Riddles, Codes, & DNA by Science to Sage

I n t e r n a t i o n a l

E - M a g a z i n e

Riddles Codes &

D NA

Origins Music Repair Self-Biologist Sequencing art

Cover

Science to Sage

Lucy

West

The Evolution of a souls journey ... ...chills run up and down my spine as I type these next words; It is a gift to be an emotional, intellectual, creative being, a gift to be one small strand within the grand tapestry of Life and one small voice echoing throughout the unfolding Universe.

...on the Information Highway

Art & Words by Lucy West

Riddle

Bruce H. Lipton - Excerpts from “the Honeymoon Effect” , Self-Biologis Gregg Braden - Excerpts from “Deep Truth”, the Building Blocks of Life.. Dr. Miceal Ledwith - The Origins of the Human Race and the Implications for Our Spiritual Empowerment Today."

All material is copyrighted by Science to Sage or is

Codes & Pattern

Jef Harvey - DNA Repai

these articles with the consent of authors

Gregg Braden - Excerpts from “The God Code” Marko Rodin - "The Quantum Mechanic State of DNA

Conscious Media Network

Sequencing

Susan Alexjander, M.A. - The Infrared Frequencies of DNA Bases as Science & Musi

Awakening Zone Radio

Krishna Madappa - Kundalini – Chakras – DNA – Neurons –

Science to Sage E-

Prana

Magazine/  Anthony Morris - The Game Unpacked, DNA & Amino Acid

Gaiam TV  Banyen Books,

Karen Elkins Excerpts from “InsideOut: The Wisdom of Our

Va n c o u v e r, B C

Designer Universe

Lucy West - Cover Art and science in ar

”

O World

Riddles, Codes & DN

CONTENT

Special thanks to the contributors. I am grateful for their articles and inspired work. Their contribution and fascination with water enriches and transforms our understanding of our designer universe.

E-Zine & Radio

SCIENCE TO SAGE International

Themed, designed , layout and production by Karen Elkins The great minds of our time are

edge science and ancient

bringing a new renaissance. The

wisdom is bridging the heart and

fusion of ideas, disciplines, and

mind, science and spirituality,

cultures has always advanced

and East and West.

civilization, be it from the

Take a quantum leap in your

renaissance of the Middle East to

understanding of the mysteries

Middle Ages of Europe, again,

of our universe.

Samples

we stand at this crossroad. The new convergence of leading-

“Self-Biologist” the science of creating heaven on earth “Self-Biologist”: While the world’s population boasts a few cell biologists, the fact is we are all “self-biologists.”

By Bruce H. Lipton Ph.D Excerpts “The Honeymoon Effect” In 1967 I began my

rst experiments with cloning stem cells. Using a microscope, I

scanned cells in a culture dish of mixed cell types, seeking stem cells distinguished by their unique spindle shape. Then I placed a small glass ring around the selected cell, which allowed me to separate it from all the other cells in the dish. Finally, I used enzymes to release the cell from the dish so I could transfer a single stem cell into its own culture dish. Our stem cell culture medium contained a very potent cocktail of salts and nutrients that allowed stem cells to grow and replicate. The single stem cell I added to the culture dish divided about every ten hours in this medium. First there was one cell, then two, then four cells; after a week there were more than 50,000 cells in the dish. Since all of the cells were derived from the same parent cell, all of the cells were genetically identical

Now here is where the experiment becomes mind- blowing. I split the cell population and placed them into three different culture. Each of the three dishes had a distinct “environment,” a culture medium consisting of different biochemicals. In one dish the cells formed muscle; in the second dish the cells

formed bone; and in the third dish the cells formed fat

The profound question this experiment answered was this:

“What controls the fate of the cells?” Remember, all cells were genetically identical at the start so genes did not control the cells’ varying fates! Yes, it was the environment, the culture medium that controlled the expression of the cells. The fate and health of cells are a complement to their environment, a principle I described in The Biology of Belief (with a nod to James Carville’s advice in Bill Clinton’s presidential campaign) as

“It’s the

environment, stupid. My mentor Irv Konigsberg, one of the rst cell biologists to master the art of cloning stem cells, had pointed me in this direction right at the beginning of my career. When I

rst

started cloning cells, he told me that when the cultured cells you’re studying are ailing, you look

rst to the cell’s

environment, not the cell itself, for the cause: a healthy environment leads to healthy cells; a sick environment leads to sick cells. All of my experiments con rming that “It’s the environment, stupid” presaged the now booming

eld of

epigenetics, which in study after study is documenting how the environment controls the activity of genes.

Finally mainstream science has recognized

”

that genes do not determine the fate of cells.

How do these studies relate to you? When you see yourself in the mirror, you see a single human organism— you—looking back. However, this is

The Drive to Bond

a misperception. We are not “single” organisms; we are

There is a fundamental biological

made up of about 50 trillion cells! By strict de nition, a

imperative that propels you and

human being is a community of living organisms, our

every organism on this planet to

cells. More speci cally, a human is a “skin-covered”

be in a community, to be in

culture dish containing 50 trillion cells. Our blood is the

relationship with other organisms.

growth medium, the cell-controlling environment within

Whether you’re thinking about it

our skin-covered culture dish

consciously or not, your biology is pushing you to bond. In fact, the

In fact, it makes no difference to the fate

coming together of individuals in

of a cell if it is in a plastic- or a skin-

principle force that drives biological

community (starting with two) is a evolution, a phenomenon I call

covered culture dish.

spontaneous evolution, which I cover in depth in the book of the

Wherever it lives, its life is controlled by the culture

medium.

same name.

If you’re a survivor of multiple failed relationships, you may wonder why you keep trying. I can assure you that you don’t persist just for the (sometimes short-lived) good times. And you don’t persist because of TV ads featuring loving couples on tropical islands. You persist, despite your track record and despite dismal divorce statistics, because you are designed to bond. Human beings are not meant to live alone.

Illustration by Bob Mueller

Get the Vib...

Whether you’re in love or running from danger, your mind calibrates your blood’s biochemistry, which in turn controls your biology and genetics. The mind interprets your perceptions of the world and your brain goes to work to produce the biochemistry that

complements your perceptions

...when you “entangle” (quantum physics terminology) with someone else’s energy, you want the interference to be constructive (good vibes) not destructive (bad vibes). You want the interaction to increase your energy, not deplete it. Now that you understand the science behind a phenomenon that you’ve no doubt already noticed —that some people energize you and some people exhaust you—I hope you’ll make it a practice to surround yourself with people who enhance your energy.

To create The Honeymoon Effect in your life you’ll need to take advantage of your wonderful innate gift, the ability to sense good and bad vibrations If “reading” energetically transmitted messages sounds like woo-woo New Age speak to you, it’s not. Until recently, life scientists generally focused on studying the physical realm and left the invisible realm to followers of religion, of which I was not one What quantum physics teaches us is that everything we thought was physical is not physical. Instead, everything in this Universe is made out of immaterial energy, and everything radiates energy. It is a given fact of science that every atom and every molecule both radiates and absorbs light (energy). Because all organisms are made out of atoms and molecules, you and I and every living thing are radiating energy (“vibes”).

But when sodium and chlorine atoms get together, they “make chemistry.” They ful ll this Universe’s tendency to nd balance by combining—they lose their wobble and stabilize. Voilà! Through their pairing, each atom now has a complete outer shell, and together they spin in perfect balance. This is a relationship based upon ful lling each other’s needs As imbalanced individuals, we have a tendency to do the same thing that atoms do—we seek a complementary partner who is out of balance as well. When two partners complement each other’s imbalances, together they can spin “harmoniously” with no wobbles.

Wobble or Harmonious?

The weirdest characteristic of quantum physics is that these smaller subatomic particles are not made of matter— they are not physical at all. I love showing the following image of the Newtonian atom versus the quantum atom The Newtonian atom on the left can easily be illustrated in a concrete manner using marbles and ball bearings—it’s the solarsystem-like model on the left that you’ll recognize from school textbooks. The illustration of the “quantum atom” on the right looks like a mistake—it’s blank. That’s because quantum physicists have learned that there is no physical substance inside atoms; the subunits that comprise atoms are made out of extremely powerful invisible energy vortices, the equivalent of nano-tornados, not tangible matter. Matter, as it turns out, is a strange form of energy: it is not physical.

Vortexes of Energy

In the unconscious process of creating codependent relationships, you won’t lose any electrons but you may think you’re losing your mind living with the imbalanced partner your subconscious mind attracted, not the wonderful partner your conscious mind envisioned.

THE HIGH-MINDED, CREATIVE CONSCIOUS MIND ...let’s talk more about the relationship between the brain and the mind. The human brain is a physical device like a radio. The mind, both conscious and subconscious, is analogous to the programming you hear on the radio. The conscious mind is the seat of your personal identity. It identi es you as a distinct individual, a unique spirit. The conscious mind manages your personal wishes, desires, and aspirations. When I ask you what kind of relationships you want in your life, your lovely, high-minded answer comes from the conscious mind—I want a relationship based on love, equality, and respect as well as sexual chemistry. This is the “positive thinking” mind that optimistically sticks Post-it notes on the refrigerator that say, “I deserve a loving relationship” or “I eat healthy food.” This is also the creative mind that can look to the past and the future; it is not bound by time.

But wait a minute: if your conscious mind isn’t paying attention and “managing” the present moment because it’s busy thinking great thoughts, or daydreaming about the kind of life you want to live, who is left to manage the “show”? Neuroscience researchers tell us that because of the conscious mind’s ability to it from thought to thought, humans, on average, use their personally creative conscious mind to control their behavior-regulating cognitive activity (as I mentioned above, but it bears repeating) about 5 percent of the time. By default, the remaining 95 percent of our cognitive activity is controlled by previously

acquired programs downloaded into the subconscious mind I can yell all I want and blame all I want but I’m wasting my time simply because there’s nobody in the subconscious mind to respond to my rant! Demonizing your subconscious mind is akin to screaming at your television. Is your television good or bad? Neither. What are you watching? Don’t blame the television set, blame the programming! Is your subconscious mind good or bad? Neither. The subconscious mind is primarily an amazing record/playback mechanism that, unlike the conscious mind, expresses little creativity and has no sense of time. It is always in the present moment, doesn’t see a future, and certainly doesn’t listen or care when you yell at it Rather than demonizing or battling with your subconscious over its bothersome behavioral programs, it’s best to acknowledge its power.

Bruce H. Lipton Ph.D & Honey! A lifetime without Love is of no account Love is the Water of Life Drink it down with heart and soul —RUMI

Interview with Bruce on the Honeymoon Effect Here

Learn more about Your DN click her

Bruce H. Lipton, Ph.D., a pioneer in the new biology, is an internationally recognized leader in bridging science and spirit. A cell biologist by training, Bruce was on the faculty of the University of Wisconsin’s School of Medicine and later performed groundbreaking stem cell research at Stanford University. He is the best‐selling author of The Biology of Belief and the more recent Spontaneous Evolution, co‐authored with Steve Bhaerman. Bruce received the 2009 prestigious Goi Peace Award (Japan) in honor of his scienti c contribution to world harmony and more recently in 2012 was chosen as Peace Ambassador for the “Thousand Peace Flags” project of the Argentinian Mil Milenios de Paz

Website: www.brucelipton.com With Permission by Hay House

WATER

Self/Cells are Living in a Water/aether environment sh in that they

The very water we are conceived in and grow in

live in a water environment;

within the womb is hexagonal in structure, both

consequently, a tissue culture

inside and outside of cells. - Gerald Pollack

“Cells resemble

dish is like a miniature aquarium. Tissue culture medium, a chemically balanced solution that supports growth and viability, provides the cell’s environment.” - Bruce Lipton

Photo credits: Fuchs/Woisetschlaeger

DNA

In-form-ation Highway

Yo u a r e P u r e C h e m i s t ry You are chemistry in motion.

