AE&M 62-2 by Sociedade Brasileira de Endocrinologia e Metabologia

ISSN 2359-3997

OFFICIAL JOURNAL OF THE BRAZILIAN SOCIETY OF ENDOCRINOLOGY AND METABOLISM Vol. 62 – No. 02 – April 2018

Archives of Endocrinology

and Metabolism

OFFICIAL JOURNAL OF THE BRAZILIAN SOCIETY OF ENDOCRINOLOGY AND METABOLISM

Archives of

Endocrinology

and Metabolism OFFICIAL JOURNAL OF THE BRAZILIAN SOCIETY OF ENDOCRINOLOGY AND METABOLISM

OFFICIAL JOURNAL OF THE BRAZILIAN SOCIETY OF ENDOCRINOLOGY AND METABOLISM Vol. 62 – No. 02 – April 2018

editorial 129 Improving care of patients with low-risk differentiated thyroid carcinoma Mario Vaisman

Archives of Endocrinology original articles

OFFICIAL JOURNAL OF THE BRAZILIAN Bruno Mussoi de Macedo, Rogério F. Izquierdo, Lenara Golbert, Erika L. Souza Meyer 139 Preoperatively undiagnosed papillary thyroid carcinoma in patients thyroidectomized for benign multinodular goiter Fausto Fama, Alessandro Sindoni, Marco Cicciu, Francesca Polito, Arnaud Piquard, OlivierSOCIETY Saint-Marc, OF Maria Gioffre’-Florio, Salvatore Benvenga 149 Clinical outcomes of low and intermediate risk differentiated thyroid cancer patients ENDOCRINOLOGY treated with 30mCi for ablation or without radioactive iodine therapy AND METABOLISM Shirlei Kugler Aiçar Súss, Cleo Otaviano Mesa Jr., Gisah Amaral de Carvalho, Fabíola Yukiko Miasaki, Carolina Perez Chaves,

131 Reliability of Thyroid Imaging Reporting and Data System (TI-RADS), and ultrasonographic classification of the American Thyroid Association (ATA) in differentiating benign from malignant thyroid nodules

and Metabolism

Dominique Cochat Fuser, Rossana Corbo, Denise Momesso, Daniel A. Bulzico, Hans Graf, Fernanda Vaisman

157 Impact of historic histopathologic sample review on the risk of recurrence in patients with differentiated thyroid cancer Fabián Pitoia, Fernando Jerkovich, Carolina Urciuoli, Florencia Falcón, Andrea Páes de Lima

164 Dynamic changes of central thyroid functions in the management of Cushing’s syndrome Sema Ciftci Dogansen, Gulsah Yenidunya Yalin, Bulent Canbaz, Seher Tanrikulu, Sema Yarman

172 The effect of metabolic surgery on type 1 diabetes: meta-analysis Abdulzahra Hussain

179 Progranulin concentration in relation to bone mineral density among obese individuals

Archives of

Alireza Milajerdi, Zhila Maghbooli, Farzad Mohammadi, Banafsheh Hosseini, Khadijeh Mirzaei

187 Impact of self-reported fasting duration on lipid profile variability, cardiovascular risk stratification and metabolic syndrome diagnosis

Carolina Castro Porto Silva Janovsky, Antonio Laurinavicius, Fernando Cesena, Viviane Valente, Carlos Eduardo Ferreira, Cristovão Mangueira, Raquel Conceição, Raul D. Santos, Marcio Sommer Bittencourt

193 Effect of one time high dose “stoss therapy” of vitamin D on glucose homeostasis in high risk obese adolescents

Endocrinology

Preneet Cheema Brar, Maria Contreras, Xiaozhou Fan, Nipapat Visavachaipan

201 Effects of drying and storage conditions on the stability of TSH in blood spots

Patrícia Künzle Ribeiro Magalhães, Carlos Henrique Miranda, Fernando Crivelenti Vilar, André Schmidt, Roberta Rodrigues Bittar, Giselle Aparecida Caixe de Carvalho Paixão, Edson Zangiacomi Martinez, Léa Maria Zanini Maciel

205 Diagnostic utility of DREAM gene mRNA levels in thyroid tumours

and Metabolism

Fernando A. Batista, Marjory A. Marcello, Mariana B. Martins, Karina C. Peres, Ulieme O. Cardoso, Aline C. D. N. Silva, Natassia E. Bufalo, Fernando A. Soares, Márcio J. da Silva, Lígia V. Assumpção, Laura S. Ward

212 Short-term insulin intensive therapy decreases MCP-1 and NF-κB expression of peripheral blood monocyte and the serum MCP-1 concentration in newly-diagnosed type 2 diabetics Yang Lin,, Shandong Ye,, Yuanyuan He, Sumei Li, Yan Chen, Zhimin Zhai

221 TSH-receptor antibodies may prevent bone loss in pre- and postmenopausal women with Graves’ disease and Graves’ orbitopathy

OFFICIAL JOURNAL OF THE BRAZILIAN SOCIETY OF ENDOCRINOLOGY AND METABOLISM

Mira Siderova, Kiril Hristozov, Aleksandra Tsukeva

reviews 227 Androgen insensitivity syndrome: a review

Rafael Loch Batista, Elaine M. Frade Costa, Andresa de Santi Rodrigues, Nathalia Lisboa Gomes, José Antonio Faria Jr., Mirian Y. Nishi,, Ivo Jorge Prado Arnhold, Sorahia Domenice, Berenice Bilharinho de Mendonca

236 Controversial issues in the management of hyperprolactinemia and prolactinomas – An overview by the Neuroendocrinology Department of the Brazilian Society of Endocrinology and Metabolism Lucio Vilar, Julio Abucham, José Luciano Albuquerque, Luiz Antônio Araujo, Monalisa F. Azevedo, Cesar Luiz Boguszewski, Luiz Augusto Casulari, Malebranche B. C. Cunha Neto, Mauro A. Czepielewski, Felipe H. G. Duarte, Manuel dos S. Faria, Monica R. Gadelha, Heraldo M. Garmes, Andrea Glezer, Maria Helane Gurgel, Raquel S. Jallad, Manoel Martins, Paulo A. C. Miranda, Renan M. Montenegro, Nina R. C. Musolino, Luciana A. Naves, Antônio Ribeiro-Oliveira Júnior, Cíntia M. S. Silva, Camila Viecceli, Marcello D. Bronstein

case report 264 What determines mortality in malignant pheochromocytoma? – Report of a case with eighteen-year survival and review of the literature

Matheus de Oliveira Andrade, Vinícius Santos da Cunha, Dayana Carla de Oliveira, Olívia Laquis de Moraes, Adriana Lofrano-Porto,

AND METABOLISM OFFICIAL JOURNAL OF THE BRAZILIAN SOCIETY OF ENDOCRINOLOGY AND METABOLISM

OFFICIAL JOURNAL OF THE BRAZILIAN SOCIETY OF ENDOCRINOLOGY AND METABOLISM

Financial and editorial assistant: Roselaine Monteiro roselaine@endocrino.org.br Rua Botucatu, 572 – conjunto 83 – 04023-062 – São Paulo, SP Telefax: (11) 5575-0311 / 5082-4788

Archives of Endocrinology Online submission / Electronic publishing www.aem-sbem.com • www.scielo.br/abem

and Metabolism

OFFICIAL JOURNAL OF THE BRAZILIAN SOCIETY OF ENDOCRINOLOGY AND METABOLISM

Archives of

Rua Anseriz, 27, Campo Belo 04618-050 – São Paulo, SP. Fone: 11 3093-3300 www.segmentofarma.com.br • segmentofarma@segmentofarma.com.br

Publication code: 22880.4.18

Endocrinology

Informations: Title: The Lighthouse Year: 1915 Author: Anita Malfatti (1889-1964) Technique: Oil on canvas Measures: 46,3OFFICIAL x 61 cm JOURNAL OF THE BRAZILIAN Collection: Gilberto Chateaubriand MAM RJ SOCIETY OF ENDOCRINOLOGY AND METABOLISM Photo: Romulo Fialdini and Valentino Fialdini

and Metabolism

All adds have to comply with RDC no 96/08 Commercial advising: Estela Kater estela.kater@gmail·com

Circulation of this issue: 3,500 copies Subscription: R$450.00/year – Single issue: R$55.00 Indexed in Biological Abstracts, Index Medicus, Latindex, Lilacs, MedLine, SciELO, Scopus, ISI-Web of Science BRAZILIAN ARCHIVES OF ENDOCRINOLOGY AND METABOLISM Brazilian Society of Endocrinology and Metabolism – São Paulo, SP: Brazilian Society of Endocrinology and Metabolism, volume 5, 1955Six issues/year Continued from: Brazilian Archives of Endocrinology (v. 1-4), 1951-1955 ISSN 2359-3997 (printed issues) ISSN 2359-4292 (online issues) 1. Endocrinology – journals 2. Metabolism – journals I. Brazilian Society of Endocrinology and Metabolism II. Brazilian Medical Association CDU 612.43 Endocrinology CDU 612.015.3 Metabolism

Supported by:

OFFICIAL JOURNAL OF THE BRAZILIAN SOCIETY OF ENDOCRINOLOGY AND METABOLISM

Archives of endocrinology and metabolism Official journal of SBEM – Brazilian Society of Endocrinology and Metabolism (Department of the Brazilian Medical Association), SBD – Brazilian Diabetes Society, ABESO – Brazilian Association for the Study of Obesity and Metabolic Syndrome

2015-2018 EDITOR-IN-CHIEF Marcello D. Bronstein (SP)

CO-EDITORS

REPRESENTATIVES OF COLLABORATING SOCIETIES SBD

Larissa Gomes (SP)

ABESO

Léa Maria Zanini Maciel (SP)

OFFICIAL JOURNALLeandro Kasuki (SP) OF THE BRAZILIANMadson Queiroz Almeida (SP) Brazilian Editorial Commission Manoel Ricardo Alves Martins (CE) Alexander A. L. Jorge (SP) OF SOCIETY Marcio Mancini (SP) Alexandre Hohl (SC) ENDOCRINOLOGY Margaret Cristina S. Boguszewski (PR) Ana Amélia Hoff (SP) AND METABOLISM Maria Candida B. V. Fragoso (SP) Ana Claudia Latronico (SP) Maria Edna de Melo (SP)

and Metabolism

Ana Luiza Silva Maia (RS)

Maria Izabel Chiamolera (SP)

André Fernandes Reis (SP)

Maria Marta Sarquis (MG)

Andrea Glezer (SP)

Mario Saad (SP)

Tânia S. Bachega (SP)

Antônio Marcondes Lerário (SP)

Mário Vaisman (RJ)

INTERNATIONAL ASSOCIATE EDITOR

Antônio Roberto Chacra (SP)

Marise Lazaretti Castro (SP)

Ayrton Custódio Moreira (SP)

Milena Caldato (PA)

Shlomo Melmed (Los Angeles, EUA)

Berenice B. Mendonça (SP)

Raquel Soares Jallad (SP)

Bruno Halpern (SP)

Rodrigo Moreira (RJ)

Carlos Alberto Longui (SP)

Ruth Clapauch (RJ)

Archives of

FOUNDER

ASSOCIATE EDITORS

Waldemar Berardinelli (RJ)

PRESIDENTS OF THE SBEM DEPARTMENTS

EDITORS-IN-CHIEF, EDITORIAL OFFICE*

ADRENAL AND HYPERTENSION

Endocrinology César Luiz Boguszewski (PR)

Sandra R. G. Ferreira (SP)

Clarisse Ponte (CE)

Simão A. Lottemberg (SP)

Delmar Muniz Lourenço Jr. (SP)

Sonir Roberto Antonini (SP)

Luiz Alberto Andreotti Turatti (SP)

Denise Momesso (RJ)

Suemi Marui (SP)

DYSLIPIDEMIA AND ATHEROSCLEROSIS

Eder Carlos R. Quintão (SP)

Madson Queiroz de Almeida (SP)

1951-1955 Waldemar Berardinelli (RJ) Thales Martins (RJ)

DIABETES MELLITUS

1957-1972 Clementino Fraga Filho (RJ)

Cynthia Melissa Valério (RJ)

Edna Nakandakare (SP)

1964-1966* Luiz Carlos Lobo (RJ)

BASIC ENDOCRINOLOGY

Edna T. Kimura (SP)

Maria Izabel Chiamolera (SP)

1966-1968* Pedro Collett-Solberg (RJ) 1969-1972* João Gabriel H. Cordeiro (RJ)

and Metabolism

Weiss (RJ)

PEDIATRIC ENDOCRINOLOGY

Julienne Ângela Ramires de Carvalho (PR)

1983-1990 Antônio Roberto Chacra (SP)

BONE AND MINERAL METABOLISM

1995-2006 Claudio Elias Kater (SP) 2007-2010 Edna T. Kimura (SP) 2011-2014 Sergio Atala Dib (SP)

Elaine Maria Frade Costa (SP)

OFFICIAL JOURNAL OF THE FelipeBRAZILIAN Gaia (SP) SOCIETY OF ENDOCRINOLOGY AND METABOLISM Rita de Cássia Viana Vasconcellos Flavio Hojaij (SP) FEMININE ENDOCRINOLOGY AND ANDROLOGY

1978-1982 Armando de Aguiar Pupo (SP)

1991-1994 Rui M. de Barros Maciel (SP)

Laércio Joel Franco (SP)

Luiz Alberto Andreotti Turatti (SP)

Archives of Endocrinology Bruno Ferraz de Souza (SP) Erika Parente (SP) Francisco Bandeira (PE) Fernanda Vaisman (RJ) Fernando M. A. Giuffrida (BA) João Roberto Maciel Martins (SP) Melanie Rodacki (RJ) Monica R. Gadelha (RJ) Nina Rosa C. Musolino (SP) Poli Mara Spritzer (RS) Ricardo Meirelles (RJ) Rogerio Friedman (RS) Rui M. B. Maciel (SP)

Julio Z. Abucham (SP)

Carolina Aguiar Moreira (PR) NEUROENDOCRINOLOGY

Marcello Delano Bronstein (SP) OBESITY

Maria Edna de Melo (SP) THYROID

Célia Regina Nogueira (SP)

Victória Borba (PR)

International Editorial Commission Andrea Giustina (Itália)

Gil Guerra-Júnior (SP)

Antonio C. Bianco (EUA)

Giovanna Balarini Lima (RJ)

Décio Eizirik (Bélgica)

Gisah M. do Amaral (SP)

Franco Mantero (Itália)

Hans Graf (SP)

Fernando Cassorla (Chile)

José Augusto Sgarbi (SP)

Gilberto Paz-Filho (Austrália)

José Gilberto H. Vieira (SP)

John P. Bilezikian (EUA)

SBEM – Brazilian Society of Endocrinology and Metabolism SBEM BRAZILIAN BOARD OF DIRECTORS 2017-2018 President Vice-President Executive Secretary Adjunct Executive Secretary Treasurer-General Adjunct Treasurer

Fábio Rogério Trujilho Alexandre Hohl Paulo Augusto Carvalho de Miranda Neuton Dornelas Gomes Rodrigo de Oliveira Moreira Marcio Corrêa Mancini

Rua Humaitá, 85, cj. 501 22261-000 – Rio de Janeiro, RJ Fone/Fax: (21) 2579-0312/2266-0170 www.endocrino.org.br sbem@endocrino.org.br

Scientific Departments - 2017/2018 Brazilian Society of Endocrinology and Metabolism ADRENAL AND HYPERTENSION

DIABETES MELLITUS

President Madson Queiroz de Almeida madsonalmeida@usp.br

President Luiz Alberto Andreotti Turatti turatti@uol.com.br Directors Amely Pereira Silva Balthazar Gustavo José Caldas Pinto Costa Sergio Alberto Cunha Vêncio Walter José Minicucci Thaísa Dourado Guedes Treasurer João Eduardo Nunes Salles Alternates Marcos Cauduro Troian Victor Gervásio e Silva

Vice-President Directors

Marivânia da Costa Santos Alexis Dourado Guedes Flávia Amanda Costa Barbosa Milena Coelho Fernandes Caldato Sonir Roberto Rauber Antonini Tânia Aparecida Sanchez Bachega

DYSLIPIDEMIA AND ATHEROSCLEROSIS

BASIC ENDOCRINOLOGY

President Cynthia Melissa Valério cy_valerio@yahoo.com.br

President Maria Izabel Chiamolera mchiamolera@unifesp.br Vice-President Bruno Ferraz de Souza Directors Catarina Segreti Porto Dóris Rosenthal Maria Tereza Nunes Marisa Maria Dreyer Breitenbach Tania Maria Ruffoni Ortiga Alternates Vânia Maria Corrêa da Costa Ubiratan Fabres Machado

Vice-President Directors

Renan Magalhães Montenegro Júnior Fernando de Mello Almada Giuffrida Marcello Casaccia Bertoluci

Scientific Departments - 2017/2018 WOMEN ENDOCRINOLOGY AND ANDROLOGY President Rita de Cássia Viana Vasconcellos Weiss rcvweiss@gmail.com Vice-President Directors Alternates

Dolores Perovano Pardini Amanda Valéria Luna de Athayde Mônica de Oliveira Poli Mara Spritzer Ricardo Martins da Rocha Meirelles Ruth Clapauch Izydorczyk Antônio Mendes Fontanelli Larissa Garcia Gomes

PEDIATRIC ENDOCRINOLOGY President Julienne Angela Ramires de Carvalho julienne@endocrinoped.com.br Vice-President Directors Alternate

Carlos Alberto Longui Aline da Mota Rocha Angela Maria Spinola e Castro Cláudia Braga Monteiro Paulo César Alves da Silva Suzana Nesi França Marilia Martins Guimarães

BONE AND MINERAL METABOLISM

NEUROENDOCRINOLOGY

President Vice-President Directors Alternate

President Marcello D. Bronstein mdbronstein@uol.com.br Vice-President César Luiz Boguszewski Directors Heraldo Mendes Garmes Luciana Ansanelli Naves Lucio Vilar Rabelo Filho Luiz Antonio de Araujo Mônica Roberto Gadelha Alternates Andrea Glezer Manoel Ricardo Alves Martins

Carolina Aguiar Moreira carolina.aguiar.moreira@gmail.com Miguel Madeira Barbara Campolina Carvalho Silva Francisco Alfredo Bandeira e Farias Marise Lazaretti Castro Sergio Setsuo Maeda Victória Zeghbi Cochenski Borba Tatiana Munhoz da Rocha Lemos Costa

OBESITY

THYROID

President Maria Edna de Melo medna@usp.br Vice-President Rosana Bento Radominski Director/Secretary Walmir Ferreira Coutinho Director/Treasurer Erika Paniago Guedes Directors Cintia Cercato Leila Maria Batista Araujo Director/Treasurer Fabio Ferreira de Moura Alternate Jacqueline Rizzolli

President Célia Regina Nogueira nogueira@fmb.unesp.br Vice-President José Augusto Sgarbi Secretary Janete Maria Cerutti Directors Ana Luiza Silva Maia Laura Sterian Ward Patricia de Fátima dos Santos Teixeira Gisah Amaral de Carvalho Mario Vaisman Alternate Danilo Glauco Pereira Villagelin Neto

Permanent Commissions - 2017/2018 Brazilian Society of Endocrinology and Metabolism STRATEGIC PLANNING FOLLOW-UP

HISTORY OF ENDOCRINOLOGY

President Alexandre Hohl alexandrehohl@uol.com.br Members Nina Rosa de Castro Musolino, Airton Golbert, Ricardo Martins da Rocha Meirelles, Ruy Lyra da Silva Filho

President Henrique de Lacerda Suplicy hsuplicy@gmail.com Members Adriana Costa e Forti, Thomaz Rodrigues Porto da Cruz

ENDOCRINOLOGY CAMPAIGNS

President

César Luiz Boguszewski

President Erika Bezerra Parente ebparente@gmail.com Members Érika Paniago Guedes, Teresa Arruti Rey

cesarluiz@hc.ufpr.br

Members

Ruy Lyra da Silva Filho, Valéria Cunha C. Guimarães, Ana Cláudia Latrônico

SCIENTIFIC COMISSION President Alexandre Hohl alexandrehohl@uol.com.br Indicated by the directories Joao Eduardo Nunes Salles, Alexis Dourado Guedes, Erika Bezerra Parente, Ana Mayra Andrade de Oliveira, Margaret Cristina da Silva Boguszewski, Guilherme Alcides Flores Rollin, Milena Coelho Fernandes Caldato, Mônica de Oliveira, Nina Rosa de Castro Musolino

SOCIAL COMMUNICATION President Ricardo Martins da Rocha Meirelles r.meirelles@terra.com.br Nominated by the president Alexandre Hohl ABEM Editor Marcello D. Bronstein Members Nina Rosa de Castro Musolino

CONTINUOUS MEDICAL EDUCATION President Alexandre Hohl alexandrehohl@uol.com.br Members Lireda Meneses Silva, Walter José Minicucci, Cleber Favaro

STATUTES, RULES AND REGULATIONS President Nina Rosa de Castro Musolino ninamusolino@gmail.com Members Airton Golbert, Henrique de Lacerda Suplicy, Luiz Henrique Maciel Griz Representative of the Evandro de Souza Portes brazilian directory

PROFESSIONAL ETHICS AND DEFENCE President Itairan da Silva Terres itairan.terres@gmail.com Vice-Inspector Maite Trojaner Salona Chimeno 1ST member Diana Viegas Martins 2ND member João Modesto Filho 3RD member Evandro de Souza Portes 4TH member Marcelo Henrique da Silva Canto Costa 5TH member Luiz Henrique Santos Canani

ENDOCRINE DYSREGULATORS President Elaine Frade Costa elainefradecosta@gmail.com Vice-President Margaret Cristina da Silva Boguszewski Members Tania Aparecida Sanchez Bachega, Ricardo Martins da Rocha Meirelles, Marilia Martins Guimarães, Eveline Gadelha Pereira Fontenele, Maria Izabel Chiamolera

INTERNATIONAL

NORMS, QUALIFICATION AND CERTIFICATION President Vivian Carole Moema Ellinger vivianellinger@gmail.com Members Ronaldo Rocha Sinay Neves, Marisa Helena César Coral, Maria Emilia Pereira de Almeida, Milena Coelho Fernandes Caldato

JOINT COMMISSION – CAAEP President Julienne Angela Ramires de Carvalho julienne@endocrinoped.com.br Members Marilia Martins Guimarães, Suzana Nesi França

RESEARCH President Members

Freddy Eliaschewitz freddy.g@uol.com.br Antônio Roberto Chacra, Luiz Augusto Tavares Russo

GUIDELINES PROJECT Coordinator Alexis Dourado Guedes dr.alexis@uol.com.br Adrenal and hypertension Madson Queiroz de Almeida Dyslipidemia and atherosclerosis Cynthia Melissa Valério Diabetes Mellitus Luiz Alberto Andreotti Turatti Basic endocrinology Maria Izabel Chiamolera Feminine and Andrology Rita de Cássia Viana Vasconcellos Weiss Pediatric Endocrinology Julienne Angela Ramires de Carvalho Bone and mineral metabolism Carolina Aguiar Moreira Neuroendocrinology Marcello D. Bronstein Obesity Maria Edna de Melo Thyroid Célia Regina Nogueira

TEMPORARY – SPORT AND EXERCISE ENDOCRINOLOGY - CTEEE President: Yuri Galeno Pinheiro Chaves de Freitas yurigaleno@gmail.com Members: Fábio Ferreira de Moura, Clayton Luiz Dornelles Macedo, Roberto Luís Zagury, Ricardo de Andrade Oliveira, Fulvio Clemo Thomazelli, Felipe Henning Duarte Gaia

TITLE OF SPECIALIST IN ENDOCRINOLOGY AND METABOLISM President: Josivan Gomes de Lima josivanlima@gmail.com Vice-President: Márcio Corrêa Mancini Members: Marise Lazaretti Castro, Mauro Antônio Czepielewski, Milena Coelho Fernandes Caldato, Renan Magalhães Montenegro Júnior, Rogério Friedman

VALORIZATION OF NEW LEADERSHIPS President Joaquim Custodio da Silva Junior jocsjunior@uol.com.br Members Joaquim Custodio da Silva Junior, Eduardo Quadros Araújo, Marcelo Fernando Ronsoni, Manoel Ricardo Alves Martins, Marcio Weissheimer Lauria

Brazilian Societies and Associations for Endocrinology and Metabolism

SBD – BRAZILIAN DIABETES SOCIETY SBD BRAZILIAN BOARD OF DIRECTORS (2018/2019)

President

Hermelinda Cordeiro Pedrosa

Vice-Presidents

Gustavo Caldas

Janice Sepulveda Reis

João Eduardo Nunes Salles

Rosane Kupfer

Rosângela Réa

1ST Secretary

Karla Melo

2ND Secretary

Fernanda Thomé

1ST Treasurer

Antonio Carlos Lerário

2ND Treasurer

Luiz Antônio Araújo

Supervisory Board

Silmara Leite

Regina Calsolari

Nely Calegaro

Estela Muskat Jatene

Rua Afonso Brás, 579, cj. 72/74 04511-011– São Paulo, SP Fone/Fax: (11) 3842-4931 secretaria@diabetes.org.br www.diabetes.org.br Administrative Manager: Anna Maria Ferreira

ABESO – BRAZILIAN ASSOCIATION FOR THE STUDY OF OBESITY AND METABOLIC SYNDROME ABESO BRAZILIAN BOARD OF DIRECTORS (2017-2018)

President

Maria Edna de Melo

Vice-President

Alexander Koglin Benchimol

1ST Secretary General

Bruno Halpern

2ND Secretary General

Fábio Ferreira de Moura

Treasurer

Erika Paniago Guedes

Rua Mato Grosso, 306, cj. 1711 01239-040 – São Paulo, SP Fone: (11) 3079-2298/Fax: (11) 3079-1732 Secretary: Renata Felix info@abeso.org.br www.abeso.org.br

editorial

Improving care of patients with low-risk differentiated thyroid carcinoma Mario Vaisman1

Arch Endocrinol Metab. 2018;62/2

ServiĂ§o de Endocrinologia do Hospital UniversitĂĄrio Clementino Fraga Filho, Universidade Federal do Rio de Janeiro (HUCFF/UFRJ), Rio de Janeiro, RJ, Brasil 1

Correspondence to: Mario Vaisman mario.vaisman@globo.com Received on Apr/6/2018 Accepted on Apr/10/2018 DOI: 10.20945/2359-3997000000034

n the last decade, imaging techniques had a great improvement in quality and became widely available all over the world for screening and diagnosis of the vast majority of malignancies. However, concerning thyroid nodule and cancer, we frequently face cases where micronodules were found incidentally by ultrasonography and other image modalities, often performed without clear indication. Some advocate this might be one of the main reasons for the rising incidence of thyroid nodules and microcarcinomas (1). Most Thyroid Societies advocate that nodules less than 0.5-1.0 cm should not be biopsied due to the low risk of those potential tumors (1). The proper utility of diagnostic tools, however, can be used to tailor the management of these nodules leading to a more accurate diagnosis and, therefore, a more adequate therapeutic approach (1). In this issue of Archives of Endocrinology and Metabolism (AE&M), Macedo and cols. (2) described 195 thyroid nodules detected by ultrasound using two scoring systems: modified TI-RADS and ATA risk stratification, both scores based on ultrasonographic features. The results were compared to cytopathological analysis. Histopathological results, considered the golden standard for diagnosis of thyroid cancer, were available in 45 cases after surgery. They concluded that both TI-RADS and the ATA ultrasound guidelines have high sensitivity and NPV for the diagnosis of thyroid carcinoma, meaning they can accurately predict the probability of benignity. They also relate that both systems are easily applicable in a routine basis and can be used to tailor fine needle aspiration cytology (FNAC), avoiding unnecessary procedures (2). These results are in agreement with other studies that evaluated the ultrasound findings in order to define criteria for indication of FNAC in a suspicious nodules with accurate results. Fama and cols. (3) provided further arguments for the better use of diagnostic tools to evaluate thyroid nodules. By retrospectively reporting a 12% histological incidence of papillary thyroid cancer (PTC) in 207 consecutive patients who, in a 1-year period, underwent thyroidectomy for benign multinodular goiter, they concluded that multinodular goiter can harbor preoperatively unsuspected PTCs, which may have already infiltrated the capsule and can be associated with PTC foci contralaterally, leading to the need of an adequate surgical approach (3). Therefore, once the option for surgery in a multinodular goiter is made, the correct assessment should be carried out in order to try to rule out the malignant nodules, helping the surgeon to avoid a higher rate of relapses and recurrences and to establish the correct surgical strategy. Regarding treatment, it is already agreed that it should be individualized (4,5). The standardized treatment, which was used for all patients, is no longer applicable: total thyroidectomy followed by ablative radioiodine dose (4). All guidelines recommend that the first therapeutic decision for differentiated thyroid carcinomas should be

129

Improving care of patients with low-risk differentiated thyroid carcinoma

between risk and benefit of each approach, reassessed in every medical appointment with the proper indication of FNAC in the correct nodule, followed by the decision of the right surgery for each patient and also adjuvant therapy afterwards. Disclosure: no potential conflict of interest relevant to this article was reported.

REFERENCES 1. Haugen BR, Alexander EK, Bible KC, Doherty GM, Mandel SJ, Nikiforov YE, et al. 2015 American Thyroid Association Management Guidelines for Adult Patients with Thyroid Nodules and Differentiated Thyroid Cancer: The American Thyroid Association Guidelines Task Force on Thyroid Nodules and Differentiated Thyroid Cancer. Thyroid. 2016;26(1):1-133. 2. Macedo BM, Izquierdo RF, Golbert L, Meyer ELS. Reliability of Thyroid Imaging Reporting and Data System (TI-RADS), and ultrasonographic classification of the American Thyroid Association (ATA) in differentiating benign from malignant thyroid nodules. Arch Endocrinol Metab. 2018;62(2):131-8. 3. Fama F, Sindoni A, Cicciu M, Polito F, Piquard A, Saint-Marc O, Gioffre’-Florio M, Benvenga S. Preoperatively undiagnosed papillary thyroid carcinoma in patients thyroidectomized for benign multinodular goiter. Arch Endocrinol Metab. 2018;62(2):139-48. 4. Momesso DP, Vaisman F, Yang SP, Bulzico DA, Corbo R, Vaisman M, et al. Dynamic Risk Stratification in Patients with Differentiated Thyroid Cancer Treated Without Radioactive Iodine. J Clin Endocrinol Metab. 2016;101(7):2692-700. 5. Vaisman F, Shaha A, Fish S, Tuttle M. Initial therapy with either thyroid lobectomy or total thyroidectomy without radioactive iodine remnant ablation is associated with very low rates of structural disease recurrence in properly selected patients with differentiated thyroid cancer. Clin Endocrinol (Oxf). 2011;75(1):112-9. 6. Ito Y, Miyauchi A, Oda H. Low-risk papillary microcarcinoma of the thyroid: A review of active surveillance trials. Eur J Surg Oncol. 2018;44(3):307-15. 7. Tuttle RM, Sabra MM. Selective use of RAI for ablation and adjuvant therapy after total thyroidectomy for differentiated thyroid cancer: A practical approach to clinical decision making. Oral Oncol. 2013;49(7):676-83. 8. Súss SKA, Mesa Jr. CO, Carvalho GA, Miasaki FY, Chaves CP, Fuser DC, Corbo R, Momesso D, Bulzico DA, Graf H, Vaisman F. Clinical outcomes of low and intermediate risk differentiated thyroid cancer patients treated with 30mCi for ablation or without radioactive iodine therapy. Arch Endocrinol Metab. 2018;62(2):149-56. 9. Pitoia F, Jerkovich F, Urciuoli C, Falcón F, Lima AP. Impact of historic histopathologic sample review on the risk of recurrence in patients with differentiated thyroid cancer. Arch Endocrinol Metab. 2018;62(2):157-63.

based on risk factors, not only for rare cancers related death, but especially on the much more common risk of recurrence (4,5). For small tumors, accumulated experience of more than a decade mainly by Ito’s group (6), recommends active surveillance for patients with microcarcinoma that meet very low risk criteria. In other centers, total thyroidectomy is indicated for almost all patients, and partial thyroidectomy may be performed in well-selected cases (7). Regarding the indication of adjuvant radioiodine therapy after surgery, for most cases requiring further treatment, the use of 30 mCi has been proved to be as effective as 100 mCi, which has been indiscriminately advocated in the past for all patients (7). A detailed surgical report is essential in order to decide the best approach for each patient. Tumor histopathology is another important factor for the therapeutic decision. In the present issue of AE&M, Súss and cols. (8) showed that in properly selected low or even intermediate risk patients, follow-up without radioiodine indication is a plausible option. More data on the tumor brings better decisions regarding the risks and benefits of radioiodine treatment (1). Pitoia and cols. (9) reviewed 210 DTC patients with low and intermediate risk of recurrence (RR) who underwent total thyroidectomy and remnant ablation, with 63 available historic pathologic samples (HPS). The RR and the response to therapy were first determinate by classic histological features (histological type, tumor size, capsular invasion, number of lymph node metastases) and, then, reassessed after observing additional histological features (vascular invasion, extrathyroidal extension, size of lymph node metastases , presence of extranodal extension, and/or status of the resection margins). A change in the RR category was observed in 16 of 63 cases (25.4%) A detailed report of specific features in the HPR of patients with DTC might give a more accurate RR classification and a better estimative of the response to treatment. In conclusion, the management of such prevalent disease which leads to very low risk of death and recurrence should include the careful evaluation

130

Arch Endocrinol Metab. 2018;62/2

original article

Reliability of Thyroid Imaging Reporting and Data System (TI-RADS), and ultrasonographic classification of the American Thyroid Association (ATA) in differentiating benign from malignant thyroid nodules Bruno Mussoi de Macedo1, Rogério F. Izquierdo1, Lenara Golbert1, Erika L. Souza Meyer1

ABSTRACT Objective: Ultrasonography (US) is the best diagnostic tool for initial assessment of thyroid nodule. Recently, data reporting systems for thyroid lesions, such as the Thyroid Imaging Reporting and Data System (TI-RADS) and American Thyroid Association (ATA), which stratifies the risk for malignancy, have demonstrated good performance in differentiating malignant thyroid nodules.The purpose of this study is to determine the reliability of both data reporting systems in predicting thyroid malignancy in a tertiary care hospital. Materials and methods: We evaluated 195 thyroid nodules using modified TI-RADS and ATA risk stratification. The results were compared to the cyto-pathology analysis. Histopathological results were available for 45 cases after surgery, which is considered the golden standard for diagnosis of thyroid cancer. Results: When compared with cytological results, sensitivity, specificity, negative predictive value (NPV), and accuracy were 100, 61.1, 100, and 63%, respectively, for TI-RADS; and 100, 75, 100, and 76%, respectively, for ATA. When compared with histopathological results, sensitivity, specificity, NPV, and accuracy were 90, 51.4, 94.7, and 60% respectively, for TIRADS; and 100, 60, 100, and 68%, respectively, for ATA. All patients with malignant nodules were classified in the categories 4 or 5 of TI-RADS and in the intermediate or high suspicion risk according to the ATA system. Conclusion: Both TI-RADS and the ATA guidelines have high sensitivity and NPV for the diagnosis of thyroid carcinoma. These systems are feasible for clinical application, allowing to better select patients to undergo fine-needle aspiration biopsies. Arch Endocrinol Metab. 2018;62(2):131-8

Thyroid Section, Endocrine Division, Irmandade da Santa Casa de Misericórdia de Porto Alegre, Universidade Federal de Ciências da Saúde de Porto Alegre (UFCSPA), Porto Alegre, RS, Brazil 1

Correspondence to: Erika L. Souza Meyer Serviço de Endocrinologia Irmandade da Santa Casa de Misericórdia de Porto Alegre Rua Professor Annes Dias, 295 90020-090 – Porto Alegre, RS, Brasil erikam@ufcspa.edu.br Received on Apr/26/2017 Accepted on Nov/3/2017 DOI: 10.20945/2359-3997000000018

INTRODUCTION

hyroid nodules are a common finding within the general population, and their detection is increasing with the widespread use of ultrasound (US) (1). Thyroid US is a widely accepted imaging modality for the initial assessment of thyroid nodules. It has been widely used to stratify the risk of malignancy in thyroid nodules and also in aiding with making decisions about whether fine-needle aspiration (FNA) is indicated. There are well-established ultrasound findings that differentiate benign and malignant thyroid nodules (2-8). A study by Kim and cols. (7) previously reported that hypoechogenicity, marked hypoechogenicity, microlobulated or irregular margins, microcalcifications, and taller than wide shape are the ultrasound features which best predicted the chance of Arch Endocrinol Metab. 2018;62/2

malignancy in thyroid nodules. Since the malignancy risk estimated by US is not determined by a single US predictor, it should be assessed by a combination of the US features (9-11). There are several classification systems which categorize thyroid nodules according to the risk of cancer (12-21). An interesting thyroid imaging reporting and data system (TI-RADS) derived from the breast imaging reporting and data system (BI-RADS) was prospectively tested in 4550 nodules where it demonstrated a high sensitivity and NPV for the diagnosis of thyroid carcinoma (21). One of the limitations of this recent version of TIRADS was related to some significant US signs not considered for the flow chart, such as the halo sign, size and central flow by Doppler study. This way, the American Thyroid Association’s (ATA) thyroid nodule 131

Keywords Thyroid nodules; US patterns; thyroid cancer

US evaluation of thyroid nodules

guideline (20) proposed a new ultrasonographic pattern considering nodule margins. There has been no standardized malignancy risk stratification system for thyroid nodules. Thus, it is important to validate these classifications in different healthcare centers. We proposed to evaluate the diagnostic accuracy of a modified TI-RADS and 2015 ATA’s ultrasound risk for the diagnosis of malignancy in thyroid nodules.

MATERIALS AND METHODS Patients

Between July 2014 and August 2015, we prospectively analyzed data from 178 consecutive unselected patients with thyroid nodules attending the Endocrinology Division at Santa Casa de Misericórdia de Porto Alegre, a tertiary, university-based hospital located in an iodine-replete area in Southern Brazil. All patients underwent a complete clinical evaluation and thyroid ultrasonography. Patients with known thyroid cancer and/or patients with purely cystic nodules were excluded. This study was approved by the local ethics committees and participants provided written informed consent (CAAE:16398613.2.0000.5335).

and the presence of lymphadenopathy. We performed a prospective evaluation using the modified Russ classification (21), each nodule was classified into a TI-RADS category (2, 3, 4 and 5) based on the US features (Figure 1). Differently from the Russ classification (21) in which mildly or moderately hypoechoic nodules (TI-RADS 4A) are categorized differently from markedly hypoechoic nodules (TI-RADS 4B), we have decided not to subdivide category 4 with the intention of simplifying this score for clinical practice. Posteriorly, the same radiologist (RFI) who was blind about the pathological results, scored all evaluated nodules of the saved pictures using a flowchart (Figure 1) based on new ATA thyroid nodule guideline of as previously published (20). Based on the number of features suspicious for malignancy we considered four different sonographic patterns: ‘‘very low suspicion”; ‘‘low suspicion”; “intermediate’’; and ‘‘high suspicion”. Pure cystic nodules were not included in the analyses. Figure 2 demonstrate representative US features in thyroid nodules. The diagnostic performance of TI-RADS and ATA classification system was evaluated by comparison with the fine-needle aspiration cytology (FNA) reports and anatomopathological examination.

Imaging technique and TI-RADS and ATA ultrasound classification

Thyroid FNA, thyroid cytology, and histology

Thyroid Ultrasound Conventional B-mode and Doppler images of the neck and thyroid gland were obtained by ultrasound machine (ACUSON S2000™, Siemens and ACUSON Antares™, Siemens HealthCare, Erlangen, Germany) using a high-frequency probe (12 MHz). All US examinations were performed by the same radiologist (RFI) who has more than 10 years of experience in thyroid ultrasound. All images were examined on realtime two-dimensional gray-scale and Doppler imaging. All sonograms obtained were saved in a picture archive. Ultrasound features were assessed for each nodule characteristic like composition (solid, cystic, mixed), echogenicity (hyperechoic, isoechoic, hypoechoic, markedly hypoechoic), margins (well defined with or without halo sign, microlobulated, ill-defined, irregular), presence of calcification (microcalcification, macrocalcification), and shape of the nodule (round, oval). Also, the presence of cervical lymphadenopathy was evaluated. Findings that were considered in favor of a malignancy were hypoechoic or markedly hypoechoic in echogenicity; irregular, microlobulated, or ill-defined margins; presence of microcalcification; round shape

All 195 nodules were submitted to FNA performed by using a capillary US-guided (FNA-US) technique with 23-gauge needle attached to a 10 mL disposable plastic syringe. There was no nodule size threshold for indicating FNA. In most of the cases, only one needle pass was made per lesion. Cytology smears were prepared on four to six slides. Slides were fixed immediately in 95% alcohol and stained with Papanicolaou stain. One cytopathologist from of our institution who has vast experience in thyroid pathology interpreted the smears. A thyroid FNA specimen was considered satisfactory if at least 6 groups of follicular cells were present, and each group comprised at least 10 cells (22). The Bethesda System for Cytological Classification of Thyroid Nodules was used to interpret smears (23) as: 1) non-diagnostic or unsatisfactory, 2) benign, 3) atypia of undetermined significance, 4) a follicular neoplasm or suspicious for a follicular neoplasm, 5) suspicious for malignancy, and 6) malignant. Surgery was indicated based on cytopathological results (Bethesda 4, 5 and 6), or when the nodule was benign (Bethesda 2) but larger than 3-4 cm and causing compressive symptoms.

132

Arch Endocrinol Metab. 2018;62/2

US evaluation of thyroid nodules

Suspect patterns

Benign patterns

Signs of High Suspicion: - Taller-than-wide - Irregular Borders - Microcalcifications - Markedly Hypoechoic

Very Probable - Isoechoic or Hyperechoic AND - No sign of high suspicion

Constantly - Simple cyst - Spongiform nodule - Isolated macrocalficication - Nodular hyperplasia

Hypoechoic solid nodule with 3 to 5 signs of high suspicion

Hypoechoic solid nodule with 1 to 2 signs of high suspicion

TI-RADS

SCORE 5

SCORE 4

SCORE 3

SCORE 2

ATA 2015

HIGH RISK

INTERMEDIATE RISK

LOW RISK

VERY LOW RISK

Solid hypoechoic nodule or solid hypoechoic component of a partially cystic nodule

+ 1 ou more of HRF

Hypoechoic solid nodule with smooth margins

without any of HRF

High Risk Features - irregular margins (infiltrative, microlobulated) - microcalcifications - taller than wide shape - rim calcifications with small extrusive soft tissue component - evidence of extrathyroidal extension

Isoechoic or hyperechoic solid nodule Partially cystic nodule with eccentric solid areas, without any High Risk Features

Spongiform Partially cystic nodules Without any of the sonographic features described in low, intermediate, or high suspicion patterns Purely cystic nodules

Figure 2. Representative images of TI-RADS and ATA systems in thyroid nodules. A: Spongiform nodule – TI-RADS 2 or ATA very low risk. B: Isoechoic solid nodule, regular-shaped and borders, without HRF - TI-RADS 3 or ATA low risk. C: Hypoechoic solid nodule with regular borders – TI-RADS 4 or ATA intermediate risk. D: Hypoechoic solid nodule with irregular borders and microcalcifications (arrows) – TI-RADS 5 or ATA high risk. Arch Endocrinol Metab. 2018;62/2

133

Figure 1. Comparative chart: TI-RADS (modified from Russ and cols.) and American Thyroid Association (ATA) 2015 HRF: High Risk Features.

US evaluation of thyroid nodules

Anatomopathological examinations of tissue samples obtained at thyroidectomy were carried out according to the World Health Organization Guidelines (24), and the pathology reports pertaining to these samples were considered identical to the gold standard for the diagnosis of thyroid cancer.

8 follicular neoplasm, and 3 atypia of indeterminate significance cases) or when the nodule was benign but larger than 3 cm and causing compressive symptoms (25 cases). There were 35 benign cases: 18 adenomatous goiters, and 17 adenomas. There were 10 malignant cases (5.13%), 9 classical papillary thyroid carcinomas, and 1 follicular thyroid variants of papillary carcinoma.

Statistical analysis Clinical, laboratory, ultrasonography and cytological data, which are reported as the mean – standard deviation (SD) values, or as the median with percentiles between 25 and 75 (continuous variables), or as absolute numbers and percentages (categorical variables), were compared using Mann-Whitney U-test or chi-squared test as appropriate. Specificity, sensitivity, positive and negative predictive value were calculated to evaluate the reliability of TI-RADS and ATA classification methods in differentiation between benign and malignant features. In all analyses, P < 0.05 was considered for statistical significance. Statistical analysis of the results was performed with SPSS software (Statistical Package for Social Sciences) version 18.0.

RESULTS

Demographic data and global results of 195 nodules by US features and scores The clinical characteristics of the 178 patients (195 nodules) included in this study were as follow: the median age was 59 years (range 49-66) and 94.9% were female. The median size of nodules was 24 mm (range 15-37). Nodules were classified as TI-RADS 2, 3, 4 and 5 in 11, 43, 44, and 2% of cases, respectively. Posteriorly, nodules were re-classified by ATA scores as very low risk in 35.9%; low risk in 28.2%; intermediate in 30.8% and high in 5.1% of cases. There was no difference in the size of the nodules among the TIRADS scores as well as among the ATA sonographic categories (p = 0.25 and 0.20, respectively). The cytological descriptive statistics results are as follow: 15.9% (n = 31) nondiagnostic (Bethesda 1), 68.2% (n = 133) benign (Bethesda 2), 4.3% (n = 9) atypia of undetermined significance (Bethesda 3), 6.7% (n = 13); suspicious for a follicular neoplasm (Bethesda 4), 2.1% (n = 4) suspicious for malignancy (Bethesda 5) and 2.6% (n = 5) malignant (Bethesda 6). Final histopathological results were available for 45 cases after surgery. Surgery was indicated based on cytopathological results (5 malignant, 4 suspect, 134

Diagnostic performance of TI-RADS and ATA scores compared with cytological results By cytology, 77% of TI-RADS scores 2 and 3 were benign (Bethesda category 2), 8.6% were indeterminate (Bethesda categories 3 and 4), and 1.9% were suspicious of malignancy (Bethesda categories 5) and none were malignant (Bethesda 6). For ATA score, 79% of low and very low risk were benign; 8.9% were indeterminate, 0.8% were suspicious of malignancy and none were malignant. Interestingly, 100% of carcinomas (Bethesda 6) and 50% of suspicious lesions (Bethesda 5) were classified as TI-RADS scores 4 and 5, and 100% of carcinomas and 75% of suspicious lesions were classified as intermediate and high risk ATA score. To compare TI-RADS and ATA score with cytological results, only Bethesda categories 2 and 6 were used (n = 138), as the probability of mistake of these two categories is < 3%. The sensitivity, specificity, NPV, and accuracy of the TI-RADS were 100, 61.6, 100, and 63% respectively. In same way, the sensitivity, specificity, NPV, and accuracy of the ATA score were 100, 75, 100, and 76% respectively. The estimated pretest probability of malignant nodule was at 3.6% for the cytology endpoint.

Diagnostic performance of TI-RADS and ATA scores compared with histopathological results (n = 45) Distribution of carcinomas among TI-RADS categories 2, 3, 4 and 5 was 0, 5.5, 26 and 100%, respectively (Table 1). Among ATA score the percentage was 0, 0, 28, and 83% for “very low”, “low”, “intermediate suspicion” and “high suspicion”, respectively (Table 2). When compared to histopathological results, sensitivity, specificity, NPV, and accuracy of the TI-RADS it was 90, 51.4, 94.7, and 60%, respectively. In addition, the sensitivity, specificity, NPV, and accuracy of the ATA score was 100, 60, 100, and 68%, respectively. The estimated pretest probability of malignant nodule was at 22.2% for the histology endpoint. The matched results of TI-RADS and ATA categories with final histopathological and cytological results are shown in Table 3. Arch Endocrinol Metab. 2018;62/2

US evaluation of thyroid nodules

Reclassification of thyroid nodules from TI-RADS to ATA score

diagnosis was follicular adenoma. Of the ATA low risk cases, 10 were classified by cytological analysis as Bethesda 2. One case was Bethesda category 3 and the outcome of the anatomopathological was follicular adenoma.

Twenty-one nodules TI-RADS category 4 were reclassified according to ATA score as very low risk (10 cases) and low risk (11 cases). Of the ATA very low risk cases, 8 presented cytological results of Bethesda 2 (benign) and 2 cases were Bethesda 3, one of them being submitted to surgery and the histopathological

Performance of TI-RADS and ATA scores in thyroid nodules with indeterminate results on cytology Of the 12 indeterminate nodules (Bethesda categories 3 and 4) examined, 10 (83.3%) were histologically benign. Sonographic classification of nodules by TI-RADS category 2 or 3, or as very low to low suspicion by ATA standards displayed negative predictive value of 100% for both systems. Positive predictive values for TI-RADS categories 4 and 5 and ATA intermediate and high risks were 54.5 and 40%, respectively.

Table 1. TIRADS categories and risk of malignancy by final histopathological Benign

Malignant

Total

Risk of malignancy (%)

TIRADS 2 (n= 2)

TIRADS 3 (n= 18)

5.5

TIRADS 4 (n= 23)

TIRADS 5 (n= 3)

100

Total (n= 45)

TIRADS category

DISCUSSION The ultrasonography terminology of thyroid nodules should be feasible for clinical application, should be useful for malignancy risk stratification, and show a low inter observer variability. Here, we demonstrated a very high NPV and a high sensibility to cancer diagnosis of scores TI-RADS and ATA ultrasound risk. The Thyroid Imaging Reporting and Data System (TI-RADS) was used by Park and cols. (12) and Horvath and cols. (13) and both systems appear to be difficult to use in routine clinical practice. In order to achieve a practical tool for analyzing thyroid nodules and to improve communication between radiologists and physicians, Russ and cols. (21) proposed a new TI-RADS classification that has a high sensitivity (95.7%) and NPV (99.7%) for diagnosis of thyroid carcinoma. Accordingly, we found NPV of 94.7% for scores TI-RADS 2 and 3.

Table 2. ATA categories and risk of malignancy by final histopathological Benign

Malignant

Total

Risk of malignancy (%)

High suspicion (n= 6)

83.3

Intermediate suspicion (n= 18)

27.7

Low suspicion (n= 10)

Very low suspicion (n= 11)

Total

ATA category

Table 3. Matched results of TIRADS and ATA categories with final histopathological and cytological results Benign histological results ( N = 35 )

Malignant histological results (N = 10)

III

TIRADS 2

TIRADS 3

TIRADS 4

TIRADS 5

ATA VERY LOW RISK

ATA LOW RISK

ATA INTERMEDIATE RISK

ATA HIGH RISK

Arch Endocrinol Metab. 2018;62/2

Ultrassonographic score

135

US evaluation of thyroid nodules

Recently, the American Thyroid Association (ATA) proposed a classification of thyroid nodules into five categories based on US features (20). In the same way, the reassessment of ATA ultrasound classification of malignancy in our patients shows a very high NPV (100%) for very low and low ATA ultrasound risk. These results confirm a high probability of both systems to discard malignancy. In fact, TI-RADS 2 or 3, and ATA very low or low risk consider similar benign patterns like spongiform nodules, isoechoic or hyperechoic solid nodules without signs of high suspicion. Interestingly, isoechoic solid nodules with some suspicious finding are not included in any of the TI-RADS or ATA categories. The risk of malignancy found in previous studies was between 16 to 20%, similar to that observed for hypoechoic nodules without any suspicious finding (25-27). We observed a prevalence of malignancy of 5.5% of nodules categorized as TI-RADS 3, similarly observed by Russ and cols. (4.3%) (21). Also, no nodule classified as low suspicion by ATA was malignant in our sample, reinforcing data from Rosario and cols. (25) that demonstrated in a large number of nodules the risk of malignancy of only 1.7%, lower than suggested by ATA (5-10%) in this category. TI-RADS category 2 or 3 and ATA very low and low risk represented a significant proportion of patients, 54% and 64%, respectively. Therefore, proven high sensitivity and NPV of both systems could allow to ultrasonographically (without FNA) monitoring these nodules categories, especially nodules under 2 cm, unless they increase in volume or if there are new suspicious sonographic features. TI-RADS proposed by Russ (21) categorize differently mild or moderate hypoechoic nodules (TI-RADS 4A) from markedly hypoechoic nodules (TI-RADS 4B) and unlike this system, we did not subdivide the category 4 of TI-RADS considering this category hypoechoic solid thyroid nodules. This was done to simplify the TI-RADS system for clinical practice minimizing discrepancies in the evaluation of the degree of hypoechogenicity. Also, to calculate the accuracy of TIRADS, it was necessary to group these categories. In addition, there is a general recommendation of US-PAAF of hypoechoic thyroid nodule especially above 1 cm, regardless of the degree of hypoechogenicity (20,28). Thus, TI-RADS 4 nodules were considered an intermediate suspicious for malignancy and were evaluated by cytology. In contrast to TI-RADS, hypoechogenicity associated with only one suspicious finding is sufficient for a nodule to be 136

classified as “high suspicion” by ATA (20). Only 5.8% (5 of 86) of our TI-RADS 4 were reclassified to ATA “high suspicion”, meaning that most of TI-RADS 4 nodules were hypoechoic solid thyroid nodules without sonographic patterns of high suspicion, considered by ATA as “intermediate suspicion”. We believe this is due to a better definition of the nodule margins (smooth vs irregular margins) proposed by ATA (20). In addition, we found a similar prevalence of malignancy of 26% for TI-RADS 4 and 28% for ATA intermediate suspicion. In fact, the risk of malignancy estimated by ATA in the “intermediate suspicion” category is 10 to 20% and, unlike Rosario that demonstrated only 9.9% for intermediate suspicion, we found a significant frequency of carcinoma in this category. We observed a malignancy risk of 100% of nodules TI-RADS 5. In fact, this category was composed of highly suspect nodules with more than 3 signs of high suspicion. For ATA “high risk” that included hypoechoic nodules with one or more signs of high suspicion, we found 83% of carcinomas, similar to risk estimated by ATA of 70-90% and a higher rate than what was observed by Rosario (54.8%) (25). Previous results of same author have been demonstrated that “high suspicion” category of ATA, markedly hypoechoic nodules with one or more suspicious findings and mildly or moderately hypoechoic with two or more suspicious findings had a similar risk of malignancy of 66% (95 % CI 57.6-73.7%) (25). These results reinforce that the degree of hypoechogenicity of nodules may not be so definitive in determining the suspicion pattern as the association of established features predictive of malignancy. In our study, US reevaluation had some disagreements regarding nodules mildly hypoechoic without suspicious US features classified initially as TI-RADS 4 that were reclassified as very low or low by ATA risk. This could have happened due to the heterogeneity of the nodules (hypoechoic areas between iso- hyperechoic areas) and the characteristics of borders, a feature not well defined in TI-RADS score. Moreover, it is important to note that poorly defined margins are sometimes difficult to delineate, and are not equivalent to irregular margins. An irregular margin, which indicates the demarcation between nodule and parenchyma, is clearly visible but demonstrates an irregular, infiltrative or spiculated course. The reassessing of these nodules in a low suspicion category by ATA was strongly corroborated by cytology and/or histology confirming benign thyroid lesions. Arch Endocrinol Metab. 2018;62/2

US evaluation of thyroid nodules

Arch Endocrinol Metab. 2018;62/2

the patients. The small number of histopathology examinations of nodules with indeterminate cytology, limited conclusions of this subgroup. In addition, this study represents a single specialized thyroid clinic’s work with the intent to implement TI-RADS and/ or ATA diagnostic guidelines in our clinical practice; however, results have to be confirmed by other centers. In conclusion, the sonographic patterns proposed by TI-RADS and the recently revised ATA’s guidelines have high sensitivity and NPV for the diagnosis of thyroid carcinoma. Both systems are feasible for clinical application and have an excellent negative predictive value allowing the selection of patients to FNA-US. Disclosure: no potential conflict of interest relevant to this article was reported.

REFERENCES 1. Cooper DS, Doherty MG, Haugen BR, Hauger BR, Kloos RT, Lee SL, et al. American Thyroid Association (ATA) Guidelines Taskforce on Thyroid Nodules and Differentiated Thyroid Cancer. Thyroid. 2009;19:1167-214. 2. Choi N, Moon WJ, Lee JH, Baek JH, Kim DW, Park SW. Ultrasonographic findings of medullary thyroid cancer: Differences according to tumor size and correlation with fine needle aspiration results. Acta Radiol. 2011;52:312-6. 3. Hong YJ, Son EJ, Kim EK, Kwak JY, Hong SW, Chang HS. Positive predictive values of sonographic features of solid thyroid nodule. Clin Imaging. 2010;34:127-33. 4. Kim DW, Lee EJ, Jung SJ, Ryu JH, Kim YM. Role of sonographic diagnosis in managing Bethesda class III nodules. Am J Neuroradiol. 2011;32:2136-41. 5. Kim DW, Lee YJ, Eom JW, Jung SJ, Ha TK, Kang T. Ultrasoundbased diagnosis for solid thyroid nodules with the largest diameter < 5 mm. Ultrasound Med Biol. 2013;39:1190-6. 6. Kim DW, Park JS, In HS, Choo HJ, Ryu JH, Jung SJ. Ultrasoundbased diagnostic classification for solid and partially cystic thyroid nodules. Am J Neuroradiol. 2012;33:1144-49. 7. Kim EK, Cheong SP, Woung YC, Ki KO, Dong IK, Jong TL, et al. New sonographic criteria for recommending fine-needle aspiration biopsy of nonpalpable solid nodules of the thyroid. Am J Roentgenol. 2002;178:687-91. 8. Moon WJ, Jung SL, Lee JH, Na DG, Baek JH, Lee YH, et al. Benign and malignant thyroid nodules: US differentiation--multicenter retrospective study. Radiology. 2008;247:762-70. 9. Campanella P, Ianni F, Rota CA, Corsello SM, Pontecorvi A. Quantification of cancer risk of each clinical and ultrasonographic suspicious feature of thyroid nodules: a systematic review and metaanalysis. Eur J Endocrinol. 2014;170(5):R203-11. 10. Remonti LR, Kramer CK, Leitão CB, Pinto LCF, Gross JL. Thyroid Ultrasound Features and Risk of Carcinoma: A Systematic Review and Meta-Analysis of Observational Studies. Thyroid. 2015;25:538-50. 11. Lee MJ, Kim EK, Kwak JY, Kim MJ. Partially cystic thyroid nodules on ultrasound: probability of malignancy and sonographic differentiation. Thyroid. 2009;19:341-6. 12. Park JY, Lee HJ, Jang HW, Kim HK, Yi JH, Lee W, et al. A proposal for a thyroid imaging reporting and data system for ultrasound features of thyroid carcinoma. Thyroid. 2009;19:1257-64.

137

The TI-RADS classification does not consider nodular size to indicate FNA-US (21). However, ATA risk score has recommended size threshold for biopsy (no biopsy in benign, > 2 cm in very low, > 1.5 cm in low, > 1 cm in intermediate, and > 1 cm in high risk, respectively) (20). In fact, the correlation between the nodule size and the risk for malignancy remains controversial. Although a recent systematic review suggested that the larger nodules present a higher pretest probability of malignancy (29). In addition, the growth of a nodule is not a reliable predictor of malignancy since many benign nodules can slowly grow over time (30-33). In our study, no correlation was found between the size of the nodules and sonographic risk assessments, reinforcing the importance of ultrasound findings more than the size of thyroid nodule in indicating FNAB-US. However, the increase of incidence of thyroid cancer in the last years, due to the diagnosis of microcarcinoma (25%), supports the ATA recommendation (20). Even with few samples evaluated by histology, a good performance of TI-RADS and ATA ultrasound risk was observed in thyroid nodules with indeterminate cytology (Bethesda categories 3 and 4). Sonographic classification of nodules by TI-RADS category 2 or 3, or as very low to low suspicion by ATA displayed NPV of 100% for both systems. Positive predictive values for TI-RADS category 4 and 5 and ATA intermediate and high risk rose the cancer prevalence to 54.5 and 40%, respectively, compared to described prevalence of 5-15% (0% in our sample) of Bethesda 3 nodules and 15-30% (15.4% in our sample) for Bethesda 4. Previous studies have demonstrated that TI-RADS 3 and 4A scores led to 80% sensitivity and 90% NPV in Bethesda 3 cases. In contrast, for nodules scored as TI-RADS 4B and 5, the combined cytological results of Bethesda 4 and 5 resulted in a higher risk of malignancy (75% and 76 9%, respectively, P < 0.001) (34). More recently studies confirm a NPV values for ATA and TI-RADS were 91 and 74%, respectively, to rule out malignancy in cytologically indeterminate thyroid nodules (35). Further, taken together, these results suggest that cytological indeterminate nodules with TI-RADS 2 or 3 and ATA very low or low risk sonographic pattern have a higher likelihood of being benign. This study has some limitations because we retrospectively evaluated thyroid nodules by ATA system. Also an inter-observer analysis was not possible, as only one radiologist with thyroid expertise evaluated

US evaluation of thyroid nodules

13. Horvath E, Majlis S, Rossi R, Franco C, Niedmann JP, Castro A, et al. An ultrasonogram reporting system for thyroid nodules stratifying cancer risk for clinical management. J Clin Endocrinol Metab. 2009;94:1748-51.

24. DeLellis RA, Lloyd RV, Heitz PU, Eng C. World Health Organization Classification Classification of Tumours: Pathology and Genetics of Tumours of Endocrine Organs. Lyon, Fr. IARC Press; 2004. p. 147-66, p. 147-166.

14. Kwak JY, Jung I, Baek JH, Baek SM, Choi N, Choi YJ, et al. Image reporting and characterization system for ultrasound features of thyroid nodules: Multicentric Korean retrospective study. Korean J Radiol. 2013;14:110-17.

25. Rosario PW, Silva AL, Nunes MS, Ribeiro Borges MA, Mourão GF, Calsolari MR. Risk of malignancy in 1502 solid thyroid nodules >1 cm using the new ultrasonographic classification of the American Thyroid Association. Endocrine. 2017 May;56(2):442-5.

15. Kwak JY, Han KH, Yoon JH, Moon HJ, Son EJ, Park SH, et al. Thyroid Imaging Reporting and Data System for US Features of Nodules: A Step in Establishing Better Stratification of Cancer Risk. Radiology. 2011;260:892-99.

26. Yoon JH, Lee HS, Kim EK, Moon HJ, Kwak JY. Malignancy risk stratification of thyroid nodules: comparison between the thyroid imaging reporting and data system and the 2014 American thyroid association management guidelines. Radiology. 2016;278:917-24.

16. Hambly NM, Gonen M, Gerst SR, Li D, Jia X, Mironov S, et al. Implementation of evidence-based guidelines for thyroid nodule biopsy: a model for establishment of practice standards. AJR Am J Roentgenol. 2011;196:655-60. 17. Perros P, Boelaert K, Colley S, Evans C, Evans RM, Gerrard Ba G, et al. Guidelines for the management of thyroid cancer. Clin Endocrinol (Oxf). 2014;81:1-136. 18. Shin JH, Baek JH, Chung J, Ha EJ, Kim JH, Lee YH, et al. Ultrasonography diagnosis and imaging-based management of thyroid nodules: Revised Korean society of thyroid Korean J. Radiol. 2016;17:370. 19. Gharib H, Papini E, Garber JR, Duick DS, Harrell RM, Hegedus L, et al. American Association of Clinical Endocrinologists, American College of Endocrinology, and Associazione Medici Endocrinologi Medical Guidelines for Clinical Practice for the Diagnosis and Management of Thyroid Nodules--2016 Update. Endocr Pract. 2016;22:622-39. 20. Haugen BR, Alexander EK, Bible KC, Doherty G, Mandel SJ, Nikiforov YE, et al. 2015 American Thyroid Association Management Guidelines for Adult Patients with Thyroid Nodules and Differentiated Thyroid Cancer. Thyroid. 2016;26:1-133. 21. Russ G, Royer B, Bigorgne C, Rouxel A, Bienvenu-Perrard M, Leenhardt L. Prospective evaluation of thyroid imaging reporting and data system on 4550 nodules with and without elastography. Eur J Endocrinol. 2013;168:649-55. 22. Suen KC, Ahdul-Karim FW, Kaminsky DB, Layfield LJ, Miller TR, Spires SE, et al. Guidelines of the Papanicolaou Society of Cytopathology for fine-needle aspiration procedure and reporting. Diagn Cytopathol. 1997;17:239-47.

28. Rosario PW, Ward LS, Carvalho GA, Graf H, Maciel RMB, Maciel LMZ, et al. Thyroid nodule and differentiated thyroid cancer: update on the Brazilian Consensus. Arq Bras Endocrinol Metabol. 2013;57:240-64. 29. Shin JJ, Caragacianu D, Randolph GW. Impact of thyroid nodule size on prevalence and post-test probability of malignancy: a systematic review. Laryngoscope. 2015;125:263-72. 30. Kamran SC, Marqusee E, Kim MI, Frates MC, Ritner J, Peters H, et al. Thyroid nodule size and prediction of cancer. J Clin Endocrinol Metab. 2013;98:564-70. 31. McHenry CR, Huh ES, Machekano RN. Is nodule size an independent predictor of thyroid malignancy? Surgery. 2008;144:1062-68. 32. Shrestha M, Crothers BA, Burch HB. The impact of thyroid nodule size on the risk of malignancy and accuracy of fine-needle aspiration: a 10-year study from a single institution. Thyroid. 2012;22:1251-56. 33. Asanuma K, Kobayashi S, Shingu K, Hama Y, Yokoyama S, Fujimori M, et al. The impact of thyroid nodule size on the risk of malignancy and accuracy of fine-needle aspiration: a 10-year study from a single institution. Eur J Surg. 2001;167:102-5. 34. Maia FFR, Matos PS, Pavin EJ, Zantut-Wittmann DE. Thyroid imaging reporting and data system score combined with Bethesda system for malignancy risk stratification in thyroid nodules with indeterminate results on cytology. Clin Endocrinol (Oxf). 2015;82:439-44. 35. Grani G, Lamartina L, Ascoli V, Bosco D, Nardi F, D’Ambrosio F, et al. Ultrasonography scoring systems can rule out malignancy in cytologically indeterminate thyroid nodules. Endocrine. 2017;57(2):256-61.

23. Cibas ES, Ali SZ. The Bethesda System for Reporting Thyroid Cytopathology. Am J Clin Pathol. 2009;132:658-65.

27. Na DG, Baek JH, Sung JY, Kim J, Kim JK, Choi YJ, et al. Thyroid imaging reporting and data system risk stratification of thyroid nodules: categorization based on solidity and echogenicity. Thyroid. 2016;26:562-72.

138

Arch Endocrinol Metab. 2018;62/2

original article

Preoperatively undiagnosed papillary thyroid carcinoma in patients thyroidectomized for benign multinodular goiter Department of Human Pathology in Adulthood and Childhood “G. Barresi”, University Hospital of Messina, Messina, Italy 2 Department of Biomedical and Dental Sciences and of Morphological and Functional Images, University Hospital of Messina, Messina, Italy 3 Department of Clinical & Experimental Medicine, University Hospital of Messina, Messina, Italy 4 Department of General, Endocrine and Thoracic Surgery, Regional Hospital of Orleans, Orléans, France 5 Master Program on Childhood, Adolescent and Women’s Endocrine Health, University Hospital of Messina, Messina, Italy 6 Interdepartmental Program on Molecular & Clinical Endocrinology, and Women’s Endocrine Health, University Hospital of Messina, Messina, Italy 1

Fausto Fama1, Alessandro Sindoni2, Marco Cicciu1, Francesca Polito3, Arnaud Piquard4, Olivier Saint-Marc4, Maria Gioffre’-Florio1, Salvatore Benvenga3,5,6

ABSTRACT Objective: Incidental thyroid cancers (ITCs) are often microcarcinomas; among them, the most frequent histotype is the papillary one. The purpose of this study was to evaluate the rate of papillary thyroid cancer (PTC) in patients thyroidectomized for benign multinodular goiter. Subject and methods: We retrospectively evaluated the histological incidence of PTC in 207 consecutive patients who, in a 1-year period, underwent thyroidectomy for benign multinodular goiter. All patients came from an iodine-deficient area (Orleans, France) with three nuclear power stations located in the neighboring areas of the county town. Results: Overall, 25 thyroids (12.1%) harbored 37 PTC, of which 31 were microcarcinomas. In these 25 PTC patients, mean age was 55 ± 10 years (range 3075), female:male ratio 20:5 (4:1). In 10 patients (40% of 25 and 4.8% of 207), PTCs were bilateral, and in 7 (2 with microPTCs) the thyroid capsule was infiltrated. These 7 patients underwent central and lateral cervical lymph node dissections, which revealed lymph node metastases in one and two cases, respectively. Radioiodine treatment was performed in 7 cases. Neither mortality nor transient and permanent nerve injuries were observed. Four (16%) transient hypocalcaemias occurred as early complications. At last follow-up visit (mean length of follow-up 17.2 ± 3.4 months), all patients were doing well and free of any clinical local recurrence or distant metastases. Conclusion: With a 12% risk that multinodular goiter harbors preoperatively unsuspected PTCs, which can have already infiltrated the capsule and that can be accompanied by PTC foci contralaterally, an adequate surgical approach has to be considered. Arch Endocrinol Metab. 2018;62(2):139-48 Keywords Incidental thyroid cancer; benign thyroid disease; multinodular goiter; total thyroidectomy; papillary thyroid cancer

Correspondence to: Alessandro Sindoni Sezione di Scienze Radiologiche, Dipartimento di Scienze Biomediche, Odontoiatriche e delle Immagini Morfologiche e Funzionali, Via Consolare Valeria, 1 98125 – Messina, Italy alessandrosindoni@alice.it Received on Sept/18/2016 Accepted on Oct/3/2017

INTRODUCTION

n the thyroid literature the term incidental has been used to indicate an unsuspected finding; nevertheless, the nature of the incidental finding depends on the clinical context in which the nodules are found. Considering thyroid gland, the identification of thyroid cancer may be classified into 3 broad categories: 1) clinically detected cancer (not incidentally detected), 2) radiologically detected cancer (clinically unsuspected), and 3) pathologically detected cancer (clinically and radiologically unsuspected) (1). Incidental thyroid cancers (ITCs) are often microcarcinomas, most frequently of the papillary histotype (2-6); the mean tumor size of ITCs decreased during the last decades Arch Endocrinol Metab. 2018;62/2

(3,6). Namely, Boucek and cols. (7) divided ITC diagnoses into four different categories: i) neoplasms found incidentally after thyroidectomy whereas preoperatively only benign pathology was known; ii) neoplasms that were diagnosed incidentally on imaging, mainly ultrasonography (US), and that were evaluated further and confirmed by fine-needle aspiration cytology (FNAC); iii) neoplasms that appeared clinically as lymph node metastases, with primary thyroid carcinoma detected only at histological specimen examination; iv) thyroid cancer that is localized in ectopic thyroid tissue with clinical symptoms or metastases present. Besides these four groups, Liu and cols. (8) proposed another ITC group including patients that presented, 139

DOI: 10.20945/2359-3997000000017

Thyroid cancer in patients thyroidectomized for benign multinodular goiter

despite benign thyroid disease ascertained at imaging and definitive histology, regional or distant lymph node metastases from primary thyroid carcinoma not identified at thyroid pathological examination. An ITC discovered at histology, after surgical removal of the thyroid for a benign pathology, is the most frequent event (9-12). In thyroidectomy specimens, ITC prevalence ranges up to 40% (2). In autopsy studies, the reported prevalence of ITC ranges from 0.01% in USA to 35.6% in Finland (7). Recently, a study from U.S.A. have documented that most counties with the highest thyroid cancer incidence are in a contiguous area of eastern Pennsylvania, New Jersey, and southern New York State; radioactive exposures from 16 nuclear power reactors within a 90-mile radius in this area have indicated that these emissions are a likely etiological factor in rising thyroid cancer incidence rates (13). Over the last 30 years, there has been an increase in the overall incidence of thyroid cancer, from 3.6 (in 1973) to 8.7 (in 2002) per 100,000 inhabitants (14). The incidence rate of papillary thyroid cancer PTC rose up more than any other malignancy (15,16), up to 93% of all thyroid cancers in Japan and up to 85.3% in Western countries (7). PTC is the most common histotype and microPTC represents up to 30% of all forms of papillary cancer (17). The very recently released American Thyroid Association guidelines on thyroid nodules and cancer underscore that “a recent population based study from Olmsted County reported the doubling of thyroid cancer incidence from 2000-2012 compared to the prior decade as entirely attributable to clinically occult cancers detected incidentally on imaging or pathology” (18-20). By 2019, one study predicts that papillary thyroid cancer (PTC) will become the third most common cancer in women (21). The purpose of this study was to evaluate the rate of histologically detected PTC in consecutive patients who were thyroidectomized for benign multinodular goiter (MNG) throughout a 1-year period at a single endocrine surgery unit. Of note, this surgery unit and patients’ residence is located near to three nuclear power units. Our data were compared with those of the English language literature on the ITCs.

SUBJECTS AND METHODS All patients of this retrospective cohort were admitted on the same day of the surgical procedures, 140

performed by 3 experienced endocrine surgeons under general anesthesia. Preoperatively, patients were studied by means of neck US and routine blood test, including hormones levels. The American Society of Anesthesiologists (ASA) physical status was assessed in all patients. In order to obtain a more homogeneous cohort of patients, we excluded patients with suspicious characteristics of the thyroid nodule(s) (i.e. irregular margin and/or contour and/or shape, calcifications, hypoechogenicity, vascularity or local invasion/lymph node metastases) at US (n = 19), history of previous neck surgery (n = 7), history of malignancy in other organs (n = 5) and ASA score greater than 4 (n = 2). Parathyroid glands and recurrent nerves were identified in all cases, and specimens sent to pathologists for the frozen section; no cervical drains were placed systematically. Patients were discharged, generally in the second post-operative day, with a prescription of a weight-adjusted thyroxine treatment. Patients were referred to our endocrinological outpatient surveillance program. We defined microcarcinoma or macrocarcinoma any cancerous nodule up to 10 mm or greater than in maximum diameter, respectively. When multifocality occurred, we considered the largest neoplasm and classified according to its anatomical site. For purpose of comparison with the international literature, we run a PubMed search entering the words “incidental thyroid cancer” or “incidental thyroid carcinoma”. The search was updated until November 2016. The search was limited taking into consideration only original papers. The references of the retrieved articles were also checked so as not to miss important clinical studies. Original articles reporting data about patients who underwent surgery for suspicious or preoperatively documented disease, as well as editorials, commentaries, review articles and similar types of articles were excluded. Animal studies were also excluded. Two researchers (A.S., S.B.) independently reviewed the titles and disagreements were resolved in a consensus meeting.

Statistical analysis Results are expressed as mean ± standard deviation (SD). Laboratory data without normal distribution were described using median and percentile values. Fisher’s exact test was used to analyze categorical data. The level for statistical significance was set at P < 0.05. Statistical analysis was performed using Kyplot v2.0 beta 13 version. Arch Endocrinol Metab. 2018;62/2

RESULTS In our study from a French endocrine surgery unit, we retrospectively reviewed 207 consecutive patients, 169 were females (mean age of 53.0 ± 12.6 years [range 18-79]) and 38 males (mean age of 54.9 ± 14.2 years [range 21-78]), who underwent total thyroidectomy (TT) for benign bilateral MNG from January to December 2014. All patients came from an iodinedeficient area (Orleans, France) (22) with three nuclear power stations located in the neighboring areas of the county town (Figure 1). Clinico-laboratory data of all patients are shown in Table 1.

Figure 1. Topography of nuclear power plants in the neighboring areas of Orleans, France (ring). Table 1. Demographic and clinico-laboratory characteristics of patients undergoing total thyroidectomy for benign multinodular goiter All patients (n = 207) Age, years mean ± SD (range)

53.9 ± 13.9 (18 – 79)

TSH, uUI/ml median (interquartile range)

1.54 (1.07 – 2.27)

FT3, pmol/L median (interquartile range)

5.6 (4.3 – 6.2)

FT4, pmol/L median (interquartile range)

15.2 (12.8 – 16.9)

Tg, ng/ml median (interquartile range)

24.2 (19.5 – 35.7)

SD: standard deviation; Tg: thyroglobulin. Arch Endocrinol Metab. 2018;62/2

Over the 12-month chronological window of our study, in 25/207 patients (12.1%) we discovered 37 preoperatively unsuspected, and therefore ITCs, all being PTCs. Their ASA score of these patients was ASA1 (n = 4), ASA2 (n = 18) and ASA3 (n = 3). Mean hospital stay was 1.1 ± 0.3 days; 23 (92%) were discharged on the 1st post-operative day and 2 on the 2nd post-operative day. Of these 37 PTCs, 31 (86.1%) were microPTCs, with a maximum diameter ranging 1 to 6 mm, while 6 were macroPTCs (diameter range 12-16 mm). Overall, mean age of the 25 patients was 55 ± 10 years (range 30-75) with 20 being females (F:M ratio = 4:1). Patients with macroPTCs were 7 years older than patients with microPTCs (Table 2). Histopathological examination showed bilateral MNG in all cases (mean weight of the thyroid glands: 53.6 ± 45.7 g) and the additional presence of chronic lymphocytic thyroiditis or Hashimoto’s thyroiditis (HT) in 6/25 patients (24%, all with positive thyroid peroxidase and thyroglobulin autoantibodies). Thyroid tumors were monofocal in 15 patients (all microPTCs; 15/37 tumors in 15 patients) and multifocal in 10. Of these multifocal PTCs, 16 were microcarcinomas and 6 macrocarciomas. In 5 of the 10 patients microPTCs and macroPTC coexisted. Multifocal PTCs, including coexistence of micro (n = 16) and macroPTCs (n = 6), were always bilateral. Of the 15 monofocal microPTCs, 8 were right-sided, and 7 left-sided (Table 1). MicroPTCs and macroPTCs did not differ in distribution if we considered the right lobe-left lobe-isthmus location (P = 0.836 by Fisher’s exact test) or the classification among the uppermiddle-lower-isthmic localization in the thyroid (P = 0.334 by Fisher’s exact test). Of the 6/207 patients with HT, 2/6 (33.3%) had 4 of the 37 PTCs, all 4 tumors being microPTCs. Seven supplementary central and lateral cervical lymph node dissections were carried out, because 2 microPTCs and 5 PTCs were infiltrating the thyroid capsule at frozen sections. Lymph node metastases were found in one and two patients, respectively. Radioiodine treatment, with a dose of 100 mCi, was performed in 7 cases, because of the presence of poor prognostic factors such as capsular infiltration, macroPTC and/or multifocality. Neither mortality nor transient and permanent nerve injuries were observed. Four (16%) transient hypocalcaemias occurred as early complications, and were successfully treated by a 6-week combined cholecalciferol and oral calcium supplementation. 141

Thyroid cancer in patients thyroidectomized for benign multinodular goiter

Table 2. PTC patients and tumours characteristics No. of nodules (%) No. of patients with multifocality (%)

Right lobe

Left lobe

Isthmus

Total

17 (46.0%)

16 (43.2%)

4 (10.8%)

37 (100%)

4 (16%)

5 (20%)

1 (4%)

10/25 (40.0%)

14 (45.2%)

3 (9.6%)

microPTC No. of nodules (%) Mean diameter (mm) ± SD

4.4 ± 2.7

3.9 ± 2.5

3.8 ± 2.6

55.9 ± 10.2

52.2 ± 7.7

57.0 ± 18.7

54.4 ± 9.9

3.7:1

3:0

4.2:1

3 (50%)

2 (33.3%)

1 (16.7%)

Mean diameter (mm) ± SD

13.0 ± 1.7

12.5 ± 0.7

15.7 ± 7.1

Mean age (years) ± SD

60.0 ± 13.5

67.5 ± 9.2

61.2 ± 11.1

3:0

2:0

0:1

5:1

Mean age (years) ± SD F:M ratio macroPTC No. of nodules (%)

F:M ratio PTC: papillary thyroid carcinoma; SD: standard deviation; F: female; M, male.

At last follow-up visit (mean length of follow-up 17.2 ± 3.4 months), all patients were doing well and free of any clinical local recurrence or distant metastases. An overview of the literature is summarized in Table 3 (23-68). Reported prevalence of ITC at surgery ranges between 2% and 40% (1,2,17,23-68): in Europe it varies from 2.2% to 27.4% and in the United States it varies from 3.3% to 33%. In some European

countries, such as Romania, Czech Republic, Ukraine and Poland, the frequency of thyroid cancer showed a lower range (i.e. from 5 to 9.2%); in Turkey, excluding the study from Tasova and cols. (46), there has been a lower variation range in its reported incidence (7-10%). Rates from other European countries were: 12.5 % from Belgium, 10.4-11.1% from Italy and 12.0% from Greece.

Table 3. Summary of the literature on thyroid cancers that were discovered incidentally at thyroidectomy in patients underwent surgery for benign thyroid disease Years of study

Country

Patients studied

Surgical procedure

Rate of cancer

Comment

Fama’ and cols., this study

One (2014)

France

207 pts

In 25/207 (12.1%) pts, 37 PTC were detected (31 microPTCs and 6 PTCs)

10/25 (40.0%) pts had multifocal tumours; all pts underwent surgery for MNG

Daumerie and cols., 1998

1976 - 1995

Belgique

93 pts

TT in 16/47 (34.0%) pts with MNG (group I), PT in 39/46 (84.8%) pts with a solitary hot nodule (group II)

2/16 (12.5%) pts (group I) and 5/39 (12.8%) pts (group II) had microTC, with a total prevalence of 12.7%

Dănilă and cols., 2008

2000 - 2006

Germany

92 pts

2/92 (2.2%) pts had microPTC (tumour size ranged from 3 to 5 mm)

All pts had GD; multifocality and lymph node involvement were not detected

Pezzolla and cols., 2014

Jan 2010 - Jun 2013

Italy

256 pts

Surgical procedures in tumours pts 28/256): TT in 27/28, PT in 1/28 PT

In 28/256 (10.9%) pts, 40 TCs were detected (29 FV-PTC, 10 PTC and 1 FTC)

Pts underwent surgery for: 176 pts (MNG), 67 pts (GD), 12 pts (UNG) and 1 pt (PD)

Pezzolla and cols., 2010

n/a

Italy

165 pts

n/a

30/165 (18.2%) pts had TC (18 PTC, 6 FTC, 5 FV-PTC and 1 oncocytic carcinoma); 15/30 (50%) were microcarcinomas

Pts underwent surgery for: 132 pts (MNG), 30 pts (UNG), 2 pts (PD) and 1 pt (GD)

Author (ref)

142

Arch Endocrinol Metab. 2018;62/2

Thyroid cancer in patients thyroidectomized for benign multinodular goiter

Years of study

Country

Patients studied

Costamagna and cols., 2013

2001 - 2009

Italy

Negro and cols., 2013*

2000 - 2010

Botrugno and cols., 2011

Surgical procedure

Rate of cancer

Comment

568 pts

TT in 499/568, PT in 69/568

53/568 (9.3%) pts had TC (24 FV-PTC, 20 PTC, 4 FTC, 4 MTC and 1 primitive thyroid paraganglioma); 32/53 (60.4%) had microPTCs

14/53 (26.4%) pts had multifocal tumours and in 12/53 (22.6%) were bilateral

Italy

970 pts

84/ 970 (8.7%) pts had TC

2000 - 2008

Italy

462 pts

41/462 (8.9%) pts had TC; the most common histotype was PTC

Gelmini and cols., 2010

10 yrs

Italy

739 pts

TT in 503/739, PT in 239/739

82/739 (11.1%) pts had TC, mainly microPTC

Lymph-node metastases were found in the 3.6% of cases

Pisello and cols., 2007

Jan 2000 - Jan 2006

Italy

502 pts

TT in 458/502, PT in 44/502

17/502 (3.4%) pts had microPTC

In 34/502 (6.8%) pts, tumours were suspected preoperatively; 2/502 (0.4%) had multifocal microPTCs

Carlini and cols., 2006*

n/a

Italy

88 pts

19/88 (21.6%) pts had TC

Miccoli and cols., 2006

Feb 2002 - Nov 2003

Italy

998 pts

TT in 902/998 pts, PT in 96/998

104/998 (10.4%) pts had TC; the most common histotype was PTC (99/104)

Carlini and cols., 2005*

1-year

Italy

n/a

Incidence of microTC was 27.4%

1985 - 1991

Italy

2930 pts

n/a

132/2463 (5.4%) pts had TC

2463/2930 pts were considered clinically benign and 467/2930 pts malignant, preoperatively

n/a

Spain

372 pts

n/a

58/372 (15.6%) pts had TC

Pts underwent surgery for: 49 pts (EMNG), 8 pts (GD) and 1 pt (HMNG)

Slijepcevic and cols., 2015

2008-2013

Serbia

2466 pts

TT or PT

403/2466 (16.3%) pts had microPTC

Zivaljević and cols., 2008

2004

Serbia

578 pts

n/a

53/578 (9.2%) pts had microTC

Alecu and cols., 2014

2002 - 2012

Romania

145 pts

TT in 102/145 pts, PT in 43/145

10/145 (6.9%) pts had microPTC

Muntean and cols., 2013

2002 - 2011

Romania

2168 pts

TT or PT

187/2168 (8.6%) pts had microPTC

In 66/187 (35.3%) pts had multifocal tumours, and in 31/187 (16.6%) were bilateral

Lukás and cols., 2010

2004 - 2008

Czech Republic

400 pts

TT or PT

34/400 (8.5%) pts had microTC; 32/34 (94.1%) were microPTCs

In 5/34 (14.7%) pts had multifocal tumours and in 4/34 (11.8%) were bilateral

Nechaĭ and cols., 2012*

2008 - 2009

Ukraine

608 pts

n/a

56/608 (9.2%) pts had TC; 43/56 (76.8%) were microPTCs

Barczyński and cols., 2011*

1999 - 2009

Poland

8132 pts

TT in 2918/8132 pts, PT in 5214/8132

406/8132 (5.0%) pts had TC

Vasileiadis and cols., 2013

2001 - 2009

Greece

2236 pts

268/2236 (12.0%) pts had microPTC.

