Ó Springer-Verlag 2000
Curr Genet (2000) 37: 412±419
ORIGINAL PAPER
Sergi Maicas á Ana C. Adam á Julio Polaina
The ribosomal DNA of the Zygomycete Mucor miehei
Received: 21 December 1999 / 1 March 2000
Abstract The ribosomal DNA from the Zygomycete Mucor miehei has been characterised. The complete rDNA unit was cloned by heterologous PCR using primers whose sequence matched conserved regions of the rDNA from related fungal species. The sequence of the overlapping PCR products revealed the existence of a repeated unit of 9574 bp. The genes encoding the di erent rRNA species were identi®ed by their homology to the corresponding sequences from other fungi. We estimate that the rDNA unit is present in the genome of M. miehei in about 100 copies. This estimation was made by comparing the intensity of its hybridisation signal in a Southern blot with that of the mmp gene coding for aspartyl protease, which was assumed to be contained in single copy. The size and structure of the M. miehei rDNA unit was similar to that of other fungi. The genes encoding the 25S, 18S and 5.8S RNAs are closely linked within the repeated unit which also contains the 5S gene. This latter gene appears to be transcribed in the opposite direction. The 25S, 18S and 5.8S genes showed 70±80% homology to the corresponding genes from other fungi, whereas the degree of homology for the 5S gene was much lower. The highest homology (about 80%) corresponded to the few available sequences from other Mucor species. Homology to genes from other Zygomycota was no higher than that observed for genes from the Ascomycota or Basidiomycota fungi. Key words Autonomous replication sequence á Filamentous fungus á Ribosomal RNA
Communicated by L. A. Grivell S. Maicas á A. C. Adam á J. Polaina (&) Instituto de AgroquõÂ mica y TecnologõÂ a de Alimentos, Consejo Superior de Investigaciones CientõÂ ®cas. Apartado de Correos 73. E-46100 Burjassot, Valencia, Spain e-mail: jpolaina@iata.csic.es Tel.: +34-963-90-00-22; Fax: +34-963-63-63-01
Introduction Mucor (Rhizomucor) miehei is a signi®cant organism from a biotechnological point of view because of its aspartic protease (MMP), a milk-clotting enzyme used as a substitute for calf chymosin in the cheese industry (Tonouchi et al. 1986; Foltmann 1987). Despite its biotechnological interest, M. miehei remains poorly characterised from a genetical point of view. At least in part, this may be due to its morphological characteristics. The fungus does not form discrete colonies on solid medium. It has a di use, ``cotton-like'' mycelial growth, which makes its manipulation di cult. The only available information about its life cycle is that it is homothallic (Ohnuki et al. 1982). The analysis of the rDNA region of M. miehei is important for several reasons. (1) It should help establishing taxonomical relationships to other species (Buckler et al. 1997). (2) It may have functional implications since replication origins (ARS sequences) are known to be present within rDNA sequences (Amin and Pearlman 1985; Wendland et al. 1999). Additionally, (3) the repeated rDNA sequences can be useful tools for the genetic manipulation of fungi, as they can be used as targets for gene integration by homologous recombination (Lopes et al. 1989; Adam et al. 1995). Integrative transformation by homologous recombination has been described for other Mucor species (Arnau et al. 1991; Wada et al. 1996). Fungi, like other eukaryotes, contain in their genomes multiple copies of a ribosomal DNA unit arranged in tandem. The organisation of the rDNA varies in di erent fungal species. The size of the repeated unit ranges from 7.7 to 12 kb (Rozek and Timberlake 1979; van Heerikhuizen et al. 1985). Within the unit there is a cistron containing the 16S/18S, 5.8S and 25S/28S sequences. These three sequences are transcribed as a high-molecular-weight (35S) precursor (Tague and Gerbi 1984; Rustchenko and Sherman 1994). The remaining rDNA functional sequence, 5S, is transcribed independently and may or may not be genetically linked
413
to the others. In some species, such as Saccharomyces cerevisiae and Mucor racemosus, the 35S rDNA cistron and the 5S rDNA are linked but are transcribed from opposite strands (Aarstad and Oyen 1975; Bell et al. 1977; Cihlar and Sypherd 1980). In Cuprinus cinereus and Schizophyllum commune these sequences are linked and are transcribed in the same direction (Buckner et al. 1988; Cassidy and Pukkila 1987). Finally, in other species, such as Neurospora crassa, Schizosaccharomyces pombe, Yarrowia lipolytica and Aspergillus nidulans, the 5S region is not linked to the 35S cistron (Selker et al. 1981; Tabata 1981; Mao et al. 1982; van Heerikhuizen et al. 1985; Metzemberg et al. 1985). This di erence in the structure of the rDNA has been used to establish phylogenetic relationships among fungal species (Chen et al. 1984). In this paper we report the structure and complete sequence of the rDNA of M. miehei, and we determine the number of copies in which the rDNA unit is present in the genome. This is the ®rst time that the rDNA region of a Zygomycete has been fully characterised.
