JIVA 10.1 April 2012 by magnus paul

Vol. 10 Issue 1 April 2012

ISSN 0975-5195

JIVA JOURNAL OF INDIAN VETERINARY ASSOCIATION, KERALA AN OFFICIAL ORGAN OF INDIAN VETERINARY ASSOCIATION, KERALA www.jivaonline.net

EDITORIAL BOARD Chairman Dr. K. R. Arun Kumar

Editorial Advisor Dr. K. Vijayakumar, M.V.Sc.,Ph.D

Convener Dr. C. Sreekumar

President, IVA, Kerala

Joint Commissioner, Govt. of India

General Secretary IVA, Kerala

Chief Editor Dr. A.P. Usha, M.V.Sc., Ph.D

Editor Dr. Laiju M. Philip, M.V.Sc.

Website Editor Dr. K. Magnus Paul, M.V.Sc.

Associate Editors Dr. M. Ranjith Mohan, M.V.Sc. Dr. Hiron M Harshan, M.V.Sc.,Ph.D

Members Dr. M.G. Sajesh, M.V.Sc. Dr. P.M. Hari Narayanan, M.V.Sc. Dr. Bindya Liz Abraham, M.V.Sc.,Ph.D

INDEXED IN HINARI, EBSCO, SCOPEMED AND INDEX COPERNICUS INTERNATIONAL

JOURNAL OF INDIAN VETERINARY ASSOCIATION, KERALA (JIVA)

Journal of Indian Veterinary Association, Kerala (JIVA), the official organ of Indian Veterinary Association, Kerala is a quarterly scientific periodical with international status (ISSN-0975-5195) which bring about the latest updates in Veterinary Medicine and Animal Husbandry Practices. The journal covers almost all topics of Dairying and Animal Husbandry besides special emphasis on Companion Animal Medicine and Surgery, Zoo and Wildlife Medicine, Meat and Feed industry, Diagnostics and Bioinformatics. The Journal JIVA is in wide circulation among all stakeholders of Veterinary Medicine and Animal Husbandry sector including the Veterinary Professionals working with Animal Husbandry Department, Kerala Agricultural University, Kerala Livestock Development Board, Milma, Techno Park, Veterinary and Medical Research Institutes of the country. The Online edition is available at www.jivaonline.net JIVA is indexed in HINARI (World Health Organization), EBSCO (World's Foremost Premium Research Database Service), SCOPE MED (International Medical Journal Management and Indexing System) and INDEX COPERNICUS INTERNATIONAL.

Guidelines to Authors 1. 2. 3.

For publishing in the journal, article may be sent by email to editorjiva@gmail.com or laijuphilip@rediffmail.com Article may be sent typewritten in double space in A4 size paper. Review article, Research article from all fields of veterinary and animal sciences, Clinical Article/ Case Reports and General Article are invited. 4. Research Article and Clinical article may be in the following format; t Title t Author(s) t Designation tAbstract t Keywords t Introduction t Materials and methods t Result t Discussion t Acknowledgment t References t Contact details of Communicating Author 5. Title of the article should be clear and concise. 6. Introduction should clearly state the purpose/ aim/ objective of the article. 7. Authors and their affiliations should be mentioned below the title. 8. Word limit for Research and General Article is 2000 words, including tables, graphs etc. 9. Word limit for Clinical Article/ Case Report is 1500 words, including tables, graphs etc. 10. Tables, photographs, graphs etc. should bear the reference number (table 1, table 2 etc) and the title. 11. References should be arranged in alphabetical order and numbered. Reference should be given in the format; Name of the author (s), followed by year, Title, Name of the Journal, Volume, Issue and Page Number. Eg. Vegad, J.L. 2008. Bird flu- an overview: JIVA: 8(1):1-11 12. Articles are accepted on the understanding that these have neither been published nor submitted for publication in any other journal/ publication either in part or in full. 13. Processing and Publication Fees (For Authors Inside India) Initial Processing Fee For Articles : Rs. 100/Publication Fees : For Research Article and General Article :Rs. 200/- per author : For Clinical Reports/Article :Rs. 100/-per author Non - Members of Indian Veterinary Association, Kerala : Should Remit an Additional Amount of Rs. 500/- (for each author) Processing and Publication Fees (For Authors outside India ) Cheque for the amount Equalent to Rs. 2500/- to editor, JIVA Payment Methods Demand draft to 'EDITOR, JIVA' PAYABLE AT MANNARKKAD or Direct REMITTANCE TO THE ACCOUNT NUMBER OF EDITOR, JIVA â&#x20AC;&#x153;0048053000106612â&#x20AC;? ( IFSC CODE: SIBL0000048) THE SOUTH INDIAN BANK, MANNARKKAD.

FOR COMMUNICATION Chief Editor : +919446337800 Editor

: +919447996512 editorjiva@gmail.com

PUBLISHER Dr. Theodore John For Indian Veterinary Association, Kerala Veterinarian's Building TC 25/2068, Dharmalayam Road Thiruvananthapuram- 695 001

Printed at : Micro Printers, Mannarkkad, 04924-224318

JOURNAL OF INDIAN VETERINARY ASSOCIATION, KERALA Vol. 10 Issue 1 April 2012

CONTENTS RESEARCH ARTICLES

5 - 42

POLYMERASE CHAIN REACTION BASED DETECTION OF Mycoplasma gallisepticum IN CHICKEN Surya Sankar, G. Krishnan Nair, M. Mini and Hiron M. Harshan.........................................5

DIETARY PHYTASE SUPPLEMENTATION ON EGG QUALITY TRAITS IN WHITE LEGHORN STRAIN CROSS CHICKEN Sukumar. D and Jalaludeen. A................................................................................................9

MOLECULAR DETECTION OF PORCINE FOOT BUSH WITH ANAEROBIC ETIOLOGIES Liya Anto, Siju Joseph, M. Mini, Sheethal. G. Mohan, S. Vamshi Krishna, Abraham Joseph Pellissery and A. P. Usha...........................................................................13

STATISTICAL TOOLS FOR THE PRICING ISSUES IN MILK PRODUCTION IN KERALA Unnikrishnan T. and Ashok B...................................................................................................17

CLINICAL MANIFESTATIONS OF PROSTATIC DISEASES IN DOGS Kiren Menon, Krishnaswamy A and Honnappa T.G.............................................................24

DEVELOPMENT OF LEAN BEEF LOAF Naseera. A .P and George T. Oommen....................................................................................27

ANALYSIS OF INFORMATION NEEDS FOR DEVELOPING A MEDIA PROTOCOL IN SELECTED DISTRICTS OF HARYANA IN ANIMAL HUSBANDRY PRACTICES S. Sreehari, H.K. Gulati and A.K. Varma..................................................................................31

ANALYSIS OF SOCIO-PERSONAL PROFILE OF LIVESTOCK- BASED SELF HELP GROUP MEMBERS OF THRISSUR DISTRICT Anu George, P.J.Rajkamal and Jiji. R.S....................................................................................38

CLINICAL REPORT 9.

43 - 55

Oxyspirura mansoni IN BACKYARD POULTRY OF KERALA Deepu Philip Mathew, Priya M .N., Deepa C.K., Syamala K., Ajithkumar K. G. and Reghu Ravindran.......................................................................................................................43

10.

BBILATERAL INGUINAL HERNIA WITH DISTINCT HYSTEROCELE AND OMENTOCELE IN A DACHSHUND BITCH John Martin K. D., Susannah Bijee Philip, Sherin B. Sarangom and Ashay P. Kankonkar......45

11.

SURGICAL MANAGEMENT OF CERVICAL MUCOCELE IN A DOG Basavanagowda M.T., Joseph Cyrus, Md. AbidHussain and ShahidVaseem S.A..................48

12.

SURGICAL MANAGEMENT OF OVARIAN TUMOUR IN A BITCH Asha Abraham and P. Ravindran.............................................................................................49

13.

FETAL ANASARCA TWINS WITH HYDROALLANTOIS IN MALABARI DOES Laiju M Philip., M. Ranjith Mohan and P. Francis Bastin.....................................................52

14.

CLINICAL MANAGEMENT OF EXOCRINE PANCREATIC INSUFFICIENCY IN A GERMAN SHEPHERD DOG V. Dhanesh, Usha Narayanapillai, S. Yogeshpriya, Roshna RasheedKutty and S. Ajith Kumar...........................................................................................................................54

GENERAL ARTICLES

56 - 75

15.

METHANE EMISSION FROM RUMINANTS ENVIRONMENTAL IMPLICATIONS AND STRATEGIES FOR REDUCTION. Lalu. K., Usha. A.P., Venkatachalapathy.R.T and Prasanth.V................................................56

16.

TERMINATION OF PREGNANCY IN BITCHES Abhilash.R.S, Anil kumar.K, Biju.S and Ajith.K.S...................................................................60

17.

HOW TO IMPROVE THE LIVESTOCK SECTOR IN KERALA: SOME NUTRITIONAL THOUGHTS Ajith, K.S., Anil Kumar, K. and Dipu, M.T..............................................................................66

18.

EFFLUX PUMP INHIBITORS FOR ANTIBACTERIAL THERAPY Sumithra T G, Chaturvedi V K, Susan Cherian, Binsila B Krishnan and Siju Susan Jacob.....69

ASSOCIATION NEWS

The editor/editorial board and referees are in no way responsible individually or collectively for the views, data and technical details presented in the contributed papers

76 - 80

RESEARCH ARTICLE

POLYMERASE CHAIN REACTION BASED DETECTION OF Mycoplasma gallisepticum IN CHICKEN* Surya Sankar, G. Krishnan Nair, M. Mini and Hiron M. Harshan Department of Veterinary Microbiology, College of Veterinary and Animal Sciences, Mannuthy *Part of PhD. thesis submitted by the first author to Kerala Agricultural University, Thrissur

INTRODUCTION

Processing of Samples

Among the prevailing diseases of poultry, mycoplasmosis has become one of the most serious and frequently reported diseases throughout the world, causing considerable economic losses. Among the mycoplasma affecting poultry, Mycoplasma gallisepticum is the most pathogenic and responsible for chronic respiratory disease (CRD) in chicken and infectious sinusitis in turkey. Although the mortality among birds affected by the disease is not very high, the disease causes substantial losses as a result of downgrading and condemnation of carcasses, decreased egg production, poor hatchability, reduced feed conversion and retarded growth, as well as aggravation of various other disease conditions and also the high cost incurred during control programme (Kleven, 1998). The severity of the disease is greatly influenced by the degree of secondary infection with Newcastle disease and Infectious Bronchitis viruses and / or bacteria such as Escherichia coli.

Fifty swab samples collected in Mycoplasma broth were removed after four hour of incubation and one ml of the broth was transferred aseptically into sterile eppendorf tubes in a laminar airflow cabinet for the preparation of template DNA for Mycoplasma genus-specific PCR. The remaining broth media were further incubated till an appreciable colour change of the broth to orange or yellow was evidenced or up to 21 days, whichever was earlier. Twenty five samples were directly plated on to the Mycoplasma agar plates also.

Pure colonies of Eschericia coli, Staphylococcus aureus and Pasturella multocida were inoculated separately in to five ml of Brain heart infusion (BHI) broth and incubated at 370C for 18 h. From this broth culture, 2 ml was transferred to an eppendorf tube and centrifuged at 3000 Ă&#x2014; g for 10 min. The supernatant was discarded and the pellet was washed twice with sterile PBS. The final pellet was re-suspended in 50Fl of triple distilled water. The mixture was boiled for 10 min and immediately chilled on ice for 30 min. The samples were thawed and centrifuged at 3000Ă&#x2014; g for 5 min and supernatant 0 was stored at -20 C for further use as template for PCR reactions.

Issue 1 April 2012

A total of 50 samples were obtained from sick/apparently healthy birds of different age groups from University Poultry Farm, Mannuthy; poultry farms in different parts of Kerala; birds brought for disease diagnosis to the Department of Veterinary Microbiology; birds necropsied in Centre of Excellence in Pathology and College of Veterinary and Animal Sciences, Mannuthy.

Extraction of DNA from other bacterial strains

Vol. 10

Source of samples

The extraction of DNA was performed according to a previously described procedure (Liu et al., 2001).

JIVA

MATERIALS AND METHODS

Extraction of DNA from clinical samples

RESEARCH ARTICLE

Polymerase chain reaction Mycoplasma genus-specific primers GPO3 and MGSO (Marois et al., 2000) and Mycoplasma gallisepticum Species Specific primers MG IGSR F and MG IGSR R (Raviv et al., 2007) were used in the study. 5' GGG AGC AAA CAG GAT TAG ATA CCC T 3' (Forward)

from E .coli, S. aureus and P. multocida were also included to check the specificity of primers selected in the study. The tubes were placed in a thermal cycler (Eppendorf Master Cycler). The reaction protocol was as follows 90 C for 1 min

40 cycles

Denaturation

95 C for 15 sec

Annealing

580C for 20 sec

Elongation

750C for 20 sec

Denaturation

95 C for 15 sec

Annealing

58 C for 45 sec

Elongation

750C for 5 min

5' TGC ACC ATC TGT CAC TCT GTT AAC CTC 3' (Reverse) Mycoplasma gallisepticum species specific primers MG IGSR F and MG IGSR R 5' GTA GGG CCG GTG ATT GGA GTT A 3' (Forward) 5' CCG GTA GCA TTT CGC AGG TTT G 3' (Reverse) Primers were obtained as custom made 100 mM standard desalted oligonucleotides with OD-260 values of 17.2 (forward) and 18.1 (reverse) from Genetrix, Bangalore

J. Ind. Vet. Assoc., Kerala. 10 (1)

The PCR reaction was carried out as per Marois et al. (2000) with slight modifications. A 25Fl reaction mixture was set up for the single PCR reaction consisting of 10 PCR assay buffer

2.5Fl

MgCl2 (0.5 mM)

0.5Fl

Forward primer (20 pM)

1 Fl

Reverse primer (20 pM)

1 Fl

dNTP's (100 FM)

1 Fl

Taq DNA Polymerase

1 Fl

Template DNA Triple distilled water

One cycle of

Samples that tested positive by genus specific PCR were further subjected for M. gallisepticum specific reactions. The PCR reaction was carried out according to Raviv et al. (2007), with some modifications. A 25Fl reaction mixture was set up for the single PCR reaction consisting of 10 PCR assay buffer

2.5Fl

MgCl2 (0.5 mM)

0.5Fl

Forward primer (20 pM)

1Fl

Reverse primer (20 pM)

1Fl

dNTP's (100 M)

1Fl

Taq DNA Polymerase

1Fl

Template DNA

5Fl

Triple distilled water

13Fl

The reaction protocol was as follows Initial denaturation

94 C for 3 min

Denaturation

940C for 20 sec

5 Fl

Annealing

550C for 30 sec

13 Fl

Elongation

72 C for 60 sec

Final extension

72 C for 5 min

One negative control with triple distilled water substituting the template DNA and one positive control incorporating template DNA from the reference strain (Mycoplasma gallisepticum 6/85) were incorporated. Template DNA prepared 6

Initial denaturation

30 cycles

Identification of PCR product Submarine agarose gel electrophoresis was performed using 1 percent agarose in 1 TBE buffer

RESEARCH ARTICLE

S p e c i e s d i f f e re n t i a t i o n o f a v i a n Mycoplasma from clinical samples The positive samples in genus specific PCR were subsequently subjected to a species specific PCR using another set of selected primers.

The samples were thoroughly agitated in the broth and kept at 37°C under 5-10 percent CO2 tension in screw capped tubes. The agar plates containing the same samples were also kept under similar conditions in a humid atmosphere. One ml of broth culture from each sample was taken after a period of four hours and processed for the extraction of genomic DNA. Remaining broth cultures were incubated as mentioned above. The agar plates were observed daily under microscope (10x) for the presence of any colonies. The genomic DNA of E. coli, S. aureus and P. multocida were also extracted for checking the specificity of the selected primers. After extraction of the genetic material, PCR was carried out using Mycoplasma genus specific primers.

Agar gel electrophoresis of the amplified PCR products were carried out along with a positive control and negative control in 0.5 × TBE buffer. A positive PCR was indicated by the presence of a band in the 660 bp region in the test and positive control samples. Out of the eight genus-specific PCR positive samples subjected to species specific PCR, only one sample was fount positive.

Mycoplasma genus specific polymerase chain reaction

Mycoplasma species specific PCR samples cultured on PPLO agar

The primers GPO3 and MGSO were used in this study for the amplification of DNA from Mycoplasma.

The individual colonies observed after 3 days on the 25 agar plates streaked with samples were picked up and put in PPLO broth and kept at 37°C under 5-10 per cent CO2 tension. The broth tubes were daily examined for colour change from pink to orange or yellow. Samples from those tubes with colour change were used for extraction of DNA. The species specific PCR was carried out in above mentioned conditions.

The amplified products were visualized by sub-marine agarose gel electrophoresis. A positive PCR result for Mycoplasma was indicated by the presence of a 270 bp fragment in electrophoresed gel under UV transillumination, whereas, no amplification indicated a negative result. In negative control, amplification was not detected and in positive control (reference strain 6/85) 270 bp band was observed. The DNA prepared from E. coli, S. aureus and P. multocida did not evidence any amplification with these primers, indicating the specificity of the selected primers (Fig. 1). Out of the total 50 samples (collected in broth and agar) subjected to genus-specific PCR, 12

Mycoplasma species specific PCR samples collected in PPLO broth The primers MG IGSR F and MG IGSR R could not amplify the DNA isolated from E. coli, S. aureus and P. multocida.

Among the twenty five samples swabbed onto agar, 12 were positive in genus specific PCR and these samples were further subjected to species specific PCR. Out of these samples, three were positive in species specific PCR. Specificity of the primers was indicated by the absence of amplification of DNA from other bacterial species tested. (Fig. 2).

Issue 1 April 2012

Processing and detection of avian Mycoplasma in clinical samples

Vol. 10

RESULTS AND DISCUSSION

were found positive. These included eight samples collected both in PPLO broth and streaked on to agar. Four more samples from agar plates also gave a positive result. Thus, a total of 12 samples were positive for Mycoplasma genus specific PCR.

JIVA

as the matrix. The gel was visualized under UV transilluminator (Hoefer, USA) and the results were documented on gel documentation system.

RESEARCH ARTICLE

Among the samples inoculated in broth, only eight were found positive for genus specific PCR whereas, in case of those plated onto PPLO agar, 12 were positive. Out of these 12, four samples were negative for PCR, when collected in broth. Thus, a total of 12 samples (including the four samples that were additionally positive when collected onto PPLO agar plates) were positive for genus specific PCR. This was in agreement with the finding that for the isolation of avian Mycoplasma, solid medium was found to be more effective than liquid medium (Ronglian et al., 1996).

Fig. 2. Agarose gel electrophoresis of Mycoplasma gallisepticum species specific PCR products

Isolation of Mycoplasma gallisepticum from PCR positive samples Out of the four samples which gave a positive result for species specific PCR, Mycoplasma could be isolated from three. This might be due to the fact that the viability of the organism in the sample did not

J. Ind. Vet. Assoc., Kerala. 10 (1)

Fig. 1. Agarose gel electrophoresis of Mycoplasma genus specific PCR product

Lane M: Molecular weight marker Lane 1, 2, 3, 4: Mycoplasma isolate Lane 5: Reference strain 6/85 Lane 6: Negative control 8

Lane M: Molecular weight marker Lane 1, 2, 3, 4: M. gallisepticum isolate Lane 5: Reference strain 6/85 Lane 6: Negative control REFERENCES Kleven, S.H. 1998. Mycoplasmas in the etiology of multifactorial respiratory disease. Poult. Sci. 77:1146-1149. Liu, T., Garcia, M., Levisohn, S., Yogev, D. and Kleven, S.H. 2001. Molecular variability of the adhesin-encoding gene pvpA among Mycoplasma gallisepticum strains and its application in diagnosis. J. Clin.Microbiol. 39: 1882-1888. Marois, C., Oufour-Gesbert, F. and Kempf, I. 2000. Detection of Mycoplasma synoviae in poultry environment samples by culture and polymerase chain reaction. Vet. Microbiol. 73: 311-318. Raviv, Z., Callison, S., Ferguson-Noel, N., Laibinis, V., Wooten, R. and Kleven, S. H. 2007. The Mycoplasma gallisepticum 16S-23S rRNA Intergenic Spacer Region Sequence, as a Novel Tool for Epidemiological Studies. Avian Dis. 51: 555-560. Ronglian, H., Jun, H., Herong, D., Meuji, L., Xianwen, D., Jian, D., Shuilian, Y., Huang, J., Deng, H.R., Lan, M.Y., Deng, X.W., Du, J. and Yang, S.L. 1996. Isolation and identification of Mycoplasma gallisepticum in chicken flocks in Guangxi. Chinese J. Vet. Med. 22: 9-11.

RESEARCH ARTICLE

DIETARY PHYTASE SUPPLEMENTATION ON EGG QUALITY TRAITS IN WHITE LEGHORN STRAIN CROSS CHICKEN Sukumar. D1 and Jalaludeen. A2 College of veterinary and Animal Sciences Mannuthy

ABSTRACT One hundred and fifty White Leghorn strain cross pullets (Athulya) were subjected to evaluate the effect of Phytase enzyme on certain egg quality parameters. The birds were grouped in to five treatments, viz., control (T1), fed with standard layer ration, T2, fed with low available Phosphorus layer ration. T3, T4 and T5 groups were formed with supplementation of 200, 300 and 400 units of enzyme per kg feed, respectively in T2 diet. Significant improvement (p<0.01) was noticed in egg weight, egg shell thickness, egg shell weight and egg specific gravity. Based on the egg quality traits studied it was found that, supplementation of 200 units of phytase per kg of low available phosphorus layer diet, the available phosphorus level in the feed could be reduced to 0.3 percent.

1. Assistant Professor, Dept. Of Poultry Science, COVAS, Mannuthy 2. Director of Academics and Research, KVASU

Materials and methods: One hundred and fifty, 18 weeks old White Leghorn strain cross, â&#x20AC;?ATHULYAâ&#x20AC;? pullets formed the subjects of this experiment. The birds were grouped in five treatments each with three replicates of ten birds each and reared up to forty weeks of age. Two types of ration viz. standard layer ration as per BIS (1992) and layer ration with low available phosphorus were used in this study.Low available Phosphorus layer ration was formulated keeping the level of available phosphorus at 0.3 percent without including DCP. The levels of all other nutrients were similar to that of standard layer ration. The enzyme used in this study was NATUPHOS -5000 a Phosphatase enzyme of fungal origin (Aspergillus sp)

Issue 1 April 2012

As Poultry population in the Country is increasing rapidly, Poultry feed requirement is also increasing in a huge quantity. Cereals and plant materials which constitute major part of Poultry feeds contain phosphorus in the form of Phytic acid. Only 30 percent of plant phosphorus can be utilized by poultry and the remaining part excreted and causes environmental pollution by eutrophication .In addition, the phytic acid may combine with inorganic elements such as calcium, magnesium, sodium, potassium, etc. in the diet and make it unavailable for the birds. In order to make it biologically available, it is necessary to hydrolyse the phytin by a phosphatase enzyme, phytase. Absence of phytase in the digestive tract of poultry necessitates the use of extraneous source of enzyme and thereby avoids the addition of other phosphorus source in poultry ration. Dicalcium Phosphate (DCP) is a costly feed ingredient usually added in poultry feed as a phosphorus source. So

incorporation of phytase can eliminate addition of DCP. Also phosphorus have major role in improving the shell quality which there by avoids easy breakage of eggs and increase keeping quality. Hence a study on supplementation of phytase enzyme on egg quality traits in White Leghorn strain cross Chicken was carried out.

JIVA Vol. 10

INTRODUCTION

RESEARCH ARTICLE

containing phytase as the only component. The five treatments are as follows.

comparable. Among the low available phosphorus layer ration fed groups, significant (P < 0.01) increase in egg weight in the enzyme supplemented groups may be attributed to the significantly increased shell thickness noticed in these groups. The result of this trait closely agree with reports made by Gordon and Roland (1997), Gordon and Roland (1998), Hadorn and Weidmer (1998) and Rao et.al (1999) ,whereas Carlos and Edwards (1998) could not observe any improvement in egg size with supplementation of Phytase may be due to variation in egg weight by change in season, clutch size, body weight, age at sexual maturity and management problems.

T1 - Birds fed with Standard layer diet. T2 - Birds fed with Low available phosphorus Layer ration (0.3 percent) T3 - T2 + 200 units of Phytase T4 - T2 + 300 units of Phytase T5 - T2 + 400 units of Phytase Feed and water were provided ad libitum. Egg weight , egg shell thickness, egg shell weight and egg specific gravity were recorded at the end of each 28-days period with 4 eggs randomly selected from each replicate for three consecutive days. Egg shell thickness was measured using shell thickness measure gauge and egg specific gravity was obtained by Brain floatation technique developed by Tyler and Geake (1961).

Table 1.Percent chemical composition of experimental diets (on dry matter basis) Nutrients

RESULTS AND DISCUSSION Mean egg weight, egg shell thickness, egg shell weight and egg specific gravity as influenced by phytase supplementation is given in Table.2 and Fig 1 . Perusal of mean egg weight data indicated that birds fed a low available phosphorus layer ration (Table 1) without enzyme (T2) laid eggs with significantly (p<o.o1) lower weight than other groups, whereas the groups fed with Standard layer ration (T1) and all the enzyme supplemented groups (T3,T4 and T5) were statistically

Standard Low available Layer ration phosphorus layer ration

Crude Protein

18.3

18.200

Ether extract

4.13

4.180

Crude fibre

6.810

6.970

Total ash

16.430

16.630

Acid insoluble ash

3.810

3.740

Calcium

03.120

03.030

Total Phosphorus

0.921

0.782

0.500

0.320

Available Phosphorus

*Calculated value

J. Ind. Vet. Assoc., Kerala. 10 (1)

Table 2. Egg quality parameters as influenced by phytase supplementation.

