Microbiology World
Issue 11
www.microbiologyworld.com
May – June 2015
ISSN 2350 - 8774
www.facebook.com/MicrobiologyWorld
~1~
Microbiology World
Issue 11
May – June 2015
ISSN 2350 - 8774
Chief Editor Mr. Sagar Aryal (Founder) Ambassador, iversity M.Sc. Medical Microbiology St. Xavier’s College, Nepal
Editors Mr. Saumyadip Sarkar ELSEVIER Student Ambassador South Asia 2013 Ph.D Scholar (Human Genetics), India Mr. Avishekh Gautam Ph.D Scholar Hallym University, South Korea Mr. Manish Thapaliya Ph.D Scholar, China Mr. Hasnain Nangyal M.Phil. Department of Botany, Hazara University, Pakistan Mr. Sunil Pandey ELSEVIER Student Ambassador South Asia 2014 B.Sc. Medical Microbiology Nobel College, Kathmandu, Nepal
www.microbiologyworld.com
www.facebook.com/MicrobiologyWorld
~2~
Microbiology World
Issue 11
May – June 2015
ISSN 2350 - 8774
Table of Content Title
Page No.
Role and Significance Lactic acid bacteria in Food Soil Bacteria Live on Wine Grapes
4-6 7
Detection of Extended Spectrum Beta Lactamase (ESBL) Multidrug Resistant Escherichia coli Isolated from Urine Specimen of Urinary Tract Infections
8-18
The Mystery of Brain Leading to Confusion of Thoughts 19-20 When Biology meets Engineering: Renewable fuel from Hijacked E. coli Bacteria could go Mainstream
22-24
Role of PGPR in Sustainable Agriculture
25-28
Determining the probiotic potential of cholesterolreducing Lactobacillus
29-31
www.microbiologyworld.com
www.facebook.com/MicrobiologyWorld
~3~
Microbiology World
Issue 11
May – June 2015
ISSN 2350 - 8774
Role and Significance Lactic acid bacteria in Food Madiha Basit1 1
Department of Microbiology, Government College University, Faisalabad. Pakistan. Corresponding Email: madiha73basit@gmail.com
Introduction Lactic acid bacteria are mainly divided into two groups; Homo-fermentative lactic acid bacteria which produce two molecules of lactic acid from one molecule
of
glucose
and
hetero-
fermentative lactic acid bacteria which produces lactic acid, CO2 and ethanol from
one
molecule
of
glucose.
Pediococcus spp., Streptococcus spp. and
Lactococcus
spp.
are
homo-
fermentative while Leuconostoc spp.
Figure 1: Role of lactic acid bacteria
and Bifidobacterium spp. are heterofermentative. Some species of Lactobacillus are homo-fermentative and some are heterofermentative.
Use of Lactic acid bacteria Lactic acid bacteria are used due to its fermentative ability as well as their health and nutritional benefits. Originally lactic acid bacteria are isolated from grains, green plants, dairy and meat products, fermenting vegetables and the mucosal surfaces of animals and have commercial applications as starter cultures in dairy, meat, vegetable and alcoholic beverages industries. It www.microbiologyworld.com
www.facebook.com/MicrobiologyWorld
~4~
Microbiology World
Issue 11
May – June 2015
ISSN 2350 - 8774
produces various compounds such as organic acids, diacetyl, hydrogen peroxide, and bacteriocins or bactericidal proteins during lactic fermentations.
Lactic acid bacteria and their products give distinctive flavors, textures and aromas, preventing from spoilage, extending the shelf-life of food product and inhibit the pathogenic organisms. In yogurt, Lb. delbrueckii subsp. Bulgaricus, S. thermophiles are used. Lb. casei, Lb. acidophilus, Lb. rhamnosus, B. lactis are used in fermented, probiotic milk while Lb. lactis subsp. lactis, Lb. lactis subsp. Cremoris are used in cheese.
Lb. sakei, Lb. curvatus,
Pedicoccus spp., Streptococcus spp. and Leuconostoc spp. are used in fermented meat products. Lb. plantarum is used in fermentation of sauerkraut.
Antimicrobial activity of lactic acid bacteria Lactic acid bacteria have antimicrobial activity due to metabolites produced during the fermentation process. Organic acids such as lactic, acetic and propionic acids produced in this process which is unfavorable for the growth of many pathogenic and spoilage microorganisms. They inhibit both gram-positive and gram-negative bacteria as well as yeast and moulds. Acids exert their antimicrobial effect by interfering with the maintenance of cell membrane potential, inhibiting active transport of nutrients, reducing intracellular pH and inhibiting a variety of metabolic functions. Hydrogen peroxide is produced in the hetero0fermentative pathway which has strong oxidizing effect on membrane lipids and cellular proteins.
Bacteriocins are ribosomally synthesized antimicrobial compounds. These are produced by many members of the lactic acid bacteria. The target of bacteriocins is the cytoplasmic membrane. Because of LPS of the outer membrane of Gram-negative bacteria, these are only active against Gram-positive bacteria. Important targets of bacteriocine are Clostridium spp., Staphylococcus spp., Enterococcus spp., Bacillus spp. and Listeria monocytogenes.
Heath benefits of lactic acid bacteria Lactic acid bacteria have various health benefits such as they improve the digestion and have beneficial effect in lactose intolerance. In normal persons, β-glactosidase is produced which www.microbiologyworld.com
www.facebook.com/MicrobiologyWorld
~5~
Microbiology World
Issue 11
May – June 2015
ISSN 2350 - 8774
convert the lactose into glucose and glactose. In the absence of this enzyme the lactose is not digested and passes to the colon. Here it is attacked by the lactose-fermenting organisms and produce abdominal discomfort, flatulence and diarrhea. When lactase-deficient individuals take milk in a fermented form such as yogurt then adverse effects are less severe or absent. Foods exposed to lactic acid bacteria are broken down and pre-digested. So, the nutrients are more readily available for absorption and improves the biological value of foods.
