Marwa ghonaim final report complete by Magdy Mohamed

Final Report For 1st Training Mission Program of: EgyptianFinnish-Project: "Enhancing Development of Water Use Efficient Crops & Production Methods to Dry and Saline Conditions" In collaboration with: "Development of Fodder Resources in SinaiProject", FCRI, ARC, Egypt From: 13th May To: 5th July, 2013

By: Ph.D. Student: Marwa M. M. Ghonaim CRD-Cell Research Department FCRI-Crops Research Institute ARC- Agricultural Research Center

Supervision: Prof. Oiva Niemel채inen Prof. Alan H. Schulman Prof. Elina Kiviharju Prof. Naglaa A. Ashry Dr. Ruslan Kalendar Dr. Magdy M. Mohamed

(MTT-Finland) (Helsinki Univ.-Finland) (MTT-Finland) (ARC-Egypt) (Helsinki Univ.-Finland) (ARC-Egypt)

Finland; June 20, 2013

Acknowledgments I wish to express my deep gratitude to the project “Enhancing Development of Water Use Efficient Crops & Production Methods to Dry and Saline Condition” Who offered this opportunity through its activities. Thanks are extended to all project members of FCRI, HU and MTT for arranging the training program and supervising the practical work throughout the training period. Many thanks for the cooperation of all memebers who responsible for this very useful project for us. I’m very appreciate to Prof, Alan who give me all scientific information about the retrotransposones and care about me in University of Helsinkii. Many thanks to Dr. Ruslan who was responsible on my training mission and also care about me and help me in this work and give me all what i needed for this scientific mission. I appreciate also for Prof. Oiva who also care about me in the length of the training period. My appreciate to Prof. Elina who care about me and extended me with scientific information. I want also to express my gratitude about all the member of this project for all chemicals and instrumints which i brought it from Helsinkii. Thanks for Prof ,Naglaa and Prof,Magdy who always care about me and give me advices from the first to the end of this mission. In the end i want to thank God for giving me this opportunity to enhanch my scintific background and Knowing all these project members to learn from them and to be as very simple part in our project.

(2)

ď ś Content:

Item

Page

1 2 3 4 5 6

Introduction Background Training Mission Objectives Financier Training Mission-Program Used Materials Training Activities Carried Out During The Mission 6.1: Germination of alfalafa seeds 6.2: Total DNA isolation 6.3: Primer testing 6.4: Data analysis 6.5:Extra activiries

4 5 5 5 5 6 6 6 9 15 16

Sent Materials to Egypt

References

Report Annexes

(3)

ď ś Introduction: Regarding to the increasing importance of using biotechnological methods in plant breeding and with the deep believe that this methods might have its positive impact on the development and acceleration of accurate and faster results of any breeding program; the present training program was designed to integrate modern biotechnology methods on the development of water use efficient genotypes to cope with the water shortage allover the country. Retro-markers, based on retro transposable elements in the plant genome is a modern simple and cost efficient method to generate molecular markers related to agronomic traits. This method was chosen to develop retro-markers related

to a valuable traits related to seed production in alfalfa. The target crop, alfalfa, has been chosen because it represents a key local importance as the main crop for fodder production and because of its objective importance of in soil enrichment under Egyptian cultivation system.

Breeding

efforts is exerted to make it even more suitable for cultivation in the new agricultural lands of the Sinai. Progress in breeding for the dry, saline condition of the Sinai requires the development of efficient molecular markers. Molecular markers enable the efficient and rapid incorporation of needed traits from germplasm in the gene banks. From a particular standpoint for marker development, alfalfa presents distinct features. Alfalfa is an auto-tetrabloid plant with a lot of genetic diversity in the germplasm collections between accessions and also within varieties themselves. The alfalfa genome sequence is now becoming available, which will prove to be valuable both for marker development and also for generation of genetic maps, which serve as important guides for breeding. Nine genotypes were chosen for this study including eight Egyptian and one Polish variety. At the first stage biodiversity among the studied genotypes will be studied and the suitable retro-markers will be generated. The markers will be used in the suitable mapping population for marker assessed breeding program.

(4)

 Background: 1. Activity 1.1: Development of a retrotransposon-based set of DNAmarkers for alfalfa.  Training Mission Objectives: Development of a set of retrotransposon-based DNA markers for alfalfa. Learn knowledge on current methods in retrotransposon marker production and utilization particularly in alfalfa plant breeding.  Financier Training Mission-Program: Egyptian-Finnish-Project:"Enhancing Development of Water Use Efficient Crops & Production Methods to Dry and Saline Conditions"; funded by: Ministry for Foreign Affairs of Finland.  Used materials: The following plant material of alfalfa were used in the training program, eight Egyptian genotypes in addition to one introduction, detailed description of the used material is listed in table one. Seeds of all material were germinated in the growth champers and used for DNA extraction in subsequent experiments. Table (1): List of used alfalfa genotypes: Sub-species

Type of Population

Populations

Country

1. Giza-1

Egypt

sativa

Variety

2. Ismailia-1 Egypt

sativa

Variety

3. Ismailia94

Egypt

sativa

Population

4. Sinai-1

Egypt

sativa

Population

5. Siwa

Egypt

sativa

Variety

6. Jenaan

USA

sativa

Variety

7. WL-528

USA

sativa

Variety

8. Siriver

Austr alia

sativa

Variety

9. Radius

Polan d

sativa x falcata

Variety

Type of Variety Nondormant Nondormant Nondormant Nondormant Nondormant Nondormant Nondormant Nondormant Dormant

Ploidy

Group

4 x

Mediterranean-type Populations.

4 x

Mediterranean-type Populations.

4 x

Mediterranean-type Populations.

4 x

Mediterranean-type Populations.

4 x

Mediterranean-type Populations.

