RESEARCH ARTICLE
MOLECULAR DETECTION OF PORCINE FOOT BUSH WITH ANAEROBIC ETIOLOGIES 1
2
3
4
5
Liya Anto , Siju Joseph , M. Mini , Sheethal. G. Mohan , S. Vamshi Krishna , 6 7 Abraham Joseph Pellissery and A. P. Usha College of Veterinary and Animal Sciences, Mannuthy.
ABSTRACT Foot bush in most instances is more comparable to foot abscess in pigs. Foot rot is primarily caused by damage to the hooves or the tissue surrounding the hooves, which allows a bacterial infection to set in and develop. Multiple etiologies are involved in the commencement of this disease, which include both aerobic and anaerobic organisms. The most commonly detected anaerobic etiology in foot rot in pigs is Fusobacteriumnecrophorum (F. necrophorum), followed by Dichelobacternodosus (D. nodosus). There was severe lameness in pigs characterized by separation of hard horny wall from the heel, oedema and abscessation. 26 cases of pigs which showed severe foot lesions were reported, of which ten representative samples were collected. All samples were processed and DNA was extracted. They were subjected to polymerase chain reaction using species specific 16S r RNA and lktA gene primer pairs for D. nodosus and F. necrophorum respectively. Out of the samples screened, none were positive for D. nodosus and two yielded an amplicon size of 402 bp of lktA gene indicating the presence of F. necrophorum.
1,2,3,4,5
Department of Veterinary Microbiology, College of Veterinary and Animal Sciences, Mannuthy. 6
Department of Veterinary Biochemistry, College of Veterinary and Animal Sciences, Mannuthy. 7
Centre for Pig Production and Research, College of Veterinary and Animal Sciences, Mannuthy.
Traditionally the identification of D. nodosus and F. necrophorum are carried out by isolation of the organism from the hoof of affected animals, its staining and biochemical characterization (Kortt et. al., 1983; Skerman, 1989; Smith et. al., 1991; Falkler et. al., 1999). Isolation of these bacteria from clinical samples is less confirmatory, very difficult, time consuming and require additional growth supplements (Smith et. al., 1991; Falkler et. al., 1999; Gradin and
Issue 1 April 2012
Foot bush, which is also known as footrot in pigs is similar clinically to footrot in other species, like sheep, goat and cattle. Foot lesions are common and have been reported in all age groups of swine(Mouttotou et. al., 1999). But footrot is relatively not common in pigs as compared to other species. Factors which predispose pigs to foot bush include rough and abrasive flooring, wet underfoot, dietary deficiency and dirty environments (Mouttotou et. al., 1999; Radostits et. al., 2000). Foot bush in pigs is caused by multiple bacterial etiologies. Detection of Fusobacterium necrophorum (Zhou et al., 2010), Dichelobacternodosus, Staphylococcus spp., Streptococcus spp
( Te s h a l e , 2 0 0 5 ) , A rc a n o b a c t e r p y o g e n e s (Radostits, 2000), Prevotella, Peptostreptococcus, Porphyromonas, Bacteroides and Eubacterium (Piriz et. al., 1996) from the lesions of limbs of pigs have been reported. Among these, two species of anaerobic bacteria are constantly found associated with foot bush in pigs: Fusobacterium necrophorum (Radostits et. al., 2000; Zhou et. al., 2010) and Dichelobacternodosus (Radostits et al., 2000; Teshale, 2005).
JIVA Vol. 10
INTRODUCTION
13
RESEARCH ARTICLE
Schmithz, 1977). So recently molecular techniques like polymerase chain reaction using 16S rRNA (LaFontaine et al., 1993; Zakaria et al., 1998,Wani et al., 2004; Moore et al., 2005) or fimA gene sequences (Dhungyel et. al., 2002) for D. nodosus and lktA gene sequences (Zhou et. al., 2009; Hickford et. al., 2010) for F. necrophorum were tried and observed to yield rapid, confirmatory and sensitive diagnosis of these bacteria in clinical samples. The present study was conducted to screen the samples from animals of Centre for Pig Production and Research, Mannuthy, having severe foot lesions and lameness.