Lactic acid bacteria also stimulate the immune system by activating the macrophages and lymphocytes, improving the levels of IgA and production of gamma interferon. Vitamin B 12 is also produced by lactic acid bacteria which are essential to blood-cell formation & DNA synthesis. L. acidophilus competes effectively against Heliobacter pylori for attachment sites. So, it provides protection against ulcers. Also reduces the levels of colon enzymes that convert pro-carcinogens to carcinogens by taking up nitrites and by reducing the levels of secondary bile salts. L. acidophilus has hypo-cholesterolemic effects, can take up cholesterol in the presence of bile or cholesterol can precipitate with free bile salts in the presence of L. acidophilus.
Conclusion Due to the flavor, texture, aroma formation, antimicrobial activity and various health benefits, the lactic acid bacteria are widely used in food products.
References Jay, J. M., Loessner, M. J., & Golden, D. A. (2005). Modern Food Microbiology (7th ed.). New York: Springer. Adams, M. R., & Moss, M. O. (2008). Food Microbiology (3rd ed.). UK: The Royal Society of Chemistry. Lee, B. H. (2015). Fundamentals of Food biotechnology (2nd ed.). UK: John Wiley & Sons Ltd.
www.microbiologyworld.com
www.facebook.com/MicrobiologyWorld
~6~
Microbiology World
Issue 11
May – June 2015
ISSN 2350 - 8774
Soil Bacteria Live on Wine Grapes Dr. Bireshwar Bera 1 1
Assistant Professor, Department of Zoology, St. Joseph’s College, Darjeeling- 734104, West Bengal, India
The earthiness of Merlot may have to do with grapevine-dwelling microbiota The fruits, flowers, and leaves on Merlot grapevines harbor bacterial taxa present in the surrounding soil, according to a study published this week (March 24) in mBio. Researchers suspect bacterial communities specific to a vine’s location may affect the flavor of wine made from those grapes. “Where you grow that particular grapevine is the most important characteristic shaping which bacteria will colonize the plant,” study coauthor Jack Gilbert, a microbial ecologist at Argonne National Laboratory, said in a press release. The idea of “terroir”—that the land shapes a wine’s qualities—is an old one, but Gilbert said that the microbiome is not usually included as one of the influencing factors. “From the wine industry’s perspective, terroir comes from the plant’s physiology, the chemical nature of the grapes, and the yeast that do the fermenting work,” he said. “We don’t have evidence that bacteria are specifically contributing to terroir, but our next step is to figure out how those bacteria are affecting the chemistry of the plant.”
Hat tip: Science News. www.microbiologyworld.com
www.facebook.com/MicrobiologyWorld
~7~
Microbiology World
Issue 11
May – June 2015
ISSN 2350 - 8774
Detection of Extended Spectrum Beta Lactamase (ESBL) Multidrug Resistant Escherichia coli Isolated from Urine Specimen of Urinary Tract Infections Ranjutha Valiappan1 1
Faculty of Biomedical and Health Sciences, University Selangor (Unisel), Shah Alam
Campus, Jalan Zircon A7/A, Section 7, Shah Alam, Selangor Darul Ehsan, Malaysia.
Abstract The prominence of extended-spectrum β-lactamase (ESBL) in manufacturing of E. coli with high virulence factor showing the prevalence of MDR among E. coli isolates is rising. This lead to the increasing in occurrence of community and nosocomial acquired infections which are caused by UPEC. This incidence must have considered seriously because it causing to an increase in morbidity and mortality. A very less quantity or number of E. coli resistance gene is capable to cause for parenchymatous urinary attacks. Therefore, this detection and systematic observation of the similarities genomic studies are emanated to identify E. coli resistance gene causing for the existing of urinary tract infections and by that can determine physiopathology of the infection. This studies became very beneficial in order to improve our necessary understanding on MDR mechanism which is encoded by UPEC and as well as in the designing of more intended drugs.
Introduction Multidrug resistance (MDR) in bacteria is increasing to the level where multidrug resistance bacteria threaten the effective prevention and treatment. The standard treatments become ineffective, so infections continue increase the risk of spread to other by having the quality to withstand the attack from antibacterial drugs. And this lead to an increasing range of infections www.microbiologyworld.com
www.facebook.com/MicrobiologyWorld
~8~
Microbiology World
Issue 11
May – June 2015
ISSN 2350 - 8774
caused by bacteria. MDR was defined as acquired non-susceptibility to at least one agent in three or more antimicrobial categories. For the definition of MDR, non-susceptibility refers to either it resistant, intermediate or can also obtained from in vitro antimicrobial susceptibility testing. The purpose of this definition can aid in reference, clinical and as well in public health microbiology laboratories into grading various antimicrobial resistant profiles by using a common terminology (Magiorakos et al., 2012). The seriousness of MDR bacteria related to the amount of antibiotics and effectiveness of the used. Patients with the infections that caused by the MDR bacteria are basically at the higher risk of worse clinical outcomes and death. As in WHO’s 2014 report on global Surveillance of Antimicrobial resistance reveals that antibiotic resistance is happening right now across all over the world and it is no longer to be prediction. That is the reason why it came to common place to hear about MDR bacteria. High regulation of MDR leads to common infections, such as urinary tract infection, pneumonia, bloodstream infections. Those
are
found
in
all
regions
of
the
world
(http://www.who.int/drugresistance/documents/surveillancereport/en).