Parameters

Treatments T1

Egg weight (g)*

50.17a

49.07b

51.16a

50.26a

50.19a

Egg shell thickness(mm)*

0.334

0.329

0.354

Egg shell weight (g)*

5.85d

5.77d

Egg specific gravity*

1.087c

1.083d

0.342

0.345

6.34a

6.05c

6.18b

1.094a

1.091b

RESEARCH ARTICLE

*Significant (p<0.01).

The mean egg shell thickness as influenced by supplementation of phytase given in Table 2, and in figure 1 ,revealed that it was significantly higher (p<0.01) with birds offered a low available Phosphorus layer ration supplemented with 200 phytase units per kilogram feed. The overall trend showed that all enzyme supplemented group registered higher (p<0.01) egg shell thickness than other treatments. The egg shell thicknesses of low available Phosphorus layer ration fed birds (T2) were significantly lower than all other treatments. Though standard layer ration fed birds recorded significantly higher egg shell thickness than the low available Phosphorus layer ration given birds ,it was lower (p<0.01) than the phytase supplemented groups. Perusal of the mean egg shell weight, indicated that, it was significantly (p<0.01) more with the group offered a low available Phosphorus layer ration added with 200 units of Phytase per Kilogram. It was also observed that all the enzyme supplemented groups had significantly higher egg shell weight than other treatments, but the group fed with 200 units of phytase added feed showed significantly (p<0.01) higher egg shell weight than the other two groups. The beneficial effects of phytase on egg shell quality were well documented by Lettner et al. (1995), Kaminiska et al. ( 1996), Gordon and Roland (1998) and Rao et al. (1999). However, Panda et al. (2010), also opined that addition of phytase to the 1.2g/kg low phosphorus diet improved both shell weight and shell thickness.

Issue 1 April 2012

days).

FIG.1. EGG QUALITY TRAITS AS INFLUENCED BY PHYTASE SUPPLEMENTATION

JIVA Vol. 10

Mean values of 5 experimental periods (28

RESEARCH ARTICLE

Gordon, R.W and Roland D.A 1998. Influence of supplemental phytase on Calcium and Phosphorous utilization in laying hens. Poult.Sci. 77: 290-294. Hardon , R. and Weidmer, H. 1998. The effect of phytase addition in a phospherous reduced layer diet. Archiv - fur - Geflugelkunide. 62 (3) : 97-103. Jensen, F. 1996. Biotechnology and poultry nutrition proceedings , XX World's poultry congress. NewDelhi . India . 2-5 September 1996, p . 305.

All the enzyme supplemented groups had significantly (p<0.01) higher specific gravity than the other two groups. Among the enzyme supplemented groups, the group fed with 200 units of phytase showed highest egg specific gravity. Findings of the present study agree with the result opined by Roland and Gordon (1996) and Gordon and Roland (1998). Addition of phytase to the diet could have led to the release of phosphorus and other minerals from phytic acid which in turn causes improvement in shell quality. Based on the findings of this study it can be inferred that by the inclusion of 200 units per kg of phytase in layer diet, the available phosphorus levels in the feed can be reduced to 0.3 percent without affecting the overall performance.

J. Ind. Vet. Assoc., Kerala. 10 (1)

REFERENCES Carlos, A. B and Edwards, H.M 1998. The effects of 1,25 dihydroxy cholecalciferol and phytase on the natural phytate phosphorous utilization by laying hens. Poult. Sci. 77 : 850-858. Gordon R.W and Roland D.A 1997. Performance of Commercial laying hens fed various phosphorous levels with and without supplemental phytase. Poult. Sci . 76 : 11171179.

Kaminska, B.Z. 1997. Effects of supplemental phytase to laying hen diets of different phosphorous content . J. Anim . Feed Sci. 6 (3) : 369 -378. Kaminska, B.Z ., Skraba, B. and Koreleski, J. 1996. Effect of supplemental phytase to laying hen diets of different phosphorous content, J . Anim. Feed Sci. 6 (30) : 369-378. Kaminska , B.Z., Skraba, B. and Koreleski, J. 1996. Effect of dietary phosphorous level and supplemental phytase on performance of Hisex brown laying hens and egg shell quantity. J Anim. Feed sci . 5(30) : 249-529. Lettner, F., Zollitsch, W. and Preining, F. 1995. Enzyme preparation in complete layer diets. Use of Natuphos and phosphorous reduction. Forderungsdieust. 43 (11) : 350-352. Nelson, T.S., Sheieh, T. R., Wodzinski, R. J and Ware, J. H 1968. The availiabilty of phytate phosphorous in soybean meal before and after treatment with mold phytase. Poult. Sci. 47 (5) : 1842-1848. Rao, S.V.R., Reddy, V.R and Ramasubbrareddy, V.1999. Enhancement ofphytase phosphorus availability in the diets of Commercial broilers and layers. Anim. Feed Sci. Tech.79:211-222. Tyler, C. And Geake,F.H 1961. Studies on egg shell: critical appraisal of various methods of assessing shell thickness. J. Sci. Food Agri. 12:281-280.

RESEARCH ARTICLE

MOLECULAR DETECTION OF PORCINE FOOT BUSH WITH ANAEROBIC ETIOLOGIES 1

Liya Anto , Siju Joseph , M. Mini , Sheethal. G. Mohan , S. Vamshi Krishna , 6 7 Abraham Joseph Pellissery and A. P. Usha College of Veterinary and Animal Sciences, Mannuthy.

ABSTRACT Foot bush in most instances is more comparable to foot abscess in pigs. Foot rot is primarily caused by damage to the hooves or the tissue surrounding the hooves, which allows a bacterial infection to set in and develop. Multiple etiologies are involved in the commencement of this disease, which include both aerobic and anaerobic organisms. The most commonly detected anaerobic etiology in foot rot in pigs is Fusobacteriumnecrophorum (F. necrophorum), followed by Dichelobacternodosus (D. nodosus). There was severe lameness in pigs characterized by separation of hard horny wall from the heel, oedema and abscessation. 26 cases of pigs which showed severe foot lesions were reported, of which ten representative samples were collected. All samples were processed and DNA was extracted. They were subjected to polymerase chain reaction using species specific 16S r RNA and lktA gene primer pairs for D. nodosus and F. necrophorum respectively. Out of the samples screened, none were positive for D. nodosus and two yielded an amplicon size of 402 bp of lktA gene indicating the presence of F. necrophorum.

1,2,3,4,5

Department of Veterinary Microbiology, College of Veterinary and Animal Sciences, Mannuthy. 6

Department of Veterinary Biochemistry, College of Veterinary and Animal Sciences, Mannuthy. 7

Centre for Pig Production and Research, College of Veterinary and Animal Sciences, Mannuthy.

Traditionally the identification of D. nodosus and F. necrophorum are carried out by isolation of the organism from the hoof of affected animals, its staining and biochemical characterization (Kortt et. al., 1983; Skerman, 1989; Smith et. al., 1991; Falkler et. al., 1999). Isolation of these bacteria from clinical samples is less confirmatory, very difficult, time consuming and require additional growth supplements (Smith et. al., 1991; Falkler et. al., 1999; Gradin and

Issue 1 April 2012

Foot bush, which is also known as footrot in pigs is similar clinically to footrot in other species, like sheep, goat and cattle. Foot lesions are common and have been reported in all age groups of swine(Mouttotou et. al., 1999). But footrot is relatively not common in pigs as compared to other species. Factors which predispose pigs to foot bush include rough and abrasive flooring, wet underfoot, dietary deficiency and dirty environments (Mouttotou et. al., 1999; Radostits et. al., 2000). Foot bush in pigs is caused by multiple bacterial etiologies. Detection of Fusobacterium necrophorum (Zhou et al., 2010), Dichelobacternodosus, Staphylococcus spp., Streptococcus spp

( Te s h a l e , 2 0 0 5 ) , A rc a n o b a c t e r p y o g e n e s (Radostits, 2000), Prevotella, Peptostreptococcus, Porphyromonas, Bacteroides and Eubacterium (Piriz et. al., 1996) from the lesions of limbs of pigs have been reported. Among these, two species of anaerobic bacteria are constantly found associated with foot bush in pigs: Fusobacterium necrophorum (Radostits et. al., 2000; Zhou et. al., 2010) and Dichelobacternodosus (Radostits et al., 2000; Teshale, 2005).

JIVA Vol. 10

INTRODUCTION

RESEARCH ARTICLE

Schmithz, 1977). So recently molecular techniques like polymerase chain reaction using 16S rRNA (LaFontaine et al., 1993; Zakaria et al., 1998,Wani et al., 2004; Moore et al., 2005) or fimA gene sequences (Dhungyel et. al., 2002) for D. nodosus and lktA gene sequences (Zhou et. al., 2009; Hickford et. al., 2010) for F. necrophorum were tried and observed to yield rapid, confirmatory and sensitive diagnosis of these bacteria in clinical samples. The present study was conducted to screen the samples from animals of Centre for Pig Production and Research, Mannuthy, having severe foot lesions and lameness.

CT3' (reverse)(La Fontaine et al., 1993; Moore et al., 2005; Wani et. al., 2007). The PCR amplifications were performed in 25µl volumes. The final concentration contained 2µl of template, 2.5µl of 10X Taq buffer (10mM Tris-HCl (pH 9.0), 50mM KCl, 15mM MgCl2), 25pM each of forward a n d r e v e r s e p r i m e r, 2 0 0 µ M o f e a c h deoxyribonucleotide triphosphate and 1IU TaqDNA polymerase. The amplification was carried out in a thermal cycler (Eppendorf) with an initial denaturing step of 94°C for 10min, followed by 35 cycles of 94°C for 1min, 58°C for 30s and 72°C for 30s, with a final extension step at 72°C for 5min.

MATERIALS AND METHODS

PCR detection of F. necrophorum

Collection of samples

F. necrophorum was detected by PCR amplification of leukotoxin (lktA) gene using primers 5'AATCGGAGTAGTAGGTTCTG-3' (Forward) and 5'CTTTGGTAACTG CCACTGC3' (Reverse) (Zhou et al., 2009). The PCR amplifications were performed in 25µl volumes.

Severe lameness and foot lesions were reported in 26 pigs of Centre for Pig Production and Research, Mannuthy. Lesions were characterized by hot, painful, swollen limbs, separation of hard horny wall from the heel and abscessation. Animals were unable to stand or take feed. Representative samples were taken from 10 pigs using sterile cotton swabs (Hi-Media, Mumbai) from the deeper portion of the lesion and were transported quickly to the laboratory.

J. Ind. Vet. Assoc., Kerala. 10 (1)

Extraction of bacterial DNA The samples were processed to isolate the DNA of the pathogens by crude method. The samples were suspended in 200µl of sterile phosphate buffered saline (PBS), boiled for 10min, immediately chilled on ice for 5 min and centrifuged at 15000 rpm for 10min. The supernatant was collected and stored in 1.5ml microcentrifuge tubes, which were later used as templates for PCR reaction. PCR detection of D. nodosus D. nodosus was detected by PCR amplification of 16S rRNA using primers 5'CGGGGTTATGTAGCTTGC3' (forward) and5'TCGGTACCGAGTATTTCTACCCAACAC

The final concentration contained 2µl of template DNA, 2.5µl of 10X Taq buffer (10mM Tris-HCl (pH 9.0), 50mM KCl, 15mM MgCl2), 25pM of each primer,200µM of each deoxyribonucleotide triphosphate and 1IU TaqDNA polymerase. Thermal profile for amplification of lktA gene consisted of denaturation at 94°C for 2min followed by 35 cycles of 94°C for 30s, 58°C for 40s and 72°C for 30s, with a final extension step at 72°C for 10min. Analysis of PCR products The PCR products were subjected to electrophoresis in 1 percent agarose (Genei, Bangalore) gels, using 1x Tris Borate EDTA buffer, containing 200ng/ml of ethidium bromide. The gels were visualized under ultraviolet illumination and photographed using gel- documentation system. RESULTS AND DISCUSSION Out of the ten hoof swabs examined, a total

RESEARCH ARTICLE

of five (50 percent) gave an amplicon size of 402 bp for lktA gene, which indicates the presence of F. necrophorum. None of the samples were found to be positive for D. nodosus. The detection of F. necrophorum on 50 percent hoof lesions of pigs suggests F. necrophorum is the major contributing factor for foot bush in pigs. This is consistent with the findings of Hickford et al., 2010, wherein a higher proportion of lame cattle were affected with F. necrophorum (53 percent), than D. nodosus (5 percent). Fig.1: PCR amplification of lktA gene of F. necrophorum

bush in pigs, than D. nodosus and has very important implications in herd health management. Presence of F. necrophorum in affected pigs can act as a potential source of infection to healthy animals in the farm, which on secondary infection with D. nodosus may lead to a much more severe condition. Outbreaks by mixed variants of F. necrophorum is not common, in contrast to report of the presence of upto seven strains of D. nodosus on a single claw (Zhou et al., 2001). Therefore this study can be further expanded to identify the strains of F. necrophorum prevalent in Kerala to develop an effective vaccine against foot bush in pigs. REFERENCES Dhungyel, O. P., Whittington, R. J. and Egerton, J. R. 2002.Serogroupspecifc single and multiplex PCR with pre-enrichment culture and immuno-magnetic bead capture for identifying strains of D. nodosus in sheep with footrot prior to vaccination. Mol. cell probes.16: 285-296. Falkler, W. A., Ewonwu, C. O. and Idigbe, E. O. 1999 Isolation of Fusobacterium necrophorum from cancrumoris (noma). Am. J. Trop. Med. Hyg. 60:150-156.

Lane 5: negative control This study may not be representative as the sample size was very low and was collected from a single farm; in addition, samples from healthy animals were not considered. This study suggests a hypothesis of an increased association of F. necrophorum with foot

Kortt, A. A., Burns, J. E. & Stewart, D. J. 1983. Detection of the extracellular proteases of Bacteroides nodosus in polyacrylamide gels: a rapid method of distinguishing virulent and benign ovine isolates. Res. Vet. Sci. 35: 171174.

JIVA Vol. 10

Lane 1, 2 and 3: samples, Lane 3: positive control

Hickford, J. G. H., Bennet, G. N and Zhou, H. 2010. The presence of Dichelobacternodosusand Fusobacterium necrophorum on the claws of th lame cattle of New Zealand. Proceedings of 4 Australasian Diary Science Symposium. pp. 428-431.

Issue 1 April 2012

Gradin, J. L. and Schmitz, J. A. 1977. Selective medium for isolation of Bacteroides nodosus. J. Clin. Microbiol. 6 (3) : 298-302.

RESEARCH ARTICLE

La Fontaine, S., Egerton, J. R. & Rood, J. I. 1993. Detection of Dichelobacter n o d o s u s using species-specific oligonucleotides as PCR primers. Vet. Microbiol. 35: 101-117. Mouttotou, N., Hatchell, F. M., Lundervold, M. and Green, L. E. 1997. Prevalence and distribution of foot lesions in finishing pigs in south-west England. Vet. Rec. 141(5): 115-20. Mouttotou, N., Hatchell, F. M. and Green, L. E. 1999. Foot lesions in finishing pigs and their associations with the type of floor. Vet. Rec. 144 (23): 629-32. Moore, L.J., Wassink, G.J., Green, L.E. and Grogono-Thomas, R. 2005. The detection and characterisation of Dichelobacternodosus from cases of ovine footrot in England and Wales. Vet. Microbiol.108: 57-67. Piriz, S., Hurtado, M. A., Valle, J., Mateos, E. M., Martin-Palomino, P. and Vadillo.S. 1996. Bacteriological study of footrot in pigs: a preliminary note. Vet. Rec. 139: 17-19. Radostits, O. M., Gay, C. C., Blood, D. C. and Hinchcliff, K. W. 2000. Veterinary Medicine: A textbook of the diseases of cattle, sheep, pigs, goats and horses.9th ed. Saunders Ltd. pp. 959-961.

J. Ind. Vet. Assoc., Kerala. 10 (1)

Skerman, T. M. 1989. Isolation and identification of Bacteroidesnodosus. In: Egerton, J. R., Yong, W. K., Riffkin, G. G. (Eds.), Footrot and Foot Abscess of Ruminants. CRC Press, Inc., Boca Raton, Florida, pp. 85104. Teshale, S. 2005. Recent footrot outbreak in Debrezeit swine farm, central Ethiopia. J. Vet. Sci.6 (4): 367-368.

Wani, S.A., Samanta I., Bhat M. A. and Buchh, A. S. 2004: Molecular detection and characterization of Dichelobacternodosus in ovine foot rot in India. Mol. Cell. Probes.18: 289-291. Wani S. A., Samanta, I. and Kawoosa, S. 2007: Isolation and characterization of Dichelobacternodosus from ovine and caprine footrot in Kashmir, India. Res. Vet. Sci. 83: 141-144. Zakaria, Z., Radu, S., Sheikh-Omar, A. R., Mutalib, A. R., Joseph, P. G. and Rusul, G. 1998. Molecular analysis of Dichelobacternodosus isolated from footrot in sheep in Malaysia. Vet. Microbiol. 62: 243-250. Zhou, H., Bennet, G. and Hickford, J. G. H. 2009. Variation of Fusobacterium necrophorum strains present on the hooves of footrot infected sheep, goats and cattle. Vet. Microbiol. 135: 363-367. Zhou, H, Dobbinsom, S. and Hickford, J. G. H. 2010. Fusobacterium necrophorum varients present on the hooves of lame pigs. Vet. Microbiol. 141: 390. Zhou, H., Hickford, J. G. H. and Amstrong, K, F. 2001. Rapid and accurate typing of Dichelobacternodosus using PCR amplification and reverse dot-blot hybridization. Vet. Microbiol. 80: 149-162.

RESEARCH ARTICLE

STATISTICAL TOOLS FOR THE PRICING ISSUES IN MILK PRODUCTION IN KERALA Unnikrishnan T.1 and Ashok B.2 Kerala Veterinary and Animal Science University

ABSTRACT The main objectives of this study included assessment of trend and growth rates of milk production, milk price and feed price, correlation between the variables and testing the linear regression equations with the highly correlated variables for prediction purposes. Yearly secondary data on milk production, wage of labourer, human population, cattle population, milk price and feed price collected from various economic reviews of Government of Kerala for the period from 1991-92 to 2009-10 were used for the analysis.

1. Academic Consultant, Dept. of Statistics, Kerala Veterinary and Animal Science University 2. Former Vice Chancellor, Kerala Veterinary and Animal Science University

The other main problem behind the low interest in dairy farmers is the decreased cultivation of paddy also increased the need for cattle feeds. Almost 90 per cent of the raw materials needed for the compounded cattle feed are coming from nearby state. Hence there need to have a sustenance mechanism where in the milk price should be determined by the in farm factors which affects its production such as rate of feed ingredients, labour charge etc. Statistics on diverse facets of milk production are required both to focus on the problems confronting farming as well as farmers in Kerala in the context of emerging challenges in the economy, and to throw light on priority areas in need of policy intervention. One cannot spell out exactly where forecasts are more frequently needed as the forecasting techniques have become essential features in all the ministries, establishments, public and private sectors. As the food security corner of Kerala is concerned, such a forecasting will cradle the government to tide over grim situations with ease.

Issue 1 April 2012

Despite, Kerala's milk production has an increasing nature; there was a huge gap between its productivity and demand for milk and milk products. The major demand for milk in the State is met by import from neighboring states and reconstituted milk. Hence, the milk price is mainly controlled by organized sectors which hold only 16 percent of the total milk produce and administrative authorities and secondary market holders, where the price is often based on the indices such as fat and SNF. The dairy farmers, who are having a very marginal profitability, do not have control over the milk price fluctuations. Also the laborers are moving towards more remunerative fields than the agricultural sector and the social status of the youth who are expecting white collar jobs do not want to take up any type of animal husbandry activity. This made the shortage of labour in the state so that the interested poor farmer who was living with the income moved away from this sector due to increased cost of production and less profit. In Kerala, the main problem for the farmer is concerned

every time the farmers' price is hiked; the consumer price has gone up, because the government does not offer subsidy while nearby states Karnataka and Tamil Nadu gives a subsidy of Rs 2 and Rs 2.50 respectively per litre of milk.

JIVA Vol. 10

INTRODUCTION

RESEARCH ARTICLE

METHODOLOGY Annual data on milk production, milk price, cattle population, feed price and human population are collected from the economic reviews of planning board of Kerala. The Directorate of Economics and Statistics changed the Triennium Ending 1981-82 base year to T.E. 1993-94 as a way of updating the base to a recent year and keep it in harmony with the other series of indices such as Index of industrial production, whole sale price index and the series of national accounts statistics. Hence all the index numbers were calculated with 1993-94 as base year. Let Pi - the price in the ith year and P0 that in base year 1993-94 in Kerala. Then the index is calculated using the formula Ii = Pi/P0*100.

commodity. Wide price fluctuations, on the other hand, discourage farmers from taking up large-scale investment to improve productivity. The study of price behavior assumes importance in this context. The significant and positive correlation between milk price and milk production shows this. This correlation tend to the regression equation, Milk Production (in Lakh Tonnes) = 0.548*Milk Price in Rs/Ltr +14.004 2

Which yields an R of 0.627 indicating 62.7 Percent of the variation in the milk production in Kerala can be explained by the variation in milk price alone. Milk Production and Price per Litre

Analysis of average annual growth rates, correlation study and regression analysis were also done to explore the relationship among the variables.

30 25 Values

20 15 10

RESULTS AND DISCUSSION

From Fig 1. it could be seen that both the milk production and the milk price shows an increasing trend. In the case of agriculture, remunerative and steady price for any agricultural produce plays a crucial role in increasing production of that

Production (Lakh MT)

J. Ind. Vet. Assoc., Kerala. 10 (1) 18

Mean Square

Sig.

Regression

110.561

31.931

.000a

Residual

65.787

3.462

Total

176.348

Table 2. Table of regression coefficients milk production and milk price Unstandardized Standardized Coefficients Coefficients B Beta Std. Error 14.004 1.281 .548

.097

2010

Fig 1. Milk production and Price per litre in Kerala

Sum of Squares

Milk Price (Rs/Ltr)

2009

Price (Rs/Ltr)

ANOVA(b)

(Constant)

2008

Year

Table 1. Anova Table for regression between milk production and milk price Model

2007

2006

2005

2004

2003

2002

2001

2000

1999

1998

1997

1996

1995

1994

1993

1992

1991

1990

.792

Sig.

10.928

.000

5.651

.000

RESEARCH ARTICLE

The demand for milk does not increase the milk price very much as other substituting products like milk powder are available in the market. But the increasing milk price is a factor for increasing in milk production along with other parameters with a weightage of 0.548 to milk price. From the significant correlation between milk price and feed price, the following linear relationship could be observed by the model,

Milk Price = 1.702*Price of Feed per Kg +1.641. The model explains 96.9% of the variation in the milk price with price of feed as explanatory variable. Thus when there is an annual increase of one rupee in one kg of feed, there will be a corresponding increase of rupees 1.70 per one litre of milk.

Table 3. Anova Table for regression between milk price and feed price Sum of Squares Degree of Freedom Mean Square Regression

356.897

Residual

11.398

.600

Total

368.296

F Value

Sig.

594.928

.000

Table 4. Table of regression coefficients between milk price and feed price Unstandardized Coefficients Std. Error

(Constant)

1.641

.478

Feed Price (Rs/Kg)

1.702

.070

.984

Sig.

3.436

.003

24.391

.000

The other factors such as labour cost, production, demand, price of procurements like milk powder etc. do not come under the model. So there need to have a more scientific way of fixation of price so that both consumer and farmer are protected by considering all the factors affecting milk price. In this context, a future

JIVA Vol. 10

Issue 1 April 2012

Standardized Coefficients Beta

RESEARCH ARTICLE

study by considering all the variables affecting milk production will help in Government policies and subsidy programme later. Analising the growth rates it could be observed that there occurred a sharp increase in feed price during 1992-93, 1997-98 and during 2009-10. Due to this the growth rate in milk production declined well in 2009-10 due to unavailability of sufficient straw due to less paddy cultivation and less grass production as summer was highly hot during that period. In this circumstances the annual growth rate of milk price was also didn't increased. These things make the farmer to move away from this sector. Fig 3. Growth rates of milk production milk price and feed price

Average annual growth rates Growth Rate (%) Annual_Milk Production

50.00

Growth rate (% )Annual_Milk Price Growth rate (%) Annual_ Cattle Feed Price

30.00

rate

Growth

40.00

20.00 10.00

2009-10

2008-09

2007-08

2006-07

2005-06

2004-05

2003-04

2002-03

2001-02

2000-01

1999-00

1998-99

1997-98

1996-97

1995-96

1994-95

1993-94

1992-93

-10.00

1991-92

0.00

-20.00

Year

Also during the last few years the wage of labourer is increasing exponentially. The highly significant correlation between milk price and wage of paddy field labourer gives the linear regression, Milk Price (in Rs/Ltr) = 0.05* Wage of Men Labourer + 5.613. Since the model explains 95.2 percent variation in milk price with wage of men as explanatory variable, the wage of labourer is a main factor in determining the milk price.

J. Ind. Vet. Assoc., Kerala. 10 (1)

Table 5. Anova Table for regression between wage of labour and milk price

Table 6. Table of regression coefficients between wage of labour and milk price

RESEARCH ARTICLE

A few years back the old families could maintain more than one animals. But when they split into nuclear families the farmer couldn't control more and they have to pay for labourers for additional work. In this context the increased wage plays a major role in the decreasing cattle population. From Table (7) with base year as 1993-94, it could be observed that the feed price was increased 310.11 percent and wage 645.04 percent where as the milk price to 274.36 percent Table 7. Index numbers of milk price, feed price, milk production and wage

JIVA Vol. 10

Table (8) shows the correlation between different variables influencing milk production. The high correlation between indigenous population and the total cattles and negative correlation between milk production and total cattles in Table (8) reveals the paradox between decreasing cattle population and increasing milk production. This is due to the selling of low yielding indigenous cows and increased productivity with crossbred.

