American International Journal of Research in Formal, Applied and Natural Sciences by iasir journals

ISSN (Print): 2328-3777 ISSN (Online): 2328-3785 ISSN (CD-ROM): 2328-3793

Issue 3, Volume 1 June-August, 2013

American International Journal of Research in Formal, Applied and Natural Sciences

International Association of Scientific Innovation and Research (IASIR) (An Association Unifying the Sciences, Engineering, and Applied Research)

STEM International Scientific Online Media and Publishing House Head Office: 148, Summit Drive, Byron, Georgia-31008, United States. Offices Overseas: India, Australia, Germany, Netherlands, Canada. Website: www.iasir.net, E-mail (s): iasir.journals@iasir.net, iasir.journals@gmail.com, aijrfans@gmail.com

PREFACE We are delighted to welcome you to the third issue of the American International Journal of Research in Formal, Applied and Natural Sciences (AIJRFANS). In recent years, advances in science, engineering, formal, applied and natural sciences have radically expanded the data available to researchers and professionals in a wide variety of domains. This unique combination of theory with data has the potential to have broad impact on educational research and practice. AIJRFANS is publishing high-quality, peer-reviewed papers covering topics such as Biotechnology, Cognitive neurosciences, Physics, Chemistry, Information coding and theory, Biology , Botany & Zoology, Logic & Systems, Earth and environmental sciences, Computer science, Applied and pure Mathematics, Decision Theory & Statistics, Medicine, Algorithms, Anatomy, Biomedical sciences, Biochemistry, Bioinformatics, Ecology & Ethology, Food & Health science, Genetics, Pharmacology, Geology, Astronomy & Geophysics, Oceanography, Space sciences, Criminology, Aerospace, Agricultural, Textile, Industrial, Mechanical, Dental sciences, Pharmaceutical sciences, Computational linguistics, Cybernetics, Forestry, Scientific modeling, Network sciences, Horticulture & Husbandry, Agricultural & Veterinary sciences, Robotics and Automation, Materials sciences and other relevant fields available in the vicinity of formal, applied and natural sciences.

The editorial board of AIJRFANS is composed of members of the Teachers & Researchers community who are actively involved in the systematic investigation into existing or new knowledge to discover new paths for the scientific discovery to provide new logic and design paradigms. Today, modern science respects objective and logical reasoning to determine the underlying natural laws of the universe to explore new scientific methods. These methods

are

quite

useful

develop

widespread

expansion

highâ&#x20AC;?quality common standards and assessments in the formal, applied and natural sciences. These fields are the pillars of growth in our modern society and have a wider impact on our daily lives with infinite opportunities in a global marketplace. In order to best serve our community, this Journal is available online as well as in hard-copy form. Because of the rapid advances in underlying technologies and the interdisciplinary nature of the field, we believe it is important to provide quality research articles promptly and to the widest possible audience.

We are happy that this Journal has continued to grow and develop. We have made every effort to evaluate and process submissions for reviews, and address queries from authors and the general public promptly. The Journal has strived to reflect the most recent and finest

researchers in the field of formal, applied and natural sciences. This Journal is completely refereed and indexed with major databases like: IndexCopernicus, Computer Science Directory,

GetCITED,

CRCnetBASE,

Google

DOAJ,

SSRN,

Scholar,

TGDScholar,

Microsoft

Academic

WorldWideScience, Search,

INSPEC,

CiteSeerX, ProQuest,

ArnetMiner, Base, ChemXSeer, citebase, OpenJ-Gate, eLibrary, SafetyLit, SSRN, VADLO, OpenGrey, EBSCO, ProQuest, UlrichWeb, ISSUU, SPIE Digital Library, arXiv, ERIC, EasyBib, Infotopia, WorldCat, .docstoc JURN, Mendeley, ResearchGate, cogprints, OCLC, iSEEK, Scribd, LOCKSS, CASSI, E-PrintNetwork, intute, and some other databases.

We are grateful to all of the individuals and agencies whose work and support made the Journal's success possible. We want to thank the executive board and core committee members of the AIJRFANS for entrusting us with the important job. We are thankful to the members of the AIJRFANS editorial board who have contributed energy and time to the Journal with their steadfast support, constructive advice, as well as reviews of submissions. We are deeply indebted to the numerous anonymous reviewers who have contributed expertly evaluations of the submissions to help maintain the quality of the Journal. For this third issue, we received 69 research papers and out of which only 24 research papers are published in one volume as per the reviewersâ&#x20AC;&#x2122; recommendations. We have highest respect to all the authors who have submitted articles to the Journal for their intellectual energy and creativity, and for their dedication to the field of formal, applied and natural sciences.

The issue of the AIJRFANS has attracted a large number of authors and researchers across worldwide and would provide an effective platform to all the intellectuals of different streams to put forth their suggestions and ideas which might prove beneficial for the accelerated pace of development of emerging technologies in formal, applied and natural sciences and may open new area for research and development. We hope you will enjoy this third issue of the American International Journal of Research in Formal, Applied and Natural Sciences and are looking forward to hearing your feedback and receiving your contributions.

(Administrative Chief)

(Managing Director)

(Editorial Head)

--------------------------------------------------------------------------------------------------------------------------The American International Journal of Research in Formal, Applied and Natural Sciences (AIJRFANS), ISSN (Print): 2328-3777, ISSN (Online): 2328-3785, ISSN (CD-ROM): 2328-3793 (June-August, 2013, Issue 3, Volume 1). ---------------------------------------------------------------------------------------------------------------------------

BOARD MEMBERS

        

                 

EDITOR IN CHIEF Prof. (Dr.) Waressara Weerawat, Director of Logistics Innovation Center, Department of Industrial Engineering, Faculty of Engineering, Mahidol University, Thailand. Prof. (Dr.) Yen-Chun Lin, Professor and Chair, Dept. of Computer Science and Information Engineering, Chang Jung Christian University, Kway Jen, Tainan, Taiwan. Divya Sethi, GM Conferencing & VSAT Solutions, Enterprise Services, Bharti Airtel, Gurgaon, India. CHIEF EDITOR (TECHNICAL) Prof. (Dr.) Atul K. Raturi, Head School of Engineering and Physics, Faculty of Science, Technology and Environment, The University of the South Pacific, Laucala campus, Suva, Fiji Islands. Prof. (Dr.) Hadi Suwastio, College of Applied Science, Department of Information Technology, The Sultanate of Oman and Director of IETI-Research Institute-Bandung, Indonesia. Dr. Nitin Jindal, Vice President, Max Coreth, North America Gas & Power Trading, New York, United States. CHIEF EDITOR (GENERAL) Prof. (Dr.) Thanakorn Naenna, Department of Industrial Engineering, Faculty of Engineering, Mahidol University, Thailand. Prof. (Dr.) Jose Francisco Vicent Frances, Department of Science of the Computation and Artificial Intelligence, Universidad de Alicante, Alicante, Spain. Prof. (Dr.) Huiyun Liu, Department of Electronic & Electrical Engineering, University College London, Torrington Place, London. ADVISORY BOARD Prof. (Dr.) Kimberly A. Freeman, Professor & Director of Undergraduate Programs, Stetson School of Business and Economics, Mercer University, Macon, Georgia, United States. Prof. (Dr.) Klaus G. Troitzsch, Professor, Institute for IS Research, University of Koblenz-Landau, Germany. Prof. (Dr.) T. Anthony Choi, Professor, Department of Electrical & Computer Engineering, Mercer University, Macon, Georgia, United States. Prof. (Dr.) Fabrizio Gerli, Department of Management, Ca' Foscari University of Venice, Italy. Prof. (Dr.) Jen-Wei Hsieh, Department of Computer Science and Information Engineering, National Taiwan University of Science and Technology, Taiwan. Prof. (Dr.) Jose C. Martinez, Dept. Physical Chemistry, Faculty of Sciences, University of Granada, Spain. Prof. (Dr.) Panayiotis Vafeas, Department of Engineering Sciences, University of Patras, Greece. Prof. (Dr.) Soib Taib, School of Electrical & Electronics Engineering, University Science Malaysia, Malaysia. Prof. (Dr.) Vit Vozenilek, Department of Geoinformatics, Palacky University, Olomouc, Czech Republic. Prof. (Dr.) Sim Kwan Hua, School of Engineering, Computing and Science, Swinburne University of Technology, Sarawak, Malaysia. Prof. (Dr.) Jose Francisco Vicent Frances, Department of Science of the Computation and Artificial Intelligence, Universidad de Alicante, Alicante, Spain. Prof. (Dr.) Rafael Ignacio Alvarez Sanchez, Department of Science of the Computation and Artificial Intelligence, Universidad de Alicante, Alicante, Spain. Prof. (Dr.) Praneel Chand, Ph.D., M.IEEEC/O School of Engineering & Physics Faculty of Science & Technology The University of the South Pacific (USP) Laucala Campus, Private Mail Bag, Suva, Fiji. Prof. (Dr.) Francisco Miguel Martinez, Department of Science of the Computation and Artificial Intelligence, Universidad de Alicante, Alicante, Spain. Prof. (Dr.) Antonio Zamora Gomez, Department of Science of the Computation and Artificial Intelligence, Universidad de Alicante, Alicante, Spain. Prof. (Dr.) Leandro Tortosa, Department of Science of the Computation and Artificial Intelligence, Universidad de Alicante, Alicante, Spain. Prof. (Dr.) Samir Ananou, Department of Microbiology, Universidad de Granada, Granada, Spain. Dr. Miguel Angel Bautista, Department de Matematica Aplicada y Analisis, Facultad de Matematicas, Universidad de Barcelona, Spain.

           

                  

Prof. (Dr.) Prof. Adam Baharum, School of Mathematical Sciences, University of Universiti Sains, Malaysia, Malaysia. Dr. Cathryn J. Peoples, Faculty of Computing and Engineering, School of Computing and Information Engineering, University of Ulster, Coleraine, Northern Ireland, United Kingdom. Prof. (Dr.) Pavel Lafata, Department of Telecommunication Engineering, Faculty of Electrical Engineering, Czech Technical University in Prague, Prague, 166 27, Czech Republic. Prof. (Dr.) P. Bhanu Prasad, Vision Specialist, Matrix vision GmbH, Germany, Consultant, TIFACCORE for Machine Vision, Advisor, Kelenn Technology, France Advisor, Shubham Automation & Services, Ahmedabad, and Professor of C.S.E, Rajalakshmi Engineering College, India. Prof. (Dr.) Anis Zarrad, Department of Computer Science and Information System, Prince Sultan University, Riyadh, Saudi Arabia. Prof. (Dr.) Mohammed Ali Hussain, Professor, Dept. of Electronics and Computer Engineering, KL University, Green Fields, Vaddeswaram, Andhra Pradesh, India. Dr. Cristiano De Magalhaes Barros, Governo do Estado de Minas Gerais, Brazil. Prof. (Dr.) Md. Rizwan Beg, Professor & Head, Dean, Faculty of Computer Applications, Deptt. of Computer Sc. & Engg. & Information Technology, Integral University Kursi Road, Dasauli, Lucknow, India. Prof. (Dr.) Vishnu Narayan Mishra, Assistant Professor of Mathematics, Sardar Vallabhbhai National Institute of Technology, Ichchhanath Mahadev Road, Surat, Surat-395007, Gujarat, India. Dr. Jia Hu, Member Research Staff, Philips Research North America, New York Area, NY. Prof. Shashikant Shantilal Patil SVKM , MPSTME Shirpur Campus, NMIMS University Vile Parle Mumbai, India. Prof. (Dr.) Bindhya Chal Yadav, Assistant Professor in Botany, Govt. Post Graduate College, Fatehabad, Agra, Uttar Pradesh, India. REVIEW BOARD Prof. (Dr.) Kimberly A. Freeman, Professor & Director of Undergraduate Programs, Stetson School of Business and Economics, Mercer University, Macon, Georgia, United States. Prof. (Dr.) Klaus G. Troitzsch, Professor, Institute for IS Research, University of Koblenz-Landau, Germany. Prof. (Dr.) T. Anthony Choi, Professor, Department of Electrical & Computer Engineering, Mercer University, Macon, Georgia, United States. Prof. (Dr.) Yen-Chun Lin, Professor and Chair, Dept. of Computer Science and Information Engineering, Chang Jung Christian University, Kway Jen, Tainan, Taiwan. Prof. (Dr.) Jen-Wei Hsieh, Department of Computer Science and Information Engineering, National Taiwan University of Science and Technology, Taiwan. Prof. (Dr.) Jose C. Martinez, Dept. Physical Chemistry, Faculty of Sciences, University of Granada, Spain. Prof. (Dr.) Joel Saltz, Emory University, Atlanta, Georgia, United States. Prof. (Dr.) Panayiotis Vafeas, Department of Engineering Sciences, University of Patras, Greece. Prof. (Dr.) Soib Taib, School of Electrical & Electronics Engineering, University Science Malaysia, Malaysia. Prof. (Dr.) Sim Kwan Hua, School of Engineering, Computing and Science, Swinburne University of Technology, Sarawak, Malaysia. Prof. (Dr.) Jose Francisco Vicent Frances, Department of Science of the Computation and Artificial Intelligence, Universidad de Alicante, Alicante, Spain. Prof. (Dr.) Rafael Ignacio Alvarez Sanchez, Department of Science of the Computation and Artificial Intelligence, Universidad de Alicante, Alicante, Spain. Prof. (Dr.) Francisco Miguel Martinez, Department of Science of the Computation and Artificial Intelligence, Universidad de Alicante, Alicante, Spain. Prof. (Dr.) Antonio Zamora Gomez, Department of Science of the Computation and Artificial Intelligence, Universidad de Alicante, Alicante, Spain. Prof. (Dr.) Leandro Tortosa, Department of Science of the Computation and Artificial Intelligence, Universidad de Alicante, Alicante, Spain. Prof. (Dr.) Samir Ananou, Department of Microbiology, Universidad de Granada, Granada, Spain. Dr. Miguel Angel Bautista, Department de Matematica Aplicada y Analisis, Facultad de Matematicas, Universidad de Barcelona, Spain. Prof. (Dr.) Prof. Adam Baharum, School of Mathematical Sciences, University of Universiti Sains, Malaysia, Malaysia. Prof. (Dr.) Huiyun Liu, Department of Electronic & Electrical Engineering, University College London, Torrington Place, London.

                                

Dr. Cristiano De Magalhaes Barros, Governo do Estado de Minas Gerais, Brazil. Prof. (Dr.) Pravin G. Ingole, Senior Researcher, Greenhouse Gas Research Center, Korea Institute of Energy Research (KIER), 152 Gajeong-ro, Yuseong-gu, Daejeon 305-343, KOREA. Prof. (Dr.) Dilum Bandara, Dept. Computer Science & Engineering, University of Moratuwa, Sri Lanka. Prof. (Dr.) Faudziah Ahmad, School of Computing, UUM College of Arts and Sciences, University Utara Malaysia, 06010 UUM Sintok, Kedah Darulaman. Prof. (Dr.) G. Manoj Someswar, Principal, Dept. of CSE at Anwar-ul-uloom College of Engineering & Technology, Yennepally, Vikarabad, RR District., A.P., India. Prof. (Dr.) Abdelghni Lakehal, Applied Mathematics, Rue 10 no 6 cite des fonctionnaires dokkarat 30010 Fes Marocco. Dr. Kamal Kulshreshtha, Associate Professor & Head, Deptt. of Computer Sc. & Applications, Modi Institute of Management & Technology, Kota-324 009, Rajasthan, India. Prof. (Dr.) Anukrati Sharma, Associate Professor, Faculty of Commerce and Management, University of Kota, Kota, Rajasthan, India. Prof. (Dr.) S. Natarajan, Department of Electronics and Communication Engineering, SSM College of Engineering, NH 47, Salem Main Road, Komarapalayam, Namakkal District, Tamilnadu 638183, India. Prof. (Dr.) J. Sadhik Basha, Department of Mechanical Engineering, King Khalid University, Abha, Kingdom of Saudi Arabia. Prof. (Dr.) G. SAVITHRI, Department of Sericulture, S.P. Mahila Visvavidyalayam, Tirupati517502, Andhra Pradesh, India. Prof. (Dr.) Shweta jain, Tolani College of Commerce, Andheri, Mumbai. 400001, India. Prof. (Dr.) Abdullah M. Abdul-Jabbar, Department of Mathematics, College of Science, University of Salahaddin-Erbil, Kurdistan Region, Iraq. Prof. (Dr.) ( Mrs.) P.Sujathamma, Department of Sericulture, S.P.Mahila Visvavidyalayam, Tirupati-517502, India. Prof. (Dr.) Bimla Dhanda, Professor & Head, Department of Human Development and Family Studies, College of Home Science, CCS, Haryana Agricultural University, Hisar- 125001 (Haryana) India. Prof. (Dr.) Manjulatha, Dept of Biochemistry,School of Life Sciences,University of Hyderabad,Gachibowli, Hyderabad, India. Prof. (Dr.) Upasani Dhananjay Eknath Advisor & Chief Coordinator, ALUMNI Association, Sinhgad Institute of Technology & Science, Narhe, Pune -411 041, India. Prof. (Dr.) Sudhindra Bhat, Professor & Finance Area Chair, School of Business, Alliance University Bangalore-562106, India. Prof. Prasenjit Chatterjee , Dept. of Mechanical Engineering, MCKV Institute of Engineering West Bengal, India. Prof. Rajesh Murukesan, Deptt. of Automobile Engineering, Rajalakshmi Engineering college, Chennai, India. Prof. (Dr.) Parmil Kumar, Department of Statistics, University of Jammu, Jammu, India Prof. (Dr.) M.N. Shesha Prakash, Vice Principal, Professor & Head of Civil Engineering, Vidya Vikas Institute of Engineering and Technology, Alanahally, Mysore-570 028 Prof. (Dr.) Piyush Singhal, Mechanical Engineering Deptt., GLA University, India. Prof. M. Mahbubur Rahman, School of Engineering & Information Technology, Murdoch University, Perth Western Australia 6150, Australia. Prof. Nawaraj Chaulagain, Department of Religion, Illinois Wesleyan University, Bloomington, IL. Prof. Hassan Jafari, Faculty of Maritime Economics & Management, Khoramshahr University of Marine Science and Technology, khoramshahr, Khuzestan province, Iran Prof. (Dr.) Kantipudi MVV Prasad , Dept of EC, School of Engg., R.K.University, Kast urbhadham, Tramba, Rajkot-360020, India. Prof. (Mrs.) P.Sujathamma, Department of Sericulture, S.P.Mahila Visvavidyalayam, ( Women's University), Tirupati-517502, India. Prof. (Dr.) M A Rizvi, Dept. of Computer Engineering and Applications, National Institute of Technical Teachers' Training and Research, Bhopal M.P. India. Prof. (Dr.) Mohsen Shafiei Nikabadi, Faculty of Economics and Management, Industrial Management Department, Semnan University, Semnan, Iran. Prof. P.R.SivaSankar, Head, Dept. of Commerce, Vikrama Simhapuri University Post Graduate Centre, KAVALI - 524201, A.P. India. Prof. (Dr.) Bhawna Dubey, Institute of Environmental Science( AIES), Amity University, Noida, India. Prof. Manoj Chouhan, Deptt. of Information Technology, SVITS Indore, India.

                               

Prof. Yupal S Shukla, V M Patel College of Management Studies, Ganpat University, KhervaMehsana. India. Prof. (Dr.) Amit Kohli, Head of the Department, Department of Mechanical Engineering, D.A.V.Institute of Engg. and Technology, Kabir Nagar, Jalandhar,Punjab (India). Prof. (Dr.) Kumar Irayya Maddani, and Head of the Department of Physics in SDM College of Engineering and Technology, Dhavalagiri, Dharwad, State: Karnataka (INDIA). Prof. (Dr.) Shafi Phaniband, SDM College of Engineering and Technology, Dharwad, INDIA. Prof. M H Annaiah, Head, Department of Automobile Engineering, Acharya Institute of Technology, Soladevana Halli, Bangalore -560107, India. Prof. (Dr.) Prof. R. R. Patil, Director School Of Earth Science, Solapur University, Solapur Prof. (Dr.) Manoj Khandelwal, Dept. of Mining Engg, College of Technology & Engineering, Maharana Pratap University of Agriculture & Technology, Udaipur, 313 001 (Rajasthan), India Prof. (Dr.) Kishor Chandra Satpathy, Librarian, National Institute of Technology, Silchar-788010, Assam, India Prof. (Dr.) Juhana Jaafar, Gas Engineering Department, Faculty of Petroleum and Renewable Energy Engineering (FPREE), Universiti Teknologi Malaysia-81310 UTM Johor Bahru, Johor. Prof. (Dr.) Rita Khare, Assistant Professor in chemistry, Govt. Women’s College, Gardanibagh, Patna, Bihar. Prof. (Dr.) Raviraj Kusanur, Dept of Chemistry, R V College of Engineering, Bangalore-59, India. Prof. (Dr.) Hameem Shanavas .I, M.V.J College of Engineering, Bangalore Prof. (Dr.) Sanjay Kumar, JKL University, Ajmer Road, Jaipur Prof. (Dr.) Pushp Lata Faculty of English and Communication, Department of Humanities and Languages, Nucleus Member, Publications and Media Relations Unit Editor, BITScan, BITS, PilaniIndia. Prof. Arun Agarwal, Faculty of ECE Dept., ITER College, Siksha 'O' Anusandhan University Bhubaneswar, Odisha, India Prof. (Dr.) Pratima Tripathi, Department of Biosciences, SSSIHL, Anantapur Campus Anantapur515001 (A.P.) India. Prof. (Dr.) Sudip Das, Department of Biotechnology, Haldia Institute of Technology, I.C.A.R.E. Complex, H.I.T. Campus, P.O. Hit, Haldia; Dist: Puba Medinipur, West Bengal, India. Prof. (Dr.) Bimla Dhanda, Professor & Head, Department of Human Development and Family Studies College of Home Science, CCS, Haryana Agricultural University, Hisar- 125001 (Haryana) India. Prof. (Dr.) R.K.Tiwari, Professor, S.O.S. in Physics, Jiwaji University, Gwalior, M.P.-474011. Prof. (Dr.) Deepak Paliwal, Faculty of Sociology, Uttarakhand Open University, Haldwani-Nainital Prof. (Dr.) Dr. Anil K Dwivedi, Faculty of Pollution & Environmental Assay Research Laboratory (PEARL), Department of Botany,DDU Gorakhpur University,Gorakhpur-273009,India. Prof. R. Ravikumar, Department of Agricultural and Rural Management, TamilNadu Agricultural University,Coimbatore-641003,TamilNadu,India. Prof. (Dr.) R.Raman, Professor of Agronomy, Faculty of Agriculture, Annamalai university, Annamalai Nagar 608 002Tamil Nadu, India. Prof. (Dr.) Ahmed Khalafallah, Coordinator of the CM Degree Program, Department of Architectural and Manufacturing Sciences, Ogden College of Sciences and Engineering Western Kentucky University 1906 College Heights Blvd Bowling Green, KY 42103-1066. Prof. (Dr.) Asmita Das , Delhi Technological University (Formerly Delhi College of Engineering), Shahbad, Daulatpur, Delhi 110042, India. Prof. (Dr.)Aniruddha Bhattacharjya, Assistant Professor (Senior Grade), CSE Department, Amrita School of Engineering , Amrita Vishwa VidyaPeetham (University), Kasavanahalli, Carmelaram P.O., Bangalore 560035, Karnataka, India. Prof. (Dr.) S. Rama Krishna Pisipaty, Prof & Geoarchaeologist, Head of the Department of Sanskrit & Indian Culture, SCSVMV University, Enathur, Kanchipuram 631561, India Prof. (Dr.) Shubhasheesh Bhattacharya, Professor & HOD(HR), Symbiosis Institute of International Business (SIIB), Hinjewadi, Phase-I, Pune- 411 057, India. Prof. (Dr.) Vijay Kothari, Institute of Science, Nirma University, S-G Highway, Ahmedabad 382481, India. Prof. (Dr.) Raja Sekhar Mamillapalli, Department of Civil Engineering at Sir Padampat Singhania University, Udaipur, India. Prof. (Dr.) B. M. Kunar, Department of Mining Engineering, Indian School of Mines, Dhanbad 826004, Jharkhand, India. Prof. (Dr.) Prabir Sarkar, Assistant Professor, School of Mechanical, Materials and Energy Engineering, Room 307, Academic Block, Indian Institute of Technology, Ropar, Nangal Road, Rupnagar 140001, Punjab, India.

                             

Prof. (Dr.) K.Srinivasmoorthy, Associate Professor, Department of Earth Sciences, School of Physical,Chemical and Applied Sciences, Pondicherry university, R.Venkataraman Nagar, Kalapet, Puducherry 605014, India. Prof. (Dr.) Bhawna Dubey, Institute of Environmental Science (AIES), Amity University, Noida, India. Prof. (Dr.) P. Bhanu Prasad, Vision Specialist, Matrix vision GmbH, Germany, Consultant, TIFACCORE for Machine Vision, Advisor, Kelenn Technology, France Advisor, Shubham Automation & Services, Ahmedabad, and Professor of C.S.E, Rajalakshmi Engineering College, India. Prof. (Dr.)P.Raviraj, Professor & Head, Dept. of CSE, Kalaignar Karunanidhi, Institute of Technology, Coimbatore 641402,Tamilnadu,India. Prof. (Dr.) Damodar Reddy Edla, Department of Computer Science & Engineering, Indian School of Mines, Dhanbad, Jharkhand 826004, India. Prof. (Dr.) T.C. Manjunath, Principal in HKBK College of Engg., Bangalore, Karnataka, India. Prof. (Dr.) Pankaj Bhambri, I.T. Deptt., Guru Nanak Dev Engineering College, Ludhiana 141006, Punjab, India. Prof. Shashikant Shantilal Patil SVKM , MPSTME Shirpur Campus, NMIMS University Vile Parle Mumbai, India. Prof. (Dr.) Shambhu Nath Choudhary, Department of Physics, T.M. Bhagalpur University, Bhagalpur 81200, Bihar, India. Prof. (Dr.) Venkateshwarlu Sonnati, Professor & Head of EEED, Department of EEE, Sreenidhi Institute of Science & Technology, Ghatkesar, Hyderabad, Andhra Pradesh, India. Prof. (Dr.) Saurabh Dalela, Department of Pure & Applied Physics, University of Kota, KOTA 324010, Rajasthan, India. Prof. S. Arman Hashemi Monfared, Department of Civil Eng, University of Sistan & Baluchestan, Daneshgah St.,Zahedan, IRAN, P.C. 98155-987 Prof. (Dr.) R.S.Chanda, Dept. of Jute & Fibre Tech., University of Calcutta, Kolkata 700019, West Bengal, India. Prof. V.S.VAKULA, Department of Electrical and Electronics Engineering, JNTUK, University College of Eng.,Vizianagaram5 35003, Andhra Pradesh, India. Prof. (Dr.) Nehal Gitesh Chitaliya, Sardar Vallabhbhai Patel Institute of Technology, Vasad 388 306, Gujarat, India. Prof. (Dr.) D.R. Prajapati, Department of Mechanical Engineering, PEC University of Technology,Chandigarh 160012, India. Dr. A. SENTHIL KUMAR, Postdoctoral Researcher, Centre for Energy and Electrical Power, Electrical Engineering Department, Faculty of Engineering and the Built Environment, Tshwane University of Technology, Pretoria 0001, South Africa. Prof. (Dr.)Vijay Harishchandra Mankar, Department of Electronics & Telecommunication Engineering, Govt. Polytechnic, Mangalwari Bazar, Besa Road, Nagpur- 440027, India. Prof. Varun.G.Menon, Department Of C.S.E, S.C.M.S School of Engineering, Karukutty,Ernakulam, Kerala 683544, India. Prof. (Dr.) U C Srivastava, Department of Physics, Amity Institute of Applied Sciences, Amity University, Noida, U.P-203301.India. Prof. (Dr.) Surendra Yadav, Professor and Head (Computer Science & Engineering Department), Maharashi Arvind College of Engineering and Research Centre (MACERC), Jaipur, Rajasthan, India. Prof. (Dr.) Sunil Kumar, H.O.D. Applied Sciences & Humanities Dehradun Institute of Technology, (D.I.T. School of Engineering), 48 A K.P-3 Gr. Noida (U.P.) 201308 Prof. Naveen Jain, Dept. of Electrical Engineering, College of Technology and Engineering, Udaipur-313 001, India. Prof. Veera Jyothi.B, CBIT, Hyderabad, Andhra Pradesh, India. Prof. Aritra Ghosh, Global Institute of Management and Technology, Krishnagar, Nadia, W.B. India Prof. Anuj K. Gupta, Head, Dept. of Computer Science & Engineering, RIMT Group of Institutions, Sirhind Mandi Gobindgarh, Punajb, India. Prof. (Dr.) Varala Ravi, Head, Department of Chemistry, IIIT Basar Campus, Rajiv Gandhi University of Knowledge Technologies, Mudhole, Adilabad, Andhra Pradesh- 504 107, India Prof. (Dr.) Ravikumar C Baratakke, faculty of Biology,Govt. College, Saundatti - 591 126, India. Prof. (Dr.) NALIN BHARTI, School of Humanities and Social Science, Indian Institute of Technology Patna, India. Prof. (Dr.) Shivanand S.Gornale , Head, Department of Studies in Computer Science, Government College (Autonomous), Mandya, Mandya-571 401-Karanataka, India.

                               

Prof. (Dr.) Naveen.P.Badiger, Dept.Of Chemistry, S.D.M.College of Engg. & Technology, Dharwad-580002, Karnataka State, India. Prof. (Dr.) Bimla Dhanda, Professor & Head, Department of Human Development and Family Studies, College of Home Science, CCS, Haryana Agricultural University, Hisar- 125001 (Haryana) India. Prof. (Dr.) Tauqeer Ahmad Usmani, Faculty of IT, Salalah College of Technology, Salalah, Sultanate of Oman. Prof. (Dr.) Naresh Kr. Vats, Chairman, Department of Law, BGC Trust University Bangladesh Prof. (Dr.) Papita Das (Saha), Department of Environmental Science, University of Calcutta, Kolkata, India. Prof. (Dr.) Rekha Govindan , Dept of Biotechnology, Aarupadai Veedu Institute of technology , Vinayaka Missions University , Paiyanoor , Kanchipuram Dt, Tamilnadu , India. Prof. (Dr.) Lawrence Abraham Gojeh, Department of Information Science, Jimma University, P.o.Box 378, Jimma, Ethiopia. Prof. (Dr.) M.N. Kalasad, Department of Physics, SDM College of Engineering & Technology, Dharwad, Karnataka, India. Prof. Rab Nawaz Lodhi, Department of Management Sciences, COMSATS Institute of Information Technology Sahiwal. Prof. (Dr.) Masoud Hajarian, Department of Mathematics, Faculty of Mathematical Sciences, Shahid Beheshti University, General Campus, Evin, Tehran 19839,Iran Prof. (Dr.) Chandra Kala Singh, Associate professor, Department of Human Development and Family Studies, College of Home Science, CCS, Haryana Agricultural University, Hisar- 125001 (Haryana) India Prof. (Dr.) J.Babu, Professor & Dean of research, St.Joseph's College of Engineering & Technology, Choondacherry, Palai,Kerala. Prof. (Dr.) Pradip Kumar Roy, Department of Applied Mechanics, Birla Institute of Technology (BIT) Mesra, Ranchi- 835215, Jharkhand, India. Prof. (Dr.) P. Sanjeevi kumar, School of Electrical Engineering (SELECT), Vandalur Kelambakkam Road, VIT University, Chennai, India. Prof. (Dr.) Debasis Patnaik, BITS-Pilani, Goa Campus, India. Prof. (Dr.) SANDEEP BANSAL, Associate Professor, Department of Commerce, I.G.N. College, Haryana, India. Dr. Radhakrishnan S V S, Department of Pharmacognosy, Faser Hall, The University of Mississippi Oxford, MS- 38655, USA. Prof. (Dr.) Megha Mittal, Faculty of Chemistry, Manav Rachna College of Engineering, Faridabad (HR), 121001, India. Prof. (Dr.) Mihaela Simionescu (BRATU), BUCHAREST, District no. 6, Romania, member of the Romanian Society of Econometrics, Romanian Regional Science Association and General Association of Economists from Romania Prof. (Dr.) Atmani Hassan, Director Regional of Organization Entraide Nationale Prof. (Dr.) Deepshikha Gupta, Dept. of Chemistry, Amity Institute of Applied Sciences,Amity University, Sec.125, Noida, India. Prof. (Dr.) Muhammad Kamruzzaman, Deaprtment of Infectious Diseases, The University of Sydney, Westmead Hospital, Westmead, NSW-2145. Prof. (Dr.) Meghshyam K. Patil , Assistant Professor & Head, Department of Chemistry,Dr. Babasaheb Ambedkar Marathwada University,Sub-Campus, Osmanabad- 413 501, Maharashtra, India. Prof. (Dr.) Ashok Kr. Dargar, Department of Mechanical Engineering, School of Engineering, Sir Padampat Singhania University, Udaipur (Raj.) Prof. (Dr.) Sudarson Jena, Dept. of Information Technology, GITAM University, Hyderabad, India Prof. (Dr.) Jai Prakash Jaiswal, Department of Mathematics, Maulana Azad National Institute of Technology Bhopal, India. Prof. (Dr.) S.Amutha, Dept. of Educational Technology, Bharathidasan University, Tiruchirappalli620 023, Tamil Nadu, India. Prof. (Dr.) R. HEMA KRISHNA, Environmental chemistry, University of Toronto, Canada. Prof. (Dr.) B.Swaminathan, Dept. of Agrl.Economics, Tamil Nadu Agricultural University, India. Prof. (Dr.) K. Ramesh, Department of Chemistry, C.B.I.T, Gandipet, Hyderabad-500075. India. Prof. (Dr.) Sunil Kumar, H.O.D. Applied Sciences &Humanities, JIMS Technical campus,(I.P. University,New Delhi), 48/4 ,K.P.-3,Gr.Noida (U.P.) Prof. (Dr.) G.V.S.R.Anjaneyulu, CHAIRMAN - P.G. BOS in Statistics & Deputy Coordinator UGC DRS-I Project, Executive Member ISPS-2013, Department of Statistics, Acharya Nagarjuna University, Nagarjuna Nagar-522510, Guntur, Andhra Pradesh, India.

                                

Prof. (Dr.) Sribas Goswami, Department of Sociology, Serampore College, Serampore 712201, West Bengal, India. Prof. (Dr.) Sunanda Sharma, Department of Veterinary Obstetrics Y Gynecology, College of Veterinary & Animal Science,Rajasthan University of Veterinary & Animal Sciences,Bikaner334001, India. Prof. (Dr.) S.K. Tiwari, Department of Zoology, D.D.U. Gorakhpur University, Gorakhpur-273009 U.P., India. Prof. (Dr.) Praveena Kuruva, Materials Research Centre, Indian Institute of Science, Bangalore560012, INDIA Prof. (Dr.) Rajesh Kumar, Department Of Applied Physics, Bhilai Institute Of Technology, Durg (C.G.) 491001, India. Dr. K.C.Sivabalan, Field Enumerator and Data Analyst, Asian Vegetable Research Centre, The World Vegetable Centre, Taiwan. Prof. (Dr.) Amit Kumar Mishra, Department of Environmntal Science and Energy Research, Weizmann Institute of Science, Rehovot, Israel. Prof. (Dr.) Manisha N. Paliwal, Sinhgad Institute of Management, Vadgaon (Bk), Pune, India. Prof. (Dr.) M. S. HIREMATH, Principal, K.L.ESOCIETY’s SCHOOL, ATHANI Prof. Manoj Dhawan, Department of Information Technology, Shri Vaishnav Institute of Technology & Science, Indore, (M. P.), India. Prof. (Dr.) V.R.Naik, Professor & Head of Department, Mechancal Engineering, Textile & Engineering Institute, Ichalkaranji (Dist. Kolhapur), Maharashatra, India. Prof. (Dr.) Jyotindra C. Prajapati,Head, Department of Mathematical Sciences, Faculty of Applied Sciences, Charotar University of Science and Technology, Changa Anand -388421, Gujarat, India Prof. (Dr.) Sarbjit Singh, Head, Department of Industrial & Production Engineering, Dr BR Ambedkar National Institute of Technology,Jalandhar,Punjab, India. Prof. (Dr.) Professor Braja Gopal Bag, Department of Chemistry and Chemical Technology , Vidyasagar University, West Midnapore Prof. (Dr.) Ashok Kumar Chandra, Department of Management, Bhilai Institute of Technology, Bhilai House, Durg (C.G.) Prof. (Dr.) Amit Kumar, Assistant Professor, School of Chemistry, Shoolini University, Solan, Himachal Pradesh, India Prof. (Dr.) L. Suresh Kumar, Mechanical Department, Chaitanya Bharathi Institute of Technology, Hyderabad, India. Scientist Sheeraz Saleem Bhat, Lac Production Division, Indian Institute of Natural Resins and Gums, Namkum, Ranchi, Jharkhand, India. Prof. C.Divya , Centre for Information Technology and Engineering, Manonmaniam Sundaranar University, Tirunelveli - 627012, Tamilnadu , India. Prof. T.D.Subash, Infant Jesus College Of Engineering and Technology, Thoothukudi Tamilnadu, India. Prof. (Dr.) Vinay Nassa, Prof. E.C.E Deptt., Dronacharya.Engg. College, Gurgaon India. Prof. Sunny Narayan, university of Roma Tre, Italy. Prof. (Dr.) Sanjoy Deb, Dept. of ECE, BIT Sathy, Sathyamangalam, Tamilnadu-638401, India. Prof. (Dr.) Reena Gupta, Institute of Pharmaceutical Research, GLA University, Mathura, India. Prof. (Dr.) P.R.SivaSankar, Head Dept. of Commerce, Vikrama Simhapuri University Post Graduate Centre, KAVALI - 524201, A.P., India. Prof. (Dr.) Mohsen Shafiei Nikabadi, Faculty of Economics and Management, Industrial Management Department, Semnan University, Semnan, Iran. Prof. (Dr.) Praveen Kumar Rai, Department of Geography, Faculty of Science, Banaras Hindu University, Varanasi-221005, U.P. India. Prof. (Dr.) Christine Jeyaseelan, Dept of Chemistry, Amity Institute of Applied Sciences, Amity University, Noida, India. Prof. (Dr.) M A Rizvi, Dept. of Computer Engineering and Applications , National Institute of Technical Teachers' Training and Research, Bhopal M.P. India. Prof. (Dr.) K.V.N.R.Sai Krishna, H O D in Computer Science, S.V.R.M.College,(Autonomous), Nagaram, Guntur(DT), Andhra Pradesh, India. Prof. (Dr.) Ashok Kr. Dargar, Department of Mechanical Engineering, School of Engineering, Sir Padampat Singhania University, Udaipur (Raj.) Prof. (Dr.) Asim Kumar Sen, Principal , ST.Francis Institute of Technology (Engineering College) under University of Mumbai , MT. Poinsur, S.V.P Road, Borivali (W), Mumbai-400103, India. Prof. (Dr.) Rahmathulla Noufal.E, Civil Engineering Department, Govt.Engg.College-Kozhikode

                                

Prof. (Dr.) N.Rajesh, Department of Agronomy, TamilNadu Agricultural University -Coimbatore, Tamil Nadu, India. Prof. (Dr.) Har Mohan Rai , Professor, Electronics and Communication Engineering, N.I.T. Kurukshetra 136131,India Prof. (Dr.) Eng. Sutasn Thipprakmas from King Mongkut, University of Technology Thonburi, Thailand. Prof. (Dr.) Kantipudi MVV Prasad, EC Department, RK University, Rajkot. Prof. (Dr.) Jitendra Gupta,Faculty of Pharmaceutics, Institute of Pharmaceutical Research, GLA University, Mathura. Prof. (Dr.) Swapnali Borah, HOD, Dept of Family Resource Management, College of Home Science, Central Agricultural University, Tura, Meghalaya, India. Prof. (Dr.) N.Nazar Khan, Professor in Chemistry, BTK Institute of Technology, Dwarahat-263653 (Almora), Uttarakhand-India. Prof. (Dr.) Rajiv Sharma, Department of Ocean Engineering, Indian Institute of Technology Madras, Chennai (TN) - 600 036,India. Prof. (Dr.) Aparna Sarkar,PH.D. Physiology, AIPT,Amity University , F 1 Block, LGF, Sector125,Noida-201303, UP ,India. Prof. (Dr.) Manpreet Singh, Professor and Head, Department of Computer Engineering, Maharishi Markandeshwar University, Mullana, Haryana, India. Prof. (Dr.) Sukumar Senthilkumar, Senior Researcher Advanced Education Center of Jeonbuk for Electronics and Information Technology, Chon Buk National University, Chon Buk, 561-756, SOUTH KOREA. . Prof. (Dr.) Hari Singh Dhillon, Assistant Professor, Department of Electronics and Communication Engineering, DAV Institute of Engineering and Technology, Jalandhar (Punjab), INDIA. . Prof. (Dr.) Poonkuzhali, G., Department of Computer Science and Engineering, Rajalakshmi Engineering College, Chennai, INDIA. . Prof. (Dr.) Bharath K N, Assistant Professor, Dept. of Mechanical Engineering, GM Institute of Technology, PB Road, Davangere 577006, Karnataka, INDIA. . Prof. (Dr.) F.Alipanahi, Assistant Professor, Islamic Azad University,Zanjan Branch, Atemadeyeh, Moalem Street, Zanjan IRAN Prof. Yogesh Rathore, Assistant Professor, Dept. of Computer Science & Engineering, RITEE, Raipur, India Prof. (Dr.) Ratneshwer, Department of Computer Science (MMV), Banaras Hindu University Varanasi-221005, India. Prof. Pramod Kumar Pandey, Assistant Professor, Department Electronics & Instrumentation Engineering, ITM University, Gwalior, M.P., India Prof. (Dr.)Sudarson Jena, Associate Professor, Dept.of IT, GITAM University, Hyderabad, India Prof. (Dr.) Binod Kumar,PhD(CS), M.Phil(CS),MIEEE,MIAENG, Dean & Professor( MCA), Jayawant Technical Campus(JSPM's), Pune, India Prof. (Dr.) Mohan Singh Mehata, (JSPS fellow), Assistant Professor, Department of Applied Physics, Delhi Technological University, Delhi Prof. Ajay Kumar Agarwal, Asstt. Prof., Deptt. of Mech. Engg., Royal Institute of Management & Technology, Sonipat (Haryana) Prof. (Dr.) Siddharth Sharma, University School of Management, Kurukshetra University, Kurukshetra, India. Prof. (Dr.) Satish Chandra Dixit, Department of Chemistry, D.B.S.College ,Govind Nagar,Kanpur208006, India Prof. (Dr.) Ajay Solkhe, Department of Management, Kurukshetra University, Kurukshetra, India. Prof. (Dr.) Neeraj Sharma, Asst. Prof. Dept. of Chemistry, GLA University, Mathura Prof. (Dr.) Basant Lal, Department of Chemistry, G.L.A. University, Mathura Prof. (Dr.) T Venkat Narayana Rao, C.S.E,Guru Nanak Engineering College, Hyderabad, Andhra Pradesh, India Prof. (Dr.) Rajanarender Reddy Pingili, S.R. International Institute of Technology, Hyderabad, Andhra Pradesh, India Prof. (Dr.) V.S.Vairale, Department of Computer Engineering, All India Shri Shivaji Memorial Society College of Engineering, Kennedy Road, Pune-411 001, Maharashtra, India Prof. (Dr.) Vasavi Bande, Department of Computer Science & Engineering, Netaji Institute of Engineering and Technology, Hyderabad, Andhra Pradesh, India Prof. (Dr.) Hardeep Anand, Department of Chemistry, Kurukshetra University Kurukshetra, Haryana, India. Prof. Aasheesh shukla, Asst Professor, Dept. of EC, GLA University, Mathura, India.

                                                

Prof. S.P.Anandaraj., CSE Dept, SREC, Warangal, India. Satya Rishi Takyar , Senior ISO Consultant, New Delhi, India. Prof. Anuj K. Gupta, Head, Dept. of Computer Science & Engineering, RIMT Group of Institutions, Mandi Gobindgarh, Punjab, India. Prof. (Dr.) Harish Kumar, Department of Sports Science, Punjabi University, Patiala, Punjab, India. Prof. (Dr.) Mohammed Ali Hussain, Professor, Dept. of Electronics and Computer Engineering, KL University, Green Fields, Vaddeswaram, Andhra Pradesh, India. Prof. (Dr.) Manish Gupta, Department of Mechanical Engineering, GJU, Haryana, India. Prof. Mridul Chawla, Department of Elect. and Comm. Engineering, Deenbandhu Chhotu Ram University of Science & Technology, Murthal, Haryana, India. Prof. Seema Chawla, Department of Bio-medical Engineering, Deenbandhu Chhotu Ram University of Science & Technology, Murthal, Haryana, India. Prof. (Dr.) Atul M. Gosai, Department of Computer Science, Saurashtra University, Rajkot, Gujarat, India. Prof. (Dr.) Ajit Kr. Bansal, Department of Management, Shoolini University, H.P., India. Prof. (Dr.) Sunil Vasistha, Mody Institute of Tecnology and Science, Sikar, Rajasthan, India. Prof. Vivekta Singh, GNIT Girls Institute of Technology, Greater Noida, India. Prof. Ajay Loura, Assistant Professor at Thapar University, Patiala, India. Prof. Sushil Sharma, Department of Computer Science and Applications, Govt. P. G. College, Ambala Cantt., Haryana, India. Prof. Sube Singh, Assistant Professor, Department of Computer Engineering, Govt. Polytechnic, Narnaul, Haryana, India. Prof. Himanshu Arora, Delhi Institute of Technology and Management, New Delhi, India. Dr. Sabina Amporful, Bibb Family Practice Association, Macon, Georgia, USA. Dr. Pawan K. Monga, Jindal Institute of Medical Sciences, Hisar, Haryana, India. Dr. Sam Ampoful, Bibb Family Practice Association, Macon, Georgia, USA. Dr. Nagender Sangra, Director of Sangra Technologies, Chandigarh, India. Vipin Gujral, CPA, New Jersey, USA. Sarfo Baffour, University of Ghana, Ghana. Monique Vincon, Hype Softwaretechnik GmbH, Bonn, Germany. Natasha Sigmund, Atlanta, USA. Marta Trochimowicz, Rhein-Zeitung, Koblenz, Germany. Kamalesh Desai, Atlanta, USA. Vijay Attri, Software Developer Google, San Jose, California, USA. Neeraj Khillan, Wipro Technologies, Boston, USA. Ruchir Sachdeva, Software Engineer at Infosys, Pune, Maharashtra, India. Anadi Charan, Senior Software Consultant at Capgemini, Mumbai, Maharashtra. Pawan Monga, Senior Product Manager, LG Electronics India Pvt. Ltd., New Delhi, India. Sunil Kumar, Senior Information Developer, Honeywell Technology Solutions, Inc., Bangalore, India. Bharat Gambhir, Technical Architect, Tata Consultancy Services (TCS), Noida, India. Vinay Chopra, Team Leader, Access Infotech Pvt Ltd. Chandigarh, India. Sumit Sharma, Team Lead, American Express, New Delhi, India. Vivek Gautam, Senior Software Engineer, Wipro, Noida, India. Anirudh Trehan, Nagarro Software Gurgaon, Haryana, India. Manjot Singh, Senior Software Engineer, HCL Technologies Delhi, India. Rajat Adlakha, Senior Software Engineer, Tech Mahindra Ltd, Mumbai, Maharashtra, India. Mohit Bhayana, Senior Software Engineer, Nagarro Software Pvt. Gurgaon, Haryana, India. Dheeraj Sardana, Tech. Head, Nagarro Software, Gurgaon, Haryana, India. Naresh Setia, Senior Software Engineer, Infogain, Noida, India. Raj Agarwal Megh, Idhasoft Limited, Pune, Maharashtra, India. Shrikant Bhardwaj, Senior Software Engineer, Mphasis an HP Company, Pune, Maharashtra, India. Vikas Chawla, Technical Lead, Xavient Software Solutions, Noida, India. Kapoor Singh, Sr. Executive at IBM, Gurgaon, Haryana, India. Ashwani Rohilla, Senior SAP Consultant at TCS, Mumbai, India. Anuj Chhabra, Sr. Software Engineer, McKinsey & Company, Faridabad, Haryana, India. Jaspreet Singh, Business Analyst at HCL Technologies, Gurgaon, Haryana, India.

TOPICS OF INTEREST Topics of interest include, but are not limited to, the following:  Biotechnology  Cognitive neurosciences  Physics  Information coding and theory  Chemistry  Biology , Botany & Zoology  Logic & Systems  Earth science  Computer science  Applied and pure Mathematics  Decision Theory  Statistics  Medicine  Algorithms, and formal semantics  Anatomy  Biomedical sciences  Biochemistry  Bioinformatics  Ecology  Ethology  Food science  Genetics  Health sciences  Pharmacology  Geology  Surface sciences  Astronomy  Geophysics  Oceanography  Space sciences  Criminology  Aerospace  Agricultural  Chemical  Textile  Industrial, Mechanical  Military science  Operations research  Healthcare sciences  Dental sciences  Pharmaceutical sciences  Biostatistics  Computational linguistics  Cybernetics  Forestry  Scientific modeling  Network sciences  Horticulture & Husbandry  Agricultural & Veterinary sciences  Neural and fuzzy systems  Robotics and Automation  Materials sciences

TABLE OF CONTENTS (June-August, 2013, Issue 3, Volume 1) Issue 3 Volume 1 Paper Code

Paper Title

Page No.

AIJRFANS 13-201

EFFECT OF SIDDHA SAMADHI YOGA CAMPS on HEALTH and NUTRITIONAL STATUS of NORMAL and OBESE SUBJECTS K. Sreedevi G., Vani Bhushanam and P. Baby Devaki

01-04

AIJRFANS 13-202

On monotonic solutions of the Schroder equation in Hilbert spaces M.A. Alim

05-09

AIJRFANS 13-203

PCR-based identification of endophytes from three orchid species collected from Similipal Biosphere Reserve, India D. Behera, K. Tayung, and UB Mohapatra

10-17

AIJRFANS 13-204

Multiverse Cosmology from Exact Solution of Generalized Modified Wheeler-De Witt Equation Anjan Kumar Chowdhury

18-22

AIJRFANS 13-206

Synthesis, Characterisation and Antimicrobial studies of complexes of metal ions with 4{(E)-[1-(1H-benzo[d]imidazol-2-yl)ethylidene]amino}-3-methyl-1H-1, 2, 4-triazole-5(4H)thione and related ligand Madhu Bala, Kumud Kumari Mishra, Sanjay Kumar, L.K.Mishra

23-29

AIJRFANS 13-209

POPULATION STRUCTURE OF Penaeusmonodon FROM COASTALWEST BENGAL USING RAPD FINGERPRINTING N. R. Chatterjee, P. Chatterjee & S. (Dutta) Roy

30-36

AIJRFANS 13-211

Breaking of Synthetic Polymeric Resinous Bonds with help of Natural Enzymes extracted from Ginger, Garlic, Onion and Pomegranate Dr. Harsha Chatrath, Mr. Rohit Durge

37-40

AIJRFANS 13-212

Analysis of Working of LNA In UWB Range Somit Pandey

41-45

AIJRFANS 13-214

SPECTROPHOTOMETRIC DETERMINATION OF Cu(II) AND Ni(II) USING 4 PHENYL3-THIOSEMICARBAZONE OF 2-HYDROXY-4-n-PROPOXY-5BROMOACETOPHENONE (HnPBAPT) AS ANALYTICAL REAGENT AMBILY P NAIR, CHRISTINE JEYASEELAN

46-50

AIJRFANS 13-215

Synthesis and antibacterial activity of Substituted methyl 5-(2-bromopropionyl)-4-oxo-3phenyl-1-oxa-5-azaspiro [5.5] undec-2-en-2-carboxylic acid ester auxillaries Sayyed Hussain, Shivaji Jadhav, Megha Rai and Mazahar Farooqui

51-56

AIJRFANS 13-219

Matrix Metalloproteinases in Subjects With Type 2 Diabetes Mellitus: Pattern of MMP-2 and MMP-9 Profile in Diabetes Mellitus Type-2 Patients Sudip Das and Arunkumar Maiti

57-60

AIJRFANS 13-220

PHYTOCHEMICAL STUDIES ON CARDIOSPERMUM CANESCENS WALL. M.P. Shivamanjunath & K.P.Sreenath

61-65

AIJRFANS 13-223

Antimicrobial activity of herbal treated wool fabric Hooda S., Khambra K.,Yadav N. and Sikka V. K.

66-69

AIJRFANS 13-231

Relating Interactions of Water Soluble Xanthene Dye Molecules with Surfactant to Adsorption Kinetic data: A Spectroscopic Study JayasreeNath, S.A.Hussian, A. Pal, S. Deb, R. K. Nath

70-77

AIJRFANS 13-236

IMPACT of NUTRITION GARDEN on the CALCIUM, IRON and VITAMIN A STATUS of RURAL POPULATION in RANGA REDDY DISTRICT, ANDHRA PRADESH G. Vani Bhushanam and Dr. M. Usha Rani

78-81

AIJRFANS 13-239

POTENTIAL MEDICINAL PLANTS OF LAMIACEAE S.M.Venkateshappa and K.P.Sreenath

82-87

AIJRFANS 13-242

Effect of Chronic Noise Stress on Neutrophil Functions in Rats Archana R

88-92

AIJRFANS 13-245

Assessment of environmental and ecological quality status in the NE of Moroccan Mediterranean coast M.SADDIK, and B. ZOURARAH

93-98

AIJRFANS 13-246

Law of convergence of masses Krishna Mohan Agrawal

99-104

AIJRFANS 13-252

The Mechanism of Neoarchaean Granitoid Formation: Evidence from Eastern Dharwar Craton, Southern India Jinia Nandy, Sukanta Dey

105-109

AIJRFANS 13-254

Spectrophotometric Determination of Trace Amounts of Samarium in Environmental Samples Pushpa Ratre and Devendra Kumar

110-118

AIJRFANS 13-260

PHYTOREMEDIATION OF CADMIUM AND CHROMIUM FROM CONTAMINATED SOILS USING PHYSALIS MINIMA LINN Subhashini, V and A.V.V.S. Swamy

119-122

AIJRFANS 13-261

Thermodynamic studies of Oxytetracycline with some transition and rare earth metal ions in mixed solvent media Shailendrasingh Virendrasingh Thakur, Mazahar Farooqui, M.A.Sakhare and S.D. Naikwade

123-127

AIJRFANS 13-267

Physicochemical Studies on Gadolinium Soaps in Solid State Binki Gangwar, Rajesh Dwivedi, Neeraj Sharma and Meera Sharma

128-129

American International Journal of Research in Formal, Applied & Natural Sciences

Available online at http://www.iasir.net

ISSN (Print): 2328-3777, ISSN (Online): 2328-3785, ISSN (CD-ROM): 2328-3793 AIJRFANS is a refereed, indexed, peer-reviewed, multidisciplinary and open access journal published by International Association of Scientific Innovation and Research (IASIR), USA (An Association Unifying the Sciences, Engineering, and Applied Research)

EFFECT OF SIDDHA SAMADHI YOGA CAMPS on HEALTH and NUTRITIONAL STATUS of NORMAL and OBESE SUBJECTS K. Sreedevi1 G. Vani Bhushanam2 and P. Baby Devaki3 Lead interventionist, Behavioral Science Unit, National Institute of Nutrition, Hyderabad, India1 Research Associate, All India Coordinated Research Project on Home Science, Acharya NG Ranga Agricultural University, Hyderabad2 Head of the Department (Retd.), Faculty of Food Science & Nutrition, Sri Venkateshwara University, Tirupathi3

Abstract: Yogasana, pranayama, meditation and changed food habits is perceived by many Indians to lead a happy purposeful life with heightened consciousness. Siddha Samadhi Yoga (SSY) camp, a10 day package is believed to be one such effort to invoke the intellectual, emotional, mental and physical potential in each individual. This paper examines the effect of Siddha Samadhi Yoga (SSY) camps on normal and obese subjects. Thirty normal and thirty obese male subjects in the age group of 25 to 45 years free from additional complications were selected from two camps conducted in Mahaboobnagar and Tirupathi. The BMI of all subjects was assessed and Diet Survey conducted. Blood samples were analyzed for post prandial blood glucose; serum cholesterol; serum iron and hemoglobin levels. A significant difference in pre and post prandial blood glucose level of Normal subjects (t = 4.9811 > 2.05) and Obese (t = 7.6582 > 2.05) was observed. The percent reduction in BMI was 4.2 and 4.1 in normal and obese subjects respectively. Serum cholesterol levels among obese reduced by 3.4% and by 2.9% in normal subjects. A significant difference in pre and post serum iron level of Normal subjects (t = 12.881> 2.05) and Obese (t = 11.354 > 2.05) was observed. Hemoglobin levels improved by 12.27% and 14.71% respectively in normal and obese subjects. Keywords: Yoga, normal, obese, cholesterol, hemoglobin, post prandial blood glucose

I. Introduction Degenerative diseases and cancer are emerging as major causes of death not only in India but in other South and Southeast Asian countries as well. If present trends continue, India could emerge as one of the countries with the highest concentration of cases of diabetes mellitus and coronary heart disease (CHD) within the next three decades[1]. Obesity threatens to become the foremost cause of chronic disease in the world. Being obese can induce multiple metabolic abnormalities that contribute to cardiovascular disease, diabetes mellitus, and other chronic disorders. Reasons for the rising prevalence include urbanization of the worldâ&#x20AC;&#x2122;s population, increased availability of food supplies, and reduction of physical activity[2]. Obesity is generally regarded as one of the most common and serious nutritional problems confronting many communities today. Adults in India suffer from a dual burden of malnutrition; more than one-third of adults are too thin, and more than 10 percent are overweight or obese [3]. Yogic exercises are getting popular all over the world, not only for health and physical fitness, but also for therapeutic purposes. Yogic training tends to reduce the cholesterol level which is significant in individuals having above normal limits[4]. Meditation reduces bodily stress which is evident with reduced blood levels of cortisol and a lowered rate of urinary excretion of nitrogen and may prove useful for persons suffering from anxiety state and depression[5]. Antioxidant deficiency and free radical stress may be a risk factor for the development of diabetes and cardiovascular disease. It is possible that treatment with antioxidant vitamins may be protective [6]. Now-a-days a new way of life comprising of yogasana, pranayama, meditation and changed food habits which is expected to lead a happy purposeful life with heightened consciousness and perceptiveness. One such yoga camp is Siddha

Page 1

K. Sreedevi et al., American International Journal of Research in Formal, Applied & Natural Sciences, 3(1), June-August, 2013, pp. 01-04

Samadhi Yoga (SSY) camp which is said to invoke the true intellectual, emotional, mental and physical potential in each individual. These yoga camps claim to have the powers of reversing the ill effects of degenerative diseases[7]. In view of the beneficial effects of Yoga, Meditation and changed food habits the effect of Siddha Samadhi Yoga (SSY) camp’s on normal and obese subjects was planned.

II. Materials & Methods Thirty normal and thirty obese male free from further complications of twenty five to forty five years of age were selected from two camps conducted in Mahaboobnagar and Tirupathi, Andhra Pradesh, India. General information regarding economic status, educational status, occupation, family size etc. was elicited using General information questionnaire. The BMI of all subjects were calculated based on the heights and weights recorded. Blood samples were analyzed for post prandial blood glucose; serum cholesterol; serum iron and hemoglobin levels. Diet Survey was conducted on the basis of food intake record provided by the subjects before and at the end of the SSY camp of 18 days. The height and weight of all subjects were recorded following the methods of Jellifee [8] BMI was calculated using the formula weight in kg / height in (m2) and compared with standard classification of James et al(1998). Five ml of the blood was drawn from each subject and divided into three portions, one for estimation of blood glucose by Nelson and Somayagi[9] method, second for the estimation of serum cholesterol by Carr and Drekter[10] Method and the other for serum iron by ά – ά – dipyridly method[11], and finger prick samples were collected to estimate hemoglobin levels by cyanomethaemoglobin method[12]. Diet survey was conducted to note down the food items consumed over a period of three days (2 working days + 1 holiday) before and at the end of the SSY camp using standard cup to measure the food they consumed. Based on the food intake record food consumed per day was computed. The mean nutrients were calculated by using the tables of food values. The data on BMI, blood glucose; serum cholesterol; serum iron and hemoglobin levels, Dietary pattern and intake and personal well being of normal and obese subjects was analyzed statistically. The percentages, mean, standard deviation, t- value and their test of significance were calculated.

III. Results & Discussion The results on the effect of yoga camp on health status of normal and obese subjects with reference pre and post levels of blood glucose and serum cholesterol is presented in Table 1. TABLE 1: PRE AND POST LEVELS OF BLOOD GLUCOSE AND CHOLESTEROL LEVELS (n=30) Glucose Levels Details of Subjects

Normal Subjects

Obese Subjects

Levels PreLevels PostLevels PreLevels PostLevels

Mean + SD

Cholesterol Levels Difference in pre & post mean +SD

t' value

2.38+2.3

4.87

147.46+10.4

Mean + SD

Difference in pre & post mean +SD

t' value

6.86+5.3

7.14

8.92+4.2

11.60

236.42+7.13

145.08+10.16

229.56+5.31

149.03+6.20

258.97+8.84 3.63+2.6

145.40+5.44

7.66 250.05+7.82

The mean difference between the pre and post blood glucose level of Normal and Obese subjects was 2.38mg/dl and 3.678mg/dl respectively. The percent reduction of blood glucose was 1.6 +7.9 in Normal and 2.44 + 2.6 in obese subjects. Statistically there is a significant difference in pre and post prandial blood glucose level of Normal subjects (t = 4.9811 > 2.05) and obese (t = 7.6582 > 2.05). The‘t’ value is greater than‘t’ critical value at 5 percent level. The percent reduction of serum cholesterol level in Normal was 2.901 + 5.26 and 3.44 + 4.20 in Obese.

