifestyle changes are also involved; therefore the aim of our study was to evaluate the role of AO supplementation with high doses of CoQ10 in combination with different lifestyles in rats. Our study included rats with sedentary or active lifestyles, normal or high-calories diets, with or without CoQ10 supplementation. To our knowledge, this is the first study conducted on animals which analyzes several lifestyles with metabolic syndrome as a potential outcome.

B. A. Chis et al., Q10 coenzyme in metabolic syndrome in rats

treated in accordance with the International Harmonization of Nomenclature and Diagnostic Criteria of Global Open Registry Nomenclature Information System (goRENI-INHAND) standards and they were sacrificed accordingly [20].

Study design The experiment was conducted on 120 Wistar male rats (Rattus norvegicus, Rodentia: Muridae) divided into 12 groups (10 rats/group), weight of 200 ± 20 grams, aged 10 ± 1 weeks. Animals were housed in plastic cages with a constant room temperature of 21 ± 1 °C, 12 hours of light/ dark cycle, and water was provided ad-libitum. Each of the 12 groups were divided into 3 types of diet – standard, high sugar and high fat – with two subgroups for each diet type – one subgroup was sedentary (E ), while the other one performed exercise (E+) (as shown in Fig. 1). The same criteria were used for the CoQ10 supplemented groups. Each animal was supplemented with 100 mg/kg of body weight of CoQ10 daily. CoQ10 had a concentration of over 98% and was delivered from Cosphatec Hamburg, Germany. High sugar and high fat diets were obtained through oral gavage of 2 ml of glucose 75% syrup (1.5 grams of pure glucose) and 2 ml of pig lard, respectively. The animals were fed at the same hour each day – 8:00 AM. Exercise involved swimming for 1 hour each morning (in wide and deep, slightly turbulent water containers to avoid escaping, bobbing or floating) at the same time, after eating [21]. The animals were harvested 1 ml of blood from the retro-orbital sinus after 12 hours of fasting (T0), 60 minutes after eating (T1) and 60 minutes after postprandial exercise (T2). In order to evaluate the postprandial sedentary time, a supplementary determination was made (T3), 2 hours postprandial, with no exercise, in all groups. At the end of the experiments, the animals were euthanized by cervical dislocation. The liver was harvested in the first minutes after death and homogenized. The thiol groups (SH) and malondialdehyde (MDA) from the blood samples were extracted from liver homogenate as well. Metabolic syndrome was considered if weight gain, elevated plasma glucose (G), triglycerides (TG) and low HDL-Cholesterol (HDL) levels were obtained [22].

Methods

Biochemical determinations

Ethics

MDA was extracted from the supernatant with thiobarbituric acid in equal quantities trough spectrophotometry on double beam UV-VIS V-530 from JASCO Hachioji, Tokyo, Japan [23]. SH were determined through Ellman reagent (5 5’-dithiobis(2-nitrobenzoic acid)) from Merck KgaA

The study has been approved by the Ethics Comity of “Iuliu Hatieganu” University of Medicine and Pharmacy in Cluj Napoca (no 401/October 5th 2011). The animals were Int J Vitam Nutr Res (2020), 90 (1–2), 33–41

Ó 2019 Hogrefe

B. A. Chis et al., Q10 coenzyme in metabolic syndrome in rats

Figure 1. Animal groups distribution. E+ exercise daily, E- sedentary; St – standard diet, HS – high sugar diet, HF – high fat diet.

Gernsheim, Germany [24]. The same methods were used for liver homogenate.

Statistical analysis Group size was determined using Mead’s resource equation and Cohen’s d table for a power of the study of 0.8. All the groups were considered independent groups and average, median, standard deviation and standard error were computed at each moment. For 2 normal distribution groups comparison we used the student t test, whereas for more than 3 groups Wilkoxon or Friedman tests were run. If normal distribution criteria were not met, Mann-Whitney and Krushal-Wallis tests were used instead. Pearson’s correlation r was also computed and ANOVA general linear model test for repeated measurements (GLM-RM) was run for moments’ comparison. Bonferoni post hoc test was applied. Statistical significant p was considered at 0.05. F-statistic value for univariate ANOVA was also computed for each group as high significance is correlated with high F. Statistical analysis was performed using SPSS 17 and Microsoft Excel 2010 software.

Results Metabolic syndrome In high-fat, high-calorie diets, sedentary groups and the groups without CoQ10 supplementation had higher body weight at the end of the experiment compared to trained and CoQ10 supplemented groups, with statistical significance for training (Table 1). Also, fasting glucose was significantly higher in high-sugar and high-fat diets (p < 0.001), while HDL-C levels were lower and TG serum Ó 2019 Hogrefe

concentrations higher. Between the same diet groups, fasting glucose was influenced only by chronic exercise, while CoQ10 supplementation and training significantly reduced fasting HDL-C and TG, especially in high-calorie diets (p < 0.05).

Standard diet Serum MDA had increased levels in all moments, with the highest values in T2 and the lowest in T3 (Table 2). Univariate analysis for T0 showed no statistical significance for exercise (F = 1.802, p = 0.188) or CoQ10 supplementation (F = 1.201, p = 0.280). ANOVA GLM-RM showed that both chronic exercise and CoQ10 supplementation changed the oxidant profile (F = 17.124, p < 0.001 and F = 13.820, p = 0.001, respectively). SH increased in T1, but decreased in T2 and T3. CoQ10 supplementation changed the T0 values (F = 88.668, p < 0.001) but not for chronic exercise (F = 3.033, p = 0.090). Both physical training and CoQ10 supplementation changed the SH profile (F = 41.102.823, p < 0.001 and F = 546.913, p < 0.001, respectively in ANOVA GLM-RM). Liver MDA was slightly higher in trained groups (F = 2.538, p = 0.120) and lower in the CoQ10 supplemented groups (F = 22.457, p < 0.001). SH decreased in trained groups (F = 0.808, p = 0.375) but were significantly lower in CoQ10 supplemented groups (F = 64.308, p < 0.001). Liver MDA and SH were moderately correlated (r = 0.465, p = 0.003).

High sugar diet MDA values in T0 were lower in trained and CoQ10 supplemented groups (Table 2) but with no statistical significance (p = 0.064 and p = 0.119 respectively). In T1 and T2 there was an increase of MDA values, which decreased in T3. Int J Vitam Nutr Res (2020), 90 (1–2), 33–41

117.3±11.4 108.8±0.6 CoQ10 Sedentary 234.6±11.9 supplementation Trained 237±8.2

Sedentary 258.1±35.6 Trained 224.4±10.2 No CoQ10

Note: Final weight in grams, serum Glucose- G in mg/dL, serum HDL-Cholesterol– HDL-C in mg/dL, serum triglycerides- TG in mg/dL. Data expressed as average±standard deviation.

105.1±14.8 91.3±14.7 30.9±3.8 36.6±4.8

123.9±13.2 p<0.001 101.2±16.5 F=15.035 p=0.024 F=5.570 p=0.391 F=0.753

Int J Vitam Nutr Res (2020), 90 (1–2), 33–41

High fat diet

CoQ10 Sedentary 232.7±13.1 supplementation Trained 222.8±14.8

p=0.017 F=6.210

p<0.001 F=19.901 Sedentary 239.1±14.6 Trained 207.6±16 No CoQ10 High sugar diet

CoQ10 Sedentary 225.8±9.2 supplementation Trained 220.4±15.6

122.7±11.2 F=7.275, 113.9±9.09 p=0.011

111.8±10.4 107.4±11.9

p=0.349 F=0.899

117.6±8.8 108.5±5.4

110.4±7.8 102.4±8.9

p=0.030 F=5.115

p=0.11 F=2.680

p=0.255 F=1.336

34.4±5.6 41.7±5.6

26.6±4.6 p<0.003 32.4±8.5 F=10.153

95.8±13.5 72.63±13.9

p=0.004 F=9.397

p<0.001 F=56.142 p=0.027 F=5.348 44.1±4.1 50.4±9.6

30.1±5.2 p<0.001 37.5±6.9 F=15.697

84.7±11.3 70.6±9

104.9±13.8 p<0.001 85.3±12.7 F=125.341

F=3.464, p=0.071 p<0.001 F=16.428 p=0.159 F=2069 42.1±7.4 p=0.135 44.3±12.2 F=2.342 p=0.184 F=1.836 112.5±5.6 p=0.028 107.8±11.5 F=5.265 p=0.467 F=0.541 p=0.035 F=4.788 Sedentary 234.3±12.1 Trained 218.9±20.8 Standard No CoQ10 diet

Univariate analysis Univariate analysis Univariate analysis Final Weight Group

Table 1. Metabolic syndrome parameters

Training CoQ10 supple mentation

HDL-C

Training CoQ10 supple mentation

93.5±15.5 76.2±12.1

Training

CoQ10 supple mentation

B. A. Chis et al., Q10 coenzyme in metabolic syndrome in rats

Univariate analysis

GLM-RM showed increase significance for exercise (F = 26.056, p < 0.001) and CoQ10 supplementation (F = 25.266, p = 0.001). SH were lower in trained (F = 8.448, p = 0.006) and CoQ10 groups (F = 118.721, p < 0.001), higher in T1 but decreased in T2 and T3 as well (F = 38.207, p < 0.001 and F = 392.633, p < 0.001 in GLM-RM respectively). Liver MDA was lower in CoQ10 groups (F = 35.151, p < 0.001) and slightly higher in trained groups (F = 1.229, p = 0.275). Liver SH decreased strongly in CoQ10 supplemented groups (F = 67.741, p < 0.001) and less in trained ones (F = 4.397, p = 0.043). Tissue MDA and SH were moderately correlated (r = 0.436, p = 0.006).

High fat diet Serum MDA in T0 was lower in trained (F = 5.594, p = 0.024) and CoQ10 supplemented groups (F = 5.222, p = 0.028), and increased in T1 and T2 (Table 3) but decreased in T3 for all the groups, especially in trained (F = 37.914, p < 0.001) and CoQ10 supplemented ones (F = 48.446, p < 0.001). T0 also had higher SH levels in trained (F = 6.741, p = 0.014) and CoQ10 groups (F = 110.335, p < 0.001), which increased in T1 and decreased in T2 and T3 (F = 280.763, p < 0.001 and F = 28.613, p < 0.001 in ANOVA GLM-RM test, respectively). Liver MDA was lower in CoQ10 groups (F = 36.812, p < 0.001), chronic exercise could not significantly change the tissue concentrations (F = 0.894, p = 0.351). Tissue SH were notably lower in CoQ10 groups (F = 36.410, p < 0.001). No correlation was found between MDA and SH liver concentrations when comparing the 2 groups with HF diet.

Rostprandial sedentary time At 2 hours postprandial (T3), with no prior exercise, a divergent trend was observed in serum OS parameters (high MDA and low SH), with negative correlation between these parameters (Pearson r = 0.423 overall, with lowest correlation in standard diet group and higher in high-calorie diet), irrespective of the CoQ10 supplementation (Fig. 2).

Discussion Metabolic syndrome was obtained through high-calorie diets in sedentary groups. Chronic exercise managed to reduce the significance of these changes, while CoQ10 supplementation had a rather cumulative effect, better observed in high fat and high sugar diets. No significant changes were found in fasting MDA serum concentrations in standard diet. CoQ10 supplementation managed to Ó 2019 Hogrefe

Ó 2019 Hogrefe

High fat diet

Sedentary 0.87±0.23 Trained 1.05±0.27

p=0.006 F=8.448

CoQ10 Sedentary 1.54±0.29 supplementation Trained 1.72±0.22

Sedentary 0.77±0.19 p=0.014 Trained 0.97±0.20 F=6.741

CoQ10 Sedentary 1.62±0.17 supplementation Trained 1.85±0.21

No CoQ10

p=0.024 F=5.594

Sedentary 1.09±0.25 p=0.090 Trained 1.23±0.32 F=3.033

CoQ10 Sedentary 1.86±0.18 supplementation Trained 2.01±0.25

No CoQ10

High sugar No CoQ10 diet

Stan dard diet

Sedentary 3.47±0.67 Trained 3.10±0.41

CoQ10 Sedentary 3.18±0.41 supplementation Trained 2.77±0.34

No CoQ10

CoQ10 Sedentary 2.80±0.54 supplementation Trained 2.56±0.41

p<0.001 F=110.335

p<0.001 F=118.721

p<0.001 F=88.668

p=0.028 F=5.222

p=0.119 F=2.548

p=0.280 F=1.201

p=0.188 F=1.802

Sedentary 3.03±0.41 p=0.064 Trained 2.75±0.28 F=3.643,

CoQ10 supplementation

Univariate analysis Training

p<0.001 F=37.914

p<0.001 F=26.056

p<0.001 F=17.124

2.59±0.51 1.62±0.24 2.88±0.37 1.80±0.22

1.75±0.11 0.77±0.17 1.99±0.27 1.22±0.24

2.57±0.26 1.86±0.28 2.89±0.33 2.01±0.30

1.75±0.31 0.90±0.25 1.98±0.21 1.34±0.39

2.41±0.29 2.03±0.29 2.54±0.29 2.29±0.36

p<0.001 F=28.613

p<0.001 F=38.207

p<0.001 F=280.763

p<0.001 F=392.633

p<0.001 F=546.913

p<0.001 F=48.446

p=0.001 F=25.266

p=0.001 F=13.820

CoQ10 supplementation

ANOVA GLM-RM Training

1.57±0.17 1.03±0.14 p<0.001 1.76±0.36 1.38±0.35 F=41.102.823

3.43±0.55 4.03±0.31 3.06±0.46 3.61±0.43

3.92±0.37 4.88±0.21 3.47±0.41 4.19±0.62

3.11±0.65 3.67±0.39 2.76±0.32 3.20±0.38

2.41±0.68 4.18±0.55 3.04±0.33 3.70±0.58

2.92±0.43 3.48±0.46 2.67±0.41 3.12±0.48

3.17±0.34 3.88±0.7 2.87±0.57 3.51±0.54

p=0.120 F=2.538

4.46±0.36 4.19±0.62

6.41±0.93 5.81±1.45

4.61±1.04 4.03±0.81

7.54±1.26 6.70±1.10

4.63±1.26 4.36±1.04

8.50±1.44 7.93±1.96

6.81±1.16 7.08±1.30

p=0.153 F=2.128

p=0.043 F=4.397

p=0.375 F=0.808

10.24±2.55 p=0.351 11.14±2.37 F=0.894

6.66±0.86 6.90±0.97

p<0.001 F=36.410

p<0.001 F=67.741

p<0.001 F=64.308

p<0.001 F=36.812

p<0.001 F=35.151

p<0.001 F=22.457

CoQ10 supplementation

Univariate analysis Training

9.57±2.06 p=0.275 10.55±2.49 F=1.229

6.12±0.94 6.83±0.93

8.43±2.3 9.34±1.82

Liver

Note: Serum malondialdehyde- MDA in nmol/ml, serum thiol groups- SH in μmol/ml, liver MDA in nmol/10 mg of protein, liver SH in μmol/100 mg of protein, T0- fasting, T1- postprandial, T2- after exercise. Data are expressed as average±standard deviation.

High fat diet

Sedentary 2.90±0.54 Trained 2.68±0.35

Sedentary 2.72±0.57 CoQ10 supplementation Trained 2.51±0.51

No CoQ10

High sugar No CoQ10 diet

MDA Stan dard diet

Group

Table 2. Serum and liver oxidative stress parameters

B. A. Chis et al., Q10 coenzyme in metabolic syndrome in rats 37

Int J Vitam Nutr Res (2020), 90 (1–2), 33–41

Figure 2. Serum parameters of oxidative stress without postprandial exercise (CoQ10 status not considered). n = 20, St – standard diet, HS – high sugar diet, HF – high fat diet, E- for chronic sedentary and E+ for trained groups. Malondialdehyde (MDA) in nmol/ml, thiol groups (SH) in μmol/ml 10; box plots ± standard deviation.

induce a significant OS status drop during high-calorie diets, while training had a similar effect only in high-fat ones. It has been observed that the more calories, the higher the number of factors that can change the OS status and the stronger their effects, showing multiple ways of interfering with diet induced metabolic changes. The best antioxidant status was observed in the trained and CoQ10 supplemented group, for standard diet. The analysis of postmenopausal women without diabetes, made by by Kitabchi et al., showed that there is a difference between the high-protein diet and the high-carbohydrate diet regarding OS and inflammation, most probably due to β-cell function stimulation, insulin sensitivity increase, with consecutive protection against oxidative stress, cardio-vascular risk factors, and also improvement in adiponectin levels [25]. Several other studies showed that CoQ10 supplementation reduced MDA and total antioxidant capacity in diabetes mellitus patients, including the ones with onset coronary heart disease [17, 26], but with no other proof of adiponectin involvement. Our study did not include rats with diabetes, but the first components of metabolic syndrome (overweight and dysmetabolism) were reached. 60 minutes after eating, before exercising, all groups had higher serum MDA levels, in response to postprandial lipid peroxidation and protein glycation, which led to oxidative stress and its subsequent complications [27]. The lowest OS response was found in the trained group with standard diet and CoQ10 supplementation. As the postprandial Int J Vitam Nutr Res (2020), 90 (1–2), 33–41

B. A. Chis et al., Q10 coenzyme in metabolic syndrome in rats

MDA serum values were the highest in high fat diet groups, postprandial OS seems to be associated with the calorie intake, as the energy needed for digestion, lipid peroxidation and protein glycation is also higher. After eating, there was an increase in serum SH concentrations, along with higher MDA, as a result to OS production while eating. This antioxidant response was higher for CoQ10 supplemented groups and proportional to the calorie intake. Fisher et al. found that high-dextrose diet as a post-exercise energy rebalance did not change the fasting OS in young healthy males, as the glucose metabolism is considered adequate, with no insulin secretion impairment or peripheral resistance [28]. Our study reached the same conclusion for the group with standard diet and postprandial exercise, but in chronic high-calorie diets, especially in high-fat diets, the changes of OS were significant, possibly because of high amount of sugar/fat per serving. After 60 minutes of swimming, serum MDA has the highest increase in untrained and non-CoQ10 groups, as a consequence of acute exercise-induced OS. The slowest antioxidant response was observed in high-calorie diets. After acute exercise, SH dropped trough antioxidants consumption as a response to MDA higher levels. This decrease is also more significant in untrained and non-CoQ10 groups, as there is a lower antioxidants reserve. Studying OS along with exercise is widely spread in the literature. MDA, as an OS marker, is highly sensitive between TBARS (thiobarbituric acid reactive species), as they are all involved in the carbohydrate oxidation. It’s been shown that physical training can help muscle fibers adapt to OS [29]. Although harvesting blood itself can generate OS, there is evidence that lipid peroxidation can be produced by exercise as well [30]. These processes are held mainly in mitochondria involving NFkappaB (nuclear factor kappa B) and protein activated mitogen kinase [31]. Although other studies found no significant changes in MDA levels during standard exercise (along with other respiratory hydrocarbons) [32], our study involves chronic lifestyle changes – such as the diets – with consequent different antioxidant response. We also considered antioxidant supplementation. Cooke et al. found a significant effect of CoQ10 supplementation on lowering OS during and after exercise, when physical chronic training was considered [33]. Along MDA, another lipid oxidation marker could be the isoprostane F2 (with its 4 classes), which doesn’t need cyclooxygenase for oxidation, but it is only applicable in high intensity acute exercise [34]. Our study involves chronic exercise, the only bout of acute unique exercise being used for sedentary groups, where high OS response has been observed. In the case of groups with sedentary status after eating (T3, 2 hours postprandial) we obtained a better postprandial oxidant status, as we did in previous trained and CoQ10 supplemented groups. Antioxidant supplementation Ó 2019 Hogrefe

B. A. Chis et al., Q10 coenzyme in metabolic syndrome in rats

brought OS status in high-calorie diets to similar values as those seen in standard diets. Antioxidant capacity decreased by consumption compared to T1, less in trained and CoQ10 groups and more in high calories diets. Postprandial oxidative stress has been adressed in few studies, most of them on Mediterranean diet in elderly, where small doses of CoQ10 supplementation came to amplify the OS reduction [35, 36], with higher increase in capillary flow and in nitric oxide levels, lower lipid peroxidation and postprandial glutathione peroxidase activity reduction. Our study was similar to these studies, involving three types of diets, and also concluding the benefits of antioxidant (CoQ10) supplementation in postprandial antioxidant activity. Even in an occasionally postprandial sedentary time, as T3 for the trained groups, the antioxidant capacity maintains better values than in sedentary groups. Tissue concentrations of OS parameters were similar to the serum findings. We obtained lower liver MDA values in CoQ10 groups and slightly higher values in trained rats, hence concluding that antioxidant supplementation can change the tissue concentrations of OS, but exercise cannot. This also shows a better role of chronic exercise in serum oxidant-antioxidant balance. SH were lower in trained and CoQ10 groups, as the antioxidant levels dropped, as a result of chronic intracellular consumption. Highest OS parameters were found in high-calorie diets, but the correlation between them was lower, showing that other parameters are involved in the tissue antioxidant response. High fat meals increased liver MDA in previous studies [37], but no correlation was found to this point in oxidant/antioxidant capacity. The high OS levels found in the liver of the high-calorie fed rats suggest higher local lipid peroxidation. Liver steatosis, found in MetS, is a source for this peroxidation, and its products can have harmful effects on the hepatic cells. The oxygen reactive species produced will interfere with the mitochondrial respiratory chain and consequently with supplementary OS production, additional liver disorders, aggravation of metabolic syndrome features or even apoptosis or necrosis of the cell with final fibrosis [38]. The same conclusion was drawn from our study: as the caloric intake rises, so does the MDA and SH levels in the liver. CoQ10 supplementation managed to reduce this increase, but not the exercise itself. In this study, MetS was obtained through sedentarism and high-calorie diets. Antioxidant supplementation managed to reduce the effects of MetS, and along with chronic exercise, the OS status to values similar to the ones found in standard diets. This study shows the importance of CoQ10 supplementation in different lifestyles, especially in the ones that can lead to obesity and metabolic changes. Considering that there is an exact amount of each nutrient needed for a healthy life, this study demonstrates that high amounts of antioxidants are required to interfere with Ó 2019 Hogrefe

the metabolic changes in MetS and its leading lifestyles. As no such high dosage is available for human use, it would be necessary to involve more antioxidants rather than just one. This could be possible by combining different antioxidants with potential additive effects.

Limits of the study This study evaluated only one type of standard exercise, as anaerobic exercise is more efficient in weight loss. Swimming can be considered anaerobic only for the first days, when the animals are not yet adapted to daily exercise [39]. Some authors considered the amount of time to induce diet related cardiovascular risk up to six weeks [40]. Our study was conducted during 28 days, enough to induce weight gain and metabolic disorders, as the first components of MetS. Also we determined two OS markers (one out of the TBARS and one from antioxidant capacity), and the results were interpreted accordingly, with high significance level.

Conclusions CoQ10 supplementation and chronic exercise improved diet-related and exercise-induced OS. The higher the daily calorie intake, the more significant the antioxidant effect of CoQ10, as the most desired effect is found in high fat diet. Chronic exercise along with CoQ10 supplementation ameliorates the OS balance in sedentary postprandial case. CoQ10 supplementation reduced liver MDA and SH, with the highest significance in high-calorie diets, while chronic exercise did not induce significant changes.

References 1. Patel, V.P., & Chu, C.T. (2011) Nuclear transport, oxidative stress, and neurodegeneration. Int J Clin Exp Pathol. 4, 215– 229. 2. Forsberg, E., Xu, C., Grünler, J., Frostegård, J., Tekle, M., Brismar, K., & Kärvested, L. (2015) Coenzyme Q10 and oxidative stress, the association with peripheral sensory neuropathy and cardiovascular disease in type 2 diabetes mellitus. J Diabetes Complications. 29, 1152–1158. 3. Niklowitz, P., Onur, S., Fischer, A., Laudes, M., Palussen, M., Menke, T., & Döring, F. (2016) Coenzyme Q10 serum concentration and redox status in European adults: influence of age, sex, and lipoprotein concentration. J Clin Biochem Nutr. 58, 240–245. 4. Ramond, A., Godin-Ribuot, D., Ribuot, C., Totoson, P., Koritchneva, I., Cachot, S., Levy, P., & Joyeux-Faure, M. (2011) Oxidative stress mediates cardiac infarction aggravation induced by intermittent hypoxia. Fundam Clin Pharmacol. 27, 252–261.

Int J Vitam Nutr Res (2020), 90 (1–2), 33–41

5. Alehagen, U., Alexander, J., & Aaseth, J. (2016) Supplementation with Selenium and Coenzyme Q10 Reduces Cardiovascular Mortality in Elderly with Low Selenium Status. A Secondary Analysis of a Randomised Clinical Trial. PLoS One. 11, e0157541. 6. Gems, D., & Partridge, L. (2008) Stress-response hormesis and aging: “that which does not kill us makes us stronger”. Cell Metab. 7, 200–203. 7. Fong, J.J., & Rhoney, D.H. (2006) NXY-059: review of neuroprotective potential for acute stroke. Ann Pharmacother. 40, 461–471. 8. Pryor, W.A. (2000) Vitamin E and heart disease: basic science to clinical intervention trials. Free Radic Biol Med. 28, 141– 164. 9. Kaur, J. (2014) A comprehensive Review on metabolic syndrome. Cardiology Research and Practice. 2014, 943162. doi: 10.1155/2014/943162 10. Bell, D.S., O’Keefe, J.H., & Jellinger, P. (2008) Postprandial dysmetabolism: the missing link between diabetes and cardiovascular events? Endocr Pract. 14, 112–124. 11. Garber, A.J. (2012) Postprandial dysmetabolism and the heart. Heart Fail Clin. 8, 563–573. 12. Nordmann, A.J., Nordmann, A., Briel, M., Keller, U., Yancy, W. S. Jr, Brehm, B.J., & Bucher, H.C. (2006) Effects of lowcarbohydrate vs low-fat diets on weight loss and cardiovascular risk factors: a meta-analysis of randomized controlled trials. Arch Intern Med. 166, 285–293. 13. Bellinger, A.M., Reiken, S., Dura, M., Murphy, P.W., Deng, S.X., Landry, D.W., Nieman, D., Lehnart, S.E., Samaru, M., La Campagne, A., & Marks, A.R. (2008) Remodeling of ryanodine receptor complex causes “leaky” channels: A molecular mechanism for decreased exercise capacity. Proceedings of the National Academy of Sciences of the United States of America. 105, 2198–2202. 14. Sies, H. (1997) Oxidative stress. Oxidants and antioxidants. Experim Physiol. 82, 291–295. 15. Radak, Z., Suzuki, K., Higuchi, M., Balogh, L., Boldogh, I., & Koltai, E. (2016) Physical exercise, reactive oxygen species and neuroprotection. Free Radical Biology and Medicine. 98, 187–196. 16. Ercan, H., Kiyici, A., Marakoglu, K., & Oncel, M. (2016) 8-Isoprostane and Coenzyme Q10 Levels in Patients with Metabolic Syndrome. Metab Syndr Relat Disord. 14, 318– 321. 17. Raygan, F., Rezavandi, Z., Dadkhah Tehrani, S., Farrokhian, A., & Asemi, Z. (2016) The effects of coenzyme Q10 administration on glucose homeostasis parameters, lipid profiles, biomarkers of inflammation and oxidative stress in patients with metabolic syndrome. Eur J Nutr. 55, 2357–2364. 18. Cicero, A.F., Morbini, M., Rosticci, M., D’addato, S., Grandi, E., & Borghi, C. (2016) Middle-term dietary supplementation with red yeast rice plus coenzyme Q10 improves lipid pattern, endothelial reactivity and arterial stiffness in moderately hypercholesterolemics. J Hypertens. 34, e109–e110. 19. Hosoe, K., Kitano, M., Kishida, H., Kubo, H., Fujii, K., & Kitahara, M. (2007) Study on safety and bioavailability of ubiquinol (Kaneka QHTM) after single and 4-week multiple oral administration to healthy volunteers. Regul Toxicol Pharmacol. 47, 19–28. 20. The University of Texas at Austin. Institutional Animal Care and Use Committee: Guidelines for the Use of Cervical Dislocation for Rodent Euthanasia.http://www.utexas.edu/ research/rsc/iacuc/forms/guideline04.pdf 21. Kregel, K.C. (2006) Exercise protocols using rats and mice. In American phisiology Society: Resource book for the design of animal exercise protocols (pp. 23–57). http://www.the-aps.

Int J Vitam Nutr Res (2020), 90 (1–2), 33–41

B. A. Chis et al., Q10 coenzyme in metabolic syndrome in rats

22.

23.

24.

25.

26.

27.

28.

29. 30.

31.

32.

33.

34.

35.

36.

org/mm/SciencePolicy/AnimalResearch/Publications/AnimalExercise-Protocols/book14824.pdf Alberti, K.G.M.M., Eckel, R.H., Grundy, S.M., Zimmet, P.Z., Cleeman, J.I., Donato, K.A., Fruchart, J.C., James, W.P.T., Loria, C.M., & Smith, S.C. (2009) Harmonizing the Metabolic Syndrome. Circulation. 120, 1640–1645. Esterbauer, H., & Chjeeseman, K. (1994) Determination of aldehydic lipid peroxidation products: malonaldehyde and 4-hydroxynonenal. In Met in Enzymol. 186, 406–413. Hu, M.L. (1994) Measurement of protein thiol groups and glutathione in plasma. In Methods in Enzymology (vol. 233, pp. 380–384). Academic Press. Kitabchi, A.E., McDaniel, K.A., Jim, Y., Wan, R.D., Tylavsky, F.A., Jacovino, C.A., Sands, C.W., Nyenwe, E.A., & Stents, F.B. (2013) Effects of High-Protein Versus High-Carbohydrate Diets on Markers of β-Cell Function, Oxidative Stress, Lipid peroxidation, Proinflammatory Cytokines, and Adipokines in Obese, Premenopausal Women Without Diabetes. A randomized controlled trial. Diabetes Care. 36, 1919–1925. Moazen, M., Mazloom, Z., Ahmadi, A., Dabbaghmanesh, M.H., & Roosta, S. (2015) Effect of coenzyme Q10 on glycaemic control, oxidative stress and adiponectin in type 2 diabetes. J Pak Med Assoc. 65, 404–408. Fatani, S.H., Babakr, A.T., NourEldin, E.M., & Almarzouki, A.A. (2016) Lipid peroxidation is associated with poor control of type-2 diabetes mellitus. Diabetes Metab Syndr. 10, S64– S67. Fisher-Wellman, K.H., & Bloomer, R.J. (2010) Lack of effect of a high-calorie dextrose or maltodextrin meal on postprandial oxidative stress in healthy young men. Int J Sport Nutr Exerc Metab. 20, 393–400. Leeuwenburgh, C., & Heinecke, J.W. (2001) Oxidative stress and antioxidants in exercise. Curr Med Chem. 8, 829–838. Chisß, B.A., Giurgea, N., Daicoviciu, D., & Muresßan, A. (2011) Oxidative stress implications in exercise physiology in experimental induced postprandial dismetabolism. Clujul Medical. 84, 23–27. Ji, L.L. (2008) Modulation of skeletal muscle antioxidant defense by exercise: Role of redox signaling. Free Radic Biol Med. 44, 142–152. Di Massimo, C., Scarpelli, P., & Tozzi-Ciancarelli, M.G. (2004) Possible involvement of oxidative stress in exercise mediated platelet activation. Clin Hemorheol Microcirc. 30, 313–316. Cooke, M., Iosia, M., Buford, T., Shelmadine, B., Hudson, G., Kerksick, C., Rasmussen, C., Greenwood, M., Leutholtz, B., Willoughby, D., & Kreider, R. (2008) Effects of acute and 14day coenzyme Q10 supplementation on exercise performance in both trained and untrained individuals. J Int Soc of Sports Nutr. 8. doi: 10.1186/1550-2783-5-8 Milne, G.L., Yin, H., Brooks, J.D., Sanchez, S., Jackson Roberts, L. 2nd, & Morrow, J.D. (2007) Quantification of F2-isoprostanes in biological fluids as a measure of oxidative stress. Methods Enzymol. 433, 113–126. Yubero-Serrano, E.M., Delgado-Casado, N., Delgado-Lista, J., Perez-Martinez, P., Tasset-Cuevas, I., Santos-Gonzalez, M., Caballero, J., Garcia-Rios, A., Marin, C., Gutierrez-Mariscal, F. M., Fuentes, F., Villalba, J.M., Tunez, I., Perez-Jimenez, F., & Lopez-Miranda, J. (2011) Postprandial antioxidant effect of the Mediterranean diet supplemented with coenzyme Q10 in elderly men and women. Age (Dordr). 33, 579–590. Yubero-Serrano, E.M., Gonzalez-Guardia, L., Rangel-Zuñiga, O., Delgado-Casado, N., Delgado-Lista, J., Perez-Martinez, P., Garcia-Rios, A., Caballero, J., Marin, C., Gutierrez-Mariscal, F. M., Tinahones, F.J., Villalba, J.M., Tunez, I., Perez-Jimenez, F., & Lopez-Miranda, J. (2013) Postprandial antioxidant gene expression is modified by Mediterranean diet supplemented

Ó 2019 Hogrefe

B. A. Chis et al., Q10 coenzyme in metabolic syndrome in rats

37.

38.

39.

40.

with coenzyme Q(10) in elderly men and women. Age (Dordr). 35, 159–170. Liu, Y., Song, A., Zang, S., Wang, C., Song, G., Li, X., Zhu, Y., Yu, X., Li, L., Wang, Y., & Duan, L. (2015) Jinlida reduces insulin resistance and ameliorates liver oxidative stress in high-fat fed rats. J Ethnopharmacol. 162, 244–252. Milagro, F.I., Campión, J., & Martínez, J.A. (2006) Weight gain induced by high-fat feeding involves increased liver oxidative stress. Obesity. 14, 1118–1123. Boutcher, S.H. (2011) High-Intensity Intermittent Exercise and Fat Loss. Journal of Obesity. 868305. doi: 10.1155/2011/ 868305 Munshi, R.P., Joshi, S.G., & Rane, B.N. (2014) Development of an experimental diet model in rats to study hyperlipidemia and insulin resistance, markers for coronary heart disease. Indian Journal of Pharmacology. 46, 270–276.

Conflict of interest The authors declare that there are no conflicts of interest.

Bogdan Augustin Chis, MD, PhD Assistant professor 2nd Internal Medicine Department Cluj County Emergency Hospital “Iuliu Hatieganu” University of Medicine and Pharmacy Clinicilor 2-4 street Cluj-Napoca Romania, 400006 bogdan_a_chis@yahoo.com

Acknowledgments This work is part of the PhD thesis of dr. Bogdan Augustin Chis. Dr. Ana Florica Chis was involved in experimental work. Prof. Muresan was involved in study design, and prof. Fodor conducted the data interpretation and the publication work.

Ó 2019 Hogrefe

Int J Vitam Nutr Res (2020), 90 (1–2), 33–41

Original Communication

Maximal dose-response of vitamin-K2 (menaquinone-4) on undercarboxylated osteocalcin in women with osteoporosis Tusar K Giri1, David Newton1,2, Opal Chaudhary1, Elena Deych1, Nicola Napoli1,3, Reina Armamento-Villareal1,4, Kathy Diemer1, Paul E Milligan1,5, and Brian F Gage1 1

Department of Medicine, Washington University in Saint Louis, Missouri

Cleveland Clinic, Cleveland, Ohio

Univeristà campus Bio-Medico di Roma, Italy

Baylor College of Medicine, Houston, Texas

BJC Healthcare System, Missouri

Received: December 10, 2016; Accepted: March 25, 2017

Abstract: Low concentrations of serum vitamin K accompany high concentrations of undercarboxylated osteocalcin (ucOC) and osteoporotic fractures. Although vitamin K2 (MK-4) is approved as a therapeutic agent for the treatment of osteoporosis in some countries, the doseresponse is unknown. The objective of this study was to assess the improvement in carboxylation of osteocalcin (OC) in response to escalating doses of MK-4 supplementation. A nine-week, open-labeled, prospective cohort study was conducted in 29 postmenopausal women who suffered hip or vertebral compression fractures. Participants took low-dose MK-4 (0.5 mg) for 3 weeks (until the second visit), then medium-dose MK-4 (5 mg) for 3 weeks (until the third visit), then high-dose MK-4 (45 mg) for 3 weeks. The mean ± SD age of the participants was 69 ± 9 years. MK-4 dose (p < 0.0001), but neither age nor other relevant medications (e.g. bisphosphonates) correlated with improvement in %ucOC. As compared to baseline concentrations (geometric mean ± SD) of 16.8 ± 2.4, 0.5 mg supplementation halved %ucOC to 8.7 ± 2.2 (p < 0.0001) and the 5-mg dose halved %ucOC again (to 3.9 ± 2.2; p = 0.0002 compared to 0.5-mg dose). However, compared to 5 mg/day, there was no additional benefit of 45 mg/day (%ucOC 4.6; p = NS vs. 5-mg dose). MK-4 supplementation resulted in borderline increases in γ-carboxylated osteocalcin (glaOC; p = 0.07). There were no major side effects of MK-4 supplementation. In postmenopausal women with osteoporotic fractures, supplementation with either 5 or 45 mg/day of MK-4 reduces ucOC to concentrations typical of healthy, pre-menopausal women. Keywords: Carboxylation of osteocalcin, Dose-finding, Postmenopausal osteoporosis, Vitamin K2 (MK-4), hip or vertebral compression fractures

Introduction Hip and vertebral fractures are common among postmenopausal women and can prevent independence [1]. Vertebral fractures cause significant back pain and limit functional activity [2]. Hip fractures reduce life expectancy and cost the US $20 billion each year [3, 4]. Given the decline in use of postmenopausal hormonal therapy after pivotal trials [5, 6] and the graying of the population, the frequency of osteoporotic fractures continues to rise [7]. Thus, additional therapies to prevent postmenopausal fractures are needed. Int J Vitam Nutr Res (2020), 90 (1–2), 42–48 https://doi.org/10.1024/0300-9831/a000554

Epidemiologic studies suggest that vitamin K promotes bone health [8, 9]. Low concentrations of circulating vitamin K accompany low bone mineral density [10] and bone fractures [11]. In the Nurses’ Health Study, low dietary intake of vitamin K (< 109 μg/d) was associated with hip fractures [12]. The major dietary sources of vitamin K1 are green leafy or cruciferous vegetables, and plant oils (e.g soybean oil). Important dietary sources of vitamin K2 are meat (especially liver), egg yolks, cheese, and the Japanese dish natto. The recommendations for Vitamin K1 are associated with its function in the activation of coagulation factors. However, there is no official recommendation of Ó 2019 Hogrefe

T.K. Giri et al., Maximal dose-response of vitamin-K2 (menaquinone-4)

vitamin K2 due to lack of sufficient data according to Food and Nutrition Board (www.nationalacademies.org/hmd). Biochemical studies suggest that vitamin K is beneficial because of its effect on osteocalcin (OC), a regulator of bone mineralization [13, 14]. Specifically, vitamin K functions as a cofactor for the enzyme that catalyzes the post-translational γ-carboxylation of glutamic acid residues on OC and other proteins [15]. With vitamin K deficiency and aging, the proportion of OC that is uncarboxylated (ucOC) rises [16]. Higher concentrations of ucOC are associated with low bone mineral density [17, 18] and hip fractures [19–22]. In young, healthy adults, approximately 7.5% of the OC is ucOC [23]. Vitamin K2 (e.g. menaquinone 4; MK-4) supplementation decreases serum ucOC concentrations within 2 weeks of supplementation [24–33]. Studies of supplementation with vitamin K2 (MK-7) 180 or 360 μg/d, have had variable biochemical benefits [32–39] and suggest that higher doses are necessary to carboxylate OC maximally [40–42]. Some trials of vitamin K supplementation have found a reduction in fractures [37, 43, 44] but others have not [36, 45, 46]. In hemodialysis patients, supplementation with 360 μg of vitamin K2 (MK-7) reduced ucOC by one-third, but lower doses had no significant benefit [41]. In healthy adults (20–60 years of age) supplementation with 90 or 180 μg of synthetic vitamin K2 (MK-7) reduced ucOC by 21% and 29%, respectively, with peak benefits obtained after approximately 3 weeks of supplementation [47]. Given prior research, we wondered what dose of vitamin K2 would maximally reduce ucOC in elderly patients with osteoporosis. Although high doses of vitamin K3 can be toxic [48], doses of vitamin K2 more than100 times the dietary recommendations [49] (e.g. MK-4 up to 45 mg/d are safe [30, 37, 50, 51] and vitamin K2 (MK-7) supplementation does not appear to increase thrombin generation [42]). The primary objective of this study was to evaluate the biochemical response of escalating doses of vitamin K2 (MK-4) up to 45 mg/d on ucOC. This was an open-labeled prospective cohort study conducted in postmenopausal women with a history of osteoporotic fractures.

hyperparathyroidism, malignancy, metabolic bone disease, rheumatoid arthritis, alcoholism, cirrhosis, or chronic kidney disease stage IV or V). We also excluded women who were taking chronic glucocorticoids or warfarin [52]. Recruitment of participants occurred via physician referral located within Washington University Medical Center.

Study design A nine-week, open-labeled, prospective cohort study was conducted to quantify the biochemical response to oral vitamin K2 (MK-4) supplementation. After the baseline blood draw, participants took low-dose MK-4 (0.5 mg) for 3 weeks (until the second-visit), then medium-dose MK-4 (5 mg) for 3 weeks (until the third-visit), then high-dose MK-4 (45 mg) for 3 weeks. The MK-4 was supplied by Eisai Co., Ltd (Tokyo, Japan) in blister packs. At the end of each 3-week period, participants donated a blood sample. Participants were instructed not to change their eating habits during the study period. In addition to vitamin K2 (MK-4), all participants received standardized doses of elemental calcium, 1200 mg/day, and vitamin D3, 800 IU/day (CitracalTM , Bayer HealthCare LLC, New Jersey, USA), divided into two doses per day in accordance with National Osteoporosis Foundation recommendations [53]. Prior to participation, vitamin D deficiency had been corrected and participants had been prescribed calcium as per standard of care. During each visit, venous blood samples were collected at the General Clinical Research Center or osteoporosis clinics affiliated with Washington University in St. Louis. Blood samples were centrifuged at 1600 g for 15 min at 4 °C. Serum was separated and stored at 80 °C until used. Prior to enrolling, participants provided written informed consent. This study was conducted according to the Declaration of Helsinki and all procedures involving human subjects were approved by the Washington University Human Research Protection Office.

Measurements of ucOC and glaOC

Materials and Methods Study participants We recruited non-Hispanic, Caucasian women living in the St. Louis area who suffered a non-pathologic hip or vertebral compression fracture that occurred without major trauma. Participants had to be age 50 or older and postmenopausal, with at least 12 months elapsed since their last menses. We excluded women with secondary causes of osteoporosis (i.e., vitamin D deficiency, Ó 2019 Hogrefe

Commercially available kits (Takara Bio Inc., Shuzo, Japan) that utilize sets of monoclonal antibodies highly reactive to ucOC (Cat# MK118) and glaOC (Cat# MK111), were used to measure the different forms of osteocalcin concentrations. The ucOC EIA kit measures 100% of undercarboxylated forms of OC (ucOC) and cross reacts 5% with human bone OC (probably the γ-carboxylated form, glaOC) [54]. Similarly, the glaOC EIA kit specifically measures 100% of γ-carboxylated form of OC with no detectable cross reactivity with undercarboxylated OC [22, 54]. A standard curve was run for every individual plate and the range of detection Int J Vitam Nutr Res (2020), 90 (1–2), 42–48

T.K. Giri et al., Maximal dose-response of vitamin-K2 (menaquinone-4)

Table 1. Dose-dependent changes in OC concentrations following MK-4 administration. Baseline concentrations, no MK-4 (n = 29); geometric mean (SD)

0.5 mg of MK-4 (n = 28); geometric mean (SD)

5 mg of MK-4 (n = 22); geometric mean (SD)

45 mg of MK-4 (n = 21); geometric mean (SD)

glaOC, (ng/ml)

8.4 (2.3)

9.9 (2.2)

13.9 (1.9)

12.0 (2.2)

ucOC, (ng/ml)

1.9 (2.8)

1.0 (2.5)

0.6 (2.6)

0.6 (2.7)

%ucOC, [(ucOC/(ucOC + glaOC)) 100]

16.8 (2.4)

8.7 (2.2)

3.9 (2.2)

4.5 (3.0)

OC: Osteocalcin, MK-4: Menaquinone 4, ucOC: undercarboxylated osteocalcin, glaOC: γ-carboxylated osteocalcin.

for ucOC EIA kit and glaOC EIA kit were 0.25–8 ng/ml and 0.5–16 ng/ml, respectively. The intra-assay and inter-assay coefficient of variation (CV) for both kits were acceptable: for ucOC, 5.2% and 8.3%, respectively and for glaOC, 3.7% and 1.4%, respectively. All samples were measured in duplicate and averaged.

Statistical analysis We used the %ucOC for all statistical analysis in this study, since it is a more sensitive marker of vitamin K availability in bone than ucOC concentrations [9, 36]. The %ucOC was calculated as [(ucOC/(ucOC + glaOC)) 100]. Prior to statistical analysis, the %ucOC values were log-transformed to achieve normal distribution. The effect of different doses of vitamin K2 (MK-4) on ucOC ratio was analyzed using ANCOVA, in a repeated measures model (PROC MIXED in SAS). We adjusted for age and related medication (alendronate, ibandronate, risedronate, calcitonin, and raloxifene). The effect of vitamin K2 (MK-4) was assessed by pair-wise comparisons adjusting for multiple comparisons in Proc MIXED as well as paired t-tests comparing pre-baseline measures to each follow-up measure after the escalating vitamin K2 (MK-4) doses. Two-sided p-values < 0.05 were considered statistically significant.

Results The mean ± SD age of the 29 participants was 69 ± 9.0 years (range 54–84 years). Sixteen patients (55%) took relevant medications (alendronate, ibandronate, risedronate, calcitonin, and raloxifene). Neither age nor medications effect were found as significant predictor of the outcome (%ucOC) in an adjusted model. Twenty-nine samples were available from the baseline visit, 28 were available from the second visit; 22 from the third-visit and 21 from the fourth visit. Reasons for failure to obtain a sample (and N) were: samples lost or not available (4), patient withdrawal without side effects (3), nausea or bloating (2), treatment for localized cancer (1), distance Int J Vitam Nutr Res (2020), 90 (1–2), 42–48

from medical center (1), development of pruritic rash (1), and fear of thrombosis in patient with history of thrombosis (1). There were no deaths or major side effect of MK-4 supplementation. The effect of MK-4 was highly significant (p < 0.0001) in a repeated measures model (PROC MIXED in SAS). The dose-dependent changes in OC concentrations following escalating dose of MK-4 supplementation were significant (Table I). Pair-wise comparisons revealed that 0.5 mg resulted in significant reduction in %ucOC compared to baseline (p < 0.0001) and increasing the dose to 5.0 mg had a significantly greater reduction than 0.5 mg (p = 0.0002). However, there was no additional benefit of MK-4 (45 mg/day) compared to 5 mg. MK-4 significantly lowered %ucOC (Figure 1), primarily because it lowered ucOC concentration (p < 0.0001). The geometric mean (SD) of baseline %ucOC was 16.8% ± 2.4. At 0.5 mg/day of MK-4 the %ucOC was halved (a 48% reduction) to 8.7% ± 2.2; at 5 mg/day it was halved again to 3.9% ± 2.2 (a 72% reduction vs. baseline) and at 45 mg/day the %ucOC was 4.5% ± 3.0. MK-4 resulted in a borderline increase in glaOC (p = 0.07).

Discussion Similar to studies of vitamin K1 [23] and of MK-7 [33, 41, 42], we found that low-dose MK-4 (0.5 mg/d) prescribed for 3 weeks in elderly women with osteoporotic fractures halved their %ucOC and that higher doses had even greater benefit. Specifically, we found that 5 mg/day of MK-4 reduced %ucOC by 72% (to absolute levels of 3.9%– 4.5%). However, the 45 mg/d dose of MK-4 was no more effective than 5 mg/d. Prior studies that prescribed 45 mg/d of MK-4 and found relative reductions of ucOC of 37% to 55% [30, 37, 46, 50]. Thus, there does not appear any biochemical benefit of prescribing 45 mg/d rather than 5 mg/d of MK-4. Prior studies of MK-7 found that supplementation with (45–360 μg/d) reduced ucOC in a dose-dependent manner [41, 42] with MK-7 doses of 180 to 360 μg/day reducing % ucOC by one-third to one-half, depending on the population [33, 41, 42]. The lower doses of MK-7 necessary to halve the Ó 2019 Hogrefe

T.K. Giri et al., Maximal dose-response of vitamin-K2 (menaquinone-4)

Figure 1. Box plots showing the changes in γ-carboxylated osteocalcin (glaOC) [A]; undercarboxylated osteocalcin (ucOC) [B]; and %ucOC ratio [C] from baseline, following escalating doses of vitamin K2 supplementation. Lines show medians, plus signs show means, whiskers show 1.5 times interquartile ranges, and open squares show outliers. All samples were measured in duplicate and averaged. A nine-week, open-labeled, prospective cohort study was conducted to quantify the biochemical response to oral vitamin K2 (MK-4) supplementation.

%ucOC reflects the greater potency and longer half-life of MK-7 vs. MK-4 [55–57]. The mechanism by which vitamin K may protect against fractures is controversial. In a study of low phylloquinone Ó 2019 Hogrefe

intake in postmenopausal women, no significant changes in bone and mineral metabolism occurred despite changes in bone markers of vitamin K status [58], but the study duration was too short (84 days) to assess risk of fracture. Int J Vitam Nutr Res (2020), 90 (1–2), 42–48

T.K. Giri et al., Maximal dose-response of vitamin-K2 (menaquinone-4)

A trial (ECKO) [44] of phylloquinone (5 mg/day) reduced fracture risk without improving bone mineral density (BMD). Both vitamin K1 and MK-7 are converted to MK-4 in extrahepatic tissues [59] with MK-7 being a more effective elevator of MK-4 [60]. Knapen et al. suggest that vitamin K2 improves bone geometry [61], perhaps because it allows for carboxylation of osteocalcin, a protein that stimulates bone mineral maturation [62, 63]. This study has strengths and weakness. One weakness is that the short-duration of follow-up did not allow us to assess the effect of MK-4 on rate of fractures. Clinical trials of vitamin K supplementation have been inconclusive, with some trials showing a reduction in fractures [37, 43, 44] and others not [45, 46, 51]. A second weakness is that we did not assess for potential benefits of MK-4 supplementation on bone geometry or density. One strength is the dose-escalation, which allowed us to quantify the biochemical benefit of escalating doses of MK-4. Prior to this study, the biochemical benefits of higher MK-4 doses were speculated, but required validation because different formulations of vitamin K appear to have different levels of potency [56, 57] and the response to vitamin K supplementation may depend on age or population [23, 28]. For example, a study in 20 elderly Japanese women found a 38% ucOC reduction after 45 mg MK-4 supplementation for 2 weeks [30] – only half the benefit we observed in our Caucasian population. Prior research suggests that MK-4 is more potent than phylloquinone in the reduction of ucOC concentration [30] and in improving lumbar spine-BMD [64] and we studied MK-4. We found that MK-4 promotes conversion of ucOC to glaOC because the total concentration of OC (ucOC + glaOC) did not rise.

Conclusion We demonstrated that in postmenopausal women with osteoporotic fractures, supplementation with 5 or 45 mg/day of MK-4 maximally reduced %ucOC to levels typical of young, healthy adults. Although 0.5 mg/d of MK-4 also reduced %ucOC significantly, the higher doses were more effective. In the future, a randomized controlled trial should test the hypothesis that 5 mg/day of MK-4 improves bone health in postmenopausal women with osteoporotic fractures.

References 1. Melton, L.J. 3rd (1995) How many women have osteoporosis now? J Bone Miner Res. 10, 175–177.

Int J Vitam Nutr Res (2020), 90 (1–2), 42–48

2. Nevitt, M.C., Ettinger, B., Black, D.M., Stone, K., Jamal, S.A., Ensrud, K., Segal, M., Genant, H.K., & Cummings, S.R. (1998) The association of radiographically detected vertebral fractures with back pain and function: a prospective study. Ann Intern Med. 128, 793–800. 3. Braithwaite, R.S., Col, N.F., & Wong, J.B. (2003) Estimating hip fracture morbidity, mortality and costs. J Am Geriatr Soc. 51, 364–370. 4. Budhia, S., Mikyas, Y., Tang, M., & Badamgarav, E. (2012) Osteoporotic fractures: a systematic review of U.S. healthcare costs and resource utilization. Pharmacoeconomics. 30, 147– 170. 5. Hulley, S., Grady, D., Bush, T., Furberg, C., Herrington, D., Riggs, B., & Vittinghoff, E. (1998) Randomized trial of estrogen plus progestin for secondary prevention of coronary heart disease in postmenopausal women. JAMA. 280, 605–613. 6. Rossouw, J.E., Anderson, G.L., Prentice, R.L., LaCroix, A.Z., Kooperberg, C., Stefanick, M.L., Jackson, R.D., Beresford, S.A., Howard, B.V., Johnson, K.C., Kotchen, J.M., & Ockene, J. (2002) Risks and benefits of estrogen plus progestin in healthy postmenopausal women: principal results From the Women’s Health Initiative randomized controlled trial. JAMA. 288, 321–333. 7. Burger, H.G., MacLennan, A.H., Huang, K.E., & CasteloBranco, C. (2012) Evidence-based assessment of the impact of the WHI on women’s health. J of Int Menopause Soc. 15, 281–287. 8. Booth, S.L., Tucker, K.L., Chen, H., Hannan, M.T., Gagnon, D.R., Cupples, L.A., Wilson, P.W., Ordovas, J., Schaefer, E.J., Dawson-Hughes, B., & Kiel, D.P. (2000) Dietary vitamin K intakes are associated with hip fracture but not with bone mineral density in elderly men and women. Am J Clin Nutr. 71, 1201–1208. 9. Booth, S.L., Broe, K.E., Peterson, J.W., Cheng, D.M., DawsonHughes, B., Gundberg, C.M., Cupples, L.A., Wilson, P.W., & Kiel, D.P. (2004) Associations between vitamin K biochemical measures and bone mineral density in men and women. J Clin Endocrinol Metab. 89, 4904–4909. 10. Kanai, T., Takagi, T., Masuhiro, K., Nakamura, M., Iwata, M., & Saji, F. (1997) Serum vitamin K level and bone mineral density in post-menopausal women. Int J Gynaecol Obstet. 56, 25–30. 11. Hodges, S.J., Akesson, K., Vergnaud, P., Obrant, K., & Delmas, P.D. (1993) Circulating levels of vitamins K1 and K2 decreased in elderly women with hip fracture. J Bone Miner Res. 8, 1241–1245. 12. Feskanich, D., Weber, P., Willett, W.C., Rockett, H., Booth, S.L., & Colditz, G.A. (1999) Vitamin K intake and hip fractures in women: a prospective study. Am J Clin Nutr. 69, 74–79. 13. Hauschka, P.V., Lian, J.B., Cole, D.E., & Gundberg, C.M. (1989) Osteocalcin and matrix Gla protein: vitamin K-dependent proteins in bone. Physiol Rev. 69, 990–1047. 14. Delmas, P.D. (1993) Biochemical markers of bone turnover. I: Theoretical considerations and clinical use in osteoporosis. Am J Med. 95, 11S–16S. 15. Suttie, J.W. (1985) Vitamin K-dependent carboxylase. Annu Rev Biochem. 54, 459–477. 16. Gundberg, C.M., Nieman, S.D., Abrams, S., & Rosen, H. (1998) Vitamin K status and bone health: an analysis of methods for determination of undercarboxylated osteocalcin. J Clin Endocrinol Metab. 83, 3258–3266. 17. Szulc, P., Arlot, M., Chapuy, M.C., Duboeuf, F., Meunier, P.J., & Delmas, P.D. (1994) Serum undercarboxylated osteocalcin correlates with hip bone mineral density in elderly women. J Bone Miner Res. 9, 1591–1595. 18. Jie, K.G., Bots, M.L., Vermeer, C., Witteman, J.C., & Grobbee, D.E. (1996) Vitamin K status and bone mass in women with

Ó 2019 Hogrefe

T.K. Giri et al., Maximal dose-response of vitamin-K2 (menaquinone-4)

19.

20.

21.

22.

23.

24.

25.

26.

27.

28.

29.

30.

31.

32.

33.

34.

and without aortic atherosclerosis: a population-based study. Calcif Tissue Int. 59, 352–356. Szulc, P., Chapuy, M.C., Meunier, P.J., & Delmas, P.D. (1993) Serum undercarboxylated osteocalcin is a marker of the risk of hip fracture in elderly women. J Clin Invest. 91, 1769–1774. Szulc, P., Chapuy, M.C., Meunier, P.J., & Delmas, P.D. (1996) Serum undercarboxylated osteocalcin is a marker of the risk of hip fracture: a three year follow-up study. Bone. 18, 487– 488. Kohlmeier, M., Saupe, J., Shearer, M.J., Schaefer, K., & Asmus, G. (1997) Bone health of adult hemodialysis patients is related to vitamin K status. Kidney Int. 51, 1218–1221. Vergnaud, P., Garnero, P., Meunier, P.J., Breart, G., Kamihagi, K., & Delmas, P.D. (1997) Undercarboxylated osteocalcin measured with a specific immunoassay predicts hip fracture in elderly women: the EPIDOS Study. J Clin Endocrinol Metab. 82, 719–724. Binkley, N.C., Krueger, D.C., Kawahara, T.N., Engelke, J.A., Chappell, R.J., & Suttie, J.W. (2002) A high phylloquinone intake is required to achieve maximal osteocalcin gammacarboxylation. Am J Clin Nutr. 76, 1055–1060. Shiraki, M., Shiraki, Y., Aoki, C., & Miura, M. (2000) Vitamin K2 (menatetrenone) effectively prevents fractures and sustains lumbar bone mineral density in osteoporosis. J Bone Miner Res. 15, 515–521. Ozuru, R., Sugimoto, T., Yamaguchi, T., & Chihara, K. (2002) Time-dependent effects of vitamin K2 (menatetrenone) on bone metabolism in postmenopausal women. Endocr J. 49, 363–370. Knapen, M.H., Nieuwenhuijzen Kruseman, A.C., Wouters, R.S., & Vermeer, C. (1998) Correlation of serum osteocalcin fractions with bone mineral density in women during the first 10 years after menopause. Calcif Tissue Int. 63, 375–379. Knapen, M.H., Jie, K.S., Hamulyak, K., & Vermeer, C. (1993) Vitamin K-induced changes in markers for osteoblast activity and urinary calcium loss. Calcif Tissue Int. 53, 81–85. Booth, S.L., Martini, L., Peterson, J.W., Saltzman, E., Dallal, G. E., & Wood, R.J. (2003) Dietary phylloquinone depletion and repletion in older women. J Nutr. 133, 2565–2569. Binkley, N.C., Krueger, D.C., Engelke, J.A., Foley, A.L., & Suttie, J.W. (2000) Vitamin K supplementation reduces serum concentrations of under-gamma-carboxylated osteocalcin in healthy young and elderly adults. Am J Clin Nutr. 72, 1523– 1528. Miki, T., Nakatsuka, K., Naka, H., Kitatani, K., Saito, S., Masaki, H., Tomiyoshi, Y., Morii, H., & Nishizawa, Y. (2003) Vitamin K(2) (menaquinone 4) reduces serum undercarboxylated osteocalcin level as early as 2 weeks in elderly women with established osteoporosis. J Bone Miner Metab. 21, 161– 165. Koitaya, N., Ezaki, J., Nishimuta, M., Yamauchi, J., Hashizume, E., Morishita, K., Miyachi, M., Sasaki, S., & Ishimi, Y. (2009) Effect of low dose vitamin K2 (MK-4) supplementation on bio-indices in postmenopausal Japanese women. J Nutr Sci Vitaminol (Tokyo). 55, 15–21. Douglas, A.S., Robins, S.P., Hutchison, J.D., Porter, R.W., Stewart, A., & Reid, D.M. (1995) Carboxylation of osteocalcin in post-menopausal osteoporotic women following vitamin K and D supplementation. Bone. 17, 15–20. Knapen, M.H., Drummen, N.E., Smit, E., Vermeer, C., & Theuwissen, E. (2013) Three-year low-dose menaquinone-7 supplementation helps decrease bone loss in healthy postmenopausal women. Osteoporos Int. 24, 2499–2507. Sokoll, L.J., Booth, S.L., O’Brien, M.E., Davidson, K.W., Tsaioun, K.I., & Sadowski, J.A. (1997) Changes in serum osteocalcin, plasma phylloquinone, and urinary gamma-

Ó 2019 Hogrefe

carboxyglutamic acid in response to altered intakes of dietary phylloquinone in human subjects. Am J Clin Nutr. 65, 779– 784. 35. Emaus, N., Gjesdal, C.G., Almas, B., Christensen, M., Grimsgaard, A.S., Berntsen, G.K., Salomonsen, L., & Fonnebo, V. (2010) Vitamin K2 supplementation does not influence bone loss in early menopausal women: a randomised double-blind placebo-controlled trial. Osteoporosis International. 21, 1731–1740. 36. Booth, S.L., Dallal, G., Shea, M.K., Gundberg, C., Peterson, J. W., & Dawson-Hughes, B. (2008) Effect of vitamin K supplementation on bone loss in elderly men and women. J Clin Endocrinol Metab. 93, 1217–1223. 37. Cockayne, S., Adamson, J., Lanham-New, S., Shearer, M.J., Gilbody, S., & Torgerson, D.J. (2006) Vitamin K and the prevention of fractures: Systematic review and meta-analysis of randomized controlled trials. Arch Intern Med. 166, 1256– 1261. 38. Braam, L.A., Knapen, M.H., Geusens, P., Brouns, F., Hamulyak, K., Gerichhausen, M.J., & Vermeer, C. (2003) Vitamin K1 supplementation retards bone loss in postmenopausal women between 50 and 60 years of age. Calcif Tissue Int. 73, 21–26. 39. Gundberg, C.M., Lian, J.B., & Booth, S.L. (2012) Vitamin Kdependent carboxylation of osteocalcin: friend or foe? Adv Nutr. 3, 149–157. 40. Tsugawa, N., Shiraki, M., Suhara, Y., Kamao, M., Tanaka, K., & Okano, T. (2006) Vitamin K status of healthy Japanese women: age-related vitamin K requirement for gammacarboxylation of osteocalcin. Am J Clin Nutr. 83, 380–386. 41. Westenfeld, R., Krueger, T., Schlieper, G., Cranenburg, E.C., Magdeleyns, E.J., Heidenreich, S., Holzmann, S., Vermeer, C., Jahnen-Dechent, W., Ketteler, M., Floege, J., & Schurgers, L.J. (2012) Effect of vitamin K2 supplementation on functional vitamin K deficiency in hemodialysis patients: a randomized trial. Am J Kidney Dis. 59, 186–195. 42. Theuwissen, E., Cranenburg, E.C., Knapen, M.H., Magdeleyns, E.J., Teunissen, K.J., Schurgers, L.J., Smit, E., & Vermeer, C. (2012) Low-dose menaquinone-7 supplementation improved extra-hepatic vitamin K status, but had no effect on thrombin generation in healthy subjects. Br J Nutr. 108, 1652–1657. 43. Sato, Y., Honda, Y., Umeno, K., Hayashida, N., Iwamoto, J., Takeda, T., & Matsumoto, H. (2011) The prevention of hip fracture with menatetrenone and risedronate plus calcium supplementation in elderly patients with Alzheimer disease: a randomized controlled trial. Kurume Med J. 57, 117–124. 44. Cheung, A.M., Tile, L., Lee, Y., Tomlinson, G., Hawker, G., Scher, J., Hu, H., Vieth, R., Thompson, L., Jamal, S., & Josse, R. (2008) Vitamin K supplementation in postmenopausal women with osteopenia (ECKO trial): a randomized controlled trial. PLoS Medicine. 5, 1–12. 45. Binkley, N., Harke, J., Krueger, D., Engelke, J., Vallarta-Ast, N., Gemar, D., Checovich, M., Chappell, R., & Suttie, J. (2009) Vitamin K treatment reduces undercarboxylated osteocalcin but does not alter bone turnover, density, or geometry in healthy postmenopausal North American women. J Bone Miner Res. 24, 983–991. 46. Tanaka, S., Miyazaki, T., Uemura, Y., Miyakawa, N., Gorai, I., Nakamura, T., Fukunaga, M., Ohashi, Y., Ohta, H., Mori, S., Hagino, H., Hosoi, T., Sugimoto, T., Itoi, E., Orimo, H., & Shiraki, M. (2017) Comparison of concurrent treatment with vitamin K2 and risedronate compared with treatment with risedronate alone in patients with osteoporosis: Japanese Osteoporosis Intervention Trial-03. J Bone Miner Metab. 35, 385–395. 47. Møller, M., Gjelstad, I.M., Baksaas, I., Grande, T., Aukrust, I. R., & Drevon, C.A. (2016) Bioavailability and Chemical/

Int J Vitam Nutr Res (2020), 90 (1–2), 42–48

48.

49.

50.

51.

52.

53.

54.

55.

56.

57.

58.

59.

T.K. Giri et al., Maximal dose-response of vitamin-K2 (menaquinone-4)

Functional Aspects of Synthetic MK-7 vs FermentationDerived MK-7 in Randomised Controlled Trials. Int J Vitam Nutr Res. 1–15. Molitor, H., & Robinson, H.J. (1940) Oral and Parenteral Toxicity of Vitamin K1, Phthiocol and 2 Methyl 1, 4, Naphthoquinone. Exp Biol Med. 43, 125–128. Anonymous. (2001). Dietary Reference intakes for vitamin A, vitamin K, arsenic boron, chromium, copper, iodine, iron, manganese, molybdenom, nickel, silicon, vanadium, and zinc. Washington, DC: National Academy Press. Sato, Y., Kanoko, T., Satoh, K., & Iwamoto, J. (2005) Menatetrenone and vitamin D2 with calcium supplements prevent nonvertebral fracture in elderly women with Alzheimer’s disease. Bone. 36, 61–68. Inoue, T., Fujita, T., Kishimoto, H., Makino, T., Nakamura, T., Sato, T., & Yamazaki, K. (2009) Randomized controlled study on the prevention of osteoporotic fractures (OF study): a phase IV clinical study of 15-mg menatetrenone capsules. J Bone Mineral Metab. 27, 66–75. Gage, B.F., Birman-Deych, E., Radford, M.J., Nilasena, D.S., & Binder, E.F. (2006) Risk of osteoporotic fracture in elderly patients taking warfarin: Results from the national registry of atrial fibrillation 2. Arch Intern Med. 166, 241–246. National Osteoporosis Foundation.. Calcium and Vitamin D: What You Need to Know. [cited 2013 Sept 15]; Available from: http://www.nof.org/articles/10 Koyama, N., Ohara, K., Yokota, H., Kurome, T., Katayama, M., Hino, F., Kato, I., & Akai, T. (1991) A one step sandwich enzyme immunoassay for gamma-carboxylated osteocalcin using monoclonal antibodies. J Immunol Methods. 139, 17– 23. Buitenhuis, H.C., Soute, B.A., & Vermeer, C. (1990) Comparison of the vitamins K1, K2 and K3 as cofactors for the hepatic vitamin K-dependent carboxylase. Biochim Biophys Acta. 1034, 170–175. Koshihara, Y., Hoshi, K., Ishibashi, H., & Shiraki, M. (1996) Vitamin K2 promotes 1alpha, 25(OH)2 vitamin D3-induced mineralization in human periosteal osteoblasts. Calcif Tissue Int. 59, 466–473. Schurgers, L.J., & Vermeer, C. (2000) Determination of phylloquinone and menaquinones in food. Effect of food matrix on circulating vitamin K concentrations. Haemostasis. 30, 298–307. Martini, L.A., Booth, S.L., Saltzman, E., a Latorre, M., & Wood, R.J. (2006) Dietary phylloquinone depletion and repletion in postmenopausal women: effects on bone and mineral metabolism. Osteoporos Int. 17, 929–935. McCabe, K.M., Booth, S.L., Fu, X., Shobeiri, N., Pang, J.J., Adams, M.A., & Holden, R.M. (2013) Dietary vitamin K and

Int J Vitam Nutr Res (2020), 90 (1–2), 42–48

60.

61.

62.

63.

64.

therapeutic warfarin alter the susceptibility to vascular calcification in experimental chronic kidney disease. Kidney Int. 83, 835–844. Sato, T., Schurgers, L.J., & Uenishi, K. (2012) Comparison of menaquinone-4 and menaquinone-7 bioavailability in healthy women. Nutr J. 11(93), 1–4. Knapen, M.H., Schurgers, L.J., & Vermeer, C. (2007) Vitamin K2 supplementation improves hip bone geometry and bone strength indices in postmenopausal women. Osteoporos Int. 18, 963–972. Ducy, P., Desbois, C., Boyce, B., Pinero, G., Story, B., Dunstan, C., Smith, E., Bonadio, J., Goldstein, S., Gundberg, C., Bradley, A., & Karsenty, G. (1996) Increased bone formation in osteocalcin-deficient mice. Nature. 382, 448–452. Boskey, A.L., Gadaleta, S., Gundberg, C., Doty, S.B., Ducy, P., & Karsenty, G. (1998) Fourier transform infrared microspectroscopic analysis of bones of osteocalcin-deficient mice provides insight into the function of osteocalcin. Bone. 23, 187– 196. Fang, Y., Hu, C., Tao, X., Wan, Y., & Tao, F. (2012) Effect of vitamin K on bone mineral density: a meta-analysis of randomized controlled trials. J Bone Miner Metab. 30, 60–68.

Acknowledgments T.G. conducted OC quantification assay and co-wrote the manuscript. D.N. and O.C. did the design of the experiments, patient recruitment and collection of data. E.D. did the data analysis. B.G. supervised the project, obtained funding, and co-wrote the manuscript. This work was supported by grants from Longer Life Foundation (RGA/ Washington University Partnership) and by the Doris Duke Foundation. Bayer donated the Citracal (Calcium) and Eisai donated the vitamin K2 (MK-4). Conflict of interest The authors declare that there are no conflicts of interest.

Brian F. Gage, MD, MS Professor of Medicine Campus Box 8005 Washington University School of Medicine 4523 Clayton Ave. Saint Louis, MO 63110 bgage@im.wustl.edu

Ó 2019 Hogrefe

Original Communication

Efficacy of Vitamin D on Chronic Heart Failure Among Adults A Meta-analysis of Randomized Controlled Trials Wang Chunbin, Wang Han, and Cai Lin Department of Cardiology, The Second Affiliated Chengdu Clinical College of Chongqing Medical University, Third People’s Hospital of Chengdu, Si Chuan, China Received: February 13, 2017; Accepted: May 22, 2017

Abstract: Vitamin D deficiency commonly occurs in chronic heart failure. Whether additional vitamin D supplementation can be beneficial to adults with chronic heart failure remains unclear. We conducted a meta-analysis to derive a more precise estimation. PubMed, Embase, and Cochrane databases were searched on September 8, 2016. Seven randomized controlled trials that investigated the effects of vitamin D on cardiovascular outcomes in adults with chronic heart failure, and comprised 592 patients, were included in the analysis. Compared to placebo, vitamin D, at doses ranging from 2,000 IU/day to 50,000 IU/week, could not improve left ventricular ejection fraction (Weighted mean difference, WMD = 3.31, 95% confidence interval, CL = 0.93 to 7.55, P < 0.001, I2 = 92.1%); it also exerts no beneficial effects on the 6 minute walk distance (WMD = 18.84, 95% CL = 24.85 to 62.52, P = 0.276, I2 = 22.4%) and natriuretic peptide (Standardized mean difference, SMD = 0.39, 95% confidence interval CL = 0.48 to 0.69, P < 0.001, I2 = 92.4%). However, a dose-response analysis from two studies demonstrated an improved left ventricular ejection fraction with vitamin D at a dose of 4,000 IU/day (WMD = 6.58, 95% confidence interval CL = 4.04 to 9.13, P = 0.134, I2 = 55.4%). The results showed that high dose vitamin D treatment could potentially benefit adults with chronic heart failure, but more randomized controlled trials are required to confirm this result. Keywords: Chronic Heart Failure, vitamin D, meta-analysis, therapy, left ventricular ejection fraction

Introduction As a high-prevalence and complex clinical syndrome with poor prognosis, heart failure (HF) is a major public health problem worldwide, that adds a significant financial burden to the healthcare system [1]. Patients who have heart failure for some time are said to have chronic heart failure (CHF); the prevalence of CHF depends on the definition applied. A patient under treatment, whose symptoms and signs have remained unchanged for at least one month, is said to have ‘stable’ CHF [2]. The condition is present in approximately 1%–2% of the adult population in the western world, particularly among people > 50 years old [3]. Currently accepted therapies for CHF that afford improvements in survival in patients with CHF, also favourably affect left ventricular (LV) remodelling, by delaying or reversing LV dilatation; these therapies include the use of angiotensin-converting enzyme inhibitors, beta-adrenoceptor antagonists, and cardiac resynchronization therapy [4–6]. The degree of favourable remodelling induced by these treatments is associated with long-term outcomes. Ó 2019 Hogrefe

Vitamin D significantly influences the regulation of calcium, phosphorous and bone homeostasis. Vitamin D deficiency often occurs in patients with CHF, particularly the elderly individuals, who are associated with impaired prognosis [7, 8]. There are many mechanisms by which vitamin D insufficiency can lead to heart failure and other cardiovascular diseases: over activity of renin angiotensin aldosterone system, endothelial dysfunction and calcium flux changes leading to reduced cardiac contractility [9]. Numerous cohort studies confirmed that increased plasma concentrations of vitamin D are related to favourable outcomes in patients with CHF [10–12]. Several studies investigated the effect of vitamin D supplementation on heart failure, cardiac functions, and possible pathophysiological pathways; however, incompatible results were obtained. It is postulated that vitamin D supplementation can decrease the progression and severity of heart failure. The mechanisms proposed include down-regulation of the pre-inflammatory substances, inhibition of the renin angiotensin aldosterone system and parathyroid hormone. They lead to reduction of the blood pressure, slowing of the myocardial remodelling,

Int J Vitam Nutr Res (2020), 90 (1–2), 49–58 https://doi.org/10.1024/0300-9831/a000487

W. Chunbin et al., Efficacy of Vit D on Chronic Heart Failure: A Meta-analysis

promotion of the cell growth and improvement of the myocyte contractility in heart failure patients [13]. A metaanalysis including seven studies on this subject was performed. These results indicate that vitamin D did not lead to an improvement in the left ventricular function and reduction the N-terminal pro-B-type natriuretic peptide in spite of significant decrease in tumour necrosis factor-α, C-reactive protein and parathyroid hormone levels[14]. Since the publication of the study, new clinical trials have demonstrated that vitamin D supplementation is associated with significant improvement in cardiac function and reversal of left ventricular remodelling [15]. To provide more evidence that vitamin D benefits cases of CHF, an updated meta-analysis was performed. In addition, we have carried out a dose-response analysis to provide evidence for vitamin D supplementation as an additional medication in adults with CHF.

Materials and Methods This meta-analysis was performed in accordance with the Preferred Reporting Items for Systematic Reviews and Meta-Analyses guidelines [16].

Search Strategy Two researchers independently searched pertinent studies in PubMed, Embase, and Cochrane Library on September 8, 2016. The search strategy used the following keywords: Vitamin D or vitamin D3, vitamin D2 or cholecalciferol or ergocalciferol or alphacalcidol, alfacalcidol or paricalcitol or doxercalciferol and heart failure. We manually searched the references of identified studies, restricted to articles published in English. Research Strategy in PubMed was as follows: (((((((( (“alpha-hydroxyergocalciferol”[SupplementaryConcept] OR”alpha-hydroxyergocalciferol”[All Fields] OR “doxercalciferol”[All Fields]) OR (“paricalcitol”[Supplementary Concept] OR “paricalcitol”[All Fields])) OR “alphacalcidol”[All Fields])) OR (“ergocalciferols”[MeSH Terms] OR “ergocalciferols”[All Fields] OR “ergocalciferol”[All Fields])) OR (“cholecalciferol”[MeSH Terms] OR “cholecalciferol”[All Fields])) OR (“ergocalciferols”[MeSH Terms] OR “ergocalciferols”[All Fields] OR (“vitamin”[All Fields] AND “d2”[All Fields]) OR “vitamin d2”[All Fields])) OR (“cholecalciferol”[MeSH Terms] OR “cholecalciferol”[All Fields] OR (“vitamin”[All Fields] AND “d3”[All Fields]) OR “vitamin d3”[All Fields])) OR (“vitamin d”[MeSH Terms] OR “vitamin d”[All Fields] OR

Int J Vitam Nutr Res (2020), 90 (1–2), 49–58

“ergocalciferols”[MeSH Terms] OR “ergocalciferols”[All Fields])) AND (“heart failure”[MeSH Terms] OR (“heart” [All Fields] AND “failure”[All Fields]) OR “heart failure”[All Fields]) (Language :English, Time:September 8, 2016).

Study Selection Two reviewers independently scanned the titles and abstracts of all retrieved articles and excluded the irrelevant studies. The eligibility of the remaining articles was further assessed with a full-text evaluation by the same two reviewers. Disagreements between the reviewers were settled through a robust discussion. Studies were eligible for inclusion, provided they met the following criteria: (1) randomized controlled studies (RCTs), (2) patients with CHF, (3) Vitamin D supplementation as additional treatment and not combined with calcium or other drugs, (4) patients aged > 18 years, and (5) reporting of one of the outcomes on left ventricular ejection fraction (LVEF), 6 min walk distance (6 MWD), N-terminal pro-B-type natriuretic peptide (NT-proBNP), or B-type natriuretic peptide (BNP); which are factors associated with a poor prognosis in chronic heart failure patients [17].

Data Extraction and Risk of Bias Assessment Relevant data from the included studies were extracted independently by the two reviewers. The third reviewer performed repeated checks, with divergences resolved by discussion. If several articles cited the same study, that with the most complete data was included in our meta-analysis. The risk of bias for the included RCTs was independently evaluated by two reviewers in accordance with the Cochrane risk of bias tool [18]. Disagreements were settled by discussion.

Statistical Analysis All statistical analyses were performed using Stata 12.0 (Stata Corp, College Station, TX, USA) and RevMan 5.3 (Cochrane Collaboration, Oxford, United Kingdom). Pooled effect estimates were presented as weighted mean difference (WMD) with confidence intervals (CI) for measurements of the same parameter or standardized mean difference (SMD) for various measurements in the included studies. Heterogeneity was evaluated using I2 test (with I2 > 50% indicating significant heterogeneity). An inverse variance (IV) fixed-effect model was used to calculate the WMD or SMD with 95% CI, if no significant heterogeneity

Ó 2019 Hogrefe

W. Chunbin et al., Efficacy of Vit D on Chronic Heart Failure: A Meta-analysis

Figure 1. PRISMA Flow diagram of study selection.

was found among the included studies; otherwise, a random effects model was chosen. Sensitivity analysis was used to identify the stability of the statistical results by excluding each study sequentially. P < 0.05 was considered statistically significant.

Results Our systematic literature search identified 1,049 articles and 577 records after removal of duplicates. A total of 319 studies were excluded based on the titles and abstracts. Subsequently, full-text evaluation was performed on the remaining 27 articles. Of this number, 20 were excluded for the following reasons: seven were identified as reviews, two were identified as meta-analyses, one included a nonadult, one was not RCT, and nine did not report our endpoints. Ultimately, seven studies were found eligible for our meta-analysis. The process of our literature search and the reasons for exclusion are provided (Figure 1). Ó 2019 Hogrefe

Study Characteristics The seven RCTs included 592 patients [19–25], as described in Tables I and II. All studies were RCT designs published from 2006 to 2016. These studies reported that the participants received optimal medical therapy based on standard CHF treatment strategies. The mean LVEF baseline of the participants varied from 24% to 45%, and the New York Heart Association (NYHA) class was from II to IV. Vitamin D dosage ranged from 2,000 IU/day to 50,000 IU/week orally, and follow-up periods ranged from 6 weeks to 12 months (Tables I and II). None of these studies reported adverse events. The results of quality assessment by Cochrane risk of bias are summarized in Figures 2 and 3. The overall quality of the seven studies was moderate.

Effectiveness Left Ventricular Ejection Fraction Four studies [19, 21, 22, 25] evaluated the effect of vitamin D on LVEF. The results showed vitamin D could not increase Int J Vitam Nutr Res (2020), 90 (1–2), 49–58

Int J Vitam Nutr Res (2020), 90 (1–2), 49–58

123 (61/62)

105 (53/52)

64 (31/33)

101 (50/51)

64 (31/33)

36 (18/18)

163 (80/83)

Schleithoff et al, 2006

Witham et al, 2010

Boxer et al, 2013

Schroten et al, 2013

Boxer et al, 2014

Dalbeni et al, 2014

Witte et al, 2016

4000 IU/day

50000 IU/week

2000 IU/day

100000 IU at baseline and 10 week 50000 IU/week

2000 IU/day

Dose of Vitamin D

Double

Blinded

12 month

6 month

6 week

6 month

20 week

15 month

Duration

NYHA class II-III symptoms, LVEF 45% on maximally tolerated medical therapy (>3 months) and a 25(OH)vitamin D < 50 nmol/L (<20 ng/mL)

Chronic HF, NYHA class II-IV, Age 70 years, chronic HF, LV systolic dysfunction NYHA class II–III, 25(OH)D < 20 ng/mL Age 50 years, NYHA class II–IV, 25(OH)D < 37.5 ng/mL Age 18 years, chronic HF, LVEF < 45% Age 50 years, NYHA class II–IV, 25(OH)D < 37.5 ng/mL Age > 40 years, chronic HF, LVEF < 55%, NYHA class > II, 25(OH)D < 30 ng/mL

Inclusion criteria

LVEF", echocardiographic parameters, NYHA class, NT-proBNP", PTH, renin, aldosterone LVEF", 6 MWD

Plasma renin activity, NT-proBNP;, fibrosis markers, PTH; LVEF, PTH;, CRP, renin, aldosterone

VO2max6MWD, renin, aldosterone, BNP;, TNF-α Peak VO2, 6 MWD"

LVEF;TNF-α, CRP, IL-10, PTH;,

Major outcomes

65.8/66 65.8/66

80 (42/38) 64 (31/33) 64 (31/33) 36 (18/18) 163(80/83)

Shedeed et al, 2012

Boxer et al, 2013

Boxer et al, 2014

Dalbeni et al, 2014

Witte et al, 2016

57/54

105 (53/52)

67/62

12/10

15/18

27/22

34/35

52/50

Male sex, n

16/17

8/10

33/34

47/40

Ischemic cause, n

25.6/26.5

42.3/44.3

39.2/36.1

36.4/37.2

33/29

31/33

LVEF, %

38.2/36.4

17.2/17.6

19.1/17.8

12.3/14.2

14.4/15.3

25(OH)D, ng/mL

II-III

II–IV

II–III

II-IV

NYHA class grade

Abbreviations: LVEF, left ventricular ejection fraction; NA, not available; NYHA class grade, the cardiac functional class of New York Heart Association. Data are expressed as vitamin D/control.

68.5/69

74.2/74.3

0.86/0.93

78.8/80.6

123 (61/62)

Age, year

Witham et al, 2010

No. of Patients (Vitamin D/Control)

Schleithoff et al, 2006

Study

Table II. Patient Characteristics.

Abbreviations: 6MWD, 6-minute walk distance; BNP, B-type natriuretic peptide; CRP, C-reactive protein; HF, heart failure; LVEF, left ventricular ejection fraction; NT-proBNP, N-terminal pro-B-type natriuretic peptide; NYHA, New York Heart Association; PTH, parathyroid hormone; VO2, oxygen volume; TNF-α,tumor necrosis factor-α; IL-10, interleukin-10.

No. of Patients (Vitamin D/Control)

Study

Table I. Characteristics of seven studies.

52 W. Chunbin et al., Efficacy of Vit D on Chronic Heart Failure: A Meta-analysis

Ó 2019 Hogrefe

W. Chunbin et al., Efficacy of Vit D on Chronic Heart Failure: A Meta-analysis

Figure 2. Risk of bias graph.

source of heterogeneity. Therefore, dose-response analysis was performed. Vitamin D, at a dosage of 4000 IU/day, was found to improve the level of LVEF in two studies (WMD = 6.58, 95% confidence interval, CI = 4.04 to 9.13, P = 0.134, I2 = 55.4%) (Figure 5). 6 Minute Walk Distance Three studies [19, 24, 25] evaluated the effect of vitamin D on 6 MWD. 6 MWD was not influenced by vitamin D, compared with the control group (WMD = 18.84, 95% confidence interval, CI = 24.85 to 62.52) without heterogeneity between trials (P = 0.245, I2 = 22.8%) (Figure 6). N-terminal pro-B-type natriuretic peptide or B-type natriuretic peptide Three studies [20, 21, 24] evaluated the difference in BNP or NT-pro BNP between the vitamin D group and the control group. No significant difference was demonstrated between these two groups (SMD = 0.39, 95% confidence interval, CI = 0.48 to 0.69, P < 0.001, I2 = 92.4%) (Figure 7).