Issue 1 April 2012

Table 8. The Correlation between the variables

RESEARCH ARTICLE

The high correlation between milk price and human population shows the increase in price with demand. There is significant correlation with the crossbred animals in milk and the milk production where as there is no significant correlation between milk production and indigenous animals in milk. It is also to be noted that the Milk price is directly correlated with feed price. Fig 4. Non increasing behavior of animals in milk during the last decade

J. Ind. Vet. Assoc., Kerala. 10 (1)

Fig 5. A small increasing behavior in milk production during the last few years

From fig 4 and 5 it could be observed that even though the animals in milk are almost steady, the milk production is moving upwards. This shows both the higher productivity of crossbred cows and the power of increasing trend of the use of frozen semen for the last few years. If it could be noted to increase the number of animals also, this will bring a good increase in milk production in Kerala.

RESEARCH ARTICLE

REFERENCE [Anonymous].1999. Brochure on new series on national accounts statistics (base year 199394). Central Statistical Organization.

Box, G.E.P. and Jenkins,G.M. 1970., Time Series Analysis: Forecasting and Control, SanFrancisco: Holden-Day. Gujarati,D.N. 2009. Basic econometrics, 5th ed., Boston, McGrawHill, 922p. Mandal,B.N.2004. Forecasting Sugarcane Production In India With ARIMA Model (online), New Delhi [19-02-09]. Unnikrishnan,T. and Ajitha,T.K. 2010. Application of ARIMA models and Co-integration Techniques in Kerala Agriculture, Proceedings of the International Seminar on Applied Statistics, Maharajas College, Ernakulam.

Issue 1 April 2012

Here an attempt is made to show the relationship between various factors that affecting directly and indirectly in determining the milk price for the last few years and also to estimate a regression equation by considering various other factors that influence the price of milk. The need for a more scientific way for fixation of price so that both consumer and farmer are protected by considering all the factors affecting milk price is explained.

[Anonymous].2008. Eleventh Five Year Plan (20072012). Planning Commission, Government of India

JIVA Vol. 10

CONCLUSION

RESEARCH ARTICLE

CLINICAL MANIFESTATIONS OF PROSTATIC DISEASES IN DOGS Kiren Menon, Krishnaswamy A and Honnappa T.G. Department of Animal Reproduction Gynaecology and Obstetrics Veterinary College, Hebbal, Bangalore ABSTRACT A study was conducted to note the major clinical signs of prostatic diseases in dogs. The major signs exhibited were constipation (66.7 per cent) followed by inappetence (53.3 per cent). Other signs included hemorrhagic prepucial discharge and dysuria (46.7 per cent each), abnormal gait (40 per cent), vomiting and cachexia (33.3 per cent each). Hematuria, pyuria and purulent prepucial discharge were also noted in some animals. Pyrexia and dehydration was seen in 33.3 per cent of the animals followed by 26.7 per cent of the animals with a poor body condition. Caudal abdominal pain was very infrequent.

INTRODUCTION The common clinical signs of prostatic disease in dogs include constipation as evidenced by tenesmus, ribbon like feaces, dysuria, prepucial discharge and abnormal gait (Kutzler and Yeager, 2005). However, these clinical signs are often misinterpreted and the disease is frequently overlooked. If the condition remains untreated, it may result in renal failure or toxemia. Therefore, it becomes mandatory to rule out the existence of prostatic diseases in all aged male dogs by a Veterinary Physician, particularly, when they are presented with one or the other clinical signs commonly associated with prostatic disease.

J. Ind. Vet. Assoc., Kerala. 10 (1)

MATERIALS AND METHODS The data pertaining to the present investigation were generated following screening of all the male dogs aged over five years which were presented to the Out Patient Department of Clinical Medicine, Veterinary College Hospital, Hebbal, Bangalore during the period between November 1st th 2007 and April 30 2008. Details about the signs exhibited were derived by both enquiries to the owners and general clinical examination of the

patient. The disease was confirmed in dogs by a combination of diagnostic techniques like rectal palpation, ultrasonography and prostatic fluid examination. RESULTS AND DISCUSSION Constipation was the most common presenting sign seen in 66.7 per cent of the dogs suffering from the disease followed by inappetence in 53.3 per cent, hemorrhagic prepucial discharge and dysuria in 46.7 per cent dogs each. Abnormal gait were noted in 40 per cent of the cases and signs like vomiting, and poor body condition were each seen in 33.33 per cent of the affected animals. Hematuria was seen in 20 per cent of the cases and pyuria and presence of purulent urethral discharge was each noted in 6.7 per cent of the cases (Table 1). Physical examination of dogs suffering from prostatic disease revealed presence of pyrexia and dehydration in 33.3 per cent of the affected animals and poor body condition in 26.7 per cent animals. Pain upon palpation of the caudal abdomen was noted in 6.7 per cent of the diseased animals (Table 2).

RESEARCH ARTICLE

The most commonest complaint in animals with prostatic disease was constipation (66.7 per cent) which has also been reported by Hornbuckle and co-workers (1978), Davidson (2003), Kutzler and Yeager (2005) and Holt (2007) who stated that constipation characterized by tenesmus is one of the prominent clinical sign of prostatic disease in aged dogs, due to compression of the colon by the enlarged prostate gland. Hemorrhagic prepucial discharge and dysuria were the observed in 46.7 per cent each in the affected animals which has also been reported in earlier studies (Hoeffer, 1977; Read and Bryden, 1995). Dilated prostatic urethral veins are considered to be the source of hemorrhagic urethral discharge and the inward growth of the gland into the urethra results in

Dysuria (Reihmann and Bruskewitz, 1993). Other clinical signs observed in this study were abnormal gait (40 per cent) and loss of body condition (33.3 per cent) which has also been described by Johnson and Archibald (1974), Hornbuckle (1978), Davidson (2003) and Holt (2007). Abnormal gait and loss of body condition are probably associated with either prostatic neoplasia or painful prostatic diseases. Emesis was observed in 33.3 per cent of animals with prostatic disease. Vomiting has also been reported in previous studies (Parry, 2006; Smith, 2008) and has been attributed to the rise in metabolites in blood that fail to get excreted due to dysuria. Hematuria, Pyuria, and purulent prepucial discharges were clinical signs observed in the present study. Similar signs have been described by

Clinical sign

1 2 3 4 5 6 7 8 9 10

Constipation Inappetence Hemorrhagic Prepucial discharges Dysuria Gait abnormality Vomiting Loss of body condition Hematuria Pyuria Purulent prepucial discharges

Number of animals exhibiting signs

Percentage

10 8 7 7 6 5 5 3 1 1

66.7 53.3 46.7 46.7 40.0 33.3 33.3 20.0 6.7 6.7

Table 2: Clinical examination findings in prostatic diseases Sl No 1. 2. 3. 4.

Nature of abnormality observed Pyrexia (>102.50 F) Dehydration Poor body condition Caudal abdominal pain

Number of animals exhibiting abnormality

Percentage

5 5 4 1

33.3 33.3 26.7 6.7

JIVA Vol. 10

Sl No

Issue 1 April 2012

Table 1: Clinical History of dogs confirmed with prostatic diseases

RESEARCH ARTICLE

Davidson (2003) and Kutzler and Yeager (2005). Hematuria which was observed in 20 per cent of the affected animals may be a result of irritation caused by excess ammonia production in the bladder due to retained urine (Johnson and Archibald, 1974). The common abnormalities on physical examination noted in the present study were pyrexia (33.3 per cent), dehydration (33.3 per cent), poor body condition (26.7 per cent) and caudal abdominal pain (6.7 percent). Cornell (1997), Davidson (2003), Parry (2007) and Smith (2008) described that signs like fever and cachexia are commonly seen in infections of the prostate gland (Prostatitis/Abscess). Caudal abdominal pain (Kutzler and Yeager, 2005; Holt, 2007) is a characteristic sign in acute inflammatory condition of the prostate, shining a light on the fact that rest of the inflammatory conditions of the prostate could be of a chronic nature. Dehydration was one of the signs in this study, as also noted by Parry (2006), can be attributed to the reflection of the systemic disturbances like pyrexia and uneasiness caused by pain results in anorexia. REFERENCES Cornell, K. K., Waters, D. J., Cooley, D. M., Pauli, B., Harvey, H. J., Hall, G., Render, J., Hendrick, M., Sweet, D. and Stoica, G., 1997. Canine prostate carcinoma; clinicopathological findings in 168 cases. In: Proceedings, Ann. Meeting, Am. Coll. Vet. Radiol. pp.86.

J. Ind. Vet. Assoc., Kerala. 10 (1)

Davidson, J.R., 2003. Prostatic diseases of the dog, Waltham Focus, 13: 2, 4-10. Hoeffer, R.E., Dykes, N.L., and Greiner, T.P., 1977. J.Am.Anim.Hosp.Assoc., 13: 98. Holt, P.E., 2007. Prostate disease, In:

SEVC

(Southern European Veterinary Conference) Proceedings, (Eds). International Veterinary Information Service, Ithaca NY. Hornbuckle, W.E., MacCoy, D.M., Allan, G.A. and Gunther,R., 1978. Prostatic disease in the dog. Cornell Vet , 68:284. Johnson, D.E. and Archibald, J., 1974. Male genital system in canine surgery, American Vet Publications, California, pp. 729. Krawiec, D.R. and Heflin, D., 1992. Study of prostatic diseases in dogs: 177 cases (19811986). J Am Vet Med Assoc, 200:1119. Kutzler, M. and Yeager, A., 2005. Prostatic Diseases. In: (ed): Ettinger, Feldman Textbook of Veterinary Internal Medicine. 6th Edition, Elsevier Inc., p. 1809- 1819. Parry, N. M. A., 2006. Inflammatory diseases of the canine prostate gland, UK Vet, 11: 8, 1-4. Parry, N. M. A., 2007. The canine prostate gland: Part 1:Non-inflammatory diseases, UK Vet, 12: 1, 1-5. Read, R. A. and Bryden, S., 1995. Urethral bleeding as a presenting sign of benign prostatic hyperplasia in the dog: a retrospective study (1979-1993). J Am Anim Hosp Assoc, 31:261. Reihmann H., Bruskewitz R.C., 1993. Benign prostatic hyperplasia: manifestations and intervention. In: Lepor H, Lawson R, K. (eds): Prostate Diseases. Philadelphia, WB Saunders Co.108. Smith, J., 2008. Canine prostatic disease: A review of anatomy, pathology, diagnosis, and treatment, Theriogenology, doi: 10.1016/j. theriogenology.04.039.

RESEARCH ARTICLE

DEVELOPMENT OF LEAN BEEF LOAF Naseera. A .P1 and George T. Oommen2 College of Veterinary and Animal Sciences, Mannuthy

ABSTRACT Excessive intake of dietary fat has been implicated as a cause of chronic degenerative disease such as coronary heart disease and cancers. It is accepted that it would be beneficial to reduce the dietary fat energy to about 30 percent of the total daily energy intake. The present study was aimed at formulating a low calorie lean beef loaf and to assess its nutritional value. The loaf was formulated with 65 percent extra lean beef, 13 percent added chilled water, 8 percent plain flour, 5.5 percent beef tallow, 1.3 percent salt, 85ppm NaNO2, 500ppm sodium ascorbate, 2 percent sucrose, 1.4 percent spice mix and 4percent condiment mixture including garlic, ginger and onion. Ground beef and fat were mixed with other ingredients and tumbled. The batter in the loaf pan was cooked to an internal temperature of 820C in a convection oven. The proximate composition of the product was determined and sensory evaluation was conducted using an eight point Hedonic scale. The product constituted of 57.96 ± 0.05percent moisture, 9.8 ± 0.1percent fat,16.5 ± 0.04 percent protein, 2.35 ± 0.01percent ash, 13.4 ± 0.04percent carbohydrate and a gross energy value of 207.8kcal /50kJ per cent. The contribution of energy from fat was only 4percent of the Recommended Daily Level. The yield of the loaf was 85.7 percent and the mean overall acceptability score was 7.3 ± 0.05.

Veterinary Surgeon, Animal Husbandry Department, Kerala

Professor& Head, Dept.of Livestock Products Technology, College of Veterinary & Animal Sciences, Pookot, Kerala

Along with its high level of consumption, ground beef has also been a major contributor of fat. It is a challenge to formulate a low-fat ground beef product in which the organoleptic qualities are not compromised, because researches indicate that people prefer ground beef with 15-20 percent fat. Low fat meat products with fat content starting below 15 percent tend to have less beefy flavor intensity,

Issue 1 April 2012

Many consumers associate meat with a negative image that it contains high fat and red meat is regarded as a cancer promoting food disregarding the important physiological functions of meat due to the presence of meat based bioactive compounds. The nutrients supplied by meat and meat products are beneficial to human health especially the high quality protein and a range of B vitamins and minerals. But the relatively high fat content of some of these products is a barrier to their wide spread acceptability. Diets high in saturated fat are believed to increase risk of cardiovascular disease, certain

cancers, and obesity (Southgate, 1997). Citing a poor diet as one of the major causes of morbidity and mortality, the 2005 Dietary Food Guidelines stress the importance of a diet low in fat. Total fat intake should represent 20 to 35 percent of calories; saturated fat should not exceed 10 percent of total caloric intake. The guidelines also state that consumers should choose lean, low-fat, or fat-free options when selecting and preparing meats.

JIVA Vol. 10

INTRODUCTION

RESEARCH ARTICLE

juiciness, and tenderness (Pearson et al., 1987). The different strategies for developing low fat meat and meat products include modification of carcass composition, manipulation of meat raw materials and reformulation of meat products. Maintenance of acceptable palatability must remain an important consideration in any effort to reduce fat in meat products. So manufacturing further processed meat products with beef cuts with excess fat trimmed off and by reformulation with nonmeat and fat replacer ingredients provide greatest opportunity to reduce fat and the problems encountered with the reduction of fat (Colmenero et al.,2001). Carbohydrate based fat replacers are probably the most widely used class of replacers in low fat meat product manufacture (Shand et al., 1990). These achieve fat replacement by stabilizing the added water in a gel-like matrix, resulting in lubricity and moisture release similar to higher fat products (Glicksman, 1991). Skog et al. (1992) reported that adding both starch and glucose to the beef patties inhibited mutagenic activity by up to 54 percent. Processed starches like plain flour, rice starch, modified potato, and tapioca are common in meat formulations. Therefore, the present study was aimed at developing a low fat lean beef loaf utilizing lean beef cut after trimming excess fat, plain flour and other non-meat ingredients and to assess its proximate composition, yield, nutritional value and sensory qualities. MATERIALS AND METHODS

J. Ind. Vet. Assoc., Kerala. 10 (1)

Lean beef loaf development and formulation Lean meat from a bull hygienically slaughtered and dressed in the Department of Livestock Products Technology, College of Veterinary & Animal Sciences, Mannuthy was utilized for the study. The meat, after removal of all visible fat, blood clots, tendons and visible connective tissue, was coarsely ground through kidney plate and a 9mm plate in a meat mincer (MADO Primus Model MEW 613, Germany). All the non-meat ingredients were taken on ground lean meat weight basis (Table 1).

Table 1.Lean beef loaf formulation.(AMSA, 1983). Ingredients

Level of addition (percent)

Extra lean beef

Plain flour

Water (g)

Salt (g)

1.3

Sugar (g)

Sodium nitrite (ppm)

Sodium ascorbate (ppm)

500

Chopped onion, Garlic paste and Ginger paste

1.4

Black pepper, Anise, Cinnamon, Red Chilly powder and Turmeric powder

beef tallow

5.5

The raw spices like black pepper, anise, cinnamon, red chilly and turmeric were freshly ground just before use. Onion, ginger and garlic were made into a paste. Minced meat was then mixed with salt, sugar, sodium nitrite and sodium ascorbate dissolved in chilled water, plain flour, ground spices, chopped onion, ginger and garlic paste using a hand held mixer into a uniform batter. This was tumbled in a double drum vacuum tumbler (BIRO Model VTS43, Germany) for 1 h (15 min. on and 5 min. off) at 7 rpm and 20â&#x20AC;? of Hg. The tumbled mix was then stuffed into stainless steel loaf pan and cooked in a o convection oven to an internal temperature of 85 C, chilled to 1- 4oC and sliced. The loaf was then analysed for its proximate composition (AOAC, 1990). Total calories and calories from fat, protein and carbohydrate were determined as per FAO (2002). Per cent RDA (Recommended Daily Allowance) for calories from fat, protein, and carbohydrate was calculated based on a 2200 kcal diet (ICMR, 1990). Per cent daily value of nutrient in the loaf was calculated as per cent nutrient in the loaf divided by RDA of the nutrient. RDA of protein was taken as 60g (ICMR, 1990). Cooking yield

RESEARCH ARTICLE

percentage (CY) was calculated as follows, CY = (weight of loaf after cooking / weight of loaf before cooking) x 100. The sensory panel evaluation of the loaf was conducted by a semi trained panel consisting of seven panelists The experiment was repeated six times and the average of the values were taken.

Table 4. Sensory evaluation scores of lean beef loaf Attributes Appearance and colour Flavour Texture Saltiness Juiciness Mouth coating Overall acceptability

Score 6.62 ± 0.03 7.55 ± 0.07 7.17 ± 0.02 7.00 ± 0.01 7.50 ± 0.06 8.00 ± 0.00 7.3 ± 0.05

RESULTS AND DISCUSSION.

Parameter

Percentage in lean beef loaf Moisture 57.96 ± 0.05 Protein 16.5 ± 0.04 Fat 9.8 ± 0.1 Carbohydrate 13.4 ± 0.04 Ash 2.35 ± 0.01 Cooking Yield 85.7 Percent Table 3. Calorific value of nutrients and their per cent contribution to the RDA Parameter

Calorific value % Contribution (kcal/100g) to RDA Protein 66 3 Fat 88.2 4 Carbohydrate 53.6 2 Total 207.8 9

SUMMARY The recipe for a lean beef loaf with fat percentage less than 10 and with high nutritional quality was developed using lean beef, plain flour and other non meat ingredients. The percentage of fat in this was 9.8 and the percentage RDA of calories from fat was only 4 which is far below the recommended 30 per cent. The per cent contribution

Issue 1 April 2012

Table 2. Proximate composition, their percentage contribution to RDA and cooking yield of lean beef loaf

The percentage contribution of total calories and calories from fat to the RDA based on a 2,200 kcal diet was 9 and 4, respectively in the loaf. The contribution of calories from carbohydrate and protein to the total calories in the loaf was significantly more than that from fat. Keeton (1994) and Pearson and Gillet (1997) reported that low fat products must contain no more than 10 per cent fat, while extra lean product must be under 5 per cent fat. In the present study it was able to achieve a less than 10 per cent of fat for the loaf. So the product prepared could be labeled as 'low fat'.More over the contribution of calories from fat to the RDA was far below the recommended 30 percent (NRC, 1989) in the formulation. So consumption of this product will not cause any health hazard related with high fat consumption, but will provide 27 percent of RDA of protein of high biological value. The overall acceptability of the product was also excellent. Brester et al (1993) also developed a low fat ground beef and reported that the product was as palatable as beef products that contain significantly higher levels of fat.

JIVA Vol. 10

The average values of proximate composition, nutritional value and the panel scores of sensory qualities of cooked lean beef loaf is presented in the Table 2, 3 and 4 respectively. The product constituted of 57.96 ± 0.05 percent moisture, 9.8 ± 0.1 percent fat,16.5 ± 0.04 percent protein, 2.35 ± 0.01 percent ash, 13.4 ± 0.04 percent carbohydrate and a gross energy value of 207.8kcal/50kJ per cent. The contribution of energy from fat was only 4 percent of the RDA. The mean overall acceptability score of the product was 7.3 ± 0.05. The yield of the loaf was 85.7 percent.

RESEARCH ARTICLE

of protein to the RDA was 27. The nutrition information on label would enable the consumers in choosing the meat product depending on their requirement. Lean beef from Indian breeds of cattle and buffaloes could well be utilised for the production of low fat meat loaf using suitable combination of added water and other carbohydrate based fat replacers, without compromising the sensory attributes, yield and with reducing the incidence of health hazards related with high fat consumption. ACKNOWLEDGMENTS The authors are thankful to the Dean, College of Veterinary and Animal Sciences, Mannuthy and to the Professor and Head, Department of Livestock Products Technology, College of Veterinary and Animal Sciences, Mannuthy for providing facilities for the work. REFERENCES

J. Ind. Vet. Assoc., Kerala. 10 (1)

AMSA, 1983. Guidelines of sensory, physical and chemical measurements in ground beef. Recip. Meats Conf. Proc. 36:221-228

Dietary Food Guidelines 2005, Executive Summary. www.health.gov/dietaryguidelines/dga200 5/document/html/executivesummary.htm FAO, 2002. Food energy methods of Analysis and conversion factors. Report of a technical workshop.FAO Food and Nutrition. Paper 77 Glicksman, M. 1991. Hydrocolloids and the starch for the 'oily Grail'. Food Technol., 45(10): 94 ICMR, 1990. Report of committee on dietary allowances, ICMR, New Delhi Keeton, J.T. 1994. Low fat Meat products technological problems with processing. Meat Sci. 36: 261-276 NRC, 1989. Recommended Dietary Allowances, Tenth Edition, National Academy of Sciences, Washington, D.C Pearson, A. M. and Gillet, T. A. 1997. Processed Meats. Third Edition. CBS Publishers and Distributors, New Delhi. pp 53-425 Pearson, A. M., Asghar, A., Gray, J.I. and Booren, A.M. 1987. Impact of fat reduction on palatability and consumer acceptance of processed meats. Proc. Recip. Meat Conf.,40: 105

AOAC, 1990. Meat and meat products. Official Methods of Analysis of Analytical Chemists, Fifteenth edition. Association of Official Analytical Chemists. Washington D.C., p. 587

Shand, P.J., Schmidt, G.R., Mandigo, R.W. and Claus, J.R. 1990. New technology for klow fat meat products. Proc. Recip. Meat Conf., 43: 37

Brester, G.W., Lhermite, P., Goodwin, B.K. and Hunt, M.C. 1993. Quantifying The Effects Of New Product Development: The Case Of Low-Fat Ground Beef. Journal of Agricultural and Resource Economics. 18:2.

Skog, K., Jägerstad, M. and Laser, A.R. 1992. Inhibitory effect of carbohydrates on the formation of mutagens in fried beef patties. Food and Chemical Toxicol. 30:8.pp. 681688

Colmenero, J.F., Carballo, J. and Cofrades, S. 2001. Healthier meat and meat products: their role as functional foods. Meat Sci.59: 5-13.

Southgate, D.A.T. 1997. Demand for healthful meat, poultry and fish products. In. Production and Processing of Healthy meat, poultry and fish products.(Eds. Pearson, A.M. and Dutson, T.R.). Blackei Academic Professional, New York, pp. 1-31

Cooper, Kathyrn and John Michaelides. “Fat Replacers and Extenders.” www.gftc.ca/ articles/2004/fat-replacers-extenders.cfm.

RESEARCH ARTICLE

ANALYSIS OF INFORMATION NEEDS FOR DEVELOPING A MEDIA PROTOCOL IN SELECTED DISTRICTS OF HARYANA IN ANIMAL HUSBANDRY PRACTICES* S. Sreehari1, H.K. Gulati2 and A.K. Varma3 Lala Lajpat Rai University of Veterinary & Animal Sciences, Hisar *Part of Ph.D thesis submitted by first author to LLRUVAS, Hisar

ABSTRACT

Women in India play a predominant role in agriculture and food provisioning and subsistence agricultural activities. The 'silent majority' of the world's poor are women. They face peculiar social, cultural, educational, political and allied problems. Studies have shown that although rural women produce up to 80 per cent of food in developing countries, yet they have title to only a fraction of farm land and access to ten percent of credit and five per 1. Veterinary Surgeon , Veterinary Dispensary, Pudukad, Thrissur. 2. Professor, Department of Livestock Production Management, College of Veterinary Sciences, Hisar. 3. Professor & Head, Department of Livestock Production Management, College of Veterinary Sciences, Hisar.

cent of extension advice (Agarwal, 2003). Rural women's access to agricultural extension services worldwide is only about 1/20th of that of men, and technology is rarely designed specifically to address the women's needs. In India, out of 88,000 village extension workers, only about 10 percent (9,000) are female (NRCWA, 2007). No training would bring desirable changes in the behaviour of farm women unless it is need and interest based. The media is playing an important role in passing on meaningful informations at faster rate to the large number of farm women in our country. It has emerged as one of the powerful sources of seeking relevant scientific information by our farm women, therefore, tapping and utilizing media for transferring the newly generated technologies in agriculture and animal

JIVA Vol. 10

INTRODUCTION

Issue 1 April 2012

The present study was conducted in Haryana state. Sixty rural women from each Khoka, Sadalpur, Purkhas and Harsana villages were selected randomly for assessing information needs of rural women regarding animal husbandry practices. On the basis of weighted mean scores and ranks messages having high five ranks and three sub-messages from each selected messages got higher rank were finally selected for media preparation. Selected messages were breeding, balanced feeding, animal diseases and their prevention, farm management and accounting and clean milk production in descending order of mean scores. Under balanced feeding, feeding management got ranked second with weighted mean score 2.79. Balanced ration and its composition ranked third with weighted mean score 2.70. Mineral mixture feeding in animal feed with weighted mean score 2.9 got ranked first. Time of insemination got rank first with weighted mean score 2.15 and the sub-message symptoms of heat got rank second with weighted mean score 2.19 among sub-messages related to breeding. Among sub-messages related to animal diseases first three ranks went to foot and mouth disease (I, 2.69), Wound treatment (II, 2.50) and Tympany/bloat (III, 2.15).

RESEARCH ARTICLE

husbandry among the Indian farm women is crucial and of significant importance. The present study was therefore conducted to assess the information needs of rural women in Hisar and Sonepat districts of Haryana for selecting the messages to be included in an internet based media package on animal husbandry practices for rural women of Haryana.