Page 2

K. Sreedevi et al., American International Journal of Research in Formal, Applied & Natural Sciences, 3(1), June-August, 2013, pp. 01-04

Generally among normal subjects before breakfast blood usually contains about 80mg/dl glucose. After a meal the concentration rises because, the glucose absorbed from the gut passes through the liver in to general circulation, it may reach 132mg or even more, but rarely exceeds 177mg at which point glucose usually enters into the urine. The effect of yoga camp of normal and obese subjects on the pre and post serum iron is presented in Table 2. Table 2: Serum iron levels before and after SSY camp Serum Iron Levels Details of Subjects

Levels Mean + SD

Normal Subjects (n=30) Obese Subjects (n=30)

Pre-Levels

143.68+11.83

Post-Levels

155.69+9.96

Pre-Levels

139.41+7.97

Post-Levels

146.10+7.28

Difference in pre & post mean +SD

t' value

12.01+5.1

12.88

6.69+3.23

11.35

The difference in pre and post serum iron levels was 12.01ug/dl in Normal and 145.73 μg/dl in Obese. There was percent decrease in serum iron levels (8.35 + 5.1) in Normal and Obese (1.2 + 7.28). There is a significant between pre and post serum iron levels of Normal and Obese. The increase in the serum iron levels from pre to post level in Normal subjects was statistically highly significant (P<0.05) compared to obese subjects. The effect of yoga camp of normal and obese subjects on the pre and post levels of dietary pattern is presented in Table 3 Table 3: Blood Hemoglobin levels of male subjects before and after SSY camp Blood Hemoglobin Levels Details of Subjects

Levels Mean + SD

Normal Subjects (n=30) Obese Subjects (n=30)

Pre-Levels

10.72+1.35

Post-Levels

12.03+1.0

Pre-Levels

10.16+0.87

Post-Levels

11.66+0.898

Difference in pre & post mean +SD

t' value

1.32+0.77

9.1

1.495+0.62

7.85

The mean blood hemoglobin pre levels of Normal and Obese subjects were 10.7 and 10.2g/dl respectively. The post levels were 12.03 and 11.66g/dl respectively. Healthy normal adult man has about 13 – 14g% blood haemoglobin11. The difference between pre and post level among normal subjects was 1.32g and percent increase in hemoglobin was 12.27+0.77and the difference between pre and post level was 1.495g and percent increase in hemoglobin was 14.71 + 0.87 among obese subjects. The effect of yoga camp of normal and obese subjects on the pre and post levels of dietary pattern is presented in Table 4. Table 4: Nutrient intake of Subjects before and during SSY program Nutrients Details of Subjects Normal Subjects (n=30) Obese Subjects (n=30)

Levels Energy

Carbohydrate

Protein

Fat

Fiber

Iron

βCarotene

Vitamin C

Before SSY

1786.63

213.43

49.92

54.58

1.76

19.82

1784.12

31.1

During SSY

1640.08

190.48

48.97

39.32

2.43

26.06

2091.93

36.91

Before SSY

1954.55

264.78

59.89

58.94

1.70

26.8

1711.8

26.49

During SSY

1667.51

211.82

57.95

43.43

4.34

28.1

1940.38

35.58

Page 3

K. Sreedevi et al., American International Journal of Research in Formal, Applied & Natural Sciences, 3(1), June-August, 2013, pp. 01-04

4.64 percent reduction of calories was observed in Normal and 14.71 in Obese. Percent reduction in carbohydrate; Protein; Fat dietary cholesterol was observed in Normal & Obese. Percent increase in intake of Fiber and Iron was observed in Normal and Obese. The percent intake of carotene was 14.71 in Normal and 24.25 in Obese but these values are still lower than the standard recommended intake which may be due to lowered intake of diet. In the present study a low degree of positive correlation was found between Vitamin C and post prandial blood glucose levels in Normal and negative correlation in obese subjects. There is a highly significant correlation between Vitamin C and post prandial blood glucose in normal subjects (r=0.484). From this it is evident that if Vitamin C intake is increased, post prandial blood glucose is controlled. IV. Summary & Conclusion The SSY camp has a significant effect in decreasing the post -prandial blood glucose and serum cholesterol levels, intake of calories, carbohydrates, cholesterol, fat and significant increase in the intake of fibre, vitamin C, iron and B-carotene. The correlations obtained between the health parameters, haematological parameters and the energy and nutrient intakes are very obvious and significant. Therefore efforts should be made to practice the food habits, regular exercise, yoga and meditation for continued beneficial effect. References [1]

Gopalan .C., 1996 Diet related chronic diseases in India changing trends Bulletin of the Nutrition Foundation of India,. 17(3): 1-5

[2]

Grundy, S.M. 1998 Multifactorial causation of obesity; implication for prevention Clinical American Journal of Clinical Nutrition, 67, (Suppl); printed in USA

[3]

National Family Health Survey (NFHS-3) 2005-06 : Key Findings, International Institute of Populational Sciences, Deonar, 14

[4]

Udupa, K.N. Singh, R.H Singh M.B. and Shettiwar, R.M. (1995) A comparative study on the effect of some individual yogic practices. Ind. Jour. Med. Res. 63:1060.

[5]

Udupa, K.N. Singh, R.H Singh M.B. (1978) Physiological studies on the effort of a Yogic relaxation posture Savasana J. Res. Ind. Med. Yoga & Homoeo 13/1:147.

[6]

Maritim A.C., Sanders R.A. and Watkins J.B. (2003) Diabetes, Oxidative stress and antioxidants: A Review J Biochem Molecular Toxicology, 17:1.

[7]

Yogeswar (1981) Textbook of Yoga, Madras.

[8]

Jellifee (1996) Assessment of Nutritional Status of the Community: with special reference to field surveys in the developing regions of the world, WHO, Geneva.

[9]

Nelson N and Somayagi M (1965) Determination of Glucose, Hawk’s Physiological Chemistry, Osler B2 Ed., New York, Mc Graw Hill Book Company, 14th Edition, 1054 – 55

[10] Carr J.J and Drekter I.J (1956) Simplified Rapid Technic for the Extraction and Determination of Serum Cholesterol without Saponification, Clinical Chemistry, 2, 353 [11] Ramsay W.N.M (1973), The measurement of serum transferring by iron binding capacity Journal of Clinical Pathology, 26:691 – 696 [12] Crosby,W.H, E. Munn and F.W. Furth (1954). Standardizing a method for hemoglobinometry, US Armed Forces Mad J_9 5:693.

Page 4

American International Journal of Research in Formal, Applied & Natural Sciences

Available online at http://www.iasir.net

On monotonic solutions of the Schröder equation in Hilbert spaces M.A. Alim Department of Mathematics, University of Chittagong, Chittagong-4331, Bangladesh ABSTRACT: We proved the existence and uniqueness of solutions of the Schröder equation (1) in the class of monotonic functions on cones in Hilbert spaces. KEYWORDS: Schröder fuctional equation, Krein-Rutman theorem. I.

INTRODUCTION

Consider the Schröder equation (1) with a positive constant . If the sequence converges pointwise, then its limit is a solution of (1). In some classes of functions it is the unique solution; cf. [3; Theorems 3.5.1, 4.6.1] and [4; corollary 1]. The class considered in [4] consists of functions such that is monotonic, but infinite values are allowed. Following ideas of [4] we consider solutions defined on a cone in a Hilbert space, taking values in possibly another Hilbert space, and such that is monotonic with a suitably chosen operator . Let be a real inner product space and be a closed cone in with non empty interior, i.e. is a closed subset of such that for every and Int . Let be a Hilbert space and be a closed cone in . We define a (partial) order on both spaces and by ). We assume that the inner product in is an increasing function on i.e. Note the following lemma (cf. [1; p. 208]).

(resp. for

Lemma 1 Suppose for . If , then for every Int there exists an such that for 1. We assume that and the following conditions hold: (H.1) and are bounded linear operators such that (2) (3) (4) (H.2)

Int

and

are such that (5) (6)

and

is an increasing function such that (7) (8) (H.3) The function

given

(9) satisfies (10) Examples of operators satisfying the above conditions will be given in section 2. Here observe that by (2) and (3) both and are increasing functions. Furthermore, by (7) with and by (9), we have Theorem 1. Assume (H.1) – (H.3). Then for every the sequence (11) converges, the function given by

Page 5

M.A. Alim, American International Journal of Research in Formal, Applied & Natural Sciences, 3(1), June-August, 2013, pp. 05-09

(12) is an increasing and nonzero solution of (1), the function

is increasing and .

(13)

(

(14)

Taking (9) into account we obtain (15) and then, by (4), (16) First we will prove that the series (17) converges for

It follows from (7) and (9) that (18)

Observe also that

is an increasing function. Then, using (5), (8) and (9) we have (19) (20)

Hence and, applying (7), As

and

increase on

We have

Then, by (6) the series (17) converges absolutely and due to (16) the sequence (11) converges for arbitrary, then according to Lemma 1 and (10) there exists an such that for Hence the sequence (11) converges for all Clearly, the function given by (12) is increasing. Since we have also Moreover,

i.e.

and

If and

take their values in a closed cone

is a solution of (1). Making use of (16) we obtain

Consequently, the function is increasing. In particular account, Consequently, is a nonzero function. Using (18) and (19) for get

and taking also (5) into and then induction we

Hence and by (7) â&#x20AC;&#x201C; (8), we obtain

Let Denote Since

be a solution of (1) such that it follows that

is increasing and (14) holds.

takes its values in

Moreover,

These remarks give jointly with (20) and (14)

whence Now we consider the case where the following conditions are fulfilled.

Page 6

M.A. Alim, American International Journal of Research in Formal, Applied & Natural Sciences, 3(1), June-August, 2013, pp. 05-09

(H.4) radius of i.e. (H.5) such that

and

Int

and

are bounded linear operators such that (2) – (4) hold with

being the spectral

(21) is an increasing function satisfying (7) and

are such that (5) holds and

(22) (H.6)

given by (23)

is increasing. Remark 1. Assume (H.4) – (H.6). It follows from (23) that

for

and, by induction, (24)

According to (21), given Therefore

we can choose an

such that

for

This shows that (10) holds. Theorem 2. Assume (H.4) – (H.6). Then for every the sequence converges, the function is an increasing and nonzero solution of , the function is increasing and Moreover, if

is a solution of

such that

given by

is increasing and (25)

for some , then Proof. It follows from (24) and (5) that (26) Taking this into account with applying (7) and arguing as in the proof of Theorem 1 we see that the series (17) converges absolutely for Applying Remark 1 and Lemma 1 we see that it converges absolutely for all On the other hand, from consideration of (23), applying (16) with replaced by – we get Consequently, the sequence (11) converges for every and the function has values in Moreover, using (26) with (7) and (22) we have

given by (12) increases and

In particular, is a nonzero function. Arguing as in the proof of Theorem 1 we obtain uniqueness. 2. Now we give three examples concerning the applicability of Theorems 1 and 2. (i) Let and with a and for It is easy to check that conditions (2) – (4) and (21) hold. Consequently, by Theorem 1, if is a function such that (10) holds and the function given by takes values in and satisfies (6) – (8) with a Int and then for every the limit (27) exists and provides an increasing and nonzero solution of (1). (ii) Let be a Hilbert space and be a completely continuous linear operator, i.e. is linear and maps bounded subsets of into relatively compact ones. Assume also that and for every there exists a positive integer such that Int Then by the Krein - Rutman Theorem ([1; The-orem 6.3]) there exists exactly one vector Int and exactly one continuous linear functional such that (28) (29) (30) (31)

Page 7

M.A. Alim, American International Journal of Research in Formal, Applied & Natural Sciences, 3(1), June-August, 2013, pp. 05-09

where

denotes the spectral radius of . Consequently, for and as well as for and conditions (2) – (4) and (21) are satisfied. Applications of Theorem 1 for and Theorem 2 for in both these cases with an increasing satisfying suitable conditions, yield an increasing solution of (1) on being the limit (32) In the next section we give conditions on under which the limit (32) coincides with the simpler one (27). (iii) Assume now is finite-dimensional. Then instead of the operator we can speak of a matrix and use the theorem of Frobenius (instead of Krein-Rutman; see, e.g., [2; Appendix 2]). Then, if all the elements of are nonnegative and there exists an integer such that all the elements of are positive, there exists vectors and with all the coordinates positive such that Consequently, for as well as for and conditions (2) – (4) and (21) are satisfied. 3. Consider now the problem – announced in Example (ii) and considered in fact also in [5] – of the equality of limits (27) and (32). Assume (H.7) is a completely continuous linear operator, and for every there exists a positive integer such that Int Remark 2. According to [1; pp. 269-270], under the assumption (H.7), for the operator given by where Int of we have

and

satisfy (28) –(31) with

being the spectral radius (33)

and (34) The proof of the following theorem is adopted from [5; Theorem 1].

Theorem 3. Assume (H.7) and let Suppose fulfils If either and

Int

and satisfy and there exist a positive constant

with such that

being the spectral radius of

is an increasing function such that hold with an is an increasing function such that (7) and (22) hold with an

and a , then

Proof. Consider the first case, with being increasing and satisfying (6) –(8). (In the second case the proof is similar.) Fix an such that the closed ball whose centre at radius is contained in Then

and (35)

Let According to (33) and (34) we have (36) and, by (35), We can assume that

for

Applying (15), we obtain for

with

replaced by

Using this

we have

for

From (20) and

(7) we get

Page 8

M.A. Alim, American International Journal of Research in Formal, Applied & Natural Sciences, 3(1), June-August, 2013, pp. 05-09

Taking into account the monotonicity of

for

we see that

Hence

for then

and, by the monotonicity of the inner product, Then

If Finally (37)

for is convergent. Consequently, putting

according to Theorem 1, the sequence (11) with

Moreover,

and using the obvious inequality

(which holds for

(37) and (6), we have Hence and from (36) we get Consequently, for

and, finally, by a use of Lemma 1, for References

[1] [2] [3] [4] [5] [6]

M. G. Krein and M.A. Rutman, Uspekhi Matem. Nauk (N.S.) 3, no. 1 (23) (1948), 3-95. [Translations, Series 1, vol. 10: Functional Analysis and Measure Theory, Amer. Math. Soc. (1962).] S. Karlin and H.M. Taylor, Academic Press, New York â&#x20AC;&#x201C; London, 1975. M. Kuczma, B. Choczewski and R. Ger, Encyclopedia Math. Appl. 32, Cambridge University Press, Cambridge, 1990. J. Walorski, Ann. Math. Sil. 8 (1994), 103-110. J. walorski, Proc. Amer. Math. Soc. 125 (1997), 153-158. Erwin Kreyszig, John Wiley & Sons, New York Inc, 1978.

Page 9

American International Journal of Research in Formal, Applied & Natural Sciences

Available online at http://www.iasir.net

PCR-based identification of endophytes from three orchid species collected from Similipal Biosphere Reserve, India D. Behera*1, K. Tayung2, and UB Mohapatra3 Regional Plant resource Centre, Nayapalli, Bhubaneswar, India; 2 P.G. Department of Botany, North Orissa University, Takatpur, Baripada, India; 3 Department of Biotechnology, Govt. of Odisha, India 1

Abstract: In the present study endophytic fungi associated with an orchid species, Acampe praemorsa was investigated. Samples (root and leaf) were collected from different sites of Similipal Biosphere Reserve. Isolation was carried out by surface sterilization procedure and inoculating the surface sterilized fragments in MS and PDA media. Altogether 50 endophytic fungal isolates were isolated from root and leaf tissues belong to 9 different species. A sterile endophytic fungus (sterile mycelia sp.1) was isolated from all the three Orchid species and was found to be dominant with highest colonization frequency in Acampe praemorsa (7.5%) followed by Vanda testacea (3%) and Cymbidium aloifolium (2%). Since the fungus could not identified by morphological features, molecular characterization was carried out by partial rDNA-ITS sequence analysis. Based on BLAST search analysis the fungus was found closest homolog to Colletotrichum sp, with maximum identity of 98%, maximum score of 913 and E- value of 0.0. The sequence has been deposited in GenBank database with an accession number JQ765411.1. The BLAST phylogeny along with 46 isolates of best hits of Colletotrichum species revealed that the fungus was found to be closest homolog to Colletotrichum sp. IP-77 with an accession number DQ780451.1 and maximum identity of 96%. Key words: Orchid; endophyte; sterile mycelium; Similipal Biosphere Reserve; mycorrhiza I. Introduction The numbers of population growths of orchid in nature are mostly dependant on seedling rather than the vegetative propagation. For germination of seed, there must be necessary of a suitable mycorrhizal association, due to lack of endosperm in the seeds [1]. After mycorrhizal association these fungi persist in the internal cortex region of root and known as endophytes. The specificity of the association between the orchid and the mycorrhiza varies from species to species. Some depend on a specific association whereas others can manage with wide range of fungal partners. To studied the mycorrihizal association of Caladenia huegelii an endangered herbaceous terrestrial orchid species of Australia in order to know the cause of the rarity [2]. The study revealed that the orchid C. huegelii is highly specific in its mycorrhizal association required for seed germination. It was also revealed that common congeners could swap or share fungal partners including the fungus associated with the rare orchid. Fungal specificity at different stages of development has been thoroughly studied [3]. Morphological identification of the fungi will be conducted based on the spore and culture characteristic like colony shape, length and colour of aerial hyphae, base color, growth rate, margin, surface texture, and depth of growth into medium. Using these characters all the fungi will be grouped into genus and species. Some non sporulataing fungus was always being confused and need to be molecular identification. However, some other group of fungi may not be able to grow on the fungus culture media. Therefore, polymerase chain reaction (PCR) methods have been used to directly identify fungi within roots using fungal specific primers [4], [5], [6] or through conventional fungal isolation step [7]. Since there was a number of interesting reports on endophytic association of orchids in worldwide, still the three species (Acampe praemorsa, Cymbidium aloifolium and Vanda testacea) create an attention to know the endophytic relations within different population of the three orchid species of Similipal Biosphere Reserve. II. Materials and Methods A. Collection of plant samples: Samples (roots and leaves) were collected from three orchid species (Acampe praemorsa, Cymbidium aloifolium and Vanda testacea). These materials were cut into small pieces and rapped with aluminum foil in the field. All these material were put in a thermo cool box and taken into Laboratory for further work. From each sites two to three samples were taken for this study. B. Isolation of endophytes and identification For isolation of endophytes samples were properly washed with running tap water and then with sterile distilled water. The washed samples were sequentially surface sterilized by immersing in 70% ethanol for 3 min. and 0.5% sodium hypochlorite (NaOCl) for 1 min and rinsed thoroughly with sterile distilled water [8]. The AIJRFANS 13-203; ÂŠ 2013, AIJRFANS All Rights Reserved

Page 10

D. Behera et al., American International Journal of Research in Formal, Applied & Natural Sciences, 3(1), June-August, 2013, pp. 10-17

surface sterilized samples were then dried under Laminar flow chamber. The leaf samples were cut into rectangular size of 0.2 cm x 0.5cm with a sterile scalpel. For root samples outer bark were dissected out and inner tissue of 0.2 cm2 were obtained with a sterile scalpel. All fragments were placed on the MS medium and Potato Dextrose Agar (PDA) medium. In each petridishes, 4 fragments of plant samples were inoculated. After inoculation, one set of plates were incubated in 14/10 h light and dark at temperature (25±2 ºC) for 2 weeks and another set of plates were incubated at dark at room temperature (28±2 ºC) for 2 week. The plates were observed once a day for the growth of endophytic fungi. Hyphal tips growing out the plated segments were immediately transferred into PDA slant, purified and maintained at 4 oC. The fungal isolates were identified based on their morphological and reproductive characters using standard identification manuals [9], [10]. The fungal cultures that failed to sporulate were categorized as sterile mycelia. C. Data analysis The relative frequency of colonization (%CF) was calculated as the number of segments colonized by specific fungus divided by total number of segments plated X 100 and dominant endophytes were calculated as percentage colony frequency divided by sum of percentage of colony frequency of all endophytes X 100. D. Isolation of genomic DNA, PCR amplification and sequencing A dominant non sporolating endophytic fungus was selected for molecular characterization. The isolation of genomic DNA, PCR amplification and sequencing was carried out in collaboration with Ocimum Biosolution, Bangalore, India. The procedure is as follows: The fungus was cultured on potato dextrose agar medium and small amount of mycelium was suspended in 40µl MQ (Make: Bio Rad) water. The suspended culture was added with 160µl of NaOH (0.05M) and mixed well. The samples were incubated on dry bath for 45 min at 60 oC and vortexed intermittently. Then 12µl of Tris-HCL (0.01M) was added and the mixture was diluted up to 100 fold. From the diluted extract 6µl was used for PCR. The PCR was set up using the following components: 2.5µl Buffer (10x), 1.5µl MgCl2 (25mM), 2.5µl dNTPs (2mM), 0.2µl promega Taq (5U/µl), 1.0µl primer F (5pm/µl) and 6.0µl DNA from diluted extract. The PCR condition was run in such a way, where initial denaturation was at 94 oC for 3 min. Denaturation, annealing and extension were done at 96 oC for 10 sec, 55 oC for 10 sec and 72 oC for 30 sec respectively in 45 cycles. Final extraction was done at 72 oC for 10 min and hold at 4 oC for infinite time. After the PCR cycle, 2µl of the product was used to check on 1% agarose gel. It was then purified using quick spin column and buffers (washing buffer and elution buffer) according to the manufacturer’s protocol (QIA quick gel extraction kit Cat No.28706). DNA sequencing was performed using an Applied Biosystem 3130xl analyzer. E. Homology Searching Using Basic Local Alignment Search Tool (BLAST) BLAST computers a pair wise alignment between a query and the data based sequence searched. The sequence was given as input in the BLAST web interface. The general parameters were chosen, selecting mega blast algorithm which searches most closely related sequences. The number of bases of the input sequence was 559 base pair. The database against which the homology search was performed was non redundant and covered all Gene Bank, EMBL, DDBJ and PDB sequences. The BLAST version chosen for the purpose of homology search was BLASTN 2.2.25 F. Phylogenetic analyses Phylogenetic investigation of the sequence was carried out based on BLAST output. Out of 100 homologous sequences, several sequences were considered representing one from each species. The tree was generated using basic MUSCLE 3.6 software [11] taking into account of partial 18S ribosomal RNA gene sequences. III. Results and Discussion A. Isolation, identification and occurrence of endophytes In both the condition the fungal hyphae comes on the media but the number of colonization was higher in the dark condition in room temperature. Almost all the fungal hyphae were isolated from the dark incubated plates, rather than the light dark resime plate. Isolated species from both the conditioned plates are same (data not shown). Altogether 94 endophytic isolates were obtained from both surface sterilized leaf and root fragments. Out of the total endophytes, 50 isolates were isolated from A. praemorsa and the rest were obtained from the other two orchid species. The endophytic isolates comprises of 9 different fungal species (Table 1), out of which 3 isolates were categories as sterile mycelia because of their sterile nature, 2 isolates were identified as Rhizoctonia spp. and 1 each of Colletotrichum, Xylaria, Ceratobasidium and Fusarium species. All the Orchids were found to be colonized by endophytic fungi. Among the Orchid species, endophytic fungal colonization was found to be highest in Acampe praemorsa (25%) followed by Vanda testacea (12.5%) and Cymbidium aloifolium (9.5%). The colonization frequency of sterile mycelia was found to be highest among endophytes and that of Xylaria and Fusarium was found to be lowest. Species of Rhizoctonia and sterile mycelia was found to be colonized in all the three orchid species studied (Plate 1) while Xylaria and Fusarium was not found to be colonized in Cymbidium aloifolium. Almost all mycorrhiza associated with terrestrial orchid is Rhizoctonia including anamorphic of Tulasnella, Ceratobasidium, and Thanatephorus [12], [13]. According to

Page 11

D. Behera et al., American International Journal of Research in Formal, Applied & Natural Sciences, 3(1), June-August, 2013, pp. 10-17

Athipunyakom et al., Tulasnella sp. is associated with Cymbidium tracyanum [14]. Fungi known to be associated with Spathoglottis sp. is Rhizoctonia [15]. The study of Tan et al. showed that there is important role of the fungi on seed germination of Spathoglottis plicata [15]. However, Hayakawa et al. showed different results, there was no significant effect of the isolate fungus on in vitro seed germination [16]. In our study, highest number of endophytes was colonized in Acampe praemorsa with 28 isolates obtained from leaf tissue and 22 isolates from root tissue. Species of Colletotrichum was found to be colonized only in root tissues of Acampe praemorsa and Cymbidium aloifolium. Two endophytic species of genus Rhizoctonia were isolated from root and leaf tissue of all the three orchid species with variable colonizing frequency. One fungus of Xylaria sp. was isolated from only leaf tissue from Acampe praemorsa and Vanda testacea. Furthermore, one percentage of colonizing frequency was noted down in Fusarium sp. from Acampe praemorsa and Vanda testacea. Moreover, Ceratobasidium sp. was also identified from both leaf and root tissue of all the three orchid species except leaf of Vanda testacea. The variation in the number of endophytic fungus species inside Acampe primorsa might be the cause of the one dominant and rigid orchid species in this locality. B. Molecular identification, Homology and Phylogenetic analysis A sterile endophytic fungus (sterile mycelia sp.1) was isolated from all the three Orchid species and was found to be dominant with highest colonization frequency in Acampe praemorsa (7.5%) followed by Vanda testacea (3%) and Cymbidium aloifolium (2%). Since the fungus was sterile it could not be identified morphologically and by microscopic observation because it did not produce any spore. Therefore, molecular identification was carried out based on partial internal transcribed spacer ribosomal DNA (ITS rDNA) gene sequence. The 18S rDNA was amplified by PCR using universal primer and DNA sequence was obtained by an Applied Biosystem 3130xl analyzer. The DNA sequence so obtained was annotated and submitted to GenBank. The sequence has been deposited in GenBank database with an accession number JQ765411.1. Based on BLAST search of the sequence, the fungus was found to be closest homolog to Colletotrichum sp. IP-77 with an accession number DQ780451.1 and maximum identity of 96%. The same type of methodology was also followed by Kasmir et al. for identifying the fungal endophytes [17]. They also reported the ITS region of NCBI data base was compiled and the closest similarities was showed the fungus species. Furthermore, they also reported that, molecular identification had been useful in precisely screening fungal endophytes than relying on microscopical features alone. Evolutionary relationship of the fungus was also studied with other Colletotrichum species selectively obtained from world database (NCBI). A phylogenetic tree was generated by Neighbor-Joining method. The optimal tree with the sum of branch length = 1.15413183 is shown (Fig. 1). The percentage of replicate trees in which the associated taxa clustered together in the bootstrap test (1000 replicates) is shown next to the branches. The evolutionary distances were computed using the Maximum Composite Likelihood method and are in the units of the number of base substitutions per site. All positions containing gaps and missing data were eliminated from the dataset (Complete deletion option). There were a total of 222 positions in the final dataset. Phylogenetic analyses were conducted in MEGA4. The tree showed that more or less the same named species of Colletotrichum clustered together forming distinct clades. The fungus under study i.e. Colletotrichum JQ765411.1 formed a distinct clade with Colletotrichum dracaenophilum and Colletotrichum sp. with well supported bootstrap value of 92%. The species under this clade were also the best hit and maximum identity in BLAST result. Further the identification of the fungus is authenticated due to fact that the fungus clustered with a Colletotrichum species with accession number DQ780451.1 with bootstrap value of 47%. Thus the BLAST and phylogeny gave similar result, identifying the sterile fungus to be under the genus Colletotrichum. The beneficial association of this fungus on in-vitro seed germination of Acampe praemorsa, Cymbidium aloifolium and Vanda testacea are being studied are near future. C. Partial sequence of orchid endophyte (ITS region) GAACTGGATTCCTAACCTGATCGAGGTCACCTTGTTACGACTTTTACTTCACTTTACGGCA GGAGAGTCCCTCCGGATCCCAGTGCGAGGTGGTAATGCTACTACGCAAAGGAGGCTCCGGGAGGG TCCGCCACTGTCTTTGGGGGCCTACGTCCGCCGTAGGGCCCCAACACCAAGCAGTGCTTGAGGGTT GAAATGACGCTCGAACAGGCATGCCCGCCAGAATGCTGGCGGGCGCAATGTGCGTTCAAAGATTC GATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCAG AACCAAGAGATCCGTTGTTAAAAGTTTTGATTATTGTTTTGCTTGTGCCACTCAGAAGAAACGTCG TTAAATCAGAGTTTGGTTATCCCCCGGCGGGCGCGCCGCGAGGGCGCCGGGGAGGCGGCGTCTCC GCCGCCTGCCCGCCGAGGCAAAAGTTGAGGTATGTTCACAAAGGGTTATAGAGCGGTAACTCAAT AATGATCCCTCCGCTGGTTCACCAACGGAGACCTTGTTG

Page 12

D. Behera et al., American International Journal of Research in Formal, Applied & Natural Sciences, 3(1), June-August, 2013, pp. 10-17

Table 1 Number and Colonization frequency of endophytic fungi in leaf and root tissues of Acampe praemorsa, Cymbidium aloifolium and Vanda testacea. Endophytic fungi

Acampe praemorsa

Colletotrichum sp.

3.0

1.5

2.0

1.0

Rhizoctonia sp. 1

2.0

4.0

3.0

1.0

2.0

1.5

1.0

2.0

1.5

Rhizoctonia sp. 2

4.0

3.0

3.5

3.0

2.0

2.5

1.0

3.0

2.0

Sterile mycelium sp.1

5.0

7.5

2.0

3.0

Sterile mycelium sp.2

5.0

3.0

4.0

2.0

Sterile mycelium sp.3

3.0

2.0

2.5

1.0

2.0

1.0

1.5

Xylaria sp.

1.0

0.5

2.0

1.0

Ceratobasidium sp.

1.0

2.0

1.5

2.0

1.0

1.5

1.0

0.5

Fusarium sp.

2.0

1.0

No. of isolates recovered

25%

9.5

12.5%

leaf

Cymbidium aloifolium

Root

CF(%)

Leaf

Root

Vanda testacea CF(%)

leaf

Root

CF(%)

CF: - Colonization frequency of endophytes based on 200 fragments plated Table 2 The most allied Colletotrichum sp. Download from NCBI database for phylogenetic tree Sl. No

Organism

Host

Country

Accession no.

Reference

Length (bp)

Colletotrichum siamense

Jasminum sambac

Viet Nam

JX010259.1

593

Colletotrichum nupharicola

Nuphar polysepala

USA

JX010189.1

Weir et al. (Unpublished) Weir et al. (Unpublished)

Colletotrichum fructicola

Fragaria x ananassa

USA

JX010179.1

Weir et al. (Unpublished)

594

Colletotrichum siamense

Capsicum annuum

Thailand

JX010257.1

593

Nuphar polysepala

USA

JX010187.1

Nymphaea odorata

USA

JX010188.1

Colletotrichum nupharicola Colletotrichum nupharicola Colletotrichum siamense

Persea americana

New Zealand

JX010249.1

Colletotrichum fructicola

Ficus habrophylla

Germany

JX010181.1

Colletotrichum siamense

Nigeria

JX010245.1

10.

Colletotrichum fructicola

Dioscorea rotundata Dioscorea alata

Nigeria

JX010183.1

11.

Colletotrichum dracaenophilum Colletotrichum dracaenophilum Colletotrichum sp. Porn02 Colletotrichum sp. IP-77 Colletotrichum hippeastri Colletotrichum boninense Colletotrichum tropicale

Dracaena sanderana Dracaena sanderiana Piper sp.

China

DQ286211.1

Weir et al. (Unpublished) Weir et al. (Unpublished) Weir et al. (Unpublished) Weir et al. (Unpublished) Weir et al. (Unpublished) Weir et al. (Unpublished) Weir et al. (Unpublished) [18]

Bulgaria

EU003533.1

559

Thailand

HM357614.1

Boben et al. (Unpublished) [19]

-Hippeastrum sp.

Thailand Netherlands

DQ780451.1 JX010293.1

564 612

Crinum asiaticum var. sinicum Theobroma cacao

Japan

JX010292.1

Panama

JX010264.1

Colletotrichum xanthorrhoeae

Xanthorrhoea sp.

Australia

JX010261.1

[20] Weir et al. (Unpublished) Weir et al. (Unpublished) Weir et al. (Unpublished) Weir et al. (Unpublished)

12. 13. 14. 15. 16. 17. 18.

594

594 594 594 594 593 594 573

572

612 593 593

Page 13

D. Behera et al., American International Journal of Research in Formal, Applied & Natural Sciences, 3(1), June-August, 2013, pp. 10-17

19.

Colletotrichum gloeosporioides Colletotrichum theobromicola

Carya illinoinensis

Australia

JX010151.1

Weir et al. (Unpublished) Weir et al. (Unpublished)

594

Fragaria x ananassa

USA

JX010285.1

21.

Colletotrichum siamense

Malus x domestica

USA

JX010263.1

593

EU056738.1

Weir et al. (Unpublished) Weir et al. (Unpublished) Weir et al. (Unpublished) Weir et al. (Unpublished) Weir et al. (Unpublished) [21]

22.

Colletotrichum musae

Musa sp.

Kenya

JX010143.1

23.

Colletotrichum musae

Musa sp.

New Zealand

JX010141.1

24.

Colletotrichum musae

Musa sp.

USA

JX010146.1

25.

Colletotrichum musae

Musa sp.

Philippines

JX010144.1

26.

Colletotrichum capsici

Capsicum chinense

27.

Colletotrichum capsici

Carica papaya

28.

Colletotrichum capsici

Carica papaya (L.)

29.

Colletotrichum capsici

Carica papaya

30.

Colletotrichum capsici

Capsicum annuum (L.)

Mexico: Yucatan Mexico: Yucatan Trinidad and Tobago Mexico: Yucatan Trinidad and Tobago

EU056739.1

[21]

569

JF749806.1

[22]

520

EU056740.1

[21]

581

JF749808.1

[22]

520

31.

Colletotrichum kahawae subsp. kahawae Colletotrichum horii

Coffea sp.

Kenya

JX010235.1

593

Diospyros kaki

Japan

JX010213.1

Colletotrichum kahawae subsp. BW-2012 Colletotrichum kahawae subsp. BW-2012 Colletotrichum horii

Dryandra sp.

South Africa

JX010237.1

Miconia sp.

Brazil

JX010239.1

Diospyros kaki

China

JX010212.1

Xanthorrhoea sp.

Australia

JX010260.1

Korea

GU935872.1

Boehmeria nivea

China

JF830783.1

Korea

GU935871.1

588

Wasabia japonica

Japan

AB455253.1

Hong et al. (Unpublished) [24]

Korea

GU935873.1

Canada

EU400147.1

Coffea sp.

Brazil

FR717701.1

Hong et al. (Unpublished) Chen et al. (Unpublished) [25]

588

43.

Colletotrichum xanthorrhoeae Colletotrichum higginsianum Colletotrichum higginsianum Colletotrichum higginsianum Colletotrichum higginsianum Colletotrichum higginsianum Colletotrichum higginsianum Colletotrichum fragariae

Weir et al. (Unpublished) Weir et al. (Unpublished) Weir et al. (Unpublished) Weir et al. (Unpublished) Weir et al. (Unpublished) Weir et al. (Unpublished) Hong et al. (Unpublished) [23]

44.

Colletotrichum fragariae

Coffea arabica

Angola

FR717696.1

[25]

489

45.

Colletotrichum fragariae

Coffea sp.

Brazil

FR717700.1

[25]

489

46.

Colletotrichum fragariae

Coffea arabica

Angola

FR717698.1

[25]

489

20.

32. 33. 34. 35. 36. 37. 38. 39. 40. 41. 42.

596

594 594 594 594 569

593 593 593 593 593 588 590

564

585 489

Page 14

D. Behera et al., American International Journal of Research in Formal, Applied & Natural Sciences, 3(1), June-August, 2013, pp. 10-17

2 1

Colletotrichum siamense JX010259.1 Colletotrichum nupharicola JX010189.1

Colletotrichum fructicola JX010179.1

Colletotrichum siamense JX010257.1 Colletotrichum nupharicola JX010187.1

Colletotrichum nupharicola JX010188.1

Colletotrichum siamense JX010249.1 Colletotrichum fructicola JX010181.1

Colletotrichum siamense JX010245.1 1

Colletotrichum fructicola JX010183.1 Colletotrichum dracaenophilum DQ286211.1 Colletotrichum dracaenophilum EU003533.1

Colletotrichum sp. HM357614.1

Colletotrichum sp. JQ765411.1*

88 47 10

Colletotrichum sp. DQ780451.1 Colletotrichum hippeastri 010293.1

Colletotrichum boninense JX010292.1 Colletotrichum tropicale JX010264.1

Colletotrichum xanthorrhoeae JX010261.1 Colletotrichum gloeosporioides JX010151.

Colletotrichum theobromicola JX010285.1 3

Colletotrichum siamense JX010263.1 1 41

Colletotrichum musae JX010143.1 Colletotrichum musae JX010141.1

46 3

Colletotrichum musae JX010146.1 11 40

Colletotrichum musae JX010144.1 Colletotrichum capsici EU056738.1 Colletotrichum capsici EU056739.1

Colletotrichum capsici JF749806.1

Colletotrichum capsici EU056740.1

19 6

Colletotrichum capsici JF749808.1 Colletotrichum kahawae JX010235.1 Colletotrichum horii JX010213.1 Colletotrichum kahawae JX010237.1

32 43

Colletotrichum kahawae JX010239.1

3 5

Colletotrichum horii JX010212.1 Colletotrichum xanthorrhoeae JX010260.1 Colletotrichum higginsianum GU935872.1

Colletotrichum higginsianum JF830783.1

Colletotrichum higginsianum GU935871.1

13 20

Colletotrichum higginsianum AB455253.1 Colletotrichum higginsianum GU935873.1 Colletotrichum higginsianum EU400147.1

Colletotrichum fragariae FR717701.1 Colletotrichum fragariae FR717696.1

100

Colletotrichum fragariae FR717700.1 22

Colletotrichum fragariae FR717698.1

Fig. 1 Phylogenetic tree inferred by Neighbor-Joining method showing evolutionary relationship of Colletotrichum sp. (JQ 765411.1) with other Colletotrichum species selectively obtained from world database

Page 15

D. Behera et al., American International Journal of Research in Formal, Applied & Natural Sciences, 3(1), June-August, 2013, pp. 10-17

Plate 1: A & B: Showing the endophytes comes out from the Leaf and Root tissue; C & D:- Purification of endophytic fungus; E:- Endophyte isolation and maintenance; F: Colletotrichum sp. (100x); G:Rhizoctonia sp. (100x) H:- Sterile mycellium (100x) IV. [1] [2] [3] [4] [5] [6] [7] [8] [9] [10]

References

R.P. Shefferson, T. Kull and K. Tali, Mycorrhizal interactions of orchids colonizing Estonian mine tailings hills. American Journal of Botany, 95, 2007, 156-164. N.D. Swarts, E.A. Sinclair, A. Francis and K. W. Dixon, Ecological specialization in mycorrhizal symbiosis leads to rarity in an endangered orchid. Molecular Ecology, 9, 2010, 3226-3242. M.I. Bidartondo, and D.J. Read, Fungal specificity bottlenecks during orchid germination and development. Molecular Ecology, 17, 2008, 3707-3716. M. Gardes, and T.D. Bruns, ITS primers with enhanced specificity for basidiomycetes--application to the identification of mycorrhizae and rusts. Molecular Ecology, 2, 1993, 113-118. K.W. Cullings, T.M. Szaro and T.D. Bruns, Evolution of extreme specialization within a lineage of ectomycorrhizal epiparasites. Nature, 379, 1996, 63-66. R. Kjoller and S. Rosendahl, Detection of arbuscular mycorrhizal fungi (Glomales) in roots by nested PCR and SSCP (single strand conformation polymorphism). Plant and Soil, 226, 2000, 189-196. D.L. Taylor and T.D. Bruns, Population, habitat and genetic correlates of mycorrhizal specialization in the ‘cheating’ orchids Corallorhiza maculata and C. mertensiana. Molecular Ecology, 8, 1999, 1719-1732. G.F. Bills, Isolation and analysis of endophytic fungal communities from woody plants. In: Systematics, Ecology and Evolution of Endophytic Fungi in Grasses and Woody plants. S.C. Redlin and L.M. Carris, eds. APS Press, St. Paul, MN, 1996, 31-65. H.L. Barnett and B.B. Hunter, Illustrated genera of imperfect fungi. Burgers Publishing Company, Minneapolis, 1972. C.V. Subramanian, Hypomycetes an account of Indian species except Cercospora. Indian Council of Agricultural Research Publication, New Delhi, 1971, 930.

Page 16

D. Behera et al., American International Journal of Research in Formal, Applied & Natural Sciences, 3(1), June-August, 2013, pp. 10-17

[11] [12] [13]

[14] [15] [16] [17]

[18] [19]

[20] [21]

[22]

[23] [24] [25]

R.C. Edgar, Local homology recognition and distance measures in linear time using compressed amino acid alphabets. Nucleic Acids Research, 32, 2004, 380-385. J.T. Otero, J.D. Ackerman and P. Bayman, Diversity and host specificity of endophytic Rhizoctonia-like fungi from tropical orchids. American Journal of Botany, 89 (11), 2002, 1852-1858. Y. Bonnardeaux, M. Brundrett, A. Batty, K. Dixon, J. Kock, and K. Sivasithamparam, Diversity of mycorrhizal fungi of terrestrial orchid: Compatibility webs, brief encounters, lasting relationships and alien invasion. Mycological Research 11, 2007, 51-61. P. Athipunyakom, L. Manoch, and C. Piluek, Isolation and identification of mycorrhizal fungi from eleven terrestrial orchids. Natural Science, 38 (2), 2004, 216-228. Z.Y. Tan, X.D. Xu, E.T. Wang, J.L. Gao, E. Martinez-Romero and W.X. Chen, Phylogenetic and genetic relationships of Mesorhizobium tianshanense and related Rhizobia. International Journal of Systematic Bacteriology, 47, 1999, 874-879. S. Hayakawa, Y. Uetake, and A. Ogoshi, Identification of symbiotic Rhizoctonias from naturally occurring protocorms and roots of Dactylorhiza aristata (Orchidaceae). Journal of Faculty of Agriculture, Hokkaido University, 69 (2), 1999, 129-141. J. Kasmir, S.R. Senthilkumar, S. John Britto and L. Joelri Michael Raj, Identification of fungal endophytes from orchidaceae members based on nrITS (internal transcribed spacer) region. International Research Journal of Biotechnology, 2(6), 2011, 139144. D.F. Farr, A.Y. Rossman, M.E. Palm, and E.B. McCray, Fungal Databases, Systematic Botany and Mycology Laboratory, ARS, USDA. Retrieved 27 Sep 2006. K. Tianpanich, S. Prachya, S. Wiyakrutta, C. Mahidol, S. Ruchirawat and P. Kittakoop, Radical seavenging and antioxidant activities of isocoumarins and aphthalide from the endophytic fungus Colletotrichum sp. Journal of Natural Products, 74 (1), 2011, 79-81. I. Promputtha, S. Lumyong, V. Dhanasekaran, E.H.C. McKenzie, K.D. Hyde and R. Jeewon, A phylogenetic evaluation of whether endophytes become saprotrophs at host senescence. Microbial Ecology, 53(4), 2007, 579-590. R. Tapia-Tussell, A. Quijano-Ramayo, A. Cortes-Velazquez, P Lappe, A. Larque Saavedra and D. Perez-Brito, PCR-based detection and characterization of the fungal pathogens Colletotrichum gloeosporioides and Colletotrichum capsici causing anthracnose in papaya (Carica papaya l.) in the Yucatan peninsula. Molecular Biotechnology, 40 (3), 2008, 293-298. A. Maharaj and S.N. Rampersad, Genetic differentiation of Colletotrichum gloeosporioides and C. truncatum associated with anthracnose disease of papaya (Carica papaya L.) and bell pepper (Capsium annuum L.) based on ITS PCR-RFLP fingerprinting. Molecular Biotechnology, 50 (3), 2012, 237-249. X.X. Wang, J. Chen, B. Wang, L.J. Liu, X. Huang, S.T. Ye and D.X. Peng, First Report of Anthracnose on Boehmeria nivea caused by Colletotrichum higginsianum in China. Plant Disease, 95 (10), 2011, 1318. J. Takeuchi, K. Takeuchi, S. Kagiwada, S. Nishimura, K. Watanabe and H. Horie, Diseases observed at wasabi Field in the Okutama area of Tokyo. Kantou Tousan Byougaichuu Kenkyuukaihou, 55, 2008, 39-44. D.N. Silva, P. Talhinhas, V. Varzea, L. Cai, O.S. Paulo and D. Batista, Application of the Apn2/MAT locus to improve the systematics of the Colletotrichum gloeosporioides complex: An example from coffee (Coffea spp.) hosts. Mycologia, 104 (2), 2012, 396-409.

Page 17

American International Journal of Research in Formal, Applied & Natural Sciences

Available online at http://www.iasir.net

Multiverse Cosmology from Exact Solution of Generalized Modified Wheeler-De Witt Equation Anjan Kumar Chowdhury Department of Physics University of Chittagong Chittagong-4331 BANGLADESH Abstract: Minisuperspace Wheeler-DeWitt equation has been solved for various types of potentials. A simple potential has been used in [5,6] where it has been shown that the universe expands from zero volume reaching a maximum size and then it recollapses to zero volume again. In this paper we have used a general type of potential and found an exact solution of the generalized modified minisuperspace WheelerDeWitt equation. The solution indicates that there might be infinite types and numbers of universes which gives the taste of multiverse cosmology and those universes expand or contract exponentially. The solution also avoids the Big Bang singularity. Keywords: multiverse cosmology; quantum gravity; Wheeler DeWitt equation; exact solution; singularity

I. Introduction It is generally accepted that the wavefuntion of a quantum particle contains all information regarding that particle. If the Big Bang theory is correct then the universe starts expansion from zero volume or literally from a point particle. The universe was congealed with immense energy at the time of its birth. So, there must be quantum fluctuations at that time and the laws of quantum mechanics should be applied to that super particle. From that point of view the wavefunction of the universe was conjectured [1- 5]. When quantum mechanics and general theory of relativity are combined to a certain satisfactory level, like Schrödinger equation in quantum mechanics, one gets a second order differential functional equation, named as, Wheeler-DeWitt (WDW) equation, which is also the basic equation of quantum gravity. Hence, it is expected that all information regarding the universe can be extracted from the wavefunction of the universe. WDW equation is a functional differential equation for the wavefunction of the universe , which is a functional of the three-geometries , given by,

where, given by

is known as the De Witt metric or (5+1) dimensional metric on superspace with signature (-+++++),

The solution of equation (1) is notoriously difficult. One way to get some primary information regarding the universe is to reduce the dimension of the equation (1). The most reduced and simplified equation is known as the “minisuperspace” WDW equation which has only two dimensions with homogeneous and isotropic manifolds. The corresponding minisuperspace WDW equation [7-10] can be given by

where,

is an arbitrary constant for matter-energy renormalization and

is the potential and is given by

where, and be the scale factor and conformally invariant scalar field respectively. The potential described by (4) is a simple one. In this paper we generalize this potential for some arbitrary parameters and found an exact

Page 18

A. K. Chowdhury, American International Journal of Research in Formal, Applied & Natural Sciences, 3(1), June-August, 2013, pp. 18-22

solution of the generalized modified minisuperspace WDW equation. The solution of this equation implies that there are infinite numbers of universes of different types depending on the parameters considered. II. Generalized modified Minisuperspace Wheeler-DeWitt Equation Let us generalize the potential function (4) as

where , and are arbitrary parameters and are integers with some unique relations among them whose will be shown later (Fig. 1). is related to Hubble constant by . Hence the modified WheelerDe Witt equation in minisuperspace can be given by:

Figure 1: Graphical representation of general WDW potential (Eq. 5) for

For convenience, let us write becomes

and

and equation (6)

Equation (7) is the modified minisuperspace WDW equation to be solved exactly. III. Solution of Generalized modified Minisuperspace Wheeler-DeWitt Equation Let us consider a general trial solution of equation (7)

where be a constant, we get

be an arbitrary parameter and &

are any integers. Differentiating with respect to

Page 19

A. K. Chowdhury, American International Journal of Research in Formal, Applied & Natural Sciences, 3(1), June-August, 2013, pp. 18-22

Similarly,

Differentiating (8) with respect to

we get

Similarly,

Putting the values of term we get

and

into equation (7) and simplifying after canceling the exponential

Let us consider

and

Now equating the powers we get

Equations (14-16) give:

Page 20

A. K. Chowdhury, American International Journal of Research in Formal, Applied & Natural Sciences, 3(1), June-August, 2013, pp. 18-22

Under these conditions the solution (8) satisfies equation (7). Writing

we get from (8) (20)

Figure 2: The graphical representation of the solution (8) for

Figure 3: The graphical representation of the solution (8) for

Figure 4: The graphical representation of the solution (20) for

when α and β take +ve values.

when α is +ve and β is -ve.

when α and β take +ve values.

Page 21

A. K. Chowdhury, American International Journal of Research in Formal, Applied & Natural Sciences, 3(1), June-August, 2013, pp. 18-22

IV. Discussions The general solution given by (20) for corresponds to infinite number of universes with individual properties depending upon the parameters considered in the equations (17-19). This can be visualized as multiverse scenario. The expansion and contraction both are exponential according to equation to (20). Every integer corresponding to can be regarded as quantum numbers of the individual universes. Very interesting point comes when one considers This shows that the universe starts expansion from a finite volume. It is generally believed that the universe starts expansion from the Planck size ( . Hence it is observed that this solution avoids the Big Bang singularity. When the universe remained at its ground state the question might peep that why did the universe start expansion? This point is not so clear; but one can assume that at the ground state the universe possessed highest possible degrees of symmetries which were broken by the violent quantum fluctuation due to Heisenberg’s uncertainty principle. The quantum fluctuation might initiate the Big Bang and the expansion of the universe. The solution (20) does not predict the cause of the Big Bang or expansion, but tells the universes how to expand. Another important aspect of our exact solution is that the solution is independent of the energy considered. Hence it is meaningless to ask the question that from where the universe comes or what happened before Big Bang. Acknowledgements I am grateful to the Government of Bangladesh for providing me research scholarship. I am also indebted to recently late Professor Jamal Nazrul Islam for his sincere encouragements.

References: [1] [2] [3] [4] [5] [6] [7] [8] [9] [10] [11] [12] [13] [14] [15]

B. S. De Witt, Phys. Rev. 160 1113 (1967). C. W. Misner, Phys. Rev. 186 1328 (1969). G. W. Gibbons and S. W. Hawking, Phys. Rev. D15 2752 (1977). G. W. Gibbons, S. W. Hawking and M. J. Perry, Nucl. Phys. B138 141 (1978). J. B. Hartle and S. W. Hawking, Phys. Rev. D28 2960 (1983). A. K. Chowdhury, Jour. of Basic and Appl. Phys. Accepted for publication (2013). J. A. Wheeler in Battelle Rencontres, edited by C. DeWitt and J. A. Wheeler ( Benjamin, New York, 1968). A. Vilenkin, Phys. Rev. D 33 3560 (1986). J. N. Islam, Mathematical Cosmology, Cambridge University Press (2001). E. Alvarez, Rev. Mod. Phys. 61 561 (1989). P. D. D’Eath, Supersymmetric Quantum Cosmology, Cambridge University Press (1996). S. W. Hawking, Nucl. Phys. B239 257 (1984). C. Kiefer, Phys. Rev. D38 1761(1988). W. B. Drees, Int. J. Theor. Phys. 26 939(1987). A. O. Barvinsky, Phys. Lett. B175 401(1986).

Page 22

American International Journal of Research in Formal, Applied & Natural Sciences

Available online at http://www.iasir.net

ISSN (Print): 2328-3777, ISSN (Online): 2328-3785, ISSN (CD-ROM): 2328-3793

AIJRFANS is a refereed, indexed, peer-reviewed, multidisciplinary and open access journal published by International Association of Scientific Innovation and Research (IASIR), USA (An Association Unifying the Sciences, Engineering, and Applied Research)

Synthesis, Characterisation and Antimicrobial studies of complexes of metal ions with 4-{(E)-[1-(1H-benzo[d]imidazol-2-yl)ethylidene]amino}-3methyl-1H-1, 2, 4-triazole-5(4H)-thione and related ligand. *

Madhu Bala1 Kumud Kumari Mishra2 Sanjay Kumar2 L. K. Mishra3 Department of Chemistry, National Institute of Technology, Patna-800005 INDIA 2 Department of Chemistry, H. D. Jain College Ara, Veer Kuwar Singh University, INDIA 3 Department of Chemistry, Patna University, Patna-800005 INDIA 1

Abstract: The complexes of Mn(II), Fe(II), Fe(III), Co(II), Ni(II), Cu(II), Zn(II), Cd(II) and Pd(II) with 4{(E)-[1-(1H-benzo[d]imidazol-2-yl)ethylidene]amino}-3-methyl-1H-1,2, 4-triazole-5(4H)-thione (Hbzeamt) and with 4-{(E)-[1-(1H-benzo[d]imidazol-2-yl)phenylmethyleneamino)-3-methyl-1H-1, 2, 4-triazole-5(4H)thione (Hbzpamt) of composition [ML2] (M= MnII, CoII, NiII, CuII, ZnII and CdII, HL= Hbzeamt or Hbzpamt), PdLX (L= Hbzeamt or Hbzpamt and X= Cl or Br) and [M(LH)Cl2] (M= CoII, NiII, or CuII). The magnetic moment value of complexes [ML2] of MnII, NiII and CuII occurs in the range of high spin octahedral environment of ligand molecules while Co II complexes show anomalous magnetic moment value. Iron (III) complexes FeL2Cl show magnetic moment value similar to high spin octahedral Fe(III) complexes. The dichloro complexes of Co(II), Ni(II) and Cu(II) are high spin type. The ir spectra of ligands show that molecule exist in thione form in solid state and coordinates as tridentate (N, N, S) donor molecule. The 1HNMR spectra of ligand in DMSO were recorded to elucidate the structure of ligand molecules. The antibacterial and antifungal activity of ligands and some of its complexes shows encouraging results. Key words: Synthesis, Antimicrobial activity, Metal complexes of triazole derivative of benzimidazole. I. INTRODUCTION Benzimidazole and triazole ring containing heterocyclic molecules possess wide range of antibacterialactivity and antifungal properties [1-5]. Benzimidazoles and triazoles have broad range of antimicrobial spectrum and have privileged nuclei to display medicinal activity [6], [7] and have strong complex forming ability [8-13]. The benzimidazole derivatives and their complexes have interesting catalytic property and industrial utility [13-16]. Complexing properties of benzimidazole and triazole derivatives have been widely investigated by various workers and in our laboratory [13-20]. The substancial, industrial and catalytic importance of benzimidazole derivatives and their applications in wide variety of pharmacological activity in controlling cardiovascular diseases [21], antitumor [22] antihelminitic [23] anticancer [24] antiulcer [25] antidiabetic [26] anti-inflammatory [27] antifungal [28] anti-HIV [29] antibacterial [30] antiamoebic [31] and antioxidant [31] substance.In view of growing interest on benzimidazole and triazole derivatives and their metal complexes. We have continued our studies in synthesis, characterisation and antimicrobial properties of metal complexes of benzimidazole and triazole derivatives [17-20]. In present investigation we report the preparation, characterisation and antimicrobial studies of Mn(II), Fe(II), Co(II), Ni(II), Cu(II), Zn(II), Cd(II) and Pd(II) complexes of4-{(E)-[1-(1H-benzo[d]imidazol-2yl)ethylidene]amino}-3-methyl-1H-1, 2, 4-triazole-5(4H)-thione (Hbzeamt) and with 4-{(E)-[1-(1Hbenzo[d]imidazol-2-yl)phenylmethyleneamino)-3-methyl-1H-1, 2, 4-triazole-5(4H)-thione (Hbzpamt). II. EXPERIMENTAL The organic compounds and solvents were obtained from BDH or E.Merck. Orthophenylenediamine was purified by distillation under reduced pressure before use. Starting material for preparation of ligand was prepared by reported method [31]. Metal salts used were B.D.H Anal-R grade or E. Merck extra pure chemicals. Palladium (II) chloride was obtained from Johnson Methey London. The ligand 4-{(E)-[1-(1H-benzo[d]imidazol-2-yl)ethylidene]amino}-3-methyl-1H-1, 2, 4-triazole-5(4H)-thione (Hbzeamt) and with 4-{(E)-[1-(1H-benzo[d]imidazol-2-yl)phenylmethyleneamino)-3-methyl-1H-1,2,4-triazole5(4H)-thione(Hbzpamt) were prepared by condensing (1H-benzimidazol-2-yl)ethanone (BZE) or (1Hbenzimidazol-2-yl)phenone(BZP) with 4-amino-5-methyl-3-mercapto-1,2,4-triazole(AMT).

Page 23

Madhu Bala et al., American International Journal of Research in Formal, Applied & Natural Sciences, 3(1), June-August, 2013, pp. 23-29

About 0.1 mole of BZE or BZP was dissolved in 150 ml ethanol and 2ml acetic acid and refluxed with 0.1 mole of 4-amino-3-methyl-1H-1, 2, 4-triazole-5(4H)-thione (AMT) on steam bath for three to four hours when light yellow crystalline product separated gradually. The products were collected on filter and filterate on evaporation and cooling gave light yellow product. The combined products were re-crystallised with tetrahydrofuran(THF)ethanol mixture. Yield 90-92%. The analytical results of Hbzpamt, found C- 61.16% H- 4.21% N-25.01 % and S- 9.38%. Required for Hbzpamt C-61.08%, H-4.18%, N-25.14% and S-9.58%. Found for the Hbzeamt C52.75% H-4.48% N-30.68% and S-11.56%, required for Hbzpamt (C17H14N6S) C-52.94% H-4.41% N-30.88% and S-11.76%. Preparation of complexes: [ML2], (M= MnII, CoII, NiII, CuII, ZnII or CdII and HL= Hbzeamt or Hbzpamt) About 20 millimole of ligand Hbzeamt or Hbzpamt was dissolved in 40-50 ml of hot ethanol-tetrahydrofuran mixture and added 10 millimole of aqueous ethanolic (20 ml) solution of metal acetate or metal nitrate with stirring. The resulting solution was added to 5-10 ml aqueous solution of sodium acetate and heated on steam bath for half an hour when bis ligated complexes separated gradually. The mixed solution was added 100 ml of water and complex separated was digested on steam bath for 20 minutes and products were collected on filter. The products were washed with hot water, aqueous ethanol and dried in a desiccators over CaCl2 in vaccum (yield 95-96%). Preparation of FeL2Cl: (HL= Hbzeamt or Hbzpamt) About 20 millimole of ligand (Hbzeamt or Hbzpamt) was dissolved in 40 ml ethanol- THF mixture and treated with aqueous ethanol solution of FeCl3 and resulting mixture was digested on steam bath by adding 50 ml water. The dark brown precipitate separated was collected on a filter, washed with water and dried over CaCl 2 (Yield 90-92%). Preparation of PdLCl: (HL= PdLCl) The complex was prepared as above by taken aqueous ethanol solution of PdCl 2 containing a few drop dilute HCl. The orange yellow product separated was digested on steam bath and collected on a filter. The products were washed with hot water a few drop of aqueous ethanol and dried over CaCl2 (yield 96-97%). Preparation of [M(HL)Cl2], (M= CoII, NiII or CuII and HL= Hbzeamt or Hbzpamt) About 10 millimole of ligand was dissolved in 20 ml hot dry THF and added slowly with stirring to hot methanolic solution of appropriate metal Chloride. The mixed solutions were treated on steam bath for one hours and evaporated to half of its bulk and cooled at room temperature when dichloro complexes gradually. The products were collected on a filtered washed with cold methanol and dried over CaCl 2 in vaccum (Yield 8085%). The purity of samples was checked by TLC. The dried complexes were analysed of metal, carbon, hydrogen, nitrogen and sulphur and results of elemental analysis of complexes are given in Table-I. The colour and magnetic moment values of complexes after making diamagnetic correction are given in Table-I. The results of antifungal and antibacterial activity of ligand and their metal complexes are given in Table-II. Table-I: Analytical results and Physical data of complexes Compound

Colour Metal

[MnA2] [FeA2]Cl [CoA2] [NiA2] [CuA2] [ZnA2] [CdA2] [Ni(HA)Cl2] [Co(HA)Cl2] [Cu(HA)Cl2] [PdACl] [MnB2] [FeB2Cl] [CoB2] [NiB2] [CuB2]

Cream Brown Dark brown Yellowish brown Ash Yellow Orange yellow Greenish yellow Buff Grey Orange yellow Cream Dark brown Reddish brown Yellowish brown Ash

9.28(9.20) 8.61(8.84) 9.63(9.80) 9.56(9.77) 10.61(10.49) 10.63(10.76) 17.01(17.17) 14.47(14.60) 14.38(14.60) 15.41(15.63) 25.61(25.73) 7.73(7.61) 7.41(7.39) 8.31(8.12) 8.19(8.09) 8.63(8.78)

Elemental analysis Found (Calc). Carbon Hydrogen 48.01(48.24) 45.16(45.46) 47.63(47.92) 47.71(47.94) 47.32(47.57) 47.31(47.41) 43.81(44.01) 35.43(35.84) 35.61(35.83) 35.31(35.45) 34.82(34.82) 56.71(56.67) 53.63(53.86) 56.18(56.28) 56.19(56.29) 55.71(55.92)

3.89(3.68) 3.72(3.47) 3.79(3.66) 3.86(3.66) 3.51(3.63) 3.67(3.62) 3.18(3.36) 3.01(2.98) 3.21(2.98) 3.11(2.95) 2.81(2.66) 3.73(3.60) 3.49(3.43) 3.68(3.58) 3.66(3.58) 3.41(3.56)

Nitrogen

Sulphur

28.41(28.14) 26.40(26.52) 27.71(27.95) 27.67(27.96) 27.47(27.74) 27.43(27.65) 25.47(25.67) 20.73(20.91) 20.62(20.90) 20.41(20.66) 20.17(20.33) 23.11(23.30) 22.31(22.17) 23.01(23.17) 23.11(23.18) 22.91(23.02)

10.68(10.72) 10.31(10.10) 10.46(10.64) 10.63(10.65) 10.51(10.57) 10.62(10.53) 9.81(9.10) 7.63(7.96) 7.72(7.96) 7.91(7.87) 7.61(7.74) 8.59(8.87) 8.31(8.44) 8.69(8.82) 8.71(8.83) 8.67(8.77)

Magnetic moment (B.M) 5.91 5.86 3.26 3.21 1.86 Dia Dia 3.42 4.68 1.89 Dia 5.92 5.84 3.68 3.32 1.89

Page 24

Madhu Bala et al., American International Journal of Research in Formal, Applied & Natural Sciences, 3(1), June-August, 2013, pp. 23-29

[ZnB2] [CdB2] [PdBCl] [Co(HB)Cl2] [Ni(HB)Cl2] Cu(HB)Cl2]

Orange yellow Orange yellow Reddish brown Buff Greenish yellow Grey

8.91(8.94) 14.61(14.44) 22.31(22.40) 12.61(12.70) 12.78(12.65) 13.81(13.56)

55.69(55.81) 52.28(52.41) 42.71(42.95) 43.37(43.47) 43.26(43.46) 43.17(43.39)

3.71(3.55) 3.46(3.34) 2.91(2.73) 3.01(2.98) 3.13(3.02) 3.21(3.01)

22.79(22.96) 21.41(21.58) 17.38(17.68) 17.72(17.92) 18.01(18.11) 17.91(18.11)

8.61(8.75) 8.01(8.22) 6.63(6.73) 6.71(6.82) 6.81(6.90) 6.71(6.90)

Dia Dia Dia 4.68 3.42 1.91

HA = Hbzeamt HB = Hbzpamt, Magnetic moment value in BM at 304K. The i.r. spectra of ligand and complexes were recorded as KBr disc in the range 4000-400cm-1 on Shimadzu IR spectrophotometer, FTIR-8400S IIT Patna, HNMR spectra at CDRI Lucknow. The magnetic moment value was determined at room temperature (304-305oK) by Gouy method using Hg [Co(NCS)4] as standard. The electronic absorption spectra of ligand and complexes were recorded in the range of 200-850 nm on Shimadzu, u-v visible spectrophotometer 2500 at IIT Patna. The results of C, H, N and S were obtained from CDRI Lucknow or BIT Mesra Ranchi on Carlo-Erb EA 1108 elemental analyser. III. RESULTS AND DISCUSSION: The ligands Hbzeamt and Hbzpamt (A & B) are interesting tridentate ligand containing benzimidazole and mercapto-4-amino-triazole ring for coordinate bond formation.