The Multidrug Resistant Organisms (MDROs) can be classified into five group. The main MDROs are extended spectrum β-lactamase (ESBL) Enterobacteriaceae which are related to antimicrobial resistance. ESBL’s are enzymes that is developed too many antibiotics mainly in β-Lactam family. Continue with second group is Methicillin-Resistant Staphylococcus Aureus (MRSA). Third group is Carbapenemases that involving with enzymes as well where they are ESBL’s with versatile hydrolytic capacities that inactivate β-lactam antibiotics and the use of carbapenems increasing with the spread of ESBL’s which causes for the increasing in development of carbapenemases. Other that included also Vancomycin Resistant Enterococci (VRE) and Clostridium difficile. Clostridium difficile is occurring because of the ability to produce greater quantities of toxin A and B. β-lactam antimicrobial agents display the most general treatment for the infections by bacteria and it persists to be the well known which causes to show resistance to β-lactam antibiotics between Gram negative bacteria internationally. As the bacterial strains continue exposure to a massive amount of β-lactam, has triggered active and continue in the production and also www.microbiologyworld.com
www.facebook.com/MicrobiologyWorld
~9~
Microbiology World
Issue 11
May – June 2015
ISSN 2350 - 8774
mutation of β-lactamases. These conditions lead to the increasing of their activity to the extent even towards the β-lactam antibiotics that is newly developed. This is due to the enzymes which make them resistance to the antibiotic and the enzymes known as extended spectrum βlactamases (ESBLs) that is produced by certain bacteria or germs (Pitout & Laupland, 2008). Hence the cure for these multiple drug resistant bacteria became major scientific concern as the occurrence of ESBL producing bacteria is complicate in overcome them because of a range of reasons, they are very hard to detect as well as reporting. Lately, a major raise in the occurrence of infections that related to ESBL has been experimental all over the global (Bakshi et al., 2013).
Materials and methods Bacteria sample Total 50 isolates of E.coli bacterial were collecting.
Antibiotics susceptibility testing Antibiotic susceptibility test is performed on the Mueller Hinton Agar (MHA) on all isolates by disc diffusion technique by Kirby Bauer based on the Clinical Laboratory Standard Institutions (CLSI) guidelines. The following antibiotic disks were used, ampicillin (10 μg), piperacillin (100 μg), cefoperazone (75 μg), cefoxitin (30 μg), ceftazidime (30 μg), cefotaxime (30 μg), ceftriaxone (30 μg), cefepime (30 μg), aztreonam (30 μg), imipenem (10 μg), amikacin (30 μg), gentamicin (10 μg), ciprofloxacin (30 μg), ofloxacin (5 μg), norfloxacin (10 μg), and nitrofurantoin (300 μg). E.coli ATCC 35218 will be used as positive control in the AST. Interpretation by measuring the diameter of zone of inhibition and recorded in millimeters with the help of sliding calipers and organism was labeled as sensitive, resistant, or intermediate as per CLSI 2012 guidelines (Table 1).
www.microbiologyworld.com
www.facebook.com/MicrobiologyWorld
~ 10 ~
Microbiology World
Issue 11
May – June 2015
ISSN 2350 - 8774
Table 1: Zone diameter interpretative criteria for E. coli
ANTIBIOTIC DISC Penicillins Ampicillin Piperacillin
SENSITIVE
INTERMEDIATE RESISTANT
≥17 ≥21
14–16 18–20
≤13 ≤17
Cephems (Parenteral) Cefoperazone Cefoxitin Ceftazidime Cefotaxime Ceftriaxone Cefepime
≥21 ≥18 ≥21 ≥26 ≥23 ≥18
16–20 15–17 18–20 23–25 20–22 15–17
≤15 ≤14 ≤17 ≤22 ≤19 ≤14
Monobactam Aztreonam
≥21
18–20
≤17
Carbapenem Imipenen
≥23
20–22
≤19
Aminoglycosides Gentamicin Amikacin
≥15 ≥17
13–14 15–16
≤12 ≤14
Flouroquinolones Ciprofloxacin Ofloxacin Norfloxacin
≥21 ≥16 ≥17
16–20 13–15 13–16
≤15 ≤12 ≤12
Nitrofuran Nitrofurantoin
≥17
15–16
≤14
www.microbiologyworld.com
www.facebook.com/MicrobiologyWorld
~ 11 ~
Microbiology World
Issue 11
May – June 2015
ISSN 2350 - 8774
E.coli identification by Serotyping Serotyping is carrying out on E.coli isolates. Strains which is motile but that did not react with O or H antiserum were classified as nontypable (nt) means O(nt) and H(nt), respectively (Brown Z et al., 2013).
Detection of MDR- ESBL E.coli by PCR Preparation of genomic DNA The genomic DNA is isolated from the bacteria cells using a loopful colony are suspended in 100µl of sterile distilled water into the 1.5ml Eppendorf tube and vortex the tube for about 5 – 10 second. Than the tube is floated in boiling water for approximately 10 minutes and next placed about 5 minutes on the chilled ice. Centrifuge the tube at 12000 rpm for 2 minutes. Remove the supernatant and used directly as template DNA for the PCR mixture (Massoud et al., 2007). The purified DNA is stored at -20 ̊ C if not going to run with PCR mixture at the time.
The Concentration of DNA is predictable by measuring the absorbance at 260nm, adjusting the measurement of A260 for turbidity (measured by absorbance at 320nm), multiplying by the dilution factor, and using the relationship that an A260 of 1.0 = 50µg/ml pure dsDNA. Concentration (µg/ml) = (A260 reading – A320 reading) × dilution factor × 50µg/ml
Total yield is obtained by multiplying the DNA concentration by the final total purified sample volume.
