Expression of epitope vaccine ctb ua against helicobacter pylori in transgenic tomato

Biotechnology Frontier June 2013, Volume 2, Issue 2, PP.12-19

Expression of Epitope Vaccine CTB-UA against Helicobacter Pylori in Transgenic Tomato Xiaokang Li1, Xinyang Li1, Xuanquan Wang1, Le Guo 2, Yingying Xing1,Tao Xi1# 1. School of Life Science and Technology, China Pharmaceutical University, 24 Tongjiaxiang, Nanjing 210009, China 2. School of Laboratory Medicine, Ningxia Medical University, Yinchuan, 750004, China #

Email: xiaokangli_cpu@126.com

Abstract Helicobacter pylori is a key reason for Stomach diseases, and how to eradicate Helicobacter pylori has been studied for several decades. Oral vaccines produced by transgenic plants would change the traditional means of production and inoculation of Helicobacter pylori vaccines and reduce the vaccination cost significantly. In this research for the first time we used the transgenic tomato system to express Helicobacter pylori epitope vaccine CTB-UA, a recombinant peptide which could protect BALB/c mice from Helicobacter pylori infection after oral immunization by increasing the specific antibodies. CTB-UA was transformed into tomato mediated by Agrobacterium tumifient EHA105, and transgenic shoots have been verified by PCR analysis, RT-PCR and Enzyme-linked immunosorbent assay (ELISA) analysis showed that CTB-UA gene could transcript and produce the target peptide in the roots, fruits and leaves from the three transgenic tomato lines. Transgenic tomato derived oral vaccine strategy could be potentially used as an alternative strategy to fight for the H. pylori infection, especially for the people in developing worlds.

Keyswords: Helicobacter Pylori; CTB-UA; Transgenic Tomato; Plant Vaccine

1 INTRODUCTION Helicobacter pylori (H. pylori), a slow-growing microaerophilic bacterium, chronically infects gastric epithelial cell surfaces and the overlying mucin layer mediated by adhesins[1-2]. H. pylori is considered to be a pivotal factor in the development of human gastrointestinal tract diseases (e.g. chronic active gastritis, gastric and duodenal ulcers, gastric adenocarcinoma[3] and gastric mucosa-associated lymphoid tissue lymphoma[4]). Since spread from person to person through fecal-oral or oral-oral routes easily, persist for life on the stomach mucosal surface, and has a high rate of recurrence unless treatment is taken, H. pylori infects more than 50% of the world’s population[5-6]. In developing world the infection rate is more immense that can reach to 90% or more[7], and the infection presents a nosogeographic or household trends.

Traditional treatments of H. pylori are antibiotics-based triple or quadruple therapies and other multidrug cocktails.

Many studies on the efficacy of antibiotic therapy have reported poor results and eradication rates of standard triple therapy had fallen from originally >90% to 70%-80% in some areas[8]. Researchers found that immunifaction with H. pylori vaccine could not only prevent infection or reduce its intensity in a prophylactic setting, but also could act therapeutically to reduce the colonization levels in H. pylori infection. To date, various antigenic proteins or peptides identified from H. pylori and their modified products have been used in animal models, including Urease, VacA, CagA, FlaA, FlaB, catalase, lipoprotein, NAP, adhesion[9-10], etc. Thereafter, a few of these vaccines have been preformed on human beings[11]. Though vaccination has been considered to be an efficient and effective means to combat H. pylori and most of the information available for vaccine candidates can be obtained now. High price of vaccination makes it unaffordable for most people, especially in developing countries, because daily average income of nearly one billion people is less than us$1. In addition, the process of developing and manufacturing vaccines is #

CITATION-Xiaokang Li, Xinyang Li, Xuanquan Wang, et al. Expression of Epitope Vaccine CTB-UA against Helicobacter Pylori in Transgenic Tomato [J]. Ivy Publisher: Biotechnology Frontier, June 2013, Volume 2, Issue 2, PP.12-19 - 12 http://www.ivypub.org/bf

complex, expensive, and lengthy. Research and development could take more than five years to manufacture a single kind of vaccine. Moreover, the cost of vaccines is projected to rise substantially over the next several years due in large part to the development of important, but more expensive vaccines. In the past decade, the cost of vaccines has increased 14 folds[12].Therefore it is necessary to find alternate methods to increase the vaccine products and reduce the costs.

