Role of Biotechnology in Crop Improvement - Vol 10 No. 1 Jan-April 2017 by NATIONAL SEED ASSOCIATION OF INDIA

Volume 10 No. 1, Jan-April 2017

Seed Times January - April 2017

Role of Biotechnology in Crop Improvement

Vegetable Seed Industry - India & World Role of Biotechnology in Crop Improvement

Seed Times July - December 2016 Seed Times January - April 2017

ABOUT NSAI

National Seed Association of India (NSAI) is the apex organization representing the Indian seed industry. The vision of NSAI is to create a dynamic, innovative and internationally competitive, research based industry producing high performance, high quality seeds and planting materials which benefit farmers and significantly contribute to the sustainable growth of Indian Agriculture. The mission of NSAI is to encourage investment in state of the art R&D to bring to the Indian farmer superior genetics and technologies, which are high performing and adapted to

a wide range of agro-climatic zones. It actively contributes to the seed industry policy development, with the concerned governments, to ensure that policies and regulations create an enabling environment, including public acceptance, so that the industry is globally competitive. NSAI promotes harmonization and adoption of best commercial practices in production, processing, quality control and distribution of seeds.

NSAI Governing Council Members

NSAI Office Bearers President: M. Prabhakar Rao (Nuziveedu Seeds Ltd.)

G.V. Bhaskar Rao (Kaveri Seed Co. Ltd.)

Sameer Mulay (Ajeet Seeds Ltd.)

Vice President: M. G. Shembekar (Ankur Seeds Pvt. Ltd.)

N.P. Patel (Western Agri Seeds Ltd.)

K.S. Narayanaswamy (Karnataka Maize Development Association)

Pranjivan P Zaveri (Farmtech Biogene Pvt. Ltd.)

General Secretary: A.S.N Reddy (Delta Agrigenetics Pvt. Ltd.)

Girdhar D. Patel (Narmada Sagar Agri Seeds Pvt. Ltd.)

Treasurer: Pawan Kumar Kansal (Kohinoor Seed Fields India Pvt. Ltd.)

Janak Peshrana (Seeds India) K. Niranjan Kumar (GARC Seeds Pvt. Ltd.)

Vaibhav Kashikar (Dharti Agro Chemicals Pvt. Ltd.) Sachin Bhalinge (Namdeo Umaji Agritech (I) Pvt. Ltd.) Arun Kumar Agarwalla (West Bengal Hybrid Seeds & Biotech Pvt. Ltd.)

NSAI SECRETARIAT Kalyan B. Goswami Executive Director

Nilendri Biswal Deputy Director - PR & Social Intervenion

Manisha Negi Asst Director - Scientific Affairs

Yash Pal Saini Sr. Manager - Admin & Accounts

Priyank Samuel G Asst. Manager - Brand Alliance & Communication

Sher Singh Office Assistant

Compiled & edited by: Nilendri Biswal & Manisha Negi Designed Coordinated by: Priyank Samuel G | Advertisements Coordinated by: Yashpal Saini The views and opinions expressed by the authors are their own and NSAI by publishing them here, does not endorse them. The editorial correspondence should be sent to, National Seed Association of India, 909, Surya Kiran Building, 19, Kasturba Gandhi Marg, New Delhi-110001 (INDIA); Ph.: 011-4353 3241-43 Fax : 011-43533248; E-mail : info@nsai.co.in Designed and Printed YUKTI -PRINTS, 338 First Floor, Old Four Story Building, Tagore Guarden Extn., New Delhi - 27of| Biotechnology E-mail: yuktiprints@gmail.com Seed Times at: January April 2017 Role in Crop Improvement

TABLE OF CONTENTS 4

1 Application Of Tissue Culture In Horticultural Crop Improvement - Ila M. Tiwari and Deepak Singh Bisht

2 Biotechnological And Molecular Approaches In Tomato Breeding: Molecular Markers And Genome Editing - Roland Schafleitner, Peter Hanson and Warwick Easdown

3 Broomrape Weeds In Indian Mustard; Basis Of Parasitism And Its Cure - Navin Chandra Gupta, Mahesh Rao, Rohit Chamola and Kanika Kumar

4 Genome Editing: Development Of Crispr/Cas9-Mediated Geminivirus Resistance In Vegetable Crops - Bijendra Singh and Achuit K. Singh

5 Identification and Utilization of Qtls; A Way Forward to Improve Seed Vigour and Longevity - Manisha Negi

6 Molecular Breeders Adopted Orphan Pulse Crops For Genetic Improvement - Shourabh Joshi and Rajani Rawat

7 Plant Tolerance To High Temperature Stress And Strategy For The Development Of Tolerant Variety - Pranab Hazra

8 Progress of Plant Breeding: From Mendelian Selection To Genomic Prediction - Elangovan Mani

9 Resynthesis of Brassica Juncea: Enriching Gene Pool For Mustard Improvement - Mahesh Rao, Navin C. Gupta, Rohit Chamola and Kanika Kumar

10 Role of Biotechnology for Breeding Climate Resilient Varieties of Field Crops - R.P. Singh

11 Seed Biotechnology: Emerging Tools And Technology For A Paradigm Shift In Enhancing Agricultural Productivity and Value Addition- Retrospectives And Perspectives - Asit B. Mandal, Sourav Dutta and Bhojaraja K. Naik

12 Transgenic Blue Tomato: Enrichment Of Tomato Fruit With Health Promoting Antioxidant - Rajani Rawat and Shourabh Joshi

Role of Biotechnology in Crop Improvement

Seed Times January - April 2017

Role of Biotechnology in Crop Improvement

Seed Times January - April 2017

Message from Desk of

President The crop improvement through plant breeding has made significant progress through modern tools like genetic mapping of the crops, markers for fast track breeding, usage of double haploid techniques etc. Adding new genes to develop traits of agronomic value through biotechnology has made crop improvement even more exciting. Altering the genetic makeup of crops by farmers, has been an old age agricultural practice, which began eight to ten thousand years ago. Plant breeding came into being, when man learnt that crop plants could be cross pollinated to be able to improve the characters of the plant. Adoption of agricultural biotechnology provided a sophisticated platform to modify plant genetics, which being practiced for centuries, by plant breeders through breeding and crossbreeding. A platform shift of transferring thousands of genes, from the traditional method to the adoption of biotechnology, facilitated breeders to transfer only selected genes. Biotechnology enabled the introduction of beneficial traits that would be difficult to create through traditional breeding methods, by expanding the possible universe of transferable genes of economic significance. The best example of improved crop through biotechnology is Bt Cotton in India. It has reduced the crop losses due to bollworms and made it easier to grow cotton crop in India. Seed Industry identifies important government policies in agricultural biotechnology, that facilitates successful innovation and adoption, like market accessibility IP protection and an efficient regulatory approval process. It is interesting that after more than 14 years of regulating hybrid wise approval of Bt cotton, GEAC has finally and rightly transferred the responsibility to the MoA. Based on the representations of NSAI, the ICAR held a meeting with the stakeholders and issued testing and release procedure for new Bt cotton hybrids and varieties with approved Bt traits. The ICAR has also removed the NOC stipulation from the trait developer as it was leading to a monopoly and blocking the breeders rights. Under the current procedure, submission of an event confirmation test report from an accredited laboratory is adequate. With this a new regime has started wherein the breeders can breed new varieties using approved GM events but are obligated to share the benefits under the PPVFR Act with the trait developer. As you are aware, NSAI has been representing for removal of the anomalies in the system and we are glad to share these developments with our members. In the current edition of Seed Times – ‘Role of Biotechnology in Crop Improvement’, readers would get to read about biotechnological approach used in agriculture encompassing innovation, advances in biotechnology, opportunities for enhancing productivity through biotechnology, adoption of biotech crops, and prospects and challenges. These articles would enable the readers to understand the recent biotechnological advancement in Seed Sector along with encouraging Seed Industry members to approaches used for new research and inventions. – Shri M. Prabhakar Rao

Seed Times January - April 2017

Role of Biotechnology in Crop Improvement

Seed Times January - April 2017

Message from Desk of

Executive Director Today India faces a huge challenge to cater to the food needs for its population which is likely to reach to 1.4 billion by 2025. The way to overcome this challenge of ensuring food security is to have varieties of seed with high productivity and climate resilience. Our farmers will need access to quality seeds of these improved varieties and hybrids. Availability of quality seed, which is the carrier of technologies, has improved in our country over a period of time. Awareness about the benefits of quality seed is growing among farmers as well as seed producers. Indian Agriculture has grown impressively and Indian Seed Sector has played its part well. Quality Seed is the pivotal input for sustained growth of agricultural sector and other inputs are contingent upon quality of seed being optimally effective. Seed is the most critical and vital input of agriculture. With strong research to back it up, Indian Seed Industry is ready to dive with full force for adopting best innovative practices. A rapid shift is being witnessed in the role of Seed Technology and Production in Indian Agriculture, in form of growing partnerships between various stakeholders i.e. public private partnerships. With growing partnerships new ideas and innovations are bound to happen. The upcoming edition focuses on Role of Biotechnology in Crop Improvement in the field of Seed development. The various chapters stress on the key role played by biotechnology in Seed Industry. I hope the readers would greatly benefit from the magazine. Happy Reading! â&#x20AC;&#x201C; Dr. Kalyan B Goswami

Seed Times January - April 2017

Role of Biotechnology in Crop Improvement

Application of Tissue culture in Horticultural Crop Improvement Ila M. Tiwari, Deepak Singh Bisht National Research Centre on Plant Biotechnology, New Delhi 110012 Email: deebisht@gmail.com

Abstract: Horticultural crops include a plethora of plants that are grown for various purposes like for food, drugs and aesthetics. To maintain the true to type characters of parent most of the horticulture crops are asexually propagated. Conventional means of asexual propagation like cuttings, grafting and layering are fraught with many challenges. Addressing these concerns plant tissue culture (PTC) has emerged as a promising technique for propagation of horticulture crops. Presently, tissue culture is developing as an industry of multimillion dollar turnover and flourishing with multidirectional development. Tissue culture techniques are routinely used for propagation of crops like strawberries, sugarcane, orchids, citrus etc. which are being traded domestically and internationally. Tissue culture has revolutionized the nursery and cutting industry as it plays a significant role in production of pathogen free plants, ex situ conservation of germplasm, micropropagation as well as in plant modification which is achieved by embryo and anther culture, using somaclonal variants, by protoplast fusion and genetic transformation. To boost the production and increase the credibility of Indian horticulture product in international market it is imperative to adopt modern scientific technologies of crop improvement and production. Key Words: Horticultural Crops, Tissue Culture, Micropropagation, in vitro culture, Meristem culture, Cryopreservation, Embryo culture

Introduction Application of Tissue culture to horticulture developed along with the original ideas of White 1963; Bhojwani and Razdan 1983, Gautheret 1985, Thorpe 1990. Techniques like embryo culture and axillary bud breaking have had a major impact on horticultural crops breeding programme. For improving asexually propagated cultivars, traditional breeding programs are based on exploitation of natural and induced variation. However, as there may be an upper limit of exhibition of natural variation within a cultivar, biotechnology practices are adopted which helped in supplementing and directing the type of variation. Plant tissue culture biotechnology got a major push for horticultural production when technique was developed for propagation of orchids by tissue culture means. In 1922 Knudson reported for the first time that it is possible to germinate orchids seeds on sugar containing media however; Morel (1960) is credited with break-through in clonal propagation by tissue culture as he introduced the meristem culture technique for vegetative propagation of orchids. Now lots of herbaceous ornamental plants can be clonally propagated by tissue culture techniques. Many commercial laboratories have adopted rapid clonal propagation techniques for many ornamental, vegetable and fruit crops like strawberries, carnations, Asperagus, apples, citrus, chrysanthemums, gerbera and many others. Horticultural researchers have used somaclonal variation to obtain various varieties of desirable characters like thorn less blackberries and red pear trees. Studies related to productivity of in vitro plantlets over conventional one revealed that in terms of uniformity, earliness, yield, and disease free nature, in vitro plantlets performed significantly better than the conventional one. Various unique commercial plant species like ornamentals and foliages were made available through tissue culture techniques as earlier conventional methods were

Seed Times January - April 2017

Role of Biotechnology in Crop Improvement

unable to produce them on large scale Moreover, plant tissue culture industry has emerged as a major employment provider in plant biotechnology sector with an immense potential for entrepreneurship. This article is an attempt to brief the stake holders about the major plant tissue culture techniques, particularly those which are commercially viable and have been successfully utilised for improvement of fruits, vegetables and ornamentals.

Pathogen free plants Plant cultivars which are propagated through asexual conventional means over an extended time is infected with one or more pathogens. These pathogens are responsible for reduced crop yield by suppressing the growth performance of the cultivars. Horticulture industry of many countries produce disease free planting materials of vegetative propagated crops by using tissue culture techniques. Methods used for obtaining pathogen free plants are meristem culture, shoot-tip culture and in vitro shoot-tip grafting. Shoot-tip culture is used for recovering pathogen free plants and involves using all or part of an apical or lateral growing point of stem in size from 0.1mm to 2mm. Although this size of explants is convenient for propagation but they may not be free of viruses and other systemic pathogens. Morel (1960) pioneered meristem culture which involves culture of the meristem (dome of actively dividing cells) on a nutrient medium resulting in the formation of a disease-free plant. The explants size for meristem culture is less than 0.1mm and included only meristematic dome and a few subtending primodia. Micropropagation techniques using meristem culture leads to production of large numbers of disease-free planting material specially in major crops like Potato, sweet potato, banana, strawberry and citrus. To produce plants free of viruses, viroids or mycoplasms especially in woody plants which do not regenerate shoots and roots easily through shoot tip culture, shoot-tip grafting technique was used. It involves grafting of shoot tip on an in vitro grown infection free seedling rootstock. This method yielded successful results in recovering pathogen free clones of citrus, apple, Prunus etc.

Germplasm Storage Tissue culture provides an effective system for conservation and maintenance of plant species that cannot be stored as seed. This can be achieved either by slow growth or by cryopreservation methods. In slow growth conservation approach retardant chemicals or reduced culture temperature is used besides extending subculture intervals upto 1-2 years. Slow growth approach helps in reducing the time, labour and materials required maintaining the cultures. In Cryopreservation, growth of the cultures was suspended by keeping them at an ultralow temperature, typically that of liquid nitrogen (-196 Â°C). Here cultures and plant material can be stored for indefinite periods with minimal risk. To minimize the culture damage during freezing and thawing one approach is through vitrification and the other involves encapsulation of specimens. For vitrificationa cryoprotectant mixture is infused with the specimen and during rapid cooling it helps in conservation of cellular water into a noncrystalline, vitreous solid (Sakai et al., 1990). Encapsulation of somatic embryos, meristems or shoot tip involves encasing them in alginate gel to form an artificial seeds which were then dehydrated in air and finally stored at ultralow temperature (Dereuddre et al., 1990). Successful cryopreservation of meristem was achieved in species like Apple, Grape, Cherry, Mulberry, Pear, Pineapple, orchids, yams etc.

Micropropagation Micropropagation is a practice of aseptic culture of plants under controlled conditions for producing clones of desired plant.Large numbers of plants can be produced from small pieces of the stock plant using this method in a relatively short period of time. During micropropagation when explants are placed on tissue culture media, either adventitious shoot proliferation occurs or shoots gets differentiated from the callus. It resulted in producing large number of shoots in a limited space which were then subsequently used for rooting. Major advantage of micropropagation is that it helps in production of plants without using seeds or necessary pollinators required for seed production. It helps in producing clones of superior ornamental plants in sufficient quantities and thus made an impact on the landscape plant market. Seeds of species like Orchids and Nepenthes have very low chances of germination and growing and here micropropagation plays a very important role in production of plants. Micropropagation also helps in production and multiplication of pathogen free plants which were then used as â&#x20AC;&#x2DC;cleaned stockâ&#x20AC;&#x2122; for horticulture and agriculture. Micropropagation of ornamental plants has taken tissue culture out of the lab and into the commercial world as now it is routinely used for production of orchids, Gerbera, Spathiphyllum, Boston fern etc. Micropropagated plants are also used as stock plants material for the production of 14

Role of Biotechnology in Crop Improvement

Seed Times January - April 2017

microcuttings in Ficus and Rhododendron spp. Progress regarding micropropagation of vegetatively propagated root and tuber crops like sweet potato, aroids, cassava and yams is encouraging as such material is made specific pathogen free and therefore gives higher yields. Protocols for micropropagation of important tropical fruit trees are already available and most widely micropropagated fruit crops are banana, papaya, passion fruit citrus, mango and pineapple.

Plant Modification Conventionally plant improvement programmes require modification in genetic background of plants by interogression of desirable traits in a breeding programme. Spontaneous mutations occur at very low frequencies and most of them are recessive and deleterious from the breeding point of view. In this scenario in vitro techniques are used as an aid to the traditional breeding method. Approaches like cultures of isolated cells, anthers and microspores are used for modification and improvement of horticultural species. Embryo culture including embryo rescue plays an important part in breeding of vegetable crops, tropical and temperate fruits and in ornamentals. Culture of excised embryos was first achieved in 1904 by Hannig and it becomes an important tool in horticulture. Most important use of embryo culture is in embryo rescue ofintervarietal, interspecific and intergeneric crosses. This technique helped in production of interspecific hybrids for the geners Brassica, Chrysanthemum, Cucumis, Impatiens, Iris, Lilium, Lycopersicon, Solanum and Vigna. The process was used in the production of triploids Citrus cultivars (Grosser, 1994), seedless grape cultivars (Gray et al., 1990) and breeding of raspberries (Zimmerman and Swartz, 1994). Embryo culture also helps in overcoming seed dormancy and low seed viability. Haploids were generated by anther and microspore culture which are of tremendous interest to plant breeders. Chromosome doubling helped in producing homozygous diploids which can be used for hybrid production. Anther culture has been successful in vegetables like cabbage, cauliflower, pepper and other vegetable Brassica and ornamentals like petunia and African violet. Somaclonal variation leads to phenotypic variations, early flowering, variation in floral morphology and colour leads to development of number of horticultural cultivars. Use of protoplast for plantlet regeneration (directly or through protoplast fusion) allowed development of unique hybrid plants. In Brassica and carrot cytoplasmic male sterility was introduced by protoplast culture and fertile breeding lines were produced. Protoplast fusion has been successfully achieved between Brassica members and protoplast regeneration has been achieved in eggplant, cucumber and potato. Somatic hybrids between potato and wild relatives for disease resistance have been successfully produced. Protoplast to plantlet regeneration was successfully achieved in fruit crops like apple, pear, cherry and strawberry (Zimmerman and Swartz, 1994). Genetic modification is also achieved by development of transformation protocols and evaluation of transgenics. Agrobacterium based transformation methods successfully used for developing insect pest resistance in crops like pea, tomato, potato, apple, strawberry, grape, plum etc. In ornamentals like antirrhinum flower colour has been manipulated by gene transfers.

Status of Tissue culture industry in India The highly diverse agro-climatic zones of India support a cauldron of wide variety of vegetation which includes a large number of horticulture crops such as fruits, vegetables, spices, plantation crops, root and tuber crops, and medicinal and aromatic crops. To harness the enormous untapped economic potential of horticulture crops Government of India launched National Horticulture Mission in the year 2005-06. Over the years, with many initiatives, the production of horticulture crops has registered a steep increase which is now almost 33% of the total Agricultural produce of India. Presently, India is the second largest producer of fruits and vegetables in the world (NHB 2016). Modern methods, particularly intervention of plant tissue culture in crop propagation are now being gradually adopted by more and more farmers. For quality assurance and providing assistance in implementation of standard operating protocol (SOP) of tissue culture raised plants Government of India has started a certification program- â&#x20AC;&#x2DC;National Certification System for Tissue Culture Raise Plant (NCS-TCP)â&#x20AC;&#x2122; under the aegis of Department of Biotechnology. Till date 87 commercial tissue culture production units have been recognized by NCS-TCP (http://dbtncstcp.nic.in/index.htm). As Indiaâ&#x20AC;&#x2122;s population is expected to cross one and half billion by the mid of this century, the demand for products obtained from horticulture crops are also expected to increase. To maintain a steady balance between the demand and supply of horticulture driven commodities it is important to devise strategies for catapulting the production of horticulture crops to new heights.

Seed Times January - April 2017

Role of Biotechnology in Crop Improvement

Conclusion With the increse in world population and improvement of living standards, increased yields are required as well as maintaining quality in the presence of various pests and pathogens is major concern. For this tissue culture technology plays a major role regarding production and improvement of horticultural crops. In vitro conservation of germplasm is of great significance in management of genetic resources. In vitro storage has great practical importance in vegetatively propagated crops which produce recalcitrant seeds. Tissue culture technology helps in better quarantine as it assures the exchange of pest and disease free material. Phenotypic variability exhibited by tissue culture raised plants is of great importance to Plant breeders and useful in cultivar improvement. Plant Tissue Culture has emerged as a flourishing industry and growing with multidirectional development and multimillion dollar turn over and becomes a crucial part of nursery and cultivating industry.

References Bhojwani SS and Razdan MK 1983. Plant Tissue Culture: Theory and Practice. Developments in Crop Csience, 5. Elsevier, Amsterdam/ Oxford/New York/Tokyo, vii pp 502 Dereuddre J, Scottez L, Arnaud Y, Duron M. 1990. Resistance of alginate-coated shoot tips of pear tree (Pyruscommunis L. cv Beurre Hardy) in vitro plant lets to dehydration and subsequent freezing in liquid nitrogen: effects of previous cold hardening. CR Acad. Sci Paris. 310(3):317- 323 Gautheret RJ 1985. In Cell Culture and Somatic Cell Genetics of Plants, Vol 2, Cell Growth, Nutrition, Cytodifferentiation and Cryopreservation (Vasil IK ed.) pp 1-59, Academic Press, Orlando Gray, DJ, Mortensen JA, Benton CM, Durham RE, and Moore GA 1990. Ovule culture to obtain progeny from hybrid seedless bunch grapes. J. Am. Soc. Hort. Sci. 15: 1019-1024 Grosser JW 1994. in vitro culture of tropical fruits. In: In I.K. Vasil and T.A. Thrope (eds), Plant Cell and Tissue Culture pp 475-496 Kluwer Acad. Publ. Dordrecht Kundson L 1922. Non-symbiotic germination of orchid seed. Bot. Gaz. 73: 1-25 Morel G.M. (1960). Producing virus-free cymbidiums. American Orchid Society Bulletin, 29, 495-497. Sakai A, Kobayashi S, Oryama I. 1990.Cryopresevation of nuclellar cells of navel orange (Citrus sinensis) Osb. Var brasiliensis Tanaka) by vitrification. Plant Cell Report, 9:30-33. Thorpe, TA 1990. The current status of plant tissue culture. In SS Bhojwani (ed.) Plant Tissue Culture: Applications and Limitations, pp 1-33, Elsevier, Amsterdam White PR 1963. The cultivation of Animal and Plant Cells Ronald Press, New York pp 228 Zimmerman RH and Swartz HJ 1994.in vitro culture of temperate fruits. In I.K. Vasil and T.A. Thrope (eds), Plant Cell and Tissue Culture, pp457-474, Kluwer Acad. Publ. Dordrecht

The article has been published with permission of authors

Role of Biotechnology in Crop Improvement

Seed Times January - April 2017

Biotechnological and molecular approaches in tomato breeding: Molecular markers and Genome Editing Roland Schafleitner, Peter Hanson, Warwick Easdown World Vegetable Centre roland.schafleitner@worldveg.org; peterhanson@worldveg.org warwickeasdown@worldveg.org

Abstract Diseases are an important yield limiting factor for tomato, therefore public research institutions and the private seed industry are continuously investing in breeding disease resistant varieties. Marker-assisted selection (MAS) has been introduced as a routine tool for monitoring introgression and maintenance of disease resistance genes in breeding lines. A number of markers for disease resistance genes are available for MAS. The most common markers and their use in tomato breeding is discussed. Some breeder- and farmer-desired traits including disease resistance genes are absent in the cultivated tomato gene pool and have to be sourced from wild relatives. Crossing barriers between different tomato species can hinder introgression of genes from wild into cultivated species and multiple rounds of backcrossing may be required to reestablish the cultivated phenotype. Genome editing by CRISPR/Cas9 or related technologies provide an alternative for introducing new alleles into elite lines by crossing. The technology was successfully tested for knocking out specific genes and methods to introduce specific sequence changes in target genes are available. Therefore CRISPR/Cas9 may be an economically favorable alternative to sourcing genes from wild relatives, provided the genes and alleles underlying the trait of interest are known.

Introduction Tomato (Solanum lycopersicum L.) is grown in India on about 880,000 ha and yields are more than 18 million tons annually (FAO, 2014). The average productivity in India is highest in Karnataka (35 t/ha) due to the favorable environmental conditions and the adoption of high yielding hybrids (ICAR, 2017). However, these yields are far below the yield potential of 60-80 t/ha achieved in some temperate countries. Reasons for the yield gap, in addition to the still relatively low adoption rates of hybrids compared to Europe and the USA, are the frequent occurrence of pests and diseases. Tomato yellow leaf curl disease, bacterial wilt and early blight cause yield can cause losses up to 70-100 %. In the absence of resistant cultivars, pesticides are the only means for farmers to control diseases. High pesticide use imposes health hazards to farmers, the environment, and consumers and substantially increases production costs (Wilson and Tisdell, 2001). Resistant cultivars are probably the cheapest, simplest, and most environmentally safe means to manage crop diseases. Research and breeding efforts by the public sector and private companies aim at increasing yields by introducing improved hybrids with high yields and resistance to common pests and diseases, as well as to abiotic stresses. Tomato lines incorporated with a range of disease resistance genes were made available to seed companies for breeding, and technologies were developed to cope with abiotic stresses to get optimum yield and quality (Ebert and Schafleitner, 2015, Sadashiva et al., 2016). Use of disease resistance genes in tomato breeding requires precise and cost-effective methods for screening large breeding populations with thousands of plants. Phenotypic screening under field conditions depends on the natural occurrence of the pathogen and can be affected by environmental factors or presence of additional diseases and pests can lead to erroneous results. Screening in controlled environments may improve the correct detection of resistant plants, but requires appropriate inoculation methods and appropriate pathogen strains to select lines that resist the disease in the target environment under field conditions. Seed Times January - April 2017

Role of Biotechnology in Crop Improvement

Resistance screening is a major cost factor in breeding disease resistant varieties. Marker-assisted selection can make resistance screening more effective through lowering costs and accelerating genetic gain. It was proven to be a cost effective tool for introgressing and maintaining desired genes and traits in breeding lines, while minimizing phenotyping efforts (Slater et al., 2013). By now, marker-assisted selection is widely used in crop breeding and is partly replacing phenotypic selection for traits. Some traits required for crop improvement may be absent in cultivated species and need to be sourced from wild relatives. Crossing barriers may hinder the introgression of traits from wild into cultivated species. Embryo rescue technologies can overcome this hurdle, but may not be successful for all cross combinations. Multiple rounds of time-consuming backcrossing may be required to reestablish the elite genotype from crosses with wild species, making gene introgression from wild into cultivated species a laborious and expensive task with insecure outcome. Genome editing technologies have emerged which facilitate introduction of new alleles into cultivated species without leaving selective markers or other foreign DNA sequences in the product. In contrast to introgression of genes from wild species, genome editing is very precise, avoids linkage drag and does not need lengthy backcrossing to reestablish the recurrent phenotype. Tomato is an ideal target for genome editing due to the extensive knowledge of its basic biology and genetics, gained from decades of conventional breeding and research on tomato as a model crop (reviewed by Zsögön et al., 2016). CRISPR/Cas9 (clustered regularly interspaced short palindromic repeats/Cas9) became the method of choice for genome editing. CRISPR/Cas9-mediated editing of SlDMR6-1 led to tomato lines with increased resistance to bacterial and oomycete pathogens (de Toledo Thomazella et al., 2016), and editing of SlMlo1 induced resistance to powdery mildew (Nekrasov et al., 2017), to name just a few recent examples to illustrate the potential of genome editing for genetic improvement of tomato. In the USA, according to letters posted by the US Department of Agriculture (USDA) in April 2016, CRISPR-edited crops presented to the US regulatory system can be cultivated and sold without oversight by USDA. The first genome-edited products, anti-browning mushroom and a waxy corn have entered the market (Waltz, 2016a,b). The CRISPR/Cas-9 edited mushroom did not trigger USDA oversight because it does not contain foreign DNA from plant pests such as viruses or bacteria. However, crops that bypass the USDA may still go through the voluntary review process at the US Food and Drug Administration, and the US Environmental Protection Agency still reviews crops with certain traits such as insecticidal properties. In most countries the regulation of genome editing of food crops has not yet been decided. Also the unclear intellectual property situation around genome editing adds some insecurity to the commercial application of this technology (Cohen, 2017). Nevertheless, it is assumed that genome editing is becoming an important tool for crop improvement.

Marker-assisted breeding in tomato Many disease resistance genes have been mapped in tomato and molecular markers linked to these genes are available for markerassisted selection (MAS). There are numerous advantages of MAS in comparison to phenotypic selection, provided markers that are strongly associated with the trait(s) of interest are available. MAS is particularly advantageous in the following cases: • The selected trait is expressed late in plant development. Here MAS shortens the time until selection can take place. • The trait is recessive: MAS can identify heterozygous individuals for the gene(s) of interest. • The trait is conditioned by two or more unlinked genes: MAS facilitates the pyramiding of the genes. • Selection for the trait of interest requires the presence of biotic and abiotic stress factors: MAS makes selection independent of the presence of the stress factor. It allows for off-season population advancement and avoids confounding effects through environmental factors. MAS is widely used in population screening and for pyramiding multiple genes in a line. In marker-assisted backcrossing, molecular markers are applied to control the presence of the target allele and/or to accelerate the return to the recurrent genotype. Markerbased recurrent selection uses breeding values obtained for a set of markers, and index selection combines molecular and phenotypic data to predict breeding values and to rank lines. Marker information can be obtained just after germination, generally long before phenotypic evaluations can be done. This allows for step-wise selection, with markers being used to identify plants lacking the gene of interest for culling in the first step, and verification of the phenotype in the marker-positive plants in the second step.

Role of Biotechnology in Crop Improvement

Seed Times January - April 2017

Marker technologies for scoring genetic polymorphisms among organisms have evolved rapidly. Microsatellite markers are successively replaced by single nucleotide polymorphism (SNP) markers. SNPS became the preferred marker system due to their abundance in the genome and because SNP genotyping is highly amenable to automatization. Methods like genotyping by sequencing generate large numbers of markers for virtually any species and population for research purposes (Elishire et al., 2011), while SNP genotyping systems for routine MAS have been made available that work reliable also when low cost DNA extraction methods are used (Semagn et al., 2014). Table 1. Molecular marker for tomato disease resistance genes R-gene

Marker

Type

Chr. Pos.

Forward primer

Reverse primer

Reference

Ty-1

TG178

SCAR

21.040

GAGTCCCTAACGAATGGTCCTACT

GCAGACAAATGCTCAAAGGTCACACC

Barbieri et al., 2010

Ty-3

P6-25

SCAR

31.499

GGTAGTGGAAATGATGCTGCTC

GCTCTGCCTATTGTCCCATATATAACC

Ji et al., 2007

Ty-1/3

TY-1/3

SCAR

30.879

ACAGGAAAAATGGGTGATCC

CCTGCTCCTTGCAGATTCTA

Chen et al., 2015

Ty-2

T0302

SCAR

51.0878

TGGCTCATCCTGAAGCTGATAGCGC

AGTGTACATCCTTGCCATTGACT

Garcia et al., 2007

Ty-2

TES0344

SSR

51.420

GCCTTTTCCCACTTATATTCCTCTC

ACACATACGACGTTCCGTCA

Yang et al., 2012

Ty-5

TM273

SSR

3.2

GGTGCTCATGGATAGCTTAC

CTATATAGGCGATAGCACCAC

Chen et al., 2015

Ty-5

SLM4-34

SSR

2.938

GACCATTAACCTCGATCA

GAAAGTCATGTGAATAGCAG

Kadirvel et al., 2012

Ty-5

SINAC1 (TAQ I)

CAPS

2.856

TGCCTGGTTTCTGCTGTCA

TAAAGCTGAAGAAGGACTTACCCT

Anbinder et al., 2009

Bwr-12

SLM12-2

SSR

3.15

ATCTCATTCAACGCA- AACGGTGGAAACTATT- Ho et al., 2013 CACCA GAAAGG

SLM12-10

SSR

2.88

ACCGCCCTAGCCATAAAGAC

TGCGTCGAAAATAGTTGCAT

Ph-2

dTG422

CAPS (HinfI)

64.9

TGACATGAGAAGGAAAAGACTTAAG

GTCAATAATTTTCAACCATAGAATGATT

Mutschler M, according to Panthee & Foolad, 2012

Ph3

Ph3.gsm/HincII

CAPS/HincII

71.4

TAGTATGGTCAAACATATGCAG

CTTCAAGTTGCAGAAAGCTATC

Wang et al., 2016

Mi-1

PM3F/R

SCAR

2.722

CCTGTGATGAGATTCCTCTTAG

ACCCTTTGTTGAGCGACTTTGCAGC

El Mehrach et al., 2005

Mi-1.2

Mi23

SCAR

2.322

TGGAAAAATGTTGAATTTCTTTTG

GCATACTATATGGCTTGTTTACCC

Seah et al., 2007

Disease resistance genes currently used in commercial tomato cultivars are mostly conditioned by single genes, each conferring resistance to a specific pathogen or pathogen race, strain, or phylotype (Yang and Francis, 2007; Scott and Gardner, 2007; Scott,2007). Such monogenic traits are highly amenable for MAS, when markers linked to the resistance genes are available. Hanson et al., (2016) summarized most common resistance genes currently used in tomato breeding (Table 1).

Seed Times January - April 2017

Role of Biotechnology in Crop Improvement

One of the most devastating diseases of tomato in India is Tomato yellow leaf curl disease (TYLCD), caused by whitefly-transmitted begomoviruses. TYLCD resistance is negligible in cultivated tomato and all known resistance genes have been sourced from wild relatives (reviewed by de la PeĂąa et al., 2010). The most commonly used TYLCD resistance genes are Ty-2 and Ty-3, mapping to chromosome 11 and 6, respectively (Hanson et al., 2006, Ji et al., 2007, Table 1). In addition, several other Ty-genes have been identified and were tagged with markers (Ji et al., 2008, Anbinder et al., 2009, Kadirvel et al., 2013). Pyramiding different Ty-genes and adding whitefly resistance genes to Begomovirus resistance is thought to improve genetic resistance to TYLCD. Combining Ty-2 and Ty-3 has been shown to protect tomato well against various TYLCD virus strains (Tabein et al., 2017). Late blight is caused by the oomycete pathogen Phytophthora infestans. It infects tomato in moderate or cool climates and under moist conditions. Resistance screening in early generations of tomato can be done with markers for the Ph-2 and Ph-3 resistance genes (Table 1). MAS for late blight resistance is advantageous because individual plants can be assayed for both Ph-2 and Ph-3 and homozygotes versus heterozygotes can be distinguished. Ph-2 and Ph-3 complement each other in pathogen race protection (Chen et al., 2008). A new cleaved amplified polymorphic sequence (CAPS) marker, Ph3.gsm/HincII that accurately detects Ph3 and differentiates variable susceptible alleles was developed (Wang et al., 2016) and is recommended for MAS to breed for later light resistance. Tomato breeders continue to search for new late blight resistance genes in wild tomato species S. pimpinellifolium (Merk et al., 2012) and S. habrochaites (Brouwer and Clair, 2004; Li et al., 2011) to provide resistance against newly evolving strains. Root knot nematodes (Meloidogyne spp) frequently infest tomato. They induce a series of changes in the root, resulting in the formation of root knots and specialized feeding cells, which affects nutrient partitioning and water uptake in the plant. Root knot nematode resistant tomato carry the dominant Mi resistance gene derived from S. peruvianum (Smith, 1944). Markers Mi-1 and Mi-1.2 are tightly associated with the Mi gene and amplify well over a broad range of tomato germplasm. Especially Mi-1.2 gives a simple banding pattern that is diagnostic for nematode resistance. Bacterial wilt caused by Ralstonia solanacearum strongly hampers tomato production in the humid tropics. Genetic resistance from Hawaii 7996 and other lines probably derived from this source have been used for breeding bacterial wilt resistant tomato. Bacterial wilt resistance has been mapped to chromosome 6 and 12 of tomato (Wang et al., 2013) and is generally assessed by analysis microsatellite markers linked to Bwr-12 (Table 1). Bwr-12 has been narrowed down to a 100 kb interval between near position 30 Mb on chromosome 12. Defining markers associated with Bwr-06 has been more difficult. The locus spans over a 15.5-cM region and the effect of the QTLs in this region is variable among environments (Wang et al., 2013). A sequence characterized amplified regions (SCAR) marker termed SCU176-534 linked to the resistance locus on chromosome 6 for MAS on tomato was reported by Truong et al., (2015). MAS costs can be reduced when multiple markers can be analyzed in a single assay. Primers for microsatelllite and SCAR markers can be chosen to yield bands with appropriate size differences for multiplex PCR (Fig. 1). Many multiplex SNP genotyping methods based on various chemistries, detection methods and reaction formats are available to fit for a wide range of sample amounts and marker numbers (Gut et al., 2001, Sobrino et al., 2005, Semagn et al., 2014).