Materials and methods Microbial strains, plasmids and culture conditions M. miehei ATCC 26282 was cultivated in YPD liquid medium (1% yeast extract, 2% peptone, 2% glucose), or on plates of the same medium containing 2% agar, at 37 °C. Liquid cultures were incubated with agitation in an orbital shaker set at 200 rpm. Cloning of M. miehei DNA was carried out using plasmid pUC18 (YanishPerron et al. 1985) as the vector, and Escherichia coli DH5a (Hanahan 1983) as the host strain.
elements 15±20 base pairs long were chosen to be used as primers in these experiments. As sequencing progressed, additional ampli®cations were carried out using primers whose sequence corresponded to the M. miehei rDNA. The relationship of the di erent oligonucleotides used is presented in Table 1. For the ampli®cation of the M. miehei aspartyl protease gene (mmp), oligonucleotides M142 and M143 (Table 1) were used as primers. These oligos correspond to the 5¢ and 3¢ regions of the mmp coding sequence, respectively (Gray et al. 1986). The primers included suitable sites for restriction endonucleases to facilitate the subsequent cloning of the ampli®ed DNA. The PCR products were electrophoresed in an agarose gel, puri®ed from the gel, digested with the appropriate restriction endonucleases, and cloned in pUC18. DNA sequencing, Southern analysis, and other molecular biology techniques DNA sequencing was carried out at ``SCSIE Universitat de ValeÁncia'', using an ABI373A equipment from Perkin-Elmer Applied Biosystem (Foster City, Calif., USA) and a dRhodamine Terminator Ready Reaction Kit from the same company. Overlapping DNA fragments to be sequenced were generated either by PCRampli®cation or by restriction endonuclease digestion of larger fragments. DNA sequences were analysed with the programs Blast, Pileup, Fasta and Best®t from the Sequence Analysis Software Package of the University of Wisconsin Genetics Computer Group (Devereux et al. 1984). The nucleotide sequence corresponding to the complete M. miehei rDNA unit has been submitted to the GenBank library (accession number AF205941). Southern analysis was carried out by using a non-radiactive procedure with the DIG DNA labelling kit (Roche Diagnostics GmbH, Mannheim, Germany). Detection of the hybridisation signals was carried out by using an anti-digoxigenin-alkaline phosphatase conjugate and the chemiluminiscence substrate CDP-Star (Roche Diagnostics GmbH, Mannheim, Germany). Equal amounts of two DNA fragments of the same size (0.5 kb), one internal to the mmp gene
Table 1 Oligonucleotides used as primers in PCR reactions
DNA puri®cation
Name
Sequence (5¢ ® 3¢)a
M. miehei spores were inoculated in liquid medium and incubated for 16 h. Young hyphal germlings were harvested by centrifugation, washed with water and re-suspended in TES bu er (100 mM Tris-HCl, 25 mM EDTA, 2% SDS, pH 7.5). The germlings were disintegrated mechanically with 425±600-micron glass beads (Sigma Chemical Co., St. Louis, Mo., USA) in a Fast Prep Cell Disruptor (FP120) (Savant Instruments Inc., Vista, Calif., USA). The cell debris was removed by centrifugation at 20,000 ´ g for 10 min. The supernatant was subjected to de-proteinisation by treatment with phenol, and the nucleic acids were collected by precipitation with isopropanol. The RNA was eliminated by treatment with RNase and the DNA was ®nally re-suspended in TE bu er (10 mM Tris, 1 mM EDTA, pH 7.5).
