2003 FEMS2 by sergi maicas

FEMS Microbiology Letters 226 (2003) 159^167

www.fems-microbiology.org

Characterization of a Candida albicans gene encoding a putative transcriptional factor required for cell wall integrity Inmaculada Moreno a , Yolanda Pedren‹o a;1 , Sergi Maicas Enrique Herrero b , Eulogio Valentin a

a;2

, Rafael Sentandreu a ,

Departamento de Microbiolog|¤a y Ecolog|¤a, Facultad de Farmacia, Universidad de Valencia, Avda. Vicente Andre¤s Estelle¤s s/n Burjassot, 46100-Valencia, Spain b Departamento de Ciencias Me¤dicas Ba¤sicas, Facultad de Medicina, Universidad de Lleida, 25198-Lleida, Spain Received 10 June 2003; received in revised form 23 July 2003; accepted 23 July 2003 First published online 22 August 2003

Abstract After screening a Candida albicans genome database the product of an open reading frame (ORF) (CA2880) with 49% homology to the product of Saccharomyces cerevisiae YPL133c, a putative transcriptional factor, was identified. The disruption of the C. albicans gene leads to a major sensitivity to calcofluor white and Congo red, a minor sensitivity to sodium dodecyl sulfate, a major resistance to zymolyase, and an alteration of the chemical composition of the cell wall. For these reasons we called it CaCWT1 (for C. albicans cell wall transcription factor). CaCwt1p contains a putative Zn(II) Cys(6) DNA binding domain characteristic of some transcriptional factors and a PAS domain. The CaCWT1 gene is more expressed in stationary phase cells than in cells growing exponentially. To our knowledge, this is the first Zn(II) Cys(6) transcriptional factor-encoding gene implicated in the cell wall architecture. > 2003 Federation of European Microbiological Societies. Published by Elsevier B.V. All rights reserved. Keywords : Transcriptional factor; Gene disruption ; Cell wall ; Candida albicans

1. Introduction Candida albicans is an opportunistic pathogen fungus in humans with increasing incidence [1], mainly in immunocompromised patients [2]. C. albicans is a polymorphic organism capable of reproducing by budding (yeast cells) or by producing ¢lamentous forms (mycelial cells) depending upon environmental factors [1]; this morphological transition has been associated with pathogenicity [3]. Eukaryotic cells respond to environmental changes modulating in a coordinate way the simultaneous expression of many genes. In these processes transcriptional factors play an important role. Knowledge of signal trans-

* Corresponding author. Tel. : +34 (96) 3543614; Fax : +34 (96) 3544299. E-mail address : eulogio.valentin@uv.es (E. Valentin). 1

Present address: Area de Microbiolog|¤a, Facultad de Biolog|¤a, Universidad de Murcia, 30071-Murcia, Spain. 2 Present address: Facultad de Ciencias Experimentales y de la Salud, Universidad Cardenal Herrera-CEU, 46113-Moncada (Valencia), Spain.

duction pathways in pathogenic fungi is essential to understand the mechanisms of adaptation to a changing and complex environment such as the human body. In C. albicans, many of the MAP (mitogen-activated protein) kinase pathway components are homologous to those in Saccharomyces cerevisiae [4,5]. The MAP kinase pathways are important in virulence and in the morphological transition of C. albicans [6], some transcriptional factors as Efg1 and Cph1 are targets of these pathways [7]. For this reason the transcriptional factors must play an important role in the pathogenicity of C. albicans and the knowledge of their function should help us to understand the complex interactions that parasite and host establish during the infection process. Recently the complete sequence of the genome of C. albicans has been determined (http://www-sequence. standford.edu/group/candida/) and annotated by the European Consortium Galar Fungail (http://www.pasteur.fr/ recherche/unites/GalarFungail and http://genolist.pasteur. fr/CandidaDB). The availability of the sequence for entire C. albicans genome and its annotation opens the door to genome functional analysis.

FEMSLE 11150 8-9-03

Cyaan Magenta Geel Zwart

160

I. Moreno et al. / FEMS Microbiology Letters 226 (2003) 159^167

In the present paper we have taken a sequence-dependent approach to identify transcriptional regulatory open reading frames (ORFs) by screening the database genome of C. albicans for transcriptional regulatory proteins containing the Zn(II) Cys(6) DNA binding domain signature [8]. From the total ORFs identi¢ed as potential transcriptional regulatory factors we selected one of them, CA2880, that presents a high homology with S. cerevisiae ORF YPL133c, a putative transcriptional factor. We have characterized the phenotype of the C. albicans null mutant for CA2880, showing that the cell wall architecture must be altered. For this reason we call the gene, in a ¢rst attempt, CaCWT1 for C. albicans cell wall transcriptional factor.

