Fusarium Wilts of Greenhouse Vegetable and Ornamental Crops

CHAPTER

15

Fusarium Diseases of Tomato ● CHENG-HUA HUANG University of Florida, Gulf Coast Research and Education Center (GCREC) Wimauma, Florida 33598, U.S.A.

● PAMELA D. ROBERTS University of Florida, Southwest Florida Research and Education Center (SWFREC) Immokalee, Florida, 34142, U.S.A. e-mail: pdr@ufl.edu

● LAWRENCE E. DATNOFF Department of Plant Pathology and Crop Physiology, Louisiana State University AgCenter Baton Rouge, Louisiana, 70803, U.S.A.

symptomology, disease development, and physiological characteristics. Genetic differences have been proposed between F. oxysporum f. sp. lycopersici and f. sp. radicislycopersici because the two formae speciales are vegetatively incompatible, which suggests the inability to form heterokaryons between them (Puhalla, 1985).

F. oxysporum f. sp. radicis-lycopersici has been isolated from the stems and roots of diseased tomato plants in field-grown, hydroponic, and rockwool-grown systems ( Jarvis and Shoemaker, 1978; Jenkins and Averre, 1983; Hartman and Fletcher, 1991). Dissemination of spores in closed environments, such as greenhouses and hydroponics, exacerbates the outbreak of Fusarium crown and root rot (Vanachter et al., 1983; Jarvis, 1988). The raised temperatures found in greenhouses also encourage spread of Fusarium wilt, whereas low temperature conditions limit spread of the disease. Moreover, sporulation of F. oxy­­sporum f. sp. lycopersici on stems has been demonstrated, suggesting that the resultant aerial dissemination of macroconidia/microconidia may have

INTRODUCTION Fusarium wilt and Fusarium crown and root rot— caused by Fusarium oxysporum Schlectend.:Fr. f. sp. lycopersici (Sacc.) W. C. Snyder & H. N. Hansen and f. sp. radicis-lycopersici Jarvis & Shoemaker, respectively—are two important diseases of tomato (Solanum lycopersicum L.). Fusarium wilt, a warm weather disease, was first described in England in 1895 and has since been found in at least 32 countries ( Jones et al., 1991). In contrast, Fusarium crown and root rot, thriving at cooler temperatures, was first identified in Japan in 1969 (Sata and Araki, 1974) and thought to be a new race ( J3) of f. sp. lycopersici. In the United States, Fusarium crown and root rot was first noted in California in 1971 (Leary and Endo, 1971) and then in Florida in 1975 (Sonoda, 1976).

In 1978, Jarvis and Shoemaker proposed that the causal agent of Fusarium crown and root rot was distinct from F. oxysporum f. sp. lycopersici based on 145

146

CHAPTER 15

serious epidemiological consequences in greenhouses (Katan et al., 1997).

F. oxysporum f. sp. lycopersici and f. sp. radicis-lycopersici are not monophyletic (Cai et al., 2003; Huang, 2009), suggesting that they may have multiple evolutionary origins. The two are thought to be paraphyletic based on DNA sequences of mitochondrial small subunit (mtSSU) rDNA and translation elongation factor 1-α (EF-1α) (O’Donnell et al., 1998). Some isolates of the two formae speciales are more closely related to each other than to those within the same forma specialis.

Morphological Characters and Physiological Races Macroconidia, microconidia, and chlamydospores are produced by F. oxysporum f. sp. lycopersici and f. sp. radicis-lycopersici during the disease cycle. Macroconidia with three to five septa are formed in paleorange sporodochia that are produced abundantly 3–4 weeks after growing on carnation leaf agar (CLA).

Microconidia, either oval or elliptical in shape, are developed in false heads on monophialides and usually do not have septations. Specific sugars excreted on the surfaces of microconidia may be responsible for the host/ parasite recognition.

F. oxysporum f. sp. lycopersici and f. sp. radicislycopersici agglutinate differently with lectins on the surfaces of microconidia, suggesting distinctive infection processes (Boyer and Charest, 1989). However, how these sugars interact with the epidermal cells of tomato roots and how they are involved in triggering conidial germination are not well known.

Chlamydospores are formed in hyphae and macroconidia and can remain dormant and viable for several years (Nelson, 1981). Isolates of F. oxysporum f. sp. lycopersici and f. sp. radicis-lycopersici produce pink- or purple-tinged pigments on potato dextrose agar (PDA), although some occur that do not show any pigmentation.

Black sclerotialike structures may also be produced abundantly on PDA. However, repeated culture on PDA may cause mutation in morphological characteristics and the loss of pathogenicity (Leary and Sanchez, 1976).