4 x

Synthetic variety

4 x

Synthetic variety

4 x

Synthetic variety

4 x

Hybrid of sativa x falcatapopulations.

(5)

 Training Activities Carried Out During The Mission: 1- Germination of alfalafa seeds Seeds were germinated in the plant room under 22 C for one week. Bellow is a figure revealing germination process, all genotypes germinated normally with no extra treatments. Beat moss media was used in germination. Leaf samples were harvested after one week and used for subsequence steps.

Figure (1): germination of Alfalfa seeds under growth room conditions

2- Total DNA isolation CTAB method for DNA extraction was used. The procedure is suitable for all types of tissues from wide variety of animal, blood and plant species. All DNA extraction steps are performed at weak acid pH (HEPES free acid) and optionally with hot chloroform for 'difficult' samples, and at room temperature . a- DNA extraction from maize and barley samples using CTAB method as follows: The following protocol is designed for small and large tissue samples (tissue volume 100-200 μl). CTAB method for DNA extraction protocol  CTAB solution: 1-2% CTAB, 2 M NaCl, 10 mM Na3EDTA, 50 mM HEPES, pH ∼5.3; 100 ml: 1-2 g CTAB, 1.2 g HEPES-acid, 2 ml 0.5 M Na3EDTA, 40 ml 5 M NaCl;  Chloroform-isoamyl alcohol mix (24:1);  100% isopropanol (isopropyl alcohol, 2-propanol);  70% ethanol;  Fresh 1xTE (1 mM EDTA, 10mM Tris-HCl, pH 8.0).

(6)

2 ml Eppendorf Safe-Lock microcentrifuge tube with tissue sample and glass ball freeze at -80°C, grind in the MM300 Mixer Mill for 2 min at 30 Hz. 2. In 2 ml tube with mechanically disrupted seeds or leaves or herbarium or blood or DNA solution (CTABpurification) add fresh 1 ml CTAB solution buffer with RNAse A (the sample volume should not exceed 20% of lysis buffer), vortex very well and incubate the samples at 60-65°C during 30-60 min. 3. Add 700 µl of chloroform, vortex very well (in the MM300 Mixer Mill for 1 min at 30 Hz); optionally: incubate the samples at 60-65°C during 30 min. 4. Spin at maximum speed in a microcentrifuge for 2 minutes, transferred the upper aqueous layer to a new 2 ml microcentrifuge tube. 5. Add 700 µl of chloroform, vortex very well for 1 minute creating an emulsion (in the MM300 Mixer Mill at 30 Hz). 6. Spin at maximum speed in a microcentrifuge for 5 minutes. 7. Transferred the upper aqueous layer to a new 2 ml microcentrifuge tube which contains of 800 µl 2-propanol, vortex well and centrifuge the tubes at maximum speed in a microcentrifuge for 3 minutes. 8. Discard supernatant and wash pellet by adding 1.5 ml 70% EtOH, vortex well. Centrifuge at 14,000 rpm for 2 min and discard ethanol. 9. The DNA pellet do not dry and dissolved immediately in 300 μl 1xTE, pH 8.0 at 55°C for 10-20 minutes. Guanidine thiocyanate method for DNA extraction protocol  GuTC extraction buffer: 2 M guanidine thiocyanate, 10 mM Na 3EDTA, 50 mM HEPES, pH ∼5.3; the final concentration of guanidine thiocyanate may need to optimized for certain plant/animals tissue from 0.5 to 4 M;  Chloroform-isoamyl alcohol mix (24:1);  100% isopropanol (isopropyl alcohol, 2-propanol);  70% ethanol;  Fresh 1xTE (1 mM EDTA, 10mM Tris-HCl, pH 8.0). 1. 2 ml Eppendorf Safe-Lock microcentrifuge tube with tissue sample and glass ball freeze at -80°C, grind in the MM300 Mixer Mill for 2 min at 30 Hz. 2. Add fresh 1 ml GuTC solution buffer (the sample volume should not exceed 20% of lysis buffer), vortex very well and incubate the samples at 6065°C during 30-60 min. 3. Add 700 µl of chloroform, vortex very well for 1 minute creating an emulsion. Spin at maximum speed in a microcentrifuge for 2 minutes, transferred the upper aqueous layer to a new 2 ml microcentrifuge tube. Repeat this step. 4. Transferred the upper aqueous layer to a new 2 ml microcentrifuge tube which contains of 800 µl 2-propanol, vortex well and centrifuge the tubes at maximum speed in a microcentrifuge for 3 minutes. 5. Discard supernatant and wash pellet by adding 1.5 ml 70% EtOH, vortex well. Centrifuge at 14,000 rpm for 2 min and discard ethanol.

(7)