2. Materials and methods 2.1. Strains, growth conditions and transformations The C. albicans strains used in this study were 3781-A (vCacwt1 : :ARG5,6/CaCWT1 vura3: :imm434/vura3: : imm434 vhis1: :hisG/vhis1: :hisG), 3781-AH (vCacwt1 : : ARG5,6/vCacwt1: :HIS1 vura3: :imm434/vura3: :imm434) both derived from CNC43 (vura3: :imm434/vura3: : imm434 his1: :hisG/vhis1: :hisG varg5,6: :hisG/varg5,6: : hisG) [9]. Escherichia coli DH5K [F, x80, lac4M15, 3 recA1, endA1, gyrA96, thi3 1, (r3 k , mk ), supE44, relA1, deoR, v(lacZYA-argF) U169] was used routinely for transformations as described by Hanahan [10]. C. albicans cells were routinely grown in YPD medium [11] or SD medium supplemented with the appropriate nutrients in amounts speci¢ed by Sherman [11]. For germ tube induction, cells were cultured in modi¢ed Lee’s medium as described elsewhere [12]. C. albicans transformation was performed according to Gietz et al. [13]. 2.2. Nucleic acid manipulations and analysis Genomic DNA preparation from C. albicans was carried out as described by Fujimura and Sakuma [14]. Total RNA isolation was done as previously described [15]. Standard DNA manipulation techniques were carried out using standard protocols [16]. DNA probes (amplicons YIE12 and YIE34) for Southern analysis were labelled by random primed incorporation of digoxigenin-labelled deoxyuridine-triphosphate (DIG-labelled DNA) using DIG DNA labelling kit (Roche) according to the manufacturer’s instructions. Southern analysis was performed as described by Ramo¤n et al. [15]. DNA and RNA concentrations were determined in a GeneQuant II RNA/DNA calculator spectrophotometer (Amersham Biosciences). 2.3. Plasmid constructions for disruption and reintegration of the CaCWT1 gene The strategy followed for disrupting CaCWT1 was car-

FEMSLE 11150 8-9-03

ried out in two steps by replacement of part of the ORF (amino acid 120^430) with CaARG5,6 or CaHIS1. The disruption cassette constructions were made by polymerase chain reaction (PCR) ampli¢cation in two steps using genomic DNA as template. In the ¢rst step an amplicon of 312 bp was obtained using the sense primer YIE1 (CACAGAATTCCTCCGGAGATAACAGAACCC) and the antisense primer YIE2 (CACAGAGCTCATGGTGGCAACGGTAACGGC) containing an engineered EcoRI (underlined) and SacI restriction site (underlined) respectively. The amplicon obtained (YIE12) was digested with EcoRI and SacI, then subcloned into pAN9 (Negredo et al., unpublished data) and pAYE1 containing CaARG5,6 and CaHIS1 respectively. The resulting plasmids were named pYIE12A and pYIE12H and contained the 5P region of the gene (positions +77 to +388 with respect to the start codon). In the second step an amplicon of 436 bp containing the 3P region of the gene (positions +1297 to +1732 with respect to the start codon) was obtained by using the sense primer YIE3 (CACAGCATGCTTTCGACCGGCTTTTAGGGC) and the antisense primer YIE4 (CACAAAGCTTCAATGGGGATAAAATTACCC) containing engineered restriction sites SphI and HindIII respectively (underlined). The amplicon obtained (YIE34) was ligated into SphI and HindIII sites of pYIE12A and pYIE12H to create plasmids pYIE14A and pYIE14H respectively, in which 908 bp (52%) of the coding region were deleted. Plasmid pAYE1 containing the CaHIS1 gene was obtained by inserting a SalI/XbaI fragment carrying the CaHIS1 gene from plasmid p34HHIS2 (Navarro-Garc|¤a et al., unpublished data) into pUC18 plasmid [17]. To reintegrate the CaCWT1 gene into the genome of the null mutant strain, 3781-AH, a 3.2-kb fragment of DNA containing the CaCWT1 gene was inserted into plasmid CIp10 [18]. The new plasmid created, CIp10-3781, was linearized by digestion with StuI and used to transform the null mutant strain. 2.4. Isolation of CaCWT1 null mutant Disruption of CaCWT1 was achieved as follows. C. albicans CNC43 cells were transformed to Argþ prototrophy with 10 Wg of an EcoRI/HindIII fragment from plasmid pYIE14A according to Gietz et al. [13]. Transformed cells were selected as Argþ in SD minimal medium lacking arginine and checked for integration of the cassette at the CaCWT1 locus by Southern blot analysis. One of the heterozygous disruptants recovered (designated C. albicans 3781-A) was used for replacement of the second CaCWT1 allele in a similar way using the EcoRI/HindIII fragment from plasmid pYIE14. Transformed cells were selected as Hisþ , and integration into the correct allele was veri¢ed by Southern blot analysis. One of these Hisþ transformants, corresponding to CaCWT1 null mutant, was designated C. albicans 3781-AH.

