Kowalska 2015

Journal of Plant Pathology (2015), 97 (1), 37-43 Edizioni ETS Pisa, 2015 37

BURKHOLDERIA GLADIOLI ASSOCIATED WITH SOFT ROT OF ONION BULBS IN POLAND

B. Kowalska, U. Smoli nska ´ and M. Oskiera Research Institute of Horticulture. Konstytucji 3 Maja 1/3, 96-100 Skierniewice, Poland

SUMMARY

Bacterial diseases of onion (Allium cepa L.) are serious problems in Poland. In this study bacterial strains were isolated from onion bulbs with soft-rot symptoms. Pathogenicity tests were conducted on onion bulbs and also on tobacco leaves on whose basis twelve isolates were chosen to further characterization. These isolates were identified using physiological and biochemical tests, and confirmed by species-specific PCR, ERIC-PCR and sequence analysis of 16S rRNA, gyrB, lepA, phaC, recA gene fragments. All examined isolates were identified as Burkholderia gladioli.

It is the first report of the occurrence of B. gladioli on onion as the cause of onion disease in Poland.

Key words: Burkholderia gladioli, onion, diagnosis, soft rot, disease.

INTRODUCTION

Onion (Allium cepa L.) is one of the major vegetable crops grown in Poland, where the total area planted and harvested in 2012 was ca. 25,000 ha. Since onion harvesting often coincides with rainy weather and during cultivation hailstorms may occur, complex bacterial and fungal diseases often develop. In recent years, bacterial diseases have caused very serious problems to Polish onion crops, inflicting significant economic losses because they are difficult to control. Successful control depends on proper sanitation, avoiding injuries, keeping bulbs dry and cool during storage, assuring good insect control and practicing crop rotation (Agrios, 2005). Bacterial soft rot of onion bulbs is most frequent and it can appear during cultivation, storage or transportation (Sobiczewski and Schollenberger, 2002).

Soft-rot diseases of bacterial origin, particularly those associated with Burkholderia gladioli, B. cepacia, Pectobacterium carotovorum subsp. carotovorum (Schwartz and Mohan, 2008; Yohalem and Lorbeer, 1997), Serratia plymuthica (Kowalska et al., 2011) are known all over the word.

Pseudomonas marginalis (Kim et al., 2002; El-Hendawy, 2004), Pseudomonas syringae, Pseudomonas viridiflava Corresponding author: B. Kowalska Fax: +48.46.8333186 E-mail: Beata.Kowalska@inhort.pl

(Gitaitis et al., 1998), Pantoea ananatis (Gitaitis et al., 2002; Walcott et al., 2002), Enterobacter cloacae (Schroeder et al., 2009), Burkholderia ambifaria and B. pyrrocinia (Jacobs et al., 2008) and Serratia spp. (Beriam, 2007) have also been reported as agents of onion bacterial diseases.

B. gladioli pv. alliicola was first reported as Phytomonas alliicola from rotten onion bulbs in New York state (USA) (Starr and Burkholder, 1942); then, under the name of Pseudomonas gladioli, from Iowa (USA), as the cause of yellowing and death of onion leaves and infection of the outer scales of young bulbs (Semeniuk and Melthus, 1943). The bacterium was isolated from onion bulbs by both Burkholder and Vitanov (Burkholder, 1950) who regarded it exclusively as an onion bulb pathogen and was reclassified as Burkholderia gladioli (Yabuuchi et al., 1992).

Its presence in onion has been reported from Europe, Asia and USA (Lee et al., 2005; Schwartz and Mohan, 2008; Stoyanova et al., 2011; Schroeder et al., 2012), with crop losses of up to 40%.

B. gladioli strains have also been isolated from and regarded as a pathogen of Gladiolus sp., Iris sp., Eustoma grandiflorum (Coenye and Vandamme, 2003; Stoyanova et al., 2007; Keith et al., 2005), summer snowflake (Leucojum aestivum) (Stoyanova et al., 2013), saffron (Crocus sativus L.) (Fiori et al., 2011), maize (Lu et al., 2007; Gijon-Hernandez et al., 2011) and rice (Ura et al., 2006; Nandakumar et al., 2009).

B. gladioli can also be a human pathogen, but it can hardly be identified with commercial detection kits. Its strains are sensitive to the complement-mediated lysis of human serum, which confers a natural immunity to healthy individuals. However, one of the four cases of human infection was in a non-immunocompromised patient (Stoyanova et al., 2007).

Very little is known on B. gladioli occurrence in Poland and the characteristics of its strains. There are only a few short reports on onion soft rot induced by Burkholderia sp.