Pingitore and cols., 1993

Pascual Corrales and cols., 2012

Arch Endocrinol Metab. 2018;62/2

Tumours were multifocal in 19.8% of the cases

Pts underwent surgery for: 201 pts (MNG), 178 pts (thyroid adenoma), 89 pts (GD), 79 pts (PD) and 31 pts thyroiditis

Author (ref)

143

Thyroid cancer in patients thyroidectomized for benign multinodular goiter

Author (ref)

Country

Patients studied

Surgical procedure

Rate of cancer

Comment

Siassakos and cols., 2008

Jan 1997 - Jul 2001

Greece

191 pts

29/191 (15.2%) pts had microTC (18 microFTC, 10 microPTC and 1 microMTC)

In 8/29 (27.6%) pts had multifocal microcarcinomas

Sakorafas and cols., 2007

Feb 1990 - Feb 2002

Greece

380 pts

TT in 377/380 pts, PT in 3/380

27/380 (7.1%) pts had microPTC

In 11/27 (40.7%) pts had multifocal tumours

Yazici and cols., 2015

2010-2013

Turkey

86 pts

TT or PT

6/86 (7.0%) pts had TC (4 microPTC and 2 PTC)

Tasova and cols., 2013

Mar 2007 - May 2011

Turkey

443 pts

TT in 401/443, PT in 42/443

66/443 (14.9%) pts had TC (56 PTC, 4 FTC and 6 indeterminate lesions)

Karakoyun and cols., 2013

Jan 2010 - Aug 2011

Turkey

50 pts

5/50 (10.0%) pts had microPTC.

Berker and cols., 2011

Jan 2004 - Jan 2009

Turkey

337 pts

18/337 (5.3%) pts had microTC

Tezelman and cols., 2009

1988-2007

Turkey

2906 pts

PT in 1695/2906 (group 1), TT in 1211/2906 (group 2)

210/2906 (7.2%) pts had TC (81 in group 1 and 129 in group 2)

Giles and cols., 2004

Sep 2001 - Dec 2002

Turkey

218 pts

TT in 109/218 (group 1), and PT in 109/218 (group 2)

18/218 (8.3%) pts had PTC (10 in group 1 and 8 in group 2)

Fernando and cols., 2009

2003 - 2005

Sri Lanka

68 pts

6/68 (8.8%) pts had TC (2 PTC, 2 MTC and 2 FTC)

Jan 2005 - Jun 2012

India

1300 pts

TT or PT

94/1300 (7.2%) pts had microPTC

Wu and cols., 1993*

1962 - 1991

China

135 pts

n/a

54/135 (40.0%) pts had TC

Koh and cols., 1992

n/a

Malaysia

107 pts

n/a

8/107 (7.5%) pts had TC, mainly PTC

All pts underwent surgery for MNG

Preece and cols., 2014

Sep 1994 - Aug 2012

Australia

1508 pts

96/1508 (6.4%) pts had TC

Pts underwent surgery for: 963 pts (MNG), 295 pts (TNG), 250 pts (GD)

Bron and cols., 2004

1998-2002

Australia

834 pts

71/834 (8.5%) pts had TC (33 microPTC, 22 PTC, 11 FTC, 5 other)

74/834 had previously undergone PT

Bhuiyan and cols., 2015

2003-2008

South Africa

90 pts

10/90 (11.1%) pts had TC (3 PTC and 7 FTC)

Bombil and cols., 2014

2005-2010

South Africa

162 pts

4/162 (2.5%) pts had PTC (3/4 were FV-PTC)

Edino and cols., 2010

2000-2006

Nigeria

160 pts

n/a

24/160 (15.0%) pts had TC (13 FTC, 10 PTC, 1 MTC and 1 ATC)

In 6/25 (24.0%) pts tumours were detected preoperatively by FNAC

Choong and cols., 2015

1990-2014

USA

148 pts

TT (120 pts) or PT (28 pts)

7/148 (4.7%) pts had TC (5 PTC, 1 FTC and 1 MTC)

All pts underwent surgery for TNG

Ergin and cols., 2014

2005-2013

USA

493 pts

69/248 (28%) pts in EG group and 64/245 (26%) pts in GD group had microPTC

Pts underwent surgery for: 248 pts (EG), 245 pts (GD)

Bahl and cols., 2014*

2003-2012

USA

2090 pts

n/a

680/2090 (33%) pts had TC

Phitayakorn and cols., 2013

Dec 1985 - Mar 2010

USA

300 pts

TT or PT

31/300 (10.3%) pts had TC (22 microPTC, 8 PTC and 1 FTC)

Phitayakorn and cols., 2008

1990-2007

USA

506 pts

TT, PT in 10 pts with GD

11/333 (3.3%) nonTNG pts had PTC, 2/92 (2.2%) GD pts had microPTC, 5/81 (6.2%) TNG pts had TC (3 PTC, 1 FTC and 1 MTC)

John and cols., 2014

Years of study

144

Pts underwent surgery for: 278 pts (MNG), 59 pts (GD)

All pts underwent surgery for MNG

Pts underwent surgery for: 333 pts (nonTNG), 92 pts (GD), 81 pts (TNG)

Arch Endocrinol Metab. 2018;62/2

Thyroid cancer in patients thyroidectomized for benign multinodular goiter

Years of study

Country

Patients studied

Surgical procedure

Rate of cancer

Smith and cols., 2013

2000-2011

USA

1523 pts

n/a

238/1523 (15.6%) pts had TC (175 PTC, 39 FV-PTC, 11 FTC and 13 other malignancies)

Smith and cols., 2013*

2002-2011

USA

164 pts

n/a

30/164 (18.3%) pts had TC

All pts underwent surgery for TNG

Dunki-Jacobs and cols., 2012

2001-2007

USA

723 pts

TT or PT

194/723 (27%) pts had TC (PTC or microPTC)

In 137/194 (70.6%) pts, tumours were suspected preoperatively

Bradly and cols., 2009

Jan 2000 - May 2008

USA

678 pts

TT or PT

81/678 (12%) pts had PTC

Lokey and cols., 2005*

Dec 1998 -Dec 2003

USA

738 pts

n/a

28/738 (3.8%) pts had TC (mainly microPTC)

Author (ref)

Comment

pts: patients; TT: total thyroidectomy; PT: partial thyroidectomy; TC: thyroid carcinoma; PTC: papillary thyroid carcinoma; FV-PTC: follicular variant of papillary thyroid carcinoma; FTC: follicular thyroid carcinoma; MTC: medullary thyroid carcinoma; ATC: anaplastic thyroid carcinoma; MNG: multinodular goiter; UNG: uninodular goiter; TNG, toxic nodular goiter; GD, Graves’ disease; PD, Plummer’s disease; HT, Hashimoto’s thyroiditis; EG, euthyroid goiter; EMNG, euthyroid multinodular goiter; HMNG, hyperthyroid multinodular goiter, FNAC: fine-needle aspiration cytology; n/a: not available.

DISCUSSION The increased incidence of thyroid carcinoma seems to be related to an improved diagnostic approach, given by a widespread use of US and cytology, but also by the employment of new imaging techniques, such as 18F-fluoro-deoxyglucose positron emission tomogram/computed tomography (18F-FDG-PET/ CT) (69-71). Among patients who performed neck US for suspected parathyroid disease, incidental thyroid nodules were found in 46% of them (72). Similarly, thyroid incidentalomas discovered during CT or magnetic resonance imaging that had been carried out for other reasons have been reported with an incidence of 16% (73,74); moreover, 9% to 13% were discovered during carotid US (75,76), and 2% to 3% at 18F-FDGPET/CT scan (77-79). The prevalence of incidental thyroid nodules on US in the general population ranges between 42% and 67% (80,81). In thyroidectomy specimens, ITC prevalence ranges up to 40% (2). In autopsy studies, the reported prevalence of ITC ranges from 0.01% in USA to 35.6% in Finland (7). The overview of the literature (Table 3, refs. 2368), has shown that one-third (n = 16) of the studies are on cohorts of thyroidectomized patients smaller than ours (n = 50 to 191, compared to 207), and oneseventh of the studies (n = 7) are on cohorts slightly greater than ours (256 to 8,132). Prevalence of ITC at surgery ranges between 2% and 40% (1,2,17,2368). In Europe, the frequency of ITC varies from 2.2% to 27.4%, and a similar wide range (3.3% to 33%) is Arch Endocrinol Metab. 2018;62/2

observed in the United States. Interestingly, in Eastern Europe (Romania, Czech Republic, Ukraine, Poland), the frequency of thyroid cancer is relatively low (range 5-9.2%). In Turkey, excluding the study from Tasova and cols. (46), there is a lower variation range in the reported incidence of thyroid cancer (7-10%). One comment deserves the coexistence of ITCs with HT. We found a 33% rate of ITCs (always microPTCs) in patients with histologically confirmed HT. This rate is greater than that reported in one recent retrospective study from Serbia (37). Slijepcevic and cols. (37) also investigated the prevalence of microPTC in patients operated for benign thyroid diseases in a retrospective study of 2,466 patients who underwent thyroid surgery from 2008 to 2013. The overall prevalence of microPTC was 16.3%, the highest being in HT. Smith and cols. (63) examined cancer frequency in patients referred for removal of benign thyroid disease in a multiinstitutional series of 2,551 patients. Indeterminate/ malignant FNA diagnoses were excluded (n = 1,028). Overall, 238 (15.6%) cancers were found, and 275 patients had thyroiditis (18%). Presence of thyroiditis was not associated with cancer, because there were 47 ITCs in the 275 patients compared with 191 ITCs in 1,247 patients without thyroiditis (17.1% vs 15.3%). Our rate of 33.3% was highly significant as well as the 22.7% (χ2 = 10.80, P < 0.001) of Slijepcevic and cols. (37), whereas the rate of 17.1% (χ2 = 0.388, P = 0.533) reported by Smith and cols. did not reach statistical significance. 145

* Tabulated data taken from the abstracts written in English and/or illustrative material.

Thyroid cancer in patients thyroidectomized for benign multinodular goiter

The limitations of this study are due to its retrospective nature. Another limitation is the natural history of thyroid cancer, which is a slow growing tumor, so that extended follow-up is needed to evaluate the long-term outcomes. The strength of the study lies in its short course, avoiding that a variable number of pathologists histologically examined the specimens using different methods of evaluation. Our 12.1% rate is comparable to rates from other European countries, including Belgium, Italy (25,30,33) and Greece (17). Because Italy and Greece have no nuclear plants, we tend to exclude that our rate was influenced by the relative vicinity of our medical center and residence of patients to three nuclear plant units (82). A systematic review and meta-analysis on this issue does not support an association between living near nuclear power plants and risk of thyroid cancer. However, sensitivity analysis by exposure definition demonstrated that living less than 20 km from nuclear power plants was associated with a significant increase in the risk of thyroid cancer (83). Additionally, with a 12% risk that MNG harbors preoperatively unsuspected PTCs which can have already infiltrated the capsule and that are accompanied frequently by other PTC foci contralaterally, an adequate surgical approach has to be considered. The operative management of benign thyroid diseases includes partial and total thyroidectomy: the first one preserves thyroid function, sparing patients the need for lifelong thyroid hormone replacement (84); moreover, microPTCs can have an excellent prognosis not requiring completion thyroidectomy. On the other hand, total thyroidectomy may present complications, such as hypoparathyroidism (often transient) (85) and recurrent laryngeal nerve injury (84), which occurs in 6% and 1% of patients, respectively (84). However, reoperation after partial thyroidectomy can be needed in cases with multifocal thyroid cancer or for radioactive iodine ablation. In our experience, total thyroidectomy showed neither mortality nor transient and permanent nerve injuries, avoiding the risk of recurrence and necessity of completion thyroidectomy, with its known technical difficulties and increased risk of complications, and also avoiding the risk of ITC presence in remnant tissue. Disclosure: no potential conflict of interest relevant to this article was reported. 146

REFERENCES 1. Bahl M, Sosa JA, Nelson RC, Esclamado RM, Choudhury KR, Hoang JK. Trends in incidentally identified thyroid cancers over a decade: a retrospective analysis of 2,090 surgical patients. World J Surg. 2014; 38:1312-17. 2. Siassakos D, Gourgiottis S, Moustafellos P, Dimopoulos N, Hadjiyannakis E. Thyroid microcarcinoma during thyroidectomy. Singapore Med J. 2008;49:23-5. 3. Trimboli P, Ulisse S, Graziano FM, Marzullo A, Ruggieri M, Calvanese A, et al. Trend in thyroid carcinoma size, age at diagnosis, and histology in a retrospective study of 500 cases diagnosed over 20 years. Thyroid. 2006;16:1151-5. 4. Ahn HS, Welch HG. South Korea’s Thyroid-Cancer “Epidemic”-Turning the Tide. N Engl J Med. 2015;373:2389-90. 5. Lin JD, Chao TC, Weng HF, Huang HS, Ho YS. Clinical presentations and treatment for 74 occult thyroid carcinoma. Comparison with nonoccult thyroid carcinoma in Taiwan. Am J Clin Oncol. 1996;19:504-8. 6. Ahmed SR, Ball DW. Clinical review: incidentally discovered 197 medullary thyroid cancer: diagnostic strategies and treatment. J Clin Endocrinol Metab. 2011;96:1237-45. 7. Boucek J, Kastner J, Skrivan J, Grosso E, Gibelli B, Giugliano G, et al. Occult thyroid carcinoma. Acta Otorhinolaryngol Ital. 2009;29:296-304. 8. Liu H, Lv L, Yang K. Occult thyroid carcinoma: a rare case report and review of literature. Int J Clin Exp Pathol. 2014;7:5210-4. 9. Saint Marc O, Cogliandolo A, Piquard A, Famà F, Pidoto RR. LigaSure vs clamp-and-tie technique to achieve hemostasis in total thyroidectomy for benign multinodular goiter: a prospective randomized study. Arch Surg. 2007;142:150-6. 10. Lasithiotakis K, Grisbolaki E, Koutsomanolis D, Venianaki M, Petrakis I, Vrachassotakis N, et al. Indications for surgery and significance of unrecognized cancer in endemic multinodular goiter. World J Surg. 2012;36:1286-92. 11. Ito Y, Higashiyama T, Takamura Y, Miya A, Kobayashi K, Matsuzuka F, et al. Prognosis of patients with benign thyroid diseases accompanied by incidental papillary carcinoma undetectable on preoperative imaging tests. World J Surg. 2007;31:1672-6. 12. Lin J, Kuo S, Chao T, Hsueh C. Incidental and nonincidental papillary thyroid microcarcinoma. Ann Surg Oncol. 2008;15:2287-92. 13. Mangano JJ. Geographic variation in U.S. thyroid cancer incidence and a cluster near nuclear reactors in New Jersey, New York, and Pennsylvania. Int J Health Serv. 2009;39:643-61. 14. Davies L. Welch H. Increasing incidence of thyroid cancer in the United States, 1973-2002. JAMA. 2006;295:2164-7. 15. Rizzo M, Sindoni A, Talamo Rossi R, Bonaffini O, Panetta S, Scisca C, et al. Annual increase in the frequency of papillary thyroid carcinoma as diagnosed by fine-needle aspiration at a cytology unit in Sicily. Hormones (Athens). 2013;12:46-57. 16. Mazzaferri EL. Managing thyroid microcarcinomas. Yonsei Med J. 2012;53:1-14. 17. Vasileiadis I, Karatzas T, Vasileiadis D, Kapetanakis S, Charitoudis G, Karakostas E, et al. Clinical and pathological characteristics of incidental and nonincidental papillary thyroid microcarcinoma in 339 patients. Head Neck. 2014;36:564-70. 18. Brito JP, Al Nofal A, Montori VM, Hay ID, Morris JC. The Impact of Subclinical Disease and Mechanism of Detection on the Rise in Thyroid Cancer Incidence: A Population-Based Study in Olmsted County, Minnesota During 1935 Through 2012. Thyroid. 2015;25:999-1007. 19. Haugen BR, Alexander EK, Bible KC, Doherty GM, Mandel SJ, Nikiforov YE, et al. 2015 American Thyroid Association Management Guidelines for Adult Patients with Thyroid Nodules and DifferenArch Endocrinol Metab. 2018;62/2

Thyroid cancer in patients thyroidectomized for benign multinodular goiter

tiated Thyroid Cancer: The American Thyroid Association Guidelines Task Force on Thyroid Nodules and Differentiated Thyroid Cancer. Thyroid. 2016;26:1-133.

38. Zivaljević VR, Diklić AD, Krgović KLj, Zorić GV, Zivić RV, Kalezić NK, et al. The incidence rate of thyroid microcarcinoma during surgery benign disease. Acta Chir Iugosl. 2008;55:69-73.

20. Francis GL, Waguespack SG, Bauer AJ, Angelos P, Benvenga S, Cerutti JM, et al.; American Thyroid Association Guidelines Task Force. Management Guidelines for Children with Thyroid Nodules and Differentiated Thyroid Cancer. Thyroid. 2015;25:716-59.

39. Alecu L, Alecu L, Bărbulescu M, Ursuţ B, Enciu O, Slavu I, et al. Occult thyroid carcinoma in our experience – should we reconsider total thyroidectomy for benign thyroid pathology? Chirurgia (Bucur). 2014 ;109:191-7.

21. Aschebrook-Kilfoy B, Schechter RB, Shih YC, Kaplan EL, Chiu BC, Angelos P, et al. The clinical and economic burden of a sustained increase in thyroid cancer incidence. Cancer Epidemiol Biomarkers Prev. 2013;22:1252-9.

40. Muntean V, Domsa I, Zolog A, Piciu D, Fabian O, Bosu R, et al. Incidental papillary thyroid microcarcinoma: is completion surgery required? Chirurgia (Bucur). 2013;108:490-7.

23. Daumerie C, Ayoubi S, Rahier J, Buysschaert M, Squifflet JP. Prevalence of thyroid cancer in hot nodules. Ann Chir. 1998;52:444-8. 24. Dănilă R, Karakas E, Osei-Agyemang T, Hassan I. Outcome of incidental thyroid carcinoma in patients undergoing surgery for Graves’ disease. Rev Med Chir Soc Med Nat Iasi. 2008;112:115-8. 25. Pezzolla A, Marzaioli R, Lattarulo S, Docimo G, Conzo G, Ciampolillo A, et al. Incidental carcinoma of the thyroid. Int J Surg. 2014;12 Suppl 1:S98-102.

41. Lukás J, Paska J, Hintnausová B, Lukás D, Syrůcek M, Sýkorová P. The occurrence of microcarcinomas in the patients after thyroidectomy--retrospective analysis. Cas Lek Cesk. 2010;149:378-80. 42. Nechaĭ OP, Larin OS, Cheren’ko SM, Sheptukha SA, Smoliar VA, Zolotar’ov PO. “Incidental” thyroid carcinoma among patients in surgical treatment for nontumors thyroid desease. Klin Khir. 2012;7:9-11. 43. Barczyński M, Konturek A, Stopa M, Cichoń S, Richter P, Nowak W. Total thyroidectomy for benign thyroid disease: is it really worthwhile? Ann Surg. 2011;254:724-9.

26. Pezzolla A, Lattarulo S, Milella M, Barile G, Pascazio B, Ciampolillo A, et al. Incidental carcinoma in thyroid pathology: our experience and review of the literature. Ann Ital Chir. 2010;81:165-9.

44. Sakorafas GH, Stafyla V, Kolettis T, Tolumis G, Kassaras G, Peros G. Microscopic papillary thyroid cancer as an incidental finding in patients treated surgically for presumably benign thyroid disease. J Postgrad Med. 2007;53:23-6.

27. Costamagna D, Pagano L, Caputo M, Leutner M, Mercalli F, Alonzo A. Incidental cancer in patients surgically treated for benign thyroid disease. Our experience at a single institution. G Chir. 2013;34:21-6.

45. Yazici P, Mihmanli M, Bozdag E, Aygun N, Uludag M. Incidental Finding of Papillary Thyroid Carcinoma in the Patients with Primary Hyperparathyroidism. Eurasian J Med. 2015;47:194-8.

28. Negro R, Piana S, Ferrari M, Ragazzi M, Gardini G, Asioli S, et al. Assessing the risk of false-negative fine-needle aspiration cytology and of incidental cancer in nodular goiter. Endocr Pract. 2013;19:444-50. 29. Botrugno I, Lovisetto F, Cobianchi L, Zonta S, Klersy C, Vailati A, et al. Incidental carcinoma in multinodular goiter: risk factors. Am Surg. 2011; 77:1553-8. 30. Gelmini R, Franzoni C, Pavesi E, Cabry F, Saviano M. Incidental thyroid carcinoma (ITC): a retrospective study in a series of 737 patients treated for benign disease. Ann Ital Chir. 2010;81:421-7. 31. Pisello F, Geraci G, Sciumè C, Li Volsi F, Modica G. Total thyroidectomy of choice in papillary microcarcinoma. G Chir. 2007;28:13-9. 32. Carlini M, Giovannini C, Mercadante E, Castaldi F, Dell’Avanzato R, Zazza S. Incidental thyroid microcarcinoma in benign thyroid disease. Incidence in a total of 100 consecutive thyroidectomies. Chir Ital. 2006;58:441-7. 33. Miccoli P, Minuto MN, Galleri D, D’Agostino J, Basolo F, Antonangeli L, et al. Incidental thyroid carcinoma in a large series of consecutive patients operated on for benign thyroid disease. ANZ J Surg. 2006;76:123-6. 34. Carlini M, Giovannini C, Castaldi F, Mercadante E, Dell’Avanzato R, Zazza S, et al. High risk for microcarcinoma in thyroid benign diseases. Incidence in a one year period of total thyroidectomies. J Exp Clin Cancer Res. 2005;24:231-6. 35. Pingitore R, Vignati S, Bigini D, Ciancia EM. Post-operative examination of 2930 thyroid glands: observations on primary carcinoma. Incidental carcinoma and the preoperative diagnostic assessment of thyroidectomy for cancer. Pathologica. 1993;85:591-605. 36. Pascual Corrales E, Príncipe RM, Laguna Muro S, Martínez Regueira F, Alcalde Navarrete JM, Guillén Grima F, et al. Incidental differentiated thyroid carcinoma is less prevalent in Graves’ disease than in multinodular goiter. Endocrinol Nutr. 2012;59:169-73. 37. Slijepcevic N, Zivaljevic V, Marinkovic J, Sipetic S, Diklic A, Paunovic I. Retrospective evaluation of the incidental finding of 403 papillary thyroid microcarcinomas in 2466 patients undergoing thyroid surgery for presumed benign thyroid disease. BMC Cancer. 2015;15:330. Arch Endocrinol Metab. 2018;62/2

46. Tasova V, Kilicoglu B, Tuncal S, Uysal E, Sabuncuoglu MZ, Tanrikulu Y, et al. Evaluation of incidental thyroid cancer in patients with thyroidectomy. West Indian Med J. 2013;62:844-8. 47. Karakoyun R, Bülbüller N, Koçak S, Habibi M, Gündüz U, Erol B, et al. What do we leave behind after neartotal and subtotal thyroidectomy: just the tissue or the disease? Int J Clin Exp Med. 2013;6:922-9. 48. Berker D, Isik S, Ozuguz U, Tutuncu YA, Kucukler K, Akbaba G, et al. Prevalence of incidental thyroid cancer and its ultrasonographic features in subcentimeter thyroid nodules of patients with hyperthyroidism. Endocrine. 2011;39:13-20. 49. Tezelman S, Borucu I, Senyurek Giles Y, Tunca F, Terzioglu T. The change in surgical practice from subtotal to near-total or total thyroidectomy in the treatment of patients with benign multinodular goiter. World J Surg. 2009;33:400-5. 50. Giles Y, Boztepe H, Terzioglu T, Tezelman S. The advantage of total thyroidectomy to avoid reoperation for incidental thyroid cancer in multinodular goiter. Arch Surg. 2004;139:179-82. 51. Fernando R, Mettananda DS, Kariyakarawana L. Incidental occult carcinomas in total thyroidectomy for benign diseases of the thyroid. Ceylon Med J. 2009;54:4-6. 52. John AM, Jacob PM, Oommen R, Nair S, Nair A, Rajaratnam S. Our experience with papillary thyroid microcancer. Indian J Endocrinol Metab. 2014;18:410-3. 53. Wu Y. Occult carcinoma of the thyroid. Zhonghua Wai Ke Za Zhi. 1993;31:609-11. 54. Koh KB, Chang KW. Carcinoma in multinodular goitre. Br J Surg. 1992;79:266-7. 55. Preece J, Grodski S, Yeung M, Bailey M, Serpell J. Thyrotoxicosis does not protect against incidental papillary thyroid cancer. Surgery. 2014;156:1153-6. 56. Bron LP, O’Brien CJ. Total thyroidectomy for clinically benign disease of the thyroid gland. Br J Surg. 2004;91:569-74. 57. Bhuiyan MM, Machowski A. Nodular thyroid disease and thyroid malignancy: Experience at Polokwane Mankweng Hospital Complex, Limpopo Province, South Africa. S Afr Med J. 2015;105:570-2.

147

22. Valeix P, Zarebska M, Preziosi P, Galan P, Pelletier B, Hercberg S. Iodine deficiency in France. Lancet. 1999;353:1766-7.

Thyroid cancer in patients thyroidectomized for benign multinodular goiter

58. Bombil I, Bentley A, Kruger D, Luvhengo TE. Incidental cancer in multinodular goitre post thyroidectomy. S Afr J Surg. 2014;52:5-9.

tiers in Thyroidology, Vol 2. New York: Plenum Medical; 1985. p. 1309-12.

59. Edino ST, Mohammed AZ, Ochicha O, Malami SA, Yakubu AA. Thyroid cancers in nodular goiters in Kano, Nigeria. Niger J Clin Pract. 2010;13:298-300.

73. Shetty SK, Maher MM, Hahn PF, Halpern EF, Aquino SL. Significance of incidental thyroid lesions detected on CT: correlation among CT, sonography, and pathology. AJR Am J Roentgenol. 2006;187:1349-56.

60. Choong KC, McHenry CR. Thyroid cancer in patients with toxic nodular goiter--is the incidence increasing? Am J Surg. 2015;209:974-6. 61. Ergin AB, Saralaya S, Olansky L. Incidental papillary thyroid carcinoma: clinical characteristics and prognostic factors among patients with Graves’ disease and euthyroid goiter, Cleveland Clinic experience. Am J Otolaryngol. 2014;35:784-90. 62. Phitayakorn R, Morales-Garcia D, Wanderer J, Lubitz CC, Gaz RD, Stephen AE, et al. Surgery for Graves’ disease: a 25-year perspective. Am J Surg. 2013;206:669-73.

74. Youserm DM, Huang T, Loevner LA, Langlotz CP. Clinical and economic impact of incidental thyroid lesions found with CT and MR. AJNR Am J Neuroradiol. 1997;18:1423-8. 75. Steele SR, Martin MJ, Mullenix PS, Azarow KS, Andersen CA. The significance of incidental thyroid abnormalities identified during carotid duplex ultrasonography. Arch Surg. 2005;140:981-5. 76. Carroll BA. Asymptomatic thyroid nodules: incidental sonographic detection. AJR Am J Roentgenol . 1982;138:499-501.

63. Smith JJ, Chen X, Schneider DF, Broome JT, Sippel RS, Chen H, et al. Cancer after thyroidectomy: a multi-institutional experience with 1,523 patients. J Am Coll Surg. 2013;216:571-7.

77. Cohen MS, Arslan N, Dehdashti F, Doherty GM, Lairmore TC, Brunt LM, et al. Risk of malignancy in thyroid incidentalomas identified by fluorodeoxyglucose-positron emission tomography. Surgery. 2001;130:941-6.

64. Smith JJ, Chen X, Schneider DF, Nookala R, Broome JT, Sippel RS, et al. Toxic nodular goiter and cancer: a compelling case for thyroidectomy. Ann Surg Oncol. 2013;20:1336-40.

78. Are C, Hsu JF, Schoder H, Shah JP, Larson SM, Shaha AR. FDGPET detected thyroid incidentalomas: need for further investigation? Ann Surg Oncol. 2007;14:239-47.

65. Dunki-Jacobs E, Grannan K, McDonough S, Engel AM. Clinically unsuspected papillary microcarcinomas of the thyroid: a common finding with favourable biology? Am J Surg. 2012;203:140-4.

79. Kim TY, Kim WB, Ryu JS, Gong G, Hong SJ, Shong YK. 18F-fluoro-deoxyglucose uptake in thyroid from positron emission tomogram (PET) for evaluation in cancer patients: high prevalence of malignancy in thyroid PET incidentaloma. Laryngoscope. 2005;115:1074-8.

66. Bradly DP, Reddy V, Prinz RA, Gattuso P. Incidental papillary carcinoma in patients treated surgically for benign thyroid diseases. Surgery. 2009;146:1099-104. 67. Phitayakorn R, McHenry CR. Incidental thyroid carcinoma in patients with Graves’ disease. Am J Surg. 2008;195:292-7.

80. Brander A, Viikinkowski P, Nickels J, Kivisaari L. Thyroid gland: US screening in a random adult population. Radiology. 1991;181:683-7.

68. Lokey JS, Palmer RM, Macfie JA. Unexpected findings during thyroid surgery in a regional community hospital: a 5-year experience of 738 consecutive cases. Am Surg. 2005;71:911-3.

81. Ezzat S, Sarti DA, Cain DR, Braunstein GD. Thyroid incidentalomas. Prevalence by palpation and ultrasonography. Ann Intern Med. 1994;154:1838-40.

69. Roti E, Rossi R, Trasforini G, Bertelli F, Ambrosio MR, Busutti L, et al. Clinical and histological characteristics of papillary thyroid microcarcinoma: results of a retrospective study in 243 patients. J Clin Endocrinol Metab. 2006;91:2171-8.

82. Fama’ F, Cicciu’ M, Lo Giudice G, Sindoni A, Palella J, Piquard A, et al. Pattern of nodal involvement in papillary thyroid cancer: a challenge of quantitative analysis. Int J Clin Exp Pathol. 2015;8:11629-34.

70. Besic N, Zgajnar J, Hocevar M, Petric R. Extent of thyroidectomy and lymphadenectomy in 254 patients with papillary thyroid microcarcinoma: a single-institution experience. Ann Surg Oncol. 2009;16:920-8.

83. Kim J, Bang Y, Lee WJ. Living near nuclear power plants and thyroid cancer risk: A systematic review and meta-analysis. Environ Int. 2016;87:42-8.

71. Bae JS, Chae BJ, Park WC, Kim JS, Kim SH, Jung SS, et al. Incidental thyroid lesions detected by FDG-PET/CT: prevalence and risk of thyroid cancer. World J Surg Oncol. 2009;7:63.

85. Famà F, Cicciù M, Polito F, Cascio A, Gioffré-Florio M, Piquard A, et al. Parathyroid Autotransplantation During Thyroid Surgery: A Novel Technique Using a Cell Culture Nutrient Solution. World J Surg. 2016. In press.

72. Horlocker TT, Hay JE, James EM. Prevalence of incidental nodular thyroid disease detected during high-resolution parathyroid ultrasonography. In: G. Medeiros-Neto, E. Gaitan, editors. Fron-

84. Pearce EN, Braverman LE. Papillary thyroid microcarcinoma outcomes and implications for treatment. J Clin Endocrinol Metab. 2004;89:3710-2.

148

Arch Endocrinol Metab. 2018;62/2

original article

Clinical outcomes of low and intermediate risk differentiated thyroid cancer patients treated with 30mCi for ablation or without radioactive iodine therapy Shirlei Kugler Aiçar Súss1,2, Cleo Otaviano Mesa Jr.2, Gisah Amaral de Carvalho2, Fabíola Yukiko Miasaki2, Carolina Perez Chaves3, Dominique Cochat Fuser3, Rossana Corbo1, Denise Momesso1, Daniel A. Bulzico1, Hans Graf2, Fernanda Vaisman1

ABSTRACT Objective: To retrospectively evaluate the outcomes of patients with low and intermediate risk thyroid carcinoma treated with total thyroidectomy (TT) and who did not undergo radioiodine remnant ablation (RRA) and to compare them to patients receiving low dose of iodine (30 mCi). Subjects and methods: A total of 189 differentiated thyroid cancer (DTC) patients treated with TT followed by 30mCi for RRA or not, followed in two referral centers in Brazil were analyzed. Results: From the 189 patients, 68.8% was ATA low-risk, 30.6% intermediate and 0.6% high risk. Eighty-seven patients underwent RRA and 102 did not. The RRA groups tended to be younger and had a higher frequency of extra-thyroidal extension (ETE). RRA did not have and impact on response to initial therapy neither in low (p = 0.24) nor in intermediate risk patients (p = 0.66). It also had no impact on final outcome and most patients had no evidence of disease (NED) at final follow-up. Recurrence/persistence of disease was found in 1.2% of RRA group and 2% in patients treated only with TT (p = 0.59). Conclusions: Our study shows that in low and intermediate-risk patients, RRA with 30 mCi seems to have no major advantage over patients who did not undergo RRA regarding response to initial therapy in each risk group and also in long term outcomes. Arch Endocrinol Metab. 2018;62(2):149-56 Keywords Thyroid carcinoma; radioiodine ablation; low activity

Serviço de Endocrinologia, Instituto Nacional do Câncer (Inca), Rio de Janeiro, RJ, Brasil 2 Serviço de Endocrinologia, Hospital das Clínicas, Universidade Federal do Paraná (UFPR), Curitiba, PR, Brasil 3 Serviço de Medicina Nuclear, Instituto Nacional do Câncer (Inca), Rio de Janeiro, RJ, Brasil 1

Correspondence to: Fernanda Vaisman Praça da Cruz Vermelha, 23 8º andar, Centro 20230-130 – Rio de Janeiro, RJ, Brasil fevaisman@globo.com Received on Jul/18/2017 Accepted on Nov/8/2017

INTRODUCTION

ver the last decades, the incidence of DTC has increased significantly, especially of tumors smaller than 2 cm (1-3). Despite this, most of these patients have an excellent prognosis and a long followup during their lifetime (4,5). Nevertheless, rarely small tumors can metastasize and have an increased recurrence risk (6-8). Recently, it has been advocated an individualized approach of DTC based on risk stratification (8-11) and a more selective use of RRA (12-15). In this sense, treatment for low-risk tumors tends to be less aggressive than high-risk tumors (16,17). Indeed, the use of RRA in low risk patients remains controversial, Arch Endocrinol Metab. 2018;62/2

because it has not been shown to be beneficial in their management after complete surgical resection in some recent studies (18). More recent guidelines recommend a more careful use of radioiodine (RRA) due to its adverse effects, particularly chronic sialoadenitis and the increased risk of development of a second primary neoplasm (19,20). In this sense, several studies have already shown that RRA with low RRA dose (30 mCi) is as effective as higher activities with excellent correlated remission rates (21-23). Mujammami and cols. summarizes the results of six studies, in which patients responded equally well to low iodine activity for RRA, when compared to higher activities, and the risk category 149

DOI: 10.20945/2359-3997000000025

Radioiodine ablation in thyroid cancer

was not a significant predictor of remission (low, intermediate and some high-risk patients without metastases) (7). However, there are authors who advocate the selective use of iodine, showing that it is not necessary in certain circumstances. In the study by Molinaro and cols., 63.6% of non-ablated low and intermediate risk patients evolved with remission during the follow-up period, without additional therapy, and all of these patients remained in remission through the study (24). Also, Schvartz and cols. failed to prove any benefit of RRA in survival in patients with low-risk DTC after thyroidectomy, reinforcing the idea that they should not be over-treated (22). Durante and cols., showed almost identical clinical response rates for low and intermediate risk patients, between subgroups with and without RRA (4). Similarly, our group had also previously shown that low and intermediate risk patients not treated with RRA had a very low risk of recurrence (25,26). The aim of this study is to retrospectively analyze the follow-up of patients with thyroid carcinoma who were treated with TT and who did not receive RRA and compare them to patients who received a low dose of iodine (30 mCi).

SUBJECTS AND METHODS We retrospectively reviewed the medical records of 189 patients with DTC > 18 years old treated with TT without RRA or with low dose RRA (30 mCi) between 1975 and 2015. We included 61 patients treated in Hospital das Clínicas da Universidade Federal do Paraná (HC-UFPR), Curitiba, Brazil and 128 patients treated in National Cancer Institute (Inca), Rio de Janeiro, Brazil. A minimum of 18 months of followup after initial therapy was required for entry into the study, unless one of the clinical outcomes was reached before that time point. The initial thyroid surgery was total thyroidectomy (TT) in all patients. Therapeutic neck dissections were only performed for clinically apparent abnormal cervical lymphadenopathy, since in both institutions, it is not routinely performed prophylactic neck dissections for DTC. RRA was performed within two to six months after surgery in 87 patients and 102 patients did not receive RRA. RRA therapy was administrated after thyroid hormone withdrawal (TWH) for 30 days or with recombinant human TSH (TSHrh) administration in selected patients, and under a low iodine diet. Pre150

ablation serum TSH, thyroglobulin (Tg) level and thyroglobulin-antibodies (Tg-Ab) titer were obtained in all patients and whole-body scans (WBS) were performed five to ten days after RRA. This study was approved by the local research Ethics Committees.

Follow-up Patients were followed every 6-8 months during the first year and at 6-12 months intervals thereafter at the discretion of the attending physician based on the risk of recurrence of the individual patient and the clinical course of the disease. Routine evaluation included serum TSH, serum Tg, Tg-Ab and neck ultrasound (US). For those patients with suspected local or distant metastasis, other imaging modalities such as computed tomography (CT) scan, or magnetic resonance imaging (MRI) and/or biopsies were performed as needed. Patients were treated and followed by the same group of physicians in each center.

Laboratory studies Serum Tg was measured postoperative and during follow-up in regular bases. We considered postoperative Tg, measurements performed at a minimum of 6-8 weeks after TT, since Tg usually reaches its nadir by 3 to 4 weeks postoperatively (9,15). Trend of non-stimulated Tg was evaluated at the same TSH levels and defined as: stable, decreasing, or increasing (> 20% over baseline). At Inca, from 1977 to 1985, the functional sensitivity of the serum Tg assays was approximately 5 ng/mL. Between 1986 and 1997, a variety of Tg assays was used with functional sensitivities of approximately 1 ng/mL. From 1998 to 2001, a Tg assay with a functional sensitivity of 0.5 ng/L was employed. Starting in 2001 until 2010, serum Tg was quantified by a immunometric assay (Immulite) with a functional sensitivity of 0.2 ng/mL, and from 2010 until today, the functional sensitivity dropped to 0.1 ng/mL. At HC-UFPR, from 1990 to 2004, serum Tg was quantified by a radioimmunoassay assay with a functional sensitivity of 0.9 ng/mL. From 2004 until today, serum Tg was quantified by a chemiluminescence assay with a functional sensitivity of 0.1 ng/mL.

Risk stratification Patients were stratified using the modified ATA 2015 risk stratification system (low or intermediate risk) (15). Arch Endocrinol Metab. 2018;62/2

Radioiodine ablation in thyroid cancer

Clinical outcomes Clinical outcomes were defined as: • No evidence of disease (NED): the absence of suspected images and Tg levels used to classify as excellent response to therapy. • Recurrent/persistent SD, defined as: positive cytology/histology, highly suspicious lymph-nodes or thyroid bed nodules on the US (hyper-vascularity, cystic areas, heterogeneous Arch Endocrinol Metab. 2018;62/2

content, rounded shape and enlargement on follow-up), or cross-sectional imaging highly suspicious for metastatic disease. • Disease specific mortality: death related to the tumor or its treatment. Additional outcomes evaluated were: need for additional therapy during follow-up (additional surgery and/or RRA), clinical outcomes after additional therapy and the trend of non-stimulated Tg after initial therapy without RRA.

Statistical analysis Continuous data is presented as mean and standard deviations with median values. For comparing medians nonparametric Mann-Whitney test was used and for categories we used Chi2 to compare 2 or multiple groups and Fisher’s exact tests. Analysis was performed using SPSS software (Version 20.0 for MAC; SPSS, Inc., Chicago IL).

RESULTS The demographics, clinical features, risk stratification, initial management and clinical outcomes of the 189 patients included in the cohort are presented in Table 1. Considering the entire cohort, TT was performed as initial therapy in all patients, papillary thyroid cancer (PTC) was the most common histology and the majority of patients were female. Fifty-four percent (n = 102) of patients did not receive RRA and 46% (n = 87) did undergo low dose RRA (30 mCi). Patients treated with RRA were younger (49, range 18-86 years in the group without RRA vs 43, range 19-80 years for the RRA group) and microscopic extra-thyroidal extension (ETE) was more frequently observed (29.9% for RRA vs 14.7% without RRA) (p = 0.04 and p = 0.01, respectively). The groups did not differ in tumor size, presence of vascular invasion, lymphnode metastases (N1), tumor multifocality or ATA risk stratification. There was no statistical difference in median postoperative non-stimulated Tg and presence of Tg-Ab between the groups. However, presence of undetectable Tg postoperative during follow-up was significantly different (p < 0.001), observed in 65,7% of the patients treated without RRA and 49,4% of patients treated with low dose RRA. The Tg trend overtime decline in 67,6% of patients treated without RRA and 56,3% patients treated with low dose RRA (p = 0.13). 151

Dynamic risk stratification was performed using the response to therapy assessment during the first 2 years of follow-up previous published by Tuttle and cols. and in the latest ATA guidelines (15,23). In patients treated with RRA, response to therapy were defined as: excellent response to therapy (negative imaging and suppressed Tg < 0.2 ng/mL and stimulated Tg < 1.0 ng/mL); indeterminate response (nonspecific findings on imaging studies, non-stimulated Tg detectable but < 1 ng/mL, stimulated Tg detectable but < 10 ng/mL); biochemical incomplete response (negative imaging and non-stimulated Tg > 1 ng/mL or stimulated Tg > 10 ng/mL); or structural incomplete response to therapy (structural or functional evidence of disease, with any Tg level) (9,15). For patients treated with TT without RRA, response to therapy definitions were: excellent response to therapy (undetectable Tg-Ab, negative imaging and non-stimulated Tg < 0.2 ng/mL or stimulated Tg < 2.0 ng/mL); indeterminate response (stable or declining Tg-Ab and/or nonspecific imaging findings and non-stimulated Tg detectable but 0.25 ng/mL, stimulated Tg detectable but 2-10 ng/mL); biochemical incomplete response (negative imaging and/or increasing Tg with similar TSH levels and/or increasing Tg-Ab and non-stimulated Tg > 5 ng/mL or stimulated Tg > 10 ng/mL); or structural incomplete response to therapy (structural or functional evidence of disease, with any Tg level) (9,11). Tg analysis were considered as following: Post operative undetectable Tg when Tg was below functional sensitivity of the Tg assay used at the time of surgery and to determinate the trend overtime we considered increase if either suppressed or stimulated Tg were rising, decline if both were declining or if one was stable and the other was falling and stable if both were stable. In those patients who did not have stimulated Tg repeated overtime, only suppressed Tg was considered. All of the patients had post operative stimulated Tg measured.

Radioiodine ablation in thyroid cancer

Table 1. Description of the cohort (n = 189) Without RRA (n = 102)

Low dose RRA (30mCi) (n = 87)

p-value

49 (18-86)

43 (19-80)

0.04

Gender-female

93.1% (n = 94)

86.2% (n = 75)

0.09

Histology Papillary thyroid cancer

93.1% (n = 94)

95.4% (n = 83)

0.36

ETE

14.7% (n = 15)

29.9% (n = 26)

0.01

Multifocality

34.3% (n = 35)

39.1% (n = 34)

0.54

1 (0.9-9)

1 (0.3-4.0)

0.21

8.8% (n = 9)

13.8% (n = 12)

0.35

Age

Size (cm) Vascular invasion N1

15.7% (n = 16)

23% (n = 20)

0.26

Post-operative non-stimulated Tg

1.25 (< 0.1-34)

0.77 (< 0.1-15)

0.59

Undetectable post-operative Suppressed Tg

65.7% (n = 67)

49.4% (n = 43)

< 0.001

6.9% (n = 7)

8.0% (n = 7)

0.78

ATA 2016 risk stratification Low Intermediate High

78.4% (n = 80) 20.5% (n = 21) 1% (n = 1)

57.5% (n = 50) 42.5% (n = 37) 0

0.04

Median follow-up (months)

40.5 (1-488)

49.6 (4-321)

0.63

Recurrence/persistence structural disease

1% (n = 1)

1.1% (n = 1)

0.55

Additional therapy

1% (n = 1)

2.3% (n = 2)

0.59

Response to therapy â&#x20AC;&#x201C; first 2 years of follow-up Excellent Indeterminate Biochemical incomplete Structural incomplete

68.6% (n = 70) 26.5% (n = 27) 2.9% (n = 3) 2% (n = 2)

81.6% (n = 71) 13.8% (n = 12) 2.3% (n = 2) 2.3% (n = 2)

0.08

Tg trend over time (suppressed and/or stimulated) Decline

67.6% (n = 69)

56.3% (n = 49)

0.13

Clinical status at final follow-up NED without additional therapy NED after additional therapy Recurrent/persistent of disease after additional therapy Recurrent/persistent of disease without additional therapy Death from disease

98% (n = 100) 1% (n = 1) 0% 1% (n = 1) 0%

98,8% (n = 86) 1.2% (n = 1) 0% 0% 0%

0.59

Positive Anti-Tg

Data are presented percentage (number) or median (range). ETE: microscopic extra thyroid extension; N1: lymph node metastases; Tg: thyroglobulin; Anti-Tg: anti-Tg antibody; ATA: American Thyroid Association; NED: no evidence of disease.

During follow-up, recurrence/persistence of disease was similar between groups, with recurrence/ persistence in 1% of patients not treated with RRA and 1.1% in patients treated with low dose RRA (30mCi) (p = 0.55). The median follow-up was 40.5 and 49.6 months respectively (p = 0.63) (Table 1). In both groups, the majority of patients had an excellent response to initial therapy followed by indeterminate and only few patients had incomplete response, either biochemical or structural. At final follow-up the majority of patients had no evidence of biochemical or structural disease without additional therapy. There were no cases of disease-related deaths. 152

Regarding response to therapy in patients classified as low risk by the ATA risk stratification system (n = 130), excellent response was found in 94 patients and indeterminate response in 30 patients, as presented in the univariate analysis shown in Table 1. Papillary was the most common histology and the majority was female in both groups. Similarly, age and size of tumor were not statistically different among them. The median postoperative non-stimulated Tg was significantly statistically different (0.1 ng/mL in patients with excellent response, ranging from < 0.1 to 3.4 ng/mL vs 1.0 ng/mL in patients with indeterminate response, ranging from < 0.1 to 3.0 ng/mL, Arch Endocrinol Metab. 2018;62/2

Radioiodine ablation in thyroid cancer

p < 0.001). The presence of lymph node metastasis at diagnosis was significantly different (7.4% in excellent response vs 13.3% in indeterminate response vs 66.7% and structural incomplete response, p = 0.04). When patients were analyzed according to their initial risk of recurrence (Tables 2 and 3), RRA treatment did not differ among patients with excellent and indeterminate response to initial therapy. Postoperative nonstimulated Tg was the only predictor of response to therapy in low and intermediate risk groups (Tables 2 and 3). Extrathyroidal extension, present only in the intermediate risk group, did not have impact on response to initial therapy even being more frequent in the group that underwent RRA. Only 3 patients with low risk tumors had a biochemical incomplete response and 3 had structural incomplete within the first 2 years of follow-up. They are shown in Table 4. Also, 3 patients from the intermediate risk group had incomplete responses.

Stands out that the only patient with persistent disease (incomplete structural response) still survives with structural disease because it is a heterogeneous lymph node in the left anterior cervical region, near the sternal, which is suspect because of its characteristics (irregular margins) and size (1.4 x 1.2 x 1.3 cm), remains unchanged for more than one year; as well as without elevation of Tg.

DISCUSSION This study showed that in properly selected low and intermediate risk DTC patients, low activities of RRA did not have a significant impact on response to therapy and also final status of being disease free. Furthermore, in response to initial therapy this difference was also not seen when patients were analyzed according to their initial risk of recurrence separately. Previous studies, Hilo and ESTIMABL, have shown in randomized trials

Table 2. Response to therapy in low risk patients (n = 130) during the first 2 years of follow-up Excellent (n = 94)

Indeterminate (n = 30)

Biochemical incomplete (n = 3)

Structural incomplete (n = 3)

p-value

44.5 (20-86)

45.5 (26-76)

42 (32-57)

53 (39-79)

0.61

Gender-female

89.4% (n = 84)

90% (n = 27)

100% (n = 3)

0.72

Histology Papillary thyroid cancer

91.5% (n = 86)

94.3% (n = 33)

100% (n = 3)

0.88

Post operative non stimulated Tg

LOW RISK Patients Age (years)

0.1 (< 0.1-3.4)

1.0 (< 0.1-3.0)

N/A

< 0.001

Size (cm)

2.0 (0.1-9.0)

1.0 (0.2-6)

1.7 (x-2.0)

1.2 (1.1-1.4)

0.78

7.4% (n = 7)

13.3% (n = 4)

66.7% (n = 2)

0.04

RRA

43.6% (n = 41)

26.7%% (n = 8)

33.3% (n = 1)

0.24

Data are presented as percentage (number) or median (range). Tg: thyroglobulin, N1: lymph node metastases, RRA: radioiodine, N/A: non available.

Intermediate risk patients

Excellent (n = 46)

Indeterminate (n = 9)

Biochemical incomplete (n = 2)

Structural incomplete (n = 1)

p-value

Age (years)

42 (18-69)

36 (34-43)

34.5 (19-50)

0.16

Gender-female

91.9% (42)

66.6% (n = 6)

100% (n = 2)

100% (n = 1)

0.48

97.8% (n = 45)

100% (n = 9)

100% (n = 2)

100% (n = 1)

0.96

< 0.1 (< 0.1-0.5)

0.1 (< 0.1-0.2)

1.4

< 0.01

69.6% (n = 32)

55.5% (n = 5)

100% (n = 2)

100% (n = 1)

0.89

Histology Papillary thyroid cancer Post operative non stimulated Tg ETE Size (cm)

2.1 (1.0-4.7)

2.3 (2.1-3.0)

1.5 (0.6-2.4)

1.4

0.92

37% (n = 17)

22.2% (n = 2)

50% (n = 1)

0.80

RRA

65.2% (n = 30)

44.4% (n = 4)

50% (n = 1)

100% (n = 1)

0.66

Data are presented as percentage (number) or median (range). Tg: thyroglobulin; N1: lymph node metastases; RRA: radioiodine. Arch Endocrinol Metab. 2018;62/2

153

Table 3. Response to therapy in intermediate risk patients (n = 58) during the first 2 years of follow-up

Radioiodine ablation in thyroid cancer

Table 4. Clinical characteristics of differentiated thyroid cancer patients with incomplete response to therapy within the first 2 years of follow-up (biochemical or structural) Pt1

Pt2

Pt3

Pt4

Pt5

Pt6

Pt7

Pt8

Pt9

Age (years)

Gender

Histology

PTC

Size (cm)

1.1

1.2

1.4

1.7

2.0

1,4

2,4

0,6

pN1

Yes

ATA risk

Low

Intermediate

Radioiodine

Yes

Response to therapy

Additional Therapy

Yes

Time to additional Therapy

120

Tg trend overtime

Decline

Stable

Increase

Follow-up (months)

384

139

Status at final follow-up

NED-AT

NED

NED - AT

F: female; SI: structural incomplete; BI: biochemical incomplete; PD: persistent of disease; NED-AT: no evidence of disease-additional therapy; NED: no evidence of disease.

that low activities such as 30mCi are equally effective for low and intermediate risk patients as RRA (12,14). Vaisman and cols., thus, showed that the recurrence rate of properly selected low and intermediate risk DTC patients are very similar in patients who underwent RRA and those followed with no additional therapy after surgery (26). Furthermore, the study by Schvartz and cols., with a 10.3 years follow-up, showed no benefit of RRA after surgery on survival in a large cohort of patients with low-risk DTC (22). In the study by Durante and cols., the rates of complete clinical response were almost identical in the subgroup that received ablation and in the subgroup that did not receive (92.2% and 98.3%, respectively), reinforcing the low impact of RRA in response to therapy (4). In the present study, patients treated with RRA were younger, and microscopic ETE was observed more frequently (p = 0.04 and p = 0.01, respectively). It is known that there is a tendency for an increase in the use of RRA in younger patients; however, most studies fail to show that isolated extra-thyroidal microscopic invasion increases recurrence significantly as an independent factor. Furthermore, the most recent recommendation is to avoid RRA in most patients when this is the only reason to treat with RRA (6). Moreover, in this present study, ETE did not have impact in response to initial therapy in the intermediate risk group, probably being only a factor that have influenced the decision of performing RRA, specially in the past. 154

In recent years, postoperative evaluation is becoming more important in decision making of RRA (13). This present study showed that the presence of undetectable non-stimulated Tg during follow-up was significantly different and more frequent in the non RRA group (p < 0.001), suggesting that independently of initial risk stratification, when postoperative Tg was negative, physicians were confortable to only follow these patients without RRA. Corroborating such findings, Webb and cols. concluded that low pre-ablation Tg should be considered a favorable risk factor in patients with DTC, suggesting that it may perhaps be used to select patients not candidates for RRA (15,27). In the same sense, Momesso and cols. (11) demonstrated that the value of non-stimulated Tg was the greatest predictor of recurrence/persistence of structural disease, which supports previous findings of patients not treated with RRA (10), in whom the decline or stability of non-stimulated Tg presented a good prognosis (18,26,28), being the best response in the first two years of follow-up, comparable to that at any time in the total follow-up of these patients (11). In the same study, there was no disease-specific mortality and low rates of recurrence/persistence of structural disease (11), as also occurred in the on-screen study, in which the majority of patients, more than 97%, had no evidence of disease (NED) at the end of the follow-up without additional therapy and without cases of death by the disease. Arch Endocrinol Metab. 2018;62/2

Radioiodine ablation in thyroid cancer

Arch Endocrinol Metab. 2018;62/2

micro-metastases to lymph nodes. Furthermore, Wang and cols. demonstrated that properly selected patients, even with affected lymph nodes, should not necessarily receive RRA (30,31). It should be noted that the present work has some limitations. As it is a retrospective and non-randomized trial, selection bias based on the assistant physician to perform RRA could occur. However, the basic characteristics are similar in both groups. Furthermore, there were changes in ultrasound technology and Tg assays as mentioned before that could interfere in initial response to therapy classification, however, the most clinically relevant endpoints, which are recurrence, and structural incomplete response is less influenced by Tg values. Other important limitation is the follow â&#x20AC;&#x201C; up period. As known, the majority of the recurrences occur with the first 2-5 years, however, some of those can occur later on. Further prospective studies and with longer follow-up periods are needed to validate our findings. In addition, most of the studies with 30mCi (12,14) evaluate the efficacy of ablation not correlating this with recurrence rates. In our study, we correlate low activities with response to therapy, which is a parameter with well establish correlation with long term prognosis (8,9,10,15). In conclusion, the present study shows that in low and intermediate risk patients, the treatment with 30mCi of radioiodine for ablation might appear to make a difference in response to therapy, however, when longer follow-up is analyzed, RRA activities at ablation seems to have no advantage over patients who did not undergo RRA with long term outcomes. As a secondary endpoint, in these patients an excellent response to treatment may be assured by the postoperative nonstimulated Tg values analyzed as predictors of diseasefree follow-up. Disclosure: no potential conflict of interest relevant to this article was reported.

REFERENCES 1. Janovsky CC, Maciel RM, Camacho CP, Padovani RP, Nakabashi CC, Yang JH, et al. A Prospective Study Showing an Excellent Response of Patients with Low-Risk Differentiated Thyroid Cancer Who Did Not Undergo Radioiodine Remnant Ablation after Total Thyroidectomy. Eur Thyroid J. 2016;5(1):44-9. 2. Brito JP, Hay ID, Morris JC. Low risk papillary thyroid cancer. BMJ. 2014;348:g3045. 3. Welsh L, Powell C, Pratt B, Harrington K, Nutting C, Harmer C, et al. Long-term outcomes following low-dose radioiodide ablation

155

Over time, the trend of Tg values decreased by more than 55% in both groups. At the final follow-up, most patients had no evidence of biochemical or structural disease without additional therapy. In the study by Mujammami and cols., levels of pre-dose ablative Tg and biochemical response to primary therapy predicted favorable outcomes (7), with the majority of patients with elevated Tg levels and incomplete or indeterminate responses progressing to undetectable levels of Tg without further treatment (7). This has already been observed by Vaisman and cols. (10), who concluded that patients with incomplete biochemical response may be reclassified as without evidence of disease, without additional therapy beyond suppression of TSH with LT4. Similarly, Momesso and cols. showed that even patients with indeterminate response to therapy had a good prognosis, with no evidence of structural disease during follow-up, and could be observed conservatively (4,9,11,29). Current second generation Tg assays (0.05-0.1 ng/mL) have shown that patients with lowrisk DTC with undetectable baseline Tg rarely recur (5). In this sense, study published in 2016 by Janovsky (1) concluded that an excellent response to treatment can be confirmed by the trend of Tg and US, these being the best follow-up approaches, showing that the use of RRA only to achieve negative levels of Tg for surveillance is not necessary because it is not an isolated value, but the tendency of Tg during follow-up, the determining factor for both (1). Therefore, based on the above, it should be emphasized that the trend of Tg is highly suggestive of being a predictor of disease-free follow-up. When analyzing the low-risk patients separately, patients with excellent response had lower values of postoperative Tg than patients with indeterminate response. Webb and cols. (27) examined the predictive value of a single dose of serum Tg immediately prior to RRA as a subsequent disease free state and concluded that this evaluation is an inexpensive tool with a high negative predictive value which could be used to select patients not RRA candidates (15,27). The presence of lymph node metastasis at the time of diagnosis was more frequent in those patients with indeterminate response to initial therapy and less frequently in those with excellent response, demonstrating that such presence may negatively interfere in the response to treatment. However, based on current ATA recommendations (15) there is no indication for RRA in low risk patients with up to 5

Radioiodine ablation in thyroid cancer

for differentiated thyroid cancer. J Clin Endocrinol Metab. 2013;98(5):1819-25.

remnant ablation: is there a role for serum thyroglobulin measurement? J Clin Endocrinol Metab. 2012;97(8):2748-53.

4. Durante C, Montesano T, Torlontano M, Attard M, Monzani F, Tumino S, et al. Papillary thyroid cancer: time course of recurrences during postsurgery surveillance. J Clin Endocrinol Metab. 2013;98(2):636-42.

19. Rosario PW, Ward LS, Carvalho GA, Graf H, Maciel RM, Maciel LM, et al. Thyroid nodules and differentiated thyroid cancer: update on the Brazilian consensus. Arq Bras Endocrinol Metabol. 2013;57(4):240-64.

5. Nakabashi CC, Kasamatsu TS, Crispim F, Yamazaki CA, Camacho CP, Andreoni DM, et al. Basal serum thyroglobulin measured by a second-generation assay is equivalent to stimulated thyroglobulin in identifying metastases in patients with differentiated thyroid cancer with low or intermediate risk of recurrence. Eur Thyroid J. 2014;3(1):43-50.

20. Brito JP, Morris JC, Montori VM. Thyroid cancer: zealous imaging has increased detection and treatment of low risk tumours. BMJ. 2013;347:f4706.

6. Lamartina L, Durante C, Filetti S, Cooper DS. Low-risk differentiated thyroid cancer and radioiodine remnant ablation: a systematic review of the literature. J Clin Endocrinol Metab. 2015;100(5):1748-61. 7.

Mujammami M, Hier MP, Payne RJ, Rochon L, Tamilia M. LongTerm Outcomes of Patients with Papillary Thyroid Cancer Undergoing Remnant Ablation with 30 milliCuries Radioiodine. Thyroid. 2016;26(7):951-8.

8. Vaisman F, Tala H, Grewal R, Tuttle RM. In differentiated thyroid cancer, an incomplete structural response to therapy is associated with significantly worse clinical outcomes than only an incomplete thyroglobulin response. Thyroid. 2011;21(12): 1317-22. 9. Momesso DP, Tuttle RM. Update on differentiated thyroid cancer staging. Endocrinol Metab Clin North Am. 2014;43(2):401-21. 10. Vaisman F, Momesso D, Bulzico DA, Pessoa CH, Dias F, Corbo R, et al. Spontaneous remission in thyroid cancer patients after biochemical incomplete response to initial therapy. Clin Endocrinol (Oxf). 2012;77(1):132-8. 11. Momesso DP, Vaisman F, Yang SP, Bulzico DA, Corbo R, Vaisman M, et al. Dynamic Risk Stratification in Patients with Differentiated Thyroid Cancer Treated Without Radioactive Iodine J Clin Endocrinol Metab. 2016;101(7):2692-700. 12. Schlumberger M, Catargi B, Borget I, Deandreis D, Zerdoud S, Bridji B, et al. Strategies of radioiodine ablation in patients with low-risk thyroid cancer. N Engl J Med. 2012;366(18):1663-73. 13. Tuttle RM, Sabra MM. Selective use of RRA for ablation and adjuvant therapy after total thyroidectomy for differentiated thyroid cancer: a practical approach to clinical decision making. Oral Oncol. 2013;49(7):676-83. 14. Mallick U, Harmer C, Yap B, Wadsley J, Clarke S, Moss L, et al. Ablation with low-dose radioiodine and thyrotropin alfa in thyroid cancer. N Engl J Med. 2012;366(18):1674-85. 15. Haugen BR, Alexander EK, Bible KC, Doherty GM, Mandel SJ, Nikiforov YE, et al. 2015 American Thyroid Association Management Guidelines for Adult Patients with Thyroid Nodules and Differentiated Thyroid Cancer: The American Thyroid Association Guidelines Task Force on Thyroid Nodules and Differentiated Thyroid Cancer. Thyroid. 2016;26(1):1-133. 16. Iyer NG, Morris LG,Tuttle RM, Shaha AR, Ganly I. Rising incidence of second cancers in patients with low-risk (T1N0) thyroid cancer who receive radioactive iodine therapy. Cancer. 2011;117(19):4439-46.

17. Cho YY, Lim J, Oh CM, Ryu J, Jung KW, Chung JH, et al. Elevated risks of subsequent primary malignancies in patients with thyroid cancer: a nationwide, population-based study in Korea. Cancer. 2015;121(2):259-68. 18. Durante C, Montesano T, Attard M, Torlontano M, Monzani F, Costante G, et al. Long-term surveillance of papillary thyroid cancer patients who do not undergo postoperative radioiodine

156

21. Castagna MG, Cevenini G, Theodoropoulou A, Maino F, Memmo S, Claudia C, et al. Post-surgical thyroid ablation with low or high radioiodine activities results in similar outcomes in intermediate risk differentiated thyroid cancer patients. Eur J Endocrinol. 2013;169(1):23-9. 22. Schvartz C, Bonnetain F, Dabakuyo S, Gauthier M, Cueff A, Fieffe S, et al. Impact on overall survival of radioactive iodine in low-risk differentiated thyroid cancer patients. J Clin Endocrinol Metab. 2012;97(5):1526-35. 23. Tuttle RM, Tala H, Shah J, Leboeuf R, Ghossein R, Gonen M, et al. Estimating risk of recurrence in differentiated thyroid cancer after total thyroidectomy and radioactive iodine remnant ablation: using response to therapy variables to modify the initial risk estimates predicted by the new American Thyroid Association staging system. Thyroid. 2010;20(12):1341-9. 24. Molinaro E, Giani C, Agate L, Biagini A, Pieruzzi L, Bianchi F, et al. Patients with differentiated thyroid cancer who underwent radioiodine thyroid remnant ablation with low-activity (1)(3)(1)I after either recombinant human TSH or thyroid hormone therapy withdrawal showed the same outcome after a 10-year follow-up. J Clin Endocrinol Metab. 2013;98(7):2693-700. 25. Momesso DP, Vaisman F, Caminha LS, Pessoa CH, Corbo R, Vaisman M. Surgical approach and radioactive iodine therapy for small well-differentiated thyroid cancer. J Endocrinol Invest. 2014;37(1):57-64. 26. Vaisman F, Shaha A, Fish S, Michael Tuttle R. Initial therapy with either thyroid lobectomy or total thyroidectomy without radioactive iodine remnant ablation is associated with very low rates of structural disease recurrence in properly selected patients with differentiated thyroid cancer. Clin Endocrinol (Oxf). 2011;75(1):112-9. 27. Webb RC, Howard RS, Stojadinovic A, Gaitonde DY, Wallace MK, Ahmed J, et al. The utility of serum thyroglobulin measurement at the time of remnant ablation for predicting disease-free status in patients with differentiated thyroid cancer: a meta-analysis involving 3947 patients. J Clin Endocrinol Metab. 2012;97(8): 2754-63. 28. Vaisman F, Momesso D, Bulzico DA, Pessoa CH, da Cruz MD, Dias F, et al. Thyroid Lobectomy Is Associated with Excellent Clinical Outcomes in Properly Selected Differentiated Thyroid Cancer Patients with Primary Tumors Greater Than 1 cm. J Thyroid Res. 2013;2013:398194. 29. Padovani RP, Robenshtok E, Brokhin M, Tuttle RM. Even without additional therapy, serum thyroglobulin concentrations often decline for years after total thyroidectomy and radioactive remnant ablation in patients with differentiated thyroid cancer. Thyroid. 2012;22(8):778-83. 30. Wang LY, Palmer FL, Migliacci JC, Nixon IJ, Shaha AR, Shah JP, et al. Role of RRA in the management of incidental N1a disease in papillary thyroid cancer. Clin Endocrinol (Oxf). 2015. 31. Wang LY, Ganly I. Nodal metastases in thyroid cancer: prognostic implications and management. Future Oncol. 2016;12(7):981-94.

Arch Endocrinol Metab. 2018;62/2

original article

Impact of historic histopathologic sample review on the risk of recurrence in patients with differentiated thyroid cancer Fabián Pitoia1, Fernando Jerkovich1, Carolina Urciuoli1, Florencia Falcón2, Andrea Páes de Lima2

ABSTRACT Objective: To compare the historic risk of recurrence (RR) and response to therapy to risk stratification estimated with historical pathology reports (HPRs) and contemporary re-review of the pathological slides in patients with differentiated thyroid cancer (DTC). Subjects and methods: Out of 210 DTC patients with low and intermediate RR who underwent total thyroidectomy and remnant ablation in our hospital, 63 available historic pathologic samples (HPS) were reviewed. The RR and the response to therapy were evaluated considering historical histological features (histological type, tumor size, capsular invasion, number of lymph node metastases) and then, reassessed after observing additional histological features (vascular invasion, extrathyroidal extension, size of lymph node metastases, presence of extranodal extension, and/or status of the resection margins). Results: A change in the RR category was observed in 16 of 63 cases (25.4%). Out of 46 patients initially classified as low RR, 2 patients were reclassified as intermediate RR, 4 as high RR, and 1 as noninvasive follicular thyroid neoplasm with papillary-like nuclear features (NIFTP). Out of 17 patients initially classified as intermediate RR, 3 were reassigned to the low RR group, 5 as high RR, and 1 as NIFTP.The percentages of structural incomplete response at final follow-up changed from 2.2 to 0% (p = 1) in patients with low RR and from 6.3 to 20% (p = 0.53) in patients with intermediate RR. Conclusion: A detailed report of specific features in the HPR of patients with DTC might give a more accurate RR classification and a better estimation of the response to treatment. Arch Endocrinol Metab. 2018;62(2):157-63

Division of Endocrinology, University of Buenos Aires, Buenos Aires, Argentina 2 Department of Pathology, University of Buenos Aires, Buenos Aires, Argentina 1

Correspondence to: Fabián Pitoia División Endocrinología Hospital de Clínicas, University of Buenos Aires Córdoba 2351, 5th Floor, Buenos Aires 1001, Argentina fpitoia@intramed.net Received on Aug/24/2017 Accepted on Nov/8/2017 DOI: 10.20945/2359-3997000000020

INTRODUCTION

he pathological examination of thyroid samples is important for establishing the diagnosis of differentiated thyroid carcinoma (DTC), and it also provides useful information for the risk stratification assessment (1). On the other side, the TNM AJCC/ UICC staging system is recommended for predicting disease mortality (1). The 2009 version of the American Thyroid Association (ATA) thyroid cancer guidelines proposed a three-tiered risk stratification system in which specific clinical-pathologic features are used to estimate the risk of structural incomplete response (SIR) and the probability of an excellent response to treatment (2). The variables taken into account for risk stratification in the 2009 version of the ATA guidelines were: evidence of microscopic or gross extrathyroidal extension, presence of aggressive histology, completeness of tumor Arch Endocrinol Metab. 2018;62/2

resection, existence of metastatic lymph node/s and/or distant metastasis, and observation of RAI-avid disease outside the thyroid bed (2). In this first ATA risk of recurrence (RR) classification system, many important features were not taken into account. For example, any patient with lymph node metastasis was deemed to have an intermediate RR. In fact, the risk of structural disease can vary from 4% if having fewer than five metastatic lymph nodes, or 5% if all involved lymph nodes are less than 0.2 cm, to 19% if more than five lymph nodes are involved or 27%-32% if any metastasis in the lymph node is larger than 3 cm (3,4). Additionally, follicular thyroid carcinomas (FTCs) with vascular invasion, initially classified by the 2009 ATA system as intermediate RR, have an excellent prognosis when minor vascular invasion is present but may have a high RR (30%-55%) when more than four foci are demonstrated in the pathological examination (5,6). 157

Keywords Risk of recurrence; response to therapy; differentiated thyroid cancer; historic histopathologic review

Pathology review and risk of recurrence

Although the 2009 risk stratification system has proven to be a valuable tool for initial risk stratification in DTC (7-10), modifications were required to better assess the RR of DTC patients. The recently published 2015 version of the ATA guidelines included specific prognostic variables: the extent of vascular invasion, the extent of lymph node involvement (number and size of metastatic lymph nodes and presence of extranodal extension), and mutational status (BRAF and/or TERT when available) (1). As a result, the low risk category was expanded to include patients with small-volume lymph node metastases (clinical N0 or < 5 pathologic N1 micrometastases, < 0.2 cm in the largest dimension), the intermediate RR group now considers only a subset of patients with lymph node metastases (clinical N1 or > 5 pathologic N1 with all involved lymph nodes < 3 cm in the largest dimension), and a second group, with intermediate to high risk of recurrence, now includes those cases with large-volume lymph node involvement (any metastatic lymph node > 3 cm in the largest dimension, > 3 lymph node metastasis with extranodal extension) and FTC with extensive vascular invasion (> 4 foci of vascular invasion or extracapsular vascular invasion). The 2015 guidelines defined this new version of the RR as the “modified risk stratification system from ATA 2009 guidelines” (MRSS ATA 2009) and were validated by our and other groups around the world in ablated and non-ablated patients (11-14). The vascular invasion (≥ or < 4 foci), the magnitude of extrathyroidal extension, the size of the largest metastatic focus in lymph nodes, the presence of extranodal extension, and the status of the resection margins were not uniformly informed in the historic pathologic reports that were used to assess the RR of DTC patients in our hospital and most centers in Latin America, with the exception of the number of lymph node metastases. However, the additional benefit of adding the previously mentioned specific features for reclassifying patients has not yet been established. Therefore, our objective was to compare the historic RR and the responses to treatment to risk stratification systems estimated with historical pathology reports and contemporary re-review of the slides by two expert pathologists.

SUBJECTS AND METHODS Inclusion criteria The file records from our database of 610 patients with DTC were reviewed for the period January 2001 to 158

March 2016. The inclusion criteria were i) to be 18 years old or older, ii) to have had a follow-up for at least 3 years, iii) to have received a total thyroidectomy with or without lymph node dissection and remnant ablation with radioiodine after thyroid hormone withdrawal (THW) or recombinant human thyrotropin (rhTSH). Lymph node dissection was performed when clinical pathological lymph nodes were diagnosed previous to surgery, when the surgeons had a suspicion of lymph node metastasis, or when the size of the thyroid tumor was greater than 4 cm in diameter. Out of 268 patients who met these inclusion criteria, 210 patients with low and intermediate RR were considered for analysis. The RR was assessed as described in Table 1. Because the historic pathological reports did not systematically detail the size of the lymph node metastasis, the extent of extranodal extension, the presence of vascular invasion, or the microscopic invasion of surgical margins, these variables were not taken into account for the initial RR stratification of these patients. The number of metastatic lymph nodes (> 5, intermediate RR, and < 5 low RR), as it was available in the pathological report, was considered for the initial RR classification. Also, as it was validated in a previous analysis from our cohort of DTC patients in our institution, intrathyroidal tumors with minor extrathyroidal extension (T3) were considered in the low RR group (11). One hundred fifteen patients were excluded because they had been operated on in other institutions and the pathological slides were not available in our hospital. Also, 32 patients were excluded due to insufficient histopathological material. Sixty-three low and intermediate RR patients were included in the final analysis. The historic histopathologic samples (HPS) of these 63 patients were reviewed by two senior pathologists from our hospital (P.L.A. and F.F.). The analysis consisted of a first diagnosis provided by F.F. and a re-review and agreement with P.L.A., to give a final homogeneous result.

Pathological analysis The RR was reassessed considering the following variables: histologic variant, number of foci of vascular invasion, volume of lymph node metastases (number of metastatic lymph nodes and size), presence of extranodal extension, and status of the resection margins. The RR classification according to these new histological features can be seen in Table 1. Arch Endocrinol Metab. 2018;62/2

Pathology review and risk of recurrence

Low RR

Classical and follicular variant PTC Minor extrathyroidal extension < 4 foci of vascular invasion < 5 LN metastasis 0.2-3 cm All LN metastasis < 0.2 cm No evidence of extranodal extension

Intermediate RR

Aggressive histology (tall cell, columnar cell, Hürthle cell carcinomas, oncocytic PTC) > 5 LN metastasis 0.2-3 cm Extranodal extension in < 3 LN metastasis

Intermediate-high RR

≥ 4 foci of vascular invasion Extranodal extension in > 3 LN metastasis Any LN > 3 cm Surgical margins involved

RR: risk of recurrence; PTC: papillary thyroid cancer; LN: lymph node.

Patients having an encapsulated follicular variant of papillary thyroid carcinoma (FVPTC) were reclassified as noninvasive follicular thyroid neoplasm with papillarylike nuclear features (NIFTP), currently considered as a benign neoplasm according to the criteria proposed by Nikoforov and cols. (15).

Ablation protocol Patients received radioiodine ablation after stimulation with rhTSH (n = 31) or endogenous TSH (n = 32), using activities of 3.70 GBq (100 mCi 131-I) for low risk (ATA 2009 RR, Table 1) and 5.55 GBq (150 mCi 131-I) for intermediate risk (ATA 2009 RR, Table 1). Endogenous TSH stimulation was obtained after thyroid hormone withdrawal for at least 3 weeks. Radioiodine was administered following that interval, in all cases with TSH levels above 50 mUI/L.

Clinical endpoints The initial response to therapy, defined as the best response to initial therapy assessed at the 12 ± 5 months visit, and the clinical status at final follow-up were evaluated according to the response-to-therapy classification proposed by the ATA 2015 guidelines (2). The initial and final responses were compared to the risk stratification before and after reviewing the pathological samples.

Statistical analysis Quantitative variables were expressed as the mean ± standard error mean, median, and range, while Arch Endocrinol Metab. 2018;62/2

qualitative variables were shown as percentages. To evaluate significant differences in the percentages of the responses-to-therapy before and after the pathologic review, we analyzed two-way contingency tables by the Fisher exact test or 2 x 2 contingency table by the chisquare test when appropriate. Statistical analysis was developed using the SPSS statistical software (SPSS version 20.0, Inc., Chicago, IL, USA). We considered p < 0.05 to be statistically significant for all the analyses.

RESULTS The demographics, clinical features, and MRSS ATA 2009 for each of the 63 patients included in this study are seen in Table 2. Table 2. Baseline characteristics of 63 patients with DTC included in the study Gender Female/Male

58 (92%)/5 (8%)

Age (years) Mean ± SEM Median (range)

48.3 ± 16.1 47 (21.2-76)

Histology PTC classic variant PTC follicular variant PTC oncocytic variant PTC tall cell variant

47 (74.6%) 13 (20.6%) 2 (3.1%) 1 (1.7%)

Cervical lymphadenectomy No Central Central and lateral

18 (28.5%) 40 (63.4%) 5 (9.1%)

Bilaterality, multifocality, and capsular invasion Bilateral Multifocal Capsular invasion

18 (28.5%) 13 (20.6%) 16 (25.3%)

TNM stage I II III

45 (71.4%) 1 (1.7%) 17 (26.9%)

MRSS ATA 2009 before HSR Low Intermediate

46 (73%) 17 (27%)

I Cumulative Dose (mCi) Mean ± SEM Median (range)

230 ± 116 150 (100-350)

131

MRSS ATA 2009: modified risk stratification system from ATA 2009 guidelines; SEM: standard error mean.

The percentages of new specific histological features assessed after the pathological review are detailed in Table 3. 159

Table 1. Risk of recurrence classification considering specific histological features

Pathology review and risk of recurrence

Table 3. Characteristics of initial pathological reports compared with those obtained after histopathological sample review Variable

Informed in initial report

Informed after HSR

Number of foci of vascular invasion (> 4)

Not informed

0/63 (0%)

Surgical margins involved

Not informed

7/63 (11.1%)

Metastatic lymph node size < 0.2 cm 0.2-1 cm > 1 cm < 3 cm > 3 cm

Not informed

Extranodal extension > 3 lymph nodes

Not informed

3/19 (15.7%) 1/19 (5.2%)

Multifocality

18 (28.5%)

Bilaterality

13 (20.6%)

Not informed

0/63 (0%)

16/63 (25.6%) Not informed Not informed

24/63 (38%) 7/63 (11.1%)

6/19 (31.6%) 5/19 (26.3%) 5/19 (26.3%) 3/19 (15.8%)

Necrosis Extrathyroidal extension Minimal Gross (> 1 cm) HSR: histopathological sample review.

After the review of the pathologic slides, a change in the RR category was made in 25.4% (16/63) of the cases. Out of 46 patients initially classified as low RR, 2 patients were reclassified as intermediate RR because of extranodal extension in fewer than 3 lymph nodes, 4 patients were reassigned to the intermediate-high RR group because of surgical margins involved, and 1 patient finally was diagnosed as harboring an NIFTP (Table 4). Out of 17 patients initially classified as intermediate RR, 3 were reassigned to the low RR group (1 because of a change in the histology variant and 2 due to the

presence of micrometastasis in all involved lymph nodes) whereas 5 patients were reclassified to the intermediate-high category (4 because of surgical margins involved and 1 because more than 3 metastatic lymph nodes with extranodal extension were present). Three patients with positive surgical margins also had at least 1 lymph node metastasis > 3 cm in the largest dimension. One patient who initially was assigned to the intermediate RR group was diagnosed as NIFTP (Table 4). Finally, the percentages of initial response to therapy and the final clinical outcomes were compared between the initial RR assessed before and after the pathology slide review. The percentage of SIR at initial evaluation changed from 6.7 to 2.4% (p = 0.6254) in the low risk group and from 12.5 to 20% (p = 0.6171) in the intermediate risk group (Table 5). The frequency of SIR at final follow-up changed from 2.2 to 0% (p = 1) in patients with low RR and from 6.3 to 20% (p = 0.5304) in patients with intermediate RR (Table 6).

DISCUSSION A detailed pathology review of the historic histological samples of 63 DTC patients initially classified as low or intermediate RR by a validated risk stratification system (7-11) demonstrated that, considering specific features (extent of extranodal extension, extent of vascular invasion, and surgical margin evaluation, among others), the change in percentage of SIR at initial and final evaluation did not significantly differ from the statistical point of view. However, adding these

Table 4. Reasons for reclassification of patients after the historic pathology slide review MRSS ATA 2009 Low RR (n = 46)

MRSS ATA 2009 after reviewing the HPS

Reason for changing the RR

Low RR (n = 39) Intermediate RR (n = 2)

n = 1, PTC oncocytic variant (previously classic variant PTC) n = 1, extranodal extension in < 3 LN metastasis

Intermediate-high RR (n = 4)

n = 3, microscopic invasion of surgical margins n = 1, 40% of tumor dedifferentiation

NIFTP (n = 1)

Intermediate RR (n = 17)

Low RR (n = 3)

n = 1, classic PTC (previously PTC tall cell variant) n = 2, all LN metastasis < 0.2 cm

Intermediate RR (n = 8) Intermediate-high RR (n = 5)

n = 4, microscopic invasion of surgical margins (n = 3 of them with LN metastasis > 3 cm) n = 1, extranodal extension in > 3 LN metastases

NIFTP (n = 1) MRSS ATA 2009: modified risk stratification system from ATA 2009 guidelines; RR: risk of recurrence; NIFTP: noninvasive follicular thyroid neoplasm with papillary-like nuclear features; HPS: historic pathology slide; PTC: papillary thyroid carcinoma; LN: lymph node.

160

Arch Endocrinol Metab. 2018;62/2

Pathology review and risk of recurrence

Table 5. Comparison of the initial response to therapy to risk of recurrence assessed before and after HPS review Initial response to therapy (n = 61)a MRSS ATA 2009 Low RR (n = 45) Intermediate RR (n = 16) MRSS ATA 2009 after HPS reviewa Low RR (n = 42) Intermediate RR (n = 10) Intermediate-high RR (n = 9)

Excellent

Indeterminate

Biochemical incomplete

Structural incomplete

27 (60%) 6 (37.5%)

14 (31.1%) 4 (25%)

1 (2.2%) 4 (25%)

3 (6.7%) 2 (12.5%)

30 (71.4%)b 4 (40%)c 3 (33.3%)

10 (23.8%) 0 (0%) 1 (11.1%)

1 (2.4%) 4 (40%) 3 (33.3%)

1 (2.4%)b 2 (20%)c 2 (22.3%)

MRSS ATA 2009: modified risk stratification system from ATA 2009 guidelines; RR: risk of recurrence; NIFPT: noninvasive follicular thyroid neoplasm with papillary-like nuclear features; HPS: historic pathology slide. a n = 2 patients reclassified as NIFTP were excluded from the analysis. They both had an initial excellent response. b Comparison between risk of recurrence classification before and after historic pathology slide review in low risk patients: excellent response (60% vs. 71.4%, p = 0.3668), structural incomplete response (6.7% vs. 2.4%, p = 0.6171). c Comparison between risk of recurrence classification before and after historic pathology slide review in intermediate risk patients: excellent response (37.5% vs. 40%, p = 1), structural incomplete response (12.5% vs. 20%, p = 0.6254).