Cyaan Magenta Geel Zwart

I. Moreno et al. / FEMS Microbiology Letters 226 (2003) 159^167

2.5. Phenotypic analysis of CaCWT1 null mutants Calco£uor white (CW), Congo red (CR) and sodium dodecyl sulfate (SDS) were tested by streaking cells on plates containing di¡erent concentrations of CW, CR or SDS following the method described by Van der Vaart et al. [19]. 3-Wl samples of serial 1/10 dilutions of cells growing overnight (adjusted to an optical density at 600 nm) were deposited on YPD plates containing di¡erent concentrations of CW (0^30 Wg ml31 ), CR (0^300 Wg ml31 ) or SDS (0^0.015%), grown at 28‡C and monitored for 3 days. Sensitivity to zymolyase was also tested following the method described by Van der Vaart et al. [19]. Exponentially growing cells were adjusted to an optical density of 0.5 (V4U106 cells ml31 ) in 10 mM Tris^HCl, pH 7.5, containing 100 Wg of zymolyase 20T ml31 of cells, and decreases in the optical density monitored over a 90-min period. 2.6. Chemical determinations Protein was extracted with 1 M NaOH for 30 min in a boiling water bath, and measured with Folin’s reagent using bovine serum albumin as standard. Neutral sugars were measured as described by Dubois et al. [20] using glucose as standard. Chitin was measured as described by Spetch et al. [21]. GlcNAc was measured by the method of Reissig et al. [22]. L-1,6-glucan was measured as described by Dijkgraaf et al. [23]. Assays were made in triplicates from at least two wall samples. Data did not di¡er by more than 10%. 2.7. Reverse transcription (RT)-PCR Oligo(dT)-primed ¢rst strand cDNA was prepared from total RNA derived from C. albicans CNC43, at di¡erent growth phases, growing in YPD medium at 28‡C. The SuperScript First Strand Synthesis System for RT-PCR (Invitrogen) was used following the manufacturer’s instructions. The sense and antisense primers were YIE1 and YIE2 respectively; this combination of primers specifically ampli¢ed a 312 bp amplicon. An approximate con¢rmation of the relative amount of total cDNA in each sample was also made by a PCR approach using primers EFB1F (ATTGAACGAATTCTTGGCTGAC) and EFB1R (CATCTTCTTCAACAGCAGCTTG) which speci¢cally ampli¢ed a 526-bp fragment of EFB from C. albicans [24]. Since EFB1 contains an intron, primers EFB1F and EFB1R also served as control to con¢rm that samples had not genomic DNA contamination (an amplicon of 890 bp appeared if this was the case). All samples contained the same quantity of ¢rst strand cDNA (1 Wg). PCR was performed as follows : EcoTaq polymerase (1 U, Ecogen) was added to 24 Wl of a solution consisting of 16.6 mM (NH4 )2 SO4 , 2.5 mM MgCl2 , 67 mM Tris^HCl (pH 8.8), 0.2 mM each of dATP, dCTP,

FEMSLE 11150 8-9-03

161

dGTP, dTTP, 0.3 WM each of primers YIE1 and YIE2 (or EFB1F and EFB1R) and 1 Wg of cDNA. Ampli¢cation was performed in a PCR thermal cycler (Perkin-Elmer Gene Amp PCR System 2400) by using one cycle at 94‡C for 5 min, and then 30 cycles as follows : 30 s at 94‡C, 30 s at 50‡C and 1 min at 72‡C. Amplicons obtained in di¡erent samples were run on 1% agarose gel.