CT3' (reverse)(La Fontaine et al., 1993; Moore et al., 2005; Wani et. al., 2007). The PCR amplifications were performed in 25µl volumes. The final concentration contained 2µl of template, 2.5µl of 10X Taq buffer (10mM Tris-HCl (pH 9.0), 50mM KCl, 15mM MgCl2), 25pM each of forward a n d r e v e r s e p r i m e r, 2 0 0 µ M o f e a c h deoxyribonucleotide triphosphate and 1IU TaqDNA polymerase. The amplification was carried out in a thermal cycler (Eppendorf) with an initial denaturing step of 94°C for 10min, followed by 35 cycles of 94°C for 1min, 58°C for 30s and 72°C for 30s, with a final extension step at 72°C for 5min.
MATERIALS AND METHODS
PCR detection of F. necrophorum
Collection of samples
F. necrophorum was detected by PCR amplification of leukotoxin (lktA) gene using primers 5'AATCGGAGTAGTAGGTTCTG-3' (Forward) and 5'CTTTGGTAACTG CCACTGC3' (Reverse) (Zhou et al., 2009). The PCR amplifications were performed in 25µl volumes.
Severe lameness and foot lesions were reported in 26 pigs of Centre for Pig Production and Research, Mannuthy. Lesions were characterized by hot, painful, swollen limbs, separation of hard horny wall from the heel and abscessation. Animals were unable to stand or take feed. Representative samples were taken from 10 pigs using sterile cotton swabs (Hi-Media, Mumbai) from the deeper portion of the lesion and were transported quickly to the laboratory.
J. Ind. Vet. Assoc., Kerala. 10 (1)
Extraction of bacterial DNA The samples were processed to isolate the DNA of the pathogens by crude method. The samples were suspended in 200µl of sterile phosphate buffered saline (PBS), boiled for 10min, immediately chilled on ice for 5 min and centrifuged at 15000 rpm for 10min. The supernatant was collected and stored in 1.5ml microcentrifuge tubes, which were later used as templates for PCR reaction. PCR detection of D. nodosus D. nodosus was detected by PCR amplification of 16S rRNA using primers 5'CGGGGTTATGTAGCTTGC3' (forward) and5'TCGGTACCGAGTATTTCTACCCAACAC
14
The final concentration contained 2µl of template DNA, 2.5µl of 10X Taq buffer (10mM Tris-HCl (pH 9.0), 50mM KCl, 15mM MgCl2), 25pM of each primer,200µM of each deoxyribonucleotide triphosphate and 1IU TaqDNA polymerase. Thermal profile for amplification of lktA gene consisted of denaturation at 94°C for 2min followed by 35 cycles of 94°C for 30s, 58°C for 40s and 72°C for 30s, with a final extension step at 72°C for 10min. Analysis of PCR products The PCR products were subjected to electrophoresis in 1 percent agarose (Genei, Bangalore) gels, using 1x Tris Borate EDTA buffer, containing 200ng/ml of ethidium bromide. The gels were visualized under ultraviolet illumination and photographed using gel- documentation system. RESULTS AND DISCUSSION Out of the ten hoof swabs examined, a total
RESEARCH ARTICLE
of five (50 percent) gave an amplicon size of 402 bp for lktA gene, which indicates the presence of F. necrophorum. None of the samples were found to be positive for D. nodosus. The detection of F. necrophorum on 50 percent hoof lesions of pigs suggests F. necrophorum is the major contributing factor for foot bush in pigs. This is consistent with the findings of Hickford et al., 2010, wherein a higher proportion of lame cattle were affected with F. necrophorum (53 percent), than D. nodosus (5 percent). Fig.1: PCR amplification of lktA gene of F. necrophorum
bush in pigs, than D. nodosus and has very important implications in herd health management. Presence of F. necrophorum in affected pigs can act as a potential source of infection to healthy animals in the farm, which on secondary infection with D. nodosus may lead to a much more severe condition. Outbreaks by mixed variants of F. necrophorum is not common, in contrast to report of the presence of upto seven strains of D. nodosus on a single claw (Zhou et al., 2001). Therefore this study can be further expanded to identify the strains of F. necrophorum prevalent in Kerala to develop an effective vaccine against foot bush in pigs. REFERENCES Dhungyel, O. P., Whittington, R. J. and Egerton, J. R. 2002.Serogroupspecifc single and multiplex PCR with pre-enrichment culture and immuno-magnetic bead capture for identifying strains of D. nodosus in sheep with footrot prior to vaccination. Mol. cell probes.16: 285-296. Falkler, W. A., Ewonwu, C. O. and Idigbe, E. O. 1999 Isolation of Fusobacterium necrophorum from cancrumoris (noma). Am. J. Trop. Med. Hyg. 60:150-156.