Table 6. Comparison of the final response to therapy between risk of recurrence assessed before and after HPS review Final response to therapya (n = 61) Excellent

Indeterminate

Biochemical incomplete

Structural incomplete

MRSS ATA 2009 Low RR (n = 45) Intermediate RR (n = 16)

31 (68.9%) 7 (43.7%)

12 (26.7%) 6 (37.5%)

1 (2.2%) 2 (12.5%)

1 (2.2%) 1 (6.3%)

MRSS ATA 2009 after HPS reviewa Low RR (n = 42) Intermediate RR (n = 10) Intermediate-high RR (n = 9)

31 (73.8%)b 3 (30%)c 3 (33.33%)

10 (23.8%) 3 (30%) 3 (33.33%)

1 (2.4%) 2 (20%) 3 (33.33%)

0 (0%)b 2 (20%)c 0 (0%)

new variables to the RR classification might confer a more accurate estimation of the probability of having an SIR at final follow-up. This frequency was 6.3% in the intermediate RR group previous to the pathologic review and 20% after adding specific histological data, which is more similar to what it was reported by larger cohorts of DTC patients (21%–34%) (7-11). Also, the excellent response at final outcome was achieved in 68.9% of low RR patients, but when patients were reclassified after the pathologic review, this percentage rose to 73.8% (without statistical difference). Two patients from this cohort were diagnosed with the encapsulated variant of follicular thyroid carcinoma, which is currently known as NIFTP (15,16). These tumors are characterized by a follicular growth pattern Arch Endocrinol Metab. 2018;62/2

without papillae formation, nuclear features of papillary thyroid carcinoma, encapsulation or clear demarcation, and no vascular or capsular invasion (15). They are associated with an indolent behavior and a very low risk of adverse outcome (15). The encapsulated forms of the follicular variant of PTC also have a distinct molecular profile, harboring predominantly RAS mutations in contrast with the more frequent BRAF mutations in the infiltrative forms (17,18). Currently, NIFTP is assumed to represent nearly two-thirds of the follicular variant PTCs (15,19,20). Although the ATA 2015 task force has recently proposed that this neoplasm with very low potential for recurrence should be reclassified as a non-cancer (16), and the 2 patients with NIFTP from our cohort had an excellent response to therapy 161

MRSS ATA 2009: modified risk stratification system from ATA 2009 guidelines; RR: risk of recurrence; NIFTP: noninvasive follicular thyroid neoplasm with papillary-like nuclear features; HPS: historic pathology slide. Follow-up of the entire cohort (months): mean 42.6 ± 3.3, median 39.3 (range 36.1-67.9). a 2 patients reclassified as NIFPT were excluded from the analysis. They had excellent response at final outcome (36 and 38 months of follow-up). b Comparison between risk of recurrence classification before and after historic pathology slide review in low risk patients: excellent response (68.9% vs. 73.8%, p = 0.6431), structural incomplete response (2.2% vs. 0%, p = 1). c Comparison between risk of recurrence classification before and after historic pathology slide review in intermediate risk patients: excellent response (43.5% vs. 30%, p = 0.6913), structural incomplete response (6.3% vs. 20%, p = 0.5304).

Pathology review and risk of recurrence

(both treated with total thyroidectomy and radioiodine ablation), isolated cases of distant metastasis have been reported (21-23). It is noteworthy that 4 patients initially classified as having a low RR were reassigned to the intermediatehigh RR group. Although it is difficult to draw a conclusion with this small cohort of patients (n = 9), this subgroup of patients showed 22% of SIR at initial evaluation, similar to what is expected in the intermediate RR group of patients (7-11). Indeed, all of them achieved an excellent response at final follow-up. Therefore, it seems that the presence of surgical margins involved in the microscopic analysis, the presence of extranodal extension in more than 3 metastatic lymph nodes, and < 50% of tumor dedifferentiation would probably have less impact on the percentage of SIR than the macroscopic invasion of tumor into the perithyroidal soft tissues or the presence of distant metastasis (1,7-10). It seems that, in the absence of extrathyroidal extension in small primary tumors, the positive margin status does not appear to be a poor prognostic indicator for local recurrence and has an excellent local recurrence-free survival, comparable to those with negative margins, at least in patients who received radioiodine remnant ablation, as it happened in our cohort (24). The presence of vascular invasion is recognized as a variable that has a negative impact on the RR (2527), and it should be informed in the pathological report. It is diagnosed as a direct tumor extension into the blood vessel lumen typically attached to the wall and covered by a fibrin thrombus (27). Minor vascular invasion (small number of foci confined to intracapsular vessels) appears to have a low risk of SIR (less than 5%) (28-30). On the contrary, more than 4 foci of vascular invasion are associated with a poor prognosis, mainly in follicular carcinomas (30-32). This situation seems to be uncommon in papillary carcinomas, even more in micro PTC, with a prevalence of less than 4% (25,26,28,33-35). In fact, none of the 63 patients from our cohort had vascular invasion in more than 4 foci in the pathological review. In our cohort, we considered the oncocytic variant of PTC as an aggressive histology such as columnar cell and tall cell subtypes. The oncocytic change in PTC patients was reported to have a higher recurrence rate than PTC patients without oncocytic change (30.8% vs. 11.7%) (36). 162

One limitation of this study is the low number of patients in each RR group, which could have limited the statistical analysis. Given 2.2% and 0% SIR in the low risk groups and 6.3 and 20% SIR in the intermediate risk groups, a type I error of 5% (two-sided), and an interval confidence of 95%, a total of 966 low risk patients and 218 intermediate risk patients would have to be included to achieve a statistical power of at least 80%. It is necessary to validate these results in larger cohorts of patients. Another limitation is that every single patient in our cohort, even those classified as low risk, was treated with total thyroidectomy and RAI, a common practice in the past in most countries of Latin America (37). Currently, this practice of care may not apply to many institutions where low risk patients do not receive remnant ablation, including in our hospital (14). Therefore, further analysis is necessary to validate our results in low risk patients who do not receive RAI. In conclusion, a detailed report of specific features in the HPR of patients with DTC might give a more accurate RR classification and a better estimation of the response to treatment. If these data are not available, the RR can also be estimated, but the expected SIR might be slightly different, although not statistically significant, as we could see in our analysis. Disclosure: no potential conflict of interest relevant to this article was reported.

Pathology review and risk of recurrence

6. Huang CC, Hsueh C, Liu FH, Chao TC, Lin JD. Diagnostic and therapeutic strategies for minimally and widely invasive follicular thyroid carcinomas. Surg Oncol. 2011;20(1):1-6. 7. Tuttle RM, Tala H, Shah J, Leboeuf R, Ghossein R, Gonen M, et al. Estimating risk of recurrence in differentiated thyroid cancer after total thyroidectomy and radioactive iodine remnant ablation: using response to therapy variables to modify the initial risk estimates predicted by the new American Thyroid Association staging system. Thyroid. 2010;20(12):1341-9. 8. Vaisman F, Momesso D, Bulzico DA, Pessoa CH, Dias F, Corbo R, et al. Spontaneous remission in thyroid cancer patients after biochemical incomplete response to initial therapy. Clin Endocrinol (Oxf). 2012;77(1):132-8. 9. Castagna MG, Maino F, Cipri C, Belardini V, Theodoropoulou A, Cevenini G, et al. Delayed risk stratification, to include the response to initial treatment (surgery and radioiodine ablation), has better outcome predictivity in differentiated thyroid cancer patients. Eur J Endocrinol. 2011;165(3):441-6. 10. Pitoia F, Bueno F, Urciuoli C, Abelleira E, Cross G, Tuttle RM. Outcomes of patients with differentiated thyroid cancer risk-stratified according to the American thyroid association and Latin American thyroid society risk of recurrence classification systems. Thyroid. 2013;23(11):1401-7. 11. Pitoia F, Jerkovich F, Urciuoli C, Schmidt A, Abelleira E, Bueno F, et al. Implementing the Modified 2009 American Thyroid Association Risk Stratification System in Thyroid Cancer Patients with Low and Intermediate Risk of Recurrence. Thyroid. 2015;25(11):1235-42. 12. Momesso DP, Vaisman F, Yang SP, Bulzico DA, Corbo R, Vaisman M, et al. Dynamic Risk Stratification in Patients with Differentiated Thyroid Cancer Treated Without Radioactive Iodine. J Clin Endocrinol Metab. 2016;101(7):2692-700. 13. Park S, Kim WG, Song E, Oh HS1, Kim M, Kwon H, et al. Dynamic Risk Stratification for Predicting Recurrence in Patients with Differentiated Thyroid Cancer Treated Without Radioactive Iodine Remnant Ablation Therapy. Thyroid. 2017;27(4):524-530. 14. Abelleira E, Bueno F, Smulever A, Pitoia F. Riesgo dinámico en pacientes con cáncer diferenciado de tiroides no ablacionados. Rev Argent Endocrinol Metab. 2017;54(2):69-75. 15. Nikiforov YE, Seethala RR, Tallini G, Baloch ZW, Basolo F, Thompson LD, et al. Nomenclature Revision for Encapsulated Follicular Variant of Papillary Thyroid Carcinoma: A Paradigm Shift to Reduce Overtreatment of Indolent Tumors. JAMA Oncol. 20161;2(8):1023-9. 16. Haugen BR, Sawka AM, Alexander EK, Bible KC, Caturegli P, Doherty GM, et al. American Thyroid Association Guidelines on the Management of Thyroid Nodules and Differentiated Thyroid Cancer Task Force Review and Recommendation on the Proposed Renaming of Encapsulated Follicular Variant Papillary Thyroid Carcinoma Without Invasion to Noninvasive Follicular Thyroid Neoplasm With Papillary-Like Nuclear Features. Thyroid. 2017;27(4):481-3. 17. Rivera M, Ricarte-Filho J, Knauf J, Shaha A, Tuttle M, Fagin JA, et al. Molecular genotyping of papillary thyroid carcinoma follicular variant according to its histological subtypes (encapsulated vs infiltrative) reveals distinct BRAF and RAS mutation patterns. Mod Pathol. 2010;23(9):1191-200. 18. Howitt BE, Jia Y, Sholl LM, Barletta JA. Molecular alterations in partially-encapsulated or well-circumscribed follicular variant of papillary thyroid carcinoma. Thyroid. 2013;23(10):1256-62. 19. Liu J, Singh B, Tallini G, Carlson DL, Katabi N, Shaha A, et al. Follicular variant of papillary thyroid carcinoma: a clinicopathologic study of a problematic entity. Cancer. 2006;107(6):1255-64. Arch Endocrinol Metab. 2018;62/2

20. Piana S, Frasoldati A, Di Felice E, Gardini G, Tallini G, Rosai J. Encapsulated well-differentiated follicular-patterned thyroid carcinomas do not play a significant role in the fatality rates from thyroid carcinoma. Am J Surg Pathol. 2010;34(6):868-72. 21. Baloch ZW, LiVolsi VA. Encapsulated follicular variant of papillary thyroid carcinoma with bone metastases. Mod Pathol. 2000;13(8):861-5. 22. Hunt JL, Dacic S, Barnes EL, Bures JC. Encapsulated follicular variant of papillary thyroid carcinoma. Am J Clin Pathol. 2002;118(4):602-3. 23. Baloch ZW, Shafique K, Flannagan M, Livolsi VA. Encapsulated classic and follicular variants of papillary thyroid carcinoma: comparative clinicopathologic study. Endocr Pract. 2010;16(6):952-9. 24. Wang LY, Ghossein R, Palmer FL, Nixon IJ, Tuttle RM, Shaha AR, et al. Microscopic Positive Margins in Differentiated Thyroid Cancer Is Not an Independent Predictor of Local Failure. Thyroid. 2015;25(9):993-8. 25. Falvo L, Catania A, D’Andrea V, Marzullo A, Giustiniani MC, De Antoni E. Prognostic importance of histologic vascular invasion in papillary thyroid carcinoma. Ann Surg. 2005;241(4):640-6. 26. Gardner RE, Tuttle RM, Burman KD, Haddady S, Truman C, Sparling YH, et al. Prognostic importance of vascular invasion in papillary thyroid carcinoma. Arch. Otolaryngol. Arch Otolaryngol Head Neck Surg. 2000;126(3):309-12. 27. Mete O, Asa SL. Pathological definition and clinical significance of vascular invasion in thyroid carcinomas of follicular epithelial derivation. Mod Pathol. 2011;24(12):1545-52. 28. Wreesmann VB, Nixon IJ, Rivera M, Katabi N, Palmer F, Ganly I, et al. Prognostic value of vascular invasion in well-differentiated papillary thyroid carcinoma. Thyroid. 2015;25(5):503-8. 29. Nikiforov YE, Ohori NP. Papillary carcinoma. In: Nikiforov YE, Biddinger PW, Thompson LDR (eds.). Diagnostic Pathology and Molecular Genetics of the Thyroid. 1st edition. Philadelphia, PA: Lippincott. 2012. p. 183-262. 30. Brennan MD, Bergstralh EJ, van Heerden JA, McConahey WM. Follicular thyroid cancer treated at the Mayo Clinic, 1946 through 1970: initial manifestations, pathologic findings, therapy, and outcome. Mayo Clin Proc. 1991;66(1):11-22. 31. Collini P, Sampietro G, Pilotti S. Extensive vascular invasion is a marker of risk of relapse in encapsulated non-Hürthle cell follicular carcinoma of the thyroid gland: a clinicopathological study of 18 consecutive cases from a single institution with a 11-year median follow-up. Histopathology. 2004;44(1):35-9. 32. Nishida T, Katayama Si, Tsujimoto M. The clinicopathological significance of histologic vascular invasion in differentiated thyroid carcinoma. Am J Surg. 2002;183(1):80-6. 33. Akslen LA, Myking AO, Salvesen H, Varhaug JE. Prognostic importance of various clinicopathological features in papillary thyroid carcinoma. Eur J Cancer. 1992;29A(1):44-51. 34. Simpson WJ, McKinney SE, Carruthers JS, Gospodarowicz MK, Sutcliffe SB, Panzarella T. Papillary and follicular thyroid cancer. Prognostic factors in 1,578 patients. Am J Med. 1987;83(3):479-88. 35. Mai KT, Khanna P, Yazdi HM, Perkins DG, Veinot JP, Thomas J, et al. Differentiated thyroid carcinomas with vascular invasion: a comparative study of follicular, Hürthle cell and papillary thyroid carcinoma. Pathology. 2002;34(3):239-44. 36. Hong JH, Yi HS, Yi S, Kim HW, Lee J, Kim KS. Implications of oncocytic change in papillary thyroid cancer. Clin Endocrinol (Oxf). 2016;85(5):797-804. 37. Pitoia, F., Ward, L., Wohllk, N., Friguglietti, C., Tomimori, E., Gauna, A., Camargo, R., Vaisman, M., Harach, R., Munizaga, F., Corigliano, S., Pretell, E., Niepomniszcze, H.: Recommendations of the Latin American Thyroid Society on diagnosis and management of differentiated thyroid cancer. Arq Bras Endocrinol Metabol. 2009;53:884-7.

163

of 18 consecutive cases from a single institution with a 11-year median follow-up. Histopathology. 2004;44(1):35-9.

original article

Dynamic changes of central thyroid functions in the management of Cushing’s syndrome Sema Ciftci Dogansen¹, Gulsah Yenidunya Yalin¹, Bulent Canbaz1, Seher Tanrikulu1, Sema Yarman¹

ABSTRACT Objective: The aim of this study was to determine the frequency of central thyroid dysfunctions in Cushing’s syndrome (CS). We also aimed to evaluate the frequency of hyperthyroidism due to the syndrome of the inappropriate secretion of TSH (SITSH), which was recently defined in patients with insufficient hydrocortisone replacement after surgery. Materials and methods: We evaluated thyroid functions (TSH and free thyroxine [fT4]) at the time of diagnosis, during the hypothalamopituitary-adrenal axis recovery, and after surgery in 35 patients with CS. The patients were separated into two groups: ACTH-dependent CS (group 1, n = 20) and ACTH-independent CS (group 2, n = 15). Patients’ clinical and laboratory findings were evaluated in five visits in the outpatient clinic of the endocrinology department. Results: The frequency of baseline suppressed TSH levels and central hypothyroidism were determined to be 37% (n = 13) and 26% (n = 9), respectively. A negative correlation was found between baseline cortisol and TSH levels (r = -0.45, p = 0.006). All patients with central hypothyroidism and suppressed TSH levels showed recovery at the first visit without levothyroxine treatment. SITSH was not detected in any of the patients during the postoperative period. No correlation was found between prednisolone replacement after surgery and TSH or fT4 levels on each visit. Conclusion: Suppressed TSH levels and central hypothyroidism may be detected in CS, independent of etiology. SITSH was not detected in the early postoperative period due to our adequate prednisolone replacement doses. Arch Endocrinol Metab. 2018;62(2):164-71

¹ Istanbul University, Istanbul Faculty of Medicine, Department of Internal Medicine, Division of Endocrinology and Metabolism, Istanbul, Turkey Correspondence to: Sema Ciftci Dogansen Istanbul University, Istanbul Faculty of Medicine, Department of Internal Medicine, Division of Endocrinology and Metabolism, Capa, 34090 – Istanbul, Turkey sdogansen@gmail.com Received on Jun/16/2017 Accepted on Jul/11/2017 DOI: 10.20945/2359-3997000000019

Keywords Cushing’s syndrome; thyroid dysfunction; syndrome of inappropriate secretion of TSH; endogenous hypercortisolemia; central hypothyroidism

INTRODUCTION

he major regulators of TSH secretion are commonly known as the stimulation effect of TRH and the negative feedback of the fT4 and fT3. However several factors such as dopamine and somatostatin, also play a role in the modulation of TSH secretion and the secretion pattern demonstrates a diurnal rhythm via these regulators (1). The hypothalamus-pituitary-thyroid (HPT) axis may be altered in Cushing’s syndrome (CS). Both endogenous CS and exogenous hypercortisolism suppress serum TSH levels (2-10). Hypercortisolemia decreases the TSH pulse amplitude and nocturnal surge without causing any changes in the TSH pulse frequency (4-6,8). Furthermore, many studies have indicated that hypercortisolemia blunts the TSH response to TRH (2,4,10-12). TSH suppression in hypercortisolemia is most likely related to decreased TRH gene expression 164

(13). However, the presence of hypercortisolemia may also decrease TSH secretion by having a direct effect on the pituitary thyrotropin cells through annexin-1, somatostatin, leptin, and dopamine (4,14-17). Another possible mechanism in the TSH suppression of glucocorticoids is the type 2 deiodinase enzyme activity that converts T4 to T3 in the hypothalamus and pituitary. The local T3 levels in the hypothalamus and pituitary are also important in the regulation of the HPT axis. Increased type 2 deiodinase activity due to glucocorticoids causes increased local T3 levels which eventually leads to the suppression of TRH and TSH secretion (18,19). In addition, central hypothyroidism with reduced fT4 may be present in patients with hypercortisolism (6,7). Mathioudakis and cols. (7) reported that central hypothyroidism can be seen in patients with ACTH-secreting pituitary microadenomas with a prevalence as high as 18%. Arch Endocrinol Metab. 2018;62/2

Recently, the syndrome of the inappropriate secretion of TSH (SITSH) was reported as a clinical condition with the presence of normal or elevated TSH secretion despite inappropriately high levels of thyroid hormones in patients who receive insufficient hydrocortisone replacement following surgery for CS (19). Furthermore, SITSH is considered as the main cause of steroid withdrawal syndrome (SWS) (20). In light of these reports, we aimed to determine the frequency of central thyroid dysfunctions in patients who underwent endogenous hypercortisolism. We evaluated thyroid function tests at baseline in the time of CS diagnosis and during the period of hypothalamopituitary-adrenal (HPA) axis recovery following surgery for CS and at remission.

MATERIALS AND METHODS This is a retrospective observational study from a university hospital outpatient clinic. We identified the patients (n = 35) with a confirmed diagnosis of CS who had a record of thyroid function tests during the past 10 years. All of the procedures were applied in accordance with the Declaration of Helsinki. The diagnosis of CS was based on the clinical and radiological findings (pituitary adenoma, adrenal adenoma, or bronchial carcinoid tumor confirmed by sellar or abdominal magnetic resonance imaging [MRI], lung computed tomography [CT] or ocreotide scintigraphy) and laboratory tests. The diagnosis of CS was confirmed by failure to suppress plasma cortisol levels after the administration of 1-mgovernight and low-dose dexamethasone suppression tests (48 hours, 2 mg/day) in accordance with the current guideline (21). A definitive diagnosis of Cushing’s disease (CD) was made with positive immunostaining for the ACTH of the pituitary adenoma and clinical cortisol dependency for several months after adenomectomy. The diagnosis of ectopic ACTH syndrome (EAS) was based on high plasma ACTH levels, the presence of a lung lesion on high-resolution CT scanning or ocreotide scintigraphy, histological confirmation of the tumor with positive immunostaining for ACTH, and clinical cortisol dependency during the follow-up period after tumor resection. The diagnosis of primary adrenal CS was based on the absence or diminished dexamethasone suppression of serum cortisol, a low or undetectable plasma ACTH concentration, the presence of a unilateral adrenal adenoma on CT or MRI scanning, and histological confirmation of the adenoma. Arch Endocrinol Metab. 2018;62/2

Patients with known thyroid disease at the time of CS diagnosis, patients who developed thyroid disease (including autoimmune thyroid disease) during followup, and patients who were on drugs known to alter thyroid functions were excluded. Macroadenoma (≥ 10 mm) of the pituitary, a history of conventional radiotherapy (RT) for the pituitary, and the development of hypopituitarism after pituitary surgery were also among the exclusion criteria of the study. Among the patients who underwent pituitary surgery, adrenalectomy, or bronchial carcinoid resection, those who fulfilled the initial surgical remission criteria were included. Patients with a residual tumor after an unsuccessful initial operation or late relapse were excluded. Initial surgical remission was defined as morning serum cortisol levels less than 2 µg/dL within a week of cortisol-secreting tumor resection. Late remission was defined as cortisol suppression with a 1-mg-overnight dexamethasone test following HPA axis recovery and the discontinuation of a glucocorticoid (prednisolone) replacement. HPA axis recovery was evaluated by using morning cortisol and/or ACTH stimulation tests. Prednisolone replacement was discontinued when morning plasma cortisol levels were ≥ 10 µg/ dL or stimulated cortisol levels were approximately ≥ 18 µg/dL with ACTH stimulation test (22). Prednisolone replacement was gradually tapered and discontinued following HPA axis recovery. We analyzed the correlation of serum cortisol with TSH and fT4 levels with in patients who had hypercortisolism due to CD (n = 17); EAS (n = 3); or primary-adrenal CS (n = 15). Comparisons were conducted before and after the remission with surgical treatment to evaluate the changes in TSH and fT4 due to the aberrations in the HPT axis. Serum cortisol, TSH (0.27-4.2 µU/Ml, intra-assay CV = 3.8%, inter-assay CV = 1.4%) and fT4 (12-22 pmol/L, intra-assay CV = 2.1%, inter-assay CV = 1.7%) levels were measured using an electrochemiluminescent immunoassay (Roche Hitachi). Serum ACTH (0-46 pg/mL, intra-assay CV: < 10%, inter-assay CV: < 10%) levels were measured using a chemiluminescence immunoassay (Immulite 2000). Sex, age at diagnosis, mean duration of CS, duration of follow-up, baseline cortisol, ACTH, TSH, and fT4 levels, and the baseline adenoma diameter were evaluated retrospectively for each patient. Serum cortisol levels were recorded in the early postoperative 165

Central thyroid dysfunctions in Cushing’s syndrome

period. Patients’ clinical findings and laboratory tests were evaluated in a total of five visits; the first visit was between the first and the third month; the second visit was at the sixth month; the third visit was at the 12th month; the fourth visit was at the time of HPA axis recovery; and the fifth visit was the last visit of the follow-up period. Cortisol, TSH, fT4, and the prednisolone replacement dose (for patients who were on prednisolone replacement) were recorded during each visit. ACTH-dependent (group 1) and ACTHindependent (group 2) CS patients were compared in terms of the baseline characteristics and thyroid function tests during follow-up. Statistical analyses were performed using SPSS version 21.0. Categorical variables were defined by frequency and percentage rate, and numeric variables by mean ± standard deviation (SD). In dual independent group comparisons, the student’s t test was used for normally distributed continuous variables, and the Mann-Whitney U test for non-normally distributed data. Categorical variables were compared using the chisquare test. Correlation analyses were performed using the Pearson correlation test. Statistical significance was set at p < 0.05. Ranges of the correlation r value were accepted as 0-0.24 weak, 0.25-0.49 moderate, 0.500.74 strong, and 0.74-1.00 very strong.

RESULTS Thirty-five patients (28 female and seven male; mean age at diagnosis of 37.2 ± 11.4 years; range of 17-61 years) were included in the study. The mean followup time was 57.1 ± 27.6 months (range of, 21-114 months). The mean duration of CS was 2.7 ± 1.5 years (range of, 1-7 years). Group 1 consisted of bronchial

carcinoid tumors (n = 3, 8%) and CD (n = 17, 49%) and group 2 consisted of cortisol-secreting adrenal adenomas (n = 15, 43%). The mean cortisol, TSH, and fT4 levels at the initial assessment are shown in Table 1. The frequencies of baseline-suppressed TSH levels and central hypothyroidism were determined to be 37% (13/35) and 26% (9/35), respectively. The diagnosis of patients with central hypothyroidism were CD (n = 3), EAS (n = 2), and primary adrenal CS (n = 4). The baseline cortisol levels correlated negatively with the baseline TSH levels (r = -0.45, p = 0.006). However, no correlation was found between the baseline cortisol and fT4 levels (p = 0.183). In addition, no differences were found between the baseline cortisol levels of patients with and without central hypothyroidism (p = 0.218). The mean postoperative early cortisol levels of the patients were 0.7 ± 0.6 µg/dL (range of, 0.1-1.8 µg/dL). Thus, all of the patients achieved remission after surgery, and prednisolone replacement was initiated. All of the patients with central hypothyroidism were recorded as euthyroid on the first visit without the replacement of levothyroxine. The mean cortisol, TSH, and fT4 levels and prednisolone replacement dose (for patients who were on prednisolone replacement) during each visit are shown in Table 1. No correlation was found between prednisolone replacement and TSH or fT4 levels during each visit (p > 0.05). The mean HPA axis recovery time was 16.2 ± 13.2 months (range of 7-60 months). TSH levels during the last visit were significantly higher than the baseline TSH levels, and no differences in the fT4 levels were found between baseline and the last visit (p = 0.003, p = 0.295, respectively). Changes in the TSH and FT4 levels during follow-up are shown in Figure 1. In group 1, the mean diameter of the pituitary adenoma was 5.9 ± 1.6 mm (range, of 3-9 mm), and the

Table 1. The mean cortisol, TSH, fT4 levels and prednisolone replacement dose* on each visit Prednisolone replacement dose* (mg/day) mean ± SD (range)

Cortisol levels (µg/dL) mean ± SD (range)

TSH levels (µU/mL) mean ± SD (range)

Baseline

26.3 ± 8.7 (13-46)

0.8 ± 0.7 (0.1-2.9)

13.8 ± 2.7 (9.3-19.7)

First visit

0.9 ± 1.1 (0.1-4.7)

2.1 ± 1.2 (0.5-4.7)

15.9 ± 2.2 (12.8-20.7)

7.3 ± 1.5 (5-10)

Second visit

2.9 ± 2.8 (0.1-8.3)

2.4 ± 1.3 (0.3-1.8)

15.1 ± 1.8 (12.4-18.6)

4.6 ± 1.5 (2.5-7.5)

Third visit

8.9 ± 5.8 (0.3-18.6)

2.7 ± 1.2 (0.5-4.8)

15.2 ± 1.3 (12.5-18.1)

3.6 ± 1.1 (2.5-5)

Fourth visit

13.2 ± 1.7 (10.4-16.9)

2.5 ± 1.2 (0.7-4.8)

15.1 ± 1.6 (12.7-19.1)

15.3 ± 2.9 (10.7-21)

2.3 ± 1.1 (0.9-4.7),

15.6 ± 1.8 (12.1-20)

Fifth visit

fT4 levels (pmol/L) mean ± SD (range)

*: Prednisolone replacement doses were revised for patients who were receiving prednisolone replacement after surgical treatment. Baseline: at initial assessment, First visit: Between the 1st and the 3rd months; Second visit: On the 6th month; Third visit: On the 12th month; Fourth visit: At the time of HPA axis recovery; Fifth visit: Last visit of the follow-up period.

166

Arch Endocrinol Metab. 2018;62/2

Central thyroid dysfunctions in Cushing’s syndrome

mean baseline ACTH level was 66.6 ± 33.8 pg/mL (range of, 16-155 pg/mL). No correlation was found between the baseline TSH and ACTH levels or the diameter of the pituitary adenoma (p = 0.268, p = 0.813, respectively). In group 2, the mean diameter of the adrenal adenomas was 32 ± 11 mm (range of, 20-54 mm). Patients in group 1 were found to be younger than those in group 2 (p = 0.03). Although baseline cortisol levels were higher in group 1, the difference was not statistically significant (p = 0.645). The frequency of central hypothyroidism at the initial assessment, and the baseline TSH and fT4 levels were not statistically different between the two groups (p = 0.912, p = 0.242, p = 0.631, respectively). The frequency of baseline-suppressed TSH levels were higher in group 1, but the difference was not statistically significant (p = 0.069). As for the TSH and fT4 levels, the TSH levels of group 2 were higher only at the second visit (p = 0.035). No statistically significant difference was found between the two groups in terms of the HPA axis recovery time and the plasma TSH; and fT4 levels (p = 0.825, p = 0.761, p = 0.841, respectively). In addition, no difference was observed between the two groups regarding the change in plasma TSH levels (Δ TSH) at the last visit (p = 0.257). The comparisons of the two groups are shown in Table 2.

DISCUSSION In this study, we demonstrated the effect of hypercortisolism on thyroid functions in patients with CS. Because it is common knowledge that plasma T3 levels decrease through peripheral type 1 deiodinase enzyme inhibition, we aimed to show the central Arch Endocrinol Metab. 2018;62/2

effects of hypercortisolism on thyroid functions (23). Furthermore, glucocorticoids are used in the treatment of hyperthyroidism due to these peripheral effects (24). We have shown suppressed baseline TSH levels in patients with active CS, which is also compatible with a number of studies in the literature (2,3,5-7,10). In this study, a very selective population was evaluated to detect merely the effect of hypercortisolism on thyroid functions, contrary to the studies in the literature. Patients who had secondary conditions that could affect thyroid function tests, such as autoimmune thyroid disease, the presence of pituitary macroadenoma or RT were not included in the study population. Although the most important factor affecting TSH secretion in CS is considered to be hypercortisolism itself, various other factors associated with CS have been investigated as well, such as severe additional disease, goiter, and diabetes mellitus (10). Similarly in this study we observed an inverse relationship between cortisol levels and TSH levels which was compatible with many other studies (6,10-12). Furthermore, it is known that glucorticoid administration in healthy individuals also may cause dose-dependent TSH suppression (9). However, one study in the literature indicated that serum cortisol levels and TSH and fT4 levels did not show a significant correlation. That study indicated that TSH suppression in CS might be related to high cumulative cortisol levels and it is rather difficult to detect such an effect. The authors suggested that high ACTH levels in CD patients might have an effect on thyroid function tests independent of plasma cortisol levels. However, such a relationship was not proved in their study (7). Therefore, we also included an evaluation of the association between ACTH and TSH 167

Figure 1. Changes in TSH and FT4 levels during folliw-up. First visit: Between the 1st and the 3 rd months; Second visit: On the 6th month; Third visit: On the 12th month; Fourth visit: At the time of HPA axis recovery; Fifth visit: Last visit of the follow-up period.

Central thyroid dysfunctions in Cushing’s syndrome

Table 2. Comparison of ACTH-dependent and ACTH-independent Cushing’s syndrome Group 1 (ACTH-dependent Cushing’s syndrome) (n =20)

Group 2 (ACTH-independent Cushing’s syndrome) (n = 15)

33.8 ± 11.7 (17-61)

41.8 ± 9.6 (25-58)

0.03

14/6

14/1

0.08

Duration of follow-up (months) Mean ± SD

63.7 ± 26.7 (25-114)

46.5 ± 23.8 (21-90)

0.06

Baseline cortisol levels (µg/dL) Mean ± SD

28.9 ± 9.6 (14.2-46)

22.8 ± 5.9 (13.3-32)

0.645

0.6 ± 0.6 (0.1-2.6)

1.2 ± 0.8 (0.2-2.9)

0.242

10 (50)

3 (20)

0.069

13.9 ± 2.8 (9.3-19.3)

13.6 ± 2.4 (10.3-19.7)

0.631

5 (25)

4 (27)

0.912

0.6 ± 0.4 (0.1-1.3)

0.8 ± 0.7 (0.1-1.9)

0.194

First visit (Mean ± SD) TSH levels (µU/mL) FT4 levels (pmol/L)

2.1 ± 1.2 (0.5-4.7) 15.6 ± 2.2 (12.8-20.7)

2.1 ± 1.3 (0.6-4.7) 16.5 ± 2.2 (13.4-19.5)

0.950 0.903

Second visit (Mean ± SD) TSH levels (µU/mL) FT4 levels (pmol/L)

2.2 ± 1.1 (0.3-4) 14.9 ± 1.6 (12.4-17.7)

2.7 ± 1.4 (0.8-4.8) 15.1 ± 2.3 (12.5-18.6)

0.035 0.752

Third visit (Mean ± SD) TSH levels (µU/mL) FT4 levels (pmol/L)

2.6 ± 1.4 (0.5-4.5) 15.2 ± 1.1 (13.4-17.8)

2.8 ± 1.2 (0.8-4.8) 15.2 ± 1.5 (12.5-18.1)

0.317 0.747

13.6 ± 5.1 (7-25)

19.6 ± 19.3 (7-60)

0.825

Fourth visit (Mean ± SD) TSH levels (µU/mL) FT4 levels (pmol/L)

2.4 ± 1.2 (0.7-4.5) 14.9 ± 1.7 (12.7-19.1)

2.7 ± 1.3 (0.8-4.8) 15.3 ± 1.4 (13.5-17.1)

0.761 0.841

Fifth visit (Mean ± SD) Cortisol levels (µg/dL) TSH levels (µU/mL) FT4 levels (pmol/L)

15.1 ± 2.9 (10.7-20) 1.9 ± 1.1 (0.5-4.5) 16.1 ± 1.8 (13.2-20)

15.7 ± 3.1 (10.7-21) 2.8 ± 1.2 (0.5-4.7) 14.9 ± 1.5 (12.1-17.1)

0.472 0.458 0.554

1.3 ± 1.1 (0.2-3.4)

1.7 ± 0.9 (-0.1-3)

0.257

Age at diagnosis (years) Mean ± SD Sex (F/M)

Baseline TSH levels (µU/mL) Mean ± SD Frequency of baseline suppressed TSH levels [n, (%)] Baseline FT4 levels (pmol/L) Mean ± SD Patients with central hypothyroidism atinitial assessment (n; %) Early postoperative cortisol levels (µg/dL) Mean ± SD

HPA axis recovery time (months) Mean ± SD

Δ TSH levels° (µU/mL) Mean ± SD

Bold values are statistically significant (p < 0.05), °Δ TSH: The change in TSH levels between baseline and the last visits. First visit: Between the 1st and the 3rd months; Second visit: On the 6th month; Third visit: On the 12th ; Fourth visit: At the time of HPA axis recovery; Fifth visit: Last visit of the follow-up period.

levels in our patients with ACTH-dependent CS, which has not been previously mentioned in the literature. However, we did not find any significant correlation between ACTH and TSH levels. A comparison between the isolated effects of local pituitary ACTH secretion and the ectopic secretion of ACTH would be possible only with the selective classification of two groups with either EAS or CD. However, due to 168

the low number of EAS patients, we were unable to design such a comparison in our study. Even though our study population included only microadenoma lesions, we also evaluated the mass effect of pituitary adenoma on TSH levels and found no significant correlation between adenoma size and TSH levels. Lower plasma T4 levels due to supressed TSH levels may be expected in hypercortisolism. However, Arch Endocrinol Metab. 2018;62/2

in our study we observed central hypothyroidism in only 26% of patients and normal plasma fT4 levels in most of the patients during hypercortisolism. Mathioudakis and cols. (7) reported an even lower prevalance of central hypothyroidism (18%). Relatively normal plasma fT4 levels in hypercortisolism may be explained with the increased biological activity of TSH through posttranslational processes (25). Although the baseline fT4 levels were lower than fT4 levels during the last visit; no statistically significant difference was found. Furthermore, the cortisol levels were similar in patients with or without central hypothyroidism, and also, no correlation was found between the baseline cortisol and fT4 levels. Thus, the presence of hypercortisolemia essentially affects plasma TSH levels, and as fluctuations in fT4 levels are independent of serum cortisol, predicting which patients will develop low fT4 levels or central hypothyoridism is difficult. The factors effective in this process may be related to the sensitivity of thyrotrop cells for TSH or the iodine status of the body. Even though the iodinization of household salt has been mandatory since 1999, a recent study demonstrated urinary iodine defficiency in the 23% of the adult population in our country (26). This may be the reason for the higher prevelance of central hypothyroidism in our study compared with Mathioudakis and cols. (7). Nevertheless, even patients with central hypothyroidism generally do not have clinically evident hypothyroidism. As the clinical presentation is silent and thyroid dysfunction is assumed to recover with the improvement of hypercortisolism, levothyroxine replacement in the preoperative period is not recommended (7,22). In the literature, only a few patients received levothyroxine replacement before surgery, all of whom presented with hypothyroidism as the first finding of CS (27,28). In our series levothyroxine replacement was not given to any of the patients. Altough the effect of CS on thyroid function tests is widely studied, studies involving the long time clinical course of these patients after surgery are limited (6,7,10,19,20,29). It has been demonstrated that TSH and thyroid hormone levels start to recover in the first six months after surgery, and these changes may take place as early as two weeks, especially in the first month following surgery (7,10,20,30). In addition, in our series we observed the most significant increase in TSH levels in the first visit, with the levels gradually increasing until the 12th month of follow-up. Likewise, Arch Endocrinol Metab. 2018;62/2

Roelfsema and cols. (6) assessed TSH and thyroid functions for a mean of 6.8 years after surgery for CD and found increased basal TSH secretion compared with the control group. To evaluate tyroid function changes according to the etiologies, we divided our patients into two groups: ACTH-dependent and ACTH-independent. No significant difference was found between the hormone levels at baseline and the clinical findings at the initial assessment. However the patients with ACTHdependent CS were younger. The presence of central hpothyroidism and low fT4 levels are more frequently reported in CD (6,7). However, we found a similar frequency of central hypothyroidism in both groups. At the follow-up visits, the mean TSH levels were slightly higher in group 2 in the second visit, which we interpreted as an incidental finding. The results of our study showed that changes in thyroid function tests in CS are the result of hypercortisolism itself independent of the etiology of CS. No significant difference was found between the two groups in terms of cortisol levels during the baseline and follow-up visits. Bartalena and cols. (12) demonstrated similar results in thyroid function tests between ACTH-dependent or ACTHindependent groups. Even though CS and TSH supression have been well known for a long time, hyperthyroidism due to TSH secretion after surgery for CS was recently defined in the literature. This situation is described as a novel cause of SITSH (19). A TSH-secreting pituitary adenoma and resistance to the thyroid hormone are the primary causes of SITSH (31). First, Tamada and cols. (19) reported two patients who presented with SITSH caused by a decrease in the hydrocortisone replacement dose after surgery for CS. Especially the rapid decreases in the hydrocortisone replacement doses in the early postoperative period were held responsible for this process. The study also discussed that sypmtoms of hyperthyroidism due to SITSH might have overlapped with symptoms of SWS. Because of this knowledge in literature, we evaluated the prednisolone replacement doses of all patients during each visit and did not detect the presence of SITSH. This may be explained with the higher glucocorticoid replacement doses in our study compared with the series in Tamada and cols. (19). In that study, hyperthyroidism was especially detected in the first month of follow-up when the daily hydrocortisone replacement doses were ≤ 20 mg. In our study patients received a mean of 7.3 mg/day 169

Central thyroid dysfunctions in Cushing’s syndrome

of prednisolone replacement during the first visit. In light of these findings we suspect that a relationship might exist between glucocorticoid replacement doses and plasma TSH and fT4 level, a subject on which we could not find any comments in the current literature. However we could not demonstrate a significant correlation between the prednisolone replacement and the concurrent plasma TSH and fT4 levels until HPA axis recovery in the postoperative period. Our comment regarding this is that the mechanisms leading to SITSH may not be triggered as long as the glucocorticoid replacement doses are sufficient. Tamada and cols. also reported that hypocortisolemia was responsible for the onset of the syndrome (19). Because hypocortisolemia leads to decreased type 2 deiodinase activity resulting with declining in the local hypotalamo-pituitary T3 levels, the TSH levels are elevated independent of the peripheral thyroid hormone status (18-20). However this theory is not the only explanation because presence of hyperthyroidism would then be expected in all hypocortisolemic patients. Although baseline TSH levels are elevated in patients with adrenal defficiency, hyperthyroidism is not defined in these patients (32). Our explanation is that in patients with CS plasma deiodinase activity which is sensitive to local T3 levels develops new set-points in the active hypercortisolemic period of CS, and a certain amount of time is needed for the recovery of the initial set points. Glucocorticoid replacement should be decreased gradually until the initial set points are recovered as Tamada and cols. (20) demonstrated in another prospective study that hyperthyroidism due to SITSH was also triggered by SWS after the treatment of CS. Thus, gradual reductions in steroid replacement doses are important in the prevention of both SWS and hyperthyroidism due to SITSH. In conclusion, plasma TSH or T4 levels may be affected in CS independent of etiology. The primary cause of this finding is hypercortisolism itself. However, the particular mechanism of these processes is not clear and needs to be further evaluated. Furthermore, central hypothyroidism may be detected in these patients. Treatment recommendations need to be evaluated individually for each patient. In contrast to the general belief that TSH levels are initially suppressed in CS, which eventually recover after CS treatment and that the follow-up of thyroid function tests is not mandatory, we suggest that patients should be monitored in the postoperative period especially 170

concerning hyperthyroidism due to SITSH. To prevent such an effect, we suggest avoiding rapid decreases in glucocorticoid replacement doses especially in the early postoperative period. The recovery of the HPT axis which was affected from glucocorticoid excess, may require some time, just as a certain period of time is necessary for the recovery HPA axis. Ethical approval: for this type of study formal consent is not required. Funding: there was no funding received for this study. Disclosure: no potential conflict of interest relevant to this article was reported.

REFERENCES 1. Mariotti S. Normal physiology of the hypothalamo-pituitary-thyroidal system and relation to the neural system and other endocrine gland. 2006. Chapter 4 in Thyroid Disease Manager. 2. Duick DS, Wahner HW. Thyroid axis in patients with Cushing’s syndrome. Arch Intern Med. 1979;139(7):767-72. 3. Nicoloff JT, Fisher DA, Appleman MD Jr. The role of glucocorticoids in the regulation of thyroid function in man. J Clin Invest. 1970;49(10):1922-9. 4. Samuels MH, McDaniel PA. Thyrotropin levels during hydrocortisone infusions that mimic fasting-induced cortisol elevations: a clinical research center study. J Clin Endocrinol Metab. 1997;82(11):3700-4. 5. Adriaanse R, Brabant G, Endert E, Wiersinga WM. Pulsatile thyrotropin secretion in patients with Cushing’s syndrome. Metabolism 1994; 43(6):782-6. 6. Roelfsema F, Pereira AM, Biermasz NR, Frolich M, Keenan DM, Veldhuis JD et al. Diminished and irregular TSH secretion with delayed acrophase in patients with Cushing’s syndrome. Eur J Endocrinol 2009; 161:695-703. 7. Mathioudakis N, Thapa S, Wand GS, Salvatori R. ACTH-secreting pituitary microadenomas are associated with a higher prevalence of central hypothyroidism compared to other microadenoma types. Clin Endocrinol (Oxf). 2012;77(6):871-6. 8. Samuels MH, Luther M, Henry P, Ridgway EC. Effects of hydrocortisone on pulsatile pituitary glycoprotein secretion. J Clin Endocrinol Metab. 1994;78(1):211-5. 9. Brabant A, Brabant G, Schuermeyer T, Ranft U, Schmidt FW, Hesch RD, et al. The role of glucocorticoids in the regulation of thyrotropin. Acta Endocrinol (Copenh). 1989;121(1):95-100. 10. Benker G, Raida M, Olbricht T, Wagner R, Reinhardt W, Reinwein D. TSH secretion in Cushing’s syndrome: relation to glucocorticoid excess, diabetes, goitre, and the ‘sick euthyroid syndrome’. Clin Endocrinol (Oxf). 1990;33(6):777-86. 11. Visser TJ, Lamberts SW. Regulation of TSH secretion and thyroid function in Cushing’s disease. Acta Endocrinol (Copenh). 1981;96(4):480-3. 12. Bartalena L, Martino E, Petrini L, Velluzzi F, Loviselli A, Grasso L, et al. The nocturnal serum thyrotropin surge is abolished in patients with adrenocorticotropin (ACTH)-dependent or ACTHindependent Cushing’s syndrome. J Clin Endocrinol Metab. 1991;72(6):1195-9. Arch Endocrinol Metab. 2018;62/2

Central thyroid dysfunctions in Cushing’s syndrome

13. Alkemade A, Unmehopa UA, Wiersinga WM, Swaab DF, Fliers E. Glucocorticoids decrease thyrotropin-releasing hormone messenger ribonucleic acid expression in the paraventricular nucleus of the human hypothalamus. J Clin Endocrinol Metab. 2005;90(1):323-7.

23. Chopra IJ, Williams DE, Orgiazzi J, Solomon DH. Opposite effects of dexamethasone on serum concentrations of 3,3’,5’-triiodothyronine (reverse T3) and 3,3’5-triiodothyronine (T3). J Clin Endocrinol Metab. 1975;41(5):911-20.

14. Saane LM, Carro E, Tovar S, Casanueva FF, Dieguez C. Regulation of in vivo TSH secretion by leptin. Regul Pept. 2000;92:25-9.

24. Bahn RS, Burch HB, Cooper DS, Garber JR, Greenlee MC, Klein I, et al. American Thyroid Association; American Association of Clinical Endocrinologists. Hyperthyroidism and other causes of thyrotoxicosis: management guidelines of the American Thyroid Association and American Association of Clinical Endocrinologists. Endocr Pract. 2011;17(3):456-520.

15. Lewis BM, Dieguez C, Lewis MD, Scanlon MF. Dopamine stimulates release of thyrotrophin-releasing hormone from perfused intact rat hypothalamus via hypothalamic D2-receptors. J Endocrinol. 1987;115:419-24. 16. Taylor AD, Flower RJ, Buckingham JC. Dexamethasone inhibits the release of TSH from the rat anterior pituitary gland in vitro mechanisms dependent on de novo protein synthesis and lipocortin 1. J Endocrinol. 1995;147:533-44. 17. Estupina C, Belmar J, Tapia-Arancibia L, Astier H, Arancidia S. Rapid and opposite effects of dexamethasone on in vivo and in vitrohypothalamic somatostatin release. Exp Brain Res. 1997;113:337-42. 18. St Germain DL, Galton VA, Hernandez A. Minireview: defining the roles of the iodothyronine deiodinase: current concepts and challenges. Endocrinology. 2009;150:1097-107. 19. Tamada D, Onodera T, Kitamura T, Yamamoto Y, Hayashi Y, Murata Y, et al. Hyperthyroidism due to thyroid-stimulating hormone secretion after surgery for Cushing’s syndrome: a novel cause of the syndrome of inappropriate secretion of thyroid-stimulating hormone. J Clin Endocrinol Metab. 2013;98(7):2656-62. 20. Tamada D, Kitamura T, Onodera T, Hamasaki T, Otsuki M, Shimomura I. Clinical significance of fluctuations in thyroid hormones aftersurgery for Cushing’s syndrome. Endocr J. 2015;62(9):805-10. 21. Nieman LK, Biller BM, Findling JW, Newell-Price J, Savage MO, Stewart PM, et al. The diagnosis of Cushing’s syndrome: An Endocrine Society Clinical Practice Guideline. J Clin Endocrinol Metab. 2008;93(5):1526-40.

26. Idiz C, Kucukgergin C, Yalin GY, Onal E, Yarman S. Iodine Status of Pregnant Women in the Apparently Iodine-Sufficient in Istanbul Province: At Least Thirteen Years After Iodization of Table Salt Became Mandatory. Acta Endocrinol (Buc). 2015;11(3):407-12. 27. Katahira M, Yamada T, Kawai M. A case of cushing syndrome with both secondary hypothyroidism and hypercalcemia due to postoperative adrenal insufficiency. Endocr J. 2004;51(1):105-13. 28. Hara Y, Sekiya M, Suzuki M, Hiwada K, Kato I, Kokubu T. A case of isolated thyrotropin deficiency with Cushing’s syndrome. Jpn J Med. 1989;28(6):727-30. 29. Hashimoto K. The pituitary ACTH, GH, LH, FSH, TSH and prolactin reserves in patients with Cushing’s syndrome. Endocrinol Jpn. 1975;22(1):67-77. 30. Stratakis CA, Mastorakos G, Magiakou MA, Papavasiliou E, Oldfield EH, Chrousos GP. Thyroid function in children with Cushing’s disease before and after transsphenoidal surgery. J Pediatr. 1997;131(6):905-9. 31. Weintraub BD, Gershengorn MC, Kourides IA, Fein H. Inappropriate secretion of thyroid-stimulating hormone. Ann Intern Med. 1981;95:339-51. 32. Samuels MH. Effects of Variations in Physiological Cortisol Levels on Thyrotropin Secretion in Subjects with Adrenal Insufficiency: A Clinical Research Center Study. J Clin Endocrinol Metab. 2000;85(4):1388-93.

22. Nieman LK, Biller BM, Findling JW, Murad MH, Newell-Price J, Savage MO, et al. Endocrine Society. Treatment of Cushing’s Syndrome: An Endcorine Society Clinical Practice Guideline. J Clin Endocrinol Metab. 2015;100(8):2807-31.

25. Persani L. Hypothalamic thyrotropin-releasing hormone and thyrotropin biological activity. Thyroid. 1998;8:941-6.

Arch Endocrinol Metab. 2018;62/2

171

original article

The effect of metabolic surgery on type 1 diabetes: meta-analysis Abdulzahra Hussain1

ABSTRACT Doncaster and Bassetlaw Teaching Hospitals, DN2 5LT, Doncaster, UK 1

Correspondence to: azahrahussain@yahoo.com Received on Apr/22/2016 Accepted on Oct/10/2016 DOI: 10.20945/2359-3997000000021

Objective: Metabolic and bariatric surgery has a definite role in the management of obese patients with type 2 diabetes mellitus (T2DM). There is also evidence of such surgery improving the health of type 1 diabetic (T1DM) patients. The aim of this paper is to explore the effect of metabolic and bariatric surgery on T1DM. Materials and methods: A comprehensive search of PubMed and Google Scholar was performed to identify relevant papers reporting metabolic and bariatric surgery effects on T1DM. A statistical analysis is applied after data synthesis. A forest plot and Pearson correlation are then calculated. Results: Of the 567 papers that were identified, 558 articles did not fulfill the inclusion criteria and were therefore excluded. Nine studies involving 78 patients were selected for this metaanalysis. There was improvement in HBA1c (p value = 0.40), insulin dose (p value = 0.0001) and BMI (p value = 0.00001) after surgery. However, improvement in the HBA1c did not reach statistical significance. There was a weak correlation between postoperative insulin dose and BMI change after surgery (r = -0.177). There was a negligible correlation between HBA1c and BMI change after operations (r = -0.01). Conclusion: Current metabolic/bariatric surgery is improving T1DM in obese and morbidly obese patients. This is not exclusively related to excess weight loss (EWL) as previously thought. Therefore, there is a role for other factors, which are potential players to reproduce the same effect in nonobese T1DM patients. Arch Endocrinol Metab. 2018;62(2):172-8 Keywords Bariatric surgery; metabolic surgery; type 1 diabetes mellitus; type 2 diabetes mellitus; HBA1c; insulin; body mass index

INTRODUCTION

astrointestinal surgery has excellent but variable outcomes on the glycemic control of diabetic patients depending on the type of surgery. The first report of gastrointestinal surgery ameliorating T2DM was reported by Friedman and cols. in 1955 (1), though its effect on T1DM was not recognized until recently when Czupryniak and cols. reported the first observation of T1DM improvement in a severely obese patient who underwent gastric bypass in 2004 (2). Hussain and cols. suggested the potential benefit of bariatric surgery for T1DM in 2009 (3), followed by Czupryniak and cols.â&#x20AC;&#x2122;s case studies involving three patients in 2010 (4). Since then, several observational studies have reported changes in insulin requirement, HBA1c and BMI following different types of bariatric/metabolic surgery. American Diabetic Association (ADA) and National Institute for Health and Care Excellence (NICE) guidelines have restricted the diagnosis of T1DM to situations in which the body does not produce insulin (5) or the destruction of insulin-producing beta cells in the pancreatic islets of Langerhans causes absolute insulin deficiency (6). This clear definition should avoid confusion 172

in reporting insulin-dependent diabetic patients after bariatric/metabolic surgery, which could fall under either T1DM (when there is no insulin production) or T2DM (when insulin is produced but is not a sufficient amount for body requirements, or there is insulin resistance). The metabolic effect of bariatric/metabolic surgery on T1DM has elicited significant interest because of the already-proven benefits on T2DM and the potential production of similar results for T1DM, which forms 10% of diabetic load (7-10). As there is no insulin production by pancreatic beta cells, the mechanisms of improving T1DM following metabolic/bariatric surgery are expected to be related to body mass index (BMI) change, reduction of insulin resistance, satiety/ dietary change and possible neuroendocrine/hormonal or incretins influence. The aim of this paper is to explore current evidence regarding the effect of metabolic surgery on T1DM.

MATERIALS AND METHODS The protocol of Preferred Reporting Items for Systematic Review and Meta-Analysis (PRISMA) is used Arch Endocrinol Metab. 2018;62/2

Metabolic surgery and type 1 diabetes

Records identified through database searching (n = 539)

Additional records identified through other sources (n = 28)

Screening

Records after duplicates removed (n = 567) Records screened (n = 567)

Records excluded (n = 554) Full-text articles excluded, with reasons (n = 4), very small studies

Included

Eligibility

Full-text articles assessed for eligibility (n = 13) Studies included in qualitative synthesis (n = 09) Studies included in quantitative synthesis (meta-analysis) (n = 9)

Data synthesis

Source: Moher D, Liberati A, Tetzlaff J, Altman DG; The PRISMA Group (2009). Preferred Reporting Items for Systemic Reviews and Meta-Analyses: The PRISMA Statement. PLoS Med. 2009;6(7):e1000097.

Figure 1. Flow diagram.

Quality of the data An assessment of the studies according to the NewcastleOttawa scoring system was performed (Table 1). The data were reviewed and entered into the fields of Microsoft Excel. The data consisted of the following: sample size, authors, year of publication, HBA1c, insulin Table 1. Newcastle-Ottawa assessment of the quality of data Studies

Selection

Comparability

Outcome

Blanco and cols. (2014)

****

Brethauer and cols. (2014)

***

Czupryniak and cols. (2010)

***

Maraka and cols. (2015)

****

Middelbeek and cols. (2015)

***

Raab and cols. (2013)

***

Robert and cols. (2015)

****

Lannoo and cols. (2014)

****

Mendez and cols. (2010)

***

Arch Endocrinol Metab. 2018;62/2

dose, BMI before and after the surgery and follow-up duration. All the studies were observational research, and no clinical trials were to have been performed for the studies to be included. Three of them were comparative protocols that included a T2DM arm. Only T1DM data were selected. Some of the studies lacked the calculation of standard deviation (SD), which is an important requirement for conducting the forest plot calculation. The SD of each study was calculated from the number of subjects, the largest and smallest value and the 95% confidence interval of 3.92. Some of the studies were lacking a mean of the specific data. Therefore, a calculation of the mean was performed. The patientsâ&#x20AC;&#x2122; follow-ups varied, even within a single study. Some studies provided follow-up at 6 months, 1 year, 2 years, 3 years, 4 years or 5 years. The included data were taken from the longest follow-up to give more power to the results. Few studies reported insulin dose per kilogram (kg) of body weight/day, while the majority quoted total units/day. It was not possible to know the total units/day for these few studies (Table 2), so the reported unit/kg/day is used for analysis.

Data synthesis was completed and is shown in Table 2. Further calculation of change in the mean of three variables is depicted in Table 3. The forest plot was performed for HBA1c, Insulin dose and BMI changes after surgery (Figures 2, 3 and 4). Pearson correlation statistics were applied, and the results are shown in Table 4.

Statistical analysis Review Manager software was used (Review Manager 5.3, version: 5.3.5). A 95% confidence interval (CI) and p < 0.05 limit was taken as significant. An odd ratio (OR), variance, standard errors and deviations were applied, and a forest plot for depicting the final results of each parameter was constructed. Different parameters such as age, insulin requirements, HBA1c, BMI and duration of diabetes were included in the final analysis. Further analysis was conducted to show the relations and degree of correlation between these 5 parameters. The correlation tests were performed using Excel (Microsoft 365, 2015) and also R software from the R Foundation for Statistical Computing (http://www.R-project.org). The test of normality was conducted for all data using Jarque-Bera and AndersonDarling normality tests. The correlation coefficient (r) was calculated using the following equation: R 173

Identification

(Figure 1). Inclusion and exclusion criteria: All English literature reporting bariatric and metabolic surgery on T1DM patients (hyperglycemia, C-peptide negative and anti-glutamic acid carboxylase [GAC] antibodies positive) were included. The studies that reported less than three patients were excluded.

Metabolic surgery and type 1 diabetes

Calculation, r = ∑((X - My)(Y - Mx)) / √((SSx)(SSy)). Data synthesis was performed, and statistical analysis was conducted. The SD was lacking in some studies,

and it was calculated using SD = √Nx (X-x)/3.92 and a confidence interval of 95% (http://handbook. cochrane.org).

Table 2. Main data, the standard deviation is calculated using the formula SD = √n x[X-x)2/3.92, n = number of subjects, X = upper limit value, x = lower limit, 3.92 = 95% confidence interval, CI. The values in the table represent the mean of the data plus SD when available. For insulin requirements, some data depicted as IU/kg/day rather than total unit/day HBA1c before/after surgery

Insulin requirements before/after surgery IU/day (u/k/day)

BMI kg/m2 before/ after surgery

Follow up (month = m)

42.2 ± 2.39/ 33.5 ± 2.65

11.60

5-8 years

104.16 ± 11.59/ 36.75 ± 7.72

41.75 ± 5.89/ 27.82 ± 2.37

17.16

1 year

7.5 ± 1.9/ 7.1 ± 0.9

1.09 ± 0.7/ 0.44 ± 0.24

46.9 ± 6.3/ 30.34 ± 6.3

23.1 ± 11.8

4.5 years

8.2 ± 1.6/ 7.8 ± 0.9

75.15 ± 6.4/ 55.45 ± 5.17

44.3 ± 8.0/ 31.2 ± 9.9

20.6 ± 11.4

2 years

38.2 ± 13.3

8.3 ± 1.28.2 ± 0.9

0.61 ± 0.17/ 0.62 ± 0.12

39.4 ± 2.2/ 27.3 ± 2.2

27.3 ± 2.2

2 years

2015

39.6 ± 8.4

8.1 ± 1.3/ 9.8 ± 1.9

53.0 ± 29.7/ 31.1 ± 22.8

43.5 ± 7.5/ 33.8 ± 7.5

24.6 ± 10.1

5 years

Brethauer and cols.

2014

45.6 ± 10.9

10 ± 1.6/ 8.9 ± 1.1

0.74 ± 0.32/ 0.40 ± 0

41.6 ± 3.9/ 30.5 ± 5.9

36.8 ± 32.3 (m)

Lannoo and cols.

2014

40.3 ± 8.5

8.4 ± 2.34/ 8.2 ± 2.11

92.5 ± 13.81/ 48.0 ± 11.36

39.7 ± 5.34/ 31.4 ± 2.86

25.3 ± 8.9

14.3 ± 10.1/ 37.8 ± 29.7

Mendez and cols.

2010

42.3

7.96 ± 0.67/ 8.03 ± 0.99

99.23 ± 9.36/ 42.9 ± 3.10

45.9 ± 3.11/ 29.4 ± 1.77

1 year

Age (mean) years

No of subjects

Duration of T1DM in years

Year

Czupryniak and cols.

2010

22 ± 6

10.13 ± 1.32/ 09.00 ± 0.73

94 ± 6.3/ 47.6 ± 6.42

Raab and cols.

2013

8.18 ± 2.17/ 6.95 ± 1.4

Robert and cols.

2015

39.2 ± 5.3

Maraka and cols.

2015

50.6 ± 8.9

Blanco and cols.

2014

Middelbeek and cols.

Table 3. Mean change in 3 variables BMI, HBA1c and insulin requirement, mean duration of T1DM (years) and age (years) are fixed

HBA1c

Insulin requirement

Duration of T1DM

BMI

AGE

1.13

46.40

11.60

08.70

22.0

1.23

67.41

17.16

13.95

43.0

0.40

00.65

23.10

16.56

39.2

0.40

19.70

20.60

13.10

50.6

0.10

00.01

27.30

12.10

38.2

-1.70

21.90

24.60

09.70

39.6

0.10

00.34

22.00

11.10

45.6

1.10

56.33

25.30

08.30

40.3

-0.07

44.50

25.00

16.50

42.3

Figure 2. Forest plot, HBA1c. 174

Arch Endocrinol Metab. 2018;62/2

Metabolic surgery and type 1 diabetes

Figure 3. Forest plot, insulin.

Figure 4. Forest plot, body mass index change after surgery. Table 4. Pearson correlation for 2 constant (age and duration of T1DM) and 3 variable post operative parameters (insulin requirements, HBA1c change and BMI change) combination. Significant moderate correlation between any two parameters is depicted in grey color (0.-0.39 = weak, 0.4-0.59 moderate, 0.6-0.79 = strong, 0.8-1.0 = very strong, Evans guide 1996) Duration of T1DM

Insulin requirement

HBA1c

BMI change after surgery

-----

0.509

-0.208

-0.220

0.405

Duration of T1DM

0.509

------

-0.418

-0.513

0.204

Insulin requirement

-0.208

-0.418

------

0.475

-0.177

HBA1c

-0.210

-0.513

0.475

-----

-0.010

BMI

0.405

0.204

-0.177

-0.010

------

RESULTS Type of bariatric/metabolic procedure The included patients underwent laparoscopic adjustable gastric band (LAGB), 2 patients (2.5%); vertical sleeve gastrectomy (VSG), 11 patients (14%); laparoscopic Roux-en Y gastric bypass (LRYGB), 52 patients (67%); bilio-pancreatic diversion (BPD) 7 patients (9%); or bilio-pancreatic diversion plus duodenal switch (BPD-DS), 3 patients (3.8%). Except gastric bypass, all other operations included a small number of patients who fell short in terms of providing statistical power, and no subgroup analysis was conducted. Therefore, the outcomes were those of the 5 procedures. Arch Endocrinol Metab. 2018;62/2

HBA1c HBA1c showed improvement after surgery; however, this improvement did not reach statistical significance, as the p value was 0.40 (Figure 2). HBA1c was moderately correlated with the duration of T1DM (r = -0.513) and insulin requirement (r = 0.475). HBA1c showed little or no correlation with BMI (r = 0.01) but a stronger correlation with age (r = -022).

Insulin requirement Insulin requirement was significantly reduced after surgery, with p value = 0.00001 (Figure 3). It was moderately correlated with HBA1c, as expected (r = 0.475), and with duration of T1DM (r = -0.418). More importantly, it was weakly correlated with BMI 175

Age

Metabolic surgery and type 1 diabetes

change after surgery (r = -.0177) and also with age (r = -0.208) (Figures 2 and 4).

Duration of the diabetes The mean duration of T1DM was 9.6 to 34.9 years, and it was correlated with age (r = 0.509). Duration of T1DM was moderately correlated with post-surgery insulin requirements and HBA1c and weakly correlated with BMI (r = -0.418, -0.513, 0.204, respectively) (Table 4).

Excess weight loss All studies showed an acceptable amount of weight loss ranging from 8.3 to 16.56 kilograms/m2. BMI change after surgery was weakly correlated with duration of diabetes, HBA1c and insulin requirement; however, it had significant correlation with age (r = 0.405) (Table 4).

Age group The age group ranged from 16-65 years with mean of 40.16 years. There was a weak negative correlation with postoperative insulin dose and HBA1c (r = -0.205, -0.21, respectively). Age group was moderately correlated with duration of T1DM and BMI (r = 0.509, 0.405, respectively).

DISCUSSION HBA1c and postoperative insulin dose are important parameters to assess glycemic control in T1DM patients following metabolic surgery. All but 2 studies (Middelbeek and cols. 2015 and Mendez and cols. 2010) showed a variable degree of improvement in HBA1c, although it did not reach statistical significance (4,11-18) (Figure 2). However, the insulin dose is significantly reduced following surgery, and it is moderately correlated with duration of T1DM and HBA1c level. This meta-analysis showed a weak correlation among postoperative HBA1c, insulin requirement and postoperative BMI loss. Therefore, the improvement in the HBA1c and insulin dose shortly after surgery is not entirely related to weight loss. The largest study of Lannoo and cols. (11) concluded that the insulin-sparing effect is probably related to insulin sensitivity following weight loss. However, according to this meta-analysis, the insulin-sparing effect is only weakly correlated with weight loss. We have to look beyond the anatomical configurations and physical 176

effects of these procedures and explore the complex metabolic pathway of glucose homeostasis. Incretins play a role in glucose regulation by reducing glucagon and food intake and increasing satiety (19). A recent review study highlighted the established roles of gut hormones in regard to diabetes (20). Metabolic and bariatric surgery may possibly produce insulin dose reduction and improve HBA1c through an incretinsrelated mechanism, but this does not exclude other potential factors that control glucose metabolism (21). The change in the nutrient flux could affect the balance of gut hormones (including hypothetical anti-incretins), and the change in hormone milieu might be responsible for changes in insulin sensitivity (22). In their study, Kempf and cols. showed a rapid decrease of insulin requirement and an improvement in HBA1c in T2DM as a result of meal modification even before substantial weight loss occurred (23). Glycogenolysis, gluconeogenesis, carbohydrate intake and the modified response of the metabolism to postmetabolic/bariatric surgery in regard to anatomical, neuroendocrine and satiety changes are the primary cofactors for net glucose production. The interaction of these complex mechanisms produces the final blood glucose level, whether it is normal, hypoglycemic or hyperglycemic. Following procedures such as gastric bypass, some T2DM patients develop hypoglycemia. The incidence of symptomatic hypoglycemia is less than 1% (24). However, asymptomatic post-bariatric/metabolic surgery hypoglycemia could reach 30% (25). In these patients, we possibly overdoing metabolic correction. On the other hand, in T1DM, the beta-cell influence on glucose homeostasis is absent, and therefore the entire set of regulatory mechanisms consists of the complex interactions among the gastrointestinal tract (GIT), liver, brain, adipose tissue, blood cells, muscles and kidneys. This results in the regulation of glucose entry into the circulation being influenced by additional factors such as hormones, the sympathetic nervous system and substrates (i.e., free fatty acid concentrations and availability of gluconeogenic precursors) (26). The question regarding how to adjust the anatomical change of the gastrointestinal tract as a result of metabolic surgery and the inherent complex interactions among these systems to optimize the glucose level in T1DM is very difficult based on the current level of knowledge surrounding metabolic/bariatric surgery. Every single centimeter of the GIT is a complex unit, and any change Arch Endocrinol Metab. 2018;62/2

Metabolic surgery and type 1 diabetes

Limitations of the study This meta-analysis included 9 studies with some degree of heterogeneity that ranged from 10-82%. The studies are relatively small, with the largest reporting 22 patients. The patient follow-ups are different, as some studies reported 1 year, whereas others reported up to 5 years. The outcomes, especially HBA1c, may be creeping up with longer follow-up, as shown by Middelbeek and cols.’s 2015 study (12), and the current conclusion regarding HBA1c is represented by the mean followArch Endocrinol Metab. 2018;62/2

ups in these studies. Some studies included women only (like Middlbeek and cols. 2015), whereas others reported women as the majority. This would raise a question regarding the actual representation of the obese T1DM population; nevertheless, the studies are shedding a light on such patients who require extra help with glycemic control after having exhausted current nonsurgical methods.

CONCLUSION Current metabolic/bariatric surgery is reducing postoperative insulin requirement and marginally improving HBA1c in obese and morbidly obese type 1 diabetic patients. This is not exclusively related to the EWL as previously thought. Therefore, there is a role for other factors, which are potential players to reproduce the same effect in nonobese T1DM patients. Further long-term studies are required to assess the real benefit of metabolic surgery for T1DM patients. Acknowledgments: none. Disclosure: no potential conflict of interest relevant to this article was reported.

REFERENCES 1. Friedman MN, Sancetta AJ, Magovern GJ. The amelioration of diabetes mellitus following subtotal gastrectomy. Surg Gynecol Obstet. 1955;100(2):201-4. 2. Czupryniak L, Strzelczyk J, Cypryk K, Pawlowski M, Szymanski D, Lewinski A, et al. Gastric bypass surgery in severely obese type 1 diabetic patients. Diabetes Care. 2004;27(10):2561-2. 3. Hussain A, Mahmood H, El-Hasani S. Can Roux-en-Y gastric bypass provide a lifelong solution for diabetes mellitus? Can J Surg. 2009;52(6):E269-75. 4. Czupryniak L, Wiszniewski M, Szymański D, Pawłowski M, Loba J, Strzelczyk J. Long-term results of gastric bypass surgery in morbidly obese type 1 diabetes patients. Obes Surg. 2010;20(4):506-8. 5. American Diabetic Association ADA. Available from: http://www. diabetes.org. Access on: Oct. 2, 2015. 6. National Institute for Health and Care Excellence (NICE). Available from: http://cks.nice.org.uk. Access on: Oct. 2, 2015. 7. Sieber P, Gass M2 Kern B, Peters T, Slawik M, Peterli R. Five-year results of laparoscopic sleeve gastrectomy. Surg Obes Relat Dis. 2014;10(2):243-9. 8. Brethauer SA, Aminian A, Romero-Talamás H, Batayyah E, Mackey J, Kennedy L, et al. Can diabetes be surgically cured? Longterm metabolic effects of bariatric surgery in obese patients with type 2 diabetes mellitus. Ann Surg. 2013 Oct;258(4):628-36. 9. Keating C, Neovius M, Sjöholm K, Peltonen M, Narbro K, Eriksson JK, et al. Health-care costs over 15 years after bariatric surgery for patients with different baseline glucose status: results from the Swedish Obese Subjects study. Lancet Diabetes Endocrinol. 2015;3(11):855-65

177

caused by metabolic and bariatric surgery will result in a comparative impact to the glucose homeostasis. Such changes will never result in total glycemic control, and the patient will still need an insulin replacement, regardless of the preoperative insulin dose. Currently, we do not entirely know what each part of the GIT produces (except some factors such as incretins, PYY hormones and ghrelins), and we are still a far way from being in a position to perfect metabolic/bariatric surgery to produce the maximum benefit for T1DM patients. The interaction between diet and GIT has been a very important focus of interest. A very low calorie diet (VLCD) was found to produce similar effects to gastric bypass in terms of insulin sensitivity and beta-cell function improvement in T2DM (27). As diabetes is a spectrum of disease, the same effect could therefore be produced in T1DM. To date, no study has examined the potential effect of VLCD on T1DM. Bile acids are recognized effectors on the regulation of glucose and lipid metabolism through the FXR and TGR5 receptors (28). There is evidence that the alteration of bile acids following bariatric surgery improves insulin responsiveness and lowers fasting glucose in animal models (29). A similar effect may be reproduced in humans, and it may be a mechanism through which to explain the effect of metabolic surgery on diabetic patients. There is no direct link between gut microbiota and improvement in glucose homeostasis following bariatric surgery. Gut microbiota does, however, have a direct effect on weight. An interesting study showed that transferring microbiota from an obese subject to a lean subject resulted in weight gain (30). The hepatocytes orchestrate the regulatory mechanisms of bile acids, microbiota and metabolome to affect glucose and lipid metabolism (31). Future research may prove the existence of a link between microbiota and beta-cell function.

Metabolic surgery and type 1 diabetes

10. Sjöström L, Peltonen M, Jacobson P, Ahlin S, Andersson-Assarsson J, Anveden Å, et al. Association of bariatric surgery with longterm remission of type 2 diabetes and with microvascular and macrovascular complications. JAMA. 2014;311(22):2297-304. 11. Lannoo M, Dillemans B, Van Nieuwenhove Y, Fieuws S, Mathieu C, Gillard P, et al. Bariatric surgery induces weight loss but does not improve glycemic control in patients with type 1 diabetes. Diabetes Care. 2014;37(8):e173-4. 12. Middelbeek RJ, James-Todd T, Cavallerano JD, Schlossman DK, Patti ME, Brown FM. Gastric Bypass Surgery in Severely Obese Women With Type 1 Diabetes: Anthropometric and Cardiometabolic Effects at 1 and 5 Years Postsurgery. Diabetes Care. 2015;38(7):e104-5. 13. Mendez CE, Tanenberg RJ, Pories W.. Outcomes of Roux-en-Y gastric bypass surgery for severely obese patients with type 1 diabetes: a case series report. Diabetes Metab Syndr Obes. 2010;3:281-3. 14. Robert M, Belanger P, Hould FS, Marceau S, Tchernof A, Biertho L. Should metabolic surgery be offered in morbidly obese patients with type I diabetes? Surg Obes Relat Dis. 2015;11(4):798-805. 15. Raab H, Weiner RA, Frenken M, Rett K, Weiner S. Obesity and metabolic surgery in type 1 diabetes mellitus. Nutr Hosp. 2013 Mar;28 Suppl 2:31-4. 16. Maraka S, Kudva YC, Kellogg TA, Collazo-Clavell ML, Mundi MS. Bariatric surgery and diabetes: Implications of type 1 versus insulin-requiring type 2. Obesity (Silver Spring). 2015;23(3):552-7. 17. Blanco J, Jiménez A, Casamitjana R, Flores L, Lacy A, Conget I, et al. Relevance of beta-cell function for improved glycemic control after gastric bypass surgery. Surg Obes Relat Dis. 2014 ;10:9-13. 18. Brethauer SA, Aminian A, Rosenthal RJ, Kirwan JP, Kashyap SR, Schauer PR. Bariatric surgery improves the metabolic profile of morbidly obese patients with type 1 diabetes. Diabetes Care. 2014;37(3):e51-2. 19. Kim W, Egan JM. The role of incretins in glucose homeostasis and diabetes treatment. Pharmacol Rev. 2008;60(4):470-512.

22. Rubino F, R’bibo SL, del Genio F, Mazumdar M, McGraw TE. Metabolic surgery: the role of the gastrointestinal tract in diabetes mellitus. Nat Rev Endocrinol. 2010;6(2):102-9. 23. Kempf K, Schloot NC, Gärtner B, Keil R, Schadewaldt P, Martin S. Meal replacement reduces insulin requirement, HbA1c and weight long-term in type 2 diabetes patients with >100 U insulin per day. J Hum Nutr Diet. 2014;27 Suppl 2:21-7. 24. Foster-Schubert KE. Hypoglycemia complicating bariatric surgery: incidence and mechanisms. Curr Opin Endocrinol Diabetes Obes. 2011;18(2):129-33. 25. Goldfine AB, Mun EC, Devine E, Bernier R, Baz-Hecht M, Jones DB, et al. Patients with neuroglycopenia after gastric bypass surgery have exaggerated incretin and insulin secretory responses to a mixed meal. J Clin Endocrinol Metab. 2007;92(12):4678-85. 26. Shrayyef MZ, Gerich JE. Normal Glucose Homeostasis. Principles of Diabetes Mellitus. 2010; p. 19-35. 27. Jackness C, Karmally W, Febres G, Conwell IM, Ahmed L, Bessler M, et al. Very low-calorie diet mimics the early beneficial effect of Roux-en-Y gastric bypass on insulin sensitivity and β-cell Function in type 2 diabetic patients. Diabetes. 2013;62(9):3027-32. 28. Albaugh VL, Flynn CR, Tamboli RA, Abumrad NN. Recent advances in metabolic and bariatric surgery. F1000Res. 2016 May 24;5. pii: F1000 Faculty Rev-978. 29. Goncalves D, Barataud A, De Vadder F, Vinera J, Zitoun C, Duchampt A, et al. Bile Routing Modification Reproduces Key Features of Gastric Bypass in Rat. Ann Surg. 2015;262(6):1006-15. 30. Bäckhed F, Ding H, Wang T, Hooper LV, Koh GY, Nagy A, et al. The gut microbiota as an environmental factor that regulates fat storage. Proc Natl Acad Sci U S A. 2004;101(44):15718-23. 31. Duparc T, Plovier H, Marrachelli VG, Van Hul M, Essaghir A, Ståhlman M, et al. Hepatocyte MyD88 affects bile acids, gut microbiota and metabolome contributing to regulate glucose and lipid metabolism. Gut. 2017;66(4):620-32.

20. Singh AK, Singh R, Kota SK. Bariatric surgery and diabetes remission: Who would have thought it? Indian J Endocrinol Metab. 2015;19(5):563-76.

21. Middelbeek RJ, James-Todd T, Patti ME, Brown FM. Short-term insulin requirements following gastric bypass surgery in severely obese women with type 1 diabetes. Obes Surg. 2014;24(9):1442-6.

178

Arch Endocrinol Metab. 2018;62/2

original article

Progranulin concentration in relation to bone mineral density among obese individuals Alireza Milajerdi1,2, Zhila Maghbooli1, Farzad Mohammadi2, Banafsheh Hosseini2, Khadijeh Mirzaei2

ABSTRACT Objective: Adipose tissue, particularly visceral adipose tissue, secretes a variety of cytokines, among which progranulin is a glycoprotein related to the immune system. Along with other secreted proteins, progranulin may be associated with bone mineral density.The aim of this study was to find out whether there are associations between the progranulin and bone mineral density among obese people. Subjects and methods: This cross-sectional study was conducted on 244 obese participants (aged 22-52). Serum progranulin, high sensitive C-reactive protein, oxidised-low dencity lipoprotein, tumor necrosis factor-α, parathormone, vitamin D, and interleukins of 1 β, 4, 6, 10, 13, and 17 concentrations were measured. Anthropometric measurements, body composition and bone mineral density were also assessed. Results: Serum progranulin was directly associated with interleukin-6 and interleukin-1β, while it had a negative association with interleukin-17 and tumor necrosis factor-α. We also observed a statistically significant direct association between progranulin concentration and visceral fat, abdominal fat, waist, abdominal and hip circumferences, hip T-score, and Z-score and T-score for the lumbar region. A partial correlation test has also shown a significant positive correlation regarding serum progranulin and the hip Z-score. Moreover, progranulin level is inversely associated with ospteopenia (P = 0.04 and CI: 0.17,0.96 ). Conclusion: Our study revealed that central obesity may be related to increased progranulin concentration. In addition, progranulin concentration was directly related to bone formation parameters, which indicates the protective effects of progranulin on bone density. Further studies are needed to clarify the exact mechanisms underlying these associations. Arch Endocrinol Metab. 2018;62(2):179-86

Endocrinology and Metabolism Clinical Sciences Institute, Tehran University of Medical Sciences, Tehran, Iran 2 Department of Community Nutrition, School of Nutritional Sciences and Dietetics, Tehran University of Medical Sciences (TUMS), Tehran, Iran 1

Correspondence to: Khadijeh Mirzaei Department of Community Nutrition, School of Nutritional Sciences and Dietetics, Tehran University of Medical Sciences (TUMS), Tehran, Iran P.O. Box: 14155-6117 – Tehran, Iran mirzaei_kh@tums.ac.ir Received on Nov/3/2016 Accepted on Mar/1/2017 DOI: 10.20945/2359-3997000000022

Keywords

INTRODUCTION

ompelling evidence indicates that obesity is associated with inflammation and immune system function (1,2). Due to the function of adipose tissue as an endocrine gland which secretes several cytokines, this association has frequently been attributed to central obesity (3). Indeed, some studies have regarded inflammation as a risk factor for osteoporosis (4,5). However, the precise mechanism underlying the role of inflammation as well as the association between obesity, inflammation and osteoporosis has not yet been clarified. Some data suggest that cytokines secreted from adipose tissue may play a major role in osteoporosis (6). Osteoporosis is considered as one of the most serious chronic diseases in the present century (7). According to the international definition, osteoporosis defined as a 2.5 Standard Deviation (SD) reduction in Bone Mineral Density (BMD) (8,9). Progranulin (PGRN) is a cytokine that is secreted from adipose tissue, and also, is a secretory 593-amino Arch Endocrinol Metab. 2018;62/2

acid glycoprotein with a widespread expression in different cells, such as immune system cells (10). PGRN is also regarded as a growth factor, similar to IGF-1, with inflammatory properties (11). There are some studies that suggested PGRN concentration is associated with the extent of visceral adiposity (12,13). It seems that PGRN can activate some inflammatory pathways (14) and, as mentioned, this can affect BMD (15) and facilitate the development of osteoporosis. Furthermore, a recent study by Romanello and cols. has suggested a proliferative and pro-survival effect of PGRN on osteocyte-like cells. The research demonstrated that PGRN can induce phosphorylation of mitogenactivated protein kinase in both HOBIT and osteocytic cells. Moreover, the authors reported that Risedronate, a bisphosphonate drug which has been widely used in the treatment of osteoporosis, induces the expression as well as the secretion of PRGN in the HOBIT secretome. These findings suggested the possible role of PGRN in osteoblast/osteocyte biology (16). 179

Bone mineral density; progranulin; obesity; osteopenia; cytokine

Progranulin and bone mineral density

The aim of this study was to find out whether there are associations between progranulin and bone mineral density among obese people.

MATERIALS AND METHODS Study population In this cross sectional study, 244 class I and II obese (30 ≤ BMI < 40 kg/m2) participants (22 to 52 years old) were recruited from Shariati hospital. The study protocol was approved by the ethics committee of the Endocrinology and Metabolism Research Center of Tehran University of Medical Sciences (TUMS) with the following identification: 90-03-27-14619. The inclusion criteria namely were having a BMI in the range of 30-39.99kg/m2, and being aged from 22-52. Exclusion criteria were defined as having any history of inflammatory conditions or inflammatory diseases, cardiovascular disease, diabetes mellitus, thyroid diseases, cancer or malignancies, hypertension or hypotensive drug abuse, hepatic, heart, or renal disease, chronic or acute infections, smoking, drug or alcohol abuse, and pregnancy. Each participant was completely informed regarding the study protocol and provided a written and informed consent form before taking part in the study.

Laboratory measurements All blood samples were collected from 8:00 to 10:00 a.m. after an 8-12 hours fast at the EMRC laboratory in Shariati hospital of TUMS. To collect serums, blood samples were centrifuged for 10 minutes at 3000 rpm. Serum samples were aliquoted and stored at -80ºC until they were analyzed. Serum high sensitive C-reactive protein (hsCRP), as a sensitive marker of inflammation, was measured by an imonoturbidimetric assay (Randox laboratories kit, Hitachi 902). Serum concentrations of adipokines (including interleukins of 1 β, 4, 6, 10, 13, and 17) were measured in triplicate and 10 replicates per EIA plate under internal quality controls. Serum concentration of interleukin 6 (IL-6) was analyzed by EIA kit (Enzo Life Sciences, Inc. Sensitivity: 3.75 pg/mL; inter-assay variability: 3.7%; intra-assay variability: 3.9%). Serum concentration of interlukin 4 (IL-4) was also assessed by EIA kit (Enzo Life Sciences, Inc. Sensitivity: < 2 pg/mL; in intra CV was 4.3% and interCV was 4.7%). TNF-α concentration was determined by EIA kit (Enzo Life Sciences, Inc. Sensitivity: 8.43 pg/mL; 180

inter-assay variability: 6%; intra-assay variability: 3.6%). Serum PGRN concentration was measured by ELISA kit (AdipoGen; Seoul, South Korea. Sensitivity: 32 pg/mL; inter-assay variability: 4.7%; intra-assay variability: 3.79%) under internal quality controls (17).