Three physiological races have been reported for F. oxysporum f. sp. lycopersici, whereas no races have been reported for F. oxysporum f. sp. radicis-lycopersici. Race 1 of F. oxysporum f. sp. lycopersici was widespread at the beginning of the last century. The vertical resistance gene I against Fusarium wilt was found in 1939 and then introgressed into many tomato cultivars (Bohn and Tucker, 1939). A second race was likely

discovered before 1940 (Alexander and Tucker, 1945) but first reported in Florida in 1961 (Stall, 1961). In 1982, race 3, overcoming resistance gene I2, of Fusarium wilt was reported in Australia and Florida (Grattidge and Obrien, 1982; Volin and Jones, 1982). Race 3 of F. oxysporum f. sp. lycopersici has a better overseasoning ability than races 1 and 2 ( Jones et al., 1989b) and is currently present in Australia, Brazil, Japan, Mexico, and the United States (Marlatt et al., 1996; Valenzuela-Ureta et al., 1996; Reis et al., 2005; Hirano and Arie, 2006).

Symptoms The symptoms of F. oxysporum f. sp. lycopersici include stunting of infected seedlings, yellowing of older leaves, and browning of vascular tissues. The earliest symptoms caused by the Fusarium wilt pathogen may be distinct between young greenhouse tomato plants and fieldgrown tomato plants. The first symptoms of young greenhouse plants include a clearing of veinlets and drooping or epinasty of the petioles, whereas yellowing of the lower leaves is more typical of field-grown tomato plants (Walker, 1971; Nelson, 1981). Infected seedlings frequently wilt and die. Vascular discoloration is quite prominent.

Symptoms on older plants are apparent from blossoming to fruit maturation. One side of the plant may show yellow leaves while the other side remains symptomless (Fig. 15.1). The yellowing gradually becomes more extensive, progresses upward, and is accompanied

FIG. 15.1. Yellowing symptom of Fusarium wilt caused by

Fusarium oxysporum f. sp. lycopersici. Before affecting most of the foliage, the yellowing often develops on leaves on one side of the plant while the other side remains symptomless.

Fusarium Diseases of Tomato

by wilting, especially during the hottest part of the day ( Jones et al., 1991). The wilting becomes progressively more severe, resulting in the collapse and death of the plant. The vascular browning is often conspicuous with Fusarium wilt and may extend far up on and into the petiole. Fruit infection occasionally occurs and causes fruit rot and drop. Root rot is apparent once the roots become infected.

The wilting caused by F. oxysporum f. sp. radicislycopersici may be similar to that caused by F. oxysporum f. sp. lycopersici (Fusarium wilt), but the vascular browning is usually confined to no more than 25 cm of the stem from the crown ( Jarvis, 1988). Fusarium crown and root rot thrives at cool temperatures (68–72°F [20–22°C]), whereas Fusarium wilt favors high temperatures (82°F [28°C]) ( Jones et al., 1991; Ozbay and Newman, 2004).

Even so, the two pathogens may be found to occur at a single field site (Baysal et al., 2009; Huang, 2009).

Early symptoms of Fusarium crown and root rot on tomato seedlings include stunting, yellowing, and defoliation. Diseased seedlings exhibit root and crown lesions.

However, the most common symptom is sudden wilting when the first fruit is at or near maturity. The wilting occurs during the hottest part of the day, and infected plants may recover at night or totally wilt and die. Plants with a slow wilt survive until the end of the season but produce a reduced number of fruits of inferior quality (Ozbay and Newman, 2004). Brown spots appear on the entire root system, but the tap root of an infected plant often will rot throughout. Chocolate-brown cankers appear at the root/stem transition area. Brown

147

discoloration usually is exhibited in the cortex of the crown and roots but also can been seen in the vascular tissue (Fig. 15.2). The pathogen can be isolated only a few millimeters beyond the discoloration ( Jarvis and Shoemaker, 1978). Under highly humid conditions, F. oxysporum f. sp. radicis-lycopersici and f. sp. lycopersici can produce large masses of pinkish-white mycelia and spores on stem lesions ( Jarvis, 1988; Katan et al., 1997).

The aerial dissemination of conidia may cause further outbreaks of these two diseases.

Although the two formae speciales are morphologically indistinguishable, F. oxysporum f. sp. radicis-lycopersici can be diagnosed rapidly based on symptomology with a petri plate assay using tomato seeds placed on water agar (Sanchez et al., 1975). The pathogen causes darkbrown lesions on the root/stem transition region or crown and occasionally on cotyledon and hypocotyls.

In contrast, the Fusarium wilt pathogen, F. oxysporum f. sp. lycopersici, produces a light-tan discoloration on the entire primary root. The typical symptom on the crown caused by F. oxysporum f. sp. radicis-lycopersici may not be obvious. Increasing the conidial concentration and/ or inoculation period (i.e., 7–14 days) may be helpful in identifying this symptom (Huang, 2009).

Molecular Diagnostics Although laborious pathogenicity tests can differentiate F. oxysporum f. sp. lycopersici and f. sp. radicis-lycopersici based on the gene-for-gene concept, molecular discrimination may provide a more rapid and unambiguous identification of the two formae speciales. These issues are discussed in more detail in Chapters 4 and 5.

Polymerase Chain Reaction (PCR)

FIG. 15.2. Internal discoloration of Fusarium crown and root

rot caused by Fusarium oxysporum f. sp. radicis-lycopersici. Brown discoloration can be seen in the cortex and vascular tissue of the crown and roots.