Figure 3. Risk of bias summary.

LVEF levels (WMD = 3.31, 95% confidence interval, CI = 0.93 to 7.55) with significant heterogeneity between trials (P < 0.001, I2 = 92.1%) (Figure 4). The number of studies was less than 10, so we could not perform a meta-regression analysis to explore the potential Ó 2019 Hogrefe

Parathyroid Hormone Three studies [19–21] were conducted on the effect of vitamin D on PTH. The PTH level was found to be significantly lower in the vitamin D group than in the placebo group (WMD = 15.28, 95% confidence interval, CI = 19.43 to 11.12, P = 0.397, I2 = 0%) (Figure 8). We conducted a sensitivity analysis for random-effects models to evaluate the effect of each study on the pooled estimate. The results indicated that removing any individual study could not significantly reduce the heterogeneity. While, the studies were less than five in analysis of vitamin D on LVEF and other outcomes, we did not put up funnel plots to analyse the publication bias among the included studies. Int J Vitam Nutr Res (2020), 90 (1–2), 49–58

W. Chunbin et al., Efficacy of Vit D on Chronic Heart Failure: A Meta-analysis

Figure 4. Forest plot depicting the effect of vitamin D on left ventricular ejection fraction (LVEF) versus placebo, WMD, weight mean difference; CI, confidence interval.

Discussion We performed the meta-analysis to provide additional evidence on the benefit of vitamin D for HF. The results showed that vitamin D could decrease the PTH level and exerted no effects on LVEF, 6 MWD and NT-pro BNP or BNP. However, in dose-response analysis, vitamin D at a dosage of 4000 IU/day was found to improve the LVEF in patients with CHF. Patients, particularly the elderly individuals, are frequently deficient in vitamin D. Vitamin D deficiency could result in increased cardio-vascular mortality [26]. Despite many studies exploring various doses and forms of vitamin D treatment in patients with CHF, the benefits of this therapy remain uncertain. The pooled results of the previous meta-analysis indicated that, additional supplementation of vitamin D failed to exert beneficial effect in left ventricular ejection fraction as well as in terms of the NT-proBNP and 6 MWD [14]. Meanwhile, vitamin D supplementation may reduce the serum levels of PTH and inflammatory mediators. This meta-analysis had two limitations [14]. Firstly, the study by Shedeed [27] aimed to evaluate the effect of vitamin D supplementation on CHF in infants, which might cause an age-related risk of bias. Secondly, the meta-analysis did not include a new study: the Vitamin Int J Vitam Nutr Res (2020), 90 (1–2), 49–58

D treating patients with CHF (VINDICATE) study [25]. The VINDICATE study is a double-blind, placebo-controlled study of an oral, non-calcium based daily supplement of 4000 IU of vitamin D3 given for 12 months in patients with CHF because of left ventricular end-systolic diameter (LVSD), on otherwise optimal medical therapy. The supplement unveiled the consistent biochemical evidence of replenishment and an effective suppression of PTH levels. Although our meta-analysis is inconsistent with the latest research, vitamin D, at a dosage of 4000 IU/day, could improve the LVEF, which means high dose vitamin D might benefit adults with CHF. However, in the study of Boxer [20], it was found that,Vitamin D3, at a dosage of 50,000 IU/day, did not improve physical performance and LVEF, despite a robust increase in serum 25-OHD. The author has concluded that the dose given was too high when compared to these other trials, and smaller, more frequent dosing vitamin D with calcium might be more beneficial for CHF patients [20]. CHF characterized by left ventricular (LV) systolic dysfunction, the maladaptive changes that occur in surviving myocytes and the extracellular matrix after myocardial injury lead to pathological “remodelling” of the ventricle with dilatation and impaired contractility; such remodelling is mirrored by a reduction in the LVEF [28]. The potential Ó 2019 Hogrefe

W. Chunbin et al., Efficacy of Vit D on Chronic Heart Failure: A Meta-analysis

Figure 5. Forest plot depicting the dose-response effect of vitamin D on left ventricular ejection fraction (LVEF) versus placebo, WMD, weight mean difference; CI, confidence interval.

Figure 6. Forest plot depicting the effect of vitamin D on 6 min walk distance (6MWD) versus placebo, WMD, weight mean difference; CI, confidence interval. Ó 2019 Hogrefe

Int J Vitam Nutr Res (2020), 90 (1–2), 49–58

W. Chunbin et al., Efficacy of Vit D on Chronic Heart Failure: A Meta-analysis

Figure 7. Forest plot depicting the effect of vitamin D on N-terminal pro-B-type natriuretic peptide (NT-proBNP) or B-type natriuretic peptide (BNP) versus placebo, SMD, standard mean difference; CI, confidence interval.

Figure 8. Forest plot depicting the effect of vitamin D on parathyroid hormone (PTH) versus placebo, WMD, weight mean difference; CI, confidence interval.

mechanisms that could explain a direct protective effect of vitamin D in CHF include: effect on the myocardial contractile function, regulation of natriuretic hormone secretion, Int J Vitam Nutr Res (2020), 90 (1–2), 49–58

regulation of the renin system, regulation of the effects on blood pressure (BP), ameliorated ischemia reperfusioninduced myocardial injury [29], reduced LV hypertrophy, Ó 2019 Hogrefe

W. Chunbin et al., Efficacy of Vit D on Chronic Heart Failure: A Meta-analysis

and regulation of inflammatory cytokines [30]. Vitamin D can also indirectly affect cardiac function by altering the levels of PTH and serum calcium [31]. Several studies suggested that the circulating concentration of PTH correlated with the severity of CHF and that it could serve as a useful biomarker of the disease [32]. The results of our meta-analysis revealed that high-dose vitamin D therapy was associated with an improvement in LVEF and a decrease in the serum levels of PTH, while vitamin D exerted no effect on 6 MWD as well as natriuretic peptide. However, a non-randomized clinical trial [13] showed that vitamin D supplementation led to a reduction in serum NTpro-BNP levels and a significant increase in 6 MWD. The possible difference between the outcomes of this study and those of RCTs might be attributed to the age of the patients included; the studies that recruited only older patients and patients with muscular disorders had negative results. Overall, vitamin D might potentially benefit the LV structure and function in adults undergoing contemporary optimal medical therapy, but the evidence is inconclusive. Several limiting factors inherent to our meta-analysis have been identified. Firstly, the number of clinical trials was limited, and the sample was small. Secondly, different durations for medications at baseline and average doses of vitamin D in each study could lead to a confounding bias and influence the effect. Thirdly, significant heterogeneity in LVEF analysis could affect the interpretation of the true effect of the intervention. There were few studies to perform a dose-response analysis [21, 25]. Fourthly, the prognostic outcomes and long-term adverse events remained undetermined. Our meta-analysis demonstrates that vitamin D supplementation decreases the serum levels of PTH, but exhibits no beneficial effect on LVEF, 6 MWD and natriuretic peptide; but high dose vitamin D could potentially improve LVEF.

References 1. Heidenreich, P.A., Albert, N.M., Allen, L.A., et al. (2013) Forecasting the impact of heart failure in the United States: a policy statement from the American Heart Association. Circ Heart Fail. 6, 606–619. 2. Ponikowski, P., Voors, A.A., Anker, S.D., et al. (2016) 2016 ESC Guidelines for the diagnosis and treatment of acute and chronic heart failure: The Task Force for the diagnosis and treatment of acute and chronic heart failure of the European Society of Cardiology (ESC). Developed with the special contribution of the Heart Failure Association (HFA) of the ESC. Eur J Heart Fail. 18, 891–975. 3. Mosterd, A., & Hoes, A.W. (2007) Clinical epidemiology of heart failure. Heart. 93, 1137–1146. 4. Van de Ven, L.L., van Veldhuisen, D.J., Goulder, M., et al. (2010) The effect of treatment with bisoprolol-first versus enalapril-first on cardiac structure and function in heart failure. Int J Cardiol. 144, 59–63.

Ó 2019 Hogrefe

5. Foley, P.W., Chalil, S., Khadjooi, K., et al. (2011) Left ventricular reverse remodelling, long-term clinical outcome, and mode of death after cardiac resynchronization therapy. Eur J Heart Fail. 13, 43–51. 6. Cohn, J.N., Ferrari, R., & Sharpe, N. (2000) Cardiac remodeling–concepts and clinical implications: a consensus paper from an international forum on cardiac remodeling. J Am Coll Cardiol. 35, 569–582. 7. Liu, L., Chen, M., Hankins, S.R., et al. (2012) Serum 25-hydroxyvitamin D concentration and mortality from heart failure and cardiovascular disease, and premature mortality from all-cause in United States adults. Am J Cardiol. 110, 834–839. 8. Gotsman, I., Shauer, A., Zwas, D.R., et al. (2012) Vitamin D deficiency is a predictor of reduced survival in patients with heart failure; vitamin D supplementation improves outcome. Eur J Heart Fail. 14, 357–366. 9. Artaza, J.N., Mehrotra, R., & Norris, K.C. (2009) Vitamin D and the cardiovascular system. Clin J Am Soc Nephro. 4, 1515–1522. 10. Welles, C.C., Whooley, M.A., Karumanchi, S.A., et al. (2014) Vitamin D deficiency and cardiovascular events in patients with coronary heart disease: data from the Heart and Soul Study. Am J Epidemiol. 179, 1279–1287. 11. Melamed, M.L., Michos, E.D., Post, W., et al. (2008) 25-hydroxyvitamin D levels and the risk of mortality in the general population. Arch Intern Med. 168, 1629–1637. 12. Belen, E., Sungur, A., & Sungur, M.A. (2016) Vitamin D levels predict hospitalization and mortality in patients with heart failure. Scand Cardiovasc J. 50, 17–22. 13. Majeed Babar, M.Z., Haider, S.S., & Mustafa, G. (2016) Effects of vitamin D supplementation on physical activity of patients with Heart Failure. Pak J Med Sci. 32, 1430–1433. 14. Jiang, W.L., Gu, H.B., Zhang, Y.F., et al. (2015) Vitamin D supplementation in the treatment of chronic heart failure: a meta-analysis of randomized controlled trials. Clin Cardiol. 39, 56–61. 15. Witte, K.K., Byrom, R., Gierula, J., et al. (2016) Effects of vitamin D on cardiac function in patients with chronic HF: The VINDICATE Study. J Am Coll Cardiol. 67, 2593–2603. 16. Moher, D., Liberati, A., Tetzlaff, J., et al. (2009) Preferred reporting items for systematic reviews and meta-analyses: the PRISMA statement. J Clin Epidemiol. 62, 1006–1012. 17. Price, J.F., Thomas, A.K., Grenier, M., et al. (2006) B-type natriuretic peptide predicts adverse cardiovascular events in pediatric outpatients with chronic left ventricular systolic dysfunction. Circulation. 114, 1063–1069. 18. Higgins, J.P., Altman, D.G., Gotzsche, P.C., et al. (2011) The Cochrane Collaboration’s tool for assessing risk of bias in randomised trials. BMJ. 343, d5928. 19. Boxer, R.S., Hoit, B.D., Schmotzer, B.J., et al. (2014) The effect of vitamin D on aldosterone and health status in patients with heart failure. J Card Fail. 20, 334–342. 20. Boxer, R.S., Kenny, A.M., Schmotzer, B.J., et al. (2013) A randomized controlled trial of high dose vitamin D3 in patients with heart failure. JACC Heart Fail. 1, 84–90. 21. Dalbeni, A., Scaturro, G., Degan, M., et al. (2014) Effects of six months of vitamin D supplementation in patients with heart failure: a randomized double-blind controlled trial. Nutr Metab Cardiovasc Dis. 24, 861–868. 22. Schleithoff, S.S., Zittermann, A., Tenderich, G., et al. (2006) Vitamin D supplementation improves cytokine profiles in patients with congestive heart failure: a double-blind, randomized, placebo-controlled trial. Am J Clin Nutr. 83, 754. 23. Schroten, N.F., Ruifrok, W.P., Kleijn, L., et al. (2013) Short-term vitamin D3 supplementation lowers plasma renin activity in

Int J Vitam Nutr Res (2020), 90 (1–2), 49–58

24.

25.

26.

27.

28.

29.

30.

W. Chunbin et al., Efficacy of Vit D on Chronic Heart Failure: A Meta-analysis

patients with stable chronic heart failure: an open-label, blinded end point, randomized prospective trial (VitD-CHF trial). Am Heart J. 166, 357–364-e352. Witham, M.D., Crighton, L.J., Gillespie, N.D., et al. (2010) The effects of vitamin D supplementation on physical function and quality of life in older patients with heart failure: a randomized controlled trial. Circ Heart Fail. 3, 195–201. Witte, K.K., Byrom, R., Gierula, J., et al. (2016) Effects of vitamin D on cardiac function in patients with chronic HF: the VINDICATE study. J Am Coll Cardiol. 67, 2593–2603. Strohle, A., & Bohn, T. (2016) Vitamin D status and mortality: meta-analysis of individual participant data confirms strong association. Int J Vitam Nutr Res. 10, 1–4. Shedeed, S.A. (2012) Vitamin D supplementation in infants with chronic congestive heart failure. Pediatr Cardiol. 33, 713–719. Shah, A.M., & Mann, D.L. (2011) In search of new therapeutic targets and strategies for heart failure: recent advances in basic science. Lancet. 378, 704–712. Safari, F., Zarei, F., Shekarforoush, S., et al. (2015) Combined 1, 25-Dihydroxy-vitamin D and resveratrol: a novel therapeutic approach to ameliorate ischemia reperfusion-induced myocardial injury. Int J Vitam Nutr Res. 85, 174–184. Perez-Hernandez, N., Aptilon-Duque, G., Nostroza-Hernandez, M.C., et al. (2016) Vitamin D and its effects on cardiovascular

Int J Vitam Nutr Res (2020), 90 (1–2), 49–58

diseases: a comprehensive review. Korean J Intern Med. 31, 1018–1029. 31. Zia, A.A., Komolafe, B.O., Moten, M., et al. (2011) Supplemental vitamin D and calcium in the management of African Americans with heart failure having hypovitaminosis D. Am J Med Sci. 341, 113. 32. Altay, H., & Colkesen, Y. (2013) Parathyroid hormone and heart failure: novel biomarker strategy. Endocr Metab Immune Disord Drug Targets. 13, 100. Conflicts of interest The authors declare there are no competing interests. Dr. Cai Lin Department of Cardiology The Second Affiliated Chengdu Clinical College of Chongqing Medical University Third People’s Hospital of Chengdu Chongqing 400010 China cd3yycailin@163.com

Ó 2019 Hogrefe

Original Communication

Strong association between serum Vitamin D and Vaspin Levels, AIP, VAI and liver enzymes in NAFLD patients Azimeh Izadi1,2, Fereshteh Aliasghari1,2, Bahram Pourghassem Gargari1, and Sara Ebrahimi3 1

Department of Biochemistry and Diet Therapy, Nutrition Research Center, Faculty of Nutrition and Food Science, Tabriz University of Medical Sciences, Tabriz, Iran

Student Research Committee, Tabriz University of Medical Sciences, Tabriz, Iran

Master of Nutrition, Jahrom University of Medical Sciences, Motahari hospital, Jahrom, Iran Abstract: Some studies indicated poor vitamin D level in NAFLD which is independently correlated with severity of steatosis. Low 25(OH) D3 levels are associated with an impaired lipid profile. Impaired levels and function of vaspin and omentin, which are adipokines, have been demonstrated in NAFLD patients. This study determined the relationship between vitamin D and serum liver enzymes, ultrasound findings, some adipokines, atherogenic index of plasma (AIP) and visceral adiposity index (VAI) in patients with NAFLD in a cross-sectional study. This study was a cross-sectional study in eighty-three NAFLD patients (57 males and 26 females). Plasma levels of omentin-1e-1, vaspin were measured. Anthropometric indices metabolic status was assessed. Visceral adiposity index and atherogenic index of plasma were calculated according to suggested formula. Anthropometric indices, lipid profiles, liver enzymes as well as abdominal ultrasonography and the status of vitamin D were assessed. The results showed that aspartate aminotransferase (AST) (44.22 ± 8.5 IU/L vs. 40.19 ± 8.75 IU/L, p-value = 0.039) AIP (0.767 ± 0.142 vs. 0.6417 ± 0.139, p < 0.001) and VAI (9.28 ± 3.25 vs. 7.048 ± 2.415, p = 0.001) were significantly higher in patients with vitamin D deficiency compared to those with vitamin D sufficiency. The positive correlations between Vaspin levels and vitamin D were found to be remarkably significant in both males and females (r = 0.437; P = 0.004; P < 0.001, r = 0.709, respectively. In both males and females serum vitamin D concentrations were negatively associated with AIP. Partial correlations controlling for age and sex showed that vitamin D is significantly and inversely associated with AIP, VAI, AST, and ALT. Additionally, vitamin D levels correlated directly with vaspin. Keywords: Vitamin D, NAFLD, Adipokines, Lipid profiles

Introduction Beside of the classical role of vitamin D in Calcium homeostasis, vitamin D has a wide variety of physiological functions [1]. Involvement of Vitamin D deficiency in many disease processes including autoimmune disease, infectious disease, cardiovascular disease and common cancers, inflammatory processes and liver diseases has been reported [1, 2]. In addition, poor vitamin D status is associated with total mortality [3]. In recent years some studies indicated poor vitamin d level in NAFLD which is independently correlated with severity of steatosis [2, 4]. In 2016, a meta-analysis indicated that vitamin D deficiencies in NAFLD patients were 26% more than in healthy people [5]. Although the mechanism in which vitamin d deficiency correlated with the pathogenesis of NAFLD is not clear, it Ó 2019 Hogrefe

has been suggested that vitamin d may exert protective anti-inflammatory, anti-fibrotic and metabolic effects of vitamin D on hepatic cells [6]. Recent researches implied that adequate serum 25(OH) D levels could improve adipocyte activity and fat oxidation with the potential effects on enhancing insulin sensitivity [5]. Significant association between lower 25(OH) D and elevated ALT levels, a marker of NAFLD, was also observed indicating the greater levels of hepatic fat [7]. Liangpunsakul et al. reported a significant inverse association between the levels of vitamin D in serum and increased ALT level and this association was independent of adiposity [8]. In a general population study, individuals with lower vitamin D levels had a higher risk of having increased levels of ALT, AST, or GGT, liver enzymes, Although the association was not statistically significant. In Skaaby et al. study, liver disease incidence was Int J Vitam Nutr Res (2020), 90 (1–2), 59–66 https://doi.org/10.1024/0300-9831/a000443

A. Izadi et al., Vitamin D, adipokines, AIP, VAI and liver enzymes in NAFLD

higher in poor vitamin D status [9]. According to some evidence, adipokines expression and secretion in adipocytes may be directly influenced by vitamin D3 [1]. Based on abundant evidence Adipokines derived from visceral adipose tissue (VAT) may play a crucial role in the pathogenesis of NAFLD as a part of IR syndrome [10–12]. Vitamin D may affect positively or negatively the adipokines release from the adipose tissue and this effect may be mediated through the vitamin D receptors in adipose tissue [13]. Impaired levels and function of vaspin and omentin, which are adipokines, have been demonstrated in NAFLD patients [14–16]. Very few studies have been conducted to evaluate vitamin D relation to vaspin and omentin. Zorlu and et al. identified a significant correlation between serum vitamin D levels with vaspin and omentin; however this correlation was negative for omentin and further studies in this regard are recommended [13]. Recently vitamin D deficiency has been suggested as potentially playing a role in the NAFLD [17]. It is reported that in patients with histologically confirmed NAFLD, circulating omentin levels are increased [18]. Additionally, serum vaspin concentration is increased in patients with NAFLD. In these patients serum vaspin, concentration is in a positive association with hepatocyte ballooning degeneration and aminotransferase levels [18, 19]. Hypovitaminosis D could also promote liver disease by dysregulating the metabolism of a number of important adipokines (i.e., adiponectin, leptin, IL-1β) and other inflammatory pathways [20]. However, we could not reach a study in the literature evaluating the relation between vitamin D, and the adipokines vaspin and omentin in NAFLD patients. Our hypothesis was that vitamin D levels in patients with NAFLD might have an association with these two mentioned adipokines. Low 25(OH)D3 levels are associated with an impaired lipid profile [21]. Recently, results from 108,711 participants of an observational study indicated higher triglycerides, total cholesterol and LDL cholesterol and lower HDL in lower 25(OH)D3 levels [22]. In this regard, some interventional studies indicated that supplementation in a subject with inadequate vitamin D status could significantly improve lipid profile [23, 24]. In NAFLD, a lipid disorder is characterized by atherogenic dyslipidemia, postprandial lipemia and HDL dysfunction which are key risk factors for cardiovascular events (CVD) [24, 25]. In 2016, A Meta-Analysis indicates NAFLD as a risk factor for cardiovascular disease [26]. The importance of this association is underlined by demonstrating of the cardiovascular disease as a major cause of mortality in individuals with NAFLD in observational studies [27]. It has been shown an atherogenic index of plasma (AIP), the ratio of TGs to HDL-C, was a strong predictor of cardiovascular disease [28]. Considering the high cardiovascular Int J Vitam Nutr Res (2020), 90 (1–2), 59–66

event rate in NAFLD patients, it is worth recognizing the NAFLD patients with higher risk of cardiovascular disease. Therefore, the aim of present study was to determine the relationship between vitamin D and serum liver enzymes, ultrasound findings, some adipokines, atherogenic index of plasma (AIP) and visceral adiposity index (VAI) in patients with NAFLD in a cross-sectional study.

Materials and Methods Study Setting and Design and Subjects This cross-sectional study surveyed the association of the serum concentration of liver enzymes and lipid profiles with the serum concentration of adipokines including Omentin and Vaspin and vitamin D status. 83 patients from Jahrom University of medical science in Iran participated in this study. Age group between 20 and 50 years with the history of NAFLD regarded as Inclusion criteria. Exclusion criteria included chronic diseases including kidney diseases, diabetes, and malignancy, smoking, menopause and pregnancy and lactation. The aim of the study was explained and the written consent was obtained from all patients. Furthermore, the ethical committee of Jahrom University of Medical Sciences approved this study.

Anthropometric measurements Weight and height were measured by seca scale (Hamburg Germany) and a stadiometer attached to the scale respectively. Body mass index (BMI) was calculated from measurement height in meters and weight in kilograms. Waist circumference measurements made at the approximate midpoint between the lower margin of the last palpable rib and the top of the iliac crest. Hip circumference measurements have been taken around the widest portion of the buttocks and waist -to-hip ratio (WHR) was determined. Each patient recorded the international physical activity questionnaire-short form (IPAQ-S) to control the confounding effects of physical activity. The visceral adiposity index (VAI) was calculated as this following gender- specific equations: Males : VAI ¼

WC TG 1:31 39:68 þ ð1:88 BMI Þ 1:03 HDL

Females : VAI

WC TG 1:52 36:58 þ ð1:88 BMIÞ 0:81 HDL

Ó 2019 Hogrefe

A. Izadi et al., Vitamin D, adipokines, AIP, VAI and liver enzymes in NAFLD

VAI: visceral adiposity index; WC: waist circumference; BMI: body mass index; TG: triglyceride; HDL: highdensity lipoprotein. To control the confounding effects of physical activity, International physical activity questionnaire-short form (IPAQ-S) was recorded for each patient.

Sample collection and laboratory assessment Approximately 10 ml of venous blood samples were taken from all patients after a 12-h overnight fasting to evaluate serum concentration of adipokines and lipid profiles, liver enzymes and vitamin D status. All the samples centrifuged at 4 °C for 10 min at 2500 r.p.m between 1100-1300 g-force to separate serum and plasma and were frozen at 80 °C. Serum Alanine aminotransferase (ALT) and Aspartate aminotransferase (AST) concentrations were measured using photometric assay (Pars Azmoun, Tehran, Iran). The serum Vaspin and Omentin-1, were analyzed using an enzyme-linked immunosorbent assay (ELISA) [BioVendor Research and Diagnostic Products, Inc., Modrice, Czech Republic]. Serum 25(OH) D3 levels were assayed using radioimmunoassay (Immunodiagnostic Systems, Boldon, UK). Vitamin D status was defined on the basis of serum concentrations of 25(OH) D3 based on Institute of Medicine’s (IOM) report. The IOM report defined the different nutritional categories [21] as follows: (a) vitamin D deficiency is defined as a 25-OH-D level lower than 20 ng/mL; (b) vitamin D sufficiency is defined as a 25-OH-D level between 20 and 50 ng/mL; and (c) vitamin D toxicity is defined as a 25-OH-D level higher than 50 ng/mL [25]. Total cholesterol, HDL cholesterol (high-density lipoprotein-cholesterol) and triglyceride levels were analyzed by enzymatic procedures with kits from Pars Azmoun, Tehran, Iran. If triglyceride concentration was < 400 mg/dl, LDL cholesterol levels were calculated by the Friedewald equation. HDL and TG levels reported in molar concentration and atherogenic index of plasma (AIP) was calculated as log (TG/HDL). All the abdominal ultrasonography was taken through an East Medical sonographic scanner equipped with a convex 3.5 MHz browser by a radiology specialist. Histopathological grading of NAFLD was scored according to the NAFLD activity score (NAS) based on Brunt et al. [26]. A threshold of 5% of hepatocytes showing steatosis was required for the diagnosis of NAFLD [26]. This scoring system is the unweighted sum of steatosis, lobular inflammation, and hepatocellular ballooning scores. Additionally, NAS has reasonable inter-rater reproducibility that is useful for studies of both adults and children with any degree of NAFLD. Ó 2019 Hogrefe

Statistical analysis SPSS version 16 statistical software (SPSS Inc, Chicago, Ill) was used to perform the statistical analysis of the data. Distribution of data related to normality was assessed by Kolmogorov–Smirnov test. The continuous variables were expressed as the mean ± standard deviation. The homogeneity of variances was determined using the Levene test. Partial correlation analysis was performed to assess the correlation of vitamin D concentration with the other variables. The values of liver enzyme, AIP, and VAI in vitamin D deficient and vitamin D sufficient patients were compared by using independent sample T-test. A p-value < 0.05 was considered statistically significant.

Results Patient characteristics Characteristics of the study patients are presented in table 1. Our study included NAFLD patients with serious n = 9 (%10.8) and moderate n = 25 (%30.1) and patients with grade 1 severity of disease n = 49 (%59.1). A total of 83 patients (42 men and 41 women) were evaluated. The mean age of the participants was 37 years (range 20–53 years). The mean weight and BMI of the subjects were 83.07 ± 12.82 kg and 29.41 ± 12.83, respectively (Table 1). Cases were grouped with regard to vitamin D levels, 37 (44.6%) patients showed vitamin D deficiency whereas 46 patients (55.4%) normal vitamin D levels. The mean serum 25 (OH) D3 level was 22.01 ± 8.38 nmol/L. The biochemical measures of participants and the values of adipokines are displayed in table 2. The means of VAI and AIP were 8.04 ± 3.01, and 0.697 ± 0.153, respectively (Table 2). The values of adipokines according to sex are shown in Table 3. In male patients, the mean VAI value was 7.52 ± 2.93; whereas the mean VAI value of female patients was 8.58 ± 3.05 (Table 3). Partial correlations controlling for age and sex showed that vitamin D is significantly and inversely associated with AIP, VAI, AST, and ALT (Table 4). Additionally, vitamin D levels correlated directly with vaspin.

The correlation between vitamin D levels and AIP, VAI, and adipokines The correlations between vitamin D levels and VAI were statistically significant for overall subjects (table 4). As it is obvious in table 4 the positive correlations between Int J Vitam Nutr Res (2020), 90 (1–2), 59–66

A. Izadi et al., Vitamin D, adipokines, AIP, VAI and liver enzymes in NAFLD

Table 1. Demographic, anthropometric, and nutritional characteristics in NAFLD patients. Characteristics

Patients (n = 83)

Gender*

Table 2. Value of biochemical parameters in NAFLD patients. Variables

Patients (n = 83)

Triglyceride (mg/dL)

195.3 ± 55.52

Total cholesterol (mg/dL)

209.52 ± 36.19

Male

42 (50.6%)

HDL-cholesterol (mg/dL)

38.75 ± 8.63

Female

41 (49.4%)

LDL-cholesterol (mg/dL)

149.31 ± 27.86

Physical activity*

VAI

8.04 ± 3.01

Light (%)

35 (42.2%)

AIP

0.697 ± 0.153

Moderate (%)

35 (42.2%)

Omentin (ng/mL)

Severe (%)

13 (15.7%)

Vaspin (ng/mL)

6.83 ± 2.37

Grade of fatty liver (%)

274.74 ± 106.28

Vitamin D (ng/ml)

22.01 ± 8.38

Grade I

49 (59.0%)

AST (IU/L)

41.99 ± 8.84

Grade I

25 (30.1%)

ALT (IU/L)

40.85 ± 8.76

Grade III

9 (10.8%)

Vitamin D status** Deficiency Sufficiency

37 (44.6%) 46 (55.4%)

Age (years)

36.71 ± 7.21

Weight (Kg)

83.07 ± 12.83

BMI (kg/m )

29.41 ± 4.18

WC(cm)

99.07 ± 10.43

WHR

0.94 ± 0.08

Mean ± standard deviation is reported for age, weight, BMI, WC and WHR. BMI: body mass index, WC: waist circumference, WHR: waist to hip ratio. *Chi-square test. **Vitamin D status: a 25-OH-D level lower than 20 ng/mL is considered deficiency; vitamin D sufficiency is defined as a 25-OH-D level between 20 and 50 ng/mL; and (c) vitamin D toxicity is defined as a 25-OH-D level higher than 50 ng/mL.

vaspin levels and vitamin D were found to be remarkably significant (P < 0.001, r = 0.584). To investigate whether the AIP levels, VAI, and liver enzymes differs by vitamin D status, we categorized the participants into two subgroups of vitamin D deficiency and vitamin D sufficiency. The results showed that AST, AIP, and VAI were significantly higher in patients with vitamin D deficiency compared to those with vitamin D sufficiency (Table 5).

Discussion Results of this recent cross-sectional study revealed an inverse relationship between serum vitamin D levels and NAFLD, which was also found in previous studies [27, 28] including Rhee’s study [29]. Study of Targher et al. [30, 31] for the first time demonstrated that low serum levels of 25(OH)D were independently associated with severity of hepatic injuries such as steatosis, necrosis, and fibrosis in NAFLD patients. Sharifi et al. [32] investigated the effect of vitamin D supplementation on serum aminotransferases, insulin resistance, oxidative stress, and inflammatory biomarkers in NAFLD patients. The authors suggested that Int J Vitam Nutr Res (2020), 90 (1–2), 59–66

Mean ± standard deviation is reported. VAI: Visceral Adiposity Index; AIP: Atherogenic Index of Plasma; AST: Aspartate aminotransferase; ALT: Alanine aminotransferase.

Table 3. The values of adipokines and VAI with regard to sex.

VAI Omentin (ng/mL) Vaspin (ng/mL)

Male

Female

7.52 ± 2.93

8.58 ± 3.05

246.73 ± 112.48

303.44 ± 92.29

6.31 ± 2.37

7.36 ± 2.29

Mean ± standard deviation is reported. VAI: Visceral Adiposity Index.

vitamin D might be considered as an adjunctive therapy to attenuate systemic inflammation and lipid peroxidation alongside other treatments for NAFLD patients. There is evidence of a significant association between serum levels of 25(OH)D3 and hepatic enzymes [8, 29]. In a recent population study (n = 2,649) [9] after adjusting for confounding variables, the higher levels of hepatic enzymes were observed for lower levels of vitamin D, although not statistically significant. Ultrasound diagnosis method revealed a negative correlation between the degree of steatosis and vitamin D levels. Similarly, in most human studies [27, 29, 30, 33, 34], an independent association was found between vitamin D deficiency and NAFLD histopathological features. Targher et al. proposed some mechanisms for connecting vitamin D deficiency to NAFLD in a review article [35]. The active form of vitamin D3, 1α,25-dihydroxyvitamin D3 modulates the insulin signaling pathway/insulin resistance, suppresses fibroblast proliferation and collagen production, exerts anticoagulant and profibrinolytic effects, and modulates macrophage activity and inflammatory cytokine generation [35]. Overall, it is suggested that treatment of vitamin D3 deficiency to prevent and/or treat NAFLD is a promising adjunctive therapy for NAFLD patients. In our study, we found that 25(OH) D was inversely associated with VAI. This is consistent with previous cross-sectional studies which reported an inverse association between serum vitamin D and adiposity, measured by Ó 2019 Hogrefe

A. Izadi et al., Vitamin D, adipokines, AIP, VAI and liver enzymes in NAFLD

Table 4. Evaluation of correlations between serum vitamin D levels, and VAI and biochemical parameters in the subjects. Omentin

Vaspin

AIP

VAI

AST

ALT

Severity of fatty liver

0.06

0.58

.34

0.38

0.35

0.27

0.17

0.56

< 0.001

.002

0.001

0.002

0.01

0.13

Vitamin D r p-value

Partial correlations controlling for age & gender. AIP: Atherogenic Index of Plasma; VAI: Visceral Adiposity Index; AST: Aspartate aminotransferase; ALT: Alanine aminotransferase.

Table 5. The comparison of lipid profiles, VAI and liver enzymes at different vitamin D status Variables

Vitamin D deficient patients

Vitamin D sufficient patients

P value

AST

44.22 ± 8.54

40.19 ± 8.75

0.039

ALT

41.89 ± 8.89

40.02 ± 1.28

0.34

AIP

0.767 ± 0.142

0.6417 ± 0.139

<0.001

VAI

9.28 ± 3.25

7.048 ± 2.415

0.001

Mann–Whitney U test; Statistical significance (p < 0.05). AIP: Atherogenic Index of Plasma; VAI: Visceral Adiposity Index; AST: Aspartate aminotransferase; ALT: Alanine aminotransferase.

% body fat [36]. In this regard it has been suggested that because vitamin D is fat soluble, it may be sequestered and stored in fat tissues, thus the bioavailability of endogenously produced vitamin D in the circulation may decrease with increasing % body fat [37]. Regarding the higher VAI values in vitamin D deficient patients, moderate to severe vitamin D deficiency could promote greater adiposity via elevated parathyroid hormone (PTH), which in turn stimulates calcium influx into adipocytes and enhances lipogenesis, thereby promoting weight gain [37, 38]. Supporting this notion, a positive association between PTH and BMI [39], and a reduction in PTH following weight loss have been reported [40]. AIP, as a transformation of TG/HDL-C, was first introduced by Dobiasova [41]. Thus, elevating TG and/or decreasing HDL-C could raise AIP. Hypertriglyceridemia and/or hypo-HDL-cholesterolemia as special types of dyslipidemia are suggested to be high-risk factors for atherosclerosis and CAD. AIP has been shown to be a more useful marker of atherogenicity and cardiovascular risk than single LDL-C or TC. AIP, as an index of dyslipidemia to predict the risk of developing atherosclerosis and CVD, has been applied in some studies [42]. The data further suggests that the improvement of vitamin D status may have favorable potential in reducing the risk of dyslipidemias [42]. In the present study, we observed that vitamin D deficient patients had higher AIP values compared to vitamin D sufficient patients. We also found a negative correlation between serum 25(OH) D levels and AIP. Our findings indicate that vitamin D deficiency may be associated with the increased risk of dyslipidemias. This potential association has been reported in a recent study [42] and still needs further study and clarification. This finding was also reported in previous studies by Yin’s et al. [43] and Ó 2019 Hogrefe

Wang et al. [42]. Though, how vitamin D influences lipid profile is not well understood yet, there are several suggested mechanisms including it has been suggested that increasing absorption of intestinal calcium could reduce synthesis and secretion of TG by the liver [44]. Vitamin D could inhibit synthesis and secretion of TG through stimulating intestinal calcium absorption. Additionally, the increased level of intestinal calcium could reduce intestinal absorption of fatty acid due to the formation of insoluble calcium-fatty complexes. the decreased absorption of fat particularly saturated fatty acids Serum levels of LDL-C would be reduced by [45]. There are various mechanisms, such as hepatocyte apoptosis, and modulation the cytokines and adipokines; whereby vitamin D can augment liver inflammation and so is involved in NAFLD [46] (see Figure 1). Large

Vitamin D

Liver

Improves lipid profile components and anthropometric indices?

Reduces liver fibrosis?

Modulates adipokine and cytokine secretion?

Figure 1. Vitamin D may be involved in the progression of NAFLD through several potentially mechanisms. Int J Vitam Nutr Res (2020), 90 (1–2), 59–66

A. Izadi et al., Vitamin D, adipokines, AIP, VAI and liver enzymes in NAFLD

placebo-controlled randomized clinical trials are suggested to determine whether vitamin D3 supplementation could have any probable beneficial effect in decreasing the development and progression of NAFLD. In this study, we aimed to evaluate the correlations between serum vitamin D levels and omentin-1 as well as vaspin in NAFLD patients. A meta-analysis study [34] reported that NAFLD patients have decreased serum 25 (OH)D concentrations, suggesting that vitamin D may play a role in the development of NAFLD. However, a causal role of hypovitaminosis D in NAFLD development has not been understood. In the present study, vitamin D and vaspin levels were in significantly positive correlation. However, no significant correlation was found between vitamin D and omentin-1 values. We could find only one study in the literature evaluating the relationship between vitamin D and adipokines vaspin and omentin. Similar to our findings Zorlu M et al. [13] reported a significant, positive correlation between serum vitamin D levels and vaspin, whereas a significant, negative correlation between vitamin D levels and omentin. However, this study did not include the male subjects. There are studies investigating other adipokines and vitamin D levels in different disease states. Gannage-Yared et al. reported a direct relation of vitamin D levels with adiponectin values in the vitamin D-deficient, nonobese, young subjects [47, 48]. Vitamin D exerts its multifactorial effects via its receptors in various tissues. Preadipocytes were shown to possess vitamin D receptors [47]. The active form of vitamin D probably exerts several effects via different mechanisms (including gene expression) by acting through these receptors, and by affecting adipokines [13]. In summary, serum vitamin D levels are inversely related in our study to vaspin, but not omentin. Additionally, according to the literature vaspin has an insulin sensitizing effect [14] and suggested to play a compensatory role in the inflammatory complications of obesity. In this regard, serum vaspin concentration has been increased in patients with NAFLD [14, 18, 19], and some studies including Farhangi et al. [11] tried to change vaspin concentrations in these patients. Further studies are recommended to better establish the association and therapeutic abilities of vitamin D, if any, in NAFLD patients. Regarding omentin, it is suggested as a Pleiotropic adipokine involved in obesity, insulin resistance, and diabetes that contribute to the major components of the metabolic syndrome and other disease conditions like atherosclerosis, autoimmune disorders etc [49], thus evaluating its correlation, if any, with vitamin D requires more studies. The importance of physical activity in NAFLD still requires scientific clarification. Moderate exercise, preferably a combination of aerobic and restrictive, has been suggested to augment improvement in the metabolic profiles of patients with NAFLD [50]. Thus, we assess the relation of Int J Vitam Nutr Res (2020), 90 (1–2), 59–66

physical activity with various degrees of disease; no significant association was found (data not shown). For better, evidence-based physical activity recommendations more rigorous, well-designed studies, are needed. The major limitation of the present study is first the relatively small number of subjects in the sample. Secondly, regarding the cross-sectional design of the study, we could not confirm a causal link between the levels of measured adipokines and vitamin D levels in NAFLD patients. The precise associations of adipokine and vitamin D need to be confirmed in a future study with different populations and larger sample size.

References 1. Ding, C., et al. (2012) Vitamin D signalling in adipose tissue. British Journal of Nutrition. 108(11), 1915–1923. 2. Kitson, M.T., et al. (2015) High-dose vitamin D supplementation and liver histology in NASH. Gut. p. gutjnl-2015-310417 3. Ströhle, A., & Bohn, T. (2016) Vitamin D status and mortality: meta-analysis of individual participant data confirms strong association. Int. J. Vitam. Nutr. Res. 1, 4. 4. Bril, F., et al. (2015) Relationship of vitamin D with insulin resistance and disease severity in non-alcoholic steatohepatitis. Journal of Hepatology. 62(2), 405–411. 5. Ahmed, A.M., et al. (2016) Assessment of Vitamin D status in a group of Egyptian children with non alcoholic fatty liver disease (multicenter study). Nutrition & Metabolism. 13(1), 53. 6. Hourigan, S.K., et al. (2015) Relation between vitamin D status and nonalcoholic fatty liver disease in children. Journal of Pediatric Gastroenterology and Nutrition. 60(3), 396–404. 7. Schindhelm, R.K., et al. (2006) Alanine aminotransferase as a marker of non-alcoholic fatty liver disease in relation to type 2 diabetes mellitus and cardiovascular disease. Diabetes/ Metabolism Research and Reviews. 22(6), 437–443. 8. Liangpunsakul, S., & Chalasani, N. (2011) Serum vitamin D concentrations and unexplained elevation in ALT among US adults. Digestive Diseases and Sciences. 56(7), 2124–2129. 9. Skaaby, T., et al. (2014) Vitamin D status, liver enzymes, and incident liver disease and mortality: a general population study. Endocrine. 47(1), 213–220. 10. Jarrar, M., et al. (2008) Adipokines and cytokines in nonalcoholic fatty liver disease. Alimentary Pharmacology & Therapeutics. 27(5), 412–421. 11. Farhangi, M.A., et al. (2014) Oral coenzyme Q10 supplementation in patients with nonalcoholic fatty liver disease: Effects on serum vaspin, chemerin, pentraxin 3, insulin resistance and oxidative stress. Archives of Medical Research. 45(7), 589–595. 12. Polyzos, S.A., Kountouras, J., & Zavos, C. (2016) Nonalcoholic fatty liver disease and adipokines. Adipokines. 214. 13. Zorlu, M., et al. (2016) Evaluation of the relation between vitamin D and serum omentin and vaspin levels in women. Experimental and Clinical Endocrinology & Diabetes. 124(07), 440–443. 14. Aktas, B., et al. (2011) Serum levels of vaspin, obestatin, and apelin-36 in patients with nonalcoholic fatty liver disease. Metabolism. 60(4), 544–549. 15. Tan, Y.-L., Zheng, X.-L., & Tang, C.-K. (2015) The protective functions of omentin in cardiovascular diseases. Clinica Chimica Acta. 448, 98–106.

Ó 2019 Hogrefe

A. Izadi et al., Vitamin D, adipokines, AIP, VAI and liver enzymes in NAFLD

16. Pan, H.-Y., Guo, L., & Li, Q. (2010) Changes of serum omentin-1 levels in normal subjects and in patients with impaired glucose regulation and with newly diagnosed and untreated type 2 diabetes. Diabetes research and clinical practice. 88(1), 29–33. 17. Jablonski, K., et al. (2013) Low 25-hydroxyvitamin D level is independently associated with non-alcoholic fatty liver disease. Nutrition, Metabolism and Cardiovascular Diseases. 23 (8), 792–798. 18. Yilmaz, Y., et al. (2011) Serum levels of omentin, chemerin and adipsin in patients with biopsy-proven nonalcoholic fatty liver disease. Scandinavian Journal of Gastroenterology. 46 (1), 91–97. 19. Kukla, M., et al. (2010) Serum chemerin and vaspin in nonalcoholic fatty liver disease. Scandinavian Journal of Gastroenterology. 45(2), 235–242. 20. Kwok, R.M., Torres, D.M., & Harrison, S.A. (2013) Vitamin D and nonalcoholic fatty liver disease (NAFLD): is it more than just an association? Hepatology. 58(3), 1166–1174. 21. Krivošíková, Z., Gajdoš, M., & Šebeková, K. (2015) Vitamin D levels decline with rising number of cardiometabolic risk factors in healthy adults: association with adipokines, inflammation, oxidative stress and advanced glycation markers. PLoS One. 10(6), e0131753. 22. Wamberg, L., et al. (2013) Effects of vitamin D supplementation on body fat accumulation, inflammation, and metabolic risk factors in obese adults with low vitamin D levels—results from a randomized trial. European journal of internal medicine. 24(7), 644–649. 23. Qin, X.F., et al. (2015) Effects of vitamin D on plasma lipid profiles in statin-treated patients with hypercholesterolemia: A randomized placebo-controlled trial. Clinical Nutrition. 34 (2), 201–206. 24. Kelishadi, R., Farajzadegan, Z., & Bahreynian, M. (2014) Association between vitamin D status and lipid profile in children and adolescents: a systematic review and metaanalysis. International Journal of Food Sciences and Nutrition. 65(4), 404–410. 25. Ross, A.C., et al. (2011) Dietary reference intakes for calcium and vitamin D. National Academies Press: . 26. Brunt, E.M., et al. (2011) Nonalcoholic fatty liver disease (NAFLD) activity score and the histopathologic diagnosis in NAFLD: distinct clinicopathologic meanings. Hepatology. 53 (3), 810–820. 27. Barchetta, I., et al. (2011) Strong association between non alcoholic fatty liver disease (NAFLD) and low 25 (OH) vitamin D levels in an adult population with normal serum liver enzymes. BMC Medicine. 9(1), 1. 28. Nakano, T., et al. (2011) Impact of artificial sunlight therapy on the progress of non-alcoholic fatty liver disease in rats. Journal of Hepatology. 55(2), 415–425. 29. Rhee, E.-J., et al. (2013) High serum vitamin D levels reduce the risk for nonalcoholic fatty liver disease in healthy men independent of metabolic syndrome. Endocrine Journal. 60 (6), 743–752. 30. Targher, G., et al. (2007) Associations between serum 25hydroxyvitamin D 3 concentrations and liver histology in patients with non-alcoholic fatty liver disease. Nutrition, Metabolism and Cardiovascular Diseases. 17(7), 517–524. 31. Targher, G., & Byrne, C.D. (2014) Lower 25-hydroxyvitamin D3 levels and increased risk of liver diseases: is there a causal link? Endocrine. 47(1), 3–4. 32. Sharifi, N., et al. (2014) Does vitamin D improve liver enzymes, oxidative stress, and inflammatory biomarkers in adults with

Ó 2019 Hogrefe

33.

34.

35.

36.

37.

38.

39.

40.

41.

42. 43.

44.

45.

46. 47.

48.

49.

50.

non-alcoholic fatty liver disease? A randomized clinical trial. Endocrine. 47(1), 70–80. Manco, M., Ciampalini, P., & Nobili, V. (2010) Low levels of 25hydroxyvitamin D3 in children with biopsy-proven nonalcoholic fatty liver disease. Hepatology. 51(6), 2229–2229. Eliades, M., et al. (2013) Meta-analysis: vitamin D and nonalcoholic fatty liver disease. Alimentary Pharmacology & Therapeutics. 38(3), 246–254. Targher, G., et al. (2013) Nonalcoholic fatty liver disease and reduced serum vitamin D3 levels. Metabolic Syndrome and Related Disorders. 11(4), 217–228. Mousa, A., et al. (2016) 25-hydroxyvitamin D is associated with adiposity and cardiometabolic risk factors in a predominantly vitamin D-deficient and overweight/obese but otherwise healthy cohort. The Journal of Steroid Biochemistry and Molecular Biology. Cheng, S., et al. (2010) Adiposity, cardiometabolic risk, and vitamin D status: the Framingham Heart Study. Diabetes. 59 (1), 242–248. Alemzadeh, R., et al. (2008) Hypovitaminosis D in obese children and adolescents: relationship with adiposity, insulin sensitivity, ethnicity, and season. Metabolism. 57(2), 183–191. Kamycheva, E., Sundsfjord, J., & Jorde, R. (2004) Serum parathyroid hormone level is associated with body mass index. The 5th Tromso study. European Journal of Endocrinology. 151(2), 167–172. Andersen, T., et al. (1988) Secondary hyperparathyroidism of morbid obesity regresses during weight reduction. Metabolism. 37(5), 425–428. Dobiasova, M., & Frohlich, J. (2000) [The new atherogenic plasma index reflects the triglyceride and HDL-cholesterol ratio, the lipoprotein particle size and the cholesterol esterification rate: changes during lipanor therapy]. Vnitrni lekarstvi. 46(3), 152–156. Wang, Y., et al. (2016) The Associations of Serum Lipids with Vitamin D Status. PLoS One. 11(10), e0165157. Yin, X., et al. (2012) Serum 25 (OH) D is inversely associated with metabolic syndrome risk profile among urban middleaged Chinese population. Nutrition Journal. 11(1), 1. Cho, H.-J., et al. (2005) The possible role of Ca2+ on the activation of microsomal triglyceride transfer protein in rat hepatocytes. Biological and Pharmaceutical Bulletin. 28(8), 1418–1423. Christensen, R., et al. (2009) Effect of calcium from dairy and dietary supplements on faecal fat excretion: a meta-analysis of randomized controlled trials. Obesity Reviews. 10(4), 475– 486. Gorman, S., et al. (2015) Can skin exposure to sunlight prevent liver inflammation? Nutrients. 7(5), 3219–3239. Ulutas, O., et al. (2013) Vitamin D deficiency, insulin resistance, serum adipokine, and leptin levels in peritoneal dialysis patients. International Urology and Nephrology. 45 (3), 879–884. Gannagé-Yared, M.-H., et al. (2009) Vitamin D in relation to metabolic risk factors, insulin sensitivity and adiponectin in a young Middle-Eastern population. European Journal of Endocrinology. 160(6), 965–971. Jaikanth, C., et al. (2013) Emergence of omentin as a pleiotropic adipocytokine. Experimental and Clinical Endocrinology & Diabetes. 121(07), 377–383. Finelli, C., & Tarantino, G. (2012) Have guidelines addressing physical activity been established in nonalcoholic fatty liver disease. World J Gastroenterol. 18(46), 6790–6800.

Int J Vitam Nutr Res (2020), 90 (1–2), 59–66

A. Izadi et al., Vitamin D, adipokines, AIP, VAI and liver enzymes in NAFLD

History Received February 26, 2017 Accepted April 17, 2017 Published online April 1, 2019

Conflicts of interest The authors declare no conflicts.

Sara Ebrahimi Acknowledgments The authors should thank Jahrom University of medical sciences for financial support.

Int J Vitam Nutr Res (2020), 90 (1–2), 59–66

saraebrahimi123@gmail.com Tel. +98917 1922566

Ó 2019 Hogrefe

Original Communication

Low-Dose Omega-3 Fatty Acid and Vitamin D for Anthropometric, Biochemical Blood Indices and Respiratory Function. Does it work? Arturas Sujeta1, Sandrija Capkauskiene2, Daiva Vizbaraite2, Loreta Stasiule2, Mindaugas Balciunas1, Arvydas Stasiulis2, and Edmundas Kadusevicius3 1

National Institute for Health Development, Lithuanian Sports University, Kaunas, Lithuania

Department of Applied Biology and Rehabilitation, Lithuanian Sports University, Kaunas, Lithuania

Department of Clinical Pharmacology, Institute of Physiology & Pharmacology, Medical Academy, Lithuanian University of Health Sciences, Kaunas, Lithuania

Received: February 5, 2017; Accepted: June 1, 2017

Abstract: Omega-3 fatty acids and vitamin D3 have beneficial effects on different blood, cardiovascular parameters and physical performance. However, the effect of low-dose omega-3 fatty acid supplementation remains unclear. 84 office workers aged 40–60 years, participated in a 16-week open, randomized, placebo-controlled, parallel-group study. The experimental group received 330 mg of omega-3 fatty acid and 0.005 mg (200 IU) of vitamin D3 per day and the control group received placebo. Anthropometric, biochemical blood and respiratory indices were measured at 12 and 16 weeks. Body mass (BM) and body mass index (BMI) significantly reduced in both the experimental (BM from 74.4 ± 13.04 to 73.2 ± 13.02 kg, p < 0.001; BMI from 25.8 ± 4.1 to 25.4 ± 4.3 kg/m2, p < 0.001) and the placebo groups (BM from 69.5 ± 11. to 68.7 ± 11.4 kg, p < 0.05; BMI from 24.1 ± 4.0 to 23.8 ± 4.2 kg/m2, p < 0.05). Omega-3 fatty acid supplementation significantly improved glucose (from 5.12 ± 0.55 to 4.97 ± 0.62 mmol/l; p = 0.05), total cholesterol (from 5.86 ± 1.0 to 5.32 ± 1.55 mmol/l; p = 0.003), and vitamin D levels (from 35.07 ± 21.65 to 68.63 ± 25.94 nmol/l; p = 0.000). Maximal oxygen consumption (from 33.7 ± 2.4 to 36.6 ± 3.2 ml/kg/min, p = 0.035), forced vital capacity (from 3.5 ± 0.6 to 3.9 ± 0.9 l, p = 0.044), forced expiratory volume (from 3.2 ± 0.6 to 3.5 ± 0.7 l, p = 0.014), and peak expiratory flow (from 6.7 ± 1.4 to 7.5 ± 1.6 l/s, p = 0.019) also slightly improved in the omega-3 fatty acid group. Daily supplementation of 330 mg of omega-3 fatty acids had a slight positive impact on total cholesterol and glucose level, while there was no effect on low and high density lipoproteins, and triglycerides levels. Therefore, dose of 330 mg per day seems as insufficient. Keywords: omega-3 fatty acids, vitamin D, blood lipids, glucose, anthropometric indices, VO2max

Introduction Fish oil omega-3 fatty acid supplementation can moderately reduce blood pressure [1], reduce the risk of cardiovascular disease and sudden cardiac death [2], and protect against cardiac arrhythmias [3]. However, changes in plasma lipid classes, especially after more than 3 months of supplementation, are not completely understood [4]. Some studies with a duration of 3–18 months have shown positive and significant lipid concentration changes in blood samples [5, 6], although each study used different supplements and a different ratio of active substances. The use of omega-3 fatty acid food supplements is also associated with better physical performance – higher Ó 2019 Hogrefe

omega-3 tissue levels may have a protective effect on muscle cells during exercise and reduce the inflammatory response and subsequent delayed onset muscle soreness [7]. It is recognized that regular consumption of polyunsaturated fatty acids or also can called polyunsaturated fatty acids (PUFAs) can improve lipid profiles, reduce oxidative stress, and reduce inflammation [8, 9]. Nevertheless, the correlation between blood glycemic levels and omega fatty acid consumption is not clear. In one study, no significant changes in this parameter were reported after consumption of fish oil for 3 months [10]. It is also known that the effects of dietary supplements are highly dependent on human anthropometric data, subjects’ age, and daily physical activity level [11]. Moreover, because the dose of Int J Vitam Nutr Res (2020), 90 (1–2), 67–83 https://doi.org/10.1024/0300-9831/a000476

A. Sujeta et al., Effect of Low-Dose Omega3 and Vitamin D

supplementation appears to be important, it is not surprising that most studies on the impact of fish oil supplementation on human health parameters report conflicting results [12, 13, 14]. Nevertheless, the potential role of n-3 PUFAs in the maintenance of cardiovascular health and disease prevention has been highlighted [15]. The American Heart Association has set up dietary recommendations for EPA and DHA due to their cardiovascular benefits: individuals with no history of coronary heart disease or myocardial infarction should consume oily fish or fish oils two times per week; those having been diagnosed with coronary heart disease after infarction should consume 1 g EPA and DHA per day from oily fish or supplements; those wishing to lower blood triglycerides should consume 2–4 g of EPA and DHA per day in the form of supplements [16]. Both omega-3 and vitamin D supplements have also been increasingly used for the possible prevention of first cardiovascular event [17]. Because, the cardiometabolic disorders and vitamin D deficiency are more prevalent across multiple populations. Different studies have suggested a potential association between abnormal vitamin D levels and multiple pathological conditions including various cardiovascular diseases and diabetes [18]. There are several possible mechanisms contributing to the association between vitamin D and cardiovascular diseases, such as insulin sensitivity, parathyroid hormone elevation and inflammation [19]. The reason of this may be dyslipidemia, because dyslipidemia is a well-described independent risk factor for cardiovascular diseases [20]. Some results indicate that a vitamin D supplementation does not adversely affect weight loss and is able to improve several cardiovascular disease risk markers in overweight subjects with inadequate vitamin D status [21]. The purpose of this study was to test the effect of a daily dose of 330 mg of omega-3 fatty acid (sum of Docosahexaenoic Acid (DHA), Eicosapentaenoic Acid (EPA) and Docosapentaenoic acid (DPA)) with 0.005 mg (200 IU) of vitamin D3 as cholecalciferol on biochemical blood indices and aerobic capacity in healthy subjects compared with a daily dose of refined sunflower oil as placebo.

a diet rich in omega-3 fatty acids. Subjects were instructed to maintain their regular diet and exercise habits throughout the study period. Physical activity records were obtained only before the study; body composition parameters were obtained at the beginning, at the middle and at the end of the study period. The inclusion criteria were as follows: male or female office workers aged 40–60 years, nonsmokers, and subjects with stable eating patterns and physical activity. The exclusion criteria included previous or current use of lipid-lowering therapies, treatment with vitamin D for osteoporosis, diabetes treated or detected at the inclusion visit, chronic diseases, and severe medical conditions that could interfere with the study, such as digestive tract surgery. Study participants’ characteristics are presented in Table 1. The study protocol was approved by the Ethics Committee (2015-12-29, No BE-2-37, LUHS Kaunas Region Biomedical Research Ethics Committee, Lithuania). An open, randomized, placebo-controlled, parallel-group study was conducted between January 2016 and September 2016 in Kaunas, Lithuania. The participants were first screened for eligibility through a phone call. All potential candidates underwent a prescreening visit during which the inclusion/exclusion criteria were detailed, and the study and the procedures to be followed were explained. The study coordinator answered any questions posed by the subjects, and their written informed consent was obtained. Thereafter, an anthropometric examination and the International Physical Activity Questionnaire were conducted, and blood samples were taken to confirm eligibility. Eligible subjects were randomly assigned to take either the placebo or the dietary supplement of omega-3 fatty acids in the morning hours, on empty stomach before breakfast. All participants were assessed at baseline (1T), at the middle (2T) (week 12), and at the end of the study (3T) (week 16) (Figure 1). Anthropometrical measurement, spirometry and physical performance tests have been performed in the specialized laboratory of the Institute of Sport Science and Innovations, Lithuanian Sports University.

Methods

Supplements

Study Protocol

Study participants received either a daily supplement of 330.2 mg omega-3 fatty acid (single dose: EPA – 91.5 mg, DHA – 63.0 mg, DPA – 10.6 mg) with 0.005 mg (200 IU) of vitamin D3 as cholecalciferol or 720 mg high-oleic sunflower oil as placebo for 16 weeks. The temperature of extraction was not specified. Supplements and placebo were produced by the company Pharmatech AS Product, Vallehellene 4, 1664 Rolvsoy, Norway.

Eighty-four healthy males and females volunteered to participate in this study. Written informed consent was received from each subject following a detailed explanation of the experimental protocol and any associated risks. Subjects were screened to ensure they were in good health, and were not using omega-3 fatty acids supplements and/or had

Int J Vitam Nutr Res (2020), 90 (1–2), 67–83

Ó 2019 Hogrefe

A. Sujeta et al., Effect of Low-Dose Omega3 and Vitamin D

Table 1. Characteristics of study participants. Omega 3 fatty acid (n = 63)

Placebo (n = 21)

Sex (n): Male

Famale

Age (y)

44.3 ± 9

47.8 ± 9.8

.953

Height (m)

1.71 ± 0.06

1.69 ± 0.05

.118

Body mass (kg)

79.9 ± 18.7

73.6 ± 12.6

.141

Body mass index (kg/m2)

27.5 ± 5.8

24.2 ± 3.7

.036

Fat mass (%)

32.2 ± 8.9

32.9 ± 11.2

.734

2956.9 ± 2013.2

2835.04 ± 1263.3

.868

High

Physical activity (MET-min/wk) Education Notes: Values are expressed as mean ± sd.

Figure 1. Flowchart of the study participants. Ó 2019 Hogrefe

Int J Vitam Nutr Res (2020), 90 (1–2), 67–83

A. Sujeta et al., Effect of Low-Dose Omega3 and Vitamin D

Questionnaire

Statistical Analysis

The short version of the International Physical Activity Questionnaire (IPAQ) was used to assess health-related physical activity.

The data were tested for normal distribution using the Kolmogorov–Smirnov test, and all data were found to be normally distributed. Two-way mixed analysis ANOVA (General Linear Model) was used to determine the effect of the repeated measurements as within-subject factor of tree levels and groups – Omega-3 fatty acid and placebo as between subject factor on the BM, BMI, FM, glucose, TCh, HDL, LDL, TG, vitamin D, VO2max, FVC, FEV1, PEF, and MVV. A significant result was followed by LSD post hoc adjustment to determine differences among measurement conditions. If Mauchly’s Test of Sphericity was significant then the Greenhouse-Geisser correction was used. The level of significance was set at p < 0.05 and effect size (partial eta squared) as well as observed power were also calculated and reported. All statistical analyses were performed using IBM SPSS Statistics 22 (IBM Corporation, Armonk, NY).

Anthropometry A body composition analyzer (Tanita, TBF-300, Illinois, USA) was used to measure body mass (BM, kg), body mass index (BMI, kg/m2), and fat mass (FM, %).

Physical Performance Physical performance was measured using the Balke treadmill exercise test, which comprised a 4-min warm-up followed by an incremental continuous increase in incline of 2.5% every 2 min until volitional fatigue. The criteria used to verify that VO2max was achieved were a respiratory exchange ratio greater than 1:1, maximum heart rate equal to 220 – age ± 10 beats per min, and a plateau in oxygen uptake with increasing workload. Pulmonary gas exchange was analyzed using a portable analyzer (Oxycon Mobile; Jaeger, Hoechberg, Germany). Before each test, the equipment was calibrated according to the manufacturer’s recommendations.

Spirometry The most common parameters of pulmonary function were measured using a portable gas analyzer (Oxycon Mobile, Jaeger): maximal oxygen consumption (VO2max), forced vital capacity (FVC), forced expiratory volume (FEV1), peak expiratory flow (PEF), and maximum voluntary ventilation (MVV). Before each test, the analyzer was calibrated according to the manufacturer’s recommendations.

Biochemical Analysis Venous blood samples were drawn at the same time (±2 h) after an overnight fast ( 12 h) before supplementation, and after 12 and 16 weeks. Plasma vitamin D3 (“COBAS 6000 e601”), glucose level, and blood lipid profile (“COBAS INTEGRA 400 plus”)—total cholesterol (TCh), high-density cholesterol (HDL), low-density cholesterol (LDL), and triglycerides (TG)—were assessed. All biochemical analyses have been carried out in the leading private hospital in Lithuania “Kardiolita Hospital. BMP”, company code:133643318, VAT No. LT336433113, Address: Savanorių pr. 423, Kaunas, Lithuania, LT-49287 Int J Vitam Nutr Res (2020), 90 (1–2), 67–83

Results FM did not change in either group over the 16-week supplementation period; however, BM after 16 weeks (3T) of supplementation significantly decreased by 1.6% from 74.4 ± 13.04 to 73.2 ± 13.02 kg (p = 0.000) in the omega-3 fatty acid group, and by 1.2% from 69.5 ± 11.1 to 68.7 ± 11.4 kg (p = 0.047) kg in the placebo group. BMI also significantly decreased after 16 weeks (3T) by 1.6% from 25.8 ± 4.1 to 25.4 ± 4.3 kg/m2 (p = 0.000) in the omega-3 fatty acid group and by 1.2% from 24.1 ± 4 to 23.8 ± 4.2 kg/m2 in the placebo group (p = 0.048) (Table 2). In the omega-3 fatty acid group, 16 weeks of supplementation (3T) significantly increased vitamin D concentration by 47.8% from 35.07 ± 21.65 to 67.15 ± 22.93 nmol/l; glucose significantly decreased by 2.9% after 12 weeks (2T) of supplementation (p = 0.005) from 5.12 ± 0.55 to 4.97 ± 0.62 mmol/l, but it remained unchanged at 3T. The TCh level at 3T decreased by 9.2% compared with the baseline level (1T) from 5.86 ± 1.0 to 5.32 ± 1.55 mmol/l (p = 0.003). The HDL, LDL, and TG parameters did not change significantly within the study period (Table 3). In the placebo group, only vitamin D concentration increased significantly by 63.4% from 25.62 ± 13.85 to 70.05 ± 16.94 nmol/l by 3T (p = 0.000); other blood parameters were unchanged. The increment in the relative VO2max value (Fig. 2) was measured in the omega-3 fatty acid group at 3T comparing with the baseline at 1T (from 33.7 ± 2.4 to 36.6 ± 3.2 ml/min/ kg, p = 0.035) and at 3T compared with the second testing (2T) (from 33.6 ± 2.5 to 36.6 ± 3.2 ml/min/kg, p = 0.023). No significant differences were found in the placebo group. Ó 2019 Hogrefe

A. Sujeta et al., Effect of Low-Dose Omega3 and Vitamin D

Table 2. Effects of omega-3 fatty acid and placebo on subjects’ body composition. Indexes

Omega-3 fatty acids

Observed Power

1T (n = 63)

2T (n = 55)

3T (n = 54)

1/2

1/3

2/3

Body mass (kg)

74.4 ± 13.0

73.3 ± 13.2

73.2 ± 12.0

.000

.265

1.000

Body mass index (kg/m2)

25.8 ± 4.1

25.5 ± 4.3

25.4 ± 4.3

.000

.262

1.000

Fat mass (%)

30.4 ± 8.0

30.1 ± 8.2

29.9 ± 8.2

.178

.097

.347

.422

Placebo

Body mass (kg) Body mass index (kg/m2) Fat mass (%)

1T (n = 21)

2T (n = 15)

3T (n = 14)

1/2

1/3

2/3

69.5 ± 11.1

68.4 ± 11.6

68.7 ± 11.4

.024

.047

.053

24.1 ± 4

23.8 ± 4.3

23.8 ± 4.2

.045

.048

.136

0.519

30.4 ± 2.6

30.3 ± 2.7

30.7 ± 2.6

.871

.442

.202

0.151

0.637

Table 3. Effects of omega-3 fatty acid and placebo on biochemical blood indices. Indexes

Omega-3 fatty acids 1T (n = 63)

2T (n = 55)

p 3T (n = 54)

1/2

1/3

Observed Power 2/3

Glucose (mmol/l)

5.12 ± 0.6

4.97 ± 0.62

5.12 ± 0.77

.005

.450

.138

Cholesterol (mmol/l)

5.86 ± 1.0

5.73 ± 1.06

5.32 ± 1.55

.090

.003

.025

0.825

HDL (mmol/l)

1.99 ± 0.52

2.06 ± 0.76

.539

.392

.345

0.145

LDL (mmol/l)

3.26 ± 0.89

3.24 ± 0.86

3.18 ± 1.25

.850

,528

.567

0.093

TG (mmol/l)

1.38 ± 0.94

1.29 ± 0.68

1.23 ± 0.56

.226

.068

.373

0.426

35.07 ± 21.65

68.63 ± 25.94

67.15 ± 22.93

.000

.659

1.000

1T (n = 21)

2T (n = 15)

3T (n = 14)

1/2

1/3

Vitamin D (nmol/l)

Placebo

0.583

p 2/3

Glucose (mmol/l)

5.08 ± 0.6

4.94 ± 0.74

5.02 ± 0.99

.473

.807

.733

0.078

Cholesterol (mmol/l)

5.45 ± 1.12

5.45 ± 1.18

4.78 ± 1.43

.987

.116

.100

0.372

HDL (mmol/l)

1.99 ± 0.57

1.91 ± 0.54

2.0 ± 0.83

.219

.713

.484

0.113

LDL (mmol/l)

2.95 ± 0.77

3.02 ± 0.89

2.74 ± 0.88

.579

.435

.392

0.171

TG (mmol/l)

1.73 ± 0.40

1.11 ± 0.47

1.30 ± 1.07

.910

.517

.536

0.106

25.62 ± 13.85

80.66 ± 27.70

70.05 ± 16.94

.000

.074

1.000

Vitamin D (nmol/l)

Notes: Values are expressed as mean ± sd. 1T, before the study; 2T, at the middle of the study; 3T, at the end of the study. 1/2 – statistical difference between 1T and 2T; 1/3 – statistical difference between 1T and 3T; 2/3 – statistical difference between 2T and 3T. HDL – high density cholesterol; LDL – low density cholesterol; TG – triglycerides.

FVC (Fig. 3) was significantly higher after 12 weeks (2T) (from 3.5 ± 0.6 to 3.8 ± 0.8 l, p = 0.047) and 16 weeks (3T) (from 3.5 ± 0.6 to 3.9 ± 0.9 l, p = 0.044) compared with the baseline at 1T in the omega-3 group. There were no significant differences in the placebo group. Figure 4 shows that 16 weeks (3T) of supplementation significantly increased FEV1 in the omega-3 fatty acid group (from 3.2 ± 0.6 to 3.5 ± 0.7 l, p = 0.014) compared with the beginning at 1T, but no significant differences were found between the two groups. PEF was significantly higher (Fig. 5) after 16 weeks (3T) of supplementation in the omega-3 fatty acid group (from 6.7 ± 1.4 to 7.5 ± 1.6 l/min, p = 0.019) comparing with the baseline at 1T, but no significant differences were found in the Ó 2019 Hogrefe

placebo group. MVV did not significantly change over the 16 weeks in either group.

Discussion The anthropometric results indicate that body weight and body mass index decreased in the omega-3 fatty acid group after 16 weeks of supplementation. Numerous studies using a fish oil dose of 1–1.5 g and a duration of use of up to 24 weeks have evaluated the effect of fish oil supplementation on body composition. Most of these studies demonstrated a positive impact on body weight and body mass index after Int J Vitam Nutr Res (2020), 90 (1–2), 67–83

A. Sujeta et al., Effect of Low-Dose Omega3 and Vitamin D

Figure 2. Effects of omega-3 fatty acid and placebo on maximal oxygen consumption. Notes: 1T, before the study (omega 3 fatty acid group n = 63; placebo n = 21); 2T, at the middle of the study (omega 3 fatty acid group n = 55; placebo n = 15); 3T, at the end of the study (omega 3 fatty acid group n = 54; placebo n = 14). *Significantly different between 1T and 3T (1/3 p = 0.035). +Significantly different between 2T and 3T (2/3 p = 0.023). Error bar represent ± standard deviation.

Figure 3. Effects of omega-3 fatty acid and placebo on forced vital capacity. Notes: 1T, before the study (omega 3 fatty acid group n = 63; placebo n = 21); 2T, at the middle of the study (omega 3 fatty acid group n = 55; placebo n = 15); 3T, at the end of the study (omega 3 fatty acid group n = 54; placebo n = 14). *Significantly different between 1T and 2T (1/2 p = 0.041) and between 1T and 3T (1/3 p = 0.042). Error bar represent ± standard deviation

omega-3 fatty acid supplementation [22, 23, 24, 25, 26, 27]. The results from our study are in line with these findings. Several studies have reported a reduction in body fat mass [24, 28, 29, 30, 31]. However, our results did not show a significant decrease of fat mass in either group, even though the duration of fish oil supplementation was similar (6–16 weeks) but the dose much larger (1.8–6 g) in those studies. Int J Vitam Nutr Res (2020), 90 (1–2), 67–83

Table 5 summarizes body composition index results obtained after consumption of different doses and duration of fish oil. Fish oil appears to have multiple mechanisms of action in the body and can provide benefits to cardiovascular health. The 2002 American Heart Association Scientific Statement published after landmark trials highlighted the benefit of Ó 2019 Hogrefe

A. Sujeta et al., Effect of Low-Dose Omega3 and Vitamin D

Figure 4. Effects of omega-3 fatty acid and placebo on forced expiratory volume. Notes: 1T, before the study (omega 3 fatty acid group n = 63; placebo n = 21); 2T, at the middle of the study (omega 3 fatty acid group n = 55; placebo n = 15); 3T, at the end of the study (omega 3 fatty acid group n = 54; placebo n = 14). *Significantly different between 1T and 3T (1/3 p = 0.034). Error bar represent ± standard deviation

Figure 5. Effects of omega-3 fatty acid and placebo on peak expiratory flow. Notes: 1T, before the study (omega 3 fatty acid group n = 63; placebo n = 21); 2T, at the middle of the study (omega 3 fatty acid group n = 55; placebo n = 15); 3T, at the end of the study (omega 3 fatty acid group n = 54; placebo n = 14). *Significantly different between 1T and 3T (1/3 p = 0.028). Error bar represent ± standard deviation

fish in reducing morbidity and mortality in those with cardiovascular disease. Since then, numerous studies have shown the benefit of fish oil in decreasing TG levels, promoting antiplatelet activity, decreasing heart failure, and improving vascular function in diabetes. Fish oil was shown to improve TG levels in combination with other lipid-lowering therapies such as statins and fibrates, and was also reported to have an effect on lowering levels of TGs and VLDL and increasing HDL [32]. Systematic reviews have Ó 2019 Hogrefe

shown that individuals with any degree of dyslipidemia, and elevated serum TG and/or cholesterol levels may benefit from a 20–30% reduction in serum TG after consuming n-3 PUFAs derived from marine sources [15]. Fish oil is popularly used for reducing TGs or improving dyslipidemia. It was shown that fish oil supplementation produces a clinically significant dose-dependent reduction of fasting blood TG, but not total, HDL, or LDL cholesterol in hyperlipidemia subjects [32]. A reduction of 9–26% in Int J Vitam Nutr Res (2020), 90 (1–2), 67–83

A. Sujeta et al., Effect of Low-Dose Omega3 and Vitamin D

Table 4. Effects of omega-3 fatty acid and placebo on spirometric indices. Indexes

Omega-3 fatty acids

1T (n = 63)

2T (n = 55)

3T (n = 54)

1/2

VO2max (ml/kg/min)

33.7 ± 2.4

33.66 ± 2.5

36.6 ± 3.2

FVC (l)

3.5 ± 0.6

3.8 ± 0.8

3.9 ± 0.9

FEV1 (l)

3,2 ± 0.6

3.4 ± 0.6

PEF (l/s)

6.7 ± 1.4

7.1 ± 1.3

124.8 ± 33.1

130.6 ± 32

1T (n = 21)

Observed Power

1/3

2/3

.931

.035

.023

0.864

.047

.044

.203

0.765

3.5 ± 0.7

.072

.014

.105

0.866

7.5 ± 1.6

.107

.019

.079

0.827

133.4 ± 34.6

.224

.294

.653

0.192

2T (n = 15)

3T (n = 14)

1/2

1/3

2/3

37.2 ± 11.3

36.6 ± 7.1

36,4 ± 5.4

.838

.855

0.054

3.8 ± 0.9

3.9 ± 0.9

4.1 ± 1.0

.471

.084

.473

0.244

FEV1 (l)

3.5 ± 1

3.5 ± 0.9

3.7 ± .0

.100

.074

0.218

PEF (l/s)

7.3 ± 2.7

7.0 ± 2.4

7.4 ± 1.9

.149

.912

.427

0.098

125.73 ± 25.9

130.6 ± 30.0

139.8 ± 27.4

.587

.109

.175

0.417

MVV (l/min)

Placebo

VO2max (ml/kg/min) FVC (l)

MVV (l/min)

Notes: Values are expressed as mean ± sd. 1T, before the study; 2T, at the middle of the study; 3T, at the end of the study. 1/2 – statistical difference between 1T and 2T; 1/3 – statistical difference between 1T and 3T; 2/3 – statistical difference between 2T and 3T. VO2max – maximal oxygen consumption; FVC – forced vital capacity; FEV1 – forced expiratory volume; PEF – peak expiratory flow; MVV – maximum voluntary ventilation.

circulating TGs was demonstrated in studies where 4 g/day n-3 PUFAs were consumed from either marine or EPA/DHA-enriched food sources. A reduction of 4–51% was found in studies where 1–5 g/day of EPA and/or DHA was consumed through the supplements [15]. On the contrary, our results showed that TG levels did not change significantly in the omega-3 fatty acid group, which was likely due to the low dose of supplementation. Poppitt et al. [34] also found that even 3 g/day of encapsulated fish oil (containing 1.2 g/day total omega-3 PUFAs) used for 12 weeks had no significant effect on TG levels. However, as seen in Table 5, other studies that used different doses and durations of supplementation showed opposite effects. Other studies have reported that daily supplementation of 720 mg of omega-3 fatty acid had no effect on LDL and HDL levels. Our results confirm the findings of other studies [13, 34, 35, 36, 37, 38] that showed no significant effect on blood lipid fractions. In those studies, the duration of supplementation varied from 6 to 12 weeks and the dose used varied from 0.85 g to 4.4 g. Our results showed that serum glucose and TCh levels were significantly reduced in the omega-3 fatty acid group. However, in general, other studies [35, 39] reported no effect on these blood induces levels [33, 36, 37, 40]. In contrast, Mostad et al. [41] reported that a high intake of fish oil (17.6 ml/day) used for 9 weeks was able to increase blood glucose level. It is known that the effects of dietary supplements are highly dependent on human anthropometric data, subjects’ age, and daily physical activity level [11]. Moreover, the dose of supplementation seems to be very important. In our case, because the supplementation dose was for Int J Vitam Nutr Res (2020), 90 (1–2), 67–83

preventive use only, it may have been too low to induce notable blood lipid changes. Different global organizations recommend varying daily doses of EPA/DHA. However, most experts recommend that adults should consume at least 500 mg of EPA/DHA daily to maintain good health [42, 43]. Table 6 summarizes the main biochemical blood and respiratory index results, and other findings obtained from adults after consumption of different doses and duration of fish oil. In our study, vitamin D status significantly increased in both groups after 16 weeks of supplementation. However, we believe that this was not as a result of low dose 200 IU of vitamin D supplementation, because the second part of study was conducted in summertime and changes in vitamin D levels were likely related to greater sun exposure. Numerous studies (Table 7) have reported on the effects of seasonal changes on vitamin D status in countries located in northern latitudes [44, 45, 46, 47, 48, 49, 50]; our results confirm these effects. The relation of Vitamin D and glucose metabolism and lipid profile is very inconsistent in the literature. Gupta et al. [51] reported that low vitamin D levels increased prediabetes risk, and in healthy adolescent males, the insulin levels decreased as the vitamin D level increased. Pittas et al., [52] reported that the type 2 diabetes risk and vitamin D insufficient is very close. The higher 25(OH) D level, the lower type 2 diabetes risk [52]. But in a study carried out with postmenopausal women [53], it was reported that low vitamin D levels were not associated with diabetes risk. In our case, after the middle testing (2T) glucose level significantly decreased (p < 0.05), and vitamin D level significantly increased at the same time. We did not evaluate insulin Ó 2019 Hogrefe

A. Sujeta et al., Effect of Low-Dose Omega3 and Vitamin D

Table 5. Studies assessing body composition outcome effects on Omega-3 fatty acids by dietary intervention. Study

Subject characteristics

Omega-3 Source (dose/day)

Duration

Body composition outcomes

Other findings

Krebs et al., 2006 [19]

116 overweight insulin-resistant women

24 weeks

Significant weight-loss was in WLFO (10.8 ± 1.0%) and WLPO (12.4 ± 1.0%) compared to the control group. The WLFO, but not WLPO or control group, showed significant increases in adipose tissue LC n-3 PUFA.

Significant decreases in triglycerides and increases in adiponectin was registered with LC n3 PUFA, in the WLFO vs WLPO groups.

Kunesova et al., 2006 [18]

20 obese woman

Control group (no weight-loss and placebo oil) Weight-loss intervention groups with either supplemental LC n-3 PUFA (WLFO) or placebo oil (WLPO). WLFO group received five 1 g oil capsules per day with predominantly LC n-3 PUFA, totalling 1.3 g EPA and 2.9 g DHA. WLPO and control group received five 1 g oil capsules per day, containing 2.8 g linoleic acid and 1.4 g oleic acid. n-3 PUFA and placebo; Plus diet – 2200 kJ/day 60 min. light or middle physical activity/day

3 weeks

Hill et al., 2007 [25]

Overweight subjects, Fish oil (FO); FO and exercise (FOX); aged 25–65 y. Sunflower oil (SO; control); SO and exercise (SOX)

12 weeks

Kabir et al., 2007 [24]

27 women with type (1) 3 g/d of either fish oil (contain2 diabetes without ing 1.8 g n-3 PUFAs – 1.08 g hypertriglyceridemia EPA and 0.72 g DHE) (2) placebo (paraffin oil)

2 months

Thorsdottir et al., 2007 [20]

324 men and woman, overweight, aged 20–40 years

(1) control-sunflower oil capsules, no seafood; (2) lean fish – 3–150 g portions of cod/week; (3) fatty fish – 3–150 g portions of salmon/week; (4) fish oil-DHA/EPA capsules, no seafood

8 weeks

Bays et al., 2009 [54]

167 dyslipidemic, overweight/obese patients aged 18 to 79 years.

OM3 4 g/day + fenofibrate 130 mg/day (n = 84) versus PLACEBO (4 g/day of corn oil) + fenofibrate 130 mg/day (n = 83), and an 8-week open-label extension (n = 117), during which all subjects received P-OM3 + fenofibrate. Subjects who received P-OM3 + fenofibrate continued the same treatment in the extension phase (nonswitchers; n = 59). Those who initially received corn oil placebo + fenofibrate received P-OM3 + fenofibrate in the extension phase (switchers; n = 58)

16 weeks

The addition of n-3 PUFA of fish origin to a very low calorie diet results in a greater BMI loss and hip circumference reduction. FO supplementation Both fish oil and exercise independently lowered TG, increased HDL reduced body fat. cholesterol, and improved endotheliumdependent arterial vasodilation. Plasma TG and Body weight were plasma plasminogen unchanged, total fat mass and subcutaneous activator inhibitor-1 were significantly adipocyte diameter significantly reduced in reduced in the fish oil group. the fish oil group. In young, overweight men, the inclusion of either lean or fatty fish, or fish oil as part of a hypoenergetic diet resulted in 1 kg more weight-loss after 4 weeks than did a similar diet without seafood or supplement of marine origin. No effect on body weight or waist circumference noted

(Continued on next page)

Ó 2019 Hogrefe

Int J Vitam Nutr Res (2020), 90 (1–2), 67–83

A. Sujeta et al., Effect of Low-Dose Omega3 and Vitamin D

Table 5. (Continued) Study

Subject characteristics

Omega-3 Source (dose/day)

Duration

Body composition outcomes

Noreen et al., 44 men and women, 4 g/d of Safflower Oil (SO); 4 g/d of 2010 [26] aged 34–45 years. fish oil (FO)

6 weeks

DeFina et al., 2011 [55]

128 overweight and obese individuals, aged 30–60 years.

24 weeks

FO significantly increased lean mass and decreased fat mass. No significant weightreduction benefit was seen with the addition of omega-3 fatty acid supplementation.

Crochemore et al., 2012 [21]

3 groups: GA (2.5 g/d fish oil), GB 41 women (60.64 ± 7.82 years) with high (1.5 g/d fish oil), GC (control) blood pressure and diabetes mellitus

Munro & Garg, 2012 [27]

Obese subjects, aged 18–60

(1) 5 omega-3 capsules/day (3.0 g EPA plus DHA at a 5:1 ratio EPA:DHA) (2) 5 placebo capsules/day

30 days

GB presented a greater frequency of glycemic and total cholesterol reduction, and an increase of highdensity lipoprotein cholesterol compared with GA. There was a significant Both groups reduction in fat mass for experienced the FO group at week 14 improved metabolic profiles but not for PB.

GB presented a greater loss of body mass and waist circumference, compared with GA.

(1) Placebo (PB) – 6 1 g capsules/d of monounsaturated oil; (2) Fish oil (FO) 6 1 g capsules/d of LCn-3PUFA

16 weeks

Harden et al., Overweight and 2014 [22] obese woman

DHA and placebo

12 weeks

Body weight decreased in the DHA group.

Huerta et al., 2015 [23]

(1) (2) (3) (4)

10 weeks

Body weight loss was significantly higher in those groups supplemented with αlipoic acid.