DNA yield (µg) = DNA concentration × total sample volume (ml) (Promega Corporation, http://www.promega.com/pubhub)
www.microbiologyworld.com
www.facebook.com/MicrobiologyWorld
~ 12 ~
Microbiology World
Issue 11
May – June 2015
ISSN 2350 - 8774
Oligonucleotides for ESBL gene The primer sequences for the detection of extended-spectrum β-lactamase gene in E.coli are adopted from the previous studies (El-mohammady et al., 2015). Table 2. Polymerase chain reaction (PCR) primer sequences for the detection of extendedspectrum β-lactamases gene in E.coli.
Table 2: Polymerase chain reaction (PCR) primer sequences for the detection of extended-spectrum β-lactamases gene in E.coli.
Target gene
Oligonucleotide primer sequences (5’ to 3’)
blaTEM-1F
CAGCGGTAAGATCCTTGAGA
blaTEM-1R
ACTCCCCGTCGTGTAGATAA
blaSHV-1F
GGCCGCGTAGGCATGATAGA
blaSHV-1R
CCCGGCGATTTGCTGATTTC
blaOXA-1F
AATGGCACCAGATTCAACTT
blaOXA-1R
CTTGGCTTTTATGCTTGATG
blaCTX-M-1F
GAAGGTCATCAAGAAGGTGCG
blaCTX-M-1R
GCATTGCCACGCTTTTCATAG
Amplicon size (bp)
643
714
599
560
Detection of targeted gene by PCR The purified bacterial DNA is than take for the detection of targeted gene via uniplex polymerase chain reaction (PCR). Table 2 below shows the primers to be use for the detection. The amplification of PCR in a 50µl, the extracted DNA is added with mixture which is containing 50 pmol primers, 0.25Mm deoxyribonucleotide, 1.5Mm MgCl2, Taq reaction buffer and 0.2U Taq DNA polymerase of Nexpro brand. Thermocycler are used to perform the amplification which coordinates with cyclic parameters. Amplification conditions incorporated 30 cycles which www.microbiologyworld.com
www.facebook.com/MicrobiologyWorld
~ 13 ~
Microbiology World
Issue 11
May – June 2015
ISSN 2350 - 8774
is begin with denaturation at 95 ̊ C for 30 sec follow by annealing for 1 min at 55 ̊ C than with amplification at 72 ̊ C for 1 min as well and this follow by a final extension step at 72 ̊ C for about 5 to 15 min (El-mohammady et al., 2015).
Gel documention The amplified DNA is than separated with 1.5% agarose gel and visualize by staining with GelRed as substitution for ethidium bromide (El-mohammady et al., 2015).
Expected outcome
Figure above show PCR amplified fragments blaTEM (on left of the ladder and blaSHV (on right of the ladder)
Acknowledgments I wish to thank my supervisor Mdm.Norhatiah binti Md Lias and co-supervisor Ms.Rozila Alias. Also Laboratory Halal University Selangor for giving me space to carry out my entire project.
www.microbiologyworld.com
www.facebook.com/MicrobiologyWorld
~ 14 ~
Microbiology World
Issue 11
May – June 2015
ISSN 2350 - 8774
References 1. Alhashash, F., Weston, V., Diggle, M., & McNally, A. (2013). Multidrug-resistant Escherichia coli bacteremia. Emerging Infectious Diseases, 19(10), 1699–1701. doi:10.3201/eid1910.130309 2. Amin, M., Mehdinejad, M., & Pourdangchi, Z. (2009). Study of bacteria isolated from urinary tract infections and determination of their susceptibility to antibiotics, 2, 118–123. 3. Bakshi, R., Walia, G., & Jain, S. (2013). Prevalence of extended spectrum β Lactamases in multidrug resistant strains of gram negative Bacilli, 1(February), 558–560. 4. Benton, B., Breukink, E., Visscher, I., Debaboy, D., Lunde, C., Janc, J., Mammen, M., Humphrey, P., 2007. Telavancin inhibits peptidoglycan biosynthesis through preferential targeting of transglycosylation: evidence for a multivalent interaction between telavancin and lipid II. Int . J. Antimicrob. Agents 29,51-52. 5. Bien, J., Sokolova, O., & Bozko, P. (2012). Role of uropathogenic escherichia coli virulence factors in development of urinary tract infection and kidney damage. International Journal of Nephrology, 2012. doi:10.1155/2012/681473 6. Brown Z, Selke S, Zeh J, K. J. (2013). Journal Medicine ©, 337(14), 509–515. 7. Bush, K. (2001). New b -Lactamases in Gram-Negative Bacteria : Diversity and Impact on the Selection of Antimicrobial Therapy, 32, 1085–1089. doi:10.1086/319610 8. Bush, K., Jacoby, G.A., Medeiros, A.A., 1995. A functional classification scheme for beta-lactamases and its correlation with molecular structure. Antimicrob. Agents Chemother. 39,1211-1233. 9. Datta, N., Kontomichalou, P., 1965. Penicillinase synthesis controlled by infectious R factor in Enterobacteriaceae. Nature 208, 239-241. 10. Dubois, S.K., Marriott, M.S., Amyes, S.G., 1995. TEM and SHV derived extendedspectrum beta-lactamases: relationship between selection, structure and function. J. antimicrob. Chemother. 35,7-22. 11. El-mohammady, H., Khalek, R. A., & Ghenghesh, K. S. (2015). Multidrug resistance and extended-spectrum b -lactamases genes among Escherichia coli from patients with urinary tract infections in Northwestern Libya, 1, 1–7.
www.microbiologyworld.com
www.facebook.com/MicrobiologyWorld
~ 15 ~
Microbiology World
Issue 11
May – June 2015
ISSN 2350 - 8774
12. Finer, G., & Landau, D. (2004). Pathogenesis of urinary tract infections with normal female anatomy. Lancet Infectious Diseases, 4(10), 631–635. doi:10.1016/S14733099(04)01147-8 13. Hu, Y. Y., Cai, J. C., Zhou, H. W., Chi, D., Zhang, X. F., Chen, W. L., … Chen, G. X. (2013).