These ligands readily form complexes with metal ions as monoanionic coordinating molecule forming bis chelates in neutral medium with MnII, FeII CoII, NiII, CuII, ZnII and CdII of composition [ML2], (HL= Hbzeamt or Hbzpamt) and [FeL2]Cl. In neutral and even acidic medium Pd(II) form mono ligated complex [PdLX], (HL= Hbzeamt or Hbzpamt and X= Cl or Br). In dry methanol Co(II), Ni(II) and Cu(II) chloride form dichloro complexes [M(HL)Cl2], (HL= Hbzeamt or Hbzpamt). The bis chelates [ML2], (M= MnII, CoII, NiII, CuII, ZnII or CdII and HL= Hbzeamt or Hbzpamt) are almost insoluble in aqueous medium but slightly dissolve in ethanol, acetone and dioxane but dissolve appreciably in DMF and DMSO. The DMF solutions of complexes [ML2], [M(HL)Cl2], (M= CoII, NiII or CuII and HL= Hbzeamt or Hbzpamt) are almost non-conducting (ʎα= 8-12 ohm1 mol-1 cm2). The negligible electrical conductance value of complexes indicated their non ionic nature and chloride ions of complexes [M(HL)Cl 2] are coordinated to metal atom [32]. The iron (III) complex [FeL2]Cl (HL= Hbzeamt or Hbzpamt) show molar electrical conductance value 56 ohm-1 mol-1 cm2 in DMF supporting ionic nature of chloride ion [32]. The Cd(II), Zn(II) and Pd(II) complexes are diamagnetic and Cu(II) complexes show room temperature magnetic moment value between 1.82-1.92BM indicating magnetically dilute nature of complexes [22]. The Ni(II) complexes display magnetic moment values between 3.23-3.32BM similar to octahedral, tetrahedral or five coordinated trigonal bipyramidal structure [23-24]. Manganese (II) complexes [ML2], (HL= Hbzeamt or Hbzpamt) and [FeL2]Cl show magnetic moment value between 5.88-5.92BM similar to high spin octahedral complexes [24-25]. The room temperature magnetic moment values of Co(II) complexes [CoL2], (HL= Hbzeamt or Hbzpamt) show magnetic moment value (3.26-3.63BM) which is anomalous. The magnetic moment of dichloro complexes [Co(LH)Cl2], (HL= Hbzeamt or Hbzpamt) were found to be 4.46 and 4.51BM which occurs in tetrahedral or five coordinated octahedral complexes. Considering stoichiometry of ligand and coordinated chloride ion in five coordinated trigonal bipyramidal structure is suggested for [M(HL)Cl2], (M= CuII, NiII or CoII and HL= Hbzeamt or Hbzpamt). The i.r. spectra of ligands and their complexes show NH stretches of imidazole ring at 3290-3340 cm-1. The triazole ring NH stretch of Hbzeamt is assigned to medium band at 3192 cm-1 which is absent in bis ligated complexes M(bzeamt)2. The NH stretches of Hbzpamt were assigned to medium band at 3265-3310 cm-1 and 3162 cm-1. The later band was absent in its complexes M(bzpamt) 2, (M= MnII, CoII, FeII, NiII, CuII, ZnII and CdII). The aldimine (C=N-N) stretches of Hbzeamt and Hbzpamt were observed at 1628 and 1632 cm-1 and these are shifted to lower frequency by 15-20 cm-1 suggesting bonding of aldimine (C=N) nitrogen to metal atom. The imidazole ring ν(C=N) stretch was observed at 1605 & 1612 cm-1) which was observed at 1595±5 cm-1 in complexes suggesting coordination of imidazole ring tertiary nitrogen to metal atom in almost all complexes. The ν(C=S) of ligand Hbzeamt was assigned to a medium band at 968 cm-1 and that of Hbzpamt at 982 cm-1 and these bands were shifted to lower frequency in complexes [M(HL)Cl 2], (M= CuII, NiII or CoII and HL= Hbzeamt or Hbzpamt) by 30-35 cm-1 soggesting coordination of thione (C=S) sulphur to metal atom. In bis ligated neutral complexes [ML2], (M= MnII, FeII, CoII, NiII, ZnII or CdII and HL= Hbzeamt or Hbzpamt) the (C=S) stretches were observed near 720-740 cm-1 suggesting coordination of deprotonated thiol sulphur with metal atom. Thus the ligands are bonded to metal atom in all complexes either as neutral or monoanionic tridentate N, N, S donor molecule [35].

Page 25

Madhu Bala et al., American International Journal of Research in Formal, Applied & Natural Sciences, 3(1), June-August, 2013, pp. 23-29

The electronic absorption spectrum of Hbzeamt shows strong absorptions at 212 and 262 nm and weak band at 324 nm attributed to σσ*, ππ* and nπ* transitions. The transitions are located at 218, 258 and 332 cm-1 for Hbzpamt. The cobalt(II) complex [Co(bzeamt) 2] displays medium to weak transitions at 430 and 560 nm assigned as 4T1g4T1g (P) and 4T1g4A2g transitions in approximately octahedral field. The Ni(II) complex, Ni(bzeamt)2 shows strong absorption below 400 nm assigned as charge transfer transition and ligand ππ* transitions. The electronic absorption bands in ethanol for Cu(II) complex Cu(bzeamt) 2 located at 430-450 and 630-650 nm are assigned to 2B1g2B2g and , 2B1g2A2g and 2Eg transitions as broad band in distorted octahedral field [36]. The electronic absorption band of Ni(bzeamt)2 at 420 nm and 585 nm as medium band assignable as 3 A2g 3T1g (P) and 3A2g 3T1g (F) transitions in octahedral field [36]. The 1HNMR spectra of Hbzeamt shows CH3 proton signal at δ= 2.895 and 3.136 ppm as triplet. The NH proton signal were observed as δ= 5.135 and 5.845 ppm for both imidazole and triazole ring NH signal. The phenyl proton signals of phenyl ring was located at δ= 6.935-7.455 ppm. The Hbzpamt show CH3 proton signal at δ= 3.455 ppm as singlet and NH proton signal at 5.345 and 5.635 ppm. The phenyl ring proton signal was located at δ= 6.945-7.454 ppm. The proton 1HNMR of ligand has confirmed the suggest structure of the ligand. On the basis of U-V, I-R and magnetic susceptibility of complexes, the following structure is suggested for ML2, FeL2, M(HL)Cl2 and [PdLCl]

A. Antibacterial and antifungal activity The antifungal activities of the ligand and its complexes have been evaluated by radial growth method [34,a]. Czapeck agar medium prepared by dissolving 20g starch, 20g agar agar and 20g glucose in one litre distilled water. The resulting medium was added requisite amount of test compound to get 50 and 100 ppm of solutions. The medium was then poured into Petri plates and the spores of fungi were placed on medium with the help of inoculums needle. These Petri plates were wrapped in polythene bags containing two to three drops of ethanol and then placed in an incubator at 30± 0.050c. The linear growth of fungus was evaluated by measuring the fungal colony diameter after five day. The percentage inhibition was calculated from the relation 100 (C-T)/C where C and T are the diameter of the fungus colony and control test plates respectively. The fungi used in present investigation included A. niger, A. flavus and R. phaseoli. The control solution was Mycostatin. The result of activity is shown in Table-II. The results show that antifungal activities of complexes are larger than free ligand. The activity increases with increasing concentration of the substances from 50< 100 ppm. The greater fungal activity may be due to large electron cloud delocalisation which increases lipophilic nature of the central metal atom causing permeation through the lipid layer of cell membrane. The bacterial activity against E. coli, S. aureus and Salmonella typhi were evaluated by inhibition zone techniques [34b]. The nutrient agar medium was presented taking 5g peptone, 5g beef extract, 5g NaCl and agar

Page 26

Madhu Bala et al., American International Journal of Research in Formal, Applied & Natural Sciences, 3(1), June-August, 2013, pp. 23-29

agar 20g in one litre distilled water. The solution was pipeted into Petri plates and added seeded agar with bacteria. The compound was dissolved in DMF having 250 and 500 ppm strength. The disc of Whatman no.1 filter paper soaked with these solutions to 5 mm diameter disc were dried and placed on the medium previously seeded with organism in Petri plates at suitable distance. The Petri plates were stored in an incubator at 30± 10c for twenty four hours. The zone of inhibition was formed around each disc. The zone of inhibition was measured accurately in millimetre. The results are shown in Table-II. It is found that metal complexes show higher activity than free ligand. The activities of the compound were compared with Ciprofloxacin and Amoxocyline.

Table:II- Antimicrobial activity of [M(Hbzeamt)2], [M(Hbzpamt)2] and its complexes, antifungal inhibition after 120 hours while antibacterial inhibition after 24 hours. Fungi A.niger

Conc . 50 100

Hbzeamt (HL) 35 43

Hbzpamt (HL’) 38 46

NiL2

CuL2

CoL2

ZnL2

NiL’2

CuL’2

CoL’2

48 57

51 65

46 61

40 50

49 59

59 71

62 73

ZnL’2

Ref.

72 93

51 A.flavus

50 100

42 64

52 70

47 61

58 70

60 74

42 53

48 62

R.Phaseol i

50 100

40 50

45 57

42 55

46 63

55 71

42 56

43 56

Bacteria E. Coli

250 500

11 15

12 16

10 14

13 16

12 17

11 14

S.aureus

250 500

13 15

15 16

12 15

12 16

13 15

250 500

11 14

13 17

11 13

13 17

13 16

70 91

S. typhi

47 64

12 15

14 17

12 16

13 15

10 14

11 15

16 12 14

12 15

14 18

14 17

71 86

1 2 3 5

2 3

A= 23, B= 25, A= Ciprofloxacin, B= Amoxocyline IV. Conclusion The ligand Hbzeamt and Hbzpamt both coordinate as neutral or monoanionic tridentate N, N, S, donor molecules. The antifungal and antibacterial activity of Cu(II) and Co(II) complexes were higher than free ligandss and other metal complexes. Acknowledgement Thanks are due to authority of IIT Patna for recording IR, U-V and Mass spectra, CDRI Lucknow for 1HNMR spectra and BIT Mesra for C, H or N analysis. The Head of the Chemistry department, Patna for magnetic susceptibility measurements. The authority of NIT Patna is thankful for providing necessary laboratory facilities. References [1]

[2] [3] [4] [5] [6] [7]

(a) Y. Ozkay , Y. Tunali, H. Karaca, I. Isikdag, “ Antimicrobial activity and a SAR study of some novel benzimidazole derivatives bearing hydrazone moiety” European Journal of Medicinal Chemistry, vol. 45 (8), 2010, pp. 3293. (b) D. Pandey, R. Shabh, et al. “Synthesis Characterisation and Pharmacological screening of novel benzimidazole derivatives” Arabian Journal of Chemistry, vol.4, 2011, pp.13. (c) Y. F. Li, G. F. Wang, P. L. He, W. G. Huang, F. H. Gao, W. Tang, et al “Synthesis and antihepatitis B virus activity of novel benzimidazole derivatives” J. Med. Chem, vol. 49, 2006, pp. 4770-4794. (d) S. O. Podunavac-Kuzmanovic, D. M. Cvetkovic, “Antibacterial Evaluation of some benzimidazole derivatives and their Zn (II) complex” J. Serb. Chem. Soc., vol. 72(5), 2007, pp. 459-466. R. Walia, Md. Hedaitullah, Syeda Farha Naaz, Khalid. Iqbal, H. S. Lamba “A newer benzimidazole derivatives; an overview” International Journal of Research in Pharmacy and Chemistry, vol. 1(3), 2011, pp. 565. Luo.Yu, Yao. Jia-Ping, Yang. Li, Feng. Chun-Lan, Tang. Wei,Wang. Gui-Feng, Zuo. Jian-Pin, Lu.Wei, “Synthesis and Antiheptitis B virus activity of Novel class of thiozolylbenzimidazole derivatives” Arch Pharm Chem. Life Sci, vol.2, 2011, 2 pp. 78-83. S. S.Kadam, K. R. Mahadik, K. G. Bolhara, “Principles of Medicinal Chemistry. Edition 13, 2005, pp. 233. K. F.Ansari, C. Lal, “Synthesis, Physicochemical properties and Antimicrobial activity of some new benzimidazole derivative” European Journal of Medicinal Chemistry, vol. 44, 2009, pp. 2294. H. Kucukbay, U. Yilmaz, N. Sireci, A. N. Onganer “Synthesis and Antimicrobial activities of some bridged bis(benzimidazole) derivatives” Turk J. Chem. vol. 35, 2011, pp. 561-571. Y. L. Nerie, P. N. Thapual, “ Fungicides in plant disease control. Oxford and IBH Publishing Co, New Delhi, 1993.

Page 27

Madhu Bala et al., American International Journal of Research in Formal, Applied & Natural Sciences, 3(1), June-August, 2013, pp. 23-29

[8]

[9] [10] [11] [12] [13] [14]

[15]

[16]

[17] [18]

[19]

[20]

[21] [22] [23] [24]

(a) R. Pandey, Daya. S. Pandey, “Reactions and structural studies of 4-(1H-benzimidazol-2-yl)-benzonitrile with metal nitrates” J. Indian Chem. Soc, vol. 89, 2012, pp. 1123-1134. (b) P. Payra, H. Zhang, W. H. Kwok, M. Duan, J. Gallucci, M. K. Chan,”Structural Trends in First Row Transition Metal Bis (benzimidazole) complexes” Inorg Chem, vol. 39, 2000, pp. 1076-1080. N. Saha, A. Misra, “Synthesis, Characterisation and a coordinating properties of a new benzimidazolylpyrazole: Cobalt(II), Nickel(II) and Copper(II) complexes of 5-methyl-3-(2-benzimidazolyl)pyrazole” J. Indian Chem. Soc., vol. 70, 1993, pp. 1035. A. K. Tripathi, Pavan. Mathur, “ A Binuclear Iron (III) complexes of N, N, N’ N’ Tetrakis(2- benzimidazolyl)1,2- Ethanediamine” J. Indian Chem. Soc. vol. 70, 1993, pp. 991. M. S. Elder, G. A. Melson, D. H. Bush, “The synthesis of O-benzylene-2,1-benzimidazole in the presence of Nickel(II) ions and a study of some of its Metal complexes” Inorg Chem. vol. 5(1),1966, pp. 74-77. Qin-De. Liu, Wen-Li. Jia, Wang. suning, “Blue Luminescent 2-(2’-Pyridyl)benzimidazole Derivative Ligands and their Orange Luminescent Mononuclear and Polynuclear Organoplatinum(II) complexes” Inorg Chem. vol. 44, 2005, pp. 1332-1343. M.R. Maurya, A. Kumar, E. Martin, D. Rehder, “Synthesis, Characterisation, Reactivity and Catalytic Potential of Model Vanadium (IV, V) complexes with benzimidazole-Derived O,N,N Donor Ligands” Inorg Chem. vol. 45, 2006, pp. 5924-5937. Yan-Ling. Zhou, Fa-Yan. Meng, Ming-Hun. Zhang Jian Zeng, Hong. Liang, “Mononuclear, Tetra, Penta-3d Molecular cluster Based on the variability of SS-1, 2-bis(1H-benzimidazol-2-yl)-1,2-ethanediol ligand arising from Hydroponic and Hydrothermal conditions structure, Crystal growth and Magnetic properties” Crystal Growth & Design, vol. 9(3) 2009, pp. 1402-1410. (a) D. Saha, S. Das, Maity. Dutta, S. Dutta, S. Baitalik “Synthesis, Structural, Characterisation and Phytophysical Electrochemical, Intercomponent Energy- Transfer and Anion- sensing studies of imidazole 4,5-bis(benzimidazole)-Bridged OsII Os II and RuII and OsII Bipyridine complexes” Inorganic Chemistry, vol.50, 2011, pp. 46-61. (b)M. Serratrice, M. A. Cinellu, L. Maiore, P. Maria, Z. Antonio, C. Gabbiani, A. Guerri, L. Ida, N. Stefania, E. Mini, L. Messori, “Synthesis, Ctructural Characterisation, solution Behaviour and invitro Antiproliferative properties of a series of Gold complexes with 2-(2’-Pyridyl)benzimidazole as Ligand: complexes of Gold(III) versus Gold(I) and Mononuclear versus Binuclear Derivatives” Inorg Chem.vol. 51, 2012, pp. 3161-3171. (a) G. A. Molander, K. Ajayl, “Oxidative condensation to form benzimidazole-substituted Potassium Organotrifluoroborates” Organic Letters vol. 14(16), 2012, pp. 4242-4255. (b) K. F. Kneubuhl, “Line Shapes of Electron Paramagnetic Resonance Signals produced by Powders, Glasses and viscous Liquids” J. Chem. Phys, vol.33, 1960, pp. 1074. P. N. Preston, “Synthesis, Molecular structure Determination and Antitumour Activity of Pt(II) and Pd(II) complexes of 2Substituted benzimidazole” Chem. Rev vol. 74,1974, pp. 279. (a) S. P. Ghosh, L. K. Mishra, “ Complexes of Iron (II &III) with 2-(2’-Pyridyl)-benzimidazole” Inorg. Chim. Acta, vol. 7, 1973, pp. 545-549. (b)C. K. Choudhary, R. K. Choudhary, L. K. Mishra, “Complexes of Rhodium (III), Palladium (II) and Platinum(II) with 2-(2’Pyridyl)benzimidazole” J. Indian Chem. Soc, vol.79, 2002, pp. 761-762. (c) S. P. Ghosh, P. Bhattacharjee, L. K. Mishra, “Complexes of Rh(III) and Pd(II) with 2-(2’-Pyridyl)benzimidazole” J. Indian Chem. Soc, vol. 51,1974, pp. 308. (d) S. P. Ghosh, P. Bhattacharjee, L. Dubey, L. K. Mishra, “Complexes of some Platinum metals with imidazole and benzimidazole” J. Indian Chem. Soc, vol. 52, 1975, pp. 230-235 (e) S. P. Ghosh, L. K. Mishra, “Palladium (II) complexes with benzimidazole and 2-methylbenzimidazole” J. Indian Chem. Soc, vol.47, 1970, pp. 1163-1172. (f) S. P. Ghosh, A. K. Sinha, C. P. Singh, L. K. Mishra, “Oxomolybdenum(V) complexes with 2-(2’-Pyridyl)benzimidazole” J. Indian Chem. Soc, vol.63, 1986, pp. 607-608. (g) A. K. Sinha, Urmilla. Kumari, C. P. Singh, L. K. Mishra, “Oxovanadium (IV) complexes with imidazole, benzimidazole and substituted benzimidazoles” J. Indian Chem. Soc, vol. 67, 1990, pp. 985-986. (h) L.K.Mishra, S.K.Gupta, “Oxovanadium (IV) complexes with 2-(o-Hydroxyphenyl)benzimidazole and imidazoline” J. Inorg Nucl Chem, vol. 41, 1979, pp. 980-891. (i) L.K.Mishra, S. K. Gupta, “Complexes of Copper (II) with 2-(o-Hydroxyphenyl)benzimidazole and related ligands” J. Indian Chem. Soc, vol.56, 1979, pp. 206-208. (j) L. K. Mishra “Complexes of 5-Nitrobenzimidazole with some Metal ions” J. Indian Chem. Soc, vol. 59, 1982, pp. 795. (k) S. P.Ghosh, L.K. Mishra, “Complexes of Zn(II), Cd(II) and Hg(II) with Benzimidazole and 2-methylbenzimidazole” J. Indian Chem. Soc, vol.60, 1983, pp. 212-214 (l) L. K. Mishra, M.M. Jha, B. K. Jha, “Stable complexes of Oxochromium(V)” J. Indian Chem Soc vol. 66, 1989, pp. 818-819. (m) L. K. Mishra, K. K. AnilRoy, “Complexes of Rh(III) and Pd(II) with N-Vinylimidazole” J. Indian Chem. Soc, vol.64, 1987, pp. 503-505. (a) M. Bala, K. Ahmad, S. R. Sharma, L.K. Mishra, “Synthesis Characterisation and Derivatographic studies of 1-(1H-benzimidazol2-yl)ethanone and 1-(1H-benzimidazol-2-yl)phenone with Co(II), Ni(II) and Cu(II)” IOSR-Journal of Applied Chemistry, vol. 3(1), 2012, pp. 46-52. (b) M. Bala, K. Ahmad, S. R. Sharma, L.K. Mishra, “Preparation, Characterisation and Anti-fungal activity of 1E-1-(1Hbenzimidazol-2-yl)-N-hydroxyethanimine and 1E-1-(1H-benzimidazol-2-yl)-N-hydroxy-1-phenylmethanimine with Co(II), Ni(II), Cu(II), Zn(II) and Cd(II)” IOSR-Journal of Applied Chemistry, vol. 3(2), 2012, pp. 21-29. (c) M. Bala, L.K. Mishra, “Synthesis, Characterisation and Anti-amoebic activity of 1E-1-(1H-benzimidazol-2-yl)-Nhydroxyethanimine and 1E-1-(1H-benzimidazol-2-yl)-N-hydroxy-1-phenylmethanimine with Oxovanadium (IV), Mn(II), Fe(II)” IJETCAS vol. 4(4), 2013, pp. 347-353. (a) A.K. Tripathi,K.K. Sharma, P. Mathur, “Monomeric and Dimeric Mn(II) complexes of N,N,N’,N’, tetrakis(2benzimidazolyl)methyl-1,1,2’-ethylenediamine and its derivatives” Indian J. Chem. Sect A, vol.68, 1991, pp. 519-525. (b) S.Tehlan, M.S.Hundal, P.Mathur, “Copper(II) complexes of N-Octalated Bis(benzimidazole)diamide Ligand and their PeroxideDependent oxidation of Aryl Alcohols” Inorg Chem, vol. 43, 2004, pp. 6589-6595. V. K. Pandey, N. Trivedi, Mukesh “ Synthesis and biological activity of 1, 2- disubstituted benzimidazoles” Indian J. Heterocycl Chem. vol. 16, 2006, pp. 183-6 A. Anderani, M. Granaiola, A. Leoni, A. Locatelli, R. Morigi, M. Rambaldi “ Synthesis and antitubercular activity of [2,1-b] thiazoles” Eur. J. Med. Chem. vol-36, 2001, pp.743-746. S. Pattan, M. Maste, J. Angadi, “ Synthesis and Microbiological evaluation of some new methyl-2-alkyl/arylthio-thiazole acetates for their antimicrobial activity” Ind. Drugs. vol-31, 1994, pp.429-432 H. H. Refaat “ Synthesis and antiulcer activity of some novel 2-substituted benzimidazole derivatives” J. Eur. Chem. vol- 45, 2010, pp. 2949-56.

Page 28

Madhu Bala et al., American International Journal of Research in Formal, Applied & Natural Sciences, 3(1), June-August, 2013, pp. 23-29

[25] S. Pattan, S. Ali, J. Pattan, S. Purohit, V. Reddy, B. Nataraj, “ Synthesis and microbiological evaluation of 2-acetanilido-4arylthiazole derivatives” Ind. J. Chem. vol-45B, 2006, pp. 1929-1932 [26] T. Usharani, M. S. Rao, V. M. Reddy, “ Biologically active fused heterocycles from naturally occurring quinines-part-II: synthesis of 3-substituted-9-hydroxy-10-undecyl benzo [2,3,4,5] thiazolo [2,3-b] benzimidazoles-8,11-diones and their anti-microbial activity” Indian J Heterocycl Chem. vol-6, 1997, pp. 259-62. [27] P. Sharma, S. Sawhney, A. Gupta, G. Singh, S. Rani, “ Synthesis and anti-inflammatory activity of some 3-(2-thiazolyl)-2benzisothiazoles” Ind. J. Chem. vol-7B, 1998, pp. 376-381 [28] P. Beuchet, M. Lembege, A. Neven, J. Lerger, J. Vercautem, S. Larrouture, “ 2-Sulphoamidothiazoles substituted at C-4: Synthesis of polyoxygenated aryl derivatives and in vitro evaluation of antifungal activity” Eur. J. Med. Chem. vol-34, 1999, pp. 773-779 [29] J. N. I Zhi, P. Barsanti, N. Brammeier, A. Diebes, D. J. Poon, N. G. Simon, “ 4-(Aminoalkylamino)-3- benzimidazole quinolinones as potent CHK-1 inhibitors” Bioorg. Med. Chem Lett. vol-16, 2006, pp. 3121-4. [30] D. Panhekar, B. Ghiya, “Synthesis of 2, 4- substituted thiazoles and their antimicrobial activity” Ind. J. Heter. Chem. vol-5, 1995, pp. 159-160 [31] D. A. Willam, T. Lemke, “Principle of medicinal Chemistry 5 th edn, B. I. Waverly Pvt Ltd. New Delhi, pp. 543-545. [32] W. J. Geary “ The use of Conductivity Measurements in Organic Solvent for the Characterisation of Coordination Compounds” Coord. Chem. Rev.vol-7, 1971, pp. 81-122. [33] K. Ramaiah, J. S. Grossert, D. L. Hooper, P.K. Dubey, J. Ramanatham, “Studies on synthesis of 2-acetylbenzimidazole and related benzimidazole derivatives” J. Indian Chem. Soc, vol. 76, 1999, pp. 140-144. [34] (a) M. D. Whitehead Phytopath, 1952, pp. 550 (b) R. K. Dubey, A. Mariya, J. Indian Chem. Soc, vol. 89, 2012, pp. 51. [35] (a) A. K. Das, M. Nath Z. Zulkerman : Complexes with Tridentate Ligands: Dimethyl(IV) complexes with N-Salicylidene derivatives of Aroylhydrazines, 5-Methyl hydrazine Carbothioate and 4-substituted thiosemicarbazides. Inorg Chim. Acta, vol. 21, 1983, pp. 49. (b) K. Nakamotto :The Infrared and Raman Spectra of Inorganic and Coordination Compounds Wiley, New York, 1978. [36] A B P Lever: Inorganic Electronics Spectroscopy Elsevier Amsterdam, 1968, pp. 357.

Page 29

American International Journal of Research in Formal, Applied & Natural Sciences

Available online at http://www.iasir.net

POPULATION STRUCTURE OFPenaeus monodon FROM COASTALWEST BENGAL USING RAPD FINGERPRINTING N. R. Chatterjee, P. Chatterjee & S. (Dutta) Roy Deptt. Of Aquaculture, Faculty of Fishery Sciences, West Bengal University of Animal and Fishery Sciences, Kolkata-94, West Bengal, India Abstract: Random amplified polymorphic DNA (RAPD) analysis was used to amplify the genome of giant tiger prawn (Penaeus monodon) to detect DNA markers and investigate genetic variation in wild black tiger prawn from coastal West Bengal in India. A total of 80 ten-base primers were screened, and 20 primers yielded amplification products. Three positive primers were selected to analyze three geographically different samples of coastal Penaeus monodon from West Bengal. A total of 40 reproducible RAPD fragments ranging in size from 100 to 1000 bp were scored and 20 fragments (50%) were found to be polymorphic. The RAPD analysis of juveniles from three different locales, Digha coast, North 24 Parganas, South 24 Parganas, revealed different levels of genetic variability among the samples. The percentages of polymorphic bands in North 24 Parganas and South 24 Parganas, suggested a high genetic variability among the samples. Digha coast indicated lower polymorphic levels among three samples. Population specificity was also found within the three samples. I. INTRODUCTION The fishery and genetic resources of India are enormously rich and diverse (Jhingram, 1984). Almost all these fishery resources are being exploited and managed under the traditional concept that each fishery is supported by wild populations having homogeneous characteristics. A typical example is the commercially valuable penaied prawn, Penaeus monodon Fabricius, 1798 – popularly known as the jumbo tiger prawn of Indian waters. Sea fishes and shell fishes like the penaied prawn, P. monodon are a major source of protein food for human consumption. Hence, from time immemorial, these fisheries resources have been subjected to worldwide commercial exploitation. Uncontrolled commercial exploitation of a resource may lead to its over exploitation or even its total loss as a fishery. To prevent over exploitation of some of these valuable sea fishery resources, many maritime nations have been forced to introduce fishing regulatory measures. Such restrictive management measures are essential not only for renewing the commercially over exploited fishery resources throughout its range of distribution but also for protection and conservation of a species or its populations with unique biological and genetic resource characteristics (Utter, 1981). One of the management strategies, thus developed for the scientific management of these resources, was to identify the natural units of the fishery resources under exploitation (Altukhov, 1981). These natural units of a species can otherwise be called as „stocks‟. A stock can be defined as “a parameter population of related individuals within a single species that is genetically distinct from other such populations” (Shaklee et. al., 1990). The populations of P. monodon which were exploited along the Indian coast were from Karwar, Mangalore, Calicut, Kochi in the west coast as well as from Chennai and Kakinada from the east coast. The species P. monodon selected for the present investigation ranks foremost in regard to its importance in aquaculture in India and overseas. Along coastal West Bengal P. monodon is caught from the districts of North 24 Parganas, South 24 Parganas and East Midnapore. According to a WBSMB in 2006-2007, West Bengal contributes a total of 63440 tonnes of prawn in which North 24 Parganas contributes 40516 tonnes, South 24 Parganas contribute 9900 tonnes, and East Midnapore contributes 12871 tonnes. Besides these three districts very little is contributed by Malda (5 tonnes), Murshidabad (10 tonnes), Nadia (20 tonnes), Hooghly (60 tonnes) and Howrah (58 tonnes). The species, P. monodon has a broad geographic distribution in tropical and subtropical waters of South-east Asian countries including east and west coast of South India (Anon, 1969 and Anon, 1978). The species is migratory in habit; the adults migrate out to sea during the breeding season (Kemp, 1915). The species also occurs in the backwaters of the Kerala coast in relatively small quantities. In West Bengal post larvae of this species occurs over a lengthy period of the year, in the tidal reaches of the Hooghly estuary, in lagoons and AIJRFANS 13-209; © 2013, AIJRFANS All Rights Reserved

Page 30

N. R. Chatterjee et al., American International Journal of Research in Formal, Applied & Natural Sciences, 3(1), June-August, 2013, pp. 3036

tidal creeks. The juveniles occur during June to September in Sunderban areas of West Bengal. The bigger catches are made all year round from Digha mohona mostly intensifying the catch during December to March. The bheris of North 24 Parganas culture wild seeds particularly between a period of November to February and from March to July. II. MATERIALS AND METHODS Penaeus monodon, also known as black tiger prawn, were collected from eight different locations of coastal West Bengal including the districts of East Midnapore, North 24 parganas, and South 24 Parganas. The places are Digha Mohona, Kharibari, Hasnabad, Bashirhat, Bhangar, Canning, Haroa, and Diamond Harbour. Forceps and scissors are used to collect muscle, pleopods and periopods from the sample. After collecting the target tissues, they were preserved in 90% alcohol and stored at 40C. While wild samples were collected from Digha Mohona, Hasnabad, Canning, Haroa, others were all cultured samples using sea water. Isolation of DNA Isolation of high molecular weight DNA was carried out from muscle tissues, pleopods and periopods of prawns. DNA was extracted by using phenol: chloroform extraction and ethanol precipitation (Sambrook et al., 1987) Procedure Day 1 1. Firstly approximately 1 g of target tissue sample was cut down With the help of scalpel and forceps and then washed with 70% Ethanol. 2. The target tissue was chopped into small pieces with the help of Scissor and forceps. 3. To it 750 µl of lysis buffer comprising of Tris, EDTA, NaCl and SDS as added with micropipette. 4. Then add 5 µl of proteinase K and tap to mix the contents. 5. The samples were incubated at 37 oC overnight till the target tissue got solubilized. Day 2 Extracted with phenol of equal volume 500 μl (pH adjusted to 7.5 to 8) mixed it gently at least for 50 times. 2. Centrifuge at 10000 rpm for 10 min at 4oC. 3. The supernatant were extracted in a fresh tube. 4. Phenol: Chloform: Isoamyl alcohol was added at equal volume (25:24:1). 5. Mixed it gently. 6. Centrifuge it again in the same manner as earlier. 7. The DNA (supernatant) was extracted in fresh tube. 8. Chloroform: Isoamyl alcohol was added of equal volume. 9. Mixed it gently and again centrifuged. 10. The DNA was extracted in a fresh tube. 11. Chilled ethanol (pure) were added 2.5 times, and then kept in the refrigerator at – 20oC. 1.

Day 3 Precipitation of DNA. 1. The above solutions were mixed properly and centrifuge for 10 min at 4oC. 2. To the aqueous layer 1/10 volume of 3M sodium acetate pH 0.5 were added. 3. Mixed it properly and centrifuged at 400rpm for 10 minutes. 4. The supernatant were decanted very carefully so that the DNA remains in the tube. 5. The precipitated DNA in the tube were added with 500 μl of ethanol (70%) 6. Centrifuged at 4000 rpm in 10 mins. 7. The supernatant were decanted. 8. The DNA is again washed with 500 μl ethanol (70%). 9. Centrifuged again as earlier. 10. The supernatant were decanted. 11. The DNA pellet was dried completely for removal of ethanol. 12. Re suspended the DNA pellet in 50 μl T.E to dissolve fully. 13. The DNA containing solution was incubated at 37oC for 3 hours. 14. The dissolved DNA was kept in the refrigerator at 4oC. For gel electrophoresis and PCR amplification. Quantification of genomic DNA (By U.V spectrophotometer) The purified genomic DNA dissolved in T.E buffer, was taken for quantification by U-V- absorbance at 260 nm.

Page 31

N. R. Chatterjee et al., American International Journal of Research in Formal, Applied & Natural Sciences, 3(1), June-August, 2013, pp. 3036

The O.D at 280nm was also recorded for determining protein contamination O.D 260 X 50 X Dilution factor Conc. In g/ = 1000 Qualitative Analysis by Agarose Gel Electrophoresis Electrophoresis through agarose is the standard method to check the quality of DNA fragments. The technique is simple, rapid to perform and capable of resolving fragments of DNA. Submerge gel electrophoresis unit used for fractionating genomic DNA on agarose gel. Procedure The open end of a clean, dry plastic tray supplied with the electrophoresis apparatus was sealed with tape so as to form a mould. The mold was set on a horizontal section of a bench. 1. Agarose gel was prepared by dissolving appropriate amount of agarose in 1X TBE buffer (0.8 % for genomic DNA and 2 % for PCR products) by heating gently in the heater. 2. A comb with adequate number of wells was placed on the tray to form the wells. 3. 10 μl of EtBr was added in the gel before it polymerize. 4. Pour the gel in the assembly setting with comb. 5. Leave the gel for polymerization, then remove the comb without disturbing the wells and the gel was mounted in the electrophoresis tank. 6. The DNA loading dye was mixed with the DNA sample in 1:6 ratios and loaded in the gel with a micropipette. 7. The electrophoresis gel was run at 92 volts for 4 hours or 100 volts for 3 hours. 8. The photographs of gel were taken by gel documentation system. PCR Amplification The polymerase chain reaction (PCR) is a technique widely used in molecular biology agricultural diagnostic, forensic analysis population genetics. It derives its name from one of its key components. A DNA polymerase used to amplify a piece of DNA polymerase by in-vitro enzymatic replication. The purpose of PCR is to make a large number of copies of short template. It is based on the enzymatic amplification of DNA fragments that are flanked by oligonucleotide primer hybridizing to opposite strands of the target sequence. This process is described in Bielawski et al., (1995) Standardization of the polymerase chain reaction (PCR) Conditions: There are a number of variables in a PCR which have to be optimized to give the target amplification. These parameters are: - Denaturation temperature and time. - Annealing temperature and time. - Amounts of template and primer. - Concentration of Mgcl2 in the assay. - The number of cycles. Primer and their code used for PCR amplification Sl.No. Primer name 1 OPX 1 2 OPX 4 3 OPX17 PCR cycles condition. Step Ι 94 oC for 4 minutes Step ΙΙ 94 oC for 1 minute Step ΙΙΙ 36oC for 1 minute Step ΙV 72oC for 2 minutes Step V 72 for 7 minutes

Primer sequence (5‟-3‟) CTGGGCACGA CCGCTACCGA GACACGGACC Initial denaturation Denaturation Annealing. Elongation. Final elongation

Length 10 10 10 1st cycle

35 cycles Last cycle

Analysis of Amplicons (PCR products) Agarose gel electrophoresis The RAPD products were electrophoresed in 1.5% agarose gel with ethidium bromide (4 µl). 2µl standard molecular weight marker (i.100bp ladder/ ii.1kb ladder) was also loaded in one lane along with the PCR samples. The samples were mixed with the 5µl Bromophenol blue and then loaded and allowed to run at AIJRFANS 13-209; © 2013, AIJRFANS All Rights Reserved

Page 32

N. R. Chatterjee et al., American International Journal of Research in Formal, Applied & Natural Sciences, 3(1), June-August, 2013, pp. 3036

90 Volts for 3 hours. The final gel was visualized under Gel- Doc system and image stored using Alpha image software. Molecular weight of the bands was determined using PopGene software.

Plate 17: RAPD profile with OPX-17

Plate 18: RAPD profile with OPX-17(rest samples) PLATES OF RAPD PROFILES OBTAINED

Page 33

N. R. Chatterjee et al., American International Journal of Research in Formal, Applied & Natural Sciences, 3(1), June-August, 2013, pp. 3036

Plate 14: Primer screening with a single sample

Plate 15: RAPD profile with OPX-1

Page 34

N. R. Chatterjee et al., American International Journal of Research in Formal, Applied & Natural Sciences, 3(1), June-August, 2013, pp. 3036

III. RESULTS Data description: diploid RAPD data set Single-population decriptive statistics  Polymorphism seen  Population 1(North 24 Parganas): 100%  Population 2(South 24 Parganas): 73.08%  Population 3(Digha coast): 38.46%  Mean gene diversity:  Population 1(North 24 Parganas): 0.4025  Population 2(South 24 Parganas): 0.3097  Population 3(Digha coast): 0.1593

IV. DISCUSSION An accurate knowledge of the natural units that sustain a fishery is of fundamental importance for its scientific exploitation, conservation and for its modern aquaculture practices through selective breeding programmes. Such vital informations can be gained by standard measurement of genetic characteristics of the sample populations of the species in question (Altukhov, 1981; Lester and Pante, 1992). The topic of the present discussion here is the results of the study of the population genetic characteristics of Penaeus monodon of South India. The genetic characteristics of the species were measured by analysis of patterns of randomly amplified DNA. The significance of the results produced by this method applied on the species is discussed below. Though the total numbers of the RAPD fractions produced by the Operon primer, OPX-1, OPX-4 and OPX-17 were seven, ten and nine respectively, the number of fractions present in North 24 Parganas, South 24 Parganas and Digha were significantly very different. Some fractions of of the primer OPX-1 were unique to North 24 Parganas sample. Similar significant differences were shown by OPX-4 and OPX-17 Each sample was short of two but fractions with different kilobases. Each sample was short of two but fractions with different kilobases. Hence, the above significant differences caused by the unique RAPD fractions strongly suggest that the North 24 Parganas, South 24 Parganas and Digha coast samples may be genetically distinct stocks. Besides, the significant differences in the number of DNA fractions between individuals of each sample also mean that level of DNA variability is also significantly different in these three places. Comparable reports of molecular genetic stock differences were reported in Melvin trout populations (Ferguson et at., 1995). There, the unique DNA fractions (alleles) present enabled to separate Ferox, Gillaroo and Sonaghen populations. Single RAPD fraction present in one of the two populations of Macrobrachium borellii was considered as a genetic marker for stock identification (D' Amato and Corach, 1996). The recent review of the genetic structure of penaeids (Benzie, 2000) reveals that the RAPD technique is the most efficient technique for detection of the natural genetic diversities in penaeid prawns, especially in P. monodon which fact is more evident in the present report. Because the genetic stock structure differences present in the east and west cost populations of P. monodon of South India could be clearly detected only by RAPD method and not by the morphometric or allozyme methods. The present finding of higher level RAPD genetic variability in North 24 Parganas and the unique RAPD fractions present in the three area samples strongly support that these three area samples of P. monodon may be separate fishery stocks. Besides, the significance of the present finding was that these unique DNA fractions can now be used as genetic markers to select separately the desired breeders for the purpose of

Page 35

N. R. Chatterjee et al., American International Journal of Research in Formal, Applied & Natural Sciences, 3(1), June-August, 2013, pp. 3036

selective breeding programmes and to monitor the level of DNA variability in the wild or cultured populations of the species. Besides, these stock-specific unique alleles can now be used to detect any possible mixing of these two stocks, especially, during selective breeding programmes or larval rearing period. Nevertheless, a word of caution also to be mentioned here. The present conclusions are based on only a few specimens and a single RAPD test. Considering the sensitivity of the RAPD procedures, the reproducibility of the present results should be confirmed before drawing a final conclusion on the stock diversity of P. monodon of West Bengal. At the same time, the very possible aspect of the RAPD experimental conditions that favors the present conclusion is to be highlighted here. The significantly different RAPD profiles obtained here were produced on a single gel under uniform electrophoresis and staining conditions. Hence, the RAPD experimental error that might have affected the results and the conclusion was the least possible. This is further strengthened by the fact that the RAPD differences were shown only by OPX-1, OPX-4 and OPX-17 primers where as some other OPX primers tried produced only non-polymorphic RAPD profiles. The significance of the present conclusions may be based on the original findings corroborated by detailed future studies. V. CONCLUSION In brief, the above discussion on the results of the population genetic studies on P. monodon leads to the following major conclusions: 1. The results of molecular genetic method obtained here were strikingly different from any other methods. The random amplified polymorphic DNA (RAPD) profiles discovered for the first time in the specimens from three populations from coastal West Bengal were significantly different. Hence, it is concluded that the molecular genetic stock structure of these populations is heterogeneous. 2. The significant differences in the number of DNA fragments (obtained from RAPD analysis) between the three populations support the hypothesis that heterogeneity exists within the distinct locations within coastal West Bengal. VI. SUGGESTIONS The present RAPD analysis, using OPX-1, OPA-4 and OPX-17, was done only for North 24 Parganas, South 24 Parganas and Digha coast samples of P. monodon. Hence, a detailed analysis of the RAPD profiles of all the other populations, using these three primers are essential to draw a final conclusion on the population genetic stock structure of the species. Since the microsatellite techniques have produced the highest genetic variability in the P. monodon of Thailand (Supungul et at. 2000), the same technique is also to be applied in the future investigations of the Indian species. REFERENCES [1]. Altukov, Yu., P. (1981). The stock concept from the viewpoint of population genetics. Can. J. Fish. Aquat. Sci. 38: 15231538.Program, University of Washington Press, Seattle, WA. Pp.1-19. [2]. Annon (1969). Prawn fisheries of India, CMFRI, Bulletin, 14: 360 p. Central Marine Fisheries Research Institute, Kochi. India. [3]. Annon ( 1978 ). Summer Institute in "Breeding and rearing of marine prawns". CMFRI., Spl., Publ. 3: 128 p. Central Marine Fisheries [4]. Research Institute , Kochi. India. [5]. Benzie, J.A.H. (2000). Population genetic structure in penaeid prawns. Aquaculture Research, 31: 95-119. [6]. D'Amato, M.E. and Corach, D. (1996). Genetic diversity of populations of the fresh water shrimp Macrobrachium borellii (Caridea: Palaemonidae) evaluated by RAPD analysis, Journal of Crustaceanm Biology, 16: 650-655. [7]. Ferguson, A., Taggart, J.B., Prodohl, P.A., McMeel, 0., Thompson, C., Stone, ., McGinnity, P. and Hynes, R.A. (1995). Population and Conservation: The application of molecular markers to the study and conservation of fish populations, with special reference to Salmo. J. Fish. Biol. 39 (A): 79-85. [8]. Jhingran, A.G. (1984). The fish genetic resources of India. Bureau of fish genetic resources. Indian Council of Agricultural Research, New Delhi. [9]. Kemp, S. (1915). Fauna of the Chilka Lake, Crustacea decapods. Mem. Indian Mus., 5: 201-325. [10]. Lester, L.J. and Pante, M.J.R. (1992). Genetics of Penaeus species. In Marine shrimp culture : Principles and practices. Arlo, W., Fast and L. James Lester, (editor). Elsevier science publishers. Pp. 29 -52. [11]. Shaklee, J.B., Allendorf, F. W., Morizot, D.C. and Whitt, G.S. (1990). Gene Nomenclature for Protein-Coding Loci in Fish. Transactions of the American Fisheries Society 119: 2-15. [12]. Supungul, P., Sootanan, P., Klinbunga, S., Kamaonrat, W., Jarayabhand, P. and Tassanakajon, A. (2000). Microsatellite Polymorphism and [13]. the population Structure of the Black Tiger Shrimp (Penaeus monodon) in Thailand. Mar. Biotechnol., 2: 339-347. [14]. Utter. F.M. (1981). Biological criteria for definition of species and distinct intraspecific populations of anadromous salmonids [15]. under the U.S. Endangered Species Act of 1973. Can. J. Fish. Aquat. Sci., 38 (12): 1626-1635.

Page 36

American International Journal of Research in Formal, Applied & Natural Sciences

Available online at http://www.iasir.net

Breaking of Synthetic Polymeric Resinous Bonds with help of Natural Enzymes extracted from Ginger, Garlic, Onion and Pomegranate Dr. Harsha Chatrath, Associate Professor & Head, Department of Chemistry, Dr. D. Y. Patil Arts, Commerce, Science College, Pimpri, Pune 411018 Mr. Rohit Durge, Scientist and Research Analyst, Dr. D. Y. Patil Arts, Commerce, Science College, Pimpri, Pune 411018 Abstracts: Strong oxidizing chemicals are being used for destructions of the polymeric bonds from waste. Chemicals such as peroxide, per acetic acid; strong acids etc. are used while processing waste for recycling containing high concentration of resinous material. There will be formation of small bundles on the metal surfaces. Treatment chemicals have ability to break the bonds and are easy to process but they also affect the metal surfaces by forming scales. Water soluble polymers present in the waste adhere to the surface of metal. To avoid these problems, natural resource chemicals have been used which will help in dispersing the polymeric materials in waste. We have extracted enzymes for treatment from Ginger, Garlic, Pomegranate and Onion. One of these extracts contains phenolic compounds which help in breaking bonds. The combination of Garlic, Ginger has given good results while dispersing the polymeric chains at 45 – 50 0 C temperature and pH range of 5.6 - 6.8. Natural enzymes from pomegranate which contain ellagic acid (C14 H6 O8), inhibition of per oxidation, could help in separating monomers. Sulpfinates group also plays as important role in polymer de-bonding in combinations with ellagic acid from pomegranates. (Fruton, J.S. (1999) Proteins, Enzymes, Genes: The Interplay of Chemistry and Biochemistry, Yale University Press, New Haven.A distinguished historian of biochemistry traces the development of this science and discusses its impact on medicine, pharmacy, and agriculture) Key words: Polymeric bonds, waste, resin, natural enzymes of onion, garlic, ginger, pomegranate. I. Introduction Generally waste is generated from various sources such as used papers, milk packs, plastic toys, plastic bags, pet bottles, food wrapper, and confectionaries wrappers. These materials carry some coating materials, PVA coated silicon base film, plastic coats, hard plastic and synthetic resins for strength at various temperatures, pH and chemical contacts, to withstand its parameters at those conditions. While processing waste for recycling there some sticky materials was formed at the surface of metals. This was due to improper dispersion of polymers such as thin plastic films, resins in plastic and base materials, from waste wherein polymers retained its original nature so that it does not separate out from its parent compound. (Society of Chemical Industry, 1968, pp. 46–76) Many different methods, like mechanical treatment of waste at various temperatures for dispersion, different types of strong acids, surfactants etc; have been adopted for recycling of waste. Because of these processes various polluting gases are released in the atmospheres. In this experiment we have tried to do environment friendly treatment of the waste. We have treated the waste with natural enzymes extracted from ginger, garlic, onion and pomegranate, for dispersion of polymer and to avoid the release of gaseous compounds from waste in the environment. The extracts of these four fruits were taken in different concentration ratios as well as individual extracts were used for treatment of polymers. Also we have concerted on the tackiness of adhesive and resins with their elasticity and surface charge, in wet form, so that it is easy to detackify the polymer base compounds with enzymes. (2002, Dr. Allen D. Hunter, Youngstown State University Department of Chemistry) II. Methodology Experiments were carried out on different types of polymer waste material such as paper waste, polypropylene waste with synthetic compounds bonded to wastes. Enzymes were extracted from ginger, garlic, onion and pomegranate. Waste was treated with individual enzymes as well as with the combination of enzymes. Waste sample (paper waste with highly adhesive and resins impregnated) small pieces of milk carton, plastic adhesives with high strength were taken in 4 glass beaker, maintaining the consistency to 5% in each set. Beakers were kept in water bath to maintain the temperature. The initial pH of five sets at temperature 28 OC was found to be 7.7. Temperature of reaction vessel was maintained at 45-50 OC. After achieving reaction temperature, the enzymes were added to the waste. Ginger extracted enzymes were added to first set, second set

Page 37

H. Chatrath et al., American International Journal of Research in Formal, Applied & Natural Sciences, 3(1), June-August, 2013, pp. 37-40

the enzymes of contained garlic extract, third set contained enzymes of onion extract and fourth set contained enzymes of pomegranate extract .The retention period of mixture was 20 minutes.[Bartley, J, & Jacobs, A.(2000)] In section first all sets were treated with singles enzymes separately, with same consistency of 5% and concentration of enzymes was 0.1% for all sets. pH varied in all sets due to enzymes additions as mentioned in following result table (no.1). Blank set without any treatment showed tackiness of materials after filtrate was dried and material was placed in closed condition which means that the blank sets could not be separated. But the sets treated with single enzymes did not show major positive results as compared to blank sets. Set treated with garlic showed little effect on polymer during dispersion. Section second has treatment of enzymes in combination sets. First set consists of combination ratio of ginger and onion (1:3), pH after additions of combination enzymes is 6.5, reaction time and temperature was same as maintained for section first. After completion of reaction the water got decanted and samples were stored in sample bottles for further testing. In second set combination ratio of ginger and garlic was1:2, pH was 6.2 Temperature and reaction time for this set was same as set one. The decanted water was more turbid as compared to set one. Set three had combination ratio of ginger and onion 1:4, pH was 6.7, temperature and reaction time was same. In this set, filtered water was less turbidity than previous set. Fourth set with combination ratio of ginger and pomegranate (2:3) with the same parameters having pH 7.1 showed no results in decanted water. Effect of water-soluble phospholipid polymers conjugated with papainon the enzymatic stabilityDepartment of Materials Engineering, School of Engineering, The University of Tokyo, 7-3-1, Hongo, Bunkyo-ku, Tokyo 113-8656, Japan Received 9 May 2003; accepted 15 June 2003. During the process of decantation of water, water soluble adhesives, resins and other coating materials present in waste were also filtered along with water. The untreated material will be check by disintegrating the waste properly in due course of time, if successful we should be able to separate the resinous material completely from waste. Thiosulphinates of garlic in combination with ginger give good results in dispersing polymers in different forms from waste; generally it comes along water in non tackiness forms. Photograph: -

Photograph1. Dispersion of polymer taking place, after drying, they are in separate forms. Reaction: 2R.SO.CH3.CH(NH2).CO2H +H2O Allinase R.SO.S.R + 2CH3.CO.CO2H+2NH3 Allicin Pyruvic acid Result table 1: Section1: Particulars Pomegranate Garlic Ginger Onion pH of Temperature Turbidity stock (OC) (FTU) Set 1 0.1% 7.4 48-50 Set 2 0.1% 6.9 48-50 210 Set 3 0.1% 6.8 48-50 Set 4 0.1% 6.3 48-50 *Table1 shows the treatment of waste with single enzymes in each set, there will be no changes in turbidity of water.

Page 38

H. Chatrath et al., American International Journal of Research in Formal, Applied & Natural Sciences, 3(1), June-August, 2013, pp. 37-40

Result table 2: Section2: Particulars Pomegranate Set 1 Set 2 Set 3 Set 4

Garlic

0.2% 0.3%

Ginger

Onion

0.1% 0.1% 0.1% 0.2%

0.3%

pH of stock 6.8 6.2 6.3 6.9

0.4%

Temperature (OC) 48-50 48-50 48-50 48-50

Tutbidity (FTU) 236 289 263 176

*Table 2 shows the different combinations of enzymes treated on waste with, their results in increasing turbidity in sets. Graph1 : - *Data from result table 2, sets made with combination enzymes.

pH of stock after enzymes added

Sets Vs pH of stock

ResultTable 2

7 6.8 6.6 6.4 6.2 6 5.8 1

Sets in numbers Graph 2: - *Data base on result table 2 with combination of enzymes.

Turbidity (FTU)

Sets Vs Turbidity of decanted water(FTU)

Table 2

350 300 250 200 150 100 50 0 1

Sets in numbers

The conclusive set with combination of ginger and garlic gave good turbidity with respects to detackified material along with adhesives and some coating materials were observed in decanted water. Above microscopic photograph shows the polymers separated out after treatment. The surface charge of polymers gets neutralized with enzymes this shows that adhesion to surface metal gets reduces during the recycling of materials. Graph indicating the details percentage of content in garlic extract, data analyzed with the help of GC-MS instrument.

Page 39

H. Chatrath et al., American International Journal of Research in Formal, Applied & Natural Sciences, 3(1), June-August, 2013, pp. 37-40

Graph 2

Compounds Vs Its purity in Percentages (%) 120 100

97.9

Percentage (%)

80 60 40 20

Percentage Purity

39.7 11.6

12.6

29.2 12.9

13.3

0 Diallyl disulphide

2-Ethyl-1-Hexyl Benzyl acetate acetate

Retention time (mins)

Dodecane

*Ester group present in it which may help in dispersing the polymers. III. Conclusion The dispersion of polymers and detackification process when done with the help of combination ratios of garlic and ginger as in mentioned in result table2 shows that the presence of ester group helps in breaking the polymeric chain in pH range of 6.5-6.8. The ratio can be altered while treating the different raw materials. References: [1]. Effect of water-soluble phospholipid polymers conjugated with papainon the enzymatic stabilityDepartment of Materials Engineering, School of Engineering, The University of Tokyo, 7-3-1, Hongo, Bunkyo-ku, Tokyo 113-8656, Japan Received 9 May 2003; accepted 15 June 2003. [2]. Atkinson, B. Mavituna, F., Biochemical Engineering and Biotechnology Handbook, 2nd Ed., Stockton Press, New York, 1991. [3]. Drochioiu, Gabi (2005). Turbidimetric lipid assay in seed flours. J. Food Lipids, 12: 1, p.12. [4]. Department of Process and Environmental Engineering 28.4.2005 Mass and Heat Transfer Process Laboratory, recycling of polymers [5]. Takashi Kashiwagi, Atsushi Inaba, James E. Brown, KoichiHatada, Tatsuki Kitayama, and Eiji Masuda, Effects of Weak Linkages on the Thermal and Oxidative Degradation of [6]. Poly(methyl methacrylates), Macromolecules 19, 2160-2168 (1986). [7]. J.V. Koleske and L.H. Wartman (eds.), Polyvinyl Chloride, Its Preparationand Properties, Gordon and Breach, New York, and Macdonald Technical and Scientific, London, 1969 [8]. R.H. Boundy and R.F. Boyer (eds.), Styrene, Its Polymers, Copolymers andDerivatives, Reinhold, New York, 1952. [9]. Nakanishi K, A historical perspective of natural products chemistry in Barton Dand Nakanishi K (eds.), Comprehensive Natural Products Chemistry, Vol. 2, XXI– XXXVIII, Elsevier Publishers, 1995. [10]. GeissmanTA, Croat DHG, Organic Chemistry of Secondary PlantMetabolism, Freeman, Cooper and Company, 1969. [11]. Bartley, J., & Jacobs, A. (2000). Effects of drying on flavour compounds inAustralian-grown ginger (Zingiber officinale). Journal of the Science of Food and Agriculture, 80, 209–215. [12]. Platel, K., & Srinivasan, K. (2000). Influence of dietary spices and theiractive principles on pancreatic digestive enzymes in albino rats. Nahrung, 1, 42–46. [13]. Romero, A., Doval, M., Stura, M., & Judis, M. (2004). Antioxidant properties of polyphenol-containing extract from soybean fermentedwith Saccharomyces cerevisiae. European Journal of Lipid Science and Technology, 105, 424–431. [14]. M.P. Stevens, Polymer Chemistry, 2nd edn., Oxford University Press, 1990 [15]. Langner, E., Greifenberg, S. and Gruenwald, J. Ginger: History and use. Adv Ther 15: 25, 1998. [16]. Economic and Medicinal Plants Research (Vol.1). Eds. H.Wagner and H.Hikino. Academic Press, New York, p.62,1965.

Page 40

American International Journal of Research in Formal, Applied & Natural Sciences

Available online at http://www.iasir.net

Analysis of Working of LNA in UWB Range Somit Pandey M.Tech. Scholar, NIIST, Bhopal (M.P.) India. Abstract: An ultra-wideband (UWB) noise-canceling low-noise amplifier (LNA) has been proposed in this paper. By using Chebyshev filter, the effective bandwidth of noise canceling is extended. This LNA has been fabricated in a 0.18μm CMOS process. The measured noise figure is calculated over 3.1–10.6-GHz along with good gain and noise figure, good linearity is also required for the LNA to operate properly. The l-dB compression point and IIP3 point are the characteristics measuring the linearity of the RF components. The objective is to get -10 dB of 1-dB compression point. Keywords: Chebeshev filter , CMOS , LNA , UWB .

I. INTRODUCTION The demand for high-speed wireless communication systems is growing during the last few years. With a frequency spectrum allocated from 3.1 to 10.6-GHz ,ultra-wideband (UWB) is emerging as a very attractive solution for short-distance and high data rate wireless communications. Two possible approaches have been proposed to implement an UWB system. One uses the multi-band OFDM modulation, while the other transmits short pulses with position or polarity modulation. Although the standard has not been completed, a front-end wideband low noise amplifier is indispensable regardless of the receiver architecture. The amplifier must meet several stringent requirements. Those include broadband input matching to minimize return loss, sufficient gain to suppress the noise of a mixer, low noise figure (NF) to enhance receiver sensitivity, low power consumption to increase battery life, and small die area to reduce the cost. There are several existing solutions for high frequency wideband amplifiers in CMOS technology. Distributed amplifiers can bring the gain-bandwidth-product (GBW) to a value close to device fT, but consume large power and area [1]. Amplifiers employing shunt-shunt feedback are well-known for their wideband matching capability, but require high power consumption to obtain reasonable noise figure [2]. A multi-section LC ladder matching network has been proposed to achieve wideband matching, low noisefigure, and low power consumption simultaneously [3].However, the rapid growth of noise figure at high frequencies decreases the receiver sensitivity when operating at upper bands. Besides, the loss of inductors in the matching network contributes substantial noise, and this makes it difficult to realize them in a small area. In this work, the concept of noise canceling is re-exploited [4]. By using inductive series and shunt peaking techniques and the design methodology described in this paper, broadband noise canceling effectively lowers the noise figure over the target band under reasonable power consumption and small die area. II. CIRCUIT DISCRIPTION

The proposed schematic is shown in Figure 1. A Chebyshev filter is used to achieve resonance in the reactive part of the input impedance over the whole frequency range of 3 to 10 GHz. Typically the Chebyshev filter consists of two capacitors and two inductors. The Chebyshev filter works as a passband filter if the sizes of L1, C1, L2 and C2 are selected correctly. The proposed solution expands the basic inductively degenerated common source amplifier by inserting an input multi section reactive network, so that the overall reactance can be resonated over a wider bandwidth. This input matching network is shown in the Figure 1. by a dotted square. A capacitor (C3) is placed to add flexibility to the design. Different values of C3, would give different matching conditions. The cascade connection of M1 and M2 improves the input output reverse isolation and the AIJRFANS 13-212; © 2013, AIJRFANS All Rights Reserved

Page 41

Somit Pandey, American International Journal of Research in Formal, Applied & Natural Sciences, 3(1), June-August, 2013, pp. 41-45

frequency response of the amplifiers.