The DNA pellet do not dry and dissolved immediately in 300 μl 1xTE, pH 8.0 at 55°C for 10-20 minutes. CTAB method for DNA extraction protocol from herbarium  CTAB solution: 2% CTAB, 2 M NaCl, 10 mM Na3EDTA, 50 mM HEPES, pH ∼5.3;  DNA binding microspin column with a silica membrane (e.g., GeneJET Plasmid Miniprep or HiBind DNA) spin columns;  Chloroform-isoamyl alcohol mix (24:1);  100% isopropanol (isopropyl alcohol, 2-propanol);  Washing buffer 1: 4 M guanidine hydrochloride, 40% isopropanol;  Washing buffer 2: 20 mMNaCl, 2 mMTris-HCl, pH 7.5, 1 mM EDTA and 80% ethanol;  Fresh 1xTE (1 mM EDTA, 10mM Tris-HCl, pH 8.0-8.5). 1. 2 ml Eppendorf Safe-Lock microcentrifuge tube with herbarium sample and glass ball grind in the MM300 Mixer Mill for 10 min at 30 Hz. 2. Add fresh 1 ml CTAB solution buffer, vortex very well and incubate the sample for 1 hour at 60-65°C. 3. Add 700 µl of chloroform, vortex very well (in the MM300 Mixer Mill for 1 min at 30 Hz); and incubate the sample for 1 hour at 60-65°C. 4. Spin at maximum speed in a microcentrifuge for 3 minutes, transferred the upper aqueous layer to a new 2 ml microcentrifuge tube. 5. Add 700 µl of chloroform, vortex very well for 1 minute creating an emulsion. Spin at maximum speed in a microcentrifuge for 2 minutes, transferred the upper aqueous layer to a new 2 ml microcentrifuge tube. 6. Transferred the upper aqueous layer to a new 2 ml microcentrifuge tube and add an equal volume (900 µl) of 2-propanol, vortex well and transfer of the sample to a microspin column, placed in a 2 ml collection tube. Centrifuge the tubes in a microcentrifuge for 1 minutes. Discard both the 2 ml collection tube and the flow-througt liquid. 7. Add 500 μl washing buffer 1 to column and centrifuge in a microcentrifuge for 1 minutes and discard the flow-througt liquid. 8. Transfer column to a second collection tube and wash by adding 700 μl washing buffer 2. Centrifuge the tubes in a microcentrifuge for 1 minutes and discard the flow-througt liquid. Repeat this step. 9. Centrifugate empty column 2 min at maximum speed to dry. Transfer column to a clean 1.5 ml tube. Apply 200 μl 1xTE buffer and incubate at at 55°C for 10 minutes. Centrifuge the tubes for 1 minutes to elute DNA. Repeat elution with additional 100-200 μl of 1xTE buffer. 6.

b- Method 1- 2 ml Eppendorf Safe-Lock microcentrifuge tube with tissue sample and glass ball freeze at -80°C, grind in the MM300 Mixer Mill for 2 min at 30 Hz.

(8)

2- In 2 ml tube with mechanically disrupted seeds or leaves or herbarium or blood or DNA solution (CTABpurification) add fresh 1 ml CTAB solution buffer with RNAse A (the sample volume should not exceed 20% of lysis buffer), vortex very well and incubate the samples at 60-65°C during 30-60 min. 3- Add 700 µl of chloroform, vortex very well (in the MM300 Mixer Mill for 1 min at 30 Hz); optionally: incubate the samples at 60-65°C during 30 min. 4- Spin at maximum speed in a microcentrifuge for 2 minutes, transferred the upper aqueous layer to a new 2 ml microcentrifuge tube. 5- Add 700 µl of chloroform, vortex very well for 1 minute creating an emulsion (in the MM300 Mixer Mill at 30 Hz). 6- Spin at maximum speed in a microcentrifuge for 5 minutes. 7- Transferred the upper aqueous layer to a new 2 ml microcentrifuge tube which contains of 800 µl 2-propanol, vortex well and centrifuge the tubes at maximum speed in a microcentrifuge for 3 minutes. 8- Discard supernatant and wash pellet by adding 1.5 ml 70% EtOH, vortex well. Centrifuge at 14,000 rpm for 2 min and discard ethanol. 9- The DNA pellet do not dry and dissolved immediately in 300 μl 1xTE, pH 8.0 at 55°C for 10-20 minutes. The extracted DNA from nine alfalfa samples were run on agrose gel to test its quality, the results is shown as follows; sample extraction was perfect and suitable to proceed with other steps.

3- Primer testing Two types of primers were tested; list of the tested primers is tabulated in table 2,3 and 4.

(9)

Table (2):PBS primers 12-13-mers and its efficacy of each PBS primer for single iPBS amplification Sequence

2074 2075 2076 2077 2078 2079 2080 2081 2083 2085 2087 2095 2374 2375 2376 2377 2378 2379 2380 2381 2382 2383 2384 2385 2386 2387 2388 2389 2390 2391 2392 2393 2394 2270 2271 2272 2273 2274 2276 2277 2278

gctctgatacca ctcatgatgcca gctccgatgcca ctcacgatgcca gcggagtcgcca aggtgggcgcca cagacggcgcca gcaacggcgcca cttctagcgcca atgccgatacca gcaatggaacca gctcggatacca cccagcaaacca tcgcatcaacca tagatggcacca acgaagggacca ggtcctcatcca tccagagatcca caacctgatcca gtccatcttcca tgttggcttcca gcatggcctcca gtaatgggtcca ccattgggtcca ctgatcaaccca gcgcaataccca ttggaagaccca acatccttccca gcaacaacccca atctgtcagcca tagatggtgcca tacggtacgcca gagcctaggcca acctggcgtgcca ggctcggatgcca ggctcagatgcca gctcatcatgcca atggtgggcgcca acctctgatacca ggcgatgatacca gctcatgatacca

Tm (C)* CG (%)

40.5 42.1 50.4 46.1 54.2 56.6 54.6 56.5 45.7 43.8 43.5 44.8 47.1 45.1 43.1 47.2 44.2 41.5 41.4 40.9 44.9 50.5 40.9 45.7 41.4 47.3 43.4 43.0 47.6 43.6 43.1 47.1 48.5 56.9 54.3 50.5 47.6 57.1 42.7 46.2 42.3

50,0 50,0 66,7 58,3 75,0 75,0 75,0 75,0 58,3 50,0 50,0 58,3 58,3 50,0 50,0 58,3 58,3 50,0 50,0 50,0 50,0 66,7 50,0 58,3 50,0 58,3 50,0 50,0 58,3 50,0 50,0 58,3 66,7 69,2 69,2 61,5 53,8 69,2 46,2 53,8 46,2

Optimal annealing Ta (C)