Anthropometric measurement Weights and heights were measured with participants wearing light clothes and without shoes. Weight was measured using a digital scale (Sega 707, Hamburg, Germany) to the nearest 0.1 kg. Height was measured using a stadiometer (Seca, Hamburg, Germany) to the nearest 0.1 cm. Body mass index (BMI) was calculated using the “weight(kg)/height2(m2)” equation. Waist circumference (WC) was measured in the middle point of the iliac crest and ribcage.

Body composition analysis Participant body composition was assessed by Body Composition Analyzer BC-418MA – Tanita (United Kingdom). This Bioelectrical Impedance Analyzer (BIA) sends out a very weak electric current across the body to measure its electrical resistance. Before assessing body composition, the manufacturer’s instructions were followed to ensure accurate assessment. Participants were asked not to exercise vigorously, put aside any electrical device (mobile phone, etc.), or to intake excessive fluid or food. As changes in bodywater distribution and body temperature can have a major impact on measurements, they were performed in the morning in a fasting condition (always urinating before taking measurements, etc.) to get a more accurate measurement every single time. To prevent inaccurately low body fat percentage measurements and other measurement errors, both arms were always held straight down when taking measurements. The device calculates the body fat percentage, fat mass and fat-free mass, and predicts the muscle mass on the basis of data obtained by dual-energy X-ray absorptiometry using bioelectrical impedance analysis (18).

BMD measurement In this study, BMD was measured by the Dual Energy X-ray Absorptiometery (DEXA) method at the hip and lumbar spine (vertebra L2-L4). The average coefficient of variation (CV) for measuring BMD in our device was 1.04%. According to the World Health Organization (WHO) standard, normal bone mass was defined as Arch Endocrinol Metab. 2018;62/2

Progranulin and bone mineral density

BMD ≥ -1 standard deviation (SD), osteopenia as -1 < BMD <-2.5 SD, and osteoporosis as BMD ≤ -2.5 SD. Osteoporosis was diagnosised based on the T-score (19).

Statistical analysis The study population was divided into two groups based on median PGRN concentration (< 113.30 and ≥ 113.30 pg/mL), then the study variables were compared among the two groups using an independent T-test. The association between serum PGRN concentration and BMD measurements was examined through a partial correlation test after adjusting for weight and fat mass. The level of statistical significance was set to < 0.05 All statistical analysis was performed using SPSS version 16.0 (Chicago, IL).

(Table 2). However, the association was statistically significant for visceral fat, trunk fat, waist, abdominal and hip circumferences (p < 0.05). We also found a higher mean of age (p = 0.17) and total body water (p = 0.28) in the high serum PGRN concentration group, which were not significant. In addition, a difference in the Central Adiposity Index (CAI) lower than 25 and above 75 centile value was seen in participants, with the following results reported: waist circumference was 95.83 cm ± 3.64 SE and 98.16 ± 1.97 in participants in

Table 1. Population characteristics, body composition, bone mineral density and laboratory measurements of the participants Variables

Men (n = 57)

Women (n = 187)

Age (years)

37.10 ± 12.77

39.60 ± 11.68

Weight (kg)

108.42 ± 15.74

90.15 ± 12.14

The particpants’ mean (±SD) of age, height, BMI, and weight were 39.12 ± 11.90 years, 162.42 ± 8.80 cm, 35.32 ± 3.98 kg/m2, and 93.68 ± 14.75 kg, respectively. The mentioned variables were 37.10 ± 12.77 years, 176.44 ± 6.89 cm, 35.30 ± 3.49 kg/m2, and 108.42 ± 15.74 kg respectively, in men, and 39.60 ± 11.68 years, 159.87 ± 6.38 cm, 35.33 ± 4.10 kg/m2, and 90.15 ± 12.14 kg, respectively in women. From 244 participants, 68 subjects (27.86%) were osteopenic and 176 individuals (72.14%) had normal BMD. The population characteristics, body composition, BMD, and laboratory measurements of participants are summarized in Table 1. As shown in the table, mean serum parathyroid hormone (PTH) and vitamin D (VitD) concentrations of participants were above and within the normal ranges respectively (10-55 pg/mLfor PTH and 30-74 ng/mL for VitD). The visceral fat rating showed that central obesity may be more serious in men compared to women (Table 1). Additionally, the DEXA assay showed an osteopenic condition only in the lumbar spine (L2-L4) of women, when BMD was expressed as mean ± (SD) T-score (T-score < -1).

Height (21)

176.44 ± 6.89

159.87 ± 6.38

BMI (kg/cm2)

35.30 ± 3.49

35.33 ± 4.10

Fat percent (%)

30.11 ± 4.23

42.43 ± 4.75

Fat mass (kg)

32.98 ± 8.22

38.48 ± 8.21

Fat-free mass (kg)

75.41 ± 9.53

51.66 ± 6.57

Visceral fat rating (kg)

14.24 ± 4.05

9.99 ± 2.46

Trunk fat percent (%)

20.80 ± 4.67

18.75 ± 4.37

119.22 ± 30.13

120.86 ± 44.02

Vitamin D (ng/mL)

32.43 ± 4.50

38.28 ± 36.39

Hs-CRP (mg/L)

2.35 ± 2.32

4.75 ± 5.86

Ox-LDL (U/dL)

556.31 ± 58.85

583.02 ± 85.54

TNF-α (pg/mL)

13.68 ± 30.92

7.67 ± 14.01

PTH (pg/mL)

84.74 ± 54.19

89.89 ± 49.90

IL-1β (pg/mL)

0.01 ± 0.00

IL-4 (pg/mL)

1.47 ± 0.86

1.81 ± 1.07

IL-6 (pg/mL)

30.28 ± 18.99

24.09 ± 20.66

IL-10 (pg/mL)

31.85 ± 38.65

14.12 ± 15.44

IL-13 (pg/mL)

32.35 ± 33.60

41.61 ± 30.41

IL-17 (pg/mL)

0.28 ± 0.13

0.95 ± 1.33

Hip BMD

1.17 ± 0.16

1.08 ± 0.16

Association between PGRN, anthropometric measures, and body composition

Hip T-score

0.64 ± 1.27

0.58 ± 1.10

Hip Z-score

0.18 ± 1.03

0.22 ± 0.99

Lumbar BMD

1.24 ± 0.18

1.19 ± 0.16

Lumbar T-score

0.24 ± 1.58

-0.10 ± 1.17

Lumbar Z-score

-0.48 ± 1.45

-0.68 ± 1.13

Anthropometry:

Our analysis revealed that mean BMI, fat percentage, fat mass, fat free mass, visceral fat, trunk fat, waist circumference, abdominal and hip circumferences were greater in the high serum PGRN concentration group compared to the low serum PGRN concentration one Arch Endocrinol Metab. 2018;62/2

Biochemistry characteristics: Progranulin (pg/mL)

Bone densitometry:

BMI: body mass index; Hs-CRP: high sensitive C-reactive protein; TNF-α: tumor necrosis factor-α; IL: interleukin; Ox-LDL: oxidized-low density lipoprotein; PTH: parathormone; BMD: bone mineral density.

181

RESULTS

Progranulin and bone mineral density

the lower than 25 and above 75 centile for progranulin value, respectively, which was not significant (P-value = 0.12). Results also highlighted values of WHR (0.86 ± 0.01 and 0.87 ± 0.01 and P-value = 0.75), visceral fat (6.30 ± 0.66 and 7.88 ± 0.41 and P-value < 0.0001) and BMI (27.85 ± 1.12 and 31.06 ± 0.65 and P-value = 0.001) in lower than 25 and above 75 centile for progranulin value, respectively. Table 2. Anthropometric measures and body composition between groups with low and high concentrations of PGRN Relative PGRN concentration (n = 244) Variables

Low concentration (n = 122)

High concentration (n = 122)

P value

Age (years)

38.08 ± 12.86

40.16 ± 11.22

0.17

BMI (kg/cm2)

34.54 ± 3.85

35.12 ± 4.44

0.27

Fat percent (%)

40.79 ± 6.56

40.86 ± 6.32

0.93

Fat mass (kg)

36.32 ± 8.86

37.40 ± 9.00

0.34

Fat-free mass (kg)

52.50 ± 9.53

53.76 ± 8.98

0.28

Visceral fat rating (kg)

9.56 ± 2.94

10.45 ± 2.71

0.01

Trunk fat percent (%)

17.57 ± 5.42

19.13 ± 4.39

0.01

Table 3. Cytokine concentrations between groups with low and high concentrations of PGRN Relative PGRN concentration (n = 244) Variables

Low concentration (n = 122)

High concentration (n = 122)

P value

Waist circumference (21)

97.00 ± 9.99

101.56 ± 9.46

< 0. 001

Hs-CRP (mg/L)

4.91 ± 4.98

4.73 ± 6.99

0.81

Abdominal circumference (21)

111.42 ± 8.88

116.45 ± 10.56

< 0. 001

TNF-α (pg/mL)

10.67 ± 19.68

3.53 ± 2.09

< 0.001

Hip circumference (21)

114.00 ± 7.09

118.38 ± 11.55

< 0.001

IL-1β (pg/mL)

0.01 ± 0.00

0.02 ± 0.01

< 0.001

TBW (%)

38.42 ± 6.99

39.36 ± 6.57

0.28

BMI: body mass index; TBW: total body water.

Association between PGRN and other cytokines According to an independent T-test, mean serum concentrations of IL-1β, IL-13, Il-10, Il-6, and Il-4 were greater in those in the high serum PGRN concentration group (Table 3), while mean serum levels of IL-17, TNF-α, and hs-CRP were lower in the high PGRN concentration group compared to the low serum PGRN concentration one. However, it should be noted that these associations were statistically significant only for IL-1β, IL-17, IL-6, and TNF-α (p < 0.05).

T-score and Z-score and the lumbar T-score (p < 0.05) and was marginally significant considering total BMD (p = 0.05). Moreover, a partial correlation between serum PGRN concentration and BMD measurements adjusted for fat mass, indicated a significant positive correlation with hip Z-score (r = 0.35, p < 0.05). However, after factoring in weight, none of the observed correlations were significant (Table 5, part A). Additionally, a binary regression analysis was done to strengthen our findings, (as shown in Table 5, part B). After adjustment for age and BMI, the PGRN level was strongly and inversely associated with osteopenia (P = 0.04 and CI: 0.17,0.96). Figure 1 demonstrates that there was a significantly lower number of osteopenic patients in the high serum PGRN concentration group.

IL-4 (pg/mL)

2.02 ± 1.35

2.21 ± 0.79

0.18

IL-6 (pg/mL)

16.68 ± 11.80

28.29 ± 28.15

< 0.001

IL-10 (pg/mL)

12.43 ± 12.21

15.51 ± 22.45

0.18

IL-13 (pg/mL)

41.83 ± 29.24

47.01 ± 31.44

0.18

IL-17 (pg/mL)

1.31 ± 1.55

0.45 ± 0.61

< 0.001

Hs-CRP: high sensitive C-reactive protein; TNF-α: tumor necrosis factor-α; IL: interleukin.

Table 4. Bone mineral density measurements between groups with low and high concentrations of PGRN Relative PGRN concentration (n = 244) Variables

Low concentration (n = 122)

High concentration (n = 122)

P value

Vitamin D (ng/mL) PTH (pg/mL)

32.76 ± 35.92

28.69 ± 13.99

0.24

92.00 ± 56.76

105.74 ± 63.04

0.09

1.07 ± 0.23

1.12 ± 0.17

0.05

Association between PGRN and bone health variables

Hip BMD

According to an independent T-test, mean hip BMD and hip T-score and Z-score, as well as T-score and Z-score for the lumbar spine (L2-L4 vertebra) were greater in the high serum PGRN concentration group (Table 4). However, it should be noted that these associations were statistically significant only for hip

Hip T-score

0.18 ± 0.79

1.05 ± 1.50

< 0.001

Hip Z-score

-0.13 ± 0.89

0.68 ± 1.30

< 0.001

182

Lumbar BMD

1.15 ± 0.13

1.18 ± 0.16

0.10

Lumbar T-score

-0.41 ± 1.16

-0.08 ± 1.36

0.04

Lumbar Z-score

-0.85 ± 1.07

-0.61 ± 1.38

0.13

BMD: bone mineral density; PTH: parathormone. Arch Endocrinol Metab. 2018;62/2

Progranulin and bone mineral density

Table 5. A: Partial correlation between PGRN concentration and bone mineral density measurements Hip BMD

Hip T-score

Hip Z-score

Lumbar BMD

Lumbar T-score

Lumbar Z-score

r Weight P value

0.21 0.25

0.32 0.75

0.33 0.65

0.24 0.19

0.24 0.18

0.26 0.15

r Fat mass P value

0.19 0.30

0.33 0.06

0.35 0.04

0.22 0.22

0.23 0.21

0.26 0.14

Adjusted for Progranulin concentration (pg/mL)

BMD: bone mineral density.

B: Binary regression model for analyzing the relationship between Progranulin Concentration and risk of osteopenia in obese people Crude model

PGRN

Model 1

Model 2

Model 3

B ± SE

-0.47 ± 0.32

0.33, 1.69

0.14

-0.52 ± 0.33

0.30, 1.30

0.11

-0.90 ± 0.99

0.17, 0.96

0.04

-0.81 ± 0.44

CI 0.18, 1.07

P 0.07

100.00% 90.00%

Non osteopenic

Osteopenic

80.00% 70.00% Percent

60.00% 50.00%

59.74% 54.49% 45.50%

40.00%

40.25%

30.00% 20.00% 10.00% 0.00%

Low High Catagorized progranulin level

Figure 1. Variety of osteopenia by categorized progranulin level.

Additionally, we found that serum PTH was greater in the high serum PGRN concentration group (p = 0.09), while vitamin D was lower in this group, in comparision with those who had lower serum concentrations of PGRN (p = 0.24). However, none of them were statistically significant. Meanwhile, comparing the prevalence of osteopenia among these two groups indicated that the osteopenic patients had considerably lower serum PRGN concentrations (Figure 1).

DISCUSSION In the current study, a significant association was found between PGRN concentration and the serum levels of some cytokines, which can be explained by the regulatory roles of PGRN on signaling pathways. To Arch Endocrinol Metab. 2018;62/2

illustrate this, it can be observed that serum PGRN was directly associated with the levels of serum IL-1β and Il-6, while it was inversely related to IL-17 and TNF-α serum levels. Results also showed significant associations between PGRN concentration and visceral and trunk fat. Increased hip, waist and abdominal circumferences were also observed in the higher concentration PGRN group. Furthermore, high PGRN was related to higher hip T- and Z-score and also lumbar T-score. These findings agreed with Zhang and cols.’s study, which found a significant linear correlation between PGRN concentration and IL-6 serum levels in patients with primary Sjögren’s syndrome (20). Frampton and cols. also have reported that Il-6 can activate the ERK1/2/RSK1/C/EBPβ pathway and PGRN synthesis as a consequence (21). Furthermore, several studies have shown that PGRN may antagonize TNF-α by the activation of its receptors, therefore PGRN may have some anti-inflammatory properties (22). Studies have also regarded TNF-α as an inhibitor of osteoblast differentiation, as well as an activator of osteoclastogenesis (23). According to previous studies, IL-6 and IL-1β induce bone resorption and inhibit bone formation (24). Although it has been widely reported that IL-17 mediates diverse inflammatory processes, its effects on bone resorption has recently been documented (25). It seems that IL-17 and TNF-α synergically stimulate bone resorption (26). This study demonstrated a significant linear association between PGRN concentration and central obesity parameters including visceral fat, abdominal fat, 183

Model 1: Adjusted for age; Model 2: Adjusted for age and BMI; Model 3: Adjusted for age, BMI and gender; PGRN: Progranulin

Progranulin and bone mineral density

waist, abdominal and hip circumferences. Along the same lines as these findings, previous studies have found that the PGRN gene expresses in macrophages existing in fat tissues, especially visceral fat (12,13). Youn and cols. reported that PGRN concentration was significantly associated with central and general obesity parameters, which can be described by stimulating omental adipose tissue macrophage infiltration by PGRN (13). Pradeep and cols. measured PGRN concentrations in serum and gingival crevicular fluid of 40 patients suffering from chronic periodentitis with and without obesity. The authors reported that the serum PGRN concentration was higher in both serum and gingival crevicular fluid in obese periodentitic patients; which can indicate that inflammation related to periodentitis and obesity may also be associated with PGRN concentration (27). In agreement with these findings, Hossein-Nezhad and cols. demonstrated an association between BMI and central obesity with PGRN gene expression and circulation levels, which revealed that PGRN is related to obesity through glucose homeostasis and metabolism regulation (28). Since we observed a linear association between PGRN concentration and central obesity parameters, changes in the secretion of cytokines may be attributed to adipose tissue expansion. Similarly, Zizza and cols.’s study found a negative association between IL-17 and visceral obesity (29). Furthermore, Mohamed-Ali’s study showed that subcutaneous fat was associated with IL-6 but not with TNF-α (30). Results from previous studies have indicated that visceral fat, as well as subcutaneous fat, as measured by computer tomography scan, and BMI have a negative association with bone density. More importantly, correlations regarding visceral fat and decreased bone density remained statistically significant even after adjustment for age, sex, and BMI (31). This study’s findings demonstrate PGRN’s effect on osteogenesis, as can be seen in the hip T-score and Z-score and T-score for the lumbar vertebra, which were significantly associated with PGRN concentration. Similarly to this study, Romanello and cols. demonstrated the proliferative and pro-survival effects of PRGN on osteocyte-like cells (16). Likewise, a recent study by Oh and cols. indicated a new regulatory axis by which PGRN may induce osteoclastogenesis. This axis is regarded as the (RANKL)/RANK axis, and PGRN may induce this pathway by stimulating PIRO expression (32). Documented results showed that recombinant 184

human PGRN can induce phosphorylation of mitogenactivated protein kinase in both HOBIT and osteocytic cells and induce cell proliferation and survival. Moreover, they found that Risedronate, a widely used bisphosphonate drug in the treatment of osteoporosis, can induce the expression and secretion of PGRN in the HOBIT secretome (16). These findings have shown the probable preventive effects of PGRN on osteoporosis by modulating bone loss. In addition, results from previous studies reported that PGRN growth factor enhances chondrocyte differentiation and endochondral ossification by regulating BMP-2 and TNF signaling, therefore PGRN injections may play an important role in bone healing, particularly in fracture conditions (33). A disadvantage of the present cross-sectional study is that it does not allow definite conclusions to be made regarding cause and effect. PGRN might affect BMD or vice versa. In conclusion, the findings of this study showed that central obesity expansion is associated with increased PGRN concentration. PGRN has some paradoxical relation with the levels of cytokine secretion, in that it has a direct association with the secretion of IL-1β and IL-6, while it inhibits the secretion of IL-17 and TNF-α. According to the aforementioned mechanisms, these changes in cytokine secretion have both degenerative and protective effects on bone structure and BMD. Aditionally, the association between obesity and bone mineral density has been demonstrated by several studies, though its effects depend on the definition of obesity; if obesity is regarded as increased body fat levels, it can be considered as a risk factor for a lower BMD, which can be affected by increased adipokines, subsequently causing a lower BMD (34). However, obesity seems to play its role as a protective factor against osteoporosis if it is defined as an increase in body weight, which can be explained by a higher level of circulating estradiol, increased peak bone mass and greater gravitational load (35). The direct observed association between PGRN concentration and bone formation parameters indicates that PGRN may have some bone-protective effects through various mechanisms other than cytokine secretion regulation. Further studies are needed to address the cellular and molecular mechanisms of both general and central obesity, as well as PGRN’s effects on bone formation and absorption. Authors’ contributions: study concept and design: Khadijeh Mirzaei; acquisition of data: Khadijeh Mirzaei and Alireza Milajerdi; Arch Endocrinol Metab. 2018;62/2

Progranulin and bone mineral density

Acknowledgment: we are particularly grateful to all participants in the study for their dedication and contribution to the research. This study was supported by Tehran University of Medical Sciences Grant for research (ID: 14619, 31818). Disclosure: no potential conflict of interest relevant to this article was reported.

REFERENCES 1.

Bastard JP, Maachi M, Lagathu C, Kim MJ, Caron M, Vidal H, et al. Recent advances in the relationship between obesity, inflammation, and insulin resistance. Eur Cytokine Netw. 2006;17(1):4-12.

2. de Heredia FP, Gómez-Martínez S, Marcos A. Obesity, inflammation and the immune system. Proc Nutr Soc. 2012;71(2):332-8. 3. Panagiotakos DB, Pitsavos C, Yannakoulia M, Chrysohoou C, Stefanadis C. The implication of obesity and central fat on markers of chronic inflammation: The ATTICA study. Atherosclerosis. 2005 Dec;183(2):308-15. 4. Al-Daghri NM, Yakout S, Al-Shehri E, Al-Fawaz HA, Aljohani N, Al-Saleh Y. Inflammatory and bone turnover markers in relation to PTH and vitamin D status among saudi postmenopausal women with and without osteoporosis. Int J Clin Exp Med. 2014;7(10):3528-35. 5. Zhang J, Fu Q, Ren Z, Wang Y, Wang C, Shen T, et al. Changes of serum cytokines-related Th1/Th2/Th17 concentration in patients with postmenopausal osteoporosis. Gynecol Endocrinol. 2015;31(3):183-90. 6. Gonnelli S, Caffarelli C, Nuti R. Obesity and fracture risk. Clin Cases Miner Bone Metab. 2014;11(1):9-14. 7. Kehler T. Epidemiology of osteoporosis and osteoporotic fractures. Reumatizam. 2014;61(2):60-4. 8. World Health Organization. Assessment of Fracture Risk and Its Application to Screening for Postmenopausal Osteoporosis. Technical Report Series 843. Geneva: WHO, 1994. 9. Mahan L, Escott-Stump S, Raymond JL, Krause MV. Krause’s Food & the Nutrition Care Process, (Krause’s Food & Nutrition Therapy). Philadelphia: WB Saunders. Elsevier; 2012. 10. Luo L, Lü L, Lu Y, Zhang L, Li B, Guo K, et al. Effects of hypoxia on progranulin expression in HT22 mouse hippocampal cells. Mol Med Rep. 2014;9(5):1675-80. 11. Wei Z, Huang Y, Xie N, Ma Q. Elevated expression of secreted autocrine growth factor progranulin increases cervical cancer growth. Cell Biochem Biophys. 2015;71(1):189-93. 12. Tanaka Y, Takahashi T, Tamori Y. Circulating progranulin level is associated with visceral fat and elevated liver enzymes: significance of serum progranulin as a useful marker for liver dysfunction. Endocr J. 2014;61(12):1191-6.

15. Katsuyama E, Miyamoto H, Kobayashi T, Sato Y, Hao W, Kanagawa H, et al. Interleukin-1 receptor-associated kinase-4 (IRAK4) promotes inflammatory osteolysis by activating osteoclasts and inhibiting formation of foreign body giant cells. J Biol Chem. 2015;290(2):716-26. 16. Romanello M, Piatkowska E, Antoniali G, Cesaratto L, Vascotto C, Iozzo RV, et al. Osteoblastic cell secretome: a novel role for progranulin during risedronate treatment. Bone. 2014;58:81-91. 17. Hossein-Nezhad A, Mirzaei K, Ansar H, Khooshechin G, Ahmadivand Z, Keshavarz SA. Mutual role of PGRN/TNF-α on osteopenia developing in obesity’s inflammation state. Minerva Med. 2012;103(3):165-75. 18. Mirzaei K, Hossein-Nezhad A, Emamgholipour S, Ansar H, Khosrofar M, Tootee A, et al. An exonic peroxisome proliferator-activated receptor-γ coactivator-1α variation may mediate the resting energy expenditure through a potential regulatory role on important gene expression in this pathway. J Nutrigenet Nutrigenomics. 2012;5(2):59-71. 19. Hossein-Nezhad A, Khoshniat Nikoo M, Mirzaei K, Mokhtarei F, Aghaei Meybodi HR. Comparison of the bone turn-over markers in patients with multiple sclerosis and healthy control subjects. Eur J Inflamm. 2010;8(2):67-73. 20. Zhang N, Yang N, Chen Q, Qiu F, Li X. Upregulated expression level of the growth factor, progranulin, is associated with the development of primary Sjögren’s syndrome. Experimental and therapeutic medicine. 2014;8(5):1643-7. 21. Frampton G, Invernizzi P, Bernuzzi F, Pae HY, Quinn M, Horvat D, et al. Interleukin-6-driven progranulin expression increases cholangiocarcinoma growth by an Akt-dependent mechanism. Gut. 2012;61(2):268-77. 22. Tian Q, Zhao S, Liu C. A solid-phase assay for studying direct binding of progranulin to TNFR and progranulin antagonism of TNF/TNFR interactions. Methods Mol Biol. 2014;1155:163-72. 23. Lam J, Takeshita S, Barker JE, Kanagawa O, Ross FP, Teitelbaum SL. TNF-alpha induces osteoclastogenesis by direct stimulation of macrophages exposed to permissive levels of RANK ligand. J Clin Invest. 2000;106(12):1481-8. 24. Ishimi Y, Miyaura C, Jin CH, Akatsu T, Abe E, Nakamura Y, et al. IL-6 is produced by osteoblasts and induces bone resorption. J Immunol. 1990;145(10):3297-303. 25. Boron% D, Agnieszka SM, Daniel K, Anna B, Adam K. Polymorphism of interleukin-17 and its relation to mineral density of bones in perimenopausal women. Eur J Med Res. 2014;19:69. 26. Shen F, Ruddy MJ, Plamondon P, Gaffen SL. Cytokines link osteoblasts and inflammation: microarray analysis of interleukin-17- and TNF-alpha-induced genes in bone cells. J Leukoc Biol. 2005;77(3):388-99. 27. Pradeep AR, Priyanka N, Prasad MV, Kalra N, Kumari M. Association of progranulin and high sensitivity CRP concentrations in gingival crevicular fluid and serum in chronic periodontitis subjects with and without obesity. Dis Markers. 2012;33(4):207-13. 28. Hossein-Nezhad A, Mirzaei K, Ansar H, Emam-Gholipour S, Tootee A, Keshavarz SA, et al. Obesity, inflammation and resting energy expenditure: possible mechanism of progranulin in this pathway. Minerva Endocrinol. 2012;37(3):255-66. 29. Zizza A, Guido M, Grima P. Interleukin-17 regulates visceral obesity in HIV-1-infected patients. HIV Med. 2012;13(9):574-7.

13. Youn BS, Bang SI, Klöting N, Park JW, Lee N, Oh JE, et al. Serum progranulin concentrations may be associated with macrophage infiltration into omental adipose tissue. Diabetes. 2009;58(3):627-36.

30. Mohamed-Ali V, Goodrick S, Rawesh A, Katz DR, Miles JM, Yudkin JS, et al. Subcutaneous adipose tissue releases interleukin-6, but not tumor necrosis factor-alpha, in vivo. J Clin Endocrinol Metab. 1997;82(12):4196-200.

14. Ong CHP, Zhiheng H, Kriazhev L, Shan X, Palfree RGE, Bateman A. Regulation of progranulin expression in myeloid cells. Am J Physiol Regul Integr Comp Physiol. 2006;291(6): R1602-R12.

31. Zhang P, Peterson M, Su GL, Wang SC. Visceral adiposity is negatively associated with bone density and muscle attenuation. Am J Clin Nutr. 2015;101(2):337-43.

Arch Endocrinol Metab. 2018;62/2

185

analysis and interpretation of data: Khadijeh Mirzaei and Alireza Milajerdi; drafting of the manuscript: Alireza Milajerdi, Banafshe Hosseini and Farzad Mohammadi; critical revision of the manuscript for important intellectual content: Khadijeh Mirzaei, Alireza Milajerdi and Farzad Mohammadi; statistical analysis: Khadijeh Mirzaei; administrative, technical, and material support: Khadijeh Mirzaei and Zhila Maghbooli; study supervision: Khadijeh Mirzaei.

Progranulin and bone mineral density

32. Oh J, Kim JY, Kim HS, Oh JC, Cheon YH, Park J, et al. Progranulin and a five transmembrane domain-containing receptor-like gene are the key components in receptor activator of nuclear factor ÎşB (RANK)-dependent formation of multinucleated osteoclasts. J Biol Chem. 2015;290(4):2042-52.

35. Shetty S, Kapoor N, Naik D, Asha HS, Prabu S, Thomas N. Osteoporosis in healthy South Indian males and the influence of life style factors and vitamin D status on bone mineral density. J Osteoporosis. 2014;2014: ID 723238.

33. Zhao YP, Tian QY, Frenkel S, Liu CJ. The promotion of bone healing by progranulin, a downstream molecule of BMP-2, through interacting with TNF/TNFR signaling. Biomaterials. 2013;34(27):6412-21.

34. Aguirre L, Napoli N, Waters D, Qualls C, Villareal DT, ArmamentoVillareal R. Increasing adiposity is associated with higher adipokine levels and lower bone mineral density in obese older adults. J Clin Endocrinol Metab. 2014;99(9):3290-7.

186

Arch Endocrinol Metab. 2018;62/2

original article

Impact of self-reported fasting duration on lipid profile variability, cardiovascular risk stratification and metabolic syndrome diagnosis Carolina Castro Porto Silva Janovsky1, Antonio Laurinavicius2, Fernando Cesena2, Viviane Valente2, Carlos Eduardo Ferreira3, Cristovão Mangueira3, Raquel Conceição2, Raul D. Santos4, Marcio Sommer Bittencourt5

ABSTRACT Objective: We sought to investigate the impact of self-reported fasting duration times on the lipid profile results and its impact on the cardiovascular risk stratification and metabolic syndrome diagnosis. Subjects and methods: We analyzed data from all consecutive individuals evaluated in a comprehensive health examination at the Hospital Israelita Albert Einstein from January to December 2015. We divided these patients in three groups, according to the fasting duration recalled (< 8h, 8-12h and > 12h). We calculated the global cardiovascular risk and diagnosed metabolic syndrome according to the current criteria and estimated their change according to fasting duration. Results: A total of 12,196 (42.3 ± 9.2 years-old, 30.2% females) patients were evaluated. The distribution of cardiovascular risk was not different among groups defined by fasting duration in both men and women (p = 0.547 for women and p = 0.329 for men). Similarly, the prevalence of metabolic syndrome was not influenced by the fasting duration (p = 0.431 for women and p = 0.166 for men). Conclusion: Self-reported fasting duration had no significant impact on the lipid profile results, including triglyceride levels. Consequently, no changes on the cardiovascular risk stratification using the Framingham risk score nor changes on the prevalence of metabolic syndrome were noted. Arch Endocrinol Metab. 2018;62(2):187-92 Keywords Triglycerides; cardiovascular risk; metabolic syndrome; fasting

Endocrinologia e Metabolismo, Universidade Federal de São Paulo (Unifesp); Medicina Preventiva, Hospital Israelita Albert Einstein (HIAE), São Paulo, SP, Brasil 2 Medicina Preventiva, Hospital Israelita Albert Einstein (HIAE), São Paulo, SP, Brasil 3 Laboratório Clínico, Hospital Israelita Albert Einstein (HIAE), São Paulo, SP, Brasil 4 Medicina Preventiva, Hospital Israelita Albert Einstein (HIAE); Instituto do Coração, Hospital das Clínicas, Faculdade de Medicina da Universidade de São Paulo (InCor-HCFMUSP), São Paulo, SP, Brasil 5 Faculdade de Medicina – Medicina Preventiva, Hospital Israelita Albert Einstein (HIAE), São Paulo, SP, Brasil 1

Correspondence to: Carolina C. P. S. Janovsky Av. Brasil, 953 – Jardim Paulista 01431-000 – São Paulo, SP, Brasil carolina.janovsky@gmail.com Received on May/17/2017 Accepted on Oct/29/2017

INTRODUCTION

urrent guidelines on screening for cardiovascular risk rely on the measurement of plasma cholesterol levels as part of the initial risk stratification (1-3). Those guidelines also recommend that the lipid panel measurement should be performed after an 8- to 12-hour fast. This fasting request is proposed as a way to eliminate any interference of the postprandial lipid levels, particularly for triglycerides, and to allow the use of previously validated cut-offs for diagnosis and management of dyslipidemia (3,4). However, this long fasting period may be cumbersome and may lead to important logistic difficulties to patients. Interestingly, prior evidence suggests that the lipid profile variability is relatively small in healthy individuals (5,6). Other groups have already analyzed the interference Arch Endocrinol Metab. 2018;62/2

of fasting on the lipid profile, and their results suggest that less than 12-hour fasting may offer important logistic advantages with minimal impact on the lipid panel results or cardiovascular risk stratification (7-9). Despite those previous results on the lipid profile variability, few studies (10,11) have evaluated the impact of the fasting duration on cardiovascular risk stratification or metabolic syndrome diagnosis. Such information is necessary as the clinical relevance of the lipid profile variability mainly depends on its effects on cardiovascular risk stratification and, hence, on the clinical decision-making process. Therefore, in the present study we sought to investigate the impact of self-reported fasting duration time on the lipid profile results and its impact on the cardiovascular risk stratification and metabolic syndrome diagnosis. 187

DOI: 10.20945/2359-3997000000023

Fasting duration, CV risk & metabolic syndrome

SUBJECTS AND METHODS We selected all consecutive individuals evaluated at the Hospital Israelita Albert Einstein from January to December 2015. This evaluation was part of an executive checkup program paid by the employers from their organizations. The protocol includes extensive clinical and laboratory evaluations. The Ethical Committee of the Hospital Israelita Albert Einstein approved this study and the consent form was waived as the research is based on database analysis and no additional patient contact was needed. Participants were questioned about previous presence of dyslipidemia, systemic arterial hypertension (previous diagnosis, use of anti-hypertensive medicines or measured blood pressure ≥ 140/90 mmHg), diabetes (previous use of medicines for diabetes or fasting glycemia > 126 mg/dL) and smoking (consumption of at least one cigarette per day within the last 30 days). Body mass index (BMI) was measured using the weight/height2 (kg/m2) formula. The abdominal circumference was measured by a trained nutritionist and was considered abnormal when above 94 cm for men and 80 cm for women. We included patients between 20 and 80 years of age and excluded those taking statins or with liver problems. When the patients made the appointment for the comprehensive health examination, they were oriented to fast for at least 12 hours. On the day of the exam, they were asked about how long they have been fasting. Independently of the fasting time, all exams were collected. Therefore, the patients were analyzed considering the period of time they self-reported they were fasting. We divided these patients in three groups, according to self-reported fasting duration: less than 8 hours fasting, between 8 and 12 hours and more than 12 hours fasting. We calculated the general cardiovascular risk, considering gender, age, systolic blood pressure, smoking, presence of diabetes, use of anti-hypertensive agents, HDL-cholesterol levels and total cholesterol levels. If the risk was lower than 10% in 10 years, it was considered low risk; between 10 and 20%, intermediate risk and higher than 20%, high risk for cardiovascular events in 10 years (12). This score calculates the risk of coronary death, myocardial infarction, coronary insufficiency, angina, ischaemic stroke, hemorrhagic stroke, transient ischemic attack, peripheral artery disease and heart failure in 10 years. 188

The diagnosis of metabolic syndrome was made if waist circumference was abnormal (≥ 94 cm in men and 80 cm in women) and at least two of these four elements were impaired: HDL-cholesterol, triglycerides, glycemia and blood pressure (13). The measurement of lipoproteins (total cholesterol, HDL-C and triglycerides) was performed in automated equipment VITROS 5600® Ortho Clinical Diagnostics by dry chemical colorimetric method. The LDL-C was calculated by Fridewald formula for triglycerides for concentrations up to 250 mg/dL. For values greater than 250 mg/dL, direct LDL-C was performed in automated equipment VITROS 5600® Ortho Clinical Diagnostics by endpoint methodology. The LDL-C calculated loses correlation when compared to the gold standard that is ultracentrifugation. The higher the triglyceride value, the worst is this relationship (14). For this reason we use the calculation for values up to 250 mg/dL keeping the routine used by Albert Einstein Hospital laboratory.

Statistical analysis Continuous variables are presented as means and standard deviation or medians and quartiles, as appropriate, and compared using one-way ANOVA or Kruskal-Wallis test. Categorical variables are presented as absolute numbers and proportions, and compared using chi-square test. In order to accommodate the significant difference in the distribution of gender across fasting duration, different cardiovascular risk calculators and differences in the definition of metabolic syndrome, we chose to perform a gender-stratified analysis across fasting duration groups. Additionally, in order to adjust for the potential confounding effect of age, gender and waist circumference across the fasting duration groups, we chose to perform a multiple linear regression analysis on triglyceride levels. A level of significance of 0.05 was used. All analysis were performed using Stata version 13.0 (StataCorp, USA).

RESULTS We included 12,196 patients that were divided in three groups according to the self-reported fasting time. The baseline characteristics of these groups are shown in Table 1. Due to the large sample size, almost Arch Endocrinol Metab. 2018;62/2

Fasting duration, CV risk & metabolic syndrome

all information was statistically different between the groups, though the absolute differences were small. For triglycerides, a small, albeit significant, increase was noted with longer fasting duration. However, after adjustment for the confounding effects of age, gender and waist circumference, no significant difference in

triglyceride levels was observed (< 8 hours vs 8-12 hours: p = 0.114; < 8 hours vs > 12 hours: p = 0.220). Additionally, most risk factors were associated with triglyceride levels, though the median fasting duration was not different across triglycerides strata (Table 2). The small changes in the lipid profile across the fasting

Table 1. Baseline characteristics stratified according to fasting duration Total (n = 12,196)

Less than 8 h fasting (n = 1,829)

Between 8 and 12 h fasting (n = 5,515)

More than 12 h fasting (n = 4,852)

Male

8,514 (69.8)

949 (52)

4,031 (73.1)

3,534 (72.8)

< 0.001

Age (y)

42.3 ± 9.2

41.4 ± 9.0

42.5 ± 9.0

42.2 ± 9.4

< 0.001

BMI (kg/m )

26.3 ± 4.2

26.0 ± 4.5

26.2 ± 4.1

26.5 ± 4.2

< 0.001

Waist circumference (cm)

91 ± 15.0

89 ± 13.6

91 ± 12.5

92 ± 17.9

< 0.001

SBP (mmHg)

115.6 ± 12.0

114.6 ± 12.6

115.7 ± 12.0

115.9 ± 11.9

< 0.001

DBP (mmHg)

76.2 ± 8.2

76.4 ± 8.7

76.0 ± 8.1

76.3 ± 8.0

0.096

Total Cholesterol (mg/dL)

191.8 ± 34.4

193.6 ± 35.3

190.5 ± 34.5

192.7 ± 34.0

< 0.001

LDL-c (mg/dL)

118.5 ± 31.4

117.9 ± 32.3

118.1 ± 31.4

119.1 ± 31.1

0.236

HDL-c (mg/dL)

48.8 ± 14.0

51.8 ± 15.5

48.3 ± 13.6

48.2 ± 13.7

< 0.001

Tryglicerides (mg/dL)

124.3 ± 83.7

119.4 ± 82.4

121.6 ± 76.0

129.3 ± 83.7

< 0.001

Glucose (mg/dL)

87.0 ± 13.1

82.0 ± 12.6

87.9 ± 11.4

87.8 ± 14.5

< 0.001

HbA1c (%)

5.40 ± 0.5

5.37 ± 0.5

5.38 ± 0.5

5.42 ± 0.6

< 0.001

178 (1.5)

19 (1.0)

84 (1.6)

75 (1.6)

0.265

Hypertension

1331 (10.9)

175 (9.6)

607 (11.0)

549 (11.3)

0.119

Smoking

1049 (8.6)

175 (9.6)

447 (8.1)

427 (8.8)

0.029

11.7 (10.2-12.4)

5.2 (4.0-6.2)

11.2 (10.3-11.6)

12.6 (12.2-13.2)

0.001

Diabetes

Fasting duration (h)* Values are mean ± SD or n (%). * Median and quartiles.

BMI: body mass index; SBP: systolic blood pressure; DBP: diastolic blood pressure; LDL-c: low-density lipoprotein cholesterol; HDL-c: high-density lipoprotein cholesterol; HbA1c: glycated hemoglobin.

Tg < 150 mg/dL (n = 9,131)

Tg 150 – 400 mg/dL (n = 2,927)

Tg > 400 mg/dL (n = 124)

5,963 (65.31)

2,430 (83.02)

117 (94.35)

< 0.001

Age (y)

41.9 ± 9.3

43.4 ± 8.8

42.8 ± 8.2

< 0.001

BMI (kg/m2)

25.7 ± 4.0

28.2 ± 4.2

28.5 ± 3.8

< 0.001

Waist circumference (cm)

88.8 ± 15.4

97.5 ± 11.8

99.2 ± 10.1

< 0.001

SBP (mmHg)

114.2 ± 11.7

119.6 ± 12

123.6 ± 12.0

< 0.001

Male

DBP (mmHg)

75.2 ± 8

79.1 ± 8

81.3 ± 8.2

< 0.001

185.5 ± 32

209.9 ± 34

232.2 ± 38.5

< 0.001

LDL-c (mg/dL)

115.8 ± 30.5

127.5 ± 32.1

100.6 ± 35.4

< 0.001

HDL-c (mg/dL)

51.5 ± 13.8

41.2 ± 11.1

31.3 ± 7.4

< 0.001

Glucose (mg/dL)

85.6 ± 10

90.7 ± 18.3

98.7 ± 30.3

< 0.001

HbA1c (%)

5.4 ± 0.4

5.5 ± 0.7

5.8 ± 1.2

< 0.001

Diabetes

90 (1.0)

79 (2.7)

9 (7.3)

< 0.001

Hypertension

826 (9.1)

481 (16.4)

23 (18.6)

< 0.001

Smoking

710 (7.8)

324 (11.1)

14 (11.3)

< 0.001

11.7 (10.1-12.4)

11.8 (10.5-12.5)

11.5 (10-12.3)

< 0.0001

Total Cholesterol (mg/dL)

Fasting duration (h)* Values are mean ± SD or n (%). * Median and quartiles.

BMI: body mass index; SBP: systolic blood pressure; DBP: diastolic blood pressure; LDL-c: low-density lipoprotein cholesterol; HDL-c: high-density lipoprotein cholesterol; HbA1c: glycated hemoglobin. Arch Endocrinol Metab. 2018;62/2

189

Table 2. Baseline characteristics stratified according to triglycerides levels

Fasting duration, CV risk & metabolic syndrome

duration groups did not impact the overall distribution of cardiovascular risk irrespective of gender (Figure 1 – p = 0.547 for women and p = 0.329 for men). Similarly, the prevalence of metabolic syndrome was not influenced by the fasting duration in both genders (Figure 2 – p = 0.431 for women and p = 0.166 for men).

DISCUSSION We have shown that the self-reported fasting time had no significant impact on the lipid profile results. Consequently, no changes on the cardiovascular risk stratification using the Framingham risk score nor changes on the prevalence of metabolic syndrome were noted. A recent review from the American College of Cardiology (15) has discussed the use of fasting or nonfasting samples depending on the question we need to answer. Although they do not provide extensive data to support the idea, they suggest that non-fasting samples are sufficient to estimate baseline cardiovascular risk in primary prevention and to define metabolic syndrome. A 100 90

Our findings provide robust real life data to support the expert opinion of this document, by addressing this issue in a large population of primary prevention adults undergoing a comprehensive heath examination. Fasting has always been recommended prior to collecting serum lipid profile as the postprandial state is associated with a significant increase in triglycerides levels. As triglycerides are included in the Friedewald equation for calculating LDL-cholesterol levels, those changes in triglycerides levels could potentially affect the estimation of LDL-c and, therefore, impact the cardiovascular risk stratification. However, recent reports suggest that the impact of usual meals on triglyceride levels might be lower than previously estimated by fat tolerance tests. Thus, those reports agree that fasting prior to lipid profile evaluation might not be needed for most individuals (6,9,16). Despite those recommendations, experts have proposed new cut-points for these exams when performed in non-fasting scenarios. A recent study from the Women’s Health Study has determined a cut-

1.9

2.0

2.8

B 100

8.4

8.0

7.4

70 89.7

90.0

89.7

5.2

41.2

42.6

43.3

53.2

52.9

51.5

8 - 12 hours

> 12 hours

4.5

60 50

5.6

< 8 hours Low Risk

8 - 12 hours Intermediate Risk

> 12 hours High Risk

< 8 hours Low Risk

p=0.547

Intermediate Risk

High Risk

p=0.329

Figure 1. General cardiovascular risk according to fasting duration in women (A) and men (B).

A 100 90 80 70 60 50 40 30 20 10 0

9.2

7.9

90.8

92.1

< 8 hours

8 - 12 hours

> 12 hours

No Metabolic Syndrome

Metabolic Syndrome

p=0.431

B 100 90 80 70 60 50 40 30 20 10 0

19.2

17.6

19.2

80.8

82.4

80.8

< 8 hours

8 - 12 hours

No Metabolic Syndrome

> 12 hours

Metabolic Syndrome

p=0.166

Figure 2. Metabolic syndrome prevalence according to fasting duration in women (A) and men (B). 190

Arch Endocrinol Metab. 2018;62/2

Fasting duration, CV risk & metabolic syndrome

Arch Endocrinol Metab. 2018;62/2

In conclusion, fasting does not impact the lipid profile testing in a comprehensive health examination, considering that the main purpose of this testing would be determining the global cardiovascular risk and metabolic syndrome diagnosis. Disclosure: no potential conflict of interest relevant to this article was reported.

REFERENCES 1. Xavier HT, Izar MC, Faria Neto JR, Assad MH, Rocha VZ, Sposito AC, et al. V Brazilian Guidelines on Dyslipidemias and Prevention of Atherosclerosis. Arq Bras Cardiol. 2013;101(4 Suppl 1):1-20. 2. European Association for Cardiovascular Prevention & Rehabilitation, Reiner Z, Catapano AL, De Backer G, Graham I, Taskinen MR, Wiklund O, et al.; ESC Committee for Practice Guidelines (CPG) 2008-2010 and 2010-2012 Committees. ESC/EAS Guidelines for the management of dyslipidaemias: the Task Force for the management of dyslipidaemias of the European Society of Cardiology (ESC) and the European Atherosclerosis Society (EAS). Eur Heart J. 2011;32(14):1769-818. 3. Stone NJ, Robinson JG, Lichtenstein AH, Bairey Merz CN, Blum CB, Eckel RH, et al.; American College of Cardiology/American Heart AssociationTask Force on Practice Guidelines. 2013 ACC/AHA guideline on the treatment of blood cholesterol to reduce atherosclerotic cardiovascular risk in adults: a report of the American College of Cardiology/American Heart AssociationTask Force on Practice Guidelines. J Am Coll Cardiol. 2014;63(25 Pt B):2889-934. 4. Fredrickson DS, Levy RI, Lees RS. Fat transport in lipoproteins--an integrated approach to mechanisms and disorders. N Engl J Med. 1967 Jan 5;276(1):34-42 contd. 5. Langsted A, Freiberg JJ, Nordestgaard BG. Fasting and nonfasting lipid levels: influence of normal food intake on lipids, lipoproteins, apolipoproteins, and cardiovascular risk prediction. Circulation. 2008;118(20):2047-56. 6. Steiner MJ, Skinner AC, Perrin EM. Fasting might not be necessary before lipid screening: a nationally representative cross-sectional study. Pediatrics. 2011;28(3):463-70. 7. White KT, Moorthy MV, Akinkuolie AO, Demler O, Ridker PM, Cook NR, et al. Identifying an Optimal Cutpoint for the Diagnosis of Hypertriglyceridemia in the Nonfasting State. Clin Chem. 2015;61(9):1156-63. 8. Sidhu D, Naugler C. Fasting time and lipid levels in a community-based population: a cross-sectional study. Arch Intern Med. 2012;172(22):1707-10. 9. Nordestgaard BG, Langsted A, Mora S, Kolovou G, Baum H, Bruckert E, et al. Fasting is not routinely required for determination of a lipid profile: clinical and laboratory implications including flagging at desirable concentration cut-points-a joint consensus statement from the European Atherosclerosis Society and European Federation of Clinical Chemistry and Laboratory Medicine. Eur Heart J. 2016;37(25):1944-58. 10. Bansal S, Buring JE, Rifai N, Mora S, Sacks FM, Ridker PM. Fasting compared with nonfasting triglycerides and risk of cardiovascular events in women. JAMA. 2007;298(3):309-16. 11. Mora S, Rifai N, Buring JE, Ridker PM. Fasting compared with nonfasting lipids and apolipoproteins for predicting incident cardiovascular events. Circulation. 2008;118(10):993-1001. 12. D’Agostino RB Sr1, Vasan RS, Pencina MJ, Wolf PA, Cobain M, Massaro JM, et al. General cardiovascular risk profile for use

191

off for triglycerides of 175 mg/dL when predicting cardiovascular risk using non-fasting samples (7). Similarly, the American College of Cardiology has established a threshold of 200 mg/dL for triglycerides when defining metabolic syndrome in a non-fasting state (15). Those recommendations contrast with the real life findings of our study, where the fasting duration did not significantly impact the lipid profile or the estimation of cardiovascular risk and metabolic syndrome based on it. Since the need of an 8 to 12 hour fasting impacts on the logistic of laboratory centers, the recent recommendations, corroborated by our current findings may facilitate the organization of laboratory services and add comfort to patients. It would allow distributing the patients’ appointment throughout the day, avoiding long waiting hours in the morning, as well as increasing the overall laboratory capacity with the distribution of tests throughout the day. Our study must, however, be read within the context of its design. First, we considered the fasting time recalled by the patients. It is probable that it was not exactly the same as the period that it really happened. However, it is difficult to find a way to measure this period without trusting the patient memory and all data on this subject considers the self-reported time. Not only that, patient recall of the last meal is the standard of care in real life. Second, the majority of our patients had low cardiovascular risk, which implies that the lipid profile is better and less likely to be affected by the fasting duration. Nonetheless, the main point of our findings is to improve patient’s adherence, especially those testing for an initial lipid profile or for first global cardiovascular risk assessment in a check-up unit. Also, we didn’t measure the lipid profile from the same patient with different fasting durations. Although it could generate some difference on the results, we understand that our population is homogeneous and the results from the group could be extrapolated to each individual. When analyzing the data, we could see that there were mild differences between the different fasting duration groups. It seems that older people with more comorbities (e.g. diabetes) are more likely to respect the fasting time, probably because they are more used to collect exams. Notwithstanding, these differences did not impact in our results and the guidance of non-fasting would be of great value for these patients in order to avoid hypoglycemia risk.

Fasting duration, CV risk & metabolic syndrome

in primary care: the Framingham Heart Study. Circulation. 2008;117(6):743-53. 13. The IDF consensus worldwide definition of the metabolic syndrome. Diabetes Obes Metab. 2005;(3):47-9.

16. Doran B, Guo Y, Xu J, Weintraub H, Mora S, Maron DJ, et al. Prognostic value of fasting versus nonfasting low-density lipoprotein cholesterol levels on long-term mortality: insight from the National Health and Nutrition Examination Survey III (NHANES-III). Circulation. 2014;130(7):546-53.

14. Martin SS, Blaha MJ, Elshazly MB, Toth PP, Kwiterovich PO, Blumenthal RS, et al. Comparison of a novel method vs the Friedewald equation for estimating low-density lipoprotein cholesterol levels from the standard lipid profile. JAMA. 2013;310(19):2061-8.

15. Driver SL, Martin SS, Gluckman TJ, Clary JM, Blumenthal RS, Stone NJ. Fasting or Nonfasting Lipid Measurements: It Depends on the Question. J Am Coll Cardiol. 2016;67(10):1227-34.

192

Arch Endocrinol Metab. 2018;62/2

original article

Effect of one time high dose “stoss therapy” of vitamin D on glucose homeostasis in high risk obese adolescents Preneet Cheema Brar1, Maria Contreras2, Xiaozhou Fan3, Nipapat Visavachaipan4

ABSTRACT Objective: To study the effect of using a one time high dose “stoss therapy” of vitamin D2 (ergocalciferol: VD2) on indices of insulin sensitivity {whole body sensitivity index: WBISI} and secretion {insulinogenic index: IGI} measured during an oral glucose tolerance test (OGTT) in obese adolescents with VDD (25 OHD; serum metabolite of vit D: < 30 ng/dL). Subjects and methods: In a randomized placebo controlled cross over design 20 obese adolescents with vitamin D deficiency (VDD) had baseline OGTT. Arm A received one time high dose 300,000 IU of ergocalciferol and Arm B received placebo. After 6 weeks the adolescents were reassigned to Arm A if they were in Arm B and vice versa. 25OHD, calcium, parathyroid hormone, comprehensive metabolic panel, urine calcium creatinine ratio were measured at each study visit. OGTTs to assess indices of sensitivity and secretion were done at baseline, 6 weeks and 12 weeks respectively. Results: Adolescents were obese and insulin resistant (mean ± SD: mean age = 15.1 ± 1.9 years; BMI: 32.7 ± 9.8; homeostatic model of insulin resistance: HOMA-IR: 4.2 ± 2.8). Stoss therapy with VD2 increased 25OHD from baseline (16.7 ± 2.9 to 19.5 ± 4.5; p = 0.0029) when compared to the placebo. WBISI (2.8 ± 1.9) showed a trend towards improvement in Rx group (p = 0.0577) after adjustment for covariates. IGI (3 ± 2.2) showed an improvement in both Rx and placebo groups. Conclusions: Our study demonstrated that using a high dose of VD2 (300,000 IU) did not have any beneficial effect on insulin sensitivity (whole body sensitivity index {WBISI}) and secretory indices (insulinogenic index {IGI}) in obese adolescents. High dose “stoss therapy” of VD2 did not appear to have any beneficial effect on glucose homeostasis on obese adolescents. Arch Endocrinol Metab. 2018;62(2):193-200

Department of Pediatrics, Division of Pediatric Endocrinology, New York University School of Medicine, New York, USA 2 Texas Tech University Health Science Center, Department of Pediatrics, Amarillo, Texas, USA 3 Department of Population Health, New York University School of Medicine, New York, USA 4 Bumrungrad International Hospital, Bangkok, Thailand 1

Correspondence to: Preneet Cheema Brar 160 East 3nd street, L3, New York 100016, New York, United States of America Preneet.Brar@nyumc.org Received on July/18/2017 Accepted on Oct/29/2017 DOI: 10.20945/2359-3997000000024

INTRODUCTION

ow vitamin D levels are consistently seen in 3250% of obese adolescents (1-3). It is also thought that these low levels could be due to differences in vitamin D metabolizing enzymes in adipose tissue (4,5) and higher volumetric dilution of serum vitamin D, rather than just sequestration in adipose tissue, which could explain these lower levels of vitamin D in obese adolescents when compared to their lean peers. Vitamin D has been shown in both in vivo and in vitro studies to have effects on beta cell function and insulin sensitivity (6,7). The role of vitamin D in glucose homeostasis is well established and prospective studies have shown that vitamin D deficiency has an inverse and significant association with prediabetes and/or Type 2 diabetes (8,9). Arch Endocrinol Metab. 2018;62/2

There have been inconsistent results in randomized controlled trials done to study the effect of vitamin D supplementation on parameters of glucose homeostasis in insulin resistance states, in both adults and children, with some showing beneficial effects on insulin sensitivity (10-13) while others did not (14). In adults, the effect of vitamin D on prediabetes and/or T2DM showed beneficial effect in a study by Neyestani and cols. (15) and no effect in another (16). More recently studies using high dosing vitamin D (150,000-300,000 units) over a short duration (4-8 weeks) have also shown conflicting results on insulin sensitivity and secretion in adults with prediabetes (17,18). There has been no RCT which has been done in obese adolescents with vitamin D deficiency, defined as a 25(OH) D level of < 30 ng/dL (75 nmol/L) (19) 193

Keywords Vitamin D; insulin resistance; prediabetes; obesity

Stoss therapy of vitamin D and glucose homeostasis

and insulin resistance to assess the efficacy of using one time high dose of VD2 on indices of insulin sensitivity and secretion over a short period of time. To summarize we tested whether one time high dose of ergocalciferol (300,000 units) corrected the vitamin D deficiency and improved glucose homeostasis in obese adolescents with insulin resistance.

SUBJECTS AND METHODS This was a randomized placebo controlled cross over design trial with inclusion criteria that were: a) obese adolescents (BMI: ≥ 95th percentile for age) who were 12-18 years; b) > Tanner 2 for puberty and had vitamin D deficiency defined as a 25(OH)D of ≤ 20 ng/mL (50 nmol/L). Exclusion criteria were: a) treatment with medication known to effect vitamin D, calcium and glucose metabolism, such as glucocorticoids, thiazolidinediones, metformin, anticonvulsants metabolized through cytochrome P-450 (phenytoin, carbamazepine, phenobarbital, sodium valproate); b) vitamin D supplementation greater than 400 IU daily in the preceding 3 months; c) history of nephrolithiasis or hypercalcemia; pregnancy; d) attendance at a tanning salon. The study was approved by the Ethics committee at New York University School of Medicine and consent was obtained from parents and patients. We chose to use “stoss” therapy {German word stossen means “to push”} based on a recent global consensus for management of vitamin D deficiency (20). The Endocrine society consensus statement recommended 50,000 for 6 weeks for children and adolescents with vitamin D deficiency. Much higher dosing was recommended for obese adults at least 6,000-10,000 per day for 8 weeks (19). We decided to give 300,000 IU as a “stoss dose”, a practical choice to improve compliance. Subjects selected for the study were randomized, half to the treatment group (A) and half to the placebo group (B). At week 7, subjects were switched over and reassigned to receive vitamin D if they are in Group B and placebo if they were in Group A and the study lasted 12 weeks from start to completion. Ergocalciferol (50,000 IU) capsules and placebo capsules were provided at the study visit based on the randomization scheme. Each subject got 6 capsules of study drug or placebo at the study visit totaling 300,000 IU of ergocalciferol or no ergocalciferol at all in the placebo capsules. Each arm of trial lasted 6 194

weeks with no washout period. Patients were blinded to treatment assignment during the entire study. Study design and recruitment are shown in the study consort diagram (Figure 1). Modified consort diagram for subject recruitment testing Subjects recruited = 30 Inclusion criteria: * 12-18 year * BMI > 95%, Vitamin D ≤ 20 ng/mL Exclusion criteria: * Medications which affect calcium metabolism &* Use of Vit D > 400 IU in past 3 months * Pregnancy * Attendance at tanning salon * History of kidney stones or hypercalcemia 6 refused and 4 cancelled 20 adolescents were consented and assents were obtained. These adolescents were randomized to Rx or placebo. The study participants were blinded to the intervention

Week 0: Group A (N = 10): Received ergocalciferol 300,000 in GCRC. Baseline OGTT, 25(OH)D, calcium, PTH, CMP and urine for calcium creatinine were obtained

Week 0: Group B (N=10): Received placebo in GCRC. Baseline OGTT, 25(OH)D, calcium, PTH, CMP and urine for calcium creatinine were obtained Cross over design was at week 6- 7 when every patient moved over to the other arm of study serving as their own control

Week 6-7: Received ergocalciferol 300,000 GCRC. Second OGTT, 25(OH)D, calcium, PTH, CMP and urine for calcium creatinine were obtained

Week 6-7: Received ergocalciferol 300,000 GCRC. Second OGTT, 25(OH)D, calcium, PTH, CMP and urine for calcium creatinine were obtained 6 week time interval

Week 12: Final OGTT, 25(OH)D, calcium, PTH, CMP and urine for calcium creatinine were obtained

GCRC: General Clinical Research Center. Figure 1. Consort diagram to show recruitment and study design.

The study subjects had an oral glucose tolerance test with 75 g of glucose solution (OGTT) and screening labs were drawn at baseline, at week 7 and then again week 12 at the completion of the study. Plasma glucose and insulin will were measured using Luminex technology. Serum 25-OH vitamin D were measured using liquid chromatography, tandem mass spectrometry (LC/MS/MS), which consists of extraction via protein precipitation, separation via highperformance liquid chromatography (HPLC), detection Arch Endocrinol Metab. 2018;62/2

Stoss therapy of vitamin D and glucose homeostasis

Primary outcome OGTT was done glucose solution (1.75 g/kg up to a maximum of 75 g) over a 2-minute period and blood samples were obtained at 0, 10, 30, 60, 90 and 120 minutes. Indices were calculated from OGTTs done at three time points: baseline; 7 week and 12 week time points.

Calculated insulin sensitivity parameter from OGTT Whole body insulin sensitivity (WBISI) (22) is an insulin sensitivity measure that has been validated in obese children and adolescents (23) calculated as follows = 10,000/√(fasting glucose mg/dl × fasting insulinµIU/ ml)×(mean glucose × mean insulin) during OGTT 1 during OGTT. Higher WBISI levels indicate greater insulin sensitivity.

Calculated insulin secretory parameters from OGTT Insulin index (IGI): is a measure of insulin secretion that has been validated in children against the hyperglycemic clamp [7], calculated as followed: IGI = [30-minute insulin – fasting plasma insulin (uIU/ mL)/[30-minute glucose – fasting plasma glucose (mg/dL)]. Adolescents with Type 2 diabetes have a significant reduction in IGI (24).

Secondary outcome a. Pre- and post treatment 25 OHD; b. change in serum PTH; c. Biochemical evidence of vitamin D toxicity such hypercalciuria (urine calcium/creatinine ratio ≥ 0.2), serum phosphate > 5.7 mg/mL, serum calcium > 10.5 mg/dL, serum 25(OH) D > 150 ng/mL. Arch Endocrinol Metab. 2018;62/2

Statistical analysis To estimate the effect of vitamin D treatment on the clinical features in this crossover study, we first examined the within patient comparison by using paired t-test. We next examined the treatment given one period (treatment/placebo) adjusted for the baseline values by using mixed regression models controlling for baseline measurements, age, gender, race, BMI, and seasons [winter: Dec-Feb; spring: Mar-May; summer: JunAug; fall: Sep-Nov]. Koch’s test was used to examine the crossover effect on the association of treatment and clinical features. We further conducted stratified analyses according to baseline diabetes and pre-diabetes status, using the criteria plasma glucose at 0 minute ≥ 100 mg/ dL or at 120 minutes ≥ 140 in oral glucose tolerance test (OGTT), HbA1C ≥ 5.7% and HOMA -IR ≥ 3.4, and intact PTH ≥ 44 pg/mL. At last, plasma glucose concentration and insulin level at times 0, minutes, 30 minutes, 60 minutes, 90 minutes, and 120 minutes in insulin sensitivity test were compared between treatment and placebo groups by using the mixed regression models described above, as well as the mean levels at the first-phase (at and before 30 minutes), second phase (after 30 minutes), and whole period (0-120 minutes). All statistical tests were two-sided, and all statistical analyses were carried out using SAS 9.3.

RESULTS Of the twenty participants, 80% (n = 16) were females, and 75% (n = 15) were Hispanic, with mean age 15 year-old. The study participants were predominantly overweight, with mean BMI 32.7 (Table 1). The baseline clinical features of all participants were shown in Table 1 as well: Serum 25-OH vitamin D levels were 16.7 ± 2.9 ng/mL (reference range 12-20 ng/mL) (25); and WBISI were 2.8 ± 1.9 (reference range 1.84 ± 0.17); and IGI were 3.0 ± 2.2; and PTH were 50.9 ± 15.8 (reference range 15 – 75 pg/mL). We first examined the effect of vitamin D treatment on the serum 25-OH vitamin D levels (Table 2). Treatment group had significant increased serum 25-OH vitamin D levels (19.5 ± 4.5 ng/mL; p from paired t-test = 0.0029) compared to baseline levels. This increase in serum 25-OH vitamin D levels after treatment was significantly different relative to placebo group, after further adjusted for covariates (adjusted p from mixed model = 0.0059), and did not due to crossover effect (p from Koch’s analysis = 0.4506). 195

and quantitation via tandem mass spectrometry. 25OHD2 and 25OHD3 concentrations were used to calculate total 25OHD levels. Glycosylated hemoglobin (HbA1C) were measured in red blood cells using HPLC method. Serum calcium (mg/dL), albumin (g/dL) and intact parathyroid hormone (PTH) (pg/ mL were measured. Calcium was corrected for the serum albumin {([4-albumin (g/dL)] x 0.8) + calcium (mg/dL)} (21). Intact PTH, 25(OH) D and spot urine calcium/creatinine ratio were checked at completion of the 6 week treatment phase (in week 7) to exclude vitamin D toxicity including hypercalciuria (urine calcium/creatinine ratio ≥ 0.2), hyperphosphatemia (serum phosphate > 5.7 mg/mL), hypercalcemia (serum calcium > 10.5 mg/dL), serum 25(OH) D > 150 ng/mL. Baseline labs were drawn at the same time as 0 minute OGTT.

Stoss therapy of vitamin D and glucose homeostasis

Table 1. Baseline characteristics and clinical features of the study population Characteristics and clinical features

Study participants (n = 20) Mean/N

SD/%

15.1

1.9

Male

Female

African American

Bangladesh

Caucasian

Age (year) Gender*

Ethnicity*

Height (cm)

Hispanic

162.5

7.8

Weight (kg)

90.7

19.2

BMI

32.7

9.8

25 OH vitamin D (ng/mL)

16.7

2.9

WBISI

2.8

1.9

IGI

3.0

2.2

Intact, PTH (pg/mL)

50.9

15.8

HbA1C

5.7

0.3

HOMA-B%

452.2

343.3

HOMA-IR

4.2

2.8

Serum calcium (mg/dL)

9.4

0.4

Albumin (g/dL)

4.2

0.3

Albumin-adjusted serum calcium (mg/dL)

9.2

0.4

Alkaline phosphatase (U/L)

110.0

46.8

AST (U/L)

29.2

14.1

ALT (U/L)

42.3

39.8

Serum phosphorus (mg/dL)

4.5

0.6

Random urine calcium (mg/dL) Random urine creatinine (mg/dL)

6.5

4.6

217.9

107.2

* Numbers of participants and percentage were calculated.

We next examined that if the vitamin D treatment were associated with insulin sensitivity and secretory parameters (Table 2). The means of whole body insulin sensitivity (WBISI) tend to be increased (∆mean = 0.1, pt-test = 0.5377) in treatment group and decreased (∆mean = 0.3, pt-test = 0.3855) in placebo group compared to baseline levels, however, without statistical significance. Whereas, the difference in WBISI between treatment and placebo group was marginally significant after adjusted for covariates (adjusted p from mixed model = 0.0577). The means of insulin index (IGI) increased with 0.1 in both treatment and placebo group compared to baseline, and these differences were not statistically 196

significant. Intact PTH decreased in treatment group (∆mean = -6.0, pt-test = 0.0538); however, this decrease was not significant compared to the changes in placebo group (adjusted p from mixed model = 0.1290). Additionally, alkaline phosphatase levels decreased in both treatment group (∆mean = -6.5, pt-test = 0.0334) and placebo group (∆mean = -7.5, pt-test = 0.0034), and AST and ALT only decreased in treatment group (∆mean = -2.0, pt-test = 0.0209 for AST, and ∆mean = -4.0, pt-test = 0.0106 for ALT). However, the decreasewere not significant compared to the changes in placebo group. Since childhood diabetes and pre-diabetes status may have effects of vitamin D treatment on insulin sensitivity, we stratified the associations of VD2 treatment with WBISI and IGI by clinical diabetes measurements (Table 3). In contrast to the overall analysis, the means of IGI decreased in treatment (∆mean = -0.70, pt-test = 0.5606) in children with fasting serum glucose level ≥ 100 or ≥ 140 at time 0 and 120 minutes during the OGTT, although these differences were not significant. Children with HOMA-IR ≥ 3.4 and HbA1C ≥ 5.7% had similar trend of in both treatment and placebo group with the overall changes. When stratified by PTH, the treatment group with PTH ≤ 44 pg/mL had increased mean of WBISI (∆mean = 0.10, pt= 0.5040), and decreased mean of IGI (∆mean = -0.30, test pt-test = 0.5722). In the comparisons of the mean differences between treatment and placebo group at each time point of OGTT (Table 4: 0 min, 10 min, 30 min, 60 min, 90 min, 120 min), serum glucose level decreased slower in treatment group (∆mean = -5.5, pt-test = 0.2162) than placebo (∆mean = -18.5, pt-test = 0.0007) at 30 minutes, with p value from mixed model equals to 0.0236. While, insulin level increased in treatment group (∆mean = 9.0, pt-test = 0. 7864), and decreased in placebo (∆mean = -6.0, pt-test = 0.1270) at 30 minutes (p from mixed model = 0.0197). No significant differences between treatment and placebo at other time point of OGTT was found, as well as the mean values of all time points in both glucose and insulin levels.

DISCUSSION Our study demonstrated that using high dose of VD2 (300,000 IU) in a cross over design trial did not have any beneficial effect on insulin sensitivity and secretory indices in obese adolescents when measured using an oral glucose tolerance test. Arch Endocrinol Metab. 2018;62/2

Stoss therapy of vitamin D and glucose homeostasis

Table 2. Baseline values and changes after treatment in clinical features and the placebo group Treatment group (N = 20)

Baseline

Placebo group (N = 20)

∆ after treatment

Mean

Median*

IQR*

Mean

Median*

IQR*

p†

p‡

p§

25 OH vitamin D (ng/mL)

16.7

2.9

19.5

4.5

2.4

4.7

0.0029

17.2

4.7

0.0

2.2

0.5262

0.0059

0.4506

WBISI

2.8

1.9

2.7

1.4

-0.1

1.1

0.5377

3.1

1.5

0.3

1.9

0.3855

0.0577

0.4205

IGI

3.0

2.2

3.5

2.7

0.1

1.8

0.2878

4.3

6.3

0.1

1.2

0.3069

0.5971

0.0030

Intact, PTH (pg/mL)

50.9

15.8

45.6

11.8

-6.0

19.0

0.0538

50.3

14.3

0.5

16.0

0.8327

0.1290

0.1075

HbA1C

5.7

0.3

5.7

0.4

0.1

0.2

0.2674

5.7

0.4

0.1

0.3

0.3264

0.9052

0.2918

HOMA-B%

452.2

343.3

483.5

258.2

19.8

173.8

0.3889

543.9

532.2

34.2

288.5

0.2769

0.5740

0.0004

HOMA-IR

4.2

2.8

5.2

3.6

0.9

2.3

0.1079

4.9

4.5

0.2

1.3

0.2829

0.3403

0.3396

Serum calcium (mg/dL)

9.4

0.4

9.3

0.4

0.0

0.4

0.4936

9.2

0.3

-0.1

0.5

0.0909

0.1287

0.2258

Albumin (g/dL)

4.2

0.3

4.2

0.9

-0.3

0.4

0.8346

4.1

0.3

-0.2

0.3

0.1670

0.8932

0.0200

Albumin-adjusted serum calcium

9.2

0.4

9.1

0.7

0.1

0.4

0.8927

14.7

25.6

0.0

0.6

0.3750

0.3975

< 0.0001

Alkaline phosphatase (U/L)

110.0

46.8

103.6

43.5

-6.5

13.0

0.0344

99.6

37.6

-7.5

15.0

0.0034

0.3105

0.4072

AST (U/L)

29.2

14.1

25.2

11.9

-2.0

5.5

0.0209

29.1

15.8

-0.5

6.0

0.9374

0.0870

< 0.0001

ALT (U/L)

42.3

39.8

36.2

32.4

-4.0

9.5

0.0106

40.6

36.7

-1.0

9.0

0.6514

0.2704

< 0.0001

Serum phosphorus (mg/dL)

4.5

0.6

4.5

0.6

-0.1

0.5

0.7354

4.5

0.5

0.0

0.4

0.5965

0.6586

0.9649

Random urine calcium (mg/dL)

6.5

4.6

8.6

7.8

2.7

6.2

0.1733

14.0

21.4

1.0

7.0

0.1411

0.3369

0.0007

217.9

107.2

274.6

441.8

-12.7

106.5

0.5034

199.2

108.3

-9.9

89.7

0.4150

0.3292

< 0.0001

Random urine creatinine (mg/dL)

†

* Medians and IQR of the difference between treatment/placebo group and baseline were calculated. † p values were calculated from exact comparison (paired t-test) of measurements to baseline. ‡ p values were calculated from mixed regression models, adjusted for baseline measurements, age, gender, race, BMI, and season [winter: Dec-Feb; spring: Mar-May; summer: Jun-Aug; fall: Sep-Nov]. § p values were calculated from Koch’s analysis testing for crossover effects.

Table 3. Changes after treatment in WBISI and IGI and the placebo group stratified according to diabetes status Treatment group

Placebo group

∆ after treatment G_0 ≥ 100 mg/dL and/ or G_120 ≥ 140 mg/dL

Mean

Median*

IQR*

∆ after treatment p†

Mean

Median*

IQR*

p†

p‡

p§

WBISI

1.38

0.80

-0.20

0.30

0.1293

1.56

1.04

-0.10

0.50

0.6213

0.4718

0.5477

IGI

5.18

4.51

-0.70

1.20

0.5606

2.94

2.43

-0.60

1.60

0.1376

0.1236

0.1126

HOMA-IR ≥ 3.4 & HbA1C ≥ 5.7%

WBISI

2.27

1.44

-0.25

0.30

0.8226

2.32

1.06

0.25

0.90

0.4391

0.2516

0.1764

IGI

5.70

3.52

2.30

5.60

0.2714

8.40

10.69

0.95

5.60

0.2636

0.1735

0.8965

2.15

1.18

0.10

0.35

0.5040

2.86

1.69

0.30

2.00

0.0765

0.3445

< 0.0001

3.26

2.20

-0.30

1.10

0.5722

2.64

1.88

-0.55

1.40

0.0389

0.3450

< 0.0001

Intact, PTH ≤ 44 pg/mL

WBISI IGI Intact, PTH > 44 pg/mL

WBISI

3.05

1.43

-0.30

1.90

0.4458

3.34

1.46

0.20

1.60

0.7871

0.2312

0.4084

IGI

3.74

3.20

0.65

3.20

0.2286

5.61

8.24

0.50

1.50

0.1978

0.7405

0.1898

N: number; SD: standard deviation; IQR: inter quartile range; p: p value. Arch Endocrinol Metab. 2018;62/2

197

Stoss therapy of vitamin D and glucose homeostasis

Table 4. Baseline values and changes after treatment in plasma glucose and insulin levels and the placebo group at each time point Treatment group (N = 20)

Baseline

Placebo (N = 20)

∆ after treatment Mean

Mean

∆ after treatment

Mean*

SD*

p†

Mean

Mean*

SD*

p†

p‡

p§

Plasma glucose At fasting

82.0

7.2

82.0

5.6

0.0

8.5

0.9698

81.2

5.5

-0.5

7.0

0.4466

0.3645

0.2856

At 10 min

102.4

16.1

100.6

13.3

1.5

9.5

0.5910

96.7

13.5

-2.5

12.0

0.0589

0.2423

0.1161

At 30 min

139.8

25.4

133.4

22.6

-5.5

33.0

0.2162

122.5

22.1

-18.5

25.0

0.0007

0.0236

0.4265

At 60 min

139.8

28.5

128.7

38.9

-3.5

55.5

0.1202

119.8

34.0

-21.0

37.0

0.0067

0.2243

0.0452

At 90 min

127.5

29.4

123.4

34.9

-10.5

53.0

0.5524

117.7

39.9

-10.5

29.0

0.2737

0.4540

0.1342

At 120 min

123.3

31.2

110.5

31.0

-13.5

28.5

0.0568

111.8

35.1

-11.0

19.0

0.0419

0.9691

0.0700

Mean

119.1

18.4

113.1

20.1

-6.9

27.0

0.0684

108.3

22.0

-10.7

19.4

0.0037

0.1754

0.1741

At fasting

20.9

13.3

25.2

16.7

4.0

10.0

0.0749

24.1

21.7

0.5

6.5

0.2686

0.4555

0.7516

At 10 min

77.7

63.4

74.2

49.5

5.0

27.0

0.7478

71.9

61.7

3.5

52.0

0.6103

0.8206

0.6579

At 30 min

183.5

147.6

176.9

110.1

9.0

117.0

0.7864

151.4

116.7

-6.0

108.5

0.1270

0.0197

0.3541

At 60 min

213.9

183.6

187.0

181.3

-8.0

95.0

0.2746

145.8

136.3

-41.5

105.5

0.0178

0.1340

0.3023

At 90 min

207.6

253.6

204.7

253.6

-17.5

133.0

0.3248

148.0

185.0

-58.0

117.0

0.0245

0.0604

0.0242

At 120 min

231.3

352.4

138.7

116.3

-37.0

109.5

0.1919

165.7

250.4

-31.0

80.5

0.0487

0.6277

0.0135

Mean

156.0

158.9

136.0

115.7

-5.5

54.4

0.2027

117.8

121.6

-2970.0

59.8

0.0215

0.2580

0.1541

First-phase (≤ 30 m)

49.3

35.3

52.1

34.9

5.5

17.8

0.6396

48.0

40.3

0.8

33.0

0.8336

0.5587

0.5024

Second-phase (> 30 m)

211.8

225.3

175.4

153.8

-20.3

83.3

0.1284

152.7

164.2

-36.8

87.0

0.0167

0.2367

0.3730

Insulin

Prediabetes was found in 10-39% of obese adolescents (24,26), which parallels the rise of obesity (27). Vitamin D has shown to have effects on insulin secretion and action and in both pediatric and adult studies an inverse association between vitamin D levels and development of prediabetes and/or T2DM have been demonstrated (10,21). Long term randomized control trials (3 months7 years) have studied whether giving vitamin D prevents the progression of insulin resistance to prediabetes to Type 2 diabetes due to its effects on augmenting insulin action and secretion. Von Hurst and cols. studied 42 South Asian women with insulin resistance using 4000 IU of D3 for 6 months. Fasting insulin and HOMA-IR improved in the cases versus controls (p values = 0.02). Davidson and cols. used a weight and vitamin D based formula to calculate vitamin D dosing (average of 88000 IU/week) for 12 months and showed improvement in Hba1c (decrease by 0.2%) but the intervention affected no other parameters of any OGTT derived secretory and sensitivity indices in this cohort of pre diabetic adults. These studies (more than 6 months 198

of vitamin D treatment) have been equivocal to truly establish any real benefit of using vitamin D on indices of beta cell function and insulin sensitivity, the caveat being the variations in the dosing of vitamin D used, compliance concerns and whether the vitamin D truly reached an optimal level (i.e. > 30 ng/mL) to effect the aspects of function of beta cell. It is clear that in this obese cohort of female adolescents (average BMI = 32.1) we found that treatment did increase the vitamin D level when compared to the placebo arm (19.5 vs. 17.2 ng/dL; p = 0.0029) and this significance stayed after adjustments for covariates: BMI, age sex, gender, race and season. However our intervention of 300,000 IU was not able to optimize the vitamin D levels to levels of sufficiency i.e. ≥ 30 ng/mL in all except one subjects. Levels reached ≥ 20 ng/mL in six subjects by the end of the three month intervention. This dosing was based on the Endocrine society guidelines of using 50,000 IU for 6 weeks for deficient states (19). We wanted to test the effect of using high dose of vitamin D effect on insulin sensitivity and secretory indices. WBISI did show an increase in the Rx group Arch Endocrinol Metab. 2018;62/2

Stoss therapy of vitamin D and glucose homeostasis

Arch Endocrinol Metab. 2018;62/2

HbA1c ≥ 5.7%-6.4% (defined as prediabetes by American Diabetes Association). No differences were found in the Rx group using this stratification analysis. No significant differences between treatment and placebo at other time point of OGTTs were found, as well as the mean values of all time points (10, 30, 60, and 90 min) in both glucose and insulin levels. These results further reiterate that the intervention had no effects in the variables of interest. The cross-over of our RCT was designed to balance the exposure to vitamin D and placebo in sequence based on the arm that the adolescents were assigned to. Each patient served as their own control which allowed for a smaller sample size. The limitations were the “order” and “carry over” effect of a cross over study and we recognize that we did not have a wash out period which could have affected our results. A strength of the study was that we did adjust for seasonal variation in our analysis of the data. We were not able to normalize 25 OHD level and that is a major limitation of our study. 25 OHD has a threshold effect on the beta cell function and we speculate that this is reason why we could find any improvements in insulin secretory and sensitivity parameters. Also, given emerging information on pharmacokinetics studies on available formulations found that ergocalciferol was not as good a choice as cholecalciferol which is more effective in increasing the serum 25(OH) D pools (30). Our results are aligned to the negative results found in the recent studies showing no beneficial effect of vitamin D on glucose and insulin indices derived from OGTT. We suggest considering much higher dosing for obese adolescents based on adult studies (31) accepting the fact that these are adult sized adolescents. Based on our study there is no evidence to support the use of high dose vitamin D over a short term period to improve glucose homeostasis. Acknowledgments: supported in part by the NYU CTSA grant UL1 TR000038 from the National Center for Advancing Translational Sciences, National Institutes of Health. Disclosure: no potential conflict of interest relevant to this article was reported.

REFERENCES 1. Olson ML, Maalouf NM, Oden JD, White PC, Hutchison MR. Vitamin D deficiency in obese children and its relationship to glucose homeostasis. J Clin Endocrinol Metab. 2012;97(1):279-85.

199

(delta mean increase 0.1) though this difference was not significant when compared to the placebo. IGI increased in both groups while PTH decreased to a greater extent when compared to the placebo though in the mixed model analysis the difference was not significant. In a similar study designed by Ashraf and cols. obese adolescents (average age 14.9 ± 1.8 years) were given 50,000 IU of vitamin D per week for 8 weeks to observe effects on glucose parameters. While HOMA-IR and WBISI did not improve on the follow up OGTT fasting glucose showed statistical improvement (p = 0.05) in cases when compared to controls. In a dose titration study (400 IU to 4000 IU) of 323 early pubertal children (age = 11.3 years; BMI% 70% and 25 (OH) levels 28 ng/mL) fasting insulin and HOMA-IR correlated with baseline levels of 25(OH) D (r = 0.14 and 0.15 respectively). Rx with vitamin D had no significant positive impact on glucose and insulin parameters over a 12 week period. In this study by Ferira and cols. among these children only 15% were vitamin D deficient and obese respectively and therefore making comparisons with our study results would not be reasonable (28). In a noteworthy study by Wagner and cols. investigated the effect of high-dose vitamin D3 treatment on beta-cell function, insulin sensitivity, and glucose tolerance in subjects with prediabetes or diet-treated type 2 diabetes adults (n = 43, BMI 28.6) randomized to 30,000 IU of cholecalciferol or placebo drops weekly for 8 weeks. They studied first and second phase insulin response (I Sec0-12, I Sec12-12), disposition index {DI} (measured with hyperglycemic clamp) and WBISI using pre and post Rx OGTT. The investigators did not find any improvement I Sec0-12, I Sec12-120 results which are in line with our results which showed no improvements in the indices derived either from the clamp or OGTT. The difference between this study in adults and ours in adolescents is that their vitamin D levels rose from 17.2 ng/mL (43 mmol/L) at baseline to 34 ng/mL at the end of the 8 week study (29). The fact that they normalized the vitamin D levels supports their findings that vitamin D given in high doses over a short period does not improve metabolic profile of prediabetes and T2DM adults. To further analyze the data we stratified and looked at the associations between vitamin D levels and metabolic parameters which reflect emerging decompensation such as: Glucose ≥ 100 mg/dL or ≥ 140 mg/dL at 0 and 120 minutes of the OGTT,

Stoss therapy of vitamin D and glucose homeostasis

2. Reis JP, von Muhlen D, Miller ER 3rd, Michos ED, Appel LJ. Vitamin D status and cardiometabolic risk factors in the United States adolescent population. Pediatrics. 2009;124(3):e371-9. 3.