Figure 1: Proposed circuit diagram. III CIRCUIT ANALYSIS A. Gain analysis The input network impedance is equal to Rs/W(s) where W(s) is the Chebyshev filter transfer function given by: W(s)= wL1 + (1/wC1) + wL2 (1) Note that W(s) is approximately unity in the in-band and tends to zero at out-of-band. The impedance looking into the amplifier is therefore equal to Rs in the in-band, and it is very high out-of-band. At high frequency the MOS transistor acts as a current amplifier because of the channel length modulation effect. The current gain is given by β(s) = gm/(sCt) [6]. The current flowing into M1 is [VinW(s)]/R, and therefore the output current is VinW(s)/(sCtR,). The load of the LNA is a shunt peaking transistor used as a resistor. The overall gain is: Vout = {GmW(s)}{RL(1+sL/RL)}

(2) where, RL is the load resistance, L is the load znductance, and Cout is the total capacitance between the drain of M2 and ground. That means Cout = Cdb1+Cgd2, where Cdb2 is the drain and bulk capacitance of transistor M2. Equation (2) shows that the voltage gain roll is compensated by L because it is directly connected to the drain of transistor M2. Moreover, it shows that Cout introduces a spurious resonance with L, which must be kept out of the band. Simulation helps in choosing the final values of these components: L3=l nH and C3=100 pF. The value of M2, which is in cascode connection to M1, is chosen to be as small as possible in order to reduce the parasitic capacitance .A very large value of R2 (higher than 200Ω) could result in reduction of the headroom . Keeping all these criteria in mind, the value chosen for RL and L are 90 Ωand 2 nH, respectively.

-80

dBm(VoltGain1)

-85

-90

-95

-100

-105

-110 3

freq, GHz

Page 42

Somit Pandey, American International Journal of Research in Formal, Applied & Natural Sciences, 3(1), June-August, 2013, pp. 41-45

Figure 2: Voltage gain in dB m2 freq= 3.000GHz mag(Vout*iOut)=1.117E-8 Max 1.2E-8 m2

mag(Vout*iOut)

1.0E-8

8.0E-9

6.0E-9

4.0E-9

2.0E-9

0.0 3

freq, GHz

Figure 3: Transconductance

10.0000000

dBm(S(1,1))

10.0000000

9.9999999

9.9999998

9.9999998 3

freq, GHz

Figure 4: S(1,1)

-60 -80 -100

Pout

-120 -140 -160 -180 -200 -220 3

Figure 5:Pin Vs Pout

Page 43

Somit Pandey, American International Journal of Research in Formal, Applied & Natural Sciences, 3(1), June-August, 2013, pp. 41-45

-85

-90

dB(S(2,1))

-95

-100

-105

-110

-115 3

freq, GHz

Figure 6: Power Gain 0

dB(var("S"))

-20

-40

-60

-80

-100

-120 3

freq, GHz

Figure7: var “S” -4.0 -4.5

dB(S(2,2))

-5.0 -5.5 -6.0 -6.5 -7.0 -7.5 -8.0 3

freq, GHz

Figure 8: S(2,2)

Page 44

Somit Pandey, American International Journal of Research in Formal, Applied & Natural Sciences, 3(1), June-August, 2013, pp. 41-45

dB(SNR2/SNR1)

-3.5

-4.0

-4.5

-5.0

-5.5 3

freq, GHz

Figure 9: Noice factor

freq 3.000 GHz 3.500 GHz 4.000 GHz 4.500 GHz 5.000 GHz 5.500 GHz 6.000 GHz 6.500 GHz 7.000 GHz 7.500 GHz 8.000 GHz 8.500 GHz 9.000 GHz 9.500 GHz 10.00 GHz

Pout

VoltGain1

1.117E-8 / -43.40... 5.851E-9 / -55.47... 3.278E-9 / -67.13... 1.930E-9 / -78.22... 1.182E-9 / -88.69... 7.478E-10 / -98.5... 4.861E-10 / -107.... 3.235E-10 / -116.... 2.198E-10 / -124.... 1.521E-10 / -132.... 1.070E-10 / -139.... 7.638E-11 / -146.... 5.529E-11 / -152.... 4.052E-11 / -158.... 3.003E-11 / -164....

5.285E-5 / -21.70... 3.825E-5 / -27.73... 2.862E-5 / -33.56... 2.197E-5 / -39.11... 1.719E-5 / -44.34... 1.367E-5 / -49.27... 1.102E-5 / -53.89... 8.993E-6 / -58.22... 7.412E-6 / -62.28... 6.166E-6 / -66.10... 5.171E-6 / -69.70... 4.370E-6 / -73.08... 3.718E-6 / -76.27... 3.183E-6 / -79.29... 2.740E-6 / -82.15...

S(1,1) 1.000 / 128.135 1.000 / 120.763 1.000 / 113.904 1.000 / 107.547 1.000 / 101.672 1.000 / 96.252 1.000 / 91.258 1.000 / 86.658 1.000 / 82.419 1.000 / 78.511 1.000 / 74.904 1.000 / 71.572 1.000 / 68.489 1.000 / 65.632 1.000 / 62.980

S(1,2)

S(2,1)

1.057E-4 / -21.70... 7.649E-5 / -27.73... 5.725E-5 / -33.56... 4.393E-5 / -39.11... 3.438E-5 / -44.34... 2.735E-5 / -49.27... 2.205E-5 / -53.89... 1.799E-5 / -58.22... 1.482E-5 / -62.28... 1.233E-5 / -66.10... 1.034E-5 / -69.70... 8.740E-6 / -73.08... 7.435E-6 / -76.27... 6.365E-6 / -79.29... 5.480E-6 / -82.15...

S(2,2) 0.409 / 18.869 0.421 / 20.160 0.433 / 21.364 0.446 / 22.459 0.459 / 23.437 0.472 / 24.296 0.486 / 25.037 0.500 / 25.667 0.514 / 26.191 0.528 / 26.617 0.542 / 26.953 0.556 / 27.208 0.569 / 27.389 0.583 / 27.505 0.596 / 27.561

SNR1 177.649 177.658 177.665 177.671 177.675 177.679 177.681 177.684 177.685 177.687 177.688 177.689 177.689 177.690 177.690

SNR2 99.429 96.531 93.924 91.532 89.308 87.222 85.252 83.384 81.605 79.905 78.278 76.715 75.213 73.767 72.372

...NR2)/dB(SNR1) 0.888 0.882 0.877 0.872 0.867 0.863 0.858 0.854 0.850 0.846 0.842 0.838 0.834 0.830 0.827

TABLE-1

REFERENCES [1] A Wideband Low Power Low-Noise Amplifier in CMOS Technology [2] Ding, W. and Marchionini, G. 1997 A Study on Video Browsing Strategies. Technical Report. University of Maryland at College Park. [3] Fröhlich, B. and Plate, J. 2000. The cubic mouse: a new device for three-dimensional input. In Proceedings of the SIGCHI Conference on Human Factors in Computing Systems

[4] Tavel, P. 2007 Modeling and Simulation Design. AK Peters Ltd. [5] Sannella, M. J. 1994 Constraint Satisfaction and Debugging for Interactive User Interfaces. Doctoral Thesis. UMI Order Number: UMI Order No. GAX95-09398., University of Washington.

[6] Forman, G. 2003. An extensive empirical study of feature selection metrics for text classification. J. Mach. Learn. Res. 3 (Mar. 2003), 1289-1305.

[7] Brown, L. D., Hua, H., and Gao, C. 2003. A widget framework for augmented interaction in SCAPE. [8] Y.T. Yu, M.F. Lau, "A comparison of MC/DC, MUMCUT and several other coverage criteria for logical decisions", Journal of Systems and Software, 2005, in press.

[9] Spector, A. Z. 1989. Achieving application requirements. In Distributed Systems, S. Mullende

Page 45

American International Journal of Research in Formal, Applied & Natural Sciences

Available online at http://www.iasir.net

SPECTROPHOTOMETRIC DETERMINATION OF Cu(II) AND Ni(II) USING 4 PHENYL-3-THIOSEMICARBAZONE OF 2-HYDROXY-4-nPROPOXY-5-BROMOACETOPHENONE (HnPBAPT) AS ANALYTICAL REAGENT AMBILY P NAIR, CHRISTINE JEYASEELAN1 Department of Chemistry, Amity Institute of Applied Sciences, Amity University, Sector-125, NOIDA-201303, INDIA

@amity. Abstract: 4-phenyl-3-thiosemicarbazone of 2-hydroxy-4-n-propoxy5-bromoacetophenone (HnPBAPT) has been developed as an analytical reagent for rapid spectrophotometric determination of Cu(II) and Ni(II) in buffer medium with appropriate pH. Both the reagents are selective and sensitive. Job’s method and Mole Ratio method showed that both the metal ions formed a 1:2 complex with the ligand. The reagent has been used to determine Cu(II) in Brass and Ni(II) in German Silver sample. Keywords: Thiosemicarbazones, Analytical reagent, 2-hydroxy-4-n-propoxy 5-bromoacetophenone

I. Introduction Thiosemicarbazones have been used for spectrophotometric determination of various metal ions like iron[1], palladium[2], cobalt[3], Vanadium[4] etc. Cu(II) has been individually determined by complexing agents like Oxime[5-8] along with other thiosemicarbazones[9]. Similarly Ni(II) also has been determined individually using oximes[10]. Determination of both Cu(II) and Ni(II) has been done using biladiene[11], thiosemicarbazones[12], 5-methyl-2-furaldehyde thiosemicarbazone[13], isatin-p-thiosemicarbazone[14], substituted salicylaldehyde thiosemicarbazone[15], semicarbazone and thiosemicarbazone of 2-hydroxy-4ethoxy acetophenone[16], oxime[17] etc. In the present work, spectrophotometric study of Cu(II) and Ni(II) has been reported using 4-phenyl-3thiosemicarbazone of 2-hydroxy-4-n-propoxy 5-bromoacetophenone (HnPBAPT). The stoichiometry and stability of the complexes can also be confirmed by spectrophotometric methods. II. Materials and methods Shimadzu UV-160A UV-Visible spectrophotometer and “Equip-tronics” pH meter were used for absorbance and pH measurement respectively. All the reagents used were of AR grade. 4-Phenyl-3-thiosemicarbazide was obtained by the method used by Kazakov and Postovskil[18]. A mixture of 2-hydroxy-4-n-propoxy-5-bromoacetophenone (2.73 gm, 0.01 mole), 4-phenyl-3-thiosemicarbazide (1.67 gm, 0.01 mole) and hydrochloric acid (3 ml) in ethanol (30 ml) was refluxed on a water-bath for four hours. The mixture was then poured in ice-cold water when orange solid thiosemicarbazone was separated. It was filtered, washed and crystallized from ethanol, when yellowish orange crystals were obtained (m.p.160 10C). Reagent solution for HnPBAPT was prepared in DMF as it was sparingly soluble in ethanol, chloroform, ethylacetate etc. The percentage of elements analyzed was found in agreement with the molecular formula (C18H20O2N3SBr). Percentage of carbon, hydrogen and nitrogen found was 51.48, 4.64 and 9.73 and calculated was 51.18, 4.73 and 9.95 respectively. Stock solution of Cu(II) (0.05M) and Ni(II) (0.05M) was prepared by dissolving requisite amount of copper sulphate pentahydrate and nickel sulphate hexahydrate respectively in doubly distilled water. A little free acid was added to prevent hydrolysis of the salts. Experimental solutions were obtained by suitable dilution of the stock solution. Sodium acetate, hydrochloric acid, ammonia and ammonium chloride buffer was used in the present study. III. Results and Discussion An aliquot of Cu(II) (0.005M, 1ml) and reagent (0.01M, 6ml) was taken and the pH was adjusted to 6.5 with Sodium acetate-hydrochloric acid buffer and the solution was made upto 25ml using DMF. The absorbance was measured against reagent blank. λmax was obtained at 520nm. Similarly absorbance measurement was done

Page 46

A. Nair et al., American International Journal of Research in Formal, Applied & Natural Sciences, 3(1), June-August, 2013, pp. 46-50

for Ni(II) (0.005M, 1ml) and reagent (0.01M, 6ml) was taken and the pH was adjusted to 10 with ammoniaammonium chloride buffer. The λmax was obtained at 530nm. The concentration of the metal present was read from a calibration curve prepared previously after verification of beers law as shown in fig 1 and 2 for Cu(II) and Ni(II) respectively. The validity of Beers law is as given in Fig 1 & 2 and the maximum limit is shown in Table 1.

0.2

Absorbance

0.15 0.1

0.05 0 0

Cu(II) in ppm

Fig 1: Beer’s Law Plot for Cu(II)- HnPBAPT Complex

Absorbance

0.2 0.18 0.16 0.14 0.12 0.1 0.08 0.06 0.04 0.02 0 0

Ni(II) in ppm

Fig 2: Beer’s Law Plot for Ni(II)- HnPBAPT Complex Table: Validity of Beers law and other maximum limits Characteristic Wavelength for determination (study) PH for determination Buffer used Beers Law Validity (ppm) Molar Absorptivity (lt mol-1cm-1) Sandell Sensitivity (μg/cm2) Stability Constants Composition of complex Standard free energy (ΔG˚) (Kcal/mol)

Cu(II)-HnPBAPT 520nm 6.5 Sodium Acetate – HCl Upto 10.16 11.525 x 102 0.055 2.305 x 1010 1:2 -14.22

Ni(II)-HnPBAPT 530nm 10.0 NH3-NH4Cl Upto 14.09 6.712 x 102 0.087 1.215 x 1010 1:2 -13.84

The order of addition of reagents has no effect on the absorbance of complexes. The reaction between metal ions and reagent are instantaneous and the complexes formed are stable upto 6 hours. The tolerance limit taken as the amount of foreign ions required to cause ± 2% error in the absorbance, indicates that the reagent is selective in determination of Cu(II) and Ni(II). In the determination of 7.62 ppm Cu(II) at pH 6.5 using HnPBAPT, 150 fold excess of fluoride, chloride, bromide, nitrate and sulphate, 5 fold excess of thiourea, thiosulphate, oxalate and 30 fold excess of Zn(II), Sr(II), Ca(II), Mg(II), Cd(II), Al(III), Na(I), K(I) and Ba(II) do not interfere. In the determination of 14.09 ppm Ni(II) at pH 10 using HnPBAPT, 150 fold excess of fluoride, chloride, bromide, nitrate and sulphate do not interfere. 5 fold excess of thiourea, 10 fold excess of thiosulphate

Page 47

A. Nair et al., American International Journal of Research in Formal, Applied & Natural Sciences, 3(1), June-August, 2013, pp. 46-50

and oxalate can be tolerated. A 50 fold excess of Zn(II), Sr(II), Ca(II), Mg(II), Cd(II), Al(III), Na(I), K(I) and Ba(II) do not interfere. The infrared spectra of HnPBAPT showed intense strong νOH stretching at 3300 cm-1, νC=N stretching at 1640 cm-1, νC=S stretching at 1220 cm-1, νN-N stretching at 1165 cm-1. The details of the synthesis and IR study was obtained from literature[19]. The metal complexes with HnPBAPT were soluble in DMF and hence they could not be isolated in solid state in pure form for IR studies. Composition and stability constant of the complexes : Jobs[20] and Mole ratio method[21] showed that Cu(II) and Ni(II) forms 1:2 complex with HnPBAPT. The results obtained are shown graphically in Fig 3,4 for Cu(II)-HnPBAPT and Fig 5,6 for Ni(II)-HnPBAPT. The stability constants and ΔG˚ values obtained from both these methods is shown in Table 1. The stability constant was calculated using the relation Ks = (1-α) / 4α3C2 where α = (Em – Es) / Em and standard free energy change at 27˚C was calculated using ΔG˚ = -RT lnKs. 0.14 Em=0.1300 Es=0.1203

0.12

Absorbance

0.1 0.08 0.06 0.04 0.02 0 0

0.2

0.4 0.6 0.8 1 Cm / Cr+Cm Fig 3: Job’s Method for Cu(II)-HnPBAPT Complex, Plot of Job’s method of variation for determination of M:L ratio 0.001 M Cu(II), 0.001 M HnPBAPT, pH = 6.5, λ = 520 nm

0.14 0.12

Em=0.1120 Es=0.1023

Absorbance

0.1 0.08 0.06 0.04 0.02 0 0

0.2

0.4

0.6 Cm / Cr

0.8

1.2

Fig 4: Mole-Ratio method for Cu(II)- HnPBAPT Complex, Plot of Yoe and Jone’s method for determination of M:L ratio 0.001 M Cu(II), 0.001 M HnPBAO, pH = 6.5, λ = 520 nm

Absorbance

Em= 0.1750 0.18 0.16 0.14 0.12 0.1 0.08 0.06 0.04 0.02 0

Es=0.1598

0.2

0.4 Cm / Cr+Cr

0.6

0.8

Page 48

A. Nair et al., American International Journal of Research in Formal, Applied & Natural Sciences, 3(1), June-August, 2013, pp. 46-50

Fig 5: Job’s Method for Ni(II)- HnPBAPT Complex, Plot of Job’s method of variation for determination of M:L ratio 0.001 M Ni(II), 0.001 M HnPBAO, pH = 10.0, λ = 530 nm

0.16 0.14

Em = 0.1500 Es = 0.1331

0.12 Absorbance

0.1 0.08 0.06 0.04 0.02 0 0

0.2

0.4

0.6

0.8

1.2

Cm / Cr Figure 6: Mole-Ratio method for Ni(II)- HnPBAPT Complex, Plot of Yoe and Jone’s method for determination of M:L ratio 0.001 M Ni(II), 0.001 M HnPBAO, pH = 10.0, λ = 530 nm

Determination of Cu in Brass: Pre-analyzed sample of brass (250 mg) was dissolved in nitric acid (1:1) by heating for 30 minutes. The solution is evaporated to a volume of 5 ml but not to dryness and the bulk of nitric acid was removed. The resulting solution was diluted to 100 ml with doubly distilled water and 10 ml of the above solution was further diluted to 100 ml. An aliquot of above diluted solution (1.0 ml) was pipetted out in a 25 ml volumetric flask. To this 6 ml of 0.005 M solution of reagent HnPBAPT and 5 ml of buffer solution of pH 6.5 was added. The solution was diluted upto mark with DMF and absorbance was measured at 520 nm. The results obtained are as follows: Weight of Brass sample: 250.00 mg (i) Absorbance of the solution : 0.1272 (Average of three measurements) (ii) Concentration of Cu(II) in ppm : 7.0 ppm (iii) Amount of Cu(II) found in 1.0 ml of finally diluted solution : 0.175 mg (iv) Amount of Cu(II) found in brass sample : 175.00 mg (v) Percent of Cu(II) found in brass sample : 70.00 % (vi) Percent of Cu(II) reported in brass sample : 70.48 % (vii) Relative error in percent : -0.68 % Determination of Nickel in German Silver : 418.00 mg of german silver was dissolved in conc. nitric acid (1:1) by heating on a sand bath to a volume of 5 ml but not to dryness. The resulting solution was diluted with double distilled water to 100 ml. 25 ml of this solution was further diluted to 100 ml. An aliquot of the above diluted solution (1.0 ml) was pipetted out in a 25 ml volumetric flask. To this solution potassium sodium tartrate was added for masking Cu(II) present in the solution. Then 6.0 ml of 0.005 M of reagent HnPBAPT and 3 ml buffer of pH 10.0 was added. The solution was diluted to the mark with DMF and absorbance was measured at 530 nm. The results obtained are as follows: Weight of German silver sample : 418.00 mg (i) Absorbance of the solution : 0.0893 (Average of three measurements) (ii) Concentration of Ni(II) in ppm : 7.9 ppm (iii) Amount of Ni(II) found in 1.0 ml. of finally diluted solution : 0.1975 mg (iv) Amount of Ni(II) found in German silver : 79.00 mg (v) Percent of Ni(II) found in German silver : 18.89 % (vi) Percent of Ni(II) reported in German silver : 19.00 % (vii) Relative error in percent : -0.58 % IV. Conclusion 4-phenyl-3-thiosemicarbazone of 2-hydroxy-4-n-propoxy5-bromoacetophenone (HnPBAPT) is a suitable reagent for spectrophotometric determination of Cu(II) and Ni(II). Many cations and anions were found not to interfere.

Page 49

A. Nair et al., American International Journal of Research in Formal, Applied & Natural Sciences, 3(1), June-August, 2013, pp. 46-50

References [1] [2] [3] [4] [5] [6] [7] [8] [9] [10] [11] [12] [13] [14] [15] [16] [17] [18] [19] [20] [21]

M. T. Martinez aguilar and J. M. CanoPavon, “2-benzoylpyridine-4-phenyl-3-thiosemicarbazone as an analytical reagent for spectrophotometric determination of iron” Microchimica Acta 1977, vol 68(5-6) pp. 631. P Parameshwara, J Karthikeyan, A Nityanada Shetty and P Shetty, “4(N,N-Diethylamino) Benzaldehyde thiosemicarbazone in spectrophotometric determination of Pd(II)” Annli di Chimica 2007, vol 97(10) pp. 1097. J.M. CanoPavon, A Lavado and F Pino, “3-Hydroxypicolinaldehyde thiosemicarbazone as an analytical reagent for spectrophotometric determination of cobalt” Michrochimica Acta. 1976, vol 66(3-4) pp. 233. M Chatterjee and S Ghosh, “Vanadium(III) complexes of salicylaldehyde thiosemicarbazones” Transition Metal chemistry 1998, vol 23(4) pp. 355. KK Desai and BD Desai, “2-hydroxy-4-ethoxy-5-bromopropiophenone oxime as analytical reagent for Cu(II)” Asian Journal of Chemistry 2001, vol13 pp. 334. K Purohit and K.K. Desai, “4-hydroxy-4-methoxybenzophenone oxime as an analytical reagent for copper(II)” E Journal of chemistry 2005, vol 2(2) pp. 161. G.R. Desai and K.K. Desai, “2-hydroxy-4-n-propoxybutyrophenone oxime as an analytical reagent for copper” Asian Journal of Chemistry 1995, vol 7(3) pp. 592. S.K. Shingadia and K.K. Desai, “2-hydroxy-5-methylbenzophenone oxime (HMBO) as an analytical reagent for gravimetric of Cu(II)” E-Journal of Chemistry 2007, vol 4(1) pp. 97. M Sayaji Rao, N.B.L. Prasad and K Hussain Reddy, “Spectrophotometric determination of Cu(II) in alloys and edible oils using 2acetylthiophene thiosemicarbazone” Indian Journal of Chemistry 2006 vol 45A pp. 1659. Makarycheva-Mikhailova et al, “Ni(II)-Mediated nitrosation of oximes bearing an α-CH2 group. Anastassiya V” Inorganic Chemistry Communication 2006, vol 9(8) pp. 869. E.V Antina, S.P. Zakharova and E.V. Rumyantsev, “Thermodynamic stability of Ni(II) and Cu(II) chelate with biladiene-a,c in DMF’ Russian Journal of co-ordination chemistry 2006, vol 32(7) pp. 524. B.K. Rai and A Baluni, “Co-ordination compounds of Co(II), Ni(II) and Cu(II) with thiosemicarbazone of a series of quinazolone derivatives; their preparation, characterization and structural investigation” Asian Journal of Chemistry 2001, vol 13(2) pp. 725. E Mostapha Jourd, A Riou, M Allain, M.A. Khan and G.M. Bouet, “Synthesis, structural and spectral studies of 5-methyl-2furaldehyde thiosemicarbazone and its Co, Ni, Cu and Cu complexes” Polyhedron 2001, vol 20(1-2) pp. 67. S.S. Konstantinonic and B.C. Radovanovic et al, “Spectrophotometric study of Co(II), Ni(II), Cu(II), Zn(II), Pd(II) and Mg(II) complexes with isatin-β-thiosemicarbazone” J.Serb. Chem Soc 2007 vol 72(10) pp. 975. D.X. West et al, “Nickel(II) and Copper(II) complexes of 5-substituted- salicyladehyde thiosemicarbazone” Transition metal Chem 1997, vol 22 pp. 180. Y.G. Patel and K.K. Desai, “Spectrophotometric determination of Fe(III) and Cu(II) using thiosemicarbazone and smicarbazone of 2hydroxy-4-ethoxy acetophenone” Acta Ciencia Indica 1991, vol 17C(4) pp. 337. N.B. Patel and K.K. Desai, “2,4-Dihydroxy-5-Bromovalerophenone oxime as a gravimetric reagent for Ni(II) and Cu(II) and spectrophotometric study of complexes” Asian Journal of Chemistry 1999, vol 11(3) pp. 1080. V. Ya. Kazabov and I. Ya. Postovskil, I2 Vest. Tekhnonol 1961, vol 4 pp. 238. A.P. Nair, J Christine and K.K. Desai, “Synthesis and characterization of bromo substituted o-hydroxy oximes and thiosemicarbazone ligands used as chelating agents” Oriental Journal of Chem 2008, vol 24(2) pp. 577. P Job, “Etude Spectrographique de la Formation des Complexes en Solution et de leur Stabilite” Compt. Rend. Acad Sci, Paris 1925, vol 180 pp. 928-930. J.H. Yoe and A.L. Jones, “Colourimetric determination of iron with disodium-1,2-dihydroxy benzene-3,5-sulfonate”. Ind Engg Chem ( Anal Ed) 1944, vol 16 pp. 111.

Page 50

American International Journal of Research in Formal, Applied & Natural Sciences

Available online at http://www.iasir.net

Synthesis and antibacterial activity of Substituted methyl 5-(2-bromopropionyl)-4-oxo-3-phenyl-1-oxa-5-azaspiro [5.5] undec-2-en-2carboxylic acid ester auxillaries.

Sayyed Hussain1*, Shivaji Jadhav1, Megha Rai2 and Mazahar Farooqui2, 3 1. Sir Sayyed College, Aurangabad 431001 (M S).India 2. Dr. Rafiq Zakaria College for Women, Aurangabad.(M.S).India Post Graduate and Research Centre, Maulana Azad College, Aurangabad.(M.S).India

Abstract: Substituted methyl 5-(2-bromopropionyl)-4-oxo-3-p5henyl-1-oxa-5-azaspiro [5.5] undec-2-en-2carboxylic acid ester auxillaries were readily prepared by the base (Pyridine) catalyzed condensation of substituted substituted methyl 4-oxo-3-phenyl-1-oxa-5-azaspiro [5.5] undec-2-en-2-carboxylic acid ester with acyl bromide in toluene. The structures of the new prepared compounds were confirmed by elemental analyses, 1H-NMR, IR and Mass spectral data. The antibacterial activity of the synthesized compounds was evaluated and shows significant results. Keywords: Substituted Spiro Base, base catalyst like pyridine, 2-Bromopropionyl bromide, and Antibacterial activity.

I. Introduction Spiro [Indole â&#x20AC;&#x201C; oxadiazones] are endowed with various pharmacological activities e.g. anti-inflammatory, fungistatic, and bacteriostatic and anticonvulsing. A large number of synthetic protocols leading to this compound [2]. One of the spiro compounds 1,3-Benzodioxanes represent an interesting motif in applied chemistry. The were reported as agrochemical fungicides [3], pesticide [4] biocides [5] and herbicides [6]. Some 1, 3-benzodioxanes were tested for pharmacological activity and were found to have anti-inflammatory activity and low toxicity [7], or analgesic, mucolytic and antipyretic activity [8]. The unsaturated spiranes occur in the acidic degredation or steroids [9]. Spiro compounds represent an important class of naturally occurring substances characterized by their highly pronounced biological properties [10-12]. On the other hand, over the past three decades spiro compounds have received considerable attention owing to their diverse chemotherapeutic potential including antineoplastic activities [13]. Some spiro compounds have been implemented as antimicrobial, antitumor and antibiotic agent [1415] . In the area of photochromism, spiro compounds, due to their steric constraints, equillibriate with the corresponding non-spiro analogue and exhibit various photochemical phenomena. Spirobenzopyrans are bistable photochromic molecules which are converted, upon ultraviolet extraction, from the closed, colourless form to an open coloured form (merocyamine). Because of this behaviour, Spirobenzopyrans are considered suitable materials for a number of technological applications like optical memories [17-19], molecular switches [19-22] as well as models of biological receptors [23-24]. Most of the naturally occurring spiroketals are biologically active compounds [25-27]. Such as for example Reveromycin [28-29], which contains spiroketals skeletons and are inhibitors of the mitogenic activity of epidermal growth factor. O OH O

HO O OH

Reveromycin

Page 51

S. Hussain et al., American International Journal of Research in Formal, Applied & Natural Sciences, 3(1), June-August, 2013, pp. 51-56

Noverties Institute of Tropical Diseases (Singapore) recently reported the new antimalarial drug candidate NITD609 which exhibit excellent oral bio availability and exceptional efficiency in a rodant material mode [30].

N F

N H

O H

NITD 609 Meanwhile, attention has been paid to the synthesis of heterocyclic compounds bearing a Bromo spiro base moiety because of their pharmacological properties. Significant commercial interest in the development of bromo spiro base derivatives, particularly Pharmaceutical uses of β- methyl Carbapenems is shown by the large number of patents filed in this area32, 33.

II.

Results and Discussion

Considering the biological and therapeutic activities of Spiro Base, It is proposed to synthesize substituted Spiro base derivatives, which may produce pharmacologically more active compounds. Compounds with spiro ring show outstanding antimalarial effects 30. Due to these valuable finding and its need, present work has been carried out on the preparation of substituted methyl 4-oxo-3-phenyl-1-oxa-5-azaspiro [5.5] undec-2-en-2carboxylic acid ester and its derivatives which can be produced from alkyl cyanide. The compounds 1.1(a-i) were readily prepared 52-88 % yield. Scheme 1: Stage I: CN OR1 O O

CH3ONa R2

Methanol OR1

OR1

Stage II: O O

CN O

T = 0 - 100C R3

1) Acetic anhydride 2) Acetic acid 3) H2 SO4

NH R1 O

R4 O R3

R4 O

OR1

1.1(a-i)

III.

Reagent and conditions

Sodium methaoxide, Acetic anhydride, Acetic acid, Sulphuric acid, Hydrochloric acid, Solvents: Methanol/MDC/IPE, T=0–100C. Almost all the major classes of antibiotics have encountered resistance in clinical applications (34, 35). The emergence of bacterial resistance to β – lactam antibiotics is becoming a major worldwide health problem (36-38). In particular, antibiotic resistance among gram negative and gram positive bacteria (Staphylococci, Enterococci, and Streptococci) is becoming increasingly serious (39-41). In order to overcome these emerging resistance problems, there is an urgent need to discover novel process to synthesize intermediate antibacterial agent which produce β – lactam antibiotics with better pharmacogical activity. Therefore continuous research work is on-going for to synthesize newer antibacterial agent with better pharmacological properties and minimum side effects. Therefore in this section according work was planned

Page 52

S. Hussain et al., American International Journal of Research in Formal, Applied & Natural Sciences, 3(1), June-August, 2013, pp. 51-56

and well executed to develop or modify the synthetic route for the synthesis of novel bromoxazones auxiliaries for the stereo-selective synthesis of 1 – β – methyl Carbapenems. Our research has been focused on the development of an efficient auxiliary for the construction of the 1–β–methyl Carbapenem nucleus.Our research has been focused on the development of an efficient auxillaries which can be produced in a single step from alkyl cynide discussed in scheme1. Bromopropionylation of 1.1(a-i) in the presence of butyl lithium or sodium hydride in THF give the 2.1(a-i) in low yields with concomitant formation of several biproduct. The use of triethyl amine (TEA) as a base also gave the disappointing results. After screening a variety of base and solvents we found that the bromopropionylation is completed in a good yield by the use of pyridine as a base and toluene as solvent. Thus the reaction 1.1(a-i) with 0.165 mole acyl bromide in the presence of 0.274 mole pyridine (base) in toluene as a solvent at 40 – 450C gave compounds 2.1(a-i) in high yields [55 – 95%] with better pharmacological applications. Scheme 2:

O O

Br N

Pyridine

NH R4

R1O O

Toluene

R1O

R4 O R3

Br O

2.1(a-i) 2-Bromopropionyl addition must be in 10–150C, Pyridine as base, Toluene as solvent most preference (other solvent is isopropyl ether or dichloromethane), Maintain 90–120 min. at T = 40–450C 2.2. Antibacterial Activity: Testing the susceptibility of staphylococcus aurous to antibiotics by the Kirby-Bauer disk diffusion method. Antibiotics diffuse out from antibiotic-containing disk and inhibit growth of S. aurous resulting in a zone of inhibition. The synthesized compounds 2.1(a-i) were screened for their antibacterial activity against Gram negative (E. coli) and Gram-positive (S. aureus)Microorganisms at 25 µg/ml. In-vitro antibacterial screening of the compounds showed that they were significant activity against both organisms compared with standard drug Vancomycine. Sr. No. 1 2 3 4 5 6 7 8 9 10

Bacteria Standard [Vancomycine 25 µg/ml Comp. 2.1a Comp. 2.1b Comp. 2.1c Comp. 2.1d Comp. 2.1e Comp. 2.1f Comp. 2.1g Comp. 2.1h Comp. 2.1i

S. aureus

Zone of inhibition in (mm) E. coli B. subtilis

P. aeruginosa

21 20 18 22 16 21 20 19 22

24 21 23 19 15 18 17 21 18

22 19 21 16 17 18 19 20 18

23 19 18 18 19 18 21 22 21

We screened comp. 2.1(a-i) for antibacterial activity. The result indicates that all compounds showed good antibacterial activity. Compounds 2.1a showed very significant activity against S. aureus, E. coli, B. subtilis and P. aeruginosa. From the above observation it is clear that the Bromo spiro base auxillaries are more active and play a prominent role in the antimicrobial activity which helpful to improve the antibacterial activity of Carbapenems. IV. Experimental Melting points were determined in open capillary tube and were found uncorrected. The reactions were monitored by thin layer chromatography (TLC), carried out on pre coated silica gel 60 F254 (Merck). Plates were visualized under UV light (where appropriate). The purity of specific synthesized compounds carried out

Page 53

S. Hussain et al., American International Journal of Research in Formal, Applied & Natural Sciences, 3(1), June-August, 2013, pp. 51-56

on HPLC i.e. High Performance liquid Chromatography (Waters) with known analysing procedure and yield is calculated by (W/W). Synthesize compounds were characterized by IR, 1HNMR, Mass spectral analysis. The IR spectra of the compounds were recorded on spectrophotometer (Shimadzu) using KBr disc method. 1HNMR was recorded on 300MHz – Berker DPX200. The chemical shifts ( ) are reported as ppm downfield from TMS in CDCl3. Coupling constants (J) are reported in Hertz, with signal multiplicity designated as singlet (s), doublet (d), triplet (t), doublet of doublet (dd), quartet (q), multiplet (m) and broad (b) values. The mass spectra were recorded on finnigan MAT–8230 and the spectral data of compounds showing (M+) peak as molecular ion peak. Elemental analyses were performed on a Euro Vector Elemental Analyzer (EA 3000 A) at ORCHID chenicals and pharmaceuticals Ltd, Aurangabad, MS. General procedure for the synthesis of spiro base (1.1a-i):A mix of alkyl cynide (0.427 moles), sodium alkaoxide (30% w/w solution) (0.455 moles) and dialkyl oxalate (0.555 moles) in methanol was stir for 60 minutes.Cool at 0–50C and quench with water and MDC.Adjust PH = 1.0 to 1.5 with 1:1 HCl.Stir, settled & separate layer. MDC layer distilled & degas u/v completely at 300C. Charged acetic anhydride (1.647 moles), cyclohexanone (0.785 moles), and acetic acid (1.73 moles) at 25 – 300C. Stir & cool at 0 – 100C.Charged slowly sulphuric acid (1.265 moles) and stir 120 min.Quench reaction mass in mix. Of water + IPE (144 + 8) ml.Stir 40 – 60minutes at 15 – 200C. Filter and wash with hexane: EA (1:1) 20 ml.Dry u/v 10 – 12 hrs at room temperature. Methyl 4-oxo-3-phenyl-1-oxa-5-azaspiro[5.5]undec-2-ene-2-carboxylate (comp.1.1a):Yield: 82%, M.P.:1701720C, IR (KBr) cm –1 : 3174 (NH), 1616 (CONH), 1446 (C – N),1735 (-CO-) 1HNMR ( CDCl3) :3.52(S,3H),7.94 (d, 1H),7.25 – 7.34 (M, 5H), Mass (M/Z) : 302 (M+), Element cal.for Mol.Formula C17H19NO4 (C = 67.75,H = 6.35,N =4.6), Found ( C = 67.69, H = 6.38, N =4.7). Methyl 2,2-dimethyl-4-oxo-5-phenyl-3,4-dihydro-2H-1,3-oxazine-6-carboxylate (comp.1.1b):Yield: 52%, M.P.:85-880C, IR (KBr) cm –1 : 3198 (NH), 1612 (CONH), 1443 (C – N),1732 (-CO-) 1HNMR ( CDCl3) :3.8(S,3H),7.77 (d, 1H),7.20 – 7.21 (M, 5H), Mass (M/Z) : 262 (M+), Element cal.for Mol.Formula C17H15NO4 (C = 64.36,H = 5.74,N =5.36), Found ( C = 64.40, H = 5.72, N =5.35). Methyl 2,2-dibutyl-4-oxo-5-phenyl-3,4-dihydro-2H-1,3-oxazine-6-carboxylate (comp.1.1c):Yield: 32%, M.P.:73-75, IR (KBr) cm –1 : 3189 (NH), 1615 (CONH), 1444 (C – N),1734 (-CO-) 1HNMR ( CDCl3) :3.85(S,3H),7.56 (d, 1H),7.21 – 7.25 (M, 5H), Mass (M/Z) : 346 (M+), Element cal.for Mol.Formula C20H27NO4 (C = 69.56,H =7.82,N =4.05), Found (C=69.52,H =7.80, N =4.07). Methyl2,2-dibenztyl-4-oxo-5-phenyl-3,4-dihydro-2H-1,3-oxazine-6-carboxylate(comp 1.1d) :Yield: 43%, M.P.:105-107, IR (KBr) cm –1 : 3190 (NH), 1615 (CONH), 1445 (C – N),1730(-CO-) 1HNMR ( CDCl3) :3.85(S,3H),7.64 (d, 1H),7.20– 7.23 (M, 5H), Mass (M/Z) : 414 (M+), Element cal.for Mol.Formula C26H23NO4 (C = 75.54,H =5.56,N =3.38), Found (C=75.5,H =5.60, N =3.41). Methyl 3-(4-methylphenyl)-4-oxo-1-oxa-5-azaspiro[5.5]undec-2-ene-2-carboxylate (comp1.1e) :Yield: 82%, M.P.:167-169, IR (KBr) cm –1 : 3185 (NH), 1620 (CONH), 1448 (C – N),1732(-CO-) 1HNMR ( CDCl3) :3.84(S,3H),7.72 (d, 1H),7.21– 7.29 (M, 5H), Mass (M/Z) : 316 (M+), Element cal.for Mol.Formula C18H21NO4 (C = 68.57,H =6.67,N =4.44), Found (C=68.62,H =6.61, N =4.45). Methyl 3-(4-chlorophenyl)-4-oxo-1-oxa-5-azaspiro[5.5]undec-2-ene-2-carboxylate (comp 1.1f) :Yield: 88%, M.P.:148-149, IR (KBr) cm –1 : 3188 (NH), 1612 (CONH), 1443 (C – N),1731(-CO-) 1HNMR ( CDCl3) :3.84(S,3H),7.90 (d, 1H),7.21– 7.29 (M, 5H), Mass (M/Z) : 335 (M+), Element cal.for Mol.Formula C17H18NO4Cl (C = 61.07,H =5.39,N =4.19), Found (C=61.02,H =5.44, N =4.20). Methyl 3-(4-nitrophenyl)-4-oxo-1-oxa-5-azaspiro[5.5]undec-2-ene-2-carboxylate(comp 1.1g) :Yield: 25%, M.P.:171-172, IR (KBr) cm –1 : 3179 (NH), 1608 (CONH), 1438 (C – N),1728(-CO-) 1HNMR ( CDCl3) :3.85(S,3H),7.89 (d, 1H),7.25– 7.26 (M, 5H), Mass (M/Z) : 347 (M+), Element cal.for Mol.Formula C17H18N2O6 (C = 58.95,H =5.2,N =8.10), Found (C=58.91,H =5.19, N =8.14). Ethyl 4-oxo-3-phenyl-1-oxa-5-azaspiro [5.5]undec-2-ene-2-carboxylate(comp 1.1h) :Yield:81%, M.P.:139, IR (KBr) cm –1 : 3190 (NH), 1618 (CONH), 1448 (C – N),1728(-CO-) 1HNMR ( CDCl3) :3.2(q,2H),1.9(t,3H),7.66 (d, 1H),7.18– 7.26 (M, 5H), Mass (M/Z) : 316 (M+), Element cal.for Mol.Formula C18H21NO4(C =68.57,H =6.67,N =4.44), Found (C=68.60,H =6.71, N =4.40). Methyl 4-oxo-3-phenyl-1,9-dioxa-5-azaspiro[5.5]undec-2-ene-2-carboxylate(comp 1.1i) :Yield: 66%,M.P.: 117 – 1190C, IR (KBr) cm –1 : 1442 (C – N), 1613 (CO – NH), 1723 (-CO-), 3185 (N – H), 1090 (C – O, ether) 1 HNMR ( CDCl3) : 3.86 (S, 3H), 7.23 – 7.31 (M, 5H),7.79 (d, 1H), Mass (M/Z) : 304 (M + 1),Element cal.for Mol.Formula C16H17NO5 (C = 63.37,H =5.61,N =4.62), Found (C=63.40,H =5.58, N =4.64). General procedure for the synthesis of Bromo spiro base 2.1(a-i):Take a mix of comp. 1.1(a-i) spiro base (0.165 moles), Pyridine (0.247 moles) in Toluene. Cool the RM at 10–150C. Charged 2-Bromopropionyl bromide (0.247 moles) diluted with Toluenein above reaction mass slowly in 30–40 minutes at T = 10–150C, exotherm should be controlled. Raised temp. Of reaction mass upto 40–450C and maintain 90–120 minutes and monitor the progress of reaction at TLC. Cool the reaction mass room temp. Reaction mass wash with water.

Page 54

S. Hussain et al., American International Journal of Research in Formal, Applied & Natural Sciences, 3(1), June-August, 2013, pp. 51-56

Organic Toluene layer wash with 9% sodium bi-carbonate solution. Organic Toluene layer again wash with water. Collect and concentrate the toluene layer under vacuum at 30–350C. Charged methanol under stirring at 25–300C. Cool at 5–100C, stir 30–45 minutes. Filter the solid and spray wash with chilled methanol at 5–100C. Dry U/V 2–3 hrs at 30–350C. Methyl 5-(2-bromopropanoyl)-4-oxo-3-phenyl-1-oxa-5-azaspiro[5.5]undec-2-ene-2-carboxylate(comp 2.1a) : Yield: 92%,M.P.: 104 – 1050C, IR (KBr) cm –1 1384, 1446 (C – N), 1631, 1681, 1739 (-CO-), 2870, 2931 cm–1 (Aromatic ring),1HNMR ( CDCl3) : 1.22 – 1.73 (M, 10H), 1.85 – 1.88 (d, J = 6.6 Hz, 3H), 3.59 (S, 3H), 5.17 (q, J = 6.8 Hz, H), 7.20 – 7.40 (M, 5H), Mass (M/Z) : 438 (M + 1),Element cal.for Mol.Formula C20H22NO5Br (C = 55.04,H =5.04,N =3.21), Found (C=55.07,H =5.01, N =3.24). Methyl 3-(2-bromopropanoyl)-2,2-dimethyl-4-oxo-5-phenyl-3,4-dihydro-2H-1,3-oxazine-6-carboxylate (comp 2.1b) : Yield: 76%,M.P.: Oily material, IR (KBr) cm –1 : :1398 (C – N), 1725 (-CO-), 2860, 2925 (Aromatic ring),1HNMR ( CDCl3) : 0.91(S, 6H), 1.84 (d, J = 6.6 Hz, 3H), 3.64 (S, 3H), 5.06 (q, J = 6.8 Hz, 1H), 7.18 – 7.36, Mass (M/Z) : 397 (M + 1),Element cal.for Mol.Formula C17H18NO5Br, (C = 51.5,H =4.54,N =3.54), Found (C=51.48,H =4.53, N =3.55). Methyl 3-(2-bromopropanoyl)-2,2-dibutyl-4-oxo-5-phenyl-3,4-dihydro-2H-1,3-oxazine-6carboxylate(comp 2.1c) : Yield: 73%,M.P.: Oily material, IR (KBr) cm –1 : : 1395 (C – N), 1480 (–CH2–), 1730 (-CO-), 2880, 2940 (Aromatic ring,1HNMR ( CDCl3) : 1.0 (t, 6H), 2.36 (t, 4H), 2.4 (M, 4H), 1.86 (d, J = 6.6 Hz, 3H), 3.64 (S, 3H), 5.10 (q, J = 6.8 Hz, 1H), 7.21 – 7.27 (M, 5H),Mass (M/Z) : 481 (M + 1),Element cal.for Mol.Formula C23H30NO5Br, (C = 57.5,H =6.25,N =2.91), Found (C=57.54,H =6.20, N =2.96). Methyl 3-(2-bromopropanoyl)-2,2-dibenzyl-4-oxo-5-phenyl-3,4-dihydro-2H-1,3-oxazine-6carboxylate(comp 2.1d) : Yield: 55%,M.P.: Oily material, IR (KBr) cm –1 : 1410 (C–N), 1728 (-CO-), 2930(Aromatic ring),1HNMR (CDCl3) : 1.84 (d, J = 6.6Hz, 3H), 3.78 (S, 3H), 5.02 (q, J = 6.8Hz, 1H),7.2 – 7.38 (M, 15H),Mass (M/Z) : 549 (M + 1),Element cal.for Mol.Formula:C29H26NO5Br,(C=63.505,H=4.74,N=2.55), Found (C=63.52,H =4.72, N =2.58). Methyl 5-(2-bromopropanoyl)-4-oxo-3-(4-methyl phenyl)-1-oxa-5-azaspiro[5.5]undec-2-ene-2-carboxylate (comp 2.1e) : Yield: 95%,M.P.: Oily material, IR (KBr) cm –1: 1420 (C–N), 1727 (-CO-), 2990 (Arring),1HNMR ( CDCl3) : 1.83 (d, J = 6.6Hz, 3H), 3.79 (S, 3H), 5.07 (q, J = 6.8Hz, 1H), 7.23 – 7.28 (t, 2H),Mass (M/Z) : 451 (M + 1),Element cal.for Mol.Formula: C21H24NO5Br ,(C=56.00,H=5.33,N=3.11), Found (C=56.04,H =5.30, N =3.10). Methyl 5-(2-bromopropanoyl)-4-oxo-3-(4-chloro phenyl)-1-oxa-5-azaspiro[5.5]undec-2-ene-2-carboxylate (comp 2.1f) : Yield: 93%,M.P.: Cotton shape, IR (KBr) cm –1: 1420 (C–N), 1728 (–CO-), 2895 (Aromatic ring),1HNMR ( CDCl3) : 1.83 (d, J = 6.6Hz, 3H), 3.72 (S, 3H), 5.10 (q, J = 6.8Hz, 1H), 7.2 – 7.27 (t, 2H),Mass (M/Z) : 470 (M + 1),Element cal.for Mol.Formula: C20H21NO5Br,(C=51.17,H=4.48,N=2.98), Found (C=51.15,H =4.50, N =3.00). Methyl 5-(2-bromopropanoyl)-4-oxo-3-(4-nitrophenyl)-1-oxa-5-azaspiro[5.5]undec-2-ene-2-carboxylate (comp 2.1g) : Yield: 88%,M.P.: 750C, IR (KBr) cm –1: 1415 (C – N), 1520 (NO2), 1730 (-CO-), 2880 (Aromatic ring), 1HNMR ( CDCl3) : 1.79 (d, J = 6.6Hz, 3H), 3.80 (S, 3H), 5.16 (q, J = 6.8Hz, 1H), 7.21 – 7.24 (t, 2H), Mass (M/Z) : 482 (M + 1),Element cal.for Mol.Formula: C20H21N2O7Br, (C=49.90,H=4.37,N=5.82), Found (C=49.88,H =4.40, N =5.79). Ethyl-5-(2-bromopropanoyl)-4-oxo-3-phenyl-1-oxa-5-azaspiro[5.5]undec-2-ene-2-carboxylate (comp 2.1h) : Yield: 86%,M.P.: Oily material, IR (KBr) cm –1: 1405(C–N),1722 (-CO-),2998 (Aromatic ring),1HNMR(CDCl3) : 1.9 (t, 3H), 3.2 (q, 2H), 1.84 (d, J = 6.6Hz, 3H),7.20–7.27(M,5H), Mass (M/Z) : 451 (M + 1), Element cal.for Mol.Formula:C21H24NO5Br,(C=56.00,H=5.33,N=3.11), Found(C=56.01,H =5.29, N =3.10). Methyl 5-(2-bromopropanoyl)-4-oxo-3-phenyl-1,9-dioxa-5-azaspiro[5.5]undec-2-ene-2-carboxylate (comp 2.1i) :Yield: 84%,M.P.: 117 – 1190C, IR (KBr) cm –1: 1220 (C–O, ether), 1410 (C–N), 1731 (-CO-), 2980 (Aromatic ring), 1HNMR ( CDCl3) : 1.84 (d, J = 6.6Hz, 3H), 3.82 (S, 3H),7.23 – 7.30 (M, 5H)Mass (M/Z) : 439 (M + 1),Element cal.for Mol.Formula: C19H20NO6Br, (C=52.05,H=4.57,N=3,20), Found (C=52.03,H =4.60, N =3.19). References [1] [2] [3] [4] [5] [6] [7] [8] [9] [10] [11]

A.V. Baeyer, Ber. Dtsch. Chem. Ges. 33, 1900, 3771–3775. D’ hooge, M, D. Kimpe, N. Tetrahedron, 62, 2006,513. W.E.J. Simon. Can. Pat. Appl. CA2117503 AA, 1995. W.E.J. Simon. Eur. Pat. Appl. EP645373AI, 1995. M. Anderson, A.G. Brinnand, R.E. Woodall, Eur. Pat. Appl. EP525877AI, 1993. M. Enomoto, H. Nagano, T. Haga, M. Sato, Jpn. KokaiTokkyoKoho JP63275580A2, 1988. V. Dauksas, P. Eaidelis, et.al, Khim – Farm. Zh. 23, 8,1989, 942. A. Torre, Eur. Pat. Appl. EP272223AI, 1988. T. Koga, Y. Nogami, Tetrahedron let, 27, 1986, 4505. A. Longeon, M. Guyot, J. Vacelet. Experentia, 46, 1990, 548–550. J. Kobayashi, M. Tsuda, K. Agemi, et.al. Tetrahedron, 47, 1991, 6617–6622.

Page 55

S. Hussain et al., American International Journal of Research in Formal, Applied & Natural Sciences, 3(1), June-August, 2013, pp. 51-56

[12] [13] [14] [15] [16] [17] [18] [19] [20] [21] [22] [23] [24] [25] [26] [27] [28] [29] [30] [31] [32] [33] [34] [35] [36] [37] [38] [41] [42]

D.M. James, H.B. Kunze, D.J. Faulkner, J. Nat. prod. 54, 1991, 1137–1140. G.A. Cordell, Ed. The alkaloids, chemistry and biology, Academic, San Diego, CA, USA, 5, 1998. T. Okita, M. Isobe. Tetrahedron. 50, 1994, 11143–11152. M.J. Kornet, A.P. Tnio. J. Med. Chem. 19, 1976, 892– 898. P.S. Silaichev, A.N. Maslivets. Molecules. 17, 2012, 13787–13794. S. Kawata, J. Kawata. Chem. Rev. 100, 2000, 1777–1788. D. Pisignano, E. Mele, et.al. J. phys. Chem. B. 110, 2006, 4506–4509. G. Berkovic, V. Krongauz, V. Weiss. Chem. Rev. 100, 2000, 1741–1753. J.R.C. Wojtyk, P.M. Kazmaier, et.al. Chem. Mater. 13, 2001, 2547–2551. J.T.C. Wojtyk, A. Wasey, P.M. Kazmaier et.al. J. Phys. Chem. A 104, 2000, 9046–9055. D. Gust. T.A. Moore, A.L. Moore, chem. comm. 2006, 1169–1178. M. Bose, D. Groff, J. Xie, E. Brustad, B.G. Schultz. J. Am. Chem. Soc. 128, 2006,388–389. A. Kocer, M. Walko, W. Meijberg, B.L. Feringa. Science, 309, 2005, 755–758. F. Parron, K.F. Albizati. Chem. Rev. 89, 1989, 1617–1661. K.T. Mead, B.N. Brewer. Curr. Org. Chem. 7, 2003, 227–256. M.A. Brimble, D.P. Furkert. Curr. Org. Chem. 7, 2003, 1461–1484. H. Koshino, H. Takahashi, H. Osada, K. Isono J. antibiot. 45, 1992, 1420–1427. T. Shimizu, K. Machida, K. Furuya, H. Osada, T. Nakata Bioorg. Med. Chem. Lett. 12, 2002, 3363–3366. C.P. Dell, In science of synthesis, Thieme, Stuttgart, 10.1,2000, 11. M. Rottamann, C. McNamara, B.K.S. Yeung, et.al. Science. 329, 2010,1175–1180. Nadenik.P, Storm.O, (Sandoz) WO 05/118586, 2005. P.N.Deshpande, R.J.Sarangdhar, P.Ganapathy, S.S Henry, S.N.Karale, A.A Jangle, R.D.Kaldate (ORCHID) WO 05/118586, 2007. K.Kondo.M.Seki, T.Kuvod, T.Yamanaka, T. Iwa Saki, J. Org. Chem., 60, 1995, 1096. Y.Ito, S.Terashima, Tetrahedron Lett, 28, 1987,6625. Berks A.H. Tetrahedron 52, 1996, 331-375. Cimarelli C;Palmieri G; Volpini E; Can. J. Chem. 82,8,2004,1314. Su Y.B; Li Z.Q; Su Y W; et al. Chem. Res. Chinese Universities 24, 1, 2008, 65. Camuesco D; Camalada M; Rodriguez–Cabezas M; et al: Br.J. pharmacol;143, 2004, 908. Fatehi M; Anvari K; Fatehi – Hassanabad Z; Shock, 18,2002, 450.

Page 56

American International Journal of Research in Science, Technology, Engineering & Mathematics

Available online at http://www.iasir.net

ISSN (Print): 2328-3491, ISSN (Online): 2328-3580, ISSN (CD-ROM): 2328-3629 AIJRSTEM is a refereed, indexed, peer-reviewed, multidisciplinary and open access journal published by International Association of Scientific Innovation and Research (IASIR), USA (An Association Unifying the Sciences, Engineering, and Applied Research)

Matrix Metalloproteinases in Subjects With Type 2 Diabetes Mellitus: Pattern of MMP-2 and MMP-9 Profile in Diabetes Mellitus Type-2 Patients Sudip Das1 and Arunkumar Maiti2 Department of Biotechnology, Haldia Institute of Technology, I.C.A.R.E. Complex, H.I.T. Campus, P.O. HIT, Haldia; Pin: 721657, Dist: Puba Medinipur, West Bengal, India.

Abstract: Dysregulation of matrix metalloproteinases (MMPs) and tissue inhibitors of matrix metalloproteinases (TIMPs) may contribute to the development of Cardiovascular Diseases. The aim of this study was to investigate if the levels of MMPs in blood samples are potential markers of early development of diabetes mellitus type-2. The serum levels of both MMP-9 and MMP-2 were significantly higher in subjects with type 2 diabetes, compared to controls. These results show that those patients with DM-2 as the risk factor for generation as well as for cardiovascular complications (results were not shown). The MMP analysis of serum from a limited number of patients (n=10) with type-2 diabetes suggest that such analysis may be potentially useful as markers in studies of people at risk of progression to chronic cardiovascular diseases and may be a viable marker of the prognosis of the several pathological conditions associated with diabetes. Keywords: Matrix mettaloproteinase; Diabetes type-2; cardiovascular disease, blood

I. Introduction Abnormal carbohydrate metabolism is an important and still growing social problem. For some years it has been recognized that cardiovascular complications are the leading cause of increasing premature mortality in patients with type 2 diabetes mellitus [1], [2], [3], [4]. Recently it has been proven that matrix metalloproteinases (MMPs) play an important role in atherosclerosis and rebuilding of the vascular wall [5]. The onset and progression of complications are delayed in patients with good glycemic control; hyperglycemia is thought to be an important regulator of vascular lesion development [3]. Recent studies indicate that elevated glucose concentrations can induce dysfunction of several intracellular signal transduction cascades, generation of reactive oxygen species (ROS), and accumulation of advanced glycation end products (AGEs) [4], [5]. However, the underlying mechanisms between hyperglycemia and vascular disease remain unclear. Matrix metalloproteinases (MMPs) are members of a family of Zn2+- and Ca2+-dependent endopeptidases, which are essential for cellular migration and tissue remodeling in both physiological and pathological conditions [6]. MMPs are secreted by many types of cells as proenzymes. Increased matrix degradation by MMPs within the atherosclerotic plaque has been implicated as one of the key factors that leads to plaque instability, and consequently to cardiovascular events [6], [7], [8], [9], [10], [11], [12]. Furthermore, MMP activity has been correlated with clinical manifestations of unstable angina, plaque rupture, and the development of abdominal aortic aneurysms [13], [14], [15]. We studied the gelatinolytic activity of plasma in patients of DM. Our findings indicate that the activity of MMP-9 and MMP-2 is preferentially enhanced in blood plasma of hyperglycemic patients. Hyperglycemia directly or indirectly (e.g., via oxidative stress or advanced glycation products) might increase MMP expression and activity in large vessels [16]. Within atherosclerotic plaques an imbalance between MMPs and TIMPs may induce matrix degradation, resulting in an increased risk of plaque rupture. Furthermore, because MMPs enhance blood coagulability they may play a role in acute thrombotic blockage of vessels and consequent cardiovascular complications [17], [18], [19], [20]. Despite these data, the role of MMPs in development of complications of type 2 diabetes (DM) is not fully understood [17], [18], [19], [20]. In our study, we have therefore endeavoured to compare the activities of selected matrix metalloproteinases (MMP-2, MMP-9) in subjects with diabetes and in non-diabetic controls of serum in chronic hyperglycemia. II. Materials and Methods A. Laboratory Analyses All subjects were studied as part of an ongoing regular, investigation from a local based laboratory. Twelve (10 patients and 2 healthy persons) individuals were selected at random from a local general pathological laboratory.

Page 57

Sudip Das et al., American International Journal of Research in Formal, Applied & Natural Sciences, 3(1), June-August, 2013, pp. 57-60

Subjects with diabetes, hypercholesterolemia, renal disease (defined as a clinical history), a history of cardiovascular diseases (defined as a clinical history), as were subjects receiving any medication. Citrated venous blood was obtained and immediately centrifuged at 1,000g and 4°C for 20 min. Plasma was aliquoted and stored at -15°C for a batch analysis of MMPs by zymography and SDS-PAGE analysis. Total blood glucose was determined using standard methodology by the laboratory. B. Determination of Protein Protein concentrations were estimated by BCA protein assay kit using bovine serum albumin as the standard. C. Polyacrylamide Gel Electrophoresis SDS-polyacrylamide gel electrophoresis (SDS-PAGE) (12%) was performed according to the procedure of Laemmli [21] using a minigel system apparatus. Samples (50 g of protein) were diluted in SDS-containing sample buffer without -mercaptoethanol (under nonreducing condition) prior to being loaded. Electrophoresis was performed at room temperature at 16mA during stacking and 18mA per plate during resolving until the bromphenol blue dye reached the bottom of the gel. Protein containing bands were visualized by coomassie staining method. D. Zymogram of Protease Activity Polyacrylamide minigels (12%) were cast containing 0.1% gelatin. Gelatin solution was made up as 2% stock in distilled water and dissolved by heating. Samples (50 g of protein) was applied to the gel in standard SDS loading buffer containing 0.1% SDS but lacking -mercaptoethanol, it was not boiled before loading [22]. The gels were run in 4C at 16mA per gel during stacking and 18mA per gel during resolving until the dye front reach at the end of the gels. Then soaked the gels in 200 ml of 2.5% (v/v) Triton X-100 in distilled water in shaker for 1 hour with one change after 30 minute at 20C to remove SDS. Next the gels were soaked in the assay buffer (50mM Tris, 200mM NaCl, 10mM CaCl2, 0.05% Brij 35, pH 7.5) for 12 hours at 37C and then stained with Coomassie Brilliant Blue-R 250 in 50% methanol and 10% acetic acid and this was followed by washing with distilled water for one minute. The clear zone of lysis against a dark background indicates enzyme activity. The zones of gelatin lysis increased with increasing dose of enzyme-containing samples and time of gel incubation. E. Activation of Progelatinase Studies These were carried out as described by Murphy et al [23]. Progelatinase incubated with HgCl2 (2mM) was analyzed for activity and molecular mass change. The enzyme was activated at 37C with a final concentration of 2mM HgCl2 from a 10X stock solution in 50mM NaOH in calcium assay buffer (CAB) composed of 50mM Tris-HCl, pH 7.5, 200mM NaCl, 10mM CaCl2, 0.05% Brij 35 for 2 hours. Control enzyme received an equal amount of NaOH without HgCl2. These studies were done in zymogram. F. Inhibition Studies The inhibitors EDTA (20mM) and PMSF (1mM) were added to the triton X-100 soaked gels for 1 hour, then incubated with reaction buffer CAB (50mM Tris, 200mM NaCl, 10mM CaCl 2, 0.05% Brij 35 pH 7.5) containing these inhibitors for 12 hours at 37C. These were then stained with Coomassie Brilliant Blue R-250 followed by washing with distilled water for one minute as above. The clear zone of lysis against the dark Coomassie background indicates protease activity.

