Veterinaria Italiana, Volume 51 (2), April-June 2015

ISSN 0505-401X

Volume 51 (2) Aprile-Giugno April-June

2015

Rivista trimestrale di Sanità Pubblica Veterinaria, edita dall’Istituto Zooprofilattico Sperimentale dell’Abruzzo e del Molise “G. Caporale” A quarterly journal devoted to veterinary public health, veterinary science and medicine, published by the Istituto Zooprofilattico Sperimentale dell’Abruzzo e del Molise ‘G. Caporale’ in Teramo, Italy

Volume 51 (2), 2015

Jan Asselijn (Dieppe, c. 1610 ‑ Amsterdam, 1652) De bedreigde zwaan, Il cigno minacciato, The threatened swan, c. 1650 Olio su tela/Oil on canvas, cm 171 x 144 Rijksmuseum, Amsterdam Un cigno difende con vigore il suo nido da un cane. Nei secoli successivi questa immagine è stata interpretata come un’allegoria politica: il cigno bianco simboleggia lo statista olandese Johan de Witt (assassinato nel 1672) che protegge il paese dai suoi nemici. Questa era l'interpretazione attribuita al quadro, prima acquisizione nel 1880 della Nationale Kunstgalerij (diventata poi Rijksmuseum).

A swan fiercely defends its nest against a dog. In later centuries this scuffle was interpreted as a political allegory: the white swan was thought to symbolize the Dutch statesman Johan de Witt (assassinated in 1672) protecting the country from its enemies. This was the meaning attached to the painting when it became the very first acquisition to enter the Nationale Kunstgalerij (the forerunner of the Rijksmuseum) in 1880.

Si ringrazia il Rijksmuseum di Amsterdam per l’immagine di copertina.

We would like to express our gratitude to the Rijksmuseum in Amsterdam for the cover image. www.rijksmuseum.nl

Questa rivista è nata nel 1950 con il nome di Croce Azzurra.

Dal 1954 si chiamerà Veterinaria Italiana.

Comitato direttivo Managing Scientific Board Romano Marabelli Fernando Arnolfo

Direttore Editor-in-Chief Giovanni Savini

Membri onorari Honorary Members Hassan Abdel Aziz Aidaros – Egypt Ayayi Justin Akakpo – Senegal Nicola T. Belev – Bulgaria Louis Blajan – France Stuart C. MacDiarmid – New Zealand J. Gardner Murray – Australia Yoshihiro Ozawa – Japan Alexander N. Panin – Russia

Victor E. Saraiva – Brazil Aristarhos M. Seimenis – Greece Arnon Shimshony – Israel Samba Sidibé – Mali James H. Steele – United States of America Gavin R. Thomson – South Africa Carlo Turilli – Italy Norman G. Willis – Canada

Comitato di redazione Editorial Board Maria Cesarina Abete – Italy Marina Bagni – Italy Gioia Capelli – Italy Pierfrancesco Catarci – Italy Giovanni Cattoli – Italy Annamaria Conte – Italy Paolo Cordioli† – Italy Esterina De Carlo – Italy Antonio Fasanella – Italy Rosario Fico – Italy Adriana Ianieri – Italy

Valerio Giaccone – Italy Ciriaco Ligios – Italy N. James MacLachlan – United States of America Paola Nicolussi – Italy Janusz Paweska – South Africa Giovanni Pezzotti – Italy Roberto Piro – Italy Giuseppe Ru – Italy Fabrizio Vitale – Italy Stéphan Zientara – France

Comitato scientifico Scientific Advisory Board L. Garry Adams – United States of America Menachem Banai – Israel Elie K. Barbour – Lebanon A.C. David Bayvel – New Zealand Giorgio Battelli – Italy Roy G. Bengis – South Africa Ingrid E. Bergmann – Argentina Peter F. Billingsley – United States of America Silvio Borrello – Italy Canio Buonavoglia – Italy Mike Brown – United Kingdom Gideon Brücknerr – South Africa Giovanni Cattoli – Italy Bernadette Connolly – United Kingdom Julio De Freitas – Brazil Piergiuseppe Facelli – Italy Gianluca Fiore – Italy Cesidio Flammini – Italy Riccardo Forletta – Italy Bruno Garin-Bastuji – France Giorgio Giorgetti – Italy Rob Gregory – New Zealand

Anwar Hassan – Malaysia Barry J. Hill – United Kingdom Katsuyuki Kadoi – Japan Bruce Kaplan – United States of America R. Paul Kitching – Canada Corinne I. Lasmézas – France Salvatore Magazzù – Italy Franco Mutinelli – Italy Klaus Nielsen – Canada Lisa Oakley – New Zealand Massimo Palmarini – United Kingdom Attilio Pini – Italy Santino Prosperi – Italy Franco M. Ruggeri – Italy Domenico Rutili – Italy Paul Sutmoller – The Netherlands Peter M. Thornber – Australia Silvio Arruda Vasconcellos – Brazil Patrick Wall – Ireland Alexander I. Wandeler – Canada Kazuya Yamanouchi – Japan Cristóbal Zepeda – United States of America

Responsabile redazione Senior Associate Editor Mariarosaria Taddeo Redattori associati Associate Editors Monica Bucciarelli, Guido Mosca, Recensioni Book reviews Manuel Graziani Progetto grafico e web Graphic and web design Paola Di Giuseppe Amministrazione Administration Istituto Zooprofilattico Sperimentale dell’Abruzzo e del Molise “G. Caporale” Campo Boario, 64100 Teramo, Italia veterinariaitaliana@izs.it Stampa Printer Giservice srl, Teramo, Italia http://www.izs.it/vet_italiana/index.html © 2015 Istituto Zooprofilattico Sperimentale dell’Abruzzo e del Molise “G. Caporale” Campo Boario, 64100 Teramo, Italia

ISSN 0505-401X Formato elettronico Electronic format ISSN 1828-1427 Stampato su carta ecologica TCF Printed on 50% recycled, 100% chlorine- and acid-free environmentally friendly paper Aut. Trib. Teramo n. 299 del 16/05/1990 ‑ Sped. in Abb. Post. Art. 2 comma 20/c ‑ L. 66/96 DCB/DC Abruzzo Pescara

Istituto Zooprofilattico Sperimentale dell’Abruzzo e del Molise “G. Caporale” Campo Boario, 64100 TERAMO, Italia telefono +39 0861 3321, fax +39 0861 332251 www.izs.it

Volume 51 (1), 2015 Biagio Bianchi, Ferruccio Giametta, Giovanna La Fianza, Andrea Gentile & Pasquale Catalano Microclimate measuring and fluid‑dynamic simulation in an industrial broiler house: testing of an experimental ventilation system..................................... 85-92 Thomson Reuters Science Journal Citation Reports® database (JCR/Science Edition®) Journal impact factor 2013: 0.675

Misurazione del microclima e simulazione fluidodinamica in un allevamento avicolo industriale: test di un sistema di ventilazione sperimentale (riassunto)...........................................................85

• National Library of Medicine’s MEDLINE/ PubMed system

Fernando Alberto Moreira, Luís Cardoso & Ana Cláudia Coelho Epidemiological survey on Mycoplasma synoviae infection in Portuguese broiler breeder flocks .................................................... 93-98

• Thomson Reuters Science Citation Index Expanded™ (SciSearch®) • CABI’s Full-Text Repository • Directory of Open Access Journals (DOAJ)

Indagine epidemiologica sulle infezioni da Mycoplasma synoviae in allevamenti di polli da riproduzione in Portogallo (riassunto).................................................93

• Elsevier’s SciVerse Scopus

Le pubblicazioni dell’Istituto Zooprofilattico Sperimentale dell’Abruzzo e del Molise “G. Caporale” (IZSAM) sono protette dalla legge internazionale sul copyright. Gli estratti possono essere letti, scaricati, copiati, distribuiti, stampati, recuperati; è consentito inoltre il collegamento ai file pdf di Veterinaria Italiana.