49,6 51,2 59,2 55,1 62,8 65,2 63,3 65,0 54,6 52,8 52,5 53,7 53,5 52,5 52,0 53,0 53,0 49,2 50,5 50,0 50,5 53,0 50,0 51,2 50,1 51,5 51,0 50,0 56,4 52,6 52,2 51,0 56,5 65,0 60,0 55,0 56,5 65,8 51,7 52,0 51,0

PCR efficiency**

barley 5 5 5 5 5 5 3 3 4 4 4 5 5 5 5 5 5 3 3 4 4 5 4 5 5 4 4 5 5 4 4 5 5 5 5 5 5 4 4 5 4

cow 5 4 5 5 5 5 5 5 5 4 4 0 5 5 5 5 5 4 5 5 5 5 5 5 5 5 5 5 5 5 5 4 5 5 5 5 5 5 1 4 2

(10)

Table (3). PBS 18-mers primers and efficacy of each PBS primer for single iPBS amplification. Sequence

Tm (C)*

CG (%)

Optimal annealing Ta (C) 51,4 51,0 53,0 57,0 56,9 53,0 55,4 55,0 53,1 54,0 52,5 52,9 52,0 55,4 55,0 56,0 55,0 55,0 55,0 57,0 53,8 49,0 50,0 49,0 51,0 53,2 51,6 51,0 50,0 51.0 50,0 60,0 60,0 51,0 52,8 51,0 52,0 51,0 53,0 50,0 61,0

Average PCR efficiency** barley Cow 3 1 3 1 3 1 4 3 4 5 5 2 5 5 4 1 3 1 5 4 5 3 5 3 4 4 5 5 5 5 5 5 5 5 4 4 4 5 5 5 4 4 4 2 4 3 3 2 5 3 5 4 5 3 5 3 4 1 5 2 5 3 5 4 5 4 5 5 5 4 5 4 4 4 5 2 4 2 3 2 5 5

2217 acttggatgtcgatacca 52.5 44.4 ctccagctccgattacca 2218 56.1 55.6 2219 gaacttatgccgatacca 51.5 44.4 acctggctcatgatgcca 2220 59.0 55.6 2221 acctagctcacgatgcca 58.0 55.6 acttggatgccgatacca 2222 55.7 50.0 2224 atcctggcaatggaacca 56.6 50.0 agcatagctttgatacca 2225 50.5 38.9 2226 cggtgacctttgatacca 54.2 50.0 cattggctcttgatacca 2228 51.9 44.4 2229 cgacctgttctgatacca 53.5 50.0 2230 tctaggcgtctgatacca 54.0 50.0 acttggatgctgatacca 2231 52.9 44.4 2232 agagaggctcggatacca 56.6 55.6 cccctacctggcgtgcca 2237 65.0 72.2 2238 acctagctcatgatgcca 55.5 50.0 acctaggctcggatgcca 2239 60.4 61.1 2240 aacctggctcagatgcca 58.9 55.6 acctagctcatcatgcca 2241 55.5 50.0 2242 gccccatggtgggcgcca 69.2 77.8 agtcaggctctgttacca 2243 54.9 50.0 2244 ggaaggctctgattacca 53.7 50.0 gaggtggctcttatacca 2245 53.1 50.0 2246 actaggctctgtatacca 50.9 44.4 aaccgacctctgatacca 2249 54.7 50.0 2251 gaacaggcgatgatacca 54.3 50.0 tcatggctcatgatacca 2252 52.7 44.4 2253 tcgaggctctagatacca 53.4 50.0 gcgtgtgctctcatacca 2255 57.1 55.6 2256 gacctagctctaatacca 49.6 44.4 ctctcaatgaaagcacca 2257 52.4 44.4 2295 agaacggctctgatacca 55.0 50.0 2298 agaagagctctgatacca 51.6 44.4 2373 gaacttgctccgatgcca 57.9 55.6 2395 tccccagcggagtcgcca 66.0 72.2 2398 gaacccttgccgatacca 57.1 55.6 2399 aaactggcaacggcgcca 63.4 61.1 2400 cccctccttctagcgcca 61.6 66.7 2401 agttaagctttgatacca 47.8 33.3 2402 tctaagctcttgatacca 49.0 38.9 2415 catcgtaggtgggcgcca 62.5 66.7 * oligonucleotide concentration is 1µM ** PCR efficiency was estimated according this scale: 0 - no bands (worth primer); 1 – few bands or (and) weak bands; 2 – few strong bands; 3 – around 10 strong bands (average primer); 4 – a lot bands (good primer); 5 – much strong and equal quality bands (best primer).

(11)

The above mentioned iBPS set of primers was tested against alfalfa DNA, among them 33 primers resulted in good DNA amplification and could be used to detect retro-markers in alfalfa, the following figures represent sample of the work while the complete data is attached as annex5. A- Sample results for Inter- Primer Bindimg Site Polymorphism (iPBS)

(12)

(13)

Table (4): primers and efficacy of each iRAP primer amplification. seq_id

sequence

IRAP Efficiency

Source

Length

Tm(째C)

CG(%)

LC(%)

PQ(%)

