Sq vol6

Saltman | Quarterly

Undergraduate Biological Research Journal UCSD Division of Biological Sciences

Volume 6 Nos. 1, 2 & 3 sq.ucsd.edu

Division of Biological Sciences University of California, San Diego Volume 6 / 2008–2009

Saltman | Quarterly

Letter from the Editors: This past year we have witnessed a wave of change and enthusiasm sweep across the biology community at UCSD, and it has affected Saltman Quarterly in ways that have left us excited for the future. It is difficult to speak of change in the context of biology without invoking Charles Darwin, a man who drew biology together into a single unified science, and forever changed our vision of life and the natural world. As we move forward in the twenty-first century, it is important to keep in mind the timeless principles discovered by Darwin, which are continually affirmed and deepened by the research of scientists today – particularly at UCSD. It was a great honor for SQ to celebrate Darwin’s 200th birthday this year, and to have had the privilege of sponsoring the division’s first Undergraduate Dean’s Symposium, “Why Darwin Matters.” The campus-wide excitement for this event and the creative contribution of undergraduates (which can be seen on the following page), show that biology at UCSD is more alive than ever. SQ is proud to be a part of this scientific community, and we anticipate a sustained interest for years to come.

This year we are pleased to publish SQ earlier than ever, as a result of the abundant volume of submissions we received. We are equally impressed with the level of excellence which is exhibited in the published manuscripts. In the Research Section, we begin by looking at tumors of the vestibular nerve, and then move to four studies focusing on different regions of the ocean, and the creatures inhabiting it. These studies focus first on the shallow sea, with sand dollars and pipefish, and then plunge deeper into the ocean with the secondary fluorescence maximum and the Oxygen Minimum Zone. It is fitting that our topics cluster around marine life, because the diversity and unique adaptations in this environment are a living record of the power of evolution.

In the Features section we take a foray into phage therapy, gene therapy, and lung cancer vaccines; three promising new approaches to combating infection and disease. We then enter the borderlands of science fiction with brain-computer interface technology, and wrap up with a discussion of alternative biofuel. We even have two Research Reviews which explore the regenerative power of neurons, both endogenously and via stem cell therapy, and the implications this has for neurodegenerative diseases and vision restoration.

In the final pages you will find abstracts of our biology student’s honors theses, and a salute to the man who inspired this journal, Dr. Paul Saltman. In his spirit we hope this journal provides you with an opportunity to express your love for science communication; and as fellow students, we encourage you to remember the grand tradition in which you are participating and the many giants who forged the way ahead of you. The science of life is truly inexhaustible, and there is no better place to experience it than here at UCSD. We eagerly anticipate future revolutions of “Darwinian” proportions in the years ahead, and have thus made it our mission to involve all biology majors in the exciting research of our time. At this unique place where discovery comes to life, we hope you enjoy Volume 6.

On the Cover: This photo of a Golden Orb Weaver was taken by Alice Ho in the countryside of southern Taiwan.

Alice is a freshman majoring in Bioengineering at Warren College.

Tyler Green and Christine Cho Editors-in-Chief

Supported By:

Editors-in-Chief: Tyler Green and Christine Cho Production: Chris Ha Research Design: Kathleen Yip Features: Brian (Seungleal) Paek Features Design: Caitlin Rodriguez Technical Editor: Esther Oh Webmaster: Anna Osvaldsson Publicity/Communications: Nancy Lin Review Board Managers: (Qing) Meng Zhang and Michael Wang Staff Writers: Christine Calabio, Leslie Corona, Matt Croskey, Leila Haghighat, Rachel Maher Staff Advisors: Gabriele Wienhausen, PhD Associate Dean for Education, Division of Biological Sciences Katie Frehafer Media Specialist, Division of Biological Sciences Karla Kaster Biology Student Affairs Advisor Faculty Advisors Molecular Biology: Eric Allen, PhD Cell and Developmental Biology: Robert Schmidt, PhD Neurobiology Lisa Boulanger, PhD Gert Cauwenberghs, PhD Andrew Chisholm, PhD Ecology, Behavior, and Evolution: Christopher Wills, PhD Therese Markow, PhD

contents Ta b l e

O f

FEAT U R E S

4 Phage Therapy: A Potent Alternative to Antibiotics in Combating Multi-Drug Resistance

Leila Haghighat 6 Lucanix: A Revolutionary Breakthrough in Lung Cancer Treatment

Christine Calabio 7 Sci-Fi Come Alive or Harnessing the Power of the Mind

Matt Croskey 9 The Slimiest Solution: Biofuels from Algae and Cyanobacteria

Rachel Maher 10 A New Hope

Leslie Corona

RESEARCH 12 Estrogen receptor and progesterone receptor expression in Vestibular Schwannoma

Ramina Amino, et al.

16 Distribution patterns of the western sand dollar (Dendraster excentricus) in a semi sheltered outer coast habitat off La Jolla, California

Angela Kemsley

19 Characterization of the secondary fluorescence peak in the eastern tropical North Pacific

Jameson Rogers, Jan Witting 24 California margin macrobenthos: the effects of oxygen and water depth on macrobenthic community structure

Sean Chou, Lisa Levin 30 Interspecific hybridization as a source of genetic variation in eastern Pacific

Syngnathus species

Eric Garcia, Stuart Sandin, Tony Wilson

REVIEW 35 Mechanisms and applications of adult neurogenesis

Ari Morcos

37 From Visual Prostheses to Stem Cells Muthu Annaamalai

40 Senior Honors Theses Abstracts 44 Dedication to Dr. Saltman 46 Staff & Acknowledgments

“Why Darwin Matters” contest entries, clockwise from top left: “Why Darwin Matters” Eran Agmon, Marshall College “Brilliant!”

Sarah Choi, Sixth College “Natural Selection” Kacie Paik, Muir College “Darwin Brings Us Together” Kim Cyprian, Marshall College

4

Phage Therapy: A Potent Alternative to Antibiotics in Combating Multi-Drug Resistance: Haghighat

Phage Therapy: A Potent Alternative to Antibiotics in Combating Multi-Drug Resistance Leila Haghighat1

Figure 1. Five mm plaques formed on an agar plate by lysogenic bacteriophage RingO; isolated by Leila Haghighat in the Pogliano lab.

T

he World Health Organization estimates that already one-third of the world’s 7 billion inhabitants are infected with Mycobacterium tuberculosis, the TB bacterium responsible for killing 2 million people yearly (1). The rise of HIV and multiple-drug resistant strains are exacerbating the spread of TB and making development of novel treatments to combat the disease increasingly imperative. Using bacteriophages (viruses that infect bacteria) as therapeutic agents to combat epidemics promises to be a potent alternative to drugs currently available (2). In particular, the recognition of immense morphological diversity among the 1031 bacteriophages in the biosphere has prompted renewed interest in experimentally affirming the efficacy of bacteriophages as pathogen repressors and substitutes for antibiotics (3, 4).

In the mid twentieth century, the preeminence of antibiotics relegated phage therapy to a practice honed exclusively in Stalin-era Eastern Europe and only a historical footnote in the West (3). However, staggering evidence that links bacterial resistance to using antibiotics has since renewed Western interest in phage therapeutics. Per the U.S. Food and Drug Administration, approximately 70 percent 1. UCSD, Revelle College, General Biology Major, English Minor, Class of 2012.

of infection-causing bacteria in hospitals express resistance to at least one common antibiotic (5).

Whereas antibiotics blindly attack bacteria, including beneficial ones, bacteriophages target specific bacterial species. Phage specificity, hence, minimizes dysbacteriosis, a microbial imbalance in patients, and consequently lessens the development of secondary infections. In addition, drugs lose their effectiveness as they are metabolized, while phages replicate inside their bacterial hosts and, upon lysis, infect new bacteria, thus growing exponentially and gaining strength in numbers over time. Harvesting phages also proves more time- and cost-effective than the pharmaceutical manufacturing of drugs.

Significant evidence in animal models corroborates the hypothetical advantages of phage therapy, specifically its capacity for overcoming infections.

As early as 1994, scientists at the University of Manchester indicated the medical potential for phages to ameliorate skin grafts in guinea pigs with burn wounds (4).

In similar experiments dealing with salmonellosis, meningitis, and septicaemia among other diseases, phages were inoculated intramuscularly or intracerebrally and, within 5 minutes of injection, infiltrated all tissues examined (muscle, blood, spleen, liver, and brain) and dramatically reduced bacterial

Saltman Quarterly, Vol. 6, Nos. 1, 2 & 3

FEATURES

5

Phage Therapy: A Potent Alternative to Antibiotics in Combating Multi-Drug Resistance: Haghighat

Figure 2. Electron micrograph of bacteriophage RingO.

concentration in infected organs.

More recent studies have attempted to uncover the precise mechanisms by which phages hamper bacterial growth. In a 2001 edition of Science, researchers at Texas A&M offered one such method. They described the discovery of a phage that synthesizes penicillinlike peptides, inhibiting bacterial cell-wall synthesis and triggering the bacterial cell to apoptose, or selfdestruct, when it attempts to divide (6).

In spite of the 80 to 90 percent success rate of phages in destroying pathogens of systemic diseases in animals, concerns have risen regarding the longterm efficacy of substituting phages for antibiotics (4). Host specificity mandates large banks of phages to treat all strains of a particular pathogen, and nonspecific, first line immune response threatens to eliminate invasive phages. Moreover, not all phages are lytic and capable of infecting large colonies of bacteria—lysogenic, or “temperate,” phages integrate their double-stranded DNA into that of the bacteria and, unless induced, do not lyse their host. Some phages also utilize specialized transduction to transfer genetic information between bacterial cells and can potentially transfer virulence to a previously benign bacterial species.

However, the benefits of phage therapy generally outweigh its detriments. Phage therapy, for example, is typically completed before specific immunity begins to develop, and a study by Merril et al. reports that point mutations in phage coat proteins allow for some mutant phages to thrive despite specific immunity.

This study effectively underscores the potential of genetic selection for isolating phages with favorable phenotypes (7).

At the University of California, San Diego, Drs. Kit and Joe Pogliano lead a team of students in genomics research to expand the database of sequenced mycobacteriophages by isolating them

from the local environment. Under this nationwide pilot project funded by the Joint Genome Institute (JGI) and Howard Hughes Medical Institute (HHMI), students experiment not with the Class 3 bacterium Mycobacterium tuberculosis but with its less pathogenic relative Mycobacterium smegmatis (8).

Although she doubts that they will eclipse antibiotics, Dr. Kit Pogliano nevertheless foresees the “application [of bacteriophages] in acute infections that are not well treated [with current antibiotics].” In particular, she recognizes their capacity for targeting bacteria-rich zones. She explains, “A lot of antibiotics have a hard time getting to structures like abcesses, where there’s a high concentration of cells in a small space, and those kinds of treatments are where phage therapy might really have some promise, because the phage can replicate well in those conditions.”

But beyond treating infections, bacteriophages serve as “vehicles for bacterial evolution.” Dr. Kit Pogliano affirms that “[bacteriophages] can infect and spread genes between many different kinds of bacteria,” and comparing their genomic compositions may reveal the mechanisms by which specific bacteriophages evolve over time through horizontal exchange of DNA (9).

Already, sequence annotation of the phage genomics class’s largest mycobacteriophage, dubbed E.T. and approximately 150 kilobases in length, has identified protein families related to those of the previously characterized mycobacteriophage Bxz1.

These similarities, in turn, reveal which fragments of the genome carry out E.T.’s array of specific functions, such as lysing bacterial hosts, packaging DNA into capsids, and directing morphogenesis.

Thus, against a setting where TB affects over 9 million people yearly and multi-drug resistant strains emerge with increasing frequency, bacteriophages lie at the forefront of the medical community’s search for alternate TB treatments (10). With the correlation between HIV infection and TB strengthening, these UFO-shaped demons may, in fact, prove life-saving, regardless of how pernicious they physically appear.

References 1. WHO | Tuberculosis (March 2007, World Health Organization, 2 March 2009;

www.who.int/mediacentre/factsheets/fs104/en/index.html).

2. B. R. Bloom, C. J. L. Murray, Science. 257, 105–1064 (1992).

3. Stone, Richard, Science. 298, 728–31 (2002).

4. D. H. Duckworth, P. A. Gulig, Biodrugs. 16, 57–62 (2002).

5. IEEE Spectrum: Computer-Designed Drugs Could Thwart Antibiotic-Resistant Bacteria (IEEE Spectrum Online: Technology, Engineering, and Science News, 2 March 2009; www.spectrum.ieee.org/feb09/7849).

6. T. G. Bernhardt, I. Wang, D. K. Struck, R. Young, Science. 292, 2326–29 (2001).

7. C. R. Merril, B. Biswas, R. Carlton, et al, Proc. Natl. Acad. Sci. USA. 93, 3188–92 (1996).

8. JGI - HHMI SEA Phage Program (DOE Joint Genome Institute, 2 March 2009; www.jgi.doe.gov/education/phages.html).

9. G. F. Hatfull, S. G. Cresawn, R. W. Hendrix, Research in Microbiology. 159, 332–339 (2008).

10. WHO Stresses TB-HIV Link - WSJ.com (Business News & Financial News The Wall Street Journal - WSJ.com, 25 March 2009; www.online.wsj.com/article/ SB123794193654332825.html).

Saltman Quarterly, Vol. 6, Nos. 1, 2 & 3

FEATURES

6

Lucanix: A Revolutionary Breakthrough in Lung Cancer Treatment: Calabio

Lucanix: A Revolutionary Breakthrough in Lung Cancer Treatment

Christine B. Calabio1

I

magine this. A woman anxiously waits in a doctor’s office, nervous about what’s to come. The doctor opens the door, walks in, and prepares to tell her the devastating news. As the woman leans closer to hear the verdict, the doctor looks her in the eye and says, “I’m sorry, but you have stage III lung cancer…” The terrible news makes everything after that a blur; dumbfounded, the woman sinks back into her chair, not knowing what to do next.

Many people, even those reading this article, have been or may know someone who has been affected by lung cancer. It is considered to be the deadliest form of cancer, killing about 430 people every day in the United States (1). It is a disease that causes rapid, uncontrolled cell growth in lung tissue.

Tumors form, eventually releasing malignant cells throughout the body. via metastasis Lung cancer has various known causes from smoking to hereditary dispositions, and is often difficult to repress. Some symptoms (depending on the stage) include chronic coughs, coughing up blood, seizures, and dizziness.

There are four stages of lung cancer. In stage I, the cancer is still in the lung. In stage II, the tumor is spread throughout the chest.

In stage III, the tumors grow larger. And in stage IV, the cancer is spread throughout the body.

Depending on its stage, the cancer may be treatable through scientific advancements such as chemotherapy and radiation therapy. However, these treatments are sometimes more hazardous than helpful to the body. While radiation and chemotherapy help repress cancer cells, they may also weaken the immune system and destroy healthy cells that strengthen the body (2).

In order to repress these cancer cells without destroying the immune system, a revolutionary breakthrough in cancer treatment has been introduced. It is called Lucanix. Lucanix is a highly advanced therapeutic lung cancer vaccine that is produced by the San Diego-based biopharmaceutical company NovaRx. It’s a vaccine that specifically treats stage III and IV non-small cell lung cancer (NSCLC) patients. Researchers from the company are still in the process of developing and experimenting with this vaccine. The idea behind Lucanix is that instead of pumping high-energy radiation into a patient’s body with potentially lethal effects, this therapeutic vaccine can help repress and kill deadly cancer cells while strengthening the immune system (2).

Pre-cancerous growths are believed to exist in everyone’s bodies (2). If a person’s immune system is healthy and functioning well, it is able to identify, locate, and attack these abnormal cells before they spread and become dangerous. However, immune

systems sometimes fail at this task, allowing large amounts of cells to form in mass growths called tumors. These tumors can either be benign, meaning that they can be removed by surgery, or malignant, meaning that the cancer cells have already spread to other areas of the body, making the ailment more difficult to repress (2).

The challenge of killing cancer cells without adversely damaging the body requires creating a therapeutic vaccine that specifically locates, attacks, and represses cancer cells before they spread. One of the difficult barriers that researchers had to overcome is that most tumor cells produce molecules that hide from the immune system through a process called immunosuppression (2). However, researchers from NovaRx have recently discovered a molecule called transforming growth factor-beta (TGF-beta) that is produced by the tumor cells.

Through this discovery, researchers have been able to modify the vaccine to block the effects of these harmful (TGF-beta) molecules. Lucanix consists of genetically altered lung cancer cells that when injected in the body, not only lesson the cancer’s ability to destroy the immune system, but also strengthen the immune system to fight off the cancer. Dr. Habib Fakhrai, president and co-founder of NovaRx explains, “The goal of Lucanix is to vaccinate a cancer patient with genetically altered tumor cells that will induce an immune response that destroys tumor cells throughout the body” (3).

Since 2006, Lucanix has undergone clinical trials and has been tested by hundreds of patients at 90 centers worldwide, ranging from the Marley Crowley Medical Research Center in Dallas, Texas, to the Klinicko-bolnicki centar Bezanijska kosa in Serbia. The main research center located at the Moores UCSD Cancer Center is conducted by Dr. Lyumidila Bahzenova, director of the UCSD Moores Cancer Unit, who explains, “the reason why UCSD gained public attention with Lucanix is that we were the first to test the vaccine on a patient; so, it’s great that this treatment is being tested all over the world. Although it’s too early to determine the effects of Lucanix in the Phase III trial, we hope that it will make a positive difference on our cancer patients” (4). Since July of 2008, the company has begun

1. UCSD, Thurgood Marshall College, Human Biology Major, Public Service Minor, Class of 2012.

Saltman Quarterly, Vol. 6, Nos. 1, 2 & 3

FEATURES

Sci-Fi Come Alive or Harnessing the Power of the Mind: Croskey

7

phase III of the clinical trial, testing the vaccine on 700 patients worldwide (2).

These treatments are specifically for stage III–IV non-small cell lung cancer patients ages 18–75 that have undergone 1–4 chemotherapy treatments. For NSCLC patients, stage III is when the cancer is still contained in the chest, and stage IV is when the cancer has spread throughout the body (5). Cancer victims usually experience unexpected massive weight loss, chest pains, sudden shortness of breath, bronchitis, consistent respiratory infections, chronic coughs, etc. In order to attack the cancer cells, patients must first undergo chemotherapy, and then receive Lucanix injections once a month for 18 months.

Afterward, patients receive two quarterly injections until the cancer cells are suppressed (1).

In Phase II of the clinical trial, over 60 percent of the patients who underwent chemotherapy followed by the Lucanix regiment lived for over two years, and about 44 percent lived for over 44 months. For those who are alive, 15 of them have lived for more than four years. Participants have experienced mild side effects such as redness and soreness at the injection site, as well as symptoms similar to those of a flu shot. Besides this, however, Lucanix has thus far achieved worldwide success. It prolongs the survival rate of patients

for up to two years, shrinks tumors, and represses cancer cells.

Since Lucanix has been FDA approved to test in international research centers, oncologists hope that Phase III of the clinical trial will be completed by 2011.

NovaRx is currently developing therapeutic vaccines that treat colon, breast, prostate, and melanoma cancers (2). With such positive feedback, Lucanix will hopefully be deemed the next scientific breakthrough in the fight against cancer. As Dr. Fakhrai states, “Our goal is to help patients fight cancer in the best possible means. I hope that phase III of the clinical trial will go just as well as phase II. I want my patients to have the best modern medicine available… if successful; I hope that in the future, Lucanix can help prolong the lives of cancer patients around the world” (3).

References 1. Novel Lung Cancer Vaccine Trial Launched at Moores UCSD Cancer Center

(UCSD Medical Center-Moores Cancer Center, 8 October 2008, UCSD Moores Cancer Center, 11 December 2008; www.cancer.ucsd.edu/AboutUs/News/ stories/Bazhenova_Vaccine.asp).

2. NovaRx: Cancer Stops Here (NovaRx, 5 January 2009; www.novarx.com/ technology.php).

3. H. Fakhrai M.D., Phone Interview, 24 February 2009.

4. L. Bazhenova M.D., Personal Interview, 26 February 2009.

5. Phase III Lucanix Vaccine Therapy on NSCLC Following Frontline Chemotherapy (STOP) (ClinicalTrials.gov, 2008, Clinical Trials, March 2009; www.clinicaltrial.gov/ ct2/show/NCT00676507?term+Lucanix&rank+1).

Sci-Fi Come Alive or Harnessing the Power of the Mind Matt Croskey1

S

cience fiction may not really be fiction. So much of what the human mind creates in science fiction seems farfetched and outrageous; but as time wears on, some of these ideas become realities.

Jules Verne depicted submarines and space flights in two of his books before either were feasible, and Mary Shelley’s Frankenstein may yet become a reality with genetic engineering. Outer Limits, a science fiction TV series, portrays scientists hooked up to patients to interface with their minds and cure their mental illnesses. With the development of brain-computer interface technology, or BCI, science is once again making a reality of the science fiction writer’s creative mind.

BCIs are devices that link the brain directly to a computer that can execute the brain’s commands. The primary focus of BCI research has been to develop systems that restore limb mobility in paralyzed subjects suffering from “locked-in syndrome,” but obstacles like creating a long-lasting implantable device, and slow processing speeds, are making this goal difficult to reach on a large scale (1, 2). Despite the current barriers, creative researchers like Jaime Pineda of the University of California, San Diego Cognitive Science 1. UCSD, Warren College, Physiology and Neuroscience Major, Law and Society Minor, Class of 2010.

Laboratory are discovering new applications of the BCI technology (3).

BCIs work by capturing the electrical activity of the brain. As electrical signals are passed between neurons in the brain, some electric current escapes to surrounding tissues. A BCI records and interprets the escaping current. It does so using one of two methods: invasive or non-invasive. As its name implies, the invasive method requires direct placement of electrodes into the brain. Ultimately, this technique gives a better reading of the escaping current since the skull does not interfere. The non-invasive method relies on a group of external electrodes that make up a device called an electroencephalograph (EEG). It detects the electrical activity of the brain from outside the skull much like a metal detector finds metal buried beneath the surface.

The electrical recordings reveal signal patterns that represent an individual’s intention to initiate a control.

This control can be a simple yes or no, or a movement of a prosthetic arm. BCIs use complex mathematical algorithms developed through extensive training with the individual to translate the signal patterns and execute the intended command. This is a simplistic overview of how a BCI works. Depending on the type of research, scientists will use different variations of this basic system to examine their particular areas of interest (4).