J. Ind. Vet. Assoc., Kerala. 10 (1)

MATERIALS AND METHODS To assess the information need of rural women regarding animal husbandry practices following methodological steps were followed. Hisar and Sonepat districts of Haryana state were selected randomly. There are 9 blocks in Hisar district and 7 blocks in Sonipat district. Out of these, two blocks from each district viz., Hisar I and Adampur blocks were selected at random from Hisar district while, Ganaur and Sonepat blocks were selected from Sonepat district, randomly. From each of the selected blocks a list of all villages of block concerned was prepared and from that list one village from each block viz., Khoka village from Hisar I block, Sadalpur village from Adampur block, Purkhas village from Ganaur block and Harsana village from Sonepat block were selected randomly. 60 rural women who involved in dairy activities from each village were selected purposively. The interview was conducted only from one female of family who had been actively involved in rearing buffaloes. In this way, the total sample for this study was 240 women. Need was operationalized as the need of the each respondent related to selected animal husbandry practices. For assessing the need of the rural women an inventory pertaining to the critical messages and sub-messages was prepared in consultation with experts, relevant literature, library and package of practices. In this way, total nine messages were listed. Each message was ascertained

under three categories i.e. most needed, needed and least needed with scores 3, 2 and 1 respectively. Weighted mean scores were worked out for each of the nine messages and sub-messages separately. The ranks were assigned according to weighted mean score and fifty per cent of messages having top five ranks and 3 sub-messages from each selected messages got upper rank were finally selected for media preparation. Frequency and percentages where used to study the profile of the respondents. RESULTS Involvement of rural women clientele in message designing and media production is of paramount importance in media preparation to avoid any loss of communication. Media effectiveness can be enhanced only when the messages selected are in tune with the need and interest of target audience. Therefore, in present study attempts were made to select the messages and sub-messages according to the need of the rural women in consultation with experts and relevant literature of animal husbandry. In this way total nine messages viz., breeding, feeding, management of cattle shed, health care, preservation of green fodder, clean milk production, farm management and accounting, marketing, animal diseases and their prevention were listed (Table 1) and each message was further divided into sub-messages (Table 2). It was revealed that out of these five messages i.e., balanced feeding, breeding, animal diseases and their prevention, farm management and accounting and clean milk production had above 2.46 weighted mean scores and ranked I to V respectively. Thus these five messages were selected for media preparation, identified as most needed messages by rural women (Table 1).

RESEARCH ARTICLE

Table 1: S. No.

Selection of the messages according to the need of the rural women regarding animal husbandry practices Most needed

Needed

Least needed

Total weighted mean score

Rank

Farm management and accounting

160

2.47

Breeding

180

2.65

Marketing

181

1.87

Management of cattle shed

132

1.59

VII

Animal diseases and their prevention

159

2.48

III

Balanced feeding

210

2.87

Health care

162

1.5

Preservation of green fodder

156

1.51

VIII

Clean milk production

161

2.46

Messages

Selection of sub-messages The selected messages were further divided into sub-messages. They were then ranked in a similar manner to find out which of the submessages have to be included and those to be eliminated. The results are shown in Table 2. Table 2: Selection of various sub-messages

Needed

Least needed

Total weighted mean score

Rank

1. Selection of sub-messages related to balanced feeding (M1) 1.

Calf feeding

195

2.77

III

Change required in feeding of animals before and after parturition/claving

176

2.67

Feeding management

198

2.79

Issue 1 April 2012

Most needed

JIVA Vol. 10

S. No. Messages

RESEARCH ARTICLE

Balanced ration and its composition

181

2.70

III

Essential nutrients in animal feed

144

1.59

Feeding of pregnant cow

179

2.65

Feeding management of milch animals

178

2.65

Mineral mixture feeding

219

2.90

2. Selection of sub-messages related to breeding (M2) 1.

Symptoms of heat

129

2.14

Heat cycle and time of breeding

2.01

VII

Pregnancy diagnosis

108

1.95

VIII

Artificial insemination

119

2.06

Time of insemination

2.15

Importance of insemination 65

118

2.03

Care during pregnancy

137

2.07

III

Care during parturition

2.07

III

Care after parturition

2.05

10.

Care of calf

123

2.07

III

J. Ind. Vet. Assoc., Kerala. 10 (1)

3. Selection of sub-messages related to animal diseases and their prevention (M3) 1.

Anestrus

112

105

2.03

Ectoparasite infestation

122

2.01

Retained placenta

2.00

Diarrhoea

108

1.92

Repeat breeding

1.90

RESEARCH ARTICLE

Endoparasite infestation

127

2.00

VIII

Intoxication

1.93

VII

Tuberculosis

100

115

1.94

VIII

Haemorrhagic septicemia (HS)

109

1.99

VII

10.

Abortion

124

2.15

III

11.

Pneumonia

1.93

12.

Milk fever

101

2.03

13.

Foot and mouth disease

196

2.69

14.

Constipation

1.88

XII

15.

Cow pox

1.84

XIV

16.

Tympany/bloat

1.87

XIII

17.

Mastitis

2.00

VII

18.

Tail necrosis

134

1.63

XVI

19.

Wound treatment

146

2.50

20.

Coughing

122

1.70

Purchase of milch animals

2.73

Purchase of feed ingredients 48

158

1.54

Sale of produce

147

2.59

Sale of animal manure

160

1.41

VII

Characteristics of Murrah buffalo

194

2.78

Age estimation of animals from teeth

198

2.77

III

Credit facilities

213

2.81

6. 7.

200

JIVA Vol. 10

Issue 1 April 2012

4. Selection of sub-messages related to Farm management and accounting (M4)

RESEARCH ARTICLE

5. Selection of sub-messages related to clean milk production (M5) 1.

Fat testing at home

177

1.32

Prevention of damage of teats77

161

2.31

Right method of milking

203

2.79

Usefulness of clean milk production

145

2.57

Health symptoms for decline in milk

132

2.45

Care to be taken after milking

117

2.46

III

Cleaning before milking

206

2.79

5. 6. 7.

DISCUSSION

J. Ind. Vet. Assoc., Kerala. 10 (1)

!In the present study among nine main messages balanced feeding ranked highest in information need as compared to breeding (Rank II), Marketing (Rank VI), Management of cattle shed (Rank VII) etc. Since the major farm operations of breeding, health care and marketing and finance require outside contact, the involvement of farm women was less. This might be the reason for the farm women to perceive these major farm operations as the least preferred areas of training. Similar findings were reported by Manjusha (1990), Sheela and Swamy (1993), Prakash et. al. (1995) and Singh et. al. (2001). Due to constraints of time and resource there was no other alternative than tone down the number of messages. Among breeding practices time of insemination ranked first followed by heat symptoms, care during pregnancy, care durin parturition and calf care. Similar studies have been reported by Durgga Rani and Subhadra, (2009) who reported selection of breeds ranked first for both knowledge and skill oriented training needs. The farm women might have perceived, selecting a suitable breed as one of the primary factors in achieving productivity in dairy animals. This finding is in line with those of Fulzele and Meena (1995) and

Raju et. al. (1999) who reported that selection of breed was a most needed area of training. Perhaps the fact that need assessment was done by a veterinarian prompted the respondents to pin point their information needs in the form of specific diseases like Foot and mouth disease, wound treatment and common conditions like Tympany. Among submessages related to farm management and accounting information regarding credit facilities ranked first. Capital is an important prerequisite for starting a dairy farm. Limited or non-availability of capital among the respondents might be the reason for their highest preference for information regarding credit facilities. Similar studies have been reported by Jothilakshmi et. al. (2009). Breed identification especially that of Murrah was ranked second among sub-messages related to management and accounting perhaps because of awareness among farmers that such knowledge is most important during purchase of animals. Similar to these findings Fulzele and Meena (1995) reported that selection of breeds were considered as important areas of training by farm women. Regarding health care, vaccination was ranked first for knowledge need. The farm women might have been interested to know about the control and identification of

RESEARCH ARTICLE

important diseases. The results are in par with the findings of Umarani and Thangamani (2000), Das and Mishra (2002) and Gupta and Tripathi (2002). About the information need with respect to the minor operations of marketing and finance, the farm women needed training the most in banking and insurance. This might be because the farm women had limited information regarding the various sources from which they could obtain financial assistance and also about the insurance policies. In the present study the women expressed need to know about practices to be followed to obtain clean milk (Rank V) as main message. This perhaps is because of lesser awareness about hygiene in rural surroundings. REFERENCES Agarwal, S. 2003. Technology model for women's empowerment. Sonepat, May, 2003: 18-28.

Women SHGs in Livestock Farming through Need-Based Trainings. AsiaPacific Journal of Rural Development. 19(2):17-30. Manjusha 1990. Time utilization pattern of rural women in dairy farming. M.Sc. Thesis, Haryana Agricultural University, Hisar, Haryana. NRCWA. 2007. Vision 2025 Perspective Plan. National Research Centre For Women In Agriculture, Bhubaneswar. Retrieved from, http://www.nrcwa.org/downloadfiles/nrcwa vision2025.pdf Prakash, O., Mahipal, R.L. and Kherde. 1995. A study of perception of training needs of landless farm women in scientific dairy farming practices. Advances in Agricultural research in India, 4: 196-209.

Durgga Rani, V. and Subhadra, M.R. 2009. Training needs of farm women in dairy farming. Veterinary World, 2(6): 221-223

Raju, L.D., Nataraju, M.S. and Niranjan, M. 1999. Women in animal production an ex- post facto analysis. Agricultural Extn. Rev., 11(3): 3-8.

Fulzele, R.M. and Meena, B.L. 1995. Training needs of dairy tribal women. Ind. J. Dairy Sci., 48: 551-553.

Sheela, B. and Swamy, S. 1993. Training needs for dairy practicing women. Maha. J. Ext. Edu., 12(3&4): 345-347.

Gupta, M. and Tripathi, H. 2002. Assessment of training needs of rural women in dairy enterprise. Indian J. Dairy Sci., 55 (3): 178182.

Singh, M., Mishra, S. and Rani, S. 2001. Training needs of rural women. Ind. J. Ext. Edu., 37(1&2): 92-94.

Issue 1 April 2012

Umarani, K. and Thangamani, K. 2000: Technological needs of women in dairying. J. Ext. Edu., 11(2): 2812-2814.

JIVA Vol. 10

Jothilakshmi, M., Krishnaraj, R. and Sudeepkumar, N.K. 2009. Empowering the Members of

RESEARCH ARTICLE

ANALYSIS OF SOCIO-PERSONAL PROFILE OF LIVESTOCKBASED SELF HELP GROUP MEMBERS OF THRISSUR DISTRICT* Anu George1, P.J.Rajkamal2 and Jiji.R.S3 College of Veterinary and Animal Sciences, Mannuthy, Kerala *Part of M.V.Sc thesis submitted by the first author to Kerala Agricultural University ABSTRACT The personal, socio-economic and socio-psychological characteristics of selected livestock based Self Help Group (SHG) members were analysed in the study. Majority of the respondents were middle aged (86 percent), females (81 percent) and had formal education of 5-8 years (77 percent). Livestock rearing was the major occupation for most of the SHG members (72 percent) and majority had an income of less than 5000 per annum (62 percent). Maximum number of the respondents owned less than four animals (44 percent). None had more than one hectare of land. Family size of most of the respondents was less than five (72 percent). More than half of the respondents had less than five years of experience in livestock farming (58 percent).More than three-forth had less than 5 years of experience as SHG members (81 percent). Majority of the respondents were in the medium category with regard to the socio psychological variables such as economic motivation (71 percent), social participation (68percent), achievement motivation (65 percent) and cosmopoliteness (57 percent).Maximum number of respondents (43 percent) had medium level of risk orientation.

J. Ind. Vet. Assoc., Kerala. 10 (1)

INTRODUCTION Self Help Group (SHG) is a small group of rural people, usually 10-20 in number, gathered voluntarily to undertake some common income generating activities through mutual trust and mutual help (Arunkumar, 2005). Its formation in each block panchayat is envisaged through Swarnajayanthi Grama Swarozgar Yojana (SGSY), a centrally sponsored, comprehensive rural development programme of Ministry of Rural Development. Under SGSY, assistance is given to poor families, living below poverty line, for taking up self employment. The beneficiaries are called Swarozgaris.SGSY promotes group approach more than individual approach and majority of the funds

PhD Scholar, 2 Professor and Head and 3Associate Professor Department of Veterinary and Animal Husbandry Extension

are given for SHGs. The major objective of SHGs is poverty eradication and their formation is facilitated by non-government organisations also. Furthermore, the poverty eradication mission of Kerala government, Kudumbasree is also organizing women SHGs including that of livestock based SHGs. In each block, 4-5 key income generating activities are identified based on the local resources, occupational skills of the people and availability of the markets. For successful self employment, it is necessary to take up the right activity. Training will be provided to the group members for micro enterprise development. Also income generating assets and inputs will be provided to the groups through a package of assistance in the form of subsidy and bank loan. In Kerala, SHGs are gaining more impetus nowadays and many are taking livestock rearing as the key activity.

RESEARCH ARTICLE

The SHG members can work together to address issues that affect not only their own members, but others in their community also. The SHG members reflect a diverse membership covering different social and economic categories. Hence the present study was undertaken to assess the personal, socio-economic and socio-psychological characteristics of the SHGs involved in livestock rearing.

RESULTS AND DISCUSSION

Characteristic

Age

Sex

Education

Caste

Family size

Experience in Livestock Farming

Experience in SHGs

Category

Percentage

Major occupation

Agriculture

Livestock rearing

Business

Labourer

< Rs.5000

Rs.5000-10000

>Rs.10000

<4numbers

4-8 numbers

>8 numbers

<1Hectare

100

Income from Livestock

Livestock Owned

Land owned

RESEARCH ARTICLE

Table 2 shows that livestock rearing was the major occupation for 72 percent of the SHG members, 15 percent were labourers, 10 percent agriculturists, and 3 percent were doing business. While studying the SHGs in the country, Anon (2006) reported that 38 percent of SHG members worked as casual labourers, 29 percent worked in own agriculture, and 17 percent were engaged in a non-farm enterprise. For 62 percent of the members, income from livestock was less than Rs.5000 per annum and 37 percent had Rs.5000-10000. One percent of the SHG members claimed to earn more

than Rs.10000 annually from livestock. Cent per cent of the respondents were having less than one hectare of land. As per the SGSY guidelines, small and marginal farmers are the target groups in the scheme. It is shown that 44 percent of the respondents were rearing less than four animals, 30 percent reared 4-8 numbers, and 26 percent reared above 8 animals. Less availability of land may be the reason for small holding units. But now a days there is a new trend that even though small holdings are reducing, there are many new entrepreneurs coming to the sector to start commercial farms.

Table 3 Distribution of SHG members based on socio-psychological characters N=100

Social participation

Achievement motivation

Cosmopoliteness

Risk orientation

It is seen in the table 3, that 71 percent of the SHG members were in the medium category for economic motivation, 19 percent were in the high category and only 10 percent were in the low category. For social participation, 68 percent of SHG members were in the medium, 22 percent in high and 10 percent in low categories. Similarly for achievement motivation, 65 percent of the members were in medium 20 percent in high and 15 percent in the low categories. This finding is in close

Percentage 10 71 19 10 68 22 15 65 20 21 57 22 37 43 20

conformity with that of Devalatha (2005) and Arunkumar (2005). For cosmopoliteness, 57 percent of the members were in medium, 22 percent in high and 21 percent in low categories. Finally for risk orientation, 43 percent in medium 37 percent in low and 20 percent in high category. The pattern is almost similar in the case of the first four sociopsychological characters. Above half of the SHG members were in the medium category. This finding was in close agreement with those of Sreedaya

Issue 1 April 2012

Category Low Medium High Low Medium High Low Medium High Low Medium High Low Medium High

JIVA Vol. 10

Sl.No Characteristic 1 Economic motivation

RESEARCH ARTICLE

(2000) and Fayas (2003). More than three-forth of the members were in the medium and high categories taken together. But in the case of risk orientation, only less than half of them were in the medium category. Surprisingly, 80 percent of the SHG were in the low and medium categories taken together. This shows that risk taking behaviour of innovators are not shown by SHG members of these blocks. Only recognized profitable businesses are taken by them. REFERENCES Anon 2006 Self Help Groups in India-A study of the lights and shades. Executive summary of EDA Rural systems Pvt.Ltd in association with APMAS for CRS, USAID, CARE, GTZ/NABARD 20p

Devalatha, C.M 2005 Profile study of women self help groups in Gadag District of Northern Karnataka, M.Sc (Agri) thesis ,University of Agricultural Sciences, Dharwad 74p Fayas, A.M 2003 Viability of Self-Help groups in vegetable and fruit promotion council Kerala An multidirectional analysis. MSc (Agri) Thesis, Kerala Agricultural University, Thrissur 126p Sreedaya,G.S. 2000 Performance analysis of the Self-Help groups in vegetable production in Thiruvananthapuram District. MSc (Agri) Thesis, Kerala Agricultural University, Thrissur 154p

OBITUARY

Swarnajayanti Gram Swarozgar Yojana Guidelines, retrieved from http:// megcnrd.gov.in/forms/ SGSY.pdf on 10/03/2012

Dr. K. S. Jayaram, Retired Deputy Director of Animal Husbandry Department, Kerala passed away on 06/01/2012 at Ambalavayal , Wayanad. He belongs to 1972 batch of Veterinary College, Mannuthy. He was the member of First General Council of Kerala Agricultural University. He held different positions in Animal Husbandry Department , Kerala and Retired from Service as Chief Veterinary Officer , District Veterinary Centre , Kalpetta. He was an active member of IVA and held various positions in the association including that of state vice president. He was also the district president of KGOA Wayanad during 1983-84. He is survived by his wife Dr.Radhamma Pilla (Professor and Head, KVK Ambalavayal), two daughters and one son. May his soul rest in peace.

REMEMBRANCE DAY

J. Ind. Vet. Assoc., Kerala. 10 (1)

Anon 2009 Evaluation Report on Swarnajayanthi Gram Swarozgar Yojana(SGSY), Jammu & Kashmir, Planning Commission, Government of India, 68p.

Arunkumar D 2005 A critical analysis of Swa-Shakti programme in Karnataka, M.Sc (Agri) Thesis, University of Agricultural Sciences, Dharwad, 112p

Dr. P.V. Pradeepan, remembrance day was arranged at Valancheri MES college auditorium on 19/01/2012 at 3pm.Dr Ajayakumar P N President IVA Malappuram district welcomed the gathering. Dr K R Arunkumar IVA State President presided over the function. Dr K Udayavarman, Director Zoo and Museum inaugurated the function. IVA State President in his presidential address mentioned about the formation of Pradeepan Memorial Trust to offer a helping hand for the best students of Irumblium Govt. High School, where Dr Pradeepan had studied. Dr Haroon Abdul Rasheed, Dr Abdul Asees, Dr Pradeepanâ&#x20AC;&#x2122;s friends Mr Madhu, Abdu salam and Radhakrishnan shared their memories about Dr Pradeepan.

CLINICAL REPORT

Oxyspirura mansoni IN BACKYARD POULTRY OF KERALA Deepu Philip Mathew1, Priya M .N2., Deepa C.K2., Syamala K2., 2 2 Ajithkumar K. G . and Reghu Ravindran College of Veterinary and Animal Sciences, Pookot ABSTRACT: A few birds reared by a private owner as backyard poultry were brought to the Veterinary Dispensary, Thiruvanvandoor, with the complaint of inability to open the eyes. Irritation and secretion of tears from the eyes of birds were observed. White, small, thread like nematode worms recovered from the eyes, The worms were identified as Oxyspirura mansoni based on morphology.

MATERIALS AND METHODS: The birds were brought to Veterinary Dispensary, Thiruvanvandoor, Alappuzha with the complaint of inability to open the eyes and protrusion of the nictitating membrane. The owner complained of irritation and inflammation with secretion of tears from the eyes of birds. The birds were reared as back yard poultry by the farmer. Examination of eyes revealed the presence of large number of live worms under the nictitating membrane. Worms recovered from the eyes were sent to the Department of Veterinary Parasitology, 1. Ve t e r i n a r y s u r g e o n , Ve t e r i n a r y D i s p e n s a r y, Thiruvanvandoor, Alapuzha 2. Assistant Professor Department of Veterinary Parasitology, College of Veterinary and Animal Sciences, Pookot, Lakkidi, P. O., Wayanad.

These parasites were then processed by dehydrating in ascending grades of alcohol followed by clearing using creosote. The species was identified based on morphology according to Soulsby (1982). RESULT: The worms were white, small and thread like measuring a little over half an inch in length. The male worms were smaller than the females. Microscopically, the mouth opening was large, circular and devoid of lips. The pharynx was observed to be hourglass shaped (Fig.1). The tail end of the male was curved ventrally while in females it was straight. Two unequal spicules were present on the posterior end of the males. One of the spicule was long and slender while the other was short and thick (Fig. 2). There were six pairs of genital papillae on the posterior end of the male. In the female, the vulva was located ventrally in the posterior half of the body. The worms were identified as Oxyspirura mansoni based on Soulsby (1982). The affected birds were treated with Albendazole 2.5 percent suspension topically by instilling a drop each into the eyes two times a day for 3 days consecutively. The complete flock including the affected birds was dewormed with

Issue 1 April 2012

Despite a tremendous increase in the commercial rearing, rural poultry still constitutes 80 per cent of our total poultry population. Though the prevalence of parasitic infections are less in commercial system due to the non availability of intermediate hosts, helminth infections are high in free range and backyard systems due to exposure to reservoir hosts and unscientific management practices (Permin et al., 1999). The present study deals with the occurrence of Oxyspirura mansoni, the eye worm of chicken.

College of Veterinary and Animal Sciences, Pookot for identification.

JIVA Vol. 10

INTRODUCTION:

CLINICAL REPORT

Eventhough the prevalence of most parasitic diseases in poultry has reduced significantly due to commercial poultry production, a number of helminth species are observed in rural scavenging poultry (Pandey et al., 1992, Permin et. al., 1997 and Kabatange and Katule, 1990). Larvae of Oxyspirura mansoni develop in the body cavity of the cockroach on ingestion of embryonated eggs that are passed through faeces of affected birds. Ingestion of infected cockroaches leads to infection (Soulsby, 1982). The movement of the worms in the eye, results in irritation ophthalmitis and abundant secretion of tears leading to self inflicted injury. The nictitating membrane becomes swollen and may protrude out of the corner of the eye (Flynn, 2007). Fig.1: Oxyspirura mansoni- anterior endHour glass shaped pharynx

Fig.2: Oxyspirura mansoni- male tail end- long left spicule and short right spicule

J. Ind. Vet. Assoc., Kerala. 10 (1)

Albendazole 2.5 per cent suspension orally at the dose rate of 25 mg/kg body weight. The treatment regimen resulted in complete recovery of all the affected birds. DISCUSSION: Previously, Pillai and Peter (1971) and Nadkal et al., (1972) have reported the occurrence of O. mansoni in Kerala. Based on available literature, there is no report of the parasite from the state since 1972. This may be due to the lack of surveys for detection of worms from poultry.

REFERENCES: Kabatange, M.A, and Katule, A.M 1990 Rural poultry production systems in Tanzania. In: Proceedings of an international workshop on rural poultry in Africa, African Network on Rural Poultry Development, Nigeria. pp. 171-176 Nadkal, A.M., John, K.C., Muraleedharan, K and Mohandas, A. 1972 Qualitative analysis of gastrointestinal helminths of domestic fowl in southern Kerala. Ind. J. Anim. Health 11: 5-9. Permin A, Magwisha H, Kassuku AA, Nansen P, Bisgaard M, Frandsen F, Gibbons L (1997) A cross-sectional study of helminths in rural scavenging poultry in Tanzania in relation to season and climate. J. Helminthol. 71: 233240. Pillai, K.M., Peter, C.T. 1971 Studies on tapeworms commonly encountered in fowls. Ind. Vet. J. 48: 430-431. Robert, J. Flynn and David, G. Baker 2007 Flynn's parasites of laboratory animals. 2nd Edn. American College of Laboratory Animal Medicine Blackwell publishing pp: 250-251 Soulsby, E.J.L. 1982 Helminthes, arthropods and protozoa of domesticated animals. 7th Edn. Bailliere Tindall, London pp: 291WATT poultry statistical yearbook 1996 Poultry Intl 35: 8

CLINICAL REPORT

BILATERAL INGUINAL HERNIA WITH DISTINCT HYSTEROCELE AND OMENTOCELE IN A DACHSHUND BITCH John Martin K. D.1, Susannah Bijee Philip2, Sherin B. Sarangom3 4 and Ashay P. Kankonkar College of Veterinary and Animal Sciences, Mannuthy, Thrissur, Kerala 680651

CASE HISTORY AND OBSERVATIONS A five year old nulliparous dachshund bitch was presented to the Kerala Veterinary and Animal Sciences University Hospital, Kokkalai with a bilateral swelling in the inguinal region. The swelling was noticed since one month, which increased in size over the last two weeks. The animal was in estrus one month back and had no previous history of any 1

Associate Professor, 2,3&4M.V.Sc. Scholar Department of Veterinary Surgery and Radiology

SURGICAL INTERVENTION AND TREATMENT The dog was premedicated with atropine a sulphate at the rate of 0.045 mg/kg body weight followed by xylazine hydrochlorideb at the rate of 1.5 mg/kg body weight, both given intramuscularly. The the surgical site ware shaved, scrubbed and painted with Tr Iodine for aseptic surgery. General anaesthesia was induced with ketamine hydrochloridec at the rate of 5 mg/kg body weight intramuscularly and was maintained by incremental intravenous injection of a combination of xylazine hydrochloride and ketamine hydrochloride, equal d quantity by volume and diazepam given 'to effect'. The dog was positioned on dorsal recumbency. The site was painted with Tincture iodine and the patient

Issue 1 April 2012

Inguinal hernias may be congenital or acquired of which the former in dogs occur as a result of a defect in the inguinal ring through which the abdominal contents protrudes into the subcutaneous space (Pratschke, 2002). Inguinal hernias may be congenital or acquired. The former are rare in dogs and may co-exist with the umbilical hernias (Fossum, 2007), while the latter are often seen in middle aged intact bitches (Waters et al., 1993). The potential factors involved in the development of inguinal hernias might be anatomical, hormonal and metabolic in nature. However, the exact etiopathogenesis is still unknown (Smeak, 2003). Polygenic inheritance of inguinal hernia had been described in Cocker Spaniels and Dachshunds by Roberts (1986). The usual contents of inguinal hernia may include omentum, fat, ovary, uterus, small intestine, colon, bladder and spleen, with omentum being the commonest. (Bellenger, 1996). Herniation of gravid uterus and pyometra uterus through the inguinal ring are also report (Munro and Stead, 1993; Byers, 2007). The present paper reports bilateral inguinal hernia in a dachshund bitch and its surgical management.

trauma. The animal was bright, active and alert. All the physiological parameters were within the normal range. On palpation, the swellings were non-painful, soft and doughy in consistency. The left inguinal swelling was bigger in size compared to the right one. The contents of both the swelling were nonreducible, even on application of moderate pressure. The bladder was catheterized, urine was relieved and thus the possibility of vesicocele was ruled out. Ultrasonographic examination of the left inguinal mass could revealed strands of hypoechoic region with areas of normal echogenicity and the right inguinal mass with moderate echogenicity. Based on history, physical inspection and ultrasonographic examination, the condition was diagnosed as an acquired bilateral inguinal hernia. The reduction of the hernial contents and herniorrhaphy under general anaesthesia were resorted to.