III. Results Table 1. Shows the correlations of Serum Glucose Levels and MMP Levels in Diabetes Compared to Healthy Person N-1

N-1

P-1

P-2

P-3

P-4

P-5

P-6

P-7

P-8

P-9

P-10

150

148

156

162

175

155

146

155

152

165

2-hr Postprandial Blood Sugar (mg/dl)

110

112

217

214

226

234

253

224

211

224

220

239

MMP Activities

Fasting Blood Sugar (FBS) (mg/dl)

N: Normal/Healthy Person; P: Diabetic Patient NS: Not Significant; S: Significant Figure 1. 12% SDS-PAGE profile of serum samples of normal (N) individuals and diabetic patients (P) 92 kDa Gelatinase (MMP-9) 72 kDa Gelatinase (MMP-2)

N1 N2

P1 P2

P10 Page 58

Sudip Das et al., American International Journal of Research in Formal, Applied & Natural Sciences, 3(1), June-August, 2013, pp. 57-60

Figure 2. 12% Zymogram profile of serum samples of normal (N) individuals and diabetic patients (P). (MMP-9) (MMP-2)

P10

Figure 3. 12% Zymogram profile of serum samples of Diabetic patients (P) treated with inhibitors PMSF & EDTA. Lane 1, Control (C); Lanes 2-5, serum samples treated with PMSF; Lanes 6-10, serum samples treated with EDTA.

PMSF

EDTA

Figure 4. 12% Zymogram profile of serum samples of Diabetic patients (P) treated with HgCl 2 with different time Course from (15’, 30’, 45’, 60’, 120’). Lane 1, Control; Lanes 2-6, Serum samples treated with specified time course with HgCl2.

IV. DISCUSSION 4 5

IV. Discussion The blood glucose level of serum samples from normal and diabetic patients were compared in Table 1 both in fasting and two hrs after meals. We have also given a SDS-PAGE profile of the same samples (Fig. 1). Furthermore we have seen the gelatinase activities (Figs. 2, 3 & 4) in the serum samples of diabetic patients compared to normal healthy individuals at 92kDa and 72 kDa regions which are specifically inhibited by the metalloproteinase inhibitors EDTA (Fig. 3). From this results it may be concluded that the gelatinase activities which we have seen are nothing but of different MMPs (MMP-2 & MMP-9). When we compared the gelatinase activities (Figs. 2,3, & 4) and the different patients of sugars levels (Table-1), it has been seen that there is correlation between the MMPs level and of the blood glucose level of serum samples of diabetic patients. MMPs activities are significantly higher in the serum samples of diabetic patients rather than the non-diabetic individuals (Figs. 2,3,4). The serum levels of both MMP-9 and MMP-2 were significantly higher in subjects with type 2 diabetes, compared to controls (Figs. 2,3,4). These results show that those patients with DM-2 as the risk factor for generation as well as for cardiovascular complications (results were not shown). The MMP analysis of serum from a limited number of patients (n=10) with type-2 diabetes suggest that such analysis may be useful as markers in studies of people at risk of progression of several pathological conditions associated with diabetes. The MMP analysis of serum from a limited number of patients (n=10) with type-2 diabetes suggest that such analysis may be potentially useful as markers in studies of people at risk of progression to chronic

Page 59

Sudip Das et al., American International Journal of Research in Formal, Applied & Natural Sciences, 3(1), June-August, 2013, pp. 57-60

cardiovascular diseases and may be a viable marker of the prognosis of the several pathological conditions associated with diabetes. V. References [1]. [2]. [3].

[4]. [5]. [6]. [7]. [8]. [9]. [10]. [11]. [12].

[13]. [14]. [15].

[16].

[17].

[18].

[19]. [20]. [21]. [22].

[23].

W. B. Kannel and D. L. McGee, “Diabetes and glucose tolerance as risk factors for cardiovascular disease: the Framingham study,” Diabetes Care, vol. 241, 1979, pp. 120-126. N. B. Ruderman and C. Haudenschild, “Diabetes as an atherogenic factor,” Prog Cardiovasc Dis, vol. 26, 1984, pp. 373-412. O. Barthelemy, S. Jacqueminet, F. Rouzet, R. Isnard, A. Bouzamondo, D. Le Guludec, A. Grimaldi, J. P. Metzger, C. Le Feuvre, “Intensive cardiovascular risk factors therapy and prevalence of silent myocardial ischaemia in patients with type 2 diabetes,” Arch Cardiovasc Dis, vol. 101, 2008, pp. 539-46. A. I. Adler, “UKPDS-modelling of cardiovascular risk assessment and lifetime simulation of outcomes,” Diabet Med, vol. 25, 2008, pp. 41-46. J. L. Beaudeux, P. Giral, E. Brukert, “Matrix metalloproteinases and atherosclerosis. Therapeutic aspects,” Ann Biol Clin, vol. 61, 2003, pp. 147-158. P. K. Shah, “Plaque disruption and thrombosis. Potential role of inflammation and infection,” Cardiol Rev, vol. 1, 2000, pp.3139. S. Mun-Bryce, G. A. Rosenberg, “Matrix metalloproteinases in cerebrovascular disease,” J Cereb Blood Flow Metab, vol. 18, 1998, pp. 1163-1172. W. Wang, C.J. Schulze, W.L. Suarez-Pinzon, J.R. Dyck, G. Sawicki, R. Schulz, “Intracellular action of matrix metallo proteinase-2 accounts for acute myocardial ischemia and reperfusion injury,” Circulation, vol. 106, 2002, pp. 1543-1559. E. E. Creemers, J. P. Cleutjens, J. F. Smits, M. J. Daemen, “Matrix metalloproteinase inhibition after myocardial infarction: a new approach to prevent heart failure?,” Circ Res, vv. 89, 2001, pp. 201-210. Z. S. Galis, G. K. Sukhova, M. V. Lark, P. Libby, “Increased expression of matrix metalloproteinases and matrix degrading activity in vulnerable regions of human atherosclerotic plaques,” J Clin Invest, vol. 94, 1994, pp. 2493-2503. C. Whalting, W. McPheat, E. Hurt-Camejo, “Matrix management assigning different role of MMP-2 and MMP-9 in vascular remodeling,” Arterioscler Thomb Vasc Biol, vol. 24, 2004, pp. 10-11. H. Kai, H. Ikeda, H. Yasukawa, M. Kai, Y. Seki, F. Kuwahara, T. Ueno, K. Sugi, T. Imaizumi, “Peripheral blood levels of matrix metalloproteinase-2 and -9 are elevated in patients with acute coronary syndromes,” J Am Coll Cardiol, vol. 32, 1998, pp. 368372. A. M. Planas, S. Sole, C. Justicia, “Expression and activation of matrix metalloproteinase-2 and -9 in rat brain after focal cerebral ischeamia,” Neurobiol Dis, vol. 8, 2001, pp. 834-846. J. Montaner, J. Alvarez-Sabin, C. A. Molina, A. Anglés, S. Abilleira, J. Arenillas, J. Monasterio, “Matrix metalloproteinase expression is related to haemorrhagic transformation after cardioembolic stroke,” Stroke, vol. 32, 2001, pp. 2762-2767. V. Portik-Dobos, M. P. Anstadt, J. Hutchinson, M. Bannan, A. Ergul, “Evidence for a matrix metalloproteinases induction/activation system in arterial vasculature and decreased synthesis and activity in diabetes,” Diabetes, vol. 51, 2002, pp. 3063-3068. A. W. Chung, Y. N. Hsiang, L. A. Matzke, B. M. McManus, C. van Breemen, E. B. Okon, “Reduced expression of vascular endothelial growth factor paralleled with the increased angiostatin expression resulting from the upregulated activities of matrix metalloproteinase-2 and -9 in human type 2 diabetic arterial vasculature,” Circ Res, vol. 99, 2006, pp. 140-148. A. Inada, K. Nagai, H. Arai, J. Miyazaki, K. Nomura, H. Kanamori, S. Toyokuni, Y. Yamada, S. Bonner-Weir, G. C. Weir, A. Fukatsu, Y. Seino, “Establishment of a diabetic mouse model with progressive diabetic nephropathy,” Am J Pathol, vol. 167, 2005, pp. 327-336. S. Y. Han, Y. H. Jee, K. H. Han, Y. S. Kang, H. K. Kim, J. Y. Han, Y. S. Kim, D. R. Cha, “An imbalance between matrix metalloproteinase-2 and tissue inhibitor of matrix metalloproteinase-2 contributes to the development of early diabetic nephropathy,” Nephrol Dial Transplant, vol. 21, 2006, pp. 2406-2416. S. V. McLennan, S. K. Martell, D. K. Yue,” “Effects of mesangium glycation on matrix metalloproteinase activities possible role in diabetic nephropathy,” Diabetes, vol. 51, 2002, pp. 2612-2618. N. P. Kadoglou, S. S. Daskalopoulou, D. Perrea, C. D. Liapis, “Matrix metalloproteinases and diabetic vascular complications,”. Angiology, vol. 56, 2005, pp. 173-189. U. K. Laemmli, “Cleavage of structural proteins during the assembly of the head of bacteriophasge T4,” Nature (London), vol. 227, 1970, pp. 680-685. S. Das, A. Mandal, M. Mandal, T. Chakraborti, S. Chakraborti, “Isolation of MMP-2 from MMP-2/TIMP-2 complex: characterization of the complex and the free enzyme in pulmonary vascular smooth muscle plasma membrane,” Biochim. Biophys. Acta vol. 1674, 2004, pp. 158– 174. G. Murphy, T. E. Cawston, J.J. Reynolds, “An inhibitor of collagenase from human amniotic fluid, purification, characterization and action on metalloproteinases,” Biochem J, vv. 195, 1981, pp. 167-170.

Page 60

American International Journal of Research in Formal, Applied & Natural Sciences

Available online at http://www.iasir.net

ISSN (Print): 2328-3777, ISSN (Online): 2328-3785, ISSN (CD-ROM): 2328-3793

PHYTOCHEMICAL STUDIES ON CARDIOSPERMUM CANESCENS WALL. M.P. Shivamanjunath & K.P.Sreenath Department of Botany, Bangalore University, Jnanabharati, Bangalore, India Abstract: There is an awerness in the soceity about the use of herbal based medicine to cure ailments. So there is a demand for herbs lead to the pressure on the natural vegetation. It creates a problems on the ecosystems. A survey at Kanakapura taluk, Ramanagar district of Karnataka, an endangered plant Cardiospermum canescens WALL., is used to treate rheumatoid arthritis in addition to Cardiospermum halicacabum Linn., without knowing the difference between the two species. The phytochemical data reveals the presence of menthanamine and others, in addition to three similar phytochemicals. Keywords: Survey, Endangered herb, Phytochemicals, Kanakapura, Arthritis. I. Introduction India is one of the richest biodiversity country, having its own traditional systems of medicine like Ayurveda, Siddha, Unani and Homeopathy. In addition to that, the ethnic people at different geological areas are practicing their own system of medicine and got the knowledge from their forefathers to cure the common ailments. Nowadays all over the globe the people are very much interested to use the herbal medicines than the synthetic drugs due to their less side effects and low cost. But there is less scientific evidence about the curative properties of these natural drugs. So there is a need of scientific validation. Hence, made an attempt to know the phytochemical constituents and validate a rare herb Cardiospermum canescens Wall. The herbaceous Cardiospermum belongs to Sapindaceae and represents more than 30 species globally. The two species [1] are known to occur in India. Cardiospermum halicacabum L., is cosmopolitan in distribution, whereas Cardiospermum canescens Wall., is restricted only in some pockets of Karnataka, Tamil Nadu and Andhra Pradesh. Gamble (1918) [2] reported the occurrence of Cardiospermum canescens Wall., from Deccan region. In fact, ours is the first report from Karnataka after Gamble. The local people of Kanakapura region are banking on Cardiospermum canescens Wall., in driving out of rheumatoid arthritis. The leaf paste is used to treat the disorder. The traditional and chemical knowledge is meagre, when compared to Cardiospermum halicacabum L. [3]. II. Materials and methods Aerial portion of Cardiospermum canescens was collected from Tulasidoddi of Kanakapura and identified and authenticated with the voucher specimen at herbarium of Botany Department, Bangalore University, Bangalore. The collected biomass is dried under shade and powdered by using mortar and pestle. The coarse powder is stored in airtight container and used for physico-chemical studies. Preliminary phyto-chemical screening was undertaken following the standard procedures [4]. Further extracts are subjected to fluorescence analysis, inorganic elements are determined through Atomic Absorption Spectrophotometer (GBC932AAHallow Cathode Lamp). Their chemical constituents are determined using GC-MS instrument model GC Clarus 500, Perkin Elmer with NIST computer mass spectral library. The Capillary column was Elite-1 (5% phenyl, 95% dimethyl polysiloxane).

Page 61

M. Shivamanjunath et al., American International Journal of Research in Formal, Applied & Natural Sciences, 3(1), June-August, 2013, pp. 61-65

III. Results Table - 1. Physico Chemical Constants Sl. No

Parameters (%)

Value% w/w

Loss on drying

19.2

Total Ash content

Acid insoluble Ash

0.04

Table - 2. Extractive values Sl.No

Reagents

Value%

Ethanol

4.19

Water

3.94

Table-3.Preliminary photochemical screening of water and alcohol extracts Sl.No

Test

Water

Alcohol

Saponin

Positive

Protein

Positive

Tannin

Positive

Sterol

Positive

Terpenes

Positive

Sugar

Positive

Flavonoids

Positive

Lignin

Negative

Alkaloids

Positive

Starch

Negative

Gum

Negative

Table-4. Fluorescencece Analysis of Extract Sl.No

Extracts

Day light

UV Light

Water

Light brown

Light green

Ethanol

Dark green

Acetone

Dark green

Ethyl acetate

Dark green

Chloroform

Light brown

Page 62

M. Shivamanjunath et al., American International Journal of Research in Formal, Applied & Natural Sciences, 3(1), June-August, 2013, pp. 61-65

Benzene

Brown

Green

Hexane

Green

Petroleum ether

Light green

Red

Table-5.AAS Analysis for different elements

Macro Nutrients

Micro Nutrients

Heavy Metals ( in ppm)

( in ppm) Nitrogen %

Phosphorou s%

Potas h%

Iron

Manganes e

Zinc

Copper

Chromiu m

Lea d

Cadmium

3.43

0.26

1.36

371.6 5

63.85

45.05

97.0

2.5

Fig-1.Chromatogram

Table-6.Chemical constituents of selected drugs detected through GCMS analysis

Sl.No 01

Retention time 3.17

Scan Methanamine

Area% 8.67

02 03 04

3.71 3.96 19.67

0.94 0.45 1.19

05 06 07 08 09

19.80 19.88 20.03 20.10 20.24

20.39

Dextroamphetamine Acetic acid, hydroxy-,methyl ester Acetic acid,10,11-dihydroxy-3,7,11-trimethyl dodeca-2,6-dienyl ester 2-Octen-1-ol,3,7-dimethyl-, isobutyrate, (z) Butanoic acid; 4-butoxy 7-Methyl-z-tetradecen-1-ol acetate 1-Heptatriacotanol 3-(1-Methylhept-1-enyl)-5-methyl-2,5-dihydrofuran2-one 1-Benzoxirel-3-ol,2,2,5a-trimethyl-la-[2-(2-methyl)1,3-dioxolan-2-yl-l-ethenyl] Perhydro

1.42 1.53 0.65 0.93 1.90 1.04

Page 63

M. Shivamanjunath et al., American International Journal of Research in Formal, Applied & Natural Sciences, 3(1), June-August, 2013, pp. 61-65

20.53

20.60

20.72

14 15 16 17 18

20.82 20.95 21.04 21.32 21.98

19 20 21 22 23

22.53 22.61 22.85 23.1 0 23.50

24 25 26 27 28 29 30

23.65 24.19 26.06 26.34 26.43 26.70 28.34

31 32 33 34 35

29.03 29.25 34.66 37.65 37.73

1,6,6-Trimethyl-7-(3-oxobut-1-enyl)-3,8dioxatricyclo[5.1.0.0(2,4)]octan-5-one 2-Myristynoyl pantetheine

0.75

5,6,6-Ttrimethyl -5-(3-oxobut-l-enyl)-1oxaspiro[2,5]octan-4-one Hexadecanal Pentadecanoic acid,14-methyl-,methyl ester 1-Dodecanol, 3,7,11-trimethyl4-(2,4-Dimethylcyclohex-3-enyl)but-3-en-2-one 5,5,8a-Trimethyl-3,5,6,7,8,8a-hexahydro-2Hchromene 3,7,11,15-Tetramethyl-2-hexadecen-1-o1 2-Pentadecanone,6,10,14-trimethyl3,7,11,15-Tetramethyl-2-hexadecen-1-o1 3,7,11,15-Tetramethyl-2-hexadecen-1-o1 6-(3-Hydroxy-but-1-enyl)-1,5,5-trimethyl-7oxabicyclo[4.1.0]heptan-2-ol Hexadecanoic acid, Methyl ester n-Hexadecanoic acid Phytol 9,12-Octadecadienoic acid(z,z) Oleic acid Octadecanoic acid 1-Oxaspiro[2,5]octane, 5,5-dimethyl-4-(3-methyl1,3-butadienyl)4,8,12,16-tetramethylheptadecan-4-olide 1,2-Benzenedicarboxylic acid,diisooctyl ester Cholesta-4,6-dien-3-ol,(3β)Astaxanthin L-Asparagine,Nτ-[2-(acetylamino)-4-O-[2(acetylamino)-2-deoxy-3,4,6-tri-O-(trimethylsilyl)-βD-glucopyranosyl]-2-deoxy-3,6-bis-O(trimethylsilyl)-β-D-glucopyranosyl]

0.93

0.87

2.18 1.10 1.87 0.53 2.66 1.31 7.77 1.47 1.14 0.70 1.31 7.77 0.98 0.83 3.20 1.47 0.65 0.44 1.25 1.66 0.41 0.46

IV. Discussion and Conclusion Cardiospermum canescens Wall., an herbal drug used by local people of Kanakapura region as a traditional medicine was studied for its phytochemical constituents. The chemical standard reveals loss on drying 19.2%, total ash 4 %, acid soluble ash 0.04%. Extractive values for Ethanol l4.19 % and for Water 3.94%. Preliminary phytochemical studies revealed the presence of Saponin, tannin, Sterol, Terpenes, Flavonoids, Saponins, and Alkaloids. GC-MS analysis revealed presence of 33 compounds, out of that Methanamine, n-Hexadeconoic acid, Oleic acid, 5, 5, 8a- trimethyl-3,5,6,8,8a-hexahydro-2H-Chromene and Hexadecanal shows 8.8%, 7.8%, 3.2%, 2.7% and 2.2% area respectively. Atomic absorption spectroscopy revealed the presence of various elements such as Nitrogen, Phosphorous, Potash, Iron, Manganese, Zinc, Copper and Lead. The chemical constituents determined in the present work add to the pharmacopeia of the traditional drug sources. Our studies can help to the modern society to use this drug in addition to another species Cardiospermum halicacabum. Since, it is a rare in Karnataka. A chemical standard helps in checking the adulterants and substitutes of this drug. This directly helps to checking the quality of herbal drug for the betterment of modern society. The phytochemical studies of Cardiospermum canescens revealed the presence of Phytol, Hexadecanoic acid and 3,7,11,15-Tetramethyl-2-hexadecen-1-o1as exclusive compound in contrast to Cardiospermum halicacabum [5] and therefore this plant, if multiplied through tissue culture studies may serve as a substitute to Cardiospermum halicacabum.

Page 64

M. Shivamanjunath et al., American International Journal of Research in Formal, Applied & Natural Sciences, 3(1), June-August, 2013, pp. 61-65

Acknowledgement The senior author is thankful to Dr. K. P. Sreenath for his valuable guidance. I also express my gratitude to all the Faculties, Department of Botany, Bangalore University and Sri Sri College of Ayurvedic Science and Research, Bangalore, M/S Shiva Analytical Laboratory, Bangalore and Bio-Centre, Department of Horticulture, Government of Karnataka, Bangalore.

Reference [1]

CSIR, The Wealth of India, A Dictionary of Indian Raw Materials and Industrial Products. Revised Edition 1992, Vol.3: Ca-Ci, pp-269- 271.

[2]

J .S. Gamble, Flora of The Presidency of Madras, Vol. I. 1918, PP 244-245.

[3]

P. S. Varier, Indian Medicinal Plants, A Compendium of 500 Species, Orient Longman Private Ltd, 1994, Chennai. Vol. I. pp 377-379.

[4]

C. K, Kokate, A. P, Purohit and S. B. Gokhale, Pharmacognosy, Nirali

[5]

K.Sughuna and P. Brinda, Chemical Standardization Studies on Cardiospermum halicacabum Linn. Int. J. of Pharmaceutical

Prakashan, Pune. 33rd ed., 2005, pp 593-597.

Research and Development 2011; Vol 3(7): September 2011(176-186).

Page 65

American International Journal of Research in Formal, Applied & Natural Sciences

Available online at http://www.iasir.net

Antimicrobial activity of herbal treated wool fabric Hooda S. * , Khambra K. ** ,Yadav N. ** and Sikka V. K. *** *BPS Institute of Higher Learning, Khanpur Kalan (Sonepat) ** Deptt. of Textile and Apparel Designing , I.C. College of Home Sciences, *** Deptt. of Biotechnology , College of Basic sciences and Humanities, CCS Haryana Agricultural University Hisar â&#x20AC;&#x201C; 125004 (India) ABSTRACT: Aloe vera, a naturally available herb which is now increasingly being used as a functional finish on textile substrate to impart antimicrobial characteristics. Aloe vera extract was applied on wool fabric by pad-dry-cure method. Finish was applied in two concentrations (3g/l and 5g/l) on grey as well as enzymatically scoured wool fabric. Weight add-on percent of extract on treated wool fabric was determined. The antibacterial activity of the finish was accessed quantitative by AATTC- 100 test method in terms of bacterial reduction. Effectiveness of finish was accessed after 5, 10, 15 and 20 washing cycles. The results indicated that weight add-on percent was increased as the concentration of extract increased. Aloe vera treated wool fabric showed 82.81% bacterial reduction even after 20 washing cycles. Aloe vera treated scoured wool fabric showed very good antibacterial activity than Aloe vera treated grey wool fabric. KEYWORDS: Aloe vera, Enzymatic scouring, Antimicrobial, Efficacy and Finish

I. INTRODUCTION Textile materials are good carriers of various types of microorganisms and can cause health related problems to the wearer. Application of natural antimicrobial agents on textiles dates back to antiquity, when the ancient Egyptians used spices and herbs to preserve mummy wraps. Herbs were used to inhibit the growth of bacteria on textiles (Ammayappan and Jeyakodi Moses 2009). In order to protect the wearer from infection, textile fabrics can be finished with herbal antimicrobial agents. Herbal antimicrobial finish is one of the special finishes which can be applied to the textile material in order to protect the skin of the wearer and the textile substrate itself. Wool is a natural fiber which contain natural pigments, waxes, pectin and protein (Keratin) that provide moisture, nutrients, oxygen and temperature for bacterial growth and multiplication (Ramachandran, et al. 2004). The wool fibre surface is covered by a covalently-bonded fatty layer, being responsible for the hydrophobicity of wool. Protease which can catalyse the degradation of different component of wool fibre is the most common enzyme used for wool fabrics. Pre-treatment of wool fabric with enzyme leads to increase in hydrophilicity nature of the wool fibre and increased swelling in nature (Julia et al.1998). Aloe vera (Aloe barbadensis, Miller) belongs to the family Liliaceae and is known as "Lily of the Desert". The activity of Aloe vera inner gel against both Gram-positive and Gram-negative bacteria has been demonstrated by several different methods (Habeeb et al., 2007). Antibacterial and antifungal properties of Aloe vera can be exploited in applications for medical textiles such as bandages, sutures, bioactive textiles, etc. (Joshi et al., 2010). Based on the literature review, it was decided to apply the methanolic Aloe vera extract on wool fabric by pad-dry-cure method in two concentrations for assessment of antimicrobial activity. II.

MATERIALS AND METHODS

Pure wool fabric with plain weave (60 EPI and 58 PPI) and fabric weight 260 g /m2 was used for antimicrobial finishing. Methanolic Aloe vera extraction was carried out by Maceration method (Mukherjee 2002). To improve the exhaustion rate of extract, enzymatic treatment on wool fabric was given. Protease enzymatic scouring was carried out by following the optimized standard conditions (Kholiya et al., 2007). Herbal antimicrobial finish was applied on wool fabric with methanolic Aloe vera leaf extract. Finish was applied on fabric by pad-dry-cure method. Initially, the samples were immersed in bath containing Aloe vera extract for thirty minutes. After this samples were taken out and padded on a two-bowl pneumatic padding mangle at a pressure of 2.5 psi with two dips and nips to give a wet pick up of its maximum take up. The samples were dried at 80oC for 3 minutes and cured at 120oC for 2 minutes on a laboratory model curing chamber. A post treatment was given with citric acid (fixing agent) at room temperature. The samples were

Page 66

Hooda S. et al., American International Journal of Research in Formal, Applied & Natural Sciences, 3(1), June-August, 2013, pp. 66-69

then again padded on a two-bowl pneumatic padding mangle at a pressure of 2.5 psi, dried at 80 °C and cured at 120 °C. Absorption rate of Aloe vera extract by the fabric was estimated by measuring the change in dry weights of the samples before and after the treatment. Add-on (%) = [(W2−W1)/W1] ×100 Where W1 : weight of fabric before treatment (g) W2 : weight of fabric after treatment (g) The microbial population (total colony forming units) of controlled and finished samples was determined quantitatively using AATCC-100 test method. Sample size taken for determination of bacterial population was 2”×2” .To access the bacterial count of samples, serial dilution (10 -1, 10-2 and 10-3) was carried out and percent reduction was calculated. The durability of the treated wool fabric against repeated launderings was evaluated by washing all finished samples in the ‘Launder-o-meter’ by using standard ISO: 6330-1984E. The fabric samples were then subjected to bacterial testing and the bacterial growth was again analyzed. III.

RESULTS AND DISCUSSION

Table 1. Weight add-on percent of Aloe vera extract on wool fabric Application Method

Pad-dry-cure method

3 5 3.70

C.D. NS

Weight/unit area of wool (g/m2)

Conc. (g/l)

Aloe vera treated grey fabric (AS2) g/m2 Add-on percent 272.00 4.35 278.66 6.88

Aloe vera treated scoured fabric (AS3) g/m2 Add-on percent 270.65 4.63 276.78 7.00 5.57

At 5.0 % level of significance * Control grey sample = 260.66 (g/m2), Control scoured sample = 258.65 (g/m2) It is evident from the results obtained from table 1 when Aloe vera application was given with pad-drycure method on grey wool fabric, then add on weight was 4.35 % with 3g/l which increased to 6.88 % with 5g/l concentration. But add on weight was attained 4.63 % when Aloe vera extract was applied on enzymatically scoured wool fabric with 3g/l concentration which increased to 7.00 % when the application was given with 5g/l concentration. It can be concluded from the data that as the concentration increased, add on percent also increased. This may be due to the reason that more amount of extract was attached in more concentrated solution. These findings are in accordance with Purwar (2005), reported that weight add-on percent increases with increase in concentration of neem bark extract. Add on percent was also increased when treatment was given on enzymatically scoured fabric as compared to grey fabric. The results are supported by Feldtman and Mcphee (1964) reported that enzymes increase the absorbency of wool fiber. Ammayappan and Jeyakodi Moses (2009) also reported that enzyme treatment improves the finish add-on (%). Table. 2

Bacterial reduction of Aloe vera treated grey and scoured wool fabric by quantitative method:

Application method Dilutions

Conc. (g/l)

Pad-dry-cure

3 5

Control (S1)

10-2 118 100

Bacterial reduction in Aloe vera treated wool fabric Aloe vera treated grey sample (AS2) Aloe vera treated scoured sample (AS3) 10-3 10-4 Mean 10-2 10-3 10-4 Mean Percent Percent 2 (10 ) (101) reduction reduction 16 3 15.93 21 Nil Nil 7.0 86.50 96.67 19 1 10 13 Nil Nil 4.3 90.00 96.70 Confluent lawn of growth

Table 2 shows that wool fabric treated Aloe vera extract was found to have good resistance to bacterial attack. It was observed that there was confluent lawn of growth in control sample. Percentage reduction was 86.50 % with 3g/l which increased to 90.00 % with 5g/l Aloe vera extract, when treatment was given by paddry-cure method. On the other hand, when Aloe vera extract was applied on enzymatically scoured wool fabric by the same method, the percentage reduction value increased in both concentrations (96.67% and 96.70%), as compared to the Aloe vera treated grey wool samples. From the above observations, it can be concluded that Aloe vera treated scoured wool fabric samples showed very good percentage of bacterial reduction as compared to Aloe vera treated grey wool samples. It may be due to reason that enzymatic scouring remove the natural impurities and increase the absorption rate of antimicrobial agent. Ammayappan and Jeyakodi Moses (2007) supported the findings that pre-treated wool fibre with formic acid prior to Aloe vera and turmeric application shows better antimicrobial activity as compared to untreated wool (without pre-treatment).

Page 67

Hooda S. et al., American International Journal of Research in Formal, Applied & Natural Sciences, 3(1), June-August, 2013, pp. 66-69

Table. 3 Efficacy of Aloe vera finish on wool fabric by pad-dry-cure method Treatments Dilutions Washing cycles 0 5 10 15 20 Control (S1)

10-2 (conc.) (g/l) 3 5 3 5 3 5 3 5 3 5

118 100 118 100 118 100 138 110 142 113

Aloe vera treated grey sample 10-3 10-4 Mean (102)

16 19 16 19 16 19 23 20 29 27

3 1 3 1 3 1 3 1 5 2

15.93 10 15.93 10 15.93 10 22.26 13.66 66.6 54.3

(AS2) Percent reduction

10-2

21 86.50 13 90.00 21 86.50 13 90.00 21 86.50 13 90.00 24 83.87 16 87.58 30 77.78 23 76.38 Confluent lawn of growth

Aloe vera treated scoured sample 10-3 10-4 Mean (101)

Nil Nil Nil Nil Nil Nil Nil Nil 7 4

Nil Nil Nil Nil Nil Nil Nil Nil 1 1

7.0 4.3 7.0 4.3 7.0 4.3 8.0 5.3 31.06 19.43

(AS3) Percent reduction

96.67 96.70 96.67 96.70 96.67 96.70 96.67 96.69 78.13 82.81

Effectiveness of Aloe vera treated wool fabric was assessed after different number of washing cycles and presented in table 3. When grey wool fabric treated with 3g/l and 5g/l concentration of Aloe vera extract, percentage bacterial reduction was found 86.50 and 90.00 % respectively. Percentage reduction value for Aloe vera treated grey wool fabric remained same up to 10 washing cycles. On 15 washing cycles, percentage bacterial reduction decreased and observed 83.87 % with 3g/l Aloe vera extract which increased to 87.58 % with 5g/l Aloe vera treated sample. At the end of 20 washing cycles, percentage bacterial reduction value reached to 77.78 % with 3g/l and 76.38 % with 5g/l Aloe vera treated grey wool fabric. It was further indicated that when the Aloe vera treatment was given to enzymatically scoured wool fabric exceptionally good resistance to bacteria was found. When scoured wool fabric treated with 3g/l and 5g/l Aloe vera extract, percentage bacterial reduction was 96.67 % and 96.70% respectively. Efficacy of Aloe vera finish on scoured wool fabric was assessed after different number of washing cycles and found that treated samples have good resistance to bacterial attack up to 20 washing cycles. On 20 washing cycles, percentage reduction value slightly decreased but still it was very good and observed 78.13% and 82.81 % for scoured wool fabric treated with 3g/l and 5g/l Aloe vera extracts respectively. It can be concluded from the data presented in table 3 that very good wash durability of finish was observed even after 20 washing cycles. These findings are in accordance with the results reported by Ammayappan and Jeyakodi Moses (2009) that there were no bacterial and fungal growth in the finished fibrous substrates up to 20 washings and after 25 washings two bacterial and two fungal colonies were observed in wool/ rabbit hair substrate. Regarding the concentration of extract, as the concentration increases percentage bacterial reduction was also increased for Aloe vera treated grey wool sample, whereas in Aloe vera treated scoured wool fabric concentration did not affect the percentage bacterial reduction value up to 15 washing cycles. After 20 washing cycles % bacterial reduction increased as the concentration increased. IV.

Conclusion

The application of Aloe vera on scoured wool fabric showed very good antimicrobial activity than Aloe vera treated grey wool fabric. As the concentration of extract increased, weight add on percent also increased. Herbal antimicrobial agent used that is Aloe vera has been found effective against bacterial growth on wool fabric. Aloe vera finishing on pre-treated wool fabric was durable up to 20 washing cycles. Aloe vera extract is eco-friendly and give good effect to human skin in addition to value on wool fabric. REFERENCES 1. 2. 3. 4. 5. 6. 7.

Ammayappan, L. and Jeyakodi Moses, J. 2009. Study of Antimicrobial activity of Aloe vera, chitosan, and curcumin on Cotton, Wool, and Rabbit Hair Journal of Fibers and Polymers. 10(2): 161-166. Feldtman,H.D., Mcphee,J.R. 1964. Treatment of wool with a water-soluble polyamide-epichlorhydrin resin. Textile research journal, 34 (11): 925-932. Habeeb, F., Shakir, E., Bradbury, F., Cameron, P., Taravati, M.R., Drummond, A.J., Gray, A.I. and Ferro, V.A. 2007. Screening methods used to determine the anti-microbial properties of Aloe vera inner gel. Methods. 42(4): 315-320. Joshi, M., Purwar, R., Ali, S. and Rajendran, S. 2010. Antimicrobial textiles for health and hygiene- application based on ecofriendly natural products. Medical and health care textiles, Woodhead publishing Limited, Cambridge. 84-92. Julia,M.R.,Cot,M.,Erra,P. and Jocic,D. 1998. The use of chitosan on hydrogen peroxide pretreated wool. Textile Chemist and Colorist. 30:78-83. Kholiya, R., Khambra, K. and Yadav, N. 2007. Scouring of woollen fabric using enzymes. Proceedings of national conference on advances in chemicals for textile polymer â&#x20AC;&#x201C; application and quality assurance held at Coimbatore. pp.109-114. Mukherjee, P.K. 2002. Quality control of herbal drugs. Pharmaceutical publishers, India. pp 398-400, 405-406.

Page 68

Hooda S. et al., American International Journal of Research in Formal, Applied & Natural Sciences, 3(1), June-August, 2013, pp. 66-69

8. 9.

Purwar, R. 2005. Study on antimicrobial finishing of cotton textiles using neem extract. Unpublished theses submitted to Indian Institute of Technology, Delhi Ramachandran, T.K., Rajendrakumar, R., Rajendran. 2004. Antimicrobial textiles-an overview. India Journal Textile 84(2): 42â&#x20AC;&#x201C;47

Page 69

American International Journal of Research in Formal, Applied & Natural Sciences

Available online at http://www.iasir.net

Relating Interactions of Water Soluble Xanthene Dye Molecules with Surfactant to Adsorption Kinetic data: A Spectroscopic Study Jayasree Nath1,S.A.Hussian2, A. Pal3, S. Deb4,R. K. Nath1*, I. Ghosh1! Department of Chemistry, Tripura University, Suryamaninagar-799130, Tripura, India 2 Department of Physics, Tripura University, Suryamaninagar-799130, Tripura, India. 3 School of Chemistry, Sambalpur University, Jyoti Vihar-768019, Orissa, India. 4 Department of Physics, Iswar Chandra Vidyasagar College, Belonia,799155, Tripura,India. 1, 1*, 1!

Abstract: Interaction ofwater soluble cationic surfactant dodecyl trimethyl ammonium bromide (DTAB) with anionic stearic acid (SA) in presence of a highly fluorescent dye eosin Y (EY) at the air-water interface has been studied. Adsorption kinetics of the complex formation on the water surface shows that, the rate of reaction depends upon DTAB concentration. The stable monolayer formation is mainly occurred due to the electrostatic interaction between SA and DTAB followed by the SA-DTAB-EY complex formation. FTIR study supports this interaction. The resulting complex films are transferred onto quartz substrate at a particular surface pressure to form LB films. UV-Vis absorption and fluorescence spectroscopic studies of complex LB films indicated the interaction of EY dye with DTAB and SA complex and closer association of dye molecules resulting to the formation of aggregates in the LB films. Scanning electron micrograph certainly confirms the formation of aggregates of EY in the complex LB films. Keywords: EY; DTAB; air-water interface; surface pressure-time isotherms; complex LB Films. I. Introduction Photoactive dye molecular assemblies have an important role for the development of functional devices such as solid state dye lasers, chemical sensors and optical storage devices[1]-[4]. Among various techniques of producing organized molecular assemblies, Langmuir-Blodgett (LB) method is one of the most versatile techniques of making well ordered ultrathin films, which are preferred for many applications and permits the control of the twodimensional structure of these films at the molecular level along with ease of multilayer deposition [5]. The advantage of LB films over thin films obtained by using other conventional techniques is that the molecular architecture may be controlled precisely by monitoring certain parameters carefully such as pH of the subphase, barrier speed, dipping speed, molar composition, temperature and surface pressure of deposition of LB film. LB filmâ&#x20AC;&#x2122;s immobilizing functional groups have great advantages for the practical applications such as optical biosensor [6] and molecular electronic device [7]. Although amphiphilic dye molecules and many polyaromatic hydrocarbon derivatives have been extensively investigated in terms of spectroscopic properties, comparatively little effort has been made to study water soluble dye molecules assembled in LB films. Recently, a great deal of attention has been devoted to the LB films containing dye molecules owing to their usefulness in the field of sensors and optical devices [8]. Aggregation of some dye molecules into the restricted geometry of LB films have been reported by Bauman [9]-[10]. Recently, we have studied the incorporation of two anionic dyes namely, chicago sky blue [11] and erythrosin B [12] within the Langmuir monolayer and LB films of cationic octadecylamine. Xanthene dyes are one of the most important classes of pigments used in dye lasers and in various photosensitized reactions. For their outstanding photophysical properties, xanthene dyes are very efficient laser dyes [13]. Eosin Y, an important xanthene dye is widely used for the light-induced electron injection from molecular dyes into semiconductor nanoparticles which is the base of numerous technical applications, such as silver photography [14], xerography [15] and molecular photovoltaics [16]. EY is examined as sensitizers for colloidal CdSnano particles [17] and also as an alternative in the field of dye-sensitized solar cells [18].Despite such interesting properties, anionic EY films have never been studied in the restricted geometry of LB films. This is the first report on the interaction of EY andDTAB mixed with SA and formcomplex in the Langmuir and Langmuir-Blodgett films. This study was undertaken in order to reveal the adsorption behavior and organization of EY on the complex monolayer film at the air-water interface. Here, SA-DTAB-EY interaction was studied at the air-water interface by measuring

Page 70

Nathet al., American International Journal of Research in Formal, Applied & Natural Sciences, 3(1), June-August, 2013, pp. 70-77

the surface pressure (π) versus time (t) isotherms. Spectral properties of complex SA-DTAB-EY LB films have been compared with that in aqueous solution and microcrystal film using absorption and emission spectroscopic data. Moreover, surface morphology of the complex LB films deposited onto quartz slide was successfully studied by SEM. II. Experimental The molecular structures of SA, DTAB and EY are given in figure 1. These chemicals were purchased from Aldrich Chemical Company (U.S.A.) and used as received. Teflon-bar-barrier type LB trough (model 2007DC, Apex Instruments Co., India) was used for the preparation, characterization and deposition of mono and multi-layer films. The subphase used throughout this study was triple distilled water, deionized with a Milli-Q water purification system from Millipore (U.S.A.). The monolayer studies were conducted with distilled water. The resistivity of the water was 18.2 M -cm. All the measurements were performed at room temperature (24oC). 200µl of stearic acid (SA) having concentration (0.5mg/ml) in chloroformwas spread to prepare a Langmuir monolayer on the air water interface. And then about 15 minute was delayed to evaporate the solvent. After that the barrier was compressed slowly to reach the expected initial surface pressure. When the desired surface pressure of SA monolayer was reached. The barrier was kept fixed and then dilute aqueous solution of DTAB having different concentration mixed with EY were slowly injected to the back side of the barrier by a microsyringe. After that the corresponding increase in surface pressure versus time was recorded. In an work Kawaguchi et al. [18] showed the adsorption of poly (NIPAM ), on the pentadecanoic acid (PDA). We have chosen the almost similar process. With the help of this process we can avoid the possibility of mixing of subphaseas well as the disturbance of monolayer stability. When the water solubleDTAB-EY poly ions come into contact with the preformed monolayer of SA within the barrier the reaction kinetics started and it is observed that the surface pressure increases with the passage of time. After a certain time gap, depending on the amount and concentration of DTAB-EY premixed solution, the surface pressure becomes stable. The flat plateau like region observed in the surface pressure-time curve, indicates the completion of adsorption process. UV-Vis absorption and emission spectra of EY solution in quartz cell, microcrystal and SA-DTAB-EY complex LB film on quartz slide were recorded by a Perkin Elmer Lamda 25 spectrophotometer and Shimadzu RF-5000 spectrofluorophotometer respectively. For FTIR measurement the complex film was transferred onto a silicon substrate after completion of the reaction kinatics. Surface morphology of the LB film was studied by a Hitachi (Japan) scanning electron microscope (Model S-415A). III. Results and Discussion A. Formation of EY-DTAB-SA complex monolayer at the air –water interface Amphiphilic stearic acid (SA) having a long hydrophobic tail and a hydrophilic head group forms a stable Langmuir monolayer at the air-water interface. Fe-stearate, Mg-stearate is also well known LB compatible material. As stearic acid has carboxylic acid (-COOH) group, it has an excellent capacity to interact electrostatically with a cationic substance. In our investigation the water soluble anionic Xanthene dye EY molecules doped with cationic surfactant DTAB molecules are used. The preformed DTAB-EY complex molecules are adsorbed electrostatically to the preformed monolayer of anionic SA molecules. At first200µl of 0.5mg/ml of SA in chloroform was spread at the air water interface of the LB trough, then 15 minute is allowed to evaporate the chloroform, after that the barrier was compressed slowly with a speed of 2×10-3nm2 mol-1S-1 to form SA monolayer at an expected surface pressure then keep the barrier fixed. Water soluble EY (500 µl) having concentration 1×10-4M is used to form complex with the different concentration of cationic surfactant DTAB(havingconcentration0.1×10-5M, 0.5×10-5M,0.75×10-5M, 0.9×10-5M and 1×10-4M). And then 1500 µl of preformed EY-DTAB complex molecules are injected from the back side of the barrier of the LB trough so as not to disturbed the preformed monolayer of SA. Being water soluble DTAB-EY complex molecules started crossing the barrier through the subphase. When EY-DTAB complex molecules come in contact with the SA molecules, interaction start between the anionic SA molecules and form a complex SA-DTABEY at the air-water interface. As the time passed the number of complex at the air-water interface increased. It is observed that, area per molecule of this complex species was greater than the area per molecule of pure SA molecules. The increase in surface pressure (π) versus time (t)was recorded to have the π-t curve. Surface pressure measurement was using Wilhelmy plate arrangement into the LB trough described elsewhere[19]. Finally the monolayer was converted into SA-DTAB-EY complex monolayer, which is shown in the schematic diagram (figure 2).

Page 71

Nathet al., American International Journal of Research in Formal, Applied & Natural Sciences, 3(1), June-August, 2013, pp. 70-77

Reaction kinetics is indicated by the increase in surface pressure with the passage of time. Figure 3showed the π-t curves for injection of preformed complex DTAB-EY solution, where EY (500 µl) having fixed concentration (1×10-4M) mixed with 1500 µl of DTAB having concentration 0.1×10-5M, 0.5×10-5M, 0.75×10-5M, 0.9×10-5M and 1×10-4M respectively. In all the cases amount and concentration of SA is fixed and it is 200 µl and 0.5mg/ml. The pressure of pure SA monolayers on air-water subphase does not increase with the passage of time and it is also observed that it remain parallel to the time axis. It indicates that SA forms a stable monolayer at the air-water interface. When the complex DTAB-EY is injected from the backside of the barrier it is observed that surfacepressure (π) is increases. This clearly indicates that there must be some interactions are going on between the complex and SA to form another complex molecule. Surface pressure is reached to its maximum value after the past of certain time interval and become form a plateau like region. This is an indication for the completion of the reaction kinetics. When1×10-4M DTAB doped with EY complex is used, it is observed that pressure rose up to 22mN/m for1.0×10-5M within a span of time almost 6 hrs, where as surface pressure rose up to 21mN/m for 0.9×10-5M, the pressure is 18mN/m for 0.75×10-5M DTAB, 15mN/m for 0.5×10-5M DTABand 13mN/m for 0.1×10-5M DTAB. That is with the increasing concentration of DTAB surface pressure raises which indicates the more interaction takes place with the SA molecules at higher concentration. From the π-t graph, it is observed initially that, the reaction kinetics is higher but when time is passed the reaction takes place slowly and become flat at the end. That is initially reaction kinetics is faster and after a definite time it is lowering the rate of interaction. It is too important to mention in this context that there are several work viz.poly (NIPAM)[18], lysozyme[20] etc. which showed such initial steep raising and flat plateau like region at the end of the reaction kinetics. In our previous work [19] the reaction kinetics of pure CTAB with SA monolayer were reported. B. Spectroscopic characterizations of complex LB Films of EY 1. FTIR study of pure SA, DTAB-EY and SA-DTAB-EY mixtures In FTIR spectrum (figure 4) of SA shows two strong peaks at 2851 and 2921 cm-1 which are due to the CH2 symmetric and anti symmetric stretching vibrationof the long hydro carbon chain of SA molecule [21].As can be seen from the figure 4, the carboxylic group (C=O) in pure SA appears at about 1702 cm-1. This peak is absent both in DTAB-EY and SA-DTAB-EY mixed film. Another interesting feature is that in IR spectrum of DTAB-EY two carbonyl stretching frequency is observed. The absorption peak at 1731 cm-1 is for carbonyl group of carboxylic acid, and another asymmetric stretch for the resonating carbonyl group of EY (1626 cm-1) which is alsototally absent in the SA-DTAB-EY mixed film. This is mainly due to the attachment of heavy chromophore EY in the mixed film. These characteristics indicate the interaction between DTAB-EY and SA-DTAB-EY, which are responsible for the formation of water insoluble complex monolayer at the air-water interface. 2. UV-Vis and steady state fluorescence spectroscopic studies of complex LB films Figure 5 shows the UV-Vis absorption spectra of SA-DTAB-EY complex film at different concentration of DTAB with EY aqueous solution and microcrystal spectra for comparison. For spectral study, 10 layers of LB film were deposited into spectral grade quartz slide at 15 control pressure. UV-Vis absorption spectra of EY in dilute aqueous solution (10-5M) at pH4.1 shows an intense band with peak at 518nm along with a shoulder at 485 nm in 450-650 nm spectral range. The longer wavelength peak is due to 0-0 band and shorter wavelength shoulder due to 0-1 vibronic transition of monomer[22]. In microcrystal absorption spectrum these two bands are red shifted to 530nm and 503 nm respectively. Whereas for complex film the monomeric band is again red shifted at 540 nm and the shoulder is almost absent. And with the increasing concentration of DTAB (0.1 × 10-5 M, 0.5× 10-5 M , 0.75×10-5 and 0.9 × 10-5 M) the monomeric band is red shifted with negligible wavelength (about 2 nm for each concentration).

Page 72

Nathet al., American International Journal of Research in Formal, Applied & Natural Sciences, 3(1), June-August, 2013, pp. 70-77

The observed bathchromic shift and overall broadening in the LB films and microcrystalabsorption spectra may be due to change in microenvironment when the molecules are transferred from aqueous solution to restricted geometry of solid surface and broadening may seems to be due to formation of some kind of aggregation. The absorption spectra of complex LB film at higher concentration of DTAB may be due to some molecular level interaction occurring between the DTAB and EY molecules in the LB films.Wohnrathet. al [23] suggests the same type of molecular level interactions for ruthenium complexes. Emission spectrums of EY solution, microcrystal and LB film have been compared. It is observed that EY has strong band in the 500-650 nm region (Figure 6) shows a single peak at 542 nm (excitation wavelength was 510 nm). An intense band around 582 nm is observed for microcrystal spectrum. The emission spectrum shows a band at 565 nm in a ten-layered complex DTAB-SA-EY LB film. This large red shift of the emission band with respect to solution of EY due to the formation of DTAB-EY complex. And this red shift of the emission band in comparison to the solution spectrum exhibits a specific orientation and closer association of dye molecules in the LB films. C. Surface Morphology of complex LB film of EY To confirm the presence of aggregates in the complex DTAB-EY-SA film, we have employed a traditional imaging method, namely, scanning electron micrograph (SEM). Figure 6 shows a scanning electron micrograph of EY doped complex LB film. The SEM picture reveals a clear heterogeneous morphology. The homogenous dark background is due to of SA forming larger region compared to DTAB-EY complex.The aggregates with sharp and distinct edge corresponds to the three dimensional aggregates of dye in the LB film. The formation of distinct crystalline domains of EY, as evidenced from the SEM, provides compelling visual evidence of aggregation of dye molecules in the LB films. Our SEM study on LB films seems to be well justified by spectroscopic study. IV. Conclusion In this paper, we have demonstrated the interaction of water soluble DTAB-EYis successfully adsorbed in the building matrix SA in the preformed Langmuir monolayer at the air water interface. The reaction kinetics of SADTAB-EY complex formation was observing by the increase in surface pressure with the passage of time graph. From platue like region of the graph it was clearly indicates the completion of the reaction kinetics. Time required for the completion of the reaction increases with the increasing concentration of DTAB-EY mixture. And also observed that for higher concentration of DTAB-EY mixture the surface pressure increases. These studies revealed that strong electrostatic interaction between DTAB-EY complex and SA molecules occurred at the air-water interface, as evidenced by the increase in surface pressure with time. So it is clear in this study that completion of reaction is totally depending on the concentration of DTAB solution. The UV-Vis adsorption and steady state fluorescence spectroscopic studies demonstrate that SA-DTAB-EY complex films are incorporated in to the LB films and form a molecular aggregate in the solid film. SEM study supports this observation. Overall conclusion of our work is that water soluble substance can also form a LB film i.e.a long chain fatty acid corporation makes the water soluble substance LB compatible which is a prerequisite for device applications using LB technique. Acknowledgement We thank Dr. A.K. Panda,North Bengal University, West Bengal for his valuable suggestions. References 1] V. MartínezMartínez,F. LópezArbeloa,J. BañuelosPrieto,T. ArbeloaLópez, andI. LópezArbeloa “Characterization of Supported Solid Thin Films of Laponite Clay. Intercalation of Rhodamine 6G Laser Dye” Langmuir, vol.20, June2004, pp. 5709-5717, doi:10.1021/la049675w. 2] V. Martinez Martinez, F. Lopez Arbeloa, J.BanuelosPrieto, F. Lopez Arbeloa, “Characterization of Rhodamine 6G Aggregates Intercalated in Solid Thin Films of Laponite Clay. 2 Fluorescence Spectroscopy” (2005) J. Phys. Chem. B., vol. 109 (15),March2005, pp. 7443– 7450,doi:10.1021/jp050440i .3] R.Sasai, H.Itoh, I.Shindachi, T.Shichi,K. Takagi,“Photochromism of Clay−Diarylethene Hybrid Materials in Optically Transparent Gelatin Films”, Chem. Mater., vol.13 (6), June 2001, pp. 2012–2016, doi:10.1021/cm000822v 4] K. Inglot, A. Kaleta, T. Martyński, D. Bauman, “Molecular aggregation in Langmuir–Blodgett films of azo dye/liquid crystal mixtures”Dyes and Pigments, vol.77,2008, pp. 303-314, doi: org/10.1016/j.dyepig.2007.05.016, 5] A. Ulman, An Introduction to Ultrathin Organic Films: From Langmuir- Blodgett Films to Self-Assemblies. 2nded. New York: Academic Press, 1991. 6] O.Worsefold, C.Toma, T.Nishiya,“Development of a novel optical bionanosensor” Biosens. Bioelectron., vol.19,June 2004, pp. 1505-1511, doi: org/10.1016/j.bios.2003.12.002. 7] P.Somani, S. Radhakrishnan“Electrochromic materials and devices: present and future”Mater. Chem. Phys, vol.77, January 2003, pp.117133, doi: org/10.1016/S0254-0584(01)00575-2.

Page 73

Nathet al., American International Journal of Research in Formal, Applied & Natural Sciences, 3(1), June-August, 2013, pp. 70-77

8] R.Rella, A.Serra, P.Siciliano, A.Tepore, L.Valli, A.Zocco,“Langmuir−Blodgett Multilayers Based on Copper Phthalocyanine as Gas Sensor Materials: Active Layer−Gas Interaction Model and Conductivity Modulation”Langmuir, vol. 13, November 1997, pp 6562–6567, doi:10.1021/la961029c. 9] Natalia Bielejewska, Danuta Bauman“Molecular aggregation of naphthalimide dyes in Langmuir–Blodgett films”J. Mol. Struct., vol 993, May 2011, pp.177-184, doi: org/10.1016/j.molstruc.2010.11.039. 10] A. Biadasz, K. Łabuszewska, E. Chrzumnicka, E. Michałowski,T. Martyński,D. Bauman “Spectral properties of some fluorescent dyes in two-dimensional films formed by means of Langmuir–Blodgett technique”, Dyes and Pigments, vol. 74, 2007,pp.598-607, doi: org/10.1016/j.dyepig.2006.03.025. 11] A.Pal,B.K.Mishra, S.Panigrahi,R.K.Nath,S.Deb, “Behavior of 1-Pyrene-Carboxaldehyde Mixed with a Polymer Matrix within the NanoDimensional Langmuir-Blodgett Films” J.Macromol.Sci., Pure Appl. Chem.,vol.48. June 2012,pp.155-162, doi:10.1080/19430892.2012.676923 12] A.Pal,B.K. Mishra, S.Panigrahi,R.K. Nath,S. Deb, “Incorporation of ErythrosinB Within the Restricted Geometry of Langmuir Monolayer and Langmuir-Blodgett Films of Octadecylamine” Soft Materials, vol 11, December 2012,pp. 85-89,doi:10.1080/1539445X.2011.582915. 13] S.Sharma,D. Mohan,N. Singh,N. Sharma, A.K. Sharma,“Spectroscopic and lasing properties of Xanthene dyes encapsulated in silica and polymeric matrices”Optik, vol.121 January 2010, pp.11-12,doi:org/10.1016/j.ijleo.2008.05.005. 14] J. R. Fyson, P. J. Twist, I. R. Gould,Electron-transfer processes in silver halide photography. In: V. Balzani (Ed.), Electron transfer in chemistry, Vol. 5, Wiley-VCH: Weinheim, 2001, p.285-378. 15] D. S. Weiss, J. R.Cowdery,R. H. Young,Electrophotography. In: V. Balzani (Ed.), Electron transfer in chemistry, Vol. 5, WileyVCH:Weinheim, 2001, pp.379-471. 16] M. Grätzel, “Photoelectrochemical cells” Nature, vol.414 November 2001, pp. 338- 344. 17] M.A. Jhonsi, A.Kathiravan, R.Renganathan “Photoinduced interaction between xanthene dyes and colloidal CdS nanoparticles.”J MolStruct, vol. 921 2009, pp. 279–284, doi:10.1016/j.jlumin.2009.03.013-15_papers. 18] Masami Kawaguchi,Midori Yamamoto, andTadaya Kato “Polymer Adsorption Induced Pattern Formation in Lipid Monolayers Spread at the Air−Water Interface” Langmuir, vol. 14 April 1998, pp 2582–2584, doi: 10.1021/la971282s 19] S. Biswas, S. A. Hussain, S. Deb, R. K. Nath and D. Bhattacharjee “Formation of complex films with water-soluble CTAB molecules” SpectroChimicaActa part A, vol. 65, 2006, pp. 628–632, doi:org/10.1016/j.saa.2005.12.021 20] SekharSundaram,James K. Ferri,Dieter Vollhardt, andKathleen J. Stebe “Surface Phase Behavior and Surface Tension Evolution for Lysozyme Adsorption onto Clean Interfaces and into DPPC Monolayers: Theory and Experiment” Langmuir,vol.14, March 1998, pp 1208–1218doi: 10.1021/la970670r 21] R.H.A. Ras, C.T. Johnston, R. A. Schoonheydt, “Chemical instability of octadecylammonium monolayers” Chemical Communications, vol. 32, 2005, pp. 4095-4097,doi:10.1039/B504483A. 22] Jun'ichiro Muto“On the Optical Properties of Rhodamine B in Aqueous Solutions” Jpn. J. Appl. Phys. , vol.11, April 1972, pp. 12171217,doi: 10.1143/JJAP.11.1217. 23] Karen Wohnrath, Luis R. Dinelli, Sarita V. Mello, Carlos J. L. Constantino, Roger M. Leblanc, Alzir A. Batista, and Osvaldo N. Oliveira, Jr. “Langmuir and Langmuir–Blodgett Films Containing a Porphyrin–Ruthenium Complex”Journal of Nanoscience and Nanotechnology, Vol. 5, June 2005 , pp. 909-916,doi:http://dx.doi.org/10.1166/jnn.2005.132

Figure Captions: Figure1: Molecular structures of (a) stearic acid (SA), (b) dodecyl trimethyl ammonium bromide (DTAB) and (c) eosin Y(EY) Figure2: Schematic representation of Langmuir monolayer of (1) SA at the air-water interface (2) SA-DTAB complex at the air water interface and (3) SA-DTAB complex at the air water interface doped with EY. Figure 3: Adsorption kinetics of EY with different DTAB concentrations. Here the curves1 for pure SA and 2, 3 , 4, 5, 6 represent the adsorption kinetics when the DTAB concentrations are 0.1 × 10-5 M,0.5× 10-5 M 0.75 × 10-5 M ,0.9 × 10-5M and 0.1 × 10-5 M respectively. Figure 4: Transmission FTIR spectra of 10 layers of pure SA, SA-DTAB and DTAB-EY-SA on silicon substrate. Figure 5:Normalised UV-Vis absorption spectra of (1) EY (1×10-5 M) in aqueous solution (dotted line), (2)microcrystal film (dash-dot line). SA-DTAB-EY complex LB films at different concentration (Solid lines) Figure 6: Fluorescence spectra of EY in aqueous solution (dotted line), SA-DTAB-EY complex LB film (dashed line) and microcrystal film (solid line). Figure 7: Scanning electron micrograph of 10 layersSA-DTAB-EY complex LB film lifted at 15mN/m pressure.

a: Stearic acid (SA)

b: Dodecyl trimethyl ammonium bromide (DTAB)

Page 74

Nathet al., American International Journal of Research in Formal, Applied & Natural Sciences, 3(1), June-August, 2013, pp. 70-77

c: Eosin Y (EY) Figure 1: J. Nath et al.

Figure 2: Schamatic diagram

24 6

22 5

20 4

Surface Pressure(mN/m)

18 16

14 2

12 10 8 6 4 2

0 0

Time(hour)

Figure:3 J. Nath et.al

Page 75

Nathet al., American International Journal of Research in Formal, Applied & Natural Sciences, 3(1), June-August, 2013, pp. 70-77

120

100 DTAB-EY

SA-DTAB-EY

1731

1626

2851

1609

1702

2851 2921

-20 3500

3000

2500

2000

1500

-1

Wavenumber (cm )

Figure 4: J. Nath et al.

1.0

0.8

Absorbance(au)

Concentration increases

0.6

0.4

0.2

0.0

450

500

550

600

650

700

Wavelength(nm)

Figure 5: J. Nath et al.

Page 76

Intensity(au)

Nathet al., American International Journal of Research in Formal, Applied & Natural Sciences, 3(1), June-August, 2013, pp. 70-77

500

550

600

650

700

750

Wavelength(nm)

Figure 6: J. Nath et al.

Figure 7: J. Nath et al.