M-94 M-139 M-140 M-142 M-143 M-144 M-145 M-147 M-151 M-152 M-153 M-154 M-155 M-162 M-163 M-164 M-165 M-168 M-174 M-175 M-178 M-179 M-180 M-183
CGTGGTAATTCTAGAGCTAATACATGC AAACTTTCAACAACGGATCTCTTG GACGGGCGGTGTGTACAAA ATAGAGCTCCAGACGAGTGTGAAGGTTGC AGCGTCTAGAACCCAAACAAGAATAAGCG ACAGAGCTCCCGCTGAACTTAAGCATATC AGCGTCTAGAACCTTGGAGAACCTGCTG AGCGTCTAGAACGGGATTCTCACCCTC AGCGTCTAGACCTGTGGTAACTTTTCTGGC ACAGAGCTCTGAAAGTGTGGCCTATCG AGCGTCTAGACAAGGCCATGCGATTC AACGAGGAATTCCTAGTAAGCGCAAG AGCGTCTAGAGGCTTTATCTAATAAGTGC ACAGAGCTCAGCAGGTCTCCAAGG ACAGAGCTCGTTGTTTGGGAATGC AGCGTCTAGAATAGGTTAAGGAC AGCGTCTAGATGTCAAACTAGAGTCAAG CCAATAGCGTATATTAAAG CGATGTACTGAGATTAAGC CAGCGTCTAGACAACAAAGGCTACTC TCCAAAAGAAGAGCCTCC CAGTCTGAAGACAAGTTG TTTGACCCTTGATCCC CTACTGCCCGTGGTTTCAGTCG
DNA sequence ampli®cations PCR ampli®cations were carried out in a Perkin-Elmer 2400 thermal cycler (Foster City, Calif., USA). The reactions contained 20 ng of M. miehei DNA as the template and 2 U of Biotaq (Bioline Ltd., London, UK), in a ®nal volume of 50 ll. The program used consisted of 30 cycles of ampli®cation. In each cycle the conditions of denaturation, annealing and extension were: 30 s at 95 °C, 1 min at 45±60 °C (depending on the primers used) and 2 min at 60 °C, respectively. An initial denaturation step (5 min at 95 °C) and a ®nal extension step (10 min at 72 °C) were performed. The sequence of the oligonucleotides initially used as primers for the cloning of M. miehei rDNA was designed by comparison with the rDNA sequences of related fungal species. Highly conserved
a
GAGCTC and TCTAGA are the sequences recognised by restriction endonucleases SacI and XbaI, respectively, introduced in the primers to facilitate the cloning of the ampli®ed DNA fragments
414 and the other internal to the 25S rDNA, were labelled in the same conditions to be used as probes. The intensity of the hybridisation bands in the Southerns was quanti®ed by densitometry, using a GDS-5000 Image Acquisition and Analysis System (Gelbase Analysis Software, Upland, California, USA). Other molecular biology techniques were carried out using standard protocols (Sambrook et al. 1989).
Results The rDNA region: cloning, sequencing and determination of the number of copies present in the genome The rDNA sequences from a number of fungal species were aligned with the program Pileup. In the resulting alignment we searched for highly conserved stretches with a minimum length of 12 bp. The information provided by this analysis was used to design a set of synthetic oligonucleotides that could be used as primers to amplify overlapping fragments covering the entire
Fig. 1 Structure of the M. miehei rDNA unit. The physical map of the unit was built by assembling data from the di erent DNA fragments (F1±F24) obtained by PCR-ampli®cation, shown in the upper part of the ®gure. The oligonucleotides used as primers in the ampli®cation reactions are represented by arrows, and their sequences are given in Table 1. Abbreviations for restriction endonucleases are as follows: B BamHI; E EcoRI; H HindIII; N NsiI; P PstI; S SacI; M SmaI; X XbaI
rDNA unit. The physical map of the entire unit, composed from data of the di erent fragments, is shown in Fig. 1. The complete sequence of the repeated unit was determined. It was 9574 bp, approximately 0.5-kb longer than the ribosomal DNA unit of S. cerevisiae (Rustchenko and Sherman 1994) and about the same size as that of M. racemosus (Cihlar and Sypherd 1980). The four regions coding for the rRNA species were identi®ed because of their homology to the sequences of other fungal species. The cistron containing the 18S, 5.8S and 25S genes together with internal transcribed spacers (ITS1 and ITS2) has a size of about 5.7 kb. The 5.8S rRNA was located in the spacer between 18S and 25S rRNA as has been established for all fungi analysed to-date (Buckner et al. 1988; Garber et al. 1988; Wendland et al. 1999). The homology analysis indicated that the 5S element was also contained in the repeated unit. It is known that fungal species contain 100±200 tandem repeats of the rDNA unit (Russell et al. 1984; Buckner et al. 1988; Garber et al. 1988; Vilgalys and Gonzalez 1990). We decided to determine the number of copies present in M. miehei by comparing the intensity of hybridisation signals in a Southern analysis in which the DNA of the fungus was probed with DNA fragments from either the rDNA region or a single-copy gene. Insu cient information about M. miehei genes made it di cult to obtain a suitable probe. The gene encoding orotidine-5¢-monophosphate decarboxilase was a ®rst choice, since its sequence had been determined for other Zygomycota: Mucor circinelloides
415
pyrG (Benito et al. 1992); Rhizopus niveus pyr4 (EMBL accession number D17362); and Phycomyces blakesleeanus pyrG (Diaz-Minguez et al. 1990). However, repeated attempts to amplify the homologous M. miehei gene by PCR, using as primers di erent combinations of synthetic oligonucleotides matching conserved sequences of the three related Zygomycota species, were unsuccessful. As an alternative, we tried the mmp gene coding for aspartyl protease, one of the few genes of M. miehei whose sequence has been reported (Gray et al. 1986). The mmp gene was cloned by PCR. A 0.5-kb fragment from this gene and another 0.5-kb fragment from the 25S rDNA element were used as probes against M. miehei DNA. The result of the Southern hybridisation is shown in Fig. 2. A densitometry scanning of the hybridisation signals showed that the intensity of the rDNA band was about 100-times stronger than that of the mmp gene. The most-likely interpretation of this result is to assume that the mmp gene is present in the M. miehei genome as a single copy, and the rDNA unit in about 100 copies.