Vaccine expressing in transgenic plants is an optional method which has been aroused a great of interests by biology researchers for its low cost, eliminating risks of product contamination and especially it can be administered as unprocessed or partially processed materials. Since the first oral plant vaccine have been studied, more than 100 recombinant proteins have been successfully expressed in different kinds of plant and several had proven to be immunogenic in animal or humans studies. Plant derived vaccines are more stable within cytoderms which protect the interest proteins from being hydrolyzed by digestive proteases. When the cytoderms are destroyed in the intestines, vaccines expressed in the transgenic foods can be released and taken up by absorptive epithelial cells or M cells, then be shuttled to, or directly captured by antigen-presenting cells, to activate the innate and adaptive mucosal immune system[13-14]. Using tomato as a model system for vaccine expression is a preferable strategy due to the edibility of the tomato fruit [15-17].A plant-made candidate subunit vaccine against plague (Yersinia pestis) was successfully expressed in transgenic tomato [18]. Tomato was transformed with A hepatitis B surface antigen (HBaAg) gene using Agrobcterium tumefaciens strain LBA4404 to express HBaAg antigen, and the production of HBaAg antigen in transgenic tomato was confirmed by western blot and ELISA[19].

In previous study, an epitope vaccine CTB-UA of urease an epitope and cholera toxin B subunit was constructed by our laboratory. The results of the immunological features and ability of inhibitory effects on enzymatic activity of the epitope vaccine CTB-UA demonstrated that CTB-UA has good immunogenicity and immunoreactivity, and could induce specific neutralizing antibodies against Ure[20]. Moreover, we evaluated the prophylactic and therapeutic effects of recombinant fusion peptide of urease an epitope and cholera toxin B subunit (CTB-UA) against H. pylori infection in BALB/c mice, which demonstrated that CTB-UA could protect BALB/c mice from H. pylori infection after oral immunization by improving humoral and cellular immune responses [21]. So the CTB-UA vaccine is worth investigating as a novel, promising approach in the development of an oral plant derived vaccine against H. pylori. In this research we used the transgenic tomato system to express CTB-UA gene in order to find a feasible strategy to combat H. pylori infection just by alimentotherapy.

2 MATERIALS AND METHODS 2.1 Plant materials.

Tomato (Solanum lycopersicum, L. esculentum) cultivar huifeng (F1 Stokes Seeds, purchased from Guangzhou vegetable research institute, Guangdong, China.) was used for transformation. Before surface sterilization, health and full developed seeds were selected and soaked at room temperature for 1 hour，and 75% ethanol for 5 min, followed by four rinses in sterile distilled water. Then treated with 20% (v:v) sodium hypochlorite solution (1% active chlorine content) for 10 min and washed five times with sterile water. Subsequently the seeds germinated on half strength Murashige and Skoog basal medium (MS) containing 0.2% phytagel at 24℃. 10 days later the young shots reached to 7cm or more, then fully expanded cotyledons and hypocotyls were used for transformation.

2.2 A. tumefaciens Strains.

A. tumefaciens EHA105 stock was given by Wuhan University and preserved in -80℃ freezer. When used, streak the strains on LB media plates (50 mg/l Rif), and incubate in 28℃ constant temperature incubator for two days.

Single clone was picked for the following research.

2.3 Tissue culture medium for tomato regeneration.

MS medium containing 30 g/l sucrose and 2 g/l phytagel formed the basis of the following different media for in vitro culture of tomato Huifeng. Co-cultivating medium (CCM) containing 100 mM acetosyringone and 100mg/L kanamycin was used to transform tomato explants. Callus inducing medium (CIM), shoot inducing medium (SIM), - 13 http://www.ivypub.org/bf

shoot growth medium (SGM) containing MS plus various combinations of phytohormones and 500mg\L carbenicillin are for the regeneration of the transgenic shoots (Table.1).