Genome editing Genome-editing via site-directed mutagenesis using CRISPR/Cas9 is likely to become an important breeding tool. The technology is based on nuclease Cas9 derived from Streptococcus pyogenes that forms a complex with a 100 bases RNA molecule, called guide RNA, which directs the nuclease to a DNA target sequence through base pairing with complementary nucleotides of over 20 bases.

Role of Biotechnology in Crop Improvement

Fig. 1. Multiplex polymerase chain reaction detection of Ty-1/3, Ty-2 (T0302), Ty-5 (TM273) and BWr-12 (SLM12-2) in breeding lines (from Chen et al., 2015)

Ty-2

BW-12

Ty-5

Ty-1/3

Seed Times January - April 2017

When these components are present and expressed in a cell, the guide RNA will direct the Cas9 nuclease to the specified site of the host DNA, where the nuclease will cut the DNA double strand. Cellular DNA repair mechanisms will close the gap. Because DNA repair is error prone, deletions, insertions, and point mutations are introduced at the cutting site, leading to site directed mutagenesis. Offering a single stranded DNA template that is partly complementary to the cutting site can introduce a desired allele or add a new sequence to the target site. A range of variants of CRISPR/Cas9 systems with altered cutting properties and specificity have been developed (Puchta, 2016). We have tested the CRISPR/Cas9 system in tomato, first on a model gene (alcohol dehydrogenase), and then on eukaryotic initiation factors elF4E1 and elF4E2 genes known to be associated with recessive resistance against potyviruses (Bastet et al., 2017). A CRISPR/Cas9 construct pKSE401 (Xing et al., 2014) carrying the Cas9 gene and containing a guide RNA cassette was obtained from the Addgene non-profit plasmid depository (https://www.addgene.org/). DNA oligonucleotides for the upper and lower strand of the target-specific section of the guide RNA were designed, synthesized and cloned into the BsaI site of the vector. The guide RNA was designed to target exon sequences containing a restriction enzyme cutting site to facilitate screening for mutations. The construct was transformed into explants of tomato line CLN1621L through Agrobacterium-mediated transformation. Shoots were regenerated and tested by restriction enzyme analysis, PCR and sequencing for mutations in the target genes. In 7—20% of the regenerated plants mutations were found in the target genes. Short deletions (average size 15 bp) were the most frequently observed kind of mutations, followed by single base pair insertions. Single base exchanges were least frequent. The predominant consequence of mutagenesis (predicted based on the DNA sequence) was change of the amino acid sequence and introduction of a premature stop codon, presumably leading to the production of a truncated protein. This showed that the applied mutagenesis method is highly suitable to knock out proteins and thus is an ideal tool for functional genetics studies to verify gene functions and to generate recessive mutants for breeding. It also may be a favorable method to introduce new alleles into elite lines. Site-specific integration of DNA sequences or precise genome alterations can be accomplished by CRISPR/Cas9. The precise site-specific integration a donor sequence in a specific locus would allow changing an allele conditioning disease susceptibility in cultivated tomato with the allele of a wild species that confers resistance, without laborious wide crosses, embryo rescue and lengthy backcrossing (Wang et al., 2017). Approaches for genomes restructuring on a more global scale by editing factors regulating gene expression or converting Cas9 to a DNA binding protein to interfere with gene regulation opens new opportunities for site-specific manipulations on the DNA and RNA level (Puchta, 2017).

Acknowledgments Support for World Vegetable Center research activities is provided by project donors and the following core donors: Republic of China (ROC), UK Department for International Development (DFID), United States Agency for International Development (USAID), Australian Centre for International Agricultural Research (ACIAR), Germany, Thailand, Philippines, Korea, and Japan.

References Anbinder I, Reuveni M, Azari R, Paran I, Nahon S, Shlomo H, Chen L, Lapidot M, Levin I (2009) Molecular dissection of Tomato leaf curl virus resistance in tomato line TY172 derived from Solanum peruvianum. Theoretical and Applied Genetics 119:519–530. Barbieri M, Acciarri N, Sabatini E, Sardo L, Accotto GP, Pecchioni N (2010) Introgression of resistance to two Mediterranean virus species causing Tomato yellow leaf curl into a valuable traditional tomato variety. Journal of Plant Pathology 92: 485-493. Bastet A, Robaglia C, Gallois JL (2017) eIF4E Resistance: Natural Variation Should Guide Gene Editing. Trends in Plant Science 22:411419. Brouwer DJ, St. Clair DA (2004) Fine mapping of three quantitative trait loci forlate blight resistance in tomato using near isogenic lines (NILS) and sub-NILS. Theoretical and Applied Genetics 108:628–638. Chen CH, Sheu ZM, Wang TC (2008) Host specificity and tomato-related race composition of Phytophthora infestans isolates in Taiwan during 2004 and2005. Plant Disease 92, 751–755.

Seed Times January - April 2017

Role of Biotechnology in Crop Improvement

Chen H-m, Lin C-y, Yoshida M, Hanson P, Schafleitner R (2015) Multiplex PCR for detection of Tomato yellow leaf curl disease and rootknot nematode resistance genes in tomato (Solanum lycopersicum L.). International Journal of Plant Breeding and Genetics 9: 44-56. Cohen J (2017) CRISPR patent ruling leaves license holders scrambling. Science 355:786. de la Peña RC, Kadirvel P, Venkatesan S, Kenyon L, Hughes J (2010) Integrated approaches to manage tomato yellow leaf curl viruses. In: Hou CT, Shaw JF (eds) Biocatalysis and Biomolecular Engineering. Wiley, pp 105–132 de Toledo Thomazella DP, Brail Q, Dahlbeck D, Staskawicz BJ (2016) CRISPR-Cas9 mediated mutagenesis of a DMR6 ortholog in tomato confers broad-spectrum disease resistance. bioRxiv doi: http://dx.doi.org/10.1101/064824. Ebert AW, Schafleitner R (2015) Utilization of Wild relatives in the breeding of tomato and other major vegetables. In: Redden R, Yadav SS, Maxted N, Dulloo ME, Guarino L, Smith P (eds) Crop Wild Relatives and Climate Change. Wiley, pp. 141-172. El Mehrach K, Gharsallah Chouchane S, Mejia L, Williamson VM, Vidavski F, Hatimi A, Salus MS, Martin CT, Maxwell DO (2005) PCRbased methods for tagging the Mi-1 locus for resistance to root-knot nematode in begomovirus resistant tomato germplasm. Acta Horticulturae 695:2635270. Elshire RJ, Glaubitz JC, Sun Q, Poland JA, Kawamoto K, Buckler ES, Mitchell SE (2011) A robust, simple genotyping-by-sequencing (GBS) approach for high diversity species. PloS one 6:e19379. FAO (2014) http://www.fao.org/faostat/en/#data/QC, last visited April 27, 2017. Garcia BE, Graham E, Jensen KS, Hanson P, Mejía L, Maxwell DP (2007) Co-dominant SCAR marker for detection of the begomovirusresistance Ty-2 locus derived from Solanum habrochaites in tomato germplasm. TGC Report 57:21-24. Gut IG (2001) Automation in genotyping of single nucleotide polymorphisms. Human Mutation 17:475–92. Hanson P, Lu SF, Wang JF, Chen W, Kenyon L, Tan CW, Tee KL, Wang YY, Hsua YC, Schafleitner R, Ledesma D, Yang RY (2016) Conventional and molecular marker-assisted selection and pyramiding of genes for multiple disease resistance in tomato. Scientia Horticulturae 201:346-354. Hanson P, Green SK, Kuo G (2006) Ty-2 gene on chromosome 11 conditioning geminvirus resistance in tomato. Report of the Tomato Genetics Cooperative 56:17–18 Ho FI, Chung CY, Wang JF (2013) Distribution of major QTLs associated with resistance to Ralstonia solanacearum phylotype 1 strain in a global set of resistant tomato accessions. Report ofH the Tomato Genetics Cooperative 63:22–30. ICAR (2017) India’s first triple disease resistant tomato F1 hybrid Arka Rakshak brings back smile on farmers face. http://www.iihr. ernet.in/content/india%E2%80%99s-first-triple-disease-resistant-tomato-f1-hybrid-arka-rakshak%E2%80%9D-brings-back-smile Ji Y, Salus M, van Betteray B, Smeets J, Jensen KS, Martin CT, Mejia L, Scott JW, Havey MJ, Maxwell DP (2007) Co-dominant SCAR markers for detection of the Ty-3 and Ty-3a loci from Solanum chilense at 25 cM of chromosome 6 of tomato. Tomato Genetics Cooperative 57:25–28. Ji Y, Scott JW, Maxwell DP, Schuster DJ (2008) Ty-4, a tomato yellow leaf curl virus resistance gene on chromosome 3 of tomato. Rept Tomato Genetics Coop 58:29–31 Kadirvel P, de la Peña R, Schafleitner R, Huang S, Geethanjali S, Kenyon L, Tsai W, Hanson P (2013) Mapping of QTLs in tomato line FLA456 associated with resistance to a virus causing tomato yellow leaf curl disease. Euphytica 190:297-308. Li J, Liu L, Bai Y, Finkers R, Wang F, Du Y, Yang Y, Xie B, Visser RGF, van Heusden AW (2011) Identification and mapping of quantitative resistance to late blight (Phytophthora infestans) in Solanum habrochaites LA1777. Euphytica179:427–438. Merk HL, Ashrafi H, Foolad MR (2012) Selective genotyping to identify late blight resistance genes in an accession of the tomato wild species Solanum pimpinellifolium. Euphytica 187:63–75.

Role of Biotechnology in Crop Improvement

Seed Times January - April 2017

Nekrasov V, Wang C, Win J, Lanz C, Weigel D, Kamoun S (2017) Rapid generation of a transgene-free powdery mildew resistant tomato by genome deletion. Scientific reports 7:482. Panthee DR, Foolad MR (2012) A reexamination of molecular markers for use in marker-assisted breeding in tomato. Euphytica 184:165-179. Puchta H (2016) Using CRISPR/Cas in three dimensions: towards synthetic plant genomes, transcriptomes and epigenomes. The Plant Journal 87:5-15. Puchta H (2017) Applying CRISPR/Cas for genome engineering in plants: the best is yet to come. Current Opinion in Plant Biology 36:18. Sadashiva AT, Singh A, Kumar RP, Sowmya V, D’Mello DP (2016) Tomato. In: Srinivasa Rao NK, Shivashankara KS, Laxman RH (eds) Abiotic Stress Physiology of Horticultural Crops. Springer, India, pp. 121-131. Scott JW, Gardner RG (2007) Breeding for resistance to fungal pathogens. In: Razdan MK, Mattoo AK (eds) Genetic Improvement of Solanaceous Crops, Vol. 2: Tomato. Science Publishers, pp. 421–456. Scott JW (2007) Breeding for resistance to viral pathogens. In: Razdan MK, Mattoo AK (eds) Genetic Improvement of Solanaceous Crops, Vol. 2: Tomato. Science Publishers, pp. 457–485. Seah S, Williamson VM, Garcia BE, Mejía L, Salus MS, Martin CT, Maxwell DPO. (2007) Evaluation of a co-dominant SCAR marker for detection of the Mi-1 locus for resistance to root-knot nematode in tomato germplasm. Report of the Tomato Genetics Cooperative 57: 37-40. Semagn K, Babu R, Hearne S, Olsen M (2014) Single nucleotide polymorphism genotyping using Kompetitive Allele Specific PCR (KASP): overview of the technology and its application in crop improvement. Molecular Breeding 33:1–14. Slater AT, Cogan NO, Forster JW (2013) Cost analysis of the application of marker-assisted selection in potato breeding. Molecular Breeding 32:299-310. Smith PG (1944) Embryo culture of a tomato species hybrid. Proceedings of the American Society of Horticultural Sciences 44:413–416. Sobrino B, Brión M, Carracedo A (2005) SNPs in forensic genetics: a review on SNP typing methodologies. Forensic Science International 154:181–194. Tabein S, Behjatnia SA, Laviano L, Pecchioni N, Accotto GP, Noris E, Miozzi L (2017) Pyramiding Ty-1/Ty-3 and Ty-2 in tomato hybrids dramatically inhibits symptom expression and accumulation of tomato yellow leaf curl disease inducing viruses. Archives of Phytopathology and Plant Protection 50: 213-227. Truong HT, Kim S, Tran HN, Nguyen TT, Nguyen LT, Hoang TK (2015) Development of a SCAR marker linked to bacterial wilt (Ralstonia solanacearum) resistance in tomato line Hawaii 7996 using bulked-segregant analysis. Horticulture, Environment, and Biotechnology 56:506-515. Waltz E (2016a) Gene-edited CRISPR mushroom escapes US regulation. Nature 532:293. Waltz E (2016b) CRISPR-edited crops free to enter market, skip regulation. Nature Biotechnology 34:582. Wang JF, Ho FI, Truong HTH, Huang SM, Balatero CH, Dittapongpitch V, Hidayati N (2013) Identification of major QTLs associated with stable resistance of tomato cultivar ‘Hawaii 7996’ to Ralstonia solanacearum. Euphytica 190: 241-252. Wang M, Lu Y, Botella J, Mao Y, Hua K, Zhu JK (2017) Gene targeting by homology-directed repair in rice using a geminivirus-based CRISPR/Cas9 system. Molecular Plant, in press

Seed Times January - April 2017

Role of Biotechnology in Crop Improvement

Wang YY, Chen CH, Hoffmann A, Hsu YC, Lu SF, Wang JF, Hanson P (2016) Evaluation of the Ph‐3 gene‐specific marker developed for marker‐assisted selection of late blight‐resistant tomato. Plant Breeding 135:636-642. Wilson C, Tisdell C (2001) Why farmers continue to use pesticides despite environmental, health, and sustainability costs? Ecological Economics 39:449–462. Xing HL, Dong L, Wang ZP, Zhang HY, Han CY, Liu B, Wang XC, Chen QJ (2014) A CRISPR/Cas9 toolkit for multiplex genome editing in plants. BMC Plant Biology 14:327. Yang W, Francis DM 2007. Genetics and breeding for resistance to bacterialdiseases in tomato: prospects for marker-assisted selection. In: Razdan MK, Mattoo AK (eds) Genetic Improvement of Solanaceous Crops, Vol. 2: Tomato. Science Publishers, pp. 421– 456. Yang ML, Zhao TM, Yu WG, Zhao LP (2012) New SSR marker linked to Ty-2 resistance to tomato yellow leaf curl virus. Jiangsu Journal of Agricultural Sciences 5:033. Zsögön A, Cermak T, Voytas D, Peres LE (2016) Genome editing as a tool to achieve the crop ideotype and de novo domestication of wild relatives: case study in tomato. Plant Science 256: 120–130.

The article has been published with permission of authors

Role of Biotechnology in Crop Improvement

Seed Times January - April 2017

Broomrape weeds in Indian mustard; basis of parasitism and its cure Navin Chandra Gupta*, Mahesh Rao**, Rohit Chamola*** and Kanika Kumar**** *Scientist, Sr. Scale, ** Scientist, ***Chief Technical Officer, **** Principal Scientist ICAR-NRCPB, Pusa Campus, New Delhi-110012 navinbtc@gmail.com, mraoiari@gmail.com, kumarkanika@rediffmail.com

Abstract Among the edible oilseed crops cultivated in India, rapeseed-mustard contributes 29% in the total oilseeds production and ranks second after groundnut. Most of the major mustard growing areas in India are experiencing various biotic stresses. Amongst these stresses, broomrape poses a major concern. â&#x20AC;&#x153;Broomrapeâ&#x20AC;? (Phelipanche and Orobanche spp.) are the obligate root plant-parasitic weed belonging to the family Orobanchaceae and constitutes one of the most dreaded biotic stress in mustard and other crops, worldwide. In India, P. ramosa and P. aegyptiaca are the major broomrape species infesting Brassica juncea. Although, several chemicals and cultural methods and practices were developed and are being used to control this problem. However, none of these are effective in countering the parasitic menace of this weed in farmerâ&#x20AC;&#x2122;s field. Hence, integrated use of breeding and biotechnological approaches for breeding for broomrape resistance along with efforts to understand broomrape interaction with the host and mechanism of parasitism will be effective in countering the broomrape infestation in Indian mustard.

Key-Words Germination, haustorium, Mustard, Brassica, Orobanche, parasitism, Phelipanche, plant recognition.

Introduction The broomrapes are obligate plant-parasitic plants from the genera Orobanche and Phelipanche in the Orobanchaceae family (Joel, 2009; Rathore et al., 2014). Because of its achlorophyllous nature, the nutritional requirements of broomrapes are fulfilled by feeding on the host plants with haustorium, an organ unique to parasitic plants(Westwood, 2013).It attacks the roots of almost all economically important crops including rapeseed-mustard in the semiarid regions of the world (Wickett et al. 2011). Infestation of broomrape is difficult to diagnose and manage because of its underground development and late emergence after flowering in rapeseed-mustard (70-90 days after sowing) (Fig 1.).The diversion of nutrition to Phelipanche from rape mustard makes the host plant weak, which ultimately results in poor growth and up to 28.2% reduction in yield (Dhanapal et al. 1996). Strategies designed to control the general weed are not effective in controlling the broomrape because of its mixed traits as weed and as root parasite. Biological traits in broomrape like achlorophyllous nature, underground parasitism, the physical connection through haustoria and growth synchronization with the crop, and the exclusive uptake of nutrition from crop rather than from the soil makes

Seed Times January - April 2017

Role of Biotechnology in Crop Improvement

broomrape control a challenging task. In addition, the biological similarity between the host and broomrape makes it more complex in developing a selective method of controlling the broomrape without affecting the host (Yoder and Scholes, 2010). Therefore, strategy to control this parasitic weed should be aimed to - reduce the broomrape seed production and decrease its viability, distraction strategies to counter the specific detection of host by broomrape, obstruct the bridge connection of broomrape to the cropâ&#x20AC;&#x2122;s vascular system and impede or to endure the parasitic sink after establishment of host-parasite connection. The inclusion of these approaches while developing the methods for countering the broomrape would deliver a more promising outcome. Figure1. Infestation of Indian mustard (Brassica juncea) crop by Broomrape (Phelipanche aegyptiaca).

Conclusion The physiological and metabolic association with the crop, achlorophyllous nature and its underground parasitism with massive seed producing abilities, makes it difficult to control. More so with management strategies specially designed for the non-parasitic weeds. Hence, to control the broomrape menace in crop strategies need be devised in a smarter way. These includes the reduction in the broomrape seed bank, thwarting the induced germination of parasitic weed and hinder the physical connection through haustoria either pre- or post-infestation by biotechnological means.

References Dhanapal GN, Struik PC, Udayakumar M, Timmermans P 1996. Management of broomrape (Orobanche spp.)- a review. Journal of Agronomy and Crop Science 76: 335-359. Joel DM 2009.The new nomenclature of Orobanche and Phelipanche. Weed Research 49: 6-7.

Role of Biotechnology in Crop Improvement

Seed Times January - April 2017

Rathore SS, Shekhawat K, Premi OP, Kandpal BK, Chauhan JS 2014. Biology and management of the fast-emerging threat of broomrape in rapeseed–mustard. Weed Biology and Management 14:145-158. Westwood JH2013.“The physiology of the established parasite-host association,” in Parasitic Orobanchaceae, eds Joel DM, Gressel J, and Musselman LJ (Berlin: Springer). pp. 87-114. Wickett NJ, Honaas LA, Wafula EK 2011. Transcriptomes of the parasitic plant family Orobanchaceae reveal surprising conservation of chlorophyll synthesis. Current Biology 21: 2098-2104. Yoder JI, Scholes JD 2010. Host plant resistance to parasitic weeds; recent progress and bottlenecks. Current Opinion in Plant Biology13: 478-484.

The article has been published with permission of authors

Seed Times January - April 2017

Role of Biotechnology in Crop Improvement

Genome Editing: Development of CRISPR/ Cas9-mediated geminivirus resistance in vegetable crops Bijendra Singh* and Achuit K. Singh** Director, ICAR-Indian Institute of Vegetable Research, Varanasi-221305, U.P. email: bsinghiivr@gmail.com, directoriivr@gmail.com **Senior Scientist, Biotechnology, Crop Improvement Division, ICAR-Indian Institute of Vegetable Research, Varanasi-221305, U.P. email: achuits@gmail.com Keywords: Genome editing, CRISPR/Cas9, Geminivirus, sgRNA

Abstract The expanding weight of the total populace on horticulture requires the advancement of more sturdy crops. As the number of information from sequenced crop genomes increases, scientific knowledge can be utilized to explore the capacity of genes in detail and to make enhanced vegetable crops at the molecular level. Lately, a RNA-customized genome-editing framework developed out of a clustered regularly interspaced short palindromic repeats (CRISPR)- encoded control RNA and nuclease Cas9 has given an effective tool to accomplish these objectives. By coalescing biotechnology tools to work and modify plants at various sub-molecular levels, the CRISPR/Cas9 framework is making fruitful stride towards advancement in essential plant research and crop improvement. Here, we discuss about circumstances, advancements, and potential pitfalls for utilizing this biotechnology innovation to bestow immunity against single and multiple geminivirus infections in vegetable crops.

Introduction It is anticipated that the world populace would increase from the present figure of 6.8 billion to 9.1 billion by the year 2050, indicating toward an extraordinary requirement for feeding the growing population. This challenge can be met only through essential plant research to improve and sustain the crop production. Genomic data of many types of plants are quickly expanding because of the extraordinary throughput, versatility, speed and ease of genomic sequencing techniques, which have prompted the fast era of entire genome sequencing information. Even though vegetable yield has been enhanced through customary plant breeding systems, these strategies are presently obliged by decreases in hereditary variety, which are hampering the development that will be required to nourish the coming generations. Genome editing technology may encourage a superior comprehension of the data resulting from genomic sequencing and of the systems underlying important traits while allowing the formation of new resistant/high yield cultivars through genome engineering. Earlier techniques viz zinc finger nucleases (ZFNs) and Transcription activator-like effector nuclease (TALENs); that are alluded to as ‘’genome editing” have some merits and demerits. The CRISPR/Cas9 system signifies to the latest genome editing technology and advances in both gene targeting and gene mutation in plant. The clustered regularly interspaced palindromic repeats (CRISPR)/CRISPR-associated 9 (Cas9) system originates from an adaptive molecular immunity system of archaea and bacteria, which identifies and debases obtrusive DNA from bacteriophages and conjugative plasmids. (Sorek et al., 2013) Even though there are different sorts of CRISPR/Cas9 frameworks, the most normally used system for genome editing is Cas9 nuclease

Role of Biotechnology in Crop Improvement

Seed Times January - April 2017

(a site-particular DNA endonuclease) from the type II CRISPR/Cas9 arrangement of Streptococcus pyogenes, which requires a NGG (N, any nucleotide; G, guanine) protospacer-associated motif (PAM) sequences for DNA targeting (Wright et al., 2016). Manipulation of this system for biotechnological progresses in plants has prompted the outline of two components, one encoding the Cas9 endonuclease, and the other a synthetic single guide RNA (sgRNA) (Belhaj et al., 2015). The sgRNA, which contains 20-nuclecotides of target sequence information, is utilized to guide the Cas9 endonuclease to its genomic target sequence, which is present prior to trinucleotide sequence the protospacer- associated motif (PAM) (Wright et al., 2016). Several excellent research articles on the CRISPR/Cas9 system are available, that sketch out the expansive use of CRISPR/Cas9 system to give molecular immunity against eukaryotic viruses, including plant DNA viruses. The present review will focus on the CRISPR/Cas9-based molecular interference and its limitations for immunity against geminiviruses.

Challenging progress of Geminivirus-immune vegetable crops Geminiviruses are characterized by their twin icosahedral capsids and small, single-stranded DNA (ssDNA) genome (â&#x2C6;ź 2.7 kb). Based upon the genome organization, insect vectors, host range and genome-wide pairwise sequence identity, the members of Geminiviridae are classified into seven genera, namely Mastrevirus, Curtovirus, Topocuvirus, Begomovirus, Eragrovirus, Turncurtovirus and Becurtovirus. The genus begomovirus, causes widespread destruction of vegetable crops around the world. Begomoviruses are ssDNA virus, with a genome of roughly 2.7 kb. The genomic structure of Begomovirus comprises of six bi-directionally organized, partially overlapping open reading frames (ORFs), with an intergenic region (IR) containing replication origin (Hanley-Bowdoin et al., 2013, Varsani, A. et al. 2014 and Gilbertson et al., 2015). Control and management of the viral diseases caused on by begomovirus are both arduous and costly. Earlier methods to deal with viral diseases were focused on insecticides/pesticides targeting virus transmission vector, the whitefly (Bemicia tabaci). Similarly, developing resistance through breeding has same challenge because of relationship between the resistance locus and genes related with poor product quality. A few endeavors have been made by over-expressing the C4 protein and capsid protein (CP) or the non-coding IR region to modify crops that are immune to begomovirus (Yang et al., 2004). The latter method depends on Rep binding protein to the origin of replication which may meddle with viral replication. Likewise, for resistance, an engineered zinc finger protein has been utilized to obstruct the binding of the replication protein (Rep, C1) of beet severe curly top virus to the origin of replication (Mori et. al., 2013). A similar approach was applied against other begomoviruses (Sera, 2005, Takenaka et al., 2007, Koshino-Kimura et al., 2008, Koshino-Kimura et al., 2009, Chen et al., 2014). Currently no effective methods exist for complete control or management of begomoviruses. A recently developed and widely adapted genome editing tool viz., CRISPR/Cas has been used effectively in several species ranging from simple microorganisms to complex animals and plants. However, till now not much work has been done regarding CRISPR/Cas9 mediated immunity in vegetable crops. Recent reports have shown the portability of the CRISPR/Cas9 machinery to efficiently confer immunity to vegetable infecting geminiviruses in model plants like Arabidopsis thaliana and Nicotiana benthamiana. Ali et al., (2015) demonstrated broad-spectrum immunity against geminiviruses by targeting the conserved nucleotide sequence of multiple geminiviruses at a time. Viz., Beet curly top virus (BCTV), Tomato yellow leaf curl virus (TYLCV) and Merremia mosaic virus (MeMV). Similarly, Baltes et al. (2015) and Ji et al. (2015) showed virus interference activities in model plant Nicotiana benthamiana against Bean yellow dwarf viruses BeYDV and BSCTV, respectively. In 2016 Ali et al. demonstrated that N. benthamiana plants expressing the CRISPR/Cas9 system can target coding and non-coding sequences of different geminiviruses.

CRISPR/Cas gives immunity in crops against geminiviruses The CRISPR/Cas machinery, evolved from bacteria and archaea, works as an adaptive immune system to counter attacking foreign DNA. For example, phages by degrading the nucleic acid by a RNA-guided DNA nuclease in a sequence-specific way (Wright et al., 2015). Recently, may researcher have exhibited versatility of the CRISPR/Cas machinery to increase immunity in plants against geminiviruses (Table 1 and Fig. 1).

Seed Times January - April 2017

Role of Biotechnology in Crop Improvement

Table 1: Comparative summary of sequence-specific nucleases designed to engineer geminivuruses resistance in plant. Tested plant

Marker

Type

species

Nuclease

Arabidopsis thaliana

Zinc finger nuclease (ZFN)

Rep binding site in IR

TYLCV

Competitive binding assay

Sera, 2005

Arabidopsis thaliana

Zinc finger nuclease (ZFN)

Rep binding site in IR

TYLCV

Competitive binding assay

Takenaka et al., 2007

Arabidopsis thaliana

Zinc finger nuclease (ZFN)

Rep binding site in IR

TYLCV

Competitive binding assay

Koshino-Kimura et al., 2008

Arabidopsis thaliana

Zinc finger nuclease (ZFN)

Rep binding site in IR

TYLCV

Competitive binding assay

Koshino-Kimura et al., 2009

Arabidopsis thaliana

Zinc finger nuclease (ZFN)

Rep binding site in IR

BSCTV

Competitive bind- Mori et al., ing assay and 2013 Southern Blot

Nicotiana benthamiana

Zinc finger nuclease (ZFN)

Rep

TYLCCNV and TbCSV

Southern Blot

Chen et al., 2014

Nicotiana benthamiana

Transcription activator-like effector nuclease (TALEN)

Rep binding site in IR

TbCSV, TLCYnV, TYLCCNV, and TYLCCNB

Southern Blot

Cheng et al., 2015

Nicotiana benthamiana

CRISPR/Cas9

IR, CP, and Rep

TYLCV, BCTV, and MeMV

Semi-qPCR, RCA, Ali et al., Southern blot 2015

Nicotiana benthamiana

CRISPR/Cas9

Nicotiana benthamiana

CRISPR/Cas9

IR, CP, and Rep

BSCTV

Nicotiana benthamiana

CRISPR/Cas9

IR, CP, and Rep

CLCuKoV, TYLCV Semi-qPCR, RCA, Ali et al., 2.3, TYLCSV, MeMV, Southern blot 2016 BCTV-Logan, BCTV-Worland

Target

Chr.

Pos.

Forward primer

Geminivirus species Geminivirus viru- References lence assay

LIR and Rep/RepA BeYDV

GFP, CFUs (Esche- Baltes et richia coli) al., 2015 qPCR, Southern blot

Ji et al., 2015

Tomato yellow leaf curl China virus (TYLCCNV), Tobacco curly shoot virus( TbCSV), Tomato yellow leaf curl virus (TYLCV), Beet severe curly topvirus (BSCTV), Tomato leaf curl Yunnan virus (TLCYnV), Tomato yellow leaf curl China betasatellite(TYLCCNB), Beet curly topvirus(BCTV), Merremia mosaic virus(MeMV), Bean yellow dwarf virus (BeYDV), Cotton leaf curl Kokhran virus(CLCuKoV), Tomato yellow leaf curl Sardinian virus(TYLCSV), Replication associated protein (Rep), intergenicregion (IR), long intergenic region (LIR), coat protein (CP). 30

Role of Biotechnology in Crop Improvement

Seed Times January - April 2017

[A]

[B]

Seed Times January - April 2017

Role of Biotechnology in Crop Improvement

Figure1: Diagrammatic illustration of geminivirus replication in an infected and a CRISPR/Cas mediated resistant plant. (A) In the infected plant cell, un-coating of geminivirus particles (virions, brown twin icosahedral) and release of the viral single-stranded DNA(ssDNA) into the host plant nucleus. Upon infection with help of host DNA polymerase viral single-stranded DNA form a complementary strand, resulting in viral double-stranded DNA (dsDNA) molecules. Further, geminivirus replicate their genome by a rolling-circle amplification (RCA) mechanism via a double-stranded DNA (dsDNA) replicative form and form multiple copies of new ssDNA that can re-enter replication or can be packaged into virions. (B) Components of the CRISPR/Cas9 machinery, gRNA, and Cas9, are expressed from the plant genome and form gRNA-Cas9 complex. Upon viral infection, the viral DNA replicates through the dsDNA replicative form inside the nucleus of host cell. The Cas9â&#x20AC;&#x201C;sgRNA complex will target the viral dsDNA for cleavage, inhibiting viral replication. Single guide RNA (sgRNA) and Cas9 nuclease, which are designed combination of the dual RNA that coordinates Cas9 to its DNA target, were expressed in plants. Ali et al. 2015 targeted three different virus species at the same time, e.g. BCTV, MeMV and TYLCV, utilizing a sgRNA coordinating an invariant sequence inside the IR region. The other two findings have demonstrated variable accomplishment while focusing on various sequences in geminiviral genomes. By co-expressing two sgRNAs in the plant there was a significant cumulative effect on reducing the viral DNA titer (Baltes et al., 2015 and Ji et al., 2015). Further, Ali et al., 2016 designed sgRNAs aiming open reading frames encoding the viral capsid protein and Rep protein and the conserved non-coding IR, having a hairpin structure which works as the replication origin. The sgRNAs focusing on the IR region was most effective in lowering down the viral DNA titer. CRISPR/Cas9-mediated virus interference in plants has various essential features, including: 1) the capacity to target numerous DNA viruses at the same time while utilizing a solitary sgRNA targeting on a conserved sequence prior to the PAM sequence, for example a) Cas9/sgRNA binds to origin of replication, and thus access to replication machinery is blocked, b) Cas9/sgRNA digests the viral dsDNA and hence meddles with its replication; or c) the viral genome is mutagenized by Cas9/sgRNA through the error-prone non-homologous end joining (NHEJ) DNA repair pathway that is enlisted by the cleaved viral DNA; 2) holding of multiplexed editing of single or many viruses utilizing numerous sgRNAs; 3) the capacity to breakdown resistance by focusing on recently advanced viral revertant with new sgRNAs; 4) appropriateness to all plant DNA viruses; and 5) relevance to all transformable plant species (Ali et al., 2016). Therefore, setting up the adequacy and expanding the utility of the CRISPR/Cas9 machinery for viral interference in plants will make a stage for analyzing common immunity and invulnerable capacities. In the meantime, it will equip biotechnologists with an influential tool for creating crop/vegetable plants immune to various viral diseases. With regard to its success, the field trials will be important to decide if CRISPR/Cas can make plants more immune to geminiviruses in the natural habitat.

Constraint of employing CRISPR/Cas for immunity counter to geminiviruses CRISPR/Cas offers many points of interest to develop geminivirus resistance in vegetable crops. CRISPR/Cas permits concurrent focusing of a solitary or multiple genetic loci in one or a few geminiviruses. The easiness and sturdiness of the CRISPR/Cas system will make it convenient to answer recently developing strains by transferring proper sgRNA transgenes into a plant. In any case, notwithstanding clear points of interest, the utilization of the CRISPR/Cas system for building geminivirus immune plants is associated with noteworthy difficulties. Primarily, vegetable crops having CRISPR/Cas system may not be positively seen by controllers, resulting in high commercialization value. Thus, the procedure of utilizing CRISPR/Cas for immunity to geminiviruses might be economically suitable for important field crops, for example, maize, however, but may not be attractive for smaller crops/vegetable crops e.g. tomato. Additionally, constitutive expression of Cas9 and sgRNA(s) may bring about off-target mutations in the product genome that could develop after some time with unknown outcome. Likewise, the technique of utilizing many sgRNAs to target on numerous viruses could additionally expand the amount of off target mutations, and the guide sequence inside the sgRNA transgene might mutate so further off-target mutations could get introduced. Inclusive, we need to better comprehend the amount and degree to which CRISPR/Cas off-target mutations emerge in plants. A riveting inquiry is whether CRISPR/Cas framework in plants will apply a tremendous and determinant weight on geminiviruses and accordingly could quicken their advancement. The CRISPR/Cas machinery may choose for synonymous or nonpartisan, nonsynonymous mutation in targeted coding sequences that would empower the geminivirus towards evasion of cleavage. Likewise, there is a possibility that CRISPR/Cas-immunity mutations may emerge inside targeted conserved noncoding sequences, e.g. the emergence of compensatory mutations in the repeat sequence in the IR of Rep protein. The attention is also drawn to the fact that mutagenic nature

Role of Biotechnology in Crop Improvement

Seed Times January - April 2017

of CRISPR/Cas system may enhance the virus evolution. Also, in natural condition when plant is infected by different virus species leading to some recombination between them. If CRISPR/Cas machinery enhances the recombination between distinct geminiviruses, such recombinogenic impact will be additional threat, which should also be considered.

