Veterinaria Italiana, Volume 50 (1), January-March 2014 by Veterinaria Italiana

ISSN 0505-401X

Volume 50 (1) Gennaio-Marzo January-March

2014

Rivista trimestrale di Sanità Pubblica Veterinaria, edita dall’Istituto Zooprofilattico Sperimentale dell’Abruzzo e del Molise “G. Caporale” A quarterly journal devoted to veterinary public health, veterinary science and medicine, published by the Istituto Zooprofilattico Sperimentale dell’Abruzzo e del Molise ‘G. Caporale’ in Teramo, Italy

Volume 50 (1), 2014

Pasquale Celommi (Montepagano, Roseto degli Abruzzi, 1851 - Teramo, Roseto degli Abruzzi, 1928) Primavera. Olio su tela/Oil on canvas, cm 76x150. Fondazione Ventilii, Pinacoteca Civica, Teramo, Italy Questa tela è un inno alla vegetazione che si risveglia e della quale l’artista descrive con estrema attenzione colori e fioriture, adoperando una tavolozza cromatica ampia e completa che rende il senso dell’esplosione di vita della natura dopo il lungo inverno. La Primavera è la stagione “nuova”, connotata dal verde intenso dei campi punteggiati di fiori. In una luce mattutina smagliante, due giovani scalze si avviano verso i campi cantando, abbigliate con i caratteristici vestiti delle contadine abruzzesi. Dietro di loro un bambino, seminascosto dalla vegetazione, viene quasi trascinato dalla pecora che tiene alla cavezza. This painting is a celebration of the awakening of the vegetation in springtime. The artist vividly describes the colours and the flowering by using the full chromatic spectrum, which very well conveys the sensation of the blooming of nature after a long winter. The Primavera is the ‘new’ season, characterised by the intense green of the fields. In a dazzling morning light, two barefooted girls, covered with typical peasant dresses, walk towards the fields while singing; behind them, a child, hidden by the vegetation, is almost carried away by the sheep that he is holding by the halter.

A cura di/By Polo Museale Città di Teramo

Questa rivista è nata nel 1950 con il nome di Croce Azzurra. Dal 1954 si chiamerà Veterinaria Italiana.

Comitato direttivo Managing Scientific Board Romano Marabelli Fernando Arnolfo

Direttore Editor-in-Chief Giovanni Savini Segreteria di redazione Associate Editors Monica Bucciarelli, Guido Mosca, Mariarosaria Taddeo, Carlo Turilli

Membri onorari Honorary Members Louis Blajan - France James H. Steele - United States of America

Comitato di redazione Editorial Board Hassan Abdel Aziz Aidaros – Egypt Ayayi Justin Akakpo – Senegal Nicola T. Belev – Bulgaria Stuart C. MacDiarmid – New Zealand J. Gardner Murray – Australia Yoshihiro Ozawa – Japan Alexander N. Panin – Russia

Victor E. Saraiva – Brazil Aristarhos M. Seimenis – Greece Arnon Shimshony – Israel Samba Sidibé – Mali Gavin R. Thomson – South Africa Carlo Turilli – Italy Norman G. Willis – Canada

Comitato scientifico Scientific Advisory Board L. Garry Adams – United States of America Menachem Banai – Israel Elie K. Barbour – Lebanon A.C. David Bayvel – New Zealand Giorgio Battelli – Italy Roy G. Bengis – South Africa Ingrid E. Bergmann – Argentina Peter F. Billingsley – United States of America Silvio Borrello – Italy Canio Buonavoglia – Italy Mike Brown – United Kingdom Gideon Brücknerr – South Africa Giovanni Cattoli – Italy Bernadette Connolly – United Kingdom Julio De Freitas – Brazil Piergiuseppe Facelli – Italy Gianluca Fiore – Italy Cesidio Flammini – Italy Riccardo Forletta – Italy Bruno Garin-Bastuji – France Giorgio Giorgetti – Italy Rob Gregory – New Zealand Anwar Hassan – Malaysia

Barry J. Hill – United Kingdom Katsuyuki Kadoi – Japan Bruce Kaplan – United States of America R. Paul Kitching – Canada Corinne I. Lasmézas – France N. James MacLachlan – United States of America Salvatore Magazzù – Italy Franco Mutinelli – Italy Klaus Nielsen – Canada Lisa Oakley – New Zealand Massimo Palmarini – United Kingdom Attilio Pini – Italy Santino Prosperi – Italy Franco M. Ruggeri – Italy Domenico Rutili – Italy Paul Sutmoller – The Netherlands Peter M. Thornber – Australia Silvio Arruda Vasconcellos – Brazil Patrick Wall – Ireland Alexander I. Wandeler – Canada Kazuya Yamanouchi – Japan Cristóbal Zepeda – United States of America Stéphan Zientara – France

Recensioni Book reviews Manuel Graziani Progetto grafico e web Graphic and web design Paola Di Giuseppe Amministrazione Administration Istituto Zooprofilattico Sperimentale dell’Abruzzo e del Molise “G. Caporale” Campo Boario, 64100 Teramo, Italia veterinariaitaliana@izs.it Stampa Printer Giservice srl, Teramo, Italia http://www.izs.it/vet_italiana/index.html © 2014 Istituto Zooprofilattico Sperimentale dell’Abruzzo e del Molise “G. Caporale” Campo Boario, 64100 Teramo, Italia

ISSN 0505-401X Formato elettronico Electronic format ISSN 1828-1427 Stampato su carta ecologica TCF Printed on 50% recycled, 100% chlorine- and acid-free environmentally friendly paper Aut. Trib. Teramo n. 299 del 16/05/1990 Sped. in Abb. Post. Art. 2 comma 20/c L. 66/96 DCB/DC Abruzzo Pescara

Istituto Zooprofilattico Sperimentale dell’Abruzzo e del Molise “G. Caporale” Campo Boario, 64100 TERAMO, Italia telefono +39 0861 3321, fax +39 0861 332251 www.izs.it

ROME, NOVEMBER 5-7, 2014 www.btconference2014.izs.it

The Steering Committee and the Scientific Committee are delighted to announce the IV International Conference on Bluetongue and related Orbiviruses, which will be held in Rome on November 5-7, 2014. Ten years after the III International Conference on Bluetongue, Orbivirus-related diseases are still priority and, in some cases, an emergency for official veterinary services and livestock industry.

The evolution of such diseases, their dissemination in different areas and the innovations introduced in laboratory diagnosis pose the need for a new meeting devoted to update the international scientific community on the current situation, compare different approaches, and define new strategies for disease control. Submissions of abstract for oral or poster presentations are welcome.

IV INTERNATIONAL CONFERENCE ON BLUETONGUE AND RELATED ORBIVIRUSES

CONFERENCE TIMELINE

July

September

October

November

2014

ASBTRACT SUBMISSION

NOTIFICATION OF ACCEPTANCE

CONFERENCE REGISTRATION

FULL PAPER SUBMISSION

5-7

CONFERENCE DAYS

PARTICIPATION Please go to the conference website for online registration and abstract submission (www.btconference2014.izs.it). Selected abstract for oral presentations will be included in the conference program; posters will be displayed for the entire conference period and brief discussion sessions will be organized

during the conference breaks. All the accepted abstracts will be made available in the Conference Abstract Book, which will be distributed both in paper and electronic format. The booklet will also appear in the conference website.

TOPIC OF INTEREST SESSION III

SESSION V

SESSION VII

EPIDEMIOLOGY AND RISK ANALYSIS

ANIMAL-VECTOR-HOSTVIRUS INTERACTIONS

DIAGNOSTICS: RECENT DEVELOPMENTS

ECONOMIC AND TRADE IMPACT

• Global ecology • Distribution and variation • Factors of emergence and spread • Host-virus-vector evolution • Modelling • Wildlife SESSION II

• Host specificity • Factors of virulence • Pathogenesis • Immune response • Cellular target • Challenge models

• Virological detection and identification in hosts and vectors • Antibody detection

• Economic and trade impact of BT (policy makers : invited speakers only)

SESSION I

VECTORS • Ecology and global distribution • Taxonomy and identification • Competence and capacity • Immune response • Genome analysis • Vector-virus interactions • Vector-host interactions • Modelling • Control and genetic modification

SESSION IV

SESSION VI

CELL/VIRUS INTERACTIONS

SURVEILLANCE AND CONTROL

• Omics • Reverse genetics • Structure • Attachment and release • Replication • Protein functions • Antiviral mechanisms

• Animals • Vectors • Strategic approaches to surveillance • Vaccines and vaccination strategies • AHS control strategies

WEBSITE: btconference2014.izs.it EMAIL: bt2014@izs.it

Volume 50 (1), 2014 John B. Kaneene, RoseAnn Miller, Bruce Kaplan, James H. Steele & Charles O. Thoen Preventing and controlling zoonotic tuberculosis: a One Health approach..............................................................................7-22 Thomson Reuters Science Journal Citation Reports® database (JCR/Science Edition®) Journal impact factor 2012: 0.519 • National Library of Medicine’s MEDLINE/ PubMed system • Thomson Reuters Science Citation Index Expanded™ (SciSearch®) • CABI’s Full-Text Repository • Directory of Open Access Journals (DOAJ) • Elsevier’s SciVerse Scopus

Le pubblicazioni dell’Istituto Zooprofilattico Sperimentale dell’Abruzzo e del Molise “G. Caporale” (IZSAM) sono protette dalla legge internazionale sul copyright. Gli estratti possono essere letti, scaricati, copiati, distribuiti, stampati, recuperati; è consentito inoltre il collegamento ai file pdf di Veterinaria Italiana. Informazioni per fini commerciali devono essere richieste all’IZSAM. Le traduzioni a stampa e gli adattamenti sono consentiti previa autorizzazione scritta da parte dell’IZSAM. Le opinioni espresse negli articoli pubblicati sono esclusivamente sotto la responsabilità degli autori. L’eventuale citazione di specifiche Ditte o prodotti, siano essi brevettati o meno, non implica che essi siano stati consigliati dall’IZSAM e vengano preferiti ad altri di simile natura non menzionati nei testi. Publications of the Istituto Zooprofilattico Sperimentale dell’Abruzzo e del Molise ‘G. Caporale’ (IZSAM) are protected by international copyright law. Users are permitted to read, download, copy, distribute, print, search abstracts; besides they can link to Veterinaria Italiana full pdf files. Should information be required for commercial purposes, prior written permission must be sought from the IZSAM. Published translations and adaptations also require prior written approval from the IZSAM. The views expressed in signed articles are solely the responsibility of the authors. The mention of specific companies or products of manufacturers, whether or not patented, does not imply that these have been endorsed or recommended by the IZSAM in preference to others of a similar nature that are not mentioned.

L'approccio One Health per la prevenzione e il controllo della tubercolosi (riassunto)....................................................................................................................7

Clara Tramuta, Patrizia Robino, Daniele Nucera, Sara Salvarani, Giuliana Banche, Aurelio Malabaila & Patrizia Nebbia Molecular characterization and antimicrobial resistance of faecal and urinary Escherichia coli isolated from dogs and humans in Italy............................................................... 23-30 Caratterizzazione molecolare e resistenza antimicrobica di Escherichia coli fecali e urinari isolati in cane e uomo in Italia (riassunto)..........................23

Alessandra Alessiani, Lorena Sacchini, Eugenio Pontieri, Jacopo Gavini & Elisabetta Di Giannatale Molecular typing of Salmonella enterica subspecies enterica serovar Typhimurium isolated in Abruzzo region (Italy) from 2008 to 2010 .................................................................................. 31-39 Tipizzazione molecolare di ceppi di Salmonella enterica subspecies enterica serovar Typhimurium isolati in Abruzzo (Italia) dal 2008 al 2010 (riassunto)...................................................................................................................31

Simona Gabrielli, Pietro Calderini, Rudi Cassini, Roberta Galuppi, Maria Paola Tampieri, Mario Pietrobelli & Gabriella Cancrini Human exposure to piroplasms in Central and Northern Italy ........... 41-47 Sieroprevalenza delle piroplasmosi nella popolazione umana del Centro e Nord Italia (riassunto)......................................................................................................42

Maria Teresa Antognoni, Fabrizia Veronesi, Giulia Morganti, Vittorio Mangili, Gabriele Fruganti & Arianna Miglio Natural infection of Anaplasma platys in dogs from Umbria region (Central Italy)......................................................... 49-56 Infezione naturale sostenuta da Anaplasma platys in cani residenti in regione Umbria, Italia Centrale (riassunto).....................................................49

Rosanna Zobba, Maria Lucia Manunta, Maria Antonietta Evangelisti, Alberto Alberti, Stefano Visco, Corrado Dimauro & Maria Luisa Pinna Parpaglia Cisternal cerebrospinal fluid analysis in 24 sheep with chronic coenurosis.......................................................................... 57-63 Analisi del liquido cerebrospinale di 24 ovini affetti da cenurosi cronica (riassunto).................................................................................................57

Volume 50 (1), 2014 SHORT COMMUNICATION Mohammad Mirzaei & Javad Khedri Ixodidae ticks in cattle and sheep in Sistan and Baluchestan Province (Iran)............................................. 65-68 Zecche del genere Ixodes nella popolazione bovina e ovina della regione del Sistan e Baluchistan (Iran) (riassunto).................................................................65

SHORT COMMUNICATION Izedin Goga, Kristaq Berxholi, Beqe Hulaj, Driton Sylejmani, Boris Yakobson & Yehuda Stram Genotyping and phylogenetic analysis of bovine viral diarrhea virus (BVDV) isolates in Kosovo ........................ 69-72 Genotipizzazione e analisi filogenetica di alcuni ceppi del virus della diarrea virale bovina (BVDV) in Kosovo (riassunto)...............................................................69

LIBRI/Book reviews Francesco Staffieri Anestesia e analgesia locoregionale del cane e del gatto ............................... 73 Francesca Bellini, Alessia Liverini, Vincenzo Rosa Conoscere gli animali familiari ...................................................................................... 75

Preventing and controlling zoonotic tuberculosis: a One Health approach John B. Kaneene1*, RoseAnn Miller1, Bruce Kaplan2, James H. Steele3 & Charles O. Thoen4 Center for Comparative Epidemiology, 736 Wilson Road, Room A-109, Michigan State University, East Lansing, MI 48824, United States of America. 2 Specializes in Internal Medicine, 4748 Hamlets Grove Drive, Sarasota, FL 34235, United States of America. 3 Veterinarian Practitioner, 153 Edgehill Circle, Kaysville, UT 84037, United States of America 4 Department of Veterinary Microbiology and Preventive Medicine, College of Veterinary Medicine, Iowa State University, Ames, IA 50011, United States of America 1

* Corresponding author at: Center for Comparative Epidemiology, 736 Wilson Road, Room A-109, Michigan State University, East Lansing, MI 48824, United States of America. Tel.: +1 517 355-2269, e-mail: kaneene@cvm.msu.edu

Veterinaria Italiana 2014, 50 (1), 7-22. doi: 10.12834/VetIt.1302.08 Accepted: 20.12.2013 | Available on line: 31.03.2014

Keywords One Health, Zoonotic tuberculosis, Human, Livestock, Wildlife, Joint surveillance programs, Disease control programs, Public health.

Summary The expression One Health refers to the unified human and veterinary approach to zoonoses, an approach that used to be identified with Medicine throughout the 20th Century. Zoonotic tuberculosis (TB), a disease due to bacteria of the Mycobacterium tuberculosis complex, is a recognized global public veterinary health problem. The significance of the health and economic threats posed by zoonotic TB has been recognized by several global health agencies, which have called for control and eradication programs for zoonotic TB. The interplay between humans, livestock, wildlife, and ecology in the epidemiology of zoonotic TB make arduous the control of the disease, as such zoonotic TB is the ideal target for the application of the One Health approach. This article argues that a successful One Health response to TB will consider the effects of disease on socio-economic well-being, and allow for addressing the social, cultural and economic conditions that facilitate spread and maintenance of this disease. The One Health approach will also enable the development of disease control programs involving both animal and human populations, fostering the participation of various stakeholders. One Health approach will also allow for expanding scientific knowledge, improve medical education and clinical care, and develop effective disease control programs for both human and animal populations.

L’approccio One Health per la prevenzione e il controllo della tubercolosi Parole chiave Animale selvatico, Bestiame, One Health, Popolazione umana, Programma di Controllo, Programma di Sorveglianza, Salute Pubblica, Tubercolosi, Zoonosi.

Riassunto L’espressione One Health si riferisce a un approccio che coinvolge sia la medicina umana sia quella veterinaria nel controllo e nella cura delle zoonosi e di altre patologie. Approccio a lungo identificato con la “Medicina” nel corso del XX secolo. La tubercolosi è una zoonosi dovuta a batteri del complesso Mycobacterium tuberculosis ed è considerata un problema globale per la Salute Pubblica Veterinaria. Diverse organizzazioni mondiali per la Salute Pubblica hanno riconosciuto la rilevanza dei rischi e dei danni economici che essa può causare. Le stesse organizzazioni hanno sottolineato la necessità di definire programmi di eradicazione della malattia. Le interazioni tra esseri umani, bestiame e animali selvatici ne hanno reso difficile il controllo, queste stesse cause fanno della tubercolosi l’obiettivo ideale per implementare l’approccio One Health. L’articolo sostiene che l’approccio One Health alla tubercolosi si dimostrerà efficace se prenderà in considerazione gli effetti socio-economici della patologia e le condizioni socio-culturali ed economiche che ne facilitano la diffusione. L’approccio One Health sostiene lo sviluppo di programmi di controllo che includano sia la popolazione animale sia quella umana, favorendo in tal modo la partecipazione di rappresentanti di interessi diversi nella definizione dei programmi di cura e controllo della malattia.

Kaneene et al.

Preventing and controlling zoonotic tuberculosis: a One Health approach

Introduction Zoonotic tuberculosis (TB), disease due to bacteria of the Mycobacterium tuberculosis (MTB) complex, is a recognized public veterinary health problem in developing countries (Ayele et al. 2004, Cleaveland et al. 2007, Cosivi et al. 1998, Kleeberg 1984, Nastasee 2009, Nawaz et al. 2012, Thoen et al. 2009). The disease is also recognized as a public health issue in such countries, although at lower levels due to the effectiveness of Bovine TB control (BTB) programs in livestock and mandated pasteurization of milk (Cosivi et al. 1998, Cotter et al. 1996, Kleeberg 1984, Lari et al. 2011). Disease caused by Mycobacterium tuberculosis, Mycobacterium bovis (BTB), and other spp of the MTB complex, including Mycobacterium africanum (Cadmus et al. 2006), Mycobacterium caprae (Bayraktar et al. 2011, Cunha et al. 2011, Cunha et al. 2012, Garcia-Jimenez et al. 2012, Gutierrez et al. 1997, Rodriguez et al. 2009) and Mycobacterium orygis (Dawson 2012), appear in humans, livestock and wildlife (Thoen et al. 2009). Other atypical mycobacteria (not members of the MTB complex) have been found in humans and small mammals from farms with BTB-infected cattle in Tanzania (Durnez et al. 2011). The significance of the public health threats from zoonotic TB resulted in the adoption of a resolution by the World Organization for Animal Health (Office International des Epizooties; OIE) in 1983, calling for the eradication of M. bovis for public health and economic reasons, adoption of stringent meat inspection and pasteurization or boiling of milk for human consumption, and continued research into BTB, particularly in the improvement of diagnostic tests (Kleeberg 1984). Other forms of BTB include: • recrudescent cases in the elderly, who acquired infection before BTB control was completed, • cases in developed countries that were imported from other regions of the world where BTB control is absent or ineffective, • cases associated with consumption of contaminated foods of animal origin, or exposure to tuberculous animals and their carcasses (Awah-Ndukum et al. 2011, Cosivi et al. 1998, Cotter et al. 1996, de la RuaDomenech 2006, Doran et al. 2009, Kankya et al. 2010, Majoor et al. 2011, Rodriguez et al. 2009, Rodwell et al. 2008, Rodwell et al. 2010, Shrikirishna et al. 2009, Wilkins et al. 2008, Winthrop et al. 2005). At the same time, workplace exposure to BTB can occur in veterinarians, livestock workers, and slaughterhouse workers (de la Rua-Domenech 2006, Rodriguez et al. 2009, Sunder et al. 2009, Winthrop et al. 2005). While the majority of BTB cases are zoonotic, there are documented cases of human-to-human

transmission of pulmonary BTB (LoBue et al. 2004, Sunder et al. 2009). Rates of BTB in HIV-AIDS patients are higher than those in the general population, and the majority of BTB in developed countries are cases of BTB-HIV/AIDS co-infection (Cosivi et al. 1998, Humblet et al. 2009). Co-infections of BTB with HIV and other diseases are increasing across the globe, and many diseases involved in these complexes are at high risk for zoonosis in humans (Ayele et al. 2004, Cosivi et al. 1998, Hlavsa et al. 2008, Katale et al. 2012, Park et al. 2010). In the developing world, non-pulmonary human TB is under-reported, and often is not a reportable disease (Katale et al. 2012). Rates of human M. bovis infection are higher in populations that own or live in areas with higher cattle populations (Katale et al. 2012). In this respect, it worthwhile noticing that living in close proximity to livestock with BTB has been associated with human BTB infection (Cosivi et al. 1998, Kankya et al. 2010). Studies have also found herds in households with human cases of TB were more likely to have BTB skin-test positive cattle than herds in households without TB, as it was the case in Ethiopia (Fetene et al. 2010, Regassa et al. 2008), Niger (Boukary et al. 2010), Zambia (Cook et al. 1966), Sweden (Sjögren I. and Sutherland 1974) and Denmark (Magnus 1966). Traditional livestock management practices in developing countries, such as transhumance, communal grazing, or keeping livestock longer due to economic constraints, are associated with increasing risks for BTB in cattle (Katale et al. 2012, Mbugi et al. 2012b, Munyeme et al. 2008, Omer et al. 2001). Control of BTB in livestock can reduce risks for human infection by decreasing human exposure to M. bovis through livestock (Milian-Suazo et al. 2010, World Bank 2010a, World Bank 2010b), underlining the importance of controlling the disease from both veterinary and human medical perspectives.

The One Health Approach History of the One Health approach Associations between animal and human diseases have been observed from ancient civilizations to the present day (Steele 2008). Parallels in the progression of disease between humans and domestic animals as well as the historic use of animals as sentinels for human disease (Rabinowitz et al. 2009) support these associations. The evidence of ‘shared risk’ in humans and animals in recent history include: • Minamata disease (mercury poisoning in humans and cats), • anthrax in livestock and humans,

Veterinaria Italiana 2014, 50 (1), 7-22. doi: 10.12834/VetIt.1302.08

Kaneene et al.

• West Nile virus in humans and animals (Rabinowitz et al. 2009). Further, studies of human and animal ethnopharmacology have found commonality in the descriptions, symptoms, and treatments for humans and animals in traditional medicine, and that many remedies were used to treat both humans and animals (Nyamanga et al. 2006, Souto et al. 2011). Some of the earliest applications of the concept of associations between human and animal disease were prompted by veterinarians in the United States, for example J. Law, a professor of veterinary medicine at Cornell University, advised the US Board of Health on the effects of zoonoses on public health in 1880 (Steele 2008). Early analyses of the impact of veterinary public health on human public health were developed in the second part of the 19th century and focused on hazards of milk obtained from unhealthy cows suffering from tuberculosis (TB), typhoid fever, diphtheria, and brucellosis. Actions to control milk-borne diseases included pasteurization after production, and control of bovine TB and brucellosis in cattle through Grade A milk requirements for cattle herd health status (Steele 2008). The success of this program resulted in the near eradication of these diseases as foodborne hazards in the United States.

Acceptance of the One Health approach In the first decade of the 21st Century, the One Health concept was promoted by the veterinary medical community through the American Veterinary Medical Association (American Veterinary Medical Association 2008, King et al. 2008, Steele 2008), which established a unique One Health collaborative liaison with the American Medical Association (AMA) in 2006. In 2007, the AMA passed a landmark One Health resolution, and the AVMA officially established the One Health Initiative Task Force (OHITF) to develop strategies to enhance collaboration between human and veterinary medical professionals. The OHITF produced a strategic framework for reducing risks of infectious diseases at the human-animal-ecosystem interface, and developed the recommendations that formed the bases of the current One Health Initiative (Food and Animal Organisation et al. 2008). As a result, in 2009 the One Health Commission (OHC) was officially chartered for the wide spectrum purpose of promoting One Health both in the United States and worldwide (One Health Commission 2012). The One Health concept has been subsequently supported by the AVMA, AMA, U.S. Centers for Disease Control and Prevention (CDC) and the American Society for Microbiology. The World Health Organization (WHO), the OIE, the United Nations

Veterinaria Italiana 2014, 50 (1), 7-22. doi: 10.12834/VetIt.1302.08

Preventing and controlling zoonotic tuberculosis: a One Health approach

(UN) Food and Agriculture Organization (FAO), UNICEF, the UN System Influenza Coordination, and the World Bank all embrace now the One Health approach. The World Bank has specifically recognized the importance of One Health and its economic benefits (World Bank 2010a and 2010b). Other major organizations promoting One Health include the U.S. Department of Agriculture (USDA), the U.S. National Environmental Health Association (NEHA), the European Union, the American Academy of Pediatrics, and many others (One Health Initiative 2012a). Recognition of the importance of One Health has also expanded beyond the medical and economic sciences, e.g. in the U.S., The National League of Cities has formally recognized and supported the work of the OHITF, and it has acknowledged how the success of the One Health Initiative will rely on leadership, communication skills and cooperation (Riedner 2012). Several countries now endorse the One Health approach to address different zoonotic diseases (Komba et al. 2012, Marcotić et al. 2009, One Health Initiative 2012b), and these days One Health principles are an important part of global health training for medical professionals and development programs (Conrad et al. 2009, One Health Global Network 2012). It is noteworthy that a trend to foster integrated human-animal surveillance systems was observed in surveillance programs for emerging zoonoses (Vrbova et al. 2010). However, despite the diffused awareness of the advantages of the One Health paradigm, barriers to its implementation in some industrialized countries include absence of evidence, governmental structures, and “relatively low degree of suffering” (Meisser et al. 2011). As the One Health concept has emerged as an approach to deal with public and veterinary health, the scope of One Health has been expanding to encompass other concepts. Ecosystem Health is an approach that links ecosystem change with human health (Rapport et al. 1999), and Ecohealth expands on Ecosystem Health to include sociology (Leung et al. 2012), all of which can be viewed as logical extensions of One Health. The One Health-One Medicine concept, while historically incorporating conservation medicine under its umbrella (Kahn et al. 2012), has also been viewed as an expansion of conservation medicine, whose goal is the pursuit of the health of ecosystems and the species that live within them (Osofsky et al. 2005).

Advantages of the One Health approach The report provided by the American Veterinary Medical Association (AVMA) on One Health Task Force offers a comprehensive outline of the following

Kaneene et al.

Preventing and controlling zoonotic tuberculosis: a One Health approach

advantages to be gained through a One Health approach (American Veterinary Medical Association 2008, King et al. 2008). By coupling human health, animal health, ecology, sociology, and economics, the One Health approach can: a. Improve animal and human health globally through collaboration among all the health sciences, especially between the veterinary and human medical professions, to address critical needs: b. Meet new global challenges head-on through collaboration among multiple professions – veterinary medicine, human medicine, environmental, wildlife and public health; c. Develop centers of excellence for education and training in specific areas through enhanced collaboration among colleges and schools of veterinary medicine, human medicine, and public health; d. Expand the body of scientific knowledge to create innovative programs to improve health. The One Health approach is considered by many professionals to be a critical necessity to address zoonotic diseases, would they be existing, emerging, or re-emerging diseases. One Health does so by addressing the very nature of zoonoses - the transmission of disease between human and animal species must be addressed at multiple levels, rather than focusing solely on humans or animals for disease prevention and control (Holveck et al. 2007, Khan et al. 2012, Mbugi et al. 2012a, Nara et al. 2008, Siembieda et al. 2011). Recognizing synergistic relationships in human and animal populations can be used for prevention-oriented planning and research will support One Health goals (Rock et al. 2009, Singer 2009). The emergence of new or old diseases have been linked to changing ecological conditions: deforestation, urbanization, population growth, and climate change create situations where humans are exposed to new ecosystems with novel pathogens, creating opportunities for zoonotic disease transmission (Coker et al. 2011, Siembieda et al. 2011). The One Health approach includes consideration of environmental and ecological factors in the development of effective disease control programs (Beasley 2009, Coker et al. 2011, Leung et al. 2012, Rweyemamu et al. 2012, Zinnstag et al. 2011). Coordinating human and veterinary medical professionals and institutions through One Health is critical in regions where resources are scarce. Surveillance programs for humans and livestock are often absent or lacking, making it difficult to identify zoonotic disease outbreaks and conduct the risk assessments necessary to formulate effective control programs (Merianos 2007).

In areas where human health services are poor, there has been recognition that zoonoses typically affect populations where veterinary medical services are poor and animals harbor more zoonotic diseases (rural livestock-keeping communities, urban slums) (World Health Organisation 2006), and regional disease surveillance may be more advanced in animals than humans due to efforts by the FAO and OIE (Shears 2000). Combined public health and veterinary ministries and integrated surveillance programs under a One Health approach will result in efficiency gains that will help reduce costs, improve access to health services, and allow for more cost-effective disease control in regions with limited resources and where diagnostic and surveillance programs are scanty (Coker et al. 2011, Mbugi et al. 2012b, Rass 2006, Schelling et. al 2005, Shears 2000, World Bank 2010b). As it was highlighted by the World Bank include, examples of efficiency gains followed from the endorsement of the One Health approach can be found in the joint animal-human vaccination campaigns in Chad (Shears 2000, Zinsstag et al. 2005); dog vaccination and sterilization reducing human rabies in India; joint public health and veterinary worker farm visits to reduce costs in Kyrgyzstan; and integration of human and animal health facilities lowering operation costs in Canada (World Bank 2010b). At the same time, it is noteworthy that wildlife conservation and ecosystem preservation also benefit from a One Health approach. By including these components in more ‘holistic’ approaches to disease control and prevention, stakeholders will be more aware of the negative impacts of potential interventions and, consequently, more favorable approaches may be used (Osofsky et al. 2005). The One Health approach can have a positive impact on the economic costs related to the management of zoonotic diseases. These economic burdens fall more heavily on emerging countries than on the developed world (Merianos 2007). Epizootics of disease that can be controlled by vaccination have serious consequences for livestock industries, both upstream (inputs, genetic resources) and downstream (slaughter, processing, marketing), jobs, income, or market access, and also have serious consequences for food security and food safety (Nara et al. 2008). Zoonotic diseases also have negative consequences for livestock production: • decreased milk production; • reduced fertility, slower growth • animal mortality, • losses when the presence of disease restricts the markets for animal products (Lamy et al. 2012, Zinsstag et al. 2008).

Veterinaria Italiana 2014, 50 (1), 7-22. doi: 10.12834/VetIt.1302.08

Kaneene et al.

The indirect costs of zoonoses are often overlooked (Narrod et al. 2012). The impact of zoonoses in terms of disability-adjusted life-years (DALYs) can be quantified by using a One Health approach (Grace et al. 2012): a cost-benefit analysis of vaccinating livestock in Mongolia for brucellosis found that the estimated costs for vaccination (US$ 8.3 million) were exceeded by the overall benefit (US$ 26.6 million), with an average benefit-cost ratio of 3.2 (Roth et al. 2003). Economic losses from outbreaks of Nipah virus, West Nile Fever, SARS, HPAI, BSE, and RVF from 1997–2009 were at least of $80 billion: prevention would have avoided losses of $6.7 B/year (World Bank 2010b). Cost-benefit analyses have determined that interventions in animal populations to reduce levels of zoonotic diseases were cost effective: control of the animal diseases was less expensive than the costs of disease in humans (World Bank 2010b, Zinsstag et al. 2008). Interdisciplinary One Health research efforts can be directed to enhance and address gaps in existing information for use in the development of control programs to promote the health and well-being of humans, animals, and ecosystems. In addition to advances in laboratory sciences, a common ‘toolbox’ of protocols for integrated disease surveillance, joint animal/human epidemiological studies, and health services should be developed, using expertise from human and veterinary medicine, social sciences, ecology, economics, and other fields (Zinsstag et al 2009). Systems theory can be used to study these complex systems and identify properties and determinants of health from microto macro-scales (Zinsstag et al. 2011). Examples of systems biology models include one of persistent tuberculosis in humans (Young et al. 2008), which could be expanded to include livestock, wildlife, and ecological and sociological drivers as part of a TB control (Zinsstag et al. 2011).

Using a One Health approach for the control of zoonotic tuberculosis The interplay between humans, livestock, wildlife, and ecology in the epidemiology of zoonotic diseases, including TB, makes control of the diseases complex (Nishi et al. 2006, Palmer et al. 2012a, Siembieda et al. 2011) and an ideal target for the application of the One Health approach. The Wildlife Conservation Society includes tuberculosis among its ‘deadly dozen’ – potentially lethal zoonoses that could spread around the world due to behavioral changes to compensate for the effects of global warming (Singer 2009). Overall reductions in health (and immune systems) in humans and livestock due to water and food insecurity can contribute to the spread of zoonotic disease (Lamy

Veterinaria Italiana 2014, 50 (1), 7-22. doi: 10.12834/VetIt.1302.08

Preventing and controlling zoonotic tuberculosis: a One Health approach

et al. 2012, Singer 2009). The geographic distribution of different clonal complexes of BTB (e.g. Africa2, Af2) that infect both livestock and humans suggests that geographically distributed factors (e.g. wildlife habitats, climate, water availability) are integral to the transmission of these clones (Berg et al. 2011). Environmental/ecological conditions can promote contact between wildlife and livestock, which can increase transmission of TB at livestock – wildlife interfaces (Gortázar et al. 2012, Miller et al. 2007, Munyeme et al. 2008, Palmer et al. 2012a, Siembieda et al. 2011). Ecological change, both natural and anthropogenic, can increase or concentrate wildlife populations, which can promote the spread of BTB or increase competition between wildlife and livestock for water and food (Cunha et al. 2011, Miller et al. 2007, Okafor et al. 2011, Siembieda et al. 2011, Singer 2009). Finally, associations may exist between climate/weather and the ability of mycobacteria to survive outside the host, which would make indirect transmission of tuberculosis between species possible (Fine et al. 2011, Humblet et al. 2010, Young et al. 2008). Control of livestock BTB in developed countries relies on test-and-cull policies for affected animals. The socio-economic costs of this approach can be economically impossible for livestock owners in developing countries, and result in refusals to participate in BTB control programs (Cosivi et al. 1998, Katale et al. 2012). In addition, this approach is not effective when wildlife reservoirs of disease are present and capable of re-infecting livestock (Coleman et al. 2011, Cosivi et al. 1998, Cunha et al. 2012, Mbugi et al. 2012b, Munyeme et al. 2008, Okafor et al. 2011, Palmere et al. 2012a). However, when levels of BTB in wildlife reservoirs are reduced, or the wildlife reservoir populations are decreased, levels of BTB in livestock (Coleman et al. 2011) or wildlife spillover species (Nugent et al. 2012) are also seen to decline. Control of BTB in wildlife reservoirs has relied on population reduction through increased hunting, trapping, or poisoning (Nugent et al. 2012, O’Brien et al. 2006) and vaccination (Buddle et al. 2011b, Chambers et al. 2011, Lesellier et al. 2006, Palmer et al. 2012b, Wedlock et al. 2005), and these strategies have met with mixed success. Efforts to reduce wildlife populations for disease control can be difficult and are often met with public criticism (Carstensen et al. 2011, Corner 2006, de la Rua‑Domenech et al. 2006, Nishi et al. 2006, O’Brien et al. 2006, Okafor et al. 2011). Vaccination of either the wildlife reservoir or the livestock population is an anticipated alternative to culling (Buddle et al. 2011b, Chambers et al. 2011, Lesellier et al. 2006, Palmer 2007, Wedlock et al. 2005). Development of novel approaches to control diseases in livestock and wildlife, including BTB,

Preventing and controlling zoonotic tuberculosis: a One Health approach

which are both biologically relevant and acceptable to livestock owners is an important goal of One Health (Zinsstag et al. 2005). Ultimately, successful control of BTB in wildlife and livestock will reduce human infection, reduce losses to productivity and reduce market restrictions from countries where eradication programs are in place (Ayele et al. 2004). Culturally appropriate education and active participation of livestock owners and other stakeholders is critical for the success of zoonotic disease control programs (Munyeme et al. 2010, Nastasee 2008, Nishi et al. 2006, Shirima et al. 2003, Zinsstag et al. 2005). Studies in sub-Saharan Africa found that knowledge about BTB in cattle owners was low: few were aware of the disease and how it was spread, fewer were aware of wildlife reservoirs in the area, and awareness was associated with personal history with BTB and geographic regions (Amenu et al. 2010, Kankya et al. 2010, Munyeme et al. 2010). In these instances, the One Health multidisciplinary/interdisciplinary approach, incorporating veterinary medical, ecological, public health, and sociological expertise, can provide useful disease control strategies.

Control programs for zoonotic TB require action at all levels of its epidemiology The epidemiology of zoonotic TB varies throughout the world, depending on the human, livestock, and wildlife populations, and on existing TB control programs, environmental conditions, and the socio‑economic status of countries or regions (developing versus industrial countries) (Humblet et al. 2009). Isolation of both M. bovis and M. tuberculosis from livestock (Awah-Ndukum et al. 2011, Cadmus et al. 2006, Cadmus et al. 2011, Chen et al. 2009, Fatene et al. 2010, Gumi et al. 2012, Jenkins et al. 2011, Kassa et al. 2012, Kazwala et al. 2001, Romero et al. 2011, Thakur et al. 2012) and humans (Awah-Ndukum et al. 2011, Cadmus et al. 2006, Chen et al. 2009, Fetene et al. 2010, Gumi et al. 2012, Milian-Suazo et al. 2010, Romero et al. 2011), M. caprae (García‑Jiménez et al. 2012, Gutiérrez et al. 1997, Rodríguez et al. 2009) and M. orygis (Dawson et al. 2012) in livestock and humans indicates cycling of M. tuberculosis-complex organisms between livestock and humans. In addition, finding cattle and goats with M. tuberculosis infection (AwahNdukum et al. 2011, Cadmus et al. 2006, Chet et al. 2009, Fetene et al. 2010, Gumi et al. 2012, Jenkins et al. 2011, Kassa et al. 2012, Romero et al. 2011) demonstrates that the traditional paradigm of MTB being strictly transmitted from human‑to‑human is incorrect, and animal reservoirs must also be included in MTB control and prevention programs.

Kaneene et al.