F. oxysporum f. sp. lycopersici can be identified using a primer pair—P12-F2B (TATCCCTCCGGATTTGAGC) and P12-R1 (AATAGAGCCTGCAAAGCATG)— to amplify an approximately 1-kb fragment of SIX1, which is a virulence gene (van der Does et al., 2008).

Interestingly, SIX1 is also the avirulence factor recognized by the resistance gene I3, which confers resistance in tomato to race 3 of F. oxysporum f. sp. lycopersici (Rep et al., 2004).

In addition to SIX1, other SIX genes have been identified as present on the same chromosome and are unique to F. oxysporum f. sp. lycopersici. Most SIX genes are found only in this forma specialis but not in the other formae speciales, making them excellent markers for molecular identification (Lievens et al., 2008). Although

148

CHAPTER 15

F. oxysporum f. sp. lycopersici is polyphyletic (i.e., of multiple evolutionary origins), this forma specialis can be identified by the primers targeting SIX1, SIX2, SIX3, and SIX5 (Lievens et al., 2009a). SIX4 can be used for identifying race 1 of F. oxysporum f. sp. lycopersici, whereas polymorphisms of SIX3 can distinguish race 2 from race 3 isolates (Lievens et al., 2009a).

Apart from the primers developed for SIX, primer sets spr1, sp13, and sp23—based on the comparison of nucleotide sequences of exo polygalacturonase (pgx4) and endo polygalacturonase (pg1), respectively—have been developed for identifying F. oxysporum f. sp. lycopersici and its races (Hirano and Arie, 2006). Some isolates may not be assigned to any race using spr1, sp13, and sp23 (Baysal et al., 2009). A pathogenicity test or other primer targeting SIX genes must be conducted to assign a race. In addition, real-time PCR has been developed to identify F. oxysporum f. sp. lycopersici and its races based on SIX1, SIX4, and the rDNA-intergenic spacer (Inami et al., 2010).

A primer set, sprlf (GATGGTGGAACGGTATGACC) and sprlr (CCATCACACAAGAACACAGGA), that targets pgx4 has been designed for identifying F. oxysporum f. sp. radicis-lycopersici (Hirano and Arie, 2006). However, it may not consistently amplify VCGs 0093, 0094, 0098, and 0099, suggesting that a high variation of pgx4 may exist in this pathogen (Huang, 2009).

The lack of specificity may have resulted from an incomplete collection of geographically and genetically distinct isolates of F. oxysporum f. sp. radicis-lycopersici for comparison. Virulence genes conferring a specific trait to a pathogen are likely ideal targets, since they have subtle nucleotide differences within the same forma specialis (Lievens et al., 2008). More specific primers for rapid diagnosis of F. oxysporum f. sp. radicis-lycopersici need to be developed.

Molecular Markers

Genotyping techniques, such as random amplified polymorphic DNA (RAPD) and microsatellites, have been used to distinguish F. oxysporum f. sp. lycopersici and f. sp. radicis-lycopersici based on a dendrogram of the genetic distances (Balmas et al., 2005; Huang, 2009).

Restriction fragment length polymorphisms (RFLP) of mitochondrial DNA may also be used to differentiate the two formae speciales (Attitalla et al., 2004).

Although laborious, genotyping may assign one of the two formae speciales for pathogenic isolates of F. oxysporum isolated from diseased tomato plants.

Diagnostic DNA fragments identified by genotyping

techniques can be converted into sequence-characterized amplified region (SCAR) primers, which are simple and reliable molecular markers. This approach has been demonstrated effective in identifying several formae speciales and races of F. oxysporum (Lievens et al., 2008).

Phylogenetic Analyses

Although the F. oxysporum species complex is monophyletic, most of its formae speciales are polyphyletic, including F. oxysporum f. sp. lycopersici and f. sp. radicislycopersici. Without enough phylogenetic resolution, loci cannot be used to differentiate the two formae speciales.

Moreover, some loci, such as the nuclear rDNA internal transcribed spacer (ITS), may have paralogous or xenologous copies, erroneously interpreting interstrain relationships within the F. oxysporum species complex (O’Donnell and Cigelnik, 1997).

EF-1α, pg1, and pg4 sequences have been used to resolve evolutionary lineages for the two formae speciales, but no strong phylogenetic signal relates to them (Ka­wabe et al., 2005; Lievens et al., 2009b). Alternatively, specific diagnostic markers may be developed for certain subgroups or vegetative compatibility groups (VCGs). Intergenic spacer region (IGS) also offers considerable potential for resolving phylogenetic relationships, categorizing VCGs of the two formae speciales, and developing specific diagnostic markers for predominant VCGs of the two formae speciales in a population (Appel and Gordon, 1996; Huang, 2009).