JIVA Vol. 10

INTRODUCTION

CLINICAL REPORT

was draped. A four centimeter long cutaneous incision was made over the lateral aspect of the left inguinal swelling parallel to the flank fold. The incision was deepened through the subcutaneous tissue to expose hernial sac by blunt dissection. The hernial sac was opened and the contents were found to be non-gravid uterine horns with the broad ligaments (Fig.1). The kelotomy was performed by incising the inguinal ring in a cranio-medial direction to reduce whole non- gravid uterus with the broad ligaments into the abdominal cavity. The hernial sac was ligated as close to the internal inguinal ring as possible and was sectioned distal to it. Both internal and external inguinal rings and the kelotomy wound were closed in separate layers by simple continuous sutures followed by a layer of subcutaneous sutures using 3.5 metric polyglactin 910e. The skin wound was apposed with horizontal mattress sutures using 3.0 metric nylon. A similar procedure was repeated on the right inguinal ring to reduce omentum. (Fig. 2). A sterile gauze stent was sutured over both skin w o u n d s a n d Tr. b e n z o i n w a s a p p l i e d . f Postoperatively, ceftriaxone was administered at the rate of 25 mg/kg body weight intravenously. Oral antibiotic therapy was continued for six more days. The animal had an uneventful recovery except for a seroma on the right side. The skin sutures were th removed on the 9 post-operative day (Fig. 3) and the seroma subsided subsequently. Ovariohysterectomy at another date was recommended to avoid complication is future.2.

Fig. 2: The exposed content of the right hernial sac, the omentum

Fig. 3: Healed skin wound after bilateral hernial repair with a seroma on right side

J. Ind. Vet. Assoc., Kerala. 10 (1)

RESULT AND DISCUSSION

Fig. 1: The exposed contents of the left hernial sac, the uterus and the broad ligament

Acquired inguinal hernias are relatively common in dogs and may often met with middle aged intact bitches. Although certain toy breeds are over represented, no breed predilection has been documented (Waters et al., 1993). According to Munro and Stead (1993), the potential for development of inguinal hernia is more in females because of the normal extension of the vaginal process through the inguinal canal. Furthermore, accumulation of fat around the round ligament may dilate the vaginal process and inguinal canal allowing herniation. The contents of the hernial sac

CLINICAL REPORT

in bitches most often consist of broad ligament and uterine horns (Formston, 1990).

utrine horn and omentum in a beagle dog. J. Vet. Emerg. Crit. Care. 17:86-92

In the present case, the history and the clinical signs were similar to the reportes of Jahromi et al. (2009). Byers et al. (2007) had reported a case of inguinal hernia in a dog with signs of oestrus approximately three to four weeks before presentation and substantial increase in size of inguinal swelling two to three weeks prior to presentation. The condition has to be differentially diagnosed from mammary tumours, cysts, lipomas, enlarged lymph nodes, abscesses and hematomas. The chances of traumatic inguinal hernia were also ruled out as the dog was in normal body condition and had no history of trauma. Though a diagnosis of bilateral inguinal herniation could be diagnosed before surgery, the hernial contents could be confirmed only through surgical correction. Instead of a midline approach for bilateral inguinal hernia repair in bitches, the conventional approach was selected as it could facilitate better visualisation of both inguinal rings (Waters et al., 1993). The contents of the left and right hernial sacs were almost the same as in the report of Jahromi et al. (2009). Ovariohysterectomy was also recommended considering (Fossum, 2007) the probable heritable nature of this disease (Roberts, 1986). The most common post-operative complications observed in dogs undergone surgical repair of inguinal hernia included hematoma or seroma formation, incisional infection, wound dehiscence, hernia recurrence, peritonitis, sepsis and death (Pratschke, 2002). However, the follow up study did not reveal any potential post-operative complications and the animal had an uneventful recovery.

Fossum, T. W. 2007. Surgery of the abdominal cavity. In: Small animal surgery (ed. Fossum, T. W.). 3rd Ed. Mosby Elsevier, Philadelphia, pp: 317338 Hayes, H. M. 1974. Congenital umbilical and inguinal hernias in cattle, horse, swine, dogs, and cats: Risk by breed and sex among hospital patients. Am. J. Vet. Res. 35: 839-842. Jahromi, A. R., Nazhvani, S. D., Gandmani M. J. and Mehrshad, S. 2009. Concurrent bilateral inguinal and umbilical hernias in a bitch-a case report. Vet. Arhiv. 79: 517-522. Munro, E. and Stead, C. 1993. Ultrasonographic diagnosis of uterine entrapment in an inguinal hernia. J. Small Anim. Pract. 34: 139-141. Pratschke, K. 2002. Management of hernias and ruptures in small animals. In Pract. 24: 570581 Roberts, S. J. 1986. Veterinary Obstetrics and genital diseases (Theriogenology), 3rd Ed. Woodstock, VT. 981p Smeak, D. D. 2003. Abdominal hernias. In: Text book of small animal surgery (ed. Slatter, D.). 3rd Ed. W. B. Saunders, Philadelphia, pp: 449-470 Waters, D. J., Roy, R. G. and Stone, E. A. 1993. A retrospective study of inguinal hernia in 35 dogs. Vet. Surg. 22: 44-49 a

Atropine Sulphate 1ml amp, Morvel

Bellenger, C. R. 1996. Inguinal and scrotal herniation in 61 dogs. Aust. Vet. Practitioner. 26: 58-59 Byers, C. G., Williams, J. E. and Saylor, D. K. 2007. Pyometra with inguinal herniation of the left

Calmpose 2 ml ampoule, Ranbaxy

Vicryl 90 cm, Ethicon

Intacef 500 mg vial, Intas Pharmaceuticals

JIVA Vol. 10

REFERENCES

Aneket 10 ml vial, Neon Laboratories Ltd.

Issue 1 April 2012

Xylaxin 10 ml vial, Indian Immunologicals

CLINICAL REPORT

SURGICAL MANAGEMENT OF CERVICAL MUCOCELE IN A DOG Basavanagowda M.T., Joseph Cyrus, Md. AbidHussain and Shahid Vaseem S.A. Compassion Unlimited Plus Action (CUPA) Animal Care Hospital, R. T. Nagar, Bangalore

CLINICAL HISTORY AND PROCEDURE A one year old mongrel male dog was presented in the hospital with a ventral neck swelling for the past two weeks without any evidence of dysphagia or sialosis. Physical examination revealed that the mass was due to collection of saliva in the deeper structures of the intermandibular space and condition was diagnosed as cervical mucocele. Palpation was not associated with any pain and was soft and fluctuant. Imaging with radiography was used to rule out foreign bodies or neoplasia. Complete blood counts and biochemistry assessment were within normal physiological values. Surgical management was opted.

J. Ind. Vet. Assoc., Kerala. 10 (1)

A complete excision of the gland duct complex and drainage of the mucocele was planned. A stab incision was made in the lumen of the mucocele and digitally the lumen was palpated. The mandibular and sublingual pairs of the glands were resected and the wound was closed leaving a drain in situ. Ceftriaxone injections at 20mg/kg. bwt. b.i.d. and liquid feeding were followed with daily dressings. The drain was removed after the 5th day and the wound was left to heal by second intention. The recovery was uneventful. No evidence of xerostomia or other complications were encountered.

DISCUSSION Mucoceles are common in dogs of any age however male dogs are more predisposed. Most dogs with cervical or inter mandibular mucoceles are usually asymptomatic (Spangler and Culbertson, 1991). They are usually caused by a salivary duct rupture or obstructions. Complete surgical removal of the affected salivary ducts and associated gland is associated with complete resolution (DeBowes, 2005). REFERENCES DeBowles, L.J., 2005. Disorders of the oral cavity. In: BSAVA Manual of Canine and Feline nd Gastroenterology, 2 Ed., Edt. Hall, E.J., Simpson, J. W. And Williams, D. A., BSAVA. Spangler, W.L. and Culberston, M.R. 1991 Salivary gland disease in dogs and cats: 245 cases (19851988), J. Am. Vet. Med. Assoc. 198:465

CLINICAL REPORT

SURGICAL MANAGEMENT OF OVARIAN TUMOUR IN A BITCH Asha AbrahamÂš and P. RavindranÂ˛ District Veterinary Centre, Kottayam

CLINICAL OBSERVATIONS 0

Temperature

: 101.6 F

Pulse

: 60/min.

Mucous membrane

: Pale

Respiration

: Panting

Physical examination revealed abdominal effusions and presence of abdominal mass. On detailed examination, blood tinged exudates could be aspirated from the abdomen (haemo-abdomen), which was positive for protein test. Wet film examination of the peripheral blood taken from the ear tip was found negative for any moving parasites. Severe ascites limited the diagnostic quality of abdominal radiography. On ultrasound scanning, the ovarian tumors were fount to be large, contained 1. MVSc Scholar, College of Veterinary and Animal Sciences, Mannuthy 2. Veterinary Surgeon, District Veterinary Centre, Kottayam

DIAGNOSIS Diagnosis was made from the history, clinical signs, haematologic investigations, radiographic examination and ultrasound scanning and the disease was diagnosed as an ovarian tumour. TREATMENT Treatment adopted was removal of tumour by ovaro-hysterectomy. In addition, chemotherapy is advisable to reduce the chances of re occurrence. Anaesthesia and control Anaesthesia was induced after premedicating with 0.4ml Glycopyrrolate and 0.4ml Xylazine hydrochloride and maintained using 1.6ml Ketamine hydrochloride. The dog was controlled on dorsal recumbency. Preparation of the site Site of incision - midventral from a point, behind the umbilicus backwards along the midline, over a length of 5 inches. The site was shaved, scrubbed with savlon, mopped dry with cotton and painted tincture iodine over the site to make it aseptic. Draped the midventral area of the dog exposing the site of incision.

Issue 1 April 2012

A nine years old, black female Pomeranian dog, of 8 kg bodyweight was brought to the District nd Veterinary Centre, Kottayam, on 22 of July 2010 with the complaint of not taking food. Abdominal enlargement was noticed. As reported by the owner, the dog was off-feed since three days and showed reduced water intake. The dog was found inactive and dull throughout these days. Defecation and urination were normal. The animal was given regular vaccinations and was dewormed at regular intervals.

multiple anechoic cystic structures and had irregular margins.

JIVA Vol. 10

CLINICAL HISTORY

CLINICAL REPORT

Surgical Technique Incised the skin on the midventral site. Divided subcutaneous tissue on midline to expose linea alba. Incised the linea alba to its full thickness and exposed the abdominal viscera. Retracted the laparotomy edges using tissue forceps. Exposed the uterine horns, ovary and the bursa. Large, numerous neoplastic growths could be identified in both ovaries. Anterior ovarian ligament was cut and anterior utero-ovarian vessels are ligatured. The ovarian bursa is cut across its middle to expose the ovary. The ovary was disconnected from its anterior attachment. After both ovaries were freed in this manner, the posterior uterine arteries were ligated and cut in level with the cervix. The broad ligament of uterus is torn to liberate the uterine cornua. Applied two clamps anterior to the cervix and cut in between them to finally disconnect and remove the uterus with the ovaries. The stump was also ligated. Simple continuous sutures using catgut no. 2 were used to close the wound. Abdominal incision was closed with simple continuous double row with lock stitch for linea alba. The skin was sutured using nylon in horizontal mattress pattern. Applied tincture benzoin gauze to prevent bleeding over the suture line

Exteriosed tumor mass with uterus &ovaries

Animal presented in the hospital after complete recovery RESULT

J. Ind. Vet. Assoc., Kerala. 10 (1)

Animal made a uneventful recovery and was presented in the veterinary hospital on 7th post operative day for suture removal. DISCUSSION

Ovaries with large tumour mass Post operative care given with Inj. Ampoxin and Inj. Taxim intravenously for 5 days.

Ovarian tumours are uncommon in bitches, which accounts for approximately 1 percent of all neoplasms. Ovarian tumors are prone for metastasizing (spreading), and some are capable of producing hormones. The peak incidence of epithelial tumors is between 4 to 15 years, with a predisposition among Pointers for epithelial tumors.

CLINICAL REPORT

(Withrow and Susaneck, 1986). In this case, the age of affected animal is 9 years. Except for teratomas, ovarian neoplasms are found in middle aged to older animals. Breeds like Boxers, German Shepherds, Lhasa apso, Pomeranians, Yorkshire, English Bulldogs to be at an increased risk for granulosatheca cell tumors, a type of sex cord stromal cell tumour. In this case, a Pomeranian bitch is affected. There are three kinds of ovarian tumors in bitches-Epithelial tumors (skin/tissue), Germ cell tumors (sperm and ova) and Stromal tumors (connective tissue). The most common type of ovarian tumor in dogs is ovarian carcinomas. (Moulton, J.E.1978). In ovarian tumors like epithelial tumors, granulosa cell tumors, dysgerminomas, teratomas and germ cell tumors the clinical signs includes malignant ascites ,fever, anorexia, weight gain/loss and pleural effusions, in case of thoracic metastasis. Lack of sexual heat and menstruation, persistent

estrus, cystic endometrial hyperplasia/pyometra complex and squamous metaplasia of uterine mucosa, vulvar and vaginal hyperplasia, sanguineous vulvar discharge, secondary sex organ changes like gynecomastia, receptivity to male dogs are also seen. Ovarian tumors are generally treated with ovariohysterectomy. (Morrison, W.B.1990). For treatment for metastatic ovarian carcinoma, since most result in carcinomatosis, intracavitary cisplatin 2 (50 mg/m every 3 weeks for five to six treatments) is recommended which has survival times ranging from 6 months up to 5 years. (Moore A.S. et al, 1991). REFERENCES Moore, A.S.1991.Intracavitary cisplatin chemotherapy experience with six dogs. J. Vet. Intern. Med. 5:227p.

KERALA VETERINARY SCIENCE CONGRESS- 2012 FIRST ANNOUNCEMENT AND INVITATION FOR PAPERS

Indian Veterinary Association, Kerala has decided to give best scientific paper awards annually for the best papers published in Journal of Indian Veterinary Association, Kerala from the year 2012. The awards will be for a best Clinical paper and a best Research paper. The award consists of a citation and a cash award which will be distributed in the Veterinarians Annual Convention.

JIVA Vol. 10

BEST SCIENTIFIC PAPER AWARD OF INDIAN VETERINARY ASSOCIATION, KERALA

Issue 1 April 2012

Scientific Papers, Clinical Reports and Research Articles are invited from all fields of Veterinary and Animal Sciences for the Kerala Veterinary Science Congress th th 2012 scheduled to be held on 10 and 11 of November in Palakkad. Itinerary will be intimated shortly. Articles and Papers are to be send to vetsciencecongress@gmail.com.

CLINICAL REPORT

FETAL ANASARCA TWINS WITH HYDROALLANTOIS IN MALABARI DOES 2

Laiju M Philip., M. Ranjith Mohan and P. Francis Bastin . Animal Husbandry Department, Kerala

INTRODUCTION

J. Ind. Vet. Assoc., Kerala. 10 (1)

Dystocia is considered to be the major reproductive disorder in does presented to the Veterinary Hospital. The complications include fetal death, fetal mummification and fetal maceration or developmental abnormalities like fetal monsters, fetal dropsy and ectopic location of the fetus. The etiology of most fetal gestational complications except abortions continues to be poorly understood. Anasarca means generalized edema all over the body. The condition is seen commonly in cattle but may affect sheep,(Roberts, 1985), goat (Tamuli et. al.,1987; Sharma et al., 2002; Purohit et. al.,2006) and also rarely reported in the buffalo (Devanathan et. al., 1990). Hydrallantois is characterized by a larger than normal accumulation of allantoic fluid during a 5to 20-day period in the last trimester of pregnancy that occurs mainly in the bovine and rarely in mares and ewes (Milton et al., 1989). Most fetuses of animals with hydrallantois may have congenital defects, are underdeveloped, or are apparently normal but not viable (Milton et al., 1989, and Morin et. al., 1994).The details of surgical management fetal anasarca twins with hydrallantois in Malabari does are mentioned. MATERIALS AND METHODS A Malabari goat and its dam were presented at different times to the Veterinary Polyclinic, Veterinary Surgeon, Veterinary Polyclinic, Mannarkkad (corresponding author: phone 09447996512 Email: laijuphilip@rediffmail.com) 2

Veterinary Surgeon, Veterinary Dispensary, Karakurissi

Senior Veterinary Surgeon, Veterinary Polyclinic, Mannarkkad

Mannarkkad with the complaint of difficulty in parturition. Both the goats were presented with abnormally large abdomen. The dam was presented for its second kidding and the doe, for the first kidding. Per vaginal examination of both the animals revealed fetal anomalies as the cause for dystocia. So it was decided to do surgical intervention in both the cases. Caesarean section was carried out. The animals were restrained in left lateral recumbancy. The surgical site was prepared aseptically. Intravenous infusion Ringers Lactate were started to prevent hypovolumic shock. Local infiltration anesthesia was done around the surgical site with 2 percent lignocaine. Incised the skin and the fascia. Exteriorized the abnormally sized thin walled uterus after the separation of the abdominal muscles. Incision was made on the body of uterus. About six litres of watery and amber coloured allantoic fluid was drained out. Two anasarca kids were taken out in both the cases after reducing the hydro allantois. The uterus was rinsed with copious amounts of Normal Saline solution. The incision on the uterus was closed in Cushing's followed by Lambert's pattern of suturing using chromic catgut size 1/0. The peritoneum and the separated abdominal muscles were apposed using chromic catgut size 1 in a simple continuous suture pattern followed by subcuticular suturing using braided silk size 1. The skin was apposed in interrupted horizontal mattress fashion using nylon. The animals were maintained on intravenous fluids for half an hour post operatively. Parenteral antibiotics and tetanus toxoid injection were given. Owner was advised oral antibiotic therapy for a week. Both the animals recovered uneventfully.

CLINICAL REPORT

Hydro allantois treatment is directed at evacuation of the uterus by cesarean section or induced termination of pregnancy with prostaglandin (Braun Jr., 1997). If a large volume of allantoic fluid in the uterus is expelled rapidly, circulatory shock can develop (Misri and Singh, 2001).Most anasarcous fetuses are expelled dead. When the fetus poses difficulty in its delivery, cuts must be given over many places to release the fluid

JIVA Vol. 10

DISCUSSION

REFERENCES Braun Jr., W. 1997. Periparturient Infection and Structural Abnormalities. In: YOUNGQUIST, R. S Current Therapy in Large Animal Theriogenology.1 Ed., W B Saunders p. 530-537 Devanathan, T.G., Asokan, S.A. and Veerapandian, Sheshagiri, V.N. 1990. A note on fetal ascites with mild anasarca in buffalo. Ind. J Anim. Reprod., 11:68. J. R. Peir贸, A. S. Borges, R. Yanaka, M. B. Koivisto,l. C. N. Mendes,F. L. F. Feitosa, J. O. Abujamra, C. A. Rodrigues 2007. Hydrallantois in an Ewe (Case Report). Ars Veterinaria, Jaboticabal, Sp, Vol. 23, 116-119. Milton. A., Welker, B., Modransky, P.1989. Hydrallantois in an Ewe J. Am. Vet. Med. Assoc.195 (10), p.1385-86 Misri, J. and Singh,N. 2001. Hydrallantois in a goat. Ind. Vet. J. 78, p 255-256 Morin, D. E. Hornbuckle II, T., Rowan, L.L., Whiteley, H.E.1994.Hydrallantois in a Caprine Doe J. Am. Vet. Med. Assoc. 204, (l), p.108-111 Roberts, S.J. 1985. Eds Veterinary Obstetrics and Genital Diseases. Indian Edition Sharma, S.S., Bishnoi, B.L., Yadav, R.C., Garg, N., Purohit, G.N. 2002.Foetal anasarca in a goat. Vet Pract., 3:47. Tamuli, M.K., Rajkonwar, C.K. and Borghain, B.N. 1987. Foetal anasarca in a kid.A cause of dystocia. Ind. J. Anim. Reprod., 8:63

Issue 1 April 2012

or fetotomy or forced extraction to deliver the fetus. Rarely caesarean section may be indicated. Morin et al. (1994) reported the recovery of apparently normal but non-viable twin fetuses after caesarean section. The antenatal diagnosis of most of the commonly occurring fetal complications of gestation is partly possible with ultrasonography and such pregnancies should be carefully monitored or terminated. As a recommendation it is suggested to perform karyotyping of the breeding stock

CLINICAL REPORT

FETAL ANASARCA TWINS WITH HYDROALLANTOIS IN MALABARI DOES 2

Laiju M Philip., M. Ranjith Mohan and P. Francis Bastin . Animal Husbandry Department, Kerala

INTRODUCTION

J. Ind. Vet. Assoc., Kerala. 10 (1)

Veterinary Surgeon, Veterinary Dispensary, Karakurissi

Senior Veterinary Surgeon, Veterinary Polyclinic, Mannarkkad

CLINICAL REPORT

JIVA Vol. 10

DISCUSSION

Issue 1 April 2012

CLINICAL REPORT

CLINICAL MANAGEMENT OF EXOCRINE PANCREATIC INSUFFICIENCY IN A GERMAN SHEPHERD DOG V. Dhanesh 1, Usha Narayana pillai 2 ,S.Yogeshpriya 3, 4 5 Roshna Rasheed Kutty and S.Ajith Kumar Department of Clinical Veterinary Medicine, College of Veterinary and Animal Sciences , Mannuthy INTRODUCTION: Exocrine pancreatic insufficiency is the inability to digest food properly due to the lack of digestive enzyme made by the pancreas. animal will show clinical sign if there is greater than 85 percent loss of the pancreatic acinar which has ability to secrete digestive enzyme and it is clinically characterized by loss of weight , pica, coprophagia, poor quality hair coat etc. Consistency of the faces becomes oily, smooth, and soft. Perineal region will be oily stained because of steatorrhea.

J. Ind. Vet. Assoc., Kerala. 10 (1)

CASE HISTOY AND CLINICAL INVESTIGATION A three year old GSD was presented in the university hospital Mannuthy with a history of foul smelling diarrhea of three month duration. The animal was treated with anthelmintics and Sulfa TMP combination (Septran) by local veterinarian. Owner reported that there is considerable weight loss even though the animal was take normal quantity of food. On examination, physiological parameters like temperature((103 0 F) , heart rate (108 beats / min), pulse rate (107/min) and mucous membrane (pale roseate) were found to be normal consistency of the fecal sample was found to be oily and semisolid standard parasitological examination was done and no ova of parasitic important could be detected. But large number fat globules were present in the sample. No change could be detected in Haemogram. Fecal sample was positive for X- ray film test. Based on X1. 3, 4- P.G Scholar, 2. Associate Professor , 5.Professor and Head

ray film test and history the case was clinically diagnosed as exocrine pancreatic insufficiency.

TREATMENT AND DISCUSSION Treatment was carried out with Tab. Enzar forte, 1 tab twice daily along with this Tab. Flagyl 400 mg, 1 tab twice daily and Tab. Rantac 150 mg, Â˝ tab twice daily. Advised the owner to review the case after 10 days. Owner reported that animal is showing much improvement in the condition. Consistency of the feces becomes normal without any foul smell. In dog Exocrine pancreatic insufficiency is mainly due to pancreatic acinar atrophy and in cat it is due to destruction of the acinar tissue associated with subclinical or chronic pancreatitis. (Nelson et. al 2003). Pancreatic enzyme had a antibacterial property and in Exocrine pancreatic insufficiency lead to over growth of different type of bacteria in small intestine. Over growth of the bacteria will lead to changes in the small intestine like villous atrophy, alteration in the mucosal enzymatic activity etc. Bacterial count in the small intestine will be more

CLINICAL REPORT

than 10 6 colony forming unit / gram of intestinal content which is much higher than the normal value (Regan, 1977). So to avoid these, oral antibiotics like Metronidazole at dose rate of 7.5-15 mg/kg BW twice daily or Tylosin at a dose rate of 20-30 mg/kg BW / day for 6 week were advocated. Fresh raw pancreas of beef can be advisable for animals which are suffering from exocrine pancreatic insufficiency. Porcine pancreas is not preferable because there is a chance of Aujezk's disease. (Khan et al 2005). Confirmatory test for the exocrine pancreatic insufficiency is estimation of the serum trypsin like immunoreactive (TLI) protein. In normal range for the TLI are 5- 32 micro g / L. If the concentration is less than 2 micro g/ L, it is considered as the animal is suffering from the exocrine pancreatic insufficiency (Westermarck, 2003). In most of the case animal need a lifelong treatment.