Root induction medium (RIM) contained half strength MS plus NAA. TABLE.1 COMBINATIONS OF PHYTOHORMONES USED IN DIFFERENT MEDIUM USED FOR REGENERATION OF THE TRANSGENIC Phytohormone

CIM

SIM

SGM

RIM

NAA

0.20

0.10

-

0.10

ZT

2.00

1.00

0.05

-

ZT (zeatin) was used as cytokinins respectively combined with NAA (1-naphthlcetic acid). ZT was dissolved in the steriled ddH2O in concentration of 1 mg/ml. 6-BA, and NAA was dissolved in DMHO in concentration of 10 mg/ml respectively.

2.4 Construction of plant expression vector pBI121-CTB-UA. A Bam HI-Sac I fragment containing the complete CTB-UA gene was amplified by PCR amplification using CTBUA1 and CTB-UA2 as primer (sequences are listed in Table 2). Plasmids pBI121 and PCR products of CTB-UA were purified by AxyTM PCR Cleanup Kit and digested with Bam HI/Sac I restriction enzyme. Open reading frame (ORF) of CTB-UA was cloned into the sense orientation into the Bam HI/Sac I sites of binary plasmid pBI121, between the cauliflower mosaic virus (CaMV) 35S promoter and opaline synthase (NOS) terminator(fig.1).

Neomycin phosphotransferase II (NPT II) gene was used for selection the positive clones. Plasmid was sequenced in the by pBI121-CTB-UA. The constructed pBI121-CTB-UA, when mobilized into A. tumefaciens EHA105 through freeze-thaw transformation methods, resulted in several kanamycin and rifampicin resistant EHA105 conjugants.

TABLE.2 PRIMERS USED FOR CONSTRUCTION PLANT BINARY VECTOR AND PCR OR RT-PCR VERIFICATION OF THE TRANSGENIC PLANTS

Primer

Sequence

CTB-UA1

AGAGGATCCATGGGCACACCTCAAA

CTB-UA2

CGAGCTCTTATTAATCCACCAGCGCGA

18S1

CTCATTAAATCAGTTATAGTTTGTTTGATG

18S2

TATCCTACCATCGAAAGTTGATAGGGCAGA

The underlined site of the sequence is restrictive endonuclease sites which were used to insert the amplified CTBUA sequence into the plant binary vector pBI121.

A BamHⅠ SphⅠ PstⅠ

XbaⅠ BamHⅠ SmaⅠ

CaMV 35S-Pro 835bp

SacⅠ

CTB-UA 405bp

Eco RⅠ

NOS-ter 253bp

FIG1. RECONSTRUCTION ANALYSIS OF THE PLANT BINARY VECTOR PBI121-CTB-UA. RESTRICTION MAP OF PBI121-CTB-UA CONTAINS THE SEGMENT OF CTB-UA (405 BP), THE 835BP HINDIII ECORI FRAGMENT CARRYING THE CAMV 35S PROMOTER (835 BP) FRAGMENT, AND NOPALINE SYNTHASE (NOS) TERMINATOR (253 BP) AEGMENT.

2.5 Transformation of tomato explants mediated by EHA105.

Cotyledons and hypocotyls from tomato plantlets were cut into small pieces of approximately 5 mm3 before used for transformation. The sub-cutting was planted on MS media for two days preculturing at 25℃ in the dark condition.

The precultured cotyledons or hypocotyls were floated for 20 min in 1:100 dilution of EHA105 culture supplemented with 100 mM acetosyringone with occasional gentle shaking in dark for 20 min. After drying off the - 14 http://www.ivypub.org/bf

excess liquid from the bacterial suspension with sterile filter paper, the explants were placed upside down onto Petri dishes containing CCM and incubated in dark for two days at 24℃.

After co-cultivation, the cotyledons or hypocotyls discs were transferred to CIM. The plates were sealed with micropore tape and kept under regeneration at 25℃，with light intensity of 2000 lx for 10 days. A set of the untransformed explants was also regenerated on CIM as described earlier and maintained simultaneously as negative control. In the follow-up experiment, the presence of A. tumefaciens would inhibit callus growth and yield false positive result during PCR detection of the transgenic gene, so Carbenicillin and Cefalothin concentration is changed in the culture medium alternatively (400mg/ml or 200mg/ml) to reduce external interference.

