NCI 2016 / 3

ISSN 2148 - 4902

NORTHERN CLINICS OF ISTANBUL • İSTANBUL KUZEY KLİNİKLERİ

Vol. 3 • No. 3 • Year 2016

MEDLINE (PubMed) abbreviation: North Clin Istanb

Evaluation of GAD67 immunoreactivity in the region of substantia nigra pars reticulata in resistance to development of convulsive seizure in genetic absence epilepsy rats • Effect of HLA-DPA1 alleles

on chronic hepatitis B prognosis and treatment response • Diagnostic value of sTREM-1 and procalcitonin levels in the early diagnosis of sepsis • Crohn’s disease in the elderly: Clinical presentation and manifestations from

a tertiary referral center in Turkey • The Turkish adaptation of scale to measure patient perceptions of the quality of nursing care and related hospital services: A validity and reliability study • The effect of myasthenia gravis as

a prognostic factor in thymoma treatment • Normal range of BMD in proximal tibia as a different skeletal site at women • Use of bladder volume measurement assessed with ultrasound to predict postoperative urinary

retention • Analysis of cancer patients admitted to intensive care unit • Primary ovarian leiomyoma in a postmenopausal woman: A case report • Chylothorax due to tuberculosis lymphadenitis • Post-

INDEXED IN PUBMED, PUBMED CENTRAL, TUBITAK TR INDEX, CINAHL AND TURKIYE CITATION INDEX.

traumatic refractory multiple canal benign paroxysmal positional vertigo: a case report • Pregabalin-induced hyperprolactinemia in a patient with fibromyalgia: A case report • A serious conundrum for surgeons: Stump appendicitis

NORTHERN CLINICS OF ISTANBUL İSTANBUL KUZEY KLİNİKLERİ Editor-in-Chief

Vıce Editors

Bekir Durmus, M.D.

Berna Terzioglu Bebitoglu, M.D. Levent Doganay, M.D. Yavuz Bastug, M.D. Arzu Tatlipinar, M.D. Derya Buyukkayhan, M.D. Ilker Tekkesin, M.D.

Scientıfıc Commıttee Abdullah Aydin, M.D.

Eren Ozek, M.D.

Kemal Memisoglu, M.D.

Recep Alp, M.D.

Adem Ozkan, M.D.

Eyup Gumus, M.D.

Kemal Nas, M.D.

Remzi Cevik, M.D.

Afitap Icagasioglu, M.D.

Fahri Ovali, M.D.

Kemalettin Koltka, M.D.

S. Tahir Eren, M.D.

Ahmet Gocmen, M.D.

Fatih Goktay, M.D.

Leyla Karadeniz Bilgin, M.D.

Sabahat Aksaray, M.D.

Alaattin Ozturk, M.D.

Fatih Saygili, M.D.

Lutfullah Orhan, M.D.

Sait Naderi, M.D.

Ali Ihsan Dokucu, M.D.

Fatma Eti Aslan, M.D.

Mahmut Durmuş, M.D.

Salih Boluk, M.D.

Ali Ozdemir, M.D.

Ferruh Isman, M.D.

Mehmet Ali Ozcan, M.D.

Salih Cetinkursun, M.D.

Ali Riza Cenk Celebi, M.D.

Filiz Akyuz, M.D.

Mehmet Doganay, M.D.

Sarenur Gokben, M.D.

Ali Riza Odabas, M.D.

Filiz Topaloglu Demir, M.D.

Mehmet Eren, M.D.

Sahin Senay, M.D.

Asiye Kanbay, M.D.

Fugen Aker, M.D.

Mehmet Kanbay, M.D.

Selcuk Mistik, M.D.

Atakan Yesil, M.D.

Fusun Mayda Domac, M.D.

Mehmet Selcuki, M.D.

Serhat Citak, M.D.

Ateş Kadioglu, M.D.

Gizem Dinler Doganay, M.D.

Mehmet Tayyar, M.D.

Seyhan Hidiroglu, M.D.

Atilla Polat, M.D.

Gozde Kir Cinar, M.D.

Mehmet Tunca, M.D.

Seyhun Kurşat, M.D.

Ayhan Verit, M.D.

Gulbahar Sarac, M.D.

Melek Celik, M.D.

Sibel Dogan, M.D.

Aysel Milanlioglu, M.D.

Gulendam Kocak, M.D.

Melek Gura, M.D.

Selami Sozubir, M.D.

Ayse Cikim Sertkaya, M.D.

Gulnur Tokuc, M.D.

Melih Atahan Guven, M.D.

Sema Yilmaz, M.D.

Ayse Serap Karadag, M.D.

H. Muammer Karakas, M.D.

Metin Akbulut, M.D.

Sevki Erdem, M.D.

Aysegul Gunduz, M.D.

Hakan Erdogan, M.D.

Metin Kapan, M.D.

Soner Sanioglu, M.D.

Aytekin Guven, M.D.

Hale Akbaylar, M.D.

Mine Hekimgil, M.D.

Sukran Kose, M.D.

Aytekin Oguz, M.D.

Haluk Vahaboglu, M.D.

Muhammed Fatih Onsuz, M.D. Tamer Okay, M.D.

Ayten Kadanali, M.D.

Hamit Okur, M.D.

Muhammet Tekin, M.D.

Tarik Sapci, M.D.

Baris Onder Pamuk, M.D.

H. Isin Ozisik Karaman, M.D.

Murat Acar, M.D.

Tayfun Kirazli, M.D.

Bekir Atik, M.D.

Hasan Bombaci, M.D.

Murat Muhcu, M.D.

Tongabay Cumurcu, M.D.

Beyhan Cengiz Ozyurt, M.D.

Hasan Borekci, M.D.

Mustafa Aldemir, M.D.

Tolga Baglan, M.D.

Birsen Yurugen, M.D.

Haydar Sur, M.D.

Mustafa Caliskan, M.D.

Tolga Canbak, M.D.

Canan Agalar, M.D.

Hilmi Ciftci, M.D.

Mustafa Girgin, M.D.

Tuba Tulay Koca, M.D.

Cevdet Ugur Kocogullari, M.D. Hulya Apaydin, M.D.

Nelgin Gerenli, M.D.

Tuba Yavuzsen, M.D.

Derya Buyukkayhan, M.D.

Huseyin Bayramlar, M.D.

Nezih Ozkan, M.D.

Turhan Caskurlu, M.D.

Destina Yalcin, M.D.

Ibrahim Akalin, M.D.

Nihat Aksakal, M.D.

Turkan Kudsioglu, M.D.

Didem Akcali, M.D.

Ibrahim Ali Ozemir, M.D.

Nilay Sahin, M.D.

Umut Kefeli, M.D.

Didem Korular Tez, M.D.

Ibrahim Ikizceli, M.D.

Nuri Aydin, M.D.

Veli Citisli, M.D.

Dilaver Tas, M.D.

Ihsan Karaman, M.D.

Nusret Acikgoz, M.D.

Volkan Ince, M.D.

Duygu Geler Kulcu, M.D.

Ihsan Metin Leblebici, M.D.

Onur S. Goksel, M.D.

Yasar Bukte, M.D.

Ebru Zemheri, M.D.

Ilknur Aktas, M.D.

Orhan Alimoglu, M.D.

Yesim Tuncok, M.D.

Emek Kocaturk Goncu, M.D.

Ismail Islek, M.D.

O. Emek Kocaturk Goncu, M.D. Yurdanur Kilinc, M.D.

Emin Evren Ozcan, M.D.

Kadriye Avci, M.D.

Ozge Ecmel Onur, M.D.

Yuksel Altintas, M.D.

Emine Samdanci, M.D.

Kamil Ozdil, M.D.

Ozlem Baysal, M.D.

Yuksel Ersoy, M.D.

Ercan Madenci, M.D.

Kaya Saribeyoglu, M.D.

Ozlem Guneysel, M.D.

Eren Gozke, M.D.

Kazim Capaci, M.D.

Ozlem Tanriover, M.D.

NORTHERN CLINICS OF ISTANBUL İSTANBUL KUZEY KLİNİKLERİ YEAR 2016 VOLUME 3 NUMBER 3

p-ISSN 2148 - 4902 e-ISSN 2536 - 4553

Ownership and Accountability for Contents on behalf of the Istanbul Northern Anatolian Association of Public Hospitals

Kemal Memisoglu, M.D.

Publicatıon Manager

Bekir Durmus, M.D.

Publicatıon Coordinators

Neslihan Buyukmurat, M.D.

Umut Elmas

Executive Office

Istanbul Anadolu Kuzey Kamu Hastaneler Birligi Genel Sekreterligi E5 Karayolu Uzeri, 34752 Atasehir, Istanbul, Turkey Phone: +90 216 578 78 00 Fax: +90 216 577 40 48 http://www.kuzeyklinikleri.com e-mail: bilgi@kuzeyklinikleri.com

Issued by the Istanbul Northern Anatolian Association of Public Hospitals Indexed in Medline, PubMed, PubMed Central, TUBITAK TR Index, CINAHL, Turkiye Citation Index.

Publisher

Press

KARE PUBLISHING

Altayceşme Mah., Engin Sok.,

Maltepe Residence, No: 3, Daire: 20

34843 Maltepe, Istanbul, Turkey

Tel: +90 216 550 61 11

Fax: +90 216 550 61 12

http://www.kareyayincilik.com e-mail: kare@kareyayincilik.com

DESIGN

Ali Cangul alicangul@kareyayincilik.com

Info

YILDIRIM PRINTING HOUSE

Yuzyil Mah., Massit Matbaacılar Sitesi,

1. Cad. No: 101, Bagcilar, Istanbul, Turkey Tel: +90 212 629 80 37 Fax: +90 212 629 80 39

Press date: December 2016 Circulation: 1000 Type of publication: Periodical

English Editing by

Gurkan Kazanci, M.D. PhD. Kazanci English Editing, and Medical Translation Office kazanci.g@gmail.com

Northern Clinics of Istanbul (NCI) is a peer-reviewed journal published triannually by the Istanbul Northern Anatolian Association of Public Hospitals.

Materials published in the Journal is covered by copyright ©2016 NCI. All rights reserved.

This publication is printed on paper that meets the international standard ISO 9706:1994.

National Library of Medicine recommends the use of permanent, acid-free paper in the production of biomedical literature.

KARE PUBLISHIN G

CONTENTS Vol. 3 • No. 3 • Year 2016

VI

INSTRUCTIONS FOR THE AUTHORS

IX EDITORIAL

EXPERIMENTAL ORIGINAL ARTICLES

161–167 Evaluation of GAD67 immunoreactivity in the region of substantia nigra pars reticulata in resistance to development of convulsive seizure in genetic absence epilepsy rats

M. Gulcebi, O. Akman, N. Carcak, T. Karamahmutoglu, F. Onat 168–174 Effect of HLA-DPA1 alleles on chronic hepatitis B prognosis and treatment response

S. Katrinli, F. Yilmaz Enc, K. Ozdil, O. Ozturk, I. Tuncer, G. Dinler Doganay, L. Doganay 175–182 Diagnostic value of sTREM-1 and procalcitonin levels in the early diagnosis of sepsis

S. Aksaray, P. Alagoz, A. Inan, S. Cevan, A. Ozgultekin 183–186 Crohn’s disease in the elderly: Clinical presentation and manifestations from a tertiary referral center in Turkey

F. Saygili, S. M. Saygili, I. Tenlik, M. Yuksel, Z. M. Y. Kilic, Y. Ozderin Ozin, E. Kayacetin 187–193 The Turkish adaptation of scale to measure patient perceptions of the quality of nursing care and related hospital services: A validity and reliability study

B. Oren, N. Zengin, N. Yildiz 194–200 The effect of myasthenia gravis as a prognostic factor in thymoma treatment

B. Aydemir 201–208 Normal range of BMD in proximal tibia as a different skeletal site at women

M. A. Aluclu, F. Bati, E. Kekilli 209–216 Use of bladder volume measurement assessed with ultrasound to predict postoperative urinary retention

N. Kavrut Ozturk, A. S. Kavakli 217–221 Analysis of cancer patients admitted to intensive care unit

Y. Aksoy, A. Kaydu, O. F. Sahin, C. K. Kacar

C A S E REPORTS

222–224 Primary ovarian leiomyoma in a postmenopausal woman: A case report

I. Sanverdi, F. Vural, O. Temizkan, O. Temel, H. Ayvaci, P. Gunes 225–228 Chylothorax due to tuberculosis lymphadenitis

O. Kutlu, S. Demirbas, A. Sakin 229–232 Post-traumatic refractory multiple canal benign paroxysmal positional vertigo: a case report

M. A. Dundar, S. Derin, M. Aricigil, M. A. Eryilmaz, H. Arbag 233–236 Pregabalin-induced hyperprolactinemia in a patient with fibromyalgia: A case report

A. Taraktas, N. Mesci, G. Ozturk, D. Geler Kulcu, E. Aydog 237–239 A serious conundrum for surgeons: Stump appendicitis

M. F. Ekici, Z. Bayhan, S. Zeren, B. I. Ucar, M. Korkmaz, A. N. Deger 240

Index of volume 3

INSTRUCTIONS FOR THE AUTHORS Northern Clinics of Istanbul

- NCI is a peer-reviewed, open-access, international journal published by the Istanbul Northern Anatolian Association of Public Hospitals (INAAPH). The NCI is printed 3 times a year. Free full-text articles in English are available at www. kuzeyklinikleri.com. The NCI is indexed in the Medline, PubMed, PubMed Central, Turkey Citation Index (Türkiye Atıf Dizini). The journal publishes research, interesting case reports, letters to the editor, review articles, editorial comments, medical news, and guidelines.

The NCI accepts manuscripts written in Turkish and English. Opinions presented in published articles do not represent official endorsement of the INAAPH. Manuscripts should be prepared in accordance with the Uniform Requirements for Manuscripts Submitted to Biomedical Journals, which is regularly updated by the International Committee of Medical Journal Editors (ICMJE), and available at http://www.icmje.org.

ARTICLE TYPES The NCI publishes the kinds of articles briefly described below.

Research Articles: These are articles on original clinical (conducted with healthy subjects or patients) or experimental (human, animal or in-vitro trials) research performed in all fields.

Case Reports: This section contains reports on interesting, instructive or rarely seen cases.

Review Articles: Reviews are usually written at the invitation of the editors.

The NCI publishes clinical review articles related to the natural course of diseases, updated diagnostic and therapeutic approaches of concern to clinicians and specialists in basic sciences that encompass genetic, physiological, and pharmacological aspects of the underlying mechanisms of diseases, and reviews about state-of-the art treatment strategies, technological advancements, and newly approved drugs.

Editorial Comments: This section contains editors’ comments, reviews, and other relevant items.

Letters to the Editor: These are comments, criticism and contributions in re-

sponse to a paper published in the NCI. The author(s) of a criticized article has the right to reply. The article that is the subject of the comments should be listed in the references section. Letters must be sent to the editor within 4 weeks following publication of the subject article in the NCI. PREPARATION OF MANUSCRIPT General Format: All manuscripts should be typewritten on A4 white paper, and 2.5 cm-wide margins should be left on all sides. The references should be numbered consecutively in the order of their first mention in the text. All text material, including references, footnotes, and table and figure legends, should be typed using double-spacing in an 11 point font with left alignment and without hyphenated line breaks. The fonts Times New Roman or Arial should be used in the text, for symbols, and all other special characters. Please use the editing features of your word processing program to type bold or italic letters, mathematical symbols, Greek letters, subscript and superscript characters. Please take care not to confuse the letters O and I with the numerals 0 and 1. To set a left indent for a paragraph, click the TAB button once. Only the International System of Units (SI) should be used for units of measurement. Abbreviations and acronyms should be written in parentheses following the full name or an explanation of the usage should be provided just after the first appearance in the text.

Please review the final version of the manuscript very carefully, especially for formatting and editing errors.

All pages of the manuscript should be consecutively numbered starting from the title page (page 1, title page; page 2, Turkish abstract; page 3, English abstract, etc.). Page numbers should be indicated on the upper right-hand corner of each page. Final version of the manuscript should be in “.doc” or “.rtf” format.

Manuscripts submitted in “.pdf” format will not be accepted.

Manuscript Sections: All research articles must contain the following sections: (1) Title page, (2) Abstract with keywords, (3) Introduction, (4) Methods, (5) Results, (6) Discussion, (7) Acknowledgements, (8) Conflict of interest, (9) Funding resources, (10) References, (11) Legends of the figures, (12) Tables, (13)

Figures. In case of need, presentation of Methods, Results, and Discussion sections under subheadings is preferred.

Case reports should be presented following abstract section, under headings of introduction, case presentation, and discussion. In review articles, appropriate headings can be used in accordance with the development of the manuscript.

Sections of the manuscript in order of their appearance in the text with relevant explanations are listed below.

Title Page: The title page should contain the following information: (1) article title, (2) full name and academic title of all participating authors, (3) department and institution of all authors, including the city and country, (4) name, full mailing address, phone and fax numbers, and e-mail address of the corresponding author, and (5) word count (including title page, abstracts, explanatory notes for figures and tables). If the study was presented elsewhere, those details should be indicated on the title page.

Abstract: The abstract should be written on a separate page. It should contain at most 250 words, and be structured as follows: (1) Objective, (2) Methods, (3) Results, and (4) Conclusion. Under these headings, briefly describe the subject of the article, methods used for the study, basic findings, and author’s conclusion.

No subtitles may be used in the abstract of a case report. A minimal number of abbreviations and/or acronyms should be used. Abstracts should not contain any references. A maximum of 5 keywords should be included at the end of the abstract. The Medical Subject Headings (MeSH) prepared by the US National Library of Medicine (NLM) may be used as a reference for keywords.

Introduction: State the specific purpose and available data relevant to the study.

Methods: All methods used to select participants and conduct the study should be described in detail. Known methods should be cited. Novel or modified methods used should be described in detail.

Doses, concentrations, routes, and duration of administration of drugs and chemical agents should be indicated. A concise report of all statistical methods used for summarizing available data and for testing the proposed hypothesis should be provided under a subtitle, in-

INSTRUCTIONS FOR THE AUTHORS cluding the p value criteria determined for statistically significant difference.

Statistical evaluation conducted should be explained in detail. Standard statistical methods should be used as much as possible. If rarely employed or novel statistical methods were used, then the relevant references should be cited. When necessary, more detailed explanations about unusual, complex or new statistical methods can be provided in separate files for readers as online supplementary data. The commercial name and version number of any statistical software package program used should be provided.

For statistical evaluation, the recommendations in the statistics section of the “Uniform Requirements for Manuscripts Submitted to Biomedical Journals: Writing and Editing for Biomedical Publication” (http://www.ICMJE.org) should be taken into consideration.

Results: The study results should be presented in logical sequence and in detail.

The findings should be supported by figures and tables. Information given in figures and tables should not be repeated in the text unless absolutely required.

Discussion: Data relevant to the study subject matter should be examined, evaluated, and substantiated with references from domestic and international sources. General information irrelevant or superfluous to the report should not be included.

Acknowledgement: The names of individuals who contributed to the study but who fail to meet the criteria of authorship should be mentioned in this section.

The written consent of all individuals mentioned should be obtained.

Conflict of Interest: All potential conflicts of interest should be declared under this heading. All affiliations with pharmaceutical firms, biomedical device manufacturers, and other service or product procurers relevant to the subject matter of the study should be explicitly indicated. If no conflict of interest exists, this should be stated as “none declared.”

Declarations related to conflicts of interest should be placed at the bottom of a separate page after the acknowledgements and before the references. A Conflict of Interest Form will be sent to the authors of accepted papers.

Funding sources: The full name of any sponsoring foundation or institution should be provided.

References: References should be listed consecutively in the order of their first appearance in the text. All sources the authors made direct use of should be included as references, excluding unpublished results and personal communications. During the preparation of the manuscript for publication, additional information regarding any unconfirmed references will be requested from the authors. Titles of journals should be abbreviated as indicated in the Index Medicus. If that is not possible, then the full name of the journal should be provided. In the references, a maximum of 6 authors should be cited for any 1 article with their full surname, and then the initial(s) of their first name. If more than 6 authors contributed to the cited article, then after the name of the sixth author, the abbreviation “et al.” should be added to indicate that there are additional authors. The notation and listing of references should comply with the following sample reference citations: 1. Journal: Balci NC, Sirvanci M, Tüfek I, Onat L, Duran C. Spontaneous retroperitoneal hemorrhage secondary to subcapsular renal hematoma: MRI findings. Magn Reson Imaging 2001;19:1145-8.

2. Articles in press: Roten L, Derval N, Sacher F, Pascale P, Wilton SB, Scherr D, et al. Ajmaline attenuates electrocardiogram characteristics of inferolateral early repolarization.

Heart Rhythm 2011 Sep 19 [Epub ahead of print], doi:10.1016/j. hrthm.2011.09.013.

3. Book: Brown AM. Physiology of the liver. 3rd ed. Philadelphia: Lippincott Williams & Wilkins; 2003.

4. Chapter in book: Anderson JL, Muhlestein JB. The role of infection. In: Theroux P, editor. Acute coronary syndromes: a companion to Braunwald’s Heart Disease. Philadelphia: W.B. Saunders; 2003. p. 88107.

5. Web page: Nainggolan L. New salt paper causes controversy. Heartwire.

May 3, 2011. Available at: http:// www.theheart.org/article/1220043. do. Accessed: June 12, 2011.

Figure Legends: Explanatory notes for

each figure should be submitted on a separate page in order of their appearance in the text immediately after the references section under the heading “figure legends.” All abbreviations and symbols used in the figure should be defined in alphabetical order.

Figures: The manuscript will not be evaluated until all figures cited in the text are submitted. The number of figures provided should be in accordance with the content and data presented in the text, and table data should not be repeated in figures. All figures should be sent in individual electronic file format ready for publication with maximum dimensions of 125 cm x 180 cm. Illustrations in color should be in CMYK format and have a minimum resolution of 300 DPI suitable for publication. Figures depicted in gray scale should have a minimum resolution of 600 DPI, and the minimum resolution required for black and white illustrations is 1200 DPI. All figures should be in TIFF format. Figures must not disclose or imply the identity of a specific individual without the written consent of the individual in question.

Tables: Each table should be typed or printed with double-spacing on a separate sheet of paper. Tables should be numbered consecutively in the order of their first citation in the text. The number and title of the table should be placed just above the table. Do not use vertical lines between columns. Horizontal lines should be used only above and below the headings of the columns, and at the bottom of the table. If required, explanatory notes regarding table data should be written in footnotes. All abbreviations and acronyms used in the table should also be explained in alphabetical order in footnotes.

ETHICAL POLICY NCI follows the ethics flowcharts developed by the Committee on Publication Ethics (COPE) for dealing with cases of possible scientific misconduct and breaches of publication ethics. For detailed information please visit www.publicationethics.org.

All submitted manuscripts are screened with plagiarism software (iThenticate) to detect instances of overlapping and similar text during the evaluation process.

INSTRUCTIONS FOR THE AUTHORS All manuscripts presenting data obtained from research involving human subjects must include a statement that the written informed consent of the participants was obtained and that the study was approved by an institutional review board or an equivalent body. This institutional approval should be submitted with the manuscript. Authors of case reports must submit the written informed consent of the subject(s) of the report or of the patient’s legal representative. Manuscripts with human and animal studies should describe the steps taken to eliminate pain and suffering.

AUTHORSHIP All individuals listed as “author” in the submitted manuscript must make an adequate contribution to the study, meet the criteria of authorship, and take responsibility for their part of the manuscript. For the sake of the outcomes and the integrity of the study, at least one author should be responsible for each section of the manuscript. All authors mentioned in the cover letter must meet all of the following criteria: (1) substantial contribution to conception, design of the study, analysis, and interpretation of data, or all of these criteria; (2) significant contribution to the drafting of the article or revision of its scientific content; (3) approval of the final version of the article to be published.

In multicentered studies, all individuals who are named as authors under the title of the article should meet all the above-mentioned requirements of authorship. Seeking or providing financial support for the study, and/or data collection do not satisfy the criteria of authorship per se, nor does general support or guidance provided to the study investigators. Individuals who contributed to the study in various ways but who fail to meet the criteria of authorship may be included in the acknowledgements with their written consent. Please refer to the ICMJE website for more information about authorship. Increasing the number of authors unnecessarily is not ethical conduct and to prevent any attempt to seek undue academic prestige or other unethical advantages, the editor may request a declaration from the authors of their individual contributions to the article and publish this information, if deemed appropriate. The sequence

of authors’ names should be based on a consensus reached by all the participating authors. Due to different specifications for the sequencing of authors, the order provided will be used unless otherwise stated. Authors may explain the rationale for a different sequence in a footnote.

COVER LETTER Each manuscript should be sent with a cover letter that must contain the following explicit declarations: (1) all authors meet the criteria of authorship; (2) the submitted manuscript was not simultaneously sent to another journal and it is not presently being evaluated by another journal; (3) no part of the content of the manuscript has been previously published elsewhere; and (4) the manuscript has been read and approved of by all authors. The name, full address, phone and fax number(s), and e-mail address of the corresponding author to whom all editorial correspondence will be directed must be provided.

A brief paragraph describing the scientific significance of the manuscript may also be included.

SUBMISSION OF THE MANUSCRIPT All manuscripts should be submitted to the NCI via the online submission system. For questions or requests related to the submission and evaluation process of manuscripts, the editorial office may be contacted by e-mail at bilgi@ kuzeyklinikleri.com. In compliance with the journal’s publication rules, the current status of the manuscript will not be discussed on the phone prior to acceptance for publication. First-time users of the online submission system will need to register. A user name and a code specific to the user will be sent by e-mail. For further details please consult the online manuscript submission page.

REVIEW OF MANUSCRIPTS In order for an article to be published in the journal it should not be published elsewhere, and must be deemed suitable for publication by the editorial board selected by the NCI Executive Committee.

All responsibility for the manuscript belongs to the author(s). The evaluation process of the submitted manuscript will not begin until a document with the signed approval of all authors has been received. During typesetting and other

preparation of the manuscript for publication, a Copyright Transfer Form will be sent to the primary author(s) (“guarantors”) who will assume responsibility for the manuscript. All submitted manuscripts are first evaluated by the editorial board. At this stage, manuscripts not deemed suitable for publication in NCI, including those not complying with the requirements or without adequate scientific content, will be returned to the authors. Manuscripts found suitable for publication will be sent to reviewers for more detailed evaluation. Acceptability of manuscripts is dependent on originality, scientific content, and the subject of the study, in accordance with the publication protocol of the journal. All research articles deemed suitable for publication are subjected to a detailed statistical evaluation. The authors are informed of the editors’ decision on the acceptability of the manuscript via e-mail, usually within 6 weeks of its submission. The editors do not discuss their decision on the phone.

All objections and requests should be communicated to the editors in a written format. If deemed necessary, the editorial board has the right to make modifications to the text without altering the main concept of the manuscript. An offprint of the manuscript will not be sent to the author(s).

OPEN ACCESS NCI is a fully open access journal. All articles published in NCI are available on the internet to all users immediately upon publication. Non-commercial use and distribution in any medium is permitted, provided the author and the journal are properly credited.

PUBLISHING FEE NCI is an open access journal. Manuscripts can be reached from the web page of journal without any fees. No additional fee is required from the authors for accepted manuscripts.

ADDRESS OF CORRESPONDENCE Istanbul Anadolu Kuzey Kamu Hastaneler Birligi Genel Sekreterligi, E5 Karayolu Uzeri 34752 Atasehir, Istanbul, Turkey Tel: 0216 578 78 00 - 0216 578 78 50 Fax: 0216 577 40 48 E-mail: bilgi@kuzeyklinikleri.com

EDITORIAL

Esteemed NCI readers, We are back with the third and final issue of 2016. With the contributions from our authors and reviewers and you, our esteemed followers, our journal has begun to be published in PubMed Central and PubMed. You can access all full-text articles that have been published in our journal online by visiting Pubmed and searching by author name, article keywords or North Clin Istanb, the abbreviation for our journal. With the pride of completing the third year and on behalf of my reviewer friends, I extend my gratitude to all who have contributed. I hope to meet you again with the first issue of 2017.

Bekir DurmuĹ&#x;, M.D. Editor of NCI

Orıgınal Article

BASIC MEDICAL SCIENCES

North Clin Istanb 2016;3(3):161–67 doi: 10.14744/nci.2016.16056

Evaluation of GAD67 immunoreactivity in the region of substantia nigra pars reticulata in resistance to development of convulsive seizure in genetic absence epilepsy rats Medine Gulcebi,1 Ozlem Akman,1 Nihan Carcak,2 Tugba Karamahmutoglu,3 Filiz Onat1 Department of Pharmacology, Marmara University Faculty of Medicine, Istanbul, Turkey

1

Department of Physiology, Bilim University Faculty of Medicine, Istanbul, Turkey

2

Department of Pharmacology, Istanbul University Faculty of Pharmacy, Istanbul, Turkey

3

ABSTRACT OBJECTIVE: Nonconvulsive absence epilepsy and convulsive epilepsy seizures are rarely seen in the same patient. It has been demonstrated that there is a resistance to development of convulsive seizures in genetic absence epilepsy models. The present study investigated glutamic acid decarboxylase (GAD) immunoreactivity in the brain region related to the interaction of these two seizure types, namely substantia nigra pars reticulata (SNR) subregions, SNRanterior and SNRposterior.

METHODS: Nonepileptic adult male Wistar rats and Genetic Absence Epilepsy Rats from Strasbourg (GAERS) were used. Experimental groups of Wistar and GAERS were electrically stimulated for kindling model to induce convulsive epileptic seizures. An electrical stimulation cannula was stereotaxically implanted to the basolateral amygdala and recording electrodes were placed on the cortex. Sagittal sections of SNR were used to evaluate immunohistochemical reaction. Sections were incubated with anti-GAD67 antibody. Densitometric analysis of GAD67 immunoreactive neurons was performed using photographs of stained sections. One-way analysis of variance and post hoc Bonferroni test were used for statistical analysis of the data.

RESULTS: There was no difference in GAD67 immunoreactivity of SNR subregions of control Wistar and control GAERS. An increase in GAD67 immunoreactivity was detected in SNRposterior subregion of stimulated Wistar rats whereas there was a decrease in GAD67 immunoreactivity in SNRposterior of stimulated GAERS. The difference in GAD67 immunoreactivity between these two groups was statistically significant.

CONCLUSION: Level of synthetized gamma-aminobutyric acid in SNRposterior subregion plays an important role in the interaction of nonconvulsive absence epilepsy seizures and convulsive epilepsy seizures.

Keywords: Epilepsy; GAERS; gamma-aminobutyric acid; immunohistochemistry.

Received: October 17, 2016 Accepted: November 06, 2016 Online: January 25, 2017 Correspondence: Dr. Filiz ONAT. Marmara Universitesi Tip Fakultesi, Tibbi Farmakoloji Anabilim Dali, Basibuyuk Yerleskesi, Maltepe, Istanbul 34668, Turkey.

Tel: +90 216 - 421 22 22 e-mail: fonat@marmara.edu.tr © Copyright 2016 by Istanbul Northern Anatolian Association of Public Hospitals - Available online at www.kuzeyklinikleri.com

162

A

bsence epilepsy and convulsive epilepsy seizures are rarely seen in the same patient [1, 2]. The mechanisms underlying convulsive seizures are thought to differ from those associated with absence epilepsy seizures. In typical absence epilepsy, inhibitory activities are considered to be dominant factors however in focal and generalized seizures, excitatory activities are conceivably predominant factors. Clinical studies and experimental studies have demonstrated concurrent involvement of thalamus and neocortex in formation of spikes and discharges characterized for absence seizures [3, 4]. However in temporal lobe epilepsy epileptic focus is mostly localized in limbic structures, such as hippocampus, amygdala or limbic cortex [5]. The genetic models; Genetic Absence Epilepsy Rats from Strasbourg (GAERS) and Wistar albino Glaxo-Rijswijk (WAG-Rij) strain rats meet criteria for absence-type nonconvulsive seizures [6, 7]. Kindling, generated by regularly repeated stimulations with electrical or chemical stimuliis frequently used for secondary generalized temporal lobe epilepsy model with convulsive seizures [8, 9]. Behavioral responses that develop as a result of kindling are evaluated using Racine’s scale [10]. There are studies investigating the interaction between convulsive and nonconvulsive seizures which have been done in the amygdala-kindling of GAERS and WAG/ Rij rats. Presence of resistance to generalization of focal limbic seizures and development of convulsive seizures during kindling process in GAERS and WAG/Rij rats was demonstrated [11–18].

Substantia nigra pars reticulata (SNR) is a cerebral region that plays a role in the modulation of both convulsive and nonconvulsive epileptic seizures and there is an endogenous system associated with SNR which is involved in the control of epileptic seizures [19]. In many studies it has been reported that gamma-aminobutyric acid (GABA)sensitive neurons in SNR mediate convulsive seizures induced in various ways in rats [19–23].

Some studies have shown that through activation or inhibition of SNR by GABAergic agents direct GABAergic striatonigral pathway can modulate absence epilepsy seizures [6, 19]. In addition, other studies have demonstrated that SNR contains

North Clin Istanb

two distinct subregions, SNRanterior and SNRposterior which may have diverse effects on spread and control of epileptic seizures in adult rats. It has been also reported that just before onset of seizures, there is an increase in deoxyglucose uptake in SNRposterior subregion which may suggest this region as a gateway for spread of seizures [24]. After onset of clonic seizures, an increase in deoxyglucose uptake in the SNRanterior subregion was detected. Based on various interpretations, it appears that this mechanism may play a role in termination or shortening of seizures [24]. In a recent study of our team, SNRposterior was demonstrated to be an important subregion for kindling resistance in GAERS [25]. As a result of suppression of SNRposterior subregion with lidocaine injections before electrical stimulation, GAERS reached stage 5 seizures with repeated kindling stimuli however GAERS that received lidocaine injection to SNRanterior subregion did not experience seizures beyond stage 2 despite recurrent kindling stimuli. Kindling stimuli induced a statistically significant increase in the parvalbumin immunoreactivity of GABAergic interneurons of SNRposterior in Wistar rats. Since immunoreactivity of thyrosine hydroxylase in dopaminergic neurons localized in SNRposterior subregion increased both in GAERS and Wistar rats, we concluded that thyrosine hydroxylase immunoreactivity is not associated with kindling resistance in GAERS [25]. In our study, it was detected that SNRposterior and GABAergic activity of this subregion play a critical role in the resistance to development of convulsive seizures in nonconvulsive genetic epilepsy model. The aim of this study was to analyze the immunoreactivity of glutamic acid decarboxylase (GAD) enzyme which plays a role in the synthesis of GABA in GABAergic neurons localized in SNRanterior and SNRposterior subregions in control groups and electrically stimulated GAERS and Wistar rats. GAD67 enzyme has a key function in the synthesis of GABA in GABAergic neurons, and levels of GAD enzyme vary in neuropsychiatric diseases. Thus important information concerning reciprocal interaction between convulsive and nonconvulsive epileptic seizures will be obtained and this will contribute to the clarification of mechanisms underlying epileptic seizures and

Gulcebi et al., Evaluation of GAD67 immunoreactivity

identification of new treatment targets in patients with epilepsy.

MATERIALS AND METHODS In the present study, nonepileptic male Wistar rats and GAERS (3 to 6 months old and weighing between 250 and 350 g) were used. All animals were housed under standard laboratory conditions on a 12/12 h light/dark cycle and were allowed free acess to food and water. Approval of the study was obtained from ethics committee of The Experimental Animal Implementation and Research Centre of Marmara University (March 2, 2011.).

Wistar strain rats were procured from experimental research animals unit of Marmara University Faculty of Medicine (DEHAMER), and GAERS were obtained from Marmara University Faculty of Medicine, Department of Medical Pharmacology.

Experimental groups were as follows: Electrically stimulated GAERS (stimulated GAERS; n=7) and Wistar rats (stimulated Wistar; n=7), and as control groups; sham-operated GAERS (n=7) and sham-operated Wistar rats (n=7).

Kindling All animals were anesthetized with ketamine (100 mg/kg, i.p.), and xylazine hydrochloride (10 mg/ kg, i.p.). Recording electrodes were implanted to cortex and a stimulation electrode into basolateral amygdala (BLA) (anteroposterior: -2.6 mm, lateral: 4.8 mm, ventral: -8.5 mm) stereotaxically. Animals that received kindling stimulation were stimulated at afterdischarge threshold twice daily for a total of 6 times and reached stage 2 seizure according to Racine’s standard 5-stage seizure scale [10, 26]. Thus all animals in the stimulation groups were in the transition phase to stage 3 seizures where convulsive seizures are induced.

Immunohistochemical staining of SNR with GAD67 Immunohistochemical staining was performed for electrically stimulated GAERS (stimulated GAERS) and Wistar rats (stimulated Wistar), sh-

163

am-operated GAERS and sham-operated Wistar groups. Stimulated rats were perfused with physiological saline and 4% neutral buffer formalin solution 1 hour after the sixth stimulation. To achieve standardization, rats in control group that would undergo immunohistochemical staining were perfused on the same day as electrically stimulated rats, and then brains were dissected out. For immunohistochemical staining, 40 Âľm-thick, freely floating sagittal sections of SNR were used. For GAD67 staining sections were first treated with 1% hydrogen peroxide for 30 minutes. Following washing procedure with phosphate buffer solution (PBS 0.1 M) sections were blocked in 10% normal horse serum (in PBS containing 0.1% TritonX-100, 1% bovine serum albumin) for 1 hour. Sections were kept at +4oC for 24 hours in PBS solution containing anti-GAD67 antibody at a concentration of 1:1000 in combination with 0.3% TritonX-100 and 1% bovine serum albumin for primary antibody incubation. Following washing procedure with 0.1 M PBS, sections were incubated for 90 minutes with anti-mouse secondary antibody, then washed again with 0.1 M PBS. Sections were labeled with avidin-biotin complex and washed once more with 0.1 M PBS. NovaRED (Vector Laboratories, Inc., Burlingame, CA, USA) substrate kit was used to visualize staining. Sections were washed with 0.1 M PBS, placed on gelatin-coated slides, and rapid drying was achieved on slide drying hotplate at 37oC in period of between 15 and 30 minutes. VectaMount solution (Vector Laboratories, Inc., Burlingame, CA, USA) was added to slides and they were left to dry at room temperature for at least 1 night. SNRanterior and SNRposterior subregions of stained sections obtained from both groups were photographed and digitally recorded with a digital camera connected to a light microscope. A sample of GAD67 reaction obtained in whole SN, in SNRanterior or SNRposterior subregions (borders of regions are indicated with arrows) has been shown Figure 1. Imagej program (US National Institutes of Health, Bethesda, MD, USA) was used for the densitometric analysis of GAD67 immunoreactivity. During analysis of each set, signal intensity of control sham-operated Wistar rat was

164

North Clin Istanb

taken as a reference and results of analyses of other animals in the set were expressed as percent of control Wistar rat.