In his research, Pineda utilizes the non-invasive

Saltman Quarterly, Vol. 6, Nos. 1, 2 & 3

FEATURES

8

EEG in combination with a technique called neurofeedback. His primary goal is to help autistic individuals regain social cognition. He notes, “The main problem for even high-functioning autistics is social interaction. We’ve identified circuits in the brain that we think are important for social interactions which are dysfunctional in autistic individuals. We use neurofeedback to restore some normative function to the circuit by exercising it.”

Neurofeedback is a training technique that allows individuals to alter and control their brain activity through operant conditioning (5). It can be used not only to help treat autism, but also attention deficit disorders, hyperactivity disorders, and sleeping problems (6). It fights the cause rather than just the symptoms by training the user’s mind to bridge neural connections by increasing or decreasing usage of specific brain functions.

“Let’s say the person with a low amplitude of waves shows a low bar whereas a normal individual would have a high bar,” Pineda said while explaining how he uses the neurofeedback system. “Every time the low individual’s bar goes up a little bit, you give them feedback as a reward, like an applause tone.

The reward makes it so they keep increasing their bar, presumably to a normal level.” He has seen promising results in some patients’ ability to control brain rhythms with a series of training sessions using this technique (7).

It was only ten years ago that researchers first demonstrated that ensembles of cortical neurons could directly control a robotic manipulator (2).

Today, Pineda and others are having success in reducing the symptoms of several neurological and psychiatric disorders.

Additionally, Emotiv, a neurotechnology company that focuses primarily on the electronic gaming industry, and companies like it, are making BCI technology available on a more commercial scale.

Non-invasive BCIs are currently available for video

Sci-Fi Come Alive or Harnessing the Power of the Mind: Croskey

game players to control characters by thought alone.

However, advancements in limb replacement and mobility in paralyzed patients have not come as quickly. Pineda thinks that the largest problem facing any BCI is the computer’s inability to process the individual’s thoughts quickly, yet he is optimistic that this roadblock will be removed and clinical applications will become more viable.

“It will be a major breakthrough when we get to a point where it’s fast enough so that somebody can converse at normal speeds,” he said. “Changing detection and processing speeds will take doing all the right algorithms in real time. I tend to be very optimistic but I had hoped that we would be further ahead by now. Processing speed is a hard problem that may take another five to ten years to solve. When [BCIs] come to a point where they are easily available, easily accessible and they work at the speed that we want, people will pay attention.”

However, if BCIs do become easily accessible like Pineda suggests, new, more ethical questions may arise.

One dilemma Pineda foresees is whether or not disabled individuals using BCI-controlled devices will be socially accepted. And much like many performance enhancing drugs, BCIs have a wide range of questionable uses for healthy individuals. For example, athletes would be able to enhance their fine motor skills, students would be able to increase their ability to focus, surgeons would be able to perform thought-controlled surgeries, and the military would be able to train soldiers with heightened senses. All these are possibilities with commercial BCIs, but society will have to discern whether or not use by healthy individuals is tolerable, much like society has determined that non-medicinal use of steroids and other drugs is unacceptable.

The current triumphs for BCIs are encouraging, but the technology is still only in its primitive stage (3).

Improvements in processing speed and implantable devices need to be made before the technology will have a significant impact on the community at large.

When such improvements are made, the technology once sprawled across the pages of science fiction may become a reality.

References 1. U. Hoffman, J. M. Vesin, T. Ebrahimi, Recent Advances in Brain-Computer Interfaces (Multimedia Signalling Processing Group, Signal Processing Institute, 6 January 2009; www.bci.epfl.ch/publications/hoffmann_recent. pdf).

2. M. Lebedev, M. Nicolelis, TRENDS in Neurosciences, 29, 536–46 (2006).

3. J. Pineda Ph.D., Personal interview, 14 January 2009.

4. A. Bashashati, M. Fatourechi, R. K. Ward, G. E. Birch, J. Neural. Eng. 4, R32-R57 (2007).

5. E. Angelakis, et al, The Clinical Neuropsychologist. 21.1, 110–29 (2007).

6. J. Van Aart, E. Klaver, C. Bartneck, L. Feijs, P. Peters, Neurofeedback Gaming for Wellbeing (BrainPlay ‘07: Playing with Your Brain, Proc. of Advances in Computer Entertainment Technology) 7. J. Pineda, D. S. Silverman, A. Vankov, J. Hestenes, IEEE Trans Neural Syst Rehabil Eng. 11(2), 181–184 (2003).

Saltman Quarterly, Vol. 6, Nos. 1, 2 & 3

FEATURES

9

The Slimiest Solution: Biofuels from Algae and Cyanobacteria: Maher

The Slimiest Solution:

Biofuels from Algae and Cyanobacteria Rachel Maher1

I

n a world where our non-renewable resources are rapidly dwindling, causing irreversible damage to the planet and driving our prices for basic necessities higher and higher, it is time to switch our consumption towards more sustainable resources. This is why many scientists are now turning to green photosynthetic organisms such as cyanobacteria and algae­—slimy and underappreciated substances that not only act as the world’s greatest carbon sink, but can also be used in the production of biofuels and synthetic chemicals. But in order for algae and cyanobacteria to be economically viable options, we must first learn how to grow them and how to make them yield the most energy. Scientists at the University of California, San Diego, and the Scripps Institution of Oceanography are doing just that, researching the genetic structure of these organisms along with molecular and agricultural techniques to be used in the “domestication” of algae and cyanobacteria.

Photosynthetic organisms include plants, protists (such as algae), and cyanobacteria. These organisms use light energy from the sun to take the carbon from carbon dioxide in the 1. UCSD, Revelle College, General Biology and International Studies majors, Class of 2012.

atmosphere and use it to make organic compounds (such as sugars and fats). The energy from the sun is stored in the bonds of these organic compounds and is used to fuel the organism’s life processes. By eating plants, humans can gain the energy that the plants have captured through photosynthesis.

Now with the help of modern science, humans can also use the products of photosynthesis for fuel. Sugars can be made into ethanol, or sugar alcohol, and burned as biofuel (fuel that is derived from a living organism, such as a plant). The lipids can be used to create biodiesel, which is fuel made by processing vegetable oils or other fats.

Algae and cyanobacteria, in comparison to other fuel sources, have numerous advantages for use as a biofuel.

These include rapid growth, efficient energy production, and the fact that their use would not compete with other markets.

Unlike corn or soy, whose sugars can also be used to create ethanol, algae is not a primary food source, so using it as a fuel source does not affect the global food supply and food-related economy. Furthermore, algae can be grown and harvested on underutilized land, such as a desert, and can be grown in reclaimed water. Thus, algae-based biofuel production would neither interfere with agriculture or industry, nor diminish our clean water supply.

In a related environmental concern, growing more corn for fuel would require increased fertilizer use, which would

Saltman Quarterly, Vol. 6, Nos. 1, 2 & 3

FEATURES

10

A New Hope: Corona

release nitrous oxide into the atmosphere. In contrast, algae and cyanobacteria are a great carbon sink, so the amount of CO2 released into the atmosphere during the burning of biofuels would be counterbalanced by the amount of CO2 taken in by the organisms grown for the biofuels during photosynthesis. Therefore, creating and using biofuels from algae and cyanobacteria can be considered a carbon neutral process. Not only do they absorb a large quantity of CO2, but they also produce oxygen in abundance, cyanobacteria being responsible for approximately 40% of the earth’s supply of oxygen.

Algae and cyanobacteria are also much more efficient sources of fuel, meaning that they produce more fuel relative to their mass. For example, the yield of biodiesel per acre for algae is over 60 times greater than that of soy.

As Dr. Susan Golden, a professor of biology at UCSD said, “Cyanobacteria are like little plants without all the nonsense” (1). These microscopic organisms also grow at an incredibly rapid rate. “Every day you could take 90% of the population and the remaining 10% would give rise to a full population and you can harvest more,” said Golden (1).

Just as domestication of dogs and cats means that humans have a fundamental understanding of those animals and an ability to care for them, domestication of algae and cyanobacteria requires scientists to have a greater knowledge of their genetic structures and their ideal growth conditions. Researchers need to experiment to find the perfect combination of a large number of variable conditions, such as growth medium, sunlight, and available nutrients that will make the organisms most productive.

There is also the important task of observing different species in order to select the ones with the most desirable traits. From these select species, scientists must determine complete gene sequences, information on gene structure, regulatory elements, maps of metabolic pathways, and targets for transformation (assimilation of external DNA by the cell). Thus far, the complete gene sequences are known

for eleven microalgal strains and over twenty cyanobacterial strains.

From the gathered genetic information, scientists can then modify certain species to produce a greater yield. For example, algae tend to store the energy from photosynthesis as fat, which can be made into biodiesel, and cyanobacteria tend to store their products as sugar, which can be made into ethanol. However, according to Golden, ethanol is highly corrosive, so it can only be used as an additive to gasoline by a maximum of 10%. Fats, on the other hand, can be made into a substance like petroleum, which is a very dense and high energy fuel. Thus, if cyanobacteria could be engineered to store energy as fats, they would be much more useful as a fuel source. Another exciting possibility is the modification of certain species of algae to directly produce a substance like petroleum.

The task of making commercially marketable biofuel from photosynthetic organisms is monumental in that it requires collaboration from many different fields. Much more research needs to be done, and it needs to be done on an accelerated time frame. Thankfully, according to Golden, “there is a real growing strength of algal biofuel research here at the University of California, San Diego” (1). Indeed, UCSD, Scripps Institution of Oceanography, and the Scripps Research Institute are forming a consortium known as the San Diego Center for Algal Biotechnology.

Right now, it is important for everyone to keep asking questions, for researchers to solve some of their greatest problems, and for everyone to understand the significance of this idea. So the next time you go to the beach and see some slimy green stuff on a rock, appreciate the fact that it may very well be fueling your car someday.

A New Hope

is your personal genome, composed of billions of base pairs of DNA that organize themselves into 23 pairs of chromosomes that determine everything which makes you who you are. From the color of your hair to approximately what age you will lose that hair, it is all determined by the code your parents gave you. Discoveries in genetics are always very exciting because they have the potential to completely revolutionize how we treat certain medical problems.

One of the most exciting medical advances of recent years has been the development of gene therapy. This type of treatment involves the insertion of functional genes into the cells and tissues of a patient who is suffering from the presence of mutant alleles in his or her genome. Typically, this is accomplished by manually inserting a normal, functioning gene into a spot in the genome to replace the nonfunctional or mutated gene. To carry this out, one of many vectors is used to carry the gene, the most common being viral

Leslie Corona1

C

onsider for a moment, your hand; all the little wrinkles in the skin around your knuckles, your fingernails, and even your unique fingerprints. Now consider what your hand is composed of: skin, muscle, bone, and connective tissue, among other things. Something that you use every day for both the mundane and familiar is actually a pretty complex piece of work. Yet, all this complicated physiology developed according to one long and intricate code, so tiny that it fits into every cell in your body. This, of course, 1. UCSD, Muir College, Physiology and Neuroscience Major, Class of 2011.

References 1. S. S. Golden, Distinguished Professor Section of Molecular Biology, UCSD, Interview, 13 February 2009.

2. S. Mayfield, Lecture, January 2009.

3. S. Mayfield, G. Mitchell, P. Roessler, Lectures, 2008 (www.spg.ucsd.edu/algae/seminars. html).

Saltman Quarterly, Vol. 6, Nos. 1, 2 & 3

FEATURES

11

A New Hope: Corona

vectors. This technique involves doctors adjusting the very simple genome of the virus and inserting the gene needed for the therapy into the actual viral genome. Subsequently, when the viruses are injected into the patient, instead of making them sick with their original viral DNA, they inject the “good” DNA into the somatic cell’s genome. When that cell reaches its time to divide, the treated genome spreads throughout the patient (2).

When the gene is placed into the genome of a somatic, or body cell, the adjustments to the genome cannot be passed on to the next generation, unlike a similar treatment known as germ line therapy. This process is almost exactly the same, except that the modifications are done in the germ, or reproductive cells, making it possible for the offspring of the patient to inherit the adjusted gene. While theoretically very effective in eradicating genetic disorders, this type of treatment is not practiced on humans due to ethical and technical reasons (2).

In general, the field of gene therapy is very new, but has an extremely promising future. It has already been used to treat a hereditary disease called Leber’s congenital amaurosis, which causes blindness, and to help with the swelling and pain of rheumatoid arthritis (3). Since DNA controls everything the human body does, or ever will do, the possibilities are next to limitless as to what this general field can contribute to medicine.

At the forefront of this field is UCSD’s Dr. Jim Kadonaga and his colleague Timur Yuzufzai. In October of 2008, they discovered a protein in human somatic cells that rewinds DNA that has been unraveled during transcription, and that fixes the bubbles that sometimes form and prevent DNA from being transcribed. They decided to call this new “annealing” helicase “HARP,” short for HepA-related protein. Up until this discovery, all other similar proteins documented have been ordinary helicases—proteins that exist to unwind DNA for transcription (4).

The discovery of HARP is special because this protein might hold the key to developing new types of gene therapy for sufferers of Schimke immuno-osseous dysplasia (SIOD), a debilitating genetic disorder that can cause strokes, congestive heart failure, kidney failure, and

sometimes death in small children. Before this discovery, the cause of SIOD was not yet known (4).

“The whole thing happened very unexpectedly,” says Dr. Kadonaga. “We were studying the proteins that cause SIOD when we found this protein that didn’t seem to alter the chromatin at all.”

Sufferers of SIOD must inherit two mutated genes, one from their mother and one from their father, that both carry the code for mutated HARPs. As a result of this, when bubbles arise in DNA after transcription, the mutated HARP cannot do its job and leaves the DNA impossible to read. These bubbles can form in specific genes for kidney function or heart function, resulting in the devastating symptoms described earlier. The severity of SIOD is directly proportional to how badly one’s HARP genes are mutated.

Unlike the other members of its protein family, HARP binds itself to DNA at the fork that forms when it is being prepared for the transcription process. When DNA at the fork stage was mixed with HARP and ATP in a test tube, the activity within the test tube went up. This boost in measurable activity proves that this protein is meant for binding to DNA at the fork (3).

Now that the cause of SIOD has been discovered, a new hope for a better therapy, or maybe even a cure, has been revived. Perhaps with a little adjustment to the genome of patients, this crippling disease can go the way of the polio virus. After a few more years of study, the possibility of harnessing the annealing capability of these proteins for use in gene therapy for other debilitating diseases such as Huntington’s disease and cystic fibrosis may be possible.

“If you’re lucky, science is an adventure,” says Dr. Kadonaga. “Sometimes it’s more than just a puzzle and more like a venture into the unknown.”

References 1. T. Yusufzai, J. T. Kadonaga, Science. 322, 748–750 (2008).

2. Gene Therapy (Human Genome Program, 9 February 2009; www.ornl.gov/sci/ techresources/Human_Genome/medicine/genetherapy.shtml).

3. Gene Therapy Gets Closer to a ‘Cure’ (NY Times Co., 2009; www.boston.com/news/ local/massachusetts/articles/2009/02/28/gene_therapy_gets_closer_to_a_cure/).

4. K. McDonald, UC San Diego Biologists Discover a Motor Protein that Rewinds DNA (Regents of the University of California, 30 October 2009; www.ucsdnews.ucsd.edu/ newsrel/science/10-08MotorProtein.asp).

Saltman Quarterly, Vol. 6, Nos. 1, 2 & 3

FEATURES

12

Estrogen receptor and progesterone receptor expression in Vestibular Schwannoma: Amino, et al.

Estrogen receptor and progesterone receptor expression in Vestibular Schwannoma Ramina Amino,1* Andrew K. Patel,2 Thomas H. Alexander,2 Ali Andalibi,2 Allen F. Ryan,3,4 Joni K. Doherty2 Vestibular Schwannomas (VS) are benign tumors that develop on the vestibular division of the eighth cranial nerve in the internal auditory canal. This tumor represents 8–10% of all intracranial tumors (1) and is diagnosed in generally one to eight per 100,000 people annually (1). It develops at a slow rate, but it can grow quite large, leading to brainstem compression, hydrocephalus, and hearing loss (2, 3). This tumor anecdotally tends to grow during pregnancy (4, 5). Surgery and radiation carry significant risks and morbidity, and therefore, development of a pharmacological treatment for the tumor is necessary. Regulation of Schwann cell growth is dependent upon heterodimers of the epidermal growth factor receptor (EGFR) family (ErbB1, ErbB2/HER2, and ErbB3/HER3), neuregulin, and possibly upon estrogen (ER) and progesterone (PR) receptor crosstalk (6-9). To further characterize growth factor and ErbB expression, regulation, and signaling, real time PCR was used to quantify estrogen and progesterone receptor expression in the Vestibular Schwannoma tumor. We hypothesize that ErbB and ER and/or PR crosstalk contribute to Vestibular Schwannoma progression, and, if correct, we anticipate that VS will demonstrate increased estrogen and progesterone receptor expression. The goal of the present research is to investigate routes to inhibit VS proliferation, by assessing the blockage of EGFR and ER receptors.

Introduction

Overview of the Vestibular Nerve The eighth cranial nerve, also known as the vestibular nerve, attaches to the semicircular canals of the inner ear.

From here it projects to the medulla and pons, located adjacent to the fourth ventricle in the brainstem. This nerve carries positional information concerning body orientation and head movement. The bundled fibers which make up the vestibular nerve arise from neurons of Scarpa’s ganglion.

The semicircular canals are important for sensing head rotation, which is measured by the motion of endolymphatic fluid that flows through the canals upon angular acceleration of the head. This motion is sensed by the cupula, a gelatinous structure located above the hair cells in the semicircular canal. When the cupula is distorted due to head movement, it bends the hair cells, which in turn sends a signal to the vestibular nerve of

which they are attached. Information is then carried through the vestibular nerve to the vestibular nucleus in the brainstem. From there, information is transferred to the appropriate regions of the cerebral cortex.

The Vestibular Schwannoma The Vestibular Schwannoma (VS; also called acoustic

1. UCSD, Revelle College, Physiology and Neuroscience Major, Class of 2010.

2. Department of Surgery, Division of Otolaryngology, Head and Neck Surgery, University of California, San Diego School of Medicine and Veterans’ Affairs Medical Center, La Jolla, CA, U.S.A. 3. House Ear Institute, Los Angeles, CA, U.S.A. 4. National Cancer Institute, Washington, D.C., U.S.A. *To whom correspondence should be addressed. E-mail: raminaamino@gmail.com.

Figure 1: Anatomy of the Vestibular Nerve

Saltman Quarterly, Vol. 6, Nos. 1, 2 & 3

RESEARCH

Estrogen receptor and progesterone receptor expression in Vestibular Schwannoma: Amino, et al.

13

As stated above, the inherited disorder NF2-related VS is characterized by the development of VS on both vestibular nerves. Of the one in 40,000 live births reported annually in the US to have NF2-related VS, 50% arise from a de novo (new) mutation (11). Early symptoms of NF2-related VS include hearing loss as early as the teenage years, tinnitus (ringing in the ear), imbalance, headaches, facial pain, numbness, or weakness (14). The mean age of symptom presentation is 20. The NF2related VS grow at a faster rate than sporadic VS, and are often large when first diagnosed.

The removal of NF2-related VS tumors also carries Figure 2A. Sporadic VS Figure 2B. NF2-related VS great risks due to their large size. Such risks include deafness, ataxia (lack of muscle coordination), hearing neuroma) is a benign tumor of the vestibular nerve. This loss, and a high risk of facial nerve injury for tumors benign tumor can lead to hearing loss, dizziness, and greater than three centimeters. Additional risks include facial weakness (2). VS occur from an overproliferation brainstem compression, hydrocephalus (for tumors four of Schwann cells, which normally play a supportive role centimeters or larger), and swallowing and breathing in myelinating neurons and increasing signal conduction difficulties due to intracranial lesions associated with VS speed. This overproliferation is commonly found near removal. Additionally, tumor burden alone can lead to Scarpa’s ganglion where Schwann cell density is greatest. cranial neuropathy (13).

The tumor comes in two forms, the first being the sporadic Vestibular Schwannoma. This unilateral schwannoma, Examination of Schwann Cells which is confined to one side of the head, is caused by an In a normal Schwann cell, the Neurofibromatosis overproliferation of Schwann cells (due to a mutation of Type II (NF2) gene encodes a tumor suppressor named the NF2 gene, located at chromosome 22q12) (Fig. 2A). merlin (15, 16). Loss of merlin function leads to the The second form is Neurofibromatosis Type II (NF2- development of both sporadic and NF2-related VS (17, related VS), an autosomal dominant disorder resulting 18). Recent studies indicate that merlin associates with from a germline mutation of the NF2 gene. This causes the human epidermal growth factor receptor (EGFR) the loss of heterozygosity, and the subsequent loss of family members, ErbB1 and ErbB2, at the cytoplasmic expression of the gene product merlin, a putative-tumor cell membrane interface in a contact-dependent fashion suppressor (both Vestibular Schwannomas result in (19). Cultured rat Schwann cell studies suggest that merlin abnormal merlin expression). The hallmark of NF2- mediates contact inhibition of growth and proliferation related VS is a bilateral VS (Fig. 2B). by down-regulating cell surface expression of the ErbB2 VS account for eight to ten percent of all intracranial receptor (19–22). This means that under normal merlin tumors (1). One in 100,000 patients in the U.S. develops function, Schwann cells have carefully controlled growth sporadic VS annually, and one in 40,000 live births in the boundaries, which are uncontrolled under abnormal U.S. is diagnosed with NF2-related VS annually (1, 11). merlin function.