97 overweight and obese woman

Control; EPA (1.3 g/d); α-lipoic acid (0.3 g/d); EPA + α-lipoic acid (1.3 g/d + 0.3 g/d)

level. So, we cannot confirm that elevated vitamin D level affected glucose level. Levels of serum cholesterol are a strong predictor of cardiovascular risk. Observational studies have demonstrated that high levels of vitamin D are associated with a favorable lipid profile, whereas low levels of vitamin D are associated with an atherogenic lipid profile [54]. Our results showed that serum TCh level was significantly reduced in the omega-3 fatty acid group, but omega-3 fatty acids and vitamin D supplement had no effect on other blood lipid parameters for the omega 3 group and placebo group. Supplementation of omega-3 fatty acid improved VO2max outcome and some respiratory function indices compared with the placebo group. Haghravan et al. [55] studied the effect of omega-3 supplementation with lifestyle Int J Vitam Nutr Res (2020), 90 (1–2), 67–83

Other findings

EPA supplementation significantly attenuated the decrease in leptin levels that occurs during weight loss. Body weight loss improved lipid and glucose metabolism parameters but without significant differences between groups.

modification on VO2max in overweight women. They reported that those individuals who followed an aerobic exercise program and received fish oil supplement significantly increased oxygen consumption. Our results agree with their findings, although our participants did not follow a specific aerobic exercise program. There are few reports on the direct effects of omega-3 fatty acid supplementation on physical performance. Brilla et al. [56] reported that those sedentary males who were supplemented with fish oil (4 g/day) for 10 weeks w ith exercise three times a week showed no additional effect on VO2max compared with those who exercised only without fish oil supplementation. It has been reported that fish oil can enhance muscle and maximum oxygen uptake (VO2max), thereby improving endurance performance recovery [57] and cardiovascular Ó 2019 Hogrefe

A. Sujeta et al., Effect of Low-Dose Omega3 and Vitamin D

Table 6. Studies assessing biochemical blood outcome effects of Omega-3 fatty acid by dietary intervention. Study

Subject characteristics

Omega-3 fatty acids Source (dose/day)

Duration

Blood biochemical outcomes Other findings

Borkman et al., 1989 [56]

10 subjects (aged 42–65 yr) with type 2 diabetes

(1) 10 g fish oil concentrate (30% omega 3FAs) daily (2) 10 g safflower oil daily

3 weeks

Woodman et al., 2002 [31]

59 subjects, aged 40–75 y with type 2 diabetes

(1) 4 g EPA/d (2) 4 g DHA/d, (3) olive oil/d – placebo

6 weeks

Ciubotaru et al., 2003 [57]

30 healthy subjects

14 g/day safflower oil (SO); 7 g/day of both safflower oil and fish oil (LFO); 14 g/day fish oil (HFO)

Fasting blood glucose increased 14% during fish oil and 11% during safflower oil supplementation compared with baseline, whereas fasting serum insulin levels, and insulin sensitivity were unchanged Neither EPA nor DHA had significant effects on glycated hemoglobin, fasting insulin or C-peptide. Serum TG in the EPA and DHA groups decreased 19% and 15%. There were no significant changes in serum total, LDL, or HDL cholesterol, although HDL-cholesterol (2) in the EPA and DHA groups increased 16% and 12%. HDL(3) cholesterol decreased 11% (P = 0.026) with EPA supplementation. Plasma (TG) descreased in the HFO compared to the SO group.

Mostad et al., 26 subjects with type 2 Intervention group was 17.6 mL 2006 [37] diabetes without fish oil/d (1.8 g 20:5n_3, 3.0 g hypertriacylglycerolemia 22:6n_3, and 5.9 g total n_3 fatty acids). The control gr. received 17.8 mL corn oil/d (8.5 g 18:2n_6).

Cazzola et al., Healthy young (18–42 2007 [32] years) and older (53–70 years) men.

Placebo or 1.35, 2.7 or 4.05 g EPA/day.

Damsgaard et al., 2008 [35]

(1) 5 mL/d fish oil capsules (FO) (Bio-marine, FFA), mean intake 3.1 g/d (n-3) LCPUFA. (2) 5 ml/d Olive oil (OO) (unrefined extra virgin, TAG) capsules (control). Within each group, they were also allocated to use fats either with a high (S/ B) or a low (R/K) LA content, resulting in a 7.3 g/d higher LA intake in the S/B groups than in the R/K groups.

Ó 2019 Hogrefe

Healthy men (n = 64), aged 19–40.

Body weight were unchanged

Neither EPA nor DHA had significant effects on fasting insulin or C-peptide, insulin sensitivity or secretion, or blood pressure.

CRP decreased and IL-6 compared to SO, with a greater effect in the LFO than HFO groups. 1 week A high intake of fish oil A high intake of fish and 9 wks moderately increases blood oil decreases insulin glucose. sensitivity in persons with type 2 diabetes and alters carbohydrate and fat utilization in a timedependent manner. 12 weeks No effect on on plasma total, LDL or HDL cholesterol. EPA lowered plasma TG, with the max effect at the lowest dose. Neither the FO nor 8 weeks FO lowered fasting plasma TAG by 51% and 19% in the fat intervention affected insulin, FO R/K-group and FO S/Bfibrinogen, Cgroup, respectively. Neither reactive protein, the FO nor fat intervention interleukin-6, affected fasting plasma vascular cell cholesterol, glucose level. adhesion molecule1, P-selectin, oxidized LDL, cluster of differentiation antigen 40 ligand (CD40L), adiponectin, or fasting or postprandial BP or HR after adjustment for body weight changes. (Continued on next page) 5 weeks

Int J Vitam Nutr Res (2020), 90 (1–2), 67–83

A. Sujeta et al., Effect of Low-Dose Omega3 and Vitamin D

Table 6. (Continued) Study

Subject characteristics Omega-3 fatty acids Source (dose/day)

Egert et al., 2009 [33]

74 healthy normolipidemic men and women aged 19–43 y

ALAgroup – 4.4 g/; EPA group – 2.2 g/d EPA; DHA group- 2.3 g/d DHA

Eslick et al., 2009 [29]

47 participants

(1) 3.25 g of EPA and/or DHA daily (2) Placebo

Duration

Blood biochemical outcomes Other findings

6 weeks

ALA,EPA, or DHA intake did not affect fasting serum concentrations of total and LDL cholesterol, but fasting serum TG significantly decreased in the EPA (20.14 mmol/L) and DHA (20.30 mmol/L) and also in the ALA intervention (20.17 mmol/L). DHA intake significantly increased serum HDL cholesterol,whereas no changeswere foundwith ALA or EPAintake. Fish oil supplementation reduced TG ( 0.34 mmol/L), no change in total cholesterol ( 0.01 mmol/L) and very slight increases in HDL (0.01 mmol/L,) and LDL cholesterol (0.06 mmol/L). No significant effect of fish No significant effect oil treatment on TG, LDL-ch. of fish oil treatment on any cardiovascular markers, inflammatory and hemostatic parameters, blood pressure, healthrelated quality of life, or mood. Fasting TG decreased significantly with supplementation relative to placebo. Omega-3 fatty acids had no significant effect on serum lipid levels, ApoA-I, glucose, insulin and HbA1c. Plasma TG reduced in the n-3 PUFA group by 0.14 mmol/l, while TG increased by 0.36 mmol/l in the control group. No significant effect of treatment was found for total cholesterol, HDL or LDLcholesterol or apolipoproteins. HDL decreased to a lesser extent than placebo, suggesting a relative increase.

Poppitt et al., 102 participants, 2009 [30] aged > 45 years.

(1) 3 g/day encapsulated fish oil (containing 1.2 g/day total omega-3 PUFA) (2) Placebo

12 weeks

Shidfar et al., 50 type 2 diabetes 2008 [36] patients

2 g/day purified omega-3 FA or placebo

10 weeks

Thusgaard et al., 2009 [34]

51 participant

(1) n-3 PUFA group – 2 capsules of Omacor twice daily; (2) 2 capsules of placebo

12 weeks

Dawczynski et al., 2010 [58]

51 adults

Both groups received intervention (3 g n-3 LC-PUFA/d) and control dairy products consecutively.

15 weeks

Fakhrzadeh et al., 2010 [59]

124 elderly healthy people, aged > or = 65

(1) intervention group – 1 g/day fish oil capsule (with 180 mg EPA and 120 mg DHA); (2) placebo group

6 months

In the placebo group, serum TG significantly increased and HDL-cholesterol decreased.

(Continued on next page)

Int J Vitam Nutr Res (2020), 90 (1–2), 67–83

Ó 2019 Hogrefe

A. Sujeta et al., Effect of Low-Dose Omega3 and Vitamin D

Table 6. (Continued) Study

Subject characteristics Omega-3 fatty acids Source (dose/day)

Duration

Blood biochemical outcomes Other findings

Dewel et al., 2011 [60]

100 middle-aged adults (1) low-dose flaxseed oil (LFx) (50 ± 10 yrs.) with (Barlean’s Organic Oils) 2.2 g metabolic syndrome ALA/d, 4 capsules/d; (2) high-dose flaxseed oil (HFx) 6.6 g ALA/d, 12 capsules/d; (3) low-dose fish oil (LFO) (Nordic Naturals) 1.2 g EPA + DHA (700 mg EPA and 500 mg DHA)/d, 2 capsule/d; (4) high-dose fish oil (HFO) 3.6 g EPA + DHA (2.1 g EPA and 1.5 g DHA)/d, 6 capsules/d); (5) placebo (P) 4 or 6 g soybean oil/d, 4 or 6 capsules/d.

8 weeks

LDL-cholesterol increased in both fish oil groups compared to both flaxseed oil groups; TG decreased in the HFO group compared to both flaxseed oil groups; group compared to all other groups (P # 0.02).

Maki et al., 2011 [61]

31 adults

Omega-3-acid ethyl esters (POM3, 4 g/day) versus placebo (soy oil).

6 weeks

Skulas-Ray et al., 2011 [15]

26 (23 men and 3 postmenopausal women) 21–65 years age healthy persons with moderate hypertriglyceridemia

0 g EPA + DHA/d (corn oil placebo), 0.85 g EPA + DHA/d, and 3.4 g EPA + DHA/d.

8 weeks

Significant for POM3 were observed for VLDLcholesterol ( 18.8%), TG ( 18.7%), and HDL-C (3.3%). Total cholesterol, non-HDL-C, apolipoproteins A1 and B, and LDL particle concentration responses did not differ between treatments. TG reduced (27%) with the 3.4-g/d dose of EPA + DHA. Total cholesterol, LDLcholesterol, and HDLcholesterol values did not differ significantly by treatment. The lower dose (0.85 g/d) did not alter lipid values, and fasting measures of glucose metabolism were not altered by either dose relative to placebo.

Vargas et al., 51 women, 20–45 y age 3.5 g of total n-3 PUFA daily 2011 [62] with polycystic ovary (essential PUFA from flaxseed oil or syndrome. long-chain PUFA from fish oil) and soybean oil (placebo).

6 weeks

Schirmer et al., 2012 [63]

3 weeks

53 participants

Ó 2019 Hogrefe

4 g n3-FA daily and placebo

There were no significant differences in changes in plasma inflammatory markers among groups in the subset with concentrations. Systolic blood pressure decreased in the HFO group compared to the HFx and P groups; and diastolic blood pressure decreased in the HFO

No effects of 0.85 or 3.4 g EPA + DHA/d on endothelial function, insulin, glucose, or inflammation relative to placebo were observed. Liver enzymes (alanine aminotransferase and aspartate aminotransferase) and body weight (or BMI) were also unchanged. Weight, BMI, fat Fish oil and flaxseed oil mass and waist lowered serum triglyceride (within-group after vs before circumference, fasting glucose, intervention). insulin, adiponectin, leptin, or highsensitivity C-reactive protein did not change with any intervention. n3-FA reduced fasting TG (18%) and postprandial TG (16%), while relative TG increase (192.8 ± 12.7%) was comparable to placebo. (Continued on next page)

Int J Vitam Nutr Res (2020), 90 (1–2), 67–83

A. Sujeta et al., Effect of Low-Dose Omega3 and Vitamin D

Table 6. (Continued) Study

Subject characteristics Omega-3 fatty acids Source (dose/day)

Duration

Blood biochemical outcomes Other findings

Oelrich et al., 42 adults 2013 [64]

4 g/d EPA + DHA

12 weeks

Reduction in serum TG concentrations (mean ± SEM) was 26 ± 4% ( 0.81 ± 10.12 mmol/L);

Haghravan et al., 2016 [47]

(1) received omega 3 supplements (600 mg EPA plus 300 mg DHA), aerobic exercise, and diet education. (2) received placebo capsules, aerobic exercise, and diet education.

8 weeks

–

44 overweigh women aged between 20 to 45 years.

Total LDL-C concentration increased by 13 ± 3% (+0.31 ± 0.08 mmol/ L); Changes in LDL phenotype patterns A, B and A/B were negligible and not statistically significant. Body weight, BMI, body fat percentage, abdominal circumference and abdominal skinfold thickness diminished in omega-3 groups. Omega 3 improved VO2max outcome compared to that of the control group.

Table 7. Studies assessing vitamin D status in countries located in northern latitudes. Study

Subject characteristics

Location

Methods

Vitamin D (nmol/l) mean of range Winter 38

Serum 25(OH)D was measured by RIA in all the women and the first 252 men; a chemiluminescent was used in the last 126 men. 25(OH)D was measured by using automated application of an enzymelinked immunosorbent assay.

50–59 in men, 50–57 in woman.

90 in men and 70 in women.

41.1 in man, 41.2 in woman

61.9 in man, 58.6 in woman

Serum concentrations of 25hydroxyvitamin D (25(OH)D) were analysed by enzyme-immunoassay. Overall mean 25(OH)D concentration throughout the year. 25-(OH) vitamin D (25(OH)D) level and parathyroid hormone (PTH) were measured in summer and in winter.

56.7

78.1

43.7 ± 15

59.3 ± 18

23.4 (winter1), 29.5 (winter-2) in girls and 47.2 (winter-1), and 50.5 (winter-2) in woman

60.3 in girls, 67.3 – in woman

Rockell et al., 2006 [41]

2946 man and woman

New Zealand

RIA Diasorin.

Bolland et al., 2007 [42]

1606 healthy postmenopausal women and 378 older men 7437 participants, 45 y old.

New Zealand

Hill et al., 2008 [44]

1015 of 12 and 15 year-old boys and girls

Northern Ireland

Kull et al., 2009 [45]

367 individuals (200 women and 167 men) mean age 48.9 ± 12.2 years 54 girls (11–13 years) and 52 women (70–75 years).

Estonia

Hypponen et al., 2007 [43]

Andersen et al., 2013 [46]

Great Britain

Denmark

The participants were examined three times (February–March 2002 (winter-1), August–September 2002 (summer) and February–March 2003 (winter-2).

risk factors in athletes [58, 59]. A study of 16 well-trained male cyclists indicated that fish oil supplementation may act within the healthy heart and skeletal muscle to reduce Int J Vitam Nutr Res (2020), 90 (1–2), 67–83

Summer

both whole-body and myocardial O2 demand during exercise, without a decrement in performance [60]. There is some evidence that omega-3 fatty acid can modestly Ó 2019 Hogrefe

A. Sujeta et al., Effect of Low-Dose Omega3 and Vitamin D

enhance lipolysis and β-oxidation during exercise and thereby improve fat loss [61]. There is also some evidence that omega-3 supplementation may help to improve various aspects of exercise performance. However, limitations in study design make it difficult to draw firm conclusions on these topics [61]. The limitation of our study is body composition analysis. We should also have used anthropometric circumference (waist and hip circumference measurement) for better demonstration of changed body fat. Future studies may include more anthropometric measurements, diet, physical activity status evaluations during the research.

Conclusion The daily supplementation of 330 mg of omega-3 fatty acid for 16 weeks is lower than the 500 mg of omega-3 fatty acid dose recommended by the International Society for the Study of Fatty Acids and Lipids [42] and the European Food Safety Authority [43] to maintain good health. Our findings indicate that while there was a positive impact on total cholesterol level and glucose level, there was no effect on glucose, LDL, HDL, or TG levels. The daily dose of 330 mg can therefore be seen as insufficient.

References 1. Geleijnse, J.M., Giltay, E.J., Grobbee, D.E., Donders, A.R., & Kok, F.J. (2002) Blood pressure response to fish oil supplementation: metaregression analysis of randomized trials. J Hypertens. 20, 1493–1499. 2. Skeaff, C.M., & Miller, J. (2009) Dietary fat and coronary heart disease: summary of evidence from prospective cohort and randomised controlled trials. Ann Nutr Metab. 55, 173–201. 3. Christensen, J.H., Gustenhoff, P., Korup, E., Aarøe, J., Toft, E., Møller, J.M., Rasmussen, K., Dyerberg, J., & Schmidt, E.B. (1997) n-3 polyunsaturated fatty acids, heart rate variability and ventricular arrhythmias in post-AMI-patients. A clinical controlled trial. Ugeskr Laeger. 159, 5525–5529. 4. Ottestad, I., Hassani, S., Borge, G.I., Kohler, A., Vogt, G., Hyötyläinen, T., Orešič, M., Brønner, K.W., Holven, K.B., Ulven, S.M., & Myhrstad, M.C. (2012) Fish oil supplementation alters the plasma lipidomic profile and increases long-chain PUFAs of phospholipids and triglycerides in healthy subjects. PLoS One. 7(8), e42550. doi: 10.1371/journal.pone.0042550 5. Dangardt, F., Osika, W., Chen, Y., Nilsson, U., Gan, L.M., Gronowitz, E., Strandvik, B., & Friberg, P. (2010) Omega-3 fatty acid supplementation improves vascular function and reduces inflammation in obese adolescents. Atherosclerosis. 212, 580–5. 6. Olendzki, B.C., Leung, K., Van Buskirk, S., Reed, G., & Zurier, R. B. (2011) Treatment of rheumatoid arthritis with marine and botanical oils: influence on serum lipids. Evid Based Complement Alternat Med. 2011, 827286. doi: 10.1155/2011/ 827286 7. Lembke, P., Capodice, J., Hebert, K., & Swenson, T. (2014) Influence of omega-3 (n3) index on performance and wellbeing

Ó 2019 Hogrefe

10.

11.

12.

13.

14.

15.

16.

17.

18.

19.

20.

21.

22.

in young adults after heavy eccentric exercise. J Sports Sci Med. 13, 151–6. Gopinath, B., Buyken, A.E., Flood, V.M., Empson, M., Rochtchina, E., & Mitchell, P. (2011) Consumption of polyunsaturated fatty acids, fish, and nuts and risk of inflammatory disease mortality. Am J Clin Nutr. 93, 1073–1079. Huang, J., Frohlich, J., & Ignaszewski, A.P. (2011) The impact of dietary changes and dietary supplements on lipid profile. Can J Cardiol. 27, 488–505. McManus, R.M., Jumpson, J., Finegood, D.T., Clandinin, M.T., & Ryan, E.A. (1996) A comparison of the effects of n-3 fatty acids from linseed oil and fish oil in well-controlled type II diabetes. Diabetes Care. 19, 463–7. Muldoon, M.F., Erickson, K.I., Goodpaster, B.H., Jakicic, J.M., Conklin, S.M., Sekikawa, A., Yao, J.K., & Manuck, S.B. (2013) Concurrent physical activity modifies the association between n3 long-chain fatty acids and cardiometabolic risk in midlife adults. J Nutr. 143, 1414–20. Vega-López, S., Kaul, N., Devaraj, S., Cai, R.Y., German, B., & Jialal, I. (2004) Supplementation with omega3 polyunsaturated fatty acids and all-rac alpha-tocopherol alone and in combination failed to exert an anti-inflammatory effect in human volunteers. Metabolism. 53, 236–40. Skulas-Ray, A.C., Kris-Etherton, P.M., Harris, W.S., Vanden Heuvel, J.P., Wagner, P.R., & West, S.G. (2011) Dose-response effects of omega-3 fatty acids on triglycerides, inflammation, and endothelial function in healthy persons with moderate hypertriglyceridemia. Am J Clin Nutr. 93, 243–52. Hayati, M.Y., Cawood, A.L., Ding, R., Williams, J.A., Napper, F. L., Shearman, C.P., Grimble, R.F., Payne, S.P., & Calder, P.C. (2013) Limited Impact of 2 g/day Omega-3 Fatty Acid Ethyl Esters (OmacorÒ) on Plasma Lipids and Inflammatory Markers in Patients Awaiting Carotid Endarterectomy. Mar Drugs. 11, 3569–3581. Leslie, M.A., Cohen, D.J.A., Liddle, D.M., Robinson, L.E., & Ma, D.W.L. (2015) A review of the effect of omega-3 polyunsaturated fatty acids on blood triacylglycerol levels in normolipidemic and borderline hyperlipidemic individuals. Lipids Health Dis. 14, 53. doi: 10.1186/s12944-015-0049-7 Kris-Etherton, P. M., Harris, W.S., & Appel, L.J. (2002) Fish Consumption, Fish Oil, Omega-3 Fatty Acids, and Cardiovascular Disease. Circulation. 106, 2747–2757. Bailey, R.L., Gahche, J.J, Miller, P.E., Thomas, P.R., & Dwyer, J. T. (2013) Why US adults use dietary supplements. JAMA Intern Med. 173(5), 355–61. Parker, J., Hashmi, O., Dutton, D., Mavrodaris, A., Stranges, S., Kandala, N.B., Clarke, A., & Franco, O.H. (2010) Levels of vitamin D and cardiometabolic disorders: systematic review and meta-analysis. Maturitas. 65, 225–36. Zittermann, A., Schleithoff, S.S., & Koerfer, R. (2005) Putting cardiovascular disease and vitamin D insufficiency into perspective. Br J Nutr. 94(4), 483–492. doi: 10.1079/ BJN20051544 Jorde, R., & Grimnes, G. (2011) Vitamin D and metabolic health with special reference to the effect of vitamin D on serum lipids. Prog Lipid Res. 50(4), 303–312. doi: 10.1016/ j.plipres.2011.05.001 Zittermann, A., Frisch, S., Berthold, H.K., Götting, C., Kuhn, J., Kleesiek, K., Stehle, P., Koertke, H., & Koerfer, R. (2009) Vitamin D supplementation enhances the beneficial effects of weight loss on cardiovascular disease risk markers. Am J Clin Nutr. 89, 1321–7. Kunesova, M., Braunerova, R., Hlavaty, P., Tvrzicka, E., Stankova, B., Skrha, J., Hilgertova, J., Hill, M., Kopecky, J., Wagenknecht, J., Hainer, V., Matoulek, M., Parízkovaa, J., Zak, A., & Svacina, S. (2006) The influence of n-3 polyunsaturated

Int J Vitam Nutr Res (2020), 90 (1–2), 67–83

23.

24.

25.

26.

27.

28.

29.

30.

31.

32. 33.

34.

35.

36.

A. Sujeta et al., Effect of Low-Dose Omega3 and Vitamin D

fatty acids and very low calorie diet during a short-term weight reducing regimen on weight loss and serum fatty acid composition in severely obese women. Physiol Res. 55, 63–72. Krebs, J.D., Browning, L.M., McLean, N.K., Rothwell, J.L., Mishra, G.D., Moore, C.S., & Jebb, S.A. (2006) Additive benefits of long-chain n-3 polyunsaturated fatty acids and weight-loss in the management of cardiovascular disease risk in overweight hyperinsulinaemic women. Int J Obes (Lond). 30, 1535–1544. Thorsdottir, I., Tomasson, H., Gunnarsdottir, I., Gisladottir, E., Kiely, M., Parra, M.D., Bandarra, N.M., Schaafsma, G., & Martinéz, J.A. (2007) Randomized trial of weight-loss-diets for young adults varying in fish and fish oil content. Int J Obes (Lond). 31, 1560–1566. Crochemore, I.C., Souza, A.F., de Souza, A.C., & Rosado, E.L. (2012) w-3 polyunsaturated fatty acid supplementation does not influence body composition, insulin resistance, and lipemia in women with type 2 diabetes and obesity. Nutr Clin Pract. 27, 553–60. Harden, C.J., Dible, V.A., Russell, J.M., Garaiova, I., Plummer, S.F., Barker, M.E., & Corfe, B.M. (2014) Long-chain polyunsaturated fatty acid supplementation had no effect on body weight but reduced energy intake in overweight and obese women. Nutr Res. 34, 17–24. Huerta, A.E., Navas-Carretero, S., Prieto-Hontoria, P.L., Martínez, J.A., & Moreno-Aliaga, M.J. (2015) Effects of alipoic acid and eicosapentaenoic acid in overweight and obese women during weight loss. Obesity (Silver Spring). 23, 313–21. Kabir, M., Skurnik, G., Naour, N., Pechtner, V., Meugnier, E., Rome, S., Quignard-Boulange, A., Vidal, H., Slama, G., Clement, K., Guerre-Millo, M., & Rizkalla, S.W. (2007) Treatment for 2 mo with n_3 polyunsaturated fatty acids reduces adiposity and some atherogenic factors but does not improve insulin sensitivity in Hill, A.M., Buckley, J.D., Murphy, K.J., & How, P. (2007) Combining fish-oil supplements with regular aerobic exercise improves body composition and cardiovascular disease risk factors. Am J Clin Nutr. 85, 1267–74. Noreen, E.E., Sass, M.J., Crowe, M.L., Pabon, V.A., Brandauer, J., & Averill, L.K. (2010) Effects of supplemental fish oil on resting metabolic rate, body composition, and salivary cortisol in healthy adults. J Int Soc Sports Nutr. 7, 31. doi: 10.1186/ 1550-2783-7-31 Munro, I.A., & Garg, M.L. (2012) Dietary supplementation with n-3 PUFA does not promote weight loss when combined with a very-low-energy diet. Br J Nutr. 108, 1466–74. Brinson, B.E., & Miller, S. (2012) Fish Oil What is the Role in Cardiovascular Health? J Pharm Pract. 25, 69–74. Eslick, G.D., Howe, P.R., Smith, C., Priest, R., & Bensoussan, A. (2009) Benefits of fish oil supplementation in hyperlipidemia: a systematic review and meta-analysis. Int J Cardiol. 136, 4–16. Poppitt, S.D., Howe, C.A., Lithander, F.E., Silvers, K.M., Lin, R. B., Croft, J., Ratnasabapathy, Y., Gibson, R.A., & Anderson, C. S. (2009) Effects of moderate-dose omega-3 fish oil on cardiovascular risk factors and mood after ischemic stroke: a randomized, controlledtrial. Stroke. 40, 3485–92. Woodman, R.J., Mori, T.A., Burke, V., Puddey, I.B., Watts, G.F., & Beilin, L.J. (2002) Effects of purified eicosapentaenoic and docosahexaenoic acids on glycemic control, blood pressure, and serum lipids in type 2 diabetic patients with treated hypertension. Am J Clin Nutr. 76, 1007–15. Cazzola, R., Russo-Volpe, S., Miles, E.A., Rees, D., Banerjee, T., Roynette, C.E., Wells, S.J., Goua, M., Wahle, K.W., Calder, P. C., & Cestaro, B. (2007) Age- and dose-dependent effects of an eicosapentaenoic acid-rich oil on cardiovascular risk

Int J Vitam Nutr Res (2020), 90 (1–2), 67–83

37.

38.

39.

40.

41.

42.

43.

44.

45.

46.

47.

48.

49.

50.

factors in healthy male subjects. Atherosclerosis. 193, 159– 67. Egert, S., Kannenberg, F., Somoza, V., Erbersdobler, H.F., & Wahrburg, U. (2009) Dietary a-Linolenic Acid, EPA, and DHA Have Differential Effects on LDL Fatty Acid Composition but Similar Effects on Serum Lipid Profiles in Normolipidemic Humans. J Nutr. 139, 861–868. Thusgaard, M., Christensen, J.H., Mørn, B., Andersen, T.S., Vige, R., Arildsen, H., Schmidt, E.B., & Nielsen, H. (2009) Effect of fish oil (n-3 polyunsaturated fatty acids) on plasma lipids, lipoproteins and inflammatory markers in HIV-infected patients treated with antiretroviral therapy: a randomized, double-blind, placebo-controlled study. Scand J Infect Dis. 41, 760–6. Damsgaard, C.T., Frøkiær, H., Andersen, A.D., & Lauritzen, L. (2008) Fish Oil in Combination with High or Low Intakes of Linoleic Acid Lowers PlasmaTriacylglycerols but Does Not Affect Other Cardiovascular Risk Markers in Healthy Men. J Nutr. 138, 1061–1066. Shidfar, F., Keshavarz, A., Hosseyni, S., Ameri, A., & Yarahmadi, S. (2008) Effects of omega-3 fatty acid supplements on serum lipids, apolipoproteins and malondialdehyde in type 2 diabetes patients. East Mediterr Health J. 14, 305–13. Mostad, I.L., Bjerve, K.S., Bjorgaas, M.R., Lydersen, S., & Grill, V. (2006) Effects of n_3 fatty acids in subjects with type 2 diabetes: reduction of insulin sensitivity and time-dependent alteration from carbohydrate to fat oxidation. Am J Clin Nutr. 84, 540–50. International Society for the Study of Fatty Acids and Lipid. (2004) Report of the sub-committee on recommendations for intake of polyunsaturated fatty acids in healthy adults. Available at: http://www.issfal.org/newslinks/resources/ publications/PUFAIntakeReccomdFinalReport.pdf Bresson, J.L., Flynn, A., Heinonen, M., Hulshof, K., Korhonen, H., Lagiou, P., et al. (2009) European Food Safety Authority. Scientific Opinion: Labelling reference intake values for n-3 and n-6 polyunsaturated fatty acids. The EFSA Journal. 1176, 1–11. Ono, Y., Suzuki, A., Kotake, M., Zhang, X., Nishiwaki-Yasuda, K., Ishiwata, Y., et al. (2005) Seasonal changes of serum 25hydroxyvitamin D and intact parathyroid hormone levels in a normal Japanese population. Bone Miner Metab. 23, 147– 151. doi: 10.1007/s00774-004-0553-8 Rockell, J.E., Skeaff, C.M., Williams, S.M., & Green, T.J. (2006) Serum 25-hydroxyvitamin D concentrations of New Zealanders aged 15 years and older. Osteoporos Int. 17(9), 1382–9. Bolland, M.J., Grey, A.B., Ames, R.W., Mason, B.H., Horne, A. M., Gamble, G.D., & Reid, R. (2007) The effects of seasonal variation of 25-hydroxyvitamin D and fat mass on a diagnosis of vitamin D sufficiency1_3. Am J Clin Nutr. 86, 959–64. Hypponen, E., & Power, C. (2007) Hypovitaminosis D in British adults at age 45 y: nationwide cohort study of dietary and lifestyle predictors. Am J Clin Nutr. 85(3), 860–8. Hill, T.R., Cotter, A.A., Mitchell, S., Boreham, C.A., Dubitzky, W., Murray, L., Strain, J.J., Flynn, A., Robson, P.J., Wallace, J.M., Kiely, M., & Cashman, K.D. (2008) Vitamin D status and its determinants in adolescents from the Northern Ireland Young Hearts 2000 cohort. Br J Nutr. 99(5), 1061–7. doi: 10.1017/ S0007114507842826 Kull, M., Kallikorm, R., Tamm, A., & Lember, M. (2009) Seasonal variance of 25-(OH) vitamin D in the general population of Estonia, a Northern European country. BMC Public Health. 9, 22. doi: 10.1186/1471-2458-9-22 Andersen, R., Brot, C., Jakobsen, J., Mejborn, H., Mølgaard, C., Skovgaard, L.T., Trolle, E., Tetens, I., & Ovesen, L. (2013) Seasonal changes in vitamin D status among Danish

Ó 2019 Hogrefe

A. Sujeta et al., Effect of Low-Dose Omega3 and Vitamin D

51.

52.

53.

54.

55.

56.

57.

58.

59.

60.

61.

62.

63.

64.

adolescent girls and elderly women: the influence of sun exposure and vitamin D intake. European Journal of Clinical Nutrition. 67, 270–274. Gupta, A.K., Brashear, M.M., & Johnson, W.D. (2011) Prediabetes and Prehypertension in healthy adults are associated with low vitamin D levels. Diabetes Care. 34(3), 658–660. Pittas, A.G., Sun, Q., Manson, J.E., & Dawson-Hughes, B. (2010) Hu FB Plasma 25-hydroxyvitamin D concentration and risk of incident type 2 diabetes in women. Diabetes Care. 33 (9), 2021–2023. Robinson, J.G., Manson, J.E., Larson, J., Liu, S., Song, Y., Howard, B.V., et al. (2011) Lack of association between 25 (OH)D levels and incident type 2 diabetes in older women. Diabetes Care. 34(3), 628–634. Wang, H., Xia, N., Yang, Y., & Peng, D. (2012) Influence of vitamin D supplementation on plasma lipid profiles: a metaanalysis of randomized controlled trials. Lipids Health Dis. 11, 42. Haghravan, S., Keshavarz, S.A., Mazaheri, R., Alizadeh, Z., & Mansournia, M.A. (2016) Effect of Omega-3 PUFAs Supplementation with Lifestyle Modification on Anthropometric Indices and Vo2 max in Overweight Women. Arch Iran Med. 19, 342–7. Brilla, L.R., & Landerholm, T.E. (1990) Effect of fish oil supplementation and exercise on serum lipids and aerobic fitness. J Sports Med Phys Fitness. 30(2), 173–80. Macaluso, F., Barone, R., Catanese, P., Carini, F, Rizzuto, L., Farina, F., & Di Felice, V. (2013) Do fat supplements increase physical performance? Nutrients. 5, 509–524. Huffman, D.M., Altena, T.S., Mawhinney, T.P., & Thomas, T.R. (2004) Effect of n-3 fatty acids on free tryptophan and exercise fatigue. European Journal of Applied Physiology. 92, 584–591. Buckley, J.D., Burgess, S., Murphy, K.J., & Howe, P.R. (2009) DHA-rich fish oil lowers heart rate during submaximal exercise in elite Australian Rules footballers. Journal of Science and Medicine in Sport. 12, 503–507. Peoples, G.E., McLennan, P.L., Howe, P.R., & Groeller, H. (2008) Fish oil reduces heart rate and oxygen consumption during exercise. J Cardiovasc Pharmacol. 52, 540–547. Tiryaki-Sönmez, G., Schoenfeld, B., & Vatansever-Ozen, S. (2011) Omega-3 fatty acids and exercise: a review of their combined effects on body composition and physical performance. Biomedical Human Kinetics. 3, 23–29. doi: 10.2478/v10101-011-0007-4 Bays, H.E., Maki, K.C., Doyle, R.T., & Stein, E. (2009) The effect of prescription omega-3 fatty acids on body weight after 8 to 16 weeks of treatment for very high triglyceride levels. Postgrad Med. 121, 145–50. DeFina, L.F., Marcoux, L.G., Devers, S.M., Cleaver, J.P., & Willis, B.L. (2011) Effects of omega-3 supplementation in combination with diet and exercise on weight loss and body composition. Am J Clin Nutr. 93, 455–62. Borkman, M., Chisholm, D.J., Furler, SM., Storlien, L.H., Kraegen, E.W., Simons, L.A., & Chesterman, C.N. (1989) Effects of fish oil supplementation on glucose and lipid metabolism in NIDDM. Diabetes. 38, 1314–9.

Ó 2019 Hogrefe

65. Ciubotaru, I., Lee, Y.S., & Wander, R.C. (2003) Dietary fish oil decreases C-reactive protein, interleukin-6, and triacylglycerol to HDL-cholesterol ratio in postmenopausal women on HRT. J Nutr Biochem. 14, 513–21. 66. Dawczynski, C., Martin, L., Wagner, A., & Jahreis, G. (2010) n-3 LC-PUFA-enriched dairy products are able to reduce cardiovascular risk factors: a double-blind, cross-over study. Clin Nutr. 29, 592–9. 67. Fakhrzadeh, H., Ghaderpanahi, M., Sharifi, F., Mirarefin, M., Badamchizade, Z., Kamrani, A.A., & Larijani, B. (2010) The effects of low dose n-3 fatty acids on serum lipid profiles and insulin resistance of the elderly: a randomized controlled clinical trial. Int J Vitam Nutr Res. 80, 107–16. 68. Dewell, A., Marvasti, F.F., Harris, W.S., Tsao, P., & Gardner, C. D. (2011) Low- and High-Dose Plant and Marine (n-3) Fatty Acids Do Not Affect Plasma Inflammatory Markers in Adults with Metabolic Syndrome. J Nutr. 141, 2166–2171. 69. Maki, K.C., Lawless, A.L., Kelley, K.M., Dicklin, M.R., Kaden, V. N., Schild, A.L., Rains, T.M., & Marshall, J.W. (2011) Effects of prescription omega-3-acid ethyl esters on fasting lipid profile in subjects with primary hypercholesterolemia. J Cardiovasc Pharmacol. 57, 489–94. 70. Vargas, M.L., Almario, R.U., Buchan, W., Kim, K., & Karakas, S. E. (2011) Metabolic and endocrine effects of long-chain versus essential omega-3 polyunsaturated fatty acids in polycystic ovary syndrome. Metabolism. 60, 1711–8. 71. Schirmer, S.H., Werner, C.M., Binder, S.B., Faas, M.E., Custodis, F., Böhm, M., & Laufs, U. (2012) Effects of omega3 fatty acids on postprandial triglycerides and monocyte activation. Atherosclerosis. 225, 166–72. 72. Oelrich, B., Dewell, A., & Gardner, C.D. (2013) Effect of fish oil supplementation on serum triglycerides, LDL cholesterol and LDL subfractions in hypertriglyceridemic adults. Nutr Metab Cardiovasc Dis. 23, 350–7.

Acknowledgments AS, EK, LS, AS, MB, and DV designed the experiments. SC, AS, and DV performed the experiments. SC, LS, and AS performed the statistical analyses. SC, EK, and AS wrote the manuscript. All the authors read and approved the final manuscript. We are thankful the company Pharmatech AS Product, Vallehellene 4, 1664 Rolvsoy, Norway, that supplied the commercial product OmegaMarine Forte + Customer: Natural Pharmaceuticals Sp.z o.o. and provided finnancial supprot along all the study: biochemical analysis were financed by this company. Conflict of Interests The authors declare that they have no competing interests.

Sandrija Capkauskiene Department of Applied Biology and Rehabilitation Lithuanian Sports University, Kaunas, Lithuania sandrija.capkauskiene@lsu.lt

Int J Vitam Nutr Res (2020), 90 (1–2), 67–83

Original Communication

Vitamin C improves liver and renal functions in hypothyroid rats by reducing tissue oxidative injury Mahdi Esmaeilizadeh1, Mahmoud Hosseini2, Farimah Beheshti3,4, Vajihe Alikhani5,6, Zakieh Keshavarzi7, Mohsen Shoja1, Mozhgan Mansoorian5, and Hamid Reza Sadeghnia8 1

Student Research Committee, Esfarayen Faculty of Medical Sciences, Esfarayen, Iran

Division of Neurocognitive Sciences, Psychiatry and Behavioral Sciences Research Center, Mashhad University of Medical Sciences, Mashhad, Iran

Neuroscience Research Center, Torbat Heydariyeh University of Medical Sciences, Torbat Heydariyeh, Iran

Neurogenic Inflammation Research Center, Faculty of Medicine, Mashhad University of Medical Sciences, Mashhad, Iran

Student Research Committee, Faculty of Medicine, Mashhad University of Medical Sciences, Mashhad, Iran

6 7

Department of Physiology, Faculty of Medicine, Mashhad University of Medical Sciences, Mashhad, Iran Natural Products and Medicinal Plants Research Center, North Khorasan University of Medical Sciences, Bojnurd, Iran

Pharmacological Research Center of Medicinal Plants, Faculty of Medicine, Mashhad University of Medical Sciences, Mashhad, Iran

Received: February 1, 2017; Accepted: August 21, 2017 Abstract: Background: The effects of Vit C on liver and renal function and the tissues oxidative damage was investigated in hypothyroid rats. Materials and methods: The pregnant rats were divided into 5 groups (n=6): (1) Control; (2) Propylthiouracil (PTU; 0.005%), (3–5) PTU plus 10, 100 or 500 mg/kg b.w. Vit C. The drugs were added to the drinking water of the dams and their pups during lactation period and then continued for the offspring through the ﬁrst 8 weeks of their life. Finally, 7 male offspring from each group were randomly selected.Results: Thyroxine, protein and albumin concentrations in the serum and thiol content and superoxide dismutase (SOD) and catalase (CAT) activities in renal and liver tissues of hypothyroid group was lower (all P<0.001) while, aspartate aminotransferase (AST), alanine aminotransferase (ALT), alkaline phosphatase (ALK-P), creatinine and blood urea nitrogen (BUN) concentrations in the serum and malondialdehyde (MDA) in the liver and renal tissues were higher than the control (all P<0.001). All doses of Vit C increased thyroxine, protein and albumin and thiol content in in renal and liver tissues while, decreased AST, ALT and ALK-P concentration and MDA in liver and renal tissues compared to PTU group (P<0.05–P<0.001). Creatinine, BUN and SOD and CAT were improved by both 100 and 500 mg/kg of Vit C in the renal (P<0.05–P<0.001) and by 100 mg/kg in the liver (P<0.05–P<0.001).Conclusion: Vit C improved liver and renal function of hypothyroid rats which might be due to its protective effects against tissues oxidative damage. Keywords: Vitamin C, hypothyroidism, liver, renal function, oxidative stress

Introduction A change in thyroid function has been reported in patients with various spectra of liver diseases [1]. Also, thyroid dysfunction has been suggested to occur in patients with chronic kidney disease (CKD) [2]. Thyroid hormones are suggested to be able to crucially regulate physiological actions of the kidneys including glomerular filtration rate (GFR), renal blood flow and secretion and re-absorption of the molecules [3–6]. Some hemodynamic changes such as hyponatremia and a diminished level of renal blood and plasma stream are suggested to be accompanied with Int J Vitam Nutr Res (2020), 90 (1–2), 84–94 https://doi.org/10.1024/0300-9831/a000495

hypothyroidism status, which may affect renal capacity and diminish the GFR [7]. It is reported that thyroid hormones have antioxidant properties [8]. Moreover, an oxidative stress status has been reported to occur in hypothyroidism [9]. A significant modulation of various aspects of reactive oxygen species (ROS) metabolism [10] and antioxidant defenses in the liver by experimentally induced hypo- and hyperthyroidism has been suggested [11]. Also, hypothyroidism has been shown, which correlates with cirrhosis [12]. An abnormal thyroid hormone status is frequently linked to hepatic lipid homeostasis changes [13]. Other previous reports by Ó 2019 Hogrefe

M. Esmaeilizadeh et al., Vitamin C on liver and renal functions of hypothyroid rats

Korshunov et al. (1997) and Baskol et al. (2007) exhibited that hypothyroidism may induce ROS production [14, 15]. Also, it has been reported that oxidative stress in thyroid disorders has a correlation with CKD [16]. Propylthiouracil (PTU) is one of the most common drugs to treat hyperthyroidism [17]. However, liver tissues injury after administration of PTU has been reported [18]. Also, after adding PTU to drinking water of animals, alanine aminotransferase (ALT) [19] and aspartate aminotransferase (AST) values have been reported to be higher compared to the control [20]. An increased level of ALT and total bilirubin in the serum of PTU treated patients has also been reported [21]. Furthermore, histological analysis has revealed a hepatotoxicity status in PTU treated animals [22]. Administration of PTU has also been able to increase lipid peroxidation in the studied organs with a parallel decrease in antioxidants such as superoxide (SOD) and catalase (CAT) [23, 24]. Normal level of thyroid hormones has been well known to be vital for development of many organs [25]. Drugs that disrupt thyroid hormones during pregnancy may have an adverse effect on normal development [26]. Hypothyroidism during fetal or postnatal periods can lead to functional abnormalities in children [27]. In one study, it has been shown that hypothyroxinemia during pregnancy might be followed by liver function disorders in dams and offspring [28]. In this context, exposure to anti-thyroid drugs such as methimazole during fetal and neonatal periods of life induces a congenital neonatal hypothyroidism and influences the pattern of genes that are under the control of thyroid hormones during rat development [10]. In addition, disturbances in endocrine status during the neonatal period of life may affect the susceptibility to chronic diseases or biological insults in adulthood [29]. Researchers showed that even a transient neonatal hypothyroidism influences the transcriptional program of genes involved in lipid metabolism in the liver accompanying with a decreased level of the liver weight [30]. Vitamin (Vit) C is a naturally-occurring water-soluble antioxidant present in cells, body fluids, and plasma [31]. In addition to acting as a ROS scavenger [32], Vit C plays a role as an essential coenzyme in the oxidative stress pathways; also, interactions have been demonstrated between Vit C and proline hydroxylase, lysine hydroxylase, 4-hydroxy phenyl pyruvate dioxygenase, dopaminehydroxylase, tryptophan hydroxylase, and γ-butyrobetaine hydroxylase [33]. Fipronil is a member of the phenylpyrazole class of pesticides, which is being extensively used in the agriculture and veterinary medicine [34]. Besides an increased level in antioxidant enzymes activities, Vit C has been able to prevent an increased level of lipid peroxidation induced by a high dose of fipronil [35]. Treatment

Ó 2019 Hogrefe

with Vit C in methylmercury-exposed animals has led to a significant decrease in malondialdehyde (MDA) concentration and hepatic enzyme activities as well as a significant increase in the levels of glutathione (GSH) and total antioxidant capacity [36]. The objective of this study was to investigate the effects of administration of Vit C during neonatal and juvenile growth on liver and renal function in PTU-induced hypothyroid rats. Protective effects against tissues oxidative damage were also investigated as a possible mechanism.

Materials and methods Drugs PTU was purchased from the Sigma (Sigma Aldrich Chemical Co. St. Louis, MO). Other compounds, which were used for biochemical assessments, were purchased from the Merck Company (Darmstadt, Germany).

Animals and treatments Thirty pregnant Wistar rats (12 weeks old and weighing 220–250 g) were purchased from the animal center of the Mashhad University of Medical Sciences, Mashhad, Iran, and kept in separate cages at 22 ± 2 °C in a room with a 12-hour light/dark cycle (lights on at 7:00 AM). Animal handling and all related procedures were carried out in accordance with the rules set by the Ethical Committee of the Mashhad University of Medical Sciences. After delivery, the mothers and their pups were randomly divided into five groups (n=6) and treated: (1) the Control group that received normal drinking water; (2) the Hypothyroid (Hypo) group that received PTU (0.005%, W/V) in their drinking water to develop hypotyhroidism; and (3–5) three groups including Hypo-Vit C 10, Hypo-Vit C 100 and Hypo-Vit C 500, which, besides PTU, received 10, 100 or 500 mg/kg Vit C [37–39]. During lactation period, the treatments were added to the drinking water of the mothers and their offspring. After lactation period, male offspring rats continued to receive the mentioned treatment through the ﬁrst 8 weeks of their life. The offspring of each group was pooled and 7 male rats were randomly selected from each group.

Biochemical assessment The animals were deeply anaesthetized using a high dose of urethane and the blood samples were collected to use for thyroxine assessment, renal function parameters and liver function tests. The rats were then sacrificed and the liver

Int J Vitam Nutr Res (2020), 90 (1–2), 84–94

M. Esmaeilizadeh et al., Vitamin C on liver and renal functions of hypothyroid rats

and renal tissues were removed to analyze for MDA concentration, total thiol (SH) content, SOD and CAT [23]. The samples were stored in a freezer ( 80 °C) until further use.

Liver and renal function tests The serum samples were analyzed for creatinine and blood urea nitrogen (BUN) using commercial kits (Pars Azmoon Company, Tehran, Iran). AST, ALT, alkaline phosphatase (ALK-P), total protein and albumin were also measured by an automatic analyzer (Hitachi 902) using the kits and based on the manufacturer’s instructions.

Liver and renal tissues oxidative damage criteria MDA reacts with thiobarbituric acid (TBA) as a thiobarbituric acid reactive substance (TBARS) to produce a red color. In brief, 2 ml of TBA/trichloroacetic acid (TCA)/ hydrochloricacid (HCL) reagent were added to 1 ml of tissue homogenates and the solution was incubated in a boiling water bath for 40 min. After cooling, the whole solution was centrifuged (1000 g for 10 min). The absorbance of the supernatant was measured at 535 nm. The MDA concentration was calculated using a formula, which has been previously described [40, 41]. Total thiol content was measured using DTNB (2, 2’dinitro- 5, 5’-dithiodibenzoic acid), which reacts with the SH groups to produce a yellow color [42]. Briefly, 1 ml of tris-(ethylenediaminetetraacetic acid) EDTA buffer was added to 50 μl of the tissue homogenates and the absorbance was read at 412 nm against Tris-EDTA buffer. Then, 20 μl of DTNB reagent (10 mM) were added to the mixture and after 15 min incubation at room temperature, the absorbance was again read. The absorbance of the DTNB reagent was also read as a blank. Total thiol concentration was calculated based on an equation previously described [40, 41]. SOD activity was measured using a method described by Madesh and Balasu Bramanian [43]. A colorimetric assay involving the generation of superoxide by pyrogallol autooxidation and inhibition of superoxide-dependent decrease of the tetrazolium dye, MTT (3-(4, 5-dimethylthiazol-2-yl) 2, 5-diphenyltetrazolium bromide) to its formazan by SOD was measured at 570 nm. One unit of the SOD activity was characterized as the amount of enzyme causing 50% inhibition in the MTT reduction rate. CAT activity was estimated using a method described by Aebi [44]. The principle of the assay is based on the determination of the rate constant, k, (dimension: s 1, k) of hydrogen peroxide decomposition. By measuring the decrease in absorbance at 240 nm/min, the rate constant

Int J Vitam Nutr Res (2020), 90 (1–2), 84–94

Figure 1. The effect of Vit C on thyroxine levels in PTU-induced hypothyroidism. Data are presented as mean±SEM (n=7 in each group). ***P<0.001 compared to the control group, +++P<0.001 compared to the Hypo group, $$P<0.01 compared to the Hypo- Vit C 10 group, &&&P<0.001 compared to the Hypo-Vit C 100 group. Hypo: Hypothyroidism, Vit C 10: Vit C 10 mg/kg, Vit C 100: Vit C 100 mg/kg and Vit C 500: Vit C 500 mg/kg.

of the enzyme was measured. Activities were expressed as k (rate constant) per liter.

Statistical analysis All data were expressed as mean ± SEM. The normality of the data was tested using the Kolmogorov-Smirnov test. Differences in variance were tested using the Levene’s test. All the data were compared by one-way ANOVA followed by Tukey’s post hoc comparisons test. Differences were considered statistically significant when p<0.05.

Results Serum thyroxine level The results showed that the offspring of the animals of PTU treated rats had a lower serum concentration of thyroxine compared to the control (P<0.001). All the three doses of Vit C improved the thyroid glands function, which was reflected in an increased level of serum thyroxine in the serum of the animals treated by 10, 100 and 500 mg/kg of Vit C (P<0.001, as shown in Figure 1). The results also showed that the medium dose was more effective than the lowest (P<0.01) and the highest dose (P<0.001) (Figure 1)

Liver function criteria The results of Vit C on liver function criteria of the hypothyroid rats are shown in Figure 2. In the hypothyroid rats, the

Ó 2019 Hogrefe

M. Esmaeilizadeh et al., Vitamin C on liver and renal functions of hypothyroid rats

(a)

(b)

(c)

(d)

(e)

Figure 2. The effect of Vit C on serum AST (a), ALT (b), ALK-P (c), total protein (d) and albumin (e) concentrations in PTU-induced hypothyroidism. Data are presented as mean ± SEM (n=7 in each group). ***P<0.001 compared to the control group, +++P<0.001 compared to the Hypo group, $ P<0.05, $$P<0.01 compared to the Hypo-Vit C 10 group. Hypo: Hypothyroidism, Vit C 10: Vit C 10 mg/kg, Vit C 100: Vit C 100 mg/kg and Vit C 500: Vit C 500 mg/kg.

serum AST concentration was higher than that in the control (P<0.001). Treatment of the animals by all the three doses including 10, 100 and 500 mg/kg of Vit C attenuated the serum concentration of AST in a dose dependent manner (P<0.001, P<0.001, and P<0.01, respectively). The results also showed that the two higher doses including 100 and 500 mg/kg of Vit C were more effective than the lowest dose (P<0.05 and P<0.01, respectively) (Figure 2a). Ó 2019 Hogrefe

Hypothyroidism status also increased the serum ALT compared to the control group (P<0.001). Similar to AST, all the three doses of Vit C prevented any increase in ALT concentration due to hypothyroidism conditions (P<0.01 for 10 mg/kg, P<0.05 for 100 mg/kg and P<0.001 for 500 mg/kg). However, there were no significant differences between the effects of the three doses of Vit C on the ALT concentration (Figure 2b). Furthermore, the Int J Vitam Nutr Res (2020), 90 (1–2), 84–94

M. Esmaeilizadeh et al., Vitamin C on liver and renal functions of hypothyroid rats

lowering effects of hypothyroidism induced by PTU on liver function was confirmed when it was seen that the serum ALK- P concentration in the PTU exposed rats was significantly higher than that in the control ones (P<0.001). Co-treatment by 10 mg/kg (P<0.001), 100 mg/kg (P<0.001) and 500 mg/kg (P<0.001) Vit C attenuated the serum ALK-P concentration compared to the PTU group. Also, there were no significant differences between the effects of the three doses of Vit C (Figure 2c). The results showed that hypothyroidism status lowered both total protein and albumin compared to the control group (P<0.001, as in Figures 2d & e). The results also revealed that all the three doses of Vit C increased the total protein concentration compared to the PTU group (P<0.001 for all, as in Figure 2d). Additionally, the serum albumin concentration in the rats treated by all the doses of Vit C was higher than that in the PTU group (P<0.001 for all, according to Figure 2e).

Liver tissues oxidative damage criteria The liver MDA concentration of the hypothyroid group was significantly higher than that of the control group (P<0.001). In addition, all the three doses of Vit C had a lower concentration of MDA in the liver tissues of the rats that received 10–500 mg/kg of Vit C during neonatal and juvenile periods (P<0.001 for 10 and 100 mg/kg and P<0.01 for 500 mg/kg compared to the PTU group) (Figure 3a). Additionally, the highest dose was more effective than both the medium and lowest doses (P<0.05 and P<0.001) (Figure 3a). Administrating PTU during lactation period and continuing up to the first 8 weeks of the life of the pups attenuated the liver tissues thiol contents (P<0.001). Vit C administration improved the thiol contents of the liver tissues (P<0.001 for all the doses of Vit C compared to the PTU group). The results also showed that the medium dose of Vit C was more effective than both its lowest and highest doses (P<0.01 for the both) (Figure 3b). A comparison of the SOD activity in the liver tissues showed a significant lower level in the hypothyroid than the control group (P<0.01). Only a medium dose of Vit C was effective to enhance the SOD activity in the liver tissues compared to the PTU group (P< 0.05). Neither 10 nor 500 mg/kg of Vit C had a significant effect of the SOD activity in the liver tissues compared to the PTU group (Figure 3c). As shown by Figure 3c, the medium dose was more effective than the highest dose (P<0.01). It was also observed that the CAT activity in the liver tissues of the hypothyroid group was significantly lower that of the control group (P<0.001). The findings also showed that the medium dose of Vit C increased the CAT activity in the liver tissues compared to the hypothyroid group (P<0.001). No significant difference was observed between the rats treated with 10 and 500 mg/kg of Vit C Int J Vitam Nutr Res (2020), 90 (1–2), 84–94

compared to the PTU group. Additionally, the medium dose was more effective than the highest dose (P<0.01) (Figure 3d).

Renal function criteria The results showed that hypothyroidism induced by PTU during neonatal and juvenile period affected renal function of the exposed rats. BUN concentration in the serum of the hypothyroid group was higher than that in the control group (P<0.001). Treatment by Vit C improved renal function of the hypothyroid rats, presented by a lower level of BUN in the serum of the animals in the groups treated by 100 and 500 mg/kg of Vit C compared to the PTU group (P<0.001); however, 10 mg/kg of Vit C was not effective (Figure 4a). The results also showed that serum BUN concentration in the animals of the Hypo-Vit C 100 and Hypo-Vit C 500 groups was lower than that in the PTUVit C 10 group (P<001) (Figure 4a). Similar to BUN, PTU administration increased serum creatinine in the hypothyroid group compared to the control group (P<0.001). Protective effects of Vit C on renal function was confirmed when the serum creatinine level was compared between the groups. The results showed that the two higher doses including 100 and 500 mg/kg of Vit C attenuated the serum creatinine concentration compared to PTU group (P<0.001 and P<0.01, respectively). The lowest dose of Vit C was not able to change the serum concentration of creatinine. The results also showed that the two higher doses including 100 and 500 mg/kg of Vit C were more effective than the lowest dose (P<0.001 and P <0.01, respectively) (Figure 4b).

Renal tissues oxidative damage criteria Renal tissue MDA in the hypothyroid group was higher than that in the control group (P<0.001). Pretreatment of the animals by 10, 100 and 500 mg/kg of Vit C brought about a diminished level of MDA in the renal tissues compared to the hypothyroid group (P<0.01–P<0.001) (Figure 5a). The results showed that the medium dose of Vit C was more effective than both the lowest (P<0.001) and highest doses (P<0.05). Hypothyroidism status also lessened the thiol content in the renal tissues (P<0.001) in comparison to the control group. Treatment of the animals by all the three doses including 10, 100 and 500 mg/kg of Vit C significantly increased levels of total thiol in the renal tissues (P<0.05– P<0.001) (Figure 5b). The two higher doses including 100 and 500 mg/kg of Vit C were more effective than the lowest dose (P<0.001). The SOD activity in the renal tissues of the hypothyroid group was lower than that in the control group Ó 2019 Hogrefe

M. Esmaeilizadeh et al., Vitamin C on liver and renal functions of hypothyroid rats

(a)

(b)

(c)

(d)

Figure 3. The effect of Vit C on liver tissues MDA (a) and total thiol (b) concentrations as well as SOD (c) and CAT (d) activities in PTU-induced hypothyroidism. Data are presented as mean ± SEM (n=7 in each group). **P<0.01 and ***P<0.001 compared to the control group, +P<0.05, ++ P<0.01 and +++P<0.001 compared to the Hypo group, $P<0.05 and $$P<0.01 compared to the Hypo-Vit C 10 group, &&P<0.01 and &&&P<0.001 compared to the Hypo-Vit C 100 group. Hypo: Hypothyroidism, Vit C 10: Vit C 10 mg/kg, Vit C 100: Vit C 100 mg/kg and Vit C 500: Vit C 500 mg/kg.

(P<0.001). The animals in the PTU-Vit C 100 and PTUVit C 500 groups demonstrated an increment in the SOD activity in the renal tissues compared to the hypothyroid group (P<0.01 and P<0.05, respectively) (Figure 5c). Additionally, the two higher doses were more effective than the lowest dose (P<0.01 and P<0.05, respectively). The CAT activity of the renal tissues in the hypothyroid group was lower, as compared to the control group (P<0.001). Also, the animals treated by 100 and 500 mg/kg of Vit C demonstrated an increased level of the CAT action in the renal tissues compared to the hypothyroid group (P<0.001). Additionally, both 100 and 500 mg/kg of Vit C were more effective than 10 mg/kg of Vit C to improve the CAT activity in the renal tissues (Figure 5c).

Discussion Thyroid hormones have been well documented to affect the functions of nearly all organs and cells in the body [45]. Ó 2019 Hogrefe

The data presented here clearly indicates how biochemical markers of liver and kidney may be affected by alteration in the level of thyroid hormones in the body. The current study demonstrated that PTU exposure during neonatal and juvenile period was resulted in development of hypothyroidism, and negatively influenced liver and renal function in rats. In the current study, PTU decreased serum thyroxine of offspring to a level, which has been reported to be seen in overt hypothyroidism status [46]. It is suggested that both hyperthyroidism and hypothyroidism states affect liver function tests. For example, an increased level of plasma concentration of total bilirubin and the liver enzyme activities in both hyperthyroid and hypothyroid subjects have been reported [47]. Enzymatic activities of AST and ALT are sensitive serological indicators of liver function. Higher activities of these enzymes in the serum have been found in response to oxidative stress induced by hyperthyroidism [48]. Normal circulating levels of thyroid hormones are required for both normal hepatic circulation and normal bilirubin metabolism [49]. Int J Vitam Nutr Res (2020), 90 (1–2), 84–94

M. Esmaeilizadeh et al., Vitamin C on liver and renal functions of hypothyroid rats

(a)

(b)

Figure 4. The effect of Vit C on serum BUN (a) and creatinine (b) concentrations in PTU- induced hypothyroidism. Data are presented as mean±SEM (n=7 in each group). ***P<0.001 compared to the control group, ++P<0.01 and +++P<0.001 compared to the Hypo group, $$P<0.01 and $$$P<0.001 compared to the Hypo-Vit C 10 group, && P<0.01 and &&&P<0.001 compared to the Hypo- Vit C 100 group. Hypo: Hypothyroidism, Vit C 10: Vit C 10 mg/kg, Vit C 100: Vit C 100 mg/kg and Vit C 500: Vit C 500 mg/kg.

In this study, we showed that serum AST, ALT and ALK-P concentrations in the hypothyroid group were higher than in the control group. Overall, our ﬁndings conﬁrm the previous observation suggesting that primary hypothyroidism is associated with an elevated level of serum liver enzyme concentrations [50]. The liver enzymes including ALT and AST have been shown to have a significant positive correlation with serum thyroid stimulating hormone (TSH) levels and a negative correlation with serum T4 levels [51]. Serum total protein always represents the excretory and synthetic functions of liver [28]. In this study, serum total protein and albumin of the hypothyroid group was lower than that of the control group. In agreement with our results, Patel et al. (2013) also showed that the serum total protein, albumin and globulin in hypothyroidism were low compared to the control group [52]. On the other hand, Verghes et al. (2010) reported that SOD activity in the liver tissues of hypothyroidism induced Int J Vitam Nutr Res (2020), 90 (1–2), 84–94

by PTU in rats was low, indicating that hypothyroidism induces an oxidative damage in liver tissues [53]. In the present study, the MDA concentration of the liver tissues in the hypothyroid group was high, while thiol, CAT and SOD in the liver tissues were low compared to the control animals. These results confirmed an oxidative stress status in the liver tissues due to PTU-induced hypothyroidism. Accordingly, in another study, an increased level of hepatic lipid peroxidation in PTU treated animals has been reported [54]. However, in contrast with our study, it has been previously shown that PTU-induced hypothyroidism reduces oxidative damage in the lung, hepatic and renal tissues, probably due to hypo metabolism, which is associated with a decreased production of reactive oxygen metabolites and enhancement of antioxidant mechanisms [55]. A relationship between the levels of thyroid hormones and the physiological actions of the kidneys has been suggested [3–6]. In addition, an increased level of creatinine in the serum of hypothyroid patients has been reported [56]. Also, a relationship between hypothyroidism and kidney dysfunction has been suggested [57, 58]. Our study also implies that reduction of thyroidal hormones affected the kidney function in rats, which was reflected by an increased level of both creatinine and BUN as markers of GFR. Consistent with the results of the present study, Den Hollander et al. (2005) observed an elevated level of serum creatinine in hypothyroid patients [3]. It has also been reported that hypothyroidism can cause reductions in GFR; thus, a screening for hypothyroidism in patients with unexplained elevations in serum creatinine has been suggested [59]. Our results also showed that the rats affected by hypothyroidism revealed a decreased level in total thiol concentration, CAT, and SOD activities, while an increased level of MDA concentration in the renal tissues. In line with the result of our study, Baltaci et al. (2014) demonstrated that the renal tissues MDA increased in an experimental hypothyroidism model induced by 4-weeks PTU administration, while the levels of GSH decreased [19]. Considering these results, tissues oxidative damage as a possible mechanism for deleterious effects of hypothyroidism on renal and liver functions might be suggested. Vit C, known as L-ascorbic acid, is a naturally existent organic substance marked by antioxidant property, and is also an essential nutrient for humans [60]. Vit C has been well known as an electron donor and as an essential cofactor for biosynthesis of intracellular biochemicals. Once avitaminosis occurs, the person suffers from severe scurvy symptoms [61]. As an antioxidant agent, Vit C has been reported to play an important protective role against insecticideinduced hepatic toxicity and to prevent the effect of free radicals on vital cells [62]. It was shown that Vit C level is lower in pregnant women with type 1 diabetes [63]. In the present study, we showed that treatment with all the doses Ó 2019 Hogrefe

M. Esmaeilizadeh et al., Vitamin C on liver and renal functions of hypothyroid rats

(a)

(b)

(c)

(d)

Figure 5. The effect of Vit C on renal tissues MDA (a) and total thiol (b) concentrations as well as SOD (c) and CAT (d) activities in PTU-induced hypothyroidism. Data are presented as mean±SEM (n=7 in each group). ***P<0.001 compared to the control group, +P<0.05, ++P<0.01 and +++P<0.001 compared to the Hypo group, $P<0.05, $$P<0.01 and $$$P<0.001 compared to the Hypo-Vit C 10 group, &P<0.05 compared to the Hypo-Vit C 100 group. Hypo: Hypothyroidism, Vit C 10: Vit C 10 mg/kg, Vit C 100: Vit C 100 mg/kg and Vit C 500: Vit C 500 mg/kg.

of Vit C decreased AST, ALT and ALK-P compared with the hypothyroid group. The results also showed that Vit C was able to improve both total protein and albumin in the serum. The other researchers also showed that Vit C had a potent protective effect against diazinon-induced hepatotoxicity in rats, which was reflected in a significant reduction in ALT and AST activities compared to the diazinon group. The beneficial effects were attributed to the scavenging of free radicals and increasing of antioxidant status [64]. Oral administration of Vit C has been reported to be able to reduce AST, ALT and ALK-P activities in the serum of lead exposed rats [65]. It has also been demonstrated that Vit C can reduce malathion-induced hepatotoxicity in rats [66]. In consistent with our study in which Vit C administration significantly increased serum concentrations of albumin and total-protein, Liang et al. also showed that these parameters decreased in a liver injury model induced by Concanavalin A in mice [67]. Vit C was administered at doses that had been previously used to protect liver injury [68]. Considering the results of the present study, the effects of Vit C on AST seems to be dose dependent. However, there Ó 2019 Hogrefe

were no significant differences on the effects of three doses of Vit C on other functional tests of the liver. Additionally, the medium dose of Vit C on liver tissues oxidative damage criteria was more effective than the low and high doses. Considering these results, a pro-oxidant effect for high doses of Vit C might be suggested, while Vit C acts as an anti-oxidant agent when administered at lower doses [69, 70]. In addition, besides protective effects against liver tissues oxidative damage, other mechanism(s) such as antiinflammatory effects may also have a role in the beneficial effects of Vit C, as seen in the present study, and are suggested to be evaluated in the future. The results of the present study showed that Vit C was able to improve renal function of the hypothyroid rats, which was reflected in a decreased level of creatinine and BUN. Similarly, Vit C has been reported to prevent oxidative stress in end-stage renal disease with scavenging free radicals [23]. The therapeutic effect of Vit C has been repeatedly attributed to its anti-oxidant properties. In the current study, treatment by all the doses including 10, 100 and 500 mg/kg of Vit C reduced the MDA concentration, while Int J Vitam Nutr Res (2020), 90 (1–2), 84–94

M. Esmaeilizadeh et al., Vitamin C on liver and renal functions of hypothyroid rats

increased thiol content in the liver tissues. Both SOD and CAT activities in the liver tissues of the rats treated by the medium dose of Vit C increased; however, the highest and lowest doses were not effective. Vit C has also been reported to be able to attenuate serum MDA concentration in depressed rotational workers [71]. It has been previously reported that high intake of Vit C exhibited a pro-oxidant activity that was associated with the production of the anion radical superoxide (O2 ) [68]. Similarly, supplementation of Vit C in high amount had adverse effects including diarrhea and gastrointestinal disturbances in most adults [72]. In this study, Vit C was able to increase total thiol concentration, CAT, and SOD activities in the renal tissues, while it decreased MDA. It is suggested that Vit C may have protective effects on renal functions because of its antioxidant effects, which has also been reported in other studies [73, 74]. This study showed that Vit C significantly increased serum T4 level. It has been already reported that Vit C significantly increases the concentration of T4, T3 and decreases the TSH [75]. Therefore, the balancing effects on thyroid hormones can be suggested as one of the possible mechanisms, which indirectly contribute to effects of Vit C on improving liver and renal function in the present study. In supporting this idea, it has been reported that Vit C protects the thyroid gland of rats from damages induced by other toxicants, while increases serum TSH, T3 and T4 concentrations [76]. Thus, it could be suggested that the improvement effect of Vit C could be partially because of an antioxidant defense system that may protect the gland against PTU toxicity. The exact mechanism(s) responsible for improving effects of Vit C on thyroid functions needs to be further investigated in future studies. Furthermore, more investigations are needed to clarify the exact mechanism(s) involved in the liver and renal protective effects of Vit C. Therefore, more precise further studies using other animal models of hypothyroidism such as thyroidectomy are suggested to be carried out to better understand the mechanism(s). Meanwhile, the results of the present study showed that a diet supplemented with Vit C improved the liver and kidney functions of the hypothyroid rats during neonatal and juvenile growth. Considering these results, it seems that medium doses of Vit C are more effective than high doses; however; it needs to be further investigated. Additionally, further molecular studies are suggested to better understand the exact mechanism(s). In conclusion, the results of this study demonstrated that Vit C improves the renal and liver functions of the rats, which were subjected to a hypothyroidism status during neonatal and juvenile growth. It is suggested that the effects of Vit C are due to its protective effects against tissues oxidative damage. Int J Vitam Nutr Res (2020), 90 (1–2), 84–94

References 1. Borzio, M., Caldara, R., Borzio, F., Piepoli, V., Rampini, P., & Ferrari, C. (1983) Thyroid function tests in chronic liver disease: evidence for multiple abnormalities despite clinical euthyroidism. Gut. 24, 631–636. 2. Iglesias, P., & Diez, J. (2009) Thyroid dysfunction and kidney disease. Eur. J. Endocrinol. 160, 503–515. 3. Den Hollander, J.G., Wulkan, R.W., Mantel, M.J., & Berghout, A. (2005) Correlation between severity of thyroid dysfunction and renal function. Clinical endocrinology. 62, 423–427. 4. Katz, A.I., Emmanouel, D.S., & Lindheimer, M.D. (1975) Thyroid hormone and the kidney. Nephron. 15, 223–249. 5. Villabona, C., Sahun, M., Roca, M., Mora, J., Gomez, N., Gomez, J.M., Puchal, R., & Soler, J. (1999) Blood volumes and renal function in overt and subclinical primary hypothyroidism. Am. J. Med. Sci. 318, 277–280. 6. Huang, X., Ding, L., Peng, K., Lin, L., Wang, T., Zhao, Z., Xu, Y., Lu, J., Chen, Y., Wang, W., Bi, Y., Ning, G., & Xu, M. (2016) Thyroid hormones associate with risk of incident chronic kidney disease and rapid decline in renal function: a prospective investigation. J. Transl. Med. 14, 336. 7. Derubertis, F.R., Michelis, M.F., Bloom, M.E., Mintz, D.H., Field, J.B., & Davis, B.B. (1971) Impaired water excretion in myxedema. Am. J. Med. 51, 41–53. 8. Ahmed, O.M., Ahmed, R.G., El-Gareib, A.W., El-Bakry, A.M., & Abd El-Tawab, S.M. (2012 Oct) Effects of experimentally induced maternal hypothyroidism and hyperthyroidism on the development of rat offspring: II-the developmental pattern of neurons in relation to oxidative stress and antioxidant defense system. Int. J. Dev. Neurosci. 30, 517–537. 9. Konukoglu, D., Ercan, M., & Hatemi, H. (2002) Plasma viscosity in female patients with hypothyroidism: effects of oxidative stress and cholesterol. Clin. Hemorheol. Microcirc. 27, 107–113. 10. Näntö-Salonen, K., Glasscock, G.F., & Rosenfeld, R.G. (1991) The effects of thyroid hormone on insulin-like growth factor (IGF) and IGF-binding protein (IGFBP) expression in the neonatal rat: prolonged high expression of IGFBP-2 in methimazole-induced congenital hypothyroidism. Endocrinology. 129, 2563–2570. 11. Das, K., & Chainy, G.B. (2001) Modulation of rat liver mitochondrial antioxidant defence system by thyroid hormone. Biochim. Biophys. Acta. 1537, 1–13. 12. Oren, R., Sikuler, E., Wong, F., Blendis, L.M., & Halpern, Z. (2000) The effects of hypothyroidism on liver status of cirrhotic patients. J. Clin. Gastroenterol. 31, 162–163. 13. Burra, P. (2013) Liver abnormalities and endocrine diseases. Best. Pract. Res. Clin. Gastroenterol. 27, 553–563. 14. Baskol, G., Atmaca, H., Tanrıverdi, F., Baskol, M., Kocer, D., & Bayram, F. (2007) Oxidative stress and enzymatic antioxidant status in patients with hypothyroidism before and after treatment. Exp. Clin. Endocrinol. Diabetes. 115, 522–526. 15. Korshunov, S.S., Skulachev, V.P., & Starkov, A.A. (1997) High protonic potential actuates a mechanism of production of reactive oxygen species in mitochondria. FEBS. Letters. 416, 15–18. 16. Batra, J., Saxena, S., Kumar, S., & Baghel, M. Correlation between Oxidative Stress and Chronic Kidney Disease in Thyroid Disorders. 17. Slot, M.C., Links, T.P., Stegeman, C.A., & Tervaert, J.W. (2005) Occurrence of antineutrophil cytoplasmic antibodies and associated vasculitis in patients with hyperthyroidism treated with antithyroid drugs: A long-term followup study. Arthritis. Rheum. 53, 108–113.

Ó 2019 Hogrefe

M. Esmaeilizadeh et al., Vitamin C on liver and renal functions of hypothyroid rats

18. Livingston, H.J., & Livingston, S.F. (1947) Agranulocytosis and hepatocellular jaundice: toxic reactions following propylthiouracil therapy. J. Am. Med. Assoc. 135, 422–425. 19. Baltaci, A., Mogulkoc, R., Ayyildiz, M., Kafali, E., & Koyuncuoglu, T. (2013) Lipid peroxidation in kidney and testis tissues in experimental hypothyroidism: the role of zinc. Bratisl. Lek. Listy. 115, 498–501. 20. Welch-White, V., Dawkins, N., Graham, T., & Pace, R. (2013) The impact of high fat diets on physiological changes in euthyroid and thyroid altered rats. Lipids. Health. Dis. 12, 100. 21. Lian, X.L., Bai, Y., Dai, W.X., Jin, Z.M., Zeng, Z.P., & Guo, Z.S. (2004) The clinical characteristics of symptomatic propylthiouracil-induced hepatic injury in patients with hyperthyroidism. Zhonghua. Nei. Ke. Za. Zhi. 43, 442–446. 22. Weiss, M., Hassin, D., & Bank, H. (1980) Propylthiouracilinduced hepatic damage. Arch. Intern. Med. 140, 1184–1185. 23. Locatelli, F., Canaud, B., Eckardt, K.U., Stenvinkel, P., Wanner, C., & Zoccali, C. (2003) Oxidative stress in end-stage renal disease: an emerging threat to patient outcome. Nephrology. Dialysis. Transplantation. 18, 1272–1280. 24. Venditti, P., & Di Meo, S. (2006) Thyroid hormone-induced oxidative stress. Cell. Mol. Life. Sci. 63, 414–434. 25. Chan, S., & Kilby, M. (2000) Thyroid hormone and central nervous system development. J. Endocrinol. 165, 1–8. 26. Brouwer, A., Morse, D.C., Lans, M.C., Gerlienke Schuur, A., Murk, A.J., Klasson-Wehler, E., Bergman, Å., & Visser, T.J. (1998) Interactions of persistent environmental organohalogens with the thyroid hormone system: mechanisms and possible consequences for animal and human health. Toxicol. Ind. Health. 14, 59–84. 27. Boyages, S.C., & Halpern, J.-P. (1993) Endemic cretinism: toward a unifying hypothesis. Thyroid. 3, 59–69. 28. Zhou, T., Taylor, M.M., DeVito, M.J., & Crofton, K.M. (2002) Developmental exposure to brominated diphenyl ethers results in thyroid hormone disruption. Toxicol. Sci. 66, 105–116. 29. Vujovic, M., Nordstrom, K., Gauthier, K., Flamant, F., Visser, T. J., Vennstrom, B., & Mittag, J. (2009) Interference of a mutant thyroid hormone receptor α1 with hepatic glucose metabolism. Endocrinology. 150, 2940–2947. 30. Santana-Farré, R., Mirecki-Garrido, M., Bocos, C., HenríquezHernández, L.A., Kahlon, N., Herrera, E., Norstedt, G., Parini, P., Flores-Morales, A., & Fernández-Pérez, L. (2012) Influence of neonatal hypothyroidism on hepatic gene expression and lipid metabolism in adulthood. PloS. One. 7, e37386. 31. Ray, S., Roy, K., & Sengupta, C. (2007) Exploring the protective effect of ascorbic acid and aqueous extract of spirulina platensis on methotrexate-induced lipid peroxidation. Iran. J. Pharm. Sci. 3, 217–228. 32. Djuraševıć, S., Djordjevıć, J., Drenca, T., Jasnıć, N., & Cvıjıć, G. (2008) Influence of vitamin c supplementation on the oxidative status of rat liver. Arch. Biol. Sci. 60, 169–173. 33. Kojo, S. (2004) Vitamin C: basic metabolism and its function as an index of oxidative stress. Curr. Med. Chem. 11, 1041–1064. 34. Tingle, C.C., Rother, J.A., Dewhurst, C.F., Lauer, S., & King, W. J. (2003) Fipronil: environmental fate, ecotoxicology, and human health concerns. Reviews of environmental contamination and toxicology. Springer1–66. 35. Badgujar, P.C., Chandratre, G.A., Pawar, N.N., Telang, A.G., & Kurade, N.P. (2015) Fipronil induced oxidative stress involves alterations in SOD1 and catalase gene expression in male mice liver: Protection by vitamins E and C. Environ. Toxicol. 31, 1147–1158. 36. Mozhdeganloo, Z., Jafari, A.M., Koohi, M.K., & Heidarpour, M. (2015) Methylmercury-Induced Oxidative Stress in Rainbow

Ó 2019 Hogrefe

37.

38.

39.

40.

41.

42. 43.

44. 45.

46.

47.

48.

49. 50.

51.

52.

53.

Trout (Oncorhynchus mykiss) Liver: Ameliorating Effect of Vitamin C. Biol Trace. Elem. Res. 165, 103–109. Shalan, M., Mostafa, M., Hassouna, M., El-Nabi, S.H., & El-Refaie, A. (2005) Amelioration of lead toxicity on rat liver with vitamin C and silymarin supplements. Toxicology. 206, 1–15. Nabavi, S.F., Nabavi, S.M., Habtemariam, S., Moghaddam, A. H., Sureda, A., & Mirzaei, M. (2013) Neuroprotective effects of methyl-3-O-methyl gallate against sodium fluoride-induced oxidative stress in the brain of rats. Cell. Mol. Neurobiol. 33, 261–267. Elhaïmeur, F., Courderot-Masuyer, C., Nicod, L., Guyon, C., Richert, L., & Berthelot, A. (2002) Dietary vitamin C supplementation decreases blood pressure in DOCA-salt hypertensive male Sprague Dawley rats and this is associated with increased liver oxidative stress. Mol. Cell. Biochem. 237, 77–83. Hosseini, M., Zakeri, S., Khoshdast, S., Yousefian, F.T., Rastegar, M., Vafaee, F., Kahdouee, S., Ghorbani, F., Rakhshandeh, H., & Kazemi, S.A. (2012) The effects of Nigella sativa hydro-alcoholic extract and thymoquinone on lipopolysaccharide-induced depression like behavior in rats. J. Pharm. Bioallied. Sci. 4, 219. Beheshti, F., Hosseini, M., Vafaee, F., Shafei, M.N., & Soukhtanloo, M. (2015) Feeding of Nigella sativa during neonatal and juvenile growth improves learning and memory of rats. J. Tradit. Complement. Med. 6, 146–152. Ellman, G.L. (1959) Tissue sulfhydryl groups. Arch. Biochem. Biophys. 82, 70–77. Madesh, M., & Balasubramanian, K.A. (1998) Microtiter plate assay for superoxide dismutase using MTT reduction by superoxide. Indian. J. Biochem. Biophys. 35, 184–188. Aebi, H.E. (1983) Catalase In B. Hu (Ed.), Methods in Enzymatic Analysis. (pp. 276–286). New York: Academic Press. Gould, E., Allan, M.D., & McEwen, B.S. (1990) Dendritic spine density of adult hippocampal pyramidal cells is sensitive to thyroid hormone. Brain. Res. 525, 327–329. Staub, J.-J., Althaus, B.U., Engler, H., Ryff, A.S., Trabucco, P., Marquardt, K., Burckhardt, D., Girard, J., & Weintraub, B.D. (1992) Spectrum of subclinical and overt hypothyroidism: effect on thyrotropin, prolactin, and thyroid reserve, and metabolic impact on peripheral target tissues. Am. J. Med. 92, 631–642. Ajala, M.O., Ogunro, P.S., & Fasanmade, O.A. (2013) Relationship between liver function tests and thyroid hormones in thyroid disorders. Niger. Postgrad. Med. J. 20, 188–192. Chattopadhyay, S., Sahoo, D.K., Subudhi, U., & Chainy, G.B. (2007) Differential expression profiles of antioxidant enzymes and glutathione redox status in hyperthyroid rats: a temporal analysis. Comp. Biochem. Physiol. C. Toxicol. Pharmacol. 146, 383–391. Youssef, W.I., & Mullen, K.D. (2002) The liver in other (nondiabetic) endocrine disorders. Clin. Liver. Dis. 6, 879–889. vii. Bayraktar, M., & Van Thiel, D.H. (1997) Abnormalities in measures of liver function and injury in thyroid disorders. Hepatogastroenterology. 44, 1614–1618. Targher, G., Montagnana, M., Salvagno, G., Moghetti, P., Zoppini, G., Muggeo, M., & Lippi, G. (2008) Association between serum TSH, free T4 and serum liver enzyme activities in a large cohort of unselected outpatients. Clin. Endocrinol. 68, 481–484. Patel, M., Mishra, V., Pawar, V., Ranvir, R., Sundar, R., & Dabhi, R. (2013) Evaluation of acute physiological and molecular alterations in surgically developed hypothyroid Wistar rats. J. Pharmacol. Pharmacother. 4, 110–115. Varghese, S., Lakshmy, P.S., & Oommen, O.V. (2001) Changes in lipid peroxidation and antioxidant enzyme activities by

Int J Vitam Nutr Res (2020), 90 (1–2), 84–94

54.

55.

56.

57.

58.

59.

60.

61. 62.

63.

64.

65.

66.

67.

M. Esmaeilizadeh et al., Vitamin C on liver and renal functions of hypothyroid rats

triiodothyronine (T3) and polyunsaturated fatty acids (PUFA) in rat liver. Endocr. Res. 27, 409–416. Panda, S., & Kar, A. (2005) Guggulu (Commiphora mukul) potentially ameliorates hypothyroidism in female mice. Phytother. Res. 19, 78–80. Sener, G., Kabasakal, L., Atasoy, B.M., Erzik, C., VeliogluOgunc, A., Cetinel, S., Contuk, G., Gedik, N., & Yegen, B.C. (2006) Propylthiouracil-induced hypothyroidism protects ionizing radiation-induced multiple organ damage in rats. J. Endocrinol. 189, 257–269. Kreisman, S.H., & Hennessey, J.V. (1999) Consistent reversible elevations of serum creatinine levels in severe hypothyroidism. Arch. Intern. Med. 159, 79–82. Gopinath, B., Harris, D.C., Wall, J.R., Kifley, A., & Mitchell, P. (2013) Relationship between thyroid dysfunction and chronic kidney disease in community-dwelling older adults. Maturitas. 75, 159–164. Basu, G., & Mohapatra, A. (2012) Interactions between thyroid disorders and kidney disease. Indian. J. Endocrinol. Metab. 16, 204–213. Ponsoye, Matthieu, Paule, R., Gueutin, Victor, Deray, Gilbert, & Izzedine, Hassane (2013) Kidney and thyroid dysfunction. Néphrologie & Thérapeutique. 9, 13–20. Lucock, M., Yates, Z., Boyd, L., Naylor, C., Choi, J.H., Ng, X., Skinner, V., Wai, R., Kho, J., Tang, S., Roach, P., & Veysey, M. (2013) Vitamin C-related nutrient-nutrient and nutrient-gene interactions that modify folate status. Eur. J. Nutr. 52, 569–582. Strohle, A., & Hahn, A. (2009) Vitamin C and immune function. Med. Monatsschr. Pharm. 32, 49–54. quiz 5–6. Abd-El-Ghaney, A. (2002) Study the effect of imidacloprid insecticide on some physiological parameters in Japanese quail. Al-Azhar University. Juhl, B., Lauszus, F.F., & Lykkesfeldt, J. (2017) Is Diabetes Associated with Lower Vitamin C Status in Pregnant Women? A Prospective Study. Int J Vitam Nutr Res. 16, 1–5. Shokrzadeh, M., Shobi, S., Attar, H., Shayegan, S., Payam, S. S., & Ghorbani, F. (2012) Effect of vitamins A, E and C on liver enzyme activity in rats exposed to organophosphate pesticide diazinon. Pak. J. Biol. Sci. 15, 936–941. Ebuehi, O.A., Ogedegbe, R.A., & Ebuehi, O.M. (2012) Oral administration of vitamin C and vitamin E ameliorates leadinduced hepatotoxicity and oxidative stress in the rat brain. Nig. Q. J. Hosp. Med. 22, 85–90. Kalender, S., Uzun, F.G., Durak, D., Demir, F., & Kalender, Y. (2010) Malathion-induced hepatotoxicity in rats: the effects of vitamins C and E. Food. Chem. Toxicol. 48, 633–638. Liang, T., Chen, X., Su, M., Chen, H., Lu, G., & Liang, K. (2014) Vitamin C exerts beneficial hepatoprotection against Concanavalin A-induced immunological hepatic injury in mice

Int J Vitam Nutr Res (2020), 90 (1–2), 84–94

68.