You make bonds like atoms. You cluster into groupings like particles that arrange themselves by frequency. All relationships evolve by ‘chemical’ bonds i.e. family, country Bonding is what keep us together, but once you lose that feeling of connection, you’re not in the same “state”, the bond is lost. This new state could be just a simple mood shift that is temporary or permanent. Consider that changing state is a natural part of life

and your personal evolution.

W h at i s Yo u r Culture?

The

rst map

describing the building blocks of life was established by James Watson and Francis Crick in 1953. Through their model of the DNA molecule, the door was opened for an entire science devoted to identifying people based on the genetic traits that make them who they are, and that also make them different from anyone else.

Building Blocks...

by Gregg Braden Re ecting upon this apparent quandary, Thomas H. Morgan, recipient of the 1933 Nobel Prize in physiology or medicine, stated that applying the “most rigid . . . tests used to distinguish wild species,” we do not “know of a single

instance of the transformation of one species into another.”

In On the Origin of Species, Darwin acknowledged this lack of evidence.. In his own words: As on the theory of natural selection an interminable number of intermediate forms must have existed . . . [w]hy do we not see these linking forms all around us? Why is not every geological formation charged with such links? We meet with no such evidence, and this is the most obvious and forcible of the many objections which may be urged against my theory.

Interesting Fossils, but They’re Not Us

Hugo Rheinhold's Affe mit Schädel (by Darwin Monkey)

DNA...your storage bi From eye and hair color, to gender, and the tendency toward developing certain diseases, the code for how our bodies look and work are stored in the blueprint of our genes, our DNA. Once Watson and Crick unlocked the code holding the evidence of our past, the science of matching segments of DNA to determine paternity, identify missing persons, and link perpetrators to crime scenes has become a keystone in the

elds of law

enforcement and forensic medicine. It has also become the foundation for one of the most successful crimesolving series in the history of television: CSI: Crime Scene Investigation In the year 1987, the same techniques used in CSI-type investigations—the results of which are accepted as evidence in the highest courts of law today—were applied to the study of human origins for only the second time in history. In 2000, researchers at the University of Glasgow Human Identi cation Centre published the results of their investigation comparing DNA from a species believed to be our ancestors to that of modern humans. Along with co-workers in Russia and Sweden, the scientists tested ancient DNA from an unusually well-preserved Neanderthal infant discovered in a limestone cave in northern Caucasus, at the border of Europe and Asia. The exceptional condition of the child’s remains is a story, and a mystery, unto itself. Normally such beautifully preserved remains are found only in frozen specimens, like those found in the icy polar regions. It was this state of preservation that allowed 30,000-year-old DNA from the infant to be compared to the DNA of humans today. It was also the rst time that such tests could be performed on a body that had already been carbon-dated. The study concluded that the possibility of a genetic link between Neanderthals and modern humans is remote. The report suggests that modern humans were not, in fact, descended from Neanderthals. While in theory the science of genetic comparison should solve the mystery of our ancestry, the results are actually raising more questions regarding our evolutionary lineage and origins,

and opening the door to “forbidden” territory.

The term early modern human (EMH), or anatomically modern human (AMH), has replaced Cro-Magnon as the descriptor for our closest ancestor. Scientists now believe that the physical differences between the bodies of contemporary humans and those of EMHs are so slight that they don’t justify a separate grouping. In other words, although ancient humans didn’t necessarily behave like us, they looked like us. Or, conversely, we still look like them: our appearance hasn’t changed much since our rst ancestors appeared on Earth about 200,000 years ago. This fact has proven to be a problem for those who look to slow evolutionary changes over long periods of time to explain how we’ve come to be as we are. In 2003, advances in DNA technology allowed for even more ambitious comparisons of ancient DNA. This time the tests compared Neanderthals and our earliest con rmed ancestors, the EMHs. The team of European scientists studied the DNA from two EMHs, one that was 23,000 years old and another that was 25,000 years old, with DNA from four Neanderthals between 29,000 and 42,000 years old. The ndings, published in Proceedings of the National Academy of Sciences, stated: “Our results add to the evidence collected previously in different elds, making the hypothesis of a ‘Neanderthal heritage’ very unlikely.”9 In other words, the Neanderthals portrayed as the cavemen in motion pictures and cartoons are not the ancestors of

EMHs. This means that we didn’t evolve from them, and they cannot be our ancestors

Skulls of 1. Gorilla 2. Australopithecine 3. Homo erectus 4. Neanderthal (La-Chapelle-auxSaints) 5. Steinheim Skull 6. Modern human

The Mystery of Fused DNA In other words, the two chromosomes that seem to be missing from our DNA appear to have been found, merged into a single new chromosome that is unique to us. Additionally, there are other characteristics of human and chimp genes that look almost identical.

Since the discovery of the genetic code, an additional mystery has emerged regarding the chromosomes that distinguish one species from another. Biological instructions are contained within the chromosomes for members of a species, determining things like the structure of their bones, the size of their brains, how they metabolize, and so on. Apes have 24 pairs of chromosomes, or a total of 48. Humans have 23 pairs, or a total of only 46. Although it looks like we’re “missing” an entire set of chromosomes compared to our nearest relatives, our genetic maps reveal an interesting curiosity. A closer look at where chromosomes appear to be absent from our genome shows that human chromosome 2 is remarkably similar—and actually “corresponds”—to chromosomes 12 and 13 of the chimpanzee, as if they somehow were combined (fused) into a single larger piece of DNA. Interestingly, this fusion occurred only in the case of humans. I’m including the technical terminology from the Proceedings of the National Academy of Sciences (October 1991) that describes this fusion: “We conclude that the locus cloned in cosmids c8.1 and c29B is the relic of an ancient telomere-telomere fusion and marks the point at which two ancestral ape chromosomes fused to give rise to human chromosome 2

How did this merging of DNA happen? Scientists simply don’t know. But the conclusion drawn from the studies opens a mysterious door that may allow us to ultimately nd the answer to this question. It’s the fact that these chromosomes are fused together, and the way they’re fused, that has led scientists to conclude that only a rare process could have given rise to such a genetic phenomenon. These studies are telling us that the arrangement of the DNA that makes human chromosome 2 (and us) unique is not something that we would normally expect from Darwin’s evolution through natural selection. What could have happened in the distant past to produce such changes in the fundamental code of life? The short answer is that we simply don’t know. Based upon a comparison of human and primate physiology, however, there is a growing body of evidence suggesting

that as Homo sapiens, we may not t neatly into a traditional tree of evolutionary steps.

New data from DNA, and the lack of fossil evidence supporting the notion of human evolution from lower primates, suggests that we may, in fact, be a species unique unto ourselves. Rather than being descendants of earlier forms of primates, this theory takes the approach that we’re separate and distinct from them. A comparison of primate and human characteristics such as bone density—and our ability to shed tears, perspire, and grow hair rather than fur—supports this theory, while fueling controversy for proponents of both creationism and evolutionary theory Although such ndings may ultimately raise more questions than they answer, each stage of investigation adds to what we know about ourselves and further de nes our place in the universe and in our role in creation. Additional evidence in the fossil record lends credibility to these studies, indicating that, while we may share genetic characteristics with less evolved forms of life, we’ve developed independently from them along our own genetic timeline. Ours may be a much older species than previously thought, and we may have changed very little with respect to evolution during our time here. Clearly, for both creationism and evolution, the sources of information are incomplete, leaving interpretations open to revision as new evidence comes to light. The partial list that follows gives an idea where the new science may be headed. It is a fact that . . . •

. . . the theory of living cells mutating randomly (evolving) over long periods of time does not explain the origin or complexities of human life

•

. . . the biological link between humans and earlier humanlike life-forms in our ancestral tree is inferred and not proven.

•

. . . DNA studies prove that we did not descend from Neanderthal families, as previously believed

•

. . . we have changed little since the early modern humans (EMHs) appeared about 200,000 years ago

•

. . . it’s unlikely that the DNA that makes us human and gives us our uniqueness could

…

have formed in the way it has from natural processes of evolution

Before we can answer the question of who are we, we must honestly consider the truths that we’ve asked science to reveal. In doing so, we quickly discover how the false assumptions of the past have led us into a proverbial rut on the road of discovery, where we are spinning our wheels in our search for the answers to life’s mysteries Discoveries that should make for bold headlines in magazines and mainstream papers

How do we understand who we are?

around the world, instead, are often relegated to obscure technical journals and newsletters with a limited number of technically minded subscribers. This may help us understand why our textbooks lag so far behind the discovery curve. It may also help us see where the thrust

Listen in Here

of exploration can lead with respect to the next great forays into the mysteries of our existence

Gregg Braden - Deep Truth - Conferenc YOU-Tub

• • • • • • •

For over 22 years, Gregg Braden has searched high mountain villages, remote monasteries and forgotten texts to uncover their timeless secrets. Combining his discoveries with the best science of today, his original research crosses the traditional boundaries of science, history, and religion offering fresh insights into ancient mysteries. In doing so he has rede ned our relationship to our inner and outer worlds, while sharing his life-af rming message of hope and possibility.Join Gregg through his highly acclaimed media specials, interviews, seminars, books and CD’s as he describes why the greatest epoch of peace, cooperation, and healing is yet to come!

About Gregg Seminars & Events Books, Audios & Videos Newsletter Resources Interviews & Articles Contact

Summary

DNA & Amino Acids The Game Unpacked by Anthony Morris

This section of ‘The Numerical Universe’ builds on, and is supportive of, an existing body of work that examines the numerical analysis of DNA and the Human Genome. Here I present a completely fresh look at the Group of 22 Amino Acids that are present in every living thing. This ‘fresh perspective’ was achieved by approaching the puzzle of DNA as a sort of ‘Game of Life’ and as if one was unpacking a game of Monopoly. As a

child, I had to know how many pieces there were, how many houses, cards etc. and was most especially keen to nd out exactly how much money came with the game.

Adenine (A) joins with Thymine (T)

Cytosine (C) joins with Guanine (G)

These Amino Acids are constructed using a possible 4 Bases, any 3 of which will form a Codon. The 4 Bases are paired exclusively so that

Any 3 from 4 gives 4 x 4 x 4 = 64 Possibilities

61 of these 64 Codons encode Amino Acids while the other 3 are ‘Start’ and ‘Stop’ codons.

KEY: H – Hydrogen P – Proton N – Neutron C – Carbon N – Nitrogen O – Oxygen S – Sulphur

I wanted to nd the smallest pieces and count them up. Each Amino Acid has a known chemical formula and we know that each element has a certain number of protons and neutrons which I reasonably considered to be the smallest pieces to the game.

My mind turned immediately to the 64 Hexagrams of the I Ching, which I have long been a student of, and also to the ancient game of Chess, played out on an 8 x 8 square. In particular, I really was struck with an image of an 8×8 chess board with the codons distributed across it.