3. Results and discussion 3.1. In silico analysis for potential transcriptional factors with Zn(II) Cys(6) DNA binding domain signature The N-terminal region of a number of fungal transcriptional regulatory proteins contains a Cys-rich motif that is involved in zinc-dependent binding of DNA. A wide range of proteins are known to contain this domain, e.g. proteins involved in amino acid metabolism, nucleotide metabolism, carbohydrate metabolism and others. The Zn(II) Cys(6) binding domain signature has the consensus sequence [GASTPV]-C-X2 -C-[RKHSTACW]-X2 -[RKHQ]X2 -C-X5 12 -C-X2 -C-X6 8 -C and was ¢rst characterized in S. cerevisiae [25]. Proteins containing this DNA binding motif are typically transcriptional factors, and it is thus far unique to the fungi [8]. On the basis of this characteristic a C. albicans database (http://genolist.pasteur.fr/CandidaDB/) was analyzed using a blast approach. Ten ORFs were identi¢ed as putative Zn(II) Cys(6) transcriptional factors (Fig. 1A). From these ORFs analyzed we selected one (CA2880) that presents a high homology (49%) with ORF YPL133c of S. cerevisiae, a putative transcriptional factor [26], when the comparison was made over the entire length (Fig. 1B). When the comparison was made in the last C-terminal 350 amino acid residues the homology was 82%, indicating that CA2880 and YPL133c are homologs. 3.2. Structural analysis of the amino acid sequence encoded by CaCWT1 The ORF encodes a putative polypeptide of 578 amino acids with a theoretical molecular mass of 64.7 kDa and a pI of 8.33. Analysis of the predicted amino acid sequence revealed the following features (Fig. 1C): (i) an N-terminal region (amino acids 34^47) with characteristics of a nuclear localization signal [27], (ii) a typical zinc binuclear cluster DNA binding domain of the fungal type Zn(II) Cys(6) (amino acids 51^79), ¢rst characterized in S. cerevisiae [25], (iii) a glutamine-rich region (amino acids 147^ 220) which resembles the glutamine-rich domains of other transcription factors, e.g. the ACEII transcriptional factor for Trichoderma reesei [28], (iv) an asparagine-rich region (amino acids 261^310), and (v) a PAS domain (amino acids 472^578). PAS domains are involved in eukaryotic signal transduction [29]. PAS domains are named after

Cyaan Magenta Geel Zwart

162

I. Moreno et al. / FEMS Microbiology Letters 226 (2003) 159^167

Fig. 1. A: Homologies among the Zn(II) Cys(6) domain signature of the ORFs found in the C. albicans database. The ORFs are named by its denomination in this database. In the consensus sequence X means any amino acid. B: Alignment of CaCwt1p amino acid sequence with S. cerevisiae ORF YPL133c. The alignment was performed with the CLUSTAL programs and subsequently shaded using Boxshade 3.31 software. Residues that are identical are shaded in black, whereas conserved residues are shaded in gray. Dashed spaces represent gaps to maximize alignment. C: Structural features of CaCwt1p. The nuclear localization signal (NS), the Zn(II) Cys(6) domain (Zn-Cys), the glutamine-rich (Gln) and asparagine-rich (Asn) regions, and PAS domain are indicated.

homology between the Drosophila period proteins (PER), the aryl hydrocarbon receptor nuclear translocator protein (ARNT) and the Drosophila single minded protein (SIM). The Zn(II) Cys(6) and PAS domains exhibit the most extensive homology between CaCwt1p and ORF YPL133c and are probably responsible for speciÂ˘c functions common to these proteins. Mutagenesis experiments have demonstrated that Zn(II) Cys(6) of identiÂ˘ed transcriptional factors participates in DNA binding [8], and it could be inferred that CaCwt1p functions in a similar way. The JIGSAW and 3D-PSSM [30] servers were used to generate homology models for the two recognized domains in CaCwt1p : (i) a zinc binuclear cluster DNA bind-

FEMSLE 11150 8-9-03

ing domain of the fungal type Zn(II) Cys(6) and (ii) a PAS domain. The structural fold of the CaCwt1p Zn(II) Cys(6) domain was predicted by using S. cerevisiae Cyp (Hap1) DNA binding domain (PDB entry: 1PYC) as the best available template (Fig. 2). The CaCwt1p structure comprises a helical region and belongs to the zinc cluster family, which is characterized by the presence of two zinc ions complexed by the sulfur atoms of six cysteines [31]. For structural prediction of CaCwt1p PAS domain, the PYP-like sensor domain FixL (PDB entry: 1ew0), a twocomponent regulatory system in Rhizobium meliloti, resulted to be a good template (90% certainty) (Fig. 3).