69. 70.

71.

72. 73.

74.

75.

76.

through inhibition of NF-kappaB signal pathway. Food. Funct. 5, 2175–2182. Patra, R., Swarup, D., & Dwivedi, S. (2001) Antioxidant effects of α tocopherol, ascorbic acid and L-methionine on lead induced oxidative stress to the liver, kidney and brain in rats. Toxicology. 162, 81–88. Herbert, V. (1996) Prooxidant effects of antioxidant vitamins. Introduction. J. Nutr. 126, 1197S–1200S. Podmore, I.D., Griffiths, H.R., Herbert, K.E., Mistry, N., Mistry, P., & Lunec, J. (1998) Vitamin C exhibits pro-oxidant properties. Nature. 392, 559. Khajehnasiri, F., Akhondzadeh, S., Mortazavi, S.B., Allameh, A., Sotoudeh, G., Khavanin, A., & Zamanian, Z. (2016) Are Supplementation of Omega-3 and Ascorbic Acid Effective in Reducing Oxidative Stress and Depression among Depressed Shift Workers? International journal for vitamin and nutrition research. Int. J. Vitam. Nutr. Res.1–12. Hoffer, A. (1971) Ascorbic acid and toxicity. N. Engl. J. Med. 285, 635–636. Paolini, M., Pozzetti, L., Pedulli, G.F., Marchesi, E., & CantelliForti, G. (1999) The nature of prooxidant activity of vitamin C. Life. Sci. 64, PL273–PL278. Carr, A.C., & Frei, B. (1999) Toward a new recommended dietary allowance for vitamin C based on antioxidant and health effects in humans. Am. J. Clin. Nutr. 69, 1086–1107. Sahin, K., Sahin, N., & Yaralioglu, S. (2002) Effects of vitamin C and vitamin E on lipid peroxidation, blood serum metabolites, and mineral concentrations of laying hens reared at high ambient temperature. Biol. Trace. Elem. Res. 85, 35–45. Qureshi, I.Z., & Mahmood, T. (2010) Prospective role of ascorbic acid (vitamin C) in attenuating hexavalent chromium-induced functional and cellular damage in rat thyroid. Toxicol. Ind. Health. 26, 349–359.

Acknowledgments The authors would like to appreciate the Vice Chancellor for Research and Technology at the Mashhad University of Medical Sciences and Esfarayen Faculty of Medical Sciences for financial support. Conflicts of interests The authors declare that there are no conflicts of interest. Farimah Beheshti Neurocognitive Research Center Faculty of Medicine Azadi Square Mashhad Iran BeheshtiF931@mums.ac.ir

Ó 2019 Hogrefe

Original Communication

Ramadan fasting improves liver function and total cholesterol in patients with nonalcoholic fatty liver disease Sara Ebrahimi1, Bahram Pourghassem Gargari2, Fereshteh Aliasghari2,3, Foad Asjodi4, and Azimeh Izadi2,3 1

Master of Nutrition, Jahrom University of Medical Sciences, Motahari Hospital, Jahrom, Iran

Department of Biochemistry and Diet Therapy, Nutrition Research Center, Faculty of Nutrition and Food Science, Tabriz University of Medical Sciences, Tabriz, Iran

Student Research Committee, Tabriz University of Medical Sciences, Iran

Board member of Sport Nutrition in IFMARC (Iran Football Medical Assessment and Research Center), Tehran, Iran

Received: February 11, 2017; Accepted: March 25, 2017

Abstract: Background: Nonalcoholic fatty liver disease (NAFLD) is a serious global health problem, thus the prevention and management of the disease is necessary. This study aimed to determine the effects of Ramadan Fasting (RF) on liver function, Visceral Adiposity Index (VAI) and Atherogenic Index of Plasma (AIP) in these patients.Methods: Eighty-three NAFLD patients (57 males and 26 females) were enrolled in the study, 42 patients who practiced RF, between Jun 18 through July 17, 2015 and 41 patients in non-fasting groups. Anthropometric parameters and Ultrasound grading were measured before and after Ramadan. The biochemical parameters including lipid profiles (total cholesterol, LDL cholesterol, HDL cholesterol, and triglycerides), liver enzymes (Aspartate aminotransferase, SGOT and Alanine aminotransferase, SGPT) were evaluated before and after Ramadan. AIP and VAI were calculated based on formula.Results: The mean decreases in anthropometric indices were significantly different between groups. Similarly, the mean decrease in the total cholesterol values in the fasting group was remarkably greater than in the control group (p = 0.02). The values of AIP and VAI decreased at the end of the study in both group and the mean of changes showed no differences between groups (p = 0.79 and p = 0.65 for AIP and VAI, respectively). The changes in the concentrations of liver enzymes, as well as the severity of hepatic steatosis, showed remarkable differences between groups (p = 0.03, p = 0.05, and p = 0.02 for SGOT and SGPT, and Liver steatosis, respectively).Conclusion: RF improved liver steatosis in NAFLD patients and might be useful in the management of NAFLD. Keywords: Fasting, Ramadan fasting, NAFLD, Liver Enzyme, VAI, AIP

Introduction Non-alcoholic fatty liver disease (NAFLD) is defined as the accumulation of liver fat exceeding 5% in the absence of significant alcohol intake, viral infection or any specific etiology of liver disease and is considered the hepatic manifestation of metabolic syndrome [1]. NAFLD has become a major health concern related to the increasing prevalence of obesity and sedentary lifestyle [2, 3]. NAFLD is a risk factor for all causes mortality such as cardiovascular disease, cancer or liver disease [4]. Since improper diet and excessive caloric intake are the key causes of NAFLD, nutritional strategies seem to be a useful tool for better management of NAFLD [2]. Indeed, an oversupply of calorie and fat Ó 2019 Hogrefe

may result in obesity, hyperinsulinemia and insulin resistance [5]. On the other hand, there is evidence that weight loss achieved through energy restriction and lifestyle intervention reduces histological steatosis (intrahepatic fat content) and the serum enzymes concentrations [6]. Ramadan is an annual Muslim religious observance during which Muslims fast, they do not eat, drink or smoke from dawn until sunset every day (Quran, 2:187). Ramadan fasting (RF), lasts from eight to 18 hours, according to the season and latitude. RF is associated with alterations in sleep pattern, physical activity, eating patterns as well as the quality of food intakes, which may result in changes in metabolism [7, 8]. Previous researches into fasting and metabolic disease have studied several aspects of these changes. Int J Vitam Nutr Res (2020), 90 (1–2), 95–102 https://doi.org/10.1024/0300-9831/a000442

S. Ebrahimi et al., Fasting, Ramadan fasting, NAFLD, Liver Enzyme, VAI, AIP

The visceral adiposity index (VAI) is proposed to be a good indicator of insulin sensitivity and is significantly correlated with visceral adiposity. Increased VAI has been strongly associated with cardio-metabolic risk [9]. In the field of NAFLD, it has been reported that the VAI accurately predicted progressive liver histology more accurately than other validated noninvasive scores and identified patients with NAFLD at increased CVD risk [10]. To the best of our knowledge, there is no research investigating the effect of RF on this index. Our objective, hence, was to investigate the impacts of fasting during Ramadan on anthropometric, VAI and liver function in patients with NAFLD.

Physical activity and dietary intakes To control the confounding effects of physical activity, International physical activity questionnaire-short form (IPAQ-S) was recorded for each patient. Dietary intakes including energy and macronutrients were assessed by 24-h recall questionnaire and were analyzed by Nutritionist IV software (version 3.5.2, The Hearst Corporation, San Bruno, CA). The visceral adiposity index (VAI) was calculated as previously described [11], using the following gender- specific equations:

Method This study was conducted from January 18 through July 17, 2015. Blood samples were collected 3 days before and after Ramadan. The range of fasting hours during the month was about 15 to 16 hours a day.

Subjects A total number of 83 NAFLD patients were included in this study. All patients were recruited at the University Hospital in Jahrom, Iran. Inclusion criteria detailed below were assessed: Patients between 20 and 50 years old with a documented previous history of NAFLD who declared that they would fast for more than 20 days during the Ramadan. Exclusion criteria included pregnancy and lactation, menopause, smoking, kidney diseases, diabetes, and malignancy. The compliance of the patients was well observed using a phone call. Approval was obtained from the ethical committee of Jahrom University of Medical Sciences with the number IR.JUMS.REC.1394.158 and written informed consent were obtained from all patients.

Anthropometric measurements Anthropometric indices were measured in light clothing and without shoes. Body weight and height were measured in the fasting state using Seca scale (Seca, Hamburg, Germany) and a stadiometer attached to the scale, respectively. BMI was calculated on the basis of weight in kilograms and height in meters. Waist circumference was measured at the midpoint between the lower border of the rib cage and the iliac crest and hip circumference was measured at the widest part of the hip region. Int J Vitam Nutr Res (2020), 90 (1–2), 95–102

TG 1:31 HDL 1:03 TG 1:52 Females : VAI ¼ 36:58þðWC HDL 0:81 1:88 BMIÞ Males : VAI ¼

WC 39:68þð1:88 BMIÞ

VAI: visceral adiposity index; WC: waist circumference; BMI: body mass index; TG: triglyceride; HDL: high-density lipoprotein.

Sample collection and laboratory assessment Blood sampling was performed 3 days before and after Ramadan. Approximately 10 ml of venous blood samples were obtained from all participants after a 12-h overnight fasting, and serum and plasma were immediately separated by centrifugation at 4°C between 1100-1300 g-force for 10 min at 2500 r.p.m. and were frozen at 80°C until analyzing. Total cholesterol, HDL cholesterol, and triglyceride levels were measured by enzymatic procedures with kits from Pars Azmoun, Tehran, Iran. LDL cholesterol values were calculated using the Friedewald equation if the triglyceride concentration was <400 mg/dl. The AIP was calculated as the logarithmically transformed ratio of molar concentrations of TG to HDL-C [12]. Serum Alanine aminotransferase (ALT) and Aspartate aminotransferase (AST) concentrations were measured using photometric assay (Pars Azmoun, Tehran, Iran). Liver ultrasonography was assessed before and after Ramadan. A skilled radiologist determined Ultrasound grading using an East Medical sonographic scanner equipped with a convex 3.5 MHz browser. Histopathological grading of NAFLD was scored according to the NAFLD activity score (NAS) as verified by Brunt et al [13]. This scoring system is the unweighted sum of steatosis, lobular inflammation, and hepatocellular ballooning scores. Additionally, NAS has reasonable interrater reproducibility that is useful for studies of both adults and children with any degree of NAFLD. Ó 2019 Hogrefe

S. Ebrahimi et al., Fasting, Ramadan fasting, NAFLD, Liver Enzyme, VAI, AIP

Statistical analysis Data were analyzed using SPSS Program version 22.0 [SPSS, Inc., Chicago, Ill]). To evaluate the normal distribution, we used the Kolmogorov- Smirnov test. Continuous variables are expressed as mean ± sd and categorical variables as frequency and percentage. Chi-squared, Wilcoxon, Paired t-test, independent sample T-test, and or the Mann– Whitney U-test were used when appropriate (based on the normality of data distribution). All significant tests were 2-tailed, and P values < .05 were considered statistically significant.

Results The flow chart of study is presented in Figure 1. Demographic characteristic and physical activity levels of patients are shown in Table 1. The significant differences were observed between two groups regarding the changes observed in total energy intakes during Ramadan. The anthropometric parameters of patients are shown in Table 3. As it is obvious, the anthropometric indices decreased after RF in both groups, although the mean decrease in the fasting group was greater than in the control group, and the differences were statistically significant. Regarding the VAI values, Table 3 clearly demonstrates that the mean decrease is not statistically significant between groups. Table 4 shows that TG, total cholesterol, and LDL cholesterol were reduced compared with before Ramadan values. It is obvious from Table 4 that AIP decreased significantly at the end of the study, and this holds true for both groups. It should be highlighted that the mean decrease in the total cholesterol values in the fasting group was greater than in the control group, and the differences were statistically significant. Mean serum liver enzymes concentrations of patients are shown in Table 5, The mean decreases in the fasting group were greater than in the control group (p = 0.03 and p = 0.05 for SGOT and SGPT, respectively). Before Ramadan, none of the participants had normal grade steatosis. The comparison of severity of hepatic steatosis between two groups before (P = 0.39) showed no significant difference. However, at the end of Ramadan, the severity of hepatic steatosis showed statistically significant difference between groups (p = 0.02).

Discussion It is well recognized that the altered feeding regime and circadian rhythms during Ramadan may influence some Ó 2019 Hogrefe

metabolic processes [14]. Thus, Ramadan is the best opportunity to investigate the impacts of the prolonged reduction of mealtime and fasting on body metabolism [15]. The anthropometric parameters including weight, BMI, WC, Hip circumference and WHR showed significant differences throughout the Ramadan in fasting group, but not in another group. Other studies [16, 17] including Norouzy A et al [18] confirmed our findings which weight and BMI decrease remarkably after Ramadan. A more likely explanation for the weight loss during Ramadan is the efficient utilization of body fat during fasting [19]. Additionally, regarding the fact that energy balance plays a key regulatory role in body weight changes, it is suggested that Ramadaninduced weight loss is a result of the reduction in the total energy intake [20]. Moreover, recently it has been suggested that body’s basal metabolism increases during Ramadan which is attributed to the increased levels of catecholamine due to the changed sleep pattern and the cortisol circadian rhythm [16]. Additionally, Ramadan fasting was able to decrease body fat noticeably. Similar changes in body fat redistribution due to the Ramadan fasting have been reported in healthy subjects [21]. Because of the positive correlation between weight and body fat, it can be concluded that the weight loss observed among our patients could be contributed to the reduced body fat. Since an increase in body fat, the especially abdominal adipose tissue is considered as an independent risk of cardiometabolic and cerebrovascular disease; these changes are favorable. As predicted, in view of the close relationships between anthropometric indices, as well as the concentration of TG and HDL with visceral adiposity index, the values of VAI were quite decreased as a result of prolonged fasting. Interestingly, VAI was also influenced in non-fasting patients and the mean changes were not statistically different between groups. It should be explained by the religious beliefs of Iranian people, that in non-fasting individuals their diets are as tightly controlled as fasting ones. It appears that VAI is correlated with IR and the severity of liver fibrosis in NAFLD patients, furthermore VAI has been suggested as an indicator of adipose-related liver damage [22]. Additionally, a positive statistically significant association between VAI and γ-glutamyl transpeptidase, and SGPT and significantly higher VAI levels was found in the subgroup of PCOS patients that presented NAFLD [23]. VAI has been suggested as an independent determinant of the insulin sensitivity [24]. Since VAI includes both physical and metabolic parameters, it might be a valuable index of both fat distribution and function [11]. Thus, it is critical to assess visceral adiposity and find some therapeutic strategies to reduce VAI in at-risk subjects. Practically, the findings of our study demonstrate that fasting approach would able to decrease VAI; studies must be done, confirm our findings in varied patient populations. Int J Vitam Nutr Res (2020), 90 (1–2), 95–102

S. Ebrahimi et al., Fasting, Ramadan fasting, NAFLD, Liver Enzyme, VAI, AIP

Figure 1. The flowchart of study design.

By the 28th day of Ramadan, at the end of study, no significant difference was observed in the mean changes of lipid profile components, except for total cholesterol. In a systematic review by Salim et al [25] concluded that Ramadan fasting results in momentous improvements in lipid profile in numerous populations including healthy subjects, patients with metabolic syndrome, dyslipidemia, hypertension and stable cardiac illness. It is important to note that Int J Vitam Nutr Res (2020), 90 (1–2), 95–102

such improvements in serum lipids during Ramadan may have favorable effects on risk factors for certain disease [15]. In the contrary, Ziaee et al [26] reported worsened LDL and HDL levels in healthy Iranian subjects; It is thought that the reason for this discrepancy is varied studied population. Since in our study participants were NAFLD patients with abnormal lipid profile; they showed more response to fasting. A surprising finding was that similar Ó 2019 Hogrefe

S. Ebrahimi et al., Fasting, Ramadan fasting, NAFLD, Liver Enzyme, VAI, AIP

Table 1. Demographic characteristic and physical activity levels of study subjects.

Table 3. Anthropometric parameters of patients before and after Ramadan

Characteristics

Variable

Age (year)*

Group

p-value

Fasting (n = 42)

Non-fasting (n = 41)

37.59 ± 7.06

35.80 ± 7.33

Sex** Male (%) Female (%)

0.19 0.06

25 (59.5%)

32 (78.0%)

17 (40.5%) 42

9 (22%) 41

Light (%)

19 (45.2%)

16 (39.0%)

Moderate (%)

18 (42.9%)

17 (41.5%)

5 (11.9%)

Non-fasting (n = 41)

Before

83.65 ± 13.02

80.81 ± 10.02

0.271

After

81.50 ± 12.80

80.73 ± 10.09

2.14 ± 2.33

0.08 ± 1.14

Before

30.09 ± 4.49

28.20 ± 2.50

0.021

After

29.28 ± 4.14

28.18 ± 2.58

< 0.001

Change

0.80 ± 1.03

0.02 ± 0.40

< 0.001

Weight (kg)

Change

0.762 < 0.001

BMI (kg/m2)

Physical activity

Severe (%)

Fasting (n = 42)

0.617

Waist circumference (cm)

8 (19.5%)

P-Value < 0.05 is significant.

Before

100.21 ± 11.02

97.70 ± 9.89

0.279

After

99.26 ± 10.86

97.67 ± 10.02

0.49

0.95 ± 0.73

0.036 ± 0.50

< 0.001

Before

107.02 ± 7.11

102.56 ± 6.27

0.017

After

106.47 ± 7.09

102.56 ± 6.27 < 0.001

Change Hip circumference (cm) Table 2. Energy and macronutrients intakes in both groups before and after Ramadan. Variable

Fasting group (n = 42)

Control group (n = 41)

p-value

Before

2228.33 ± 230.3

After

0.06

1970.54 ± 150.79 2150.61 ± 168.30 <0.001

P-value

<0.001

0.853

Change

257.79 ± 62.40

3.33 ± 114.7

<0.001

285.96 ± 30.01

297.69 ± 19.04

0.11

Total Carbohydrate (g) Before After

277.99 ± 27.27

294.04 ± 26.22

P-value

0.041

0.409

Change

7.97 ± 24.46

3.64 ± 27.99

0.55 ± 0.67

0.0 ± 0.22

< 0.001

Before

0.935 ± 0.07

0.953 ± .08

0.222

After

0.931 ± 0.07

0.952 ± .08

0.161

Change

0.004 ± 0.007

0.0005 ± 0.0044

0.001

Before

34.70 ± 8.76

30.66 ± 5.89

0.016

After

34.02 ± 8.82

30.36 ± 5.72

0.38

Change

0.68 ± 0.87

0.29 ± 1.87

0.003

Waist to Hip Ratio

Energy (kcal) 2147.29 ± 150.79

Change

0.11

Body fat percent

Data are presented as mean ± SD. Pb Between group comparisons using independent t-test or the Mann–Whitney U-test based on normality test. P Value < 0.05 is significant. BMI: Body Mass Index.

0.24

Total fat (g) Before

62.48 ± 9.81

62.83 ± 9.17

0.852

After

56.20 ± 10.57

59.78 ± 10.89

0.597

P-value

0.001

0.102

Change

6.28 ± 11.79

3.05 ± 11.67

0.29

Before

75.28 ± 7.54

75.94 ± 5.93

0.613

After

73.08 ± 7.76

74.48 ± 6.28

0.195

P-value

0.133

0.183

Change

2.20 ± 9.31

1.46 ± .90

Total Protein (g)

0.38

Data are expressed as means ± SD, Student’s unpaired t-test (for the normally distributed) or the Mann–Whitney U-test based on normality test. P-Value < 0.05 is significant.

changes were observed in control group. Remembering that there were not fasting, such improvement in lipid profiles is suggested to be attributed to changes in the dietary pattern. In this regard, high intake of fresh vegetables and fruits rich in antioxidant during Ramadan has been suggested which has been linked to improved lipid status [15]. Our results concerning patients with NAFLD represent a novel observation. Ramadan fasting has yielded markedly lower values of AIP. Interestingly, AIP was also influenced in control Ó 2019 Hogrefe

individuals (p-values not shown) and at the end of the study, the mean changes of AIP were not statistically different between groups. Since AIP is calculated as log TG/HDL, it is obvious that interventions to lessen the concentrations of TG and HDL would lead to the diminution in AIP levels. Since our patients showed no significant difference in HDL values, and AIP it is strongly affected by serum triglycerides, which in turn is associated with the carbohydrate intake [27]; these favorable changes are attributed to a reduction in TG concentrations and in fact to carbohydrate intakes in Ramadan. A previous research has established a strong correlation between AIP and lipoprotein particle size, therefore AIP could be representative of atherogenic lipoprotein status [28]. The ratio of TG/HDL-C has been proposed to identify cardiometabolic risk associated with insulin resistance [29]. Additionally, a piece of data suggests that AIP is more closely associated with increased CVD risk than lipids alone, and is more significantly correlated with CVD risk when compared to other risk parameters [30]. Thus, it adds clinical advantages compared with the use of the simple TG and Int J Vitam Nutr Res (2020), 90 (1–2), 95–102

100

S. Ebrahimi et al., Fasting, Ramadan fasting, NAFLD, Liver Enzyme, VAI, AIP

Table 4. The values of VAI in groups, according to gender. Variable

Females Fasting

Males

Non-fasting (n=)

Fasting

Non-fasting (n=)

VAI Before

9.67 ± 3.02

9.18 ± 3.96

0.726

7.90 ± 2.67

6.84 ± 2.36

0.127

After

9.22 ± 3.96

8.30 ± 2.91

0.425

7.19 ± 2.47

6.17 ± 2.12

0.043

0.001

0.312

0.71 ± 0.93

0.67 ± 1.08

Pa Change

0.066

0.073

0.45 ± 0.95

0.88 ± 1.28 a

0.772

Data are presented as mean ± SD. P Within group comparison (paired t-test), P Between group comparisons (independent t-test or the Mann–Whitney U-test, based on normality). P Value < 0.05 is significant. VAI: Visceral Adiposity Index.

Table 5. The blood levels of serum lipid profile before and after Ramadan Variable

Fasting (n = 42) Non-fasting (n = 41) Pb

Table 6. Before and after Ramadan fasting levels of liver enzyme and ultrasound findings of participants. Variable

Triglycerides (mg/dL) Before

196.02 ± 49.33

186.51 ± 48.33

0.53

After

183.83 ± 53.51

180.27 ± 57.77

0.49

Change

16.04 ± 13.78

17.00 ± 27.11

0.314

Before

205.28 ± 35.16

214.05 ± 37.49

0.613

After

191.57 ± 32.00

201.07 ± 26.32

0.144

Change

13.71 ± 11.79

7.80 ± 11.60

0.016

42.28 ± 12.72 42.63 ± 12.50 0.945

After

37.62 ± 11.04 40.27 ± 11.08 0.558

Before

153.40 ± 29.18

145.25 ± 26.79

0.192

After

146.21 ± 27.96

139.07 ± 24.60

0.224

7.19 ± 8.84

6.17 ± 8.47

0.603

Before

37.55 ± 8.08

39.32 ± 8.08

0.208

After

37.19 ± 8.12

39.39 ± 7.67

0.122

0.36 ± 2.86

0.07 ± 2.24

0.252

AIP Before

2.36 ± 4.31 0.031

Before

39.97 ± 10.80 41.44 ± 9.93 0.523

After

36.54 ± 10.11 44.02 ± 20.66 0.057 3.43 ± 4.51

2.58 ± 18.03 0.046 0.392

Grade 1 (%)

31 (73.8%)

32 (78.0%)

Grade 2

7 (16.7%)

8 (19.5%)

Grade 3

4 (9.5%)

1 (2.4%)

15 (35.7%)

6 (14.6%)

Grade 1 (%)

22 (52.4%)

26 (63.4%)

Grade 2

5 (11.9%)

8 (19.5%)

Grade 3

1 (2.4%)

NAFLD grade (after Ramadan)

HDL-cholesterol (mg/dL)

Change

4.66 ± 4.94

SGPT (IU/L)

NAFLD grade** (before Ramadan)

LDL-cholesterol (mg/dL)

0.72 ± 0.14

0.67 ± 0.14

0.165

After

0.68 ± 0.14

0.63 ± 0.14

0.097

Change

0.034 ± 0.05

0.04 ± 0.06

0.792

Data are represented as mean ± SD. Pb Between group comparisons (independent t-test or the Mann–Whitney U-test, based on normality). AIP: Atherogenic Index of Plasma.

HDL concentration. In view of the clinical importance of insulin resistance in NAFLD patients, and the increased risk of cardiovascular disease in patients with NAFLD [31], improvement of this index in NAFLD patients is of paramount importance. More studies are needed to elucidate the effects of fasting and dietary approaches on AIP. Providing statistical evidence, we showed that fasting has affected the levels of the hepatic enzyme in NAFLD patients. However, what is not well understood is the reason why non-fasting group showed similar changes in their levels of the hepatic enzyme. In our hypothesis, regarding the religious beliefs, their diets were as tightly controlled as fasting group. A piece of research has investigated the Int J Vitam Nutr Res (2020), 90 (1–2), 95–102

Before

Change

Non-fasting (n = 41)

SGOT (IU/L)

Change

Total cholesterol (mg/dL)

Fasting (n = 42)

0.024

Data are presented as mean ± SD. P Between group comparisons (independent t-test or the Mann–Whitney U-test, based on normality). p Value < 0.05 is significant. SGOT: Aspartate aminotransferase; SGPT: Alanine aminotransferase.

changes in hepatic enzyme during Ramadan. Lower levels of ALT, compared to before Ramadan values, has been observed in Healthy and Obese Individuals [32]. Along with our findings, Arabi SM et al [33] reported remarkably significant lower levels of ALT after Ramadan in NAFLD patients. A study by Hannah WN et al [34] provides an explanation for the improvement of hepatic function since they stated that weight loss of 3% to 5% reduces hepatic steatosis. Based on our findings, we supported our hypothesis which fasting would improve the liver fibrosis Since there is no solid data regarding the beneficial effects of Ramadan fasting on the severity of NAFLD, further study is warranted to get a clear conclusion in this regard. To sum up, both timing of caloric intake as well as the caloric restriction may account for these improvements Ó 2019 Hogrefe

S. Ebrahimi et al., Fasting, Ramadan fasting, NAFLD, Liver Enzyme, VAI, AIP

[15]. Eating two meals, one light meal just before the dawn and relatively large one immediately after sunset are characteristic of Ramadan feeding pattern. We conclude that fasting practice is a promising approach to manipulating the inflammatory process, liver fibrosis in NAFLD patients. The mechanism by which fasting exerts these beneficial effects needs to be elucidated. The current study had several strengths including, this study evaluated, for the first time, the impact of RF on VAI and AIP, which are involved in the obesity-related metabolic disturbance. This study is of a great interest to understand whether lifestyle behaviors during Ramadan including altered eating behaviors could affect the biomarkers of NAFLD patients. One limitation of our study was the lack of liver biopsy results. Additionally, we did not investigate the effects of diurnal rhythm-related hormones, and we did not follow up the effects of RF, as it is possible that they are transient.

References 1. Michelotti, G.A., Machado, M.V., & Diehl, A.M. (2013) NAFLD, NASH and liver cancer. Nature Reviews Gastroenterology and Hepatology. 10(11), 656–665. 2. Stachowska, E., et al. (2016) Nutritional Strategies for the Individualized Treatment of Non-Alcoholic Fatty Liver Disease (NAFLD) Based on the Nutrient-Induced Insulin Output Ratio (NIOR). International Journal of Molecular Sciences. 17(7), 1192. 3. Oh, S., et al. (2015) Moderate to vigorous physical activity volume is an important factor for managing nonalcoholic fatty liver disease: a retrospective study. Hepatology. 61(4), 1205–1215. 4. Lazo, M., et al. (2011) Non-alcoholic fatty liver disease and mortality among US adults: prospective cohort study. Bmj. 343, d6891–0000. 5. Yoon, H., & Cha, B.S. (2014) Pathogenesis and therapeutic approaches for non-alcoholic fatty liver disease. World J Hepatol. 6(11), 800–811. 6. Promrat, K., et al. (2010) Randomized controlled trial testing the effects of weight loss on nonalcoholic steatohepatitis. Hepatology. 51(1), 121–129. 7. Celik, A., et al. (2014) Effect of Ramadan fasting on serum concentration of apelin-13 and new obesity indices in healthy adult men. Medical Science Monitor. 20, 337–342. 8. Yousefi, B., et al. (2014) The effects of Ramadan fasting on endothelial function in patients with cardiovascular diseases. European Journal of Clinical Nutrition. 68(7), 835–839. 9. Du, T., et al. (2014) Visceral adiposity index, hypertriglyceridemic waist and risk of diabetes: the China Health and Nutrition Survey 2009. International Journal of Obesity. 38(6). 10. Amato, M.C., & Giordano, C. (2014) Visceral adiposity index: an indicator of adipose tissue dysfunction. International Journal of Endocrinology. 2014. 11. Amato, M.C., et al. (2010) Visceral Adiposity Index A reliable indicator of visceral fat function associated with cardiometabolic risk. Diabetes Care. 33(4), 920–922. 12. Dobiás˘ová, M., & Frohlich, J. (2001) The plasma parameter log (TG/HDL-C) as an atherogenic index: correlation with lipoprotein

Ó 2019 Hogrefe

13.

14.

15.

16.

17.

18.

19.

20.

21.

22.

23.

24.

25.

26.

27.

28.

29.

30.

31.

101

particle size and esterification rate inapoB-lipoprotein-depleted plasma (FER HDL). Clinical Biochemistry. 34(7), 583–588. Kleiner, D.E., et al. (2005) Design and validation of a histological scoring system for nonalcoholic fatty liver disease. Hepatology. 41(6), 1313–1321. Al Hourani, H.M., et al. (2009) Effects of Ramadan fasting on some haematological and biochemical parameters. Jordan J Biol Sci. 2(3), 103–108. Asadi, H., et al. (2015) Effects of Ramadan fasting on serum amyloid A and protein carbonyl group levels in patients with cardiovascular diseases. Journal of Cardiovascular and Thoracic Research. 7(2), 55. Syam, A.F., et al. (2016) Ramadan fasting decreases body fat but not protein mass. International Journal of Endocrinology and Metabolism. 14(1). Mohammad, M.K. (2012) Impact of Ramadan Intermittent Fasting on Oxidative Stress Measured by Urinary 15-F2tIsoprostane. Norouzy, A., et al. (2013) Effect of fasting in Ramadan on body composition and nutritional intake: a prospective study. Journal of Human Nutrition and Dietetics. 26(s1), 97–104. Kul, S., et al. (2014) Does Ramadan fasting alter body weight and blood lipids and fasting blood glucose in a healthy population? A meta-analysis. Journal of Religion and Health. 53(3), 929–942. Shariatpanahi, Z.V., et al. (2008) Effect of Ramadan fasting on some indices of insulin resistance and components of the metabolic syndrome in healthy male adults. British Journal of Nutrition. 100(1), 147. Kacimi, S., et al. (2012) Intermittent fasting during Ramadan attenuates proinflammatory cytokines and immune cells in healthy subjects. Nutrition Research. 32(12), 947–955. Petta, S., et al. (2012) Visceral adiposity index is associated with significant fibrosis in patients with non-alcoholic fatty liver disease. Alimentary Pharmacology & Therapeutics. 35(2), 238–247. Androulakis, I.I., et al. (2014) Visceral adiposity index (VAI) is related to the severity of anovulation and other clinical features in women with polycystic ovary syndrome. Clinical Endocrinology. 81(3), 426–431. Oh, J.Y., Sung, Y.A., & Lee, H.J. (2013) The visceral adiposity index as a predictor of insulin resistance in young women with polycystic ovary syndrome. Obesity. 21(8), 1690–1694. Salim, I., et al. (2013) Impact of religious Ramadan fasting on cardiovascular disease: a systematic review of the literature. Current Medical Research and Opinion. 29(4), 343–354. Ziaee, V., et al. (2006) The changes of metabolic profile and weight during Ramadan fasting. Singapore Medical Journal. 47(5), 409. Caminhotto, R.d.O., et al. (2015) Atkins diet program rapidly decreases atherogenic index of plasma in trained adapted overweight men. Archives of Endocrinology and Metabolism.0–0. (AHEAD) Niroumand, S., et al. (2015) Atherogenic Index of Plasma (AIP): A marker of cardiovascular disease. Medical Journal of the Islamic Republic of Iran. 29, 240. Salazar, M.R., et al. (2014) Identification of cardiometabolic risk: visceral adiposity index versus triglyceride/HDL cholesterol ratio. The American Journal of Medicine. 127(2), 152– 157. Bhardwaj, S., et al. (2013) Atherogenic index of plasma, castelli risk index and atherogenic coefficient-new parameters in assessing cardiovascular risk. Int J Pharm Biol Sci. 3 (3), 359–364. Tarantino, G., et al. (2016) Serum levels of Lp (a) are related to waist circumference in NAFLD patients with low prevalence of

Int J Vitam Nutr Res (2020), 90 (1–2), 95–102

102

S. Ebrahimi et al., Fasting, Ramadan fasting, NAFLD, Liver Enzyme, VAI, AIP

co-morbidities. Scandinavian Journal of Clinical and Laboratory Investigation.1–9. 32. Ünalacak, M., et al. (2011) Effects of Ramadan fasting on biochemical and hematological parameters and cytokines in healthy and obese individuals. Metabolic Syndrome and Related Disorders. 9(2), 157–161. 33. Arabi, S.M., et al. (2015) The effect of Ramadan fasting on non-alcoholic fatty liver disease (NAFLD) patients: a prospective observational study. Journal of Fasting and Health. 3(2), 74–80. 34. Hannah, W.N., & Harrison, S.A. (2016) Effect of weight loss, diet, exercise, and bariatric surgery on nonalcoholic fatty liver disease. Clinics in Liver Disease. 20(2), 339–350.

Conflicts of interest The authors declare no conflict of interest. Azimeh Izadi Department of Biochemistry and Diet Therapy Nutrition Research Center, Faculty of Nutrition and Food Science Tabriz University of Medical Sciences, Tabriz, Iran Golgasht st, Tabriz, Iran izadia@tbzmed.ac.ir

Acknowledgments The Jahrom University of Medical funded the present study with the grant number 94/154. We gratefully acknowledge all patients who participated in this study.

Int J Vitam Nutr Res (2020), 90 (1–2), 95–102

Ó 2019 Hogrefe

Original Communication

Inhibition of Pro-Inflammatory Cytokine Secretion by Select Antioxidants in Human Coronary Artery Endothelial Cells Michael J. Haas, Marilu Jurado-Flores, Ramadan Hammoud, Victoria Feng, Krista Gonzales, Luisa Onstead-Haas, and Arshag D Mooradian Department of Medicine, Division of Endocrinology, Diabetes, and Metabolism, University of Florida Jacksonville College of Medicine, Jacksonville, FL 32209. Received: March 21, 2017; Accepted: March 2, 2018

Abstract: Inflammatory and oxidative stress in endothelial cells are implicated in the pathogenesis of premature atherosclerosis in diabetes. To determine whether high-dextrose concentrations induce the expression of pro-inflammatory cytokines, human coronary artery endothelial cells (HCAEC) were exposed to either 5.5 or 27.5 mM dextrose for 24-hours and interleukin-1β (IL-1β), interleukin-2 (IL-2), interleukin-6 (IL-6), interleukin-8 (IL-8), and tumor necrosis factor α (TNF α) levels were measured by enzyme immunoassays. To determine the effect of antioxidants on inflammatory cytokine secretion, cells were also treated with α-tocopherol, ascorbic acid, and the glutathione peroxidase mimetic ebselen. Only the concentration of IL-1β in culture media from cells exposed to 27.5 mM dextrose increased relative to cells maintained in 5.5 mM dextrose. Treatment with α-tocopherol (10, 100, and 1,000 μM) and ascorbic acid (15, 150, and 1,500 μM) at the same time that the dextrose was added reduced IL-1β, IL-6, and IL-8 levels in culture media from cells maintained at 5.5 mM dextrose but had no effect on IL-1β, IL-6, and IL-8 levels in cells exposed to 27.5 mM dextrose. However, ebselen treatment reduced IL-1β, IL-6, and IL-8 levels in cells maintained in either 5.5 or 27.5 mM dextrose. IL-2 and TNF α concentrations in culture media were below the limit of detection under all experimental conditions studied suggesting that these cells may not synthesize detectable quantities of these cytokines. These results suggest that dextrose at certain concentrations may increase IL-1β levels and that antioxidants have differential effects on suppressing the secretion of pro-inflammatory cytokines in HCAEC.

Introduction Though lipids and cholesterol were once thought to be essential for the initiation of atherosclerosis, it is now clear that inflammation plays a primary role in its pathophysiology [1, 2]. Fatty streak formation, thought to be the earliest type of lesion, is formed by activated macrophage cells derived from monocytes that attached and crossed to the sub-endothelial space and accumulate lipids and cholesterol from low-density lipoprotein (LDL) [3, 4]. Coronary artery endothelial cells play an essential role in this process. In the presence of pro-inflammatory cytokines, coronary artery endothelial cells express cell adhesion molecules (CAMs) including intra-CAM and vascular CAM [5, 6], which are essential for the adhesion of monocytes at the site of endothelial dysfunction and differentiate into macrophage cells. Coronary artery endothelial cells play an essential role in directing where inflammatory processes take Ó 2019 Hogrefe

place and mount an appropriate response such as repairing the inflammatory insult. To accomplish this, endothelial cells express a variety of chemokine and cytokines [7, 8] which orchestrate the response. However, coronary artery endothelial cells are also targeted by inflammatory processes in which they go through a phenotypic response to an activated state characterized by their decreased barrier function, altered vascular tone, and pro-thrombotic state. If chronic injurious conditions persist, this endothelial dysfunction accelerates the atherogenic process. Though the antioxidants vitamin E and vitamin C failed to prevent cardiovascular disease in clinical trials [9–11], the glutathione peroxidase mimetic ebselen has not been examined in this context though it has been shown to prevent cerebral vascular ischemia and stroke [12]. Human coronary artery endothelial cells (HCAECs) are an important model for examining the effects of various pathological processes on cell stress in vitro. High-dextrose was Int J Vitam Nutr Res (2020), 90 (1–2), 103–112 https://doi.org/10.1024/0300-9831/a000520

104

demonstrated to induce oxidative stress in human umbilical vein endothelial cells (HUVEC) and HCAEC, which could be prevented by the addition of various antioxidants such as α-tocopherol, ascorbic acid, and ebselen [13–15]. Highdextrose also induced endoplasmic reticulum (ER) stress in both human umbilical vein endothelial cells (HUVEC) and HCAEC, however this was not inhibited by the addition of α-tocopherol, ascorbic acid and ebselen [14, 15]. Based on these observations, we hypothesized that high-dextrose levels may promote inflammatory stress in HCAEC by inducing the expression of pro-inflammatory cytokines and that these may be inhibited by the addition of α-tocopherol, ascorbic acid, and ebselen. To examine this, we exposed HCAEC to normal dextrose levels (5.5 mM) or high-dextrose (27.5 mM) and measured interleukin-1β (IL-1β), interleukin-2 (IL-2), interleukin-6 (IL-6), interleukin-8 (IL-8), and TNF α production. Each of these cytokines have been shown to activate endothelial cells, potentially promoting atherosclerosis [16].

Materials and Methods Materials Ascorbic acid and α-tocopherol were purchased from Sigma-Aldrich (Saint Louis, MO) and ebselen was purchased from Cayman Chemical (Ann Arbor, MI). Cell culture media and additives, trypsin, and trypsin inhibitor were purchased from American Type Culture Collection (ATCC) (Manassas, VA). Enzyme immunoassay kits for IL-1β (DY201-05), IL-2 (DY202-05), IL-6 (DY206-05), IL8 (DY208-05), and TNF α (DY210-05) were purchased from R&D Systems (Minneapolis, MN). All other chemicals were purchased from either Sigma-Aldrich or Fischer Scientific (Pittsburg, PA).

M. J. Haas et al., Antioxidants Inhibit Cytokine Expression

Figure 1. Experimental design. Human coronary artery endothelial cells (HCAEC) were exposed to either 5.5 or 27.5 mM dextrose in the presence or absence of 10, 100, and 1,000 μM α-tocopherol, 15, 150, and 1,500 μM ascorbic acid, or 0.1, 1.0, or 10 μM ebselen. After 24hours and IL-1β, IL-2, IL-6, IL-8, and TNF α levels were measured in the conditioned medium by enzyme immunoassay (EIA).

concentrations of α-tocopherol used is at the low end of the plasma reference range and the 100 μM dose is slightly higher than normal plasma levels. The 15 and 150 μM doses of ascorbic acid are slightly lower and higher than the reference range in human plasma. Finally, we examined 1,000 μM α-tocopherol and 1,500 μM ascorbic acid to examine the effects of supra-physiological levels of each antioxidant. The control cells in these experiments were treated with media containing 5.5 mM dextrose and an equivalent volume of dimethylsulfoxide, the solvent for the drugs used in each experiment. Dextrose concentrations were adjusted to 27.5 mM by the addition of a concentrated, sterile dextrose dissolved in tissue culture-certified dH2O. An equivalent amount of the same volume was added to the media used in the control cells. The cells were maintained in a humidified incubator at 37°C and 5% CO2. Experiments were performed with cells in passages 3 and 4.

Cytokine enzyme immunoassay HCAEC culture HCAEC (PCS-100-020) were purchased from American Type Culture Collection (Manassas, VA) and maintained in vascular endothelial cell growth medium containing 0.2% bovine brain extract, 5 ng/ml recombinant human epidermal growth factor, 10 mM glutamine, 1 μg/ml hydrocortisone hemisuccinate, 0.75 units/ml heparin sulfate, 50 μg/ml ascorbic acid, 2% fetal bovine serum, 10 units/ml penicillin and 10 μg/ml streptomycin. HCAEC were exposed to either 5.5 or 27.5 mM dextrose and treated with 10, 100, and 1,000 μM α-tocopherol, 15, 150, and 1,500 μM ascorbic acid, and 0.1, 1, and 10 μM ebselen for 24-hours and IL-1β, IL-2, IL-6, IL-8, and TNF α levels were measured in the conditioned medium (Figure 1). The lowest Int J Vitam Nutr Res (2020), 90 (1–2), 103–112

IL-1β, IL-2, IL-6, IL-8, and TNF α levels were measured in 100 μl of conditioned medium from cells exposed to either 5.5 or 27.5 mM dextrose and treated with 10, 100, and 1,000 μM α-tocopherol, 15, 150, and 1,500 μM ascorbic acid, and 0.1, 1, and 10 μM ebselen for 24-hours. The immunoassays were performed following the manufacturer’s directions though two changes were made to increase sensitivity. First, the samples and standards were allowed to bind the capture antibody by incubating the plates at 4°C for 24-hours. Second, detection antibody binding was also allowed to occur at 4°C for 24-hours. Optical densities at 450 nm (signal) and 570 nm (background) were measured with an ELx800 microplate spectrophotometer (BioTek Instruments, Inc., Winooski, VT USA) and exported to Microsoft Excel. Ó 2019 Hogrefe

M. J. Haas et al., Antioxidants Inhibit Cytokine Expression

Cytokine levels were calculated from the linear region of the standard curves using Microsoft Excel. The intra-assay precision (coefficient of variation, CV) for the IL-1β enzyme immunoassay is 2.4% with a lower limit of detection of 1 pg/ ml. The intra-assay precision (CV) for the IL-2 enzyme immunoassay is 4.3% with a lower limit of detection of 7 pg/ml. The intra-assay precision (CV) for the IL-6 enzyme immunoassay is 4.4% with a lower limit of detection of 0.7 pg/ml. The intra-assay precision (CV) for the IL-8 enzyme immunoassay is 4.6% with a lower limit of detection of 7.5 pg/ml. The intra-assay precision (CV) for the TNF α enzyme immunoassay is 5.3% with a lower limit of detection of 1.6 pg/ml.

Data analysis and statistics The results are expressed as the mean ± standard deviation. Normal distribution of the data was tested with the ShapiroWilk test while equality of variance was assessed using Levene’s test. Statistical significance was assessed by oneway analysis of variance (ANOVA) followed by the Dunnett multiple comparison test to compare treatments with the controls. Statistical analyses were performed with SPSS (Armonk, NY).

Results The effect of dextrose and α-tocopherol, ascorbic acid, and ebselen on IL-1β levels Exposing cells to 27.5 mM dextrose increased IL-1β levels slightly (10.1 ± 0.1%) relative to cells treated with 5.5 mM dextrose (p<0.05) (Figure 2A). Treatment of cells exposed to 27.5 mM dextrose with α-tocopherol had no effect on IL-1β levels relative to cells exposed to 27.5 mM dextrose. Though the two lowest concentrations had no effect on IL-1β levels, the highest concentration of ascorbic acid suppressed IL-1β levels significantly (9.3 ± 3.7%, p<0.05 relative to cells exposed to 27.5 mM dextrose). In contrast, treatment of cells with ebselen significantly decreased IL1β levels 10.6 ± 0.3%, 24.6 ± 1.6%, and 15.8 ± 1.1% in cells treated with 0.1, 1, and 10 μM ebselen, respectively, relative to IL-1β levels in cells exposed to 27.5 mM dextrose (p<0.05, p<0.01, and p<0.01, respectively) (Figure 2A). In cells exposed to 5.5 mM dextrose, all three antioxidants that were tested decreased IL-1β levels relative to cells treated with 5.5 mM dextrose alone. Treatment with 10, 100, and 1,000 μM α-tocopherol decreased IL-1β levels to 19.3 ± 2.5%, 17.6 ± 3.8%, and 10.5 ± 3.0%, respectively (p<0.05, p<0.05, and p<0.05, respectively relative to cells treated with 5.5 mM dextrose) (Figure 2B). Treatment with 15, Ó 2019 Hogrefe

105

150, and 1,500 μM ascorbic decreased IL-1β levels 14.1 ± 2.0%, 15.8 ± 1.7%, and 15.8 ± 4.2%, respectively (p<0.05, p<0.01, and p<0.05, respectively relative to cells exposed to 5.5 mM dextrose) (Figure 2B). Treatment with 0.1, 1, and 10 μM ebselen decreased IL-1β levels 26.3 ± 0.7%, 28.1 ± 1.2%, and 28.2 ± 1.5%, respectively (p<0.01, p<0.01, and p<0.01, respectively relative to cells exposed to 5.5 mM dextrose) (Figure 2B).

The effect of dextrose and α-tocopherol, ascorbic acid, and ebselen on IL-6 levels In contrast to IL-1β levels, exposing cells to 27.5 mM dextrose had no effect on IL-6 levels relative to cells exposed to 5.5 mM dextrose (Figure 3A). While treatment with ebselen suppressed IL-6 levels in cells exposed to 27.5 mM dextrose relative to cells exposed to 27.5 mM dextrose alone (24.2 ± 4.2%, 11.0 ± 1.0%, and 16.9 ± 1.1% in cells treated with 0.1, 1, and 10 μM ebselen) (p<0.05, p<0.05, and p<0.05 respectively relative to cells exposed to 27.5 mM dextrose), treatment with 1,000 μM α-tocopherol increased IL-6 levels (17 ± 1.2%, p<0.05 relative to cells exposed to 27.5 mM dextrose) and treatment with ascorbic acid had no effect (Figure 3A). When cells were exposed to 5.5 mM dextrose, α-tocopherol, ascorbic acid and ebselen decreased IL-6 levels (Figure 3B). Treatment with 10, 100, and 1,000 μM α-tocopherol decreased IL-6 levels 26.5 ± 1.9%, 23.8 ± 3.6%, and 21.5 ± 4.1%, respectively (p<0.01, p<0.01, and p<0.05, respectively relative to cells exposed to 5.5 mM dextrose) (Figure 3B). Treatment with 15, 150, and 1,500 μM ascorbic acid decreased IL-6 levels 10.6 ± 7.1%, 24.3 ± 1.2%, 23.7 ± 3.6%, respectively (p<0.01 and p<0.01, respectively relative to cells exposed to 5.5 mM dextrose) (Figure 3B). Treatment with 0.1, 1, and 10 μM ebselen decreased IL-6 levels 25.2 ± 1.8%, 28.3 ± 2.5%, and 28.8 ± 2.6%, respectively (p<0.01, p<0.01, and p<0.01, respectively relative to cells exposed to 5.5 mM dextrose) (Figure 3B).

The effect of dextrose and α-tocopherol, ascorbic acid, and ebselen on IL-8 levels Compared to cells exposed to 5.5 mM dextrose, exposure to 27.5 mM dextrose did not alter IL-8 concentrations (Figure 4A). Treatment with α-tocopherol and ascorbic also had no effect on IL-8 levels while treatment with 0.1, 1, and 10 mM ebselen reduced IL-8 levels 33.7 ± 1.1%, 27.1 ± 6.2%, and 22.1 ± 2.9% relative to cells exposed to 27.5 mM dextrose alone (p<0.01, p<0.05, and p<0.05, respectively relative to cells exposed to 27.5 mM dextrose) (Figure 4A). However, in cells maintained in 5.5 mM dextrose, treatment with α-tocopherol, ascorbic acid, and ebselen were all Int J Vitam Nutr Res (2020), 90 (1–2), 103–112

106

M. J. Haas et al., Antioxidants Inhibit Cytokine Expression

Figure 2. The effect of low- and high-dextrose and α-tocopherol, ascorbic acid, and ebselen on IL-1β levels. A. HCAEC were exposed to either 5.5 or 27.5 mM dextrose (Dex) and treated with 10, 100, and 1,000 μM α-tocopherol (Toc), 15, 150, and 1,500 μM ascorbic acid (AA), and 0.1, 1, and 10 μM ebselen (EB) for 24-hours and IL-1β levels were measured in the conditioned medium. Exposure to 27.5 mM dextrose increased IL-1β levels relative to IL-1β levels in cells exposed to 5.5 mM dextrose. Treatment with α-tocopherol acid had no effect on IL-1β levels in cells exposed to 27.5 mM dextrose relative to cells exposed to 27.5 mM dextrose alone. Treatment with the two lower concentrations of ascorbic acid had no effect on IL-1β levels relative to cells exposed to 27.5 mM dextrose, however the highest dose decreased IL-1β levels significantly. In contrast, treatment with ebselen at all concentrations reduced IL-1β levels at all the concentrations examined relative to cells exposed to 27.5 mM dextrose. N=6; *, p<0.05, p<0.05, p<0.01, and p<0.01, respectively relative to cells exposed to 27.5 mM dextrose. B. HCAEC were exposed to 5.5 mM dextrose and treated with 10, 100, and 1,000 μM α-tocopherol, 15, 150, and 1,500 μM ascorbic acid, and 0.1, 1, and 10 μM ebselen for 24-hours and IL-1β levels were measured in the conditioned medium. Treatment with α-tocopherol, ascorbic acid, and ebselen reduced IL-1β levels relative to cells exposed to 5.5 mM dextrose alone. N=6; *, p<0.05, p<0.05, p<0.05, p<0.05, p<0.01, p<0.05, p<0.01, p<0.01, and p<0.01, respectively relative to cells exposed to 5.5 mM dextrose.

Int J Vitam Nutr Res (2020), 90 (1–2), 103–112

Ó 2019 Hogrefe

M. J. Haas et al., Antioxidants Inhibit Cytokine Expression

107

Figure 3. The effect of low- and high-dextrose and α-tocopherol, ascorbic acid, and ebselen on IL-6 levels. A. HCAEC were exposed to either 5.5 or 27.5 mM dextrose (Dex) and treated with 10, 100, and 1,000 μM α-tocopherol (Toc), 15, 150, and 1,500 μM ascorbic acid (AA), and 0.1, 1, and 10 μM ebselen (EB) for 24-hours and IL-6 levels were measured in the conditioned medium. Exposure to 27.5 mM dextrose had no effect on IL-6 levels relative to IL-6 levels in cells exposed to 5.5 mM dextrose. Treatment with ascorbic acid had no effect on IL-6 levels in cells exposed to 27.5 mM dextrose. Treatment with α-tocopherol had no effect on IL-6 levels at the two lower doses but actually increased IL-6 levels treated with the highest dose. In contrast, treatment with ebselen reduced IL-6 levels at all the concentrations examined. N=6; *, p<0.05, p<0.05, p<0.05, and p<0.05, respectively relative to cells exposed to 27.5 mM dextrose. B.HCAEC were exposed to 5.5 mM dextrose and treated with 10, 100, and 1,000 μM α-tocopherol, 15, 150, and 1,500 μM ascorbic acid, and 0.1, 1, and 10 μM ebselen for 24-hours and IL-6 levels were measured in the conditioned medium. Treatment with α-tocopherol, ascorbic acid, and ebselen reduced IL-6 levels. N=6; *, p<0.01, p<0.01, p<0.05, p<0.01, p<0.01, p<0.01, p<0.01, and p<0.01, respectively relative to cells exposed to 5.5 mM dextrose.

Ó 2019 Hogrefe

Int J Vitam Nutr Res (2020), 90 (1–2), 103–112

108

M. J. Haas et al., Antioxidants Inhibit Cytokine Expression

Figure 4. The effect of low- and high-dextrose and α-tocopherol, ascorbic acid, and ebselen on IL-8 levels. A. HCAEC were exposed to either 5.5 or 27.5 mM dextrose (Dex) and treated with 10, 100, and 1,000 μM α-tocopherol (Toc), 15, 150, and 1,500 μM ascorbic acid (AA), and 0.1, 1, and 10 μM ebselen (EB) for 24-hours and IL-8 levels were measured in the conditioned medium. Exposure to 27.5 mM dextrose had no effect on IL-8 levels relative to IL-8 levels in cells exposed to 5.5 mM dextrose. Treatment with ascorbic acid had no effect on IL-8 levels in cells exposed to 27.5 mM dextrose. Treatment with α-tocopherol and ascorbic acid had no effect on IL-8 levels. In contrast, treatment with ebselen reduced IL-6 levels at all the concentrations examined. N=6; *, p<0.01, p<0.05, and p<0.05, respectively relative to cells exposed to 27.5 mM dextrose. B. HCAEC were exposed to 5.5 mM dextrose and treated with 10, 100, and 1,000 μM α-tocopherol, 15, 150, and 1,500 μM ascorbic acid, and 0.1, 1, and 10 μM ebselen for 24-hours and IL-8 levels were measured in the conditioned medium. Treatment with α-tocopherol, ascorbic acid, and ebselen reduced IL-8 levels. N=6; *, p<0.01, p<0.01, p<0.01, p<0.01, p<0.01, p<0.01, p<0.01, p<0.01 and p<0.01, respectively relative to cells exposed to 5.5 mM dextrose.

equally effective at suppressing IL-8 levels relative to cells exposed to 5.5 mM dextrose alone (Figure 4B). Treatment with 10, 100, and 1,000 μM α-tocopherol decreased IL-8 Int J Vitam Nutr Res (2020), 90 (1–2), 103–112

levels 35.3 ± 2.4%, 31.1 ± 3.3%, and 32.6 ± 2.2%, respectively (p<0.01, p<0.01, and p<0.01, respectively relative to cells exposed to 5.5 mM dextrose) (Figure 4B). Treatment with Ó 2019 Hogrefe

M. J. Haas et al., Antioxidants Inhibit Cytokine Expression

15, 150, and 1,500 μM ascorbic acid decreased IL-8 levels 32.3 ± 1.1%, 36.5 ± 4.7%, 35.8 ± 5.9%, respectively (p<0.01, p<0.01, and p<0.01, respectively relative to cells exposed to 5.5 mM dextrose) (Figure 4B). Treatment with 0.1, 1, and 10 μM ebselen decreased IL-8 levels 37.0 ± 0.7%, 38.9 ± 1.2%, and 34.3 ± 1.0%, respectively (p<0.01, p<0.01, and p<0.01, respectively relative to cells exposed to 5.5 mM dextrose) (Figure 4B). These results and those described above suggest that α-tocopherol and ascorbic were only effective at suppressing IL-1β, IL-6 and IL-8 levels in cells exposed to 5.5 mM dextrose and not in cells exposed to 27.5 mM dextrose. In contrast, ebselen treatment suppressed IL-1β, IL-6 and IL8 levels in cells exposed to both 5.5 and 27.5 mM dextrose.

The effect of dextrose and α-tocopherol, ascorbic acid, and ebselen on IL-2 and TNF α levels Neither IL-2 nor TNF α could be detected in the conditioned media of cells maintained either in 5.5 mM or 27.5 mM dextrose and treated with the antioxidants since they were below the lower limit of the assay in each case (7 pg/ml and 1.6 pg/ml, respectively). These results suggest that HCAEC do not secrete these two cytokines, even when treated with high-dextrose concentrations for 24-hours.

Discussion The early stage of atherosclerosis is associated with endothelial cell stress and the release of pro-inflammatory cytokines and vascular adhesion molecules that induce proliferation of the underlying smooth muscle cells and promote monocyte invasion and differentiation into macrophage cells. Therefore, how these cells respond to various physiological stressors is critical to understand how these processes can be reversed. Previous studies have demonstrated that high-dextrose concentrations increase both oxidative stress and ER stress in both HUVEC and HCAEC [13–15]. Though antioxidants such as α-tocopherol, ascorbic acid, and the glutathione peroxidase mimetic ebselen suppressed the former, they had no effect on ER stress. Likewise, treatment with high concentrations of the antioxidants α-tocopherol and ascorbic acid actually induced ER stress in HCAEC [14]. The two lower concentrations of α-tocopherol (10 and 100 μM) and ascorbic acid (15 and 150 μM) are at the low and high ends of the normal plasma levels for each antioxidant and were used in a prior study by us to examine the effects of antioxidants on high-dextrose-induced oxidative stress in human umbilical vein endothelial cells [17]. The Ó 2019 Hogrefe

109

highest doses we used (1,000 μM α-tocopherol and 1,500 μM ascorbic acid) may or may not be achieved by individuals who consume much higher doses of each vitamin. After consumption, 70% of α-tocopherol is absorbed and transported to the liver where it is stored and released into the plasma to maintain adequate levels, while 30% of the αtocopherol is not absorbed and is released into the feces [18]. α–Tocopherol is also released into the bile where it undergoes enterohepatic circulation while some is lost through the feces [19]. In the liver (and in other tissues to a lesser degree), α-tocopherol is metabolized in several ways, forming quinone derivatives [20], α-carboxyethylhydroxychromans (α-CEHC) [21] and other less characterized metabolites [22]. Some α-tocopherol metabolites have been shown to have distinct biochemical effects. The metabolite α-tocopheryl quinone was shown to inhibit vitamin K-dependent carboxylase activity in vitro and may affect blood coagulation [23], while the reduced form of α-tocopheryl quinone, α-tocopheryl hydroquinone, was shown to inhibit lipid peroxidation [24]. Furthermore, α-CEHC was shown to possess anti-inflammatory activity by inhibiting TNF α-stimulated nitrite production in both rat aortic endothelial cells and mouse microglial cells, lipopolysaccharide-stimulated nitrite efflux from mouse microglial cells, and prostaglandin E2 production from mouse microglial cells [25]. Interestingly, α-tocopherol had no effect at inhibiting these cytokine-stimulated inflammatory processes suggesting that the anti-inflammatory effects of the tocopherols are cell type and stimulus dependent [25]. Ascorbic acid is absorbed within the gastrointestinal tract by both simple diffusion and through active transport by the sodium-ascorbate co-transporters 1 and 2 (SVCT1 and SVCT2) [26]. Ascorbic acid is an essential co-factor for several enzymes involved in the synthesis of collagen and carnitine, as well as peptide hormone amidation. Plasma levels of ascorbic acid are maintained at a threshold of 1.5 mg/dl for men and 1.3 mg/dl for women, above which it is rapidly excreted in the urine. However, ascorbic acid bioavailability is influenced by several factors and low vitamin C levels are often observed with aging, smoking, obesity, alcohol consumption, as well as by genetic variation in the SVCT gene [27, 28]. In addition, cellular and tissue ascorbic acid uptake can vary dramatically and these levels cannot be ascertained by measuring plasma ascorbic acid levels [29]. Other antioxidants have been shown to suppress inflammation both in vitro and in vivo. Muzakova et al. examined correlations between β-carotene levels and IL-6 levels in patients with advanced coronary artery disease and control subjects with no stenosis [30]. They noted that advanced coronary artery disease correlated with low high-density lipoprotein levels and low β-carotene levels, and while IL-6 levels were elevated in these patients, they were lower Int J Vitam Nutr Res (2020), 90 (1–2), 103–112

110

than IL-6 levels measured in the controls [30]. In mildly hypertensive patients, coenzyme Q10 supplementation for 12 weeks (100 mg/day) was associated with increased adiponectin levels and decreased plasma IL-6 and highsensitivity c-reactive protein concentrations [31]. There were no changes in TNF α and IL-2 levels suggesting that the effect of coenzyme Q10 supplementation has specific effects on some cytokines but not others [31]. Likewise, in streptozotocin-induced diabetic mice, supplementation with vitamins E, C, and D reduced IL-6 levels (which were elevated in the diabetic mice) and enhanced superoxide dismutase, catalase, and glutathione peroxidase activity and increased the levels of reduced glutathione [32]. In macrophage cells derived ex-vivo from control mice or mice treated with either orange juice or the citrus-derived antioxidant hesperidin for two-weeks, treatment with orange juice enhanced the antimicrobial activity of the macrophage cells while treatment with hesperidin had a general suppressive effect on lipopolysaccharide-induced inflammation, decreasing NO production and IL-10, IL-12, and TNF α levels [33]. Pomegranate seed oil, which is rich in omega-5 polyunsaturated fatty acids, prevented lipopolysaccharide-induced BV-2 microglial cell death, while also decreasing NO production and TNF α release [34]. Of the cytokines examined, HCAEC expressed the proinflammatory cytokines IL-1β, IL-6 and IL-8, but not IL-2 and TNF α. Furthermore, exposure to high-dextrose (27.5 mM) induced only IL-1β levels but had no effect on IL-6 and IL-8. Treatment with α-tocopherol and ascorbic had no effect on cytokine levels in cells exposed to 27.5 mM dextrose relative to cells exposed to 5.5 mM dextrose. Indeed, treatment with 1,000 μM α-tocopherol actually increased IL-6 levels relative to cells exposed to 5.5 or 27.5 mM dextrose (Figure 2A). Ebselen, however, was effective at lowering IL-1β, IL-6, and IL-8 levels in cells exposed to 27.5 mM dextrose. This may be due to its mechanism of action as a glutathione peroxidase mimetic, converting H2O2 to H2O + O2 utilizing reduced glutathione in the process, suggesting that intracellular reduced glutathione levels are important in regulating pro-inflammatory cytokine expression in HCAEC. Indeed, others have demonstrated that glutathione levels regulate pro-inflammatory transcription factor activity (especially activator protein 1 and nuclear factor-κB), as well as hypoxia-inducible factor-1 [35]. Interestingly, when cells were exposed to 5.5 mM dextrose, treatment with all three antioxidants suppressed IL-1β, IL-6, and IL-8 levels. It is not clear why IL-1β levels increased upon exposure to high-dextrose but not IL-6 and IL-8. It is possible that 24hours of treatment is not sufficient to increase IL-6 and IL-8 levels and that longer exposure may increase expression of these cytokines. Another possibility is that Int J Vitam Nutr Res (2020), 90 (1–2), 103–112

M. J. Haas et al., Antioxidants Inhibit Cytokine Expression

high-dextrose may activate the nucleotide-binding oligomerization domain, leucine-rich repeat and pyrin domain containing 3 (NLRP3) inflammasome in HCAEC leading to caspase-1-mediated cleavage of pro-IL-1β to mature IL-1β and subsequent secretion [36]. Indeed, dextrose was shown to elevate NLRP3 inflammasome activity in pancreatic islet β-cells [37, 38]. Though IL-6 expression can be induced by IL-1β [39], it is not clear if IL-6 processing and secretion is regulated by inflammasomes. Likewise, cigarette smoke has been shown to promote release of IL1β and IL-8 by inducing inflammasome activity [40]. Though toll-like receptors-4 and -9 were implicated in this response, the investigators did not measure actual IL-8 processing and secretion making it unclear if this cytokine is directly regulated by inflammasomes. Further studies are needed to investigate the role of inflammasome activation by high-dextrose and pro-inflammatory cytokine release in HCAEC. There are some clear limitations to our study. First, the cells were exposed to dextrose for only 24-hours. This may not be long enough to measure the expression of some cytokines if there is a feed-forward loop by which one master cytokine, perhaps IL-1β, enhances the expression of the others. Second, our experiments were performed with pure HCAEC cultures so the contribution of other cells essential for atheroma development (macrophage foam cells and vascular smooth muscle cells) was not assessed. It is clear from other studies that factors from each of these cell types modifies endothelial cell function, including barrier function and cytokine release. Performing co-culture experiments with each of these other cell types may modify the response of the endothelial cell to high-glucose. Overall these results indicate that antioxidants have differential effects on suppressing the secretion of pro-inflammatory cytokines in HCAEC. In this regard, it appears that the efficacy of antioxidants is reduced in the presence of high dextrose concentrations.

References 1. Fuster, V., Badimon, L., Badomon, J.J., & Chesebro, J.H. (1992) The pathogenesis of coronary artery disease and the acute coronary syndromes (2). N Engl J Med. 326, 310–318. 2. Libby, P., Ridker, P.M., & Maseri, A. (2002) Inflammation and atherosclerosis. Circulation. 105, 1135–1143. 3. Ross, R., & Glomset, J.A. (1976) The pathogenesis of atherosclerosis (first of two parts). N Engl J Med. 295, 369–377. 4. Ross, R. (1999) Atherosclerosis-an inflammatory disease. N Eng J Med. 340, 115–126. 5. Ridker, P.M., Hennekens, C.H., Roitman-Johnson, B., Stampfer, M.J., & Allen, J. (1998) Plasma concentration of soluble intercellular adhesion molecular molecule 1 and risks of future myocardial infarction in apparently healthy men. Lancet. 351, 88–92.

Ó 2019 Hogrefe

M. J. Haas et al., Antioxidants Inhibit Cytokine Expression

6. Cybulsky, M.I., Iiyama, K., Li, H., Zhu, S., Chen, M., Iiyama, M., Davis, V., Gutierrez-Ramos, J.C., Connelly, P.W., & Milstone, D. S. (2001) A major role of VCAM-1, but not ICAM-1, in early atherosclerosis. J Clin Invest. 107, 1255–1262. 7. Tedgui, A., & Mallat, Z. (2006) Cytokines in atherosclerosis: pathogenic and regulatory pathways. Physiol Rev. 86, 515–581. 8. Surmi, B.K., & Hasty, A.H. (2010) The role of chemokines in recruitment of immune cells to the artery wall and adipose tissue. Vas Pharmacol. 52, 27–36. 9. Lee, I.M., Cook, N.R., Gaziano, J.M., Gordon, D., Ridker, P.M., Manson, J.E., Hennekens, C.H., & Buring, J.E. (2005) Vitamin E in the primary prevention of cardiovascular disease and cancer: the Women’s Health Study: a randomized controlled trial. JAMA. 294, 56–65. 10. Sesso, H.D., Buring, J.E., Christen, W.G., Kurth, T., Belanger, C., MacFadyen, J., Bubes, V., Manson, J.E., Glynn, R.J., & Gaziano, J.M. (2008) Vitamins E and C in the prevention of cardiovascular disease in men: the Physicians’ Health Study II randomized controlled trial. JAMA. 300, 2123–2133. 11. Riccioni, G., D’Orazio, N., Salvatore, C., Franceschelli, S., Pesce, M., & Speranza, L. (2012) Carotenoids and vitamins C and E in the prevention of cardiovascular disease. Int J Vitamin Nutr Res. 82, 15–26. 12. Yamaguchi, T., Sano, K., Takakura, K., Saito, I., Shinohara, Y., Asano, T., & Yasuhara, H. (1998) Ebselen in acute ischemic stroke: a placebo-controlled, double-blind clinical trial. Ebselen Study Group. Stroke. 29, 12–17. 13. Sheikh-Ali, M., Sultan, S., Alamir, A.R., Haas, M.J., & Mooradian, A.D. (2010) Effects of antioxidants on glucose-induced oxidative stress and endoplasmic reticulum stress in endothelial cells. Diabetes Res Clin Pract. 87, 161–166. 14. Mooradian, A.D., Onstead-Haas, L., & Haas, M.J. (2016) Asymmetrical cross-talk between the endoplasmic reticulum stress and oxidative stress caused by dextrose. Life Sci. 144, 37–48. 15. Makhoul-Awach, S., Thomas, M., Onstead-Haas, L., Mooradian, A.D., & Haas, M.J. (2015) The glutathione mimic ebselen inhibits oxidative stress but not endoplasmic reticulum stress in endothelial cells. Life Sci. 134, 9–15. 16. Xiao, L., Liu, Y., & Wang, N. (2014) New paradigms in inflammatory signaling in vascular endothelial cells. Am J Physiol Heart Circ Physiol. 306, H317–H325. 17. Horani, M.H., Haas, M.J., & Mooradian, A.D. (2004) Rapid adaptive down regulation of oxidative burst induced by high dextrose in human umbilical vein endothelial cells. Diabetes Res Clin Pract. 66, 7–12. 18. Kelleher, J., & Losowsky, M.S. (1970) The absorption of alphatocopherol in man. Br J Nutr. 24, 1033–1047. 19. Mustacich, D.J., Shields, J., Horton, R.A., Brown, M.K., & Reed, D.J. (1998) Biliary secretion of alpha-tocopherol and the role of the mdr2 P-glycoprotein in rats and mice. Arch Biochem Biophys Res Commun. 350, 183–192. 20. Liebler, D.C., Burr, J.A., Phillips, L., & Ham, A.J. (1996) Gas chromatography-mass spectrometry analysis of vitamin E and its oxidation products. Anal Biochem. 236, 27–34. 21. Schultz, M., Leist, M., Petrzika, M., Gassmann, B., & BrigeliusFlohe, R. (1995) Novel urinary metabolite of alpha-tocopherol, 2, 5, 7, 8-tetramethyl-1(2’-carboxyethyl)-6-hydrochroman, as an indicator of an adequate vitamin E supply? Am J Clin Nutr. 62, 1527S–1534S. 22. Pope, S.A., Clayton, P.T., & Muller, D.P. (2000) A new method for the analysis of urinary vitamin E metabolites and the tentative identification of a novel group of compounds. Arch Biochem Biophys. 381, 8–15. 23. Dowd, P., & Zheng, Z.B. (1995) On the mechanism of the anticlotting actions of vitamin E quinone. Proc Natl Acad Sci USA. 92, 8171–8175.

Ó 2019 Hogrefe

111

24. Neuzil, J., Witting, P.K., & Stocker, R. (1997) Alpha-tocopheryl hydroquinone is an efficient multifunctional inhibitor of radical-initiated oxidation of low density lipoprotein lipids. Proc Natl Acad Sci USA. 94, 7885–7890. 25. Grammas, P., Hamdheydari, L., Benaksas, E.J., Mou, S., Pye, Q.N., Wechter, W.J., Floyd, R.A., Stewart, C., & Hensley, K. (2004) Anti-inflammatory effects of tocopherol metabolites. Biochem Biophys Res Commun. 319, 1047–1052. 26. Savini, I., Rossi, A., Pierro, C., Avigliano, L., & Catani, M.V. (2008) SVCT1 and SVCT2: key proteins for vitamin C uptake. Amino Acids. 34, 347–355. 27. Brubacher, D., Moser, U., & Jordan, P. (2000) Vitamin C concentrations in plasma as a function of intake: a metaanalysis. Int J Vitam Nutr Res. 70, 226–237. 28. Michels, A.J., & Frei, B. (2013) Myths, artifacts, and fatal flaws: identifying limitations and opportunities in vitamin C research. Nutrients. 5, 5161–5192. 29. Michelss, A.J., Hagen, T.M., & Frei, B. (2013) Human genetic variation influences vitamin C homeostasis by altering vitamin C transport and antioxidant enzyme function. Annu Rev Nutr. 33, 45–70. 30. Muzakova, V., Kandar, R., Meloun, M., Skalicky, J., Kralovec, K., Zakova, P., & Vojtsek, P. (2010) Inverse correlation between plasma beta-carotene and interleukin-6 in patients with advanced coronary artery disease. Int J Vitam Nutr Res. 80, 369–377. 31. Bagheri Nesami, N., Mozaffari-Khosravi, H., Najarzadeh, A., & Salehifar, E. (2015) The Effect of Coenzyme Q10 Supplementation on Pro-Inflammatory Factors and Adiponectin in Mildly Hypertensive Patients: A Randomized, Double-Blind, PlaceboControlled Trial. Int J Vitam Nutr Res. 85, 156–164. 32. Greń, A. (2013) Effects of vitamin E, C and D supplementation on inflammation and oxidative stress in streptozotocin-induced diabetic mice. Int J Vitam Nutr Res. 83, 168–175. 33. Zanotti Simoes Dourado, G.K., de Abreu Ribeiro, L.C., Zeppone Carlos, I., & Borges César, T. (2013) Orange juice and hesperidin promote differential innate immune response in macrophages ex vivo. Int J Vitam Nutr Res. 83, 162–167. 34. Račková, L., Ergin, V., Burcu Bali, E., Kuniaková, M., & Karasu, Ç. (2014) Pomegranate Seed Oil Modulates Functions and Survival of BV-2 Microglial Cells in vitro. Int J Vitam Nutr Res. 84, 295–309. 35. Haddad, J.J., & Harb, H.L. (2005) L-γ-Glutamyl-L-cysteinylglycine (glutathione; GSH) and GSH-related enzymes in the regulation of pro- and anti-inflammatory cytokines: a signaling transcriptional scenario for redox(y) immunologic sensor(s)? Mol Immunol. 42, 987–1014. 36. Schroder, K., & Tschopp, J. (2010) The inflammasomes. Cell. 140, 821–832. 37. Maedler, K., Sergeev, P., Ris, F., Oberholzer, J., JollerJemelka, H.I., Spinas, G.A., Kaiser, N., Halban, P.A., & Donath, M.Y. (2002) Glucose-induced beta cell production of IL-1β contributes to glucotoxicity in human pancreatic islets. J Clin Invest. 110, 851–860. 38. Boni-Schentzler, M., Thorne, J., Parnaud, G., Marselli, L., Ehses, J.A., Kerr-Conte, J., Pattou, F., Halban, P.A., Weir, G.C., & Donath, M.Y. (2008) Increased interleukin (IL)-1beta messenger ribonucleic acid expression in beta-cells of individuals with type 2 diabetes and regulation of IL-1β in human islets by glucose and autostimulation. J Clin Endocrinol Metab. 93, 4065–4074. 39. McGeough, M.D., Pena, C.A., Mueller, J.L., Pociask, D.A., Broderick, L., Hoffman, H.M., & Brydges, S.D. (2012) IL-6 is a marker of inflammation with no direct role in inflammasomemediated mouse models. J Immunol. 189, 2707–2711.

Int J Vitam Nutr Res (2020), 90 (1–2), 103–112

112

40. Mortaz, E., Henricks, P.A., Kraneveld, A.D., Givi, M.E., Garssen, J., & Folkerts, G. (2011) Cigarette smoke induces the release of CXCL-8 from human bronchial epithelial cells via TLRs and induction of the inflammasome. Biochim Biophys Acta. 12, 1104–1110.

Acknowledgments MJH, concept, data analysis and interpretation, drafting article, data collection, approval of article. MJ-F, data collection, data analysis, critical revision of the article, approval of article. RH, data collection, data analysis, critical revision of the article, approval of article. VF, data collection, data analysis, critical revision of the article, approval of article. KG, data collection, data analysis, critical revision of the article, approval of article. LO-H, data collection, data interpretation,

Int J Vitam Nutr Res (2020), 90 (1–2), 103–112

M. J. Haas et al., Antioxidants Inhibit Cytokine Expression

critical revision of the article, approval of article. ADM, Concept/ design, data analysis and interpretation, critical revision of article, approval of article. Conflicts of Interest The authors declare that there are no conflicts of interest. Michael J. Haas Department of Medicine Division of Endocrinology, Diabetes, and Metabolism 653-1 West 8th Street, L14 Jacksonville, FL 32209 Michael.haas@jax.ufl.edu

Ó 2019 Hogrefe

Original Communication

Supplementation with beta-hydroxybeta-methylbutyrate impacts glucose homeostasis and increases liver size in trained mice Ines Schadock1,*, Barbara G. Freitas1,*, Irae L. Moreira1, Joao A. Rincon2, Marcio Nunes Correa2, Renata Zanella1, Evelise Sampaio Silva1, Ronaldo Carvalho Araujo4, Marcia Rubia D Buchweitz1, Elizabete Helbig1, Fabricio B Del Vecchio3, Augusto Schneider1, and Carlos Castilho Barros1 1

Laboratory of Nutrigenomics, Department of Nutrition – Federal University of Pelotas – UFPel – Pelotas, Brazil

Veterinary School – Federal University of Pelotas – UFPel – Pelotas, Brazil Superior School of Physical Education – Federal University of Pelotas – UFPel – Pelotas, Brazil

3 4

Department of Biophysics – Federal University of São Paulo, Sao Paulo, Brazil

Received: February 23, 2017; Accepted: June 28, 2017 Abstract: β-hydroxy-β-methyl butyrate (HMB) is a bioactive metabolite derived from the amino acid leucine, usually applied for muscle mass increase during physical training, as well as for muscle mass maintenance in debilitating chronic diseases. The hypothesis of the present study is that HMB is a safe supplement for muscle mass gain by strength training. Based on this, the objective was to measure changes in body composition, glucose homeostasis and hepatic metabolism of HMB supplemented mice during strength training. Two of four groups of male mice (n = 6/group) underwent an 8-week training period session (climbing stairs) with or without HMB supplementation (190 mg/kgBW per day). We observed lower body mass gain (4.9 ± 0.43% versus 1.2 ± 0.43, p < 0.001) and increased liver mass (40.9 ± 0.9 mg/gBW versus 44.8 ± 1.3, p < 0.001) in the supplemented trained group compared with the non-supplemented groups. The supplemented trained group had an increase in relative adipose tissue mass (12.4 ± 0.63 mg/gBW versus 16.1 ± 0.88, P < 0.01) compared to the non-supplemented untrained group, and an increase in fasting blood glucose (111 ± 4.58 mg/dL versus 122 ± 3.70, P < 0.05) and insulin resistance (3.79 ± 0.19 % glucose decay/min versus 2.45 ± 0.28, P < 0.05) comparing with non-supplemented trained group. Adaptive heart hypertrophy was observed only in the non-supplemented trained group (4.82 ± 0.05 mg/gBW versus 5.12 ± 0.13, P < 0.05). There was a higher hepatic insulin-like growth factor-1 expression (P = 0.002) in supplemented untrained comparing with non-supplemented untrained group. Gene expression of gluconeogenesis regulatory factors was increased by training and reduced by HMB supplementation. These results confirm that HMB supplementation associated with intensive training protocol drives changes in glucose homeostasis and liver metabolism in mice. Keywords: HMB, muscle mass, insulin resistance, metabolism, resistive exercise, G6Pase, PEPCK, mice

Introduction The use of nutritional supplements is becoming more frequent in young people seeking to improve athletic abilities, as well as their physical appearance [1, 2]. Some of these commercial supplements claim to promote body fat loss and muscle mass preservation, by ensuring higher energy availability for muscle growth, among other unconfirmed *Both authors had similar contribution in this study. Ó 2018 Hogrefe

benefits. Most of these commonly used supplements do not have adequate scientific evidence for their claims, neither is there sufficient knowledge about long-term safety of certain compounds of these products available [3]. One among these promising compounds found in industrial dietary supplements is β-hydroxy-β-methyl butyrate (HMB). HMB is a bioactive metabolite derived from the amino acid leucine. Only about five percent of the free leucine in blood is converted to HMB in the liver [4]. HMB has been indicated as a supplement to preserve/gain muscle Int J Vitam Nutr Res (2020), 90 (1–2), 113–123 https://doi.org/10.1024/0300-9831/a000445

114

mass [5, 6]. It has also been tested in chronic diseases management, such as polio, cancer, sepsis and malnutrition, aiming to reduce the loss of muscle mass [7, 8]. Although some studies indicated that HMB supplementation is safe [9], new data indicate undesired effects in insulin sensitivity and glucose homeostasis [10, 11]. There are some hypotheses about mechanisms involved in the supposed muscle gain or preservation promoted by HMB supplementation. One of these hypothesis is that the HMB supplementation contributes to protein synthesis in skeletal muscle, possibly by regulating hepatic insulin-like growth factor 1 (IGF-1) synthesis and the mammalian target of rapamycin (mTOR) signaling pathway [12]. Other authors suggest that HMB promotes muscle mass gain by promoting upregulation of insulin-like growth factor 1 (IGF-1) gene expression in skeletal muscle, stimulation of protein synthesis by the mTOR signaling pathway and the suppression of proteolysis by inhibition of the ubiquitin–proteasome system. Nevertheless, more studies are necessary to investigate the reason for the heterogeneity in the data observed in the literature [13]. The hypothesis of the present study is that HMB is a safe supplement for muscle mass gain by strength training. Based on this, the study herein aimed to verify the HMB supplementation effects in mice subjected to intense training in body composition, glucose homeostasis and hepatic IGF-1 mRNA expression.

Methods Animals and supplementation The experiment was conducted according to the standards established by the National Council for Control of Animal Experimentation (CONCEA). The Ethics Committee on Animal Experimentation from the Federal University of Pelotas approved all the performed procedures (Process 23110.006179/2013-90). For this study 24 male mice with isogenic background (C57BL/6), aged eight weeks, were initially randomized into four groups: control group without supplement (CS-); control group with supplement (CS+); training group without supplement (TS-); training group with supplement (TS+). Supplemented mice received HMB (190 mg/kg BW, NutraKey, Longwood-USA) by oral gavage, once a day 30 minutes before each training session. This dose of HMB was chosen based on effective doses tested in rodents by other authors [10, 11]. Nonsupplemented mice received only saline solution (0.9%) in the same way. The mice were kept in ventilated shelves, under controlled temperature (22 ± 2 °C) and humidity (40-60%). During the experiment, mice received commercial diet and water ad libitum. Int J Vitam Nutr Res (2020), 90 (1–2), 113–123

I. Schadock et al., HMB, Training and Insulin Resistance

Training The experiment lasted 12 weeks. During the first two weeks, the mice were adapted to the animal facility conditions and diet. Over the next two weeks, the mice were adapted to the training exercise. In the subsequent eight weeks, the mice underwent force training with additional load attached to the base of their tails. [14, 15]. Oral supplementation started with the training phase (week 5). For the training, mice were submitted to a stair climbing exercise in a structure constructed in the following way: A ladder 1.10 m high and 10 cm wide, with a dark box on the top containing a small entrance. In the training adaptation period three sets of workouts with no load were performed five days a week. At the beginning of the training the loads were added to the tail basis starting with loads corresponding to 50% of the mice body mass in the first two weeks, increasing to 100%, 150% and 200% of the body mass every two subsequent weeks (Figure 1). During this period, the mice trained five days a week with five sets of climbing exercises per session and one-minute rest between sets. The mice in the control groups (with and without supplement; CS+ and CS-) were submitted to all training procedures, except they were immediately placed near the box entrance, therefore with no necessary physical effort, but subjected to the same handling procedures as the trained mice. The mice were submitted to training sessions until 24 hours before euthanasia.

Measurements of body weight and food intake Body weight and food intake were measured weekly during the experiment. Each group was divided in two cages with three mice each, and food intake was calculated as an average for the group, and is presented as g/mice/day.

Glycemic tests Glycemic tests were carried out in the last week of the experiment and mice were not subjected to training at that day. Blood glucose levels were measured in a drop of blood from the tip of the tail using a glucometer (Accu-Chek Performa, Roche, Basel- Switzerland). For the glucose tolerance test (GTT) mice were injected with glucose (1g/kg BW, i.p.) after 12 hours fasting [15]. Blood glucose was measured before the injection and after 15, 30, 60 and 120 min for GTT, and the results were obtained comparing the mean of the areas under the curves. After a three-day interval and 8-hour fasting, the insulin tolerance test (ITT) was also performed. For the ITT mice were injected with insulin (1 U/kg BW i.p) [16]. Blood glucose Ó 2018 Hogrefe

I. Schadock et al., HMB, Training and Insulin Resistance

115

Figure 1. Experiment design. After adaptation to animal housing conditions (2 weeks), mice were adapted to the training protocol by manipulation and learning to access the dark box in the top of the ladder apparatus (2 weeks, 3 times a week, without exercise). During the next 8 weeks, mice were submitted to training 5 days a week, with loads attached to the tail base using tape. Loads were weight individually for each mouse and increased after each 2 weeks of training until reaching 200% of individual body mass. The only stimulus to complete the ladder climbing were to hide themselves in the dark box at the top.

was measured before the injection and after 3, 15 and 30 minutes. For ITT analysis, the glucose decay constant (KITT) was calculated using the glycemia measured at 3 and 15 minutes, considering 3 minutes as reference point (100%). The difference of glycemia at 3 and 15 minutes was divided by 12. The results were presented as % of glucose decay/minute and indicate the period after insulin injection where mainly only insulin is acting. Before the 3 minutes time point there is influence of adrenalin release due to manipulation and insulin injection itself. After the 15 minutes time point, the reduction on glycemia generates glucagon and cortisol release mixing their effects with insulin [16]. Therefore, that is why the KITT is calculated between 3 and 15 minutes time points.