Molecular
typing
of
CTX-M-Producing
Escherichia
coli
isolates from
environmental water, swine feces, specimens from healthy humans, and human patients.
Applied
and
Environmental
Microbiology,
79(19),
5988–5996.
doi:10.1128/AEM.01740-13 14. Johnson, T. J., & Nolan, L. K. (2009). Pathogenomics of the virulence plasmids of Escherichia coli. Microbiology and Molecular Biology Reviews : MMBR, 73(4), 750–774. doi:10.1128/MMBR.00015-09 15. Kaper, J. B., Nataro, J. P., & Mobley, H. L. (2004). Pathogenic Escherichia coli. Nature Reviews. Microbiology, 2(February), 123–140. doi:10.1038/nrmicro818. 16. Livermore, D.M., 1995. Beta-lactamases in laboratory and clinical resistance. Clin. Microb. Rev. 8,557-584. 17. Magiorakos, a. P., Srinivasan, a., Carey, R. B., Carmeli, Y., Falagas, M. E., Giske, C. G., … Monnet, D. L. (2012). Multidrug-resistant, extensively drug-resistant and pandrugresistant bacteria: An international expert proposal for interim standard definitions for acquired
resistance.
Clinical
Microbiology
and
Infection,
18(3),
268–281.
doi:10.1111/j.1469-0691.2011.03570.x 18. Marrs, C. F., Zhang, L., & Foxman, B. (2005). Escherichia coli mediated urinary tract infections: Are there distinct uropathogenic E. coli (UPEC) pathotypes? FEMS Microbiology Letters, 252(2), 183–190. doi:10.1016/j.femsle.2005.08.028 19. Massoud, B. Z., Sherbini, E. A. El, Rizk, N. G., & Arafa, S. A. (2007). Characterization of Uropathogenic Escherichia coli Strains Isolated from Community Acquired and Hospital Acquired Infections in Alexandria, 16(3), 513–520. 20. Paterson, D.L., Bonomo, R.A., 2005. Extended-spectrum betalactamases; a clinical update. Clin. Microbiol. Rev. 18,657-686.
www.microbiologyworld.com
www.facebook.com/MicrobiologyWorld
~ 16 ~
Microbiology World
Issue 11
May – June 2015
ISSN 2350 - 8774
21. Philippon, L.N., Naas, T ., Bouthors, A.T., Barakett, V., Nordmann, P., 1997. OXA-18, a class D clavulanic acid-inhibited extendedspectrum beta lactamases from Pseudomonas aeruginosa. Antimicrob. Agents Chemother. 41, 2188-2195. 22. Pitout, J. D. D., & Laupland, K. B. (2008). Extended-spectrum beta-lactamase-producing Enterobacteriaceae: an emerging public-health concern. The Lancet. Infectious Diseases, 8(March), 159–166. doi:10.1016/S1473-3099(08)70041-0 23. Rupp, M. E., & Fey, P. D. (2003). Extended spectrum beta-lactamase (ESBL)-producing Enterobacteriaceae: considerations for diagnosis, prevention and drug treatment. Drugs, 63(4), 353–365. doi:10.2165/00003495-200363040-00002 24. Shaikh, S., Fatima, J., & Shakil, S. (2015). Antibiotic resistance and extended spectrum beta-lactamases : Types , epidemiology and treatment. Saudi Journal of Biological Sciences, 22(1), 90–101. doi:10.1016/j.sjbs.2014.08.002 25. Soto, S. M., Smithson, a., Horcajada, J. P., Martinez, J. a., Mensa, J. P., & Vila, J. (2006). Implication of biofilm formation in the persistence of urinary tract infection caused by uropathogenic Escherichia coli. European Society of Clinical Infectious Diseases, 12(10), 1034–1036. doi:10.1111/j.1469-0691.2006.01543.x 26. Soughakoff, W., Goussard, S., Courvalin, P., 1988. TEM-3 betalactamaseswhich hydrolyzes broad-spectrum cephalosporins is derived from the TEM-2 penicillinases by two amino acid substitutions. FEMS Microbiol. Let. 56,343-348. 27. Stamm, W. E. (1982). Recent developments in the diagnosis and treatment of urinary tract infections. The Western Journal of Medicine, 137(3), 213–20. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/6755913. 28. Stamm, W. E., & Norrby, S. R. (2001). Urinary tract infections: disease panorama and challenges. The Journal of Infectious Diseases, 183 Suppl , S1–S4. doi:10.1086/318850. 29. Straus, S.K., Hancock, R.E.W., 2006. Mode of action of the new antibiotic for grampositive pathogens daptomycin: comparison with cationic antimicrobial peptides and lipopeptide. Biochim. Biophys. Acta 1758,1215-1223. 30. Strohl, W.R., 1997. BiotechAntibiotics. Marcel Dekker Inc., New York, USA.
www.microbiologyworld.com
www.facebook.com/MicrobiologyWorld
~ 17 ~
Microbiology World
Issue 11
May – June 2015
ISSN 2350 - 8774
31. Thenmozhi, S., Moorthy, K., Sureshkumar, B. T., & Suresh, M. (2014). Antibiotic Resistance Mechanism of ESBL Producing Enterobacteriaceae in Clinical Field : A Review, 2(3), 207–226. 32. Tzouvelekis, L.S., Bonomo, R.A. 1999. SHV-type b-lactamases. Curr. Pharm. Des. 5, 847-864. 33. Weldhagen, G.F., Poirel, L., Nordmann, P., 2003. Ambler class A extended-spectrum beta-lactamases in Pseudomonas aeruginosa: novel developments and clinical impact. Antimicrob. Agents Chemother. 47,2385-2392.