The tumors grow between the cerebellum and pons (the In a normal Schwann cell, the ErbB2 pathway is shown cerebellopontine angle) causing pressure and damage to in Fig. 3. In subconfluent cells (those in the growth neighboring nerves (2). promoting mode; Fig. 3A), merlin is phosphorylated by Two methods used to treat VS are radiosurgery and focal adhesion kinase (FAK), and is recurited by paxillin microsurgery. Radiosurgery combines the principles to the cell membrane (19, 22–25). Phosphorylation of of 3-D target localization, using multiple cross-fired merlin renders it inactive, allowing neuregulin (NRG) beams from a high-energy radiation source to irradiate stimulation of growth, proliferation, and survival via an abnormal lesion within a patient’s body (12). The ErbB1/ErbB2 and ErbB2/ErbB3 heterodimer-induced objective of this technique is the ablation or destruction intracellular signaling, and the ERK1/2 and PI3K/Akt of the targeted area, without damaging the normal tissue outside the defined target area. Microsurgery is surgery pathways (6, 25–30). In the confluent cells (those in the performed under magnification.The risks associated with growth inhibitory mode; Fig. 3B), merlin translocates the two techniques of VS treatment include complete to the cytoplasm and associates with the ErbB1/ErbB2 loss of hearing and vestibular function, facial nerve palsy, heterodimer. This allows merlin to inhibit growth cerebrospinal fluid leak, meningitis, persistent headaches, promoting signaling from a ligand that binds to the brainstem edema or infarction, intracranial hemorrhage, heterodimer receptors and activates the ERK1/2 and Akt hydrocephalus, seizures, other cranial neuropathies, pathways (31–33). When transfected into transformed cells merlin restores contact inhibition of growth (21, pneumocephalus, cerebellar ataxia, or death (13).

24). When the Schwann cells are in close proximity, the Saltman Quarterly, Vol. 6, Nos. 1, 2 & 3

RESEARCH

14

Estrogen receptor and progesterone receptor expression in Vestibular Schwannoma: Amino, et al.

extracellular matrix (ECM) proteins interact with beta 1-integrin at the cell surface, inducing dephosphorylation of merlin and thereby inhibiting growth. This is the tumor suppressor function of merlin (22, 34). In its activated form, dephosphorylated merlin induces internalization of ErbB complexes, thereby eliminating growth factor signaling and resulting in growth arrest (31, 32).

However, Schwann cells with mutated or absent merlin have the ERK1/2 and PI3K/Akt pathways function as if merlin is phosphorylated (inactive), regardless of whether it is in the confluent or subconfluent mode. This occurs because a mutated or absent merlin fails to maintain its function of translocating to the cell surface, associating with EGF receptors, and thus suppressing growth.

Figure 3B. Confluent Cells Consequently, cells with mutated or absent merlin remain Figure 3A. Subconfluent Cells in the growth-promoting mode (9, 25). role in the progression of Vestibular Schwannoma.

Roles of Receptors in Schwann Cells Messenger RNA (mRNA) was isolated from Vestibular Specific receptor proteins appear to mediate hormone Schwannoma tissue and control nerve tissue. The control sensitivity for some tumors (12). Indeed, there seems tissue came from the greater auricular nerve (GAN) to be an existing relationship between the amount of tissue, because it is a sensory nerve like the vestibular receptor molecules and the behavior of tumor formation nerve (VN), but contains “normal� Schwann cells (nonand proliferation. Steroid sexual hormones seem to be tumor-forming cells). associated with the development of some tumors of the qRT-PCR involves the reliable detection and central nervous system, according to epidemiological data measurement of complementary DNA (cDNA) (35). generated during each cycle of the polymerase chain Overexpression of receptors results in an increased reaction (PCR) process, which is directly proportionate sensitivity to ligand binding, or constant receptor to the amount of starting template cDNA prior to the activation (36). Moreover, overexpression can enhance amplification process. Using this technique the relative processes responsible for tumor growth and progression, expression level of a gene of interest can be quantified. including promotion of proliferation, angiogenesis, qRT-PCR was utilized to screen Vestibular Schwannoma invasion and metastasis, and inhibition of apoptosis (36). cells derived from Vestibular Schwannomas removed at surgery, and from GAN Schwann cells obtained Objective from a tumor bank as a control. mRNA was extracted The objective of the present study was to identify and converted to the more stable cDNA using an whether estrogen receptor (ER) and progesterone mRNA isolation kit (Invitrogen; Carlsbad, CA). cDNA receptor (PR) play a role in the progression of Vestibular was amplified by qRT-PCR using primers and probes Schwannomas (VS) via the interrogation of ER and PR designed specifically for the detection of ER gene and mRNA expression levels. ER and PR expression levels PR gene expression. A human cyclophillin primer were analyzed in tumor samples and correlated to clinical and probe mixture was used as an internal control for parameters including age, NF2-related VS status, and amplification. tumor size. If ER and PR expression is elevated in the VS, then it can be expected that crosstalk among ErbB Results receptors and ER and PR might occur. Crosstalk, (the A total of 12 of 23 (52%) sporadic VS samples phenomenon whereby one receptor type influences signal upregulate ER, and 16 of 23 (69.6%) sporadic VS samples transduction activity in another pathway), would indicate upregulate PR. A total of 4 of 16 (25%) NF2-related VS that ER and PR can increase the level of ErbB signaling, upregulated ER and 5 of 16 (31.3%) upregulated PR. Most and/or ER/PR-induced transcriptional activation of NF2-related VS did not upregulate ER or PR expression proliferation signals. levels in a statistically significant manner (Fig. 4). The variability in ER mRNA expression was not statistically Methods significant in sporadic VS versus NF2-related VS (not Over an eight week period, 39 human tumor samples shown). Sporadic VS upregulate ER mRNA above 10of sporadic VS (n=23) and NF2- related VS (n=16) were fold, and upregulate levels of PR mRNA over 100-fold. analyzed using quantitative real-time reverse transcription To explore the clinical relevance of ER and PR PCR (qRT-PCR). It was tested whether or not estrogen expression, mRNA expression levels were correlated with receptors (ER) and progesterone receptors (PR) play a clinical parameters, including patient age at presentation, Saltman Quarterly, Vol. 6, Nos. 1, 2 & 3

RESEARCH

Estrogen receptor and progesterone receptor expression in Vestibular Schwannoma: Amino, et al.

15

Progesterone Receptor Modulator (SPRMS), a new class of PR ligands (which exhibit both progesterone agonistic and antagonistic activities in vivo) could potentially be used to treat sporadic VS.

References

Figure 4. ER and PR mRNA median fold-induction in NF2-related and sporadic VS. Median expression was calculated due to a high degree of variability in the expression levels. NF2-related VS are shown in light blue and sporadic VS in red. Values are normalized to background control nerves (GAN).

tumor size, and NF2-related VS status. The average age at presentation for NF2-related tumors was 24.5 years of age, and the mean patient age in sporadic VS was 51.6 years of age. The male to female ratio in NF2-related VS was 1:0.875, and the male to female ratio in sporadic VS was 1:2. The average NF2-related VS tumor size was 2.21cm, which was similar to the average sporadic VS average tumor size of 2.17cm. Using logistic regression with all the variables (age, gender, tumor size, ER, PR), the only clinical parameter that was significantly associated with NF2-related VS was younger age (p < 0.0148).

Conclusion

The goal of the present study was to determine whether ER or PR plays a role in the proliferation of Schwann cells due to estrogenic or progesterogenic stimulation.

According to our results, the upregulation of ER and PR in sporadic VS indicates that ER and PR may be potential therapeutic targets in sporadic VS. The downregulation of PR mRNA was specific to NF2-related VS. The distinction between NF2-related and sporadic VS indicate possible differences in mechanisms of tumor growth.

The different clinical characteristics of VS tumor growth, such as the faster growth rate and more invasive character of NF2-related VS, may be explained by the molecular differences between sporadic and NF2-related VS (37). VS is not the only tumor that demonstrates overexpression of ER and PR. Several other human tumors also have an overexpression of ER and PR (38). Furthermore, ER and PR are effective therapeutic targets in some human cancers (38-39).

ER and PR each behave as transcriptional regulators. ER activation occurs through ligand binding or phosphorylation.

Several lines of evidence illustrate that the enhancement of the growth factor receptor signaling by ER does not require a ligand binding (24, 26, 40). Our results indicate that using therapeutic agents such as Tamoxifen, an orally active selective estrogen receptor modulator, and Selective

1. M. Tos, J. Thomsen, J. Laryngol. Otol. 98, 685–92 (1984).

2. A. Masuda, L. M. Fisher, M. L. Oppenheimer, Z. Iqbal, W. H. Slattery, Otol. Neurotol. 25, 150–4 (2004).

3. H. A. Ramsey, W. M. Luxford, J. Laryngol. Otol. 107, 295–7 (1993).

4. L. Beni-Adani, S. Pomeranz, I. Flores, Y. Shoshan, Y. Ginosar et al, Acta.

Obstet. Gynecol. Scand. 80, 179–184 (2001).

5. G. Magliulo, R. Ronzoni, R. Petti, D. Marcotullio, M. Marini, Eur. Arch.

Otorhinolaryngol. 252(2), 123–4 (1995).

6. Z. Dong, A. Brennan, N. Liu, et al, Neuron. 15, 585–96 (1995).

7. R. Kachhara, C. G. Chandrika Devi, S. Nair, R. N. Bhattacharya, V. V. Radhakrishnan, Acta. Neurochir. 143, 587–91 (2001).

8. V. Kasantikul, M. G. Netsky, M. E. Glasscock III, J. W. Hays, J. Neurosurg. 52, 28–35 (1980).

9. L. Sherman, J. P. Sleeman, R. F. Hennigan, et al, Oncogene. 18, 6692–9 (1999).

10. http://jacketmagazine.com/20/px/ear-1.jpg 11. D. M. Parry, R. Eldridge, M. I. Kaiser-Kupfer, et al, Am. J. Med. Genet.

52, 450–61 (1994).

12. http://www.cksociety.org/PatientInfo/radiosurgery_stereotactic_technology_ comparisons.asp 13. J. W. House, R. A. Friedman, “Tranlabyrinthine Approach” in Otologic Surgery, D. E. Brackman, C. Shelton, M. A. Arriaga, Eds. (WB Saun ders Company, Philadelphia, PA, ed. 2, 2001), pp. 510, 534–6.

14. R. T. Miyamoto, K. L. Roos, R. L. Campbell, “Treatment of bilateral acoustic neuromas” in Otologic Surgery, D. E. Brackman, C. Shelton, M. A. Arriaga, Eds. (W. B. Saunders Company, Philadelphia, PA, ed. 2, (2001), p. 592.

15. G. A. Roulea, P. Merel, M. Lutchman, et al, Nature. 363, 515–21 (1993).

16. W. Wertelecki, G. A. Rouleau, D. W. Superneau, et al, N. Eng. J. Med. 319, 278–83 (1988).

17. K. M. Schulze, C. O. Hanemann, H. W. Muller, et al, Hum. Molec.

Genet. 11, 69–76 (2002).

18. E. C. Twist, M. H. Ruttledge, M. Rousseau, et al, Hum. Molec. Genet.

3, 147–51 (1994).

19. C. Fernandez-Valle, Y. Tang, J. Richard, et al, Nat. Genet. 31, 354–62 (2002).

20. D. Lallemand, M. Curto, I. Saotome, et al, Genes Dev. 17(9), 1090– 1100 (2003).

21. H. Morrison, L. S. Sherman, J. Legg, et al, Genes Dev. 15, 968–80

(2001).

22. A. R. Taylor, S. E. Geden, C. Fernandez-Valle, Glia. 41, 94–104 (2003).

23. N. G. Azios, F. Jhabvala-Romero, M. C. Denton, et al, Oncogene. 20, 5199–5209 (2001).

24. L. S. Shamieh, A. J. Evans, M. C. Denton, G. M. Clinton, FEBS. Lett.

568(1-3), 163–6 (2003).

25. E. I. Surace, C. A. Haipek, D. H. Gutmann, Oncogene. 23(2), 580–7 (2004).

26. M. R. Hansen, F. H. Linthicum Jr., Otol. Neurotol. 25, 155–9 (2004).

27. M. R. Hansen, P. C. Roehm, P. Chatterjee, S.H. Green, Glia. 53, 593– 600 (2006).

28. M. C. Harrisingh, E. Perez-Nadales, D. Parkinson, et al, Embo. J. 23, 3061–71 (2004).

29. N. E. Hynes, D. F. Stern, Biochem. Biophys. Acta. 1198, 165–84 (1994).

30. P. Maurel, J. L. Salzer, J. Neurosci. 20(12), 4635–45 (2000).

31. Y. Hirokawa, A. Tikoo, J. Huynh, et al, Cancer J. 10(1), 20–6 (2004).

32. Q. A. Justman, G. M. Clinton, J. Biol. Chem. 227(23), 20618–24 (2002).

33. J. Y. Lim, H. Kim, Y. H. Kim, et al, Biochem. Biophys. Res. Commun.

302(2), 238–45 (2003).

34. M. A. Adelsman, J. B. McCarthy, Y. Shimizu, Mol. Bio. Cell. 10, 2861– 78 (1999).

35. J. M. De Campos Gutiérrez, F. Ramos Duce, P. A. Gómez Lopez, M. E. Kusak Lambea, J. R. Boixadós Servat, Rev. Esp. Oncol. 31(2), 289– 97 (1984).

36. O. Hamid, Journal of the American Pharmacists Association. 44(1), 52–58 (2004).

37. M. M. Abaza, E. Makariou, M. Armstrong, A. Lalwani, Laryngoscope.

106, 694–8 (1996).

38. J. Vaquero, M. L. Marcos, R. Martinez, G. Bravo, Surg. Neurol. 19(1), 11–3 (1983).

39. K. S. Lee, T. Nagashima, K. G. Cho, T. J. Mampalam, L. H. Pitts, T. Hoshino, Surg. Neurol. 32(6), 427–33 (1989).

40. A. K. Patel, T. H. Alexander, A. Andalibi, A. F. Ryan, J. K. Doherty, Laryngoscope. 118(8), 1458–63 (2008).

Submitted for publication 29 October 2008

Saltman Quarterly, Vol. 6, Nos. 1, 2 & 3

RESEARCH

16

Distribution patterns of the western sand dollar in a semi-sheltered outer coast habitat off La Jolla, CA: Kemsley

Distribution patterns of the western sand dollar (Dendraster excentricus) in a semi-sheltered outer coast habitat off La Jolla, California Angela Kemsley1* While the western sand dollar (Dendraster excentricus) is abundant along the Pacific coast of North and Central America, few studies have been done on the species. Previous research has classified standard distribution patterns in common habitats. There is, however, a population at La Jolla Shores, California, in which the habitat is bound by a submarine canyon that runs parallel to the shore, therefore limiting the seaward expansion of the bed. This study examines the sand dollar population in this unusual environment in order to demonstrate the impact the submarine canyon has on the standard size and age distribution of the population. It does so by asking the questions: what is the relationship between population density and depth, does size distribution vary along a depth gradient, and is the bed dominated by a certain age class?

Population density and average size are found to be greatest at intermediate depths, possibly due to the effects of water flow on filter feeding, as well as hazards caused by the neighboring deep-water canyon. Size frequency is bimodal, suggesting that the bed is dominated by two age classes, likely due to predator interactions.

Introduction

Dendraster excentricus, more commonly known as the western sand dollar, is a filter feeding echinoderm that is frequently found in sandy bottom habitats and is commonly known by its round, white shell (referred to as a test) with a flower-like pattern that washes ashore on beaches along the Pacific coast. Populations tend to aggregate in shallow waters near the coast, forming dense bands that may stretch for miles, collectively known as a bed (1). One of the distinguishing characteristics of D. excentricus is its habit of inserting its anterior end into the sand while leaving its oral surface exposed, creating a vertical attitude with the substrate (1–4).

Dead sand dollars are a popular collectible as their remains wash up on shore, often covering entire beaches.

Alive, they are avidly enjoyed by snorkelers and SCUBA divers since they form large, conspicuous, and easily accessible beds close to shore. Sand dollars are also an important navigational tool used by SCUBA divers since their orientation can be read to determine the direction of the shore. Despite this, surprisingly little scientific research has been done on the species. Almost all of the recent studies have focused on details of their reproductive biology, revealing that young sand dollars can clone themselves as a 1. UCSD, Muir College, Ecology, Behavior and Evolution Major, Class of 2008. *To whom correspondence should be addressed.

E-mail: ajkemsley@gmail.com

defense against predation, thus creating a subset of smaller individuals (5). Practically all of the research done on D. excentricus’ spatial patterns was in the early to mid twentieth century, with little demographic research after the 1970s.

The early research on D. excentricus, along with one study by Morin et al. in 1985, reveals several trends in the distributions of most populations studied (1, 6).

According to Merrill et al. and Morin et al. the beds formed by populations of D. excentricus are composed of highly delineated seaward and shoreward edges, with greater density occurring toward the seaward margin. Merrill et al. attempt to explain this phenomenon by proposing that there are two regular patterns of distribution (1). In the first, populations form dense bands parallel to the shore at depths of 4–12m. Juveniles dominate the shoreward edge while the seaward edge consists primarily of adults. The second type of distribution is similar to the first except that the bed extends to a greater depth and past 10–15m individuals get progressively smaller with depth. These investigations were fairly comprehensive in studying most habitats where D. excentricus are found, including sandy bottom, outer-coast habitats such as La Jolla, but they neglect to adequately examine the effects that a submarine canyon, such as Scripps Canyon at La Jolla Shores, may have on distribution patterns.

Within a bed, age classes may adequately be grouped according to test length (1). One common feature of D. excentricus is the tendency to form beds dominated by one age class (6–9). Oliver et al.’s explains this phenomenon

Saltman Quarterly, Vol. 6, Nos. 1, 2 & 3

RESEARCH

Distribution patterns of the western sand dollar in a semi-sheltered outer coast habitat off La Jolla, CA: Kemsley

Figure 1: Topographic map of La Jolla Shores, courtesy of Ross Overstreet (11).

by demonstrating that biological filters, such as predation by amphipods, crabs, and fishes, prevent successful recruitment of young D. excentricus (9). Recruitment remains low until wave action or some other ecological upset reduces the number of predators. The predators soon rebound and prevent recruitment once again, leading to the skewed age class distribution.

This study site, at La Jolla Shores, is a semi-sheltered outer coast with a west facing sandy beach in La Jolla, California. Scripps Canyon, a narrow submarine canyon that connects to the larger La Jolla Canyon, runs close to the beach with a vertical drop-off starting at about 15.2m in depth. The population of D. excentricus in my study inhabits this sandy bottom habitat, following the contours of the canyon’s edge (Fig. 1).

This study attempts to show that the size and age distribution of D. excentricus off of La Jolla Shores, California, deviates from the standard distribution patterns of this species set forth by previous researchers due to the presence of a submarine canyon at the seaward edge of the population. To classify the deviance this study examines three general questions: 1) what is the relationship between population density and depth, 2) how does size distribution of the local D. excentricus population correspond to the depth gradient, and 3) is the bed dominated by a certain age class?

17

mark the dive entrance to the beach, making it easy to identify on repetitive dives. For this reason, the point was used as a reference point from which to identify transect locations. From the reference point, the first transect ran due east to 4.6m in depth. A 1/3m2 quadrat made of PVC pipe was placed at every 1.5m in depth, from 15.2m to 4.6m, totaling 8 quadrats per transect to cover the entire east-west distribution of the bed. Two more identical transects were placed approximately 120m away to both the north and south of the reference point, parallel to the first transect. In each quadrat test length data was collected for every sand dollar within the quadrat, measuring the test diameter at its largest point using calipers. Measuring every sand dollar also gave accurate count data with which to perform a density analysis. Data from the three quadrats at each depth were combined to perform size distribution, density, and size frequency analyses.

Results

D. excentricus densities follow a significant polynomial trend in distribution (nonlinear regression, F2,5= 26.86, p= 0.0021, r2= 0.88, Fig. 2). Lowest densities occur in the shoreward and seaward edges of the bed, while greatest densities occur in the middle, from about 9.1-12.2m in depth. The seaward edge has an average density of 266 per m2 at 15.2m, while the shoreward edge only reaches a density of 32 individuals per m2. The greatest average density is reached at 12.2m in depth with 606 per m2.

When data from all quadrats are combined, size distribution as reflected in test length shows a polynomial distribution along the depth gradient (nonlinear regression, F2,3033= 45.84, p<0.0001, r2=0.03, Fig. 3) for the area of the bed in which data was collected. Average test length progressively increases with depth until it reaches a maximum at about 12.2m, after which point test length begins to decrease with depth. Shallower depths exhibit a much greater variance in the range of test lengths present, with a difference of up to 50mm between the smallest and largest individuals, while individuals in deeper areas exhibit

Methods and Materials

A total of 3036 individuals of D. excentricus were measured in May 2008 over a series of six dives, with a total of 7.4-hours spent underwater. Data were collected using three transects placed parallel to each other and perpendicular to the beach. Transects were followed according to cardinal direction using an underwater compass and quadrats were placed according to depth using a standard dive depth gauge. One transect was placed starting at GPS coordinates 32º51’22”N 117º15’44”W, corresponding to 15.2m in depth at the edge of Scripps Canyon. This point is due west from the bathrooms that

Figure 2. Polynomial regression of average density (per m2) along a depth gradient shows density is greatest at intermediate depths.

Saltman Quarterly, Vol. 6, Nos. 1, 2 & 3

RESEARCH

18

Distribution patterns of the western sand dollar in a semi-sheltered outer coast habitat off La Jolla, CA: Kemsley

Figure 3. Polynomial regression of test length along a depth gradient shows absolute test length is greatest in shallow waters, but average test length is greatest at intermediate depths.

Figure 4. Moving average of test length frequencies shows a bimodal distribution of test lengths, representing a bimodal distribution in age.

et al. and Morin et al. (1, 6), and appears unaffected by the presence of the canyon. The La Jolla Shores population begins at about 4.6m in depth, similar to the 4m in these previous studies, and runs to 15.2m, stopping about 0.20.3m from the canyon wall. The polynomial nature of the test length distribution is similar to the model set forth previously, including the critical depth at which the test length ceases to increase and begins to decrease with depth. The La Jolla Shores population begins to decrease with depth at about 12.2m, fitting well between the 10-15m proposed.