Insulin analysis The plasma insulin analysis was performed after 12 hours fasting using an Insulin ELISA kit according to the manufacturer’s instruction (EZRMI-13 K – Rat/Mouse Insulin ELISA, Merck Millipore Corporation, Darmstadt, Germany). The Homeostatic Model of Assessment-Insulin Resistance (HOMA-IR) was calculated using the following formula [17]. HOMA IR ¼ Glucose ½mmol=L Insulin ½m=U=mL

Plasma transaminases quantification Concentrations of aspartate transaminase (AST) and alanine transaminase (ALT) were measured in serum samples by the kinetic method in an automated biochemical equipment (Lambax Plenno – Labtest Diagnóstica SA, Lagoa Santa-Brazil) using commercially available kits (Labtest Diagnóstica SA, Lagoa Santa-Brazil).

Gene expression quantification Total RNA was isolated from liver samples using TRIzol Reagent (ThermoFisher-Invitrogen, Waltham-USA). Firststrand cDNAs were synthesized using High Capacity cDNA Reverse Transcription kit (Applied Byosystems, Foster City-USA). Real-time PCR was performed using SYBRGreen assay (Thermo Scientific, Waltham-USA) using the primers described in Table 1. The cycling conditions were as follows: 10 min at 95 °C, followed by 40 cycles of 30 s at 95 °C and 30 s at 60 °C. Standard curves were added in the reaction plate for each primer pair to check the amplification efficiency. Target mRNA expression was normalized to β-actin in liver or TBP in skeletal muscle, and expressed as a relative value using the comparative threshold cycle (Ct) method (2-ΔΔCt) according to the manufacturer’s instructions. Expression levels from genes of interest were normalized to the control group without supplement (CS-) [16].

Tissue collection Mice were anesthetized with isoflurane and euthanized by decapitation after 12 hours fasting. The blood was collected and centrifuged at 4,000 rpm and serum was stored at -20 ° C for later analyses. The mass of skeletal muscle (triceps surae), heart, liver and epididymal adipose tissue were measured and liver fragments were frozen at 80 °C for RNA extraction. The hearts were washed in saline solution before mass measurement. Ó 2018 Hogrefe

Statistical Analysis Liver, adipose tissue and heart mass were normalized with individual body weight and are presented as mg/g BW. Normality of data was determined using the Shapiro–Wilk test and equality of variance verified using Brown-Forsythe test. Two-way ANOVA was used to analyze the effects of training, HMB supplementation and the interaction Int J Vitam Nutr Res (2020), 90 (1–2), 113–123

116

I. Schadock et al., HMB, Training and Insulin Resistance

Table 1. Primers sequences Transcript Glucose-6-phosphatase

Abbreviation G6PASE

Primer Sequence 0

5 -TCGGAGACTGGTTCAACCTC-3

Amplicon 0

128 bp

50 -ACAGGTGACAGGGAACTGCT-30 Phosphoenolpyruvate carboxykinase

PEPCK

50 -CTAACTTGGCCATGATGAACC-30

158 bp

50 -CTTCACTGAGGTGCCAGGAG-30 Forkhead box protein O1

FOXO1

50 -GCTTTTGTCACGATGGAGGT-30

155 bp

50 -CGCACAGAGCACTCCATAAA-30 Solute carrier family 2, member 4

GLUT4

50 -GTAACTTCATTGTCGGCATGG-30

155 bp

50 -AGCTGAGATCTGGTCAAACG-30 Insulin-like growth factor 1

IGF-1

50 -CTGAGCTGGTGGATGCTCTT-30

118 bp

50 -CACTCATCCACAATGCCT-30

between HMB supplementation and training. When a significant interaction was detected a Tukey multiple comparisons test was used to compare means between individual groups. Repeated measures ANOVA followed by Tukey post-hoc test was used to compare body weight during the experimental period between groups. Statistical analyzes were performed using Graphpad PrismÒ software (GraphPad Software Inc, La Jolla, USA). Results were considered significant when p < 0.05 and data were exhibited as means ± standard error of the mean (SEM).

Results Changes in food intake and body weight TS+ mice had a reduction in body weight gain in comparison to other groups (CS-, 4.2 ± 0.7 mg/g BW; CS+, 4.9 ± 0.4 mg/g BW; TS-, 4.6 ± 0.5 mg/g BW; TS+, 1.2 ± 0.4 mg/g BW; p < 0.01, Figure 2A and B). TS+ mice also had an increase in adipose tissue depot (CS-, 12.4 ± 0.6 g; CS+, 10.9 g ± 0.2; TS-, 13.3 ± 0.5 g; TS+, 16.1 ± 0.9 g; p < 0.01, Figure 2C–D). There were no differences in the relative mass of the triceps surae muscle between groups (Figure 2E). Food intake was similar between groups in the adaptation and light training phases. During the hard training (with loads of 150 to 200% of body weight), CS+ and TS- groups had an increase in food intake (CS-, 2.8 ± 0.4 g/mice/day; CS+, 3.6 ± 0.4 g/mice/day; TS-, 3.6 ± 0.2 g/mice/day; TS+, 2.7 ± 0.4 g/mice/day; p < 0.01, Figure 2F).

Effects of HMB supplementation on glucose homeostasis After the training period, glycemic tests were performed. Mice from the CS+ group had an increase in glucose uptake Int J Vitam Nutr Res (2020), 90 (1–2), 113–123

in the GTT, and no difference was observed among the other groups (Figure 3A and B). The improvement in the insulin sensitivity generated by training in the TS- group was reverted by the HMB supplementation, as shown by the glucose decay constant (KITT) calculated from the ITT (CS-, 2.5 ± 0.4 % of glucose decay/min; CS+, 3.3 ± 0.3 % of glucose decay/min; TS-, 3.8 ± 0.2 % of glucose decay/ min; TS+, 2.5 ± 0.3 % of glucose decay/min; p < 0.05, Figure 3C and D). Higher fasting blood glucose was observed in the TS+ group (CS-, 102.0 ± 6.1 mg/dL; CS+, 102.2 ± 4.1 mg/dL; TS-, 110.6 ± 4.6 mg/dL; TS+, 122.0 ± 3.7 mg/dL; p < 0.05, Figure 3E). A significant interaction between training and HMB supplementation was observed for HOMA-IR (p = 0.014), and a decreased HOMA-ID index was observed in the TS- compared to other groups (Figure 3F).

Adaptive heart hypertrophy The heart weight was normalized for individual body weight. The expected hypertrophy due to the strength training was evidenced in the TS- group (4.8 ± 0.05 mg/g BW vs. 5.7 ± 0.31 mg/g BW; CS- vs. TS- respectively, p < 0.05; Figure 4). However, the relative heart weight from the HMB supplemented groups showed no signs of hypertrophy (5.1 ± 0.1 mg/g BW vs. 4.9 ± 0.08 mg/g BW; CS+ vs. TS+ respectively; Figure 4).

Effect of HMB supplementation in liver size and plasma transaminases A small increase in relative liver size was observed in both groups supplemented with HMB (CS-, 41.9 ± 0.5 mg/g BW; CS+, 45.8 ± 0.1 mg/g BW; TS-, 40.9 ± 0.9 mg/g BW; TS+, 44.8 ± 1.3 mg/g BW; p < 0.05, Figure 5A). To verify if these changes were associated with liver injury, the classical transaminases markers were measured in plasma. Ó 2018 Hogrefe

I. Schadock et al., HMB, Training and Insulin Resistance

117

Figure 2. Indicators of body composition. A) mice body mass (%) during the experiment; B) total mass variation (g); C) relative mass of epididymal adipose tissue depots (mg/g BW); D) absolute values of C; E) triceps surae muscle mass; F) food intake during adaptation (weeks 0 to 4), light training (weeks 4 to 8) and hard training (weeks 8 to 12) periods. CS-, control group without supplement; CS+, control group with supplement; TS-, trained group without supplement; TS+, trained group with supplement. P values presented were calculated using two-way ANOVA. *, p < 0.05, **, p < 0.01 and ***, p < 0.001 for Tukey multiple comparisons test between indicated columns. Data presented as means ± SEM, # p < 0.05 comparing TS+ group to CS- group in Tukey’s post-test, n = 6.

HMB supplementation was associated with higher plasma ALT (CS-, 12.8 ± 1.8 UI/L; CS+, 16.0 ± 1.8 UI/L; TS-, 13.0 ± 0.7 UI/L; TS+, 17.0 ± 1.1 UI/L; p < 0.05, Figure 5B) but not for AST, which tended to be reduced in plasma of trained mice (p = 0.06, Figure 5C). Ó 2018 Hogrefe

Hepatic gene expression Usually changes in liver morphology are associated with changes in its function. Accordingly, differences in glycemic tests can also reflect changes in liver glucose Int J Vitam Nutr Res (2020), 90 (1–2), 113–123

118

I. Schadock et al., HMB, Training and Insulin Resistance

Figure 3. Glycemic tests. A) glycemia during glucose tolerance test (GTT) before and after glucose injection (1 g/kg BW, 12 hours fasting); B) area under the curve for the GTT: C) glycemia during the insulin tolerance test (ITT) before and after insulin injection (1 U/kg BW, 8 hours fasting); D) glucose decay constant (KITT) from the ITT calculated at times 3 to 15 minutes. E) fasting blood glucose (12 hours fasting); F) HOMA-IR after 12 hours fasting. CS-, control group without supplement; CS+, control group with supplement; TS-, trained group without supplement; TS+, trained group with supplement. Data presented as means ± SEM. P values presented were calculated using two-way ANOVA. *, p < 0.05 for Tukey multiple comparisons test between indicated columns, n = 6.

metabolism. Therefore, the expression of three genes regarding gluconeogenesis regulation belonging to the insulin signaling pathway was checked. There was no effect of training or HMB supplementation in hepatic forkhead box protein O1 (FoxO1) gene expression (Figure 6A), but Int J Vitam Nutr Res (2020), 90 (1–2), 113–123

its downstream targets, phosphoenolpyruvate carboxykinase (PEPCK) and glucose-6-phosphate (G6Pase) increased its expression with training and reduced with HMB supplementation (Figure 6B-C). A possible mechanism involved in muscle hypertrophy promoted by HMB

Ó 2018 Hogrefe

I. Schadock et al., HMB, Training and Insulin Resistance

119

Figure 4. Heart mass variation. Heart mass after training period normalized for body mass. CS-, control group without supplement; CS +, control group with supplement; TS-, trained group without supplement; TS+, trained group with supplement. Data presented as means ± SEM. P values presented were calculated using two-way ANOVA. *, p < 0.05 for Tukey multiple comparisons test between indicated columns, n = 6.

supplementation is the increased IGF-1 liver expression. In non-trained groups, HMB increased hepatic IGF-1 gene expression as expected, but the same was not observed in trained groups, indicating a combined effect of HMB supplementation and strength training (Figure 6D). No differences were observed for GLUT4 gene expression in skeletal muscle (Figure 6E).

Discussion HMB has been considered a useful supplement to improve skeletal muscle hypertrophy during strength training [5, 6], and to preserve muscle mass in certain pathological conditions [7, 8]. However, some studies found no beneficial effects of HMB supplementation for sport practitioners [18–22]. These unequal findings demand more information to ensure the safe application of HMB to achieve the desired outcomes. Therefore, in the present study we investigated the effect of HMB supplementation on body composition, glucose metabolism and liver gene expression in mice submitted to strength training. The major findings are that although the HMB supplementation seems beneficial in the untrained group, undesired effects were found, such as an increased basal glycemia, reduced body-weight gain and increased fat depots when HMB supplementation was combined with intense exercise. We observed that HMB impaired glucose homeostasis. Similar effects were observed recently in rats supplemented Ó 2018 Hogrefe

Figure 5. Changes in liver mass and plasma transaminases. A) liver mass after training normalized by body mass; B) plasma alanine transaminase (ALT); C) plasma aspartate transaminase (AST). CS-, control group without supplement; CS+, control group with supplement; TS-, trained group without supplement; TS+, trained group with supplement. Data presented as means ± SEM. P values presented were calculated using two-way ANOVA. *, p < 0.05 for Tukey multiple comparisons test between indicated columns, n = 6.

with HMB and cortisol [10] and in healthy sedentary rats supplemented with HMB [11]. The response to GTT is influenced mainly by muscle glucose uptake [21] and the effect of endogenous cortisol release during intense Int J Vitam Nutr Res (2020), 90 (1–2), 113–123

120

I. Schadock et al., HMB, Training and Insulin Resistance

Figure 6. Analyses of gene expression of gluconeogenesis regulator factors and IGF-1 in liver and GLUT4 in skeletal muscle. Tissues were collected after 24 hours without exercises. A) relative mRNA expression of the transcript factor FoxO1; B and C) gene expression of enzymes that activate gluconeogenesis, both of them FoxO1 target; D) training interaction and HMB supplementation in IGF-1 gene expression. E) muscle expression of solute carrier family 2, member 4 (GLUT4). CS-, control group without supplement; CS+, control group with supplement; TS-, trained group without supplement; TS+, trained group with supplement. P values presented were calculated using two-way ANOVA. *, p < 0.05 for Tukey multiple comparisons test between indicated columns. Data presented as means ± SEM, n = 6.

exercise has been well characterized [22]. Although an increase of glucose uptake in the GTT of untrained mice treated with HMB was found here, that implication was Int J Vitam Nutr Res (2020), 90 (1–2), 113–123

absent in mice subjected to intense exercise. Further studies with oral GTT in supplemented rats may help elucidate this point [23]. Ó 2018 Hogrefe

I. Schadock et al., HMB, Training and Insulin Resistance

The exact molecular mechanism of how HMB influences insulin sensitivity is not well understood. Circulating IGF-1 and at least one of its polymorphisms are positively associated with insulin sensitivity [24]. Some authors describe that part of the effects of HMB supplementation is due to increased hepatic production of IGF-1 [25]. However, in our study it was observed that although HMB increases the liver expression of IGF-I mRNA in non-trained mice, it decreases IGF-I expression in trained mice, the group with the lowest insulin sensitivity. These results can justify part of the mechanism involved in the changes observed in glucose homeostasis in the present study. Hepatic gluconeogenesis is the main cause of elevated glucose production and fasting hyperglycemia in Type 2 diabetes mellitus [26]. Furthermore, the combination of decreased peripheral glucose uptake (mainly muscle) and augmented endogenous glucose production are features of insulin resistance [27]. To evaluate if changes in hepatic glucose metabolism are participating in the elevated blood glucose levels found in trained and supplemented mice we used gene expression analyses of one central gluconeogenesis regulator, the transcription factor FoxO1. FoxO1 activates the expression of two key enzymes in the regulation of gluconeogenesis pathway: G6Pase and PEPCK [28, 29]. Insulin signaling leads to protein kinase B (AKT) phosphorylation, which phosphorylates the FoxO1 transcription factor excluding it from the nucleus and consequently inhibiting G6Pase and PEPCK gene expression and gluconeogenesis [30]. Although an increase in FoxO1 gene expression was not observed, small changes in the expression of its targets were evidenced. The increased gene expression of G6Pase and PEPCK in trained mice after fasting is compatible with adaptation to increased glucose uptake and consumption, normally a consequence of increased insulin sensitivity in response to training [31]. On the other hand, the opposite effect was observed during HMB supplementation evidencing deregulation of the adaptive metabolism as a possible explanation of how HMB impairs glucose metabolism under intensive training. However, this hypothesis remains speculative. Even though the exact mechanism of how HMB influences glucose homeostasis is not established yet, the effects found here and recently elsewhere [10, 11] are not desired. Especially as elevated fasting blood glucose and insulin resistance are known risk factors for development of diabetes and related diseases, HMB supplementation urgently requires further investigation. Up to date a long-term application of HMB to athletes or non-professional sportsmen in the opinion of the authors must be revised. It is a consensus that training promotes physiologic adaptive heart hypertrophy, especially when executed with heavy loads [32–34]. The training protocol used in the present study was effective to induce heart mass gain in mice, Ó 2018 Hogrefe

121

however when combined with HMB supplementation this effect was lost. To our knowledge, we present here for the first-time data about myocardial heart development and HMB supplementation combined with extensive training. Therefore, these findings have to be interpreted with caution. Nevertheless, extensive training without adaptive heart hypertrophy might not only reduce the exercise effectiveness but may increase the risk of cardiac injury and nutritional undersupply, especially during training. Further studies are required to verify the impact of HMB on heart hypertrophy as well as on skeletal muscle hypertrophy. The HMB effects in liver are also alarming. Despite changes observed in liver size and plasma ALT were within the physiological range, the increase of these values indicates a possible risk to exacerbation of liver injury when additional non-controlled factors causing liver stress, such as an inappropriate diet or drug intake. Petterson et al. described that training can be a risk factor for liver damage [35]. However, in the present study we observed that only HMB supplementation was associated to liver size and plasma ALT increases, which could potentiate this risk. Although a previous study was not able to find effects of HMB supplementation on liver injury [36], our results suggest carefulness, and regular medical control for signs of liver injury when HMB supplementation is combined with intensive training. One accepted hypothesis for the molecular mechanism of HMB muscle hypertrophy promotion/preservation is through increased IGF-1 liver expression [34–37] as discussed before. However, some authors suggested that circulating IGF-1 is not enough to decrease growing in mice during the post-natal period [37]. Although IGF-1 is produced mainly in the liver and is the main effector of growth hormone actions, local IGF-1 production can compensate systemic reduction of its levels. On the other hand, the reduced IGF-1 expression in trained mice observed in the present study, together with changes in body weight and adipose tissue depots could be an indicator of the IGF-1 mediated HMB hypothesis. Therefore, more studies are necessary to elucidate the effects of HMB on IGF-1 expression and its interaction with training, since this is one of the main mechanisms responsible for muscle hypertrophy, and may be involved in the pathogenesis of insulin resistance. The present study showed clearly that the combination of intensive training and HMB supplementation can impact glucose homeostasis and liver size in mice, confirming recent published results observed in rats [10, 11]. Changes in KITT values shows that supplementation with HMB reduced the insulin sensitivity gain obtained by training in mice. These results were reinforced with basal glycemia and HOMA-IR index analyses. Although no significant differences of KITT and HOMA-IR were noted when comparing supplemented trained group and non-supplemented Int J Vitam Nutr Res (2020), 90 (1–2), 113–123

122

untrained group, there is a clear difference when comparing both trained groups. Unfortunately, the lower number of animals and the non-specific design of the experiment suggest caution in the interpretation of some results as cardiac hypertrophy, liver damage and molecular mechanisms involved in the action of HMB in the body. In conclusion, supplementation with HMB associated to intense strength training in mice impacts the glucose homeostasis and increases liver mass. These results suggest caution in the recommendation of HMB supplementation associated with high-intensity physical training, mainly when other metabolic risk factors are present.

I. Schadock et al., HMB, Training and Insulin Resistance

11.

12.

13.

References 14. 1. Calfee, R., & Fadale, P. (2006) Popular ergogenic drugs and supplements in young athletes. Pediatrics. 117, e577–589. 2. Petroczi, A., Naughton, D.P., Pearce, G., Bailey, R., Bloodworth, A., & McNamee, M. (2008) Nutritional supplement use by elite young UK athletes: fallacies of advice regarding efficacy. J Int Soc Sports Nutr. 5, 22. 3. American Dietetic, A., Dietitians of C., American College of Sports M. Rodriguez, N.R., Di Marco, N.M., & Langley, S. (2009) American College of Sports Medicine position stand. Nutrition and athletic performance. Med Sci Sports Exerc. 41, 709–731. 4. Baptista, I.L., Silva, W.J., Artioli, G.G., Guilherme, J.P., Leal, M. L., Aoki, M.S., Miyabara, E.H., & Moriscot, A.S. (2013) Leucine and HMB differentially modulate proteasome system in skeletal muscle under different sarcopenic conditions. PLoS One. 8, e76752. 5. Wilson, J.M., Lowery, R.P., Joy, J.M., Walters, J.A., Baier, S.M., Fuller, J.C. Jr., Stout, J.R., Norton, L.E., Sikorski, E.M., Wilson, S.M., Duncan, N.M., Zanchi, N.E., & Rathmacher, J. (2013) beta-Hydroxy-beta-methylbutyrate free acid reduces markers of exercise-induced muscle damage and improves recovery in resistance-trained men. Br J Nutr. 110, 538–544. 6. Wilson, J.M., Lowery, R.P., Joy, J.M., Andersen, J.C., Wilson, S. M., Stout, J.R., Duncan, N., Fuller, J.C., Baier, S.M., Naimo, M. A., & Rathmacher, J. (2014) The effects of 12 weeks of betahydroxy-beta-methylbutyrate free acid supplementation on muscle mass, strength, and power in resistance-trained individuals: a randomized, double-blind, placebo-controlled study. Eur J Appl Physiol. 114, 1217–1227. 7. Nunes, E.A., Kuczera, D., Brito, G.A., Bonatto, S.J., Yamazaki, R.K., Tanhoffer, R.A., Mund, R.C., Kryczyk, M., & Fernandes, L. C. (2008) Beta-hydroxy-beta-methylbutyrate supplementation reduces tumor growth and tumor cell proliferation ex vivo and prevents cachexia in Walker 256 tumor-bearing rats by modifying nuclear factor-kappaB expression. Nutr Res. 28, 487–493. 8. Deutz, N.E., Pereira, S.L., Hays, N.P., Oliver, J.S., Edens, N.K., Evans, C.M., & Wolfe, R.R. (2013) Effect of beta-hydroxy-betamethylbutyrate (HMB) on lean body mass during 10 days of bed rest in older adults. Clin Nutr. 32, 704–712. 9. Nissen, S., Sharp, R.L., Panton, L., Vukovich, M., Trappe, S., & Fuller, J.C. Jr. (2000) beta-hydroxy-beta-methylbutyrate (HMB) supplementation in humans is safe and may decrease cardiovascular risk factors. J Nutr. 130, 1937–1945. 10. Nunes, E.A., Goncalves-Neto, L.M., Ferreira, F.B., dos Santos, C., Fernandes, L.C., Boschero, A.C., Calder, P.C., & Rafacho, A.

Int J Vitam Nutr Res (2020), 90 (1–2), 113–123

15.

16.

17.

18.

19.

20.

21.

22.

23.

(2013) Glucose intolerance induced by glucocorticoid excess is further impaired by co-administration with beta-hydroxybeta-methylbutyrate in rats. Appl Physiol Nutr Metab. 38, 1137–1146. Yonamine, C.Y., Teixeira, S.S., Campello, R.S., GerlingerRomero, F., Rodrigues, C.F. Jr., Guimaraes-Ferreira, L., Machado, U.F., & Nunes, M.T. (2014) Beta hydroxy beta methylbutyrate supplementation impairs peripheral insulin sensitivity in healthy sedentary Wistar rats. Acta Physiol (Oxf). 212, 62–74. Molfino, A., Gioia, G., Rossi Fanelli, F., & Muscaritoli, M. (2013) Beta-hydroxy-beta-methylbutyrate supplementation in health and disease: a systematic review of randomized trials. Amino Acids. 45, 1273–1292. Zanchi, N.E., Gerlinger-Romero, F., Guimaraes-Ferreira, L., de Siqueira Filho, M.A., Felitti, V., Lira, F.S., Seelaender, M., & Lancha, A.H. Jr. (2011) HMB supplementation: clinical and athletic performance-related effects and mechanisms of action. Amino Acids. 40, 1015–1025. Philippe, A.G., Py, G., Favier, F.B., Sanchez, A.M., Bonnieu, A., Busso, T., & Candau, R. (2015) Modeling the responses to resistance training in an animal experiment study. Biomed Res Int. 2015, 914860. Stotzer, U.S., Rodrigues, M.F., Domingos, M.M., Silva, G.H., Duarte, F.O., Gatto, C.V., Duarte, A.C., Shiguemoto, G.E., Perez, S.E., & Selistre-de-Araujo, H.S. (2015) Resistance training suppresses intra-abdominal fatty acid synthesis in ovariectomized rats. Int J Sports Med. 36, 226–233. Barros, C.C., Haro, A., Russo, F.J., Schadock, I., Almeida, S.S., Ribeiro, R.A., Vanzela, E.C., Lanzoni, V.P., Barros, F.C., Moraes, M.R., Mori, M.A., Bacurau, R.F., Wurtele, M., Boschero, A.C., Carneiro, E.M., Bader, M., Pesquero, J.B., & Araujo, R.C. (2012) Altered glucose homeostasis and hepatic function in obese mice deficient for both kinin receptor genes. PLoS One. 7, e40573. Matthews, D.R., Hosker, J.P., Rudenski, A.S., Naylor, B.A., Treacher, D.F., & Turner, R.C. (1985) Homeostasis model assessment: insulin resistance and beta-cell function from fasting plasma glucose and insulin concentrations in man. Diabetologia. 28, 412–419. Kreider, R.B., Ferreira, M., Wilson, M., & Almada, A.L. (1999) Effects of calcium beta-hydroxy-beta-methylbutyrate (HMB) supplementation during resistance-training on markers of catabolism, body composition and strength. Int J Sports Med. 20, 503–509. Slater, G., Jenkins, D., Logan, P., Lee, H., Vukovich, M., Rathmacher, J.A., & Hahn, A.G. (2001) Beta-hydroxy-betamethylbutyrate (HMB) supplementation does not affect changes in strength or body composition during resistance training in trained men. Int J Sport Nutr Exerc Metab. 11, 384–396. Ransone, J., Neighbors, K., Lefavi, R., & Chromiak, J. (2003) The effect of beta-hydroxy beta-methylbutyrate on muscular strength and body composition in collegiate football players. J Strength Cond Res. 17, 34–39. Hoffman, J.R., Cooper, J., Wendell, M., Im, J., & Kang, J. (2004) Effects of beta-hydroxy beta-methylbutyrate on power performance and indices of muscle damage and stress during high-intensity training. J Strength Cond Res. 18, 747–752. Thomson, J.S., Watson, P.E., & Rowlands, D.S. (2009) Effects of nine weeks of beta-hydroxy-beta- methylbutyrate supplementation on strength and body composition in resistance trained men. J Strength Cond Res. 23, 827–835. Andrikopoulos, S., Blair, A.R., Deluca, N., Fam, B.C., & Proietto, J. (2008) Evaluating the glucose tolerance test in mice. Am J Physiol Endocrinol Metab. 295, E1323–1332.

Ó 2018 Hogrefe

I. Schadock et al., HMB, Training and Insulin Resistance

24. Mannino, G.C., Greco, A., De Lorenzo, C., Andreozzi, F., Marini, M.A., Perticone, F., & Sesti, G. (2013) A fasting insulin-raising allele at IGF1 locus is associated with circulating levels of IGF-1 and insulin sensitivity. PLoS One. 8, e85483. 25. Portal, S., Eliakim, A., Nemet, D., Halevy, O., & Zadik, Z. (2010) Effect of HMB supplementation on body composition, fitness, hormonal profile and muscle damage indices. J Pediatr Endocrinol Metab. 23, 641–650. 26. Roden, M., & Bernroider, E. (2003) Hepatic glucose metabolism in humans–its role in health and disease. Best Pract Res Clin Endocrinol Metab. 17, 365–383. 27. Cersosimo, E., Triplitt, C., Mandarino, L.J., & DeFronzo, R.A. (2000). Pathogenesis of Type 2 Diabetes Mellitus. In LJ De Groot. P Beck-Peccoz. G Chrousos. K Dungan. A Grossman. JM Hershman. C Koch. R McLachlan. M New. R Rebar. F Singer. A Vinik. & MO Weickert. South Dartmouth (MA): Endotext. 28. Barros, C.C., Haro, A., Russo, F.J., Schadock, I., Almeida, S.S., Reis, F.C., Moraes, M.R., Haidar, A., Hirata, A.E., Mori, M., Bacurau, R.F., Wurtele, M., Bader, M., Pesquero, J.B., & Araujo, R.C. (2012) Bradykinin inhibits hepatic gluconeogenesis in obese mice (Eds.), Lab Invest. 92, 1419–1427. 29. Oh, K.J., Han, H.S., Kim, M.J., & Koo, S.H. (2013) CREB and FoxO1: two transcription factors for the regulation of hepatic gluconeogenesis. BMB Rep. 46, 567–574. 30. Tsai, W.C., Bhattacharyya, N., Han, L.Y., Hanover, J.A., & Rechler, M.M. (2003) Insulin inhibition of transcription stimulated by the forkhead protein Foxo1 is not solely due to nuclear exclusion. Endocrinology. 144, 5615–5622. 31. Haase, T.N., Ringholm, S., Leick, L., Bienso, R.S., Kiilerich, K., Johansen, S., Nielsen, M.M., Wojtaszewski, J.F., Hidalgo, J., Pedersen, P.A., & Pilegaard, H. (2011) Role of PGC-1alpha in exercise and fasting-induced adaptations in mouse liver. Am J Physiol Regul Integr Comp Physiol. 301, R1501–1509. 32. Scheuer, J., & Buttrick, P. (1987) The cardiac hypertrophic responses to pathologic and physiologic loads. Circulation. 75, I63–68.

Ó 2018 Hogrefe

123

33. Ehsani, A.A., & Spina, R.J. (1997) Loss of cardiovascular adaptations after physical inactivity. Cardiol Clin. 15, 431–438. 34. Paterick, T.E., Gordon, T., & Spiegel, D. (2014) Echocardiography: profiling of the athlete’s heart. J Am Soc Echocardiogr. 27, 940–948. 35. Pettersson, J., Hindorf, U., Persson, P., Bengtsson, T., Malmqvist, U., Werkstrom, V., & Ekelund, M. (2008) Muscular exercise can cause highly pathological liver function tests in healthy men. Br J Clin Pharmacol. 65, 253–259. 36. Gallagher, P.M., Carrithers, J.A., Godard, M.P., Schulze, K.E., & Trappe, S.W. (2000) Beta-hydroxy-beta-methylbutyrate ingestion, part II: effects on hematology, hepatic and renal function. Med Sci Sports Exerc. 32, 2116–2119. 37. Yakar, S., Liu, J.L., Stannard, B., Butler, A., Accili, D., Sauer, B., & LeRoith, D. (1999) Normal growth and development in the absence of hepatic insulin-like growth factor I. Proc Natl Acad Sci USA. 96, 7324–7329.

Acknowledgments Part of this study was supported by CAPES and CNPq. Conflict of interest The authors declare that there are no conflicts of interest.

Carlos Castilho Barros Universidade Federal de Pelotas – UFPel Laboratório de Nutrifisiogenômica e Metabologia R. Gomes Carneiro nº 01, Sala 239 – Pelotas – RS CEP 96010-610 barrosccpel@gmail.com

Int J Vitam Nutr Res (2020), 90 (1–2), 113–123

Original Communication

No Relation Between Zinc Status and Inflammatory Biomarkers in Adolescent Judokas Artemizia Francisca de Sousa1, Laiana Sepúlveda de Andrade Mesquita2, Kyria Jayanne Clímaco Cruz3, Ana Raquel Soares de Oliveira3, Jennifer Beatriz Silva Morais3, Juliana Soares Severo3, Jéssica Batista Beserra3, Nadir do Nascimento Nogueira3, and Dilina do Nascimento Marreiro3 1

Department of Nutrition, Federal University of Piauí, Campus Senador Helvídio Nunes de Barros, Junco, Picos, Piauí, Brazil

Department of Physiotherapy, State University of Piauí, Faculty of Medical Sciences, Centro, Teresina, Piauí, Brazil Department of Nutrition, Federal University of Piauí, Campus Minister Petrônio Portela, Ininga, Teresina, Piauí, Brazil

Received: January 14, 2017; Accepted: November 7, 2017

Abstract: This study aimed to assess the relation between zinc status and inflammation biomarkers in adolescent judokas. This crosssectional study included 52 male adolescents, aged between 14 and 19 years, who were subdivided into two groups: judoka group (n = 25) and control group (n = 27). Zinc intake was monitored using 3-day food records and the NutWin software version 1.5. The plasma and erythrocyte zinc concentrations were determined by flame atomic absorption spectrophotometry. Analysis of cytokines (IL-1β, IL-6, and TNF-α) was performed. The mean values of zinc concentration in the diet were found to be higher than those recommended (11.0 ± 3.9 mg/day and 20.3 ±11.9 mg/day for control group and judokas, respectively) although there was no significant difference between the groups. The mean plasma concentrations of zinc were below the reference range (71.4 ± 16.0 μg/dL and 71.9 ± 13.8 μg/dL for control group and judokas, respectively), without a significant difference between the groups. The mean concentrations of zinc erythrocyte were within the reference range (41.2±8.6 μg/ gHb and 42.6 ± 11.3 μg/gHb for control group and judokas, respectively), without a significant difference between the groups. There was no significant difference in the inflammatory biomarkers between the judokas and controls. There was not a significant correlation between biochemical parameters of zinc and inflammation biomarkers in adolescent judokas. Regarding the data found in the study, it can be concluded that the athletes evaluated have low plasma zinc concentrations, normal erythrocyte values, and high dietary intake of zinc. Moreover, the study don’t show a relationship between zinc parameters and inflammatory markers evaluated. Keywords: Inflammation, judokas, nutritional status, zinc

Introduction Physical exercise promotes increased energy metabolism with synthesis of reactive oxygen species and inflammatory markers [1]. Furthermore, hormonal changes occur in period of adolescence, such as the increase of sexual steroids concentration, which contribute to exacerbate the oxidative stress and inflammation induced by exercise [2]. In this sense, some cytokines appear to alter the metabolism of minerals, such as zinc, but the mechanisms underlying this phenomenon are not yet clear [3, 4]. Zinc is an essential mineral that promotes stabilization of cell membranes and structural proteins and cell signaling. Moreover, zinc is a cofactor of more than 300 metalloenzymes such as carbonic anhydrase and lactate dehydrogenase, which are

Int J Vitam Nutr Res (2020), 90 (1–2), 124–130 https://doi.org/10.1024/0300-9831/a000504

involved in intermediary metabolism during exercise. Zinc also participates in catalytic activity of superoxide dismutase, which protects from oxidative damage caused by exercise [5–7]. Studies show changes in zinc homeostasis in athletes [8–10]. The systematic review and meta-analysis of Chu et al. [8], for example, indicated significant increase in serum zinc concentrations immediately after an aerobic exercise session, and they showed that changes in serum zinc are influenced by exercise intensity, the mode of exercise and the participants training status. Higher increase in serum zinc concentrations was observed after maximally exercise testing, running and in untrained individuals. Muscle contractions performed during exercise, especially in impact, short duration, and high-intensity exercise

Ó 2019 Hogrefe

A.F. de Sousa et al., Zinc and inflammation in judokas

such as judo, cause disruption of muscle tissue, leading to the rapid release of zinc into the extracellular fluid, and as a result, an increase in plasma zinc. On the other hand, the subsequent reduction of this mineral’s level in serum occurs due to its redistribution to the liver and erythrocytes, under the influence of circulating interleukins [11–13]. In this regard, interleukin 1β (IL-1β), IL-6, and tumor necrosis factor α (TNF-α) are the cytokines that show the most relevant changes in expression during exercise [3, 4, 11, 14]. Studies have revealed that cytokines IL-1β, IL-6, and TNF-α stimulate expression of genes coding for metallothionein and the zinc transporter protein Zip-14 in plasma membrane; this change promotes the zinc influx into cells such as hepatocytes [15, 16]. Therefore, the increase in expression of these proteins results in this mineral’s accumulation in specific tissues and a consequent reduction of its plasma concentrations. Thus, the inflammatory process seems to play an important role in zinc homeostasis in the body of individuals practicing intensive physical exercise [17]. Considering the scarcity of data on the metabolic behavior of zinc in anaerobic-exercise practitioners and the antiinflammatory effect of this mineral, the aim of this study was to assess the relationship between zinc status and inflammation biomarkers in adolescent judokas.

Methods This was a cross-sectional study, with cases and controls, involving 52 male adolescents, aged between 14 and 19 years. This study involved only male athletes aiming to minimize the influence of specific female hormonal factors. The participants were subdivided into two groups: control (n = 27) and athletes (n = 25). The study participants were selected according to the following inclusion criteria: minimum training time equal to or greater than one year (judokas) or the absence of any physical activity (controls); no smoking; no diseases that can interfere with the nutritional status of zinc, e.g., diabetes mellitus and chronic renal failure; the absence of mineral supplements or vitamins in the diet or medications such as corticosteroids and penicillin, which can influence the testing for this mineral. The extreme weight judo athletes, with more than 100 kg, were excluded. The determination of sample size (n = 25) was based on the number of members of the Selection Piauiense Judo at the age of interest (n = 35), accounting for approximately 70% of the study population. The study’s protocol was approved by the Ethics Committee of the Federal University of Piauí, with protocol number

Ó 2019 Hogrefe

125

62/09. The study participants or their legal guardians (when the participants were younger than 18 years) signed the Consent Form, and the study was conducted in accordance with the Declaration of Helsinki.

Evaluation of Nutritional Status To assess this status, we determined the body-mass index calculated as the participant’s body weight divided by the square of the height. The classification of nutritional status was performed according to the recommendation of the World Health Organization [18]. The measurement of waist circumference was performed using a flexible, inelastic tape surrounding the natural waistline; the narrowest area between the chest and the hips was used as a reference value, as proposed by the World Health Organization [19]. The determination of body composition was performed using the bioelectrical impedance with a Biodynamics device model 310 Body Composition Analyzer (Biodynamics Corp., Shoreline, WA, 1995).

Measurement of Zinc Intake Food consumption was recorded using a 3-day food diary containing two alternate days during the week and one day on the weekend (Saturday or Sunday). At the time of submitting forms, guidelines were provided as to the correct way to write down the foods, such as to list the types of meals, preparation, portioning, portion sizes and times in which they were consumed. Upon receipt, the records were checked by researchers. The zinc content of the diet was calculated using the NutWin analysis software version 1.5 provided by the Federal University of Sao Paulo [20]. The Estimated Average Requirement (EAR) and Recommended Dietary Allowances (RDA) for zinc served as references values for suitable intake, being 8.5 mg/day (EAR) and 11 mg/day (RDA) for males aged between 14 and 18 years [21, 22].

Assessment of Maximum Oxygen Consumption Evaluation of maximum oxygen consumption (VO2max) was performed at baseline and served as a characterization tool for the participants (athletes and controls). VO2max was determined using spirometry in the Exercise Physiology Laboratory of the NOVAFAPI Faculty, by a specialist using the ErgoPC Elite system (MicromedBiotecnologia LTDA., Brasília, Brazil, 2002).

Int J Vitam Nutr Res (2020), 90 (1–2), 124–130

126

Assessment of Biochemical Parameters of Zinc Fourteen-milliliter samples of venous blood were collected in the morning, between 7 and 9 a.m., after the participants had fasted for at least 12 h, and in case of judokas, at least 24 h without exercise. The collected blood was distributed in two distinct tubes: (1) a polypropylene tube containing 30% sodium citrate as an anticoagulant (10 μL/mL blood) for zinc analysis (10 mL of blood) and (2) an EDTA tube for cytokine analysis (5 mL of blood). Plasma was separated from whole blood using centrifugation (CIENTECÒ 4 K15, São Paulo, Brazil) at 1831 g for 15 min at 4 °C. Subsequently, plasma was extracted with an automatic pipette, placed in the previously demineralized polypropylene microtubes, and stored at 20 °C. To isolate erythrocytes for the measurement of zinc concentration, the methods proposed by Whitehouse et al. [23] were used. The red blood cell mass was washed with 5 mL of isotonic saline (0.9% NaCl), was slowly homogenized by inversion, and was centrifuged at 1831 g for 10 min. The supernatant was then aspirated and discarded. The procedure described was performed three times to remove any contaminants from erythrocytes (i.e., platelets and leukocytes) [22]. Zinc analysis in plasma and erythrocytes was conducted using flame atomic absorption spectrophotometry, according to the method described by Rodriguez et al. [24]. TritisolÒ (MERCK) prepared by dilution with MilliQÒ water at concentrations of 0.1, 0.2, 0.3, 0.5, and 1.0 μg/mL served as a standard.

Plasma concentrations of IL-1β, IL-6, and TNF-α Analysis of cytokines was performed by means of a commercial kit according to the manufacturer’s instructions (Lincoplex Cytokine analytes, Linco Research, Missouri, USA), on the basis of the ELISA principle. The limits of detection for IL-1β, IL-6, and TNF-α were from 0.4 to 0.7 pg/mL, 0.3 to 0.7 pg/ml, and 0.1 pg/ml, respectively.

Statistical analysis The data were analyzed using the software packages S-PLUS v.3.2 Release, Minitab for Windows Release 11.0, and SPSS (for WindowsÒ version 9.0). The KolmogorovSmirnov test was conducted to verify the normality of the data. To compare outcome measures between the two groups of subjects, Student’s t test or Mann–Whitney U test was performed for parametric and nonparametric data, respectively. Additionally, Pearson’s or Spearman correlation test was used considering parametric or Int J Vitam Nutr Res (2020), 90 (1–2), 124–130

A.F. de Sousa et al., Zinc and inflammation in judokas

non-parametric variables, respectively. A difference was considered statistically significant when the p value was <0.05, with a 95% confidence interval.

Results The mean values and standard deviations for the anthropometric parameters used to assess the nutritional status of judokas and control subjects are shown in Table I. There were significant differences in the body weight, body-mass index, body fat, lean body mass, and fat mass (p < 0.05). Mean values and standard deviations for VO2max were 24.0 ± 7.1 mL/(kg min) for the control group and 42.4 ± 6.5 mL/(kg min) for judokas. This difference was significant (Student’s t test, p < 0.001). VO2max was higher in athletes, which shows that these adolescents had greater physical fitness and endurance than the control group did. Table II shows the means and standard deviation of energy, macronutrients, and zinc present in the diet ingested by control subjects and judokas. The mean values of dietary zinc were found to be higher than those recommended. There was a significant difference in the Table I. Means and standard deviation of body weight, height, body mass index, body fat, lean body mass and fat mass in the control group and judokas. Parameters

Control (n = 27) Mean ± SD

Judokas (n = 24) Mean ± SD

Weight (kg)

58.0 ± 9.0

66.2 ± 8.9

0.002

Height (m)

1.68 ± 0.08

1.72 ± 0.07

0.162

BMI (kg/m2)

20.4 ± 2.6

22.5 ± 2.0

0.003

BF (%)

19.4 ± 6.4

11.7 ± 3.9

<0.001

LBM (kg)

49.8 ± 22.2

58.3 ± 7.4

0.080

FM (kg)

12.3 ± 7.7

7.8 ± 3.3

0.012

Values significantly different between the judokas and control groups using Student’s t-test (p < 0.05). SD: standard deviation; BMI: body mass index; BF: body fat; LBM: lean body mass; FM: fat mass.

Table II. Means and standard deviation of energy, macronutrients, and zinc present in the diet ingested by control subjects and judokas. Parameters

Energy (kcal)

Control (n = 25) Mean ± SD

Judokas (n = 24) Mean ± SD

1950.0 ± 656.3 3261.5 ± 2013.3

p 0.005

Carbohydrate (%)

52.6 ± 6.4

51.0 ± 7.2

0.431

Protein (%)

22.7 ± 5.3

22.0 ± 6.2

0.673

Lipid (%)

24.7 ± 3.5

27.0 ± 3.9

0.039

Dietary Zinc (mg/day)

11.0 ± 3.9

20.3 ± 11.9

< 0.001

Dietary Zinc (mcg/kcal/day)

5.8 ± 1.6

6.4 ± 0.9

0.147

Values significantly different between the judokas and control groups using Student’s t-test or Mann-Whitney U test (p < 0.05). Reference values: Protein: 10-35%; Lipid: 20-35%; Carbohydrates: 45-65% (IOM, 2005). Dietary Zinc: EAR = 8.5 mg/day, RDA = 11 mg/day [22]. SD: standard deviation.

Ó 2019 Hogrefe

A.F. de Sousa et al., Zinc and inflammation in judokas

127

Table III. Means and standard deviation of biochemical parameters of zinc and plasma inflammatory biomarkers in the control group and judokas. Parameters

Control (n = 23) Mean ± SD

Judokas (n = 24) Mean ± SD

Plasma Zinc (μg/dL)

71.4 ±16.0

71.9 ± 13.8

0.914

Plasma Zinc (μg/dL/Kg LBM)

1.61 ± 0.69

1.25 ± 0.30

0.030

Plasma Zinc (μg/dL/Kg FM)

7.4 ± 4.0

10.8 ± 5.5

0.018

Erythrocyte Zinc (μg Zn/gHb)

41.2 ± 8.6

42.6 ± 11.3

0.632

IL-1β (pg/mL)

1.15 ± 0.80

1.37 ± 0.42

0.347

IL-6 (pg/mL)

3.25 ± 0.97

2.25 ± 0.50

0.156

TNF-α (pg/mL)

11.24 ± 3.02

10.11 ± 3.01

0.226

Values significantly different between the judokas and control groups using Student’s t-test (p>0.05). Reference values: Plasma Zinc: 75-110 μg/dL [25]; Erythrocyte Zinc: 40-44 μg/gHb [26]. SD: standard deviation. BF: body fat; LBM: lean body mass; FM: fat mass; IL-1β: interleucina 1β; IL-6: interleucina 6; TNF-α: fator de necrose tumoral α.

consumption of this mineral (p < 0.05) between the groups. However, there was not statistical difference for dietary zinc per kilocalories per day (p > 0.05) between the groups. Mean values and standard deviation of biochemical parameters of zinc and plasma values of IL-1β, IL-6, and TNF-α for control subjects and judokas are shown in Table III. There was no significant difference in plasma and erythrocytic zinc levels between the groups (p > 0.05). However, there was statistical difference for plasma zinc per kilograms of lean body mass per day and for plasma zinc per kilograms of fat mass per day (p < 0.05) between the groups. There was no significant difference in the inflammatory biomarkers between judokas and the control group (p > 0.05). Table IV shows the linear simple correlation between zinc status and plasma inflammatory biomarkers in control group and judokas. There was not a significant correlation between biochemical parameters of zinc and inflammation biomarkers in adolescent judokas (p > 0.05).

Discussion In this study, we determined certain biomarkers of zinc status and we analyzed their relationship to plasma

concentrations of proinflammatory cytokines in adolescent judokas. The judokas showed the mean zinc intake above the EAR and RDA values, with statistically significant differences between both athletes and control group (p < 0.05). The consumption of zinc by the participants of this study can be explained by the usual protein intake, especially red meat and other animal foods: known dietary sources of zinc that are a part of eating habits in these groups [27–29]. It is noteworthy that the mean zinc intake in mg/kcal/day was not statistically different between the groups. This result evidences that the higher caloric consumption may have contribute to for the higher zinc intake of judokas. The dietary intake of zinc did not influence the plasma levels of this nutrient in the athletes, given that the judokas had high average values of dietary zinc and a reduced concentration of zinc in plasma, without significant difference between the groups in this study (p > 0.05). However, the findings of Casimiro-Lopes et al. [30], who also evaluated the plasma zinc concentrations in judo athletes 24 hours after completion of training, showed adequate values of this biomarker. The reduced plasma levels of zinc in judokas may be due to increases in plasma volume induced by exercise or due to changes in the distribution of zinc in the body of physically active people, characterized by increased levels of this mineral in specific tissues, such as liver [11, 12, 31]. In addition, it should be mentioned that the assessment of plasma zinc in this study was performed 24 hours after exercise. In this regard, the literature shows high levels of zinc in the plasma immediately after high-intensity exercise, which may be due to the disruption of muscle tissue, leading to the rapid release of zinc into the extracellular fluid [8, 11]. However, studies evaluating the levels of zinc in plasma or serum, a day or a few weeks after the exercise, showed reduced concentrations of zinc, corroborating the findings of our study [12, 32, 33]. On this point, researches show an increase in plasma volume of athletes 24-hours after exercise, and it could be due to an increase in plasma protein mass, that creates an osmotic gradient for water movement into the vascular space; to a decrease in central venous pressure, that would facilitate greater flux of fluid from the lymphatic system or interstitial

Table IV. Analysis of linear simple correlation between plasma and erythrocyte zinc and plasma inflammatory biomarkers in control group and judokas. Parameters

Plasma Zinc

Erythrocyte Zinc

Control r

Judokas p

Control p

Judokas p

IL-1β

0.098

0.750

0.205

0.523

0.313

0.257

0.358

0.254

IL-6

0.414

0.586

0.919

0.258

0.916

0.029*

0.483

0.679

TNF-α

0.455

0.058

0.285

0.211

0.045

0.858

0.029

0.899

*Pearson’s linear correlation (p < 0.05).

Ó 2019 Hogrefe

Int J Vitam Nutr Res (2020), 90 (1–2), 124–130

128

space; and/or an increase in renal fluid retention [34–37]. In this way, this hypervolemia could contribute to the reduced plasma concentrations of zinc in judokas in our study. It is worth mentioning that body composition may influence plasma concentration of zinc. In our study, the judokas showed reduced values of plasma zinc in μg/dL/Kg of lean body mass, when compared with control group. This result can be explained by the higher lean body mass in judokas that is associated with higher plasma volume. The increase in plasma volume promotes hemodilution of zinc, reducing its plasma values. On the other hand, the levels of plasma zinc in μg/dL/kg of body fat were elevated in judokas, in relation to control group because the body fat is associated with lower plasma volume. Regarding the determination of average concentrations of zinc in red blood cells, this assay showed no statistically significant difference between the groups (p > 0.05). These results are consistent with the study by Mundie and Hare [38], which revealed no difference in erythrocytic zinc concentrations 24 hours after a session of anaerobic exercise in athletes compared to the control group. Scarcity and discrepancies in the results of studies on erythrocytic zinc in athletes engaged in strenuous activities limit the broader discussion of the topic. In this sense, the literature shows a relation between zinc concentrations in erythrocytes and the mode and intensity of exercise. Anaerobic activity, like judo, seems to result in a high metabolic and nutritional demand, in line with the usually observed increase in the activity of the enzymes superoxide dismutase and carbonic anhydrase, both zinc-dependent, and even a loss of this mineral with sweat [39, 40]. These factors may have contributed to the finding that the zinc values in judokas’ erythrocytes did not show a significant difference from those in controls, although they had high zinc levels in the diet. The mean values of plasma concentrations of IL-1β, IL-6, and TNF-α showed no significant differences between the groups (p > 0.05). These results are similar to those reported by Oliveira, Procida, and Borges-Silva [41], who also analyzed the plasma concentrations of IL-6 and TNF-α in judo athletes and found no statistically significant differences between the athletes and controls. The literature shows that there is substantial variability in the results of studies involving the analysis of cytokines. According to Pedersen [42], the explanation for this variation is the absence of homeostatic control of these substances because their synthesis is influenced by the type, duration, and intensity of exercise. This reasoning may help to explain the absence of statistically significant differences in IL1-β, IL-6, and TNF-α levels in this study. In light of a better understanding of the results, we conducted an analysis of correlation between zinc status parameters and the evaluated inflammatory biomarkers, Int J Vitam Nutr Res (2020), 90 (1–2), 124–130

A.F. de Sousa et al., Zinc and inflammation in judokas

and it was not observed significant result. However, Liuzzi et al. [43] showed the influence of IL-6 on the manifestation of hypozincemia associated with an acute inflammatory response. Increase in IL-6 concentration appears to contribute to changes in zinc metabolic patterns through redistribution of plasma zinc to the liver, where it remains attached to metalloproteins, such as metallothionein. Furthermore, it has been demonstrated that IL-6 also regulates the expression of the protein Zip14 in hepatic tissue; this mechanism may facilitate zinc compartmentalization in that organ and thereby reduce its concentration in plasma [43]. It is emphasized that factors such as accelerated growth in adolescence and metabolic disorders resulting from exercise are also important for changes in zinc metabolism [11, 44]. Therefore, it appears that further research is needed on this topic for a better understanding of the metabolic behavior of zinc in the metabolic changes induced by exercise, particularly in relation to the increased plasma concentrations of inflammatory biomarkers. This study has certain limitations. The assessment of dietary intake is susceptible to random and systematic errors, and can be affected by the number of days. In order to minimize, the data of zinc obtained were subsequently adjusted on the basis of energy intake and intra-individual variation. Another limitation is the reduced number of participants of this study. Judokas evaluated in this study eat diets with high zinc content. Biochemical parameters of this mineral in the study participants show adequate zinc concentrations in erythrocytes and reduced levels in plasma. Moreover, the study don’t show a relationship between zinc parameters and inflammatory markers evaluated.

References 1. Parker, L., McGuckin, T.A., & Leitch, A.S. (2014) Influence of exercise intensity on systemic oxidative stress and antioxidant capacity. Clin. Physiol. Funct. Imaging. 34, 377–383. 2. Sociedade Brasileira de Cardiologia. (2005). I Diretriz de prevenção da aterosclerose na infância e na adolescência. Rio de Janeiro Brasil: Arquivos Brasileiros de Cardiologia. 3. Díaz-Castro, J., Guisado, R., Kajarabille, N., García, C., Guisado, I.M., de Teresa, C., & Ochoa, J.J. (2012) Coenzyme Q(10) supplementation ameliorates inflammatory signaling and oxidative stress associated with strenuous exercise. Eur. J. Nutr. 51, 791–799. 4. Michailidis, Y., Karagounis, L.G., Terzis, G., Jamurtas, A.Z., Spengos, K., Tsoukas, D., Chatzinikolaou, A., Mandalidis, D., Stefanetti, R.J., Papassotiriou, I., Athanasopoulos, S., Hawley, J.A., Russell, A.P., & Fatouros, I.G. (2013) Thiol-based antioxidant supplementation alters human skeletal muscle signaling and attenuates its inflammatory response and recovery after intense eccentric exercise. Am. J. Clin. Nutr. 98, 233–245. 5. Cruz, K.J., de Oliveira, A.R., & Marreiro, D.N. (2015) Antioxidant role of zinc in diabetes mellitus. World J. Diabetes. 6, 333–337.

Ó 2019 Hogrefe

A.F. de Sousa et al., Zinc and inflammation in judokas

6. Lima, V.B.S., Brito, A.K.S., Morais, J.B.S., Severo, J.S., Freitas, T.E.C., Araújo, C.G.B., & Marreiro, D.N. (2015) Participação do estresse oxidativo sobre o metabolismo do zinco e da enzima superóxido dismutase no diabetes mellitus tipo 2. Nutrição em Pauta. 23, 5–9. 7. Lukaski, H.C. (2000) Magnesium, zinc, and chromium nutriture and physical activity. Am.J.Clin. Nutr. 72, 585S–593S. 8. Chu, A., Petocz, P., & Samman, S. (2016) Immediate effects of aerobic exercise on plasma/serum zinc levels: a metaanalysis. Med. Sci. Sports. Exerc. 48, 726–733. 9. Soria, M., González-Haro, C., Ansón, M., López-Colón, J.L., & Escanero, J.F. (2015) Plasma levels of trace elements and exercise induced stress hormones in well-trained athletes. J. Trace Elem. Med. Biol. 31, 113–119. 10. Kara, E., Gunay, M., Cicioglu, I., Ozal, M., Kilic, M., Mogylkoc, R., & Baltaci, A.K. (2010) Effect of zinc supplementation on antioxidant activity in young wrestlers. Biol. Trace Elem. Res. 134, 55–62. 11. Chu, A., & Samman, S. (2014) Zinc homeostasis in exercise: implications for physical performance. Vitam. Miner. 3, e 132. 12. Kara, E., Ozal, M., Gunay, M., Kilic, M., Baltaci, A.K., & Mogulkoc, R. (2011) Effects of exercise and zinc supplementation on cytokine release in young wrestlers. Biol. Trace Elem. Res. 143, 1435–1440. 13. Val, F.F.A., Okubo, R., Falcai, M.J., Asano, F.S., & Shimano, A. C. (2013) Efeito de regimes de treinamento físico de alto impacto nas propriedades mecânicas de ossos – estudo experimental em ratas Wistar. Rev. Bras. Med.Esporte. 19, 252–255. 14. Nieman, D.C., Konrad, M., Henson, D.A., Kennerly, K., Shanely, R.A., & Wallner-Liebmann, S.J. (2012) Variance in the acute inflammatory response to prolonged cycling is linked to exercise intensity. J. Interferon. Cytokine Res. 32, 12–17. 15. Chu, A., Foster, M., Ward, S., Zaman, K., Hancock, D., Petocz, P., & Samman, S. (2015) Zinc-induced upregulation of metallothionein (MT)-2A is predicted by gene expression of zinc transporters in healthy adults. Genes Nutr. 10, 44. 16. Lichten, L.A., Luizzi, J.P., & Cousins, R.J. (2009) Interleukin 1-β contributes via nitric oxide to the upregulation and functional activity of the zinc transporter Zip-14 (Slc 39a14) in murine hepatocytes. Am. J. Physiol.Gastrointest. Liver Physiol. 296, G860–G867. 17. Ni, H., Li, C., Feng, X., & Cen, J.N. (2011) Effects of forced running exercise on cognitive function and its relation to zinc homeostasis-related gene expression in rat hippocampus. Biol. Trace Elem. Res. 142, 704–712. 18. World Health Organization. (2000). Obesity: preventing and managing the global epidemic, technical report series. Geneva Switzerland: World Health Organization. 19. World Health Organization. (2008). Waist circumference and waist–hip ratio: report of a who expert consultation. Geneva Switzerland: World Health Organization. 20. Anção, M. S., Cuppari, L., Draine, A.S., & Singulem, D. (2002). Programa de apoio à nutrição Nutwin : versão 1.5. São Paulo: Departamento de Informática em Saúde SPDM, Unifesp/EPM. 21. Institute of Medicine. (2001). Dietary reference intakes for vitamin a, vitamin k, arsenic, boron, chromium, copper, iodine, iron, manganese, molybdenum, nickel, silicon, vanadium, and zinc. Washington DC: National Academies Press. 22. Institute of Medicine. (2005). Dietary reference intakes for energy, carbohydrate, fiber, fat, fatty acids, cholesterol, protein, and amino acids. Washington DC: National Academies Press. 23. Whitehouse, R.C., Prasad, A.S., Rabbani, P.I., & Cossack, Z.T. (1982) Zinc in plasma, neutrophils, lymphocytes, and

Ó 2019 Hogrefe

129

24.

25.

26.

27.

28.

29.

30.

31. 32.

33.

34.

35.

36.

37.

38.

39. 40. 41.

42.

43.

erythrocytes as determined by flameless atomic absorption spectrophotometry. Clin. Chem. 28, 475–480. Rodriguez, M.P., Narizano, A., Demezylo, V., & Cid, A. (1989) A simpler method for determination of zinc human plasma levels by flame atomic abortion spectro cvf photometry. At. Spectrosc. 10, 68–70. Gibson, R.S. (2005). Assessment of chromium, copper and zinc status. In R.S. Gibson (Ed.), principles of nutritional assessment. (pp. 711–730). New York: Oxford University Press. Guthier, H.A., & Picciano, M.F. (1994). Micronutrient minerals. In H.A. Guthier & M.F. Picciano (Eds.), human nutrition. (pp. 351–357). New York: Mosby. Gibson, R.S. (2012) A historical review of progress in the assessment of dietary zinc intake as an indicator of population zinc status. Adv. Nutr. 3, 772–782. Instituto Brasileiro de Geografia e Estatística. (2011). Pesquisa de orçamentos familiares 2008–2009: análise do consumo alimentar pessoal no Brasil. Rio de Janeiro: IBGE. Freire, S.C., Fisberg, M., & Cozzolino, S.M. (2013) Dietary intervention causes redistribution of zinc in obese adolescents. Biol. Trace Elem. Res. 154, 168–177. Casimiro-Lopes, G., de Oliveira-Junior, A.V., Portella, E.S., Lisboa, P.C., Donangelo, C.M., Moura, E.G., & Koury, J.C. (2009) Plasma leptin, plasma zinc, plasma copper are associated in elite female and male judo athletes. Biol. Trace Elem. Res. 127, 109–115. Canali, E.S., & Kruel, L.F.M., Respostas hormonais ao exercício. (2001). Rev. Paul. Educ. Fís. 15, 141–153. Kara, E., Akil, M., & Yalçinkaya, O. (2012) The effect of aerobic exercise programme on trace element levels of young men. Afr. J. Microbiol. Res. 6, 165–168. Andrade, L.P., Lima, V.B.S., Sousa, A.F., Nogueira, N.N., Moura Filho, O.F., & Marreiro, D.N. (2010) Nutritional status zinc in adolescente judo athletes. Fit. Perf. J. 9, 77–84. Bartholomew, K., O’Brien, B.J., & Gill, N.D. (2004) Exerciseinduced hypervolemia may not be consequential to dehydration during exercise. J. S. Sci Med. 3(YISI 1), 50–55. Mack, G.W., Yang, R., Hargens, A.R., Nagashima, K., & Haskell, A. (1998) Influence of hydrostatic pressure gradients on regulation of plasma volume after exercise. J Appl Physiol. 85, 667–675. Nagashima, K., Wu, J., Stavros, A.K., & Mack, G.W. (2001) Increased renal tubular sodium reabsorption during exerciseinduced hypervolemia in humans. J Appl Physiol. 91, 1229–1236. Wu, J., & Mack, G.W. (2001) Effect of lymphatic outflow pressure on lymphatic albumin transport in humans. J Appl Physiol. 91, 1223–1228. Mundie, T.G., & Hare, B. (2001) Effects of resistance exercise on plasma, erythrocyte, and urine Zn. Biol. Trace Elem. Res. 79, 23–28. Hambidge, M. (2003) Biomarkers of trace mineral intake and status. J. Nutr. 133, 948S–955S. Peres, P.M., & Koury, J.C., Zinco, imunidade, nutrição e exercícioCERES. 11 9–18. Oliveira, D.C., Rossano-Procida, I., & Borges-Silva, C. (2010) Effect of training judo in the competition period on the plasmatic levels of leptin and pro-inflammatory cytokines in high-performance male athletes. Biol. Trace Elem. Res. 135, 345–354. Pedersen, B.K. (2000) Special feature for the Olympics: effects of exercise on the immune system: exercise and cytokines. Immunol. Cell. Biol. 78, 532–535. Liuzzi, J.P., Lichten, L.A., Rivera, S., Blanchard, R.K., Aydemir, T.B., Knutson, M.D., Ganz, T., & Cousins, R.J. (2005)

Int J Vitam Nutr Res (2020), 90 (1–2), 124–130

130

A.F. de Sousa et al., Zinc and inflammation in judokas

Interleukin-6 regulates the zinc transporter Zip-14 in liver and contributes to the hypozincemia in the acute-phase response. Proc. Natl. Acad. Sci. 102, 6843–6848. 44. Toral, N., Rhein, S.O., Cintra, I.P., & Fisberg, M. (2005) O papel do zinco na infância e adolescência. Rev. Bras. Med. 0, 158– 168.

Conflict of Interest The authors declare that there are no conflicts of interest.

Acknowledgments Sousa AF, Mesquita LSA, Cruz KJC, Oliveira ARS, Morais JBS, Severo JS, Beserra JB and Nogueira NN have participated to the redaction and the review of the manuscript; Marreiro DN had supervised the paper, participated in the redaction and the review of the paper.

dilina.marreiro@gmail.com

Int J Vitam Nutr Res (2020), 90 (1–2), 124–130

Professor Dr. Dilina do Nascimento Marreiro 665, Hugo Napoleão st., Ed. Palazzo Reale, Apto . 2001, Jóquei 64048-320, Teresina, Piauí Brazil

Ó 2019 Hogrefe

Original Communication

The Vitamins Involved in OneCarbon Metabolisms are Associated with Reduced Risk of Breast Cancer in Overall and Subtypes Case-Control Study Mahshid Hatami1,2, Farhad Vahid2,3, Mohammad Esmaeil Akbari2, Mahya Sadeghi1,2, Fatemeh Ameri1,2, Hassan Eini-Zeinab4, Yasaman Jamshidi-Naeini1,2, and Sayed Hossein Davoodi1,2 1

Department of Nutritional Sciences, National Nutrition and Food Technology Research Institute, Faculty of Nutrition Sciences and Food Technology, Shahid Beheshti University of Medical Sciences, Tehran, Iran

Cancer Research Center, Shahid Beheshti University of Medical Sciences, Tehran, Iran

Department of Nutritional Sciences, School of Health, Arak University of Medical Sciences, Arak, Iran

Department of Community Nutrition, National Nutrition and Food Technology Research Institute, Faculty of Nutrition Sciences and Food Technology, Shahid Beheshti University of Medical Sciences Tehran, Iran

Received: March 27, 2017; Accepted: September 7, 2017 Abstract: Background: Some micronutrients like folate, vitamin B12, B6, and B2 are the source of coenzymes, which participate in one-carbon metabolism. Any disruption in this metabolism can interfere with DNA replication, repair and regulation of gene expression and ultimately promote the likelihood of carcinogenesis. This study aimed at investigating the relationship between the intakes of micronutrients involved in one-carbon metabolism with breast cancer (BrCa) and its subtype’s odds. Methods: Nutrients’ intake from diet and supplements were collected through interviewing 151 cases and 154 controls by a 168-item semiquantitative food frequency questionnaire. Logistic regression was used to determine the relationship between dietary and/or total intake of studied nutrients and odds of BrCa and its subtypes. Results: After adjusting the effects of confounding variables in the models, the odds of BrCa was significantly lower in the highest intake quartile compared with the lowest quartile for total intake of vitamin B2 (OR = 0.17, 95% CI, 0.07–0.39; Ptrend < 0.001), vitamin B6 (OR = 0.11, 95% CI, 0.05–0.27; Ptrend < 0.001), vitamin B12 (OR = 0.20, 95% CI, 0.09–0.43; Ptrend < 0.001) and folate (OR = 0.09, 95% CI, 0.04–0.21; Ptrend < 0.001). Also, those with the highest quartile of vitamin B6, B12, B2 and folate intake compared with the lowest quartile were less likely to develop estrogen receptor (ER)+ and progesterone receptor (PR)+ subtypes, ER- status, PR- and human epidermal growth factor receptor 2 (HER2)+ subtypes and HER2- status. Conclusion: High intakes of vitamins B2, B6 and folate are associated with reduced odds of BrCa in overall and all ER, PR and HER2 subtypes. Also, high intakes of vitamin B12 reduced the odds of all subtypes of BrCa except ER- subtype. Keywords: Breast cancer, micronutrients, HER2, one-carbon metabolism

Introduction Breast cancer (BrCa) is the most common cancer among women worldwide, and it is the second leading cause of cancer-related death among women, after lung cancer, in the developed countries [1]. This cancer is among the top five most common cancers among the Iranians and it is the most common cancer among the Iranian women. [2]. More than 50,000 Iranian women suffer from this disease, and each Ó 2019 Hogrefe

year more than 7,000 patients are added to this number [2]. BrCa has a diverse etiology and several risk factors contributing to its development [3, 4]. Several risk factors such as age, family history of cancer, early menarche, late menopause, genetic predisposition, age at the birth of first child and number of months of breastfeeding are involved in the BrCa etiology [11]. Among modifiable risk factors, diet stands out as a potentially important set of factors [12]. Despite the advances that have been made in early Int J Vitam Nutr Res (2020), 90 (1–2), 131–140 https://doi.org/10.1024/0300-9831/a000501

132

M. Hatami et al., Vitamins Involved in One-Carbon Metabolism and Breast Cancer

detection and treatment of this cancer, still is the most cause of cancer deaths among women [13]. Several experimental and observational study have examined the association of nutrients [14–16] and dietary patterns and the risk of BrCa [12, 17]. One of the key biochemical pathways involved in the regulating gene expression is one-carbon metabolism that provides methyl groups for a variety of essential biomolecules and biological processes [19, 20]. Disruption in this metabolism can interfere with DNA replication, repair and regulation of gene expression, and promote the likelihood of carcinogenesis. The most effective vitamin in the process is folate; whereas vitamins B2, B6 and B12 are essential cofactors for enzymes involved in the reaction [21–25]. On the other hand, a number of factors involved in the biology of BrCa are “prognostic factors” and “predictive factors”. These factors could be used to predict the disease. The most well-known of them are estrogen (ER), progesterone receptor (PR), and human epidermal growth factor receptor-2 (HER-2). The association between this factors and vitamins are reported in some study [21] but the studies that examined associations between vitamins intake and BrCa have provided inconsistent results. As far as we know, no attention has been paid to the association between the intake of micronutrients and BrCa in Iranian women. Thus, this is the first study to examine the relationship between intake of vitamins involved in one-carbon metabolism and BrCa and its subtypes.

Inclusion and exclusion criteria Inclusion criteria for cases included the following: a) having a histopathologically confirmed BrCa diagnosis, b) willingness to cooperate in the study, c) not following a restrictive diet, including ones resulting in weight reduction or increase during the year prior to the interview, d) be between 20 and 80 years of age, e) be within three months from the time of diagnosis of BrCa, f) be free of conditions such as pregnancy, lactation, and neurological, gastrointestinal, hepatic, endocrine, immune, kidney and heart disorders and diseases, g) have no other malignancy apart from this cancer. Exclusion criteria in the case group included the following: a) non-adherence to the study protocol, b) reporting caloric intake > 5500 or < 800 kcal/day, c) Severe lethargy (The patient’s inability to respond to the questions) Inclusion criteria in control group included the following: a) willingness to cooperate in the study, b) absence of any malignancy, c) not following a restrictive diet, including one resulting in weight reduction or increase during the year prior to the interview, d) be between 20 and 80 years of age, f) be free of conditions such as pregnancy, lactation, and neurological, gastrointestinal, hepatic, endocrine, immune, kidney and heart disorders and diseases. Exclusion criteria in the control group included the following: a) non-adherents to the study protocol, b) reporting total caloric intake > 5500 or < 800 kcal/day

Assessment of dietary intake

Materials and Methods Participants A hospital-based case–control study with simple convenience sampling method was conducted in Tehran, Iran. The cases were patients with BrCa diagnosed by a pathologist within the previous three months. The controls were women referred to the same center and their lack of BrCa was confirmed by the clinical examination. The study included 151 patients with BrCa and 154 controls. The study was conducted at the Shahid Beheshti University of Medical Sciences (SBMU) Cancer Research Center (CRC) of Iran from March 2015 to February 2016. Controls were frequency matched on age (±10 year). Data on cases and controls were collected at the same time and they were interviewed in the same setting using the standardized procedures. After providing written and verbal explanations about the methodology of the study, informed consent was received from all the participants. The study protocol was approved by the local Ethics Review Committee at SBMU, Tehran, Iran. Int J Vitam Nutr Res (2020), 90 (1–2), 131–140

In this study, dietary intakes of the subjects over the past year prior to diagnosis were evaluated by a valid and reliable FFQ [26], which included 168 food and beverage items commonly consumed by Iranians using standard serving sizes. Participants were asked to report the frequency and the amount of consumption of each food item in the last year according to the standard size units (standard serving size) in the questionnaire. According to the questionnaire, depending on the type of food, subjects indicated their intake of the food items per day, week, month or year, or as never. Information obtained from the FFQ was analyzed using Nutritionist IV (First Databank, Hearst Corp., San Bruno, CA, USA) in order to calculate the average daily intake of energy and nutrients. The averages of daily intake for B2, B6, and B12 vitamins were calculated through summing up the multiplications of consumed amount of each food (g/d) item containing of these vitamins by the specified standard portion size of that food. The intake of each nutrient from the supplements was taken from the box’s’ ingredients information and was added to dietary intake of each nutrient. The total folate Ó 2019 Hogrefe

M. Hatami et al., Vitamins Involved in One-Carbon Metabolism and Breast Cancer

intake was computed by first multiplying synthetic folate by a conversion factor of 1.7 and then adding intakes of natural food folate [27].

Assessment of physical activity Physical activity was assessed by a validated questionnaire [28]. Participants were asked to rate their daily activities such as walking, exercise, sleep, hours devoted to watching television, housework, bathing, etc., along with the intensity of the activity reported. Total activity was reported for 24 hours and the Metabolic Equivalent of Tasks (METs) were calculated based on these self-reports.

Assessment of other variables For all participants, the required information about age (year), smoking (yes/no/former smoker), education (illiterate/low literate/diploma/higher than diploma), family history of cancer (yes/no), employment (housekeeper/ employee/retired), marital status (single/married/ divorced), menopause status (yes/no), number of children and other variables of interest were collected through a general information questionnaire during the interviews. The weight of each participant was measured with the least clothes using a SECA digital scale, which is accurate to 100 grams. Height was measured without shoes in standing position, leaning against the wall and shoulder blades under normal circumstances with an accuracy of .5 cm by the mean of a tape mounted on the wall. Body mass index (BMI) was calculated by dividing weight (in kilograms) by the square of height (square meters).

Statistical analysis We used mean and standard deviation to describe the quantitative data and absolute and relative frequencies, to describe qualitative data. Kolmogorov-Smirnov test was used to test the Normality of distribution, if the data showed normal distribution; independent sample t-test was used to compare means and standard deviations of variables between case and control groups. Otherwise, Mann-Whitney U test was applied. Chi-squared test was performed for categorical variables to compare the distribution of qualitative variables between the two groups. Conditional logistic regression was performed to estimate the odds ratio (OR) and 95% confidence intervals (95% CI) in order to assess the correlation between nutrients intake and risk of BrCa. Multivariate unconditional logistic regression analysis was applied to consider related potential confounding Ó 2019 Hogrefe

133

factors such as energy intake, physical activity, employment status, marital status, educational level, and use of oral contraceptives in adjusted models. P values of < 0.05, two-sided, was considered to show a statistically significant outcome. Statistical tests were performed using IMB SPSS Statistics 21; all p values were based on two-sided tests.

Results Demographic, reproductive, and lifestyle characteristics of study participants, are presented in Table 1. Compared with the controls, the cases had more physical activity (p = 0.007), energy intake (p < 0.001), and oral contraceptives consumption (p < 0.001). The cases were more housekeepers (p = 0.046), married (p = 0.040), and somewhat less educated (p = 0.004). No significant differences were found between the cases and controls in BMI, age, age at menarche, age at menopause, the number of live births, menopause status, history of BrCa and using hormone replacement therapy. Greater intakes of vitamin B2, vitamin B6, vitamin B12, and folate were associated with lower odds of BrCa for all women (Table 2). Table 3 shows the impact of dietary vitamins consumption and BrCa odds according to ER and PR status. As important results of our study, Table 4 shows the impact of dietary B vitamins consumption and BrCa odds according to HER2+/- BrCa. ORs for the highest quartile of dietary intake of vitamin B2 compared with the lowest (ORQ1-Q4) were 0.07(95% CI, 0.02-0.22; P trend < 0.001) for HER2+ status, 0.13 (95% CI, 0.04-0.42; P trend < 0.001) for HER2- status. ORs for the highest quartile of dietary intake of vitamin B6 compared with the lowest (ORQ1Q4) were 0.07 (95% CI, 0.02-0.22; P trend < 0.001) for HER2+ status, 0.05 (95% CI, 0.01-0.20; P trend < 0.001) for HER2- status. ORs for the highest quartile of dietary intake of vitamin B12 compared with the lowest (ORQ1-Q4) were 0.20 (95% CI, 0.08-0.52; P trend < 0.001) for HER2 + status, 0.31 (95% CI, 0.12-0.82; P trend = 0.035) for HER2- status. ORs for the highest quartile of dietary intake of folate compared with the lowest (ORQ1-Q4) were 0.07 (95% CI, 0.02-0.22; P trend < 0.001) for HER2+ status, 0.08 (95% CI, 0.03-0.25; P trend < 0.001) for HER2- status.

Discussion In this case-control study, we observed a statistically significant inverse association between dietary and total intake of vitamin B2, B6, B12 and folate and odds of BrCa. Also, this Int J Vitam Nutr Res (2020), 90 (1–2), 131–140

134

M. Hatami et al., Vitamins Involved in One-Carbon Metabolism and Breast Cancer

Table 1. Comparison of cases and controls on sociodemographic characteristics among Iranian women. Cases (n = 151)

Controls (n = 154)

Mean ± sd or Percentages

p–value

Age (years)

49.70 (11.60)

47.83 (12.36)

Weight (kg)

69.03 (11.27)

70.30 (11.15)

0.162 0.331

Height (cm)

158.42 (5.89)

158.21 (5.39)

0.891

BMI (kg/m2)

27.53 (4.42)

28.15 (4.71)

0.381

Physical activity in (MET-hour/day)

35.43 (3.93)

33.72 (5.64)

0.007

Energy Intake (kcal/day)

2065.83 (853.82)

1787.32 (440.85)

<0.001

Age at menarche (years)

13.20 (1.52)

13.15 (1.37)

0.170

Age at menopause (years)

48.89 (4.98)

47.85 (4.20)

0.061

2.89 (1.53)

3.07 (1.73)

0.770

Number of live births Menopausal status Premenopausal

51.00

55.80

Postmenopausal

49.00

44.20

Housewife

65.60

53.90

Employed

24.50

37.70

9.90

8.40

Occupation

Retired

0.400 0.046

Marital status Unmarried Married Divorced/Widowed

6.60

15.60

84.10

77.30

9.30

7.10

0.040

Educational level Primary school or lower

21.20

7.80

Junior high school

10.60

15.60

Senior high school

30.50

40.90

College or higher

37.70

35.70

0.004

Smoking Yes

4.00

3.20

93.40

95.50

2.60

1.30

Yes

54.30

29.20

45.70

70.80

Yes

9.30

4.50

90.70

95.50

Previously

0.651

Oral contraceptive use <0.001

Hormone replacement therapy use 0.102

Family history of breast cancer Yes

9.30

8.40

90.70

91.60

0.803

a ANOVA was used for continuous variables and Chi-square was used for categorical variables. SD = Standard Deviation, BMI = body mass index, METs = Metabolic Equivalent of Tasks.

inverse association was observed in most subtypes of ER, PR, and HER2 status. One-Carbon metabolism contains a complex network of biochemical pathways of interactions between vitamins, homocysteine, and methionine. Folate and methionine are the main sources of methyl groups [21, 29, 30] that have been investigated in several studies [31–38]. A J-shaped correlation between the folate intake and BrCa has been shown in a dose response Meta-Analysis of prospective studies. Int J Vitam Nutr Res (2020), 90 (1–2), 131–140

This means that an intake of 200 to 300 μg folate has a protective effect against the BrCa but daily folate intake more than 400 μg is associated with an increased risk [39]. Also, a U- shaped correlation has been indicated in prospective studies in a systematic review and meta-analysis study. This means that daily intake of less than 153 μg and 400 μg of folate may exacerbate the risk of the BrCa [35, 40]. Some case-control studies showed that the individuals in the highest quartile of folate intake compared to the lowest Ó 2019 Hogrefe

M. Hatami et al., Vitamins Involved in One-Carbon Metabolism and Breast Cancer

135

Table 2. Association between dietary and total intake of vitaminB2, B6, B12, folate and BrCa risk among Iranian women.

Dietary Vitamin B2 (mg/day)

Total Vitamin B2 (mg/day)

Dietary Vitamin B6 (mg/day)

Total Vitamin B6 (mg/day)

Dietary Vitamin B12 (μg/day)

Total Vitamin B12 (μg/day)

Dietary Folate (μg/day)

Total Folate (μg/day)

OR(95%CI)1

P-trend

25(16.2)

0.001

39(25.3)

0.45(0.23-0.88)

Quartiles of intake

Cases (%)

Controls (%)

Q1( 1.25)

52(34.4)

Q2(1.26-1.60)

37(24.5)

OR (95%CI)2

P-trend

<0.001

0.40(0.20-0.83)

Q3(1.61-1.94)

29(19.2)

47(30.5)

0.30(0.15-0.58)

0.19(0.09-0.42)

Q4( 1.95)

33(21.9)

43(27.9)

0.37(0.19-0.71)

0.14(0.06-0.34)

Q1(1.27)

52(34.4)

25(16.2)

Q2(1.28-1.65)

37(24.5)

39(25.3)

0.46(0.24-0.88)

0.002

<0.001

0.40(0.20-0.82)

Q3(1.66-2.01)

28(18.5)

48(32.2)

0.28(0.14-0.55)

0.17(0.08-0.37)

Q4( 2.02)

34(22.5)

32(27.3)

0.39(0.20-0.75)

0.17(0.07-0.39)

Q1( 1.11)

56(37.1)

21(13.6)

Q2(1.12-1.32)

31(20.5)

45(29.2)

0.26(0.13-0.51)

0.001

<0.001

0.23(0.11-0.48)

Q3(1.33-1.64)

31(20.5)

45(29.2)

0.26(0.13-0.51)

0.14(0.06-0.32)

Q4( 1.65)

33(21.9)

43(27.9)

0.29(0.15-0.57)

0.08(0.03-0.21)

Q1( 1.12)

54(35.8)

23(14.9)

Q2(1.13-1.33)

33(21.9)

43(27.9)

0.33(0.17-0.64)

0.002

<0.001

0.27(0.13-0.57)

Q3(1.34-1.75)

30(19.9)

46(29.9)

0.28(0.14-0.54)

0.16(0.07-0.35)

Q4( 1.76)

34(22.5)

42(27.3)

0.34(0.17-0.67)

0.11(0.05-0.27)

Q1( 2.86)

50(33.1)

27(17.5)

Q2(2.87-3.97)

33(21.9)

43(27.9)

0.41(0.22-0.79)

Q3(3.98-5.10)

35(23.2)

41(29.9)

0.46(0.24-0.88)

0.42(0.20-0.86)

Q4( 5.11)

32(21.9)

43(27.3)

0.41(0.22-0.79)

0.31(0.15-0.65)

Q1( 2.88)

51(33.8)

26(16.9)

Q2(2.89-4.17)

36(23.8)

40(26.0)

0.46(0.24-0.88)

0.016

0.002

0.48(0.24-0.99)

0.001

<0.001

0.48(0.22-0.98)

Q3(4.18-5.46)

36(23.8)

40(26.0)

0.46(0.24-0.88)

0.42(0.20-0.86)

Q4( 5.47)

28(18.5)

48(31.2)

0.29(0.15-0.58)

0.20(0.09-0.43)

Q1( 186.20)

58(38.4)

19(12.3)

Q2(186.21-235.44)

32(21.2)

44(28.6)

0.24(0.12-0.47)

<0.001

0.16(0.08-0.35)

Q3(235.45-294.04)

26(17.2)

50(32.5)

0.17(0.08-0.34)

0.09(0.04-0.21)

Q4( 294.05)

35(23.2)

41(26.6)

0.28(0.14-0.55)

0.09(0.04-0.22)

Q1( 188.87)

56(37.1)

21(13.6)

Q2(188.88-239.87)

37(24.5)

39(25.3)

0.36(0.18-0.70)

<0.001

0.25(0.12-0.53)

Q3(239.88-309.56)

27(17.9)

49(31.8)

0.21(0.10-0.41)

0.10(0.04-0.22)

Q4( 309.57)

31(20.5)

45(29.2)

0.26(0.13-0.51)

0.09(0.04-0.21)

1 Crude. 2Models are adjusted for education, physical activity, education, parity, OCP use, occupation, and total energy intake. BrCa = Brest Cancer, mg = milligram, mcg = microgram, OCP = Oral contraceptive pill.

had less chance of developing BrCa in overall and all subtypes [24, 41]. However, some prospective cohort studies [22, 42] and some case-control studies [27, 43] did not find a significant inverse association of dietary folate intake with BrCa. In a cohort study, after 16.5 years, a significant inverse association was indicated between the folate intake and BrCa risk in the overall and all of the subtypes of ER, PR, and HER2 status. A borderline inverse association was observed between the dietary folate and BrCa risk but statistically, a significant association was found with ERand PR- status among the premenopausal women in EPIC study [44]. Although a significant inverse association was found in all subtypes of BrCa in our study, the levels of total and dietary folate intakes were much lower compared to quartiles of the folate intake in other countries; and this represents the possibility of not sufficient mean intake of Ó 2019 Hogrefe

folate among the Iranian women. Also, vitamins B2, B6, and B12 are essential cofactors for the enzymes involved in one-carbon metabolism. An error in this process can disrupt DNA replication, DNA repair and regulation of gene expression through a methylation that each disruption increases susceptibility to cancer. So intake of these vitamins is important in cancer prevention [45]. We observed a significant inverse association between dietary and total vitamin B12 intake and BrCa odds in overall and all subtypes except ER- status. In most studies, there was no significant difference between vitamin B12 intake and the risk of BrCa in overall or its subtypes [23, 41–43, 46]. Probably these results are due to inaccurate assessment of diet. Because in these studies diet was assessed 1 to 5 years before cancer diagnosis and this may lead to recall bias. Int J Vitam Nutr Res (2020), 90 (1–2), 131–140

Int J Vitam Nutr Res (2020), 90 (1–2), 131–140 19/50 25/41 <0.001

Q3(235.45-294.04)

Q4( 294.05)

<0.001

0.072

0.002 44/19 19/44

2/43

Q4( 5.11)

Q1( 186.20) Q2(186.21-235.44)

24/41

Q3(3.98-5.10)

0.001

<0.001 35/27 26/43

21/43

Q4( 1.65)

Q1( 2.86) Q2(2.87-3.97)

23/45

Q3(1.33-1.64)

0.006

<0.001 42/21 21/45

Q4( 1.95)

Q1( 1.11) Q2(1.12-1.32)

23/47 19/43

Q3(1.61-1.94)

38/25 27/39

Q1( 1.25) Q2(1.26-1.60)

<0.001

0.09(0.04-0.24)

0.11(0.05-0.26)

1 0.13(0.05-0.30)

<0.001

0.29(0.13-0.66)

0.38(0.17-0.84)

1 0.50(0.23-1.07)

<0.001

0.06(0.02-0.18)

0.15(0.06-0.35)

1 0.22(0.10-0.49)

<0.001

0.10(0.04-0.27)

0.22(0.10-0.49)

1 0.39(0.18-0.85)

ER + OR(95%CI)

<0.001

7/41

4/50

8/19 12/44

0.011

6/43

10/41

10/27 5/43

<0.001

6/43

7/45

10/21 8/45

<0.001

9/43

4/47

10/25 8/39

No. of cases/ controls

0.07(0.02-0.34)

0.05(0.01-0.28)

1 0.36(0.11-1.19)

0.28(0.08-0.97)

0.55(0.18-1.71)

1 0.43(0.12-1.55)

0.07(0.01-0.35)

0.13(0.03-0.55)

1 0.30(0.08-1.07)

0.18(0.05-0.75)

0.15(0.04-0.61)

1 0.52(0.16-1.70)

EROR(95%CI)

21/41

15/50

39/19 16/44

17/43

22/41

29/27 23/43

18/43

20/45

38/21 15/45

15/43

20/47

31/25 25/39

No. of cases/ controls

0.09(0.03-0.24)

0.10(0.04-0.24)

1 0.12(0.05-0.30)

0.32(0.14-0.76)

0.48(0.21-1.07)

1 0.58(0.26-1.28)

0.06(0.02-0.18)

0.14(0.06-0.34)

1 0.16(0.07-0.39)

0.12(0.04-0.33)

0.25(0.11-0.58)

1 0.46(0.21-1.02)

PR + OR(95%CI)

11/41

8/50

13/19 14/44

11/43

11/41

16/27 8/43

9/43

10/45

14/21 13/45

13/43

6/47

17/25 10/39

No. of cases/ controls

0.09(0.03-0.32)

0.09(0.03-0.31)

1 0.28(0.10-0.79)

0.24(0.08-0.70)

0.33(0.12-0.91)

1 0.34(0.12-0.99)

0.07(0.02-0.28)

0.15(0.05-0.49)

1 0.40(0.15-1.10)

0.11(0.03-0.39)

0.10(0.03-0.34)

1 0.33(0.12-0.90)

PROR(95%CI)

Models are adjusted for education, physical activity, education, parity, OCP use, occupation, and total energy intake. ER = Estrogen receptor, PR = Progesterone receptor, OCP = Oral contraceptive pill.