www.microbiologyworld.com
www.facebook.com/MicrobiologyWorld
~ 18 ~
Microbiology World
Issue 11
May – June 2015
ISSN 2350 - 8774
The Mystery of Brain Leading to Confusion of Thoughts Radha Govind Neha Nidhi The
foggy night in subconscious dreams
with the chaos wrapped,strong
imaginations
mesmerized with some unusual sounds ,disturbed the patient in scare.He got up so frightened and in the moment in a high fever.He couldn’t realize was it a dreams,the past memory long back or was that a future self imagination.The brain neurons left him unanswered,trembled and confused.He couldn’t do anything but left with an interrogative,frightened,perspiring teary face.
It is really difficult to understand the emotion difference between the past memory running in the neurons and the future imaginations.It was previously considered that the frontal lobe of brain is solely responsible for high level decisions,thoughts and imaginations but the fMRI scan demonstrated that many other areas are responsible for the activities like memory recapitulation and the self imaginations
.Moreover
the
fMRI
scan
pictures of these two activities were found to be similar.The neurons carrying frequent information in blood tremendous speed in the game of the same parts of brain ,then what leads the brain to understand the differences in the thoughts hovering around in the brain every flash of seconds?
Brain being the most intricate,complicated and powerful part the fundamental core of the nervous system is responsible functions.Mankind’s
for both lower order functions and the higher order
interest in unlocking the mysteries of the brain could be seen even
www.microbiologyworld.com
www.facebook.com/MicrobiologyWorld
~ 19 ~
Microbiology World
Issue 11
May – June 2015
ISSN 2350 - 8774
thousands of years ago.When Herophilus,the first known anatomist posited that the brain was the seat of intelligence Aristotle,on the other hand ,posited that the brain’s function was to cool blood.
Magnetic resonance imaging(MRI) uses radio waves and a strong magnetic field to identify regions of the brain where blood vessels are expanding,chemical changes taking place or extra oxygen is being delivered.These are indications that a particular part of the brain is processing information and giving commands .As a patient performs a particular tasks the metabolism increases in the brain area responsible for that task ,changing the signal in the MRI image .So by performing specific tasks that correspond to different functions,scientists can locate the part of the brain that governs that function.
The thoughts which comes as a part of our thinking or some imaginations is sometimes undifferentiated from the past memories in the subconscious mind in sleep and we often get scared getting confused and many a times taking it as something happening real to us at that moment.It’s the game of the same areas of brain which play to provide us thoughts and ideas through tremendously fast neurotransmitters.
Researchers say besides furthering their understanding of the brain- the finding may help research into amnesia, a curious psychiatric phenomenon.In addition to not being able to remember the past,most people who suffer from amnesia cannot envision or visualize what they’ll be doing in the future – even the next day.The mystery of understanding the mysterious brain has only remained a mystery still awaites to be resolved in the long future .when it would still leave us with the confusion that these trials we did were our memories or is it just an imagination !!!
www.microbiologyworld.com
www.facebook.com/MicrobiologyWorld
~ 20 ~
Microbiology World
Issue 11
www.microbiologyworld.com
May – June 2015
ISSN 2350 - 8774
www.facebook.com/MicrobiologyWorld
~ 21 ~
Microbiology World
Issue 11
May – June 2015
ISSN 2350 - 8774
When Biology meets Engineering: Renewable fuel from Hijacked E. coli Bacteria could go Mainstream Lester C. Recio People need energy. A world without energy is unimaginable. For giving us the access of electricity in our homes, powering up our vehicles that provide transportation, manufacturing goods and giving services—we can say at this point, energy is indeed getting identical to our one of the biggest necessities, the food we eat.
However, the world runs into a big plot twist. We are getting hungrier and hungrier for energy and the energy resources we have, specifically, the fossil fuels such as coal, oil and natural gas are finite and are getting depleted.
The
conflict
may
arise
while
competing for the last remaining fossil fuels in the near future.
At this point, scientists are currently looking for the methods by which we could have replaced the massive use of nonrenewable energy sources to renewable energy sources for a vast and inexhaustible energy supply, for a more reliable and resilient energy system, and for less global warming emission.
Some of these methods are already applied, but these are yet to be considered as mainstream. Converting renewable energy into electricity is one thing; converting it into fuel is another.
www.microbiologyworld.com
www.facebook.com/MicrobiologyWorld
~ 22 ~
Microbiology World
Issue 11
May – June 2015
ISSN 2350 - 8774
A team of researchers from Imperial College London in London and Turku University in Finland has successfully hijacked a common intestinal bacterium, Escherichia coli (E. coli) to produce renewable propane. This diverse group of bacteria which normally lives in the intestines and helps the human body to break down and digest food we eat, is commonly known for causing food poisoning symptoms when ingested. In searching for a renewable fuel process that could be economically sustainable, they focused on propane, a component of liquid petroleum gas for it was became a target for several reasons, and in fact, it’s a gas that they could easily separate the finished product. The microbes that produced the propane would be left behind and the fuel will escape as a gas. There’s no need for messy separation.
Propane derived from fossil fuels is already produced as a by-product during natural gas processing and petroleum refining, but these are finite resources, unlike in Propane produced by E. coli bacteria are renewable sources.
The researchers can only produce small amount of propane for the moment, but, if the development can be scaled up to a commercially viable process, it could become a sustainable alternative to fossil fuels. Researchers said it could be ready for commercial production within ten years.