(Sobiczewski and Schollenberger, 2002), but no information on the biochemical and molecular properties of the associated bacteria, except for a paper by Schollenberger and Zamorski (2008) who observed atypical disease symptoms on lisianthus growing in greenhouses near Warsaw.

The bacterium isolated from diseased plants was identified as B. gladioli by conventional microbiological methods, and the disease was named bacterial ring blight of lisianthus (Schollenberger and Zamorski, 2008).

38

Journal of Plant Pathology (2015), 97 (1), 37-43

Burkholderia gladioli in Poland

Table 1. Bacterial strains used in this study and GeneBank accession Nos. Bacterial isolates Bg259 Bg260 Bg261 Bg285 Bg294 Bg295 Bg435 Bg469 Bg467 Bg494 Bg500 Bg514 B. gladioli pv. alliicola LMG 6979 B. cepacia LMG 6962

Locality, place and year of isolation Poland, Tomaszów Lubelski; field; 2006 Poland, Tomaszów Lubelski; field; 2006 Poland, Tomaszów Lubelski; field; 2006 Poland, Radom; field; 2006 Poland, Radom; field; 2006 Poland, Radom; field; 2006 Poland, Skierniewice; storage; 2007 Poland, Skierniewice; storage; 2007 Poland, Skierniewice; storage; 2007 Poland, Skierniewice; field; 2008 Poland, Skierniewice; field; 2008 Poland, Hopkie; storage; 2008 USA USA

The objective of this study was the identification of bacteria associated with soft rot of onion in Poland, using biochemical and molecular methods.

MATERIALS AND METHODS

Isolation of soft rotting bacteria. Onion bulbs with bacterial soft rot were obtained during summer and autumn of 2006, 2007 and 2008 from Polish onion storage warehouses or field crops. The bulbs were washed with tap water and cut lengthwise. Diseased scale tissues were then cut into about 10-15 mm cubes with a sterilized scalpel, the fragments were sterilized in ethanol for 30 sec, washed in sterile water and plated onto nutrient agar medium (NA, beef extract 3 g, glucose 2.5 g, peptone 5 g, agar 15 g, and distilled water 1000 ml). Petri dishes with NA were incubated at 28°C for 48 h. Next, a selected bacterial colony was streaked onto a fresh NA plate and used for this study.

Bacterial strains and culture conditions. Forty two bacterial isolates used in this study were maintained at −80ºC in nutrient broth medium containing 50% (v/v) glycerol. The isolates were transferred onto NA, incubated at 28°C for 24 h and maintained at 4°C for short-term use. Genuine isolates of B. gladioli pv. alliicola LMG 6979 and B. cepacia LMG 6962, provided by from a Belgian Microorganism Collection (Ghent University) were used for comparison.

Pathogenicity tests. All strains were examined for the ability to macerate onion tissue. To this aim, healthy bulbs of cv. Grabowska were peeled, washed with running water and sterilized in 70% ethanol for 30 sec and in 0.5% NaOCl for 5 min. The bulbs were then washed in sterile water and cut lengthwise into two parts. Three onion pieces were placed into a large Petri dish incubation chamber (volume 314 cm3), on a paper filter which had been wetted with 10 ml of sterile water. The outer scale of

GenBank accession No. gltB

lepA

phaC

recA

KF857489 KF857490 KF857491 KF857492 KF857493 KF857494 KF857495 KF857496 KF857497 KF857498 KF857488 -

KF857500 KF857501 KF857502 KF857503 KF857504 KF857505 KF857506 KF857507 KF857508 KF857509 KF857510 KF857511 KF857499 -

KF857513 KF857514 KF857515 KF857516 KF857517 KF857518 KF857519 KF857520 KF857521 KF857522 KF857523 KF857512 -

KF857525 KF857526 KF857527 KF857528 KF857529 KF857530 KF857531 KF857532 KF857533 KF857534 KF857535 KF857524 -

each piece was wounded with a laboratory needle to make a wound 3-4 mm in diameter which was inoculated with 20 µl suspension from a 24 h pure bacterial culture containing 1.0-2.5 × 108 CFU ml−1. Controls were not inoculated. Inoculations of reference strains B. cepacia LMG 6962 and B. gladioli LMG 6979 were also made consisting of two replicates (six onion pieces) for each bacterial strain.

Disease symptoms were examined after 4 days incubation at 28°C. Virulence was evaluated using an arbitrary scale from 0 (no tissue maceration) to 3 (complete maceration).

The experiment was repeated twice. For the experiments that followed only the isolates were used that induced maceration of level two and greater than two. A total of 12 isolates were investigated: Bg259, Bg260, Bg261, Bg285, Bg294, Bg295, Bg435, Bg467, Bg469, Bg494, Bg500 and Bg514 (Table 1).