REFERRENCE: Khan, C.M 2005: the Merck Veterinary Manual, ninth edn, Merks & Co., INC, Whitehouse station, U.S. 2712pp Nelson, R.W., Couto, C.G. 2003: Small Internal Medicine, Third edn, Mosby, Missouri, U.S. 1362pp Westermarck, E., Wiberg, M. 2003: Exocrine pancreatic insufficiency in dogs, Vet Clin North Am Small Anim Pract. 33: 11651179pp Regan, P.T., Malagelada, J.R., Dimango, E.P., Glanzman S.L., and Vay, L.W. 1977: C o m p a r a t i v e E ff e c t o f A n t a c i d s , Cimetidine and Enteric Coating on the Therapeutic Response to Oral Enzyme In Severe Pancreatic Insufficiency. N Engl J Med. 297: 854-858pp

INDEXING AND ARCHIVING IN CAB ABSTRACTS JOURNAL OF INDIAN VETERINARY ASSOCIATION, KERALA From Subject To Date

: Uma Sabapathy Allen <u.allen@cabi.org> : Indexing and archiving in CAB Abstracts - Journal of Indian Veterinary Association, Kerala : "vijikumaran@yahoo.com" <vijikumaran@yahoo.com> : Tuesday, 28 February, 2012, 21:34

Thank you. Uma Allen Uma Allen Content Editor, CABI Head Office, Nosworthy Way, Wallingford, Oxfordshire, OX10 8DE, United Kingdom Telephone: +44 (0)1491 829458, Fax: +44 (0)1491 833508 Email: u.allen@cabi.org Visit us at: www.cabi.org

JIVA Vol. 10

Chief Editor, Journal of Indian Veterinary Association, Kerala (ISSN 0975-5195) I am writing on behalf of CAB International regarding the Journal of Indian Veterinary Association, Kerala. We recently evaluated the journal according to our internal selection criteria of potential yield, scientific value and geographic origin and judged its content to be both novel and important, and deemed to be very relevant to the CAB Abstracts database produced by CABI. We would therefore like to request permission not just to abstract and index the title but also to archive the journal's full-text content in the CABI Full-Text Repository. For the latter we would only require non-exclusive internet publishing rights; copyright remains with the publisher/author, allowing them to publish the material through any internet site/publication. I understand the JIVA is an open access publication. By including the JIVA and as many publications as possible in the full-text repository, we hope to ensure that they are preserved and easily located by researchers and professionals throughout the world, both now and in the future. This would also be a valuable way of promoting the publications amongst the global users of CAB Abstracts. A list of documents currently available in the repository can be viewed at http://www.cabi.org/fulltext Please let me know if you require further information to support this request.

Issue 1 April 2012

Dr. K.Vijaya Kumar

GENERAL ARTICLE

METHANE EMISSION FROM RUMINANTS ENVIRONMENTAL IMPLICATIONS AND STRATEGIES FOR REDUCTION.

J. Ind. Vet. Assoc., Kerala. 10 (1)

Lalu. K., Usha. A.P., Venkatachalapathy.R.T and Prasanth.V. Centre for Pig Production and Research, Mannuthy INTRODUCTION

of polar ice cap.

Methane, the simplest aliphatic hydrocarbon, is one of the gaseous end products of fermentative digestion in ruminants. It is released into the atmosphere by eructation. It is twenty times more potent than carbon dioxide as green house gas. Its atmospheric concentration has doubled since industrial revolution. About 22 Percent of anthropogenic methane is from ruminants. Continuous release of methane is a matter of worry. It also contributes to green house effect by the process called radiative forcing leading to global warming which in turn result in erratic weather patterns, desertification and rising of sea level due to melting

METHANE PRODUCTION BY INDIAN LIVESTOCK

ENVIRONMENTAL HAZARDS DUE TO METHANE Among the entire green house gases methane is one of the most dangerous as its radiative forcing effect is very high that the greenhouse

Indian livestock contribute about 14 Percent of total methane emitted by world livestock. According to Khan et al., (1996) methane production per head of animal (cattle/buffalo) is only 170 liters/day which is much less than in the developed countries where animals are managed in factory style. Comparative emission of methane from animals is presented in Table 1. The energy content of methane is very high (13.25 Kcal/g) and the amount of methane belched by Indian cattle is equivalent to the feed costing to Rs 2.7 crores per day.

potential of one unit of methane is expressed as 7.5 C equivalent. Moreover the rate of production of methane is higher when compared to any other green house gases. Methane has both direct and indirect effect on climate. It interacts directly with chlorine in presence of infrared energy in the upper troposphere

GENERAL ARTICLE

and lower stratosphere leading to depletion of ozone layer. Indirectly it reacts with carbon dioxide a green house gas. The reaction is complex as 1) methane has absorption band in the infrared region 2) It is oxidized in troposphere by free hydroxyl radical 3) It is sizeable source of carbon monoxide through oxidation. 4) Stratospheric methane can react with chlorine from hydrochloric acid which destroys ozone layer. METHANOGENESIS IN RUMINANTS Methane is produced in rumen strictly under anaerobic condition and serves as a hydrogen sink. Most of the methane is produced in rumen by the reduction of carbon dioxide and some is derived from formate. Methanogenic bacteria are mainly responsible for methane production, which involves a specialized biochemical function. Methanogenesis is a very intricate process that involves vitamin B12, folic acid, coenzyme (2 Mercapto ethane sulfonic acid), fatty acid and methyl butyrate. Half of the hydrogen produced during fermentation of carbohydrate is used for propionate production , biohydrogenation of unsaturated fatty acid and the other half for methane production The fermentation reaction are given below

1. C6 H12 O6

2CH3 COOH + 2CO2 + 8(H) (Acetate) (Methanogenic)

2. C6H12O6

2CH3 CH2 COOH + 2H2O + 4(H) (Propionate) (Glucogenic)

3. C6H12 O6

CH3 CH2-CH-COOH + 2CO2 + 4(H) (Butyrate) (Methanogenic)

Of the sixteen hydrogen molecules produced during the fermentation of carbohydrate, eight hydrogen molecules are utilized for propionate formation and other eight is converted to methane as shown. 4H2 + CO2

CH4 + 2H2O

Ruminants produce about 20g of methane for each kg of dry matter intake. Methane production in cattle is affected by variety of nutritional factors including level of intake, type of carbohydrate, forage processing, and change in the rumen microflora. Diet favoring propionate production in rumen causes decrease in methane and diet like roughage favours acetate production, which increases methane production. The molar proportion of volatile fatty acid plays a key role because fibrous feed results in higher methanogenic VFA (Preston and Leng 1987). So narrowing of the acetate: propionate ratio would increase performance in ruminants.

Substrates

Products

CO2, H2 and HCOOH

CH4, CO2 and H2O

Methanobacterium formicicum

HCOOH

CH4, CO2 and H2O

Methanobrevibacter ruminantium

HCOOH

CH4, CO2 and H2O

Methanobacterium mobile

HCOOH

CH4, CO2 and H2O

Methanosarcina barkerii

Methanol, Acetate

CH4, CO2 and NH4

Methanobacterium ruminantium

METHANE MITIGATION -A BOON TO FARMERS AND ENVIRONMENT It is desirable to maximally utilize fibre for ruminant production, because plant fibre is the most abundant organic matter that is available, and the greatest merit of ruminants is the ability to utilize

fibre. As the current practice of feeding highconcentrate diets to cattle is a luxury that future generations may not experience. An improvement in fibre utilization will become increasingly important. Therefore, it is critical to develop strategies aimed at reducing ruminal methanogenesis without

JIVA Vol. 10

Bacteria

Issue 1 April 2012

Table.2. Methanogenic bacteria and their substrates for methane production

GENERAL ARTICLE

depressing fibre digestion. Reduction in methane emission by ruminants may be one of the means to achieve animal productivity in environment friendly manner. Reducing methane up to 70 Percent will be beneficial for reducing fodder wastage, increase in milk production, better fat percentage, and for better animal health. METHODS OF METHANE MITIGATION There are different methods to reduce methane from ruminants which includes I. Proper managemental practices II. Manipulation of rumen ecosystem III. Using vaccine against methanogens I. PROPER MANAGEMENTAL PRACTICES a. Controlled grazing It is cheap and simple strategy to keep animals in smaller area to graze. Such controlled grazing decreases methane production and should formulate an ideal grazing schedule that minimize methane and maximize efficiency (USEPA, 1998). b. Selective breeding Studies in New Zealand have shown that there are significant differences in methane emission between individual sheep on same diet. This suggests that breeding for low methane out put may be a strategy for methane mitigation. But such selective breeding of ruminants for low methane output is still at preliminary stage.

J. Ind. Vet. Assoc., Kerala. 10 (1)

c. Animal health and sanitary measures Chronic disease in livestock is a persistent problem in developing countries. In disease condition like foot and mouth disease and tuberculosis, there is less feed efficiency and more methane production .So better health management reduces methane production. d. Improving digestibility of diet The use of chopped straw, treatment of cereal straw with alkali or ammonia increases the intake and digestibility and reduces methane

production per kg organic matter digested. Supplementation of Urea molasses mineral block (UMMB) reduces the methane release by increased utilization of diet(Turnbull et. al., 2000). II MANIPULATION OF RUMEN ECOSYSTEM here are many techniques to manipulate the rumen ecosystem. Feeding of antibiotics, methane analogues and using genetic engineering tools can control methanogenesis in rumen. a. Defaunation Defaunation is a term used for the elimination of protozoa from the rumen. Anaerobic protozoa lack mitochondria, but contain hydrogenosomes, in which hydrogen is produced when pyruvate is converted to acetyl Coenzyme A and carbon dioxide. Defaunation reduces methanogenesis in rumen to an extent of 20 to 50 percent depending upon diet composition (Kreuzer et. al., 1986). b. Suppression of ruminal methanogenesis by chemicals Over the years extensive attempts have been made to reduce ruminal methanogenesis, including the addition of chemicals such as halogen compounds and antibiotics. The polyether ionophores, such as monensin and lasalocid, have been considered to be the most useful modifiers of ruminal fermentation, because propionate redection is increased and hence reduction in methanogenesis. A peptide ionophore, aibellin was found to reduce methanogenesis and augment propionate production in the rumen without decreasing protozoal numbers, the digestibility of neutral detergent fibre, or the production of total volatile fatty acids (Hino et al., 1993). Recently, it has been reported that as low as 4 nmol of mevastatin and lovastatin, inhibited in vitro growth and methane production of ruminal methanogenic bacteria. c. Suppression of Ruminal methanogenesis by fats It has long been known that methanogenesis is reduced by the addition of fats or long-chain fatty

GENERAL ARTICLE

Chlorinated methane analogues such as chloroform, carbon tetrachloride and methylene chloride inhibit methanogenesis in rumen. Halogenated alkanes also block the function of corrinoid enzymes (Vitamin B12dependent enzymes) in methanogenesis. Bromoethane sulfonic acid (BES) is a potent inhibitor of methanogenesis and growth of M. ruminantium. Among the halogenated methane analogues bromochloromethane (BCM) seems to be the most potent. (Trei et al., 1970; Sawyer et al., 1971; Chalupa, 1984). III

VACCINES

Recently scientists of CSIRO (Australia) developed vaccine against methanogens using pseudumurein layer of its cell wall. This vaccine suppress the growth of methanogens subsequently reduces methane production. CONCLUSION Ruminants are evidently major source of methane emission and so methane abundance would continue to grow in the atmosphere with rise in animal number and production. Reduction of methane emission from ruminants can be achieved by several methods viz., supplementation of critical nutrient through concentrate or green fodder, feeding urea molasses mineral block, defaunation variation of roughage: concentrate ratio, ammoniation of cereal crop residues, feeding of halogenated methane, use of vaccines etc. If proper feeding strategy and managemental practices are followed,

REFERRENCES Chalupa, W. 1984. Manipulation of rumen fermentation. In: Recent Advances in Animal Nutrition (edited by haresign, W., Cole, D.), London, UK, Butterworths, pp 143-160. Czerkawski, J.W. 1986. Transfer of metabolic hydrogen in the rumen. In: An introduction to rumen studies. Oxford, UK; Pergamon Press, pp. 173-188. Hino, T., Saitoh, H., Miwa, T., Kanda, M. and Kumazawa, S. 1993. Effect of aibelin, a peptide antibiotic, on propionate production in the rumen of goats. J. Dairy Sci., 77: 3426-3431. Khan, M.Y., Murari Lal, Biswas, J.C., Haque, N. and Girdhar, N. 1996. Methane production from Indian livestock. National Symposium. Prospects of livestock and poultry development in 21st Century. CARI, Izatnagar, India, pp 41. Kreuzer, M., Kirchgessner, J. and Muller, H.L. 1986. Effect of defaunation on the loss of energy in weathers fed different quantities of cellulose and normal or steam-flaked maize starch. Anim. Feed Sci. Technol., 16: 233-241. Leng, R.A. 1991. Improving ruminant production and reducing methane emission from ruminants by strategic supplementation. EPA, Washington, D.C. Preston, T.R. and Leng, R.A. 1987. Matching ruminant production system with available resources in the tropics and subtropics penumble books. Armidale Australia. Sawyer, M.S., Hoover, W.H. and Sniffen, C.J. 1971. Effects of methane inhibitor on growth and energy metabolism in sheep. J. Dairy Sci., 34: 1191-1199. Trei, J.E., Singh, Y.K. and Scot, G.C. 1970. Effects of methane inhibition on rumen metabolism. J. Anim. Sci., 31: 256. Turnbull, G.W., Cripe, K. and Mishra, S. 2000. Effects of molasses urea supplementation of buffalo diet in Gujarat state. India on work production, butterfat, animal weight and methane loss. In: Proceedings of II International Methane Mitigation Conference, June 18-23; Novosibirsk, Russia. USEPA 1998. Small steps make a difference: Improving your cow-calf business and the emission of the southeastern USEPA 430-K-98-001, 12P.

Issue 1 April 2012

d. Halogenated Methane Analogues

methane production from ruminants can be reduced. It will improve the energy utilization /production performance of ruminants and protect the environment by reducing global warming.

JIVA Vol. 10

acids in the rumen, especially unsaturated fatty acids (UFAs) such as linoleic and linolenic (Czerkawski, 1986). UFAs have toxic effects on methanogens and the reduction in methanogenesis appears to be mostly a secondary effect on fermentation. Both in vivo and in vitro experiments have showed that addition of fats and oils containing UFAs depressed fibre digestion as cellulolytic bacteria are sensitive to UFAs. Addition of alpha-tocopherol and beta-carotene alleviates the toxic effect of UFAs, and improves fibre digestion.

GENERAL ARTICLE

TERMINATION OF PREGNANCY IN BITCHES Abhilash.R.S, Anil kumar.K, Biju.S and Ajith.K.S, Livestock Research Station, Thiruvazhamkunnu, Palakkad

INTRODUCTION Termination of pregnancy is one of the most common requests from dog owners. The usual reasons include too young age, too old age, disproportionate size of mating partners or unwanted or accidental mating. Over the last 20 years many new drugs have been used for termination of pregnancy in canines. There are different treatment protocols such as oestrogen therapy, PGF2% and its analogues, dopamine agonists, combination of prostaglandins and dopamine agonists, anti progestin therapy etc. Although most of these drugs have already been used for years in other species, only few are widely marketed or approved for use in dogs. The aim of the present article is to briefly review the steps to be taken before proceeding with termination of pregnancy, the drugs available for the termination of pregnancy in bitches, their pharmacological properties and availability.

J. Ind. Vet. Assoc., Kerala. 10 (1)

INITIAL EXAMINATION A thorough history is valuable prior to attempt termination of pregnancy in bitch. Confirm whether the animal has actually mated or not. A vaginal smear is the best diagnostic tool for evaluating mating and to find the stage of the cycle. The presence of sperm or sperm head confirms mating whereas absence of sperm does not indicate that a fertile breeding did not occur. Pregnancy should be confirmed by ultrasound scanning around day 30 of the last breeding before starting the treatment. The points to ponder in planning to abort a bitch include its pregnancy confirmation and the

safety, reliability and the ease of administration of the drug used. The first stage of pregnancy begins at fertilization and ends a few days after implantation. During this time pregnancy cannot be confirmed and induction of abortion is difficult because of the refractory nature of corpus luteum to exogenous medications. Termination of pregnancy at this stage can be attempted with medications like estrogens, prostaglandins and anti progestins. During the second stage, pregnancy can be confirmed and abortion can be induced if necessary. Abortion can be induced with prostaglandins, antiprolactin agents (dopamine agonists such as bromocriptine or cabergoline), combination of prostaglandins and dopamine agonists or with inhibitors of progesterone secretions (epostane) or antiprogestins (mifepristone or aglepristone). Third stage is one that begins with the calcification of fetal structures and abortion is always associated with expulsion of foetus. In this stage abortion might induce premature parturition with delivery of live pups. Hence the best time for initiation of abortion protocols in bitches is between days 30 and 35 from the date of last breeding INDUCTION OF ABORTION PRIOR TO IMPLANTATION Fertilization of eggs and the initial 6-10 days of embryonic development take place in the oviducts. Large doses of estrogens can prolong retention time of embryo within the oviduct that leads to the degeneration and death of embryo. The mechanism of action of oestrogen is in two ways, firstly it tightens uterotubal junction and thus

GENERAL ARTICLE

Oestrogens are widely used to prevent unwanted pregnancies. They act by altering the transport time of zygotes and thus interfering with implantation. In some bitches estrogens given during oestrus results in early luteolysis and this effect may be mediated either directly upon luteal progesterone production or by inhibition of LH release which is luteotrophic. a. Diethyl Stilbesterol (DES) Injection of DES at a dose rate of 2mg/kg body weight, up to 25mg once or twice within 5 days of mating is found to be highly effective in terminating pregnancy. However injectable DES is not available for veterinary practice. Oral DES has been recommended at a dosage of 1 to 2 mg/day for 7 days after mating, but oral therapy has not been found to be completely reliable. b. Oestradiol cypionate It was an oestrogen compound commonly used by veterinarians for the management of unwanted mating. The treatment protocol involved is administration of 0.25 to 1 mg total dose within 3 days of mating. A dose rate of 0.04 mg /kg is 100 percent successful in preventing pregnancy in bitches. The total dose should not exceed 1mg. Despite the potentially favourable action on termination of pregnancy, it has major side effects such as permanent bone marrow suppression or destruction resulting in severe anaemia, leukopenia, thrombocytopenia and death. c. Conjugated oestrogen Conjugated oestrogens can be used for the treatment of misalliance in dogs within 5 days following breeding. They are mainly isolated from mare's urine and hence it can be called as conjugated equine oestrogen. Most commonly used for the treatment of osteoporosis, atrophic vaginitis,

However estrogens can result in the development of pyometra by causing cervical relaxation thus allowing the vaginal bacteria to enter the uterus. Estrogens may also produce dose related bone marrow suppression. Diethyl stilbesterol, oestradiol benzoate and estradiol cypionate have been widely used to prevent implantation. But oestrogen preparations are not recommended in veterinary practice because of their harmful side effects. Oestrogen is thought to predispose pyometra in bitches by sensitizing progesterone receptors and enhancing binding of progesterone to the endometrium. It has been also reported that excess serum estrogens can lead to oestrogen- induced bone marrow destruction. 2. PROSTAGLANDINS AND ITS ANALOGUES Pregnancy in the bitch depends on progesterone secretion from corpora lutea. Many studies indicate that bitches that have corpora lutea are relatively resistant to the luteolytic effects of prostaglandins during the first 14 to 28 days of pregnancy. PGF2% (Natural Prostaglandins ie Dinoprost) is luteolytic and uterotonic, inducing intense uterine contractions due to the smooth muscle contraction effects and may lead to adverse reactions. Synthetic analogs (cloprostenol sodium) characterized by more specific activity on the corpus luteum and less on smooth muscle stimulation properties have fewer side effects. A. Natural Prostaglandin: - Prostaglandins are found to be highly effective for termination of pregnancy in bitches after 30 days of gestation. Its use prior to 30 day is not recommended. Most preferred treatment protocol is 0.1 mg/kg s/c every 8 hours for 2 days and then 0.2 mg/kg given s/c every 8 hours until abortion complete, the average was

Issue 1 April 2012

1. OESTROGENS

atrophic urethritis etc as a complication of menopause in woman. Commonly available preparation is PREMARIN 0.625mg and 1.25mg tablets. Dosage 1.875mg daily for 3 days

JIVA Vol. 10

prolong oviductal retention of embryos and secondly oestrogen has direct degenerative effects on ova and may alter the endometrium.

GENERAL ARTICLE

J. Ind. Vet. Assoc., Kerala. 10 (1)

approximately 5-7 days (Feldman et.al, 1993 and Renukaradhya et.al, 2008). This protocol resulted in the least side effects. After administration of drug, the dog should be observed for 30 minutes for any side effects. The dog should be fed 1-2 hours after prostaglandin injection so as to avoid vomiting. It has been observed that plasma progesterone less than 2.0 ng / ml result in pregnancy termination and pre treatment concentration of plasma progesterone is more than 6ng/ml (Feldman et.al, 1993). Most of the animals treated will exhibit some of the following side effects like panting, respiratory distress, excess salivation, vomiting, defecation, stranguria and urination. Normally these side effects start within 30 seconds to 3 minutes and usually persist for 5-20 minutes. Side effects are usually severe during the first few injections and side effects will be diminishing after each subsequent injection. Preparation - LUTALYSE 5ml &10ml vials are available. Concentration 5mg/ml b. Prostaglandin analogs:- It has greater luteolytic effectiveness at relatively low doses and decreases the occurrence of myometrial contractions and severity of side effects compared to natural prostaglandins. It has much greater affinity for the prostaglandin receptors and has a longer half life than natural prostaglandin. It can be given at the dose rate of 2.5µg/Kg body weight subcutaneously every 48 hours for 3 to 4 times (Reddy et.al, 2010). In order to reduce the side effects atropine sulphate can be given at the rate of 0.04 mg/kg body weight subcutaneously 10-15 minutes prior to the administration of drug. Preparation Inj.Clostenol 2ml, Inj.Pragma2ml, Inj.Cyclix 2ml, Inj. Estropur 2ml Concentration250µg/ml 3. DOPAMINE AGONISTS Dopaminergic agonists are ergotinederivative alkaloid compounds that exert an antiprolactinergic effect. The ability of dopamine agonists to inhibit prolactin secretion makes them optimal for milk suppression, either during overt

pseudopregnancy episodes or in the post-partum period. It is well known that prolactin is a required luteotropic hormone during the second half of canine luteal phase. Therefore, anti-prolactins can also be used to suppress luteal function in progesterone dependent conditions such as pyometra, unwanted pregnancy and mammary tumors. Two of the most widely used dopamine agonists in dogs are bromocriptine and cabergoline, which have a direct action on D2-dopamine receptors of the lactotrophic cells of the anterior pituitary gland. a. Bromocriptine: - It has been reported to be an effective abortifacient after 35 days of gestation but not prior to day 30. Two different treatment protocols have been adopted. In one protocol 0.1mg/kg body weight daily or BID for 6 consecutive days beginning on day 30 of gestation. In the second protocol, 0.03 mg/kg twice daily for 4 days beginning after day 30 of gestation. Bromocriptine commonly causes inappetence, anorexia, vomiting and depression. Also the drug is not 100% effective in terminating pregnancy. Emesis is presumably due to interaction with dopaminergic elements in the emesis centre of the brain and the ability of the drug to cross the blood brain barrier. The emetic effect may reduce the absorption of the total dose administered, and thus compromise efficacy. Because of above reasons the drug has not been used extensively. Preparation ENCRIPT 2.5 mg tab, PROCTINAL 1.25 & 2.5 mg tabs. b. Cabergoline: - It is a long acting dopamine receptor agonist and prolactin inhibitor. It is highly effective orally and parenterally. A dose of 5µg/kg once daily cause a sharp decline in serum prolactin concentration and result in abortion without much side effects (Reddy et.al, 2010).. The side effects of cabergoline are milder (compared to those of bromocriptine) presumably due to the fact that it appears to be a more specific D-2 dopamine receptor agonist and is less able to cross the blood-brain barrier and have CNS effects. Preparation CABGOLIN Tab 0.25 & 0.5 mg, CAMFORTE Tab 0.5 & 1mg

GENERAL ARTICLE

5. ANTI PROGESTERONE THERAPY Anti-progestins are synthetic steroids that bind with great affinity to progesterone receptors, preventing progesterone from exerting its biological effects. After administration of the drug peripheral progesterone concentration remains unaltered but its action is blocked. In dogs, the anti-progestins mifepristone and aglepristone have been used for experimental and clinical purposes, including pregnancy termination and management of pyometra. a. Mifepristone: -Mifepristone is a progesterone and glucocorticoid antagonist. It is more potent as an anti-progestin than as an anti-corticoid. In pregnant women, mifepristone is able to interrupt early pregnancy in 80 percent of cases without any major side effects. To improve its efficacy, mifepristone is currently used in combination with low doses of prostaglandin analogs such as misoprostol. The efficacy of combined treatment (mifepristone plus misoprostol) is 96 percent in humans. The drug act as a progesterone receptor antagonist at the level of the uterus independent of any additional effects on luteal function. Premature cessation of luteal function may have occurred secondary to the termination of

This drug is orally active and has been shown to be safe and effective in terminating pregnancy after 30 days of gestation. The treatment protocol involved oral administration of drug at the rate of 2.5 mg/kg twice daily for 4-5 days or until abortion or resorption occurred (Concanoon et.al, 1990). It is a competitive antagonist of progesterone on the receptor level thus having most clinical effects in the presence of progesterone. Preparation Tab. MTPILL 200mg, MEFIPIL 200mg, UNWANTED 200mg B. Aglepristone: - This is a relatively new antiprogesterone drug developed for animal use. Aglepristone can be used any time up to day 45 for safe effective termination of pregnancy (Fieni et. al, 2001). Aglepristone does not modify plasma concentrations of progesterone, prostaglandins, oxytocin or cortisol within 24 hours after its administration but induces an increase in concentrations of prolactin within 12 hours in bitches treated in mid pregnancy (Galac, et. al, 2000). This can explain the mammary gland congestion typically observed after mid pregnancy termination. Shortening of the inter-oestrous interval and prolactin release seems to prove a direct or indirect action of aglepristone on hypothalamic-pituitary axis. As an abortifacient, aglepristone acts like a progesterone antagonist, at the uterus level and does not have direct and immediate luteolysis properties. Termination of pregnancy occurs in the presence of high plasma progesterone concentrations (Baan et.al, 2005).. The early administration of aglepristone at 0 to 25 days after mating always resulted in prevention of pregnancy. The later administration of aglepristone at day 26 to 45 after mating induced resorbtion or abortion within seven days in 96 percent of cases. There were no untoward side effects. The drug can be administered at a dosage of

Issue 1 April 2012

Simultaneous administration of prostaglandin and dopamine agonist is found to be highly effective. Therapy begins 28 days after first breeding. Cloprostenol is administered subcutaneously on alternative days at a dose rate of 1 Âľg/kg and the drug has to be administered three times. Oral cabergoline has to be given at a dose rate of 5Âľg/kg body weight for 9 days. This regimen reduces the adverse effects of prostaglandin therapy alone and increases the efficacy of prolactin antagonists. When the bitches were treated for approximately 9 days, 100 percent showed resorption and there was generally no side effects except sanguinous vaginal discharge (Onclin et.al, 1995).

pregnancy or may represent a luteolytic effect of treatment independent of pregnancy status. Mifepristone has been demonstrated to induce direct luteolysis and has an anticorticoid activity.