4333

ccatggcgagcagatgtgct

60.7

60.0

4334

tatgttgggaaaacggggtg

55.9

50.0

4335

tgaaaatcgcagcactcctaggt

58.0

47.8

4336

tgtacaaagactggcacgagatgc

59.4

50.0

4337

tgcagcttcgacggccaagatgc

64.7

60.9

4338

ctttgccaatctgtgatgcag

55.9

47.6

4339

tcatacactgttaagtgctcaacc

55.1

41.7

4340

atggttgtcgaaactccagc

55.9

50.0

4341

gtcccacagcttgggcaacag

62.5

61.9

4342

gattgcaaagcctatttcgctg

56.2

45.5

4343

caattatcaaaccctccactttcg

55.2

41.7

4344

ctcttctcaaacaccaggagtc

55.9

50.0

4345

ccaaacaggatttctgaacgactc

56.9

45.8

4346

accttgctgctaaggttgaggcat

60.5

50.0

4347

ctgctccaaatccctttcttttgctccaaga

62.4

45.2

4348

ttagatgaaaccaacgatcccaaggct

59.6

44.4

4349

ctcaccccttctgcttggaaatgttgct

63.1

50.0

4350

gtaaataggctcccagggcatcaagccctc

66.1

56.7

4351

caggcaagaatgagcgtctc

57.1

55.0

4352

acccggaagggcggttcatgcaa

65.2

60.9

4353

gcaagtaactatatctggccaacc

56.4

45.8

4354

ccccttggggcatctgcagc

65.3

70.0

4355

ttcccggtggatcgaaaacc

58.1

55.0

4356

ccccacattgagaacggcca

60.7

60.0

4357

tgacatttgtggcactttctggcgt

61.1

48.0

4358

ggtaataatcttgctgggaacacc

56.8

45.8

4359

atgaacttagctaccacttgcttggtcacat

60.6

41.9

4360

gccgtaataaataaatcgcttccatggtcga

60.3

41.9

4361

gtcgaccttcccggcatgaa

60.1

60.0

4362

accaaattgattctcagtaacttgagtctcc

58.2

38.7

4363

gcactctatcatacgctttctcc

56.0

47.8

4364

atagcgccgagatgcatgct

58.9

55.0

4365

gctatctcttggatttgttccgtgaggacat

61.3

45.2

4366

catgtagccgaccccacctagtgg

63.8

62.5

4367

acctagtgggataaggcgtt

55.2

50.0

4368

gatgttgcggtggatgtgtggtaagact

62.3

50.0

4369

agatgaaacaacagttgccggttcaacaa

60.6

41.4

4370

atgccgtattctcagcatcc

55.3

50.0

4371

gttgctcctatcaatgcagc

55.3

50.0

4372

acggagttctttagcaagttcctc

57.0

45.8

4373

gaacggtggaagcccatacg

59.4

60.0

4374

gtgcctaacaccttcccgta

57.1

55.0

4375

atcgctccgggtgcctaacac

62.1

61.9

4376

gctacgggaaggtgttaggcacc

62.8

60.9

4377

cgtacccttttaagggatcaaaacc

56.9

44.0

(14)

B- Sample results for Inter- Retrotransposone Amplification Polymorphism (iRAP)

4- Data analysis The resulted data was subjected to computer analysis, the resulted dendrograms are shown below. From the resulted dendrogram it is clear that no consistency was found in the distribution of cultivars using these two sets of markers: further work may be needed to find out the suitable set of markers>

(15)

Extra Activities:

In addition to the work of the project material I had the chance to do some retromarkers related to my PhD study; I have tested a set of iBPS and iRAP primers on 16 Egyptian Maize commercial hybrids. I started to analyze the data after my arrival to Cairo lab and the work is in progress

(16)

Sent materials to Egypt:

A list of chemicals and equipments sent FCRI lab is tabulated below; these chemicals will be used for work related to the project acdtivities. After my arrival to Cairo lab I started to establish the technique in Cairo and the results will be presented in coming reports . Table (5): list of the chemicals and equipments sent to Cairo lab among the project activities company

ordered

ImmunoDiagnostic Fisher Scientific Fisher Scientific Fisher Scientific MWG MWG BioNordika BioNordika BioNordika Sigma-Aldrich Sigma-Aldrich Verkkokauppa

337100 0.7kg ReSolute Wide Range Agarose dNTP, 4x 1ml. R0182 F-122L, Phire® Hot Start II DNA Polymerase (1000 reactions) GeneRuler DNA Ladder Mix # SM0332 (25 tubes x 50 µg) 32 primer, Zea LTRs 45 primer, alfalfa LTRs Cetyltrimethylammonium bromide BioChemica (AppliChem Gmb; A0805,0500) CTAB Guanidine thiocyanate (AppliChem Gmb; A4335,1000) Agarose, BIOTOP, 500g: BIO-41025 Z338842-1set Maxi-Plus horizontal electrophoresis units, Uncooled Unit Z339458-1EA Maxi horizontal electrophoresis unit accessory, Gel Casting Tray Nikon d5200, 32Gb SDHC

References: 

Kalendar R., Schulman AH 2013. Transposon based tagging: IRAP, REMAP, and iPBS.Springer protocols, Methods in Molecular Biology series: Molecular Plant Taxonomy. Protocols and applications., Pascale Besse (ed.), Humana Press, a part of Springer Science+Business Media LLC.



Kalendar R, Schulman AH 2006. IRAP and REMAP for retrotransposon-based genotyping and fingerprinting. Nature Protocols, 1(5): 2478 - 2484.



Modiﬁed from Fedoroff, N.V. (1998). The discovery of transposable elements. In Discoveries in Plant Biology, vol. 1 (eds Shain-Dow Kung and Shang-Fa Yang), World Scientiﬁc Publishing Co. Pte. Ltd., Singapore, pp. 89–104.



R Kalendar1, AJ Flavell2, THN Ellis3, T Sjakste4, C Moisy1 and AH Schulman1,5 (2011). Analysis of plant diversity with retrotransposon-based molecular markers. Heredity, 106, 520–530

(17)



ReportAnnexes:

(18)

(19)

(20)

(21)

Annex 5 Raw data for the Helsinki lab work on alfalfa generated Marwa Ghonaim 1-iPBS (Inter- Primer Bindimg Site Polymorphism) 20130525 iPBS primer Test on Alfalfa sample iPBS Primer list 2221 2231 2232 2237 2238 2239 2241 2242 2295 2296 2297 2298 2299 2395 2397 2403 2415 2416

1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18.