Tobacco hypersensitivity reaction was conducted using tobacco plants of cv. Samsun (Klement et al., 1964). A bacterial suspension of 1.0-2.5 × 108 CFU ml−1 was injected into the intercellular space of tobacco leaves, recording as positive the complete collapse of the tissues after 24 h. The test was repeated with each isolate at least twice.

Biochemical and physiological tests. For these assays 12 bacterial isolates were used, that gave positive responses in pathogenicity tests. Bacterial colony morphology was assessed on NA medium taking into account the shape, size, texture and markings of the surface. Physiological and biochemical characterization was according to Schaad et al. (2001). The following properties were determined: Gram reaction by 3% KOH (Suslow et al., 1982) and Gram stain, anaerobic growth in Hugh and Leifson (1953) medium, production of fluorescent pigment on King B medium [peptone 20.0 g, K 2HPO4 2.5 g, glycerol 15 ml, MgSO4 × 7H 2O 6.0 g, agar 15.0 g, water 1000 ml (King et al., 1954)]; colony colour on YDC medium [yeast extract 10.0 g, glucose 20.0 g, CaCO3 20.0 g, agar 15.0 g, water 1000 ml (Wilson et al., 1967)]; growth on D1M medium [cellobiose 5.0 g, NH4Cl 1.0 g, NaH 2PO4 1.0 g, K 2HPO4

Journal of Plant Pathology (2015), 97 (1), 37-43

Kowalska et al.

39

Table 2. PCR primers used for Burkholderia spp. identification.

Gene

Primer name

Sequence (5’→ 3’)

Reference

Specific for B. gladioli 16S rRNA

CMG-16-1 = fD1

AGAGTTTGATCMTGGCTC

Weisburg et al., 1991

G-16-2

CGAAGGATATTAGCCCTC

CMG-23-1

ATAGCTGGTTCTCTCCGAA

G-23-2

CCTACCATGCAYATAAAT

ERIC1R

ATGTAAGCTCCTGGGGATTCAC

ERIC2

AAGTAAGTGACTGGGGTGAGCG

Specific for B. gladioli 23S rRNA ERIC-PCR genome DNA “fingerprint”

1.0 g, MgSO4 × 7H2O 3.0 g, malachite green 10.0 mg, agar 15.0 g, water 1000 ml (Perry and Kado, 1982]); utilization of arginine [peptone 5.0 g, yeast extract 5.0 g, K 2HPO4 2.0 g, dextrose 50.0 g, arginine HCl 3.0 g, water 1000 ml (Cowan, 1974)]; growth at 40°C; oxidase reaction. Oxidase test was conducted using a filter paper impregnated with 1% aqueous tetramethyl-p-phenylenediamine dihydrochloride solution (Fluka, Germany). A small loopful of the inoculum was transferred onto the filter paper. The isolate was rated oxidase-positive if a purple colour developed within 10 sec, negative if no colour developed after 60 sec.

Utilisation of the following carbohydrates: lactose, sucrose, sorbitol and cellobiose was investigated. All carbon sources were added at 0.1% final concentration to a mineral salts medium consisting of K 2HPO4 7 g, KH 2PO4 2 g, MgSO4 × 7H 2O 0.1 g and (NH4)2SO4 1 g per liter of distilled water (pH 7). The medium was filter-sterilized and solidified with agar. Bacteria were streaked onto the plates which were incubated at 28°C. The growth was observed over seven days. Reference bacteria were used as a standard.

The ability of the bacteria under study to grow on selective PCAT and CB media was also examined. PCAT medium consisted of azelaic acid 2 g, tryptamine 0.2 g, MgSO4 × 7H2O 0.1 g, K2HPO4 4 g, KH2PO4 4 g, yeast extract 0.02 g, agar 15 g, water 1000 ml and chlorothalonit 1 ml added after sterilization (Salles et al., 2006). CB medium consisted of tryptone 5 g, yeast extract 2.5 g, glucose 1 g, agar 15 g, water 1000 ml and polymyxine B sulfate added after sterilization (Wu and Thompson, 1984).