Histological confirmation Histological confirmation was performed by staining 1 set of sections of the brain with thionine. Only rats with properly placed electrodes were included in the study. All data obtained were expressed as means Âą standard error of the mean. For statistical analysis of data, one-way analysis of variance and post hoc Bonferroni test were used. p<0.05 was accepted as the level of significance.

RESULTS As a result of comparison between rats with genetic absence epilepsy, namely control GAERS, which demonstrated kindling resistance and nonepileptic control Wistar rats, a statistically significant difference was not detected for GAD67 immunoreactivity in subregions of SNRanterior or SNRposterior.

GAD67 immunoreactivity in SNRanterior did not differ between GAERS or Wistar rats following stimulation of BLA (Figure 2). Electrical stimulation had a statistically significant effect on the GAD67 immunoreactivity in SNRposterior of stimulated Wistar rats and stimulated GAERS (p<0.05) (Figure 3). GAD67 immunoreactivity increased in SNRposterior in stimulated Wistar rats whereas a decrease in GAD67 immunoreactivity was detected in SNRposterior of stimulated GAERS group and the difference between these two groups was statistically significant (p<0.05).

DISCUSSION GABA-sensitive neurons found in SNR have an important regulatory role on epilepsy seizures. In addition to its role in the control of convulsive seizures, SNR also assumes a role in modulation of nonconvulsive seizures. Many studies have reported on the regulatory role of these neurons in susceptibility of rats against clonic seizures induced with various triggering factors [19â&#x20AC;&#x201C;22].

Figure 1. Visualization of GAD67 reaction in SN, SNRanterior, and SNR posterior with immunohistochemical staining.

With efferent projections to intrinsic and extrinsic regions and afferent projections with basal ganglia, SNR plays important roles in both control of epileptic seizures and in the coordination of cognition and motor functions [22, 27, 28]. SNR contains relatively higher amounts of GABA [29]. As a GABAA receptor agonist, muscimol suppresses absence seizures both in genetic and pharmacological absence epilepsy models. However blockade of GABAA receptors with picrotoxin applied to SNR promoted a development of absence seizures. Furthermore prevention of absence seizures with application of N-methyl-D-aspartate antagonists to SNR revealed a role of glutamatergic neurotransmission [30]. In adult rats, available evidence has demonstrated the presence of two distinct subregions, SNRanterior and SNRposterior in the SNR, which may have diverse effects on spread and control of seizures. A decrease in activity of GABAergic neurons localized in SNRanterior leads to a remission in the severity of seizures. Freichel et al., investigated GABA levels in SNR during kindling and demonstrated lack of difference in the density of neuronal GABA in SNR measured 6 weeks after stimulation compared with pre-kindling levels. The decrease in GAD and GABA levels detected in previous studies

Gulcebi et al., Evaluation of GAD67 immunoreactivity

A

165

A

100

50

0

B

150

GAD-ir in SNRP (% of WSHAM)

GAD-ir in SNRA (% of WSHAM)

150

Wistar control

Stimulated Wistar

GAERS control

Stimulated GAERS

100

50

0

B

Wistar control

Stimulated Wistar

GAERS control

Stimulated GAERS

Figure 2. GAD67 immunoreactivity in the SNRanteri-

subregion. (A) Demonstration of GAD67 immuor noreactivity in SNRanterior in the control and stimulated groups. (200x). (B) Comparison of GAD67 immunoreactivity in SNRanterior of Wistar rats and GAERS. Mean GAD67 immunoreactivity in SNRan: Wistar control rats: 100.268±0.881; stimuterior lated Wistar rats: 99.408±1.551; GAERS control: 100.899±1.90; stimulated GAERS: 98.487±1.230.

Results were expressed as mean±standard error.

SNRA: SNRanterior.

Figure 3. GAD67 immunoreactivity in the SNRposterior subregion. (A) Demonstration of GAD67 immunoreactivity in SNRposterior in control and stimulated groups. (200x).

(B) Comparison of GAD67 immunoreactivity in SNRposof Wistar and GAERS. Mean GAD67 immunoreacterior tivity in SNRposterior: Wistar control rats: 100.162±1.154; stimulated Wistar rats: 102.689±1.321; GAERS control: 98.319±0.715; stimulated GAERS: 96.979±1.505.

Results were expressed as mean±standard error. Oneway analysis of variance and posthoc Bonferroni test were used for all groups *; p<0.05. SNRP: SNRposterior.

of the same research group were associated with the impact of kindling on GABAergic projections extending from striatum or globus pallidus into SNR, rather than GABAergic neurons in SNR [31].

Based on our results, there was no statistically significant difference in the GAD67 immunoreactivity in SNRanterior between GAERS and Wistar rats related with the effect of electrical stimulation applied to BLA. Also there was no difference in the GAD67 immunoreactivity in SNRanterior between

control GAERS and Wistar control rats. However it has not yet been investigated whether analyzed GAD67 immunoreactivity originated from GABAergic neurons of SNR or their projections. In contrast to SNRanterior GAD67 immunoreactivity in SNRposterior differed between stimulated GAERS and stimulated Wistar rats and the difference between these two groups was statistically significant.

Although electrical stimulation increased GAD67 immunoreactivity in SNRposterior among stimulated

166

Wistar rats, a decrease in GAD67 immunoreactivity in the same subregion was determined in stimulated GAERS group. The kindling resistance in GAERS may stem from the difference in GABAergic transmission found in the potentially proconvulsive SNRposterior of the stimulated GAERS. The increase in GAD67 immunoreactivity in SNRposterior of Wistar rats following electrical stimulation of BLA might cause an increase in GABAergic transmission and inhibitory effects of SNR on target regions mayresult with easy onset of convulsive seizures. However in stimulated GAERS the decreased GAD67 immunoreactivity in SNRposterior might become manifest due to a decrease in GABAergic transmission and a protective effect of SNR on convulsive epileptic seizures. In GAERS suppressive effect of SNR on epileptic seizures might be more dominant as a result of difference in GAD67 activity in SNRposterior of stimulated GAERS when compared with Wistar rats. In addition a decrease in GAD67 immunoreactivity in SNRposterior of stimulated GAERS as well as in GABAergic transmission may lead to abolition of inhibitory effect of SNR in target regions.

Consequently, this disinhibition may play a role in the prevention of convulsive epileptic seizures in GAERS model due to activation of thalamic nuclei or superior colliculus.

Increased deoxyglucose uptake in SNRposterior subregion just before onset of seizure has been reported and SNRposterior was considered to be a gateway for the spread of seizure activity [24]. We did not detect any difference between basal values of GABA at nerve terminals in GAERS and Wistar control groups. However a statistically significant difference in GAD67 immunoreactivity was detected in SNRposterior between stimulated rats. Kindling resistance in stimulated GAERS may cause from the difference in GABAergic activity detected in the proconvulsive SNRposterior.

The results of this study indicated that SNRposhas an important role in the interaction of abterior sence epilepsy and temporal lobe epilepsy. In line with the results obtained from our study, analysis of electrophysiological characteristics of SNRanterior and SNRposterior subregions in GAERS and other models of absence epilepsy during kindling seizure

North Clin Istanb

activity, will contribute to highlighting of the clarification of novel underlying mechanisms of epilepsy and identifiying new targets for the effective treatment of seizures.

Conflict of Interest: None declared.

Funding/Sources of funding: This study was supported by the Scientific and Technological Research Council of Turkey (TUBITAK; Project no: 111S209).

Authorship contributions: Concept – F.O.; Design – F.O.; Supervision – F.O.; Materials – M.G.; Data collection &/or processing – M.G.; Analysis and/or interpretation – M.G., Ö.A., N.Ç., T.K., F.O.; Literature search – M.G., Ö.A., N.Ç., T.K.; Writing – M.G., Ö.A., N.Ç., T.K.; Critical review – F.O.

REFERENCES 1. Koutroumanidis M, Hennessy MJ, Elwes RD, Binnie CD, Polkey CE. Coexistence of temporal lobe and idiopathic generalized epilepsies. Neurology 1999;53:490–5.

2. Nicholson A, Chadwick DW, Smith DF. The coexistence of idiopatic generalized epilepsy and partial epilepsy. Epilepsia 2004;45:682–5.

3. Gloor P, Fariello RG. Generalized epilepsy: some of its cellular mechanisms differ from those of focal epilepsy. Trends Neurosci 1988;11:63–8.

4. Meeren H, van Luijtelaar G, Lopes da Silva F, Coenen A. Evolving concepts on the pathophysiology of absence seizures: the cortical focus theory. Arch Neurol 2005;62:371–6.

5. Engel JrJ. Introduction to temporal lobe epilepsy. Epilepsy Research 1996;26:141–50.

6. Depaulis A, Snead OC 3rd, Marescaux C, Vergnes M. Suppressive effects of intranigral injection of muscimol in three models of generalized non-convulsive epilepsy induced by chemical agents. Brain Res 1989;498:64–72.

7. van Luijtelaar EL, Coenen AM. Two types of electrocortical paroxysms in an inbred strain of rats. Neuroscience Letters 1986;70:393–7.

8. Bertram EH. Temporal lobe epilepsy: Where do the seizures really begin? Epilepsy & Behav 2009;14:32–7.

9. Mcintyre DC, Poulter MO, Gilby K. Kindling: some old and some new. Epilepsy Research 2002;50:79–92.

10. Racine RJ. Modification of seizure activity by electrical stimulation. II. Motor seizure. Electroencephalography and Clinical Neurophysiology 1972;32:281–94.

11. Eskazan E, Onat FY, Aker R, Öner G. Resistance to propagation of amygdaloid kindling seizures in rats with genetic absence epilepsy. Epilepsia 2002;43:1115–1.

12. Onat FY, Eşkazan E, Aker R. Experimental absence versus amygdaloid kindling. In: Corcoran M, Moshe SL, editors. Kindling 6.

Advances in Behavioral Biology. Springer; 2005. p. 37–48.

Gulcebi et al., Evaluation of GAD67 immunoreactivity

13. Aker RG, Yananli HR, Gurbanova AA, Ergun AO, Ates N, van Luijtelaar G, et al. Amygdala kindling in the WAG/Rij rat model of absence epilepsy. Epilepsia 2006;47:33–40.

14. Onat FY, Aker RG, Gurbanova AA, Ateş N, van Luijtelaar G. The effect of generalized absence seizures on the progression of kindling in the rat. Epilepsia 2007;48:150–6.

15. Çarçak N, Ferrandon A, Koning E, Aker GA, Özdemir O, Onat FY, et al. Effect of stage 2 kindling on local cerebral blood flow rates in rats with genetic absence epilepsy. Epilepsia 2009;50:33– 43.

16. Onat FY, Eşkazan E, Aker R. Interactions between CorticoThalamo-Cortical and Limbic Seizures. Philip A. Schwartzkroin, editor Encyclopedia of Basic Epilepsy Research. Oxford: Academic Press 2009;2:825–30.

17. Akman O, Karson A, Aker RG, Ates N, Onat FY. Hippocampal kindling in rats with absence epilepsy resembles amygdaloid kindling. Epilepsy Research 2008;81:211–9.

18. Akman O, Karson A, Aker RG, Ates N, Onat FY. Perirhinal cortical kindling in rats with genetic absence epilepsy. Neuroscience Letters, 2010;479:74–8.

19. Depaulis A, Vergnes M, Marescaux C. Endogenous control of epilepsy: the nigral inhibitory system. Progress in neurobiology 1994;42:33,52.

20. Bloms-Funke P, Löscher W. The anticonvulsant gabapentin decreases firing rates of substantia nigra pars reticulata neurons.

Eur J Pharmacol 1996;316:211–8.

21. Gale K. Mechanisms of seizure control mediated by gammaaminobutyric acid: role of the substantia nigra. Federation proceedings 1985;44:2414–24.

22. Mcnamara JO, Galloway MT, Rigsbee LC, Shin C. Evidence im-

167 plicating substantia nigra in regulation of kindled seizure threshold. Journal of Neuroscience 1984;4:2410–7.

23. Moshe SL, Sperber EF. Substantia nigra-mediated control of generalized seizures, Generalized epilepsy: cellular, molecular and pharmacological approaches. Ed: Gloor G, Kostopoulos R, Naquet M, Avoli P. Birkhauser Inc, Boston 1990;355–67.

24. Veliskova J, Miller AM, Nunes ML, Brown LL. Regional neural activity within the substantia nigra during peri-ictal flurothyl generalized seizure stages. Neurobiology of Disease 2005;20:752–9.

25. Akman O, Gulcebi MI, Carcak N, Ketenci Ozatman S, Eryigit T, Moshé SL, et al. The role of the substantia nigra pars reticulata in kindling resistance in rats with genetic absence epilepsy. Epilepsia 2015;56:1793–802.

26. Racine RJ. Modification of seizure activity by electrical stimulation. I. After-discharge threshold. Electroencephalography and Clinical Neurophysiology 1972;32:269–79.

27. Iadarola MJ, Gale K. Substantia nigra: site of anticonvulsant activity mediated by γ aminobutyric acid. Science 1982;218:1237–40.

28. Veliskova J, Moshé SL. Update on the role of substantia nigra pars reticulata in the regulation of seizures. Epilepsy Currents 2006;6:83–7.

29. Bolam JP, Hanley JJ, Booth PA, Bevan MD. Synaptic organisation of the basal ganglia. Journal of Anatomy 2000;196:527–42.

30. Deransart C, Marescaux C, Depaulis A. Involvement of nigral glutamatergic inputs in the control of seizures in a genetic model of absence epilepsy in the rat. Neuroscience 1996;71:721–8.

31. Freichel C, Ebert U, Potschka H, Löscher W. Amygdala-kindling does not induce a persistent loss of GABA neurons in the substantia nigra pars reticulata of rats. Brain Res 2004;29:1025:203–9.

Orıgınal Article

GENETICS & MOLECULAR MEDICINE

North Clin Istanb 2016;3(3):168–74 doi: 10.14744/nci.2016.27870

Effect of HLA-DPA1 alleles on chronic hepatitis B prognosis and treatment response Seyma Katrinli,1 Feruze Yilmaz Enc,2 Kamil Ozdil,3 Oguzhan Ozturk,3 Ilyas Tuncer,2 Gizem Dinler Doganay,1 Levent Doganay3 Department of Molecular Biology and Genetics, Istanbul Technical University, Istanbul, Turkey

1

Department of Gastroenterology, Goztepe Training and Research Hospital, Medeniyet University, Istanbul, Turkey

2

Department of Gastroenterology, Umraniye Training and Research Hospital, University of Medical Sciences, Istanbul, Turkey

3

ABSTRACT OBJECTIVE: Chronic hepatitis B (CHB) is a major health problem. The outcome of hepatitis B virus (HBV) infection is associated with variations in HLA-DPA1 alleles. The aim of this study was to investigate possible associations of HLA-DPA1 alleles with treatment response and with hepatitis B virus e antigen (HBeAg) seroconversion.

METHODS: Eight different HLA-DPA1 alleles from 246 CHB patients were genotyped by polymerase chain reaction with sequence-specific primers at high resolution to investigate the association of HLA-DPA1 alleles with treatment response, development of cirrhosis, HBeAg seroconversion, and disease reoccurrence upon HBeAg loss.

RESULTS: There was no significant association between HLA-DPA1 alleles and treatment response, development of cirrhosis, or HBeAg seroconversion. However, HLA-DPA1*04:01 allele was significantly more frequently found in patients who redeveloped disease upon HBeAg seroconversion (100% vs 36.8%: p=0.037; Fisher’s exact test).

CONCLUSION: HLA-DPA1*04:01 allele may be a risk factor for reoccurrence of CHB after HBeAg seroconversion.

Keywords: Chronic hepatitis B; cirrhosis; HBeAg seroconversion; HLA-DPA1; treatment response.

C

hronic hepatitis B (CHB) is a major global health issue, and despite national vaccination programs, between 350 million and 400 million people are infected with hepatitis B virus (HBV) worldwide [1]. Chronic HBV infection results in liver fibrosis, which can further develop into cirrhosis or hepatocellular carcinoma, both of which are major causes of liver-related death [2]. Number of annual deaths due to consequences of HBV in-

fection is estimated to be nearly 600000 worldwide [3]. In Turkey, 5% of population is hepatitis B surface antigen positive, and our country currently has medium endemicity profile for hepatitis B [4].

Development of chronic HBV infection is a complex process that involves various viral, environmental and genetic components, such as HBV genomic variability, host age, and sex, as well as concurrent infection with hepatitis C virus (HCV), hepatitis D

Received: November 29, 2016 Accepted: December 14, 2016 Online: January 25, 2017 Correspondence: Levent DOGANAY, MD. Saglik Bilimleri Universitesi, Umraniye Egitim ve Arastirma Hastanesi, Gastroenteroloji Klinigi, Elmalikent Mahallesi, Adem Yavuz Cad. No: 1, Umraniye, Istanbul, Turkey.

Tel: +90 216 - 632 18 18 e-mail: levent.doganay@ueh.gov.tr © Copyright 2016 by Istanbul Northern Anatolian Association of Public Hospitals - Available online at www.kuzeyklinikleri.com

Katrinli et al., Effect of HLA-DPA1 alleles on chronic hepatitis B prognosis and treatment response

virus, and human immunodeficiency virus (HIV) [5–8]. Segregation analysis and twin studies also suggest involvement of host genetic profile in development of chronicity in HBV infection [9, 10].

Human leukocyte antigen (HLA) class II loci have been proposed as major genetic host sites associated with HBV infection [11–14]. HLA-restricted T lymphocytes and B lymphocytes in the humoral immune system are responsible for the generation of an accurate immunological response against the virus [5, 6]. When this cytolytic immune reaction is inaccurate and nonselective in hepatocytes, instead of virus eradication, necroinflammation and liver fibrosis occur [15]. Genome-wide association studies (GWAS) have also demonstrated an association between HLA class II gene region and HBV chronicity [16, 17]. A recent GWAS study reported specific association between HLA-DP locus and CHB in Japanese and Thai populations [18]. In the present study, 8 HLA-DPA1 polymorphisms in the Turkish population were screened in high resolution to investigate association between HLA-DPA1 polymorphisms and HBV treatment response, cirrhosis, hepatitis B e antigen (HBeAg) seroconversion, and recurrence of disease after HBeAg seroconversion.

MATERIALS AND METHODS Study group The present study, which was approved by the local ethics committee, included 246 CHB patients who were followed-up at the hepatology clinic of Goztepe Teaching and Research Hospital between August 2005 and August 2010. Patient case notes were carefully reviewed, and demographic data, laboratory results, endoscopy results, virological parameters, biopsy scores, and treatment status details were analyzed. Patients with delta virus co-infection, HCV, HIV, liver disease other than HBV, patients receiving immunosuppressive treatment, and patients under age of 18 were not selected for the study. Demographic data of the patients is provided in Table 1.

HLA-DPA1 genotyping In total, 5 mL of peripheral blood was collected from each patient and stored in ethylenediaminetetraace-

169

Table 1. Demographic data of patients

Gender Male Female Age Log DNA (IU/mL) ALT (U/L) AST (U/L) HBeAg Positive Negative Cirrhosis Presence Absence

n±SD

(Min.–Max.)

152 (61.8%) 94 (38.2%) 5.56±2.25 92.03±100.72 61.51±59.32

(1.15–10.89) (8–681) (14–433)

56 (22.8%) 190 (77.2%) 53 (21.5%) 193 (78.5%)

SD: Standard deviation; Min.: Minimum; Max.: Maximum; DNA: Deoxyribonucleic acid; ALT: Alanine transaminase; AST: Aspartate aminotransferase; HBeAg: Hepatitis B e antigen.

tic acid tubes at -80°C until extraction of deoxyribonucleic acid (DNA). Genomic DNA was extracted from 1 mL of blood using Invitrogen PureLink Genomic DNA purification kit (Thermo Fischer Scientific, Inc., Waltham, MA, USA) according to manufacturer’s instructions. Eight different HLA DPA1 alleles were screened by polymerase chain reaction with sequence-specific primers (PCR-SSP) at high resolution [19]. Primer sequences and PCR product lengths are listed in Table 2. Internal positive control primers were included in the reaction system to exclude false negatives. Internal control was 439 bp fragment of human growth hormone gene 1 (Forward primer:5’GCCTTCCCAACC ATTCCCTTA3’, Reverse primer: 5’TCACGGATTTATGTTGTGTTTC3’). PCR was performed in 25 µL reaction mixture containing 0.5 units of DreamTaq Green DNA Polymerase (Thermo Fisher Scientific, Inc., Waltham, MA, USA), 1 mM magnesium chloride, 0.8 mM deoxynucleotide triphosphates, 0.2 mM primers, and 0.05 mM internal control primers. PCR amplification was achieved with initial denaturation at 94°C for 2 minutes followed by 30 amplification cycles. First 10 cycles consisted of denaturation at 94°C for 10

170

North Clin Istanb

Table 2. List of primers used in the study DPA1 allele

Primer

PCR product

*01:03/03:01 F: 5’GGGAGTTTATGTTTGAATTTGATGAA3’

R: 5’AGATAGGGCGTTACCGTTGG3’ *01:03/01:04 F: 5’ATGCCGCGTTTGTACAGACG3’

R: 5’AGATAGGGCGTTACCGTTGGT3’ *01:04 F: 5’TCTCTACTGTCTTTATGCAGCGG3’

R: 5’GATCCACATAGAACATCTCATCG3’ *02:01:01/02:01:02 F: 5’GACCATGTGTCAACTTATGCCGC3’

R: 5’CTTTTTATCCAGATCCACATAGAACTG3’ *02:02:01/02:02:02 F: 5’GACCATGTGTCAACTTATGCCA3’

R: 5’CTTGTCCAGATCCACATAGAACTG3’ *03:01 F: 5’GACCATGTGTCAACTTATGCCAT3’

R: 5’AGATAGGGCGTTACCGTTGGT3’ *04:01 F: 5’GCGTTTGTACAGACGCATAGAA3’

R: 5’GTGGTTGGAACGCTGGATAGC3’ *02:01:01 F: 5’ATGCCGCGTTTGTACAGACC3’

R: 5’AGATGCCAGACGGTCTCCTTT3’ *02:01:02 F: 5’TATGCCGCGTTTGTACACACG3’

R: 5’AGATGCCAGACGGTCTCCTTT3’ *02:02:01 F: 5’GACCATGTGTCAACTTATGCCAT3’

R: 5’TGCCAGACGGTCTCCTTCTTA3’ *02:02:01/03:01 F: 5’GACCATGTGTCAACTTATGCCA3’

R: 5’GCCAGACGGTCTCCTTCTTG3’

209 bp 242 bp 119 bp 108 bp 103 bp 258 bp 207 bp 109 bp 110 bp 122 bp 121 bp

PCR: polymerase chain reaction.

seconds followed by combined annealing-extension step at 65°C for 60 seconds. Remaining 20 cycles consisted of denaturation at 94°C for 10 seconds, annealing at 61°C for 50 seconds, and extension at 72°C for 30 seconds. After amplification, 10 μL of PCR products were loaded onto 2% agarose gel and stained with SYBR Green I Nucleic Acid Gel Stain (Thermo Fisher Scientific, Inc., Waltham, MA, USA). Upon visualization under ultraviolet light, DPA1 allele types were determined according to presence or absence of a PCR product of corresponding length.

response to nucleotide analogs, patients with and without good treatment response to interferon, patients with and without cirrhosis, patients with and without HBeAg seroconversion, and patients with and without disease progression after HBeAg seroconversion. For these analyses, 2x2 contingency tables and chi-square test were used. If the sample size was small, Fisher’s exact test was applied.

For all analyses, SPSS Statistics 21 (IBM Corp., Armonk, NY, USA) was used; double-sided p values were calculated, and p<0.05 was considered statistically significant.

Statistical analysis Statistical analyses were performed to evaluate differences between groups: patients with and without good treatment response to standard antiviral drugs, patients with and without good treatment

RESULTS CHB patients were grouped and analyzed according to their treatment response to standard antiviral drugs, nucleotide analogs or interferon, presence of

Katrinli et al., Effect of HLA-DPA1 alleles on chronic hepatitis B prognosis and treatment response

171

Table 3. Number of patients in each study group Study group

Treatment response to all antivirals

Treatment response to nucleotide analogs

Treatment response to interferon

Cirrhosis

HBeAg seroconversion

Recurrence of disease after HBeAg seroconversion

Number of patients

Yes 93 No 99 Yes 71 No 73 Yes 69 No 14 Present 53 Absent 193 Present 23 Absent 34 Present 11 Absent 12

HBeAg: Hepatitis B e antigen.

Table 4. Frequency of DPA1 alleles among chronic hepatitis B patients (n=246) DPA1 alleles

Frequency (n=246) n

%

DPA1*01:03 114 46.3 DPA1*01:04 46 18.7 DPA1*03:01 190 77.2 DPA1*04:01 55 22.4 DPA1*02:01:01 27 11.0 DPA1*02:01:02 31 12.6 DPA1*02:02:01 10 4.1 DPA1*02:02:02 9 3.7

cirrhosis, HBeAg seroconversion, and recurrence of disease after HBeAg seroconversion. Number of patients in each group can be seen in Table 3 and frequency of all DPA1 alleles among all patients (n=246) is listed in Table 4.

No significant association was observed between HLA DPA1 alleles and patients with or without cirrhosis (Table 5). Neither was there significant association between HLA DPA1 alleles and patients with or without HBeAg seroconversion. In

addition, HLA DPA1 alleles were not found to be associated with treatment response to standard antiviral drugs (Table 6), nucleotide analogs, or interferon. However, when recurrence of disease after seroconversion was analyzed, HLA DPA1*04:01 allele was significantly more frequently found in patient CHB group with recurrence vs patients with inactive disease (100% vs 36.8%; p=0.037; Fisherâ&#x20AC;&#x2122;s exact test) (Table 7).

DISCUSSION CHB treatment is a challenging issue. In addition to viral factors, several host immune factors participate in drug resistance, HBeAg seroconversion, and reoccurrence of the disease. Since HLA-DPA1 and -DPB1 are less polymorphic than HLA-DR or -DQ, and HLA-DP cell surface expression levels are also likely to be lower, HLA-DP region was not thought to have as much clinical impact as other HLA alleles [20, 21]. However, recent GWAS studies have shown that HLA-DP region is associated with both protection against CHB and viral clearance [16â&#x20AC;&#x201C;18].

HLA-DPA1 molecules, which are HLA class II molecules, are responsible for antigen presentation

172

North Clin Istanb

Table 5. Frequency of HLA DPA1 alleles in patients with and without cirrhosis DPA1 alleles

Cirrhotic patient group (n=53)

n

Non-cirrhotic patient group (n=193)

%

n

p

%

DPA1*01:03 29 54.7 85 44.0 0.167 DPA1*01:04 9 17.0 37 19.2 0.717 DPA1*03:01 39 73.6 151 78.2 0.474 DPA1*04:01 7 13.2 48 24.9 0.071 DPA1*02:01:01 6 11.3 21 10.9 0.928 DPA1*02:01:02 6 11.3 25 13.0 0.751 DPA1*02:02:01 3 5.7 7 3.6 0.507 DPA1*02:02:02 3 5.7 6 3.1 0.381

Table 6. Distribution of HLA DPA1 alleles according to treatment response DPA1 alleles

Patients with treatment response (n=99)

n

Patients without treatment response (n=93)

%

n

p

%

DPA1*01:03 49 49.5 40 43.0 0.368 DPA1*01:04 19 19.2 18 194 0.977 DPA1*03:01 72 72.7 73 78.5 0.353 DPA1*04:01 16 16.2 22 23.7 0.193 DPA1*02:01:01 13 13.1 11 11.8 0.785 DPA1*02:01:02 12 12.1 10 10.8 0.766 DPA1*02:02:01 6 6.1 3 3.2 0.353 DPA1*02:02:02 5 5.1 3 3.2 0.527

Table 7. Frequency of HLA DPA1*04:01 allele in hepatitis B e antigen seroconverted group with and without disease recurrence

Patients with disease recurrence after HBeAg seroconversion

Patients with inactive disease after HBeAg seroconversion

n

%

n

%

HLA DPA1*04:01 carrier HLA DPA1*04:01 non- carrier

4 7

100 36.8

0 12

0 63.2

HBeAg: Hepatitis B e antigen. p=0.037 according to Fisherâ&#x20AC;&#x2122;s exact test.

to CD4+ T helper cells. Since T cell helper response is critical for HBV clearance, there is a direct link between HBV clearance and increased CD4+ T cells

response [22, 23]. Antigen-binding sites of HLADP molecules, which play a crucial role in the physical binding of peptides and subsequent recognition

Katrinli et al., Effect of HLA-DPA1 alleles on chronic hepatitis B prognosis and treatment response

by T-cells, are highly polymorphic [24, 25]. Therefore, diversity of HLA-DPA1 alleles due to variations in the HLA-DP coding regions is a key factor in antigen presentation and hence, viral clearance.

Recent studies demonstrated that HLA-DPA1 SNPs rs3077 and rs9277378, which are located in the 3’UTR and 2Kb upstream intronic site, respectively, are associated with spontaneously resolved HBV infection [26, 27] and chronicity of HBV [28, 29]. In this study, no significant association between HLA-DPA1 alleles and HBeAg seroconversion was found. However, we observed higher frequency of HLA-DPA1*04:01 allele in patients with active disease vs inactive disease after HBeAg seroconversion (100% vs 36.8%; p=0.037; Fisher’s exact test), thus showing an association between HLA-DPA1 and recurrence of disease after HBeAg loss. Lack of association between HLA-DPA1 alleles and HBeAg seroconversion has also been stated in the literature [30]. However, HLA-DPA1 alleles were shown to be associated with HBeAg loss, anti-HBe seroconversion, and HBV DNA level suppression in HBeAg seropositive CHB patients upon interferon alpha or pegylated interferon treatment [31].

In conclusion, presence of HLA-DPA1*04:01 allele may be a risk factor for recurrence of the disease upon HBeAg seroconversion, and thus may be a potential biomarker to predict patients in need of prolonged antiviral therapy. Nonetheless, a larger cohort is required to validate this finding.

Conflict of Interest: None declared.

Financial Disclosure: Sources of funding for this study were Istanbul Technical University internal funds and Umraniye Education and Research Hospital internal funds.

Authorship contributions: Concept – K.Ö., İ.T., G.D.D., L.D.; Design – K.Ö., İ.T., G.D.D., L.D.; Supervision – K.Ö., İ.T., G.D.D., L.D.; Materials – K.Ö., İ.T., G.D.D., L.D.; Data collection &/or processing – Ş.K., O.Ö., F.Y.E.; Analysis and/or interpretation – Ş.K., G.D.D., L.D.; Literature search – Ş.K., O.Ö.; Writing – Ş.K., O.Ö., G.D.D., L.D.; Critical review – K.Ö., İ.T., G.D.D., L.D.

REFERENCES 1. Lavanchy D. Hepatitis B virus epidemiology, disease burden, treatment, and current and emerging prevention and control measures. J Viral Hepat 2004;11:97–107.

2. Calvaruso V, Craxi A. Fibrosis in chronic viral hepatitis. Best

173

practice & research Clinical gastroenterology 2011;25:219–30.

3. Goldstein ST, Zhou F, Hadler SC, Bell BP, Mast EE, Margolis HS. A mathematical model to estimate global hepatitis B disease burden and vaccination impact. Int J Epidemiol 2005;34:1329– 39.

4. Alacacioglu A, Somali I, Simsek I, Astarcioglu I, Ozkan M, Camci C, et al. Epidemiology and survival of hepatocellular carcinoma in Turkey: outcome of multicenter study. Jpn J Clin Oncol 2008;38:683–8.

5. Chu CJ, Lok AS. Clinical significance of hepatitis B virus genotypes. Hepatology 2002;35:1274-6.

6. Wang FS. Current status and prospects of studies on human genetic alleles associated with hepatitis B virus infection. World journal of gastroenterology, WJG 2003;9:641–4.

7. Thursz M. Genetic susceptibility in chronic viral hepatitis. Antivir Res 2001;52:113–6.

8. Frodsham AJ, Hill AVS. Genetics of infectious diseases. Human Molecular Genetics 2004;13:187–94.

9. Hann HWL, Kim CY, London WT, Whitford P, Blumberg BS. Hepatitis-B Virus and Primary Hepatocellular-Carcinoma - Family Studies in Korea. Int J Cancer 1982;30:47–51.

10. Lin TM, Chen CJ, Wu MM, Yang CS, Chen JS, Lin CC, et al.

Hepatitis-B Virus Markers in Chinese Twins. Anticancer Res 1989;9:737–41.

11. Thursz MR, Kwiatkowski D, Allsopp CE, Greenwood BM, Thomas HC, Hill AV. Association between an MHC class II allele and clearance of hepatitis B virus in the Gambia. The New England journal of medicine 1995;332:1065–9.

12. Hohler T, Gerken G, Notghi A, Lubjuhn R, Taheri H, Protzer U, et al. HLA-DRB1*1301 and *1302 protect against chronic hepatitis B. Journal of hepatology 1997;26:503–7.

13. Ahn SH, Han KH, Park JY, Lee CK, Kang SW, Chon CY, et al.

Association between hepatitis B virus infection and HLA-DR type in Korea. Hepatology 2000;31:1371–3.

14. Kummee P, Tangkijvanich P, Poovorawan Y, Hirankarn N. Association of HLA-DRB1*13 and TNF-alpha gene polymorphisms with clearance of chronic hepatitis B infection and risk of hepatocellular carcinoma in Thai population. Journal of viral hepatitis 2007;14:841–8.

15. Guo XC, Wu YQ. A review: progress of prevention and control on viral hepatitis in China. Biomed Environ Sci 1999;12:227– 32.

16. Mbarek H, Ochi H, Urabe Y, Kumar V, Kubo M, Hosono N, et al. A genome-wide association study of chronic hepatitis B identified novel risk locus in a Japanese population. Hum Mol Genet.

2011;20:3884–92.

17. Nishida N, Sawai H, Matsuura K, Sugiyama M, Ahn SH, Park JY, et al. Genome-wide association study confirming association of HLA-DP with protection against chronic hepatitis B and viral clearance in Japanese and Korean. PLoS One 2012;7:39175.

18. Kamatani Y, Wattanapokayakit S, Ochi H, Kawaguchi T, Takahashi A, Hosono N, et al. A genome-wide association study identifies variants in the HLA-DP locus associated with chronic

174 hepatitis B in Asians. Nat Genet 2009;41:591–5.

19. Aldener-Cannava A, Olerup O. HLA-DPA1 typing by PCR amplification with sequence-specific primers (PCR-SSP) and distribution of DPA1 alleles in Caucasian, African and Oriental populations. Tissue antigens 1996;48:153–60.

20. Edwards JA, Durant BM, Jones DB, Evans PR, Smith JL. Differential expression of HLA class II antigens in fetal human spleen: relationship of HLA-DP, DQ, and DR to immunoglobulin expression. J Immunol 1986;137:490–7.

21. Guardiola J, Maffei A. Control of MHC class II gene expression in autoimmune, infectious, and neoplastic diseases. Crit Rev Immunol 1993;13:247–68.

22. Penna A, Del Prete G, Cavalli A, Bertoletti A, D’Elios MM, Sorrentino R, et al. Predominant T-helper 1 cytokine profile of hepatitis B virus nucleocapsid-specific T cells in acute self-limited hepatitis B. Hepatology 1997;25:1022–7.

23. Urbani S, Boni C, Amadei B, Fisicaro P, Cerioni S, Valli MA, et al. Acute phase HBV-specific T cell responses associated with HBV persistence after HBV/HCV coinfection. Hepatology 2005;41:826–31.

24. Fontenot AP, Torres M, Marshall WH, Newman LS, Kotzin BL. Beryllium presentation to CD4+ T cells underlies diseasesusceptibility HLA-DP alleles in chronic beryllium disease.

Proceedings of the National Academy of Sciences of the United States of America 2000;97:12717–22.

25. Diaz G, Amicosante M, Jaraquemada D, Butler RH, Guillen MV, Sanchez M, et al. Functional analysis of HLA-DP poly-

North Clin Istanb morphism: a crucial role for DPbeta residues 9, 11, 35, 55, 56, 69 and 84-87 in T cell allorecognition and peptide binding. Int Immunol 2003;15:565–76.

26. Wasityastuti W, Yano Y, Ratnasari N, Triyono T, Triwikatmani C, Indrarti F, et al. Protective effects of HLA-DPA1/DPB1 variants against Hepatitis B virus infection in an Indonesian population. Infect Genet Evol 2016;41:177–84.

27. Posuwan N, Payungporn S, Tangkijvanich P, Ogawa S, Murakami S, Iijima S, et al. Genetic association of human leukocyte antigens with chronicity or resolution of hepatitis B infection in thai population. PLoS One 2014;9:86007.

28. Wong DK, Watanabe T, Tanaka Y, Seto WK, Lee CK, Fung J, et al. Role of HLA-DP polymorphisms on chronicity and disease activity of hepatitis B infection in Southern Chinese. PLoS One 2013;8:66920.

29. An P, Winkler C, Guan L, O’Brien SJ, Zeng Z, Consortium HBVS. A common HLA-DPA1 variant is a major determinant of hepatitis B virus clearance in Han Chinese. J Infect Dis 2011;203:943–7.

30. Komatsu H, Murakami J, Inui A, Tsunoda T, Sogo T, Fujisawa T. Association between single-nucleotide polymorphisms and early spontaneous hepatitis B virus e antigen seroconversion in children. BMC Res Notes 2014;7:789.

31. Cheng L, Sun X, Tan S, Tan W, Dan Y, Zhou Y, et al. Effect of HLA-DP and IL28B gene polymorphisms on response to interferon treatment in hepatitis B e-antigen seropositive chronic hepatitis B patients. Hepatol Res 2014;44:1000–7.