PCR master mix for 18 primers: MQ (distilled water) 305 µl DNA 4 µl 10X PFU buffer with MgCl2 40µl 10 mMdNTPs 8µl 5 U/ µl Taq DNA polymerase 3.2 µl Add 2 µl 10 µM primer + 18µl of premix

Centrifuge PCR program 95 -3 min; 32 cycles * (95°C–20sec; 55°C–30sec; 72°C-90 sec)last elongation 5 min at 72°C. Add 40 µl 1x loading buffer; mix well, 8 µl for loading in gel. Electrophoresis with 1.4% agarose (1xTHE buffer); 90V, ~3h

(22)

20130527 iPBS primer test iPBS Primer list: 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18.

PCR master mix for 18 primers:

2220 2224 2228 2229 2230 2231 2240 2243 2244 2245 2252 2253 2256 2257 2373 2398 2399 2401

MQ (distilled water) DNA 10X PFU buffer with MgCl2 10 mMdNTPs 5 U/ µl Taq DNA polymerase

305 µl 4 µl 40µl 8µl 3.2 µl

Add 2 µlfrom 10 µM primer + 18µl of premix

(23)

28- 5-2013 Primer test for alfalfa samples 9 sample for Alfalfa 1. Sinai 2. Radius 3. Siriver 4. Jenaan 5. Wl-528 6. Ism-94 7. Ism-1 8. Giza-1 9. Siwa-1

Premix for 3 primers: Primer: 1- 2221 2- 2231 3- 2232 Number of reactions: 33(µl) Reaction volume 20 (µl) Total reaction volume 660 (µl) Premix solution 378(µl) Mille-Q water: 66(µl) 10x PCR buffer: 13.2(µl) 10 mMdNTP: 5 U/µl DreamTaq polymerase: 5.2(µl) Mix vortex and divide to 3 tubes: 154 µl of premix to each tube Add to tube primer 22 µl 10 µM primer Mix, vortex 16 µl of premix + 4 µl of DNA PCR program 95 -3 min; 30 cycles: (95 – 20 sec, 55 – 30 sec; 72 – 90 sec ;) last elongation 5 min at 72. Add 40 µl 1x loading buffer; mix well, 8 µl for loading in gel. Electrophoresis with short gel 1.4% agarose (1xTHE buffer); 90V, ~3h (2221) M

(2231) 7

(2232) 7

(24)

release this primer

31-05-2013 / Run two iPBSprimer which I made it in 28 because the last primer sample (8) have no result so I 9 sample for Alfalfa Premix for 2 primers: Primer: 1. Sinai 1. 2221 2. Radius 2. 2231 3. Siriver 4. Jenaan 22(µl) Number of reactions: 5. Wl-528 20(µl) Reaction volume (µl): 6. Ism-94 440(µl) Total reaction volume (µl): 7. Ism-1 Premix solution (µl): 8. Giza-1 252(µl) Milli-Q water: 9. Siwa-1 44(µl) 10x PCR buffer: 8.8(µl) 10 mMdNTP: 3.5(µl) 5 U/µl DreamTaq polymerase: Mix vortex and divide to 2 tubes: 154 µl of premix to each tube Add to tube primer 22 µl 10 µM primer Mix, vortex 16 µl of premix + 4 µl of DNA 95 -3 min; 30 cycles: (95 – 20 sec, 55 – 30 sec; 72 – 90 sec;) last elongation 5 min at 72 Add 40 µl 1x loading buffer; mix well, 8 µl for loading in gel. Electrophoresis with short gel 1.4% agarose (1xTHE buffer); 50V, ~14h

(2221) M

1 2

(2231) 4

7 8

(25)

1. 2.

20130529 seven iPBS primer for Alfalfa sample 2228 5. 2242 2229 6. 2295

3. 4.

2230 2239

7. 2395

Number of reactions: Reaction volume (µl): Total reaction volume : Premix solution Milli-Q water: 10x PCR buffer: 10 mMdNTP: 5 U/µl DreamTaq polymerase:

77(µl) 20(µl) 1540(µl) 885(µl) 154(µl) 30.8(µl) 12.5(µl)

Mix vortex and divide to 7 tubes: 154 µl of premix to each tube Add to tube primer 22 µl 10 µM primer Mix, vortex 16 µl of premix + 4 µl of DNA 95 -3 min; 29 cycles: (95 – 20 sec, 55 – 30 sec; 72 – 90 sec) last elongation 5 min at 72. Add 40 µl 1x loading buffer; mix well, 8 µl for loading in gel. Electrophoresis with short gel 1.4% agarose (1xTHE buffer); 50V, ~14h

2228 M

2229 7

2230 6

2239 6

(26)

20130529 (7) iPBS primer test on Alfalfa sample. 1. 2.

2228 5. 2242 2229 6. 2295 2230 7. 2395 4. 2239 Number of reactions: Reaction volume (µl): Total reaction volume : Premix solution Milli-Q water: 10x PCR buffer: 10 mMdNTP: 5 U/µl DreamTaq polymerase:

77(µl) 20(µl) 1540(µl) 885(µl) 154(µl) 30.8(µl) 12.5(µl)

( 2242) M

( 2295 ) 8

( 2395) 6 7

M 1

(27)

20130612_1 iPBS fingerprint for alfalfa Premix for 3 primers: Primer: 1. 2232 2. 2241 3. 2242 Number of reactions: 33 µl Reaction volume (µl): 20 µl Total reaction volume (µl): 660 µl Premix solution (µl): Milli-Q water: 377 µl 10x PFU buffer MgSO4: 66 µl 10 mMdNTP: 13.2 µl 5 U/µl BioTools DNA polymerase: 6.6 µl

1. 2. 3. 4. 5. 6. 7. 8. 9.