Fig. 2 A, B Comparative Southern analysis of the rDNA unit and the mmp gene from M. miehei. In both panels, lanes 1 and 2 contain equal amounts of undigested and EcoRI-digested DNA, respectively. The ®lters shown in panels A and B were hybridised with probes consisting of a 0.5-kb fragment of the mmp gene and a 0.5-kb fragment of the rDNA, respectively. Table 2 Comparison of genes encoding 25/28S ribosomal RNA from di erent species
Comparative analysis of the rDNA sequences The position of the M. miehei 25S gene (3331 bp) within the repeated unit of rDNA was assigned by comparison with the reported sequence from M. racemosus (3469 bp) (Ji and Orlowsky 1990). Both sequences share a high degree of homology (77% identity). A comparable homology was found to the 25S sequences from other fungi (Table 2). A homology analysis of the 18S rDNA from di erent fungi led to the de®nition of the M. miehei 18S gene as a 1780-bp sequence. This sequence showed the highest homology (about 80%) to the 18S rDNA of two other Mucor species: M. racemosus and M. mucedo (Table 3). Surprisingly, it showed a similar degree of homology to two entries of the database that supposedly corresponded to the 18S rDNA of two algae, Cepedea virguloidea and Opalina ranarum (accession nos. AF141969 and AF141970). The 18S genes of M. miehei, M. racemosus and the two algae share conserved sequences of 37 and 35 bp in their 5¢ and 3¢ termini, respectively. These sequences are also present in the 18S rDNA of S. cerevisiae, but are absent in the genes from other fungi, including two Mucor species: M. mucedo and M. rammanianus. We have also located the nucleotide sequence of M. miehei 5.8S rDNA by comparison with other fungal 5.8S sequences. The M. miehei 5.8S gene is 158-bp long. It showed higher homology to the 5.8S sequences of several Ascomycota and Basidiomycota species than to the available 5.8S sequences from the Zygomycota (Table 4). No 5.8S sequence from any other Mucor species was found in the databases. The region of M. miehei rDNA situated between the 25S and 18S subunits was examined in search of a sequence matching known 5S rDNA sequences available in the databases. A 122-bp sequence with this characteristic was found (Table 5). The putative M. miehei 5S gene was 1813 bp away from the 35S cistron and appeared to be transcribed in the opposite direction. This sequence showed lower homology to the 5S rDNA sequences in the databases than the other M. miehei rDNA genes did to their corresponding homologues. The non-coding regions of M. miehei rDNA were also analyzed. The internal transcribed spacers, ITS1 (198 bp) and ITS2 (255 bp), are AT-rich (66% and 77%,
Organism
Taxaa
Size (bp)
% GC
% Identity to Accession no. M. miehei gene
Mucor miehei Mucor racemosus Candida albicans Cryptococcus neoformans Saccharomycopsis ®buligera Saccharomyces cerevisiae Schizosaccharomyces japonicus Tricholoma matsutake Magnaporthe grisea
Z Z A B A A A B A
3331 3469 3360 3391 3362 3392 3417 3399 3338
46.2 42.8 47.6 48.3 43.7 47.9 44.3 47.4 53.9
100 77 74 74 73 73 73 72 72
a
A = Ascomycota; B = Basidiomycota; Z = Zygomycota
AF205941 M26190 X70659 L14067 U09238 J01355 Z32848 U62964 AB026819
416 Table 3 Comparison of genes encoding 16/18S ribosomal RNA from di erent species
Organism
Taxaa
Size (bp)
% GC
% Identity to M. miehei gene
Accession no.