DNA-based techniques. For molecular analysis, total genomic DNA was isolated according to Aljanabi and Martinez (1997). Amplification reactions were performed in a 20 µl final reaction mixture containing 1× PCR buffer (with 2 mM MgCl2, 250 µM of each deoxynucleoside triphosphate 0.5 µM of each primer, 1 U of DreamTaq DNA polymerase for standard PCR or Taq DNA polymerase (all

by Thermo Scientific, USA) for ERIC-PCR and 20 ng of bacterial DNA. PCR was performed with Mastercycler ep gradient S (Eppendorf, USA) under the following condition: denaturation for 3 min at 95°C, then 35 amplification cycles of 30 sec at 94°C, 30 sec at the appropriate annealing temperature and 60 sec at 72°C and followed by a final extension step of seven min at 72°C. For ERIC-PCR a

Bauernfeind et al., 1998a, 1998b

Louws et al., 1995

different PCR thermal profile was used: 5 min denaturation at 95°C, 35 amplification cycles of 1 min at 94°C, 90 sec at 52°C and 8 min at 65°C, followed by a final extension step of 16 min at 65°C. Amplified products were checked by 1.5% agarose (Basica Le Gqt, Prona, Norway) gel electrophoresis and stained with ethidium bromide (0.25 µg ml−1).

The identity of the bacterial isolates was confirmed by using Burkholderia-specific PCR primers (Bauernfeid et al., 1998a, 1998b) (Table 2). ERIC-PCR primers (Louws et al., 1995) were used to generate and compare genomic fingerprints of bacterial isolates and B. gladioli pv. alliicola strain LMG 6979. Primers ERIC1R and ERIC2 (Table 2) correspond to conserved motifs in bacterial repetitive sequences. Sequencing of the 16S rRNA, gyrB, lepA, phaC, recA gene fragments was done with the PCR primers listed in Table 3. Amplicons were generated with the same primers as used for further sequencing in both directions. Only three representative isolates Bg259, Bg295, and Bg494 were chosen for 16S rRNA gene sequencing. 16S rRNA amplicons were generated and sequenced with fD1, rP2 primers (Weisburg et al., 1991) and additionally primers 800f and 800r (Drancourt et al. 1997) were used for sequencing.

PCR conditions used for amplification were as above for standard PCR without modifications. PCR products were cleaned with Exo-Sap (Affymetrics, USA) procedure following manufacturer’s instructions and 6 µl total mixture of 20 ng PCR amplicons with 5 µM primer were sequenced (Genomed, Poland). Editing and analysing of the obtained sequences were performed with CLC Genomic Workbench 6 and NCBI megablast software.

RESULTS AND DISCUSSION

A bacterium responsible for soft rotting was consistently isolated from diseased onions in the field and from bulbs under storage. During storage, infected onion bulbs did not show any symptoms except for softening of the neck tissue but, when cut longitudinally, one or two inner fleshy scales appeared soft and water-soaked or pale brown. Eventually the infection spread to other scales and in the more severe cases, soft rotting of the internal scales extended to the external ones which emanated a sour smell, turned brown and dried out.

40

Journal of Plant Pathology (2015), 97 (1), 37-43

Burkholderia gladioli in Poland

Table 3. Primers used for sequencing of gene fragments and amplicons generation, with exception of Drancourt’s primers which were used for sequencing reactions only.

Gene

Primer name

Sequence (5’→ 3’)

16S rRNA gene almost full length

fD1

AGA GTT TGA TCM TGG CTC

rP2

ACGGCTACCTTGTTACGACTT

800f

ATTAGATACCCTGGTAG

800r

CTACCAGGGTATCTAAT

gyrB for

ACCGGTCTGCAYCACCTCGT

gyrB rev

YTCGTTGWARCTGTCGTTCCACTGC

lepA for

CTSATCATCGAYTCSTGGTTCG

lepA rev

CGRTATTCCTTGAACYCGTARTCC

phaC for

GCACSAGYATYTGCCAGCG

phaC rev

CCATSTCSGTRCCRATGTAGCC

recA for

AGGACGATTCATGGAAGAWAGC

recA rev

GACGCACYGAYGMRTAGAACTT

16S rRNA gene half length gyrB (DNA gyrase subunit B, partial sequence)

lepA (GTP binding protein, partial sequence) phaC (phaC gene partial sequence) recA (recombinase A, partial sequence)

Onion bulbs artificially inoculated with bacterial isolates Bg259, Bg260, Bg261, Bg285, Bg294, Bg295, Bg435, Bg467, Bg469, Bg494, Bg500 and Bg514 developed symptoms of soft rot similar to those observed after inoculation with the reference strains (B. cepacia and B. gladioli). The tissues around the inoculation points became yellow or pale brown and sunken. These symptoms were visible within 4 days post inoculation and progressed as time went by. The disease index differed among studied isolates (Table 4). No symptoms were observed in any of the controls.

According to Lopez et al. (2004) and Alvarez (2004) the accurate and reliable diagnosis of plant pathogenic bacteria requires the use of integrated approaches based on the use of multiple techniques. Accordingly, in the present case, biochemical and molecular methods were used for the identification of the bacterial isolates under study.