Biology, Ecology, and Epidemiology Roles of Tomatinase and Fusaric Acid in Pathogenesis

The ability of a fungal pathogen to tolerate constitutively antimicrobial phytoanticipins or induced phytoalexins may potentially determine its pathogenicity or virulence (VanEtten et al., 1994). Alpha-tomatine, a steroidal glycoalkaloid sapoine found in tomato plants, has been demonstrated to protect Solanum species from pathogen attack (Arneson and Durbin, 1968; Suleman et al., 1996). However, both F. oxysporum f. sp. lycopersici and f. sp. radicis-lycopersici can secrete tomatinase, which degrades α-tomatine into two compounds with a lower level of antifungal activity: the aglycon tomatidine (Td) and the tetrasaccharide lycotetraose (Lt) (Lairini et al., 1996; Lairini and Ruiz-Rubio, 1997; Ito et al., 2004).

Td and Lt have been demonstrated able to suppress

Fusarium Diseases of Tomato

oxidative burst, which is necessary for the subsequent host’s defense responses (Ito et al., 2004).

Although nonpathogenic isolates of F. oxysporum can also secrete tomatinase, they are more sensitive to α-tomatine. For example, nonpathogenic isolates of F. oxysporum are more sensitive to α-tomatine than pathogenic isolates during germ tube elongation and growth of mature mycelia (Suleman et al., 1996; Lairini and Ruiz-Rubio, 1997). The expression level of genes encoding tomatinase may be associated with pathogenicity or virulence.

Fusaric acid (FA; 5-butyl-picolinic acid, C10H13NO2 , MW 179.22), an amino acid derivative, is a wellknown non-host-specific phytotoxin produced by several Fusarium species, including nonpathogenic and pathogenic isolates of F. oxysporum (Bacon et al., 1996; Landa et al., 2002; Bouizgarne et al., 2006). The compound was discovered in 1934 and later implicated in the pathogenesis of F. oxysporum f. sp. lycopersici (Gäumann, 1957). Although the role of FA in pathogenicity has not been well established, its function is probably related to virulence (Kuźniak, 2001). Different toxicological effects of FA on plants have been demonstrated, including the induction of reactive oxygen production, the modification of membrane permeability or membrane potential, the increase of electrolyte leakage, the decrease of O2 uptake and cellular ATP, and chelation with copper, cobalt, zinc, and iron (D’Alton and Etherton, 1984; Marrè et al., 1993; Kuźniak, 2001; Bouizgarne et al., 2004).

Given that FA is likely related to virulence, it has been utilized in selecting for resistant cultivars to F. oxysporum f. sp. lycopersici, which is an important complement to the classical breeding method in tomato (Shahin and Spivey, 1986). Resistance may result from the capacity to detoxify FA (Beckman, 1987). The role of FA in the pathogenesis of F. oxysporum f. sp. radicis-lycopersici and f. sp. lycopersici on tomato has not been thoroughly examined, and it may be further evaluated by knocking out FA synthesis-related genes. Most importantly, the interaction of FA and the host cell in the earliest time/ space frameworks (i.e., a few hours to 2 days) should be examined (Beckman, 1987).

Most studies have focused on the toxic effects of FA but ignored other interactions between it and the host plants. The concentration of FA that causes wilting is about 150 ppm (Gäumann, 1957). Likewise, FA has been shown to impair the biological activity of antagonistic microorganisms, suggesting that it acts as an antibiotic to help the pathogen to compete with other microorganisms (Notz et al., 2002). In spite of causing

149

toxic effects on plants at concentrations greater than 10–5 M, FA may induce the synthesis of phytoalexins and the production of reactive oxygen species at nontoxic concentrations (i.e., less than 10–6 M) (Bouizgarne et al., 2006).

Whether the concentration of FA produced by nonpathogenic isolates of F. oxysporum is associated with defense responses in tomato has not been evaluated, although the isolates have been demonstrated effective in controlling Fusarium wilt (Fuchs et al., 1997; Shishido et al., 2005). These issues are discussed in more detail in Chapter 3.

Vegetative Compatibility

Vegetative compatibility refers to the ability of any two isolates to form a stable heterokaryon. The isolates are said to be vegetatively compatible and to belong to the same vegetative compatibility group (VCG) (Puhalla, 1985). Nine VCGs (0090, 0091, 0092, 0093, 0094, 0096, 0097, 0098, and 0099) have been reported worldwide for F. oxysporum f. sp. radicis-lycopersici, and five VCGs (0030, 0031, 0032, 0033, and 0035) have been identified for F. oxysporum f. sp. lycopersici (Elias and Schneider, 1991; Katan et al., 1991; Katan, 1999; Primo et al., 2001; Cai et al., 2003).

Subgroups of VCGs were first revealed in F. oxy­ sporum f. sp. radicis-lycopersici (Katan et al., 1991).

Cross-VCG compatibility (i.e., bridging isolates) is not unusual in the two formae speciales. For example, two VCGs have been assigned to some single isolates (i.e., VCG 0090 and VCG 0092, VCG 0094 and VCG 0098, and VCG 0030 and VCG 0032) because of their ability to form heterokaryons with the testers of different VCGs within the same forma specialis (Katan et al., 1991; Mes et al., 1999; Huang, 2009). This cross-VCG compatibility indicates some extent of genetic relatedness between the two VCGs and suggests an evolutionary process of either the convergence or divergence and formation of new VCGs (Katan et al., 1991).