Mucor miehei Mucor racemosus Mucor mucedo Candida lusitaniae Saccharomyces cerevisiae Cryptosporidium muris Theileria sergenti Mucor rammanianus Mortierella polycephala Neolecta vitellina Syncephalastrum racemosum
Z Z Z A A P P Z Z A Z
1780 1831 1755 1759 1798 1743 1750 1739 1719 1722 1756
46.1 43.0 43.2 48.2 44.9 42.3 44.3 43.8 43.9 46.5 47.5
100 83 79 77 77 75 75 75 75 74 73
AF205941 X54863 X89434 M55526 J01353 L19069 U97051 X89435 X89436 Z27393 X89437
a
Table 4 Comparison of genes encoding 5.8S ribosomal RNA from di erent species
Organism
Taxaa
Size (bp)
% GC
% Identity to M. miehei gene
Accession no.
Mucor miehei Omphalina ericetorum Piriformospora indica Lipomyces kononenkoae Lipomyces spencermartinsiae Waltomyces lipofer Chimonobambusa marmorea Nematoctonus robustus Thelephoraceae sp. Tremella foliacea Saccharomyces cerevisiae Glomus etunicatum Scutellospora castanea Entrophosphora infrequens Entomophaga aulicae
Z B B A A A B B B B A Z Z Z Z
158 158 156 158 158 158 158 156 156 154 158 155 156 155 155
40.5 44.3 45.5 41.1 41.1 41.1 39.2 45.8 45.5 44.2 46.2 44.2 41.8 44.9 38.5
100 78 77 77 77 77 77 76 76 76 75 75 74 72 67
AF205941 U66445 AF019636 U82454 U82455 U82461 U65613 U51978 U83477 AF042427 K01048 U94712 U31998 U94713 U35394
a
Table 5 Comparison of genes encoding 5S ribosomal RNA from di erent species
A = Ascomycota; P = Apicomplexa; Z = Zygomycota
A = Ascomycota; B = Basidiomycota; Z = Zygomycota
Organism
Taxaa
Size (bp)
% GC
% Identity to M. miehei gene
Accession no.
Mucor miehei Basidiolobus magnus Cunninghamella elegans Linderina macrospora Mortiriella formosensis Phycomyces blakesleeanus Dipsacomyces acuminosporus Genistelloides hibernus Blakeslea trispora Capniomyces stellatus Smittium culisetae Saccharomyces cerevisiae Coemansia mojavensis Amoebidium parasiticum
Z Z Z Z Z Z Z Z Z Z Z A Z Z
122 120 120 120 120 120 119 122 120 121 121 121 120 119
32.8 50.8 45.0 45.0 51.7 51.0 47.1 54.1 48.3 55.4 52.1 52.1 53.3 55.0
100 46 45 45 44 44 44 44 44 43 43 41 41 40
AF205941 M36313 M36310 M36308 M36312 V01120 M36307 M36315 M36311 M36316 M36314 X06838 M36309 M36306
a
A = Ascomycota; Z = Zygomycota
respectively). Poly A and poly T tracts 6±12 nucleotides long were found in both spacers. ITS1 is longer than the corresponding sequence of other Zygomycota, but still 163-bp shorter than the sequence of S. cerevisiae (Veldman et al. 1981). Some characteristic sequences found in S. cerevisiae (van Nues et al. 1994, 1995) and Ashbya gossypii (Wendland et al. 1999), presumptively
involved in the processing of the 35S precursor, were not found in the M. miehei ITSs. The non-transcribed spacers of M. miehei rDNA, NTS1 and NTS2, comprise 1813 bp and 1917 bp, respectively. As a comparison, S. cerevisiae NTS1 and NTS2 are 1100 and 1250 bp, respectively. M. miehei NTSs have low homology to the corresponding
417 Table 6 Possible ARS within the rDNA of M. miehei Putative ARS sequences in M. miehei rDNA
Positiona
Location NTS1 NTS1 5S NTS2 NTS2
C G T T A
T T T T T
T T T T A
T T T T T
A A A A A
T T T T T
G A A A A
T T C T T
C T T T T
T T T C T
T A T A T
nt nt nt nt nt
A/T
T
T
T
A
T
A/G
T
T
T
A/T
Consensus sequenceb
a b
7269±7279 7574±7584 5792±5802 8499±8509 8601±8611
Nucleotide positions are referred to Genbank sequence AF205949 S. cerevisiae ARS consensus sequence (Skryabin et al. 1984; Fabiani et al. 1996)
sequences of other fungi. They show many poly A and poly T tracts 6±12-bp long, which are more frequent in NTS1. This feature is also present in S. cerevisiae (Skryabin et al. 1984). The NTSs contains several direct repeats of up to 26 bp, and inverted repeats 8±10-bp long. A repeated (CAG)7 motif was also found in NTS2. A computer search was done, looking for putative origins of replication (termed ACS for ``ARS consensus sequences'') that have been described for di erent types of eukaryotes, such as S. cerevisiae, Tetrahymena thermophila or Pisum sativum (Skryabin et al. 1984; Amin and Pearlman 1985; HernaÂndez et al. 1993; Fabiani et al. 1996; Clyne and Kelly 1997; SaÂnchez et al. 1998). Five such sequences were found (Table 6), although their functional signi®cance remains to be elucidated.