Amino Acids have two parts to them, the so called Standard Block, common to all of them, and the Side Chain which is where all the ‘magic happens. I simply did an analysis of both the Standard Block and the Side Chain individually and then combined to see the numbers and relationships involved. The results were and are really quite surprising. The observations in this paper would seem to strongly suggest the existence of a primordial, numerical, geometric, and ultimately musical process, inherent to the 'Game of Life' and its origins, and further the ordering of the Universe in which we exist. As you will see, not a single Hydrogen atom, nor even a single proton or neutron can be omitted or

displaced without the entire musical perfection of the structure being lost completely. To say these numbers are random is akin to saying that Hamlet is the possible result of a monkey with a typewriter. With such a glaringly obvious numerical, geometric and musical structure, is it really likely that Life evolved stochastically from some primordial soup that was at one moment inanimate and the next animate? These findings mean that it is infinitely more likely that the origin of Life is the result of the inherent canonical, numerical, geometric and musical template that pervades the created Universe and has done since the moment of its inception.

anthony@marketharmony.com

Up-dated Version of DNA & Amino Acids

This work is licensed under a Crea ve Commons A ribu on-NonCommercial-NoDerivs 3.0 Unported License. tt

The observations in this paper would seem to strongly suggest the existence of a primordial, numerical, geometric, and ultimately musical process, inherent to the 'Game of Life'

More on DNA here

"The Origins

of the Human Race...

by Miceal Ledwith Most people know that for several

to experience every day. People

centuries Jewish and Christian believers

everywhere are making valiant efforts to

in the West were

escape from the web of fables we have

rmly convinced that

the universe was created six thousand

been spun for millennia.

has an enormous amount of evidence

major stumbling block in the way of being

that will empower that present-day

able to create the kind of reality we wish

journey.

its companion set of beliefs still act as a

What we now know about human origins

is the extent to which this conviction and

years ago. But what is not often realized

.”.. and the Implications for Our Spiritual Empowerment Today."

Origins

It's been over 350 years since the Irish Archbishop James Ussher and the Cambridge Professor John Lightfoot tried to calculate the age of the world, based largely on the evidence in the Bible. In my own theology lectures years ago the students would always laugh when I mentioned that Ussher and Lightfoot had calculated the world was created in the year 4004 BC on 23rd October at 9.00 a.m.. though the time of day was not given by Ussher himself. That was ne as a lighthearted tool for an undergraduate lecture designed to awaken students to the fact that things were seldom as they seem. Nevertheless the efforts of Ussher and Lightfoot were very creditable achievements for their time. The usual ridicule to which they are subjected is often mainly due to an unfortunate smallmindedness about the circumstance of a past that was "all so unimaginably different" in terms of lacking perspectives and information which we take for granted today.

To create such a chronology was no small achievement. The Bible as we have it today was assembled from many different manuscript sources, over a long period of time during the Middle Ages, and besides there are many gaps in the chronologies of the Bible texts themselves. So it was not just a simple matter of adding up the ages of all the signi cant people in the Bible between the creation and Jesus Christ. Extensive cross checking with many other sources outside the Bible was necessary in order to establish that chronology.

James Ussher It was largely due to an accident of history that Ussher's chronology became so well known and accepted worldwide, for there were already half a dozen other such chronologies equally well based, such as the chronology of Bede, Sir Isaac Newton and J o h a n n e s K e p l e r. H o w e v e r t h e n e w Authorized English translation of the Bible that was to gradually become known as "The King James Version" had appeared only a few decades before, and was only really attaining universal in uence by the middle of the seventeenth century. After Ussher's calculations were published in 1650 the various printings of the King James Bible worldwide began to insert Ussher's chronology into the margins of the text of the Bible itself. So it happened that before long those calculations themselves began to assume the very status of Holy Writ in people's minds. For centuries this effectively barred any signi cant inquiry into the dating of human origins in a more scienti c way.

That was an extremely unfortunate situation as a true understanding the circumstances of our origins is crucial in order to assume that power and strength which is the goal of our life's experience on this earth.

more than an attempt to edge God out of his own universe. By the dawn of the 19th century geology had calculated that life must have existed on earth for at least 250 million years. And this was long before any theory of evolution ever saw the light of day.

As the years passed open minded researchers found enormous problems in trying to reconcile the Ussher's calculation of a six thousand year old creation with the new facts about human origins that were beginning to emerge. Many saw the efforts of these researchers as nothing

Enormous clashes punctuated the early 19th century between the geologists and those who curiously accepted that belief in God stood or fell with the accuracy of Ussher's chronology.

Six Thousand Year VS

. Million

When Darwin's theory of evolution appeared, the issue of the age of the universe took a back seat in the priorities of believers, as they now had much more immediate crises on their hands. In place of the "God explanation" Darwin appeared to offer a much more reasonable mechanism by which life might have appeared, even though he never endorsed atheism or agnosticism in any shape or form.

Science's continuing attempts to date the creation continued to place the date farther and farther back in history until nally in 2003 NASA's Wilkinson Microwave probe calculated the age of the universe to be 13.7 billion years, with a margin of error of only 2%.

Twelve years ago a study of the human Y chromosome indicated that the human race appeared between 50,000-250,000 years ago. The present stage of research today inclines to a date well over 200 millennia ago. In addition it is crucial to note that the human race appeared very abruptly, at least in geological and anthropological terms. After a period of well over a million years in which there had been no progress, humans suddenly increased their brain capacity by half, developed the physiological changes needed to facilitate speech and assumed our modern biological make-up. How did this happen?

The suddenness of this appearance has posed enormous problems for anthropology and geology for years. It is only recently that more plausible explanations have been forthcoming. In biblical research many astute commentators had also long realized than the Book of Genesis was never intended to be a textbook of science which also provided a detailed chronology of the earliest days of human and world history. Today it is much more easy to understand what Genesis actually was talking about, which is wildly at variance with what both traditional style beliefs and traditional science had assumed was its message. By now I believe it must be clear to any serious researcher that there really has never yet been a serious debate between religious belief and science, but only between caricatures of each. But all these the major problems posed by scienti c advances in anthropology, biblical

studies, archeology and geology were only the beginning. In 1849 a massive collection of inscribed clay tablets in the ruins of the library of King Assurbanipal at Nineveh was discovered. That collection began to unfold a story whose remarkable implications about understanding who we really were, only emerged gradually, and that was well into the mid twentieth century. Scattered throughout the museums of the world there are over a quarter million tablets from Mesopotamia that go back more than ve thousand years in human history. Many of them tell a remarkably different version of how the human race came to be than we were familiar with. And now it appears some of our most sacred texts in the Bible may actually have been modeled on these earlier 'pagan' works, principally the Book of Genesis. Parallel to this research into the ancient texts, many practical archeological discoveries and investigations were taking place at almost all the so-called sacred sites throughout the world.

Common Ground

Marduk and the Dragon Marduk, chief god of Babylon, with his thunderbolts destroys Tiamat the dragon of primeval chaos

Indra of Indi Viracocha for the Incas

Megalithic Ideas for a Grasshopper And, there we saw the giants, the sons of Anak, which come of the giants: and we were in our own sight as grasshoppers, and so we were in their sight.

There were giants (also known as the Nephilim) in the earth in those days; and also after that, when the sons of God came in unto the daughters of men, and they bare children to them, the same became mighty men which were of old, men of renown.

— Genesis 6:

This research raised very many obvious puzzling questions. How could such advanced technologies have come into existence in so many different places all over the world at the same time, and with no obvious mean of communication between them as far as our records of the time went? These obvious questions were nothing in terms of impact compared to the less obvious ones that were now coming to the surface. Over the past ten years in particular, archeological investigations in South Africa, have given us a much more expanded understanding of the ancient peoples who walked this earth a quarter million years ago. Now it begins to appear that they may have been the designers and engineers of our physical bodies. Obviously to many elds in traditional science all of this was a mine eld. It was even more so to the traditional religions, who were now being asked to accept the hypothesis that the God of the traditional religions may have actually been a esh and blood being, however advanced in technology.

Many of the all too human-style attributes of God that we read of in the sacred Jewish and Christian texts - and that have always been the stock-in-trade of church preaching a n g e r, d i s p l e a s u r e a t d i s o b e d i e n c e , punishment, ckleness, vengeance and the desire to be worshipped, now take on a very different appearance indeed. The whole elaborate structure in which we believed we exist - a life of moral testing, a redemption worked for us by Jesus from the consequences of our sin, the need for

repentance, and a punishment or reward for eternity after death; all these and many another web of fables grew around such an all too human gure. It must be said such a caricature of God can have nothing to do with the real thing. Similarly, such a caricature of human destiny and purpose based on this kind of caricature of God has nothing to do with reality either, and this is a much more serious matter. It took a long time for us to recognize how bizarre those beliefs really were. But the real tragedy is not that, but the fact that those beliefs have totally crippled our ability to manifest. Furthermore, the routine religious practices put forward by the religions compound that crippling all afresh. Establishing the truth about the circumstances of humanity's origin has amassed a body of knowledge that has proven to be very unsettling to many, but those people who are open and perceptive have begun to see that for the rst time we now have the opportunity to understand where we really came from. What is even more important is that we now know in truth what it was we came here to do. This is a far more important issue than establishing the date of the creation of mankind, but establishing that date was a crucial step along the way that gave us a whole new vision of our place in creation. Had we been imprisoned in the conviction of a six thousand year old creation we could have never have become open to the new discoveries about reality that have come to light in recent times, and we could never have drawn the implications from that for our understanding of God and of human destiny and purpose

Open the door to understandings

New Giant Skulls Found http://www.youtube.com/watch? v=omm8Ey8vwbg

of much more major signi cance: How did we get here Who are we really?

Anunnaki Human DNA http://www.ashtarcommandcrew.net/ video/anunnaki-human-dna-2? xg_source=activityHistory http:// www.youtube.com/watch? v=MDHp5Bdqh0c

Anunnaki Secret History on Eart http://www.youtube.com/watch? v=UsEUYkh2Gpg

Anunnaki of Nibiru DNA Alignmen http://www.youtube.com/watch? v=a6Zzdf_p7qU

Anunnaki & Nibiru Everything you need to kno

http://www.youtube.com/watch? feature=endscreen&NR=1&v=29HCv _8kNM4

Is this universe all that exists? Are their other dimensions of reality? Given what we know about the structure of what exists is there any real justi cation for a radical division such as we have had for so long between matter and spirit, or between the natural and the supernatural? Are they not, after all, and however different from each other, only different stages along one continuum of reality

Was Jesus's promise that we could do all the miracles that he did meant to be taken literally after all? Or will fear, guilt, and the need to be taken care of, ultimately defeat the opening up to those new potentials within the human person which now, with the new understanding of our origins and later history, we have come to realize we have? Ultimately this is the greatest hurdle of all we have to overcome. People are willing to sacri ce almost anything except the belief in a benevolent Parent in the Skies, who has taken the place of the beloved parents they were lucky enough to have during childhood. This really is the last great test. The real truth is that when we are willing to move out of those beliefs that offer such spurious and deceptive comfort, it is only then that we can access a power and ability that can take greater care of us than any imaginary Benevolent Being in the Skies ever could. That power is the gateway through which humanity can open into real abilities, and freedom and creativity in manifestation, in which there can be no more room for lack, fear, guilt, troubles, sickness, crying or sorrow, but only emergence into the freedom and power of what all along, was our birthright.

“Let those who seek, continue seeking until they nd. When they nd, they will become troubled. When they become troubled they will be astonished . . . “Recognize what is in your sight, and that which is hidden from you will become plain to you.