Milk from infected cattle is one of the most common sources of BTB infection for humans, and many regional cultures and customs (consumption of undercooked animal products, direct contact) support transmission of BTB from animals to humans (Ayele et al. 2004, Ben Kahla et al. 2011, Cosivi et al. 1998, Fetene et al. 2010, Hlavsa et al. 2008, Katale et al. 2012, Kazwala et al. 2001, Park et al. 2010, Regassa et al. 2008, Shirima et al. 2003). In abattoirs in Tanzania, the most common cause for carcass condemnation was BTB (1.2% of all carcasses in one year), highlighting the public health risks to consumers of foods from these animals and to abattoir workers (Komba et al. 2012). Other atypical mycobacteria (mycobacteria not in the MTB complex) have been recovered from milk, which poses a significant danger to immunocompromised consumers of raw or unprocessed milk (e.g., HIV sufferers) (Durnez et al. 2009, Katale et al. 2012). The ability of BTB, and other MTB, to infect a wide diversity of animals beyond cattle indicates that more than one host species should be taken into consideration when developing BTB control programs (Allepuz et al. 2011, Corner 2006, Cunha et al. 2012, García-Bocanegra et al. 2012, Humblet et al. 2009). Outbreaks of BTB have been reported in different livestock species when BTB was transmitted from cattle to small ruminants and swine (Di Marco et al. 2012, Kassa et al. 2012). Once infection is present, it may become self-sustaining in some cases (Di Marco et al. 2012). Presence of wildlife reservoirs has made BTB eradication difficult in countries where conventional BTB control programs had effectively eliminated the disease from livestock (Allepuz et al. 2011, Coleman et al. 2011, Cunha et al. 2011, Doran et al. 2009, Palmer et al.2012a, Palmer et al.2012b, Santos et al. 2012), and makes control of BTB in livestock difficult when complete segregation of livestock and wildlife is difficult (Cunha et al. 2012, Gortázar et al. 2012, Katale et al. 2012, Mbugi et al. 2012). An important route of infection, particularly between wildlife and domestic animals, is the indirect transmission of mycobacteria by environmental substrates. Studies have demonstrated that wildlife reservoirs are capable of excreting M. bovis capable of serving as a source of infection for other animals (Courtenay et al. 2006, Palmer et al. 2004), and M. bovis can exist in environmental samples for an extended period of time (Fine et al. 2011, Humblet et al. 2010, Young et al. 2008). Experimental studies have showed that M. bovis can be transmitted between white-tailed deer (Palmer et al. 2001), from white-tailed deer to dairy calves (Palmer et al. 2004), and studies have found evidence for environmental contamination as a source of infection for cattle (Green et al. 2012, Okafor et al. 2011).

Veterinaria Italiana 2014, 50 (1), 7-22. doi: 10.12834/VetIt.1302.08

Kaneene et al.

Preventing and controlling zoonotic tuberculosis: a One Health approach

Wildlife disease detection and surveillance programs are rare (Siembieda et al. 2011) due to difficulties in enumerating and testing free-ranging wildlife populations. In instances where wildlife reservoirs are commonly hunted, surveillance programs have relied on post-mortem testing of hunter‑harvested wildlife (O’Brien et al. 2006). However, when harvesting wildlife for surveillance is not feasible (e.g. rare or endangered species) programs involve trapping, sampling, and releasing animals to collect samples for immunological tests (Chambers 2009). Once detected, control programs for wildlife disease, including BTB, can be difficult to implement and maintain, and are often unpopular (O’Brien et al. 2010, Santos et al. 2012). While culling infected wildlife is a useful strategy for reducing BTB risk for livestock in many situations (O’Brien et al. 2010), there have been instances where culling has had mixed impacts on livestock BTB (Chambers et al. 2011, Griffin et al. 2005). In fact, some critics have suggested that, given the economic costs and unpopularity of BTB control in wildlife reservoirs and the successes of pasteurization and food hygiene, the costs far outweigh the benefits of control programs, and BTB should not be considered a public health issue (Torgerson and Torgerson 2009).

zoonoses, including BTB, in Zambia (Monath et al. 2010). Educational efforts should also be expanded to span different disciplines (e.g., ecology, sociology, etc.) to create a cadre of multidisciplinary professionals for One Health programs (Merianos 2007), and curricula at academic institutions should be designed with the One Health approach in mind (Zinsstag et al. 2005).

Sharing human and veterinary resources

Several programs that can provide important information to One Health-based TB control are being conducted in sub-Saharan Africa. The Health for Animals and Livelihood Improvement (HALI) program in Tanzania (Conrad et al. 2009) is currently involved in detection of M. bovis in cattle that provide milk for human consumption, and from wildlife sharing water and habitat with infected cattle; sampling water for the presence of M. bovis and other waterborne pathogens and parasites; and identifying possible animal sentinel species for human TB (rats). Another program is the Federation of American Scientists’ Animal Health Emerging Animal Diseases (AHEAD) International Lookout for Infectious Animal Disease (ILIAD) program in South Africa (102). ILIAD has been designed to develop regional programs to detect and document the extent of infectious diseases shared by wildlife and livestock, and provide disease treatment, prevention and control programs to increase livestock production, protect the health of wildlife, develop physical and professional resources to sustain the programs, and bring communications and epidemiology information technologies to rural areas. Additionally, the Southern Center for Infectious Disease Surveillance (SACIDS) is conducting research using a One Health approach in the Serengeti National Park, to describe interactions at the human-livestock-wildlife interface to determine how TB is transmitted between these groups (Mbugi et al. 2012b, Rweyemamu et al. 2012).

Sharing resources between public health and veterinary medical scientists takes advantage of existing infrastructure and reduces unnecessary duplication. It also has the shared benefit of increasing interaction between professionals in these disciplines (Kazwala et al. 2006, Young et al. 2008). These interactions will raise awareness in all areas, from medical professionals, to governmental agencies, and other stakeholders. Combined public health and veterinary laboratory resources will result in efficiency gains that will help reduce costs and improve access to health services, particularly in developing countries where zoonotic TB is an important issue and resources are limited (Coker et al. 2011, World Bank 2010b). Training for current and future health sciences workers requires a paradigm shift to the perspective of ‘shared risk’ between humans and animals (Zinsstag et al. 2005, Zinsstag et al. 2009). Communications between medical and veterinary medical students are critical and must include crossover education and opportunities for communication and exploration of local priorities and perceived needs (Nara et al. 2008, Schelling et al. 2005, Tibbo et al. 2008). An example of one training program designed to meet these needs is the analytical epidemiology curricula being developed under a One Health approach to address regional

Veterinaria Italiana 2014, 50 (1), 7-22. doi: 10.12834/VetIt.1302.08

In addition to formal education programs, development of virtual Centers of Expertise for One Health approaches to TB control and research have been proposed (Brownlie et al. 2012, Dockrell 2012). Using these resources, new researchers will be able to contribute to trans-disciplinary research on zoonotic TB in a holistic approach, where these researchers will work jointly, using shared conceptual frameworks that integrate the disciplinary-specific concepts, theories, and approaches from their areas of expertise (Zinsstag et al.2008).

Sharing research between disciplines Research that integrates human and animal health across different disciplines is critical for the success of One Health approaches to disease control (Tibbo et al. 2008).

Preventing and controlling zoonotic tuberculosis: a One Health approach

Current diagnostics for human TB are focused on pulmonary disease associated with M. tuberculosis (sputum smears, very few extrapulmonary lesions tested) and requirements for mycobacterial culture for diagnostics are often skipped, resulting in missed diagnosis of M. bovis (Cotter et al. 1996). Differentiation of mycobacterial species responsible for pulmonary TB is often not pursued. Use of inappropriate diagnostic protocols or laboratory techniques (e.g. using culture media that inhibits M. bovis) or lack of additional testing to identify the species MTB, contributes to under-reporting of human BTB (Bayraktar et al. 2011, De Kantor et al. 2008). Such a shortcoming has significant implications for the treatment of zoonotic TB: M. bovis is resistant to pyrazinamide, a drug often used for the treatment of M. tuberculosis infection (Bilal et al. 2010, Cosivi et al. 1998, de la Rua-Domenech 2006), and the proportion of deaths amongst BTB patients is higher than among patients with MTB (Majoor et al. 2011, Rodwell et al. 2008). Determination of species also adds important information needed by epidemiological studies to identify sources of infection and routes of transmission (Bayraktar et al. 2011, Cadmus et al. 2011, Cunha et al. 2012, Duarte et al. 2010, García-Jiménez et al. 2012, Jenkins et al. 2011, Rodríguez et al. 2009). Using One Health approaches, particularly in sharing resources, training, and knowledge of laboratory and health care workers, should decrease this form of misdiagnosis. Refinement of currently-used tests for BTB to improve sensitivity and specificity, particularly those that can be readily used in the field in developing countries and the development of new tests, are goals for TB research. Serological diagnostic tests for human and animal tuberculosis, which measure cell-mediated and humoral immune responses [gamma-interferon assay, ELISA, Multi-Antigen Print Immuno-Assay (MAPIA), immunochromatographic rapid test (ICT or RT), lab-on-a-chip (LOC) devices] are being developed, refined, and tested under field conditions (Buddle et al. 2011a, Chambers 2009, Chambers et al. 2011, de la Rua-Domenech 2006, García-Bocanegra et al. 2012, Lyaschenko et al. 2008, Wadhwa et al. 2012, Zinsstag et al. 2008). Microarray analysis to identify specific genetic markers that identify cattle more likely to be false positives on screening tests is being conducted to improve the effectiveness of the screening protocol (Lim et al. 2012). Researchers also continue to make improvements to traditional TB tests, including skin testing in cattle (Buddle et al. 2011a). Improving diagnostic tools for MTB infections is an ongoing goal for research in both human and veterinary medical sciences. For example, molecular techniques (spoligotyping, MIRU-VNTR, IS6110 RFLP, deletion typing, nested PCR) are being

Kaneene et al.

developed and refined for use with isolates from both humans and animals. Molecular approaches for detection of mycobacteria are more sensitive, specific, and rapid than traditional mycobacterial culture (Allix et al. 2006, Awah-Ndukum et al. 2011, Berg et al. 2011, Cadmus et al. 2006, Duarte et al. 2010, Durnez et al. 2009, Grant et al. 2012, Gumi et al. 2012, Gutiérrez et al. 1997, Hlavsa et al. 2008, Nawaz et al. 2012, Van Soolingen et al. 1994). These tools are being used to identify circulating strains and species of mycobacteria in given regions and populations, which is needed to describe the transmission and molecular diversity of mycobacteria and are gaining acceptance as tools for use in outbreak investigations (Allix et al. 2006, Awah-Ndukum et al. 2011, Bayraktar et al. 2011, Berg et al. 2011, Cadmus et al. 2006, Cadmus et al. 2011, Cunha et al. 2011, Cunha et al. 2012, Di Marco et al. 2012, Duarte et al. 2010, García-Bocanegra et al. 2012, García-Jiménez et al. 2012, Humblet et al. 2010, Jenkins et al. 2011, Kazwala et al. 2006, Lari et al. 2011, Mbugi 2012b, Rodríguez et al. 2009, Rodwell et al. 2010, Romero et al. 2011, Shrikirishna et al. 2009, Van Soolingen et al. 1994). Research into novel approaches to the prevention of tuberculosis can be used not only for animal but human disease control and prevention. Current studies into the immunology, diagnostics, and treatment (Dooley et al. 2012) of TB involve research using information gleaned from both humans and animals. For example, experimental trials to determine if drug-assisted protective immunity against M. bovis infection is present in calves (Dean et al. 2008) may have applications for human BTB control. The development of effective TB vaccines has been identified as an important goal by the STOP TB partnership and other international TB control agencies (Gutiérrez et al. 2012, Kaufmann et al. 2010). Even though the bulk of vaccine research is directed towards the development of human MTB vaccines, discoveries in human vaccine research can be applied to the development of novel animal vaccines (Waters et al. 2012). The TBVAC Consortium has been funded by the EU (Dockrell 2012), with the goal of development of new vaccines against TB. These efforts include interdisciplinary research involving identification of new antigens, testing in animal models, new delivery systems and adjuvants. Recently, efforts to develop DNA vaccines for TB that induce cellular immunity against TB have been successfully tested in animal models (Okada and Kita 2010). The Gates Foundation has funded a study of biomarkers for TB in Africa through their Grand Challenges (Dockrell 2012): the goal of this study is to longitudinally follow cohorts at seven different sites to identify biomarkers for the development of TB or protection from TB. To date, investigators have

Veterinaria Italiana 2014, 50 (1), 7-22. doi: 10.12834/VetIt.1302.08

Kaneene et al.

Preventing and controlling zoonotic tuberculosis: a One Health approach

detected differences in human immune responses in different populations (Malawi vs. UK), demonstrating the impact of environment on immune response, and are currently studying the effects of helminthes co-infection on immunity against TB and other diseases.

• improved diagnostic tests,

Vaccination of livestock and wildlife for BTB control is been investigated in developing countries and in countries with wildlife reservoirs of BTB (Chambers et al. 2011, Cosivi et al. 1998, Gortázar et al. 2008, Katale et al. 2012, Lesellier et al. 2006, Mbugi et al. 2012b, Palmer et al. 2012b, Wedlock et al. 2005, Zinsstag et al. 2008). In some instances, vaccination does not prevent infection, but reduces the burden of disease in the vaccinated wildlife (Chambers et al. 2011). With ongoing research to develop better vaccines and delivery methods, vaccination has been recognized as a future option for control of BTB transmission between wildlife and livestock (Palmer et al. 2012a). In addition to efficacy studies, there are concerns that vaccination may confound screening tests for BTB. Cattle exposed to BCG (Bacillus Calmette‑Guérin, an attenuated strain of M. tuberculosis used for vaccination), will give false positives through skin testing. Concerns have been raised that vaccinated wildlife may transmit BCG to livestock (Palmer et al. 2010), and hunters may be exposed to BCG from vaccinated deer (Palmer et al. 2012b). However, current studies have demonstrated that, while BCG is shed from vaccinated wildlife (Chambers et al. 2011, Lesellier et al. 2006, Palmer et al. 2010, Wedlock et al. 2005), the risk of transmitting BCG from wildlife to livestock or humans is considered to be low (Chambers et al. 2011, Palmer et al. 2012b).

• additional research into the role of different wildlife species,

Research is also ongoing in the development of vaccines and vaccine delivery systems for use in cattle and wildlife reservoirs of BTB, which will be critical in situations where conventional test‑and‑slaughter control programs are not practical, and where it is impossible to segregate wildlife reservoirs from livestock or when slaughter of infected wildlife is socially controversial (Buddle et al. 2001b, Carstensen et al. 2011, Gortázar et al. 2012, O’Brien et al. 2006, Waters et al. 2012). Vaccination can reduce the impact of BTB on wildlife populations, particularly where threatened or endangered species [e.g., lions and cheetahs in South Africa (de Vos et al. 2001); Iberian lynx in Spain (Gortázar et al. 2012)] are threatened (Buddle et al. 2011b, Lesellier et al. 2006, Waters et al. 2012).

Improved efficiency of TB surveillance, diagnosis, and control programs The following have all proved to be necessary to develop comprehensive zoonotic TB control programs:

Veterinaria Italiana 2014, 50 (1), 7-22. doi: 10.12834/VetIt.1302.08

• better wildlife, • transboundary surveillance programs, • application of control measures to livestock and wildlife,

• the role of ecosystem environments on the transmission of BTB (García-Bocanegra et al. 2012, Humblet et al. 2009, Mbugi et al. 2012a). The transboundary nature of zoonotic TB automatically expands the scope of surveillance and control programs: in sub-Saharan Africa, wildlife reservoirs, livestock, and pastoralists constantly traverse large geographic areas, providing opportunities to both acquire and transport zoonotic diseases as they move across borders (Capobianco Dondona et al. 2010, Rass 2006, Schwabe 1984). Early detection of BTB in both human and animal populations, a cornerstone of the One Health approach to zoonoses control, is critical to control the disease in all populations (Meisser et al. 2011). Simultaneous surveillance of human and animal populations, which would reduce detection time (Narrod et al. 2012, Schelling et al. 2003, Zinsstag et al. 2005, Zinsstag et al. 2009), is an emerging strategy in zoonotic disease surveillance (Vrbova et al. 2010) and the integration of human and animal surveillance and prevention programs has been strongly recommended for BTB (Ayele et al. 2004, Boukary et al. 2010, Chen et al. 2009, Cleaveland et al. 2007, Cosivi et al. 1998). Collaborative efforts between public health, agriculture, and wildlife professionals, with support from the public, are critical to the control of BTB (Cunha et al. 2012, Okafor et al. 2011). Lack of stakeholder support can seriously reduce the effectiveness of BTB control programs, as seen in the control of BTB in wild white tailed-deer in Michigan and Minnesota (Carstensen et al. 2011). Control programs have successfully reduced BTB levels in wild deer in Minnesota with public acceptance and support (Carstensen et al. 2011), while lack of cooperation with farmers and hunters in Michigan have made control programs more difficult to maintain (Carstensen et al. 2011, O’Brien et al. 2006).

Conclusions The One Health approach offers many advantages in controlling disease. These include: 1) efficiency as a result of shared surveillance programs, laboratory facilities, training of personnel, and research; 2) potentially positive impacts on the disease in

Kaneene et al.

Preventing and controlling zoonotic tuberculosis: a One Health approach

livestock, wildlife, and humans; 3) opportunity to involve trans-disciplinary teams of professionals in biomedical sciences, social sciences, and ecological sciences. Given the complex nature of the epidemiology of zoonotic TB, and the influences of sociological, economic, and ecological factors, One Health provides an excellent economical approach for conducting research, and the development of effective disease control and prevention programs for zoonotic tuberculosis.

Conflict of interest/Competing interests Dr Kaneene is the most recent former chairperson of the Zoonotic TB Sub-Section of the International Union Against Tuberculosis and Lung Disease (IUATLD). Dr Kaplan is a member of the One Health Initiative Team (http://www.onehealthinitiative. com/index.php). Dr Steele is a current member of the One Health Initiative Website Advisory Board.

References Allepuz A., Casal J., Napp S., Saez M., Alba A., Vilar M., Domingo M., González M.A., Duran-Ferrer M., Vicente J., Álvarez J., Muñoz M. & Saez J.L. 2011. Analysis of the spatial variation of bovine tuberculosis disease risk in Spain (2006-2009). Prev Vet Med, 100, 44-52. Allix C., Walravens K., Saegerman C., Godfroid J., Supply P. & Fauville-Dufaux M. 2006. Evaluation of the epidemiological relevance of Variable-Number Tandem-Repeat genotyping of Mycobacterium bovis and comparison of the method with IS6110 restriction fragment length polymorphism analysis and spoligotyping. J Clin Microbiol, 44, 1951-1962. Amenu K., Thys E., Regassa A. & Marcotty T. 2010. Brucellosis and tuberculosis in Arsi-Negele District, Ethiopia: prevalence in ruminants and people’s behaviour towards zoonoses. Tropicultura, 28(4), 205-210. American Veterinary Medical Association (AVMA). 2008. One Health: a new professional imperative. One Health Initiative Task Force: Final Report (www.avma.org/ onehealth/default.asp accessed on 5 October 2012). Awah-Ndukum J., Kudi C., Bradley G. & Ane-Anyangwe I.N. 2011. Preliminary report of the zoonotic significance of tuberculosis in cattle in the highlands of Cameroon. In Animal hygiene and sustainable livestock production: Proc XV Int Congress, Int Soc Animal Hygiene, Vienna, Austria, 3-7 July, 1, 193-195. Ayele W.Y., Neill S.D., Zinsstag J., Weiss M.G. & Pavlik I. 2004. Bovine tuberculosis: an old disease but a new threat to Africa. Int J Tuberc Lung Dis, 8, 924-937. Bayraktar B., Bulut E., Baris A.B., Toksoy B., Dalgic N., Celikkan C. & Sevgi D. 2011. Species Distribution of the Mycobacterium tuberculosis Complex in Clinical Isolates from 2007 to 2010 in Turkey: a Prospective Study. J Clin Microbiol, 49, 3837-3841. Beasley V. 2009. ‘One Toxicology’, ‘Ecosystem Health’, and ‘One Health’. Vet Ital, 45, 97-110. Ben Kahla I., Boschiroli M.L., Souissi F., Cherif N., Benzarti M., Boukadida. & Hammami S. 2011. Isolation and molecular characterisation of Mycobacterium bovis from raw milk in Tunisia. African Health Sci, 11, S2-S5. Berg S., Garcia-Pelayo M.C., Müller B., Hailu E., Asiimwe B., Kremer K., Dale J., Boniotti M.B., Rodriquez S., Hilty M., Rigouts L., Firdessa R., Machado A., Mucavele C.,

Ngandolo B.N.R., Bruchfeld J., Boschiroli L., Müller A., Sahraoui N., Pacciarini M., Cadmus S., Joloba M., van Soolingen D., Michel A.L., Djønne B., Aranaz A., Zinsstag J., van Helden P., Portaels F., Kazwala R., Källenius G., Hewinson R.G., Aseffa A., Gordon S.V. & Smith N.H. 2011. African 2, a clonal complex of Mycobacterium bovis epidemiologically important in East Africa. J Bacteriol, 193, 670-678. Bilal S., Iqbal M., Murphy P. & Power J. 2010. Human bovine tuberculosis – Remains in the differential. J Med Microbiol, 59, 1379-1382. Boukary A.R., Thys E., Rigouts L., Matthys F., Berkvens D., Mahamadou I., Yenikoye A. & Saegerman C. 2010. Risk factors associated with bovine tuberculosis and molecular characterization of Mycobacterium bovis strains in urban settings in Niger. Transbound Emerg Dis, 59(6), 490-502. Brownlie J. 2012. A foresight vision for infectious diseases in Africa. Onderstepoort J Vet Res, 79(2), 459, doi:10.4102/ ojvr.v79i2.459. Buddle B.M., Livingstone P.G. & de Lisle GW. 2011a. Advances in ante-mortem diagnosis of tuberculosis in cattle. N Z Vet J, 57, 173-180. Buddle B.M., Wedlock D.N., Denis M., Vordermeier H.M. & Hewinson R.G. 2011b. Update on vaccination of cattle and wildlife populations against tuberculosis. Vet Microbiol, 151, 14-22. Cadmus S., Palmer S., Okker M., Dale J., Gover K., Smith N., Jahans K., Hewinson R.G. & Gordon S.V. 2006. Molecular analysis of human and bovine tubercule bacilli from a local setting in Nigeria. J Clin Microbiol, 44, 29-34. Cadmus S.I.B., Gordon S.V., Hewinson R.G. & Smith N.H. 2011. Exploring the use of molecular epidemiology to track bovine tuberculosis in Nigeria: an overview from 2002 to 2004. Vet Microbiol, 151, 133-138. Capobianco Dondona A., Jago M., Lelli R., Marais A. & Scacchia M. 2010. Preliminary report of transfrontier disease surveillance in free-ranging buffalo in the Caprivi Strip, Namibia. Vet Ital, 46, 267-275. Carstensen M., O’Brien D.J. & Schmitt S.M. 2011. Public acceptance as a determinant of management strategies for bovine tuberculosis in free-ranging U.S. wildlife. Vet Microbiol, 151, 200-204.

Veterinaria Italiana 2014, 50 (1), 7-22. doi: 10.12834/VetIt.1302.08

Kaneene et al.

Chambers M.A. 2009. Review of the diagnosis and study of tuberculosis in non-bovine wildlife species using immunological methods. Transbound Emerg Dis, 56, 215-227. Chambers M.A., Rogers F., Delahay R.J., Lesellier S., Ashford R., Dalley D., Gowtage S., Davé D., Palmer S., Brewer J., Crawshaw T., Clifton-Hadley R., Carter S., Cheeseman C., Hanks C., Murray A., Palphramand K., Pietravalle S., Smith G.C., Tomlinson A., Walker N.J., Wilson G.J., Corner L.A.L., Rushton S.P., Shirley M.D.F., Gettinby G., McDonald R.A. & Hewinson R.G. 2011. Bacillus Calmette-Guérin vaccination reduces the severity and progression of tuberculosis in badgers. Proc R Soc B, 278, 1913-1920. Chen Y., Chao Y., Deng Q., Liu T., Ziang J., Chen J., Zhou J., Zhan Z., Kuang Y., Cai H., Chen H. & Guo A. 2009. Potential challenges to the Stop TB Plan for humans in China; cattle maintain M. bovis and M. tuberculosis. Tuberculosis, 89, 95-100. Cleaveland S., Shaw D.J., Mfinanga S.G., Shirima G., Kazwala R.R., Eblate E. & Sharp M. 2007. Mycobacterium bovis in rural Tanzania: risk factors for infection in human and cattle populations. Tuberculosis, 87, 30-43. Coker R.J., Hunter B.M., Rudge J.W., Liverani M. & Hanvoravongchai P. 2011. Emerging infectious diseases in southeast Asia: regional challenges to control. Lancet, 377, 599-609. Coleman J.D., Coleman M.C. & Warburton B. 2011. Trends in the incidence of tuberculosis in possums and livestock, associated with differing control intensities applied to possum populations. N Z Vet J, 54, 52-60. Conrad P.A., Mazet J.A., Clifford D., Scott C. & Wilkes M. 2009. Evolution of a transdisciplinary ‘‘One Medicine– One Health’’ approach to global health education at the University of California, Davis. Prev Vet Med, 92, 268-274. Cook A.J.C., Tuchili L.M., Buve A., Foster S.D. GodfreyFaussett P., Pandey G.S. & McAdam K.P.W.J. 1966. Human and bovine tuberculosis in the Monze district of Zambia – a cross-sectional study. Br Vet J, 152, 37-46. Corner L.A.L. 2006. The role of wild animal populations in the epidemiology of tuberculosis in domestic animals: How to assess the risk. Vet Microbiol, 112, 303-312. Cosivi O., Grange J.M., Daborn C.J., Raviglione M.C., Fujikura T., Cousins D., Robinson R.A., Huchzermeyer H.F., de Kantor I. & Meslin F.X. 1998. Zoonotic tuberculosis due to Mycobacterium bovis in developing countries. Emerg Infect Dis, 4, 59-70. Cotter T.P., Sheehan S., Cryan B., O’Shaughnessy E., Cummins H. & Bredin C.P. 1996. Tuberculosis due to Mycobacterium bovis in humans in the south-west region of Ireland: is there a relationship with infection prevalence in cattle? Tuberc Lung Dis, 77, 545-548. Courtenay O., Reilly L.A., Sweeney F.P., Hibberd V., Bryan S., Ul-Hassan A., Newman C., Macdonald D.W., Delahay R.J., Wilson G.J. & Wellington E.M.H. 2006. Is Mycobacterium bovis in the environment important for the persistence of bovine tuberculosis? Biol Lett, 2, 460-462. Cunha M.V., Monteiro M., Carvalho P., Mendonça P., Albuquerque T. & Botelho A. 2011. Multihost tuberculosis: insights from the Portuguese Control

Veterinaria Italiana 2014, 50 (1), 7-22. doi: 10.12834/VetIt.1302.08

Preventing and controlling zoonotic tuberculosis: a One Health approach

Program. Vet Med Int, 795165, doi: 10.4061/2011/795165. Cunha M.V., Matos F., Canto A., Albuquerque T., Alberto J.R., Aranha J.M., Vieira-Pinto M. & Botelho A. 2012. Implications and challenges of tuberculosis in wildlife ungulates in Portugal: a molecular epidemiology perspective. Res Vet Sci, 92, 225-235. Dawson K.L., Bell A., Kawakami P., Coley K., Yates G. & Collins D.M. 2012. Transmission of Mycobacterium orygis (M. tuberculosis Complex Species) from a tuberculosis patient to a dairy cow in New Zealand. J Clin Microbiol, 50, 3136-3138. De Kantor I.N., Ambroggi M., Poggi S., Morcillo N., Da Silva Telles M.A., Ribeiro M.O., Garzón Torres M., Llerena Polo C., Ribón W., García V., Kuffo D., Asencios L., Vásquez Campos L.M., Rivas C. & de Waard J.H. 2008. Human Mycobacterium bovis infection in ten Latin American countries. Tuberculosis, 88, 358-365. de la Rua-Domenech R. 2006. Human Mycobacterium bovis infection in the United Kingdom: incidence, risks, control measures and review of the zoonotic aspects of bovine tuberculosis. Tuberculosis, 86, 77-109. de la Rua-Domenech R., Goodchild A.T., Vordermeier H.M., Hewinson R.G., Christiansen K.H. & Clifton-Hadley R.S. 2006. Ante mortem diagnosis of tuberculosis in cattle: A review of the tuberculin tests, gamma-interferon assay and other ancillary diagnostic techniques. Res Vet Sci, 81, 190-210. de Vos V., Bengis R.G., Kriek N.P., Michel A.L., Keet D.F., Raath J.P & Huchzermeyer H.F.K.A. 2001. The epidemiology of tuberculosis in free-ranging African buffalo (Syncerus caffer) in the Kruger National Park, South Africa. Onderstepoort J Vet Res, 68, 119–130. Dean G.S., Rhodes S.G., Coad M., Whelan A.O., Wheeler P., Villareal-Ramos B., Mead E., Johnson L., Clifford D.J., Hewinson R.G. & Vordermeier H.M. 2008. Isoniazid treatment of Mycobacterium bovis in cattle as a model for human tuberculosis. Tuberculosis, 88, 586-594. Di Marco V., Mazzone P., Capuccio M.T., Boniotti M.B., Aronica V., Russo M., Fiasconaro M., Cifani N., Corneli S., Biasibetti E., Biagetti M., Pacciarini M.L., Cagiola M., Basquali P. & Marianelli C. 2012. Epidemiological significance of the domestic black pig (Sus scrofa) in maintenance of bovine tuberculosis in Sicily. J Clin Microbiol, 40, 1209-1218. Dockrell H.M. 2012. One Health – ‘joining the dots’. Onderstepoort J Vet Res, 79(2), 458, doi:10.4102/ojvr. v79i2.458. Domenech J., Lubroth J., Eddi C., Martin V. & Roger F. 2006. Regional and international approaches on prevention and control of animal transbound and emerging diseases. Ann N Y Acad Sci, 1081, 90-107. Dooley K.E., Obuku E.A., Durakovic N., Belitsky V., Mitnick C. & Nuremberger E.L. 2013. World Health Organization Group 5 drugs for the treatment of drug-resistant tuberculosis: unclear efficacy or untapped potential? J Infect Dis, 207(9), 1352-1358. Doran P., Carson J., Costello E. & More S.J. 2009. An outbreak of tuberculosis affecting cattle and people on an Irish dairy farm, following the consumption of raw milk. Irish Vet J, 62, 390-397.

Preventing and controlling zoonotic tuberculosis: a One Health approach

Duarte E.L., Domingos M., Amado A., Cunha M.V. & Botelho A. 2010. MIRU-VNTR typing adds discriminatory value to groups of Mycobacterium bovis and Mycobacterium caprae strains defined by spoligotyping. Vet Microbiol, 143, 299-306.

Green L.E., Carrique-Mas J.J., Mason S.A. & Medley G.F. 2012. Patterns of delayed detection and persistence of bovine tuberculosis in confirmed and unconfirmed herd breakdowns in cattle and cattle herds in Great Britain. Prev Vet Med, 106, 266-274.

Durnez L., Sadiki H., Katakweba A., Machang’u R.R., Kazwala R.R., Leirs H. & Portaels F. 2009. The prevalence of Mycobacterium bovis-infection and typical mycobacterioses in cattle in and around Morogoro, Tanzania. Trop Anim Health Prod, 41, 1653-1659.

Griffin J.M., Williams D.H., Kelly G.E., Clegg T.A., O’Boyle I., Collins J.D. & More S.J. 2005. The impact of badger removal on the control of tuberculosis in cattle herds in Ireland. Prev Vet Med, 67, 237-266.

Durnez L., Katakweba A., Sadiki H., Katholi C.R., Kazwala R.R., Machang’u R.R., Portaels F. & Leirs H. 2011. Mycobacteria in terrestrial small mammals on cattle farms in Tanzania. Vet Med Int, 495074, doi: 10.4061/2011/495074. Food and Animal Organization (FAO), Office International des Epizooties (OIE), World Health Organization (WHO). 2008. Contributing to One World, One Health: A strategic framework for reducing risks of infectious diseases at the Animal–Human–Ecosystems Interface (consultation document). 14 October 2008 (www.fao. org/docrep/011/aj137e/aj137e00.htm accessed on 11 September 2012). Fetene T., Kebede N. & Alem G. 2010. Tuberculosis infection in animal and human populations in three districts of Western Gojam, Ethiopia. Zoonoses Public Health, 58, 47-53. Fine A.E., Bolin C.A., Gardiner J.C. & Kaneene J.B. 2011. A study of the persistence of Mycobacterium bovis in the environment under natural weather conditions in Michigan, USA. Vet Med Int, 765430, doi:10.4061/2011/765430. García-Bocanegra I., Pérez de Val B., Arenas-Montes A., Paniagua J., Boadella M., Gortázar C. & Arenas A. 2012. Seroprevalence and risk factors associated to Mycobacterium bovis in wild artiodactyl species from southern Spain, 2006-2010. PLoS ONE, 7(4), e34908, doi:10.1371/journal.pone.0034908. García-Jiménez W.L., Benítez-Medina J.M., FernándezLlario P., Abecia J.A., García-Sánchez A., Martínez R., Risco D., Ortiz-Peláez A., Salguero F.J., Smith N.H., Gómez L. & Hermoso de Mendoza J. 2012. Comparative pathology of the natural infections by Mycobacterium bovis and by Mycobacterium caprae in wild boar (Sus scrofa). Transbound Emerg Dis, 60(2), 102-109. Gortázar C., Torres M.J., Vicente J., Acevedo P., Reglero M., de la Fuente J., Negro J.J. & Aznar-Martín J. 2008. Bovine tuberculosis in Donana Biosphere Reserve: the role of wild ungulates as disease reservoirs in the last Iberian lynx strongholds. PLoS ONE, 3, 1-8. Gortázar C., Delahay R.J., McDonald R.A., Boadella M., Wilson G.J., Gavier-Widen D. & Acevedo P. 2012. The status of tuberculosis in European wild mammals. Mammal Rev, 42, 193-206.

Kaneene et al.

Gumi B., Schelling E., Berg S., Firdessa R., Erenso G., Mekonnen W., Hailu E., Melese E., Hussein J., Aseffa A. & Zinsstag J. 2012. Zoonotic transmission of tuberculosis between pastoralists and their livestock in South-East Ethiopia. EcoHealth, 9, 139-149. Gutiérrez M., Samper S., Jiménez M.S., van Embden J.D., Marín J.F. & Martín C. 1997. Identification by spoligotyping of a caprine genotype in Mycobacterium bovis strains causing human tuberculosis. J Clin Microbiol, 35, 3328-3330. Gutiérrez A.H., Spero D., Gay C., Zimic M. & De Groot A.S. 2012. New vaccines needed for pathogens infecting animals and humans: One Health. Hum Vaccin Immunother, 8, 971-978. Hlavsa M., Moonan P.K., Cowan L.S., Navin T.R., Kammerer J.S., Morlock G.P., Crawford J.T. & LoBue P.A. 2008. Human tuberculosis due to Mycobacterium bovis in the United States, 1995-2005. Clin Infect Dis, 47, 168-175. Holveck J.C., Ehrenberg J.P., Ault S.K., Rojas R., Vasquez J., Cequeira M.T., Ippolito-Shepherd J., Genovese M.A. & Periago M.R. 2007. Prevention, control, and elimination of neglected diseases in the Americas: pathways to integrated, inter-programmatic, inter-sectoral action for health and development. BMC Public Health, 7, 6. doi:10.1186/1471-2458-7-6. Humblet M.F., Boschiroli M.L. & Saegerman C. 2009. Classification of worldwide bovine tuberculosis risk factors in cattle: a stratified approach. Vet Res, 40, 50. doi: 10.1051/vetres/2009033. Humblet M.F., Gilbert M., Govaerts M., Fauville-Dufaux M., Walravens K. & Saegerman C. 2010. New assessment of bovine tuberculosis risk factors in Belgium based on nationwide molecular epidemiology. J Clin Microbiol, 48, 2802-2808. Jenkins A.O., Cadmus S.I.B., Venter E.H., Pourcel C., Hauk Y, Vergnaud G. & Godfroid J. 2011. Molecular epidemiology of human and animal tuberculosis in Ibadan, Southwestern Nigeria. Vet Microbiol, 151, 139147. Kahn L.H., Kaplan B. & Steele J.H. 2007. Confronting zoonoses through closer collaboration between medicine and veterinary medicine (as ‘one medicine’). Vet Ital, 43, 5-19.

Grace D., Gilbert J., Randolph T. & Kang’ethe E. 2012. The multiple burdens of zoonotic disease and an ecohealth approach to their assessment. Trop Anim Health Prod, doi: 10.1007/s11250-012-0209-y.

Kahn L.H., Monath T.P., Bokma B.H., Gibbs E.P. & Aguirre A.A. 2012. Chapter 3: One Health, One Medicine. In New directions in conservation medicine: applied cases of ecological health. (A.A. Aguirre, R. Ostfeld, P. Dasza, eds). New York, NY, Oxford University Press, USA, 33-44.

Grant J., Kammerer S., Baker B. & Kim L. 2012. Tuberculosis Genotyping – United States, 2004-2010. MMWR, 61, 723-725.

Kankya C., Muwonge A., Olet S., Munyeme M., Biffa D., Opuda-Asibo J., SKjerve E. & Oloya J. 2010. Factors associated with pastoral community knowledge

Veterinaria Italiana 2014, 50 (1), 7-22. doi: 10.12834/VetIt.1302.08

Kaneene et al.

Preventing and controlling zoonotic tuberculosis: a One Health approach

and occurrence of mycobacterial infections in Human-Animal Interface areas of Nakasongola and Mubende districts, Uganda. BMC Publ Health, 10, 471. doi:10.1186/1471-2458-10-471.

productivity. In Environmental stress and amelioration in livestock production (V. Seijan, S.M.K. Naqvi, T. Ezeji, J. Lakritz, & R. Lal, eds). Springer-Verlag, Berlin Heidelberg, 19-51. doi:10.1007/978-3-642-29205-7_2.

Kaplan B. & Echols M. 2009. ‘One Health’ - the Rosetta stone for 21st century health and health providers. Vet Ital, 45, 377-382.

Lari L., Bimbi N., Rindi L., Tortoli E. & Garzelli C. 2011. Genetic diversity of human isolates of Mycobacterium bovis assessed by spoligotyping and Variable Number Tandem Repeat genotyping. Infect Genet Evol, 11, 175-180.

Kaplan B. & Scott C. 2011. Who coined the term “One Medicine”? (www.onehealthinitiative.com/ publications/Who%20coined%20the%20term%20 One%20Medicine%20by%20B%20%20Kaplan%20 and%20C%20%20Scott%20May19%202011-C.S.pdf accessed on 20 August 2012).