Discussion The structure of the ribosomal DNA of M. miehei is similar to that of other fungi. The size of the rDNA unit (9574 bp) and the disposition of the 5.8S, 18S, and 25S rRNA elements are about the same as in other Ascomycota and Basidiomycota (Buckner et al. 1988; Tsuge et al. 1989; Vilgalys and Gonzalez 1990). In M. miehei, the 5S element is also contained in the repeated unit, as occurs in S. cerevisiae (Philippsen et al. 1978), M. racemosus (Cihlar and Sypherd 1980) or Ashbya gossypii (Wendland et al. 1999). In contrast, other fungi such as Neurospora, Aspergillus and Schizosaccharomyces contain multiple copies of the 5S rDNA that are dispersed in di erent locations of the genome (Garber et al. 1988), a property shared with higher eukaryotes. As would be expected, M. miehei rDNA genes showed highest scores of homology to the few published sequences from other Mucor species (Tables 2 and 3). However, the degree of homology to genes from other Zygomycota is about the same as that observed in Ascomycota and Basidiomycota species. Surprisingly, the 18S rDNA from M. miehei was found to be highly homologous to sequences that supposedly belonged to two seaweeds. The signi®cance of this result is unclear. It is possible that the sequenced DNA corresponds to a contaminant or a symbiotic fungus associated with the algae.
The analysis of the 5S element revealed a much lower degree of homology to the corresponding sequences of other fungi than that observed for other rDNA genes. This fact could be explained by the much higher heterogeneity shown by the 5S elements from di erent species, which can be transcribed in a di erent direction or even have a di erent physical localisation. The NTS is the most variable region in the rDNA, both in length and in DNA sequence. The study of the M. miehei NTS revealed the existence of several directed and inverted repetitions similar to those described for S. cerevisiae (Skryabin et al. 1984). Smith (1976) proposed that duplications easily evolve within a DNA region that has no sequence-speci®c function, by random unequal crossing-over between sister chromatids. When duplicated sequences are contained in a highly repeated tandem, like the rDNA structure, the probability of ®nding such repetitions is much higher. The functional role of NTSs has been studied in S. cerevisiae and S. carlsbergiensis by Skryabin et al. (1984). They described the presence of an ARS, corresponding to a chromosomal origin of replication, located on a fragment of 570 bp within NTS2. We have found some sequences resembling an ARS in the M. miehei NTS, although their function as replication origins has not been tested. Our analysis of M. miehei rDNA represents the ®rst complete characterisation of this sequence made for a Zygomycete. As rDNA sequences are highly repeated in the genome, their use as targets for homologous recombination could represent a valuable tool for genetic analysis, as it has been for several fungi (Lopes et al. 1989; Tsuge et al. 1990; Adam et al. 1995). This possibility would be of particular value in the case of a species with a known biotechnological application, such as M. miehei. Acknowledgments This work has been supported by grant ALI0362-97 from CICYT. We are grateful to Gracia GonzaÂlez-Blasco for assistance with some of the experiments.