Informazioni per fini commerciali devono essere richieste all’IZSAM. Le traduzioni a stampa e gli adattamenti sono consentiti previa autorizzazione scritta da parte dell’IZSAM. Le opinioni espresse negli articoli pubblicati sono esclusivamente sotto la responsabilità degli autori. L’eventuale citazione di specifiche Ditte o prodotti, siano essi brevettati o meno, non implica che essi siano stati consigliati dall’IZSAM e vengano preferiti ad altri di simile natura non menzionati nei testi.

Publications of the Istituto Zooprofilattico Sperimentale dell’Abruzzo e del Molise ‘G. Caporale’ (IZSAM) are protected by international copyright law. Users are permitted to read, download, copy, distribute, print, search abstracts; besides they can link to Veterinaria Italiana full pdf files. Should information be required for commercial purposes, prior written permission must be sought from the IZSAM. Published translations and adaptations also require prior written approval from the IZSAM. The views expressed in signed articles are solely the responsibility of the authors. The mention of specific companies or products of manufacturers, whether or not patented, does not imply that these have been endorsed or recommended by the IZSAM in preference to others of a similar nature that are not mentioned.

Manuela Tittarelli, Marcello Atzeni, Paolo Calistri, Elisabetta Di Giannatale, Nicola Ferri, Enrico Marchi, Alessandra Martucciello & Fabrizio De Massis A diagnostic protocol to identify water buffaloes (Bubalus bubalis) vaccinated with Brucella abortus strain RB51 vaccine ....................... 99-105 Un protocollo diagnostico per identificare bufali domestici (Bubalus bubalis) vaccinati con Brucella abortus ceppo RB51 (riassunto).................................................................99

Gabriella Masu, Rosaura Porcu, Valentina Chisu, Antonello Floris & Giovanna Masala Reorganization of actin cytoskeleton in L929 cells infected with Coxiella burnetii strains isolated from placenta and foetal brain of sheep (Sardinia, Italy) ........................................ 107-114 Riorganizzazione dell'actina del citoscheletro in cellule L929 infettate con ceppi di Coxiella burnetii isolati da placenta di pecora e cervello fetale ovino (Sardegna, Italia) (riassunto).................................................................... 107

Mayurkumar P. Bhimani, Bharat B. Bhanderi & Ashish Roy Loop‑mediated Isothermal Amplification assay (LAMP) based detection of Pasteurella multocida in cases of haemorrhagic septicaemia and fowl cholera.................................... 115-121 Rilevamento di Pasteurella multocida mediante amplificazione isotermica mediata da loop del DNA in casi di setticemia emorragica e colera aviare (riassunto)....... 115

Massimo Scacchia, Umberto Molini, Giuseppe Marruchella, Adrianatus Maseke, Grazia Bortone, Gian Mario Cosseddu, Federica Monaco, Giovanni Savini & Attilio Pini African horse sickness outbreaks in Namibia from 2006 to 2013: clinical, pathological and molecular findings................................... 123-130 Episodi di peste equina in Namibia dal 2006 al 2013: rilievi clinici, patologici e molecolari (riassunto)........................................................................... 123

Volume 51 (1), 2015 Maria Goffredo, Monica Catalani, Valentina Federici, Ottavio Portanti, Valeria Marini, Giuseppe Mancini, Michela Quaglia, Adriana Santilli, Liana Teodori & Giovanni Savini Vector species of Culicoides midges implicated in the 2012‑2014 Bluetongue epidemics in Italy ............................. 131-138 Specie di Culicoides coinvolte nell'epidemia di Bluetongue 2012‑2014 in Italia (riassunto)................................................................................ 131

RAPID COMMUNICATION Sanja Bosnić, Relja Beck, Eddy Listeš, Ivana Lojkić, Giovanni Savini & Besi Roić Bluetongue virus in Oryx antelope (Oryx leucoryx) during the quarantine period in 2010 in Croatia.............................. 139-143 Virus della Bluetongue rinvenuto in antilope (Oryx leucoryx) durante il periodo di quarantena nel 2010 in Croazia (riassunto)............................................ 139

SHORT COMMUNICATION Saravanan Subramaniam, Punam Bisht, Jajati K. Mohapatra, Aniket Sanyal & Bramhadev Pattnaik A new lineage of foot-and-mouth disease virus serotype O in India.............................................................................. 145-149 Sequenziamento nucleotidico completo di un nuovo lineage del virus dell'afta epizootica, sierotipo O, in India (riassunto)............................................145-149

SHORT COMMUNICATION Giulia Barlozzari, Alessia Franco, Gladia Macrì, Serena Lorenzetti, Fabiana Maggiori, Samuele Dottarelli, Marina Maurelli, Elisabetta Di Giannatale, Manuela Tittarelli, Antonio Battisti & Fabrizio Gamberale First report of Brucella suis biovar 2 in a semi free-range pig farm, Italy.................................................... 151-154 Prima segnalazione di Brucella suis biovar 2 in allevamento semibrado di suini in Italia (riassunto)................................................................ 151

SHORT COMMUNICATION Riccardo Caprioli, Paola Garozzo, Carla Giansante & Nicola Ferri Blue‑colour variants of the crayfish Austropotamobius pallipes in 2 rivers of the Abruzzo region, Italy............................................... 155-158 Varianti di colore blu dei gamberi Austropotamobius pallipes in 2 fiumi della regione Abruzzo, Italia (riassunto)........................................................................ 155

LIBRI/Book reviews Ernesto Correale Il bufalo - Allevamento e gestione .............................................................................159 (a cura di) Ambito Territoriale Caccia di Napoli SOS Gabbiani - Gestire la convivenza con il gabbiano reale ........................160

Microclimate measuring and fluid‑dynamic simulation in an industrial broiler house: testing of an experimental ventilation system Biagio Bianchi1*, Ferruccio Giametta2, Giovanna La Fianza2, Andrea Gentile2 & Pasquale Catalano2 1 2

University of Bari – DISAAT Dept., Via Amendola 165/A, 70126 Bari, Italy.

Department of Agriculture, Environment and Food, University of Molise.

* Corresponding author at: University of Bari – DISAAT Dept., Via Amendola 165/A, 70126 Bari, Italy.

Tel.: + 39 080 5442940, e‑mail: biagio.bianchi@agr.uniba.it.

Veterinaria Italiana 2015, 51 (2), 85-92. doi: 10.12834/VetIt.689.5112.03 Accepted: 10.04.2015 | Available on line: 30.06.2015

Keywords Environment, Fluid‑dynamic simulation, Hen house, Microclimate, Ventilation.

Summary The environment in the broiler house is a combination of physical and biological factors generating a complex dynamic system of interactions between birds, husbandry system, light, temperature, and the aerial environment. Ventilation plays a key role in this scenario. It is pivotal to remove carbon dioxide and water vapor from the air of the hen house. Adequate ventilation rates provide the most effective method of controlling temperature within the hen house. They allow for controlling the relative humidity and can play a key role in alleviating the negative effects of high stocking density and of wet litter. In the present study the results of experimental tests performed in a breeding broiler farm are shown. In particular the efficiency of a semi transversal ventilation system was studied against the use of a pure transversal one. In order to verify the efficiency of the systems, fluid dynamic simulations were carried out using the software Comsol multiphysics. The results of this study show that a correct architectural and structural design of the building must be supported by a design of the ventilation system able to maintain the environmental parameters within the limits of the thermo‑neutral and welfare conditions and to achieve the highest levels of productivity.

Misurazione del microclima e simulazione fluidodinamica in un allevamento avicolo industriale: test di un sistema di ventilazione sperimentale Parole chiave Microclima, Pollaio, Simulazione fluido‑dinamica, Ventilazione.

Riassunto L'ambiente dell’allevamento avicolo è costituito da una combinazione di fattori fisici e biologici che interagiscono come un sistema dinamico complesso di interazioni tra volatili, sistema di allevamento, luce, temperatura e ambiente aereo. La ventilazione riveste un ruolo essenziale in questo contesto. Essa è essenziale per l'eliminazione di CO2 e di vapore acqueo dall'aria del pollaio. Tassi di ventilazione adeguati sono il metodo più efficace di verifica della temperatura all'interno del pollaio e consentono anche il controllo dell'umidità relativa oltre a svolgere un ruolo chiave per alleviare gli effetti negativi dell’alta densità di allevamento e dei rifiuti umidi.