It has been suggested that VCG can be correlated with pathogenicity (Puhalla, 1985; Katan et al., 1989; Manicom et al., 1990). However, the correlation may be strong, weak, or nonexistent, depending on the forma specialis tested (Leslie, 1993, 1996). For example, nonpathogenic isolates of F. oxysporum are not vegetatively compatible with pathogenic isolates of F. oxysporum f. sp. cyclaminis (Woudt et al., 1995). In contrast, nonpathogenic isolates of F. oxysporum are vegetatively compatible with VCG 0031 but not with VCGs 0030 and 0032 (Cai et al., 2003). The correlation of

150

CHAPTER 15

VCG with pathogenicity in F. oxysporum f. sp. radicislycopersici has not been addressed, however.

Vegetative compatibility has been useful in characterizing population structure and genotypic diversity in F. oxysporum f. sp. radicis-lycopersici and f. sp. lycopersici (Katan and Katan, 1999; Rosewich et al., 1999; Cai et al., 2003). The VCG assay, although laborious, has helped to elucidate population structure and to differentiate F. oxysporum f. sp. lycopersici from f. sp. radicis-lycopersici (Puhalla, 1985; Rosewich et al., 1999).

A genetic difference between the two pathogens has been proposed because they are vegetatively incompatible (Puhalla, 1985). Since no physiological races have been identified for F. oxysporum f. sp. radicis-lycopersici, the frequency of VCG may help breeders choose representative isolates of the pathogen for screening tomato lines for disease resistance (Primo et al., 2001). Florida has been suggested as the center of origin for VCG 0033 of F. oxysporum f. sp. lycopersici (Gale et al., 2003) and for the cosmopolitan VCG 0094 of F. oxysporum f. sp. radicis-lycopersici, along with the recently found VCGs 0098 and 0099 (Rosewich et al., 1999). These issues are discussed in more detail in Chapter 4.

Disease Cycle

Fusarium wilt of tomato is exacerbated by warm weather.

Soil and air temperatures of 82°F (28°C) are optimum for disease development. Temperatures higher than 93°F (34°C) or lower than 68°F (20°C) may retard wilt development ( Jones and Woltz, 1981). In addition, the disease is more prevalent on acidic, sandy soils ( Jones and Woltz, 1970). Other factors favoring Fusarium wilt include soil moisture approaching field capacity, short day length, and low light intensity ( Jones et al., 1991).

Plants amended with fertilizers containing low nitrogen and phosphorus and high potassium may be susceptible to Fusarium wilt, but their vulnerability will depend on a variety of factors, such as their physiology at the time of nutrient application and infection by F. oxysporum f. sp. lycopersici.

F. oxysporum f. sp. lycopersici does not form appressoria before penetration. Rather, the pathogen uses germ tubes and mycelia to directly penetrate the roots’ tips or to enter the roots via wounds and cracks formed by lateral roots (Nelson, 1981; Jones et al., 1991; Xu et al., 2006). Mycelium development is stimulated mainly by organic nitrogen in the vicinity of the roots, and signaling and recognition mechanisms between the host and pathogens likely occur on or in the roots, rather than external to them (Steinberg et al., 1999). The F-box

protein Frp1, which is involved in proteasomal protein degradation via the ubiquitin conjugation pathway, is required for the fungus to effectively penetrate the root epidermis and colonize the vascular tissue ( Jonkers et al., 2009). The Δfrp1 mutant reduces expression of several cell wall–degrading enzyme (CWDE) genes, resulting in the inability to penetrate the roots.

This finding suggests that CWDEs are important in pathogenesis.

After penetrating the roots, the mycelia advance to the xylem vessels through the root cortex intercellularly.

Although the mycelia remain in the vessels and move upward and toward the crown and stem of the plant, they also penetrate adjacent vessels laterally via pits. Microconidia are produced in the vessels and carried upward in the sap stream. They germinate at the stopping point of the upward movement. Clogging and crushing of the vessels interrupt the flow of water, leading to wilting or death when the plant’s roots and stems cannot transport enough water for transpiration. The fungus can sporulate profusely on the diseased plant and disseminate inoculum sources to new plants (Agrios, 2005).

In contrast to the 82°F (28°C) optimum for Fusarium wilt, the optimum temperature for Fusarium crown and root rot is 64°F (18°C) ( Jarvis and Shoemaker, 1978).

However, like infection by F. oxysporum f. sp. lycopersici, infection by f. sp. radicis-lycopersici is favored by an acidic, sandy soil; plants supplied with ammonium nitrogen; and low light duration ( Jones et al., 1990, 1993). Other factors affecting the development of Fusarium crown and root rot have been evaluated, as well. Wounding of the tomato plant’s crown and roots increases the possibility of infection by the fungus. Wounding a leaf may cause infection by F. oxysporum f. sp. radicis-lycopersici, but the temperature and duration of high relative humidity will affect the rate of colonization (Rekah et al., 2000). Glyphosate predisposes tomato to Fusarium crown and root rot because of the inhibition of structural and defense barriers in the plant (Brammall and Higgins, 1988b). The incidence and severity of the disease significantly increase under irrigation with saline water because of the physiological damage to the plant (Triky-Dotan et al., 2005).