Lesellier S., Palmer S., Dalley D.J., Davé D., Johnson L., Hewinson R.G. & Chambers M.A. 2006. The safety and immunogenicity of Bacillus Calmette-Guérin (BCG) vaccine in European badgers (Meles meles). Vet Immunol Immunopathol, 112, 24-37.

Kassa G.M., Abebe F., Worku Y., Legesse M., Medhin G., Bjune G. & Ameni G. 2012. Tuberculosis in goats and sheep in Afar Pastoral Region of Ethiopia and isolation of Mycobacterium tuberculosis from goat. Vet Med Int, 869146. doi:10.1155/2012/869146.

Leung Z., Middleton D. & Morrison K. 2012. One Health and EcoHealth in Ontario: a qualitative study exploring how holistic and integrative approaches are shaping public health practice in Ontario. BMC Public Health, 12, 358. doi:10.1186/1471-2458-12-358.

Katale B.Z., Mbugi E.V., Kendal S., Fyumagwa R.D., Kibiki G.S., Godfrey-Faussett P., Keyyu J.D., van Helden P. & Matee M.I. 2012. Bovine tuberculosis at the humanlivestock-wildlife interface: is it a public health problem in Tanzania? A review. Onderstepoort J Vet Res, 79, 463. doi: 10.4102/ojvr.v79i2.463.

Lim A., Steibel J.P., Coussens P.M., Grooms D.L. & Bolin S.R. 2012. Differential gene expression segregates cattle confirmed positive for bovine tuberculosis from antemortem tuberculosis test-false Positive cattle originating from herds free of bovine tuberculosis. Vet Med Int, 192926. doi: 10.1155/2012/192926.

Kaufmann S.H., Hussey G. & Lambert P.H. 2010. Tuberculosis 6: new vaccines for tuberculosis. Lancet, 375, 2110-2119.

LoBue P.A., Betancourt W., Cowan L., Seli L., Peter C. & Moser K.S. 2004. Identification of a familial cluster of pulmonary Mycobacterium bovis disease. Int J Tuberc Lung Dis, 8, 1142-1146.

Kayunze K.A., Kiwara A.D., Lyamuya E., Kambarage D.M., Rushton J., Coker R., Kock R. & Rweyemamu M.M. 2012. A socio-economic approach to One Health policy research in southern Africa. Onderstepoort J Vet Res, 79, 460. doi:10.4102 /ojvr.v79i2.460. Kazwala R.R., Daborn C.J., Sharp J.M., Kambarage D.M., Jiwa S.F.H. & Mbembati N.A. 2001. Isolation of Mycobacterium bovis from human cases of cervical adenitis in Tanzania: a cause for concern? Int J Tuberc Lung Dis, 5, 87-91. Kazwala R.R., Kusiluka L.J.M., Sinclair K., Sharp J.M. & Daborn C.J. 2006. The molecular epidemiology of Mycobacterium bovis infections in Tanzania. Vet Microbiol, 112, 201-210. King L.J., Anderson L.R., Blackmore C.G., Blackwell M.J., Lautner E.A., Marcus L.C., Meyer T.E., Monath T.P., Nave J.E., Ohle J., Pappaioanou M., Sobota J., Stokes W.S., Davis R.M., Glasser J.H. & Mahr R.K. 2008. Executive summary of the AVMA One Health Initiative Task Force Report. J Am Vet Med Assoc, 233, 259-261. Kleeberg H.H. 1984. Human tuberculosis of bovine origin in relation to public health. Rev Sci Tech Off Int Epiz, 3, 11-32. Klement E., Shpigel N., Balicer R.D., Baneth G., Grotto I. & Davidovitch N. 2009. ‘One Health’, from science to policy: examples from the Israeli experience. Vet Ital, 45, 45-53. Komba E.V.G., Komba E.V., Mkupasi E.M., Mbyuzi A.O. Mshamu S., Mzula A. & Luwumba D. 2012. Sanitary practices and occurrence of zoonotic conditions in cattle at slaughter in Morogoro Municipality, Tanzania: implications for public health. Tanzania J Health Res, 14. doi:/10.4314/thrb.v14i2.6. Lamy E., van Harten S., Sales-Baptista E., Guerra M.M.M. & Almeida A.M. 2012. Chapter 2: Factors influencing livestock

Veterinaria Italiana 2014, 50 (1), 7-22. doi: 10.12834/VetIt.1302.08

Lyaschenko K.P., Greenwald R., Esvandiari J., Chambers M.A., Vicente J., Gortazar C., Santos N., Correia-Neves M., Buddle B.M., Jackson R., O’Brien D.J., Schmitt S., Palmer M.V., Delahay R.J. & Waters W.R. 2008. Animal-side serologic assay for rapid detection of Mycobacterium bovis infection in multiple species of free-ranging wildlife. Vet Microbiol, 132, 283-292. Magnus K. 1966. Epidemiological basis of tuberculosis eradication 3. Risk of pulmonary tuberculosis after human and bovine infection. Bull World Health Org, 35, 483-508. Majoor C.J., Magis-Escurra C., van Ingen J., Boeree M.J. & van Soolingen D. 2011. Epidemiology of Mycobacterium bovis disease in humans, the Netherlands, 1993-2007. Emerg Infect Dis, 17, 457-463. Marcotić A., Krajinović L.C., Margaletić J., Turk N., MitelićMedved M., Žmak L., Janković M., Kurolt I.C., Šoprek S., Ðaković Rode O., Milas Z., Pujiz I., Ledina D., Hukić M. & Kuzman I. 2009. Zoonoses and vector-borne diseases in Croatia – a multidisciplinary approach. Vet Ital, 45, 55-66. Mbugi E.V., Kayunze K.A., Katale B.Z., Kendall S., Good L., Kibik G.S., Keyyu J.D., Godfrey-Faussett P., van Helden P. & Matee M.I. 2012a. ‘One Health’ infectious diseases surveillance in Tanzania: are we all on board the same flight? Onderstepoort J Vet Res, 79, 500. doi: 10.4102/ ojvr.v79i2.500. Mbugi E.V., Katale B.Z., Kendall S., Good L., Kibiki G.S., Keyyu J.D., Godfrey-Faussett P., van Helden P. & Matee M.I. 2012b. Tuberculosis cross-species transmission in Tanzania: towards a One-Health concept. Onderstepoort J Vet Res, 79, 501. doi: 10.4102/ojvr.v79i2.501.

Preventing and controlling zoonotic tuberculosis: a One Health approach

Meisser A., Schelling E. & Zinsstag J. 2011. One Health in Switzerland: a visionary concept at a crossroads? Swiss Med Wkly, 141, w13201.

among the Luo in Western Kenya. Anthropol Med, 13, 13-24.

Merianos A. 2007. Surveillance and response to disease emergence. Curr Topics Microbiol Immunol, 315, 477509. doi:10.1007/978-3-540-70962-6_19.

O’Brien D.J., Schmitt S.M., Fitzgerald S.D., Berry D.E. & Hickling G.J. 2006. Managing the wildlife reservoir of Mycobacterium bovis: The Michigan, USA, experience. Vet Microbiol, 112, 313-323.

Milian-Suazo F., Pérez-Guerrero L., Arriaga-Díaz C. & Escartín-Chávez M. 2010. Molecular epidemiology of human cases of tuberculosis by Mycobacterium bovis in Mexico. Prev Vet Med, 97, 37-44.

O’Brien D.J., Schmitt S.M., Fitzgerald S.D. & Berry DE. 2011. Management of bovine tuberculosis in Michigan wildlife: current status and near term prospects. Vet Microbiol, 151, 179-187.

Miller R., Kaneene J.B., Schmitt S.M., Lusch D.P. & Fitzgerald S.D. 2007. Spatial analysis of Mycobacterium bovis infection in white-tailed deer (Odocoileus virginianus) in Michigan, USA. Prev Vet Med, 82, 111-122.

Okada M. & Kita Y. 2010. Tuberculosis vaccine development: the development of novel (preclinical) DNA vaccine. Human Vaccines, 64, 297-308.

Monath T.P., Kahn L.H. & Kaplan B. 2010. Introduction: One health perspective. ILAR J, 51, 193-198. Muma J.B., Simuunza M., Mwachalimba K., Munyeme M., Namangala B., Hankanga C., Sijumbila G., Ndonyo R.L., Sinkala Y., Mwanza A. & Mweene A.S. 2012. Development of a curriculum for training in One Health analytical epidemiology at the University of Zambia. Onderstepoort J Vet Res, 79(2), 475. doi: /10.4102/ojvr. v79i2.475. Munyeme M., Muma J.B., Skjerve E., Nambota A.M., Phiri I.G.K., Samui K.L., Dorny P. & Tryland M. 2008. Risk factors associated with bovine tuberculosis in traditional cattle of the livestock/wildlife interface areas in the Kafue basin of Zambia. Prev Vet Med, 85, 317-328. Munyeme M., Muma J.B., Munang’andu H., Kankya C., Skjerve E. & Tryland M. 2010. Cattle owner’s awareness of bovine tuberculosis in high and low prevalence settings of the wildlife-livestock interface areas in Zambia. BMC Vet Res, 6, 21. doi: 10.1186/1746-6148-6-21. Nara P.L., Nara D., Chaudhuri R, Lin G. & Tobin G. 2008. Perspectives on advancing preventative medicine through vaccinology at the comparative veterinary, human and conservation medicine interface: Not missing the opportunities. Vaccine, 26, 6200-6211. Narrod C., Zinsstag J. & Tiongco M. 2012. A One Health framework for estimating the economic costs of zoonotic diseases on society. EcoHealth, 9, 150-162. Nastasee S. 2008. Zoonotic tuberculosis in Africa. Med J Ther Africa, 2, 53-58. Nawaz A., Chaudhry Z.I., Shahid M., Gul S., Khan F.A. & Hussain M. 2012. Detection of Mycobacterium tuberculosis and Mycobacterium bovis in sputum and blood samples of human. J Anim Plant Sci, 22, 117-120. Nishi J.S., Shury T. & Elkin B.T. 2006. Wildlife reservoirs for bovine tuberculosis (Mycobacterium bovis) in Canada: Strategies for management and research. Vet Microbiol, 112, 325-338.

Kaneene et al.

Okafor C.C., Grooms D.L., Bruning-Fann C.S., Averill J.J. & Kaneene J.B. 2011. Descriptive epidemiology of bovine tuberculosis in Michigan (1975-2010): lessons learned. Vet Med Int, 11, 874924. doi:10.4061/2011/874924. Omer M.K., Skjerve E., Woldehiwet Z. & Holstad G. 2001. A cross-sectional study of bovine tuberculosis in dairy farms in Asmara, Eritrea. Trop Anim Health Prod, 33, 295-303. One Health Commission (OHC). 2012. One Health Commission: About us: History (www. onehealthcommission.org/en/why_one_health/ about_us/history/ accessed on 16 October 2012). One Health Global Network. 2012. One Health Global Network Webportal: Training (www.onehealthglobal. net/?page_id=43 accessed on 16 October 2012). One Health Initiative (OHI). 2012a. One Health Initiative Supporters (www.onehealthinitiative.com/supporters. php accessed on 16 October 2012). One Health Initiative (OHI). 2012b. One Health Initiative Contact (www.onehealthinitiative.com/contact.php accessed on 16 October 2012). Osofsky S.A., Kock R.A., Kock M.D., Kalema-Zikusoka G., Grahn R., Leyland T. & Karesh W. 2005. Chapter 5. Building support for protected areas using a “One Health” perspective. In Friends for life: new partners in support of protected areas. (J.A. McNeely, ed). International Union for Conservation of Nature (IUCN), Gland and Cambridge, 65-79. Palmer M. 2007. Tuberculosis: a reemerging disease at the interface of domestic animals and wildlife. Curr Topics Microbiol Immunol, 315, 195-215. Palmer M.V., Whipple D.L. & Waters W.R. 2001. Experimental deer-to-deer transmission of Mycobacterium bovis. Am J Vet Res, 62, 692-696. Palmer M.V., Waters W.R. & Whipple D.L. 2004. Investigation of the transmission of Mycobacterium bovis from deer to cattle through indirect contact. Am J Vet Res, 65, 1483-1489.

Nugent G., Whitford J., Yockney I.J. & Cross M.L. 2012. Reduced spillover transmission of Mycobacterium bovis to feral pigs (Sus scofa) following population control of brushtail possums (Trichosurus vulpecula). Epidemiol Infect, 140, 1036-1047.

Palmer M.V., Thacker T.C., Waters W.R., Robbe-Austerman S. & Harris B.N. 2010. Investigations on deer to deer and deer to cattle transmission of the vaccine Mycobacterium bovis Bacillus Calmette-Guérin (BCG). J of Vaccines & Vaccination, 1 (2), 104. doi:10.4172/21577560.1000104.

Nyamanga P.A., Suda C. & Aagaard-Hansen J. 2006. Similarities between human and livestock illnesses

Palmer M.V., Thacker T.C., Waters W.R., Gortázar C. & Corner L.A.L. 2012a. Mycobacterium bovis: a model pathogen

Veterinaria Italiana 2014, 50 (1), 7-22. doi: 10.12834/VetIt.1302.08

Kaneene et al.

at the interface of livestock, wildlife, and humans. Vet Med Int, 12, 236205. doi:10.1155/2012/236205. Palmer M.V., Thacker T.C., Waters W.R., Robbe-Austerman S. & Aldwell F.E. 2012b. Persistence of Mycobacterium bovis bacillus Calmette-Guerin (BCG) Danish in whitetailed deer (Odocoileus virginianus) vaccinated with a lipid-formulated oral vaccine. Transbound Emerg Dis, doi:10.1111/tbed.12032. Park D., Qin H., Jain S., Preziosi M., Minuto J.J., Mathews W.C., Moser K.S. & Benson C.A. 2010. Tuberculosis due to Mycobacterium bovis in patients coinfected with Human Immunodeficiency Virus. Clin Infect Dis, 51, 1343-1346. Rabinowitz P., Scotch M. & Conti L. 2009. Human and animal sentinels for shared health risks. Vet Ital, 45, 23-34. Rapport D.J., Böhm G., Buckingham D., Cairns J. Jr, Costanza R., Karr J.R., De Kruijf H.A.M., Levins R., McMichael A.J., Nielsen N.O. & Whitford W.G. 1999. Ecosystem health: the concept, the ISEH, and the important tasks ahead. Ecosystem Health, 5, 82-90. Rass N. 2006. Policies and strategies to address the vulnerability of pastoralists in sub-Saharan Africa. (PPLPI Working Paper No. 37). Rome: Food and Agriculture Organization of the United Nations (www. fao.org/ag/againfo/projects/en/pplpi/publications. html accessed on 16 September 2012).

Preventing and controlling zoonotic tuberculosis: a One Health approach

Rweyemamu M.M., Paweska J., Kambarage D. & Namube F. 2012. Towards one Africa, one health: the Southern African Centre for Infectious Disease Surveillance One Health focus on infectious diseases. Onderstepoort J Vet Res, 79, 449-450. Santos N., Correia-Neves M., Almeida V. & Gortázar C. 2012. Chapter 14. Wildlife tuberculosis: a systematic review of the epidemiology in Iberian Peninsula. In Epidemology Insights (Cunha M.L.R. ed.) InTech ( w w w. i nte c h o p e n . co m / b o o k s / e p i d e m i o l o g yinsights/wildlife-tuberculosis-a-systematic-review-oftheepidemiology-in-the-iberian-peninsula accessed on 16 October 2012). Schelling E., Diguimbaye C., Daoud S., Nicolet J., Boerlin P., Tanner M. & Zinsstag J. 2003. Brucellosis and Q.-fever seroprevalences of nomadic pastoralists and their livestock in Chad. Prev Vet Med, 61, 279-293. Schelling E., Wyss K., Bechir M., Moto D.D. & Zinsstag J. 2005. Synergy between public health and veterinary services to deliver human and animal health interventions in rural low income settings. Br Med J, 331, 1264-1267. Schwabe C. 1984. Veterinary medicine and human health, 3rd ed. Baltimore: Williams and Wilkins. Shears P. 2000. Communicable disease surveillance with limited resources: the scope to link human and veterinary programmes. Acta Tropica, 76, 3-7.

Regassa A., Medhin G. & Ameni G. 2008. Bovine tuberculosis is more prevalent in cattle owned by farmers with active tuberculosis in central Ethiopia. Vet J, 78, 119-125.

Shirima G.M., Fitzpatrick J., Cleaveland S., Kambarage D.M., Kazwala R.R., Kunda J. & French N.P. 2003. Participatory survey on zoonotic diseases affecting livestock keeping communities in Tanzania. J Anim Vet Adv, 2, 253-258.

Riedner G.J. 2012. Mayor Nancy Chaney Participates in National League of Cities Conference (USA) (www. onehealthinitiative.com/news.php accessed 18 November 2012).

Shrikirishna D., de la Rua-Domenech R., Smith N.H., Colloff A. & Coutts I. 2009. Human and canine pulmonary Mycobacterium bovis in the same household: reemergence of an old zoonotic threat? Thorax, 64, 89-91.

Rock M., Buntain B.J., Hatfield J.M. & Hallgrímsson B. 2009. Animal-human connections, ‘‘One Health,’’ and the syndemic approach to prevention. Social Sci Med, 68, 991-995.

Siembieda J.L., Kock R.A., McCracken T.A. & Newman S.H. 2011. The role of wildlife in transboundary animal diseases. Animal Health Res Rev, 12, 95-111.

Rodríguez E., Sánchez L.P., Pérez S., Herrera L., Jiménez M.S., Samper S. & Iglesias M.J. 2009. Human tuberculosis due to Mycobacterium bovis and M. caprae in Spain, 20042007. Int J Tuberc Lung Dis, 13, 1536-1541. Rodwell T.C., Moore M., Moser K.S., Brodine S.K. & Strathdee S.A. 2008. Tuberculosis from Mycobacterium bovis in binational communities, United States. Emerg Infect Dis, 14, 909-916. Rodwell T.C., Kapasi A.J., Moore M., Milian-Suazo F., Harris B., Guerrero L.P., Moser K., Strathdee S.A. & Garfein R.S. 2010. Tracing the origins of Mycobacterium bovis tuberculosis in humans in the USA to cattle in Mexico using spoligotyping. Int J Infect Dis, 145, e129-e135.

Singer M.C. 2009. Doorways in nature: syndemics, zoonotics, and public health. A commentary on Rock, Buntain, Hatfield & Hallgrímsson. Social Sci Med, 68, 996-999. Sjögren I. & Sutherland I. 1974. Studies of tuberculosis in man in relation to infection in cattle. Tubercule, 56, 113-127. Souto W.M.S., Mourão J.S., Barboza R.R.D. & Alves R.R.N. 2011. Parallels between zootherapeutic practices in ethnoveterinary and human complementary medicine in northeastern Brazil. J Ethnopharmacology, 134, 753-767. Steele J.H. 2008. Veterinary public health: past success, new opportunities. Prev Vet Med, 86, 224-243.

Romero B., Rodríguez S., Bezos J., Díaz R., Copano M.F., Merediz I., Mínguez O., Marqués S., Palacios J.J., Viedma D.G., Sáez J.L., Mateos A., Aranaz A., Domínguez L. & Juan L. 2011. Humans as source of Mycobacterium tuberculosis infection in cattle, Spain. Emerg Infect Dis, 17, 2393-2395.

Sunder S., Lanotte P., Godreuil S., Martin C., Boschiroli M.L. & Besnier J.M. 2009. Human-to-human transmission of tuberculosis caused by Mycobacterium bovis in immunocompetent patients. J Clin Microbiol, 47, 1249-1251.

Roth F., Zinsstag J., Orkhon D., Chimed-Ochir G., Hutton G., Cosivi O., Carrin G. & Otte J. 2003. Human health benefits from livestock vaccination for brucellosis: case study. Bull WHO, 81, 867-876.

Thakur A., Sharma M., Katoch V.C., Dhar P. & Katoch R.C. 2012. Detection of Mycobacterium bovis and Mycobacterium tuberculosis from cattle: possible public health relevance. Indian J Microbiol, 52, 289-291.

Veterinaria Italiana 2014, 50 (1), 7-22. doi: 10.12834/VetIt.1302.08

Preventing and controlling zoonotic tuberculosis: a One Health approach

Thoen C.O., LoBue P.A., Enarson D.A., Kaneene J.B. & de Kantor I.N. 2009. Tuberculosis: a re-emerging disease in animals and humans. Vet Ital, 45, 135-181. Tibbo M., Schelling E., Grace D., Bishop R., Taracha E., Kemp S., Ameni G., Dawo F. & Randolph T. 2008. Crossdisciplinary and participatory livestock and human health research for successful control of zoonoses in the developing world. Ethiop J Health Dev, 22, 109-116. Torgerson P.R. & Torgerson D.J. 2009. Public health and bovine tuberculosis: what’s all the fuss about? Trend Microbiol, 18, 67-72. Van Soolingen D., de Haas P.E.W., Haagsma J., Eger T., Hermans P.W., Ritacco V., Alito A. & van Embden J.D. 1994. Use of various genetic markers in differentiation of Mycobacterium bovis strains from animals and humans and for studying epidemiology of bovine tuberculosis. J Clin Microbiol, 32, 2425-2433. Vrbova L., Stephen C., Kasman N., Boehnke R., DoyleWaters M., Chablitt-Clark A., Gibson B., FitzGerald M. & Patrick D.M. 2010. Systematic review of surveillance systems for emerging zoonotic diseases. Transbound Emerg Dis, 57, 154-161.

Winthrop K.L., Scott J., Brown D., Jay M.T., Rios R., Mase S., Richardson D., Edmonson A., MacLean M. & Flood J. 2005. Investigation of human contacts: a Mycobacterium bovis outbreak among cattle at a California dairy. Int J Tuberc Lung Dis, 9, 809-813. World Bank. 2010a. People, Pathogens and Our Planet – Volume 1: Towards a One Health approach for controlling zoonotic diseases. The World Bank, Report 50833-GLB. World Bank. 2010b. People, Pathogens and Our Planet – Volume 2: The Economics of One Health. World Bank, Report 69145-GLB. World Health Organization (WHO). 2006. The control of neglected zoonotic diseases: a route to poverty alleviation’, Report of a Joint WHO/DFID-AHP Meeting with the participation of FAO and OIE, Geneva, 20-21 September 2005 (whqlibdoc.who.int/ publications/2006/9789241594301_eng.pdf accessed on 28 August 2012). Young D., Stark J. & Kirschner D. 2008. Systems biology of persistent infection: tuberculosis as a case study. Nat Rev Microbiol, 6, 520-528.

Wadhwa A., Hickling G.J. & Eda S. 2012. Opportunities for improved serodiagnosis of human tuberculosis, bovine tuberculosis, and paratuberculosis. Vet Med Int, 12, 674238. doi:10.1155/2012/674238.

Zinsstag J., Schelling E., Wyss K. & Mahamat M.B. 2005. Potential of cooperation between human and animal health to strengthen health systems. Lancet, 366, 2142-2145.

Waters W.R., Palmer M.V., Buddle B.M. & Vordermeier H.M. 2012. Bovine tuberculosis vaccine research: historical perspectives and recent advances. Vaccine, 30, 2611-2622.

Zinsstag J., Schelling E., Roth F. & Kazwala R. 2008. Chapter 9. Economics of Bovine Tuberculosis. In Mycobacterium bovis infection in animals and humans, 2nd ed. (C.O. Thoen, J.H. Steele, M.L. Gilsdorf, eds). Blackwell Publishing, Ames, Iowa, 68-83.

Wedlock D.N., Aldwell F.E., Keen D., Skinner M.A. & Buddle B.M. 2005. Oral vaccination of brushtail possums (Trichosurus vulpecula) with BCG: immune responses, persistence of BCG in lymphoid organs and excretion in faeces. N Z Vet J, 53, 301-306. Wilkins M.J., Meyerson J., Bartlett P.C., Spieldenner S.L., Berry D.E., Mosher L.B., Kaneene J.B., RobinsonDunn B., Stobierski M.G. & Boulton M.L. 2008. Human Mycobacterium bovis infection and bovine tuberculosis outbreak, Michigan, 1994-2007. Emerg Infect Dis, 14, 657-660.

Kaneene et al.

Zinsstag J., Schelling E., Bonfoh B., Fooks A.R., Kasymbekov J., Waltner-Toews D. & Tanner M. 2009. Towards a ‘One Health’ research and application toolbox. Vet Ital, 45, 121-133. Zinnstag J., Schelling E., Waltner-Toews D. & Tanner M. 2011. From “One Medicine” to “One Health” and systemic approaches to health and well-being. Prev Vet Med, 101, 148-156.

Veterinaria Italiana 2014, 50 (1), 7-22. doi: 10.12834/VetIt.1302.08

Molecular characterization and antimicrobial resistance of faecal and urinary Escherichia coli isolated from dogs and humans in Italy Clara Tramuta1, Patrizia Robino1, Daniele Nucera2, Sara Salvarani1, Giuliana Banche3, Aurelio Malabaila4 & Patrizia Nebbia1* 1

Department of Veterinary Sciences, University of Turin, Via Leonardo da Vinci 44, 10095 Grugliasco, Torino, Italy. 2 Department of Agricultural, Forestry and Food Sciences, University of Turin, Via Leonardo da Vinci 44, 10095 Grugliasco, Torino, Italy. 3 Department of Public Health and Microbiology, University of Turin, Via Santena 9, 10126 Torino, Italy. 4 Analysis Laboratory and Microbiology, Infermi Hospital, Via Caraccio 5, 13900 Biella, Italy. * Corresponding author at: Department of Veterinary Sciences, University of Turin, Via Leonardo da Vinci 44, 10095 Grugliasco, Torino, Italy. Tel.: +39 011 6709188, e-mail: patrizia.nebbia@unito.it

Veterinaria Italiana 2014, 50 (1), 23-30. doi: 10.12834/VetIt.1304.09

Accepted: 21.02.2014 | Available on line: 31.03.2014

Keywords Antibiotic resistance, Dog, Escherichia coli, Human, Phylogenetic group, Virulence factors.

Summary During this study, 109 faecal Escherichia coli samples isolated from 61 dogs and 48 humans were characterised according to phylogenetic group, extraintestinal virulence factors and antibiotic resistance. The isolates from dogs were predominantly distributed within phylogroup B1 (36%), while the majority of human strains belonged to phylogroup B2 (54%). The prevalence of cnf1, hlyA, papC and sfa virulence genes was significantly associated with the group B2. Canine isolates showed multidrug resistance (MDR) more frequently than human strains. Since group B2 contains most of the strains that cause extraintestinal infections, all 46 B2 faecal strains were confronted against an addition population of 57 urinary E. coli strains belonging to the same phylogroup. The comparison shows that there was no significant difference in the occurrence of virulence factors or in the distribution of antibiotic resistance between faecal and urinary E. coli isolates fromd dogs. At the same time, a highly significant association was detected between multiple resistence and the source of the strains and between MDR and E. coli isolated from urine in human. This study highlighted similar features of E. coli isolated across sources and hosts. The data suggest a high prevalence of antibiotic resistance in faecal strains, which may represent a serious health risk since these strains can function as a reservoir for uropathogenic E. coli.

Caratterizzazione molecolare e resistenza antimicrobica di Escherichia coli fecali e urinari isolati in cane e uomo in Italia Parole chiave Cane, Escherichia coli, Gruppo filogenetico, Fattore di virulenza, Resistenza antimicrobica, Uomo.

Riassunto Lo studio ha coinvolto 109 campioni di Escherichia coli fecali isolati da 61 cani e 48 uomini. I campioni sono stati caratterizzati in base al gruppo filogenetico, alla presenza di fattori di virulenza extraintestinali e alla resistenza antimicrobica. Gli isolati provenienti da cani si sono distribuiti principalmente nel filogruppo B1 (36%), la maggior parte dei ceppi umani nel filogruppo B2 (54%). Lo studio ha mostrato come la prevalenza dei geni di virulenza cnf1, hlyA, papC e sfa fosse significativamente associata al gruppo B2 e gli isolati canini presentassero multi-resistenza (MDR) con frequenza maggiore rispetto ai ceppi umani. Poiché al gruppo B2 sono risultati appartenere ceppi responsabili di infezioni extraintestinali, i 46 ceppi fecali del filogruppo B2 sono stati comparati con 57 isolati urinari associati anch’essi al gruppo B2. Tra i ceppi fecali e urinari non sono state osservate differenze concernenti la distribuzione dei fattori di virulenza e la prevalenza dell’antibiotico-resistenza ma è stata osservata un’associazione altamente significativa sia tra multi-resistenza e origine dei campioni sia tra MDR ed Escherichia coli urinari nei ceppi umani. Gli isolati hanno mostrato caratteristiche simili rispetto alla provenienza e all’ospite. Lo studio ha permesso di evidenziare nei ceppi fecali un’alta prevalenza di resistenza antibiotica, aspetto che rappresenta un serio rischio, in quanto questi stessi ceppi possono comportarsi come serbatoi di Escherichia coli uropatogeni.

Faecal and urinary E. coli in dogs and humans in Italy

Introduction Escherichia coli is a normal inhabitant of the mammalian intestine, including the human intestine. The gut also constitutes an important reservoir of strains that cause extraintestinal infections, such as urinary tract infection (UTI). Uropathogenic E. coli (UPEC) is often marked by the presence of special virulence factors, such as P and S pili, afimbrial adhesins, siderophores and toxins (Féria et al. 2006), and all of these traits can be encoded on mobile genetic elements, such as plasmids, bacteriophages and pathogenicity-associated islands (PAIs) (Sabate et al. 2006). Most pathogenic E. coli strains belong to group B2 or, to a lesser extent, to group D (Zhang et al. 2002), while commensal E. coli belong mostly to phylogenetic groups A and B1 and generally lack virulence factors (Duriez et al. 2001, Moreno et al. 2006). Urinary tract infections (UTIs) in humans and dogs present an important clinical problem, i.e. the presence of virulence factors and the microorganisms’ abilities to colonize tissues, which frequently proves difficult to resolve due to antimicrobial resistance. In some instances, these characteristics contribute to the chronicity and persistence of the pathology (Idress et al. 2010). Although antimicrobial therapy is often able to provide an efficient treatment for UTI infections, resistance to antimicrobials is widespread and is an aspect of growing concern, in human as well as in veterinary medicine (Harada et al. 2012, Johnson et al. 2003). The transmission of E. coli between pet animals and humans was recently documented; specifically, extraintestinal pathogenic E. coli (ExPEC) isolated from dog were shown to infect humans causing urinary diseases (Johnson et al. 2008, Stenske et al. 2009). No report of E. coli transmission between pet animals and humans has yet been reported in Italy, nor have investigations been conducted so far to characterise E. coli isolated from human and pet hosts living in the same geographical area. The aims of this study were: i) to characterise canine and human faecal E. coli populations according to phylogenetic group, virulence profile and antibiotic resistance status; ii) to analyse the differences between B2 strains isolated from faecal vs. urinary samples.

Material and methods Samples and E. coli strains In 2011, 109 faecal samples were collected from humans and dogs living in the same geographical area (North-Eastern Piedmont, Italy): 61 from dogs (of various breed, 35 females and 26 males; mean age 7 years within the range of 2 - 13 years). Forty-eight samples were collected from human volunteers (28 females and 20 males; mean age 43 years, within

Tramuta et al.

the range of 30 - 55 years). Neither dogs nor humans had undergone antibiotic therapy in the 6 months prior the sampling and all the sampled individuals were seemingly healthy, presenting no clinical signs of gastro-intestinal tract disorders at the time of sample collection. Each faecal specimen was streaked onto MacConkey Agar (Oxoid, Basingstoke, UK) and incubated overnight at 37°C. One putative E. coli colony per sample was arbitrarily selected from the solid medium and subjected to the BBL Crystal test (Becton Dickinson, Franklin Lakes, NJ, USA) in order to identify E. coli isolates. All identified E. coli strains were stored at -80 °C in Luria-Bertani broth (Oxoid, Basingstoke, UK) containing 15% glycerol until further testing. For comparative purposes, a collection of 57 urinary E. coli belonging to phylogroup B2 was also included in this study: 27 samples isolated from dogs (21 females and 6 males; mean age 7 years, within the range of 2 - 13 years) with uncomplicated cystitis (Salvarani et al. 2011, Tramuta et al. 2011); and 30 samples isolated from hospitalised humans with UTI (all women; mean age 47 years, within the range of 29 - 75 years). No subject had received any antimicrobial therapy in the preceding 6 months. The 30 human urine samples had been collected from patients living in the North-Eastern area of Piedmont, between January 2008 - April 2011 (unpublished data).

DNA extraction All E. coli strains were cultured on Tryptic Soy Agar (Oxoid, Basingstoke, UK) for 20 hrs at 37°C. The bacterial genomic DNA was extracted using a commercially available kit (InstaGene DNA, BioRad, Philadelphia, PA, USA), following the manufacturer’s instructions.

Detection of phylogenetic groups and virulence genes Faecal strains were assigned to 1 of the 4 major phylogenetic groups (A, B1, B2 and D) by detecting the presence of specific marker genes (chuA, yjaA and tspE4.C2) using a triplex polymerase chain reaction (PCR) method. Virulence genes were also detected by PCR, using primers targeting 7 extraintestinal putative virulence factors, which included adhesion genes (afa, papC, and sfa), toxin genes (cdt, cnf1, and hlyA) and the aerobactin receptor gene (iutA) (Table I).

Antimicrobial susceptibility test All E. coli strains were tested for antimicrobial susceptibility using the agar disk diffusion

Veterinaria Italiana 2014, 50 (1), 23-30. doi: 10.12834/VetIt.1304.09

Tramuta et al.

Faecal and urinary E. coli in dogs and humans in Italy

Table I. Polymerase chain reaction primers used to detect phylogenetic groups and extraintestinal virulence factors genes of E. coli in samples collected in 2011 in the North-Eastern Piedimont, Italy. Target gene chuA yjaA tspE4.C2 afa papC sfa

cdt

cnf1 hlyA iutA

Primer sequence (5’ to 3’) GACGAACCAACGGTCAGGAT TGCCGCCAGTACCAAAGACA TGAAGTGTCAGGAGACGCTG ATGGAGAATGCGTTCCTCAAC GAGTAATGTCGGGGCATTCA CGCGCCAACAAAGTATTACG GCTGGGCAGCAAACTGATAACTCTC CATCAAGCTGTTTTGTTCGTCCGCCG GACGGCTGTACTGCAGGGTGTGGCG ATATCCTTTCTGCAGGGATGCAATA CTCCGGAGAACTGGGTGCATCTTAC CGGAGGAGTAATTACAAACCTGGCA GAAAGTAAATGGAATATAAATGTCCG AAATCACCAAGAATCATCCAGTTA GAAAATAAATGGAACACACATGTCCG AAATCTCCTGCAATCATCCAGTTA GGCGACAAATGCAGTATTGCTTGG GACGTTGGTTGCGGTAATTTTGGG AACAAGGATAAGCACTGTTCTGGCT ACCATATAAGCGGTCATTCCCGTCA ATGAGCATATCTCCGGACG CAGGTCGAAGAACATCTGG

Product size (bp)

Annealing temp (°C)

Reference

279

Clermont et al. 2000

211

Clermont et al. 2000

152

Clermont et al. 2000

750

Le Bouguenec et al. 1992

328

Le Bouguenec et al. 1992

410

Le Bouguenec et al. 1992

466

method, according to the guidelines provided by the Clinical and Laboratory Standards Institute (CLSI)1. The following antibiotics (Oxoid, Basingstoke, UK) were used: cephalothin 30 µg (KF), cefotaxime 30 µg (CTX), gentamicin 10 µg (CN), imipenem 10 µg (IPM), piperacillin 100 µg (PRL), sulfamethoxazole‑trimethoprim 25 µg (SXT) and a fluoroquinolone: ciprofloxacin 5 μg (CIP) for human strains and enrofloxacin 5 μg (ENR) for canine strains. Strains showing intermediate susceptibility were defined as resistant; and multidrug-resistant (MDR) strains were defined as those resistant to antimicrobials belonging to at least 3 of the following classes of antibiotics: aminoglycosides, carbapenems, cephalosporines (cefotaxime), fluoroquinolones, penicillins, sulfamethoxazole‑trimethoprim.

Statistical analyses Data were organized into 2x2 tables considering the presence/absence of the virulence factor/ 1

C linical and Laboratory Standards Institute. Performance standards for antimicrobial susceptibility testing. Twentieth informational Supplement. Document M100-S20. Wayne, PA, CLSI, 2010.

Veterinaria Italiana 2014, 50 (1), 23-30. doi: 10.12834/VetIt.1304.09

Tòth et al. 2003 466

522

Pass et al. 2000

1177

Yamamoto et al. 1995

587

Moulin-Schouleur et al. 2006

antibiotic resistance as the outcome variable and the source of the strain (fecal/urinary) as the exposure variable. Tables were analyzed using EPIINFO v. 6 by performing a stratified analysis, considering the species as the stratum variable. The same stratified analysis was performed for faecal strains, considering the association between the presence of virulence traits/antibiotic resistance and strain phylogroup (B2 versus non B2). The χ2 test and the Fisher’s Exact probability test (FEP) were used to assess the significance of the associations in single strata, and the Mantel–Haenszel χ2 was calculated for the summary analysis. In addition, for B2 strains, in order to evaluate the association between MDR and the source of strain, the same stratified analysis was performed considering the species as the stratum variable. P values <0.05 were considered statistically significant, and P values <0.01 were considered highly significant. Within each phylogroup, faecal strains were compared between species with respect to aggregate virulence factors scores (calculated by adding up the number of virulence genes possessed by each strain). A similar analysis was performed for urinary strains (all belonging to phylogroup B2). All comparisons were made using the Mann-Whitney U test, considering P<0.05 to be significant.

Faecal and urinary E. coli in dogs and humans in Italy

Tramuta et al.

Results Distribution of phylogenetic groups, virulence factors and antibiotic resistance in faecal strains The distribution of the phylogenetic groups differed depending on the species. In dogs (n = 61 strains), 36% of isolates belonged to group B1, 33% to group B2, 26% to group A, and 5% to group D. In humans (n = 48 strains), phylogroup B2 was predominant (54%) followed by phylogroups A (25%) and D (21%) – no human strains belonged to group B1.