Conclusion: Keeping in the view that emergence and re-emergence of plant viruses and breakage of resistant in vegetable crops against the viruses calls for urgent attention to develop broad-spectrum resistant vegetables. Hence, some of the recent publications on CRISPR/ Cas9 system give a ray of hope for plant biotechnologist on broad-spectrum resistant vegetable varieties against viruses. Therefore, the new technique involving CRISPR/Cas should be considered with regards to different possibilities for managing geminivirus diseases, particularly in the developing world.

References Ali Z, Abulfaraj A, Idris A, Ali S, Tashkandi M, Mahfouz MM 2015. CRISPR/Cas9-mediated viral interference in plants. Genome Biology. 16:238. Ali Z, Ali S, Tashkandi M, Zaidi SS, Mahfouz MM 2016. CRISPR/Cas9-mediated immunity to geminiviruses: differential interference and evasion. Science Reports. 6:26912. Baltes NJ, Hummel AW, Konecna E, Cegan R, Bruns AN, Bisaro DM, et al., 2015. Conferring resistance to gemini viruses with the CRISPR–Cas prokaryotic immune system. Nature Plants 1:15145. Belhaj K, Chaparro-Garcia A, Kamoun S, Patron NJ, Nekrasov V 2015. Editing plant genomes with CRISPR/Cas9. Current Opinion Biotechnology. 32:76–84. Chen W, Qian Y, Wu X, Sun Y, Wu X, Cheng X 2014. Inhibiting replication of begomoviruses using artificial zinc finger nucleases that target viral-conserved nucleotide motif. Virus Genes 48, 494–501. Cheng X, Li F, Cai J, Chen W, Zhao N, Sun Y, et al., 2015. Artificial TALE as a convenient protein platform for engineering broadspectrum resistance to begomoviruses. Viruses 7, 4772–4782. Gilbertson RL, Batuman O, Webster CG, Adkins S 2015. Role of the Insect Super vectors Bemisia tabaci and Frankliniella occidentalis in the Emergence and Global Spread of Plant Viruses. Annual Review of Virology 2, 67–93. Hanley-Bowdoin L, Bejarano ER, Robertson D, Mansoor S 2013. Geminiviruses: masters at redirecting and reprogramming plant processes. Nature Reviews Microbiology 11, 777–788. Ji X, Zhang H, Zhang Y, Wang Y, Gao C 2015. Establishing a CRISPR-Cas-like immune system conferring DNA virus resistance in plants. Nature. Plants 1:15144. Koshino-Kimura Y, Takenaka K, Domoto F, Ohashi M, Miyazaki T, Aoyama Y, et al. 2009. Construction of plants resistant to TYLCV by using artificial zinc-finger proteins. Nucleic Acids Symp. Ser.(Oxf.) 53, 281–282. Koshino-Kimura Y, Takenaka K, Domoto F, Aoyama, Sera T 2008. Generation of plants resistant to tomato yellow leaf curl virus by using artificial zinc-finger proteins. Nucleic Acids Symp. Ser. (Oxf.) 52, 189–190. Mori T, Takenaka K, Domoto F, Aoyama Y, Sera T 2013. Inhibition of binding of tomato yellow leaf curl virus rep to its replication origin by artificial zinc-finger protein. Molecular Biotechnology. 54, 198–203. Sera, T 2005. Inhibition of virus DNA replication by artificial zinc finger proteins. Journal of Virology. 79, 2614–2619.

Seed Times January - April 2017

Role of Biotechnology in Crop Improvement

Sorek R, Lawrence CM, Wiedenheft B, 2013. CRISPR-mediated adaptive immune systems in bacteria and archaea. Annual Review of Biochemistry. 82:237–266. Varsani, A. et al. 2014. Establishment of three new genera in the family Geminiviridae: Becurtovirus, Eragrovirus and Turncurtovirus. Archives of virology, 1–11, Wright AV, Nunez JK, Doudna JA 2016.Biology and applications of CRISPR systems: harness singnature’s tool box for genome engineering. Cell 164, 29–44. Yang Y, Sherwood TA, Patte CP, Hiebert E, Polston JE 2004. Use of tomato yellow leaf curl virus (TYLCV) Rep gene sequences to engineer TYLCV resistance in tomato. Phytopathology. 94(5):490–496.

The article has been published with permission of authors

Role of Biotechnology in Crop Improvement

Seed Times January - April 2017

Identification And Utilization Of Qtls; A Way Forward to Improve Seed Vigour and Longevity Dr Manisha Negi Assistant director â&#x20AC;&#x201C; Scientific Affairs National Seed Association of India, New Delhi-110001 E-mail- manisha.negi@nsai.co.in

Introduction: Cropping lies at the heart of human innovation, and genetic diversity of crops developed by farmers over several millennia, aided over the last century by plant breeders and scientists is critical for its success. A sample of this diversity in the major crop species at least is maintained in collections curated in a variety of ex situ gene banks. Seeds (and in some cases other plant material) held in these collections provide the raw materials required for breeding crop varieties able to withstand environmental change and the everincreasing demand for improved yield and quality On the other hand for agricultural purpose seed is also stored from one cropping season to next cropping season, and in some cases it is stored for more than one cropping season interval. During seed storage, the deterioration is obvious which decreases vigour of seed. Because of this the seed technologists are continuously engaged in the exploitation of phenomenon of seed vigour and various factors that affects seed vigour. Seed vigor is a complex physiological trait required to ensure the rapid and uniform emergence of plants in the field, under different environmental conditions. Seed vigor essentially depends on the ability to withstand prolonged storage (i.e., Seed longevity) and the deleterious effects of aging. The assessment of seed vigor has many important implications to the seed industry as a basic monitoring of seed physiological potential during different phases of seed production and a support for strategic decisions regarding the selection of high quality seed lots to meet the consumer demand. The potential attributes of seed vigor as a fundamental physiological seed characteristic and its association with field stand establishment and crop productivity has been worldwide recognized from the 1960s onward. This led to the diversification of research ap-proaches involving the synchronization of different physiological characteristics and events that determine the potential for high performance during seed storage and after sowing. Seed longevity is an important consideration in the context of ex situ conservation. Its non-genetic determinants are the ambient environment during seed development, the seedâ&#x20AC;&#x2122;s moisture content and maturity of the seed at harvest, the presence of pathogenic micro flora on the surface of, or within, the seed, the extent of mechanical damage to the seed and the post-harvest storage conditions. Superimposed upon these variables is a genetic component of seed longevity; for example, seed of pea and alfalfa can remain viable for many decades, while those of other species (e.g., lettuce, onion, parsnip and rye) are short-lived. If the loci determining the genetic components of seed vigour and longevity were identified, plant breeders would be able to select specifically for alleles contributing to improved seed vigour. In the other crops in which seed storage is problematic for longer duration due to poor seed longevity these identified QTLs can be utilized to improve their longevity.

History behind seed vigour: The evaluation of seed physiological potential is well documented in the literature beginning with observations from Nobbe, in 1876 that proposed procedures for a germination test. During the 1940â&#x20AC;&#x2122;s, the first studies for the determination of seed viability by the tetrazolium (TZ) test were reported. Seed Times January - April 2017

Role of Biotechnology in Crop Improvement

The term ‘seed vigor’ was introduced by F. Nobbe in 1876, in his “Handbuch der Samenkunde”. In 1911, Hiltner and Ihssen used the term triebkraft to imply “driving force” and “shooting strength” of germinating seedlings, to highlight seeds that produced seedlings with longer roots in comparison to those from “weaker” seeds from the same lot. The early days of research on seed vigor and its evaluation included studies conducted by Hiltner and Ihssen who developed the brick gravel test, It was not until 1950, however, at the International Seed Testing Association (ISTA) Congress held in Washington, D.C. that this seed quality attribute was focused on. The identification of vigor as a component of seed physiological potential, independent from seed germination, gained considerable credence as a separate and essential component of seed quality. At that time, Franck (1950), during that ISTA meeting, proposed differentiating the terminology and objectives of standard germination tests (performed with artificial substrates under optimum environmental conditions) prevailing in Europe from tests performed under field conditions or related to the percentage of seedling emergence (following methodology used in the USA). It was therefore proposed and accepted a new term, vigor tests, to better express the seed physiological potential, mainly under suboptimal conditions. During the 1960s, research on the evaluation of vigor and its influence on seed performance were intensified, an effort that also stimulated significant research on other aspects of Seed Physiology. The progress of knowledge about seed vigor, maturation and deterioration resulted in a diversification of research approaches, leading to a chain reaction and synchronization of different themes closely associated with seed physiological potential, the activity of repair mechanisms, recalcitrance in seeds, desiccation tolerance, and concept, techniques and effects of priming. In the recent research scientists are doing molecular research to enhance seed vigour by QTL mapping and linkage mapping of the genomic regions. These studies are not only helpful to identify the QTLs responsible for high seed vigour and longevity, but also these studies will give a new direction to utilize these QTLs in improving seed vigour of different crops. Consequently, the recognition of the significance and importance of seed vigor, its correct evaluation and influence on seed performance can be considered the main factor. These topics remain the major contents of scientific and technical seed journals, presentations in meetings, congresses, seminars, and books about seeds and represent the primary interests of seed companies and consumers when asked about their research priorities.

Molecular aspects of seed vigor New cultivars are generally selected based on the quality of fresh products while traits related to seed quality, such as longevity and germination efficiency, are often excluded from breeding programmes. A typical example is lettuce (Lactuca sativa L.), largely selected for leaf phenotypes and less frequently for seed vigor, although seed companies and their market would for sure benefit from the availability of high quality seeds. Germination of lettuce seeds is strongly under temperature control since efficiency declines with increase in temperature and this aspect represents one of the most relevant obstacle to seed quality improvement (Jahangar et al. 2009). On the other hand, seed performance is a relevant trait when new cultivars are used for breeding purposes. Biomarkers of seed vigor can be highlighted by comparing varieties having different levels of vigor. Different level of gene expression and enzyme activities and also differences in signal transduction responses and regulatory mechanisms need to be considered as a possible source of molecular markers. It is generally acknowledged that the expression profiles of key genes under specific environmental conditions, might be an important tool for improving selection. On the basis of these concepts QTLs for seed vigour are identified based on different stress responses of seed. Under the different vigour tests when seed is exposed to different stress (high temperature, high RH, accelerated ageing, cold test, controlled deterioration test and electrical conductivity test) some seed show high vigour and longevity. The seeds showing better performance are studied for the QTL mapping to find out the genes which are responsible for better seed vigour. These molecular studies are based on the physiological basis of Seed Vigour. Physiological basis of seed vigour 1. Seed size 2. Seed ageing and deterioration 3. Factors during seed storage 4. Metabolic efficiency

Role of Biotechnology in Crop Improvement

Seed Times January - April 2017

These physiological basis are utilized for identification of QTLs for different seed vigour related traits.

1. Seed size: Seed size is an important physical indicator of seed quality that affects vegetative growth and is frequently related to yield, market grade factor and harvest efficiency. Seed size has positive correlation with seed vigour. Seeds originating from the same seed lot contain different seed sizes and can affect seedling establishment, growth and yield.

Causes in Differences in seed size • Difference in species and variety / genetic makeup of seed • Due to environmental factors • Due to agronomic practices Quantitative genetic analysis of seed vigour and premergence seedling growth traits in Brassica oleracea has been done by Bettey et al., (2000). They identify different linkage group in Brassica Seeds for different seed vigour related traits. For seed quality traits like seed weight O6, O9 linkage groups were identified with 14.2 per cent phenotypic variance by QTL. For other quality parameters like shoot & root length, shoot & root weight and shoot & root growth rate they also identified different linkage group. These identified linkage groups can be utilized for improving seed vigour. Genes associated with relevant agronomical traits, such as seed size, might be utilized for enhancing agriculture production. It has been demonstrated that the ARF (Auxin Response Factor) genes affect seed size in Arabidopsis and rice (Oryza sativa L.) and that Arabidopsis mutants defective in ARF2, a negative regulator of cell growth, produce larger seeds compared with wild type plants (Okushima et al. 2005).

2. Seed ageing and deterioration Seed aging is characterized by a sigmoid relationship between viability and time, in which a phase of no apparent change in vigour is followed by a phase of rapid death. Seed ageing and deterioration, is the major cause of differences in seed vigour and has been described as the accumulation of deleterious changes within the seed until the ability to germinate is lost. Seeds age due to deterioration during: • Seed production- At the time of seed production seed quality may deteriorate due to bad weather conditions and delayed harvesting. After harvesting at the time of seed processing and transportation bad handling of seed also results in seed deterioration. • Storage – At the time of storage, storage temperature, seed moisture content and storage relative humidity affects the rate of seed deterioration. Genetic studies of seed longevity in hexaploid wheat using segregation and association mapping approaches was done to identify QTLs (Rehman et al. 2011). They done their study focusing on identification of those QTL which are associated with the seed longevity at the time of different stress treatment. They present the outcome of a genetic dissection of seed longevity in bread wheat. Under the artificial accelerated ageing and controlled deterioration condition QTLs are identified by them in range of 8-10 per cent phenotypic variance for different seed vigour related traits. They applied both a standard quantitative trait locus analysis based on segregation from a biparental cross, and an association analysis using a germplasm panel to detect marker trait associations. They later revealed more loci than the former. The results open perspectives for identification of favorable longevity alleles and the more accurate prediction of seed longevity in cereal germplasm collections. QTLs for seed vigor-related traits were identified in maize seeds germinated under artificial aging conditions (Han et al., 2014). They use single-nucleotide polymorphism (SNP) markers to map quantitative trait loci (QTLs) for four seed vigor traits in two connected recombinant inbred line (RIL) maize populations under artificial ageing condition. Sixty-five QTLs distributed between the two populations were identified and a meta-analysis was used to integrate genetic maps. Sixty-one initially identified QTLs were

Seed Times January - April 2017

Role of Biotechnology in Crop Improvement

integrated into 18 meta-QTLs (mQTLs). These mQTLs are identified for different seed vigour traits viz. germination percent, germination energy, root & shoot dry weight in maize. These QTLs are responsible for seed vigour related traits under accelerated ageing and can be utilized to improve maize seed longevity by marker assisted breeding programme.

3. Factors during seed storage Two most important environmental factors that influence seed storage life are temperature and relative humidity. Of the two stages factors, the seed moisture content exerts a greater impact on seed longevity than the temperature. However, several other factors are known to govern the relationship between the seed moisture and longevity. Over the years, a lot of data have also been generated to show that it is not only the moisture content, at which the seed is stored, which determines its longevity. Dargahi et al., (2014) identified the genomic regions controlling seed storability in soybean. They use SSR markers to identify genomic regions associated with quantitative trait loci (QTLs) controlling seed storability based on relative germination rate in the F2:3 population derived from a cross between vegetable soybean line (MJ0004-6) with poor longevity and landrace cultivar from Myanmar (R18500) with good longevity. Single marker analysis revealed that 13 markers from six linkage groups (C1, D2, E, F, J and L) were associated with seed storability. Andres et al., (2010) also studied QTL associated with longevity of lettuce seeds under conventional and controlled deterioration storage conditions. Lettuce exhibit Poor shelf life and thermo inhibition. Priming results in reduction of longevity compared to nonprimed lettuce seeds controlled deterioration (CD) or accelerated ageing storage conditions (i.e. elevated temperature and relative humidity) are used to study seed longevity and to predict potential seed lifetimes under conventional storage conditions. Multiple longevity-associated QTLs were identified under both conventional and CD storage conditions for control (non-primed) and primed seeds. These identified QTLs show a range of 7.2 – 19.2 percent phenotypic variance for seed longevity associated traits. QTLs identified for these longevity associated traits can be utilized in other crops also to increase their storage potential for a prolong time. Utilization of these QTLs can be done by molecular marker assisted breeding programme. QTL for seedling vigour identified in rice under three temperature conditions (Zhang et al., 2005 ) they studied a set of recombinant inbred lines derived from a rice cross were assessed for seedling vigor related traits in natural field environments including two treatments (drained soil and flooded soil). Composite interval mapping identified nine QTL for seedling vigor traits that correlated positively with each other. These nine QTLs are identified under three temperature conditions (15, 20 and 25° C) for germination rate, seedling & root length and dry weight.

4. Metabolic efficiency Seed metabolic efficiency may be defined as the amount of shoot and root dry matter (g) produced form 1 unit (g) of dry seed weight that was respired. Higher the value of seed metabolic efficiency (SME), the higher is the efficiency of seed as more seed reserves would be used for producing roots and shoots (Sikder et al., 2009). SME

Shoot dry weight + Root dry weight Seed material respired

Davar et al., (2011) studied quantitative trait loci for seedling vigour and development in sunflower (Helianthus annuus L.) using recombinant inbred line population. The ability of seeds to germinate and establish seedlings in a predictable manner under a range of conditions has a direct contribution to the economic success of commercial crops, and should therefore be considered in plant breeding programs. Quantitative trait loci (QTLs) implicated in seedling vigour and development of sunflower were investigated using a population of recombinant inbred lines (RILs) developed through single-seed descent from the cross ‘PAC2 × RHA266’. Different traits associated with germination, seedling vigour, early growth and development were studied. A large genetic variation and transgressive segregation was observed for all the studied traits. In sunflower QTL-mapping was performed using a high-density simple sequence repeat/ amplified fragment length polymorphism (SSR/AFLP) linkage map. Several QTLs associated with the seedling vigour related traits viz. speed of germination, days to seedling emergence, root & shoot length, fresh root & shoot weight, dry root & shoot weight were identified.

Role of Biotechnology in Crop Improvement

Seed Times January - April 2017

Conclusion: In addition to many attempts to improve the level of understanding of various aspects of seed performance, new knowledge about seed vigor has come from the fields of molecular biology, biotechnology, biophysics and seed and seedling imaging analyses. These new approaches have enhanced our understanding of various aspects of seed physiology and technology, and are considered symbols of modernity that should serve as important complements to traditional seed research. The availability of high quality seeds contributes to increase food production and making feasible their use for different purposes. For this reason, all the possible aspects of seed physiology related to vigor need to be investigated with the most innovative technologies, in order to build up a clear picture of the key molecular players. Seed vigour is determined by both genetic and environmental components and although the environmental influences on seed vigour have been extensively studied the genetic components are less well understood. However, seed vigour remains difficult to assess, because it is a complex trait determined by a number of different factors. If the loci determining the genetic components of seed vigour were identified, plant breeders would be able to select specifically for alleles contributing to improved seed vigour. The availability of locus-specific molecular markers for seed vigour would be of great benefit, providing the potential for more rapid screening of beneficial combinations of alleles in breeding programmes. Furthermore, informationâ&#x20AC;&#x2122;s obtained from model plant need to be rapidly translated to commercially relevant species and tested on large scale samples to address the needs of seed companies as well as the seed bank operators.

Acknowledgement The author is thank full to Dr. Kalyan Goswami, Executive Director, NSAI and Mr. A.S.N. Reddy, General Secretary, NSAI for their invaluable suggestions and advice for preparation of this article.

References: Andres, R., Schwember and Bradford, J.K. 2010. Quantitative trait loci associated with longevity of lettuce seeds under conventional and controlled deterioration storage conditions. J. Exp. Bot., 61(15): 4423â&#x20AC;&#x201C;4436. Bettey, M., Finch-savage, W. E., King, G.J. and Lynn, J.R. 2000. Quantitative genetic analysis of seed vigour and pre-emergence seedling growth traits in Brassica oleracea. New Phytol., 148: 277-286 Dargahi, H., Tanya, P. and Srinives, P. 2014. Mapping of the genomic regions controlling seed storability in soybean (Glycine max L.). J. Genet., 93: 365-370 Davar, R., Majd, A., Darvishzadeh, R. and Sarrafi, A. 2011. Mapping quantitative trait loci for seedling vigour and development in sunflower (Helianthus annuus L.) using recombinant inbred line population. Plant omics J., 4 (7): 418-427. Han Z, Ku L, Zhang Z, Zhang J, Guo S, et al., 2014. QTLs for Seed Vigor-Related Traits Identified in Maize Seeds Germinated under Artificial Aging Conditions. PLoS ONE 9(3): e92535. doi:10.1371/journal.pone.0092535. M.M. Jahangar, Amjad, M., Afzal, I., Iqbal, Q. and Nawaz, A. 2009. Lettuce achene invigoration through osmopriming at supraoptimal temperature, Pak. J. Agric. Sci. 46. Okushima, Y., Mitina, I., Quach, H.L. and Theologis, A. 2005. Auxin response factor 2 (ARF2): a pleiotropic developmental regulator, Plant J., 43-46. Rehman, M. A., Arif, M., Nagel, K., Neumann, B., Kobiljski, U. and Lohwasser, A. B. 2011. Genetic studies of seed longevity in hexaploid wheat using segregation and association mapping approaches. Euphytica, 11: 471-485. Sikder, S., Hasan, M. A. and Hossain, M. S. 2009. Germination Characteristics and Mobilization of Seed Reserves in Maize Varieties as Influenced by Temperature Regimes. J Agric Rural Dev, 7(1&2): 51-56. Zhang, Z. H., Qu, X. S., Wan, S., Chen, L.H. and Zhu, Y. A. 2005. Comparison of QTL controlling seedling vigour under different temperature conditions using recombinant inbred lines in rice (Oryza sativa). Annals of Bot., 95: 423 - 429.

Seed Times January - April 2017

Role of Biotechnology in Crop Improvement

Molecular Breeders Adopted Orphan Pulse Crops for Genetic Improvement Dr Shourabh Joshi and Dr Rajani Shourabh Joshi1 and Rajani1 Assistant Professor, Department of Agriculture, Faculty of Science- JaganNath University, Jaipur-303901 1

Email: rawat.rajni08@gmail.com

Abstract Pulses are legumes and rich source of protein to most of the world’s marginal and vegetarian population. It’s not only helps to improve soil characteristics but also helps to enrich soil micro flora. Pulse production not only helps to supplement dietary requirements but also improves nutritional, food security and environmental sustainability. Therefore, for a developing country like India various policy driven approaches adopted by government and genetic improvement are key methods to overcome production constraints and breakdown yield barriers. In the present article, major emphasis is kept on various molecular breeding tools to broaden narrow genetic base available in pulses crops. Keywords: Ecosystem resilience, environmental sustainability, Pulses Development Scheme, gene pyramiding and synteny. Pulses, a versatile group of twelve leguminous crops which produce an edible seed that grows within a pod imparts major plant-based protein supplement to a country where by-enlarge population prefers to be vegetarian. Pulses are important source of protein (poor man’s meat (Reddy 2010), high in fiber content and provide ample quantity of vitamins and minerals. Pulses are important component to sustain the agriculture production as the pulse crops possess wider adaptability, improves soil fertility being leguminous in nature and physical health of soil while making soil more porous due tap root system. They are ideal in achieving three developmental goals in developing countries—improving nutrition and health conditions, reducing poverty through higher food security, and enhancing ecosystem resilience. Keeping in view large benefits of pulses for human health, the United Nations has proclaimed 2016 as the “International Year of Pulses”.

Role of Biotechnology in Crop Improvement

Seed Times January - April 2017

India contributes the largest shares about 25% productions, about 33% acreage and about 27% consuming of total pulses of the world. Availability of pulses reduced from 22.1 kg/capita/year in 1951 to 15 kg/capita/year during 2012. Thus, the availability of pulses is quite lower than actual recommendation of WHO as 80 grams/capita/day (29.2 kg/capita/year). Self sufficiency in pulse production not only helps to supplement dietary requirements but also improves nutritional, food security and environmental sustainability. The demand for pulses necessarily depends on the availability and prices of pulses of diverse varieties. Apart from the demand-supply side problems, policy matters, present article will concentrate on key issues as such as abiotic, biotic factors and yield barriers. Trends in pulses production from 2001 to 2011 and projections for 2020.

The enhancement of domestic production of pulses is more realistic and appropriate to meet growing requirement of the country and for that technological breakthrough is needed. In the recent time, Government of India has launched a number of schemes/ programmes time to time for area expansion and productivity enhancement to increase the pulses production in country. Among them major initiatives are “Pulses Development Scheme (4th FiveYear Plan (FYP), National Pulse Development Project (7th FYP), Special Food Grain Production Programme (1989-90), Integrated Scheme of Oilseeds, Pulses, Oilpalm & Maize (ISOPOM) (2004) and National Food Security Mission (NFSM) 2007-08”.Under NFSM a special programme ‘Accelerated Pulses Production Programme’ (A3P) was also launched in year 2010-11. Introduction of the chickpea crop into non-traditional areas such as South Indian states is an example of technological and institutional breakthrough that has the potential to be replicated in other areas and also in other crops. The area under chickpea is shifting from northern states to southern states. The seed replacement rate of different pulses crops has improved - in chickpea from 9.87% (200405) to 21.17% (2012-13), in pigeon pea from 9.80 % (2004-05) to 21.46% (2012-13); and similarly in other pulses seed replacement rate has also improved considerably. This means more availability of quality seed of improved varieties being made available to famers and it is one of the factors contributing to better harvest of pulses in recent years.

Seed Times January - April 2017

Role of Biotechnology in Crop Improvement

Integration of conventional breeding approaches with cutting edge technologies such as genomics, molecular marker-assisted breeding, transgenic, it is possible to develop suitable varieties that tolerate biotic and abiotic stress, have high input use efficiency and desired quality traits. Decoding of genome of the two major crops, chickpea and pigeon pea, will definitely accelerates the precision breeding to evolve new cultivars with high yield potential and yield stability across the agro-ecological zones of the India. It is also envisaged to broaden the genetic base of cultivated species of different pulse crops by strengthening pre-breeding, harnessing potential of hybrid breeding particularly in pigeon pea, mapping and tagging of genes of interest, gene pyramiding for durable resistance, development of transgenic for pod borer resistance and other biotic stresses i.e. SMD, FW in pigeon pea and chickpea, in particular. Figure shows synteny between the pigeonpea and soybean genomes (Courtesy: Varshney et al., 2012).

In the year 2012, ICRISAT scientistâ&#x20AC;&#x2122;s team led by Dr Rajeev K. Varshney, sequenced the pigeon pea genome which enables identification of the structure and function of more than 48,000 genes of pigeon pea. Identification of unique genes which can be exploited to develop high yielding varieties, identification of synteny among the species to identify evolution pattern. This would also help cut down on the time taken to breed new varieties, from 10-12 years to just about 5-6 years. To break the yield barrier in pigeon pea, ICRISAT and partners have developed medium maturity hybrids, ICPH 2671 and ICPH 2740, which have produced 30-40% greater grain yields than the popular varieties across farmersâ&#x20AC;&#x2122; fields in India. Molecular breeders are involved in the development of short duration, photo-thermo insensitive varieties of pulses for different agro climatic zones, development of hybrids in pigeon pea, development of efficient plant architecture in major pulse crops and development of multiple disease and pest-resistant varieties to reduce yield loss of standing crop and to increase yields. To enhance area and production of pulse crops, crop specific and region specific approaches should be assured in order to achieve self sufficiency in pulse production and breakdown yield barriers in pulses.

Role of Biotechnology in Crop Improvement

Seed Times January - April 2017

References • J C Sandhu published online article as “Status of Pulses in India” under Indian Pulses and Grain Association. • Reddy, A. A., 2009. Pulses Production Technology: Status and Way Forward. Economic and Political Weekly, Vol. 44, (52): 73–80, December 2009. • Varshney, R. K., Chen, W. B. and Li, Y. P. 2012. Draft genome sequence of pigeonpea (Cajanus cajan), an orphan legume crop of resource-poor farmers. Nat Biotechnol, 30, 83-U128.

The article has been published with permission of authors

Seed Times January - April 2017

Role of Biotechnology in Crop Improvement

NSAI PUBLICATIONS

SEED TIMES MAGAZINE

NEWS LETTER 44

Role of Biotechnology in Crop Improvement

INDUSTRY HANDBOOK Seed Times January - April 2017

Plant tolerance to high temperature stress and strategy for the development of tolerant variety PRANAB HAZRA Professor Department of Vegetable crops, Faculty of Horticulture Bidhan Chandra Krishi Viswavidyalaya Mohanpur-741252, Nadia, West Bengal Email: hazra.pranab05@gmail.com

Abstract The term abiotic stress is best defined as any factor exerted by the environment on the optimal functioning of a plant. High temperatures above optimal have generally damaging effects on plant development which has led to the prediction that Global warming have a negative effect on plant growth. High temperature regimes may cause severe yield reduction leading to even famine. High temperature stress has wide range of effects on plant in terms of physiology, biochemistry and gene regulation pathways. In this article, focus has been given to understand the impact of high temperature stress and the mechanisms of plant tolerant to high temperature stress along with different approaches to develop new varieties which may give sustainable yield at high temperature regime as well as under larger temperature fluctuations. Key words: Abiotic stress, global warming, heat stress, disorder, food security, heat tolerance, yield

Introduction Stress is a relative term, measured in comparison to survival, biomass accumulation or seed yield in a species. The most commonly encountered abiotic stress factors are drought, flooding or submergence, temperature extremes such as heat stress, cold spells and freezing and soil ion content, typically in the form of increased salinity (i.e., high sodium content).Climate change refers to a change in the state of the climate that can be identified (e.g. using statistical tests) by changes in the mean and/or the variability of its properties and that persists for an extended period, typically decades or longer. It has been estimated that CO2 concentration in the atmosphere has increased drastically from 280 ppm to 370 ppm and is likely to be doubled in 21st century (IPCC, 2007). With the increase in CO2 and other green-house gases, a rise in global mean temperature in the range 1.8â&#x20AC;&#x201C;4.0 Â°C higher than the current level by 2100 is predicted (IPCC, 2007) which is the threat to the biosphere. The Indian climate has undergone significant changes showing increasing trends in annual temperature with an average of 0.56Â°C rise over last 100 years (Rao et al. 2009; IMD, 2010). Heat stress has known effects on the life processes of organisms, acting directly or through the modification of surrounding environmental components. Plants are sessile organisms because they spend their lives anchored to the substrate and cannot move to more favourable environments as a result of which plant growth and developmental processes are substantially affected, often lethally, by high temperature stress (Lobell and Field, 2007). Rate of plant growth and development is dependent upon the temperature surrounding the plant and each species has a specific temperature range represented by a minimum, maximum, and optimum. The evidence of global warming has increased the interest in the cause of yield declines at temperatures only slightly above optimal in different crops such as rice (Baker and Allen 1993; Wheeler et al, 2000), groundnut (Vara Prasad et al. 1999), sorghum (Craufurd et al. 1998), cowpea (Craufurd et al. 1998), tomato (Peet et al. 1998; Hazra and Ansary, 2008), wheat (Barlow et al., 2015), etc. Seed Times January - April 2017

Role of Biotechnology in Crop Improvement

Analysis by Meehl et al. (2007) revealed that daily minimum temperatures will increase more rapidly than daily maximum temperatures leading to the increase in the daily mean temperatures and a greater likelihood of extreme events and these changes could have detrimental effects on yield.

Heat stress Abiotic stresses either individually or in combination cause morphological, physiological, biochemical and molecular changes that adversely affect plant growth and ultimately yield. Of the major forms of abiotic stress plants are exposed to in nature viz., heat, drought, cold and salinity, heat stress has an independent mode of action on the physiology and metabolism of plant cells. The susceptibility to high temperatures in plants varies with the stage of plant development however, it depend on the species and genotype, with abundant inter- and intra-specific variations (BarnabĂĄs et al., 2008; Sakata and Higashitani, 2008). 1. Anatomical and morphological changes Temperatures higher than the optimal can cause burning of twigs and leaves, senility of leaf and abscission, prohibition in the development of shoot and root, discoloration of fruit which lead to diminished production (Ismail and Hall, 1999; Vollenweider and Gunthardt-Goerg, 2005). High temperature considerably affects the anatomical structures not only at the tissue and cellular levels but also at the sub-cellular level. The cumulative effects of all these changes under high temperature stress may result in poor plant growth and productivity. A general tendency of reduced cell size, closure of stomata and curtailed water loss, increased stomatal and trichomatous densities and greater xylem vessels of both root and shoot has been observed at the whole plant level (AË&#x153;non et al., 2004). 2. Negative impact on reproductive manifestation Sexual reproduction and flowering in particular have been long recognized as extremely sensitive to heat stress, which often results in reduced crop plant productivity (Hedhly et al., 2009; Thakur et al., 2010). The most affected stage is the reproductive phase and the affected process is the physiology related to pollen grain development. However, several studies on different vegetable and other crops have documented that bud drop before pollination, undeveloped flowers, persistence of flower and calyx for a long time without fruitset, splitting of antheridial cone, lack of anther dehiscence, poor pollen production, pollen sterility, degeneration of embryo sac, browning and drying of stigma, reduction in stigma receptivity, style elongation, under developed ovary, poor fertilization, slow pollen tube growth, poor pollen viability and germinability, poor ovule viability, ovule abortion and embryo degeneration, disruption in meiosis and prevention of pollen formation, hindered sugar metabolism and failure of viable pollen production, reduced carbohydrate availability for the fruits, reduced total soluble protein content, developmental abnormalities and poor fruit set, reduction in fruit size and seeds/fruit and inhibition of pathogen induced resistance mechanisms are some of the negative impact of high temperature stress on reproductive manifestations in the crops (Sato et al. 2001; Hazra and Ansary, 2008; Hatfield et al., 2011). All these changes lead to a single result: non setting of fruits/pods and thus significant reduction in yield. Heat stress often accelerates rather than delays the onset of anthesis, which means that the reproductive phase of development will be initiated prior to the accumulation of sufficient resources (Zinn et al., 2010). High temperature is most deleterious at the stage of flower bud initiation, and that this sensitivity is maintained for 10â&#x20AC;&#x201C;15 days (Hedhly et al., 2009; Nava et al., 2009) most probably as result of reduced water and nutrient transport during reproductive development (Young et al., 2004). The developmental pathway for the male gametophyte (pollen grains) starts with the separation of the reproductive tissues of the anther, continues with meiosis of the pollen mother cell, followed by mitosis and microspore maturation that results in the mature pollen grain. After initiation, the highly specialized anther tissues will acquire non-reproductive (e.g., the tapetum for support, the stomium for dehiscence) or reproductive functions (the pollen mother cell for pollen formation). Both tapetum and microspore development are essential for male fertility, as documented by numerous studies on male sterile mutants (Jaggard et al., 2010; Zinn et al., 2010). The male gametophyte is particularly sensitive to high temperatures at all stages of development, while the pistil and the female gametophyte are considered to be more tolerant (Hedhly, 2011). High temperature stress is possibly linked to tapetum degeneration and pollen sterility in several plant species (Oshino et al., 2007; Endo et al., 2009). Heat stress also induces early abortion of tapetal cells which cause the pollen mother cells to rapidly progress toward meiotic prophase and finally undergo programmed cell death (PCD), thus leading to pollen sterility (Sakata and Higashitani, 2008; Parish et al., 2012).

Role of Biotechnology in Crop Improvement

Seed Times January - April 2017

Heat stress also reduces carbohydrate accumulation in pollen grains and in the stigmatic tissue by altering assimilates partitioning and changing the balance between symplastic and apoplastic loading of the phloem (Taiz and Zeiger, 2006). Heat stress down-regulates sucrose synthase and several cell wall and vacuolar invertases in the developing pollen grains; as consequence, sucrose and starch turnover are disrupted and thus soluble carbohydrates accumulate in reduced levels (Sato et al., 2006). Continuing heat stress beyond a successful fertilization can also halt further development of the embryo (Barnabás et al., 2008). 3. Physiological, cellular and molecular impact of high temperature stress High temperatures negatively affect various physiological processes including photosynthesis, primary and secondary metabolism and hormonal signalling. Heat stress has negative effects on plant growth and development by disrupting the stability of various proteins, membranes and cytoskeleton structures. Heat induces accumulation of “Heat Shock Proteins” (HSPs) which prevent protein degradation and it also causes a state of metabolic imbalance and the build-up of toxic by-products, such as “Reactive oxygen species” (ROS) which are chemically reactive chemical species containing oxygen viz., peroxides, superoxide, hydroxyl radical and singlet oxygen. These ROS ultimately affect plant vegetative and reproductive development, with negative consequences on fruit set, yield and product quality. Heat stress induces changes in respiration and photosynthesis and thus leads to a shortened life cycle and diminished plant productivity (Barnabás et al., 2008). Heat stress induces major modifications at the sub-cellular level in chloroplasts, leading to significant reduction in photosynthesis by changing the structural organization of thylakoids (Karim et al., 1997). Loss of grana stacking or its swelling, disruption of vacuoles and mitochondria has also been reported as the specific effects of high temperatures resulting in reduced photosynthetic and respiratory activities (Zhang et al., 2005). Homeostasis in general, including biosynthesis and compartmentalization of metabolites is disturbed in plant tissues due to high temperature stress (Maestri et al., 2002). High temperature modifies the activities of carbon metabolism enzymes, starch accumulation and sucrose synthesis by down-regulating specific genes in carbohydrate metabolism (Ruan et al., 2010). Among the primary metabolites accumulating in response to heat stress are proline, glycine betaine or soluble sugars (Wahid, 2007). Several key phyto-hormones including abscisic acid, ethylene and salicylic acid (a type of phenolic acid which functions as a plant hormone) increase their levels under heat stress, while others decrease, such as cytokinin, auxin, and gibberellic acids that ultimately cause premature plant senescence (Talanova et al., 2003; Larkindale et al., 2005). Heat stress also leads to the transient activation of repetitive elements or silenced gene clusters close to the centromeric regions as well as the transient loss of epigenetic gene silencing (Lang-Mladek et al., 2010; Pecinka et al., 2010). Such gene silencing mechanisms are thought to be involved in transcriptional repression by hetero-chromatinization of repetitive DNA regions in plants (Khraiwesh et al., 2012). Heterochromatin is a tightly packed form of DNA which mainly consists of genetically inactive satellite sequences and both centromeres and telomeres are heterochromatic.