F. oxysporum f. sp. radicis-lycopersici has a disease cycle similar to that of f. sp. lycopersici. After spore germination, the fungal mycelia and germ tubes enter the roots via the cortical cleavage formed by the emergence of lateral roots, and they also directly penetrate the tips of taproots and lateral roots (Xu et al., 2006). The colonization by F. oxysporum f. sp. radicis-lycopersici has been investigated (Charest et al., 1984; Brammall and

Fusarium Diseases of Tomato

Higgins, 1988a; Xu et al., 2006). Direct penetration of epidermal cells by the fungus can occur by 24 hours after inoculation, and the fungus can colonize suberized hypodermal cells and adjacent intercellular spaces by 72 hours. The colonizations of the cortex and the stele occur from 72–96 hours and from 120–144 hours, respectively. These time frames are associated with the breakdown of parenchymatous cell walls and middle lamellae near the fungal hyphae.

Penetration of the suberized hypodermal cells by the fungus occurs in both resistant and susceptible cultivars.

Moreover, phenolic-containing structural defensive barriers—papillae and modified cortical cell walls—are also produced in both susceptible and resistant cultivars.

However, the inefficient modification of defensive barriers in hypodermal cells of susceptible cultivars allows for the rapid intercellular colonization of the inner cortex by the fungus, such that defense responses are halted (Brammall and Higgins, 1988a).

Host Range and Symptomless Carriers

F. oxysporum f. sp. radicis-lycopersici has a wide range of hosts, but F. oxysporum f. sp. lycopersici is host specific to members of the genus Solanum (Rowe, 1980; Menzies et al., 1990). As with some formae speciales of F. oxysporum, f. sp. radicis-lycopersici can infect many plant species of varying genera. Plants in Solanaceae and Leguminosae—including eggplant, green bean, pea, peanut, pepper, and soybean—were first described as hosts of the fungus, whereas cereals, crucifers, and cucurbits were found not to be infected (Rowe, 1980). Using these susceptible hosts as organic mulches may provide potential sources of inoculum. Susceptible hosts in Chenopodiaceae, Cucurbitaceae, Leguminosae, and Solanaceae were later confirmed, and hosts in Amaranthaceae, Caryophyllaceae, Compositae, Cruciferae, Liliaceae, Poaceae, Polygonaceae, and Umbelliferae were mildly infected

by F. oxysporum f. sp. radicis-lycopersici (Menzies et al., 1990).

Without susceptible host plants, F. oxysporum f. sp. radicis-lycopersici and f. sp. lycopersici can colonize symptomless carriers, forming reservoirs of inoculum, and they can survive in host debris. The genera Amaranthus, Chenopodium, Digitaria, Malva, and Oryzopsis have been reported as symptomless carriers for F. oxysporum f. sp. lycopersici (Katan, 1971; Fassihiani, 2000), whereas Tamarix nilotica has recently been identified as a carrier for F. oxysporum f. sp. radicis-lycopersici (Rekah et al., 2001).

151

Dissemination

The sporulation on tomato stems and aerial dissemination of conidia of F. oxysporum f. sp. lycopersici has been reported to cause serious epidemiological consequences (Katan et al., 1997). The pathogen can also be disseminated by contaminated seeds, tomato stakes, soils, and transplants. Long-distance spread occurs via infected seeds and transplants, whereas local dissemination occurs via transplanted tomato stakes, windborne and waterborne infested soil, and farm machinery ( Jones et al., 1991).

F. oxysporum f. sp. radicis-lycopersici can be introduced to new tomato-growing regions by means of infected seeds, transplants, soil, and media ( Jarvis, 1988; Hartman and Fletcher, 1991; Menzies and Jarvis, 1994).

Once introduced, this polycyclic pathogen can be disseminated via root-to-root contact, dispersal of airborne conidia, water flow, and fungus gnats of the genus Bradysia (Rowe et al., 1977; Jarvis, 1988; Hartman and Fletcher, 1991; Gillespie and Menzies, 1993; Rekah et al., 1999), making control of Fusarium crown and root rot difficult.

The roots of the salt cedar shrub T. nilotica, a weed, can be colonized by F. oxysporum f. sp. radicis-lycopersici.

The infected weed can then serve as an additional mechanism for survival of the pathogen and dissemination via the spread of infested seed or chaff of the weed (Rekah et al., 2001).