Nel presente studio sono riportati i risultati di prove sperimentali effettuate in un allevamento di polli; in particolare è stata analizzata l'efficienza di un sistema di ventilazione semi trasversale in rapporto ad uno trasversale puro. Al fine di verificare l'efficienza dei sistemi sono state effettuate simulazioni fluidodinamiche utilizzando il software COMSOL Multiphysics. I risultati di questo studio mostrano che una progettazione architettonica e strutturale corretta dell'immobile deve essere accompagnata da un design meccanico e fluidodinamico del sistema di ventilazione ugualmente corretto al fine di mantenere parametri ambientali tali da garantire il benessere animale e raggiungere i massimi livelli di produttività.

85

Fluid-dynamic simulation in an industrial broiler house

Introduction The environment in the hen house is a combination of physical and biological factors which interact as a complex dynamic system of interactions between birds, husbandry system, light, temperature, and the aerial environment (Sainsbury 2000).

Pollutants include organic and inorganic dust, pathogens and other micro‑organisms as well as gases, such as ammonia, nitrous oxide, carbon dioxide, hydrogen sulphide, and methane or other compounds like endotoxins and even residues of antibiotics (Kristensen and Wathes 2000). Chronic exposure to some types of aerial pollutants – like gases, dust, and micro‑organism form bio‑aerosols – may exacerbate multi‑factorial environmental diseases. There is strong epidemiological evidence that bioaerosols cause directly infectious and allergic diseases in farm workers and animals. In addition, air contaminants may depress the growth of the birds (Wathes 1998). The main sources of aerial pollutants are the feed, the litter, and the chickens themselves. Alle these sources are indirectly or directly influenced by factors such as season, diseases, nutrition, and the management (Wathes, 2004). It is remarkable that broiler chickens tolerate the high burden of aerial pollutants, and yet there are reasons for concerns, insofar as their welfare may be compromised by chronic exposure (Wathes 2004). Wathes (2004) suggested that the current guidelines for air quality should be revised and lower limits considered (EFSA 2012).

Carbon dioxide (CO2) is a non‑reactive gas, which is removed only by ventilation. It may interact chemically, for example, by absorption on wet building surfaces or dust particles. CO2 is a metabolic by‑product of both broiler chickens and litter processes. The EU Broiler Directive (Commission 2007) advises 3,000 ppm for carbon dioxide. However, an increase in CO2 levels is usually accompanied by increased levels of other detrimental air pollutants such as ammonia, dust, and micro‑organisms. Therefore CO2 is used as an air quality indicator and the minimum ventilation rate is calculated on the basis of CO2 production by the chickens and the litter (EFSA 2012).

The most important role of ventilation is to remove carbon dioxide and water vapor from the air of the hen house. Adequate ventilation rates provide the most effective method of controlling temperature within the house and also allows for controlling the relative humidity. Ventilation also plays a key role in alleviating the negative effects of high stocking density and of wet litter.

Litter moisture is positively correlated with the incidence of footpad dermatitis, one of the most important welfare indicators (EFSA 2012).

86

Bianchi et al.

The main elements that have to be considered to ensure comfort conditions are: type of animal housing, stocking density, food quantity and quality, presence or absence of litter, available space per head, micro‑environment conditions (light, temperature, noise, speed, air quality, etc.), weaning technique (EFSA 2010).

The industrial breeding allows farmers to achieve good economic level by mean of mechanization, specialized employees, optimization of planimetry, high stocking rate that, of course, require specific solutions to ensure suitable air quality and temperature and humidity conditions (Kristensen and Wathes, 2000, Quaglio et al. 1988).

To keep body temperature stable, the heat produced by animals metabolism must be equal to the one transferred to the room. Environmental conditions with too high temperatures are deleterious (Cahaner 2008) because they reduce body heat loss, further aggravating chicken welfare, given that animal feathers inhibit internal heat dissipation (Deeb and Cahaner 1999). The optimum temperature for best performance ranges between 18 and 22 °C for growing broiler chickens (Charles 2002, Ross 2010, EFSA 2010). Birds most efficiently convert feed to meat when they are given consistently optimum environmental conditions, with temperature being the most critical factor.

Broiler houses are heated as young chicks cannot maintain their body temperature. Sometimes floor heating systems are used, but in the majority of the houses local or central heating systems are utilized.

If the temperature is too low, birds increase their feed intake but have to use more of that feed energy to keep their bodies warm. If temperature is too high, they reduce feed intake to limit heat production. At each stage of a bird’s development, there is a narrow temperature range where maintenance energy requirements are lowest and the bird can make maximum use of feed energy for growth. If temperature goes just a few degrees outside the optimum performance zone, cooler or warmer, birds will be using a higher proportion of their feed energy for body maintenance and less for growth. For example, research conducted in the United States showed that exposing day‑old chicks to an air temperature of 13 °C for only 45 minutes reduced 35 day weights by about 110 g (Ross 2010). The first day the temperature on chick level should be 30 °C. During the rearing period the temperature is lowered according to the guidelines of the breeding companies. At 27 days of age the temperature should be around 20 °C. (EFSA 2010). The target temperature for best broiler performance changes during a grow‑out, typically from around 30°C on day 1 to near 20 °C or lower at harvest time, depending on bird size and other factors. (Ross 2010).

Veterinaria Italiana 2015, 51 (2), 85-92. doi: 10.12834/VetIt.689.5112.03

Bianchi et al.

Humidity is also a very important parameter for the welfare of broilers. In the first week of life the relative humidity for a chick is particularly important because it affects the health and well‑being in adulthood. A too low relative humidity during this time may lead to dehydration and uneven growth (Aviagen 1999). Usually during the first week of farming, it is recommended that relative humidity in livestock buildings is kept at 70-75% (Dobrzański and Kolacz 1996). The effect of humidity on the thermal regulation of chickens depends on age and air temperature (Lin et al. 2005). During the whole breeding cycle, the relative humidity should be maintained at a value between 60% and 70% (Ross 2009, Ross 2010, EFSA 2010, EFSA 2012). It depends mainly on factors within the building but also on outside humidity. Examples of important factors in the building are stocking density, live weight of the birds, ventilation rate, indoor temperature, number, type and management of drinkers, water consumption and water spillage. Birds are basically air‑cooled. That is, air moving over the birds picks up their body heat and transfers it to the environment.

Birds do not sweat, they do get some evaporative cooling effect through breathing and panting (Ross 2010). Temperature and relative humidity influence the thermal comfort of the birds. A relative humidity of 60‑70% in the house is necessary in the first 3 days (Ross 2009). Relative humidity above 70% can occasionally be reached with high stocking densities durig Winter, when the ventilation rate may be reduced to retain heat and save energy (Ross 2009).

At later ages high relative humidity causes wet litter and its associated problems. During summer, broilers may often experience discomfort due to the combined effect of high humidity and high temperature. Relative humidity below 50% leads to an increase in dust and micro‑organisms, which increase the susceptibility to respiratory diseases.

This situation is not very common and normally occurs only in the first or second week of life (EFSA 2012).

As a ventilation system is conceived to change the air inside the farm, it should be able to control air temperature, relative humidity, and velocity at the height of the animals, while at the same time maintaining a tolerable concentration of gas, in particular CO2. Therefore, in addition to the global flow rate, that determines the air exchange rate, local air speed has also to be considered. Suitably ventilation design carefully considers the broiler house structure, paying particular attention to turbulence and uniformity of the air distribution. For example, a well‑designed ventilation systems that helps dust removal (Banhazi et al. 2008), avoids high speeds close to the litter as the associated turbulence favors the suspension of particles in the environment.

Mainly 2 ventilation systems are used in a herd:

Veterinaria Italiana 2015, 51 (2), 85-92. doi: 10.12834/VetIt.689.5112.03

Fluid-dynamic simulation in an industrial broiler house

• the longitudinal system, in which the air is flowed longitudinally along the axis of livestock (today basically into disuse); • the transverse system, in which air is fed and expelled crosswise so as to ventilate the breeding cross sections (most used today).

The 2 systems can be combined, in order to offer appropriate solutions to the selected type of ventilation.