Read More Here: http://issuu.com/ sciencetosage/ docs/1-

”

— THE LOST GOSPEL OF THOMAS

What it is possible for us to do?

Dr. Miceal Ledwith

Dr. Ledwith was featured in What The BLEEP Do We Know!? and Down the Rabbit Hole. Dr. Miceal Ledwith, L.Ph., L.D., D.D., LL.D (h.c), served as a Catholic priest and as Professor of Theology and College President for over 25 years in Ireland. During the course of his academic and administrative careers he lectured extensively to interested adult groups in many countries and continues to speak at venues all over the world today. He is a long-time member of Ramtha's School of Ancient Wisdom and has been invited to speak at Events held by the school for several years at many venues throughout the Given his life's experience and long years as a professional theologian Miceal Ledwith believes he is in a unique position to assist people who are also searching for information and answers, and to point the way so that they too can move towards nding the journey of discovery which he is on.

Order Produces Here

Start your 10 Free Tria

To assist in that way is the objective of both the DVD series and his forthcoming major work, "Forbidden Truth." His book "The Orb Phenomenon," co-authored with the German physicist Dr. Klaus Heinemannand his DVD "The Phenomenon of Orbs" are now "Forbidden Truth," which will be titled "Jesus of Nazareth," is forthcoming.

Gaiam TV.Co Click Here With Miceal Ledwith

http://hamburgeruniverse.com/

A Very Interesting Interview, Listen in... http://www.disclose.tv/action/viewvideo/122918/ Joseph_Farrell_Interview__Ancient_Giants_Cosmic_War/

"When they moved, the others moved; when they stopped, the others stopped; and when they rose from the earth, the wheels rose along with them; for the spirit of the living creatures [Cherubim] was in the wheels." Ezekiel 10:1

Japan’s Raising Sun

Marduk and his dragon Mušḫuššu, from a Babylonian cylinder seal

A Giant Leap for Mankind

"I looked, and, behold, a whirlwind came out of the north, a great cloud, and a re infolding itself ... the color of amber."

Victory stele of Naram-Sin/p/photo by Rama

Santa Barbara, Califorina Cave Drawings

Wheedling New Ideas Vedic Wisdom

The Pushpaka chariot that resembles Sun Chariot the Sun and belongs to my brother

was brought by the powerful Ravana; that aerial and excellent chariot going everywhere at will .... that chariot resembling a bright cloud in the sky ... and the King [Rama] got in, and the excellent chariot at the command of the Raghira, rose up into the

higher atmosphere. - Ramayana

Vedic

"Now war arose in heaven, Michael and his angels fighting against the dragon; and the dragon and his angels fought, but they were defeated and there was no longer any place for them in heaven. And the great dragon was thrown down, that ancient serpent, who is called the Devil and Satan, the deceiver of the whole world – he was thrown down to the earth, and his angels were thrown down with him."[8] — Revelations

Fighting the Dragon/Dinosaurs

by Mohonu/ Public Domain

Woman entwined by God K's (K'awiil's) serpent leg

Serpents raptured, captured, & conquered Christianity

India

Jesus and Krishna Conquer the Serpent

In this article we will cover recent advances in science as we outline some of the greatest challenges to raising the consciousness and wellness of humanity as well as reversing deliberate and accidental DNA damage we are exposed to daily.

DNA Repair

The challenge is our species was genetically manipulated eons ago ostensibly to advance our evolution many fold. If the records of the ancient past are accurate, we were far more advanced in past

civilizations than we are today.

Why? With genetically modi ed foods, estrogen mimicking additives, deliberate tainting of vaccines and personal care products, chronic disease is on the rise world wide. Many of the obstacles we face are due to ElectroMotive Force (EMF) pollution from sources including but not limited to radar, AM/FM broadcast towers, police,

and military transmission equipment, cellular phone systems (proven to damage the human organism). The constant bombardment by EMF not only weakens the immune system, in an individual with an already compromised immune system (diabetics, etc.) the damage further deepens the disease state. These factors coupled with airborne pollutants in the millions of tons annually (documented by the EPA), water borne and food borne toxins from our poisoned food supplies and aquifers causes genetic defects in adults and newborn infants.

By Jef Harvey

toxic load! toxic womb. Shortly thereafter, I attended a health symposium where it was revealed that the child in the womb takes on up to 50% of the mothers toxin load from the amniotic uid and the breast milk (the child MUST breast feed to get a good start in building an immune system)

Several years ago I was using the principles of homotoxicology to treat my patients with nutrient de cits and had great success. In those days I rarely came across a toxic infant unless they were vaccinated. Suddenly there was a very large increase in toxic infants that I could only attribute to a

The illustration you see above is the extracellular matrix (ECM) of the human body. This is where much of the toxin burden is stored that you are not able to excrete naturally. With a clean ECM and nutrient balanced interstitial uids surrounding our cells, the vesicles inside the cells can bring the nutrients into the cells so they have the resources needed to function and keep the genetic status quo. When the ECM is clogged, disease quickly follows.

When you absorb toxins, a healthy body with healthy information elds excretes these toxins via several mechanisms (phase 1 and

2 liver processes among others). If the information elds are corrupted due to the many stressors detailed above, the matrix must store what is not excreted. Once the ECM reaches a certain toxic level, the intracellular membrane breaks down and advanced disease states manifest due to dedifferentiation/pleomorphism. High quality organic nutriture like SpiruZAN (a combined Spirulina and Asaxanthin organic tablet) coupled with advanced water technology provided by the QAW Stirwand used in concert with the Heel Detox Kit can be used to drain the toxin burden.

The aquaporin channels of the cells are nano size tubes allowing millions of single water molecules (non-clustered) to hydrate the cell. Nobel prize winner Peter Agre is responsible for this discovery Increasing cellular voltage with electron donation technology to increase cellular hydration coupled with the scalar radionic hologram programmer solves the water problem, Read on to see how

Emanating from and surrounding every cell and particle of matter in the universe is a eld of information that provides the instructions/codes which direct matter as to how it is to function. If the data in this eld becomes corrupted, it can

For our bodies to ourish, we need a peaceful environment, balanced emotions, clean air, clean and energized water, high quality nutrients and much more.The QAW Stirring device on our site uses a proprietary blend of minerals to stimulate electron donation in water to make water up to 32.4% more absorbable as proven in human clinical trials with FDA approved testing procedures.

now be restored using the most advanced way to analyze information eld imbalances and correct them either locally or remotely. At JefTech we use the SE-5 1000 to modulate the information eld of toxins and pathogens in soils, air, our bodies, food and water. This reduces or eliminates the impact of fracking and municipal treatments of water supplies. The codes/tunings/ rates we use to correct or modulate information elds come from over 60 years of practitioners cataloging in rate books thousands of tuning rates for various elds (cell, organ, molecule, etc.) and comparing thousands of rate books for repeatable results. We ship the SE-5 1000 with approximately 17,000 codes. This type of scrutiny is why scalar based radionics (as opposed to orgonite) has garnered such widespread (US and Europe) acceptance and utilization in the hands of quali ed doctors. With professional use of these devices, and careful lifestyle (as in gentle daily exercise) and food selection, we can now combat the DNA damage as well as boost the bio eld of our bodies to make them resistant to these de cits,...especially the tremendous stress and in ammatory producing EMF soup we are immersed in every day and night

Uses for radionic technology go far beyond food and water. In our work with pollutants, we modify the eld of the substance to render it inactive. The material sciences are about to get an upgrade as we apply eld changes to improve performance and modify how a eld causes a substance to change its characteristics. Balancing the elds for DNA, regulatory systems (like neurotransmitters, the endocrine system and thousands of other elds) now enables us to successfully deal with detrimental DNA manipulation from Monsanto, Dupont and the rest of their ilk. Help is here and available NOW! As we burrow deeper into the coding of genetics, we will solve many more puzzles. Within a few short years, we envision tremendous changes to how the world does business, cares for each other and explores the furthest reaches of consciousness as scalar wave technology and radionics change the face of our planet. Several hundred thousand systems have been deployed world wide and we plan to deploy many more.

Balancing the Field

About Jeff Harve Jef spent six years in the United States Navy and was inducted into a watcher group that in ltrated many of the Jesuit Illuminati controlled military organizations. He was assigned to EC Division, an electronics unit and worked in the Intelligence Center on board the now decommissioned aircraft carrier CV-67. Today Jef is board certi ed in nutrition and specializes in homotoxicology for creating detoxi cation protocols utilizing homeopathics, oxygen species combined with hydrogen, and system speci c plant-based endocrine adaptogens delivered by traditional means as well as holographic methods. Jef provides the scalar systems used for coding holograms to various practitioners and companies entering the eld of holographics.. Current Research focuses on information eld modulation of matter, clinical research involving patterned frequency engram modulation of the Central Nervous System pain neuromatrix, activating dormant areas of the brain mind matrix, astral manipulation and consciousness projection in both animate and inanimate partners. He utilizes various leading edge technologies including, but not limited to radionic/torsion/ bio eld generators, Shiva and Shakti Neural Stimulation Systems and complex signal wave generation. As a military trained remote viewer and radionics technologist he assists the brain in directing energy patterns for various remote eld manipulation strategies including biological effects.

By Jef Harvey QN jef@jeftech.net

a field of information

Outside Informs, the Insides The womb is the stimulus package

rst intimate setting from which life incubates . It is a full sensory experience. It’s the preview of what is to come. What’s brewing

May we fulfill our sole purpose on earth - which is to discover our divinity and live it! - Lao and Walter Russell

As espoused by Joseph Chiton Pearce and Bruce Lipton, the life process begins within the womb. If a mother is stressed, the developing fetus will go into a stress response, influencing the ‘fight and flight’ part of the brain. In contrast a relaxed mother allows the blood to nourish the frontal lobe of the brain and stimulate the development of reason and intelligence. The ‘fight/flight response constricts this blood flow. Science has proven that we don’t learn while under stress – no flow, no go

GET STARTED TODAY! Enjoy GaiamTV.com FREE for 10 days & then just $9.95 per month. No Commitments. Cancel anytime.

DNA with David Wilcox We have previously learned the positive effect that light has on DNA. That concept is further explored as David Wilcock reveals the energetic secrets of the DNA molecule. David provides scienti c evidence showing that DNA molecules harness a non-electrical energy source and that holographic information can be transmitted into DNA to promote and restore health Discover how your DNA is written into the background of space-time, revealing that you are not just a part of the source eld, you are the universe expressing itself as biological life in this unique

presentation originally webcast April 15, 2013

The God Code Excerpts from the God Code by Gregg Braden

A REMARKABLE DISCOVERY LINKING the biblical alphabets of Hebrew and Arabic to modern chemistry reveals that a lost code—a translatable alphabet—and a clue to the mystery of our origins, has lived within us all along.

Applying this discovery to the language of life, the familiar elements of hydrogen, nitrogen, oxygen, and carbon that form our DNA may now be replaced with key letters of the ancient languages. In doing so, the code of all life is transformed into the words of a timeless message. Translated, the message reveals that the precise letters of God’s ancient name are encoded as the genetic information in every cell, of every life

The message reads:

“God/Eternal within the body.”