References Aarstad K, Oyen TB (1975) On the distribution of 5s RNA cistrons on the genome of Saccharomyces cerevisiae. FEBS Lett 51: 227± 231
418 Adam AC, Rubio-Texeira M, Polaina J (1995) Induced expression of bacterial beta-glucosidase activity in Saccharomyces. Yeast 11: 395±406 Amin AA, Pearlman RE (1985) Autonomous replicating sequences from the non-transcribed spacers of Tetrahymena thermophila ribosomal DNA. Nucleic Acids Res 13: 2647±2659 Arnau J, Jepsen LP, Stroman P (1991) Integrative transformation by homologous recombination in the Zygomycete Mucor circinelloides. Mol Gen Genet 225: 193±198 Bell GI, DeGennaro LJ, Gelfand DH, Bishop RJ, Valenzuela P, Rutter WJ (1977) Ribosomal RNA genes of Saccharomyces cerevisiae. J Biol Chem 252: 8118±8125 Benito EP, Diaz-Minguez JM, Iturriaga EA, Campuzano V, Eslava AP (1992) Cloning and sequence analysis of the Mucor circinelloides pyrG gene encoding orotidine-5¢-monophosphate decarboxylase: use of the pyrG for homologous transformation. Gene 116: 59±67 Buckler ES, Ippolito A, Holtsford TP (1997) The evolution of ribosomal DNA: divergent paralogues and phylogenetic implications. Genetics 145: 821±832 Buckner B, Novotny CP, Ullrich RC (1988) Organization of the ribosomal RNA genes of Schizophyllum commune. Curr Genet 13: 417±424 Cassidy JR, Pukkila PJ (1987) Inversion of 5S ribosomal RNA genes within the genus Coprinus. Curr Genet 12: 33±36 Chen MW, Anne J, Volckaert G, Huysmans E, Vandenbergue A, De Wachter R (1984) The nucleotide sequences of the 5S rRNAs of seven molds and a yeast and their use in studying Ascomycete phylogeny. Nucleic Acids Res 12: 4881±4892 Cihlar RL, Sypherd PS (1980) The organization of the ribosomal RNA genes in the fungus Mucor racemosus. Nucleic Acids Res 8: 793±804 Clyne RK, Kelly TJ (1997) Identi®cation of autonomous replicating sequence (ARS) elements in eukaryotic cells. Methods 13: 221±233 Devereux J, Haeberli P, Smithies O (1984) A comprehensive set of sequence analysis programs for the VAX. Nucleic Acids Res 12: 387±395 Diaz-Minguez JM, Iturriaga EA, Benito EP, Corrochano L, Eslava AP (1990) Isolation and molecular analysis of the orotidine5¢-phosphate decarboxylase gene (pyrG) of Phycomyces blakesleeanus. Mol Gen Genet 224: 269±278 Fabiani L, Frontali L, Newton CS (1996) Identi®cation of an essential core element and stimulatory sequences in a Kluyveromyces lactis ARS element, KARS101. Mol Microbiol 19: 757±766 Foltmann B (1987) General and molecular aspects of rennets. In: Fox PF (ed) Cheese: chemistry, physics and microbiology. Volume 1, general aspects. Elsevier Applied Science, London New York, pp 33±62 Garber RC, Turgeon BG, Selker EU, Yoder OC (1988) Organization of ribosomal RNA genes in the fungus Cochliobolus heterostrophus. Curr Genet 14: 573±582 Gray GL, Hayenga K, Cullen D, Wilson LJ, Norton S (1986) Primary structure of Mucor miehei aspartyl protease: evidence for a zymogen intermediate. Gene 48: 41±53 Hanahan D (1983) Studies on transformation of Escherichia coli with plasmids. J Mol Biol 166: 557±560 Heerikhuizen H van, Ykema A, Klootwijk J, Gaillardin C, Ballas C, Fournier P (1985) Heterogeneity in the ribosomal RNA genes of the yeast Yarrowia lipolytica; cloning and analysis of two size classes of repeats. Gene 39: 213±222 Hernandez P, Martin-Parras L, Martinez-Robles ML, Schvartzman JB (1993) Conserved features in the mode of replication of eukaryotic ribosomal RNA genes. EMBO J 12: 1475±1985 Ji GE, Orlowsky M (1990) Primary and secondary structure of the 25S rRNA from the dimorphic fungus Mucor racemosus. Curr Genet 17: 499±506 Lopes TS, Klootwijk J, Veenstra AE, van der Aar PC, van Heerikhuizen H, Raue HA, Planta RJ (1989) High-copy number integration into the ribosomal DNA of Saccharomyces