According to the researcher Patrik Jones, the lead author of the study from Turku University, renewable propane is not created through natural reactions—no organisms naturally produce propane in the way humans breathe out CO 2 or trees exhale oxygen. They therefore turned to synthetic biology, where Biology meets Engineering, to make this occurrence possible. They chose E. coli because it is easy to engineer and also of its ability to produce fatty acids, where in fact, Biofuels are consist of long chain fatty acids that are usually derived from vegetable oils or animal fats, but the bacterium’s ability to make fatty acids wasn’t merely enough to make the propane. In this case, the scientists had to design a propane biosynthetic pathway that does not exist in E. coli. To do so, they had to take genes from multiple bacteria: www.microbiologyworld.com
www.facebook.com/MicrobiologyWorld
~ 23 ~
Microbiology World
Issue 11
May – June 2015
ISSN 2350 - 8774
Bacteroides fragilis, Mycobacterium marinum, Bacillus subtilis, and Prochlorococcus marinus and engineer them into the E. coli that it finally tricked the bacteria into making propane instead of cell membranes. “Although we have only produced tiny amounts so far, the fuel we have produced is ready to be used in an engine straight away,” researcher Jones, said in his statement. “This opens up possibilities for future sustainable production of renewable fuels that at first could complement, and thereafter replace fossil fuels like diesel, petrol, natural gas and jet fuel,” he said. The discovery is one step closer to his goal, which is able to use the genetically engineered system to convert solar energy into propane-like fuel. “At the moment, we don’t have a full grasp of exactly how the fuel molecules are made, so we are now trying to find out exactly how this process unfolds… I hope that over the next five to ten years we will be able to achieve commercially viable processes that will sustainably fuel our energy demands,” he said.
The researchers published their study in the journal Nature Communications. Facts based on Patrik Jones’ How we tricked E. coli bacteria into making renewable propane
Photo Credit: Ap Photo/Pa-Adam Butler
www.microbiologyworld.com
www.facebook.com/MicrobiologyWorld
~ 24 ~
Microbiology World
Issue 11
May – June 2015
ISSN 2350 - 8774
Role of PGPR in Sustainable Agriculture Meenu Assistant professor, Department of Agriculture, Baba Farid College, Bathinda, Punjab, India. Corresponding E.mail: meet.shrma90@gmail.com
Sustainable agriculture plays an inevitable role worldwide as it offers the potential to meet our future agricultural needs which our conventional agriculture system is unable to do. It is an act of farming using principles of ecology, the study of relationships between organisms and their environment. It is an integrated system of plant and animal production practices having a sitespecific application that will last over the long term. PGPRs (Plant growth-promoting rhizobacteria) offer a great and attractive alternative that contains the possibility of developing more sustainable approaches to agriculture.
Kloepper and Schroth coined the term PGPR for the first time to describe the microbial population in the rhizosphere which is beneficial, colonize plant roots and shows plant growth promotion activity. PGPR are naturally occurring soil bacteria that aggressively colonize plant roots and benefit plants by influencing the growth, yield and nutrient uptake. Various species of bacteria like Pseudomonas, Azospirillum, Azotobacter, Alcaligenes, Klebsiella, Enterobacter, Burkholderia, Bacillus and Serratia have been reported as PGPRs. They help in increased supply of phosphorus, sulphur, iron and copper; produce plant hormones; enhance other beneficial bacteria or fungi; control fungal and bacterial diseases and help in controlling insect pests.
Increasing concern about the natural environment demands a developed strategy for its maintenance. So our scientists are developing much research interest in PGPR. To date, an increasing number of PGPR have been commercialized for various crops such as for suppression of plant disease (Bioprotectants), improved nutrient acquisition (Biofertilizers), or phytohormone production (Biostimulants). PGPR can act as excellent model systems which can
www.microbiologyworld.com
www.facebook.com/MicrobiologyWorld
~ 25 ~
Microbiology World
Issue 11
May – June 2015
ISSN 2350 - 8774
provide the biotechnologist with novel genetic constituents and bioactive chemicals having diverse uses in agriculture and environmental sustainability.
Ideal characters for microbes to be considered as PGPR 1. They must be efficient enough to colonize rhizosphere. 2. They must survive, multiply and compete with other microbiota present in the vicinity of plant roots. 3. They must promote plant growth. Various Mechanisms followed by PGPR
Direct mechanisms 1. Production of stimulatory bacterial volatiles and phytohormones. 2. Lowering of the ethylene level in plants. 3. Improvement of the plant nutrient status by biological nitrogen fixation and liberation of phosphates and micronutrients from insoluble sources. 4. Siderophores produced by some PGPR scavenge heavy metal micronutrients in the rhizosphere (e.g. iron). Plants commonly excrete soluble organic compounds (chelators and phytosiderophores) which bind Fe +3 and reduced it to Fe+2 which are immediately absorbed through root surface.
Indirect mechanisms 1. PGPR as biocontrol agents reducing various plant diseases when they stimulate other beneficial symbioses and protect the plant by degrading xenobiotics in contaminated soils. 2. Mitigation of abiotic stresses like drought, salt and fertility stress by PGPR through stimulation of disease resistance mechanism i.e. Induced Systemic Resistance (ISR). Antibiotic production by PGPR releases compounds that prevent the growth of the pathogens. For eg. Pseudomonas fluorescens CHA0, the GacS/GacA system is essential for the production of antibiotic compounds against plant pathogens. www.microbiologyworld.com
www.facebook.com/MicrobiologyWorld
~ 26 ~
Microbiology World
Issue 11
May – June 2015
ISSN 2350 - 8774
Figure 1: Basic Mechanism involved in plant growth promotion by rhizobacteria
Commercial Use of PGPR in Agriculture Several criteria must be followed for the commercial development of PGPR: effectiveness against target organisms, quality control, production costs, inoculum formulation, product safety and value of crops to be treated. The following table 1 represents commercialized PGPR as biocontrol agents with their brand name.