While this size distribution has been well described, it is unclear why it exists. A possible hypothesis is that average size is greatest at intermediate depths for the same reasons that density is greatest in these depths as well. Filter feeding Discussion is optimal in areas with moderate water movement because Density estimates for the La Jolla Shores D. excentricus it provides adequate nutrient flow without disturbing population reveal a different distribution than in previous settlement (1). This critical point for size distribution also studies for this species at other sites. The local population corresponds to the general depth of the thermocline, exhibits greatest densities in the middle of the bed, as which may cause the water temperature to drop by as much opposed to previous research that found greatest densities as 5.5°C at La Jolla Shores (personal observation). It is also at the seaward margin of the bed. The La Jolla Shores possible that light availability and pressure are optimal at population is bound by the Scripps Canyon, and often this range, as these are known to be key limiting factors of currents and surge will push individuals over the edge and subtidal organisms. into the depths of the canyon, reducing the density closest Variance is greater in shallower depths, possibly due to the wall of the canyon (personal observation). Wave to two documented observations set forth by Merrill et action and longshore currents that frequent the surf zone al. (1970). They report that young juveniles inhabit the parallel to the La Jolla coast, along the shoreward edge shoreward edge and migrate seaward as they grow, so it is of the bed, likely limit the shoreward edge as this habitat expected that they account for a large number of recorded presents challenges for small individuals that are prone to individuals at the shoreward edge (1). Also present at the being picked up and swept away by any significant water shoreward edge of the bed are, to a lesser extent, adults that movement (10). The result is that the regions with the most are strong enough to persist in the fluctuating conditions modest water movement show the greatest densities, as they near the surf zone. These individuals are able to achieve a are the most optimum for the filter feeding D. excentricus. It relatively large size at the shoreward edge of the bed due to is in fact this method of feeding that impels individuals of greater food availability than that found at the seaward edge D. excentricus to adopt the upright position (1â&#x20AC;&#x201C;4), which in (1). This creates a mixture of large and small individuals turn allows them to congregate as densely as they do. that is not found anywhere else in the bed.

Size distribution along the depth gradient is in agreement Size frequency distribution in the La Jolla Shores with the deeper-extending populations studied by Merrill population shows a bimodal distribution, which may be a range of only about 30mm. The largest individual, with a test length of 56mm, was at 7.6m in depth. In fact, every individual above 31mm was found at a depth of 7.6m or shallower; however, having an individual above this value was rare, so the greatest average test length was still found at 12.2m in depth.

Size frequency data exhibits a bimodal distribution, with test lengths of 16mm and 20mm displaying a much higher frequency than other lengths (frequency analysis, Fig. 4).

On average, each of the test lengths adjacent to these values are progressively smaller. Therefore the bed is dominated by two age classes, allowing for a slight variation of average test length for each age class.

Saltman Quarterly, Vol. 6, Nos. 1, 2 & 3

RESEARCH

19

Characterization of the secondary fluorescence peak in the eastern tropical North Pacific: Rogers, et. al.

explained by one of two theories. It has been documented that D. excentricus beds are dominated by a single age class (6–9). This is considered to be due to poor recruitment as a result of continually high predation (6). Within a bed, size is an effective predictor of age (1), so a bimodal size distribution correlates to a bimodal age distribution. This suggests that two age classes dominate the bed off of La Jolla Shores. Previous data on other D. excentricus beds suggests only one age class dominates (6-9); however, it is possible that there have been two incidents of predator dieoffs in the recent history of La Jolla Shores, resulting in two separate age classes experiencing high recruitment rates.

The second theory concerns the recent finding by Vaughn et al. that juvenile sand dollars may clone themselves when threatened (5). These clones are smaller than the parents, resulting in a prevalent subset of a smaller size class.

Both of the dominant size classes documented in the La Jolla Shores population are of generally small individuals (probably juveniles), so it is possible that the smaller dominant size class is a result of cloning by the larger dominant age class. This would agree with the hypothesis that there was an increase in predators after the recruitment of the larger dominant size class. This increase suppressed the recruitment of proceeding age classes and threatened the existing individuals with high levels of predation, inducing them to clone. Cloned individuals, aside from strictly increasing population size, are less vulnerable to predation because juvenile sand dollars lay flat. As a result, they are often buried by sand, reducing their chances of being detected by a predator (5). Without genetic testing it is impossible to tell which of these theories is correct, so future studies using genetic analyses to determine the relatedness among individuals of these dominant age classes would be beneficial.

Since La Jolla Shores is a unique habitat, with its shallow water submarine canyon, future studies should focus on documenting differences between areas of the bed close to where the canyon meets the beach and areas further north, where the canyon begins farther out. In addition, D. excentricus bed composition is plastic, following diel and seasonal patterns as well as restructuring after environmental interruptions (1). Studies documenting these changes should be done to further explain distributional patterns in D. excentricus beds. These data would help to better understand the affects of submarine canyons on subtidal ecosystem interactions.

Acknowledgements

I would first and foremost like to thank Travis Kemsley, who was really more of a co-author than an assistant.

Without his hours of hard work researching literature, collecting data, and discussing theories, this paper would not have been possible. I would also like to thank Dr. Heather Henter for her encouragement and guidance in submitting my research. Finally, thank you to my wonderful field assistants: Greg Cantor, Jan Cantor, and Frank Kemsley.

References 1. R. J. Merrill, E.S. Hobson, Am. Midl. Nat. 83, 585–624 (1970).

2. H. L. Clark, Soc. Natur. Hist. 29, 323–337 (1901).

3. H. L. Clark, Ann. Mag. Natur. Hist. ser 10. 15, 120–129 (1935).

4. T. Mortensen, Studies of the Development and Larval Forms of Echinoderms (E.E.C. Gad., Copenhagen, 1921), p. 261.

5. D. Vaughn, R. Strathmann, Science. 319, 1503 (2008).

6. J. G. Morin, et al, Mar. Ecol. Prog. Ser. 27, 163–185 (1985).

7. R. A. Cameron, S.S. Rumrill, Dendraster excentricus in Monterey Bay, California, USA. Mar. Biol. 71, 197–202 (1982).

8. J. E. Kastendiek, Oecologia (Berl.). 52, 340–347 (1982).

9. J. S. Oliver, et al, Fish. Bull. U.S. 78, 437–454 (1980).

10. J. Allen, Geografiska Annaall. Ser A, Physical Geography. 56(3/4), 237–240 (1974).

11. R. Overstreet, “La Jolla Canyon Divers Map” (2005). http://www.rossoverstreet.org/scuba/GIS/ index.htm 10. Overstreet, Ross. 2005. “La Jolla Canyon Divers Map.” http://www.rossoverstreet.org/scuba/GIS/ index.htm

Submitted for publication 10 January 2009

Characterization of the secondary fluorescence peak in the eastern tropical North Pacific Jameson Rogers,1* Jan Witting2,3 The existence of a secondary fluorescence maximum found in suboxic regions of the world’s oceans has yet to be fully explained. Fluorescence is an indicator of photosynthetic activity and consequently related to our planet’s carbon budget. The secondary fluorescence maximum exists below the euphotic zone at the boundary between oxic and anoxic water. In this study the secondary fluorescence maximum is characterized across 14 stations with respect to depth, oxygen concentration, temperature, and fluorescence. Oxygen concentration and depth are the two most important factors in determining the magnitude of the fluorescence peak, with the effect of depth being attributed to relative light intensity.

Niche cyanobacteria that thrive in low light conditions may offer insight into novel photosynthetic adaptations that contribute to the secondary fluorescence maximum phenomenon. The present study provides data inversely linking the intensity of secondary fluorescence maxima with relative oxygen concentration in the eastern tropical North Pacific.

Saltman Quarterly, Vol. 6, Nos. 1, 2 & 3

RESEARCH

20

Characterization of the secondary fluorescence peak in the eastern tropical North Pacific: Rogers, et al.

Introduction

Prochlorococcus is a genus of marine photosynthetic cyanobacteria that is responsible for a substantial portion of oceanic primary production. Consequently, the abundance and energy metabolism of Prochlorococcus is important when considering the global CO2 budget. Prochlorococcus is the most abundant primary producer in the tropical Pacific (1) and can account for more than 50% of total photosynthetic pigment in some regions (2). These 0.5 to 0.7 µm photosynthetic microorganisms occur in high density from the surface down to approximately 200 m water depth across the entire 40N to 40S latitudinal band of the global oceans (3). Prochlorococcus is often found to cohabitate with closely related Synechococcus, however Prochlorcoccus is generally found in a wider range of environmental conditions. Genomic studies have shown at least two distinct ecotypes of Prochlorococcus characterized by high and low light intensity adaptations (4). The high light adapted strains use ammonia as their sole nitrogen source.

The low light adapted strains can utilize both ammonia and nitrite as nitrogen sources. The diversity of Prochlorococcus strains allows this genus to occupy niches all over the world’s oceans. The niche explored in this paper is deficient in both light and oxygen, yet rich with Prochlorococcus. This produces an enigmatic peak when chlorophyll fluorescence is observed as a function of depth in the water column. This phenomenon is known as the secondary chlorophyll fluorescence maximum.

Figure 1. Deployments occurred at 67 stations along the voyage.

The early stages of a mild El Niño event were reported during this time. Inset: Stations where SFM was observed.

1. UCSD, Sixth College, Bioengineering: Biotechnology Major, Class of 2008.

2. Woods Hole Oceanographic Institution, Woods Hole, MA, U.S.A. 3. Sea Education Association, Woods Hole, MA, U.S.A. *To whom correspondence should be addressed. E-mail: j3rogers@ucsd.edu

Figure 2. Diagram with naming conventions for the SFM. The first peak is the deep fluorescence maximum, the maximum observed all over the world’s oceans. The second peak, the SFM, is unique in its location. It indicates the presence of photosynthetic organisms thriving below the traditional boundary of the euphotic zone.

The secondary fluorescence maximum (SFM) is found in suboxic waters and has been of interest to researchers for over 20 years (5, 6). This maximum is always located below the more common Deep Fluorescence Maximum (7, 8). It has been observed to correspond with the top of the oxygen minimum zone (OMZ), and a local minimum in the nitrite profile. Anderson proposed photosynthetic oxidation of nitrite as one possible reaction accounting for this phenomenon (5). Lewitus and Broenkow concluded that possible SFM sources were dark-adapted photosynthetic bacteria that were heterotrophically associated with sinking particles (6). However, Lewitus and Broenkow later found the Anderson nitrification hypothesis to be consistent with the data.

Mechanisms other than purely photosynthetic growth may be required to support these fluorescence maxima as the SFM has been observed well below the typically defined euphotic zone (beyond the depth where sunlight is sufficient for photosynthesis to occur), where the incident light intensity is less than 0.05% of surface intensity (I0 < 0.05%).

The organisms making up the SFM are almost exclusively Prochlorococcus (8), indicating something unique about the physiology of this species. The extreme low light conditions in this niche may imply a novel third Prochlorococcus ecotype that is separate and distinct from the previously recognized high and low light adapted ecotypes. It is therefore suggested that this ecotype would possess another metabolic pathway besides photosynthesis. Dilution experiments have shown that in situ growth rates are higher than on deck growth rates (8). This

Saltman Quarterly, Vol. 6, Nos. 1, 2 & 3

RESEARCH

Characterization of the secondary fluorescence peak in the eastern tropical North Pacific: Rogers, et al.

21

and thus all fluorescence units are relative. Prochlorococcus and Synechococcus samples were obtained by filtering 20 mL of seawater through a Millipore 0.22 micron filter on top of a Millipore 5 micron backing filter. The 0.22 micron filter was then placed on a slide and frozen for later analysis.

Sample Analysis Oxygen was quantified using the Winkler titration method described in Parsons et al. (9). Nitrite and Nitrate were analyzed as described in Parsons et al. (9). Cyanobacteria concentrations were determined using a Zeiss Axiostar epifluorescence microscope.

Figure 3. Plot of SFM peak fluorescence over the cruise track. The magnitude of fluorescence increased with distance from shore. This correlated with the elevation of the thermocline and consequently the oxygen minimum zone (OMZ). No secondary peak was observed after leaving the OMZ.

suggests important environmental factors are maintaining the SFM. Suboxic conditions may be one such factor.

The aim of this study is to further characterize the secondary fluorescence maximum and to further define the conditions that support the growth of cyanobacteria in the SFM.

Methods

Cruise track The S208 cruise track started November 26th, 2006 in Puerto Vallarta, Mexico and ended January 5th, 2007 in Papeete, Tahiti (Fig. 1). The eastern tropical Pacific transect was made aboard the SSV Robert C. Seamans.

Sampling Carousel deployments took place every day at 0800 and 2000 hrs along the S208 cruise track. The Sea-Bird Electronics 32 carousel setup included a Sea-Bird Electronics 19plus SEACAT Profiler CTD, Sea-bird Electronics 43 oxygen probe, and a Seapoint fluorometer. The carousel was deployed to a depth of approximately 500 m. Nitrite and nitrate samples were drawn from the carousel in 125-mL plastic Nalgene bottles and frozen. Oxygen was drawn from the carousel by filling biological oxygen demand bottles without exposure to air. These bottles were then fixed according to the Winkler method (9) for later analysis. Three oxygen samples were drawn at each station to verify the accuracy of the oxygen probe. The fluorometer that was used was not calibrated,

Data Analysis Three points on the secondary fluorescence maximum were evaluated. Each of these points was considered in terms of depth, fluorescence, oxygen concentration, and temperature. The mean, median, and standard deviation of these variables were calculated from the 14 stations exhibiting the SFM. Depth, temperature, and oxygen concentration at each of the three points was plotted against peak fluorescence.

Regression lines were determined and analysis of variance was performed.

Results

Prevalence The secondary fluorescence maximum was observed at 14 stations along the S208 cruise track between November 28 and December 04, 2006 (Fig. 1).

With one exception these stations were continuous, starting in the bay of Banderas and ending 830 nautical miles off the coast of Mexico. The disappearance of the SFM corresponded with the 10ยบ North thermocline ridge and the end of the oxygen minimum zone. The magnitude of the fluorescence maximum generally increased with distance from shore (Fig. 3). The highest magnitude SFM was observed just before the sudden absence of further SFM. Characteristics The secondary fluorescence maximum was observed to have varying depths, temperatures, and oxygen concentrations for the peak of the fluorescence anomaly.

The mean distance from the thermocline to the SFM peak was 59 m. The median, minimum, and maximum distances were 60, 35, and 85 m, respectively. The length of the SFM varied from 20 to 65 m with a mean and median of 44 and 48 m, respectively. Single distinct SFM were observed for all the stations except for stations 12 and 14 which exhibited dual peaks below the deep chlorophyll maximum (data not shown).

Prochlorococcus and Synechococcus cell concentrations were recorded at station 14 (Fig. 4). A peak in Prochlorococcus concentration was observed to correspond with the SFM at that station at approximately 75 m. In contrast, the peak in Synechococcus abundance more closely correlated with the deep chlorophyll maximum centered near 40 m (Fig. 4).

Saltman Quarterly, Vol. 6, Nos. 1, 2 & 3

RESEARCH

22

Characterization of the secondary fluorescence peak in the eastern tropical North Pacific: Rogers, et al.

n = 14

Depth (m)

Fluorescence

Oxygen (ml/L)

Temperature (C)

Peak: Min Max Mean Median % Std Dev

75 140 108 108 15%

0.17 0.86 0.47 0.46 44%

0.20 0.06 0.10 0.08 38%

12.77 14.58 13.68 13.68 4%

Table 1. The characteristics of the SFM peak.

Relationship to oxygen, depth, and temperature The relationship between oxygen concentration and magnitude of fluorescence for the SFM appears to be a threshold effect. When considering the SFM peak, no maxima were observed with oxygen concentrations above 0.2 ml/L. All but one SFM occurred with oxygen concentrations below 0.13 ml/L. Plotting the SFM peaks showed that higher levels of maximum fluorescence were reached when oxygen concentrations were lower (Fig. 5).

This threshold effect is also visible in Fig. 6. Secondary fluorescence maxima can be seen below the primary fluorescence maxima approximately following the 0.1â&#x20AC;&#x201C;0.2 ml/L oxygen iso-contours.

The magnitude of SFM peak fluorescence was also correlated with the depth of the peak. As the depth of the peak increased the fluorescence decreased with R2 = 0.32 (P < 0.04) (data not shown). The magnitude of SFM peak fluorescence also correlated with depth of SFM start. As the depth of the SFM starting point increased the fluorescence at the peak decreased with R2 = 0.47 (P < 0.01) (Fig. 7).

The magnitude of SFM peak fluorescence did not a have significant correlation with temperature at the peak R2 = 0.02 (P > 0.64) (data not shown).

Discussion

Environmental factors The goal of this study was to determine and describe the environmental conditions that are responsible for the creation and persistence of the secondary fluorescence maxima in the eastern tropical north Pacific. This was done using the parameters of oxygen concentration, temperature, depth, and relative light intensity. The compilation of data corresponding to the beginning, peak, and end of the secondary fluorescence maximum shows that there is a strong relationship between the concentration of oxygen and the magnitude of fluorescence.

It has been shown previously that the SFM is only observed in suboxic waters (7, 8). Here it is shown that suboxic conditions are more than just a binary control. Fig. 5 shows lower oxygen concentrations at the SFM peak were associated with larger amounts of fluorescence. It is possible that oxygen acts to inhibit a key process that supports the growth of the SFM community. It is also possible that the lower oxygen

Figure 4. Prochlorococcus (cells/L), Synechococcus (cells/L), and Fluorescence at Station 14. The peak in Prochlorococcus cell density corresponds to the secondary fluorescence maxima while the Synechococcus cell density peak corresponds to the deep fluorescence maximum.

concentrations inhibit predation in the SFM region.

The correlation between starting depth of the SFM and peak fluorescence was the strongest of all correlated variables (Fig. 7). As depth does not have a biological effect on the SFM community itself, variables associated with depth must be affecting the peak fluorescence. The most likely variables are temperature and light intensity. Plotting temperature against SFM magnitude showed no correlation (data not shown).

Light intensity must then be responsible for the strong correlation between depth and fluorescence magnitude.

The SFM often occurs well below 1% surface irradiance (7). Consequently, it is predicted that the SFM cyanobacteria that thrive in these low light conditions perform extremely efficient photosynthesis.

Magnitude along cruise track The increase of the SFM magnitude with increasing distance from the shore seems to be a function of the decreasing depth of suboxic waters. Fig. 5 shows the clustering of SFM peaks around 0.1 ml/L oxygen concentration (see also Fig. 6). The SFM peaks roughly follow the 0.1 ml/L oxygen contour. As this contour gets closer to the surface the fluorescence intensity of the peaks increases. This effect can be attributed to the increase in light intensity found at lesser depths. The sudden disappearance of SFM is due to the vertical drop of the 0.1 ml/L oxygen contour, visible in Fig. 6. The trend of the SFM to be near the 0.1 ml/L oxygen

Saltman Quarterly, Vol. 6, Nos. 1, 2 & 3

RESEARCH

Characterization of the secondary fluorescence peak in the eastern tropical North Pacific: Rogers, et al.

23

Figure 6. Oxygen concentration (ml/L) overlaid onto a fluorescence plot. The strongest SFM fluorescence can be observed at 14oN (~105 m depth). The SFM was not observed south of 11oN. Figure 5. Nearly all of the secondary fluorescence maxima were observed below 0.15 ml/L oxygen concentrations with the majority of high magnitude peaks occurring below 0.10 ml/L.

contour, but to increase in magnitude with decreasing depth, suggests an optimal growth condition that balances a need for suboxic conditions with a need for light energy.

Conclusion

The present findings show that the secondary fluorescence maximum is limited in magnitude by oxygen concentration.

While no maximum is observed with high concentrations of oxygen, the peak fluorescence is usually centered at an oxygen concentration of 0.1 ml oxygen/L. Rather than oxygen concentration acting solely as an on/off switch for the secondary maximum, greater fluorescence peaks are reached with lower oxygen concentrations. It was additionally shown that the depth of where the secondary fluorescence maximum starts is negatively correlated with peak fluorescence. With shallower depth, more light is available and the peak reaches higher levels of fluorescence. Organisms associated with the secondary fluorescence peak thus depend on light and

low oxygen concentrations for optimal growth. To fully describe the mechanisms responsible for the creation and maintenance of the SFM, further studies must be done.

Laboratory incubation studies would elucidate just what the optimal growth conditions are and may be able to determine other factors that contribute to the SFM phenomenon as well. Moreover, molecular analysis of genetic signatures from SFM-associated populations and their comparison against high and low-light adapted Prochlorococcus ecotypes may reveal a novel group of cyanobacteria inhabiting the sub-photic zone. Genomic characterization and reconstruction of the metabolic potential of these populations may further reveal novel insight into a hitherto underexplored aspect of marine cyanobacterial physiology.

Acknowledgments

The author would like to thank Sea Education Association for providing the oceanographic research vessel that made data collection possible, Woods Hole Oceanographic Institute for providing the venue for intensive oceanography training, Captain Chris McGuire for his guidance and patience, and Dr. Kara Lavender for always being there to answer questions.

References

Figure 7. SFM peak fluorescence plotted against depth of SFM start. Fluorescence decreases with increasing depth.

1. J. Blanchot, J. Andre, C. Navarette, J. Neveux, M. Radenac, Deep Sea Research Part I: Oceanographic Research Papers. 48, 297–314 (2001).

2. L. Campbell, H.A. Nolla, D. Vaulot, Limnol. Oceanogr. 39, 954–961 (1994).

3. F. Partensky, W.R. Hess, D. Vaulot, Microbiol. Mol. Biol. Rev. 63, 106–127 (1999).

4. G. Rocap, et al, Nature. 424, 1042–1047 (2003).

5. J.J. Anderson, Deep Sea Research Part A. Oceanographic Research Papers. 29, 1193–1201 (1982).

6. A.J. Lewitus, W.W. Broenkow, Deep Sea Research Part A. Oceanographic Research Papers. 32, 1101–1115 (1985).

7. R. Goericke, R.J. Olson, A. Shalapyonok, Deep Sea Research Part I: Oceanographic Research Papers. 47, 1183–1205 (2000).

8. Z. Johnson, M.L. Landry, R.R. Bidigare, S.L. Brown, L. Campbell, et al, Deep Sea Research Part II: Topical Studies in Oceanography. 46, 1719– 1743 (1999).

9. T. Parsons, M. Yoshiaki, L. Carol, A Manual of Chemical and Biological Methods for Seawater Analysis (Pergamon Press, Oxford, England, 1984).

Submitted for publication 30 January 2009

Saltman Quarterly, Vol. 6, Nos. 1, 2 & 3

RESEARCH

24

California margin macrobenthos: the effects of oxygen and water depth on macrobenthic community structure: Chou, et al.