During inducement, sub-culturing was done at 3-4 weeks intervals and explants showing shoot regeneration were subsequently transferred to SIM for shoot development. After 30 days of shoot growth and multiplication, the shoots obtained were transferred to RIM for root development. Rooted plants were hardened for 2 weeks before shifted to glasshouse. The established plants were designated as T0-generation plants. T0-generation transgenic lines maintained in the glasshouse were self-pollinated for fruit setting. No-transgenic controls were maintained out of the glasshouse to insulate pollination effect of the transgenic lines.

2.6 The testifying of CTB-UA gene inserting into the genome of tomato To confirm the presence of the CTB-UA gene in genome of regenerated plants, total DNA was isolated from all transformed, untransformed (negative control) plant samples using TIGEN-plant genomic DNA kits. DNA was subjected to PCR amplification using CTB-UA -specific primers, and purified pBI121- CTB-UA plasmids were used as positive control. PCR amplifying was performed in a 50 μl reaction mixture containing 200μM of each dNTP, 25 pmol/l of each primer, 10×PCR buffer, 1μl DNA extraction products, and 3 U of Taq DNA polymerase with the following cycle conditions: one cycle of 4 min at 94 ℃ followed by 30 cycles of 30 s at 94 ℃, 30 s at 57 ℃, 1 min at 72℃ and a final extension cycle of 10 min at 72 ℃. PCR product (5μl) of each sample was electrophoresed on 1% agarose gel.

2.7 Verification of transcription of CTB-UA gene in transgenic tomato leaves When the transgenic lines were established, total RNA was isolated from 1 mg of transgenic lines (one plant of each line) and untransformed tomato leaf samples to verify the transcription of the CTB-UA gene. 10.0 μl heat denatured RNA samples mixed up with the RT-PCR kit components and CTB-UA2 primer in a 50 μl reaction system was kept at 25°C for 10 minutes, then 42°C for 1 hour. 30 cycles of PCR reaction amplified the cDNA sequence with CTBUA primers as the methods described above. To study the mRNA of CTB-UA transcription level, mRNA of 18s rRNA gene was also reverse transcripted and PCR amplified by 30 cycles. To testify the possibility that contaminated DNA would produce negative results, direct PCR was performed on the RNA samples.

2.8 Enzyme-linked immunosorbent assay (ELISA) analysis to detect target gene CTB-UA expressed in transgenic tomato After the transgenic and untransformed lines were fruited, total proteins were extracted from tomato leaves, roots and fruits of those tomato samples using the Keygen-plant protein extraction kit. The extracts were tested by ELISA assays as privious described, with some modifications[24].Briefly, ELISA plates were coated with 100μg total protein from the leaves or roots and or fruits extracts at 4℃ overnight. The plates were washed with PBST, and blocked with 5% (w/v) BSA in PBS. The plates were then washed with PBST and incubated with 100 μl antigen specific mouse sera (1:1000 dilution) obtained from our labratary, setially diluted in PBS at 37℃ for 1h.After washing, HRPconjugated goat anti-mouse IgG (General Bioscience Corporation, USA) was added, and the plates were incubated again for 1h. The color reaction based on TMB was terminated after incubation for 10 min at room temperature by the addition of 50μl of H2SO4 (2M), and the absorbance at 450 nm was measured by microplate reader.

3 RESULTS AND DISCUSSION 3.1 Construction of plant expression vector pBI121-CTB-UA. The recombinant plasmid pBI121-CTB-UA was constructed by inserting the epitope vaccine gene ctb-ua (405bp, - 15 http://www.ivypub.org/bf

Fig.2b) into Bam HI/Sac I sites of plant expression vactor pBI121. Recombinant plamid pBI121-CtUBE was comfirmed by SacⅠ/BamHⅠdisgesttion (Fig.2a). E.coli DH5α (ATCC53868) was used as the host for propagating plasmids. Then the reuslting recombinant vector pBI121-CTB-UA mobilized into A. tumefaciens EHA105 through freeze-thaw transformation methods. PCR analysis using CTB-UA primers indicated the insertion of the ~ 405 bp CTB-UA gene in several conjugants. Such positive conjugants were PCR amplified using primers CTB-UA1 and CTBUA2 to verify the transformation results (data not show). One positive clone was used to transform tomato explants.