Orıgınal Article

MICROBIOLOGY

North Clin Istanb 2016;3(3):175–82 doi: 10.14744/nci.2016.26023

Diagnostic value of sTREM-1 and procalcitonin levels in the early diagnosis of sepsis Sebahat Aksaray,1 Pinar Alagoz,2 Asuman Inan,3 Simin Cevan,4 Asu Ozgultekin5 Department of Medical Microbiology, Haydarpasa Numune Training and Research Hospital, Istanbul, Turkey

1

Sinop Public Health Laboratory, Sinop,Turkey

2

Department of Infectious Diseases and Clinical Microbiology, Haydarpasa Numune Training and Research Hospital, Istanbul, Turkey

3

Bolu Public Health Laboratory, Bolu,Turkey

4

Department of Anesthesiology and Reanimation, Haydarpasa Numune Training and Research Hospital, Istanbul, Turkey

5

ABSTRACT OBJECTIVE: Sepsis is still major cause of morbidity and mortality, despite improvements in diagnosis and treatment in modern medicine. Therefore, laboratory examinations that provide correct and rapid results are needed to support the diagnosis. This study was conducted to investigate value of immunological indicators procalcitonin (PCT) and soluble triggering receptor expressed on myeloid cells-1 (sTREM-1) in differential diagnosis of patients with sepsis and systemic inflammatory response syndrome (SIRS), as well as to assess their importance in determining prognosis of patients with sepsis.

METHODS: Total of 90 patients, 38 with SIRS and 52 with sepsis, who were between the ages 20 to 92, were included in this prospectively planned study. Blood sample was collected from the patients during hospitalization and again in follow-up visit. Enzyme-linked immunosorbent assay (MyBioSource, Inc., San Diego, CA, USA) was used to measure sTREM-1, and PCT was measured using mini VIDAS B.R.A.H.M.S PCT assay (Biomerieux, S.A., Marcy-l’Étoile, France). In addition, patients were clinically assessed using Acute Physiology and Chronic Health Evaluation (APACHE) II scoring system.

RESULTS: On day of intensive care unit admission, sTREM-1 and PCT levels, as well as APACHE II score were significantly higher in sepsis group than SIRS group (p=0.001, p=0.01, p=0.001, respectively). Values of sTREM-1 and APACHE II score were higher in the patients with positive blood cultures than those with negative culture results (p=0.002, p=0.006, respectively). PCT, C-reactive protein, and sTREM-1 levels were significantly higher in nonsurviving group. In differentiation of SIRS from sepsis, sTREM-1 cut-off value ≥133 pg/mL and PCT cut-off value of 1.57 ng/mL yielded sensitivity of 71.1% and 67.33%, and specificity of 73.3% and 65.79%, respectively.

CONCLUSION: In patients with suspected sepsis, sTREM-1 and PCT can be used as indicators, in addition to scoring systems such as APACHE II and Sepsis-related Organ Failure Assessment score. However, it would be appropriate to support present findings with studies of larger series.

Keywords: APACHE II; procalcitonin; sepsis; SIRS; sTREM-1.

Received: October 12, 2016 Accepted: December 20, 2016 Online: January 25, 2017 Correspondence: Dr. Sebahat AKSARAY. Haydarpasa Numune Egitim ve Arastirma Hastanesi, Mikrobiyoloji Laboratuvari Tibbiye Poliklinik Binasi, Uskudar, Istanbul, Turkey.

Tel: +90 216 - 542 32 32 e-mail: aksarays@hotmail.com © Copyright 2016 by Istanbul Northern Anatolian Association of Public Hospitals - Available online at www.kuzeyklinikleri.com

176

S

epsis is a common cause of morbidity and mortality in critically ill patients [1, 2]. Lack of specific clinical signs and symptoms for sepsis frequently leads to delay in treatment. However, accurate and timely diagnosis could allow for early treatment, reduce misuse of antibiotics and costs, limit morbidity, and improve patient outcomes. Microbiological cultures are still considered optimal for sepsis diagnosis, but this method has low sensitivity and specificity [3, 4]. In this context, it is imperative to identify ideal markers that would prove useful in differentiating sepsis from noninfectious diseases.

Therefore, evaluation of sepsis biomarkers in different patient groups is still of great consequence.

C-reactive protein (CRP) has been widely used as an indicator of infection, but it is also elevated by other inflammatory conditions at early stages.

Among recent potentially useful sepsis markers, procalcitonin (PCT) has been considered one of the most promising, and cumulative published reports support use of PCT measurement [3–5].

Serum triggering receptor expressed on myeloid cells-1 (TREM-1) is a recently discovered member of the immunoglobulin superfamily, expression of which on neutrophils and monocytes was upregulated by exposure to bacteria and fungi. sTREM-1 is soluble form of TREM-1 and is released from activated phagocytes into body fluids, such as plasma, pleural fluid, bronchoalveolar lavage fluid, urine, and cerebrospinal fluid. Many studies and several meta-analyses have indicated that sTREM-1 could be a valuable diagnostic biomarker for various infectious diseases [5–9].

In this study, sTREM-1, PCT, CRP serum levels and a scoring system, Acute Physiology and Chronic Health Evaluation (APACHE) II, were assessed in terms of their value for sepsis diagnosis and prediction of prognosis for hospitalized patients.

MATERIALS AND METHODS This prospective observational study was performed in the adult medical-surgical intensive care units (ICUs) of a Training and Research Hospital, which has 725 beds, between May 2013 and January 2014.

Approval of the hospital ethics committee and signed

North Clin Istanb

informed consent forms were obtained from patients or their families before inclusion in the study.

Patients Consecutive hospitalized patients who had 2 or more of the following signs during their first 24 hours in the units were diagnosed as SIRS and were included in the study: temperature of >38°C or <36°C, pulse rate of >90 beats/min, respiratory rate of >20 breaths/min or hyperventilation with partial pressure of arterial carbon dioxide of <32 mmHg, or white blood cell (WBC) count of >12 000μL or <4000 μL, or >10% immature cells.

Patients exhibiting 2 or more signs of SIRS with proven infection were diagnosed as sepsis. Exclusion criteria were: <18 years of age, acquired immunodeficiency syndrome, neutropenia (polymorphonuclear granulocyte count <500 μL), or died within 24 hours after admission to the hospital, elected not to participate in the study, or declined treatment during the observation period.

All medical records of the patients were retrospectively evaluated and the patients were classified as sepsis or SIRS at the time of submission by 2 clinicians blinded to biomarker results.

Data collection Upon admission to the units, the following data were recorded for each patient: age, gender, main complaints for admission, symptoms, body temperature, leukocyte count, APACHE II score, etiological factors, and underlying diseases. Survival or death in hospital was evaluated during 28-day follow-up period.

When the patients were admitted, first blood sample was drawn within the first 24 hours and second was taken during treatment when patient had fever or mental state disorder (consistent with sepsis criteria).

Blood samples were centrifuged at 3000 rpm for 15 minutes and supernatant was stored at -80ºC. Assays BacT/ALERT 3D automated microbial detection system (Biomerieux, S.A., Marcy-l’Étoile, France) was used for blood cultures and pathogens

Aksaray et al., Diagnostic value of sTREM-1 and procalcitonin levels in the early diagnosis of sepsis

were identified conventionally or using automated (VITEK 2 Compact; Biomerieux, S.A., Marcyl’Étoile, France) system. WBC was determined using CELL-DYN 3700 hematology analyzer (Abbott Laboratories, Abbott Park, IL, USA). CRP was determined using nephelometric assay (Beckman Coulter, Inc., Brea, CA, USA and Siemens Healthcare Diagnostics Products GmbH, Marburg, Germany). PCT was measured using mini VIDAS B.R.A.H.M.S PCT assay (Biomerieux, S.A., Marcy-l’ Étoile, France), sTREM-1 level was determined in duplicate using an enzyme-linked immunosorbent assay (MyBioSource, Inc., San Diego, CA, USA). All procedures were performed in strict accordance with manufacturers’ instructions and standard microbiology guidelines.

Statistical analysis Descriptive results of continuous variables with normal distribution are presented as mean± SD or median (interquartile range). Mann-Whitney U test was used for comparison of variables and to evaluate differences between groups. Wilcoxon signed-rank test was used to analyze relationship between second and first measurements, and Yates continuity correction was applied to compare qualitative data.

Receiver operating characteristic (ROC) curve was employed to evaluate effects of sTREM-1, PCT, CRP levels, and APACHE II scores on sepsis diagnosis. NCSS 2007 and PASS 2008 (NCSS, LLC, Kaysville, UT, USA) statistical software programs were used for statistical analysis. Two-tailed p<0.05 was considered significant.

RESULTS A total of 90 consecutive patients admitted to ICUs of the hospital were enrolled in the study. Final diagnosis of 52 patients was established to be sepsis and 38 were diagnosed as SIRS. Forty-seven patients (52.2%) were male and 43 (47.8%) were female.

Mean age of the patients was 64.27±15.54 years (range: 20–92 years). Comorbidities were frequent (92.2%). In terms of predisposing factors, only rate of cerebrovascular occlusion was statistically higher in sepsis group than in SIRS group (p=0.03).

177

Blood cultures were positive in 38 (73.3%) patients with sepsis. Most frequently isolated microorganisms were methicillin-resistant coagulase-negative Staphylococcus (36%), Escherichia coli (13%), and Acinetobacter baumannii (13%), respectively. Main source of infection was the lungs (44.2%), followed by the blood (21%). Length of stay in ICU was 14±12 (SD) days. Twenty-two patients (24.4%) died. Mortality rate was much higher in sepsis group than in SIRS group (p=0.01) (Table 1). sTREM-1, PCT level, and APACHE II score were significantly elevated in sepsis group compared with SIRS group (p=0.001, p=0.01, p=0.001, respectively), on first day of ICU admission. There were no significant differences in median CRP value or WBC count (p=0.498, p=0.180, respectively).

Both first and second measurements of sTREM-1 level were significantly higher in sepsis group than in SIRS group (p=0.001, p=0.001, p<0.01, respectively). First and second measurement of PCT level (p=0.01, p=0.01, p<0.05) and APACHE II score (p=0.001, p<0.01) were significantly higher in sepsis group. In terms of differentiation between sepsis and SIRS, there was no significant difference between first and second measurement of sTREM-1, PCT and CRP levels, or WBC count (Table 2). sTREM-1 value and APACHE II score were higher in the patients with positive blood cultures than negative ones (177.9 pg/mL vs 113.96 pg/mL, p=0.002; 26 vs 29.5, p= 0.006). PCT, CRP, and WBC levels were found to be higher in the patients with positive blood cultures, but the difference between 2 groups was not statistically meaningful.

PCT and CRP levels were significantly higher (1.07 ng/mL vs 3.11 ng/mL, p=0.01; 9.15 mg/dL vs 17.80 mg/dL, p=0.02) in second measurement, and initial APACHE II score was statistically higher (26 vs 31; p=0.001), in nonsurviving patients. sTREM-1 level increased in second measurement of nonsurviving group (104.37 pg/mL vs 160.74 pg/mL; p <0.01). First and second sTREM-1 levels were higher in nonsurviving group (135.83 pg/ mL vs 104.37 pg/mL; 140 pg/mL vs 160.74 pg/ mL), but the difference was not statistically significant (p=0.840, p=0.512) between surviving and nonsurviving groups.

178

North Clin Istanb

Table 1. Baseline characteristics of the patients

Age Gender Male Female Positive blood culture APACHE II Etiological factors Respiratory system infection Bacteremia Urinary tract infection Unknown Catheter-related bloodstream infection Intraabdominal infection Surgical site infection Endocarditis Predisposal factors CVO Malignancy Respiratory disorder CKD Trauma COPD Neurological disorder CAD HT Length of hospital stay (days) Mortality

SIRS n=38 n

% 65.71±15.23

Sepsis n=52 n

% NS

63.21±15.83

18 47.4 20 52.6 0 0 23.84±5.26

29 55.8 23 44.2 38 73.1* 27.83±5.76

– – – – – – – –

21 11 5 4 4 4 2 1

– – – – – – – –

p

NS <0.001 0.001

40 21 9 8 8 8 4 2

4 10 11 21 5 15 5 9 4 10 3 6 4 10 3 6 1 3 2 4 2 5 2 4 2 5 2 4 1 3 2 4 2 5 1 2 25.05±14.19 32.7±21.37 5 13.2 17 32.7

– – – – – – – – 0.03 NS NS NS NS NS NS NS NS NS 0.01

APACHE: Acute Physiology and Chronic Health Evaluation; CAD: Chronic arterial disease; CKD: Chronic kidney disease; COPD: Chronic obstructive pulmonary disease; CVO: Chronic vascular occlusion; HT: Hypertension; SIRS: Systemic inflammatory response syndrome.

ROC was used to determine cut-off values of sTREM-1, PCT, and APACHE II. Area under the ROC curve (AUROC) was 0.78 (95% CI, 0.69– 0.86) for sTREM-1, 0.65 (95% CI, 0.53–0.76) for PCT, and 0.71 (95% CI, 0.60-0.81) for APACHE II score. sTREM-1 cut-off value of ≥133 pg/mL yielded sensitivity of 71.15%, specificity of 76.32%, positive predictive value (PPV) of 80.43, and negative predictive value (NPV) of 65.91 for differentiating patients with SIRS from those with infection.

When 1.57 ng/mL was set as cut-off value for PCT, sensitivity was 67.31%, specificity established was 65.79%, PPV was 72.92, and NPV was determined to be 59.52. APACHE II score of greater than 25 produced sensitivity of 80.77%, specificity of 52.63%, PPV of 70.00, and NPV of 66.67 (Figure 1).

DISCUSSION Sepsis has high mortality rate, with estimated range of 10% to 52%. Early identification of sepsis and

Aksaray et al., Diagnostic value of sTREM-1 and procalcitonin levels in the early diagnosis of sepsis

179

Table 2. PCT, sTREM-1, CRP, WBC levels and APACHE II score of patients with sepsis and SIRS

PCT Min-Max (Median) 1st measurement

Mean±SD PCT 2nd measurement Min-Max (Median)

Mean±SD b p Difference; Min-Max (Median) sTREM-1 1st measurement Min-Max (Median)

Mean±SD sTREM-1 2nd measurement Min-Max (Median)

Mean±SD b p Difference; Min-Max (Median) CRP 1st measurement Min-Max (Median)

Mean±SD CRP 2nd measurement Min-Max (Median)

Mean±SD b p Difference; Min-Max (Median) WBC 1st measurement Min-Max (Median)

Mean±SD WBC 2nd measurement Min-Max (Median)

Mean±SD b p Difference; Min-Max (Median) APACHE II Min-Max (Median)

Mean±SD

Sepsis (n=52)

SIRS (n=38)

p

0.05–95.03 (3.86) 11.33±19.31

0.05–71.95 (1.14) 5.86±13.57

0.010*

0.06–106.70 (2.62) 11.53±18.96 0.820 -66.02/105.45 (-0.23)

0.05–13.34 (0.91) 2.48±3.38 0.516 -61.15/12.21 (-0.05)

0.010*

67.49–2000 (164.66) 389.82±524.44

18.33–371.62 (96.78) 110.86±57.66

0.001**

70.86–2000.00 (171.28) 397.59±494.75 0.426 -829.12/797.78 (2.85)

37.08–289.36 (99.85) 111.45±45.84 0.602 -82.26/49.58 (1.89)

0.001**

3.0–42.8 (13.7) 14.55±7.00

4.3–32.5 (11.75) 13.91±7.18

0.498

1.93–42.90 (11.0) 13.24±8.14 0.201 -19.80/33.85 (-3.22)

1.98–30.00 (9.61) 11.63±7.21 0.213 -24.85/16.39 (-1.52)

0.367

6.0–46.7 (14.1) 15.86±7.97

2.4–46.2 (13.05) 14.10±8.64

0.180

2.4–55.9 (12.2) 14.83±8.95 0.473 -37.70/38.90 (-1.00) 10–40 (28.5) 27.83±5.76

3.1–45.1 (10.9) 13.14±8.45 0.293 -24.10/20.39 (-0.86) 10–32 (23.5) 23.84±5.26

0.170

a

0.958

0.947

0.922

0.927 0.001**

APACHE: Acute Physiology and Chronic Health Evaluation; CRP: C-reactive protein; PCT: Procalcitonin; SIRS: Systemic inflammatory response syndrome; sTREM-1: Soluble triggering receptor expressed on myeloid cells-1; WBC: White blood cell; aMann-Whitney U test; bWilcoxon signed-rank test; *p<0.05; **p<0.01

appropriate initial treatment has a major effect on clinical course and outcomes of patients [10–14].

Currently, physicians use a variety of tools, such as WBC, CRP, PCT, and severity scores, such as APACHE II, to help discriminate between infec-

tious and noninfectious conditions, as well as to predict clinical outcomes. Many sepsis-related biomarkers have been identified for this purpose; however, it is still controversial which biomarker is best for early sepsis diagnosis in daily practice [15, 16].

180

North Clin Istanb

ROC curve

1.0

Sensitivity

0.8

0.6

0.4

Source of the curve PCT sTREM-1 CRP WBC APACHE Reference line

0.2

0.0 0.0

0.2

0.4 0.6 Specificity

0.8

1.0

APACHE: Acute Physiology and Chronic Health Evaluation; CRP: C-reactive protein; PCT: Procalcitonin; sTREM-1: Soluble triggering receptor expressed on myeloid cells-1; WBC: White blood cell.

Figure 1. Receiver operating characteristic curve of PCT, sTREM-1, CRP, WBC, and APACHE II values.

Although CRP level has been widely proposed as a useful screening test for sepsis, it is doubtful that it is a good indicator for early diagnosis of sepsis [17]. PCT complies with most of the desirable preanalytical, analytical, and postanalytical features for an ideal laboratory biomarker. PCT level increases in bacterial infection, especially Gram-negative bacterial infections [18]. Compared to other biomarkers of sepsis, PCT has superior diagnostic accuracy and remains unaffected even in the presence of concomitant immunosuppressive therapy. PCT level was found to be the most valuable biomarker for diagnosis of sepsis and bacteremia for patients in the emergency department and ICU [19â&#x20AC;&#x201C;21]. Endo et al. [22] reported that if they used serum PCT cutoff point of 2.0 ng/mL to discriminate between sepsis and severe sepsis, overall diagnostic efficiency was 84.3%. On the other hand, several studies have also reported less convincing data, making use of this biomarker controversial [23, 24].

Many studies have indicated that sTREM-1 could be valuable diagnostic biomarker for various infectious diseases [25â&#x20AC;&#x201C;31]. Dynamic changes in sTREM-1 level could predict outcome of pa-

tients at early stage of sepsis. Rivera-Chavez et al.

[26] evaluated 93 patients in a surgical ICU with SIRS symptoms and suspected infection. The patients were classified as having SIRS (n=37) or sepsis (n=56) according to decision of the treating physician and bacteriological evidence. The authors reported that the patients with sepsis had significantly higher sTREM-1 level than those with SIRS. sTREM-1 cut-off value of 230 pg/mL yielded sensitivity of 98% and specificity of 91% in differentiating patients with SIRS from those with infection. Su et al. [27] performed a study involving 144 patients in ICU (60 patients with SIRS and 84 patients with sepsis complicated by new onset of fever). They found that sepsis group had higher serum sTREM-1, PCT, and CRP levels compared with SIRS group (p<0.05) on first day of ICU admission. In study conducted by Li et al. [28], 52 consecutive patients hospitalized in surgical ICU with suspicion of infection included 14 patients with SIRS, 9 patients with sepsis, 14 patients with severe sepsis, and 15 patients with septic shock. They found that in postoperative patients, plasma level of sTREM-1 was higher in patients with sepsis than in patients with SIRS (111.7 pg/mL vs 64.1 pg/ mL; p<0.05), with sensitivity, specificity, and predictive values higher than those of PCT and tumor necrosis factor alpha.

In meta-analysis of 13 clinical studies that fulfilled inclusion criteria (Total 980 patients, 557 patients with bacterial and 423 with nonbacterial infection), Jiyong et al. [9] reported that sTREM-1 level for diagnosis of infection in AUC of summary ROC was 0.86, with sensitivity of 0.82, and specificity of 0.86. These findings indicated that sTREM-1 is reliable biomarker for bacterial infection. Wu et al. [16] evaluated 11 studies with total of 1795 patients in a recent meta-analysis. AUC of summary ROC was 0.87, pooled sensitivity and specificity were 79% and 80%, respectively. The authors concluded that plasma sTREM-1 had moderate diagnostic performance in differentiating sepsis from SIRS. Moreover, some researchers have suggested that PCT and CRP are more sensitive biomarkers than sTREM-1 for diagnosis of bacterial infection [32, 33]. In the present study, we found

Aksaray et al., Diagnostic value of sTREM-1 and procalcitonin levels in the early diagnosis of sepsis

that plasma sTREM-1 and PCT values, as well as APACHE II score, were significantly higher in patients with sepsis than in patients with SIRS. There was no significant difference between median CRP value and WBC count of the 2 groups. Additionally, AUROC was 0.78 for sTREM-1, 0.65 for PCT, and 0.71 for APACHE II score. sTREM-1 cut-off value of ≥133 pg/mL yielded higher sensitivity for differentiating patients with SIRS from those with infection.

Although many studies on predictive value of PCT in diagnosis of bacteremia exist, there are only a few studies about using sTREM-1for the same purpose [19–21, 27, 34]. Ruiz-Gonzales et al. [34] suggested that sTREM-1 is useful biomarker in diagnosis of secondary bacteremia due to communityacquired pneumonia. Su et al. [27] recently reported that there were no significant differences in serum sTREM-1 or PCT levels between blood culturepositive and negative groups with ICU-acquired new onset fever. However, we found that initial sTREM1level and APACHE II score were significantly higher in patients with positive blood culture than negative ones (p=0.02, p=0.06, respectively).

Gibot et al. [25] evaluated alterations in serum sTREM-1, PCT, and CRP levels in sepsis, severe sepsis, and septic shock in a medical ICU and reported that sTREM-1 level was significantly lower in the survival group. Su et al. [27] found that within bacteremia group, sTREM-1 and PCT levels were significantly higher in nonsurvivors, and they reported that sTREM-1 and PCT levels were useful for predicting prognosis of bacteremia.

In this study, we found that APACHE II score of the patients was high, and serum plasma levels of CRP and PCT were elevated in second measurement of nonsurviving group. Interestingly, although sTREM-1 level was higher in nonsurvivors than survivors, the difference between the 2 groups was not statistically meaningful.

Main limitations of this study must also be acknowledged. First, number of enrolled patients was relatively small. Second, severe bacterial sepsis patients with negative blood cultures were not investigated in this study.

181

In conclusion, present study demonstrated that measurement of sTREM-1 in plasma may be valuable tool for early distinction between sepsis and SIRS in adult patients in daily practice. Our data also suggest that plasma sTREM-1 at admission is the most useful biomarker for prediction of bacterial culture positivity. Initial high APACHE-II score and elevation of CRP and PCT levels are important parameters to predict outcome of ICU patients with sepsis.

Conflict of Interest: None declared.

Financial Disclosure: The authors declared that this study has received no financial support.

Authorship contributions: Concept – S.A., P.A.,; Design – S.A., P.A.; Supervision – S.A., P.A.; Materials – S.A.; Data collection &/or processing – S.A., P.A., A.Ö.; Analysis and/or interpretation – P.A. ; Literature search – P.A.; Writing – P.A., A.İ., S.C.; Critical review – S.A.

REFERENCES 1. Martin GS, Mannino DM, Eaton S, Moss M. The epidemiology of sepsis in the United States from 1979 through 2000. N Eng J Med 2003;348:1546–54.

2. Davis BH. Improved diagnostic approaches to infection/sepsis detection. Expert Rev Mol Diagn 2005;5:193–207.

4. Di Somma S, Magrini L, Travaglino F, Lalle I, Fiotti N, Cervellin G, et al. Opinion paper on innovative approach of biomarkers for infectious dieseases and sepsis management in the emergency department. Clin Chem Lab Med 2013;51:1167–75.

5. O’Grady NP, Barie PS, Bartlett JG, Bleck T, Carroll K, Kalil AC, et al. Guidelines for evaluation of new fever in critically ill adult patients: 2008 update from the American College of Critical Care Medicine and the Infectious Diseases Society of America.

Crit Care Med 2008;36:1330–49.

6. Harbarth S, Holeckova K, Froidevaux C, Pittet D, Ricou B, Grau GE, et al. Diagnostic value of procalcitonin, interleukin-6, and interleukin-8 in critically ill patients admitted with suspected sepsis. Am J Respir Crit Care Med 2001;164:396–402.

7. Muller B, Becker KL, Schachinger H, Rickenbacher PR, Huber PR, Zimmerli W, et al. Calcitonin precursors are reliable markers of sepsis in a medical intensive care unit. Crit Care Med 2000;28:977–83.

8. Uzzan B, Cohen R, Nicolas P, Cucherat M, Perret GY. Procalcitonin as a diagnostic test for sepsis in critically ill adults and after surgery or trauma: a systematic review and meta-analysis. Crit Care Med 2006;34:1996–2003.

9. Jiyong J, Tiancha H, Wei C, Huahao S. Diagnostic value of the soluble triggering receptor expressed on myeloid cells-1 in bacterial infection: a meta-analysis. Intensive Care Med 2009;35:587–

182 95.

10. Dombrovskiy VY, Martin AA, Sunderram J, Paz HL. Rapid increase in hospitalization and mortality rates for severe sepsis in the United States: a trend analysis from 1993 to 2003. Crit Care Med 2007;35:1244–50.

11. Padkin A, Goldfrad C, Brady AR, Young D, Black N, Rowan K. Epidemiology of severe sepsis occurring in the first 24 hrs in intensive care units in England, Wales, and Northern Ireland. Crit Care Med 2003;31:2332–8.

12. Pavon A, Binquet C, Kara F, Martinet O, Ganster F, Navellou JC, et al. Profile of the risk of death after septic shock in the present era: an epidemiologic study. Crit Care Med 2013;41:2600–9.

13. Yealy DM, Kellum JA, Huang DT, Barnato AE, Weissfeld LA, Pike F, et al. A randomized trial of protocol-based care for early septic shock. N Engl J Med 2014;370:1683–93.

14. Liu V, Escobar GJ, Greene JD, Soule J, Whippy A, Angus DC, et al. Hospital deaths in patients with sepsis from 2 independent cohorts. JAMA 2014;312:90,2.

15. Jiyong J, Tiancha H, Wei C, Huahao S. Diagnostic value of the soluble triggering receptor expressed on myeloid cells-1 in bacterial infection: a meta-analysis. Intensive Care Med 2009;35:587– 95.

16. Wu Y, Wang F, Fan X, Bao R, Bo L, Li J, et al. Accuracy of plasma sTREM-1 for sepsis diagnosis in systemic inflammatory patients: a systemic review and meta-analysis. Critical care 2012;29;16:229.

17. Lee CC, Hong MY, Lee NY, Chen PL, Chang CM, Ko WC. Pitfalls in using serum C-reactive protein to predict bacteremia in febrile adults in the ED. Am J Emerg Med 2012;30:562–9.

18. Clech’h C, Ferriere F, Karoubi P, Fosse JP, Cupa M, Hoang P, et al. Diagnostic and prognostic value of procalcitonin in patients with septic shock. Crit Care Med 2004;32:1166–9.

19. Kim MH, Lim G, Kang SY, Lee WI, Suh JT, Lee HJ. Utility of procalcitonin as an early diagnostic marker of bacteremia in patients with acute fever. Yonsei Med J 2011;52:276–81.

20. Lai CC, Tan CK, Chen SY, Wang CY, Liu WL, Hou CC, et al.

Diagnostic performance of procalcitonin for bacteremia in patients with bacterial infection at the emergency department. J Infect 2010;61:512–5.

21. Jain S, Sinha S, Sharma KS, Samantaray JC, Aggrawal P, Vikram NK, et al. Procalcitonin as a prognostic marker of sepsis: a prospective observational study. BMC Reseach Notes 2014;7:458.

22. Endo S, Aikawa N, Fujishima S, Sekine I, Kogawa K, Yamamoto Y, et al. Usefulness of procalcitonin serum level for the discrimination of severe sepsis from sepsis: a multicenter prospective study. J Infect Chemother 2008;14:244–9.

23. Blijlevens NM, Donnelly JP, Meis JF, De Keizer MH, DePauw

North Clin Istanb BE. Procalcitonin does not discriminate infection from inflammation after allogeneic bone marrow transplantation. Clin Diagn Lab Immunol 2000;7:889–92.

24. Tang BM, Eslick GD, Graig JC, McLean AS. Accuracy of procalcitonin for sepsis diagnosis in critically ill patients: systematic review and meta-analysis. Lancet Infect Dis 2007;7:210–7.

25. Gibot S, Cravoisy A, Kolopp-Sarda MN, Bene MC, Faure G, Bollaert PE, et al. Time course of sTREM (soluble triggering receptor expressed on myeloid cells)-1, procalcitonin, and Creactive protein plasma concentrations during sepsis. Crit Care Med 2005;33:792–6.

26. Rivera-Chavez FA, Minei JP. Soluble triggering receptor expressed on myeloid cells-1 is an early marker of infection in the surgical intensive care unit. Surg Infect (Larchmt) 2009;10:435– 9.

27. Su L, Han B, Liang L, Zhaoxu J, Deng J, Yan P. Value of soluble TREM-1, procalcitonin and C-reactive protein serum levels as biomarkers for detecting bacteremia among sepsis patients with new fever in intensive care units: a prospective cohort study.

BMC Infect Dis 2012;18:12:157.

28. Li L, Zhu Z, Chen J, Ouyang B, Chen M, Guan X. Diagnostic value of soluble triggering receptor expressed on myeloid cells-1 in critically-ill, postoperative patients with suspected sepsis. Am J Med Sci 2013;345:178–84.

29. Palmiere C, Bardy D, Mangin P, Augsburger M. Value of STREM-1, procalcitonin and CRP as laboratory parameters for postmortem diagnosis of sepsis. J Infect 2013;67:545–55.

30. Gibot S, Bene MC, Noel R, Massin F, Guy J, Cravoisy A, et al.

Combination biomarkers to diagnose sepsis in the critically ill patient. Am. J Respir Crit Care Med 2012;186:65–71.

31. Jeong SJ, Song YG, Kim CO, Kim WH, Ku SN, Han HS, et al.

Measurement of plasma sTREM-1 in patients with severe sepsis receiving early goal-directed therapy and evaluation of its usefulness. Shock 2012;37:574–8.

32. Kofoed K, Andersen O, Kronborg G, Tvede M, Petersen J, Eugen-Olsen J, et al. Use of plasma C-reactive protein, procalcitonin, neutrophils, macrophage migration inhibitory factor, soluble urokinase-type plasminogen activator receptor, and soluble triggering receptor expressed on myeloid cells-1 in combination to diagnose infections: a prospective study. Crit Care 2007;11:38.

33. Barati M, Bashar FR, Shahrami R, Zadeh MH, Taher MT, Nojomi M. Soluble triggering receptor expressed on myeloid cells 1 and the diagnosis of sepsis. J Crit Care 2010;25:362–6.

34. Ruiz-Gonzalez A, Esquerda A, Falguera M, Abdulghani N, Cabezas P, Bielsa S, et al. Triggering receptor (TREM-1) expressed on myeloid cells predicts bacteremia better than clinical variables in community-acquired pneumonia. Respirology 2011;16:321– 5.

Orıgınal Article

GASTROENTEROLOGY

North Clin Istanb 2016;3(3):183–86 doi: 10.14744/nci.2016.35582

Crohn’s disease in the elderly: Clinical presentation and manifestations from a tertiary referral center in Turkey Fatih Saygili,1 Saba Mukaddes Saygili,2 Ilyas Tenlik,1 Mahmut Yuksel,1 Zeki Mesut Yalin Kilic,1 Yasemin Ozderin Ozin,1 Ertugrul Kayacetin1 Department of Gastroenterology, Turkiye Yuksek Ihtisas Training and Research Hospital, Ankara, Turkey

1

Department of Reanimation and Intensive Care, Ankara University Faculty of Medicine, Ankara, Turkey

2

ABSTRACT OBJECTIVE: There is no precise consensus at present on age to define elderly patients with inflammatory bowel disease (IBD), but recently, age of more than 60 years has been widely accepted. Characteristics of IBD in the elderly are somewhat different from what is seen in younger patients. The elderly have milder disease activity, and therapeutic options are fewer because of their age and features such as comorbidities, drug interactions, and loss of organ function. There are few reports on Crohn’s disease in the elderly. Herein, first report on this topic with respect to population of this country is presented.

METHODS: Characteristics of 95 patients with Crohn’s disease, who were over age 60 from 3125 patients with IBD treated in our clinic between 1996 and 2015 were analyzed. Research was performed using patient files, and outpatient clinic visits, when possible.

RESULTS: Median age of the group was 66 years, and male:female ratio was 1.6. Of the total, 48.4% of the patients had colonic disease, 37.9% had ileocolonic disease, and 13.7% had small bowel disease. Data indicated that 23.1% of patients had undergone surgical procedures, which were primarily right hemicolectomy and ileotransversostomy.

Disease was most often managed with mesalazine or azathioprine. It was also determined that 12.6% patients had 2 or more comorbidities, and findings indicated coronary heart disease and hypertension were most prevalent.

CONCLUSION: Analysis revealed similar features in characteristics of disease compared with recent knowledge reported in the literature. This is the first report from our country to describe Crohn’s disease in the elderly population, and the number of patients is sufficient to provide general information about this group.

Keywords: Crohn’s disease, clinical features; elderly.

C

rohn’s disease is largely considered to be a disease of early adulthood; however, incidence shows another peak at approximately 70 years of

age [1]. Elderly onset or presentation of disease demonstrates differences in terms of clinical presentation, diagnosis, clinical course, and complications

Received: October 10, 2016 Accepted: December 19, 2016 Online: January 23, 2017 Correspondence: Dr. Fatih SAYGILI. Turkiye Yuksek Ihtisas Egitim ve Arastirma Hastanesi, Gastroenteroloji Klinigi, Sihhiye, Ankara, Turkey.

Tel: +90 312 - 306 10 00 e-mail: fsaygili2014@gmail.com © Copyright 2016 by Istanbul Northern Anatolian Association of Public Hospitals - Available online at www.kuzeyklinikleri.com

184

of both the disease and treatment when compared with early onset disease [2]. These differences have been reported in studies of European and American population in a few publications, but there is currently no data from our country about clinical course among the elderly [3]. Turkiye Yuksek Ihtisas Education and Research Hospital has an individual IBD outpatient clinic and is a tertiary referral center for Turkey. This report is retrospective analysis of data of 95 patients with Crohn’s disease who were over age of 60 years of age. Analysis was performed to establish definitive data that would reflect clinical features and course of the patients, and local results obtained were compared with literature data to investigate any possible local differences.

MATERIALS AND METHODS Records of 3125 patients with diagnosis of IBD who were treated in our clinic between 1995 and 2016 were screened, and data of 95 patients with Crohn’s disease who were older than 60 years of age were analyzed. All of the patients had diagnosis of Crohn’s disease after the age of 60, according to the files retrieved from the clinic. Date of diagnosis, treatment schedule, and clinical course and follow up were analyzed using special handwritten file system and electronic medical information system of the clinic. Observed and demographic features of the patients were reported as definitive data, and as there was no applicable comparison, statistical difference was not calculated. These definitive data describing clinical course and features of the patients were obtained to provide local report on elderly patients with Crohn’s disease.

RESULTS Median age of 95 patients was 66 years, and male:female ratio was 1.6:1. Demographic characteristics are summarized in Table 1. Colonic involvement was most prevalent in terms of localization, with incidence of 48.4%. Ileocolonic disease was present in 37.9%, and small intestinal involvement was observed in 13.7%. None of the patients had perianal disease or fistula. Mean follow-up time

North Clin Istanb

was 38 months (range: 14–62 months).

When treatment modalities were considered, preferred medications reflected relatively milder clinical course: 89.5% of the patients were using oral mesalazine, and azathioprine use was 56.8%. Only 2 patients (2.1%) were treated with adalimumab, as they were observed to have relapsing disease at site of ileotransversostomy following right hemicolectomy. None of the patients reported any serious adverse effects due to their medications. Surgical therapy was observed to be necessary in 23.1% of the patients, and all cases were ileotransversostomy following right hemicolectomy due to severe ileocaecal involvement and fibrotic narrowing.

More than 2 comorbidities were observed in 12.6% patients. Hypertension and coronary heart disease were most common; however, these comorbidities did not affect treatment of Crohn’s disease.

There were no patient deaths in the group during the study period.

DISCUSSION Definition of IBD in the elderly is widely accepted as patients older than 60 years who have IBD. Patients diagnosed after age of 60 as well as previously diagnosed patients who have reached or exceeded this age have increasing importance in terms of clinical follow-up and treatment strategies. Incidence of IBD in the elderly was reported to be between 4 and 8/100000 in an American and European population study [4]. Clinical features tend to be different in elderly patients compared with young adults. Most common features in the young, such as diarrhea, abdominal pain, and anemia, tend to be less frequent, whereas loss of weight, bleeding, fever, and paradoxically, constipation are more common symptoms in the elderly with Crohn’s disease [5]. Elderly onset of the disease has milder activity with more stable clinical course. For example, stricturing and fistulating disease with ileocolonic involvement is comparably less frequent than in young individuals [6]. However, despite milder disease activity, comorbidities, drug interactions, and increasing organ dysfunction can be problematic and management of the patients and treatment strategies can still be challenging.

Saygili et al., Crohn’s disease in the elderly

185

Table 1. Demographic and clinical features of the patients

Elderly population (n=95) n

%

Remaining Crohn’s patients (n=1092) n

%

Age (years) 60–82 (median: 66) 18–60 Gender Male/Female 59/36 536/461 Localization (Montreal classification) L1 13 13.7 390 35.7 L2 46 48.4 242 22.2 L3 36 37.9 460 42.2 Behavior (Vienna classification) B1 91 95.8 580 53.1 B2 4 4.2 239 21.9 B3 none 93 8.5 Perianal disease none 198 18.1 Treatment 5-Aminosalicylate 82 89.5 929 85.1 Azathioprine 54 56.8 707 64.7 Biologic 2 2.1 282 25.8 Surgery 22 23.1 309 28.3 Diabetes 13 13.7 78 7.1 Coronary heart disease 21 22.1 53 4.9 Hypertension 36 37.9 156 14.3 Pulmonary disease 8 8.4 35 3.2

We aimed to investigate clinical features and follow-up of patients with Crohn’s disease who were older than 60 years of age. This is the first report to examine this topic in Turkey.

Our local clinical findings, such as involvement, clinical presentation, and treatment choices were similar to results previously reported in the literature.

It is easily observed that Crohn’s disease behaves a little differently in the elderly compared with younger individuals. Natural course of the disease is different, apart from additional clinical characteristics of an elderly patient. Principal difference is localization of the disease, which is more prominent in colonic region. In our population, this was comparably different from younger individuals in our database. This is also reported in the literature.