California margin macrobenthos: the effects of oxygen and water depth on macrobenthic community structure Sean Chou,1* Lisa Levin2 Oxygen Minimum Zones (OMZs), which occur around regions of high primary productivity on continental margins where oxygen concentrations are less than 0.5 ml/L, are zones significantly different from any other part of the world’s oceans. In studying OMZs, we have learned what types of organisms have adapted to the low oxygen environment, and what adaptational advantages these organisms have over others. By examining multicores taken at the depths of 500, 800, 1000, and 1200 meters off the Northern California Margin, the macrofaunal community structure was carefully analyzed. With decreasing oxygen, it was hypothesized that macrofaunal abundance would decrease, organisms would tend to congregate closer to the surface because of a shallowing effect, and organisms that are more adapted to the environment would be represented in higher numbers, mainly macrofauna of the major taxa annelids. Results showed that decreasing oxygen concentration did not always correspond with decreasing macrofaunal density (at 800 m), but that the majority of macrofauna did tend to remain within the first two centimeters of each ten cm fraction, and annelids were indeed favored by composition. By studying OMZs, we may gain a better perspective of where the oceans are headed, and how OMZs might impact the planet as greenhouse gases continue to rise and heat earth to levels it has not seen for tens of thousands of years.

Introduction

Oxygen Minimum Zones (OMZs) are regions of extremely low oxygen (defined as less than 0.5 ml/L) usually occurring at depths between 200 and 1,000 m within the world’s oceans (1). Surface ocean water is generally oxygen-rich, containing the highest amount of dissolved oxygen compared to other depths due to continuous mixing with atmospheric air. Dying planktonic organisms within the surface water rain down as organic matter, which aerobic bacteria feed on while also consuming oxygen. These aerobic bacteria are the most significant cause of oxygen depletion, which results in most organic matter being consumed within the first 1,000 m.

Along with an increased depletion of oxygen with depth, other contributing factors to OMZs include stagnant water, oxygen-deficient source waters, and the distance between the source water and current position (age) (2).

Benthic OMZs occur along the continental margins of the eastern Pacific, northern Indian, and western Atlantic oceans (1). The OMZs are not limited to these regions only, and can be found, though to a much smaller extent, at locations where the seawater is of a much older origin; thereby, containing lower oxygen concentrations due to the 1. UCSD, Warren College, Biochemistry and Cell Biology Major, Chinese Studies Minor, Class of 2010.

2. Integrative Oceanography Division, Scripps Institution of Oceanography, La Jolla, CA, U.S.A. *To whom correspondence should be addressed. E-mail: stchou@ucsd.edu

depletion of oxygen over time. New source waters originate in the North Atlantic Ocean and sink down, moving on a conveyor belt system southwards, curving around South America to reach the Pacific Ocean as well as making its way into the Indian Ocean, producing OMZs in these regions (Fig. 1).

OMZs are important because as the environment changes, especially due to human actions such as eutrophication (an influx of nutrients into the oceans primarily by dumping that affects primary productivity and oxygen concentrations), and global warming, OMZs may expand and intensify.

Understanding these regions of oxygen-depleted seawater will enable predictions of the effects that nutrient inputs to

Figure 1. Distribution of the world’s oxygen minimum zones. Open water oxygen zones are shown in black. Hypoxic enclosed seas and fjords are stippled (2, 3).

Saltman Quarterly, Vol. 6, Nos. 1, 2 & 3

RESEARCH

California margin macrobenthos: the effects of oxygen and water depth on macrobenthic community structure: Chou, et al.

25

Figure 3. The oxygen profile off of the Eel River mouth. Arrows indicate depths at which samples are taken. Data collected by CTD.

Objectives Figure 2. Dotted area represents the region of study in the Northern California margin.

the ocean and other factors such as warming may have on the productivity of the oceans.

The macrobenthos (benthic macroorganisms larger than 300 microns) community structure in an OMZ along the Northern California Margin will be analyzed in this study.

These organisms which live at the bottom of the sea floor are herein referred to as macrofauna. This study will center on the effects oxygen has on abundance, composition, and vertical distribution within the OMZ. However, oxygen is unlikely to be the sole factor influencing community structure, and variations in temperature and food supply (which decrease with depth) could create confounding factors. Yet as will be shown, the differences in community structure can be viewed more as a function of oxygen than of any other parameter (4).

Figure 4. On the left, the multicorer used on R/V Atlantis is being prepared by a crew member. On the right, it is being dropped into the water and lowered to a specific depth. Pictures courtesy of Michael Thelen.

The objective of this research is to investigate the effects of the Oxygen Minimum Zone (OMZ) (bottom water oxygen concentration <0.5 ml/L) on the macrofaunal community structure off of the Eel River along the Northern California margin (Fig. 2). The given oxygen profile for each depth will also be recorded (Fig. 3). The OMZ impinges on the margin at 600 to 1000 m in depth; and in this study communities will be analyzed at depths ranging from 500 to 1200 m. Through the sorting of the macrofaunal samples at different sites and depths, consequent analysis will provide a better understanding of how low oxygen affects macrofaunal diversity, density, vertical distribution within sediment, and composition. The research done here will provide insight and knowledge into how macrofaunal life has adapted to conditions inside and around OMZs. Hypotheses

1. H0: Oxygen variations (0.2–0.5 ml/L) have no effect on macrofaunal density.

HA: Decreasing oxygen levels decrease macrofaunal density.

2. H0: Oxygen variations (0.2–0.5 ml/L) have no effect on composition.

HA: Composition will change with varying oxygen levels.

Annelids will be more favored.

3. H0: Oxygen variations (0.2–0.5 ml/L) have no effect on the shallowing effect (vertical distribution of organisms in sediment).

HA: As oxygen levels diminish, organisms living within the sediment will tend to congregate closer to the surface (vertical distribution will change with varying oxygen levels).

Methods

Field work The samples of macrofauna were taken in July of 2006

Saltman Quarterly, Vol. 6, Nos. 1, 2 & 3

RESEARCH

26

California margin macrobenthos: the effects of oxygen and water depth on macrobenthic community structure: Chou, et al.

Annelids - Polychaetes

Molluscs â&#x20AC;&#x201C; Bivalve

Crustaceans

Heteromastus filiformis

Gemma gemma Nereis succinea Figure 5. Examples of macrofauna found along the Northern California margin.

from the R/V Atlantis using a multicorer (Fig. 4). The multicorer is a device that collects sediment from the sea floor and has eight tubes, each with a diameter of 9.6 cm (an area of 72.40 cm2). The samples were taken at four stations at depths of approximately 500, 800, 1000, and 1200 m. At each station, the multicorer was dropped three times, with the exception at 800 m, where only one drop was properly recorded. Using a CTD during the drops, an acronym for Conductivity, Temperature, and Depth, which is the primary tool for determining essential physical properties of sea water, data was taken to be correlated with each depth (Table 1).

From each multicore drop, three tubes were processed for macrofauna. Each tube was sectioned vertically as 0-1, 1-2, 25, 5-10, and 10-20 cm fractions. The 10-20 cm fraction was not used in subsequent analysis because it contained relatively few organisms. The top three sections were preserved unsieved in 8% buffered formalin. The 5-10 cm fraction was sieved on the ship through a 300 micron mesh and then preserved in 8% buffered formalin.

Laboratory analysis Samples taken from the cruise were preserved with 8% formalin to keep the organisms from decomposing. Under the fume hood, the formalin was carefully transferred out of the sample container and into a separate retainer for recycled formalin. The remaining sediment was then carefully sieved through 300 and 45 micron sieves, the 300 micron sieve used to collect the macrofauna, and the 45 micron sieve for retaining the remaining sediment and meiofauna (organisms that range between 45 and 300 microns). The sediment captured in the 300 micron sieve was filtered until it was ready to be transferred to a petri dish for sorting. Once the whole sample was processed, the remaining sediment and meiofauna were transferred back into the original sample container and preserved with the recycled 8% formalin.

The petri dishes of macrofauna and material larger than 300 microns were diluted with deionized water and sorted using a dissecting microscope at 12X magnification and dissecting forceps. The macrofauna were categorized into the major taxonomic groups in which they belong (Annelida, Crustacea, Mollusca, Echinodermata), counted, and labeled in their respective vials (Fig. 5).

Cumacea

Data collection and statistical analyses After the macrofauna were sorted, counted, and organized into vials based on taxonomic groups, the counts from the data sheet were entered into a Microsoft Excel file in their entirety.

Summaries were done for the total amount of macrofauna per core, with the mean number per station, standard error, and percentage proportion of each taxonomic group. Density was recorded as number of individuals per square cm and normalized to number of individuals per square meter.

A one-way ANOVA analysis was done for the total macrofauna, total annelids, total crustaceans, total molluscs, and total echinoderms. This analysis was done with JMP statistical software in order to find the p value and any significant differences between depths and degrees of freedom.

Results

Macrobenthic abundance Macrofaunal densities were highest at 800 m (16,955 ind. m-2), followed by 500 m and 1200 m (15,926 and 12440 ind. m-2 respectively), with the lowest densities at 1000 m (6035 ind. m-2)(F3,11 = 7.523 and p = 0.010)(Fig. 6). There is no linear correlation here between macrofaunal density and oxygen Date of Cast 13-Jul-06 13-Jul-06 27-Jul-06 14-Jul-06 1-Oct-06 2-Oct-06 14-Jul-06 3-Oct-06 16-Jul-06 28-Jul-06

Depth (m) 280 440 501 515 517 692 730 803 860 1000

Temp. (°C) 7 6.06 6.28 5.6 5.89 4.72 4.6 4.42 4.1 3.7

Salinity 34 34.1 34.11 34.2 34.15 34.28 34.32 34.32 34.4 3.4

O2 conc. (ml/L) 1.164 0.981 0.988 0.529 0.706 0.334 0.252 0.294 0.22 0.279

Table 1. Date, depth, temperature, salinity, and oxygen concentration data for the sites studied. Shows minimum in oxygen concentration around 800 m. Not all replicates are shown.

Saltman Quarterly, Vol. 6, Nos. 1, 2 & 3

RESEARCH

California margin macrobenthos: the effects of oxygen and water depth on macrobenthic community structure: Chou, et al.

27

also not proven to be correlated with oxygen concentration.

As oxygen concentration increased, crustacean density increased tenfold even when oxygen concentration increased no more than 0.3 ml/L O2 (Fig. 8). Tests showed that there was not enough significance to prove any correlations. This was probably due to the fact that so little data was collectively analyzed. Alternatively, crustacean and annelid densities could be determined by other environmental variables besides oxygen. It is possible crustaceans do better above a certain depth, while annelids do better below a certain depth, and neither do well at intermediate depths, for other undetermined reasons. Thus, it remains to be seen whether oxygen is the independent variable in annelid and crustacean density, and Figs. 7 and 8 should be read in this light.

Figure 6. Macrofaunal density stacked with relative proportions of the major taxonomic groups.

Macrobenthic taxonomic composition All stations (500 â&#x20AC;&#x201C; 1200 m) were dominated by annelids, which were consistently well above 50% of total organisms found (Fig. 9). The percentage of annelids was lowest at 500 concentration.

Annelid densities were highest at 800 m, and lowest at 1000 m, where they made up 57% of the total macrofauna found. m, with the two depths being significantly different from each As oxygen concentrations decreased, the annelid composition other while 500 m and 1200 m were not significantly different became more dominant, with the depths of 800 and 1000 m from any of the depths in regards to annelid density (posteriori in the middle of the OMZ having annelid percentages at 84% HSD test) (F3,11 = 6.713 and p = 0.014). For crustaceans, and 90% respectively. At 1200 m, annelid composition dropped the highest densities were found at 500 m, this depth being to 73%. Crustaceans were more prominent at 500 m than any significantly different from the 800, 1000, and 1200 m stations other depth, making up about 40% of the total macrofauna (F3,11 = 15.161 and p = 0.0012)(posteriori HSD test). Mollusc found at that depth. Crustacean composition decreased with densities were highest at 500 m, and a one-way ANOVA decreasing oxygen concentration, with far fewer (5-7%) being analysis revealed that the 500 m station was not significantly found at 800 and 1000 m. It then increased at 1200 m to 22% different from any other stations (F3,11 = 1.172 and p = 0.241) where oxygen concentrations rose to 0.511 ml/L O2. (posteriori HSD test). The highest densities of echinoderms were found at the 800 m depth, though the station was not Vertical distribution of macrofauna Macrofauna were found to be most numerous in the top significantly different from any other station (F3,11 = 1.414 and two cm fractions, making up well over 50% of the total p = 0.308) (posteriori HSD test). organisms found in the entire 10 cm fraction. The exception Densities of annelids were not proven to be linearly was the 800 m cores, where macrofauna made up only 33% in correlated with oxygen concentration, with an average of the top two cm (Fig. 10). At 500 m, 46% of all organisms were over 100 individuals being found at 800 m (0.220 ml/L O2) found in just the top 0-1 cm fraction with decreasing amounts where oxygen was lowest, a drastic decrease in density at 1000 found in lower fractions.

1200 m also follows this trend, as the m (0.279 ml/L O2), and then an increase in annelid density when the oxygen concentration was above 0.500 ml/L O2 at 500 and 1200 m (Fig. 7). As oxygen concentration increased, annelid density decreased 40-60%. Crustacean density was

Figure 7. Plot of annelid density versus oxygen concentration.

Figure 8. Plot of crustacean density versus oxygen concentration.

Saltman Quarterly, Vol. 6, Nos. 1, 2 & 3

RESEARCH

28

California margin macrobenthos: the effects of oxygen and water depth on macrobenthic community structure: Chou, et al.

two depths share similar oxygen concentrations. At 800 m, most organisms were found in the 2-5 cm fraction, making up just above 50% of the total macrofauna found.

The depth of 500 m clearly had the most organisms found in the first two cm, as shown in the 0-1 and 1-2 cm fractions (Fig. 10). All depths except for 800 m had the most organisms found per cm in the top 0-2 cm fractions, compared to any of the lower fractions. 800 m had an equal amount of organisms per fraction in each of the first five cm, which perhaps could be explained by predator avoidance.

Discussion

Macrofaunal Density Northern California Margin: Results found the 800 m station, with the lowest dissolved oxygen concentration of 0.22 ml/L, to have the highest density of macrofauna compared to all the other depths. This refutes the hypothesis made earlier which stated that decreasing concentrations of oxygen would result in decreasing densities of macrofauna. This also goes against the findings in Levin, which support the general trend of depressed density within the OMZ where oxygen concentrations are the lowest (2).

Outside Studies: Along the Oregon Margin, macrofaunal densities were found to be lowest at 800 and 900 m, which corresponds to the sight of lowest oxygen concentration in the OMZ (5).

This finding counters the results found in this study at 800 m.

This discrepancy may be attributed to influences other than oxygen concentration. On Volcano 7, a site off the eastern Pacific, it was observed that low oxygen concentration was likely the explanation for the low macrofaunal density on the upper summit (6). Off Pakistan, at the 700 to 800 m depth range where oxygen concentrations were lowest, it was also found that macrofaunal densities were the most reduced, compared with depths with higher oxygen concentrations (7).

Similar findings were seen across other OMZs including the Oman Margin and Peru.

Figure 9. Macrofaunal composition showing relative composition of each major taxonomic group.

Levin and Gage concluded from surveying 40 bathyal stations in the north Atlantic, eastern Pacific, and Indian oceans that organic matter may also play a large part in determining macrofaunal community structure (8). Thus, organic matter may be contributing to the fact that macrofaunal density at the 800 m station off the Northern California Margin is highest, even in light of having the lowest oxygen concentration.

Indeed, this is supported by studies off the Northwest Arabian Sea where the highest densities of macrofauna found were at stations within the core of the OMZ, which is where the highest amount of total organic carbon occurred, with a decrease in macrofaunal density when total organic carbon dropped and oxygen concentration increased (9).

Macrofaunal Composition Northern California Margin: As hypothesized, annelids were the most dominant of all the major taxonomic groups, making up greater than 50% of all macrofauna at each station studied on the Northern California Margin. The next most abundant taxonomic group was the crustaceans, followed by molluscs, and finally echinoderms. Annelids are perhaps most dominant in OMZs due to low oxygen adaptations, and a high surface to volume ratio that enables them to efficiently take up oxygen from their surroundings.

Outside Studies: Off of the Oregon Margin, composition was much the same as it was off the Northern California Margin, partially owing to the fact that both are in relatively close proximity to each other. Annelids far exceeded half of the macrofauna collected, followed by molluscs, crustaceans, and then echinoderms (5).

Studies on the California continental margin off of Santa Barbara also found annelids to be the most dominant taxa with Crustaceans following right behind (10). Off of the Chile and Oman margins, annelids were the most dominant taxonomic group, followed by crustaceans. Off of Peru and Pakistan, annelids were also most dominant, though followed by molluscs and then crustaceans. For all the oxygen minimum regions studied, calcareous macrofauna were the least abundant, perhaps due to the low oxygen levels which tend to favor lower pH values (more acidic conditions), making it hard for carbonate shells to form.

Vertical Distribution of Macrofauna Northern California Margin: The hypothesized trend was that most macrofauna would be found within the top levels of the core (first two cm), tending to congregate closer to the surface where oxygen was available. The results showed that this was true of all stations except 800 m, where oxygen was lowest, and slightly more than half of the total individuals were found within the 25 cm fraction (Fig. 10). The 500, 1000, and 1200 m stations all had more than 50% of the total macrofauna within the first two cm. Such a trend is most likely due to more than just oxygen concentration itself, and could be attributed to factors

Saltman Quarterly, Vol. 6, Nos. 1, 2 & 3

RESEARCH

California margin macrobenthos: the effects of oxygen and water depth on macrobenthic community structure: Chou, et al.

29

their relatively high surface to volume ratio, enabling them to efficiently uptake more oxygen than the other taxa.

The depths of 500, 1000, and 1200 m followed the hypothesis that most organisms would tend to cluster within the top two cm of sediment as oxygen levels diminish.

The exception was the 800 m depth, in which the 2-5 cm fraction contained the largest fraction of organisms. As with macrofaunal density, it is suspected that other environmental factors had affected this particular depth.

The macrofaunal samples taken at 500, 1000, and 1200 m all follow the hypotheses laid out previously, which have been confirmed by other similar studies on macrofaunal communities in OMZs. The 800 m sample is most likely a deviant replicate. As discussed earlier, there was a lack of Figure 10. Vertical distribution of macrofauna as percentages of total analyzed data. There was only one set of 800 m samples, while organisms against the vertical fraction the macrofauna were taken from. there were three replicate sets of the 500, 1000, and 1200 m samples. The fact that the 800 m data deviates away from the trends seen at the other three depths suggests that other such as organic carbon content in the sediment. environmental factors besides oxygen has affected the data.

Outside Studies: Understanding the changes of macrofaunal communities Off the Oregon Margin, all the stations studied contained in OMZs is an ongoing project. In addition, a greater greater than 50% of the total individuals within the 0-2 cm understanding of the delicate balance of OMZs in the ocean fraction regardless of oxygen concentration. However, the will most likely prove highly useful. These communities are 500 and 800 m samples contained considerable amounts dynamically changing, and as will be discussed in the next of macrofauna within the 2-5 cm fraction, 33% and 38% section, are growing as well. Consistent study of OMZs may respectively (5). enable us to correlate the health of the planet to regions Following this trend was the Oman Margin, which also had hundreds of meters below the sea. From these studies, we the most individuals within the shallowest fraction, followed may be able to observe changing macrofaunal communities by the highest density of macrofauna within the 2-5 cm and predict later changes to the oceans and climate. fraction (11). Similarly, the Peru Margin had most macrofauna allocated near the surface fractions, but also contained a single depth (305 m) where greater than 50% of the total macrofauna Future Research OMZs are found all over the world, and they share similar existed within the 2-5 cm fraction instead of the first two cm trends regarding macrofaunal density, composition, and (12). vertical distribution.

With global warming and eutrophication, Such trends could be due to factors other than oxygen the dissolved oxygen content within the worldâ&#x20AC;&#x2122;s oceans will such as organic carbon content within the sediment, predator inevitably decrease.

This occurs as warmer waters lead to avoidance, particle size of sediment, and other lifestyle saturation, the inability to hold as much oxygen as colder waters, variations of the macrofauna present. At all margins where and loss of oceanic stratification, where the top and bottom macrofauna were highest in the 2-5 cm fraction, the depth was layers of the oceanic water column lose the ability to interalso found to have the lowest oxygen concentration, being at mix, dramatically reducing oceanic circulation.

This ultimately the core of the OMZ. results in lower oxygen concentration in deeper waters, with less efficient mixing of oxygen from surface waters.

Conclusion Recently, a study by Stramma et al. has found that OMZs Macrofaunal density did not decrease with a decrease have been increasing in tropical oceans around the world due in oxygen concentration, as previously hypothesized. The to a series of thermal, dynamic, and biogeochemical factors depth with the lowest oxygen concentration, 800 m, had the (13).

In this study, Stramma cites that climate models predict highest macrofaunal density. However, the other depths were an overall decrease in dissolved oxygen content in the worldâ&#x20AC;&#x2122;s consistent with the claim put forth by Levin, which says that oceans.

It also documents that OMZs have expanded and macrofauna density will decrease with decreasing oxygen intensified within the last 50 years. concentration. The exception at 800 m must be due to some With an expansion of OMZs in our oceans, studies on unforeseen environmental variables differing from the other permanent OMZs will forecast what is to become of our depths. oceans in regards to species, adaptations, and processes Varying oxygen concentrations did have an effect on occurring in this relatively unknown region (2).

Future research macrofaunal composition, as hypothesized. Annelids appear could include a wider measurement of other environmental most prevalent in the lowest oxygen concentrations, followed by crustaceans, molluscs, and echinoderms. Annelids are most variables besides oxygen, to better understand macrofaunal likely the best adapted to low oxygen concentrations due to composition with respect to depth. Further studies and Saltman Quarterly, Vol. 6, Nos. 1, 2 & 3

RESEARCH

30

Interspecific hybridization as a source of genetic variation in eastern Pacific Syngnathus species: Garcia, et al.

correlations between the world’s OMZs will give us insight into where the oceans are headed, as well as the impact that expanding OMZs will have on the planet.

References

1. J. Helly, L. A. Levin, Deep Sea Research. 45, 129–163 (2004).

2. L. A. Levin, Oceanography and Marine Biology: An Annual Review. 41, 1–45 (2003).

3. R. J. Diaz, R. Rosenberg, Oceanography and Marine Biology, an Annual Review. 33, 245-303 (1995).

4. L. Levin, D. Guitierrez, A. Rathburn, C. Neira, J. Sellanes, et al, Progr.

Oceanography. 53, 1–27 (2004).

5. C. Rochman, Unpublished BISP 199 individual research paper (2007).

6. L. A. Levin, C. L. Thomas, K. Wishner, Journal of Marine Research. 49, 763–800 (1991).

7. D. J. Hughes, P. A. Lamont, L. A. Levin, M. Packer, J. D. Gage, Deep Sea Research II. 8. L. A. Levin, J. D. Gage, Deep-Sea Research. 45, 129-163 (1998).