The airflow is due to the longitudinal supply (or suction) by the fans and the control of the air speed can prevent the air back layering towards the central zone.

In the present study the results of experimental tests performed in a breeding broilers farm are shown; in particular the efficiency of a semi transversal ventilation system was studied against the use of a pure transversal one. The system under study was suitably designed for the experimentation.

Materials and methods Poultry farming The experimentation was conducted in a hen house located in Sant'Elia a Pianisi (Campobasso, Molise, Italy). The module of farming has a capacity of 30,000 animals per cycle: 20,500 males and 9,500 females.

Each cycle lasts approximately 80 days: 60 days needed to bring the chicks to commercial size (60 for males and 35 for females) and 20 required for the underfloor space, 20 needed to the health rest.

The external dimensions are: 132.00 m x 14.20 m corresponding to a gross floor area of 1,874.40 m2, with coverage of the type pitched with a height to the eaves of 2.65 m.

The orientation of the building is North‑South; the supporting structure is made of steel, the perimeter walls and the cover are made of composite panels consisting of 2 metal plates coatings between which a layer of insulating foam injected at high pressure is interposed. The natural ventilation is crosswise, made with glazing tape with polycarbonate windows and flap opening, which runs along the lateral walls parallel to the longitudinal axis (Figure 1).

In this research, however, a specific longitudinal aeration system has been realized. It consists of 14 axial fans (Figure 1, Table I), with a grid of protection placed at the outlet. Eight fans are placed in the lower part of the wall, while 6 have been positioned in the upper part.

The fan operation is regulated by a control unit regulating the temperature inside the shed and the air exchange. These 2 parameters are set by the

87

Bianchi et al.

Fluid-dynamic simulation in an industrial broiler house

Table I. Main technical data of the fans in the studied ventilation system of an industrial broiler house.

Model Electrical motor Impeller Mass Maximum air flow

Euroemme® EM50n P = 1.0 HP; n = 1,400 rpm blades: 6; Φ = 1,270.0 mm; n = 368 rpm 84.0 kg 36,180 m3/h, adjustable with 10 suction blades

Figure 1. Chicken farming in an industrial broiler house: crosswise natural ventilation with windows and flap opening, specific longitudinal aeration system. farmer: the fans start at 19 °C and must provide an air change of 80% in summer and 30% in winter.

The shed is equipped with a control and high temperature protection system, which comes into operation during the warmer months. Depending on the external temperature, it can proceed in 2 ways: a. When the outdoor temperature is higher than the tolerance limits for short periods of the day, the internal temperature rise is controlled during the coolest hours of the day, with the introduction of an air flow rate depending on the inner temperature: the greater the increase in temperature above the ideal value, the greater the air flow rate. b. When the outdoor temperature is higher than the tolerance limits for long periods of the day, the internal temperature rise is controlled by mean of an evaporative cooling system.

Two cooling systems are placed along the lateral walls directly next to the service area (on the opposite side of the fans): in this way the air that enters through the cooling runs through the whole shed before being expelled outside. The activation of the cooling has been set as follows: on at 27 °C and off at 24 °C.

Measuring chain and related procedures The following LSI probes were used for measurements and connected to the data acquisition system BABUC / A. • Psychrometer BSU102 equipped with 2 thermometers, a dry bulb measuring the air temperature and a wet bulb thermometer (Temperature range: ‑5‑60 °C ± 0.13 °C; relative humidity range: 0‑100%, 2% with T = 15‑45 °C. The 2 measurements were performed at an air speed of 4 m/s, imposed by a little fan housed inside the instrument.

• BSV101 hot‑wire anemometer for omni‑directional air speed measurement.

88

Figure 2. Computational Fluid Dynamic in an industrial broiler house.

The air speed measuring range is 0 ‑ 45 m/s (threshold: 0.01 m/s), ±0.05 m/s (0‑0.5 m/s), ±0.10 m/s (0.5‑1.5 m/s), 4% (>1.5 m/s).

• BSO 103.1 probe for carbon dioxide measurement. It is an infrared absorption cell with measuring range: 0 to 3,000 ppm.

The measurements were carried out in Summer (June‑July 2012), during an entire breeding cycle, when the maximum air flow rate is required. The shed was divided in the longitudinal direction in 14 areas and, for each of them, 3 measurements were made in the central part, each at a different height: 20 cm, 100 cm and 150 cm. Moreover, the positions labelled 1, 5, 9, 13, were divided into 3 subareas: lateral left, central, and lateral right, so as to obtain other 2 sets of measurements. Figure 2 shows a diagram from which it is possible to locate

Veterinaria Italiana 2015, 51 (2), 85-92. doi: 10.12834/VetIt.689.5112.03

Bianchi et al.

Fluid-dynamic simulation in an industrial broiler house

the position of the points where measurements were made.

experimental ones (longitudinal ventilation system).

In this way it was possible to validate the model by comparing simulated and measurement data. The same model has subsequentely been used in the same hen house, once this was equipped with a cross ventilation system with the same total air flow rate.

In order to verify the efficiency of the longitudinal ventilation system compared with a system of transversal type, fluid dynamic simulations were performed using the software Comsol multiphysics.

In such a system it is possible to define the geometry of the system, the reference equations for the specific problem (momentum and mass transport in this case) and the boundary conditions (number and type of fans turned on and their flow rate, openings for the air inlet, concentration of the trace gas in input: CO2 in the specific case, etc.).

Results and discussion Figures 3, 4, and 5 show the trends of the measured quantities, temperature, relative humidity and CO2 concentration of the air inside the plant at different heights. In particular, the average values recorded in each position in the test period have been reported.

A general increase was observed of both of the temperature and of the CO2 moving from the area (Figure 2 ‑ position 1: main input of the air) opposite

In this way it was possible to determine the air flow field inside the farm as well as the concentration of the trace gas. The simulation was made considering stationary conditions corresponding to the

Temperature

70

29

65

28

60

27

55

26

50 45

25

40

24 23

Relative Humidity

75

30

35 1

2

3

Min

4

5

6

Mean

7

8

9 10 11 12 13 14

Max

Left

30

1

2

3

Min

Right

4

5

6

Mean

7

8

Max

9 10 11 12 13 14 Left

800 750 700 650 600 550 500 450 400 350 300

Carbon Dioxide

1

Right

2

3

Min

4

5

6

Mean

7

8

9 10 11 12 13 14

Max

Left

Right

Figure 3. Trends of the measured quantity (temperature, relative humidity and CO2) concentration of the air inside the plant at 20 cm.

Temperature

30

70

29

65

28

60

27

55

26

50 45

25

40

24 23

Relative Humidity

75

35 1

2

3

Min

4

5

6

Mean

7

8

9 10 11 12 13 14

Max

Left

30

1

2

3

Min

Right

4

5

6

Mean

7

8

Max

9 10 11 12 13 14 Left

800 750 700 650 600 550 500 450 400 350 300

Carbon Dioxide

1

Right

2

3

4

Min

5

6

Mean

7

8

9 10 11 12 13 14

Max

Left

Right

Figure 4. Trends of the measured quantity (temperature, relative humidity and CO2) concentration of the air inside the plant at 100 cm.

Temperature

30

70

29

65

28

60

27

55

26

50 45

25

40

24 23

Relative Humidity

75

35 1

2 Min

3

4

5

Mean

6

7 Max

8

9 10 11 12 13 14 Left

Right

30

1

2 Min

3

4

5

Mean

6

7 Max

8

9 10 11 12 13 14 Left

Right

800 750 700 650 600 550 500 450 400 350 300

Carbon Dioxide

1

2 Min

3

4

5

Mean

6

7

8

9 10 11 12 13 14

Max

Left

Right

Figure 5. Trends of the measured quantity (temperature, relative humidity and CO2) concentration of the air inside the plant at 150 cm.

Veterinaria Italiana 2015, 51 (2), 85-92. doi: 10.12834/VetIt.689.5112.03

89

Bianchi et al.

Fluid-dynamic simulation in an industrial broiler house

to that of the fans to the air suction wall (Figure 2 ‑ position 14), while the relative humidity remains almost constant. This is due to the presence of the animals and of the litter producing thermal energy and carbon dioxide.