After two-day growth on NA medium, colonies were round, small, circular and creamy. B. cepacia LMG 6979 produced a yellowish pigment, probably toxoflavin, a Table 4. Pathogenicity index of bacterial isolates obtained in pathogenicity tests on onion bulbs.

Bacterial isolates or species Bg259 Bg260 Bg261 Bg285 Bg294 Bg295 Bg435 Bg467 Bg469 Bg494 Bg500 Bg514 B. gladioli pv. alliicola LMG 6979 B. cepacia LMG 6962 Non inoculated control

Pathogenicity index (0-3)* 3.0 2.3 3.0 3.0 1.7 1.7 1.8 2.5 3.0 3.0 3.0 3.0 3.0 3.0 0.0

* 0 = no maceration of onion tissue; 1 = limited tissues maceration; 2 = about 50% maceration; 3 = about 100% maceration.

References Weisburg et al., 1991 Drancourt et al., 1997

Spilker et al., 2009

compound playing a role in the virulence of B. gladioli to rice seedling (Ura et al., 2006).

All studied isolates were Gram-negative, lacked arginine dihydrolase, did not produce fluorescent pigment on King B medium, grew aerobically and were able to utilize arginine, lactose, cellobiose, sorbitol and sucrose. On YDC medium the colonies were brownish-cream, non-mucoid and produced a diffusible brownish pigment. Furthermore, all isolates were oxidase positive, were able to grow at pH 4.0 and 8.0 but not at pH 9.0 and caused distinct necrotic lesions on the leaves of tobacco plants. The same biochemical profiles were shown by the reference strain B. gladioli pv. alliicola LMG 6979 (Table 5). On CB and PCAT media all isolates grew like the reference isolates.

The colonies were white, had a flat margins and were ca.

1 mm in diameter.

The results of biochemical tests of all isolates were in agreement with those described for B. gladioli (Schaad, 2001), an identification that was confirmed by PCR using B. gladioli-specific primers (CMG-16-1/G-16-2 and CMG-23-1/G-23-2) which amplified the expected products of 468 and 388 bp (Fig. 1 and 2). Furthermore the ERIC-PCR profiles of all isolates were identical to that of the reference strain B. gladioli, as shown in Fig. 3 which illustrates the ERIC-PCR profiles of reference strain and of the three representatives of the isolates under study (Bg259, Bg500 and Bg514).

All partial sequences of recA and phaC genes of the Polish isolates were identical to the comparable sequences of strain LMG 6979, deposited in BCCM as Burkholderia gladioli pv. alliicola. By contrast, sequences of gyrB and lepA of isolates Bg435, Bg469, Bg494 were identical to those of LMG 6979, but differed from those of the remaining Polish isolates, so that the isolates under study separated into two groups based on the sequences of these two genes (Table 6). Sequences were deposited in GenBank (http://www.ncbi.nlm.nih.gov/) with accession Nos KF857488-KF857535.

Journal of Plant Pathology (2015), 97 (1), 37-43

Kowalska et al.

41

Table 5. Phenotypic characteristic of pathogenic bacterial isolates from onion bulbs used in this study and reference strain B. gladioli pv. alliicola LMG 6979.

Test Gram reaction KOH reaction Colour of colony on NA medium Anaerobic growth Tobacco HR Oxidase Production of fluorescent pigment on King B medium Colonie colour on YDC medium Growth on D1M medium Growth at pH 4.0 Growth at pH 8.0 Growth at pH 9.0 Utilization of arginine Growth at 40ºC Arginine dihydrolase Utilization of lactose Utilization of sucrose Utilization of sorbitol Utilization of cellobiose

Studied isolates (Bg259, Bg260, Bg261, Bg285, Bg294, Bg295, Bg435, Bg467, Bg469, Bg494, Bg500 and Bg514)

Reference strain B. gladioli pv. alliicola LMG 6979

− − creamy − + + −

− − creamy − + + −

brownish-cream − + + − + + − + + + +

brownish-cream − + + − + + − + + + +

+ positive; − negative.

Table 6. Representation of sequence types of analysed strains.

Strain group

Sequence type gyrB

lepA

phaC recA

1 - LMG 6979, Bg435, Bg469, Bg494

1

1

1

1

2 - Bg259, Bg260, Bg261, Bg285, Bg294, Bg295, Bg467, Bg500, Bg514

2

2

1

1

Fig. 1. Amplification of the 388-bp product of the 16S rDNA gene from Burkholderia gladioli using species-specific PCR primers. Lane 1 and 18, 100 bp DNA ladder; lane 2, B. gladioli pv. alliicola LMG 6979; lanes 3-15, isolates Bg259, Bg260, Bg261, Bg285, Bg294, Bg295, Bg435, Bg467, Bg469, Bg494, Bg500, Bg514; lane 16 , B. cepacia LMG 6962; lane 17, water control.