The detection of virulence factors using PCR revealed that 52 (48%) of all strains (n = 109) were positive for at least 1 of the virulence genes tested; of these strains, 24 (46%) were canine and 28 (54%) were human. In the strains isolated from dogs, sfa and hlyA were the most common virulence genes identified (20% and 18%, respectively), followed by iut (15%), cnf and pap (13% each), while afa and cdt were never detected. In the human strains, iutA, hlyA and papC were the most common virulence genes detected, present in 38%, 31% and 31% of cases, respectively, followed by cnf and sfa (21% each), whereas afa and cdt genes were never detected (Table II). In strains belonging to phylogroup B2,

Table II. Frequency of virulence genes (%) in relation to phylogenetic group (FG) among faecal and urinary E. coli isolated from dog and human samples collected in 2011 in the North-Eastern Piedimont, Italy. Source

Canine faeces

Human faeces

Canine urine Human urine

No. strains

Total A B1 B2 D Total A B1 B2 D B2 B2

61 16 (26) 22 (36) 20 (33) 3 (5) 48 12 (25) 0 26 (54) 10 (21) 27 30

afa 0 0 0 0 0 0 0 0 0 1 (4) 0

cdt 0 0 0 0 0 0 0 0 0 2 (7) 0

Virulence genes (%) cnf1 hlyA iutA 8 (13) 11 (18) 9 (15) 0 0 0 0 3 (14) 5 (23) 8 (40) 8 (40) 2 (10) 0 0 2 (67) 10 (21) 15 (31) 18 (38) 0 0 4 (33) 10 (38) 11 (42) 10 (38) 0 4 (40) 4 (40) 21 (78) 8 (30) 6 (22) 7 (23) 10 (33) 17 (57)

papC 8 (13) 0 0 8 (40) 0 15 (31) 2 (17) 11 (42) 2 (20) 19 (70) 12 (40)

sfa 12 (20) 2 (13) 0 10 (50) 0 10 (21) 0 10 (38) 0 22 (81) 6 (20)

Table III. Frequency of antibiotic resistance (%) in relation to phylogenetic group among faecal and urinary E. coli isolated from dog and human samples collected in 2011 in the North-Eastern Piedimont, Italy. Source

Canine faeces

Human faeces

Canine urine Human urine

No. strains

Total A B1 B2 D Total A B1 B2 D B2 B2

61 16 (26) 22 (36) 20 (33) 3 (5) 48 12 (25) 0 26 (54) 10 (21) 27 30

CN 16 (26) 6 (38) 2 (9) 7 (35) 1 (33) 29 (60) 12 (100) 16 (62) 1 (10) 6 (22) 5 (17)

CTX 10 (16) 2 (13) 3 (14) 3 (15) 2 (67) 0 0 0 0 2 (7) 12 (40)

Antibiotic resistance* (%) ENR/CIP IPM KF 7 (11) 0 55 (90) 0 0 13 (81) 2 (9) 0 20 (91) 3 (15) 0 19 (95) 2 (67) 0 3 (100) 3 (6) 0 19 (40) 0 0 8 (67) 3 (12) 0 11 (42) 0 0 0 5 (19) 0 10 (37) 10 (33) 0 16 (53)

PRL 21 (34) 6 (38) 6 (27) 6 (30) 3 (100) 19 (40) 6 (50) 10 (38) 3 (30) 7 (26) 17 (57)

SXT 13 (21) 2 (13) 6 (27) 4 (20) 1 (33) 4 (8) 2 (17) 2 (8) 0 4 (15) 7 (23)

As determined by the disk diffusion method. FG = phylogenetic group; CN = gentamicin; CTX = cefotaxime; ENR = enrofloxacin (used for canine strains); CIP = ciprofloxacin (used for human strains); IPM = imipenem; KF = cephalothin; PRL = piperacillin; SXT = sulfamethoxazole-trimethoprim. *

Veterinaria Italiana 2014, 50 (1), 23-30. doi: 10.12834/VetIt.1304.09

Tramuta et al.

Faecal and urinary E. coli in dogs and humans in Italy

Table IV. Main resistance pattern phenotypes detected among the 77 antibiotic resistant isolates of E. coli strains recovered from dogs and humans in phylogroup B2 of the sample collected in 2011 in the North-Eastern Piedimont, Italy. Number of resistance patterns per isolate 6 5

Phenotype of resistance pattern CN, CTX, ENR/CIP, KF, PRL, SXT CN, CTX, KF, PRL, SXT CTX, ENR/CIP, KF, PRL, SXT CN, KF, PRL, SXT ENR/CIP, CN, KF, PRL CTX, KF, PRL, SXT CTX, ENR/CIP, KF, PRL CN, CTX, KF, PRL CN, ENR/CIP, PRL, SXT ENR/CIP, KF, PRL ENR/CIP, KF, SXT CTX, CN, KF CN, KF, PRL CN, PRL, SXT ENR/CIP, PRL, SXT CN, PRL ENR/CIP, KF CTX, KF CN, SXT CN, KF PRL, KF

MDR NON MDR

Faecal isolates B2 (n=42) 2 1 0 1 2 0 0 0 0 1 0 0 3 0 0 4 1 0 2 1 3 6 25

Urine isolates B2 (n=35) 2 0 3 0 0 2 4 1 1 2 1 1 2 1 1 0 0 1 0 2 1 15 16

P-value 0.0306

CN = gentamicin; CTX = cefotaxime; ENR = enrofloxacin (used for canine strains); CIP = ciprofloxacin (used for human strains); IPM = imipenem; KF = cephalothin; PRL = piperacillin; SXT = sulfamethoxazole-trimethoprim.

cnf1, hlyA, papC, and sfa were often present together (38% of isolates). The aggregate virulence scores attributed to canine strains ranged from 0 to 4, the median being 0 (due to the prevalence of null scores); while in human strains, it ranged from 0 to 5, with a median score of 1.5. The results of antibiotic susceptibility tests are summarised in Table III. The large majority of strains (96/109: 58 canine and 38 human) was resistent to at least one antimicrobic, while 13 strains (3 canine and 10 human) were sensitive to all antibiotics tested. Imipenem was the only antibiotic effective on all the strains. The highest frequencies of resistance were observed for cephalothin in canine strains (90%) and for gentamicin in human strains (60%). Fourteen strains (13%) were classified as MDR: 10 (16%) from dogs and 4 (8%) from humans. Among the 46 faecal E. coli strains belonging to phylogroup B2, 42 (91%) were resistant to at least 1 antimicrobic, 21 of these 42 stains were resistant only to 1 antimicrobial molecule. The

Veterinaria Italiana 2014, 50 (1), 23-30. doi: 10.12834/VetIt.1304.09

most frequent resistance pattern phenotypes are reported in Table IV. In particular, 2 antimicrobial combinations were detected in 11 strains, 3 and 4 antimicrobial combinations were observed in 7Â strains, and only 3 strains showed resistance to 5Â or 6 antimicrobials.

Prevalence comparison in faecal strains The only significant difference in phylogroup distribution for the 2 hosts of origin was observed for phylogroup B1, which included 36% of canine strains and none from humans (P<0.001). The stratified analyses on the prevalence of virulence factors across phylogroup, stratifying by species, highlighted that cnf1, papC, hlyA and sfa genes were highly associated with phylogroup B2 (P<0.001). The results of the stratified analyses on antibiotic resistance across phylogroups only revealed a significant association for resistance to cephalothin, which was higher in strains belonging to phylogenetic group B2 than in other groups (P<0.001).

Faecal and urinary E. coli in dogs and humans in Italy

Distribution of virulence factors and antibiotic resistance in urinary strains belonging to phylogroup B2

strains and 11% in urinary tract retrieved strains. Similarly, the stratified analysis did not reveal any significant difference for humans vs. dogs.

The results on the prevalence of virulence factors and antibiotic resistance status for the 57 urinary E. coli strains belonging to phylogroup B2 are reported in Table II and Table III. It is worthwhile noticing that 26 (96%) canine and 24 (80%) human strains had at least 1 virulence factor. The aggregated median virulence score was 4.0 (range 0-5) for canine strains and 1.0 (range 0-5) for human strains, respectively. Thirty-five strains (61%) were resistant to at least 1 of the antimicrobics tested and 10 (29%) isolates showed resistance to just a single antimicrobic. The resistance patterns are reported in Table IV.

When we assessed the association between virulence factors and antibiotic resistance phenotypes, we observed a significant association between the presence of iut and resistance to enrofloxacin/ ciprofloxacin (P<0.01) in urinary strains, and between iut and resistance to sulfamethoxazole‑trimethoprim (P<0.05) in faecal strains. Moreover, the frequency of iut was significantly higher (P<0.05) in MDR E. coli isolated from the urinary tract than in those isolated from faeces.

Prevalence comparisons in urinary strains

A total of 109 E. coli isolates collected from the faeces of healthy dogs (56%) and humans (44%) was tested to determine the phylogenetic group of each strain, the presence of the 7 ExPEC-virulence genes and susceptibility to 8 antibiotics. Finally, the faecal isolates belonging to phylogroup B2 were compared to (previously collected) human urinary E. coli strains of the same phylogroup to investigate the differences in virulence factor and antibiotic resistance prevalence between the 2 sources.

When comparing virulence factor prevalences according to host of origin, cnf1 and sfa were detected in a significantly higher proportion in canine strains over human strains (P<0.001). Conversely, iutA was significantly more predominant in E. coli isolated from humans than in strains isolated from dogs (P<0.05). Moreover, the virulence score was significantly higher for canine than for human strains (Mann Whitney Z = 3.1, P<0.05).

Comparisons between faecal and urinary E. coli strains with respect to virulence factors and antibiotic resistance Strains belonging to phylogroup B2 were chosen for the comparisons because of their potential pathogenicity. Faecal E. coli strains were compared with 2 collections of strains belonging to phylogroup B2 isolated from urine (Table II). In the faecal strains, neither cdt nor afa were detected in the hosts. However, a very low prevalence was detected when analysing urinary strains isolated from dogs. The results of the stratified analyses did not show any significant differences between the prevalence of virulence factors in urinary vs. faecal E. coli. A similar result was obtained when analysing the frequency of the antibiotic resistances (Table III). Conversely, the analysis of multidrug resistance and strain source indicated the presence of a highly significant association between MDR and urinary E. coli in humans (P<0.01), as shown in Table IV. In particular, in E. coli isolated from human urinary specimens the frequency of B2 MDR strains was higher (40%) than the one isolated in human faecal strains (8%). The analysis of the MDR frequency in dog specimens did not reveal any significant differences with regard to faecal vs. urine specimens, with an MDR frequency of 8% in faecal

Tramuta et al.

Discussion

The results show that group B1 is the most prevalent phylogenetic group in canine faecal strains, while B2 is the most frequent group for human faecal strains. These results are consistent with various epidemiological studies, as reported by Tenaillon (Tenaillon et al. 2010). We did not observe human isolates belonging to group B1, the study would need to be repeated using a much larger sample population in order to explore this aspect in more depth. The 48% of B1 strains harboured extraintestinal virulence factors; a figure that is much higher than the prevalences of 22% and 35% previously reported in the literature (Stenske et al. 2009, Usein et al. 2003). The results highlight the presence of isolates harbouring a combination of cnf1, hlyA, papC, and sfa genes, which could implicate the presence of PAIs – typical chromosomal traits of the UPEC strains (Blum et al. 1995). Furthermore, the prevalence of strains showing multiple virulence factor patterns was slightly higher than reported in previous studies (Chen et al. 2003, Kuhar et al. 1998, Yuri et al. 1998) and, as expected, this prevalence was strongly associated with strains belonging to phylogroup B2 (Johnson et al. 2003, Zhang et al. 2002). As expected, the majority of urinary strains (88%) harboured extraintestinal virulence factor‑encoding genes and many strains carried PAIs. Regarding the prevalence of iutA (22% in canine and 57% in human strains), our results are consistent with those of other studies and support the hypothesis that the low prevalence of

Veterinaria Italiana 2014, 50 (1), 23-30. doi: 10.12834/VetIt.1304.09

Tramuta et al.

aerobactin in canine E. coli could indicate that these strains utilise other systems for iron acquisition (Chen et al. 2003, Yamamoto et al. 1995). When we compared strains belonging to phylogroup B2 collected from faeces with those collected from urine, similar frequencies of virulence genes and antibiotic resistance patterns were observed. This observation may support the hypothesis that E. coli residing in the intestinal tract may act as a reservoir for UTIs. This study also revealed an association between the presence of iutA (encoding the aerobactin receptor) and resistance to fluoroquinolones and sulfamethoxazole-trimethoprim. Indeed, previous studies have hypothesized that aerobactinâ&#x20AC;&#x2018;producing strains have a greater chance of survival in a habitat with low iron concentrations than strains that do not produce aerobactin. As a consequence, aerobactin-positive strains are characterised by a greater likelihood of antibiotic resistance acquisition when compared with other strains (Harada et al. 2012). Another interesting result obtained in this research was the low prevalence of MDR strains in both faecal and urinary strains isolated from dogs, in contrast to the high prevalence observed in human urinary strains. This data suggest that in the geographical area considered, the treatment of human E. coli

Veterinaria Italiana 2014, 50 (1), 23-30. doi: 10.12834/VetIt.1304.09

Faecal and urinary E. coli in dogs and humans in Italy

urinary infections represents a problem, which should be emphasized and addressed. The antibiotics showing high resistance frequencies, such as gentamicin and cephalosporins, should not be selected as first choice therapies by clinicians. The use of these antibiotics should be dependent upon the prior execution of in vitro susceptibility testing. Of all the antibiotics tested, imipenem was the only effective drug against all isolated strains, probably due to its infrequent use in both veterinary and human medicine owing to its high cost. In conclusion, the results show that enteric E. coli revealed no significant difference in dogs and humans: both populations commonly belonged to group B2 and were characterised by a similar distribution of virulence factors and antibiotic resistances. However, a large proportion of canine strains also belonged to group B1, whereas no human strains belonged to this phylogenetic group. Considering that in Italy reports on the characterization of faecal E. coli strains are scanty, this research may offer useful insights for both human and veterinary clinicians operating in this country. Further studies should be designed to assess the transmission of extraintestinal strains of faecal origin in pets, with the additional scope of increasing pet ownersâ&#x20AC;&#x2122; awareness of their potential role in the control of the transmission of pathogenic strains of E. coli.

Faecal and urinary E. coli in dogs and humans in Italy

Tramuta et al.

References Blum G., Falbo V., Caprioli A. & Hacker J. 1995. Gene clusters encoding the cytotoxic necrotizing factor type 1, Prsfimbriae and alpha-hemolysin form the pathogenicity island II of the uropathogenic Escherichia coli strain J96. FEMS Microbiol Lett, 126, 189-195. Clermont O., Bonacorsi S. & Bingen E. 2000. Rapid and simple determination of the Escherichia coli phylogenetic group. Appl Environ Microbiol, 66, 4555-4558. Chen Y.M., Wright P.J., Lee C.S. & Browning G.F. 2003. Uropathogenic virulence factors in isolates of Escherichia coli from clinical cases of canine pyometra and faeces of healthy bitches. Vet Microbiol, 94, 57-69. Duriez P., Clermont O., Bonacorsi S., Bingen E., Chaventre A., Elion J., Picard B. & Denamur E. 2001. Commensal Escherichia coli isolates are phylogenetically distributed among geographically distinct human populations. Microbiology, 147, 1671-1676. Féria C.P., Correia J.D., Gonçalves J. & Machado J. 2000. Detection of virulence factors in uropathogenic Escherichia coli isolated from humans, dogs and cats in Portugal. Adv Exp Med Biol, 485, 305-308. Harada K., Niina A., Nakai Y., Kataoka Y. & Takahashi T. 2012. Prevalence of antimicrobial resistance in relation to virulence genes and phylogenetic origins among urogenital Escherichia coli isolates from dogs and cats in Japan. Am J Vet Res, 73, 409-417. Idress M., Mussarat U., Badshah Y., Qamar R. & Bokhari H. 2010. Virulence factors profile of drug-resistant Escherichia coli isolates from urinary tract infections in Punjab, Pakistan. Eur J Clin Microbiol Infect Dis, 29, 1533–1537. Johnson J.R., Kuskowski M.A., Owens K., Gajewski A. & Winokur P.L. 2003. Phylogenetic origin and virulence genotype in relation to resistance to fluoroquinolones and/or extended-spectrum cephalosporins and cephamycins among Escherichia coli isolates from animals and humans. J Infect Dis, 188, 759-768. Johnson J.R., Owens K., Gajewski A. & Clabots C. 2008. Escherichia coli colonization patterns among human household members and pets, with attention to acute urinary tract infection. J Infect Dis, 197, 218-224. Kuhar I., Grabnar M. & Zgur-Bertok D. 1998. Virulence determinants of uropathogenic Escherichia coli in faecal strains from intestinal infections and healthy individuals. FEMS Microbiol Lett, 164, 243-248. Le Bouguenec C., Archambaud M. & Labigne A. 1992. Rapid and specific detection of the pap, afa, and sfa adhesinencoding operons in uropathogenic Escherichia coli strains by polymerase chain reaction. J Clin Microbiol, 30, 1189-1193. Moreno E., Prats G., Planells I,. Planes A.M., Perez T. & Andreu A. 2006. Characterization of Escherichia coli isolates derived from phylogenetic groups A and B1 causing

extraintestinal infection. Enferm Infect Microbiol Clin, 24, 483-489. Moulin-Schouleur M., Schouler C., Tailliez P., Kao M.R., Brée A, Germon P., Oswald E., Mainil J., Blanco M. & Blanco J. 2006. Common virulence factors and genetic relationships between O18:K1:H7 Escherichia coli isolates of human and avian origin. J Clin Microbiol, 44, 3484-3492. Pass M.A., Odedra R. & Batt R.M. 2000. Multiplex PCRs for identification of Escherichia coli virulence genes. J Clin Microbiol, 38, 2001-2004. Sabate M., Moreno E., Perez T., Andreu A. & Prats G. 2006. Pathogenicity island markers in commensal and uropathogenic Escherichia coli isolates. Clin Microbiol Infect, 12, 880-886. Salvarani S., Tramuta C., Nebbia P. & Robino P. 2011. Identificazione e caratterizzazione di ceppi di Escherichia coli produttori di beta-lattamasi isolati da cani e gatti con cistite nella provincia di Torino. XIII Congresso Nazionale SIDiLV, 12-14 ottobre, Trani, 366-367. Stenske K.A., Bemis D.A., Gillespie B.E., Oliver S.P., Draughon F.A., Matteson K. & Bartges J.W. 2009. Prevalence of urovirulence genes cnf, hlyD, sfa/foc, and papGIII in faecal Escherichia coli from healthy dogs and their owners. Am J Vet Res, 70, 1401-1406. Tenaillon O., Skurnik D., Picard B. & Denamur E. 2010. The population genetics of commensal Escherichia coli. Nat Rev Microbiol, 8, 207-217. Tóth I., Hérault F., Beutin L. & Oswald E. 2003. Production of cytolethal distending toxins by pathogenic Escherichia coli strains isolated from human and animal sources: establishment of the existence of a new cdt variant (Type IV). J Clin Microbiol, 41,4285-4291. Tramuta C., Nucera D., Robino P., Salvarani S. & Nebbia P. 2011. Virulence factors and genetic variability of uropathogenic Escherichia coli isolated from dogs and cats in Italy. J Vet Sci, 12, 49-55. Usein C.R., Damian M., Tatu-Chiţoiu D., Căpuşă C., Fāgăraş R. & Mircescu G. 2003. Comparison of genomic profiles of Escherichia coli isolates from urinary tract infections. Roum Arch Microbiol Immunol, 62, 137-154. Yamamoto S., Terai A., Yuri K., Kurazono H., Takeda Y. & Yoshida O. 1995. Detection of urovirulence factors in Escherichia coli by multiplex polymerase chain reaction. FEMS Immunol Med Microbiol, 12, 85-90. Yuri K., Nakata K., Katae H., Yamamoto S. & Hasegawa A. 1998. Distribution of uropathogenic virulence factors among Escherichia coli strains isolated from dogs and cats. J Vet Med Sci, 60, 287-290. Zhang L., Foxman B. & Marrs C. 2002. Both urinary and rectal Escherichia coli isolates are dominated by strains of phylogenetic group B2. J Clin Microbiol, 40, 3951-3955.

Veterinaria Italiana 2014, 50 (1), 23-30. doi: 10.12834/VetIt.1304.09

Molecular typing of Salmonella enterica subspecies enterica serovar Typhimurium isolated in Abruzzo region (Italy) from 2008 to 2010 Alessandra Alessiani1, Lorena Sacchini1, Eugenio Pontieri2, Jacopo Gavini2 & Elisabetta Di Giannatale1* 1

Istituto Zooprofilattico Sperimentale dell’Abruzzo e del Molise ‘G. Caporale’, Campo Boario, 64100 Teramo, Italy. 2 Facoltà di Scienze Biologiche, Università degli Studi dell’Aquila, Via Giovanni Di Vincenzo 16/B, 67100 L’Aquila. * Corresponding author at: Istituto Zooprofilattico Sperimentale dell’Abruzzo e del Molise ‘G. Caporale’, Campo Boario, 64100 Teramo, Italy. Tel.: +39 0861 332461, e-mail: e.digiannatale@izs.it

Veterinaria Italiana 2014, 50 (1), 31-39. doi: 10.12834/VetIt.1304.07

Accepted: 08.02.2013 | Available on line: 31.03.2014

Keywords Antibiotic resistance, floSt, int, invA, phage type, spvC, Salmonella enterica subspecies enterica serovar Typhimurium (ST), Salmonella enterica subspecies enterica serovar Typhimurium monophasic variant (mST).

Summary In this study, 47 antibiotic-resistant strains of Salmonella enterica subspecies enterica serovar Typhimurium (ST) were characterised, including 15 monophasic variants 1, 4, [5], 12:i:-, (STm) isolated from different matrices. They were all selected from 389 Salmonella enterica subspecies enterica strains isolated during 2008-2010 in Abruzzo region (Italy). Thirty-seven strains showed to be resistant to more than 1 antibiotic. Among 47 isolates, phage type U311 and DT104 were identified. The ASSuT resistance pattern was predominant in mST strains and ACSSuT in ST DT104 and U302. A multiplex Polimerase Chain Reaction (PCR) method was used to investigate 4 genes: fluorfenicol (floSt), virulence (spvC), invasine (invA) and integrase (int). All ST the strain were positive for invA gene and 28,32% of strains were positive for spvC gene. PFGE analysis revealed a large number of small clonal populations, however not ascrivable to outbreaks.

Tipizzazione molecolare di ceppi di Salmonella enterica subspecies enterica serovar Typhimurium isolati in Abruzzo (Italia) dal 2008 al 2010 Parole chiave Antibioticoresistenza, fagotipo, floSt, int, invA, spvC, Salmonella enterica subspecies enterica serovar Typhimurium (ST), Salmonella enterica subspecies enterica serovar Typhimurium variante monofasica (STm).

Riassunto Nel presente studio sono stati caratterizzati 47 ceppi di Salmonella enterica subspecies enterica serovar Typhimurium (ST) resistenti agli antibiotici, tra cui 15 varianti monofasiche 1,4,[5],12:i:-; (STm) isolate da varie matrici. Essi sono stati selezionati da 389 ceppi di Salmonella enterica subspecies enterica isolati in Abruzzo (Italia) nel periodo 2008-2010. Trentasette ceppi sono risultati resistenti a più di un antibiotico. Nei ceppi STm, il pattern di resistenza predominate è stato ASSuT, mentre nei ceppi ST DT104 e U302 il pattern ACSSuT. La Polimerase Chain Reaction (PCR) multiplex è stata utilizzata per valutare la presenza di quattro geni: fluorfenicolo (floSt), virulenza (spvC), invasione (invA) e l’integrone (int). Tutti i ceppi ST sono risultati positivi per il gene invA e il 28,32% per il gene spvC. L’analisi della PFGE ha rivelato un gran numero di piccole popolazioni conali, non ascrivibili tuttavia a focolai.

Salmonella enterica isolated in Abruzzo region (Italy)

Introduction Salmonella enterica subspecies enterica serovar Typhimurium (ST) is one of the most common causes of non-typhoid salmonellosis in the world, with both the biphasic and monophasic variants being implicated (CDC 2007a, CDC 2007b, EFSA Panel on Biological Hazards 2010). Between 2000 and 2010, this was one of the serotypes most frequently isolated in Europe, from animals and foods and it was responsible, together with Salmonella enteritidis and Salmonella infantis, for 14.1% of cases of food poisoning, with the epidemic strain ST DT104 mainly involved (Barco et al. 2011, EFSA Panel on Biological Hazards 2010, Health Protection Agency 2010). The high number of antibiotic resistant Salmonella strains is principally due to the horizontal transfer of mobile DNA elements such as plasmids, transposons and integrons (Barnaud et al. 1998, Carattoli et al. 2002). In some serotypes, the resistance genes are collected in a chromosome area known as Salmonella Genomic Island 1 (SGI1), which was first identified in a multi-resistant epidemic strain of ST, DT104 (Carattoli et al. 2002, Doublet et al. 2005). These genes confer resistance to ampicillin (A), chloramphenicol/florfenicol (C/Fl), streptomycin/ spectinomycin (S/Sp), sulphonamide (Su) and tetracycline (T). The most widespread resistant pattern is ACSSuT, which may be associated with additional antibiotic resistances patterns (Borrego et al. 1992, Boyd et al. 2001, Boyd et al. 2002, Busani et al. 2004, Doublet et al. 2005, Doublet et al. 2008). Recently a monophasic variant of Salmonella Typhimurium (mST), serotype 1, 4, [5], 12:i:- has rapidly spread (Bone et al. 2010, CDC 2007a, CDC, 2007b, EFSA Panel on Biological Hazards 2010). Between the end of the 90s and 2008, the prevalence of this variant increased from 0.1% to 8.3% in samples of animal origin and from 0.1% to 14% in samples of human origin (Health Protection Agency 2010). This variant was isolated from several matrices, including foods and pets, and was one of the serotypes most often implicated in cases of human infections. Its virulence and antibiotic resistance, common to all strains of ST, make it a high risk for public health (Echeita et al. 2001, Folster et al. 2009, Guard-Petter 2001, Threlfall 2000). It is worthwhile stressing that the outbreaks of food poisoning in which it was implicated were often associated with ASSuT resistance pattern and different phage types (AFSSA 2009, Borrego et al. 1992, De la Torre et al. 2003, Echeita et al. 1999, Harker et al. 2011, Hauser et al. 2010, Rabsch 2009, Trupschuch et al. 2010, Walker et al. 2001). It Italy, like in other countries, mST has been one of the most common serotypes found in human infections since 2004 (Dionisi et al. 2009) and it was the second

Alessiani et al.

most isolated in 2009. While prevalence of ACSSuT pattern remained constant (29.6%), ASSuT (with or without additional resistances) increased from 7.6% to 34.1% (Busani et al. 2004), with a prevalence for phage types DT193 (48%) and U302 (13%) (Lucarelli et al. 2010) (Istituto Superiore Sanità 2010). However, phage types do not indicate whether the variant is monophasic or biphasic (Echeita et al. 1999). The aim of this study was to characterize the local population of ST and mST, by PFGE, phage typing and antibiotic resistance patterns in order to reveal any relationship among the strains circulating in Italy between 2008-2010. Polymerase chain reaction (PCR) was used to detect SGI1 gene conferring resistance to chloramphenicol/florfenicol (floSt), int coding integrase, invA gene for invasiveness, and spvC gene for virulence.

Materials and methods Phenotype identification and antibiogram This study examined 47 strains of ST and mST selected from 389 strains of Salmonella isolated from different matrices in the period 2008-2010. The strains were stored at –80°C, revitalised in Brain Infusion broth B H I broth and subcultured in BHI agar (Thermo Scientific, Basingstoke, UK). Biochemical identification was conducted using the automated Vitek 2 system (Biomerieux, Marcy l'Etoile, France). Serological identification was carried out using the Kauffmann-White method with commercial antisera (Statens Serum Institute, Copenhagen, Denmark) and using a PCR to detect fljB gene (Barco et al. 2011). Phage typing was accomplished within the National Reference Centre for Salmonellosis (Istituto Zooprofilattico Sperimentale delle Venezie, Italy - IZSVE). Antibiotic resistance patterns were identified using the disk diffusion method (Kirby-Bauer) in Mueller Table I. Primers used for the investigation of floSt, int, invA and spvC genes. Primer FloF FloR VirF VirR InvF InvR IntF IntR

Target Gene floSt spvC invA int

5-3’ sequence 5’- ACCCGCCCTCTGGATCAAGTCAAG -3’ 5’- CAAATCACGGGCCACGCTGTATC -3’ 5’- GGGGCGGAAATACCATCTACA -3’ 5’- GCGCCCAGGCTAACACG -3’ 5’- CGCGGCCCGATTTTCTCTGGA -3’ 5’- AATGCGGGGATCTGGGCGACAAG -3’ 5’- GCCCTCCCGCACGATGAT -3’ 5’- ATTGGCGCCCTTGCTGTTCTTCTA -3’

Veterinaria Italiana 2014, 50 (1), 31-39. doi: 10.12834/VetIt.1304.07

Alessiani et al.

Salmonella enterica isolated in Abruzzo region (Italy)

Hinton agar (Basingstoke Scientific, UK), testing for the following compounds: ampicillin (10 µg), amoxicillin + clavulanic acid (20/10 µg), cefazolin (30 µg), gentamicin (10 µg), kanamycin (30 µg), enrofloxacin (5 µg), trimetoprim + sulfamethoxazole (1.25/23.75 µg), tetracycline (30 µg), ceftazidime (30 µg), colistin (10 µg), sulfisoxazole (300 µg), nalidixic acid (30 µg), streptomycin (10 µg), Table II. ST and mST strains and matrices. Pork Human faeces Chicken meat Eggs Beef Pigeon faeces Mulluscs/fish Animal feed River water

ST (4, 5, 12:i:1, 2) 8 3 8 4 2 2 4 1

STm (4, 5:i:-;) 12 1 1

cloramphenicol (30 µg), cefalotin (30 µg) and ciprofloxacin (5 µg) (Becton Dickinson, Italy). The results were interpreted according to Clinical and Laboratory Standard Institute criteria1.

Polymerase Chain Reaction Resistance and pathogenicity genes floSt, int, invA and spvC were investigated by using PCR (Khan et al. 2000) and reported in Table I; while DNA extraction was performed using the UltraClean™ Microbial DNA Isolation Kit (Mo BIO, Carlsbad, CA, USA). The PCR was structured using Master Mix 2X according to the manufacturer's instructions (Promega, Madison, WI, USA). The PCR products were identified with Qiaxcel (Qiagen, Hilden, Germany); ST DT104 (IZSVE) was used as reference strain. PCR for fljB gene detection was carried out according to Barco (Barco et al. 2011). 1

1 15

C linical and Laboratory Standard Institute (CLSI) 2008. Performance Standards for Antimicrobial disk and dilution susceptibility. Test for bacteria isolated from animals: Approved Standard Third Edition. 2008. Document M31-A3. Vol. 24 No. 1, Wayne PA. USA.

Table III. Phage type, antibiotic resistance patterns and genes identified in ST strains of Salmonella enterica subspecies enterica strains isolated during 2008-2010 in Abruzzo region (Italy). Number 1 3 1 1 2 1 1 1 1 6 1 2 1 1 1 1 1 1 1 1 1 1 1 32

Sample type Pork Pork Pork Pork Pork Human faeces(CH) Human faeces (PE) Human faeces (TE) Chicken meat Chicken meat Chicken meat Eggs Eggs Eggs Pigeon faeces Pigeon faeces Animal feed Beef Beef Molluscs Molluscs Molluscs Fish

Phage type RNDC DT104 DT104 DT20 U311 NT U302 NT NT U311 U311 DT2 DT3 DT99 DT3 U302 DT99 DT99 U302 DT104 NT U311 NT

Resistance pattern ACSSuT + AMC ACSSuT + AMC ACST + AMC ASSuT ACSSuT + AMC + CL ACSSuT A ASSuT + CZ + SXT + NA + CF ASSu + ENO + NA

ACSSuT + SXT ACSSuT ASSuT ASSuT

Genes invA int+invA+spvC+floSt int+invA+spvC int+invA+spvC invA invA int+invA+spvC+floSt int+invA+spvC+floSt invA int+invA invA invA invA invA invA invA invA invA int+invA+spvC int+invA+spvC+floSt invA invA invA

NT = strain could not be typed; RNDC = stable unidentified reading.

Veterinaria Italiana 2014, 50 (1), 31-39. doi: 10.12834/VetIt.1304.07

Salmonella enterica isolated in Abruzzo region (Italy)

Alessiani et al.

Table IV. Phage type, antibiotic resistance patterns and genes identified in mST strains of Salmonella enterica subspecies enterica strains isolated during 2008-2010 in Abruzzo region (Italy). Number

Sample type Pork Pork Pork Pork River water Pork Pork Pork Pork Pork Chicken Human

4 1 1 2 2 2 1 1 1 15

Phage type DT120 U302 U311 U311 DT193 RNDC U311 DT193 U311 NT, DT193 DT193 DT7 U311

Resistance pattern ASSuT ASSuT ASSuT ASSuT ASSuT ASSu ASSu ACSSuT T T AST+STX+Na

Genes invA invA invA+floSt invA invA invA invA invA invA invA int+invA invA

A = ampicillin; S = streptomycin; Su = sulfisoxazole; T = tetracycline; C = chloramphenicol; AMC = amoxicillin + clavulanic acid; CL = colistin; SXT = trimetoprim + sulphamethoxazole; Eno = enrofloxacin; NA = nalidixic acid; Cz = cefazolin; CF = cefalotin.

3000.0

300.0

100.0

16.0

K-

10 11 13 14 15 16 K+ 18 19 20 21 25 26 27 28 29 31 32

Figure 1. PCR results of strains of Salmonella enterica subspecies enterica strains isolated during 2008-2010 in Abruzzo region (Italy). Line 1: molecular weight markers; line 2: blank; line 3: negative control (S. branderup); line 13: positive control (STm DT104); from 5 to 16 and from 18 to 32: multi-resistant samples.

Pulsed Field Gel Electrophoresis Pulsed Field Gel Electrophoresis (PFGE) was carried out according to the Pulsenet protocol (PulseNet USA 2010) after digestion with restriction enzymes Xba1 and Bln1 (Promega, Madison, WI, USA). The gel was stained with Sybr Safe DNA Gel Stain (Life Technologies, Paisley, UK) and the images were taken using Chemilmager 5500 v. 3.04 (Alpha Innotech Corporation, San Leandro, CA, USA) and analysed with Bionumerics 6.0 programm (Applied Math, Sint-Martens-Latem, Belgium). For the analysis, 1% tolerance and optimisation criteria were imposed. The dendrogram was calculated by using the computer

program UPGMA (Unweighted Pair Group Method using Arithmetic averages). The discriminating power was measured with Simpson's index, considering the set of strains with a similarity above 98% as the subpopulation (Hunter and Gaston 1998).

Results Serotyping, phage typing and antibiotic resistance patterns Thirty-two of the 47 strains tested were confirmed as ST (4, 5, 12; i:1, 2) and 15 as mST (4, 5, 12;i:-.). TableÂ II

Veterinaria Italiana 2014, 50 (1), 31-39. doi: 10.12834/VetIt.1304.07

Alessiani et al.

Salmonella enterica isolated in Abruzzo region (Italy)

Xba1

Xba1 S. Typhimurium 4; i; 1, 2.

ACSSuT + SXT

JPXX01.0001

S. Typhimurium 4; i; 1, 2. S. Typhimurium 4; i; 1, 2. S. Typhimurium 4; i; 1, 2.

ACST + AMC ACSSuT + AMC ACSSuT + AMC+ CL

JPXX01.0002 JPXX01.0005 JPXX01.0005

S. Typhimurium 4; i; 1, 2.

ACSSuT + AMC

JPXX01.0007

S. Typhimurium 4; i; 1, 2. S. Typhimurium 4; i; 1, 2. S. Typhimurium 4; i; 1, 2. S. Typhimurium 4; i; S. Typhimurium 4; i;

ACSSuT + AMC ACSSuT + AMC ASSuT ASSuT ASSuT

JPXX01.0003 JPXX01.0004 JPXX01.0018 JPXX01.0019 JPXX01.0020

S. Typhimurium 4; i; 1, 2. S. Typhimurium 4; i; 1, 2.

ASSuT + CZ + SXT + NA + CF ASSuT + CZ + SXT + NA + CF

JPXX01.0026 JPXX01.0027

S. Typhimurium 4; i; 1, 2. S. Typhimurium 4; i; S. Typhimurium 4; i; S. Typhimurium 4; i; 1, 2.

ASSuT ASSu ASSu ASSu + ENO + NA

JPXX01.0031

S. Typhimurium 4; i; 1, 2.

ASSuT + CZ + SXT + NA + CF

JPXX01.0028

S. Typhimurium 4; i; 1, 2. S. Typhimurium 4; i; 1, 2.

ASSuT + CZ + SXT + NA + CF ASSuT

S. Typhimurium 4; i; S. Typhimurium 4; i;

ACSSuT ASSu

JPXX01.0030 JPXX01.0021 JPXX01.0011

S. Typhimurium 4; i;

ASSuT

JPXX01.0014

S. Typhimurium 4; i;

ACSSuT

JPXX01.0032

S. Typhimurium 4; i; S. Typhimurium 4; i; S. Typhimurium 4; i;

ASSuT ASSuT ASSuT

JPXX01.0022 JPXX01.0023 JPXX01.0012

S. Typhimurium 4; i; 1, 2.

ASSuT + CZ + SXT + NA + CF

JPXX01.0016

S. Typhimurium 4; i; 1, 2.

ASSuT

JPXX01.0013

S. Typhimurium 4; i; 1, 2. S. Typhimurium 4; i; 1, 2. S. Typhimurium 4; i; S. Typhimurium 4; i; 1, 2.

ACSSuT ASSuT + CZ + SXT + NA + CF AST+STX+NA ACSSuT

JPXX01.0008 JPXX01.0015 JPXX01.0017 JPXX01.0009

JPXX01.0024 JPXX01.0024 JPXX01.0028

JPXX01.0010

Figure 2. Xba1 PFGE profile of strains of Salmonella enterica subspecies enterica strains isolated during 2008-2010 in Abruzzo region (Italy). reports the matrices from which the 2 variants ST and mST were isolated. Table III and Table IV describe the results of phage typing, antibiotic resistance patterns and PCR for ST and mST. Of the strains tested, 10.6% were characterized as phage type DT104 and 36.2% as phage type U311. A total of 68% of the analysed strains showed to be resistant to at least 2 antibiotics (Tables III and IV). Six strains isolated from chicken were resistant to 9 different antibiotics, with resistence pattern ACSSuTCzSxtNaCf. ACSSuT resistance pattern was the most common in ST strains, while ASSuT was the most common in mST strains (Tables III and IV).