The air temperature inside the farm varies only slightly (¹1.5 °C) although it remains higher than optimal. These values, however, are not considered unreasonable because the relative humidity is kept always lower than 50%. It is also a substantial invariance of these quantities depending on the height from the litter, while the relative humidity at 20 cm from the litter is higher.

The ventilation system operates in terms of control of environmental parameters, allowing for a proper air exchange in all areas of the farming module.

Trial results highlight the need for a modulated ventilation system, with the possibility of acting in a differentiated way in the layers near the floor, in which, regardless of the distance from the fans, critical environmental conditions may occur due to increased moisture, which may lead to an increased diseases risk in animals, caused by the proliferation of bacteria in the litter.

90

satisfied by the used ventilation system allowing a limited temperature and carbon dioxide range.

The latter two parameters, while remaining within the limits of acceptability, tend to increase in the module areas most distant from the fans, showing a limit of the longitudinal distribution compared to the transverse (Figures 6 and 7). To confirm this, it is noted that the presence of the central openings corresponding to position 7 (Figure 2) and leads to a substantial decrease in the concentration of CO2 in the central area downstream of section 7, due to a better air circulation.

Figure 6 shows the simulated flow field, represented by the stream lines, in which the concentration of CO2 is at 20 cm above the litter. It is observed that the stream lines are mainly concentrated in the central corridor as well as found experimentally. This fact is confirmed by the analysis of the average values both of temperature and CO2 concentration also experimentally determined during the trial period (Figures 3, 4, and 5). These are greater in the 2 lateral corridors with respect to the central one, especially in the downstream area of the lateral openings (position 7 in Figure 2).

The highest concentration of moisture near the floor is due to animals respiration and manure exhalations, which are constituted by complex gas mixtures, in which the water vapor has the highest specific weight and tends to be disposed in the lower layers with respect to CO2, other gaseous compounds based on hydrogen are also present.

Moreover, in the specific case, the studied breeding module is located in a temperate climatic zone, where the Summer temperatures are not so high and, therefore, do not feel particularly the need to remove the warm air from the upper layers.

The tests, however, show that this requirement is

Therefore, the longitudinal system has the drawback of not allowing a uniform and effective air flow along the side walls, especially in those areas farther away from the fans. In this context, supplying air from side intakes lead to partially overcome this limitation, as it has been highlighted by the experimental data.

Consequently, these results lead to particular design solutions such as to housing animals in the middle part of the breeding module, allocating the lateral areas to technical and/or functional operations providing only animals and operators passage.

Figure 6. Simulated flow field of the industrial broiler house considered as case study.

Figure 7. Simulated flow field in the case of cross ventilation in an industrial broiler house.

Figure 7 reports the flow field in the case of cross ventilation, as well as the trend of CO2 concentration

Veterinaria Italiana 2015, 51 (2), 85-92. doi: 10.12834/VetIt.689.5112.03

Bianchi et al.

at 20 cm above the litter. Also in this case observed values are always below the aforementioned limits.

However, the transverse CO2 distribution obtained by simulation shows a more uniform air exchange.

On the one hand, the distance from the fans becomes an important technical variable that significantly influences the formation of areas of stagnant air.

The hypothesized fan positioning meets the design parameters currently adopted but, in the specific case, is characterised by an excessive distance with regard to the possible stagnation that appear in the proximity of the walls between 2 successive fans.

On the other hand, a possible reduction of these distances may cause flow ‘short‑circuiting’, which was observed in some points, especially close to the transverse walls (beginning and end of the module).

These flows leave from a fan and partly carry the air towards the next fan thus reducing the efficiency of the ventilation.

This allows to state that this parameter should be determined at design time through a proper fluidynamic study, in particular a shorter distance may be accepted in the central parts of the module and should be increased to extremes, without altering the total number of fans required.

The correct positioning of the fans, as well as an adequate distribution of flows, also facilitate the control of CO2 and moisture concentration in each volume of the breeding module, thus leading to greater flexibility. The latter is essential when the breeding cycle is all done in the same module, imposing its partitioning, both in the use of machines and spaces.

Conclusions The buildings for broiler breeding have dimensional characteristics that set them apart in a rather marked way from buildings designed for other livestock farms. The dimensions in the horizontal plane, in

Veterinaria Italiana 2015, 51 (2), 85-92. doi: 10.12834/VetIt.689.5112.03

Fluid-dynamic simulation in an industrial broiler house

fact, have a very high length / width ratio due to the high level of mechanization and automation of the feeding operations. In this context, the identification of the most suitable type of installation ensuring a uniform and regular air exchange in all areas of the building is of fundamental importance.

The results of this study show that a correct architectural and structural design of the building must be supported by an equally correct mechanical and fluid dynamics design of the ventilation system in order to maintain the environmental parameters within the limits of the thermo‑neutral and welfare conditions, to achieve the highest levels of productivity.

The possibility to gain optimal thermo‑hygrometric conditions, in addition to the breeding cycle and animal species, is also related to the climatic conditions of the farm location. Therefore plant solutions should be appropriately assessed by maintaining, in each case, their flexibility.

In this study, the experimental results and those of the computational fluid dynamic (CFD) simulation show that the longitudinal distribution must be supported by a specific design of spaces and facilities for the movement of the personnel, for distribution of food and water. This solution should be suitably integrated with both more lateral openings for the air inlet at the center of the module and with automatic systems controlling the fans at the different heights. With these changes, the system can also fit situations where the maintenance of optimal thermal conditions is more important than the need to control gas layering.

In contrast, the transverse distribution of the air, most frequently adopted in industrial installations, offers the best performance in terms of installed power and temperature control in warm climates, while requiring a particular fluid dynamic study, aiming to positioning the fans so as to minimize the stagnation zones and short‑circuiting phenomena of the introduced air.

91

Bianchi et al.

Fluid-dynamic simulation in an industrial broiler house

References Aviagen. 1999. Ross breeders broiler management manual.

Aviagen Ltd., Newbridge, Midlothian, Scotland.

Banhazi T.M. Seedorf J. Rutley D.L. & Pitchford W.S. 2008. Identification of risk factors for sub‑optimal housing conditions in Australian piggeries – part III: environmental parameters. Journal of Agricultural Safety and Health, 14, 41‑52.

Benson F. 2000. Sistema de pago de los productos derivados del avestruz. La solucion mejor para todos: productores, transformadores y consumidores.

Selecciones Avicolas, 4, 218‑222.

Cahaner A. 2008. Breeding fast‑growing, high‑yield broilers for hot conditions. In Poultry production in hot climates.

2nd ed. (N.J. Daghir ed). CAB Int., Oxfordshire, UK. Deeb N. & Cahaner A. 1999. The effects of naked neck genotypes, ambient temperature, and feeding status and their interactions on body temperature and performance of broilers. Poult Sci, 78, 1341‑1346.

Charles D.R. 2002. Responses to the thermal environment.

In Poultry environment problems, A guide to solutions (D.A. Charles & A.W. Walker, eds). Nottingham University Press, Nottingham, United Kingdom, 1‑16.

Dobrzański Z. & Kołacz R. 1996. Manual for students of zoo hygene. Wyd. AR Wrocław.

Department for Environment, Food and Rural Affairs (DEFRA). 2002. Code of recommendations for the welfare of livestock: meat chickens and breeding chickens. Department for Environment, Food and Rural Affairs, London.

European Food Safety Authority (EFSA). 2010. Animal welfare risk assessment guidelines on housing and management (EFSA Housing Risk) (Question No EFSA‑Q‑2009‑00844). www.efsa.europa.eu/publications.

European Food Safety Authority (EFSA). 2012. Opinions on the welfare of broilers and broiler breeders.

Supporting Publications: EN‑295. www.efsa.europa.eu/ publications.

92

European Commission (EC). 2007. Council Directive 2007/43/EC of 28 June. Laying down minimum rules for the protection of chickens kept for meat production.

Off J, L 182, 19‑28.