Mechanisms of heat tolerance Heat tolerance is generally defined as the ability of the plant to grow and produce economic yield under high temperature conditions. It is a multigenic character hence, numerous biochemical and metabolic traits are involved in the development and maintenance of thermo-tolerance viz., antioxidant activity, membrane lipid unsaturation, gene expression and translation, protein stability, and accumulation of compatible solutes (Kaya et al., 2001). Nevertheless, plant responses to high temperatures clearly depend on genotypic parameters, as certain genotypes are more tolerant (Prasad et al., 2006; Challinor et al., 2007). Several plant physiological parameters and mechanisms that contribute to heat tolerance in the field include amendments to essential processes such as photosynthesis and concomitant increases of transcripts coding for proteins involved in protection. In many cases, a heat-tolerant variety is characterized by higher photosynthetic rates, increased membrane thermo-stability and heat avoidance (Nagarajan et al., 2010; Scafaro et al., 2010). In all plant species, the ability to sustain leaf gas exchange under heat stress is directly correlated with heat tolerance. Different cellular and metabolic responses required for the plant to tolerate high temperature stress include changes in the organization of organelles, cytoskeleton, and membrane functions (Weis and Berry,1988), accompanied by a decrease in the synthesis of normal proteins and the accelerated transcription and translation of heat-shock proteins, HSPs (Brayetal., 2000), production of Seed Times January - April 2017

Role of Biotechnology in Crop Improvement

phyto-hormones such as abscisic acid (ABA) and anti-oxidants and other protective molecules like, late embryogenesis abundant (LEA) proteins, osmo-protectants, antioxidant defence, etc. (Maestrietal.,2002; Wang et al., 2004; RodrĂguez et al., 2005). Thus, increasing the saturation level of fatty acids appears to be critical for maintaining membrane stability and enhancing heat tolerance (Larkindale and Huang, 2004). Accumulation of osmo-protectants like, proline, glycine betaine, and soluble sugars is an important adaptive mechanism in plants to tolerate high temperature stress (Sakamoto and Murata, 2000) because accumulation of these osmo-protectants is necessary to regulate osmotic activities and protect cellular structures from increased temperatures by maintaining the cell water balance, membrane stability and by buffering the cellular redox potential (Farooq et al., 2008). Sucrose is the principal end product of photosynthesis, which translocates from source leaves to sink organs through the phloem. Different studies suggest that high carbohydrate availability (e.g., glucose and sucrose) during heat stress represents an important physiological trait associated with heat stress tolerance (Liu and Huang, 2000). Sucrose and its cleavage products regulate plant development and response to stresses through carbon allocation and sugar signalling (Roitsch and GonzĂĄlez, 2004). Studies on a heattolerant tomato genotype demonstrated that it is the high cell wall and vacuolar invertases activities and increased sucrose import into young tomato fruit that contribute to heat tolerance through increasing sink strength and sugar signalling activities (Li et al., 2012). Similarly, the carbohydrate content of developing and mature pollen grains may be an important factor in determining pollen quality, as heat-tolerant tomato genotypes appear to have a mechanism for maintaining the appropriate carbohydrate content under heat stress condition (Firon et al., 2006). Enhanced synthesis of secondary metabolites under heat stress conditions also protects against oxidative damage. Several studies in tomato and watermelon indicate that thermal stress induces the accumulation of phenolics in the plant by activating their biosynthesis as well as inhibiting their oxidation, which could be an acclimation mechanism of the plant against thermal stress (Rivero et al., 2001). Several plant growth regulators, such as abscisic acid, salicylic acid, ethylene, cytokinin and auxin may play important role in plant thermo-tolerance (Kotak et al., 2007). The most important characteristic of thermo-tolerance is the massive production of heat-shock proteins, HSPs (Vierling, 1991). In many plant species, thermo-tolerance of cells and tissues after a heat stress is pretty much dependent upon induction of HSP70, though HSP101 has also been shown to be essential (Gurley, 2000). The enhanced expression of HSP70 was reported to assist in translocation, proteolysis, translation, folding, aggregation, and refolding of denatured proteins (Gorantla et al., 2007; Zhang et al., 2010), while a methionine-rich chloroplast HSP has been shown to protect the thermolabile photosystem II and, consequently the whole-chain electron transport during heat stress (Peet et al., 2002).

Strategies for the development of high temperature stress variety Conventional breeding strategy In general, the negative impacts of abiotic stresses on crop productivity can be reduced by a combination of genetic improvement and cultural practices. Genetic improvement entails development of varieties which can produce economic yield under high temperature stress condition. Breeding for stress tolerance requires efficient screening procedures, identification of key traits in diverse donor or tolerant lines and understanding their inheritance and molecular genetics. Traditional breeding of heat resistant crops basically based on screening and selection. The common technique of selecting crops for heat stress resistance has been to grow breeding materials in high temperature condition and detect individuals/lines with higher yield (Ehlers and Hall, 1998). Several types of morphological traits help in identifying heat tolerant line(s) in the conventional breeding approaches viz., long root length, short life-span, hairiness which provides partial shade to cell wall and cell membrane and repels sun rays, small leaf size which restricts transpiration, leaf orientation, glossiness and waxiness which repel incident sunlight. However, detection of appropriate genetic resources is the major concern. In most of the vegetable crops, for instance tomatoes and legumes, availability of high temperature tolerant genotypes within the cultivated species is restricted which necessitates the use of wild relatives in the breeding programme (Foolad, 2005).

Role of Biotechnology in Crop Improvement

Seed Times January - April 2017

As photosynthesis and reproductive development are the most sensitive physiological processes to stress (Prasad et al., 2008), a heat-tolerant variety will be usually characterized by higher photosynthetic rates reflected in stay-green leaves, increased membranethermostability and successful fruit set under high temperature conditions (Nagarajan et al., 2010; Scafaro et al., 2010). Tolerance to high temperatures is a multigenic character hence, screening for heat tolerance in the field presents a challenge due to interactions with other environmental factors. However, successful selection in the field condition depends on the identification of a variety of screenable traits (Hall, 2011). However, regardless the screening method, a key objective for plant breeders is to develop an effective set of thermo- tolerance markers which can be used to further implement heat tolerance into various crop species. Since plants adapt to temperature stress by developing more appropriate morphological, physiological, and biochemical characteristics, analyzing plant phenology in response to heat stress often gives a better understanding of the plant response and facilitates further molecular characterization of the tolerance traits (Wahid et al., 2007).

Physiological and Biotechnological approach Photosynthesis and photosynthate partitioning: The reduction in carbon fixation and the consequent oxygen evolution result in generation of harmful ROS. As a consequence, the repair mechanism of the damaged photosystem is inhibited. Hence, approaches to develop varieties with improved productivity in a high temperature environment could include manipulating leaf photosynthesis and even photosynthate partitioning (Ainsworth and Ort, 2010). Membrane lipid saturation: One of the typical heat stress symptoms is tissue senescence, characterized by membrane damage associated with increased fluidity of membrane lipids, lipid peroxidation, and protein degradation in various metabolic processes (Savchenko et al., 2002) hence, membrane lipid saturation may, therefore, be considered as an important physiological indicator in high temperature tolerance. Osmo-protectants: Transgenic approaches have confirmed the beneficial effect of proline over-production during high temperature stress as enhanced proline production in transformed plants correlates well with a more negative leaf osmotic potential and higher production of protective xanthophyllic pigments under heat stress (Dobra et al., 2010). Glycine betaine plays an important role as compatible solute in plants experiencing high temperature conditions (Sakamoto and Murata, 2002). Glycine betaine production in chloroplasts maintains the activation of Rubisco by sequestering Rubisco activase near thylakoids and preventing its thermal inactivation (Allakhverdiev et al., 2008). Hence, these osmo-protectants may, therefore, be considered as important physiological indicator in high temperature tolerance. Phenomics: Phenomics is an area of biology concerned with the measurement of phenomes (a phenome is the set of physical and biochemical traits belonging to a given organism) as they change in response to genetic mutation and environmental influences. Generally, tolerance to heat is characterized by consistent increases of transcripts involved in the biosynthesis of protective components. The emerging phenomics methodologies can be used to identify genes associated with traits of interest by establishing functional relationships between genetics and the associated phenotype. Molecular markers: The search for molecular markers associated to phenotypic traits is one aspect of molecular genetics usually carried out with methods based on segregation mapping, genomic introgression, and association mapping (Morgante and Salamini, 2003). QTL mapping has recently become the method of choice to identify specific chromosome segments that contain candidate genes for heat tolerance (Argyris et al., 2011; Zhang et al., 2012). At present, high temperature tolerance QTL identification is performed using different yield related traits, such as the thousand-grain weight, yield, etc (Pinto et al., 2010) or senescence related traits (Vijayalakshmi et al., 2010). In order to transfer these traits, classical breeding requires the establishment of rapid and cost effective screening procedures and implementing these using conventional non-transgenic breeding approaches such as â&#x20AC;&#x153;markerassisted screening,â&#x20AC;? association mapping or genomic selection procedures.

Seed Times January - April 2017

Role of Biotechnology in Crop Improvement

Conclusion Plant response to high temperature stress is a complex syndrome hence, can only be tackled with a holistic approach that integrates examination of crop heat tolerance traits by classical and modern molecular genetic tools resulting thus in superior crop genotypes. Heat stress tolerance is a polygenic character often measured using complex traits such as yield under stress, which implicate many processes and mechanisms. Therefore, introgression of a gene or QTL by conventional or modern breeding is usually not sufficient to develop heat-tolerant lines, unless there is a large effect on a particular key process. The polygenic basis of heat tolerance and the issues of detecting minor QTLs with molecular markers strongly limit the use of marker assisted selection (MAS) to identify heat tolerance related traits by classical genetics. The manipulation of major regulatory genes through biotechnology is considered to be more efficient than conventional breeding through serial hybridizations. Linking several beneficial genes (transgenic pyramiding) into a commercial variety via the transgenic approach is also likely to provide a key route to crop improvement.

References Añon S, Fernandez JA, Franco JA, Torrecillas A, Alarcón JJ, Sánchez-Blanco MJ 2004. Effects of water stress and night temperature preconditioning on water relations and morphological and anatomical changes of Lotus creticusplants. Scientia Horticulturae 101: 333–342. Ainsworth E A, Ort DR 2010. How do we improve crop production in a warming world? Plant Physiology 154: 526–530. Allakhverdiev S I, Kreslavski VD, Klimov VV, Los D A, Carpentier R, Mohanty P 2008. Heat stress: an overview of molecular responses in photosynthesis. Photosynthesis Research 98: 541–550. Argyris J, Truco M J, Ochoa O, McHale L, Dahal P, VanDeynze A. 2011.A gene encoding an abscisic acid biosynthetic enzyme (LsNCED4) collocates with the high temperature germination locus Htg6. 1 in lettuce (Lactuca sp.). Theoretical and Applied Genetics 122: 95–108. Barlow KM, Christy BP, O’Leary GJ, Riffkin PA, Nuttall JG 2015. Simulating the impact of extreme heat and frost events on wheat crop production: a review. Field Crops Research 171: 109–119 Barnabás B, Jäger K, Fehér A. 2008. The effect of drought and heat stress on reproductive processes in cereals. Plant Cel lEnvironment 31: 11–38. Challinor A, Wheeler T, Craufurd P, Ferro C, Stephenson D 2007. Adaptation of crops to climate change through genotypic responses to mean and extreme temperatures. Agriculture, Ecosystems and Environment 119: 190–204. Craufurd PQ, Bojang M, Wheeler TR, Summerfield RJ 1998. Heat tolerance in cowpea: Effect of timing and duration of heat stress. Annals of Applied Biology 133:257 – 267 Craufurd PQ, Qi A, Ellis RH, Summerfield RJ, Roberts EH, Mahalakshmi V. 1998. Effect of temperature on time to panicle initiation and leaf appearance in sorghum. Crop Science 38: 942–947 Dobra J, Motyka V, Dobrev P,Malbeck, J, Prasil I T, Haisel D 2010.Comparison of hormonal responses to heat, drought and combined stress in tobacco plants with elevated proline content. Journal of Plant Physiology 167: 1360–1370. Ehlers JD, Hall AE 1998. Heat tolerance of contrasting cowpea lines in short and long days. Field Crops Research, 55: 11–21. Endo M, Tsuchiya T, Hamada K, Kawamura S, Yano K, Ohshima M 2009.High temperatures cause male sterility in rice plants with transcriptional alterations during pollen development. Plant Cell Physiology 50: 1911–1922. Farooq M, Basra S, Wahid A, Cheema Z, Cheema M, Khaliq A 2008. Physiological role of exogenously applied glycine betaine to improve drought tolerance in fine grain aromatic rice (Oryza sativa L.). Journal of Agronomy and Crop Science 194: 325– 333.

Role of Biotechnology in Crop Improvement

Seed Times January - April 2017

Firon N, Shaked R,Peet M, Pharr D, Zamski E, Rosenfeld K 2006.Pollen grains of heat tolerant tomato cultivars retain higher carbohydrate concentration under heat stress conditions. Scientia Horticulturae 109: 212–217. Foolad MR 2005. Breeding for abiotic stress tolerances in tomato. In: Abiotic Stresses: Plant Resistance Through Breeding and Molecular Approaches (Eds. Ashraf M, Harris PJC), The Haworth Press Inc., New York, USA, pp. 613–684. Gorantla M, Babu P, Lachagari VBR, Reddy A, Wusirika R, Bennetzen J L 2007.Identification of stress-responsive genes in an indica rice (Oryza sativa L.) using ESTs generated from drought- stressed seedlings. Journal of Experimental Botany 58: 253–265. Gurley WB 2000. HSP101: a key component for the acquisition of thermo-tolerance in plants. Science Signaling 12: 457 Hall A E 2011.“Breeding Cowpea for Future Climates, In: Crop Adaptation to Climate Change (eds. S S Yadav, R. Redden, J L Hatfield, H LotzeCampen, AJW Hall), JohnWiley & Sons. Hatfield JL, Boote KJ, Kimball BA, Ziska LH, Izaurralde RC, Ort D, Thomson AM, Wolfe DW, 2011. Climate impacts on agriculture: implications for crop production. Agronomy journal 103: 351–370. Hazra P, Ansary SH 2008. Genetics of heat tolerance for floral and fruit set to high temperature stress in tomato (Lycopersicon esculentum Mill.). SABRAO Journal of Breeding and Genetics 40 : 117- 125. Hedhly A 2011.Sensitivity of flowering plant gametophytes to temperature fluctuations. Environmental and Experimental Botany 74: 9–16. Hedhly A, Hormaza J I, Herrero M 2009.Global warming and sexual plant reproduction. Trends in Plant Science 14: 30–36. IMD, Annual Climate Summary, 2010. India Meteorological Department, Pune. Government of India, Ministry of Earth Sciences, Pp. 27. Ismail AM, Hall AE 1999.Reproductive stage heat tolerance, leaf membrane thermo-stability and plant morphology in cowpea. Crop Science 39: 1762-1768. Jaggard KW, Qi A, Ober ES 2010.Possible changes to arable crop yields by 2050. Philosophical transactions of the Royal Society of London Series B, Biological sciences 365: 2835–2851. Karim MA, Fracheboud Y, Stamp P 1997. Heat tolerance of maize with reference of some physiological characteristics. Annals of Bangladeshi Agriculture 7: 27–33. Kaya H, Shibahara K,Taoka K, Iwabuchi M,Stillman B, Araki T 2001. FASCIATA genes for chromatin assembly factor-1in Arabidopsis maintain the cellular organization of apical meristems. Cell 104: 131–142. Khraiwesh B, Zhu JK, Zhu J 2012.Role of miRNAs and siRNAs in biotic and abiotic stress responses of plants. Biochimica etBiophysica Acta 1819: 137–148. Kotak S, Larkindale J,Lee U, von KoskullDöring P, Vierling E, Scharf KD 2007.Complexity of the heat stress response in plants. Current Opinion in Plant Biology 10: 310–316. Lang-Mladek C, Popova O, Kiok K, Berlinger M, Rakic B, Aufsatz W 2010.Transgenerational inheritance and resetting of stressinduced loss of epigenetic gene silencing in Arabidopsis. Molecular Plant 3: 594–602. Larkindale J, Huang B 2004. Thermo-tolerance and antioxidant systems in Agrostis stolonifera : involvement of salicylic acid, abscisic acid, calcium, hydrogen peroxide, and ethylene. Journal of Plant Physiology 161: 405–413. Larkindale J, Hall JD, Knight MR, Vierling E 2005.Heat stress phenotypes of Arabidopsis mutants implicate multiple signalling pathways in the acquisition of thermo-tolerance. Plant Physiology 138: 882–897. Li M, Ji L, Yang X, Meng Q, Guo S 2012.The protective mechanisms of CaHSP26 in transgenic tobacco to alleviate photo-inhibition of PSII during chilling stress. Plant Cell Reports 31: 1969–1979.

Seed Times January - April 2017

Role of Biotechnology in Crop Improvement

Liu X, Huang B 2000.Carbohydrate accumulation in relation to heat stress tolerance in two creeping bent grass cultivars. American Society for Horticultural Science 125: 442–447. Lobell DB, Field CB 2007.Global scale climate–Crop yield relationships and the impacts of recent warming. Environmental Research Letters 2, doi:10.1088/1748-9326/2/1/014002. Maestri E, Klueva N, Perrotta C, Gulli M, Nguyen HT, Marmiroli N 2002.Molecular genetics of heat tolerance and heat shock proteins in cereals. Plant Molecular Biology 48: 667–681. Maestri E, Klueva N, Perrotta C, Gulli M, Nguyen HT, Marmiroli N 2002.Molecular genetics of heat tolerance and heat shock proteins in cereals. Plant Molecular Biology 48: 667–681. Meehl GA, Stocker TF, Collins WD, Gaye AJ, Gregory J., Kitoh A, Knutti R, Murphy JM, Noda A, Raper SCB, Watterson JG, Weaver AJ, Zhao, Z. 2007. Global Climate Projections (eds. Solomon S, Qin D, Manning M, Chen Z, Marquis M, Averyt KB, Tignor M, Miller HL), Cambridge University Press, Cambridge, U.K. and New York, USA. Morgante M, Salamini F 2003. From plant genomics to breeding practice. Current Opinion in Biotechnology 14: 214–219. Nagarajan S,Jagadish S, Prasad, Thomar A, Anand A, Pal, M 2010.Local climate affects growth, yield and grain quality of aromatic and non-aromatic rice in north-western India. Agriculture, Ecosystems and Environment 138: 274–281. Nava GA, Dalmago GA, Bergamaschi H, Paniz R, dosSantos RP, Marodin, GAB 2009. Effect of high temperatures in the pre-blooming and blooming periods on ovule formation, pollen grains and yield of ‘Granada’ peach. Scientia Horticulturae 122: 37–44. Oshino T, Abiko M, Saito R, Ichiishi E, Endo M, Kawagishi-Kobayashi M 2007.Premature progression of anther early developmental programs accompanied by comprehensive alterations in transcription during high-temperature injury in barley plants. Molecular Genetics and Genomics 278: 31–42. Parish RW, Phan HA, Iacuone S, Li SF 2012.Tapetal development and abiotic stress: a centre of vulnerability. Functional Plant Biology 39: 553–559. Pecinka A, Dinh HQ, Baubec T, Rosa M, Lettner N, Scheid OM 2010.Epigenetic regulation of repetitive elements is attenuated by prolonged heat stress in Arabidopsis. Plant Cell 22: 3118–3129. Peet M, Sato S, Gardner R 2002.Comparing heat stress effects on male-fertile and male- sterile tomatoes. Plant Cell Environment 21: 225–231. Peet MM, Sato S, Gardner RG 1998. Comparing heat stress effects on male-fertile and male-sterile tomatoes. Plant and Cell Environment 21: 225–231. Pinto RS, Reynolds MP, Mathews KL, McIntyre C L, Olivares-Villegas JJ, Chapman SC 2010. Heat and drought adaptive QTL in a wheat population designed to minimize confounding agronomic effects. Theoretical and Applied Genetics 121: 1001–1021. Prasad P, Boote K, Allen L, Sheehy J, Thomas J 2006.Species, ecotype and cultivar differences in spikelet fertility and harvest index of rice in response to high temperature stress. Field crops research 95: 398–411. Rao GGSN, Rao AVMS, Rao VUM 2009. Trends in rainfall and temperature in rainfed India in previous century. In: Global climate change and Indian Agriculture case studies from ICAR network project, (Ed. Aggarwal PK), ICAR Publication, New Delhi. pp.71 73. Rivero RM, Ruiz JM, Garcia PC, López-Lefebre LR, Sánchez E, Romero,L 2001.Resistance to cold and heat stress : accumulation of phenolic compounds in tomato and watermelon plants. Plant Science 160: 315–321. Rodríguez M, Canales E, Borrás-Hidalgo O 2005. Molecular aspects of abiotic stress in plants. Biotechnology and Applied Biochemistry 22: 1–10. Roitsch T, González MC 2004. Function and regulation of plant invertases : sweet sensations. Trends in Plant Science 9: 606–613.

Role of Biotechnology in Crop Improvement

Seed Times January - April 2017

Ruan YL, Jin Y, Yang YJ, Li GJ, Boyer JS 2010. Sugar input, metabolism, and signaling mediated by invertase : roles in development, yield potential, and response to drought and heat. Molecular Plant 3: 942–955. Sakamoto A, Murata N 2002. The role of glycine betaine in the protection of plants from stress: clues from transgenic plants. Plant Cell Environment 25: 163–171. Sakata T, Higashitani A 2008. Male sterility accompanied with a normal anther development in plants–genes and environmental stresses with special reference to high temperature injury. International Journal of Plant Developmental Biology 2: 42–51. Sakata T, Higashitani A 2008. Male sterility accompanied with abnormal anther development in plants–genes and environmental stresses with special reference to high temperature injury. International Journal of Plant Developmental Biology 2: 42–51. Sato S, Kamiyama M, Iwata T, Makita N, Furukawa H, Ikeda H 2006.Moderate increase of mean daily temperature adversely affects fruit set of Lycopersicon esculentum by disrupting specific physiological processes in male reproductive development. Annals of Botany 97: 731–738. Sato S, Peet MM, Gardner RG 2001. Formation of partenocarpic fruit, undeveloped flowers and aborted flowers in tomato under moderately elevated temperatures. Scientia Horticulturae, 90:243–254. Savchenko G, Klyuchareva E, Abramchik L, Serdyuchenko E 2002. Effect of periodic heat shock on the inner membrane system of etioplasts. Russian Journal of Plant Physiology 49: 349–359. Scafaro AP, Haynes PA, Atwell BJ 2010.Physiological and molecular changes in Oryza meridionalis Ng., a heat-tolerant species of wild rice. Journal of Experimental Botany 61: 191–202. Taiz L, Zeiger E 2006. Stress physiology, In: Plant Physiology, (eds. L Taiz, E Zeiger), Sinauer Associates, Sunderland, USA. pp. 671–681. Talanova V, Akimova T, Titov A 2003.Effect of whole plant and local heating on the ABA conten tin cucumber seedling leaves and roots and on their heat tolerance. Russian Journal of Plant Physiology 50: 90–94. Thakur P, Kumar S, Malik J, Berger JD, Nayyar H 2010. Cold stress effects on reproductive development in grain crops, an overview. Environmental and Experimental Botany 67: 429–443. Vara Prasad PV, Craufurd PQ, Summerfield RJ 1999. Fruit number in relation to pollen production and viability in groundnut exposed to short episodes of heat stress. Annals of Botany, 84: 381-386. Vierling E 1991.The roles of heat shock proteins in plants. Annual Review of Plant Biology 42: 579–620. Vollenweider P, Gunthardt-Goerg MS 2005.Diagnosis of abiotic and biotic stress factors using the visible symptoms in foliage. Environmental Pollution 137:455–465. Wahid A, Gelani S, Ashraf M, Foolad M 2007.Heat tolerance in plants: an overview. Environmental and Experimental Botany 61: 199–223. Wahid A 2007.Physiological implications of metabolite biosynthesis for net assimilation and heat-stress tolerance of sugarcane (Saccharum officinarum) sprouts. Journal of Plant Research 120, 219–228. Wang W, Vinocur B, Shoseyov O, Altman A 2004. Role of plant heat-shock proteins and molecular chaperones in the abiotic stress response. Trends in Plant Science, 9: 244–252. Wheeler TR, Craufurd PQ, Ellis RH, Porter JR, Vara Prasad V 2000. Temperature variability and the yield of annual crops. Agriculture, Ecosystems and Environment, 82: 159-167. Young LW, Wilen RW, Bonham-Smith PC 2004.High temperature stress of Brassica napus during flowering reduces micro-and megagametophyte fertility, induces fruit abortion, and disrupts seed production. Journal of Experimental Botany 55: 485–495. Zhang J, Huang W, Pan Q, Liu Y 2005. Improvement of chilling tolerance and accumulation of heat shock proteins in grape berries (Vitis

Seed Times January - April 2017

Role of Biotechnology in Crop Improvement

vinifera cv.Jingxiu) by heat pre-treatment. Postharvest Biology and Technology 38: 80–90. Zhang JH, Huang WD, Liu YP, Pan QH 2005. Effects of temperature acclimation pretreatment on the ultrastructure of mesophyll cells in young grape plants (Vitis vinifera L. cv. Jingxiu) under cross-temperature stresses. Journal of Integrative Plant Biology 47:959–970. Zhang JX, Wang C, Yang CY, Wang JY, Chen L, Bao XM 2010.The role of Arabidopsis AtFes1 A in cytosolic Hsp70 stability and abiotic stress tolerance. Plant Journal 62: 539–548. Zinn KE, Tunc-Ozdemir M, Harper JF 2010.Temperature stress and plant sexual reproduction: uncovering the weakest links. Journal of Experimental Botany 6: 1959–1968.

The article has been published with permission of authors

Role of Biotechnology in Crop Improvement

Seed Times January - April 2017

Progress of Plant breeding: From Mendelian Selection to Genomic Prediction Dr. Elangovan Mani Crop Research Lead (Vegetables) Advanta Seeds, A UPL Seeds Division Email: Elangovan.M@advantaseeds.com

A Giant leap in the human population happened after he transformed into a farmer from a hunter/wanderer. He learnt to produce his own food and started saving seeds, that he found tasty and meeting his needs. Such selection of plants with required trait pushed the yield level, thus producing more food from less resources. Though times have changed, the practice of identifying, evaluating and advancing only those genotypes which meets the needs, still remains the same. Agriculture still acts as the livelihood of major population world-wide and Plant breeding is the main engine to improve the crops. Conventional plant breeding has made the world more food secure and in future it will focus on nutritional security too. The last 50 years has profound impact on human civilization, from industrial civilization, now we have moved into information civilization. Rapid explosion of information has helped in major discovery and inventions, and adoption of technology across globe. Advanced technology in biology is beginning to change the way we perceive and perform plant breeding in 21st century. This article aims to provide a glimpse of the past and will help the reader to browse recent advances and its potential application in plant breeding. In this article, the role of new technology and its adoption in improving plant breeding is discussed. A. Genetic traits – Inheritance has scientific basis

a. Mendel’s genetic solution to explain plant breeding

b. Genetics of traits – Quantitative & Qualitative – Post Mendel period

B. Genes- Physical units of Inheritance

a. Genome sequencing – from room sized machines to matchbox sized sequencers

b. Bioinformatics – simple sequence alignment to Pan -genome viewers

c. DNA markers- Marker assisted selection to genomic selection

C. Modification of gene – New traits and endless possibilities D. Phenotype Data collection– Drones E. Conclusion – Accessible Technology for all

Graduated in Agriculture and Masters in Genetics & Plant Breeding. Pursued Ph.D. in Biotechnology at National chemical Lab, Pune with research work on “Wheat Molecular genetics”. Awarded DAAD- IAESTE fellowship in 2005 to complete a part of his wheat research work in Germany. Started his industrial career in Bejo sheetal seeds, as Marker Lab Head and joined Advanta UPL in 2009 as Molecular Breeder, now looking after Molecular Breeding activity of India crops. Trained at Michigan state university through USDA-Cochran Fellowship in 2015. Very Passionate about technology in Agriculture and have a life ambition to develop safe, tasty and nutritious food-crop for the society.

Seed Times January - April 2017

Role of Biotechnology in Crop Improvement

Genetic traits- inheritance has scientific basis

In beginning days, it was hard for mankind to believe that there might be some scientific basis for inheritance.

a. Mendel’s genetic solution to explain plant breeding

Mendel - father of Genetics was the first to apply scientific principles to explain the inheritance of traits. He proposed - law of dominance, law of segregation and law of independent assortment. Mendel’s laws played key role in accelerating plant breeding and laying foundation for modern plant breeding by end of the 19th century. Mendel not only proposed the theory to explain inheritance of simple traits, but also validated and proved with this experiments on garden pea (Pisum sativum). Plant breeders gained the knowledge on segregation of alleles and applied the Mendelian principles for their selection. The Law of segregation is still a guide to all modern plant breeders for selecting desired plants with desired traits at various generations. It also paved way for understanding the segregation of dominant & recessive traits and ability to fix the trait in two or three generations. In fact Mendel’s Law of Dominance was the foundation for Inbred – hybrid concept and all commercial hybrids are output of Mendelian genetics in plant breeding. With the knowledge of Mendelian genetics, plant breeders have made significant progress in developing and implementing experimental design and statistical analysis (Olby 2000).

b. Genetics of traits – Quantitative & qualitative – Post Mendel period

The Phenotype or external appearance of trait is a collective interaction of genotype (effect of genes) and environment. Phenotypes due to simple traits (qualitative) are governed by Major genes and not affected by environment, on the contrary phenotype due to complex trait are governed by many minor genes influenced by environment. Mendelism ignored the effect of environment on genotype, so it could not be directly applied in understanding complex traits. Father of quantitative genetics RA Fisher showed that a large number of genes influencing a trait would cause a continuous distribution of trait values. Based on this knowledge researchers developed techniques to identify quantitative traits loci (QTL’s) and to incorporate the information in breeding programmes. These applications allowed the assessment of relative importance of the environmental effect and inheritance of genes. Analysis of extensive phenotypic data permitted the estimation of breeding values of the parents involved in hybrid development and to develop genetically improved cultivars. Theory on complex traits, helped in dissecting the QTLs into variation governed by genetical (G) and non-genetical (G x E). This knowledge paved way for rapid improvement of population, varieties and hybrids.

Genes- Physical units of Inheritance

Genes- Mendelian factors are the physical units of inheritance. The year 1944 was an exciting period when Oswald Avery, Colin MacLeod and Maclyn McCarty demonstrated that DNA is the basis for heredity and it’s a chemical chain of Purines and Pyrimidines bond in double stranded like a tape and instruct each and every cell of an organism “how to look like and behave”. Watson and Crick deciphered the DNA double strand model and shown entire world, how this DNA paired and packed inside the nucleus. Crick also postulated a theory that the sequence of aminoacid in protein is due to information from DNA. The big difference between the modern science of genetics and Mendel’s basic laws is that modern scientists have a much clearer understanding of the mechanisms behind the patterns after decoding the structure of DNA. We now know that genes/alleles are encoded into DNA in chromosomes. A wide range of interest brew among the researchers to uncomplex and decode DNA sequence to interpret the genetic information. Though many DNA sequencing methods were demonstrated after invention of Polymerase chain reaction (PCR), Sanger provided a rapid DNA sequencing method of those time, which dominated 1980 to 2000.

a. Genome sequencing – from a Room sized machines to matchbox sized sequencers

The Dye terminator based DNA sequencing technology, though considered a gold standard, had very low efficiency in terms of data output compared to modern DNA sequencers (Next generation sequencers). Arabidopsis was the first plant and Rice was the first commercial crop be sequenced. Rice genome sequencing started with “The International Rice Genome Sequencing Project (IRGSP)” in September 1997, through international collaboration and It took nearly 10 years to publish first Rice genome sequence due to use of old “sanger sequencing method”.

From a full room sized DNA Sequencers (454, illumina, SoLID, PacBio) now sequencers have miniaturized into small usb drives. Oxford’s nanopore is latest entrant, a truly mobile sequencer which delivers sequence information ranging from 5Kb to 200Kb. Various 56

Role of Biotechnology in Crop Improvement

Seed Times January - April 2017

DNA sequencers are used standalone or in combination with others to suit the requirement of sequencing projects. Crops with little genome information tends to have long sequence generation machines with PacBio, while crops with good curated genome information like Corn, Soybean, Rice, Tomato use machine like SoLID, Illumina, 454. Latest entrant Illumina X 10 series machine has the potential to sequence and deliver 315 Rice genome in 30x sequencing depth per day (Illumina Hiseq x series information sheet, 2017). In nutshell, the cost of DNA sequencing has come down and its accuracy has gone up. It has given breeders, an opportunity to understand genetic variation by directly inferring the DNA sequence rather than interpreting through phenotypes.

b. Bioinformatics â&#x20AC;&#x201C; Simple Sequence alignment to Pan-genome viewers

The more powerful and affordable the DNA sequencers become, more data will be generated by the plant breeding / biotech community. The genetic information generated, far exceeds the available computation power to read and make sense of it. Bioinformatics is another field which helps in processing the bulk information, removing the noise and helps the user to visualise it. It integrates various aspects of cell function like Genome (DNA sequence), Transcriptome (RNA sequence), Proteome (Protein sequence), Metabolome (Metabolites in system) and Phenome (collection of all phenotype variations). The major role of Bioinformatics is linking the DNA variation to phenotype through RNA and Protein.

Bioinformatics was a mere sequence alignment program before development of next generation sequencers. With the advent of NGS, various varieties and lines were also sequenced using reference genome assemblies. The analysis of NGS data by means of bioinformatics development allows discovering new genes and regulatory sequences and their positions, and makes available large collections of molecular markers. As mentioned earlier, the computation power of an average computer is far less compared to the genome sequence data input. This paradox is solved by the evolution of cloud computing, where the computation actually takes place in the cloud server, while the user is able to visualize the data in his computer. Bioinformatics helps to identify structural variation at DNA sequence level. There is increasing awareness that as a result of structural variation, a reference sequence representing a genome of a single individual is unable to capture all of the gene variations. The pan-genome helps in viewing the entire genome variation across germplasm comprising many inbreds. The conservative regions, variable regions are plotted with reference genome to show presence/absence, which may contribute to phenotypic & agronomic trait diversity in crops. A similar Pan-genome analysis in B. oleracea identified the role of Flowering locus gene BoFLC2 in determining early flowering (A Agnieszka et al. 2016). Genome-wide variation studies provide breeders with an understanding of the molecular basis of traits.

c. DNA markers- Marker assisted selection to genomic selection

DNA Markers like simple sequence repeats (SSR), Single Nucleotide Polymorphism (SNP) laid foundation for Marker assisted selection (MAS). Genetic maps using these markers helped to tag traits and carefully transfer to desirable parents/ inbred/ lines. Since the past decade plant breeders are armed with Marker tools to aid their routine selection, trait mapping, backcross, test purity, etc. Number of native genes (with traits) have been introgressed from wild type to commercial parents and deployed in hybrids. Popularly known examples are Rice - Bacterial leaf blight resistance (xa5, xa13, Xa21), Blast resistance (Pi2, Pi52, Pi9), Tomato - Tomato leaf cholorosis virus resistance (Ty1, Ty2, Ty3), Wheat High molecular weight Glutenin proteins (x5+y10). Molecular marker tools and resources are leading to a new revolution in plant breeding, as they facilitate the study of the genotype and its relationship with the phenotype, particularly for complex traits. Introgressing popular quantitative traits like Salt tolerance (SKC), submergence tolerance (sub1) QTLs in Rice were achieved only through Marker assisted Breeding. MAS has become smart breeding with combinations of genome sequence, precise phenotyping tools and Genomic prediction tools. Genomic selection is a new area in Plant Breeding (borrowed from animal science) which helps in near accurate prediction of plant performance by estimating its Breeding value. The success of this statistical tool depends on the reliability of experimental population, test population, Marker density and accuracy of phenotype. Yield is the most complex trait influenced by genes prevalent throughout the genome and genomic prediction tools have demonstrated to be good enough in estimating the breeding values of lines, with relevance to yeild. It has the potential to eliminate the need for estimating general combining ability using traditional tools like line x tester analysis. These tools are deployed routinely in crops like Corn, Wheat, Rice and Barley.