9 sample for Alfalfa Sinai Radius Siriver Jenaan Wl-528 Ism-94 Ism-1 Giza-1 Siwa-1

Mix vortex and divide to 3 tubes: 154 µl of premix to each tube, add to tube primer 22 µl 10 µM primer; mix, vortex, 16 µl of premix + 4 µl of DNA PCR program: 95°C -3 min; 32 cycles: (95°C – 20 sec, 50°C- 30 sec; 72°C- 90 sec) last elongation 5 min at 72°C. Add 40 µl 1x loading buffer; mix well, 8 µl for loading in gel. Electrophoresis with short gel 1.4% agarose (1xTHE buffer); 50V, 14h

2232 M

1 2 3 4

2241 5

2242 1 2 3

8 9

M 1

3 4

(28)

20130613_2 iPBS fingerprint for alfalfa Premix for 3 primers: Primer: 1. 2296 2. 2297 3. 2298 Number of reactions: 33 µl Reaction volume (µl): 20 µl Total reaction volume (µl): 660 µl Premix solution (µl): Milli-Q water: 377 µl 10x PFU buffer MgSO4: 66 µl 10 mMdNTP: 13.2 µl 5 U/µl BioTools DNA polymerase: 6.6 µl

9 sample for Alfalfa 1. 2. 3. 4. 5. 6. 7. 8. 9.

Sinai Radius Siriver Jenaan Wl-528 Ism-94 Ism-1 Giza-1 Siwa-1

5 6

2297 7

M 1

2298 7

(29)

20130613_2 iPBS fingerprint for alfalfa Premix for 2 primers: Primer: 1. 2299 2. 2398 Number of reactions: Reaction volume (µl): Total reaction volume (µl): Premix solution (µl): Milli-Q water: 10x PFU buffer MgSO4: 10 mMdNTP: 5 U/µl BioTools DNA polymerase:

1. 2. 3. 4. 5. 6. 7. 8. 9.

22 µl 20 µl 440 µl 252 µl 44 µl 8.8 µl 3.5µl

9 sample for Alfalfa Sinai Radius Siriver Jenaan Wl-528 Ism-94 Ism-1 Giza-1 Siwa-1

2299 M 1

2 3 4 5

2398 7

M 1

2 3

4 5

(30)

20130615_2 iPBS fingerprint for alfalfa Premix for 3 primers: Primer: 1. 2232 2. 2403 3. 2415 Number of reactions: Reaction volume (µl): Total reaction volume (µl): Premix solution (µl): Milli-Q water: 10x PFU buffer MgSO4: 10 mMdNTP: 5 U/µl BioTools DNA polymerase:

9 sample for Alfalfa Sinai Radius Siriver Jenaan Wl-528 Ism-94 Ism-1 Giza-1 Siwa-1

1. 2. 3. 4. 5. 6. 7. 8. 9.

33 µl 20 µl 660 µl 377 µl 66 µl 13.2 µl 6.6 µl

2403 7

2415 6

(31)

20130616_2 iPBS fingerprint for alfalfa Premix for 3 primers: Primer: 1.2416 2. 2224 3. 2228 Number of reactions: 33 µl Reaction volume (µl): 20 µl Total reaction volume (µl): 660 µl Premix solution (µl): Milli-Q water: 377 µl 10x PFU buffer MgSO4: 66 µl 10 mMdNTP: 13.2 µl 5 U/µl BioTools DNA polymerase: 6.6 µl

1. 2. 3. 4. 5. 6. 7. 8. 9.

9 sample for Alfalfa Sinai Radius Siriver Jenaan Wl-528 Ism-94 Ism-1 Giza-1 Siwa-1

1 2

M 1

2 3

(32)

20130616_2 iPBS fingerprint for alfalfa Premix for 2 primers: Primer: 1. 2229 2. 2231 Number of reactions: Reaction volume (µl): Total reaction volume (µl): Premix solution (µl): Milli-Q water: 10x PFU buffer MgSO4: 10 mMdNTP: 5 U/µl BioTools DNA polymerase:

1. 2. 3. 4. 5. 6. 7. 8. 9.

22 µl 20 µl 440 µl 252 µl 44 µl 8.8 µl 3.5 µl

9 sample for Alfalfa Sinai Radius Siriver Jenaan Wl-528 Ism-94 Ism-1 Giza-1 Siwa-1

2231 5

(33)

20130617_2 iPBS fingerprint for alfalfa Premix for 3 primers: Primer: 1. 2373 2. 2399 3. 2401 Number of reactions: 33 µl Reaction volume (µl): 20 µl Total reaction volume (µl): 660 µl Premix solution (µl): Milli-Q water: 377 µl 10x PFU buffer MgSO4: 66 µl 10 mMdNTP: 13.2 µl 5 U/µl BioTools DNA polymerase: 6.6 µl

1. 2. 3. 4. 5. 6. 7. 8. 9.

9 sample for Alfalfa Sinai Radius Siriver Jenaan Wl-528 Ism-94 Ism-1 Giza-1 Siwa-1

2 3

6 7

2399 8

9 M

2401 6

9 M 1 2

5 6

(34)

B- IRAP ( Inter-Retrotransposone Amplification Polymorphism) 20130604_1 Alfalfa 45 LTRs primer test: 4333...4377 33 34 35 36

37 38

39 40

42 43

44 45

46 47

Number of reactions: Reaction volume (µl): Total reaction volume (µl): Premix solution (µl) Milli-Q water: 10x Pfu Buffer (wt MgSO4) 25 mM MgSO4 10 mMdNTP DNA alfalfa 100ng/µl 5 U/µl BioTools plus Pfu (200:1):