Page 77

American International Journal of Research in Formal, Applied & Natural Sciences

Available online at http://www.iasir.net

ISSN (Print): 2328-3777, ISSN (Online): 2328-3785, ISSN (CD-ROM): 2328-3793

IMPACT of NUTRITION GARDEN on the CALCIUM, IRON and VITAMIN A STATUS of RURAL POPULATION in RANGA REDDY DISTRICT, ANDHRA PRADESH G. Vani Bhushanam1 and Dr. M. Usha Rani2 Research Associate, AICRP on Home Science, Department of Foods & Nutrition, Acharya N.G.Ranga Agricultural University, Hyderabad1, INDIA Principal Scientist, AICRP on Home Science, Department of Foods & Nutrition, Acharya N.G.Ranga Agricultural University, Hyderabad2, INDIA Abstract: Science driven progress in agriculture in the last hundred years has resulted in technological operations capable of achieving lifts in productivity needed to provide adequate food energy for the world. During this push ‘Green Revolution’ increased the yield of staples and diets throughout the world changed, resulting in dramatic increase in micronutrient deficiencies. This paper examines the Impact of Establishment of Nutrition Garden as a Community level strategic intervention program in 60 households (@12 from 5 villages) using Purposive sampling technique in the Operational villages of AICRP, Ranga Reddy District, Andhra Pradesh for Intervention Period of 3 years (2008 – 09, 2009 – 010 & 2010 – 11). The Impact was assessed using 24 hour dietary recall; studying food consumption pattern and Mean nutrient intake of household consumption before and after establishment of nutrition garden. The results reveal that the percent intake of Calcium, Iron and Vitamin A at the end of the intervention showed an increase of 15% 11% and 55% respectively. Key Words: Nutrition Garden, intervention, nutrient, food consumption, micronutrient deficiencies I. INTRODUCTION Science driven progress in agriculture in the last hundred years has resulted in technological operations capable of achieving lifts in productivity needed to provide adequate food energy for the world. During this push ‘Green Revolution’ increased the yield of staples and diets throughout the world changed, resulting in dramatic increase in micronutrient deficiencies. Micronutrient deficiencies impair the function of the brain; the immune and reproductive systems and energy metabolism resulting in learning disabilities, reduced work capacity and serious illness. Reducing micro nutrition malnutrition, the so called ‘hidden hunger’ has been cited as an important dimension of National Nutrition Policy designed to address the problems of malnutrition. Anemia and vitamin A deficiencies are also widespread, with anemia affecting over half of children 6 to 59 months and pregnant women in the developing countries [1]. Vitamin A deficiency is a public health problem in nearly 80 developing nations: in these low income countries, more than 7 million pregnant women suffer from insufficient vitamin A[2],[3] .Over half of the prevalence of anemia globally is estimated to be due to iron deficiency[4]. Macro- and micronutrient malnutrition have lasting and devastating consequences for individual health and national development, as malnutrition early in life often leads to stunted growth[5], poor cognitive and physical development, and is associated with increased episodes of infection throughout an individual’s lifetime. In addition, maternal nutrition has a significant effect on nutritional status of young children: during pregnancy, small variations in maternal diets, particularly reduction in micronutrient content, can have a significant impact on fetal growth and development[6],[7], which will later affect the child’s growth potential and adult height[8]. Anemia during pregnancy also has significant carry-over effects on anemia and iron status of infants and young children. Moreover, dietary calcium intake is inadequate when compared to the recommended daily allowances (RDA) for India [9] contributing to stunted growth. These health outcomes will ultimately hinder development at a national level. Agricultural interventions to improve household food availability and dietary diversity are considered one of the most sustainable solutions to addressing these problems of high household food insecurity and malnutrition by increasing household’s access to diverse foods and consumption of micronutrient rich food[10]. Such programs can also lead to reduced household poverty [11], improved nutritional status of household members [12] and potentially empower women beneficiaries [13]. II. METHODOLOGY Strategy: Establishment of Nutrition Garden as Community level strategic program Sample Size & Technique: 60 households (@12 from 5 villages) were selected through Purposive Sampling technique by screening 150 households based on their willingness and interest to establish Nutrition Garden in

Page 78

G. Vani Bhushanam et al., American International Journal of Research in Formal, Applied & Natural Sciences, 3(1), June-August, 2013, pp. 78-81

their farm or in their backyard after conducting awareness program on the importance of vegetables and seasonal fruits in ensuring nutrition security. Venue: The study was conducted in the Operational villages of AICRP, Ranga Reddy District, Andhra Pradesh Intervention Period: 3 years (2008 – 09, 2009 – 010 & 2010 – 11) Impact Assessment: The impact of establishing Nutrition Garden in the rural households were assessed by conducting 24 hour dietary recall studying food consumption pattern before and after establishment of Nutrition Garden and the Mean nutrient intake of households’ consumption before and after establishment of Nutrition Garden were calculated. III. RESULTS & DISCUSSION A Baseline Survey was carried out in the 5 operational villages. A total of 150 households from 5 villages (@ 30 households each village) were randomly selected to collect data on the General Profile of the families, Major crops grown, Anthropometric measurements of women and children, Consumption pattern and mean nutrient intake. The data was collected, tabulated and subjected to statistical analysis. Mean, frequency and percentages calculated and reveal the following: General Profile of the family: Majority (75.3%) of the households in the five operational villages live as nuclear families with family size less than 5. Half (50%) of the households live in mixed houses while 38% live in pucca houses. More than half (57.4%) of the households had land holding of 1.1 to 5 acres. Majority (72.67%) were involved in cultivation as their major occupation. The major source of information is through TV (83%) followed by newspaper (35%). Major crops grown by the family: The major Occupation in the five operational villages is Agriculture. The major crops are Rice, Maize and Jowar under Cereals & Millets. Red gram and Bengal gram are the widely grown pulses. Spinach, Amaranthus, Gogu and Coriander are the Major Green leafy vegetables grown. The Other vegetables grown are Brinjal, Lady’s finger and Cluster beans. Carrots are the major crop grown under Roots & Tubers. The major crops under Nuts & Oil seeds are Sunflower and Safflower while Chillies under Spices grown in the 5 villages. Tomato is the abundantly grown fruit. Bench mark survey A bench mark survey was conducted to study the Nutritional status of 30 households willing to establish Nutrition Garden in the operational villages. Anthropometric measures and Classification of women by BMI: The height and weight of women in the child bearing age, pregnant and lactating mothers were measured and BMI calculated. Majority (60.7%) of women of child bearing age was malnourished, 26.5% were of normal BMI and 12.8% were either overweight or obese. Majority (87.5%) of the lactating mothers in the households surveyed were malnourished while 12.5% were found normal. Anthropometric measures and Classification of infants, children and adolescent girls based on Gomez classification: The percent standard weight calculated by measuring the weights and heights reveal that the mean percent standard weight per height of infants was 5.84 for 0 -6 months and for older infants was 10.3 for 6 – 12 months. Deficiency symptoms among the family members: The commonly observed deficiency symptoms were angular stomatitis, spongy and bleeding gums, teeth carries and pale eyelids and palm. Mean food intake of the families: The mean food intake of cereals was 504.3+ 76.2g, pulses 11.3+26.9g, roots & tubers 44.2 + 27.2g, green leafy vegetable 29.2+45.4g, other vegetables 65.6+4.9g fruits 81.9_ 24.3g, milk & milk products 55.5+27.8g, fats/ oils 20.2+10.3 and Sugar 14.9+5.1g per adult consumption unit. The mean percent adequacy was highest in cereals (120.1%) and lowest in milk (18.5%). Mean percent adequacy of nutrient consumption of families: The percent adequacy of nutrient consumption of families (per Adult Consumption Unit (ACU)/day) of the villages compared to Recommended Dietary Allowance (RDA) before establishing nutrition garden is presented in Table1. TABLE 1: PERCENT ADEQUACY OF NUTRIENT CONSUMPTION OF FAMILIES (PER ACU/DAY) OF THE VILLAGES COMPARED TO RDA BEFORE ESTABLISHING NUTRITION GARDEN No. Name of the Protein Fat (g) CHO (g) Energy Calcium Iron β_Carotene village (g) (kcal) (mg) (mg) (µg) RDA 2400 60 20 360 2425 400 28 1 Khandawada 81.12 119.48 130.33 93.89 71.31 38.63 24.89 2

Palgutta

91.48

109.84

151.16

106.83

77.30

35.56

132.46

Malkapuram

80.35

117.96

116.20

85.34

91.80

52.38

36.28

Kesaram

82.08

127.87

112.87

84.76

103.83

72.30

24.87

Ibrahimpally

78.32

116.30

116.99

85.95

79.90

47.56

41.56

82.7±5.1

118.3±6.5

125.5±15.8

91.4±9.4

84.8±12.9

49.3±14.5

52.0 + 45.6

Mean ± SD

Page 79

G. Vani Bhushanam et al., American International Journal of Research in Formal, Applied & Natural Sciences, 3(1), June-August, 2013, pp. 78-81

The mean percent adequacy was observed highest in carbohydrates followed by fat. Rice being the staple cereal, coupled with daily consumption of Jowar by 86% of the households contributes significantly to the carbohydrate content. The mean consumption of visible fat was at a higher level as against 14g/CU/day reported by National Nutrition Monitoring Bureau Survey [14]. The adequacy of Iron through food consumption is reflected from the poor usage of Iron rich foods such as leafy vegetables mixed with protein leading to poor absorption of Iron. Impact of Establishment of Nutrition Garden The ease of the farm women in establishment and monitoring the crop in the nutrition garden was given top priority to encourage production and consumption of produce of the nutrition garden. The mean plot size of each established garden in the five operational villages in represented in figure5. 114.5 108.7

108 103.07

Khandawada

Palgutta

102.95

Malkapur

Kesaram

Ibrahimpally

FIGURE 1: MEAN TOTAL PLOT SIZE OF EACH NUTRITION GARDEN IN THE FIVE OPERATIONAL VILLAGES

Mean food intake of the households after establishment of Nutrition Garden The percent adequacy of nutrient consumption of families (per Adult Consumption Unit (ACU)/day) of the villages compared to Recommended Dietary Allowance (RDA) before establishing nutrition garden is presented in Table2. TABLE2: Name of the village Khandawada

MEAN FOOD INTAKE OF THE FAMILY (PER ADULT CONSUMPTION UNIT/DAY) OF THE VILLAGES AFTER ESTABLISHING NUTRITION GARDEN Green Milk & Roots & Other Fats & Cereals Pulses Leafy Fruits Milk Sugar Tubers Vegetables Oils Vegetables Products 390.54 21.42 29.34 22.73 106.36 22.76 69.73 69.48 16.95

Palgutta

584.10

28.12

80.60

75.83

43.62

74.42

106.24

19.99

23.73

Malkapuram

517.65

8.58

37.97

125.75

10.50

132.80

105.34

18.99

20.93

Kesaram

497.45

31.41

17.19

0.00

61.33

20.83

79.15

20.78

18.12

Ibrahimpalli

399.00

19.00

34.10

123.33

19.42

137.59

76.42

15.59

21.50

Overall Mean+SD

477.7+82.3

21.7+8.97

39.8+24.1

87.0+48.7

94.7+15.5

18.5+2.2

21.4+2.1

78.9+51.2

31.5+20.6

Mean percent adequacy of food intake of households before and after establishment of Nutrition Garden The mean adequacy of food intake at the end of intervention period improved in Pulses (18.9%) followed by other vegetables (13.3%) and Milk (13.06%). The mean adequacy of food intake per ACU/day before and after establishment of Nutrition Garden is represented in Table 3. TABLE 3: MEAN PERCENT ADEQUACY OF FOOD INTAKE OF THE HOUSEHOLDS BEFORE AND AFTER ESTABLISHMENT OF NUTRITION GARDEN Food Group Mean Percent Adequacy (%) Before After Difference Cereal / Millets 120.07 113.74 6.33 Pulses 18.89 36.17 18.89 Roots & Tubers 22.10 19.85 2.25 Other Vegetables 65.61 78.93 13.32 Green Leafy Vegetable 29.16 31.52 2.36 Fruits 81.88 87.03 5.15 Milk 18.50 31.56 13.06 Fats & Oils 80.72 73.84 6.88 Sugars 59.66 53.00 6.66

Mean percent adequacy of nutrient consumption of families after establishment of Nutrition Garden

Page 80

G. Vani Bhushanam et al., American International Journal of Research in Formal, Applied & Natural Sciences, 3(1), June-August, 2013, pp. 78-81

The percent adequacy of nutrient consumption of families after establishment of Nutrition Garden is presented in Table 4 TABLE 4: PERCENT ADEQUACY OF NUTRIENT CONSUMPTION OF FAMILIES (PER ACU/DAY) OF THE VILLAGES COMPARED TO RDA AFTER ESTABLISHING NUTRITION GARDEN No. Name of the Protein (g) Fat (g) CHO (g) Energy Calcium Iron (mg) β_Carotene village (kcal) (mg) (µg) RDA 60 20 360 2425 400 28 2400 1 Khandawada 84.32 75.90 112.53 88.50 103.42 58.57 74.99 2 Palgutta 91.86 84.18 125.50 96.15 93.94 53.52 147.75 3 Malkapuram 83.29 84.43 125.79 95.85 93.82 43.28 57.73 4 Kesaram 86.84 77.85 109.30 83.41 105.30 78.00 137.19 5 Ibrahimpally 89.17 85.31 118.44 93.26 101.82 61.35 116.94 Mean ± SD 87.04±8.4 81.4±7.8 118.3±12.3 91.4±8.3 99.7±23.03 58.9±14.3 106.9 + 39.1

The decrease in fat consumption from 118.3% to 81.4% could be attributed to awareness programs on low fat consumption during the intervention period in the wake of dual burden of malnutrition creeping to the rural areas as well. The mean percent adequacy has improved in micronutrients Calcium, Iron and β_Carotene at the end of the intervention showed an increase of 15%, 11% and 55% respectively. IV. CONCLUSION Improved consumption of green leafy vegetables and fruits from Nutrition Garden is a low cost sustainable approach for reducing micronutrient malnutrition in developing countries. The need to bring about behavior change communication in sustainability of right food choices and consumption of micronutrient rich foods in the homestead garden in rural areas is being reinforced at and again. V. REFERENCES [1] [2] [3] [4] [5] [6] [7]

[8] [9] [10]

[11] [12] [13] [14]

World Health Organization. Vitamin and mineral nutrition information system (VMNIS). [online]. 2009. [cited 2010 Mar 14] West, K. P., Jr. 2002. Extent of vitamin A deficiency among preschool children and women of reproductive age. Journal of Nutrition 132 (Supplement 9): 2857S–2866S. West, K. P., Jr., and I. Darnton-Hill. 2008. Vitamin A deficiency. In Nutrition and health in developing countries, ed. R. D. Semba and M. W. Bloem. Totowa, N.J., U.S.A.: Humana Press Rastogi, R., and C. D. Mathers. 2000. Global burden of iron deficiency anaemia in the year 2000. In Global burden of disease 2000. Geneva: World Health Organization. <http://www.who.int/healthinfo/statistics/bod_irondeficiencyanaemia.pdf>. ACC/SCN (2000) Fourth Report on the World Nutrition Situation: Nutrition Throughout the Life Cycle. ACC/SCN in collaboration with IFPRI, Geneva (online) Ruowei L, Haas JD, Habicht J-P. Timing of the influence of maternal nutritional status during pregnancy on fetal growth. American Journal of Human Biology. 1998; 10:529-539. Bukowski R, Smith GC, Malone FD, Ball RH, Nyberg DA, Comstock CH, Hankins GD, Berkowitz RL, Gross SJ, Dugoff L, Craigo SD, Timor-Tritsch IE, Carr SR, Wolfe HM, D’Alton ME. Fetal growth in early pregnancy and risk of delivering low birth weight infant: prospective cohort study. FASTER Research Consortium. BMJ 2007; 334 (7598):836 Cole T. Secular trends in growth. Proc Nut Soc 2000; 59:317-324 Harinarayan CV, Ramalakshmi T and Venkataprasad U High prevalence of low dietary calcium and low vitamin D status in healthy south Indians. Asia Pacific Journal of Clinical Nutrition 2004;13(4):359-64 HKI/Cambodia. Nutrition Bulletin, Homestead food production program improves food and nutrition security by increasing consumption of micronutrient-rich foods and family income in households with HIV/AIDS and other chronic diseases. HKI/Cambodia 2007 (7); 1. Bloem MW, Moench-Pfanner R and Kiess L. Combating micronutrient deficiences – an important component of poverty reduction. Biomedical Environmental Science. 2001; 14: 92-97. De Pee S, Bloem MW and Kiess L. Evaluating food-based programmes for their reduction of vitamin A deficiency and its consequences. Food Nutrition Bulletin. 2000; 21; 232-238. Bushamuka VN, de Pee S, Talukder A, Kiess L, Panagides D, Taher A and Bloem MW. Impact of a homestead gardening program on household food security and empowerment of women in Bangladesh. Food Nutrition Bulletin. 2005; 26: 17-25. Diet and Nutritional status of population and prevalence of Hypertension among adults in rural areas, NNMB Technical Report No.24, 2006, NIN, pp14.

VI.

Acknowledgments

The author acknowledges DRWA under Indian Council of Agricultural Research for including the project of "Ensuring Micronutrient Security to farm families" under the All India Coordinated Research Project (Home Science) sanctioned to ANGR Agricultural University, Rajendranagar, Hyderabad. But for this project, data of this nature would not have been possible. Grateful acknowledgements are due to Dr.Sudhakar Rao, Director of Research, ANGRAU and Dr.Mallikarjun Reddy, Associate Director of Research for the administrative support given during this work.

Page 81

American International Journal of Research in Formal, Applied & Natural Sciences

Available online at http://www.iasir.net

ISSN (Print): 2328-3777, ISSN (Online): 2328-3785, ISSN (CD-ROM): 2328-3793

POTENTIAL MEDICINAL PLANTS OF LAMIACEAE S.M.Venkateshappa and K.P.Sreenath Department of Botany, Bangalore University, Bangalore-560056, Karnataka, India Abstract : The objective of the present study was to review on few medicinally potential plants of Lamiaceae of Karnataka. Plants in this family, are herbs or shrubs often with an aromatic smell. They are common in the Mediterranean countries for the fact that some of them produce a high amount of essential oil that enables them to survive the hot summer season. Some examples from this family include Anisomeles, Colebrookea, Coleus, Hyptis, Leonotis, Leucas, Mentha, Ocimum, Oreganum and Salvia. These are important for medicinal, perfumery, culinary and ornamental purposes. Medicinal constituents include the strong aromatic essential oil, tannins, saponins and organic acids. The oil is obtained by steam distillation. In aromatherapy, the oil is used for its soothing effects. These plants have sedative, diuretic, tonic, antispasmodic, antifungal, antimicrobial, anti-inflammatory and antiseptic properties. Keywords: Lamiaceae, Anisomeles, Colebrookea, Coleus, Hyptis, Leonotis, Leucas, Mentha, Ocimum, Oreganum, Salvia, aromatic, phytochemical, medicinal.

1. Introduction Plants have provided man with all his needs in terms of shelter, clothing, food, flavours and fragrances but not the least, medicines. Plants have formed the basis of sophisticated Traditional Medicine systems that have been in existence for thousands of years and continue to provide mankind with new remedies. Some of the oldest known medicinal systems of the world such as Ayurveda of the Indus civilization, Arabian medicine of Mesopotamia, Chinese and Tibetan medicine of the Yellow River civilization of China and Kempo of the Japanese are all based mostly on plants. The Lamiaceae (Labiatae) is one of the most diverse and widespread plant families in terms of ethnomedicine and its medicinal value is based on the volatile oils concentration [1]. The Lamiaceae plant family is one of the largest families among the dicotyledons, many species belonging to the family being highly aromatic, due to the presence of external glandular structures that produce volatile oil [2]. This oil is important in pesticide, pharmaceutical, flavouring, perfumery, fragrance and cosmetic industries [3]. Medicinal plants have an important value in the Socio-cultural, spiritual and medicinal use in rural and tribal lives of the developing countries [4]. People around the world use between 50,000 to 80,000 flowering plants for medicinal purposes [5]. Medicinal and aromatic plants, are known to be used by 70% to 80% of global population for their medicinal-therapeutic effects as estimated by WHO [6]. The mints, taxonomically known as Lamiaceae, are a family of flowering plants. They have traditionally been considered closely related to Verbenaceae [7]. But in the 1990s, phylogenetic studies suggested that many genera classified in Verbenaceae belongs to Lamiaceae [8][9]. The currently accepted version of Verbenaceae may not be more closely related to Lamiaceae than some of the other families in the order Lamiales [10]. It is not yet known which of the families in Lamiales is closest to Lamiaceae. The plants are frequently aromatic in all parts and include many widely used culinary herbs, such as basil, mint, rosemary, sage, marjoram, thyme, lavandula, orthosiphon, ocimum, leucas, anisomeles, colebrookea, coleus, hyptis, oreganum, brunella, scutellaria, lamium, teucrium and perilla. Many members of the family are widely cultivated, owing not only to their aromatic qualities but also their ease of cultivation: these plants are among the easiest plants to propagate by stem cuttings. Besides those grown for their edible leaves, some are grown for decorative foliage, such as Coleus. The enlarged Lamiaceae contains about 236 genera and 6,900 to 7,200 species. The largest genera are Salvia (900), Scutellaria (360), Coleus (325), Plectranthus (300), Hyptis (280), Teucrium (250), Thymus (220) and Nepeta (200). Clerodendrum was once a genus of over 400 species [7], but by 2010, it had been narrowed to about 15 [11].

Page 82

S.M.Venkateshappa et al., American International Journal of Research in Formal, Applied & Natural Sciences, 3(1), June-August, 2013, pp. 82-87

In Karnataka about 109 plants from various genera of plant belongs to family have been identified among which many plants possess medicinal properties. Hence, this study was undertaken to explore the Lamiaceae plants which have been scientifically proved for their potential medicinal values.

II. Materials and methods The ten Lamiaceous plants were selected for the study and the information collected from the several scientific literatures. The ten plants selected for this particular study are Anisomeles indica, Colebrookea oppositifolia, Coleus amboinicus, Hyptis suaveolens, Leonotis nepetaefolia, Leucas aspera, Mentha spicata, Ocimum canum, Oreganum vulgare and Salvia coccinea.

III. Results The most common plants and their therapeutic potentials have been listed in the following table. Sl.No.

Name of the plant

Parts used

Anisomeles indica, O. Kze.

Whole plant

Medicinal properties Plant extracts and isolated constituents inhibit inflammatory mediators and tumor cell proliferation[12]. Leaves chewed treatment for toothaches, rheumatism, cold, fever, abdominal pain, intermittent fever and dyspepsia. Recently, the ethanol extract of this plant exhibited antibacterial activity [13]. Aerial parts of plant decoction used as an analgesic. It is used as a antimetastatic effects on human breast cancer cells[14].

Colebrookea oppositifolia, Sm.

Root, stem and leaves

Plant juice can be used to treat fever and headache. Leaves used to treat dysentery. Roots decoction is used to treat peptic ulcers and haemostatic. Leaves are used in the treatment of wounds, bruises and fracture besides possessing antifertility activity; roots are used in the treatment of epilepsy; oil possesses fungitoxic property [15-17].

Coleus amboinicus, Lour.

Whole plant

It is folkloric medicinal plant used to treat malarial fever, hepatopathy, renal & vesicle calculi, cough, chronic asthma, hiccough, bronchitis, helminthiasis, colic, convulsions& arthritic inflammations [18]. Treatment for GIT complications- dyspepsia, indigestion & diarrhea. Ethanolic and aqueous leaf extracts of the plant has been found possess significant diuretic activity [19]. Plant contain the constituents responsible for cytotoxicity and anti-bacterial activity [20]

Hyptis suaveolens, Poit.

Stem, leaves, seeds and roots

The leaves have been utilized as a stimulant, carminative, sudorific, galactogogue and as a cure for parasitic cutaneous diseases [21]. Crude leaf extract is used as a relief to colic and stomachache. Leaves and twigs are considered to

Page 83

S.M.Venkateshappa et al., American International Journal of Research in Formal, Applied & Natural Sciences, 3(1), June-August, 2013, pp. 82-87

be antispasmodic and used in antirheumatic and antisuporific baths [22]. Seeds of essential oil used as antioxidant and antimicrobial activity. The decoction of the roots is highly valued as appetizer and is reported to contain urosolic acid, a natural HIV-integrase inhibitor [23].

Leonotis nepetaefolia, R.Br.

Stem and leaves

This plant is used for treatment of antiinflammatory, antidiabetic and hypoglycemia. This plant exhibited various biological activities viz. antifungal, antimalarial [24], anticancer[25] and hypotensive. Leaves are brewed as a tea for fever, coughs and womb prolapsed. Antibacterial activity of the essential oil of the plant was tested by disk diffusion method [26].

Leucas aspera, Spreng.

Whole plant

Entire plant is used as an insecticide and indicated in traditional medicine for coughs, colds, painful swellings and chronic skin eruptions [27]. It is used as antimicrobial activity of essential oils and flowers. It possesses wound healing property and is used in cobra venom poisoning [28]. It is used as toxicity evaluation of herbal smoke and synthetic mosquito mat. The plant has been scientifically investigated for anti-inflammatory, analgesic activity [29].

Mentha spicata, (Spearmint)

Linn.

Stem, leaves and flowers

The leaves are used as a flavouring in salads or cooked foods, often used in mint sauce, which is used as a flavouring in meal. Essential oil is obtained from the leaves and flowers used as a flavouring agent in the foods and beverages industry. In the fragrance industry it is found in perfumes and in oral hygiene products [30]. Spearmint oil showed antimicrobial activity against the broadest group of viruses, fungi and bacteria [31]. The stems are macerated and used as a poultice on bruises. This oil is considered safe and non-toxic when used as directed. May cause irritation to mucous membrane [32].

Ocimum canum, Sims.

Stem, leaves and seeds

The plant is used for treating various types of diseases and lowering blood glucose and also treats cold, fever, parasitic infestations on the body and inflammation of joints and headaches [33.] Essential oil from the leaves possesses antibacterial and insecticidal properties [34]. The seeds may constipation.

provide

fiber

reduce

The plant reduced the severity of injury-oxygen radical-intiated lipid peroxidation may contribute

Page 84

S.M.Venkateshappa et al., American International Journal of Research in Formal, Applied & Natural Sciences, 3(1), June-August, 2013, pp. 82-87

to the impaired cellular function and necrosis associated with reperfusion of ischemic tissues [35].

Oreganum vulgare, Linn.

Stem, leaves

Oregano is an important culinary herb, used for the flavor of its leaves, which can be more flavourful when dried than fresh [36]. Factors such as climate, seasons and soil composition may effect the aromatic oils present in this plant. Oregano is high in antioxidant activity, due to a high content of phenolic acids and flavonoids [37]. Oil of oregano treated colds and flus, and that oil of oregano taken orally treated and relieved bacterial and viral infections and their symptoms [38].

10.

Salvia coccinea, Bucâ&#x20AC;&#x2122;hoz ex Etl.

Stem, leaves and flowers

Aqueous leaf extract of Salvia coccinea is medicinally using in inflammatory diseases such as ischemia, thermal or physical injury, infectious agents and antigen-antibody interactions[39] leads to release of allergic mediators, which causes injury. Use ornamental: easily grown, blooms ornamental, colour, perennial garden. Conspicuous, fragrant and nectar source flower attracts: Butterflies, Humingbirds, Bees and Insects. The leaf extract of anti-inflammatory drugs have severe side effects such as water and salt retention, cancer [40] and gastro- intestinal disturbances [41].

IV. Conclusion The detailed information in this review shows its potential therapeutic values and is a rich source of biologically active compounds. The potential of the plants to be an excellent analgesic, antipyretic, anti-inflammatory, antifungal, antispasmodic, antioxidant, antimicrobial, antidiabetic, antiasthmatic, antidiarrhea, antidote, antiseptics treatment for skin diseases, arthritic, carminative, toothaches, rheumatism, peptic ulcers, haemostatic, anthelmintic, tuberculosis, epilepsy, urinary diseases, vaginal discharges, insect bites, allergies, diarrhea and influenza. Acknowledgement The authors thank to The Bangalore University for provides facilities and Department of Botany, East-West college of Science, Off. Magadi Road, Bangalore-560091. References [1].

Sarac, N. and A. Ugur, 2007. Antimicrobial activities and usage in folkloric medicine of some Lamiaceae species growing in Mugla, Turkey. EurAsia J. Bio. Sci., 1:28-34.

[2].

Giuliani, C. And L. Maleci Bini, 2008. Insight into the structure and chemistry of glandular trichomes of Labiatae, with emphasis on subfamily Lamioideae. Plant systematic and Evolution, 276:199-208.

[3].

Ozkan, M., 2008. Glandular and eglandular hairs of salvia recognita Fisch. And Mey. (Lamiaceae) in Turkey. Bangladesh Journal of Botany, 37:93-95.

[4].

Hendawy, S.F., A.A. Ezz El-Din, E.E. Aziz and E.A. Omer, 2010. Productivity and oil quality of Thymus vulgaris L. under organic fertilization conditions. Ozean J. Appl. Sci., 3:203-216.

[5].

Naguib, N.Y.M., 2011. Organic Vs Chemical Fertilization of Medicinal Plants: A Concise Review of Researches. Advances in Environmental Biology, 5:394-400.

Page 85

S.M.Venkateshappa et al., American International Journal of Research in Formal, Applied & Natural Sciences, 3(1), June-August, 2013, pp. 82-87 [6].

World Health Organization (WHO), 2008. “Traditional medicine” Fact sheet number: 134 (December). Retrieved from : “http://www.who.int/mediacentre/factsheets/fs134/en

[7].

^ a b c d e f g h Raymond M. Harley, Sandy Atkins, Andrey L. Budantsev, Philip D. Cantino, Barry J. Conn, Renee J. Grayer, Madeline M. Harley, Rogier P.J. de Kok, Tatyana V. Krestovskaja, Raman Morales, Alan J. Paton, and P. Olof Ryding. 2004. “Labiatae” pages 167-275. In: Klaus Kubitzki (editor) and Joachim W. Kadereit (volume editor). The families and Genera of Vascular plants volume V11. Springer-Verlag: Berlin; Heidelberg, Germany. ISBN 978-3-540-40593-1

[8].

^ Cantino, P.D., Harley, R.M. and Wagstaff, S. J. 1992. Genera of Labiatae: Status and classification. Pp. 511-522. In: Raymond M. Harley and Tom Reynolds (editors). Advances in Labiatae Science. Richmond, Royal Botanic Gardens, Kew.

[9].

^ a b Steven J. Wagstaff, Laura Hickerson, Russ Spangler,Patrick A. Reeves, and Richard G. Olmstead. 1998 “Phylogeny in Labiatae s.1., inferred from cpDNA sequences”. Plant systematics and Evolution 209 (3-4): 265-274.

[10].

^ Peter F. Stevens. 2001 onwards. Angiosperm phylogeny Website At: Missouri Botanical Garden Website. (See External links below).

[11].

^ a b c d Yao-Wu Yuan, David J. Mabberley, Dorothy A. Steane, and Richard G. Olmstead. 2010. “Further disintegration and redefinition of Clerodendrum (Lamiaceae): Implications for the understanding of the evolution of an intriguing breeding strategy”. Taxon 59 (1): 125-133.

[12].

Hsieh S.C., Fang S.H., Rao Y.K., Tzeng Y.M. Inhibition of proinflammatory mediators and tumor cell proliferation by Anisomeles indica extracts. J. Ethnopharmacol. 2008;118:65-70. [PubMed]

[13].

Wang Y.C., Huang T.L. Screening of anti-Helicobacter pylori herbs deriving from Taiwanese folk medicinal plants. FEMS Immunol. Med. Microbiol. 2005;43:295-300. [PubMed]

[14].

Lin K.L., Tsai P.C., Hsieh C.Y., Chang L.S., Lin S.R. Antimetastatic effect and mechanism of ovatodiolida in MDA-MB-231 human breast cancer cells. Chem. Biol. Interact. 2011;194:148-158. [PubMed]

[15].

Yoganarasimhan SN. Medicinal plants of India, Vol.2, TamilNadu: Bangalore: Cybermedia, 2000, 152.

[16].

Gupta RS, Yadav RK, Dixit VP, Dobhal MP. Antifertility studies of Colebrookea oppositifolia leaf extract in male rats with special reference to testicular cell population dynamics. Fitoterapia, 2001, 72(3): 70.

[17].

Singh SP, Singh SK, Tripathi SC. Antifungal activity of essential oils of some Labiatae plants against dermatophytes. Indian perfume 1983, 27(3&4): 171-173.

[18].

Kirtikar KR, Basu BD. Indian medicinal plants (2nd edition). Dehradun: International Book Distributors. 1975; 1971.

[19].

Patel R. Mahobia NK. Gendle R. Kaushik B. Singh SK. Diuretic activity of leaves of Plectranthus amboinicus (Lour) Spreng in male albino rats. Pharmacog Res. 2010; 2(2):86-88.

[20].

da Costa JGM. Campos AR. Brito SA. Pereira CKB. Erlanio O Souza. Rodrigues FFG. Biological screening of araripe basin medicinal plants using Artemia salina Leach and pathogenic bacteria. Ph Cog Mag. 2010; 6(24):331-334.

[21].

The wealth of India (Raw Materials), Vol. V, CSIR, New Delhi, 1964, 159.

[22].

Kirtikar, K.R and Basu, B.D., Indian medicinal plants, Vol.3, Singh B and Singh, M.P. Publishers, India, 1991, 2032.

[23].

Chatterjee, A. and Pakrashi, S.C., The Treatise on Indian Medicinal Plans, Vol.5, PID, New Delhi, 1997, 15.

[24].

Pandey, D.K., Tripathi, R.N., Tripathi, N.N., and Tripathy, R.D., „Environ India‟, 1981, 4, 83.

[25].

Von Dreele, R.B., Petit, G.R., Odd, R.H., Perdue, R.E., White, J.D., and Manchand, P.S., J.Am. Chem. Soc., 1975, 97, 6236.

[26].

Robert Cruickshank., „Medical Microbiology‟, 11th Edn., E&S., Livinstone Ltd., 1965, 894.

[27].

Chopra R.N., Nayar S.L. and Chopra I.C., In; Glossary of Indian Medicinal Plants, NISCAIR, CSIR, New Delhi, 2002, 153.

[28].

Anonymous, In; Wealth of India (Raw Materials), Vol.4, publications and information Directorate, CSIR, New Delhi, 2001, 36.

[29].

Reddy, K.M., Viswanathan, S., Thirugnanasambantham, D., Santa, R and Lalitha K., Fitoterapia, 1993, 64, 151.

[30].

Lis Balchan M. Aromatherapy Science: A Guide for Health care professionals. London: Pharmaceutical press; 2006:312-313.

[31].

Chao SC. Screening for inhibitory activity of Essential oils on selected Bacteria, Fungi and Viruses. J. Essent. Oil Res. Sep 2000; 12(5): 639-649.

[32].

Tisserand R. Balacs T. Essential oil safety. Churchill: Livingston; 1995:210.

[33].

Ngassoum, M.B. Ousmaila, H., Ngamo, L.T., Maponmetsem, P.M., Jirovetz, L., Buchbauer, G., Aroma compounds of essential oils of two varieties of the spice plant Ocimum canum Sims from northern Cameroon. J. Food Comp. Anal, 2004; 17, 197-204.

[34].

Bassole, I.H.N., Guelbeogo, W.M., Nebie, R., Constantini, C., Sagnon, N.F., Kabore, Z.I., Traore, S.A., Ovicidal and larvicidal activity against Aedes aegypti and Anopheles gambiae complex mosquitoes of essential oils extracted from three spontaneous plants of Burkina Faso. Parasitology, 2003;45, 23-26.

[35].

Stark G. Functional consequences of oxidative membrane damage. J Membr Biol. 2005;205:1-16.

[36].

^ http://gernot-katzers-spice-pages.com/engl/orig vul.html. Oregano leaves are more flavorful when dried

[37].

^ Dragland, Steinar; etal. (1May 2003). “Several culinary and medicinal herbs are important sources of dietary antioxidants.” J Nutr. 133(5): 1286-1290. PMID 12730411.

Page 86

S.M.Venkateshappa et al., American International Journal of Research in Formal, Applied & Natural Sciences, 3(1), June-August, 2013, pp. 82-87 [38].

^ Barrett. Stephen(13 June 2005). “Regulatory Actions against Michael Teplitsky. M.D.”. Quackwatch. Retrieved 2 November 2010.

[39].

Osadebe P.O., F.B.C. Okoy‟e. (2003). Anti-inflammatory effects of crude smethanolic extract and fractions of Alchornea cordifolia leaves. Journal of Ethnopharmacology., 89:19-24.

[40].

Wong Y.F., H. Zhou, J.R. Wang, Y. Xie, H.X. Xu and L. Liu. (2008). Anti-inflammatory and analgesic effects and molecular mechanisms of JCICM-6, a purified extract derived from an anti-arthritic Chines herbal formula. Phytomedicine., 15:416-426.

[41].

Gooch, K., B.F. Culleton, B.J. Manns, J. Zhang, H. Alfonso, M. Tonelli. (2007). NSAID use and progression of chronic kidney disease. American Journal of Medicine., 120:280(1-7).

Page 87

American International Journal of Research in Formal, Applied & Natural Sciences

Available online at http://www.iasir.net

Effect of Chronic Noise Stress on Neutrophil Functions in Rats Archana R Department of Physiology, Saveetha Medical College,Saveetha University, Thandalam, Chennai-602 105, INDIA Abstract: Long term exposure to loud noise acts as an environmental stressor which affects the physiological as well as the psychological well being of the individual. The aim of the present study was to determine whether chronic noise exposure could affect the neutrophil functions in albino rats. A significant enhancement of the neutrophil functions was observed as indicated by the increase in the candida phagocytosis and nitroblue tetrazolium reduction test in the noise stressed animals. The lymphocyte count was increased and the neutrophil count was decreased. Noise exposure altered the organ weight of spleen, thymus and adrenal gland . The total leukocyte count was unaltered while the corticosterone level was suppressed. In conclusion, the chronic exposure to noise acts as a stressor affecting the neutrophil functions while certain parameters like corticosterone and total leukocyte count gets adapted. Key words: Corticosterone, noise stress, neutrophil function, phagocytosis, spleen, thymus,adrenal. I.

INTRODUCTION

Today technology and rapid industrialization has thrown up a new and rapidly spreading environmental pollutant – Noise. Nowadays, noise has become the most commonly encountered stressor in our daily lives. When noise intensity that we are exposed to exceeds 90dB, then it becomes a stressor. Depending on the frequency, intensity and duration of exposure noise affects the body in different ways. Exposure to noise of high intensity causes hearing loss, damage to hair cells and affects the auditory cortex [1]. Chronic noise stress affects the extra-auditory system by causing hypertension [2], duodenal ulcers [3], behavioural disturbances [4] and alters the immune system [5]. Though noise is known to affect almost all the systems of the body, so far very few studies have been done on the effect of noise stress on neutrophil functions. As we are all exposed to noise in our daily lives we found it highly relevant to study the effect of chronic noise exposure on neutrophil functions which are the first line of defence and on haematological parameters in albino rats. II. MATERIALS AND METHODS Wistar strain male albino rats weighing 150-200 gm were used for the study. The animals were reared in the animal house of the Institute and were maintained under standard laboratory conditions with food (Hindustan Lever Ltd., Bangalore, India) and water ad libitum in a 12 hour light and 12 hour dark cycle. Ethical clearance was obtained from the ethical committee of this institute before the commencement of the experiments. The animals were divided into three groups of 9 animals each, as Control (Group 1) and two experimental groups (Group 2 and Group 3). Group 2 animals were exposed to chronic noise stress ( 4hr/day) for fifteen days and sacrificed on the sixteenth day. The Group 3 animals were exposed to chronic noise stress of similar duration for thirty days and sacrificed on the thirty first day. A. Noise Exposure: Broad band (White) noise at 100dB intensity was used for the study. The sound was produced by a white noise generator. This was amplified by an amplifier (40 watt) which was connected to a loud speaker fixed 30cm above the animal cages. A sound level meter (Cygnet, D 2023) was used to measure the intensity of noise. The background noise level in the stress room was at 44±2dB due to the ventilation system. Throughout their stress exposure period these animals remained in the stress room to prevent other unnecessary stress on the animals. B. Biological assays: The blood collection and animal sacrifice was done between 8.00-10.00 a.m in order to avoid variations in the parameters studied due to circadian rhythm. The animals were anaesthetized with ether and stress free [6] heparinized blood samples were collected from the jugular vein for haematological studies and steroid estimation. The spleen, thymus and adrenals were removed, blotted and weighed. The total leukocyte count and differential leukocyte count were determined by standard methods. Neutrophil functions

Page 88

Archana R, American International Journal of Research in Formal, Applied & Natural Sciences, 3(1), June-August, 2013, pp. 88-92

were evaluated by Candida phagocytosis [7] and Nitroblue tetrazolium reduction (NBT) test [8]. Candida phagocytosis assesses the phagocytic ability of the neutrophils. The number of neutrophils positive for candida ingestion in the 100 neutrophils gives the phagocytic index (PI). The total number of candida albicans counted within the 100 positive cells divided by 100 gives the mean particle number or the avidity index (AI). NBT assesses the killing ability of the neutrophils. When neutrophils are exposed to the yellow dye NBT, it is taken by the cells into phagosomes and intracellular reduction of the dye converts it to an insoluble blue crystalline form (formazon crystals). 100 cells were observed and the positive cells with the formazon granules were counted. The plasma corticosterone level was estimated by spectrofluorimetric method [9]. C. Statistical Analysis: The data obtained in this study was statistically analysed using One Way Analysis of Variance (ANOVA) followed by Tukey’s Multiple comparison test. The values were expressed in the Table1, Table 2 and Table 3 as mean±standard deviation. P<0.05 was considered statistically significant. III. RESULTS Chronic noise stress caused enhancement of the neutrophil functions (Table 1). A significant increase in the NBT reduction and in candida phagocytosis as indicated by an increase in the PI and AI were observed in the stressed animals. No changes were observed in the total leukocyte count (Table 2). The lymphocyte count was increased , neutrophil count was decreased and a suppression in corticosterone level was observed. Noise exposure for 15 days caused a significant increase in the organ weight of spleen, thymus and adrenal gland (Table 3). Table 1: Effect of noise stress on Neutrophil functions Parameters

Control

15 day noise stress

30 day noise stress

Phagocytic Index

65.5±.53

85.06±.66

72.8±.73

Avidity Index

2.31±.03

3.72±.02

2.98±.11

NBT (%)

9.8±.23

29.4±.67

50.27±.98

Table 2: Effect of noise stress on total leukocyte count and differential leukocyte count Parameters Total leukocyte count (cu mm)

Control 14317±547

15 day noise stress 11022±474

30 day noise stress 13870±796

DC - Lymphocyte % DC - Neutrophil %

68.9±.54 20.65±.35

79.7±.71 10.06±.36

81.1±.53 8.47±.35

Table 3: Effect of noise stress on organ weight and plasma corticosterone level Parameters

Control

15 day noise stress

30 day noise stress

Organ weight -Adrenal

.207±.003

.284±.005

.211±.006

Organ weight -Spleen

3.84±.11

4.49±.24

3.91±.21

Organ weight-Thymus

1.14±.04

2.05±.08

1.22±.03

Corticosterone (µg/dl)

42.38±1.26

10.89±.28

15.77±1.42

Page 89

Archana R, American International Journal of Research in Formal, Applied & Natural Sciences, 3(1), June-August, 2013, pp. 88-92

Page 90

Archana R, American International Journal of Research in Formal, Applied & Natural Sciences, 3(1), June-August, 2013, pp. 88-92

IV. DISCUSSION The exposure to chronic noise stress caused an increase in the percentage of lymphocytes and a decrease in the neutrophil percentage with no significant changes being observed in the total leukocyte count. Activation of hypothalamo-pituitary adrenal system leads to the corticosteroid related reduction in absolute number of lymphocytes [10]. In this study, the plasma corticosterone level was significantly lower in the noise stress group compared to the control. Thus the reduced corticosteroid may be the reason for the increased lymphocytes. The percentage of lymphocytes and neutrophils are inversely related to each other both in basal and stressed conditions. Thus the decrease in the neutrophil count could be secondary to the increase in the lymphocyte count. Scanty literature evidence exists on neutrophil function tests in stress. In our previous study in albino rats exposed to acute noise stress, a significant enhancement in candida phagocytosis, increase in NBT reduction, elevated plasma corticosterone level and leukocytopenia was observed indicating that acute noise is a potent stressor causing intense alterations in the neutrophil functions [11]. Phagocytosis is an energy dependant phenomena and cyclic adenosine monophosphate (cAMP) acts as a second messenger. cAMP regulates the selective extrusion of lysosomal enzymes in phagocytosing neutrophils and ability to kill candida albicans. Sympathetic neurohormone (catecholamines) acts through cAMP [12]. Studies in mice exposed to noise stress have shown similar increase in oxidative response of the peritoneal macrophages. Phagocytes have beta adrenergic receptors and possess receptors for neuropeptides. Thus phagocytes can be greatly affected by the nervous system products. So, the phagocytic and oxidative response of neutrophils may be controlled by the sympathetic nervous system [13] which is activated during stress. NBT reduction relies on the generation of bactericidal enzymes like NADPH-oxidase in neutrophils which are essential for normal intracellular killing of foreign antigens. During intracellular killing, the cellular oxygen consumption increases and glucose metabolism reduces the colourless NBT to blue formazan [14].The increased NBT reduction observed in our study may be due to increase in the bactericidal enzymes within the neutrophils caused by noise stress.

Page 91

Archana R, American International Journal of Research in Formal, Applied & Natural Sciences, 3(1), June-August, 2013, pp. 88-92

Noise exposure for 15 days has increased the weight of spleen, thymus and adrenal glands. The increase in the spleen weight may be due to an increase in the number of splenic macrophages [15] The increased organ weight of thymus could be due to an increase in the thymocyte number [16]. This could be due to the effect of the autonomic nervous system which innervates extensively both thymus and the spleen. The autonomic nervous system permits the movement of thymocytes and T cells to the gland by selectively altering the permeability of thymic blood barrier. In our study, chronic (30 day) noise exposure did not alter the organ weight of spleen, thymus and adrenals which might be due to adaptation of the system due to chronic noise stress. Studies were available to show that, changes occurring in adrenal and thymus weight due to acute noise exposure decreased and the response turned into a chronic inhibitory state in chronic noise exposure [17]. No variation observed in the total leukocyte count and the suppression of the corticosterone level observed in this study contradictory to our previous – acute noise stress studies, could be due to the operation of the adaptation process in the animals due to expose to the same stressor over a long period of time. Though the exact mechanism behind this corticosteroid suppression is not fully known, similar adaptive response of corticosteroid has also been reported in rats exposed to one month chronic stress [18]. Further it was shown that repeated administration of noise stress and CRF desensitizes the neurons of the locus coeruleus while acute administration of both activates the locus coeruleus. Using electrophysiological response of locus coeruleus as an assay, it was shown that repeated white noise stress resulted in reciprocal cross-desensitization between the CRF and stress [19]. This interaction between the CRF and the locus coeruleus may be the reason behind the mechanism of adaptive response to stress. Thus exposure to chronic noise acts as a stressor causing definite alterations in the neutrophil functions of albino rats and the influence of noise stress on human neutrophil functions and its impact on immune status needs further in depth study. REFERENCES [1]

[2] [3] [4] [5]

[6] [7] [8] [9] [10] [11] [12] [13] [14] [15] [16] [17] [18] [19]

Fetoni AR, De Bartolo P, Eramo SL, Rolesi R, Paciello F, Bergamini C, Fato R, Paludetti G, Petrosini L and Troiani D. “Noiseinduced hearing loss (NIHL) as a target of oxidative stress-mediated damage: cochlear and cortical responses after an increase in antioxidant defense” J Neurosci. Vol. 3(9) Feb. 2013 273, pp 4011-23. Hammoudi N, Aoudi S, Tizi M, Larbi K and Bougherbal R. “Relationship between noise and blood pressure in an airport environment” Ann vol. 62(3) Jun 2013, pp 166-71. Liu GS, Huang YX, Li SW, Pan BR, Wang X, Sun DY and Wang QL. “Experimental study on mechanism and protection of stress ulcer produced by explosive noise ” World J Gastroenterol. Vol. 4(6) Dec. 1998, pp 519-523. Angrini MA, Leslie JC. “Vitamin C attenuates the physiological and behavioural changes induced by long-term exposure to noise ”Behav Pharmacol. Vol. 23(2) Apr 2012, pp 119-25. Pascuan CG, Uran SL, Gonzalez-Murano MR, Wald MR, Guelman LR, Genaro AM.“Immune alterations induced by chronic noise exposure: Comparison with restraint stress in BALB/c and C57Bl/6 mice” J Immunotoxicol. Jun 7,2013. [Epub ahead of print]. Feldman,S and Conforti, N. “Participation of dorsal hippocampus in the glucocorticoid feedback effect on adrenocortical activity” Neuroendocrinology, vol. 30, 1980, pp 52-55. Wilkinson,P. 1977. In: Techniques in clinical immunology pp212. ed.Thompson RA, Blackwell Publications, Oxford, London. Gifford,R.H. and Malawista,S.E. “A simple rapid micromethod for detecting chronic granulomatous disease of childhood” J. Lab.Clin. Med. Vol 75, 1970, pp 511-517. Mattingly,D. “ A simple fluorimetric method for the study of free 11-hydroxy corticosteroids in human plasma”, J. Clin. Pathol. Vol.15, 1962, pp 374-379. Keller SE., Weiss JM, Schleifer SJ, Miller NE and Stein M. “Stress induced suppression of immunity in adrenalectomized rats” Science vol. 221, 1983, pp 1301-1304. Archana,R. and Namasivayam A. “The effect of acute noise stress on neutrophil functions” Ind. J. Physiol. Pharmacol. Vol. 43, 1999, pp 491-495. Bourne,HR., Lichtenstein,L.M., Melmon,K.L., Henrey,C.S.,Weinsten,Y. and Shearer,G.M. “Modulation of inflammation and immunity by cyclic AMP”. Science vol. 184, 1974, pp 19-28. Spehner,V., De Wazieres,B., Nicod,L., Harraga,S., Roberrt,J.F. and Seilles E. “Auditory stress induced changes in membrane functions of mouse peritoneal macrophages ”. Scand. J. Immunol. Vol.44, 1996, pp 643-647. Freire Garabal M., Nunez M.J., Fernandez Rial J.C., Couceiro J., Garcia Vallejo L., Rey Mendez M., “Phagocytic activity in stressed mice: effects of alprazolam.”Res. Immunol., vol.144, 1993, pp 311-316. Semenov BF, Vargin VV, Ozherelkov SV and Semenova IB. “Stress increases the population of splenic macrophages, permissive for Langat virus, in mice” Zh Mikrobiol Epidemiol Immunobiol.vol. 3, 1998, pp 57-60. Folch H, Ojeda F and Esquivel P. “Rise in thymocyte number and thymulin serum level induced by noise”. Immunol. Lett., vol.30, 1991, pp 301-305. Zheng S, Qian W, Wang B, Shi X, Liang Z, Hu Z. “The stress reaction induced by intensive noise exposure in rat”. Space Med Med Eng (Beijing). Vol.10(5), Oct 1997, pp 333-6. Odio,M., Goliszek,A., Brodish,A and Ricardo,M.J.. “Impairment of immune function after cessation of long term chronic stress.” Immunol. Letters vol. 13, 1986, pp 25-31. Conti,L.H. and Foote,S.L. “Reciprocal cross-desensitization of locus coeruleus electrophysiological responsivity to corticotrophin-releasing factor and stress.” Brain Research vol. 722, 1996, pp.19-29.

ACKNOWLEDGMENT I am grateful to Late Dr.A.Namasivayam for his advice and guidance.

Page 92

American International Journal of Research in Formal, Applied & Natural Sciences

Available online at http://www.iasir.net

Assessment of environmental and ecological quality status in the NE of Moroccan Mediterranean coast 1

M.SADDIK1, and B. ZOURARAH1 Chouaib Doukkali University, Faculty of Sciences, Laboratory of Geosciences Marine and Soil Science - Unit Associated CNRST (URAC 45), Morocco

Abstract: The coastal zone between Nador and El Hoceima has high fisheries potential and ecological importance. Since different sources of stress exist in this area, any scientific exploration were conducted in this area, also the present study was conducted to evaluate environmental quality and to determine health status in this zone based on water physicochemical parameters, sediments analyze , benthic communities and their biological parameters. Sampling was done during 2010, water was sampled with a clean plastic bucket at an average depth of 50 cm, sediment and benthic communities was collected by stainless steel Van Veen grab sampler. Macro-invertebrates were separated, sorted and identified to the lowest possible taxon. In addition, biological parameters such as diversity, richness, biomass and abundance were calculated. In parallel, water physicochemical parameters and sediments chemistry were analyzed using various analysis methods. The result of the biological and physical analysis shows that this zone has a good environmental quality and good ecological status. Keywords: Benthic communities-pollution-Ecosystem health- NE of Moroccan Mediterranean coast I. Introduction Estuarine and coastal areas are complex and dynamic aquatic environment [1]. When river water mixes with seawater a large number of surface water and sediment as a very sensitive issue. The natural processes, such as precipitation inputs, erosion, weathering of crustal materials, as well as the anthropogenic influences, urban, industrial and agricultural activities, calling for increasing exploitation of water ressources, together determine the quality of surface water and sediment in region. A major problem in coastal areas is the anthropogenicallyinduced disturbance of the marine environment. Sediments accumulate natural and anthropogenic compounds from the overlying water. As such, heavy metals, hydrocarbons and other pollutants derived from human activities produce perturbations in the ecosystem; these change its biotic conditions and affect its biota. The study of physical and biological parameters, in such environmental, permits the assessment of environmental and ecological quality status. Various studies have demonstrated that benthic organisms are useful indicators of ecological status, and they respond predictably to various natural and man-induced disturbances (Thouzeau et al, 1991 ; Daner , 1993 ; Ritter and Montagna, 1999). The analysis of changes in benthic communities , using various univariate and multivariate methods, have become an important tool in the assessment and monitoring at the biological effects of marine pollution. II. Presentation of the site The study area located in the Mediterranean coast between EL Hoceima (35° 14 57 N 3° 55 58 w) and Nador (35° 10 42 N, 2° 55 51 W). This area has high fisheries potential and ecological importance, in geographical terms, it’s territory is characterized by: The mountains (35%); the trays 30%); and the Plains (35%). III. Materials and methods A. Site water collection and physicochemical analysis Site water for physicochemical analysis was collected at 8 sampling locations with a clean plastic bucket at an average depth of 50 cm (figure1). Preservation and transportation of the water samples to the laboratory were as per standard methods [2]. Water temperature was measured on the site using mercury thermometer.The salinity was measured using a portable conductivity meter. Dissolved oxygen was determined by (WTW oxi96 oxygen) method. Total suspended solids (TSS) measuring physical pollution, they are evaluated after solubilization of soluble salts. Nitrite analyzed by (ICP-AES) method. The major ions : Chloride (CI-) were measured by method of Mohr [3]. Sodium (Na +) was determined by flame spectrophotometry. Calcium (Ca2+) and magnesium (Mg

Page 93

M.Saddik et al., American International Journal of Research in Formal, Applied & Natural Sciences, 3(1), June-August, 2013, pp. 93-98

2+) were determined by complex metric using a solution of disodium salt of ethylene diamine tetra acetic acid (EDTA) (Ca2+: [4] and Mg 2+: [5]). Trace elements (B, F) analyzed by ICP-MS method. The Sulphates was determined by the nephelometric method [3]. Bicarbonate HCO3-were measured in the laboratory by acid titration using an automatic titrator type crison compact titrator. Figure 1 Study area and Water, Sediment & Benthic samples locations (NE Moroccan coast)

B. Collection and analysis of sediments Surface sediment sample were collected at 10 sampling locations using a stainless steel Van Veen grab sampler. Sediment samples collected for physicochemical analyses were pooled and further treated as one single sample. A simple of each sample was dried at 60°C in oven until constant weight and weighed. Dried sediments were analyzed in order to determine grain size [6], and geochemical analysis .The grain size distribution of a sediment sample is determined by sieving technique . Trace elements (Cu, Cd, Cr, Ni, Pb and Zn) were analyzed by Inductively Coupled plasma Atomic Emission Spectrometry (ICP-AES) method. The distinction between ‘‘polluted '' and'' unpolluted ‘‘sediments were identified according to contamination levels N1 and N2 of French standards [7]. C. Sampling of benthic macrofauna and species identification Benthic fauna was collected at 10 sampling locations (Figure 1). The samples of benthic macrofauna were performed using a Stainless Van Veen grab sampling (0.1 m² surface). Samples are sieved on site with each sample being washed with seawater, throught a 1mm metal mesh sieve. The material retained on the sieve is then transferred to a clearly labelled, airtight container, taking care not to leave animals on the sieve. Alternatively in the field, samples may be potted whole and separately into labelled sealed pots or double plastibag. Samples are subsequently preserved using buffered formalin (50g sodium tetraborate in 2.5 litres of 40 % formaldehyde solution, diluted with seawater to 4% solution), as soon after collection as practicable. Diversity of benthic communities was defined from 4 indices: - Species richness (S) was defined as the total number of taxa, for each taxa, the names of the species were identified using the ERMS (European Register For Marine Species, 2001) [8]. - Abundance (N) was expressed as the number of individuals per m² (calculated as the raw count x 25 ), except for colonial organisms which were counted as present/absent. - Shannon diversity index (H ') calculation employed the natural logarithm opposed to log base 2 (Clarke and Warwick2001). - Evenness index (J '): This index reflects the equal distribution of individuals per species, J varies from 0 (one species in the stand) and 1 (the number of individuals per species is still the same). D. Ecological status of the environment Ecological quality of the environment has been estimated on the macrofauna composition .The implementation of the European Union Framework Directive for coastal waters, various index have been developed. The three most commonly used indices are: the AMBI [9], the BENTIX (Simboura & Zenetos, 2002) [10] and the BOPA [11]. These index are based on the classification of species in different ecological groups (EG) according to their sensitivity / tolerance to stress. These EG are ranked according to their sensitivity to an increasing stress

Page 94

M.Saddik et al., American International Journal of Research in Formal, Applied & Natural Sciences, 3(1), June-August, 2013, pp. 93-98

gradient : EG1 (species very sensitive to organic matter enrichment ) , EG2 (species indifferent to enrichment ), EG3 (species tolerant to excess organic matter enrichment ), EG4 ( second-order opportunistic species favored by excess organic matter enrichment ), EG5 (first- order opportunistic species favored by excess organic matter enrichment ).The proportions of the five ecological groups (EG) were used to calculate the AMBI index ( Borja et al., 2000; Borja and Muxik , 2005), it is calculated using the formula: AMBI =0EG1 + 1.5EG2 + 3EG3 +4.5EG4 + 6EG5.The results of the AMBI calculations can vary between 0 (high ecological Status) and 7 (bad ecological Status ) ( Borja et al., 2003).The BENTHIX index ( Simboura and zenetos , 2002) , the same groups were used, but were proportioned differently EG1 and EG2 were placed in a second group GII , and the calculation was BENTHIX = 6 GI + 2 GII.The result for the BENTHIX index can either be equal to 0 (bad ecological Status) or can vary between 2 (poor ecological Status ) and 6 ( high ecological Status). The BOPA is based on the ratio of opportunistic polychaetes (ie EG4 et EG5 of the AMBI) and amphipods, except Jassa). It is calculated using the formula : BOPA = log10 [(fp / fa + 1) + 1]where (fp) is the polychaetes opportunistic frequency and (fa) is the amphipods frequency (except Jassa spp.).The BOPA index is null only when there are no opportunistic polychaetes, indicating an area with a very low amount of organic matter. Table 1 Ecological status according the three index Index

High

Good

Moderate

Poor

Bad

AMBI

0-1,2

1,2-3,3

3,3-4,3

4,3-5,5

>5,5

BENTIX

6-4,5

4,5-3,5

3,5-2,5

2,5-2

BOPA

0-0,04

0,04-0,13

0,13-0,19

0,19-0,26

0,26-0,30

III. Results and Discussion A. Water parameters The different water quality parameters are shown in Table 2.pH Values ranged between 7.76 and 8.28 pH corresponding to alkaline system.The temperature varied between 20°C and 21.7 °C. Salinity ranged between 36.7 g / l and 37.8 g / l. The values of Dissolved Oxygen obtained reflect well oxygenated water , They ranged between 5.76 mg / l and 7.3 mg / l. Suspended solids varied between 0.8 mg / l and 3.64 mg / l. Concerning major elements, the mean and maximum concentration of N (10.4 to 22.7), Cl (16422-20818), K (286-477), Na (971-1121) , Ca (385-481) ¸Mg (1132-1311), B (4.14 -5.41), F (1.03- 2.1),SO42- (2.03-3.1),HCO3(0.13-0.46). In conclusion the analysis shows that all samples sites had a good water quality. Table 2 The values of water quality parameters collected at 8 stations 6 8,06

8,11

8,28

21,27

20,5

21,04

20,94

37,44

36,88

37,16

36,73

6,22

5,86

6,11

7,12

6,32

2,27

0,8

1,21

0,88

1,05

22,7

9,4

15,6

9,7

12,1

19211

18461

17692

16422

18422

20818

19422

286

319

422

349

395

477

371

1076

1099

1035

996

971

1082

1102

1121

Ca (mg/l)

412

481

400

358

469

416

376

382

Mg (mg/l)

1297

Sample pH

1 8,1

2 7,97

3 8,18

4 7,76

5 7,90

T° (°C)

20,4

20,18

Salinité (g/l)

37,07

37,54

21,03

22,0

37,6

36,92

O2 dissout (mg/l)

7,3

MES (mg/l)

3,64

6,42

5,76

1,38

2,06

N (mg/l)

10,4

Cl (mg/l)

18980

K (mg/l)

398

Na (mg/l)

1272

1182

1246

1311

1132

1170

1411

B (mg/l)

4,5

4,18

5,41

4,63

6,0

4,14

4,99

F (mg/l)

1,3

Sulfates SO42- (g/l) Bicarbonates HCO3- (g/l)

2,65 0,14

3,59

1,2 2,92

1,74 3,1

1,03 2,7

1,7 2,35

2,1 2,22

1,44 1,94

1,32 2,03

0,13

0,17

0,14

0,46

0,18

0,15

0,28

B. Granulometry and distribution of sediments Analysis of the bathymetric map prepared in 2004 by the Moroccan company of ports dredging “ Drapor “ and the grain size analysis of sample sediments collected in the study area (Figure 2 and Figure 3) have Identified three distinct areas (Figure 3): Area 1: located around Cap Ras Afraou shows a very irregular bathymetry , also we notice presence of rocky outcrops underwater. Area 2: located in front of Oued n-Lmaadene and forms a very open bay. This area is represented by sands and silty sands. Area 3: From the East of Sidi Saleh river to the West of the Amekrane river,it’s represented by sandy muds (25 to 90% clay) and vessels.

Page 95

M.Saddik et al., American International Journal of Research in Formal, Applied & Natural Sciences, 3(1), June-August, 2013, pp. 93-98

C. Sediment chemistry The results of chemical analyze (Table 3) show that they have lower levels of N1 values French standards (Geode, 1996). Heavy metals show the mean and maximum concentration: Pb (0-3.9), Cr (4.66 - 16.76), Cd (00.2), Cu (0.87 - 5, 54), Ni (0.1 - 2.3), Zn (8.62 to 23.2). All of the heavy metal concentration in the site was not elevated above N1 level; also the sediments in this area are unpolluted [12]. Table 3 The values of geochemical sediment analysis Sample

Pb (mg/kg)

Cr (mg/kg)

Cd (mg/kg)

Cu (mg/kg)

Ni (mg/kg)

Zn (mg/kg

2,8

5,61

2,72

1,61

16,12

3,2

16,76

1,8

2,3

23,2

4,66

3,24

19,05

2,8

2,25

15,01

3,9

14,72

2,93

0,2

12,16

5,54

1,6

8,62

1,4

12,1

1,8

20,3

1,7

8,6

3,1

0,1

10,6

0,9

5,1

0,2

1,12

11,7

1,3

6,0

0,87

14,1

Norm N1*

100

1,2

276

Norm N2*

200

180

2,4

552

Figure 2 Bathymetry map (in Drapor, 2004) and distribution of sediments at the study area

Figure 3 Sample granulometry

Page 96

M.Saddik et al., American International Journal of Research in Formal, Applied & Natural Sciences, 3(1), June-August, 2013, pp. 93-98

D. Benthic macrofauna A total of 52 taxa were identified in the area study. The Arthropoda Malacostraca is the most speciose taxonomic group with 22 taxa identified (42,3 %of the total). The Annelids (28,84%) and the Molluscs (25%) were the next most speciose group with 15 and 13 taxa respectively. In addition, we notice presence of one (1) Echinoderm , and one (1) Nemertea (Figure5). Annelids are mainly polychaetes. Arthropods are crustaceans mainly dominated by amphipods. Molluscs are divided between Bivalvia and Gastropoda. On the structural level (Figure 6), species richness and abundance vary respectively between 15 and 18 , and between 320 and 920 ind. / Sq. The Shannon diversity index (H ') and the evenness (Pielou ) index (J') vary between 3.5 and 4.5 bits, and between 0.8 and 0.9 respectively. These index shown good structured level of the benthic macrofauna in the study area. Figure 4 Biodiversity of benthic macrofauna in the study area. Ann: Annelids Polycheates, Cru : Crustaceans, Mol : Molluscs, Ech : Echinoderms, Nem : Nemerteans.