C. Modification of gene â&#x20AC;&#x201C; New traits and endless possibilities Next Generation Sequencing (NGS) technologies are allowing the mass sequencing of genomes and transcriptomes, which is producing a vast array of genomic information. This information, help us to understand the molecular basis of the trait and how the variations affect the trait. TILLING (Targeting Induced Local Lesions in Genomes) were popular techniques to create a variation in gene Seed Times January - April 2017

Role of Biotechnology in Crop Improvement

using artificial mutagenesis. Though it was popular, it was criticised for lack of precision & backcrossing was required to clean-up nontarget mutations. Many Next generation breeding tools, like zinc finger nucleases (ZFNs), transcription activator-like effector-based nucleases (TALEN) clustered regularly interspaced short palindromic repeats (CRISPR)-Cas system were demonstrated by researchers to precisely modify the gene of interest. But among them CRIPSR is considered to be best and named 2015’s Breakthrough of the Year by the American Association for the Advancement of Science’s journal. It needs a guide RNA to target the gene of interest and a Cas9 protein to perform the gene modification in host. Due to high precision, the CRIPSR do not have many off target and the host plant will resemble exactly like mother plant with newly modified gene. CRISPR- is widely anticipated to generate a big breakthrough, similar to NGS tools impact on Plant breeding. Trait development is a time consuming process and takes years to transfer a trait from one genotype to another. The best technology also need minimum 5 cycles of generation to complete the backcross to reduce yield drag. CRISPR has potential to modify the genome in first generation and select the desired plants in second generation itself. It has number of applications like extending the life of popular hybrids and varieties by addition of traits in very short period of time. CRISPR is considered as new plant breeding technology and does not attract regulations like genetically modified organism (GMO) in USA. Already Monsanto, Bayer, Dupont have licensed and adopted this technology for application in plant breeding.

D. Phenotype Data collection – Drones Phenotyping or collection of the plant trait is the single most indispensable data for plant breeding. Today, phenotyping is quickly emerging as the major operational bottleneck limiting the power of genetic analysis and genomic prediction. Next-generation phenotyping generates significantly more data to help new statistical tools for enhancing experimental design and extracting biologically meaningful signal data. Plant imaging is the standard process to accurately estimate the phenotype. The goal of plant imaging and analysis is to measure the physiological, growth, development, and other phenotypic properties of plants through automated processes. Sustaining and increasing crop yields with the advantages afforded modern genetics tools now hinges on rapid advancement of phenomics. Drones are new entries in Plant phenotyping, the use of drones for this purpose could substantially reduce the man-hours needed to evaluate new crops. Plant breeders grow number of hybrids, lines for evaluation and they need continuous monitoring for data collection & need to be repeatedly checked. To make things easier, a team including breeders, computer scientists, engineers, and geographic information specialists turned to unmanned aerial vehicles – commonly known as UAVs or drones (Jelani 2016)

E. Conclusion – Affordable Technology for All Modern plant breeding offers number of ways to improve breeding programs with use of genomic tools. Technology aim, to empower the breeder to aid in faster, precise and efficient selection and will be a tool in hands of breeder. Breeder will remains as the owner of the breeding projects and it’s his duty to look for technology bring improvement in his program. Continuous learning is the key to successful breeding programmes and always have a constant objective to produce more, safe, nutritious food with less resources.

References 1. Olby, Robert C. “Mendelism: from hybrids and trade to a science.” Compte-Rendus del’Académie des Sciences de Paris, 2000, Sciences de la vie / Life Sciences 323: 1043-51 2. Palladino, Paolo., “Between craft and science: plant breeding, Mendelian genetics, and British universities, 1900-1920.” 1993, Technology and Culture, 34, n° 2: 300-323 3. Agnieszka et al 2016, Nature commuications, DOI: 10.1038/ncomms13390 4. Vincent Jelani, 2016, Plant Breeding: The Drone Way

The article has been published with permission of authors 58

Role of Biotechnology in Crop Improvement

Seed Times January - April 2017

Resynthesis of Brassica juncea: Enriching gene pool for mustard improvement Mahesh Rao*, Navin C. Gupta**, Rohit Chamola*** and Kanika Kumar**** ICAR-National Research Centre on Plant Biotechnology, Pusa Campus, Delhi-110012 *Scientist **Scientist (Sr. Scale) ***Chief Technical Officer ****Principal Scientist Email: mraoiari@gmail.com

Abstract: Brassica juncea an important oilseed crop of India. It stands second in position among oilseed crops. It is an amphidiploid (interspecific hybrid carrying the complete diploid chromosome set from each parent form and also called allotetraploid) evolved in nature by intercrossing between diploids, B.rapa and B. nigra. The occurrence of wide genetic diversity in the germplasm pool of any crop allows its progress through improvement in desired traits besides increasing the scope through heterosis breeding approach. The native gene pool of B. juncea, however, is narrow. The utilization of diversity of parental species for resynthesis of Brassica juncea opens an opportunity to broaden its genetic base and find new gene combinations. Studies have been carried out with this vision to resynthesize Brassica juncea through interspecific hybridization between its progenitor species, B. rapa and B. nigra. The second approach of resynthesis through hybridization between B. carinata and B. napus opens up a new avenue. Key words: amphidiploid, Brassica juncea, colchicine, diversity, embryo rescue, gene pool, mustard.

Introduction: Genus Brassica comprises mainly six cultivated species. Three of these species i.e. B. rapa, B. nigra and B. oleracea are diploid, while B. juncea, B. carinata and B. napus are amphidiploids that evolved through intercrossing between diploids followed by amphidiplodization (U, 1935; Fig. 1). Brassica juncea (2n=36; AABB) evolved by intercrossing between B. rapa and B. nigra. It has complete 20 chromosome complement of the A-genome (B. campestris or B. rapa; AA) and 16 chromosome complement of the B-genome (B. nigra; BB). Hybridization between two species with subsequent fusion of unreduced gametes quickly established barriers that prevented gene flow between the new polyploid and the old progenitor species. This led to reproductive isolation. (Ramsey and Schemske, 1998). B. juncea evolved in nature because of the chance crossing and that resulted into narrow genetic diversity. Therefore, resynthesis of B. juncea by crossing diverse germplasm of the parental diploid species (Olsson, 1960) would be proficient in enlarging the gene pool and genetic diversity. Since such synthesized interspecific hybrids generally fail to set seed, embryo rescue approach and colchicine treatment for amphidploidization have to be followed to obtain hybrids but the frequency of amphidiploid production is very low (Srivastava et.al, 2004). Similarly, polyploidy species, B. carinata (BBCC; 2n=34) and B. napus (AACC; 2n=38) can also be used to synthesize B. juncea lines. This approach is expected to deliver the accumulation of AA and BB genome in the advanced generation and finally produce the more diversity and plant types as two diverse genomes are involved. On the other hand, Seed Times January - April 2017

Role of Biotechnology in Crop Improvement

a three-way cross can also be used, where the diverse B. rapa lines are crossed to make F1s and these F1s are crossed with B. nigra lines and vice-versa. All these methods are valuable in broadening the gene pool and enhancing the diversity to utilize them into mustard improvement program. Figure.1: Schematic representation of the evolutionary development of the Brassica species.

Conclusion: Genetic diversity is important because it helps maintain the health of the crop, by including alleles that may be valuable in imparting resistance to diseases, pest, and other stresses. Maintaining diversity gives the population a buffer against change, providing flexibility to adapt. It is a major source of crop improvement against all odds. Unfortunately, the process of domestication has led to decrease in the genetic diversity between and within the crop species. Reproductive isolation between amphidiploids and their diploid progenitor species also blocked gene flow between them. All this contributed to narrow the genetic base of amphidiploids. Resynthesis of polyploidy species gives an opportunity to utilize the variability of diploids to enhance the diversity of the related polyploidy species. The resynthesized B. juncea lines developed by various worker possess the diversity for many desirable agronomic traits such as growth habit, branch number, and silique number on main axis and per plant, silique density, seeds per silique, plant height, leaf colour, seed size, plant biomass and tolerance to many biotic and abiotic stresses.

Role of Biotechnology in Crop Improvement

Seed Times January - April 2017

References Olsson G 1960. Species crosses within the genus Brassica. Artificial Brassica juncea Coss. Hereditas (4): 171-222. Ramsey J, Schemske DW 1998. Pathways, mechanisms, and rates of polyploid formation in flowering plants. Annu Rev Eco Syst 29: 467-501. Srivastava A, Mukhopadhyay A, Arumugam N, Gupta V, Verma JK, Pental D, Pradhan AK 2004. Resynthesis of Brassica juncea through interspecific crosses between B. rapa and B. nigra. Plant Breeding 123(2): 204-206. U N 1935. Genome-analysis in Brassica with special reference to the experimental formation of B. napus and peculiar mode of fertilization. Japanese Journal of Botany 7: 389-452.

The article has been published with permission of authors

Seed Times January - April 2017

Role of Biotechnology in Crop Improvement

Role of Biotechnology for Breeding Climate Resilient Varieties of Field Crops R.P. Singh Directorate of Seed & Farms Birsa Agricultural University, Kanke, Ranchi-834006, Jharkhand E-mail- dsfbau@rediffmail.com

Abstract The Sustainable Development Goals (SDGs) specifically SDGs 1 and 2 call for ending poverty and hunger including all forms of malnutrition by 2030. Also, Paris Climate Change Agreement specifically emphasize on enhancing adaptive capacity, strengthening resilience and reducing vulnerability to climate change which is manifested through more frequencies of extreme events in the form of droughts, floods and temperature extremes, thereby culminating into increased climate variability and vulnerability. Therefore, development of climate resilient varieties at faster rate is the need of the day which can only be developed through the efficient use of currently available biotechnological tools and techniques in a more precise manner in comparison to conventional breeding which often takes much more time. From 1990â&#x20AC;&#x2122;s onwards biotechnology and genetic engineering have proved the power of technology world over with time by adopting GM crops in both developed and developing nations. Nevertheless, opposition of GM crops is mainly centered on issues like, safety to humans and animals, safety of non-target organisms, the perception of industrial monopoly over world agriculture and ideological discomfort with scientists. In the present paper, various challenges before Indian agriculture, the achievements made through biotechnological/GE approaches in relation to develop climate resilient varieties along with the regulatory measures concerning GM crops in the Indian context have been presented. It has been established that genetic engineering has not increased the yield potential of crops, though the technology has been used to reduce yield gaps due to pests and other stress condition like moisture stress and submergence etc., Also, the yield and profit gains are higher in developing countries than in developed countries. Therefore, keeping the facts in mind with respect to issues and challenges viz, food and nutritional security to meet the demand of ever increasing population vis-a-vis diversified food items demand due to increased incomes, diminishing natural resource base, stagnating yield levels, higher yield gaps, and challenges posed by climate change a balanced and unbiased decisions need to be taken to regulate the GM crops in the country. Key Words: Biotechnology, GM crops, Climate change, Climate resilient varieties and Yield gaps Indiaâ&#x20AC;&#x2122;s per capita land availability is 0.25 ha per person compared to the global average of 2.3 ha per person (Census of India, 2011). Indiaâ&#x20AC;&#x2122;s cattle density is 62 heads per km2 compared to the global average of 10 heads per km2 (Robinson et al., 2014; Meiyappan et al., 2016) and reflecting unwarranted pressure on land. With respect to food and nutritional security of the country, vonGrebmer et al. (2016) reported that in 2016, India ranked 97th position in the list of Global Hunger Index (GHI) and represents extremely alarming situation. Although India has reduced hunger from 46.4% (1992), 38.2% (2000), 36.0% (2008) to 28.5% (2016) and represents the group of Nations in which hunger situation has reduced by 25% to 49.9%. The GHI of India is even below of Nepal (72), Sri Lanka (84) and Bangladesh (90). Globally, in 2015 Sustainable Development Goals (SDGs) were adopted by Nations, while specifically SDGs 1 and 2, call for ending poverty and hunger, including all forms of malnutrition, by 2030 and thus to meet the objectives namely, to end hunger, achieve food security and improved nutrition, and promote sustainable agriculture which ultimately signifies the critical role of enhancing adaptation to climate change vis-a-vis food and nutritional security. Also in 2015, the Paris Agreement was also adopted by 195 Nations in Paris in December 2015, underlines the links between safeguarding food security and ending hunger and the impacts of climate change. According to the Paris Climate Change Agreement even if the increase in temperature is restricted to less than 2oC, 62

Role of Biotechnology in Crop Improvement

Seed Times January - April 2017

adaptation support would be required for developing countries. The agreement establishes the global goal on adaptation-of enhancing adaptive capacity, strengthening resilience and reducing vulnerability to climate change-with a view to contributing to sustainable development and ensuring and adequate adaptation response in the context of the 20C goal. In India, nearly 120.8 million ha constituting 36.5 per cent of geographical area in India are degraded due to soil erosion, salinity/ alkalinity, soil acidity, water logging, and other edaphic problems (ICAR, 2010). Abiotic stresses, which cause more than 50% losses in crop productivity are the major concerns for food and nutritional security of additional 0.4 billion Indians by 2050. The effects of climate change on agricultural production and livelihoods are expected to intensify over time (FAO, 2016). Extreme climate or weather event is defined as “the occurrence of a value of a weather or climate variable above (or below) a threshold value near the upper (or lower) ends of the range of observed values of the variable” (IPCC, 2012). Climate variability and changes in the frequency of extreme events are important for yield, its stability and quality. Apart from reducing yield, the crop quality is also affected by climate variability (Rehmani et al., 2014). The climate change events are reflected in terms of increased frequencies of temperature extremes, frequent droughts, floods, and increased salinity have already started affecting agricultural production and productivity and particularly more so in marginal or low input environments. India ranks among the top two or three producers globally of wheat, rice, pulses, oilseeds, cotton, sugarcane, tea, milk, and fruits and vegetables. Also the country has a witnessed a number of revolutions namely, Green, Yellow, White, Blue and rainbow etc. and with regard to crop productivity, it has remarkably increased since 1950-51 to 2010-11 by 4.5 times in wheat and maize, by 4 times in pearlmillet, 3.4 times in rice, 3.7 times in food grains, 2.5 times in oilseeds and 2.7 times in sorghum. Similarly, the pulse productivity has increased by 1.6 times during same period. However, India ranks 54th in wheat, 57th in rice productivity and 81st in maize at global level (Dastagiri et al., 2013). India’s population is projected to reach 1.6 billion by 2050.For meeting requirement of the burgeoning population, the country will need an estimated 400 million tonnes of food grains by 2050, from a current level of about 260-270 million tonnes. Presently, about 10- 20% of pulses and approximately 50% of edible oil requirement of the country is met through import and thus causing heavy burden on National exchequer annually. To meet the ever increasing food and feed demand, the production need to be doubled from the available resources which are already under stress. Nevertheless, issues such as climate change, diminishing natural resources including biodiversity loss, and declining total factor productivity having serious concerns about food security as the natural resources (land, water and biodiversity) are shrinking. Overcoming abiotic stresses in crops through crop breeding has proven to be an effective means of increasing food production (Evenson and Gollin, 2003), and arguably mitigating climate change effects (Burney et al., 2010; Vermeulen et al., 2011). New varieties are needed with higher level of yield and stability to replace the older once since the development of new varieties is a continuous programme of almost all coordinated crop improvement programme in India since genetic improvement is a highly cost effective intervention (Yadavendra et al., 2005). The key to ensuring long-run food security lies in targeting cereals productivity to increase significantly faster than the growth in population (Ramasamy, 2013). The challenge of food grain production is generation of sufficient number of new varieties of field crops with threshold potential in changing climate scenario (Brahmanand et al., 2013). In the present paper attempts have been made to analyze the specific challenges before the country and the role of biotechnology and genetic engineering in the Indian context for the faster development/deployment of climate resilient varieties to adapt climate change. Also, the progress and achievements made so far in the country is presented.

Challenges i) Limitations of natural nutrient and water availability cause gaps between the potential yield and actual yield if nutrient supplementation and water supplementation are not possible. Actual yield may be further curtailed by “reducing factors”: insect pests and diseases, which physically damage crops; weeds, which reduce crop growth by competition for water, light, and nutrients; and toxicity caused by water logging, soil acidity, or soil contamination (NASEM,2016). Moreover, climate change adversely affects almost all physiological processes like, germination, translocation, transpiration, photosynthesis, respiration, membrane stability, fertilization, fruit maturation, grain quality, nutrient absorption, protoplasmic, movement, transport of materials etc,. Nevertheless, climate change and climate varibility affect population dynamics of insects, emergence of new pests, changing status of pest and disease development in addition to the evolution of new races of the pathogen. The crop production is also affected by crop weed interactions (C3-C4), and loss of pollinator biodiversity etc. Nevertheless, the crop production is also affected due to climate change effect on crop phenology, reproduction, flowering, anthesis/pollen viability, pollination/fertilization, length of grain filling duration, grain setting, grain size, yield and ultimately grain quality (Singh et al.,2013).

Seed Times January - April 2017

Role of Biotechnology in Crop Improvement

ii) India, currently a producer of about 13%of the world’s wheat crop, might be forced to turn away from a high-yield potential, irrigated, low rainfall mega-environment to a heat-stressed irrigated, short season production environment because of changes in climate (Ortiz et al., 2008). Wheat yields may have stagnated in parts of India also because of current cultivars approaching their yield potentials. The effect of water scarcity for irrigation, falling groundwater water tables and soil-quality depletion may be even more pronounced for rice leading to the widespread rice-yield stagnation. On the basis of crop database covering the period between 1961 and 2008 annually, and tracks maize, rice, wheat and soybean performance across 13,500 political units Ray et al. (2012) demonstrated that for India yield gains are not occurring across 37% of rice, 70% of Wheat cropland areas and for some crops, the spatial extent of yield stagnation is more than half the cropped area. Rice in the Ganges–Brahmaputra Delta in Bangladesh and India are vital for the world rice production. Projected impacts of climate change—increased flooding and salinity pose a major threat to rice production in these areas (Banga and Kang, 2014). iii) In India, out of net sown area of 141 million hectares about 68% is reported to be vulnerable to drought in varying degrees, and in arid, semi-arid, semi humid and western India, the frequency of below normal rainfall is 54-57%, causing regular droughts. Long term data of India indicates that rain-fed areas witnesses 3-4 drought year after every decade, with 2-3 moderate and one severe, however, occurrence of droughts did not show any trend in frequency over the country (Mahdi et al., 2015). Drought is the most widespread and damaging abiotic stress in rice production. In parts of India, severe drought can cut rice yields by as much as 40%, equal to losses of $800m annually (IRRI, 2014). India ranks first among the rainfed agricultural countries of the world in terms of both extent and value of produce. The rainfed agriculture accounts for 57.0 per cent of total cropped area, 48.0 per cent of the area under food crops and 68.0 per cent of that under non-food crops (Planning Commission, 2011a). Nevertheless, India has the largest rainfed lowland area in the world, with flooding being considered as one of the most important abiotic stresses to rice production, after drought and weeds (Yamano et al., 2013). In India, about 17.4 Mha of rainfed lowland rice are grown each year; of which 5.2 Mha are submergence-prone. Rainfed upland rice constitute about 6.1 Mha area in India with very low productivity of less than 1.0 ton/hectare (Shetty et al., 2013). iv) Agricultural production is also adversely affected by other climate induced weather extremes, such as flooding and submergence (IPCC, 2007). Excess water in the soil reduces oxygen availability (Kozlowski 1984) leading plant death due to lack of oxygen and accumulation of toxic substances, such as organic acids, NO2 −, Mn2+, Fe2+, and H2 S (Janiesch, 1991). Thus, development of more flood-tolerant cultivars is critical for enhancing sustainable production and reducing yield gaps. Crop varieties that are optimal for current growing environments are unlikely to be the best vari¬eties for these environments in the future, as temperatures rise, rainfall patterns shift, and pest and disease pressures built-up. As a result, varieties that perform well under a wide range of conditions will be desirable (Heisey and Rubenstein, 2015). v) Achim Dobermann, Deputy Director General (Research) at International Rice Research Institute (IRRI), Los Baños, Philippines questioned that conventional breeding often takes 12-15 years from making the cross to reaching a measurable impact in farmers’ fields and even many varieties released do not even find wide adoption at all. Moreover, the goal of breeding is not to release more varieties, but to develop varieties or hybrids that meet the demands of farmers, processors, traders, consumers and other end users, only then will the return on investment be high enough (Dobermann, 2013). The benefit of investments made through R&D in crop improvement programme across country can only be realized if Varietal Replacement Rates (VRRs) is proper. On the basis of three years average, in wheat and rice only two dozen varieties covers >60% share in the total BS. In wheat and rice varieties developed in North and South India respectively spreaded in Eastern region, thus reflecting the advantage of domestic spillover (Singh, 2015a). BOX Biotechnology-The Codex definition of modern biotechnology comes from the Cartagena Biosafety Protocol under the Convention on Biological Diversity. It is defined as “the application of in vitro nucleic acid techniques, including recombinant DNA and direct injection of nucleic acid into cells or organelles or the fusion of cells beyond the taxonomic family that overcome natural physiological reproductive or recombinant barriers and that are not techniques used in traditional breeding and selection” (CAC, 2003). From 1973 to 2016, the ways to manipulate DNA to endow new characteristics in an organism (that is, biotechnology) have advanced Genetic engineering- A process by which humans introduce or change DNA, RNA, or proteins in an organism to express a new trait or change the expression of an existing trait—was developed in the 1970s. Genetic improvement of crop varieties by the combined use of conventional breeding and genetic engineering holds advantages over

Role of Biotechnology in Crop Improvement

Seed Times January - April 2017

reliance on either approach alone because some genetic traits that cannot be introduced or altered effectively by conventional breeding are amenable to genetic engineering. Other traits can be improved more easily with conventional breeding. Genome engineering- employs a direct and precise approach to whole-genome design and mutagenesis to enable a rapid and controlled exploration of an organism’s phenotype landscape. Advances in genome engineering are being fueled by two prevailing approaches: genome synthesis and genome editing. Whole-genome synthesis- which combines de novo DNA synthesis, large-scale DNA assembly, transplantation, and recombination, permits de novo construction of userdefined double-stranded DNA throughout the whole genome. Genome-editing- techniques, which can make a specific modification to a living organism’s DNA to create mutations or introduce new alleles or new genes, advanced in the 2000s. These techniques—such as mega nucleases, zinc finger nucleases, transcription activator-like effect or nucleases, multiplex automated genome engineering, and clustered regularly interspaced palindromic repeats—also may obviate the need for vector organisms. Genome editing- (often used interchangeably with the term Gene editing) permits targeted changes directly in the chromosomes of living cells. Leveraging these advances in genome engineering, synthetic biology has also been used to generate new products. In Synthetic biology-engineering principles are applied to reduce genetics into DNA “parts” so that those parts can be understood in isolation and reassembled into new biological parts, devices, and whole systems to build desired functions in living cells (NASEM, 2017).

Biotechnological Approaches for Crop Improvement In United States of America (USA) an ad hoc committee on Genetically Engineered Crops: Past Experience and Future Prospects conducted a broad review of available information on GE crops in the context of the contemporary global food and agricultural system. Many claims of positive and negative effects of existing genetically engineered (GE) crops have been made. The main task of the Committee was to examine the evidence related to those claims. The committee was also asked to assess emerging geneticengineering technologies, how they might contribute to crop improvement, and what technical and regulatory challenges they may present. The committee reviewed the relevant literature, conducted hearing from various stakeholders and read more than 700 opinions/comments from members of the public to expand its understanding of issues surrounding GE crops. Finally, the committee concluded that “sweeping statements about GE crops are problematic because issues related to them are multidimensional”. In 2016, the committee prepared its report and the same was published by the world’s leading academy, the National Academy of Sciences (USA) as Genetically Engineered Crops: Past Experience and Future Prospects (NASEM,2016). A few key findings and recommendations from the report are mentioned below to refresh readers.

Findings • The ability of crops with GE traits to address food-security concerns will depend on the types of traits introduced and the social and economic contexts in which the traits are developed and diffused. • Conventional and genetically engineered plant-breeding approaches in the 21st century have been enabled by increased knowledge of plant genomes, the genetic basis of agronomic traits, and genomic technologies to genotype germplasm. • Continued improvements in genomic technologies and algorithm and software development in the coming decades will facilitate further improvements in the efficiency of plant breeding. • As genomic technologies increase in throughput and decrease in cost, thousands of genomes will be characterized per crop species. • Construction of GE plants commonly relies on in vitro plant tissue culture that can result in unintended, somaclonally induced genetic change. Development of transformation methods that minimize or bypass tissue culture for all crop species would reduce the frequency of tissue-culture–induced somaclonal variation. • Exploitation of inherent biological processes—DNA binding-zinc finger proteins (ZFNs), pathogen-directed transcription of host genes (TALEs), and targeted degradation of DNA sequences (CRISPR/Cas) now permit precise and versatile manipulation of DNA in plants. Seed Times January - April 2017

Role of Biotechnology in Crop Improvement

• Application of -omics technologies has the potential to reveal the extent of modifications of the genome, the transcriptome, the epigenome, the proteome, and the metabolome that are attributable to conventional breeding, somaclonal variation, and genetic engineering. Full realization of the potential of -omics technologies to assess substantial equivalence would require the development of extensive species-specific databases, such as the range of variation in the transcriptome, proteome, and metabolome in a number of genotypes grown in diverse environmental conditions. • New molecular tools are further blurring the distinction between genetic modifications made with conventional breeding and those made with genetic engineering. • Treating genetic engineering and conventional breeding as competing approaches is a false dichotomy; more progress in crop improvement could be brought about by using both conventional breeding and genetic engineering than by using either alone.

Recommendations: • Investments in GE crop R&D may be just one potential strategy to solve agricultural-production and food-security problems because yield can be enhanced and stabilized by improving germplasm, environmental conditions, management practices, and socioeconomic and physical infrastructure. Policy-makers should determine the most cost-effective ways to distribute resources among those categories to improve productio • More research should be done to document benefits of and challenges to existing intellectual-property protection for GE and conventionally bred crops. • More research should be done to determine whether seed-market concentration is affecting GE seed prices and, if so, whether the effects are beneficial or detrimental to farmers. • Research should be done on whether trait stacking is leading to the sale of more expensive seeds than farmers need. • Public investment in basic research and investment in crops that do not offer strong market returns for private firms should be increased. Nevertheless, the American Seed Trade Association (ASTA), the “Plant breeding builds upon itself “and the “continued innovation in plant breeding is directly related to global food security, nutrition and a safe and sustainable environment.” Furthermore, ASTA stressed that the “ next evolution of plant breeding is genome editing” which works in the within the plant’s family as Andy LaVigne, ASTA president and CEO describe as “it just depends on which ones we are harnessing to bring into the marketplace to address the opportunities for consumer demands. It allows us to reach the same endpoint as we could through traditional methods, but in a more precise manner”. This has led the association and its members to adopt the following policy when it comes to plant breeding innovation: “Plant breeding varieties developed through the latest breeding methods should not be differentially regulated if they are similar to or indistinguishable from varieties that could have been produced from earlier breeding methods’ (Deering, 2016).

Prospects and Progress In the Indian Context An urgent requirement is to design breeding strategies aimed at improving traits that underlie adaptation to multiple stresses and have high scalability to yield or crop productivity (Sadras and Richards, 2014). Manipulation of root architecture can contribute to avoidance of multiple stress conditions such as water and nutrient deficiencies, as exemplified by the DEEPER ROOTING 1 (DRO1) locus in rice which alters root architecture towards vertical, deeper roots, resulting in both improved drought tolerance in terms of yield and enhanced nitrogen acquisition without a growth penalty in rice (Uga et al., 2014; Arai-Sanoh et al., 2014). Similarly, high transpiration rate can be detrimental under severe drought stress where stomata closure and maintenance of water status is more favorable. However, stomatal closure can amplify heat stress damage (Blum, 2015). Low canopy temperature is correlated with high stomatal transpiration and is used as a proxy for yield performance under optimal and stress conditions, facilitating drought and heat stress avoidance (Singh et al., 2007; Lopes et al., 2014; Singh, 2014). The stay-green trait is an indicator for the regulation of senescence and resource allocation which is crucial for yield under optimal as well as stress conditions (Thomas and Ougham, 2014). The molecular approaches in addition to genomics could be effectively utilized for precise incorporation of desirable traits including mentioned above to speed up the progress and varietal developments.

Role of Biotechnology in Crop Improvement

Seed Times January - April 2017

Smart breeding or marker assisted selection (MAS, also called marker assisted breeding – MAB) and Selection with Markers and Advanced Reproductive Technologies (SMART) breeding. Basically smart breeding works like conventional breeding. Because of the speed and accuracy of MAS, smart breeding can dramatically fast track conventional breeding efforts. Currently, molecular marker techniques are available to help breeders select desirable characters to be transferred into improved lines. In multinational seed corporations (MNCs) use of molecular breeding has increased significantly. The submergence trait in rice variety Swarna was transferred from a farmers’ variety, Dhullaputia, identified over 50 years ago in Orissa (India) and known to carry flood resistant gene ‘sub1a’55A (Singh, 2014). Submergence tolerance rice variety ‘Suvarna Sub- 1’ was released in 2009 in India. This was the first variety for which the flash-flood tolerance gene (SUB1A) was introgressed. Later, this gene was introgressed into 4 more mega rice varieties namely Samba Mahsuri, IR64, CR1009. Resistance breeding against diseases by MAS is highly efficient and precise compared to conventional approaches. Other successful examples of the success of MAS are tackling bacterial leaf blight, one of the most serious threats to rice in irrigated and rain-fed systems, across South and East Asian countries. MAS has extended the lifespan of a popular and effective pearl millet variety in Northern India by breeding in downy mildew resistance. Backcrossing has been used mostly for introgression of exotic germplasm to locally adapted best lines (one or two backcrosses to the adapted germplasm). Backcrossing has been used widely in the multinational seed companies for transferring transgenic traits (e.g. resistances to corn borers or specific herbicides) into the local best lines in order to make up new hybrids that are resistant to those traits (Kunta, 2013). Indian researchers associated to decodes Rice and Tomato genomes as part of international consortia and also decoded Pigeon pea (Arhar) and Chickpea (Chana) genomes on their own. Wheat is considered one of the challenging crop to decode, due to its huge genome size and three sets of highly similar chromosomes in the genome. The decoding of the wheat genome has led to the identification of more than 125,000 genes assigned to individual wheat chromosomes. The draft sequence is a major landmark towards obtaining a complete reference sequence of the hexaploid breadwheat genome. With a chromosome-based full sequence in hand, wheat breeders would have a high quality tool at their disposal to accelerate breeding programmes and to identify how genes control complex traits such as yield, grain quality, disease and pest resistance and tolerance to drought, heat and salt stresses. This would be able to precisely locate specific genes in individual wheat chromosomes. It would provide thousands of markers for DNA fingerprinting, diversity analysis and marker-assisted breeding in wheat. The availability of the wheat genome will accelerate gene discovery efforts and fast-track the development of superior wheat varieties. Similarly, brown plant hopper resistance was confirmed in nine farmers’ varieties of brown rice (Oryza rufipogan). The complete genome sequence of the Indian isolate of the rice tungro spherical virus (RTSV) from Andhra Pradesh was deciphered and deposited in the National Center for Biotechnology Information (NCBI) database (GOI, 2016). Although, India began developing transgenic crops (GM crops) in the early 1990s, Bt cotton is the only transgenic crop approved for commercial cultivation in India. Bt technology was deployed in cotton crop through genetic engineering techniques for control of bollworms, a major pest, thereby reducing the risk of crop failures and the use of pesticides. India cultivated approximately11.75 million hectares of Bt cotton with an adoption rate of 94 per cent approximately (2013-14). In the 13 years since its commercialization in 2002, there has been a phenomenal 230-fold increase in area. Both production and yield have increased and India – once an cotton-importing country turned into an exporter (Reddy et al., 2015). The GEAC, or Genetic Engineering Appraisal Committee, a body that functions under the Environment Ministry, on May 11,2017 gave its recommendation to approve a transgenic mustard called DMH-11. The final decision however, has to be given by the Hon’ble Supreme Court of India for its general cultivation and if permission is given by the apex court it will pave the way for other GM crops not only to ensure food and nutritional security of the country but also to reduce poverty and/or vulnerability by increasing yields vis-a-vis decreasing variability in yields. Ultimately, it will also help to attain the SDGs 1 and 2 (poverty reduction and zero hunger respectively by 2030), also this will help to adapt to climate change by the development and deployment of climate resilient varieties.

Rationalizing the Regulations Transgenic crops have not received universal acceptance. Opposition is mainly centered on issues like (i) safety to humans and animals as food and feed; (ii) safety of non-target organisms (biodiversity), soil and water; (iii) the perception that the technology push is mainly industry driven and consequently the fear of industry taking an portative hold over world agriculture and (iv) ideological discomfort with scientists (Reddy et al., 2015). However, basically objections to GM technologies are based on the twin fears that they may harm humans consuming the resulting produce and they may have adverse effects on biodiversity. But no compelling evidence supporting either of these fears has emerged more than two decades after the original introduction of GM foods in 1994. On the contrary, GM technology has proven useful in curtailing the use of pesticide and insecticide in combating pests and diseases. In the

Seed Times January - April 2017

Role of Biotechnology in Crop Improvement

Indian context, it also offers the prospects of making crops tolerant to drought, salinity and other abiotic stresses. The fortification of grains and edible oils with vitamin A and modified fatty acid profile are some examples of upstream benefits to consumers. The United States has reaped these benefited for at least one and half decades. Recently, even India has been importing and consuming canola oil made from GM rapeseed with no adverse health effects reported. NITI Aayog also noted, “World’s leading scientific bodies like the US National Academy of Sciences, the UK’s Royal Society, the German Risk Assessment Agency, the European Academy of Science, the Canadian Royal Society, the New Zealand Royal Society, and India’s seven science academies have declared GM crops safe. Innumerable scientific associations and regulatory bodies have all concluded that GM crops are safe and economically beneficial, based on hundreds of independent economic assessment studies published in the best scientific publications that undergo rigorous peer review” (NITI Aayog, 2015). Concerning to GM food safety, the [Genetically modified] foods currently available on the international market have passed safety assessments and are not likely to present risks for human health. In addition, no effect s on human health have been shown as a result of the consumption of such foods by the general population in the countries where they have been approved (World Health Organization, 2014). Although commercially deployed GE crops have generally had favorable economic outcomes for adopters of these crops, outcomes for farmers are heterogeneous because the social and economic effects depend not only on the fit of the crop variety to the environment, but also on the institutional support available to the farmer, such as access to credit, affordable inputs, extension services, and markets. Researchers have also found that, so far, genetic engineering has not increased the yield potential of crops, though the technology has been used to reduce yield losses due to pests, and research to improve nutrient use and increase the efficiency of photosynthesis is ongoing (NASEM, 2016). Through an in-depth societal impacts analysis, socio-economist have found that economic impacts of GE crops for different groups of farmers are mixed; that the political and regulatory context has significant impact on the ability of different groups to benefit; and that current private-sector control of GE crops, which is reinforced by the intellectual property system, reduces the benefits of GE crops for poor farmers due to high seed costs and distributional constraints (Fischer et al., 2015). With regard to access to affordable inputs and to markets, some people argue that the industrialization of agriculture through biotechnology may reduce the number of agents with economic access to agriculture (for example, inability of small farmers to compete with transnational enterprises) as well as decrease genetic diversity that can be achieved through plant-breeding programs and seed sharing at the grower level (Shiva et al., 2011). On a related note, some are concerned that industrial deployment of certain seed varieties over others may reduce the biodiversity of the food supply (that is, reduction in the seed varieties to be planted and cultivated worldwide) (Jacobsen et al., 2013). Concentration of the global transgenic seed market has been rapidly increasing, and food and agriculture are increasingly controlled by just a few companies which focus on profitable GE crop products (Bonny, 2014). In a meta-analysis published summarizes the findings of 147 original studies published between 1995 and March 2014, to provide robust evidence that GE technology applied to soybean, maize and cotton has reduced chemical pesticide use by 37%, increased crop yields by 22% and enhanced farmer profits by 68%. The analysis also concluded that (i) yield gains and pesticide reductions are larger for insect-resistant crops than for herbicide-tolerant crops, and (ii) yield and profit gains are higher in developing countries than in developed countries (Klu¨mper and Qaim, 2014). Therefore, keeping the facts in mind with respect to issues and challenges viz, food and nutritional security to meet the demand of ever increasing population vis- a-vis diversified food items demand due to increased incomes, diminishing natural resource base, stagnating yield levels, higher yield gaps, and challenges posed by climate change a balanced and unbiased decisions need to be taken to regulate the GM crops in the country.