Alemzadeh R, Kichler J, Babar G, Calhoun M. Hypovitaminosis D in obese children and adolescents: relationship with adiposity, insulin sensitivity, ethnicity, and season. Metabolism. 2008;57(2):183-91.

4. Wamberg L, Christiansen T, Paulsen SK, Fisker S, Rask P, Rejnmark L, et al. Expression of vitamin D-metabolizing enzymes in human adipose tissue -- the effect of obesity and diet-induced weight loss. Int J Obes (Lond). 2013;37(5):651-7. 5. Drincic AT, Armas LA, Van Diest EE, Heaney RP. Volumetric dilution, rather than sequestration best explains the low vitamin D status of obesity. Obesity (Silver Spring). 2012;20(7):1444-8. 6. Norman AW, Frankel JB, Heldt AM, Grodsky GM. Vitamin D deficiency inhibits pancreatic secretion of insulin. Science (New York, NY). 1980;209:823-5. 7.

Chiu KC, Chu A, Go VL, Saad MF. Hypovitaminosis D is associated with insulin resistance and beta cell dysfunction. Am J Clin Nutr. 2004;79(5):820-5.

Deleskog A, Hilding A, Brismar K, Hamsten A, Efendic S, Ostenson CG. Low serum 25-hydroxyvitamin D level predicts progression to type 2 diabetes in individuals with prediabetes but not with normal glucose tolerance. Diabetologia. 2012;55(6):1668-78.

17. Nazarian S, St Peter JV, Boston RC, Jones SA, Mariash CN. Vitamin D3 supplementation improves insulin sensitivity in subjects with impaired fasting glucose. Transl Res. 2011;158(5):276-81. 18. Wagner H, Alvarsson M, Mannheimer B, Degerblad M, Ostenson CG. No Effect of High-Dose Vitamin D Treatment on β-Cell Function, Insulin Sensitivity, or Glucose Homeostasis in Subjects With Abnormal Glucose Tolerance: A Randomized Clinical Trial. Diabetes Care. 2016;39(3):345-52. 19. Holick MF, Binkley NC, Bischoff-Ferrari HA, Gordon CM, Hanley DA, Heaney RP, et al. Evaluation, treatment, and prevention of vitamin D deficiency: an Endocrine Society clinical practice guideline. J Clin Endocrinol Metab. 2011;96(7):1911-30. 20. Munns CF, Shaw N, Kiely M, Specker BL, Thacher TD, Ozono K, et al. Global Consensus Recommendations on Prevention and Management of Nutritional Rickets. J Clin Endocrinol Metab. 2016;101(2):394-415. 21. Pittas AG, Dawson-Hughes B. Vitamin D and diabetes. J Steroid Biochem Mol Biol. 2010;121(1-2):425-9. 22. Matsuda M, DeFronzo RA. Insulin sensitivity indices obtained from oral glucose tolerance testing: comparison with the euglycemic insulin clamp. Diabetes Care. 1999;22(9):1462-70.

9. Song Y, Wang L, Pittas AG, Del Gobbo LC, Zhang C, Manson JE, et al. Blood 25-hydroxy vitamin D levels and incident type 2 diabetes: a meta-analysis of prospective studies. Diabetes Care. 2013;36(5):1422-8.

23. Yeckel C, Weiss R, Dziura J, Taksali S, Dufour S, Burgert T, et al. Validation of insulin sensitivity indices from oral glucose tolerance test parameters in obese children and adolescents. J Clin Endocrinol Metab. 2004;89(3):1096-101.

10. Pittas AG, Lau J, Hu FB, Dawson-Hughes B. The role of vitamin D and calcium in type 2 diabetes. A systematic review and metaanalysis. J Clin Endocrinol Metab. 2007;92(6):2017-29.

24. Sinha R, Fisch G, Teague B, Tamborlane WV, Banyas B, Allen K, et al. Prevalence of impaired glucose tolerance among children and adolescents with marked obesity. N Engl J Med. 2002;346(11): 802-10.

11. von Hurst PR, Stonehouse W, Coad J. Vitamin D supplementation reduces insulin resistance in South Asian women living in New Zealand who are insulin resistant and vitamin D deficient - a randomised, placebo-controlled trial. Br J Nutr. 2010;103(4):54955. 12. Belenchia AM,Tosh AK, Hillman LS, Peterson CA. Correcting vitamin D insufficiency improves insulin sensitivity in obese adolescents: a randomized controlled trial. Am J Clin Nutr. 2013;97(4):774-81. 13. Nader NS, Aguirre Castaneda R, Wallace J, Singh R, Weaver A, Kumar S. Effect of vitamin D3 supplementation on serum 25(OH) D, lipids and markers of insulin resistance in obese adolescents: a prospective, randomized, placebo-controlled pilot trial. Horm Res Paediatr. 2014;82:107-12. 14. Wamberg L, Kampmann U, Stodkilde-Jorgensen H, Rejnmark L, Pedersen SB, Richelsen B. Effects of vitamin D supplementation on body fat accumulation, inflammation, and metabolic risk factors in obese adults with low vitamin D levels - results from a randomized trial. Eur J Intern Med. 2013;24(7):644-9. 15. Neyestani TR, Nikooyeh B, Alavi-Majd H, Shariatzadeh N, Kalayi A, Tayebinejad N, et al. Improvement of vitamin D status via daily intake of fortified yogurt drink either with or without extra calcium ameliorates systemic inflammatory biomarkers, including adipokines, in the subjects with type 2 diabetes. J Clin Endocrinol Metab. 2012;97(6):2005-11.

D insufficiency - a double-blind, randomized, placebo-controlled trial. Metabolism. 2014;63(9):1115-24.

16. Kampmann U, Mosekilde L, Juhl C, Moller N, Christensen B, Rejnmark L, et al. Effects of 12 weeks high dose vitamin D3 treatment on insulin sensitivity, beta cell function, and metabolic markers in patients with type 2 diabetes and vitamin

200

25. Ross AC, Manson JE, Abrams SA, Aloia JF, Brannon PM, Clinton SK, et al. The 2011 report on dietary reference intakes for calcium and vitamin D from the Institute of Medicine: what clinicians need to know. J Clin Endocrinol Metab. 2011;96(1):53-8. 26. Nowicka P, Santoro N, Liu H, Lartaud D, Shaw M, Goldberg R, et al. Utility of hemoglobin a1c for diagnosing prediabetes and diabetes in obese children and adolescents. Diabetes Care. 2011;34(6):1306-11. 27. Ogden CL, Carroll MD, Flegal KM. High body mass index for age among US children and adolescents, 2003-2006. JAMA. 2008;299(20):2401-5. 28. Ferira AJ, Laing EM, Hausman DB, Hall DB, McCabe GP, Martin BR, et al. Vitamin D Supplementation Does Not Impact Insulin Resistance in Black and White Children. J Clin Endocrinol Metab. 2016;101(4):1710-8. 29. Herpertz S, Albus C, Wagener R, Kocnar M, Wagner R, Henning A, et al. Comorbidity of diabetes and eating disorders. Does diabetes control reflect disturbed eating behavior? Diabetes Care. 1998;21(7):1110-6. 30. Itkonen ST, Skaffari E, Saaristo P, Saarnio EM, Erkkola M, Jakobsen J, et al. Effects of vitamin D2-fortified bread v. supplementation with vitamin D2 or D3 on serum 25-hydroxyvitamin D metabolites: an 8-week randomised-controlled trial in young adult Finnish women. Br J Nutr. 2016;115(7):1232-9. 31. Barger-Lux MJ, Heaney RP, Dowell S, Chen TC, Holick MF. Vitamin D and its major metabolites: serum levels after graded oral dosing in healthy men. Osteoporos Int. 1998;8(3):222-30.

Arch Endocrinol Metab. 2018;62/2

original article

Effects of drying and storage conditions on the stability of TSH in blood spots Patrícia Künzle Ribeiro Magalhães1, Carlos Henrique Miranda1, Fernando Crivelenti Vilar1, André Schmidt1, Roberta Rodrigues Bittar1, Giselle Aparecida Caixe de Carvalho Paixão1, Edson Zangiacomi Martinez2, Léa Maria Zanini Maciel1

ABSTRACT Objective: To evaluate the influence of sample drying and storage temperature on TSH stability in neonatal screening. Subjects and methods: Blood samples from 29 adult volunteers as a surrogate for neonatal blood (10 with normal TSH, 9 with overt hypothyroid and 10 with subclinical hypothyroidism) were spotted on filter paper and dried at 22°C or 35°C for 3 hours. The samples were then stored at 22°C, -4°C, or -20°C, and TSH measurements were performed at day 0 (D0), D7, D30, D60, D180, and D360 of storage. Results: The drying temperature did not interfere with TSH measurement on D0. TSH values remained stable up to D30 when stored at 22°C and were stable up to D60 when stored in a refrigerator or freezer. Samples stored at 22°C had a greater decrease in TSH values than samples stored in a refrigerator or a freezer. Conclusions: Freezer storage is not advantageous compared to storage in the refrigerator. At the end of one year, if confirmation of the initial result is required, a reduction of TSH concentrations should be taken into account. Arch Endocrinol Metab. 2018;62(2):201-4 Keywords

Divisão de Endocrinologia, Departamento de Medicina Interna, Faculdade de Medicina de Ribeirão Preto, Universidade de São Paulo (FMRP-USP), Ribeirão Preto, SP, Brasil 2 Departamento de Medicina Social, Faculdade de Medicina de Ribeirão Preto, Universidade de São Paulo (FMRP-USP), Ribeirão Preto, SP, Brasil 1

Correspondence to: Léa Maria Zanini Maciel Av. Bandeirantes, 3900 14048-900 – Ribeirão Preto, SP, Brasil lmzmacie@fmrp.usp.br Received on Dec/9/2016 Accepted on Apr/25/2017 DOI: 10.20945/2359-3997000000026

INTRODUCTION

eonatal screening for congenital hypothyroidism (CH) in order to prevent neurological deficit is accomplished through measurement of thyroid stimulating hormone (TSH) in dried blood spots on filter paper (1). Despite the simplicity of this method, which does not require venipuncture and simplifies sample transportation from distant regions to a central laboratory, questions arise about the possible interference of sample drying, storage and transportation under different physical conditions and of the quality of filter paper with the stability of the hormones (2-8). This study was conducted to evaluate the influence of sample drying and storage temperature on TSH stability along 1 year.

SUBJECTS AND METHODS Sample collection, drying and storage This study was conducted at the University Hospital, Ribeirão Preto Medical School, USP (HCFMRPArch Endocrinol Metab. 2018;62/2

USP), one of four newborn screening reference centers in the State of São Paulo, Brazil. Adult blood was tested as a surrogate for neonatal blood. Two venous blood samples (4 mL in a sodium heparin tube and 4 mL in a clotting activator tube [BD Vacutainer® tubes; catalog numbers 367835 and 368774, respectively]) were collected from 29 adult volunteers aged 21-76 years: 10 had normal serum TSH (TSH = 0.4 – 4 µIU/mL), 9 had a serum TSH of ≥ 20 µIU/mL, and 10 had a serum TSH of > 4.0-20 µIU/ mL during routine tests performed at the Newborn Screening and Thyroid Laboratory of HCFMRP-USP. Six filter paper discs (Whatman™ 903 Neonatal Screening Cards, Life Sciences, GE Healthcare, US) per subject were spotted with 50 µL of heparinized blood. Three discs from each individual were dried horizontally at room temperature (RT, 22°C) and 50% air relative humidity (ARH) for 3 hours. The remaining three discs were dried horizontally in an oven at 35°C and 65% ARH for 3 hours, simulating the temperature in tropical countries like ours. After drying, the samples were wrapped in aluminum foil envelopes and stored 201

Neonatal screening; TSH; congenital hypothyroidism; filter paper storage

Stability of TSH in blood spots

under three different conditions (1 disc per patient in each condition): at RT (22°C), in a refrigerator (4°C), or in a freezer (-20°C).

Laboratory determinations Serum TSH was measured by a chemiluminescent assay (Immulite 2000, Diagnostic Products Corporation, Los Angeles, CA), with an interassay error of < 10%. The total blood TSH equivalent was calculated from the serum TSH value according to the patient`s hematocrit. TSH measurements of the filter paper blood spots under all conditions were performed by the AutoDELFIA® Neonatal hTSH Kit (PerkinElmer, Wallac Oy, Finland) at six different times: the same day of sample collection (day 0 [D0]), D7, D30, D60, D180, and D360 of storage. The intra-assay and interassay coefficients of variation were < 10%.

Statistical analysis Serum TSH, hematocrit, total blood TSH equivalent and baseline values of TSH in blood collected on filter paper were expressed in median and range. TSH values in blood collected on filter paper were log transformed due to their non-Gaussian distribution. The transformed data were analyzed by using mixed effects linear models (9), considering the effects of days of storage (D0, D7, D30, D60, D180 and D360), storage temperatures (RT, 4°C, and -20°C), and interactions between days of storage and storage temperatures. Analyses were performed in SAS 9.3 (10), with the level of significance set at 0.05. The study was approved by the Research Ethics Committee of HCFMRP-USP (protocol No. 13094/2011).

RESULTS Median serum TSH for all samples was 9.7 μUI/mL (range: 0.5-301) and the hematocrit was 38.7% (range: 24-45). The median total blood TSH equivalent was 6.0 μUI/mL (range: 0.3-172.3) and confirmed the initial dried blood TSH concentrations. The median baseline values of TSH in blood collected on filter paper were 6.0 µIU/mL whole blood (WB) (range: 0.4-154) for samples dried at RT and 6.0 µIU/mL WB (range: 0.4-140) for samples dried in an oven. After log 202

transformation, the geometric mean and confidence interval of the TSH values at D0 were 6.4 (3.4-12.0) and 6.0 (3.2-11.3) µIU/mL WB for the samples dried at RT and for the samples dried in an oven, respectively, with no significant difference between them (P = 0.06). TSH values over time under different storage conditions demonstrated the same behavior in both the samples dried at RT and those dried in an oven, i.e., they were stable up to D30 when stored at RT and were stable up to D60 when stored in a refrigerator or a freezer (Table 1 and Figure 1). At the end of 360 days, the median reduction of TSH concentrations compared to baseline values when the filter paper was dried at RT and stored at RT, in a refrigerator, or in a freezer, was 47.7%, 16.8%, and 10.1%, respectively. When the paper was dried in an oven, the mean reduction of TSH concentration was 37.4%, 12.8% and 9.2% when the filter paper was stored at RT, in a refrigerator or in a freezer, respectively. Regardless of the drying conditions, a greater decrease of TSH values occurred in samples stored at RT than in samples stored in a refrigerator or a freezer (P < 0.001), with no significant difference between storage in a refrigerator or a freezer (Table 1 and Figure 1).

DISCUSSION The use of blood obtained by heel puncture and dried on filter paper has greatly facilitated newborn screening. Although the pertinent literature is quite limited (2-8), it is undeniably important to establish the best drying and storage conditions of blood samples collected on filter paper for newborn screening. The samples are frequently exposed to different climate conditions during drying and transport to the laboratories, a fact that may influence the test results. These factors are extremely relevant for the National Newborn Screening Program in view of the climatic conditions of some Brazilian regions and those of other tropical countries, with high temperatures and humidity, and considering that the test cards are transported in ambulances, buses, or postal transport cars, in most cases without proper packaging. Additionally, in Brazil, the cards with filter paper are usually stored in a refrigerator until the screening tests are performed. After the results are obtained, the cards are stored at RT so the samples can be reutilized in the future for confirmation of the initial results in case of diagnostic doubts. Arch Endocrinol Metab. 2018;62/2

Stability of TSH in blood spots

Table 1. Thyroid stimulating hormone (TSH) concentrations (µIU/mL whole blood) in blood samples collected on filter paper and stored under different temperatures (room temperature [RT], 4°C, and -20°C) for 1 year Dried at RT Days

4°C

-20°C

Dried in an Oven P values

4°C

-20°C

P values

6.2 (3.3, 11.6) P = 0.59

6.0 (3.2, 11.2) P = 0.83

6.2 (3.3, 11.6) P = 0.57

RT vs 4 °C P = 0.45 RT vs -20 °C P = 0.98 4oC vs -20 °C P = 0.44

RT vs 4°C P = 0.06 RT vs -20°C P < 0.01 4°C vs -20°C P = 0.41

6.1 (3.3, 11.4) P = 0.86

6.5 (3.5, 12.1) P = 0.14

6.5 (3.5, 12.1) P = 0.12

RT vs 4 °C P = 0.20 RT vs -20 °C P = 0.17 4oC vs -20 °C P = 0.95

6.1 (3.3, 11.5) P = 0.34

RT vs 4°C P = 0.02 RT vs -20°C P = 0.25 4°C vs -20°C P = 0.24

5.3 (2.8, 9.9) P < 0.01

6.0 (3.2, 11.1) P = 0.73

6.1 (3.3, 11.4) P = 0.91

RT vs 4 °C P = 0.01 RT vs -20 °C P <0.01 4oC vs -20 °C P = 0.65

5.5 (2.9, 10.3) P < 0.01

5.8 (3.1, 10.9) P = 0.02

RT vs 4°C P < 0.01 RT vs -20°C P < 0.01 4°C vs -20°C P = 0.21

4.1 (2.2, 7.8) P < 0.01

5.0 (2.7, 9.3) P <0.01

5.4 (2.9, 10.1) P = 0.02

RT vs 4 °C P <0.01 RT vs -20 °C P <0.01 4oC vs -20 °C P = 0.06

4.9 (2.6, 9.1) P < 0.01

5.2 (2.8, 9.7) P < 0.01

RT vs 4°C P < 0.01 RT vs -20°C P < 0.01 4°C vs -20°C P = 0.10

3.5 (1.9, 6.6) P < 0.01

4.6 (2.5, 8.6) P <0.01

4.8 (2.6, 9.0) P <0.01

RT vs 4 °C P <0.01 RT vs -20 °C P <0.01 4oC vs -20 °C P = 0.27

6.4 (3.4, 12.0)

6.1 (3.3, 11.4) P = 0.27

6.1 (3.3, 11.5) P = 0.35

6.4 (3.4, 12.0) P = 0.89

RT vs 4°C P = 0.86 RT vs -20°C P = 0.33 4°C vs -20°C P = 0.42

D30

6.0 (3.2, 11.3) P = 0.16

6.5 (3.5, 12.2) P = 0.63

6.7 (3.6, 12.6) P = 0.20

D60

5.9 (3.1, 11.0) P = 0.04

6.4 (3.4, 12.1) P = 0.83

D180

4.0 (2.1, 7.5) P < 0.01

D360

3.4 (1.8, 6.4) P < 0.01

RT 6.0 (3.2, 11.3)

Figure 1. Variation of geometric mean TSH concentration (µIU/mL) along time under the different drying and storage conditions. RT/RT = samples dried and stored at room temperature; RT/4ºC = samples dried at room temperature and stored in a refrigerator; RT/-20ºC = samples dried at room temperature and stored in a freezer; Ov/RT = samples dried in an oven and stored at room temperature; Ov/4ºC = samples dried in an oven and stored in a refrigerator; Ov/-20ºC = samples dried in an oven and stored in a freezer.

The current study demonstrated that drying temperatures of up to 35°C for 3 hours do not interfere with the basal TSH results. Sample storage conditions, however, interfered with the TSH values observed. Regardless of the drying conditions (RT or oven), the samples remained stable for a longer period of time (up to D60) when stored in a refrigerator or freezer than when stored at RT (up to D30), with no difference between storage in a refrigerator or a freezer. Arch Endocrinol Metab. 2018;62/2

The present data disagree with those reported by Chen and cols. (5) who observed that the TSH values in blood collected by newborn heel puncture and dried on filter paper were higher when the samples were dried in room air than under direct sunlight (4060°C) or in a heater (60-80°C). However, the drying temperatures used by Chen and cols. (5) were higher than those used in the current study (35°C), which are close to those naturally occurring in Brazil during the summer. In addition, some of the samples in Chen and cols. (5) were directly exposed to sunlight, a fact that may have contributed to the reduction of TSH. Within this context we may refer to the work of Davis & Poholek (2) who demonstrated that direct irradiation with sunlight or exposure to a high temperature (6064°C), especially in combination with exposure to higher humidity, may reduce blood extraction from the filter paper, reduce thyroxine (T4) values, and may consequently yield false-negative results within a few days after collection. It should be noted, however, that T4 is more susceptible than TSH to the effects of improper sample drying and storage, representing an additional factor favoring TSH determination as the method of choice for newborn CH screening (4,8). Confirming the stability of TSH up to D30 regardless of drying or storage conditions, Waite and cols. (4) did 203

TSH values are reported as geometric means with their respective confidence intervals (95%CI). P values below the geometric mean refer to the comparison with the D0 mean. D0, TSH measurement at the same day of sample collection; D7, D30, D60, D180 and D360, TSH measurement after 7, 30, 60, 180, and 360 days of storage, respectively.

Stability of TSH in blood spots

not detect differences in TSH results during 1 month of storage of blood samples collected on filter paper, dried at room temperature for several hours, and stored under different temperature and humidity conditions. The stability of TSH in this study (30 days at RT and up to 60 days in the refrigerator or freezer) was shorter than the 36 months reported by Lando and cols. (6) for samples collected from newborns on filter paper and stored in a refrigerator (2-8oC), and also shorter than the 2.7, 4.1 and 6.5 years for samples stored at RT, 4oC and -20oC, respectively, reported by El Ezzi and cols. (7). However, the determinations performed by Lando and cols. (6) over a period of 60 months were not carried out on samples from the same individual, a fact that limits this comparison. El Ezzi and cols. (7) used a sealed plastic bag containing silica gel for samples storage, which may have increased sample stability. This interpretation is supported by Adam and cols., (8) who found that TSH and T4 degradation on filter paper is three and ten times greater, respectively, in samples stored at higher humidity. In addition, other factors such as the quality of the filter paper used, the way the blood was placed on filter paper, the time of blood elution, and even the method of hormone determination may interfere with TSH results and stability (6). It must be mentioned, that our study has an important limitation: the great variability of the TSH values of the samples. In Brazil, the cut-off level of neonatal TSH used by the newborn screening reference centers is around 6-10 µIU/mL WB. Imprecision and a moderate degree of instability will not affect the screening decision for a TSH level of < 4 mIU/L blood WB (normal) or > 20 mIU/L blood WB, but could lead to failure diagnosis of affected children who had neonatal TSH close to cut-off levels. However, in this study, an analysis using only the samples with serum TSH of 4.5–20 µIU/mL would have a low accuracy because of the small number of samples (N = 10). In conclusion, although adult samples were used instead of newborn blood, the results of the current study contribute to better quality control of TSH results obtained in newborn screening tests and indicate the lack of influence of high temperatures for sample drying. In addition, these results suggest that,

204

under ideal conditions, the sample should be placed in a refrigerator for long-term storage, something that does not routinely occur in Brazilian Newborn Screening laboratories. Even so, if confirmation of the initial result should become necessary after 6 months of storage, it is necessary to consider the possibility of reduced TSH concentrations due to loss of hormone stability inherent to storage, mainly in samples close to cut-offs levels. Author contributions: P.K.R.M. and L.M.Z.M. designed the overall concept and wrote the manuscript; C.H.M. and F.C.V collected the data; R.R.B. and G.A.C.C.P. performed the experiments; A.S. and E.Z.M. performed the statistical analysis. Disclosure: no potential conflict of interest relevant to this article was reported.

REFERENCES 1. American Academy of Pediatrics, Rose SR; Section on Endocrinology and Committee on Genetics, American Thyroid Association, Brown RS; Public Health Committee, Lawson Wilkins Pediatric Endocrine Society, Foley T, Kaplowitz PB, Kaye CI. Update of newborn screening and therapy for congenital hypothyroidism. Pediatrics. 2006;117:2290-303. 2. Davis G, Poholek R. Stability of dried blood spots on paper, as used in screening neonates for hypothyroidism. Clin Chem. 1979;25(1):24-5. 3. Coombes EJ, Gamlen TR, Batstone GF. Effect of temperature on the stability of thyroid stimulating hormone in dried blood spots. Ann Clin Biochem. 1983;20 (Pt 4):252-3. 4. Waite KV, Maberly GF, Eastman CJ. Storage conditions and stability of thyrotropin and thyroid hormones on filter paper. Clin Chem. 1987;33(6):853-5. 5. Chen X, Wu G, Song Z, Zhou H, Zhou C, Yang C, et al. The investigation of factors influencing the measurement of thyroid stimulating hormone in dried blood spots on filter paper. Southeast Asian J Trop Med Public Health. 2003;34 Suppl 3:147-9. 6. Lando VS, Batista MC, Nakamura IT, Mazi CR, Mendonça BB, Brito VN. Effects of long-term storage of filter paper blood samples on neonatal thyroid stimulating hormone, thyroxin and 17-alpha-hydroxyprogesterone measurements. J Med Screen. 2008;15(3):109-11. 7. El Ezzi AA, El-Saidi MA, Kuddus RH. Long-term stability of thyroid hormones and DNA in blood spots kept under varying storage conditions. Pediatr Int. 2010;52(4):631-9. 8. Adam BW, Hall EM, Sternberg M, Lim TH, Flores SR, O’Brien S, et al. The stability of markers in dried-blood spots for recommended newborn screening disorders in the United States. Clin Biochem. 2011;44(17-18):1445-50. 9. West BT, Galecki AT. An Overview of Current Software Procedures for Fitting Linear Mixed Models. Am Stat. 2012;65(4):274-82. 10. Littell RC, Henry PR, Ammerman CB. Statistical analysis of repeated measures data using SAS procedures. J Anim Sci. 1998;76(4):1216-31.

Arch Endocrinol Metab. 2018;62/2

original article

Diagnostic utility of DREAM gene mRNA levels in thyroid tumours Fernando A. Batista1, Marjory A. Marcello1, Mariana B. Martins1, Karina C. Peres1, Ulieme O. Cardoso1, Aline C. D. N. Silva1, Natassia E. Bufalo1, Fernando A. Soares2, Márcio J. da Silva3, Lígia V. Assumpção1, Laura S. Ward1

ABSTRACT Objective: The transcriptional repressor DREAM is involved in thyroid-specific gene expression, thyroid enlargement and nodular development, but its clinical utility is still uncertain. In this study we aimed to investigate whether DREAM mRNA levels differ in different thyroid tumors and how this possible difference would allow the use of DREAM gene expression as molecular marker for diagnostic and/or prognosis purpose. Materials and methods: We quantified DREAM gene mRNA levels and investigated its mutational status, relating its expression and genetic changes to diagnostic and prognostic features of 200 thyroid tumors, being 101 malignant [99 papillary thyroid carcinomas (PTC) and 2 anaplastic thyroid carcinomas] and 99 benign thyroid lesions [49 goiter and 50 follicular adenomas (FA)]. Results: Levels of mRNA of DREAM gene were higher in benign (0.7909 ± 0.6274 AU) than in malignant (0.3373 ± 0.6274 AU) thyroid lesions (p < 0.0001). DREAM gene expression was able to identify malignancy with 66.7% sensitivity, 85.4% specificity, 84.2% positive predictive value (PPV), 68.7% negative predictive value (NPV), and 75.3% accuracy. DREAM mRNA levels were also useful distinguishing the follicular lesions FA and FVPTC with 70.2% sensitivity, 73.5% specificity, 78.5% PPV, 64.1% NPV, and 71.6% accuracy. However, DREAM gene expression was neither associated with clinical features of tumor aggressiveness, nor with recurrence or survival. Six different genetic changes in non-coding regions of DREAM gene were also found, not related to DREAM gene expression or tumor features. Conclusion: We suggest that DREAM gene expression may help diagnose thyroid nodules, identifying malignancy and characterizing follicular-patterned thyroid lesions; however, it is not useful as a prognostic marker. Arch Endocrinol Metab. 2018;62(2):205-11 Keywords Calsenilin; diagnostic; follicular thyroid lesion; KChIP-3; thyroid nodules

Laboratório de Genética Molecular do Câncer (Gemoca), Faculdade de Ciências Médicas (FCM), Universidade Estadual de Campinas (Unicamp), Campinas, SP, Brasil 2 Departamento de Patologia, Hospital A.C. Camargo – Fundação Antonio Prudente, São Paulo, SP, Brasil 3 Centro de Biologia Molecular e Engenharia Genética (CBMEG), Universidade Estadual de Campinas (Unicamp), Campinas, SP, Brasil 1

Correspondence to: Laura S. Ward Laboratório de Genética Molecular do Câncer (Gemoca), Faculdade de Ciências Médicas (FCM), Universidade Estadual de Campinas (Unicamp) Rua Tessalia Vieira de Camargo, 126, Cidade Universitária Zeferino Vaz 13083-887 – Campinas, SP, Brasil ward@fcm.unicamp.br Received on May/15/2017 Accepted on Nov/8/2017

INTRODUCTION

n important increase in the incidence of thyroid cancer has been observed worldwide, mainly because of a better access to high resolution image exams, such as ultrasound, and frequent fine-needle aspiration (FNA) biopsies of small nodules (1-4). Despite the advantages of cytological analysis using FNA, this method has limitations, not being able to diagnose reliably a substantial part of thyroid nodules. Hence, many patients are submitted to thyroid resection for a definitive diagnosis, and postsurgical exams reveal no need for surgery in approximately 75% of these cases (4-7). A series of diagnostic markers has been proposed and some molecular platforms are particularly helpful in thyroid cancer diagnosis, but their implementation in clinical routine is still difficult (8). The determination of prognosis in thyroid cancer patient is problematic as well. Although most patients Arch Endocrinol Metab. 2018;62/2

have satisfactory outcome, recurrences are relatively frequent and up to 10-15% of cases may present an aggressive behavior characterized by metastases during follow-up, eventually leading to death (9). Reliable markers able to predict poor outcome during followup are utmost needed in clinical practice (2,4). The DREAM gene (downstream regulatory element antagonist modulator) has been mapped to chromosome 2q11.1 and has nine exons. The product of this gene, an homonymous protein, also identified as KchIP-3 (K channel-interacting protein 3) or calsenilin, belongs to the KchIP family, composed by four proteins (KChIP1-4) (10). DREAM has the ability to directly bind to specific DNA sites, the downstream regulatory elements (DRE), acting as a transcriptional repressor (11). Under basal conditions, DREAM binds to DRE, resulting in repression of transcription of target genes. Activation of DREAM, which can happen by increasing 205

DOI: 10.20945/2359-3997000000028

Diagnostic utility of DREAM in thyroid tumours

nuclear calcium or by direct phosphorylation by PKA, results in the disruption of the DREAM-DRE binding, which enables gene transcription (10,12,13). DREAM may also connect to Kv4 potassium channels in the membrane as an accessory subunit, regulating their opening through stimulation by calcium (14). DREAM expression is found in the central nervous system, organs of the immune system, tests and thyroid (10). Although previous studies have suggested that DREAM has an important role as a mediator in several thyroid signaling pathways, and it is also involved in the regulation of follicular cellular functions (15-17), a possible clinical utility of DREAM as a biomarker for diagnosis or prognosis of thyroid lesions has not been explored. For these reasons, we quantified DREAM mRNA levels, and investigated the occurrence of its genetic alterations both in benign and malignant thyroid nodules, comparing the presence of these alterations and/or expression levels to diagnostic and prognostic features of these tumors.

MATERIALS AND METHODS

Patients We investigated a total of 200 patients whose tissue samples were maintained in the tissue bank of the AC Camargo Cancer Hospital, São Paulo, Brazil. Fresh thyroid tissue samples were obtained from 101 patients diagnosed with thyroid carcinoma (TC): 99 papillary thyroid carcinomas (PTCs), including 63 classic papillary thyroid carcinomas (CPTC), 36 follicular variants of papillary thyroid carcinomas (FVPTC); and two anaplastic thyroid carcinomas (ATC). In addition, there were 49 nodular goiters and 50 follicular adenomas (FA). Four normal tissues from the contralateral lobe of four goiter cases were obtained as well. The diagnosis of TC was based on standard clinical criteria described in our previous article (18). All patients were treated according to a standard protocol (19,20) and followed for 12-87 months with a median follow-up of 3.16 years (38 ± 17 months). This study was approved by the Research Ethics Committees of the institutions involved (Process # 821,805). All procedures performed in this study were in accordance with the ethical standards of the institutional and national research committee and the 1964 Helsinki declaration and its later amendments or comparable ethical standards. 206

Quantitative real-time PCR (qPCR) We were able to extract RNA from all 204 samples. Total RNA was extracted from pulverized frozen thyroid tissues using Trizol reagent (Invitrogen Life Technologies Inc., Carlsbad, CA, USA), according to the manufacturer instructions. The samples were digested with Amplification Grade DNAse I (Life Technologies, Rockville, MD, USA) and reversetranscribed using SuperScript III reverse-transcriptase (Invitrogen Life Technologies Inc.). The assays were carried out with the use of commercially available TaqMan gene expression assays (Applied Biosystems) for DREAM (Hs01106289_m1) relative to the internal reference gene GAPDH (Hs02758991_g1). Reactions were prepared with TaqMan gene expression master mix (Applied Biosystems), according to the manufacturer protocol. Analysis was performed with a 7500 RT-PCR system (Applied Biosystems, Foster City, CA, USA), using a four-stage program: 50ºC for 2 min, 95ºC for 10 min, 40 cycles of 95ºC for 15s, and 60ºC for 1 min. Each sample was assayed in triplicate. Threshold cycle (Ct) was obtained using the sequence detection software (Applied Biosystems SDS v1.3 Software). We used DDCT, in which the amount of target (DREAM) normalized to an endogenous reference and relative to calibrator is given by 2-DDT. The expression levels were given in arbitrary units (AU).

Sequencing the coding regions of DREAM gene The coding regions of DREAM gene were amplified by PCR using the following primers (all 5’–3’, forward and reverse respectively): AGGGGTGGAGCGATAGAAG and CAAAGGAAAGTGGAACAAGAG for exon 1; CCCATCTTACACCATAGCCA and GGGAAGGGTGTGAATGAATG for exon 2; GGTAGTCATGCAAAGAGAGTTC and TTTCCCACAACACATAAGCC for exon 3; CAAGGGGGTGGAGAGAGG and CCCAGGGTGACTCACAAGAT for exons 4 and 5; AATGGATGCCGTCAGTCTCT and CCGAGAACACTTGCTGAGCT for exon 6; CTTCTCTCTCCAGCTCGTC and GAGTAGGGAGGCTCAGAGG for exon 7; CCAGAGTAGTCACAGGGGCA and AGACAAGAGGGCAAGTGGAG for exon 8; CTCCCTGCACCAATAAGAC and CTGGCAGGATGGAGGTTTCT for exon 9. PCR was Arch Endocrinol Metab. 2018;62/2

Diagnostic utility of DREAM in thyroid tumours

Statistical analysis Statistical analysis was carried out using the SAS System for Windows (Statistical Analysis System, version 9.1.3, Service Pack 3 Institute Inc., 2002–2003, Cary, NC, USA). For the analysis of correlation of DREAM gene expression and clinical and pathological features of aggressiveness, patients were classified according to age of diagnosis, gender, tumor size, presence of extrathyroidal invasion, presence of capsule, multifocality, presence of metastasis at diagnosis and TNM. For the comparison with patients outcome, the population as classified according to response to treatment, as recommended by the latest ATA guidelines (4). The Mann–Whitney tests were used to compare continuous or arranged measures between two groups; Kruskal–Wallis test was used to compare three or more groups. The accuracy of gene expression studies to predict malignancy and/or differentiate follicular lesions was evaluated using receiver operating curve (ROC) analysis, based on predicted probabilities from logistic regression models. Recurrence-free survival was calculated using Kaplan–Meier survival curves with log rank comparison. For this analysis, the Arch Endocrinol Metab. 2018;62/2

TC patients were divided in two groups, low expression of DREAM (≤ 0.2AU) and normal/hyperexpression of DREAM (> 0.2AU). All tests were conducted at the significance level p = 0.05.

RESULTS As expected, thyroid cancer patients were predominantly females (75.3%) aged 14–70 years old (41.1 ± 14.3 years) at the time of diagnosis. The 101 patients of the thyroid cancer group did not differ from the 99 individuals with benign thyroid diseases concerning gender (67 females and 22 males vs. 78 females and 16 males, respectively) or age at diagnosis (45.6 ± 16.3 years old vs. 48.5 ± 14.8 years old, respectively). Multifocality was observed in 37% of the patients and 26% presented invasion of the capsule. Stage I (66%) and stage II (29%) were more frequent than stage III (3%) and stage IV (2%) cases. Metastasis at the time of diagnosis was observed in 45% of the patients.

DREAM mRNA levels DREAM mRNA level comparison between benign and malignant lesions is summarized in Table 1. As presented in Figure 1, the levels were significantly higher in benign (0.7909 ± 0.6274 AU) than in malignant nodules (0.3373 ± 0.6274 AU; p < 0.0001). Among the different histological types of tumors, we found higher mRNA levels of DREAM gene in goiter, followed by FA, FVPTC and CPTC respectively, as represented in Figure 2. Furthermore, DREAM gene expression was able to distinguish goiter and FA, goiter and FVPTC, goiter and CPTC, FA and CPTC, and the follicular-patterned lesions, FA and FVPTC, as shown in Table 1. Table 1. Comparisons of different histopathological types according to their DREAM mRNA levels Analyzed groups

DREAM mRNA levels DDCt (qPCR)

p value

Malignant vs. Benign

0.3373 ± 0.6274 vs. 0.7909 ± 0.6274

< 0.0001

Goiter vs. FA

0.7816 ± 0.6512 vs. 0.8001 ± 0.6160

0.6725

Goiter vs. FVPTC

0.7816 ± 0.6512 vs. 0.3449 ± 0.2221

0.0069

Goiter vs. CPTC

0.7816 ± 0.6512 vs. 0.3281 ± 0.2261

0.0002

FA vs. FVPTC

0.8001 ± 0.6160 vs. 0.3449 ± 0.2221

0.0002

FA vs. CPTC

0.8001 ± 0.6160 vs. 0.3281 ± 0.2261

< 0.0001

FVPTC vs. CPTC

0.3449 ± 0.2221 vs. 0.3281 ± 0.2261

0.6378

207

performed in 20 μL volume of a mixture containing 100 ng of DNA, 5 mM of each primer, 2 μL of 10X PCR Buffer, 150 μM of each dinucleotide triphosphate, 1U Taq DNA polymerase, 1.5 mM MgCl2 and deionized water up to 20 μL. Amplifications were carried out for 35 cycles of 94°C for 30 seconds, 55°C for 50 seconds and 72°C for 1 minute, with an initial denaturation step of 94°C for 5 minutes and a final extension step of 72°C for 10 minutes, using a MJ PTC-200 PCR system. Purification was performed using ExoSAPIT (USB Products, Cleveland, OH). The samples were submitted to automated sequencing using the SANGER method. For this reaction, we used for each sample: 13.5 μL of water, 4 μL of save money 5x buffer, 1 μL of each primer, 0.5 μL of BigDye buffer and 1 μL of the purified sample. The following cycles were used in the sequencing reaction: initial cycle of 1 min and 30s at 96°C, followed by 25 cycles of 96°C for 12s, 50°C for 6s and 60°C for 4 min. Sequencing reactions were performed using Eppendorf PCR BD3700 system and separated on an ABI Prism 3700 DNA Analyzer (Applied Biosystems, Foster, CA, USA). All sequences were analyzed using CLC DNA Workbench® (Katrinebjerg, Denmark) software and compared with the DREAM genomic sequence (ENSG00000115041).

DREAM mRNA level of expression (AU)

Diagnostic utility of DREAM in thyroid tumours

found 6 single base substitutions in noncoding regions near the amplified coding regions (Table 3). No association was found regarding clinical or pathological features, and we were unable to demonstrate any variation of mRNA levels in association with the observed sequence substitutions.

5 4 3 2 1 0

DISCUSSION

-1 Benign

Malignant

Figure 1. DREAM mRNA expression by quantitative PCR in benign and malignant thyroid lesions (P < 0.0001).

Table 2. Comparison of DREAM mRNA levels to clinical and pathological features of aggressiveness and outcome of 101 thyroid carcinomas

5 DREAM mRNA level of expression (AU)

In the present study we report higher mRNA levels of DREAM gene in benign thyroid tumours when

Variable

DREAM expression

p value

< 45

0.44 ± 0.51

0.76

> 45

0.46 ± 0.66

Age of diagnosis

3 2

Gender

1 0 -1 Goiter

FVPTC

CPTC

Figure 2. DREAM mRNA expression by quantitative PCR in goiter, follicular adenoma (FA), follicular variant papillary thyroid carcinoma (FVPTC) and classic papillary thyroid carcinoma (CPTC).

Male

0.34 ± 0.30

Female

0.48 ± 0.67

0.9

Tumour size < 2 cm

0.20 ± 0.31

2 – 4 cm

0.33 ± 0.33

> 4 cm

0.39 ± 0.45

0.23

Extrathyroidal invasion

Aiming to investigate the diagnostic utility of DREAM gene expression, we further performed ROC analysis based on predicted probabilities from logistic regression models. Using a cutoff of 0.528 AU, DREAM was able to predict malignancy in thyroid nodules with 66.7% sensitivity, 85.4% specificity, 84.2% positive predictive value (PPV), 68.7% negative predictive value (NPV), and 75.3% accuracy. DREAM mRNA levels were also useful in distinguishing the follicular lesions FA and FVPTC with 70.2% sensitivity, 73.5% specificity, 78.5% PPV, 64.1% NPV, and 71.6% accuracy, using a cutoff value of 0.405 AU. Although DREAM gene mRNA levels were different among thyroid lesions, there was no association with any clinical or pathological parameter of tumor aggressiveness and there was no association with patient outcomes (Table 2, Figure 3).

DREAM mutational analysis We were able to perform mutational analysis of all 9 exons of DREAM gene in all 200 samples. There were no genetic changes in the coding regions. However, we 208

Present

0.46 ± 0.65

Absent

0.40 ± 0.45

0.83

Presence of capsule Present

0.48 ± 0.60

Absent

0.44 ± 0.61

0.27

Multifocality Present

0.35 ± 0.26

Absent

0.49 ± 0.72

0.24

Metastasis at diagnosis Present

0.48 ± 0.62

Absent

0.38 ± 0.48

0.32

TNM I

0.94 ± 0.42

0.71 ± 0.38

III

0.67 ± 0.57

0.41 ± 0.00

0.43

Outcome* Excellent response

0.49 ± 0.10

Incomplete response

0.82 ± 0.40

0.61

* Classification according to recommendation of American Thyroid Association 2015 guidelines (4). Incomplete responses were grouped together due to insufficient number of structural incomplete response cases for statistical analysis. Indeterminate response cases were excluded from the analysis. Arch Endocrinol Metab. 2018;62/2

compared to malignant thyroid lesions. By comparing different histologic types of tumours, we also described higher DREAM gene expression not only presents potential identifying malignancy but also distinguishing the follicular-patterned lesions AF and CPVF. We also described the presence of intronic genetic changes of DREAM gene in thyroid nodules patients. Although this is, to our knowledge, the first study of the DREAM gene comprehending malignant and benign thyroid nodules, previous studies have already demonstrated the importance of DREAM for the normal function of the thyroid gland, which may justify the possible loss of

1.0

Recurrence-free survival

0.8

0.6

0.4

0.2

0.0 .00

25.00

50.00

75.00

100.00

125.00

Time to recurrence (months) Low expression

Normal/hyperexpression

Figure 3. Kaplan-Meier curve comparing patterns of recurrence-free survival between patients according to DREAM gene expression. Table 3. Genetic changes in DREAM gene found in this study ID (rs)

Localization

Nucleotide

–

Promoter region

IVS-95T>A

rs2248415

Intron1

IVS1+41C>G

–

Intron1

IVS2-131C>T

rs117109173

Intron3

IVS3+10G>C

–

Intron3

IVS3+17T>C

rs58372613

Intron7

IVS8-118C>T

Allelic frequency A = 0.9975 (399/400) T = 0.0025 (01/400) C = 0.2500 (100/400) G = 0.7500 (300/400) C = 0.0050 (02/400) T = 0.9950 (398/400) C = 0.940 (376/400) G = 0.0600 (24/400) T = (0.0025 (01/400) C = 0.9975 (399/400) C = 0.4300 (112/400) T = 0.5700 (288/400)

Arch Endocrinol Metab. 2018;62/2

expression during the dedifferentiation process of the gland. Rivas and cols., demonstrated that, in thyroid follicular cells, DREAM interacts directly with the thyroid transcription factor-1 (TTF-1) by modulating its transcriptional activity, and acts in the regulation of gene expression of thyroglobulin and the other two main thyroid-specific transcription factors PAX8 and FOXE1 (15), both involved in thyroid differentiation (21,22). DREAM can still act as intracellular effector of TSH receptor (TSHR), activating the signaling cascade by cAMP (adenosine 3’,5’-cyclicmonophosphate) independently of stimulation by TSH, which is suggested by Rivas and cols., as a possible mechanism of development of multinodular goiter by describing overexpression of DREAM in 10 of 16 human samples (16). Similarly, Shinzato and cols. described overexpression of DREAM gene in 53.3% of a cohort composed of 60 multinodular goiter patients (23). Our data is compatible with these findings, being goiter the lesion which presented higher levels of DREAM mRNA compared to any other histological type of the analyzed thyroid samples. The same study also reports mutational analysis of DREAM. The SNPs rs2248415 and rs117109173, found in a 75 and 6% of our patients respectively were also described by them in 91.6 and 8.3% of their patients respectively. In our analysis, the intronic polymorphisms did not correlate in DREAM mRNA levels in different thyroid lesions and, similarly to previously published, do not seem to be associated with differential DREAM expression (23). The expression pattern of DREAM in different thyroid lesions rise the hypothesis of a possible involvement of this transcription repressor in the tumorigenesis and dedifferentiation of the thyroid gland. Although the exact mechanism by which DREAM could possibly play a role in this process remains unknown, there are multiple paths to be explored. The lower expression of DREAM in malignant lesions may play a role in thyroid carcinogenesis given to the proapoptotic activity, thanks to the direct interaction with the presenilin 2(PS2) protein, which culminates in the activation of the caspase cascade (24). The above mentioned transcriptional modulation activity of DREAM on PAX8 and FOXE1 gene expression (15) could also explain the lower mRNA levels in malignant thyroid tissue, since both genes are involved in thyroid differentiation. Our previous findings about mRNA levels of thyroid specific transcription factors in thyroid tumours corroborate this hypothesis: both PAX8 209

Diagnostic utility of DREAM in thyroid tumours

and FOXE1 follow a similar expression pattern than DREAM, being highly expressed in benignant lesions compared to malignant lesions (18). A third possibility would be the involvement of DREAM as repressor of the immune response. Savignac and cols. have previously demonstrated that transient knockdown of DREAM induced basal expression of interleukin-2 and interferon gamma in wild-type splenocytes (25). Recent publications from our group have demonstrated the important role which the immune system plays in thyroid cancer behaviour (26-29). Further investigation could lead to the identification of DREAM as one of the many molecules which take part in this association. The differential expression of the DREAM gene described by us rises the possibility of use of this gene as a molecular marker. Although DREAM mRNA levels failed to identify aggressiveness and predict prognosis, there is potential for the use as a diagnostic marker. A comparison with some of the currently available panels of molecular markers can be seen on Table 4. DREAM specificity (85%), was better than Afirma (52%), Rosetta microRNA classifier (72%) and ThyGenX®/ ThyraMIR™ (85%). Despite its low NPV (69%), DREAM presented the second best PPV (84%), higher than other four panels (ThyroSeq v2, 77%; Afirma, 47%; Rosetta microRNA classifier, 59%; and ThyGenX®/ ThyraMIR™, 74%). Perhaps the most interesting comparison is the one between DREAM expression and Afirma, given the fact that this gene expression classifier (GEC) test which possesses high NPV and sensitivity (93 and 92% respectively), has relatively low specificity and PPV (52 and 47% respectively). As a result, more than a half of the patients tested positive by the Afirma GEC may still have a benign disease on surgical pathology. On the contrary, DREAM presented much higher PPV and specificity values (84 and 85%

respectively) but much lower NPV and sensitivity value (69 and 67% respectively). We suggest that DREAM gene expression may not be useful as a single marker, but could be part of a panel of markers of malignancy, like the GEC test. Also, it may help identify follicular lesions, one of the major challenges in clinical practice. In conclusion, our investigation demonstrated a possible diagnostic utility of DREAM gene mRNA levels in the identification of thyroid nodule malignancy and differentiation of follicular-patterned thyroid lesions. In addition, we demonstrated the presence of intronic changes of DREAM gene in patients with thyroid nodules, although these changes were not related to clinical features.

Table 4. Comparison of sensitivity, specificity, NPV and PPV values of DREAM mRNA levels in thyroid tumours with some currently available panels of thyroid cancer molecular markers

Sensitivity

Specificity

NPV

PPV

DREAM mRNA levels

67%

85%

69%

84%

Seven-gene panel (30)

63%

99%

94%

88%

ThyroSeq v2 (31)

91%

92%

97%

77%

Afirma (32)

92%

52%

93%

47%

Acknowledgements: the authors would like to thank financial support from the Foundation for Research of the State of São Paulo (Fapesp) for the financial support (grant # 2013/18683-7) and our group from the Laboratory of Cancer Molecular Genetics (Gemoca) of the School of Medical Sciences, Unicamp. The authors declare that they have no conflict of interest. Disclosure: no potential conflict of interest relevant to this article was reported.

REFERENCES 1. 2.

3. 4.

8. 9.

Nikiforov YE, Nikiforova MN. Molecular genetics and diagnosis of thyroid cancer. Nat Rev Endocrinol. 2011;7(10):569-80. Pitoia F, Ward L, Wohllk N, Friguglietti C, Tomimori E, Gauna A, et al. Recommendations of the Latin American Thyroid Society on diagnosis and management of differentiated thyroid cancer. Arq Bras Endocrinol Metabol. 2009;53(7):884-7. Ahn HS, Kim HJ, Welch HG. Korea’s thyroid-cancer “epidemic”-screening and overdiagnosis. N Engl J Med. 2014;371(19):1765-7. Haugen BR, Alexander EK, Bible KC, Doherty GM, Mandel SJ, Nikiforov YE, et al. 2015 American Thyroid Association Management Guidelines for Adult Patients with Thyroid Nodules and Differentiated Thyroid Cancer: The American Thyroid Association Guidelines Task Force on Thyroid Nodules and Differentiated Thyroid Cancer. Thyroid. 2016;26(1):1-133. Melillo RM, Santoro M. Molecular biomarkers in thyroid FNA samples. J Clin Endocrinol Metab. 2012;97(12):4370-3. Wang CC, Friedman L, Kennedy GC, Wang H, Kebebew E, Steward DL, et al. A large multicenter correlation study of thyroid nodule cytopathology and histopathology. Thyroid. 2011;21(3):243-51. Bryson PC, Shores CG, Hart C, Thorne L, Patel MR, Richey L, et al. Immunohistochemical distinction of follicular thyroid adenomas and follicular carcinomas. Arch Otolaryngol Head Neck Surg. 2008;134(6):581-6. Ward LS, Kloos RT. Molecular markers in the diagnosis of thyroid nodules. Arq Bras Endocrinol Metabol. 2013;57(2):89-97. Jemal A, Siegel R, Xu J, Ward E. Cancer statistics, 2010. CA Cancer J Clin. 2010;60(5):277-300.

Rosetta microRNA classifier™ (33)

85%

72%

91%

59%

ThyGenX® and ThyraMIR™ (34)

10. Carrión AM, Link WA, Ledo F, Mellström B, Naranjo JR. DREAM is a Ca2+-regulated transcriptional repressor. Nature. 1999;398(6722):80-4.

89%

85%

94%

74%

11. Carrión AM, Mellström B, Naranjo JR. Protein kinase A-dependent derepression of the human prodynorphin gene via differential

210

Arch Endocrinol Metab. 2018;62/2

Diagnostic utility of DREAM in thyroid tumours

binding to an intragenic silencer element. Mol Cell Biol. 1998;18(12):6921-9. 12. Ledo F, Carrión AM, Link WA, Mellström B, Naranjo JR. DREAMalphaCREM interaction via leucine-charged domains derepresses downstream regulatory element-dependent transcription. Mol Cell Biol. 2000;20(24):9120-6. 13. Sanz C, Mellstrom B, Link WA, Naranjo JR, Fernandez-Luna JL. Interleukin 3-dependent activation of DREAM is involved in transcriptional silencing of the apoptotic Hrk gene in hematopoietic progenitor cells. EMBO J. 2001;20(9):2286-92. 14. An WF, Bowlby MR, Betty M, Cao J, Ling HP, Mendoza G, et al. Modulation of A-type potassium channels by a family of calcium sensors. Nature. 2000;403(6769):553-6. 15. Rivas M, Mellström B, Naranjo JR, Santisteban P. Transcriptional repressor DREAM interacts with thyroid transcription factor-1 and regulates thyroglobulin gene expression. J Biol Chem. 2004;279(32):33114-22. 16. Rivas M, Mellström B, Torres B, Cali G, Ferrara AM, Terracciano D, et al. The DREAM protein is associated with thyroid enlargement and nodular development. Mol Endocrinol. 2009;23(6):862-70. 17. D’Andrea B, Di Palma T, Mascia A, Motti ML, Viglietto G, Nitsch L, et al. The transcriptional repressor DREAM is involved in thyroid gene expression. Exp Cell Res. 2005;305(1):166-78. 18. Batista FA, Ward LS, Marcello MA, Martins MB, Peres KC, Torricelli C, et al. Gene expression of thyroid-specific transcription factors may help diagnose thyroid lesions but are not determinants of tumor progression. J Endocrinol Invest. 2016;39(4):423-9. 19. Ward LS, Maciel LM. Thyroid consensuses: guidelines for clinical practice. Arq Bras Endocrinol Metabol. 2013;57(3):161-2. 20. American Thyroid Association (ATA) Guidelines Taskforce on Thyroid Nodules and Differentiated Thyroid Cancer, Cooper DS, Doherty GM, Haugen BR, Kloos RT, Lee SL, Mandel SJ, et al. Revised American Thyroid Association management guidelines for patients with thyroid nodules and differentiated thyroid cancer. Thyroid. 2009;19(11):1167-214. 21. Civitareale D, Saiardi A, Falasca P. Purification and characterization of thyroid transcription factor 2. Biochem J. 1994;304(Pt 3):981-5. 22. Plachov D, Chowdhury K, Walther C, Simon D, Guenet JL, Gruss P. Pax8, a murine paired box gene expressed in the developing excretory system and thyroid gland. Development. 1990;110(2):643-51.

25. Savignac M, Pintado B, Gutierrez-Adan A, Palczewska M, Mellström B, Naranjo JR. Transcriptional repressor DREAM regulates T-lymphocyte proliferation and cytokine gene expression. EMBO J. 2005;24(20):3555-64. 26. Cunha LL, Nonogaki S, Soares FA, Vassallo J, Ward LS. Immune Escape Mechanism is Impaired in the Microenvironment of Thyroid Lymph Node Metastasis. Endocr Pathol. 2017;28(4):369-372. 27. Cunha LL, Morari EC, Nonogaki S, Marcello MA, Soares FA, Vassallo J, et al. Interleukin 10 expression is related to aggressiveness and poor prognosis of patients with thyroid cancer. Cancer Immunol Immunother. 2017;66(2):141-8. 28. Cunha LL, Marcello MA, Nonogaki S, Morari EC, Soares FA, Vassallo J, et al. CD8+ tumour-infiltrating lymphocytes and COX2 expression may predict relapse in differentiated thyroid cancer. Clin Endocrinol (Oxf). 2015;83(2):246-53. 29. Cunha LL, Marcello MA, Ward LS. The role of the inflammatory microenvironment in thyroid carcinogenesis. Endocr Relat Cancer. 2014;21(3):R85-R103. 30. Nikiforov YE, Ohori NP, Hodak SP, Carty SE, LeBeau SO, Ferris RL, et al. Impact of mutational testing on the diagnosis and management of patients with cytologically indeterminate thyroid nodules: a prospective analysis of 1056 FNA samples. J Clin Endocrinol Metab. 2011;96(11):3390-7. 31. Nikiforov YE, Carty SE, Chiosea SI, Coyne C, Duvvuri U, Ferris RL, et al. Impact of the Multi-Gene ThyroSeq Next-Generation Sequencing Assay on Cancer Diagnosis in Thyroid Nodules with Atypia of Undetermined Significance/Follicular Lesion of Undetermined Significance Cytology. Thyroid. 2015;25(11):1217-23. 32. Alexander EK, Kennedy GC, Baloch ZW, Cibas ES, Chudova D, Diggans J, et al., Preoperative diagnosis of benign thyroid nodules with indeterminate cytology. N Engl J Med. 2012;367(8):705-15. 33. Bar D, Meiri E, et al. A First-of-its-Kind, microRNA-based Diagnostic Assay for Accurate Thyroid Nodule Classification. 15th International Thyroid Congress (ITC) and 85th Annual Meeting of the American Thyroid Association (ATA), Orlando, Florida, 2015. 34. Labourier E, Beaudenon A, Wylie D, GiordanoTJ. Multi-categorical testing for miRNA, mRNA and DNA on fine needle aspiration improves the preoperative diagnosis of thyroid nodules with indeterminate cytology. 97th Meeting and Expo of the Endocrine Society; 2015. p. SAT-344.

23. Shinzato A, Lerario AM, Lin CJ, Danilovic DS, Marui S, Trarbach EB. Evaluation of Downstream Regulatory Element Antagonistic Modulator Gene in Human Multinodular Goiter. Med Sci Monit Basic Res. 2015;21:179-82.

24. Lilliehook C, Chan S, Choi EK, Zaidi NF, Wasco W, Mattson MP, et al. Calsenilin enhances apoptosis by altering endoplasmic reticulum calcium signaling. Mol Cell Neurosci. 2002;19(4):552-9.

Arch Endocrinol Metab. 2018;62/2

211

original article

Short-term insulin intensive therapy decreases MCP-1 and NF-κB expression of peripheral blood monocyte and the serum MCP-1 concentration in newlydiagnosed type 2 diabetics School of Medicine, Shandong University, Jinan, Shandong 250100, China 2 Department of Pediatrics, Anhui Provincial Hospital, Hefei, Anhui 230001, China 3 Department of Endocrinology, Anhui Provincial Hospital, Hefei, Anhui 230001, China 4 Endocrinological Laboratory, Anhui Provincial Hospital, Hefei, Anhui 230001, China 5 Department of Central lab, Anhui Provincial Hospital, Hefei, Anhui 230001, China 1

Correspondence to: Shandong YE, Shandong University, Jinan, 250100, China ysd196406@163.com Received on Jan/10/2017 Accepted on Dec/13/2017 DOI: 10.20945/2359-3997000000029

Yang Lin1,2, Shandong Ye1,3, Yuanyuan He3, Sumei Li3, Yan Chen4, Zhimin Zhai5

ABSTRACT Objective: To observe the effect of short-term insulin intensive treatment on the monocyte chemoattractant protein-1 (MCP-1) as well as on the nuclear factor-kappa B (NF-κB) expression of peripheral blood monocyte. This is also in addition to observing the serum MCP-1 level in newlydiagnosed type 2 diabetic patients and probing its anti-inflammation effects. Subjects and methods: Twenty newly-diagnosed type 2 diabetic patients were treated with an insulin intensive treatment for 2 weeks. MCP-1 and NF-κB expression on the monocyte surface were measured with flow cytometry, the serum MCP-1 level was measured by enzyme linked immunosorbent assay (ELISA) during pretreatment and post-treatment. Results: After 2 weeks of the treatment, MCP-1 and NF-κB protein expression of peripheral blood monocyte and serum MCP-1 levels decreased significantly compared with those of pre-treatment, which were (0.50 ± 0.18)% vs (0.89 ± 0.26)% (12.22 ± 2.80)% vs (15.53 ± 2.49)% and (44.53 ± 3.97) pg/mL vs (49.53 ± 3.47) pg/mL, respectively (P < 0.01). The MCP-1 expression on monocyte surface had a significant positive relationship with serum MCP-1 levels (r = 0.47, P < 0.01). Conclusions: Short-term insulin intensive therapy plays a role in alleviating the increased inflammation reaction in type 2 diabetics. Arch Endocrinol Metab. 2018;62(2):212-20 Keywords Type 2 diabetes; insulin intensive therapy; MCP-1; NF-κB

INTRODUCTION

he world has seen a rapid increase in the incidence of diabetes generally, and type 2 diabetes mellitus (T2DM) has become the most common metabolic disease globally (1). Experimental data have shown that hyperglycemia may induce a chronic inflammatory state in the vessel wall, thus accelerating the development of diabetic chronic complications (2). T2DM and obesity are insulin-resistant (IR) disorders characterized by chronic inflammation (3). NF-κB is a family of transcription factors that controls the production of pro-inflammatory proteins. The NF-κB pathway unites the inflammatory and metabolic responses, and, as a well-studied mediator of inflammation, represents an entry point for an improved understanding of metabolic diseases. 212

MCP-1 is a member of chemotactic cytokines (CC) sub-family chemokines, which plays a pivotal role in the development of inflammatory reactions. MCP-1 accelerates the development and progress of diabetic nephropathy (DN) and macrovascular complications through inducing inflammatory cells from the circulation to artery endothelium and kidney. It also contributes to the proliferation of arterial smooth muscle cells, which constitute the key cellular components of atherosclerotic plaques (4). Insulin has been shown to suppress inflammatory changes through the down-regulation of proinflammatory cytokines, reactive oxygen species (ROS) (5) and acute phase proteins (6), and the up-regulation of anti-inflammatory cytokines (7). In this report, we aim to demonstrate an anti-inflammatory effect of short Arch Endocrinol Metab. 2018;62/2

Insulin intensive therapy decreases MCP-1 and NF-κB expression of Peripheral blood monocyte in type 2 diabetics

SUBJECTS AND METHODS The subjects are 20 newly-diagnosed T2DM patients (HbA1c 9.02 ± 0.17%, women, n = 6; men, n = 14; mean age, 51.25 ± 5.71 years) admitted to department of endocrinology, Anhui provincial hospital, which is consistent with the diabetes diagnostic criteria of the World Health Organization (WHO) in 1999. To reduce the possibility of confounding, patients were selected according to the following exclusion criteria: pregnancy, concomitant diseases, smoking, and alcohol intake of more than 10 g/d. Patients with allergic diathesis regarding both type 1 e type 2 immune responses and/or reporting respiratory, gastrointestinal, or genitourinary tracts infections during the last three months were also screened out. The acute complications and severe chronic complications of diabetes have not appeared in type 2 diabetics recently, and the urinary albumin relative to the urinary creatinine was below 300 mg/gCr. None of the patients were receiving statins, aldosterone receptor antagonists, angiotensin-converting enzyme inhibitors, or angiotensin receptor antagonists, antibiotics, nonsteroidal anti-inflammatory drugs, corticosteroids, or cytotoxic drugs at the time of the study. The other 20 healthy volunteers (women, n = 9; men, n = 11; mean age, 54.30 ± 7.39 years) were chosen from the Health Medical Examination Center of Anhui Provincial Hospital, serving as control subjects.

excretion, which was abbreviated as UACR (UALB/ UCr ratio). Clearance of Creatinine Rate (Ccr) was calculated to stand for the glomerular filtration rate (GFR), using the formula raised by Cockcroft and Gault in 1976 (8). The patients in the observation group then received insulin intensive treatment consisting of regular pre-meal and bedtime neutral protamine hagedorn (NPH) insulin injections for two weeks. The indexes mentioned above were measured again at the study’s conclusion. All laboratory tests were performed in the Biochemical Laboratory and Endocrinology Laboratory of Anhui Provincial Hospital. The 20 newly-diagnosed T2DM patients, with an average HbA1c (9.02%), indicated that they had poor blood-glucose control, so the insulin treatment was necessary. Fasting blood glucose (FBG) and postprandial 2h blood glucose (P2hBG) were measured daily, and daily insulin doses (in units) were approximately 1 unit per kilogram; the dosage of insulin was adjusted according to blood glucose levels, FBG were controlled among 3.9~8.3 mmol/L while P2hBG were controlled < 10 mmol/L, and 3-5 days were limited to reach the determined blood glucose levels.

METHODS Measurement of Serum MCP-1 Level (by ELISA) Fasting serum samples were collected to measure serum MCP-1 level. For purposes of analysis, samples were thawed and vortexed vigorously, and MCP-1 level (pg/mL) was measured in duplicate according to the manufacturer’s instructions with a commercially available ELISA (Biosource Inc).

Research design

Measurement of MCP-1 expression on the monocyte surface (by flow cytometry)

Blood samples were obtained from all participants after a 12-hour fast to measure the blood glucose, insulin, glycosylated haemoglobin A1c (HbA1c), white blood cell count (WBC), the neutrocyte percents (N%), cholesterol (TC), triglyceride (TG), low density lipoprotein cholesterol (LDL-C), MCP-1 expression on the monocyte surface, serum MCP-1 level and NF-κB expression in monocyte. Random spot urine samples were collected for the examination of urinary Albumin and creatinine levels. To eliminate the effect of urine volume, we expressed the level of urinary albumin (UALB) relative to the urinary creatinine (UCr)

Five mL peripheral vein blood were drawn with the heparin supplemented tube. The measurement tube was supplemented with mouse monoclonal antibody to the human CD14 antigen stained with PE-Cy5 (Caltag Laboratories) 2.5 ul and mouse monoclonal antibody to the human MCP-1 antigen stained with PE (eBioscience) 1.25 ul. Mouse monoclonal antibody was added in the control tube to the human CD14 antigen stained with PE-Cy5 2.5 ul and Armenian hamster IgG isotype control stained with PE (eBioscience) 1.25 ul, then both the measurement tube and the control tube were injected with 100 ul blood followed by shaking in order

Arch Endocrinol Metab. 2018;62/2

213

insulin intensive therapy through comparing changes in MCP-1 expression on the monocyte surface, NF-κB expression in the monocyte, and serum MCP-1 level in newly-diagnosed T2DM patients pre-short-term insulin intensive treatment with those of post-treatment.

Insulin intensive therapy decreases MCP-1 and NF-κB expression of Peripheral blood monocyte in type 2 diabetics

to misce bene. Subsequently, both tubes were protected from light for 20 min at room temperature, and then each tube was added with hemolytic agent 2 mL. 10 min later, the two tubes were centrifugated at 1500 r/min for 5 min, abandoned the supernatant and supplemented with 2 mL PBS, repeated 1500 r/min centrifugalization for 5 min. Each tube was then washed three times with PBS, abandoned the supernatant, and then both the two tubes were supplemented with normal sodium to 500 ul, shaken to misce bene before measured by flow cytometry.

Measurement of NF-κB expression in the monocyte (by flow cytometry)

One milligram peripheral vein blood were drawn with heparin supplemented tube. The measurement tube and the control tube were supplemented with mouse monoclonal antibody to the human CD14 antigen stained with PE-Cy5 (Caltag Laboratories) 2.5 ul, then were added with 100 ul blood followed by shaking in order to misce bene. Subsequently, both tubes were protected from light for 20 min at room temperature, and then the tubes were added with 100 ul Fixation Medium A to fix. The tubes were then protected from light for 15 min at room temperature, then supplemented with 2 mL PBS, followed by 1500 r/min centrifugalization for 5 min, abandoned the supernatant and supplemented with 100 ul permeabilization medium B to rupture the membrane of monocyte. The measurement tube was added with mouse monoclonal antibody to the human NF-κB P65 antigen that stained with PE (eBioscience) 5 ul while the control tube had Armenian hamster IgG isotype control stained with PE added (eBioscience) 5 ul, followed by shaking in order to misce bene. Following this, both tubes were protected from light for 20 min at room temperature, supplemented with 2 mL PBS, repeated 1500 r/min centrifugalization for 5 min, and abandoned the supernatant. After this, both tubes were supplemented with normal sodium to 500 ul, shaked to misce bene before measured by flow cytometry.

NF-κB, and the change of FBG and P2hBG were performed by linear correlation. In all cases, a P value ≤ 0.05 was considered statistically significant.

RESULTS The comparisons of data between diabetic patients and control group The FBG, P2hBG, HbA1C, TC, TG, LDL-C, UACR, the expression of MCP-1 on monocyte and NF-κB in monocyte and serum MCP-1 level in diabetic patients were higher significantly than those in the control group, which were (11.18 ± 1.73) mmol/L vs (4.52 ± 0.15) mmol/L (17.92 ± 2.08) mmol/L vs (5.26 ± 0.34) mmol/L (9.02 ± 0.17)% vs (5.37 ± 0.08)% (5.45 ± 0.65) mmol/L vs (4.51 ± 0.53) mmol/L (2.02 ± 0.35) mmol/L vs (1.40 ± 0.30) mmol/L (3.85 ± 0.59) mmol/L vs (2.32 ± 0.69) mmol/L (71.98 ± 31.62) mg/gCr vs (12.88 ± 1.35) mg/gCr (0.89 ± 0.26)% vs (0.28 ± 0.09)% (Figures 1 and 2), (15.53 ± 2.49)% vs (3.67 ± 1.68)% (Figures 4 and 5) (49.53 ± 3.47) pg/mL vs (39.14 ± 7.43) pg/ mL, respectively, P < 0.05. But there were no significant differences in age, BMI, GFR, SBP and DBP between the diabetic patients and the control group, which were (51.25 ± 5.71)y vs (54.30 ± 7.39)y, (23.26 ± 0.40) kg/ m2 vs (22.15 ± 0.62)kg/m2, (99.35 ± 10.30) mL/min vs (105.10 ± 8.74) mL/min, (128.63 ± 2.41) mmHg vs (125.28 ± 5.31) mmHg, (75.21 ± 2.12) mmHg vs (70.31±2.48) mmHg, respectively, P > 0.05 (Table 1). Table 1. The comparisons of paremeters between diabetic patients and control group AGE (y)

54.30 ± 7.39

51.25 ± 5.71

BMI (kg/m2)

22.15 ± 0.62

23.26 ± 0.40

SBP (mmHg)

125.28 ± 5.31

128.63 ± 2.41

DBP (mmHg)

70.31 ± 2.48

75.21 ± 2.12

TC (mmol/L)

4.51 ± 0.53

5.45 ± 0.65*

TG (mmol/L)

1.40 ± 0.30

2.02 ± 0.35*

LDL-C (mmol/L)

2.32 ± 0.69

3.85 ± 0.59*

GFR (mL/min)

105.10 ± 8.74

99.35 ± 10.30

Statistical analysis

UACR (mg/gCr)

12.88 ± 1.35

71.98 ± 31.62*

Data were presented as means ± SD and analyzed using the Statistical Package for the Social Sciences 13.0. After testing data for normality, we used Student’s paired t test to compare values before and after two weeks of insulin intensive treatment. The relationship between MCP-1 expression on monocyte surface and serum MCP-1 level, the relationships between MCP-1,

FBG (mmol/L)

4.52 ± 0.15

11.18 ± 1.73*

P2hBG (mmol/L)

5.26 ± 0.34

17.92 ± 2.08*

HbA1c (%)

5.37 ± 0.08

9.02 ± 0.17*

serum MCP-1 (pg/mL)

39.14 ± 7.43

49.53 ± 3.47*

MCP-1 expression (%)

0.28 ± 0.09

0.89 ± 0.26*

NF-κB expression in monocyte (%)

3.67 ± 1.68

15.53 ± 2.49*

214

vs normal control group, * P < 0.05. Arch Endocrinol Metab. 2018;62/2

Insulin intensive therapy decreases MCP-1 and NF-κB expression of Peripheral blood monocyte in type 2 diabetics

The changes of the MCP-1 and NF-κB expression before and after insulin intensive therapy in diabetic group are as follows: After 2 weeks of the insulin intensive treatment, the MCP-1 expression on monocyte surface and serum MCP-1 level decreased significantly compared with those of pre-treatment, which were (0.50 ± 0.18)% vs (0.89 ± 0.26)%, (44.53 ± 3.97) pg/mL vs (49.53 ± 3.47) pg/mL, respectively, (P < 0.01) (Table 2, Figures 2 and 3); NF-κB expression in monocyte also decreased significantly compared that of pre-treatment, which were (12.22 ± 2.80)% vs (15.53 ± 2.49)% (P < 0.01) (Table 2, Figures 5 and 6). The changes of FBG, P2hBG, Homa-IR (log), WBC and N% before and after insulin intensive therapy in diabetic group are as follows: The FBG, P2hBG, Homa-IR(log), WBC and N% all significantly decreased after two weeks of insulin intensive treatment compared with those of pretreatment, which were (6.37 ± 1.07) mmol/L vs (11.18 ± 1.73) mmol/L, (8.27 ± 2.12) mmol/L vs (17.92 ± 2.08) mmol/L, (0.71 ± 0.04) vs (0.78 ± 0.03), (5.52 ± 1.12) × 109/L vs (7.39 ± 1.56) × 109/L, (56.23 ± 4.71)% vs (64.61 ± 5.45)% (Table 2).

Relationship analysis The MCP-1 expression on monocyte surface had a significant and positive relationship with serum MCP-1 level (r = 0.47, P < 0.01). The expression of NF-κB in monocyte had a positive relationship with the MCP-1 expression on monocyte

surface (r = 0.51, P < 0.01) and serum MCP-1 level (r = 0.49, P < 0.01). The changes of FBG had no significant relationship with the changes of MCP-1 expression on monocyte surface (r = 0.31 P > 0.05), serum MCP-1 (r = 0.33, P > 0.05) and expression of NF-κB in monocyte (r = 0.28, P > 0.05). The changes of P2hBG had no significant relationship with the changes of MCP-1 expression on monocyte surface (r = 0.32, P > 0.05), serum MCP1 (r = 0.28, P > 0.05) and expression of NF-κB in monocyte (r = 0.31, P > 0.05).

The incidence of hypoglycemia Hypoglycemia was recorded as blood glucose < 3.9 mmol/L with symptoms such as hunger, shakiness, nervousness, sweating, or dizziness. Twenty-six percent of patients were recorded to have had a hypoglycemic attack at least once in the T2DM patients. No hypoglycemia occurred in the control group.

DISCUSSION T2DM is characterized by two major defects: a dysregulation of pancreatic hormone secretion (quantitative and qualitative – early phase, pulsatility – decrease of insulin secretion, increase in glucagon secretion), and a decrease of insulin action on target tissues (IR) (9). Now, T2DM is also recognized as a disease of chronic inflammation, which may play an important role in the development of IR, impairment of islet function, and

pre-treatment

post-treatment

FBG (mmol/L)

11.18 ± 1.73

6.37 ± 1.07

11.77

< 0.01

P2hBG (mmol/L)

17.92 ± 2.08

8.27 ± 2.12

19.14

< 0.01

Homa-IR(log)

0.78 ± 0.03

0.71 ± 0.04

6.43

< 0.01

WBC × 109/L

7.39 ± 1.56

5.52 ± 1.12

5.54

< 0.01

64.61 ± 5.45

56.23 ± 4.71

5.72

< 0.01

BMI (kg/m )

23.26 ± 0.40

22.43 ± 0.52

1.856

> 0.05

TC (mmol/L)

5.45 ± 0.65

5.32 ± 0.51

2.77

< 0.05

TG (mmol/L)

2.02 ± 0.35

1.82 ± 0.31

8.91

< 0.01

LDL-C (mmol/L)

3.85 ± 0.59

3.55 ± 0.53

6.88

< 0.01

GFR (mL/min)

99.35 ± 10.30

101.20 ± 8.84

1.78

> 0.05

UACR (mg/gCr)

71.98 ± 31.62

53.52 ± 24.99

6.50

< 0.01

serum MCP-1 level (pg/mL)

49.53 ± 3.47

44.53 ± 3.97

4.21

< 0.01

MCP-1 expression (%)

0.89 ± 0.26

0.50 ± 0.18

8.48

< 0.01

NF-κB expression in monocyte (%)

15.53 ± 2.49

12.22 ± 2.80

3.96

< 0.01

Arch Endocrinol Metab. 2018;62/2

Table 2. The changes of indexes in diabetic group before and after insulin intensive therapy

215

Insulin intensive therapy decreases MCP-1 and NF-κB expression of Peripheral blood monocyte in type 2 diabetics

Figure 1. The MCP-1 expression on monocyte surface measured by flow cytometry in normal control group.

Figure 2. The MCP-1 expression on monocyte surface measured by flow cytometry before the treatment

Figure 3. The MCP-1 expression on monocyte surface measured by flow cytomery after the treatment.

Figure 4. The expression of monocyte NF-κB measured by flow cytometry in normal control group.

Figure 5. The expression of monocyte NF-κB measured by flow cytometry before the treatment. 216

Figure 6. The expression of monocyte NF-κB measured by flow cytometry after the treatment Arch Endocrinol Metab. 2018;62/2

Insulin intensive therapy decreases MCP-1 and NF-κB expression of Peripheral blood monocyte in type 2 diabetics

diabetic chronic complications (10). Hyperglycemia, a main metabolic disorder in T2DM patients, activates the body’s inflammatory defense mechanism, causing the waterfall release of numerous inflammatory mediators and cytokines, and eventually leading to organ damage (11). The dyslipidemia of T2DM also results in an increase in circulation concentrations of inflammatory cytokines (12). Previous studies have shown that many inflammatory factors, such as NF-κB, MCP-1, TNF-α, C reactive protein (CRP), IL-6, etc., not only take part in the dys-regulation of pancreatic hormone secretion and IR, but also in the development of the chronic complications of diabetes, such as its microvascular and macrovascular complications (12). In this study, the result also showed that the expressions of MCP-1 on monocyte and NF-κB in monocyte and serum MCP-1 level increased significantly in newly-diagnosed diabetic patients, which further indicates that increased chronic inflammation is present in T2DM patients. Data accumulated in recent years suggest that activated NF-κB signaling pathway may be involved in the pathogenesis of IR, stress response, and inflammation by controlling gene network expression (13-15). NF-κB is present in the cytoplasm complexed to its inhibitory protein known as inhibitory κB (Iκ-B). Following activation, the phosphorylation of IκB molecules promotes their degradation and the release Arch Endocrinol Metab. 2018;62/2

of NF-κB, which then translocates to the nucleus to promote the transcription of target genes (16). The NF-κB signaling pathway controls the expression of genes including inflammatory cytokines, chemokines, and adhesion molecules (17), such as MCP-1, IL-6, TNF-α, etc., which in turn initiate local inflammation and leukocyte accumulation (18). MCP-1 is expressed by a variety of cell types, including monocyte, macrophage, endothelial cell (EC), vascular smooth muscle cell (VSMC), podocyte, adipocyte and fibroblast, etc. The expression of MCP-1 in all kinds of cells listed above is low under normal physiological conditions, once given the stimulations such as increased blood glucose, advanced glycation end products (AGEs), hyper-lipemia, angiotensin II (Ang II), oxidative stress, interleukin-1 (IL-1), TNF-α, et al., the expression of MCP-1 is obviously up-regulated (19,20). Increased serum MCP-1 level in humans correlates with markers of metabolic disorder including obesity, IR, and T2DM (21-23). MCP-1 accelerates the onset of atherosclerosis, as it attracts monocytes to the inflammatory sites of vascular subendothelial space, initiating the migration of monocytes into the arterial wall to form excessive macrophage-derived foam cells (24). It also participates in the early renal injury through activation of lysosomal enzymes and proteolytic enzymes in mononuclear macrophages 217

Figure 7. The pathophysiology of NF-kB and MCP-1 in T2DM.