Cyaan Magenta Geel Zwart

I. Moreno et al. / FEMS Microbiology Letters 226 (2003) 159^167

163

Fig. 2. A: Structure-based alignment of CaCwt1p Zn(II) Cys(6) domain sequence relative to its template for homology modelling (Cyp, PDB : 1PYC), S. cerevisiae homologous protein domain (ORF YPL133c) and other X-ray crystallographed homologous structures in S. cerevisiae Gal4 and Put3 (PDB: 1D66 and 1AJY respectively) and Aspergillus nidulans AlcR (PDB: 2ALC). B: Schematic representation of the CaCwt1p Zn(II) Cys(6) domain achieved by threading it to S. cerevisiae Cyp1 (Hap1) DNA binding domain (PDB: 1PYC). Oxygen, nitrogen and sulfur are colored in red, blue and yellow respectively. The ¢gure was generated with RasMol [35].

The N-terminus subdomain (amino acid residues 472^507) appears to be a PAS core showing high density of conserved residues with other PAS domains [32]. Two L-sheets (AL and BL ) and three K-helices (CK , DK and EK ) have been detected in this region. The L-sca¡old C-terminus subdomain (amino acid residues 543^578) is a platform that comprises three L-sheets (GL , HL and IL ) and maintains the structural integrity of the PAS domain, and a helical connector (FK ) (amino acid residues 508^542) which lies between the PAS core and the L-sca¡old. The helical connector and the L-sca¡old have a lower degree of conservation than the PAS core as appears to be frequent for other PAS domains [29]. Analysis of a completely sequenced organism has revealed the existence of abundant PAS domains [33]. Fungi are not highly represented, as only a few PAS structures have been reported [29] by acting as transcriptional activators. 3.3. Construction of a CaCWT1 null mutant and its phenotypic analysis To investigate the function of the CaCWT1, construction of null mutants by targeted gene disruption and analysis of the resulting phenotype were carried out as described in Section 2. Disruption of the CaCWT1 was performed by using a strategy in two steps. In the ¢rst

FEMSLE 11150 8-9-03

step a cassette consisting of the CaARG5,6 gene £anked by CaCWT1 sequences was used to transform C. albicans CNC43 to Argþ . 24 transformants were analyzed and 17 of them contained the desired insert at the CaCWT1 locus (data not shown). Southern analysis of a representative isolate, C. albicans 3781-A, after digestion with XbaI revealed the correct integration in the allele contained in a 3.9-kb XbaI fragment originating a 5.3-kb and a 1.65-kb fragment; this is consistent with replacement of one allele of the CaCWT1 with the transforming DNA. The 3.9-kb XbaI fragment corresponds to the other allele which was still present in the Argþ transformants. In the second step the homozygous CaCWT1 null mutant was generated after transformation of strain C. albicans 3781-A with a cassette consisting of the CaHIS1 gene £anked by CaCWT1 sequences. Genomic DNA was isolated from transformants and screened by Southern blot analysis of a representative Hisþ isolate that exhibited a hybridization pattern consistent with targeting of the previously undisrupted allele, strain C. albicans 3781-AH. The parental 3.9-kb XbaI fragment was absent, both a 1.65-kb and a 1.4-kb fragment appearing instead, indicating a correct integration. RT-PCR analysis demonstrated that no mRNA was present in RNA samples from the null mutant C. albicans 3781-AH (data not shown). In order to know the possible role of CaCWT1, we

Cyaan Magenta Geel Zwart

164

I. Moreno et al. / FEMS Microbiology Letters 226 (2003) 159^167

Fig. 3. A: Multiple alignments of fungal PAS domains. The alignment was performed as described by Taylor and Zhulin [29] with modi¢cations. B: The secondary structure of CaCwt1p was deduced from that of R. meliloti FixL (PDB: 1ew0). Similar residues in at least four sequences are highlighted. The N-terminal link region (blue), PAS core (red), helical connector (green) and L-sca¡old (yellow) are shown. The ¢gure was generated with RasMol [35].