Polymerase Chain Reaction The polymerase chain reaction confirmed the absence of fljB gene for all 15 strains identified as mST by serotyping. All ST and mST strains analyzed were positive for invA gene, regardless of whether they were sensitive (S) or resistant (R) to the tested antibiotics (Tables III and IV). Figure 1 depicts the PCR results showing the bands corresponding to the investigated genes: floSt (584 bp), spvC (392 bp), invA (321 bp) and int (265 bp). Of the tested ST strains, 18.75% were positive for the association

Veterinaria Italiana 2014, 50 (1), 31-39. doi: 10.12834/VetIt.1304.07

int+invA+spvc+floSt in addition to ACSSuT resistance pattern (with or without additional resistance), while the association int+invA+spvc was found in 9.37% of strains (2 from pork and 1 from beef ) with ACSSuT+AMC, ACST+AMC, ACSSuT+SXT resistance patterns association. Six mST strains isolated from chicken were positive for int+invA genes associated with a multiple resistance pattern, with ACSSuT associated with CzSxtNaCf. Only 1 mSTM strain showed the association invA+flo and ASSuT and 1 int+invA (Tables III and IV).

Pulsed Field Gel Electrophoresis Analysis of the images revealed numerous small clone populations but none with characteristics ascribable to outbreaks. The analytical method we endorsed was found to be highly discriminating, with a Simpson’s index (D) of 0.99. Figure 2 shows the dendrogram with the restriction profiles of the tested strains after digestion with Xba1 and their comparison with the resistance patterns. A clear distinction among samples with ACSSuT and ASSuT profiles can be observed, regardless of the phage type. Figure 3 illustrates the comparison of strains after digestion with Xba1 and Bln1.

Salmonella enterica isolated in Abruzzo region (Italy)

Comp

Xba1

Alessiani et al.

Bln1 S. Typhimurium 4; i; 1, 2. S. Typhimurium 4; i; 1, 2.

ACSSuT + AMC ACSSuT + AMC

S. Typhimurium 4; i; 1, 2.

AACSSuT + AMC+ CL

S. Typhimurium 4; i; 1, 2.

ACSSuT + AMC

S. Typhimurium 4; i; 1, 2. S. Typhimurium 4; i; 1, 2.

ACSSuT + AMC ACSSuT

S. Typhimurium 4; i; 1, 2.

ACSSuT + SXT

S. Typhimurium 4; i; 1, 2.

ACST + AMC

S. Typhimurium 4; i; 1, 2.

ASSuT

S. Typhimurium 4; i;

ASSuT

S. Typhimurium 4; i; 1, 2. S. Typhimurium 4; i; 1, 2.

ACSSuT ASSuT

S. Typhimurium 4; i;

ASSuT

S. Typhimurium 4; i; 1, 2.

ASSuT + CZ + SXT + NA + CF

S. Typhimurium 4; i; 1, 2.

ASSuT + CZ + SXT + NA + CF

S. Typhimurium 4; i; 1, 2.

ASSu + ENO + NA

S. Typhimurium 4; i; 1, 2.

ASSuT + CZ + SXT + NA + CF

S. Typhimurium 4; i; 1, 2. S. Typhimurium 4; i; 1, 2.

ASSuT + CZ + SXT + NA + CF ASSuT

S. Typhimurium 4; i; S. Typhimurium 4; i;

ASSu ASSu

S. Typhimurium 4; i;

ASSu

S. Typhimurium 4; i;

ACSSuT

S. Typhimurium 4; i;

ASSuT

S. Typhimurium 4; i; 1, 2.

ASSuT + CZ + SXT + NA + CF

S. Typhimurium 4; i; 1, 2.

ASSuT + CZ + SXT + NA + CF

S. Typhimurium 4; i;

AST+STX+NA

S. Typhimurium 4; i;

ASSuT

S. Typhimurium 4; i; 1, 2.

ASSuT

S. Typhimurium 4; i;

ASSuT

S. Typhimurium 4; i; S. Typhimurium 4; i;

ASSuT ACSSuT

Figure 3. Xba1 and Bln1 PFGE profile of Salmonella enterica subspecies enterica strains isolated during 2008-2010 in Abruzzo region (Italy).

Discussion The widespread occurrence of multi drug resistant strains of both monophasic and biphasic S. Typhimurium and the constant increasing of human infections are becoming a big concern for public health in a large part of the world. As already occurred in other Italian regions (Graziani et al. 2008), also in Abruzzo there is a predominance of resistant strains with ASSuT pattern (with or without additional resistance), in 31.23% of ST and 33.3% of mST strains. In 6 strains isolated from chicken, resistance was found to other 4 antibiotics: CzSXTNaCf. ACSSuT pattern (with or without additional resistance) was found in 25% of ST and in 6.66% of mST strains. Some of the strains were also resistant to AMCCl and/or SXT. The increasing growth of ASSuT resistance pattern, which predominates in monophasic S. Typhimurium, could be related to the postulated ability of mST to evade the immune system, while the association of ACSSuT with the phage type DT104 could be linked to the latter's predisposition to combine both horizontal and vertical resistance transfer

phenomena (Cloeckaert and Chaslus-Dancla 2001, Bolton et al. 1999). Integrons express mobile genes known as cassettes, which in many cases are antibiotic resistance genes. The integrase gene int is an essential part of all integrons and codes for a site-specific recombinase that catalyses the insertion of the gene into the integron. This gene was found in 46.9% of the strains. The invasiveness gene invA is considered essential for the complete virulence of Salmonella. It is thought to activate the interiorisation wich is necessary for the invasion of deeper lying tissues (Galan and Curtiss 1989). In addition to the chromosome genes described above, a highly conserved 8 kb plasmid region, called spv (Salmonella plasmid virulence), was also observed, which is usually associated with a particularly serious form of disease. This region is more common in strains isolated from extraintestinal human infections than in those isolated from stool samples or environmental samples and includes a regulatory gene, spvR, and 4 structural genes, spv ABCD. The spv genes seem to promote the macrophagic stage of the disease, preventing neutrophils from destroying the bacteria and facilitating the proliferation of

Veterinaria Italiana 2014, 50 (1), 31-39. doi: 10.12834/VetIt.1304.07

Alessiani et al.

extraintestinal Salmonella strains. spvC in particular interacts with the hostâ&#x20AC;&#x2122;s immune system and it is responsible for the hight growth rate in the host cells (Gulig et al. 1993). All ST strains were positive for invA, as reported in literature (Khan et al. 2000), and 28.32% were positive for spvC constantly associated with ACSSuT resistance profile and phage type DT104 in strains isolated from pigs, cattle and molluscs. The presence of less common phage types in ST and mST reflected the trend reported in literature, which also highliths that the ST phage type DT193 could have a new pathogenicity island, which seems to increase its virulence and whose functions on metabolic activity are still under study (Threlfall 2000). The distribution of resistance genes in relation to the various phage types and serotypes is particularly complex, floSt was found in only 1 case of mST U311 with ASSuT profile, while it was always present in DT104 and was also found in one strain whose phage type could not be determined (NT). No particular distribution of resistance genes was found with respect to other phage types. The analysis of PFGE data revealed large groups with a common resistance profile, one with ASSuT and the other with ACSSuT, but neither was suspected as responsible of the outbreak, as it could be deduced from the extreme spatiotemporal variety of the test samples. This partition reflects the literature evidence on this type of Salmonella. In fact, previous

Veterinaria Italiana 2014, 50 (1), 31-39. doi: 10.12834/VetIt.1304.07

Salmonella enterica isolated in Abruzzo region (Italy)

studies (Dionisi et al. 2009, Lucarelli et al. 2010) already highlighted the different genomic origin of Salmonella strains with one resistance profile rather than another. Only ST strains with an ACSSuT profile formed part of the ASSuT group; however these strains did not have integrase. The combination of these events suggests that they derive from the clonal line ASSuT, although they developed resistance to chloramphenicol through other routes. Interestingly, phage type U311 was common in strains with ASSuT profile. Differently from DT193, it is not one of the most widespread in Europe (Hopkins et al. 2010) but seems to be particularly present in Italy. The prevalence of ST and mST in Abruzzo over the period of this study reflects the general trend for Italy and Europe, with a prevalence of phage type U311 and ASSuT resistance profile over ACSSuT (both with and without additional resistance). Finally, bacteria with multiple antibiotic resistance, especially those newly resistant to quinolones, sulphonamides and cephalosporin, are becoming more and more widespread, with a growing socioeconomic impact. There is a need to intensify campaigns for reducing use of antibiotics and common therapeutic protocols. Constant monitoring of pathogens with an impact on public health through phenotyping and molecular techniques is also necessary in order to enable the competent authorities to activate effective, specific surveillance and control plans.

Salmonella enterica isolated in Abruzzo region (Italy)

Alessiani et al.

References Agence Française de Sécurité Sanitaire des Aliments (AFSSA). 2009. Opinion of the French Food Safety Agency concerning two draft amendments to Orders for controlling salmonellae in the Gallus gallus species. 2009-SA-0182, 22 pp.

Centers for Disease Control and Prevention (CDC). 2007b. Turtle-Associated Salmonellosis in Humans - United States, 2006-2007 (http://www.cdc.gov/ Salmonella/4512eyeminus.html accessed on 24 March 2014).

Barco L., Lettini A.A., Ramon E., Longo A., Saccardin C., Dalla Pozza M.C. & Ricci A. 2011. A rapid sensitive method to identify and differentiate Salmonella enterica serotype Typhimurium and Salmonella enterica serotype 4, [5], 12: i:- by combining traditional serotyping and multiplex Polymerase Chain Reaction. Foodborne Path Dis, 8(6), 741-743.

Cloeckaert A. & Chaslus-Dancla E. 2001. Mechanisms of quinolone resistance in Salmonella. Vet Res, 32, 291-300.

Barnaud G., Arlet G., Verdet C., Gaillot O., Lagrange P.H. & Philippon A. 1998. Salmonella enteritidis: AmpC plasmid-mediated inducible betalactamase (DHA1) with an ampR gene from Morganella morganii. Antimicrob Agents Chem, 42, 2352-2358

Dionisi A.M., Graziani C., Lucarelli C., Filetici E., Villa L., Owczarek S., Caprioli A. & Luzzi I. 2009. Molecular characterization of multidrug-resistant strains of Salmonella enterica serotype Typhimurium and monophasic variant (S. 4, [5], 12:i:-) isolated from human infections in Italy. Foodborne Path Dis, 6, 711-717.

Bone A., Noel H., Le Hello S., Pihier N., Danan C., Raguenaud ME., Salah S., Bellali H., Vaillant V., Weill FX & Jourdanda Silva N. 2010. Nationwide outbreak of Salmonella enterica serotype 4, 12:i:- infections in France, linked to dried pork sausage, March-May 2010. Eurosurveillance, 15 (24), 19592. http://www.eurosurveillance.org/ ViewArticle.aspx?ArticleId=19592. Borrego J.J., Castro D., Jimenez-Notario M., Luque A., Martinez-Manzanares E., Rodriguez-Avial C. & Picazo J.J. 1992. Comparison of epidemiological markers of salmonella strains isolated from different sources in Spain. J Clin Microbiol, 30, 3058-3064. Boyd D., Cloeckart A., Chaslus-Dancla E. & Mulvey M.R. 2002. Characterization of variant Salmonella genomic island 1 multidrug resistance regions from serovars Typhimurium DT104 and Agona. Antimicrob Agents Chem, 46, 1714-1722 Boyd D., Peters G.A., Cloeckart A., Sidi Boumedine K., Chaslus-Dancla E., Imberechts H. & Mulvey M.R. 2001. Complete nucleotide sequence of a 43 kb genomic island associated with multidrug resistance region of Salmonella enterica serovar Typhimurium DT104 and its identification in phage type DT120 and Agona. J Bacteriol, 183, 5725-5732. Busani L., Graziani C., Battisti A., Franco A., Ricci A., Vio D., Di Giannatale E., Paterlini F., D’Incau M., Owczarek S., Caprioli A. & Luzzi I. 2004. Antibiotic resistance in Salmonella enterica serotypes Typhimurium, Enteritidis and Infantis from human infections, food stuffs and farm animals in Italy. Epidemiol Infect, 132, 245-251. Carattoli A., Filetici E., Villa L., Dionisi A.M., Ricci A. & Luzzi I. 2002. Antibiotic resistance genes and Salmonella genomic island 1 in Salmonella enterica serovar Typhimurium isolated in Italy. Antimicrobial Agents Chem, 46, 2821-2828. Centers for Disease Control and Prevention (CDC). 2007a. Investigation of Outbreak of Human Infections Caused by Salmonella I 4, [5], 12:i: (http://www.cdc. gov/Salmonella/4512eyeminus.html accessed on 24 March 2014).

De la Torre E., Zapata D., Tello M., Mejia W., Frias N., Pena F.J.G., Mateu E.M. & Torre E. 2003. Several Salmonella enterica subsp enterica serotype 4, 5, 12 : i: - Phage types isolated from swine samples originate from serotype Typhimurium DT U302. J Clin Microbiol, 41, 2395-2400.

Doublet B., Boyd D., Mulvey R. & Cloeckert A. 2005. The Salmonella genomic Island 1 is an integrative mobilization element. Mol Microbiol, 55, 1911-1924. Doublet B., Boyd D., Mulvey M. R. & Cloeckaert A. 2008. The Salmonella genomic island 1 is an integrative mobilizable element. Antimicrob Agents Chem, 52, 340-344. Echeita M.A., Aladuena A., Cruchaga S. & Usera M.A. 1999. Emergence and spread of an atypical Salmonella enterica subsp enterica serotype 4, 5, 12 : i :- Strain in Spain. J Clin Microbiol, 37, 3425-3425. Echeita M.A., Herrera S.& Usera M.A. 2001. Atypical, fljBnegative Salmonella enterica subsp. enterica strain of serovar 4, 5, 12:i:2 appears to be a monophasic variant of serovar Typhimurium. J Clin Microbiol, 8, 2981-2983. EFSA Panel on Biological Hazards (BIOHAZ). 2010. Scientific Opinion on monitoring and assessment of the public health risk of “Salmonella Typhimurium-like” strains. EFSA Journal, 8(10), 1826. http://www.efsa.europa.eu/ en/scdocs/doc/1826.pdf. Folster J.P., Pecic G., Bolcen S., Theobald L., Hise K., Carattoli A., Zhao S., McDermott P.F. & Whichard J.M. 2009. Characterization of extended-spectrum cephalosporin-resistant Salmonella enterica serovar Heidelberg isolated from humans in the United States. Foodborne Path Dis, 7, 181-187. Galan J.E. & Curtiss R. 1989. Cloning and molecular characterization of genes whose products allow S. typhimurium to penetrate tissue culture cells. Proc Natl Acad Sci USA, 86, 6383–6387. Graziani C., Busani L., Dionisi A.M., Lucarelli C., Owczarek S., Ricci A., Mancin M., Caprioli A. & Luzzi I. 2008. Antimicrobial resistance in Salmonella enterica serovar Typhimurium from human and animal sources in Italy. Vet Microbiol, 128, 414-418. Guard-Petter J. 2001. The chicken, the egg and Salmonella enteritidis. Environ Microbiol, 3, 421-430. Gulig P.A., Danbara H., Guiney D.G., Lax A.J., Norel F. & Rhen M. 1993. Molecular analysis of spv virulence

Veterinaria Italiana 2014, 50 (1), 31-39. doi: 10.12834/VetIt.1304.07

Alessiani et al.

genes of the Salmonella virulence plasmids. Mol Microbiol, 7(6), 823-830. Harker K.S., Lane C., de Pinna E. & Adak G.K. 2011. An outbreak of Salmonella Typhimurium DT191a associated with reptile feeder mice. Epidemiol Infect, 139, 1254-61. Hauser E., Tietze E., Helmuth R., Junker E., Blank K., Prager R., Rabsch W., Appel B., Fruth A. & Malorny B. 2010. Salmonella enterica serovar 4, [5], 12:i:- contaminated pork is an emerging foodborne health risk for humans. App Environ Microbiol, 76(14), 4601-4610. Health Protection Agency (HPA). Epidemiological data. All human isolates reported to the Health Protection Agency Centre for Infections England and Wales, 2000-2010 (http://www.hpa.org.uk/ Topics/InfectiousDiseases/InfectionsAZ/Salmonella/ EpidemiologicalData/salmDataHuman/ accessed on 24 March 2014). Hunter, P.R. & Gaston M.A. 1998. Numerical index of the discriminatory ability of typing systems: an application of Simpson's index of diversity. J Clin Microbiol, 26, 2465-2466. Khan A.A., Nawaz M.S., Saeed A. Khan & Cerniglia C.E. 2000. Detection of multidrug-resistant Salmonella typhimurium DT 104 by multiplex polymerase chain reaction. FEMS Microbiol Lett, 182(2), 355-360. Hopkins K.L., Kirchner M., Guerra B., Granier S.A., Lucarelli C., Porrero M.C., Jakubczak A., Threlfall E.J. & Mevius D.J. 2010. Multiresistant Salmonella enterica serovar 4, [5], 12:i:- in Europe: a new pandemic strain? Eurosurveillance, 15(22), 19580. http://w w w.eurosur veillance.org/ViewAr ticle. aspx?ArticleId=19580. Bolton L.F., Kelley L.C., Lee M.D., Fedorka-Cray P.J. & Maurer J.J. 1999. Detection of multidrug-resistant Salmonella enterica serotype Typhimurium DT104 based on a gene which confers cross-resistance to florfenicol and

Veterinaria Italiana 2014, 50 (1), 31-39. doi: 10.12834/VetIt.1304.07

Salmonella enterica isolated in Abruzzo region (Italy)

chloramphenicol. Clin Microbiol, 37(5), 1348-1351. Istituto Superiore SanitĂ . ENTERNET Salmonella 2010. Sorveglianza delle infezioni da Salmonella (www.iss.it/ binary/salm/cont/4f_Dati_SALMONELLA_2007-_2009. pdf accessed on 24 March 2014). Lucarelli C., Dionisi A.M.M., Villa L.C.K., Threlfall J., Caprioli A. & Luzzi I. 2010. Evidence for a second genomic island conferring multidrug resistance in a clonal group of strains of Salmonella enterica serovar Typhimurium and its monophasic variant circulating in Italy, Denmark, and the United Kingdom. J Clin Microbiol, 48(6), 2103-2109. PulseNet USA. 2010. One day (24-26h) Standardized Laboratories Protocol for Molecular Subtyping of Escherichia coli O157:H7, Salmonella serotypes, Shigella sonnei, and Shigella flexneri by Pulsed Field Gel Electrophoresis (PFGE) (http://www. pulsenetinternational.org/assets/PulseNet/uploads/ pfge/PNL05_Ec-Sal-ShigPFGEprotocol.pdf accessed on 24 March 2014). Rabsch W. 2009. International emergence and trends of S. Typhimurium DT193. 2nd Annual Meeting of Food and Waterborne Diseases and Zoonoses Surveillance Network in Europe, 24-25 Sept 2009, Malta. Threlfall E.J. 2000. Epidemic Salmonella Typhimurium DT 104 a truly international multiresistant clone. J Antimicrob Chemother, 46, 7-10. Trupschuch S., Laverde Gomez J.A., Ediberidze I., Flieger A. & Rabsch W. 2010. Characterisation of multidrugresistant Salmonella Typhimurium 4, [5], 12:i:- DT193 strains carrying a novel genomic island adjacent to the thrW tRNA locus. Int J Med Microbiol, 300(5), 279-88. Walker R.A., Lindsay E., Woodward M.J., Ward L.R. & Threlfall E.J. 2001. Variation in clonality and antibiotic-resistance genes among multiresistant Salmonella enterica serotype Typhimurium phagetype U302 (MR U302) from humans, animals, and foods. Microb Drug Res, 7, 13-21.

Human exposure to piroplasms in Central and Northern Italy Simona Gabrielli1*, Pietro Calderini2, Rudi Cassini3, Roberta Galuppi4, Maria Paola Tampieri4, Mario Pietrobelli3 & Gabriella Cancrini1 Dipartimento di Sanità Pubblica e Malattie Infettive, Sapienza Università di Roma, Piazzale Aldo Moro 5, 00185 Roma, Italy. 2 Istituto Zooprofilattico Sperimentale delle Regioni Lazio e Toscana, Sezione Rieti, Via Tancia 21, 02100 Rieti, Italy. 3 Dipartimento di Medicina Animale, Produzioni e Salute, Università degli Studi di Padova, Viale dell’Università 16, 35020 Legnaro (PD), Italy. 4 Dipartimento di Scienze Mediche Veterinarie, Alma Mater Studiorum Università di Bologna, Via Tolara di Sopra 50, 40064 Ozzano Emilia (BO), Italy. 1

* Corresponding author at: Dipartimento di Sanità Pubblica e Malattie Infettive, Sapienza Università di Roma, Piazzale Aldo Moro 5, 00185 Roma, Italy. Tel: +39 0649914896, e-mail: simona.gabrielli@uniroma1.it

Veterinaria Italiana 2014, 50 (1), 41-47. doi: 10.12834/VetIt.1302.13

Accepted: 27.12.2013 | Available on line: 31.03.2014

Keywords Babesia, Italy, Risk exposure, Serosurvey, Theileria, Tick-borne zoonoses.

Summary A serosurvey has been conducted in Northern and Central Italy to investigate the presence in humans of antibodies against zoonotic Babesia and Theileria species. The study focused on a total of 432 volunteers, of which 290 were persistently exposed to tick bites because of their jobs (forester employees, livestock keepers, veterinary practitioners, farmers and hunters) and 142 resident in the same area less frequently exposed. An indirect fluorescent antibody test (IFAT) for humans was used to detect antibodies to Babesia microti, IFAT tests for veterinary use were modified to detect reactivity to Babesia bovis, Babesia canis and Theileria equi. A laboratory-derived ELISA was employed to detect antibodies to Babesia divergens. Both reactive and 10 negative sera were analysed against plasmodial antigens to evaluate possible aspecificity. A high reactivity to piroplasm antigens was found, showing significant difference between the sera of the two groups of volunteers (24% vs 7.0%; p<0.001). No cross-reactivity was observed, while each professional group showed reactivity that would fit with the professional risk exposure. In particular, a high reactivity to B. microti and B. divergens antigens was observed in foresters and hunters (32% and 12%, respectively). This is the first report on the human seroreactivity to piroplasms in Italy; it also provides additional epidemiological information on these tick-borne zoonoses in Europe. Our findings suggest the possible occurrence of piroplasm infections in Italy and alert physicians to consider these otherwise neglected parasitic diseases when dealing with any febrile illness, especially in subjects exposed to tick bites.

Gabrielli et al.

Piroplasms in Central and Northern Italy

Sieroprevalenza delle piroplasmosi nella popolazione umana del Centro e Nord Italia Parole chiave Babesia, Fattore di rischio, Italia, Piroplasmosi, Sieroprevalenza, Theileria, Zecca, Zoonosi.

Riassunto Il lavoro descrive i risultati di un’indagine sierologica effettuata nel 2009 nel Nord e Centro Italia per valutare, in campioni di siero umano, l’eventuale presenza di anticorpi verso specie di Babesia e Theileria, capaci di trasmettere zoonosi. Lo studio ha riguardato 432 volontari, di cui 290 esposti con maggiore frequenza al morso di zecca a causa della loro professione (allevatori, agricoltori, guardie forestali, medici veterinari, cacciatori) e 142 individui residenti nella stessa area ma non esposti allo stesso fattore di rischio. La ricerca di anticorpi verso Babesia microti è stata condotta utilizzando kit di immunofluorescenza indiretta (IFI) per la diagnosi nell’uomo. La reattività verso gli antigeni di Babesia bovis, Babesia canis e Theileria equi è stata valutata mediante test IFI per uso veterinario opportunamente modificati. Per la ricerca di anticorpi anti-Babesia divergens è stato impiegato un saggio sperimentale (ELISA). I sieri positivi e i 10 sieri negativi sono stati analizzati anche per la reattività ai plasmodi per valutare possibili reazioni aspecifiche. Lo studio ha rivelato un numero elevato di sieri umani reattivi agli antigeni dei piroplasmi, con differenze significative tra i soggetti più esposti e meno esposti alla puntura da zecca (24% vs 7,0%; p<0,001). Non è stata osservata cross-reattività ad antigeni di specie diverse dai piroplasmi né a plasmodi. Ogni gruppo professionale ha mostrato una reattività coerente con il rischio di esposizione relativo al lavoro svolto. In particolare, nelle guardie forestali e nei cacciatori è stata osservata un’elevata reattività agli antigeni di Babesia microti e Babesia divergens (fino a 32% e 12%, rispettivamente). Questo è il primo studio sulla sieroprevalenza delle piroplasmosi nella popolazione italiana. Lo studio aggiunge ai dati europei nuove informazioni epidemiologiche relative alle zoonosi trasmesse da zecche. I risultati della ricerca evidenziano la possibile insorgenza di casi di piroplasmosi in Italia e suggeriscono ai medici di considerare queste parassitosi, generalmente trascurate, nei casi di sintomatologia febbrile in soggetti a rischio di infezione.

Introduction Piroplasmoses are tick-borne emerging zoonoses that can induce malaria-like syndromes. The etiological agents of these diseases are haemoprotozoa of the genus Babesia and Theileria (Apicomplexa: Piroplasmida), which both infect a wide range of domestic and wild animals and constitute an obstacle to livestock production in farming areas. These parasites are transmitted from specific ticks that feed on several hosts. Humans are included among the parasites’ blood sources and, once bitten, can develop diseases of different degree of severity. Human infections were first described in 1957 in Europe in a splenectomised cattle farmer (Skrabalo and Deanovic 1957) and, in 1968, in the US in an asplenic man (Scholtens et al. 1968). To this day, more than 100 Babesia species have been described worldwide, but human infection has been associated with only few of them, i.e. Babesia microti and Babesia duncani in North America and Babesia divergens in Europe (Conrad 2006, Leiby 2006, Meliani et al. 2006), where the occurrence of human subclinical and persistent infections due to B. microti has also been recently documented (Hildebrandt, 2007). It is noteworthy that over the past few years, further zoonotic B. divergenslike pathogens have been identified using molecular techniques both in the United States (the WA1, CA1

and MO1 parasites) and in Europe (the EU1, proposed by Herwaldt et al., 2003 as Babesia venatorum) (Herwaldt 2003) and have been shown to cause a significant number of human infections (CentenoLima et al. 2003, Herwaldt et al. 2004, Gray 2006, Holman 2006, Vannier and Krause 2009). Although not well‑documented, a few reports have also been provided on human infections with other species such as Babesia bovis and Babesia canis s.l. (Homer 2000). In Italy, piroplasms affect livestock, pets and wild animals (Pietrobelli et al. 2007, Cassini et al. 2009, Tampieri et al. 2008, Moretti et al. 2010, Cassini et al. 2012) and the first case of human infection has been reported in 2003 (Herwaldt 2003). The main aim of this article is to report the preliminary results of a serological screening performed in Central and Northern Italy to evaluate the seroreactivity to piroplasm antigens in people resident/working in areas where Babesia/Theileria species have been detected in animals.

Materials and methods Population study During the 2009, 432 blood samples were collected from volunteers living and/or working in

Veterinaria Italiana 2014, 50 (1), 41-49. doi: 10.12834/VetIt.1302.13

Gabrielli et al.

Northern and Central Italy, in areas included within 46°1'33''N-11°54'44''E and 42°24'29"N-12°51'36"E. Babesia EU1, B. microti, B. microti-like, B. divergens, B. canis, and Theileria equi have been previously found in animals living in these areas (Pietrobelli et al. 2007), and ticks carriers of B. microti-like, B. bovis, B. canis canis, B. canis vogeli and T. equi have also been reported (Iori et al. 2010). Informative meetings to explain motivation, aims and plan of the research were organized with volunteer blood donors, and no children were involved in the research. All study protocols followed the principles of the Helsinki Declaration1 and its subsequent modification, as well as those of the Italian rule (Ministerial Decree, 18.03.98)2 and the Italian National Law no. 675.19963 concerning the protection of personal data. Relevant data concerning age, place of residence (urban or rural), recreational pursuits (e.g. camping, hiking, fishing, hunting, gardening, and walking dogs) as well as occupational activities (involving or not job in brushy or grassy areas that might be inhabited by ticks), and awareness of tick bite were collected from each subject by means of a semi-structured form. All volunteer blood donors signed an informed consent stating to be fully conscious about procedures described by the physician. Moreover, each individual authorized us to carry out the diagnosis of babesiosis/theileriosis, as well as the publication of the results and the storage of his/her blood sample. Results of serological investigations remained anonymous and were directly communicated exclusively to each individual who was interested in knowing them. Positive subjects had access to further specific medical checks. Enrolled volunteers were grouped in subjects potentially more exposed to an infection risk due to their job (n=290: foresters, veterinary practitioners, livestock keepers, hunters and farmers) and individual resident in the same areas (n=142) but less exposed to the risk of an infection as their job or life do not occur in wildlife microenvironments.

Serological analyses The indirect fluorescent antibody (IFA) kit (Fuller Laboratories, Fullerton, CA, USA) was used to detect antibodies to B. microti. Human IgG antibodies against B. bovis, B. canis and T. equi were captured on

Piroplasms in Central and Northern Italy

IFAT slides carrying pre-fixed infected erythrocytes available for diagnosis in animals (B. bovis-IFA IgG, B. canis-IFA IgG, T. equi-IFA IgG Antibody kit, Fuller Laboratories, Fullerton, CA, USA) by means of a specific anti-human secondary antibody. As recommended in the data sheet of B. microti IFAT, sera were diluted serially in phosphate buffered saline (PBS) solution from 1:32 to 1:256 and then added on the slides. The cut-off value was fixed at 1:64, as suggested by the manufacturer. After incubation in a moist chamber for 30 min at 37°C and 3 wash cycles with PBS solution, the fluorescein‑conjugated goat anti-human IgG antibody (Sigma Aldrich, St. Louis, MO, USA) was added for incubation at 37°C for 30 min. Wells were counterstained with 0.02% Evans Blue containing 30% glycerol (Fuller Laboratories, Fullerton, CA, USA), and were submitted to fluorescence microscopic analysis at 40X magnification. Positive and negative controls, supplied by each kit, were used to ensure accurate test performance. In order to highlight the presence of antibodies to B. divergens, a laboratory-derived Enzyme‑Linked Immunosorbent Assay (ELISA) based on metabolic antigens of the cultured parasite recently developed (Gabrielli et al. 2012) was applied. Briefly, B. divergens antigens, obtained from the culture supernatant and quantified by Bradford assay as 17.3μg/μL, were adsorbed onto the ELISA wells. Sera (diluted 1:50 in PBS-Tween 20) were tested following standard ELISA procedures by using anti‑human IgG secondary antibody HRP conjugated (diluted 1:2000 in PBS-Tween 20) (Sigma, St Louis, MO, USA). Orthophenylene‑diamine (Sigma, St Louis, USA, USA) in 0.05M citrate buffer (pH=4.0) with 0.04% (v/v) H2O2 was added as substrate, and the enzymatic reaction was stopped with 0.5M H2SO4. Optical Density (O.D.) was measured at 492nm (Bio‑Rad, Life Sciences, Hercules, CA, USA). The cut‑off value was calculated as O.D. arithmetical mean plus 3 times standard deviation for 50 sera from healthy people with PCR-negative blood samples (Gabrielli et al. 2012). A positive reaction corresponded to an Ab index ≥1.0. To evaluate the specificity of serological assays applied, all reactive sera and 10 negative ones were further tested to evidence antibodies to plasmodia (protozoa closely related to piroplasms) with the DiaMed ELISA malaria antibody test (DiaMed‑Italiana S.r.l., Milan, Italy).

D eclaration of Helsinki. Ethical Principles for Medical Research Involving Human Subjects. Adopted by the 18th World Medical Association (WMA) General Assembly, Helsinki, Finland, June 1964; amended by the 29th WMA General Assembly, Tokyo, Japan, October 1975; 35th WMA General Assembly, Venice, Italy, October 1983; 41st WMA General Assembly, Hong Kong, September 1989; 48th WMA General Assembly, Somerset West, Republic of South Africa, October 1996, and the 52nd WMA General Assembly, Edinburgh, Scotland, October 2000. 2 D ecreto ministeriale of March the 18th 1998 ‘Linee guida di riferimento per l'istituzione e il funzionamento dei Comitati etici’. Off J, 122, 28/05/1998. 3 L egge n. 675 of December the 31st 1996 ‘Tutela delle persone e di altri soggetti rispetto al trattamento dei dati personali’. Off J (Suppl. n. 3), 5, 8/01/1997. 1

Veterinaria Italiana 2014, 50 (1), 41-49. doi: 10.12834/VetIt.1302.13

Gabrielli et al.

Piroplasms in Central and Northern Italy

Stastical analyses The Chi-square test was used to compare differences between the overall seroprevalence of more and less exposed groups of individuals and between Northern and Central population. Whereas the Fischer-Yates exact test was used to compare seroprevalence for each piroplasm species, P values <0.05 were considered to be statistically significant (Sullivan et al. 2009).

Results Eighty-one subjects showed to be reactive to Babesia/Theileria antigens, accounting for an overall positivity of 18.7%. No cross-reactivity to different babesial nor to plasmodial antigens was found. Antibodies to B. microti, B. bovis, B. divergens, B. canis and T. equi antigens were detected in 4.6%, 4.3%, 3.9%, 3.4%, and 2.3% of the tested sera, respectively. Table I summarizes reactivity to each piroplasm species per each study group. The prevalence of antibodies was significantly higher in the more exposed subjects (71/290; 24.4%) than in less exposed ones (10/142; 7.0%) (χ2=19.03; p<0.001). Seroreactivity against B. microti antigens was the most frequently found, with IgG titres from 1:64 to 1:256, and it was mainly detected in people highly exposed to tick bites as foresters and hunters (32.0% and 11.7%, respectively). Two foresters and 4 hunters reported a tick infestation in their anamnesis. In addition, 3 (3.7%) out of 80 livestock keepers, and 6 (4.2%) out of 142 subjects exposed to a recreational risk of infection turned out positive to B. microti IFAT (at 1:64 serum dilution). Similarly, antibodies against B. bovis (from 1:64 to 1:128 screening dilutions) were detected only in sera of people exposed to cattle farm environment such as livestock keepers (6.2%) and veterinary practitioners (9.3%); therefore its seroprevalence

was strongly correlated to the professional risk of infection (p<0.001). Antibodies to B. canis antigens (at 1:64 screening dilution) were found in 3.4% of the sera tested, mostly obtained from veterinary practitioners (8.0%), hunters (5.8%) and livestock keepers (1.2%). A less exposed subject also turned out to be positive (0.7%), however seroprevalence was significantly higher (p=0.02) in the more exposed group. About 6% of the veterinary practitioners and only 1 subject resident in Central Italy (0.7%) showed IgG reactivity against T. equi antigen (at 1:64 screening dilution), suggesting a significant professional and recreational risk of infection (p<0.001). Finally, anti‑B divergens antibodies were detected in 17 (3.9%) of the 432 subjects, who were mainly livestock keepers, but also foresters, veterinary practitioners and less exposed people. It is important to stress that the infection risk was significantly correlated with the job exposure (p=0.04), livestock keepers being the most seroreactive group. As for professional groups, foresters showed the highest number of positivities (39.2% of them showed antibodies mostly to B. microti and to B. divergens antigens), followed by veterinary practitioners (25.3%, most of them showed to reactive to B. bovis, B. canis and T. equi antigens), livestock keepers (23.7%, mainly reactive to B. divergens and B. bovis antigens), and hunters (17.6%, reactive to B. microti and B. canis antigens). Concerning the study area, the overall serological reactivity detected in Northern Italy (66/279; 23.6%) was higher (p<0.05) than the one recorded in Central Italy (15/152; 9.8%) (Table II).

Discussion This study aimed to evaluate the possible involvement of people living in Italy in an emerging

Table I. Seroreactivity to piroplasm antigens classified by professional risk of infection in the samples collected in North and Central Italy in 2009. Examined subjects More exposed Foresters Livestock keepers Veterinary practitioners Hunters Farmers Less exposed Total p

No. 290 28 80 150 17 15 142 432

B. canis 14 (4.8) 0 (0) 1 (1.2) 12 (8.0) 1 (5.8) 0 (0) 1 (0.7) 15 (3.4)

T. equi 9 (3.1) 0 (0) 0 (0) 9 (6.0) 0 (0) 0 (0) 1 (0.7) 10 (2.3)

0.02

<0.001

No. seroreactive subjects (%) B. bovis B. divergens 19 (6.5) 15 (5.1) 0 (0) 2 (7.1) 5 (6.2) 10 (12.5) 14 (9.3) 3 (2) 0 (0) 0 (0) 0 (0) 0 (0) 0 (0) 2 (1.4) 19 (4.3) 17 (3.9) <0.001

0.04

B. microti 14 (4.8) 9 (32.0) 3 (3.7) 0 (0) 2 (11.7) 0 (0) 6 (4.2) 20 (4.6)

Total 71 (24.4) 11 (39.2) 19 (23.7) 38 (25.3) 3 (17.6) 0 (0) 10 (7.0) 81 (18.7)

>0.05

<0.001 χ2=19.03

Veterinaria Italiana 2014, 50 (1), 41-49. doi: 10.12834/VetIt.1302.13

Gabrielli et al.

Piroplasms in Central and Northern Italy

Table II. Seroreactivity to piroplasm antigens of subjects exposed to different risk level. The data refer to the samples collected in North and Central Italy in 2009 and categorised by study area. Examined subjects Northern Italy More exposed (foresters, livestock keepers, veterinary practitioners)

Less exposed Central Italy More exposed (livestock keepers, hunters, farmers)

Less exposed

No.

No. seroreactive subjects (%) B. bovis B. divergens 16 (5.7) 13 (4.6)

B. microti 16 (5.7)

Total 66 (23.6)

13 (6.3)

12 (5.8)

62 (29.9)

0 (0) 3 (1.9)

0 (0) 4 (2.6)

4 (5.5) 4 (2.6)

4 (5.5) 15 (9.8)

0 (0)

3 (3.6)

2 (2.4)

9 (10.8)

1 (1.4)

0 (0)

2 (2.8)

6 (8.5)

279

B. canis 12 (4.3)

T. equi 9 (3.2)

207

12 (5.8)

9 (4.3)

16 (7.7)

72 153

0 (0) 3 (1.9)

0 (0) 1 (0.6)

2 (2.4)

1 (1.4)

sanitary problem as zoonotic piroplasmoses. Serological tests, widely accepted as important surveillance tools, were therefore applied to samples of the local population, which were deemed representative of the categories exposed to different degrees to several piroplasm species. To our knowledge, this is the first published data on the piroplasm seroprevalence in Italy. To overcome the lack of commercial assays to diagnose in humans B. bovis, B. canis and T. equi infections, we applied an adapted protocol to kits available for the diagnosis in animals. The reliability of the results is supported by the absence of reactivity to plasmodial antigens (the human protozoa most closely related to piroplasms) and to different babesial species (no mixed infections were found). This result was expected in view of the fact that we classified as positive only specific reactions indicated by the manufacturer as distinct apple-green inclusion bodies within the infected erythrocytes. Notwithstanding the need for a prudential interpretation of these results because of the human diagnostic adaptation and the limited sample size tested for some groups, these preliminary data are quite alarming. Seroreactivity to piroplasm species was detected in more than 18% of the samples tested, showing an overall mean seroprevalence higher than expected. The possible piroplasm transmission to people is likely a consequence of the high presence of these parasites in animal populations of the same area (where infection rates range from 17% to 56%, according to the animal species) (Pietrobelli et al. 2007). The second important aspect suggesting an easy involvement of people among the hosts was the molecular identification, in unselective feeder ticks of piroplasms closely related to zoonotic species, as B. microti-like, B. rodhaini and B. canis, detected in Rhipicephalus sanguineus, Ixodes ricinus and R. turanicus, respectively (Iori et al. 2010).