In a study from Hungary conducted by Lakatos et

al., incidence of Crohn’s disease in the elderly was 4/100000 annually. Colonic involvement was reported to be most common, and clinical course did not demonstrate difference according to Montreal classification system [7]. Absence of perianal disease and strictures are the other main diversions from what is typically seen in younger population. These facts are directly responsible for disease severity, and absence of these behavioral aspects can be beneficial side of Crohn’s disease in the elderly. On the other hand, presence of comorbidities can make treatment of this population challenging. As the clinical disease activity is milder, with very low rate of perianal disease, fistulation, or severe strictures, and with colonic involvement more common, need for use of biologics is less frequent in this group of patients [8]. Present study results regarding biologic use

186

can be largely explained by this fact. This can lead to fewer drug interactions and relatively lower risk of adverse drug effects [9]. Furthermore, due to this milder clinical course and the character of involvement, need for surgical treatment is comparably less frequent when compared with young individuals.

This can be an advantage when higher morbidity and mortality rates are considered with regard to surgical intervention in an elderly patient [10].

This is first report of clinical aspects of a relatively large group of elderly patients with Crohn’s disease in our country. Definitive features, such as nature of involvement, clinical presentation, disease activity, and clinical course demonstrate differences compared with what is observed in younger patients with Crohn’s disease. Due to increased comorbidities, organ dysfunction, and possible drug interactions among the elderly, this group of patients should be considered separately and treatment strategies should be tailored according to both disease and host characteristics. As a result of emerging therapies, growing number of elderly patients with IBD can be expected in the future and more studies to define particular features are needed to clearly establish widely accepted management strategies.

Conflict of Interest: None declared.

Financial Disclosure: The authors declared that this study has received no financial support.

Authorship contributions: Concept – F.S., İ.T.; Design – F.S., İ.T.; Supervision – F.S., İ.T.; Materials – ; Data collec-

North Clin Istanb tion &/or processing – İ.T., M.Y.; Analysis and/or interpretation – S.M.S., İ.T.; Literature search – F.S.; Writing – F.S., S.M.S., Y.Ö.Ö., Z.M.Y.K.; Critical review – F.S., Y.Ö.Ö., Z.M.Y.K., E.K.

REFERENCES 1. Chir AI, Carlomagno N, Grifasi C, Dumani X, Conte D. Lo, Renda A. Clinical management of Crohn’s. Disease 2012. p. 1–6.

2. Gisbert JP, Chaparro M. Systematic review with meta-analysis: inflammatory bowel disease in the elderly. Alimentary Pharmacology & Therapeutics 2014;39:459–77.

3. Hussain SW, Pardi DS. Inflammatory bowel disease in the elderly. Drugs Aging 2010;27:617–24.

4. Ha C, Katz S. Management of inflammatory bowel disease in the elderly: do biologicals offer a better alternative? Drugs Aging 2013;30:871–6.

5. Katz S, Feldstein R. Inflammatory bowel disease of the elderly: a wake-up call. Gastroenterol Hepatol (N Y) 2008;4:337–47.

6. Charpentier C, Salleron J, Savoye G, Fumery M, Merle V, Laberenne JE, et al. Natural history of elderly-onset inflammatory bowel disease: a population-based cohort study. Gut 2014;63:423–32.

7. Lakatos PL, David G, Pandur T, Erdelyi Z, Mester G, Balogh M, et al. IBD in the elderly population: results from a populationbased study in Western Hungary, 1977-2008. J Crohns Colitis 2011;5:5–13.

8. Van Assche G, Dignass A, Panes J, Beaugerie L, Karagiannis J, Allez M, et al. The second European evidence-based Consensus on the diagnosis and management of Crohn’s disease: Definitions and diagnosis. J Crohns Colitis 2010;4:7–27.

9. Heresbach D, Alexandre JL, Bretagne JF, Cruchant E, Dabadie A, Dartois-Hoguin M, et al. Crohn’s disease in the over-60 age group: a population based study. Eur J Gastroenterol Hepatol 2004;16:657–64.

10. Picco MF, Cangemi JR. Inflammatory bowel disease in the elderly. Gastroenterol Clin North Am 2009;38:447–62.

Orıgınal Article

NURSING

North Clin Istanb 2016;3(3):187–93 doi: 10.14744/nci.2016.42650

The Turkish adaptation of scale to measure patient perceptions of the quality of nursing care and related hospital services: A validity and reliability study Besey Oren,1 Neriman Zengin,2 Nebahat Yildiz3 Department of Midwifery, University of Health Sciences Faculty of Health Sciences, Istanbul, Turkey

1

Department of Midwifery, Istanbul University Faculty of Health Sciences, Istanbul, Turkey

2

Istanbul University Istanbul Faculty of Medicine Hospital, Istanbul, Turkey

3

ABSTRACT OBJECTIVE: This study aimed to test the validity and reliability of a version of the tool developed in Sri Lanka in 2011 to assess patient perceptions of the quality of nursing care and related hospital services created for use with Turkish patients.

METHODS: This methodological study was conducted between November 2013 and November 2014 after obtaining ethical approval and organizational permission. Data was collected during discharge from 180 adult patients who were hospitalized for at least 3 days at a medical school hospital located in Istanbul. After language validation, validity and reliability analyses of the scale were conducted. Content validity, content validity index (CVI), construct validity, and exploratory factor analysis were assessed and examined, and reliability was tested using the Cronbach’s alpha coefficient and item-total correlations.

RESULTS: Mean CVI was found to be 0.95, which is above expected value. Exploratory factor analysis revealed 4 factors with eigenvalues above 1, which explained 82.4% of total variance in the Turkish version of the tool to measure patient perceptions of nursing care and other hospital services. Factor loading for each item was ≥.40.

Cronbach’s alpha coefficient of sub-dimensions and total scale were found to be 0.84-0.98 and 0.98, respectively.

Item-total correlations ranged from 0.56 to 0.83 for the entire group, which was above expected values.

CONCLUSION: The Turkish version of the scale to assess patient perceptions of the quality of nursing care and related hospital services, which comprised 4 sub-dimensions and 36 items, was found to be valid and reliable for use with the Turkish population.

Keywords: Nursing care; nursing services; reliability and validity.

Received: November 02, 2016 Accepted: November 07, 2016 Online: January 25, 2017 Correspondence: Dr. Besey OREN. Saglik Bilimleri Universitesi Saglik Bilimleri Fakultesi, Ebelik Bolumu, Selimiye Mahallesi, Tibbiye Caddesi, No: 38, 34668 Uskudar, Istanbul, Turkey.

Tel: +90 216 - 346 36 38 e-mail: besey_oren@yahoo.com © Copyright 2016 by Istanbul Northern Anatolian Association of Public Hospitals - Available online at www.kuzeyklinikleri.com

188

T

he position and importance of the service sector in national economies is rapidly increasing all over the world; therefore, in recent years, the quality of service provided has become a crucial issue. Service has been defined as “benefits purchased by the consumer unrelated to ownership” [1]. Perceived quality of service is an outcome of consumers’ expectations of the service and perceptions about performance of the service during its delivery [2].

The main objective of healthcare sector is to provide various healthcare services needed by the community with quality and at the time desired by the patient at lowest possible cost. Patients, who constitute the largest group of external consumers, do not ordinarily have the means to evaluate technical quality of services provided. Therefore, importance of functional quality, i.e., how services are delivered, has grown. One of the keys for health organizations to achieve long-term success is to measure and evaluate perceptions of the patients about service quality, in addition to examining technical quality [3].

Measurement and assessment of perceived quality of service in healthcare organizations, and decreased hospital expenditures as result of effective utilization of very limited hospital resources will provide a competitive advantage. In today’s competitive health services market, evaluation of service quality and meeting or exceeding patient expectations is a necessity [4].

Nursing care and related hospital services constitute majority of healthcare services. Courtesy, affection, sympathy, and understanding demonstrated by nurses, and their professional attitude and manner of employing their knowledge and skills play an important role in patient-nurse rapport [5].

However, nursing care has often been largely associated with supportive services, such as hospital hygiene, climate control, lighting, number and quality of beds, providing directions inside and outside the facility, and quality of meals [6]. A multicenter study performed in medical-surgical units of 146 hospitals in the USA revealed that the patients’ satisfaction with nursing care was closely related to support services because availability of support services enabled nurses to give more time to patients’ healthcare. Nurses cannot offer optimal healthcare

North Clin Istanb

to their patients when services providing for such things as protection of patient privacy and comfort are restricted [7]. In a study performed in Turkey, it was reported that patient satisfaction was affected by many factors, including diet and related care, atmosphere and cleanliness of the room, admission process, and availability of facilities such as cafeteria and parking area [8].

Several valid scales have been developed to evaluate quality of hospital services and to measure degree of satisfaction with nursing services. SERVQUAL scale is 22-item questionnaire developed to evaluate consumer perceptions about commercial services [9]. Gonzales et al. used SERVQUAL scale and adapted it to determine patient perception of nursing care [10]. Patient Perception of Hospital Experience with Nursing (PPHEN) is another scale used in the field of nursing care [11]. In Canada, patient-centered Patient Satisfaction with Nursing Care Quality Questionnaire (PSNCQQ) scale was developed [12]. In addition, Patient’s Assessment of Quality Scale-Acute Care Version (PAQS-ACV) scale was recently created in the USA and focuses on individualized care, personal characteristics of nurses, and environment [13]. A scale to evaluate healthcare services in Turkey was created in 2001.

This scale has 7 factors (nutritional care, healthcare provided by physicians, nursing care, room atmosphere, admission procedures, room cleanliness, and other facilities, such as cafeteria and parking area), and it can be used to measure patient satisfaction and quality of healthcare services [14].

Most scales have focused on nursing services and related patient satisfaction, and generally they have not considered hospital services other than nursing care. However, many studies have demonstrated that satisfaction with nursing care also affected other related services [8, 13, 14].

A specific, validated, and reliable scale directly related to nursing care and related hospital services that also measures patient perceptions about these issues has not yet been created. Therefore, with the opinion that such a scale developed in Sri Lanka would also be suitable for the Turkish population, it was adapted for that purpose and tested with respect to its validity and reliability.

Oren et al., The Turkish adaptation of scale to measure patient perceptions

MATERIALS AND METHODS Objective: This methodological and descriptive investigation was performed to test validity and reliability of a Turkish adaptation of an instrument to measure patient perception of quality of nursing care and related hospital services developed in Sri Lanka.

Time and place of the investigation: The investigation was performed in the Department of Surgery and Department of Internal Medicine of Istanbul University Faculty of Medicine Hospital between November 2013 and November 2014.

Study population and sample: Study population consisted of all adult patients hospitalized in the Department of Internal Medicine and Department of Surgery of Istanbul University Faculty of Medicine Hospital between November 2013 and November 2014. Sample consisted of 200 literate patients without any mental or psychological problems who were hospitalized for at least 3 days in medical or surgical units who volunteered to participate. Twenty patients who did not complete questionnaire due to time constraints at discharge were excluded, and the study was completed with 180 patients. In evaluation of scale, rule stipulating that size of sample should be at least 5 times greater than the number of variables was strictly observed [15].

Data collection tools Data of the investigation were collected using patient information form and 36-item questionnaire to evaluate patient perception of the quality of nursing care and related hospital services.

Patient information form: Form consisted of 12 questions related to the unit of hospitalization, gender, age, marital status, educational level, profession, place of residence (i.e., metropolitan city or rural area), employment status, income level, previous hospital admissions (if any), and patient description of their illness.

Patient perception of the quality of nursing care and related hospital services scale: The original scale was created at National Hospital of Sri Lanka, the country’s foremost training and research hospital, with patients being discharged after hospitalization

189

for between 3 and 90 days in the medical and surgical units. Scale comprises 36 items and 8 factors. All items are affirmative expressions that were rated with 5-point Likert-type scale as follows: 1. I am not satisfied at all /I don’t agree at all, 2. I am not satisfied/I don’t agree, 3. I am satisfied/ I agree, 4. I am not sure, 5. I am absolutely satisfied /I certainly agree. Factor 1 was related to “interpersonal care,” and concerned the way nurses personally interacted with the patient, asking about such things as communicating respect, courtesy, and concern. Factor 2 was “efficiency,” and included items regarding competence of nurses and their actions to fulfill health needs without delay.

Factor 3 asked patients about “comfort,” and included items about quality of privacy and sleep. Factor 4 was “hygiene,” and was related to adequacy and cleanliness of restrooms. Factor 5 asked patients “individual information” about hospital facilities and illness, Factor 6 queried them about perception of “physical environment,” including such items as climate control and cafeterias, and Factor 7 was related to “basic instructions,” such as hospital signage. Factor 8 was titled “competency,” and asked patients questions related to knowledge and skills of the nurses.

Application of data collection tools: Data were collected by charge nurses in the clinics during faceto-face interviews. After discharge procedures were completed, a suitable environment was located, the study was explained, and questionnaire was given to patients who volunteered to participate. Twenty patients who had time constraints at discharge and did not complete the forms were excluded from the study.

Evaluation of data: Statistical analysis of data was performed with SPSS software, version 15.0 (IBM Corp., Armonk, NY, USA). Validity and reliability studies were completed in 2 stages.

Stage 1. Two specialists whose native language is English translated the patient perception of the quality of nursing care and related hospital services scale into Turkish. Then, opinions of 10 Turkish language specialists were requested regarding style of expression used in Turkish to test language validity. In line with their views, some expressions used in the questionnaire were altered for better comprehension.

Next, a translator and interpreter who had perfect command of both languages back-translated the scale

190

from Turkish into English. An independent specialist evaluated the translations, and a joint text was created. The final version was sent to Upul Senarath, the corresponding author of the original study. Since he had no additional corrections, questionnaire was used in this final form.

Stage 2. Psychometric characteristics of the questionnaire were analyzed. Validity and reliability studies were performed. During the validation process, validity of expressions used was tested using content validity index (CVI). Construct validity was performed using explanatory factor analysis. In reliability study, for internal consistency of the scale and subdimensions, Cronbach’s alpha coefficient was used, and for item-total score analysis, Pearson correlation analysis was performed.

Ethical aspect of the investigation: Written permission was obtained from Upul Senarath via e-mail for the validity, and reliability studies of Turkish version of patient perception of the quality of nursing care and related hospital services scale. Approval for the study itself was obtained from the ethics committee of the Istanbul University Faculty of Medicine, and the principles of the Helsinki Declaration of Human Rights were observed.

RESULTS Mean age of the patients of the research group was 49.66±19 years. More than half of participants were male (61.3%) and married (77.7%). Some (22.8%) were secondary school or lycée graduates. More than half (69.4%) were not working at the time, and 54.4% of study participants lived in metropolitan city. Most (83.9%) described themselves as being in middle income group. Majority (63.3%) of the patients had been hospitalized before, and had mean hospital stay of 16.705±24 days.

Results of validity and reliability studies The final version of the scale was administered to 78 medical and 192 surgical treatment patients. Based on results retrieved, high level of positive correlation was found between Turkish version and original English-language scale (r=.90; p<.001). Once equivalency of Turkish and English versions of the scale

North Clin Istanb

Table 1. Results of Kaiser-Meyer-Olkin and Bartlett tests

Kaiser-Meyer-Olkin 0.938 Bartlett’s Test of Sphericity Chi-square 9744.763

SD 630

p 0.000 SD: Standard deviation.

was established, validity and reliability studies were conducted.

Validity study Content validity and construct validity of the scale were analyzed. CVI of 0.95 was determined, demonstrating very good content validity.

To assess construct validity, suitability of data for factor analysis was evaluated using Kaiser-MeyerOlkin and Bartlett tests, and suitability of data for factor analysis was confirmed (Table 1).

Principal component analysis: As a result of explanatory factor analysis using Varimax rotation with Kaiser normalization, 4 factors with eigenvalue over 1 were detected, which explained 82.40% of total variance. Factor loading for each expression was ≥40. Therefore, 8 factors in the original scale were consolidated into 4 factors: Factor 1 contained items related to nursing care and its applications; Factor 2 was related to efficiency, competency, personal information, and quality of general instructions; Factor 3 was concerned with number, quality, and hygiene of restrooms; and Factor 4 was related to quality and hygiene of beds and bed coverings.

Reliability study Cronbach’s alpha internal consistency coefficient and item-total score correlation were used to determine reliability level of the scale. Item-total correlation of each of 36 items was examined using Pearson correlation analysis. Correlation reliability coefficient was between r=0.57 and r=0.86, which indicated a strong, positive relationship that was statistically significant (p<0.001; Table 2). Further analysis of the

Oren et al., The Turkish adaptation of scale to measure patient perceptions

191

Table 2. Factor composition of the Turkish version of the scale, item-total correlation, and Cronbachâ&#x20AC;&#x2122;s alpha values (n=180)

Factor 1 Item-total Factor 2 Item-total Factor 3 Item-total Factor 4 Item-total Total scale point point point point item-total

correlation correlation correlation correlation correlation Item 1 .809 .87 .77 Item 2 .837 .90 .77 Item 3 .865 .91 .76 Item 4 .842 .88 .81 Item 5 .849 .89 .81 Item 6 .842 .88 .81 Item 7 .845 .88 .76 Item 8 .901 .95 .80 Item 9 .896 .94 .78 Item 10 .882 .93 .76 Item 11 .848 .89 .81 Item 12 .856 .91 .79 Item 13 .831 .88 .80 Item 14 .818 .87 .83 Item 15 .872 .93 .84 Item 16 .744 .83 .83 Item 17 .776 .86 .78 Item 18 .773 .87 .61 Item 19 .791 .88 .62 Item 20 .787 .88 .57 Item 21 .560 .75 .57 Item 22 .453 0.73 .61 Item 23 .460 0.73 .79 Item 24 .848 .82 .83 Item 25 .873 .86 .72 Item 26 .855 .86 .74 Item 27 .693 .82 .83 Item 28 .809 .89 .82 Item 29 .745 .78 .81 Item 30 .748 .80 .81 Item 31 .795 .88 .86 Item 32 .778 .87 .83 Item 33 .802 .88 .77 Item 34 .807 .87 .77 Item 35 .776 .89 .76 Item 36 .792 .88 .81 Cronbachâ&#x20AC;&#x2122;s alfa 0.98 0.97 0.92 0.84 0.98 Eingenvalue 22.51 4.33 1.80 1.01 Variance 64.54 12.04 5.04 2.81 Total variance 82.40 Extraction method: Principal component analysis; Rotation method: Varimax with Kaiser normalization. Rotation converged in 6 iterations. Pearson correlation; p<0.001.

192

items revealed that Cronbach’s alpha reliability coefficient for each factor was determined to be 0.98, 0.97, 0.92, and 0.84, respectively. While total Cronbach’s alpha reliability coefficient of the current scale was calculated to be 0.98. Cronbach’s alpha reliability coefficient of the scale developed by Senarath et al.

(2011) was reported to be 0.91 [6].

DISCUSSION During the process of adapting the scale, validity and reliability studies were performed to analyze psychometric characteristics [16]. Validity is defined as accurate measurement of required characteristics with the aid of measurement tools developed without interference from other characteristic features. Reliability is the capability of a test or any measurement tool to yield sensitive, compatible, consistent, and stable results [17].

Language equivalence study was extremely important for successful revision of the scale. Analysis of correlation between scores of English and Turkish versions of the relevant scale revealed high level of consistency (r=.90; p<.001). This result is significant in that it shows effective, high quality translation of the scale into Turkish [18]. The objective of content/scope validation is to request an expert group to determine if items contained in the assessment tool fully represent the domain to be measured in order to form an integrity [16]. Result of CVI test performed to evaluate content validity of the scale found no significant difference among expert opinions. It was concluded that the expressions used were compatible with Turkish culture and sufficiently represented all facets of the construct.

When using Likert-type scale, reliability coefficient should be as close to 1 as possible. In the literature, item-total item correlation scores above 0.25, and Cronbach’s alpha reliability values greater than 0.5 have been specified as expected limits for internal consistency of scales [19, 20].

As a result of explanatory factor analysis, 4 factors had eigenvalues above 1, which explained 82.40% of the variance, and factor loading of 36 items listed under these factors was above. 40; therefore, none of the items were excluded. Detection of high inter-

North Clin Istanb

nal consistency coefficient indicates adequate level of agreement between items used on the scale. If level of reliability for measurement tools to be used in investigations is. 70 [21], then reliability level of all sub-dimensions of the scale can be deemed to be adequate. In the interpretation of item-total correlation, if we consider that items with correlation coefficient of ≥.30 identify individuals much better on the characteristic feature measured [18], then itemtotal correlations appear to be adequate. Results obtained from validity and reliability tests demonstrated that Turkish version of the scale developed in this study is a valid and reliable measurement tool.

In conclusion, scale with validity and reliability in terms of content pertaining to nursing and related hospital services provided in Turkey was developed.

As it was designed for use with Turkish population, it may be more applicable in Turkey than other available measurement tools. In further studies to be performed, comparison of this scale with similar scales may be analyzed. Additional studies should also include patients from other types of hospitals to expand validity and reliability of the tool and add to its utility.

Conflict of Interest: None declared.

Financial Disclosure: The authors declared that this study has received no financial support.

Authorship contributions: Concept – B.Ö., N.Z., N.Y.; Design – B.Ö., N.Z., N.Y.; Supervision – B.Ö., N.Z., N.Y.; Materials – N.Y.; Data collection &/or processing – N.Y.; Analysis and/or interpretation – B.Ö., N.Z.; Literature search – N.Y.; Writing – B.Ö., N.Z.; Critical review – B.Ö., N.Z.

REFERENCES 1. Mucuk İ. Pazarlama ilkeleri. 6. baskı. İstanbul: DER Yayınları; 1994.

2. Parasuraman A, Zeithaml VA, Berry LL. Reassesment of expectations as a comparison standard in measuring service quality: implications for further research. J Mark January 1994;56:111– 24.

3. Asubonteng P, McCleary KJ, Swan JE. SERVQUAL Revisited: a critical review of service quality. JSM 1996;10:62–81.

4. Devebakan N, Aksaraylı M. Sağlık işletmelerinde algılanan hizmet kalitesinin ölçümünde SERVQUAL skorlarının kullanımı ve Özel Altınordu Hastanesi Uygulaması. Dokuz Eylül Üniversitesi Sosyal Bilimler Enstitüsü Dergisi 2003;5:38–54.

Oren et al., The Turkish adaptation of scale to measure patient perceptions

5. Yılmaz M. Sağlık bakım kalitesinin bir ölçütü: Hasta memnuniyeti. CNJ 2001;5:69–74.

6. Senarath U, Nalika SG. Development of an ınstrument to measure patient perception of the quality of nursing care and related hospital services at the national hospital of Sri Lanka. Asian Nurs Res June 2011;5:71–80.

7. Bacon CT, Mark B. Organizational effects on patient satisfaction in hospital medical-surgical units. J Nurs Adm 2009;39:220–7.

8. Yildiz Z, Erdoğmus S. Measuring patient satisfaction of the quality of health care: a study of hospitals in Turkey. J Med Syst 2004;28:581–9.

9. Parasuraman A, Zeithaml V, Berry L. A conceptual model of service quality and its implications for future research. J Mark 1988;49:41–9.

10. Gonzalez-Valentin A, Padin-Lopez S, de Ramon- Garrido E. Patient satisfaction with nursing care in a regional university hospital in southern Spain. J Nurs Care Qual 2005;20:63–72.

11. Dozier AM, Kitzman HJ, Ingersoll GL, Holmberg S, Schultz AW. Development of an instrument to measure patient perception of the quality of nursing care. Res Nurs Health 2001;24:506–17.

12. Sandin Bojo AKF, Hall-Lord ML, Axelsson O, Uden G, Wilde Larsson B. Midwifery care: development of an instrument to measure quality based on the World Health Organization’s classification of care in normal birth. J Clin Nurs 2004;13:75–83.

193

13. Lynn M, McMillen B, Sidani S. Understanding and measuring patients’ assessment of the quality of nursing care. Nursing Research 2007;56:159–66.

14. Uzun O. Patient satisfaction with nursing care at a university hospital in Turkey. J Nurs Care Qual 2001;16:24–33.

15. Erkuş A. Psikolojide Ölçme ve Ölçek Geliştirme I: Temel kavramlar ve işlemler. Ankara: Pegem Akademi; 2012.

16. Aksayan S, Gözüm S. Kültürlerarası ölçek uyarlaması için rehber I: Ölçek uyarlama araştırmaları ve dil uyarlaması. HEMARG 2002;4:9–14.

17. Karasar N. Ölçme ve araçlarında aranan nitelikler. Bilimsel araştırma yöntemi. 19. basım. Ankara: Nobel Yayın Dağıtım; 2009.

18. Şencan H. Güvenirlik Analiz Yöntemleri. Sosyal ve davranışsal ölçümlerde güvenilirlik ve geçerlilik. 1. baskı. Ankara: Seçkin Yayıncılık; 2005.

19. Süt N. Geçerlilik, güvenirlik ve madde (Item) analizleri. Şenocak MŞ, editör. Klinik biyoistatistik. 1. baskı. İstanbul: Nobel Matbaacılık; 2009.

20. Gözüm S, Aksayan S. Kültürlerarası ölçek için rehber II: Psikometrik özellikler ve kültürler arası karşılaştırma. HEMARG 2003;4:9–20.

21. Tezbaşaran AA. Likert tipi ölçek geliştirme kılavuzu. Ankara: Türk Psikologlar Derneği Yayınları; 1996.

Orıgınal Article

THORACIC SURGERY

North Clin Istanb 2016;3(3):194–200 doi: 10.14744/nci.2016.60352

The effect of myasthenia gravis as a prognostic factor in thymoma treatment Bulent Aydemir Dr. Siyami Ersek Thoracic and Cardiovascular Surgery Training and Research Hospital, Istanbul, Turkey

ABSTRACT OBJECTIVE: Thymoma is a standard epithelial tumor. Though it is rare, it constitutes 50% of anterior mediastinal masses. Variety of immunological diseases may accompany thymoma; however, myasthenia gravis (MG) is the most frequently associated paraneoplastic syndrome. Most effective treatment for thymoma is complete surgical resection. In this study, impact of MG on prognosis of thymoma cases was examined.

METHODS: Records of 61 patients who underwent surgery with diagnosis of thymoma between January 2003 and September 2016 were retrospectively reviewed. All cases were analyzed for data related to age, gender, complaint, localization of lesion, surgical procedure, histopathological diagnosis, stage, MG, and long-term follow-up results.

RESULTS: Total of 58 cases were included in the study. Of those, 37 patients were male and 21 were female.

Mean age was 48 years. While 24 cases of thymoma were accompanied by MG, 34 cases were not. Duration of follow-up ranged from 1 month to 155 months.

CONCLUSION: It was found that in group with MG, 5-year survival rate was 87.5% while it was 82.4% in group without MG. Despite longer duration of survival in group of thymoma associated with MG, there was no significant statistical difference between groups (p=0.311).

Keywords: Myasthenia gravis; thymectomy; thymoma.

T

hymoma is a standard epithelial tumor. Although it is rare, it constitutes 50% of anterior mediastinal tumors [1]. Its annual incidence is 0.5/100.000 [2]. Thymoma may be seen at any age. It has observed in patients aged 8 months to 90 years; however, average age at onset is 53 years [3].

Most patients are aged between 40 and 60 years at diagnosis, and no gender difference has been noted in frequency of the disease [2]. Ninety-five percent

of thymomas are found at anterior mediastinum [4].

At present, etiological factors of thymoma are not known. Thymoma typically grows slowly, and may show local invasion. Metastasis is generally seen on pleura pericardium or diaphragm; extrathoracic metastasis is rarely seen [5]. Even after complete resection, thymoma demonstrates tendency to local recurrence [6].

One-third of thymoma cases do not manifest any

Received: December 14, 2016 Accepted: December 20, 2016 Online: January 25, 2017 Correspondence: Dr. Bulent AYDEMIR. Dr. Siyami Ersek Gogus Kalp ve Damar Cerrahisi Egitim ve Arastirma Hastanesi, Tibbiye Caddesi, No: 13, 34668 Uskudar, Istanbul, Turkey.

Tel: +90 216 - 542 44 44 e-mail: draydemirb@gmail.com © Copyright 2016 by Istanbul Northern Anatolian Association of Public Hospitals - Available online at www.kuzeyklinikleri.com

Aydemir, The effect of myasthenia gravis as a prognostic factor in thymoma treatment

195

Table 1. World Health Organization histopathological classification of thymomas Type Type Type Type Type

Type

A AB B1 B2 B3 C

Oval or spindle cell thymoma demonstrating little nuclear atypia associated with or without a few lymphocytes Thymoma rich in lymphocytes and with characteristic features of Types A and B Thymoma containing numerous lymphocytes and patchy areas of medulla with normal thymic activity Thymoma containing numerous lymphocytes, marked or lack of medullary differentiation foci Thymoma containing round or polygonal epithelial cells that exhibit no or mild atypia and minor component of lymphocytes A definite cytologic atypia and a set of histologic features no longer specific to the thymus (thymic carcinoma)

Table 2. Masaoka staging system Stage Stage Stage Stage Stage Stage

I IIA IIB III IVA IVB

Encapsulated tumor without microscopic or macroscopic capsular invasion Microscopic capsular invasion Macroscopic invasion of mediastinal fatty tissue and/or mediastinal pleura Macroscopic invasion of neighboring organ (pericardium, major vessels and/or lungs) Pleural and/or pericardial spread Lymphogenous and/or hematogenous metastasis

clinical symptoms. Clinical symptoms develop due to compression, expulsion, or infiltration of adjacent organs as result of growing tumor. Symptoms such as pain, coughing, hoarseness, shortness of breath, vena cava superior syndrome, and weight loss may occur, depending on location of the tumor [4].

Treatment of thymoma varies according to factors such as clinical appearance, presence of encapsulation, and invasion of surrounding tissues [7]. Complete surgical resection is most effective method. However, in stage III and IVA thymoma, due to circumstances such as presence of local invasion of neighboring organs and diffuse pleural or pericardial implants, surgical success cannot always be achieved [8]. In case of advanced stage thymoma, adjuvant radiotherapy [9] or chemotherapy [10] is suitable treatment method.

Most important prognostic factors for thymoma involve clinical staging of the patient, histopathological classification, and complete resection of the tumor. Various diseases have been associated with thymoma. These include hematological syndromes, red cell aplasia, Hashimotoâ&#x20AC;&#x2122;s thyroiditis, immune deficiency syndromes, and bone and kidney dis-

eases [4]. Myasthenia gravis (MG) is the most frequently seen autoimmune disease associated with thymoma. MG is an autoimmune neuromuscular junction disease. Weigert first demonstrated possible association between MG and thymic tumors in 1901. In 1939, Blalock reported that remission can be achieved in a patient with a thymic tumor [11].

MG has been observed in association with 25% to 59% of thymoma cases [12]. Though worse prognosis has been claimed for cases of thymoma associated with MG, many other authors have advocated against this assertion [13].

The present study is examination of impact of presence of MG on prognosis of patients with thymoma.

MATERIALS AND METHODS Records of 61 patients who underwent surgery for diagnostic and therapeutic purposes related to thymoma at Dr. Siyami Ersek Thoracic and Cardiovascular Surgery Training And Research Hospital Clinic of Thoracic Surgery between January 2003 and September 2016 were retrospectively analyzed.

196

North Clin Istanb

Table 3. Characteristic features of the cases, with and without myasthenia gravis MG Factors

Cases associated with MG

n

%

Cases not associated with MG n

p

%

Number of patients 24 41.4 34 58.6 Age (years) 41.5 (13–62) 54.18 (23–84) 0.106

0.200 Gender Female 11 45.58 10 29.4 Male 13 54.2 24 70.6 Symptomatic 24 100 20 58.8 Tumor size (cm) 5.68 (2–11) 8.46 (3–16) 0.102 Method 0.307 Sternotomy 20 83.3 26 76.5 Thoracotomy 3 12.5 8 23.5 VATS 1 4.2 0 0 Masaoka stage 0.062 I 7 29.2 8 23.5 II 14 58.3 16 47.1 III 2 8.3 9 26.5 IV 1 4.2 1 2.9 WHO histological classification 0.026 B2 14 58.3 10 29.4 B3 6 25 5 14.7 AB 1 4.2 7 20.6 B1 2 8.3 9 26.5 A 1 4.2 3 8.8 Resection 0.419 R0 19 79.2 31 91.2 R1 3 12.5 2 5.9 R2 2 8.3 1 2.9 MG: Myasthenia gravis; VATS: Video-assisted thoracic surgery; WHO: World Health Organization.

Cases were divided into 2 groups: thymoma patients with and without associated MG. Groups were compared with regard to patient gender, histological type of thymoma, type of surgical procedure, and long-term follow-up results.

Cases were staged based on Masaoka staging system, while histological type was determined according to World Health Organization (WHO) histopathological classification system (Table 1, 2) [4]. Preoperative diagnosis was made, and treat-

ment was performed based on analysis of clinical files and pathology reports; physical examination; chest radiograms; computed thoracic tomograms, and in some cases, positron emission tomographic/ computed tomographic examinations; fine-needle aspiration biopsy; and mediastinotomy. Biopsy procedures were performed under radiographic guidance. All patients underwent detailed neurological examination for MG, and medical treatment for the patients with MG was determined based on treatment protocols of neurology clinics. Potential intra-

Aydemir, The effect of myasthenia gravis as a prognostic factor in thymoma treatment

Kaplan-Meier method. Comparisons between survival curves were performed using log-rank test. P value ≤0.05 was accepted as statistically significant.

Survival was calculated from date of surgery to last day of follow-up period. SPSS Statistics 21.0 (IBM Corp., Armonk, NY, USA) software was used to perform analyses.

Survival functions 1.0

0.8 Cum survival

197

0.6

RESULTS 0.4

MG + – +censored – censored

0.2

0.0 0

50

100 Survival

150

200

Figure 1.

Analysis of overall survival in cases of thymoma with or without MG.

and postoperative complications were explained, and approval of the patients was obtained.

Standard monitoring procedures (e.g., measurement of invasive blood pressure, body temperature, end-tidal carbon dioxide and oxygen concentration, neuromuscular block, electrocardiographic monitoring, pulse oxymetry) were performed for all patients post surgery. Procedure performed was median sternotomy, posterolateral thoracotomy, or video-assisted thoracic surgery. Mass was resected with thymic tissue and mediastinal fat tissue. For cases of Masaoka stage III or IV, other involved tissues were also resected.

Monitoring of patients during early postoperative stage included obtaining daily posterior-anterior chest radiogram and performing hemograms, biochemical tests, and clinical assessment of health status. No change in medical treatment was made during early postoperative period.

For comparison between categorical values, Pearson’s chi-square test and Fisher’s exact test were used. Survival rates were calculated based on clinical and histopathological data, surgical resection, Masaoka stage, and MG criteria according to

In our clinic, total of 61 patients underwent surgical procedure related to thymoma between 2003 and 2016. Three patients who had biopsy only were excluded. A total of 58 (male: n=37, 63.8%; female: n=21, 36.2%) patients with mean age of 48.93±2.141 years (range: 13-84 years) were included in the study. MG was associated with thymoma in 24 cases, while in 34 cases, only thymoma was detected (Table 3). In cases without MG, shortness of breath was the most frequently seen symptom. Lethargy, pain, weight loss, and swelling of the neck were among other symptoms encountered.

Cases of thymoma with MG were followed-up over period of between 12 and 155 months (median: 83.96 months). Five-year survival rate was 87.5%. Follow-up of cases without MG ranged between 1 and 149 months (median: 52.18 months), and 5-year survival rate was 82.4% (Figure 1). No statistically significant difference was found between the 2 groups (p=0.311) (Figure 1).

Relationship between Masaoka stage and WHO histological classification in cases with and without associated MG was also analyzed. Mortality rates were highest in stage I and III. Masaoka stage I and II thymomas were mostly found WHO type B2, stage III and IV were type B2 and B3.

Mortality rates in cases of thymoma associated with and without MG were 12.5% and 17.6%, respectively (Table 4).

DISCUSSION Thymoma is the most frequently encountered anterior mediastinal tumor. Two-thirds of patients are asymptomatic, and diagnosis is often made based on routine examinations and tests. Fifty percent of

198

North Clin Istanb

Table 4. Correlation between Masaoka stage and WHO histological classification WHO histological classification Group

Associated with MG

Not associated with MG

Masaoka stage Total %

B2

B3

B1

AB

A

n

n

n

n

n

Mortality

n

n

I II III IV

7 29.2 4 1 0 1 1 14 58.3 10 2 2 0 0 2 8.3 0 2 0 0 0 1 4.2 0 1 0 0 0

1 1 â&#x20AC;&#x201C; 1

I II III IV

8 23.5 2 1 2 2 1 16 47.1 4 3 5 3 1 9 26.5 3 1 2 2 1 1 2.9 1 0 0 0 0

2 1 3 â&#x20AC;&#x201C;

MG: Myasthenia gravis; WHO: World Health Organization.

symptomatic cases are associated with a paraneoplastic neurological syndrome, and most frequently it is MG. Neurological findings of MG play key role in investigation of thymic pathologies such as thymoma [14]. In this study, 58.8% of the cases not associated with MG were symptomatic.

Thymoma is observed in both male and female patients generally aged between 40 and 50 years of age, without difference in gender distribution [15].

In the present study, median age of the patients was 49 years, and no difference in distribution was observed according to gender. In thymoma group without associated MG, male patients were more numerous than women.

There is currently no standardized system for staging of thymoma in the literature. Though type of resection, presence of MG, and advanced age have been reported as prognostic factors, prognosis of thymoma has primarily been based on Masaoka stage and WHO histological classification [16].

Masaoka staging system is anatomical classification first described in 1981 and subsequently revised in 1994. It uses criteria of invasion of peripheral organs, completeness of resection, association of thymoma with MG, tumor size, and involvement

of major vessels. It is presently the most widely accepted and most used staging system for treatment approach. Since 1999, histological classification system of WHO has also been accepted and used worldwide. According to this system, thymomas are divided into 2 main groups based on the shape of neoplastic epithelial cells or their nuclei which are oval and dendritic shapes define type A and type B accordingly. Type B tumors are divided into 3 subtypes of B1, B2, and B3. Type AB tumors combine these 2 morphologies. Any type of thymic carcinoma cases are classified as type C [17].

All histological types except type A of thymoma may be seen in cases with associated MG. Type B2 is most frequently observed thymoma type in patients with MG [18]. Okumura et al. reported that type A and type C thymomas were not seen in cases with MG, while types AB (6.8%), B1 (40%), B2 (55.6%), and B3 (10%) were seen in respective percentage of cases [19]. In the present study, type A thymoma was encountered in only 1 case with MG, while types B1, B2, and B3 were detected in 8.3%, 58.3%, and 25% of cases, respectively.