9. L. A. Levin, J. D. Gage, C. Martin, P. A. Lamont, Deep Sea Research Special Volume: Benthic Processes in the Arabian Sea. Deep Sea Research Part II. 47, 189–226 (2000).

10. J. Hyland, E. Baptiste, J. Campbell, J. Kennedy, R. Kropp, et al, Communities of the Santa Maria Basin on the California Outer Continental Shelf and Slope (2001).

11. C. R. Smith, L. A. Levin, D. J. Hoover, G. McMurtry, Deep-Sea Research Part II. 47, 227–257 (2000).

12. L. A. Levin, American Scientist. 90, 436–444 (2002).

13. L. Stramma, J. C. Johnson, J. Sprintall, V. Mohrholz, Science. 320(5876), 655–658 (2008).

Submitted for publication 7 January 2009

Interspecific hybridization as a source of genetic variation in eastern Pacific Syngnathus species Eric Garcia,1* Stuart Sandin,2 Tony Wilson3 While hybridization is thought to be an important source of genetic variation, it has not yet been reported in any syngnathid species (pipefish and seahorses). However, hybridization may contribute to genetic variation in exceptionally dense and diverse communities of Syngnathus pipefish along the coast of California and Baja California. We used both genetic and morphological analyses to investigate hybridization in Californian pipefish. A Syngnathus-specific non-coding nuclear sequence and mitochondrial DNA were obtained from distinctly preserved specimens collected from the area under investigation. Genetic results of each species were compared and used to construct a phylogeny.

In addition to successful DNA extraction and amplification from samples fixed in formalin, results documented novel Syngnathus sequences as well as a new S. exilis haplotype. Although S. exilis indicates some degree of hybridization, we were not able to attribute this variation directly to hybridization. Nonetheless, this study presents a useful framework for further research detailing the great, but unresolved, genetic variation of the eastern Pacific Syngnathus species.

Introduction

Scientists have expressed hybridization as an important source of novel genetic variation and have illustrated that interspecific hybridization may improve the ability of wild populations to adapt to new environments (1). The scientific interest in hybridization has increased over the last three decades, especially after recent improvements in molecular genetic techniques that have contributed to the discovery of many more hybrid species. These findings suggest that hybrid taxa may be more frequent than was previously thought (2, 1. UCSD, Eleanor Roosevelt College; Ecology, Behavior and Evolution Major, Class of 2010.

2. Scripps Institute of Oceanography, University of California, San Diego, La Jolla, CA, U.S.A. 3. Department of Zoological Museum, University of ZurichIrchel, Zurich, Switzerland. *To whom correspondence should be addressed. E-mail: e5garcia@ucsd.edu

3). Most cases of natural hybridization occur between closely related species. However, it was found that incidents which bring ecologically divergent parent species together could also produce a speciation event (3). Although hybridization is very common in plants, and generally very rare in animals, hybrid species are not unusual in fish (4, 5, 3). For example, the Gila seminuda population of the Moapa River, Nevada, is proposed to have a hybrid origin. Similarly, stickleback fish have been shown to have the ability to generate fertile hybrids between divergent populations from different parts of the globe (6, 7).

The Syngnathus pipefish species of the eastern Pacific Ocean could possibly be another case of interspecific hybridization. A total of eight Syngnathus species inhabit almost the entire Pacific shoreline of North, Central and South America (8). The coast of California and Baja California exclusively shelters five of these species: Syngnathus exilis, S. euchrous, S. carinatus, S. insulae, and S. californiensis (8). The particularity of the distributions

Saltman Quarterly, Vol. 6, Nos. 1, 2 & 3

RESEARCH

31

Interspecific hybridization as a source of genetic variation in eastern Pacific Syngnathus species: Garcia, et al.

Sample

Species

EG1

Syngnathus exilis Syngnathus exilis Syngnathus exilis Syngnathus carinatus Syngnathus auliscus Syngnathus insulae Syngnathus euchrous Syngnathus leptorhynchus Syngnathus leptorhynchus Syngnathus californiensis Syngnathus californiensis

exT2 exi 1-15 cari 1-15 auli 1-15 insu 1-15, EG3 euch 1-15, EG 2 lep 1-125, EG 5-6 EG 7 EG4 cali2

Sampling Location/ SIO collection # SIO# 02-71

Preservation

Donator / Source

Ethanol

HJ Walker

SIO# 02-71

Ethanol

HJ Walker

SIO# 47-106

Formalin

HJ Walker

SIO# 47-53

Formalin

HJ Walker

SIO# 50-69

Formalin

HJ Walker

SIO# 63-169

Formalin

HJ Walker

SIO# 47-68

Formalin

HJ Walker

Bred in lab 04

Ethanol

Dr. Marchetti

San Diego Bay 06

Frozen -80 C

Dr. Wilson

Mission beach 04

Dry

Dr. Marchetti

Mission beach 04

Dry

Dr. Marchetti

o

Table 1. Specimen information chart. Bold numbers specify the year of the specimen’s collection. For example, 50 = 1950, 02 = 2002, and so on.

and high density of Californian pipefish has generated scientific interest to investigate the cause of their unique high diversity. Although hybridization has never been recorded in any syngnathid species, there is evidence of interspecific mating between two other eastern Pacific pipefish, Syngnathus leptorhynchus (occurring from Alaska to Baja California) and Syngnathus auliscus (occurring from northern Peru to California), whose wide distributions overlap in Californian waters as well (1). This interspecific mating and the high diversity of Syngnathus species cooccurring in high densities in California and Baja California suggest that hybridization may be contributing variation to these Syngnathus species. By employing genetic analyses of DNA extracted from specimens preserved in an extensive variety of methods (including formalin preservation), and morphological analyses involving meristic traits quantification, this project investigated the role of hybridization as a source of genetic variation in these highly dense and diverse communities of Californian pipefish.

Materials and methods

Specimen compilation Pipefish specimens were provided by former UCSD investigator, Dr. Marchetti, and by H.J. Walker, manager of the marine vertebrate collection of Scripps Institution of Oceanography (SIO). Most of the specimens obtained from Dr. Marchetti were bred in lab, but some were captured from Mission Beach, CA. Those coming from the marine vertebrate collection were acquired from several points along the coast of California and Baja California, including the SIO pier, the bay of San Diego, and the previously mentioned Mission beach. The exact sampling coordinates of the SIO’s specimens can be found in the institution’s database using the given specimens’ collection number (Table 1).

Morphological analysis The morphological examination consisted of contrasting and identifying all pipefish according to the Syngnathus species morphological key provided by Fritzsche, which uses a meristic approach involving trunk ring, tail ring, and dorsal fin ray quantifications (8). All measurements required were performed as described by the Syngnathus species morphological key.

Genetic Analysis 1. Standard ethanol precipitation DNA extractions For ethanol-preserved, dried and frozen specimens, DNA was extracted from lateral caudal muscle tissue and isolated as indicated by the DNeasy 96 Tissue Kits for purification, using the animal DNA purification protocol.

The DNA was then diluted to a concentration of 2 ng/ μL as preparation for mtDNA and nuclear sequence analysis (1). While there were no preliminary procedures performed for frozen and ethanol-preserved samples, dry specimens were submerged in 70% ethanol for 17 days prior to the extraction. For practicality and to account for equipment limitations, few modifications were made to the DNeasy protocol. However, of the changes that were made, DNA was incubated at 65ºC rather than 70ºC. Primer 16Sar 16Sbr SlepA1f SlepA1r

Sequence CGCCTGTTTATCAAAAACAT CCGGTCTGAACTCAGATCACGT ATCTGAGCCAGCGGGCCGAGCAG TGGAGCGCGGCTTGCAGTCGTG

Analysis 16S gene mtDNA 16S gene mtDNA Nuclear Sequence Nuclear Sequence

Table 2. Primer information. All primers were obtained from Tony Wilson.

Saltman Quarterly, Vol. 6, Nos. 1, 2 & 3

RESEARCH

32 1000bp

Interspecific hybridization as a source of genetic variation in eastern Pacific Syngnathus species: Garcia, et al.

EG1-e EG2-f EG3-f EG4-d EG5-e EG6-e EG7-fz (-)

management reasons. Prior to washing, extracted tissues were submerged in 70% ethanol overnight. Then they were poured into petri dishes to be collected and placed in new tubes, where they were air-dried in an incubator at 37˚C for 55 minutes. Secondly, purified DNA was precipitated by adding approximately 2 volumes instead of 2.5 volumes of cold ethanol stored at -21˚C, rather than -80˚C. The purified DNA was then placed at -21˚C, which completed precipitation after 14 hours instead of 24 hours.

3. PCR protocol The genetic study included a Syngnathus-specific noncoding nuclear sequence and the mitochondrial 16S gene to determine maternal inherence of the examined Figure 1. 16S gene mtDNA gel electrophores showing 550-600 bp pipefish species. Both genes were amplified using a 25μL bands. EG# represents the sample’s name and the final highlighted polymerase chain reaction (PCR) protocol containing 1 letter denotes the preservation method of the sample. -e : ethanolU Taq (Promega), 2.5 μL 10X reaction buffer (Promega), preserved, -f : formalin-preserved, -d : dry sample, and –fz :frozen 2.5 mM MgCl2 (Promega), 1.0 μm dNTPs (Promega), sample. 1000 bp symbolizes a 1000 base pair bench ladder.

200 nM primers, and 20-50 ng DNA (1). Amplification EG1: S. exilis, EG2: S. euchrous, EG3: S. insulae, EG4: S. californienand sequencing of the 16S mitochondrial gene was done sis, EG5-EG7: S. leptorhynchus, (-) : negative control. with 16Sar and 16Sbr primers, and with a PCR process Secondly, DNA centrifugation for the removal of residual starting at 94°C (3 min), followed by 39 cycles of 94°C ethanol was done at the speed of 13,000 rpm instead of (30 sec), 50°C (30 sec), 72°C (1 min), 72°C (5 min) and 14,000 rpm. Thirdly, final elution was not repeated as it finishing with 14°C. Amplification and sequencing of the was irrelevant for the purpose of this research. non-coding nuclear sequence was done with SlepA1f and SlepA1r primers and with a PCR process starting at 92°C 2. DNA extraction from formalin-preserved specimens (10 sec), followed by 39 cycles of 92°C (10 sec), 59°C (30 A formalin-specific protocol outlined by Schedlock et sec), 68°C (2 min) and finishing with 14°C. al. was followed for extracting and isolating DNA from Nuclear and mitochondrial DNA sequences were specimens preserved in formalin (9). Muscle tissue was edited, compared, and analyzed with BioEdit© sequence extracted using the previous technique for all formalin- alignment editor software (10). Following this, Forcon© preserved specimens, except for S. auliscus samples, which software was utilized to convert the format of the were too small to extract enough muscle tissue. Instead, sequencing data into Mega format (11). Finally, the the complete right half of the trunk was removed, and Molecular Evolutionary Genetics Analysis© (MEGA4) chopped and used as a DNA source. Also, a small number program was used to construct a phylogeny that provides of ethanol-stored specimens were included as positive insight into the origin of genetic variation among these controls. As with the ethanol precipitation extractions, few Californian Syngnathus species (12). changes were made to the protocol for practical and time 1000 EG4 <--- lepto ---> exi bp -d 124-e 62-e 7-e 1-f 2-f

insu 2-f 3-f

euch 2-f 3-f

cari 1-f 2-f

<--- S. auliscus ---> 1-f 1*-f 2-f 2*-f

X

1000 (-) bp

Figure 2. 16S gene mtDNA gel electrophoresis showing 550-600 bp bands. 1000 bp represents 1000 base pair bench ladder, and numbers represent specimen names. EG4: S. californiensis (positive control), lepto: S. leptorhynchus (positive controls), exi: S. exilis, insu: S. insulae, euch: S. euchrous, cari: S. carinatus; S. auliscus 1*and 2* are replicates of S. auliscus 1 and 2. Final highlighted letter denotes the preservation method of the sample, -d: dry sample, -e: ethanol preserved, -f: formalin-preserved; (-) : negative control, X: extra.

Saltman Quarterly, Vol. 6, Nos. 1, 2 & 3

RESEARCH

Interspecific hybridization as a source of genetic variation in eastern Pacific Syngnathus species: Garcia, et al.

1000bp insu2-f

insu3-f

1ep62-e 1ep62-e

(-)

Figure 3. Nuclear sequence gel electrophoresis showing 550-600 bp bands. insu: S. insulae, lep: S. leptorhynchus, -e: ethanol preserved, -f : formalin-preserved, (-) : negative control.

Results

The first round of DNA extractions followed standard ethanol precipitation methods and successfully yielded genetic material from all specimens, except those stored in formalin. Extracted DNA was then used to amplify the mtDNA 16S gene. As expected, gel electrophoresis showed a band of approximately 550600 base pairs for all samples except for formalin-fixed ones, indicating the presence of the 16S gene fragment (Fig. 1). Following this, the 16S gene was effectively sequenced for specimens: EG1, EG4, EG5, EG6, and EG7.

The second set of DNA extractions followed the protocol for formalin-preserved specimens, and yielded genetic material from the ethanol-preserved positive controls, S. californiensis and S. leptorhynchus, but also from two individuals of the formalin-stored S. insulae (Fig. 2).

Finally, a total of six 16S gene sequences were obtained from S. exilis, S. californiensis, S. leptorhynchus, as well as two nuclear sequences from Syngnathus exilis

33

Figure 4. 16S gene mtDNA neighbor-joining phylogeny for the Californian S. exilis, S. californiensis, S. leptorhynchus, S. auliscus and the European S. acus (outgroup). Not scaled in time but in species genetic difference. Presented bootstrap values (91, 100, 65, 64) indicate node and branch confidence. The maximum value of 100 represents a well-supported node or branch. GenBank accession numbers for S. leptorhynchus haplotypes are as follows: E, DQ309797; H, DQ309799; G, DQ309800; and F, DQ309798.

and californiensis. These eight sequences were edited and compared with already published Syngnathus sequences to create phylogenies for both mitochondrial and nuclear sequences (Figs. 4 and 5).

Discussion

Standard DNA extractions yielded six novel 16S gene mtDNA sequences from specimens in preservations other than formalin. Remarkably, DNA extractions from formalin-fixed samples also contributed two new nuclear sequences. In addition, genetic analysis revealed a previously unknown S. exilis haplotype.

As expected, phylogenies identified the European outgroup, S. acus, as the most divergent of all species examined in this study. In agreement with Wilson, the illustrated mitochondrial phylogeny (Fig. 4) classified S. auliscus, the most widely dispersed of the analyzed pipefish (along with S. leptorhynchus), as the most genetically distinct species of Californian pipefish (1). Because S. auliscus is one of the most dispersed species, and is also the most genetically distinct, it can expected that pipefish such as S. exilis, S. euchrous, S. insulae and S. californiensis, which have restricted and overlapping ranges, are therefore more closely related. In addition, since most cases of natural hybridization occur between closely related species (3), these pipefish are more likely to be hybrid species.

Figure 5. Nuclear sequence neighbor-joining phylogeny for the Interestingly, both phylogenies illustrated S. exilis Californian S. exilis, S. leptorhynchus, S. auliscus and the European S. in multiple braches, suggesting that S. exilis is a hybrid acus (outgroup). Not scaled in time but in species genetic difference. species. In contrast, the 16S gene phylogeny exhibits Presented bootstrap values (30, 38, 21) indicate node and branch S. leptorhynchus, exilis and californiensis in a single branch, confidence. The maximum value of 100 represents a well-supported implying that all three pipefish are actually one single node or branch. species with different possible morphs. However, Saltman Quarterly, Vol. 6, Nos. 1, 2 & 3

RESEARCH

34

Interspecific hybridization as a source of genetic variation in eastern Pacific Syngnathus species: Garcia, et. al.

Species

S. exilis S. californiensis S.leptorhynchus S. auliscus S. insulae S. carinatus S. euchrous S. macrobrachium

16S gene mtDNA

Nuclear Sequence

Amplified

sequenced

Amplified

sequenced

Y

Y

Y

Y

Y

Y

Y

Y

Y

Y

Y

Y

Y

Y

Y

Y

Y

Y Y

Table 3. Final data summarizing whether or not 16S gene mtDNA and analyzed nuclear DNA sequence were amplified and sequenced from each species; Y = Yes.

discrepancies in results may be a product of misidentifying specimens and/or mixing samples while analyzing genetic data. Although genetic data presented in phylogenies can be a powerful indicator of species status, this study did not consider other important factors such as the age of the divergence of the Californian pipefish radiation.

Furthermore, only two sequences of approximately 550 bp each were analyzed per sample; hence, a larger data set and additional DNA markers are needed to make a statement about the true identity, the absolute species richness, and the role of hybridization in the eastern Pacific Syngnathus species.

An unanticipated and extremely valuable outcome was the success of the DNA extraction from pipefish stored in formalin. This DNA extraction protocol will permit researchers to obtain DNA sequences from samples found at the many aquariums, museums, universities and other institutions that possess a formalin-preserved fish collection. By successfully amplifying DNA from two 46 year-old S. insulae individuals, the extractions were proven to work efficiently with specimens collected more than four decades ago. However, DNA yields were lower in quantity and quality when using older specimens, suggesting that higher quality sequences should be obtained from younger specimens, which are extensively abundant in natural collections.

In summary, while the formalin protocol will be greatly valuable to a broad array of investigations, this study mainly serves as a framework for further research in the status of the eastern Pacific Syngnathus species. Due to time restrictions, the genetic data obtained was limited, producing results that offered suggestions rather than definite answers. Nevertheless, our presented framework sets the basis for supplementary genetic analysis that can demonstrate definitively whether these pipefish are phenotypically plastic or species abundant. Additional research, therefore, has the potential to lower the species number of what is currently regarded as the highly diverse Californian Syngnathus pipefish.

Future studies and limitations

In order to better understand the origin of diversity and phylogenetic relationships between these organisms, further investigation is encouraged in at least two directions: the completion of this project by sampling missing species and including supplementary sequences, or the development of a new study enclosing additional nuclear and/or mtDNA markers. There are strong suggestions that further analysis has the potential to report for the first time hybridization in any Syngnathidae species, and unmask the true identity of these pipefish species. Additional analyses will most likely provide significant insights into the origin of the high diversity among these Syngnathus species.

Potential sources of error could have been the resolving power of the markers used, and the possibility of specimen misidentification and/or mixing during genetic analysis.

Nonetheless, time was the most prevalent limiting factor of this study. This included issues such as gathering pipefish specimens in the allotted time, delays in the arrival of some specimens, the long duration of protocols, and the time consuming final genetic analysis.

Acknowledgements

I would like to express my gratitude to Kai Stoelting for helping supervise my project, to my great and always smiling lab partners for the extra tutoring, and to Dr. Wilson, Dr. Michael and Dr. Denise Hengartner for their support and hospitality at the University of Zurich. Equally sincere is my gratitude to donors of specimens and to all the people who assisted me at my home institution, especially Dr. Jacquie Azize for always being enthusiastic and supportive about my project. Finally, I am especially grateful to those who financially nourished this research endeavor.

References

1. A.B. Wilson, Molecular Ecology. 15, 909–824 (2006).

2. K. Mebert, Molecular Ecology. 17, 1918–1929 (2008).

3. O. Seehausen, Trends in Ecology and Evolution. 19, 198–207 (2004).

4. T.E. Dowling, C.L. Secor, Annual Review of Ecology and Systematics.

28, 593–619 (1997).

5. S. Roques, J.M. Sevigny, L. Bernatchez, Molecular Ecology. 10, 149–165 (2001).

6. P.F. Colosimo, K.E. Hosemann, S. Balabhadra, G. Villarreal Jr., M. Dickson, et al, Science. 307, 1928–1933 (2005).

7. B.D. DeMarais, T.E. Dowling, M.E. Douglas, W.L. Minckley, P.C. Marsh, Proc. Natl. Acad. Sci. U.S.A. 89, 2747–2751 (1992).

8. R.A. Fritzsche, Proc. Natl. Acad. Sci. U.S.A. 42(6), 181–227 (1980).

9. A.M. Shedlock, M.G. Haygood, T.W. Pietsch, P. Bentzen, BioTechniques.

22, 394–400 (1997).

10. T. Hall, BioEdit : biological sequence alignment software version 7.0.9 (Caredata.com, Inc., 1999; www.mbio.ncsu.edu/BioEdit/bioedit.html) 11. J. Raes, Y. Van de Peer, ForCon : a software tool for the conversion of sequence alignments (EMBnet.news 6(1), 1999; www.vulcan.rug. ac.be/~jerae/ForCon/index.html).

12. K. Tamura, J. Dudley, M. Nei, S. Kumar, MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0.

(Molecular Biology and Evolution 24, 1596–1599, 2007; http://www. megasoftware.net/mega.html).

Submitted for publication 28 March 2009

Saltman Quarterly, Vol. 6, Nos. 1, 2 & 3

RESEARCH

35

Mechanisms and applications of adult neurogenesis: Morcos

REVIEW Mechanisms and applications of adult neurogenesis Ari Morcos1* Introduction

Adult neurogenesis is one of the most interesting and promising fields in biomedical science today.

Though contrary to centuries of dogma, adult humans do grow new neurons in an incredibly complicated, yet fascinating process. Not only does adult neurogenesis elucidate the remarkable plasticity of the adult brain, but many researchers also believe it is the key to curing such neurodegenerative diseases as Alzheimer’s, Parkinson’s, and epilepsy. In the decade or so since the popularization of adult neurogenesis, the field has raced forward, and there are currently close to 3,000 articles on the topic. This review will provide a general overview of the field as it stands today, and will explain the hypes and hopes of adult neurogenesis.

A Brief History of Adult Neurogenesis

In the early twentieth century, Santiago Ramón y Cajal propelled the field of neuroscience forward and has since become known to many as the “Father of Neuroscience.” However, he also established the dogma that neurons do not grow in the adult brain, stating that “once development was ended, the founts of growth and regeneration of the axons and dendrites dried up irrevocably. In adult centres the nerve paths are something fixed, ended, immutable. Everything may die, nothing may be regenerated” (1). This belief went unquestioned until 1965 when Joseph Altman and Gopal Das showed that when the dentate gyrus of adult rats was injected with thymidine-H3, a marker used only by pre-mitotic cells, many cells showed positive for the marker, suggesting that mitosis was present in the adult rodent brain (2). Altman went on to suggest that neurogenesis was present in both the guinea-pig and the cat (3, 4). However, due to lack of substantiation, his findings were ignored and adult neurogenesis remained a myth until the 1980s when 1. UCSD, Revelle College, Physiology and Neuroscience major, Class of 2011 *To whom correspondence should be addressed. E-mail: arimorcos@gmail.com.