The meaning: Humankind is one f a m i l y, u n i t e d t h r o u g h a common heritage, and the result of an intentional act of creation!

before modern science veri ed such connections •

The odds that this relationship has occurred by “chance” are approximately 1 in 200,000

Clues found in the Sepher Yetzirah reveal the hidden link between the ancient elements of Fire, Air, and Water, and their direct equivalents in today’s language of chemistry —a correlation that has surprising results! Uncover the hidden relationship that bridges ancient and modern beliefs. “The Discovery,” applies this powerful link and continues our journey into the mystery of alphabets and The basic elements of DNA—hydrogen,

hidden letter codes.

nitrogen, oxygen, and carbon—translate directly to key letters of the Hebrew and

The remarkable

nding that reduces letters

Arabic alphabets

and elements to a common denominator of

In these languages, our genetic code

numbers allows us to compare “apples to

spells the ancient name of God. The same

apples,” and to correlate the oldest accounts

name lives within all humans, regardless of

of Genesis with the science of today.

their beliefs, actions, lifestyle, religion, or The personal name of God—the name

heritage •

This relationship was described in

recorded more than 3,500 years before our

sacred texts, such as the Hebrew

time—forms the very foundation of our DNA

Sepher Yetzirah, at least 1,000 years

•

Decoded, the message discloses the following undeniable facts:

(Genesis 1:2). It was “the spirit of God” that rst moved over the face of the earth “The Lord God formed Man from the dust of the earth . . .” - THE TORA “We created you out of dust . . .” - THE HOLY QURA

Elements Classical Element Five Element Period Tabl Alchemy

http://en.wikipedia.org/wiki/Five_elements

New discovery: Through determining their simple mass, the elements of DNA (hydrogen, nitrogen, oxygen, and carbon) within our bodies may now be replaced with four letters of the Hebrew alphabet: Yod, Hey, Vav, and Gimel, thus revealing that our DNA may be read literally as a translatable alphabet within each of our cells. The odds of these four letters randomly creating a meaningful message from the Hebrew alphabet are only 1 in 234,256, or the slim probability of .00042 percent

The term tetragrammaton (from Greek τετραγράμματον, meaning "four letters")[1][2] refers to

On June 26, 2000, the world watched in awe as the announcement was made that two competing companies, one private and one federal, had pooled their resources to produce the rst map of how the bases that form human DNA are arranged. In illustrating this map, seemingly endless streams of alphabetic letters were ashed upon our television screens and across the pages of popular magazines. The sequences, some of which were hundreds of letters long, represented the bases that had been identi ed at different places on the human DNA molecule. These combinations are known as genes. It is groups of genes that form the 23 pairs of living information (chromosomes) that make us unique as a species. Following is a portion of human chromosome 1 to illustrate the appearance of this code

the Hebrew theonym (Hebrew: ‫)יהוה‬ transliterated to the Latin letters YHWH. It may be derived from the verb that means "to be". - Wikepeida

GATCAATGAGGTGGACACCAGAGGCGGGGACTTGTAAATA A C A C T G G G C T G T A G G A G T G A T G G G G T T C A C C T C TA AT T C TA A G AT G G C TA G ATA A G C A T C T T T C A G G G T T G T G C T T C T A TCTAGAAGGTAGAGCTGTGTCGTTCAATAAAAGTCCTCAAG A G G T T G G T A A T A C G C A T GTTTAATAGTACAGTATGGTGACTATAGTCAACAATAATTTAT TGTACATTTTTAAATA

Two hundred and forty bases from a portion of human chromosome 1

The key to translating the code of DNA into a meaningful language is to apply the discovery that converts elements to letters. Based upon their matching values, hydrogen becomes the Hebrew letter Yod (Y), nitrogen becomes the letter Hey (H), oxygen becomes the letter Vav (V), and carbon becomes Gimel (G). These substitutions now reveal that the ancient form of God’s name, YH, exists as the literal chemistry of our genetic code. Through this bridge between God’s name and the elements of modern science, it now becomes possible to reveal the full mystery and nd even greater meaning in the ancient code that lives as each cell of our bodies

Diagrams as seen in the “God Code”

Illustration of the double-helix structure of DNA, showing how speci c bases always pair with one another: C with G, and A with T.

“Ten Se rot of Nothingness: One is the Breath of the Living God, Life of worlds. . . . This is the Holy Breath. Additionally, the rst chapters of Genesis relate that it is in a nonphysical form that the Creator was present during the time of creation (Genesis 1:2). It was “the spirit of God” that rst moved over the face of the earth The Sepher Yetzirah further describes the rst Hebrew letter to emerge from the void of creation as the Mother Letter that made the universe possible: Alef. Through a great, mystical “secret,” Alef then evolved into the rst element to appear in our universe, hydrogen, as well as the rst letter of God’s name: Yod. Modern theories of the Big Bang now suggest that hydrogen was the rst element to form from the energy released at the instant of creation, and remains as the single most abundant element in the universe. Both accounts appear to be describing the same element

”

Exodus reminds us in very speci c terms that the name YHVH was revealed as the personal name of God. In equally clear terms, we are shown that humankind is made “in the image” of God

Indeed, in the earliest descriptions of God, we are told that He is omnipresent and takes on a form in our world that cannot be seen with our eyes. Thus, He can be known only through His manifestations. The Sepher Yetzirah describes this nonphysical form of God’s presence as the “Breath” of God

The second aspect of our chemical name carries our relationship with God to a new level. Further, it describes precisely how God exists in our bodies. The next two letters (VG) of our name as Hebrew letter equivalents of DNA (YHVG) illustrate the nature of this relationship. In the science of gematria, it’s important to note the number codes of ancient alphabets are not sensitive to the order of the letters. Just as 1 + 2 and 2 + 1 both give us the same result of 3, the rules of letter codes permit the same considerations with letter values Additionally, within the mysteries of the Kabbalah, the reverse (altered) order of a given set of letters is often associated with alternate realms of creation. While the qualities related to such a mirror may vary, the meaning itself does not change. Thus, with consideration to the VG or GV of humankind’s name, YHVG, we may look to the literal translation for greater understanding

“Quantum Hologram,”

)

First Day of Creation (from the 1493 Nuremberg Chronicle Add-ons by Karen Elkins 2013!

Sepher Yetzirah - YOU-Tub http://www.youtube.com/watch?v=nct8IG4tDlU

Although the links between language and the elements fall short of de ning who the God of our prayers is, or what such a presence would a c t u a l l y l o o k l i k e , t h e y o ff e r u s a n unprecedented insight into our relationship with our world and one another. With respect to Figure 6.8, a number of conclusions immediately come to light When correlated with the Hebrew alphabet, the code of all life becomes a translatable message in our cells •

Different forms of DNA bases produce the message in varying degrees of repetition

•

50 percent of the message within our cells translates literally to “God/Eternal.

•

The remaining 50 percent of our genetic code translates to “within the body,” thus describing where we may nd God’s eternal nature in this world

In humankind’s most cherished traditions, we are reminded of our relationship to a greater power and the lasting nature of that relationship. At the very least, the discovery of God’s name within each cell of all life reveals a message, as well as a promise, that transcends any differences that we could ever impose upon one another. In a very real sense, the foundation of our existence is formed of an essence that is limitless, unbounded, and eternal.

New research began to suggest that the events of creation, from tiny subatomic particles to massive and distant galaxies, are somehow related. Acknowledging the existence of a previously unknown form of energy, scientists suddenly found themselves in the uncharted territory of a world where the line between traditional science and the mystical world of unseen forces became less clear Given names such as the “Mind of God,” “Nature’s Mind,” and the “Quantum Hologram,” this previously unrecognized eld of energy is described as a force that is everywhere all of the time, has been in existence from the time of the Beginning, and exhibits a form of intelligence that responds to our deepest emotions. In modern terms, such descriptions sound strikingly similar to ancient references to the presence of God

The H in the YHVH of God’s name is replaced by G in the YHVG of Humankind. Through language, this illustrates that, while we share three of the four letters of God’s personal name as our genetic code, we are not equal to God—25 percent of our composition is very different. It is this difference that gives us our physicality and accounts for our uniqueness as a species.

”

Diagram as seen in the “God Code”

Mind of God

Start your 10 Free Tria

By Gregg Brade With Permission by Hay House

Click Here See Review According to noted author and lecturer Gregg Braden, there is a code embedded in our cells that links us all, and this code can be the key to bridging the dif culties that separate us as individuals and cultures Gregg Braden possesses a rare combination of scienti c acumen and a vast knowledge of spiritual texts. While researching his latest book, The God Code, he discovered that we are at a time in history where the easy lessons are past and the time has come to dig deep and learn the big lessons

From his groundbreaking books, Awakening to Zero Point and Walking Between the Worlds, to his pioneering work in The Isaiah Effect, Braden offers meaningful solutions to the challenges of our time

• • • • • • •

About Gregg Seminars & Events Books, Audios & Videos Newsletter Resources Interviews & Articles Contact

Jacob’s Ladder Know that your DNA ladder informs your membrane (memory/brain) and maybe even the cosmic brain! DNA’s spiral structure, just like electrical wiring, sends “currents”, (your current issues) and “charges” (your charges) through its network. This gives rise to an impulse (your pulse), causing muscles to contract. This kind of power surges also works in outer space as well as in your inner space It’s the kind of “charge” in a situation that drives the energy up or down the scale. So on the score card of life how are you doing

on the stairway to heaven?

DNA

of Bases, as Science and Music

Susan Alexjander, M.A.

The Infrared Frequencies

The story that presents itself as one works with the spectral tones of DNA is one of underlying beauty and order...an order suggesting freedom to express and improvise within the matrix. The fact that perfect harmonic ratios exist within its frequency data could, and should, lead to further

Abstract

stories of interconnectedness with the In 1988 the author and biologist Dr.

rest of life and the universe, since so

David Deamer collaborated on a

much of our world is so ordered. We

science/art project which consisted

express creatively through harmonic

of measuring the vibrational frequencies of the four DNA base molecules, translating them into 'sound,' programming them into a

proportions and their variations in our music, our architecture, paintings, dance - in virtually all that we are and

Yamaha synthesizer and using this

do down to the design of a pack of

tuning system as the basis for

cards, using the Golden Rectangle

original compositions entitled

(whose sides have a phi relationship).

Sequencia (1990 and '94 CD). The realization of biological, infrared frequencies into sound has resulted in unusual insights into the harmonic fabric of DNA, and reactions from listeners suggest that our bodies may have a way of recognizing

their

own

electromagnetic patterns through

the resonance of tone

Methods and Materials: The Science

There are about three billion base pairs in the DNA of each human cell. If they were strung out they would measure about three feet long. Yet each of these bases remains absolutely consistent in its chemical makeup. The four DNA bases, adenine, cytosine, guanine and thymine, consist each of carbon, hydrogen, oxygen and nitrogen. There exists a variety of chemical structures, including C=O, N-H, C-H, O-H, and C-O whose bonds bend, stretch, and rock upon absorbing infrared light with a speci c frequency related to the energy and strength of the bond and the mass of the nucleus of the atom. A tighter, smaller bond from, say, hydrogen, will absorb light with a higher wavenumber (number of waves per centimeter), and a higher 'note' in the infrared spectrum. (The original energy for these motions comes from the sun in the form of infrared radiation. Solar photons cause heating in the molecule as orbiting electrons jump to a higher energy state).

Spectrophotometer readout of wavenumbers fro DNA base adenine.