analyzed the phenotype of three independent Cacwt1 null mutants under di¡erent conditions, and compared them with their parental strain. The speci¢c growth rates of the yeast form of the parental strain C. albicans CNC43 and strains 3781-A and 3781-AH were similar in both aerobic and anaerobic conditions, and no di¡erences in morphology were observed. No di¡erences in the kinetics of germ tube formation were observed between mutants and the parental strain. Possible alterations in the cell wall were studied by testing the sensitivities of the mutants to CW, CR, SDS and zymolyase, as described by Van der Vaart et al. [19]. Sensitivities to CW and CR did increase with respect to the parental strain (Fig. 4A); however, the sensitivity to SDS was decreased (Fig. 4A). These results could suggest that the di¡erent components of the cell wall could be in no adequate concentrations in the mutant strain. In order to know it, a comparative chemical composition of cell walls from the wild-type (CNC43) and the null mutant strain (3781-AH) was performed. The results obtained (Table 1) show di¡erences in the composition of the isolated walls. The L-glucan fraction was diminished and the mannan fraction was highly (about six times) incremented in the mutant cell walls, whereas no di¡erences were observed in both chitin and protein content when compared to the parental strain. A high decrease in sensi-

FEMSLE 11150 8-9-03

tivity to zymolyase was also observed in the null mutant (Fig. 4B). This minor sensitivity could be related to changes in the structure of the glucan network or an increment in the thickness of the outer layer of the cell wall as suggested by Van der Vaart et al. [20] for S. cerevisiae. To check that the observed phenotype of the null mutant was a consequence of the CaCWT1 gene disruption, one copy of the gene was reintegrated into the genome of the C. albicans 3781-AH into the RP10 locus. Upon reintegration of the CaCWT1 gene, the null mutant strain

Table 1 Chemical composition of cell walls Component

Content (Wg mg31 cell wall dry weight) CNC43

Total glucan L-1,6-glucan L-1,3-glucan Mannan Chitin Protein

132 129 3 16 296 8.5

3781-AH 65 63 1.8 101 295 8.7

Isolated cell walls from exponentially growing cultures were analyzed as described in Section 2. The values are from a single representative experiment in a series of three independent experiments.

Cyaan Magenta Geel Zwart

I. Moreno et al. / FEMS Microbiology Letters 226 (2003) 159^167

165

Fig. 4. A: Sensitivities to CW, CR and SDS of the parental strain, the heterozygous (Cacwt1v/CaCWT1) 3781-A and homozygous (Cacwt1v/Cacwt1v) 3781-AH strains. Cells were grown in YPD medium and a 1/10 dilution series of each strains was inoculated in YPD medium. Control means YPD medium alone. B: Sensitivities to zymolyase of the null mutant (a, Cacwt1v/Cacwt1v) and the parental strain (b, CaCWT1/CaCWT1). Exponentially growing cells were incubated in 100 Wg of zymolyase 20T ml31 , and the decreases in the OD600nm were monitored.

FEMSLE 11150 8-9-03

Cyaan Magenta Geel Zwart

166

I. Moreno et al. / FEMS Microbiology Letters 226 (2003) 159^167

Fig. 5. Expression of CaCWT1 mRNA measured by RT-PCR. A: Representation of growth phases of C. albicans in YPD. Filled squares represent the samples from which RNA was obtained for RT-PCR. B: Samples containing 1 Wg cDNA were subjected to 30 cycles of ampli¢cation and then run on a 1% agarose gel (see text for further details). Numbers mean cells at di¡erent OD600nm .

became more resistant to CW and CR, and more sensitive to SDS (data not shown) being its behavior similar to the heterozygous mutant strain (3781-A; Fig. 4A) but not regained the characteristics of the parental strain. These results could indicate that the e¡ect of the CaCWT1 in the cell wall architecture of C. albicans could be dosage dependent. 3.4. Expression patterns of CaCWT1 The expression of CaCWT1 was examined by RT-PCR as described in Section 2. The results (Fig. 5) indicate that CaCWT1 shows a di¡erential expression pattern as a function of growth phases, being more expressed when cells were in stationary phase than in exponential phase of growth. Valentin et al. [34] reported in S. cerevisiae di¡erences in the levels of N-glycosidically linked mannose residues between cells at early exponential phase and at stationary phase. This fact could mean a regulation of the cell wall components through the population cell cycle, and so we can speculate that one of the transcriptional factors involved could be CaCwt1p. We have not been able to establish the exact biological function for CaCwt1p, although structural data suggest its implication as a transcriptional factor, in which the Zn(II) Cys(6) domain could act as a DNA binding factor and the PAS domain could contribute to the activation of the molecule. Additional studies with modi¢ed versions of CaCwt1p and a global analysis of the transcriptome using

FEMSLE 11150 8-9-03

DNA microarrays should provide insights about its regulatory mechanism.