A

BACACCTCAAAATATTACTGATTTGTGTGCA GAATACCACAACACACAAATATATACGCTAA ATGATAAGATATTTTCGTATACAGAATCTCTA GCTGGAAAAAGAGAGATGGCTATCATTACTT TTAAGAATGGTGCAATTTTTCAAGTAGAAGTA CCAGGTAGTCAACATATAGATTCACAAAAAA AAGCGATTGAAAGGATGAAGGATACCCTGA GGATTGCATATCTTACTGAAGCTAAAGTCGA AAAGTTATGTGTATGGAATAATAAAACGCCT CATGCGATTGCCGCAATTAGTATGGCAAATG ATCCGCGGGTACCGAGCAGCAGCGTGGAAC TGATTGATATTGGCGGCAACCGCCGCATTTT TGGCTTTAACGCGCTGGTGGAT

FIG 2. RECOMBINAT PLAMID pBI121-CTB-UA WAS COMFIRMED DISGESTTION AND SEQUENCE ANALYSIS OF THE PLANT BINARY VECTOR PBI121-CTB-UA. (A). C: CTB-UA gene PCR products; P: pBI121 plasmid; M: marker DL2000; 1-2: SacⅠ/BamHⅠdisgesttion products of the recombinant plasmids. (B). Sequencing analysis showed no mutation site in the constructed plant binary vector pBI121- CTB-UA.

3.2 Transgenic tomato transformation and regeneration.

According to the totipotency theory, higher plants cells often retain their usual potentialities to regenerate organs or whole plantlets. Yet these properties are not stable and are usually lost after isolated from tissues and the explants not all have the same differentiation states (Fig.3). The cause of this phenomenon is unknown and it has not yet been possible to control it. In this study, phytohormones NAA and ZT combinations were used on the culture of shoot segment, and showed that phytohormones had great effect on bud and wound callus inducement. MS+2.0 mg/L of ZT+0.2 mg/l of NAA used for callus inducement had characters of short inducing time and healthy bud.

Combination of phytohormones used in the shoot inducing and shoot grow was 1.0 mg/l ZT+0.1 mg/l NAA and 0.05 ZT respectively.

A

D

B

E

C

F

FIG 3. GENERATION OF TOMATO PLANTS TRANSFORMED BY EHA105 WITH BINARY PLANT PLASMIDS PBI121- CTB-UA. (A, B) Primary selection of kanamycin-resistant tomato calli. The incubated kanamycin-resistant calli appeared as small yellow or pale green mounts of dividing cells. (C) Plant regeneration in the SIM for 4 weeks showing shoots clusters. (D) Introduced shoots was elongated on the SGM. (E) Rooting of regenerated tomato shoots. Following successful rooting, plants are transferred to the soil and grown to maturity in the greenhouse. (F) T0-generation transgenic lines maintained in the glasshouse were self-pollinated and fruit setting. Bar: 0.1 cm (A, B) and 1,0 cm (C, D, E and F).

- 16 http://www.ivypub.org/bf

3.3 Integration of CTB-UA gene into tomato plants After transformation and kanamycin resistance selection, 15 seedlings were induced and generated. Though the kanamycin resistance character could be used for transgenic plants selection, but it would come out some negative results because different shoots may show different capability to the resistance or some shoot may change their physiological responses to the changing environment. Therefore it needed the molecular analysis to verify CTB-UA gene whether it was integrated into the genome of the regenerated tomato lines. We extracted genome DNA from 15 shoots of transgenic lines to detect the target gene. The PCR reaction used CTB-UA specific primers was electrophoresed and 12 transgenic lines were verified in molecular level that has been transfomed (Fig. 4), only 6 verified transgenic lines was listed because not all the transgenic lines were generated and verified at the same time).

CTB-UA

FIG. 4 PCR DETECTION OF TRANSGENIC TOMATO PLANTS M: DL2000 marker; Pc: positive control using purified pBI121-CTB-UA vector; WT: No-transgenic tomato used as negative control; C1-C6: The transgenic tomato lines the target gene was amplified.

3.4 Detection of transcriptional activity in transgenic tomato All four transgenic plants transformed by pBI121-CTB-UA plasmid mediated by EHA105 presented active transcriptional activity that correlated to the recombinant CTB-UA fragmentďźŒwhereas untransformed plants showed no reactivity (Fig. 5 A). 18S rRNA transcript products used as control experiment also amplified the target products.