Fraser D., Duncan I.J.H., Edwards S.A., Grandin T., Gregory N.G., Guyonnet V., Hemsworth P.H., Huertas S.M., Huzzey J.M., Mellor D.J., Mench J.A., Špinka M. & Whay H.R. 2013. General principles for the welfare of animals in production systems: the underlying science and its application. Vet J, 198, 19‑27.

Kristensen H.H. & Whates C.M. 2000. Ammonia and poultry Welfare. World's Poult Sci J, 56, 235‑245.

Lin H., Zhang H.F., Jiao H.C., Zhao T., Sui S.J., Gu X.H., Zhang Z.Y. Buyse J. & Decuypere E. 2005. The thermoregulation response of broiler chickens to humidity at different ambient temperatures I. One‑week‑age. Poult Sci, 84, 1166‑1172.

Quaglio G., Franchini F. & Quaglio F. 1998. Ambiente e produzioni zootecniche. Le tecnopatie, malattie polifattoriali condizionate nell'avicoltura intensiva.

Rivista di Avicoltura, 2, 19‑28.

Ross. 2009. Broiler thepoultrysite.com

Management

Manual.

www.

Ross. 2010. Environmental Management in the Broiler House. www.thepoultrysite.com.

Sainsbury D. 2000. Poultry health and management: chickens, turkeys, ducks, geese and quail.

Wiley‑Blackwell, London.

Wathes C.M. 1998. Aerial emissions from poultry production. World’s Poult Sci J, 54, 241‑251.

Wathes C.M., Demmers T.G.M., Teer N., White R.P., Taylor L.L., Bland V., Jones P., Armstrong D., Gresham A.J.C., Hartung J., Chennells D.J. & Done S.H. 2004. Production responses of weaned pigs after chronic exposure to airborne dust and ammonia. Anim Sci, 78, 87‑97.

Veterinaria Italiana 2015, 51 (2), 85-92. doi: 10.12834/VetIt.689.5112.03

Epidemiological survey on Mycoplasma synoviae infection in Portuguese broiler breeder flocks Fernando Alberto Moreira*, Luís Cardoso & Ana Cláudia Coelho Department of Veterinary Sciences, School of Agrarian and Veterinary Sciences, University of Trás-os-Montes e Alto Douro (UTAD), Animal and Veterinary Science Center (CECAV), Quinta de Prados, 5000-801 Vila Real, Portugal . * Corresponding author at: Department of Veterinary Sciences, School of Agrarian and Veterinary Sciences, University of Trás-os-Montes e Alto Douro (UTAD), Animal and Veterinary Science Center (CECAV), Quinta de Prados, 5000-801 Vila Real, Portugal.

Tel.: +351 913090126, e-mail: fernando.moreira@lusiaves.pt.

Veterinaria Italiana 2015, 51 (2), 93-98. doi: 10.12834/VetIt.116.329.3

Accepted: 20.07.2014 | Available on line: 30.06.2015

Keywords Broiler breeder, ELISA, Epidemiology, Mycoplasma synoviae, Mycoplasmosis, PCR.

Summary Since modernization and expansion of the poultry industry, infections with Mycoplasma spp. bacteria have been reported as a cause of considerable economic losses. The prevalence of Mycoplasma synoviae infection in 974,000 Portuguese broiler breeders, belonging to 36 flocks, was investigated from December 2008 to March 2012. This study was conducted using a commercial indirect enzyme-linked immunosorbent assay (ELISA) for the analysis of serum antibodies, and a polymerase chain reaction (PCR) for the tracheal tissue. Twentyfour flocks were simultaneously found positive by ELISA and PCR [66.7%, 95% confidence interval (CI): 43.5-76.9%]. The M. synoviae prevalence among chickens averaged 40.3% (483/1,200), with values ranging from 0.0 to 83.3% per flock. The prevalence of farms where M. synoviae positive birds have been found was determined in different poultry categories such as density, biosecurity, strains, offspring quality, premises’age, and others husbandry factors. Prevalence values were significantly higher among birds housed in new facilities (less than 3 years old) and were also significantly higher in the production period. The high prevalence of M. synoviae infection detected in the present study suggests the need to adopt appropriate control measures.

Indagine epidemiologica sulle infezioni da Mycoplasma synoviae in allevamenti di polli da riproduzione in Portogallo Parole chiave ELISA, Epidemiologia, Mycoplasma synoviae, Micoplasmosi, Polli da riproduzione, PCR.

Riassunto Le infezioni da Mycoplasma spp. sono causa di notevoli perdite economiche per il settore avicolo. Questo studio, condotto nel periodo dicembre 2008 e marzo 2012, ha riguardato la prevalenza di infezione da Mycoplasma synoviae in 974.000 allevamenti di polli da riproduzione in Portogallo, appartenenti a 36 allevamenti. Lo studio è stato condotto utilizzando un’ELISA indiretta (kit commerciale), per l'analisi degli anticorpi e un saggio PCR (reazione a catena della polimerasi), per l’analisi del tessuto tracheale. Ventiquattro allevamenti sono risultati simultaneamente positivi all’ELISA e al test PCR [66,7%, intervallo di confidenza 95% (CI): 43,5-76,9%]. La prevalenza di M. synoviae tra gli animali è risultata in media pari al 40,3% (483/1.200), con valori tra 0,0% e 83,3% per allevamento. La prevalenza di allevamenti in cui sono stati trovati animali positivi a M. synoviae è stata determinata valutando i seguenti fattori di allevamento: densità dei polli, biosicurezza, ceppi del microrganismo, qualità dei pulcini, età dei locali ecc. I valori di prevalenza sono risultati significativamente più alti tra gli animali alloggiati in nuove strutture (meno di 3 anni) e nel periodo di produzione. L'alta prevalenza di infezione da M. synoviae rilevata in questo studio suggerisce la necessità di adottare adeguate misure di controllo.

93

Mycoplasma synoviae infection in Portuguese broiler breeders

Introduction Several mycoplasmas (genus Mycoplasma) are pathogens of mammals, birds, reptiles, fish, and arthropods, they cause a wide variety of diseases and mainly affect respiratory and genital tracts, as well as joints (Vogl et al. 2008). Infections with Mycoplasma gallisepticum and Mycoplasma synoviae are considered endemic in the poultry industry in several countries, where they cause considerable economic losses to heavy breeders, broilers, and layers (Kleven 2008, Noormohammadi 2007). The failure to eradicate M. gallisepticum and M. synoviae from commercial poultry flocks has been largely due to the ability of these organisms to establish lifelong infections and to spread both by horizontal and vertical transmission among their hosts (McAuliffe et al. 2006, Butcher and Jacob 2009). Mycoplasma synoviae most frequently occurs as a subclinical or inaparent infection of the upper respiratory tract. Nevertheless, this agent can also cause an infectious synovitis. In both cases, infection with M. synoviae might result in a decrease of egg production rate, growth and hatchability rates, and in a downgrading of carcasses at slaughter due to airsacculitis and arthritis (Fiorentin et al. 2003, Kleven 2003b, Peebles et al. 2011). In recent years, the occurrence of arthropathic and amyloidogenic strains of M. synoviae, as well as strains that induce eggshell apex abnormalities and egg production losses, has increased the economic impact of this pathogen (Feberwee et al. 2008). Mycoplasma synoviae can be found in eggs laid by infected breeders. Although this vertical transmission route is regarded as not very efficient, a higher shed of the organism may occur if immunosuppression factors are present (Behbahan et al. 2005, Dhondt et al. 2007). Diagnosis is based on epidemiological data, clinical signs, analysis of macroscopic lesions, specific serology, and isolation and molecular characterization of Mycoplasma spp. Monitoring must be part of control programs performed in breeder flocks and is mostly feasible by routine serology and polymerase chain reaction (PCR) (Feberwee et al. 2005, Luciano et al. 2011).

As data are lacking in Portugal, the aim of this study was to assess the prevalence of M. synoviae in different production systems of commercial poultry breeder flocks, by means of specific serology and PCR.