It is very difficult to describe prognostic factors for thymoma. The fundamental reason is its rarity

Aydemir, The effect of myasthenia gravis as a prognostic factor in thymoma treatment

and polymorphic structures. Presence of MG complicates diagnosis and treatment of thymoma further. MG is observed in ≥30% of patients with thymoma, and thymoma is detected in approximately 10% to 15% of cases of MG [20].

In the literature, impact of MG on prognosis for thymoma is controversial. Though earlier studies reported presence of MG as an indicator of poor prognosis, recent publications have demonstrated that presence of MG may not affect prognosis or that, in fact, these thymoma patients may have a better prognosis [21]. Outcomes of study performed by Wang et al. in 2016 demonstrated that MG exerts favorable impact on long-term results of thymoma and that patients with thymoma with associated MG survive longer [22]. Various studies have shown that cases with MG have better prognosis due to early onset of myasthenic symptoms.

Filosso et al. detected an association between MG and early Masaoka stage, which was explained by early diagnosis of thymoma as result of MG [23].

Elmacı et al. demonstrated that survival rates were markedly higher in cases with myasthenic thymomas diagnosed at early stage, and their recent studies have substantiated this finding [24]. In present study, 87.5% of cases with associated MG were in early stage of the disease (Masaoka stages I and II), while 70.6% of thymoma cases not associated with MG were diagnosed in early stage of the disease.

In addition, 5-year survival rates were higher in the group associated with MG relative to thymoma alone group.

Conflict of Interest: None declared.

Financial Disclosure: The authors declared that this study has received no financial support.

Authorship contributions: Concept – B.A.; Design – B.A.; Supervision – B.A.; Materials – B.A.; Data collection &/or processing – B.A.; Analysis and/or interpretation – B.A.; Literature search – B.A.; Writing – B.A.; Critical review – B.A.

REFERENCES 1. Schmidt-Wolf IG, Rockstroh JK, Schuller H, Hirner A, Grohe C, Muller-Hermelink HK, et al. Malignant thymoma: current status of classification and multimodality treatment. Ann Hematol 2003;82:69–76.

199

2. Wilkins KB, Sheikh E, Green R, Patel M, George S, Takano M, et al. Clinical and pathologic predictors of survival in patients with thymoma. Ann Surg 1999;230:562–74.

3. Engels EA, Pfeiffer RM. Malignant thymoma in the United States: demographic patterns in incidence and associations with subsequent malignancies. Int J Cancer 2003;105:546–51.

4. Metin, SK, Timik tümörler. Mediyasten Hastalıkları ve Cerrahisi. Bölüm 32, TÜSAD Eğitim Kitapları Serisi 2015;281–99.

5. Gray GF, Gutowski WT III. Thymoma. A clinicopathologic study of 54 cases. Am J Surg Pathol 1979;3:235–49.

6. Ruffini E, Mancuso M, Oliaro A, Casadio C, Cavallo A, Cianci R, et al. Recurrence of thymoma: analysis of clinicopathologic features, treatment, and outcome. J Thorac Cardiovasc Surg 1997;113:55–63.

7. Kuzucu, A, Liman, T, Taştepe, İ, Demircan, S, Soysal, Ö, Erkal, HS, et al. Treatment and prognosis in patients with thymoma.

Turkish J Thorac and Cardiovasc Surg 2000;8:793–6.

8. Ichinose Y, Ohta M, Yano T, Yokoyama H, Asoh H, Hata K. Treatment of invasive thymoma with pleural dissemination. J Surg Oncol 1993;54:180–3.

9. Batata MA, Martini N, Huvos AG, Aguilar RI, Beattie EJ. Thymomas: Clinicopathologic features, therapy, and prognosis. Cancer 1974;34:389–96.

10. Chahinian P, Bhardwaj S, Meyer RJ, Jaffrey IS, Kirschner PA, Holland JF. Treatment of invasive or metastatic thymoma: Report of eleven cases. Cancer 1981;47:1752–61.

11. Wilkins EW, Edmunds LH, Castleman B. Cases of thymoma at the Massachusetts General Hospital. J Thorac Cardiovasc Surg 1966;52:322–30.

12. Lewis JE, Wich MR, Scheithauer BW, Bernatz PE, Taylor WF. Thymoma: a clinicopathologic review. Cancer 1987;60:2727–43.

13. Okumura M, Ohta M, Tateyama H, Nakagawa K, Matsumura A, Maeda H, et al. The world health organization histologic classification system reflects the oncologic behavior of thymoma.

Cancer 2002;94:624–32.

14. İşeri P, Komsuoğlu S. Timoma ve nörolojik hastalıklarla ilişkisi.

Available at www.toraks.org.tr. Accessed September, 1, 2016.

15. Griffith RC. Thymus gland. IN Anderson’s Pathology. The CV Mosby Co; 1985.

16. Sarihan S, Bayram AS, Gebitekin C, Yerci Ö, Özkan L. Thymic tumors and outcomes after radiotherapy. Turk J Oncol 2013;28:59–66.

17. Blalock A, Mason MF, Morgan HJ, Riven SS. Mgravis and tumors of the thymic region: report of a case in which the tumor was removed. Ann Surg 1939;110:544–61.

18. Okumura M, Miyoshi S, Fujii Y, Takeuchi Y, Shiono H, Inoue M, et al. Clinical and functional significance of WHO classification on human thymic epithelial neoplasms: a study of 146 consecutive tumors. Am J Surg Pathol 2001;25:103–10.

19. Elmacı T, Tireli E, Barlas S, Toker A, Dayıoğlu E, Deymeer F, et al. Surgical approaches in thymomas. Türk Göğüs Kalp Damar Cerrahisi Dergisi 1994;2:375–8.

20. Zhang Z, Cui Y, Jia R, Xue L, Liang, H. Myasthenia gravis in

200 patients with thymoma affects survival rate following extended thymectomy. Oncol Lett 2016;11:4177–82.

21. Nichols FC, Trastek VF. Standard thymectomy. In: Shields TW, LoCicero J, Reed CE, Feins RH, editors. General thoracic surgery.

Philadelphia: Lippincott Williams and Wilkins; 2009. p. 2278– 83.

22. Kondo K, Monden Y. Thymoma and myasthenia gravis: A clinical study of 1,089 patients from Japan. Ann Thorac Surg 2005;79:219–24.

North Clin Istanb 23. Wang F, Pang L, Fu J, Shen Y, Wei Y, Tan L, et al. Postoperative survival for patients with thymoma complicating myasthenia gravis-preliminary retrospective results of the ChART database.

J Thorac Dis 2016;8:711–7.

24. Filosso PL, Evangelista A, Ruffini E, Rendina EA, Margaritora S, Novellis P, et al. Does myasthenia gravis influence overall survival and cumulative incidence of recurrence in thymoma patients? A Retrospective clinicopathological multicentre analysis on 797 patients. Lung Cancer 2015;88:338–43.

Orıgınal Article

NUCLEAR MEDICINE

North Clin Istanb 2016;3(3):201–8 doi: 10.14744/nci.2016.95866

Normal range of BMD in proximal tibia as a different skeletal site at women Mustafa Arif Aluclu,1 Fatih Bati,2 Ersoy Kekilli3 Department of Pediatrics, Yenisehir Hospital, Mersin, Turkey

1

Department of Nuclear Medicine, Malatya State Hospital, Malatya, Turkey

2

Department of Nuclear Medicine, Inonu University Faculty of Medicine, Malatya, Turkey

3

ABSTRACT OBJECTIVE: Osteoporosis is progressive metabolic bone disease that decreases bone density and features deterioration of bone structure. Dual-energy X-ray absorptiometry (DXA) is commonly used and reliable method to measure bone mineral density (BMD). Aim of this study was to determine normal ranges of BMD in left proximal tibia.

METHODS: Fifty-five females were included in this study. BMD was measured at the lumbar spine and the left proximal tibia using DXA. BMD value of subregions in the left proximal tibia was significantly correlated with BMD value of the total lumbar spine (r=0.111–0.766). New average BMD values of the left proximal tibia were calculated according to age using linear regression formula, leading to average BMD value for the total lumbar spine (L1-L4) in normal population. New simulated T-scores for proximal subregions of the tibia were then calculated.

RESULTS: T-scores for proximal subregions were not different from T-scores of total lumbar spine (p>0.05).

CONCLUSION: It was concluded that proximal tibia is an ideal region for measurement of BMD in osteoporosis.

Keywords: Bone mineral density; correlation; regression; T-score.

O

steoporosis is a progressive skeletal disorder characterized by low bone mass, which causes bone fractures due to decrease in bone mineral density (BMD) and strength [1–6]. Incidence and costs associated with treating osteoporosis are significant socioeconomic burden. Currently, diagnosis of osteoporosis is primarily made based on BMD and bone turnover markers [7]. Bone mineral metabolism can be affected by many factors,

such as age, ethnicity, menopause, endocrine-metabolic disease, socioeconomic and sociocultural environment, rural or urban lifestyle, genetics, use of various drugs, physical activity, some diseases, nutrition, and genetics [8]. Another of these factors may be electromagnetic fields [9]. Genetic factors are important in determining peak bone mass and structure, as well as predisposition to bone deterioration and fragility fractures [10]. Osteopo-

Received: December 09, 2016 Accepted: December 20, 2016 Online: January 25, 2017 Correspondence: Dr. Fatih BATI. Malatya Devlet Hastanesi, Nukleer Tip Bolumu, Malatya, Turkey.

Tel: +90 444 56 34 e-mail: fatihbatimd@gmail.com © Copyright 2016 by Istanbul Northern Anatolian Association of Public Hospitals - Available online at www.kuzeyklinikleri.com

202

rosis is the most common metabolic bone disease and is characterized by deterioration of bone microarchitecture structure, decrease in bone mass, and increase in fragility [11–15].

Osteoporosis affects approximately 300 million people worldwide, primarily due to age-related estrogen deficiency in postmenopausal women [16]. With a high content of trabecular bone, osteoporotic fractures are most commonly seen in vertebrae, proximal femur, distal radius, humerus, pelvis, and ribs [17]. The World Health Organization has stated that osteoporosis can be diagnosed by demonstrating reduced BMD in certain bone areas. Dual-energy X-ray absorptiometry (DXA) is an accurate, reliable, and inexpensive method of measurement that allows for diagnosis of osteoporosis before fracture [18]. DXA is widely used to measure BMD [19]. Rapid increase in BMD can be seen discontinuation of treatment. Early or precocious puberty should be treated with gonadotropin-releasing hormone-agonist to prevent permanent short stature [20]. DXA is clinically proven method of measuring BMD in the lumbar spine, proximal femur, and forearm. It is used primarily in diagnosis and management of osteoporosis and other disease states characterized by abnormal BMD, as well as to monitor response to therapy for these conditions. It may also be used to measure whole-body composition [21]. Skeletal deformities such as spinal curve or compression fracture, bowing of long bones, or presence of metal rods can significantly impair DXA results [22]. In a multicenter study in Canada, prevalence of osteoporosis was found to be 12.1% in the lumbar vertebrae, 7.9% in the femur neck, and 15.8% in both the femur neck and the lumbar vertebrae.

Incidence of osteoporosis has been reported to be 6% in those over 50 years of age and 50% in those over 80 years of age [16]. Rey et al. reported that age-related bone loss was greatest in the forearm (27%–31%), followed by the proximal femur (21%), and less in the lumbar vertebrae (7%) [23].

Aim of this study was to calculate BMD in regions of the proximal tibia and publish mean and standard deviation values (according to age) for measurement of T- and Z-scores in women.

North Clin Istanb

MATERIALS AND METHODS Patient selection A total of 55 women (mean age 49.0 years; range: 26–69 years) who presented at the Department of Nuclear Medicine between October 2011 and March 2012 were enrolled in this study to measure BMD. Study protocol was approved by Malatya clinical research ethics committee. Each volunteer was read patient information form and provided written consent. Patients who were pregnant, had scoliosis, metabolic bone disease, rheumatic bone disease, previous bone fracture in related region, or history of contrast barium or enema radiological examination or radioisotope scan in prior week were not included. Age and anthropometric measurements of all patients were recorded.

Patients were divided into 4 groups according to age. Group I comprised patients between ages of 25 and 39 (n=14), Group II was made up of patients between ages of 40 and 49 (n=14), Group III constituted those between ages of 50 and 59 (n=14), and Group IV patients were between ages of 60 and 69 (n=13).

Measurement of BMD BMD measurements were made using DEXA device (Hologic QDR 4500 W; Hologic Inc., Marlborough, MA, USA). All DXA scans were performed by the same technician. BMD of posterior-anterior lumbar vertebrae (L1-L4) in all patients was measured. BMD and T-scores of patients were calculated automatically according to normal and standard deviation values of Caucasian women using Hologic device database. All patients were measured in supine position. Left tibia was positioned at 180°, straight and parallel to the table. BMD scans of left proximal tibia were performed and BMD values of left proximal tibia regions were calculated using lumbar vertebrae acquisition protocol.

Four rectangular regions of interest, each 25 pixels in width, were measured distally from intercondylar eminence (Figure 1). BMD values of these 4 regions were measured in g/cm2.

Aluclu et al., Normal range of BMD in proximal tibia as a different skeletal site at women

203

New simulated T-scores of proximal tibia subregions were compared with T-scores of total lumbar spine (p>0.05).

Data were expressed as mean±SD. Analysis of variance test was applied for comparison of patient anthropometric data, one-tailed Pearson correlation test was used for correlation of BMD values, and Wilcoxon and Friedman tests were used for comparison of simulated T-scores. SPSS (version 16.0; IBM Corp., Armonk, NY, USA) and OpenOffice Calc 3.3 (Apache Software Foundation, Forest Hill, MD, USA) software were used to conduct statistical analysis. P value <0.05 was considered statistically significant.

eminentia intercondylaris

RESULTS Figure 1.

Four rectangular regions of interest of left proximal tibia. L: Lumbar.

Statistical analysis New average BMD values and new simulated Tscores of all subregions in left proximal tibia were calculated according to age using linear regression formula, which yielded average BMD value of the total lumbar spine (L1-L4) in normal population.

Descriptive data of cases are presented in Table 1.

There was no significant difference between groups (p>0.05).

Strong relationships were found in comparisons of lumbar vertebrae using Pearson correlation test (r=0.797–0.962). These findings are presented in Table 2. Highest correlation value was between total lumbar vertebrae and the other vertebrae; therefore, total lumbar vertebrae value was used for comparison with proximal tibia regions.

Moderate significant correlations were found

Table 1. Descriptive data of patients and statistical comparisons

Group I (n=14) Mean±SD (Range)

Group II (n=14) Mean±SD (Range)

Group III (n=14) Mean±SD (Range)

Group IV (n=14) Mean±SD (Range)

Age (years) Weight (kg) Height (cm) BMI (kg/m2)

33.0±1.1 (26.0–40.0) 61.6±3.5 (42.0–90.0) 158.7±1.4 (150.0–168.0) 25.3±1.7 (16.8–41.9)

45.0±0.8 (41.0–49.0) 70.0±2.7 (55.0–88.0) 161.0±1.5 (150.0–170.0) 27.0±1.1 (21.4–35.5)

54.7±0.7 (51.0–60.0) 72.9±4.3 (55.0–100.0) 158.2±1.2 (150.0–165.0) 28.8±1.3 (21.8–37.4)

64.3±0.8 (61.0–70.0) 70.0±1.9 (60.0–80.0) 155.9±1.6 (145.0–163.0) 28.8±0.7 (24.6–35.5)

SD: Standard deviation; BMI: Body mass index.

p

0.150 0.156 0.113

204

North Clin Istanb

Table 2. Correlation analysis of bone mineral density value of lumbar vertebra

L1 L2 L3 L4 LT L1 r 1 0.914** 0.855** 0.797** 0.928** p p<0.001 p<0.001 p<0.001 p<0.001 L2

r 0.914** 1 0.901** 0.813** 0.952** p p<0.001 p<0.001 p<0.001 p<0.001 L3

r 0.855** 0.901** 1 0.859** 0.962** p p<0.001 p<0.001 p<0.001 p<0.001 L4 r 0.797** 0.813** 0.859** 1 0.931** p p<0.001 p<0.001 p<0.001 p<0.001 LT

r 0.928** 0.952** 0.962** 0.931** 1 p p<0.001 p<0.001 p<0.001 p<0.001 L1: First lumbar vertebra; L2: Second lumbar vertebra; L3: Third lumbar vertebra; L4: Fourth lumbar vertebra; LT: Total lumbar vertebrae (L1-4). r: Correlation coefficient.

Table 3. Correlation analysis between bone mineral density value of lumbar vertebrae and tibial regions

T1 T2 T3 T4 TT Group I (n=14) LT r 0.448 0.487* 0.611* 0.487* 0.538*

p 0.054 0.039 0.010 0.039 0.024 Group II (n=14) LT r 0.378 0.356 0.322 0.111 0.337

p 0.091 0.105 0.130 0.352 0.119 Group III (n=14) LT r 0.691** 0.592* 0.564* 0.625** 0.674**

p 0.003 0.013 0.018 0.008 0.004 Group IV (n=13) LT r 0.553* 0.766** 0.738** 0.705** 0.741**

p 0.025 0.001 0.002 0.004 0.002 Total (n=55) LT r 0.588** 0.559** 0.561** 0.525** 0.601** p 0.0001 0.0001 0.0001 0.0001 0.0001 L1: First lumbar vertebra; L2: Second lumbar vertebra; L3: Third lumbar vertebra; L4: Fourth lumbar vertebra; LT: Total lumbar vertebrae (L1-4); T1: First tibial region of interest; T2: Second tibial region of interest; T3: Third tibial region of interest; T4: Fourth tibial region of interest; TT: Sum of areas in the tibia; r: Correlation coefficient.

between lumbar vertebrae and tibia region BMD values (r=0.111–0.766). When Group II was excluded, correlation was higher than previous measurement (r=0.448–0.766) (Table 3).

Using each patient’s BMD values, linear regression curve and formula were obtained for all groups showing relationship between total lumbar vertebrae and each region of proximal tibia (Figure 2 and Table 4).

Aluclu et al., Normal range of BMD in proximal tibia as a different skeletal site at women

1.2

205

Table 4. Linear regression formulas of all groups and relationship between total lumbar vertebrae and each proximal tibia region

1 0.8

0.6 0.4 0.2 0

y=0.49+0.44x r2=0.37 0.6

0.7

0.8

0.9

1

1.1

1.2

1.3

Figure 1. Linear regression curve and formula for groups indicating the relationship between bone mineral density values of total lumbar vertebrae and second region of proximal tibia.

According to age, new average±SD BMD values for all subregions of proximal tibia were calculated using linear regression formula, leading to average BMD value for the total lumbar spine (L1-L4) of normal population of Caucasian women based on Hologic database (Table 5).

Then, according to new average±SD BMD in all subregions, new simulated T-scores for each left proximal tibia subregion were calculated for each patient. In Groups I through III, new simulated Tscores of subregions were not different from T-score of total lumbar spine (p>0.05) (Table 6). In Group IV, simulated T-scores of proximal tibia differed from T-score of total lumbar vertebrae (p=0.006).

When first region of proximal tibia is excluded, no significant differences were found between lumbar spine T-scores and simulated T-score of each proximal tibia region (p>0.05).

DISCUSSION As a result of the present study, it has been demonstrated that the proximal tibia area can be used to measure and evaluate BMD. Abrahamsen et al. found statistically significant correlation for BMD values, T-score and Z-score among lumbar spine, proximal femur, and forearm in their study of 2005 healthy perimenopausal women (r=0.40–0.77; p<0.01). Correlation of T-scores was higher be-

Group

Group

Group

Group

I

II

III

IV

Lt-T1 Lt-T2 Lt-T3 Lt-T4 Lt-TT Lt-T1 Lt-T2 Lt-T3 Lt-T4 Lt-TT Lt-T1 Lt-T2 Lt-T3 Lt-T4 Lt-TT Lt-T1 Lt-T2 Lt-T3 Lt-T4 Lt-TT

Linear regression formulas

r2

y=0.7+0.26x y=0.64+0.33x y=0.49+0.44x y=0.54+0.33x y=0.57+0.37x y=0.66+0.28x y=0.62+0.32x y=0.63+0.27x y=0.77+0.1x y=0.63+0.29x y=0.38+0.6x y=0.22+0.79x y=0.12+0.77x y=0+0.79x y=0.15+0.81x y=0.61+0.26x y=0.09+0.96x y=0.09+0.8x y=0.07+0.73x y=0.16+0.8x

0.2 0.24 0.37 0.24 0.29 0.14 0.13 0.1 0.01 0.11 0.48 0.35 0.32 0.39 0.45 0.05 0.49 0.35 0.37 0.32

LT: Total lumbar vertebrae (L1-4); T1: First tibial region of interest; T2: Second tibial region of interest; T3: Third tibial region of interest; T4: Fourth tibial region of interest; TT: Sum of areas in the tibia.

tween the proximal femur and the lumbar spine (r=0.67; p<0.01) [21]. In our study, we found high correlation among T-scores of lumbar vertebrae (r=0.111–0.766).

Previous studies found BMD values of lumbar vertebrae in Turkey calculated using quantitative computed tomography and DXA device were similar to those of Western countries [5, 24]. In our study, BMD and T-scores of total lumbar vertebrae were used as reference for comparisons.

Regression analysis and regression curves are commonly used to determine risk factors for osteoporosis but calculation of normal values and standard derivation of BMD using regression formula was not found in literature search.

Bone densitometry has been performed on the

206

North Clin Istanb

Table 5. New average±SD bone mineral density values in all proximal tibia subregions Age (years)

LT

T1±SD

T2±SD

T3±SD

T4±SD

TT±SD

20 1.070 1.423±0.500 1.303±0.394 1.318±0.296 1.606±0.394 1.351±0.352 25 1.060 1.385±0.500 1.273±0.394 1.295±0.296 1.576±0.394 1.324±0.352 30 1.040 1.308±0.500 1.212±0.394 1.250±0.295 1.515±0.394 1.270±0.352 35 1.030 1.269±0.500 1.182±0.394 1.227±0.296 1.485±0.394 1.243±0.352 40 1.020 1.067±0.216 1.013±0.164 1.169±0.169 1.291±0.165 1.074±0.161 45 1.000 1.033±0.217 0.987±0.165 1.143±0.169 1.266±0.164 1.049±0.161 50 0.990 1.017±0.216 0.975±0.164 1.130±0.169 1.253±0.165 1.037±0.161 55 0.970 0.983±0.217 0.949±0.165 1.104±0.169 1.228±0.164 1.012±0.161 60 0.960 1.346±0.216 0.906±0.09 1.088±0.09 1.219±0.09 1.000±0.086 65 0.940 1.269±0.217 0.885±0.09 1.063±0.09 1.192±0.09 0.975±0.086 70 0.930 75 0.920 80 0.900 85 0.890 SD: Standard deviation; LT: Total lumbar vertebrae (L1-4); T1: First tibial region of interest; T2: Second tibial region of interest; T3: Third tibial region of interest; T4: Fourth tibial region of interest; TT: Sum of areas in the tibia.

Table 6. New simulated T-scores of each proximal tibia region

LTTs T1Ts T2Ts T3Ts T4Ts TTTs P value

Group I (n=14) Mean±SD (Range)

Group II (n=14) Mean±SD (Range)

Group III (n=14) Mean±SD (Range)

Group IV (n=14) Mean±SD (Range)

-1.271±1.028 -1.029±0.412 -1.050±0.449 -1.036±0.573 -1.107±0.478 -1.129±0.484 0.452

-1.729±0.100 -1.336±0.752 -1.379±0.796 -1.529±0.833 -1.571±0.841 -1.400±0.857 0.167

-1.757±1.516 -1.029±0.849 -1.021±0.742 -1.029±0.698 -1.029±0.785 -0.993±0.862 0.743

-2.646±0.907 -3.015±0.590 -2.092±1.026 -2.531±1.027 -2.669±1.144 -2.592±1.074 0.0001

SD: Standard deviation; BMI: Body mass index; T1Ts: T-scores of first tibial region of interest; T2Ts: T-scores of second tibial region of interest; T3Ts: T-scores of third tibial region of interest; T4Ts: T-scores of fourth tibial region of interest. TTTs: T-scores of the sum of areas in the tibia.

lumbar spine, the proximal femur, and the forearm.

Previous studies have indicated that sclerotic changes increase T-scores of lumbar vertebrae. Removing sclerotic area from assessment allows for more accurate T- and Z-scores. Depending on excluded area, 1 patient may generate different scores. This can be observed in different scan areas, such as the proximal femur and the forearm [25–28].

BMD values of distal tibia in children have been measured using DXA and quantitative computed tomography in previous studies [29, 30]. BMD measurements in proximal tibia have typically been published in cases of total knee arthroplasty [31].

In present study, mean and standard deviation values of BMD in proximal tibia were calculated using regression curve and formula from T-scores

Aluclu et al., Normal range of BMD in proximal tibia as a different skeletal site at women

of total lumbar vertebrae. Regions of interest used were also original.

New average BMD values of left proximal tibia were calculated according to age using linear regression formula, which yielded average BMD value of the total lumbar spine (L1-L4) in normal population. New simulated T-scores of proximal tibia subregions were then calculated. New simulated T-scores of proximal tibia subregions were not different from T-scores of the total lumbar spine (p>0.05). We concluded that proximal tibia is an ideal evaluation region to measure BMD for diagnosis of osteoporosis. Increase in average life span indicates osteoporosis will become even more serious problem in the near future. For this reason, determination of BMD and early bone loss in different anatomical regions is very important.

Conflict of Interest: None declared.

Financial Disclosure: The authors declared that this study has received no financial support.

Authorship contributions: Concept – M.A.A.; Design – M.A.A.; Supervision – M.A.A.; Materials – M.A.A.; Data collection &/or processing – M.A.A.; Analysis and/or interpretation – F.B.; Literature search – M.A.A.; Writing – F.B.; Critical review – E.K.

REFERENCES 1. Lundeen GA, Knecht SL, Vajda EG, Bloebaum RD, Hofmann AA. The contribution of cortical and cancellous bone to dual-energy X-ray absorptiometry measurements in the proximal femur.

Osteoporos Int 2001;12:192–8.

2. Brown JP, Fortier M, Frame H, Lalonde A, Papaioannou A, Senikas V, et al. Canadian consensus conference on osteoporosis, J Obstet Gynaecol Can 2006;28:95–112.

3. Kanis JA. Diagnosis of osteoporosis. Osteoporos Int 1997;7:108–16.

4. Fink HA, Harrison SL, Taylor BC, Cummings SR, Schousboe JT, Kuskowski MA, et al. Differences in site-specific fracture risk among older women with discordant results for osteoporosis at hip and spine: study of osteoporotic fractures. J Clin Densitom 2008;11:250–9.

5. Paker N, Erbil M, Otlu Z, Soy D, Uysal E. Bone mineral density in healthy Turkish women. J Miner Stoffwechs 2005;12:73–6.

6. Garg MK, Kharb S. Dual energy X-Ray absorptiometry: Pitfalls in measurement and interpretation of bone mineral density. Indian Journal of Endocrinology and Metabolism 2013;17:203–10.

7. Lv H, Jiang F, Guan D, Lu C, Guo B, Chan C, et al. Metabolo-

207

mics and Its Application in the Development of Discovering Biomarkers for Osteoporosis Research. Int J Mol Sci 2016;17:2018.

8. Ediz L, Dülger AC, Toprak M, Ceylan MF, Kemik O. The prevalence and risk factors of decreased bone mineral density in firstly diagnosed ulcerative colitis patients in the eastern region of Turkey. Int J Clin Exp Med 2011;4:157–63.

9. Cidem M, Bahadir C, Karakoc Y, Karacan I. Forearm bone mineral density in healthy young adult mobile phone users. MedScience 2012;1:35–40.

10. Marini F, Cianferotti L, Brandi ML. Epigenetic mechanisms in bone biology and osteoporosis: Can they drive therapeutic choices? International Journal of Molecular Sciences 2016;17:1329.

11. World Health Organization Study Group. Assessment of fracture risk and its application to screening for postmenopausal osteoporosis. Report of a WHO Study Group, World Health Organ Tech Rep 1994;843:1–129.

12. Keen RW. Osteoporosis: strategies for prevention and management. Best Practice & Research Clinical Rheumatology 2007;21:109–22.

13. Kanis JA, Melton LJ, Christiansen C, Johnston CC, Khaltaev N. The diagnosis of osteoporosis. J Bone Miner Res 1994;9:1137–41.

14. Erhan B, Gunduz B. The Effect of Fracture on Quality of Life in Postmenopausal Osteoporotic Women. Osteoporoz Dünyasından 2006;12:31–4.

15. Erkin G, Akınbingöl M, Didere Gülşen E, Aybay C, Özel S. The features of the geriatric Patients who have bone mineral Dansitometric measurements in Our osteoporosis unit. Türk Geriatri Dergisi 2004;7:84–8.

16. Shu R, Ai D, Bai D, Song J, Zhao M, Han X. The effects of SOST on implant osteointegration in ovariectomy osteoporotic mice. Arch Oral Biol 2016;74:82–91.

17. Court-Brown C. Osteoporotic fractures. In: Court-Brown C, McQueen MM, Tornetta P, editors. Trauma. 1st ed. Philadelphia: Lippincott Williams and Wilkins, 2006. p. 54–8.

18. Bone Mineral Density: What it Means and How to Measure it.

Available at: http://www.oif.org/site/DocServer/Bone_Mineral_Density.pdf?docID=7185. Accessed December 12, 2016.

19. Genant HK, Njeh CE. Update on the diagnosis of osteoporosis.

Current Orthopedics 1999;13:144–55.

20. Kekilli E, Aluclu MA, Bati F, Koksal İ. Lumbar spine and proximal femur BMD values in Turkish girls and the effect of precocious puberty on BMD. Med-Science 2012;1:188–99.

21. American College of Radiology (ACR) and Society of Skeletal Radiology (SSR). Practice guideline for the performance of dual-energy x-ray absorptiometry (DXA). Revised 2013;1–14.

22. Abrahamsen B, Hansen TB, Jensen LB, Hermann AP, Eiken P. Site of osteodensitometry in peri menopausal women: correlation and limits of agreement between anatomic regions. J Bone Miner Res 1997;12:1471–9.

23. Rey P, Sornay-Rendu E, Garnero P, Vey-Marty B, Delmas PD. Measurement of bone density in the wrist using X-ray absorptiometry: comparison with measurements of other sites. Rev Rhum Ed Fr 1994;61:619–26.

208 24. Dinç H, Sadikoğlu Y, Savci G, Demirci A, Tuncel E. Bone mineral density measurement by quantitative computed tomography in a normal Turkish population. Eur J Radiol 1995;21:79–83.

25. Jacobson JA, Jamadar DA, Hayes CW. Dual X-ray absorptiometry: recognizing image artifacts and pathology. AJR 2000;174:1699–705.

26. Bonnick SL. Bone Densitometry in Clinical Practice. 3rd ed.

New York: Humana Press 1998:48–50.

27. Siminoski K, Leslie WD, Frame H, Hodsman A, Josse RG, Khan A, et al. Recommendations for bone mineral density reporting in Canada. Can Assoc Radiol J 2005;56:178–88.

28. Syed Z, Khan A. Bone densitometry: applications and limita-

North Clin Istanb tions. J Obstet Gynaecol Can 2002;24:476–84.

29. Zemel BS, Stallings VA, Leonard MB, Paulhamus DR, Kecskemethy HH, Harcke HT, et al. Revised pediatric reference data for the lateral distal femur measured by Hologic Discovery/Delphi dual-energy X-ray absorptiometry. J Clin Densitom 2009;12:207–18.

30. Tryon E, Szalay EA. The lateral distal femoral DEXA scan in children: a chronology of growing bone? Orthopedics 2008;31:1093.

31. Sievänen H, Oja P, Vuori I. Precision of dual energy x-ray absorptiometry in determining bone mineral density and content of various skeletal sites. J Nucl Med 1992;33:1137–42.

Orıgınal Article

ANESTHESIOLOGY & REANIMATION

North Clin Istanb 2016;3(3):209–16 doi: 10.14744/nci.2016.03164

Use of bladder volume measurement assessed with ultrasound to predict postoperative urinary retention Nilgun Kavrut Ozturk, Ali Sait Kavakli Department of Anesthesiology and Reanimation, Antalya Training and Research Hospital, Antalya, Turkey

ABSTRACT OBJECTIVE: Postoperative urinary retention (POUR) is a common complication after spinal anesthesia. Ultrasound (US) is a simple, non-invasive method to estimate bladder volume before and after surgery. Primary aim of the present study was to investigate utility of bladder volume measured before and after surgery in prediction of POUR risk.

Secondary aim was to investigate necessity of urethral catheter use and risk of urethral catheter-related infections.

METHODS: Eighty patients who received spinal anesthesia for arthroscopic knee surgery were included in the study. Level and duration of sensory and motor block; bladder volume measured preoperatively, in post-anesthetic care unit (PACU), and when discharged from PACU; use of urethral catheter; and incidence of urinary tract infection data were recorded.

RESULTS: POUR was observed in 28.7% of patients. Length of time for sensory block regression was significantly shorter in patients without POUR (p=0.012). Spontaneous urination was not observed in 3 of 23 patients with POUR, although bladder volume was less than 600 mL. Bladder volume over 600 mL without urination was recorded in 20 patients. There was no statistical difference in preoperative bladder volume between patients who did or did not develop POUR. Bladder volume on admission to PACU was higher in patients with POUR (p=0.023).

Urgency and dysuria were observed in 5 patients who required urethral catheterization during postoperative period. Urinary tract infection developed in 1 patient. There was no statistical difference in development of urinary tract infection between patient groups who did and did not undergo urethral catheterization.

CONCLUSION: Assessment of patient bladder volume with US before arthroscopic knee surgery may be used to foresee development of POUR. Avoiding elective urinary catheterization may reduce urinary infections.

Keywords: Bladder volume; postoperative urinary retention; spinal anesthesia; ultrasound.

P

ostoperative urinary retention (POUR) is a frequent complication encountered following spinal anesthesia. In the literature, incidence of POUR has been reported within a broad spectrum,

ranging between 5% and 52% [1, 2].

Risk increases in women, and population aged over 50 years. Factors such as type of surgery, neurological disease, diabetes mellitus, drugs used

Received: October 18, 2016 Accepted: December 16, 2016 Online: January 20, 2017 Correspondence: Dr. Nilgun KAVRUT OZTURK. Antalya Egitim ve Arastirma Hastanesi, Anesteziyoloji ve Reanimasyon Klinigi, Kazim Karabekir Caddesi, 07100 Muratpasa, Antalya, Turkey.

Tel: +90 242 - 249 44 00 e-mail: kavrut@yahoo.com © Copyright 2016 by Istanbul Northern Anatolian Association of Public Hospitals - Available online at www.kuzeyklinikleri.com

210

during perioperative period (e.g., anticholinergics, beta-blockers, sympathomimetics), quantity of intravenous fluid used, duration of surgery, analgesics and anesthetics, and anesthesia technique play role in development of POUR [3].

Various studies have revealed correlation between spinal anesthesia and development of POUR. In 30 to 60 seconds following intrathecal injection of local anesthetic, feeling of urgency to micturate disappears; however, feeling of distension caused by full bladder continues. Analgesia of the bladder is achieved with blockade of conduction of stimuli via afferent nerve fibers traveling from the bladder to miction center in the brain. Blockade of the detrusor muscle begins to take effect 2 to 5 minutes after injection of anesthetic agent. Sensory block regresses to level of sacral spine segment S3 7 to 8 hours after intrathecal injection of bupivacaine. When the detrusor strength is returned, the level of analgesia is at or caudal to L5 [4].

Relationship between long-acting local anesthetics and POUR has been reported. Use of short-acting local anesthetics is associated with lower incidence of bladder distension and risk of POUR [5].

US is noninvasive method that can easily be used to calculate bladder volume before anesthesia and during postoperative period, as well as to estimate post-void residual volume.

Aim of the present study was to evaluate use of bladder volume measured with US before application of spinal anesthesia and during postoperative period to predict development of POUR and need for urethral catheterization.

MATERIALS AND METHODS This study was conducted in compliance with the principles of Declaration of Helsinki, and it was approved by the ethics committee of Antalya Training and Research Hospital (decision no: 22/14, dated: 04.07.2013). Written informed consent of all patients was obtained.

Primary objective of the study was to investigate the utility of pre- and postoperatively measured bladder volume to predict postoperative urinary

North Clin Istanb

retention. Secondary objective was to investigate necessity for catheterization and risk of urinary infection associated with urethral catheter.

Total of 80 patients of American Society of Anesthesiologists classification I through III and aged 19 to 65 years, who were scheduled for elective unilateral arthroscopic surgery were included in the study. Patients with known prostatic disease; history of difficulty voiding, urinary incontinence, urological surgery; contraindication for spinal anesthesia (e.g., coagulopathy, serious valvular disease); neurological dysfunction; or who unable to cooperate.

Patients were permitted to urinate before they were brought to operating room for induction of anesthesia. In the operating room, pulse oximetry, electrocardiographic examination, and standard anesthetic monitoring, which included noninvasive blood pressure measurement, were performed. Peripheral venous route was opened with 18-G cannula, and 0.9% sodium chloride infusion was initiated at a rate of 6 mL/kg/hr. The patients also received intravenous midazolam at dose of 0.05 mg/kg.

Bladder volume of the patients was measured and calculated with US device (DC-T6 Diagnostic Ultrasound System; Mindray Bio-Medical Electronics Co., Ltd., Shenzhen, China) with 5 Mhz convex probe. All measurements were performed by 2 anesthesiologists. US probe was placed approximately 2 cm over transverse and longitudinal planes, and transverse, anteroposterior, and superoinferior diameters of the bladder were measured. Bladder volume was calculated automatically (Figure 1).

Patients were placed in lateral decubitus position, and 27-G pencil point spinal needle (Egemen Tibbi Teknik Sanayi ve Dis Ticaret Ltd. Sti., Izmir, Turkey) was inserted at L4-5 interspace to deliver 7.5 mg 0.5% hyperbaric bupivacaine to subarachnoid space. Patients were left in lateral decubitus position for 10 minutes, then turned to supine position and placed in 20ยบ Trendelenburg position. Following application of spinal anesthesia, level of sensory and motor blocks was evaluated using pinprick test and Bromage scale, respectively.