Lane 5: negative control This study may not be representative as the sample size was very low and was collected from a single farm; in addition, samples from healthy animals were not considered. This study suggests a hypothesis of an increased association of F. necrophorum with foot
Kortt, A. A., Burns, J. E. & Stewart, D. J. 1983. Detection of the extracellular proteases of Bacteroides nodosus in polyacrylamide gels: a rapid method of distinguishing virulent and benign ovine isolates. Res. Vet. Sci. 35: 171174.
JIVA Vol. 10
Lane 1, 2 and 3: samples, Lane 3: positive control
Hickford, J. G. H., Bennet, G. N and Zhou, H. 2010. The presence of Dichelobacternodosusand Fusobacterium necrophorum on the claws of th lame cattle of New Zealand. Proceedings of 4 Australasian Diary Science Symposium. pp. 428-431.
Issue 1 April 2012
Gradin, J. L. and Schmitz, J. A. 1977. Selective medium for isolation of Bacteroides nodosus. J. Clin. Microbiol. 6 (3) : 298-302.
15
RESEARCH ARTICLE
La Fontaine, S., Egerton, J. R. & Rood, J. I. 1993. Detection of Dichelobacter n o d o s u s using species-specific oligonucleotides as PCR primers. Vet. Microbiol. 35: 101-117. Mouttotou, N., Hatchell, F. M., Lundervold, M. and Green, L. E. 1997. Prevalence and distribution of foot lesions in finishing pigs in south-west England. Vet. Rec. 141(5): 115-20. Mouttotou, N., Hatchell, F. M. and Green, L. E. 1999. Foot lesions in finishing pigs and their associations with the type of floor. Vet. Rec. 144 (23): 629-32. Moore, L.J., Wassink, G.J., Green, L.E. and Grogono-Thomas, R. 2005. The detection and characterisation of Dichelobacternodosus from cases of ovine footrot in England and Wales. Vet. Microbiol.108: 57-67. Piriz, S., Hurtado, M. A., Valle, J., Mateos, E. M., Martin-Palomino, P. and Vadillo.S. 1996. Bacteriological study of footrot in pigs: a preliminary note. Vet. Rec. 139: 17-19. Radostits, O. M., Gay, C. C., Blood, D. C. and Hinchcliff, K. W. 2000. Veterinary Medicine: A textbook of the diseases of cattle, sheep, pigs, goats and horses.9th ed. Saunders Ltd. pp. 959-961.
J. Ind. Vet. Assoc., Kerala. 10 (1)
Skerman, T. M. 1989. Isolation and identification of Bacteroidesnodosus. In: Egerton, J. R., Yong, W. K., Riffkin, G. G. (Eds.), Footrot and Foot Abscess of Ruminants. CRC Press, Inc., Boca Raton, Florida, pp. 85104. Teshale, S. 2005. Recent footrot outbreak in Debrezeit swine farm, central Ethiopia. J. Vet. Sci.6 (4): 367-368.
16
Wani, S.A., Samanta I., Bhat M. A. and Buchh, A. S. 2004: Molecular detection and characterization of Dichelobacternodosus in ovine foot rot in India. Mol. Cell. Probes.18: 289-291. Wani S. A., Samanta, I. and Kawoosa, S. 2007: Isolation and characterization of Dichelobacternodosus from ovine and caprine footrot in Kashmir, India. Res. Vet. Sci. 83: 141-144. Zakaria, Z., Radu, S., Sheikh-Omar, A. R., Mutalib, A. R., Joseph, P. G. and Rusul, G. 1998. Molecular analysis of Dichelobacternodosus isolated from footrot in sheep in Malaysia. Vet. Microbiol. 62: 243-250. Zhou, H., Bennet, G. and Hickford, J. G. H. 2009. Variation of Fusobacterium necrophorum strains present on the hooves of footrot infected sheep, goats and cattle. Vet. Microbiol. 135: 363-367. Zhou, H, Dobbinsom, S. and Hickford, J. G. H. 2010. Fusobacterium necrophorum varients present on the hooves of lame pigs. Vet. Microbiol. 141: 390. Zhou, H., Hickford, J. G. H. and Amstrong, K, F. 2001. Rapid and accurate typing of Dichelobacternodosus using PCR amplification and reverse dot-blot hybridization. Vet. Microbiol. 80: 149-162.