Insulin intensive therapy decreases MCP-1 and NF-κB expression of Peripheral blood monocyte in type 2 diabetics

and overproduction of ROS (25). Chow and cols. (26) reported that the MCP-1 genetic knockout mouse displayed amelioration of diabetic albuminuria, reduction in renal fibrosis, preservation of kidney clearance function, and decreased accumulation of macrophages. Increasing evidence shows that short-term insulin intensive therapy can alleviate glucose toxicity, lipotoxicity and IR, and improve islet β cell function in newly diagnosed type 2 diabetics, but the study about its effect in inhibiting the MCP-1 and NF-κB expression in diabetic patients in vivo has not been reported. Two large, prospective, randomized controlled studies showed that intensive insulin therapy in hyperglycemic patients in a surgical intensive care unit (ICU) resulted in a 50% reduction in mortality, along with several other benefits, including a reduction in the incidence of renal failure, septicemia and ICU neuropathy. Insulin infusion also lowered circulating levels of MCP-1, intracellular adhesion molecule-1 (ICAM-1) and E-selectin in patients with prolonged critical illness (27,28). Aljada and cols. (29) reported that insulin could inhibit NFκB and MCP-1 expression in human aortic endothelial cells. Treatment of Akita mice with insulin implants for 20 weeks normalized hyperglycemia and decreased urinary albumin excretion (30). This study showed that two weeks of intensive insulin therapy reduced MCP1 expression on the monocyte surface, serum MCP-1 level, NF-κB expression in monocyte, peripheral blood WBC and N%, which further demonstrated the antiinflammatory effect of insulin therapy. So an earlier initiation of insulin intensive treatment may be more effective in providing long-term efficacy against the complications of T2DM. The mechanisms underlying the anti-inflammatory effect of insulin therapy are, however, unclear, but it can be proved as follows: 1) Insulin can activate some signaling pathways, including PI3K, protein kinase B/ Akt, and mitogen-activated protein kinases (MAPK) such as p38, p42/p44, and JNK (31), activation of those signaling pathway is known to limit proinflammatory gene expression (28,32-34). 2) Insulin therapy has been reported to increase the production and release of anti-inflammatory cytokines such as IL-2 and IL-4 IL-10, and anti-inflammatory signal transcription factor mRNA expression of SOCS-3 and RANTES (35). 3) Long-term hyperglycemia has been proven to activate NF-κB and upregulate the expression of MCP-1 gene, insulin intensive treatment 218

can control hyperglycemia more quickly (36). 4) Hyperglycemia can induce intracellular oxidative stress which results in the expression of pro-inflammatory cytokines gene. Dandona and cols. (37) showed that insulin therapy could decrease the production of ROS. Recent research also confirms that insulin played a significant role in the regulation of the cellular redox balance via Nrf-2 dependent pathway (38-40). 5) Insulin therapy can attenuate the IR, which is related to the inflammatory reaction in vivo. In this trial, we also found that short-term insulin intensive therapy improved IR in newly-diagnosed T2DM patients. 6) The dyslipidemia of T2DM also results in an increase in circulation concentrations of inflammatory cytokines (41). Hayashi (42) demonstrates that intensive insulin therapy reduced serum small dense LDL particles and TG levels in type 2 diabetics. In the present study, we also found that serum TC, TG, LDL-C levels in diabetic patients were higher than those in the control group, and, furthermore, their levels decreased after two weeks of intensive insulin therapy, which indicated that insulin may exert an anti-inflammatory effect partly through its hypolipidemic effects. In this study, we observed that the UACR was also reduced in type 2 diabetics after two weeks of treatment, which indicates that insulin intensive treatment could ameliorate micro-albuminuria, which may be partially related to the reduction of the expression of MCP-1 and NF-κB. In summary, our primary study shows that insulin therapy can reduce the MCP-1 expression on the monocyte surface, serum MCP-1 level and NF-κB expression in monocyte, which indicates that short-term insulin intensive treatment can alleviate the increased micro-inflammatory state in T2DM patients. But the mechanisms of insulin therapy in anti-inflammation must be further evaluated. We also discovered that reduced expression of MCP-1 and NF-κB were not related to the changes of FBG and P2hBG, which requires more cases and long-term studies to research whether or not the anti-inflammatory effect of insulin therapy is independent of its hypoglycemic effects. Acknowledgments: the research presented in this paper was supported by the Natural Science Foundation (no. 11040606 M159) and the Natural Science Research Project (no. 1508085SMH227) of China’s Anhui Province. Great help was offered by the Department of Endocrinology and Central Laboratory of Anhui Provincial Hospital. Disclosure: no potential conflict of interest relevant to this article was reported. Arch Endocrinol Metab. 2018;62/2

Insulin intensive therapy decreases MCP-1 and NF-κB expression of Peripheral blood monocyte in type 2 diabetics

1. Chen S, Jiang H, Wu X, Fang J. Therapeutic Effects of Quercetin on Inflammation, Obesity, and Type 2 Diabetes. Mediators Inflamm. 2016 (2016):9340637. 2. Schmidt AM, Hofmann M, Taguchi A, Yan SD, Stern DM. RAGE: a multiligand receptor contributing to the cellular response in diabetic vasculopathy and inflammation. Semin Thromb Hemost. 2000;26(5):485-93. 3. Dubé JJ, Amati F, Stefanovic-Racic M, Toledo FG, Sauers SE, Goodpaster BH. Exercise-induced alterations in intramyocellular lipids and insulin resistance: the athlete’s paradox revisited. Am J Physiol Endocrinol Metab. 2008;294(5):E882-8. 4. Han KH, Ryu J, Hong KH, Ko J, Pak YK, Kim JB, et al. HMG-CoA reductase inhibition reduces monocyte CC chemokine receptor 2 expression and monocyte chemoattractant protein-1-mediated monocyte recruitment in vivo. Circulation. 2005;111(11):1439-47. 5. Dandona P, Aljada A, Mohanty P, Ghanim H, Hamouda W, Assian E, et al. Insulin inhibits intranuclear nuclear factor kappaB and stimulates IkappaB in mononuclear cells in obese subjects: evidence for an anti-inflammatory effect? J Clin Endocrinol Metab. 2001;86(7):3257-65. 6. Hansen TK, Thiel S, Wouters PJ, Christiansen JS, Van den Berghe G. Intensive insulin therapy exerts antiinflammatory effects in critically ill patients and counteracts the adverse effect of low mannose-binding lectin levels. J Clin Endocrinol Metab. 2003;88(3):1082-8. 7. Jeschke MG, Klein D, Herndon DN. Insulin treatment improves the systemic inflammatory reaction to severe trauma. Ann Surg. 2004;239(4):553-60. 8. Cockcroft DW, Gault MH. Prediction of creatinine clearance from serum creatinine. Nephron. 1976;16(1):31-41. 9. Girard J. Contribution of free fatty acids to impairment of insulin secretion and action. mechanism of beta-cell lipotoxicity. Med Sci (Paris). 2005;21 Spec No:19-25. 10. Guclu M, Oz Gul O, Cander S, Unal O, Ozkaya G, Sarandol E, et al. Effect of Rosiglitazone and Insulin Combination Therapy on Inflammation Parameters and Adipocytokine Levels in Patients with Type 1 DM. J Diabetes Res. 2015;2015:807891. 11. Sun Q, Li J, Gao F. New insights into insulin:The anti-inflammatory effect and its clinical relevance. World J Diabetes. 2014;5(2): 89-96. 12. Kanagasabapathy G, Kuppusamy UR, Abd Malek SN, Abdulla MA, Chua KH, Sabaratnam V. Glucan-rich polysaccharides from Pleurotus sajor-caju (Fr.) Singer prevents glucose intolerance, insulin resistance and inflammation in C57BL/6J mice fed a highfat diet. BMC Complement Altern Med. 2012;12:261.

the Toll-Like receptor 4/Nuclear Factor Kappa B signaling pathway in High-Fat diet fed and streptozotocin-induced diabetic rats. J Diabetes Res. 2015 (2015):390428. 19. Ehlermann P, Eggers K, Bierhaus A, Most P, Weichenhan D, Greten J, et al. Increased proinflammatory endothelial response to S100A8/A9 after preactivation through advanced glycation end products. Cardiovasc Diabetol. 2006 Mar 30;5:6. 20. Zhan Y, Brown C, Maynard E, Anshelevich A, Ni W, Ho IC, et al. Ets1 is a critical regulator of Ang-mediated vascular inflammation and remodeling. J Clin Invest. 2005;115(9):2508-16. 21. Patsouris D, Cao JJ, Vial G, Bravard A, Lefai E, Durand A, et al. Insulin Resistance is Associated with MCP1-Mediated Macrophage Accumulation in Skeletal Muscle in Mice and Humans. PLoS One. 2014;9(10):e110653. 22. Kamei N, Tobe K, Suzuki R, Ohsugi M, Watanabe T, Kubota N, et al. Overexpression of monocyte chemoattractant protein-1 in adipose tissues causes macrophage recruitment and insulin resistance. J Biol Chem. 2006;281(36):26602-14. 23. Uchida Y, Takeshita K, Yamamoto K, Kikuchi R, Nakayama T, Nomura M, et al. Stress augments insulin resistance and prothrombotic state:role of visceral adipose-derived monocyte chemoattractant protein-1. Diabetes. 2012;61(6):1552-61. 24. Panee J. Monocyte Chemoattractant Protein-1(MCP-1) in Obesity and Diabetes. Cytokine. 2012;60(1):1-12. 25. Gu J, Ye S, Wang S, Sun W, Hu Y. Metformin inhibits nuclear factor-κB activation and inflammatory cytokines expression induced by high glucose via adenosine monophosphateactivated protein kinase activation in rat glomerular mesangial cells in vitro. Chin Med J (Engl). 2014;127(9):1755-60. 26. Chow FY, Nikolic-Paterson DJ, Ozols E, Atkins RC, Rollin BJ, Tesch GH. Monocyte chemoattractant protein-1 promotes the development of diabetic renal injury in streptozotocin-treated mice. Kidney Int. 2006;69(1):73-80. 27. Dandona P, Mohanty P, Chaudhuri A, Garg R, Aljada A. Insulin infusion in acute illness. J Clin Invest. 2005;115(8):2069-72. 28. Langouche L, Vanhorebeek I, Vlasselaers D, Vander Perre S, Wouters PJ, Skogstrand K, et al. Intensive insulin therapy protects the endothelium of critically ill patients. J Clin Invest. 2005;115(8):2277-86. 29. Aljada A, Ghanim H, Saadeh R, Dandona P. Insulin inhibits NFkappaB and MCP-1 expression in human aortic endothelial cells. J Clin Endocrinol Metab. 2001;86(1):450-3. 30. Salem ES, Grobe N, Elased KM. Insulin treatment attenuates renal ADAM17 and ACE2 shedding in diabetic Akita mice. Am J Physiol Renal Physiol. 2014;306(6):F629-39.

13. Arkan MC, Hevener AL, Greten FR, Maeda S, Li ZW, Long JM, et al. IKK-beta links inflammation to obesity-induced insulin resistance. Nat Med. 2005;11(2):191-8.

31. Harbrecht BG, Nweze I, Smith JW, Zhang B. Insulin inhibits hepatocyte iNOS expression induced by cytokines by an Aktdependent mechanism. Am J Physiol Gastrointest Liver Physiol. 2012;302(1):G116-22.

14. Austin RL, Rune A, Bouzakri K, Zierath JR, Krook A. siRNAmediated reduction of inhibitor of nuclear factor-kappaB kinase prevents tumor necrosis factor-alpha-induced insulin resistance in human skeletal muscle. Diabetes. 2008;57(8):2066-73.

32. Fan W, Nakazawa K, Abe S, Inoue M, Kitagawa M, Nagahara N, et al. Inhaled aerosolized insulin ameliorates hyperglycemiainduced inflammatory responses in the lungs in an experimental model of acute lung injury. Crit Care. 2013;17(2):R83.

15. Shoelson SE, Lee J, Goldfine AB. Inflammation and insulin resistance. J Clin Invest. 2006;116(7):1793-801.

33. Ge D, Dauchy RT, Liu S, Zhang Q, Mao L, Dauchy EM, et al. Insulin and IGF1 enhance IL-17-induced chemokine expression through a GSK3B-dependent mechanism: a new target for melatonin’s antiinflammatory action. J Pineal Res. 2013;55(4):377-87.

16. Zhao Y, Chen SJ, Wang JC, Niu HX, Jia QQ, Chen XW, et al. Sesquiterpene lactones inhibit advanced oxidation protein product-induced MCP-1 expression in podocytes via an IKK/NF-κBDependent mechanism. Oxid Med Cell Longev. 2015;2015:934058. 17. Kim JE, Lee MH, Nam DH, Song HK, Kang YS, Lee JE, et al. Celastrol, an NF-κB inhibitor, improves insulin resistance and attenuates renal injury in db/db mice. PLoS One. 2013;8(4):e62068. 18. Ma ZJ, Zhang XN, Li L,Yang W, Wang S-S, Guo X, et al.Tripterygium glycosides tablet ameliorates renal tubulointerstitial fibrosis via Arch Endocrinol Metab. 2018;62/2

34. Guenzl PM, Raim R, Kral J, Brunner J, Sahin E, Schabbauer G. Insulin Hypersensitivity Induced by Hepatic PTEN Gene Ablation Protects from Murine Endotoxemia. PLoS One. 2013 Jun 25;8(6):e67013. 35. Jeschke MG, Einspanier R, Klein D, Jauch KW. Insulin attenuates the systemic inflammatory response to thermal trauma. Mol Med. 2002;8(8):443-50.

219

REFERENCES

Insulin intensive therapy decreases MCP-1 and NF-κB expression of Peripheral blood monocyte in type 2 diabetics

36. Garvey WT, Olefsky JM, Griffin J, Hamman RF, Kolterman OG. The effect of insulin treatment on insulin secretion and insulin action in type II diabetes mellitus. Diabetes. 1985;34(3):222-34. 37. Dandona P, Aljada A, Mohanty P, Ghanim H, Hamouda W, Assian E, et al. Insulin inhibits intranuclear nuclear factor kappaB and stimulates IkappaB in mononuclear cells in obese subjects: evidence for an anti-inflammatory effect? J Clin Endocrinol Metab. 2001;86(7):3257-65. 38. Wang X, Tao L, Hai CX. Redox-regulating role of insulin: the essence of insulin effect. Mol Cell Endocrinol. 2012;349(2):111-27.

40. Niture SK, Kaspar JW, Shen J, Jaiswal AK. Nrf2 signaling and cell survival. Toxicol Appl Pharmacol. 2010;244(1):37-42. 41. Bouchi R, Nakano Y, Fukuda T, Takeuchi T, Murakami M, Minami I, et al. Reduction of visceral fat by liraglutide is associated with ameliorations of hepatic steatosis, albuminuria, and microinflammation in type 2 diabetic patients with insulin treatment: a randomized contral trial. Endocr J. 2017;64(3):269-81. 42. Hayashi T, Hirano T, Yamamoto T, Ito Y, Adachi M. Intensive insulin therapy reduces small dense low-density lipoprotein particles in patients with type 2 diabetes mellitus: relationship to triglyceriderich lipoprotein subspecies. Metabolism. 2006;55(7):879-84.

39. Wang X, Wu H, Chen H, Liu R, Liu J, Zhang T, et al. Does insulin bolster antioxidant defenses via the extracellular signalregulated kinases-protein kinase B-nuclear factor erythroid 2

p45-related factor 2 pathway? Antioxid Redox Signal. 2012;16(10): 1061-70.

220

Arch Endocrinol Metab. 2018;62/2

original article

TSH-receptor antibodies may prevent bone loss in pre- and postmenopausal women with Graves’ disease and Graves’ orbitopathy Mira Siderova1, Kiril Hristozov1, Aleksandra Tsukeva2

ABSTRACT

Clinic of Endocrinology and Metabolic Diseases, University Hospital “St. Marina”, Varna, Bulgaria 2 Department of Neurology and Neuroscience, University Hospital “St. Marina”, Varna, Bulgaria 1

Objective: Thyrotoxicosis is established risk factor for osteoporosis due to increased bone turnover. Glucocorticoids often administered for Graves’ orbitopathy (GO) have additional negative effect on bone mineral density (BMD). Our aim was to examine the influence of thyroid hormones, TSH, TSH-receptor antibodies (TRAb) and glucocorticoid treatment on bone in women with Graves’ thyrotoxicosis and Graves’ orbitopathy (GO). Subjects and methods: Forty seven women with Graves’ disease, mean age 55.6 ± 12.8 (23 women with thyrotoxicosis and 24 hyperthyroid with concomitant GO and glucocorticoid therapy) and 40 age-matched healthy female controls were enrolled in the study. We analyzed clinical features, TSH, FT4, FT3, TRAb, TPO antibodies. BMD of lumbar spine and hip was measured by DEXA and 10-year fracture risk was calculated with FRAX tool. Results: The study showed significantly lower spine and femoral BMD (g/cm2) in patients with and without GO compared to controls, as well as significantly higher fracture risk. Comparison between hyperthyroid patients without and with orbitopathy found out significantly lower spine BMD in the first group (p = 0.0049). Negative correlations between FT3 and femoral neck BMD (p = 0.0001), between FT4 and BMD (p = 0.049) and positive between TSH and BMD (p = 0.0001), TRAb and BMD (p = 0.026) were observed. Fracture risk for major fractures and TRAb were negatively associated (p = 0.05). We found negative correlation of BMD to duration of thyrotoxicosis and cumulative steroid dose. Conclusions: Our results confirm the negative effect of hyperthyroid status on BMD. TRAb, often in high titers in patients with GO, may have protective role for the bone, but further research is needed. Arch Endocrinol Metab. 2018;62(2):221-6

Correspondence to: Mira Siderova Clinic of Endocrinology and Metabolic Diseases University Hospital “St. Marina” 9010 Varna, bul. Hr.Smirnenski 1 Bulgaria mirasiderova@abv.bg

Received on Aug/10/2016 Accepted on Dec/23/2016 DOI: 10.20945/2359-3997000000027

INTRODUCTION

hyroid hormones (TH) are one of the major regulators involved in bone metabolism and development among other regulators (1). They play a crucial role in the skeletal growth, peak bone mass acquisition and maintenance of bone mass. Triiodothyronine (T3) plays a primordial role in the skeletal homeostasis and stimulates osteoblast differentiation and activity by complex direct actions on TH-receptors and indirect mechanisms, involving diverse growth factors and cytokines (2). T3 also stimulates osteoclast differentiation and bone resorption, but it still remains unclear whether this effect results from direct action in osteoclasts or indirectly through RANK-RANKL system (3). Thyrotoxicosis is an established risk factor for secondary osteoporosis due to increased bone turnover (4). Glucocorticoids Arch Endocrinol Metab. 2018;62/2

often administered for Graves’ orbitopathy (GO) have additional negative impact on bone mineral density (BMD) in these patients by diminishing bone formation. The circulating antibodies specific to hyperthyroid Graves’ disease are directed against the TSH-receptor (receptor for thyroid stimulating hormone) on the cell surface of thyroid follicular cells and behave as thyroidstimulating antibodies (5). There is now evidence that TSH-receptor is also expressed widely in a variety of extrathyroidal tissues including orbital preadipocyte fibroblasts, playing a pivotal role in the pathogenesis of GO, and bone (6). Recent studies have shown that TSH acts as a direct regulator of bone remodeling through TSH-receptors both on osteoblasts and osteoclasts, highlighting the importance of integrity of the hypothalamo-pituitary-thyroid axis (7). Given that TSH receptor signaling has a functional role in the 221

Keywords Graves’ disease; Graves’ orbitopathy; bone mineral density; TSH-receptor antibodies; osteoporosis

Bone loss in Graves’ disease and orbitopathy

bone, we could expect that TSH receptor antibodies (TRAb) may also affect bone metabolism. There are conflicting results in the literature regarding the bone effect of TRAb, ranging from bone protection to accelerated bone loss (8-10). Some authors explain this phenomenon in the context of the thyroid status (overt or subclinical hyperthyroidism or restored euthyroidism), others by the type of TRAb (stimulating or blocking) (8-11). The aim of this study was to examine the influence of TH, thyroid antibodies and glucocorticoid treatment on bone by assessing BMD and fracture risk in women with Graves’ thyrotoxicosis alone or with Graves’ orbitopathy (GO) and steroid treatment.

SUBJECTS AND METHODS Forty seven females with Graves’ disease, mean age 55.6 ± 12.8 (23 women with Graves’ thyrotoxicosis without orbitopathy and 24 thyrotoxic with concomitant active moderate-to-severe GO and glucocorticoid therapy) were enrolled in the study. Graves’ disease was previously diagnosed and mean duration of hyperthyroidism was 43.6 ± 19.2 months in patients without orbitopathy and 32.0 ± 18.5 months in patients with orbitopathy (p = 0.45). At the time of study enrollment 29 patients were in overt hyperthyroidism (16 without orbitopathy and 13 with orbitopathy) and 18 had subclinical hyperthyroidism (7 without and 11 with orbitopathy; p = 0.37). Forty healthy women, mean age 53.2 ± 7.1, without thyroid disease served as age-matched controls. Informed consent was obtained from all patients. Clinical evaluation including weight, height, body mass index (BMI), cardiovascular parameters, electrocardiography and thyroid ultrasound were performed. Assessment of GO activity was carried out using the clinical activity score (CAS) consisting of seven items: spontaneous retrobulbar pain, pain on attempted up or down gaze, redness of the eyelids, conjunctival redness, swelling of the eyelids, chemosis, inflammation of the caruncle and/or plica; the final score was calculated as the sum (1 point for each) of all items with CAS ≥ 3/7 points indicating active GO. Severity of GO was assessed according to NOSPECS classification. Data on duration of thyrotoxicosis, duration of GO, cumulative dose and duration of glucocorticoid treatment were collected. Serum levels of TSH, FT4 (free thyroxine), FT3 (free triiodothyronine), TSH receptor antibodies (TRAb) and TPO antibodies were analyzed through 222

chemiluminescent immunoassays (Siemens Healthcare Diagnostics) on ADVIA Centaur XP and Immulite 2000 systems with following reference ranges: TSH 0,4-4,0 mU/l; FT4 10,3-24,0 pmol/l; FT3 2,86,5 pmol/l; TRAb with normal range < 1IU/l and TPO-Ab 10-100 U/mL. BMD of total hip, femoral neck and lumbar spine (L1-L4) was measured by GE-Lunar Prodigy DEXA and the 10-year fracture risk was calculated with FRAX tool (https://www.shef.ac.uk/FRAX/tool.jsp). This was first BMD measurement for all participants, so they could not provide any information of previous BMD or bone metabolic markers. Neither patients, nor controls were taking calcium or vitamin D3 supplementation. Statistical analysis of the data was performed by SPSS v.19.0 (SPSS, Chicago, USA). The data are expressed as mean ± standard deviation (SD). Student’s T-test was used to compare continuous variables. Nonmetric variables were presented by relative frequency distribution (in percentages). Fisher’s exact test was used to detect differences between the groups. The Spearman correlation method was performed between different measured parameters. A p-value (two-tailed) of less than 0.05 was considered statistically significant with statistical power 80% for the sample size.

RESULTS Patients and controls did not differ for age, prevalence of smokers and premenopausal women. Four women of the patients’ group had fractures (2 with and 2 without steroid treatment). Both patients on steroid treatment had a vertebral fracture, whereas one patient without steroid treatment had a vertebral fracture and the other had a distal radius fracture. Although there was no significant difference in BMI (25.3 ± 3.23 vs 26.1 ± 3.53, p = 0.29), the body weight was lower in the patients’ group (64.8 ± 7.9 vs 69.1 ± 9.2, p = 0.025), but weight loss is a well known clinical characteristic of Graves’ disease. The study showed significantly lower BMD (g/cm2) at spine, total hip and femoral neck in patients compared to healthy controls (p < 0.0001; p < 0.0001; p = 0.0002). The results are summarized in Table 1. Both subgroups of patients with and without GO had lower BMD than controls (p = 0.0002; p < 0.0001), as well as significantly higher 10-year fracture risk for major osteoporotic and hip fractures (p < 0.0001; p < 0.0001). Comparison between patients with Graves’ thyrotoxicosis without orbitopathy and those with Arch Endocrinol Metab. 2018;62/2

Bone loss in Graves’ disease and orbitopathy

additional steroid-treated Graves’ orbitopathy found out significantly lower spine BMD in the first subgroup (p = 0.0049). However, the duration of thyrotoxicosis in this first subgroup was longer (43.6 vs 32 months, p = 0.45). The GO subgroup was younger than the subgroup without orbitopathy, but this diffenrence did not reach statistical significance (52.6 ± 12.3 years vs. 58.5 ± 11.9 years, p = 0.14). Although the study population was heterogeneous concerning menopausal status, there was no significant difference in number of postmenopausal women between the subgroup without GO and that with GO (20/23 vs 16/24, p = 0.17). Table 2 presents the analysis of both subgroups of hyperthyroid patients. In patients’ group as a whole we observed negative correlation between FT3 and BMD (p = 0.019 for spine; p = 0.0001 for total hip and p = 0.0001 for femoral

neck), as well as between FT4 and BMD of femoral neck (p = 0.049). Data are presented in Table 3. There was a positive association between TSH and BMD with statistical significance for total hip and femoral neck (p = 0.0001; p = 0.0001). We found also significant positive correlation between TRAb and BMD (p = 0.006 for spine; p = 0.013 for total hip and p = 0.026 for femoral neck) and a negative correlation between TRAb and fracture risk for major fractures (p = 0.050). The analysis showed negative association of BMD to duration of steroid treatment for GO and cumulative steroid dose with significance for total hip (p = 0.016; p = 0.030) and femoral neck (p = 0.011; p = 0.020). There was also negative correlation between BMD and duration of thyrotoxicosis (p = 0.048 for spine; p = 0.045 for total hip and p = 0.040 for femoral neck).

Table 1. Comparison between clinical characteristics, laboratory exams, DEXA and FRAX assessment in patients and controls Patients (Thyrotoxicosis with/ without GO) Number

Healthy controls

p-value

Mean age (years)

55.6 ± 12.8

53.2 ± 7.1

p = 0.25

Weight (kg)

64.8 ± 7.9

69.1 ± 9.2

p = 0.025*

BMI (kg/m2)

25.3 ± 3.23

26.1 ± 3.53

p = 0.29

TSH (mU/l)

0.0185 ± 0.13

1.840 ± 0.96

p < 0.001**

TRAb (IU/l)

16.2 ± 13.32

Negative (< 1.0)

36/47 47.7

31/41 48.6

0.994 ± 0.15

BMD total hip (g/cm ) BMD fem. neck (g/cm2)

Women in menopause Mean age of menopause

p < 0.0001***

NS S

p = 0.327 p = 0.391

NS NS

1.197 ± 0.08

p < 0.0001***

0.885 ± 0.12

0.999 ± 0.07

p < 0.0001***

0.845 ± 0.11

0.920 ± 0.06

p = 0.0002***

FRAX (major osteoporotic fractures %)

6.85

3.49

p < 0.0001***

FRAX (hip fractures %)

1.95

0.36

p < 0.0001***

BMD spine (g/cm2) 2

NS: not significant, p > 0.05; */S: significant; p = 0.01-0.05; **: very significant, p = 0.001-0.01 ***: extremely significant, p < 0.001.

Table 2. Comparison between clinical characteristics, laboratory exams, DEXA and FRAX assessment in Graves’ patients with and without Graves’ orbitopathy

Number Mean age (years) Women in menopause

Graves’ disease with orbitopathy (GO)

p-value

58.5 ± 11.9

52.6 ± 12.3

p = 0.14

20/23

16/24

p = 0.17

Duration of hyperthyroidism (months)

43.6 ± 19.2

32.0 ± 18.5

p = 0.45

TSH (mUI/l)

0.017 ± 0.12

0.019 ± 0.14

p = 0.62

TRAb (IU/l)

15.58 ± 13.0

16.61 ± 13.5

p = 0.88

BMD spine (g/cm )

0.936 ± 0.14

1.059 ± 0.15

p = 0.0049** S

BMD total hip (g/cm2)

0.863 ± 0.11

0.9123 ± 0.12

p = 0.205

BMD fem. neck (g/cm2)

0.836 ± 0.11

0.858 ± 0.11

p = 0.517

FRAX (major osteoporotic fractures %)

5.97

7.91

p = 0.200

FRAX (hip fractures %)

1.64

2.32

p = 0.313

Graves’ disease without orbitopathy

NS: not significant, p > 0.05. **: very significant, p = 0.001-0.01. Arch Endocrinol Metab. 2018;62/2

223

Bone loss in Graves’ disease and orbitopathy

Table 3. Correlations between clinico-laboratory parameters and BMD/fracture risk BMD Spine

BMD total hip

BMD femoral neck

FRAX major osteoporotic fractures

FRAX hip fractures

FT3

r -0.361 p 0.019

r -0.635 p 0.0001

r -0.665 p 0.0001

r 0.262 p 0.117

r 0.267 p 0.110

FT4

r -0.021 p 0.807

r -0.100 p 0.439

r -0.250 p 0.049

r 0.037 p 0.817

r 0.129 p 0.416

TSH

r 0.120 p 0.282

r 0.418 p 0.0001

r 0.539 p 0.0001

r -0.045 p 0.688

r -0.263 p 0.017

TRAb

r 0.412 p 0.006

r 0.380 p 0.013

r 0.348 p 0.026

r -0.292 p 0.050

r -0.231 p 0.07

TPOAb

r -0.357 p 0.024

r -0.421 p 0.007

r -0.434 p 0.005

r 0.229 p 0.155

r -0.115 p 0.481

Duration of steroid treatment for GO

r -0.434 p 0.072

r -0.557 p 0.016

r -0.585 p 0.011

r 0.371 p 0.129

r -0.05 p 0.844

Cumulative dose of steroids

r -0.402 p 0.100

r -0.515 p 0.030

r -0.541 p 0.020

r 0.397 p 0.103

r 0.051 p 0.841

DISCUSSION Thyrotoxicosis is a well-established cause for high bone turnover osteoporosis and fragility fractures (12). Our study demonstrates lower bone mineral density at axial skeleton (spine and hip) in hyperthyroid perimenopausal women with Graves’ disease compared to healthy controls in accordance with results of many other authors (12,13). Some studies have proved that in premenopausal women this decrease in the bone density is observed mainly in cortical bone (femoral neck) similarly to other examples of secondary osteoporosis (14). Histomorphometric analysis has shown that thyrotoxicosis results in an increased frequency of bone remodelling cycle initiation and a shortened cycle duration (15). The bone formation phase is reduced to a greater extent than the resorption phase, leading to a 10% loss of bone per cycle (15,16). Our results showed unexpectedly lower spine BMD in the subgroup of Graves’ patients without orbitopathy than that of the subgroup with GO, despite the steroid treatment in the latter. This phenomenon could be partially explained with the longer duration of thyrotoxicosis in the subgroup of patients without GO. The difference in age and menopausal status was not significant between the two subgroups to affect the findings at lumbar spine BMD. Another factor influencing the difference in BMD between hyperthyroid patients with and without GO is the short duration and low cumulative dose of steroid treatment in GO subgroup. Since we aimed 224

to include patients in the study and to perform DEXA scan as soon as possible, the cumulative dose of already started steroid treatment was relatively low (2050 ± 1200 mg) as well as duration of steroid treatment for GO was relatively short (3,1 ± 1.9 months). This confounding factor could also be the reason for the insignificant correlation between cumulative steroid dose/duration of steroid treatment and spine BMD in our study. The main effect of glucocorticoids on bone is inhibition of osteoblast function, leading to a decrease in bone formation (17). Several studies and reports show a decrease in bone mineral density and an increased risk of fractures during glucocorticoid use for GO (18). Bone loss starts promptly after initiation of glucocorticoids and is mainly taking place in the first six months of treatment (17). Last but not least both TSH and TRAb were higher in the subgroup of GO patients although this difference did not reached statistical significance. Physiologically TSH stimulates T4 secretion by thyroid follicular cells (13,19), however, the effects of the hypothalamic–pituitary–thyroid (HPT) axis on its target organs are related to levels of TH and to the activities of the deiodinase enzymes that regulate the local concentration of triiodothyronine (T3). Thus, T4 is a pro-hormone of the biologically active T3 (19,20). A recent study on human osteoblast cell line showed increased expression of deiodinase 2 (which converts T4 to T3) by administration of TSH, suggesting that TSH may indirectly promote bone turnover by Arch Endocrinol Metab. 2018;62/2

increasing local T3 availability (21). Furthermore, the HPT axis set-point in an individual is at least in part genetically determined and may influence fracture risk (22,23). Our results confirmed a negative correlation between FT3 and BMD at spine, total hip and femoral neck), as well as between FT4 and BMD of femoral neck. In the studies of van Rijn and cols. similar association was found in euthyroid perimenopausal women – higher fT4 levels within the normal reference range were independently related to decreased BMD at lumbar spine (13). It is well established that thyroid hormones (TH), acting via thyroid receptors alpha (TRα), promote catabolic actions on the adult skeleton (19,24). Some authors have proposed that TSH plays important role in bone tissue, which is independent of the actions of TH (7,25,26). This is supported by studies on mice with deletion of the TSHR gene, which show high TSH and low serum levels of TH. TH therapy in these mice affect body weight but not bone mass (7,27,28). Another study has suggested that TSH binding to its receptor in bone cells has beneficial effects on the skeleton through inhibition of osteoclastogenesis (29). In the study of Tuchendler and Bolanowski BMD changes among premenopausal women with newly diagnosed hyperthyroidism before and after reaching normal thyroid function were assessed (14). There was a clear decrease in the BMD at femoral neck of hyperthyroid patients compared to controls, as well as higher serum concentrations of osteocalcin and collagen type 1 crosslinked C-telopeptide (14). Despite the increase in BMD after one year of methimazol treatment and restoration of euthyroidism, significantly lower femoral neck BMD was observed in patients compared to controls, indicating that correcting the hormonal dysfunction does not fully normalize bone density (14). Probably the effect of TSH which is the last to normalize and the TSH-Ab is responsible for these observations. Another study of Haras and cols. proved that TSH raise during treatment of hyperthyroid patients is the best predictor for bone density increase (30). Our data revealed a positive significant correlation between TSH and BMD, as well as between TRAb and BMD, and a negative association between TRAb and fracture risk. Similarly, Ma and cols. suggested that in Graves’ disease the antibody TRAb decreases bone loss against the catabolic effects of high circulatory levels of TH (8). According to them, TSHR-Abs offer Arch Endocrinol Metab. 2018;62/2

skeletal protection in hyperthyroid Graves’ disease, even in the face of high thyroid hormone and low TSH levels (8). By contrast, in Graves’ patients with subclinical hyperthyroidism with normal FT4 and FT3, TRAb were positively associated with bone metabolic markers, including B-ALP, U-PYD, and U-DPD (9). In the study of Ecolano and cols. patients with previous Graves’ disease hyperthyroidism and restored euthyroidism for at least 6 months were investigated (10). In postmenopausal women BMD of lumbar spine correlated negatively with TRAb and positively with the time of euthyroidism, but neither with serum T4 nor TSH (10). In a multiple regression analysis TRAb was the only significant independent variable in relation to lumbar spine BMD, which suggest that this antibody may affect bone metabolism (10). However, discrepancies exist in the results regarding the role of TRAb in bone metabolism. They could be summarized as bone protective role in the settings of overt hyperthyroidism (8) and accelerated bone loss in subclinical hyperthyroidism and euthyroidism (9,10) underlining the complex interactions of TH, TSH and TSH-R antibodies locally in the bone. Further studies are needed to elucidate their role, as well as the role of inhibiting TSH-R antibodies for bone metabolism. The strength of the current study is that all participants were peri-menopausal women within a narrow age range and they were not receiving hormone replacement therapy, neither calcium, vitamin D or anti-osteoporosis medication. However, several limitations of our study should be considered. First, DEXA scan was performed shortly after the start of steroid treatment in the group of patients with GO, which can not segregate the effect of steroids from the influence of TH, TSH and TRAb on bone metabolism. Second, bone metabolic markers were not measured in this study and they could add additional information to BMD conserning the effect of hypothalamic–pituitary– thyroid axis and thyroid antibodies on skeleton. Third disadvantage is the lack of follow up and assessment of BMD after restoration of euthyroidism, especially in the cases that will appear with low or negative TRAb in the follow up. In conclusion, our results confirm the negative effect of hyperthyroid status on BMD. Whereas TH are negatively correlated with BMD, TSH has a positive influence. TSH-receptor antibodies, often in higher titers in patients with Graves’ orbitopathy, might have protective role for the bone, but further research is needed. 225

Bone loss in Graves’ disease and orbitopathy

Disclosure: no potential conflict of interest relevant to this article was reported.

REFERENCES 1. Harvey CB, Williams GR. Mechanism of thyroid hormone action. Thyroid. 2002;12:441-6. 2. Stathatos N, Wartofsky L. Effects of thyroid hormone on bone. Clin Rev Bone Miner Metab. 2004;2:135-50. 3. Cardoso LF, Maciel LMZ, Paula FJA. The multiple effects of thyroid disorders on bone and mineral metabolism. Arq Bras Endocrinol Metabol 2014;58:452-63. 4. Nicholls JJ, Brassill NJ, Williams GR, Bassett JHD. The skeletal consequences of thyrotoxicosis. J Endocrinol. 2012;213:209-21. 5. Adams DD. The presence of abnormal thyroid-stimulating hormone in the serum of some thyrotoxic patients. J Clin Endocrinol Metab. 1958;18:699-712. 6. Williams GR. Extrathyroidal expression of TSH receptor. Ann Endocrinol (Paris); 2011;72:68-73. 7. Abe E, Marians RC,Yu W, Hu XB, AndoT, LiY, et al.TSH is a negative regulator of skeletal remodeling. Cell. 2003;115(2):151-62. 8. Ma R, Morshed S, Latif R, Zaidi M, DaviesTF.The influence of thyroidstimulating hormone and thyroid-stimulating hormone receptor antibodies on osteoclastogenesis. Thyroid. 2011;21:897-906. 9. Kumeda Y, Inaba M, Tahara H, Kurioka Y, Ishikawa T, Morii H, et al. Persistent increase in bone turnover in Graves’ patients with subclinical hyperthyroidism. J Clin Endocrinol Metab. 2000;85:4157-61. 10. Ecolano M, Drnovsek ML, Silva Croome MC, Moos M, Fuentes AM, Viale F, et al. Negative correlation between bone mineral density and TSH receptor antibodies in long-term euthyroid postmenopausal women with treated Graves’ disease. Thyroid Res. 2013;6(1):11. 11. Cho SW, Bae JH, Noh GW, Kim YA, Moon MK, Park KU, et al. The presence of thyroid-stimulation blocking antibody prevents high bone turnover in untreated premenopausal patients with Graves’ Disease. PLoS One. 2015;10(12):e0144599. 12. Vestergaard P, Mosekilde L. Fractures in patients with hyperthyroidism and hypothyroidism: a nationwide follow-up study in 16,249 patients. Thyroid. 2002;12:411-9. 13. van Rijn LE, Pop VJ, Williams GR. Low bone mineral density is related to high physiological levels of free thyroxine in perimenopausal women. Eur J Endocrinol. 2014;170:461-8.

16. Eriksen EF, Mosekilde L, Melsen F. Trabecular bone remodeling and bone balance in hyperthyroidism. Bone. 1986;6:421-8. 17. Mazziotti G, Guistina A, Canalis E, Bilezikian JP. GlucocorticoidInduced Osteoporosis: clinical and Therapeutic Aspects. Arq Bras Endocrinol Metab. 2007;51:1404-12. 18. Kahaly GJ, Pitz S, Hommel G, Dittmar M. Randomized, single blind trial of intravenous versus oral steroid monotherapy in Graves’ orbitopathy. J Clin Endocrinol Metab. 2005;90:5234-40. 19. Gogakos AI, Duncan Bassett JH, Willliams GR. Thyroid and bone. Archives of Biochemistry and Biophysics. 2010;503:129-36. 20. Williams GR. Actions of thyroid hormones in bone. Endokrynol Pol. 2009;60(5):380-8. 21. Lloyd A, Bursell J, Gregory JW, Rees DA, Ludgate M. TSH receptor activation and body composition. J Endocrinol. 2010;204(1): 13-20. 22. Andersen S, Pedersen KM, Bruun NH, Laurberg P. Narrow individual variations in serum T4 and T3 in normal subjects: a clue to the understanding of subclinical thyroid disease. J Clin Endocrinol Metab. 2002;87(3):1068-72. 23. Hansen PS, Brix TH, Sorensen TI, Kyvik KO, Hegedus L. Major genetic influence on the regulation of the pituitary-thyroid axis: a study of healthy Danish twins. J Clin Endocrinol Metab. 2004;89(3):1181-7. 24. Gorka J, Taylor-Gjevre RM, Arnason T. Metabolic and clinical consequences of hyperthyroidism on bone density. Hindawi Publishing Corporation. Int J Endocrinol. 2013;2013:638727. 25. Tsai JA, Janson A, Bucht E, Kindmark H, Marcus C, Stark A, et al. Weak evidence of thyrotropin receptors in primary cultures of human osteoblast-like cells. Calcif Tissue Int. 2004;74(5):486-91. 26. Kim TH, Joung JY, Kang M, Choi SK, Kim K, Jang JY, et al. A modest protective effect of thyrotropin against bone loss is associated with plasma triiodothyronine levels. PLoS One. 2015;10(12):e0145292. 27. Baliram R, Sun L, Cao J, Li J, Latif R, Huber AK, et al. Hyperthyroidassociated osteoporosis is exacerbated by the loss of TSH signaling. J Clin Invest. 2012;122(10):3737-41. 28. Murphy E, Williams GR. The thyroid and the skeleton. Clin Endocrinol (Oxf). 2004;61(3):285-98. 29. Hase H, Ando T, Eldeiry L, Brebene A, Peng Y, Liu L, et al. TNFalpha mediates the skeletal effects of thyroid-stimulating hormone. Proc Natl Acad Sci U S A. 2006;103(34):12849-54. 30. Haras M, Onose G, Capisizu A, Vulpoi C. Evolutive particularities in thyrotoxic osteoporosis. Acta Endo (Buc) 2012;8(1):47-58.

14. Tuchendler D, Bolanowski M. Assessment of bone metabolism in premenopausal females with hyperthyroidism and hypothyroidism. Endokrynologia Polska. 2013;64(1):40-4.

15. Mosekilde L, Melsen F. A tetracycline-based histomorphometric evaluation of bone resorption and bone turnover in hyperthyroidism and hyperparathyroidism. Acta Medica Scandinavica. 1978;204:97-102.

226

Arch Endocrinol Metab. 2018;62/2

review

Androgen insensitivity syndrome: a review Rafael Loch Batista1, Elaine M. Frade Costa1, Andresa de Santi Rodrigues1,2, Nathalia Lisboa Gomes1, José Antonio Faria Jr.1, Mirian Y. Nishi1,2, Ivo Jorge Prado Arnhold1, Sorahia Domenice1, Berenice Bilharinho de Mendonca1,2

ABSTRACT

Unidade de Endocrinologia do Desenvolvimento, Laboratório de Hormônios e Genética Molecular/ LIM42, Hospital das Clínicas, Disciplina de Endocrinologia, Faculdade de Medicina da Universidade de São Paulo (FMUSP), São Paulo, SP, Brasil 2 Laboratório de Sequenciamento em Larga Escala (SELA), Faculdade de Medicina da Universidade de São Paulo (FMUSP), São Paulo, SP, Brasil 1

Androgenic insensitivity syndrome is the most common cause of disorders of sexual differentiation in 46,XY individuals. It results from alterations in the androgen receptor gene, leading to a frame of hormonal resistance, which may present clinically under 3 phenotypes: complete (CAIS), partial (PAIS) or mild (MAIS). The androgen receptor gene has 8 exons and 3 domains, and allelic variants in this gene occur in all domains and exons, regardless of phenotype, providing a poor genotype – phenotype correlation in this syndrome. Typically, laboratory diagnosis is made through elevated levels of LH and testosterone, with little or no virilization. Treatment depends on the phenotype and social sex of the individual. Open issues in the management of androgen insensitivity syndromes includes decisions on sex assignment, timing of gonadectomy, fertility, physcological outcomes and genetic counseling. Arch Endocrinol Metab. 2018;62(2):227-35 Keywords Androgen insensitivity syndrome; androgen receptor; disorders of sex development; 46,XY DSD

Correspondence to: Berenice Bilharinho de Mendonca Hospital das Clínicas, Laboratório de Hormônios e Genética Molecular Av. Dr. Enéas de Carvalho Aguiar, 155, 2° andar, Bloco 6 05403-900 – São Paulo, SP, Brasil beremen@usp.br Received on Sep/21/2017 Accepted on Jan/18/2018

INTRODUCTION

ndrogen Insensitivity Syndrome (AIS) is an X-linked genetic disease and it is the most common cause of disorders of sex development (DSD) in 46,XY individuals (1). The phenotype ranges from normal female external genitalia in the complete form (CAIS) to normal male external genitalia associated with infertility and/or gynecomastia in the mild form (MAIS). A large spectrum of undervirilized male external genitalia is observed in the partial form (PAIS) (2). Mutations in the androgen receptor gene (AR) are found in most individuals with CAIS but in less individuals with PAIS (3). AIS was first described by Morris, in 1953, with the clinical description of 82 female patients with testes but female phenotype and for this reason Morris named the syndrome as testicular feminization (4). Later, this syndrome was characterized for being a condition resulting from a complete or partial resistance to Arch Endocrinol Metab. 2018;62/2

androgens in 46,XY individuals with normal male gonad development (5). PAIS should be considered in all individuals with atypical genitalia at birth regardless of the degree of external genitalia virilization and MAIS is a possible diagnosis in males with persistent gynecomastia and or infertility (6). Role of Androgens in Male Fetal Development: androgens are key elements for appropriate internal and external male sex differentiation. After normal testes development, the Leydig cells produce testosterone, which promotes Wolffian duct differentiation into epididymes, vasa deferentia and seminal vesicles (7). The conversion of testosterone to dihydrotestosterone by the 5α-reductase type 2 enzyme promotes male external genitalia differentiation (8). In humans, the critical period for genitalia virilization occurs between 8 and 14 weeks of gestation and depends on the presence of androgens and of a functioning androgen receptor (9). Impairment of 227

DOI: 10.20945/2359-3997000000031

Androgen insensitivity syndrome

androgen secretion and defects in the androgen receptor will compromise the virilization process.

THE HUMAN ANDROGEN RECEPTOR The AR gene is located at chromosome Xq11-12, is encoded by eight exons and codifies a 919 aminoacids protein (Figure 1). The AR is a ligand-dependent transcription factor composed by three functional domains as the other nuclear receptors: a large N-terminal domain (NTD) (residues 1-555), a DNAbinding domain (DBD) (556-623 residues), a hinge domain (624-665 residues) and a C-terminal ligandbinding domain (LBD) (666–919 residues) (10). The NTD is encoded by exon 1 and contains a ligandindependent transactivation function 1 (AF1), which contains two distinct transcription activation units: Tau-1 (aminoacids 100-370) and Tau-5 (aminoacids 360-485), that are essential for full AR activity. The DBD is composed by two zinc fingers and connects the AR to promoter and enhancer regions of AR regulated genes by direct nuclear DNA binding allowing the activate functions of NTD and LBD (11). The LBD is encoded by exons 4-8 and contains 11 α-helices associated with two anti-parallel β-sheets in a sandwichlike conformation with a central ligand binding pocket, in which the ligand can bind (12).

CLINICAL PRESENTATION

CAIS prevalence in 46,XY males is estimated from 1 in 20.400 to 1 in 99.100 (13). Except in cases of familial

inheritance, CAIS is diagnosed in three scenarios: in fetal life when prenatal sex determination disclosed a 46,XY karyotype in a fetus with female external genitalia; in childhood in a girl with inguinal hernia or at puberty in females with primary amenorrhea (14). The presence of inguinal hernia in a female child is rare and could indicate a CAIS diagnosis (13). Patients with AIS developed breasts with estradiol levels in normal male range suggesting that the lack of androgen action is the main driver of breast development in these patients, rather than an increased estrogen secretion. Menstrual cycles do not appear since normal production of antimullerian hormone (AMH) by the testis impeded uterus, cervix and proximal vagina to development. A shortened blind-ending vagina is observed in almost all patients and the vaginal measurement varied from 2.5 to 8 cm in CAIS and 1.5 – 4 cm in PAIS. Pubic and axillary hair are sparse or absent (1,14). Final height in CAIS is above normal mean female height, probably due to the action of the growthcontrolling gene (GCY) located at the Y chromosome (15). Interestingly, newborns with CAIS have the same size of male newborns, suggesting that postnatal factors are involved in the final height in these individuals (16). In our cohort, the final height of CAIS individuals (165.7 ± 8.9 cm) was taller than described for Brazilian females, but lower than expected for Brazilian males (15). Differential diagnosis of CAIS includes complete gonadal dysgenesis, Mayer-Rokitanski-KusterHauser syndrome and Mullerian ducts anomalies (1). Biosynthetic enzyme deficiencies are rarely a differential diagnosis for CAIS (8,17).

Figure 1. A schematic representation of androgen receptor gene and androgen receptor protein. 228

Arch Endocrinol Metab. 2018;62/2

Androgen insensitivity syndrome

The PAIS clinical phenotype varies according to the degree of AR residual function and ranges from proximal hypospadias to micropenis (18). Hypospadias are a common finding with an estimated prevalence of 1:8000 male births and AR sequencing is necessary to exclude PAIS diagnosis (19). Gynecomastia observed at puberty time in patients with atypical genitalia can be indicative of PAIS (2,20). Differential diagnosis of PAIS includes all causes resulting in a undervirilized male external genitalia such as chromosomal defects (Klinefelter syndrome), genetic diseases (Smith-LemliOpitz syndrome, Denys-Drash syndrome, Frasier syndrome), partial gonadal dysgenesis, LH receptor defects, biosynthetic enzyme deficiencies (17,20-lyase deficiency, P450 oxidoreductase deficiency, 17β-hydroxysteroid dehydrogenase deficiency type 3, 5α-reductase 2 deficiency and hypospadias in small for gestation age boys (8,17). MAIS is associated with AR mutations but without external genitalia abnormalities (6). This diagnosis could be suspected in the investigation of male infertility or in pubertal gynecomastia (14,18). There are few AR mutations associated exclusively with MAIS, but this condition is probably underdiagnosed (3,6). MAIS can also manifest in a patient with neurological disorder characterized by bulbar and muscular atrophy (Kennedy’s disease). This condition is due to the hyperexpansion of the CAG repeats (> 38), present in AR exon 1 (21). These patients present with normal male external genitalia, but testosterone resistance will develop with disease progression. For MAIS, the differential diagnosis includes other causes of male infertility.

ENDOCRINE FEATURES In AIS the endocrine profile is consistent with androgen resistance characterized by elevated or normal basal

serum testosterone levels associated with high serum LH levels (22). Elevated serum AMH and testosterone levels in a newborn suggest the diagnosis of androgen insensitivity and also exclude the diagnosis of complete gonadal dysgenesis (23). In postpuberal patients estradiol levels are normal or slightly elevated for a male individual (22). This pattern is seen at mini-puberty or after puberty. During childhood when gonadotropin axis is not activated, a hCG stimulation is necessary to evaluate testosterone secretion by Leydig cells (24). In MAIS, hormone concentrations are usually normal, but elevated serum LH and testosterone levels could be found in these patients (19). Typically in AIS, basal testosterone and LH levels are elevated demonstrating the impairment of androgen negative feedback on the anterior pituitary (22). In contrast, FSH levels are usually normal in AIS. This is explained by the fact that FSH is mainly regulated by gonadal inhibin (25). Although there are differences in the AR residual function among the mutated receptors between CAIS and PAIS phenotypes, no difference are observed in hormonal levels (20,22). Serum LH, FSH estradiol, DHT were not different in subjects with CAIS and PAIS (Table 1).

MOLECULAR DEFECTS IN THE ANDROGEN RECEPTOR GENE The AIS diagnosis is confirmed by the presence of allelic variants in the AR gene (1,26). About 30% of AR mutations in AIS are de novo and sequencing of the entire AR gene is recommended for all 46,XY DSD newborns, regardless of a familial history of DSD or AIS (26). In the absence of allelic variants in AR a multiplex ligation-dependent probe amplification (MLPA) can be helpful in order to detect deletions, insertions and duplications in the AR gene (26). There are more than 1000 AR mutations described in a website database

Table 1. Basal hormone levels in patients with AIS LH (U/L)

FSH (U/L)

Testosterone ng/dL

Estradiol pg/mL

CAIS n = 11

14 – 43* 26**

3.5 – 16* 7.4**

186 – 1033* 342**

10 – 40* 27**

(22)

PAIS n = 14

9 – 32* 26**

– 34* 5.0**

157 – 1592* 1032

20 – 109* 49

(22)

CAIS n = 42

5.5 – 51 18.5

0.4 – 16** 3.5*

173 – 1497* 576**

4.8 – 70* 30.7**

(60)

Reference

Phenotype

* Range; ** Median. Arch Endocrinol Metab. 2018;62/2

229

Androgen insensitivity syndrome

associated with AIS and prostate cancer (http://www. mcgill.ca/androgendb) and around 600 of them were described in AIS (3). Mutations are found along the AR gene, being more frequent in exon 1 (the largest AR exon, which encodes the NTD). Defects in the NTD domain are more frequent in CAIS’s patients and variants in exons 5 and 6 (that encode LBD) are more frequent in PAIS’s patients (3). Almost all AR mutations in MAIS were found in the NTD, but there is a low number of AR mutations related to this phenotype. The most common AR allelic variants in all AIS phenotypes are non-synonymous point mutations. Insertions and deletions causing a frameshift leading to a premature stop codon downstream are more frequently reported in CAIS’s patients. Allelic variants affecting mRNA splicing are reported in CAIS and PAIS phenotypes. Rarely, synonymous allelic variants affecting splicing sites has been described in PAIS (27) and in CAIS individuals (28). Large structural mutations (exon 1 deletion, exon 2 duplication, exon 3 deletion, exon 4-8 (LBD domain) deletion and deletion of entire AR gene) have been described but are very rare in AIS (3). Interesting, a deletion of an entire exon (exon 4) was previously described in a phenotypic male with azoospermia (29). Postzygotic AR allelic variants resulting in somatic mosaicism are rarely described in AIS (30). In this situation the variant appears in heterozygote instead of hemizygote state. AR allelic variants in heterozygosis was also identified in some individuals with 47,XXY karyotype causing AIS (31). There is not a perfect correlation between genotype and phenotype in AIS. In the AR mutation database, there are some AR allelic variants that can cause different phenotypes (Table 2). The explanation for this is not completely understood. It is hypothesized that AR co-regulators (activators and repressors) are implicated with this phenomenon. Other possibilities are variations in the level of 5α-reductase type 2 activity resulting in different DHT availability, and the presence

of germ-line AR allelic variants at a post zygote stage conferring somatic mosaicism (31).

CLINICAL MANAGEMENT OF AIS AIS patients have complex issues including functional, sexual and psychosocial aspects. Sex assignment, external genitalia adequacy for social sex, hormonal replacement, psychosexual outcome, ideal time for gonadectomy, infertility and genetic counseling are issues that need attention in AIS care. All of them demand flexible, sensible and individualized procedures to achieve good results.

CLINICAL MANAGEMENT OF CAIS After diagnosis, the first aspect to be considered is the time for bilateral gonadectomy. In a girl, maintenance of the gonads will allow spontaneous breast development, though breast development is similar with estrogen replacement in gonadectomized females. So far, gonadectomy is performed at early age, in order to avoid the risk of malignancies and the psychosocial difficulties in submitting an adolescent female to gonadectomy (24). When gonadectomy is performed before puberty, estrogen replacement is necessary to induce puberty. In general, hormonal replacement is started at the age of 11-12 years with oral or transdermal estrogen. Both ways are adequate and the patient and family can choose the route in which the compliance will be better (18). Due to the absence of uterus, progesterone replacement is not necessary. Genitoplasty is not necessary in CAIS and vaginal dilation promotes an adequate vaginal length vaginal dilation should occur after puberty or when the patient refers to desire to initiate sexual activity (32). Most of the individuals (80%) who were submitted to vaginal dilation referred satisfactory and some of them reported dyspareunia (33). There are many vaginoplasty techniques (34), but non-surgical dilation is effective, safe, non expensive and normalizes vaginal length and

Table 2. AR allelic variants identified in more than one AIS phenotype (3) Allelic variants

Phenotype

p.Leu174, p.Arg616Pro, p.Asn693del, p.Asn706Ser,p.Gly744Val, p.Met746Phe, p.Met750Val, p.Trp752*, p.Ala766Thr, p.Pro767Ser, p.Arg775His, p.Arg841His, p.Ile843Thr, p.Val867Met, p.Val890Met, p.Ser704Gly

CAIS, PAIS

p.Pro392Ser, p.Leu548Phe, p.Arg616His, p.Asp696Asn, p.Met781Ile, p.Arg856His, p.Ala646Asp

CAIS, PAIS, MAIS

p.Tyr572His, p.Arg608Gly, p.Asn757Ser, p.Arg789Ser, p.Gln799Glu, p.Thr801Ile, p.Ser815Asn, p.Leu822Val, p.Ala871Gly, p.Gly216Arg, p.Arg608Gly 230

PAIS, MAIS

Arch Endocrinol Metab. 2018;62/2

Androgen insensitivity syndrome

sex intercourse (32). Because of that, surgical creation of a vagina should be avoid regardless of the surgical technique (32).

repeats in the AR exon 1 and a number of patients also have testicular atrophy, gynecomastia, oligospermia and erectile dysfunction (37).

CLINICAL MANAGEMENT OF PAIS

HORMONAL REPLACEMENT IN AIS

PAIS diagnosis is usually suspected in a newborn with atypical genitalia and palpable gonads. Most of the patients are raised as male. The degree of external genitalia virilization is related to the residual AR function and can be predictive of androgen response at puberty. In male patients, correction of cryptorchidism and hypospadias are recommended as soon as possible, preferably before two years of age (35). PAIS males frequently develop gynecomastia at puberty and surgical correction is generally necessary (22). High testosterone or DHT trials (intramuscular or topic testosterone esters or topic DHT) can be use to increase penile length and to improve other virilization signs (18,30). The results are unpredictable but are usually limited. Maximum virilization effect is observed after 6 months of high androgen usage treatment, subsequently, androgen therapy can be withdrawn in the patients with normal testes and preserved testosterone secretion. For individuals raised as females, bilateral gonadectomy is recommended in childhood to avoid virilization and to eliminate the risk of testicular tumors (36). Genitoplasty is usually necessary in PAIS females and estrogen replacement is mandatory at pubertal time, with similar recommendation as describe for CAIS patients (15). For MAIS, there is little information about clinical outcomes. Gynecomastia and infertility are the usual clinical presentation of this phenotype (6) and mastectomy is recommended for gynecomastia correction. This phenotype is observed in individuals with Kennedy’s disease, which is more commonly known as spinal and bulbar muscular atrophy (SBMA). This syndrome is caused by an excessive number of CAG

Hormonal replacement is mandatory for all gonadectomized individuals. In females, the purpose is the development of secondary sexual characteristics and an adequate and bone mass (2). Estrogen can be introduced in low doses (one quarter of the adult dose), at 9 – 11 years of age, with titration of this dosage every 6 months (20). The time for complete feminization is expected to be about 2 years. Oral or transdermic estrogen are alternative ways for estrogen replacement. The initial dose is 0.25 mg/day of 17β-estradiol increasing the dose each 6 months considering the progression of breast development. After complete breast development, a regular dose can be introduced (1-2 mg/day of 17β-estradiol continuously) (9). In male individuals, the testes are able to produce testosterone. In male AIS, at pubertal age, high testosterone doses (200–500 mg twice a week) can be used, in order to increase the penile size and to promote virilization (1). Maximum penile length is obtained after six months of treatment with high testosterone doses. After this period, the dose of testosterone when necessary should return to the maintenance dose. The use of DHT in male PAIS has been tested (0.3 mg/kg of androstanolone gel 2.5% for 4 months) and mixed results were obtained following DHT therapy (38).

Type of defect

CAIS

PAIS

MAIS

Non-synonymous

155

125

Stop codon

Indel

Duplication

259

131

Total

Arch Endocrinol Metab. 2018;62/2

Disorders of sex development are recognized as a risk factor for type II germ cell tumors (GCTs). These tumors are classified as seminomatous and non-seminomatous types (39). The seminomatous tumors referred to seminoma (testis) and to dysgerminoma (ovary and dysgenetic gonads). In the non-seminomatous group, many differentiated variants can be identified according to the cellular origin, being the teratomas from somatic differentiation, yolk sac tumor and choriocarcinoma from extra-embryonic differentiation, and embryonal carcinoma from stem cells (27). These tumors derivate from a non-invasive precursor named carcinoma in situ – CIS – or Intrabular germ cell neoplasia unclassified – IGCNU). In 2016, the World Health Organization suggested to change the nomenclature of 231

Table 3. Types of androgen receptor allelic variants related to AIS reported in the androgen receptor mutations database

GONADAL TUMOR RISK IN AIS

Androgen insensitivity syndrome

this initial germinative neoplastic lesion from CIS or IGCNU to germ cell neoplasia in situ (GCNIS) (40). GCNIS are always non-invasive, but 50% of GCNIS progress to invasive GCTs within 5 years. The risk of GCTs development is related to the presence of a Y chromosome, but is not the same for the different etiologies of 46,XY DSD. So far, some factors, as chronological age and gonadal location can influence GCTs development (41). In CAIS, the risk of GCTs is considered low and related to age (36). The estimated risk of gonadal tumors in CAIS gonads was about 0.8% - 22% (42). However, most old series included patients without confirmed AR mutation or without description of age at gonadectomy. The reports of malignant GCTs before puberty in CAIS are very rare (43). There is only one documented report of an invasive yolk-sac tumor in a CAIS individual before puberty. This occurred in a 17-months-old CAIS girl with abdominal gonads (44). After puberty, the risk is low, but not negligible. In a study, including 133 patients with CAIS, the gonadsâ&#x20AC;&#x2122; histological and immunohistochemical findings showed a prevalence of 1.5% (2/133) for malignancies (45). The low incidence of GCTs in CAIS individuals can be explain by the rapid decline of germ cells after the first year of life (46). PAIS individuals may maintain their germ cells because of the presence of residual androgen receptor responsiveness, differently of CAIS (46). Therefore, the incidence of GCTs in PAIS (15%) is higher than in CAIS (42). In cases of PAIS with untreated undescended testes the GCTs risk may be as high as 50% (47). Therefore, laparoscopic bilateral gonadectomy is indicated in all PAIS females and orquidopexy in scrotum in the male patients (48). In patients who maintained the gonads, a careful monitoring including ultrasonography (US) or MRI has been suggested (43). Due to easy access and low cost, US remain the first choice for monitoring retained gonads. MRI has demonstrated adequate sensitivity to detect benign gonadal lesions, such as cysts or Sertoli cell adenomas, but failed to detect GCNIS (49). Annual US follow-up of labioscrotal and/or inguinal gonads is recommended. For abdominal gonads monitoring MRI is more helpful (50).

FERTILITY IN AIS A normal androgen receptor is necessary for normal male reproduction, because testosterone and FSH, are 232

essential factors for male spermatogenesis. Therefore, mutations in the androgen receptor gene have been searched in order to identify possible causes for male infertility. As previously described, infertility may be the only clinical manifestation of undervirilization in MAIS phenotype (6,51). The strategy to obtain fertility in AIS individuals has not been defined yet (52). In CAIS, there is absence of uterus and testes histology reveals incomplete spermatogenesis, increased fibrosis, Leydig cell hyperplasia and low frequency of spermatogonia conferring a very low potential to fertility. In addition, the viability of male germ cells in CAIS is restricted to the first two years of life and for fertility in adult life germ cells should be preserved before this age (46). In PAIS individuals, some residual androgen receptor function is preserved, but not usually enough to promote fertility (46). Indeed, infertility is the rule in AIS (22). Probably, fertility is the most sensitive outcome which depends of an intact androgen receptor. For it, MAIS individuals can present only infertility (6,51). However, the p.G824K and p.R840C AR variant allelics, were found in male individuals with preserved fertility (51,53). A successful fertility was recently described in a PAIS individual harboring the p.V686A AR variant, after prolonged high-dose testosterone therapy (250 mg of testosterone enanthate weekly by four years) causing improvement in sperm count. The gonadotropin concentrations remained unaffected and intracytoplasmic sperm injection with a single sperm directly into an egg resulted in proved fertility (54). In general, infertility in AIS is the rule. The evidence of sperm count improvement after high doses of testosterone (as described above) can be an indicative of fertility success, but should be tested in further studies as well as the use of aromatase inhibitors and clomiphene citrate to obtain fertility in these patients

PSYCHOLOGICAL OUTCOMES Psychological support is essential for AIS individuals and their parents, in general (55). Dialogue about fertility, sexuality and karyotype are delicated issues to be approached with AIS individuals. The gender identity, gender role and sexual orientation show a female pattern in CAIS individuals. In PAIS patients, in general, gender identity aligned with both sex of rearing male or female (56). Arch Endocrinol Metab. 2018;62/2

Androgen insensitivity syndrome

CONCLUSION AIS is the most common molecular diagnosis in newborns with 46,XY DSD and results of an AR defect. It has an X-linked inheritance and affects 50% of the male offspring. In CAIS, the diagnosis can be done intrauterus, at birth, childhood or after puberty. In PAIS, the diagnosis is usually at birth due to the atypical external genitalia. In MAIS, the diagnosis should be considered in cases of pubertal gynecomastia and male infertility. AR defects are found along AR gene in all AIS phenotypes. Non-synonymous point mutations are the commonest AR defects reported in AIS. Molecular diagnosis is achieved in almost all patients with CAIS and in a lower frequency in PAIS individuals. AIS is characterized by elevated serum LH and testosterone. In CAIS, there is a low risk of GCTs before puberty and postponing surgery to after puberty may allow the development of spontaneous puberty. In PAIS there is a risk of GCTs in 15% of the patients, and bilateral gonadectomy is recommended at childhood in all individuals raised in the female social sex. For males with PAIS, the testis should be placed in the scrotum and regularly monitored. Fertility was described in one PAIS individuals, and therapeutic strategy for successful fertility could be experienced in PAIS and MAIS individuals. In AIS, gender identity usually follows the sex of rearing, but quality of sexual life, sexual functioning and quality of life can be slightly compromised and are important issues for keeping patients in psychological care. Funding: this work was supported by: Fundação de Amparo à Pesquisa do Estado de São Paulo Grant 2013/02162-8, Núcleo Arch Endocrinol Metab. 2018;62/2

de Estudos e Terapia Celular e Molecular (NETCEM) and Conselho Nacional de Desenvolvimento Científico e Tecnológico Grant 303002/2016-6 (to B.B.M.); Fundação de Amparo à Pesquisa do Estado de São Paulo 2014/50137-5 (to SELA). Disclosure: no potential conflict of interest relevant to this article was reported.

REFERENCES 1. Melo KFS, Mendonça BB, Billerbeck AEC, Costa EMF, Latronico AC, Arnhold IJP. [Androgen insensitivity syndrome: clinical, hormonal and molecular analysis of 33 cases]. Arq Bras Endocrinol Metab. 2005;49(1):87-97. 2. Mendonca BB, Costa EM, Belgorosky A, Rivarola MA, Domenice S. 46,XY DSD due to impaired androgen production. Best Pract Res Clin Endocrinol Metab. 2010;24(2):243-62. 3. Gottlieb B, Beitel LK, Nadarajah A, Paliouras M, Trifiro M. The androgen receptor gene mutations database: 2012 update. Hum Mutat. 2012;33(5):887-94. 4. Morris JM. The syndrome of testicular feminization in male pseudohermaphrodites. Am J Obstet Gynecol. 1953;65(6):1192211. 5. McPhaul MJ, Marcelli M, Zoppi S, Griffin JE, Wilson JD. Genetic basis of endocrine disease. 4. The spectrum of mutations in the androgen receptor gene that causes androgen resistance. J Clin Endocrinol Metab. 1993;76(1):17-23. 6. Carmina E. Mild androgen phenotypes. Best Pract Res Clin Endocrinol Metab. 2006;20(2):207-20. 7. Imperato-McGinley J, Zhu YS. Androgens and male physiology the syndrome of 5alpha-reductase-2 deficiency. Mol Cell Endocrinol. 2002;198(1-2):51-9. 8. Mendonca BB, Batista RL, Domenice S, Costa EM, Arnhold IJ, Russell DW, et al. Steroid 5α-reductase 2 deficiency. J Steroid Biochem Mol Biol. 2016;163:206-11. 9. Mendonca BB, Domenice S, Arnhold IJ, Costa EM. 46,XY disorders of sex development (DSD). Clin Endocrinol (Oxf) 2009;70:173-87. 10. Tan MH, Li J, Xu HE, Melcher K, Yong EL. Androgen receptor: structure, role in prostate cancer and drug discovery. Acta Pharmacol Sin. 2015;36(1):3-23. 11. Clinckemalie L, Vanderschueren D, Boonen S, Claessens F. The hinge region in androgen receptor control. Mol Cell Endocrinol. 2012;358(1):1-8. 12. Nadal M, Prekovic S, Gallastegui N, Helsen C, Abella M, Zielinska K, et al. Structure of the homodimeric androgen receptor ligandbinding domain. Nat Commun. 2017;8:14388. 13. Oakes MB, Eyvazzadeh AD, Quint E, Smith YR. Complete androgen insensitivity syndrome – a review. J Pediatr Adolesc Gynecol. 2008;21(6):305-10. 14. Hughes IA, Werner R, Bunch T, Hiort O. Androgen insensitivity syndrome. Semin Reprod Med. 2012;30(5):432-42. 15. Danilovic DL, Correa PH, Costa EM, Melo KF, Mendonca BB, Arnhold IJ. Height and bone mineral density in androgen insensitivity syndrome with mutations in the androgen receptor gene. Osteoporos Int. 2007;18(3):369-74. 16. Miles HL, Gidlöf S, Nordenström A, Ong KK, Hughes IA. The role of androgens in fetal growth: observational study in two genetic models of disordered androgen signalling. Arch Dis Child Fetal Neonatal Ed. 2010;95(6):F435-8. 17. Mendonca BB, Gomes NL, Costa EM, Inacio M, Martin RM, Nishi MY, et al. 46,XY disorder of sex development (DSD) due to 17β-hydroxysteroid dehydrogenase type 3 deficiency. J Steroid Biochem Mol Biol. 2017;165(Pt A):79-85.

233

Gender change is very rarely described in CAIS and there are just four cases of gender change in individuals with CAIS (57). Therefore, gender dysphoria in CAIS is considered truly transgenderism. However, sexual functioning and sexual quality of life demonstrated lesspositive outcome in CAIS patients in comparison with normal woman (58). Although there is no inconsistency in gender identity, male PAIS individuals show disappointment with undervirilization signs. The absence or paucity of facial and body hair, the high-pitched voice compromised their self-perception of manhood (59). In female individuals, low scores in feminility scales have been reported (58). An impairment of sexual functioning is reported in male and female PAIS individuals (58).

Androgen insensitivity syndrome

18. Mongan NP, Tadokoro-Cuccaro R, Bunch T, Hughes IA. Androgen insensitivity syndrome. Best Pract Res Clin Endocrinol Metab. 2015;29(4):569-80. 19. Qiao L, Tasian GE, Zhang H, Cunha GR, Baskin L. ZEB1 is estrogen responsive in vitro in human foreskin cells and is over expressed in penile skin in patients with severe hypospadias. J Urol. 2011;185(5):1888-93. 20. Arnhold IJ, Melo K, Costa EM, Danilovic D, Inacio M, Domenice S, et al. 46,XY disorders of sex development (46,XY DSD) due to androgen receptor defects: androgen insensitivity syndrome. Adv Exp Med Biol. 2011;707:59-61. 21. Madeira JLO, Souza ABC, Cunha FS, Batista RL, Gomes NL, Rodrigues AS, et al. A severe phenotype of Kennedy disease associated with a very large CAG repeat expansion. Muscle Nerve 2018;57(1):E95-7. 22. Melo KF, Mendonca BB, Billerbeck AE, Costa EM, Inácio M, Silva FA, et al. Clinical, hormonal, behavioral, and genetic characteristics of androgen insensitivity syndrome in a Brazilian cohort: five novel mutations in the androgen receptor gene. J Clin Endocrinol Metab. 2003;88(7):3241-50. 23. Edelsztein NY, Grinspon RP, Schteingart HF, Rey RA. Anti-Müllerian hormone as a marker of steroid and gonadotropin action in the testis of children and adolescents with disorders of the gonadal axis. Int J Pediatr Endocrinol. 2016;2016:20.

35. Sircili MH, e Silva FA, Costa EM, Brito VN, Arnhold IJ, Dénes FT, et al. Long-term surgical outcome of masculinizing genitoplasty in large cohort of patients with disorders of sex development. J Urol. 2010;184(3):1122-7. 36. Cools M, Looijenga LH, Wolffenbuttel KP, T’Sjoen G. Managing the risk of germ cell tumourigenesis in disorders of sex development patients. Endocr Dev. 2014;27:185-96. 37. Fischbeck KH. A role for androgen reduction treatment in Kennedy disease? Muscle Nerve. 2013;47(6):789. 38. Becker D, Wain LM, Chong YH, Gosai SJ, Henderson NK, Milburn J, et al. Topical dihydrotestosterone to treat micropenis secondary to partial androgen insensitivity syndrome (PAIS) before, during, and after puberty – a case series. J Pediatr Endocrinol Metab. 2016;29(2):173-7. 39. Wünsch L, Holterhus PM, Wessel L, Hiort O. Patients with disorders of sex development (DSD) at risk of gonadal tumour development: management based on laparoscopic biopsy and molecular diagnosis. BJU Int. 2012;110(11 Pt C):E958-65.

24. Ahmed SF, Cheng A, Hughes IA. Assessment of the gonadotrophingonadal axis in androgen insensitivity syndrome. Arch Dis Child. 1999;80(4):324-9.

40. Moch H, Cubilla AL, Humphrey PA, Reuter VE, Ulbright TM. The 2016 WHO Classification of Tumours of the Urinary System and Male Genital Organs-Part A: Renal, Penile, and Testicular Tumours. Eur Urol. 2016;70(1):93-105.

25. Lahlou N, Bouvattier C, Linglart A, Rodrigue D, Teinturier C. [The role of gonadal peptides in clinical investigation]. Ann Biol Clin (Paris). 2009;67(3):283-92.

41. van der Zwan YG, Cools M, Looijenga LH. Advances in molecular markers of germ cell cancer in patients with disorders of sex development. Endocr Dev. 2014;27:172-84.

26. Achermann JC, Domenice S, BachegaTA, Nishi MY, Mendonca BB. Disorders of sex development: effect of molecular diagnostics. Nat Rev Endocrinol. 2015;11(8):478-88.

42. Looijenga LH, Hersmus R, Oosterhuis JW, Cools M, Drop SL, Wolffenbuttel KP. Tumor risk in disorders of sex development (DSD). Best Pract Res Clin Endocrinol Metab. 2007;21(3):480-95.

27. Hellwinkel OJ, Holterhus PM, Struve D, Marschke C, Homburg N, Hiort O. A unique exonic splicing mutation in the human androgen receptor gene indicates a physiologic relevance of regular androgen receptor transcript variants. J Clin Endocrinol Metab. 2001;86(6):2569-75.

43. Döhnert U, Wünsch L, Hiort O. Gonadectomy in Complete Androgen Insensitivity Syndrome: Why and When? Sex Dev. 2017;11(4):171-4.

28. Batista RL, Rodrigues ADS, Nishi MY, Gomes NL, Faria JAD Junior, Moraes DR, et al. A recurrent synonymous mutation in the human androgen receptor gene causing complete androgen insensitivity syndrome. J Steroid Biochem Mol Biol. 2017;174:14-16. 29. Akin JW, Behzadian A, Tho SP, McDonough PG. Evidence for a partial deletion in the androgen receptor gene in a phenotypic male with azoospermia. Am J Obstet Gynecol. 1991;165(6 Pt 1):1891-4. 30. Köhler B, Lumbroso S, Leger J, Audran F, Grau ES, Kurtz F, et al. Androgen insensitivity syndrome: somatic mosaicism of the androgen receptor in seven families and consequences for sex assignment and genetic counseling. J Clin Endocrinol Metab. 2005;90(1):106-11. 31. Batista RL, Rodrigues AS, Nishi MY, Feitosa ACR, Gomes NLRA, Junior JAF, et al. Heterozygous nonsense mutation in the androgen receptor gene associated with partial androgen insensitivity syndrome in an individual with 47,XXY karyotype. Sex Dev. 2017;11(2):78-81. Copyright© AE&M all rights reserved.

34. Hayashida SA, Soares JM Jr, Costa EM, da Fonseca AM, Maciel GA, Mendonça BB, et al. The clinical, structural, and biological features of neovaginas: a comparison of the Frank and the McIndoe techniques. Eur J Obstet Gynecol Reprod Biol. 2015;186:12-6.

44. Handa N, Nagasaki A, Tsunoda M, Ohgami H, Kawanami T, Sueishi K, et al. Yolk sac tumor in a case of testicular feminization syndrome. J Pediatr Surg. 1995;30(9):1366-7. 45. Chaudhry S, Tadokoro-Cuccaro R, Hannema SE, Acerini CL, Hughes IA. Frequency of gonadal tumours in complete androgen insensitivity syndrome (CAIS): A retrospective case-series analysis. J Pediatr Urol. 2017;13(5):498.e1-498.e6. 46. Kaprova-Pleskacova J, Stoop H, Brüggenwirth H, Cools M, Wolffenbuttel KP, Drop SL. Complete androgen insensitivity syndrome: factors influencing gonadal histology including germ cell pathology. Mod Pathol. 2014;27(5):721-30. 47. Kathrins M, KolonTF. Malignancy in disorders of sex development. Transl Androl Urol. 2016;5(5):794-8. 48. Hiort O, Birnbaum W, Marshall L, Wünsch L, Werner R, Schröder T, et al. Management of disorders of sex development. Nat Rev Endocrinol. 2014;10(9):520-9. 49. Nakhal RS, Hall-Craggs M, Freeman A, Kirkham A, Conway GS, Arora R, et al. Evaluation of retained testes in adolescent girls and women with complete androgen insensitivity syndrome. Radiology. 2013;268(1):153-60.

32. Ismail-Pratt IS, Bikoo M, Liao LM, Conway GS, Creighton SM. Normalization of the vagina by dilator treatment alone in Complete Androgen Insensitivity Syndrome and Mayer-Rokitansky-KusterHauser Syndrome. Hum Reprod. 2007;22(7):2020-4.

50. Cools M, Looijenga L. Update on the pathophysiology and risk factors for the development of malignant testicular germ cell tumors in complete androgen insensitivity syndrome. Sex Dev. 2017;11(4):175-81.

33. Costa EM, Mendonca BB, Inácio M, Arnhold IJ, Silva FA, Lodovici O. Management of ambiguous genitalia in pseudohermaphrodites: new perspectives on vaginal dilation. Fertil Steril. 1997;67(2): 229-32.

51. Hiort O, Holterhus PM. Androgen insensitivity and male infertility. Int J Androl. 2003;26(1):16-20.

234

52. Finlayson C, Fritsch MK, Johnson EK, Rosoklija I, Gosiengfiao Y, Yerkes E, et al. Presence of germ cells in disorders of sex Arch Endocrinol Metab. 2018;62/2

Androgen insensitivity syndrome

development: implications for fertility potential and preservation. J Urol. 2017;197(3 Pt 2):937-43. 53. Chu J, Zhang R, Zhao Z, Zou W, Han Y, Qi Q, et al. Male fertility is compatible with an Arg(840)Cys substitution in the AR in a large Chinese family affected with divergent phenotypes of AR insensitivity syndrome. J Clin Endocrinol Metab. 2002;87(1):347-51. 54. Tordjman KM, Yaron M, Berkovitz A, Botchan A, Sultan C, Lumbroso S. Fertility after high-dose testosterone and intracytoplasmic sperm injection in a patient with androgen insensitivity syndrome with a previously unreported androgen receptor mutation. Andrologia. 2014;46(6):703-6. 55. Cohen-Kettenis PT. Psychosocial and psychosexual aspects of disorders of sex development. Best Pract Res Clin Endocrinol Metab. 2010;24(2):325-34.

58. de Vries AL, Doreleijers TA, Cohen-Kettenis PT. Disorders of sex development and gender identity outcome in adolescence and adulthood: understanding gender identity development and its clinical implications. Pediatr Endocrinol Rev. 2007;4(4):343-51. 59. Callens N, Van Kuyk M, van Kuppenveld JH, Drop SLS, CohenKettenis PT, Dessens AB, et al. Recalled and current gender role behavior, gender identity and sexual orientation in adults with Disorders/Differences of Sex Development. Horm Behav. 2016;86:8-20. 60. Doehnert U, Bertelloni S, Werner R, Dati E, Hiort O. Characteristic features of reproductive hormone profiles in late adolescent and adult females with complete androgen insensitivity syndrome. Sex Dev. 2015;9(2):69-74.

56. Mendonca BB. Gender assignment in patients with disorder of sex development. Curr Opin Endocrinol Diabetes Obes. 2014;21(6):511-4.

57. Bermúdez de la Vega JA, Fernández-Cancio M, Bernal S, Audí L. Complete androgen insensitivity syndrome associated with male gender identity or female precocious puberty in the same family. Sex Dev. 2015;9(2):75-9.

Arch Endocrinol Metab. 2018;62/2

235

review Serviço de Endocrinologia, Hospital das Clínicas, Universidade Federal de Pernambuco (UFPE), Recife, PE, Brasil 2 Unidade de Neuroendócrino, Escola Paulista de Medicina, Universidade Federal de São Paulo (Unifesp/EPM), São Paulo, SP, Brasil 3 Centro de Endocrinologia e Diabetes de Joinville (Endoville), Joinville, SC, Brasil 4 Serviço de Endocrinologia do Hospital Universitário de Brasília, Universidade de Brasília (UnB), Brasília, DF, Brasil 5 Serviço de Endocrinologia e Metabologia, Hospital de Clínicas, Universidade Federal do Paraná (SEMPR), Curitiba, PR, Brasil 6 Divisão de Neurocirurgia Funcional, Instituto de Psiquiatria do Hospital das Clínicas, Faculdade de Medicina da Universidade de São Paulo (IPqHC-FMUSP), São Paulo, SP, Brasil 7 Serviço de Endocrinologia, Hospital de Clínicas de Porto Alegre, PPG Endocrinologia, Faculdade de Medicina, Universidade Federal do Rio Grande do Sul (UFRGS), Porto Alegre, RS, Brasil 8 Serviço de Endocrinologia, Hospital das Clínicas, Faculdade de Medicina da Universidade de São Paulo (FMUSP), São Paulo, SP, Brasil 9 Serviço de Endocrinologia, Hospital Universitário Presidente Dutra, Universidade Federal do Maranhão (UFMA), São Luís, MA, Brasil 10 Serviço de Endocrinologia, Hospital Universitário Clementino Fraga Filho, Universidade Federal do Rio de Janeiro (HUCFF-UFRJ), Rio de Janeiro, RJ, Brasil 11 Unidade de Neuroendocrinologia, Instituto Estadual do Cérebro Paulo Niemeyer, Rio de Janeiro, RJ, Brasil 12 Departamento de Clínica Médica, Faculdade de Ciências Médicas, Universidade Estadual de Campinas (FCM/Unicamp), Campinas, SP, Brasil 13 Serviço de Endocrinologia, Hospital Universitário Walter Cantídio, Universidade Federal do Ceará (UFCE), Fortaleza, CE, Brasil 14 Serviço de Endocrinologia e Metabologia, Santa Casa de Belo Horizonte, Belo Horizonte, MG, Brasil 15 Serviço de Endocrinologia, Hospital das Clínicas, Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG, Brasil 1

Correspondence to: Lucio Vilar Hospital das Clínicas, Departamento de Medicina Clínica Av. Prof. Moraes Rego, 1235, Cidade Universitária 50670-901 – Recife, PE, Brasil lvilarf@gmail.com

Controversial issues in the management of hyperprolactinemia and prolactinomas – An overview by the Neuroendocrinology Department of the Brazilian Society of Endocrinology and Metabolism Lucio Vilar1, Julio Abucham2, José Luciano Albuquerque1, Luiz Antônio Araujo3, Monalisa F. Azevedo4, Cesar Luiz Boguszewski5, Luiz Augusto Casulari4, Malebranche B. C. Cunha Neto6, Mauro A. Czepielewski7, Felipe H. G. Duarte8, Manuel dos S. Faria9, Monica R. Gadelha10,11, Heraldo M. Garmes12, Andrea Glezer8, Maria Helane Gurgel13, Raquel S. Jallad8, Manoel Martins13, Paulo A. C. Miranda14, Renan M. Montenegro13, Nina R. C. Musolino6, Luciana A. Naves4, Antônio Ribeiro-Oliveira Júnior15, Cíntia M. S. Silva10, Camila Viecceli7, Marcello D. Bronstein8

ABSTRACT Prolactinomas are the most common pituitary adenomas (approximately 40% of cases), and they represent an important cause of hypogonadism and infertility in both sexes. The magnitude of prolactin (PRL) elevation can be useful in determining the etiology of hyperprolactinemia. Indeed, PRL levels > 250 ng/mL are highly suggestive of the presence of a prolactinoma. In contrast, most patients with stalk dysfunction, drug-induced hyperprolactinemia or systemic diseases present with PRL levels < 100 ng/mL. However, exceptions to these rules are not rare. On the other hand, among patients with macroprolactinomas (MACs), artificially low PRL levels may result from the so-called “hook effect”. Patients harboring cystic MACs may also present with a mild PRL elevation. The screening for macroprolactin is mostly indicated for asymptomatic patients and those with apparent idiopathic hyperprolactinemia. Dopamine agonists (DAs) are the treatment of choice for prolactinomas, particularly cabergoline, which is more effective and better tolerated than bromocriptine. After 2 years of successful treatment, DA withdrawal should be considered in all cases of microprolactinomas and in selected cases of MACs. In this publication, the goal of the Neuroendocrinology Department of the Brazilian Society of Endocrinology and Metabolism (SBEM) is to provide a review of the diagnosis and treatment of hyperprolactinemia and prolactinomas, emphasizing controversial issues regarding these topics. This review is based on data published in the literature and the authors’ experience. Arch Endocrinol Metab. 2018;62(2):236-63 Keywords Hyperprolactinemia; prolactinomas; pseudoprolactinomas; macroprolactin; hook-effect; dopamine agonists; pituitary surgery; temozolomide

Received on Feb/3/2017 Accepted on Aug/9/2017 DOI: 10.20945/2359-3997000000032

236

Arch Endocrinol Metab. 2018;62/2

Controversial issues in the management of hyperprolactinemia and prolactinomas

INTRODUCTION

yperprolactinemia has multiple etiologies (Table 1) and is the most common endocrine disorder of the hypothalamic-pituitary axis (1-3). A prolactinoma is the most common cause of chronic hyperprolactinemia once pregnancy, primary hypothyroidism, and drugs that raise serum prolactin (PRL) levels have been ruled out (4-6). Prolactinomas are the most common hormonesecreting pituitary tumors,accounting for approximately 40% of all pituitary tumors (2,6) In adults, prolactinomas have an estimated prevalence of 60-100 per million population (7,8), and in a population from three different districts of Belgium, prolactinomas have been reported to represent 73.3% of all pituitary adenomas, with a higher prevalence in women (78.2%) (9). Between the age of 20 and 50 years, the ratio between women and men is estimated to be 10:1, whereas after the fifth decade of life, both genders are equally affected (10,11). Although prolactinomas are rare at the pediatric and adolescent ages, they account for approximately half of all pituitary adenomas in that population (12). PRLsecreting carcinomas are extremely rare (13). Table 1. Causes of hyperprolactinemia Physiologic • Pregnancy; lactation; stress; sleep; coitus; exercise Pathologic • Systemic diseases – Primary hypothyroidism; adrenal insufficiency; renal insufficiency; cirrhosis; pseudocyesis; epileptic seizures • Hypothalamic diseases – tumors (craniopharyngiomas, dysgerminomas, meningiomas, etc.); infiltrative disorders (histiocytosis, sarcoidosis, etc.), metastasis; cranial radiation; Rathke’s cleft cysts, etc. • Pituitary diseases – Prolactinomas; acromegaly; thyrotropinomas; Cushing’s disease; infiltrative disorders; metastasis; lymphocytic hypophysitis; empty sella syndrome, etc. • Stalk disorders – Hastitis; seccion; traumatic brain injury • Neurogenic – Chest wall lesions (burns; breast surgery; thoracotomy; nipple rings; herpes zoster, etc.); spinal cord injury (cervical ependymoma; tabes dorsalis; extrinsic tumors, etc.), breast stimulation, etc. • Idiopathic • Ectopic prolactin production – Renal cell carcinoma; ovarian teratomas; gonadoblastoma; non-Hodgkin lymphoma, uterine cervical carcinoma; colorectal adenocarcinoma, etc.) Macroprolactinemia Drug-induced (Table 3)

effects of hyperprolactinemia on testes and ovaries. Hypogonadism can cause menstrual irregularity and amenorrhea in women, sexual dysfunction, infertility, and loss of bone mineral mass in both genders (15,16). Hyperprolactinemia can also reduce the libido independently of testosterone levels (17). In patients harboring macroprolactinomas, tumor mass effect symptoms, such as headache, visual changes, and, more rarely, cerebrospinal fluid (CSF) rhinorrhea, hydrocephalus and seizures, can also occur (1-3). Hypopituitarism beyond hypogonadism can occur if there is compression of the pituitary stalk or destruction of normal pituitary tissue (3,6,7). It is worth commenting that some women present with non-puerperal galactorrhea in the presence of regular menstrual cycles and normal PRL levels (18,19). This so-called “idiopathic galactorrhea” is estimated to be present in up to 40-50% of all women with non-puerperal galactorrhea (19,20). In contrast, the finding of galactorrhea in men is highly suggestive of a prolactinoma (2,18). In this publication, the goal of the Neuroendocrino logy Department of the Brazilian Society of Endocrinology and Metabolism (SBEM) is to provide a review on the diagnosis and treatment of hyperprolactinemia and prolactinomas, emphasizing controversial issues regarding these topics.