Saltman Quarterly, Vol. 6, Nos. 1, 2 & 3

Steve Goldman’s contention that adult neurogenesis existed in the adult canary was accepted (5, 6).

Following that discovery, a flurry of articles appeared, eventually showing that groups of stem cells exist in the brain (known as neural stem cells or NSCs) in two regions, the subventricular zone (SVZ) and the subgranular zone (SGZ) (7). In 1996, Fred Gage showed that the hippocampus of adult rats produced new neurons (8). Finally, in 1998, Gage’s lab showed adult neurogenesis in the adult human hippocampus, proving once and for all that neurons do regrow (9).

Neurogenesis in the Subgranular Zone of the Hippocampus

Adult neurogenesis in the hippocampus occurs in the dentate gyrus, in an area beneath the granule cell layer (hence the name, subgranular zone).

Neurogenesis in this region progresses through four phases: a precursor cell phase, an early survival phase, a postmitotic maturation phase, and a late survival phase (10, 11). In the precursor phase, the cells that will differentiate into neurons undergo proliferation and show signs of multipotency and self-renewal (12). In the early survival phase, the cells are still proliferative, but begin to develop dendrites and axons. In the postmitotic maturation phase, the cells begin to develop dendritic spines and axon elongation occurs (13).

Finally, in the late maturation phase, the cells integrate into the neural network and become indistinguishable from mature adult neurons. This entire process takes approximately seven weeks and results in new, fullyfunctional neurons (10).

Neurogenesis in the Subventricular Zone and the Olfactory Bulb

Neurogenesis in the SVZ is an incredibly complex process that creates new interneurons for the olfactory bulb (OB), the area of the brain that processes odors.

Neurogenesis begins in the SVZ, a region below the lateral ventricles of the brain. Three types of cells are involved in this process: type-A cells, type-B cells, and type-C cells. Type-A cells function as migratory neuroblasts (14). Type-B cells act as astrocytes and are the SVZ stem cells, with the potential to differentiate into oligodendrocytes and interneurons (15). Finally, type-C cells act as a rapidly dividing intermediate between type-B cells and type-A cells (16). In vivo, the lineage of these cells is type-B to type-C to type-A (10). Once type-A cells are created in the SVZ,

REVIEW

36

Mechanisms and applications of adult neurogenesis: Morcos

they travel to the Rostral Migratory Stream (RMS).

From there, they form a chain and migrate at speeds reaching 120 μm/hr to the OB (17). Once they reach the OB, type-A cells differentiate into granule cells or periglomerular cells and integrate themselves into the existing neuronal circuitry. This remarkable plasticity proves the existence of an SVZ NSC, leading to their in vitro culture, in which they can differentiate into astrocytes, oligodendrocytes and neurons (18).

Functional Implications of Adult Neurogenesis

Concluding Thoughts and Questions for the Future

In the time since the discovery of adult neurogenesis, the field has made remarkable progress. Neurogenesis has been proven to occur across all mammalian species, including humans. Moreover, the mechanisms of both SVZ and SGZ neurogenesis have been discovered and although the functional significance of newborn neurons is not yet clear, they are most definitely serving some function. Neurogenesis has also been related to and suggested as a possible cause of several diseases common today. However, many questions have yet to be answered. For example, what is the exact functional role of adult neurogenesis, and what are the factors driving it? What causes deficiencies in neurogenesis and how are these deficiencies related to disease?

What is the molecular basis for in vivo neurogenesis?

The answers to these questions will help us to better understand adult neurogenesis and may hold the key to life-saving technologies.

The functional implication of adult neurogenesis is one of the most debated areas within the field. One of the links most consistently suggested has been that between neurogenesis and learning or the creation of new memories (19, 20, 21). These articles show that animals with reduced hippocampal function (usually induced by radiation) display impaired memory and learning. Furthermore, several studies have suggested that the cognitive decline associated with aging is due to decreased neurogenesis (22, 23). However, some References 1. S. Ramón y Cajal, J. DeFelipe, E.G. Jones, Cajal’s Degeneration and studies have disputed this contention, showing no Regeneration of the Nervous System (New York, Oxford University Press, correlation between the level of neurogenesis and 2. 1991).

J. Altman, G.D. Das, Journal of Comparative Neurology. 124, 319–& (1965). memory (24). Thus, it is clear that further study is 3. J. Altman, G.D. Das, Nature. 214, 1098–& (1967).

4. G.D. Das, J. Altman, Brain Res. 30, 323–330 (1971). needed to resolve the issue.

5. S.A. Goldman, F. Nottebohm, Proc. Natl. Acad. Sci. U.S.A. 80, 2390-2394

Neurogenesis and Its Potential Applications to Disease

One of the primary reasons for the hype surrounding the discovery of adult neurogenesis was the realization of the many and varied applications of neurogenesis to disease. Though many cures may benefit from neurogenesis, two that seem to have the most hope are Alzheimer’s disease and Parkinson’s disease.

Studies regarding Alzheimer’s disease have shown that there is decreased neurogenesis in Alzheimer’s patients relative to normal adults (25). Further studies have suggested that the absence of certain cholinergic neurons (often found in Alzheimer’s patients) which normally innervate the hippocampus results in a significant decrease in the survival of new neurons in the dentate gyrus (26). This evidence suggests a clear link between the onset of Alzheimer’s and neurogenesis. Recent research into Parkinson’s disease has shown that overexpression of alpha-synuclein, a protein which accumulates in Parkinson’s patients, in animal models decreases the survival of newborn neurons in the SVZ and the SGZ (27). Thus, it is clear that deficiencies in neurogenesis have a major effect on normal physiological function and may contribute to neurodegenerative diseases.

Saltman Quarterly, Vol. 6, Nos. 1, 2 & 3

(1983).

6. S.A. Goldman, A. Zaremba, D. Niedzwiecki, J. Neurosci. 12, 2532–2541 (1992).

7. D. L. Stemple, D.J. Anderson, Cell. 71, 973–985 (1992).

8. H.G. Kuhn, H. Dickinson-Anson, F.H. Gage, J. Neurosci. 16, 2027–2033 (1996).

9. P.S. Eriksson, E. Perfilieva, T. Bjork-Eriksson, A.M. Alborn, C. Nordborg, et al, Nat. Med. 4, 1313–1317 (1998).

10. F. Gage, G. Kempermann, H. Song, Adult Neurogenesis (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 2008).

11. G. Kempermann, S. Jessberger, B. Steiner, G. Kronenberg, Trends Neurosci. 27, 447–452 (2004).

12. T. D. Palmer, J. Takahashi, F.H. Gage, Mol. Cell Neurosci. 8, 389–404 (1997).

13. C. Zhao, E.M. Teng, R.G. Summers, Jr., G.L. Ming, F.H. Gage, J. Neurosci. 26, 3–11 (2006).

14. J. M. Garcia-Verdugo, F. Doetsch, H. Wichterle, D.A. Lim, A. Alvarez-Buylla, J. Neurobiol. 36, 234–248 (1998).

15. B. Menn, J.M. Garcia-Verdugo, C. Yaschine, O. Gonzalez-Perez, D. Rowitch, et al, J. Neurosci. 26, 7907–7918 (2006).

16. F. Doetsch, J.M. Garcia-Verdugo, A. Alvarez-Buylla, J. Neurosci. 17, 5046– 5061 (1997).

17. H. Wichterle, J.M. Garcia-Verdugo, A. Alvarez-Buylla, Neuron. 18, 779– 791 (1997).

18. F. H. Gage, J. Ray, L.J. Fisher, Annu. Rev. Neurosci. 18, 159–192 (1995).

19. K. Jaako-Movits, A. Zharkovsky, Eur. J. Neurosci. 22, 2871–2878 (2005).

20. T. J. Shors, D.A. Townsend, M. Zhao, Y. Kozorovitskiy, E. Gould, Hippocampus. 12, 578–584 (2002).

21. G. Winocur, J.M. Wojtowicz, M. Sekeres, J.S. Snyder, S. Wang, Hippocampus.

16, 296–304 (2006).

22. J. L. Bizon, M. Gallagher, Eur. J. Neurosci. 18, 215–219 (2003).

23. E. Drapeau, W. Mayo, C. Aurousseau, M. Le Moal, P.V. Piazza, et al, Proc.

Natl.Acad. Sci. U.S.A. 100, 14385–14390 (2003).

24. D. A. Merrill, R. Karim, M. Darraq, A.A. Chiba, M.H. Tuszynski, J. Comp.

Neurol. 459, 201–207 (2003).

25. K. Boekhoorn, M. Joels, P.J. Lucassen, Neurobiol. Dis. 24, 1–14 (2006).

26. C. M. Cooper-Kuhn, J. Winkler, H.G. Kuhn, J. Neurosci. Res. 77, 155–165 (2004).

27. B. Winner, E. Rockenstein, D.C. Lie, R. Aigner, M. Mante, et al, Neurobiol.

Aging. 29, 913-925 (2008).

Submitted for publication 25 March 2009

REVIEW

37

From visual prostheses to stem cells: Annaamalai

REVIEW From Visual Prostheses to Stem Cells Muthu Annaamalai1* Neural Prostheses

The field of neural prostheses emerged based upon the principle that nerves send signals via electrical impulses. Therefore, since electrodes also produce electrical signals, they can be used to bypass damaged nerves. Although the field of neural prostheses is only 50 years old, it has reached unimaginable successes, which include the use of pure thought to control the motions of a robotic arm. Neural prostheses have been important in Deep Brain Stimulation treatment of patients with Parkinson’s disease, have restored hearing to deaf individuals through cochlear implants, and have restored mobility to disabled people with artificially functional limbs. Ultimately, the field of neural prostheses has been able to provide a higher standard of life to those suffering from neural damage.

Yet despite these successes, the field has not yet achieved a satisfactory solution for restoring vision through prostheses.

Visual Prostheses—Cortical Implants

One of the first attempts at visual prostheses was to create a cortical implant that would send images directly to the visual cortex. The most famous cortical implant was produced by Dr. William H. Dobelle of the Dobelle Institute. His first prototype came out in 1978, but only his second generation prototype, which came out in 2002, was commercially available. The second prototype was first implanted in patient Jens Naumann, a man with acquired blindness.

The Dobelle implant requires computer jacks to be mounted on both sides of the skull and electronic implants encased in biocompatible plastic to be directly mounted on the surface of brain. The overall device is composed of three parts: (1) a miniature video camera mounted on eyeglasses, (2) a 5 kg computer processor that converts the image into brain signals, and (3) platinum electrode array implants that stimulate the visual cortex (1).

However, even with this implant, the best resolution a person can obtain is 144 (12x12) pixels. Fig. 2 shows

Figure 1. Diagram of Dobelle Cortical Implant (1).

an enlarged 144 pixel image and the same image in 16384 pixels (2). As can be seen, it is difficult to make out objects in the 12x12 image, although it is an improvement over blindness. The device also requires the user to teach his or her brain to interpret the image, which is composed of dots from the implanted electrodes. Additionally, the need to constantly carry around a computer and have computer jacks mounted on the skull can be uncomfortable and restrictive for the user.

Further work on this implant receded when funding was cut due to the death of the main researcher, Dr. Dobelle. Soon after Dr. Dobelle’s death, it became necessary for Jens Naumann to have the implants removed due to brain tissue scarring, which caused the device to not work properly (3).

Visual Prostheses—Retinal Implants

Currently, researchers have moved away from external cortical implants and are looking into retinal implants that can either be implanted subretinally (behind the retina) or epiretinally (on the retina).

These two methods assume that the ganglion cells and

1. UCSD, Revelle College, Bioengineering major, Class of 2009. *To whom correspondence should be addressed. E-mail: mannaama@ucsd.edu.

Saltman Quarterly, Vol. 6, Nos. 1, 2 & 3

Figure 2. (left) 144 pixels (right) 16384 pixels (2)

REVIEW

38

From visual prostheses to stem cells: Annaamalai

Figure 3. Retinal Implant by Dr. Humayun, et al. (5).

optic nerve are still intact, and therefore only replace the function of the photoreceptor cells. This provides limited vision restoration to those individuals suffering from photoreceptor degeneration diseases such as Retinitis Pigmentosa and Macular Degeneration.

The first retinal implants were created by a team led

by Dr. Mark Humayun of the Doheny Eye Institute in 1996. Their design makes use of a camera mounted on glasses and epiretinally implanted electrodes. These electrodes send signals to the ganglion cells, which in turn produce percepts of images in the brain through the optic nerve. The camera sends signals to activate corresponding electrodes that produce the proper image (4). The key to this implant was the creation of a safe method to power the electrodes. This retinal implant has since been successfully tested on six patients with Retinitis Pigmentosa, and has provided them with limited restoration of vision. However, as mentioned earlier, this device only works in patients with a viable neuronal pathway to the brain. Additionally, it may cause retinal damage due to heat dissipation of the power source.

Another approach to retinal implants is the Artificial Silicon Retina chip designed by brothers, Drs. Alan Chow and Vincent Chow in 2004. They created a 2 mm microchip with 5,000 microphotodiodes that can convert light energy into electrical impulses without the need for an external power source. However, it is doubtful that even bright sunlight would produce the power for the microamps of current necessary to stimulate photoreceptors extracellularly. This treatment also assumes that the ganglion cells and optic nerve of the patient are still viable in order for signals from the photodiodes to be sent to the brain. Clinical studies of six patients with Retinitis Pigmentosa show that these chips provide some increase in visual acuity; however, the improvements in vision Figure 4. ASR chip implanted subretinally (6).

Saltman Quarterly, Vol. 6, Nos. 1, 2 & 3

were not solely at the location of the Artificial Silicon Retina chip (6). This suggests that although the chip did not directly stimulate the activity of retinal cells, it may have induced protective neurotrophic growth factors that caused existing retinal cells to regain their function.

Currently, one of the most novel retinal implant approaches is the Biohybrid Retinal Implant designed

by Dr. Yagi and his team. They are hoping to transplant cultured neurons that can act as “living electrical cables” to connect the electrodes to the visual cortex.

Axons of the transplanted neurons will be guided with an axon-guiding material such as a peripheral nerve graft filled with Schwann cells and extracellular matrix (7). This approach is more applicable to all blind diseases since the retinal ganglion cells and optic nerve do not need to be intact. An update article published in 2005 states that the team is working on guiding neural axons on microelectromechanical systems (MEMS) by a peripheral nerve graft (8). However, there has been no additional news on the successes and failures of this hybrid retinal implant since then. .

Visual Prostheses­—The Future

The current lack of success of neural prostheses in restoring vision is due to the fact that the human eye is such a complex system. The eye is capable of converting brightness and wavelengths of light to complex images of the world we can see. Our vision is capable of detecting subtle changes in intensity, directing attention to regions of interest, producing depth perception, and filling in missing parts in the image such as for the optic nerve blind spot, among other fascinating abilities. Therefore, trying to recreate full functionality of human vision with a microarray of electrodes and other electronic implant technologies is infeasible. This suggests that the ultimate future of retinal prostheses is not with prostheses, but rather with stem cells and regenerative medicine. This new direction promises the regeneration and replacement of lost retinal cells to restore full vision.

Dr. Young and Dr. Lashkari of the Shepens Eye Research Institute have had major breakthroughs in vision restoration via stem cells. Through the use of discarded retinal scar tissue from retinal reattachment surgery in premature babies, Dr. Lashkari found that progenitor cells are the key to vision restoration.

Progenitor cells are an advanced, more mature stage of stem cells that are already restricted as to what they can differentiate into. By testing in vitro, Dr. Lashkari found that the progenitor cells grew into retinallike tissue (9). Dr. Young then used this discovery to implant progenitor cells from newborn mice into blind adult mice. He used retinal stem cells from “green mice” that have fluorescent tissue and injected them into blind mice. This allowed him to track the growth

REVIEW

39

From visual prostheses to stem cells: Annaamalai

advances. The capacity of the body to use its own cells for regeneration truly is brilliant, and we have just begun to tap into this amazing ability.

The Impact of Stem Cell Therapy

Figure 5. Schematic of Biohybrid Retinal Implant (7).

of the injected fluorescent cells (10). He tested the treated mice against a control group and found that the treated mice were able to respond to much lower levels of light. This indicated that their vision had improved.

Dr. Young is currently working on using scaffolds of polymers to grow stem cells, so that sheets of cells can be implanted. A main factor in this method, however, is that fetal stem cells are necessary from the second trimester of pregnancy. This means that a method to create a sustainable supply of progenitor cells will need to be devised, so that cells do not need to be removed from the fetus.

Researchers at the University College London Institutes of Ophthalmology and Child Health and Moorfields Eye Hospital were able to produce similar results with progenitor cells. They have also performed studies solely on mice, but have yet to reach clinical study stages. However, they have developed a research map to lead to clinical studies. The first step is to extract and clone adult cell DNA to produce an embryonic stem cell. The second step is to differentiate the stem cell into embryonic photoreceptor cells in vitro. The last step, which has already been developed, is a method to transplant the cells to allow for maximal integration with existing retinal cells. This method involves slicing the retinal tissue tangentially to produce a sheet of photoreceptors that allows for maximal integration (11). With these steps in mind, further development of stem cell therapy for vision restoration is bound to occur.

In China, where stem cell research has proliferated due to fewer governmental regulations, greater advances in stem cell therapy for vision restoration have been made. Macie Morse, a 16-year-old from Colorado born with optic nerve hypoplasia, suffers from a condition where the optic nerve does not fully develop. Her optic nerve was re-grown using umbilical cord stem cells by Beike Biotech, an expanding stem cell research company in China. With a restored optic nerve, Macie has regained her sight and has even obtained a drivers’ permit. These are successes visual prostheses has been struggling for years to achieve (12).

Research funds for stem cell research will most likely increase greatly in the next couple years due to the promising results that have already been witnessed, which in turn will result in great stem cell therapy Saltman Quarterly, Vol. 6, Nos. 1, 2 & 3

Stem cells are currently being used in other neural areas besides vision restoration. Progress has already been made in differentiating stem cells into hair cells, which are the specialized sensory receptors in the inner ear. The degeneration of these hair cells is generally the cause of hearing loss (13). Stem cells have also been used in spinal cord defects and have the potential to cure Parkinson ’s disease, among other neural diseases.

Stem cells show great promise in remedies for many of the disorders of the central and peripheral nervous system faced today. Although some other parts of the body may continue to grow and regenerate throughout life, the brain, spinal cord, and visual and auditory systems do not (9). Therefore, damage to any of these areas cannot be automatically mended by the body.

However, stem cells have the capability to differentiate into the damaged neural cells of these tissues, and restore proper function. With this new tool, and possibly relaxed stem cell research regulations by the government, the potential for advances seems boundless.

References

1. CBS News, “The Jens Naumann Story – Out of the Dark” (05 January 2003, Accessed 17 March 2009; www.cbc.ca/sunday/sight/procedure.html).

2. P. Meijer, “Artificial Vision for the Blind” (17 March 2009, Accessed 17 March 2009; www.seeingwithsound.com/etumble.htm).

3. “Cheri Robertson: Robochick - Bionic Eye” (UK Extraordinary People Series, 23 July 2008, Accessed 17 March 2009; www.mymultiplesclerosis. co.uk/misc/robochick.html).

4. M. S. Humayun, E. De Juan Jr., G. Dagnelie, R. J. Greenberg, R. H. Propst, et al, Arch Ophthalmol. 114, 40–46 (1996).

5. J. Randerson, “Robotic Retina Offers Second Chance for Sight” (Guardian News and Media, 16 February 2007, Accessed 17 March 2009; www. guardian.co.uk/technology/2007/feb/16/news.medicineandhealth).

6. A. Y. Chow, V. Y. Chow, K. H. Packo, J. S. Pollack, G. A. Peyman, et al, Arch Ophthalmol. 122, 460–469 (2004).

7. M. Shimizu, T. Yagi, “Visual Prostheses” (Accessed 17 March 2009; www. io.mei.titech.ac.jp/research/retina/).

8. T. Yagi, M. Watanabe, Y. Ohnishi, S. Okuma, T. Mukai, “Biohybrid hRetinal Implant: Research and Development Update in 2005” (Proc. 2nd Int. IEEE EMBS Conf. Neural Engineering (EMBC’2005), Arlington VA, 2005).

9. K. Lashkari, M. Young, Sightings. 5–7 (2007).

10. M. A. Shatos, K. Mizumoto, H. Mizumoto, Y. Kurimoto, H. Klassen, et al, E-Biomed: The Journal of Regenerative Medicine. 2, 13–15 (2001).

11. R E. MacLaren, R.A. Pearson, “Stem Cell Therapy and the Retina” (Cambridge Ophthalmology Symposium Lecture, 2006; www.nature.com/ eye/journal/v21/n10/full/6702842a.html).

12. S. Boyd, “Chinese Stem Cell Therapy Helps Girl See” (CBS News, 10 March 2009; www.cbsnews.com/stories/2009/03/10/national/ main4856566.shtml?source=RSSattr=HOME_4856566).

13. R. Salvi, “Stem Cells and the Inner Ear” (02 February 2005, Accessed 17 March 2009; www.isscr.org/public/ear.htm).

Submitted for publication 2 April 2009

REVIEW

40

BISP 196: Senior Honors Theses Abstracts

SENIOR HONORS THESES ABSTRACTS The Division of Biological Sciences Senior Honors Thesis Program (BISP 196) is open to undergraduate biology majors who have an overall, and major, GPA of 3.7 or higher, have senior standing, and commit to three consecutive quarters of research during their senior year. The goals of the program are to increase one-to-one interaction between students and faculty and to encourage more biology majors to pursue independent research. Each student in the program has a faculty mentor who provides guidance to the student during the year. In spring quarter each year, students in the honors thesis program participate in a poster session that showcases their research, and gives them the opportunity to discuss their research with faculty and their fellow students. Below are abstracts of all the outstanding research projects conducted by undergraduates in the program during the 2008-2009 academic year.