JIVA Vol. 10

4. COMBINATION OF PROSTAGLANDIN AND DOPAMINE AGONIST

GENERAL ARTICLE

10mg/kg body weight (0.33ml/kg/day) subcutaneously twice at 24 hour interval. Efficacy of treatment for termination of pregnancy is reported to be 95 percent. No side effects were observed except mammary development and lactation. Preparation ALIZIN 10 ml vial 30 mg/ml. 6. OGESTERONE SYNTHESIS INHIBITORS Progesterone production can be blocked by the hydroxyl steroid dehydrogenase isomerase enzyme inhibitors, which prevent the conversion of prognenelone to progesterone. Prognenelone is biologically inactive, and therefore progesterone support for the pregnancy is lost, resulting in resorption or abortion (Simpson, 1998). Epostane is one such enzyme inhibitor that has no intrinsic oestrogenic, androgenic or progestogenic activity. When administered subcutaneously at the onset of metoestrus (dioestrus), epostane will prevent or terminate pregnancy. It can be given at a dose rate of 5mg/kg body weight orally for 7 days (Keister et. al, 1989).

J. Ind. Vet. Assoc., Kerala. 10 (1)

7. TAMOXIFEN CITRATE It acts as an antiestrogen in premenopausal women but has estrogenic activity in dogs. It may interfere with zygote transport and/or implantation. Relatively high doses of drug are given twice daily during proestrus, oestrus, and early metoestrus. The drug was effective in preventing or terminating pregnancy if administration began during proestrus or estrus or on day 2 of estrus. Efficacy was much poor in if the treatment commenced on day 15 onwards. It can be given at a dose rate of 1mg/kg orally twice a day for 10 days. A high incidence of pathological changes in the bitch's reproductive tract is induced by tamoxifen, including ovarian cysts and endometritis, and the compound is of little value for potential breeding animals (Bowen et.al, 1988). Preparation TAMOFEN Tab 10 mg, TAMOXIFEN Tab 10, 20 and 40 mg.

8. EMBRYOTOXIC AGENTS Several novel embryotoxic agents such as phenyltriazole isoindole and isoquinoline compounds have been evaluated in the bitch. They are most effective when given around the time of implantation and often only a single administration is required. A single sub cutaneous or intra muscular injection of 2-(3-ethoxy-phenyl)-5, 6-dihydro-striazole[5,1-a]isoquinoline (DL 204-IT) dissolved or suspended in an oily vehicle is sufficient. The optimal time of treatment was found to be day 20 of gestation, at which time the smallest effective dose was 6.25 ng/kg (Galliani et. al, 1982). However many of these agents have toxic side effects including vomiting, diarrhoea, weight loss, pyrexia, lethargy and immunosuppression. 9. DEXAMETHAZONE Dexamethasone administered beginning at mid-gestation can terminate pregnancy in dogs, presumably by activating endogenous mechanisms similar to those involved in parturition. It can result in the production of oestrogen and prostaglandin by the fetoplacental unit. Single dose of glucocorticoids are not efficacious in the bitch. It can be given at a dose rate of 200Âľg/kg body weight for 7 days and then at a tapering dose of 10-20 Âľg/kg for next 3 days (Wanke et. al, 2002). Advantages of such a therapy for pregnancy termination include the fact that it involves only oral administration of a relatively inexpensive drug; however repeated administration and high doses make the method impractical. Preparation: - DEXONA Tab 0.5mg, WYMESONE Tab 0.5 mg CONCLUSION Before deciding treatment for misalliance, vaginal cytology should be performed to make sure that mating had taken place. Aglepristone, oestrogens and tamoxifen citrate are the drugs which can be preferred for the treatment of misalliance in

GENERAL ARTICLE

Baan, M, Taverne, M.A.M, Kooistra,H.S, J. de Gier, Dieleman, S.J and Okkens, A.C (2005) “Induction of parturition in the bitch with the progesterone-receptor blocker aglépristone” Theriogenology Volume 63, Issue 7 , Pages 1958-1972, 15 April 2005 Bowen RA, Olson PN, Young S, Withrow SJ. 1988 “Efficacy and toxicity of tamoxifen citrate for prevention and termination of pregnancy in bitches” Am. J. Vet. Res. Jan; 49 (1):27-31. Concannon PW, Yeager A, Frank D, Iyampillai A. 1990 “Termination of pregnancy and induction of premature luteolysis by the antiprogestagen, mifepristone, in dogs” J. Reprod. Fertil. Jan; 88(1):99-104. Feldman EC, Davidson AP, Nelson RW, Nyland TG, Munro C 1993 Prostaglandin induction of abortion in pregnant bitches after misalliance J. Am. Vet. Med. Assoc. Jun 1;202(11):1855-8. Fieni,F, J.F. Bruyas, I. Battut and D. Tainturier 2001 “Clinical Use of Anti-Progestins in the Bitch” International Veterinary Information Service, Ithaca NY (www.ivis.org), A1219.0201 Galac,S, H.S. Kooistra,J. Butinar, M.M. Bevers, S.J.

Galliani, G, Lernerm, L.J, Caramel, C., Maraschin. R, Nani, S., Nava, A, Nava, A. 1982 “Pregnancy termination in dogs with novel non-hormonal compounds. Studies of 2-(3-ethoxy-phenyl)5,6-dihydro-s-triazole [5,1-a] isoquinoline (DL 204-IT)” Arzneimittelforschung. 32 (2): 123-7. Gilian, M. Simpson. 1998 Basava Manual of Small Animal Reproduction and Neonatology. Published by British Small Animal Veterinary Association, United Kingdom pp 121-124 Keister DM, Gutheil RF, Kaiser LD, D'Ver AS 1989 Efficacy of oral epostane administration to terminate pregnancy in mated laboratory bitches J. Reprod. Fertil. Suppl. 39:241-9. Onchn, K., L. D. M. Silva and J. P. Verstegen 1995 Termination of unwanted Pregnancy in dogs with the dopamine agonist, cabergoline, in combination with a synthetic analog of pcxzalpha, either cloprostenol or alphaprostol. Theriogenology 43:813-622. Reddy,R.C.K., Sadasiva Rao,K, Solomon Raju, K.G, K.B.Raghavender and A. Gopal Reddy 2010 Ind. J. Anim. Reprod. 31(2) 19-22 Renukaradhya, G.J, Krishnaswamy, A. and Honnappa,T.G (2008) Studies on the termination of pregnancy in bitches using natural prostaglandins. National Symposium on Recent trends and Future Strategies for improved Reproduction of Livestock, Companion and wild animals pp - 186 Wanke, M.M, S. Romagnoli, J. Verstegen and P. W. Concannon 2002 Pharmacological Approaches to Pregnancy Termination in Dogs and Cats Including the Use of Prostaglandins, Dopamine Agonists, and Dexamethasone International Veterinary Information Service (www.ivis.org), Ithaca, New York, USA

Issue 1 April 2012

REFERENCE

Dieleman, G. Voorhout, A.C. Okkens 2000 Termination of mid-gestation pregnancy in bitches with aglepristone, a progesterone receptor antagonist. Theriogenology, Volume 53, Issue 4 , Pages 941-950.

JIVA Vol. 10

dogs. Among these aglepristone is the best drug of choice. Due to adverse side effects diethyl stilbesterol and tamoxifen citrate are not preferred. During mid gestation from 28-30 days onwards synthetic prostaglandins, anti prolactins and antiprogesterone therapy are found to be effective. A combination of prostaglandin and antiprolactin (cabergoline) is found to be highly effective in terminating pregnancy. This treatment has the advantages of being free of side effects, it induces abortions by resorption, and it works as early as day 25. The embryo toxic agents such as phenyltriazole isoindole and isoquinoline compounds are drugs which can be tried for pregnancy termination but the toxic side effects limits its use in dogs.

GENERAL ARTICLE

HOW TO IMPROVE THE LIVESTOCK SECTOR IN KERALA: SOME NUTRITIONAL THOUGHTS Ajith K.S1., Anil Kumar, K2 and Dipu, M.T3. Livestock Research Station, Thiruvizhamkunnu.

Challenges and Opportunities Why the cattle population is decreasing in Kerala in spite of the increasing demand of milk is being debated in every animal husbandry seminars. There is a decline in total cattle population and the buffalo population shows a more rapid declining trend. The demand by consumers are not met by production within the state and the human population is increasing day by day. There is always a deficit of 25 percent in milk as far as requirement is considered. In Kerala, out of the total geographical area of 38.86 lakh hectare, 18 percent of the land area is barren land or uncultivated land area or cultivable waste area which can be utilized in one way or other for improving the livestock sector.

J. Ind. Vet. Assoc., Kerala. 10 (1)

One major problem faced by Kerala is the weak feed and fodder base. With the shift in cropping pattern of Kerala, the area under rice cultivation has come down by more than 50 percent over the last two decades leading to drastic reduction in the availability of straw for feeding cattle. It is estimated that the state produces only 60 per cent of the roughage requirement for cattle in Kerala.(economic review, Kerala 2010) As a result roughage in the form of straw is being brought in to the state from adjacent states at an exorbitant rate. Kerala has got a unique distinction among Indian states that, it is the only state which uses readymade concentrate as the major feed resource, 1. Asistant Professor, Livestock Research Station, Thiruvizhamkunnu. 2. Associate Professor & Head, Livestock Research Station, Thiruvizhamkunnu. 3. Assistant Professor, Department of Animal Nutrition, College of Veterinary & Animal Sciences , Mannuthy.

instead of depending on “homemade” feeds. Regarding the cattle feed concentrate, which will have to supplement the shortage in quality fodder production, the current level of production is not enough to satisfy the requirement. Now KCMMF, Kerala Feeds Ltd. and a few private players are taking conscious steps for facing this challenge. Dairy farmers in Kerala have tried to adjust with the situation by restricting the number of cattle and by preferring high yielding cross breds. This is evident from the steady increase in the proportion of crossbred animals, which Kerala achieved during the last three decades. What is the way out ? A joint effort by the researchers, policy makers and implementing agencies is the need of the hour. Some thoughts which may be valuable are narrated here. Development of “local” feeding standards Most of the feeding standards which are being used today are developed for conditions not directly related to feeding practices prevailed under Kerala conditions. Farmers in Kerala use a wide range of low quality and unconventional feeds. As the partitioning of nutrients are complex and are governed by a number of factors including the genotype of the animal, quantity and quality of feed and the environment, the possible solution is to give nutritional recommendation to the farmers under our managemental conditions and some efforts are being done by the Department of Animal Nutrition, KVASU.

GENERAL ARTICLE

Advantages of Total Mixed Ration Ø It is the best way to feed balanced ration to ruminants. Ø Less feed wastage. Ø Saves time and labor. Ø Easy for transportation and storage. Ø Crop residues can be effectively utilized Ø Reduces methane production. Ø Improved productive and reproductive efficiency. Use of Agricultural or Industrial byproducts or novel feeds During 2009-10, the price of cow milk has increased only by 6 percent in Kerala. On the input

Since there is emergence of more and more human food industries, their byproducts can form excellent substances to be included in cattle feed. Notable examples being brewery waste, pine apple waste, spent ginger, tea waste, flours of bread industry, etc. Much nutritional studies in this regard have to be conducted in future. Use of bypass technology Ruminants have advantage over nonruminants in that they can digest large amount of fiber and they can utilize non protein nitrogen. However there are also some constraints as the microbial nutrients may be insufficient for a higher producing animal and the concept of bypass protein, bypass fat and by pass starch comes in to picture. Steps have to be taken for educating the farmers for judicious use of the feed available to them.

Issue 1 April 2012

Considering the cost of production involved, farmers are very conscious of increasing the productivity of their animals. Considering the deficiency of fodder and the increasing price of feed ingredients, it is possible to go for precision feeding and one such method is total mixed ration. Total mixed ration is a concept of delivering nutrients to animals as a complete balanced ration. Total mixed ration consists of concentrate, roughage and micronutrients / feed additives. The concentrate and roughage are added in different levels, according to the stage of lactation and physiological stage of the animal. Roughage part is generally crop residue or hay. The concentrate portion includes oilcakes, molasses, grains or grain byproducts. Bypass proteins or bypass fat can also be added depending on the requirement of the animal. Micro nutrients, vitamins, trace minerals, binders, probiotics, antioxidants, antitoxins and herbal extracts are also included to promote proper body function. These ingredients are made into blocks using hydraulic press and as a result of densification process the concentrate matter get attached to the roughage along with molasses which facilitates the cellulolytic microbes to grow faster and enhance cellulolytic activity in rumen.(Walli,T.K. 2010)

side, the price of grass, gingelly oil cake, coconut oil cake and ground nut cake recorded an increase of 20 percent, 12 percent, 3 percent and 12.5 percent respectively during 2009-10. The increased cost of inputs is a serious threat affecting profitability of dairy farming. Since feed cost accounts to about 70 percent of the cost of the livestock farming, research should be focused on measures to reduce the cost of feeding. Researches on nutritional and possible inclusion of tapioca leaves, tapioca starch waste, rubber seed, coffee husk, neem seed, coconut pith, plantain rhizome, cashew apple waste, pepper waste, African payal, palm leaves, frog meal, prawn waste, jack fruit waste, cocoa pods, etc in cattle feed had been undertaken at the Department of Animal nutrition, Kerala Veterinary And Animal Sciences University. These results should be popularized among farmers and the farmers should be encouraged to produce of low cost feed using the locally available feed resources at their door steps. Agricultural by products and crop residues which are available in plenty can be effectively utilized either by physical treatment (chopping of straw or water soaking), chemical treatment (Urea treatment of straw) or by biological treatment (using fungi or treatment with exogenous fibrolytic enzymes).

JIVA Vol. 10

Precision Feeding and Total Mixed Ration (TMR) concept

GENERAL ARTICLE

How to increase the fodder base? Role of socially committed NGOs As stated elsewhere in this article, 18% of total geographic area in Kerala state lays underutilized. Self help groups and other unemployed youths can venture in to production of green grass, legume crops or tree fodders by adopting various silvi pastural systems and sell it to farmers as preserved form or fresh. The required technical know how should be provided to them. Many such endeavors have been started in many parts of Kerala. Thrust on tree fodder. Various tree species which can be used as tree fodders include Mullan kaini (Bridelia retusa), Murukku (Erythrina indica), Chamba (Eugenia jambosa), Kumbil (Gmelina arborea), Aval (Holoptelia integrifolia), Subabul (Leucaena leucocephala), Venga (Pterocarpus marsupium), Agathi (Sesbania grandiflora), Njaval (Syzygium cumini), Malayan chamba (Syzygium malaccense) etc. Various silvipastural and agro forestry techniques can be tried for increasing the fodder base as it will not only supply forage but also provide mulch, acting as a control to soil erosion and enhancing soil fertility. Forage Conservation

J. Ind. Vet. Assoc., Kerala. 10 (1)

Kerala is blessed with abundant rain fall. The forages which are produced in excess during rainy season should be preserved for use in the lean periods. Preservation can be done in the form of hay or silage and many self help groups can venture into such activities. Improvement of forage quality is also as important as forage conservation and many ways to improve the inferior crop residues are well established. Residual feed Consider a case where two animals which are equal in all aspects are receiving same feed but one animal is yielding more milk â&#x20AC;Ś the point here is the

feed efficiency and those animal which eat more is eating the residual feed. In other sense the feed eaten extra is a waste. So to reduce the wastage what are the solutions? Genetic selection of animals having more feed efficiency. Vigorous culling policy should be initiated in those animals used for progeny testing to eliminate the character from the population. Feed additives Probiotics, prebiotics, enzymes (exogenous enzymes like Cellulases, Xylanases, Hemicellulases, Pentosanases and amylases), organic acids and modifiers of rumen fermentation (ionophores) will help in improving the feed efficiency and reduce methane production. Intake strategies A nutritionally balanced ration is essential for an animal to perform at its optimum level. It is also necessary that animal should sufficiently consume the feed. Often the feed supplied may be imbalanced in minerals, vitamins and other nutrients. Supplementation poses two questions: what to supply? and how to supply? Multinutrient feed blocks is an answer to this as they will supply required nutrients in an easy way. Some points are narrated here which may invoke interest in the minds of the stake holders of animal husbandry activities and hopefully generate enthusiasm for the betterment of this noble profession in Kerala. REFERENCES 1. Kerala Economic review, 2010. Kerala State Planning Board, Thiruvananthapuram. 2. Walli,T.K. 2010, Densified complete feed block technology and its role in enhancing ruminant production, including buffaloes, Proceedings of international Buffalo Conference :294-300

GENERAL ARTICLE

EFFLUX PUMP INHIBITORS FOR ANTIBACTERIAL THERAPY

bacteria due to efflux systems.

For the past seventy years, antibiotics are the best weapons against bacteria which have turned bacterial infections from life-threatening situations into treatable conditions. But indiscriminate use of antibiotics again changed the scenario by leading to the emergence of multi-drug resistant bacteria. Though this is not a new problem, it is becoming more dangerous these days and can be best contemplated by news from Science daily (2011) stating that drug resistant bacterial infections cause more than 25,000 deaths and â&#x201A;Ź1.5 billion in extra healthcare costs every year in European Union alone. According to U.S. Center for Disease Control and Prevention (CDC, 2010), each year 90,000 people in the United States die because of drug-resistant bacteria indicating the necessity for the discovery of new antibacterials and resistance-modifying agents. But the pace of anti-infective research is dramatically slow and only one new class of antibacterials (oxazolidinones) has reached the market recently (Marquez, et. al., 2005). The rapid emergence of antibiotic resistant pathogens and slow arrival of new antibiotics threatens the present and future medical and veterinary science. So novel alternate therapeutic approaches must be looked upon to face this threat and one of such option is efflux pump inhibitors.

Efflux is the pumping of a solute out of a cell. Efflux pumps (EPs) are membrane-associated active transporters promoting the extrusion of toxic compounds including antibiotics. This decreases their intracellular concentration resulting in less susceptibility. Simultaneously this predisposes the emergence of higher level adaptive resistance mechanisms, as target mutations (Zechini and Versace, 2009). Mainly there are two types of EPs in bacteria. Those systems which confer resistance to a specific drug (specific drug resistance (SDR) transporters) or to class of drugs (MDR efflux pumps) (Marquez, 2005). Multi Drug Resistant (MDR) EPs can handle a wide variety of structurally unrelated compounds.

EFFLUX PUMPS Three main mechanisms are involved in antibiotic resistance which include modification of the drug target, enzymatic inactivation of the antibiotics and default of its accumulation within

The microbial drug efflux was first reported by Ball et al. (1980) and Mc Murry et al. (1980) for tetracycline in E. coli. The multidrug efflux systems have recently been identified as significant determinants of resistance by Poole (2002). Phylogenetically, bacterial antibiotic EPs belong to five super families that are classified in two distinct types as primary transporters (drug extrusion by ATP hydrolysis) and secondary transporters (by trans-membrane electrochemical gradients) (Stavri et al., 2007). MDR among Grampositive bacteria is mainly conferred by MFS (major facilitator super family) and that for Gramnegative bacteria is RND (resistance nodulation and cell division) family. EFFLUX PUMPS INHIBITORS (EPIs) The study of EPs in bacteria shows that its inhibitors can be used for-

JIVA Vol. 10

INTRODUCTION

Issue 1 April 2012

Sumithra T G, Chaturvedi V K, Susan Cherian, Binsila B Krishnan and Siju Susan Jacob Indian Veterinary Research Institute, Izatnagar, U.P

GENERAL ARTICLE

1. Reversal of acquired antibiotic resistance conferred by over expression of an EP. 2. Removal of intrinsic antibiotic resistance contributed by EPs 3. To reduce the frequency of emergence of resistant mutant strains. 4. For reduction of bacterial virulence in vivoRecent studies show that S. enterica Subsp. enterica serovar Typhimurium, E. coli, and C. jejuni overexpressing EPs are resistant to high concentrations of bile salts. In addition, over expression of EP in N. gonorrhoeae enhances the bacterial survival inside host (Piddock, 2006). Moreover, outer channel components of RND EPs are involved in seceretion of bacterial toxins. Thus EPIs can be used as new weapon against secretion of virulence factors and to reduce the bacterial survival in vivo.

5. By collapsing the energy of efflux- Carbonyl cyanide m-chlorophenylhydrazone (CCCP) and potassium cyanide are used in the laboratory to totally abolish the efflux of drugs (Pages et al., 2005). But it raises the question, whether it is their direct effect on EP activity or the alteration of cell envelope induces bacterial death. Although no molecule belonging to this category has been currently developed for clinical use or has been patented, phenothiazines may serve this need in future.

5. Provide a new method for screening new antibiotics.

6. By creating competitive or non-competitive inhibition to the affinity sites of EP (Mahamoud et al., 2007).

TARGETS - Inhibition of pump activity may be achieved by different ways.

CLASSIFICATION OF EPIs

1. Changing the chemical design of previous antibiotics to reduce its affinity for efflux. Tigecycline is a new antibiotic exhibiting reduced affinity for Tet pumps (Someya et al., 1995). 2. Repressing the expression of EP genes by altering its regulatory steps using antisense oligonucleotides or small interfering RNA. This patented strategy was used for the inhibition of AcrAB EP in E. coli (Van Bambeke et al., 2006). J. Ind. Vet. Assoc., Kerala. 10 (1)

4. Blocking the outermembrane channel with a plug- Use of nano-antibodies or a molecule exhibiting strong affinity for the channel area exposed at the cell-surface may achieve it (Zechini and Versace, 2009). Although this may yield an efficient EPI, it remains as an attractive hypothesis at this moment.

3. Inhibiting the functional assembly of the multicomponent pump- Globomycin can remove the lipoprotein signal sequence of exported membrane proteins. Mallea et al. (2002) reported that globomycin at selected concentrations restore chloramphenicol intracellular accumulation in MDR E. aerogenes which overproduces EP.

ANTIBIOTIC ANALOGUES

Chemical modification of substrates of EPs by incorporating structural motifs of inhibitors is an interesting approach for identifying new and potent EPIs. Nelson and Levy (1999) demonstrated the ability of 13-cyclopentylthio-tetracycline to inhibit TetB in E. coli. German et al. (2008) showed that a core of ofloxacin conjugated with bisaryl urea is a potent inhibitor of NorA and MepA in S. aureus. 2.

DRUGS OTHER THAN ANTIBIOTICS Drugs other than antibiotics having EPI activity are summarized in the Table No.1 3.

NATURAL SOURCES

Natural products that have been identified as EPIs are given in the Table 2. 4.

SYNTHETIC COMPOUNDS During this decade, various compounds have

GENERAL ARTICLE

b. Quinoline derivatives- Alkoxy- and thioalkoxy-quinolines increased the susceptibility of E. aerogenes MDR strains to chloramphenicol (Mahamoud et al., 2006). More studies are necessary to determine the therapeutic properties of these compounds. c. Arylpiperidines and arypiperazines Schumacher et al. (2006) demonstrated EPI acitivity of anthryl piperazines and naphthyl piperazines. However, due to â&#x20AC;&#x153;serotonin agonistâ&#x20AC;? properties of arylpiperazines, they are likely to be toxic in man and animals (Kern et al., 2006) Table 1. Drugs having EPI activity

e. Substituted polyamines- Gill et al. (1999) showed the EPI ability of N-benzylated polyazaalkanes, N-benzylated polyaminoalkanes in H. influenzae Other synthetic compounds having EPI activity are given in table 3. CONCLUSION Nargotra et al. (2009) pointed out the application of quantitative structure-activity relationship (QSAR) analysis to identify the pharmacophoric groups involved in the inhibition of EP. This can be applied for designing new EPIs. Currently, no EPIs has been licensed for therapeutic use in human or veterinary practice. But one program involving co-administration of an EPI (aerosolized formulation of a PA$Nderivative) with ciprofloxacin has reached phase II human clinical trials for the treatment of pulmonary exacerbations in cystic fibrosis due to MDR Gram-negative bacterial pathogens by Mpex Pharmaceuticals.

Drug

Bacteria

References

Reserpine

Bmr

B. subtilis

Neyfakh et al., 1991

tetK

MRSA

Gibbons and Udo, 2000

Verapamil

LmrA

L. lactis

VanVeen et al., 1996

11 pyrroloquinaxoline derivatives of Omeprazole

NorA

G+ve bacteria

Vidaillac et al., 2007

Phenothiazines

MFS

S. aureus

Anti-tubercular drugs

M. tuberculosis

Chan et al., 2007

BpeAB-OprB, AmrAB-OprA

B. pseudomallei

Chan et al., 2005

E. coli, P. aeruginosa, S. Typhimurium

Martins et al., 2008

G+ve and G-ve bacteria

Wei et al., 2004

RND P-SSRI

MFS and RND

Issue 1 April 2012

a. PA$N and their derivatives - Renau et al. (2003) showed that Phe-Arg-$-naphthylamine (PA$N) effectively inhibits the efflux mechanism of quinolones. The modification of this chemical series by Yoshida et al. (2006) through the addition of various hydrophilic chains has yielded pyridopyrimidine compounds. Among these an ammonium acetic acid analogue had potent efficacy, high solubility, and a good safety profile in acute toxicity assay in animal model of P. aeruginosa infection.

d. Amide derivatives- 5,9-dimethyl-deca-2,4,8trienoic acid amides and 9-formyl-5methyldeca-2,4,8- trienoic acid amides enhance the activity of ciprofloxacin by blocking EP in S. aureus.