Time elapsed for sensory block to reach T12

Kavrut Ozturk et al., Use of bladder volume measurement assessed with ultrasound to predict postoperative urinary retention

Figure 1. Ultrasonographic view of the bladder in 2 different images. The image on the left was obtained by placing the probe in transverse plane. Dashed lines indicate the longest transverse diameter of the bladder. The image on the right was obtained by placing the probe in longitudinal plane. Dashed lines demonstrate anteroposterior and supero-inferior diameters of the bladder. thoracic vertebra, maximum level of sensory block, time needed for sensory block to reach maximum level on both sides, maximum sensory block, time to reach maximum block, quantity of fluid given during perioperative period, and volume of blood loss were recorded.

Patients were brought to postoperative recovery room after procedure and monitored until motor and sensory blocks had completely receded. Time elapsed from application of spinal anesthesia until loss of motor block (Bromage=0), and time interval until regression of sensory block to L2 level were recorded.

In recovery room, intravenous paracetamol at dose of 1 g was administered.

Bladder volume of patients who met criteria (fully conscious, stable vital signs, visual analog scale <5, absence of nausea and vomiting, loss of motor and sensory block) for transfer to ward was measured again in recovery room using the same method. Patients were also asked about need to urinate before they were sent to ward. Urethral catheterization was performed for patients whose bladder volume was â&#x2030;Ľ600 mL and could not urinate despite

211

presence of urgency. If the patient did not indicate any need to urinate, we waited for 30 minutes. If the patient could not urinate spontaneously, urethral catheterization was performed, and amount of residual urine was measured. Patients whose bladder volume was less than 600 mL, but who could not urinate within 1 hour were also catheterized and urine volume was recorded.

During monitoring of catheterized patients, urine cultures were obtained for patients who complained of fever (>38oC), dysuria, frequency, strangiuria, or suprapubic pain. Urinary infection was defined as presence of bacterial growth of more than 105/mL CFUs on culture media.

Statistical analysis SPSS software, version 21 (IMB Corp., Armonk, NY, USA) was used to analyze statistical data. All data were expressed as number or percentage. Results were expressed as meanÂąstandard deviation.

Normal distribution was assessed using ShapiroWilk test. Studentâ&#x20AC;&#x2122;s t-test and chi-square test were used to compare numerical and nominal values, respectively. P<0.05 was accepted as level of statistical significance.

RESULTS Total of 80 patients who underwent elective unilateral arthroscopic knee surgery under spinal anesthesia were included in the study. Demographic data of the patients are presented in Table 1.

Postoperative urinary retention developed in 23 (28.7%) study patients and was not seen in 57 (71.3%) patients.

Surgery of all patients was performed under spinal anesthesia. No patient displayed any indication of need to switch to general anesthesia or required additional intraoperative analgesia.

Time for sensory block to rise to level of T12 did not differ between patients who did or did not develop urinary retention. However, time until regression of sensory block to level of L2 was significantly shorter in patients who did not develop POUR (p=0.012). Significant intergroup difference was not detected in time to develop motor

212

North Clin Istanb

Table 1. Demographic data

Patients who developed urinary retention (n=23)

n

Age (mean±SD) Gender

Male

Female BMI kg/m2 (mean±SD) ASA score

ASA I

ASA II ASA III Comorbidities Hypertension Diabetes mellitus Coronary artery disease

Patients who did not develop urinary retention (n=57)

%

n

52±11

p

% 54±9

0.775

14 60.9 36 63.2 0.322 9 39.1 21 36.8 0.414 27.8±3.1 27.3±4.2 0.822 10 43.5 23 40.4 0.212 9 39.1 26 45.6 0.324 4 17.4 8 14 0.243 3 2 3

13 8.7 13

6 4 6

10.5 7 10.5

0.466 0.439 0.364

SD: Standard deviation; BMI: Body mass index; ASA: American Society of Anesthesiologists.

Table 2. Sensory and motor block data

Patients who developed urinary retention (n=23)

Patients who did not develop urinary retention (n=57)

Mean±SD

Mean±SD

5±2 210±18 12±4 226±32

7±2 150±16 11±3 198±21

Time Time Time Time

elapsed until sensory block reached T10 level, min elapsed until sensory block regressed toL2 level, min until achievement of maximum motor block, min until termination of motor block, min (Bromage scale=0)

p

0.765 0.012* 0.818 0.226

SD: Standard deviation.

block. Although time until termination of motor block was shorter in group that did not develop urinary retention, intergroup difference was not statistically significant (Table 2).

No difference was found in preoperative bladder volume between groups that did or did not develop urinary retention. However, bladder volume was significantly higher at admission to postoperative

recovery room in patients who developed urinary retention (p=0.023). Three (3.7%) of 23 patients who developed urinary retention had bladder volume below 600 mL and could not urinate spontaneously. In addition, 20 (25%) patients whose bladder volume was above 600 mL could not urinate spontaneously (Table 3).

Kavrut Ozturk et al., Use of bladder volume measurement assessed with ultrasound to predict postoperative urinary retention

213

Table 3. Comparison of data of the patients who did and did not develop urinary retention

Patients who

developed urinary retention (n=23) n

%

Mean±SD

Patients who did not develop urinary retention (n=57) n

%

p

Mean±SD

Operating time, min 69±11 4 3±14 Quantity of fluid given during surgery, mL 1050±226 725±115 Quantity of fluid given during postoperative period, mL 950±214 860±195 Preoperative bladder volume, mL 180±40 160±37 Bladder volume at admission to recovery room, mL 520±52 220±45 Bladder volume before leaving recovery room, mL 652±54 345±67 Bladder volume >600 mL 20 25 6 7.5 Bladder volume <600 mL 3 3.8 51 63.7 Development of urinary tract infection 1 4.3 0 0 Length of hospital stay, d 6 5 Complications Bradycardia 3 13 5 8.7 Hypotension 2 8.7 4 7

0.028* 0.033* 0.590 0.840 0.023* 0.012* 0.042* 0.015* 0.778 0.277 0.175 0.766

SD: Standard deviation.

Statistically significant difference was not found between measurement of urine volume using US evaluation and volume estimated with urethral catheterization (Figure 2).

During postoperative monitoring, 5 patients who underwent urinary catheterization complained of frequency and dysuria. Bacterial growth was detected on urine culture of 1 of these patients and he was diagnosed with urinary infection. Rate of urinary infection did not differ between patients who developed urinary retention and required urethral catheterization and those did not undergo urethral catheterization. No patient required urethral catheterization for more than 24 hours.

Paresthesia was not detected in any patient. Intraoperatively, in 8 (10%) patients, bradycardia developed, and hypotension was observed in 6 (7.5%) cases. No other complication related to spinal anesthesia was observed.

mL 750 700 650 600 550 500 450 400

Bladder volume measured with ultrasound machine

Bladder volume measured with urethral catheter

Figure 2.

Comparison of bladder volume values obtained using ultrasound and urethral catheter.

DISCUSSION Present study has demonstrated that measurement of bladder volume in postoperative recovery room

214

following spinal anesthesia may predict development of POUR. Spinal anesthesia may affect vesicle function, thereby leading to POUR. Association of use of long-acting analgesics for spinal anesthesia [6] and bilateral spinal anesthesia with development of POUR has been reported in relevant studies [7].

In study conducted by Keita et al., authors reported close relationship between bladder volume greater than 270 mL at admission to postoperative recovery room and development of POUR [8]. In the same study, age of more than 50 years, intraoperative fluid requirement greater than 750 mL, operating time longer than 60 minutes, and anesthesia lasting longer than 80 minutes were associated with development of POUR. In the current study, mean bladder volume of the patients who did and did not develop urinary retention at admission to recovery room was 460±52 mL and 220±45 mL, respectively. Similarly, in present study, operating time was found to be associated with development of POUR. In study performed by Hollman et al., incidence of POUR was found to be 39.9% among 376 patients who had undergone implantation of total hip prosthesis. Authors also revealed age of 70 years or older, spinal anesthesia, and postoperative patient -controlled analgesia were independent risk factors for POUR [9]. Higher incidence of POUR when compared with our study might be related to difference in surgical procedure performed or use of morphine sulfate during postoperative period, rather than paracetamol. Unilateral spinal anesthesia with hyperbaric bupivacaine was associated with development of POUR in 30% of patients who had undergone knee arthroscopy, and no difference was found with regard to bilateral spinal anesthesia [10].

In the current study, development of POUR was detected in 21.7% of cases, smaller percentage than results reported by Voelckel et al. This difference might stem from differences in management of perioperative fluid therapy. In the study conducted by Voelckel et al., intraoperative fluid therapy was administered at rate of 7 mL/kg/hr, while in our study, fluid therapy was provided at rate of 6 mL/kg/hr.

In the literature, incidence of POUR varies between 7% and 52% [11]. Palpation alone is insuffi-

North Clin Istanb

cient to demonstrate the presence of vesical globes, because about 61% of cases have urinary retention without pain [12]. US is simple and reliable tool to measure bladder volume [13]. US measurement of bladder volume of ≥100 cc has 97% sensitivity, 91% specificity, and 94% accuracy [8]. Pavlin et al., demonstrated only 15 mL difference between US measurement of intravesical urine volume and that measured after urethral catheterization [12, 14].

Present study also found consistency between measurements with US and bladder catheterization.

US measurement of the longest transverse diameter of the bladder has been reported to aid in management of patients with risk for POUR [15].

In the same study, it was reported that patients with longest transverse diameter of the bladder <9.7 cm can be discharged from postoperative recovery room without waiting for the patients to urinate. Need for catheterization was indicated in patients whose longest transverse diameter of the bladder was >10.7 cm [15]. In the current study, longest mean transverse diameter of the bladder in patients who developed POUR was 11.2±2.2 cm, which was consistent with results of cited study. We preferred to calculate bladder volume based on measurements of 3 different diameters to increase reliability of assessment.

Various formulas may be employed to calculate bladder volume using transabdominal US; superiority of one formula over another has not yet been demonstrated. Authors have reported that bladder volume calculated using formulas were nearly the same as those estimated using urethral catheterization, and it was concluded that transabdominal US is reliable method of measurement [16]. Specific automated bladder US devices developed to measure bladder volume may be also used. Watanabe et al. compared 3-dimensional US machine with transabdominal US machine, and found no significant difference between measurements of bladder volume [17].

Normal bladder capacity ranges between 400 and 600 mL [18]. For bladder volume >600 mL, urethral catheterization is recommended to prevent development of POUR [19]. However, that volume is somewhat high for adult patient group whose

Kavrut Ozturk et al., Use of bladder volume measurement assessed with ultrasound to predict postoperative urinary retention

maximum bladder volume is 400 to 500 mL and in present study, bladder volume of 600 mL was accepted as catheterization cut-off value.

Various studies have shown that routine catheterization during total hip prosthesis surgery increases hospital costs [20]. It is suggested that the urinary probe should not be routinely applied to speed up the recovery process of patients and to facilitate the mobilization of patients [21]. In a study performed with 4906 patients who had undergone orthopedic surgery, incidence of catheter-related urinary system infection was 8.5% [22]. Decrease in use of urethral catheter in postoperative period will decrease risk of infection and thereby shorten hospital stay. In present study, urinary infection developed in only 1 (4.3%) of 23 patients who had urethral catheter. Lower rate of urinary tract infection in our patients may be due to shorter (<24 hr) urethral catheterization period. Rate of urinary infection may increase when longer periods of urethral catheterization are needed.

POUR can lead to complications, such as infection, delirium, detrusor muscle damage, or even cardiac arrhythmia through activation of autonomic nervous system, and also may delay hospital discharge.

Conclusion US measurement of bladder volume during postoperative period is simple and noninvasive. Likelihood of postoperative development of POUR due to spinal anesthesia can be predicted with US measurement of bladder volume in recovery room. Thus, routine and unnecessary catheterization may be prevented, which may reduce incidence of urinary infection, and thereby shorten hospital stay and reduce expenditures.

Conflict of Interest: None declared.

Financial Disclosure: The authors have declared that this study received no financial support.

Authorship contributions: Concept – N.K.Ö.; Design – N.K.Ö.; Supervision – N.K.Ö.; Materials – N.K.Ö., A.S.K.; Data collection &/or processing – N.K.Ö., A.S.K.; Analysis and/or interpretation – N.K.Ö., A.S.K.; Writing – N.K.Ö., A.S.K.; Critical review – N.K.Ö., A.S.K.

215

REFERENCES 1. Choi S, Mahon P, Awad IT. Neuraxial anesthesia and bladder dysfunction in the perioperative period: a systematic review. Can J Anaesth 2012;59:681–703.

2. Rosseland LA, Stubhaug A, Breivik H. Detecting postoperative urinary retention with an ultrasound scanner. Acta Anaesthesiol Scand 2002;46:279–82.

3. Kowalik U, Plante MK. Urinary retention in surgical patients.

Surg Clin North Am 2016;96:453–67.

4. Axelsson K, Möllefors K, Olsson JO, Lingårdh G, Widman B. Bladder function in spinal anaesthesia. Acta Anaesthesiol Scand 1985;29:315–21.

5. Mulroy MF, Salinas FV, Larkin KL, Polissar NL. Ambulatory surgery patients may be discharged before voiding after short-acting spinal and epidural anesthesia. Anesthesiology 2002;97:315–9.

6. Baldini G, Bagry H, Aprikian A, Carli F. Postoperative urinary retention: anesthetic and perioperative considerations. Anesthesiology 2009;110:1139–57.

7. Kamphuis ET, Ionescu TI, Kuipers PW, de Gier J, van Venrooij GE, Boon TA. Recovery of storage and emptying functions of the urinary bladder after spinal anesthesia with lidocaine and with bupivacaine in men. Anesthesiology 1998;88:310–6.

8. Keita H, Diouf E, Tubach F, Brouwer T, Dahmani S, Mantz J, et al. Predictive factors of early postoperative urinary retention in the postanesthesia care unit. Anesth Analg 2005;101:592–6.

9. Hollman F, Wolterbeek N, Veen R. Risk Factors for Postoperative Urinary Retention in Men Undergoing Total Hip Arthroplasty. Orthopedics 2015;38:e507–11.

10. Voelckel WG, Kirchmair L, Rehder P, Garoscio I, Krappinger D, Luger TJ. Unilateral anesthesia does not affect the incidence of urinary retention after low spinal anesthesia for knee surgery.

Anesth Analg 2009;109:986–7.

11. Brouwer TA, Rosier PF, Moons KG, Zuithoff NP, van Roon EN, Kalkman CJ. Postoperative bladder catheterization based on individual bladder capacity: a randomized trial. Anesthesiology 2015;122:46–54.

12. Pavlin DJ, Pavlin EG, Fitzgibbon DR, Koerschgen ME, Plitt TM. Management of bladder function after outpatient surgery.

Anesthesiology 1999;91:42–50.

13. Rosseland LA, Stubhaug A, Breivik H. Detecting postoperative urinary retention with an ultrasound scanner. Acta Anaesthesiol Scand 2002;46:279–82.

14. Pavlin DJ, Pavlin EG, Gunn HC, Taraday JK, Koerschgen ME. Voiding in patients managed with or without ultrasound monitoring of bladder volume after outpatient surgery. Anesth Analg 1999;89:90–7.

15. Daurat A, Choquet O, Bringuier S, Charbit J, Egan M, Capdevila X. Diagnosis of postoperative urinary retention using a simplified ultrasound bladder measurement. Anesth Analg 2015;120:1033–8.

16. Doğanay M, Aksakal O, Dumanlı H, Özakşit G. Urethral cath-

216 eterisation with abdominal ultrasound in the measurement of residual urine volume after anti-incontinence operation. JinekolojiObstetrik ve Neonatoloji Tıp Dergisi 2012;8:1354–7.

17. Watanabe A, Ichimatsu K, Ito T, Morii A, Yasuda K, Fujiuchi Y, et al. The efficacy of portable 3-dimensional ultrasound scanning device (Bladder Scan BVI6100) for measurement of residual urine volume-comparison with transabdominal ultrasound estimation. [Article in Japanese] Hinyokika Kiyo 2008;54:203–6.

[Abstract] 18. Lamonerie L, Marret E, Deleuze A, Lembert N, Dupont M, Bonnet F. Prevalence of postoperative bladder distension and urinary retention detected by ultrasound measurement. Br J Anaesth 2004;92:544–6.

North Clin Istanb 19. Darrah DM, Griebling TL, Silverstein JH. Postoperative urinary retention. Anesthesiol Clin 2009;27:465–84.

20. Iorio R, Whang W, Healy WL, Patch DA, Najibi S, Appleby D. The utility of bladder catheterization in total hip arthroplasty.

Clin Orthop Relat Res 2005;432:148–52.

21. Balderi T, Mistraletti G, D’Angelo E, Carli F. Incidence of postoperative urinary retention (POUR) after joint arthroplasty and management using ultrasound-guided bladder catheterization.

Minerva Anestesiol 2011;77:1050–7.

22. Rajasekaran S, Ravi S, Aiyer SN. Incidence and preventability of adverse events in an orthopaedic unit: a prospective analysis of four thousand, nine hundred and six admissions. Int Orthop 2016;40:2233–8.

Orıgınal Article

ANESTHESIOLOGY & REANIMATION

North Clin Istanb 2016;3(3):217–21 doi: 10.14744/nci.2016.67699

Analysis of cancer patients admitted to intensive care unit Yakup Aksoy,1 Ayhan Kaydu,2 Omer Fatih Sahin,1 Cem Kivilcim Kacar3 Department of Anesthesiology, Diyarbakir Bismil State Hospital, Diyarbakir, Turkey

1

Department of Anesthesiology, Diyarbakir Selahaddin Eyyubi State Hospital, Diyarbakir, Turkey

2

Department of Anesthesiology, Diyarbakir Gazi Yasargil Training and Research Hospital, Diyarbakir, Turkey

3

ABSTRACT OBJECTIVE: The present study is an analysis of cancer patients who received follow-up treatment for either cancer-related complications or treatment-associated side effects while hospitalized in the intensive care unit (ICU).

METHODS: Records of cancer patients treated at Dr. Lütfi Kırdar Kartal Training and Research Hospital ICU between January 1, 2011 and December 31, 2012 were retrospectively reviewed. Demographic data and type of cancer were recorded in prepared forms and subsequently analyzed.

RESULTS: Among 2240 ICU patients treated and hospitalized between January 1, 2011 and December 31, 2012, 482 cancer patients were identified and included in the study. Percentage of cancer patients in ICU was 23.9%.

Male to female ratio was determined to be 1.55. First 3 most common cancers found were colorectal (19.7%), lung (15.7%), and stomach cancers (11.6%). Mortality rate of cancer patients hospitalized in ICU was 46.6%.

Larynx, lung, urinary bladder, skin, rectosigmoid, hematological, and kidney cancer were more prevalent in male patients, whereas esophageal cancer was seen in more female patients than male patients. Incidence of stomach, brain, and pancreatic cancers, as well as unclassified tumors, was found to be unrelated to gender.

CONCLUSION: Rectosigmoid cancer was most common type of cancer observed in our ICU. Esophageal cancer was observed in more females than males, while larynx cancer was more frequently present in males.

Keywords: Cancer; intensive care unit; malignancy.

C

ancer is a group of malignant diseases and develops as result of uncontrolled growth and proliferation of cells that were altered as result of factors in locoregional or remote site [1]. Cancer classification is made according to tissues or organ of origin. Signs, symptoms, and management of ma-

lignancies vary with type of cancer. Most frequently seen cancer types stem from the lung, breast, gastrointestinal system, and reproductive system [2].

Though cancer demonstrates differences according to cancer type, patient age and gender, and geographic region, estimated overall incidence in popu-

Received: October 07, 2016 Accepted: November 21, 2016 Online: January 25, 2017 Correspondence: Dr. Yakup AKSOY. Diyarbakir Bismil Devlet Hastanesi, Anesteziyoloji ve Reanimasyon Klinigi, 21090 Diyarbakir, Turkey.

Tel: +90 412 - 415 23 10 e-mail: dr.yaksoy@hotmail.com © Copyright 2016 by Istanbul Northern Anatolian Association of Public Hospitals - Available online at www.kuzeyklinikleri.com

218

lation is between 85–350/100.000 [3]. Number of cancer cases, and hence, cancer-related morbidity and mortality rates, are expected to increase in years to come, depending on population growth [4, 5].

Growing number of patients is being treated in intensive care unit (ICU) for cancer-related complications or adverse effects of treatment [6]. A number of studies have reported higher mortality rate in patients with prolonged stay in ICU, especially among those who develop leukopenia or require mechanical ventilation [7, 8].

Based on 2003 data of American Cancer Society, most frequently seen type of cancer in men is prostate cancer, followed by lung, colorectal, and bladder cancer in decreasing order of frequency. In women, breast cancer is most common, followed by lung, colorectal, and uterine cancers [9].

In this study, data of cancer patients hospitalized in general ICU were analyzed to determine most frequently seen cancer types and to examine cancer-gender relationship, demographic characteristics, and percentage of patients hospitalized in ICU with cancer.

MATERIALS AND METHODS After receiving approval from the Kartal Dr. Lütfi Kırdar Training and Research Hospital (KLKTRH) ethics committee, hospital files of patients in ICU of KLKTRH between January 1, 2011 and December 31, 2012 were retrospectively reviewed.

From among these patients, details of age, gender, type of cancer, presence of any metastasis or concomitant disease of 482 patients were recorded on prepared forms and analyzed. Patients hospitalized more than once were counted only once.

Statistical analysis Statistical analysis of study data was performed using SPSS software (version 13.0; IBM Corp., Armonk, NY, USA). Fold changes were used to investigate correlations between gender and presence of cancer. Malignancies with fold change of ≥2 were associated with male gender, while those with fold change of between 0.5 and 2.00 were evaluated as unrelated to gender.

North Clin Istanb

Table 1. Cancer patients in instensive care unit

n

%

Male 293 Female 189 Age (mean±SD) 59.9±15.06 Metastasis Present 87 18.0 Absent 395 82.0 Concomitant disease Present 176 36.5 Absent 306 63.5 Surgical procedure Yes 285 59.1 No 197 31.9 Cardiopulmonary resuscitation Present 17 3.5 None 465 96.5 Recurring admission to intensive care unit 2 admissions 35 3 admissions 6 4 admissions 1 5 admissions 1 SD: Standard deviation.

RESULTS From total of 2240 patients, 482 (23.9%) cases with cancer (male: n=293, 60.8%; female: n=189, 39.2%; male:female ratio: 1.55) were hospitalized and treated in ICU between January 1, 2011 and December 31, 2012. Cancer patients were aged between 3 and 93 years, with mean age of 59.9±15.06 years (Table 1).

Patients were categorized as ≥70 (n=138; 28.6%) or <70 (n=344; 71.4%) years of age. Age distribution graph demonstrated accumulation of cancer patients within age interval of 40 to 80 years, and majority in age bracket of 60 to 69 years (Figure 1).

Indication for ICU hospitalization of cancer patients was most often respiratory distress or deterioration of general state of health. Patients were also admitted to ICU for closer monitoring, metastatic

Aksoy et al., Analysis of cancer patients admitted to intensive care unit

Distribution of cancer patients (2011–2012)

90–99

80–89

70–79

60–69

50–59

40–49

30–39

20–29

10–19

0–9

Series 1

Age groups

160 140 120 100 80 60 40 20 0 Years

219

Figure 1. Patient age groups. complications, adverse effects of oncological therapy, and advanced life support after cardiopulmonary resuscitation (CPR).

Rectosigmoid cancer (19.7%) was most prevalent type of cancer seen among cancer patients hospitalized in ICU, followed by lung (15.7%), and gastric (11.6 %) cancers (Figure 2).

Among a total of 482 cancer patients hospitalized in intensive care unit, 225 died while in hospital, and 257 cases were transferred to relevant clinic after treatment in ICU. Mortality rate was 46.6%.

Forty-three patients who were transferred were subsequently re-admitted to ICU between 2 and 5 times (Table 1). Total number of ICU hospitalizations for 482 patients was 536.

In the present study, 87 (18.0%) patients were observed to have metastasis or comorbidity (n=176; 36.5%), and 285 (59.1%) patients consulted to ICU following surgical intervention. CPR was performed on 17 (3.5%) patients who were admitted to ICU for advanced life support (Table 1). Sixteen of those patients died; mortality rate for CPR patients was calculated at 94.1%.

Based on fold changes, lung, rectosigmoid, hematological, bladder, and cutaneous malignancies were associated with male gender, while esophageal cancer was seen in more female patients than male patients. Stomach, brain, and pancreatic cancers, as well as unclassified tumors, were not found to be correlated with gender. In our analysis, laryngeal cancer was malignancy with highest (15.00) fold change (Table 2). Gender-related malignancies, such as gynecological, breast, and prostatic cancers were not included in this analysis.

Colorectal Lung Gynecological Breast Prostate Esophagus

No.

Stomach

Pancreas Kidney

Malignancy

1 Colorectal 2 Lung 3 Stomach 4 Brain 5 Hematological 6 Breast 7 Gynecological 8 Pancreas 9 Bladder 10 Larynx 11 Prostate 12 Esophagus 13 Kidney 14 Skin 15 *Other Total

Hematologic Brain Bladder Larynx *Other Skin

Patients (n) 95 76 56 35 27 25 24 22 22 16 14 13 12 10 35 482

Ratio (%) 19.71 15.77 11.62 7.26 5.60 5.19 4.98 4.56 4.56 3.32 2.90 2.70 2.49 2.07 7.26

*Thyroid ca, soft tissue, fibrous mass, liver, gall bladder, testis, nasopharynx, placenta tm.

Figure 2. Cancer patients distribution.

DISCUSSION Cancer is still a leading health problem worldwide, and cancer patients constitute substantial number of ICU patients. These patients are generally in the terminal phase of their disease, and they are hospitalized in ICU most often due to respiratory distress, deterioration of general health, complications related to metastasis, adverse effects of oncological treatment, and close postoperative monitoring.

220

North Clin Istanb

Table 2. Relationship between gender and malignancy Site of malignancy

Male (n)

Female (n)

Fold changes

Lung Rectosigmoid Stomach Brain Blood (hematological) Pancreas Bladder Larynx Esophagus Kidney Skin Unclassified tumors Total

61 15 4.07 64 31 2.06 33 23 1.43 19 16 1.19 18 9 2.00 12 10 1.20 17 5 3.40 15 1 15.00 4 9 0.44 8 4 2.00 7 3 2.33 21 14 1.50 279 140

Gender-related cancers, such as prostate, breast, and gynecological malignancies were not included in this analysis.

Based on 2008 data of the Ministry of Health, in Turkey, lung cancer was most frequent type of cancer seen in men, followed by prostate, bladder, and colorectal cancers. In women, most frequently observed cancer type was breast cancer, followed by thyroid, colorectal, and uterine cancers [10].

In a study of cancer patients of the medical oncology clinic of Van Yuzuncu Yil University Faculty of Medicine between 2001 and 2004 conducted by Alici et al., most frequently seen was gastric cancer, followed by esophageal, breast colorectal, and lung cancers. In women, breast cancer was most common, followed by gastric cancer, while in men, gastric cancer was predominant, followed by esophageal cancer [11]. Tow et al. performed a retrospective study based on registries of oncology department and reported gastrointestinal, lung, and breast cancers as most frequently seen cancer types [12]. These studies evaluated patients hospitalized in services; however, our study analyzed cancer patients hospitalized in ICU, and most frequently observed were colorectal, followed by lung and gastric cancers.

Among both male and female patients, most often seen was colorectal cancer (male: 22.94%; female:

22.14%). Lung cancer (21.86%) was second among men, while in women, next most often seen was gastric cancer (16.43%). These findings on cancer patients hospitalized in ICU are consistent with data of the Ministry of Health as well as other studies.

A multicenter study was performed by Taccone et al. with the aim of evaluating characteristics and outcomes of cancer patients hospitalized in European ICUs. From total of 3147 ICU patients, they reported 473 (15%) patients with malignancy and male:female ratio among them of 1.27 [13]. Alici et al. determined male:female ratio of 1.19 (male: 861; female: 723) [11]. In our study we observed that 23.9% of hospitalized ICU patients were cancer patients and male:female ratio of 1.55 (male: 293; female: 189). In parallel with higher frequency of cancer among male patients, dominancy of male gender among cancer patients admitted to our intensive care units is remarkable. Our study also revealed that percentage of cancer patients hospitalized in ICU is significant and should not be underestimated.

Alici et al. reported that among their study participants, 151 (9.53%) were cancer patients aged â&#x2030;Ľ70 years, and 1433 (90.46%) cases were aged <70 years [11]. In our study, 140 (29.04%), cancer patients were aged â&#x2030;Ľ70 years, while 342 (70.95%) patients were younger than 70. These rates suggest that cancer is now detected and treated at an earlier age thanks to development of new diagnostic tools and treatment alternatives.

Laryngeal cancers are most often seen among people aged 45 to 75 years, and male:female ratio is 10:1 [14]. In present study, 15 of 16 patients with laryngeal cancer were male, which is consistent with epidemiological data, and also explains high fold change in laryngeal cancer.

Limitation of this study is single-centered design. It was also blinded to stage, histological type, and other characteristics of cancer cases. Status and ultrastructure of hospital and whether or not cancer center focuses on certain types of cancer will also affect results. Regarding retrospective nature of our study, selection bias may be present.

Aksoy et al., Analysis of cancer patients admitted to intensive care unit

Conclusion In conclusion, cancer is most often observed in older people, and cancer patients generally stay in ICU longer than other, younger patients. Slow improvement in their state of health, and in many cases, advanced age, requires additional workforce. We think that palliative approaches for many advanced cancer patients hospitalized in ICU, rather than interventional therapies, will increase patient satisfaction as well as be more efficient use of ICU resources.

Multicenter, long-term studies should be conducted to further delineate demographic characteristics of cancer patients in ICU. Conflict of Interest: None declared.

Financial Disclosure: The authors declared that this study has received no financial support.

Authorship contributions: Concept – Y.A.; Design – Y.A.; Supervision – Y.A.; Materials – Y.A.; Data collection &/or processing – Y.A.; Analysis and/or interpretation – A.K.; Literature search – O.F.S., C.K.K.; Writing – O.F.S., C.K.K. ; Critical review – Y.A., A.K.

REFERENCES 1. Homburger F, Hayes JA, Pelica W. A guide to general toxicology.

Karger continuing edukation series. Basel, Switzerland. 1983. p.

199.

2. Kutluk T, Kars A. Kanser konusunda genel bilgiler. T.C. Sağlık Bakanlığı Kanser Savaş Daire Başkanlığı. Ankara: Türk Kanser Araştırma ve Savaş Kurumu Yayınları; 1994.

221

3. Parkin DM, Bray F, Ferlay J, Pisani P. Global cancer statistics, 2002. CA Cancer J Clin 2005;55:74–108.

4. Eaton L. World cancer rates set to double by 2020. BMJ 2003;326:728.

5. Pisani P, Parkin DM, Bray F, Ferlay J. Estimates of the worldwide mortality from 25 cancers in 1990. Int J Cancer 1999;83:18–29.

6. Azoulay E, Afessa B. The intensive care support of patients with malignancy: do everything that can be done. Intensive Care Med 2006;32:3–5.

7. Regazzoni CJ, Irrazabal C, Luna CM, Poderoso JJ. Cancer patients with septic shock: mortality predictors and neutropenia.

Support Care Cancer 2004;12:833–9.

8. Regazzoni CJ, Irrazabal C, Luna CM, Poderoso JJ. Cancer patients with septic shock: mortality predictors and neutropenia.

Support Care Cancer 2004;12:833–9.

9. Karabulut B, Uslu R. Kanser epidemiyolojisi, kanser ve palyatif bakım. İzmir: Meta Basım; 2006.

10. http://www.kanser.gov.tr/index.php/daire-faaliyetleri/kanseristatistikleri.html (Available at: August 11, 2015).

11. Alıcı S, İzmirli M, Doğan E. Epidemiologic evaluation of the patients admitted to Department of Medical Oncology, Yüzüncü Yıl University, Medical Faculy. Turk J Oncol 2006;21:87–97.

12. Tan TS, Jatoi A. End-of-life hospital costs in cancer patients: do advance directives or routes of hospital admission make a difference? Oncology 2011;80:118–22.

13. Taccone FS, Artigas AA, Sprung CL, Moreno R, Sakr Y, Vincent JL. Characteristics and outcomes of cancer patients in European ICU’s. Critical Care, 2009; 13: R15 http://ccforum.com/ content/13/1/R15 (Available at: April 25, 2016).

14. Almadori G, Bussu F, Cadoni G, Galli J, Paludetti G, Maurizi M. Molecular markers in laryngeal squamous cell carcinoma: towards an integrated clinicobiological approach. Eur J Cancer 2005;41:683–93.

CASE REPORT

OBSTETRICS&GYNECOLOGY

North Clin Istanb 2016;3(3):222–4 doi: 10.14744/nci.2015.07379

Primary ovarian leiomyoma in a postmenopausal woman: A case report Ilhan Sanverdi,1 Fisun Vural,2 Osman Temizkan,3 Orhan Temel,2 Habibe Ayvaci,1 Pembegul Gunes4 Obstetrics and Gynecology Department, Zeynep Kamil Maternity and Pediatric Research and Training Hospital, Istanbul, Turkey

1

Obstetrics and Gynecology Department, Haydarpasa Numune Training and Research Hospital, Istanbul, Turkey

2

Obstetrics and Gynecology Department, Sisli Hamidiye Etfal Training and Research Hospital, Istanbul, Turkey

3

Obstetrics and Gynecology Department, Haydarpasa Numune Training and Research Hospital, Istanbul, Turkey

4

ABSTRACT Leiomyomas are benign neoplasms that can develop wherever smooth muscle is present. Primary leiomyomas of the ovary originate from smooth muscle cells of ovarian tissue and are rare, solitary tumors. Approximately 70 cases have been reported. They usually present in premenopausal women. The present case is a report of left ovarian leiomyoma in a postmenopausal woman.

Keywords: Adnexal mass; leiomyoma; ovarian cancer; ovarian tumors; solid tumor.

O

varian leiomyoma is very rare, solid tumor of the ovaries. It accounts for 0.5–1% of benign tumors of the ovary. They are benign in nature, but exact diagnosis requires histopathological evaluation and differentiation from other solitary tumors of the ovary, such as fibroma, thecoma, and sclerosing stromal tumor [1]. Approximately 70 cases have been reported. Most cases are asymptomatic, and 80% occur in premenopausal women [2]. The present case is that of a left ovarian leiomyoma: a solitary mass in the adnexal region and normal tumor markers in a woman who had undergone subtotal hysterectomy 16 years earlier. The objective is to discuss differential diagnosis of solid ovarian tumors.

CASE REPORT A 52-year-old woman presented at the clinic with pelvic pain and floating of three months’ duration.

Subtotal hysterectomy had been performed 16 years earlier. There was no history of comorbidities or regular medication use (Gravidity: 1, Parity: 0, Abortion: 1). Transvaginal ultrasonography showed 25×25 mm mass in the cervical region (cervix).

There was solitary tumoral mass in the left adnexal area. Serum tumor markers were normal (β Human chorionic gonadotropin [hCG]: < 1 mIU/mL, cancer antigen [CA]-125: 12 U/mL, CA-15-3: 19 U/ mL, CA-19-9: 5 U/mL, Alpha fetoprotein [AFP]: 1.8 ug/L, Carcinoembryonic antigen [CEA]: 1.2

Received: 14.06.2015 Accepted: 11.11.2015 Online: 04.04.2016 Correspondence: Dr. Fisun VURAL. Tibbiye Cad. No: 40, 34668 Uskudar, Istanbul, Turkey.

Tel: +90 216 542 32 32 e-mail: fisunvural@yahoo.com.tr © Copyright 2016 by Istanbul Northern Anatolian Association of Public Hospitals - Available online at www.kuzeyklinikleri.com

Sanverdi et al., Primary ovarian leiomyoma in a postmenopausal women

223

Figure 1. Whorled fascicles of tumoral proliferation (HE×100). ng/mL, lactic dehydrogenase [LDH]: 193 IU/L).

Complete blood count (CBC) results were: hemoglobin: 12.2 gr/dL, hematocrit: 36%, thrombocyte: 178,000 mm3, white blood count (WBC): 10700 mm3. Pelvic computed tomography (CT) showed solid, smooth contoured mass (60x50x60 mm) located in the left adnexal area. Bilateral oopherectomy was performed. Left site shows the solid mass, frozen section diagnosed leiomyoma.

Pathological Evaluation: The tumor was a whitish-gray, solid mass (55x55 mm) with a smooth sur-

face. Microscopic findings showed whorled interlacing fascicles of smooth muscle cells (leiomyoma).

There was no cytologic atypia, necrosis, or mitosis.

Microscopic view of leiomyoma (HE×100) can be seen in Figure 1. Smooth muscle cells with bundles of elongated cells and spindled nuclei (HE×200) can be seen in Figure 2.

DISCUSSION Since the first report of primary ovarian leiomyomas

Figure 2. Smooth muscle cells with bundles of elongate cells and spindled nuclei (HE×200).

224

in 1862, few additional cases have been reported [2, 3]. Data from prior reports indicate that primary ovarian tumors are benign, unilateral, asymptomatic, less than 3 cm in size, and occur in premenopausal women [1, 2]. In this report, a case of a postmenopausal woman with ovarian leiomyoma is presented.

Leiomyomas are benign neoplasms, and can develop wherever smooth muscle is present. Primary leiomyomas often originate from smooth muscle cells in ovarian tissue. Most accepted theory for the histogenesis of leiomyoma in the ovary is growth of the tumor in smooth muscle cells of the ovarian ligament or smooth muscle fibers of the vascular wall or stroma [3, 4].

Ovarian leiomyomas are usually asymptomatic and are found either during routine physical examination or incidentally at surgery. Abdominal pain is a commonly encountered symptom, and rarely, some women present with elevated cancer antigen (CA)125, hydrothorax, and ascites [1, 5–7]. The present patient presented at the clinic with pelvic pain.