Acknowledgements This work was partially supported by grants from the Ministerio de Ciencia y Tecnolog|¤a (Spain) (BMC20001449 and ALI99-1224-CO2-02), the Program Quality of Life and Management of Living Resources (QLK2-CT2000-00795) and Fondo de Investigaciones Sanitarias (FIS 01/1693E), Spain. We thank Dr. Federico NavarroGarc|¤a and Dr. Jesu¤s Pla¤ for plasmids pAN9 and pHHIS2, and for strain C. albicans CNC43. Thanks to Mr. Stan Perkins for revision of the English version of the manuscript. References [1] Odds, F.C. (1994) Candida species and virulence. Am. Soc. Microbiol. News 60, 313^318. [2] Corner, B.E. and Magee, P.T. (1997) Candida pathogenesis : unravelling the threads of infection. Curr. Biol. 7, R691^R694. [3] Sentandreu, R., Elorza, M.V., Mormeneo, S., Sanjuan, R. and Iranzo, M. (1993) Possible roles of mannoproteins in the construction of Candida albicans cell wall. In: Dimorphic Fungi in Biology and Medicine (Vanden Bossche, H., Odds, F. and Kerndge, D., Eds.), pp. 169^175. Plenum Press, New York. [4] Brown, A.J.P. and Gow, N.A.R. (1999) Regulatory networks controlling Candida albicans morphogenesis. Trends Microbiol. 7, 333^ 338.

Cyaan Magenta Geel Zwart

I. Moreno et al. / FEMS Microbiology Letters 226 (2003) 159^167 [5] Paravicini, G., Mendoza, A., Antonsson, B., Cooper, M., Losberger, C. and Payton, M. (1996) The Candida albicans PKC1 gene encodes a protein kinase C homolog necessary for cellular integrity but not dimorphism. Yeast 12, 741^756. [6] Ernst, J.F. (2000) Transcription factors in Candida albicans-environmental control of morphogenesis. Microbiology 146, 1763^1774. [7] Berman, J. and Sudbery, P.E. (2002) Candida albicans: a molecular revolution built on lessons from budding yeast. Nat. Rev. Genet. 3, 918^930. [8] Todd, R.B. and Andrianopoulos, A. (1997) Evolution of a fungal regulatory family: The Zn(II) 2(Cys)6 binuclear cluster DNA binding motif. Fungal Genet. Biol. 21, 388^405. [9] Negredo, A., Monteoliva, L., Gil, C., Pla, J. and Nombela, C. (1997) Cloning analysis and one-step disruption of the ARG5,6 gene of Candida albicans. Microbiology 143, 297^302. [10] Hanahan, D. (1983) Studies on transformation of Escherichia coli with plasmids. J. Mol. Biol. 166, 557^580. [11] Sherman, F. (1991) Getting started with yeast. In: Guide to Yeast Genetics and Molecular Biology (Guthrie, C. and Fink, G.R., Eds.), pp. 3^21. Academic Press, San Diego, CA. [12] Elorza, M.V., Marcilla, A. and Sentandreu, R. (1988) Wall mannoproteins of the yeast and mycelial cells of Candida albicans: nature of the glycosidic bonds and polydispersity of their mannan moieties. J. Gen. Microbiol. 134, 2393^2403. [13] Gietz, R.D., Schiestl, R.H., Willems, A.R. and Woods, R.A. (1995) Studies on the transformation of intact cells by the LiAc/SS-DNA/ PEG procedure. Yeast 11, 355^360. [14] Fujimura, H. and Sakuma, Y. (1993) Simpli¢ed isolation of chromosomal and plasmid DNA from yeast. BioTechniques 14, 538^540. [15] Ramon, A.M., Gil, R., Burgal, M., Sentandreu, R. and Valentin, E. (1996) A novel cell wall protein to the mycelial form of Yarrowia lipolytica. Yeast 12, 1535^1548. [16] Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual, 2nd Edn. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. [17] Yanisch-Perron, C., Vieira, J. and Messing, J. (1988) Improved M13 phage cloning vectors and host strains : nucleotide sequences of the M13mp18 and pUC19 vectors. Gene 33, 103^119. [18] Murad, A.M.A., Lee, P.R., Broadbent, I.D., Barelle, C.J. and Brown, A.J.P. (2000) CIp10, an e⁄cient and convenient integrating vector for Candida albicans. Yeast 16, 325^327. [19] Van der Vaart, J.M., Caro, H.P., Chai Man, J.W., Klis, F.M. and Verrips, C.T. (1995) Identi¢cation of three mannoproteins in the cell wall of Saccharomyces cerevisiae mnn9. J. Bacteriol. 177, 3104^3110. [20] Dubois, M., Gilles, K.A., Hamilton, J.K., Rebes, P.A. and Smith, F. (1956) Colorimetric method for determination of sugars and related substances. Anal. Chem. 28, 350^356.