Fig. 2. Amplification of the 468-bp product of the 16S rDNA gene from Burkholderia gladioli using species-specific PCR priners. Lane 1 and 18, 100 bp DNA ladder; lane 2, B. gladioli pv. alliicola LMG 6979; lanes 3-15, isolates Bg259, Bg260, Bg261, Bg285, Bg294, Bg295, Bg435, Bg467, Bg469, Bg494, Bg500, Bg514; lane 16 , B. cepacia LMG 6962; lane 17, water control.

Fig. 3. ERIC-PCR. Lane 1 – 100 bp DNA ladder (Thermo Scientific), 10 – Bg514, 11 – B. cepacia LMG 6962, 12 – B. gladioli LMG 6979, 15 – Bg259, 19 – Bg500, 20 – B. gladioli LMG 6979, lanes 2, 3, 4, 5, 6, 7, 8, 9, 13, 14, 16, 17, 18 – other isolates not studied in this work.

42

Journal of Plant Pathology (2015), 97 (1), 37-43

Burkholderia gladioli in Poland

Table 7. Megablast crosschecks with obtained sequences types.

Bacterial strain B. gladioli strain BSR3

Fig. 4. 16S rRNA alignment with distinction of nucleotide differences shown as shadows in the box.

Three representative isolates (Bg259, Bg295 and Bg494) were chosen for 16S rRNA sequence identification. The sequence (accession No. KF857486) was identical for Bg259 and Bg295 but differed from that of Bg494 (accession No. KF857487) by two base pairs (Fig. 4).

Genome sequence of B. gladioli strain BSR3 (GenBank accession No. CP002599.1) and Burkholderia glumae strain BGR1 (GenBank accession No. CP001503.2) were used for megablast crosschecks with the sequences of the Polish isolates (Table 7). As BLASTn search with megablast algorithm (http://blast.ncbi.nlm.nih.gov) against GenBank nucleotide collection (nr/nt) database of all sequences obtained support the identification of Polish bacterial isolates as B. gladioli pv. alliicola the conclusion is that there is a complete agreement in the outcome the morphological, physiological, biochemical and molecular diagnostic methods utilized in the present investigation.

The isolates under study had a patogenicity index ranging from 1.7 to 3.0 (Table 4). However, since the majority of them had index 3.0 and caused complete rotting of bulbs, it can be assumed that these isolates are severe onion pathogens. To our knowledge, the present study provides the first experimental evidence of the presence of B. gladioli as dangerous pathogen of onion in Poland.

REFERENCES Agrios G.N., 2005. Plant Pathology. Elsevier-Academic Press, New York, NY, USA Aljanabi S.M., Martinez I., 1997. Universal and rapid salt extraction of high quality genomic DNA for PCR-based techniques. Nucleic Acids Research 25: 4692-4693.

Alvarez A.M., 2004. Integrated approaches for detection of plant pathogenic bacteria and diagnosis of bacterial diseases.

Annual Review of Phytopathology 42: 339-366.

Bauernfeind A., Schneider I., Jungwirth R., Roller C., 1998a.

Molecular procedure for rapid detection of Burkholderia mallei and Burkholderia pseudomallei. Journal of Clinical Microbiology 36: 2737-2741.

Bauernfeind A., Schneider I., Jungwirth R., Roller C., 1998b.

Discrimination of Burkholderia gladioli from other Burkholderia species detectable in cystic fibrosis patiens by PCR. Journal of Clinical Microbiology 36: 2748-2751.

Beriam L.O.S., 2007. Palestra doenças bacterianas em hortaliças. Biologico 69: 81-84.

Burkholder W., 1950. Sour skin, a bacterial rot of onion bulbs.

Phytopathology 40: 115-118.

B. glumae strain BGR1

Sequence

Identity E-value Query coverage (%) (%)

phaC_1

99

0.0

99

lepA_1

99

0.0

99

lepA_2

99

0.0

99

recA_1

99

0.0

99

gyrB_1

99

0.0

99

gyrB _2

99

0.0

99

phaC_1

94

0.0

99

lepA_1

92

0.0

98

lepA_2

92

0.0

98

recA_1

95

0.0

98

gyrB _1

93

0.0

99

gyrB _2

93

0.0

99

Coenye T., Vandamme P., 2003. Diversity and significance of Burkholderia species occupying diverse ecological niches.

Environmental Microbiology 5: 719-729.