The process of "collecting" frequencies from the bases of DNA begins with a spectrophotometer, a device about the size of a breadbox. In this instrument, infrared light with frequencies ranging from 600 to 3000 wave numbers (in units of cm-1) is passed through the sample, in this case a base molecule of DNA. The bases of DNA and RNA have certain resonance frequencies related to the absorption of infrared light. This is a common property of all organic molecules, and in fact infrared spectra are used as a primary diagnostic characteristic in analytical procedures

As the light is passed through the sample, it is absorbed by the sample at speci c frequencies and the instrument plots the absorption bands

as a spectrum a process analogous to a glass chime sounding when it is struck. For example, the C-H (carbon-hydrogen) bond absorbs infrared light with a wavenumber of approximately 2900 cm-1 (Spectrophotometer readouts of wave numbers of the four DNA bases: adenine, guanine, thymine and cytosine) These gigantic hertz numbers are problematic in two ways. First, they are light frequencies, not sound. And second, they are too high to be heard, even if they were sound, since our ears can only register frequencies between 20 20,000 Hz. Below 20, vibrations are 'felt' rather than heard, and frequencies above 20,000 belong to ears more discerning than ours

The problem of getting the frequencies within hearing range can be solved by recognizing that any hertz number divided in half or doubled will produce its corresponding lower or upper octave, respectively, whether it be sound or light. Thus, 8.7 x 1013 Hz can be divided in half, again and again, to create lower and lower octaves. Finally we derive, after dividing 36 times, a workable frequency which, if it were sound, would fall within the range of hearing. Thus we would have for the example above 1266, which is a very comfortable frequency for the ear, corresponding to a (slightly sharp) D#

The question of 'translating' light into sound is more a philosophical one. Sound sped up can of course never be light, since the former depends upon molecules to push around while the second derives from electromagnetic radiation. One could argue that what is important here is not so much the medium but the ratios involved; the relationships between frequencies. The ears can detect about 10 octaves of sound, while the eyes can only perceive a little over one octave of light, or color. An octave in light is the same ratio as an octave in sound....2:1. A perfect fth, or a relationship of 3:2 is the same proportion in light as in sound (and can be continued into the world of geometry, architecture, movements of the planets and so forth; anywhere there is a periodic or regular vibration). By discovering patterns of ratios in light, we are simply translating into a sound medium to "hear" what information they might contain and how they relate to each other. It could also be argued that both light and sound refer back to a common archetype which, as yet, is unknown

to us, not unlike cousins who relate back to a common relative Again, four base molecules were measured: adenine, cytosine, guanine and thymine. Each base molecule after being subjected to light yielded about 15 or 18 frequencies; 60 in all. Once this data was collected, it was iterized down into a hearing range and programmed into a Yamaha DX7 IID synthesizer which would create sound banks from any hertz numbers provided as input. A special electronic keyboard was needed because the tunings that were derived were almost all microtones, or tones smaller than a normal half-step (for instance any c to c#) on a piano The tuning system on ordinary keyboards is an arti cial one, based on and adapted from the natural harmonic series. Around the time of J.S. Bach, equal temperament as a favored tuning system came into being to solve the problem of modulating through different keys. (Bach did not entirely welcome it. Its sound was inferior to the sweet concordances of just intonation). Equal temperament divides the keyboard octave into twelve equal parts, assigning a measurement of 1200 cents to the octave, with each half-step being 100 cents. Half-steps are of course xed on the piano, but a violin could play a variety of c#s, anywhere from 50 cents to 99 cents away from the original C, and then 50 cents above the c#. These are de ned as microtones, and are often considered harsh and out-of-tune to our Western ears, except for the wonderful 'bent' pitches found, for example, in Blues, Folk, and so on. Other cultures such as those of the Middle East, Asia and India have been creating music with microtonal scales for centuries

Story: The Art Before describing what the tunings sounded like, it is of interest to address a rational for doing this at all. Pythagorus (6thC BC), who is credited with explaining musical harmonics to the Western world, is reputed to have described a stone as frozen music (1. Homage to Pythagoras). He knew nothing of physics but intuited that the mathematics of frequency which occur in processes such as planetary rotations, cycles of the seasons, right down to the atomic world of elemental matter, are not just lifeless pieces of data but reveal movements, rhythms, relationships and meanings which may be loosely translated as 'stories.' Stories in turn generate meanings and artistic expression. The word 'mathema' comes from the Old French 'mathein', "to be aware; to awaken. The art, then, assists in 'telling the story' of the data. It is mythic as well as 'mathic.' There is a reasonable degree of certainty that deep within

our molecular beings, beauty will show up as a central issue. It can be found in all other stellar, planetary and natural processes, in the growth of a ower or wanderings of a river; why not DNA? At another level, if the body recognized itself in sound, might this mean something in terms of health, or at the very least, inspire the imagination, and help to understand our adaptation to the environment, or to persistent stimuli? The process unfolds, but really, all we want to know is - will I Iike these sounds

Microtonal World A rst hearing of these 60 pitches from infrared spectra was discouraging. The scales and clusters they created sounded so strange and alien that one despairs at rst of ever creating a beautiful work of art, or making any coherent 'sense' out of them. An overall description might be "tight relationships... densely packed microtones, with curious leaps.

Adenin Guanin Thymin Cytosine

Placement of DNA frequencies for each base molecule arrange

from “low” to “high” on a keyboard.

The four individual bases - adenine, cytosine, guanine and thymine - are very similar in terms of the ratio relationships, or the distances between the separate 'pitches' within each base. If they are con gured like a musical scale, arranged from lowest frequency to the highest, there is about a 2 and l/2 octave span for all four with a noticeable gap, or distance, of a Major 6th/ minor 7th in all bases. Intervals on the keyboard are named major and minor seconds, thirds, sixths, and sevenths, depending on how many steps they are away from the beginning note, or tonic. A Major 6th in the scale of C would be C to the sixth note, or A, above, and a minor 7th would be C to B at above. (To sing a minor 7th interval, begin Bernstein's "There's a Place For Us" from West Side Story. "There's a...." = a minor 7th). In addition to major and minor intervals, we also recognize the Perfect fourth (C to F), the Perfect fth (C to G) and the tritone (C to

Using Editor Librarian and Vision software on a Macintosh computer, the DNA tunings were programmed in as microtonal "scales" for each base

)

[Figure #2] (Infrared tunings and musical scales.

F#), the interval which cuts the scale perfectly in half The smaller, microtonal intervals, or ratios, tend to rub against each other when heard, creating beats. Beats occur when two frequencies are extremely close together...within a few hertz of each other such as 254 and 257 Hz...two very slightly different middle Cs. The frequencies will be heard as the same pitch, C, but slightly out-ofphase. The phasing results in occasional louder moments, or "wa-wa" beats, when they do phase together. To the ear this bears a striking resemblance to the quality of 'aliveness.'......or organic movement found in any living process As these microtones were played over and over on the synthesizer, some arrestingly beautiful combinations began to appear, but, what to do with them

Compositional Considerations Microtones present formidable complications for composers, not to mention performers. First of all it is virtually impossible to play them on a normal keyboard. Microtonal scales can be mastered, with practice, by those performing on stringed instruments such as cellos and violins, who can play any pitch on their string, once they have found it. However, microtones are often too dif cult for many ' xed pitched' instruments such as clarinets and trumpets. The voice has the easiest time matching microtones. If a singer's ear can hear it, s/he can produce it. And percussionists, of course, need not worry about them at all In addition to dif culty of tone production, microtones play havoc with the idea of 'key,' or tonality. What one is working with is a clump of 'random' sounds with no seeming tone order or organization at all. However, something very interesting began to happen. After weeks and weeks of experimenting with different sound combinations on the synthesizer, a tonal center began to emerge. One pitch seemed to draw other pitches to it...to lend coherency to the mass. This pitch turned out to be a kind of a C#, common to all the bases • • • • •

Adenine: 545.6 H Guanine: 55 Average Hz = 544. Thymine: 543. Cytosine: 537.

Most pianos are tuned to around 554 for C#. An acute ear would be able to discriminate between 554 and 544....an approximate 1/4 tone. It is important to emphasize that this discovery was cemented musically in the compositions rst by the ear, and not by the data. The above numbers were only discovered

later. If one looks at the pitch chart (Fig. 2) one can see that this C# is found in all four bases almost exactly in the middle of each column. Also, it is positioned almost exactly in the center of the absorbency rates, and shows up as the average. This C# seems to act as a balancer for the entire spectrum of frequencies The pitch which shows up the most frequently and ought to have asserted itself as a tonic, or tonal center, is F#. It is found no less than three times in each base collection. But instead it is its fth, the C#, which acts as the organizing force. The rst composition, Sequencia, was written for tabla, or tuned drum, with the drum tuned to C#. The drum keeps a steady rhythm throughout the ensemble sections. While the synthesizer plays an ostinato, or repeating pattern, with the original sounds of the frequencies, the added instruments- violin, cello and voice - revolve harmonically around this central stabilizing force and match the tunings with their melodic shapings It is interesting to observe that most of the gongs, bells and drums of the non-Western world are tuned to this keynote, suggesting further that perhaps we, as a planet (not to mention as a body), may be trying to collectively tune to something. One theory involves a recently discovered pulsar called Vela X (PSR 0833) which collapsed into its pulsar state about 11,000 years ago. It is beaming radio waves towards earth with a period frequency of 11.24Hz, or an F# equivalent (2. Encyclopedia of Science & Technology). Its fth, or C#, turns out to be a frequency of 16.86 or 539.52.....exceedingly close to our DNA 544. The emissions, scientists think, come from a combination of spin and strong magnetic elds. No one knows for sure if these emissions and their periodicities, which are regular, have an effect upon our energy elds

The Doryphoros is assumed to be also described by the Golden Proportion characteristic numbers, according for example to Gyorgy Doczi, The Power of Limits: Proportional Harmonies in Nature, Art and Architecture

They most certainly are.

By comparing all 60 pitches one can nd all of the precise ratios found in the rst 16 harmonics of the overtone series: octaves, P5th, P4ths, Major and minor thirds, Major and minor 2nds and 7ths; even a ' at' seventh. Mathematically, the odds of this happening at random are almost non-existent. This author has not taken the time to measure the higher harmonics, but Randy Masters of Aptos, California, is re ning this step of the process (3. personal conversation). He is trying to discover a fundamental that could possibly be generating all of the DNA frequencies as overtones. This nding would be invaluable to all those involved in sound and the healing arts as well as scientists, and artists The compositions did not make particular, conscious use of the simpler, perfect ratios. But the ratios are there, doing their work, as are all the microtonal relationships. What is more important is the raw sound. Eikos, for instance, (only on the CD recording) pays extreme attention to the way the violin enters into, explores and leaves single synthesized tones. Its energy is zen-like; subterranean, with a playful middle section

It is not known what information is encoded in these ratios, but one particular pattern appears striking. Figure #3 shows a curious leap in all four bases from the pitch F# up to the D# above, roughly a Major 6th/minor 7th. The interval in-between, G to D, contains no measurable frequencies at all. Its mirror, the G to D an octave below, contains a tightly packed cluster of 22 frequencies, over a third of the total frequencies measured

Are The Frequencies in DNA Bases Harmonically Ordered?