Disease Management Cultural Control

The use of nitrate nitrogen has been reported to reduce the severity of both Fusarium wilt and Fusarium crown and root rot, although the use of ammonium nitrogen increases the two Fusarium diseases (Woltz and Jones, 1973; Jones et al., 1993). The decrease in disease severity may be related to the pH effect; using nitrate nitrogen enhances the rhizosphere pH because of H+ exuded to regulate cytosolic pH and charge balance (Mengel and Kirkby, 2001). Interestingly, suppression of the two Fusarium diseases by enhancing the soil pH has been revealed as a result of inducing antagonistic and competitive actinomycete and bacterial populations ( Jones et al., 1989a, 1990). The use of liming materials to adjust soil pH also affects disease suppression. Hydrated lime (Ca[OH]2) and limestone (CaCO3) are more effective than gypsum (CaSO4), which does not affect pH and disease development ( Jones et al., 1990).

152

CHAPTER 15

Soil solarization eliminates pests and plant pathogens using energy from the sun. The soil is mulched and irrigated and then covered with a transparent plastic tarp for 4–6 weeks—ideally, during the hottest season of the year. This nonchemical method of soil disinfestation has been demonstrated to alleviate both Fusarium wilt and Fusarium crown and root rot (Chellemi et al., 1997; Shlevin et al., 2004). Soil solarization combined with organic amendments or fumigants may effectively reduce the population of F. oxysporum f. sp. radicis-lycopersici (Klein et al., 2007; Rekah et al., 2009). However, the fungus is an effective colonizer of sterilized soils ( Jarvis, 1988). Amending the compost after sterilizing the soil may be important to maintain soil suppressiveness and thus avoid recolonization by the fungus.

Crop rotation may be necessary for fields with recurring Fusarium wilt and Fusarium crown and root rot, although it does not entirely eliminate F. oxysporum f. sp. lycopersici or f. sp. radicis-lycopersici. Susceptible hosts should be avoided, and symptomless carriers should be removed from the field. Lettuce has been suggested for use in rotation and intercropping with tomato because of evidence of phenolic compounds from this plant inhibiting the growth of F. oxysporum f. sp. radicislycopersici ( Jarvis and Thorpe, 1981; Jarvis, 1988).

Chemical Control

Although methyl bromide (MB) has been used for soil fumigation to control pests of tomato, it will be phased out worldwide by 2015. MB alternatives have been developed for controlling F. oxysporum f. sp. lycopersici and f. sp. radicis-lycopersici.

Metam sodium or dazomet in combination with solarization has proven to decrease the incidence of Fusarium wilt and to increase tomato yield (Yucel et al., 2009). Rotovation of metam sodium at 935 liters/ha into preformed beds reduced the incidence of Fusarium crown and root rot equivalent to that achieved by MB plus chloropicrin (McGovern et al., 1998). To achieve a level of pest control for fresh-market tomato that is similar to that of MB plus chloropicrin, the recommendation is a combination of 1,3-dichloropropene plus chloropicrin with the herbicide pebulate (Gilreath and Santos, 2004). As noted earlier, steam sterilization and fumigation of soil to control Fusarium crown and root rot may have limited success because of the rapid recolonization of sterile soil by airborne conidia of F. oxysporum f. sp. radicis-lycopersici ( Jarvis, 1988).

Two systemic fungicides, benomyl and hymexazol, have been demonstrated to control Fusarium crown and root rot (Mihuta-Grimm et al., 1990; Hibar et al., 2007).

Benomyl can be added in hydroponic systems at 0.090 g of active ingredient per liter (a.i./L) on a 21-day schedule to achieve optimal disease control (Mihuta-Grimm et al., 1990). Although benomyl may provide acceptable control under greenhouse conditions, it may cause phytotoxicity symptoms, such as chlorosis and stunting of seedlings at 2–3 weeks of age. Moreover, widespread and intensive use of fungicides may result in the selection of fungicide-resistant isolates.

Elicitors of induced resistance may also reduce the severity of Fusarium wilt and Fusarium crown and root rot. The addition of salicylic acid through root feeding and foliar application has been reported to induce resistance against F. oxysporum f. sp. lycopersici (Mandal et al., 2009). Foliar spraying of validamycin A or validoxylamine A also effectively controls Fusarium wilt, but neither chemical is antifungal to the pathogen (Ishikawa et al., 2005). The exogenous application of benzo-(1,2,3)thiadiazole-7-carbothioic acid S-methyl ester (BTH) on tomato leaves resulted in the formation of protective layers at the sites of fungal penetration, such that the rate and extent of colonization by F. oxysporum f. sp. radicislycopersici were restricted (Benhamou and Belanger, 1998). The application of these elicitors has not been investigated for controlling Fusarium wilt and Fusarium crown and root rot under commercial tomato production.

Biological Control

Biological control through the use of beneficial fungi or bacteria has also been explored as an alternative for managing Fusarium wilt. Fungal antagonists—such as nonpathogenic F. oxysporum and F. solani, Gliocladium virens, Penicillium oxalicum, and Trichoderma harzianum—have been shown effective as biocontrol agents (Larkin and Fravel, 1998; Larena et al., 2002; Shishido et al., 2005).

Although nonpathogenic isolates of F. oxysporum have effectively controlled Fusarium wilt (Fuchs et al., 1997; Shishido et al., 2005), they have not been registered or commercialized, probably because of the concern as to whether a nonpathogenic isolate of F. oxysporum on a particular plant species will be pathogenic on another species (Fravel et al., 2003).