FEMSLE 11150 8-9-03

167

[21] Spetch, C.A., Lui, Y., Robbins, P.W., Bulawa, C.E., Iartchouk, N., Winter, K.R., Riggle, P.J., Rhodes, J.C., Dodge, C.L., Culp, D.W. and Borgia, P.T. (1996) The chsD and chsE genes of Aspergillus nidulans and their roles in chitin synthesis. Fungal Genet. Biol. 2, 153^167. [22] Reissig, I.L., Strominger, J.L. and Leloir, L.F. (1955) A modi¢ed colorimetric method for estimation of N-acetylamino sugars. J. Biol. Chem. 217, 959^966. [23] Dijkgraaf, G.J., Brown, J.L. and Bussey, H. (1996) The KNH1 gene of Saccharomyces cerevisiae is a functional homolog of KRE9. Yeast 7, 683^692. [24] Maneu, V.E., Cervera, A.M., Martinez, J.P. and Gozalbo, D. (1996) Molecular cloning and characterization of a Candida albicans gene (EFB1) coding for elongation factor EF-1L. FEMS Microbiol. Lett. 145, 157^162. [25] Pan, T. and Coleman, J.E. (1990) Gal4 transcription factor is not a ‘zinc ¢nger’ but forms a Zn(II)2Cys6 binuclear cluster. Proc. Natl. Acad. Sci. USA 87, 2077^2081. [26] Tzagolo¡, A., Capitanio, N., Nobrega, M.P. and Gatti, D. (1990) Cytochrome oxidase assembly in yeast requires the product of COX11, a homolog of the P. denitri¢cans protein encoded by ORF3. EMBO J. 9, 2759^2764. [27] Hicks, G.R. and Raikhel, N.V. (1995) Protein import into the nucleus: an integrated view. Annu. Rev. Cell Dev. Biol. 11, 155^188. [28] Aro, N., Saloheimo, A., Ilmen, M. and Penttila«, M. (2001) ACEII, a novel transcriptional activator involved in regulation of cellulose and xylanase genes of Trichoderma reesei. J. Biol. Chem. 26, 24309^ 24314. [29] Taylor, B.L. and Zhulin, I.B. (1999) PAS domains: internal sensors of oxygen, redox potential and light. Microbiol. Mol. Biol. Rev. 63, 479^506. [30] Bates, P.A., Kelley, L.A., MacCallum, R.M. and Sternberg, M.J.E. (2001) Enhancement of protein modelling by human intervention in applying the automatic programs 3D-JIGSAW and 3D-PSSM. Protein Struct. Funct. Genet. Suppl. 5, 39^46. [31] Johnston, M. (1987) A model fungal gene regulatory mechanism: the GAL genes of Saccharomyces cerevisiae. Microbiol. Rev. 51, 458^476. [32] Zhulin, I.B., Taylor, B.L. and Dixon, R. (1997) PAS domain S-boxes in archaea, bacteria and sensors for oxygen and redox. Trends Biochem. Sci. 22, 331^333. [33] Ponting, C.P. and Aravind, L. (1997) PAS: a multifunctional domain family comes to light. Curr. Biol. 7, 674^677. [34] Valentin, E., Herrero, E., Rico, H., Miragall, F. and Sentandreu, R. (1987) Cell wall mannoproteins during the population growth phases in Saccharomyces cerevisiae. Arch. Microbiol. 148, 88^94. [35] Bernstein, H.J. (2000) Recent changes to RasMol, recombining the variants. Trends Biochem. Sci. 25, 453^455.

Cyaan Magenta Geel Zwart