What is the function of this 'shadow' gap? Is it just a coincidence, or are we looking into some kind of anti-matter, fourth dimension? More and more we are nding that things contain their complements; their opposites. It is almost a given 'law' of the universe. This 'gap' could be important, especially because both are balanced on their lower and upper edges by D#-F# intervals: nine pitches in the lower cluster and 10 pitches in the upper cluster. Almost perfect symmetry

Possible Physiological Manifestations Through the DNA Code "The trick is to hear the music that is the body.   If we can do so, the meaning of the body can be transformed. It becomes not a blind, silent, doomed machine but a glorious composition,   a part of God's oeuvre... 'The Great Tone.'"  Meaning and Medicine, Larry Dossey, M.D Again, MATH makes processes visible. It decodes meanings. We can see the selforganizing power of the universe, and because the universe is a community it is constantly communicating. Are the sounds of DNA communicating anything to us Sequencia rst begins to communicate through its concept, that we can hear the hidden beauty of life. This helps to give us a perspective - to nd our place in the "Great Tone." This comes directly out of the ancient Greek de nition of education: the purpose of studying science and the natural world is to nd our proper place in it, allowing us to ful ll our role in the larger pattern. It is truly "student-centered learning," and the natural world is the primary educator. Art processes which translate directly from nature allow us deeper access into levels of being. And art is of course a celebration

Music, or organized sound, is just about perfect as a metaphor for life. It is born, goes through a process of evolution and transformation, perhaps repeats itself or creates new avenues of life, and dies. (If you really listen, after it is over you can still hear the sounds continuing). The components of music express a yearning for balance. Energy is gathered together for forward motion, and then is released. Pulses, small ones for frequencies, larger ones for rhythms, and still larger ones for phrasing all act in concert. Relationships are constantly forming and reforming as new tones, rhythms and events come into the picture and others recede Music is the active way we live our lives; the way we like our lives to be. It is the very life process itself. If the music doesn't ow we are deeply disturbed. How long can you tolerate a stuck recording? Bringing physics into the picture adds to this metaphor. Music (literally) mirrors the essence of nature itself in its chaos patterns and mathematics

The same mathematical formula that characterizes the ebb and ow of music has been discovered to exist widely in nature: the ow of a river, beating of a human heart, the wobbling of the earth's axis. This is more than just simple pulse. The rhythms closely resemble irregular patterns of coastlines, clouds and mountain ranges, and other natural scenery. The brain must, then, on

The second way Sequencia communicates is simply because it is music. This is more than a casual statement. We are attracted, often like moths to a ame, to music. One explanation is that composed music can be seen as a metaphor for life itself

some level perceive its reality as a musical, complex landscape. And turning this around, the music we hear must feel like our earthly home. No wonder we love it It is likely that something unusual is being communicated directly through the combinations and ratios of spectral music. The descriptive adjectives one hears most often are: soothing, comfortable, a feeling of spaciousness, expansion. Sequencia is not "new age" or demonstration music, nor was it composed it to "heal" anyone. It was written because that is what a composer does in the world; write music. But after ten years of hearing unique reactions and virtually no complaints from those who hear these strange tunings for the rst time, one cannot help but wonder what is going on. Some listeners admit that they never (or hardly ever) listen to music because it 'interferes with what is going on in their heads' or is too invasive. However, they love, even crave, these DNA sounds. About one in every 4 or 5 persons has a deep, almost devotional response. Movement teachers love it, saying their students respond deeply. Would people react in the same way to compositions employing 60 random, microtonal combinations? Who knows? And certainly there are endless styles of tonal arrangement, given the same musical materials to begin with. But these particular DNA ratios, originating in light, are profoundly arresting to the ear. This rst wakes up the nervous system, puts it on alert. What follows in sound is then allowed to enter our psyches on a deep level. People report feelings of connectedness, familiarity. "I feel right at home," they say. It is tempting to speculate that the body is recognizing itself, and is communicating this to the psyche

"See deep enough, and you see musically; the heart of Nature being everywhere music, if you can only reach it.

—Thomas Carlyle

The Impact of Sound

their voices, the client's voice, or by machine.

Upon The Body

allowing the patient's natural healing ability to

No one knows how sound, the raw stuff of

chaos and static

Their methods can often create coherency, take over. This harmonious state can clear up

creation, impacts our being; our consciousness. Mysteriously, we decode meanings which come to us through sonic carrier waves, perceiving these waves as a full-

Communication on all levels, physiological and emotional, often becomes clearer and brighter; healthier. Nature loves these resonant states where very little energy is wasted

body experience not only through the ears but directly through the bones, tissue and matter of

There is every reason to believe that our

the body. The body mass feels sound as

psyches and physiologies can recognize the

pressure. We know that the body is constantly

light, infrared patterns of life through the

piezoelectric, translating pressure into electrical

resonance of sound. What we do with that

signals, such as the way in which the inner

information is anyone's guess

ears send signals to the brain. Sound, therefore, impacts the many realms of the

Conclusions

molecular world directly and somehow nds its way to the parts of us that make meanings

Certainly the freedom to express and improvise

We know for sure from the work of many medical institutions that sound can affect hormonal levels and other physiological systems of the body. Dr. Valerie Hunt of Malibu Beach, Ca. (4. In nite Mind: The Science of Human Vibrations.), has done extensive work measuring the strengthening effects of sound upon the auric

eld, the energy

eld

surrounding the body. Dr. Hunt did most of her

thousands of years. Our music has always re ected these two things: a love for order and spontaneity. DNA, the chemistry of life, seems naturally at home in a musical venue. For in our inner beings and in our listening there has always been a deep yearning; a knowingness that music is who we are. The mystic Su poet Rumi said it best

research while a professor at UCLA. And there

"All day and night, music. A quiet, bright

is no doubt that a sophisticated knowledge of

reedsong. If it fades, we fade.

resonance has led many practioners and

Quatrains, Rumi

researchers throughout the world to use sound in a variety of successful ways. Some introduce

sound frequencies directly into the body with

has been our salvation as a species for

Sequencia: Eikos DNA Music/DNA Suite DNA Music

About Susan

has a Master’s degree in

Theory and Composition from San Jose State University in California. Her compositions have been performed throughout the United States, including collaborations with dance companies, lmmakers and sculptors for gallery installations In addition to a twenty year university‐level teaching career in music, she is an avid presenter of workshops on the physics and metaphysics of sound. Her main love since 1988 has been to research vibrational frequencies from the natural world of molecules, stars, elements, body rhythms, time cycles, water etc., and to translate those patterns into sound. This is motivated by a desire to hear the dance; the sonic landscape in which “everything is, on some level, communicating with everything else. Her album Sequencia is internationally known for pioneering sound based on the molecular frequencies of DNA, and has been featured on major radio stations, galleries and exhibits throughout the world. Her lm soundtracks with lmmaker Diana Hobson have been featured in Europe and the US.

”

For more, visit: www.OurSoundUniverse.com

Susan Alexjander

By David Deamer & Suan Alexjander SEQUENCIA is a unique and lyrical celebration of the miracle of life. The songs of SEQUENCIA are derived and inspired by the resonant frequencies of DNA, the complex building block molecule that contains the blueprints for all life on earth. Adjusted to the registers of the human ear, SEQUENCIA offers an exciting and unusual glimpse into the often haunting, often beautiful whispers of the invisible world within In SEQUENCIA, raw data derived from the light absorption spectra of the four bases (adenine, cytosine, thymine, guanine) that make up the DNA molecule is converted into sonic frequencies. These are programmed to a Macintosh computer and sent to a synthesizer, and then arranged into four pitch collections (or four 'scales' based on the individual base molecules). These synthesized notes mixed with vocals, cello, tabla, and violin become the palettes for Alexjander's compositions, which range from somber and zen-like to fanciful and improvisational

Your DNA is Noted

Nature has already discovered that the principles of sound and sequence are the perfect tools to build biological entities ef ciently, expressively and musically Wave genetics has successfully proven that without sound, DNA could not function and it is at this point that musicians and composers step in to provide an artistic expression to this data purely to bring these elements into the range of human hearing for a greater appreciation of the workings of creation DNA music has been developed since the early 1970’s when Geneticists found it easier to read the ling strands of DNA code by assigning pitches to the 22 Amino Acids

By Stuart Mitchell

Harmonic Interference Theor

by Richard Merrick

DNA

"The Quantum Mechanic State of DNA Sequencing"

Marko Rodin

Created by User:Vossman

Rodin’s Vortex Based Mathematics,

DNA and Microbiology Rodin discovered that DNA is not comprised of two helices but from three with the third helix being invisible and occupying a displacement space called the Major Groove which is located in between the two helical strands. Nature abhors a vacuum. This Major Groove is not empty, instead it’s where information for genetic coding exists. Rodin’s Vortex Based Mathematics is a schematic for life revealing that inside the Major Groove of DNA exists a higher dimensional Bioaetheric Template (Morphogenetic Field) de ned by the mathematical number pattern 3, 9, 6, 6, 9, 3 revealing the existence of an All- Coherent higher intelligence guiding evolution Selective splicing of novel DNA sequence combinations are able to be performed at will for medical treatment and the elimination of diseases by utilizing these higher

dimensional Flux Fields to control DNA cleavage and receptor sites Maxwell previously stated that there needs to exist a Monopole to symmetrize all of his electrical equations. Rodin’s math is a blueprint that gives us the ability to observe this missing Monopole in the form of an Inertia Aether Flux represented by the number 9 and it’s associated Magnetic Field represented by the numbers 3 & 6 which are perfectly nested in unison within the Major Groove of DNA The backbone of DNA’s double spiral helix is comprised of phosphates and phosphates are known to always have a negative electric charge and obviously with any negative electric charge there is always going to be an associated magnetic eld

The magnitude and direction of an electric field generated by two oppositely charged, point-like particles. The magnitude and direction of an electric field generated by two oppositely charged, point-like particles.

Creative Commons Attribution-Share Alike 3.0 Unportedhttps://en.wikipedia.org/wiki/File:Field-illustrations-add.png

Rodin Microscopic Underpinning Nested Vortices Every continuous medium has the inherent capability to be superconductive based on harmonic cascadence. Examples of continuous mediums, in the form of a toroidal matrix, are tornados, hurricanes, water spouts, solar systems, galaxies, black holes/white holes and maelstroms. There are many other examples of localized spacetime implosions which Rodin refers to as underpinning nested vortices. Whether energy is maintained and survives in the form of a toroid, or DNA spiral helix, or goes through mitosis and duplicates itself, is determined by whether or not nested

underpinning vortices are staggered or aligned in their World Boundary Condition Rodin Medical Devices Marko Rodin has the most advanced technologies for medical devices that include unique elds & frequencies,elation elds, incensory biometrictreatments. Several existing medical products have incorporated the Rodin Coil into their design. Applications of this technology include improved designs of MRI & imaging machines for visualization of the internal structure and function of neurological (brain), musculoskeletal, cardiovascular, and oncological (cancer) imaging Rodin Medical Treatments

Diseases can be controlled by enabling selective cutting and splicing of genetic sequencing at cleavage and receptor sites. Mathematics reveals that the major groove nested inside the double spiral helix of DNA is

not hollow but occupied by a Morphogenetic Field (Bioetheric Template) de ned by the discovery of a mathematical number pattern now called the equal potential major groove gap space of the ux eld of (3-9-6-6-9-3). This controls cellular communication and its how all genetic information is stored and reproduced, through Mitosis and DNA sister strand unravelling

Rodin Peer Reviews & Endorsements Dr. Hans Nieper, world renown cancer doctor and former physician to President Reagan, invited Rodin to submit a paper to the prestigious medical journal he is president of because he believed in Rodin ́s work; Dr. Jonas Salk, offered to be Rodin ́s personal physician and told him his work was so advanced he ́d never complete it in his lifetime unless he cloned himself; Prof. Scot C. Nelson, University of Hawaii, “In my opinion, the Rodin Coil may have more than just unusual or interesting electromagnetic properties. Mr. Rodin's model is a new way to look at the relationship between music, mathematics, and the structure of plants and animals. I believe that a study of the relationship between energy and matter could start by applying the principles of the Rodin Torus model and Rodin's “polarized fractal geometry". I was able to arrive at an independent and scienti cally valid con rmation of the mathematical principles that form the basis of the Rodin Torus model.” Christine Jackson, editor of "Explore More", a cutting edge medical journal in the US; Sal Rosenthal, inventor and patent holder of the tuberculosis test, regularly invited Rodin to participate in his California think tanks

http://www.markorodin.com/

Lloyd Mear Preview of Interview http:// www.youtube.com/watch?v=01m08fGFzN4

Click Here to View

It is well-known that health conditions are associated with certain frequencies.

healing with numbers

See Reviews In this fascinating interview, Regina explores how numbers work and delves into the type of healing the body is able to perform on itself with the combination of energy, intention and the right numerical sequence. Mear explains that it’s not unlike a radio that you tune into a certain number on a dial to get a specific frequency in order to listen to a program. If that number is slightly off, all you get is static. If you can’t hear the program, you must adjust the number.