Materials and methods Flocks and birds A cross-sectional investigation was conducted between December 2008 and March 2012 to determine positivity to M. synoviae among

94

Moreira et al.

non‑vaccinated broiler breeder flocks. Among the 36 poultry farms under assessment in the present study, 8 were located in the North, 24 in the Center and 4 in South Portugal. The study area comprises more than 75% of the poultry business in the country. The number of flocks studied from each poultry farm varied between 2 and 4. The study was carried out in a total of 974,000 birds: 13 flocks were Ross 308 breeder (n = 385,000 birds), 20 were Cobb 500 breeder (n = 535,000) and 3 were Hubbard breeder (n = 54,000). Flock size ranged from 15,000 to 30,000 birds (average per flock: 27,000). A total of 1,200 serum samples were collected from the 36 breeder flocks. The sampled animals aged from 1 to 60 weeks. Serum samples were obtained in the rearing and production sites by collecting 30 to 70 samples per flock. This sample size has been based on an expected prevalence ranging from 5 to 15%, an accepted absolute error of 8-12% and a confidence level of 95% (Thrusfield 2007).

Flocks found seropositive were subject to PCR analysis. Samples of tracheal tissue were collected for PCR from freshly dead hens. Samples from at least 6 birds were pooled for analysis. Data on the health management and risk factors were recorded from all flocks.

Serology Blood samples (2 ml per bird) were asseptically collected from the wing veins. Serum samples were tested for antibodies to M. synoviae by an enzyme‑linked immunosorbent assay (ELISA), according to the manufacturer’s instructions (BioChek© MS Antibody Test Kit, Gouda, Holland). This serological kit uses a highly purified recombinant antigen protein, which is present in all known M. synoviae strains. The BioChek© MS Antibody Test Kit is highly sensitive for early detection of antibodies to M. synoviae (>98% sensitivity). Briefly, 100 µl of each serum sample diluted at 1:500 was tested. An undiluted and diluted control was distributed in duplicate in each plate. Samples are incubated for 30 minutes at 18-26 ºC. Antibodies to M. synoviae will bind and form an antigen-antibody complex.

Non-specific antibodies and other serum proteins are then washed away with 350 µl of distilled water (4 repeats). Anti-chicken immunoglobulin (Ig) G labelled with the enzyme alkaline phosphatase was then added to the wells and incubated for 30 minutes at 18-26 ºC. An additional wash was carried out to remove unreacted conjugate and then substrate added in the form of p-Nitrophenyl Phosphate chromogen followed by incubation for 15 minutes at 18-26 ºC. Reaction was quenched with 100 µl of stopping solution, a yellow colour developed in presence of antibodies to M. synoviae. Furthermore, the colour intensity directly relates to the amount of

Veterinaria Italiana 2015, 51 (2), 93-98. doi: 10.12834/VetIt.116.329.3

Moreira et al.

Mycoplasma synoviae infection in Portuguese broiler breeders

specific antibodies present. Absorbance or optical density values were measured at 650 nM.

Polymerace chain reaction Field samples were randomly collected from hens not more than 8 hours after natural dead and submitted to a commercial laboratory (Controlvet, Tondela, Portugal). Samples of tracheae (6 trachea portions from 6 birds per seropositive flock) were prepared for PCR as described by Ramírez (Ramírez et al. 2006). The amount of the macerate used was 25 mg. Afterwards, the macerate was transferred into the kit lysis buffer. Briefly, 900 ml of initial cell suspensions were centrifuged (12,000 × g, 4 ºC, 20 minutes) and the pellets were washed once in 500 µl of phosphate buffer saline (PBS) and resuspended in 20 µl PBS. Samples were heated at 95 ºC for 2 minutes. A forward primer (Ms2FF 5’-TAA AAG CGG TTG TGT ATC GC-3’) was used with a reverse primer (23SR 5’-CGC AGG TTT GCA CGT CCT TCA TCG3’) targeting the 23S rRNA gene. The concentration of primers was 20 µM. Reaction mixtures contained 2.5 U of Taq DNA polymerase (AB Gene), 0.2 µM of Ms2FF primer, 1 x reaction buffer, 1.75 mM MgCl2, 0.2 mM dNTPs, and water up to a volume of 50 µl.

One microliter of the template was added to the reaction. Amplification was achieved with a first step at 80 ºC for 30 seconds, 5 denaturation cycles at 94 ºC for 15 seconds, renaturation at 55 ºC for 30 seconds, and elongation at 72 ºC for 1 minute, followed by 30 cycles as previously described, but with an extension of 2 seconds per cycle in the elongation step. A 5µl amount of each amplified product was separated by electrophoresis on a 1.5% agarose gel.

Gels were stained with ethidium bromide (3 µg ml ) and observed under UV light. The positive control was DNA from a M. synoviae reference material (M. synoviae field isolate) and the negative control was water free from DNases and RNases, instead of the DNA sample. The size of the expected amplicon was 312 bp, which corresponds to the expected band visualized on agarose gel size. ‑1

Variables Number of birds: house capacity was between 10,000 and 25,000 or between 25,000 and 30,000 birds. The offspring quality was good, no sanitary problems were reported in the broiler houses nor was noted any bad offspring quality when sanitary problems were reported in the broiler houses. The broiler breeder strains considered in this study were: Ross, Cobb and Hubbard. As for the region, the poultry houses were located in the North, Center and South Portugal. All the considered premises were new or not older than 3 years and light control was either natural or artificial. The level of biosecurity varied

Veterinaria Italiana 2015, 51 (2), 93-98. doi: 10.12834/VetIt.116.329.3

depending on the respect of the relevant rules.

Medication (respiratory signs) were also considered, in cases in which during the flock life at least 1 medication focusing on respiratory signs had been reported and/or if at least 1 medication focuses on enteric or septicemic signs had been reported.

Other variables included in this study are: • mortality: flock total mortality less than 8% or equal/superior to 8%; • egg production: total egg production per hen less than the strain standard, equal to the strain standard or more than the strain standard; • hatchability: flock average hatchability at 60 weeks less than the strain standard, equal to the strain standard or more than the strain standard; • misshapen eggs: presence of misshapen eggs during flock life more than normal or normal; • site: rearing houses, period between 0 and 20 weeks, or production houses, period between 20 and 60 weeks.

As for the data analysis, Chi square and Fischer exact tests were used to compare percent results according to independent variables. Analyses were done with SPSS 19.0 software for Windows considering a probability (p) < 0.05 as statistically significant. Whenever appropriate, the exact binomial test established confidence intervals (CI) for the proportions with a 95% confidence level.

Results and discussion Four hundred and eighty-three birds (40.3%, 95% CI: 8.4-43.1) had antibodies to M. synoviae. Out of the 36, both ELISA and PCR found 24 positive flocks (66.7%, 95% CI: 43.5-76.9). Twelve flocks were considered negative, i.e. 5 flocks had seropositivity less than 15% and were PCR-negative, and in seven flocks all tested animals were seronegative. All the 24 flocks with seropositivity higher than 15% were PCR-positive. Table I summarizes these results.

Prevalence values were significantly higher among birds housed in new facilities, less than 3 years old (77.3%). Prevalence was also significantly higher in the production period (multi-age farms) (Table I).

This survey reveals a high prevalence of M. synoviae in broiler breeder commercial flocks. Positive birds, flocks and farms were found in all the assessed geographical regions of Portugal, which represent the core of the poultry industry in the country. At best of the author’s knowledge, no other studies on the prevalence of M. synoviae positive poultry farms or regarding different poultry categories in Portugal are currently available.

95

Mycoplasma synoviae infection in Portuguese broiler breeders

Moreira et al.

Table I. Prevalence of Mycoplasma synoviae infection in Portuguese broiler breeder flocks between December 2008 and March 2012.