Veterinaria Italiana 2014, 50 (1), 41-49. doi: 10.12834/VetIt.1302.13

<0.001 χ2=12.45

Finally, the increase of tick habitat used by humans for recreational and occupational purposes, the spread of these arthropods towards upper altitudes and new habitats in relation to available hosts and climatic conditions, are all factors favouring human infection. Therefore, the results presented in this study are surprising but nearly expected. It is important to remark that the unexpected high reactivity to B. microti antigens (an average of 4.6%, which rises 11.7% in hunters and 32% in foresters) overcomes the one recently reported in Poland (4.4% in foresters) (Pancewicz et al. 2010), and the one found in Northern Italy (3.4% in foresters) [Sambri 2003, unpublished data, cited by Genchi (Genchi 2007)]. The findings described in this article support the data reported in Switzerland, where residents in the Eastern part of the country showed a 1.5% seroreactivity to B. microti (Foppa et al. 2002), and in Germany, where this value was 1.7% (Hunfeld et al. 2002). As for B. divergens, despite most of the reported human cases of babesiosis in Europe being attributed to this species, no human cases have been yet reported in Italy. Nevertheless, this study found reactivity to B. divergens antigens in 3.9% of the examined sample taken in areas where the seroprevalence in bovines ranges from 8% to 14% and the parasite has been molecularly detected in the examined cattle (Tampieri et al. 2008). Furthermore, different B. divergens-like strains are highly present in wild animals of the same area (Cancrini et al. 2008), a factor that increases the infection risk. However, it is useful to underline that contacts with B. divergens‑like species, such as B. venatorum, could remain undetected by the laboratory-derived ELISA applied in this study, which proved very specific (more than the conventional IFA and ELISA home‑made using corpuscular antigen) because based on metabolic antigens of the cultured B. divergens Rouen strain.

Gabrielli et al.

Piroplasms in Central and Northern Italy

The other piroplasm species (T. equi, B. canis and B. bovis), not documented but suspected as possible agent of zoonosis, proved their possible contact to humans, especially for those subjects more exposed to the infection risk. This result is of concern not only because it is indicative of a more wide number of possible zoonotic species, but also because it includes, among them, species that usually infect animals strongly associated to humans, particularly B. canis. For example, in the studied areas 3.4% of the people showed reactivity to B. canis, which has been found (as B. c. canis and B. c. vogeli) in 4.9% of the ticks collected (Cassini et al. 2009) and in 6.020% of the examined dogs (Pietrobelli et al. 2007, Solano‑Gallego et al. 2008). Statistical analyses showed a high association between job (and therefore environments more often frequented) and specific reactivity for piroplasms. As for less exposed subjects, those living in Northern Italy (mostly near natural protected areas) proved strongly exposed to B. microti, whereas those living in Central Italy (where natural recreational areas are available for people, and breeding, farming, and hunting are largely practised) proved at risk of infection with any species. Only farmers (a very small sample) proved negative to all tested antigens. Different seroreactivity found in Northern and Central Italy may be determined by distinct environmental features as well as by tick species that act as piroplasm vector/carrier, but it may also be biased by the different characteristics of the sampled population. Finally, a positive anamnesis to tick bite was reported in 6 cases, it is useful to remember that tick bite often

remains unnoticed and, therefore, asymptomatic infections may occur.

Conclusions This study documented the human seroreactivity to piroplasms in Italy and provides new epidemiological information on these zoonoses in Europe. It highlighted significant differences between more exposed and less exposed subjects. It also showed species-specific reactivity that fits in with the risk exposure to tick bite in different environmental conditions due to the different professional groups examined. Our findings suggest that infections due to several species, but overall to B. microti and B. divergens, may occur in Italy. Physician should indeed consider piroplasmoses when dealing with any febrile illness, especially in people who are exposed to infection risk for work‑related reasons.

Acknowledgements Authors are very grateful to Mrs Graziella Croce for her technical assistance in performing the serologic testing and to all volunteer blood donors for their enthusiastic participation to the serosurvey.

Grant support This work was financially supported by grants from the Italian Ministry of University and Research (PRIN, Prot. 2004075927 and PRIN, Prot. 2006072280).

Veterinaria Italiana 2014, 50 (1), 41-49. doi: 10.12834/VetIt.1302.13

Gabrielli et al.

Piroplasms in Central and Northern Italy

References Cancrini G., Gabrielli S., Iori A., Grifoni G. & Calderini P. 2008. Morphology and genetics of a Babesia isolate from Capreolus capreolus. J Wildl Dis, 44(1), 168-171.

Holman P.J. 2006. Phylogenetic and biologic evidence that Babesia divergens is not endemic in the United States. Ann N Y Acad Sci, 1081, 518-525.

Cassini R., Marcer F., di Regalbono A.F., Cancrini G., Gabrielli S., Moretti A., Galuppi R., Tampieri M.P. & Pietrobelli M. 2012. New insights into the epidemiology of bovine piroplasmoses in Italy. Vet Parasitol, 184(1), 77-82.

Homer M.J., Aguilar-Delfin I., Telford S.R. 3rd, Krause P.J. & Persing D.H. 2000. Babesiosis. Clin Microbiol Rev, 13 (3), 451-469.

Cassini R., Zanutto S., Frangipane di Regalbono A., Gabrielli S., Calderini P., Moretti A., Tampieri M.P. & Pietrobelli M. 2009. Canine piroplasmosis in Italy: epidemiological aspects in vertebrate and invertebrate hosts. Vet Parasitol, 165(1-2), 30-35. Centeno-Lima S., do Rosário V., Parreira R., Maia A.J., Freudenthal A.M., Nijhof A.M. & Jongejan F. 2003. A fatal case of human babesiosis in Portugal: molecular and phylogenetic analysis. Trop Med Int Health, 8(8), 760-764. Conrad P.A., Kjemtrup A.M., Carreno R.A., Thomford J., Wainwright K., Eberhard M., Quick R., Telford S.R. & Herwaldt B.L. 2006. Description of Babesia duncani n. sp. (Apicomplexa: Babesiidae) from humans and its differentiation from other piroplasms. Int J Parasitol, 36(7), 779-789. Foppa I.M., Krause P.J., Spielman A., Goethert H., Gern L., Brand B. & Telford S.R. 2002. Entomologic and serologic evidence of zoonotic transmission of Babesia microti, eastern Switzerland. Emerg Infect Dis, 8, 722-726. Gabrielli S., Galuppi R., Marcer F., Marini C., Tampieri M.P., Moretti A., Pietrobelli M. & Cancrini G. 2012. Development of Culture-Based Serological Assays to Diagnose Babesia divergens Infections. Vector Borne Zoonotic Dis, 12(2), 106-110. Genchi C. 2007. Human babesiosis, an emerging zoonosis. Parassitologia, 49, 29-31. Gray J.S. 2006. Identity of the causal agents of human babesiosis in Europe. Int J Med Microbiol, 296 (Suppl. 40), 131-136. Herwaldt B.L., de Bruyn G., Pieniazek N.J., Homer M., Lofy K.H., Slemenda S.B., Fritsche T.R., Persing D.H. & Limaye A.P. 2004. Babesia divergens-like infection, Washington State. Emerg Infect Dis, 10(4), 622-629. Herwaldt B.L., Cacciò S., Gherlinzoni F., Aspöck H., Slemenda S.B., Piccaluga P., Martinelli G., Edelhofer R., Hollenstein U., Poletti G., Pampiglione S., Löschenberger K., Tura S. & Pieniazek N.J. 2003. Molecular characterization of a non-Babesia divergens organism causing zoonotic babesiosis in Europe. Emerg Infect Dis, 9(8), 942-948. Hildebrandt A., Hunfeld K.P., Baier M., Krumbholz A., Sachse S., Kiehntopf M., Fricke H.J. & Straube E. 2007. First confirmed autochthonous case of human Babesia microti infection in Europe. Eur J Clin Microbiol Inf Dis, 26, 595-601.

Veterinaria Italiana 2014, 50 (1), 41-49. doi: 10.12834/VetIt.1302.13

Hunfeld K.P., Lambert A., Kampen H., Albert S., Epe C., Brade V. & Tenter A.M. 2002. Seroprevalence of Babesia infections in humans exposed to ticks in midwestern Germany. J Clin Microbiol, 40(7), 2431-2436. Iori A., Gabrielli S., Calderini P., Moretti A., Pietrobelli M., Tampieri M.P., Galuppi R. & Cancrini G. 2010. Tick reservoirs for piroplasms in central and northern Italy. Vet Parasitol, 170(3-4), 291-296. Leiby D.A. 2006. Babesiosis and blood transfusion: flying under the radar. Vox Sang, 90(3), 157-165. Meliani P., Khatibi S., Randazzo S., Gorenflot A. & Marchou B. 2006. Human babesiosis. Med Mal Infect, 36(10), 499-504. Moretti A., Mangili V., Salvatori R., Maresca C., Scoccia E., Torina A., Moretta I., Gabrielli S., Tampieri M.P. & Pietrobelli M. 2010. Prevalence and diagnosis of Babesia and Theileria infections in horses in Italy: a preliminary study. Vet J, 184(3), 346-350. Pancewicz S., Moniuszko A., Bieniarz E., Puciło K., Grygorczuk S., Zajkowska J., Czupryna P., Kondrusik M. & Swierzbińska-Pijanowska R. 2011. Anti-Babesia microti antibodies in foresters highly exposed to tick bites in Poland. Scand J Infect Dis, 43(3), 197-201. Pietrobelli M., Cancrini G., Moretti A. & Tampieri M.P. 2007. Animal babesiosis: an emerging zoonosis also in Italy? Parassitologia, 49 (Suppl 1), 33-38. Scholtens R.G., Braff E.H., Healey G.A. & Gleason N. 1968. A case of babesiosis in man in the United States. Am J Trop Med Hyg, 17(6), 810-813. Skrabalo Z. & Deanovic Z. 1957. Piroplasmosis in man; report of a case. Doc Med Geogr Trop, 9, 11-16. Solano-Gallego L., Trotta M., Carli E., Carcy B., Caldin M. & Furlanello T. 2008. Babesia canis canis and Babesia canis vogeli clinicopathological findings and DNA detection by means of PCR-RFLP in blood from Italian dogs suspected of tick-borne disease. Vet Parasitol, 157(3-4), 211-221. Sullivan K.M., Dean A. & Soe M.M. 2009. OpenEpi: a webbased epidemiologic and statistical calculator for public health. Public Health Rep, 124(3), 471-474. Tampieri M.P., Galuppi R., Bonoli C., Cancrini G., Moretti A. & Pietrobelli M. 2008. Wild ungulates as Babesia hosts in northern and central Italy. Vector Borne Zoonotic Dis, 8(5), 667-674. Vannier E. & Krause P.J. 2009. Update on babesiosis. Interdiscip Perspect Infect Dis, 984568. doi: 10.1155/2009/984568.

Natural infection of Anaplasma platys in dogs from Umbria region (Central Italy) Maria Teresa Antognoni, Fabrizia Veronesi, Giulia Morganti, Vittorio Mangili, Gabriele Fruganti & Arianna Miglio 1

Department of Veterinary Medicine, Section of Internal Medicine, Faculty of Veterinary Medicine, University of Perugia, Via San Costanzo 4, 06126 Perugia, Italy

* Corresponding author at: Department of Veterinary Medicine, Section of Internal Medicine, Faculty of Veterinary Medicine, University of Perugia, Via San Costanzo 4, 06126 Perugia, Italy. Tel.: +39 075 5857610, e-mail: miglioarianna@libero.it

Veterinaria Italiana 2014, 50 (1), 49-56. doi: 10.12834/VetIt.82.258.2

Accepted: 24.02.2014 | Available on line: 31.03.2014

Keywords Anaplasma platys, Central Italy, Diagnosis, Dog, Immune-Mediated Hemolytic Anemia, Thrombocytopenia.

Summary Anaplasma platys is a tick-borne pathogen causing the Infectious Canine Cyclic Thrombocytopenia. The pathogenesis of this disease is not yet well understood, due to the wide variety of clinico-pathological patterns described worldwide and to the high prevalence of co-infections with other vector-borne pathogens occurring in endemic areas. The present paper reports 3 cases of infection by A. platys occurring in dogs native to Central Italy, considered a non-endemic area to date. Infections were initially diagnosed based on clinical data and observation of morulae within platelets and then confirmed by biomolecular techniques. Moreover, two dogs showed an immune-mediated hemolytic anemia, as yet not described in literature in association with A. platys infection. The symptoms and the pathological findings observed will be discussed, as well as the importance to include this pathogen in the differential diagnosis of tick-borne diseases even in Central Italy.

Infezione naturale sostenuta da Anaplasma platys in cani residenti in regione Umbria, Italia Centrale Parole chiave Anaplasma platys, Anemia emolitica immuno-mediata, Cane, Diagnosi, Italia Centrale, Trombocitopenia ciclica canina.

Riassunto Anaplasma platys è un agente patogeno trasmesso da zecche responsabile della trombocitopenia ciclica canina. La patogenesi di questa malattia non è ancora ben conosciuta per la manifestazione di quadri clinico-patologici variabili e la possibile concomitanza del microrganismo con altri agenti patogeni trasmessi da vettori. L’infezione risulta sottostimata. L’articolo descrive tre casi di infezione da A. platys in cani stabilmente residenti nella regione Umbria, Italia Centrale, area considerata indenne. Le infezioni sono state diagnosticate sulla base dei rilievi clinici e la presenza, nello striscio ematico, di morule all'interno di piastrine. Successivamente, le infezioni sono state confermate mediante tecniche biomolecolari. In due cani, inoltre, è stata riscontrata contemporaneamente all’infezione anche anemia emolitica immuno-mediata, associazione non riportata in letteratura. L’articolo evidenzia la necessità di dare rilevanza ad Anaplasma platys in Italia Centrale e di includere la trombocitopenia ciclica canina nella diagnosi differenziale delle malattie trasmesse da zecche nella specie canina.

Anaplasma platys in dogs from Central Italy

Introduction Anaplasma platys (formerly Ehrlichia platys) is a Gram negative, non-mobile, pleomorphic bacterium, belonging to the Anaplasmataceae Family, which has been speculated, but not conclusively demonstrated, to be transmitted by Rhipicephalus sanguineus, known as the “brown dog tick”(Simpson et al. 1991). Anaplasma platys is an obligate intracellular microorganism, which appears to parasitise dog platelets exclusively, causing a Canine Vector-Borne Disease (CVBD) named Infectious Canine Cyclic Thrombocytopenia (ICCT) (Cardoso et al. 2010) due to the thrombocytopenia that relapses every 7-14 days (Harrus et al. 1997). Since its first identification in Florida (Harvey et al. 1978), A. platys infection has been reported in several countries around the world, including the United States, China, Thailand, India, Japan, Venezuela, Brazil, Chile, Israel and Australia (Abarca et al., 2007, Abd Rani et al. 2011, Brown et al. 2001, Cardozo et al. 2009, French et al. 1983, Hua et al. 2000, Inokuma et al. 2001, Suksawat et al. 2001). With regard to Europe, the presence of A. platys has been reported in France, Italy, Spain, Greece, Portugal, and Croatia and in 2 dogs imported in Germany (Beaufils et al. 2002, De La Fuente et al. 2006, Dyachenko et al. 2012, Ferreira et al. 2007, Kontos et al. 1991). Despite the increasing interest in Vector Borne Pathogens (VBPs) affecting dogs in Italy (Dantas‑Torres et al. 2012), the infection by A. platys is poorly documented and considered to be sporadic throughout the country. Nonetheless, A. platys has been serologically and molecularly detected in dogs from Southern regions (Sicily, Apulia and Abruzzo), mostly in co-infection with other VBPs (16, 17, 35, 37,39). Moreover, the DNA of this pathogen has also been found in R. sanguineus ticks by PCR (Sparagano et al. 2003). There is a significant need to improve basic knowledge of the distribution of this VBP affecting autochthonous canine populations and to describe, from a practical standpoint, the potential impact that a single natural A. platys infection may have on the patients. This article describes 3 cases of A. platys infection occurring in autochthonous dogs from Central Italy.

Materials and methods History and clinical presentation Three dogs (dog 1: a 6-year-old female Breton dog; dog 2: a 7-year-old female mongrel dog; dog 3: a 10-year-old female German Shepherd dog) were brought to the Veterinary Teaching Hospital of

Antognoni et al.

the University of Perugia (Central Italy) following a few days of depression, anorexia, lethargy, as well as diarrhoea and intermittent nasal and buccal mucosal bleeding (dog 3). The dogs lived outdoors in rural areas of Umbria (region in Central Italy) and, according to the owner’s declaration, the dogs had never travelled outside Italy. For each animal, vaccinations and monthly heartworm preventions had been correctly conducted and commercial topical products (spot on formulation of imidacloprid 10 mg/kg and permethrin 50 mg/kg) were used to control tick, flea, mosquito and sand flies. At clinical presentation, all 3 dogs were dehydrated and had pale mucous membranes, enlarged popliteal lymph nodes, splenomegaly, and the dog 3 also had intestinal fluid content at abdominal palpation.

Diagnostic procedures Venous blood samples were collected for complete blood count (CBC) (Genius Vet hematology analyzer, SEAC-Radim, Calenzano, Italy), serum biochemical profile (Hitachi 904 automatic-analyzer Boehringer Ingelheim, Milan, Italy; Diasys kits, Holzheim, Germany), coagulation panel (Clot 2s, semiautomated coagulation analyzer, SEAC-Radim, Calenzano, Italy), serum protein electrophoresis (Hydrasys LC-SEBIA, Hydragel B1-B2 kits, Florence, Italy), Modified Knott’s test for microfilariae detection and ‘insaline slide blood autoagglutination test’. Moreover, the direct Coombs’ Testwas performed on dogs 2 and 3 in a referral laboratory (Idexx, Vet Med Lab., Giessen, Germany). Blood and buffy coat smears were prepared and stained for microscopic examination using May Grünwald Giemsa (Aerospray slide stainer, Delcon, Wescor, Milan, Italy) Serum samples were tested by Indirect Immunofluorescence Antibody Tests (IFAT) using commercial antigens (MEGACOR, DIAGNOSTIK Lochauer Straße, Hoerbranz, Austria) to detect IgG and IgM antibodies against the most common VBPs i.e. Ehrlichia canis (MegaScreen®, FLUOEHRLICHIA canis), Anaplasma phagocytophilum (MegaScreen®, ANAPLASMA ph.), Leishmania infantum (MegaScreen®, FLUOLEISH inf.), Borrelia burgdorferi (MegaScreen®, FLUOBORRELIA canis), and Babesia canis (MegaScreen®, BABESIA c.), following the manufacturer’s directions. Moreover, DNA was extracted from blood samples containing ethylenediaminetetraacetic acid (EDTA) using the QIAamp® DNA Mini Kit (QIAGEN S.p.A., Milan, Italy) according to the manufacturer’s instructions, and submitted to PCR assays, previously described in literature: A. phagocytophilum, A. platys and E. canis DNA was searched using a Ehrlichia genus set of primers that amplify a 345 bp fragment of the 16S rRNA gene (Martin et al. 2005); a specific nested PCR

Veterinaria Italiana 2014, 50 (1), 49-56. doi: 10.12834/VetIt.82.258.2

Antognoni et al.

protocol (Chu et al. 2008), amplifying a 226–266 bp fragment (depending on the strains) encompassing the 5S–23S intergenic spacer region of the rRNA, was used for B. burgdorferi DNA detection. In order to search for the presence of babesial parasite DNA, PCR was performed using the CRYPTO F (Herwaldt et al. 2003) and RLB-R2 (Centeno-Lima et al. 2003), which amplifies a fragment of the 18S-rRNA approximately 800 bp in size; Bartonella spp. DNA was amplified by conventional PCR targeting a fragment of 16S-23S intergenic transcribed spacer (ITS) as described previously (Diniz et al. 2007). PCR assays were run with 50 µl of PCR reaction mixture containing 10 µl of Tfl buffer (Promega, Milan, Italy), 1 µl of 10 mMdNTPs, 1 µl (10 pmol) of each primer, 3 µl of 25 mM MgSO4,1 µl of DNA sample (80 ng/µl), 1 µl of Tfl Polymerase (Promega, Milan, Italy) and 32 µl of nuclease-free water per reaction. Amplification reactions were carried out in a ONE-Personal PCR Thermocycler (EuroClone, Milan, Italy). In order to confirm amplicon identity, all the amplified fragments obtained were purified from excess primers and buffers using the ExoSAP-IT (Affymetrix, Santa Clara, CA, USA) kit and sequenced with a 16-capillary ABI PRISM 3130 Genetic Analyzer (Applied Biosystem, Foster City, CA, USA). The forward and reverse sequences were aligned with ClustalW, validated visually, and consensus sequences were generated using the Applied Biosystems SeqScape Software 1 (version 2.5). The resultant consensus sequences were compared with sequence data in GenBank using the BLAST algorithm1.

Results Table I shows the results of the blood analysis. The complete blood count revealed neutrophilic leukocytosis with a left shift, moderate to severe normocytic normochromic anemia, anisocytosis, reticulocytosis, mild to severe thrombocytopenia with increased MPV (Mean Platelet Volume) in all 3 dogs. Lymphopenia was also present in dog 1 and eosinophilia, lymphocytosis and monocytosis in dog 2. The serum biochemical profile, coagulation panel and serum protein electrophoresis revealed an increased concentration of alkaline phosphatase, total and indirect bilirubin, fibrinogen and fibrinogen degradation products (dogs 2 and 3). They also showed an increased concentration of albumin, an elevated albumin to globulin ratio and reduced concentrations of α1, α2 and γ globulins (dog 2), and an increase in prothrombin time, thrombin time and activated partial thromboplastin time (dog 3). The microscopic examination of the blood and buffy coat smears evidenced the presence of 1

h ttp://blast.ncbi.nlm.nih.gov/ Blast.cgi.

Veterinaria Italiana 2014, 50 (1), 49-56. doi: 10.12834/VetIt.82.258.2

Anaplasma platys in dogs from Central Italy

macroplatelets and intracellular basophilic platelet inclusions with 1 or more elements resembling A. platys morulae (Figure 1). Spherocytosis was detected in dogs 2 and 3, and therefore the Coombs’ Testand the ‘insaline slide blood autoagglutination test’ returned positive results, suggesting the occurrence of an Immune Mediated Hemolytic Anemia (IMHA). The Modified Knott’s test was negative for each dog and all IFAT tests were negative both for IgG and IgM antibodies. Polymerase chain reaction test for Anaplasmataceae‑16S rRNA gene was found to be positive in all 3 dogs; the resultant consensus sequences analysis revealed that all the specimens were closely related to A. platys (99-100%); the highest identity was obtained with sequences from Croatian (GenBank accession number, JQ396431.1) and Spanish strains (GenBank accession number, AY821826.1). Based on data generated with additional PCR and serology tests, there was no evidence of co-infections with other pathogens, such as A. phagocytophilum, E. canis, B. canis, B. burgdorferii, Bartonella spp., L. infantum, H. canis, all of which may also occur in Italy and could further influence clinicopathological findings and the clinical course of the disease. Based on the clinicopathological findings and on the PCR results, all 3 dogs proved to be affected by ICCT and therefore received a compatible fresh blood transfusion and specific therapy with doxycycline (10 mg/kg/day, PO). Dogs 2 and 3 also received prednisone (2mg/kg/day, PO) and ranitidine (2 mg/kg BID, IV) for the IMHA treatment. After 1 week of therapy, dog 1 clinically improved and A. platys morulae were no longer detectable by a microscopic evaluation of blood and buffy coat smears; the PCR testing conducted at days 7 and 28 of the therapy were also negative. The dog was still alive 6 months after treatment and has never had recurrence of the infection. On the other hand, dogs 2 and 3 developed worsening signs including lethargy, hypothermia and respiratory failure and died on the 7th and 11th day of therapy, respectively. Post‑mortem examination revealed both dogs had not only yellow icteric colouring of the subcutaneous connective tissue and skin, splenomegaly with red pulp hyperplasia and hemosiderosis, pulmonary edema and disseminated pulmonary vascular thrombosis, but also hyperplasia of the erythroid and megakaryocytic lineages in the bone marrow. Dog 3 also showed hepatic nodular hyperplasia with extramedullar diffused hematopoiesis membranous glomerulonephritis and tubular nephrosis. The death of both dogs was attributable to acute cardio‑respiratory failure secondary to the development of IMHA and disseminated intravascular coagulation (DIC).

Anaplasma platys in dogs from Central Italy

Antognoni et al.

Table I. Cell Blood Count (CBC), serum biochemical profile, coagulation panel and serum protein electrophoresis results from 3 dogs from Central Italy with Anaplasma platys infection. Breton a

Mongrel c

German Shepherd

Reference intervals

37.9 18.6 5.3 2.7 7.9 3.4 1.07 2.6 7.2 67 33.5 165.3 11.9 164 11.2

42.4 19.8 6.4 3.7 8.9 3.6 2.74 6.4 17.9 69 36.4 127.1 15.9 179 11.3

21.5 16.0 1.7 0.8 2.2 0.8 2.79 7.3 21.5 77 33.9 161.4 18.6 59 11.9

6.0 - 13.0 3.9 - 12.0 0 - 0.3 0-1.9 0.8 - 3.6 0.1 - 1.8 5.50- 7.90 12.0 - 18.0 37.0 - 55.0 60 – 77 32.0 - 38.0 <150.0 12.0 - 16.0 200 – 500 4.9 - 7.0

86 0.70 6.0 3.2 30 670 3 34 2.84 2.00 4

39 1.0 6.0 3.1 75 309 9 49 3.98 3.45 5

20 – 50 < 1.8 6 - 7.5 2.9 - 3.7 < 80 < 100 < 10 < 60 < 0.2 < 0.1 2.9 - 5.0

CBC WBC (x10 /L) Neutrophils (x109/L) Bands (x109/L) Eosinophils (x109/L) Lymphocytes (x109/L) Monocytes (x109/L) RBC (x1012/L) Hb (g/dL) HCT (%) MCV (fL) MCHC (g/dL) Reticulocytes (x109/L) RDW (%) PLT (x109/L) MPV (fL) 9

18.9 16.1 1.1 1.0 0.5 0.2 1.39 4.0 11.1 77 36.3 531 21.8 163 10.0

5.4 1.3 0.3 2.5 1.3 0 3.32 8.6 23.4 70 36.6 151.2 18.8 303 9.6

7.0 4.0 0 1.3 1.6 0.1 6.00 12.8 37.8 63 32.5 51.0 15.4 356 6.5

BIOCHEMICAL PROFILE Urea (mg/dL) Creatinine (mg/dL) Total Protein (g/dL) Albumin (g/dL) ALT (IU/L) ALP (IU/L) GGT (IU/L) AST (IU/L) Total bilirubin Indirect bilirubin (mg/dL) Phosphorus (mg/dL)

42 0.83 6.2 2.9 20 70 6 28 0.22 0.10 5

41 0.89 6.4 3.3 17 74 5 22 0.17 0.09 3

47 0.90 6.6 3.3 21 73 5 20 0.19 0.11 3

80 0.83 6.3 3.6 24 410 3 28 4.55 3.19 4

COAGULATION PANEL Prothrombin Time (sec) Thrombin Time (sec) Activated partial thromboplastin time (sec) Fibrinogen (mg/dL) FDP (μg/ml)

7.3 16.4

6.5 19.3

8.3 28.9

6.2 12.2

12.7 112.6

72.3 99.2

5–8 15 – 30

17.5

12.4

17.0

15.1

120.1

185.2

9 - 20

53 23

130 9

207 3

980 14

410 10

633 6

100 – 400 < 10

4.0 0.3 0.4 0.3 0.5 0.5 2.00

3.6 0.2 0.6 0.1 0.3 0.9 1.60

2.2 - 3.8 0.2 - 0.5 0.5 - 1.0 0.5 - 1.1 0.3 - 0.7 0.5 - 1.8 0.80 - 1.65

SERUM PROTEIN ELECTROPHORESIS Albumin (g/dL) α1 - globulins (g/dL) α2 - globulins (g/dL) β1- globulins (g/dL) β2 - globulins (g/dL) γ - globulins (g/dL) Albumin: Globulin ratio

2.7 0.2 0.5 0.9 0.7 1.2 0.79

3.4 0.2 0.5 0.6 0.5 1.2 1.16

3.7 0.3 0.2 0.5 0.6 1.3 1.27

4.8 0.1 0.1 0.6 0.5 0.2 3.40

a = at hospitalization; b = 7 days after treatment; c = 28 days after treatment. PLT = platelets; ALP = alkaline phosphatase; ALT = alanine aminotransferase; AST = aspartate aminotransferase; GGT = gamma-glutamyl transferase; FDPs = fibrinogen degradation products.

Veterinaria Italiana 2014, 50 (1), 49-56. doi: 10.12834/VetIt.82.258.2

Antognoni et al.

Figure 1. Anaplasma platys morulae in the platelets (arrow) and giant platelets in blood from 3 dogs with A. platys infection in Central Italy. May Grünwald Giemsa (MGG), X 100 objective.

Discussion To the authors’ knowledge, this report is the first documentation of single natural A. platys infections in dogs native of and living permanently in Central Italy. Among the current available diagnostic methods for detection of A. platys infection, the most commonly used include morulae identification in the blood smears, antibody detection and DNA amplification by PCR (Otranto et al. 2010). Demonstration of the intra-platelet inclusion bodies of A. platys on blood or buffy-coat smears commonly represents the first diagnostic approach in A. platys infection, especially during the acute phase of disease. On the basis of the study described in this article, an accurate, light microscopy analysis of the stained blood smears appears to be a reliable method to point the diagnosis in the direction of A. platys infection, as it allowed platelet cytoplasmic inclusions resembling A. platys morulae to be detected and acute infection to be suspected in all 3 clinical cases. However, a definitive detection of the organisms in blood films may be difficult and cannot be considered a reliable diagnostic method in the chronic phase of the infection due to the cyclic course of bacteremia, the rarely found parasitemia and the fairly frequent presence of a very low number of infected platelets (Harrus et al. 1997, Otranto et al. 2010). Furthermore, it should be considered that inclusion bodies within platelets may be present and related to platelet activation during inflammation and E. canis infection and, thus, misdiagnosed as A. platys morulae (Ferreira et al. 2007). Serological methods, such as IFAT, were not taken into account in the diagnostic approach of A. platys infection because they are uncommonly applied, due to the difficulty in obtaining A. platys‑infected platelets to use as antigen (A. platys has not yet been cultured) (Lai et al. 2011, Martin et al. 2005) and the possible false-positive results linked to the serologic cross-reactivity between organisms belonging to the same sero-group (e.g. A. phagocytophilum). Recently, a simple qualitative in-clinic Enzyme Linked Immunosorbent Assay (ELISA), the Snap®4Dx

Veterinaria Italiana 2014, 50 (1), 49-56. doi: 10.12834/VetIt.82.258.2

Anaplasma platys in dogs from Central Italy

Plus (IDEXX Laboratories, Westbrook, ME, USA) was developed in order to identify antibodies against A. platys, as well as to detect Dirofilaria immitis antigen and antibodies for further VBPs e.g. A. phagocytophilum, E. canis, E. erwiingi, B. burgdorferi. This rapid ELISA gained favour among small-animal practitioners due both to its ease of use and its accuracy, however is not able to distinguish between A. phagocytophilum and A. platys. Moreover, the presence of anti-A. platys antibodies does not mean clinical infection, but rather exposure to the infectious agent (Martin et al. 2005). Recently, more specific and sensitive strategies focusing on molecular methods based on PCR approaches were employed (Eddlestone et al. 2007, Ferreira et al. 2007, Inokuma et al. 2002, Lai et al. 2011, Martin et al. 2005) to enable the diagnosis of active cases of A. platys infection, which would otherwise have gone undetected due to low‑sensitivity of microscopy and the low-specificity of the serological diagnosis. It has been demonstrated that PCR is positive even in the case of low-level parasitemia (Otranto et al. 2010). Several PCR assays were optimized to allow for accurate identification of A. platys infection in dogs using different targets (16S rRNA, p44, groESL, gltA). Therefore, the PCR test, confirmed by a sequence analysis of amplicons, is considered to be the most reliable diagnostic test for this pathogen to date (Aguirre et al. 2006, De La Fuente et al. 2006, Gaunt et al. 2010). Since PCR represents a diagnostic method offering more specific resources to identify and confirm the A. platys infections compared to the standard assay, such as microscopic evaluation, a PCR protocol which amplified a target fragment of the 16S rRNA (Martinet al. 2010), common to several species of Anaplasmataceae pathogens (i.e. E. canis and A. phagocytophilum) included in the differential diagnosis of the ICCT, was performed for all 3 cases herein. All 3 dogs showed 16S rRNA sequences closely related or identical to other A. platys European strains previously reported (Aguirre et al. 2006, Dyachenko et al. 2012). These results agree with previous reports, in which low, genetic diversity was observed between 16S rRNA sequences of the A. platys strains above and beyond their different geographical origins (Aguirre et al. 2006, De La Fuente et al. 2006, Torina et al. 2008, Unver et al. 2003), and they confirm that such a genetic target is quite a crucial tool for diagnostic confirmation, even though it does not represent the best choice for further phylogenetic analysis. The common detection of dogs co-infected by A. platys and other infectious agents (E. canis, Babesia spp., A. phagocytophilum, and H. canis), together with the fact that A. platys infection develops in a similar way to other tick-borne

Anaplasma platys in dogs from Central Italy

At presentation, the 3 dogs herein showed severe, acute disease, which could be explained partly by the occurrence of high virulent A. platys strains, as recently reported in cases from Israel, France and Greece (Beaufils at al. 2002, Harrus et al. 1997, Kontos et al. 1991).

(Baker et al. 1988, Gaunt et al. 2010) and natural infections (Beaufils et al. 2002, De Caprariis et al. 2011) of A. platys. At the beginning of the disease, the fundamental mechanism of thrombocytopenia and thrombocytopathy, found in both single and co-infections with A. platys, may be attributed mainly to the direct action of the parasite (increased platelet consumption, production of inhibitory factors) and, at a later stage, to the hypersplenism or immunologically mediated platelet destruction stimulated by the bacteria (Baker et al. 1988, De Caprariis et al. 2011, Harvey et al. 1978). The immune mediated phenomena and particularly IMHA, have been previously observed in dogs infected by A.Â phagocytophilum and E. canis (Bexfield et al. 2005, Harrus et al. 1999, Mazepa et al. 2010), whereas they have never before been described in dogs infected by A. platys. Some authors stated that dogs affected with bacterial infection and IMHA are prone to the development of thromboembolic complications with consequent negative course of the disease (Carr et al. 2002). The occurrence of the disseminated intravascular coagulation (DIC) observed in dogs 2 and 3 probably exasperated the overall clinical conditions of the animals, bringing to their death in absence of a prompt anticoagulant prophylaxis. In this respect, it is significant that the symptomatology in dog 1, which showed no immune-mediated complication, rapidly regressed after therapy as also observed by other authors (Beaufils et al. 2002, Eddlestone et al. 2007, Gaunt et al. 2010).

Common haematological abnormalities recorded in the 3 dogs included mild to moderate thrombocytopenia with increased MPV, moderate to severe normocytic normochromic anaemia and evidence of giant platelets on blood films, these findings are consistent with experimental

In conclusion, the present findings demonstrate that autochthonous infections by A. platys can be observed in dogs living in Central Italy and, therefore, A. platys infection should be included in the differential diagnosis of CVBDs and IMHA occurring in such areas.

infections causing thrombocytopenia, may lead to a misunderstanding of the real pathogenic role of this pathogen (Antognoni et al. 2010, De Caprariis et al. 2011, Eddlestone et al. 2007). A wide range in the degree of severity of A. platys infection has been described in animals from different geographical areas, suggesting that the variety of clinical developments could be strongly related to the origin of the A. platys strains. In the United States and in Australia, most reports of experimental and natural A. platys infections emphasized the occasional discovery of the parasite and the subclinical or asymptomatic course of disease (Barker et al. 2012, Carr et al. 2002, Woody and Hopkins 1991), whereas in other countries, especially those of the Mediterranean basin (Israel, France, Greece and Spain), the A. platys strains appear to be more virulent (Aguirre et al. 2006, Beaufils et al. 2002, Cardoso et al. 2010, Sparagano et al. 2003). At the same time, some findings suggest that the severity and course of disease caused by this agent could be related not only to the strain, but also to conditioning factors (immune status of the animal, stress conditions, breed, age, etc.), as it has also been previously suggested for E. canis infection (Aguirre et al. 2006, Harrus et al. 1997).

Antognoni et al.

Veterinaria Italiana 2014, 50 (1), 49-56. doi: 10.12834/VetIt.82.258.2

Antognoni et al.