P-trend

Folate(μg/day)

P-trend

Vitamin B12 (μg/day)

P-trend

Vitamin B6 (mg/day)

P-trend

Vitamin B2 (mg/day)

No. of cases/ controls

Quartiles of intake

Table 3. Dietary intake of vitamin B2, B6, B12, folate and BrCa risk stratified by estrogens receptor (ER)/progesterone receptor (PR) status among Iranian women.

136 M. Hatami et al., Vitamins Involved in One-Carbon Metabolism and Breast Cancer

Ó 2019 Hogrefe

M. Hatami et al., Vitamins Involved in One-Carbon Metabolism and Breast Cancer

137

Table 4. Dietary intake of vitamin B2, B6, B12, folate and BrCa risk stratified by HER-2 status.

Vitamin B2 (mg/day)

P-trend Vitamin B6 (mg/day)

P-trend Vitamin B12 (μg/day)

P-trend Folate (μg/day)

P-trend

Quartiles of intake

No. of cases/controls

HER2+

No. of cases/controls

HER2-

Q1( 1.25)

28/25

20/25

Q2(1.26-1.60)

9/39

0.21(0.08-0.55)

26/39

0.76(0.31-1.83)

Q3(1.61-1.94)

14/47

0.17(0.07-0.43)

13/47

0.21(0.08-0.58)

Q4( 1.95)

11/43

0.07(0.02-0.22)

15/43

0.13(0.04-0.42)

Q1( 1.11)

25/21

27/21

Q2(1.12-1.32)

13/45

0.21(0.09-0.54)

16/45

0.29(0.12-0.72)

Q3(1.33-1.64)

10/45

0.08(0.03-0.24)

19/45

0.22(0.08-0.59)

Q4( 1.65)

14/43

0.07(0.02-0.22)

12/43

0.05(0.01-0.20)

<0.001

Q1( 2.86)

25/27

20/27

Q2(2.87-3.97)

15/43

0.49(0.02-1.15)

16/43

0.51(0.20-1.29)

Q3(3.98-5.10)

11/41

0.27(0.11-0.69)

22/41

0.59(0.24-1.46)

Q4( 5.11)

11/43

0.20(0.08-0.52)

16/43

0.31(0.12-0.82)

<0.001 Q1( 186.20)

24/19

28/19

Q2(186.21-235.44)

14/44

0.14(0.05-0.36)

16/44

0.17(0.07-0.45)

Q3(235.45-294.04)

9/50

0.06(0.02-0.17)

15/50

0.13(0.05-0.34)

Q4( 294.05)

15/41

0.07(0.02-0.22)

15/41

0.08(0.03-0.25)

<0.001

Models are adjusted for education, physical activity, education, parity, OCP use, occupation, and total energy intake. BrCa = Brest Cancer, HER2 = human epidermal growth factor receptor 2, OCP = Oral contraceptive pill. The scoring method for HER2 expression on IHC is based on the cell membrane staining pattern and is as follows: 3+: Positive HER2 expression - Uniform intense membrane staining of more than 30% of invasive tumor cells. 2+: Equivocal for HER2 protein expression - Complete membrane staining that is either nonuniform or weak in intensity but has circumferential distribution in at least 10% of cells. 0 or 1+: Negative for HER2 protein expression.

On the other hand, in line with our results, in some studies, high vitamin B12 intake was associated with the decreased risk of developing BrCa in overall and ER- subtypes [24, 47]. In return and surprisingly, in Melbourne cohort study that investigated the association between vitamins and BrCa risk, the individuals in the highest quartile of vitamin B12 intake were more disposed to catching cancer compared with the lowest quartile [22]. It may be due to the fact that the information on diet and potential confounding variables was only collected at baseline and might not be relevant to the full-time period. Among the vitamins involved in one-carbon metabolism, vitamin B6 is an essential coenzyme in the conversion of tetrahydrofolate to 5, 10 methylene tetrahydrofolate in the synthesis of nucleotides, repair, and methylation [25]. So an inadequate intake of this vitamin leads to an imbalance in the DNA precursors [48]. In addition to the important role of vitamin B6 in one-carbon metabolism, this vitamin is also necessary for the synthesis of glutathione from homocysteine via cystathionine and cysteine. Glutathione is a cofactor of glutathione S-transferases and glutathione peroxidase which is crucial in the removal and detoxification of carcinogens [49, 50]. By the way, some studies have not found a significant association between vitamin B6 intake and BrCa risk [24, 42, 51]. Ó 2019 Hogrefe

On the other hand, in agreement with our results, higher vitamin B6 intake was found to be inversely associated with BrCa[21, 41]. In addition, a daily intake of more than 700 μg of vitamin B6 compared with a daily intake of less than 580 μg was associated with the lower development of BrCa in overall and ER- status [52]. Riboflavin is the precursor of flavin adenine dinucleotide, a cofactor of methylenetetrahydrofolate reductase enzyme and methionine synthase reductase enzyme in one-carbon metabolism [53,43]. Some prospective studies have found inverse association between riboflavin intake and BrCa risk in overall [21, 22] and with ER+, ER-, HER2+, and HER2- subtypes [21]. This study is the first study to examine the association between nutrients and receptor status of BrCa in Iran. Using a validated and reliable food frequency questionnaire by the trained interviewers and considering nutrients intake from dietary supplement are the strengths of this study. Also, as a maximum of three months had passed since the diagnosis of the disease; changes in eating habits, and recall bias among the patients are negligible. Removing the patients with BrCa who had cyst or cancer previously is another strengths of this study. However, the present study has some limitations. The measurement error is one of the errors in collecting data Int J Vitam Nutr Res (2020), 90 (1–2), 131–140

138

M. Hatami et al., Vitamins Involved in One-Carbon Metabolism and Breast Cancer

on dietary intake and physical activity, which may weaken the real associations. As mentioned before, to minimize the recall bias, we selected the cases with a maximum three months to be passed since the diagnosis. Also, using a valid and reliable FFQ in hospital setting minimizes the recall and selection bias. Matching on age (±10 years) was another limitation. To conclude, our study supports the hypothesis that high dietary intake of vitamins involved in one-carbon metabolism can reduce BrCa odds in overall and its subtypes.

References 1. Khazaee-Pool, M., Montazeri, A., Majlessi, F., Rahimi Foroushani, A., Nedjat, S., & Shojaeizadeh, D. (2014) Breast cancer-preventive behaviors: exploring Iranian women’s experiences. BMC women’s health. 14, 41. 2. Almasi, Z., Mohammadian-Hafshejani, A., & Salehiniya, H. (2016) Incidence, mortality, and epidemiological aspects of cancers in Iran; differences with the world data. J BUON. 21, 994–1004. 3. Almendro, V., & Fuster, G. (2011) Heterogeneity of breast cancer: etiology and clinical relevance. Clin Transl Oncol. 13, 767–773. 4. Hiatt, R.A., Haslam, S.Z, & Osuch, J. (2009) The breast cancer and the environment research centers: transdisciplinary research on the role of the environment in breast cancer etiology. Environ Health Perspect. 117, 1814–1822. 5. Coussens, L.M., & Werb, Z. (2002) Inflammation and cancer. Nature. 420, 860–867. 6. Duncan, B.B., Schmidt, M.I., Pankow, J.S., Ballantyne, C.M., Couper, D., Vigo, A., Hoogeveen, R., Folsom, A.R., & Heiss, G. (2003) Low-grade systemic inflammation and the development of type 2 diabetes: the atherosclerosis risk in communities study. Diabetes. 52, 1799–1805. 7. Vahid, F., Shivappa, N., Karamati, M., Jafari-Naeini, A., Hebert, J.R., & Davoodi, S.H. (2016) Association between dietary inflammatory index (DII) and risk of pre-diabetes: a casecontrol study. Appl Physiol Nutr Metab. 42, 399–404. 8. Vahid, F, Shivappa, N., Hekmatdoost, A., Hebert, J.R., Davoodi, S.H., & Sadeghi, M. (2017) Association between maternal dietary inflammatory index (DII) and abortion in Iranian women and validation of DII with serum concentration of inflammatory factors: case-control study. Appl Physiol Nutr Metab. 42, 511–516. 9. Nicolini, A., Carpi, A., & Rossi, G. (2006) Cytokines in breast cancer. Cytokine Growth Factor Rev. 17, 325–337. 10. Porta, C., Larghi, P., Rimoldi, M., Totaro, M.G., Allavena, P., Mantovani, A., & Sica, A. (2009) Cellular and molecular pathways linking inflammation and cancer. Immunobiology. 214, 761–777. 11. Shaukat, U., Ismail, M., & Mehmood, N. (2013) Epidemiology, major risk factors and genetic predisposition for breast cancer in the Pakistani population. APJCP. 14, 5625–5629. 12. Albuquerque, R.C., Baltar, V.T., & Marchioni, D.M. (2014) Breast cancer and dietary patterns: a systematic review. Nutr Rev. 72, 1–17. 13. Parsa, Y., Mirmalek, S.A., Kani, F.E., Aidun, A., SalimiTabatabaee, S.A., Yadollah-Damavandi, S., Jangholi, E., Parsa, T., & Shahverdi, E. (2016) A review of the clinical implications of breast cancer biology. Electron Physician. 25, 2416–24.

Int J Vitam Nutr Res (2020), 90 (1–2), 131–140

14. Vera-Ramirez, L., Ramirez-Tortosa, M.C., Sanchez-Rovira, P., Ramirez-Tortosa, C.L., Granados-Principal, S., Lorente, J.A., & Quiles, J.L. (2013) Impact of diet on breast cancer risk: a review of experimental and observational studies. Crit Rev Food Sci Nutr. 53, 49–75. 15. Levi, F., Pasche, C., Lucchini, F., & La Vecchia, C., (2001) Dietary intake of selected micronutrients and breast-cancer risk. Int J Cancer. 91, 260–263. 16. Negri, E., La Vecchia, C., Franceschi, S., D’ Avanzo, B., Talamini, R., Parpinel, M., Ferraroni, M., Filiberti, R., Montella, M., Falcini, F., Conti, E., & Decarli, A. (1996) Intake of selected micronutrients and the risk of breast cancer. Int J Cancer. 65, 140–144. 17. Brennan, S.F., Cantwell, M.M., Cardwell, C.R., Velentzis, L.S., & Woodside, J.V. (2010) Dietary patterns and breast cancer risk: a systematic review and meta-analysis. Am J Clin Nutr. 91, 1294–1302. 18. Moskal, A., Pisa, P.T., Ferrari, P., Byrnes, G., Freisling, H., Boutron-Ruault, M.C., Cadeau, C., Nailler, L., Wendt, A., Kuhn, T., Boeing, H., Buijsse, B., Tjonneland, A., Halkjaer, J., Dahm, C.C., Chiuve, S.E., Quiros, J.R., Buckland, G., Molina-Montes, E., Amiano, P., Huerta-Castano, J.M., Gurrea, A.B., Khaw, K.T., Lentjes, M.A., Key, T.J., Romaguera, D., Vergnaud, A.C., Trichopoulou, A., Bamia, C., Orfanos, P., Palli, D., Pala, V., Tumino, R., Sacerdote, C., de Magistris, M.S., Bueno-deMesquita, H.B., Ocke, M.C., Beulens, J.W., Ericson, U., Drake, I., Nilsson, L.M., Winkvist, A., Weiderpass, E., Hjartaker, A., Riboli, E., & Slimani, N. (2014) Nutrient patterns and their food sources in an international study setting: report from the EPIC study. PloS one. 9, e98647. 19. Vahid, F., Zand, H., Nosrat-Mirshekarlou, E., Najafi, R., & Hekmatdoost, A. (2015) The role dietary of bioactive compounds on the regulation of histone acetylases and deacetylases: a review. Gene. 562, 8–15. 20. Xu, X., & Chen, J. (2009) One-carbon metabolism and breast cancer: an epidemiological perspective. J Genet Genomics. 36, 203–214. 21. Cancarini, I., Krogh, V., Agnoli, C., Grioni, S., Matullo, G., Pala, V., Pedraglio, S., Contiero, P., Riva, C., Muti, P., & Sieri, S. (2015) Micronutrients involved in one-carbon metabolism and risk of breast cancer subtypes. PloS one. 10, e0138318. 22. Bassett, J.K., Baglietto, L., Hodge, A.M., Severi, G., Hopper, J. L., English, D.R., & Giles, G.G. (2013) Dietary intake of B vitamins and methionine and breast cancer risk. Cancer Causes Control. 24, 1555–1563. 23. Cho, E., Holmes, M., Hankinson, S.E., & Willett, W.C. (2007) Nutrients involved in one-carbon metabolism and risk of breast cancer among premenopausal women. Cancer epidemiology, biomarkers & prevention: a publication of the American association for cancer research, cosponsored by the American society of preventive oncology. Plos one. 16, 2787–2790. 24. Lajous, M., Lazcano-Ponce, E., Hernandez-Avila, M., Willett, W., & Romieu, I. (2006) Folate, vitamin B(6), and vitamin B(12) intake and the risk of breast cancer among Mexican women. Cancer epidemiology, biomarkers & prevention: a publication of the American association for cancer research, cosponsored by the American society of preventive oncology. Plos one. 15, 443–448. 25. Hekmatdoost, A., Vahid, F., Yari, Z., Sadeghi, M., Eini-Zinab, H., Lakpour, N., & Arefi, S. (2015) Methyltetrahydrofolate vs folic acid supplementation in idiopathic recurrent miscarriage with respect to methylenetetrahydrofolate reductase C677T and A1298C polymorphisms: a randomized controlled trial. PloS one. 10, e0143569.

Ó 2019 Hogrefe

M. Hatami et al., Vitamins Involved in One-Carbon Metabolism and Breast Cancer

26. Mayer-Davis, E.J., Vitolins, M.Z., Carmichael, S.L., Hemphill, S., Tsaroucha, G., Rushing, J., & Levin, S. (1999) Validity and reproducibility of a food frequency interview in a multicultural epidemiology study. Ann Epidemiol. 9, 314–324. 27. Yang, T.L., Hung, J., Caudill, M.A., Urrutia, T.F., Alamilla, A., Perry, C.A., Li, R., Hata, H., & Cogger, E.A (2005) A long-term controlled folate feeding study in young women supports the validity of the 1.7 multiplier in the dietary folate equivalency equation. J Nutr. 135, 1139–1145. 28. Aadahl, M., & Jorgensen, T. (2003) Validation of a new selfreport instrument for measuring physical activity. Med Sci Sports Exerc. 35, 1196–1202. 29. Otani, T., Iwasaki, M., Hanaoka, T., Kobayashi, M., Ishihara, J., Natsukawa, S., Shaura, K., Koizumi, Y., Kasuga, Y., Yoshimura, K., Yoshida, T., & Tsugane, S. (2005) Folate, vitamin B6, vitamin B12, and vitamin B2 intake, genetic polymorphisms of related enzymes, and risk of colorectal cancer in a hospitalbased case-control study in Japan. Nutr Cancer. 53, 42–50. 30. Lewis, S.J., Harbord, R.M., Harris, R., & Smith, G.D. (2006) Meta-analyses of observational and genetic association studies of folate intakes or levels and breast cancer risk. J Natl Cancer Inst. 98, 1607–1622. 31. Baglietto, L., English, D.R., Gertig, D.M., Hopper, J.L., & Giles, G.G. (2005) Does dietary folate intake modify effect of alcohol consumption on breast cancer risk, prospective cohort study. BMJ. 331, 807. 32. Duffy, C.M., Assaf, A., Cyr, M., Burkholder, G., Coccio, E., Rohan, T., McTiernan, A., Paskett, E., Lane, D., & Chetty, V.K. (2009) Alcohol and folate intake and breast cancer risk in the WHI observational study. Breast Cancer Res Treat. 116, 551–562. 33. Ericson, U., Sonestedt, E., Gullberg, B., Olsson, H., & Wirfalt, E. (2007) High folate intake is associated with lower breast cancer incidence in postmenopausal women in the Malmo diet and cancer cohort. Am J Clin Nutr. 86, 434–443. 34. Ericson, U., Sonestedt, E., Ivarsson, M.I., Gullberg, B., Carlson, J., Olsson, H., & Wirfalt, E. (2009) Folate intake, methylenetetrahydrofolate reductase polymorphisms, and breast cancer risk in women from the Malmo diet and cancer cohort. Cancer epidemiology, biomarkers & prevention: a publication of the American association for cancer research, cosponsored by the American society of preventive oncology. Plos one. 18, 1101–1110. 35. Chen, P., Li, C., Li, X., Li, J., Chu, R., & Wang, H. (2014) Higher dietary folate intake reduces the breast cancer risk: a systematic review and meta-analysis. Br J Cancer. 110, 2327–2338. 36. Cho, E., Spiegelman, D., Hunter, D.J., Chen, W.Y., Zhang, S.M., Colditz, G.A., & Willett, W.C. (2003) Premenopausal intakes of vitamins A, C, and E, folate, and carotenoids, and risk of breast cancer. Cancer epidemiology, biomarkers & prevention: a publication of the American association for cancer research, cosponsored by the American society of preventive oncology. Plos one. 12, 713–720. 37. Gao, C.M., Kazuo, T., Tang, J.H., Cao, H.X., Ding, J.H., Wu, J.Z., Wang, J., Liu, Y.T., Li, S.P., Su, P., Keitaro, M., & Toshiro, T. (2009) MTHFR polymorphisms, dietary folate intake and risks to breast cancer. Zhonghua yu fang yi xue za zhi. [Chinese journal of preventive medicine] 43, 576–580. 38. Harris, H.R., Bergkvist, L., & Wolk, A. (2012) Folate intake and breast cancer mortality in a cohort of Swedish women. Breast Cancer Res Treat. 132, 243–250. 39. Zhang, Y.F., Shi, W.W., Gao, H.F., Zhou, L., Hou, A.J., & Zhou, Y. H. (2014) Folate intake and the risk of breast cancer: a doseresponse meta-analysis of prospective studies. PloS one. 9, e100044.

Ó 2019 Hogrefe

139

40. Willers, J., Heinemann, M., Bitterlich, N., & Hahn, A. (2014) Vitamin intake from food supplements in a German cohort - Is there a risk of excessive intake? Int J Vitam Nutr Res. 84, 152–162. 41. Zhang, C.X., Ho, S.C., Chen, Y.M., Lin, F.Y., Fu, J.H., & Cheng, S.Z. (2011) Dietary folate, vitamin B6, vitamin B12 and methionine intake and the risk of breast cancer by oestrogen and progesterone receptor status. Br J Nutr. 106, 936–943. 42. Shrubsole, M.J., Shu, X.O., Li, H.L., Cai, H., Yang, G., Gao, Y.T., Gao, J., & Zheng, W. (2011) Dietary B vitamin and methionine intakes and breast cancer risk among Chinese women. Am J Epidemiol. 173, 1171–1182. 43. Ma, E., Iwasaki, M., Kobayashi, M., Kasuga, Y., Yokoyama, S., Onuma, H., Nishimura, H., Kusama, R., & Tsugane, S. (2009) Dietary intake of folate, vitamin B2, vitamin B6, vitamin B12, genetic polymorphism of related enzymes, and risk of breast cancer: a case-control study in Japan. Nutr Cancer. 61, 447–456. 44. de-Batlle, J., Ferrari, P., Chajes, V., Park, J.Y., Slimani, N., McKenzie, F., Overvad, K., Roswall, N., Tjonneland, A., Boutron-Ruault, M.C., Clavel-Chapelon, F., Fagherazzi, G., Katzke, V., Kaaks, R., Bergmann, M.M., Trichopoulou, A., Lagiou, P., Trichopoulos, D., Palli, D., Sieri, S., Panico, S., Tumino, R., Vineis, P., Bueno-de-Mesquita, HB., Peeters, P.H., Hjartaker, A., Engeset, D., Weiderpass, E., Sanchez, S., Travier, N., Sanchez, M.J., Amiano, P., Chirlaque, M.D., Barricarte Gurrea, A., Khaw, K.T., Key, T.J., Bradbury, K.E., Ericson, U., Sonestedt, E., Van Guelpen, B., Schneede, J., Riboli, E., & Romieu, I. (2015) Dietary folate intake and breast cancer risk: European prospective investigation into cancer and nutrition. J Natl Cancer Inst. 107, 367. 45. Visekruna, I., Rumbak, I., Samarin, I.R., Keser, I., & Ranilovic, J. (2015) Homocysteine levels show significant differences among Mediterranean dietary quality index variables compared to folate and vitamin B(12) status in women. Int J Vitam Nutr Res. 85, 202–210. 46. Wu, W., Kang, S., & Zhang, D. (2013) Association of vitamin B6, vitamin B12 and methionine with risk of breast cancer: a dose-response meta-analysis. Br J Cancer. 109, 1926–1944. 47. Yang, D., Baumgartner, R.N., Slattery, M.L., Wang, C., Giuliano, A.R., Murtaugh, M.A., Risendal, B.C., Byers, T., & Baumgartner, K.B. (2013) Dietary intake of folate, B-vitamins and methionine and breast cancer risk among Hispanic and non-Hispanic white women. PloS one. 8, e54495. 48. Matsubara, K., Komatsu, S., Oka, T., & Kato, N. (2003) Vitamin B6-mediated suppression of colon tumorigenesis, cell proliferation, and angiogenesis (review). J Nutr Biochem. 14, 246–250. 49. Balendiran, G.K., Dabur, R., & Fraser, D. (2004) The role of glutathione in cancer. Cell Biochem Funct. 22, 343–352. 50. Elmadfa, I., & Meyer, A.L. (2012) Vitamins for the first 1000 days: preparing for life. Int J Vitam Nutr Res. 82, 342–347. 51. Ma, E., Iwasaki, M., Junko, I., Hamada, G.S., Nishimoto, I.N., Carvalho, S.M., Motola, J. Jr., Laginha, F.M., & Tsugane, S. (2009) Dietary intake of folate, vitamin B6, and vitamin B12, genetic polymorphism of related enzymes, and risk of breast cancer: a case-control study in Brazilian women. BMC cancer. 9, 122. 52. Chou, Y.C., Chu, C.H., Wu, M.H., Hsu, G.C., Yang, T., Chou, W.Y., Huang, H.P., Lee, M.S., Yu, C.P., Yu, J.C., & Sun, C.A. (2011) Dietary intake of vitamin B(6) and risk of breast cancer in Taiwanese women. Epidemiol. 21, 329–336.

Int J Vitam Nutr Res (2020), 90 (1–2), 131–140

140

M. Hatami et al., Vitamins Involved in One-Carbon Metabolism and Breast Cancer

53. Mason, J.B. (2003) Biomarkers of nutrient exposure and status in one-carbon (methyl) metabolism. J Nutr. 133, 941S–947. Acknowledgments This article has been extracted from a Master’s thesis results and funded by Cancer Research Center Shohada hospital in Tehran, Iran. Conflict of Interests The authors declare no conflict of interests.

Int J Vitam Nutr Res (2020), 90 (1–2), 131–140

Dr. Sayed Hossein Davoodi Department of Nutrition Research National Nutrition and Food Technology Research Institute Faculty of Nutrition Sciences and Food Technology Shahid Beheshti University of Medical Sciences No 7, West Arghavan St. Farahzadi Blvd Tehran Iran hdavoodi1345@gmail.com

Ó 2019 Hogrefe

Original Communication

Hydro-ethanolic extract of Curcuma longa affects tracheal responsiveness and lung pathology in ovalbuminsensitized rats Farzaneh Shakeri1, Nama Mohamadian Roshan2, and Mohammad Hossein Boskabady3,4 1

Natural Products and Medicinal Plants Research Center, North Khorasan University of Medical Sciences, Bojnurd, Iran

Department of Pathology, School of Medicine, Mashhad University of Medical Sciences, Mashhad, Iran

Neurogeneeic Inflammation Research Center, Mashhad University of Medical Sciences, Mashhad, Iran

Department of Physiology, School of Medicine, Mashhad University of Medical Sciences, Mashhad, Iran

Received: November 26, 2017; Accepted: July 7, 2018 Abstract: Anti-inflammatory effect of Curcuma longa (C. longa) was shown previously. In the present study, the effect of the plant on tracheal responsiveness and lung pathological features in ovalbumin-sensitized rats was evaluated. Six groups of rats including control (C), ovalbumin (OVA)-sensitized (S), S groups treated with C. longa (CL; 0.75, 1.50, and 3.00 mg/ml equal to 150, 300 and 600 mg/kg/day) and dexamethasone (D; 1.25 μg/ml) were studied (n=8 in each group). The extract of C. longa and dexamethasone were administered with daily drinking water of animals during sensitization period (for 21 days). Following the treatment period, tracheal responsiveness to methacholine and ovalbumin and lung pathological features was investigated. Tracheal responsiveness to methacholine and OVA and lung pathological scores were increased in group S compared to controls (p<0.01 to p<0.001); however, these parameters in groups treated with dexamethasone and two higher concentrations of C. longa were significantly decreased compared to group S (p<0.05 to p<0.001). Tracheal responsiveness to methacholine was decreased from 50 to 400% due to the extract treatment. All concentrations of C. longa significantly decreased interstitial fibrosis compared to group S (p<0.05 to p<0.001). Treatment with the extract resulted to improvement of pathological changes from 20 to 70%. These results showed a preventive effect for C. longa extract on tracheal responsiveness and lung pathological insults in sensitized rats which were similar or even more than those of dexamethasone at used concentrations. Keywords: Curcuma longa, Sensitized rats, Tracheal responsiveness, Lung inflammation, Ovalbumin

Introduction Curcuma longa (C. longa), or turmeric is a perennial herb belonging to Zingiberaceae (ginger) family, that has been used in Ayurvedic medicine for treatment of inflammatory diseases for a long time. Chemical compositions of C. longa include phenolic compounds (diarylheptanoids (curcuminoids), diarylpentanoids, phenylpropenes, vanillic acid and vanillin), terpenes (monoterpenes, sesquiterpenes, diterpenes and triterpenoids), fatty acids (linoleic acid, 8,11-Octadecadienoic acid, methyl ester, oleic acid and stearic acid), steroids (β-sitosterol, stigmasterol and gitoxigenin) and miscellaneous compounds [1]. This plant has been shown several pharmacological effects such as bronchodilatory [2] anti-asthmatic [3], antioxidant [4] and anti-inflammatory [5] activities. In a study, hydroalcoholic Ó 2019 Hogrefe

extract of a polyherbal formulation consisting of C. longa and Butea frondosa showed muscle relaxant effects [6]. Moreover, C. longa showed vasorelaxant effects on rats isolated superior mesenteric arteries [7]. There is evidence indicating that curcumin has anti-spasmodic effect on smooth muscle of dogs’ intestine in-vivo and guinea pigs’ vas-deferens in-vitro [8]. Asthma is a chronic inflammatory disorder of the airways involving several inflammatory cells which release inflammatory mediators such as reactive oxygen species (hydrogen peroxide, superoxide radical and hypohalites, etc.) [9]. Inflammatory mediators lead to pathological insults including thickening of the airway walls (sub epithelial basement membrane), infiltration of inflammatory cells, enhanced smooth muscle mass, hypertrophy of mucous gland, vascular congestion (leading to edema or Int J Vitam Nutr Res (2020), 90 (1–2), 141–150 https://doi.org/10.1024/0300-9831/a000524

142

M.H. Boskabady et al., Curcuma longa affects lung inflammation in sensitized rats

swelling of the airway wall), collagen deposition causing thickened airway wall, reduced airway diameter, airway epithelial shedding, and mucus plugs occluding medium and small bronchi, in the lung [10]. A relationship between the lung inflammation and the severity of airway hyper responsiveness in asthma has been reported [11]. In the present study, the effects of the hydro-ethanolic extract of C. longa on tracheal responsiveness to methacholine and OVA and lung pathological features in OVA-sensitized rats as a rat model of asthma were investigated.

Materials and Methods Animal sensitization Sensitization of rat was performed by three intraperitoneal (ip) administration of 1 mg/kg chicken egg albumin (Ovalbumin=OVA, grade V, 98% pure; Sigma, St. Louis, MO, USA) in 0.9% sterile saline containing 100 mg Al(OH)3 (Sigma, St. Louis, MO, USA) on days 1, 2 and 3 of the experiment. Following i.p. administration of OVA, animals were exposed to aerosolized 1% OVA on days 6, 9, 12, 15, 18 and 21, for 20 min/day, in a whole-body inhalation exposure chamber (30 20 20 cm). A solution of 1% OVA in normal saline was aerosolized using DeVilbiss PulmoSonic nebulizer (DeVilbiss Health Care Ltd., Feltham, U.K.), [12]. In this study, 48 male Wistar rats (200–250 g) were obtained and kept in Animal house, School of Medicine, Mashhad University of Medical Sciences, Mashhad, Iran. Water and food were available ad libitum during experimental period. Animals were kept at 22 ± 2°C with 12 hr/ 12 hr light/dark cycles. The study was carried out in six groups of rats (n= 8 in each group) as follow: 1) Control group (group C) which received normal saline (ip and inhalation) instead of OVA. 2) OVA-sensitized group (group S). 3–5) OVA-sensitized rats treated with the extract of C. longa 0.75, 1.5, 3 mg/ml (CL 0.75, CL 1.50, and CL 3.00, respectively), [13]. 6) OVA-sensitized rats treated with dexamethasone (1.25 μg/ml) (group D). The extract of C. longa and dexamethasone (Sigma, St. Louis, MO, USA) were added to animals’ drinking water during the sensitization period. The schematic timetable of the study stages was shown in the Figure 1. Each rat used 40 ml drinking water/day which did not significantly differ among different groups. Therefore the administered doses of the extract were 150, 300 and 600 mg/kg/day. Animal studies were performed in accordance with National Laws and National Institutes of Health guidelines for the use Int J Vitam Nutr Res (2020), 90 (1–2), 141–150

and care of laboratory animals and the study was approved by Ethics Committee of Mashhad University of Medical Sciences (Ethics allowance No. 921249).

Plant collection and extract preparation One hundred grams of C. longa rhizomes (purchased from a local herbal market in Mashhad, Khorasan Razavi province, Iran) was cleaned, grounded, weighed, and homogenized in 96% ethanol (Sigma, St. Louis, MO, USA) at a ratio of 1:10 (plant powder to ethanol) and left to soak for 3 days at 37°C with occasional shaking and stirring. The mixture was then filtered and the resulting liquid was concentrated under reduced pressure at 45°C in an Eyela (Heidolph, Schwabach, Germany) rotary evaporator to yield a gummy dark-yellow extract [14]. The yield of the extraction was 14%.

Qualitative and quantitative determination of curcumin in the extract The main bioactive compound of turmeric extract is curcumin. The content of curcumin in the prepared extract was determined qualitatively and quantitatively using RP-HPLC. Different concentrations (i.e. 2, 20 and 200 μg/ml) of standard curcumin (Golexir Pars company, Mashhad, Iran) was injected to HPLC apparatus (Knauer, Berlin, Germany) using a gradient eluent system (starting from 20% and increasing to 100% of methanol) and 0.05% trifluoroacetic acid (Sigma, St. Louis, MO, USA) as buffer. The standard curve of curcumin was provided using Microsoft Excel (version 2013). The extract (2 μg/ml) was then dissolved in methanol and subjected to HPLC system. The chromatograms of the extract and curcumin were recorded at 420 nm. The other conditions of HPLC analysis included: Flow rate 1 ml/min; Column type C18; Column size 250 4.6 mm; Particle size 5 μm. The content of curcumin in the ethanolic extract was determined to be 9.4%. No other impurities were observed in the extract at 420 nm (Figure 2).

Pathological evaluation Rats were sacriﬁced by ketamine (Sigma, St. Louis, MO, USA), (50 mg/kg, ip), [15] and lungs were removed and placed into buffered formalin 10% (Merck, Darmstadt, Germany). Seven days later, tissues were dried using Auto Technicon apparatus (Jinhua Hisure, Zhejiang, China), cleared by passage of tissues through ethanol 70–100% (Sigma, St. Louis, MO, USA) and xylol and parafﬁn blocks were prepared. The specimens were cut into 4-μm slices and stained with hematoxylin and eosin. The tissues were Ó 2019 Hogrefe

M.H. Boskabady et al., Curcuma longa affects lung inflammation in sensitized rats

143

Figure 1. The schematic timetable of the study stages.

fibrosis, bleeding, emphysema and epithelial damage. The pathological features were scored according to previous study [16] as follows: No pathologic changes 0; Patchy changes 1; and severe changes 2.

Tracheal tissue preparations For obtaining the trachea, rats were sacrificed on day 22 by ketamine. After opening the chest, trachea was removed and cut into 2 parts, each containing 5–6 cartilaginous rings. One part of the trachea was hung between two nichrome hooks inserted into the lumen, and placed in a 10-ml organ bath containing Krebs-Henseleit solution (KHS; NaCl 120, KCl 4.72, KH2PO4 1.2, MgSO4 7H2O 0.5, CaCl2 2H2O 2.5, NaHCO3 25 and dextrose 11 (all in mM). This solution was maintained at 37 ± 0.5°C and bubbled constantly with 5% CO2-95% O2. Tissue was suspended under isotonic tension of 1 g and allowed to equilibrate for at least 1 hr while being washed with KHS solution every 15 min. In all experiments, contraction responses were measured using an isometric transducer (MLT0202, AD Instruments, Australia) which was connected to a PowerLab system (Power Lab 8/30, ML870, AD Instruments, Australia).

Measurement of tracheal response to methacholine and ovalbumin

Figure 2. RP-HPLC of the extract of C. longa (a), curcumin (b) and chemical structure of curcumin (c).

then evaluated under a light microscope. The pathological insults that were studied in the lungs of sensitized and treated groups included: interstitial inflammation, interstitial Ó 2019 Hogrefe

In order to evaluate the speciﬁc and nonspeciﬁc tracheal responsiveness of the plant, responsiveness to methacholine and ovalbumin respectively was investigated on sensitized rats. For this purpose, a cumulative concentration (log)-response curve for methacholine hydrochlorideinduced contraction of tracheal smooth muscle was obtained in each experiment. Consecutive concentrations (from 10 8 to 10 3 M) were added every 2 min, and the contraction induced by each concentration was recorded at the Int J Vitam Nutr Res (2020), 90 (1–2), 141–150

144

M.H. Boskabady et al., Curcuma longa affects lung inflammation in sensitized rats

Figure 3. Cumulative concentration (log)response curves of methacholineinduced contraction of isolated trachea (a) and methacholine EC50 (b) in control animals (C), sensitized group (S), sensitized rats treated with dexamethasone (S+D) and sensitized rats treated with C. longa (S+CL), (n=8 in each group). Data are presented as mean ± SEM values. ***p<0.001 compared to group C. ++ +p<0.001 compared to group S. ### p<0.001 compared to group S+D. Statistical analyses were performed using ANOVA with Tukey-Kramer’s post-test. Abbreviations: EC50: Effective concentration of methacholine, causing 50% of maximum response.

end of each 2 min until the effect reached a plateau. The percentage of contraction of the tracheal smooth muscle induced by each concentration of methacholine in proportion to the maximum contraction obtained by its ﬁnal concentration was plotted against concentration (log) of methacholine. The concentration of methacholine causing 50% of maximum response (EC50) was measured using methacholine response curve. Tracheal response to 0.2% solution of OVA was measured as follows: 1 ml of 2% OVA solution was added to 10-ml organ bath and the degree of tracheal smooth muscle contraction was recorded after 15 min and expressed as contractile force gram [17].

Statistical analysis The results were presented as means ± SEM. Normal distribution and equality of variances of the results were checked by Kolmogorov–Smirnov test. The comparison among the results of treated groups, un-treated sensitized groups and control group as well as the comparison among the data obtained from three concentrations of extract, were compared using one way analysis of variance (ANOVA) with Tukey-Kramer’s post-test. Significance was considered at Int J Vitam Nutr Res (2020), 90 (1–2), 141–150

p<0.05. InStat (GraphPad Software, La Jolla, USA) was used for statistical analysis.

Results Tracheal responsiveness to methacholine in treated and untreated sensitized animals Concentration-response curves to methacholine showed a leftward shift in sensitized group compared to group C, but the curves plotted for groups treated with dexamethasone and all concentrations of the extract had a rightward shift compared to group S (Figure 3a). The values of EC50 in untreated group S and groups treated with the lowest concentration of extract were signiﬁcantly lower than group C (p<0.001 for both cases; Figure 3b). The values of EC50 in asthmatic rats treated with the two higher concentrations of extract and dexamethasone were signiﬁcantly improved compared to the group S (p<0.001 for all cases; Figure 3b). Maximum response to methacholine in group S and in animals treated with the lowest concentration of the extract Ó 2019 Hogrefe

M.H. Boskabady et al., Curcuma longa affects lung inflammation in sensitized rats

145

Figure 4. Maximum contractile response of methacholine (a) and tracheal contractile response to OVA (b) in control animals(C), sensitized group (S), sensitized rats treated with dexamethasone (S+D) and sensitized rats treated with C. longa (S+CL), (n=8 in each group). Data are presented as mean ± SEM values. ***p<0.001 compared to group C. +p<0.05, ++p<0.01, and +++p<0.001 compared to group S. ### p<0.001 compared to group D. Statistical analyses were performed using ANOVA with TukeyKramer’s post-test. Abbreviations: OVA: Ovalbumin.

was signiﬁcantly higher than group C (p<0.001 for both cases; Figure 4a). Treatment with the two higher concentrations of C. longa and dexamethasone led to signiﬁcant reduction in maximum response compared to group S (p<0.05 to p<0.001; Figure 4b).

Tracheal responsiveness to ovalbumin in treated and untreated sensitized animals Tracheal responsiveness to OVA in group S and in asthmatic rats treated with the lowest concentration of C. longa extract was signiﬁcantly higher than group C (p<0.001 for both cases; Figure 4b). In groups treated with dexamethasone and the two higher concentrations of the extract, tracheal responsiveness to OVA were signiﬁcantly decreased compared to group S (p<0.001 for all cases; Figure 4b).

Pathological studies of lungs from treated and untreated sensitized animals The scores of all pathological changes in group S were signiﬁcantly increased compared to the control group (p< 0.01 to p<0.001; Figures 5 and 6). Ó 2019 Hogrefe

Significant and concentration-dependent decreases in interstitial fibrosis were observed in groups treated with different concentrations of extract compared to group S (p<0.05 to p<0.001; Figure 5a). The two higher concentrations of the extract also significantly reduced the scores of pathological insults including interstitial inflammation, bleeding, emphysema and epithelial damage, compared to untreated group S (p<0.05 to p<0.001; Figures 5 and 6). Only interstitial inflammation score following treatment with the lowest concentration of extract signiﬁcantly increased compared to the control group (p<0.05; Figure 4a). Dexamethasone treatment also signiﬁcantly improved interstitial inflammation, interstitial fibrosis, bleeding, and emphysema scores in asthmatic animals (p<0.05 to p<0.001; Figures 5 and 6). Figure 7 shows a specimen of lung photograph of each studied group.

Comparison of the effects of three concentrations of C. longa extract as well as the effects of C. longa and dexamethasone The effects the two (1.50 and 3.00 mg/ml) on methacholine and OVA response EC50 and the highest concentration on Int J Vitam Nutr Res (2020), 90 (1–2), 141–150

146

M.H. Boskabady et al., Curcuma longa affects lung inflammation in sensitized rats

Figure 5. Interstitial inﬂammation (a) and interstitial fibrosis (b) scores in control animals (C), sensitized group (S), sensitized rats treated with dexamethasone (S+D) and sensitized rats treated with C. longa (S+CL), (n=8 in each group). Data are presented as mean ± SEM values. *p<0.05, **p<0.01, and ***p<0.001 compared to group C. +p<0.05, ++p<0.01, and +++p<0.001 compared to group A. Statistical analyses were performed using ANOVA with Tukey-Kramer’s post-test.

maximum response, were significantly higher than the lowest concentration (0.75 mg/ml), (p<0.05 for maximum response and p<0.001 for other cases; Table I). The effect of the highest concentration of extract (3.00 mg/ml) on interstitial inflammation was significantly higher than its lowest concentration (p<0.05; Table I). The effect of the lowest concentration of the extract on EC50 and maximum response to methacholine and OVA response was significantly lower than the effect of dexamethasone (p<0.001 for all cases; Figures 3 and 4). No signiﬁcant difference was seen between dexamethasone-treated group and groups treated with extract in terms of pathological scores.

Discussion C. longa is used in traditional medicine for treatment of various diseases and it has exhibited anti-inflammatory, antioxidant, anti-asthmatic and anticancer effects. Curcumin (diferuloylmethane), is a bioactive component derived from the rhizomes of C. longa. Curcumin has poor absorption, biodistribution and metabolism. Several formulations include nanoparticles, liposomes, micelles, and phospholipid complexes have been prepared to Int J Vitam Nutr Res (2020), 90 (1–2), 141–150

enhance the bioavailability, longer circulation, better permeability, and resistance to metabolic processes of curcumin. Most of curcumin metabolized in liver and intestine however, a small quantity is still remains detectable in the body organs [18]. In this study, we investigated the effect of C. longa on lung pathological features and tracheal responsiveness to methacholine (left shifting of cumulative concentrationresponse curves of methacholine), significant reductions in EC50 of methacholine and maximum response to methacholine and OVA, in sensitized rats. The findings of the present study showed increased tracheal responsiveness to methacholine and OVA which conﬁrm sensitization of animals. In fact, the results of this study were very similar to the previous studies using a similar method of sensitization [17, 19]. Although, Tiberio and his colleagues [20] and some others used only inhaled OVA to induce sensitization, but others studies used both injected and inhaled OVA to ensure the occurrence of sensitization in animals [17, 19, 21]. Dexamethasone and all concentrations of extract showed protective effect on enhanced tracheal responsiveness to methacholine and OVA in sensitized rats. The main pathological feature of asthmatic patients is airway inflammation and responsiveness. The preventive effect of the extract of C. longa on tracheal responsiveness Ó 2019 Hogrefe

M.H. Boskabady et al., Curcuma longa affects lung inflammation in sensitized rats

147

Figure 6. Bleeding (a) emphysema (b) and epithelial damage (c) scores in control animals (C), sensitized group (S), sensitized rats treated with dexamethasone (S+D) and sensitized rats treated with C. longa (S+CL), (n=8 in each group). Data are presented as mean ± SEM values. **p<0.01, and ***p<0.001 compared to group C. +p<0.05, and ++p<0.01 compared to group S. Statistical analyses were performed using ANOVA with Tukey-Kramer’s post-test.

(which is mainly induced by airway inflammation) in sensitized animals is perhaps due to its therapeutic effect on airway inflammation. In fact, anti-inflammatory and bronchodilatory effects of this plant were previously shown which support the results of the current study. Aaldini and his colleagues showed that C. longa has a myorelaxant effect on mouse ileum and colon in a mouse model of colitis [22]. Moreover, anti-asthmatic effect of curcumin in a guinea pig model of airway hyper responsiveness was shown previously [23]. In another study, Ram et al. showed development of certain characteristics of asthma including allergen-induced airway constriction and airway hyper-reactivity to histamine in OVA-sensitized animals. Ó 2019 Hogrefe

Curcumin treatment (20 mg/kg body weight, orally) significantly inhibited OVA-induced airway constriction and airway hyper-reactivity. Another study demonstrated that curcumin could inhibit the development of mastocytosis and intestinal anaphylaxis in OVA-challenged allergic mice [24]. Intranasal curcumin (5.0 mg/kg) was effectively absorbed and detected both in plasma and lungs and suppressed airway inflammations and bronchoconstriction in a mouse model of asthma [25]. The results of the above-described studies demonstrate that C. longa and its constituent, curcumin are effective in improving the impaired airways in OVA-sensitized animals, which confirms the findings of the present study. Int J Vitam Nutr Res (2020), 90 (1–2), 141–150

148

M.H. Boskabady et al., Curcuma longa affects lung inflammation in sensitized rats

Figure 7. Lung pathological studies using a light microscope at X40 magnification, in control (C), sensitized (S) with interstitial inﬂammation (II), interstitial fibrosis (IF), bleeding (B), emphysema (E) and epithelial damage (ED), and sensitized rats treated with dexamethasone (S+D) and three concentration of C. longa (S+CL).

Table I. Comparisons of methacholine EC50, maximum response to methacholine, OVA responsiveness and lung pathological insults in sensitized animal (S) treated with three concentrations of the extract of C. longa (CL, 0.75 mg/ml, 1.50 mg/ml and 3.00 mg/ml) Parameters

S+CL 0.75

S+CL 1.50

S+CL 3.00

EC50 (μM)

0.06±0.01

0.41±0.04+++

0.45±0.03+++

Max Response (g)

1.07±0.09

0.92±0.07

0.79±0.03+

OVA Response (g)

0.59±0.07

0.29±0.02+++

0.26±0.04+++

Interstitial inﬂammation score

1.75±0.25

1.00±0.40

0.75±0.25+

Interstitial fibrosis score

0.75±0.25

0.50±0.29

0.00±0.00

Bleeding score

0.50±0.29

0.25±0.25

0.00±0.00

Emphysema score

1.00±0.40

0.50±0.29

0.25±0.25

Epithelial damage score

0.50±0.29

0.25±0.25

Data were presented as mean±SEM. +P<0.05, ++p<0.01, and +++p<0.001 compared to CL 0.75. Statistical analyses were performed using ANOVA with Tukey-Kramer’s post-test. Abbreviations: EC50: Effective concentration of methacholine, causing 50% of maximum response; OVA: Ovalbumin; CL: C. longa. g: gram.

The present study showed increased pathological insults including interstitial inflammation, interstitial fibrosis, bleeding, emphysema and epithelial damage, in lung tissues of sensitized animals. The pathological features observed in sensitized rats in this study were similar to those reported by some previous studies [16, 26] all confirming the sensitization of animals in the present study. Treatment of sensitized rats with the extract and dexamethasone led to improvement of almost all lung histological Int J Vitam Nutr Res (2020), 90 (1–2), 141–150

insults. It was shown that treatment with herbal capsules containing C. longa, Zingiber officinale and Alpinia galanga extracts improved histological features such as congestion, emphysema and mononuclear cells infiltration in a rat model of OVA-induced airway inflammation [2], which confirms the results of the present study. Therapeutic effect of curcumin against lung inflammation and pathological damages in acute lung injury was also demonstrated [27, 28]. Curcumin has been also reported to ameliorate Ó 2019 Hogrefe

M.H. Boskabady et al., Curcuma longa affects lung inflammation in sensitized rats

acute respiratory distress syndrome in female rats by alteration of inflammation and myofibroblast differentiation [29]. Another study showed that methanolic extract of C. longa decreased peri-bronchial inflammation, congestion in the alveoli and intra-luminal hemorrhage in the bronchus in OVA-sensitized rats [3], which supports the preventive effect of this plant on lung inflammation in asthma observed in the present study. The effects of curcumin on asthma-induced proliferation of airway smooth muscle cells (ASMCs), were studied in vitro and in vivo. The thickness of the airway wall, the airway smooth muscle layer, the number of ASMCs and the expression of extracellular signal-regulated kinase (ERK) were significantly reduced in the curcumin-treated group as compared to the control group. Platelet-derived growth factor (PDGF) which causes cell proliferation was also inhibited by curcumin. Moreover, PDGF-induced phosphorylation of ERK was reduced in rats. Curcumin also upregulated protein expression of caveolin-1 and mRNA [30]. In our previous studies, the anti-inflammatory effect of C. longa extract and its constituent curcumin in animal models of asthma was observed [12, 31]. Since the effect of the extract was concentrationdependent, we may suggest the anti-inflammatory effect of the plant. The results of the present study showed a concentration-dependent preventive effect for the extract on tracheal responsiveness and lung pathological features. The effects of the two higher concentrations of the extract on EC50 methacholine and OVA response and the effect of the highest concentration of the extract on maximum response to methacholine and interstitial inﬂammation were significantly more pronounced than those of the lowest concentration of the extract. The effect of the extract of C. longa on lung pathological features and tracheal responsiveness in sensitized rats were comparable or even more marked as compared to the effect of dexamethasone (especially on tracheal responsiveness). These finding also suggest the therapeutic potential of the plant on asthma. In this study, the effects of C. longa on tracheal responsiveness to methacholine and OVA as well as lung pathological insults were investigated in OVA-sensitized rats as an animal model of asthma for the first time. However, more studies are required to examine the effect of the plant on other aspects of asthma such as inflammatory cells, mediators and markers of inflammation (i.e. biochemical endpoints). Another limitation of this study was inaccessibility to the bioavailability of curcumin which may have been suboptimal from drinking water. The effects of different constituents of C. longa such as turmerone, germacrone, atlantone, and zingiberene in sensitized animals should be also examined in further studies. The effect of the plant and

Ó 2019 Hogrefe

149

its constituents on asthmatic patients should be also examined in clinical studies. These results together with the results of other studies indicate the preventive effect of the plant on lung pathological damages and tracheal responsiveness. These results suggest a preventive therapeutic effect of C. longa on asthma by reducing lung pathological insults and tracheal responsiveness, as two main characteristics of asthma which are induced by lung inflammation. However, further studies are needed to evaluate the effect of the plant in asthmatic patients.

Conclusion In conclusion, the ﬁndings of this study showed improvement in lung pathological features and tracheal responsiveness in OVA-sensitized rats treated with the extract of C. longa, which was comparable to the effect of dexamethasone at used concentrations. Therefore, these results indicate that this plant could have a therapeutic effect on asthma by reducing lung pathological insults and tracheal responsiveness, as two main characteristics of the disease. While, the content of curcumin in the ethanolic extract was determined to be 9.4% it is possible that the effect of the extract is at least in part was due to its main constituent, curcumin.

References 1. Li, S., Yuan, W., Deng, G., Wang, P., Yang, p., & Aggarwal, B.B. (2011) Chemical Composition and Product Quality Control of Turmeric (Curcuma longa L.). Pharmaceutical Crops. 2, 28–54. 2. Dongre, P.R., Bhujbal, S.S., & Kumar, D. (2015) Bronchodilatory activity of Curcuma longa, Zingiber officinale and Alpinia galanga based herbal formulation (AHF). Orient Pharm Exp Med. 15, 341–346. 3. Sarkar, S., Chaturvedi, A., Srivastava, R., Dwivedi, P., Shukla, R., Srivastava, S., & Chaturvedi, D. (2015) Search for a Herbal Medicine: Anti-asthmatic Activity of Methanolic Extract of Curcuma longa. Res Rev J Pharmacogn Phytochem. 3, 59–72. 4. Lim, H.S., Park, S.H., Ghafoor, K., Hwang, S.Y., & Park, J (2011) Quality and antioxidant properties of bread containing turmeric (Curcuma longa L.) cultivated in South Korea. Food Chem. 124, 1577–1582. 5. Anna, K.T., Suhana, M.E., Das, S., Faizah, O., & Hamzaini, A. (2011) Anti-inflammatory effect of Curcuma longa (turmeric) on collagen-induced arthritis: an anatomico-radiological study. Clin Ter. 162, 201–207. 6. Abid, G.B., Furqan, H., & Khan, N.A. (2011) Evaluation of anxiolytic and muscle relaxant effect of polyherbal formulation of Curcuma longa and Butea frondosa on rats. Pharmacologyonline. 3, 1007–1014. 7. Adaramoye, O.A., & Medeiros, I.A. (2008) Involvement of Na+-Ca 2+ exchanger in the endothelium-independent

Int J Vitam Nutr Res (2020), 90 (1–2), 141–150

M.H. Boskabady et al., Curcuma longa affects lung inflammation in sensitized rats

150

10.

11.

12.

13.

14.

15.

16.

17.

18.

19.

20.

21.

vasorelaxation induced by Curcuma longa L. in isolated rat superior mesenteric arteries. J Smooth Muscle Res. 44, 151–158. Rao, T.S., Basu, N., Seth, S., & Siddiqui, H. (1984) Some aspects of pharmacological profile of sodium curcuminate. Indian J Physiol Pharmacol. 28, 211–215. Cluzel, M., Damon, M., Chanez, P., Bousquet, J., De Paulet, A.C., Michel, F., & Godard, P. (1987) Enhanced alveolar cell luminol-dependent chemiluminescence in asthma. J Allergy Clin Immunol. 80, 195–201. Barrios, R.J., Kheradmand, F., Batts, L.K., & Corry, D.B. (2006) Asthma: pathology and pathophysiology. Arch Pathol Lab Med. 130, 447–451. Boumendjel, A., Tridon, A., Messarah, M., Ughetto, S., Meharzi, S., & Boulakoud, M.S. (2012) Eosinophilic activity and bronchial hyperresponsiveness within an asthmatic pediatric population. Allergol Immunopathol. 40, 301–305. Shakeri, F., Soukhtanloo, M., & Boskabady, M.H. (2017) The effect of hydro-ethanolic extract of Curcuma longa rhizome and curcumin on total and differential WBC and serum oxidant, antioxidant biomarkers in rat model of asthma. Iran J Basic Med Sci. 20, 155–165. Khan, M.B., Atai Rabby, M.D., Hasmat Ullah, M.D., & Faiz Hossain, C. (2013) Investigation of antimicrobial and antiinflammatory activity of Curcuma longa. Int J Pharm Sci Res. 4, 1105–1109. Salama, S.M., Abdulla, M.A., Rashdi, A.S., Ismail, S., Alkiyumi, S.S., & Golbabapour, S. (2013) Hepatoprotective effect of ethanolic extract of Curcuma longa on thioacetamide induced liver cirrhosis in rats. BMC Complement Altern Med. 13, 1–17. Mengi, S.A., & Bakshi, V.J. (2009) Evaluation of the aqueous extract of Rotula aquatica roots in acute and chronic inflammatory conditions in rats. Pharm Biol. 47, 491–495. Boskabady, M.H., Tabatabaee, A., & Jalali, S. (2014) Potential effect of the extract of Zataria multiflora and its constituent, carvacrol, on lung pathology, total and differential WBC, IgE and eosinophil peroxidase levels in sensitized guinea pigs. J Func Foods. 11, 49–61. Boskabady, M.H., & Jalali, S. (2013) Effect of carvacrol on tracheal responsiveness, inflammatory mediators, total and differential WBC count in blood of sensitized guinea pigs. Exp Biol Med. 238, 200–208. Prasad, S., Tyagi, A.K., & Aggarwal, B.B. (2014) Recent developments in delivery, bioavailability, absorption and metabolism of curcumin: the golden pigment from golden spice. Cancer Res Treat. 46, 2–18. Boskabady, M.H., & Kiani, S. (2007) The effect of exposure of guinea pig to cigarette smoke and their sensitization in tracheal responsiveness to histamine and histamine receptor (H1) blockade by chlorpheniramine. Pathophysiol. 14, 97–104. Tibério, I., Turco, G., Leick-Maldonado, E.A., Sakae, R.S., Paiva, S., do Patrocinio, M., Warth, T., Lapa e Silva, J., Saldiva, P., & Martins, M.A. (1997) Effects of neurokinin depletion on airway inflammation induced by chronic antigen exposure. Am J Respir Crit Care Med. 155, 1739–1747. Zemmouri, H., Sekiou, O., Ammar, S., El Feki, A., Bouaziz, M., Messarah, M., & Boumendjel, A. (2017) Urtica dioica attenuates ovalbumin-induced inflammation and lipid peroxidation of lung tissues in rat asthma model. Pharm Biol. 55, 1561–1568.

Int J Vitam Nutr Res (2020), 90 (1–2), 141–150

22. Aldini, R., Budriesi, R., Roda, G., Micucci, M., Ioan, P., D’Errico-Grigioni, A., Sartini, A., Guidetti, E., Marocchi, M., & Cevenini, M. (2012) Curcuma longa extract exerts a myorelaxant effect on the ileum and colon in a mouse experimental colitis model, independent of the anti-inflammatory effect. PloS one. 7, 1–12. 23. Ram, A., Das, M., & Ghosh, B. (2003) Curcumin attenuates allergen-induced airway hyperresponsiveness in sensitized guinea pigs. Biol Pharm Bull. 26, 1021–1024. 24. Kinney, S.R., Carlson, L., Ser-Dolansky, J., Thompson, C., Shah, S., Gambrah, A., Xing, W., Schneider, S.S., & Mathias, C.B. (2015) Curcumin ingestion inhibits mastocytosis and suppresses intestinal anaphylaxis in a murine model of food allergy. PloS one. 10, 1–20. 25. Chauhan, P.S., Kumari, S., Kumar, J.P., Chawla, R., Dash, D., Singh, M., & Singh, R. (2013) Intranasal curcumin and its evaluation in murine model of asthma. Int Immunopharmacol. 17, 733–743. 26. Boskabady, M.H., Aslani, M., & Kiani, S. (2006) Relaxant effect of Thymus vulgaris on guinea-pig tracheal chains and its possible mechanism(s). Phytother Res. 20, 28–33. 27. Bansal, S., & Chhibber, S. (2010) Curcumin alone and in combination with augmentin protects against pulmonary inflammation and acute lung injury generated during Klebsiella pneumoniae B5055-induced lung infection in BALB/c mice. J Med Microbiol. 59, 429–437. 28. Guzel, A., Kanter, M., Aksu, B., Basaran, U.N., Yalçın, Ö., Guzel, A., Uzun, H., Konukoğlu, D., & Karasalihoglu, S. (2009) Preventive effects of curcumin on different aspiration material-induced lung injury in rats. Pediatr Surg Int. 25, 83–92. 29. Avasarala, S., Zhang, F., Liu, G., Wang, R., London, S.D., & London, L. (2013) Curcumin modulates the inflammatory response and inhibits subsequent fibrosis in a mouse model of viral-induced acute respiratory distress syndrome. PloS one. 8, 1–13. 30. Zeng, X., Cheng, Y., Qu, Y., Xu, J., Han, Z., & Zhang, T. (2013) Curcumin inhibits the proliferation of airway smooth muscle cells in vitro and in vivo. Int J Mol Med. 32, 629–636. 31. Shakeri, F., & Boskabady, M.H. (2017) Anti-inflammatory, antioxidant, and immunomodulatory effects of curcumin in ovalbumin-sensitized rat. BioFactors. 43, 567–576.

Acknowledgments This study was financially supported by a grant from Research Council of Mashhad University of Medical Sciences, Mashhad, Iran. The results of this paper are a part of the PhD thesis of Farzaneh Shakeri. Conflict of interest The authors declare that they have no conflict of interest.

Mohammad Hossein Boskabady Neurogenic Inflammation Research Center and Department of Physiology School of Medicine, Mashhad University of Medical Sciences Mashhad 9177948564 boskabadymh@mums.ac.ir; boskabadymh2@gmail.com

Ó 2019 Hogrefe

Original Communication

Homologous G776G Variant of Transcobalamin-II Gene is Linked to Vitamin B12 Deficiency Khalid M. Al-Batayneh1, Mazhar Salim Al Zoubi1,2, Bahaa Al-Trad1, Emad Hussein1,6, Wesam Al Khateeb1, Alaa A. A. Aljabali3, Khaldon Bodoor4, Murad Shehab1, Mohammad A. Al Hamad5, Greg J. Eaton7, and Christopher T. Cornelison8 1

Department of Biological Sciences, Faculty of Science, Yarmouk University, Irbid, Jordan

Department of Basic Medical Sciences, Faculty of Medicine, Yarmouk University, Irbid, Jordan

Faculty of Pharmacy, Yarmouk University, Irbid, Jordan

Department of Applied Biology, Faculty of Science and Arts, Jordan University of Science and Technology, Irbid, Jordan

Department of Pathology, College of Medicine, Imam Abdulrahman Bin Faisal University (IAU), Dammam, Kingdom of Saudi Arabia

Department of Food Science and Human Nutrition, College of Applied Sciences, A’Sharqiyah University, Ibra, Oman

Department of Biological Sciences, Rowan University, New Jersey, USA

Division of Research and Advanced Studies, Kennesaw State University, Georgia, USA

Received: August 3, 2017; Accepted: April 26, 2018

Abstract: Vitamin B12 (Cobalamin) deficiency, due to improper internalization of cobalamin, is a metabolic disorder prevalent in impoverished and elderly populations and is associated with megaloblastic anemia and dementia. It has been suggested that mutations in transcobalamin II (TCN2) or gastric intrinsic factor (GIF) proteins can alter their binding efficiency to cobalamin or reduce the ability of their receptors to internalize them. In this case-control study, the correlation between vitamin B12 deficiency and alternative alleles of TCN2 and GIF was investigated in a Jordanian population. One hundred individuals with vitamin B12 deficiency (B12 < 200 mg/mL) were enrolled in our study to evaluate the TCN2 and GIF polymorphisms. The control group (B12 > 200 mg/mL) included 100 individuals. Our results indicated a significant association between the homologous variant of the TCN2 gene (G776G) and vitamin B12 deficiency, and an intermediate phenotype in heterozygous individuals (p < 0.001, OR = 5.6, 95% CI = 2.95 to 10.63). The GIF gene, however, showed no correlation between the A68G variant and vitamin B12 deficiency (p = 0.2). This study expounds the association of TCN2 polymorphism with cobalamin levels in a Jordanian population and highlights the necessity of further studies to elucidate the molecular basis and impact of TCN2 and GIF genes polymorphisms on vitamin B12 deficiency and associated disorders. Keywords: Transcobalamin, Gastric Intrinsic Factor, Vitamin B12 Deficiency, Polymorphisms

Introduction The deficiency of vitamin B12 (Cobalamin) is a worldwide health concern that is common in western countries and highly prevalent in low-income countries, particularly among the elderly [1–3]. In Jordan, vitamin B12 deficiency was estimated at 32.1-48.5% [4–6]. Vitamin B12 deficiency is a serious disorder associated with megaloblastic anemia and neurological diseases including neural tube defects [7], dementia, and Alzheimer’s [8–11]. Besides dietary insufficiency; vitamin B12 deficiency can be a result of failure at one of the steps of cobalamin internalization, in particular among the elderly population. Vitamin B12 absorption requires gastrointestinal and blood transporters Ó 2019 Hogrefe

for the delivery to the target tissues. For instance, the gastric internist factor (GIF) is responsible for the capturing of cobalamin to bind its receptor on the intestinal cells for internalization. Then, transcobalamin II (TCN2) is assigned as a blood transporter of cobalamin which delivers it to various tissues through receptors mediated mechanism [12]. Consequently, variations in the TCN2 or IF proteins can affect the binding features of vitamin B12 to TCN2 or GIF or the recognition of the B12-TCN2 or B12-GIF complexes by the endocytosis receptors. Accordingly, genetic polymorphisms of TCN2 and GIF genes have been suggested to have an influence on vitamin B12 metabolism [13–18]. Specifically, the TCN2-776C>G (rs1801198) genotype and G allele have shown a reduction in the transcription and Int J Vitam Nutr Res (2020), 90 (1–2), 151–155 https://doi.org/10.1024/0300-9831/a000536

152

K. M. Al-Batayneh et al., TCN-II and GIF polymorphisms and B12 Deficiency

plasma concentration of transcobalamin, and thus influence the availability of vitamin B12 [13, 19–22]. Furthermore, congenital intrinsic factor deficiency (IFD), a rare disorder, is associated with megaloblastic anemia and neurological abnormalities due to malabsorption of vitamin B12 [23, 24]. Nevertheless, the effect of the GIF-A68G (rs35211634) polymorphism on vitamin B12 status is not well known, even though this polymorphism has been related to pernicious anemia [25]. The aim of the current case-control study was to investigate a possible association between the TCN2-776C>G (Arg259Pro) (rs1801198) and GIF-68A>G (Q23R) (rs35211634) variants and vitamin B12 deficiency in Jordan.

Materials and Methods Patients and ethical approval The study population included two hundred individuals which are subjected to vitamin B12 assessment at the clinics of Princess Basma Hospital included. The affected group (vitamin B12 deficient < 200 mg/mL) consisted of 45 males (45%) and 55 (55%) females. On the other hand, the control group (vitamin B12 > 200 mg/mL) consisted of 53 (53%) males. Blood specimens were collected from patients (low level of Vitamin B12, with no any other diseases) and control group after signing an informed consent form according to the rules of the Research Ethics Committee at Yarmouk University. Vitamin B12 level measurement in serum specimens was performed by automated immunoassay analyzer (Cobas-Hitachi e411, Roche Diagnostics, Japan) at Princess Basma Hospital. Pregnant women and individuals less than 18 years old were excluded from the study. In addition, individuals with a history of supplementary treatment were excluded from the population study. Demographic and clinical information was obtained by direct questionnaire and clinical records in the hospital.

Genomic DNA Extraction DNA extraction from blood specimens was performed after the collection in EDTA tubes. The extraction procedure was performed by modified phenol-chloroform extraction method [26]. Briefly, 0.2 mL of blood added to 0.5 mL of lysis buffer (10 mM Tris-HCl, 100 mM NaCl, 10 mM EDTA, 2% SDS and 0.39 M DTT) and 400 μg of proteinase K (New England BioLabs, Ipswich, MA, USA). The mixture was incubation at 56° C for 120 minutes. After cell digestion, 0.5 mL of phenol:chloroform:isoamyl alcohol mixture was added and shake vigorously and centrifuged at maximum speed (14,000 g) for 5 minutes. Then 1 mL of 0°C absolute Int J Vitam Nutr Res (2020), 90 (1–2), 151–155

ethanol was mixed with the aqueous layer and centrifuged at maximum speed (14,000 g) for 5 minutes. The precipitated DNA was washed with 70% ice cold ethanol twice. The last wash was removed and the pellet mixed with 0.1 mL of TE buffer and stored at –20 °C. All chemicals were purchased from (Sigma-Aldrich) unless it’s described.

PCR amplification of the TCN2 target sequences The target sequence in the TCN2 gene was amplified by mutagenically-separated-PCR technique (MS-PCR). The specific primers were designed as reverse-1 (R1-50 ACCCTC GCCTTGAGACATGCCCTTCCCAGTTCTGC CCGAG-30 ) and reverse-2 (R2-50 -TGTTCCCAGTTC TGCCGCAC-30 ) containing 30 -mismatch ends and two contiguous positions corresponding to the 50 -end of the R1 primer. The forward primer was (F1-50 -TCTGT CCCCCACTTCAAGAC-30 ) [27]. All primers were supplied by Integrated DNA Technologies (IDT, Coralville, Iowa, USA). The PCR mixture was performed in 25 μl containing 12.5 μl of Taq 2X Master Mix (New England BioLabs, Ipswich, MA, USA), 4 μl of genomic DNA (200 ng/μl), 2 μl of 10 μM R1 primer, 2 μl of 10 μM F1 primer and 0.25 μl of 10 μM R2 primer, and 4.25 μl D.H2O. The mixture was denatured initially at 95°C for 15 minutes, then 35 cycles of amplification (94°C/20 sec, 20 60°C/sec, and 72°C/25 sec). The final extension was for 5 minutes at 72°C by using (XP-PCR Thermal Cycler, Bioer, Hangzhou，China).

PCR amplification of the GIF target sequences The GIF target sequence (Exon 1) was amplified by using the following pairs of specific primers: F-50 -GTTGGGGACAGATTATTTAACAAAGG-30 and R-50 -GCACACAATCACACTCAGACTTACCC-30 as described before [23]. The Taq 2X Master-Mix was used for PCR reactions (New England BioLab, Ipswich, MA, USA). The amplification was performed under the following conditions: (35X of cycling including 94°C/20 sec, 55°C/20 sec, and 72°C/30 sec) and a final extension for 5 min at 72°C. The PCR products were sequenced by GENWIZ (115 Corporate Boulevard, South Plainfield, NJ, USA).

Agarose Gel Electrophoresis of MS-PCR (C776G) The PCR products were separated by 2% agarose gel electrophoresis for 160 minutes at 100 Volts using 1X TBE buffer. The 380-bp band product indicated the presence Ó 2019 Hogrefe

K. M. Al-Batayneh et al., TCN-II and GIF polymorphisms and B12 Deficiency

153

Table 1. General characteristics and TCN2-C776G genotypes distribution. Total

C776C

C776G

G776G

p value

(n=200)

n = 146 (73%)

n = 39 (19.5%)

n = 15 (7.5%)

0.1*

Age (Years ± SD)

35.4 ± 13.7

36 ± 14.6

31.9 ± 10.3

38.9 ± 11.5

0.26

B12 (< 200 mg/mL)

100 (50%)

0.0001

B12 ( 200 mg/mL)

100 (50%)

TCN2** genotype Genotype Frequency

*Hardy-Weinberg Equilibrium **TCN2: Transcobalamin II

Table 2. TCN2-C776G and GIF-A68G genotypes distribution. B12 Deficient

Control

p Value

B12 (mg/mL ± SD)

142.31 ± 24.09

441.76 ± 179.06

2.84E-39

Age (years± SD)

38.04 ± 11.69

32.71 ± 15.04

0.006*

Male n (%)

45 (45%)

53 (53%)

0.26

Female n (%)

55 (55%)

47 (47%)

59 26

87 13

TCN2** C776G

GIF*** A68G

CC CG GG

144

187

AA AG

66 30

78 20

162

176

95% CI

5.6

(2.95 to 10.63)

1.7

(0.99 to 2.99)

0.0001*

0.0001* 0.20

0.07

* p value < 0.05 ** TCN2: Transcobalamin II *** GIF: Gastric Intrinsic Factor

of C allele, while the 360-bp product indicated the presence of G allele for the TCN2-776C>G polymorphisms.

Statistical Analysis The statistical parameters; p-values and odd ratio (OR), 95% confidence interval (CI), Chi-square and Fisher’s exact test were analyzed by the GraphPad-Prism-6 software. Hardy–Weinberg Equilibrium (HWE) was used to calculate the allelic and genotype frequencies in the tested population. The significant association was considered when p value is less than 0.05.

Results The study population did not show a significant difference in the mean age which was 37 years for the vitamin B12 deficient group and 32 for the control group. Hardy–Weinberg Equilibrium (HWE) did not show a significant difference in the normality distribution of the analyzed genotypes. Frequencies of the TCN2-776C>G (rs1801198) and GIF68A>G (rs35211634) genotypes in the selected population Ó 2019 Hogrefe

are presented in Table 1 and Table 2. In the vitamin B12 deficient group, the homologous G776G genotype in the TCN2 gene was more frequent as compared to the control group (p < 0.001). Moreover, G allele showed significant association with vitamin B12 deficiency in the studied population (p < 0.001, OR = 5.6, 95% CI = 2.95 to 10.63). Conversely, 68A>G genotypes frequencies of the GIF gene was found to be not associated with the low level of vitamin B12 (p = 0.2), neither the G allele (p = 0.07, OR = 5.6, 95% CI = 0.99 to 2.99) (Table 2).

Discussion Probable association between 776A>G and 68A>G variants of the TCN2 and GIF genes and vitamin B12 status have been suggested [13, 19–22]. Here we investigated the possible association between TCN2-776C>G (rs1801198) and GIF-68A>G (rs35211634) genotypes and vitamin B12 deficiency in a Jordanian population. In the selected case-controlled study population, we found a significant association between homologous G776G Int J Vitam Nutr Res (2020), 90 (1–2), 151–155

154

K. M. Al-Batayneh et al., TCN-II and GIF polymorphisms and B12 Deficiency

Figure 1. Representative “MS-PCR” products of TCNII region surrounding nucleotide C776G. Amplified DNA was resolved on a 2% agarose. Lane 1 is 100 bp DNA markers. Lanes 2-4 wild type (CC), lanes 5-7: heterozygous (CG) and lanes 8-10: recessive polymorphism (GG).

genotype of the TCN2 gene and the deficiency of vitamin B12, which is consistent with some previously reported results and conflicting with other studies [15, 22, 28–30]. In an example of conflicting results, Castro et al, have reported a significant association between homozygous G776G genotype and holo-Transcobalamin (holo-TCN2) concentration but not vitamin B12 level in plasma [22]. Moreover, Ale0 ssio et al reported similar results for hyperhomocysteinemia without association with the vitamin B12 level in G776G genotype individuals [29]. The molecular basis of the correlation between homozygous G776G genotype of the TCN2 gene is not clear. Nevertheless; the polymorphic change in 776C>G genotype of the TCN2 gene will replace proline with arginine at codon 259 of the TCN2 protein [17]. This substitution has a potential effect on the tertiary structure of the TCN2; consequently, this may influence the binding ability of vitamin B12 to TCN2 or holo-TCN2 to its receptor [30]. However, proline 259 is part of the flexible loop between helices α10 and α11, this position has been suggested to have no influence on the binding ability of cobalamin to TCN2, or the receptor affinity to the B12-TCN2 complex [31]. Moreover, TCN2 transcript stability has been suggested to explain the influence of 776C>G polymorphism on the vitamin B12 status. Namour et al, have shown a low concentration of 776G containing transcripts in comparison with the other genotype [19]. Whether holo-TCN2 or vitamin B12 level is associated with the G776G genotype of the TCN2 gene; the reduction in holo-TCN2 or vitamin B12 level has an influence on the homocysteine level, which may lead to neurological disorders [15–17, 22, 28, 30]. For instance, vitamin B12 metabolism deficiency; due to total level reduction or cellular delivery, has been associated with neurological disorders Int J Vitam Nutr Res (2020), 90 (1–2), 151–155

such as NTD and recurrent abortion [14, 17, 21, 30, 32]. Comprehensive genetic investigation of cobalamin metabolism is required to understand the role of all involved transporters and receptors [33, 34]. For instance, methylene-tetrahydrofolate reductase 1298A to C polymorphism genotype has been identified as a modulator factor for the C776G genotype’s influence on Alzheimer’s type dementia [13]. Moreover, genetic variations of TCN2 and Transcobalamin II-Receptor (TCblR) proteins in association with cobalamin deficiency are influenced by age [14]. There is a worldwide heterogeneity in the distribution of the TCN2-776C>G polymorphism. Environmental factors have been hypothesized to play a role in genotype selection. Therefore, the differences in the findings of the effect of 776C>G polymorphism can be explained by the ethnic variation and environmental influence [27, 35]. In our study population, the G776G genotype is less frequent than Caucasian and African populations but similar to Asian populations [27]. Therefore, our results can be considered as a new genetic dataset for the regional genetic databases that can be generated by performing similar studies. Sample size can be considered as a limitation of our study; however, it gives a preview about the genotype distribution and the impact of TCN2 genotype on vitamin B12 status in the Jordanian population. Moreover, nutritional and lifestyle information, as well as the previous history of vitamin B12 status of the selected population would improve the conclusion of the current study. Therefore, further studies are recommended to be conducted in Jordan to evaluate the status of vitamin B12 in different geographical areas with larger sample size. In conclusion, our results suggest that the homologous G776G (rs1801198) genotype of the TCN2 gene has a significant association with vitamin B12 level in a Jordanian population. On the other hand, the A68G (rs35211634) genotype of the GIF gene showed insignificant association with vitamin B12 deficiency. Further studies are required to elucidate the impact of TCN2, GIF genes polymorphisms on vitamin B12 indices and vitamin B12 associated disorders.

References 1. Allen, L.H. (2009) How common is vitamin B-12 deficiency? Am J Clin Nutr. 89, 693S–696S. 2. Stabler, S.P., & Allen, R.H. (2004) Vitamin B12 deficiency as a worldwide problem. Annu Rev Nutr. 24, 299–326. 3. Gupta Bansal, P., et al. (2015) Deficiencies of Serum Ferritin and Vitamin B12, but not Folate, are Common in Adolescent Girls Residing in a Slum in Delhi. Int J Vitam Nutr Res. 85, 14– 22. 4. El-Qudah, J.M., et al. (2013) Serum Vitamin B12 Levels Related to Weight Status Among Healthy Jordanian Students. Laboratory Medicine. 44, 34–39. Ó 2019 Hogrefe

K. M. Al-Batayneh et al., TCN-II and GIF polymorphisms and B12 Deficiency

5. Barghouti, F.F., et al. (2009) High frequency of low serum levels of vitamin 12 among patients attending Jordan University Hospital. East Mediterr Health J. 15, 853–860. 6. Fora, M.A., & Mohammad, M.A. (2005) High frequency of suboptimal serum vitamin B12 level in adults in Jordan. Saudi Med J. 26, 1591–1595. 7. Abulencia, A., et al. (2006) Observation of Bs(0)-Bs(0) oscillations. Phys Rev Lett. 97, 242003. 8. Finkelstein, J.L., et al. (2015) Vitamin B-12 and Perinatal Health. Adv Nutr. 6, 552–563. 9. Nasri, K., et al. (2015) Association of maternal homocysteine and vitamins status with the risk of neural tube defects in Tunisia: A case-control study. Birth Defects Res A Clin Mol Teratol. 103, 1011–1020. 10. McCaddon, A. (2013) Vitamin B12 in neurology and ageing; clinical and genetic aspects. Biochimie. 95, 1066–1076. 11. Spence, J.D. (2016) Metabolic vitamin B12 deficiency: a missed opportunity to prevent dementia and stroke. Nutr Res. 36, 109–116. 12. Seetharam, B. (1999) Receptor-mediated endocytosis of cobalamin (vitamin B12). Annu Rev Nutr. 19, 173–195. 13. Cascalheira, J.F., et al. (2015) Association of the transcobalamin II gene 776C –> G polymorphism with Alzheimer's type dementia: dependence on the 5, 10-methylenetetrahydrofolate reductase 1298A –> C polymorphism genotype. Ann Clin Biochem. 52, 448–455. 14. Kurnat-Thoma, E.L., et al. (2015) Association of Transcobalamin II (TCN2) and Transcobalamin II-Receptor (TCblR) Genetic Variations With Cobalamin Deficiency Parameters in Elderly Women. Biol Res Nurs. 17, 444–454. 15. von Castel-Dunwoody, K.M., et al. (2005) Transcobalamin 776C->G polymorphism negatively affects vitamin B-12 metabolism. Am J Clin Nutr. 81, 1436–1441. 16. Miller, J.W., et al. (2002) Transcobalamin II 775G>C polymorphism and indices of vitamin B12 status in healthy older adults. Blood. 100, 718–720. 17. Afman, L.A., et al. (2002) Single nucleotide polymorphisms in the transcobalamin gene: relationship with transcobalamin concentrations and risk for neural tube defects. Eur J Hum Genet. 10, 433–438. 18. Fodinger, M., et al. (2003) Effect of TCN2 776C>G on vitamin B12 cellular availability in end-stage renal disease patients. Kidney Int. 64, 1095–1100. 19. Namour, F., et al. (2001) Transcobalamin codon 259 polymorphism in HT-29 and Caco-2 cells and in Caucasians: relation to transcobalamin and homocysteine concentration in blood. Blood. 97, 1092–1098. 20. Namour, F., et al. (1998) Isoelectrofocusing phenotype and relative concentration of transcobalamin II isoproteins related to the codon 259 Arg/Pro polymorphism. Biochem Biophys Res Commun. 251, 769–774. 21. Afman, L.A., et al. (2001) Reduced vitamin B12 binding by transcobalamin II increases the risk of neural tube defects. QJM. 94, 159–166. 22. Castro, R., et al. (2010) The TCN2 776CNG polymorphism correlates with vitamin B(12) cellular delivery in healthy adult populations. Clin Biochem. 43, 645–649. 23. Gordon, M.M., et al. (2004) A genetic polymorphism in the coding region of the gastric intrinsic factor gene (GIF) is

Ó 2019 Hogrefe

24.

25.

26.

27.

28. 29.

30.

31.

32.

33.

34.

35.

155

associated with congenital intrinsic factor deficiency. Hum Mutat. 23, 85–91. Tanner, S.M., et al. (2005) Hereditary juvenile cobalamin deficiency caused by mutations in the intrinsic factor gene. Proc Natl Acad Sci U S A. 102, 4130–4133. Ferrand, A., et al. (2015) Biochemical and Hematologic Manifestations of Gastric Intrinsic Factor (GIF) Deficiency: A Treatable Cause of B12 Deficiency in the Old Order Mennonite Population of Southwestern Ontario. JIMD Rep. 18, 69–77. Di Pietro, F., et al. (2011) Genomic DNA extraction from whole blood stored from 15- to 30-years at -20 degrees C by rapid phenol-chloroform protocol: a useful tool for genetic epidemiology studies. Mol Cell Probes. 25, 44–48. Bowen, R.A., et al. (2004) Population-based differences in frequency of the transcobalamin II Pro259Arg polymorphism. Clin Biochem. 37, 128–133. McCaddon, A., et al. (2001) Transcobalamin polymorphism and homocysteine. Blood. 98, 3497–3499. Alessio, A.C., et al. (2007) Polymorphism C776G in the transcobalamin II gene and homocysteine, folate and vitamin B12 concentrations. Association with MTHFR C677T and A1298C and MTRR A66G polymorphisms in healthy children. Thromb Res. 119, 571–577. Stanislawska-Sachadyn, A., et al. (2010) The transcobalamin (TCN2) 776C>G polymorphism affects homocysteine concentrations among subjects with low vitamin B(12) status. Eur J Clin Nutr. 64, 1338–1343. Wuerges, J., et al. (2006) Structural basis for mammalian vitamin B12 transport by transcobalamin. Proc Natl Acad Sci U S A. 103, 4386–4391. Godbole, K., et al. (2011) Maternal one-carbon metabolism, MTHFR and TCN2 genotypes and neural tube defects in India. Birth Defects Res A Clin Mol Teratol. 91, 848–856. Sharma, P., et al. (2006) Mining literature for a comprehensive pathway analysis: a case study for retrieval of homocysteine related genes for genetic and epigenetic studies. Lipids Health Dis. 5, 1. Chmurzynska, A., et al. (2017) Rs6586282 of the CBS Gene: Its Lack of Eff ect on Homocysteine Concentrations, and Interaction Eff ects on Body Weight in Elderly Women. Int J Vitam Nutr Res. 0, 1–7. Gueant, J.L., et al. (2007) Environmental influence on the worldwide prevalence of a 776C->G variant in the transcobalamin gene (TCN2). J Med Genet. 44, 363–367.