Conclusion Returns to investment on stress-tolerant breeding are expected to be quite attractive. A 5-10 per cent higher crop yield and an internal rate of return of 29-167 per cent on investment in drought-tolerant rice research have been reported for eastern India (Mottaleb et al., 2012). An ex-ante assessment of the benefits of drought-tolerant wheat and maize (Kostandini, 2008) and groundnut (Birthal et al., 2012) established that adoption of drought-tolerant varieties can considerably reduce production risks. Rice cultivars (Subarna Sub 1) that can withstand prolonged sub-emergence are now becoming popular (Birthal, 2013). The Crop Science Society of America has developed a “Position Statement” on climate change, which goes on to suggest that research investments and scientific and technological measures among others are needed to understand the physiological, genetic, and molecular basis of adaptation to drought, heat, and biotic stresses likely resulting from climate change (CSSA, 2010). Dar et al. (2012) report that a flood-tolerant rice variety (Suvarna Sub-1) had a significant positive impact (45 percent higher yields) under prolonged flooding (6–14 days) compared to a popular variety in the eastern region. In Bihar, another randomized evaluation of traits in rice varieties (Ward et al., 2013) finds that farmers value drought-tolerant cultivars and are willing to pay more for them. The climate resilient varieties of cereal crops 68

Role of Biotechnology in Crop Improvement

Seed Times January - April 2017

developed and deployed in India have been able to increase the production and productivity in different states (Singh, 2015b). These climate resilient varieties have been able to reduce the yield gap in rice in the eastern India. In the recommendations of Inter drought II, 2nd International conference held in Rome (2005) “While the support for and the capacity of plant biotechnology increased, the collaboration with plant breeding has been insufficient (with the exception of the private sector). This lack of collaboration resulted in slow delivery of biotechnology solutions to the user in the field. There is an explosive growth of information in genomics with a proportionally minute rate of application of this information to problem solving in farming under water-limited conditions” highlighting the crucial role to be played to develop climate resilient varieties in the future.

References Arai-Sanoh, Y., Takai, T., Yoshinaga, S., Nakano, H., Kojima, M., Sakakibara, H., Kondo, M., Uga, Y. (2014). Deep rooting conferred by DEEPER ROOTING 1 enhances rice yield in paddy fields. Scientific Rep., 2014:4. Banga, S.S. and Kang, M.S. (2014). Developing Climate-Resilient Crops. Journal of Crop Improvement, 28(1): 57-87. Birthal, P.S. (2013). Application of Frontier Technologies for Agricultural Development. Indian Journal of Agricultural Economics, 68(1):20-38. Birthal, P.S., Nigam, S.N., Narayanan, A.V. and Kareem, K.A. (2012). Potential Economic Benefits from Adoption of Improved Droughttolerant Groundnut in India. Agricultural Economics Research Review, 25(1): 1-14. Blum A (2015). Towards a conceptual ABA ideotype in plant breeding for water limited environments. Functional Plant Biol., 42:502513. Bonny, S. (2014). Taking stock of the genetically modified seed sector worldwide: Market, stakeholders, and prices. Food Security, 6(4): 525–540. Brahmanand, P.S., Kumar, A., Ghosh, S., Chowdhury, S.R., Singandhupe, R.B., Singh, R., Nanda, P., Chakraborthy, H., Srivastava, S.K. and Behera, M.S. (2013). Challenges to food security in India. Current Science, 104 (7): 841-846. Burney, J.A., Davis, S.J. and Lobell, D.B. (2010). Greenhouse gas mitigation by agricultural intensification. Proceedings of the National Academy of Sciences USA 107 (26): 12052–12057. CAC (Codex Alimentarius Commission) (2003). Principles for the Risk Analysis of Foods Derived from Modern Biotechnology. Doc CAC/ GL 44-2003. Rome: World Health Organization and Food and Agriculture Organization. Available on file:///C:/Users/DSF/Downloads/ CXG_044e.pdf. Census of India (2011). Census provisional population totals. Office of the Registrar General and Census Commissioner, Ministry of Home Affairs, New Delhi, India. Available on http://censusindia. gov.in/. Dar, M.H., de Janvry, A., Emerick, K., Raitzer, D. and Sadoulet, E. (2013). Flood-tolerant rice reduces yield variability and raises expected yield, differentially benefitting socially disadvantaged groups. Science Report, 3: 1-8. Dastagiri, M.B., Immanuelraj, T.K. and Patil, G.I. (2013). India’s Self, cross & often cross pollinated crops in the global crop production: Mendalian variation perspectives. Science Discovery, 1(3): 16-27. Deering, J. (2016). ASTA talks plant breeding innovation. available on (http://seedworld.com/author/jdeering/). Dobermann, A. (2013). How plant breeders can change the world. Sabrao Journal of Breeding and Genetics, 45 (1): 6-7. Evenson, R.E. and Gollin, D. (2003). Assessing the impact of the Green Revolution, 1960 to 2000. Science, 300: 758–762. FAO (2016). The State of Food and Agriculture; Climate Change, Agriculture and Food Security. pp194. ISBN 978-92-5-109374-0.

Seed Times January - April 2017

Role of Biotechnology in Crop Improvement

Fischer, K., Ekener-Petersen, E., Rydhmer, L. and Björnberg, K.E. (2015). Social impacts of GM crops in agriculture: A systematic literature review. Sustainability, 7(7): 8598–8620. GOI (2016). State of Indian Agriculture2015-16. Ministry of Agriculture & Farmers elfare, Department of Agriculture, Cooperation & Farmers Welfare Directorate of Economics & Statistics. New Delhi. Heisey, P.W. and Rubenstein, K.D (2015). Using Crop Genetic Resources To Help Agriculture Adapt to Climate Change: Economics and Policy, EIB-139, U.S. Department of Agriculture, Economic Research Service, April 2015. ICAR (2010). Degraded and Wastelands of India Status and Spatial Distribution. Indian Council of Agricultural Research, KAB-I, Pusa, New Delhi. Interdrought-II (2005). 2nd International conference on integrated approaches to sustain and improve plant production under drought stress. Conference conclusions and recommendations. Rome, Italy, 24–28 Sept 2005. http://www.plantstress.com/ID2/ID2-Report.pdf. IPCC (2007). Climate Change 2007: Impacts, Adaptation and Vulnerability. Contribution of Working Group II to the Fourth Assessment Report of the Intergovernmental Panel on Climate Change, M.L. Parry, O.F. Canziani, J.P. Palutikof, P.J. van der Linden and C.E. Hanson, Eds., Cambridge University Press, Cambridge, UK, 976pp. IPCC (2012). Managing the Risks of Extreme Events and Disasters to Advance Climate Change Adaptation. A Special Report of Working Groups I and II of the Intergovernmental Panel on Climate Change [Field, C.B., V. Barros, T.F. Stocker, D. Qin, D.J. Dokken, K.L. Ebi, M.D. Mastrandrea, K.J. Mach, G.-K. Plattner, S.K. Allen, M. Tignor, and P.M. Midgley (eds.)]. Cambridge University Press, Cambridge, UK, and New York, NY, USA, 582 pp. IRRI (2014). Drought tolerant rice. International Rice Research Institute (IRRI). http://irri.org/our-work/research/better-ricevarieties/ climate-change-ready-rice. Jacobsen, S.E., Sørensen, M., Pedersen, S.M. and Weiner, J. (2013). Feeding the world: Genetically modified crops versus agricultural biodiversity. Agronomy for Sustainable Development, 33(4): 651–662. Janiesch, P. (1991). Ecophysiological adaptation of higher plants in natural communities to water logging. In Ecological responses to environmental stresses, Edited by: Rozema, J. and Verkleij, J. A. C. 50–60. Dordrecht: The Netherlands: Kluwer Academic Publishers. Klümper, W. and Qaim, M. (2014). A Meta-Analysis of the Impacts of Genetically Modified Crops. PLoS ONE 9(11): e111629. https:// doi.org/10.1371/journal.pone.0111629. Kostandini, G. (2008). Three Essays on Measuring the Ex-ante Economic Impacts of Agriculture Technology Innovations, Doctoral Dissertation, Virginia Polytechnic Institute and State University, Virginia. Kozlowski, T.T. (1984). Extent, causes, and impact of flooding. In: Flooding and plant growth, Edited by: Kozlowski, T. T. 1–5. London, UK: Academic Press. Kunta, T. (2013). Reflections on 23 years of field crop breeding for the multinational seed companies in tropical and sub-tropical regions. SABRAO J. Breed. Genet. 45: 8-16. Lopes, M.S., Rebetzke, G.J., Reynolds, M. (2014). Integration of phenotyping and genetic platforms for a better understanding of wheat performance under drought. J. Exp. Bot. 65: 6167-6177. Mahdi, S.S., Dhekale, B.S., Choudhury, S.R., Bangroo, S.A. and Gupta, S.K. (2015). On the climate risks in crop production and management in India: A review. Australian Journal Crop Science, 9(7): 585-595. Meiyappan, P., Roy, P.S., Sharma, Y., Ramachandran, R.M., Joshi, P.K., DeFries, R.S. and Jain, A.K. (2016). Dynamics and determinants of land change in India: integrating satellite data with village socioeconomics. Reg Environ Change, pp. 162, DOI 10.1007/s10113-0161068-2

Role of Biotechnology in Crop Improvement

Seed Times January - April 2017

Mottaleb, K.A., Roderick, M., Mohanty, S., Murty, M.V.R., Li, T., Valera, H.G. and Gumma, M.K. (2012). Ex-ante Impact Assessment of a Drought Tolerant Rice Variety in the Presence of Climate Change, Paper presented at the Agricultural and Applied Economics Association Annual Meeting, Seattle, Washington, U.S.A., August 12-14. National Academies of Sciences, Engineering and Medicine (2016). Genetically Engineered Crops: Experiences and Prospects. Washington, DC:The National Academies Press. doi: 10.17226/23395. National Academies of Sciences, Engineering, and Medicine (2017). Preparing for Future Products of Biotechnology. Washington, DC: The National Academies Press. doi:10.17226/24605. NITI Aayog (2015). Raising Agricultural Productivity and Making Farming Remunerative for Farmers. An Occasional Paper based on the work of the Task Force on Agricultural Development constituted by the National Institution for Transforming India (NITI) Aayog, Government of India in March 2015. Ortiz, R., Braun, H., Crossa, J., Crouch, J.H., Davenport, G., Dixon, J., Dreisigacker, S., Duveiller, E., He, Z. and Huerta, J. (2008). Wheat genetic resources enhancement by the international maize and wheat improvement center (CIMMYT). Genet. Resour. Crop Evol. 55: 1095-1140. Planning Commission (2011a). Faster, Sustainable and More Inclusive Growth. An Approach to the Twelfth Five Year Plan (2012-17), Govt. of India, p. 146. Ramasamy, K. (2013). New Innovations, Technologies and Practices Enhancing Agricultural Production and Productivity in India. In: Shetty P K, Ayyappan S and Swaminathan M S (eds). Climate Change and Sustainable Food Security, National Institute of Advanced Studies, Bangalore and Indian Council of Agricultural Research, New Delhi. pp 57-78. Ray, D.K., Ramankutty, N., Mueller, N.D., West, P.C., Foley, J.A. (2012). Recent patterns of crop yield growth and stagnation. Nature Communications, 3: 1293. Reddy, D.V.R., Kumar, P.A., Kumar, P.L., Loebenstein and Rao, C.K. (eds). (2015). Improving Food Security and the Livelihoods of the Resources: Genetically Engineered Crops in Developing Countries. Studium Press LLC, P.O. Box 722200, Houston, TX 77072, USA. 2015. xviii + 405 pp. ISBN: 1-62699-035-2. Rehmani, M.I.A., Wei, G., Hussain, N., Li, G., Ding, C., Liu, Z., Wang, S. and Ding, Y. (2014). Yield and quality responses of two indica rice hybrids to post-anthesis asymmetric day and night open-field warming in lower reaches of Yangtze River delta. Field Crops Res. 256: 231-241. Robinson, T.P., Wint GW, Conchedda G, Van Boeckel TP, Ercoli V, Palamara E, Cinardi G, Dâ&#x20AC;&#x2122;Aietti L, Hay SI, Gilbert M (2014) Mapping the global distribution of livestock. PLoS ONE 9:e96084. Sadras, V.O., Richards, R.A. (2014). Improvement of crop yield in dry environments: benchmarks, levels of organisation and the role of nitrogen. J. Exp. Bot., 65: 1981-1995. Shetty, P.K., Hegde, M.R., Mahadevappa, M. (2013). Innovations in rice production. National Institute of Advanced Studies. Indian Institute of Science Campus, Bangalore-560012, pp. 262. Shiva, V., Barker, D. and Lockhart, C. (2011). The GMO Emperor Has No Clothes: A Global Citizens Report on the State of GMOs, Synthesis Report. Florence: Navdanya International. Singh, R.P. (2014). Effect of heat and drought in crops under rainfed/marginal environments and mitigation strategies through breeding for tolerance: A Review, Climate Change and Environmental Sustainability, 2(1): 10-29. Singh, R.P. (2015a). Varietal replacement rates among field crops: current status, constraints, impact, challenges and opportunities for the Indian seed industry. Seed Times, 7(3&4): 71-89.

Seed Times January - April 2017

Role of Biotechnology in Crop Improvement

Singh, R.P. (2015b). Productivity enhancement among major cereal crops by mitigating climate change effect through deployment of climate resilient varieties in India: Evidence from the field. Climate Change and Environmental Sustainability, 3(2): 144-156. Singh, R.P., Prasad, P.V.V. and Reddy, K.R. (2013). Impact of changing climate and climate variability on seed production and seed industry. Advances in Agron. (Academic Press, New York), 118: 49-110. Singh, R.P., Prasad, P.V.V., Sunita, K., Giri, S.N. and Reddy, K.R. (2007). Influence of High Temperature and Breeding for Heat Tolerance in Cotton- A Review. Advances in Agronomy, (Academic Press, New York), 93: 313-385. Thomas, H. and Ougham, H (2014). The stay-green trait. J. Exp. Bot. 65:3889-3900. Uga, Y., Sugimoto, K., Ogawa, S., Rane, J., Ishitani, M., Hara, N., Kitomi, Y., Inukai, Y., Ono, K., Kanno, N. (2013). Control of root system architecture by Deeper Rooting 1 increases rice yield under drought conditions. Nat Genet., 45: 1097-1102. Vermeulen, S.J., Aggarwal, P.K., Ainslie, A., Angelone, C., Campbell, B.M., Challinor, A.J., Hansen, J.W., Ingram, J.S.I., Jarvis, A., Kristjanson, P., Lau, J.C., Nelson, G.C., Thornton, P.K. and Wollenberg, E. (2011). Options for support to agriculture and food security under climate change. Environmental Science & Policy (in press), pp. 9. vonGrebmer, K., Bernstein, J., Nabarro, D., Prasai, N., Amin, S., Yohannes, Y., Sonntag, A., Patterson, F., Towey, O. and Thompson, J. (2016). Global Hunger Index: Getting to Zero Hunger. Bonn, Washington, DC,and Dublin: Welthungerhilfe, International Food Policy Research Institute, and Concern Worldwide. ISBN: 978-0-89629-226-0 DOI: http://dx.doi.org/10.2499/9780896292260 Ward, P.S., Ortega, D.L., Spielman, D.J., Singh, V. and Magnan, S. (2013). Farmer Preferences for Abiotic Stress Tolerance in Hybrid versus Inbred Rice: Evidence from Bihar, India. Selected Paper prepared for presentation at the Agricultural and Applied Economics Association 2013 AAEA & CAES Joint Annual Meeting, Washington, D.C., August 4-6, 2013., pp. 30. World Health Organization (2014). Frequently Asked Questions on Genetically Modified Foods. Available at http://www.who.int/ foodsafety/areas_work/food-technology/Frequently_ asked_ questions_on_gm_foods.pdf. Yadavendra, J.P., Patel, V.P. and Witcombe, J.R. (2005). The impact of new maize and rice varieties on the livelihoods of poor farmers in marginal agricultural areas of western India. In: livelihood summit 2005 Udaipur, Organised by IFFDC during 27th -30th October. Yamano, T., Malabayabas, M. and Gumma, M.K. (2013). Adoption, Yield, and Ex Ante Impact Analysis of Swarna-Sub 1 in Eastern India. STRASA Economic Briefs, No. 2.

The article has been published with permission of authors

Role of Biotechnology in Crop Improvement

Seed Times January - April 2017

Seed biotechnology: emerging tools and technology for a paradigm shift in enhancing agricultural productivity and value addition - Retrospectives and Perspectives Asit B. Mandal*+, Sourav Dutta+ and Bhojaraja K. Naik# *Former Director, Directorate of Seed Research, Mau 275101 Present address: +Biotechnology Unit, ICAR-Central Research Institute for Jute and Allied Fibres, Barrackpore, Kolkata 700120, WB #ICAR-Directorate of Seed Research, Mau-275103 Email: amandal2@rediffmail.com

Abstract Agriculture provides lifeline to nearly 65% population in India. Agriculture has witnessed spectacular growth in spite of huge population pressure and at the interface of innumerable odds. India is a country endowed with agrarian economy albeit the GDP has drastically reduced to 15.7%, which was about 50 % during the time of independence. In this memorable journey, agricultural science has played magnificent role’. The nightmare of food scarcity wiped out and India emerged as a “bread basket” instead of its” begging bowl” status. Seed constitutes the basic input in effecting successful agriculture and is the most important determinant in realizing production potential, on which the efficacy and efficiency of other agricultural input are heavily contingent upon for being optimally effective. An increase in agricultural production and productivity largely depends upon development and deployment of new and improved varieties of crops with superior genetics and an efficient system for timely supply of quality seed and other inputs to the farmers. Seed is indispensable to have profitable crop husbandry from productive varieties with superior genetics and extreme genetic purity. The need of the hour is to ensure quality seed availability by implementing stringent quality control measures to arrest proliferation of spurious seed and ensuring their availability through diverse mechanisms in rural areas including public-public and public-private partnership development for research and commercialization of elite varieties, elaborate seed technology research and developing far greater infrastructure and effective mechanism for inbred, hybrid / transgenic production as well as quality seed production. In increasing quality seed production the country has developed efficient protocol for quality seed multiplication for diverse categories of seeds with the aid of intensive research on quality seed production, seed physiology, seed pathology, entomology, postharvest technology including safe storage protocol of different categories of seeds. However, the quantum of seed biotechnology research, which is deemed to be very potential to augment seed quality. Extremely limited efforts have been made in India in conducting seed science research except in six specialized laboratories across the country along with some sporadic efforts made transiently, which warrants conceptualization and implementation of hi- tech biotech research to augment Indian agriculture to attain farm prosperity.

Introduction “India lives in its villages”. And the villages where about 70% people live (of which about 57%) are largely dependent upon agriculture for their livelihood, perpetuation and prosperity. In spite of all round efforts since independence the colonial legacy and feudalistic social systems, which the country has inherited are found to be serious bottlenecks in augmenting Indian agriculture. Before probing Seed Times January - April 2017

Role of Biotechnology in Crop Improvement

into the biotechnological approaches for quality seed enhancement it would be prudent to have a glimpse of Indian seed sector so that the strength and SWOT of the system could be understood to draw appropriate strategies. Seed is seminal to agriculture and is the sole technology, which dispense life into the soil without which the production of agriculture cannot take place to its full potential. The efficacy and efficiency of other agricultural inputs are predominantly contingent upon the quality of seeds for remunerative agriculture. In this parlance, quality seeds play the vital role, which must be genetically pure, safe and embodied with the ingredients, which would lead into a robust uniform crop stand endowed from highly productive varieties with appreciable seed germination, maximum speed of seedling emergence and thereby an uniform crop stand which would be able to capitalize inputs uniformly, best agronomic practices including health care, postharvest technologies and safe storage value addition and marketing to bring remunerative crop husbandry. The quality seed alone can enhance productivity up to 15-20% and under optimum management condition the yield may be increased up to 40-45% in different crops. So in nutshell for a productive agriculture quality seed is indispensible. It is unfortunate that even in this current age when our demand for diverse crops is booming up and has to be almost doubled by 2050 AD and many crops e which, constitute the principal component of Indian dietary system need to be increased by 70%. In the countryside, the farmers still grow (about 80%) farm- saved seeds i.e., those seed, which remain left after consumption as food. Special efforts are meager by the farmers to produce quality seeds, which is largely coming out from private companies and affordable by only the progressive farmers. India is a country where 90% land holders are marginal and cannot be subjected to large-scale mechanization and manually everything has to be done, which is not only tedious, time consuming and often costly. At the interface of global climatic change, declining bio resources, acute manpower shortage and their migrations towards urban areas for sustenance and maintenance of livelihood (alternate livelihood), inadequate availability of agricultural inputs, which are very costly and non-availability of quality seeds at affordable cost in time are the stumble blocks, which are discouraging the younger generation for alternative option of livelihood and thus the future of Indian agriculture is at cross road, need redressal of the emerging problems. Considering pros and cons the indispensability of use of quality seeds is obviously should be considered to be the need of the hour which is highlighted below in tabular form:

Source: www.dsr.org.in 74

Role of Biotechnology in Crop Improvement

Seed Times January - April 2017

Since antiquity the importance of quality seed to enhance agricultural productivity is well evident as mentioned in old testimonials, literature, scriptures, epics, and many other treatises. In course of time through critical observation and elaborate experimentations conducted over years across continents, it was observed that there are ample ways and means to enhance vigour of germinating seedlings while emerging from the seed which produce uniform crop stand and finally more yields is achieved by adopting such simple techniques. The history of quality seed production, which ushered in mid-sixties and India, could emerge as a country from its ‘begging bowl’ status to ‘bread basket’ and now an ‘often’ exporter country in which the major pillars were quality seeds of most productive dwarf rice and wheat varieties, adoption of best agronomic practices, including appropriate health care, PHT and storage, enabling govt. policies and above all the hard work of Indian peasants. It is interesting to note that events before Green revolution, Govt. of Indian had realized the importance of quality seed and launched a project, which was a landmark event in this country i.e. is the launching of a project captioned PIRCOM in 1958 to produce quality seeds of predominant crops from good quality indigenous varieties. Anyhow, in course of time and with the massive financial grant received in three major phases from the World Bank, the National Seed Programme (NSP) was launched in seventies and the country made huge success in production of breeder seeds of productive varieties and the succeeding categories there of like foundation, certified, TFL etc., by involving both public and private partners in a very cohesive way and the seed multiplication model emerged as a role model, which are now being followed by many countries including our neighboring SAARC countries. The production target as envisaged in National Seed Plan 2005 has been fulfilled (259 lakh q) but still we need more quality seeds since vast majority of agricultural land is still being grown with farm-saved seeds, which is not at all logical and must be replaced with quality seeds at 4 years interval in case of self-pollinated crops and 3 years interval in case of cross pollinated crops. In spite of all odds, the Indian agricultural scientists have developed very sound, effective and efficient seed multiplication chain starting from nucleus to certified/truthfully labeled seed, which is implemented throughout the country and thus ensured no deficiency in supply of quality seeds in different crops and the country, would be able to nourish its people without many hassles. The country has accorded due priority to the development of new high yielding varieties/ hybrids right from 1960s. As a result, HYV programme was launched, through which new high yielding/ dwarf varieties of wheat and rice and high-yielding hybrids of maize; pearl millet and sorghum were developed very systematically. In fact India is the world leader in development of hybrids and till now we have developed hybrids in as many as eight crops. Knowing well the fact that seed is the key for spread of varietal technology, the country has are most priority or production and distribution of quality seed of improved varieties/hybrids by establishing National Seed Corporation-the giant seed sector in 1963. Enactment of Seed Act in 1966 and establishment of State Seed Corporations (SSC) and Seed Certification Agencies across the country, which all contributing synergistically in successful quality seed production programme in the country. The role of quality seed is also very important in the context of seed health and phyto-sanitary aspects. The public: private share in Indian seed market in terms of volume is 54:56 and in terms of value 40:60. There is preferential holding of the seed market by the private sector for high value, low volume seeds, whereas the public sector deals with high volume low value crops to ensure food and nutritional security of the people. The contribution of Indian agriculture has declined to a level of 15.7% only, which was about 70% (85% people were engaged in agriculture) during the time of independence owing to opening of alternative livelihood avenues, urbanization, shrinkage of cultivation land, discernible decline in resources, yield plateauing in major crops, climate change and innumerable other anthropogenic reasons. Agriculture contributes about 10.23% of the national export. Private and public sector investment in agriculture is 17.6 and 82.4%, respectively. India is a gene rich country. Among 90 crops cultivated in India 35 crops are major crops. About 37% area is irrigated that produces 60% food grains, average land holdings is 0.15 ha. About 93% possess <4 ha land and operate on 55% of arable land, only 1.67% farmers have operational land holdings > 10 ha and cultivate 17.4% of the cultivable land. It cultivates on its 187 million ha land and could produce a record production of 233.88 million tons during 2008 - 09, while our production was only 50 million tons during the time of independence. It indicates that significant strides have been made owing to development of large number HYVs (3500) in diverse agricultural crops (233.88 million tons from 187 mha), formulation and adoption of improved package of practices including integrated nutrient management, inspection and disease pest managements, efficient PHT, storage and value addition. The country is self-sufficient to feed the people, however, serious challenges like climate change, depleting resources, and diversions of agricultural land to other uses and declining bio resources are looming large in the horizon. In spite of intensive efforts in majority of the crops our productivity is exceedingly low in comparison to the developed countries, growth rate is wobbling around 2.37%, which is expected to be 4% this year, which warrants intensive research, technology development, refinement and dissemination to spearhead Indian agriculture to attain farm prosperity and a robust economy thereof in which quality seeds would constitute key component in the entire production technology gamut. Since India is endowed with diverse agro climatic zones with contrasting climatological parameters across the country and the kinds of agricultural crops and commodities being cultivated are also diverse, the task of managing the requirements of such a highly diversified agriculture is obviously a stupendous job, which needs redressal of the existing and emerging problems through deployment of both conventional and cutting edge frontier science to have speedy remedy synergistically. In the meantime a new biology called biotechnology has taken its birth, based on genetic level, be it nucleic Seed Times January - April 2017

Role of Biotechnology in Crop Improvement

acid or protein in a very precise way with ease and confidence, which averts the masking efforts of the growing environments and can be used in nondestructive manner. The work in this endeavor for assessing genetic purity has started since the beginning of nineties and now at least we are in a position to use, some of the findings and we optimistically look forward that within a couple of years concrete recommendations in this endeavor will be at our disposal, which would capitalize the benefits of biotechnological tools and techniques in seed science research not only for genetic purity assessment but also for other avenues, which would augment seed science research to spearhead productivity, value addition and product diversification, which are highlighted thematically below. Biotechnology – a new horizon to enhance seed science research After independent even at the inter face of many odds, quality and quantity of seed have increased significantly amounting to about 3 times in field crops, 5 times in horticulture crops and 7 times in fisheries mainly through conventional genetics, breeding, seed technology research including post-harvest technology and storage however there was hardly any biotechnological research was adopted because this new branch of knowledge is of very recent origin and countries like India, where insufficient infrastructure, inadequate facilities & skilled man power were the stumble block in implementing high tech frontier research involving sophisticated tools and techniques. Basically in the seed science research particularly in the crop science, which contributes the main stream of agriculture need to be focused to enhances the characteristics related to seeds like germination percentage, speed of seedlings immergence, dormancy, seed longevity, senescence and finally the productivity. So it was the outmost essentiality to under strand the molecular mechanism governing those traits and finally they are manifestation in enhancing quality seed production and the related characters, which are deemed to be contributing to enhanced productivity and production as well. Un fortunately at molecular the quantum of research done especially after inception of AICRP-NSP (crops) in seventies which was a landmark even could not be revolutionized. The sewed multiplication systems were predominantly governed by production of nucleus and breeders’ seeds at the govt. level and conductance of grow out test to assess the genetic purity. Although there are 30 regulatory seed rules, laws and amendments are available owing to their non-stringent complains the quality of foundation and certified seeds very often found to be spurious. It is to be mentioned d that GOT by removing the off-type is very tedious and time consuming processes,which must be replaced with more precise techniques which can be practiced with ease and confident but with 100 % genetic purity. Thematic area for seed Biotechnological research: The biotechnological research to augment seed science research should be focused as mentioned below with a view to fulfill some specific objective, which are exclusively seed related.

1. Genetic Purity test for enhanced productivity: Raising seed crops from appropriate class of seed is crucial. Five principal categories of seeds are generally recognized in the seed sector viz nucleus, breeder, foundation, certified and truthfully labeled seeds (TFL). Breeder’s seed are seeds or vegetative propagating material which is directly developed by breeders or controlled by the sponsoring breeder of the host institution. This should be 100 % genetically pure & which represents the progenies of nuclear seeds provides increases of foundation seeds. Foundation seed are normally produced by the national seed corporations seed stock, spread across the country, which actually used as the source material for certified seeds. In each and every generation especially from nucleus to certified seeds categories, plant to row progenies are mentioned and are periodically absorbed by the scientist and finally approved by seed certificatory inspector with proper leveling and certification. The responsibility of TFL seeds of course grows to the producer. Isolation is required during seed crop production to avoid contamination due to natural crossing and diseases infection by wind and insects from neighboring field and also during sowing, harvesting, threshing and handling of seeds to avoid mechanical mixtures. The off type plants i.e. plants arising from presence of recessive genes in heterozygous condition, continued presence of which would certainly deteriorate the genetic purity of the variety are removed. This is referred to as “rouging”. The objective of seed certification to maintain and make available crop seeds, tubers, bulbs, etc. of good seeding value and true to variety for seed certification purpose. For this purpose, experienced and qualified personal are required from seed certification agency to carry out field inspection at appropriate stage of crop growth. After crop harvest, samples for seed testing and also for grow-out-test (GOT) are taken. Varieties being grown for seed production should periodically be tested for genetic purity by grow-out-test, to make sure that the seeds are being maintained in their true form. While producing quality seeds, genetic purity must be given highest priority, which is of course produced by breeders and seed technologies through Grow-out-test(GOT) i.e., it is the official measure for controlling the genetic purity of the seed lot. It serves as a pre-control as well as a ‘post-control’ test for avoiding genetic contaminations. According to the official regulations in India, it is

Role of Biotechnology in Crop Improvement

Seed Times January - April 2017

pre-requisite for seed certification of hybrids of certain species such as cotton, castor, musk melon and brinjal by growing seeds of individual plants into progenies and by assessing the presence of off types, seeds can be tested based on morphological characters especially in respect of unique characters. However in assessing genetic purity, novel and innovative approaches like biochemical markers (Polypeptide profiling {water soluble and Tris - soluble polypeptide}, Isozyme analysis, Chemotyping) and most powerful molecular marker having extreme stringency and reproducibility are nowadays being used. Different kind of marker like RAPD, RFLP, EST-PCR, AFLP, SNP, Microarray and RAD sequencing, next generation sequencing are potential markers. This maybe further up scaled and made 100% full proof by using most modern high throughput assays like detection of single nucleotide polymorphism (SNP), through microarray, next generation sequencing in conjunction with appropriate bioinformatics tools (http://agridr.in, http:// www.agriinfo.in). Isozyme (multiple molecular forms of an enzyme with altered function) and/or DNA databases are necessary for varietal identification and protection and have found immense application in plant breeding programs. Their usage is indispensible in resolving queries associated with errors during multiplication, mixing of hybrid seeds/lines, uncontrolled pollination etc. Genetic purity of seeds can also be determined by electrophoresis of their storage proteins. Molecular markers, which in comparison to other morphological markers are much more robust and can easily be used for rapid data collection, are much in vogue contemporarily (Nikolić et al., 2008). SSR marker (RM 202) profile of seed lot with 95 per cent genetic purity in rice hybrid KRH-4 at Bengaluru

Source: Annual Report DSR 2013-14.

Genetic purity test is very much important in case of hybrids and transgenic in comparison to thus inbreeds and thus wider attention must be focused on these two important aspect,which demands elaborate research in a very leak proof way. Molecular biology studies in detailed is felt essential so that the mechanism governing different seed attributes can be flagged and compatible genes, up and down regulatory elements could be easily fished out so that the characters can be modified as required for a desired crop ideotype for maximum productivity and added values.