Anaplasma platys in dogs from Central Italy

References Abarca K., López J., Perret C., Guerrero J., Godoy P., Veloz A., Valiente-Echeverría F., León U., Gutjahr C. & Azócar T. 2007. Anaplasma platys in dogs, Chile. Emerg Infect Dis, 13, 1392-1395. Abd Rani P.A., Irwin P.J., Coleman G.T., Gatne M. & Traub R.J. 2011. A survey of canine tick-borne diseases in India. Parasit Vectors, 4, 141. doi:10.1186/1756-3305-4-141. Aguirre E., Tesouro M.A., Ruiz L., Amusategui I. & Sainz A. 2006. Genetic characterization of Anaplasma (Ehrlichia) platys in dogs in Spain. J Vet Med B Infect Dis Vet Public Health, 53, 197-200. Antognoni M.T., Birettoni F., Miglio A., Lalli P., Porciello F. & Mangili Pecci V. 2010. Monoclonal gammopathy associated with multiple myeloma and visceral leishmaniasis in the dog: a comparison of two cases. Vet Res Comm, 34, 97-101. Baker D.C., Gaunt S.D. & Babin S.S. 1988. Anemia of inflammation in dogs infected with Ehrlichia platys. Am J Vet Res, 49, 1014-1016. Barker E.N., Langton D.A., Helps C.R., Brown G., Malik R., Shaw S.E. & Tasker S. 2012. Haemoparasites of free-roaming dogs associated with several remote Aboriginal communities in Australia. BMC Vet Res, 8, 55. Beaufils J.P., Inokuma H., Martin-Granel J., Jumelle P., Barbault-Jumell M. & Brouqui P. 2002. Anaplasma platys (Ehrlichia platys) infection in a dog in France: description of the case and characterization of the agent. Revue de Médecine Vétérinaire, 153, 85-90. Bexfield N.H., Villiers E.J. & Herrtage M.E. 2005. Immunemediated haemolytic anaemia and thrombocytopenia associated with Anaplasma phagocytophilum in a dog. J Small An Pract, 46, 543-548. Brown G.K., Martin A.R., Roberts T.K. & Aitken R.J. 2001. Detection of Ehrlichia platys in dogs in Australia. Aust Vet J, 79, 554-558. Cardoso L., Tuna J., Vieira L., Yisaschar-Mekuzas Y. & Baneth G. 2010. Molecular detection of Anaplasma platys and Ehrlichia canis in dogs from the North of Portugal. Vet J, 183, 232-233. Cardozo G.P., Oliveira L.P., Mansur M.A., Santos E.V., Roberto P.G. & Marins M. 2009. Molecular characterization of two strains of Anaplasma platys in Brazil. Vet Rec, 164, 338-340. Carr A.P., Panciera D.L. & Kidd L. 2002. Prognostic factors for mortality and thromboembolism in canine immunomediated hemolytic anemia: a retrospective study of 72 dogs. J Vet Int Med, 16, 504-509. Centeno-Lima S., Do Rosário V., Parreira R., Maia A.J., Freudenthal A.M., Nijhof A.M. & Jongejan F. 2003. A fatal case of human babesiosis in Portugal: molecular and phylogenetic analysis. Trop Med Int Health, 8, 760-764. Chu C.Y., Jiang B.G., Liu W., Zhao Q.M., Wu X.M., Zhang P.H., Zhan L., Yang H. & Cao W.C.2008. Presence of pathogenic Borrelia burgdorferi sensu lato in ticks and rodents in Zhejiang, south-east China. J Med Microbiol, 57, 980-985.

Veterinaria Italiana 2014, 50 (1), 49-56. doi: 10.12834/VetIt.82.258.2

Dantas-Torres F., Chomel B.B. & Otranto D. 2012. Ticks and tick-borne diseases: a One Health perspective. Trends Parasitol, 28, 437-446. De Caprariis V., Dantas-Torres F., Capelli G., Mencke N., Stanneck D., Breitschwerdt E.B. & Otranto D. 2011. Evolution of clinical, haematological and biochemical findings in young dogs naturally infected by vectorborne pathogens. Vet Microbiol, 149, 206-212. De La Fuente J., Torina A., Naranjo V., Nicosia S., Alongi A., La Mantia F. & Kocan K.M. 2006. Molecular characterization of Anaplasma platys strains from dogs in Sicily, Italy. BMC Vet Res, 2, 24-29. Diniz P.P., Maggi R.G., Schwartz D.S., Cadenas S.P., Bradley J.M., Hegarty B. & Breitschwerdt E.B. 2007. Canine bartonellosis: serological and molecular prevalence in Brazil and evidence of co-infection with Bartonella henselae and Bartonella vinsonii subsp. berkhooffii. Vet Res, 38, 697-710. Dyachenko V., Pantchev N., Balzer H.J., Meyersen A. & Straubinger R.K. 2012. First case of Anaplasma platys infection in a dog from Croatia. Parasit Vectors, 5, 49-55. Eddlestone S.M., Gaunt S.D., Neer T.M., Boudreaux C.M., Gill A., Haschke E. & Corstvet R.E. 2007. PCR detection of Anaplasma platys in blood and tissue of dogs during acute phase of experimental infection. Ex Parasitol, 115, 205-210. Ferreira R.F., Cerqueira A.M.F., Pereira A.M., Guimaraes C.M., De Sá A.G., Abreu F.S., Massard C.L. & Pereira Almosny N.R. 2007. Anaplasma platys diagnosis in dogs: comparison between morphological and molecular tests. Int J Appl Res Vet Med, 5, 113-119. French T.W. & Harvey J.W. 1983. Serologic diagnosis of infections cyclic thrombocytopenia in dogs using an indirect fluorescent antibody test. Am J Vet Res, 44, 2407–2411. Gaunt S.D., Beall M.J., Stillman B.A., Lorentzen L., Diniz P.P.V.P., Chandrashekar R. & Breitschwerdt E.B. 2010. Experimental infection and co-infection of dogs with Anaplasma platys and Ehrlichia canis: hematologic, serologic and molecular findings. Parasit Vectors, 3, 33-44. Harrus S., Aroch L., Lavy E. & Bark H. 1997. Clinical manifestations of infectious canine cyclic thrombocytopenia. Vet Rec, 141, 2247-2250. Harrus S., Waner T., Bark H., Jongejan F. & Cornelissen A.W. 1999. Recent advances in determining the pathogenesis of canine monocytic ehrlichiosis. J Clin Microbiol, 37, 2745-2749. Harvey J.W., Simpson C.F. & Gaskin J.M. 1978. Cyclic thrombocytopenia induced by a Rickettsia-like agent in dogs. J Infect Dis, 137, 182-188. Herwaldt B.L., Cacciò S., Gherlinzoni F., Aspöck H., Slemenda S.B., Piccaluga P., Martinelli G., Edelhofer R., Hollenstein U., Poletti G., Pampiglione S., Löschenberger K., Tura S. & Pieniazek N.J. 2003. Molecular characterization of a Non–Babesia divergens organism causing zoonotic Babesiosis in Europe. Emerg Infect Dis, 9, 942-948.

Anaplasma platys in dogs from Central Italy

Hua P., Yuhai M., Slide T., Yang S., Bohai W. & Xiangrui C. 2000. Canine ehrlichiosis caused simultaneously by Ehrlichia canis and Ehrlichia platys. Microbiol Immunol, 44, 737-739. Inokuma H., Fujii K., Matsumoto K., Okuda M., Onishi T., Beaufils J.P., Raoult D. & Brouqui P. 2002. Determination of nucleotide sequences of groESL heat shock operon and citrate synthase gene (gltA) of Anaplasma (Ehrlichia) platys for phylogenetic and diagnostic studies. Clin Diagn Lab Immunol, 9, 1132-1136. Inokuma H., Ohno K., Onishi T., Raoult D. & Brouqui, P. 2001. Detection of ehrlichial infection by PCR in dogs from Yamaguchi and Okinawa Prefecture, Japan. J Vet Med Sci, 63, 815-817. Kontos V.I., Papadopoulos O. & French, T.W. 1991. Natural and experimental canine infections with a Greek strain of Ehrlichia platys. Vet Clin Pathol, 20, 101-105. Lai T.H., Orellana N.G., Yuasa Y. & Rikihisa Y. 2011. Cloning of the major outer membrane protein expression locus in Anaplasma platys and seroreactivity of a speciesspecific antigen. J Bacteriol, 193, 2924-2930. Martin A.R., Brown G.K., Dunstan R.H. & Roberts T.K. 2005. Anaplasma platys: an improved PCR for its detection in dogs. Ex Parasitol, 109, 176-180. Mazepa A.W., Kidd L.B., Young K.M. & Trepanier L.A. 2010. Clinical presentation of 26 Anaplasma phagocytophilum-seropositive dogs residing in an endemic area. J Am Anim Hosp Assoc, 46, 405-412. Otranto D., Testini G., Dantas-Torres F., Latrofa M.S., Diniz P.P., De Caprariis D., Lia R.P., Mencke N., Stenneck D.,

Antognoni et al.

Capelli G. & Breitschwerdt E.B. 2010. Diagnosis of canine vector-borne diseases in young dogs: a longitudinal study. J Clin Microbiol, 48, 3316-3324. Simpson R.M., Gaunt S.D., Hair J.A., Kocan K.M., Henk W.G. & Casey H.W. 1991. Evaluation of Riphicephalus sanguineus as a potential biologic vector of Ehrlichia platys. Am J Vet Res, 52, 1537-1541. Sparagano O.A., De Vos A.P., Paoletti B., CammĂ C., De Santis P., Otranto D. & Giangaspero A. 2003. Molecular detection of Anaplasma platys in dogs using polymerase chain reaction and reverse line blot hybridization. J Vet Diagn Invest, 15, 527-534. Suksawat J., Pitulle C., Arraga-Alvarado C., Madrigal K., Hancock S.I. & Breitscherdt E.B. 2001. Co-infection with three Ehrlichia species in dogs from Thailand and Venezuela with emphasis on consideration of 16S Ribosomal DNA secondary structure. J Clin Microbiol, 39, 90-93. Torina A., Alongi A., Naranjo V., Scimeca S., Nicosia S., Di Marco V., Caracappa S., Kocan K.M. & De La Fuente J. 2008. Characterization of Anaplasma infection in Sicily, Italy. Ann N Y Acad Sci, 1149, 90-93. Unver A., Rikihisa Y., Kawahara M. & Yamamoto S. 2003. Analysis of 16S rRNA gene sequences of Ehrlichia canis, Anaplasma platys, and Wolbachia species from canine blood in Japan. Ann N Y Acad Sci, 990, 692-698. Woody B.J. & Hopkins J.D. 1991. Ehrlichial diseases of dogs. Vet Clin North Am Small Anim Pract, 21, 75-98.

Veterinaria Italiana 2014, 50 (1), 49-56. doi: 10.12834/VetIt.82.258.2

Cisternal cerebrospinal fluid analysis in 24 sheep with chronic coenurosis Rosanna Zobba1*, Maria Lucia Manunta1, Maria Antonietta Evangelisti1, Alberto Alberti1, Stefano Visco1, Corrado Dimauro2 & Maria Luisa Pinna Parpaglia1 1

Dipartimento di Medicina Veterinaria, Università di Sassari, via Vienna 2, 07100 Sassari, Italy 2 Dipartimento di Agraria, Università di Sassari, via De Nicola 9, 07100, Sassari, Italy

* Corresponding author at: Dipartimento di Medicina Veterinaria, Università di Sassari, via Vienna 2, 07100 Sassari, Italy. Tel.: +39 079 229523, e-mail: zobba@uniss.it

Veterinaria Italiana 2014, 50 (1), 57-63. doi: 10.12834/VetIt.1306.02

Accepted: 25.11.2013 | Available on line: 31.03.2014

Keywords Cerebrospinal Fluid (CSF), Coenurus cerebralis, Pleocytosis, Sardinia, Sheep.

Summary Coenurosis, a neurological parasitic infection of ruminants caused by the larval stage of Taenia multiceps, is commonly reported in Sardinia, the most representative region for ovine population in Italy. Chronic form appears as a consequence of cyst development, frequently reported in the brain and spinal cord. Diagnostic suspect of coenurosis is based on physical and neurological examination. The aim of this article is to describe physical, biochemical and cytological aspects of cisternal cerebrospinal fluid of 24 sheep with chronic coenurosis and to evaluate whether these alterations are helpful in the diagnosis of coenurosis. Cerebrospinal fluid was altered in 20 animals (83.3%). Increase of total protein was revealed in 7 animals (29.2%); an increase of total nucleated cell count was observed in 18 samples (75%). Cytological examination revealed mononuclear pleocytosis in 17 animals (70.1%). Eosinophils were observed in 16 animals in various degree (66.7%). Our results show that cerebrospinal fluid confirms signs of Central Nervous System inflammation in 20 animals out of 24 (83.3%) and in particular it was useful to identify a parasitic inflammation in 66.7% of the animals in which eosinophils were observed. Considering the results of this study, the very absence of significant neutrophilic pleocytosis could be considered useful to diagnose chronic cerebral coenurosis.

Analisi del liquido cerebrospinale di 24 ovini affetti da cenurosi cronica Parole chiave Coenurus cerebralis, Liquido cefalorachidiano (LCR), Ovini, Pleocitosi, Sardegna.

Riassunto La cenurosi è un’infezione neurologica dei ruminanti causata da Taenia multiceps allo stadio larvale. Essa viene riportata comunemente in Sardegna, regione maggiormente rappresentativa della popolazione ovina italiana. La forma cronica si manifesta come conseguenza dello sviluppo della cisti, in particolare nel cervello e nel midollo spinale. Il sospetto diagnostico della malattia si basa sull’esame fisico e neurologico dell’animale. Questo articolo descrive le caratteristiche fisiche, biochimiche e citologiche del liquido cerebrospinale di 24 ovini affetti da cenurosi cronica e considera l’utilità di eventuali alterazioni per la diagnosi. Il liquido cerebrospinale è risultato alterato in 20 animali (83,3%). Sette dei soggetti campionati (29,2%) hanno presentato aumento delle proteine liquorali e 18 animali (75%) hanno manifestato pleocitosi. L’esame citologico ha rivelato pleocitosi mononucleare in 17 animali (70,1%). La presenza di eosinofili, in percentuali variabili, è stata osservata in 16 ovini (66,7%). Dai risultati dello studio si è potuto osservare che la valutazione del liquido cerebrospinale è stata utile per individuare un processo infiammatorio nel sistema nervoso centrale nell’83,3% degli animali. In particolare, ha permesso di sospettare un’infiammazione di tipo parassitario nel 66,7% dei casi per la presenza di granulociti eosinofili nei preparati citologici. Sulla base dei dati ottenuti, anche l’assenza di un quadro di pleocitosi neutrofilica può essere considerato utile per confermare la presenza di cenurosi cerebrale cronica.

Cerebrospinal fluid analysis of sheep with chronic coenurosis

Introduction Coenurus cerebralis is the larval stage of Taenia multiceps. The adult worm inhabits the small intestine of carnivores, dog being the most frequent definitive host. The cystic larva is reported in the central nervous system of sheep and goat mostly, but it can also be found in camel, deer, pig, horse, however rarely in cattle and human (Varcasia et al. 2013, Yoshino et al. 1988). Coenurosis occurs in 3 consecutive stages: acute, quiescent and chronic. The chronic form, commonly reported in growing sheep of 6-18 months, is caused by the development of 1 or more cysts into the brain (Scott 2012). The resulting increase of the intracranial pressure produces the typical symptoms of slowly progressive focal lesions of the brain. Symptoms vary depending on the cyst’s location, size, and compression of the brain (Gul et al. 2007, Sharma and Chauhan 2005). According to the literature, circling is frequently towards the side of the brain in which the cyst is located (Achenef 1999). Sheep can present depression and head-pressing behaviour when cyst involves the frontal lobe of the cerebrum, loss of unilateral menace response with cyst in the contralateral hemisphere, unilateral proprioceptive deficits in the case of contralateral cerebral cyst, whereas bilateral deficits in the case of cerebellar cyst; ipsilateral head tilt with cyst in the vestibular or cerebello-vestibular pathways. Dismetria, ataxia, bilateral postural deficits and lack of menace response are typical of cerebellar lesions (Sharma and Chauhan 2005). Other reported symptoms are teeth grinding, salivation, paresis, convulsions, cerebral atrophy, thinning and morphologic changes in the cranium (Yoshino et al. 1988). Infected sheep usually remain isolated from the flock and show a loss of reactivity to external stimuli (Achenef et al. 1999, Bussell and Kinder 1997). Clinical diagnosis of cerebral coenurosis is based on the physical and neurological examinations. It is normally supported by general information on age, breeding conditions, duration of signs and flock mortality (Komnenou et al. 2000). The aim of this study was to evaluate the modifications of cisternal cerebrospinal fluid (CSF) associated to coenurosis and to confirm the utility of CSF analysis in the diagnostic scenario. Observation of CSF in sheep affected by coenurosis has been seldom reported in the literature (Doherty et al. 1989, Oruc and Uslu 2006, Schweizer et al. 2006).

Materials and methods Between February 2010 and May 2011, 24 Sarda breed sheep with clinical signs indicative of chronic coenurosis were examined. These animals were

Zobba et al.

included in a study about magnetic resonance imaging (MRI) characteristic of the brain and skull of sheep with chronic coenurosis (Manunta et al. 2012). Age of animals (21 ewes and 4 rams) ranged from 1 to 3 years with 25 to 33 kg body weight. All the animals received clinical and neurological examination, brain MRI and CSF analysis were also performed. Definitive diagnosis of chronic coenurosis was made by macroscopic and morphological identification of Taenia multiceps cyst after surgical extraction (Leske 1780). For MRI, sheep were anesthetized and positioned in sternal recumbency. Sheep received Diazepam (0.5 mg/kg, IV) before induction of anaesthesia, which was induced with thiopenthal sodium (10 mg/ kg, IV). Lidocaine (2 mg/kg, IV) was administered and sheep were orotracheally intubated. Anaesthesia was maintained with sevofluraned in oxygen delivered via a circle system designed for use with small animals. The end-tidal concentration of sevoflurane was maintained at a concentration sufficient to ensure adequate depth of anaesthesia. Saline solution (0.9% NaCl) was administered IV (5 to 10 mL/kg/h) during anaesthesia. All sheep were mechanically ventilated, and end-tidal partial pressures of carbon dioxide were maintained between 30 and 37 mm Hg (i.e. moderate hyperventilation). Immediately before extubation, lidocaine (1 mg/kg, IV) was administered to sheep to prevent an increase of cranial pressure. Images were obtained by use of an MRI machine with a 0.23-T magnet (0.23-T MRI scanner, Paramed medical system, Genova, Italy) in the 3 planes from the atlas to the nasal cavity using a knee coil. Magnetic resonance imaging was also used to investigate the position, number, and size of cysts (expressed as cyst volume and cyst /skull volumes). After MRI, but before surgical removal of the cyst, CSF was collected by cerebellomedullary cisternal puncture. For the collection of CSF, the patient was positioned in lateral recumbency with the skull and cervical vertebrae at the edge of the table and the neck full flexed to create a 90° angle with the cervical spine. Briefly the area overlying the Cisterna Magna was surgically prepared and puncture was performed by inserting a spinal needle (21G) (a hypodermic needle could be sufficient) at the level of the atlanto-occipital space. All surgical procedures were conducted with the use of sterile technique. Between 1 and 2 ml of CSF sample was collected in 1.5 ml polypropylene microcentrifuge tubes by free flow and processed within 20 minutes. Macroscopic appearance (colour and turbidity), specific gravity, total protein concentration (TP), total nucleated cell count (TNCC) and cytological microscopic examination of CSF were recorded for all sheep. Total protein concentration was estimated with an automated photometer (ABX Pentra 400, Horiba

Veterinaria Italiana 2014, 50 (1), 57-63. doi: 10.12834/VetIt.1306.02

Zobba et al.

Cerebrospinal fluid analysis of sheep with chronic coenurosis

Medical, Montpellier, France) by the pyrogallol red method. Cell count was performed using a Fuchs‑Rosenthal chamber. A correlation between size of the cysts (volume and cyst volume‑skull volume ratio) and the degree of CSF alteration (PT and TNCC) was evaluated. To determine the probability that an observed correlation occurred by chance, a two-tailed t-test was conducted. The following mutually exclusive hypotheses were tested: H0: r=0 and H1: r≠0. A correlation was considered significantly different from 0 if p-value was <0.05. For cytological evaluation of CSF, 2 slides for each sample were prepared using a cytospin (Shandon Cytospin 4, Thermo Fisher Scientific, Waltham, Massachusetts, USA) and depending on the number of cells in the fluid, 200-300 µl of sample was centrifuged at 123 x g for 6 min with low acceleration at room temperature. Slides were air dried, stained with Romanowsky stain variant (Diff Quick, Dade Behring AG, Düdingen, Switzerland) and observed with an optical microscope at 10x, 40x and 100x magnification. Reference values from

published data for healthy sheep were used to classify the results (Scott 2004). The degree of the increase in total protein concentration was classified as mild (67-100 mg/dL), moderate (101‑200 mg/ dL), or marked (>200 mg/dL). Inflammation was further classified on the basis of the TNCC, as mild (10-50 cells/mL), moderate (51-100 cells/mL), or marked (>100 cells/mL). Inflammation was also categorised on the basis of the predominant leukocyte type, as neutrophilic (>70% neutrophils), lymphocytic (>70% lymphocytes), histiocytic (>70% macrophages), mixed mononuclear (>70% lymphocytes+macrophages), and mixed (<70% lymphocytes+macrophages) (Stokol et al. 2009).

Results At clinical examination, 4 ewes (Tables I and II; Id 1; 2; 20; 21) revealed chronic mastitis, disease of the feet, and suspect of lung parasites. Twenty-three out of 24 sheep had at least 1 of the following neurological signs: depression and disorientation

Table I. Size of cyst and some parameters of Cerebrospinal fluid in 24 Sarda sheep with chronic coenurosis sampled between February 2010 and May 2011. Id 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24

Cyst Location of cysts number 1 RT parietal-temporal occipital lobe 3 RT frontal-parietal; frontal-parietal-occipital lobe 1 RT frontal-parietal lobe 1 RT hemisphere 2 RT hemisphere 2 RT hemisphere 1 RT hemisphere 1 RT hemisphere 2 RT parietal-temporal-occipital lobe 1 RT frontal-parietal-occipital lobe 1 RT frontal-parietal lobe 1 RT frontal-parietal lobe 1 RT frontal-parietal lobe 1 RT parietal-temporal-occipital lobe 1 RT hemisphere 1 RT hemisphere 1 RT hemisphere 2 RT\CT left intraventricular; cerebellum 1 RT temporal-parietal lobe 1 RT frontal-parietal lobe 1 RT parietal-temporal-occipital lobe 1 CT brainstem 1 RT parietal-occipital lobe 1 RT frontal parietal lobe

C/S (%) 30.17 32.72 23.13 35.42 11.45 42.74 43.32 38.34 26.71 20.79 35.98 31.19 39.03 34.35 46.93 36.07 40.64 10.02 10.01 21.08 25.66 10.25 27.62 28.91

CV (cm3) 49.31 49.89 32.75 48.39 59.36 79.79 87.37 73.76 36.93 37.39 55.67 51.76 70.11 70.25 90.37 62.04 67.42 11.65 10.64 30.28 44.66 13.46 42.26 45.33

Clear Clear Clear Clear Clear Clear Clear Clear Clear Clear Clear Clear pink Clear Clear Clear Clear Clear Clear Clear pink Clear Clear Clear

1.006 1.006 1.005 1.005 1.006 1.006 1.006 1.005 1.005 1.006 1.005 1.005 1.007 1.005 1.005 1.006 1.006 1.006 1.006 1.006 1.005 1.005 1.006 1.006

TP (mg/dl) <30 <30 50 58 77 43 11 19 15 56 20 31 61 <30 <30 30 <30 <30 <30 <30 <30 23 54 <30

TNCC 29 13 21 6 33 28 11 6.6 13.4 573 13 26.6 166 63 17 87 47 3 0 6 31 1 78 11

Id = identification number of sheep; C/S = cyst/skull volumes; CV = cyst volume. In case of multiple cysts it indicate total volume; MA = macroscopic appearance; SG = specific gravity; TP = total protein concentration; TNCC = total nucleated cell count/miclroliter; RT = rostro-tentorial; CT = caudo-tentorial; Grey background = normal CSF

Veterinaria Italiana 2014, 50 (1), 57-63. doi: 10.12834/VetIt.1306.02

Zobba et al.

Cerebrospinal fluid analysis of sheep with chronic coenurosis

Table II. Cytological findings in Cerebrospinal fluid in sheep with chronic coenurosis sampled between February 2010 and May 2011. Id

lym

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24

80% 51.6% 30.8% 71% 71.1% 46.5 48.8% 47% 54% 68.1% 55.6% 54.6% 44.3% 43.5% 50% 41.3% 53.6% 76% 63.2% 68.7% 67% 40.2% 56.9%

Reac lym yes yes yes yes yes -

mon

yes yes yes yes yes yes yes yes -

20% 46.9% 67.8% 28% 26.9% 49.3% 50.4% 44% 44% 19.4% 44.4% 24.8% 43.7% 43.5% 20% 49.6% 36.8% 24% 36.3% 26.6% 33% 29.9% 23%

Foamy cyto plasm yes yes yes yes yes yes yes yes yes yes yes yes yes yes yes yes yes

yes yes yes yes yes

yes yes yes yes yes yes yes yes yes -

yes -

MIT

eos

neutr

EP cell

MLM

yes

<0.5% 1.5% 1.4% 1% 2% 3.5% 0.8% yes yes

yes

1% 12.5%

yes

9% 1% rare

17% 1.8% 10.8% 2% 4.3% 9.6%

3.6% 10.2% 2.2% 28% 4.3%

3.1%

0.5% 1.6%

29.9% 6.2%

13.9%

yes

0.7%

Id = identification number of sheep; Lym = lymphocytes; Reac lym = reactive lymphocites; Pl = plasma cells; Mon = monocytes; LP = Leukophagocytosis; EP = erythrophagocytosis; PH = unidentifiable intracellular debris; MIT = mitosis; EOS = eosinophils; NEUTR = Neutrophils; EP = epithelial cells; MLM = extracellular myelin-like material; Grey background = normal CSF

(21 animals), postural abnormalities (1 animals), alterations of postural reactions (16 animals), unilateral (8 animals) or bilateral (7 animals) menace deficit, gait abnormalities (6 animals), and head turn (1 animal). The MRI images showed 1 cyst in 19 sheep, 2 cysts in 4 sheep (Tables I and II; Id 5; 6; 9; 18) and 3 cysts in 1 sheep (Tables I and II; Id 2). Twenty-two sheep had cyst localised in rostro-tentorial (RT) position, 1 sheep had 1 cyst in caudo-tentorial (CT) position, and 1 sheep had 1 cyst in RT and 1 in CT position (Tables I and II; Id 18). The specific involvement of lobes in the brain is showed in Table I. It is noteworthy that in some cases the cyst involves the entire hemisphere, the sizes of cysts are reported in Table I. Perilesional oedema was detected in 5 ewes. Signs of haemorrhage, necrosis, atrophy and gliosis were not observed with MRI. Complete resolution of neurologic signs was observed in 22 sheep within 7 days after removal of cysts, while 2 sheep died for complications after surgery.

Figure 1. Lymphocytic pleocytosis (Diff Quick 40x).

CSF was altered in 20 animals (Tables I and II). Eighteen pathological CSFs were colourless and clear while 2 pathological CSFs showed mild pink coloration suggesting the presence of blood caused

Veterinaria Italiana 2014, 50 (1), 57-63. doi: 10.12834/VetIt.1306.02

Zobba et al.

Cerebrospinal fluid analysis of sheep with chronic coenurosis

Figure 2. Mixed mononuclear pleocytosis (70.1% lymphocytes+macrophages) with a high prevalence of eosinophils (29.9%) (Diff Quick 40x). by iatrogenic contamination during collection (absence of xantochromic appearance after centrifugation and absence of erythrophages/ siderophages in cytological sample). All CSF had normal specific gravity value (from 1.005 to 1.007). Mild increase of TP was revealed in 7 animals (35.33 ± 3.28 mg/dl) while an increase of TNCC was observed in 18 samples (53.5 ± 23.8 cells/µl). No correlation between size of the cysts (volume and cyst volume-skull volume ratio) and the degree of CSF alteration (PT and TNCC) was observed (p-value > 0.05). Mixed mononuclear pleocytosis was observed in 16 animals, lymphocytic pleocytosis was observed in 2 animals (Figure 1; Tables I and II; Id 1; 5), 1 animal showed albumin-cytologic dissociation with an increase of TP (58 mg/dl) without increase in cells (6 cells/µl) (Tables I and II; Id 4), and 1 animal showed TNCC within normal reference intervals (6.6 cells/ µl) but increased percentages of neutrophils (9%) (Table II; Id 8). Eosinophils were observed in 16 animals in various degrees (6.65 ± 1.97) (Figure 2; Table II). Pleocytosis was mild in 13 animals, moderate in 3 animals and marked in 2 animals. Reactive lymphocytes with basophilic cytoplasm and/or plasmocytoid cells with more abundant basophilic cytoplasm and perinuclear clear zone were observed in 10 pathological CSFs. Monocytoid cells showed signs of intense activation and transformation in macrophages (increased size of basophilic and foamy cytoplasm, phagocytised material such as cell debris and/or cytophagia, multinucleation). Mitotic figures were occasionally observed. Uncommon elements were sporadically observed: little groups of cells ascribed as “surface epithelium” were observed in 2 samples. Cells appeared with cuboidal to columnar morphology, a wide border of pink or blue-grey cytoplasm and eccentrically located, small, round nuclei with granular to coarse

Veterinaria Italiana 2014, 50 (1), 57-63. doi: 10.12834/VetIt.1306.02

Figure 3. Cluster of (probably epithelial) cells on-going to activation and transformation to macrophages (Diff Quick 100x).

Figure 4. Extracellular myelin-like material. It appears as variably sized aggregates of pink, foamy material, with internal circular structures that give it a honeycomb-like appearance. (Diff Quick 40x) chromatin (Figure 3). Two CSF showed extracellular myelin-like material. It appeared as variably sized aggregates of pink, foamy material, often with internal circular structures that give it a honeycomblike appearance (Figure 4).

Discussion Coenurosis is an important parasitosis of Sardinian sheep, which may cause serious economic damage in farms (Deiana 1971, Scala et al. 2007). Control of coenurosis can be achieved by regular anthelmintic treatment of farm dogs at 6-8 week intervals, by correct disposal of all sheep carcasses in order to avoid their dogs scavenging behaviour and by a strict control to prevent irregular slaughter. Education programs detailing these correct behaviours have

Zobba et al.

Cerebrospinal fluid analysis of sheep with chronic coenurosis

proved to be quite effective in other countries, e.g. in the United Kingdom, they allowed for stopping the sheep/dog cycle and helped reducing the incidence of coenurosis (Scott 2004). Cerebral coenurosis and the localization of the cysts can be strongly hypothesised after careful neurological examination paying special attention to general behaviour, postural tests and visual deficits (Scott 2004). However, clinical signs may be confused with other nervous conditions. It is useful to make differential diagnosis with neurological disease caused by other local space-occupying lesions in the CNS of young sheep, in particular abscesses and haemorrhage. In the absence of a focal compressive spinal cord lesion, there are no substantial differences between the composition of cisternal and lumbar CSF samples in sheep, therefore veterinarians practitioners may find useful for diagnostic purposes to collect lumbar CSF under local anaesthesia (Scott 2010). Sedation of the animal, adequate for collection of CSF both from cerebello medullary cistern or lumbosacral interspace can be made using Diazepam (0.4 mg/kg/ IV bodyweight) associated with fentanyl (1-2 mcg/ kg/IV). Cisternal cerebrospinal fluid analysis is an un-invasive, economic and rapid diagnostic tool that can help to confirm inflammation of central nervous system and associated with clinical examination can help to enforce suspect of parasitic infection by Coenurus cerebralis. There are some reports in the veterinary literature of a consistent association between an increased CSF eosinophil concentration and parasitic infection of the CNS in sheep (Doherty 1989, Lunn and Hinchcliff 1989, Schweizer 2006, Tschuor 2006). In this study, 16 sheep with coenurosis (67%) showed mononuclear pleocytosis of various degrees with presence of eosinophils, enforcing the suspect of a parasitic inflammation of CNS. The degree of eosinophilia was variable (6.65 ± 1.97). Four CSF samples were only indicative of mononuclear nonspecific inflammatory condition, whereas 4 CSF samples were in normal range. This results show that the absence of abnormality in CSF or the finding of mononuclear pleocytosis do not exclude the presence of coenurus cyst. The term ‘‘surface epithelium’’ is used in human medicine to describe cells in cluster or single elements, including choroid plexus, ependymal cells, endothelial cells and meningeal cells of mesenchymal origin that are found in CSF and are difficult to distinguish cytologically (Kluge et al. 2007). Their presence in human CSF has been recognized as either a consequence of lumbar puncture or indicators of pathologic conditions, such as trauma, inflammation or infection, that affect structures enclosing the CSF space (Kluge et al. 2007). When enter in the CSF, these cells may present signs of activation (indicated

by separation of individual cells from cell cluster, increased polychromasia and hypercromasia in the cytoplasm) and differentiation to macrophages (Kluge et al. 2007). The presence of myelin-like material in the CSF has not been described in coenurosis. This finding has been rarely reported in the relevant literature, with a few single reports in dogs, in horses with necrotizing encephalomyelitis, and in an experimental study in sheep infected by Visna (Bauer et al. 2006, Fallin et al. 1996, Mesher et al. 1996, Zabolotzky 2012). Initially, an underlying demyelinating or myelomalacic disease process was suspected as the cause of myelin-like material in canine CSF (Bauer et al. 2006, Fallin et al. 1996, Mesher et al. 1996). Nevertheless, the presence of myelin like material has been observed as an artifact of collection technique especially in lumbar samples, and in a variety of disease conditions such as idiopathic epilepsy, spondylomyelopathy, immune-mediated polyarthritis, syringomyelia (Zabolotzky 2012). Myelin in sheep with cysts of cenurosis could be associated to the necrosis of brain tissue around the cysts. Necrotic lesions around the cysts have been described by different authors (Achenef et al. 1999, Mouchira 2010, Nourani 2009). Luxol fast blue staining was not carried out on CSF samples to confirm our assessment of the pink material as myelin-like in nature. However, the observed material was similar to the one previously described as myelin-like material (Freeman and Raskin 2001, Zabolotzky 2012). The absence of correlation between Total Protein or Total Nucleated Cell Count in cerebrospinal fluid with the size of the cyst or the cyst volume-skull volume ratio showed that the degree of alteration in CSF in chronic coenurosis in not dependent on the extension of the cyst in the CNS.

Conclusions The frequency of CSF analysis in disease investigation may decrease as CT scans or MRI expands in veterinary medicine as it has in human medicine. Since these advanced diagnostic modalities are not easily deployed in farm animal practice, CSF analysis associated with physical examination remains a simple and economic diagnostic method that provides important assistance in establishing a diagnosis of CNS inflammation. Such a method could help to suspect parasitic infection, such as coenurosis, when certain alterations, like for example the presence of eosinophils, are shown. Even if it could be considered an “old” test, CSF diagnostic utility will potentially increase with new observations and additional assays, such as direct detection of some microorganisms with PCRs methods.

Veterinaria Italiana 2014, 50 (1), 57-63. doi: 10.12834/VetIt.1306.02

Zobba et al.

Cerebrospinal fluid analysis of sheep with chronic coenurosis

References Achenef M., Markos T., Feseha G., Hibret A. & Tembely S. 1999. Coenurus cerebralis infection in Ethiopia highland sheep: incidence and observations on pathogenesis and clinical signs. Vet Parasitol, 31, 15-24. Bauer N.B., Bassett H., O’Neill E.J. & Acke E. 2006. Cerebrospinal fluid from a 6-year-old dog with severe neck pain. Vet Clin Pathol, 35,123. Bussell K.M. & Kinder A.E. 1997. Posterior paralysis in a lamb caused by a Coenurus cerebralis cyst in the lumbar spinal cord. Vet Rec, 140, 560.

Mouchira M. Mohi El-Din. 2010. The Significance of Subarachnoid Cerebrospinal Fluids (CSF) in the Development of Metacestode of Coenurus Cerebralis in Sheep with Reference to its Pathological Effect. Global Veterinaria, 4, 343-348. Nourani H. & Pirali Kheirabadi K. 2009. Cerebral coenurosis in a goat: pathological findings and literature review. Comp Clin Pathol, 18, 85-87.

Deiana S. 1971. Human and sheep coenurosis in Sardinia. Parassitologia, 13, 173-175.

Oruc E. & Uslu U. 2006. Comparative cytopathological and histopathological studies of sheep with suspected Coenurus cerebralis infection. Turkiye Parazitol Derg, 30(4), 285-288.

Doherty M.L., Bassett H.F., Breathnach R., Monaghan M.L. & McLearn B.A. 1989. Outbreak of acute coenuriasis in adult sheep in Ireland. Vet Rec, 125, 185-186.

Scala A., Cancedda G.M., Varcasia A., Ligios C., Garippa G. & Genchi C. 2007. A survey of Taenia multiceps coenurosis in Sardinian sheep. Vet Parasitol, 143, 294-298.

Fallin C.W., Raskin R.E. & Harvey J.W. 1996. Cytological identification of neural tissue in the cerebrospinal fluid of two dogs. Vet Clin Pathol, 25, 127-129.

Schweizer G., Grünenfelder F., Sydler T., Rademacher N., Braun U. & Deplazes P. 2006. Importet coenurosis in sheep. Schweiz Arch Tierheilkd, 148, 490-499.

Freeman K.P. & Raskin R.E. 2001. Cytology of the Central Nervous System. In Atlas of Canine and Feline Cytology, 1st Ed. (R.E. Raskin & D.J. Meyer, eds). Saunders Company, Philadelphia, 325-365.

Scott P.R. 2004. Diagnostic techniques and clinicopathologic findings in ruminant neurologic disease. Vet Clin Food Anim, 20, 215-230.

Gul Y., Issi M. & Ozer S. 2007. Clinical and pathological observations of flock of sheep showing epileptoid spasm related to Oestrosis and Coenurosis. F Ü Sağlık Bil Derg, 21, 173-177. Kluge H., Linke E., Wieczorek V. & Zimmermann Kuehn H.J. 2007. Cell populations in the normal cerebrospinal fluid. In Atlas of CSF Cytology, 1st Ed. (H. Kluge, eds). Thieme, New York, 13-20.

Scott P.R. 2010. Cerebrospinal fluid collection and analysis in suspected sheep neurological disease. Small Rumin Res, 92, 96-103. Scott PR. 2012. Diagnosis and treatment of coenurosis in sheep. Vet Parasitol, 189, 75-78. Sharma D.K. & Chauhan P.P.S. 2005. Coenurosis status in Afro-Asian region: a review. Small Rum Res, 64, 197-202.

Komnenou A., Argyroudis S.T., Giadinis N. & Dessiris A. 2000. Surgical treatment of coenurosis (gid) in sheep. Vet Rec, 147, 242-244.

Stokol T., Divers T.J., Arrigan J.W. & McDonough S.P. 2009. Cerebrospinal fluid findings in cattle with central nervous system disorders: a retrospective study of 102 cases (1990-2008). Vet Clin Pathol, 38, 103-112.

Leske N.G. 1780. Von dem Drehen der Schafe und dem Blasenbandwurm im Gehirn derselben, als der Ursache dieser Krankheit. Liepzig, Germany, 28.

Tschuor A.C., Sydler T., Rauch S., Hertzberg H., Gendotti M. & Schweizer G. 2006. Ovine cerebrospinal nematodosis in Switzerland. Schweiz Arch Tierheilkd, 148, 609-619.