Acknowledgments We are very thankful to the Deanship of Scientific Research and Graduate Study/Yarmouk University for the financial support to complete this work. Conflict of Interest The authors declare that there are no conflicts of interest. Dr. Khalid Al-Batayneh albatynehk@yu.edu.jo

Int J Vitam Nutr Res (2020), 90 (1–2), 151–155

Original Communication

Neuroprotective and long term potentiation improving effects of vitamin E in juvenile hypothyroid rats Yousef Baghcheghi1, Somaieh Mansouri2, Farimah Beheshti3,4, Mohammad Naser Shafei4, Hossien Salmani1, Parham Reisi5, Akbar Anaeigoudari6, Alireza Ebrahimzadeh Bideskan7, and Mahmoud Hosseini8 1

Student Research Committee, Department of Physiology, Faculty of Medicine, Mashhad University of Medical Sciences, Mashhad, Iran

Department of Anatomy and Cell Biology, Faculty of Medicine, Mashhad University of Medical Sciences, Mashhad, Iran

Neuroscience Research Center, Torbat Heydariyeh University of Medical Sciences, Torbat Heydariyeh, Iran

Division of Neurocognitive Sciences, Psychiatry and Behavioral Sciences Research Center, Mashhad University of Medical Sciences, Mashhad, Iran

Department of Physiology, School of Medicine, Isfahan University of Medical Sciences, Isfahan, Iran

6 7

Department of Physiology, School of Medicine, Jiroft University of Medical Sciences, Jiroft, Iran Microanatomy Research Center, Mashhad University of Medical Sciences, Mashhad, Iran

Neurogenic Inflammation Research Center, Mashhad University of Medical Sciences, Mashhad, Iran

Received: April 30, 2018; Accepted: June 7, 2018

Abstract: Protective effects of vitamin E (Vit E) on long term potentiation (LTP) impairment, neuronal apoptosis and increase of nitric oxide (NO) metabolites in the hippocampus of juvenile rats were examined. The rats were grouped (n=13) as: (1) control; (2) hypothyroid (Hypo) and (3) Hypo-Vit E. Propylthiouracil (PTU) was given in drinking water (0.05%) during 6 weeks. Vit E (20 mg/ kg) was daily injected (IP). To evaluate synaptic plasticity, LTP from the CA1 area of the hippocampus followed by high frequency stimulation to the ipsilateral Schafer collateral pathway was carried out. The cortical and hippocampal tissues were then removed to measure NO metabolites. The brains of 5 animals in each group were removed for apoptosis study. The hypothyroidism status decreased the slope, 10–90% slope and amplitude of field excitatory post synaptic potential (fEPSP) compared to the control group (P<0.01–P<0.001). Injection of Vit E increased the slope, 10–90% slope and amplitude of the fEPSP in the Hypo-Vit E group in comparison to the Hypo group (P<0.05–P<0.01). TUNEL positive neurons and NO metabolites were higher in the hippocampus of the Hypo rats, as compared to those in the hippocampus of the control ones (P<0.001). Treatment of the Hypo rats by Vit E decreased apoptotic neurons (P<0.01–P<0.001) and NO metabolites (P<0.001) in the hippocampus compared to the Hypo rats. The results of the present study showed that Vit E prevented the LTP impairment and neuronal apoptosis in the hippocampus of juvenile hypothyroid rats. Keywords: Hypothyroidism, Long term potentiation, Apoptosis, Hippocampus Vitamin E, Nitric oxide

Introduction Thyroid hormones (THs) are essential for growth and development of the mammalian brain. Using human and animal studies, insufficiency of THs has been reported to be followed by structural and functional dysfunctions of the brain [1, 2]. THs deficiency is also associated with profound neurological and morphogenetic deficits including defects in interneuronal connectivity, synaptogenesis, myelination, cell migration and proliferation [3–7]. Int J Vitam Nutr Res (2020), 90 (1–2), 156–168 https://doi.org/10.1024/0300-9831/a000533

In initial reports, it was well documented that deficiency of THs delays maturation of innate reflexes, decreases behavior activity and impairs the ability to acquire some complex forms of learning [8–10]. It has been recently demonstrated that THs inhibits the release of apoptotic molecules to prevent excess apoptosis during cerebellar development [1]. Hypothyroidism in rats is connected with an increased level of neuronal apoptosis in the inner granule layer of the developing cerebellum [11]. Hypothyroidism is also accompanied by mitochondrial dysfunction, an Ó 2019 Hogrefe

M. Hosseini et al., Neuroprotective effect of Vit E in juvenile hypothyroid rat

enhanced level of expression of pro-apoptotic protein Bax, and a decrease in anti-apoptotic Bcl-2 and Bcl-xL proteins [12–14]. Long term potentiation (LTP) is a component of synaptic plasticity, which is involved in memory acquisition and consolidation. Many studies report an inability to induce LTP in the hippocampal neurons of hypothyroid rats [15, 16]. It has been well documented that hypothyroidism disrupts hippocampal-dependent learning, short- and long-term memory, and early and late phases of LTP [16–20]. The CA1 area in hippocampus is the most important region for spatial learning [21], where memory is encoded, consolidated and stored by synaptic plasticity [22]. Functional synaptic plasticity is a physiological process, in which certain patterns of neural activity result in modification of synaptic strength that outlives the engendering events and has physiological properties of an information storage device [23, 24]. As one form of synaptic plasticity, LTP is essential for learning and memory and for activitydependent regulation of synapse formation in the developing brain [22]. LTP-like processes in the CA1 area alone could lay down the memory trace required for learning [21]. Thus, LTP in the CA1 area is a well-accepted synaptic model of learning and memory [22]. Vitamin E (Vit E) is a fat-soluble vitamin with numerous biological functions [25]. Vit E represents a generic term for all tocopherols and their derivatives, including naturally occurring and biologically active stereoisomeric compounds of α-tocopherol [26]. It is the most effective chain breaking lipid soluble antioxidant in biological membranes, and protects cellular structures against damage from oxygen free radicals and reactive products of lipid peroxidation [27–29]. The antioxidant activity of Vit E has persuaded many groups to study its ability to prevent chronic diseases, especially those believed to have an oxidative stress component, such as cardiovascular diseases and atherosclerosis [30, 31]. Vit E has also been shown to play a role in immune function, DNA repair, and other metabolic processes [29, 32]. Using animal models, previous ﬁndings suggest that oxidative stress may contribute to learning and memory deﬁcits following oxidative stress-induced brain damage [33, 34]. Exposure to hypothyroidism has been reported to enhance oxidative stress and cause neurotoxicity [35, 36]. Vit E has been suggested to prevent oxidative damage in order to improve cognitive functions [37, 38]. In particular, Vit E supplementation is able to protect cultured hippocampal neurons against neurotoxic effects of oxidative damage [39]. The aim of this study was to evaluate protective effects of Vit E on LTP impairment, neuronal apoptosis and nitric oxide (NO) concentration metabolites in the hippocampus of juvenile hypothyroid rats. Ó 2019 Hogrefe

157

Material and methods Animals and drugs Thirty-nine male Wistar rats with an age of 3 weeks and a weight of 60 ± 5 g were randomly supplied by our local animal center at Mashhad University of Medical Sciences, Mashhad, Iran. The animals were kept in standard conditions including a temperature of 22±2°C, a periodic 12 h light/dark and a free access to water and food. All experiments were conducted in accordance the rules provided by the National Institute of Health Guide for the Care and Use of Laboratory Animals and approved by the Committee on Animal Research of Mashhad University of Medical Sciences (IR.MUMS.REC.1394.158). The animals were randomly classified into three groups: (1) control (2) hypothyroid (Hypo) and (3) Hypo-Vit E. The animals of the Hypo and Hypo-Vit E groups received 0.05% PTU (0.5 gram PTU was added to 1000 ml in drinking water) water during 6 weeks. Rats were intraperitoneally injected with 20 mg/kg Vit E(Iran Hormone Company, Tehran, Iran) or same volume of saline[40]. PTU (Sigma Aldrich Chemical Co.) was daily added to the drinking water of the rats. Moreover, Vit E (Iran Hormone Company, Tehran, Iran). Twenty-four of the animals (n=8 in each group) were used for electrophysiological study. The brains of these animals were removed to use for measurement of NO metabolites. In addition, fifteen of the animals (n = 5 in each group) were used for histology experiments.

Electrophysiological study After anesthesia with urethane (1.6 g/kg), the heads of the rats were mounted in a stereotaxic device. The skull was exposed the locations of CA1 area(AP = 4.1 mm; ML= 3 mm) and Schafer collateral pathway(AP= 3 mm; ML= 3.5 mm; DV= 2.8–3 mm) of the hippocampus was determined according to the Paxinos and Watson atlas[41]. Two small holes were then drilled on the skull. For recording field excitatory post synaptic potential (fEPSP), a bipolar stimulating electrode (stainless steel, diameter of 0.125 mm, AM system, England) was lowered to the Schafer collateral pathway of the right hippocampus (DV= 2.8-3 mm). A unipolar recording electrode was also lowered to the CA1 area of the ipsilateral (DV= 2.5 mm) [41]. Physiological and stereotaxic indicators were considered to verify the appropriate location of the electrodes. A differential amplifier was used to record, amplify (100 ) and filtere (1Hz to 3 kHz band pass) fEPSP from the CA1 after stimulating the Schafer collateral. After inserting of the electrodes, 30 min was applied as a rest period. Then an input-output (I/O) protocol was done to evaluate synaptic potency. Int J Vitam Nutr Res (2020), 90 (1–2), 156–168

158

M. Hosseini et al., Neuroprotective effect of Vit E in juvenile hypothyroid rat

To do this, the stimuli intensities were gently increased and the fEPSPs were recorded. 50% of maximum response was considered and a baseline of fEPSP was recorded [41] for 30 min. A high frequency stimulus(100 Hz) was applied to induce LTP [42] and the fEPSPs were recorded for 90 min. Neurotrace software version 9 and Eletromodule 12 (Science Beam Institute, Tehran, Iran)were used for stimulating and recording.

Measurement of nitric oxide metabolites After LTP recording, the rats were sacrificed and the brains were removed and the hippocampus and cortex were used to measure the levels of nitric oxide (NO) metabolites (NO 2 /NO3 ) based on the Griess reagent method. In this method, 100 μL of the brain tissues supernatant were added to the Griess reagent. The solution was then transferred to a 96-well micro-plate and the absorbance (520 nm) was read by a micro-plate reader. The final concentration was determined using a standard plot [43–45].

Histological studies 15 animals were used (n = 5 in each group) to do a histological study. To provide a deep anesthesia, a high dose of urethane was injected and the rats were then transcardially perfused with saline and then followed by 100 ml of glutaraldehyde 1.25% plus paraformaldehyde %1 (in buffer phosphate PBS; 0.2 molar, pH=7.4) as a fixative. The Paraffin blocks from the were provided and serial coronal sections (5 μm) were prepared. Ten sections of each brain including the hippocampus were randomly selected using systematic randomized sampling method. Poly L lysine slides were used for TUNEL staining of the sections [46, 47]. To do TUNEL method, the deparafﬁnized sections were rehydrated using descending ethanol concentrations. The samples were then rinsed (10 min) using 0.1 M PBS and then incubated in protein kinase K (20 g/ml) at room temperature for 15 min. After washing (PBS), 3% H2O2 in PBS (10 min/room temperature) was used to inactivate endogenous peroxidase. Using a PBS, the sections were again washed twice with and incubated with TUNEL (Roche Kit, Germany) reaction solution (Deoxynucleotidyl transferase and Lable-deoxynucleotide) overnight at a dark environment with 4°C and an ambient humidity. Then, the samples were then rinsed using PBS solution and incubated with converter-POD (POD, 1:500) for 30 min at a 37°C condition. The sections were subsequently rinsed using PBS solution for 3 min. a solution containing 3, 30 diaminobenzidine (DAB) (30 mg DAB and 200μl H2O2/100ml PBS)

Int J Vitam Nutr Res (2020), 90 (1–2), 156–168

was used to incubate the sections for 5 min at room temperature to visualize the reaction products. Running water was used to wash the sections then counterstained with haematoxylin. An increasing graded concentration of ethanol was administered to dehydrate the sections. The samples were cleared with xylene and mounted with cover slip. A similar method was used for negative control samples; except the deoxynucleotidyl transferase was not used. The samples of positive control slides were treated with DNAase I. In this method, the cells with a brown nucleus were considered as apoptotic cells. A light microscope with a 40 objective lens (UPlan FI, Japan) was used to evaluate the sections. Five fields from each area of the hippocampus (CA1, CA2, CA3 and DG) were selected and a high-resolution camera (BX51, Japan) d was used to take photographs. A mosaic method and a zigzag model were used to take the photos. A computer and a 10,000 μm2 counting frame was used to count the TUNEL positive cells (number of per unit area). The following formula was used to calculate the TUNEL positive cells (NA) in different regions of the hippocampus [47–52]:

NA ¼

ΣQ a=f :ΣP

” is the sum of counted particles appeared in the “ΣQ sections, “a/f” is the area associated with each frame, and “ΣP” is the sum of the frame associated points hitting space.

Determination of serum T4 content The blood samples were drawn from the heart of the anesthetized rats. To determine the serum thyroxin level and hypothyroidism status, a radioimmunoassay method (Daisource, T4-RIA – CT) was used. Total T4 (tT4) concentrations in serum were measured in duplicate according to manufacturer’s instructions. Briefly, 20 μl of calibrators, controls and samples were mixed with 200 μl of 125Iodine labelled T4 and 100 μl of anti-T4 in the respective tubes and the mixture was shaken gently. After 1 hour incubation at room temperature with continuous shaking, the content of each tube was aspirated. After that, the tubes were washed with 2 ml provided working wash solution and counted in a gamma counter for 60 seconds [50, 53–59].

Statistical Analysis All data were expressed as means ± SEM. KolmogorovSmirnov was used to verify the normality of data. The data of LTP criteria were compared using the repeated measures analysis of variance (ANOVA) followed by Tukey’s post hoc

Ó 2019 Hogrefe

M. Hosseini et al., Neuroprotective effect of Vit E in juvenile hypothyroid rat

(a)

159

(b)

(c)

Figure 1. Comparison of the amplitude (a), slope (b), 10–90% slope (c) and fEPSP after LTP induction in the CA1 area of the hippocampus using 100 Hz tetanic stimulation. **P<0.05, **P<0.01 and ***P<0.001 compared to the control group, +P<0.05, ++P<0.01 and+++P<0.001 compared to the Hypo group. CA1: Cornu Ammonis 1.

comparisons test The data of histology and the biochemical data were compared by one-way ANOVA followed by Tukey’s post hoc comparisons test. Differences were considered statistically significant when P<0.05.

Results Electrophysiological results The results showed that applying HFS increased the amplitude, slope and 10–90% slope of the fEPSP in the control group (Figures 1A, 1B and 1C). However, the amplitude, slope and 10–90% slope in the Hypo group was significantly lower than those in the control group after applying HFS (P<0.01–P<0.001, Figures 1A, 1B and 1C). Injection of Vit E increased the fEPSP amplitude, slope and 10–90% slope in the Hypo-Vit E group in comparison with the Hypo group (P<0.05–P<0.01, Figures 1A, 1B and 1C). Additionally, by applying HFS, the amplitude and slope of the fEPSP in Hypo-Vit E group were observed to be lower than those in the control group (P<0.05–P<0.001, Figures 1A, 1B and 1C). Ó 2019 Hogrefe

Nitric oxide (NO) metabolites NO metabolites (NO 2 /NO3 ) concentrations in the hippocampal tissues of the Hypo group were higher than those in the control group (P<0.01). Treatment of the animals by Vit E in the Hypo-Vit E group decreased NO metabolites in the hippocampal tissues in comparison with those in the Hypo group (P<0.001). However, there was no significant difference between the Hypo-Vit E and control groups (Figure 2A). NO metabolites concentrations in the cortical tissues of the Hypo group were higher than those in the control group (P<0.001). Treatment of the Hypo rats by Vit E in the HypoVit E group decreased NO metabolites in the cortical tissues in comparison with those in the Hypo group (P<0.001); however, NO metabolites in the Hypo-Vit E group were higher than those in the control group (P<0.01) (Figure 2B).

Histological results obtained from the CA1 area The results showed that TUNEL positive cells in the CA1 area of the Hypo group were 13.39 ± 0.70, while they were Int J Vitam Nutr Res (2020), 90 (1–2), 156–168

160

M. Hosseini et al., Neuroprotective effect of Vit E in juvenile hypothyroid rat

(a)

(b)

Figure 2. Comparison of NO metabolites among the groups in (a) hippocampal and (b) cortical tissues; data are presented as mean ± SEM (n = 8 in each group). **P<0.01 and ***P<0.001 compared to the control group. +++P<0.001 compared to the Hypo group.

0.28 ± 0.19 (N/mm2) in the control group. The results also showed that hypothyroidism increased TUNEL positive cells in CA1 compared to those in the control group (P<0.001, Figure 3). The produced TUNEL positive cells in the Hypo-Vit E group were 8.20 ± 1.83 (N/mm2), which were lower than those in the Hypo group (P<0.01, Figure 3). In the CA1 area of the Hypo-Vit E group, TUNEL positive cells were higher than those in the control group (P<0.01, Figure 3).

Histological results obtained from the CA2 area The results showed that TUNEL positive cells in the CA2 area of the control, Hypo and Hypo-Vit E groups were 0.13 ± 0.13, 12.39 ± 1.26 and 9.88 ± 2.47 (N/mm2), respectively. The TUNEL positive cells in the Hypo group were higher than those in the control group (P<0.001, Figure 4). The TUNEL positive cells produced in the Hypo-Vit E group were also higher than those in the control group (P<0.01, Figure 4). However, there was no significant difference between the Hypo and Hypo-Vit E groups in this regard (Figure 4).

Histological results obtained from the CA3 area The results showed that TUNEL positive cells in the CA3 area of the control, Hypo and Hypo-Vit E groups were 0.15 ± 0.08, 6.50 ± 0.39 and 6.20 ± 0.95 (N/mm2), respectively. The number of TUNEL positive cells in the Hypo group was higher than that in the control group (P<0.001, Figure 5). The produced TUNEL positive cells in the Hypo-Vit E group were also higher than those in the control group (P<0.001, Figure 5). However, there was no Int J Vitam Nutr Res (2020), 90 (1–2), 156–168

significant difference in the number of TUNEL positive cells between the Hypo and Hypo-Vit E groups (P>0.05, Figure 5).

Histological results obtained from the DG area The results showed that TUNEL positive cells in the DG area of the control, Hypo and Hypo-Vit E groups were 0.66 ± 0.32, 15.27 ± 0.94 and 8.30 ± 2.14 (N/mm2), respectively. The number of TUNEL positive cells in the Hypo group was higher than that in the control group (P<0.001, Figure 6). The TUNEL positive cells produced in the Hypo-Vit E group were lower than those in the Hypo group (P<0.001, Figures 6). In addition, the number of TUNEL positive cells in the Hypo-Vit E group was higher than that in the control group (P<0.01, Figure 6).

Serum T4 level The results showed that PTU administration in juvenile rats induced a hypothyroidism status, which was presented as a low level of serum thyroxine in the Hypo group compared to the control group (P<0.001). Vit E was able to improve serum thyroxin level in the Hypo-Vit E group compared to the Hypo group (P<0.05); however, it was lower than that in the control group (P<0.001) (Figure 7).

Discussion The present study revealed a protective effect for Vit E against LTP impairment and neuronal apoptosis in the hippocampus of juvenile Hypo rats. Vit E also decreased NO metabolites in the brain tissues of Hypo rats. A thorough Ó 2019 Hogrefe

M. Hosseini et al., Neuroprotective effect of Vit E in juvenile hypothyroid rat

161

(a)

(b)

Figure 3. (a) Comparison of the number of TUNEL positive cells per area in the CA1 area among the groups; data are presented as mean ± SEM (n = 5 in each group). **P<0.01 and ***P<0.001 compared to the control group. ++P<0.01 compared to the Hypo group. (b) Photomicrographs showing TUNEL positive cells in the CA1 area of the rat hippocampus among the groups; arrows show apoptotic cells. CA1: Cornu Ammonis 1.

investigation of the literature revealed no research on the effects of Vit E on apoptosis and LTP impairments due to hypothyroidism so that its results could be compared with the results of the present study. However, several investigations have reported that Vit E administered to rodents prevented LTP impairment induced by lead or Vit E deficiency [60, 61]. It was also previously reported that Vit E reacted with the radicals to prevent neuronal apoptosis [62, 63]. It has been well documented that hypothyroidism disrupts hippocampal-dependent learning, short- and Ó 2019 Hogrefe

long-term memory, and early and late phases of LTP [17, 18]. Likewise, it has been shown that treatment of thyroidectomized rats with thyroxine improves LTP in the CA1 area of the hippocampus [64]. LTP is an activitydependent, long lasting synaptic plasticity procedure that occurs at the excitatory synapses [65]. This phenomenon is considered to be a model of the synaptic and cellular events, which may underlie memory formation [66]. In the present study, we found that hypothyroidism impaired LTP induction in CA1 synapses in rats, which Int J Vitam Nutr Res (2020), 90 (1–2), 156–168

162

M. Hosseini et al., Neuroprotective effect of Vit E in juvenile hypothyroid rat

(a)

(b)

Figure 4. (a) Comparison of the number of TUNEL positive cells per area in the CA2 area among the groups; data are presented as mean ± SEM (n = 5 in each group). **P<0.01 and ***P<0.001 compared to the control group. (b) Photomicrographs showing TUNEL positive cells in the CA2 area of the rat hippocampus among the groups; arrows show apoptotic cells. CA2: Cornu Ammonis 2.

was preventable by Vit E. The exact mechanism(s) underlying the LTP changes associated with hypothyroidism in the hippocampus has (have) not been well known. LTP impairments induced by hypothyroidism have also been hypothesized to be related to changes in the activity of NMDA (N-Methyl-D-aspartic acid) receptors [67, 68]. NMDA receptors play an important role in learning and memory [69, 70], and their activation is necessary for LTP induction in the DG and CA1 areas of the hippocampus [71, 72]. In fact, it has been observed that hypothyroidism Int J Vitam Nutr Res (2020), 90 (1–2), 156–168

decreases expression of the NR1 NMDA-receptor subunit [67], which may have a role in LTP impairment due to hypothyroidism, as was observed in the present study. On the other hand, it has been suggested that there is a relationship between NMDA receptors in the brain of rats and Vit E, such that NMDA receptor densities in the rat striatum are modified by chronic treatment with Vit E [73]. We found that administration of Vit E produced a marked improvement in LTP induction in the CA1 area in rats. Ó 2019 Hogrefe

M. Hosseini et al., Neuroprotective effect of Vit E in juvenile hypothyroid rat

163

(a)

(b)

Figure 5. (a) Comparison of the number of TUNEL positive cells per area in the CA3 area among the groups; data are presented as mean ± SEM (n = 5 in each group). ***P<0.001 compared to the control group. (b) Photomicrographs showing TUNEL positive cells in the CA3 area of the rat hippocampus among the groups; arrows show apoptotic cells. CA3: Cornu Ammonis 3.

The results of the present study also showed that hypothyroidism was followed by apoptosis in the hippocampus of rats. It has been well documented that neuronal apoptosis or death leads to LTP impairment [74, 75]. Therefore, an LTP impairment, which was seen in the present study, might be probably due to induction of apoptosis in the hippocampus of Hypo rats. Interestingly, it has been reported that hypothyroidism down-regulates expression of Bcl-2 and Bcl-xL, whereas Bax is up-regulated throughout the developmental period [14]. Huang et al. (2008) also demonstrated that thyroid hormones prevented apoptosis of hippocampal neurons through the up-regulation of Ó 2019 Hogrefe

Bcl-2 and down-regulation of Bax [7]. In the PTU induced hypothyroidism, pro-apoptotic Bax was up-regulated and anti-apoptotic Bcl-2 was down-regulated in the hippocampus [76]. In the present study TUNEL staining method was used to evaluate apoptosis in the hippocampal areas and further studies using cellular and molecular methods are suggested to determine the level of the proteins such as Bax and Bcl-2. In the present study, Vit E also prevented the increase of NO metabolites in both the hippocampal and cortical tissues of Hypo rats. The results of our study are consistent with the previous investigations, in which an elevated level Int J Vitam Nutr Res (2020), 90 (1–2), 156–168

164

M. Hosseini et al., Neuroprotective effect of Vit E in juvenile hypothyroid rat

(a)

(b)

Figure 6. (a) Comparison of the number of TUNEL positive cells per area in the DG area among the groups; data are presented as mean ± SEM (n = 5 in each group). **P<0.01 and ***P<0.001 compared to the control group. +++P<0.001 compared to the Hypo group. (b) Photomicrographs showing TUNEL positive cells in the DG area of the rat hippocampus among the groups; arrows show apoptotic cells. DG: Dentate Gyrus.

of NO in the hippocampal tissue of Hypo rats was confirmed to cause oxidative damage [59, 77]. On the other hand, free radicals and related molecules are often classified as reactive oxygen species (ROS) to signify their ability to produce oxidative changes within the tissues, mainly on lipids, proteins and nucleic acids, leading to subsequent cell death, apoptosis and LTP impairment [78, 79]. An elevation in NO level in the brain of Hypo rats has been previously reported to cause oxidative stress and neuronal damage [59, 77]. Under neurotoxic conditions, NO has been well known to cause oxidative damage through the formation of the highly reactive metabolite peroxynitrit [80]. Int J Vitam Nutr Res (2020), 90 (1–2), 156–168

Therefore, by reacting with superoxide, NO produces peroxynitrite, a powerful oxidant, which can damage many biological molecules [81, 82]. Moreover, NO induces a mitochondrial dysfunction due to damaging the complexes of the respiratory chain (complex I–III, II–III, and cytochrome c oxidase), which finally leads to more formation of superoxide radical [83, 84]. Therefore, an increased level of NO-induced ROS could be a factor to elucidate the oxidative damage observed in the brain tissue of Hypo rats. On the other hand, it was previously reported that α-tocopherol blocked glutamate induced cell death in cultured rat cortical neurons [85]. Moreover, α-tocopherol was Ó 2019 Hogrefe

M. Hosseini et al., Neuroprotective effect of Vit E in juvenile hypothyroid rat

9. Figure 7. (a) Comparison of serum thyroxin levels among the groups; data are presented as mean ± SEM (n = 8 in each group). ***P<0.001 compared to the control group. +P<0.05 compared to the Hypo group.

reported to inhibit oxidative stress-mediated cytotoxicity induced by (O2 ) or NO donor in cultured rat striatal neurons [86]. These survival effects were attributed to scavenging effects of oxygen radical species [85, 87]. Vit E has been well-known as a major antioxidant in biological systems acting as a powerful chain-breaking agent through the scavenging of peroxyl radicals [88]. Taking into account our ﬁndings, an oxidative stress status induced by NO might be involved in synaptic dysfunction and apoptosis related to hypothyroidism, which was prevented by Vit E as a well-known antioxidant. In conclusion, in this study, we provided evidence showing that NO can interrelate to affect synaptic plasticity and apoptosis in hippocampal tissue of Hypo rats, which is preventable by Vit E. Our results also suggest that Vit E supplementation might be a potent therapeutic agent for preventing neuronal damage due to hypothyroidism in juvenile rats. However, further studies are needed to be done to understand the exact mechanism of protective effect of Vit E in hypothyroid rat such as determination the level of the proteins such as Bax and Bcl-2.

10.

11.

12.

13.

14.

15.

16.

17.

18.

References 1. Singh, R., Upadhyay, G., & Godbole, M.M. (2003) Hypothyroidism alters mitochondrial morphology and induces release of apoptogenic proteins during rat cerebellar development. J Endocrinol. 176, 321–329. 2. Kobayashi, K., Tsuji, R., Yoshioka, T., Kushida, M., Yabushita, S., Sasaki, M., Mino, T., & Seki, T. (2005) Effects of hypothyroidism induced by perinatal exposure to PTU on rat behavior and synaptic gene expression. Toxicology. 212, 135–147. 3. Oppenheimer, J.H., & Schwartz, H.L. (1997) Molecular basis of thyroid hormone-dependent brain development. Endocr Rev. 18, 462–475. 4. Thompson, C.C., & Potter, G.B. (2000) Thyroid hormone action in neural development. Cereb Cortex. 10, 939–945. 5. Zoeller, T.R., Dowling, A.L.S., Herzig, C.T.A., Iannacone, E.A., Gauger, K.J., & Bansal, R. (2002) Thyroid hormone, brain Ó 2019 Hogrefe

19.

20.

21.

165

development, and the environment. Environ Health Perspect. 110, 355–361. Bernal, J., Guadaño-Ferraz, A., & Morte, B. (2003) Perspectives in the study of thyroid hormone action on brain development and function. Thyroid. 13, 1005–1012. Huang, X.W., Yin, H.M., Ji, C., Qin, Y.F., Yang, R.W., & Zhao, Z.Y. (2008) Effects of perinatal hypothyroidism on rat behavior and its relation with apoptosis of hippocampus neurons. J Endocrinol Invest. 31, 8–15. Gerges, N.Z., Alzoubi, K.H., Park, C.R., Diamond, D.M., & Alkadhi, K.A. (2004) Adverse effect of the combination of hypothyroidism and chronic psychosocial stress on hippocampus-dependent memory in rats. Behav Brain Res. 155, 77–84. Wilcoxon, J.S., Nadolski, G.J., Samarut, J., Chassande, O., & Redei, E.E. (2007) Behavioral inhibition and impaired spatial learning and memory in hypothyroid mice lacking thyroid hormone receptor α. Behav Brain Res. 177, 109–116. Correia, N., Mullally, S., Cooke, G., Tun, T.K., Phelan, N., Feeney, J., Fitzgibbon, M., Boran, G., O’Mara, S., & Gibney, J. (2009) Evidence for a specific defect in hippocampal memory in overt and subclinical hypothyroidism. J Clin Endocrinol Metab. 94, 3789–3797. Xiao, Q., & Nikodem, V.M. (1998) Apoptosis in the developing cerebellum of the thyroid hormone deficient rat. Front Biosci. 3, A52–57. Porterfield, S.P., & Hendrich, C.E. (1993) The role of thyroid hormones in prenatal and neonatal neurological development–current perspectives. Endocr Rev. 14, 94–106. Muller, Y., Rocchi, E., Lazaro, J.B., & Clos, J. (1995) Thyroid hormone promotes BCL-2 expression and prevents apoptosis of early differentiating cerebellar granule neurons. Int J Dev Neurosci. 13, 871–885. Singh, R., Upadhyay, G., Kumar, S., Kapoor, A., Kumar, A., Tiwari, M., & Godbole, M.M. (2003) Hypothyroidism alters the expression of Bcl-2 family genes to induce enhanced apoptosis in the developing cerebellum. J Endocrinol. 176, 39–46. Niemi, W.D., Slivinski, K., Audi, J., Rej, R., & Carpenter, D.O. (1996) Propylthiouracil treatment reduces long-term potentiation in area CA1 of neonatal rat hippocampus. Neurosci Lett. 210, 127–129. Gerges, N.Z., Stringer, J.L., & Alkadhi, K.A. (2001) Combination of hypothyroidism and stress abolishes early LTP in the CA1 but not dentate gyrus of hippocampus of adult rats. Brain Res. 922, 250–260. Gerges, N.Z., & Alkadhi, K.A. (2004) Hypothyroidism impairs late LTP in CA1 region but not in dentate gyrus of the intact rat hippocampus: MAPK involvement. Hippocampus. 14, 40–45. Gerges, N.Z., Alzoubi, K.H., Park, C.R., Diamond, D.M., & Alkadhi, K.A. (2004) Adverse effect of the combination of hypothyroidism and chronic psychosocial stress on hippocampus-dependent memory in rats. Behav Brain Res. 155, 77–84. Alzoubi, K.H., Gerges, N.Z., & Alkadhi, K.A. (2005) Levothyroxin restores hypothyroidism-induced impairment of LTP of hippocampal CA1: electrophysiological and molecular studies. Exp Neurol. 195, 330–341. Gerges, N.Z., Alzoubi, K.H., & Alkadhi, K.A. (2005) Role of phosphorylated CaMKII and calcineurin in the differential effect of hypothyroidism on LTP of CA1 and dentate gyrus. Hippocampus. 15, 480–490. Huang, Y.Y., Kandel, E.R., Varshavsky, L., Brandon, E.P., Qi, M., Idzerda, R.L., McKnight, G.S., & Bourtchouladze, R. (1995) A genetic test of the effects of mutations in PKA on mossy fiber LTP and its relation to spatial and contextual learning. Cell. 83, 1211–1222.

Int J Vitam Nutr Res (2020), 90 (1–2), 156–168

166

M. Hosseini et al., Neuroprotective effect of Vit E in juvenile hypothyroid rat

22. Vara, H., Munoz-Cuevas, J., & Colino, A. (2003) Age-dependent alterations of long-term synaptic plasticity in thyroiddeficient rats. Hippocampus. 13, 816–825. 23. Jeffery, K.J. (1997) LTP and spatial learning – Where to next? Hippocampus. 7, 95–110. 24. Shors, T.J., & Matzel, L.D. (1997) Long-term potentiation: what’s learning got to do with it? Behav Brain Sci. 20, 597–614. discussion 614-555. 25. Flora, S.J.S. (2002) Nutritional components modify metal absorption, toxic response and chelation therapy. J Nutr Environ Med. 12, 53–67. 26. Traber, M.G., & Packer, L. (1995) Vitamin E: beyond antioxidant function. Am J Clin Nutr. 62, 1501S–1509S. 27. Liebler, D.C. (1993) The role of metabolism in the antioxidant function of vitamin E. Crit Rev Toxicol. 23, 147–169. 28. Zingg, J.M. (2007) Vitamin E: an overview of major research directions. Mol Aspects Med. 28, 400–422. 29. El-Shenawy, N.S., MS, A.L.-H., & Hamza, R.Z. (2015) Effect of vitamin E and selenium separately and in combination on biochemical, immunological and histological changes induced by sodium azide in male mice. Exp Toxicol Pathol. 67, 65–76. 30. Stampfer, M.J., Hennekens, C.H., Manson, J.E., Colditz, G.A., Rosner, B., & Willett, W.C. (1993) Vitamin E consumption and the risk of coronary disease in women. N Engl J Med. 328, 1444–1449. 31. Brigelius-Flohé, R., & Traber, M.G. (1999) Vitamin E: function and metabolism. The FASEB Journal. 13, 1145–1155. 32. Packer, L., Weber, S.U., & Rimbach, G. (2001) Molecular aspects of alpha-tocotrienol antioxidant action and cell signalling. J Nutr. 131, 369s–373s. 33. Tuzcu, M., & Baydas, G. (2006) Effect of melatonin and vitamin E on diabetes-induced learning and memory impairment in rats. Eur J Pharmacol. 537, 106–110. 34. Fukui, K., Onodera, K., Shinkai, T., Suzuki, S., & Urano, S. (2001) Impairment of learning and memory in rats caused by oxidative stress and aging, and changes in antioxidative defense systems. Ann N Y Acad Sci. 928, 168–175. 35. Rahaman, S.O., Ghosh, S., Mohanakumar, K.P., Das, S., & Sarkar, P.K. (2001) Hypothyroidism in the developing rat brain is associated with marked oxidative stress and aberrant intraneuronal accumulation of neurofilaments. Neurosci Res. 40, 273–279. 36. Bhanja, S., & Jena, S. (2013) Modulation of antioxidant enzyme expression by PTU-induced hypothyroidism in cerebral cortex of postnatal rat brain. Neurochem Res. 38, 42–49. 37. Takatsu, H., Owada, K., Abe, K., Nakano, M., & Urano, S. (2009) Effect of vitamin E on learning and memory deficit in aged rats. J Nutr Sci Vitaminol (Tokyo). 55, 389–393. 38. Fukui, K., Takatsu, H., Shinkai, T., Suzuki, S., Abe, K., & Urano, S. (2005) Appearance of amyloid beta-like substances and delayed-type apoptosis in rat hippocampus CA1 region through aging and oxidative stress. J Alzheimers Dis. 8, 299–309. 39. Deng, S., Hou, G., Xue, Z., Zhang, L., Zhou, Y., Liu, C., Liu, Y., & Li, Z. (2015) Vitamin E isomer delta-tocopherol enhances the efficiency of neural stem cell differentiation via L-type calcium channel. Neurosci Lett. 585, 166–170. 40. Zaidi, S.M., & Banu, N. (2004) Antioxidant potential of vitamins A, E and C in modulating oxidative stress in rat brain. Clin Chim Acta. 340, 229–233. 41. Saadati, H., Sheibani, V., Esmaeili-Mahani, S., Hajali, V., & Mazhari, S. (2014) Prior regular exercise prevents synaptic plasticity impairment in sleep deprived female rats. Brain Res Bull. 108, 100–105.

Int J Vitam Nutr Res (2020), 90 (1–2), 156–168

42. Piao, M.H., Liu, Y., Wang, Y.S., Qiu, J.P., & Feng, C.S. (2013) Volatile anesthetic isoflurane inhibits LTP induction of hippocampal CA1 neurons through alpha4beta2 nAChR subtype-mediated mechanisms. Ann Fr Anesth Reanim. 32, e135–141. 43. Sadeghian, R., Fereidoni, M., Soukhtanloo, M., Azizi-Malekabadi, H., & Hosseini, M. (2012) Decreased nitric oxide levels in the hippocampus may play a role in learning and memory deficits in ovariectomized rats treated by a high dose of estradiol. Arq Neuropsiquiatr. 70, 874–879. 44. Azizi-Malekabadi, H., Hosseini, M., Soukhtanloo, M., Sadeghian, R., Fereidoni, M., & Khodabandehloo, F. (2012) Different effects of scopolamine on learning, memory, and nitric oxide metabolite levels in hippocampal tissues of ovariectomized and Sham-operated rats. Arq Neuropsiquiatr. 70, 447–452. 45. Hosseini, M., Harandizadeh, F., Niazmand, S., Soukhtanloo, M., Faizpour, A., & Ghasemabady, M. (2014) The role for nitric oxide on the effects of hydroalcoholic extract of Achillea wilhelmsii on seizure. Avicenna J Phytomed. 4, 251–259. 46. Ebrahimzadeh Bideskan, A., Mohammadipour, A., Fazel, A., Haghir, H., Rafatpanah, H., Hosseini, M., & Rajabzadeh, A. (2017) Maternal exposure to titanium dioxide nanoparticles during pregnancy and lactation alters offspring hippocampal mRNA BAX and Bcl-2 levels, induces apoptosis and decreases neurogenesis. Exp Toxicol Pathol. 69, 329–337. 47. Ebrahimzadeh Bideskan, A.R., Lale Ataei, M., Mansouri, S., & Hosseini, M. (2015) The effects of tamoxifen and soy on dark neuron production in hippocampal formation after pentylenetetrazole-induced repeated seizures in rats. Pathophysiology. 22, 125–135. 48. Ebrahimzadeh-Bideskan, A.R., Mansouri, S., Ataei, M.L., Jahanshahi, M., & Hosseini, M. (2018) The effects of soy and tamoxifen on apoptosis in the hippocampus and dentate gyrus in a pentylenetetrazole-induced seizure model of ovariectomized rats. Anat Sci Int. 93, 218–230. 49. Karimzadeh, F., Hosseini, M., Mangeng, D., Alavi, H., Hassanzadeh, G.R., Bayat, M., Jafarian, M., Kazemi, H., & Gorji, A. (2012) Anticonvulsant and neuroprotective effects of Pimpinella anisum in rat brain. BMC Complement Altern Med. 12, 76. 50. Asiaei, F., Fazel, A., Rajabzadeh, A.A., Hosseini, M., Beheshti, F., & Seghatoleslam, M. (2017) Neuroprotective effects of Nigella sativa extract upon the hippocampus in PTU-induced hypothyroidism juvenile rats: A stereological study. Metab Brain Dis. 32, 1755–1765. 51. Seghatoleslam, M., Alipour, F., Shafieian, R., Hassanzadeh, Z., Edalatmanesh, M.A., Sadeghnia, H.R., & Hosseini, M. (2016) The effects of Nigella sativa on neural damage after pentylenetetrazole induced seizures in rats. J Tradit Complement Med. 6, 262–268. 52. Mansouri, S., Ataei, M.L., Hosseini, M., & Bideskan, A.R. (2013) Tamoxifen mimics the effects of endogenous ovarian hormones on repeated seizures induced by pentylenetetrazole in rats. Exp Neurobiol. 22, 116–123. 53. Baghcheghi, Y., Hosseini, M., Beheshti, F., Salmani, H., & Anaeigoudari, A. (2018) Thymoquinone reverses learning and memory impairments and brain tissue oxidative damage in hypothyroid juvenile rats. Arq Neuropsiquiatr. 76, 32–40. 54. Khordad, E., Alipour, F., Beheshti, F., Hosseini, M., Rajabzadeh, A.A., Asiaei, F., & Seghatoleslam, M. (2017) Vitamin C prevents hypothyroidism associated neuronal damage in the hippocampus of neonatal and juvenile rats: A stereological study. J Chem Neuroanat. 55. Beheshti, F., Karimi, S., Vafaee, F., Shafei, M.N., Sadeghnia, H.R., Hadjzadeh, M.A.R., & Hosseini, M. (2017) The effects of

Ó 2019 Hogrefe

M. Hosseini et al., Neuroprotective effect of Vit E in juvenile hypothyroid rat

56.

57.

58.

59.

60.

61.

62.

63.

64.

65.

66.

67.

68.

69.

70.

vitamin C on hypothyroidism-associated learning and memory impairment in juvenile rats. Metab Brain Dis. 32, 703–715. Beheshti, F., Hosseini, M., Shafei, M.N., Soukhtanloo, M., Ghasemi, S., Vafaee, F., & Zarepoor, L. (2017) The effects of Nigella sativa extract on hypothyroidism-associated learning and memory impairment during neonatal and juvenile growth in rats. Nutr Neurosci. 20, 49–59. Baghcheghi, Y., Beheshti, F., Shafei, M.N., Salmani, H., Sadeghnia, H.R., Soukhtanloo, M., Anaeigoudari, A., & Hosseini, M. (2017) The effects of vitamin E on brain derived neurotrophic factor, tissues oxidative damage and learning and memory of juvenile hypothyroid rats. Metab Brain Dis. Baghcheghi, Y., Beheshti, F., Salmani, H., Soukhtanloo, M., & Hosseini, M. (2016) Protective effect of PPARgamma agonists on cerebellar tissues oxidative damage in hypothyroid rats. Neurol Res Int. 2016, 1952561. Hosseini, M., Dastghaib, S.S., Rafatpanah, H., Hadjzadeh, M.A., Nahrevanian, H., & Farrokhi, I. (2010) Nitric oxide contributes to learning and memory deficits observed in hypothyroid rats during neonatal and juvenile growth. Clinics (Sao Paulo). 65, 1175–1181. Xie, Z., & Sastry, B.R. (1995) Impairment of long-term potentiation in rats fed with vitamin E-deficient diet. Brain Res. 681, 193–196. Salehi, I., Karamian, R., Komaki, A., Tahmasebi, L., Taheri, M., Nazari, M., Shahidi, S., & Sarihi, A. (2015) Effects of vitamin E on lead-induced impairments in hippocampal synaptic plasticity. Brain Res. 1629, 270–281. Tagami, M., Yamagata, K., Ikeda, K., Nara, Y., Fujino, H., Kubota, A., Numano, F., & Yamori, Y. (1998) Vitamin E prevents apoptosis in cortical neurons during hypoxia and oxygen reperfusion. Lab Invest. 78, 1415–1429. Ho, F.Y.F., Tsang, W.P., & Kwok, T.T. (2006) Antioxidant suppression of apoptosis induction by reoxygenation after chronic hypoxia in human hepatocellular HepG2 cells. Cancer Res. 66, 954–955. Alzoubi, K.H., Gerges, N.Z., Aleisa, A.M., & Alkadhi, K.A. (2009) Levothyroxin restores hypothyroidism-induced impairment of hippocampus-dependent learning and memory: Behavioral, electrophysiological, and molecular studies. Hippocampus. 19, 66–78. Subramaniyan, S., Hajali, V., Scherf, T., Sase, S.J., Sialana, F.J., Groger, M., Bennett, K.L., Pollak, A., Li, L., Korz, V. & Lubec, G. (2015) Hippocampal receptor complexes paralleling LTP reinforcement in the spatial memory holeboard test in the rat. Behav Brain Res. 283, 162–174. Bliss, T.V., & Lomo, T. (1973) Long-lasting potentiation of synaptic transmission in the dentate area of the anaesthetized rabbit following stimulation of the perforant path. J Physiol. 232, 331–356. Lee, P.R., Brady, D., & Koenig, J.I. (2003) Thyroid hormone regulation of N-methyl-D-aspartic acid receptor subunit mRNA expression in adult brain. J Neuroendocrinol. 15, 87–92. Alva-Sanchez, C., Becerril, A., Anguiano, B., Aceves, C., & Pacheco-Rosado, J. (2009) Participation of NMDA-glutamatergic receptors in hippocampal neuronal damage caused by adultonset hypothyroidism. Neurosci Lett. 453, 178–181. File, S.E., Fluck, E., & Fernandes, C. (1999) Beneficial effects of glycine (bioglycin) on memory and attention in young and middle-aged adults. J Clin Psychopharmacol. 19, 506–512. Palmer, C., Ellis, K.A., O’Neill, B.V., Croft, R.J., Leung, S., Oliver, C., Wesnes, K.A., & Nathan, P.J. (2008) The cognitive effects of modulating the glycine site of the NMDA receptor with highdose glycine in healthy controls. Hum Psychopharmacol. 23, 151–159.

Ó 2019 Hogrefe

167

71. Platt, B., Carpenter, D.O., Busselberg, D., Reymann, K.G., & Riedel, G. (1995) Aluminum impairs hippocampal long-term potentiation in rats in vitro and in vivo. Exp Neurol. 134, 73–86. 72. Zhuo, M. (2003) Synaptic and molecular mechanisms of glutamatergic synapses in pain and memory. Sheng Li Xue Bao. 55, 1–8. 73. Martinez-Villayandre, B., Paniagua, M.A., Fernandez-Lopez, A., & Calvo, P. (2006) Effect of delta-aminolevulinic acid and vitamin E treatments on the N-methyl-D-aspartate receptor at different ages in the striatum of rat brain. Brain Res. 1114, 19–23. 74. Martin, D.S., Lonergan, P.E., Boland, B., Fogarty, M.P., Brady, M., Horrobin, D.F., Campbell, V.A., & Lynch, M.A. (2002) Apoptotic changes in the aged brain are triggered by interleukin-1beta-induced activation of p38 and reversed by treatment with eicosapentaenoic acid. J Biol Chem. 277, 34239–34246. 75. Liu, M.C., Liu, X.Q., Wang, W., Shen, X.F., Che, H.L., Guo, Y.Y., Zhao, M.G., Chen, J.Y., & Luo, W.J. (2012) Involvement of microglia activation in the lead induced long-term potentiation impairment. PLoS One. 7, e43924. 76. Zhang, L., Blomgren, K., Kuhn, H.G., & Cooper-Kuhn, C.M. (2009) Effects of postnatal thyroid hormone deficiency on neurogenesis in the juvenile and adult rat. Neurobiol Dis. 34, 366–374. 77. Cano-Europa, E., Perez-Severiano, F., Vergara, P., OrtizButron, R., Rios, C., Segovia, J., & Pacheco-Rosado, J. (2008) Hypothyroidism induces selective oxidative stress in amygdala and hippocampus of rat. Metab Brain Dis. 23, 275–287. 78. Evans, P.H. (1993) Free radicals in brain metabolism and pathology. Br Med Bull. 49, 577–587. 79. De Felice, F.G., Velasco, P.T., Lambert, M.P., Viola, K., Fernandez, S.J., Ferreira, S.T., & Klein, W.L. (2007) Abeta oligomers induce neuronal oxidative stress through an N-methyl-D-aspartate receptor-dependent mechanism that is blocked by the Alzheimer drug memantine. J Biol Chem. 282, 11590–11601. 80. Baraona, E., Zeballos, G.A., Shoichet, L., Mak, K.M., & Lieber, C.S. (2002) Ethanol consumption increases nitric oxide production in rats, and its peroxynitrite-mediated toxicity is attenuated by polyenylphosphatidylcholine. Alcohol Clin Exp Res. 26, 883–889. 81. Chabrier, P.E., Demerle-Pallardy, C., & Auguet, M. (1999) Nitric oxide synthases: targets for therapeutic strategies in neurological diseases. Cell Mol Life Sci. 55, 1029–1035. 82. Jonnala, R.R., & Buccafusco, J.J. (2001) Inhibition of nerve growth factor signaling by peroxynitrite. J Neurosci Res. 63, 27–34. 83. Franco, M.C., Antico Arciuch, V.G., Peralta, J.G., Galli, S., Levisman, D., Lopez, L.M., Romorini, L., Poderoso, J.J., & Carreras, M.C. (2006) Hypothyroid phenotype is contributed by mitochondrial complex I inactivation due to translocated neuronal nitric-oxide synthase. J Biol Chem. 281, 4779–4786. 84. Venditti, P., & Meo, S.D. (2006) Thyroid hormone-induced oxidative stress. Cell Mol Life Sci. 63, 414–434. 85. Khanna, S., Roy, S., Ryu, H., Bahadduri, P., Swaan, P.W., Ratan, R.R., & Sen, C.K. (2003) Molecular basis of vitamin E action: tocotrienol modulates 12-lipoxygenase, a key mediator of glutamate-induced neurodegeneration. J Biol Chem. 278, 43508–43515. 86. Jolitha, A.B., Subramanyam, M.V., & Asha Devi, S. (2006) Modification by vitamin E and exercise of oxidative stress in regions of aging rat brain: studies on superoxide dismutase isoenzymes and protein oxidation status. Exp Gerontol. 41, 753–763.

Int J Vitam Nutr Res (2020), 90 (1–2), 156–168

168

M. Hosseini et al., Neuroprotective effect of Vit E in juvenile hypothyroid rat

87. Johnson, R.A., & Mitchell, G.S. (2003) Exercise-induced changes in hippocampal brain-derived neurotrophic factor and neurotrophin-3: effects of rat strain. Brain Res. 983, 108–114. 88. Beyer, R.E. (1994) The role of ascorbate in antioxidant protection of biomembranes: interaction with vitamin E and coenzyme Q. J Bioenerg Biomembr. 26, 349–358. Acknowledgments The authors would like to thank the Vice President of Research in Mashhad University of Medical Sciences for providing financial support.

Int J Vitam Nutr Res (2020), 90 (1–2), 156–168

Conflict of interest The authors declare no conflict of interest. Mahmoud Hosseini, PhD Division of Neurocognitive Sciences Psychiatry and Behavioral Sciences Research Center Mashhad University of Medical Sciences, Mashhad, Iran hosseinim@mums.ac.ir

Ó 2019 Hogrefe

Review

Thylakoids: A Novel Food-Derived Supplement for Obesity – A Mini-Review Sahar Foshati and Maryam Ekramzadeh Nutrition and Food Sciences Research Center, Department of Clinical Nutrition, School of Nutrition and Food Sciences, Shiraz University of Medical Sciences, Shiraz, Iran Received: December 12, 2016; Accepted: March 9, 2017

Abstract: Nowadays, overweight and obesity are major epidemic health problems that can bring about some other health issues such as cardiovascular disease which is the first cause of mortality worldwide. Thylakoids are disc-like membranes responsible for photosynthetic light reactions in chloroplasts of green plants. Although only a few animal and human studies have been conducted regarding the impact of thylakoids on overweight- and obesity-related factors, all of them have resulted in positive outcomes. These outcomes are as follows: increment of satiety response; suppression of hunger sensations, particularly hedonic hunger; reduction of body weight and fat; promotion of glucose homeostasis; decrease in serum lipids; attenuation of oxidative stress and inflammation; and modulation of gut microbiota, notably by increasing some helpful bacteria such as Lactobacillus reuteri. It seems that some of these useful effects are related to retarded absorption of dietary fat and carbohydrate caused by thylakoids. There is still a need for more well-designed studies. Keywords: Appetite, Dietary supplements, Obesity, Overweight, Thylakoids

Introduction Overweight and obesity are defined as abnormal or excessive fat accumulation that have recently received attention as a major pandemic health problem [1]. Simply, these two conditions are the consequences of imbalance between food intake and energy consumption [2]. Many intrinsic and extrinsic factors such as environmental, behavioral, psychological, hormonal and genetic ones have contributed to the disturbance of the mentioned balance. That is why keeping this balance has become much more harder these days [3]. Overweight and obesity can lead to number of other health issues such as coronary heart disease, high blood pressure, abnormal lipid profile, type 2 diabetes, metabolic syndrome, stroke, renal damage, cancer, osteoarthritis, obesity hypoventilation syndrome, sleep apnea, gallstones, reproductive disorders, and depression [4, 5]. In fact, excessive weight is the sixth most significant universal risk factor for all causes of mortality and morbidity [6]. According to the World Health Organization, 39% and 13% of the world’s adult population aged 18 years and older were overweight and obese in 2014, respectively [7]. Both developed and developing countries are suffering from these two diseases [8]. As an example of developing nation, Ó 2019 Hogrefe

the prevalence of overweight and obesity in Iranian adults has lately been reported to be 27.0%–38.5% and 21.7%, respectively [9, 10]. Depending on the degree of overweight and obesity, different weight loss strategies are used. Lifestyle modification, pharmacotherapy, nutraceutical supplements, and bariatric surgery are the main ways to treat these conditions [11, 12]. Konjac root fiber, green tea, capsaicin, conjugated linoleic acids, common beans, hydroxycitric acid, and Veldt grape are instances of weight loss nutraceuticals [13]. Recently, thylakoids have also been added to this nutraceutical list. In this article, we briefly described thylakoids and reviewed studies which have evaluated their impact on weight management and obesity-related factors. It is necessary to point out that systematic searches were conducted in order to find related publications. Multiple databases including PubMed, ScienceDirect, Google Scholar, Scopus, Web of Science, Scientific Information Database, Magiran, and IranMedex were searched from inception to the end of August 2016. This search was limited to English- and Persian-language published articles, but no other restrictions were imposed. The search terms used were “thylakoids” and “obesity” or “overweight” as well as their equivalents in Persian. In PubMed, the above search terms were entered Int J Vitam Nutr Res (2020), 90 (1–2), 169–178 https://doi.org/10.1024/0300-9831/a000556

170

as both medical subject headings (MeSH) and text words. After completing the research process, all relevant human and animal studies were selected for inclusion in the overview. In this mini-review, we also looked at the mechanisms of action of thylakoids.

M. Ekramzadeh et al., Thylakoids in Management of Obesity

effects such as steatorrhea [23]. Further beneficial features of them will be discussed in greater detail in the following sections.

Animal studies Thylakoids Around 1950s, thylakoids were discovered, and their 3D structures were identified. Wilhelm Menke was the person who introduced the name “thylakoid” which means sac or pouch like [14]. Thylakoids are little disc-shaped structures responsible for photosynthetic light reactions in chloroplasts of green plants. Each one of these tiny compartments has a membrane and an aqueous area called lumen. In higher plants, thylakoids make a stack which is known as a granum. Multiple grana are adjoined by intergranal or stroma thylakoids, also referred to as lamellae [15]. Although several decades have passed since the discovery of thylakoids, their potential health benefits have recently become an interest of researchers working on obesity-related issues. Thylakoids consist of proteins, phospholipids, galactolipids, vitamins, and certain pigments and antioxidants like chlorophylls, flavonoids and carotenoids. The main thylakoids’ sources are dark green leafy vegetables [16]. Particularly, spinach (Spinacia oleracea) is the most frequently used source to prepare thylakoid membranes, maybe because it is widely available and famous as a health-promoting food [17–19]. In addition to these presumptive reasons, the high chlorophyll content of spinach suggests the probability of ranking it among the highest thylakoid-containing plant foods [20, 21]. Nevertheless, no published study has yet measured the thylakoid content of various green leafy vegetables to certainly prove or disprove the aforementioned idea. Besides being a nutritious supplement, thylakoids have some other special properties that make them unique among weight loss nutraceuticals. They have hydrophobic characteristics and an isoelectric pH of 4.7 [22]. Apparently, these two key attributes make thylakoids adhere to lipids as well as some enzymes and luminal mucosal surfaces in the gastrointestinal tract [23]. Thylakoids are also capable of reducing intestinal macromolecular permeability which is a complicated multifactorial problem highlighted in obese patients [24, 25]. Moreover, they are resistant to degradation by gastric and pancreatic enzymes that allows longer persistence of their advantageous effects [26]. In spite of their good resistance, digestive enzymes gradually and completely degrade thylakoids after several hours. This trait easily makes thylakoids unparalleled to other lipase inhibitors in terms of not causing gastrointestinal side Int J Vitam Nutr Res (2020), 90 (1–2), 169–178

Different animal studies on the effect of thylakoids were conducted in mice, rats and pigs. In all of these researches, the oral administration of thylakoids has shown to be fruitful on body weight status and metabolic parameters [18, 27–32]. These plant compartments have mainly led to a decrease in both food intake and subsequent weight gain of the experimental mice and rats [18, 27, 28, 30, 32]. As a potential appetite suppressant, thylakoids have been shown to increase the satiety hormone cholecystokinin (CCK) in blood serum or plasma samples of rats, mice and pigs and reduce the hunger hormone ghrelin in pigs’ blood plasma samples [27, 28, 31]. Nevertheless, it seems anorexic properties of thylakoids are not relevant to the satiating role of peptide YY (PYY) [33]. Serum levels of PYY were reported to remain statistically unaffected after a long-term period of treatment with thylakoids [28]. A decrement in leptin levels, an indicator of adipose tissue mass, occurred after 100 days of intervention with thylakoids in female apolipoprotein E-deficient mice [28, 34]. Even in different animal models with high fat diets, dual energy X-ray analysis demonstrated substantial body fat reduction in female mice treated with thylakoids [18, 28]. Although it was not statistically significant, more body fat reduction was observed in a high fat diet enriched with thylakoids in comparison to a low fat diet without thylakoids [18]. Furthermore, thylakoid consumption has brought about an improvement in other metabolic factors like glucose, insulin and lipid profile in all types of animals under study [27–31]. Thylakoids have been shown to significantly increase protein expression and enzymatic activities of pancreatic lipase and colipase in rats, mice and pigs. This consequence has been considered as a compensatory response to the prolonged and retarded process of fat digestion caused by these membranous sacs [27–29]. Indeed, the majority of animal studies have focused on retarding properties of thylakoids in the fat digestion series as a chief reason for producing various beneficial effects [18, 27–29, 31]. Only a small number of studies have investigated other pathways and found their prebiotic and enzyme-enhancing functions in Sprague– Dawley rats [30, 32]. New influential routes and unknown aspects of thylakoids may also be revealed by performing more scientific experiments in future. As an example, obesity-related genes may be a potential focus for further investigation regarding the effects of these membrane-bound Ó 2019 Hogrefe

M. Ekramzadeh et al., Thylakoids in Management of Obesity

compartments. In the same way, thylakoids’ impacts on predictive factors of developing obesity-related diseases such as levels of adipocytokines and inflammatory and oxidative stress markers can be an interesting topic for future studies. One animal study measured some enzyme activities in tissues of liver and muscle. Surprisingly, this research showed increased levels of alanine aminotransferase and aspartate aminotransferase in rats that were fed with thylakoids [32]. Elevation of these two enzymes can be a sign of hepatic and/or muscular toxicity [35]. Nevertheless, the researchers of this animal study simply rejected the possibility of any kind of damage and stated that these effects were non-toxic. From our point of view, more caution should be taken in this regard [32]. More investigation including histopathological examination of liver and muscle is desirable for better evaluation and clarification. All animal studies are summarized in Table 1.

Human studies Some innovative and elaborate human studies were performed within the scope of thylakoids’ efficacy. Their results are nearly consistent with the animal studies. Satiety promoting and appetite suppressing effects of thylakoids are even more evident in human studies [36–42]. Feelings of fullness and three known satiety effectors including CCK, glucagon-like peptide-1 (GLP-1) and leptin have been demonstrated to increase after intake of single meals enriched with thylakoids [36–39, 41, 42]. On the other hand, leptin levels have decreased after about two-month supplementation with thylakoids. This reduction can be a result of a statistically non-significant more loss in total body fat of the intervention group, especially from the hip area, compared with that of the control group [40]. It is also intriguing that ghrelin levels, hunger sensations, urges for palatable foods, and prospective intake have been observed to decline in clinical trials of this new nutraceutical with different lengths of supplementation, ranging from single meals up to three months [36–42]. Through these satiety- and appetite-related actions, thylakoids keep the body weight from creeping up and accelerate its reduction over time, as occurred after 90 days of supplementation with 5 grams of thylakoids [38–40]. Encouraging alterations have further happened in some other serum metabolic parameters, notably lipid profile [36–40]. Serum concentrations of total cholesterol, low density lipoprotein cholesterol and apolipoprotein B1 have been documented to decrease after about two to three months of thylakoid supplementation. During this period, a 30- or 60-min/day exercise program of low- to Ó 2019 Hogrefe

171

moderate-intensity as well as a three-meal diet containing large quantities of vegetables and fruits or a 1800 kcal/day meal plan were followed along with supplementation [38– 40]. Contrary to the aforementioned consistent outcomes, serum concentrations of glucose and insulin have produced conflicting results in several occasions. Some researchers thought that the carbohydrate content of eaten meals can be responsible for such conflict in the studies [36–41]. Very little and non-significant decrement in hemoglobin A1c has also been indicated after 56 days of supplementation [40]. To remove hesitations and contradictions, it is much better to test thylakoids’ impacts on glucose-related variables in diabetic patients who are more susceptible to subtle changes of these markers. Aside from the mentioned findings, one study examined the effect of consuming a single dose of thylakoids on high-sensitivity C-reactive protein (hs-CRP) and reported no differences between intervention and control groups [41]. To best of our knowledge, hs-CRP usually requires more time to be significantly affected [43]. Hence, performing longer-term trials is essential. An optimum dosage of thylakoids for achieving the most health benefits and the least possible side effects has not yet been established. According to results of one study, nondelipidated thylakoids showed more positive consequences in comparison with the same dosage of delipidated ones that lack membrane lipids and pigments [36]. The probable explanation for this finding is that delipidated thylakoids are more readily degraded by gastrointestinal enzymes, as it was previously demonstrated [26]. Based on these data, we can note that non-delipidated thylakoids are seemingly a better supplement choice. In order to find an appropriate dosage for thylakoid supplementation, attempting to draw dose-response curves for its different effects seems a wise step. It is good to know that the optimal satiety response of CCK has occurred after intake of 25 grams of these green-plant membranes. In contrast, reduction in serum levels of free fatty acids, the pivotal outcome in preventing common obesity-related conditions, has only been seen after consuming 50 grams of them. These two statistically significant changes have taken place around 4 hours after ingestion of the aforementioned single doses of thylakoids with a high fat meal [36, 44]. Another interesting point is that although a marked decrease in concentrations of circulating triglycerides has been recorded in animal studies, a proper dosage that can reveal this impact on humans has not been found until now [27, 28, 38–41]. Despite all the above issues, thylakoids still work efficiently in terms of some aspects such as weight loss at low doses like 5 grams [37–42]. Another important issue that needs to be discussed is the possible side effects of thylakoids. The good news is that no adverse events or effects so far have been reported in most of the human studies [37–40]. Nevertheless, mild cases of Int J Vitam Nutr Res (2020), 90 (1–2), 169–178

Int J Vitam Nutr Res (2020), 90 (1–2), 169–178

16 female Sprague–Dawley rats weighing 200 gr

30 female apolipoprotein Edeficient mice

9 female NMRI mice weighing 28–30 gr

5 castrated male pigs weighing 13.2 ± 0.3 kg

16 specific pathogen free Sprague-Dawley rats

6 crossbred pigs weighing 13.7 ± 1.1 kg

12 male Sprague–Dawley rats weighing 180–200 g

P.-Å. Albertsson et al. (2007) [27]

R. Köhnke et al. (2009) [28]

S. C. Emek et al. (2010) [18]

R. Köhnke et al. (2010) [29]

C. Montelius et al. (2013) [30]

C. Montelius et al. (2014) [31]

D. Masih et al. (2016) [32]

Feeding a high fat diet containing 36% fat to pigs for 1 month and then performing OGTT (1 g/kg D-glucose) with or without supplementation of 0.5 g/kg body weight of thylakoids in a crossover design Feeding a standard food pellets with a suspension of thylakoids at a dose of 0.5 g/kg body weight to the experimental group for 4 days

Feeding a standard rat chow enriched with a thylakoid– rapeseed oil suspension at a concentration of 6 mg chlorophyll/g of normal food intake to the experimental group for 10 days

Feeding a high fat diet containing 42.1% fat with purified thylakoids at a concentration of 2 mg chlorophyll/g of food to the experimental group for 13 days Feeding a high fat diet containing 41% fat with thylakoids at a concentration of 6 mg chlorophyll/g of diet to the experimental group for 100 days Feeding a low fat diet containing standard mouse chow to the 1st group, a high fat diet containing 63% fat to the 2nd group and the same high fat diet with crude thylakoids at a concentration of 6 mg chlorophyll/g of food to the 3rd group for 32 days Feeding a high fat meal containing 20% fat with and without 10% thylakoid powder in a crossover design

Intervention

M food intake, ; body weight gain, " activities of G6PDH, LDH, SDH & ALT in both liver & muscles, " activities of MDH & AST in muscles

; food intake, M body weight gain, M faecal fat, ; insulin, M glucose, " Lactobacilli specifically Lactobacillus reuteri on the ileal mucosa, ; Lactobacillus johnsonii on the ileal & colon mucosa, M bifidobacteria, M Enterobacteriaceae, M Bacteroides ; glucose, M insulin, " CCK, ; ghrelin

" pancreatic lipase and colipase activity, M CCK, M glucose, ; insulin

; food intake, ; body weight gain, ; body fat, ; FFA, ; TG, ; glucose, M cholesterol, " pancreatic lipase activity, " CCK, ; leptin, M PYY M food intake in three groups, ; body weight gain in the 3rd group compared with the other two groups, ; body fat in the 3rd group compared with the 2nd group

; food intake, ; body weight gain, ; TG, " pancreatic lipase protein expression, " lipase/colipase activity, " CCK

Main findings

; = decrease, " = increase, M = no differences, ALT = alanine aminotransferase, AST = aspartate aminotransferase, CCK = cholecystokinin, FFA = free fatty acids, G6PDH = glucose-6-phosphate dehydrogenase, LDH = lactate dehydrogenase, MDH = malate dehydrogenase, OGTT = oral glucose tolerance test, PYY = peptide YY, SDH = succinate dehydrogenase, TG = triglycerides

Sample

Study

Table 1. Summary of animal studies on the effects of thylakoids on overweight- and obesity-related parameters.

172 M. Ekramzadeh et al., Thylakoids in Management of Obesity

Ó 2019 Hogrefe

Ó 2019 Hogrefe Main findings

1st day: ; glucose, ; insulin, " GLP-1, M ghrelin, ; for sweets & chocolate 90th day: M glucose, M insulin, " GLP-1, M ghrelin, ; for sweets & chocolate

(2)

(1) M body weight, M total body fat, M trunk fat, ; hunger, M urge for chocolate, M urge for carbohydrate, M waist circumference, ; hip circumference, ; leptin, M insulin, ; glucose, M HbA1c, ; LDL-cholesterol, M total cholesterol, M TG, ; ApoB1

– urge – urge

(2) One day meal tests at the 1st and 56th day of study

– 1st day: M hunger, ; urge for chocolate, ; urge for carbohydrate – 56th day: M hunger, ; urge for chocolate, M urge for carbohydrate A single supplementation with 5 g of thylakoids or placebo " fullness, ; hunger, ; longing for food, ; prospective before lunch intake, M satisfaction, ; thirst, ; desire for savory food, ; desire for salty food, M desire for sweet food, M intake at dinner meal, M liking & wanting, " glucose, M TG, M total cholesterol, M LDL-cholesterol, M HDL-cholesterol, M FFA, M hs-CRP A single dose of 5 g thylakoids or placebo before breakfast ; hunger, " fullness, ; wanting salty snacks, ; wanting sweet snacks, ; wanting sweet-and-fat snacks, ; wanting all snacks, M food intake from ad libitum snack buffet, M liking for salty snacks after consumption, ; liking for sweet snacks after consumption, M liking for sweet-and-fat snacks after consumption, M liking for all snacks after consumption

(1) Daily supplementation with 5.6 g of thylakoids or placebo for 56 days in addition to following a 7500 kJ/d diet and a 60 min/d low/medium intensity exercise program

(2) One day meal tests at the 1st and 90th day of study

A high fat meal with and without the addition of thylakoids 50 g thylakoids: " CCK, M ghrelin, " leptin, M glucose, ; in different doses of 5, 10, 25 and 50 g and in delipidated insulin, ; FFA form with dosage of 25 g 25 g thylakoids: " CCK (optimal response), ; ghrelin, " leptin, M glucose, ; insulin, M FFA 25 g delipidated thylakoids: " CCK, ; ghrelin, M leptin, M glucose, ; insulin, M FFA A high carbohydrate breakfast on three occasions, with Both doses of thylakoids: ; hunger motivation, M fullness, one acting as a control and two being thylakoid-enriched " CCK, M glucose, " insulin with doses of 3.7 and 7.4 g (1) Daily supplementation with 5 g of thylakoids or placebo (1) " weight loss, M FFM, M body fat, M waist circumference, ; total cholesterol, ; LDL-cholesterol, M for 12 weeks in addition to following a three-meal paradigm and a 30 min/d low intensity exercise program HDL-cholesterol, M TG, M leptin, M insulin, M glucose (2)

Intervention

; = decrease, " = increase, M = no differences, ApoB1 = apolipoprotein B1, BMI = body mass index, CCK = cholecystokinin, FFA = free fatty acids, FFM = fat free mass, GLP-1 = glucagon-like peptide-1, HbA1c = hemoglobin A1c, HDL-cholesterol = high-density lipoprotein cholesterol, hs-CRP = high-sensitivity C-reactive protein, LDL-cholesterol = low-density lipoprotein cholesterol, TG = triglycerides.

A randomized, double-blind, placebo-controlled, crossover study

30 male & 30 female A randomized, double-blind, with BMI 25.2–34.5 crossover study

E.-L. Stenblom et al. 32 female with BMI (2015) [42] 22.4–36.2

C. J. Rebello et al. (2015) [41]

E.-L. Stenblom et al. 26 overweight (2014) [40] female

A randomized, single-blind, placebo-controlled study

C. Montelius et al. (2014) [38, 39]

38 female with BMI 25–33

A randomized, single-blind, crossover study

E.-L. Stenblom et al. 20 female with BMI (2013) [37] 24.6–31.8

5 male & 6 female of A crossover study normal weight

R. Köhnke et al. (2009) [36]

Design

Subjects

Study

Table 2. Summary of human studies on the effects of thylakoids on overweight- and obesity-related parameters.

M. Ekramzadeh et al., Thylakoids in Management of Obesity 173

Int J Vitam Nutr Res (2020), 90 (1–2), 169–178

174

M. Ekramzadeh et al., Thylakoids in Management of Obesity

Figure 1. Summary of the mechanisms of action of thylakoids on overweight and obesity.

nausea and headaches have been documented in both intervention and control groups of one clinical trial. In our opinion, reporting the same adverse effects in both groups of this study rejects the possibility of considering them as actual side effects of thylakoids [42]. Altogether, current human studies suggest that thylakoids can not only prevent weight gain, but also promote weight loss and overall health without leaving any noticeable side effects [36–42]. Meanwhile, there is no doubt that more comprehensive human studies are required before firm conclusions can be drawn. The summary of human studies is presented in Table 2.

Mechanisms of action Thylakoids have emulsifying properties. Due to the high concentration of galactolipids and hydrophobic proteins, they make lipophilic interactions with dietary fats in the digestive tract. They cover the surfaces of lipid droplets and form stable emulsions in there. Besides, thylakoids strongly bind to the pancreatic lipase-colipase complex and sterically hinder the subsequent lipolysis reaction in the intestine. It is possible that their phenolic compounds play a role in binding to this and maybe other protein-based digestive enzymes. Furthermore, thylakoids attach to Int J Vitam Nutr Res (2020), 90 (1–2), 169–178

intestinal mucosal surfaces. Through all of the aforementioned ways, thylakoids retard the processes of digestion and absorption. Thus, high levels of undigested contents pass to the lower part of the gastrointestinal tract and subsequently trigger the ileal brake [24, 27, 45–51]. The ileal brake is an excellent target for appetite regulation. It is defined as a primary inhibitory feedback mechanism to control the passing of a meal through the digestive tract in order to optimize digestion and absorption of nutrients. Activation of ileal brake makes gut cells to release appetite suppressing hormones such as CCK and GLP-1 into the bloodstream. These hormones increase satiety and suppress hunger sensations, especially hedonic hunger which is an urge to eat palatable foods like sugarand fat-rich snacks to obtain pleasure in the absence of an energy deficit [52–55]. Therefore, thylakoid supplements may be the best choice for controlling food intake in emotional eaters [42, 56]. Presumably, sufferers of the probable metabolic-mood syndrome can also take advantage of this novel plant-based supplement [57]. In addition, it is worth mentioning that central satiety is achieved through activation of reward pathway mediators such as serotonin after thylakoid consumption [58]. Remarkably, weight management properties of thylakoids have been reported in both high fat and high carbohydrate diets. This finding can lead us to a complementary Ó 2019 Hogrefe

M. Ekramzadeh et al., Thylakoids in Management of Obesity

mechanism for the action of these flattened spherical vesicles. As has recently been shown, thylakoids increase activities of certain metabolic enzymes involved in the cascades of Kreb’s cycle, Cori’s cycle and gluconeogenesis. The increment in activities of these glucose metabolizing enzymes such as glucose 6-phosphate dehydrogenase (G6PDH), lactate dehydrogenase (LDH), succinate dehydrogenase (SDH), and malate dehydrogenase (MDH) enhances utilization of substrates to produce energy. This enhanced energy metabolism caused by consumption of thylakoids eventually results in weight reduction or at least decreased weight gain over time. The extent of increased thermogenesis or heat production from the enhanced energy metabolism is a key principle in determining the effectiveness of this pathway for weight loss progress [32, 59]. Alterations in activities of the above-mentioned metabolic enzymes were also previously reported in cases of intermittent fasting and few other weight loss supplements [60–63]. Moreover, thylakoids have anti-obesity functions similar to prebiotics by changing intestinal microbiota. They increase Lactobacillus reuteri which was shown to have inhibitory effects on abdominal fat accumulation and agerelated weight gain in mice irrespective of their baseline diet [30, 64, 65]. This useful probiotic bacterium was also reported to exert increasing effects on the secretion of GLP-1 and -2, insulin and C-peptide [66]. It seems up-regulating levels of interleukin-10 (IL-10) is involved in the aforementioned anti-adipogenic process [65]. Overexpression of IL-10 also ameliorates insulin sensitivity and reduces obesity-mediated inflammation [67]. Besides inflammation, the generation of reactive oxygen species (ROS) is considered as one of the several detrimental cellular responses to nutrient excess in obesity [68]. Thylakoids have a solution to overcome this weight associated health problem, too. Antioxidant content of thylakoids such as chlorophylls, flavonoids and carotenoids like zeaxanthin and lutein may be helpful in alleviating this harmful condition by scavenging ROS [23, 69–72]. It is worth noting that anti-inflammatory and anti-oxidative properties of thylakoids were previously proven [73, 74]. In addition to having antioxidant properties, chlorophyll derivatives can signal peroxisome proliferator-activated receptors (PPARs) which are involved in regulating numerous metabolic routes such as insulin sensitivity, glucose homeostasis, lipid metabolism, fatty acid oxidation, and anti-inflammatory responses [75–77]. Their beneficial effects on these ligand-activated nuclear receptors were observed in in-vitro models of adipocytes, hepatocytes, renocytes, and skeletal myocytes [78–82]. Activation of PPARs induces decrements in weight gain as well as many overweight- and obesity-related diseases such as hyperlipidemia through regulation of the above metabolic pathways Ó 2019 Hogrefe

175

[83]. As highlighted earlier, thylakoids are a well concentrated source of chlorophyll [16]. Therefore, they can be a stimulator of PPARs as has recently been demonstrated [84]. Since thylakoids are gradually gone through degradation by intestinal enzymes, neither stomach discomfort nor steatorrhea appears during supplementation schedules [30, 85]. In addition, thylakoids contain fat-soluble vitamins including vitamin K, A and E and seem not to have any decreasing effects on absorption of the mentioned essential nutrients [19, 23]. Therefore, thylakoids are considered preferable to anti-obesity drugs like Orlistat (Xenical) in terms of these kinds of side effects [86]. Figure 1 illustrates the summary of current possible pathways which are involved in the influence of thylakoids on weight reduction.

Conclusions In conclusion, thylakoids have shown to have positive effects on prevention and treatment of overweight and obesity in both the animal and human studies. These effects can be summarized as follows: inhibition of the pancreatic lipase/colipase, alterations in levels of appetite-regulating hormones like CCK and GLP-1, increment of satiety response, suppression of hunger sensations; particularly hedonic hunger, increase in activities of specific carbohydrate metabolism enzymes such as G6PDH, LDH, SDH, and MDH, reduction of body weight and fat, promotion of glucose homeostasis, suppression of oxidative stress and inflammation, decrease of blood lipids, and acting as a prebiotic to modulate gut microbiota. Nevertheless, there is still a need for more well-designed studies to elucidate thylakoids’ effects on human bodies and evaluate their benefits in obesity-related diseases such as hyperlipidemia, impaired glucose metabolism like diabetes mellitus, cardiovascular disease, polycystic ovary syndrome, metabolic syndrome, and etc. Conducting researches on practical comparisons between thylakoids and other well-known weight loss supplements is also suggested.

References 1. Maggi, S., Busetto, L., Noale, M., Limongi, F., & Crepaldi, G. (2015) Obesity: definition and epidemiology. In: Multidisciplinary Approach to Obesity (Lenzi, A., Migliaccio, S., & Donini, L.M., eds.) pp. 31 -39. Springer, Switzerland. 2. Hopkins, M., & Blundell, J.E. (2016) Energy balance, body composition, sedentariness and appetite regulation: pathways to obesity. Clin Sci. 130(18), 1615–1628. 3. O'Rourke, R. W. (2015) The pathophysiology of obesity and obesity-related diseases. In: The ASMBS Textbook of Bariatric

Int J Vitam Nutr Res (2020), 90 (1–2), 169–178

176

6. 7.

10.

11. 12.

13.

14.

15.

16.

17.

18.

19.

20.

M. Ekramzadeh et al., Thylakoids in Management of Obesity

Surgery: Volume 1: Bariatric Surgery (Nguyen, N.T., Blackstone, R.P., Morton, J.M., Ponce, J., & Rosenthal, R.J., eds.) pp. 13 -36. Springer, New York.. Jensen, C. D., Sato, A. F., & Jelalian, E. (2013) Obesity: causes and consequences. In: Encyclopedia of Behavioral Medicine (Gellman, M.D. & Turner, J.R., eds.) pp. 1355 -1358. Springer, New York. Kyrou, I., Randeva, H. S., & Weickert, M. O. (2014) Clinical problems caused by obesity. In: Endotext (De Groot, L., BeckPeccoz, P., Chrousos, G., et al. eds.) [Internet]. MDText.com, Inc, South Dartmouth (MA). Available from: http://www.ncbi. nlm.nih.gov/books/NBK278973/ James, W.P.T. (2013) Obesity-a modern pandemic: the burden of disease. Endocrinol Nutr. 60(SUPPL.1), 3–6. World Health Organization. (2015) Obesity and overweight. Retrieved July 11, 2016, from http://www.who.int/mediacentre/factsheets/fs311/en/ Ng, M., Fleming, T., Robinson, M., Thomson, B., Graetz, N., Margono, C., et al. (2014) Global, regional, and national prevalence of overweight and obesity in children and adults during 1980–2013: a systematic analysis for the Global Burden of Disease Study 2013. Lancet. 384(9945), 766–781. Jafari-Adli, S., Jouyandeh, Z., Qorbani, M., Soroush, A., Larijani, B., & Hasani-Ranjbar, S. (2014) Prevalence of obesity and overweight in adults and children in Iran; a systematic review. J Diabetes Metab Disord. 13(1), 121. Rahmani, A., Sayehmiri, K., Asadollahi, K., Sarokhani, D., Islami, F., & Sarokhani, M. (2015) Investigation of the prevalence of obesity in Iran: a systematic review and metaanalysis study. Acta Med Iran. 53(10), 596–607. Kushner, R.F. (2014) Weight loss strategies for treatment of obesity. Prog Cardiovasc Dis. 56(4), 465–472. Martínez-augustin, O., Aguilera, C.M., Gil-campos, M., Medina, F.S., De, Gil., & A., (2012) Bioactive anti-obesity food components. Int J Vitam Nutr Res. 82(3), 148–156. Poddar, K., Kolge, S., Bezman, L., Mullin, G.E., & Cheskin, L.J. (2011) Nutraceutical supplements for weight loss: a systematic review. Nutr Clin Pract. 26(5), 539–552. Staehelin, L.A. (2003) Chloroplast structure: from chlorophyll granules to supra-molecular architecture of thylakoid membranes. Photosyn Res. 76(1–3), 185–196. Mustárdy, L., Buttle, K., Steinbach, G., & Garab, G. (2008) The three-dimensional network of the thylakoid membranes in plants: quasihelical model of the granum-stroma assembly. Plant Cell. 20(10), 2552–2557. Staehelin L. A., & Staay, G. W. M. (1996) Structure, composition, functional organization and dynamic properties of thylakoid membranes. In: Oxygenic Photosynthesis: the Light Reactions (Ort, D.R., Yocum, C. F., & Heichel, I.F. eds.) pp. 11 30. Springer, Dordrecht, Netherlands. Andreasson, E., Svensson, P., Weibull, C., & Albertsson, P.Å. (1988) Separation and characterization of stroma and grana membranes – evidence for heterogeneity in antenna size of both photosystem I and photosystem II. Biochim Biophys Acta. 936(3), 339–350. Emek, S.C., Szilagyi, A., Akerlund, H.E., Albertsson, P.Å., Köhnke, R., Holm, A., & Erlanson-Albertsson, C. (2010) A large scale method for preparation of plant thylakoids for use in body weight regulation. Prep Biochem Biotechnol. 40(1), 13–27. Roberts, J.L., & Moreau, R. (2016) Functional properties of spinach (Spinacia oleracea L.) phytochemicals and bioactives. Food Funct. 7(8), 3337–3353. Fuhrmann, E., Gathmann, S., Rupprecht, E., Golecki, J., & Schneider, D. (2009) Thylakoid membrane reduction affects

Int J Vitam Nutr Res (2020), 90 (1–2), 169–178

21.

22.

23.

24.

25.

26.

27.

28.

29.

30.

31.

32.

33.

34.

35.