Direct PCR using RNA samples as template produced negative results verifying the specificity of RT-PCR reaction (Fig. 5 B).

CTB-UA

CTB-UA

18srRNA

FIG. 5 RT-PCR DETECTION OF THE TRANSGENIC LINES OF TOMATO RT-PCR products amplified from the total RNA of transgenic tomato leaves. Primers designed for PCR amplification of the CtBUE and 18S transcription products specifically amplified DNA fragments of 400 kb CTB-UA and 218 kb 18s cDNA approximately. Total RNA without reverse transcription could not be amplified by PCR amplification. M: Molecular-weight ladder DL2000; C1-C4: RNA from pBI121- CTB-UA transformed tomato leaves, WT: RNA from a untransformed leaves, Pc pBI121- CTB-UA plasmid.

3.5 Expression of the target peptide in transgenic tomato plants After the T0 generation tomato developed and fruited, roots, leaves and fruits extracts of all three transgenic lines showed a positive reaction with mouse anti-CTB-UA mouse sera compared to control plants (Fig. 6). All the - 17 http://www.ivypub.org/bf

transgenic plants gave more or less the same intensity of antigen-antibody reaction. Based on the ELISA assay, it may be concluded that the CTB-UA gene is being translated to produce ~16 kDa (the expected size) peptide in these transgenic plants. However, the protein antigen CTB-UA expressing in the fruits should be improved with some strategies, and the CaMV35S promoter replaced by the fruit-specific promoter E8 could be a preferable choice.

FIG. 6 TARGET PEPTIDE CTB-UA EXPRESSED IN THE TRANSGENIC TOMATO. Total proteins were extracted from the roots, fruits and leaves of three transgenic lines (C1, C2, C3) and wide type line (WT).

100Îźg total protein was added for ELISA analysis. CTB-UA gene under CaMV 35S promoter can be expressed in all three organs of the transgenic lines. The expression level varied from the three organs and different lines.

4 CONLUSIONS In this study we expressed recombinant CTB-UA peptide in tomato fruits successfully, implying that Agrobacterium-mediated tomato transformation could be used to express H. pylori vaccine and tomato fruits-derived CTB-UA peptide could be developed as an alternative oral vaccine for the research of oral derived vaccine used in H. pylori infection. The edible vaccine strategy, if successful, would be an inexpensive way to prevent H. pylori infection, especially beneficial to people in developing worlds, where currently available vaccines might be too expensive to produce and their H. pylori infection rate is rather high.

ACKNOWLEDGEMENT This work was supported by the National Major Special Program of New Drug Research and Development (grant no.2012ZX09103-301-008). We especially thank the institute of life science of Wuhan University for providing the A. tumefaciens strain EHA105, and the institute of life science of China Pharmaceutical University for providing the green house for transgenic tomato regenerate.

REFERENCES [1]

Sutton Y.-T. C. P. Targeting of whole killed bacteria to gastrointestinal M-cells induces humoral immunity in the female reproductive tract. Infection and Immunity, July 2009, p. 2009; 77: 2962-70

[2]

Tas A., Akbal E., Kocak E. and Koklu S. Moxifloxacin-tetracycline-lansoprazole triple therapy for first-line treatment of Helicobacter pylori infection: a prospective study. Helicobacter 2011; 16: 52-4

[3]

Rothenbacher D. and Brenner H. Burden of Helicobacter pylori and H. pylori-related diseases in developed countries: recent developments and future implications. Microbes Infect 2003; 5: 693-703

[4]

Suzuki H., Saito Y. and Hibi T. Helicobacter pylori and Gastric Mucosa-associated Lymphoid Tissue (MALT) Lymphoma: Updated Review of Clinical Outcomes and the Molecular Pathogenesis. Gut Liver 2009; 3: 81-7

[5]

Mendall M. A. Transmission of Helicobacter pylori. Semin Gastrointest Dis 1997; 8: 113-23

[6]

Del Giudice G., Covacci A., Telford J. L., et al. The design of vaccines against Helicobacter pylori and their development. Annu Rev Immunol 2001; 19: 523-63

[7]