The bacteria used successfully against Fusarium wilt include Azospirillum brasilense, Bacillus subtilis, Burkholderia cepacia, Paenibacillus polymyxa, P. lentimorbus, and Pseudomonas fluorescens (Larkin and Fravel, 1998;

Fusarium Diseases of Tomato

Ramamoorthy et al., 2002; Abo-Elyousr and Mohamed, 2009; Son et al., 2009). In addition to suppressing Fusarium wilt, P. polymyxa and P. lentimorbus also show a nematicidal activity to Meloidogyne incognita, reducing disease severity caused by the synergistic effect of the root-knot nematode and F. oxysporum f. sp. lycopersici.

Fungal antagonists—such as F. equiseti, G. intraradices, Pythium oligandrum, and T. harzianum—have been demonstrated to suppress Fusarium crown and root rot (Datnoff et al., 1995; Benhamou et al., 1997; Horinouchi et al., 2007, 2008). Beneficial bacteria against F. oxysporum f. sp. radicis-lycopersici include Bacillus species and Pseudomonas species (Kamilova et al., 2009; Saidi et al., 2009). These bacteria suppressed F. oxysporum f. sp. radicis-lycopersici through antibiosis, induced systemic resistance, and competition for nutrients and niches (Kamilova et al., 2006, 2009).

The success of a biological control agent for reducing Fusarium crown and root rot may be determined by its ability to multiply rapidly in fumigated soil, to colonize roots or establish its population in the rhizosphere, and to suppress the population reestablishment of F. oxysporum f. sp. radicis-lycopersici (Marois and Mitchell, 1981).

Resistance

The mechanisms of resistance to Fusarium diseases involve physical barriers and biochemical changes within the plant to deter fungal invasion either locally or systemically (Beckman, 1987; Brammall and Higgins, 1988a; Beckman, 1989, 2000). The incapability of the susceptible cultivar to impede infection could result from a failure to recognize the pathogen effectors, an inhibition of defense responses, or an innately slow or weak response capacity (Beckman et al., 1982). Enlargement and vacuolization of the cytoplasm and callose deposition appear greater and more rapid in a resistant cultivar than in a susceptible cultivar (Beckman et al., 1982, 1991). Moreover, the rapid release of compartmentalized phenolic compounds in the resistant cultivar induces the formation of tyloses and gums, which restrict pathogens within the vascular systems (Beckman, 1987, 2000; Panina et al., 2007).

Three resistance genes—I, I2, and I3—have been discovered to confer resistance in tomato to races 1, 2, and 3 of F. oxysporum f. sp. lycopersici, respectively (Scott and Gardner, 2007). For some tomato production regions where race 3 has not occurred, I or I2 is still effective in controlling Fusarium wilt. In contrast, I3 needs to be deployed in these regions with major populations of

153

race 3. Although the complete loss of AVR3 (SIX1) in race 3 leads to reduce virulence, single-point mutations in AVR3 may result in a breakdown in I3 (Takken and Rep, 2010). As a consequence, the emergence of race 4 will occur. Studies of population genetics may help plant pathologists deploy an appropriate resistance gene while monitoring the emergence of new races.

Resistance to Fusarium crown and root rot is conferred by the single dominant gene Frl (Vakalounakis, 1988). Although some new cultivars may carry Frl, marker-assisted selection would facilitate the introgression of this gene into commercial cultivars. A few cultivars have been released that are resistant to both F. oxysporum f. sp. radicis-lycopersici and all three races of F. oxysporum f. sp. lycopersici. However, horticultural traits favored in the marketplace may be the main factors in determining whether growers will accept a new cultivar, unless they have catastrophic disease problems. This issue is also discussed in Chapter 9.

Integrated Disease Management

Without resistant cultivars, it is difficult to control Fusarium wilt and Fusarium crown and root rot, because their pathogens may recolonize sterilized soils, their resting spores can persist for long periods, and their pathogens can colonize symptomless carriers. However, the losses caused by these two diseases can be reduced by integrated disease management employing the following practices for susceptible tomato cultivars: 1. Use disease-free seeds and transplants. Disinfest transplant trays and stakes before reuse.

2. Use preplant fumigation, if economically feasible.

A waiting period of 2 weeks between planting and fumigating is necessary to permit fumigant vapors to dissipate and to avoid crop injury. Soil solarization alone or in combination with a low dosage of fumigant may efficiently reduce the populations of the two pathogens. Composts and base fertilizers may be used to amend the soils after fumigation.

3. Manipulate soil fertility. Avoid the use of ammonia nitrogen fertilizers alone, and add lime amendments to obtain a soil pH of 6–7. Balancing fertilizer management is important, as well. For example, the excess application of manganese, iron, and zinc increases the growth and sporulation of Fusarium ( Jones and Woltz, 1981). Silicon, a beneficial element, may reduce the severity of Fusarium crown and root rot (Huang et al., 2011).