PROLACTIN SERUM ISOFORMS The PRL size is heterogeneous in terms of circulating molecular forms. The predominant form in healthy subjects and in patients with prolactinomas is monomeric PRL (molecular weight of 23 kDa), while dimeric or big PRL (45-60 kDa) and big-big PRL or macroprolactin (150-170 kDa) correspond to less than 20% of the total PRL (20,21). When the serum of a patient with hyperprolactinemia contains mostly macroprolactin, the condition is termed macroprolactinemia (22,23). In up to 90% of cases, macroprolactin is composed of a complex formed by an IgG and monomeric PRL (2,24-29).

Adapted from Ref. 1.

Arch Endocrinol Metab. 2018;62/2

DIAGNOSTIC EVALUATION For the correct identification of the etiology of hyperprolactinemia, some parameters must be taken into account: medical history, physical examination, clinical features, laboratory findings (especially PRL serum levels), and imaging studies of the 237

The most characteristic signs and symptoms found in patients with hyperprolactinemia are those related to hypogonadotropic hypogonadism and galactorrhea (1,3,7). Increased PRL levels decrease gonadotropin pulsatile secretion through inhibition of hypothalamic GnRH release (14). In addition, there may be direct

Controversial issues in the management of hyperprolactinemia and prolactinomas

pituitary and sella turcica (1,3,5). Furthermore, the screening for macroprolactinemia should often be considered, particularly in cases of asymptomatic hyperprolactinemia (3-5). In addition to PRL determination, TSH, free T4, and creatinine levels should be obtained to rule out secondary causes of hyperprolactinemia (1,3,6). Moreover, acromegaly must be investigated by measuring IGF-1 in all patients with a macroadenoma, even when there are no manifestations of this disease (30). Finally, β-hCG measurement is mandatory in any woman of childbearing age with amenorrhea (1,3).

1. CONTROVERSIAL ISSUES REGARDING DIAGNOSIS

1.1. Environmental influences on PRL secretion

Prolactin is secreted in a pulsatile manner, and serum levels can vary greatly throughout the day, with higher levels during sleep, a morning peak and a gradual decline after awakening, but without a typical circadian rhythm. Under normal conditions, ∼50% of the total daily production of PRL occurs during the sleep period. Thus, samples should be collected up to 3 hours after awakening, preferably while the patient is fasted (1,4). Stress from any source, whether psychological, induced by exercise or due to other acute illness, leads to the physiological elevation of PRL levels (2,3,5). However, supine rest is not necessary prior to sampling, contrary to what was believed in the past (31). Venipuncture stress may cause an elevation in the PRL level, but it is usually mild (< 40-60 ng/ mL) (32). The same is true for breast stimulation (1,2,33). Moreover, as PRL is secreted episodically, its levels measured during the day may possibly be beyond the upper limit of normality for a particular laboratory in healthy individuals (1,3). Therefore, an elevated PRL level should be confirmed at least once (33) unless the PRL levels are clearly elevated (> 80-100 ng/mL) (1). Nevertheless, according to the guidelines of the Endocrine Society, a single PRL level above the upper limit of normal confirms the diagnosis of hyperprolactinemia, as long as the serum sample was obtained without excessive venipuncture stress (4). COMMENT 1: As PRL is secreted in a pulsatile manner and as venipuncture stress can increase PRL levels, we suggest that an elevated PRL level should be confirmed at least once, unless the PRL levels are clearly elevated (> 80-100 ng/mL). 238

COMMENT 2: Vigorous exercise and nipple stimulation should be avoided for at least 30 minutes before checking PRL levels as they may result in PRL elevation.

1.2 Accuracy of prolactin levels The magnitude of PRL elevation can be useful in determining the etiology of hyperprolactinemia because the highest values are observed in patients with prolactinomas (1-5,33,34). For example, levels > 250 ng/mL are highly suggestive of the presence of a prolactinoma (3-5), although they may occasionally be found in other conditions (1,34), as commented on below. In contrast, most patients with stalk dysfunction (pseudoprolactinomas), drug-induced hyperprolactinemia or systemic diseases present with PRL levels < 100 ng/mL (1,4,34). However, exceptions to these rules are not rare (1,34). In patients with prolactinomas, circulating PRL levels usually parallel the tumor size (1,4,7). Indeed, microprolactinomas (MIC) (diameter < 10 mm) usually result in PRL levels of 100-200 ng/mL, but not infrequently, they may be < 100 ng/mL, and occasionally reach 500 ng/mL or more (1,33,34). Macroprolactinomas (MACs) (diameter ≥ 10 mm) are typically associated with PRL values > 250 ng/mL (4-7). In the vast majority of patients with giant prolactinomas (maximum diameter ≥ 4 cm), PRL levels will be > 1000 ng/mL (35,36). On the other hand, artificially low PRL levels may result from the so-called “hook effect”, which should be considered in all cases of large (≥ 3 cm) pituitary macroadenomas associated with normal or mildly elevated PRL levels (< 200 ng/mL) (1,37-39), as commented on below. Patients harboring cystic MACs may also present with mild PRL elevation (1-3). The Brazilian Multicenter Study on Hyperprolactinemia (BMSH) analyzed 1234 patients whose results are presented in Figure 1 and Table 2 (34). In this study, only patients harboring prolactinomas presented with PRL values ≥ 500 ng/nL (34).

1.2.1 How do PRL levels behave in cases of pseudoprolactinomas? In patients with “pseudoprolactinomas”, whose main etiology isa nonfunctioning pituitary adenoma (NFPA), hyperprolactinemia results from compression of the pituitary stalk (2,40). In that situation, this soArch Endocrinol Metab. 2018;62/2

Controversial issues in the management of hyperprolactinemia and prolactinomas

Prolactin levels in hyperprolactinemic patients (n = 1234) 1400 1200 1000 800 600 400 200 0 Macroprolacti- Macroprolactinomas (n = 250) nomas (n = 444) Mean PRL (ng/mL)

1422

165

Idiopathic (n = 45)

Macroprolacti- Drug-induced nemia (n = 115) (n = 80)

163

119

105

Acromegaly (n = 40) 99

Non-functioning pituitary Hypothyroidism adenomas (n = 78) (n = 82) 80

Figure 1. PRL levels according to the etiology of the hyperprolactinemia in the Brazilian multicenter study on hyperprolactinemia (Adapted from Ref. 34).

Etiology

N (%)

Mean PRL (range) (ng/mL)

Macroprolactinomas

250 (20.2)

1422.9 ± 3134.7 (108-21,200)

Microprolactinomas

444 (36)

165.6 ± 255.1 (32-525)

Idiopathic

45 (3.6)

163.9 ± 81.8 (46-328)

Macroprolactinemia

115 (9.3)

119.5 ± 112.9 (32.5-404)

Drug-induced

180 (14.6)

105.1 ± 73.2 (28-380)

Acromegaly

40 (3.2)

99.3 ± 57.4 (28-275)

NFPA

82 (6.6)

80.9 ± 54.5 (28-490)

Primary hypothyroidism

78 (6.3)

74.6 ± 42.4 (30-253)

NFPA: Non-functioning pituitary adenomas. Adapted from Ref. 34.

called disconnection hyperprolactinemia is thought to result from loss of the inhibitory effect of dopamine on PRL secretion (19). NFPAs represent the principal differential diagnosis of macroprolactinomas, as they require distinct treatments and have a distinct natural history and prognosis (1,40). The term pseudoprolactinomas also includes other conditions such as craniopharyngiomas, Rathke´s cleft cysts, sarcoidosis, Langerhans-cell histiocytosis and metastasis (19,40). Based on a large series of histologically confirmed cases (n = 226) with NFPA, serum PRL > 2000 mIU/L (> 95 ng/mL) is almost never (< 2%) encountered in these patients (41). Accordingly, in a recent study, among 64 patients with immunohistochemically confirmed NFPAs, PRL levels ranged from 33 to Arch Endocrinol Metab. 2018;62/2

250 ng/mL (~80% < 100 ng/mL) (42) By contrast, in BMSH, among 82 patients with NFPA, PRL levels ranged from 28 to 490 ng/mL (< 100 ng/mL in 82%); however, not all patients had been submitted to immunohistochemical evaluation (Table 3) (34). COMMENT 3: In cases of non-functioning pituitary adenomas, hyperprolactinemia results from stalk compression, and thus, prolactin (PRL) levels are modestly elevated (< 100 ng/mL) in the great majority of cases. Values > 250 ng/mL are exceedingly rare. By contrast, in patients with macroprolactinomas, PRL levels are usually > 250 ng/mL, and not infrequently, they exceed 1000 ng/mL. However, PRL levels may be misleadingly low due to the hook effect or in patients with cystic macroprolactinomas.

1.2.2 How do PRL levels behave in cases of druginduced hyperprolactinemia? The most common cause of non-physiological hyperprolactinemia is the use of drugs, which act through different mechanisms: increased transcription of the PRL gene (estrogens), antagonism of the dopamine receptor (risperidone, haloperidol, metoclopramide, domperidone, sulpiride, etc.), dopamine depletion (reserpine, methyldopa), inhibition of hypothalamic dopamine production (verapamil, 239

Table 2. Prolactin levels (ng/mL) according to the etiology of the hyperprolactinemia in the Brazilian Multicenter Study on Hyperprolactinemia

Controversial issues in the management of hyperprolactinemia and prolactinomas

heroin, morphine, enkephalin analogs, etc.), inhibition of dopamine reuptake (tricyclic antidepressants, cocaine, amphetamine, monoamine oxidase inhibitors), inhibition of serotonin reuptake (opiates, fenfluramine, fluoxetine, sibutramine), etc. (1,2,42-47) (Table 3). Table 3. Drug-induced hyperprolactinemia Antipsychotics • Typical – Phenothiazines; butirophenones; thyoxanthenes • Atypical – Risperidone; molindone; amisulpride; quetiapine; olanzapine Antidepressants • Tricyclics – Amitriptyline; desipramine; clomipramine • MAO inhibitors – Pargyline; clorgyline • SSRIs – Fluoxetine; citalopram; paroxetine Antihypertensive drugs • Verapamil; α-methyldopa; reserpine; labetolol Anticonvulsivants • Phenytoin Prokinetic agents • Metoclopramide; domperidone; bromopride Others • Estrogens; anesthetics; cimetidine; ranitidine; opiates; methadone; morphine; apomorphine; heroin; cocaine; marijuana; alcohol; sibutramine, etc.

MAO: monoamine oxidase; SSRIs: selective serotonin re-uptake inhibitors. Adapted from Refs. 1, 2, and 3.

In the Brazilian Multicenter Study on Hyperprolactinemia (BMSH), antidepressants and neuroleptics (in monotherapy or in combination) were the culprits in a large majority of the cases (82.2%) (34). Among antipsychotics, the most frequently involved drugs were haloperidol, phenothiazines, and risperidone, while tricyclic drugs were the main representants among the antidepressants (34). Other studies found the following rates of hyperprolactinemia associated with each therapeutic drug class: 31% for neuroleptics, 28% for neuroleptic-like drugs, 26% for antidepressants, 5% for H2-receptor antagonists, and 10% for other drugs (45). In one group of 106 patients receiving antipsychotics, hyperprolactinemia was present in 81%, 35%, 29%, and 38% of patients taking risperidone, olanzapine, ziprasidone, and typical antipsychotics, respectively (46). The newer atypical antipsychotics (AAPs) are characterized by increased antipsychotic efficacy and fewer neurological and endocrine related side-effects compared to classical antipsychotic drugs (45,46). With the exception of risperidone, amisulpride and molindone, which are often associated with high PRL levels (45), most of the AAPs elicit a poor 240

hyperprolactinemic response or no hyperprolactinemia at all (43,45,46). Furthermore, the use of drugs such as quetiapine and aripiprazole (a dopamine partial agonist) was shown to be associated with resolution of the hyperprolactinemia induced by other AAPs (48). Moreover, decreased PRL levels were also reported when aripiprazole was used as adjunct therapy to risperidone (49). Antidepressants induce hyperprolactinemia in a small proportion of patients, but they rarely elevate PRL to a significant degree (46). Among 80 patients treated with fluoxetine, only 10 (12.5% developed hyperprolactinemia, with 38 ng/mL being the highest PRL level (50). Atypical antidepressants, including bupropion and mirtazapine, appear to have no effect on PRL levels (44,47). Although PRL elevation is usually mild (25-100 ng/mL) in cases of drug-induced hyperprolactinemia, it is also highly variable. Indeed, metoclopramide, risperidone, and phenothiazines can lead to prolactin levels > 200 ng/mL (1,43-46). Among 180 cases enrolled in the BMSH, most (64%) presented with PRL levels < 100 ng/mL, but in 5%, they exceeded 250 ng/mL (range, 28-380; mean, 105.1 ± 73.2) (Table 3) (34). Interestingly, PRL levels of 720 ng/mL were recently reported in a young lady who had been treated with domperidone for 3 months. Following domperidone discontinuation, PRL fell to the normal range (51). COMMENT 4: Although drug-induced hyperprolactinemia is usually associated with PRL levels < 100 ng/mL, they are largely variable and may overlap those found in patients with prolactinomas.

1.2.3 How do the hook effect and linearity issues in PRL assays impact our practice? Immunometric assays have greatly improved the sensitivity of PRL and other hormone measurements. They are usually performed through capture antibodies that are immobilized in a solid phase, and a second antibodyis labeled a signal generator. These antibodies bind to different epitopes of the PRL to be quantified, thus forming a “sandwich” test using either a fluorescent or chemiluminescent marker. The relative antigen-to-antibody proportion influences its interaction and may compromise the appropriate Arch Endocrinol Metab. 2018;62/2

Controversial issues in the management of hyperprolactinemia and prolactinomas

Capture antibody Antigen Sinal antibody “Sandwick”

Antigen concentration extremely high

Figure 2. Schematic depiction of “hook effect.” Left, Extremely high antigen concentrations saturate both capture and signal antibodies and prevent “sandwich” formation. Right, When liquid phase is discarded, most of the antigen is lost with the signal antibody; thus, antigen concentration is measured as low (Adapted from Ref. 39).

The hook effect differs between the different assay systems used in clinical practice. Dilution of the sample at 1:100 is the test of choice to unmask this hook effect (1,4). Indeed, this step will result in a dramatic rise in PRL levels if the patient has a macroprolactinoma, remaining low in cases of non-functioning pituitary adenomas (1,4,37,38). Physicians should keep in mind that laboratories cannot dilute all samples on a routine basis to rule out the hook effect. Thus, it is extremely important that they are aware of the phenomenon so they do not forget to order dilution for all PRL samples suspected to be overconcentrated. In clinical practice, this means that dilutions must be ordered for PRL measurements in all patients with macroadenomas ³ 3 cm and initial PRL levels < 200 ng/mL, even if the PRL levels are normal (1,2,38). However, it is relevant to mention that dilutions ordered by physicians are performed at the discretion of laboratory workers. This means that, according to the reportable reference range of an assay Arch Endocrinol Metab. 2018;62/2

and its reported levels of hook effect by the respective manufacturer, dilutions may occasionally start at 1:10. For instance, considering an assay in which, according to its manufacturer, the hook effect is not supposed to be induced up to a PRL value of 20,680 ng/mL, this theoretically means that a starting dilution of 1:10 should be sufficient enough to detect the phenomenon, as it is very improbable to have a PRL value higher than 200,680 ng/mL (53). In this regard, it is noteworthy that unnecessary dilutions usually cause a loss of accuracy in measurements. Fortunately, with the newer assays, extremely high levels of PRL are usually necessary to hook the assay, and this fact has dramatically decreased the incidence of this phenomenon (53,54). Interestingly, the hook effect has often been confused with assay linearity problems by clinicians (54). In a given assay with a reportable PRL ranging from 0.25-200 ng/mL according to the manufacturer, PRL samples coming from patients with untreated macroprolactinomas may often fall out of this reportable range, even when an automatic dilution of 1:10 is superimposed. In this case, it is common that the laboratory releases a result of “> 2000 ng/mL”, and it seems that they are not aware of the importance of exact quantification of the result. Therefore, clinicians must refrain from starting treatment until the laboratory reassays the sample at further dilutions, even if it has to be performed manually, and up to the point that the linear range of the assay is reached. Otherwise, the observed effect of a treatment may be misled due to an inexact reported measurement (53,54). COMMENT 5: The hook effect should be considered in every patient presenting with a large (≥ 3 cm) pituitary macroadenoma and prolactin levels within the normal range or only modestly elevated.

1.3 Macroprolactinemia screening: routinely or just in asymptomatic individuals? Macroprolactinemia is a condition where more than 60% of circulating PRL is made up of macroprolactin (1,29). In most of the in vitro studies, macroprolactin was shown to display low biological activity (28,29,55). This is corroborated by the finding that in most series with macroprolactinemia, individuals are pauci- or asymptomatic (56,57), with no need to perform sellar imaging (58) or specific treatments (58,59). Others argued that the binding of PRL to their receptor could 241

formation of the immunocomplexes. Thus, extremely high concentrations of PRL can simultaneously saturate both the capture and the labeled antibody when only a few PRL molecules are actually bound in a sandwich complex to be quantified by the test. In that situation, most of the PRL molecules are bound to just one antibody instead and are subsequently washed away (Figure 2). Therefore, falsely low results are reported, and the correct result for the PRL concentration is much higher than reported. This artifact is called a high-dose hook effect, also known as the prozone phenomenon, and the reported results are usually within or, more often, slightly above the manufacturer´s reference range (52,53).

Controversial issues in the management of hyperprolactinemia and prolactinomas

be blocked by modification of the tertiary structure of the original molecule (60). However, there are individuals who, despite increased macroprolactin, also present with high levels of monomeric PRL, leading to “true” hyperprolactinemia with clinical symptoms and the need foran etiologic diagnosis for the proper management of hyperprolactinemia (59). Moreover, the presence of symptoms could result from the concomitance of macroprolactinemia with other conditions, such as polycystic ovary syndrome (61), idiopathic galactorrhea (1,2), or psychogenic erectile dysfunction (62). Assaying serum PRL before and after precipitation with polyethylene glycol (PEG) is the most used method for screening macroprolactinemias due to its low cost and easy workability (63). Theoretically, macroprolactin is precipitated with PEG, and only monomeric PRL will be recovered in the supernatant. However, some monomeric PRL also suffers precipitation, hence the need for the standardization of normal monomeric PRL values after PEG precipitation (58,60). Recoveries < 40% are indicative of the predominance of macroprolactin, whereas recoveries > 60% point to the diagnosis of monomeric hyperprolactinemia (56,58). Overall, PEG precipitation enables the correct diagnosis of macroprolactinemia in at least 80% of cases (56,63). The gold standard diagnostic test is the separation of isoforms by gel filtration, which correlates well with the PEG precipitation and is the only way of assessment when screening with PEG is inconclusive (58,63). However, it is an expensive and time-consuming method that cannot be used routinely. It is noteworthy that different assays recognize macroprolactin differently (64). It has been demonstrated that some of the new assays show lower cross-reactivity with macroprolactin; however, the number of samples defined as macroprolactin is still significant (65). Hyperprolactinemia related to macroprolactin may be due to its lower renal clearance, longer halflife and lower capability to activate hypothalamic dopaminergic tone, which negatively regulates the secretion of pituitary prolactin (5). The frequency of macroprolactinemia in the general population was shown to be 0.2% in women from Scandinavia (66) and 3.7% in a total of 1330 Japanese hospital workers of both genders (67), whereas among hyperprolactinemic individuals, it ranged from 8 to 42%, with a mean of 242

19.6%, in 8 European series (56,68-75). The study population may explain the variation in the frequency of macroprolactinemia in hyperprolactinemic individuals. As an example, two Brazilian studies have shown frequencies of 16.5% in 115 consecutive patients with hyperprolactinemia (76) and 46% in 113 cases from a reference laboratory (58). This high frequency of macroprolactinemia becomes an important issue in clinical practice: what is the probability with an additional assessment and treatment in an individual presenting with macroprolactinemia? Should all individuals with hyperprolactinemia be actively investigated for the presence of macroprolactinemia? The request for serum PRL assessment occurs in two scenarios. At first, there are complaints related to hyperprolactinemia, such as galactorrhea, hypogonadism and infertility, leading to serum PRL measurement. If laboratory tests confirm the clinical suspicion of monomeric hyperprolactinemia, macroprolactinemia screening is not indicated, and it is recommended to proceed to the usual investigation of physiological, pharmacological and pathological causes of hyperprolactinemia for proper handling of the case. In the second scenario, serum PRL evaluation is requested in the absence of complaints related to hyperprolactinemia. In this situation, facing hyperprolactinemia in an asymptomatic individual, macroprolactinemia screening is always indicated. If positive and monomeric PRL levels are normal, it should guide the patient that there is no need for further investigation, follow-up or treatment, due to the benign nature of the condition. If the screening with PEG is inconclusive, one may proceed to gel-filtration chromatography, or if the latter is unavailable, be guided by the clinical picture. If the macroprolactin result is negative, investigate hyperprolactinemia as usual. A flowchart for the management of macroprolactinemic individuals is proposed in Figure 3. Asymptomatic

No imaging No treatment High

Macroprolactinemia Symptomatic

True hyperprolactinemia

mPRL after PEG precipitation Normal

Evaluate other causes for clinical picture

Figure 3. Flowchart to the management of patients with macroprolactinemia (mPRL: monomeric prolactin) (Adapted from Ref. 6). Arch Endocrinol Metab. 2018;62/2

Controversial issues in the management of hyperprolactinemia and prolactinomas

Arch Endocrinol Metab. 2018;62/2

patients in the BMSH (33). In most studies, PRL levels were lower in macroprolactinemic patients than in those with monomeric hyperprolactinemia, but there was a great overlap between groups (34,56,63,69,83). Moreover, MRI abnormalities (e.g., macroadenomas and, mostly, microadenomas or an empty sella) may be found in approximately 20-25% of macroprolactinemic patients (69,70,73,74,84). COMMENT 6: Macroprolactinemia is, in most cases, a laboratory diagnostic pitfall, with a mean frequency of ~20% among hyperprolactinemic subjects. Clinical, radiological and laboratory features cannot be used reliably to differentiatemonomeric hyperprolactinemia from macroprolactinemia. The screening for macroprolactin is mostly indicated for asymptomatic hyperprolactinemic patients, subjects with apparent idiopathic hyperprolactinemia, and any patient without an obvious cause for the hyperprolactinemia.

TREATMENT OF HYPERPROLACTINEMIA AND PROLACTINOMAS The ideal treatment of hyperprolactinemia depends on its etiology and may include, for instance, L-thyroxine replacement in patients with primary hypothyroidism, dopamine agonists (DAs) for prolactinomas, and drug withdrawal in cases of drug-induced hyperprolactinemia (2-7). By contrast, macroprolactinemia does not need to be treated (5,24,25). Current available therapeutic options for prolactinomas include surgery, pituitary radiation therapy and pharmacotherapy with dopamine agonists (DAs) (19). DAs are the gold standard treatment for prolactinomas, as their use controls hormonal secretion and tumor growth in approximately 80% of cases (8). Among DAs, bromocriptine (BRC) and cabergoline (CAB), both of which are ergot derivatives, are the most commonly used worldwide. Quinagolide is available in some European countries. Cabergoline (CAB), a specific agonist of the dopamine receptor type 2 (D2R), is the first choice because of its better tolerability and greater efficacy in inducing PRL normalization and tumor shrinkage (Figures 4 and 5) (Table 4) (19,86-89). Bromocriptine use leads to normal serum PRL levels in 80% of microprolactinomas and 70% of 243

Some authors advocate routine macroprolactin screening as a cost-effective procedure (56,76-78), and others allow screening to rule out macroprolactinemia and investigate other conditions that justify symptoms (79). In a study conducted in a Brazilian reference laboratory, there was more cost in searching for individuals with true hyperprolactinemia, but screening macroprolactinemia did not prevent investigation and inappropriate treatment, pointing to the need for the dissemination of medical knowledge about macroprolactinemia (80). By contrast, according to some studies, the detection of macroprolactin may change the initial diagnosis in a significant proportion of patients. Indeed, in three series (73,74,81), macroprolactinemia was encountered in 25 to 68.3% (mean, 42.3%) of patients with apparent idiopathic hyperprolactinemia (IH). Moreover, the diagnosis of PRL-secreting pituitary microadenoma shifted to non-secreting pituitary microadenoma in 10 of 49 patients (20%) reported by Donadio and cols. (73). Thus, macroprolactinemia may occasionally represent a relevant cause of misdiagnosis, unnecessary investigation and inappropriate treatment (73,74,81). Conversely, PRL should never be measured in asymptomatic patients, in order to avoid the unnecessary detection of macroprolactinemia cases (1,5). Concerning the natural history of macro prolactinemia, macroprolactinemic subjects usually display persistent macroprolactinemia without the development of raised free PRL (82). However, during follow-up, hyperprolactinemia may develop in macroprolactinemic subjects who were initially normoprolactinemic along with an increase in antiPRL autoantibody titers (82). Overall, symptoms related to hyperprolactinemia (galactorrhea, menstrual disorders and sexual dysfunction) have been reported in up to 45% of patients with macroprolactinemia (56,58,69,70,73, 74,76,83,84). As mentioned, this would mostly result from the concomitance with monomeric hyperprolactinemia (74,75,85) or other disorders, such as polycystic ovary syndrome (1,61,62). Of note, the finding of both galactorrhea and menstrual disorders is rare in macroprolactinemia (83,84). In most patients with macroprolactinemia, PRL levels are < 100 ng/mL, but they are highly variable: from 20-663 ng/mL (mean, 61 ± 66; < 100 ng/mL in approximately 91% of cases) (83), to 119.5 ± 112.9 (range, 32.5-404; < 100 mg/L in 74%) among 115

Controversial issues in the management of hyperprolactinemia and prolactinomas

macroprolactinomas, whereas with CAB, this goal is achieved in 85% of patients (3,86-88). CAB effectiveness is higher in naïve patients, but the drug is also very effective in patients with intolerance or resistance to BCR (Figures 6 and 7) (34,88). The better performance of CAB probably results from its better tolerance and higher affinity for D2R (10,19,88).

90% 80% 70% 60% 50% 40% 30% 20% 10% 0%

80% 57% 40%

40% 21%

Naive patients (n = 40)

BCR-intolerant patients (n = 47)

Tumor shrinkage > 50%

100% 80%

67%

BCR-resistant patients (n = 20)

BCR-responsive patients (n = 10)

Complete disappearance

43%

40% 20% 10% 0%

20%

Figure 7. Concerning macroprolactinoma shrinkage, cabergoline is effective not only in naive patients but also in those previoiusly treated with bromocriptine (BCR) (Adapted from Ref. 34).

86%

60%

30%

PRL normalization

22%

18%

Resistance

Side-effects

14%

Intolerance

Table 4. Comparative efficacy of cabergoline (CAB) and bromocriptine (BCR) among patients with macroprolactinomas from the Brazilian Multicenter Study on Hyperprolactinemia Outcome

CAB (n = 238)

BCR (n = 304)

PRL normalization

Figure 4. Comparison of cabergoline (CAB) and bromocriptine (BCR), concerning efficacy and tolerability (Adapted from Ref. 34).

Tumor reduction > 50% Complete tumor disappearance

CAB (n = 117)

BCR (n = 133)

p-value

77.8%

59.4%

0.042

80%

58.7%

0.048

57.5%

34.7%

0.034

Adapted from Ref. 34.

80%

80% 60%

59%

57%

40%

2. CONTROVERSIAL ISSUES REGARDING TREATMENT In this topic, we will cover challenging or controversial aspects related to the treatment of prolactinomas and the management of psychotropic-induced hyperprolactinemia.

35%

p = 0.048 20%

p = 0.034

Cabergoline (n = 40)

Bromocriptine (n = 43)

Reduction > 50%

Complete disappearance

Figure 5. Comparative efficacy of CAB and BCR in inducing tumor shrinkage in naïve patients with macroprolactinomas (Adapted from Ref. 34). 100% 100% 100% 80%

91%

83%

88%

81%

60%

61%

40%

50%

20% 0%

Naive patients

BCR-intolerant patients

Microprolactinoma (n = 121)

BCR-resistant patients

BCR-responsive patients

Macroprolactinoma (n = 117)

Figure 6. Efficacy of cabergoline on the normalization of PRL levels in 238 patients with prolactinomas. BCR: bromocriptine (Adapted from Ref. 34). 244

2.1 How to manage the resistance to dopamine agonists? Different arbitrary concepts have been proposed for the definition of resistance to dopamine agonist (DA) therapy (2,4,88-91). Currently many experts have adopted the definition suggested by Molitch, which includes failure to normalize PRL levels and to decrease macroprolactinoma size by ≥ 50% with maximal conventional doses of medication (7.5 mg/day of bromocriptine or 2.0 mg/week of cabergoline) (89,90). Bromocriptine (BCR) fails to normalize prolactin levels in approximately one-quarter of patients; cabergoline (CAB), in 10-15%. BCR fails to decrease prolactinoma size by at least 50% in approximately one-third of the patients; CAB, in 10-15% (34,88-91). Arch Endocrinol Metab. 2018;62/2

Controversial issues in the management of hyperprolactinemia and prolactinomas

There are a number of potential mechanisms to explainresistance to DAs. Drug absorption or drug affinity to D2R are not involved (90). DA resistance is rather associated with a decrease in D2R gene transcription, resulting in a 4-fold decrease in the number of D2Rs on the cell membrane (92,93). Moreover, there is a decrease in the G protein that couples the D2R to adenylyl cyclase, further decreasing the ability of dopamine to inhibit PRL secretion (90). Patients who initially respond to a DA may rarely become resistant to these drugs at a later point in time (90). Most commonly, this is due to noncompliance. Rarely, there may be malignant transformation of a prolactinoma (94). In some cases, the development of DA resistance is due to the concomitant use of hormone replacement therapy with estrogen or testosterone (95).

Treatment The approaches for patients with resistance to DA therapy include (1) switching to another DA; (2) raising the dose of the DA beyond conventional doses if the patient continues to respond and tolerate; (3) surgical tumor resection; (4) radiotherapy; and (5) experimental treatments with other drugs (34,88,90,96,97).

Using an individualized, stepwise approach of dose titration of CAB, Ono and cols. (99) documented that 25 of 26 patients (96.1%) considered to have DA resistance, achieved normalization of the PRL levels within 12 months, with a mean dose of CAB of 5.2 ± 0.6 mg per week (range 3-12 mg/week). The rate of PRL normalization gradually increased to 35, 73, and 89% at 3, 6, and 9 mg/week, respectively, finally reaching 96% at the highest dose of 12 mg/week (99). DiSarno and cols. (100) found that doses > 2.0 mg/week (up to 7 mg/week) of CAB werestill unable to normalize PRL levels in 18% of patients with macroadenomas and 10% of those with microadenomas. More recently, Vilar and cols. (101) prospectively evaluated the management of 25 prolactinomas refractory to CAB 3 mg/week by progressively increasing the CAB dose as needed and tolerated, every 3 months, up to 9 mg/week. Overall, normalization of PRL levels was achieved in 18 patients (72%), as follows: in 3 (12%) patients, with up to 4 mg/week; in 9 (36%) patients, with 5 mg/week; and in 6 (24%) patients, with 6-7 mg/week. No patients benefitted from doses > 7 mg/week. CAB was well tolerated, and no significant echocardiographic valve abnormalities were detected (101).

Debulking surgery

Most of the data regarding switching dopamine agonists in resistant patients address switching from BCR to CAB. CAB is effective in normalizing PRL levels in approximately 50-80% of patients resistant to BCR, and up to 70% respond with some tumor size change (30,90,96,97). It is not clear why CAB should be so effective in patients resistant to BCR, but this may be due to cabergoline’s possessing a higher affinity for dopamine binding sites, a longer time occupying the receptor, and a slower elimination from the pituitary (90,97). By contrast, the response to BCR in a patient resistant to CAB is much more rare and has only been reported twice (90,98).

Patients can always undergo transsphenoidal surgery if their tumor is potentially resectable and an experienced neurosurgeon is available (4,90). There is also some evidence that debulking surgery may improve the response to DA (6,102-104). Of 61 patients resistant to either BCR or CAB, Hamilton and cols. (102) reported that surgery resulted in a normalization of PRL in 36% without dopamine agonist medication and in 15% with medication. Similarly, Primeau and cols. (102) found in 26 patients resistant to BCR, quinagolide or CAB that surgery resulted in a normalization of PRL in 42% without medication and in 27% with medication. In the European Multicenter Study, the rate of postoperative normalization of PRL was only 7.8% without medication and 5.3% with medication (104).

Raising the dose of the DA beyond conventional doses

Radiotherapy

As long as there is a continued response and no adverse effects from higher doses, there is no reason not to continue to increase the CAB dose (90). There is, however, a concern regarding the risk of cardiac valvulopathy induced by high doses of CAB (see below) (88,90).

Among the functioning pituitary tumors, prolactinomas seem to be the less responsive to radiotherapy (see below). Indeed, although it can also be effective in controlling tumor growth, its efficacy in restoring PRL levels to normal is limited (4,89,90).

Switching to another DA

Arch Endocrinol Metab. 2018;62/2

245

Pathogenetic mechanisms

Controversial issues in the management of hyperprolactinemia and prolactinomas

Other drugs Of note, if one is dealing with microprolactinomas resistant to DAs, hormonal replacement therapy is often all that is necessary for men and premenopausal women not willing to conceive (4,19,90). Estrogens may cause a decrease in the effectiveness of dopamine agonists through multiple mechanisms, including direct effects on PRL gene transcription (105), stimulation of mitotic activity (106), and a decrease in the number of D2 receptors on the lactotroph cell membrane (107). Moreover, estrogen may block apoptosis (108). Thus, reducing endogenous estrogens in resistant prolactinomas through the use of SERMs in women or aromatase inhibitors in men might be an interesting experimental approach. Accordingly, a few patients with “bromocriptine resistant” invasive macroprolactinomas have been shown to respond with a decrease in tumor size and a lowering of PRL levels when tamoxifen was added (90,109). The use of the SERM clomiphene was also shown to be effective in the recovery of hypogonadism in prolactinoma patients who persisted with low testosterone levels despite maximal doses of DA (110,111). In addition, the successful use of anastrozole, an aromatase inhibitor, was recently reported in two males with DA-resistant prolactinomas (90,112). Somatostatin analogs generally are not useful for PRL-secreting tumors (90), and there have been few reports on the successful combination therapy of octreotide (113) or lanreotide (114) and cabergoline in cases of DA-resistant tumors. The somatostatin receptor subtype 5 (SSTR5) is the most important with respect to the regulation of PRL secretion (115). Therefore, as pasireotide only has substantial activity at SSTR5 (116), it would be potentially more useful than the SSTR2-agonists octreotide and lanreotide in patients with aggressive DA-resistant prolactinomas (90). Temozolomide, an oral alkylating agent, has been successfully used in the treatment of aggressive or malignant pituitary tumors since 2006 (117,118). It has also been found to be moderately successful in some very aggressive, large DA-resistant prolactinomas. Reviewing such cases, Whitelaw and cols. (119) found that 12 of 20 (75%) resistant PRL-secreting macroadenomas responded to temozolomide. Given the toxicity of the drug, its use is generally regarded as the therapy of last resort and should only be performed 246

after the failure of DAs, surgery and radiotherapy for tumor control (90,119). Unfortunately, many of these very aggressive tumors escape from the suppressive effects of temozolomide after 0.5-2.5 years (90,119). Other treatment strategies undergoing clinical trials are the use of chimeric molecules (somatostatin analogues and dopamine D2 receptors) (2,3), PRL receptor antagonists (3), and antiblastic drugs, such as mTOR and tyrosine kinase inhibitors (3,120). COMMENT 7: Patients with resistance to bromocriptine should be switched to treatment with cabergoline (CAB), which leads to prolactin normalization in at least 50% of cases. Facedwith resistance to CAB, a stepwise increase in the dose should be performed first, as long as there is a continued response and no adverse effects. This approach is successful in at least 70% of patients. In our experience, doses > 7 mg/week do not provide additional benefits. Debulking surgery may improve a response to the dopamine agonist (DA) when the medical treatment has failed.Radiation and temozolomide can be indicated to control aggressive tumor growth even under DA therapy.

2.2 Are there differences in the safety profile of DAs? DA therapy often precipitates a broad spectrum of side effects, more frequently gastrointestinal symptoms (e.g., constipation, nausea, vomiting, etc.) but also postural hypotension, dizziness and headaches, which may range from mild to severe (34,88,121). The most common adverse events include nausea or vomiting (~35%), headache (~30%), and dizziness or vertigo (~25%) (121). The safety profile of CAB is similar to that reported for BRC, but CAB adverse effects are generally less frequent, less severe, and of shorter duration (34,88), and they resolve with dose reduction or continued use in many patients (34,88,121). The rate of treatment discontinuation due to complete intolerance is also significantly higher with BCR, compared to CAB (~12% vs ~4%) (87). Whether CAB is associated with an increased risk of clinically relevant cardiac valvulopathy in patients with prolactinomas as in those with Parkinson’s disease is still debated (see below) (10,121). Arch Endocrinol Metab. 2018;62/2

Controversial issues in the management of hyperprolactinemia and prolactinomas

Dopamine antagonists (e.g., haloperidol, olanzapine, quetiapine, sulpiride) are classically used for the treatment of psychiatric disorders such as psychosis and schizophrenia due to the supposed dopaminergic hyperactivity that occurs in these cases (43,46,47). DA treatment exerts the opposite effect to that of the dopamine antagonists (7). These agents can rarely cause psychiatric adverse side effects, including depression, somnolence, anorexia, anxiety, insomnia, impaired concentration, nervousness, hallucinations, nightmares, psychosis, impulsive control disorders (ICDs), and mania (3,5,122-125). The exact incidence of these side effects in DA-treated patients is not known but is thought to range from less than 1% to 3% (122,123). ICDs are characterized by difficulties in resisting urges to engage in behaviors that are excessive and/ or ultimately harmful to oneself or others and can include gambling, kleptomania, intermittent explosive disorder, compulsive sexual behavior and compulsive buying (126). Few reports have been published focusing on ICDs and other psychiatric disorders in prolactinoma patients treated with CAB (123-133). These reports have described disorders such as a first episode of mania (123,129); mania with psychotic features in a subject with bipolar disorder after starting CAB (125); psychosis in a patient with undiagnosed depression (126); compulsive gambling one year after starting CAB (130); gambling and compulsive sexual behavior just after starting CAB (131); psychosis in a patient without a previous history of psychiatric disorder three months after starting CAB (132); and depression and compulsive buying (133). In 2011, Martinkova and cols. (128) published a review reporting a 10% prevalence of ICD in patients on CAB for prolactinoma treatment. In another study, males with prolactinomas treated with DAs have been reported to be 9.9 times more likely to develop an impulse control disorder compared to their counterparts with nonfunctioning pituitary adenomas (134). More recently, Barake and cols. (135) conducted the only randomized study aiming to assess the impact of CAB on the appearance of ICDs and concluded that patients on CAB (particularly with higher dosages) were more susceptible to impulsivity disorders than those not taking the drug. Arch Endocrinol Metab. 2018;62/2

Psychiatric effects of CAB can be modulated by P-glycoprotein (P-gp). This protein, encoded by the ABCB1 gene (136), is a membrane transporter expressed in tumor cells and in normal tissues that acts as an efflux transporter in order to transport certain substances out of the brain and protect it against harmful substances. A recent study showed that CAB is a P-gp substrate (137). This study demonstrated that ABCB1 gene polymorphisms (with loss of function) could explain individual differences in the occurrence of central nervous system side-effects, demonstrating a future perspective to select patients for CAB treatment based on this gene study (137). COMMENT 8: In susceptible subjects, psychotic symptoms and impulsive control disorders may be triggered or aggravated by dopamine agonist (DA) therapy. It seems therefore important to exclude psychiatric disorders before prescribing DAs and to carefully follow up patients prone to or with a history of psychiatric disorders.

2.4 Risk of heart valvular disease associated with dopamine agonists â&#x20AC;&#x201C; what is its relevance? The main warning signs that cause concerns among endocrinologists about a possible association between the therapeutic use of dopamine agonists (DAs) with heart valvular disease (HVD) emerged from two articles published in 2007 involving patients with Parkinsonâ&#x20AC;&#x2122;s disease (138,139). In this group of patients, there is now strong evidence that treatment with high doses of CAB and pergolide (PGL) is associated with a higher risk of cardiac valvular regurgitation and moderate evidence that treatment with CAB, and the non-ergotderived DAs pramipexole is associated with a higher risk of heart failure (140). The underlying mechanism involves the activation of the 5-hydroxytryptamine 2B (5-HT2B) receptors, abundantly expressed on heart valves, which induces a cascade of events involving mitogenesis, fibroblast proliferation, valve thickening and, finally, valvular dysfunction (141,142). DAs bind to 5-HT2B receptors with different affinities; for instance, CAG and PGL show high affinity and act as a potent agonist, whereas bromocriptine (BRC) has a lower affinity compared to other DAs (141,142). However, there have been case reports and clinical studies in Parkinson's disease reporting on an increased 247

2.3 Do dopamine agonists cause psychiatric disorders?

Controversial issues in the management of hyperprolactinemia and prolactinomas

risk of abnormal valvular regurgitation and cardiac and non-cardiac fibrotic reactions in patients treated with BRC (143,144). As expected, the findings in patients with Parkinson's disease brought an immediate concern about the risk of HVD in endocrine patients treated with DAs, especially CAB, despite the striking differences between these groups that must be highlighted. First, the daily and cumulative doses of DAs used in neurology (at least 3 mg of CAB per day) are approximately 10-fold higher than those used in endocrinology (rarely more than 3 mg of CAB per week) (145). Moreover, most studies in Parkinson’s disease predominantly include men older than 60 years of agewho are usually on therapy with multiple drugs, while patients with endocrine abnormalities treated with DAs are predominantly young or middle-age women (146). This is important because the prevalence of valvular regurgitation increases with age and is influenced by gender, body mass index and hypertension (146,147). Another factor to be considered is the impact of examiner bias in the results, as shown in the study by Gu and cols. (148). In patients with hyperprolactinemia, most crosssectional studies were dedicated to investigating the role of CAB in HVD. A meta-analysis of seven observational studies with 1,398 individuals found an increased risk of mild-to-moderate tricuspid valve regurgitation in hyperprolactinemic patients taking CAB. No significant differences were observed in mitral or aortic valve regurgitation (149). Another recent systematic review analyzed data from 21 studies and from 40 patients followed by the authors (150). Utilizing the precise definition of CAB-associated valvulopathy as the triad of moderate or severe regurgitation associated with a restricted and thickened valve, clinically relevant disease was identified in only two out of 1,811 patients, resulting in a prevalence of 0.11% (150). The authors of this study also prospectively assessed 40 patients with prolactinoma taking cabergoline. Cardiovascular examination before echocardiography detected an audible systolic murmur in 10% of cases (all were functional murmurs), and no clinically significant valvular lesion was shown on echocardiogram in the 90% of patients without a murmur (150). A Brazilian study by Boguszewski and cols. (151) was the first to include a group of prolactinoma patients treated with BRC for comparison. Notably, a higher prevalence of trace tricuspid regurgitation was observed in patients taking BRC, while more prevalent 248

trace-to-mild tricuspid and trace mitral regurgitation and a higher mitral tent area were observed in CAB users; nevertheless, all these echocardiographic findings were not clinically significant (151). This observation was confirmed in a subsequent study in which an increased prevalence of subclinical HVD in patients with prolactinomas on long-term treatment with either BRC or CAB was reported (152). Beyond the cross-sectional investigations, longitudinal studies have shed light on the potential damage caused by DAs to cardiac valves. Delgado and cols. (153) followed patients with prolactinomas treated (n = 45) or not treated (n = 29) with CAB for 2 years and found an increased prevalence of valvular calcification in CAB users that was not accompanied by a higher prevalence of valvular dysfunction. Auriemma and cols. (154) concluded that 5 years of CAB therapy in prolactinomas does not increase the risk of significant cardiac valve regurgitation. Similarly, 19 patients with prolactinomas were followed in Curitiba, Brazil, during 5 years of continuous treatment with DAs. Neither a significant change in valvular regurgitation grades nor symptomatic disease was observed in the follow-up (155). Population-based studies have also confirmed the safety of CAB in endocrine patients. A nationwide cohort study carried out in Denmark did not support that hyperprolactinemia or its treatment is associated with an increased risk of clinically significant HVD (156). In a multi-country, nested case-control study involving data from the United Kingdom, Italy, and the Netherlands, CAB was associated with an increased risk of HVD in Parkinson’s disease but not in hyperprolactinemia (157), confirming the role of high cumulative doses in the development of valvular dysfunction and the safety of long-term use of low cumulative doses. In two studies involving 51 prolactinoma patients considered to be resistant to standard doses of CAB, no significant echocardiographic valve abnormalities were detected despite the use of doses ranging from 3 to 12 mg/week (99,110). The absence of a detrimental effect of CAB therapy on cardiac valves has also been noticed in a longitudinal study in patients with acromegaly (158). The findings of the abovementioned studies challenge the US Food and Drug Administration (FDA) advice that patients with prolactinoma treated with CAB should have an annual echocardiogram to screen for valvular heart disease. Of note, with Arch Endocrinol Metab. 2018;62/2

conventional doses of cabergoline, i.e., up to 2 mg/ week, usually used in patients with prolactinomas, there does not appear to be any increased risk of cardiac valve abnormalities (90,145,156). However, as it is uncertain at what dose level these valve effects become significant, some experts recommend assessing all patients receiving > 2 mg/week with an echocardiogram on a yearly basis (90). More recently, based on the findings of their systematic review, Caputo and cols. (150) proposed that such patients should be screened by a clinical cardiovascular examination and that echocardiograms should be reserved for patients with an audible murmur, those treated for more than 5 years at a dose of more than 3 mg per week, or those who maintain cabergoline treatment after the age of 50 years. Nevertheless, special attention should be given in interpreting echocardiographic findings in older individuals, as highlighted by some authors (146,147). Subclinical valvular abnormalities detected by echocardiography are not an indication for cessation of the therapy (121,154). Importantly, if valve lesions are detected or progress during follow-up, further evaluation is indicated to distinguish CAB-induced etiologies from other causes of valvulopathies. In such cases, therapy may be interrupted, reduced or maintained based on clinical judgment and discussion with the patient (121,150,154). COMMENT 9: Current available data do not support major concerns about the risk of valvulopathy in patients with hyperprolactinemia or other endocrine diseases who are chronically treated with DAs in standard doses. Thus, an echocardiogram evaluation would not be recommended for patients receiving cabergoline at doses up to 2 mg/week.

2.5 Withdrawal of the dopamine agonist â&#x20AC;&#x201C; Why, when, how and how often? Why, when and how? Although it is well known that prolactinomas respond very well to DAs, the optimal duration of treatment is still not clear (4,6,10). Despite the need for long-term therapy, withdrawal of treatment should be considered because of the adverse effects of medical treatment, potential long-term consequences in cardiac valves, and treatment costs (4,6,88). Arch Endocrinol Metab. 2018;62/2

Studies on persistent normoprolactinemia after DA withdrawal have been published since 1979 (159). In 2002, a Brazilian study by Passos and cols. (160) showed a remission rate of 20.6% after BCR discontinuation. In 2003, a landmark prospective study by Colao and cols. (161) demonstrated that CAB could be successfully withdrawn in 70% of patients with a MIC and 64% of those harboring a MAC (161). An extension of this study to 8 years documented remission rates of 66 and 47%, respectively (162). The higher success rates of this study were attributed to stricter selection criteria for CAB withdrawal, including a prolonged period of normoprolactinemia during treatment and a significant tumor size reduction (161,162). Since 2003, several studies have evaluated the recurrence rates of hyperprolactinemia after DA withdrawal with variable results (162-170). In a meta-analysis of 19 studies with a total of 743 patients, the overall remission rate after the withdrawal of DA therapy was only 21%, 32% for idiopathic hyperprolactinemia, 21% for microadenoma and 16% for macroprolactinomas (171). Furthermore, a higher rate of remission was found in studies in which CAB was used (35% in 4 studies) versus BRC (20% in 12 studies) (p = 0.07) (171). In studies lasting over 24 months of treatment, the remission was higher (34%) in comparison to studies with a shorter treatment duration (16%) (p = 0.01) (153). The remission rate was also higher in studies in which agreater than 50% reduction of the tumor was achieved in all patients prior to discontinuation of therapy (171). The guidelines provided by the Endocrine Society in 2011 recommended that patients who have attained normoprolactinemia for at least 2 years and who have no visible tumor remnant on MRI may be candidates for a gradual DA withdrawal (4). A meta-analysis from 2015 that only evaluated patients submitted to CAB withdrawal found that the hyperprolactinemia recurrence rate was 65% by a random effects meta-analysis (172). In a random effects meta-regression adjusting for optimal withdrawal strategies, a CAB dose reduced to the lowest level before withdrawal was associated with treatment success (p = 0.006), whereas CAB treatment longer than 2 years showed no trend of effect (p = 0.587). Patients who received the lowest CAB dose and presented a significant reduction in tumor size before withdrawal were more likely to benefit from CAB withdrawal (p < 0.001) (172). 249

Controversial issues in the management of hyperprolactinemia and prolactinomas

In three recent studies, the recurrence rates after CAB withdrawal ranged from 27% to 54% (168-170). Among 74 patients (19 MACs and 55 MICs) treated with CAB for â&#x2030;Ľ 3 years, recurrences occurred within 12 months in 34 (45.9%), regardless of the previous duration of CAB therapy (up to 3 yrs, 3 to 5 yrs or > 5 yrs) or initial adenoma size (168). Among 67 patients (23 MACs and 44 MICs), the overall recurrence rate was 54% (35% in cases of MIC and 64% in subjects with MAC) (169). A higher remission rate was found with CAB, compared to BCR (55% vs. 36%) (169). More recently, treatment discontinuation was evaluated in 11 patients with macroprolactinomas treated with CAB for at least 5 years (170). Recurrences of hyperprolactinemia were observed in 3 (27%) postwithdrawal patients at a median time of 3.0 (range; 2.911.2) months, indicating that a high percentage (73%) maintained remission for at least 12 months after CAB cessation (170).

How often? Two independent studies (173,174) have investigated the outcome of a second attempt at CAB withdrawal in patients with recurrence of hyperprolactinemia after the first withdrawal, receiving additional CAB therapy for at least 2 years. The results of these studies have demonstrated that a second attempt at CAB withdrawal after 2 additional years of therapy may be successful in approximately 30% of patients (173,174).

What are the predictors of remission? Several studies in the literature sought the predictors of remission after stopping DAs, but the results of these studies have been contradictory (4,6,10,19). Overall, parameters more often associated with a successful DA withdrawal include suppressed PRL levels, the use of low doses of CAB, and lack of a visible tumor on MRI before withdrawal. However, hyperprolactinemia recurrence was observed even in patients who presented with these parameters (168-172). In the great majority of studies, patients harboring MACs presented a lower risk of hyperprolactinemia remission than those with MICs when treatment is discontinued (161-169). The same was true when CAB and BCR were compared (167-169). In the series by Dogansen and cols. (169), the overall remission rate was 46% (65% in cases of MIC and 36% in subjects with MAC). A higher remission rate was experienced by 250

patients treated with CAB vs. BCR, for both MIC (86% vs. 56%) and MAC (45% vs. 27%), respectively (169). Menopause might be considered a factor that influences the reduction of PRL levels (175). Nevertheless, Colao and cols. (163) showed that the rate of recurrence of hyperprolactinemia was similar among premenopausal and postmenopausal patients. There are few studies showing that some patients may spontaneously normalize serum PRL concentrations after pregnancy. Auriemma and cols. (176) reported that pregnancy was associated with normalization of PRL levels in 68% of patients. Moreover, breastfeeding did not increase the recurrence rate of hyperprolactinemia (177). Thus, DA withdrawal has been suggested after pregnancy to assess the possibility of hyperprolactinemia remission (176,177). Previous pituitary surgery and radiotherapy also favor persistent normal PRL levels after DA withdrawal (4,6,88).

How long should patients be followedup after withdrawal? The follow-up after DA withdrawal has varied in different studies. Generally, the patients have been observed for 1 to 5 years after cessation of treatment (171,172). Most patients relapse within the first year, during which the patient should be subjected to a stricter monitoring of PRL levels (e.g., every 3 months) (164-169). In virtually all studies, all recurrences were observed within 24 months of DA discontinuation (162-173). In cases of hyperprolactinemia recurrence, the risk of tumor growth is very low (< 10%) (88,160,162,169). COMMENT 10: Following two years of treatment, cabergoline (CAB) withdrawal should be strongly considered in all patients with microprolactinomas and those with macroprolactinomas without visible tumor or harboring small tumor remnants, in the presence of PRL levels < 10 ng/mL and the use of the lowest dose of CAB. Before drug withdrawal, it is recommended to gradually taper the CAB dose.

2.6 What is the role of surgery for prolactinomas? Transsphenoidal surgery (TSS) represents the golden standard of surgical approach for both microprolactinomas and most macroprolactinomas (88), whereas craniotomy must be reserved for tumors inaccessible via the transsphenoidal approach and currently is indicated in extremely rare cases (6,88,178). Arch Endocrinol Metab. 2018;62/2

Controversial issues in the management of hyperprolactinemia and prolactinomas

Table 5. Indications for surgery in prolactinomas Increasing tumor size despite optimal medical therapy Pituitary apoplexy Intolerance to dopamine agonists Resistance to dopamine-agonists Persistent optic chiasm compression Cerebrospinal fluid leak during administration of dopamine agonists Adapted from Refs. 6, 10, and 19.

Efficacy The most important determinants of successful surgery for prolactinoma treatment are the experience of the neurosurgeon, moderately increased serum PRL levels (< 200 ng/mL), and tumor size and invasiveness (6,121). In a literature review involving more than 50 series, initial surgical remission, defined as the normalization of PRL levels, occurred on average in 74.7% and 34% of patients with microprolactinomas (MICs) and macroprolactinomas (MACs), with a recurrence rate of 18% and 23%, respectively (88). More recently, the analysis of surgical results from 13 published series, including at least 100 patients, has shown the control of PRL levels to be achieved in approximately 73% of 1211 microprolactinomas and 38% of 1480 macroprolactinomas (185). Notably, as shown in two recent studies (102,104), many patients with partial resistance to CAB achieve PRL normalization after surgical debulking, using a lower dose of CAB than the presurgical one. Arch Endocrinol Metab. 2018;62/2

Safety Complications from TSS for MIC are infrequent, the mortality rate being at most 0.6% and the major morbidity rate being approximately 3.4% (88,121). In patients with large tumors, particularly those with giant prolactinomas, the mortality rate ranges from 3.3% to 31.2% (88,121). Visual loss, stroke/ vascular injury, meningitis/abscess, oculomotor palsy and cerebrospinal fluid rhinorrhea have been reported to occur in 0.1%, 0.2%, 0.1%, 0.1% and 1.9% of cases, respectively (121,186-188). Transient diabetes insipidus (DI) is quite common with TSS for both micro- and macroadenomas (121). In contrast, permanent DI is rare and has been reported to occur in approximately 1% of surgeries on MACs (121,187,188). Hypopituitarism, commonly found in patients with macroadenomas before surgery as a consequence of mass effects, has been reported either to further worsen or to improve after surgery (102-104). COMMENT 11: Surgery, usually by the transsphenoidal approach, is indicated for patients with resistance or intolerance to dopamine agonists; macroprolactinomas with chiasmal compression and visual impairment without fast improvement by medical treatment; and acute tumor complications, such as symptomatic apoplexy or cerebrospinal fluid leakage.

2.7 What is the role of radiotherapy for prolactinomas? As prolactinomas are among the most radioresistant pituitary tumors, PRL normalization occurs in only approximately one-third of patients submitted to radiotherapy (RT) (88,189,190). Moreover, it is associated with a high risk of radiation-induced hypopituitarism at 10-20 years (121,191). Therefore, RT is only indicated to control tumor growth in DAresistant cases not controlled by surgery, as well as in the very rare cases of malignant prolactinomas (4,6,88). Historically, patients have been treated with both external beam radiotherapy and stereotactic techniques (189). External beam radiotherapy, also referred to as “conventional radiotherapy” (CRT), involves the use of multiple non-overlapping beams of X-rays that intersect over the target area (191). Stereotactic RT is a form of RT that uses stereotactic guidance to deliver high 251

Additional indications for TSS surgery are complications of the prolactinomas, particularly the management of symptomatic apoplexy (178) and the surgical repair of CSF leaks (179). The latter can occur spontaneously due to tumor invasion of the sphenoid sinus or result from a rapid tumor shrinkage induced by DA therapy (180-182). In a recent review, more than 90% of cases of cerebrospinal fluid leakage were related to the use of DA, with a mean time of 3.3 months between the start of drug administration and the diagnosis of rhinorrhea (182). However, this complication can also occur during long-term treatment (183). An additional strategy to CSF leakage would be the withdrawal of DA to allow tumor re-growth to stop the leak (181). As β2-transferrin is only found in CSF, its detection in nasal secretions is a very accurate tool for confirming the diagnosis of CSF rhinorrhea (179,184).

Controversial issues in the management of hyperprolactinemia and prolactinomas

doses of radiation in a single fraction (radiosurgery) or in multiple fractions (191).

Efficacy A comprehensive review of the literature regarding hormonal normalization in patients with prolactinomas treated with CRT or radiosurgery concluded that the overall normalization rate of both approaches seems to be similar (34.1% for CRT vs. 31.4% for radiosurgery) (88). In the series by Wan and cols. (190), of the 176 patients with prolactinomas submitted to gamma-knife radiosurgery, 23.3% achieved PRL normalization, whereas in 90.3%, the tumor volume decreased or remained unchanged. Stereotactic techniques deliver less radiation to normal brain and nerve tissue in the tumor vicinity. Thus, radiation-induced complications are thought to be less frequent with radiosurgery than with CRT (88,189,190). Moreover, a shorter time to hormonal normalization with radiosurgery has been reported in some series (189,191), but not in all (192). Currently, radiosurgery has been the recommended treatment option unless the tumor is larger than 3-4 cm, or within 3 mm of the optic nerves, chiasm or tracts (192). In this situation, patients should be offered CRT or, whenever possible, stereotactic RT in multiple fractions (88,189-191).

Safety The use of convention radiotherapy (CRT) is associated with the development of several severe complications (121). More than 50% of patients receiving pituitary radiotherapy will develop at least one anterior pituitary hormone deficiency within the following decade (193,194). Although hypopituitarism tends to arise in the first 5 years after radiation treatment, new deficiencies can appear even 20 years later (103,176,177). Additional complications of CRT include cerebrovascular accidents (CVAs), a second brain tumor and optic nerve injury. The incidence of CVA has been found to increase from the time of radiation, from 4% at 5 years to 11% at 10 years and 21% at 20 years (121,195). The cumulative risk of second brain tumors has been demonstrated to range from 2.0% at 10 yr, to 2.4% at 20 yr, and 8.5% at 30 yr (196). The rate of presumed radiation-induced optic neuropathy has been estimated to be 0.8% at 10 years (197). Another rare complication is radiation252

induced necrosis of the surrounding brain tissue, with a prevalence of approximately 0.2-0.8% (88,121). In patients receiving radiosurgery, hypopituitarism has been found to be the most common complication, occurring in approximately one-third of patients (121,198). Clinical deterioration due to visual field loss and worsened facial sensory loss, as well as a handful of cases of second brain malignancies have also been reported (88,191,199). These data suggest the greater safety of radiosurgery compared to CRT. However, further studies of large series and with long follow-ups are required to draw definitive conclusions (121). COMMENT 12: Due to its low efficacy and potentially severe side-effects, radiation therapy is only indicated to control tumor growth in DAresistant cases not controlled by surgery. Whenever possible, preference should be given to stereotactic techniques.

2.8 How giant prolactinomas should be managed? Although there is no consensus on the definition of giant prolactinomas (GPs), they are usually defined as tumors with a maximum diameter greater than or equal to 4 cm (200-202). GPs represent only 2-3% of all prolactinomas, and they are more commonly found in middle-aged men (200,201). These tumors are usually more aggressive in men than in women (203). GPs often cause visual field defects and/or ophthalmoplegia due to compression of the optic chiasm and/or cranial nerves, respectively, and headaches, as well as other neurological alterations and other atypical manifestations for a pituitary adenoma, such as orbital invasion, epistaxis or obstructive hydrocephalus (204-207). Panhypopituitarism may also be present. Therefore, formal visual testing is usually necessary, and pituitary function evaluation is mandatory (200,203). Different therapeutic approaches, such as dopamine agonists (DAs) alone or in combination with surgery and radiotherapy, may be necessary to reach the therapeutic goals in patients with GPs, which include tumor volume control, normalization of the PRL level and restoration of eugonadism (200). Temozolomide (TMZ) has been used in aggressive prolactinomas that are unresponsive to the abovementioned therapies Arch Endocrinol Metab. 2018;62/2

Controversial issues in the management of hyperprolactinemia and prolactinomas

(117-119). Due to the large tumor volume and commonly invasive behavior, control of mass effects should be a priority in the management of patients with giant prolactinomas (88).

Dopamine agonists As medical therapy in most cases causes a marked and rapid reduction of the tumor size, it is considered the first-line treatment option in patients with GPs, even in the presence of visual abnormalities. However, close monitoring of the visual field is mandatory (200-202). In this setting, early surgery (e.g., within 15 to 30 days) may occasionally be necessary if the tumors do not shrink and if severe visual field defects do not improve or even get worse (200-202). The use of DA for GPs seems to reduce significantly the tumor mass (> 30% decrease in tumor diameter or > 65% reduction in tumor volume) in 74% of the cases and to normalize the PRL level in 60% of the cases (200). Cabergoline (CAB) is the preferred DA for the medical management of GPs due to its greater efficacy and better tolerability compared to BCR (34,88). In the series by Espinosa and cols. (208), CAB treatment resulted in the normalization of PRL levels in 68% and in the reduction of > 50% in tumor volume in 87% of the GP patients. The composite goal of PRL normalization and > 50% tumor reduction was achieved by 55% of patients with GPs (n = 26) and by 66% of patients with no giant macroprolactinomas (n = 100) (p = 0.19) (208). Among GPs ≥ 6 cm, DA treatment achieved PRL normalization in 11/18 (61%) patients within a median interval of 20 months (209). In the series by Vilar and cols. (210), 10 of 16 patients (62.5%) reached PRL normalization at weekly doses ranging from 2.5 to 7 mg. Regarding DA withdrawal, there are no data in the literature about CAB withdrawal in patients with GPs. Concerning BRC withdrawn in these patients, some authors described the persistence of normoprolactinemia and tumor volume shrinkage in only a minority of patients (211-213).

considered for patients with severe visual field defects that do not show any improvement or even worsen during DA treatment. The transsphenoidal approach is usually the first choice, even for GPs (200). In patients with giant and invasive prolactinomas, surgery is hardly curative, regardless of the surgical technique employed or the neurosurgeon’s experience. Therefore, in these cases, the goal of surgery is to debulk the tumor in order to improve the symptoms related to mass effects (88,121). Debulking surgery may also improve the tumor response to DA therapy (102,104).

Radiotherapy Radiotherapy should be used in patients with GPs who do not achieve disease control with DA therapy and surgery, particularly regarding mass effects (200-202).

Temozolomide Temozolomide is an oral alkylating chemotherapeutic agent that exerts cytotoxic effects through methylation of DNA and can be used in aggressive giant prolactinomas that remain uncontrolled in terms of mass effects despite the multiple treatment modalities previously mentioned. The standard dose is 150–200 mg/m2 for 5 days, repeated every 28-days in a cycle (117,119). COMMENT 13: Cabergoline is the therapy of choice for patients with giant prolactinomas (GPs), as this drug enables normalization of prolactin levels and significant tumor reduction in the majority of cases, but higher doses are often required, compared to those for smaller macroprolactinomas. Surgery should be considered as part of the management of these patients, especially in patients who still have a large tumor load despite dopamine agonist therapy. Radiotherapy and/or temozolomide should be reserved for the subgroup of GPs that are not controlled in terms of mass effects regardless of the multiple conventional treatment modalities.

Neurosurgery should be considered as part of the multidisciplinary approach to patients with DAresistant prolactinoma (debulking surgery) or should be restricted to some acute complications such as apoplexy or leakage of cerebrospinal fluid during DA therapy (4,206,214). Neurosurgery could also be Arch Endocrinol Metab. 2018;62/2

2.9 How to manage the challenges involving prolactinomas and pregnancy? Chronic anovulation and infertility are very frequent among women with prolactinomas, mostly due to the hypogonadotropic hypogonadism related to hyperprolactinemia (6,10,88). Hyperprolactinemia 253

Surgery

Controversial issues in the management of hyperprolactinemia and prolactinomas

decreases the luteinizing hormone (LH) pulse amplitude and frequency through the suppression of GnRH (14). This effect appears to be mediated by an earlier step of suppressing the generation of kisspeptin, a protein made by neurons in the arcuate and periventricular nuclei of the hypothalamus, which stimulates GnRH release (215). PRL can also decrease estrogen and progesterone production through direct effects on the ovaries (216). Fertility is, however, restored in most women with the use of DA. In the absence of hormonal control in cases with microprolactinomas, clomiphene citrate or recombinant gonadotropins may be used for ovulation induction (216,217). During pregnancy, the primary concern is growth of the tumor because of high levels of estrogens, leading to visual disturbances and headache. The second point of concern is the fetal exposure to DA in early embryogenesis and the potential risk of malformations (216,217).

Tumor growth Prolactinomas can enlarge during pregnancy as a result of both the stimulatory effect of these high estrogen levels and the discontinuation of the dopamine agonist that might have caused tumor shrinkage (216). In microprolactinomas, the chance of clinically significant tumor growth is less than 5%; therefore, after pregnancy confirmation, DA can be withdrawn, and the patient should be monitored clinically every trimester. In contrast, in patients with macroadenomas, the risk of tumor growth with clinical repercussion is up to 35% (217). However, Holmgren and cols. (218) noted a reduced risk of tumor growth during preg nancy in patients treated with BRC for at least 12 months. Thus, in patients with expansive macroprolactinomas, it is mandatory to observe a tumor within the sellar boundaries and usually to wait at least 1 year under treatment with a DA (217,219).

DAs safety in the fetus BRC has been shown to cross the placenta in human studies (103); CAB has been shown to do so in animal models, but such data are lacking in humans (121,216). As a general approach in pregnancy, DAsare discontinued as soon as pregnancy is confirmed (216). Nevertheless, taking into account that CAB has a long half-life and can be detected in the circulation within 30 days after drug withdrawal, early fetal exposure is 254

unavoidable (217). Moreover, the experience with this drug is still limited compared to BRC: ~950 vs. ~6200 pregnancies induced by CAB and BRC, respectively (216). These facts are the rational for BRC preference in hyperprolactinemic women willing to become pregnant (217), as recommended by the Guidelines of the Endocrine Society, with BRC being the only authorized DA for pregnancy induction (4). However, in clinical practice, CAB has often been used for this purpose with no apparent damage to the fetus (216). The potential fetal malformation and impairment of the dopaminergic brain circuitry under DA use are a concern (216,217,219). Addressing this issue, Molitch (216) has compared outcomes data from 6239 pregnancies induced by BCR with 968 pregnancies induced by CAB and pregnancies in the US general population, regarding miscarriages, births at term, premature births, multiple pregnancies, and malformed newborns. Overall, no difference was found among the three groups (216). In the vast majority of cases, the DA was with drawn at up to 6 weeks of pregnancy. In the literature, there are only data on approximately 100 cases of BRC use throughout pregnancy, which have disclosed one case of undescended testis and one case of talipes deformity (217,220,221). Recently, a compilation of 15 pregnancies with the use of CAB during the entire pregnancy has shown 12 healthy babies and one fetal death by severe pre-eclampsia (222). Concerning the long follow-up of children conceived during BRC treatment, Bronstein followed up 70 children, during 12 to 240 months, and there was one case of idiopathic hydrocephalus, one child with tuberous sclerosis and another one with precocious pu berty (223). In two other studies (217,224), no impairment of physical development was observed. In four studies, the follow-ups of children con ceived on CAB were described. Bronstein (223) and Ono and cols. (225) did not find any abnormalities in five and 83 children followed for 41 months and 12 years, respectively. Lebbe and cols. (226) following 88 children described two cases of slight delay in verbal fluency and one case of difficulty in achieving complete conti nence. Moreover, Stalldecker and cols. (227) followed 61 children and found two cases of seizures and two cases of pervasive developmental disorder. In summary, BCR and CAB seem to be equally safe for the fetus; none of these drugs are apparently associated with increased risk for abortions or malformations, when used for pregnancy induction Arch Endocrinol Metab. 2018;62/2

Controversial issues in the management of hyperprolactinemia and prolactinomas

Microprolactinoma and intrasellar macroprolactinoma

Clinical follow-up each 3 months

Sellar MRI and PRL serum levels reassed after delivery

The best approach An algorithm proposed by Glezer and cols. (217) for the management of prolactinoma during pregnancy is shown is Figure 8. The DA should be withdrawn as soon as pregnancy is confirmed in patients with microadenomas or enclosed macroadenomas. Assessment of tumor shrink age in macroadenomas is mandatory before pregnancy allowance. In previously expanded or invasive tumors, the choice of BRC maintenance throughout pregnancy or its reintroduction if needed, or else the indication of previous surgical debulking, depends on the physician’s and patient’s decision (217). Patients with microprolactinomas (MICs) or enclosed macroprolactinomas (MACs) should be followed each trimester, with attention to headache and visual impairment (217). In the presence of those complaints, sellar MRI without contrast, preferably after the first trimester, should be performed, and BRC reintroduction is indicated if tumor growth is related to the clinical findings (217). In cases of BCR intolerance, CAB, although off-label, could be used instead (217,219,222). On the other hand, in patients with expanding MACs, DA maintenance throughout pregnancy should be evaluated by an expert (217,219). Clinical evaluation monthly and neuroophthalmological evalu ation each trimester are indicated. In patients with MICs or MACs experiencing symptoms related to mass effects and without improvement with clinical treatment, neuro surgery should be performed, preferably during the second trimester (216,217). An alternative approach might be delivery of the baby, if the pregnancy is sufficiently advanced (e.g., > 37 weeks) (216,217,219). Notably, during pregnancy, periodic checking of PRL levels is of no diagnostic benefit and can be misleading (216,217). Indeed, in normal women, PRL levels rise with gestation, but PRL levels do not always rise with tumor enlargement, and tumor enlargement can occur without a change in the PRL concentration (216). A rise in PRL may well not indicate tumor enlargement and therefore may cause unnecessary worry. By contrast, the lack of a rise in PRL may be falsely reassuring in a patient with headaches or other evidence of tumor enlargement (216). Arch Endocrinol Metab. 2018;62/2

Headache and/or visual impairment

Sellar MRI without contrast

BRC reintroduction

Medical treatment failure or apoplexy

Macroprolactinoma

Clinical follow-up each month + Neurophtalmologic evaluation 3/3 months

BRC mantainance evaluated in individual cases

Neurosurgery

Sellar MRI and PRL serum levels reassed after delivery

Figure 8. Algorithm suggested for the prolactinoma management during pregnancy (PRL: prolactin; BCR: bromocriptine; MRI: magnetic resonance imaging) (Adapted from Ref. 217).

Follow-up After pregnancy, PRL levels and tumor size should be reassessed because reduction, or even complete tumor disappearance, after pregnancy may occur. Moreover, asymptomatic tumor enlargement may occur during pregnancy (216,217). It has been suggested that high levels of estrogen during pregnancy can induce areas of tumor necrosis and apoptosis. The median rate of hyperprolactinemia remission after pregnancy in eight studies was 27%, ranging from 10 to 68% (217). Breastfeeding does not seem to be associated with tumor growth risk, and it is allowed in patients who did not require DA during pregnancy (216-219). COMMENT 14: In the large majority of cases, a dopamine agonist is only necessary to induce pregnancy and should be discontinued as soon as pregnancy is confirmed. Nevertheless, in selected cases harboring invasive macroprolactinomas or in patients with marked growth and visual and/ or headache complaints, the drug may be used throughout pregnancy. COMMENT 15: Bromocriptine and cabergoline seem to be equally safe for the fetus, when used for pregnancy induction. Indeed, short-term exposure to these drugs for less than 6 weeks of gestation has not been found to cause any increase in spontaneous abortions, ectopic pregnancies, trophoblastic disease, multiple pregnancies, or congenital malformations. 255

in infertile hyperprolactinemic women. Ideally, CAB should be discontinued 30 days before the conception (216,218,223).

Controversial issues in the management of hyperprolactinemia and prolactinomas

2.10 How to manage the psychotropic-induced hyperprolactinemia? It should always be kept in mind that patients with apparent psychotropic-induced hyperprolactinemia may have an alternative etiology for the PRL elevation, such prolactinomas, primary hypothyroidism, macroprolactinemia, or pseudo-prolactinoma (1). Ideally, a baseline PRL level should be obtained before starting psychotropic medications known to increase PRL, but in the majority of cases, this is not practically possible, particularly when these medications are started urgently (4,44). Endocrine Society Guidelines suggest discontinuing the drug for 3 days or substituting with an alternative drug if psychotropic-induced hyperprolactinemia is suspected and then remeasuring PRL (4). Nevertheless, the decision to withdraw or substitute the medication should always be made in consultation with the patientâ&#x20AC;&#x2122;s psychiatrist (4,46). If the drug cannot be safely withdrawn due to the risk of a relapse of psychiatric symptoms and if the onset of hyperprolactinemia does not coincide with the initiation of therapy, then pituitary MRI should be performed to exclude or diagnose a sellar region lesion (4,46). The different approaches proposed for symptomatic patients with confirmed psychotropic-induced hyperprolactinemia include (i) switching the offending drug to aripiprazole or other atypical antipsychotics (AAPs) with a low effect on PRL levels (41,209-211) and (ii) adding DA therapy (41).

Switching to aripiprazole or other AAPs Because the atypical antipsychotic aripiprazole is a partial D2 receptor agonist, it has a neutral effect on PRL levels and may often decrease them (46, 228). Thus, it may be used as alternative therapy for patients with antipsychotic-induced hyperprolactinemia (46,228). Other atypical antipsychotics, such as quetiapine, olanzapine, lurasidone, asenapine, or clozapine, cause only a mild elevation in PRL levels, and only in a subgroup of those treated (43,46). Therefore, these drugs may also serve as alternatives to antipsychotics with robust effects on PRL (e.g., risperidone) (43,46). However, in patients who are clinically very stable on antipsychotic treatment, switching to a different antipsychotic such as aripiprazole or other atypical antipsychotics may be inappropriate (46-48). In these cases, using aripiprazole as adjunctive therapy may be useful. Indeed, in a placebo-controlled trial, adjunctive 256

aripiprazole normalized drug-induced hyperprolactinemia in more than 80% of patients with schizophrenia (229). More recently, in a double-blind, randomized, placebocontrolled trial involving patients with risperidoneinduced hyperprolactinemia, normalization of PRL levels was encountered in 46% of patients who received adjunctive aripiprazole therapy (49). Very interestingly, aripiprazole therapy was recently shown to be effective in normalizing PRL levels and in reducing tumor size in two patients with microprolactinomas and psychotic symptoms (230,231).

Adding DA therapy The use of DA in the treatment of antipsychoticinduced hyperprolactinemia is not well studied (46,47). DA and antipsychotic medications may have opposing mechanisms of action. Indeed, the therapeutic effects of most antipsychotics come from D2 receptor antagonism (232,233). Thus, there is a concern that DA therapy may reduce the effectiveness of antipsychotic drugs and trigger relapse or exacerbation of psychosis (46). There is, however, little evidence to support this concern. For instance, Chang and cols. (234) reported a cabergolineinduced psychotic exacerbation in three schizophrenic patients when CAB was introduced for the treatment of the hyperprolactinemic symptoms. Likewise, Santos Andrade and cols. (235) described a similar situation when BCR was added for macroprolactinoma treatment in a patient with schizophrenia on haloperidol. By contrast, in 5 studies that involved 174 schizophrenic and bipolar patients and had a duration ranging from 8 weeks to 6 months, the association of dopamine antagonists with low doses of CAB or BCR for the treatment of hyperprolactinemic symptoms apparently did not impair the underlying psychiatric disorder (236-240). DA therapy should therefore be reserved for patients with severe hyperprolactinemia who fail to respond to aripiprazole as an alternative or adjunctive treatment. Due to its higher specificity for the D2 receptor, CAB would be preferable to BCR in the management of antipsychoticinduced hyperprolactinemia. Nevertheless, it should be used cautiously, in doses as low as possible (46). COMMENT 16: The best approach for symptomatic antipsychotic-induced hyperprolactinemia would be the use of aripiprazole as an alternative or adjunctive therapy. DA therapy at low doses can be used cautiously in patients who do not respond to the first approach. Arch Endocrinol Metab. 2018;62/2

Controversial issues in the management of hyperprolactinemia and prolactinomas

Disclosure: no potential conflict of interest relevant to this article was reported.

21. Sinha YN. Structural variants of prolactin: occurrence and physiological significance. Endocr Rev. 1995;16(3):354-69.

REFERENCES

22. Jackson RD, Wortsman J, Malarkey WB. Characterization of a large molecular weight prolactin in women with idiopathic hyperprolactinemia and normal menses. J Clin Endocrinol Metab. 1985;61(2):258-64.

1. Vilar L, Fleseriu M, Bronstein MD. Pitfalls in the diagnosis of hyperprolactinemia. Arq Bras Endocrinol Metab. 2014;58(1):9-22.

23. Jackson RD, Wortsman J, Malarkey WB. Macroprolactinemia presenting like a pituitary tumor. Am J Med. 1985;78(2):346-50. 24. Hattori N. The frequency of macroprolactinemia in pregnant women and the heterogeneity of its etiologies. J Clin Endocrinol Metab. 1996;81(2):586-90.

3. Bronstein MD. Disorders of prolactin secretion and prolactinomas. In: DeGroot LJ, Jameson JL, editors. Endocrinology. 6th ed. Philadelphia: Saunders/Elsevier; 2010. p. 333-57.

25. Cavaco B, Leite V, Santos MA, Arranhado E, Sobrinho LG. Some forms of big big prolactin behave as a complex of monomeric prolactin with an immunoglobulin G in patients with macroprolactinemia or prolactinoma. J Clin Endocrinol Metab. 1995;80(8):2342-6.

4. Melmed S, Casanueva FF, Hoffman AR, Kleinberg DL, Montori VM, Schlechte JA, et al. Diagnosis and treatment of hyperprolactinemia: An Endocrine Society clinical practice guideline. J Clin Endocrinol Metab. 2011;96(2):273-88.

26. Hattori N, Ikekubo K, Nakaya Y, Kitagawa K, Inagaki C. Immunoglobulin G subclasses and prolactin (PRL) isoforms in macroprolactinemia due to anti-PRL autoantibodies. J Clin Endocrinol Metab. 2005;90(5):3036-44.

5. Glezer A, Bronstein MD. Approach to the patient with persistent hyperprolactinemia and negative sellar imaging. J Clin Endocrinol Metab. 2012;97(7):2211-6.

27. Heffner LJ, Gramates LS,Yuan RW. A glycosylated prolactin species is covalently bound to immunoglobulin in human amniotic fluid. Biochem Biophys Res Commun. 1989;165(1):299-305.

6. Glezer A, Bronstein MD. Prolactinomas. Endocrinol Metab Clin N Am. 2015;44(1):71-8.

28. Thirunavakkarasu K, Dutta P, Sridhar S, Dhaliwal L, Prashad GR, Gainder S, et al. Macroprolactinemia in hyperprolactinemic infertile women. Endocrine. 2013;44(3):750-5.

7. Colao A, Lombardi G. Growth hormone and prolactin excess. Lancet. 1998;352:1455-61. 8. Ciccarelli A, Daly AF, Beckers A. The epidemiology of prolactinomas. Pituitary 2005;8(1):3-6.

29. Kasum M, Oreskovic S, Zec I, Jezek D, Tomic V, Gall V, et al. Macroprolactinemia: new insights in hyperprolactinemia. Biochem Med (Zagreb). 2012;22(2):171-9.

9. Daly AF, Rixhon M, Adam C, Dempegioti A, Tichomirowa MA, Beckers A. High prevalence of pituitary adenomas: a crosssectional study in the province of Liege, Belgium. J Clin Endocrinol Metab. 2006;91(12):4769-75.

30. Vilar L, Czepielewski MA, Naves LA, Rollin GA, Casulari LA, Coelho CE. Substantial shrinkage of adenomas cosecreting growth hormone and prolactin with use of cabergoline therapy. Endocr Pract. 2007;13(4):396-402.

10. Auriema R, Pivonello R, Colao A. Prolactinomas. In: Vilar L (editor). In: Vilar L, editor. Endocrinologia Clínica, 6a ed. (Clinical Endocrinology, 6th ed.). Rio de Janeiro: Guanabara Koogan; 2016. p. 15-29. 11. Colao A, Sarno AD, Cappabianca P, Briganti F, Pivonello R, Di Somma C, et al. Gender differences in the prevalence, clinical features and response to cabergoline in hyperprolactinemia. Eur J Endocrinol. 2003;148(3):325-31. 12. Fideleff HL, Boquete HR, Suárez MG, Azaretzky M. Prolactinoma in children and adolescents. Horm Res. 2009;72(4):197-205. 13. Heaney AP. Pituitary carcinoma: difficult diagnosis and treatment. J Clin Endocrinol Metab. 2011;96(12):3649-60. 14. Milenković L, D’Angelo G, Kelly PA, Weiner RI. Inhibition of gonadotropin hormone-releasing hormone release by prolactin from GT1 neuronal cell lines through prolactin receptors. Proc Natl Acad Sci USA. 1994;91(4):1244-7. 15. Buvat J, Lemaire A, Buvat-Herbaut M, Fourlinnie JC, Racadot A, Fossati P. Hyperprolactinemia and sexual function in men. Horm Res. 1985;22(3):196-203. 16. Corona G, Mannucci E, Fisher AD, Lotti F, Ricca V, Balercia G, et al. Effect of hyperprolactinemia in male patients consulting for sexual dysfunction. J Sex Med. 2007;4(5):1485-93. 17. Huang W, Molitch M. Evaluation and management of galactorrhea. Am Fam Physician. 2012;85(11):1073-80. 18. Sakiyama R, Quan M. Galactorrhea and hyperprolactinemia. Obstet Gynecol Surv. 1983;38(12):689-700.