Preoperative evaluation of ovarian solid tumors requires ultrasonography, tumor markers and MRI (magnetic resonance imaging). Ultrasonography shows solid mass isoechoic with myometrium, so it is difficult to distinguish from other solitary tumors or pedunculated myomas. MRI is often a useful adjunct to ultrasonography [7, 8]. Preoperative evaluation of this case included ultrasonography (isoechoic mass in left ovary) and normal serum tumor marker levels. However, precise diagnosis requires histopathologic confirmation. Immunohistochemical markers are helpful in making the distinction between leiomyomas and fibromatous tumors. Desmin shows diffuse positivity in leiomyomas. Actin is positive in both leiomyomas and fibromas, but negative in thecomas [1]. Differential diagnosis includes other solitary tumors of the ovary (fibroma, thecoma, fibrothecoma, cellular fibroma, sclerosing stromal tumors, sex cord-stromal tumors), leiomyomas arising from broad ligament or uterus later becoming parasitic. Primary ovarian myoma should be inside the ovary without coexistent uterine myomas. However, this coexistence has been reported by many researchers [1]. The present

North Clin Istanb

patient had a hysterectomy 16 years previously. Although only some 70 cases have been reported, as a result of incidental findings, the authors believe some cases have gone unreported. Literature indicates that primary ovarian leiomyomas are a benign condition without recurrence, and oophorectomy is the preferred treatment, but in young women, fertility–sparing, minimally invasive procedures should be considered.

In conclusion, primary ovarian leiomyoma is a rare, benign tumor of the ovary. It should be considered in the differential diagnosis of solid tumors of the ovary.

Conflict of Interest: None declared.

Financial Disclosure: The authors declared that this study has received no financial support.

Authorship contributions: Concept – I.S., O.T.; Design – H.A., O.T.; Supervision – O.T., I.S.; Materials – H.A., P.G.; Data collection and/or processing – F.V., I.S.; Analysis and/or interpretation – F.V., P.G.; Literature search – O.T.; Writing – F.V.; Critical review – I.S.

REFERENCES 1. Agrawal R, Kumar M, Agrawal L, Agrawal KK. A huge primary ovarian leiomyoma with degenerative changes-an unusual. J Clin Diagn Res 2013;7:1152–4.

2. Blue NR, Felix JC, Jaque J. Primary ovarian leiomyoma in a premenarchal adolescent: first reported case. J Pediatr Adolesc Gynecol 2014;27:87–8.

3. Tomas D, Lenicek T, Tuckar N, Puljiz Z, Ledinsky M, Kruslin B. Primary ovarian leiomyoma associated with endometriotic cyst presenting with symptoms of acute appendicitis: a case report.

Diagn Pathol 2009;4:25.

4. Khaffaf N, Khaffaf H, Wuketich S. Giant ovarian leiomyoma as a rare cause of acute abdomen and hydronephrosis. Obstet Gynecol 1996;87(5 Pt 2):872–3.

5. Erdemoglu E, Kamaci M, Bayram I, Güler A, Güler Sahin H. Primary giant leiomyoma of the ovary--case report. Eur J Gynaecol Oncol 2006;27:634–5.

6. Taskin MI, Ozturk E, Yildirim F, Ozdemir N, Inceboz U. Primary ovarian leiomyoma: A case report. Int J Surg Case Rep 2014;5:665–8.

7. Kawano Y, Takai N, Shimano M, Nasu K, Miyakawa I. Magnetic resonance imaging findings in leiomyoma of the ovary: a case report. Arch Gynecol Obstet 2006;273:298–300.

8. Güney M, Ozsoy M, Oral B, Mungan T, Kapucuoğlu N. Unilateral primary ovarian leiomyoma in adolescent: a case report.

Arch Gynecol Obstet 2007;275:507–10.

Case Report

THORACIC DISEASES

North Clin Istanb 2016;3(3):225–28 doi: 10.14744/nci.2015.52714

Chylothorax due to tuberculosis lymphadenitis Orkide Kutlu,1 Soner Demirbas,2 Abdullah Sakin3 Department of Internal Medicine, Okmeydani Training and Research Hospital, Istanbul, Turkey

1

Department of Thoracic Medicine, Necmettin Erbakan University Meram Faculty of Medicine, Konya, Turkey

2

Department of Medical Oncology, Okmeydani Training and Research Hospital, Istanbul, Turkey

3

ABSTRACT Chylothorax is a rare clinical condition characterized by high triglyceride and low cholesterol levels in milky pleural aspirate. Generally, it occurs through leakage of chyle as result of trauma or malignancy. Chylothorax due to tuberculous lymphadenitis is very rare clinical condition that has only been documented in a few cases. Although precise pathogenesis is not known, enlarged mediastinal and hilar lymph nodes are thought to be associated with opening of collateral anastomosis between thoracic duct and the azygos and intercostal veins by creating pressure on thoracic duct and cisterna chyli. Presently described is case of chylothorax thought to be due to compression from mediastinal tuberculous lymphadenitis, and which had complete remission after antituberculosis treatment.

Keywords: Chylothorax: lymphadenitis; tuberculosis.

C

hylothorax secondary to tuberculous lymphadenitis is rarely seen condition cited in the literature in only scarce number of case reports [1, 2]. In tuberculosis of mediastinal lymph node, lymph nodes obstruct thoracic duct and/or cisterna chyli or infiltrate these structures, which may lead to increase in pressure inside surrounding lymphatic system and leakage of chylous material into pleural cavity [1–3]. Chylothorax is rarely seen clinical condition characterized by high triglyceride (TG) and low cholesterol levels in milky pleural aspirate.

Generally, it occurs as result of leakage of chyle into pleural cavity in cases of trauma or malignancy involving the thoracic duct. Chyle has bacteriostatic

and non-irritant characteristics, and low potential for development of fibrothorax. Every day, chyle is absorbed from the intestines, passes through cisterna chyli and thoracic duct, and between 1.5 L and 2.5 L of chyle drains into venous system. Therefore, in case of chylothorax, immediately following drainage, drained quantity of chyle may be replenished. Symptoms of chylothorax are almost always related to volume of accumulated fluid. Generally, fever and chest pain are not seen. Chyle does not always resemble milk, and in some cases, it assumes hemorrhagic appearance.

Chyle is primarily made up of 400–6800/mm3 small lymphocytes. Therefore, long-lasting drainage of chyle may lead to T-lymphocyte deficiency [4–6].

Received: March 02, 2015 Accepted: December 25, 2015 Online: January 25, 2017 Correspondence: Dr. Orkide KUTLU. Okmeydani Egitim ve Arastirma Hastanesi, Dahiliye Klinigi, Darulaceze Caddesi, No: 27, 34384 Sisli, Istanbul, Turkey.

Tel: +90 212 - 221 77 77 e-mail: orkidekutlu@windowslive.com © Copyright 2016 by Istanbul Northern Anatolian Association of Public Hospitals - Available online at www.kuzeyklinikleri.com

226

North Clin Istanb

Figure 2. Positron emission tomography.

Figure 1. A dark shadow can be seen, consistent with pleural fluid masking the demarcation line between mediastinum and pleura at the inferior zone of the right lung.

Presently described is case of complete regression of pleural effusion in patient with chylothorax thought to be related to compression from mediastinal tuberculous lymphadenitis.

CASE REPORT Female patient aged 75 years who had no history of chronic disease apart from depression presented at outpatient clinic with complaints of lassitude, loss of appetite, exertional dyspnea for 4 months, and dry coughing for 2 months. Her examination revealed marked decrease in respiratory sounds at basal segments of the right lung. Hematological values, sedimentation, glucose, urea, creatinine, sodium, potassium, total protein, and albumin levels were within normal limits. Levels of alanine aminotransferase (189 U/L), aspartate aminotransferase (113 U/L), cholesterol (251 mg/dL), and lactate dehydrogenase (LDH) (193 U/L) were also measured. Thoracic computed tomography (CT) revealed multiple sites of lymphadenopathy, the largest containing dense calcification 22 mm in size, and marked pleural effusion on the right side. (Figure 1). Milky fluid

with high density sampled from pleural effusion did not precipitate after centrifugation, and contained TG (1072 mg/dL), cholesterol (173 mg/dL), LDH (148 U/L), and albumin (2.7 g/ dL) at indicated concentrations. Sudan staining disclosed presence of fat globules. Lymphocyte dominancy was also detected in pleural fluid.

Sputum ARB -negativity was detected 3 times, and bronchoscopy of the patient did not reveal any endobronchial pathology. Pleural biopsy was performed. Bronchial lavage and bronchoscopic biopsy results indicated benign condition of chronic pleuritis. Positron emission tomography-CT was obtained to rule out mediastinal tumor (Figure 2).

During lymphatic scanning performed to detect etiology of chylothorax, images taken at second, fourth, and sixth hours demonstrated passage of radiographic contrast substance through bilateral inguinal, parailiac, paracaval, and paraaortic lymph nodes, and accumulation of radioactivity in these lymph nodes at popliteal, femoral, and pelvic regions, respectively. On delayed thoracic images, no uptake of radioactivity apart from background activity was observed. Images suggested possible thoracic duct obstruction. Mediastinal lymph node biopsy performed at external center revealed presence of granulomas demonstrating caseous necrosis. Abdominal ultrasound was normal. Antituberculosis treatment was initiated.

Symptoms regressed with treatment, and level of liver enzymes decreased. At sixth month, marked regression in pleural effusion was observed (Figure 3).

Kutlu et al., Chylothorax due to tuberculosis lymphadenitis

Figure 3. Prominent decrease in pleural fluid was observed at sixth month of treatment.

DISCUSSION Chylothorax was first defined by Bartolet in 1633, and the first case was presented by Quinke in 1875.

Trauma is the most frequent cause of chylothorax; however, etiology may also be tumor or other cause may be responsible. Long course of the thoracic duct makes it vulnerable to injury. Chylothorax may occur secondary to mobilization of subclavian vein during cardiovascular, pulmonary, or esophageal surgery. It can also be seen following trauma such as fall from height, motor vehicle accidents, and abdominal and thoracic crush injury. The second most frequently detected cause is malignancy; 75% are due to lymphoma, but bronchogenic carcinoma, and rarely leukemias may also be seen. Many idiopathic cases are thought to occur secondary to minor trauma, such as coughing or hiccupping, or eating fatty foods, or it may be congenital. The fourth category includes vena cava superior or subclavian vein thrombosis, cirrhosis, lymphangioleiomyomatosis (a rarely seen interstitial parenchymal disease), Gorham’s Syndrome, Kaposi’s sarcoma, Castleman’s disease, filariasis, and familial lymphedema, sarcoidosis, radiation-related mediastinal fibrosis, and hypothyroidism [4–7].

227

Literature contains scarce number of cases related to tuberculous lymphadenitis. Kim et al., incubated tuberculosis bacilli in sputum and pleural fluid of a 17-year-old female patient with diffuse nodular opacities in her pulmonary parenchyma multiple necrotic abdominal lymphadenopathies, chylothorax, and chylous ascites. They reported improvement of the patient’s health with antituberculosis treatment, dietary regimen rich in protein but low in fat, and supportive treatment. Hammoumi et al., also reported that they achieved cure with antituberculosis and supportive medical treatment in a patient with chylothorax secondary to mediastinal and abdominal tuberculous lymphadenitis [2, 5].

In our country, Buyuksirin et al., detected growth of M.tuberculosis in chylous pleural aspiration fluid of a 22-year-old female patient who presented with pleural effusion, and achieved favorable response with antituberculosis treatment [8]. We also achieved cure with antituberculosis treatment and further medical care in present case with chylothorax secondary to mediastinal tuberculous lymphadenitis.

Though pathogenesis of chylothorax is not known for sure, it is thought to be associated with compression of cisterna chyli, and thoracic duct by enlarged mediastinal and hilar lymph nodes, and opening of collateral anastomoses between thoracic duct system, azygos, and intercostal veins. With compression exerted by lymph nodes, pressure inside lymphatic system increases with resultant seeping of chyle into pleural cavity [1–4].

The most characteristic finding in diagnosis of chylothorax is level of TG in pleural fluid. Pleural fluid TG level >110 mg/dL, pleural fluid/serum TG ratio >1, but pleural fluid/serum cholesterol ratio <1 establish diagnosis of chylothorax. Pleural fluid TG level <50 mg/dL rules out diagnosis of chylothorax. If pleural fluid TG level is 50–100 mg/dL, then presence of chylomicrons in pleural fluid may establish diagnosis [2, 4–6].

Milky pleural fluid should be discriminated from pseudochylothorax and drainage of empyema or parenteral fluid through subclavian vein into thoracic cavity. Pseudochylothorax is associated with high cholesterol level and induces chronic pleuritis, which is characterized by increase in cholesterol or

North Clin Istanb

228

lecithin-globulin complexes in pleural fluid. It has milky appearance, as in chylothorax; however, it leads chronic clinical course. If, after centrifuging, turbidity of the fluid persists and addition of ethyl ether eliminates turbidity, then diagnosis favors psedochylothorax. Important for this discrimination is that pleural fluid/serum cholesterol ratio should be >1. Empyema develops more frequently as complication of bacterial pneumonia. Fluid may have milky appearance and there may be acute onset, as seen in chylothorax; however, it has strong scent, unlike odorless fluid seen in chylothorax. Different from chylothorax, following centrifuging supernatant portions do not clarify. If parenteral fluid drains into pleural space through subclavian vein, only TG level in fluid increases, while in chylothorax, chylomicrons, TG, and lymphocytes are present. Fluid accumulates at acute onset and precipitation does not occur after centrifugation [4, 6].

In treatment of chylothorax associated with tuberculous lymphadenitis, when necessary, antituberculosis treatment in combination with therapeutic thoracentesis is performed. In case of serious dyspnea, pleuroperitoneal shunt, or drainage with chest tube may be required.

Malnutrition and immunological disorders may manifest in cases with recurrent drainage of pleural fluid. Chyle contains high concentrations of protein, lipid, electrolyte, and lymphocytes. In some case reports, therapeutic use of octreotide has been indicated. In traumatic injury, defect of the thoracic duct generally closes spontaneously; however, if chylothorax persists for longer than 4 weeks, ligation of the thoracic duct during surgical exploration may be considered [1, 2, 4, 7].

Typical appearance of the pleural fluid of our patient, high TG concentration in the sample

obtained from pleural fluid, high pleural fluid/serum TG ratio, and relatively low pleural fluid/serum cholesterol established diagnosis of chylothorax.

Our patient responded to antituberculosis treatment favorably. While analyzing pleural fluid to make diagnosis of chylothorax, tuberculosis should also be considered in differential diagnosis.

Conflict of Interest: None declared.

Financial Disclosure: The authors declared that this study has received no financial support.

Authorship contributions: Concept – O.K.; Design – O.K.; Supervision – O.K.; Materials – O.K., S.D.; Data collection &/or processing – O.K., S.D.; Analysis and/or interpretation – O.K. S.D., A.S.; Literature search – O.K. S.D.; Writing – O.K. S.D.; Critical review – A.S.

REFERENCES 1. Bielsa S, Pardina M, Porcel JM. Chilothorax due to enlarged tuberculosis lymph nodes. BMJ Case Rep 2014.

2. El Hammoumi MM, Drissi G, Achir A, Benchekroun A, Kabiri EH, Benosman A. Spon-taneous bilateral chylothorax revealing a mediastinal and abdominal lymph node tuberculosis. [Article in French] Rev Pneumol Clin 2014;70:173–6. [Abstract] 3. Grobbelaar M, Andronikou S, Goussard P, Theron S, Mapukata A, George R. Chylothorax as a complication of pulmonary tuberculosis in children. Pediatr Radiol 2008;38:224–6.

4. Kant S, Verma SK, Anand SC, Prasad R, Verma RK. Development of bilateral chylothorax in a younger female secondary to tuberculosis. Lung India 2011;28:56–9.

5. Kim KJ, Park DW, Choi WS. Simultaneous chylothorax and chylous ascites due to tuber-culosis. Infect Chemother 2014;46:50–3.

6. Ananthan VS, Siva KK. A rare case of acid-fast bacilli in chylothorax. Lung India 2012;29:166–8.

7. Karapolat S, Sanli A, Onen A. Chylothorax due to tuberculosis lymphadenopathy: report of a case. Surg Today 2008;8:938–41.

8. Büyükşirin M, Konya A, Polat G, Ürpek G, Tibet G. Case of chylothorax due to Mycobac-terium tuberculosis. Toraks Dergisi 2006;7:216–7.

Case Report

OTORHINOLARYNGOLOGY

North Clin Istanb 2016;3(3):229–32 doi: 10.14744/nci.2015.36349

Post-traumatic refractory multiple canal benign paroxysmal positional vertigo: a case report Mehmet Akif Dundar,1 Serhan Derin,2 Mitat Aricigil,1 Mehmet Akif Eryilmaz,1 Hamdi Arbag1 Department of Otolaryngology, Necmettin Erbakan University Faculty of Medicine, Konya, Turkey

1

Department of Otolaryngology, Mugla Sitki Kocman University Faculty of Medicine, Mugla, Turkey

2

ABSTRACT Benign paroxysmal positional vertigo (BPPV) is the most prevalent form of peripheral vertigo and is seen in a significant number of patients who present at neurology and ear, nose, and throat clinics. Various maneuvers may be used to determine the affected canal based on observation of specific nystagmus signs, and may also be used for treatment. Multiple canal pathology can make diagnosis and treatment more difficult. Presently described is case of BPPV with multiple canal pathology and traumatic etiology that was resistant to treatment.

Keywords: Head trauma; multiple canal benign paroxysmal positional vertigo; refractory.

B

enign paroxysmal positional vertigo (BPPV) is the most frequent cause of recurrent vertigo, and one of the most frequently encountered diseases in otolaryngology and neurology clinics [1, 2]. Though most often the posterior semicircular canals are affected, more rarely, the horizontal and anterior canals may be also involved. Multiple canal etiology is detected in 4.6% to 20% of all cases of BPPV [2]. It may be ipsilateral, or both ears may be affected. Since different canals induce various, distinct nystagmus patterns, BPPV can have very different clinical symptomatologies and examination findings. Accurate diagnosis has crucial importance for proper treatment.

CASE REPORT A 33-year-old male patient with history of fall from a balcony presented at the clinic with complaint of dizziness persisting for 2 months. He reported that after the traumatic incident, his left ear bled and he had discharge from left ear during subsequent 1½ months. For approximately 20 days prior to presentation, however, he had not had ear discharge.

Initially, he had severe headache, but severity gradually decreased. Vertigo was provoked by sudden movements, especially when looking upward and to his left. When walking, his eyes drifted to left. He added that hearing acuity of left ear had decreased.

Received: November 09, 2015 Accepted: December 29, 2015 Online: November 27, 2016 Correspondence: Dr. Serhan DERIN. Muga Sitki Kocman Universitesi Tip Fakultesi, Kulak Burun Bogaz Anabilim Dali, Mugla, Turkey.

Tel: +90 252 - 211 48 00 e-mail: serhanderin@yahoo.com.tr © Copyright 2016 by Istanbul Northern Anatolian Association of Public Hospitals - Available online at www.kuzeyklinikleri.com

North Clin Istanb

230

Patient also reported that dizziness was triggered by coughing or straining. Otoscopic examination revealed pale, intact, left tympanic membrane. Right tympanic membrane was normal. Spontaneous, low-amplitude nystagmus involving right side was observed. Supine roll test demonstrated bilateral apogeotropic nystagmus that was more severe on left side. Dix-Hallpike maneuver revealed clockwise nystagmus on left side, while on right side, counterclockwise, upbeating rotational nystagmus was observed. Stepping test with closed eyes and Unterbergerâ&#x20AC;&#x2122;s test revealed deviation to left side. Fistula test yielded negative results. Laboratory tests disclosed bilateral, symmetrical, high-frequency sensorineural hearing loss (SNHL). Video head impulse test did not yield a valid impulse or significant result. On head thrust test, defective vestibulo-ocular reflex was detected. Caloric reflex test revealed decreased lateral canal response on left side.

In the light of available findings, in addition to labyrinthine concussion of the left ear, BPPV originating from bilateral posterior and right horizontal semicircular canals was suggested Ageotropic nystagmus was observed in supine roll test. Nystagmus worsened with left turn of the head, which was evaluated as right lateral canal cupulolithiasis.

For right posterior canal BPPV, Epley maneuver was performed. One day later, barbecue maneuver was performed for treatment of right horizontal canal cupulolithiasis, and Epley maneuver was used for the treatment of the left posterior canal. Complaints of the patient had not regressed at follow-up visit 10 days later, which led to recommendation of Vanucchiâ&#x20AC;&#x2122;s forced prolonged position maneuver to treatment for presence of right lateral canal cupulolithiasis. One week later, regression was still not seen. Habituation exercises, including Brand-Daroff exercises, and rehabilitation were prescribed.

Two months later, spontaneous nystagmus had disappeared, and results of Unterbergerâ&#x20AC;&#x2122;s and stepping tests were within normal limits. Head thrust test revealed active bilateral vestibulo-ocular reflex.

Recovery from paresis of left peripheral vestibular system due to left labyrinthine concussion was observed. However, incidents of positional nystagmus persisted at lower frequency. Clinically, the patient felt better. At follow-up visit 3 months later, disappearance of spontaneous nystagmus was noted, but bilateral apogeotropic nystagmus that was more

severe on left was detected in supine roll test. DixHallpike maneuver induced clockwise and counterclockwise upbeating rotational nystagmus on left and right. Semont maneuver was performed for the right ear. Three days later, Dix-Hallpike maneuver revealed disappearance of nystagmus on right side, but it persisted on left side. Semont maneuver was performed for the left ear. At follow-up 1 week later, patient reported considerable regression of his symptoms. On Dix-Hallpike test, no nystagmus or dizziness was observed. However, supine roll test revealed lingering bilateral apogeotropic nystagmus and dizziness. Three months later, the patient returned due to worsening of his complaints. Supine roll test revealed persistence of apogeotropic nystagmus. Furthermore, bilateral rotational nystagmus, which had disappeared following Semont maneuvers, but was observed on Dix-Hallpike test, recurred at the same severity. It was learned that the patient had not performed his habituation exercises regularly. Semont maneuver was performed for the right and then for the left ear at 3-day intervals. Epley maneuver was used with same 3-day protocol, but no recovery was achieved. It was recommended to patient that he continue his habituation exercises. At final follow-up scheduled 17 months later, otologic pathology with bilateral involvement of 3 semicircular canals persisted.

DISCUSSION BPPV is clinical condition that is result of movements of otoliths in the inner ear triggered by head movements. It usually affects single canal. Symptomatology of BPPV patients consists of rotational, vertigo-like sensation of spinning surroundings, occurring mostly when the patients lie down, turn to one side, or sit up quickly. Sudden head movements can also trigger vertiginous episodes [3]. Rarely, it may affect more than 1 canal and induce complex clinical manifestations [2]. Multi-canal BPPV can involve ipsilateral canals or canals of both ears. In this case, BPPV involved bilateral posterior canals and right horizontal canal. Main etiological factors in cases with multi-canal BPPV are trauma and labyrinthitis [2, 4, 5]. In the present case, clinical manifestations of vertigo began following incident of head trauma 2 months earlier. Odiometric tests disclosed bilateral, symmetric, high-frequency

Dundar et al., Post-traumatic refractory multiple canal benign paroxysmal positional vertigo

SNHL which demonstrated sudden drop at 4 KHz. Left shift in Unterberger’s test and stepping test with closed eyes and typical nystagmus during supine roll and Dix-Hallpike tests were observed.

Intact bone structure, internal ear, and eighth cranial nerve observed on post-traumatic cranial computed tomography and magnetic resonance image ruled out diagnoses of labyrinthitis, vestibular neuritis, and sudden hearing loss. Multiple canal BPPV and labyrinthine concussion of the left ear were suggested.

Duration of nystagmus and vertigo was analyzed, and it was noted that such instances of longer duration are observed in multi-canal etiology [2]. However, nystagmus induced by movements of head can be difficult to interpret.

The most important diagnostic tool for patients with BPPV is specific nystagmus findings obtained with maneuvers directed to specific canal [5–7].

Combination of these findings along with patient’s history increases possibility of making correct diagnosis.

In BPPV series, bilateral posterior canal involvement has been reported in between 6% and 26% of cases [8]. On physical examination, bilateral positive Dix-Hallpike sign is seen. In this case, on right side, counterclockwise, upbeating rotational nystagmus was observed, and clockwise on left side. In DixHallpike test, typically, when patient sits erect from supine position, direction of the rotation is reversed.

Nystagmus is more severe on side of the affected ear.

In evaluation of treatment success, both decrease in the patient’s complaints and negative results in DixHallpike and supine roll tests are important.

It is easier to diagnose canal pathologies with different canal planes whether they involve the same or contralateral side. In mixed-type vertigo, most prevalent combinations seen are posterior and horizontal canal pathologies, as was the case with our patient [1, 2, 4]. In a multicenter study presented

by Leopardi et al., in only 4.4% of BPPV cases were multi-canal etiologies observed, and the authors reported combination of posterior and horizontal canal pathologies as most frequently seen type of BPPV [9].

In a series of 345 cases of BPPV reported by Balatsouras et al., only 32 cases had multi-canal etiology, and 11 of those occurred after a traumatic event

231

[1]. They also detected viral etiologies and chronic otitis as underlying factors.

Therapeutic maneuvers have been defined for each type of BPPV. Principal maneuvers are as follows: Epley and Semont maneuvers are used for posterior canal BPPV, Lempert and barbecue maneuvers for horizontal canal BPPV, and Yacovino maneuver for anterior canal BPPV [2]. In multicanal BPPV, combinations of these maneuvers are applied, and treatment can be challenging. In these cases, treatment should be initiated first for the canal with more numerous symptoms. In our case, since complaints concerning right posterior and right horizontal canal were more intense, we started treatment with Epley maneuver for the right ear, followed by barbecue maneuver the next day.

Multiple canal BPPV requires greater number of sessions and it can be more resistant to treatment.

In present case, despite various maneuvers applied many times, only patient’s complaint of dizziness decreased; complete cure was not achieved.

Conclusion Though cases of multiple canal BPPV are not exceptional, important difficulties remain in clinical diagnosis and treatment. Most often, there is trauma in multi-canal pathology. Accurate analysis of nystagmus findings obtained with provocative tests is important in the selection of correct therapeutic maneuvers. Potential longevity of treatment should also be kept in mind.

Conflict of Interest: None declared.

Financial Disclosure: The authors declared that this study has received no financial support.

Authorship contributions: Concept – M.A.D., H.A., M.A.E.; Design – M.A.D., H.A.; Supervision – M.A.D., H.A.; Materials – M.A.D., M.A.; Data collection &/or processing – M.A.D., M.A.; Analysis and/or interpretation – M.A.E, M.A.E.; Literature search – S.D.; Writing – S.D.; Critical review – M.A.D., H.A.

REFERENCES 1. Balatsouras DG, Koukoutsis G, Aspris A, Fassolis A, Moukos A, Economou NC, et al. Benign Paroxysmal Positional Vertigo Secondary to Mild Head Trauma. Ann Otol Rhinol Laryngol 2017;126:54–60.

2. Shim DB, Song CE, Jung EJ, Ko KM, Park JW, Song MH. Benign paroxysmal positional vertigo with simultaneous in-

232 volvement of multiple semicircular canals. Korean J Audiol 2014;18:126–30.

3. Kim CH, Shin JE, Shin DH, Kim YW, Ban JH. “Light cupula” involving all three semicircular canals: A frequently misdiagnosed disorder. Med Hypotheses 2014;83:541–4.

4. Tomaz A, Ganança MM, Ganança CF, Ganança FF, Caovilla HH, Harker L. Benign paroxysmal positional vertigo: concomitant involvement of different semicircular canals. Ann Otol Rhinol Laryngol 2009;118:113–7.

5. Balatsouras DG, Koukoutsis G, Ganelis P, Korres GS, Kaberos A. Diagnosis of Single- or Multiple-Canal Benign Paroxysmal Positional Vertigo according to the Type of Nystagmus. Int J Otolaryngol 2011;2011:483965.

North Clin Istanb 6. Alessandrini M, Micarelli A, Pavone I, Viziano A, Micarelli D, Bruno E. Persistent benign paroxysmal positional vertigo: our experience and proposal for an alternative treatment. Eur Arch Otorhinolaryngol 2013;270:2769–74.

7. Herdman SJ. Vestibular rehabilitation. Curr Opin Neurol 2013;26:96–101.

8. Pollak L, Stryjer R, Kushnir M, Flechter S. Approach to bilateral benign paroxysmal positioning vertigo. Am J Otolaryngol 2006;27:91–5.

9. Leopardi G, Chiarella G, Serafini G, Pennacchi A, Bruschini L, Brizi S, et al. Paroxysmal positional vertigo: short- and long-term clinical and methodological analyses of 794 patients. Acta Otorhinolaryngol Ital 2003;23:155–60.

CASE REPORT

PM&R

North Clin Istanb 2016;3(3):233–6 doi: 10.14744/nci.2015.71501

Pregabalin-induced hyperprolactinemia in a patient with fibromyalgia: A case report Aslihan Taraktas,1 Nilgun Mesci,2 Gulcan Ozturk,3 Duygu Geler Kulcu,2 Ece Aydog4 Department of Physical Medicine and Rehabilitation, Fatih Sultan Mehmet Training and Research Hospital, Istanbul, Turkey

1

Department of Physical Medicine and Rehabilitation, Haydarpasa Numune Training and Research Hospital, Istanbul, Turkey

2

Department of Physical Medicine and Rehabilitation, Gebze State Hospital, Kocaeli, Turkey

3

Department of Physical Medicine and Rehabilitation, Yeditepe University Hospital, Istanbul, Turkey

4

ABSTRACT Several pharmacological and non-pharmacological modalities have been proposed for the treatment of fibromyalgia syndrome (FMS), a common rheumatic disease. Pregabalin is suggested as a first-step medication for FMS in the newest guidelines. Drowsiness, dizziness, and peripheral edema are well-known side effects of pregabalin; however, mastalgia is rarely seen. Presently described is a case of FMS in a patient who developed mastalgia and hyperprolactinemia (HPL) while taking pregabalin.

Keywords: Fibromyalgia; hyperprolactinemia; neuropathic pain; pregabalin.

F

ibromyalgia syndrome (FMS) causes widespread pain and is often accompanied by fatigue, tenderness, memory problems and sleep disturbances. It affects 2–4% of the population. According to the American College of Rheumatology (ACR) FMS 1990 criteria, widespread pain lasting at least 3 months, and 11 of 18 positive tender points are necessary for the diagnosis [1]. In 2011, the ACR recommended new modified diagnostic criteria for FMS (2011 ModCr). New criteria consist of 19 objective pain locations in addition to 6 self-reported symptoms (impaired sleep, fatigue, poor cognition, headaches, depression and abdominal pain) [2]. Diagnosis is based on widespread pain

index (WPI) and symptom severity (SS) scores of 3–6 WPI and ≥9 SS or ≥7 WPI and ≥5 SS. The etiopathophysiology of FMS is still unknown; however, neuroendocrine, autonomic, immunological mechanisms, genetic and environmental factors have been suspected. Recent research has supported the role of central sensitization mechanism and involves new treatment options [3]. Pregabalin, one of the first-step drugs for the treatment of neuropathic pain, has also been used for the treatment of FMS in recent years [4, 5]. This case report discusses a patient with FMS who developed mastalgia and hyperprolactinemia (HPL), believed to be side effects of pregabalin.

Received: 17.06.2015 Accepted: 28.10.2015 Online: 04.04.2016 Correspondence: Dr. Aslıhan TARAKTAS. Fatih Sultan Mehmet Egitim ve Arastirma Hastanesi, Fiziksel Tip ve Rehabilitasyon Klinigi, Istanbul, Turkey Tel: +90 216 578 31 00 e-mail: aslihantaraktas@gmail.com © Copyright 2016 by Istanbul Northern Anatolian Association of Public Hospitals - Available online at www.kuzeyklinikleri.com

234

CASE REPORT A 32-year-old female patient with symptoms of widespread pain, fatigue and sleep problems presented at the outpatient clinic one year ago. She did not have a history of chronic disease or any medication use. Physical examination indicated that range of motion of spine and peripheric joints were not limited and painful. There were no pathological findings in the neurological examination. She had 11 positive tender points (according to ACR 1990 FMS classification criteria) and her WPI and SS scores were 9 and 5, respectively.

Routine laboratory tests (hemoglobin [Hgb]: 13.3 g/dL, aspartate aminotransferase [AST]: 22 U/L, alanine aminotransferase [ALT]: 18 U/L, creatinine: 0.49 mg/dL, thyroid stimulating hormone [TSH]: 0.707uIU/mL, sedimentation: 14 mm/h and C-reactive protein: 5 mg/L) were in normal ranges. With these findings, she was diagnosed with FMS according to 2011 ModCr and ACR 1990 criteria.

Pregabalin was prescribed with a dosage of 75 mg/day to be taken at night for the first three days.

The dosage was then increased to 75 mg twice a day for 1 week. During this period, the patient complained of drowsiness and dizziness; however, the effects were not severe enough to require discontinuing the medication. In the second week, the pregabalin dose was 150 mg twice a day. Patient began to tolerate the drug well. During treatment period of 1 year, follow-up examinations were conducted at 3-month intervals. Over the course of the year, intensity of symptoms decreased. Patientâ&#x20AC;&#x2122;s visual analog scale pain score and fibromyalgia impact questionnaire score decreased from 8 to 4 and from 50 to 33, respectively, over time. Patient was also asked about drug side effects, such as vertigo, drowsiness, dry mouth, and weight gain.

In her last examination, one year after the prescription, the patient complained of mastalgia and tenderness in her breasts without galactoria. Gynecology and endocrinology departments were consulted.

Laboratory test results were as follows: serum

North Clin Istanb

prolactin (PRL): 54.2 ng/mL (3.2â&#x20AC;&#x201C;26), TSH: 1.45IU/mL, serum B12 vitamin: 223pg/mL, erythrocyte sedimentation rate: 22 mmHg/h, serum dehydroepiandrosterone sulphate (DHEA-S): 556 mg/dL, serum follicle stimulating hormone (FSH): 7.44, serum luteinizing hormone (LH): 11.35 IU/L, serum estradiol: 37 pg/mL, fasting blood sugar: 100 mg/dL, and serum insulin: 4.8IU/mL. Breast ultrasound and cranial magnetic resonance imaging (MRI) showed no abnormality.

HPL etiology was not observed; therefore HPL was considered a side effect of pregabalin. Accordingly, use of pregabalin was ceased. It was explained to the patient that after stopping the medication, the complaints might resolve themselves over time.

However, the patient did not want to wait for her complaints to resolve in time, and so kebergolin 0.5 mg/day for one week was prescribed. After one week of use, PRL value decreased to 2.44 ng/mL and breast tenderness and mastalgia complaints were completely resolved. As patient did not want to use any further medication, an exercise and physical therapy program was scheduled.

DISCUSSION FMS is a multifactorial disease of unknown etiology with several contributing factors. These include hormones, immune system, external stressors, psychiatric aspects, and dysfunction of central and autonomic nervous systems [5]. Recent studies suggest that FMS is a neurosensitive disorder characterized by abnormal processing of pain. However, etiopathogenesis is related to central nerve system changes and central sensitization. Various neurotransmitters (i.e., serotonin, norepinephrine, dopamine, substance P) seem to be involved in central sensitization [5].

There are various pharmacological treatment recommendations for FSM. European League Against Rheumatism (EULAR) primarily advises the use of pregabalin, duloxetine, and amitriptyline.

Guidelines suggest pregabalin in first-line treatment [4, 5].

In cases of FMS, voltage-sensitive calcium channels remain open longer, an effect of an increase in

Taraktas et al., Pregabalin induced hyperprolactinemia in a patient with fibromyalgia

the number of alpha 2-delta subunits. This causes greater glutamate release in presynaptic gap and increase in superficial dorsal root neurons excitability.

Therefore, pregabalin can be used to treat FMS. Pregabalin is a medication that is structurally analogous to gamma-amino butyric acid (GABA).

It is usually prescribed for chronic pain syndromes such as postherpetic neuralgia, diabetic and peripheric neuropathic pain, partial seizures, sleep disorders, anxiety disorders, and fibromyalgia [6].

Pregabalin, an alpha 2 delta Ca channel ligand, has analgesic, anxiolytic and anticonvulsive properties. Being a calcium channel antagonist, it decreases the release of many neurotransmitters such as substance P, norepinephrine, and glutamate [6–8].

Common adverse effects of pregabalin include dizziness, vertigo, nausea, vomiting, hypotension, headache, hallucinations, fatigue, cognitive impairment, drowsiness, and peripheric edema [9]. Constipation, rhabdomyolysis, hypersensitivity reaction, akathisia, urticaria, and mastalgia are rarely encountered adverse effects and provided as prospectus information. In the present case, HPL, identified as a rare premarketing side effect that has not been reported in the literature, was observed [10].

HPL is a common disorder of pituitary gland that may occur for various reasons. The most frequent cause is PRL-secreting tumors. Before examining for pituitary tumors as part of differential diagnosis, pregnancy, primary hypothyroidism, liver or renal failure, polycystic ovary syndrome, and medication should be considered. In the present case, gynecology and endocrinology departments were consulted in order to analyze those etiologic factors. According to results of physical examinations, laboratory tests and MRI findings, the patient’s HPL was thought to be drug-induced. Medications are the most frequent cause of non-tumoral HPL. In the case of drug-induced HPL, PRL levels range from 25 to 100 ng/mL, similar to the present patient’s PRL level [11, 12].

The results of laboratory and diagnostic tests were in normal range. Thus, HPL may have been induced by medication. In the literature, several drugs

235

are reported to cause HPL, such as antipsychotics, antidepressants (e.g., tricyclic and tetracyclic selective serotonin reuptake inhibitors [SSRIs]), opiates, antihypertensive medications (verapamil, methyldopa, reserpine), gastrointestinal medications (metoclopramide, domperidone, histamine receptor blockers) and estrogens [13].

Dopamine (prolactin inhibiting factor [PIF]) is the most important hypothalamic-inhibiting factor of PRL. It binds to the D2 receptor, affecting lactotroph (unique among endocrine cells in having a high basal secretory activity, and which are located in the anterior pituitary gland) cell membranes.

This activation causes suppression of the PRL gene expression and inhibition of PRL exocytosis; first, inhibition of adenylyl cyclase and inositol phosphate metabolism, then modification/alteration of several potassium and calcium channels [14].

Antipsychotics like phenothiazines (chlorpromazine-fluphenazine), thioxanthenes (thiothixene), and butyrophenones (haloperidol) block dopamine and can lead to development of HPL. In addition, gastrointestinal medications used to increase gastrointestinal motility may cause HPL in the same way, by blocking dopamine receptors. Most evidence suggests that opioid peptides do not directly affect the pituitary gland and stimulate PRL release by inhibiting hypothalamic dopamine secretion [13].

Among antihypertensive medications, only verapamil raises prolactin levels. Kelley et al., researched the mechanism of this effect of verapamil, a calcium channel blocker. Researchers concluded that verapamil decreases central dopamine generation, perhaps through N-type calcium channels [15].