Cowan S.T., 1974. Cowan and Steel’s Manual for Identification of Medical Bacteria. Cambridge University Press, Cambridge, UK. Drancourt M., Bollet C., Raoult D., 1997. Stenotrophomonas africana sp. nov., an opportunistic human pathogen in Africa.

International Journal of Systemic Bacteriology 47: 160-163.

El-Hendawy H.H., 2004. Association of pectolytic fluorescent pseudomonads with postharvest rots of onion. Phytopathologia Mediterranea 43: 369-376.

Fiori M., Ligios V., Schiaffino A., 2011. Identification and characterization of Burkholderia isolates obtained from bacterial rot of saffron (Crocus sativus L.) grown in Italy. Phytopathologia Mediterranea 50: 450-461.

Gijon-Hernandez A., Teliz-Ortiz D., Mejia-Sanchez D., De La Torre-Almaraz R., Cardenas-Soriano E., De Leon C., MoraAguilera A., 2011. Leaf stripe and stem rot caused by Burkholderia gladioli, a new maize disease in Mexico. Journal of Phytopathology 159: 377-381.

Gitaitis R., MacDonald G., Torrance R., Hartley R., Sumner D.R., Gay J.D., Jahnson W.C., 1998. Bacterial streak and bulb rot of sweet onion: II. Epiphytic survival of Pseudomonas viridiflava in association with multiple weed hosts. Plant Disease 82: 935-938.

Gitaitis R., Walcott R., Culpepper S., Sanders H., Zolobowska L., Langston D., 2002. Recovery of Pantoea ananatis, casual agent of center rot of onion, from weeds and crops in Georgia , USA. Crop Protection 21: 983-989.

Hugh R., Leifson E., 1953. The taxonomic significance of fermentative versus oxidative metabolism of carbohydrates by various Gram-negative bacteria. Journal of Bacteriology 66: 24-26.

Jacobs J.L., Fasi A.C., Ramette A., Smith J.J., Hammerschmidt R., Sundin G.W., 2008. Identification and onion pathogenicity of Burkholderia cepacia complex isolates from the onion rhizosphere and onion field soil. Applied Environmental Microbiology 74: 3121-3129.

Journal of Plant Pathology (2015), 97 (1), 37-43 Keith L.M., Sewake K.T., Zee F.T., 2005. Isolation and characterization of Burkholderia gladioli from orchids in Hawaii.

Plant Disease 89: 1273-1278.

Kim Y.K., Lee S.D., Choi C.S., Lee S.B., Lee S.Y., 2002. Soft rot of onion bulbs caused by Pseudomonas marginalis under low temperature storage. Plant Pathology Journal 18: 199-203.

King E.O., Ward M.K., Raney D.E., 1954. Two simple media for the demonstration of pyocyanin and fluorescein. Journal of Laboratory and Clinical Medicine 44: 301-307.

Klement Z., Farkas G.L., Lovrekovetch L., 1964. Hypersensitive reaction induced by phytopathogenic bacteria in tobacco leaf. Phytopathology 54: 474-477.

Kowalska B., Smolińska U., Oskiera M., 2011. First report of Serratia plymuthica causing onion bulb rot in Poland. Polish Journal of Microbiology 60: 85-87.

Lee C.J., Lee J.T., Kwon J.H., Kim B.C., Park W., 2005. Occurrence of bacterial soft rot of onion plants caused by Burkholderia gladioli pv. alliicola in Korea. Australasian Plant Pathology 34: 287-292.

Lopez M.M., Bertolini E., Caruso P., Penyalver R., Marco E., Gorris M.T., Morente C., Salcedo C., Llop P., 2004. Advantages of an integrated approach for diagnosis of plant pathogenic bacteria in plant material. Workshop: Improvement and Unification of Plant Disease Diagnostic. Skierniewice, Poland: 80.

Louws F.J., Fulbright D.W., Stephens C.T., de Bruijn F.J., 1995.

Differentation of genomic structure by rep-PCR fingerprinting to rapidly classify Xanthomonas campestris pv. vesicatoria.

Phytopathology 85: 528-536.

Lu S.E., Henn R.A., Nagel D.H., 2007. First report of ear soft rot of corn (Zea mays) caused by Burkholderia gladioli in the United States. Plant Disease 91: 1514.

Nandakumar R., Shahjahan A.K.M., Yuan X.L., Dickstein E.R., Groth D.E., Clark C.A., Cartwright R.D., Rush M.C., 2009.

Burkholderia glumae and B. gladioli cause bacterial panicle blight in rice in the Southern United States. Plant Disease 93: 896-905.

Perry K.L., Kado C.J., 1982. Characteristics of Ti plasmids from broad-host range and ecologically specific biotype 2 and 3 strains for Agrobacterium tumefaciens. Journal of Bacteriology 151: 343-350.