Figure 5 Structure of benthic macrofauna populations at the study area

E. Ecological Status of environment The results of the assessment of the ecological quality are shown in Table4.

Page 97

M.Saddik et al., American International Journal of Research in Formal, Applied & Natural Sciences, 3(1), June-August, 2013, pp. 93-98

AMBI index values range between 0.55 (station 9) and 1.07 (station 5). The values obtained at all stations surveyed show a good healthy status of benthic macrofauna populations and, therefore, a good ecological state of the environment in the study area. Same thing for the other two biotic index used in this study: BENTIX and BOPA that reveal states of ecological environment quality varies between good and very good. The values obtained for the BENTIX varied between 4.37 and 5.68 while for the BOPA index shown zero values for all stations, this result is explained by the absence of opportunistic polychaetes in the study sites. In summary, using both AMBI BOPA and BENTIX index shows a very good ecological quality status of this environment. Table 4 Assessment of ecological status in the area study. Stations S1 S2 S3 S4 S5 S6 S7 S8 S9 S10

AMBI

BENTIX

BOPA

1,06 0,87 0,83 1,04 1,07 0,86 0,72 0,48 0,55 0,9

4,96 5,00 4,37 5,05 5,04 5,26 5,09 5,69 5,13 5,04

0 0 0 0 0 0 0 0 0 0

V. Conclusion The European Union Water Framework Directive (WFD, 2000) requires the establishment of methods to quantify the ecological status of water bodies. Biological indicators play a key role in the assessment of ecological status. Biological assessment results need to be expressed using a numerical scale between zero and one, the ‘Ecological Quality Ratio’ (EQR) [13]. The EQR value one represents (type-specific) reference conditions and values close to zero bad ecological status (Figure 1.1). The use of EQRs is prescribed in Annex V, 1.4.1 of the Framework Directive. The present study aims to expand the knowledge of the study coastal area, and to define its environmental and ecological reference state. Analysis values obtained shows that the sediments are not polluted; water has a good quality also this environment is not affected by any pollution. The sedimentary area analysis shows the existence of three types of sediment: mud, sand and rocky outcrop. And the three Marine biotic index calculated shown that this environment had a good ecological quality. VI. References [1] [2] [3] [4] [5] [6] [7] [8] [9] [10] [11] [12] [13]

Morris, A.W., Allen, J.I., How Land, R.J.M., and wood, R.G, (1995). The estuary plume zone: source or sink for land-derived nutrient discharges? Estuarine, Coastal and Schelf Science 40: 387-402. AFNOR Norms for water analysis RODIER J., 1984. L'analyse de l'eau : eaux naturelles, eaux résiduaires, eau de mer, 7e Edition : Dunod, Bordas, Paris. AFNOR NT 90-010 AFNOR T90-203 Folk RL and Ward WC. 1957. Brazos river bar: a study in the significance of grain size parameters. Tulsa, USA. J Sed Petrol 27(1): 3-26. GEODE 2000 Decree of 14 June 2000 (Official Gazette of August 10, 2000) baseline levels to be considered in an analysis of marine or estuarine sediments in natural or port environment, France. ERMS : European Register For Marine Species, 2001. Borja, A., Franco, J., Perez, V., 2000. A marine biotic index to the establish ecology quality of soft-bottom benthos within European estuarine coastal environments. Marine Pollution Bulletin 40, 1100–1114. Simboura, N., Zenetos, A., 2002. Benthic indicators to use in Ecological Quality classification of Mediterranean soft bottom marine ecosystems, including a new Biotic Index. Mediterranean Marine Science 3, 77–111. Dauvin, J.C., Ruellet, T., Derroy, N., Janson, A.L., 2007. The ecological quality status of the Bay of Seine and the Seine estuary: use of biotic indices. Marine Pollution Bulletin 55, 241–257. AFNOR norms. Borja, A., Muxika, I., 2005. Guidelines for the use of AMBI (AZTI’s Marine Biotic Index) in the assessment of the benthic ecological quality. Marine Pollution Bulletin 50, 787–789.

Page 98

American International Journal of Research in Formal, Applied & Natural Sciences

Available online at http://www.iasir.net

Law of convergence of masses Krishna Mohan Agrawal Superintending Engineer (Retd.), Irrigation Department, UP. Abstract: Innovations in all fields as well as Earth Sciences lead to proper progress and people’s prosperity. Progress in knowledge and education means wisdom, vision and all round happiness, calm, peace, progress and confidence on sound scientific footings. Presently most our study seems to be changing views time and again, being unscientific. Evolution of Earth, explained by ‘plate tectonics’, seems to be always changing views and is mostly hypothetical, assuming Earth’s surface to consist of plates, which happened to be close together once, and to be drifting and forming mountain ranges due to collision. Instead Earth’s surface is ‘permanent’ and formed under a well defined scientific process of lava motion governed by ‘Law of convergence of masses’. Thus India occupies its position permanently, since ages. So also all the Continents occupy their present positions permanently since ages. The same explains other evolution, i.e., formation of Moon, formation of inclined axis of Earth, motion along flat disc called the Ecliptic in our ‘Solar system’. It explains as to why Earth attracts masses and the satellites sent away, back to it. In a way it redefines ‘Newton’s law of gravitation’, which presently defines Earth to attract masses, as also all masses are said to attract one another, thus leading to the existence of a ‘Black hole’, attracting all around, even light; proving it a myth. Instead masses pull and move in relational motion only. So knowledge of one kind may lead to several more know how as well, if properly tackled, otherwise not, howsoever hard one may try. So a proper know how is the top priority of society for its prosperity. Therefore all education has to reform itself for the betterment of society. No education which in itself is incorrect can ever hope of doing any good to society, except creating a ground for itself, which may be for a few days only. This applies to our know how of ‘Earth Sciences’ as well. Keywords: Axis, Black-hole, continent, continuance, convergence, Earth, Ecliptic, end, Equator, erupt, Everest, evolution, gravity, height, high, inclination, inertia, lava, law, magma, mass, Moon, motion, mountain, peaks, permanency, planet, pole, pull, tilt, volcano. I. Introduction All bodies in this Universe rotate and revolve. This forms the fundamental principle of all study. But today some studies need review, as gravity, explaining all masses attracting all other masses, evolution of Earth, described by plate tectonics, formation of Moon being described by the collision of a large planet with Earth, a Black hole gobbling all mass around, even light. The whole Universe is a huge mystery, but some of the present studies make it more, being based on unscientific grounds. Here is an attempt to make all study simple and comprehensive, based on sound scientific reason. Most of the present study is based on multiple ifs, reaching conclusions which are doubted and changed, even by those making them. As said above ‘all bodies rotate and revolve’. It defines an orbital and cyclic motion, or ‘to and fro’ motion. This leads to a simple law defined as ‘Law of convergence of masses’. That means that all mass must return back to its ‘Origin’, because of a cyclic motion. This defines the basic nature of ‘All Evolution’. So any study on evolution must mention this cyclic motion. We cannot forget this aspect in our study. As soon as we leave this aspect we go astray and reach nowhere. So we have to remain confined in our study, as all satellites must fall back to Earth, come what may, as Earth pulls back all to itself. So also is the case with our study to remain confined within certain parameters, to make it authentic, credible and progressive. So ‘Convergence of all mass to origin’ is the essence of this presentation on ‘Evolution’. This introduction and view makes the study very simple and comprehensive. II. Law of convergence of masses A stone thrown up from Earth falls back to it. This is due to the process of convergence, to origin, or from where the stone moved. Similarly a manmade satellite, after remaining, operative for some time, extending to several years, returns and falls back to Earth as debris, as did UARS, Upper Atmosphere Research Satellite, fell back to Earth on Sept. 23, 2011. The 6.5-ton satellite was deployed from space shuttle Discovery in 1991 and decommissioned in December 2005. NASA reports that thousands of satellites become defunct and inoperative because they leave their Geo-stationary orbit. Thus every satellite, though tremendously costly and sent with

Page 99

K. M. Agrawal ., American International Journal of Research in Formal, Applied & Natural Sciences, 3(1), June-August, 2013, pp. 99-104

huge precision and precaution, becomes debris one day, just because being unable to surpass the pull backward to Earth, by all the means available to it or man, guiding and feeding it with all the energy possible. On December 7, 2011 NASA gave a news item in the Times of India, that Voyager-1, sent more than three decades ago, is going to become the first man-made vehicle to go beyond, leaving the ‘Solar System’ behind. But at the same time it writes the vehicle to be in ‘stagnation zone’. Even today it is reported in news, to be well inside the boundaries of the Solar System. This signifies that the vehicle has entered a ‘come back zone’. This unsurpassed pull is ‘Convergence’. No mass can leave the ‘Solar system’. III. Convergence cause of all Evolution Thus a satellite meets and gets torn between two type of forces, one thrusting it out and the other pulling it in, to the source. While forces pushing it out are man-made, the forces pulling it in or back are natural, working continuously. Similarly all mass and Evolution is torn between these two types of forces, pushing out and pulling in. Thus all mass and Evolution is working between these two forces, one pushing out and the other pulling in. Similar to the forces launching a man-made satellite outward from a source, all masses get pushed out outward from some source. Similarly also as the satellite is pulled inward back to its source or ‘Origin’, all masses get pulled back to the source, they moved away from. This is because of the continued ongoing affect of forces, still acting as forces of inertia, defined here onward as ‘Convergence’. Thus obviating to the present belief that masses attract each other, as postulated by ‘Newton’s Law of Gravitation’, masses move under the influence of the ongoing rotation, they were undergoing, before departure outward. This forms convergence to the source or Origin. It thus forms into a Universal and most fundamental law, ‘Law of convergence of masses’. While the forces, thus leading a mass to ‘Converge’, to its source hereby seem to be simple and easily defined, the forces pushing it out away need to be well analyzed and understood, too. The forces and the manner that lead a mass to move out from a source, is the basic and most fundamental need of any study, as is ‘convergence’. But in nature all forces are natural, automatically generated, controlled and set in equilibrium. This keeps the whole set of masses establish themselves in space. This study is an attempt to study such type of ‘System Analysis’, generating the masses, making them move out, and converge back to ‘ORIGIN’. Thus ‘Evolution’ is an attempt to study such ‘System Analysis’. An answer seems to lie in the following pages. The study seems capable to explain almost all the formations in a credible, scientific manner, though this study is made to confine to a few aspects only. Some of the formations are being touched herein, to make a feel and need of this study, so as to provide an insight into the subject matter properly. IV. Volcanic Eruption as Source of mass Volcanic eruption is a natural process of mass formation. Magma pushing out of Earth, to great heights, is a regular feature being observed frequently. But this magma again, comes back to Earth, not because of Earth’s attraction, but because of Earth’s rotation. The magma has already been a part of Earth, while inside the Earth’s surface. V. Convergence as Inertia of rotation While inside the Earth’s surface even it was undergoing rotation along with rest of the Earth. So when outside, it is forced to undergo the same rotation or inertia of rotation. It falls back to Earth, instead of going anywhere else. A. Forces affecting lava mass The lava mass gets subjected to the following forces, on the Earth’s surface:1. Anti-clockwise rotation of main Earth, 2. Forces of friction and adhesion between the Earth and lava mass, 3. Effect of viscosity of lava mass, 4. Inertia of rest and inertia of motion of the Earth as well as lava mass. Lava mass moves over the Earth’s surface under the effect of the above forces. Earth rotates anti-clockwise continuously about its axis, forming days and nights. The magma or lava mass starts moving over the Earth’s surface like a football, because of this anti-clockwise rotation. The lava mass which is highly viscous, meets the friction and adhesion of the Earth’s surface. It gets retarded and broken into fast and slow moving layers. B. Slow and fast lava layers The lava mass as described above gets broken into fast and slow moving layers. These form lower and upper layers in contact with the Earth’s surface. While the lower layers get slowed down by constant friction, the upper layers keep moving fast. The Earth’s surface rotates faster along larger circles around the axis, just as along the Equator. But it rotates slower along shorter circles, closer to the axis or poles and least at axis. The slowed down lava mass too, starts leaving the faster outer or larger circles. It starts moving towards inner concentric circles. C. Convex shaped formations The slowed down lava mass leaves the faster outer larger circles. It moves towards inner concentric circles, moving at a slower speed. But in doing so it makes convex shaped traces. As these traces get slower bit by bit, they make convex shaped traces, convex towards inner concentric circles, rotating with a lesser circumferential speed. The upper or faster lava layers keep rotating with higher speed of the larger outer circles. They thus leave

Page 100

K. M. Agrawal ., American International Journal of Research in Formal, Applied & Natural Sciences, 3(1), June-August, 2013, pp. 99-104

traces in the form of the outer larger circles, convex outward or away from the axis. Thus the lower layers meet larger and larger friction in the travel path, resulting into movement towards inner and more inner circles. Slowly they move closer to the axis D. Movement closer to the axis Thus the retarded lava layers move closer towards the axis, resulting into more contact time with the underneath Earth surface. These lava layers slowly get deposited on the Earth’s surface, forming long mountain chains, depositing higher and higher peaks. E. Formation of high peaks Thus lava layers get retarded, move to inner concentric circles. They start depositing on the Earth’s surface underneath, forming mountain chains and tall peaks. The retarded lava layers get more contact time with the Earth’s surface and deposit. Thus higher and higher peaks start forming closer to the axis, because of the snail pace motion there. F. Convergence of lava to axis This makes lava layers get closer, compact showing convergence to the axis, following the anti-clockwise rotation of the Earth. Thus traces developing higher and higher mountain ranges, having tall peaks start forming closer to the axis. The retarded lava layers, thus moving close to the axis, move at a snail pace. They get a large contact time and deposit forming a long chain of extremely tall mountain peaks. G. Formation of the Himalayas The retarded lower lava layers, moving towards the inner concentric circles develop convex shapes towards inner concentric circles and axis as well. The Himalayas thus form a well demarcated convex shape along the southernmost tall ridge, which consists of extremely tall mountain peaks. H. Formation of Mt. Everest This southernmost convex shaped tall ridge consists of the tall peaks reaching above 8000 metres, even containing the tallest peak of Mt. Everest ht. 8848 metres along it. I. Wider eastern Himalayas The fast moving lava layers too move to the inner concentric circles, getting retarded in the later reaches of their travel path. These faster lava layers still do not find enough contact time with the underneath surface. They thus leave traces which do not develop too high mountain ranges. They make traces, convex away from axis shaped. They even remain moving a bit away from the axis, along larger circles. Some of these fast paced lava layers do also move towards the inner concentric circle, and towards the axis, depositing lesser peaks, but forming wider spaced land forms. In the process they leave wider traces towards the axis, too. Thus the wider eastern Himalayas form such convex outward shapes, which develop low peaks as well. J. Westward convergence Thus the Himalayas form into a large bulb shaped eastern high lands. But their inertia of motion makes them keep moving westward. They thus move towards inner concentric circles and closer to axis as well. In the process they too, converge more and more towards the axis. This is signified by huge tapering and thinning westward in the Himalayas. Thus the lava mass gets moved showing tapering fast towards the southern convex tall ridge, in the western Himalayas. K. Axis in the Himalayas The westward tapering or thinning thus points towards the presence of an axis of rotation, there, close to the tall southern convex ridge. The westward tapering or thinning in the Himalayas also points towards a well demarcated process of convergence of the lava mass to an axis, there. The southernmost convex shaped tall ridge, thus points towards the presence of an axis, along it, in the Himalayas, towards which the lava layers moved or converged, once in the history of time. L. Formation of Saltoro ridge But the two type of lava motion, slow and fast, do try to reach the axis. But fast lava layer motion continues to move far away from the axis, due to residual inertia of motion, but still not far enough. It ultimately lays to form an inclined straight line tall ridge, northwestward from the axis. This straight line tall ridge is still available today too, in the form ‘Saltoro ridge’. M. Area susceptible to earthquakes But the shaky and violent formation of these western areas in the Himalayas, make them lay non-compact too, making them highly jointed. These high joints are cause of repeated deep- seated slips leading to frequent high magnitude earthquakes. The areas of Afghanistan particularly, formed from large faster traveling lava layers, away from the axis, are more vulnerable to high magnitude earthquake repeatedly. At the end of winter due to snow fall and later sunshine these areas become more susceptible to high magnitude earthquakes, as the deep seeping water vapourises, but finds it difficult to escape out easily, thus comes out bursting and shaking surroundings. N. Westward convergence of masses There is thus a westward convergence of lava mass observed in the Himalayas, leading to thinning westward, indicating towards the presence of an axis there. A similar process of convergence towards the axis is observed

Page 101

K. M. Agrawal ., American International Journal of Research in Formal, Applied & Natural Sciences, 3(1), June-August, 2013, pp. 99-104

in the formations in the earlier reaches, towards the Himalayas even, even today. This westward convergence towards the axis is further accentuated by the westward thrust of the States of Assam, Arunachal Pradesh, Manipur, Meghalaya, Mizoram, Nagaland and Nagaland forming Seven Sisters, in North-east India. O. Forming of the States of Seven Sisters The lava mass on its way to the inner circles and then towards the axis, passed through these traces. Then it entered the eastern end of the vast Himalayas through Arunachal Pradesh. But even then in doing so the lava layers tried to thrust fast towards the axis, laying the lands of Meghalaya, as a straight line westward, as an arrow, in the ‘Bow and Arrow; arrangement. This westward convex shaped formation strongly points towards the above described, lava laying process, converging towards an axis in the western Himalayas. This indicates to an attempt by the lava layers to reach the axis as early as possible. P. Westward convergence in early traces There is found a similar tendency to move westward towards the inner concentric circles and to the axis in the earlier traces too. As observed in the formation of the Seven Sisters and the eastern Himalayas, in the form of westward convex shaped formations, a similar tendency is seen in other traces formed earlier in the travel path. This westward convex shaped formations are observed along following too, thus pointing towards a travel towards the inner concentric circles, leaving convex traces. 1. Andaman and Nicobar Islands, 2. Malaysia, 3. Indonesia, along Sumatra and Java. Q. Traces made by faster lava layers On the contrary there is a demarcated eastward convex shaped formations along the following: 1. Japan, 2. New Zealand. These two type of land formations point towards the fast type of lava layer movements. While the former traces indicate lava layer travel more and more towards inner concentric circles, they point instead to outer circle lava motion. R. Areas develop shorter peaks But the fast traveling lava layers are not able to form compact rock mass. These land forms do not form very high peaks too, because of less contact time with the inner Earth. The fast motion of lava layers, laying them, make these areas lay in thin strips, which have high dip and non-compact rockmass too, making them highly jointed S. Areas susceptible to earthquakes These highly jointed rock masses are cause of repeated deep seated slips, leading to frequent high magnitude earthquakes. The areas of Japan etc., formed from large faster traveling lava layers, are more vulnerable to high magnitude earthquake repeatedly. At the end of winter due to snow melt under later sunshine these areas become susceptible to high magnitude earthquakes. Here too the deep seeping water vapourises and finds it difficult to escape out easily, thus comes out bursting and shaking surroundings. T. Formation of Moon The axis tilts too, (dealt in a separate article), makes a new Equator as well as new Poles, making Earth’s surface rotate along the new circles, seen today. Thus surface that was moving along the old Equator, has to rotate now closer to the Pole, or along a shorter circle, along it.So the lava ball leaves the Earth’s surface, to remain revolving or ‘Converge’ along its original plane of rotation and flies away as Moon. U. Convergence to original motion Thus even after forming as Moon, the lava ball continues to keep moving along its original plane and with its original speed. This process is defined as ‘Convergence to original motion’. Thus a mass continues to follow its old or original inertia of motion. The Moon seems to move at a tremendous slow speed in an orbit completing its one cycle in a month, about the Earth. While the Earth’s surface seems to rotate faster, as compared to the motion of the Moon. This is so because the Moon revolves in a larger circle as compared to the Earth’s surface. V. Original motion along Ecliptic As described above Moon continues to revolve along its original plane of rotation on the Earth’s surface. Moon revolves almost along the plane of the Ecliptic. Thus original motion or rotation of the lava mass, forming it, took place along the plane of the Ecliptic on the Earth’s surface. Thus original Equator formed in the plane of Ecliptic and Earth rotated along an axis perpendicular to this plane or Ecliptic. The plane of revolution of Moon is a bit inclined to the plane of Ecliptic. It is actually as good as coincident with the Ecliptic. All original motion takes place in the plane of the Ecliptic, which is essence of this or any scientific study, hence onward. W. Earth once formed body of Sun As discussed above Moon revolves in the plane of the Ecliptic, Earth too rotated originally, in the plane of the Ecliptic. Again Earth too revolves in the plane of the Ecliptic. It indicates that as Moon once formed a part of the Earth, the Earth itself formed a part of the body of Sun, around which it revolves. X. All Planets formed body of Sun

Page 102

K. M. Agrawal ., American International Journal of Research in Formal, Applied & Natural Sciences, 3(1), June-August, 2013, pp. 99-104

Moon revolves in the plane of the Ecliptic, as it formed part of the Earth. So also all Planets like the Earth, revolve in the plane of the Ecliptic. It indicates that being a part of the Sun, all Planets rotated originally along the plane of the Ecliptic, itself, with their axes perpendicular to the Ecliptic. Their axes too tilted later to their present alignments, as does that of the Earth, as mentioned above. Also tilting of their axes formed Moons and Rings around them, which too revolve in the plane of the Ecliptic, though showing a bit of inclination, as observed in case of Saturn and Jupiter. Y. Ecliptic is original plane of rotation Original direction of rotation is described as Ecliptic, direction of revolution of all planets in the ‘Solar system’. Thus our ‘Solar system forms a large spiral shaped large flat disc, called the Ecliptic, as discussed in the above pages. Z. Solar system forms a large flat disc As described above our ‘Solar system’ forms a large spiral shaped flat disc, called the Ecliptic. This flat disc of Ecliptic in our ‘Solar system’, signifies ‘continuance of all motion along the original motion, in parts or fragments too, obeying inertia of motion. VI. All motion is evolved from rotation All motion is evolved out of rotation, thus leading to continuance and convergence to the main or source or origin, obeying laws of inertia of motion. Thus this forms a huge flat disc or plane of our ‘Solar system’, where the Sun is the source or ‘Origin’. The same process applies to all type of Evolution, whether large or small, in our ‘Solar system’. The same process applies for the ‘Evolution of the Earth’s surface’. VII. Convergence to original rotation This process of ‘Continuation along the original rotation’, leads to lava mass converge to the axis, seem to be existing in the western Himalayas, as discussed in the above study. VIII. Permanency of Continents The land mass thus formed is seen today even, thus laying foundation to ‘Permanency of Continents is the only reality’. This thus obliterates any drift or motion, as being propagated by ‘plate tectonics’, in the form of a snail pace motion. Thus India occupies its present position permanently since ages, as do all the Continents. IX. Gravity- review This convergence to the original motion, is the only dominating force. This applies to ‘Gravity’, too, which is actually the continuance to the original rotation. This exerts a pull on the moving away object, which has been defined as gravity. But ‘Gravity’ has been wrongly defined as a pull between masses. X. Black Hole ‘Gravity’ has been wrongly defined as a pull between masses. Thus the same has been used to define ‘Black holes’, which has been defined as a very dense mass with huge density. Just because of its huge density a ‘black hole’ is described to pull all the other masses and even light to itself, thus reflecting none. But no such ‘Black hole’ has been discovered, or ever possible, thus justifying a ‘concept of attraction between masses’. This sort of conception needs to be reviewed. XI. Gravity- a new view Thus convergence to the original motion, is the only dominating force. This applies to ‘Gravity’, too, which is actually the continuance to the original rotation, acting as ‘Inertia of motion’. This exerts a pull on the moving away object, which is the real meaning of gravity. So satellites sent away from Earth are pulled back to Earth, due to this convergence, as they form a part of Earth. XII. Discussion & Conclusions All evolution is guided by the most fundamental scientific law ‘Law of convergence of masses’. A mass has an inertia of rotational motion, so it is bound to revolve about the origin or source and return to it. Revolution is transformation of rotation, it had in contact with source or origin. A mass is pulled only towards its own source or ‘ORIGIN’, and towards no other mass, however large. All the masses do pull one another, through the action of centrifugal forces, through the source. So all ‘Universe’ acts as a huge ‘WEB’. So an action is transmitted all around the ‘Universe’, through this ‘WEB’. Permanency of continents-Is a reality. . Plate tectonics explaining Evolution of Earth is absurd. This thus obliterates any drift or motion, in the form of a snail pace motion. Thus India occupies its present permanently since ages, as do all the Continents. Lava mass coming out of the volcano breaks into upper and lower layers, due to adhesion and friction. Lava mass converges towards inner concentric circles and to the axis. An axis of rotation exists originally in the western Himalayas, to which the lava mass converges. While converging towards the axis, lava mass leaves traces, developing tall southernmost convex curve in the Himalayas. The southernmost convex curve in the Himalayas, forms all the tall peaks, above 8000 metre, including the tallest peak of MT. Everest, 8848 metres, due to friction and snail pace lava motion. Fast

Page 103

K. M. Agrawal ., American International Journal of Research in Formal, Applied & Natural Sciences, 3(1), June-August, 2013, pp. 99-104

lava layers also converge towards the axis, but they keep moving a bit away from it, developing lower peaks. These fast moving lava layers form a straight lime inclined tall radial ridge. This tall ridge is called ‘Saltoro ridge’. Lava mass on Earth’s surface moves away as Moon, to converge and revolve along the original rotation over the Earth. This revolves along a flat plane, called Ecliptic. Earth originally rotates in the plane of the Ecliptic. All Planets and all masses revolve in the plane of the Ecliptic, thus converging to the original plane of rotation. It defines adherence of all evolution to the Ecliptic, obeying the initial inertia of motion, and thus ‘Law of convergence of masses’. Ecliptic forms into a large flat plane, maintaining all rotation and revolution, in the ‘Solar system’. Gravity does not act independently for a single mass, with huge density only. It is a relational motion between bodies. Black hole, gobbling up all- is not possible. Acknowledgements: The author thanks all the humanity and parents for this study. References: Any school atlas

Page 104

American International Journal of Research in Formal, Applied & Natural Sciences

Available online at http://www.iasir.net

The Mechanism of Neoarchaean Granitoid Formation: Evidence from Eastern Dharwar Craton, Southern India Jinia Nandy1, Sukanta Dey1 Department of Applied Geology, Indian School of Mines, Dhanbad - 826004, INDIA

Abstract: Field, petrographic and geochemical studies of different suites of granitoids in a critical part of the eastern Dharwar craton, southern India provide information on their petrogenesis and tectonic setting. The area exposes the N-S trending Kadiri greenstone belt. A sanukitoid-like granitoid is exposed along the eastern margin of the belt which is enriched in LILE as well as ferromagnesian elements. It is interpreted to be derived from a metasomatized mantle in a subduction zone. Along the western margin a transitional TTG is emplaced as a linear body probably derived from a mafic source with some felsic crustal material. Various other types of granitoids in the area include highly silicic foliated gneisses, K-rich biotite granites and HFSEenriched granites with geochemical characteristics consistent with derivation from crustal melting. A subduction zone setting characterized by melting of metasomatized mantle wedge, slab- break-off, asthenospheric upwelling and crustal reworking are envisaged to explain occurrence of various types of granitoids in the area. Keyword: Granitoid; petrography; geochemistry; petrogenesis; tectonics. I. Introduction Archaean cratons are dominated by granitoids. However, the exact mechanism of formation of Archaean granitoids is still being actively debated. Detailed field, petrographic and geochemical study of these granitoids, nevertheless, can provide important insights in to the magma generation processes, crust-mantle interaction and tectonic history of Archaean terrains. The eastern Dharwar craton (EDC), southern India is a collage of N-S trending narrow ~2.7 Ga greenstone belts interleaved with various types of 2.7-2.5 Ga granitoids [2] (Fig. 1). These granitoids include gneissic tonalite-trondhjemite-granodiorite (TTG), transitional TTG, sanukitoid, K-rich anatectic granite and A-type granite whose origin and tectonic setting are highly controversial [2], [10], [11], [17]. Various tectonic models were suggested for the Neoarchaean evolution of the EDC including (a) subduction zone setting with successive accretion of arcs [2], [3] (ii) plume related crustal growth and crustal recycling [10], [11] and (iii) juvenile magmatic accretion and syn-convergence flow of soft, buoyant crust in a hot orogen [5]. In this communication we report field, petrographic and elemental characteristics of granitoids from a critical part of the EDC surrounding the Kadiri Township (Fig. 1). These information are utilized to discuss the petrogenesis of the granitoids and their possible tectonic setting. II. Field setting The area exposes N-S trending Kadiri greenstone belt hosting basalts, andesites and dacites [9]. During the course of the present work five suits of granitoids were recognised. Along the eastern margin of the Kadiri greenstone belt, a medium to coarse grained linear body of greenish grey hornblende-biotite granitoid is exposed. This granitoid is moderately deformed, foliated and hosts mafic microgranular enclaves. These enclaves are stretched and parallel to the foliation which suggests synmagmatic deformation (Fig. 2a). Along the western margin of the Kadiri belt, a sheet like body of grey biotite (Âą hornblende) granitoid is exposed with prominent mineral lineation. This granitoid is moderately deformed and banded (Fig. 2b) with rare mafic microgranular enclaves and gneissic xenoliths. Further east and west moderately to mildly deformed, pink and grey biotite leucogranite occupy large area. These granites contain gneissic and surmicaceous enclaves (Fig. 2c). At the southern part of the area a grey, well foliated, gneissic granitoid is exposed. The rock also shows alternate mm scale dark (biotite-rich) and light (quartz-feldspar rich) bands (Fig. 2d). At the north-eastern part of the area an oval-shaped, coarse grained, undeformed pink, porphyritic biotite granite is exposed near Dorigallu village (Fig. 2e).

Page 105

Nandy and Dey, American International Journal of Research in Formal, Applied & Natural Sciences, 3(1), June-August, 2013, pp. 105-109

Fig 1: Geological map of southern India (after Vasundhara Project, Geological Survey of India Special Publication, 1994) showing the location of the study area. CG- Closepet granite.

(a)

(b)

(c)

(d) (e) Fig 2: (a) Stretched mafic microgranular enclave within eastern hornblende-biotite granitoid showing parallel alignment with the foliation. (b) Outcrop photograph of biotite (Âąhornblende) granitoid occurring along the western margin of the Kadiri belt. (c) Biotite-rich surmicaceous enclave within leucogranite. (d) Prominent dark and light banding within foliated gneiss. (e) Coarse grained Dorigallu granite. III. Petrography The eastern hornblende-biotite granodiorite is inequigranular, medium to coarse grained, consisting of plagioclase, quartz, K-feldspar, hornblende and biotite. Rounded plagioclase porphyroclasts are surrounded by granulated quartz grains indicating effect of deformation (Fig. 3a). Stretching of quartz grains and parallel alignment of biotite and hornblende laths imparts a foliation within the rock. Cluster of mafic minerals were noted forming glomeroporphyritic texture. In QAP diagram the samples fall mainly in the granodioritic field (Fig. 4) and will be referred to as eastern granodiorites.The western margin banded grey granitoid is a fine to medium grained inequigranular rock consisting mainly of plagioclase, quartz, K-feldspar and biotite with amphibole in places (Fig. 3b). Some of the plagioclase grains are fractured which are filled up by biotite and quartz grains. K-feldspar commonly shows perthitic texture and contains inclusion of subhedral to euhedral sericitised plagioclase, biotite flakes and rarely quartz. In QAP diagram this rock falls mainly in the monzogranite and granodiorite field (Fig. 4) and will be called western monzogranites. The leucogranites are medium to coarse grained rocks consisting mostly of plagioclase, K-feldspar and quartz with accessory biotite, opaques and zircons showing hypidiomorphic texture. Myrmekite intergrowth is observed within leucogranite (Fig. 3c). Some of the plagioclase grains are zoned. K-feldspar grains show perthitic texture. This rock is mildly to moderately deformed as indicated by bending of feldspar twin laths, kinking of biotite grains and formation AIJRFANS 13-252; ÂŠ 2013, AIJRFANS All Rights Reserved

Page 106

Nandy and Dey, American International Journal of Research in Formal, Applied & Natural Sciences, 3(1), June-August, 2013, pp. 105-109

of subgrains within quartz. In QAP diagram these rocks fall mainly in the monzogranite and syenogranite fields, and will be referred to as leucogranites (Fig. 4). The foliated gneiss is an inequigranular, medium to coarse grained granitic rock showing large porphyroclasts of plagioclase along with some quartz, K-feldspar, biotite and hornblende set in a finer groundmass of quartz, biotite, plagioclase and K-feldspar. Some plagioclase grains acquired subrounded shape due to deformation and rotation (Fig. 3d). Subparallel alignment of biotite grains imparts a prominent foliation within the rock which swerves around the porphyroclast grains. In QAP diagram, this gneissic rock falls mainly in the monzogranite field (Fig. 4). The Dorigallu granite is a coarse grained rock consisting of plagioclase, K-feldspar and quartz with accessory biotite, opaques, zircon, epitode and apatite. Plagioclase grains are subhedral to euhedral in shape and frequently sericitised. K-feldspar grains are large, anhedral to subhedral, showing perthitic texture and include subhedral to anhedral sericitised plagioclase and rounded to subrounded blebs of quartz. Myrmekite intergrowth was also noted. Overall this granite shows hypidiomorphic granular texture (Fig. 3e). In QAP diagram this rock plots within the monzogranite field (Fig. 4).

(a)

(b)

(c)

(d) (e) Fig 3: Petrographic aspects of granitoids. a: Rounded plagioclase porphyroclast (p) surrouded by granulated quartz grains (q) in the eastern granodiorite. Also present are hornblende grains (h). b: Western monzogranite showing inequigranular texture consisting of plagioclase (p), quartz (q) and biotite(b). c: Myrmekite intergrowth (m) associated with feldspar (f), quartz (q) and biotite (b) in the leucogranite. d: Rotated plagioclase porphyroclast (p) surrounded by linear trail of quartz (q) within foliated gneiss. e: Plagioclase (p), microcline (m) and quartz (q) grains forming hypidiomorphic texture within Dorigallu granite.

Fig 4: Quartz-Alkali feldspar-Plagioclase feldspar (QAP) triangular classification of the granitoids. IV. Geochemistry The eastern granodiarites are characerised by wide range of SiO2 (59.7-69.8%) with high Mg# (0.38-0.52), Ba, Sr and ferromagnesian elements. In REE plot, LREE is well fractionated and HREE is moderately fractionated AIJRFANS 13-252; ÂŠ 2013, AIJRFANS All Rights Reserved

Page 107

Nandy and Dey, American International Journal of Research in Formal, Applied & Natural Sciences, 3(1), June-August, 2013, pp. 105-109

with slightly positive to slightly negative Eu anomaly (Fig.5a). The granitoids have primordial mantle (PM)normalized enrichment of large ion lithophile elements or LILE (Ba, Th, U, K, La and Ce) and prominent negative Nb, Ta and Ti anomalies (Fig. 5b). The western monzogranites are more silicic (SiO2 = 66.3–71.6 %), weakly metaluminous rocks with high Na2O (3.92-5.63%) and moderate Mg# (0.34-0.44). REE patterns shows fractionated LREE with moderately fractionated HREE and slightly negative, no or slightly positive Eu anomalies (Fig. 5a). PM-normalized plots are characterized by enrichment of LILE and very distinct negative Nb, Ta and P anomalies (Fig. 5b). The leucogranie are highly silicic (SiO2= 67.4–75.1 %), weakly peraluminous to weakly metaluminous rocks with high K2O (4.07-5.78%) and K2O/Na2O (1.3-1.9). In REE plot, LREE are enriched and highly fractionated, and HREE are moderately fractonated with a negative Eu anomaly (Fig. 5a). PM- normalized plots have distinct enrichment of LILE (especially Rb, U, K, Th, La and Ce) and prominent troughs at Ba, Nb, Sr, P and Ti ( Fig.5b). The foliated gneissic rock is silica enriched (SiO2 = 65.1-72.2%) having moderate to high Na2O (3.85-4.56 %) and Mg# (0.35-0.50) with wide range of MgO (0.42-2.34%), K2O (2.33-4.52%), and K2O/Na2O (0.5–1.2). The rock has low Rb and moderate Ba and Sr. It shows well fractionated LREE and moderately fractionated HREE with slightly negative Eu anomaly (Fig. 5a). PM-normalised plot shows enrichment of LILE with distinct negative Na, Ta, P and Ti anomaly (Fig. 5b). The Dorigallu granite has restricted and high SiO2 (72.2-74.8%) with high K2O/Na2O (1.2-1.7). This granite has low Mg# (0.17-0.26) and relatively higher concentrations of high field strength elements (U,Th, Nb, Ta and Zr). It displays highly enriched and fractionated LREE, and flat HREE with negative Eu anomaly (Fig. 5a). PMnormalised plot shows enrichment of LILE with prominent troughs at Ba, Sr, P and Ti (Fig. 5b).

Fig 5: Chondrite normalized REE (a) and primordial mantle (b) normalized patterns for representative samples of the granitoids. V. Discussion A. Petrogenesis The eastern granodiorite has elevated contents of MgO, Mg# and ferromagnesian elements as well as LILE (K, Ba, Sr) like sanukitoids [18], [15], [7], [6]. The presence of mafic microgranular enclaves and low Rb contents also suggest similarity with sanukitoids [1], [6]. Sanukitoids are generally thought to be produced by partial melting of mantle metasomatized by crustally derived fluid fluxing (mostly in subduction zones). The eastern granodiorites also probably formed in the same way. The western monzogranites have some similarities with TTG like high SiO2 and Na2O, and low ferromagnesian element contents [7], [8]. However, the K2O, Rb, Ba, Th and U contents are higher than typical TTG. So they show intermediate character between typical TTG and K-rich anatectic granite and, therefore, can be termed as transitional TTG [4]. Generally TTG is produced by melting of mafic source [8]. Nevertheless, the LILE enriched character of the western monzogranites suggests presence some felsic crustal material in the source besides mafic rocks [4]. The leucogranites are enriched in SiO2 and LILE but depleted in MgO and Sr. Negative Eu anomaly and low to moderate Sr/Y (3.3-26.1) ratio indicates low pressure melting condition of the source. These are typical granitoids produced by intracrustal melting of Archaean felsic rocks [13], [14], [16], [17], [12]. The foliated gneiss has high SiO2 and Na2O with K2O/Na2O generally lower than 1 similar to those of TTG. However, the K2O, Rb, Th and U contents are higher than typical TTG [8]. Therefore this rock was also generated by melting of a mafic source with some contribution of felsic crustal material. The Dorigallu granite has a ferroan character with enrichment in K, Rb, Pb and HFSE. It is also characterized by high TiO2/MgO, enrichment in LREE and flat HREE with negative Eu anomaly. These characteristics indicate generation from a felsic crustal source at shallow depth with plagioclase in the residue. B. Possible tectonic setting The eastern margin granitoids are more or less similar to Archean sanukitoids. These type of rocks are generally thought to be produced by melting of a metasomatised mantle [7]. Slab-derived fluids and melts generally metasomatize the overlying mantle wedge in subduction zones. So the sanukitoid-like eastern granodiorite

Page 108

Nandy and Dey, American International Journal of Research in Formal, Applied & Natural Sciences, 3(1), June-August, 2013, pp. 105-109

suggests presence of subduction zone in the area. This sanukitoid magma probably supplied heat and fluid in to the arc crust. This process probably triggered melting at the base of the arc and produced transitional TTG (western monzogranites). The production of various types of silicic granitoids (leucogranites, foliated gneiss, Dorigallu granite) indicates a thermal event which induced widespread crustal melting. A scenario of slab breakoff and attendant asthenosphere upwelling can be envisaged supplying abundant heat to the overlying crust. References [1] [2] [3] [4]

[5]

[6] [7] [8] [9] [10]

[11]

[12]

[13] [14] [15] [16]

[17]

[18]

A. Kovalenko, J.D. Clemens, V. Savatenkov, “Petrogenetic constraints for the genesis of Archaean sanukitoids suites: geochemistry and isotopic evidence from Karelia, Baltic Shield” Lithos, vol. 79, 2005, pp.147–160. B. Chadwick, V.N. Vasudev and G.V. Hegde, “The Dharwar craton, southern India, interpreted as the result of Late Archaean oblique convergence”, Precambrian Research, vol. 99, 2000, pp. 91-111. C. Manikyamba, and R. Kerrich, “Eastern Dharwar Craton, India: Continental lithosphere growth by accretion of diverse plume and arc terranes”, Geoscience Frontiers, vol. 3, 2012, pp. 225-240. D.C. Champion, and H.R. Smithies, “Geochemistry of Paleoarchean granites of the East Pilbara Terrane, Pilbara craton, western Australia: Implications for early Archean crustal growth, in:” Kranendonk, M.J.V., Smithies, R.H., Bennet, V.C. (Eds.), Earth’s Oldest Rock, Developments in Precambrian Geology, Elsevier, vol. 15, 2007, pp. 369–409. D.Chardon, M. Jayananda and J.-J. Peucat, “Lateral constrictional flow of hot orogenic crust: Insights from the Neoarchean of south India, geological and geophysical implications for orogenic plateau”, Geochemistry, Geophysics and Geosystems, vol. 12, 2011, Q02005, doi: 10.1029/2010GC003398. H. Martin, J.-F. Moyen, and R. Rapp, “The sanukitoid series: magmatism at the Archaean– Proterozoic transition” Transactions of the Royal Society of Edinburgh, Earth and Environmental Science, vol. 100, 2009, pp.1–19. H. Martin, R.H. Smithies, R. Rapp, J.-F. Moyen, D. Champion, “An overview of adakite, tonalite-trondhjemite-granodiorite (TTG), and sanukitoids: relationships and some implications for crustal evolution” Lithos, vol. 79, 2005, pp.1–24. J.-F. Moyen and H. Martin, “Forty years of TTG research” Lithos, vol. 148, 2012, pp.312–336. K. Satyanarayana, J. Sddilingam and Jagannath Jetty, “Geochemistry of Archean metavolcanics rocks from Kadiri schist belt, Andhra Pradesh, India” Gondwana Research, vol. 3, 2000, pp.235–244. M. Jayananda, H. Martin, J.J. Peucat, and B. Mahabaleshwar, “Late Archean crust mantle interaction: geochemistry of LREE enriched mantle derived magmas. Example of the Closepet batholith, southern India”, Contribution to Mineralogy and Petrology, vol. 119, 1995, pp. 314-329. M. Jayananda, J.-F. Moyen, H. Martin, J.-J. Peucat, B. Auvray, and B. Mahabaleshwar, “Late Archean (2550-2520 Ma) juvenile magmatism in the Eastern Dharwar Craton, Southern India: constrains from geochronology, Nd-Sr isotopes and wholerock geochemistry”, Precambrian Research, vol. 99, 2000, pp.225-254. P. Mikkola, L.S. Lauri and A. Kapyaho, “Neoarchean leucogranitoids of the Kianta Complex, Karelian Province, Finland: Source characteristics and processes responsible for the observed heterogeneity”, Precambrian Research, vol. 206–207, 2012, pp. 72–86. P.J. Sylvester, “Archean granite plutons. In: Condie, K.C. (Ed.), Archean Crustal Evolution”, Amsterdam, 1994, pp. 261– 314. R.H Smithies and W.K. Witt, “Distinct basement terranes identified from granite geochemistry in late Archaean granitegreenstones, Yilgran Craton, Western Australia”, Precambrian Research, vol. 81, 1997, pp. 185–201. R.H. Smithies and D.C. Champion, “The Archaean high-Mg diorite suite: links to tonalite–trondhjemite–granodiorite magmatism and implications for early Archaean crustal growth” Journal of Petrology, vol. 41, 2000, pp.1653–1671. S. Dey, R. Gajapathi Rao, R.A. Gorikhan, D. Veerabhaskar, Sunil Kumar, M.K. Kumar, “Geochemistry and origin of northern Closepet Granite from Gudur- Guledagudda area, Bagalkot district, Karnataka” Journal of the Geological Society of India, vol. 62, 2003, pp.152–168. S. Dey, U.K Pandey, A.K. Rai and A. Chaki, “Geochemical and Nd isotope constraints on petrogenesis of granitoids from NW part of the eastern Dharwar craton: Possible implications for late Archaean crustal accretion” Journal of Asian Earth Sciences, vol. 45, 2012, pp.40–56. S.B. Shirey and G.N. Hanson, “Mantle-derived Archaean monzodiorites and trachyandesites” ,Nature, vol. 310, 1984, pp.222−224.

Acknowledgements JN acknowledges a Ph.D. research fellowship from ISM. SD acknowledges ISM research grant FRS (13)/2010- 11/AGL.

Page 109

American International Journal of Research in Formal, Applied & Natural Sciences

Available online at http://www.iasir.net

Spectrophotometric Determination of Trace Amounts of Samarium in Environmental Samples Pushpa Ratre1 and Devendra Kumar2 Department of Applied Chemistry and Polymer Technology, Delhi Technological University (Formerly Delhi College of Engineering), Shahbad Daulatpur, Bawana Road, Delhi-10042, INDIA 1,2

Abstract: Sm(III) forms two mixed-ligand complexes, a pink colour complex with 2-(5-bromo-2-pyridylazo)-5diethyl-aminophenol (5-Br-PADAP) in the presence of p-tolunenes sulfonic acid (PTSA) at pH 7.0 and a red colour complex in the presence of triton X-100 or Polyethylene-di-isobutyl-glycol-ether (TX-100) and it is extractable with N-p-carboxyphenylbenzohydroxamic acid (PCBHA) in dichloromethane at pH 10.0. The optimum concentration ranges for the determination of Sm(III) are 0.1-3.5 and 0.05-3.0 g mL-1 for the pink and red complexes, respectively. The proposed method has been successfully applied on the mafic rock reference samples, monazite sand and sea water of coastal region of Kerala in India. The average recovery of Sm(III) has been found to be 99.5 ± 0.1% with relative standard deviation (RSD) value ranging between 1.4-7.3%. Keywords: Samarium (III); 5-Br-PADA; TX- 100; PTSA; N-p-carboxyphenylbenzohydroxamic acid

Introduction

Rare earth elements are extremely important due to its applications in nuclear power activities, material science, catalysis, medicine, and life science. So, it is important to determine trace amounts of such element [1], [2]. These elements are widely distributed in low concentration in the Earth’s crust. The vapors or dusts of these elements are highly toxic when inhaled. They tend to remain in the lungs, liver, spleen, and kidneys. Samarium is found along with other members of the rare-earth elements in many minerals, including monazite and bastnasite to the extent of 2.8% [3]. Samarium is used as a gasoline cracking catalyst and a polishing compound, as well as in the iron and steel industries to remove sulfur, carbon, or other electronegative elements[4]. Samarium is mainly used in drugs, electronic, glass, laser, electrical, nuclear and ceramics industries. Samarium is generally used in such applications as neutron absorber in nuclear reactors, quadramet (Sm 153 lexidronam) in the manufacture of drugs, doping calcium fluoride crystals in optical masers or lasers, carbon arc lighting in motion picture industry, etc. The oxide of samarium exhibits catalytic properties in the dehydration and dehydrogenation of ethyl alcohol [5]. SmCo5 has been used in making new permanent magnet materials with the highest resistance to demagnetization of any known material[6]. These uses illustrate the importance of samarium and its compounds in the geological matrices. In the proposed method, Samarium forms stable chelates with 2-(5-bromo-2-pyridylazo)-5diethylaminophenol (5-Br-PADAP) [7]-[9] due to presence of the –N-(CH3)2 and halogen group in the presence of surfactant triton X-100 (TX-100) [10] and p-tolunenes sulfonic acid (PTSA) [11]. Hydroxamic acid and their derivatives are weak organic acids and have low toxicity. It has wide applications in quantitative determination of metal ions in the environment, organic, inorganic and pharmaceutical analysis [12], [13]. N-p-carboxyphenylbenzohydroxamic acid (PCBHA) has various applications in the field of pharmacology, toxicology and pathological areas [14]. This reagent is successfully utilized for the quantitative analysis of samarium ions in monazite sand and seawater samples. The spectrophotometric method is the most popular and cheaper technique for the quantative determination of lanthanide metal ions. A survey of literature reveals that various reagents have been employed for the determination of samarium (III). Soylak et al. [15] used a chrome azurol reagent under borax buffer of pH 7.5

Page 110

P. Ratre et al., American International Journal of Research in Formal, Applied & Natural Sciences, 3(1), June-August, 2013, pp. 110-118

and his method was sensitive but suffered from interferences of metal ions. Mathew et al. [16] and Dey et al. [17] developed a method with low molar absorbtivity, using a reagent 1-(2-pyridylazo)-2-naphthol (PAN) in presence of the surfactant. Gadzhieva et al. [18] developed a less sensitive method, using a 2-(2-hydroxy-3-sulfo-5nitrophenylazo)-naphthalene-1,8-dihydroxy-3,6-disulfonate in the presence of surfactant. Dik et al. [19] developed a less sensitive method in hydrochloric Acid Solution. Agrawal et al. [20] developed a method in narrow pH range, using a N-phenylbenzohydroxamic acid and xylenol orange as reagent for the separation of lanthanoid element. Alaa et al. [21] developed a method with low sensitivity, using a pyrimidine azo derivatives in micelar medium. Mohamed et al. [22] developed a less sensitive method, using a 8-hydroxyquinoline-5-sulfonic acid as reagent which suffered from interference of rare-earth element. Shah et al. [23] developed a method with low molar absorbtivity, using a 4,5,dihydroxy-3-phenylazo-2,7-naphthalene disulphonic acid, disodium salt as reagent at narrow pH range. Lanthanide elements being hard bases tend to form chemical bonds with atoms belonging to the hard acid group. For example, oxygen and lanthanide element tend to form Ln-O bonds. The most common coordination number of lanthanide complex is 8 or 9 due to their large ionic radius [24]. Samarium (III) ions form covalent polar bond with ligands having oxygen donor atoms such as 5-Br-PADAP, TX-100, PTSA and PCBHA reagents. II. A.

Experimental

Material and Methods

All chemicals used were procured from Central Drug House and Sigma Aldich. Millipore double distilled water was used for the preparation of all solutions. a.

Preparation of Substituted Hydroxamic Acid

PCBHA was synthesized by the reaction of equimolar concentration of N-p-carboxyphenylhydroxylamine and N-phenylbenzanilide and crystallizing it in absolute alcohol as reported in the literature [25]. A 4.7 10-3 mol L-1 (0.1%, w/v) solution of PCBHA were prepared in dichloromethane and employed for extraction of Sm(III)-5-Br-PADAP-TX-100 complex. The stock solutions 6.62×10-3 mol L-1 of rare earth ions was prepared in concentrated HCl and HNO3 acids (1:1), respectively. The solutions were heated on a sand bath until the oxides was completely dissolved and diluted with water to the mark in volumetric flasks. The above stock solution was standardized by complexometric method of EDTA [26]. A 8.610-4 mol L-1 (0.03%, w/v ) solution of 5-Br-PADAP in 95.0% ethanol was employed for color development. An aqueous solution of 1.5410-3 mol L-1 (0.1%, w/v) of TX-100 and 5.1410-2 mol L-1 (1%, w/v) solution of PTSA were used. Ammonia buffer solution of pH 8.0 to 14.0 were prepared by mixing a appropriate volume of NH4Cl and NH4OH in 100 ml volumetric flask and Phosphate buffer solution were also prepared by mixing a appropriate volume of 0.1m HCl or 0.1m NaOH into 0.1m disodium hydrogen phosphate and calibrated with digital pH meter (DB-1011) [26]. B.

Apparatus

The absorption spectra of the solutions were recorded on double beam UV-Visible spectrophotometer 54440SS model in the range 300–800 nm using 10 mm quartz cell. A digital pH meter (DB-1011) was calibrated regularly with standard buffer solution of acid and base before use. C.

General Procedure

The pink colored Sm(III)-(PTSA)-(5-Br-PADAP) aqueous complex were prepared by standard solution containing (10-35) g solution of Sm(III) was transferred into 10.0 ml volumetric flask. To the above solution, mix 1.0 mL (1%, PTSA) and 1.0 mL ethanolic solution of (0.03%, 5-Br-PADAP), solution and diluted to final volume upto 10.0 mL with phosphate buffer pH 7.0±0.2 solution and measured absorbance at 565.5 nm against the solvent in which it was prepared. The red color Sm(III)-(TX-100)-(5-Br-PADAP) aqueous complex were prepared by standard solution containing (5.0-30) g solution of Sm(III) was transferred into separtory funnel. Mix 0.5 mL (0.1%, TX-100) and 1.0 mL ethanolic solution of (0.03%, 5-Br-PADAP) solution and diluted to final volume upto 10.0 mL with ammonia buffer pH 10.0±0.2 solution then shaken it vigorously for 1 min with 5.0 mL of PCBHA solution in dichloromethane thereafter washed with 2×2 ml fresh dichloromethane. All extracts after drying over anhydrous sodium sulfate (2 gm) were transferred to a 10.0 mL volumetric flask and then made up to the mark with

Page 111

P. Ratre et al., American International Journal of Research in Formal, Applied & Natural Sciences, 3(1), June-August, 2013, pp. 110-118

dichloromethane. The absorbance of the complex was finally measured at 590 nm against the solvent in which it was prepared. D.

Sample Preparation and Sampling Method

Digestion of Monazite Sand Sample

A 2.0 g sample of monazite sand was dissolved in the ratio of 3:1:3 mL of HF, HCl, and HNO3 in a glassycarbon dish. The paste obtained was treated with 8.0 mL of HNO3 at 50–60°C to the point of complete distillation of HF. The residue obtained was dissolved in water and transferred to a 100 mL volumetric flask; the solution was diluted to the mark with water. Take a portion of above samples and follow the above Procedure. b.

United State Geological Survey Mafic Rock Reference Samples (USGS) The synthetic samples were prepared as per compositions of USGS mafic rock reference samples.

Sea Water Sample

The monazite sand and sea-water samples were collected from different site of coastal region of Kasargod and Mangalore of Kerala in summer season on the dated 16 April 2013 and 11 June 2013, respectively from India. The sea-water samples were filtered with a membrane filter (pore size 0.45 mm, Millipore) to remove dirt, sand and suspended matter. Take an aliquot of sea water sample, then put into ultrasonicater and leave it for 1h at 60°C, then follow the above procedure. III. Results and Discussion A.

Absorption spectra

Effect of various surfactants and salt on the absorbance of Sm(III) complex was investigated at wavelength of (200-800) nm. Other surfactant such as Brij-35, cetylpyridinium chloride, sodium dodecyl sulfate, Tween-20 were tried, but it turbid the aqueous complex in the pH range of ammonia buffer solution of 8.0-11.0 and 6.0-8.0 of phosphate buffer. The pink colored Sm(III)-PTSA-5-Br-PADAP aqueous complex and red coloured Sm(III)-TX-100-5-BrPADAP-PCBHA organic complex show maximum absorbance at 565.5 nm and 590 nm, respectively with their corresponding blank and solvent and the same is discussed and shown in Table 1 and Fig. 1, respectively.

Figure 1 Absorption spectra of complex of Sm(III)-complex in aqueous(C-1) pH [7.0] and organic phase(C2) pH [10], Sm(III) [7.210-6 mol L-1]; PTSA [2.5710-3 mol L-1],TX-100 [1.510-4 mol L-1]; 5-Br-PADAP [8.610-5 mol L-1]; PCBHA [2.3410-3 mol L-1] B.

Choice of Extraction Solvent

The samarium (III) complex was extractable with many organic solvents such as chloroform, dichloromethane, toluene, benzene, n-butyl alcohol etc. Satisfactory results were obtained only with chloroform and dichloromethane. With other solvents, the molar absorptivity was found to be decreased i.e. 0.95-4.0×104 L mol-1 cm-1. Since dichloromethane is less toxic than the chloroform. So it was chosen as solvent for extraction of Sm(III)complex.

Page 112

P. Ratre et al., American International Journal of Research in Formal, Applied & Natural Sciences, 3(1), June-August, 2013, pp. 110-118

Effect of pH

The effect of different buffer solution on the formation of Sm(III)-PTSA-5-Br-PADAP aqueous complex and Sm(III)-TX-100-5-Br-PADAP-PCBHA organic complex was examined at 565.5 nm and 590.0 nm using buffer solutions of different pH i.e. 8.0-15.0 of ammonia buffer and phosphate buffer of 6.0-11.0. The best results were obtained between 10.0-14.0 pH of ammonia buffer and 7.0-8.5 pH of phosphate buffer as shown in Fig. 2. Moreover, other buffers of citrate, acetate and borax were also tried but satisfactorily result were not obtained.

Figure 2 Effect of pH on the formation of Sm(III)-complex. C-1(Phosphate buffer) and C-2(Ammonia buffer), Sm(III) [2.8610-6 mol L-1]; PTSA [2.5710-3 mol L-1], TX-100 [1.510-4 mol L-1]; 5-Br-PADAP [8.610-5 mol L-1]; PCBHA [2.3410-3 mol L-1] D.

Effects of Reagents

For maximum color development of Sm(III)-(PTSA)-5-Br-PADAP aqueous complex, optimum concentration range of the various reagents are as follows: A (1.71-4.29)  10-5 mol L-1 of 5-Br-PADAP in ethanol, (2.57-5.14) 10-3 mol L-1 aqueous solution of PTSA in distilled water. The Sm(III)-(TX-100)-5-Br-PADAPPCBHA complex showed maximum color development in the concentration range of (7.6-10.0)  10-5 mol L-1 of 5Br-PADAP in ethanol and (1.4-3.0) 10-4 mol L-1 aqueous solution of TX-100 and (2.1-2.6) 10-3 mol L-1 of PCBHA in dichloromethane. E.

Effect of Temeperature, Stability, Electrolyte and Dilution

The study on the variation of temperature for the formation of metal complexes showed no change in the absorbance of the Sm(III) complexes between 10 to 50ºC. Beyond this temperature, the absorbance of the complexes decreased. Hence, all extraction work was carried out at 30ºC. It was observed that the colour of the complexes were stable for 24h. About 1.5 mol L-1 concentrations of KCl/ K2SO4 /NH4Cl did not affect the absorbance and max of the complex. The effect of variation in the volume of the aqueous phase, on the formation of the metal complexes was studied. No change in the absorbance and max of the complex was observed while varying the volume ratio of the organic to aqueous phase from 2:1 to 1:5. Hence 1:1 organic solution was chosen for the entire work. F.

Composition of the Complexes

The composition of the mixed-ligand complexes of samarium were determined by the curve fitting methods as described in Sillen [27] and Job’s continuous variation method [28]. A graph was plotted between log D (distribution ratio) of metal and [ligands]. The stoichiometric ratio of the metal to ligand in the complex was established to be 1:1:1 for [Sm(III): PTSA: 5-Br-PADAP] in aqueous phase. The stoichiometric ratio of the metal to ligand in the organic complex was established to be 1:2:2:2 for [Sm(III): TX-100: 5-Br-PADAP: PCBHA] ( Fig. 3).

Page 113

P. Ratre et al., American International Journal of Research in Formal, Applied & Natural Sciences, 3(1), June-August, 2013, pp. 110-118

Figure 3 Curve fitting method for the determination of Sm(III) to PTSA/5-Br-PADAP(1:1:1) and 5-BrPADAP/TX-100/ PCBHA(1:2:2:2) complex in dichloromethane. The probable reaction mechanism is given below: (i) N O-H+

Sm+3 +

[Sm-L]-

2- (5-Bromo-2-Pyridylazo) -5-Diethylaminophenol

[Sm-L]- + [CH3C6H4SO3H]+

[Sm-L]- [CH3C6H4SO3H]+

p-Tolunenes sulfonic acid

(ii) [Sm-(5-Br-PADAP)2]− + 2[TX-100] + 2[PCBHA]+  {[(TX-100)2 Sm(5-Br-PADAP)2 .(PCBHA)2]Cl}0 Subscript “0” here describes the organic phase. G.