36.

the photosystem stoichiometry in the cyanobacterium Synechocystis sp. PCC 6803. Plant Physiol. 149(2), 735–744. Limantara, L., Dettling, M., Indrawati, R., & Brotosudarmo, T. H.P. (2015) Analysis on the chlorophyll content of commercial green leafy vegetables. Procedia Chem. 14, 225–231. Akerlund, H.E., Andersson, B., Persson, A., & Albertsson, P.Å. (1979) Isoelectric points of spinach thylakoid membrane surfaces as determined by cross partition. Biochim Biophys Acta. 552(2), 238–246. Erlanson-Albertsson, C., & Albertsson, P.-Å. (2015) The use of green leaf membranes to promote appetite control, suppress hedonic hunger and loose body weight. Plant Foods Hum Nutr. 70(3), 281–290. Montelius, C., Gustafsson, K., Westrom, B., Albertsson, P.A., Emek, S.C., Rayner, M., & Erlanson-Albertsson, C. (2011) Chloroplast thylakoids reduce glucose uptake and decrease intestinal macromolecular permeability. Br J Nutr. 106(6), 836–844. Teixeira, T.F., Collado, M.C., Ferreira, C.L., Bressan, J., & Maria do Carmo, G.P. (2012) Potential mechanisms for the emerging link between obesity and increased intestinal permeability. Nutr Res. 32(9), 637–647. Emek, S.C., Åkerlund, H.-E., Clausén, M., Ohlsson, L., Weström, B., Erlanson-Albertsson, C., & Albertsson, P.-Å. (2011) Pigments protect the light harvesting proteins of chloroplast thylakoid membranes against digestion by gastrointestinal proteases. Food Hydrocoll. 25(6), 1618–1626. Albertsson, P.Å., Köhnke, R., Emek, S., Mei, J., Rehfeld, J., Akerlund, H., & Erlanson-Albertsson, C. (2007) Chloroplast membranes retard fat digestion and induce satiety: effect of biological membranes on pancreatic lipase/co-lipase. Biochem J. 401, 727–733. Köhnke, R., Lindqvist, A., Goransson, N., Emek, S.C., Albertsson, P.Å., Rehfeld, J.F., et al. (2009) Thylakoids suppress appetite by increasing cholecystokinin resulting in lower food intake and body weight in high-fat fed mice. Phytother Res. 23 (12), 1778–1783. Köhnke, R., Svensson, L., Piedra, J.L.V., Pierzynowski, S.G., Weström, B., & Erlanson-Albertsson, C. (2010) Feeding appetite suppressing thylakoids to pigs alters pancreatic lipase/colipase secretion. Livest Sci. 134(1), 68–71. Montelius, C., Osman, N., Weström, B., Ahrné, S., Molin, G., Albertsson, P.-Å., & Erlanson-Albertsson, C. (2013) Feeding spinach thylakoids to rats modulates the gut microbiota, decreases food intake and affects the insulin response. J Nutr Sci. 2, e20. Montelius, C., Szwiec, K., Kardas, M., Lozinska, L., ErlansonAlbertsson, C., Pierzynowski, S., et al. (2014) Dietary thylakoids suppress blood glucose and modulate appetiteregulating hormones in pigs exposed to oral glucose tolerance test. Clin Nutr. 33(6), 1122–1126. Masih, D., Rakhra, G., & Singh, S.N. (2016) Effect of thylakoid supplementation on activities of glucose metabolizing enzymes in rats. Adv Weigh Loss Manag Med Dev. 1(1), 1–5. Cooper, J.A. (2014) Factors affecting circulating levels of peptide YY in humans: a comprehensive review. Nutr Res Rev. 27(01), 186–197. Yadav, A., Kataria, M.A., Saini, V., & Yadav, A. (2013) Role of leptin and adiponectin in insulin resistance. Clin Chim Acta. 417, 80–84. Ramaiah, S.K. (2007) A toxicologist guide to the diagnostic interpretation of hepatic biochemical parameters. Food Chem Toxicol. 45(9), 1551–1557. Köhnke, R., Lindbo, A., Larsson, T., Lindqvist, A., Rayner, M., Emek, S.C., et al. (2009) Thylakoids promote release of the

Ó 2019 Hogrefe

M. Ekramzadeh et al., Thylakoids in Management of Obesity

37.

38.

39.

40.

41.

42.

43.

44. 45.

46.

47.

48.

49.

50.

51.

satiety hormone cholecystokinin while reducing insulin in healthy humans. Scand J Gastroenterol. 44(6), 712–719. Stenblom, E.-L., Montelius, C., Östbring, K., Håkansson, M., Nilsson, S., Rehfeld, J.F., & Erlanson-Albertsson, C. (2013) Supplementation by thylakoids to a high carbohydrate meal decreases feelings of hunger, elevates CCK levels and prevents postprandial hypoglycaemia in overweight women. Appetite. 68, 118–123. Montelius, C., Erlandsson, D., Vitija, E., Stenblom, E.-L., Egecioglu, E., & Erlanson-Albertsson, C. (2014) Body weight loss, reduced urge for palatable food and increased release of GLP-1 through daily supplementation with green-plant membranes for three months in overweight women. Appetite. 81, 295–304. Montelius, C., Erlandsson, D., Vitija, E., Stenblom, E.L., Egecioglu, E., & Erlanson-Albertsson, C. (2016) Corrigendum to “Body weight loss, reduced urge for palatable food and increased release of GLP-1 through daily supplementation with green-plant membranes for three months in overweight women” [Appetite 81 (2014), 295–304]. Appetite. 101, 239. Stenblom, E.-L., Montelius, C., Erlandsson, D., Skarping, L., Fransson, M., Egecioglu, E., et al. (2014) Decreased urge for palatable food after a two-month dietary intervention with green-plant membranes in overweight women. J Obes Weight Loss Ther. 4, 238. Rebello, C.J., Chu, J., Beyl, R., Edwall, D., ErlansonAlbertsson, C., & Greenway, F.L. (2015) Acute effects of a spinach extract rich in thylakoids on satiety: a randomized controlled crossover trial. J Am Coll Nutr. 34(6), 470–477. Stenblom, E.-L., Egecioglu, E., Landin-Olsson, M., & ErlansonAlbertsson, C. (2015) Consumption of thylakoid-rich spinach extract reduces hunger, increases satiety and reduces cravings for palatable food in overweight women. Appetite. 91, 209–219. Bassuk, S.S., Rifai, N., & Ridker, P.M. (2004) High-sensitivity C-reactive protein: clinical importance. Curr Probl Cardiol. 29 (8), 439–493. Boden, G. (2008) Obesity and free fatty acids. Endocrinol Metab Clin North Am. 37(3), 635–646. van Hummel, H. C. (1975) Chemistry and biosynthesis of plant galactolipids. In: Fortschritte der Chemie Organischer Naturstoffe/Progress in the Chemistry of Organic Natural Products (Zechmeister, L., Herz, W., Grisebach, H., & Kirby, G.W. eds.) pp. 267 -295. Springer, Vienna. Chu, B.S., Rich, G.T., Ridout, M.J., Faulks, R.M., Wickham, M. S., & Wilde, P.J. (2009) Modulating pancreatic lipase activity with galactolipids: effects of emulsion interfacial composition. Langmuir. 25(16), 9352–9360. Rayner, M., Ljusberg, H., Emek, S.C., Sellman, E., ErlansonAlbertsson, C., & Albertsson, P.A. (2011) Chloroplast thylakoid membrane-stabilised emulsions. J Sci Food Agric. 91(2), 315–321. Emek, S.C., Akerlund, H.E., Erlanson-Albertsson, C., & Albertsson, P.A. (2013) Pancreatic lipase-colipase binds strongly to the thylakoid membrane surface. J Sci Food Agric. 93(9), 2254–2258. Birari, R.B., & Bhutani, K.K. (2007) Pancreatic lipase inhibitors from natural sources: unexplored potential. Drug Discov Today. 12(19), 879–889. Williamson, G. (2013) Possible effects of dietary polyphenols on sugar absorption and digestion. Mol Nutr Food Res. 57(1), 48–57. Jakobek, L. (2015) Interactions of polyphenols with carbohydrates, lipids and proteins. Food Chem. 175, 556–567.

Ó 2019 Hogrefe

177

52. Maljaars, P.W.J., Peters, H.P.F., Mela, D.J., & Masclee, A.A.M. (2008) Ileal brake: a sensible food target for appetite control. A review. Physiol Behav. 95(3), 271–281. 53. Golding, M., & Wooster, T.J. (2010) The influence of emulsion structure and stability on lipid digestion. Curr Opin Colloid Interface Sci. 15(1), 90–101. 54. Rebello, C.J., O’Neil, C.E., & Greenway, F.L. (2015) Gut fat signaling and appetite control with special emphasis on the effect of thylakoids from spinach on eating behavior. Int J Obes. 39(12), 1679–1688. 55. Witt, A.A., & Lowe, M.R. (2014) Hedonic hunger and binge eating among women with eating disorders. Int J Eat Disord. 47(3), 273–280. 56. van Bloemendaal, L., Veltman, D.J., ten Kulve, J.S., Drent, M. L., Barkhof, F., Diamant, M., & IJzerman, R.G. (2015) Emotional eating is associated with increased brain responses to food-cues and reduced sensitivity to GLP-1 receptor activation. Obesity. 23(10), 2075–2082. 57. Mansur, R.B., Brietzke, E., & McIntyre, R.S. (2015) Is there a “metabolic-mood syndrome”? A review of the relationship between obesity and mood disorders. Neurosci Biobehav Rev. 52, 89–104. 58. Erlanson-Albertsson, C., Albertsson, P.-Å., Gustafsson, K., Montelius, C., Emek, S.C., Köhnke, R., & Landin-Olsson, M. (2012) Thylakoids promote satiety in healthy humans. Metabolic effects and mechanisms. In Symposium on Agricultural, Food Derived Natural Products for Preventing, Combating Disease (Vol. 1093, pp. 521–531). American Chemical Society. 59. Dashty, M. (2013) A quick look at biochemistry: carbohydrate metabolism. Clin Biochem. 46(15), 1339–1352. 60. Farooq, N., Priyamvada, S., Arivarasu, N.A., Salim, S., Khan, F., & Yusufi, A.N.K. (2006) Influence of Ramadan-type fasting on enzymes of carbohydrate metabolism and brush border membrane in small intestine and liver of rat used as a model. Br J Nutr. 96(06), 1087–1094. 61. Khan, S.A., Priyamvada, S., Arivarasu, N.A., Khan, S., & Yusufi, A.N.K. (2007) Influence of green tea on enzymes of carbohydrate metabolism, antioxidant defense, and plasma membrane in rat tissues. Nutrition. 23(9), 687–695. 62. Hussin, M., Hamid, A.A., Mohamad, S., Saari, N., Bakar, F., & Dek, S.P. (2009) Modulation of lipid metabolism by Centella asiatica in oxidative stress rats. J Food Sci. 74(2), H72–H78. 63. Sasikala, S., Lakshminarasaiah, S., & Naidu, M.D. (2015) Effect of Centella asiatica (Linn) leaves on selective mitochondrial and cytosolic enzymes in streptozotocin induced diabetic rats. Int J Pharm Pharm Sci. 7(11), 322–325. 64. Kellow, N.J., Coughlan, M.T., & Reid, C.M. (2014) Metabolic benefits of dietary prebiotics in human subjects: a systematic review of randomised controlled trials. Br J Nutr. 111(07), 1147–1161. 65. Poutahidis, T., Kleinewietfeld, M., Smillie, C., Levkovich, T., Perrotta, A., Bhela, S., et al. (2013) Microbial reprogramming inhibits Western diet-associated obesity. PLoS One. 8(7), e68596. 66. Simon, M.C., Strassburger, K., Nowotny, B., Kolb, H., Nowotny, P., Burkart, V., et al. (2015) Intake of Lactobacillus reuteri improves incretin and insulin secretion in glucose-tolerant humans: a proof of concept. Diabetes Care. 38(10), 1827–1834. 67. Dagdeviren, S., Jung, D.Y., Lee, E., Friedline, R.H., Noh, H.L., Kim, J.H., et al. (2016) Altered interleukin-10 signaling in skeletal muscle regulates obesity-mediated inflammation and insulin resistance. Mol Cell Biol.MCB.00181–16. 68. Bondia-Pons, I., Ryan, L., & Martinez, J.A. (2012) Oxidative stress and inflammation interactions in human obesity. J Physiol Biochem. 68(4), 701–711.

Int J Vitam Nutr Res (2020), 90 (1–2), 169–178

178

69. González-Castejón, M., & Rodriguez-Casado, A. (2011) Dietary phytochemicals and their potential effects on obesity: a review. Pharmacol Res. 64(5), 438–455. 70. Hsu, C.Y., Chao, P.Y., Hu, S.P., & Yang, C.M. (2013) The antioxidant and free radical scavenging activities of chlorophylls and pheophytins. Food Nutr Sci. 4A(8), 1–8. 71. Bergman, M., Perelman, A., Dubinsky, Z., & Grossman, S. (2003) Scavenging of reactive oxygen species by a novel glucurinated flavonoid antioxidant isolated and purified from spinach. Phytochemistry. 62(5), 753–762. 72. Krinsky, N.I. (1998) The antioxidant and biological properties of the carotenoids. Ann N Y Acad Sci. 854(1), 443–447. 73. Andersen, A., Bissonnette, E., Drouin, R., & Purcell, M. (2008). Compositions comprising thylakoids useful in the modulation of inflammation process. U.S. Patent No. 7,329,423. U.S. Patent and Trademark Office, Washington, DC. 74. Purcell, M. (2014). Process of obtaining thylakoids from photosynthetic organisms; plant fractions obtained from the process; pure thylakoids; and methods of use of thylakoids as ROS scavengers, photo-protectors, biosensors, biofilters and bioreactor. U.S. Patent No. 8,632,824. U.S. Patent and Trademark Office, Washington, DC. 75. Ulbricht, C., Bramwell, R., Catapang, M., Giese, N., Isaac, R., Le, T.D., et al. (2014) An evidence-based systematic review of chlorophyll by the Natural Standard Research Collaboration. J Diet Suppl. 11(2), 198–239. 76. Olofsson, P., Hultqvist, M., Hellgren, L.I., & Holmdahl, R. (2014) Phytol: a chlorophyll component with anti-inflammatory and metabolic properties. In Recent Advances in Redox Active Plant and Microbial Products pp. 345–359. Springer, Netherlands. 77. Grygiel-Górniak, B. (2014) Peroxisome proliferator-activated receptors and their ligands: nutritional and clinical implications-a review. Nutr J. 13(1), 17. 78. Schluter, A., Giralt, M., Iglesias, R., & Villarroya, F. (2002) Phytanic acid, but not pristanic acid, mediates the positive effects of phytol derivatives on brown adipocyte differentiation. FEBS Lett. 517(1–3), 83–86. 79. Schlüter, A., Barberá, M.J., Iglesias, R., Giralt, M., & Villarroya, F. (2002) Phytanic acid, a novel activator of uncoupling protein-1 gene transcription and brown adipocyte differentiation. Biochem J. 362(1), 61–69. 80. Heim, M., Johnson, J., Boess, F., Bendik, I., Weber, P., Hunziker, W., & Flühmann, B. (2002) Phytanic acid, a natural peroxisome proliferator-activated receptor (PPAR) agonist, regulates glucose metabolism in rat primary hepatocytes. FASEB J. 16(7), 718–720. 81. Goto, T., Takahashi, N., Kato, S., Egawa, K., Ebisu, S., Moriyama, T., & Kawada, T. (2005) Phytol directly activates peroxisome proliferator-activated receptor α (PPARα) and regulates gene expression involved in lipid metabolism in

Int J Vitam Nutr Res (2020), 90 (1–2), 169–178

M. Ekramzadeh et al., Thylakoids in Management of Obesity

82.

83.

84.

85.

86.

PPARα-expressing HepG2 hepatocytes. Biochem Biophys Res Commun. 337(2), 440–445. Che, B.N., Oksbjerg, N., Hellgren, L.I., Nielsen, J.H., & Young, J. F. (2013) Phytanic acid stimulates glucose uptake in a model of skeletal muscles, the primary porcine myotubes. Lipids Health Dis. 12(1), 14. Monsalve, F.A., Pyarasani, R.D., Delgado-Lopez, F., & MooreCarrasco, R. (2013) Peroxisome proliferator-activated receptor targets for the treatment of metabolic diseases. Mediators Inflamm. 2013, 549627. Stenkula, K.G., Stenblom, E.L., Montelius, C., Egecioglu, E., & Erlanson-Albertsson, C. (2017) Thylakoids reduce body fat and fat cell size by binding to dietary fat making it less available for absorption in high-fat fed mice. Nutr Metab (Lond). 14(1), 4. Östbring, K., Rayner, M., Sjöholm, I., Otterström, J., Albertsson, P.Å., Emek, S.C., & Erlanson-Albertsson, C. (2014) The effect of heat treatment of thylakoids on their ability to inhibit in vitro lipase/co-lipase activity. Food Funct. 5(9), 2157–2165. Filippatos, T.D., Derdemezis, C.S., Gazi, I.F., Nakou, E.S., Mikhailidis, D.P., & Elisaf, M.S. (2008) Orlistat-associated adverse effects and drug interactions. Drug Safety. 31(1), 53– 65.

Acknowledgments We would like to thank the editors and anonymous reviewers for their constructive comments and suggestions which helped us to improve this article. We would also like to thank the Research Consultation Center (RCC) at Shiraz University of Medical Sciences for invaluable assistance in linguistic revision. Conflict of Interest The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be constructed as a potential conflict of interest.

Maryam Ekramzadeh, PhD Assistant Professor of Nutrition Nutrition and Food Sciences Research Center Department of Clinical Nutrition School of Nutrition and Food Sciences Shiraz University of Medical Sciences Razi Blvd Shiraz Iran mekramzade@gmail.com

Ó 2019 Hogrefe

Review

Effects of Astaxanthin Supplementation on Oxidative Stress A Systematic Review and Meta-Analysis of Randomized Controlled Trials Di Wu1, Hao Xu2, Jinyao Chen1, and Lishi Zhang1 1

Department of Nutrition, Food Hygiene and Toxicology, Sichuan University, West China School of Public Health, Chengdu, Sichuan, China

Department of Epidemiology and Biostatistics, West China School of Public Health, Sichuan University, Chengdu, China

Received: May 1, 2017; Accepted: August 25, 2017

Abstract: A systematic review and meta-analysis was conducted in six databases from 1948 to 2015 to assess the antioxidant activity of astaxanthin in humans. Nine randomized controlled trials were included in the systematic review. Results of meta-analysis revealed a borderline significant antioxidant effect of astaxanthin between the intervention and control groups, with a malondialdehyde-lowering effect for lipid peroxidation (p = 0.050). However, the data included here are insufficient. When compared with the baseline in intervention groups, the meta-analysis suggested that astaxanthin supplements significantly decreased plasma malondialdehyde {Standard mean difference (SMD) 1.32 μmol/L [95% CI 1.92, 0.72]; p < 0.0001} and isoprostane (SMD 3.10 ng/mL [95% CI 4.69, 1.51]; p < 0.0001). However, they increased superoxide dismutase (SMD 1.57 U/mL [95% CI 0.57, 2.56]; p = 0.002) and total antioxidant capacity (SMD 0.77 mmol 95% CI [0.12, 1.43]; p = 0.018). For dosage subgroup analysis, high dose ( 20 mg/day) of astaxanthin showed significant antioxidant effect (on total antioxidant capacity, isoprostane, and superoxide dismutase, p < 0.05). However, low dose (<20 mg/day) showed no significant effect (p > 0.05). Further duration subgroup analysis indicated that astaxanthin showed antioxidant effect after a 3-week intervention (p < 0.001), whereas this effect was not observed after a 12-week or 3-month intervention (on isoprostane and superoxide dismutase, p > 0.05). This review suggested that the antioxidant effect of astaxanthin on humans is unclear. Keywords: Astaxanthin, meta-analysis, oxidative stress, randomized controlled trial, systematic review

Introduction Oxidative stress is defined as “the imbalance between the oxidants and the antioxidants favouring the former,” resulting in a change for signaling properties of redox and/or molecular damage [1, 2]. Oxidative stress contributes to more than 100 human disorders through DNA, lipid, or protein damage [3]. These human disorders include atherosclerosis [4], cardiovascular diseases [5], cancer [6], diabetes [7], and neurodegenerative diseases [8]. Additionally, a huge amount of in vitro and animal studies indicated that the nutrient antioxidants, such as vitamin C, E, and carotenoids, can combat lipid, protein, or DNA oxidation and defeat chronic diseases [9–14]. However, the evidence from clinical trials on human beings is controversial. Only a few clinical trials have consistently proven the advantages of using nutrient antioxidants to treat chronic diseases [15, 16]. However, others concluded with null or even negative outcomes [17–19]. For example, the protective effect of vitaÓ 2019 Hogrefe

min E was not been observed in heart outcomes prevention evaluation study, questioning the underlying principles of the antioxidant hypothesis for these micronutrients [17]. Stanner et al. reviewed the epidemiological studies and also failed to show any benefit from the consumption of these nutrient antioxidants by people with cancer and cardiovascular disease [20]. The antioxidant hypothesis has lasted for over 20 years, and still, no conclusion was reached. However, the failure may be due to the limitation of the study design, the oxidative status of subjects, the dosage of supplements, the intervention duration, or the limited studied types of micronutrients [21, 22]. Therefore, more research is needed either by consistently exploring the previously studied micronutrients (such as β-carotene) at different dosages or durations of intervention and on diverse subjects or by exploring novel and potent nutrient antioxidants with different biochemical characteristics [22]. Nowadays, astaxanthin (ASTX) has been studied extensively, because it is a relatively new carotenoid that can purportedly relieve oxidant stress. ASTX is a xanthophyll Int J Vitam Nutr Res (2020), 90 (1–2), 179–194 https://doi.org/10.1024/0300-9831/a000497

180

D. Wu et al., Effects of Astaxanthin Supplementation on Oxidative Stress

carotenoid that is present in microalgae, fungi, and seafoods; it is a potential antioxidant that can be used to prevent cardiovascular diseases [23]. From a biochemical standpoint, the potentially powerful antioxidant efficacy of ASTX may be due to its conjugated double bonds and polar property. ASTX contains 13 conjugated double bonds, whereas lutein, zeaxanthin, and lycopene contain 10, 11, and 11 conjugated double bonds, respectively [24]. Lee and Min compared the effects of different carotenoids and suggested that the antioxidant effects of the carotenoids are positively associated with the number of the conjugated double bonds [24]. Shimidzu et al. also indicated that more conjugated double bonds in carotenoids contribute to greater singlet oxygen-quenching activity [25]. Furthermore, compared with the nonpolar carotenoids (lycopene and β-carotene), the polar property of ASTX allows strategic placement in cell membranes, protecting the membrane structure as antioxidant [26]. Considering the above-mentioned biological discoveries, ASTX has been shown to possess strong potential as a potent antioxidant. Furthermore, several animal trials have suggested that ASTX can lower oxidative stress by decreasing 8-hydroxy20 -deoxyguanosine (8-OHdG) [27] and malondialdehyde (MDA) [28], but it can increase antioxidant enzymes [28, 29]. Clinical trials have also been conducted, but the number of trials is limited. Most of the clinical trials aimed to define the proper dose [30], assess the bioavailability [31], and safety [32] of ASTX on humans. However, according to the clinical trials, the protective effect of ASTX against oxidative stress is still inconclusive. Carotenoids, such as lycopene, have been studied in systematic reviews and meta-analyses for antioxidant activity [33]. However, ASTX has not been systematically reviewed yet. Thus, the aim of the current review is to assess the impact of ASTX on a variety of parameters, i.e., oxidative stress, including lipid oxidation, protein oxidation, DNA damage, antioxidant enzymes, and other related biomarkers in plasma. Furthermore, we aim to explore the effect of the dosage and duration of ASTX intervention in subgroup analyses.

Methods and materials Search strategy Electronic searches were done in CENTRAL (The Cochrane Library) as well as in VOID MEDLINE, EMBASE, ESBCO, Web of Science, and CBM from January 1948 to December 2015. Some related literature was found by further searching through the reference lists of the primary studies and reviews. Trials published in English and Chinese were considered. No other limitation was imposed. Int J Vitam Nutr Res (2020), 90 (1–2), 179–194

Terms used for OVID MEDLINE (and adopted for other databases) in both subject headings and full fields were: 1. astaxanthin, haematococcus, carotenoids, xanthophyll; 2. antioxidants, DNA damage, protein oxidation, lipid peroxidation, oxidative stress, oxidoreductases, malondialdehyde, oxidation-reduction. The search started with the results obtained from using the terms (1) and (2). Then, the term randomized controlled trial was used as the limitation.

Inclusion criteria Original studies were included if they met the following inclusion criteria: (1) intervention study; (2) randomized controlled trial (RCT); (3) investigated the impact of ASTX on biomarkers of oxidative stress; and (4) presented sufficient information on biomarkers of oxidative stress at baseline and at the end of study in both ASTX intervention and control groups. The selection of these biomarkers was based on previous research, which specified that lipid peroxidation, protein oxidation, plasma antioxidant, DNA damage, antioxidant enzymes, and antioxidant capacity of plasma can be used as biomarkers to detect oxidative stress [33]. Currently, many markers have been proposed [34]; these markers can be classified as follows: 1. Oxidative damage to lipids: MDA, 4-hydr-oxynonenal, thiobarbituric acid–reactive substances (TBARS), phospholipid hydroperoxides (PLOOH), phosphatidylethanolamine hydroperoxide (PEOOH), and phosphatidylcholine hydroperoxide (PCOOH); 2. Oxidative damage to protein: advanced oxidation protein product (AOPP) and sulphydryl (SH) group; 3. Low-density lipid (LDL) oxidation: LDL lag time and LDL oxidation rate; 4. Product of the free radical oxidation of arachidonic acid: isoprostane (ISP); 5. Plasma antioxidant of lipid oxidation: uric acid (UA); 6. Oxidative damage to DNA: 8-OHdG; 7. Antioxidant enzymes: superoxide dismutase (SOD), catalase (CAT), glutathione peroxidase (GSH-Px), and paraoxonase (PON); 8. Plasma antioxidant capability: total antioxidant capability (TAC), total antioxidant status (TAS), total oxidant status (TOS), pro-oxidant-antioxidant balance (PAB), and redox balance.

Exclusion criteria The following were the exclusion criteria: (1) studies that used food enriched with ASTX or preparations, in which Ó 2019 Hogrefe

D. Wu et al., Effects of Astaxanthin Supplementation on Oxidative Stress

ASTX is not the main antioxidant; (2) studies that provided no numerical values on baseline; and (3) studies with inadequate details of methodologies or results (even after contacting the authors).

Data extraction Data were extracted independently by two investigators (DW and HX) using guidelines published by the Cochrane Collaboration [35]. Eligible studies were reviewed and the following data were extracted: (1) first author’s name; (2) year of publication; (3) study location; (4) sample size; (5) characteristics of study participants, e.g., age, gender, and body mass index; (6) study design; (7) form of treatment; (8) daily dosage of ASTX; (9) duration of the active treatment phase; and (10) outcome measurement of oxidative stress biomarkers.

Quality assessment All trials were objectively assessed for the risk of bias by two independent reviewers (DW and HX), as recommended by the Cochrane guideline [35]. Briefly, each paper was assessed using the JADAD scale [36]. The JADAD scale is a 5-point scale for evaluating the quality of randomized trials, in which 3 points or more indicate superior quality. The items, which include allocation sequence, allocation concealment, blinding, and follow-up, were reported in the text.

181

from 2 mg to 40 mg even for 90 days [38]. Hence, half of the maximum dosage (40 mg/2 = 20 mg) was chosen as the dividing point. The duration of intervention was taken into our second subgroup analysis. We classified the durations into two categories: (1) short term, 21 days (3 weeks); and (2) long term, 84 (12 weeks) or 90 days (3 months). No unified rule is provided to classify the durations; two categories that are supposed to work well for the available data were chosen. The fixed-effect model and random-effect model were used to combine data. When clinical heterogeneity was sufficient to expect that the underlying treatment effects differed among trials, or if substantial statistical heterogeneity was detected, a random-effect model was adopted to produce an overall summary. In addition, the robustness of results was explored by sensitivity analysis excluding selected trials with potential risk of bias. Publication bias or small study effect was assessed by fail-safe index [39]. Finally, data not allowed for entry into the STATA software were reported in texts. We listed the supposed factors that might lead to the heterogeneity across studies as follows: (1) characteristic of the participants, which was normal or in a specific state (smoker or the overweight); (2) different design of trials: parallel or repeated measures design.

Results

Statistical analysis

Search result and description of included studies

Meta-analysis was conducted with STATA 11.0 software. We focused on all the biomarkers of oxidative stress in each included research and converted them into the same units. Data were extracted as baseline and endpoint means, standard deviations (SDs), and sample sizes of intervention and placebo groups for each oxidative outcome. Only data from the final time point were taken into consideration when tests were performed at multiple time points. The effect was calculated as the difference on the baseline and at the end-trial levels between the intervention and control groups for every dosage. We also extracted data from intervention groups and compared the difference before and after the interventions. One subgroup meta-analysis was conducted to explore whether the treatment effect on oxidative stress levels was associated with the dosage of ASTX (<20 or 20 mg/day), because we supposed that the influence of phytochemicals dosage on the outcomes was physiologically plausible [37]. In clinical studies, no adverse effect was observed after consumption of ASTX at dosages ranging

The initial screening for potential relevance removed articles whose titles and/or abstracts were irrelevant. Among the 33 full text articles assessed for eligibility, we excluded 8 trials for not focusing mainly on ASTX, 14 trials for not providing specific oxidative stress biomarkers, and 1 trial for not stating explicitly the word “random” in the description of treatment assignment. Two trials [40, 41] focusing on different biomarkers of oxidative stress conducted with the same subjects were included into this meta-analysis as one trial. Characteristics of the nine clinical trials that met the criteria are summarized in Table 1, and the selection procedure is shown in Figure 1. The nine trials were conducted between 2007 and 2015 and comprised of 436 participants. The trials were conducted in Serbia (two trials) [40–42], Japan [43], Finland [44], China [45], and South Korea (three trials) [46–48]. One trial was conducted by both South Korea and United States [49]. Seven of the nine trials included discrete control group (placebo-controlled or ASTX-free diet controlled)

Ó 2019 Hogrefe

Int J Vitam Nutr Res (2020), 90 (1–2), 179–194

Peng et al. 2011 [45] China

Nakagawa et al. 2011 [43] Japan

Kim et al. 2011 [46] South Korea

Djordjevic et al. 2012 [42] Serbia

Baralic et al. 2013, 2015 [40], [41] Serbia

Study ID location T: ASTX capsules (made from Haematococcu spluvialis) C: placebo (saccharose)

Randomized

Placebo-controlled

Parallel trial (2 groups)

Placebo-controlled

Randomized

Double blind

Parallel trial (3 groups)

Placebo-controlled

Randomized

Trial (4 groups)

Repeated measured

Randomized

Double blind

T: ASTX capsules (made of Haematococcus pluvialis ± maize oil, and edible gelatin) C: placebo (maize oil and edible gelatin)

T1, T2: ASTX capsules (made of Haematococcus pluviallis, Puresta oil 80 and alive oil.) C: placebo (maize oil)

T: ASTX capsules (made from Haematococcus pluvialis, soybean oil) C: n.a.

C: placebo (sacharose)

Placebo-controlled

Parallel trial (2 groups)

T: ASTX capsules (made from Haematococcus pluvialis)

Randomized

Double blind

Parallel trial (2 groups)

Treatment/ Control b

Study design

Table I. Characteristics of include studies. c

C: 0 mg

T: 40 mg

C: 0 mg 90 days

BMI: n.a.

Age: 45 -65

F/M: 62/53

healthy subjects

BMI: 27.5 ± 2.1

Age: -69

F/M: 15/15

healthy subjects

T1: 6 mg

T2: 12 mg

BMI: 24.3 ± 3.27

C: 0 mg

M/F: 38/1

T: Smokers

Age: T: 18.1 ± 0.16, C: 17.7 ± 0.6 BMI: T: 22.8 ± 1.4, C: 22.7 ± 1.7

Soccer players, M,

Age: T: 17.9 ±0.2 ± C: 17.6 ± 0.1 BMI: T: 22.4 ± 0.3 ± C: 22.2 ± 0.4

Soccer players, M

Participants Characteristic

Age: 21-43

84 days

21 days

90 days

Duration

T3: 40 mg

T2: 20 mg

T1:5mg

C: 0mg

T: 4mg

C: 0mg

T: 4mg

ASTX dosage per day

BMI: 22.6 ± 2.68

Age: 21-42

M/F: 38/1

C: Non-smokers

C: 57

T: 58

Total: 115

C: 10

T2: 10

T1: 10

Total: 30

C: 39

T3: 13

T2: 13

T1: 13

Total : 78

C: 14

T: 18

Total: 32

C: 19

T: 21

Total: 40

Sample size

(Continued on next page)

MDA, SOD, GSH-Px activity

PCOOH, PEOOH, UA

MDA, ISP, SOD, TAC

MDA, AOPP, SOD, SH groups, TAS

TAS, TOS, PAB, UA, PON1, SH groups, TBARS, AOPP, redox balance

Biomarkers of oxidative stress

182 D. Wu et al., Effects of Astaxanthin Supplementation on Oxidative Stress

Ó 2019 Hogrefe

Double blind

Parallel trial (3 groups)

Placebo-controlled

Randomized

Double blind

Parallel trial (2 groups)

T: ASTX capsules (made of Haematococcus pluvialis; Con- tain small amounts (<15%) of mixed carotenoids) C: placebo (n.a.)

T: ASTX capsules (nutrient, fatty acids, ASTX monoesters and amino acids) C: placebo (microcrystalline cellulose)

C: 0 mg

T2: 8 mg

T1: 2 mg

C: 0 mg

T: 8 mg

90 days

F/M: 23/4

Overweight and obese

BMI 25

56 days

BMI: 16.3-27.5

Age: 20.2-22.8

Healthy subjects (College students), F

BMI: 23.8

Age: 19-33

Healthy subjects, M,

BMI 25

Randomized Placebo-controlled

Age: 25.1 ± 3.7

F/M:20/3

T:Overweight and obese

Participants Characteristic

Double blind

C: 0 mg

84 days

21 days

Duration

Age: 20-55

C: placebo (n.a.)

Placebo-controlled

T: 20 mg

C: 0 mg

T2: 20 mg

T1: 5 mg

ASTX dosage per day

Parallel trial (2 groups)

T: ASTX capsules (n.a.)

T: ASTX capsules (made of Haematococcus pluvialis, soybean oil) C: n.a.

Treatment/ Control b

Randomized

Double-blind

Trial (3 groups)

Repeated measured

Randomized

Study design

BMI :22.8±2.34

Age: 26.0±2.34

F/M:10/0

C:Normal weight

C: 14

T2: 14

T1: 14

Total: 42

C: 19

Total: 39

C: 13

T: 14

Total: 27

C: 10

T2: 11

T1: 12

Total: 33

Sample size

8-OHdG, ISP

T: 20

ISP, PON, UA, LDL lag time

MDA, ISP, SOD, TAC

Biomarkers of oxidative stress

Name of the first author; published year; country where the trial conducted. bIntervention arm (ingredients). cCharacteristic of subjects; Gender (M: male, F: Female); Age (years); BMI: Body Mass Index (kg/m2). Abbreviations: ASTX, astaxanthin; n.a., not available; T, treatment groups; C, control groups. TAS, total antioxidant status; TOS, total oxidant status; PAB, Prooxidant-antioxidant balance; TAC, total antioxidant capacity; UA,uric acid; SH groups, sulphydryl groups; TBARS, thiobarbituric acid-reactive substances; MDA, malondialdehyde; ISP, isoprostane; AOPP, advanced oxidation protein product; PEOOH, phosphatidylethanolamine hydroperoxide; PCOOH, phosphatidylcholine hydroperoxide; SOD, superoxide dismutase; GSH-Px, glutathione activity; PON, PON1, paraoxonase; LDL, low density lipid; 8-OHdG, 8-hydroxy-20 -deoxyguanosine.

Park et al. 2010 [49] USA (South Korean)

Karppi et al. 2007 [44] Finland

Choi, Youn et al. 2011 [48] South Korea

Choi, Kim et al. 2011 [47] South Korea

Study ID location

Table I. (Continued)

D. Wu et al., Effects of Astaxanthin Supplementation on Oxidative Stress 183

Int J Vitam Nutr Res (2020), 90 (1–2), 179–194

184

D. Wu et al., Effects of Astaxanthin Supplementation on Oxidative Stress

Figure 1. Flow diagram of the study selection procedure.

[40–45, 48, 49], whereas two studies featured a repeated measures design with incomparable characteristics of participants in controlled groups [46, 47] (Table 1). The sample sizes ranged from 23 to 115 participants. In terms of the intervention arms, all the trials implemented through the use of ASTX capsules, but the treatment dosages were different. The capsuled ASTX was derived from microalgae Haematococcus pluvialis [40–43, 45–49]. The capsules used in eight trials contained ASTX as the only effective component on oxidative stress [40–48], whereas, the capsules used in one trial contained small amounts (<15%) of mixed carotenoids [49]. Dosages of ASTX ranging from 2 mg/day to 40 mg/day were administered in the included trials. Duration of supplementation with ASTX ranged from 3 weeks (21 days) to 3 months (90 days). The participants in the nine trials were adults without specific diseases (diabetes, hypertension, and cardiovascular disease). However, for oxidative damage status, the trial participants were heterogeneous, as follows: included Int J Vitam Nutr Res (2020), 90 (1–2), 179–194

healthy subjects [43–45, 49] without any history of obesity, alcohol abuse, or smoking; and subjects suffering oxidative damage because they are obese or overweight [47, 48], smokers [46], or soccer players [40–42]. All nine included studies [40–49] investigated the antioxidant effect of ASTX on lipid and protein peroxidation products, namely, MDA, TBARS, ISP, and UA. Seven studies [41, 42, 44–48] reported the effect of ASTX on SOD, CAT, GSHPx, and PON. One study [44] focused on LDL oxidation, specifically LDL lag-time. Five studies [40, 42, 46–48] showed the results of plasma antioxidant capability of TAC, TOS, and PAB. One study [49] focused on DNA damage (8-OHdG).

Quality assessment The JADAD scores of the included trials reached the standard, which ranged from 1 to 4 [40–49]. Only one study Ó 2019 Hogrefe

D. Wu et al., Effects of Astaxanthin Supplementation on Oxidative Stress

185

Table II. Quality assessment of included studies. a

Study ID

Description

Baralic et al. 2013, 2015 [40], [41]

Randomized; Double blind;

Compliance

Dietary advice

J.S.b

Compliance by estimating daily energy and nutrient intake of players.

Instructed to refrain from making any drastic changes in their diet and also to abstain from anti-inflammatory, analgesic drugs throughout the study.

n.a.

Instructed to abstain from any antioxidant supplementation

Compliance (97.0%) by counting the returned capsules, questioning the subjects and reporting and measuring the plasma ASTX.

Instructed to maintain current and smoking habit and to refrain from taking any vitamins or antioxidant supplements.

Compliance (99.5%, 98.1%, 98.7%, 3 groups) by assessing interviews self-reports and returned capsule counts; recording dietary intake, alcohol consumption and physical activity 3 days before each blood collection.

Instructed to maintain usual lifestyle (avoid excessive eating and drinking, intense exercise and lack of sleep).

C: n.a.; L: 0 Djordjevic et al. 2012 [42]

Randomized; Double blind; C: n.a.; L: 0.

Kim et al. 2011 [46]

Randomized; n.a.;

C:n.a.;L:n.a. Nakagawa et al. 2011 [43]

Randomized; Double blind;

C: n.a.; L: 0 Peng et al. 2011 [45]

Randomized; Placebo (without mentioning “blind”); C: Stratified random sampling; L: 5/120, 4.2%

The subjects who did not follow the prescribed dose were less than 5.

Instructed to maintain usual lifestyle and diet habits

Choi, Kim et al. 2011 [47]

Randomized; Double blind;

Compliance by counting the remaining ASTX soft capsules, measuring plasma ASTX response, and dietary record.

Instructed to maintain their usual lifestyle and to refrain from taking vitamins, antioxidant supplements and ASTX-rich foods.

Compliance (93.4% and 92.9%, two groups) by counting ASTX capsules.

Instructed to maintain their usual lifestyle and to refrain from taking any vitamins or nutritional supplements.

Compliance by food recordings and measuring plasma ASTX

Instructed not to take any astaxanthin supplementation at baseline and keep their exercise and dietary habits unchanged.

Compliance by measuring plasma ASTX and dietary recall

Instructed to consume their normal diets and refrain from eating astaxanthin-rich foods such as salmon, lobster, and shrimp.

C: n.a.; L: 0 Choi, Youn et al. 2011 [48]

Randomized; Double blind; C: n.a.; L: 0

Karppi et al. 2007 [44]

Randomized; Double blind;

C:n.a.;L: 2.5% Park et al. 2010 [49]

Randomized; Double blind;

C: Stratified random sampling; L: 0 a

Randomization; Allocation concealment; Blinding; Loss to follow-up; C, concealment; L, Loss to follow-up; bJ.S., JADAD score. n.a., not available.

[46] scored 1, because information about the allocation concealment, blinding methods, or follow-up in its content is not available. The remaining eight studies [40–45, 47–49] scored higher than or equal to 3, which could be ranked as “A” level. However, only two trials [45, 49] stated the Ó 2019 Hogrefe

allocation concealment. The majority of the studies were double-blind, except one study [45], which only stated “placebo” without the description of “blind” in the text. Except for the trial by Kim et a1. [46], the other eight trials [40–45, 47–49] mentioned the exact sample sizes in the of Int J Vitam Nutr Res (2020), 90 (1–2), 179–194

186

D. Wu et al., Effects of Astaxanthin Supplementation on Oxidative Stress

Table III. Categorised oxidative parameters of each study. Biomarkers of oxidative stress

Study ID

Lipid oxidation/ peroxidation products 8-epi-PGF2,8-iso-PGF2, 8-isoprostane(ISP)

Kim et al. (2011) [46] [p < 0.05, higher doses (20 mg, 40 mg) groups compared with the lowest one (5 mg)], Choi, Kim et al. (2011) [47] (p < 0.01, compared with the baseline values in ASTX intervention groups), Choi, Youn et al. (2011) [48] (p < 0.01), Karppi et al. (2007) [44] (p > 0.05), Park et al. (2010) [49] (p > 0.05).

plasma malondialdehyde (MDA)

Kim et al. (2011) [46] (p < 0.05, compared with the baseline values in higher doses groups), Peng et al. (2011) [45] (p < 0.01), Choi, Kim et al. (2011)[47] (p < 0.01, compared with the baseline values in ASTX intervention groups), Choi, Youn et al. (2011) [48] (p < 0.01), Djordjevic et al. (2012) [42] (p > 0.05)

thiobarbituric acid-reactive substances (TBARS)

Baralic et al. (2013) [41] (p < 0.05, after 45days, mainly effected by training), Djordjevic et al. (2012) [42] (p > 0.05)

phospholipid hydroperoxides (PLOOH)

Nakagawa et al. (2011) [43] (p < 0.05)

phosphatidyl ethanolamine hydroperoxide (PEOOH)

Nakagawa et al. (2011) [43] (p < 0.01, compared with the baseline values in ASTX intervention groups)

phosphatidyl choline hydroperoxide (PCOOH)

Nakagawa et al. (2011) [43] (p < 0.01, compared with the baseline values in ASTX intervention groups)

low density lipid (LDL) lag time

Karppi et al. (2007) [44] (p > 0.05)

Plasma antioxidant of lipid oxidation

Baralic et al. (2015) [40] (p > 0.05),

uric acid (UA)

Nakagawa et al. (2011) [43] (p < 0.05, compared with the baseline in ASTX intervention groups), Karppi et al. (2007) [44] (p < 0.05, compared with the baseline in ASTX intervention groups)

Protein oxidation advanced oxidation protein product (AOPP)

Baralic et al. (2013) [41] (p > 0.05), Djordjevic et al. (2012) [42] (p > 0.05)

sulphydryl (SH) groups

Baralic et al.(2013) [41] (p < 0.05, compared with baseline values in ASTX intervention groups), Djordjevic et al.(2012) [42] (p > 0.05)

Plasma antioxidant status or capability total antioxidant status (TAS)

Baralic et al. (2015) [40] (p > 0.05), Djordjevic et al. (2012) [42] (p < 0.05)

total oxidant status (TOS)

Baralic et al. (2015) [40] (p > 0.05)

pro-oxidant antioxidant balance (PAB)

Baralic et al. (2015) [40] (p < 0.05, compared with baseline values in ASTX intervention groups)

redox Balance

Baralic et al. (2013) [41] (p < 0.001, compared with baseline values in ASTX intervention groups)

total antioxidant capacity (TAC)

Kim et al. (2011) [46] (p < 0.05, compared with the baseline values in all doses), Choi, Kim et al. (2011) [47] (p < 0.01, compared with the baseline values in ASTX intervention groups), Choi, Youn et al. (2011) [48] (p < 0.01)

Antioxidant enzyme superoxide dismutase (SOD)

Kim et al. (2011) [46] (p < 0.05, compared with the baseline values in all dose groups), Peng et al. (2011) [45] (p < 0.01), Choi, Kim et al. (2011) [47] (p < 0.01, compared with the baseline values in ASTX intervention groups), Choi, Youn et al. (2011) [48] (p<0.01), Djordjevic et al. (2012) [42] (p > 0.05)

glutathione peroxidase (GSH-Px activity) Peng et al. (2011) [45] (p < 0.01) paraoxonase (PON, PON1)

Baralic.et al. (2013) [41] (p < 0.05, compared with the baseline values in ASTX intervention groups), Karppi et al. (2007) [44] (p > 0.05)

DNA damage 8-hydroxy-2-deoxyguanosine (8-OHdG)

Park et al. (2010) [49](p < 0.01)

P > 0.05 means no significant difference with control groups or baseline; p < 0.05 or 0.01 means significant difference with control group.

Int J Vitam Nutr Res (2020), 90 (1–2), 179–194

Ó 2019 Hogrefe

D. Wu et al., Effects of Astaxanthin Supplementation on Oxidative Stress

187

Figure 2. Forest plot: effect of astaxanthin (ASTX) supplementation on plasma isoprostane (ISP) based on the comparison with baseline in intervention groups (subgroup analysis by dosage), presented as ng/mL. SMD, Standard mean difference; CI, confidence interval.

method and result sections; six trials [40–43, 45–47] did not lose any participant, and two trials [44, 45] discussed the details of the loss to follow-up. Most of the trials described the methods for evaluating participant compliance [40, 41, 43–49], including estimating daily energy and nutrient intake of subjects [40, 41, 43, 44, 47–49], counting the returned capsules [43, 46–48], conducting interviews or measuring plasma ASTX [44, 49]; four of the studies provide the adherence rates or amounts of the subjects who did not follow [43, 45, 46, 48]. For dietary advices, seven of the nine studies suggested that the subjects should refrain from having ASTX-rich food, other antioxidants or anti-inflammatory supplementation, and even avoid the supplements which have effect on immune [40–42, 44, 46–49]; seven of them [41, 43–45, 47–49] instructed the volunteers to maintain usual lifestyle and diet habits. All of the studies mentioned the details of dietary advices. Quality assessment results are shown in Table 2.

Oxidative biomarkers assessment The oxidative stress biomarkers mentioned in the nine included trials are collected and presented in Table 3. The sum of oxidative parameters applied in these studies was Ó 2019 Hogrefe

nearly 20, covering most of the aspects of oxidative stress. The summary of the results is presented below. Lipid oxidation/peroxidation products. Lipid oxidation/ peroxidation products were evaluated in all of the included studies [41–49].Two trials detected TBARS without clear results [41, 42]. One found no effect (p > 0.05), whereas the other one reported the difference between ASTX and placebo groups (p < 0.05), which was mainly influenced by training instead of ASTX supplements. Only Nakagawa et al. assessed the value of PLOOH, including PEOOH and PCOOH values (p < 0.01, compared with the baseline in ASTX groups) [43]. The total PLOOH levels were lower in the ASTX groups than in the placebo group (p < 0.05). Five trials focused on plasma MDA [42, 45–48], whereas ISP was evaluated in five trials [44, 46–49] (Table 3). Data of plasma MDA and ISP were subjected to a meta-analysis. ASTX intervention and control groups. Three RCTs [42, 45, 48] evaluated the concentration of plasma MDA. The random-effect meta-analysis of data showed a borderline significant decrease of plasma MDA concentrations with ASTX supplementation (SMD 1.15 μmol/L [95% CI 2.30, 0.00]; p = 0.050) (the figure is shown in ESM 7). However, given that only three RCTs are qualified to be included in the meta-analysis, data are insufficient for determination. Int J Vitam Nutr Res (2020), 90 (1–2), 179–194

188

D. Wu et al., Effects of Astaxanthin Supplementation on Oxidative Stress

Comparison with the baseline. The random-effect metaanalysis of data from five trials (eight treatment arms) with a pooled sample size of 152 subjects showed significant effect of ASTX on plasma MDA (SMD 1.32 μmol/L [95% CI 1.92, 0.72], p < 0.0001). The treatment effect was apparent when trials were divided into subgroups by ASTX dosage as well ( 20 mg/day, SMD 1.69 μmol/L [95% CI 2.28, 1.09], p < 0.0001; <20 mg/day, SMD 0.72 μmol/L, [95% CI 1.41, 0.04], p = 0.039). The outcomes were similar in short term (21 days) and long term (84 or 90 days) (short term, SMD 1.16 μmol/L [95% CI 1.54, 0.77]; p < 0.0001; long term, SMD 1.55 μmol/ L, [95% CI 3.01, 0.08]; p = 0.038). No heterogeneity was observed in the short-term group (I2 = 0.0%; p = 0.749), whereas heterogeneity still existed in long-term studies (I2 = 93.1%; p < 0.0001) (figures are shown in ESM 1 and 2). For ISP, with a total pooled sample size of 96 subjects, the ASTX treatment significantly decreased the concentration of ISP (SMD 3.10 ng/mL [95% CI 4.69, 1.51]; p < 0.0001) (Figure 2.). The subgroup meta-analysis of a four-arm trial investigating the effect of ASTX dosage 20 mg/day revealed a statistically significant reduction of ISP (SMD 3.63 ng/mL [95% CI 4.85, 2.41]; p < 0.0001). In contrast, the subgroup meta-analysis of three-arm trial using ASTX dosage <20 mg/day was not significantly different compared with baseline values (SMD 2.33 ng/mL [95% CI 4.88, 0.22]; p = 0.073) (Figure 2.). In the second subgroup analysis of the duration of intervention, ASTX significantly reduced the concentration of ISP in the short-term group (21 days), whereas no effect was shown in the long-term group (84 or 90 days) (short term, SMD 3.23 ng/mL [95% CI 4.44, 2.01]; p < 0.0001, long term, SMD 2.74 ng/mL, [95% CI 8.21, 2.74]; p = 0.327) (the figure is shown in ESM 3). No difference was found in control groups of any of the trials. Heterogeneity was high for MDA (I2 = 79.5%; p < 0.0001) but was not explained by different ASTX dosages. To some extent, the duration of intervention contributed to explain the heterogeneity of MDA. However, neither the dosage nor duration of intervention could explain the high heterogeneity of ISP (I2 = 93.0%; p < 0.0001). Plasma antioxidants of lipid oxidation. UA was investigated in three trials [40, 43, 44]. Except the one directed by Baralic [40], the other two trials reported the differences of UA versus baseline in the treatment groups. However, inverse changes in blood biomarkers were noted, with Karppi et al. [44] indicating an increase in oxidation and Nakagawa et al. indicating a decrease [50]. No other significant effect of ASTX on UA was reported, neither compared with the placebo groups nor baseline. Given the evidence of no heterogeneity among the three studies (I2 = 0.0%; p = 0.705), we used a fixed effects model to calculate the mean Int J Vitam Nutr Res (2020), 90 (1–2), 179–194

difference with a pooled sample size of 119 subjects. In comparison with control groups, a slight decrease on UA in ASTX groups was observed; this decrease is insignificant (SMD 0.01 mg/dL [95% CI 0.37, 0.36]; p = 0.975) (figure is shown in ESM 5). Protein oxidation/oxidation products. In terms of protein oxidation, AOPP was reported in two trials without any significant effect (p > 0.05) [41, 42]. These two trials also focused on –SH groups; Baralic et al. found a significant protective effect with the supplementation of ASTX compared with the baseline values [41]. However, no similar evidence was found in the other trails [42] (Table 3). Plasma antioxidant status or capability. TAS, TOS, PAB, redox balance, and TAC were adopted to assess the total plasma antioxidant status or capability. For TAS, one trial [42] found a significant effect with ASTX treatment (p < 0.05). However, the other one [40] reported no effect (p > 0.05). In comparison with the baseline values in ASTX groups, PAB and redox balances reportedly showed significant differences (p < 0.05) [40, 41] (Table 3). TAC data were considered appropriate for meta-analysis. The random-effect meta-analysis (I2 = 72.5%; p = 0.003) of data from three trials (six treatment arms) [46–48] with a pooled sample size of 76 subjects showed significant effect of ASTX on TAC (SMD 0.77 mmol [95% CI 0.12, 1.43]; p = 0.018). However, the subgroup analysis depending on dosage showed no significant effect on the ASTX groups with low dosage (SMD 0.49 mmol [95% CI 1.06, 2.04]; p = 0.539) (figures are shown in ESM 6). No significant effect was found for other parameters. Antioxidant enzyme and DNA damage. Seven trials focused on antioxidant enzymes, including SOD [42, 45– 48], GSH-Px [45], and PON [41, 44]. The difference between the intervention and control groups are not statistically significant at a level of p = 0.055; data of three RCTs [42, 45, 48] including 90 participants were pooled (SMD 1.09 U/mL [95% CI 0.02, 2.20]). Given the limited data, the results were still uncertain. However, treatment effect was apparent when data obtained before and after the interventions were compared, with 152 subjects [42, 45–48] (SMD 1.57 U/mL [95% CI 0.57, 2.56]; p = 0.002) (figures are shown in ESM 4 and 8). When the trials were divided by dosage, the subgroup random effect analysis showed that no significant effect was observed in the low-dose group; however, in the high-dose group, the increase of SOD is found ( 20 mg/day, SMD 1.92 U/mL [95% CI 0.78, 3.06], p = 0.001; <20 mg/day, SMD 0.99 U/mL [95% CI 1.41, 3.38], p = 0.419). Further subgroup analysis of duration indicated significant increases on SOD in shortterm group (21 days). However, ASTX failed to indicate its antioxidant activity in the long-term group (84 or 90 days) (short term, SMD 2.51 U/mL [95% CI 1.99, 3.03], p < 0.0001; long term, SMD 2.74 U/mL, [95% CI 1.09, Ó 2019 Hogrefe

D. Wu et al., Effects of Astaxanthin Supplementation on Oxidative Stress

189

Figure 3. Forest plot: effect of astaxanthin (ASTX) supplementation on plasma superoxide dismutase (SOD) based on the comparison with baseline in intervention groups (subgroup analysis by duration of intervention), presented as U / mL. SMD, Standard mean difference; CI, confidence interval.

1.19], p = 0.937). No heterogeneity was observed in the short-term group (I2 =12.4%; p = 0.335), whereas heterogeneity still existed in long-term studies (I2 = 90.3%; p < 0.0001) (Figure 3). Only one trial [45] evaluated GSH-Px activity and reported a significant effect. Karppi et al. assessed PON activity or relative items with no significant effect [51]. Baralic et al. suggested the increase of PON activity compared with baseline (Table 3) [48]. For DNA damage, Park et al. found the decreasing plasma 8-OHdG in ASTX groups versus control groups (p < 0.01) [49] (Table 3).

Sensitivity analyses Sensitivity analyses were conducted by excluding each study to test the robustness of results. Sensitivity analyses did not alter the results significantly (figures are not shown).

Publication bias Considering that few studies met the inclusion criteria of our meta-analysis, the publication bias was not visualized Ó 2019 Hogrefe

by funnel plot. Instead, the fail-safe numbers were conducted to explore the publication bias. At 0.05 and 0.01 significance levels, studies on UA may have publication bias (Nfs(0.05) = 3.8, Nfs0.01 = 3.9); other Nfs0.05 or Nfs0.01 values were consistently greater than the number of studies included in this meta-analysis (table is shown in ESM 9).

Discussion Our meta-analysis suggests that ASTX may be effective in reducing oxidative stress as ASTX may effectively reduce the total amount of the specific lipid peroxidation (MDA and ISP), enhance plasma antioxidant capability (TAC), and elevate a specific antioxidant enzyme (SOD). MDA, a decomposition product of peroxidised polyunsaturated fatty acids in membrane lipids, is thought to be one of the most sensitive biological molecules in terms of susceptibility to reactive oxygen species over a long period of time [50, 51]. MDA is one of the most widely used indicators in literature for animal models and clinical trials [45–48, 52–55]; however, the use of MDA as a valid biomarker of lipid peroxidation within human in recent studies is Int J Vitam Nutr Res (2020), 90 (1–2), 179–194

190

D. Wu et al., Effects of Astaxanthin Supplementation on Oxidative Stress

controversial [56]. Despite the controversy, MDA is still recognized as a relatively good biomarker for the present review. ISP is one of the eicosanoids formed in vivo from free radical-catalyzed oxidation of primarily arachidonic acid. ISP is a frequently used and reliable biomarker of in vivo lipid peroxidation [57, 58]. In our study, daily supplementation with ASTX significantly decreased the plasma levels of MDA and ISP from the baseline level. However, the difference in MDA between the ASTX treatment and control groups was still unclear because of limited data. ASTX is one of the most effective antioxidants against lipid peroxidation among in vitro and in vivo systems [59]. The effect of ASTX in inhibiting radical-initiated lipid peroxidation has been revealed in vitro or in animal models, and ASTX might be several times more active than α-tocopherol in protecting rat mitochondria against lipid peroxidation [60] and human lens epithelial cells against UVB radiation insult [61]. The potent antioxidant activity of ASTX is due to its polar structure, which features ionone rings with the capability to quench free radicals [62]. ASTX might not only eliminate lipid peroxidation but also enhance the antioxidant system. The present review suggested the increase in plasma levels of SOD and TAC with ASTX intake compared with the baseline. SOD is the main in vivo antioxidant enzyme that quenches superoxide anions, and TAC represents a full spectrum of antioxidant activities against various reactive radicals [63]. However, the meta-analysis results of three RCTs did not show significant effect on SOD. This result was different from the result in comparison with the baseline values. The null result might have occurred due to the limited amount of the included RCTs. However, two of the three included trials suggested significant effects [45, 48]. Only Djordjevic et al. showed a negative result [42], which could be due to the subjects in this trial who suffered from prolonged exercise leading to strong oxidative stress in the antioxidant system; therefore, the synthesis result of the meta-analysis was affected. All in all, data were not enough for determination. Thus, the effect of ASTX either on lipid peroxidation or on antioxidant system was still unclear. Unfortunately, the result based on UA was not confirmed. UA is a final enzymatic product following an oxidant– antioxidant paradox [64]. UA can work as an antioxidant with some protective effects under certain conditions; it may be a pro-oxidant producing other radicals that might lead to oxidative damage. Thus, UA might not be a suitable marker of oxidative stress. Moreover, its unsafe index was relatively low indicating that the evidence may be not reliable. No clear conclusion was found based on UA. A subgroup analysis was performed to test dosages of ASTX. The effects were more significant if taken in high dosages, which were greater than or equal to 20 mg daily.

Int J Vitam Nutr Res (2020), 90 (1–2), 179–194

When the dosages of ASTX were lower than 20 mg, no statistically significant effect was found for ISP, TAC, and SOD, whereas the protective effect was consistently observed in the high-dosage groups. Results suggest that the antioxidant capability of ASTX may be dose-related. However, one trial failed to find any difference between the 5 mg ASTX group and the 20 mg ASTX group on any biomarker or clinical results. However, the plasma concentration of ASTX in the 20 mg group was significantly higher than in the 5 mg group [47]. This phenomenon may be similar with other carotenoids, which may lose their effectiveness as antioxidants at high concentrations [65]. Thus, the dose-related antioxidant effect of ASTX is still unconfirmed. Given the ISP and SOD data, the second subgroup analysis indicated that ASTX showed antioxidant effect in short-term trials (3 weeks), but the effect was not significant when the duration of intervention expanded to long term (12 weeks or 3 months). Controversially, the long-term RCTs included in this review did suggest the antioxidant efficacy of ASTX on other biomarkers, such as MDA, GSH-Px, and TAC [45, 48]. As literature shows, the lack of long-term effect of β-carotene on cardiovascular disease has been suggested [66]. However, given the limited studies on humans, it is still unclear whether ASTX will lose its antioxidant effect as β-carotene in the long term. More recently, some researchers suggest that antioxidant vitamins, which include vitamins E and C, may have adverse effects on healthy subjects, especially in high doses because of the imbalance of endogenous redox equilibrium [67, 68]. However, the systematic review did not indicate any detrimental effect of ASTX on healthy subjects in doses given. Peng et al., Park et al., and Nakagawa et al. indicated the protective effect of ASTX against oxidative stress on healthy subjects from different aspects [43, 45, 49], whereas Karppi et al. found no antioxidant effect [44]. However, whether ASTX can show antioxidant effects on healthy subjects who are not suffering oxidative damage is unclear. Thus far, no adverse effect or clinical result has been found in the doses administered.

Strengths and limitations To our knowledge, this is the first systematic review about the effect of ASTX supplementation on oxidative stress based on clinical trials. The included criteria are rigid, as we excluded the trials in which ASTX were not the main antioxidant supplementation to eliminate the interference from other antioxidants. Also, a detailed research protocol with prior specification and evaluation of potential study design considerations without language exclusion was included. Furthermore, subgroup analyses were performed

Ó 2019 Hogrefe

D. Wu et al., Effects of Astaxanthin Supplementation on Oxidative Stress

to explore factors affecting ASTX’s antioxidant capability. To completely explore the data, the differences between before and after intervention treatments have been taken into consideration in the meta-analysis as well. Currently, some biomarkers of oxidative stress used in this review, such as TBARS or MDA, and TAC, have been questioned in human studies [56, 69, 70]. However, no evidence exists to dispute their function as markers. The markers were widely used as important indicators in clinical trials and are relatively accessible. Hence, these controversial biomarkers were still included in this systematic review. Diverse biomarkers of oxidative stress were categorized to analyse the antioxidant activity of ASTX through comprehensive views. The present systematic review does have its limitations. First, the heterogeneity could not be fully explained by subgroup analyses based on dosage and duration of intervention; this heterogeneity may be caused by other factors, such as the different genders, ages, or the difference in oxidant status of subjects. However, limited trials focusing on the same biomarkers make it challenging to explore all possible factors for the subgroup analyses. Therefore, we were unable to confirm whether ASTX has different antioxidant effects among subjects with different ages, genders, or other characteristics; this result highlights the need for future research. Second, the RCTs involving supplementation with small quantities of other nutrients included might influence antioxidant effects of ASTX. However, the same is true for all the manufactured ASTX supplements. From a practical standpoint, the application of pure ASTX is very limited. Producing ASTX capsules with other essential components such as oils and other nutrients is very common. Thus, this review remains practically valuable for the consumption of lycopene supplements in the real world. Third, the present review includes two repeated-measurement trials with inequivalent control groups [46, 47]. These two trials focused on smokers and the obese or overweight. However, they set normal subjects who did not smoke or with normal weight as control. Therefore, data from control groups in these two trials were not included in meta-analyses. Instead, the differences between pre- and pro-intervention based on the two trials were compared to completely analyse the limited data. In conclusion, the antioxidant effect of ASTX on humans is still unclear based on this systematic review and metaanalysis of nine trials. However, this review reflects the potential protective effect of supplementation with ASTX on oxidative stress by eliminating the lipid peroxidation/ products and enhancing the antioxidant system by inducing an increase in the plasma concentration of SOD. Further, well-designed clinical trials are necessary to provide more evidence. Ó 2019 Hogrefe

191

Electronic supplementary material The electronic supplementary material is available with the online version of the article at http://dx.doi.org/10.1024/ 0300-9831/a000497 ESM 1. Figure. Forest plot: effect of astaxanthin (ASTX) supplementation on plasma malondialdehyde (MDA) based on the comparison with baseline in intervention groups (subgroup analysis by dosage), presented as μmol/l. SMD, Standard mean difference; CI, confidence interval. ESM 2. Figure. Forest plot: effect of astaxanthin (ASTX) supplementation on plasma malondialdehyde (MDA) based on the comparison with baseline in intervention groups (subgroup analysis by duration of intervention), presented as μmol/l. SMD, Standard mean difference; CI, confidence interval. ESM 3. Figure. Forest plot: effect of astaxanthin (ASTX) supplementation on plasma isoprostane (ISP) based on the comparison with baseline in intervention groups (subgroup analysis by duration of intervention), presented as ng/ml. SMD, Standard mean difference; CI, confidence interval. ESM 4. Figure. Forest plot: effect of astaxanthin (ASTX) supplementation on plasma superoxide dismutase (SOD) based on the comparison with baseline in intervention groups (subgroup analysis by dosage), presented as U/ml. SMD, Standard mean difference; CI, confidence interval. ESM 5. Figure. Forest plot: effect of astaxanthin (ASTX) supplementation on plasma uric acid (UA) based on the comparison between the treatment and control groups, presented as mg/dl. SMD, Standard mean difference; CI, confidence interval. ESM 6. Figure. Forest plot: effect of astaxanthin (ASTX) supplementation on total antioxidant capability (TAC) based on the comparison with baseline in intervention groups (subgroup analysis by dosage), presented as mmol. SMD, Standard mean difference; CI, confidence interval. ESM 7. Figure. Forest plot: effect of astaxanthin (ASTX) supplementation on plasma malondialdehyde (MDA) based on the comparison between the treatment and control groups, presented as μmol/L. SMD, Standard mean difference; CI, confidence interval. ESM 8. Figure. Forest plot: effect of astaxanthin (ASTX) supplementation on plasma superoxide dismutase (SOD) based on the comparison between the treatment and control groups, presented as U/mL. SMD, Standard mean difference; CI, confidence interval. Int J Vitam Nutr Res (2020), 90 (1–2), 179–194

192

D. Wu et al., Effects of Astaxanthin Supplementation on Oxidative Stress

ESM 9. Table. Fail-safe numbers of each meta-analysis.

References 1. Shukla, V., Mishra, S.K., & Pant, H.C. (2011) Oxidative stress in neurodegeneration. Adv. Pharmacol. Sci. 2011, 1–13. 2. Sies, H., & Jones, D.P. (2007) Oxidative Stress. In Encyclopedia of Stress. (vol. 3 pp. 45–48). Elsevier. 3. Uki, M., Ninkovi, M., & Jovanovi, M. (2008) Oxidative stress clinical diagnostic significance. J. Med. Biochem. 27, 409–425. 4. Schriner, S.E., Linford, N.J., Martin, G.M., Treuting, P., Ogburn, C.E., Emond, M., Coskun, P.E., Ladiges, W., Wolf, N., Van Remmen, H., Wallace, D.C., & Rabinovitch, P.S. (2005) Extension of murine life span by overexpression of catalase targeted to mitochondria. Science. 308, 1909–1911. 5. Dzau, V.J., Antman, E.M., Black, H.R., Hayes, D.L., Manson, J. E., Plutzky, J., Popma, J.J., & Stevenson, W. (2006) The cardiovascular disease continuum validated: clinical evidence of improved patient outcomes: part ii: clinical trial evidence (acute coronary syndromes through renal disease) and future directions. Circulation. 114, 2871–2891. 6. Serrano, M., & Blasco, M. (2007) Cancer and ageing: convergent and divergent mechanisms. Nat. Rev. Mol. Cell Biol. 8, 715–722. 7. Houstis, N., Rosen, E.D., & Lander, E.S. (2006) Reactive oxygen species have a causal role in multiple forms of insulin resistance. Nature. 440, 944–948. 8. Beal, M.F. (2003) Bioenergetic approaches for neuroprotection in parkinson ‘ s disease. Ann Neurol. 53, 39–48. 9. Brezezinska-Slebodzinska, E., Slebodzinski, A.B., Pietras, B., & Wieczorek, G. (1995) Antioxidant effect of vitamin e and glutathione on lipid peroxidation in boar semen plasma. Biol. Trace Elem. Res. 47, 69–74. 10. Sindhu, E.R., Preethi, K.C., & Kuttan, R. (2010) Antioxidant activity of carotenoid lutein in vitro and in vivo. Indian J. Exp. Biol. 48, 843. 11. Bohm, F., Edge, R., Mcgarvey, D.J., & Truscott, T.G. (1998) Beta-carotene with vitamins e and c offers synergistic cell protection against nox. Febs Letters. 436, 387–389. 12. Chen, K., Suh, J., Carr, A.C., Morrow, J.D., Zeind, J., & Frei, B. (2001) Vitamin c suppresses oxidative lipid damage in vivo, even in the presence of iron overload. Am. J. Physiol. – Endocrinol. Metab. 279, 1406–1412. 13. Darr, D., Combs, S., Dunston, S., Manning, T., & Pinnell, S. (1992) Topical vitamin c protects porcine skin from ultraviolet radiation-induced damage. Br. J. Dermatol. 127, 247–253. 14. Xavier, S.M., Barbosa, C.O., Barros, D.O., Silva, R.F., Oliveira, A.A., & Freitas, R.M. (2007) Vitamin c antioxidant effects in hippocampus of adult wistar rats after seizures and status epilepticus induced by pilocarpine. Neurosci. Lett. 420, 76–79. 15. Cocate, P.G., Natali, A.J., Alfenas, R.C., De, O.A., Dos Santos, E.C., & Hermsdorff, H.H. (2015) Carotenoid consumption is related to lower lipid oxidation and dna damage in middleaged men. Br. J. Nutr. 114, 1–8. 16. Carty, J.L., Bevan, R., Waller, H., Mistry, N., Cooke, M., Lunec, J., & Griffiths, H.R. (2000) The effects of vitamin c supplementation on protein oxidation in healthy volunteers. Biochem. Biophys. Res. Commun. 273, 729–735. 17. Yusuf, S., Dagenais, G., Pogue, J., Bosch, J., & Sleight, P. (2000) Vitamin e supplementation and cardiovascular events in highrisk patients. the heart outcomes prevention evaluation study investigators. N. Engl. J. Med. 342(3), 154–160.

Int J Vitam Nutr Res (2020), 90 (1–2), 179–194

18. Heart Protection Study Collaborative Group. (2002) Mrc/bhf heart protection study of antioxidant vitamin supplementation in 20, 536 high-risk individuals: a randomised placebocontrolled trial. Lancet. 360, 23–33. 19. Miller, E.R., Pastorbarriuso, R., Dalal, D., Riemersma, R.A., Appel, L.J., & Guallar, E. (2005) Meta-analysis: high-dosage vitamin e supplementation may increase all-cause mortality. Ann. Intern. Med. 142, 37–47. 20. Stanner, S.A., Hughes, J., & Buttriss, C.K.J. (2004) A review of the epidemiological evidence for the ‘antioxidant hypothesis’. Public Health Nutr. 7, 407–422. 21. Steinhubl, S.R. (2008) Why have antioxidants failed in clinical trials? Am. J. Cardiol. 101, 14–19. 22. Fassett, R.G., & Coombes, J.S. (2009) Astaxanthin, oxidative stress, inflammation and cardiovascular disease. Future Cardiol. 5, 333–342. 23. Fassett, R.G., & Coombes, J.S. (2012) Astaxanthin in cardiovascular health and disease. Molecules. 17, 2030–2048. 24. Lee, S., & Min, D. (1990) Effects, quenching mechanisms, and kinetics of carotenoids in chlorophyll-sensitized photooxidation of soybean oil. J. Agric. Food Chem. 38, 1630–1634. 25. Shmidzu, N., Goto, M., & Miki, W. (1996) Carotenoids as singlet oxygen quenchers in marine organisms. Fish Sci. 62, 134–137. 26. Mcnulty, H., Jacob, R.F., & Mason, R.P. (2008) Biologic activity of carotenoids related to distinct membrane physicochemical interactions. Am. J. Cardiol. 101, 20–29. 27. Kochi, T., Shimizu, M., Sumi, T., Kubota, M., Shirakami, Y., Tanaka, T., & Moriwaki, H. (2014) Inhibitory effects of astaxanthin on azoxymethane-induced colonic preneoplastic lesions in c57/bl/ksj-db/db mice. BMC Gastroenterol. 14, 212. 28. Guo, S.X., Zhou, H.L., Huang, C.L., You, C.G., Fang, Q., Wu, P., Wang, X.G., & Han, C.M. (2015) Astaxanthin attenuates early acute kidney injury following severe burns in rats by ameliorating oxidative stress and mitochondrial-related apoptosis. Mar. Drugs. 13, 2105–2123. 29. Fassett, R.G., & Coombes, J.S. (2011) Astaxanthin: A potential therapeutic agent in cardiovascular disease. Mar. Drugs. 9, 447–465. 30. Iwamoto, T., Hosoda, K., Hirano, R., Kurata, H., Matsumoto, A., Miki, W., Kamiyama, M., Itakura, H., Yamamoto, S., & Kondo, K. (2000) Inhibition of low-density lipoprotein oxidation by astaxanthin. J. Atheroscler. Thromb. 7, 216–222. 31. Rufer, C.E., Moeseneder, J., Briviba, K., Rechkemmer, G., & Bub, A. (2008) Bioavailability of astaxanthin stereoisomers from wild (oncorhynchus spp.) and aquacultured (salmo salar) salmon in healthy men: a randomised, double-blind study. Br. J. Nutr. 99, 1048–1054. 32. Haematococcus, A., Spiller, G.A., & Dewell, A. (2003) Safety of an astaxanthin-rich haematococcus pluvialis algal extract: a randomized clinical trial. J. Med. Food. 6, 51–56. 33. Chen, J., Song, Y., & Zhang, L. (2013) Effect of lycopene supplementation on oxidative stress: an exploratory systematic review and meta-analysis of randomized controlled trials. J. Med. Food. 16, 361–374. 34. Betteridge, D.J. (2000) What is oxidative stress? Metabolism. 49, 3–8. 35. Shuster, J.J. (2011) Review: Cochrane handbook for systematic reviews for interventions, Version 5.1.0, published 3/2011. Julian P.T Higgins and Sally Green, Editors. Res. Synth. Methods. 2, 126–130. 36. Kiehna, E.N., Starke, R.M., Pouratian, N., & Dumont, A.S. (2010) Standards for reporting randomized controlled trials in neurosurgery. J. Neurosurg. 114, 280–285. 37. Hsu, Y.M., Lai, C.H., Chang, C.Y., Fan, C.T., Chen, C.T., & Wu, C.H. (2008) Characterizing the lipid-lowering effects and

Ó 2019 Hogrefe

D. Wu et al., Effects of Astaxanthin Supplementation on Oxidative Stress

38.

39.

40.

41.

42.

43.

44.

45.

46.

47.

48.

49.

50.

51.

52.

53.

antioxidant mechanisms of tomato paste. Biosci. Biotechnol. Biochem. 72, 677–685. European Food Safety Authority. (2014) Scientific Opinion on the safety of astaxanthin-rich ingredients (AstaREAL A1010 and AstaREAL L10) as novel food ingredients. EFSA J. 12, 1–35. Rosenberg, M.S. (2005) The file-drawer problem revisited: a general weighted method for calculating fail-safe numbers in meta-analysis. Evolution (N.Y). 59, 464–468. Baralic, I., Andjelkovic, M., Djordjevic, B., Dikic, N., Radivojevic, N., Suzin-Zivkovic, V., Radojevic-Skodric, S., & Pejic, S. (2015) Effect of astaxanthin supplementation on salivary iga, oxidative stress, and inflammation in young soccer players. Evidence-based Complementary and Alternative Medicine. 2015, 41–46. Baralic, I., Djordjevic, B., Dikic, N., Kotur-Stevuljevic, J., Spasic, S., Jelic-Ivanovic, Z., Radivojevic, N., Andjelkovic, M., & Pejic, S. (2013) Effect of astaxanthin supplementation on paraoxonase 1 activities and oxidative stress status in young soccer players. Phytotherapy Research Ptr. 27, 1536–1542. Djordjevic, B., Baralic, I., Kotur-Stevuljevic, J., Stefanovic, A., Ivanisevic, J., Radivojevic, N., Andjelkovic, M., & Dikic, N. (2012) Effect of astaxanthin supplementation on muscle damage and oxidative stress markers in elite young soccer players. J. Sports Med. Phys. Fitness. 52, 382–392. Nakagawa, K., Kiko, T., Miyazawa, T., Carpentero Burdeos, G., Kimura, F., Satoh, A., & Miyazawa, T. (2011) Antioxidant effect of astaxanthin on phospholipid peroxidation in human erythrocytes. Br. J. Nutr. 105, 1563–1571. Karppi, J., Rissanen, T.H., Nyyssonen, K., Kaikkonen, J., Olsson, A.G., Voutilainen, S., & Salonen, J.T. (2007) Effects of astaxanthin supplementation on lipid peroxidation. Int. J. Vitam. Nutr. Res. 77, 3–11. Peng, L., Zhao, P., Li, B., Zhang, J., & Huang, C. (2011) Antioxidant effects and impact on human health of astaxanthin. Chinese J. Food Hyg. 23, 313–316. Kim, J.H., Chang, M.J., Choi, H.D., Youn, Y.-K., Kim, J.T., Oh, J. M., & Shin, W.G. (2011) Protective Effects of Haematococcus Astaxanthin on Oxidative Stress in Healthy Smokers. J. Med. Food. 14, 1469–1475. Choi, H.D., Kim, J.H., Chang, M.J., Kyu-Youn, Y., & Shin, W.G. (2011) Effects of astaxanthin on oxidative stress in overweight and obese adults. Phyther. Res. 25, 1813–1818. Choi, H.D., Youn, Y.K., & Shin, W.G. (2011) Positive effects of astaxanthin on lipid profiles and oxidative stress in overweight Subjects. Plant Foods Hum. Nutr. 66, 363–369. Park, J.S., Chyun, J.H., Kim, Y.K., Line, L.L., & Chew, B.P. (2010) Astaxanthin decreased oxidative stress and inflammation and enhanced immune response in humans. Nutr. Metab. (Lond). 7, 18. Gaweł, S., Wardas, M., Niedworok, E., & Wardas, P. (2004) Malondialdehyde (mda) as a lipid peroxidation marker. Wiad. Lek. 57, 453–455. Repetto, M., Semprine, J., & Boveris, A. (2012) Lipid peroxidation: chemical mechanism, biological implications and analytical determination. In Lipid peroxidation. (vol 1, pp 29). InTech. Nielsen, F., Mikkelsen, B.B., Nielsen, J.B., Andersen, H.R., & Grandjean, P. (1997) Plasma malondialdehyde as biomarker for oxidative stress: reference interval and effects of life-style factors. Clin. Chem. 43, 1209–1214. Kadiiska, M.B., Gladen, B.C., Baird, D.D., Graham, L.B., Parker, C.E., Ames, B.N., Basu, S., FitzGerald, G.A., Lawson, J.A., Marnett, L.J., Morrow, J.D., Murray, D.M., Plastaras, J., Roberts, L.J., Rokach, J., Shigenaga, M.K., Sun, J., Walter, P.B., Tomer, K.B., Barrett, J.C., & Mason, R.P. (2005) Biomarkers of oxidative stress study: III. effects of the nonsteroidal

Ó 2019 Hogrefe

54.

55.

56.

57.

58.

59.

60.

61.

62.

63. 64.

65.

66.

67.

68.

193

anti-inflammatory agents indomethacin and meclofenamic acid on measurements of oxidative products of lipids in ccl4 poisoning. Free Radic. Biol. Med. 38, 711–718. Kadiiska, M.B., Gladen, B.C., Baird, D.D., Dikalova, A.E., Sohal, R.S., Hatch, G.E., Jones, D.P., Mason, R.P., & Barrett, J.C. (2000) Biomarkers of oxidative stress study: are plasma antioxidants markers of ccl4 poisoning? Free Radic. Biol. Med. 28, 838–845. Kadiiska, M.B., Gladen, B.C., Baird, D.D., Germolec, D., Graham, L.B., Parker, C.E., Nyska, A., Wachsman, J.T., Ames, B.N., Basu, S., Brot, N., FitzGerald, G.A., Floyd, R.A., George, M., Heinecke, J.W., Hatch, G.E., Hensley, K., Lawson, J.A., Marnett, L.J., Morrow, J.D., Murray, D.M., Plastaras, J., Roberts, L.J., Rokach, J., Shigenaga, M.K., Sohal, R.S., Sun, J., Tice, R.R., Van Thiel, D.H., Wellner, D., Walter, P.B., Tomer, K.B., Mason, R.P., & Barrett, J.C. (2005) Biomarkers of oxidative stress study II: are oxidation products of lipids, proteins, and DNA markers of ccl 4 poisoning? Free Radic. Biol. Med. 38, 698–710. Khoubnasabjafari, M., Ansarin, K., & Jouyban, A. (2015) Reliability of malondialdehyde as a biomarker of oxidative stress in psychological disorders. Bioimpacts. 5, 123–127. Montuschi, P., Barnes, P.J., & Roberts, L.J. (2004) Isoprostanes: markers and mediators of oxidative stress. FASEB J. 18, 1791–1800. Roberts, L.J., & Morrow, J.D. (2000) Measurement of F 2-isoprostanes as an index of oxidative stress in vivo. Free Radic. Biol. Med. 28, 505–513. Barros, M.P., Pinto, E., Colepicolo, P., & Pedersen, M. (2001) Astaxanthin and peridinin inhibit oxidative damage in Fe2+-loaded liposomes: scavenging oxyradicals or changing membrane permeability? Biochem. Biophys. Res. Commun. 288, 225–232. Kurashige, M., Okimasu, E., Inoue, M., & Utsumi, K. (1989) Inhibition of oxidative injury of biological membranes by astaxanthin. Physiol. Chem. Phys. Med. NMR. 22, 27–38. Chitchumroonchokchai, C., Bomser, J.A., Glamm, J.E., & Failla, M.L. (2004) Xanthophylls and alpha-tocopherol decrease UVB-induced lipid peroxidation and stress signaling in human lens epithelial cells. J. Nutr. 134, 3225–3232. Kidd, P. (2011) Astaxanthin, cell membrane nutrient with diverse clinical benefits and anti-aging potential. Altern. Med. Rev. 16, 355–364. Sies, H. (2007) Total Antioxidant Capacity: Appraisal of a Concept. J. Nutr. 137, 1493–1495. Sautin, Y.Y., & Johnson, R.J. (2008) Uric acid: the oxidantantioxidant paradox. Nucleosides, Nucleotides and Nucleic Acids. 27, 608–619. Prochazkova, D., Bousova, I., & Wilhelmova, N. (2011) Antioxidant and prooxidant properties of flavonoids. Fitoterapia. 82, 513–523. Hennekens, C.H., Buring, J.E., Manson, J.E., Stampfer, M., Rosner, B., Cook, N.R., Belanger, C., LaMotte, F., Gaziano, J. M., Ridker, P.M., Willett, W., & Peto, R. (1996) Lack of effect of long-term supplementation with beta carotene on the incidence of malignant neoplasms and cardiovascular disease. N. Engl. J. Med. 334, 1145–1149. Aris, A., Leblanc, S., Ouellet, A., & Moutquin, J.M. (2008) Detrimental effects of high levels of antioxidant vitamins c and e on placental function: considerations for the vitamins in preeclampsia (VIP) trial. J. Obstet. Gynaecol. Res. 34, 504–511. Versari, D., Daghini, E., Rodriguez-Porcel, M., Sattler, K., Galili, O., Pilarczyk, K., Napoli, C., Lerman, L.O., & Lerman, A. (2006) Chronic antioxidant supplementation impairs coronary endothelial function and myocardial perfusion in normal pigs. Hypertension. 47, 475–481.

Int J Vitam Nutr Res (2020), 90 (1–2), 179–194

194

D. Wu et al., Effects of Astaxanthin Supplementation on Oxidative Stress

69. Gerardi, G., Usberti, M., Martini, G., Albertini, A., Sugherini, L., Pompella, A., & Lorenzo, D.D. (2002) Plasma total antioxidant capacity in hemodialyzed patients and its relationships to other biomarkers of oxidative stress and lipid peroxidation. Clin. Chem. Lab. Med. 40, 104–110. 70. Del Rio, D., Stewart, A.J., & Pellegrini, N. (2005) A review of recent studies on malondialdehyde as toxic molecule and biological marker of oxidative stress. Nutr. Metab. Cardiovasc. Dis. 15, 316–328.

Acknowledgments This work was supported by China National 863 Hi-tech Plan (2010AA023001) “Study on the Safety Assessment Methods for Functional Foods and Detection Technologies for Functional Components”; China NSFC Key Project (81030053)”Study on the Rapid Detection Methods of Chemical Contaminants in Water Products and

Int J Vitam Nutr Res (2020), 90 (1–2), 179–194

Agricultural Products and the Mycotoxin-producing Moulds in Flavours/Risk Assessments of Toxic Natural Components or Contaminants in Foods”. Conflicts of interest The authors declare no conflict of interests. Lishi Zhang West China School of Public Health Sichuan University No. 16, third section S. Renmin Rd. Chengdu 610041 China lishizhang_56@163.com

Ó 2019 Hogrefe

So that’s how my mind works – Now I get it!

“As a fan of PSI theory for more than 20 years, I am very happy seeing it translated for popular consumption! The book makes the theory reasonably simple, with lots of fun illustrations.” Kennon M. Sheldon, PhD, Professor of Psychological Sciences, University of Missouri, Columbia, MO

Johannes Storch / Corinne Morgenegg / Maja Storch / Julius Kuhl

Now I Get It!

Understand Yourself and Take Charge of Your Behavior 2018, vi + 248 pp. US $34.80 / € 27.95 ISBN 978-0-88937-541-3 Also available as eBook Using the example of four colleagues working together in a small company, Now I Get It! shows us the main personality types and their strengths and weakness in such a way that we gain real “now I get it!” insights into what is going on in our own and others’ subconscious. How does my mind work and what kind of personality do I have? When we can answer these questions and have come to terms with who we are, then the solutions to many issues that arise in everyday life will fall into place. What sort of people do I get on with best and how can I

www.hogrefe.com

best deal with the others? Are there recurring stressful situations in my professional or private life, and how do I resolve them? This humorously written and illustrated book, by the world’s leading experts in personality systems interaction (PSI) theory and the Zurich Resource Model (ZRM), gives us profound insights into our and other people’s subconscious thoughts – so we can adapt our own behavior and interactions to improve our quality of life. Cartoons and worksheets help us on our way.