Salles J.F., Samyn E., Vandamme P., van Veen J.A., van Elsas J.D., 2006. Changes in agricultural management drive the diversity of Burkholderia species isolated from soil in PCAT medium. Soil Biology and Biochemistry 38: 661-673.

Schaad N.W., Jones J.B., Chun W., 2001. Laboratory Guide for Identification of Plant Pathogenic Bacteria. APS Press, St. Paul, MN, USA. Schollenberger M., Zamorski C., 2008. New bacterial disease of lisianthus. Progress in Plant Protection 48: 520-523.

Schroeder B.K., Humann J.L., 2012. Effects of postharvest onion curing parameters on the development of sour skin and slippery skin in storage. Plant Disease 96: 1548-1555.

Schroeder B.K., du Toit L.J., Schwartz H.F., 2009. First report of Enterobacter cloacae causing onion bulb rot in the Colum-

Received February 12, 2014 Accepted August 28, 2014

Kowalska et al.

43

bia Basin of Washington State. Plant Disease 93: 323.

Schwartz H.F., Mohan S.K., 2008. Compendium of Onion and Garlic Diseases and Pests. APS Press, St. Paul, MN, USA. Semeniuk G., Melthus I.E., 1943. Botany and plant pathology section. Republic Iowa Agricultural Experiment Station 19421943: 125-145.

Sobiczewski P., Schollenberger M., 2002. Bacterial diseases of horticultural plants. PWRiL, Warsaw, Poland: 54-67.

Spilker T., Baldwin A., Bumford A., Dowson C.G., Mahenthiralingam E., LiPuma J.J., 2009. Expanded multilocus sequence typing for Burkholderia species. Journal of Clinical Microbiology 47: 2607-2610.

Starr M.P., Burkholder W.H., 1942. Lipolytic activity of phytopathogenic bacteria determined by means of spirit blue agar and its taxonomic significance. Phytopathology 32: 598-604.

Stoyanova M., Georgieva L., Moncheva P., Bogatzevska N., 2013. Burkholderia gladioli and Pseudomonas marginalis pathogens of Leucojum aestivum. Biotechnology & Biotechnology Equipment 27: 4069-4073.

Stoyanova M., Kizheva Y., Chipeva V., Bogatzevska N., Moncheva P., 2011. Phytopathogenic Burkholderia species in bulb plants in Bulgaria. Biotechnology & Biotechnology Equipment 25: 2477-2483.

Stoyanova M., Pavlina I., Moncheva P., Bogatzevska N., 2007.

Biodiversity and incidence of Burkholderia species. Biotechnology & Biotechnology Equipment 21: 306-310.

Suslow T.V., Schroth M.N., Isaka M., 1982. Application of rapid methods for Gram differentiation of plant pathogenic and saprophytic bacteria without staining. Phytopathology 72: 917-918.

Ura H., Furuya N., Iiyama K., Hidaka M., Tsuchiya K., Matsuyama N., 2006. Burkholderia gladioli associated with symptoms of bacterial grain rot and leaf-sheath browning of rice plants. Journal of Genetic Plant Pathology 72: 98-103.

Walcott R.R., Gitaitis R.D., Castro A.C., Sanders Jr. F.H., DiazPerez J.C., 2002. Natural infestation of onion seed by Pantoea ananatis, casual agent of center rot. Plant Disease 86: 106-111.

Weisburg W.G., Barns S.M., Pelletier D.A., Lane D.J., 1991. 16S ribosomal DNA amplification for phylogenetic study. Journal of Bacteriology 173: 697-703.

Wilson E.E., Zeitoun F.M., Fredrickson D.L., 1967. Bacterial phloem canker, a new disease of Persian walnut trees. Phytopathology 57: 618-621.

Wu B.J., Thompson S.T., 1984. Selective medium for Pseudomonas containing 9-chloro-9 (4-diethylaminophenyl)10-phenylacridan and polymixin β sulphate. Applied and Environmental Microbiology 48: 743-746.

Yabuuchi E., Kosako Y., Oyaizu H., Yano I., Hotta H., Hashimoto Y., Ezaki T., Arakawa M., 1992. Proposal of Burkholderia gen. nov. and transfer of seven species of the genus Pseudomonas homology group II to the new genus, with the type species Burkholderia cepacia (Palleroni and Holmes 1981) comb. nov. Microbiology and Immunology 36: 1251-1275.

Yohalem D.S., Lorbeer J.W., 1997. Distribution of Burkholderia cepacia phenotypes by niche, method of isolation and pathogenicity to onion. Annals of Applied of Biology 130: 467-479.