cerevisiae: a new vector for high-level expression. Gene 79: 199±206 Mao J, Appel B, Schaack H, Yamada H, Soll D (1982) The 5S RNA genes of Schizosaccharomyces pombe. Nucleic Acids Res 10: 487±500 Metzemberg RL, Stevens JN, Selker EU, Morzycka-Wroblewska E (1985) Identi®cation and chromosomal distribution of 5S rRNA genes in Neurospora crassa. Proc Natl Acad Sci USA 82: 2067±2071 Nues RW van, Rientjes JMJ, van der Sande CAFM, Zerp SF, Sluiter C, Venema C, Planta RJ, Raue HA (1994) Separate structural elements within internal transcribed spacer I of Saccharomyces cerevisiae precursor ribosomal RNA direct the formation of 17S and 26S rRNA. Nucleic Acids Res 22: 912±919 Nues RW van, Venema J, Rientjes JM, Dirks-Mulder A, Raue HA (1995) Processing of eukaryotic pre-rRNA: the role of the transcribed spacers. Biochem Cell Biol 73: 789±801 Ohnuki T, Etoh Y, Beppu T (1982) Intraspeci®c and interspeci®c hybridization of Mucor pusillus and M. miehei by protoplast fusion. Agric Biol Chem 46: 451±458 Philippsen P, Thomas M, Kramer RA, Davis RW (1978) Unique arrangement of coding sequences for 5S, 5.8S, 18S and 25S ribosomal RNA in Saccharomyces cerevisiae as determined by R-loop and hybridization analysis. J Mol Biol 123: 387±404 Rozek CE, Timberlake WE (1979) Restriction endonuclease mapping by crossed contact hybridization: the ribosomal RNA genes of Achlya ambisexualis. Nucleic Acids Res 7: 1567± 1578 Russell PJ, Wagner S, Rodland KD, Feilbaum RL, Russell JP, Bret-Harte MS, Free SJ, Metzenberg RL (1984) Organization of the ribosomal ribonucleic acid genes in various wild-type strains and wild-collected strains of Neurospora. Mol Gen Genet 196: 275±282 Rustchenko EP, Sherman F (1994) Physical constitution of ribosomal genes in common strains of Saccharomyces cerevisiae. Yeast 10: 1157±1171 Sambrook J, Fritsch EF, Maniatis T (1989) Molecular cloning: a laboratory manual, 2nd edn. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York SaÂnchez JA, Kim SM, Huberman JA (1998) Ribosomal DNA replication in the ®ssion yeast Schizosaccharomyces pombe. Exp Cell Res 238: 220±30 Selker EU, Yanofsky C, Driftmier K, Metzenberg RL, AlznerDeWeerd B, RajBhandary UL (1981) Dispersed 5S RNA genes in N. crassa: structure, expression and evolution. Cell 24: 819± 828 Skryabin KG, Eldarov MA, Larionov VL, Bayev AA, Klootwijk J, de Regt VC, Veldman GM, Planta RJ, Georgiev OI, Hadjiolov AA (1984) Structure and function of the non-transcribed spacer regions of yeast rDNA. Nucleic Acids Res 12: 2955±2968 Smith GP (1976) Evolution of repeated DNA sequences by unequal crossover. Science 191: 528±535 Tabata S (1981) Nucleotide sequences of the 5S ribosomal RNA genes and their adjacent regions in Schizosaccharomyces pombe. Nucleic Acids Res 9: 6429±6437 Tague BW, Gerbi SA (1984) Processing of the large rRNA precursor: two proposed categories of RNA-RNA interactions in eukaryotes. J Mol Evol 20: 362±367 Tonouchi N, Shoun H, Uozumi T, Beppu T (1986) Cloning and sequencing of a gene for Mucor rennin, an aspartate protease from Mucor pusillus. Nucleic Acids Res 14: 7557±7568 Tsuge T, Kobayashi H, Nishimura S (1989) Organization of ribosomal RNA genes in an Alternaria alternata Japanese pear pathotype, a hostselective AK-toxin-producing fungus. Curr Genet 16: 267±272 Veldman GM, Klootwijk J, van Heerikhuizen H, Planta RJ (1981) The nucleotide sequence of the intergenic region between the 5.8S and 26S rRNA genes of the yeast ribosomal RNA operon. Possible implications for the interaction between 5.8S and 26S rRNA and the processing of the primary transcript. Nucleic Acids Res 10: 4847±4862
419 Vilgalys R, Gonzalez D (1990) Organization of ribosomal DNA in the Basidiomycete Thanatephorus praticola. Curr Genet 18: 277±280 Wada M, Beppu T, Horinouchi S (1996) Integrative transformation of the Zygomycete Rhizomucor pusillus by homologous recombination. Appl Microbiol Biotechnol 45: 652±657
Wendland J, PoÈhlmann R, Dietrich F, Steiner S, Mohr C, Philippsen P (1999) Compact organization or rRNA genes in the ®lamentous fungus Ashbya gossypii. Curr Genet 35: 618±625 Yanish-Perron C, Vieira J, Messing J (1985) Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mp18 and pUC19 vectors. Gene 33: 568±572