Blanchard T. G., Eisenberg J. C. and Matsumoto Y. Clearance of Helicobacter pylori infection through immunization: the site of T cell activation contributes to vaccine efficacy. Vaccine 2004; 22: 888-97

[8]

Gisbert J. P. and Pajares J. M. Treatment of Helicobacter pylori infection: the past and the future. Eur J Intern Med 2010; 21: 357-9

[9]

Tang R. X., Luo D. J., Sun A. H. and Yan J. Diversity of Helicobacter pylori isolates in expression of antigens and induction of - 18 http://www.ivypub.org/bf

antibodies. World J Gastroenterol 2008; 14: 4816-22 [10] Agarwal K. and Agarwal S. Helicobacter pylori vaccine: from past to future. Mayo Clin Proc 2008; 83: 169-75 [11] Remes-Troche J. [Safety and immunogenicity of an intramuscular Helicobacter pylori vaccine in noninfected volunteers: a phase I study.]. Rev Gastroenterol Mex 2008; 73: 254 [12] Daniell H., Singh N. D., Mason H. and Streatfield S. J. Plant-made vaccine antigens and biopharmaceuticals. Trends Plant Sci 2009; 14: 669-79 [13] Tiwari S., Verma P. C., Singh P. K. and Tuli R. Plants as bioreactors for the production of vaccine antigens. Biotechnol Adv 2009; 27: 449-67 [14] Takahashi I., Nochi T., Yuki Y. and Kiyono H. New horizon of mucosal immunity and vaccines. Curr Opin Immunol. 2009; 21: 352-8 [15] Salyaev, R. K., et al. Study of the mucosal immune response duration in mice after administration of a candidate edible vaccine based on transgenic tomato plants carrying the TBI-HBS gene. Dokl Biochem Biophys 2009; 428: 232-234 [16] Shchelkunov, S. N., et al. Study of immunogenic properties of the candidate edible vaccine against human immunodeficiency and hepatitis B viruses based on transgenic tomato fruits. Dokl Biochem Biophys 2005 401: 167-169 [17] Shchelkunov, S. N., et al. Designing of a candidate edible vaccine against hepatitis B and HIV on the basis of a transgenic tomato.

Vestn Ross Akad Med Nauk 2004; 11: 50-55 [18] Ryo Matsuda, Chieri Kubota, M. Lucrecia Alvarez, and Guy A. Cardineau. Effect of high electrical conductivity of hydroponic nutrient solution on vaccine protein content in transgenic tomato. Hort Technology 2012; 22: 362-367 [19] Zheng-jun Guan, Bin Guo., Hao-yong Hao., et.al. Expression of hepatitis B surface antigen (HBsAg) gene in transgenic cherry tomato. 2012; 11: 7186-7192 [20] Le Guo, Xiaokang Li and Tao Xi., et al. Immunological features and the ability of inhibitory effects on enzymatic activity of an epitope vaccine composed of cholera toxin B subunit and B cell epitope from Helicobacter pylori urease A subunit. Appl Microbio Biotechnol 2012; 93: 1937-1945 [21] 21. Le Guo, Kunmei Liu and Tao Xi, et al. Prophylactic and therapeutic efficacy of the epitope vaccine CTB-UA against Helicobacter pylori infection in a BALB/c mice model. Appl Microbio Biotechnol 2012; 95: 1437-1444

AUTHORS 1

3

Life Science and Technology, China

Technology, China Pharmaceutical University, China.

Xiaokang Li (1986-) is in School of

Pharmaceutica University, China.

Email: xiaokangli1986@163.com

Xuanquan Wang (1985-) is in School of Life Science and

Email: yantaiquan@126.com 4

Le Guo (1982-) is in School of Laboratory Medicine, Ningxia

Medical University. Email: guoletian1982@163.com 5

Yingying Xing (1980-) is in School of Life Science and

Technology, China Pharmaceutical University, China.

2

Email: xingying1980@126.com

Technology, China Pharmaceutical University, China.

6

Email: yipinyoulan521@163.com

China Pharmaceutical University, China.

Xinyang Li (1987-) is in School of Life Science and

Tao Xi (1956-) is in School of Life Science and Technology,

Email: xiaokangli_cpu@126.com

- 19 http://www.ivypub.org/bf