2. Towards seed invigouration for enhanced productivity: This is an exciting area for research because it is expected to provide clues to enhance productivity by seed invigoration through diverse physical, chemical, and mechanical means & the macro molecules could be identified, which would facilitate to achieve seed invigoration at very cheaper rate Only by using quality seeds, productivity can be enhanced 15-20% easily and under optimum management the increment may touch upon to 45% depending upon the crops. Metabolic activity of seed is drastically reduced to a very low level (quiescence) while retaining their ability to germinate after a considerable period. Different storage physiology is found to be operative in recalcitrant seeds, which are characterized by their vulnerability to conditions, which are normally considered to be conducive to seed storage, i.e. dry and cool. Because of their low tolerance to desiccation, they are also called ‘desiccationsensitive’ or ‘desiccation- intolerant. Seeds possess a wide range of systems (protection, detoxification, repair) allowing them to survive in the dry state and to preserve high germination ability. Maintenance of seed viability is a basic condition for successful preservation of germplasm as seeds. It has also been observed that enriching micronutrient elements, which are lacking in the soil (e.g. zinc) in seeds have resulted in enhanced seed viability, greater seedling vigor, require lower seeding rates (cost-effective for farmers), resistant to diseases and exhibit better plant survival, thus giving rise to increased productivity in comparison to seedlings with feeble micronutrients. This is of immense significance in developing countries as the soil is usually found to be deficit in various essential micronutrient elements (Welch 2005). Seed Times January - April 2017

Role of Biotechnology in Crop Improvement

The seed coat has developed highly sophisticated processes for the protection of embryos and germinating seedlings from biotic and abiotic stresses, but it also plays a role in the control of development. The ability to manipulate any of these processes with cloned genes has the potential to alter the yield and composition of seeds for traditional uses and for the production of novel products. The modification of seed quality and use of seeds for the expression and storage of foreign proteins has been widely investigated in plant systems, including crop species. The types of foreign proteins that have been expressed include proteins to improve the amino acid content, enzymes, antigens, and biopharmaceuticals among others. In theory, any protein could be expressed in the seed, as could nonprotein materials such as vitamin A precursors in rice (Ye et al., 2000) if the metabolic pathways in the developing seed were modified (Moi se et al., 2005). The initial germinabilty of the seeds, seed moisture content and its interaction with relative humidity of the air and the storage temperature bears significant influence on seed longevity. Seed longevity affects the regeneration cycle of accession stored in gene banks. Seed longevity is thus the period over which a seed is able to germinate under favourable condition. Seed longevity is found to be maximum during post abscission phase of seed development mainly at the time of natural dispersion of seed. Even in seeds stored under optimal conditions suitable for long-term storage, viability may decline as a result of deterioration processes. These deterioration processes include: an increase of the free radical content, changes in protein structure, depletion of food reserves, development of fat acidity, changes in enzymatic activity, membrane injury, electrolyte leakage, chromosomal changes and increased rate of respiration. These processes can manifest at different levels resulting in decrease in seed germination, production of numerous abnormal seedlings and even complete loss of viability. The rate at which the seed aging process takes place depends upon the ability of seed to resist degradation changes by protection mechanisms, which are specific for each plant species. Seeds of different plant species lose viability differentially even when they kept under the same storage conditions. For example, onion seed is very difficult to store, while barley seed maintains good germination under a variety of storage conditions. The chemical composition of oilseeds causes specific processes to occur during storage. The seeds rich in lipids have limited longevity due to their specific chemical composition. For example, sunflower seed storage demands special attention due to high oil content, there are many other process also operates which leads to complete loss of germination and loss of seed viability. Three major factors, which influence longevity of seed, are determined by genetic constitution, environment during seed development and storage. At physiological maturity the crop generally reaches maximum possible grain yield and kernels, which are no longer growing, merely lose water. It signifies that no additional assimilates are deposited in the developing kernels and seed at this stage reaches to its maximum potential for germination and vigour. Seed longevity is of practical importance because of ongoing efforts to preserve plant genetic resources (PGR) for future agricultural crops by setting up seed gene banks and also for regulation sowing to grow crop. It is mentionable that seed quality is a cumulative character, reflects seed germination, seedling growth, speed of germination, percentage seedling emergence, seed vigour and tolerance to adversity. Despite the major importance of this character, very limited studies have been made in unzipping the mechanisms governing this very important attribute. Knowing and understanding the complex features that govern seed longevity are therefore bears major ecological, agronomical and economic importance. With the aid of high tech instruments the molecular mechanism should be unzipped which would help enable us to genetically manipulate this character in desirable direction. May be it would include in depth proteomics and metabolomics study, which ultimate aim to fish out the gene for development of suitable transgenics. â&#x20AC;˘

Environmental factors influencing seed longevity:

Seed longevity is determined not only by physiological/ genetic factors, but also by environmental factors during seed formation and ripening, as well as by storage conditions after harvesting. Chappie et al., 1994 reported that wild-type (WT) Arabidopsis seeds are mainly condensed tannins of the procyanidin type and derivatives of the flavonol quercetin, which are end-products of the flavonoid biosynthetic pathway in WT and their mutant seeds stored for four years at ambient temperature were used for seed longevity determination on the basis of germination and seedling abnormalities. Seedlings were judged as abnormal when presenting any malformation not present in the one-year old seed lots used as a control. Generally, the recorded malformation fell into one of the following categories: no cotyledons, asymmetrical cotyledons, narrow vitrified cotyledons, chlorotic or albino cotyledons, no cauline apex, no root and short or elongated hypocotyls. In crops like soybean and ground nut seed longevity is a serious constraint, which must be sorted out by application of suitable molecular techniques like RNAi, siRNA, miRNA, piwiRNA or by Agrobacterium mediated gene silencing Priming often results in a reduction of seed longevity compared with non- primed seed, although some studies have found the opposite effect. Primed lettuce seeds are particularly prone to reduced longevity relative to non-primed seeds when stored under high moisture content conditions. Tesnier et al. (2002) described control deterioration test (CDT) for Arabidopsis, in this test seed were kept

Role of Biotechnology in Crop Improvement

Seed Times January - April 2017

at elevated temperature and relative humidity studies of seed. Accelerated ageing or controlled deterioration test (CDT) conditions are used to speed the loss of viability or at seed aging under storage. It is known that longevity under conventional or optimal storage conditions would take years to complete. Sinniah et al., (1998) found that stachyose is possibly involved in both tolerance to desiccation and potential longevity CDT simulates aging of seeds under controlled but artificial conditions and can be used to predict seed storage potential. Shin et al., 2009 also observed that mutations in the rice aldehyde dehydrogenase 7 (OsALDH7) genes resulted in seeds that were more sensitive to CDT conditions and that accumulated more malondialdehyde than the wild-type seeds, implying that this enzyme could play a role in maintaining seed viability by detoxifying the aldehydes generated by lipid peroxidation. â&#x20AC;˘

Genetic mechanism of seed longevity:

Genetics provides a powerful approach to identify the physiological and molecular bases of phenotypic characters such as seed longevity and other quality factors. Seed longevity is a quantitative trait since it is plausibly controlled by multiple genes and is strongly affected by the environment during seed formation, harvest, and storage. Genetic loci associated with seed longevity have been identified in Arabidopsis and rice (Oryza sativa). In both species, several quantitative trait loci (QTLs) located on different chromosomes have been located associated with seed viability after storage. A large number of reports concluded that difference of seed longevity existed among different cultivars. Arabidopsis can be a good model species for the identification of genes controlling seed longevity, because it is amenable to both classical and molecular genetic studies. Clerkx, (2004) observed in Arabidopsis, that there is only one QTL viz, on chromosome 3, which controls seed longevity. The Sha allele from the identified QTL conferred a higher longevity to prolonged storage similar to the CDT QTL found at the same position by the increasing the tolerance to H2O2.and a higher tolerance to the high temperature. In essence colocation of QTLs related to germination under stressful conditions was observed on top of chromosome 1, where the Sha allele imparts a higher tolerance to CDT survival, seed germination under saline conditions, and germination after heat treatment. A common factor in all these stresses could be the release of ROS. For CDT it is known that seed deterioration can occur through the generation of oxidative stress. Saline conditions are also known to generate ROS. Stressing seeds might also induce the expression of LEA proteins and after heat shock; sHSPs are specifically expressed. Besides acting as protector in preventing irreversible protein denaturation, HSPs may also modulate cellular redox state. This and the localization of several known ROS scavenging enzymes in this region, viz, catalase and a superoxide dismutase might point toward the production of active oxygen species as a mechanism in seed deterioration. Several other stress-related genes were mapped in this region, e.g. genes related to freezing tolerance, possibly also related to oxidative stress, and genes involved in drought stress, one of those having homology to a glutathione 6-transferase, an enzyme involved in reactive oxygen scavenging. The QTL mapping approach appears to be a valuable method not only in elucidating the genetics of longevity but also the physiological background of seed germination and seed longevity. Molecular studies support the complex genetic nature of seed longevity. For example, Arabidopsis mutants affected in the tocopherol or flavonoid biosynthetic pathways showed reduced seed longevity. Reactive oxygen species are important constraints for seed longevity. It has been confirmed by Clerkx et al. (2004a) in Arabidopsis where it showed discernible reduction in seed longevity when quantum of reactive oxygen species (ROS) increased. Other studies showed, mutation in genes related to germination e.g. DOG1 (Delay in germination) in Arabidopsis shortened seed dormancy with a reduced seed longevity phenotype. It indicates that seed dormancy mechanisms may be involved in delaying seed deterioration. In seed longevity mechanism, there is some role of stress-related proteins and enzymes. The transcription factor for heat shock HaHSFA9 (Helianthus annus), when was over expressed in seed of tobacco, significant improvement in resistance of seed to controlled deterioration, without detrimental effects on plant growth or development, seed morphology, or total seed yield was observed. HSFA9 (Heat Shock Factor A9) activates a genetic programme contributing to seed longevity and to desiccation tolerance in plant embryos. Genetic approaches in rice (Oryza scitiva) and Arabidopsis (.Arabidopsis thaliana) showed that seed longevity is controlled by several genetic factors. For both plants, several quantitative trait loci were identified as viability affecting factors, and these were located on different chromosomes. This behavior suggests that seed longevity is a multigenic trait including germination under various stresses or Sue (soluble sugars in Arabidopsis seeds) and seed oligosaccharide contents. Efforts have been made by many researchers to flag the genes responsible for germination in seed longevity. Clerkx et al. (2004) reported, co-localization of QTL in Arabidopsis regulating both seed longevity and germination under salt stress. Interestingly, such genetic loci include reactive oxygen species (ROS) scavenging enzymes as catalase, superoxide dismutase or small heat shock proteins involved in preventing irreversible protein denaturation and modulating cellular redox state, suggesting the hypothesis that mechanisms limiting oxidative stress influence both seed longevity and seed vigour. In this context, several studies demonstrated that tocopherols are essential for protein repair and seed longevity. It has been observed that there are many antioxidants, which by limiting nonenzymatic lipid peroxidation regulate Arabidopsis seed longevity and germination potential. Noticeably in the context of this work, cytotoxic lipid peroxidation products are known to entail extensive damage to proteins. There are several other reports, which inspected QTLs responsible for seed longevity. Three QTLs were found to be involved in longevity of seeds in rice. These were qLG-2, qLG-4, and qLG-9 on chromosome-2, 4, and 9. They used 98 backcross inbred lines (BILs) derived Seed Times January - April 2017

Role of Biotechnology in Crop Improvement

from cross between japonica rice variety Nipponbare and an Indica var Kasalath. Later, it was seen by Fujino et al., 2008, these QTLs (qLTG-3- 1, qLTG-3-2, and qLTG-4) were associated with low-temperature germination. Sasaki et al. (2005) sought quantitative trait loci (QTL) that control seed longevity after various periods of seed storage were sought using recombinant inbred lines (RIL) derived from a combination involving ‘Milyang 23’ (Indica-type) and Akihikari’ (Japonica-type). In all, 12 QTLs for germination and normal seedling growth were detected as indices of seed longevity on chromosome 7 (one region) and chromosome 9 (two regions) in treated seeds that had been stored under laboratory conditions for 1, 2 or 3 years. ‘Milyang23’ alleles of all QTLs promoted germination and normal seedling growth after all durations of storage. These QTL regions were detected repeatedly in more than one seed condition. Therefore, he inferred that these regions are involved in controlling seed longevity. Kiyoyuki et al. (2004) identify quantitative trait loci (QTLs) for low temperature seed germination (LTG) and seed longevity using backcross inbred lines derived from a cross between a japonica var Nipponbare and an indica var Kasalath in order to facilitate marker assisted selection (MAS) of these traits. Five putative QTLs controlling LTG were detected on chromosomes 2, 4 and 11. A putative QTL with a large seed longevity effect was detected on chromosome 9. After long-term storage, the frequency of chromosome deformation and gene mutation increase. Most reports deemed that DNA subjected to certain degree of damages during seed deterioration consequently affected the synthesis of early stage performance. Seed deterioration was found to be closely related to DNA metabolism (Pers. Commun). It is interesting to note that to appropriately develop designer crop changes at the genomic level is a must and there should be a comparable plantlet regeneration system to manifest such characters in a well-orchestrated manner.

3. Seed enhancement through priming, coating, pelleting, colouring for uniform crop stand and increased productivity: A large no of priming (osmo-priming, Hydro-Priming) and coating with diverse matrices including encapsulated with nutrients, pesticides etc. have been well evident in many crops and this techniques are now very much accepted in the private companies to spin more monies. In case of odd surfaced seed materials pelleting are advisable for mechanical sowing, in India, Venagamurdi has done extensive research works involving different types of chemical dies and botanical and reported significant yield increase in diverse crops (Pers. Commun). Seed quality is the major factor governing stand establishment of any crop and thus bears immense importance and deserve utmost priority in case of high value, low volume crops like vegetables in particular and for high volume low value crops in general for enhanced productivity and production as well. A number of diverse materials/ treatments at varying doses have been used to increase the rate and uniformity of seedling emergence in wheat and rice, which are generally categorized as seed enhancement, which is a kind of value addition. Seed enhancements may be defined as post-harvest treatments that improve germination and seedling growth or facilitate the delivery of seeds and other inputs/materials required at the time of sowing. Seed enhancement technology predominantly possess a central objective to further improve seed performance by treating with specific additives/chemical/botanicals etc. under very specific regimes and with the aid of certain planting equipment’s to grow uniform crop obviously for higher productivity and production. Various techniques have been employed to assure superior performance in different crops and most have been found to have immense commercial application. This includes three general areas of enhancement: pre sowing hydration treatment (priming), coating, pelleting technologies and seed conditioning. Seed priming first allows the seed to imbibe moisture, using various protocols of osmo, halo and hydro-priming, followed by redrying the seeds to undertake routine handling smoothly in most efficient manner. This process controls hydration of seeds to a level that allows pre germination activities aggressively. Seed hydration is a process whereby seeds are hydrated using various protocols and subsequently redried to permit routine handling. This process results in increased germination rate more uniform seedling emergence under broader range of environments that led to improved seedling vigour and growth. The objective of seed hydration technology is principally to increase the percentage and rate of germination, expand the range of temperature over which the seed will germinate and increase the uniformity of stand establishment in the field. Three general approaches for hydration have been developed: prehydration, priming and solid priming. Lastly, priming has been commercially used to eliminate or greatly reduce the amount of seed borne fungi load and bacteria such as Xanthomonas campestris in Brassica seeds and Septoria in celery have been shown to be eliminated within seed lots after priming. Seed priming is a technique in which seeds are partially hydrated until the germination process begins, but radical emergence does not occur (Bradford, 1986). Priming allows the metabolic processes necessary for germination to occur without true germination. Primed seeds actually exhibit increased germination rate, greater germination uniformity and enhanced speed of emergence and at times, greater total germination percentage (Basra et al., 2005). Increased germination rate and uniformity have been attributed to metabolic repair during imbibition (Bray et al., 1989), buildup of germination enhancing metabolites (Basra et al. 2005), osmotic adjustment (Bradford, 1986), and for seeds that are not redried after treatment, a simple reduction is discernible in imbibition lag time (Bradford, 1986). Other scientists have written excellent reviews on seed priming. Our review aims primarily to

Role of Biotechnology in Crop Improvement

Seed Times January - April 2017

sum up earlier works on rice seed priming in particular. Osmo conditioning or osmo priming is the term used to describe the soaking of seeds in aerated, low water potential solutions. In this special type of seed priming, polyethylene glycol (PEG) or salt solution is used to control water uptake and prevent radicle protrusion (Bray, 1995). PEG is most commonly used because of its nontoxic nature and large molecule size, which lower water potential without penetrating into the seeds. The salts used to lower water potential are KN03, KCl, K3PO4, KH2PO4, CaCl, NaCl and mannitol. Salts supply the seed with N and other nutrients needed for protein synthesis during germination. Upon completion of priming, the seeds dried back to enable normal handling, storage and planting. Primed seeds can be stored successfully for short periods without losing the benefits gained from the treatment. These salts, however, result in occasional toxicity, a disadvantage to the germinating seedlings. Seed soaking, sometimes followed by dehydration of seeds has been demonstrated to improve subsequent germination of numerous vegetable seeds especially under suboptimal conditions (Muhyaddin and Weibe, 1989; Bradford 1986). More recently, osmo conditioning has been introduced successfully in cereals, including rice. Lee et al (1998) suggested priming of rice seeds to ensure better seedling establishment under adverse soil conditions. Du and Tuong (2002) concluded that, when rice is seeded in very dry soil (near the wilting point), priming further increase plant density, tiller number, and grain yield. In drought-prone areas, seed priming reduced the need for a high seedling rate, although it can be detrimental if seedling is done in soil that is at or near saturation (Du & Tuong, 2002). Lee and Kim (2000) investigated the effects of osmo conditioning on germination of normal and naturally aged seeds by analyzing total sugar content and a-amylase activity. The normal seeds had a higher total sugar content and a-amylase activity than the aged seeds. Aged seeds that underwent osmo conditioning and hardening increased their - total sugar and a-amylase activity. The latter was positively correlated with total sugar and germination rate. Basra et al (2005) had the same results when they evaluated the effects of osmo conditioning, traditional soaking, and toxic effects of KNO3 osmopriming on fine rice. Increased a-amylase activity and sugar content were also reported in the treated seeds compared with the control. The salts used to control water potential may cause toxicity and/or germination inhibition in rice (Basra et al 2003, 2005). Effect of different durations of priming on protein profile (soluble, total soluble and heat stable protein content) of UMI 61 maize genotype

Source: Annual Report DSR 2011-12.

Hardening (Wetting and drying or hydration-dehydration) refers to repeated soaking in water and drying (Basra et al 2003). The hydration-dehydration cycle may be repeated several times (Lee and Kim, 2000). The hardening treatment for 24 h proved to be better for vigour enhancement (Basra et al 2005) than osmopriming (-1.1 MPa KNO3) for 24 and 48 h and traditional soaking (overnight soaking followed by saturated gunny bags up to radicle appearance). Basra et al (2003) also evaluated the effects of seed hardening for 24 and 18h and reported that this resulted in better invigoration of hardened seeds of fine rice in comparison to osmo conditioning and the control set. Greater a- amylase activity and higher sugar content were also reported in the hardened seeds than in the control. Farooq et al (2005) introduced a new technique for rice seed invigoration, integrating both seed hardening and osmo conditioning.

Seed Times January - April 2017

Role of Biotechnology in Crop Improvement

Seeds of course and fine rice were hardened in various salt solutions rather than in tap or distilled water. Osmo hardening in CaCl2 (with anosmotic potential of -1.5 MPa) solution was found to be better than with other salts and simple hardening (Farooq et al 2005). Humidification is a pre sowing hydration treatment in which seeds are equilibrated under conditions of high humidity (Lee et al., 1998). Humidification of normal rice seeds with a high germination rate did not increase the germination rate, but could accelerate the germination rate of aged seeds, especially those under unfavourable soil conditions and suboptimal temperatures (Lee et al., 1998). Lee et al (1998) investigated the effects of humidification on normal and aged rice seeds. Relative humidity (RH) and humidification duration were found not to effect germination rate, but reduced the time to 50% germination of normal seeds, but at 80% RH found to reduce germination percentage and increased the time to 50% germination. Incorporating plant growth regulators as part of presoaking, priming, and other pre sowing treatments of many crops resulted in improved seed performance (Miyoshi and Sato, 1997). Dry heat treatment of seeds is done for two reasons: (1) to control external and internal seed borne pathogens, including fungi, bacteria, viruses and nematodes and (2) to break seed dormancy. Generally, the high temperature in the treatment reduces seed viability and seedling vigour, but the optimum temperature for breaking dormancy promotes seed germination and seedling emergence in rice (Lee et al 2002). Recent research on a range of crop species showed faster germination, early emergence and vigorous seedlings achieved by soaking seeds in water for some time followed by surface drying before sowing, which may result in higher crop yield (Harris et al 2000). This soaking practice is termed on-farm seed priming- a simple, cheap and low risk method of promoting rapid seedling establishment and vigorous early growth. The duration of soaking is critical and should be less than the safe limit of each crop cultivar. The safe limit is defined as the maximum length of time that farmers should prime seeds; if exceeded; this can result in seed or seedling damage brought about by premature germination (Harris et al. 2000). This concept of safe limit differentiation-farm seed priming from pre germination. Primed seeds will not continue to germinate, unless those are placed in a moist soil environment. If primed seeds are shown on to a seed bed within adequate moisture, those will not germinate unless moisture subsequently becomes available (e.g. rainfall). In contrast, seeds soaked longer than the safe limit will continue to germinate even in the absence of an external moisture source. The use of pre germinated seed has inherent risk, whereas the use of primed seed has an advantage-the primed seed behaves as dry seed if sowing is delayed or seed bed conditions are suboptimal. Soaking overnight was also successful in rice and proved to be highly cost-effective, resulting in better stand, earlier maturity and higher yields at little cost (Harris et al 2002). Traditionally, rice seedlings are widely transplanted in nurseries, thereby increasing production cost and water requirements. The rising labour cost and the emerging water crisis are the major challenges being faced by the rice- producing world, including India, Bangladesh, and Pakistan, all other south and south-east Asian countries and recently emerged nontraditional rice growing areas in USA and Australia in particular. Direct seedling could be an alternative, but poor germination, uneven crop stand, and high weed infestation are constraints that prevent the adoption of direct-seeded rice (Du and Tuong, 2002). Effective herbicides are currently available for weed control, but poor germination and poor crop establishment remain a serious concern. Seed priming has the potential to overcome this problem since invigouration persists under less optimum conditions such as salinity and excessively high and low temperature (Muhyaddin and Weibe 1989; Bradford 1986). The need for research in this area is more strongly felt now than in the past. Coating is a sophisticated process of applying precise amount of active ingredients along with a liquid material directly on to the seed surface without obscuring its shape. Coating has gained popularity as a seed-coating method over the last several years because of worker safety considerations. It is a process of applying useful materials to form a continuous layer of thin coating over the seed without altering the shape or size, by employing water as the solvent. Seed coating polymers are used with active ingredients such as insecticides and fungicides, which improve the resistance of the seed towards pest and diseases in the much-warranted juvenile stage, besides improve the seedling vigour. Seed coating with commercial polymers diluted with nutrient instead of water may sow increased seed germination. Encapsulation of plant protectants by film coating ensures a uniformity of application superior to slurry application, the other method. Once plant protectants are sealed to the seed, dispersal to the environment prior to planting is minimized. All the dosage originally applied to the seed will be available against the pests in the target environment, and worker exposure to harmful dusts is minimized. Pelleting process of enclosing the seed with small quantity of ingredient along with filter materials is coated to produce a globular unit of standard size to facilitate precision planting. Seed pelleting is the process of enclosing a seed inside a small quantity of inert material just large enough to produce a globular unit of standard size to facilitate planting. Small and irregularly shaped seed can now be treated as larger, round-shaped seed. Simulation of seed in the field is therefore easier. There are two components to a seed pellet: bulking coating) material and binder. The bulking material can be either being a mixture of several different mineral and/or organic substances or a single component. The coating material is the â&#x20AC;&#x153;work-horseâ&#x20AC;? of the duet. The coating material changes the size, shape and weight of the seed. Desirable characteristics of a good coating material includes: uniformity of particle size distribution, availability of material, and lack of phytotoxicity. The second component, the binder, holds the coating material together. Binder concentration is critical because too much binder will delay germination. Too little binder will cause chipping and cracking of pellets in the planter box, which can cause skips and/or wide gaps in the plant rows. Many different compounds have been used as binders, 82

Role of Biotechnology in Crop Improvement

Seed Times January - April 2017

including various starches, sugars, gum Arabic, clay, cellulose, vinyl polymers (Halmer, 1987) and even water (Burgesse, 1949). As the demand for pelleted seeds increased, so did the number of companies that produced pelleted seeds, increased competition of pelleted seed market has fostered the development of more effective pellets with greater capabilities and wider plating characteristics. Pellet improvements over the last 10 years include increased O2 penetration/availability, wider pellet density range, pellet loading, better field visibility. Because of the large increase in volume obtained when seeds are pelleted, pellets have been shown to be effective carriers of plant protectants (pesticides). The same plant protectants that are often deleterious if applied directly to the seed can be “carried” in the seed pellet. The act of applying a plant protectant in a band within the pellet is known as “pellet loading”. The pellet either acts to “dilute” the negative impact of plant protectants as it moves through the pellet to the seed, or acts as a barrier to prevent direct seed contact. Active products can thus be “loaded” onto the seed while minimizing adverse seed germination effects. The total amount of “toxicants” applied per acre is less with in furrow or other soil applications.

4. Gene prospecting for important seed related character and unzipping the metabolicgrids: Potential longevity of seeds depends upon seed quality at the time of limitation of storage. In addition, seed moisture content and storage temperature conditions also influence seed longevity. During conservation of germplasm of orthodox-seeded species, drying seeds to low (<5%) moisture content and storing these at sub-zero temperatures is a common practice. Such seeds can maintain high viability and seed survival curves, which reflect percent survival as a function of time under certain condition can be used to describe the pattern of loss of viability and predicts longevity in storage. Seed storage is often accompanied by a progressive loss of germination vigour, storage conditions must be optimized for both preservation of genetic resources and commercial applications. For orthodox or desiccation-tolerant seeds, low seed moisture content, low temperature or cryopreservation seems to result in an increase in storage life span reported in his abstract that the zoysia grass seeds with equilibrium moisture content, and with original germination percentage of 84% and viability of 89% with one of four moisture contents (7.9, 12.11, 15.8, and 19.36%) were stored hermetically at one of four constant temperatures (3, 14, 25, 35 °C) for up to 217 days, and changes in final germination percentage (FGP), mean germination time, viability and vigour index were determined at 5 days interval during first 30 day period and tested at 15 to 30 days interval afterward. At the highest seed moisture content of 19.36% and storage temperature of 25 and 35 °C, after 30 days and 50 days, respectively, FGP decreased to 50% of original germination percentage. At the seed moisture content of 15.8% and 35 °C, after 42 days FGP decreased to 50% of original germination percentage, but at 25 °C, after 31 weeks FGP decreased to 52% of original germination percentage. At the seed moisture content of 12.34% and 35°C, after 31 weeks, FGP decreased less than 10%. At the lowest seed moisture content of 7.9%, no significant FGP changes at all of four temperature conditions, however, the vigor index results indicated a consistent deterioration occurred during storage. Our results suggest at ambient temperature condition the optimum storage conditions for zoysia grass seed as following, atmospheric relative humidity was not found to be higher than 60%, seed moisture content was less than 8%. Each seed has a maximum potential lifetime, the values of which vary in a normal distribution among individual seeds, and that the time to germination of a particular seed is inversely proportional to the remaining difference between the accumulated ageing period and the maximum lifetime of that seed. This model described with reasonable accuracy the germination time-courses of lettuce (Lactuca sativa L.) seeds after increasing periods of controlled deterioration at 10% moisture content (fresh weight basis) and 40 °C. In seeds of high initial quality, two phases of deterioration were detected, a relatively slow phase before significant loss of viability occurred and a more rapid phase once viability began to decline. Probert (2009) in his study observed that the longevity of seeds held in dry storage is mainly determined by seed moisture content and storage temperature with life-span increasing predictably with decreasing temperature and moisture content. However, there are also wide inherent differences in seed longevity between species. For example, using the improved seed viability equations (derived from rapid ageing experiments at elevated temperatures and moisture contents), the predicted time for viability to decline from 97.7 to 84.1% for seeds stored under gene-bank conditions (-20°C after equilibration at 15% RH, 15°C). It was noticed that seed longevity character relate closely to its sensibility to ABA. Emile et al. (2004a) indicated that Arabidopsis ABA- insensitive mutant (n) and ABA - deficiency mutant (abal) possess poor seed longevity. On the other hand, vitamins are also found to involve in this attributes Scott et al. (2004) investigated vitamin E’s effect on seed vigour and longevity with three vitamin E mutants: vtel-1, vte2-l and vte2-2. The result showed vitamin E deficiency mutant seeds had poor seed longevity and displayed severe seedling growth defects. Shen-Miller, 2002 reported that the activity of proteins also contribute to seed longevity like L-isoaspartyl methyltransferase (IAMT), an enzyme repairing abnormal L- isoaspartyl residues accumulated in proteins during ageing, may be associated with the multicentenarian longevity of sacred lotus (Nelumbo nucifera) seed, since the IAMT activity of sacred lotus cotyledons persists during germination. This protein is encoded by two Arabidopsis genes (PIMT1 and PIMT2), whose transcripts increased in developing seeds in response to abscisic acid (ABA). ABA enhanced the production of one form of PIMT2 (PIMT2x) through post-transcriptional modifications. Over expressing PIMT1 in Arabidopsis enhanced seed longevity, while inactivating the gene reduced seed longevity, Schwember and Bradford suggested that Seed Times January - April 2017

Role of Biotechnology in Crop Improvement

the increased ability to repair damaged proteins upon imbibition is associated with greater seed longevity. Other parameters include protection of proteins and cell membranes during desiccation and storage probably depends upon multiple mechanisms. During dehydration, water molecules are replaced by sugars at hydrogen-bonding sites to preserve the native structure of proteins and the spacing between membrane phospholipids. At low moisture contents, glass formation increases viscosity and slows deteriorative chemical reactions. Specific anti-oxidative mechanisms may also play a role in the protection of seeds against ageing. While these processes and deterioration itself occur in dry seeds where metabolism is prevented, the genes involved during seed development in establishing the preconditions for these mechanisms might be revealed by genetic analysis. Modeling approaches have also been proposed that can predict potential seed longevity based upon changes in germination rates prior to loss of viability. The seed coat performs important functions to protect the embryo and seed reserves from biotic and abiotic stresses during storage (pathogen and predator attacks, UV radiations, high moisture content, elevated temperature, oxygen, etc.). These data raised the hypothesis that protein damage is particularly detrimental for seed longevity and correlatively that a limitation of isoAsp accumulation in the seed proteome contributes to seed vigour and longevity. Consistent with this, aged barley seeds were shown to contain increased levels of isoAsp residues in proteins. A phenotypic analysis of transgenic lines over-accumulating or under-accumulating the PIMT1 enzyme in Arabidopsis seeds confirmed the main findings that the PIMT repair enzyme limits in plant at the accumulation of deleterious isoAsp residues in seed proteins and hence contributes immensely to seed longevity and germination vigour (Protein Repair L-Isoaspartyl Methyl transferase 1 is involved in both seed longevity and germination vigour in Arabidopsis) tocopherols (vitamin E), or through the formation of a glassy state of the cytoplasm of embryo cells that physically stabilizes cells against deterioration accompanying desiccation at the end of the seed maturation program. Lipid peroxidation, resulting in cell membrane damage as well as the generation of toxic byproducts, is well documented in stored seeds. Oxidative damage to DNA and proteins is also likely to be involved in seed ageing. Formation of sugar-protein adducts (Maillard reaction) or of isoaspartyl residues may be factors in loss of protein function during deterioration. On the other hand, antioxidants, heat shock proteins (HSPs) and enzymes to repair protein damage may be involved in ameliorating the effects of ageing on seed longevity. Suzuki et al., (1996); Li et al. (2007) also reported that lipoxygenases (LOXs) is also involved in seed deterioration. Interestingly water acts as a plasticizer of glasses and influences both enzyme activity and cytoplasmic viscosity. Besides these non-enzymatic factors, other studies have highlighted the importance of enzymes, such as catalase, glutathione oxidase or superoxide dismutase, that detoxify reactive oxygen species (ROS) to limit lipid oxidation and oxidative damage to proteins and nucleic acids. Those enzymatic detoxifying mechanisms are thought to occur in metabolically active seeds both during maturation and germination. The combined effects of moisture and temperature in a constant storage environment have been interpreted in terms of mathematical models allowing some predictions to be made about seed longevity under controlled environmental conditions. From these studies, optimum aging conditions and optimum methods for handling seed samples have been identified, giving rise to two different standardized seed storage protocol. The decrease in viability and vigour could be related to an increase in electrical conductivity suggesting membrane deterioration. This was not affected by light conditions during imbibition, expected to influence the generation of active oxygen species. During seed maturation, ABI -3 regulates several processes: acquiring dormancy and long-term storability and loss of chlorophyll. GRS (green seeded) locus of Arabidopsis is a common regulator in the latter two but not of dormancy/germination (Characterization of green seed, an Enhancer of abi3-l in Arabidopsis That Affects Seed Longevity).Different types of markers and bioinformatics tools, transcriptomics, C-DNA library construction, Q PCR, Next gen sequencing should be restored this endeavor

5. Omics for gene prospecting: Whole Genomics (structural and functional) need to be unzipped to know the genome in details as well as to mimic genes (bio prospecting of novel genes.) Transcriptomics of seed quality attributes, drought tolerance and disease resistance has been initiated and partially done. Microarray may be restored to study expression profiles of diverse genes during fibre development, moisture stress and pathogen challenge. Functional validation of the candidate genes may be done using RNA interference (RNAi) and transgenic approach. (a) Genomics: This sub-discipline of genetics is exclusively devoted for mapping, sequencing and functional analysis of genome. It is a computeraided study of structure and function of entire genome sequence of an organism. It deals with mapping of genes (a rapid and accurate way) on the chromosome and their sequencing, functioning of genes and metabolic pathway in an organism. The genomics technique is very powerful highly through put, efficient and effective in solving complex genetic problems, thus becoming indispensable in plant breeding and genetics. Structural genomics and functional genomics together characterize a genome to its full extent. Genomic

Role of Biotechnology in Crop Improvement

Seed Times January - April 2017

has various practical application in crop improvement to study genome size, gene number, gene mapping, gene sequencing, gene cloning, to study the evolution of crop plants, transgenic breeding, identification of DNA markers, construction of linkage maps, marker assisted selection etc. â&#x20AC;˘

Structural genomics

Structural genomics focus on the physical structure of the genome generally aimed to identify, locate, and order genomic features along chromosomes. It determines the size of the genome and number of genes located on the entire genome of a species. It involves high resolution of genetic and physical map, sequencing complete set of protein of the organism and 3 dimensional structure of the concerned protein. â&#x20AC;˘

Functional genomics

It deals with the study of function of all the genes found along the entire genome of any living organism. It deals with the transcriptome (involving complete set of RNAs transcribed) and proteome (involving complete set of protein encoded by genome). It assigns the function to each and every gene identified during the structural genomic study. Thus functional genomics is more complicated in comparison to structural genomics. Different techniques such as comparative genomics, microarray chip technology and molecular marker technology are the different tools involved for studying genomics. Maximum works on genomics have been reported in prokaryotes, a few reports in plants whose genome has been sequenced are Arabidopsis, rice and pigeon pea. Now genome sequencing of several crop species is being carried out funded by Indian Agriculture Research Institute (ICAR), New Delhi and Department of Biotechnology (DBT) in many institutes and universities. (b) Mapping population development for tagging genes governing important seed characters: Mapping population needs to be developed by hybridizing contrasting parents for important seed characters like seed germination, speed of immerges, dormancy longevity ageing, seed multiplication rate, seed cote vulnerability. QTL mapping for important seed character like protein of soybean, oil quality in mustard, neutraceuticals in rice and other cereals are worthy to mention. Similarly in fibers crop, pulses, vegetables etc. the character will be certainly changed and their by most appropriate breeding strategy should be restored appropriate mapping population involving maximum possible recombination. Quality genes are essential in diploid and tetraploid varieties. Suitable varieties would be an effective resource for making super fine seeds quality. Association mapping is another lucrative means to tag gene/s governing economically important traits for crop genetic modulation for value addition. Magic population is a new concept to work and tag gene of interest and linkage map, which is having bit similarity with bulk segregation analysis-may be instrumental in unzipping gene location. Furthermore to harness the benefit of genome wide selection (GWS) for exploring most suitable genes in the entire germplasm for genetic enhancement has to be carried out. (c) Molecular Markers and MAS for quality seed production: Suitable molecular markers should be identified for deployment in MAS to augment biotic and abiotic stress tolerances and to improve quality. Different kind of marker like RAPD, RFLP, EST-PCR, AFLP, SNP, Micro-array and RAD sequencing, next generation sequencing are potential markers. Linkage map has been constructed which need to be saturated with more markers for use. Even from a fine map positional cloning of genes would be possible, which can be subsequently introgressed into varieties for trait enrichment. Immense possibility is looming large for adoption of MAS. Both foreground and background selection using molecular markers would hasten variety development but since the productivity of transgenics itself is very difficult, the time has not yet come to explore the possibility of using this (Mandal et al., 2014).

Seed Times January - April 2017

Role of Biotechnology in Crop Improvement

Multiplex PCR of SSR markers with RM 202 and RM 204 for hybrid A - Female parent, H - Hybrid, R - Male parent, M - Marker

Source: Annual Report DSR 2013-14.

Beside genomics, proteomics, transcriptomics and metabolomics do possess immense potential for gene discovery as well as their utilization for seed enhancement. Furthermore, these tools also bear profound influence in understanding the metabolic grids and signal transduction, which makes the foundation to draw appropriate strategies for development of designer plants with superior genetics.