Several peptides or neurotransmitters, such as serotonin, oestrogens, tachykinins (substance P, neurokinin A-B and neuropeptide K), Gonadotropin-releasing hormone associated peptide (GAP), opioids (especially ß-endorphins), histamine and GABA can also affect the modulation of PRL secretion [11].

GABA, a neurotransmitter secreted mostly in the hypothalamus, has a mostly inhibiting effect.

GABA modulates secretion of pituitary hormones through dopaminergic tone or influence on the an-

236

terior pituitary cells. Stimulation of GABA-A and GABA-B receptor decreases PRL secretion; however, Nakayama et al., reported that GABA-C receptor activation led to an increase in PRL levels in cultured rat anterior pituitary cells [16].

Pregabalin is an analog of GABA, but it shows no effect on GABA receptors. Activation mechanism is disclosed with calcium channel blocking.

Though it cannot be precisely explained how pregabalin induced HPL in the present case, only the use of pregabalin accounts for its occurrence.

In conclusion, this is the first case report demonstrating HPL due to pregabalin usage. Although it has been identified as a premarketing adverse side effect, there is no recent case report in the literature.

As it is a very rare side effect, in clinical practice, mastalgia is generally not questioned, though the most frequent side effects are routinely questioned.

Based on this case report, when pregabalin is used, the authors suggest professionals also inquire about breast tenderness. Further studies should focus on the effects of pregabalin use on prolactin levels.

Conflict of Interest: None declared.

Financial Disclosure: The authors declared that this study has received no financial support.

Authorship contributions: Concept – A.T., N.M., D.G.K.; Design – A.T., N.M., D.G.K.; Supervision – D.G.K; Data collection and/or processing – A.T., G.O.; Analysis and/or interpretation – A.T., N.M., G.O., D.G.K, E.A; Literature search – A.T.; Writing – A.T., D.G.K; Critical review – D.G.K., E.A.

REFERENCES 1. Wolfe F, Smythe HA, Yunus MB, Bennett RM, Bombardier C, Goldenberg DL, et al. The American College of Rheumatology 1990 Criteria for the Classification of Fibromyalgia. Report of the Multicenter Criteria Committee. Arthritis Rheum 1990;33:160–72.

2. Wolfe F, Clauw DJ, Fitzcharles MA, Goldenberg DL, Häuser W, Katz RS, et al. Fibromyalgia criteria and severity scales for clinical and epidemiological studies: a modification of the ACR Preliminary Diagnostic Criteria for Fibromyalgia. J Rheumatol

North Clin Istanb 2011;38:1113–22.

3. Yunus MB. Central sensitivity syndromes: a new paradigm and group nosology for fibromyalgia and overlapping conditions, and the related issue of disease versus illness. Semin Arthritis Rheum 2008;37:339–52.

4. Ablin J, Fitzcharles MA, Buskila D, Shir Y, Sommer C, Häuser W. Treatment of fibromyalgia syndrome: recommendations of recent evidence-based interdisciplinary guidelines with special emphasis on complementary and alternative therapies. Evid Based Complement Alternat Med 2013;2013:485272.

5. Bellato E, Marini E, Castoldi F, Barbasetti N, Mattei L, Bonasia DE, et al. Fibromyalgia syndrome: etiology, pathogenesis, diagnosis, and treatment. Pain Res Treat 2012;2012:426130.

6. Bockbrader HN, Wesche D, Miller R, Chapel S, Janiczek N, Burger P. A comparison of the pharmacokinetics and pharmacodynamics of pregabalin and gabapentin. Clin Pharmacokinet 2010;49:661–9.

7. Gee NS, Brown JP, Dissanayake VU, Offord J, Thurlow R, Woodruff GN. The novel anticonvulsant drug, gabapentin (Neurontin), binds to the alpha2delta subunit of a calcium channel. J Biol Chem 1996;271:5768–76.

8. Fink K, Dooley DJ, Meder WP, Suman-Chauhan N, Duffy S, Clusmann H, et al. Inhibition of neuronal Ca(2+) influx by gabapentin and pregabalin in the human neocortex. Neuropharmacology 2002;42:229–36.

9. Salinsky M, Storzbach D, Munoz S. Cognitive effects of pregabalin in healthy volunteers: a double-blind, placebo-controlled trial. Neurology 2010;74:755–61.

10. GD-pregabalin (pregabalin) Product Monograph. Pfizer Canada Inc. 2013:1–63.

11. Kabalak T, Yılmaz C, Tuzun M. Endokrinoloji. El Kitabı, Izmir: Güven Kitabevi; 2004. s. 61–92.

12. Erem C, Civan N, Nuhoğlu İ. Causes and Differential Diagnosis of Hyperprolactinemia. Turkiye Klinikleri J Endocrin-Special Topics 2012;5:10–21.

13. Molitch ME. Medication-induced hyperprolactinemia. Mayo Clin Proc 2005;80:1050–7.

14. López Román J, Martínez Gonzálvez AB, Luque A, Pons Miñano JA, Vargas Acosta A, Iglesias JR, et al. The effect of a fibre enriched dietary milk product in chronic primary idiopatic constipation. Nutr Hosp 2008;23:12–9.

15. Kelley SR, Kamal TJ, Molitch ME. Mechanism of verapamil calcium channel blockade-induced hyperprolactinemia. Am J Physiol 1996;270(1 Pt 1):96–100.

16. Nakayama Y, Hattori N, Otani H, Inagaki C. Gamma-aminobutyric acid (GABA)-C receptor stimulation increases prolactin (PRL) secretion in cultured rat anterior pituitary cells. Biochem Pharmacol 2006;71:1705–10.

CASE REPORT

GENERAL SURGERY

North Clin Istanb 2016;3(3):237–9 doi: 10.14744/nci.2016.21043

A serious conundrum for surgeons: Stump appendicitis Mehmet Fatih Ekici,1 Zulfu Bayhan,2 Sezgin Zeren,2 Bercis Imge Ucar,2 Mehmet Korkmaz,2 Ayse Nur Deger4 Department of General Surgery, Evliya Celebi Training and Research Hospital, Kutahya, Turkey

1

Faculty of Medicine, Department of General Surgery, Dumlupınar University, Kutahya, Turkey

2

Faculty of Medicine, Department of Radiology, Dumlupınar University, Kutahya, Turkey

3

Faculty of Medicine, Department of Pathology, Dumlupınar University, Kutahya, Turkey

4

ABSTRACT Stump appendicitis is an acute inflammation of remnant appendix, a rare complication of incomplete appendectomy.

It may present as acute abdomen with history of appendectomy, which may cause delay in diagnosis. Therefore, incomplete appendectomy should be considered as a differential diagnosis of acute abdomen in patients with medical history of appendectomy. The present case is one of stump appendicitis 6 months after appendectomy. Stump appendectomy was performed and the patient was discharged 7 days after the operation without any complication.

Keywords: Acute abdomen; delayed surgery; stump appendicitis.

A

ppendectomy is the most common emergency surgical intervention in abdominal surgery.

Stump appendicitis is a rare condition characterized by inflammation of the remnant appendix tissue left behind after appendectomy, first published by Rose in 1945 [1, 2]. The stump may pose a serious diagnostic conundrum if the surgeon is unaware of this uncommon phenomenon. A history of appendectomy can cause delay in diagnosis and may increase morbidity [2].

CASE REPORT A 26-year-old man was admitted to the emergency department with a 24-hour history of diffuse ab-

dominal pain that had started in the epigastric area, then localized at the right lower quadrant (RLQ), followed by nausea and vomiting.

Six months earlier, he had undergone an open appendectomy due to appendicitis. Physical examination revealed a McBurney incision scar. Tenderness and rebound tenderness were noted in the RLQ during palpation. White blood cell (WBC) count was 17400 cells/mm3 with a neutrophil percentage of 78%, whereas C-reactive protein (CRP) was in normal reference ranges. Contrast-enhanced computed tomography (CECT) scan of abdomen and pelvis showed pericecal free pelvic fluid, cecal inflammation and inflammatory changes in the

Received: 18.08.2015 Accepted: 24.01.2016 Online: 04.04.2016 Correspondence: Dr. Mehmet Fatih EKICI. Genel Cerrahi Klinigi, Evliya Celebi Egitim Arastirma Hastanesi, 43000 Kutahya, Turkey.

Tel: +90 274 742 31 66 e-mail: mfatihekici@gmail.com © Copyright 2016 by Istanbul Northern Anatolian Association of Public Hospitals - Available online at www.kuzeyklinikleri.com

238

North Clin Istanb

operative day. Histopathological examination confirmed stump appendix 5 cm in size with features of local peritonitis (Figure 2).

DISCUSSION

Figure 1. Yellow arrow: Periceceal free pelvic fluid, cecal inflammation; red arrow: Right lower quadrant with a dilated tubular structure (stump appendicitis).

RLQ with a dilated tubular structure extending from the base of the cecum (Figure 1).

The patient underwent emergency surgery for acute abdomen. Laparotomy was performed through lower midline incision. Purulent fluid and severe adhesions in the right iliac fossa were observed. After adhesiolysis, a remnant suppurative appendiceal stump 5 cm. in size was noted. The appendicular stump had not been inverted in the previous surgery. Stump appendectomy was performed. The postoperative period was uneventful and the patient was discharged on the seventh post-

Figure 2. On surface epithelium ulceration, all the layers of appendix wall leukocyte infiltration (Hematoxylin and Eosin Ă&#x2014;100).

Most patients diagnosed with stump appendicitis present with typical symptoms and findings of acute appendicitis, including pain that starts periumbilically and migrates to the RLQ with anorexia, nausea and vomiting [3]. Leukocyte count and CRP levels are usually found to be elevated. Tomography scan is more useful than ultrasound to diagnose stump appendicitis, as ultrasonographic findings are not characteristic [2, 4]. CECT scan can reveal findings that support the diagnosis of stump appendicitis, such as inflammatory changes in pericecal region, thickening of cecal wall, abscess formation, presence of fluid in right paracolic area, and air-filled tubular structure [5, 6]. Tomography scan not only confirms stump appendicitis but also excludes other differential diagnoses [4].

Clinical diagnosis of stump appendicitis may be difficult due to underlying conditions like mental retardation, pregnancy, immune suppression and steroid use. Medical history of appendectomy can also lead to delay or even missed diagnosis of stump appendicitis. Therefore, stump appendicitis should be considered in differential diagnosis of patients with acute abdomen indication, appendectomy or McBurneyâ&#x20AC;&#x2122;s incision scar [7].

Cecal diverticulitis should also be considered in differential diagnosis of stump appendicitis since cecal diverticulitis is clinically indistinguishable from acute appendicitis. It has been reported that almost 70% of patients with cecal diverticulitis underwent surgery based on preoperative diagnosis of acute appendicitis, and correct preoperative diagnosis was made in only 5.3% of 318 patients [8]. It is also reported that time interval from initial appendectomy to stump appendectomy may vary from 2 months to 50 years [1, 9]. In the present case, stump appendicitis developed 6 months after first appendectomy.

Rate of perforation for stump appendicitis (detected during surgery) approaches 68% and length of hospital stay increases due to delayed diagnosis

Ekici et al., Stump appendicitis

[2]. Stump length varied between 0.5 and 5.1 cm in patients diagnosed with stump appendicitis. Appropriate stump length to be left after appendectomy is 3–5 mm to prevent stump appendicitis [10].

Incidence and prevalence of stump appendicitis have increased in recent years. Stump appendicitis has been reported after both open and laparoscopic appendectomy; there is very little difference between various surgical techniques in terms of increase in incidence of stump appendicitis [11]. In both open and laparoscopic appendectomy, optimal visualization of base of appendix is necessary to minimize incidence of stump appendicitis. A longer stump can be obstructed with fecalith, which may lead to chronic inflammation causing ischemia of appendiceal wall and eventually perforate and/or suppurate [12]. While some authors do not support this idea, incidence of stump appendicitis has increased relative to the increase of laparoscopic appendectomy [13]. In an open or laparoscopic approach, careful appendix artery dissection of taenia coli reduces possibility of leaving a long stump. Appendiceal cecal junction identification is very important, especially for subserous appendix [14]. In the present case, retrospective examination of patient’s medical records of first appendectomy revealed multiple abscesses and adhesions in right iliac fossa (RIF).

Simple ligation was performed.

It is important to understand that a history of appendectomy is, by itself, insufficient to exclude diagnosis of appendicitis. Presence of McBurney scar may be a warning for surgeons to consider stump appendicitis during an emergency examination.

Identification of appendiceal base by tracing taenia coli to appendix is very important to prevent stump appendicitis. Appendiceal stump of less than 5 mm in length can minimize incidence of stump appendicitis. Careful evaluation of clinical and computed tomography (CT) scan findings may prevent delay in diagnosis, and decrease morbidity and length of hospital stay.

239 Conflict of Interest: None declared.

Financial Disclosure: The authors declared that this study has received no financial support.

Authorship contributions: Concept – M.F.E., Z.B.; Design – M.F.E., S.Z.; Supervision – M.K., B.I.U.; Data collection – M.F.E., A.N.D.; Analysis – S.Z., Z.B.; Literature search – M.F.E., B.I.U.; Writing – M.F.E., S.Z.; Critical review – M.K., A.N.D.

REFERENCES 1. Aydın A, Buluş H, Yavuz A, Akkoca M, Coşkun A. A rare case report: Stump appendicitis. Turkish J Surg 2012;28:156–8.

2. Önder A, Kapan M, Böyük A, et al. Stump Appendicitis After Appendectomy. Turkish Dis Col Rec 2010;20:188–91.

3. Roberts KE, Starker LF, Duffy AJ, Bell RL, Bokhari J. Stump appendicitis: a surgeon’s dilemma. JSLS 2011;15:373–8.

4. Uludag M, Isgor A, Basak M. Stump appendicitis is a rare delayed complication of appendectomy: A case report. World J Gastroenterol 2006;12:5401–3.

5. Sharma M, Agrawal A. Pictorial essay: CT scan of appendicitis and its mimics causing right lower quadrant pain. Indian J Radiol Imaging 2008;18:80–9.

6. Truty MJ, Stulak JM, Utter PA, Solberg JJ, Degnim AC. Appendicitis after appendectomy. Arch Surg 2008;143:413–5.

7. Menteş O, Zeybek N, Oysul A, Onder SC, Tufan T. Stump appendicitis, rare complication after appendectomy: report of a case. Ulus Travma Acil Cerrahi Derg 2008;14:330–2.

8. Lane JS, Sarkar R, Schmit PJ, Chandler CF, Thompson JE Jr. Surgical approach to cecal diverticulitis. J Am Coll Surg 1999;188:629–35.

9. Salehi H, Anjamrooz SH. Successfully treated stump appendicitis diagnosed by CT and ultrasonography. Indian J Surg 2008;70:89–91.

10. Erzurum VZ, Kasirajan K, Hashmi M. Stump appendicitis: a case report. J Laparoendosc Adv Surg Tech A 1997;7:389–91.

11. Kumar A, Sharma A, Khullar R, Soni V, Baijal M, Chowbey PK. Stump appendicitis: A rare clinical entity. J Minim Access Surg 2013;9:173–6.

12. Özden İ, Özkan E. Internal herniation due to a long appendiceal stump. J Istanbul Med Fac 2000;63:80–1.

13. Awe JA, Soliman AM, Gourdie RW. Stump appendicitis: an uncompleted surgery, a rare but important entity with potential problems. Case Rep Surg 2013;2013:972596.

14. Constantin V, Popa F, Carâp A, Socea B. Stump appendicitis an overlooked clinical entity. Chirurgia (Bucur) 2014;109:128– 31.

North Clin Istanb

240

NORTHERN CLINICS OF ISTANBUL SUBJECT INDEX FOR VOLUME 3 (2016) Acrocephalosyndactyly see 2016;3(2):135–9 Acute abdomen see 2016;3(3):237–9 Acute appendicitis see 2016;3(1):60–3 Adenovirus see 2016;3(2):140–2 Adnexal mass see 2016;3(3):222–4 Agenesis see 2016;3(2):146–9 Anesthetic considerations see 2016;3(2):97–103 Anthropometric measurements see 2016;3(2):124–30 Anti-Mullerian hormone (AMH) see 2016;3(2):90–6 Antioxidant see 2016;3(2):83–9 Aorta-coronary bypass see 2016;3(1):27-33 APACHE II see 2016;3(3):175–82 Apert syndrome see 2016;3(2):135–9 Appendectomy see 2016;3(1):60–3 Arthritis see 2016;3(2):131–4

Correlation see 2016;3(3):201–8 Craniosynostosis see 2016;3(2):135–9 Craniotabes see 2016;3(1):15-21 Crohn’s disease see 2016;3(3):183–86 CT angiography see 2016;3(1):64–6

Immunohistochemistry see 2016;3(1):67–70 Immunohistochemistry see 2016;3(3):161–67 In vitro fertilization see 2016;3(2):90–6 Incidental parathyroidectomy see 2016;3(1):9–14 Infertility see 2016;3(2):90–6 Intensive care unit see 2016;3(3):217–21 Intestinal obstruction see 2016;3(1):75-8 Intracerebral calcification see 2016;3(1):71-4 Intrathecal see 2016;3(1):53–9

Delayed surgery see 2016;3(3):237–9 Depression see 2016;3(2):118–23 Diabetes mellitus see 2016;3(1):34–8 Diabetes see 2016;3(2):83–9 Diaphragm see 2016;3(2):146–9 Duodenal diverticulum see 2016;3(2):143–5 Laparoscopic appendectomy Duodenum see 2016;3(2):143–5 see 2016;3(1):60–3 Laparoscopic see 2016;3(2):146–9 Elderly see 2016;3(3):183–86 Larynx see 2016;3(1):67–70 Epilepsy see 2016;3(1):71-4 Leiomyoma see 2016;3(3):222–4 Epilepsy see 2016;3(3):161–67 Lymphadenitis see 2016;3(3):225–28 ERCP see 2016;3(2):104–10 Esophageal varices see 2016;3(1):46-52 Malignancy see 2016;3(3):217–21 Beck see 2016;3(2):118–23 Extrapulmonary tuberculosis see 2016;3(2):150–55 Malnutrition see 2016;3(2):124–30 Biliary fistula see 2016;3(2):104–10 Fahr’s syndrome see 2016;3(1):71-4 MDA see 2016;3(2):83–9 Bladder volume see 2016;3(3):209–16 Fertilization see 2016;3(2):90–6 Migraine see 2016;3(1):1-8 Blink reflex see 2016;3(1):1-8 Fetus see 2016;3(1):60–3 Mirtazapine see 2016;3(1):53–9 Bone mineral density see 2016;3(3):201–8 Fibromyalgia see 2016;3(3):233–6 Misdiagnosis see 2016;3(1):64–6 Finger see 2016;3(1):22-6 Morphine see 2016;3(1):53–9 Cancer see 2016;3(3):217–21 Flow-mediated dilatation MQSGA see 2016;3(2):124–30 Caregiver see 2016;3(2):118–23 Multiple canal benign paroxysmal positional Carotid body tumors see 2016;3(2):97–103 see 2016;3(1):39–45 Follicle-stimulating hormone (FSH) vertigo see 2016;3(3):229–32 CAT see 2016;3(2):83–9 see 2016;3(2):90–6 Myasthenia gravis see 2016;3(3):194–200 Cervical tuberculous lymphadenitis see 2016;3(2):150–55 Follicular fluid see 2016;3(2):90–6 Child see 2016;3(2):131–4 Neuropathic pain see 2016;3(3):233–6 Cholecystectomy see 2016;3(2):146–9 Gabapentin see 2016;3(1):53–9 Newborn see 2016;3(1):15-21 Chromatography see 2016;3(2):156–60 GAERS see 2016;3(3):161–67 Newborn see 2016;3(1):75-8 Chronic hepatitis B see 2016;3(3):168–74 Gamma-aminobutyric acid Non-alcoholic fatty liver disease see 2016;3(3):161–67 see 2016;3(2):111–7 Chronic inflammatory disease see 2016;3(1):39–45 Gastric varices see 2016;3(1):46-52 Nursing care see 2016;3(3):187–93 Chylothorax see 2016;3(3):225–28 Geriatric see 2016;3(2):124–30 Nursing services see 2016;3(3):187–93 Cirrhosis see 2016;3(1):46-52 Glomus tumors see 2016;3(2):97–103 Cirrhosis see 2016;3(3):168–74 Ondansetron see 2016;3(1):53–9 Clinic see 2016;3(1):79–82 HBeAg seroconversion see 2016;3(3):168–74 Ovarian cancer see 2016;3(3):222–4 Clinical features see 2016;3(3):183–86 Head trauma see 2016;3(3):229–32 Ovarian tumors see 2016;3(3):222–4 Clinical pregnancy see 2016;3(2):90–6 Headache see 2016;3(1):1-8 Column chromatography Healthy see 2016;3(2):111–7 Percutaneous coronary intervention see 2016;3(2):156–60 see 2016;3(1):27-33 Hemodialysis see 2016;3(2):124–30 Complex regional pain syndrome Perforation see 2016;3(2):143–5 HLA-DPA1 see 2016;3(3):168–74 see 2016;3(2):131–4 Pertussis-like syndrome see 2016;3(2):140–2 Home care see 2016;3(2):118–23 Complimentary medicine see 2016;3(1):34–8 Hyperleucocytosis see 2016;3(2):140–2 Platelet count see 2016;3(1):46-52 Congenital band compression Pleomorphic adenoma see 2016;3(1):67–70 Hyperprolactinemia see 2016;3(3):233–6 see 2016;3(1):75-8 Postoperative bile leakage Hypocalcemia see 2016;3(1):9–14

NCI Index of Vol. 3

see 2016;3(2):104–10 Postoperative urinary retention see 2016;3(3):209–16 Pregabalin see 2016;3(3):233–6 Pregnancy see 2016;3(1):60–3 Prevalence see 2016;3(2):111–7 Procalcitonin see 2016;3(3):175–82 Protein purification see 2016;3(2):156–60 Pruritus see 2016;3(1):53–9 Psoriasis see 2016;3(1):79–82 Readmission see 2016;3(1):27-33 Refractory see 2016;3(3):229–32 Regression see 2016;3(3):201–8 Regulation of glucose see 2016;3(1):34–8 Rehabilitation see 2016;3(1):22-6

241 Reliability and validity see 2016;3(3):187–93 Transesophageal echocardiography Replantation see 2016;3(1):22-6 see 2016;3(1):64–6 Treatment response see 2016;3(3):168–74 Sepsis see 2016;3(3):175–82 Triglyceride/high-density lipoprotein-cholesSIRS see 2016;3(3):175–82 terol ratio see 2016;3(1):39–45 Solid tumor see 2016;3(3):222–4 Tuberculosis see 2016;3(2):150–55 Spinal anesthesia see 2016;3(3):209–16 Tuberculosis see 2016;3(3):225–28 Spleen diameter see 2016;3(1):46-52 Type A aortic dissection see 2016;3(1):64–6 sTREM-1 see 2016;3(3):175–82 Stump appendicitis see 2016;3(3):237–9 Ultrasonography see 2016;3(2):111–7 Ultrasound see 2016;3(3):209–16 T-score see 2016;3(3):201–8 Unilateral see 2016;3(2):146–9 Therapy see 2016;3(1):79–82 Thymectomy see 2016;3(3):194–200 Viscum album see 2016;3(2):83–9 Thymoma see 2016;3(3):194–200 Vitamin D deficiency see 2016;3(1):15-21 Thyroidectomy see 2016;3(1):9–14

NORTHERN CLINICS OF ISTANBUL AUTHOR INDEX FOR VOLUME 3 (2016) Abuoglu HH (see Gulmez M et al.) 2016;3(2):143–5 Aciksari G (see Keles N et al.) 2016;3(1):39–45 Akansel S (see Sargin M et al.) 2016;3(1):27-33 Akbal N (see Arican B et al.) 2016;3(2):118–23 Akbas ES (see Ozdil K et al.) 2016;3(1):46-52 Akhan A et al. see 2016;3(1):53–9 Akin M (see Sarbay H et al.) 2016;3(2):140–2 Akman O (see Gulcebi M et al.) 2016;3(3):161–67 Aksaray S et al. see 2016;3(3):175–82 Aksoy Y et al. see 2016;3(3):217–21 Aksu F (see Keles N et al.) 2016;3(1):39–45 Alagoz P (see Aksaray S et al.) 2016;3(3):175–82 Alimoglu O (see Burcu B et al.) 2016;3(1):60–3 Alimoglu O (see Ozemir IA et al.) 2016;3(1):9–14 Alimoglu O (see Sagiroglu J et al.) 2016;3(2):146–9 Altin Kule Z (see Deveci HS et al.) 2016;3(2):150–55 Altiparmak E (see Sayar S et al.) 2016;3(2):104–10 Aluclu MA et al. see 2016;3(3):201–8 Arbag H (see Dundar MA et al.) 2016;3(3):229–32 Arican B et al. see 2016;3(2):118–23 Aricigil M (see Dundar MA et al.) 2016;3(3):229–32 Atak T (see Burcu B et al.) 2016;3(1):60–3 Ateser RY (see Akhan A et al.) 2016;3(1):53–9 Avcioglu F (see Sayar S et al.) 2016;3(2):104–10 Aydemir B see 2016;3(3):194–200 Aydin BA (see Kaya A et al.) 2016;3(1):64–6 Aydin E see 2016;3(1):75-8 Aydın Cataklı S (see Ilhan M et al.) 2016;3(1):34–8 Aydog E (see Taraktas A et al.) 2016;3(3):233–6 Aykut Aka S (see Sargin M et al.) 2016;3(1):27-33 Ayvaci H (see Sanverdi I et al.) 2016;3(3):222–4 Baglan T (see Sarac G et al.) 2016;3(1):79–82

Balci YI (see Sarbay H et al.) 2016;3(2):140–2 Balyemez F (see Sagiroglu J et al.) 2016;3(2):146–9 Basaran Yilmaz S (see Sagiroglu J et al.) 2016;3(2):146–9 Batan S (see Akhan A et al.) 2016;3(1):53–9 Bati F (see Aluclu MA et al.) 2016;3(3):201–8 Bayer S (see Sargin M et al.) 2016;3(1):27-33 Bayhan Z (see Ekici MF et al.) 2016;3(3):237–9 Bayram NA (see Turkkan A et al.) 2016;3(2):83–9 Baysal H (see Ozemir IA et al.) 2016;3(1):9–14 Bicakci I (see Egilmez Z et al.) 2016;3(2):131–4 Bosna G (see Akhan A et al.) 2016;3(1):53–9 Boylu E (see Unal Z et al.) 2016;3(1):1-8 Bozbeyoglu E (see Kaya A et al.) 2016;3(1):64–6 Buldanli MZ (see Ozemir IA et al.) 2016;3(1):9–14 Bulur A (see Ozdil K et al.) 2016;3(1):46-52 Burcu B et al. see 2016;3(1):60–3 Caliskan M (see Keles N et al.) 2016;3(1):39–45 Calık ES (see Ozdil K et al.) 2016;3(1):46-52 Calıskan Z (see Ozdil K et al.) 2016;3(1):46-52 Carcak N (see Gulcebi M et al.) 2016;3(3):161–67 Cekin ME (see Keles N et al.) 2016;3(1):39–45 Celikdelen P (see Ugurlar M et al.) 2016;3(1):22-6 Celiker H (see Pembegul Yigit I et al.) 2016;3(2):124–30 Cevan S (see Aksaray S et al.) 2016;3(3):175–82 Coskun O see 2016;3(2):156–60 Dabak MR (see Arican B et al.) 2016;3(2):118–23 Deger AN (see Ekici MF et al.) 2016;3(3):237–9 Degirmenci E (see Ongun N et al.) 2016;3(1):71-4 Demir B (see Ilhan M et al.) 2016;3(1):34–8 Demiral BH (see Arican B et al.) 2016;3(2):118–23 Demirbas S (see Kutlu O et al.) 2016;3(3):225–28

242 Demircioglu K (see Keles N et al.) 2016;3(1):39–45 Demirdag H (see Ozdil K et al.) 2016;3(1):46-52 Derin S (see Dundar MA et al.) 2016;3(3):229–32 Deveci HS et al. see 2016;3(2):150–55 Dinler Doganay G (see Katrinli S et al.) 2016;3(3):168–74 Dogan Altunpulluk M et al. see 2016;3(1):67–70 Doganay L (see Katrinli S et al.) 2016;3(3):168–74 Doganay L (see Ozdil K et al.) 2016;3(1):46-52 Dogukan A (see Pembegul Yigit I et al.) 2016;3(2):124–30 Dundar MA et al. see 2016;3(3):229–32 Duran B (see Eymen Bolat S et al.) 2016;3(2):90–6 Egilmez Z et al. see 2016;3(2):131–4 Ekici MF et al. see 2016;3(3):237–9 Ekinci O (see Akhan A et al.) 2016;3(1):53–9 Ekinci O (see Burcu B et al.) 2016;3(1):60–3 Ercan M et al. see 2016;3(1):15-21 Erden Habesoglu T (see Deveci HS et al.) 2016;3(2):150–55 Erdogan C (see Ongun N et al.) 2016;3(1):71-4 Eren M (see Kaya A et al.) 2016;3(1):64–6 Eren M (see Sargin M et al.) 2016;3(1):27-33 Eren T (see Ozemir IA et al.) 2016;3(1):9–14 Eren T (see Sagiroglu J et al.) 2016;3(2):146–9 Eren TT (see Burcu B et al.) 2016;3(1):60–3 Eryilmaz MA (see Dundar MA et al.) 2016;3(3):229–32 Eymen Bolat S et al. see 2016;3(2):90–6 Geler Kulcu D (see Taraktas A et al.) 2016;3(3):233–6 Goktas L (see Eymen Bolat S et al.) 2016;3(2):90–6 Gulcebi M et al. see 2016;3(3):161–67 Gulmez M et al. see 2016;3(2):143–5 Gunes P (see Sanverdi I et al.) 2016;3(3):222–4 Guney M (see Arican B et al.) 2016;3(2):118–23 Guven B (see Ercan M et al.) 2016;3(1):15-21 Icagasioglu A (see Egilmez Z et al.) 2016;3(2):131–4 Ilhan M et al. see 2016;3(1):34–8 Ilhan O (see Gulmez M et al.) 2016;3(2):143–5 Inan A (see Aksaray S et al.) 2016;3(3):175–82 Kabakas F (see Ugurlar M et al.) 2016;3(1):22-6 Kacar CK (see Aksoy Y et al.) 2016;3(3):217–21 Kahraman R (see Ozdil K et al.) 2016;3(1):46-52 Kalcik M (see Keles N et al.) 2016;3(1):39–45 Kale B (see Turkkan A et al.) 2016;3(2):83–9 Kanat E (see Ozdil K et al.) 2016;3(1):46-52 Karabulut MH (see Dogan Altunpulluk M et al.) 2016;3(1):67–70 Karacaer Z (see Okur G et al.) 2016;3(2):111–7 Karaci M (see Ercan M et al.) 2016;3(1):15-21 Karahanoglu E (see Eymen Bolat S et al.) 2016;3(2):90–6 Karamahmutoglu T (see Gulcebi M et al.) 2016;3(3):161–67 Karaman O (see Ilhan M et al.) 2016;3(1):34–8 Kasapoglu T (see Eymen Bolat S et al.) 2016;3(2):90–6

North Clin Istanb Katrinli S et al. see 2016;3(3):168–74 Kavakli AS (see Kavrut Ozturk N et al.) 2016;3(3):209–16 Kavakli AS et al. see 2016;3(2):97–103 Kavci Kokar I (see Arican B et al.) 2016;3(2):118–23 Kavrut Ozturk N (see Kavakli AS et al.) 2016;3(2):97–103 Kavrut Ozturk N et al. see 2016;3(3):209–16 Kaya A et al. see 2016;3(1):64–6 Kayacetin E (see Saygili F et al.) 2016;3(3):183–86 Kaydu A (see Aksoy Y et al.) 2016;3(3):217–21 Kaytaz K (see Gulmez M et al.) 2016;3(2):143–5 Kekilli E (see Aluclu MA et al.) 2016;3(3):201–8 Keles N et al. see 2016;3(1):39–45 Kır G (see Dogan Altunpulluk M et al.) 2016;3(1):67–70 Koca TT (see Sarac G et al.) 2016;3(1):79–82 Koca TT see 2016;3(2):135–9 Kocer A (see Unal Z et al.) 2016;3(1):1-8 Korkmaz M (see Ekici MF et al.) 2016;3(3):237–9 Kostek O (see Keles N et al.) 2016;3(1):39–45 Kule M (see Deveci HS et al.) 2016;3(2):150–55 Kutlu O et al. see 2016;3(3):225–28 Leblebici M (see Ozemir IA et al.) 2016;3(1):9–14 Mayda Domac F (see Unal Z et al.) 2016;3(1):1-8 Mesci N (see Taraktas A et al.) 2016;3(3):233–6 Mete E (see Sarbay H et al.) 2016;3(2):140–2 Mutlu Bilgic N (see Ozdil K et al.) 2016;3(1):46-52 Nadir A (see Arican B et al.) 2016;3(2):118–23 Odabasi HM (see Gulmez M et al.) 2016;3(2):143–5 Okur G et al. see 2016;3(2):111–7 Olmez S (see Sayar S et al.) 2016;3(2):104–10 Onat F (see Gulcebi M et al.) 2016;3(3):161–67 Ongun N et al. see 2016;3(1):71-4 Oren B et al. see 2016;3(3):187–93 Orhun K (see Burcu B et al.) 2016;3(1):60–3 Oz A (see Kaya A et al.) 2016;3(1):64–6 Ozaslan E (see Sayar S et al.) 2016;3(2):104–10 Ozcelik IB (see Ugurlar M et al.) 2016;3(1):22-6 Ozcetin M (see Ercan M et al.) 2016;3(1):15-21 Ozdemirci S (see Eymen Bolat S et al.) 2016;3(2):90–6 Ozderin Ozin Y (see Saygili F et al.) 2016;3(3):183–86 Ozdil K (see Katrinli S et al.) 2016;3(3):168–74 Ozdil K (see Sayar S et al.) 2016;3(2):104–10 Ozdil K et al. see 2016;3(1):46-52 Ozemir IA et al. see 2016;3(1):9–14 Ozgultekin A (see Aksaray S et al.) 2016;3(3):175–82 Ozgurhan G (see Ercan M et al.) 2016;3(1):15-21 Ozturk G (see Taraktas A et al.) 2016;3(3):233–6 Ozturk O (see Katrinli S et al.) 2016;3(3):168–74 Ozturk O (see Ozdil K et al.) 2016;3(1):46-52

NCI Index of Vol. 3

Pamuk H (see Akhan A et al.) 2016;3(1):53–9 Pembegul Yigit I et al. see 2016;3(2):124–30 Polat A (see Sarbay H et al.) 2016;3(2):140–2 Purisa H (see Ugurlar M et al.) 2016;3(1):22-6 Sagiroglu J et al. see 2016;3(2):146–9 Sahin OF (see Aksoy Y et al.) 2016;3(3):217–21 Sahin S (see Dogan Altunpulluk M et al.) 2016;3(1):67–70 Sakin A (see Kutlu O et al.) 2016;3(3):225–28 Sanverdi I et al. see 2016;3(3):222–4 Sarac G et al. see 2016;3(1):79–82 Sarbay H et al. see 2016;3(2):140–2 Sargin M (see Arican B et al.) 2016;3(2):118–23 Sargin M et al. see 2016;3(1):27-33 Saritas B (see Sayar S et al.) 2016;3(2):104–10 Savas NB (see Turkkan A et al.) 2016;3(2):83–9 Sayar S et al. see 2016;3(2):104–10 Saygili F et al. see 2016;3(3):183–86 Saygili SM (see Saygili F et al.) 2016;3(3):183–86 Selcuk N (see Sargin M et al.) 2016;3(1):27-33 Sezer I (see Ugurlar M et al.) 2016;3(1):22-6 Sokmen HM (see Ozdil K et al.) 2016;3(1):46-52 Subasi FD (see Akhan A et al.) 2016;3(1):53–9 Tanridag T (see Unal Z et al.) 2016;3(1):1-8 Taraktas A et al. see 2016;3(3):233–6 Tasan E (see Ilhan M et al.) 2016;3(1):34–8 Tasdemir Mete M (see Sargin M et al.) 2016;3(1):27-33 Tatlisu MA (see Sargin M et al.) 2016;3(1):27-33 Temel O (see Sanverdi I et al.) 2016;3(3):222–4 Temizkan O (see Sanverdi I et al.) 2016;3(3):222–4 Tenlik I (see Sayar S et al.) 2016;3(2):104–10

243 Tenlik I (see Saygili F et al.) 2016;3(3):183–86 Tombalak E (see Sagiroglu J et al.) 2016;3(2):146–9 Tuncer I (see Katrinli S et al.) 2016;3(3):168–74 Turan G (see Akhan A et al.) 2016;3(1):53–9 Turan Turgut S (see Egilmez Z et al.) 2016;3(2):131–4 Turkkan A et al. see 2016;3(2):83–9 Ucar BI (see Ekici MF et al.) 2016;3(3):237–9 Ugurlar M et al. see 2016;3(1):22-6 Ulu R (see Pembegul Yigit I et al.) 2016;3(2):124–30 Unal Z et al. see 2016;3(1):1Us O (see Unal Z et al.) 2016;3(1):1-8 Uz E (see Turkkan A et al.) 2016;3(2):83–9 Vural F (see Sanverdi I et al.) 2016;3(3):222–4 Yalin Kilic ZM (see Saygili F et al.) 2016;3(3):183–86 Yasar A (see Ercan M et al.) 2016;3(1):15-21 Yavuz B (see Turkkan A et al.) 2016;3(2):83–9 Yener O (see Ozemir IA et al.) 2016;3(1):9–14 Yigit A (see Turkkan A et al.) 2016;3(2):83–9 Yildiz MK (see Gulmez M et al.) 2016;3(2):143–5 Yildiz N (see Oren B et al.) 2016;3(3):187–93 Yilmaz Enc F (see Katrinli S et al.) 2016;3(3):168–74 Yilmaz Y (see Keles N et al.) 2016;3(1):39–45 Yıldız RS (see Ilhan M et al.) 2016;3(1):34–8 Yuksel M (see Saygili F et al.) 2016;3(3):183–86 Yuksel S (see Ilhan M et al.) 2016;3(1):34–8 Zengin N (see Oren B et al.) 2016;3(3):187–93 Zeren S (see Ekici MF et al.) 2016;3(3):237–9