Lloyd Mear was ahead of his time when he came to the understanding that each and every ailment, nutrient, emotion, and so forth, has its own frequency signified by a sequence of numbers. After years of research, he found that by reciting the correlative number for balancing a particular ailment, that the body would respond the same as with a physical antidote. It is, loosely speaking, a matter of healing by the numbers.

numbers rotating right

newunderstandings.com

lloyd mear on energy balancing by numbers Go to around minute 39 and you will here the concept for balancing... http://blueiris.org/community/images/pdf/additional/Quick%20Code%20List.pdf -

The backbone of standard DNA (the blue spiral ribbon-like structure in this drawing) contains an alternating chain of linked phosphate and sugar molecules. Positive The new research shows that 'quadruple helix' DNA structures tend to form in Current regions DNA that are rich in the building block guanine. Image Credit: U.S. National Library of Medicine

Flip the switch... Negative Current

numbers rotating left

newunderstandings.com

positive & negative ...above and below add to 9

cosmic antenna Your body’s neuro network is like a radio tuner. It selects channels that play your tune. Your DNA is the antenna and receptor of signals. Antennas are transducers and a receivers of electromagnetic waves.

We employ this technology into the air waves, outer s p a c e a n d u n d e r w a t e r. S o w i t h t h i s b a s i c understanding, have we placed a mental ceiling on where our antenna can roam?

As above, so below and so within.

The word chakra comes from a Sanskrit word for “wheel” or “tuning”. The Eastern chakra system represents the vortexes of energies within. The chakra’s also matches the ascending color on our light spectrum and these colors correlate to frequencies.

vortexes & spheres of energy

(Snow akes by Wilson Bentley ; http://www.photolib.noaa.gov/historic/nws/ wea02087.htm ; Plate XIX of "Studies among the Snow Crystals

Consider that you live within a universe of spinning spheres and within you is a universes that is the same. Like the solar (soul) system you also have 7 major systems fixed within your orbit influencing your sphere.

kundalini – chakras –

DNA

– neurons – prana

by krishna madappa

The philosophy in yoga sciences conveys that the entire universe, of which we all are an integrated part is a pure manifestation of consciousness

In the manifesting of the universe this pure consciousness seems to have been divided into two aspects, neither of which can exist without the other One aspect is conceptualized as masculine, a state of formless presence, consciousness, bliss which is called SHIVA. The other aspect of pure non-dual consciousness is an energetic, creative and dynamic part called SHAKTI. She is the Divine mother of the universe and from her all forms are born. Shakti is the subtlest form of all forces and she is manifest in the entire universe as matter, mind and life. In Vedic science, the human is a miniature universe “as above, so below”. The inner world is organized around the system of chakras, consciousness centers which link and tier the layers of personality. The spinal column is as a pole around which the seven major chakras are present. When consciousness manifests through any particular center, the experience of the world/universe is referenced by the associated chakra.

The uppermost chakra is the “sahasrara”, also the abode of transcendental consciousness, also as SHIVA. At the lowest end of the spinal pole is a “kunda” or reservoir. It has been said that in this “kunda” is a sleeping re, therefore the Jiva, individual soul lies dormant. This dormant re res ng at the base of the spine is also termed as the kundalini. Kundalini is SHAKTI, and is at rest a er manifes ng the crea ve ows of her being. So, she is also called kundalini – Shak or the dormant power. Kundalini Shak is the nest force that resides in the individual soul, jiva. The awakening of this Shak is by breath and vibra on. This is also in molecular terminology referred to as empowering the DNA as we are managing the intelligence of nature at the basis and structures of the human physiology. These are catalogued as impulses of consciousness, structures, structuring dynamics of the laws of nature.

E le ctr o P ho togr aph y b y the GDV and Kr ishna M adappa

Research

The Science of a Mystic

Krishna Madappa Mada Eliza Dalian

a g lo b a l net work for

A GlobAl AwAkeninG TUNE IN TO THE AWAKENING ZONE TODAY

• Tune in 24 Hours a Day - listen to live shows or archives • Shows offered in English, Spanish and 9 other languages • Always free, always easy Over 50 top Hosts including: Jean Adrienne Garret Annofsky Lee Carroll

Steve & Barbara Rother

Dee Wallace

Dr. Douglas Davies Norma Delaney Karen Elkins Linda Benyo Hoppe

Suzy Miller

Jim Self

Christine Day

Nina Impala Miriam Knight David McMaster Kahu Fred Sterling

Dr. Doug Davies

Karen Elkins

Jonette Crowley

Asia Voight Kelly Walden Plus 30 international Hosts

Sandie Sedgbeer

Pepper Lewis

Geoffrey Hoppe

AWA K E N I N G Z O N E T h e I n t e r n a t i o n a l R a d i o N e t w o r k f o r E m p o w e r e d Aw a k e n i n g

W W W. AWA K E N I N G Z O N E . C O M SPONSORED BY THE CRIMSON CIRCLE

– w w w. c r i m s o n c i r c l e . c o m

The O World Project is a multi-media initiative encompassing the arts, sciences, philosophical and religious/ spiritual traditions. The mission of the project is to celebrate the diversity of human culture, to contrast the perspectives of leaders from all areas of human endeavor and to add another voice of inspiration for a new paradigm of global community and conscious evolution.

The Arts phase

of the project is

based on an original song called 'O World'. The song represents a ‘unity of purpose’, Purchase the Album $9.99 or a song for .99

as all participating musicians are basing their own unique interpretations on a single composition. The project enlisted musicians from around the world and

Support the Vision

asked each of them to adapt the original alternative rock version of O World and

One Voice One People One Song

create their own unique arrangement, reflecting their particular style, genre, and ethnic musical tradition. Some of the countries represented include Spain, Argentina, US, Peru, Canada, Venezuela, India, Taiwan, China, Vietnam, Philippines, Uganda, and Turkey, with more to follow.

ABOUT

O WORLD SONG /ALBUM

The second phase

O World Project

of the project focuses on Science, Philosophy and Spirituality. Following the intention of promoting inclusiveness and solidarity the O World Project features interviews with prominent scientists, philosophers, activists, business leaders and spiritualists from many faiths and practices, who share their perspectives on the current state of humanity, our relationship with the earth, and our evolution as a species.

O World Project

Interview Eliza Mada Dalian O World Project Interview with mystic, author, healer and creator of the Dalian Method Eliza Mada Dalian.

SCIENCE

SPIRITUAL

ACTIVISM

Eliza Mada Dalian, affectionately known as Mada, is a self-realized mystic, internationally acclaimed master healer, and spiritual teacher. Having awakened at age 33, Mada devised an advanced healing system known as the Dalian Method, which quickly erases the causes of pain and ailments from the body's cellular memory and permanently transforms what’s unconscious in the person's energy into consciousness. She is the best-selling author of the multi award-winning book In Search of the Miraculous: Healing into Consciousness. Mada travels internationally offering private sessions, as well as seminars and retreats with active meditations and the Self-Healing Dalian Method. www.MadaDalian.com

AUTHORS

Llyod Pye - Human Genetics If aliens did once walk this planet, is there really evidence that we are the result of some ancient genetic plan? Lloyd Pye is at the forefront of research into human origins from alien sources. Using remarkable scienti c analysis, Lloyd Pye makes a strong case that human DNA is not of this world In this presentation, lmed at the International Scienti c and Metaphysical Symposium in Australia, he proposes his Intervention Theory. Lloyd Pye's also presents his take on the mysterious 900 year-old skull of a child that shows evidence of an alien race once having walked planet Earth  Judge for yourself the amazing and indepth research and evidence brought to light by this incredible researcher http://www.lloydpye.com

Secrets of The Serpent - Philip Gardiner Evidence is being uncovered that suggests serpents were revered and worshiped all over the globe, and may have led the foundation for many religions of the world. Philip Gardiner takes us on a journey where he expounds on examples showing that serpent worship was once highly prevalent. Though the serpent originally represented wisdom, it was eventually reckoned as evil as medieval religious fervor overtook Europe and serpent worshipers were stamped out This program only begins to scratch the surface on ancient serpent worship. A vast amount of evidence suggests that it is very likely that serpent worship was the original religion of mankind and has in uenced all other modern religions. The evidence is in plain sight and obvious to those whose eyes are open to seeing such things

Start Your Ten Day

Free Trial

Signature of the Universe As I search for the meaning of my place in the universe I contemplate the

astounding story of Life that has been unfolding throughout time..."

Science is beautiful I began to artistically explore philosophical matters; the idiosyncrasies of being human, spirituality and self-awareness, consciousness, love and the needful human condition, the bewildering dynamics between man and woman, the resilience of the human spirit, the enigmatic mysteries of the human psyche, the hungry human mind, the inherent desire to explore new territories whether they be earth bound, off-earth destinations or the fractal, microscopic world of atoms and cells – and most of all, how and why are we even here?

As I journeyed these questions I came to realize that what I was looking for was to know the origins of everything and to understand everything.

Science has answered many of my questions about the physical world and opened new doors and concepts on the quantum front, and created new questions regarding the emotional and philosophical side of being human. It’s a lovely tangled web of interconnectedness that all my searching has weaved.

Both natures have a purpose and place within my being and within the universe. I discovered a hunger more insatiable than any other I had ever experienced - to explore our remarkable human appearance on this beautiful blue world that travels in an astounding universe. Quantum sciences therein had an easy entry into my probing which added a new dimension to the thought of all things being interconnected. The strange realms and dimensions describe by quantum science are the perfect breeding ground for an artists imagination.

Art Exploration Lucy has been a professional artist for over 30 years. Her works have been commissioned and/or displayed by notable people and venues such as NASA (Kennedy Space Center), NASA seniors, astronauts and scientists, NASA websites, The House of Representatives (Washington D.C.), independent lms, music industries, galleries, agencies and private collectors worldwide. She has been published in books and magazines and has been featured in science and space related blogs, podcasts and websites. Lucy is a member of the International Association of Astronomical Artists.

My goal is to create art t h at h a s a s e n s e of scientific accuracy and fine art quality... www.lucyweststudios.com

lucy west