50 51 52

53 54

55 56

60 61 62

64 65 66

67 68

70 71 72 73

75 76 77

50 µl 20 µl 10000 µl

730 µl 100 µl 80 µl 20 µl 10 µl 10 µl

19 µl of premix + 1 µl of 10 µM primer 95C – 2 min; 32x: (95C – 20 sec, 60C - 30 sec, 72C – 90 sec) last elongation 72C – 5 min. Add 40 µl 1x loading buffer; mix well, 8 µl for loading in gel. Electrophoresis with short gel 1.4% agarose (1xTHE buffer); 90V, ~3h

(35)

20130605_1 Alfalfa 45 LTRs primer test: 4333...4377 33 34 35

36 37 38 39 40 41 42

43 44

45 46 47 48

Number of reactions: Reaction volume (µl): Total reaction volume (µl):

50 51 52

5455 56 57 58

59 60 61

62 63 64

65 66 67

68 69 70

71 72

M 73

75 76 77

50 µl 20 µl 10000 µl

Premix solution (µl) Milli-Q water: 10x Pfu Buffer (wt MgSO4) 25 mM MgSO4 10 mMdNTP DNA alfalfa 100ng/µl 5 U/µl DreamTaq plus Pfu (100:1):

720 µl 100 µl 80 µl 20 µl 10 µl 10 µl

18.8 µl of premix + 1.2 µl of 10 µM primer 95C – 2 min; 32x: (95C – 20 sec, 60C - 30 sec, 72C – 90 sec) last elongation 72C – 5 min. Add 40 µl 1x loading buffer; mix well, 8 µl for loading in gel. Electrophoresis with short gel 1.4% agarose (1xTHE buffer); 90V, ~3h

(36)

20130605_2 Alfalfa 45 LTRs primer test: 4349...4377 M

56 57 58

59 60

61 62 63 64

Number of reactions: Reaction volume (µl): Total reaction volume (µl):

50 µl 20 µl 10000 µl

Premix solution (µl) Milli-Q water: 10x Pfu Buffer (wt MgSO4) 25 mM MgSO4 10 mMdNTP DNA alfalfa 100ng/µl 5 U/µl DreamTaq plus Pfu (100:1):

720 µl 100 µl 80 µl 20 µl 10 µl 10 µl

65 66

67 68

69 70

71 72

74 75 76 77

(37)

20130607_1 Alfalfa 9 samples, IRAP test (TaiI restriction): 4347 4349 4374 M

Number of reactions: Reaction volume (µl): Total reaction volume (µl):

44 µl 20 µl 880 µl

Premix solution (µl) Milli-Q water: 10x Pfu Buffer (wt MgSO4) 25 mM MgSO4 10 mMdNTP 5 U/µl BioTools plus Pfu (200:1):

475 µl 88 µl 70.4 µl 17.6 µl 9.3 µl

4375 7

1. 2. 3. 4. 5. 6. 7. 8. 9.

Sinai -1 Radius Siriver Jenaan Wl-528 Ism-94 Ism-1 Giza-1 Siwa-1

Mix 165 µl divide 3 tube, and add 11 µl each 10 µM primer 16 µl of premix + 4 µl of DNA alfalfa 5ng/µl

(38)

95C – 2 min; 32x: (95C – 20 sec, 60C - 30 sec, 72C – 90 sec) last elongation 72C – 5 min. Restriction with TaiI and TaqI: (10 µl PCR plus 10 µl of 2x restriction mix) 2x(450 µl: 355 µl MQ, 90 µl 10x buffer, 5 µl enzyme); 65C – 60 min. Add 20 µl 2x loading buffer; mix well, 8 µl for loading in gel. Electrophoresis with long gel 1.3% agarose (1xTHE buffer); 50V, ~14h

(39)

20130607_2 Alfalfa 9 samples, IRAP test (TaqI restriction): 4347 M

4349 8

Number of reactions: Reaction volume (µl): Total reaction volume (µl): Premix solution (µl) Milli-Q water: 10x Pfu Buffer (wt MgSO4) 25 mM MgSO4 10 mMdNTP 5 U/µl BioTools plus Pfu (200:1)

4374 8

4375 9

1 2

7 8

9 M

1. 2. 3. 4. 5. 6. 7. 8. 9.

Sinai -1 Radius Siriver Jenaan Wl-528 Ism-94 Ism-1 Giza-1 Siwa-1

44 µl 20 µl 880 µl

475 µl 88 µl 70.4 µl 17.6 µl 9.3 µl

Mix 165 µl divide 3 tube, and add 11 µl each 10 µM primer 16 µl of premix + 4 µl of DNA alfalfa 5ng/µl 95C – 2 min; 32x: (95C – 20 sec, 60C - 30 sec, 72C – 90 sec) last elongation 72C – 5 min. Restriction with TaiI and TaqI: (10 µl PCR plus 10 µl of 2x restriction mix) 2x(450 µl: 355 µl MQ, 90 µl 10x buffer, 5 µl enzyme); 65C – 60 min. Add 20 µl 2x loading buffer; mix well, 8 µl for loading in gel. Electrophoresis with long gel 1.3% agarose (1xTHE buffer); 50V, ~14h

(40)

201306025_1 Alfalfa 9 samples, IRAP test:

4354 M

4376 7

M 1

Number of reactions: Reaction volume (µl): Total reaction volume (µl):

33 µl 20 µl 660 µl

Premix solution (µl) Milli-Q water: 10x Pfu Buffer (wt MgSO4) 25 mM MgSO4 10 mMdNTP 5 U/µl ´Dream Taq plus Pfu (100:1):

356 µl 66 µl 53 µl 13.2 µl 7 µl

4377 8

M 1

6 7

1. 2. 3. 4. 5. 6. 7. 8. 9.

Sinai -1 Radius Siriver Jenaan Wl-528 Ism-94 Ism-1 Giza-1 Siwa-1

(41)