Analytical Parameters

The Sm(III)-(PTSA)-(5-Br-PADAP) and Sm(III)-(TX-100)-(5-Br-PADAP)-PCBHA complex follow Beer’s law up to (0.1-3.5) g mL-1 in aqueous phase and (0.05-3.0) g mL-1 in organic phase, respectively. The slope, intercept and correlation coefficient, detection limit of the method at (2σ) and sandall’s sensitivity of Sm(III)complex are calculated for the complexes and the same are listed in Table I. The precision of the method in terms of the relative standard deviation (n=10) for the determination of 2.5g Sm(III) is ±0.052%. Table I Spectrophotometric characteristics of Sm(III)-complex. Sm(III) [7.210-6 mol L-1] ; TX-100 [1.510-4 mol L-1]; PTSA [2.5710-3 mol L-1], 5-Br-PADAP [8.610-5 mol L-1]; PCBHA [2.3410-3 mol L-1]. Sm(III)-complex

Sm(III)-TX-100-5-Br-PADAPPCBHA-Dichloromethane pH 100.2 Sm(III)-PTSA-5-Br-PADAP (Aqueous complex) pH 7.00.2

max, nm

(ε), L mol-1 cm-1 Beer’s law, g/mL

590.0

1.42×105

565.5

1.27×105

Detection limit ng/mL

0.05-3.0

21.0

0.1- 3.5

11.0

Sandell’s sensitivity (ng/cm2)

10.50

5.78

Intercept / slope / correlation coefficient

0.094 /0.0006 / ±0.996

0.82/ 0.005 / ± 0.995

Page 114

P. Ratre et al., American International Journal of Research in Formal, Applied & Natural Sciences, 3(1), June-August, 2013, pp. 110-118

Effect of Foreign Ion

The variable amounts of foreign ions were introduced into a [7.210-6 mol L-1] of Sm(III) complex. If there is some small change in the absorbance, then  2% tolerance limit for the ions can be considered. The methods are free from the interference of alkaline and alkaline earth metal and lanthanide group of metal ions. However, some transition metal ions such as Co(II), Ni(II), Cu(II), Pd(II) and Ru(III) were found to interfere with complexes which were effectively masked by the addition of EDTA prior to extraction and the same is shown in Table II. Table II Tolerance limit (TL) of diverse ion in the determination of [7.210-6 mol L-1] Sm(III)-complexes Ions added

TL, mg 10 mL-1 aqueous phase1

TL, mg 10 mL-1 organic phase2

Relative error, %

Ru(III) Co(II) ,Cu(II) Rh(III)

0.1** 0.2* 0.3

0.25** 0.34* 0.45

0.4 -1.9 -1.2

Ni(II) Pd(II) Th(IV) Pt(IV), Ce(IV), U(VI), Eu(III), Gd(III), Nd(III), Y(III), Yb(III), Fe(III) Mn(II) V(V), Pr(III) Nb(V), Ho(III),Tb(III),Tm(III) Bi(III), La(III) Os(VIII) Zr(IV) Pb(II) Zn(II) Hg(II) Ca(II) Mg(II), Cd(II) Phosphate KSCN Citrate Oxalate

0.4* 0.4** 0.5 0.6

0.6* 0.2** 0.25 0.55

-0.9 0.6 -1.7 -1.9-1.2

0.07 0.20 0.50 0.60 0.80 1.25 2.0 20 50 80 100 1.0 10 20 50

0.14 0.50 0.10 0.50 0.60 2.0 3.0 60 70 100 100 3.0 20 40 100

1.2 1.3 -1.2 0.9 1.1 1.5 0.3 1.4 0.5 -1.2 -1.5 0.9 0.3 -1.3. 1.1

160

170

-1.5

Bromide, Tartrate

EDTA 1000 1000 1- Sm(III)-PTSA-5-Br-PADAP (Aqueous medium at pH [7.0±0.2] 2- Sm(III)-TX-100-5-Br-PADAP-PCBHA (Organic medium at pH[10.0±0.2] * Removed by 0.4 ml of 0.58% EDTA ** Masked with 1 ml, 1% aqueous SCN- solution. Foreign ions interfere when they cause a change in the absorbance of the Sm(III)- complex by   2%.

0.9

Comparison with other methods

The analytical characteristics of some important spectrophotometric methods reported for the determination of Sm(III) reveal the superior part of the present method in terms of sensitivity and selectivity for the detection owing to the negligible interference from the lanthanide ions as listed in Table III. J.

Application of the methods

The methods are successfully applied on USGS mafic rock synthetic samples [29], monazite sand and sea water samples collected from costal region of Kerala in India. The validity of the methods were tested by using a reported method of Soylak et al. [15]. The average concentration of Sm(III) in different sites of costal region of Kerala state of India were found between 0.5 to 6.0 ppm with RSD value ranging between 1.9-2.8%. The average

Page 115

P. Ratre et al., American International Journal of Research in Formal, Applied & Natural Sciences, 3(1), June-August, 2013, pp. 110-118

recovery of Sm(III) were calculated to be 99.5  0.1% with RSD value ranging between 1.4-7.3% as listed in Table IV and V. IV.

Conclusion

In the proposed method, a highly sensitive and selective spectrophotometric method is developed for the determination of trace amounts of Sm(III) in monazite sand and sea water in costal region of Kerala state of India, and in synthetically synthezied standared geological matrices samples. The surfactant, p-tolunenes sulfonic acid (PTSA) and triton-X-100 (TX-100) were used to increase the solubility and decrease the time of colour development of the complexes of samarium. An extacting agent N-p-carboxyphenylbenzohydroxamic acid (PCPBDA) are used due to its high organophilic character, having wide flexibility for the introduction of substituents, and widened acidity range for the formation of metal complexes. The applied methods are free from the interference of the lanthanoid group elements. V.

Acknowledgment

The authors are thankful to Delhi Technological University for providing financial assistence and Lab facilities. Table III Comparative study of analytical potential of samarium(III) method. Reagents

Solvent/Acidity range

ϵ/L mol-1cm-1 ƛmax, nm / Beer’s law( μg/ml)

M:L

Remark

Chrome azurols + Cetylpyridinium chloride 1-(2-pyridylazo)-2-naphthol+ cetyltrimethyl ammonium Bromide, TritonX-100, sodium dodecyl sulphate

Aq / Borax bufferpH, 7.5

1.4×105 / 505 / 0.05-2.0

NPHR / II-Cr+3, and Bi+3 etc

Fe+3

Aq / Borax bufferpH, 6.0-8.0 and ammonical bufferpH, 8.0-10.0

5.8×104, 7.4×104, 5.7×104 / 545, 535, 540 / 1×10-6 3×10-5 mol L-1

1:3

NPHR / Fe+3, Cu+2, Cd+2, Ni+2, Zn+2 and U+4 etc

Disodium 2-(2-Hydroxy-3sulfonic-5-Nitrophenylazo) naphthalene-1,8-Dihydroxy3,6-Disulfonate + CTMA

Aq / pH, 6.0

4.74×10-3 / 529 / 1.20-9.60

1:1:1

NPHR / II-Ca+2, Cu+2 , Al+3 Zr+4, Th+4, Na2HPO4 · 12H2O, F-1 etc

N-phenylbenzohydroxamic acid +Xylenol orange

CHCl3/ pH, 10.0

9.3×104 / 600 / 0.008-3.22

1:2:1

NPHR / II- Y+3

Pyrimidine azo derivatives (Ra, Rb and Rc)+ CTMA or CTMA

CHCl3/ pH, 7.2, 7.7, 8.2

(8.8-9.8)×103 and 3.163.40×103 / 595, 625, and 613 / (- CTMA)- 1.0–8.7, 1.3– 9.4 and 1.2–8.1, (+CTMA) 0.5–3.9, 0.7–4.2 and 0.6– 4.1

+ CTMA, 1:1 -CTMA, 1:2

NPHR / II-Cu+2 Zr+4, Th+4, Na2HPO4· 12H2O, F-1 etc

2.5×10-3 / 410 / 10- 100

1:1

NPHR / II- foreign ions interfere

8-Hydroxyquinoline-5-sulfonic Acid

Aq / pH, 7.0

Ref

4,5,Dihydroxy-3-phenylazo2,7-naphthalenedisulphonic acid, disodium salt (Chromotrope 2R)

Aq / pH, 6.0-9.0

6.01×102 / 550 / NG

1:1

(1) p-Tolunenes sulfonic acid + 5-Br-PADAP (2)TX-100 + 5-Br-PADAP+ N-p-carboxyphenylbenzohydroxamic acid

DCM / phosphate Buffer-pH=6.08.0. Ammonia Buffer pH= 8.0-11.0

Aq-1.27105 at 565.5 / 0.1-3.5 Og-1.42105at 590.0 / 0.053.0

1:1:1 and 1:2:2:2

II-Co+2, Ni+2, Cu+2, Pd+2 and Ru+3 etc

LIGENDS: Aq : Aqueous solution, NG : Not Given, DCM : Dichloromethane, Ra : 5-(20-bromophenylazo)-6-hydroxy pyrimidine-2,4-dione, Rb : 5-(40chlorophenylazo)-6-hydroxypyrimidine-2,4-dione, Rc : 5-(20,40-dimethylphenylazo)-6-hydroxypyrimidine-2,4-dione, -CTMA : Absence of cetyltrimethyl ammonium Bromide , +CTMA : Presence of cetyltrimethyl ammonium Bromide , 5-Br-PADAP : 2-(5-bromo-2-pyridylazo)-5diethylaminophenol, (M:L) : (Metal: Ligand), NPHR : Narrow pH range, II : Ions interference, PM : Present method.

Page 116

P. Ratre et al., American International Journal of Research in Formal, Applied & Natural Sciences, 3(1), June-August, 2013, pp. 110-118

Table IV Concentration of samarium (III) in environmental samples using standared addition method. S. No.

Sample

Sm (III) found by present method [M1]

1. 2. 3. 4.

MS-1 MS-2 SW-1 SW-2

Added 2.0 2.0 2.0 2.0

Actual[M ] 0.612 5.410 0.981 1.200

present method[M2] [ppm]

[ppm] 1

M [ppm ± RSD %] Actual 2.612 ± 2.6 0.613 7.410 ± 2.8 5.410 2.981 ± 2.0 0.984 3.200 ± 4.2 1.216

[ppm ±RSD %] 2.613 ± 5.0 7.420 ± 1.0 2.984 ± 3.0 3.216 ± 1.1

Soylak et al.[15] Reported method [ppm] Actual [ppm ± RSD a%] 0.610 2.610 ± 5.2 5.400 7.400 ± 1.2 0.982 2.982 ± 5.3 1.212 3.212 ± 3.0

LIGENDS: a : Five determination were made MS-1 : 2Monozite sand samples from Kasargod from sea beaches of Kerala. MS-2 : Monozite sand samples from Mangalore from sea beaches of Kerala. SW-1 : Sea water samples from Kasargod from sea beaches of Kerala. SW-2 : Sea water samples from Mangalore from sea beaches of Kerala. M1 : Sm(III)-PTSA-5-Br-PADAP complex (Method) M2 : Sm(III)-TX-100-5-Br-PADAP-PCBHA complex (Method)

Table V Concentration of samarium (III) in synthetic samples. Samples

Synthetic composition of USGS mafic rock references samples (ppm)

M1 [ppm ± RSDa%]

[W-2]

Nb, 5.0; Ni, 52.7; Mo, 2.7; Pb, 5.78; Zr, 75.5; Th, 1.82; U, 0.37; W, 0.196; V, 195.0; Sm, 2.5 Nb, 5.65; Ni, 437.9; Mo, 0.35; Pb, 9.23; Zr, 68.26; Th, 0.39; U, 0.17; W, 0.33; V, 147.5; Sm; 2.5 Nb, 5.59; Ni, 411.88; Mo, 6.68, Pb, 7.77; Zr, 45.54; Th, 0.24; W, 0.544; U, 0.247; W, 0.196; V, 777.7; Sm, 2.5

2.47 ± 2.3

2.50 ± 2.6

2.48 ± 2.5

2.50 ± 2.8

2.50 ± 1.9

2.50 ± 2.0

[DNC-1]

[BIR-1]

M2[ppm ± RSDa%]

LIGENDS: a : Five number of determinations W-2, DNC-1, BIR-1 : Different composition of USGS Mafic Rock Samples M1 : Sm(III)-PTSA-5-Br-PADAP complex (Method) M2 : Sm(III)-TX-100-5-Br-PADAP-PCBHA complex (Method)

VI. [1] [2] [3] [4] [5] [6] [7] [8]

[9] [10] [11]

References

P. Hendersona, General Geochemical Properties and Abundances of the Rare Earth Elements, Amsterdam, Elsevier, 1984. C.P. Marshal and R W Fairbridge, Encyclopedia of Geochemistry, Kluwer Academic Publisher, Dordrecht. Boston, 1999. R. E. Kirk and D. F. Othmer, Encyclopedia of Chemical Technology, vol. 19, 1982, NewYork: Wiley, pp. 836-851. J. Emsley, Samarium, “Nature's Building Blocks: An A-Z Guide to the Elements”, Oxford University Press, Oxford, England. UK, 2001. L. W. Fine and H. Beall, Chemistry for Engineers and Scientists. Philadelphia:Saunders, 1990. A. S. Kim, F. E. Camp and E. J. Dulis, IEEE Trans. Magnetics, vol. 26, 1990, pp.1936. C. R. Hammond, “The Elements, in Handbook of Chemistry and Physics”, 81st ed, CRC press, 2004. S. Biswas, P. N. Pathak and S. B. Roy, “Development of an extractive spectrophotometric method for estimation of uranium in ore leach solutions using 2-ethylhexyl phosphonic acid-mono-2-ethylhexyl ester (PC88A) and tri-n-octyl phosphine oxide (TOPO) mixture as extractant and 2-(5-bromo-2-pyridylozo)-5-diethyl aminophenol (Br-PADAP) as chromophore”, Spectrochim Acta A Mol Biomol Spectrosc., vol. 91, 2012, pp. 222-227. R. Salim and B. Shraydeh, “Spectrophotometric determination of cadmium(ll) using 2-(5bromo-2-pyridylazo)5-diethylaminophenol”, Microchem. J., vol. 34, 1986, pp. 251-253. N.M. Modawe and M.A.Z.E. Hayeb, “H-Point standared addition method for simultaneous spectrophotometric determination of cobalt(II), nickel (II)”, Adv. Ana. Chem.,vol. 3(1), 2013, pp.1-7. S. Padmanabha and V. Suryanarayana Rao, “spectrophotometric determination of trace copper in industrial waste after preconcentration with 4-Hydroxybenzaldeyde thiosemicarbazone in presence of micellar medium”, Water res. Develop., vol-1(2), 2011, pp. 63-66.

Page 117

P. Ratre et al., American International Journal of Research in Formal, Applied & Natural Sciences, 3(1), June-August, 2013, pp. 110-118

[12]

[13]

[14] [15] [16]

[17] [18]

[19] [20] [21] [22] [23] [24] [25] [26] [27] [28] [29]

Y. K. Agrawal, S. K. Menon and K. R. Patel, “Extraction and micro-determination of vanadium(V) in the environment with αphenylstyrylacrylosubstituted hydroxamic acid and Aliquat 336 and inductively coupled plasma atomic emission spectrometry”, Microchim. Acta, vol. 130, 1999, pp. 219-224. H. Jahangirian, J. Haron, S. Silong, N. A. Yusof, K. Shameli, S. Eissazadeh, R. R. Moghaddam, B. Mahdavi and M. Jafarzade, “Antibacterial effect of phenyl fatty hydroxamic acids synthesized from canola oil”, J. Medi. Plants Res., vol. 5(19), Sept. 2011, pp. 4826-4831. J. Jiang, A. T. Sahu, V. krchnak, A. jedinak, G. E. Sandusky, D. Sliva, “NAHA, a Noval Hydroxamic acid Derivatives, Inhibit growth and Angiogenesis of Breast cancer in vitro and in vivo”, Mar 2012, pp. 29-31. M. Soylak and T. Orhan, “Spectrophotometric determination of samarium(III) with chrome azurol S in the presence of cetylpyridinium chloride”, Talanta, vol. 53, Mar. 2000, pp. 125-129. A. V. Mathew, K. Kumar, I. M. Rao, “A. Satyanarayana and P. Shyamala, Spectrophotometric determination of neodymium(III), samarium(III) in micellar medium – An alternative to solvent extraction procedures”, Ind. J. chem. Techno., vol. 19, Sept. 2012, pp. 331-336. A .K. Dey and N. K. Munshi, “Spectrophotometric determination of lanthanides using 4-(2-Pyridylazo) resorcinol”, Microchim. Acta, vol. 59, 1971, pp. 751-756. S. R. Gadzhieva, F. M. Chyragov and F. E. Guseinov, “Spectrophotometric study of the complexation of samarium(III) with disodium 2-(2-hydroxy-3-sulfo-5-nitrophenylazo)naphthalene-1,8-dihydroxy-3,6-disulfonate in the presence of cetyltrimethylammonium bromide”, J. Anal. Chem., vol. 60, Nov. 2005, pp. 819-821. T. A. Dik, N. N. Kostyuk and A. G. Trebnikov, “Spectrophotometric determination of Sm(III) content in hydrochloric acid solution”, J. Appl. Spectro., vol. 70, 2003, pp. 729-732. Y. K. Agrawal and P. T. Thomaskutty, “Separation and microdetermination of rare earth metals with N-phenylbenzohydroxamic acid and xylenol orange”, J. Radioanal. Nu. Chem., vol. 116, April 1987, 365-374. S. Alaa and A. S. Ibrahim, “Complexation and spectrophotometric study of samarium(III) using pyrimidine azo derivatives in the presence of cetyltrimethyl ammonium bromide”, Anal. Lett., vol. 43, Dec. 2010, pp. 2598-2608. Mohamed, M. T. Hafezand and M. Zaki, “Application of 8-hydroxyquinoline sulfonic Acid in the spectrophotometric determination of Some lanthanides”, Microchem. J., vol. 34, May 1986, 258-261. V. L. Shah and S. P. Sancal, “A spectrophotometric study of the chelates of chromotrope 2R with praseodymium, neodymium, samarium and europium”, “Microchem. j., vol. 14, Nov. 1969, pp. 261-270. C-H Huang, Rare Earths Coordination Chemistry-Fundamentals and Applications, Wiley-Blackwell, Oxford, 2010. H. Agarwal, O.P. Agarwal, R. Karnawat, I.K. Sharma and P.S. Verma, “Synthesis, characterisation and biocidal studies of some hydroxamic acids”, The Inter. J. of Appl. Bio. and Pharma. Techn., vol. I (3), Dec. 2010, 1293-1299. T. S. West, Complexometry with EDTA and Related Reagents, 3rd ed., Broglia Press, London, 1969. L.G. Sillen, Some graphical methods for determining equilibrium constant II. On “ curve-fitting” methods for two-variable data’, Acta Chem Scan, vol. 10, 1956,186-202. P. Job, “Job plot”, Ann Chim, vol. 9, 1928, pp. 113-203. F. J. Flanagan, United State of Geological Survey Bulletin 1623, Three USGS Mafic Rock Reference Samples, W-2, DNC-1, and BIR-1, US: Library of Congress Cataloging in Publication Data, 1976.

Page 118

American International Journal of Research in Formal, Applied & Natural Sciences

Available online at http://www.iasir.net

ISSN (Print): 2328-3777, ISSN (Online): 2328-3785, ISSN (CD-ROM): 2328-3793

PHYTOREMEDIATION OF CADMIUM AND CHROMIUM FROM CONTAMINATED SOILS USING PHYSALIS MINIMA LINN Subhashini, V and A.V.V.S. Swamy Faculty, Dept. of Environmental Sciences, Acharya Nagarjuna University, Nagarjuna nagar- 522 510, Guntur, Andhra Pradesh, INDIA. Abstract: Heavymetals are currently of much environmental concern. They are harmful to humans, animals and tend to bioaccumulate in the food chain. Activities such as mining, smelting of ores, industrial emissions and application of insecticides and fertilizers have all contributed to elevated levels of heavy metals in the environment. Additional potential sources of heavy metals include irrigation water contaminated with sewage and industrial effluents leading to contamination of soil and water. Phytoremediation of soil metals has been successfully carried out at military sites, agricultural fields, industrial sites and mine tailings. Application of phytoremediation for the clean up of industrial waste dump sites contaminated with toxic metals is another important area that has blossomed in recent years. Phytoremediation is the direct use of living green plants for in situ, or in place, removal, degradation, or containment of contaminants in soils, sludges, sediments, surface water and groundwater. Phytoremediation an environmentally sound technology for pollution prevention, control and remediation. An investigation was conducted to study the heavy metals Cd and Cr accumulation capacity in a fast growing weed plant Physalis minima Linn. The plant fed with to 5ppm heavy metal solution on alternate days for a period of 60 days in pot cultures. After 20, 40 and 60 days, the heavy metal concentrations in P. minima Linn and soil was estimated using atomic absorption spectrophotometer. Heavy metal concentrations increased in all plant parts viz. leaf, stem and roots. The experimental results are compared with those of control. The results showed that roots had higher concentrations of heavy metals when compared to the stem and leaves. The roots were found to accumulate highest concentrations of heavy metals. The results showed that Physalis minima L. has the ability to accumulate these heavy metals in their tissue. The Bio concentration factor (BCF) and Translocation factor (TF) was estimated. Based on the results the plant species Physalis minima L. is a high heavy metal accumulator. Key words: Phytoremediation, hyperaccumulators, Bioconcentration factor, Translocation factor. I. Introduction Geological and anthropogenic activities are sources of heavy metal contamination [7]. Sources of anthropogenic metal contamination include industrial effluents, fuel production, mining, smelting processes, military operations, utilization of agricultural chemicals, small-scale industries (including battery production, metal products, metal smelting and cable coating industries), brick kilns and coal combustion. One of the prominent sources contributing to increased load of soil contamination is disposal of municipal wastage. These wastes are either dumped on roadsides or used as landfills, while sewage is used for irrigation. These wastes, although useful as a source of nutrients, are also sources of carcinogens and toxic metals. Other sources can include unsafe or excess application of pesticides, fungicides and fertilizers [25]. Additional potential sources of heavy metals include irrigation water contaminated by sewage and industrial effluent leading to contaminated soils and vegetables [4]. The mobilization of heavy metals by man (through mining from ores and processing for different applications) has led to the contamination of different environmental segments by these elements. By contaminating food chain, these elements pose a risk to environmental and human health. As a result of their release and presence in the ecosystems, these pollutants are accumulated by living organisms in their bodies and subsequently biomagnified as they pass from one trophic level to the next. Since man also is at the top of food chain, he is vulnerable to heavy metal pollution. According to [20] about 90% of the anthropogenic emissions of heavy metals have occurred since 1900 AD; it is now well recognized that human activities lead to a substantial accumulation of heavy metals in soils on a global scale (e.g. 5.6 â&#x20AC;&#x201C; 38 x 106 kg Cd yr-1). These toxic substances are released into the environment and contribute to a variety of toxic effects on living organisms in food chain by bioaccumulation and bio-magnification [17]. Heavy metals, such as arsenic, cadmium, copper, lead; chromium, zinc and nickel are important environmental pollutants, particularly in areas with high anthropogenic pressure [23]. Higher levels of heavy metals distrub the normal physiology and

Page 119

Subhashini et al., American International Journal of Research in Formal, Applied & Natural Sciences, 3(1), June-August, 2013, pp. 119122

biochemistry of living systems. The most dangerous heavy metals are Pb, Hg, As, Cd, Sn, Cr, Zn and Cu [9]. Among these, Cd and Pb are the most dangerous metals for human health [21]. Currently, conventional remediation methods of heavy metal contaminated soils are expensive and environmentally destructive. Major component of inorganic contaminates are heavy metals [1] they present a different problem than organic contaminants. Soil microorganisms can degrade organic contaminants, while metals need immobilization or physical removal. Thus, metals render the land unsuitable for plant growth and destroy the biodiversity. Plants extract and accumulate metals from soil solution. Phytoremediation is seen as an alternative green solution to the problem. Phytoremediation refers to the use of green plants, soil amendments and agronomic techniques to remove contain or render the pollutants harmless [5] and phytoextraction refers to the use of pollutant accumulating plants that can extract and translocate contaminants to the harvestable parts. As a plant-based technology, the success of phytoextraction is inherently dependent upon proper plant selection. Plants used for phytoextraction must be fast growing and have the ability to accumulate large quantities of environmentally important metal contaminants in their shoot tissue [6]. Phytoremediation an environmentally sound technology for pollution prevention, control and remediation. Several researchers have screened fastgrowing, high-biomass accumulating plants, including agronomic crops, for their ability to tolerate and accumulate metals in their shoots [2]. Phytoremediation, a fast-emerging new technology for removal of toxic heavy metals, is cost-effective, non-intrusive and aesthetically pleasing. It exploits the ability of selected plants to remediate pollutants from contaminated sites. Plants have inter-linked physiological and molecular mechanisms of tolerance to heavy metals. Improvement of plants by genetic engineering, i.e., by modifying characteristics like metal uptake, transport and accumulation and plantâ&#x20AC;&#x2122;s tolerance to metals, opens up new possibilities of phytoremediation. The major processes involved in hyperaccumulation of trace metals from the soil to the shoots by hyperaccumulators include: (a) bioactivation of metals in the rhizosphere through rootmicrobe interaction; (b) enhanced uptake by metal transporters in the plasma membranes; (c) detoxification of metals by distributing to the apoplasts like binding to cell walls and chelation of metals in the cytoplasm with various ligands, such as phytochelatins, metallothioneins, metal-binding proteins; (d) sequestration of metals into the vacuole by tonoplast-located transporters. [24]. Deep rooting plants could reduce the highly toxic Cr VI to Cr III, which is much less soluble and therefore, less bioavailable [11]. Most of the studies on candidate species are mainly based on the interpretation of the analysis of metal concentrations in their plant parts [18, 10]. Cadmium is a chemical element with the symbol Cd and atomic number 48. Cadmium has no known useful role in higher organisms. Cadmium is an extremely toxic metal commonly found in industrial workplaces. Cadmium is an especially mobile element in the soil and is taken up by plants primarily through the roots. The major factors governing cadmium speciation, adsorption and distribution in soils are pH, soluble organic matter content, hydrous metal oxide content, clay content and type, presence of organic and inorganic ligands, and competition from other metal ions. Cadmium is a heavy metal with high toxicity and has an elimination half-life of ten to thirty years [12]. People are exposed to Cd by intake of contaminated food or by inhalation of tobacco smoke or polluted air [13]. Chromium (Cr) is one of the toxic metals widely distributed in nature. It has two forms found in the environment, trivalent and hexavalent. The latter form is considered to be the greatest threat because of its strong oxidizing ability as well as high solubility and availability to penetrate cell membranes [16]. Chromium is considered a serious environmental pollutant, due to its wide industrial applications. Toxic effects of Cr2+ on plant growth and development include alterations in the germination process as well as in the growth of roots, stems and leaves, which may affect dry matter production and yield [22]. Chromium and its compounds have multifarious industrial uses. They are extensively employed in leather processing and finishing, production of refractory steel, drilling mud, electroplating cleaning agents and chromic acid. Hexavalent chromium compounds are used in industry for metal plating, cooling water treatment, hide tanning and until recently, wood preservation. These anthropogenic activities have led to the wide spread contamination that chromium shows in the environment and have increased its bioavailability and biomobility [14]. II. Materials and Methods The plant species belong to Solanaceae family of perennial herbs. Physalis minima L, is known by several names viz., native gooseberry, wild cape gooseberry and pygmy ground cherry. The vernacular names (Telugu, Andhra Pradesh) are kupanti, budda, budama. It is a pantropical annual herb 20-50 cm high at its maturity. Leaves are soft and smooth with entire or jagged margins, 2.5-12 cm long. [15]. Physalis minima L. is commonly found on the bunds of the fields, wastelands, around the houses, on roadsides, etc., where the soil is porous and rich in organic matter. It is an annual herbaceous plant having a very delicate stem and leaves. A small, delicate, erect, annual, pubescent herb, 1.5 meters tall; internodal length, 8.2 cm; more or less the whole plant is pubescent. The plant tends to have a weedy character, often found growing in disturbed sites [8]. Physalis minima L. plants were grown in pots filled with ten kgs of garden soil. The seedlings were collected from the uncontaminated soils. All the selected seedlings were of uniform size and free of any disease symptoms. The heavy metals selected for the study are Cadmium and Chromium. The uptake was estimated for every 20 days for a total period of 60 days, in total plant. In addition a control blank set of experimental pots

Page 120

Subhashini et al., American International Journal of Research in Formal, Applied & Natural Sciences, 3(1), June-August, 2013, pp. 119122

was also maintained. The heavy metals were dissolved in distilled water to prepare stock solution of 1000 ppm for each metal. The calibration curves for each heavy metal were also prepared. A blank reading was also taken to incorporate necessary correction factor. The heavy metal solution of 5mg/L was prepared from the stock and administered to the plants and care was taken to avoid leaching of water from the pots. The metal uptake was estimated once in 20 days. The sample plants were removed from the pots and washed under a stream of water and then with distilled water. The collected plants were air dried, then placed in a dehydrator for 2-3 days and then oven dried for four hours at 100 ºc. The dried samples of the plant were powdered and stored in polyethylene bags. The powdered samples were subjected to acid digestion. 1gm of the powdered plant material were weighed in separate digestion flasks and digested with HNO3 and HCl in the ratio of 3:1. The digestion on hot plate at 110ºc for 3-4 hours or continued till a clean solution was obtained. After filtering with Whatman No. 42 filter paper the filtrate was analyzed for the metal contents in AAS. III. Results and Discussion Phytoremediation an environmentally sound technology for pollution prevention, control and remediation.The present study was designed to investigate the phytoextraction of cadmium and chromium from polluted soil by Physalis minima L. Table 1: Accumulation of Cadmium (mg/kg) in Physalis minima during the experimental period Experimental period

Plant Part

Control

20th day

40th day

60th day

Total Accumulation

Leaf

0.22

0.69

40.16

40.38

40.16

Stem

0.3

1.14

2.1

3.35

3.05

Root Total Accumulation

0.39

6.26

6.73

20.29

19.9

0.91

8.09

48.99

64.02

63.11

The highest concentration of cadmium was observed in 20th day in roots followed by stem and leaves, respectively. In the 20th day observation the accumulations was higher in roots. In the second observation (40th day) Cd highly accumulated in the leaves than roots and stem. Highest accumulation from 20th to 40th day was observed in leaves. In the 60th day observation root concentration higher than the leaves and stem, while root concentration was increased in this period. Finally, it was observed that cadmium accumulated in the order leaf> root> stem. (Table 1). Table 2: Accumulation of Chromium (mg/kg) in Physalis minima during the experimental period Experimental period

Plant part

Control

20th day

40th day

60th day

Total accumulation

Leaf

4.59

5.83

12.13

13.6

Stem

14.12

14.13

19.18

19.55

5.43

Root

19.43

24.36

42.7

49.12

29.69

Total accumulation

38.14

44.32

74.01

82.27

44.12

In 20th day chromium concentration was highly found in roots, after stem and leaves. There is no much change compared with the control plants. 40th day chromium accumulated highly in the roots. During this period there is a much difference in the 20th day and 40th day accumulations by roots, stem and leaves. The chromium was translocated to roots to stem and leaves. By 60th day it was observed that chromium accumulation was high in the root than shoot. There no significant difference in the shoot accumulation, there was a small increase was observed in the shoot part. Finally it was observed that in the total experimental period roots have highly accumulated chromium. Chromium accumulated in the order roots> leaves> stem. The ability of plants to tolerate and accumulate heavy metals is useful for phytoextraction and Phytostabilization purpose, measured using Translocation factor (TF) and Bioconcentration factor (BCF), which are defined as the ratio of metal concentration in plant shoots to roots and the ratio of metal concentration in plant roots to soils, respectively. [3].

Page 121

Subhashini et al., American International Journal of Research in Formal, Applied & Natural Sciences, 3(1), June-August, 2013, pp. 119122

Table 3: Bioconcentration factor and Translocation factor for Cadmium and Chromium for Physalis minima. Heavy metal

Translocation factor

Cadmium

Bioconcentration factor 51.02

Chromium

2.18

0.48

2.17

The identification of metal hyperaccumulators, plants capable of accumulating extra- ordinary high metal levels demonstrates that plants have the genetic potential to clean up contaminated soil. Hyperaccumulators are also characterized by a shoot-to-root metal concentration ratio (i-e. the translocation factor (TF) of more than 1, whereas non-hyperaccumulator plants usually have great metal concentrations in the roots than in the shoots. Several authors [19] include the bioaccumulation factor (BAF) as an element for classification as a hyperaccumulator species. The BCF refers to the plant metal concentration in root and the soil metal concentration ratio. This ratio should be greater than one for inclusion into the hyperaccumulator category. Bio concentration factor and Translocation factor was calculated after the experimental period. Cadmium and Chromium soil background concentrations were 0.39mg/kg and 13.58mg/kg respectively. Cadmium Bio concentration factor was 51.02 Chromium Bio concentration factor was 2.18. Cadmium Translocation factor was 2.17 and Chromium Translocation factor was 0.48. Based on the Bio concentration factor the plant Physalis minima L. as a high heavy metal accumulator. IV. References [1] [2] [3] [4] [5] [6] [7] [8] [9] [10] [11] [12]

[13] [14] [15] [16] [17] [18] [19] [20] [21] [22] [23] [24] [25]

Alloway, B. J., Heavy Metals in Soils (ed Alloway B. J.), Blackie, Glasgow, 1990. Banuelos, G.S., H.A. Ajaw, B. Mackey, L. Wu, C. Cook, S. Akohoue, and S. Zambruzuski., Evaluation of different plant species used for phytoremediation of high soil selenium. J. Environ. Qual. 26:639-646, 1997. Bini, C., L. Gentili, L. Maleci- Bini and O. Vaselli., Trace elements in plants and soils of urban parks (Florence, Italy), Annexed to contaminated soil, Prost, INRA, Paris, 1995. Bridge G., Contested terrain: mining and the environment. Annu. Rev. Environ. Resour. 29: 205-259, 2004. Chaney, R.L., M. Malik, Y.M. Li, S.L. Brown, J.S. Angle and A.J.M. Baker., Phytoremediation of soil metals. Current Opinion in Biotech., 8: 279-284, 1997. Cunningham S.D. and Ow D.W., Promises and prospects of phytoremediation. Plant Physiol., 110, 715-719, 1996. Dembitsky V., Natural occurrence of arseno compounds in plants, lichens, fungi, algal species, and microorganisms. Plant Sci. 165: 1177-1192, 2003. Gamble, J. S., Flora of the presidency of Madras. Bishen Singh Mahendra Pal Singh Publishers.23-A, New Cannaught Place, Dehra Dun- 248001 (India). Vol, II. P- 939, 2008. Gosh S., “Wetland macrophytes as toxic metal accumulators”, International Journal of Environmental Sciences, 1 (4), pp 523528, 2010. Huang, J. W., J. Chen, W. R. Berti, and S. D. Cunningham., Phytoremediation of Lead Contaminated Soils: Role of Synthetic Chelates in Lead Phytoextraction. Environ. Sci. Technol. 31 (3): 800–805, 1997. James, B. R., Remediation-by- reduction strategies for chromate-contaminated soils. Environ. Geochem. Health 23: 175–189. 2001. Jan, A.S., H.A. Roels, D. Emelianov, T. Kuznetsova, L. Thijs, J. Vangronsveld and P. Fagard., Environmental exposure to cadmium, forearm bone density, and risk of fractures: prospective population study for the public health and environmental exposure to cadmium. The Lancet, 353(9159): 1140-1 144, 1999. Jarup, L., M. Berglund, C.G. Elinder, G. Nordberg and M. Vahter., Health effects of cadmium exposure a review of the literature and a risk estimate, Scandinian J Work Envir. & Health, 24 (1): 1-5, 1998. Kotas J, Stasicka Z., Commentary: Chromium occurrence in the environment, and methods of its speciation. Environ Pollut 107:263–283, 2000. Low, T., Wild Food Plants of Australia., ISBN 0-207-16930-6. 1988. Lytle, C.M., F.W. Lytle, N. Yang, J.H. Qian, D. Hansen, A. Zayed and N. Terry., Reduction of Cr(VI) to Cr(III) by Wetland Plants: Potential for in situ Heavy Metals Detoxification. Environ. Sci. Technol., 32: 3087-3093, 1998. Manohar S, Jadia CD, Fulekar MH., Impact of ganesh idol immersion on water quality. Indian J. Environ. Prot. 27(3): 216-220, 2006. Nanda Kumar, P. B. A., V. Dushenkov, H. Motto, and I. Raskin., Phytoextraction: The Use of Plants to Remove Heavy Metals from Soils. Environ. Sci. Technol. 29 (5): 1232-1238, 1995. Nriago JO., Global metal pollution: Poisoning the biosphere. Environment 32:7–33, 1990. Nriagu JO., Toxic metal Pollution in Africa. Science. 223: 272. 1996. Sekara A., Poniedzialek M., Ciura J., and Jedrszczyk E., “Cadmium and lead accumulation and distribution in the organs of nine crops: Implications for phytoremediation”, Polish Journal of Environmental Studies, 14, pp 509-516, 2005. Shanker AK, Cervantes C, Loza-Tavera H, Avudainayagam S., Chromium toxicity in plants – A review. Environ Int 31(5):739– 753. 2005. United States Environmental Protection Agency. Recent Developments for In Situ Treatment of Metal Contaminated Soils. Washington, DC: Technology Innovation Office, 1997. Yang X, Feng Y, He Z, Stoffella PJ., Molecular mechanisms of heavy metal hyperaccumulation and phytoremediation. J Trace Elem Med Biol. 2005; 18(4):339-53, 2005. Zhen-Guo S, Xian-Dong L, Chun-Chun W, Huai-Man Ch, Hong Ch., Lead Phytoextraction from contaminated soil with high biomass plant species. J. Environ. Qual. 31: 1893-1900, 2002.

Page 122

American International Journal of Research in Formal, Applied & Natural Sciences

Available online at http://www.iasir.net

Thermodynamic studies of Oxytetracycline with some transition and rare earth metal ions in mixed solvent media Shailendrasingh Virendrasingh Thakur1, Mazahar Farooqui2, M.A.Sakhare3 and S.D. Naikwade4 1. Department of Chemistry, Milliya College Beed (MS) 431122, INDIA. 2. Post Graduate and Research Center, Maulana Azad College, Aurangabad.(MS) 431003 INDIA. 3. Department of Chemistry, Balbhim College, Beed (MS) 431122, INDIA. 4. Mrs. K. S. K. College, Beed (MS) 431122, INDIA. Abstract: In the present work we investigated the stability constant of Oxytetracycline Hydrochloride drug with transition metal ions Fe, Co, Ni, Cu, Zn, Cd and trivalent rare earth metal ions La, Ce, Nd, Sm, Gd, Tb, Dy using pH metric metric titration technique in 20% (v/v) ethanol-water mixture at three different temperatures (298K, 308K and 318K) and at an ionic strength of 0.1M NaClO4. The method of Calvin and Bjerrum as adopted by Irving and Rossotti has been employed to determine metal-ligand stability constant logK values. It is observed that transition metal ions and lanthanide metal ion forms 1:1 and 1:2 complexes. The trend in the formation constants for transition metal ions follows the order: Fe3+ > Cu2+ > Ni2+ > Zn2+ > Co2+ > Cd2+ and for lanthanide metal ion as: La3+< Ce3+< Nd3+< Sm3+ > Gd3+< Tb3+< Dy3+ and shows a break at gadolinium. Keywords: Stability Constant, Metal complexes, Lanthanide, Thermodynamic parameter, Oxytetracycline Hydrochloride drug.

Introduction

Chemistry of drugs attracts many researchers because of its application in medicinal study. In recent years, medicinal chemistry has undergone a revolutionary change. Rapid advances in the biological sciences have resulted in a much better understanding of how body functions at cellular and molecular levels. As a result, most research projects in pharmacy industry now began by identifying suitable target in body and designing a drug to interact with the target for understanding structure and mechanism. Therefore, research is now target oriented. As drug has various functional groups which can bind to receptor or enzyme or metal ions present in the body, they can conform many type of complexes and can enhance the activity of drug. The stability of metal complexes with medicinal drugs plays a major role in the biological and chemical activity. Metal complexes are widely used in various fields, such as biological processes pharmaceuticals, separation techniques, analytical processes etc. Recently, there has been great interest in heavy-metal pollution and in the design of improved drugs for removing them from plasma. However, before any new pharmaceutical is marketed, it is prudent to know as much as possible about the molecular chemistry of its mode of action. This involves the knowledge of the product of ligand metabolism, the selectivity of the ligand for the pollutant cations with respect to the essential metal ions, the major species present at physiological pH values, the extent to which the ligand and its complexes partition in a cell membrane and the structures of the complexes formed. 1 It is well known that proton transfer plays an important role in the reactions such as complexation, acidâ&#x20AC;&#x201C;base catalyzing and enzymatic reaction2 in aqueous solution. The stability constants can be of significance in order to predict different chemical processes such as isolation, extraction, or preconcentration methods.3, 4 Thus, the accurate determination of acidity and stability constants values are fundamental to understanding the behavior of ligands and their interaction with metal ions in aqueous solution. pH metric titration is accepted as a powerful and simple electro analytical technique for determination of stability constants. The determination of stability constants is an important process for many branches of chemistry.5 For the present investigation, we have selected antibacterial drug Oxytetracycline Hydrochloride (OTC), having molecular formula C22H25ClN2O9 and IUPAC name is (4S,4aR,5S,5aR,6S,12aS)-4(dimethylamino)3,5,6,10,12,12a-hexahydroxy-6-methyl1,11dioxo1,4,4a,5,5a,6,11,12OTCahydrotetracene-2 carboxamide.OTC is used for treatment of infections caused by variety of Gram positive and Gram negative microorganisms including Mycoplasma pneumoniae, Pasteurella pestis, Escherichia coli, Haemophilus

Page 123

S.Thakur et al., American International Journal of Research in Formal, Applied & Natural Sciences, 3(1), June-August, 2013, pp. 123-127

influenzae (respiratory infections) and Diplococcus pneumoniae. OTC is known as a broad-spectrum antibiotic due to its activity against such a wide range of infections. In continuation of our earlier work with complexation of medicinal drugs such as Adenosine6, Imipramine Hydrochloride7, Metformin Hydrochloride8, 9, Isoniazid10. It was thought of interest to study the effect of temperature and evaluated thermodynamic parameters ΔG, ΔH and ΔS of complexes of OTC drug with transition metal ions Fe, Co, Ni, Cu, Zn, Cd and rare earth metal ions La3+, Ce3+, Nd3+, Sm3+, Gd3+, Tb3+, Dy3+ using pH metric titration technique in 20% (v/v) ethanol-water mixture at constant ionic strength of 0.1M NaClO4. Figure 1: Oxytetracycline Hydrochloride

II.

Experimental

a. Materials and Solution: For the present investigation, Oxytetracycline Hydrochloride (OTC) used as ligand is soluble in ethanol. NaOH, NaClO4, HClO4 and metal salts are of AR grade. The solutions used in the pH metric titration were prepared in double distilled water. The NaOH solution was standardized against oxalic acid solution (0.1M) and standard alkali solution was again used for standardization of HClO4. The metal salt solutions were also standardized using EDTA titration. All the measurements were made at 298K, 308K and 318K in 20% (v/v) ethanol-water mixture at constant ionic strength of 0.1M NaClO4. The water thermostat was a Fisher Scientific Isotemperature Refrigerated Circulator, thermostat model 9000 accurate to ± 0.1°C. The solutions were equilibrated in the thermostat for about 15 min before titration. The pH measurement were made using a digital pH meter model Elico L1-120 in conjunction with a glass and reference calomel electrode (reading accuracy ± 0.01 pH units) the instrument was calibrated at pH 4.00, 7.00 and 9.18 using the standard buffer solutions. b. pH metric Procedure: The following sets of solutions were prepared (total volume 50 ml) and titrated pH metrically against standard NaOH solution at temperature 298K, 308K and 318K. (A) HClO4 (2ml) + NaClO4 (5ml) + C2H5OH (10ml) (B) HClO4 (2ml) + OTC (10ml) + NaClO4 (5ml) + C2H5OH (10ml) (C) HClO4 (2ml) + OTC (10ml) + Metal solution (2ml) + NaClO4 (5ml) + C2H5OH (10ml) c. Determination of the thermodynamic parameters: The thermodynamic parameters for formation of complexes are determined. The change in Gibb’s free energy (∆G), of the ligands is calculated by using following equation.

2.303RT log K

(1)

Where R (ideal gas constant) = 8.314 JK-1mol-1 K is the dissociation constant for the ligand or the stability constant of the complex and T is absolute temperature(K) The change in enthalpy (∆H) is calculated by plotting logK vs 1/T The equation utilized for the calculation of changes in enthalpy is as

H 2.303R

Slope

(2)

The evaluation of changes in entropy (∆S) is done by the following equation.

( H

G) T

(3)

Page 124

S.Thakur et al., American International Journal of Research in Formal, Applied & Natural Sciences, 3(1), June-August, 2013, pp. 123-127

Figure 2: Plot of logK1 vs 1/T for Cu (II)-OTC

Figure 3: Plot of logK2 vs 1/T for Cu (II)-OTC

Table 1. Proton-ligand and metal-ligand stability constant of transition metal ions with OTC drug Temperature

pKa

logK

Fe3+

Co2+

Ni2+

Cu2+

Zn2+

Cd2+

298K

4.316

logK1

5.027

3.772

4.726

4.973

3.999

2.955

logK2

4.831

3.019

3.169

4.283

3.107

2.745

logK1

4.719

3.559

4.463

4.667

3.728

2.813

logK2

4.525

2.943

3.358

3.994

2.979

2.660

logK1

4.444

3.341

4.194

4.395

3.553

2.722

logK2

4.252

2.821

3.153

3.748

2.901

2.570

308K

4.010

318K

3.732

Table 2. Metal-ligand stability constant of rare earth metal ions with OTC drug. Temperature

logK

La3+

Ce3+

Nd3+

Sm3+

Gd3+

Tb3+

Dy3+

298K

logK1

4.323

4.431

4.531

4.614

4.460

4.568

4.705

logK2

3.350

3.426

3.730

3.959

3.858

4.094

4.149

logK1

4.026

4.102

4.135

4.312

4.158

4.268

4.389

logK2

3.097

3.267

3.467

3.675

3.574

3.805

3.852

logK1

3.734

3.791

3.828

4.044

3.890

4.003

4.118

logK2

2.901

3.092

3.259

3.438

3.337

3.560

3.611

308K

318K

Page 125

S.Thakur et al., American International Journal of Research in Formal, Applied & Natural Sciences, 3(1), June-August, 2013, pp. 123-127

Table 3. Thermodynamic parameters of OTC complexes formation with transition metal ions. - ΔG KJ / mol

Metal ions

Ni2+

Zn2+

- ΔS KJ / mol

- ΔH KJ / mol

298K

308K

318K

298K

308K

318K

ΔG1=28.68

27.83

27.06

ΔH1=52.88

ΔS1=0.081

0.081

ΔG2=27.57

26.69

25.89

ΔH2=52.59

ΔS2=0.084

0.084

ΔG1=21.52

20.99

20.34

ΔH1=39.05

ΔS1=0.059

0.058

0.059

ΔG2=17.23

17.36

17.17

ΔH2=17.82

ΔS2=0.002

0.002

ΔG1=26.97

26.32

25.54

ΔH1=48.29

ΔS1=0.071

0.071

ΔG2=18.08

19.80

19.19

ΔH2=42.34

ΔS2=0.081

0.073

ΔG1=28.38

27.52

26.76

ΔH1=52.52

ΔS1=0.081

0.081

ΔG2=24.44

23.55

22.82

ΔH2=48.59

ΔS2=0.081

0.081

ΔG1=22.82

21.98

21.63

ΔH1=40.51

ΔS1=0.059

0.060

0.059

ΔG2=17.72

17.57

17.67

ΔH2=18.14

ΔS2=0.001

0.002

ΔG1=16.86

16.59

16.57

ΔH1=21.17

ΔS1=0.014

0.015

0.014

ΔG2=15.66

15.69

15.65

ΔH2=15.87

ΔS2=0.001

0.001

Table 4. Thermodynamic parameters of OTC complexes formation with rare earth metal ions. Metal

- ΔG

ions

KJ /mol

La3+

Ce3+

Nd3+

Sm3+

Gd3+

Dy3+

- ΔH

- ΔS

KJ / mol

298K

308K

318K

ΔG1=24.66

23.74

22.74

ΔH1=52.59

ΔS1=0.094

0.094

ΔG2=19.11

18.26

17.66

ΔH2=40.77

ΔS2=0.073

0.073

ΔG1=25.28

24.19

23.08

ΔH1=58.03

ΔS1=0.110

0.110

ΔG2=19.55

19.26

18.83

ΔH2=30.26

ΔS2=0.036

0.036

ΔG1=25.85

24.38

23.31

ΔH1=63.90

ΔS1=0.127

0.128

ΔG2=21.28

20.44

19.84

ΔH2=42.75

ΔS2=0.072

0.072

ΔG1=26.32

25.43

24.62

ΔH1=51.70

ΔS1=0.085

0.085

ΔG2=22.59

21.67

20.93

ΔH2=47.36

ΔS2=0.083

0.083

ΔG1=25.45

24.52

23.69

ΔH1=51.69

ΔS1=0.088

0.088

ΔG2=22.01

21.08

20.32

ΔH2=47.41

ΔS2=0.085

0.086

0.085

ΔG1=26.07

25.17

24.37

ΔH1=51.58

ΔS1=0.085

0.086

ΔG2=23.36

22.44

21.67

ΔH2=48.47

ΔS2=0.084

0.085

0.084

ΔG =26.84

25.88

25.07

ΔH1=53.35

ΔS1=0.089

0.089

ΔG2=23.67

22.72

21.98

ΔH2=48.85

ΔS2=0.084

0.085

III.

298K

308K

318K

Results and Discussion

The results obtained are analyzed by the computer programme and the stability constant values are calculated. Oxytetracycline Hydrochloride contains four hexacyclic rings. There are six hydroxyl groups attached to different rings. Out of six one is phenolic -OH, remaining is cyclic alcoholic -OH groups. The rings also possess two exocyclic carbonyl groups, one tertiary amino group and one amide (CONH2) group. The dimethyl ammonium group has been considered to be the most basic functional group of tetracyclines, therefore the metal can be attached either to the tricarbonyl-methan or the phenol-diketone areas.11 The OTC under experimental

Page 126

S.Thakur et al., American International Journal of Research in Formal, Applied & Natural Sciences, 3(1), June-August, 2013, pp. 123-127

condition shows only one protonation constant that too in acidic range. Instead of the hydroxyl groups and carbonyl groups, nitrogen of amide or tertiary amino group might be involved in the protonation. The possibility of ternary group is ruled out due to steric hindrance. Moreover, the pKa value (4.316) is close to the amide group. Hence deprotonation-protonation equilibria might be taking place at amide groups only. The proton ligand stability constant pKa of OTC drug is determined by point wise calculation method as suggested by Irving and Rossoti. Metal ligand stability constant logK of transition and rare earth metal ions with OTC drug are calculated by point wise and half integral method of Calvin and Bjerrum as adopted by Irving and Rossotti has been employed. For the present investigation we have studied the stability constant of transition metal ions and trivalent rare earth metal ions. Since we got

between 0.2 to 0.8 and 1.2 to 1.8 indicating 1:1 and 1:2

complex formations. The proton-ligand stability constants pKa values decreases with increase in temperature i.e. the acidity of the ligands increases.12 This suggests that liberation of protons becomes easier at higher temperature. The negative values of change in Gibb’s free energy ΔG indicates that both dissociation of the ligand and the complexation process are spontaneous.13 A decrease in metal-ligand stability constant logK with an increase in temperature and the negative values of enthalpy change (ΔH) for the complexation suggests that all the complexation reactions are exothermic, favorable at lower temperature and the metal-ligand binding process is enthalpy driven14 and metal-ligand bonds are fairly strong. The changes in entropy (ΔS) values are all negative; the complexation has an unfavorable change of entropy. An extensive solvation of metal chelates in aqueous-organic medium15 for all the transition and rare earth metal complexes may also be responsible for the negative ΔS values. The order of stability constants for transition metal complexes was as: Fe3+ > Cu2+ > Ni2+ > Zn2+ > Co2+ > Cd2+ Which are in accordance with the Irving-Williams natural order.16, 17 The order of stability constants for rare earth metal complexes was as: La3+< Ce3+< Nd3+< Sm3+ > Gd3+< Tb3+< Dy3+ and it shows a break at gadolinium. IV.

Conclusion

The transition metal and rare earth metal ion forms 1:1 and 1:2 complexes with OTC drug. The metal-ligand stability constant logK decreases with an increase in temperature and shows a break at gadolinium. The negative value of change in enthalpy (ΔH) for the complexation suggests that all the complexation reactions are exothermic, favorable at lower temperature. The negative change in free energy (ΔG) values indicates that both dissociation of the ligand and the complexation process are spontaneous. The negative change in entropy (∆S) values indicated a highly solvated metal complexes. V.

References

[1] S. Monica, I. Daniela and M. Ledi, J. Inorg. Biochem., 78, 355, 2000 [2] I. Ando, K. Ujimto and H. Kurihara, Bull. Chem. Soc. Japan., 55,713, 1982 [3] E.A. Gracia and D.B.Gomis, Mikrochem. Acta., 124, 179, 1996 [4] S.Cao and M.J.Zhang, Trace Microprobe Tech., 17, 157, 1999 [5] R.J. Motekatis and A.E. Martell, The determination and use of stability constants, VCH, New York, 1988 [6] S.V.Thakur, Mazahar Farooqui and S.D.Naikwade, Int J.Emerging tech.Comp,App.Sci. Ind. Inst. Sci. 4(4), 389-393, 2013 [7] S.V.Thakur, Mazahar Farooqui and S.D.Naikwade, Int J.Emerging tech.Comp,App.Sci. Ind. Inst. Sci. 4(4), 342-346, 2013 [8] S.V.Thakur, Mazahar Farooqui and S.D.Naikwade, J Adv.Sci.Res, 4(1),31-33, 2013 [9] S.V.Thakur, Mazahar Farooqui and S.D.Naikwade, Der chemical sinica., 3(6),1406-1409, 2012 [10] S.V.Thakur, Mazahar Farooqui and S.D.Naikwade, Int.J Res.Inorg.Chem,1(4), 5-7, 2012 [11] N. P.Marta, El. Mansour, M. Hadi and P.Gabor, J. Pharm. Biomed. Ana., 14,1025, 1996 [12] A.A. El-Bindary, A.Z. El-Sonbati, El-Mosalamy and R.M. Ahmed, Chem. Pap. 57, 255, 2003 [13] M.F.El-Sherbiny, Chem. Pap., 59, 332, 2005 [14] Y. Sharmeli and R. Lonibala, J. Chem. Eng. Data., 54, 28, 2009 [15] P. Ettaiah, K.J. Charyulu, K.L. Omprakash, A.V. Chandra Pal and M.L.N.Reddy, Indian J. Chem. 24A, 890, 1985 [16] H. Irving and R.J.P.Williams, Order of stability of metal complexes. Nature,162, 746, 1948 [17] H. Irving and R.J.P.Williams , The stability of transition metal complexes. J. Chem. Soc. 3192, 1953.

ACKNOWLEDGMENT Authors thankful to Principal Dr. Md. Ilyas Fazil, Principal Dr. Maqdoom Farooqui, Entire management of Milliya Arts, Science and Management Science College, Beed(MS) & Maulana Azad College, Aurangabad(MS) for providing all research facilities

Page 127

American International Journal of Research in Formal, Applied & Natural Sciences

Available online at http://www.iasir.net

Physicochemical Studies on Gadolinium Soaps in Solid State Binki Gangwar, Rajesh Dwivedi, Neeraj Sharma** and Meera Sharma* *Reader, Dept. of Chemistry, Agra College, Agra-282002(India) ** Asst. Prof., Department of Chemistry, Institute of Applied Science, GLA University, Mathura Abstract: Decomposition reaction was found kinetically of zero order with energy of activation for gadolinium soaps lies in the range 26.92–37.62 KJ mol-1 and for thermal decomposition lies in the range 33.34–42.63KJ mol-1. IR spectra and thermal analysis were used to illustrate the structure of gadolinium soaps in solid state. IR results reveal that the fatty acid exists with dimeric structure through intermolecular hydrogen bonding and gadolinium soaps were ionic in nature. Key words: Gadolinium soaps, TGA, IR and lower carboxylic acids. I. Introduction Metal soaps are potentially very useful for applications in various fields1-4 ,such as lubricating greases, intended to improve flow, coating smoothness, finish, printability, antidusting effects, driers in paints, dry cleaning industries, cosmetic gels, heat stabilizers for plastics and in the development of polyvinylchloride as an important commercial polymer. Other uses of metal soaps are as fungicides and pesticides5, optical polymer fibers6 ,coating pigment in paper industry7 and in the preparation of nanofilms8. S K Upadhyaya9 studied the conductometric and acoustical properties of gadolinium soaps in nonaqueous medium. The energy of activation of rare earth metal soaps calculater by Mehrotra et. al10-13. The valent thermal behavior of divalent and higher valent metal soaps have been carried out by Akanni et al,14. Folarin et al,15 determined relative thermal stability of metal soaps of Ximenia americana and Balanites aegyptiaca seed oils. The characterization of metal soaps has been done by Robinet et al,16. In comparison of earlier studies on metal soaps, we report here results of our studies on thermal and IR spectra of Gadolinium soaps with a view to investigate the characteristic and structure of these soaps in solid state. II. Experimental All acids were purified by distilling under reduced pressure. The Gadolinium soaps were prepared by the direct metathesis of corresponding sodium soaps (Butyrate, Valerate, Caproate and Caprylate) by pouring a slight stochiometric excess of aqueous metal salt solution into the clear dispersion at raised temperature with vigorous stirring. After initial drying in an air oven 50-60°C, final drying was carried out under reduced pressure. The precipitates was filtered off and washed with hot distilled water and acetone. The IR spectra of fatty acids and of corresponding sodium and gadolinium soaps were recorded on Perkin Elimer – 842 spectrophotometer. The TGA of gadolinium soaps were carried out at a constant heating rate 100C/min. in nitrogen atmosphere and maintaining similar conditions by a Perkin – Elmer Thermogravimetric analyzer TG S-2. III. Result and Discussion The purity of soaps was confirmed by the determination of melting points. The MP of the purified gadolinium soaps were: Gadolinium Butyrate : 85.50C Gadolinium Valerate : 91.00C Gadolinium Caproate : 94.50C Gadolinium Caprylate : 96.50C The IR spectra of gadolinium soaps are reported and compared with the results of the corresponding fatty acids, the absorption bands observed near 2650-2640, 1705-1675, 1425-1400, 960-935, 680 and 560 cm-1 have indicated the presence of localized-COOH group17 in the form of dimeric structure and the existence of intermolecular hydrogen bonding between two molecules of the fatty acids. The absorption bands observed near 2650-2640, 1705-1675 and 960-935 cm-1 corresponding to the –OH group in the spectra of fatty acids have disappeared in the spectra of corresponding potassium and gadolinium soaps. The complete disappearance of the

Page 128

B. Gangwar et al., American International Journal of Research in Formal, Applied & Natural Sciences, 3(1), June-August, 2013, pp. 128129

carboxylic band near 1700 cm-1 in the spectra of gadolinium soaps, indicates that there is a complete resonance between the two C=O bond of the carboxylic groups gadolinium soaps. The bonds observed near about 425 cm-1 indicate to Gd-O bonds in spectra of gadolinium soaps. The results of thermogravimetric analysis of gadolinium soaps indicated that the final residue was metal oxide and weight of residue was in agreement with the theoretically calculated weight of gadolinium oxide. The thermal decomposition of gadolinium soaps can be expressed as: (RCOO)3 Gd → Gd3++3RCOO2(RCOO)3 Gd → 3RCOR + Gd2O3 + 3CO2 Where R= C3H7, C4H9, C5H11, and C7H15. It was found that the order of reaction for the decomposition of gadolinium soaps is zero and the values of energy of activation obtained from Freeman- Carroll’s18, Horowitz-metzger’s19 and coats- Redfern’s20 equations and the values are given belowEnergy of Activation of gadolinium soaps in Kcal Mol-1 from different equations Soaps Butyrate Valerate Caproate Caprylate

Freeman-Caroll’s 10.2 9.6 9.7 8.9

Coat-Redfern’s 10.4 13.9 13.6 14.8

Horowitz-Metzger’s 11.2 12.5 10.0 11.8

The values of activation energy E are obtained from the slope(-E/2.303R) of the plots of log (dw/dt) vs (T-1) , the values of entropy of activation ∆S, and free energy of activation ∆G are calculated by following eqations∆S = 2.303R log (Zh/KTs) ∆G = E- Ts(∆S) Acknowledgement The authors are thankful to the department of chemistry Agra College, Agra for facilities to carryout the studies. References 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20.

E. D. Owen, K. J. Msayib, J. Polym. Sci. Polym. Chem., A27, 399 (1989). S. Saori, I. M. Sawada, Kohol. Jpn. Kokai Tokyo Koho Jp., 247, 828 (2000). G. Poulenat, S. Sentenac and Z. Mouloungui, Ind. Eng. Chem. Res., 43(7), 1574 (2004) T. O. Egbuchunam, D. Balkose and F. E.Okieimen, Nig. J. Chem. Soc., 32, 107 (2007). J. Salager, “Surfactants: Types and Uses”, FIRT, http/www.nanoparticles.org (2002). Q. Zhang, H. Ming and Y. Zhai, J. Appl. Polym. Sci., 62, 887 (1996). P. N. Nene, Adv. Nat. Appl. Sci., 2(2), 73 (2008). M. Gonen, S. Ozturk, D. Balkose, S. Okur and S.Ulku, Ind. Eng. Chem. Res., 49(4), 1732 (2010). S K Upadhyaya, Physics and chemistry of liquids; An International Journal, 27(1),1994. K. N Mehrotra, A.S. Gahlaut, M. Sharma, J. Indian Chem. Soc., 64, 285, 1987. K. N Mehrotra, A.S. Gahlaut, M. Sharma, Recl. Trav. Pasys. Bas., 107, 310-312, 1988. K. N Mehrotra, M . Chauhan, R. K. Shukla, Tenside Surfactants Detergent, 34(2) 124-127, 1997. K. N Mehrotra, M. Anis, Tenside Surfactants Detergent, 116-119, 2001. S.M. Akanni, E.K. Okoh, H.D. Burrows and H.A. Ellis, A Review. Thermochim Acta. 208: 1(1992). O.M. Folarin, I.C. Eromosele and C.O. Eromosele, Scientific Reserch and Essays, 6(9): 1922(2011). L. Robinet and M. C. Corbeil, Studies in conservation, 48(1): 23(2003). K. Nakanishi, “Infrared absorption spectroscopy”, Holden-Day, San Francisco., p. 39, 1977. E. S. Freeman and B. J. Caroll, Ohys. Chem., 62, 394.1958. H. H. Horowitz and G. Metzger, Anal. Chem., 35, 1464, 1963. A. W. Coats and J. P. redferns, Nature, 68, 201, 1964.

Page 129