31. Vieira JGH, Oliveira JH, Tachihana T, Maciel RMB, Hauache OM. Evaluation of plasma prolactin levels: is it necessary to rest before the collection? Arq Bras Endocrinol Metab. 2006;50(3):569-70. 32. Ferriani RA, Sá MFS. Effect of venipuncture stress on plasma prolactin levels. Int J Gynaecol Obstet. 1985;23(6):459-62. 33. Molitch ME. Disorders of prolactin secretion. Endocrinol Metab Clin North Am. 2001;30(3):585-610. 34. Vilar L, Freitas MC, Naves LA, Casulari LA, Azevedo M, Montenegro R Jr, et al. Diagnosis and management of hyperprolactinemia: results of a Brazilian multicenter study with 1234 patients. J Endocrinol Invest. 2008;31(5):436-44. 35. Rahmanian M, Meybodi HA, Larijani B, Mohajeri-Tehrani MR. Giantprolactinoma: case report and review of literature.J Diabetes Metab Disord. 2013;12(1):3. 36. Acharya SV, Gopal RA, Menon PS, Bandgar TR, Shah NS. Giantprolactinoma and effectiveness of medical management. Endocr Pract. 2010;16(1):42-6. 37. Fleseriu M, Lee M, Pineyro MM, Skugor M, Reddy SK, Siraj ES, et al. Giant invasive pituitary prolactinoma with falsely low serum prolactin: the significance of ‘hook effect’. J Neurooncol. 2006;79(1):41-3. 38. Barkan AL, Chandler WF. Giant pituitary prolactinoma with falsely low serum prolactin: the pitfall of the “high-dose hook effect”: case report. Neurosurgery. 1998;42(4):913-5.

19. Romijn JA. Hyperprolactinemia and prolactinoma.Handb Clin Neurol. 2014;124:185-95.

39. Frieze TW, Mong DP, Koops MK. “Hook effect” in prolactinomas: case report and review of literature. Endocr Pract. 2002;8(4):296303.

20. Suh HK, Frantz AG. Size heterogeneity of human prolactin in plasma and pituitary extracts. J Clin Endocrinol Metab. 1974;39(5):928-35.

40. Randall RV, Scheithauer BW, Laws, ER Jr, Abboud CF. Pseudoprolactinomas. Trans Am Clin Climatol Assoc. 1983; 94:114-21.

Arch Endocrinol Metab. 2018;62/2

257

2. Vilar L, Naves LA, Fleseriu M. Avaliação diagnóstica da hiperprolactinemia (Diagnostic evaluation of hyperprolactinemia). In: Vilar L, editor. Endocrinologia Clínica, 6a ed. (Clinical Endocrinology, 6th ed.). Rio de Janeiro: Guanabara Koogan; 2016. p. 3-14.

Controversial issues in the management of hyperprolactinemia and prolactinomas

41. Karavitaki N, Thanabalasingham G, Shore HC, Trifanescu R, Ansorge O, Meston N, et al. Do the limits of serum prolactin in disconnection hyperprolactinaemia need re-definition? A study of 226 patients with histologically verified non-functioning pituitary macroadenoma. Clin Endocrinol (Oxf). 2006;65(4):524-9. 42. Vilar L, Albuquerque JL, Vilar CF, Ferreira LA, Cardoso IRA, Inacio IS, et al. Demographic, clinical, and laboratorial features of 770 patients with hyperprolactinemia. Arch Endocrinol Metab. 2017; 61 (Suppl. 3):S11. 43. Voicu V, Medvedovici A, Ranetti AE, Rădulescu FŞ. Druginduced hypo- and hyperprolactinemia: mechanisms, clinical and therapeutic consequences. Expert Opin Drug Metab Toxicol. 2013;9(8):955-68. 44. La Torre D, Falorni A. Pharmacological causes hyperprolactinemia. Ther Clin Risk Manag. 2007;3(5):929-51.

45. Petit A, Piednoir D, Germain ML, Trenque T. Drug-induced hyperprolactinemia: a case-non-case study from the national pharmacovigilance database. Therapie. 2003;58(2):159-63. 46. Johnsen E, Kroken RA, Abaza M, Olberg H, Jørgensen HA. Antipsychotic- induced hyperprolactinemia: a cross-sectional survey. J Clin Psychopharmacol. 2008;28(6):686-90.

62. Guay AT, Sabharwal P, Varma S, Malarkey WB. Delayed diagnosis of psychological erectile dysfunction because of the presence of macroprolactinemia. J Clin Endocrinol Metab. 1996;81(7):2512-4. 63. Vieira JGH, Tachibana TT, Obara LH, Maciel RMB. Extensive experience and validation of polyethylene glycol precipitation as a screening method for macroprolactinemia. Clin Chem. 1998;44(8):1758-9. 64. Smith TP, Suliman AM, Fahie-Wilson MN, McKenna TJ. Gross variability in the detection of prolactin in sera containing big big prolactin (macroprolactin) by commercial immunoassays. J Clin Endocrinol Metab. 2002;87(12):5410-5. 65. Vieira JGH, Tachibana TT, Ferrer CM, de Sá J, Biscolla RP, Ana Hoff AO, et al. Hyperprolactinemia: new assay more specific for the monomeric form does not eliminate screening for macroprolactin with polyethylene glycol precipitation. Arq Bras Endocrinol Metab. 2010;54(9):856-62.

LB. Psychotropic-induced review. Psychosomatics.

66. Bjøro T, Mørkrid L, Wergeland R, Turter A, Kvistborg A, Sand T, Torjesen P. Frequency of hyperprolactinaemia due to large molecular weight prolactin (150-170 kD PRL).Scand J Clin Lab Invest. 1995;55(2):139-47.

48. Kunwar AR, Megna JL. Resolution of risperidone-induced hyperprolactinemia with substitution of quetiapine. Ann Pharmacother. 2003;37(2):206-8.

67. Hattori N, Ishihara T, Saiki Y. Macroprolactinaemia: prevalence and aetiologies in a large group of hospital workers. Clin Endocrinol (Oxf). 2009;71(5):702-8.

49. Shim JC, Shin JG, Kelly DL, Jung DU, Seo YS, Liu KH, et al. Adjunctive treatment with a dopamine partial agonist, aripiprazole, for antipsychotic-induced hyperprolactinemia:a placebo-controlled trial. Am J Psychiatry. 2007;164(9):1404-10.

68. Fahie-Wilson MN, Soule SG. Macroprolactinemia contribution to hyperprolactinemia in a district general hospital and evaluation of a screening test based on precipitation with polyethylene glycol. Ann Clin Biochem. 1997;34:252-8.

50. Papakostas GI, Miller KK, Petersen T, Sklarsky KG, Hilliker SE, Klibanski A, et al. Serum prolactin levels among outpatients with major depressive disorders during the acute phase of treatment with fluoxetine. J Clin Psychiatry. 2006;67(6):952-7.

69. Vallette-Kasic S, Morange-Ramos I, Selim A, Gunz G, Morange S, Enjalbert A, et al. Macroprolactinemia revisited: a study on 106 patients. J Clin Endocrinol Metab. 2002;87(2):581-8.

47. Ajmal A, Joffe H, Nachtigall hyperprolactinemia: a clinical 2014;55(1):29-36

51. Vilar L, Lyra R, Albuquerque JL, Lyra R, Vilar CF, Diniz ET, et al. Very high prolactin levels associated to chronic therapy with domperidone. Arch Endocrinol Metab. 2016;60 (Suppl. 3):S22. 52. St-Jean E, Blain F, Comtois R. High prolactin levels may be missed by immunoradiometric assay in patients with macroprolactinomas. Clin Endocrinol (Oxf). 1996;44(3):305-9. 53. Stenman UH. Pitfalls in hormone determinations. Best Pract Res Clin Endocrinol Metab. 2013;27(6):743-4. 54. do Carmo Dias Gontijo M, de Souza Vasconcellos L, RibeiroOliveira A Jr. Hook effect and linear range in prolactin assays: distinct confounding entities.Pituitary. 2016;19(4):458-9. 55. Glezer A, Soares CR, Vieira JG, Giannella-Neto D, Ribela MT, Goffin V, et al. Human macroprolactin displays low biological activity via its homologous receptor in a new sensitive bioassay. J Clin Endocrinol Metab. 2006;91(3):1048-55. 56. Gibney J, Smith TP, McKenna TJ. The impact on clinical practice of routine screening for macroprolactin.J Clin Endocrinol Metab. 2005;90(7):3927-32. 57. Leite V, Cosby H, Sobrinho LG, Fresnoza MA, Santos MA, Friesen HG. Characterization of big, big prolactin in patients with hyperprolactinaemia. Clin Endocrinol (Oxf). 1992;37(4):365-72. Copyright© AE&M all rights reserved.

61. Hayashida SA, Marcondes JA, Soares JM Jr, Rocha MP, Barcellos CR, Kobayashi NK, et al. Evaluation of macroprolactinemia in 259 women under investigation for polycystic ovary syndrome. Clin Endocrinol (Oxf). 2014;80(4):616-8.

58. Hauache OM, Rocha AJ, Maia AC Jr, Maciel RM, Vieira JG. Screening for macroprolactinaemia and pituitary imaging studies. Clin Endocrinol (Oxf). 2002;57(3):327-31. 59. Bronstein MD. Editorial: is macroprolactinemia just a diagnostic pitfall? Endocrine. 2012;41(2):169-70. 60. Hattori N, Nakayama Y, Kitagawa K, Ishihara T, Saiki Y, Inagaki C. Anti-prolactin (PRL) autoantibody-binding sites (epitopes) on PRL molecule in macroprolactinemia. J Endocrinol. 2006;190(2):287-93.

258

70. Strachan MW, Teoh WL, Don-Wauchope AC, Seth J, Stoddart M, Beckett GJ. Clinical and radiological features of patients with macroprolactinaemia. Clin Endocrinol (Oxf). 2003;59(3):339-46. 71. Theunissen C, De Schepper J, Schiettecatte J, Verdood P, Hooghe-Peeters EL, Velkeniers B. Macroprolactinemia: clinical significance and characterization of the condition. Acta Clin Belg. 2005;60(4):190-7. 72. Bağdatoğlu C, Bağdatoğlu OT, Muslu N, Köseoğlu A, Dağtekin A, Polat G, et al. The importance of macroprolactinemia in the differential diagnosis of hyperprolactinemic patients. Turk Neurosurg. 2008;18(3):223-7. 73. Donadio F, Barbieri A, Angioni R, Mantovani G, Beck-Peccoz P, Spada A, et al. Patients with macroprolactinaemia: clinical and radiological features. Eur J Clin Invest. 2007;37(7):552-7. 74. Isik S, Berker D, Tutuncu YA, Ozuguz U, Gokay F, Erden G, et al. Clinical and radiological findings in macroprolactinemia. Endocrine. 2012;41(2):327-33. 75. Parlant-Pinet L, Harthé C, Roucher F, Morel Y, Borson-Chazot F, Raverot G, et al. Macroprolactinaemia: a biological diagnostic strategy from the study of 222 patients. Eur J Endocrinol. 2015;172(6):687-95. 76. Vilar L, Moura E, Canadas V, Gusmão A, Campos R, Leal E, et al. Prevalence of macroprolactinemia among 115 patients with hyperprolactinemia. Arq Bras Endocrinol Metab. 2007;51(1):86-91. 77. Fahie-Wilson M. The macroprolactinemiaproblem and its solution. South Med J. 2006;99(11):1206. 78. Shimatsu A, Hattori A. Macroprolactinemia: diagnostic, clinical, and pathogenic significance. Clin Dev Immunol. 2012;2012:167132. 79. Leaños-Miranda A, Ramírez-Valenzuela KL, Campos-Galicia I, Chang-Verdugo R, Chinolla-Arellano LZ. Frequency of Arch Endocrinol Metab. 2018;62/2

Controversial issues in the management of hyperprolactinemia and prolactinomas

80. de Soárez PC, Souza SC, Vieira JG, Ferraz MB. The effect of identifying macroprolactinemia on health-care utilization and costs in patients with elevated serum prolactin levels. Value Health. 2009;12(6):930-4. 81. Vilar L, Gadelha PS, Rangel Filho F, Siqueira A, Viana KF, Fonseca MM, et al. Prevalence of macroprolactinemia among patients with idiopathic hyperprolactinemia. Arq Bras Endocrinol Metab. 2014;58 (Suppl 1):S17-18. 82. Hattori N, Adachi T, Ishihara T, Shimatsu A. The natural history of macroprolactinaemia. Eur J Endocrinol. 2012;166(4):625-9. 83. Vilar L, Naves LA, Freitas MC, Lima M, Canadas V, Albuquerque JL, et al. Clinical and laboratory features greatly overlap in patients with macroprolactinemia or monomeric hyperprolactinemia. Minerva Endocrinol. 2007;2(2):79-86. 84. Vilar L, Vilar CF, Albuquerque JL, Gadelha PS, Thé AC, Trovão E, et al. Clinical and MRI findings among 120 patients with macroprolactinemia: results from a prospective study. Arch Endocrinol Metab. 2017;61 (Suppl. 3):S8. 85. Elenkova A, Genov N, Abadzhieva Z, Kirilov G, Vasilev V, Kalinov K, et al. Macroprolactinemia in patients with prolactinomas: prevalence and clinical significance. Exp Clin Endocrinol Diabetes. 2013;121(4):201-5. 86. dos Santos Nunes V, El Dib R, Boguszewski CL, Nogueira CR. Cabergoline versus bromocriptine in the treatment of hyperprolactinemia: a systematic review of randomized controlled trials and meta-analysis. Pituitary. 2011;14(3):259-65. 87. Webster J, Piscitelli G, Polli A, Ferrari CI, Ismail I, Scanlon MF. A comparison of cabergoline and bromocriptine in the treatment of hyperprolactinemic amenorrhea. Cabergoline Comparative Study Group. N Engl J Med. 1994;331(14):904-9. 88. Gillam MP, Molitch MP, Lombardi G, Colao A. Advances in the treatment of prolactinomas. Endocr Rev. 2006;27(5):485-534. 89. Molitch ME. Pharmacologic resistance in prolactinoma patients. Pituitary. 2005;8(1):43-52.

respond to chronic cabergoline treatment. J Clin Endocrinol Metab. 1997;82(3):876-83. 98. Iyer P, Molitch ME. Positive prolactin response to bromocriptine in two patients with cabergoline resistant prolactinomas. Endocr Pract. 2011;17(3):e55-8. 99. Ono M, Miki N, Kawamata T, Makino R, Amano K, Seki T, et al. Prospective study of high-dose cabergoline treatment of prolactinomas in 150 patients. J Clin Endocrinol Metab. 2008; 93(12):4721-7. 100. Di Sarno A, Landi ML, Marzullo P, Di Somma C, Pivonello R, Cerbone G, et al. The effect of quinagolide and cabergoline, two selective dopamine receptor type 2 agonists, in the treatment of prolactinomas. Clin Endocrinol (Oxf). 2000; 53(1):53-60. 101. Vilar L, Vilar C, Albuquerque JL, Gadelha P,Thé AC, Trovão E, et al. The use of increasing doses of cabergoline in the management of cabergoline-resistant prolactinomas. Endocrine Abstracts. 2017;49:EP975. 102. Primeau V, Raftopoulos C, Maiter D.Outcomes of transsphenoidal surgery in prolactinomas: improvement of hormonal control in dopamine agonist-resistant patients. Eur J Endocrinol. 2012;166(5):779-86. 103. Hamilton DK, Vance ML, Roulos PT, Laws ER. Surgical outcomes in hyporesponsive prolactinomas: analysis of patients with resistance or intolerance to dopamine agonists. Pituitary. 2005;8(1):53-60. 104. Vrooner L, Jaffrain-Rea M-L, Petrossians P, Tamagno G, Chanson P, Vilar L, et al. Prolactinomas resistant to standard doses of cabergoline: a multicenter study of 92 patients. Eur J Endocrinol. 2012;167(5):651-62. 105. Maurer RA. Estradiol regulates the transcription of the prolactin gene. J Biol Chem. 1982;257(5):2133-6. 106. Lloyd GM, Meares JD, Jacobi J. Effects of oestrogen and bromocriptine on in vivo secretion and mitosis in prolactin cells. Nature. 1975;255(5508):497-8. 107. Pasqualini C, Bojda F, Kerdelhue B. Direct effect of estradiol on the number of dopamine receptors in the anterior pituitary of ovariectomized rats. Endocrinology. 1986;119(6):2484-9.

90. Molitch ME. Management of medically refractory prolactinoma.J Neurooncol. 2014;117(3):421-8.

108. Aoki MDP, Aoki A, Maldonado CA. Sexual dimorphism of apoptosis in lactotrophs induced by bromocryptine. Histochem Cell Biol. 2001;116(3):215-22.

91. Vilar L, Burke CW. Quinagolide efficacy and tolerability in hyperprolactinaemic patients who are resistant to or intolerant of bromocriptine. Clin Endocrinol (Oxf). 1994;41(6):821-6.

109. Lamberts SWJ, Verleun T, Oosterom R. Effect of tamoxifen administration on prolactin release by invasive prolactin-secreting pituitary adenomas. Neuroendocrinology. 1982;34(5):339-42.

92. Passos VQ, Fortes MAHZ, Giannella-Neto D, Bronstein MD. Genes differentially expressed in prolactinomas responsive and resistant to dopamine agonists. Neuroendocrinology. 2009;89(2):163-70.

110. Vilar L, Vilar CF, Aroucha PT, Albuquerque JL, Gadelha PS, Thé AC, et al. The role ofclomiphene citrate in the resolution of hypogonadism in male patients with prolactinomas under cabergoline therapy. Arch Endocrinol Metab. 2017;61 (Suppl. 3):S28.

93. Shimazu S, Shimatsu A, Yamada S, Inoshita N, Nagamura Y, Usui T, et al. Resistance to dopamine agonists in prolactinoma is correlated with reduction of dopamine D2 receptor long isoform mRNA levels. Eur J Endocrinol. 2012;166(3):383-90. 94. Hurel SJ, Harris PE, McNicol AM, Foster S, Kelly WF, Baylis PH. Metastatic prolactinoma: effect of octreotide, cabergoline, carboplatin and etoposide; immunocytochemical analysis of proto-oncogene expression. J Clin Endocrinol Metab. 1997;82(9):2962-5.

111. Ribeiro RS, Abucham J. Recovery of persistent hypogonadism by clomiphene in males with prolactinomas under dopamine agonist treatment. Eur J Endocrinol. 2009;161(1):163-9. 112. Gillam MP, Middler S, Freed DJ, Molitch ME. The novel use of very high doses of cabergoline and a combination of testosterone and an aromatase inhibitor in the treatment of a giant prolactinoma. J Clin Endocrinol Metab. 2002;87(10):4447-51.

95. Prior JC, Cox TA, Fairholm D, Kostashuk E, Nugent R. Testosterone-related exacerbation of a prolactin-producing macroadenoma: possible role for estrogen. J Clin Endocrinol Metab. 1987;64(2):391-4.

113. Fusco A, Lugli F, Sacco E, Tilaro L, Bianchi A, Angelini F, et al. Efficacy of the combined cabergoline and octreotide treatment in a case of a dopamine-agonist resistant macroprolactinoma. Pituitary. 2011;14(4):351-7.

96. Olafsdottir A, Schlechte J. Management of resistant prolactinomas. Nat Clin Pract Endocrinol Metab. 2006;2(10):552-61.

114. Vilar L, Vilar C, Albuquerque JL, Gadelha P, Thé AC, Trovão E, et al. Effect of the addition of lanreotide autogel to the treatment of an aggressive prolactinoma – a case report. Endocrine Abstracts. 2017;49:EP841.

97. Colao A, DiSarno A, Sarnacchiaro F, Ferone D, DiRenzo G, Merola B, et al. Prolactinomas resistant to standard dopamine agonists Arch Endocrinol Metab. 2018;62/2

259

macroprolactinemia in hyperprolactinemic women presenting with menstrual irregularities, galactorrhea, and/or infertility: etiology and clinical manifestations. Int J Endocrinol. 2013;2013:478282.

Controversial issues in the management of hyperprolactinemia and prolactinomas

115. Jaquet P, Qouafik L, Saveanu A, Gunz G, Fina F, Dufour H, et al. Quantitative and functional expression of somatostatin receptor subtypes in human prolactinomas. J Clin Endocrinol Metab. 1999;84(9):3268-76. 116. Bruns C, Lewis I, Briner U, Meno-Tetang G, Weckbecker G. SOM230: a novel somatostatin peptidomimetic with broad somatotropin release inhibiting factor (SRIF) receptor binding and a unique antisecretory profile. Eur J Endocrinol. 2002;146(5):707-16. 117. Halevy C, Whitelaw BC. How effective is temozolomide for treating pituitary tumours and when should it be used? Pituitary.2017;20(2):261-6.

135. Barake M, Evins AE, Stoeckel L, Pachas GN, Nachtigall LB, Miller KK, et al. Investigation of impulsivity in patients on dopamine agonist therapy for hyperprolactinemia: a pilot study. Pituitary. 2014;17(2):150-6.

118. Ji Y, Vogel RI, Lou E. Temozolomide treatment of pituitary carcinomas and atypical adenomas: systematic review of case reports. Neurooncol Pract. 2016;3(3):188-95.

136. 136.Hoffmeyer S, Burk O, von Richter O, Arnold HP, Brockmoller J, Johne A, et al. Functional polymorphisms of the human multidrug-resistance gene: multiple sequence variations and correlation of one allele with P-glycoprotein expression and activity in vivo. Proc Natl Acad Sci U S A. 2000;97(7):3473-8.

119. Whitelaw BC, Dworakowska D, Thomas NQ, Barazi S, RiordanEva P, King AP, et al. Temozolomide in the management of dopamine agonist-resistant prolactinomas. Clin Endocrinol (Oxf). 2012;76(6):877-86.

137. Athanasoulia AP, Sievers C, Ising M, Brockhaus AC, Yassouridis A, Stalla GK, et al. Polymorphisms of the drug transporter gene ABCB1 predict side effects of treatment with cabergoline in patients with PRL adenomas. Eur J Endocrinol. 2012;167(3):327-35.

120. Jouanneau E, Wierinckx A, Ducray F, Favrel V, Borson-Chazot F, Honnorat J, et al. New targeted therapies in pituitary carcinoma resistant to temozolomide. Pituitary. 2012;15(1):37-43.

138. Zanettini R, Antonini A, Gatto G, Gentile R, Tesei S, Pezzoli G. Valvular heart disease and the use of dopamine agonists for Parkinson’s disease. N Engl J Med. 2007;356(1):39-46.

121. Auriemma RS, Grasso LF, Pivonello R, Colao A. The safety of treatments for prolactinomas. Expert Opin Drug Saf. 2016;15(4):503-12.

139. Schade R, Andersohn F, Suissa S, Haverkamp W, Garbe E. Dopamine agonists and the risk of cardiac-valve regurgitation. N Engl J Med. 2007;356(1):29-38.

122. National Library of Medicine. Daily Med Current Medication Information. 2010 Available from: http://dailymed.nlm.nih.gov/ dailymed/drugInfo.cfm?id=31309. Accessed on: April 7, 2017.

140. Tran T, Brophy JM, Suissa S, Renoux C. Risks of cardiac valve regurgitation and heart failure associated with ergot- and nonergot-derived dopamine agonist use in patients with Parkinson’s disease: asystematic review of observational studies. CNS Drugs. 2015;29(12):985-98.

123. Yüksel RN, Elyas Kaya Z, Dilbaz N, Cingi Yirün M. Cabergolineinduced manic episode: case report. Ther Adv Psychopharmacol. 2016;6(3):229-23. 124. Voon V, Reynolds B, Brezing C, Gallea C, Skaljic M, Ekanayake V, et al. Impulsive choice and response in dopamine agonistrelated impulse control behaviors. Psychopharmacology (Berl). 2010;207(4):645-59. 125. Rovera C, Cremaschi L, Thanju A, Fiorentini A, Mauri MC, Serati M. Cabergoline can induce mania with psychotic features in bipolar I disorder: a case report. Asian J Psychiatr. 2016;22:94-5. 126. Bilal L, Ching C. Cabergoline-induced psychosis in a patient with undiagnosed depression.J Neuropsychiatry Clin Neurosci. 2012;24(4):E54. 127. Samuel M, Rodriguez-Oroz M, Antonini A, Brotchie JM, Ray Chaudhuri K, Brown RG, et al. Management of impulse control disorders in Parkinson’s disease: Controversies and future approaches. Mov Disord. 2015;30(2):150-9. 128. Martinkova J, Trejbalova L, Sasikova M, Benetin J, Valkovic P. Impulse control disorders associated with dopaminergic medication in patients with pituitary adenomas. Clin Neuropharmacol. 2011;34(5):179-81. 129. Harris YT, Harris AZ, Deasis JM, Ferrando SJ, Reddy N, Young RC. Cabergoline associated with first episode mania. Psychosomatics. 2012;53(6):595-600. 130. Davie M. Pathological gambling associated with cabergoline therapy in a patient with a pituitary prolactinoma. J Neuropsychiatry Clin Neurosci. 2007;19(4):473-4.

134. Bancos I, Nannenga MR, Bostwick JM, Silber MH, Erickson D, Nippoldt TB. Impulse control disorders in patients with dopamine agonist-treated prolactinomas and nonfunctioning pituitary adenomas: a case-control study. Clin Endocrinol (Oxf). 2014;80(6):863-8.

131. Falhammar H, Yarker JY. Pathological gambling and hypersexuality in cabergoline-treated prolactinoma. Med J Aust. 2009;190(2):97. 132. Bilal L, Ching C. Cabergoline-induced psychosis in a patient with undiagnosed depression. J Neuropsychiatry Clin Neurosci. 2012;24(4):E54. 133. Almanzar S, Zapata-Vega MI, Raya JA. Dopamine agonistinduced impulse control disorders in a patient with prolactinoma. Psychosomatics. 2013;54(4):387-91.

260

141. Roth BL. Drugs and valvular heart disease. N Engl J Med. 2007;356(1):6-9. 142. Elangbam, C.S. Drug-induced valvulopathy: an update. Toxicol Pathol. 2010;38(6):837-48. 143. Serratrice J, Disdier P, Habib G, Viallet F, Weiller PJ. Fibrotic valvular heart disease subsequent to bromocriptine treatment. Cardiol Rev. 2002;10(6):334-6. 144. Tan LC, Ng KK, Au WL, Lee RK, Chan YH, Tan NC. Bromocriptine use and the risk of valvular heart disease. Mov Disord. 2009;24(3):344-9. 145. Valassi E, Klibanski A, Biller BM. Potential cardiac valve effects of dopamine agonists in hyperprolactinemia. J Clin Endocrinol Metab. 2010;95(3):1025-33. 146. Choong CY, Abascal VM, Weyman J, Levine RA, Gentile F, Thomas JD, et al. Prevalence of valvular regurgitation by Doppler echocardiography in patients with structurally normal hearts by two-dimensional echocardiography. Am Heart J. 1989;117(3):636-42. 147. Okura H, Takada Y, Yamabe A, Ozaki T, Yamagishi H, Toda I, et al. Prevalence and correlates of physiological valvular regurgitation in healthy subjects. Circ J. 2011;75(11):2699-704. 148. Gu H, Luck S, Carroll PV, Powrie J, Chambers J. Cardiac valve disease and low-dose dopamine agonist therapy: an artefact of reporting bias? Clin Endocrinol (Oxf). 2011;74(5):608-10. 149. De Vecchis R, Esposito C, Ariano C. Cabergoline use and risk of fibrosis and insufficiency of cardiac valves. Meta-analysis of observational studies. Herz. 2013;38(8):868-80. 150. Caputo C, Prior D, Inder WJ.The need for annual echocardiography to detect cabergoline-associated valvulopathy in patients with prolactinoma: a systematic review and additional clinical data. Lancet Diabetes Endocrinol. 2015;3(11):906-13. 151. Boguszewski CL, dos Santos CM, Sakamoto KS, Marini LC, de Souza AM, Azevedo M. A comparison of cabergoline and bromocriptine on the risk of valvular heart disease in patients with prolactinomas. Pituitary. 2012;15(1):44-9. Arch Endocrinol Metab. 2018;62/2

Controversial issues in the management of hyperprolactinemia and prolactinomas

152. Elenkova A, Shabani R, Kalinov K, Zacharieva S. Increased prevalence of subclinical cardiac valve fibrosis in patients with prolactinomas on long-term bromocriptine and cabergoline treatment. Eur J Endocrinol. 2012;167(1):17-25.

168. Sala E, Bellaviti Buttoni P, Malchiodi E, Verrua E, Carosi G, et al. Recurrence of hyperprolactinemia following dopamine agonist withdrawal and possible predictive factors of recurrence in prolactinomas. J Endocrinol Invest. 2016;39(12):1377-82.

153. Delgado V, Biermasz NR, van Thiel SW, Ewe SH, Marsan NA, Holman ER, et al. Changes in heart valve structure and function in patients treated with dopamine agonists for prolactinomas, a 2-year follow-up study. Clin Endocrinol (Oxf). 2012;77(1):99-105.

169. Dogansen SC, Selcukbiricik OS,Tanrikulu S,Yarman S. Withdrawal of dopamine agonist therapy in prolactinomas: In which patients and when? Pituitary. 2016;19(3):303-10.

155. Zaccaron BA, Sena RH, Souza AM, Boguszewski CL. Safety of long-term treatment with dopamine agonists on valvular heart disease in patients with prolactinomas. Arq Bras Endocrinol Metab. 2014;58(Suppl 5):S172. 156. Steffensen C, Maegbaek ML, Laurberg P, Andersen M, Kistorp CM, Norrelund H, et al. Heart valve disease among patients with hyperprolactinemia: a nationwide population-based cohort study. J Clin Endocrinol Metab. 2012;97(5):1629-34. 157. Trifirò G, Mokhles MM, Dieleman JP, van Soest EM, Verhamme K, Mazzaglia G, et al. Risk of cardiac valve regurgitation with dopamine agonist use in Parkinson’s disease and hyperprolactinaemia: a multi-country, nested case-control study. Drug Saf. 2012;35(2):159-71. 158. Maione L, Garcia C, Bouchachi A, Kallel N, Maison P, Salenave S, et al. No evidence of a detrimental effect of cabergoline therapy on cardiac valves in patients with acromegaly. J Clin Endocrinol Metab. 2012;97(9):E1714-E19. 159. Eversmann T, Fahlbusch R, Rjosk HK, von Werder K. Persisting suppression of prolactin secretion after long-term treatment with bromocriptine in patients with prolactinomas. Acta Endocrinol (Copenh). 1979;92(3):413-27. 160. Passos VQ, Souza JJ, Musolino NR, Bronstein MD. Longterm follow-up of prolactinomas: normoprolactinemia after bromocriptine withdrawal. J Clin Endocrinol Metab. 2002; 87(8):3578-82. 161. Colao A, Di Sarno A, Cappabianca P, Di Somma C, Pivonello R, Lombardi G. Withdrawal of long-term cabergoline therapy for tumoral and nontumoral hyperprolactinemia. N Engl J Med. 2003;349(21):2023-33. 162. Colao A, Di Sarno A, Guerra E, Pivonello R, Cappabianca P, Caranci F, et al. Predictors of remission of hyperprolactinaemia after longterm withdrawal of cabergoline therapy. Clin Endocrinol (Oxf). 2007;67(3):426-33. 163. Biswas M, Smith J, Jadon D, McEwan P, Rees DA, Evans LM, et al. Long-term remission following withdrawal of dopamine agonist therapy in subjects with microprolactinomas. Clin Endocrinol (Oxf). 2005;63(1):26-31.

170. Watanabe S, Akutsu H, Takano S, Yamamoto T, Ishikawa E, Suzuki H, et al. Long-term results of cabergoline therapy for macroprolactinomas and analysis of factors associated with remission after withdrawal. Clin Endocrinol (Oxf). 2017;86(2):207-13. 171. Dekkers OM, Lagro J, Burman P, Jørgensen JO, Romijn JA, Pereira AM. Recurrence of hyperprolactinemia after withdrawal of dopamine agonists: systematic review and meta-analysis. J Clin Endocrinol Metab. 2010; 95(1):43-51. 172. Hu J, Zheng X, Zhang W, Yang H. Current drug withdrawal strategy in prolactinoma patients treated with cabergoline: a systematic review and meta-analysis. Pituitary. 2015;18(5):745-51. 173. Vilar L, Albuquerque JL, Gadelha PS, Rangel Filho F, Siqueira AM, da Fonseca MM, et al. Second attempt of cabergoline withdrawal in patients with prolactinomas after a failed first attempt: is it worthwhile? Front Endocrinol (Lausanne). 2015;6:11. 174. Kwancharoen R, Auriemma RS, Yenokyan G, Wand GS, Colao A, Salvatori R. Second attempt to withdraw cabergoline in prolactinomas: a pilot study. Pituitary. 2014;17(5):451-6. 175. Karunakaran S, Page RC, Wass JA. The effect of the menopause on prolactin levels in patients with hyperprolactinaemia. Clin Endocrinol (Oxf). 2001;54(3):295-300. 176. Auriemma RS, Perone Y, Di Sarno A, Grasso LF, Guerra E, Gasperi M, et al. Results of a single-center observational 10-year survey study on recurrence of hyperprolactinemia after pregnancy and lactation. J Clin Endocrinol Metab. 2013;98(1):372-9. 177. Domingue ME, Devuyst F, Alexopoulou O, Corvilain B, Maiter D. Outcome of prolactinoma after pregnancy and lactation: a study on 73 patients. Clin Endocrinol (Oxf). 2014;80(5):642-8. 178. SmithTR, Hulou MM, Huang KT, Gokoglu A, Cote DJ, Woodmansee WW, Laws ER Jr. Current indications for the surgical treatment of prolactinomas. J Clin Neurosci. 2015;22(11):1785-91 179. Lund VJ. Endoscopic management of cerebrospinalfluid leaks. Am J Rhinol. 2002;16(1):17-23. 180. Mankia SK, Weerakkody RA, Wijesuriya S, Kandasamy N, Finucane F, Guilfoyle M, et al. Spontaneous cerebrospinalfluid rhinorrhoea as the presenting feature of an invasive macroprolactinoma. BMJ Case Rep. 2009;2009. pii: bcr12.2008.1383 181. Leong KS, Foy PM, Swift AC, Atkin SL, Hadden DR, MacFarlane IA. CSF rhinorrhoea following treatment with dopamine agonists for massive invasive prolactinomas. Clin Endocrinol (Oxf). 2000;52(1):43-9.

164. Kharlip J, Salvatori R, Yenokyan G, Wand GS. Recurrence of hyperprolactinemia after withdrawal of long-term cabergoline therapy. J Clin Endocrinol Metab. 2009;94(7):2428-36.

182. Lam G, Mehta V, Zada G. Spontaneous and medically induced cerebrospinal fluid leakage in the setting of pituitary adenomas: review of the literature. Neurosurg Focus. 2012;32(6):E2.

165. Huda MS, Athauda NB, Teh MM, Carroll PV, Powrie J. Factors determining the remission of microprolactinomas after dopamine agonist withdrawal. Clin Endocrinol (Oxf). 2010;72(4):507-11.

183. Bronstein MD, Musolino NR, Benabou S, Marino R Jr. Cerebrospinal fluid rhinorrhea occurring in long-term bromocriptine treatment for macroprolactinomas. Surg Neurol. 1989;32(5):346-9.

166. Barber TM, Kenkre J, Garnett C, Scott RV, Byrne JV, Wass JA. Recurrence of hyperprolactinaemia following discontinuation of dopamine agonist therapy in patients with prolactinoma occurs commonly especially in macroprolactinoma. Clin Endocrinol (Oxf). 2011;75(6):819-24. 167. Anagnostis P, Adamidou F, Polyzos SA, Efstathiadou Z, Karathanassi E, Kita M. Long term follow-up of patients with prolactinomas and outcome of dopamine agonist withdrawal: a single center experience. Pituitary. 2012;15(1):25-9. Arch Endocrinol Metab. 2018;62/2

184. Anani WQ, Ojerholm E, Shurin MR. Resolving transferrin isoforms via agarose gel electrophoresis. Lab Med. 2015;46(1):26-33. 185. Colao A. The prolactinoma. Best Pract Res Clin Endocrinol Metab. 2009;23(5):575-96. 186. Barker 2nd FG, Klibanski A, Swearingen B. Transsphenoidal surgery for pituitary tumors in the United States, 1996–2000: mortality, morbidity, and the effects of hospital and surgeon volume. J Clin Endocrinol Metab. 2003;88(10):4709-19.

261

154. Auriemma RS, Pivonello R, Perone Y, Grasso LF, Ferreri L, Simeoli C, et al. Safety of long-term treatment with cabergoline on cardiac valve disease in patients with prolactinomas. Eur J Endocrinol. 2013;169(3):359-66.

Controversial issues in the management of hyperprolactinemia and prolactinomas

187. Sudhakar N, Ray A, Vafidis JA. Complications after transsphenoidal surgery: our experience and a review of the literature. Br J Neurosurg. 2004;18(5):507-12.

207. Alkatari S, Aljohani N. Obstructive hydrocephalus, fifth nerve and hypothalamus involvement: acute presentation of a giant prolactinoma. Clin Med Insights Case Rep. 2012;5:115-8.

188. Nelson Jr AT, Tucker Jr HS, Becker DP. Residual anterior pituitary function following transsphenoidal resection of pituitary macroadenomas. J Neurosurg 1984;61(3):577-80.

208. Espinosa E, Sosa E, Mendoza V, Ramírez C, Melgar V, Mercado M. Giant prolactinomas: are they really different from ordinary macroprolactinomas? Endocrine. 2015;52(3):652-9.

189. 189.Sheplan Olsen LJ, Robles Irizarry L, Chao ST, Weil RJ, Hamrahian AH, Hatipoglu B, Suh JH. Radiotherapy for prolactinsecreting pituitary tumors.Pituitary. 2012;15(2):135-45.

209. Shimon I, Sosa E, Mendoza V, Greenman Y, Tirosh A, Espinosa E et al. Giant prolactinomas larger than 60 mm in size: a cohort of massive and aggressive prolactin-secreting pituitary adenomas. Pituitary. 2016;19(4):429-36.

190. Wan H, Chihiro O, Yuan S. MASEP gamma knife radiosurgery for secretory pituitary adenomas: experience in 347 consecutive cases. J Exp Clin Cancer Res. 2009;28:36. 191. Kong DS, Lee JI, Lim do H, Kim KW, Shin HJ, Nam DH, et al. The efficacy of fractionated radiotherapy and stereotactic radiosurgery for pituitary adenomas: long-term results of 125 consecutive patients treated in a single institution. Cancer. 2017;110(4):854-60.

211. Saeki N, NakamuraM, Sunami K, Yamaura A. Surgical indication after bromocriptine therapy on giant prolactinomas: effects and limitations of the medical treatment. Endocr J. 1998;45(4):529-37.

192. Castinetti F, Nagai M, Morange I, Dufour H, Caron P, Chanson P, et al. Long-term results of stereotactic radiosurgery in secretory pituitary adenomas. J Clin Endocrinol Metab. 2009;94(9):3400-7.

212. Sieck JO, Niles NL, Jinkins JR, Al-Mefty O, el-Akkad S, Woodhouse N. Extrasellar prolactinomas: successful management of 24 patients using bromocriptine. Horm Res.1986;23(3):167-76.

193. Tsang RW, Brierley JD, Panzarella T, Gospodarowicz MK, Sutcliffe SB, Simpson WJ. Radiation therapy for pituitary adenoma: treatment outcome and prognostic factors. Int J Radiat Oncol Biol Phys. 1994;30(3):557-65.

213. Kyung Rae C, Kyung-Il J, Hyung Jin S. Bromocriptine therapy for the treatment of invasive prolactinoma: the single institute experience. Brain Tumor Res Treat. 2013 ; 1(2):71–7

194. Littley MD, Shalet SM, Beardwell CG, Robinson EL, Sutton ML Radiation-induced hypopituitarism is dose-dependent. Clin Endocrinol (Oxf). 1989;31(3):363-73. 195. Brada M, Burchell L, Ashley S, Traish D. The incidence of cerebrovascular accidents in patients with pituitary adenoma. Neurooncol Pract. 2014;1(1):22-8. 196. Minniti G, Traish D, Ashley S, Gonsalves A, Brada M. Risk of second brain tumor after conservative surgery and radiotherapy for pituitary adenoma: update after an additional 10 years. J Clin Endocrinol Metab. 2005;90(2):800-4.

214. Komotar RJ, Starke RM, Raper DM, Anand VK, Schwartz TH. Endoscopic endonasal compared with microscopic transsphenoidal and open transcranial resection of giant pituitary adenomas. Pituitary. 2012;15(2):150-9. 215. Brown RS, Herbison AE, Grattan DR. Prolactin regulation of kisspeptin neurons in the mouse brain and its role in the lactation-induced suppression of kisspeptin expression. J Neuroendocrinol. 2014:26(12):898-908. 216. Molitch ME. Endocrinology in pregnancy: management of the pregnant patient with a prolactinoma. Eur J Endo crinol. 2015;172(5):R205-13.

197. Erridge SC, Conkey DS, Stockton D, Strachan MW, Statham PF, Whittle IR, et al. Radiotherapy for pituitary adenomas: long-term efficacy and toxicity. Radiother Oncol. 2009;93(3):597-601.

217. Glezer A, Jallad RS, Machado MC, Fragoso MC, Bronstein MD. Pregnancy and pituitary adenomas. Minerva Endocrinol. 2016;41(3):341-50.

198. Cohen-Inbar O, Xu Z, Schlesinger D, Vance ML, Sheehan JP. Gamma Knife radiosurgery for medically and surgically refractory prolactinomas: long-term results. Pituitary. 2015;18(6):820-30.

218. Holmgren U, Bergstrand G, Hagenfeldt K, Werner S. Women with prolactinoma--effect of pregnancy and lactation on serum prolactin and on tumour growth. Acta Endocrinol (Copenh). 1986;111(4):452-9.

199. Liu X, Kano H, Kondziolka D, Park KJ, Iyer A, Shin S, et al. Gamma knife stereotactic radiosurgery for drug resistant or intolerant invasive prolactinomas. Pituitary. 2013;16(1):68-75.

219. Bronstein MD, Paraiba DB, Jallad RS. Management of pituitary tumors in pregnancy.Nat Rev Endocrinol. 2011;7(5):301-10.

200. Moraes AB, Silva CM, Vieira Neto L, Gadelha MR. Giant prolactinomas: the therapeutic approach. Clin Endocrinol (Oxf). 2013;79(4):447-56.

220. Raymond JP, Goldstein E, Konopka P, Leleu MR, Merceron LE, Loria Y..Follow-up of children born of bromoc riptine-treated mothers. Horm Res. 1985;22(3):239-46.

201. Delgrange E, Raverot G, Bex M, Burman P, Decoudier B, Devuyst F, et al. Giant prolactinomas in women. Eur J Endocrinol. 2013;170(1):31-8.

221. Canales ES, Garcia IC, Ruiz JE, Zárate A. Bromocriptine as prophylactic therapy in prolactinoma during pregnan cy. Fertil Steril. 1981;36(4):524-6.

202. Maiter D, Delgrange E. Therapy of endocrine disease: the challenges in managing giant prolactinomas. Eur J Endocrinol. 2014;170(6):R213-27.

222. Glezer A, Bronstein MD. Prolactinomas, cabergoline, and pregnancy. Endocrine. 2014;47(1):64-9.

203. Delgrange E, Trouillas J, Maiter D, Donckier J, Tourniaire J. Sexrelated difference in the growth of prolactinomas: a clinical and proliferation marker study.J Clin Endocrinol Metab. 1997;82(7):2102-7. Copyright© AE&M all rights reserved.

210. Vilar L, Albuquerque JL, Gomes B, Gadelha PS, Lopes IGA, Thé AC , et al. Giant prolactinomas: clinical manifestations and response to treatment in 16 cases. Arch Endocrinol Metab. 2015; 59 (Suppl. 1):S21.

204. Shrivastava RK, Arginteanu MS, King WA, Post KD. Giant prolactinomas: clinical management and long-term follow up. J Neurosurg. 2002;97(2):299-306. 205. Levy RA, Quint DJ. Giant pituitary adenoma with unusual orbital and skull base extension. AJR Am J Roentgenol. 1998;170(1):194-6. 206. Chaurasia PK, Singh D, Meher S, Saran RK, Singh H. Epistaxis as first clinical presentation in a child with giant prolactinoma: Case report and review of literature. J Pediatr Neurosci. 2011;6(2):134-7.

262

223. Bronstein MD. 2005;8(1):31-8.

Prolactinomas

and

pregnancy.

Pituitary.

224. Krupp P, Monka C, Richter K. The safety aspects of infertility treatments. Program of the Second World Con gress of Gynecology and Obstetrics 1988. Rio de Janeiro, Brazil. p. 9. 225. Ono M, Miki N, Amano K, Kawamata T, Seki T, Makino R, et al. High-dose cabergoline therapy for hyperprolactinemic infertility in women with micro- and macroprolactinomas. J Clin Endocrinol Metab. 2010;95(6):2672-9. 226. Lebbe M, Hubinont C, Bernard P, Maiter D. Outcome of 100 pregnancies initiated under treatment with caber goline in hyperprolactinaemic women. Clin Endocrinol (Oxf). 2010;73(2):236-42. Arch Endocrinol Metab. 2018;62/2

Controversial issues in the management of hyperprolactinemia and prolactinomas

227. Stalldecker G, Gil MSM, Guitelman MA, Alfieri A, Ballarino MC, Boero L, et al. Effects of cabergoline on pregnancy and embryofetal development: retrospective study on 103 pregnancies and a review of the literature. Pituitary. 2010;13(4):345-50.

235. Santos Andrade EH, Pan PM, da Silva PF, Gadelha A. New insights in the management of antipsychotics in the treatment of schizophrenia in a patient with prolactinoma: a case report and review of the literature. Case Rep Med. 2010;2010:573252.

228. Yoon HW, Lee JS, Park SJ, Lee SK, Choi WJ, Kim TY, et al. Comparing the effectiveness and safety of the addition of and switching to aripiprazole for resolving antipsychotic-induced hyperprolactinemia: a multicenter, open-label, prospective study. Clin Neuropharmacol. 2016;39(6):288-94.

236. Pollice R, Di Giovambattista E, Tomassini A, Di Pucchio A, Mazza M, Di Michele V, et al. Risperidone-induced symptomatic hyperprolactinemia in youth with schizophrenia: efficacy and tolerability of cabergoline treatment. Clin Ter. 2007;158(2):121-6.

229. Raghuthaman G, Venkateswaran R, Krishnadas R. Adjunctive aripiprazole in risperidone-induced hyperprolactinaemia: doubleblind, randomised, placebo-controlled trial. B J Psych Open. 2015;1(2):172-7. 230. Burback L. Management of a microprolactinoma with aripiprazole in a woman with cabergoline-induced mania. Endocrinol Diabetes Metab Case Rep. 2015;2015:150100. 231. Bakker IC, Schubart CD, Zelissen PM. Successful treatment of a prolactinoma with the antipsychotic drug aripiprazole. Endocrinol Diabetes Metab Case Rep. 2016;2016:160028. 232. Yanofski J. The dopamine dilemma. Psychiatry (Edgmont). 2010;7(6):18-23. 233. Owen R, Owen F, Poulter M, Crow TJ. Dopamine D2 receptors in substantia nigra in schizophrenia. Brain Res. 1994;299(1):152-4.

238. Cavallaro R, Cocchi F, Angelone SM, Lattuada E, Smeraldi E. Cabergoline treatment of risperidone-induced hyperprolactinemia: a pilot study. J Clin Psychiatry. 2004;65(2):187-90. 239. Kalkavoura CS, Michopoulos I, Arvanitakis P, Theodoropoulou P, Dimopoulou K, Tzebelikos E, Lykouras L. Effects of cabergoline on hyperprolactinemia, psychopathology, and sexual functioning in schizophrenic patients. Exp Clin Psychopharmacol. 2013;21(4):332-41. 240. Lee MS, Song HC, Na H, Yang J, Ko YH, Jung IK, Joe SH. Effect of bromocriptine on antipsychotic drug-induced hyperprolactinemia: eight-week randomized, single-blind, placebo-controlled, multicenter study. Psychiatry Clin Neurosci. 2010;64 (1):19-27.

234. Chang SC, Chen CH, Lu ML. Cabergoline-induced psychotic exacerbation in schizophrenic patients. Gen Hosp Psychiatry. 2008;30(4):378-80.

237. Tollin SR. Use of the dopamine agonists bromocriptine and cabergoline in the management of risperidone-induced hyperprolactinemia in patients with psychotic disorders. J Endocrinol Invest. 2000;23(11):765-70.

Arch Endocrinol Metab. 2018;62/2

263

case report

What determines mortality in malignant pheochromocytoma? – Report of a case with eighteen-year survival and review of the literature Matheus de Oliveira Andrade1, Vinícius Santos da Cunha1, Dayana Carla de Oliveira1, Olívia Laquis de Moraes1, Adriana Lofrano-Porto1,2

Laboratório de Farmacologia Molecular, Faculdade de Ciências da Saúde, Universidade de Brasília (UnB), Brasília, DF, Brasil 2 Unidade de Endocrinologia, Hospital Universitário de Brasília, Universidade de Brasília (UnB), Brasília, DF, Brasil 1

Correspondence to: Adriana Lofrano Porto Laboratório de Farmacologia Molecular, Faculdade de Ciências da Saúde, Universidade de Brasília, 70910-900 – Brasília, DF, Brasil adlofrano@unb.br Received on Jan/5/2017 Accepted on Jan/19/2018

SUMMARY Pheochromocytoma (PCC) is a tumor derived from adrenomedullary chromaffin cells. Prognosis of malignant PCC is generally poor due to local recurrence or metastasis. We aim to report a case of malignant PCC with 18-year survival and discuss which factors may be related to mortality and longterm survival in malignant pheochromocytoma. The patient, a 45-year-old man, reported sustained arterial hypertension with paroxysmal episodes of tachycardia, associated with head and neck burning sensation, and hand and foot tremors. Diagnosis of PCC was established biochemically and a tumor with infiltration of renal parenchyma was resected. No genetic mutation or copy number variations were identified in SDHB, SDHD, SDHC, MAX and VHL. Over 18 years, tumor progression was managed with 131I-MIBG (iodine-metaiodobenzylguanidine) and 177Lutetium-octreotate therapy. Currently, the patient is asymptomatic and presents sustained stable disease, despite the presence of lung, para-aortic lymph nodes and femoral metastases. Adequate response to treatment with control of tumor progression, absence of significant cardiovascular events and other neoplasms, and lack of mutations in the main predisposing genes reported so far may be factors possibly associated with the prolonged survival in this case. Early diagnosis and life-long follow-up in patients with malignant pheochromocytoma are known to be crucial in improving survival. Arch Endocrinol Metab. 2018;62(2):264-9

DOI: 10.20945/2359-3997000000033

INTRODUCTION

heochromocytoma (PCC) is a tumor derived from adrenomedullary chromaffin cells, which produce catecholamines, such as norepinephrine, epinephrine and dopamine. Approximately 15-20% of chromaffincell tumors arise from extra-adrenal chromaffin cells, and they are called paragangliomas (1). PCCs are rare, with an incidence of 2 to 8 per 1 million adults, and correspond to 5% of all adrenal incidentalomas (2). The clinical relevance of these tumors is based on their potential of secreting cathecolamines, causing cardiovascular morbidity and mortality. Around 0.2% to 1% of patients with hypertension have chromaffin-cell tumors. These tumors may also extend into adjacent organs, causing mass-effect symptoms (1,2). Malignant pheochromocytomas are defined as those with metastases, evidence of local invasion, or recurrence. The main sites of metastasis are lymph nodes (80% of patients), bones (50-70%), liver (50%), 264

lungs (30-50%), and kidney. Approximately 10% to 25% of PCCs are malignant (2-4). There is no available method to accurately predict the malignant potential of these tumors when they present without metastases. Tumors larger than 5 cm, location of the primary lesion, local invasion, tumor necrosis, high cellularity, nuclear pleomorphism and hyperchromasia are some characteristics that may suggest malignancy, but distant metastases remain the only widely accepted malignancy criterion (3,5). The pattern of cathecolamine secretion is also not useful to differentiate benign from malignant pheochromocytomas, despite previous reports claiming that dopamine levels may be higher in malignant cases (6). The prognosis of malignant PCC is generally poor due to local recurrence or metastasis, with 5-year survival rates varying between 40% e 70%, and median survival of 7 years (7,8). Nevertheless, there are few reports of patients with malignant PCC surviving for Arch Endocrinol Metab. 2018;62/2

Pheochromocytoma with eighteen-year survival

CASE REPORT The patient, a 45-year-old man, reported sustained arterial hypertension with paroxysmal episodes of tachycardia, associated with burning sensations in the head and neck, and hand and foot tremors. On the first consultation, blood pressure was 220 x 160 mmHg, the heart rate was 58 bpm and a systolic murmur 2+/6+ in mitral area was noticed, radiating to the left sternal border. No relevant family history was reported. His father died of prostate cancer at age 65, but there were no other cases of cancer in the family. An abdominal computed tomography (CT) scan showed compression of the left kidney by a tumor measuring 14.8 x 9.8 cm. At that time (1998), the concentrations of total catecholamines and vanillylmandelic acid in 24-hour urine sample were 1875 μg/24h (normal range: < 100 μg/24h) and 86.8 mg/24h (normal range: < 8 mg/24h), respectively. Adrenalectomy and nephrectomy were performed, accompanied by splenectomy and resection of the tail of the pancreas due to tumor infiltration. Histopathological examination was consistent with pheochromocytoma with vascular invasion and infiltration of renal parenchyma. After two years, the patient presented negative biochemical evaluation for pheochromocytoma, and the only reported symptom was intestinal subocclusion, which was clinically treated. However, an abdominal CT scan demonstrated recurrence of a tumor measuring 8 x 6 cm, in the left renal bed, which was resected. In subsequent years, 131I-MIBG (iodinemetaiodobenzylguanidine) scintigraphy and abdominal and pelvic CT scans showed multiple enlarged paraaortic lymph nodes, compatible with metastasis, as well as metastatic nodules in the left adrenal bed and left lung base. Over twelve years, treatment was performed with four therapeutic doses of 131I-MIBG (two, seven, eleven and thirteen years after the second surgery), totaling a cumulative dose of 700 mCi (first dose of 100 mCi and the others of 200 mCi). In the last seven years, however, persistently elevated levels of urinary normetanephrines have been noted. The last magnetic resonance imaging (MRI) revealed Arch Endocrinol Metab. 2018;62/2

the presence of node formations on the left para-aortic region and on the topography of the ipsilateral adrenal gland. Recently, 111Indium-octreotide scintigraphy was performed, followed by 177Lutetium-octreotate therapy, and the last whole body scan after the second therapeutic dose (200 mCi) of 177Lutetium-octreotate demonstrated the presence of neuroendocrine lesions in the lungs, left para-aortic lymph nodes and in the intertrochanteric region of the left femur, suggesting active disease (Figure 1). The patient, currently 63 years old, remains asymptomatic and normotensive, under use of antihypertensive medication (Enalapril 40 mg/day). In face of the malignant presentation, molecular studies were conducted to screen mutations in five genes related to pheochromocytoma: SDHB, SDHD, SDHC, MAX and VHL. Genomic DNA was extracted from 12 mL of EDTA-anticoagulated peripheral blood, by the salting out method. All coding exons and flanking intronic regions of SDHB, SDHD, SDHC, MAX and VHL were amplified and automatically sequenced. Since no point mutations were found by the Sanger sequencing, analysis for large deletions in SDH and VHL was included. Multiplex Ligand-Probe Amplification (MLPA) was performed using commercially available kits, P226 for SDH, and P016 for VHL (MRC Holland®). No mutation or copy number variations were identified in the assessed genes. A

Figure 1. 177Lutetium-Octreotate Single-Photon Emission Computed Tomography (SPECT) revealing areas of radiopharmaceutical hyperconcentration (shown by black arrows) in the lungs (A, axial and sagittal view), left para-aortic lymph nodes (B, coronal view), and left femoral intertrochanteric region (C, coronal view). 265

more than 15 years after diagnosis (6,8-24). We report a case of malignant PCC with 18-year survival and discuss which factors may be related to mortality and long-term survival in malignant pheochromocytoma.

Pheochromocytoma with eighteen-year survival

DISCUSSION We report a rare case of malignant pheochromocytoma with 18 years of follow-up, during which the patient has been asymptomatic and has referred a good quality of life after treatment with a cumulative dose of 700 mCi of 131 I-MIBG, followed by 177Lutetium-octreotate therapy. While the diagnosis of a malignant pheochromocytoma was suspected in 1998 when an invasive 14.8-cm adrenal tumor was resected, the confirmation of malignancy came with early postoperative evidence of locoregional recurrence followed by multiple paraaortic lymph nodes metastasis. Despite the anatomical evidence of relatively stable metastatic disease, no evidence of cathecolamine hypersecretion was noted for approximately 10 years. Moreover, even though urinary normetanephrine levels have slowly increased over the last 7 years, the patient remains clinically controlled. According to recent guidelines, the initial diagnosis of pheochromocytoma is based on the assessment of increased cathecolamines or metabolites (metanephrines) in a plasma sample or in a 24h urine collection, followed by localization of the tumor using imaging techniques, such as CT, T2-weighted MRI and I-MIBG scintigraphy (3). In the present case, MRI and I-MIBG scintigraphy have shown complementary usefulness in the clinical follow up and identification of disease recurrence, as previously reported (25). Genetic testing is recommended in all PCC patients, since it may guide genetic counselling and ensure a personalized approach to patient management. Although approximately 14 confirmed genes are associated with pheochromocytoma and paraganglioma susceptibility, the genes investigated in the present case â&#x20AC;&#x201C; SDHB, SDHC, SDHD, VHL and MAX â&#x20AC;&#x201C; have been the main reported genes associated with malignant PCC reported so far, according to the Endocrine Society Clinical Practice Guideline (1). Metastatic disease is one of the features that indicates likelihood of a hereditary cause, and it is recommended that patients with malignant PCC should undergo genetic testing for SDHB, SDHC, SDHD, VHL and MAX (1,26). In the presented case, we performed genetic screening of those main malignancy predisposing genes, but no germline mutations or copy number variations were identified. Accordingly, it has been shown that only 40% of patients carry germline mutations in the susceptibility genes, and up to two thirds of the remaining sporadic PCCs have somatic mutations (26). 266

The prevalence of germline mutations in SDHB, SDHC, SDHD, VHL and MAX in PCC and paraganglioma patients is, respectively, 10%, 1%, 9%, 7%, and 1%. SDHx mutations are associated with inappropriate activation of hypoxic signaling leading to angiogenesis, metabolic alterations and tumorigenesis. SDHB mutations are especially related to sporadic malignant PCC with poor prognosis, and up to 40% of patients with metastatic disease harbor mutations in this gene. Hypoxic signaling is also disrupted by loss-offunction mutations in VHL, which cause von HippelLindau disease, a syndrome characterized by tumors in several organs, including kidney, central nervous system, pancreas and adrenal gland. MAX mutations promote upregulation of the MYC signaling, a key oncogenic pathway, leading to familial pheochromocytomas (1,26). The absence of germline mutations in the main predisposing genes suggests that other mechanisms are related to the development of malignancy, particularly in indolent cases, which still has no biological markers or defined pathophysiological basis. The absence of mutations in the reported case, especially SDHB, may also be related to long-term survival, since SDHB mutations are independently related to shorter survival in patients with malignant pheochromocytoma (26). Intriguingly, there are few reports of malignant pheochromocytoma patients harboring SDHB mutations with prolonged survival (17,22). Whether the absence of germline mutations in the genes previously associated with a malignant behavior represents a protective factor against aggressive disease must be further investigated. Curative treatment for malignant PCC is not available yet, and surgery is focused on reducing hormonal activity and palliating local complications. MIBGradiotherapy, radiolabeled somatostatin analogues (e.g. octreotide), and chemotherapy are other available therapeutic options. Conventional chemotherapeutic regimens (e.g. cyclophosphamide, vincristine, and dacarbazine) provide limited efficacy (27). Several studies have investigated the use of radiolabeled MIBG for treatment of malignant PCC. Dose regimen and tumor response are variable, as there is no established agreed-upon protocol. A phase II study involving 50 patients with malignant pheochromocytoma or paraganglioma treated with high-dose 131I-MIBG showed overall 5-year survival rate of 64% and sustained stable disease in 8% of patients (28). Another study reported median survival of 4.7 years for patients with malignant PCC after treatment with high-dose 131I-MIBG (29). Arch Endocrinol Metab. 2018;62/2

Pheochromocytoma with eighteen-year survival

In the present case, the patient responded to treatment with 131I-MIBG for 12 years and, more recently, to 177Lutetium-octreotate therapy. Currently, the patient presents sustained stable disease, despite the presence of metastases in the lung, para-aortic lymph nodes and, more recently, femoral metastasis. Repeated intermediate-dosage of 131I-MIBG is considered an efficient and well-tolerated treatment in patients with malignant PCC, but the role of 131I-MIBG in longevity remains to be elucidated in patients with long-term survival (19). The most frequent cause of death in malignant pheochromocytoma is tumor progression, highlighting the importance of controlling tumor growth in disease management. Cardiovascular manifestations related to catecholamine hypersecretion account for 30% of mortality (4). The main cardiovascular events associated with mortality are myocardial infarction, heart failure, cerebrovascular complications, and hypertensive or hypotensive crisis associated with operations for unrelated conditions (7). Other cancers are also associated with mortality in PCC. These additional neoplasms may occur in the context of genetic syndromes, such as von HippelLindau syndrome and neurofibromatosis type 1. They also may be sporadic, considering that presence of pheochromocytoma is associated with increased risk of developing other malignancies (melanoma, carcinoma

of uterine cervix, liver/biliary tract and central nervous system tumors) (30). So far, no additional or secondary neoplasm has been identified in our case. Control of tumor progression, as well as the absence of significant cardiovascular events and other cancers may have contributed to the prolonged survival in the reported case. An extensive literature search from 1970 to 2016 revealed 42 cases of malignant pheochromocytomas and paragangliomas with more than 15 years of survival (Table 1). It is noteworthy that a significant number of malignant cases with prolonged survival (11 of 42; 26%) were described more than 25 years ago, when imaging and radionuclide-based therapies were not widely available in clinical practice. Overall, among 31 cases of malignant PCCs with prolonged survival in which the primary tumor localization was provided, the majority were unilateral adrenal tumors (62.5%; n = 20), followed by extra-adrenal (35.5%; n = 11), and bilateral tumors (3.2%; n = 1). Only two studies (17,22) performed genetic analysis, and out of four cases in which genetic screening was performed in apparently sporadic malignant PCC, three presented SDHB mutations, and one patient was negative for SDHB, SDHD, RET and VHL mutations. The variability in clinical presentation and rarity of cases with prolonged survival impair the establishment of definitive factors associated with better outcomes and long-term survival in malignant PCC.

Table 1. Reports of malignant pheochromocytomas and paragangliomas with more than 15 years of survival Age at diagnosis (years)

Location of primary tumor

Tumor size (cm)

Site of metastasis

Genetic testing

Survival time (years)

Reference

Adrenal Uni

Pleura

Traub and Rosenfeld (1970) (9)

Lung

Van den Broek and De Graeff (1978) (11)

Adrenal Uni

Left renal hilus

Abemayor and cols. (1980) (12)

>20

Brennan and Kaiser (1982) (13)

Liver

Okada and cols. (1990) (14)

Mornex and cols. (1992) (15)

Adrenal Uni

Lumbar vertebrae and ilium

Yoshida and cols. (2001) (16)

Extra-adrenal

Liver and vena cava

SDHB

Young and cols. (2002) (17)

Remine and cols. (1975) (10)

Bone

Arias Martinez and cols. (2003) (24)

Adrenal Bi

Liver

MĂłzes and cols. (2003) (18)

Arch Endocrinol Metab. 2018;62/2

267

No.

Pheochromocytoma with eighteen-year survival

No.

Age at diagnosis (years)

Location of primary tumor

Tumor size (cm)

Site of metastasis

Genetic testing

Survival time (years)

Reference

Adrenal Uni

Liver and retroperitoneum

Lam and cols. (2005) (19)

Extra-adrenal

Bone

Adrenal Uni

Lung

Extra-adrenal

Regional

Adrenal Uni

Liver

Adrenal Uni

Liver

Adrenal Uni

Regional

Adrenal Uni

Liver

Extra-adrenal

Bone

Adrenal Uni

Lung

Extra-adrenal

Liver

Adrenal Uni

Bone

Adrenal Uni

11x12x11

Lung and bone

Huang and cols. (2007) (6)

Adrenal Uni

Szalat and cols. (2011) (21)

Adrenal Uni

Lung

Adrenal Uni

3.2

Kidney and retroperitoneum

Adrenal Uni

Lung

Adrenal Uni

Liver, lung, duodenum, bone

Extra-adrenal

Adrenal Uni

SDHB

Extra-adrenal

SDHB

Adrenal Uni

Negative

Extra-adrenal

Anterior cranial fossa and cervical lymph nodes

Sisson and cols. (2006) (20)

Choi and cols. (2015) (8)

Rutherford and cols. (2015) (22)

Belgioia and cols. (2016) (23)

Uni: unilateral; Bi: bilateral; NA: not available.

This case report and literature review carefully illustrate that regular clinical monitoring with imaging and biochemical evaluation of malignant pheochromocytomas is essential to address tumor behavior, and to ensure prompt intervention when complications or tumor recurrence arise. In addition, early diagnosis and life-long follow-up are crucial for improving survival. Adequate response to treatment with control of tumor progression, absence of significant cardiovascular events and other neoplasms, and lack of mutations in the main predisposing genes reported so far might be associated with the prolonged survival in the presented case. Further studies involving a larger number of cases are needed to compare the clinical, biochemical and molecular signatures of malignant 268

pheochromocytomas with indolent versus aggressive behavior and treatment response. Acknowledgements: the authors thank Dra. Mayra Veloso (Radiology Unit, University Hospital of BrasĂlia) for the assistance provided in the imaging studies. Fundings: no financial support. Disclosure: no potential conflict of interest relevant to this article was reported.

REFERENCES 1. Lenders JW, Duh QY, Eisenhofer G, Gimenez-Roqueplo AP, Grebe SK, Murad MH, et al.; Endocrine Society. Pheochromocytoma and paraganglioma: an endocrine society clinical practice guideline. J Clin Endocrinol Metab. 2014;99(6):1915-42.

Arch Endocrinol Metab. 2018;62/2

Pheochromocytoma with eighteen-year survival

2. Harari A, Inabnet WB 3rd. Malignant pheochromocytoma: a review. Am J Surg. 2011;201(5):700-8.

associated with mutation in the succinate dehydrogenase B gene. J Clin Endocrinol Metab. 2002;87(9):4101-5.

3. Adjallé R, Plouin PF, Pacak K, Lehnert H. Treatment of malignant pheochromocytoma. Horm Metab Res. 2009;41(9):687-96.

18. Mózes G, van Heerden JA, Gharib H. Prolonged survival of a patient with multiple endocrine neoplasia type 2b and stage IV medullary thyroid carcinoma. Endocr Pract. 2003;9(1):45-51.

4. Baudin E, Habra MA, Deschamps F, Cote G, Dumont F, Cabanillas M, et al. Therapy of endocrine disease: treatment of malignant pheochromocytoma and paraganglioma. Eur J Endocrinol. 2014;171(3):R111-22. 5. Kim KY, Kim JH, Hong AR, Seong MW, Lee KE, Kim SJ, et al. Disentangling of malignancy from benign pheochromocytomas/ paragangliomas. PLoS One. 2016;11(12):e0168413. 6. Huang KH, Chung SD, Chen SC, Chueh SC, Pu YS, Lai MK, et al. Clinical and pathological data of 10 malignant pheochromocytomas: long-term follow up in a single institute. Int J Urol. 2007;14(3):181-5. 7. Prejbisz A, Lenders JW, Eisenhofer G, Januszewicz A. Mortality associated with phaeochromocytoma. Horm Metab Res. 2013;45(2):154-8. 8. Choi YM, Sung TY, Kim WG, Lee JJ, Ryu JS, Kim TY, et al. Clinical course and prognostic factors in patients with malignant pheochromocytoma and paraganglioma: A single institution experience. J Surg Oncol. 2015;112(8):815-21. 9. Traub YM, Rosenfeld JB. Malignant pheochromocytoma with pleural metastasis of unusually long duration. Chest. 1970;58(5):546-50. 10. Remine WH, Chong GC, Van Heerden JA, Sheps SG, Harrison EG. Current management of pheochromocytoma. Bull Soc Int Chir. 1975;34(2):97-8. 11. van den Broek PJ, de Graeff J. Prolonged survival in a patient with pulmonary metastases of a malignant pheochromocytoma. Neth J Med. 1978;21(6):245-7. 12. Abemayor E, Harken AH, Koop CE. Multiple sequential pulmonary resections for metastatic pheochromocytoma with long-term survival. Am J Surg. 1980;140(5):696-7. 13. Brennan MF, Kaiser HR. Persistent and recurrent pheochromocytoma: The role of surgery. World J Surg. 1982;6(4):397-401. 14. Okada S, Ohshima K, Onai T, Umahara M, Kobayashi S, Ishihara H. [A long survived case of malignant pheochromocytoma treated with alpha-methyl-p-tyrosine and midaglizol (DG-5128)]. Nihon Gan Chiryo Gakkai Shi. 1990;25(6):1221-5. 15. Mornex R, Badet C, Peyrin L. Malignant pheochromocytoma: a series of 14 cases observed between 1966 and 1990. J Endocrinol Invest. 1992;15(9):643-9. 16. Yoshida S, Hatori M, Noshiro T, Kimura N, Kokubun S. Twentysix-years’ survival with multiple bone metastasis of malignant pheochromocytoma. Arch Orthop Trauma Surg. 2001;121(10):598600.

20. Sisson JC, Shulkin BL, Esfandiari NH. Courses of malignant pheochromocytoma: implications for therapy. Ann N Y Acad Sci. 2006;1073:505-11. 21. Szalat A, Fraenkel M, Doviner V, Salmon A, Gross DJ. Malignant pheochromocytoma: predictive factors of malignancy and clinical course in 16 patients at a single tertiary medical center. Endocrine. 2011;39(2):160-6. 22. Rutherford MA, Rankin AJ, Yates TM, Mark PB, Perry CG, Reed NS, et al. Management of metastatic phaeochromocytoma and paraganglioma: use of iodine-131-meta-iodobenzylguanidine therapy in a tertiary referral centre. QJM. 2015;108(5):361-8. 23. Belgioia L, Pupillo F, Bacigalupo A, Corvò R. Long-term survival in a patient with head and neck paraganglioma treated with tailored modalities for 20 years: a case report. Tumori. 2016;102(Suppl. 2). 24. Arias Martinez N, Barbado Hernandez FJ, Couto Caro R, Gil Guerrero L, Coronado Arias Martínez N, Barbado Hernández FJ, Couto Caro R, Gil Guerrero L, Coronado Poggio M, Navarro T, et al. [Treatment of malignant pheochromocytoma with 131I MIBG: a long survival]. An Med Interna. 2003;20(11):575-8. 25. Eisenhofer G, Lenders JW, Timmers H, Mannelli M, Grebe SK, Hofbauer LC, et al. Measurements of plasma methoxytyramine, normetanephrine, and metanephrine as discriminators of different hereditary forms of pheochromocytoma. Clin Chem. 2011;57(3):411-20. 26. Favier J, Amar L, Gimenez-Roqueplo AP. Paraganglioma and phaeochromocytoma: from genetics to personalized medicine. Nat Rev Endocrinol. 2015;11(2):101-11. 27. Strajina V, Dy BM, Farley DR, Richards ML, McKenzie TJ, Bible KC, et al. Surgical treatment of malignant pheochromocytoma and paraganglioma: retrospective case series. Ann Surg Oncol. 2017;24(6):1546-50. 28. Gonias S, Goldsby R, Matthay KK, Hawkins R, Price D, Huberty J, et al. Phase II study of high-dose [131I]metaiodobenzylguanidine therapy for patients with metastatic pheochromocytoma and paraganglioma. J Clin Oncol. 2009;27(25):4162-8. 29. Safford SD, Coleman RE, Gockerman JP, Moore J, Feldman JM, Leight GS Jr, et al. Iodine-131 metaiodobenzylguanidine is an effective treatment for malignant pheochromocytoma and paraganglioma. Surgery. 2003;134(6):956-62. 30. Khorram-Manesh A, Ahlman H, Nilsson O, Odén A, Jansson S. Mortality associated with pheochromocytoma in a large Swedish cohort. Eur J Surg Oncol. 2004;30(5):556-9.

17. Young AL, Baysal BE, Deb A, Young WF Jr. Familial malignant catecholamine-secreting paraganglioma with prolonged survival

19. Lam MG, Lips CJ, Jager PL, Dullaart RP, Lentjes EG, van Rijk PP, et al. Repeated [131I]metaiodobenzylguanidine therapy in two patients with malignant pheochromocytoma. J Clin Endocrinol Metab. 2005;90(10):5888-95.

Arch Endocrinol Metab. 2018;62/2

269

Instructions for authors GENERAL INFORMATION

should be 2,000 words or less, with no more than four figures and tables, and no more than 30 references.

We emphasize the importance of following these instructions carefully. Failure to do so will delay the processing of your manuscript. Manuscripts should be submitted solely to the AE&M and should not have been published, or be under consideration for publication in any substantial form, in another periodical-either professional or lay. Manuscripts should be submitted in English. Proofreading by a scientific editing service is strongly recommended; the following companies are suggested: Voxmed Medical Communications, American Journal Experts and PaperCheck. Manuscripts that successfully complete the peer-review process and are recommended for publication will only be accepted and published upon receipt of a certificate proving professional academic English proofreading. In extraordinary circumstances, the certificate can be waived by editorial decision. All submissions are initially evaluated in depth by the scientific editors. Papers that do not conform with the general criteria for publication will be returned to the authors without detailed review, typically within three to five days. Otherwise, manuscripts will be sent to reviewers (most commonly two).

We emphasize that only case reports that offer important basic translational or clinical contributions, preferentially together with a review of the literature, will be considered for publication.

Letters to the Editor Letters to the Editor may be submitted in response to manuscript that has been published in the Journal. Letters should be short commentaries related to specific points of agreement or disagreement with the published manuscript. Letters are not intended for the presentation of original data unrelated to a published article. Letters should be no longer than 500 words, with no more than five complete references, and should not include any figures or tables.

MANUSCRIPT PREPARATION MANUSCRIPT CATEGORIES Reports of original research may be submitted to AE&M as Original Articles or Brief Reports. Other special categories of manuscripts are described below. All manuscripts must adhere to the word count limitations, as specified below, for text only; word count does not include the abstract, references, or figures/tables and their legends. Word count must be shown on the title page, along with the number of figures and tables. The format is similar for all manuscript categories, and it is described in detail in the “Manuscript Preparation” section.

Original Articles The Original Article is a scientific report of the results of original research that has not been published or submitted for publication elsewhere (either in print or electronically). It represents a substantial body of laboratory or clinical work. In general, Original Articles should not exceed 3,600 words in the main text, include more than six figures and tables, or more than 35 references.

Review Articles The AE&M publishes Review Articles that show a balanced perspective on timely issues within the field of clinical endocrinology. All reviews are submitted upon invitation and are subject to peer review. Articles in this category are requested by the Editors to authors with proven expertise in the field. Authors considering the submission of uninvited reviews should contact the editors in advance to determine whether the topic that they propose is of current potential interest to the Journal. Review articles should be no longer than 4,000 words in the main text, include no more than four figures and tables, and no more than 60 references. The author should mention the source and/or request authorization for use of previously published figures or tables.

Consensus Statements Consensus Statements related to the endocrine and metabolic health standards and healthcare practices may be submitted by professional societies, task forces, and other consortia. All such submissions will be subjected to peer review, must be modifiable in response to criticism, and will be published only if they meet the usual editorial standards of the Journal. Consensus Statements should typically be no longer than 3,600 words in the main text, include no more than six figures and tables, and no more than 60 references.

Brief Report The Brief Report consists of new data of sufficient importance to warrant immediate publication. It is a succinct description of focused study with important, but very straightforward, negative or confirmatory results. Brevity and clarity are always likely to enhance the chance of a manuscript being accepted for publication. A maximum of 1,500 words in the main text plus up to 20 references and normally no more than two illustrations (tables or figures or one of each) are acceptable for Brief Reports.

Case Report A Case Report is a brief communication presenting collected or single case reports of clinical or scientific significance. These reports should be concise and focused on the issue to be discussed. They should address observations of patients or families that add substantially to the knowledge of the etiology, pathogenesis, and delineation of the natural history or management of the condition described. Case Reports

GENERAL FORMAT The Journal requires that all manuscripts be submitted in a single-column format that follows these guidelines: • The manuscript must be submitted in MS-Word format. • All text should be double-spaced with 2 cm margins on both sides using 11-point type Times Roman or Arial font. • All lines should be numbered throughout the entire manuscript and the entire document should be paginated. • All tables and figures must be placed after the text and must be labeled. Submitted papers must be complete, including the title page, abstract, figures, and tables. Papers submitted without all of these components will be placed on hold until the manuscript is complete.

ALL SUBMISSIONS MUST INCLUDE: • A cover letter requesting the evaluation of the manuscript for publication in AE&M, and any information relevant to the manuscript. Elsewhere on the submission form, authors may suggest up to three specific reviewers and/or request the exclusion of up to three others.

The manuscript must be presented in the following order: 1. Title page. 2. Structured abstract (or summary for case reports). 3. Main text. 4. Tables and figures. They must be cited in the main text in numerical order. 5. Acknowledgments. 6. Funding statement, competing interests and any grants or fellowships supporting the writing of the paper. 7. List of references.

Title Page The title page must contain the following information: 1. Title of the article (a concise statement of the major contents of the article). 2. Full names, departments, institutions, city, and country of all co-authors. 3. Full name, postal address, e-mail, telephone and fax numbers of the corresponding author. 4. Abbreviated title of no more than 40 characters for page headings. 5. Up to five keywords or phrases suitable for use in an index (the use of MeSH terms is recommended). 6. Word count – excluding title page, abstract, references, figures/tables and their legends. 7. Article type

Structured Abstracts All Original Articles, Brief Reports, Reviews, Case Reports should be submitted with structured abstracts of no more than 250 words. The abstract must be self-contained and clear without reference to the text, and should be written for general journal readership. The abstract format should include four sections that reflect the section headings in the main text. All information reported in the abstract must appear in the manuscript. Please use complete sentences for all sections of the abstract.

Introduction

Photographs

The article should begin with a brief introductory statement that places the study in historical perspective, and explains its objective and significance.

The AE&M strongly prefers to publish unmasked patient photos. We encourage all prospective authors to work with families prior to submission and address the issue of permission for review and possible publication of patient images. If your submission contains ANY identifiable patient images or other protected health information, you MUST provide documented permission from the patient (or the patient’s parent, guardian, or legal representative) before the specific material circulates among editors, reviewers and staff for the purpose of possible publication in AE&M. If it is necessary to identify an individual, use a numerical designation (e.g. Patient 1) rather than using any other identifying notations, such as initials.

Materials and Methods These should be described and referenced in sufficient detail for other investigators to be able to repeat the study. The source of hormones, unusual chemicals and reagents, and special pieces of apparatus should be stated. For modified methods, only the modifications need be described.

Results and Discussion The Results section should briefly present the experimental data in text, tables, and/ or figures. For details on preparation of tables and figures, see below. The Discussion should focus on the interpretation and significance of the findings, with concise objective comments that describe their relation to other studies in that area. The Discussion should not reiterate the Results.

Units of Measure Results should be expressed in metric units. Temperature should be expressed in degrees Celsius and time of day using the 24-hour clock (e.g., 0800 h, 1500 h).

Standard Abbreviations All abbreviations must be immediately defined after it is first used in the text.

Authorship The AE&M ascribes to the authorship and contributorship guidelines defined by the International Committee of Medical Journal Editors (www.ICMJE.org). Unrestricted joint authorship is allowed. A maximum of two corresponding authors is allowed. The uniform requirements for manuscripts submitted to medical journals state that authorship credit should be based only on substantial contribution to: 1. The conception and design, or analysis and interpretation of data. 2. The drafting of the article or its critical review for important intellectual content. 3. The final approval of the version to be published. All these conditions must be met. The corresponding author is responsible for ensuring that all appropriate contributors are listed as authors, and that all authors have agreed with the content of the manuscript and its submission to the AE&M.

Experimental Subjects To be considered for publication, all clinical investigations described in submitted manuscripts must have been conducted in accordance with the guidelines of The Declaration of Helsinki, and must have been formally approved by the appropriate institutional review committees or their equivalent. The study populations should be described in detail. Subjects must be identified only by number or letter, not by initials or names. Photographs of patients’ faces should be included only if scientifically relevant. The authors must obtain written consent from the patient for the use of such photographs. For further details, see the Ethical Guidelines. Investigators must disclose potential conflict of interest to study participants and should indicate in the manuscript that they have done so.

Conflict of interest

Acknowledgments The Acknowledgments section should include the names of those people who contributed to a study but did not meet the requirements for authorship. The corresponding author is responsible for informing each person listed in the acknowledgment section that they have been included and providing them with a description of their contribution so they know the activity for which they are considered responsible. Each person listed in the acknowledgments must give permission – in writing, if possible – for the use of his or her name. It is the responsibility of the corresponding author to provide this information.

References References to the literature should be cited in numerical order (in parentheses) in the text and listed in the same numerical order at the end of the manuscript on a separate page or pages. The author is responsible for the accuracy of references. The number of references cited is limited for each category of submission, as indicated above.

Tables Tables should be submitted in the same format as the article (Word), and not in another format. Please note: we cannot accept tables as Excel files within the manuscript. Tables should be self-explanatory and the data they contain must not be duplicated in the text or figures. Tables must be constructed as simply as possible and be intelligible without reference to the text. Each table must have a concise heading. A description of experimental conditions may appear together with footnotes at the foot of the table. Tables must not simply duplicate the text or figures.

Figures and Legends All figures must display the figure number. Sizing the figure: the author is responsible for providing digital art that has been properly sized, cropped, and has adequate space between images. All color figures will be reproduced in full color in the online edition of the journal at no cost to the authors. Authors are requested to pay the cost of reproducing color figures in print (the publisher will provide price quotes upon acceptance of the manuscript).

Experimental Animals A statement confirming that all animal experimentation described in the manuscript was conducted in accordance with accepted standards of humane animal care, as outlined in the Ethical Guidelines, should be included in the manuscript.

Molecular Genetic Description • Use standard terminology for variants, providing rs numbers for all variants reported. These can be easily derived for novel variants uncovered by the study. Where rs numbers are provided, the details of the assay (primer sequences, PCR conditions, etc.) should be described very concisely. • Pedigrees should be drawn according to published standards (See Bennett et al. J Genet Counsel (2008) 17:424-433 - DOI 10.1007/s10897-008-9169-9).

Nomenclatures • For genes, use genetic notation and symbols approved by the HUGO Gene Nomenclature Committee (HGNC) – (http://www.genenames.org/). • For mutation nomenclature, please use the nomenclature guidelines suggested by the Human Genome Variation Society (http://www.hgvs.org/mutnomen/) • Provide information and a discussion of departures from Hardy-Weinberg equilibrium (HWE). The calculation of HWE may help uncover genotyping errors and impact on downstream analytical methods that assume HWE. • Provide raw genotype frequencies in addition to allele frequencies. It is also desirable to provide haplotype frequencies. • Whenever possible, drugs should be given their approved generic name. Where a proprietary (brand) name is used, it should begin with a capital letter. • Acronyms should be used sparingly and fully explained when first used.

Papers must be written in clear, concise English. Avoid jargon and neologisms. The journal is not prepared to undertake major correction of language, which is the responsibility of the author. Where English is not the first language of the authors, the paper must be checked by a native English speaker. For non-native English speakers and international authors who would like assistance with their writing before submission, we suggest Voxmed Medical Communications, American Journal Experts or PaperCheck. ISSN 2359-3997 © A&EM – Rua Botucatu, 572 – conjunto 83 – 04023-062 – São Paulo, SP, Brazil

A conflict of interest statement for all authors must be included in the main document, following the text, in the Acknowledgments section. If authors have no relevant conflict of interest to disclose, this should be indicated in the Acknowledgments section.