Future prospects PGPR have spectacular role in sustainable agriculture. Their productive efficiency can be further enhanced with the optimization and acclimatization according to the prevailing soil www.microbiologyworld.com
www.facebook.com/MicrobiologyWorld
~ 27 ~
Microbiology World
Issue 11
May – June 2015
ISSN 2350 - 8774
conditions. In future, they are expected to replace the chemical fertilizers, pesticides and artificial growth regulators which have numerous side-effects to sustainable agriculture.
References 1. Ahemad, M. & Kibret, M. 2014 Mechanisms and applications of plant growth promoting rhizobacteria: Current perspective. J. King Saud Uni. Sci. 26, 1-20. 2. Akhtar, A., Hisamuddin, Robab, M. I., Abbasi & Sharf, R. 2012 Plant growth promoting Rhizobacteria: An overview. J. Nat. Prod. Plant Resour. 2, 19-31. 3. http://en.wikipedia.org/wiki/Sustainable_agriculture 4. Nandal, M. & Hooda, R. 2013 Plant growth promoting rhizobacteria: A review article. Int. J. Curr. Res. 5, 3863-3871. www.microbiologyworld.com
www.facebook.com/MicrobiologyWorld
~ 28 ~
Microbiology World
Issue 11
May – June 2015
ISSN 2350 - 8774
Determining the probiotic potential of cholesterol-reducing Lactobacillus Abhishek Negi Corresponding E-mail: abhisheknegi1995@yahoo.com
Excess cholesterol is associated with cardiovascular diseases (CVD), an important cause of mortality worldwide. Current CVD therapeutic measures, lifestyle and dietary interventions, and pharmaceutical agents for regulating cholesterol levels are inadequate. Probiotic bacteria have demonstrated potential to lower cholesterol levels by different mechanisms, including bile salt hydrolase activity, production of compounds that inhibit enzymes such as 3-hydroxy-3methylglutaryl coenzyme A, and cholesterol assimilation. Probiotics are living microorganisms that, upon ingestion in high amounts, exert health effects beyond inherent basic nutrition. Many patients prefer nondrug treatments for hyperlipidemia for many reasons, including the adverse effects of antilipid drugs, contraindications to drugs or personal preference for natural or alternative therapies.
So a study was done to evaluate the probiotic potential of lactic acid bacteria (LAB) isolated from traditionally fermented south Indian koozh and gherkin (cucumber). A total of 51 LAB strains were isolated, among which four were identified as Lactobacillus spp. and three as Weissella spp. All isolated Lactobacillus and Weissella strains were capable of surviving under low pH and bile salt conditions. GI9 and FKI21 were able to survive at pH 2.0 and 0.50% bile salt for 3 h without losing their viability. All LAB strains were able to deconjugate bile salt. Higher deconjugation was observed in the presence of sodium glycocholate (P < 0.05). GI9 (58.08 Îźg/ml) and FKI21 (56.25 Îźg/ml) exhibited maximum cholesterol reduction with bile salts. 16S rRNA sequencing confirmed GI9 and FKI21 as Lactobacillus crispatus and Weissella koreensis, respectively.
www.microbiologyworld.com
www.facebook.com/MicrobiologyWorld
~ 29 ~
Microbiology World
Issue 11
May – June 2015
ISSN 2350 - 8774
A similar research on cholesterol assimilation was investigated in culture media and under simulated intestinal conditions. The best cholesterol assimilator was L. plantarum ATCC 14917 (15.18 ± 0.55 mg/1010 cfu) in MRS broth. L. reuteri NCIMB 701089 assimilated over 67% (2254.70 ± 63.33 mg/1010 cfu) of cholesterol, the most of all the strains, under intestinal conditions. This work demonstrates that probiotic bacteria can assimilate cholesterol under intestinal conditions, with L. reuteri NCIMB 701089 showing great potential as a CVD therapeutic.
Schematic representation of probiotic cholesterol assimilation mechanism (a) Cholesterol absorption by the intestinal enterocytes increases cardiovascular disease risks. (b) Probiotic administration enhances cholesterol assimilation, leading to the excretion of nonmetabolized cholesterol and other lipid molecules decreasing cardiovascular disease risks. If organisms located in the intestine can assimilate some of the cholesterol ingested in the diet and make it unavailable for absorption into the blood. The cholesterol-lowering effect of probiotics has been partly attributed to their ability to bind cholesterol in the small intestine.
www.microbiologyworld.com
www.facebook.com/MicrobiologyWorld
~ 30 ~
Microbiology World
Issue 11
May â&#x20AC;&#x201C; June 2015
ISSN 2350 - 8774
Probiotic bacteria are advantageous as they are naturally found in foods such as yoghurt, are inexpensive, and are generally regarded as safe. Finally, Cholesterol assimilation by probiotic bacteria in the gastrointestinal tract would allow for the reduction of cholesterol absorption by enterocytes and excretion of the cholesterol from the host, as depicted in Figure.
References 1.
http://www.ncbi.nlm.nih.gov/pubmed/25839996
2.
http://www.hindawi.com/journals/bmri/2014/380316/
www.microbiologyworld.com
www.facebook.com/MicrobiologyWorld
~ 31 ~
Microbiology World
Issue 11
May â&#x20AC;&#x201C; June 2015
ISSN 2350 - 8774
You can also send your articles to
info@microbiologyworld.com Selected ones will be published in our next issue of July-Aug 2015. Thanks, Sagar Aryal Editor-In-Chief Microbiology World
www.microbiologyworld.com
www.facebook.com/MicrobiologyWorld
~ 32 ~