The identification of conserved enhancer regions from the msh gene in Drosophila melanogaster Michael Harabaglia, Thurgood Marshall College, Biology: Bioinformatics Major, Class of 2009 PI: Ethan Bier, Ph.D., Professor of Biology, UCSD Division of Biological Sciences

Abstract

In genetics, an enhancer represents a short region of DNA that can bind activator proteins. Binding in this region can initiate the transcription of a nearby gene or a gene on a separate chromosome. This increase in transcription is due to the recruitment of transcription factors by the activators, which enhances the binding of RNA polymerase. The main objective in this study is to use a bioinformatics approach to determine the conserved enhancer region in the msh gene which is involved in the patterning of the neuroectoderm in flies. This information can then be utilized to provide a reliable and testable prediction of the conserved mechanism for patterning in the ectoderm. These results can then be used to determine the level of enhancer conservation in species as far ranging as Drosophila melanogaster, the beetle, bee, mosquito, and eventually the zebra fish. The methodology is comprised entirely of bioinformatics tools, including both unpublished programs and published programs such as ClustalW and BigFoot. As of now, significant conservation has been found throughout the Drosophila genome, and modifications are being made to identify highly significant hits in the organisms mentioned above. It is hypothesized that the mechanism for neuroectoderm patterning is highly conserved, and therefore patterns with high significance will be found in the beetle, bee, mosquito, and zebra fish genomes.

These results would imply that that the sensitivity of the msh gene to BMP signaling in vertebrates has the same mechanism as that in Drosophila melanogaster, and does not follow the inverted mechanism currently accepted in academia.

Regulation of cystic fibrosis transmembrane conductance regulator biogenesis by arachidonic acid metabolizing proteins 12/15-LO and Cyp4B1 Damian Tse Chun Ng, Thurgood Marshall College, Biochemistry and Cell Biology Major, Class of 2009 PI: Christopher Glass, M.D., Ph.D., Professor of Cellular and Molecular Medicine, Professor of Medicine, UCSD School of Medicine, Cellular and Molecular Medicine Department

Abstract

Cystic fibrosis is a hereditary disease caused by mutations in the cystic fibrosis transmembrane conductance regulator (CFTR), an apical membrane chloride channel. These mutations lead to CFTR misfolding and premature degradation, resulting in the loss of functional CFTR from the apical membrane. Efforts to develop therapeutic treatments for cystic fibrosis are aimed at modulating and improving CFTR folding. Patients with cystic fibrosis are characterized with altered fatty acid metabolism, particularly showing increased arachidonic acid levels. From these observations, we hypothesize that arachidonic acid metabolites are implicated in CFTR folding, and we investigate the effects of arachidonic acid-metabolizing proteins 12/15-lipoxygenase (12/15-LO) and cytochrome P450 Cyp4B1 on CFTR biogenesis. Preliminary overexpression studies show that while 12/15-LO has no effect on CFTR, Cyp4B1 reduced CFTR maturation. Protein immunoblot data in COS-7 cells overexpressing CFTR and Cyp4B1 show reduced mature CFTR, and an accumulation of immature CFTR. This accumulation suggested the possibility that Cyp4B1 may inhibit CFTR degradation by ubiquitination. However, treatment with proteasome inhibitor MG-132 did not reveal any differences in polyubiquitinated CFTR, suggesting that Cyp4B1 is not implicated in CFTR ubiquitination and degradation.

Further experiments are in progress to determine the specific mechanism for Cyp4B1 inhibition of CFTR biogenesis and maturation.

Saltman Quarterly, Vol. 6, Nos. 1, 2 & 3

RESEARCH

41

BISP 196: Senior Honors Theses Abstracts

Phosphorylation of Rpt6 by CaMKII is responsible for localization of 26S proteasome at synapses Carissa Chu, Warren College, Human Biology Major, Class of 2010 PI: Gentry Patrick, Ph.D., Assistant Professor of Biology, UCSD Division of Biological Sciences Abstract

The ubiquitin-proteasome system (UPS) is the main eukaryotic pathway for protein degradation. In neurons, degradation of synaptic proteins by the 26S proteasome is important for activity-induced plasticity of synaptic connections. In this study, we investigate the role of calmodulin-dependent kinase II (CaMKII) in regulating activity of the proteasome. CaMKII is a calcium-dependent protein kinase highly expressed in neurons, and it plays a central role in synaptic plasticity. Previous work in the Patrick lab determined that CaMKII regulates the function of the proteasome by phosphorylating Rpt6, a subunit of the 19S regulatory cap. Here, we show that CaMKII regulates proteasome function by increasing its distribution at synapses.

Overexpression of a constitutively active CaMKII induces robust accumulation of Rpt6 along dendrites and at dendritic spines. This observation is consistent with our previous studies, which show increased proteasome trafficking in response to NMDA receptor activation and calcium influx. Using site-directed mutagenesis and immunofluorescence imaging, we also found that the Ser 120 residue on Rpt6, a target phosphorylation site for CaMKII, is involved in induced trafficking of proteasomes to dendritic spines. We compared the effects of phospho-mimicking (S120D) and phospho-dead (S120A) Rpt6 point mutants on Rpt6 localization in neurons. Preliminary data show a significant increase in proteasome concentration at synapses in neurons expressing phospho-mimicking (S120D) Rpt6, and no significant change in trafficking in neurons expressing phospho-dead (S120A) Rpt6. As a follow-up study, we will use time-lapse imaging to determine the effects of Rpt6 phospho-mutations on trafficking into dendritic spines upon stimulation. Altogether, our data suggest that CaMKII phosphorylation at Ser120 on the Rpt6 subunit is a key regulated step in activity-dependent protein degradation in neurons.

High-resolution metagenomic characterization of salt-impacted microbial communities Tobin J. Hammer, Eleanor Roosevelt College, General Biology Major, Class of 2009 PI: Eric Allen, Ph.D., Assistant Professor of Biology/Marine Biology, UCSD Division of Biological Sciences, Scripps Institution of Oceanography

Abstract

The community genomics approach can provide insight into the ecological and evolutionary dynamics of microbes as they exist in nature. However, the high diversity of most microbial communities precludes genome assembly from all but the most “extreme” habitats. Aquatic environments with 20–30% salt are typically dominated by one or a few species of haloarchaea and provide a tractable system for metagenomic characterization.

We analyzed more than 500,000 shotgun and fosmid end-sequences from spatiotemporally distinct sites in the hypersaline Lake Tyrrell system, aiming to reveal the ecological structure and functional potential of halophile communities and their response to salinity and seasonal changes. Bioinformatic binning of assembled fragments and unassembled reads indicated a replacement of haloarchaea by bacteria in lower-salinity samples, as well as a shift in taxonomic composition between winter and summer samples.

A shotgun sequence assembler reconstructed the near-complete genomes of two novel, coexisting species of Haloquadratum, a globally distributed, square-shaped haloarchaeon. In addition to genome assembly, the deep level of metagenome sequencing enabled the analysis of patterns of genetic variation among individuals using alignment tools.

The two Haloquadratum populations are relatively clonal and resistant to interspecific recombination, supporting previous assertions that the species is coherent. In contrast, other haloarchaeal populations are significantly more variable, containing a high abundance of single nucleotide polymorphisms and other forms of genetic heterogeneity. This variability most likely affected genome assembly for these groups, which was less successful despite a very large amount of available sequences.

Using metagenomic data, we have reconstructed novel Haloquadratum genomes directly from the environment, and show that salt-impacted communities are dynamic consortia responsive to environmental fluctuations and composed of populations with distinct evolutionary signatures.

Saltman Quarterly, Vol. 6, Nos. 1, 2 & 3

RESEARCH

42

BISP 196: Senior Honors Theses Abstracts

Using an LCMV peptide as a vaccine model antigen Elisabeth Crow-Lucal, Eleanor Roosevelt College, Human Biology Major, Class of 2009 PI: Shane Crotty, Ph.D., Associate Professor, Division of Vaccine Discovery, La Jolla Institute for Allergy and Immunology, UCSD School of Medicine, Division of Infectious Disease

Abstract

Germinal centers are essential for the generation of long-term immunity due to their role in the differentiation of long-lived plasma cells and memory B cells. Because nearly all vaccines are protein based, it is important to understand germinal center formation and regulation induced by individual protein antigens within the broader context of an infection. In order to study the immune response to a protein antigen, many groups have used the ovalbumin (OVA) model antigen system. Because OVA is not expressed by any pathogen, an anti-OVA immune response tends to be very weak and not comparable to the immune response against a typical infection. Consequently, the OVA system is not ideal for the study of vaccine development. To develop a more physiologically relevant system, we fused the LCMV gp61 minimal CD4 T cell epitope (amino acids 66-77) with the gp2 protein that is recognized by B cells. The resulting fusion peptide enables LCMV gp1-specific CD4 T cells such as SMARTA TCR transgenic cells to provide antigen-specific help to gp2-specific B cells. We have shown that this peptide can be used to study the germinal center reaction using far lower and more physiological concentrations of antigen and antigen-specific CD4 T cells than are used in the OVA system.

Growth parameters of Nannochloris oculata and its contribution to biofuel Chun Fang Cheng, Thurgood Marshall College, Biochemistry and Cell Biology Major, Class of 2009 PI: Gregory Mitchell, Ph.D., Research Biologist, Scripps Institution of Oceanography

Abstract

The Scripps Photobiology Group (SPG) lab is focused on characterizing microalgae physiology in terms of growth models for various species and evaluating microalgal potential for commercialized biofuel. The SPG group is interested in answering the various questions regarding biofuel production and environmental concerns.

One question that the algal-biofuel researchers are currently trying to answer is what species should be used. Species and strain selection are the most basic aspects of this effort. Research into species selection will provide support for what algae should be put into large ponds and bioreactors for fuel production. One aspect of this selection research is being able to predict the growth models, and providing evidence that such a growth model will succeed on a larger scale. The factors that need to be considered when designing a growth model are variables such as pH, salinity, media, temperature, light, nutrients, and turbulence. Nannochloris oculata has been shown to be a promising producer of oils and has been selected as the strain for this research project.

Another major environmental concern is that wastewater with concentrated nutrients is discharged from cities straight into the ocean. This causes eutrophication condition that leads to macroalgal blooms nearshore and other severe damages to marine environments. SPG’s proposed solution is to re-route this nutrient-enriched wastewater and use it for microalgal growth. Because of the ability of microalgae to remediate and recycle nutrients from the wastewater, the amount of micro and macroalgal growth along the shore should be reduced. Furthermore, the microalgae biomass that is generated from the wastewater can then be used to produce biofuel. Although this model appears to be limited on a large scale at this point, it is a very promising solution once researchers have developed a low-cost and reliable process for algal growth.

To contribute to the large research efforts of biofuel production, our project seeks to find the optimal growth conditions for N. oculata. The experiment design includes growth at 15°C and 25°C. At each temperature, five different light levels are used. By comparing the growth level of N. oculata in this matrix of light-temperature variability, we can determine the optimal growth conditions for this species. Growth rate is monitored via hemacytometer cell counts, and in vivo chlorophyll fluorescence. During log-phase growth, experiments on photosynthetic physiology were performed, and we determined cellular quotas of extracted chlorophylls, particulate organic carbon, particulate organic nitrogen, and lipids analysis.

Saltman Quarterly, Vol. 6, Nos. 1, 2 & 3

RESEARCH

43

BISP 196: Senior Honors Theses Abstracts

STAT1-ISG15 conjugation in the interferon response Nhat Pham, Revelle College, Human Biology Major, Computer Science Minor, Class of 2009 PI: Michael David, Ph.D., Professor of Biology, UCSD Division of Biological Sciences Abstract

Interferon Stimulated Gene 15 (ISG15) is a 15 kDa protein induced in the presence of type I interferons. It is an important member of the ubiquitin-like protein family. Due to its homology with ubiquitin, ISG15 is recognized by the ubiquitin conjugating system (UBE1, UBE2, UBE3), and with the help of these enzymes, ISG15 has been found to be conjugated to important cellular proteins involved in several processes such as glycolysis, cell motility, stress, and immune responses. ISG15 is also an important participant in interferon-induced immunity, as ISG15 knock-out mice showed increased susceptibility to influenza, herpes and Sindbis virus infections.

In the presence of interferon (IFN), ISG15 is upregulated and conjugated to other proteins. One of the important target proteins in the interferon-induced transduction pathway is STAT1, a member of the Signal Transducer and Activator of Transcription family. The primary purpose of this project is to identify the mechanism, localization, and function of ISG15 conjugation to STAT1. Given that ubiquitin-like proteins are typically conjugated to a lysine residue on the target protein, we generated lysine to arginine mutants of the 60 potential conjugation sites for ISG15 on STAT1. These mutants are currently being screened for their ability to undergo ISG15 conjugation upon stimulation with IFN. The mutant(s) identified to lack ISG15 conjugation will be introduced into STAT1 knockout cells to investigate the roles of STAT1-ISG15 conjugation in interferon biology.

Thoracic muscle pH and rate of water loss indicate time and cause of death in Hymenoptera Christine V. Young, Thurgood Marshall College, General Biology Major, Class of 2009 PI: David Holway, Ph.D., Associate Professor of Biology, UCSD Division of Biological Sciences

Abstract

Little is known about the relative contributions of scavenged carrion and prey in a generalist predatorâ&#x20AC;&#x2122;s diet. This is largely due to the inability to determine how a diet item was obtained. Distinguishing between prey and scavenged items in arthropod diets is essential for gaining a better understanding of the ecological interactions between organisms. Such relationships can form intricate food webs, where generalist predators may be subsidized by carrion in addition to consuming prey. Without a method of distinguishing between scavenged and prey items, diet analyses may overestimate the predatory impacts on a species. This is the first study to develop a method that differentiates prey from scavenged diet items by utilizing quantitative physiological properties of thoracic muscle in Hymenoptera (e.g. rate of water loss, thoracic muscle pH, and muscle coloration). We used the western yellowjacket, Vespula pensylvanica, as our model predator. This generalist predator actively preys upon and scavenges bees and yellowjackets. We therefore analyzed the post-mortem physiological responses to predation stress on bees (Apis mellifera and Bombus impatiens) and yellowjackets (V. Pensylvanica). Time since death can be estimated from water loss rates and cause of death can be determined from the acidity of thoracic muscle pH. The ability to successfully differentiate carrion from prey is critical for determining what ecological mechanisms drive population-level dynamics and for formulating accurate food webs.

Disc1 and Dpy-19: two important regulators of neuronal development Alex Ohlendorf, Thurgood Marshall College, Physiology and Neuroscience Major, Class of 2009 PI: Yimin Zou, Ph.D., Associate Professor of Biology, UCSD Division of Biological Sciences Abstract

The Disrupted in Schizophrenia 1 (Disc1) gene was identified by linkage to schizophrenia and other major mental illnesses in a large Scottish pedigree. Disc1 is disrupted by a translocation between chromosomes 1 and 11, resulting in a truncated protein. The function of Disc1 in the cell is unknown, but it has been shown to be involved with neurite outgrowth and neuronal migration.

Binding partners of Disc1 include fasciculation and elongation protein zeta-1 (FEZ1), a molecule important in neuronal development.

This report addresses subcellular localization of Disc1 in order to determine the proteinâ&#x20AC;&#x2122;s function. Dpy-19 is a gene known to be important for the migration of Q neuroblasts in C. elegans. Previous work on Dpy-19 uncovered a mouse homologue, and showed that Dpy-19 is important for neuronal cell migration in the mouse cortex. By causing in vivo knockdown of mouse Dpy-19 expression, we examine the function of this gene in cortical neuron migration and morphology, and have found a significant phenotype.

Saltman Quarterly, Vol. 6, Nos. 1, 2 & 3

RESEARCH

Dr. Paul

S ALTMAN In the early morning hours

on August 27, 1999, UC San Diego and its students lost a great teacher and friend, Paul Saltman. You may ask, “Who was this man and why is this journal dedicated to his memory”? He was an intellectual giant and a brilliant teacher. Formerly Provost of Revelle College as well as Vice Chancellor for Academic Affairs. A man of utmost integrity and inspiration. An acclaimed researcher in the field of nutrition, whose impressive body of work continues to be influential to this day. Not only a distinguished scholar, but also a wonderful father, a loving husband, and an avid sportsman. He had a contagious passion for learning and teaching, and became a legend, touching the lives of all who met him.

Saltman graduated from the California Institute of Technology in Pasadena with a bachelor’s degree in Chemistry and a doctorate in Biochemistry. He then performed his postgraduate studies in Biochemistry at the College de France in Paris and was a professor at the University of Copenhagen and at Murdoch University in Australia. He was also a faculty member in the Department of Biochemistry at the University of Southern California for 14 years before coming to UCSD. He focused his research on the nutritional importance of trace metals such as iron, copper, zinc, and manganese, and its metabolic and biochemical effects on the human body. Saltman was passionate about debunking dietary myths and emphasized the importance of an overall balanced diet. He strongly believed in communicating scientific developments in the context of their social and ethical importance, and to that effect, published his work in professional journals as well as newspapers and popular magazines. He also served on national and international editorial boards for scientific journals and was a consultant to the National Institutes of Health, the National Academy of Sciences, the National Science Foundation, and local and regional agencies.

“

“

He had a contagious passion for learning and teaching and became a legend, touching the lives of all who met him.

Saltman was well known for his enthusiasm and passion for teaching, learning, and sharing his knowledge about both science and life. He truly cared for his students’ education and well-being. Stuart Brody, a close colleague of Saltman and a professor of biology at UCSD states, “Paul was not only excellent in teaching, but he was a true advocate for teaching… especially for undergraduates.

Saltman Quarterly, Vol. 6, Nos. 1, 2 & 3

DEDICATION

He was a real role model for someone who was in a high administrative position.” Saltman once concluded that the ingredients of a great teacher were “knowledge, skill, and the ability to inspire students and excite them with the notion of learning.” He lived what he believed and embodied these traits to the extent that he was awarded the first ever Career Teaching Award from the San Diego Division of the UC Academic Senate. Countless students from Revelle, Muir, Warren, and Thurgood Marshall Colleges also endowed him with the Excellence in Teaching Awards. In honor of Saltman’s extraordinary commitment and contribution to education, the Paul D. Saltman Chair in Science Education was established in 1999 and is now awarded to faculty

“

“

“Paul was not only excellent in teaching, but he was a true advocate for teaching… especially for undergraduates.

members who demonstrate the same excellence of teaching and enthusiasm for students that Saltman had reflected in his years of teaching.

Although we did not have the privilege of meeting Dr. Saltman, his passion for science and enthusiasm for sharing knowledge is still manifested among the students and faculty of UCSD. Just as Dr. Saltman believed that a “teacherpupil relationship should be an interactive process of giving and sharing,” we would like the Saltman Quarterly journal to be a reflection of his teaching in giving and sharing students’ knowledge in research to other students and faculty members.

His legacy lives on and we wish to acknowledge the generous support provided by the Saltman family in underwriting this publication and for supporting undergraduate research education in Biological Sciences at UC San Diego.

Saltman Quarterly, Vol. 6, Nos. 1, 2 & 3

DEDICATION

46

Acknowledgments

Saltman | Quarterly 2008â&#x20AC;&#x201C;2009 Staff

Tyler Green

Christine Cho Editor-in-Chief

Research Editor

Junior, Human Biology major John Muir College

Senior, Physiology & Neuroscience and Philosophy majors, Thurgood Marshall College

Michael Wang

(Qing) Meng Zhang

Review Board Manager

Brian (Seungleal) Paek Features Editor

Chris Ha

Productions Editor

Sophomore, Biochemistry and Cell Biology Junior, General Biology and Philosophy majors, major, John Muir College Revelle College

Esther Oh

Caitlin Rodriguez

Freshman, Human Biology major, John Muir College

Sophomore, Physiology and Neuroscience major, John Muir College

Junior, General Biology and Psychology majors, Warren College

Review Board Manager

Junior, General Biology and Psychology majors, John Muir College

Technical Editor of Content

Kathleen Yip

Anna Osvaldsson

Christine Calabio

Rachel Maher

Junior, Biochemistry and Cell Biology major, John Muir College

Freshman, Biochemistry and Cell Biology major, John Muir College

Freshman, Human Biology major, Thurgood Marshall College

Freshman, General Biology major, Revelle College

Research Design Editor

Webmaster

Staff Writer

Leslie Corona

Matt Croskey

Leila Haghighat

Sophomore, Physiology and Neuroscience major, John Muir College

Junior, Human Biology major, John Muir College

Freshman, General Biology major, Revelle College

Staff Writer

Staff Writer

Staff Writer

Feature Design Editor

Staff Writer

Nancy Lin

Fundraising/Communications Freshman, Biochemistry and Cell Biology major, John Muir College

Saltman Quarterly, Vol. 6, Nos. 1, 2 & 3

Acknowledgments

Acknowledgments Staff Advisors

Gabriele Wienhausen, PhD Associate Dean for Education

Katie Frehafer Media Specialist

Faculty Advisors Eric Allen, PhD Molecular Biology

Lisa Boulanger, PhD Neurobiology

Therese Markow, PhD

Ecology, Behavior and Evolution

Andrew Chisholm, PhD Neurobiology

Review Board Members

Allene Chang Alyssa Songveera Andrew Yatteau Chelsea Mannie Chelsey Sullivan Chris Ha Chris Toomey Karla Kastner Elizabeth Yee Undergraduate Advisor Emerson Posadas Esther Oh Hemal Patel Robert Schmidt, PhD James Zhang Cell and Developmental Jeeyeon Kim Jennifer Phun Biology Jennifer Rust Jennifer Vo Julia Lipianskaya Julie Kim Karen (Yoona) Ho Kayla Wong Christopher Wills, PhD Kyle McCann Ecology, Behavior and Laura Toy Evolution Leila Haghighat Leonardo Chingcuanco Lexie Wang Matt Poling Matthew Mayeda Melissa Galinato Michael Ramirez Gert Cauwenberghs, PhD Oanh Nguyen Neurobiology Omeed Oveyssi Ranier Borda Regina Ip Robert Vo Scott Roberts Shannon Campbell Stephen Huerta Steve Thanh Pham Sudheshna Miryala Theresa Wong Thomas Wu Tianying Su Tiffany Tran Tina Lu Varahenage Perera Yunan Quinn

Saltman Quarterly, Vol. 6, Nos. 1, 2 & 3

47

S|Q

Get involved

48

Saltman | Quarterly Division of Biological Sciences University of California, San Diego 9500 Gilman Drive La Jolla, CA 92093-0376 (858) 534-5635 www.sq.ucsd.edu sq@biomail.ucsd.edu