Lunn D.P. & Hinchcliff K.W. 1989. Cerebrospinal fluid eosinophilia and ataxia in five llamas. Vet Rec, 124, 302-305.

Varcasia A., Pipia A.P., Arru D., Pes A.M., Tamponi C., Dore F., Garippa G. & Scala A. 2013. Morphological and molecular characterization of bovine coenurosis in Sardinia, Italy. Parasitol Res, 112(5), 2079-2082.

Manunta M.L., Evangelisti M.A., Burrai G.P., Columbano N., Ligios C., Varcasia A., Scala A. & Sanna Passino E. 2012. Magnetic resonance imaging of the brain and skull of sheep with cerebral coenurosis. Am J Vet Res, 73, 1913-1918. Mesher C.I., Blue J.T. & Guffroy M.R.G. 1996. Intracellular myelin in cerebrospinal fluid from a dog with myelomalacia. Vet Clin Pathol, 25, 124-126.

Veterinaria Italiana 2014, 50 (1), 57-63. doi: 10.12834/VetIt.1306.02

Yoshino T. & Momotani E. 1988. A case of bovine coenurosis (Coenurus cerebralis) in Japan. Nihon Juigaku Zasshi, 50, 433-438. Zabolotzky S.M., Vernau K.M., Kass P.H. & Vernau W. 2012. Prevalence and significance of extracellular myelin-like material in canine cerebrospinal fluid. Vet Clin Pathol, 39, 90-95.

SHORT COMMUNICATION Ixodidae ticks in cattle and sheep in Sistan and Baluchestan Province (Iran) Mohammad Mirzaei & Javad Khedri* Pathobiology Department, School of Veterinary Medicine, Shahid Bahonar University of Kerman, Kerman, Iran * Corresponding author at: Pathobiology Department, School of Veterinary Medicine, Shahid Bahonar University of Kerman, Kerman, Iran, 76169-133, 7616914111. Tel.: +983413222047, e-mail: javadkhedri512@yahoo.com

Veterinaria Italiana 2014, 50 (1), 65-68. doi: 10.12834/VetIt.1018.00

Accepted: 19.12.2013 | Available on line: 31.03.2014

Keywords Cattle, Hyalomma spp., Iran, Ixodidae, Rhipicephalus sanguineus group, Sheep, Sistan and Baluchestan, Tick.

Summary This survey was conducted to investigate the presence and abundance of hard tick species (Acari: Ixodidae) on cattle and sheep in Sistan and Baluchestan Province (Iran). Between 2010 and 2011, a total of 1,403 ticks was collected from 332 infested cattle and 1,480 ticks were collected from 602 infested sheep during the seasons of tick activity. The species collected from cattle were Hyalomma marginatum (46.04%), Hyalomma excavatum (25.51%), Hyalomma anatolicum (10.33%), Hyalomma asiaticum (6.34%), and ticks of the Rhipicephalus sanguineus group (11.76%); while the species collected from sheep were of the Rhipicephalus sanguineus group (34.66%), H. marginatum (25.60%), H. excavatum (27.97%), H. asiaticum (9.45%) and Hyalomma scupense (2.29%). The results show that H. marginatum, H. excavatum, as well as ticks of the R. sanguineus group are dominant in the surveyed area.

Zecche del genere Ixodes nella popolazione bovina e ovina della regione del Sistan e Baluchistan (Iran) Parole chiave Bovini, Hyalomma spp., Iran, Ixodidae, Pecore, Rhipicephalus sanguineus, Sistan e Baluchistan, Zecca.

Riassunto Tra il 2010 e il 2011 è stata condotta un’indagine per accertare la presenza e l’entità di zecche nella popolazione bovina e ovina della regione del Sistan e Baluchistan (Iran). Durante la stagione di maturità del parassita, sono stati raccolti 1.403 esemplari di zecca da 332 bovini e 1.480 da 602 ovini. Nei bovini le specie identificate sono state: Hyalomma marginatum (46,04%), Hyalomma excavatum (25,51%), Hyalomma anatolicum (10,33%), Hyalomma asiaticum (6,34%), Rhipicephalus sanguineus (11,76%). Negli ovini sono state identificate le seguenti specie: Rhipicephalus sanguineus (34,66%), H. marginatum (25,60%), H. excavatum (27,97%), H. asiaticum (9,45%) e H. scupense (2,29%). I risultati dell’indagine hanno mostrato la dominanza nella regione delle specie: H. Marginatum, H. excavatum e Rhipicephalus sanguineus.

Khedri et al.

Ixodidae ticks in cattle and sheep in Iran

Studies on the biology and distribution of ticks in Iran started in 1810 when Dupre visited this country (Telmadarraiy et al. 2004). Since then, the Razi Institute, Pasteur Institute of Iran, Faculties of Veterinary and School of Public Health, have all continued to work on Iranian ticks. In 1935, Brumpt conducted a study on ticks of the genus Ornithodoros (Telmadarraiy et al. 2004). Subsequently, Delpy published a paper on the family of Ixodidae genus Hyalomma in 1936, while Baltazard described the characteristics of Ornithodorus ticks (Telmadarraiy et al. 2004). Ticks are among the major vectors of pathogens for animals and humans in the world. They can play a crucial role in the transmission of protozoa and bacteria, such as Babesia, Theileria and Anaplasma spp. (Soulsby 1986), or Borrelia spp., which cause the so called tick-borne relapsing fever (Telmadarraiy et al. 2004), an acute febrile disease which is an endemic in Iran human population. From 1997 to 2006, 1,415 cases of relapsing fever have been reported throughout the country (Arshi 2002, Masoumi et al. 2009). At the same time, other public health problems related to ticks are emerging in the country, as the Crimean-Congo haemorrhagic fever (CCHF), a viral haemorrhagic fever, for which cattle and ticks serve as reservoirs of the virus (Salim et al. 2010). In this scenario, it is pivotal to ascertain the presence and abundance of the tick species involved in transmission as well as their geographic distribution, insofar as information related to these aspects might facilitate the control of ticks and tick-borne diseases. The aim of this study was to determine the frequency of tick infestation in cattle and sheep of Sistan and Baluchestan Province (Iran). The Sistan and Baluchestan province (25°3’ to 28°31’ N and 58°48’ to 63°19’ E, subtropical climate) is located in the South-East, it is the largest province in Iran, with an area of 181,785 km2 and a population of 2,4 million. It is surrounded by Khorassan, Kerman and Hormozgan provinces. Pakistan and Afghanistan confine with the Eastern boundaries, while its Southern border is on the Oman Sea (Figure 1). The province comprises 3 regions of differing geography: the coastal region in the South, a mountainous region in the West and the desert region in the East and North. Several localities in each region were randomly selected for the survey, the selection was based on the features of the different areas and intended to avoid statistical bias. The tick samples were collected from infested cattle and sheep using tweezers and rubber gloves, during the spring and summer of 2010 and 2011. The tick specimens were collected from animals, which grazed in open rangeland pastures. After collection, the tick samples were stored in vials with

70% ethyl alcohol. All specimens were labelled to note location, host, date and species determination. The ticks were brought to the laboratory and adults identified under a stereomicroscope according to general identification keys (Estrada-Peña et al. 2004, Walker et al. 2003). A total of 1,403 ticks was collected from 332 infested cattle; whereas 1,480 ticks were collected from 602 sheep in the Sistan and Baluchestan Province of Iran (Table I). Six species of Ixodid ticks were recognized (Tables II and III). The most abundant species in cattle were Hyalomma marginatum, followed by Hyalomma excavatum and ticks of the Rhipicephalus sanguineus group; while R. sanguineus showed to be the most common species in sheep, followed by H. marginatum, H. excavatum and Hyalomma asiaticum. As noted in Tables II and III, the abundance of other species was low. It was found that the maximum numbers of ticks were collected from the perineal and chest regions of both cattle and sheep (Table I). Ticks (Ixodidae) have a crucial role as a vector of pathogens of domestic animals in Iran, where the major losses caused by ticks are related to transmission of babesiosis, theileriosis, and anaplasmosis in ruminants (Rahbari et al. 2007). The collection of comprehensive information on the regional distribution and abundance of species ticks is essential. The occurrences of suitable hosts together with favourable climate conditions foster the presence of ticks and tick-borne disease in nature. Furthermore, the land exploitation occurred over the last decades has dramatically reduced the diversity of Iranian environment and significantly modified the distribution and the abundance of the tick species, which strongly adapted to domestic animals in each area. If this

Khorasan Zabol

AFGHANISTAN

Zahedan

Kerman

IRAN Sistan and Baluchestan

PAKISTAN

Hormozgan

Gulf of Oman

Figure 1. Location of Sistan and Baluchestan Province (Iran).

Veterinaria Italiana 2014, 50 (1), 65-68. doi: 10.12834/VetIt.1018.00

Khedri et al.

Ixodidae ticks in cattle and sheep in Iran

Table I. Distribution of ticks in different parts of the body of sampled animals in the Sistan and Baluchestan Province of Iran, in 2010 and 2011. Animals

External ear (%)

Perineal and chest region (%)

Hind leg and around the eyes (%)

Udder (%)

No. of ticks

Cattle

266 (18.95)

932 (66.42)

107 (7.62)

98 (6.98)

1,403

Sheep

305 (20.60)

965 (65.20)

78 (5.27)

132 (8.91)

1,480

Table II. Frequency of tick species on cattle in the Sistan and Baluchestan Province of Iran, in 2010 and 2011.

Table III. Frequency of tick species on sheep in the Sistan and Baluchestan Province of Iran, in 2010 and 2011.

Tick species

No. of males

No. of females

Total (%)

Tick species

No. of males

No. of females

Total (%)

Hyalomma marginatum

286

360

646 (46.04)

231

282

513 (34.66)

Hyalomma excavatum

148

210

358 (25.52)

Rhipicephalus sanguineus group

Hyalomma anatolicum

145 (10.33)

Hyalomma marginatum

172

207

379 (25.61)

Hyalomma asiaticum

89 (6.34)

Hyalomma excavatum

197

217

414 (27.97)

Rhipicephalus sanguineus group

Hyalomma asiaticum

140 (9.46)

165 (11.76)

Hyalomma scupense

34 (2.30)

Total

635

768

1,403 (100)

Total

700

780

1,480 (100)

trend continues, it is feasible that new tick species will gradually replace the one usually found in this area, making necessary to continue monitoring tick populations (Nabian et al. 2007). In the present study, 2 genera and at least 6 species of Ixodidae ticks were found to infest cattle and sheep in the Sistan and Baluchestan area. These results are similar to those of other studies conducted in the South-East of Iran (Dehaghi et al. 2011, Mazlum 1971, Rahbari 2007, Salim 2010). Particularly, H. marginatum was the dominant tick in cattle, while R. sanguineus group ticks were dominant among sheep. With regards to ticks infesting cattle, Hyalomma spp. has been found to be dominating, this result is consistent with those of other studies conducted in Iran and in Turkey (Aktas et al. 2004, Dehaghi et al. 2011, Razmi et al. 2003, Salim et al. 2010). Hyalomma were most abundant in each zone and especially in the desert boundary area (Rahbari et al. 2007). Specimens of H. marginatum were also found in the hilly regions of Sistan and Baluchestan area with the highest percentage in the tick population; a similar pattern has been previously observed by Mazlum (Mazlum 1971). This species has also been reported in different parts of Iran, such as the Caspian Sea region, Khoozestan, and Markazi Provinces (Rahbari et al. 2007). Hyalomma anatolicum was present over widely scattered areas throughout Iran. It is a vector of the causative organism of tropical theileriosis and can transmit a variety of pathogenic organisms such as Theileria lestoquardi, Theileria equi, Babesia

Veterinaria Italiana 2014, 50 (1), 65-68. doi: 10.12834/VetIt.1018.00

caballi, Trypanosoma theileri and Crimean-Congo haemorrhagic fever virus (Nabian and Rahbari 2008). Hyalomma excavatum was more commonly found on livestock than H. anatolicum, in this respect it is worth mentioning that the distribution of this species from the Mediterranean steppe climatic regions of North Africa to steppe climatic regions elsewhere, including Iran and Turkmenistan, has also been reported in another study (Walker et al. 2003). Hyalomma asiaticum was found in this area as well. The presence of this thick has been recorded in the South-East part of Iran, near the Pakistan borders (Abbasian 1961). It has been described all over Iran, especially in the Southern and South-Western provinces (Rahbari et al. 2007). Adults attack camels, other domestic herbivores, such as wild goats, sheep and gazelles in semidesert and desert environments (Hoogstraal and Valdez 1980). We found H. scupense (syn.: detritum) only in sheep, but other researchers assumed that adults of this tick infest cattle, horses, sheep, goats, and camels (Walker et al. 2003). The presence of this species has been described in a wide area ranging from Southern Europe to the Caspian, with outlying pockets in the mountains of Golestan National Park in the Northern part of Iran (Izadi et al. 2004), and in Khorassan, in West and East Azerbaijan, Khoozestan Boushehr, Mazenderan, Gilan and in Fars provinces (Rahbariet al. 2007). In this study, R. sanguineus group ticks were dominant among sheep. The different species of this group, not easily distinguishable, adapted to different climatic conditions in different ecological zones with various hosts (Rahbariet al. 2007). These ticks have been previously reported (as R. sanguineus s.str.) from all

Ixodidae ticks in cattle and sheep in Iran

over Iran, especially in the Caspian Sea region, in the North-Western area of the country and in Boushehr (Rahbari et al. 2007). Regarding ticks infesting cattle and sheep, Hyalomma was found to be the most frequent genus in this study, as it has also been reported before in Iran (Nabian and Rahbari 2008, Rahbari et al. 2007). Since Theileria annulata and Theileria lestoquardi are both transmitted by ticks of the genus Hyalomma (Brown et al. 2006, Kirvar et

Khedri et al.

al. 1998), it is reasonable to expect the presence of these diseases in the examined region. Crimean Congo Haemorragic fever has instead been reported in Sistan and Baluchestan province (Izadi et al. 2004). This survey showed that genus Hyalomma, which also includes the principal vectors of CCHF in the world, was dominant in this province. Measures to reduce its population should be considered in order to prevent CCHF epidemics.

References Abbasian L. 1961. Records of tick (Acarina: Ixodidae) occurring in Iran and their distributional data. Acarologia, 3, 546-559. Aktas M., Dumanli N. & Angin M. 2004. Cattle infestation by Hyalomma ticks and prevalence of Theileria in Hyalomma species in the east of Turkey. Vet Parasitol, 119, 1-8. Arshi S.H., Majidpour A., Sadeghihomayoun E.D., Asmar M. & Derakhshan M.H. 2002. Relapsing fever in Ardabil, a northwestern province of Iran. Arch Iranian Med, 5, 141-145. Brown C.G.D., Ilhan T., Kirvar E., Thomas M., Wilkie G., Leemans I. & Hooshmandand Rad P. 2006. Theileria lestoquardi and T. annulata in cattle, sheep, and goats: in vitro and in vivo studies. Ann N Y Acad Sci, 849, 44-51.

Mazlum Z. 1971. Ticks of domestic animals in Iran: Geographical distribution, host relation and seasonal activity. J Vet Fac Univ Tehran Iran, 27, 1-32. Nabian S. & Rahbari S. 2008. Occurrence of soft and hard ticks on ruminants in Zagros mountainous areas of Iran. Iranian J Arthropod Borne Dis, 2, 16-20. Nabian S., Rahbari S., Shayan P. & Haddadzadeh H.R. 2007. Current status of tick fauna in north of Iran. Iranian J Parasitol, 2, 12-17. Rahbari S., Nabian S. & Shayan P. 2007. Primary report on distribution of tick fauna in Iran. Parasitol Res, 101, 175-177.

Dehaghi M.M., Fathi S., Asl E.N. & Nezhad H.A. 2011. Prevalence of ixodid ticks on cattle and sheep southeast of Iran. Trop Animal Health Prod, 43, 459-461.

Rahbari S., Nabian S., Shayan P. & Haddadzadeh H.R. 2007. Status of Haemaphysalis tick infestation in domestic ruminants in Iran. The Korean journal of parasitology, 45, 129-132.

Estrada-Pe単a A., Bouattour A., Camicas J.L. & Walker A.R. 2004. Ticks of domestic animals in the Mediterranean Region. A guide to identification of species. University of Zaragoza, Spain, 131 pp.

Razmi G.R., Ebrahimzadeh E. & Aslani M.R. 2003. A study about tick vectors of bovine theileriosis in an endemic region of Iran. J Vet Med Ser B, 50, 309-310.

Hoogstraal H. & Valdez R. 1980. Ticks (Ixodoidea) from wild sheep and goats in Iran and medical and veterinary implications. Fieldiana Zool, 6, 1-16. Izadi S., Naieni K.H., Madjdzadeh S.R. & Nadim A. 2004. Crimean-Congo hemorrhagic fever in Sistan and Baluchestan Province of Iran, a case-control study on epidemiological characteristics. Int J Infect Dis, 8, 299-306. Kirvar E., Ilhan T., Katzer F., Wilkie G., Hooshmand Rad P. & Brown D. 1998. Detection of Theileria lestoquardi (hirci) in ticks, sheep, and goats using the polymerase chain reaction. Ann N Y Acad Sci, 849, 52-62. Masoumi Asl H., Goya M., Vatandoost H., Zahraei S., Mafi M., Asmar M., Piazak N. & Aghighi Z. 2009. The

epidemiology of tick-borne relapsing fever in Iran during 1997-2006. Travel Med Infect Dis, 7, 160-164.

Salim Abadi Y., Telmadarraiy Z., Vatandoost H., Chinikar S., Oshaghi M.A., Moradi M., Ardakan E.M., Hekmat S. & Nasiri A. 2010. Hard ticks on domestic ruminants and their seasonal population dynamics in Yazd Province, Iran. Iranian J Arthropod-Borne Dis, 4, 66-71. Soulsby E.J.L. 1986. Helminths, arthropods and protozoa of domesticated animals, 7th Ed. Bailliere Tindall, London. Telmadarraiy Z., Bahrami A. & Vatandoost H. 2004. A survey on fauna of ticks in west Azerbaijan province, Iran. Iranian J Public Health, 33, 65-69. Walker A.R., Bouattour A., Camicas J.L., Estrada-Pe単a A., Horak I.G., Latif A.A., Pegram R.G. & Preston P.M. 2003. Ticks of domestic animals in Africa: a guide to identification of species. Bioscience Reports, Edinburgh, 221 pp.

Veterinaria Italiana 2014, 50 (1), 65-68. doi: 10.12834/VetIt.1018.00

SHORT COMMUNICATION Genotyping and phylogenetic analysis of bovine viral diarrhea virus (BVDV) isolates in Kosovo Izedin Goga1*, Kristaq Berxholi2, Beqe Hulaj1, Driton Sylejmani4, Boris Yakobson3 & Yehuda Stram3 Kosovo Food and Veterinary Laboratory, Kosovo Food and Veterinary Agency, Zona industriale, 10 000 Pristina, Kosovo. 2 Faculty of Veterinary Medicine, Agricultural University, Tirana, Albania. 3 Kimron Veterinary Institute, Beit Dagan 50250, Israel. 4 Agricultural and Veterinary Faculty, University of Pristina, Bulevardi Bill Clinton P.N. 10000 Pristina, Kosovo. 1

* Corresponding author at: Kosovo Food and Veterinary Laboratory, Kosovo Food and Veterinary Agency, Zona industriale, 10 000 Pristina, Kosovo. Tel.: +377 44 238214, e-mail: izeding@yahoo.com

Veterinaria Italiana 2014, 50 (1), 69-72. doi: 10.12834/VetIt.1304.11

Accepted: 20.12.2013 | Available on line: 31.03.2014

Keywords Bovine viral diarrhea virus, BVDV, Genotyping, Isolate, Kosovo, Phylogenetic analysis.

Summary Three serum samples positive in Antigen ELISA BVDV have been tested to characterise genetic diversity of bovine viral diarrhea virus (BVDV) in Kosovo. Samples were obtained in 2011 from heifers and were amplified by reverse transcription-polymerase chain reaction, sequenced and analysed by computer-assisted phylogenetic analysis. Amplified products and nucleotide sequence showed that all 3 isolates belonged to BVDV 1 genotype and 1b sub genotype. These results enrich the extant knowledge of BVDV and represent the first documented data about Kosovo BVDV isolates.

Genotipizzazione e analisi filogenetica di alcuni ceppi del virus della diarrea virale bovina (BVDV) in Kosovo Parole chiave Analisi filogenetica, Genotipizzazione, Isolato, Kosovo, Virus della diarrea virale bovina (BVDV).

Riassunto Per caratterizzare la diversità genetica del virus della diarrea virale bovina (BVDV) in Kosovo, sono stati testati tre campioni di siero positivi all’ELISA Antigene BVDV. I campioni, ottenuti da giovenche nel corso del 2011, sono stati amplificati con PCR-reverse ranscription, sequenziati e analizzati mediante analisi filogenetica assistita da computer. I prodotti amplificati e la sequenza nucleotidica hanno dimostrato l’appartenenza dei ceppi al BVDV genotipo1 e sotto-genotipo1b. I risultati ottenuti sono i primi dati documentati su ceppi di BVDV in Kosovo.

Goga et al.

BVDV isolates in Kosovo

The bovine viral diarrhoea virus (BVDV) is a significant pathogen of cattle. It is a small enveloped RNA virus which, like classical swine fever virus (CSFV) and border disease virus (BDV), belongs to genus Pestivirus in the Flaviviridae family (Heinz et al. 2000). The length of RNA genome is approximately 12.3 kbp. The viral genome comprises a single open reading frame (ORF) encoding about 4,000 amino acids (Collet et al. 1998, Demoerlooze et al. 1993). The bovine viral diarrhoea virus is classified by biotype and genotype (Baker 1995, Fulton et al. 2000, Pellerin et al. 1994, Ridpath et al. 1994). Based on the presence or absence of visible cytopathic effects in infected cell cultures, BVDV genotypes are classified in cytopathic (CP) and noncytopathic (NCP) biotypes. Genotypes 1 and 2 of BDVD are detected by polymerase chain reaction (PCR) for nucleotide and antigenic differences (Fulton et al. 2000, Hamers et al. 2001, Pellerin et al. 1994, Ridpath and Bolin 1998, Stram et al. 2004). Type 1 BVDV (BVDV-1) strains include the classic BVDV isolates, while type 2 (BVDV-2) comprises the BVDV strains associated with high mortality (Brownlie et al. 1984). Genotype 1 has been reported worldwide, whereas BVDV-2 has been observed mainly in North America (Pellerin et al. 1994, Ridpath et al. 1994). Genetic diversity of BVDV isolates as well as to other viruses (Stram et al. 2004, Stram et al. 2011) is important for laboratory diagnosis, vaccine design and taxonomy. The bovine viral diarrhoea virus causes a variety of clinical syndromes in cattle, including diarrhea, reproductive failure, respiratory disease, mucosal disease, and hemorrhagic syndrome resulting from thrombocytopenia (Baker 1995, Perdrizet et al. 1987). An important condition for the maintenance of BVDV in bovine populations is the immunotolerant and persistent infection that results from a transplacental infection of

the foetus before the onset of immunological maturity (McClurkin et al. 1984). Intrauterine BVDV infections are a serious problem, which causes high rates of abortion, still births, foetal resorption, mummification, congenital malformations, weak calf births, and growth retardation (Houe 1999, Moennig and Liess 1995). The aim of this study was to examine the genetic diversity of recently obtained BVDV isolates in Kosovo. Three serum samples have been collected from heifers, which responded positively to BVDV Ag ELISA in Kosovo during 2011. One of the positive samples belonged to a backyard heifer aged 10-months without clinical signs from Ferizaj municipality. The second positive sample belonged to 6-month old heifer with signs of yellowish diarrhea, dehydration, erosion in the region of the nose and lips. This sample was taken in Dubrava correctional center, in Istog. The third positive sample belonged to 6-month old heifer without clinical signs from dairy farm in Istog. RNA was isolated using Viral Gene-Spin kit (iNtRON, Seoul, South Korea) following manufacturer's instructions. RT-PCR was performed using Maxim RT-PCR one tube reaction mix (iNtRON, Seoul, South Korea) according to manufacturer's instructions and using primers BVDV#86, CCCTCTTCAGCGAAGGCCGAA at position 86 and BVDV#371, TCAACTCCATGTGCCATGTACAGCA at position 371 in acc. # M31182. The product of PCR was purified using QIAquick purification kit (Qiagen, Hidden, Germany) according to the manufacturer's instructions, in addition the eluted DNA was ethanol precipitated and dissolved in 15µl DNase free water and used for sequencing. Sequence analysis was done using Vector NTI (Invitrogen, Carlsbad, CA, USA) and EMBOSS suits (http://bioinfo.agri.huji.ac.il/wemboss/). For the

Table I. Sequences of 3 Bovine viral diarrhea virus (BVDV) isolates obtained from heifers in Kosovo in 2011. Isolate

BVDV-1135 isolate

BVDV-1717-1 isolate

BVDV-1717-2 isolate

5’ untraslated region (UTR) sequence TGAGGCTAGCCATGCCCTTAGTAGGACTAGCATAATAAGGGGGGTAGCAACAGTGGTGAGTTCGT TGGATGGNTTAAGCCCTGAGTACAGGGTAGTCGTCAGTGGTTCGACGCCTTAACATNAGGNCTCG AGATGCCACGTGGACGAGGGCATGCCCACAGCACATCTTAACCTGANCGGGGGTCGCTCGGG GCGAAAACGGTTTANNCAACCGCTACGAATACAGCCTGATAGGGTGCTGCAGAGGCCCACTGT ATTGCTACTAAAAATCTCTGCTGTACATGGCACATGGAGTTGA GGTCCCTCTCAGCGAAGGCCGAAAAGAGGCTAACCATGCCCTTAGTAGGACTAGCAAAACAA GGGGGGTAGCAACAGTGGTGAGTTCGTTGGATGGCTGAAGCCCTGAGTACAGGGTAGTCGTCA GTGGTTCGACGCTTCGTGTGACAAGCCTCGAGATGCCACGTGGACGAGGGCATGCCCACAGC ACATCTTAACCTGAGCGGGGGTCGTCCAGGTGAAACGGTTTAACCAACCGCCACGAATACAGC CTGATAGGGCGCTGCAGAGGCCCACTGTATTGCTACTAAAAATCTCTGCTGTACATGGCACATGG AGTTGA CTCAGCGAAGGCCGAAAAGAGGCTAGCCATGCCCTTAGTAGGACTAGCATATTGGGGAGGGTA GCAGCAGTGGTGAGTTAGTTGGATGGCTGAAGCCCTGAGTACAGGGTAGTCGTCAGTGGTTCGA CGTCTTAAATGTAGGCCTCGAGATGCCACGTGGACGAGGGCATGCCCACAGCACATCTTAACTT GAGCAGGGGTCGCTCAGGTGAAAGCGGGTAAACCGTTACTGACACAGCCTGATAGGGTGCTG CAGAGGCCCACTGAACTGCTACTAAAAATCTCTGCTGTACATGGCACATGGAGTTGA

Veterinaria Italiana 2014, 50 (1), 69-72. doi: 10.12834/VetIt.1304.11

Goga et al.

BVDV isolates in Kosovo

CCL34 CCL81 3127 31 IT99-4250 18 34 Bnaya-03 66 b72729-53 5284/00 4 94 Kfar-Baruch-06 6119 7 24/15 10 bv2818-35 12 bvdv-1717-1-2011 28 1/A/00 49 UEL1/BR/04 30 Neve-Ur-00 CH615 47

phylogenetic analyses ClustalW1 was performed and the *.aln output file was utilized in MEGA 6.0 program to perform the analysis (Tamura et al. 2007).

65 51

20 73

All sera identified previosly as positive by the BVDV‑antigen ELISA were confirmed by the RT-PCR. Sequence analyses are shown in Table I, whereas phylogenetic relations of Kosovo isolates are reported in Figure 1.

Results showed that BVDV-1 infection was dominant in Kosovo and all 3 BVDV-1 isolated strains clustered within the same sub genotype BVDV 1b.

BVDV1135 BVDV-1717-2-2011 Lita-07

6291 52 86 1a 99 Bet-Eliezry-01 Erez-98 76 3596/86 1d 16484/93 77 Te-Yosef-02 91 Aloney-Habashan-1-10 98 Aloney-Habashan-2-10 62 c413 strain-78 KZ91CP 76 97 AU501 98 Matan-00 B2256 104/98 52 2124a bvd1817 1745\1 95 bvd-1745 1811\1 1692\1 2124b 0 HI748 1 9 2124 99 BDV-strain-X818-AF037405.1 93 BDV-Strain-BD31 reindeer-V60-Krefeld CSFVstrain/CH//TWN 100 CSFVstrainZj 95 CSFVstrainSXCDK 89 28 CSFV-isolate-Paderborn-MarkedV csv1 30 88 csv2

CSFV

The BVDV 1 genotype has been categorised into 2 to 11 subgenotypes (Vilcek et al. 2001). Infections with BVDV occur globally and are the cause economic losses in cattle. BVDV 1 is predominant in cattle and widely spread throughout the world. In Croatia, all 18 tested positive BVDV isolates belonged to genotype 1 (Bedekovic et al. 2012). A study previously conducted to evaluate the genotypic distribution for 105 BVDV-positive samples at the Oklahoma diagnostic laboratory indicated that 61% of the samples was type 1 genotipe and 39% was type 2 genotipe (Fulton et al. 2000). This study, which was the first one performed for Kosovo BVDV isolates, confirmed that sub genotype BVDV 1b was dominant in Kosovo. The genetic data presented in this paper improve the general knowledge about the BVDV-1b isolates circulating in Kosovo. All this was useful for the developed molecular diagnostics assays for BVDV infection in order to control and prevent this disease.

0.02 1

h ttp://www.ebi.ac.uk/Tools/clustalw2/index.html.

Figure 1. Genotyping of BVDV 1135, 1717-1-2011 and 1717-2-2011 isolates from heifers in Kosovo in 2011. Phylogenetic tree of Israli and Croatia isolates based on the 5’ UTR of each isolate. The right simbols represent BVDB genotypes. BD = Border Disease Virus; CSFV = Classical Swine Fever Virus.

Veterinaria Italiana 2014, 50 (1), 69-72. doi: 10.12834/VetIt.1304.11

BVDV isolates in Kosovo

Goga et al.

References Baker J.C. 1995. The clinical manifestations of BVD infection. Vet Clin N Am Food Anim Pract, 11, 425-445. Bedekovic T., Lojkic I., Lemo N., Cac Z., Cvetnic Z., Lojkic M. & Madic J. 2012. Genetic typing of Croatian bovine viral diarrhea virus isolates. Vet Arhiv, 82, 449-462. Brownlie J., Clarke M.C. & Howard C.J. 1984. Experimental production of fatal mucosal disease in cattle. Vet Rec, 114, 535-537. Collet M.S., Larson R., Belzer S. & Retzel E. 1988. Proteins encoded by bovine viral diarrhoea virus: the genome organization of a pestivirus. Virology, 165, 200-208. Demoerlooze L., Lecomte C., Brownshimmer S., Schmetz D., Guiot C., Vandenbergh D., Allaer D., Rossius M., Chappuis G., Dina D., Renard A. & Martial J.A. 1993. Nucleotide-sequence of the bovine viral diarrhea virus Osloss strain – Comparison with related viruses and identification of specific DNA probes in the 5’ untranslated region. J Genl Virol, 74, 1433-1438. Fulton R.W., Saliki J.T., Confer A.W., Burge L.J., D’Offay J.M., Helmen R.G., Bolin S.R., Ridpath J.F. & Payton M.E. 2000. Bovine viral diarrhea virus cytopathic and noncytopathic biotypes and type 1 and 2 genotypes in diagnostic laboratory accessions: clinical and necropsy samples from cattle. J Vet Diagn Invest, 12, 33-38. Hamers C., Dehan P., Couvreur B., Letellier C., Kerkhofs P. & Pastoret P.P. 2001. Diversity among bovine pestiviruses. Vet J, 161, 112-122. Heinz F.X., Collett M.S., Purcell R.H., Gould E.A., Howard C.R., Houghton M., Moormann R.J.M., Rice C.M. & Thiel H.J. 2000. In Virus Taxonomy. (Van Regenmortel M.H.V., Fauquet C.M., Bishop D.H.L., Carsrens E., Estes M.K., Lemon S., Maniloff J., Mayo M.A., Mcgeogh D., Pringle C.R. & Wickner R.B., eds). New York, Academic press, Genus pestivirus, 867-872. Houe H. 1999. Epidemiological features and economical importance of bovine viral diarrhea virus (BVDV) infections. Vet Microbiol, 64, 89-107.

McClurkin A.W., Littledike E.T., Cutlip R.C., Frank G.H., Coria M.F. & Bolin S.R. 1984. Production of cattle immunotolerant to BVD virus. Can J Comp Med, 48, 156-161. Moennig V. & Liess B. 1995. Pathogenesis of intrauterine infections with bovine viral diarrhea virus. Vet Clin N Am Food Anim Pract, 11, 477-487. Pellerin C., Van Den Hurk J., Lecomte J. & Tijssen P. 1994. Identification of a new group of bovine viral diarrhea virus strains associated with severe outbreaks and high mortalities. Virology, 203, 260-269. Perdrizet J.A., Rebhun W.C., Dubovi E.J. & Donis R.O. 1987. Bovine virus diarrhea – clinical syndromes in dairy herds. Cornell Vet, 77, 46-74. Ridpath J.F. & Bolin S.R. 1998. Differentiation of types 1a, 1b and 2 bovine viral diarrhea virus (BVDV) by PCR. Mol Cell Probes, 12, 101-106. Ridpath J.F., Bolin S.R. & Dubovi E.J. 1994. Segregation of bovine viral diarrhea virus into genotypes. Virology, 205, 66-74. Stram Y., Brenner J., Braverman Y., Banet-Noach C., Kuznetzova L. & Ginni M. 2004. Akabane virus in Israel: a new wirus lineage. Virus Res, 104, 93-97. Stram Y., Engel O., Rubinstein M., Kuznetzova L., Balaish M., Yadin H., Istumin S. & Gelman B. 2011. Multiple invasions of O1 FMDV serotype into Israel revealed by genetic analysis of VP1 genes of Israeli’s isolates from 1989 to 2007. Vet Microbiol, 147, 398-402. Tamura K., Dudley J., Nei M. & Kumar S. 2007. MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol Bio Evol, 24,1596-1599. Vilcek S., Paton D.J., Durkovic B., Strojny L., Ibata G., Moussa A., Loitsch A., Rossmanith W., Veja S., Scicluna M.T. & Paif V. 2001. Bovine viral diarrhea virus genotype 1 can be separated into at least eleven genetic groups. Arch Virol, 146, 99-115.

Veterinaria Italiana 2014, 50 (1), 69-72. doi: 10.12834/VetIt.1304.11

a cura di Manuel Graziani

LIBRI/Book reviews

Francesco Staffieri

Anestesia e analgesia locoregionale del cane e del gatto (Poletto, pp. 112, € 27,00) www.polettoeditore.it

Il volume di anestesia e analgesia locoregionale del cane e del gatto è pensato per essere un testo “da sala operatoria” – come afferma l’autore – perché consente un rapido, ma allo stesso tempo dettagliato, consulto per il libero professionista che si trova a gestire un’anestesia. Si tratta di un piccolo libro, tascabile, che può essere considerato un punto di partenza per gli studenti e per tutti quei medici veterinari che intendono avvicinarsi in maniera specialistica all’arte dell’anestesiologia veterinaria. L’anestesia locoregionale costituisce, infatti, uno strumento insostituibile per la gestione del dolore perioperatorio in medicina veterinaria. Nel volume si forniscono le nozioni di base per praticare i principali blocchi nervosi centrali e periferici. Per ogni blocco sono riportate le tecniche alla cieca (mediante l’ausilio dei punti di repere anatomici) e quelle con l’impiego dello stimolatore nervoso periferico. Il volume, corredato da immagini foto e grafici, per un totale di 65 figure, si apre con i capitoli relativi ai farmaci, agli strumenti e alle complicanze dell’anestesia locoregionale. Prosegue con i blocchi nervosi centrali (anestesia epidurale e spinale) e si conclude con i blocchi periferici (testa, arto anteriore, torace, arto posteriore). L’autore, Francesco Staffieri, è un medico veterinario che svolge il dottorato di ricerca nel Dipartimento delle Emergenze e dei Trapianti di Organi, Sezioni di Cliniche Veterinarie e Produzioni Animali dell’Università degli Studi Aldo Moro di Bari.

a cura di Manuel Graziani

LIBRI/Book reviews

Francesca Bellini, Alessia Liverini, Vincenzo Rosa

Conoscere gli animali familiari (Aracne, pp. 188, € 15,00) www.aracneeditrice.it

Conoscere gli animali familiari è la settima uscita della collana diretta da Paolo Polidori “produzioni

animali e sicurezza alimentare” sulla ricerca nell’ambito della nutrizione e alimentazione animale, zootecnia, ispezione degli alimenti di origine animale, clinica medica e parassitologia veterinaria con risvolti di natura tecnica, scientifica e pratica.

Il volume, redatto da medici veterinari in servizio presso differenti Aziende Sanitarie italiane, è un sintetico manuale su domesticazione, cura sanitaria, etnografia e addestramento del proprio cane (o gatto). Gli autori partono dall’assunto che i proprietari scelgono il cane per lo più sulla base del gusto visivo o sulla consuetudine tramandata in famiglia, senza un’esaustiva conoscenza degli aspetti riguardanti l’origine dell’animale, la sua attitudine prevalente, le sue patologie ricorrenti e le eventuali predisposizioni genetiche nei confronti di una determinata patologia. Puntano l’accento sin dalle prime battute sul cambiamento culturale che ha modificato anche il rapporto uomoanimale sotto l’aspetto sociale, effettuale e giuridico. L’animale da semplice “res” si è da tempo affermato come un essere diverso ma senziente, quindi destinatario di tutele, con diritti contemplati dalle carte costituzionali di diversi Paesi. Per questo motivo chi detiene un animale domestico deve prepararsi ad un impegno non riducibile al possesso di un oggetto, al punto di risponderne penalmente per eventuali sofferenze fisiche o psicologiche, per l’abbandono (anche solo temporaneo) o per l’incuria. Conoscere gli animali familiari fornisce nozioni scientifiche e sanitarie alla portata di tutti, utili soprat-

tutto nelle occasioni in cui i proprietari dovranno recarsi dal veterinario o affrontare visite legate alla profilassi e alle vaccinazioni di routine.

Pasquale Celommi (Montepagano, Roseto degli Abruzzi, 1851 â&#x20AC;&#x201C; Teramo, Roseto degli Abruzzi, 1928), Riposo. Olio su tela, 63,6x114 cm. Collezione privata.