JIVA Vol. 10

been designed to inhibit the activity of EPs which includes

GENERAL ARTICLE

Table 2. Drugs having EPI activity EPI

SOURCE

BACTERIA

REFERENCE

Pheophorbide A and 5'-MHC

Berberis plants

S. aureus

Stermitz et al., 2000

6-dimethyl-4-phenylpyridine-3,5-dicarboxylic acid diethyl ester

Jatropha elliptica

S. aureus

Marquez et al., 2005

Isopimarane derivatives

Lycopus europaeus

E. aerogenes

Gibbons et al., 2003

Epicatechin-gallate and epigallocatechin gallate

Green tea extracts

S. aureus

Roccaro et al., 2004

-{[(E)-5-(3,3-dimethyl-2oxiranyl)-3-methyl-2pentenyl]oxy}-7H-furo [3,2-g]chromen-7-one

Grapefruit

MRSA

Abulrob et al., 2004

Polyacylated neohesperidosides

G. caespitosum

S. aureus

Stermitz et al., 2003

Phenolic metabolites

Dalea versicolor

S. aureus

Belofsky et al., 2004

Piperine

Piperaceae

S. Aureus

Pages et al., 2003

Thanathin

Podisus maculiventris

S. Aureus

Khan et al., 2006

Fermentation products

Streptomyces MF-EA-371-NS1

P. aeruginosa

Lee et al., 2001

J. Ind. Vet. Assoc., Kerala. 10 (1)

Table. 3. Synthetic EPI Compounds

EPI

EP/ antibiotic

Bacteria

References

Iron-chelators (nocardamine)

TetB and TetK

S.aureus

Rothstein et al., 1993

Arylated benzothiophenes and tiophenes

NorA

S. aureus

Chabert et al., 2007

Indole derivatives (INF-55 and INF-271)

NorA

S. aureus

Ambrus et al., 2008

GG918, biricodar (VX-710) and timcodar (VX-853)

Fluoroquinolone

S.aureus, S. pneumoniae, E. faecalis

Mullin et al., 2004

GENERAL ARTICLE

Ambrus, J. I., Kelso, M. J., Bremner, J. B., Ball, A. R. Casadei, G. and Lewis, K. 2008. StructureActivity Relationships of 2-Aryl-1Hindole Inhibitors of the NorA Efflux Pump in S. aureus. Bioorg. Med. Chem. Lett., 18 (15): 4294-4297. Ball, P. R., S. W. Shales. and I. Chopra. 1980. Plasmid mediated tetracycline resistance in E. coli involves increased efflux of the antibiotic. Biochem. Biophys. Res. Commun. 93: 74-81. Belofsky, G., Percivill, D. and Lewis, K. 2004. Phenolic metabolites of Dalea versicolor that enhance antibiotic activity against model pathogenic bacteria. J. Nat. Prod., 67: 48. Centers for Disease Control (CDC) 2010. Food borne Diseases Active Surveillance Network (FoodNet), United States. Chabert, F. D., Marquez, B., Neville, L., Joucla, L., Broussous, S., Bouhours, P., David, E., PelletRostaing, S., Marquet, B, Moreau, N. and Lemaire, M. 2007. Synthesis and evaluation of new aryl benzothiophene and diarylthiophene derivatives as inhibitors of the NorA multidrug transporter of S. aureus. Bioorg. Med. Chem.,15 (13):4482-97 Chan, Y.Y., Ong, Y.M. and Chua, K.L. 2007. Synergistic interaction between phenothiazines and antimicrobial agents against B. pseudomallei. Antimicrob. Agents Chemother., 51: 623-630. Chan, Y. Y., and K. L. Chua. 2005. The B. pseudomallei BpeAB-OprB efflux pump: expression and impact on quorum sensing and virulence. J. Bacteriol. 187:4707-4719

Gibbons, S., Oluwatuyi, M., Veitch, N.C. and Gray, A.I. 2003. Bacterial resistance modifying agents from Lycopus europaeus. Phytochemistry, 62: 83-87. Gibbons, S and Udo, E.E. 2000. The effect of reserpine, a modulator of multidrug efflux pumps, on the in vitro activity of tetracycline against clinical isolates of methicillin resistant S. aureus (MRSA) possessing the tet(K) determinant. Phytother Res.,14: 139-140. Gill, M.J., Brenwald, N.P. and Wise, R. 1999. Identification of an efflux pump gene, pmrA, associated with fluoroquinolones resistance in S. pneumoniae. Antimicrob. Agents Chemother., 43: 187-189. Kern, W.V., Steinke, P., Schumacher, A., Schuster, S., von Baum, H. and Bohnert, J.A. 2006. Effect of 1-(1-naphtylmethyl)-piperazine, a novel putative efflux pumps inhibitor, on antimicrobial drug susceptibility in clinical isolates of E. coli. J. Antimicrob. Chem., 57: 339-343. Khan, I.A., Mirza, Z.H. and Kumar, A. 2006. Piperine, a phytochemical potentiator of ciprofloxacin against S. aureus. Antimicrob. Agents Chemother., 50: 10-12. Lee, M.D., Galazzo, J.L. and Staley, A.L . 2001. Microbial fermentation-derived inhibitors of efflux-pump-mediated drug resistance. Farmaco., 56: 815. Mahamoud, A., Chevalier, J., Alibert-Franco, S., Kern, W.V. and PagĂ¨s, J.M. 2007. Antibiotic efflux pumps in Gram-negative bacteria: the inhibitor response strategy. J. Antimicrob. Chemother., 59: 1223-1229. Mahamoud, A., Chevalier, J., Davin-Regli, A.,

Issue 1 April 2012

Abulrob, A.N., Suller, M.T. E., Gumbleton, Simons, M.C., Russell, A.D. 2004. Identification and biological evaluation of grapefruit oil components as potential novel efflux pump modulators in methicillin-resistant S. aureus bacterial strains. Phytochemistry, 65:3021-7

German, N., Wei, P., Kaatz, G.W. and Kerns, R.J. 2008. Synthesis and evaluation of fluoroquinolones derivatives as substratebased inhibitors of bacterial efflux pumps. Eur. J. Med. Chem.

JIVA Vol. 10

REFERENCES

GENERAL ARTICLE

Barbe, J. and Pages, J.M. 2006. Quinoline derivatives as promising inhibitors of antibiotic efflux pump in multidrug resistant Enterobacter aerogenes isolates. Current Drug Targets, 7 (7): 843-847. Malléa, M., Chevalier, J., Eyraud, A. and Pagès, J.M. 2002. Inhibitors of antibiotic efflux pumpin resistant Enterobacter aerogenes strains. Biochem. Biophys. Res. Comm., 293: 13701373. Marquez, B., Neuville, L., Moreau, N.J., Genet, J.P., dos Santos, A.F., Caño de Andrade, M.C. and Sant'Ana, A.E. 2005. Multidrug resistance reversal agent from Jatropha elliptica. Phytochemistry, 66(15):1804-11. Martins, M., Dastidar, S. G. and Fanning, S. 2008. Potential role of non-antibiotics (helper compounds) in treatment of multidrugresistant gram-negative infections: mechanisms for their direct and indirect activities. Int. J. Antimicrob. Agents., 31: 198208. Mc Murry, L., R. E. Petrucci, Jr., and S. B. Levy. 1980. Active efflux of tetracycline encoded by four genetically different tetracycline resistance determinants in Escherichia coli. Proc. Natl. Acad. Sci. U.S.A. 77: 3974-3977.

J. Ind. Vet. Assoc., Kerala. 10 (1)

Mullin,S., Mani, N. and Grossman, T. H. 2004. Inhibition of Antibiotic Efflux in Bacteria by the Novel Multidrug Resistance Inhibitors Biricodar (VX-710) and Timcodar (VX-853). Antimicrob. Agents Chemother., 48(11): 41714176 Nargotra, A., Sharma, S., Koul, J.L., Sangwan, P.L., Khan, I.A., Kumar, A., Taneja, S.C. and Koul, S. 2009. Quantitative structure activity relationships (QSAR) of piperine analogs for bacterial NorA efflux pump inhibitors. Eur. J. Med. Chem., 44(10): 4128-35 Nelson, M.L. and Levy, S.B. 1999. Reversal of tetracycline resistance mediated by different bacterial tetracycline resistance determinants

by an inhibitor of the Tet(B) antiport protein. Antimicrob. Agents Chemother., 43: 17191724. Neyfakh, A.A., Bidnenko, V.E. and Bo Chen, L. 1991. Efflux-mediated multidrug resistance in Bacillus subtilis: similarities and dissimilarities with the mammalian system. Proc. Natl. Acad. Sci. USA., 88: 4781-4785 Pagès, J.M., Dimarcq, J.L., Quenin, S. and Hetru, C. 2003. Thanatin activity on multidrug resistant clinical isolates of Enterobacter aerogenes and Klebsiella pneumonia. Int. J. Antimicrob. Agents., 22: 265-269. Pages, J. M., Muriel Masi. and Jacques Barbe. 2005. Inhibitors of efflux pumps Gram-negative bacteria.Trends in Molecular Medicine,11(8): 382-389. Piddock, L.V. 2006. Clinically relevant chromosomally encoded multi drug resistance efflux pumps in bacteria. Clin. Microbiol. Rev.,19: 382-402. Poole, K. 2002. Mechanisms of bacterial biocide and antibiotic resistance. J. Appl.Microbiol., 92(suppl 1): 55-64 Renau, T.E., Léger, R., Filonova, L., Flamme, E.M., Wang, M., Yen, R., Madsen, D., Griffith, D., Chamberland, S., Dudley, M.N., Lee, V.J., Lomovskaya, O., Watkins, W.J., Ohta, T., Nakayama, K. and Ishida, Y. 2003. Conformationally-restricted analogues of efflux pump inhibitors that potentiate the activity of levofloxacin in Pseudomonas aeruginosa. Bioorg. Med. Chem. Lett., 13: 2755-2758. Roccaro, S.A., Blanco, A.R., Giuliano, F., Rusciano, D. and Enea, V. 2004. Epigallocaechingallate enhances the activity of tetracyclines in staphylococci by inhibiting its efflux from bacterial cells. Antimicrob. Agents Chemother., 48: 1968-1973. Rothstein, D.M., McGlynn, M. and Bernan, V.

GENERAL ARTICLE

Schumacher,A., Steinke, P. and Bohnert, J.A. 2006. Effect of 1-(1-naphthylmethyl)-piperazine, a novel putative efflux pump inhibitor, on antimicrobial drug susceptibility in clinical isolates of Enterobacteriaceae other than E. coli. J. Antimicrob. Chemother., 57:344- 348 Someya, Y., Yamaguchi,A. and Sawai, T. 1995. A novel glycylcycline, 9-(N,N-dimethylglycylamido)-6-demethyl-6-deoxytetracycline, is neither transported nor recognized by the transposon Tn10-encoded metaltetracycline/H antiporter. Antimicrob. Agents Chemother., 39: 247-249. Stavri, M., Piddock, L.J.V. and Gibbons, S. 2007. Bacterial efflux pump inhibitors from natural sources. J. Antimicro. Chemother., 59: 12471260. Stermitz, F.R., Cashman, K.K. and Halligan, K.M. 2003. Polyacylated neohesperidosides from Geranium caespitosum: bacterial multidrug resistance pump inhibitors. Bioorg. Med. Chem. Lett., 13: 19-25. Stermitz, F.R., Lorenz, P., Tawara, J.N.,. Zenewicz, L.A. and Lewis, K. 2000. Synergy in a medicinal plant: antimicrobial action of berberine potentiated by 5'methoxyhydnocarpin, a multi drug pump inhibitor. Proc. Natl. Acad. Sci. USA., 97: 1433-1437.

VanVeen, H.W., Venema, K., Bolhuis, H., Oussenko, I., Kok, J. and Poolman, B. 1996. Multi drug resistance mediated by a bacterial homolog of the human multidrug transporter MDR1. Proc. Natl. Acad. Sci. USA., 93: 10668-10672. Vidaillac, C., Guillon, J. and Arpin, C. 2007. Synthesis of omeprazole analogues and evaluation of these as potential inhibitors of m u l t i d r u g e ff l u x p u m p N o r A o f Staphylococcus aureus. Antimicrob. Agents Chemother., 51: 831-838. Wei, P., Kaatz, G.W. and Kerns, R.J. 2004. Structural differences between paroxetine and femoxetine responsible for differential inhibition of Staphylococcus aureus efflux pumps, Bioorg. Med. Chem. Lett., 14: 30933097. Yoshida, K., Nakayama, K., Yokomizo, Y., Ohtsuka, M., Takemura, M., Hoshino, K., Kanda, H., Namba, K., Nitanai, H., Zhang, J.Z., Lee, V.J. and Watkins, W.J. 2006. MexAB-OprM specific efflux pump inhibitors in Pseudomonas aeruginosa, part 6: exploration of aromatic substituents. Bioorg. Med. Chem., 14: 8506-8518. Zechini, B and Versace, I. 2009. Inhibitors of multidrug resistant efflux systems in bacteria. Recent Pat. Anti infect. Drug Discov., 4 (1):37-50.

Issue 1 April 2012

Science Daily. New Antibiotics Against Resistant Bacterial Infections Discovered. Science Daily (April 8, 2011).

Van Bambeke, F., PagĂ¨s, J.M. and Lee, V.J. 2006. Inhibitors of bacterial ef?ux pumps as adjuvants in antibiotic treatments and diagnostic tools for detection of resistance by efflux, Recent Patents Anti-Infect Drug Disc., 1: 157-175.

JIVA Vol. 10

1993. Detection of tetracyclines and efflux pump inhibitors. Antimicrob. Agents Chemother., 37: 1624-1629.

ASSOCIATION NEWS

VETERINARIANS ANNUAL CONVENTION 2011 HELD AT KANNUR

J. Ind. Vet. Assoc., Kerala. 10 (1)

"Utharayanam-2011,the Veterinarian's Annual Convention was inaugurated byHonourable MLA Sri. Abdullakutty, on 30-12-2011 at Kannur. The inaugural ceremony was presided by Dr. K.R. Arunkumar, President, IVA, Kerala. The gathering was welcomed by Dr. C. Sreekumar, President, KVSSA. Sri. Abdullakutty MLA, in his inaugurall addressed the need for a different view with regard to development in Kerala. He called for the development for mini

Dr.E.K.Easwaran, General secretary, IVA, Kerala expressed vote of thanks. The kalasandhya was inaugurated by reknowned poet Prof. V.Madhusoodanan Nair. He had a very warm interaction with the audience and gave a very passionate and thought provoking speech on the need for love and affection for all living beings. He introduced the kids into the art of writing poems. The meeting was welcomed by Dr. Kurien K Jacob, Secretary, AHOAK. Meeting was presided by Dr. EK.Easwaran, General Secretary, IVA, Kerala. Dr. S.Yohannan felicitated the meeting. Vote of thanks was offered by Dr. Sisy Philip , Vice President, IVA, Kerala. The inaugural ceremony was followed by a colorful, melodious and beautiful cultural programme by Vets and their family members. The gathering was welcomed by Dr.Abdul Salim, DAHO of Kannur. The seminar was inaugurated by Honorable Minister fir AH, Sri. K.P.Mohanan. The meeting was presided by Dr. K.R. Arunkumar, President, IVA, Kerala. He sought the intervention of the Hon. Minister in some pressing issues before our community like Pay revision, reduction of the loan lending rates of Banks to farmers, purchase of quality medicines etc. The Hon. Minister in his inaugural addresss appreciated whole heartedly IVA's decision to help the bereaved families of dairy farmers who have committed suicide in Palakkad and pathanamthitta. IVA will raise funds from Vets and give good quality Milch animals and feed for a year free of cost to the affected families. The minister also

dairy farms and requested that more emphasis should be given to development of meat breeds for Kerala. He released the third issue of JIVA. Director of Animal Husbandry Department Dr. R. Vijayakumar, Director and Registrar of KSVC, Dr. N.N.Sasi, Dr. Udayavarman, Director of Zoos and Museums,Dr. Sukumara Pillai, President, AHOAK and Dr. Mohandas spoke on the Occasion.

stressed the need for improvement of physical assets of our institutions and farms. He also clarified that the One man commission will start functioning at the earliest and the just demands of officers working in AHD, shall be looked into by the government in a positive way. He stressed the need for doing away with beaurocratic hurdles for implementation of a decision. He called upon vets to work hard for the farming community and stay away from controversies. He released the AHD calendar prepared by LMTC, Kannur and the Souvenir of Utharayanam 2011. Seminar was handled by Prof. Dr. A.P.Nambi, Ph.D., Professor and Head, Dept. of Clinical Medicine, Madras veterinary College. The function was presided by Dr. K.R. Arunkumar.The meting was inaugurated by Hon. District Panchayat president, Prof.K.A. Sarala. She wished peace, prosperity and relaxation for all Vets and their family members. Later she released the IVA Diary for 2012 and also gave away awards and recognitions of IVA, KVSSA and AHOAK. Dr. Unnikrishnan, General convenor, Utharayanam 2011 offered Vote of Thanks.

IVA AWARDS 2011

Best Veterinarian :

Dr. Laiju. M. Philip (Palakkad)

ASSOCIATION NEWS

INDIAN VETERINARY ASSOCIATION, KERALA STATE OFFICE BEARERS - 2012

Vice President (North Zone) Dr Mohammed Haneefa PH : 0466-2263217, 9447632370 E-mail : anivet84@gmail.com

Vice. President (Lady) Dr R Saira

PH : 94475 86773, 0471-2486777 Email : ceeyeskay_1618@yahoo.co.in

Vice. President (South Zone) Dr Kurian K Jacob Ph : 94471 05222

Joint Secretary (South Zone) Dr. S. Saiprasad

Ph : 94953 91367

Phone : 9447441627 E-mail :drsai33@gmail.com

Joint Secretary (North Zone) Dr V Prasanth

Joint Secretary (Lady) :

Ph : 94472 63687

Treasurer Dr L Rajesh Ph : 94461 70888 E-mail : rajeshvety@yahoo.com

Dr. R. Usha Ph : 0481-2515050 9446396881

Building Committee Member Dr S Yohannan Ph : 94476 56166

Issue 1 April 2012

PH : 9846075281, 9446572255 Email : drarun1965@yahoo.com

General Secretary Dr C Sreekumar

JIVA Vol. 10

President Dr K R Arunkumar

ASSOCIATION NEWS

INSTALLATION OF IVA STATE OFFICE BEARERS - 2012 Installation ceremony of state office bearers of IVA for the year 2012 was conducted on14/01/2012 at Veterinarianâ&#x20AC;&#x2122;s building, Thiruvananthapuram. Dr P Bahuleyan administered the oath to the IVA State President, Dr K R Arunkumar. The other office bearers also took charge of their respective positions on the day.

J. Ind. Vet. Assoc., Kerala. 10 (1)

STATE LEVEL PROGRAMME FOR DISTRIBUTION OF RELIEF TO BEREAVED FAMILIES OF DAIRY FARMERS WHO COMMITTED SUICIDE IN PALAKKAD DISTRICT

Families of Sri. Chandran of Peruvambu and Sri. Ramakrishnan kottekkad of Marutha Road were given the assistance. Indian Veterinary Association, Kerala took a landmark decision to provide help to these dairy farmers. The decision was taken in the state convention of Indian Veterinary Association, Kerala held at Kannur chaired by Dr. K.R. Arunkumar, State IVA president. The function started with a welcome speech by Dr. S. Selva Murugan, President, IVA Palakkad. Dr. K.R. Arunkumar, State IVA president did the presidential address. The inauguration of the glittering ceremony and A commendable ceremony was organized by the distribution of the IVA RELIEF PACKAGE was done Indian Veterinary Association, Kerala to mark the by Sri. V.S. Achyuthanandan, Honorable leader of distribution of relief to bereaved families of dairy opposition, Kerala legislative assembly. Sri. K. Achuthan, farmers who committed suicide in Palakkad district at M.L.A was the chief guest on the occasion. Sri. M. Siva Malampuzha Block Panchayat Hall, Palakkad on Kumar, President, Marutha Road Grama Panchayat, Sri. P. Babu, President, Peruvambu Grama Panchayat, Sri. T. 03/02/2012. The families of two dairy farmers who have Radhakrishnan, President, Malampuzha Block committed suicide due to debt were given the IVA Panchayat, Dr. M. Sumangala, District Animal RELIEF PACKAGE which included the distribution Husbandry Officer were among the galaxy of dignitaries of two elite cows free of cost; free cattle feed for 10 and officials who were present on the occasion. The months, free 3 year insurance coverage and free programme came to an end with the vote of thanks by Dr. B. Biju, President KVSSA Palakkad. veterinary assistance for the period.

ASSOCIATION NEWS

MOVE TO REGULARISE CONTRACT POSTINGS BY KVASU DRAWS WIDE PROTEST

Now KVASU statute has come out with a draft proposing to regularize the appointments of academic consultants and to post them as assistant professors. This is a serious violation of the agreement and is against the interest of many eligible qualified professionals. The decision of KVASU to move ahead with the statute is totally disregarding the basic qualification and standards set for appointment of faculty in any University. Convention of post graduate veterinarians was convened by IVA at Thrissur on 10/03/2012. More than 60 members attended the meeting and a

A workshop on KVASU Draft Statute was held on 13/03/2012 at COVAS, Mannuthy under the auspices of IVA. More than 50 members from Mannuthy, Pookot and other units attended the workshop. The workshop went through the draft statute page by page and made necessary amendments and submitted the recommendations to the Registrar, KVASU. A positive decision from the registrar is expected in these recommendations.

Issue 1 April 2012

It was in 2011 that KVASU invited application to post academic consultants. It was said that the posting of academic consultants will be purely on contract basis for a period of 3 years or till a permanent hand is posted. A Masters degree in the concerned subject was the only qualification required for the appointment.

memorandum to immediately stop the beaurocratic conspiracy to â&#x20AC;&#x153;The decision to appoint faculty through back door, flouting UGC norms will be viewed as a direct infringement on the rights of qualified professionals eligible for appointment as assistant professors.â&#x20AC;? In a related movement IVA has also demanded that a wholetime vice-chancellor be posted for KVASU observing existing norms. IVA demands that the vicechancellor should be a whole-time officer of the University and should be appointed from amongst the distinguished veterinarians in the state. regularize the appointment of academic consultants was represented to the Registrar, KVASU and to Dr K Jayakumar, acting ViceChancellor of KVASU. The convention decided to seek all possible legal and political means to stop the move by KVASU.

JIVA Vol. 10

The move of KVASU statute to regularize the temporary appointment of academic consultants made last year is drawing wide protest. IVA views that the decision to appoint faculty through back door flouting the UGC norms is a direct infringement on the rights of qualified professionals eligible for appointment as assistant professors.

ASSOCIATION NEWS

SIGN POST & ACHIEVEMENTS Dr. K. Vijayakumar, Associate Professor, Department of Veterinary Epidemiology and Preventive Medicine, College of Veterinary and Animal Sciences, Mannuthy has been appointed as Joint Commissioner, Livestock Health, Department of Animal Husbandry, Dairying and Fisheries, Ministry of Agriculture, Government of India. He holds his office in Krishi Bhawan, New Delhi. He was the state executive member of Indian Veterinary Association, Kerala. He was also the chief editor of Journal of Indian Veterinary Association, Kerala. IVA, Kerala wishes all success in his new venture.

Dr. K Rajankutty is a native of Kulathupuzha, Kollam District. He is 1978 batch graduate from CoVAS, Mannuthy. He was the Prof and Head, Univesity Veterinary Hospital, Kokkalai during 2009 August. In 2011 he became the Professor and Head, Department of Veterinary Surgery and Radiology, CoVAS, Mannuthy. He has 65 scientific publications in his credit. He has guided 1 PhD and 12 MVSc students. He is currently the Professor and Head, Department of Veterinary Surgery and Radiology, CoVAS, Pookode. Dr. T. Prakash, Assistant director (P), Regional Poultry Farm, Malampuzha received BEST FARM OFFICER AWARD instituted Government of Kerala. He is presently working as Assistant Rinderpest Officer, Regional Disease Diagnostic Laboratory, Palakkad. Dr. T. Prakash was the recipient of best veterinarian award for 2006 instituted by Indian Veterinary Association, Kerala. Dr. S. Sharmila, Veterinary Surgeon, Veterinary Dispensary, Akathethara received BEST VETERINARY SURGEON AWARD instituted Government of Kerala. Dr. S. Sharmila was the recipient of best veterinarian award for 2010 instituted by Indian Veterinary Association, Kerala

J. Ind. Vet. Assoc., Kerala. 10 (1)

Dr Ajith Kumar K G, Assistant Professor, Department of Veterinary Parasitology, College of Veterinary and Animal Sciences, Pookode, bagged the Best Poster award for his poster entitled ”Survey of myiasis in wild animals of Kerala” in the XXII National Congress of Indian Association for the Advancement of Veterinary Parasitology and National Symposium on Integrated Research Approach in Veterinary Parasitolgy: From Basic to Molecular Techniques held on 15-17 March, 2012 at Department of Parasitology, College of Veterinary Science & A.H., DUVASU, Mathura, Uttar Pradesh

Dr.AneesCherukunnath: Won the Young Scientist Awards during the 24th Kerala Science Congress held at RRII, Kottayam in the category of Fishery and Veterinary Science. The award comprises of cash prize of Rs.25000/- and One lakh Research Grant and Certificate of Merit. Dr. Anees's paper was on “Caprine foetus-A novel source of stem cells for research and therapeutics in Veterinary Science”. He is currently working as Academic Consultant in the Department of Veterinary Physiology, COVAS, Pookode. He is 2005 batch graduate from CoVAS, Mannuthy. Dr.Nandakumar. S, Veterinary Surgeon and Officer in charge of All India Coordinated Research Project on FMD, Chief Disease Investigation Office, Palode participated in the FAO-ICAR International Conference on Scientific Developments and Technical challenges in the Progressive Control of Foot & Mouth Disease in South Asia during 13th to 15 February 2012 at New Delhi.