6. Development of seeds for specialized purpose: Beside introduction, acclimatization and their subsequent cultivation on large- scale in case of novel variety development, different types of hybridizations like single cross, double cross, back cross, three way cross, polycross, bulk population development, and of course selection procedures like pure line and mass selections, pedigree selection were amply attempted and significant strides made in enhancing productivity and a variety of other economic trait enrichment. Back cross breeding is another way to concentrate some specific trait in superior genetic background for variety development. It is to be mentioned before undertaking any hybridization programme the second degree statistics should be worked out in detail to know the magnitude and nature of different components of variations like phenotypic genotypic and environmental (epistatic interaction too) in respect of diverse characters, which contributes towards governing the productivity so that the desirable plants can be developed with higher productivity coupled with premium seed quality and other value addition. In this context the mutation breeding exploitation of apomixes, utilization of different kind of sterility systems like EGMS, TGMS, GMS, and CMS etc. can be exploited to harness maximum heterosis in developing productive lines. In this conventional way of breeding procedure biotechnological approaches like tissue culture, synthetic seed production exploitation of apomixis can be amply be used in specific context. In case of vegitatively propagated crops if heterotic hybrids are developed then with a help of apomixes the heterotic combination may be immortalized forever, which is very desirable character however in case of higher plants the apomixes is not clearly understood and till today no transgenics with this desirable trait is develop. Basically apomixis is the phenomenon by which certain plants produce â&#x20AC;&#x2DC;seeds without sexâ&#x20AC;&#x2122;. The use of apomixes in plant breeding was articulated by Hanna and Bashaw (1987). It increases the opportunity for developing superior gene combinations and facilitates the rapid incorporation of desirable traits. This tool may enable to develop plants to the environment, rather than the current necessity for adapting the environment by the plants through intensive agricultural practice. In contrast to todayâ&#x20AC;&#x2122;s hybrid technologies, it would make grain and seed once again the same, restoring farmers to their role as innovators. The introduction of this trait into crop plants would herald perhaps the single greatest change in agricultural practice since the dawn of cultivation. The greatest application of apomixes is in hybrid development for commercial cultivation. It makes seed production job very simple as isolation is not necessary and no need to maintain and increase parental lines. Commercial F1 hybrids can be generated if CMS and or restorer lines are not 86

Role of Biotechnology in Crop Improvement

Seed Times January - April 2017

available. It helps breeders to produce new true breeding hybrids in comparison to other hybrid breeding systems. This helps farmers to grow their crops from seeds produced on their commercial hybrid crop year after year, thus increasing the profit. Only an apomitic forage grass species has been improved through breeding. Bashaw (1980) developed 3 improved cultivars of apomitic buffel grass. Several attempts has been made towards development of apomictic species in pearl millet, maize, transferring apomixes to maize. â&#x20AC;˘

Development of transgenics for increased productivity through capitalizing enhanced seeds characters

Through conventional plant breeding, pooling of all desirable genes in a superior stock is practically impossible though spectacular achievements have been made in the past in the endeavour. Since eighties, the era of transgenic research has started very aggressively, which averts the hassles of transsexual boundary and transfer of desirable gene/s from any recipient source, which can be dove-tailed into a large number of a genera to develop a variety of transgenic plants in diverse crops. With the help of cell technology, molecular biology tools and techniques, genes can be tailored in desirable ways, for which standard protocols are available and a few protocols are under fine tuning phase for more efficiency, reproducibility effectively. A large number of tools, technique and approaches have been widely used like Agrobacterium-mediated transformation, microprojectile based bombardment. Floral-dip transformation, pollen tube mediated transformation, micro injection, electroporation have tremendous potential for seed character enhancement. The field is at present having no worthy example to mention need to be addressed aggressively in the days to come. However the technique are described below in a very brief way (i) Vector-mediated Gene Transfer in Plant Cells The pioneering work on the non-sexual transfer of genes by recombinant DNA methods in higher plants has been with the Agrobacterium-mediated transformation in plants. The critical information on this system possibly came from the elegant work of Chilton et al. (1997). In accomplishing genetic transformation of plants, most widely used two methods are Agrobacterium-mediated transformation and by using microparticle bombardment. The former has several advantages over the latter; the former allows for a more stable integration of a defined segment of DNA into the plant genome and generally results in a lower copy number and fewer rearrangements than the latter. But the major demerit is limited host range of Agrobacterium, which need to be expanded for its largescale utilization and monocots especially many cereals have been reported to be recalcitrant to Agrobacterium transformation except rice, maize etc. (ii) Floral-dip transformation In planta transformation involves no in vitro culture of plant cells or tissues, which reflects its greatest virtue. The technology was first developed in 1990, has attracted international interest all over the world. Based on this principle, many technologies (without cultivating tissue in vitro), such as vacuum infiltration method, floral-dip transformation method, Agrobacterium spraying method, and so on have been developed until now. Such methods can acquire a number of bodies of in-planta transformation in a short time, and can activate a variety of separating methods of gene according to a genetic vector to be used. The technique has been used in many crops like wheat, rice and kenaf. (iii) Pollen tube pathway transformation During in vitro maturation, pollen can be one of the targets for gene transfer. Genes integrated in the microspore nucleus can be transmitted by the pollen in its normal biological function. This can be an alternative approach for species that cannot easily be regenerated from protoplast or other explants. It is difficult to conceive how DNA enters into the mature pollen without being degraded by nucleases from pollen and how it integrated into the sperm DNA. This may be due to that enzymes participating in DNA replication may be involved. Two new approaches were adopted using mature pollen as a super vector. One of them used particle gun to deliver DNA into mature pollen (Agracteus European patent Application Nr. 87310612.4), whereas in the other case DNA was applied to stigmas after pollination or to the styles after cutting off the stigma and the DNA is thought to penetrate to the embryo sac through pollen tube pathway. (iv) Liposome mediated genetic transformation Liposomehave been used extensively to entrap a large variety of molecules including macromolecules such as enzymes and nucleic acid, and to deliver them into the cells by fusion with the plasma membrane or through endocytosis. The advantages of using liposome for gene transfer are: enhanced delivery of DNA and its protection from nuclease activity, low toxicity to cells, delivery of intact small organelles like mitochondria, and nucleic acid into different cells apart protoplast through cell wall and plasmodesmata. The mode of DNA entry in cell is not clear, but believed to be by the process of fusion. Seed Times January - April 2017

Role of Biotechnology in Crop Improvement

(v) Electroporation and Electrofusion Electrofusion (electric field-induced cell-to-cell fusion) and electroporation (electric field-mediated membrane permeabilization) are simple procedures that may be used for altering the genetic make-up of organisms. Electrofusion was first reported by Senda et al., (1979) in Rauwolfia serpentia. Zimmermann et al., (1981; 1984) reported electrofusion in Vicia faba protoplasts from mesophyll cells. Bates and Hasenkampf (1985) produced somatic hybrid plants from electrofused protoplasts of Nicotiana plumbaginifolia and N. tabacum. DNA transfer Electroporation offers the possibility for the transfer of small numbers of well-characterized genes into the recipient cell mediated by electric field and termed electroporation by Jones et al., (1987). In 1982, Wong and Neumann reported that plasmid DNA could be taken up and expressed by animal cells. Shortly electroporation of plants was demonstrated by Fromm et al. 1985 and reported uptake and expression of DNA in protoplasts from both monocots (maize) and dicots (carrots & tobacco). Transformed rice (fertile) and maize (sterile) plants were developed through electroporation of protoplasts. Lindsey and Jones (1990) reported removal of pectin from the plant cell wall increases the amount of DNA that can be introduced by electroporation. The electric field provides a driving force for the introduction of DNA into protoplast. (vi) Microlaser application A micro laser beam focused into the path of microscope can be used to burn holes into cell walls and membrane. Incubation of perforated cells in hypertonic solution containing DNA labeled with bisbenzimide, after laser irradiation of individual cells, fluorescence became associated with the inside of these cells, indicating uptake of DNA and could serve as a basis for vectorindependent gene transfer into walled cells. Jefferson et al., 1987 incorporated DNA into individually selected cells or embryos by laser beam. Hirschberg and Mc Intosh (1983) and Weber et al., 1989 incorporated DNA carrying genes for resistance to a herbicide into chloroplast by injecting DNA into the cytoplasm of a cell, both reported only transient expression of gene only (Mandal et al., 2014). Some of the larger companies, which have readily gone for alliances with transnational corporations, are engaged in low-end technology transgenics research only. For e.g., Maharashtra based Mahyco Seeds, which has a tie-up with Monsanto, has developed transgenic cottonseeds through backcrossing with the genes borrowed from Monsanto for pest resistance. Some relatively smaller companies, like Ankur and Rasi and a few others, have also alliances with Monsanto for similar endeavors. In India, almost 9 millionhectare of land area are under cotton cultivation with 2.86 million tonnes of cotton lint a year. Since Indian independence (1947), nearly 150 hybrid â&#x20AC;¨varieties of cotton have been released, which account for 60% of the cotton cultivation.

Source: Spielman et al., 2014.

Role of Biotechnology in Crop Improvement

Seed Times January - April 2017

•

Synthetic seed development:

Plant propagation using artificial or synthetic seeds broadens the horizon of plant biotechnology and agriculture. The technology provides methods for preparation of seed analogues from the micropropagules such as axillary shoots, apical shoot tips, embryogenic calli, somatic embryos as well as protocorm or protocorm-like bodies. It’s a promising technique for propagation of transgenic plants at a faster rate, non-seed producing plants, polyploids endowed with desirable traits and plants having constraints in seed propagation. Being clonal in nature the technique offer cut shorts laborious selection procedure as practiced in the conventional recombination breeding and can bring the advancements of biotechnology to the doorsteps of the farmer in a cost-effective manner. In vitro developed micro-shoots have been used in many crops like groundnut, carrot, cauliflower etc. Synthetic seeds have been effectively developed in banana, cardamom, sandalwood, mulberry and rice to name a few. Cell masses (callus) from embryos grown in suitable nutrient matrix have been encapsulated to enable synthetic seed production in banana, sandalwood and rice. In cardamom, shoot apices from aseptic cultures have been used to develop synthetic seeds and encapsulated axillary buds have been developed in mulberry. These are some of the examples of synthetic seeds, wherein without the employment of subcultures, we can regenerate healthy plants (http://www.barc.gov.in/publications/nl/2000/200009-02.pdf). Tissue culture plants during the last 2-3 decades has opened up new opportunities in many areas of basic and applied biological research. It provides a mechanism to study the intricate mechanism in plant development in vitro base to study in all the disciple of science, it also presents new strategies for the improvement of cereals, legumes, forest trees, plantation crops, ornamental crops etc. To improve the quality of any plant by genetic engineering many mainly rely on tissue culture by cell manipulation. Many fruit plants are difficult to multiply by conventional propagation and improve through traditional breeding methods. Among the innovative techniques, the concept of somatic embryogenesis along with synthetic seed is more promising. Use of vegetative propagules like axillary buds, adventitious buds, shoot tips, bulbs, corms and protocorms for synthetic seed.(Successes stories observed in papaya, banana, citrus, sandal wood, rice, cardamom etc.) and for seed propagated crops outstanding hybrids can be multiplied through tissue culture and propagated by using synthetic seed rapidly. Micropropagation is an area of plant tissue culture which has received maximum attention of researchers for its potential commercial applications in many crops and the list is very huge. However regeneration of plantlets to hardening and their final delivery to fields for commercial cultivation is highly problematic, there are many plants, which are found to produce numerous embryos during in vitro culture, which are found similar to natural embryos including germination leading to plant production. To copycat the natural seeds, embryos from cultures are encapsulated in a nutrient gel containing essential organic/inorganic salts, plant hormones, some carbon source and antimicrobial agents to protect the embryos from mechanical damages during handling and to allow the development and germination without any kind of variation. To overcome this problem encapsulation of tissue culture derived propagules in a nutrient gel has initiated a new line of research on synthetic seeds. Several agents have been used for encapsulation, however sodium alginate complexing with calcium chloride is found to be the most suitable. By this hydrated and desiccated synthetic seeds are produced. Hydrated synthetic seeds consist of embryos individually encapsulated in a hydrogel (sodium alginate, potassium alginate, carrageenan etc.), whereas in desiccated type they are produced naked, when coating mixture is allowed to dry for several hours in a sterile hood especially in desiccation tolerance species. They are basically defined as, “encapsulated somatic embryos which functionally mimic seeds and can develop into seedlings under sterile conditions” or encapsulated buds or any other form of meristems which can develop into plants. They don’t need any sophisticated transport, labour and cost to deliver the products to field. These can be stored for long time in suitable conditions. Synthetic seed production save time required to obtain plants and eliminates the difficult stage involved during the process of culture. The uniform production of encapsulated propagules using uniform germination could possibly remove many drawbacks associated with natural seeds.

7. Gene pyramiding / stacking: Varieties with pyramided genes need to be developed. It has been observed that in majority of cases, some biotic and abiotic stresses are predominant for which candidate genes are already available. By systematic generation wise selection pyramided lines with tolerant genes tolerant to both stresses at HYV background especially in well adaptive popular background in a feasible population. Disease and insect resistance genes should be pyramided through conventional breeding and MAS to develop durable resistance (Mandal et al., 2014).

Seed Times January - April 2017

Role of Biotechnology in Crop Improvement

8. Gene silencing technology for seed enhancement: RNA interference / Antisense RNA technology / Methylomes The discovery of RNA interference (RNAi) in mid-ninety’s has added a new dimension in the regulation of gene expression by different types of RNA. It soon caught the worldwide attention and a number of reviews have been published to describe the RNAi phenomenon both in plants and animals. The technology became a powerful tool to understand the functions of individual genes and also proved useful for molecular breeders to produce improved crop varieties. Different types of RNA have been used for gene silencing in an effective way to over various issues in crop plants. Scientists at CSIRO, in Australia, have played a pioneering role in demonstrating that RNAi technology may be used as gene silencing thereby generating improved crop varieties in terms of disease-, insect resistance, enhancing nutritional qualities etc. Using this technique this group has developed varieties of barley that are resistant to BYDV (barley yellow dwarf virus). RNAi interference (RNAi), a mechanism that regulates gene expression at the stage of translation or transcription of specific genes, is recognized as a landmark discovery of this decade in the field of biological sciences. RNAi technology prospects immensely in understanding basic biology and in executing clinical practice very precisely. An increasing number of small non-coding RNAs, including siRNA, miRNA and piRNA were found to play important roles in many life forms starting from protozoa to plants and mammals. Those regulatory RNAs are involved in a variety of phenomena including epigenetics regulation, genome control and stability, metabolomics, innate immunity regulation and in imparting adaptive responses to biotic and abiotic stresses. Although RNA-mediated silencing of genes was initially observed in plants, the real breakthrough of mechanistic understanding emerged via introduction of dsRNA in C. elegans. Subsequently the phenomena of gene silencing and involvement of RNAi machinery at breakneck pace about the mechanistic picture is still not completely known. The sorting of siRNAs in various pathways of gene silencing in cells, the biogenesis of piRNAs, is being extensively investigated. Despite several longstanding unanswered questions on the basic biochemistry of gene silencing, RNAi’s ascent from ‘bench to bedside’ has really been startling. The siRNA based medicines for age related macular degeneration and respiratory syncytial virus infection, miRNA based cancer diagnosis, identification of human factors for sensitivity towards viral pathogens like HIV, influenza, and West Nile using the genome-wide RNAi screening etc., are some of spectacular events that usher in an era of excitement and promise. RNAi possess ample scope in agriculture and in medicine is many laboratories worldwide and scientists are exploring the possibility of use of siRNA delivery, dose selection, design of siRNA and artificial-miRNA to combat various diseases in plants and animals. Kusuba et al. 2003 have recently made significant contribution by applying RNAi to improve rice plants. They were able to reduce the level of glutenin and produced a rice variety called LGC-1 (low glutenin content 1). Production of banana varieties resistant to the Banana Bract Mosaic Virus (BBrMV), currently devastating the banana population in Southeast Asia and India has been engineered using this technique. RNA interference through use of miRNA or siRNA may be used to engineer tolerance against parasitic genes and viruses. RNAi – mediated resistance against YMV is possible. Inverted repeat constructs for YMV tolerance and other compatible constructs must be searched out for gene silencing. Chromosome walking and T5 mutagenesis, site directed mutagenesis are of immense importance in up and down regulating many gene/s as and when required. Agrobacterium-based gene silencing for trait enrichment demands special attention. Methylome can also be restored for gene silencing especially for control of deadly diseases, which makes heavy dent in the annual productivity (Mandal et al., 2014). Antisense RNA technology is a potential molecular biology tool especially to control seed borne viral diseases, by using coat protein specific macromolecules. Similarly, in case of silencing of undesirable genes, down regulation through methylomes is a feasible proposition in present day biotech research, which may be used in seed quality enhancement too.

9. Nanotechnology: Nanotechnology is the cognizance and the ability to modulate matter at dimension ranges of ~1-100nm. At these dimensions, the chemical reactivity of these materials differs largely from the bulk form, thus enabling novel applications. Vastly increased surface area and unique electronic, mechanical, magnetic and photonic properties empower nanoparticles with the potential to act as entirely new entities compared to their macro or even micro forms (Anon 2007). Nanotechnology can attribute to enhancing agriculture productivity in a sustainable manner, using agriculture inputs more efficiently, and reducing by-products that can harm the environment or human health. Nanoparticles can provide a new dimension in augmenting productivity through seeds especially by dispensary nutrient solution into germinating embryo or by clogging the cell membrane pores which would halt entry and dispersal of disease

Role of Biotechnology in Crop Improvement

Seed Times January - April 2017

causing pathogens/insect pests/nematodes etc. with special reference to seed borne disease, which causes epidemics very often. Fouad et al., 2008 demonstrated application of carbon nanobiotechnology in gene transfer in Arabidopsis thaliana using GFP. Their versatility can also be applied to plant science research to serve as a new and promising tool for plant DNA transfection and cell biology studies.

Perspectives In developing countries like India, emerging frontier technologies are expected to play a crucial role in nation development through technological enlightenment especially in the agricultural sectors. As such the country is endowed with insufficient inputs inadequate resources and the yield level has attained plateau (Green Revolution fatigue), which are the main constrain to augment productivity (Chaturvedi 2005). The country fortunately harbors two major hot spots of biodiversity, 8 % of the total biodiversity of the earth is available in the Indian subcontinent and thus India is a gene rich country. The Government of India, upon realizing the potential of biotechnology as a tool to make breakthroughs to achieve improvements both qualitatively as well as quantitatively in the field of crop biotechnology, set up the ‘National Biotechnology Board’ in 1982, which subsequently gave birth to the ‘Department of Biotechnology, DBT’ in 1986 under Ministry of Science and Technology (Sharma et al., 2003; www.helpBIOTECH.blogspot.com). Multiple approaches, strategies, tools and techniques were included embodied in biotechnological approaches. These tools clubbed with contemporary computational techniques and understandings have also given the ideational creation to a field of ‘Bio-Informatics’. DBT enables the enhancement of various quality attributes of agricultural products. Access to proprietary genes and technology is essential for developing and commercializing genetically modified (GMO) varieties. These approaches are expected to fulfill the demands of market by producing suitable varieties through exploitation of culture induced variation for higher productivity, value addition and in terms of enhanced biotic and abiotic stress tolerances (Bijman 2001). In India, biotechnological advances in the agricultural sector are largely being spearheaded not only by the Indian Council for Agricultural Research (ICAR), which has established a National Research Centre on Plant Biotechnology (NRCPB) at the Indian Agricultural Research Institute (IARI), Pusa, New Delhi, fully dedicated to work on plant biotechnology but also, a large number of agribiotech companies, which have taken up activities related to biotechnology research and product development (Chaturvedi 2005). Besides these, sporadic attempts to utilize biotechnological tools in quality seed enhancement is also evident in 23 BSP and 35 STR centres of AICRP-NSP (crops) since the fag end of seventies and in course of time, many useful results emerge from such studies, which could ultimately generate number of technologies that help the country to augment crop productivity and production as well. It is to be mentioned that to have a remunerative agriculture seed, which are sown must be genetically pure, safe from phytosanitary point of view, capable to raise robust seedlings uniformly with maximum speed of seedling emergence to establish a uniform crop stand. In essence, genetic purity should be very high amounting to about 99-100%. In different categories of seeds like nucleus, breeder, foundation, certified seed, the extent of genetic purity of course vary marginally. Simply by using quality seeds, agriculture cannot be up scaled vigorously to meet the growing demands of the booming up population. There is ample scope of many physiological techniques like seed priming, pelleting, coating with different ingredients including nutrient solution, insecticides, fungicides and final coating with synthetic biodegradable polymers, which have been found to be highly economical to augment agriculture sensu lato. Genetically pure seeds need to be protected from biotic and abiotic stresses. To detect the presence of insect pest pathogens, soft x-ray are normally used to discard the infected seeds. In case of correct identification, sero-diagnostic and molecular diagnostic are deemed to play a key role in formulating appropriates control strategies. The storage of seed bears immense importance for which nowadays many commercial companies are use most modern storage facilities, which can be filled with 40% CO2 and infrared guarded doors saving almost 30-40% PHT loss. Such storage facility also minimizes effects like extreme temperature, relative humidity, superoxides, reactive oxygen species (ROS), which are potential danger to quality seeds. Besides the applied technological aspects, it is prudent to understand the principal factors, which are governing the ill traits like low seed germination, dormancy, aging and senescence, low seed multiplication rate, vulnerability of the seed coat to mechanical injury and thereby loss of viability, seeds with extremely low longevity etc. With the help of modern plant biotechnology and molecular biology tools and techniques like transcriptomics, genomics, metabolomics etc., can identify the constraints and help us to mitigate those with a host of other diverse techniques like capitalizing the benefits of in vitro culture induced variation, trait enrichment by dovetailing alien genes from heterologous sources, antisense RNA technology, Agrobacterium mediated gene silencing, methylomes and many other techniques, which are in the pipeline to create desirable varieties and their successful quality seed production under extremely stringent condition preciously with ease and confidence. In the recent past nanotechnology is emerging as a promising weapon especially by dispersing nutrients to the germinating embryos and by treating seeds with nanoparticles to prevent the incidence of seed borne diseases without the hassles of pesticides application. The emanation of high-efficiency seeds through biotechnology Seed Times January - April 2017

Role of Biotechnology in Crop Improvement

has provided us with a powerful tool for the enhancement for improving crop productivity and quality to provide a linear evolution in the field of seed production in agricultural crops. Suitable package of practices including appropriate health care system and supply of quality seeds at affordable cost in time would help the farmers to augment productivity, thus ushering in an era of agricultural production, hence contributing meaningfully towards accomplishment of a second green revolution. We optimistically look forward that a well-orchestrated module of processes involving both conventional and biotechnology approaches would be developed and implemented en masse in an elaborate way and thus a paradigm shift would be discernible in production of genuine hi-quality, value added pure seed, which would augment Indian agriculture significantly to ensure its food security and to attain a robust economy thereof. The imminent future of seed technology is indeed a bright and appealing one.

References • Anon. 2007. Nanotechnology, Commodities & Development, a Background Paper for the International Workshop on Nanotechnology, Commodities & Development, Meridian Institute • Bapat, V.A. Synthetic Seeds: A Novel Concept in Seed Biotechnology. http://www.barc.gov.in/publications/nl/2000/200009-02.pdf • Basra, S.M.A., Farooq. M., Khaliq, A. 2003. Comparative study of pre-sowing seed enhancement treatments in fine rice (Oryza sativa L.). Pak. J. Life Soc. Sci. 1(1): 5-9 • Baxevanis AD, Ouellette BFF, 2001. BIOINFORMATICS - A Practical Guide to the Analysis of Genes and Proteins. Wiley-Interscience, John Wiley & Sons,Inc., Publication. • Bijman, W.J.J. 2001. How biotechnology is changing the structure of the seed industry. Int. J. Biotechnology, 3(1/2): 82-94 • Bradford, K.J. 1986. Manipulation of seed water relations via osmotic priming to improve germination under stress conditions. Hort Sci. 21: 1105-1112 • Bray, C.M., P.A. Davison, M. Ashraf and R.M. Taylor. 1989. Biochemical changes during osmopriming of leek seeds. Ann. Bot. 63: 185-93 • Burgesser, F.W. 1949. Important developments in coated seeds may save time and money. The Fruit and Vegetable Review 11: 18-19 • Chaturvedi, S. 2005. Dynamics of Biotechnology Research and Industry in India: Statistics, Perspectives and Key Policy Issues. OECD Science, Technology and Industry Working Papers, 2005/06, OECD Publishing. http://dx.doi.org/10.1787/873577115356 • Claverie J-M, Notredame C, 2007. Bioinformatics for Dummies. 2nd Edition, Wiley Publishing, Inc. • Du, L.V., Toung, T.P. 2002. Enhancing the performance of dry-seeded rice effect of seed priming, seedling rate, and time of seeding. In: Pandey,S., Mortiner, M.,Wade, L.. Tuong, T.P., Lopez, K., Hardy, B. (Eds.). Direct seeding: research strategies and oppurtunities. Manila (Philippines). International Rice Research Institute. Pp 241-256 • Harris, D., Rashid, A., Hollington, P.A., Jasi, L. and Riches, C. 2002. Prospects of improving maize yields with “on-farm” seed priming. In: Rajbhandari, N.P., Ransom. J.K., Adjkhari, K., Palmer, A.F.E. (Eds.), Sustainable maize production systems for Nepal NARC and CIMMYT. Kathmandu, pp. 180-185 • Halmer, P. 1987. Technical and commercial aspects of seed pelleting and film coating. British Protection Council, Thorton Health, 191-204

Role of Biotechnology in Crop Improvement

Seed Times January - April 2017

14. Lee, S.Y., Lee, J. H., Kwon. T. O. 2002. Varietal differences in seed germination and seedling vigour of Korean rice varieties following dry heat treatments. Seed Sci. Technol. 30: 311-321 15. Lee, S.S., Kim, J.H., Hong, S.B., Yun, S.H. 1998. Effect of humidification and hardening treatment on seed germination of rice. Kor. J. Crop Sci. 43(3): 157-160 16. Lee, S.S., Kim, J.H., Hong, S.B., Yun, S.H., Park, E.H. 1998. Priming effect of rice seeds on seedling establishment under adverse soil conditions. Kor. J. Crop Sci. 43(3): 194-198 17. Mandal, A.B., Meena, K., Mondal, R., Mukherjee, P. and Dutta, S. 2014. Mesta-an orphan crop: Status and perspectives for genetic enhancement for more productive and value addition through frontier science, by International Journal of Current research, 6(12): 10883-10890. 18. Miyoshi, K., Satom, T. 1997. The effects of kinetin and gibberellin on the germination of dehusked seeds of indica and japonica rice (Oriza sativa L.) under anaerobic and aerobic conditions. Ann. Bot. 80: 479-483 19. Muhyaddin, T., Weibe, H. J. 1989. Effects of seed treatments with polyethylene glycol (PEG) on emergence of vegetable seeds. Seed Sci. Technol. 17: 49-56 20. 20. Moi ̈se, J.A., Han, S., Gudynaite ̨ -Savitch, L., Johnson, D.A. and Miki, B.L.A. 2005. Seed Coats: Structure, Development, Composition, and Biotechnology, In Vitro Cell. Dev. Biol.—Plant, 41: 620–644 21. Natesh, S. and Bhan, M.K. 2009. Biotechnology sector in India: strengths, limitations, remedies and outlook. Current Science, 97(2): 157-16 22. Nikolic, Z., Vujakovic, M. and Jevtic, A. 2008. Genetic purity of Sunflower Hybrids determined on the basis of Isozymes and Seed storage proteins. HELIA, 31(48): 47-54 23. Ruan, S., Xue. Q., Tylkowska, K. 2002. The influence of priming on germination of rice (Oriza sativa L.) seeds and seedling emergence and performance in flooded soils. Seed Sci. Technol. 30: 61-67 24. Sharma, M. India: Biotechnology Research and Development, www.helpBIOTECH.blogspot.com 25. Sharma, M., Charak, K.S., and Ramanaiah, T.V. 2003. Agricultural biotechnology research in India: Status and policies. Current Science, 84(3): 297-302 26. Spielman, D.J., Kolady, D.E., Cavalieri, A., and Rao, N.C. 2014. The seed and agricultural biotechnology industries in India: An analysis of industry structure, competition, and policy options. Food Policy, 45: 88–100 27. Welch, R.M. 2005. Biotechnology, biofortification, and global health. Food and Nutrition Bulletin, 26(4): S304-S306 28. Ye, X., Al-Babili, S., Klöti, A., Zhang, J., Lucca, P., Beyer, P. and Potrykus I. 2000. Engineering the Provitamin A (β-Carotene) Biosynthetic Pathway into (Carotenoid-Free) Rice Endosperm. Science, 287 (5451): 303-305 29. TNAU Agritech portal, http://agridr.in 30. http://www.agriinfo.in

The article has been published with permission of authors

Seed Times January - April 2017

Role of Biotechnology in Crop Improvement

Transgenic Blue Tomato: Enrichment of Tomato Fruit With Health Promoting Antioxidant Rajani1 and Shourabh Joshi1 Assistant Professor, Department of Agriculture

Faculty of Science- JaganNath University, Jaipur-303901 Email: rawal.rajni08@gmail.com

Abstract: Transgenic tomato plants accumulating high amounts (70â&#x20AC;&#x201C;100 fold) of anthocyanin in the fruit were developed by the fruit specific expression of two transcription factors, Delila and Rosea1 isolated from Antirrhinum majus. Two transcription factors from snapdragon in tomato, the fruit of the plants accumulated anthocyanins at levels substantially higher than previously reported for efforts to engineer anthocyanin accumulation in tomato and at concentrations comparable to the anthocyanin levels found in blackberries and blueberries. Anthocyanin-rich tomato fruit is important in view of the protective function of these compounds on consumption against a number of lifestyle-related diseases. Keywords: Antirrhinum majus, Anthocyanin, Polyphenols, Transgenic and Flavonoids

Introduction Anthocyanins (ACN) are responsible for the red to dark purple colours in various fruits and vegetables. Epidemiological studies have shown an inverse relationship between consumption of ACN and risk of diseases, particularly cardiovascular diseases (CVD). Supplementation of animal diets with ACN-rich foods and extracts has been shown to reduce atherosclerosis, improve vascular function and alter gene expression. However, although these studies have provided evidence that anthocyanin-rich foods can protect against CVD. Anthocyanins are naturally occurring polyphenols present in many foods that are commonly consumed as part of the human diet. They offer protection against certain cancers, cardiovascular disease and age-related degenerative diseases. There is evidence that anthocyanins also have anti-inflammatory activity5, promote visual acuity and hinder obesity and diabetes (Eugenio et al, 208).

Role of Biotechnology in Crop Improvement

Seed Times January - April 2017

Research on Purple Transgenic Tomato: Anthocynin Rich Tomato is an excellent candidate for transgenic enhancement of flavonoid content. It is an important food crop worldwide and its levels of flavonoids (which include anthocyanins) are considered suboptimal, with only small amounts of naringenin chalcone and rutin accumulating in tomato peel. Flavonoids represent an important source of hydrophilic dietary antioxidants, whereas the most abundant antioxidant in tomato fruit is lycopene, a lipophilic antioxidant. Generally, foods rich in both soluble and membrane-associated antioxidants are considered to offer the best protection against disease (Yeum, K.J. et al., 2004) Eugenio et al., 2008 conduct an experiment on “Enrichment of tomato fruit with health-promoting anthocyanins by expression of select transcription factors”. When they expressed two transcription factors from snapdragon in tomato, the fruit of the plants accumulated anthocyanins at levels substantially higher than previously reported for efforts to engineer anthocyanin accumulation in tomato and at concentrations comparable to the anthocyanin levels found in blackberries and blueberries. Expression of the two transgenes enhanced the hydrophilic antioxidant capacity of tomato fruit threefold and resulted in fruit with intense purple coloration in both peel and flesh. In a pilot test, cancer-susceptible Trp53 mice fed a diet supplemented with the high-anthocyanin tomatoes showed a significant extension of life span.

Transgenic tomato plants accumulating high amounts (70–100 fold) of anthocyanin in the fruit were developed by the fruit specific expression of two transcription factors, Delila and Rosea isolated from Antirrhinum majus. The transgenic tomato plants were identical to the control plants, except for the accumulation of high levels of anthocyanin pigments throughout the fruit during maturity, thus giving the fruit a purplish colour. The total carotenoids, including lycopene levels were unaffected in the anthocyanin-rich fruits, while its antioxidant capacity was elevated. The gene expression analysis confirmed the elevated expression of the downstream genes of the anthocyanin pathway due to the expression of the transcription factors and the expression levels coincided with the fruit ripening stages, highest expression occurring during the breaker stage. Anthocyanin-rich tomato fruit is important in view of the protective function of these compounds on consumption against a number of lifestyle-related diseases (Manamohan et al, 2013). A later study in 2003 was able to use activation tagging to isolate a gene that occasionally appeared in tomato mutants and made them purple in color, named Anthocyanin 1 (ANT1). After isolating the gene, transferring it into other tomatoes and tobacco plants confirmed that it

Seed Times January - April 2017

Role of Biotechnology in Crop Improvement

was responsible for up-regulation of anthocyanin production and the resulting dark purple coloration. This was helpful in determining which genes in the production pathway were directly responsible for anthocyanin regulation, rather than precursor or side product molecules (Mathews, et al., 2003). Some of the earliest attempts to induce higher anthocyanin production included using regulator genes from other plant species. In a 2008 study, the Production of Anthocynanin Pigment 1 (PAP1) regulation gene found in the model organism Arabidopsis was transferred into a tomato specimen. The immediate result was a much higher production of anthocyanins in the plant tissues, though it also resulted in a common problem with attempts to utilize anthocyanins as a antioxidant source. While acting as pigments in plant tissues, the majority of anthocyanins produced in most plants congregate in tissues besides the fruiting body, including leaves, stems, roots, and flowers. In order to produce a tomato with any biologically useful amount of anthocyanins, the ability to force the pigment produced into the resulting fruit would need to be enacted (Zuluaga et al., 2008). In another study it is proved, enrichment of anthocyanin, a natural pigment, in tomatoes can significantly extend shelf life. Processes late in ripening are suppressed by anthocyanin accumulation, and susceptibility to Botrytis cinerea, one of the most important postharvest pathogens, is reduced in purple tomato fruit. We show that reduced susceptibility to B. cinerea is dependent specifically on the accumulation of anthocyanins, which alter the spreading of the ROS burst during infection. The increased antioxidant capacity of purple fruit likely slows the processes of over ripening. Enhancing the levels of natural antioxidants in tomato provides a novel strategy for extending shelf life by genetic engineering or conventional breeding.

References • Eugenio Butelli, Lucilla Titta, Marco Giorgio, Hans-Peter Mock, Andrea Matros, Silke Peterek, Elio G W M Schijlen, Robert D Hall, Arnaud G Bovy, Jie Luo & Cathie Martin. 2008. Enrichment of tomato fruit with health-promoting anthocyanins by expression of select transcription factors. Nature biotechnology, (26) 11. • Manamohan Maligeppagol, G. Sharath Chandra, Prakash M. Navale, H. Deepa, P. R. Rajeev, R. Asokan, K. Prasad Babu, C. S. Bujji Babu, V. Keshava Rao and N. K. Krishna Kumar. 2013.Anthocyanin enrichment of tomato (Solanum lycopersicum L.) fruit by metabolic engineering. Current science 105(1):72-80. • Mathews H, Clendennen SK, Caldwell CG, Liu XL, Connors K, Matheis N, Schuster DK, Menasco DJ, Wagoner W, Lightner J, et al. 2003. Activation Tagging in Tomato Identifies a Transcriptional Regulator of Anthocyanin Biosynthesis, Modification, and Transport. The Plant Cell [accessed 2016 May 11]; 15:1689–1703. • Zuluaga DL, Gonzali S, Loreti E, Pucciariello C, Degl’Innocenti E, Guidi L, Alpi A, Perata P. 2008. Arabidopsis thaliana MYB75/PAP1 transcription factor induces anthocyanin production in transgenic tomato plants. Functional Plant Biology [accessed 2016 May 11]; 35:606–618.

The article has been published with permission of authors

Role of Biotechnology in Crop Improvement

Seed Times January - April 2017

NOTES

NSAI PUBLICATION ADVERTISEMENT RATES Seed Times Magazine: Amount in INR Back Cover

` 40,000

Inside Cover (Front)

` 25,000

Inside Cover (Back)

` 25,000

Inside Page (Full)

` 15,000

Inside Page (Half)

` 10,000

Note: On Purchasing Yearly advertisement bookings (3 issues of Seed Times) FLAT 20% Off.

NSAI Website: NSAI Home Page Banner

6 Months

1 Year

` 50,000

` 80,000

NSAI e-Newsletter: Amount in ` Cost for one month issue

` 10,000 Non Bleed- Dimensions

National Seed Association of India

Volume 10 No. 1, Jan-April 2017 909, Surya Kiran Building, 19, Kasturba Gandhi Marg, New Delhi - 110001 (INDIA) Ph.: 011-43553241-45; Fax: 011-43533248 E-maill: info@nsai.co.in Web: www.nsai.co.in