Variable/category No. of birds Offspring quality

Strains

Region Premises’ age (years) Light Biosecurity Medication (respiratory signs) Medication (other signs) Mortality

Egg production

Hatchability

Misshapen eggs Site

10,000-25,000 25,000-30,000 Good Bad Ross Cobb Hubbard North Center/South 0-3 >3 Natural Artificial Good Bad Yes No Yes No <8% ≥8% < STD STD > STD < STD STD > STD Yes No Rearing Production

Flocks tested (n) 8 28 13 23 13 20 3 8 28 22 14 18 18 19 17 16 20 30 6 19 17 10 18 8 11 20 5 17 19 36 36

Relative distribution (%) 22.2 77.8 36.1 63.9 36.1 55.6 8.3 22.2 77.8 61.1 38.9 50 50 52.8 47.2 44.4 55.6 83.3 16.7 52.8 47.2 27.8 50 22.2 30.6 55.6 13.9 47.2 52.8 50.0 50.0

Positive (n) 7 17 7 17 9 13 2 7 17 17 5 11 13 15 9 9 15 20 4 12 12 6 13 5 9 11 4 13 11 3 24

Flock prevalence (%) 87.5 60.7 53.8 73.9 69.2 65.0 66.7 87.5 60.7 77.3* 35.7* 61.1 72.2 78.9 52.9 56.3 75.0 66.7 66.7 63.2 70.6 60.0 72.2 62.5 81.8 55.0 80.0 76.5 57.9 8.3*** 66.7***

95% CI (%) 47.3-99.7 40.6-78.5 25.0-80.8 51.6-89.8 38.6-90.9 40.8-84.6 9.4-99.2 47.3-99.7 40.6-78.5 46.5-85.1 12.8-64.9 35.7-82.7 46.5-90.3 54.4-93.9 27.8-77.0 29.9-80.2 50.9-91.3 47.2-82.7 22.3-95.7 38.4-83.7 44.0-89.7 26.2-87.8 46.5-90.3 24.5-91.5 48.2-97.7 31.5-76.9 28.4-99.5 50.1-93.2 33.5-79.7 1.8-22.5 49.0-81.4

* p = 0.013; *** p < 0.001 (only statistically significant differences are shown).

Mycoplasmas are important avian pathogens, which cause large economic losses in Portugal and worldwide. This investigation, regarding M. synoviae, one of the main species of mycoplasmas, was carried out in one of the most important stages of the poultry industry, i.e. broiler breeders (Kleven 2008). This type of birds stays long periods in the rearing and production sites. This means that they are exposed to several agents that interfere with their defense system and predispose them to infection. Very often, infections with M. synoviae are subclinical, but they still induce damage in the infected hosts and may cause immunosupression (Feberwee et al. 2008). If the vertical transmission characteristic of this pathogen is considered, the

96

detected high prevalence might imply a continuous dissemination within the broiler farms. This fact potentially amplifies the prevalence of infection and disease, with an impact on their effects on economical losses (Cobb 2011, Kleven 2003a, Stipkovits et al. 2012).

Despite the good level of biosecurity and stringent control of contact routes of Portuguese breeder farms, a considerably high prevalence of M. synoviae was found in this study. Therefore, probably culling M. synoviae-positive flocks is not a solution to reduce the risk of this Mycoplasma transmission, contradicting the conclusions of Buim and colleagues (Buim et al. 2009), such an approach is only sustainable if there is a low prevalence of

Veterinaria Italiana 2015, 51 (2), 93-98. doi: 10.12834/VetIt.116.329.3

Moreira et al.

M. synoviae. So, medication and vaccination may be good alternatives. In this survey, flocks not treated to clinical respiratory signs or other signs had the highest values of prevalence, but this difference was not statistically significant.

Prevalence results (66.7%) in the present study were higher in comparison with those from other studies.

In the Netherlands, Feberwee and colleagues (Feberwee et al. 2008) found a flock prevalence of 35%. A study in South America found a prevalence of 15% (Buim et al. 2009) and, in Middle East, (Amer et al. 2012) reported a prevalence rate at 27%. These values suggest that there is an increased prevalence of M. synoviae in breeder flocks.

According to Feberwee and colleagues (Feberwee et al. 2005) and Luciano and colleagues (Luciano et al. 2011), mycoplasmosis diagnosis based only on seroconversion may be inadequate. These authors suggest the adoption of other techniques to confirm the presence of the agent, PCR costs have been decreasing and made it attractive to be established as a routine confirmatory technique (Hammond et al. 2009).

The prevalence of M. synoviae positive farms was significantly higher in the production site than in rearing site. This fact suggests multi-age farms as the most important variable regarding infection. All the rearing and old production sites were single-age systems and new production sites were all multi‑age farms. The failure to eradicate M. synoviae in commercial poultry flocks is in part due to the ability of this organism to establish lifelong infections in their hosts and due to the physical design of the modern poultry premises (Kleven 2003b). Another plausible reason for these high values in the production site, when compared with the rearing one, is the fact that the immune system may be down-regulated due to stress factors in this phase.

In fact, stress factors in the production site, including male aggressions, intensive egg production and nutricional imbalance, can depress the immune system of the hen predisposing to infections such as that with M. synoviae (Peebles et al. 2011, Stanley et al. 2001, Xavier et al. 2011).

In the present study, the prevalence value was significantly higher among birds housed in new facilities (less than 3 year old). The construction of multi-age farms (farms with birds of different ages) and the pathogen’s ability to cause lifelong infections and spread by horizontal transmission

Veterinaria Italiana 2015, 51 (2), 93-98. doi: 10.12834/VetIt.116.329.3

Mycoplasma synoviae infection in Portuguese broiler breeders

may also have contributed to the high prevalence of infection. It is known that the distance between flocks can influence positivity to Mycoplasma among birds (Feberwee et al. 2005). The older facilities with lower biosecurity standards reveal better results, probably because of farm isolation.

It has been assumed that M. synoviae would spread quickly after introduction on a farm (Hartput et al.

1998, Landman and Feberwee 2008). These results suggest that the multi-age housing seen in the newest facilities is more important than facilities’ age or biosecurity. Therefore, multi-age farms pose a significant epidemiological risk.

Taking into account that breeders must be free of pathogenic agents, the high prevalence of M. synoviae is quite worrying. Vaccines are available, but vaccination is not yet common in Portugal.

Although very strict hygiene rules are being implemented, poultry farms built in the latest years are designed considering mainly an economical perspective and very rarely is disease prevention a primary consideration. The consequence is that farms have grown in size and density, and an ideal environment was created for agents as M. synoviae to thrive (Marois et al. 2005). Under these circumstances, it is necessary to determine new and more effective strategies to reduce losses due to Mycoplasma infections (Kleven 2003b).

Until recently, the economic impact of M. synoviae has been considered controversial. Economic loss reports increase every day, including eggshell pathology reports, and this fact develops awareness of poultry community all over the world (Catania et al. 2010, Landman and Feberwee 2008).

In conclusion, infections with M. synoviae are endemic in broiler breeder flocks in Portuguese poultry farms. This fact should alert animal health authorities to the economical impact of M. synoviae.

Strategies for the planning and construction of new poultry premises and a raising awareness should be put into practice among the poultry industry.

Acknowledgments The authors are grateful to Grupo Lusiaves and Controlvet for their support. This study was partially sponsored by the strategic research project Pest-OR/ AGR/UI0772/2011 financed by the Foundation for Science and Technology (FCT, Portugal).

97

Mycoplasma synoviae infection in Portuguese broiler breeders

Moreira et al.

References Amer M.M., Zohair G.A., EL-Bayomi Kh.M., Zeinab M.S. & Amin Girsh M.S. 2012. Effect of tilmicosin in control of Mycoplasmosis in broiler chickens from infected breeders using Elisa test for evaluation. J Am Sci, 8, 696-700.

Kleven S.H. 2003b. Mycoplasma synoviae infection. In Diseases of Poultry, 11th Ed. (Saif Y.M., Barnes H.J., Fadly A.M., Glisson J.R., McDougald L.R. & Swayne D.E., eds) Iowa press, Iowa, 756-766.

Behbahan N., Asasi K., Afsharifar A.R. & Pourbakhsh S.A. 2005. Isolation and detection of Mycoplasma gallisepticum by polymerase chain reaction and restriction fragment length polymorphism. Iran J Vet Res, 6, 35-41.

Kleven S.H. 2008. Control of avian mycoplasma infections in commercial poultry. Avian Dis, 52, 367-374.

Buim M.R., Mettifogo E., Timenetsky J., Kleven S. & Piantino F.A.J. 2009. Epidemiological survey on Mycoplasma gallisepticum and M. synoviae by multiplex PCR in commercial poultry. Braz J Vet Res, 29, 552-556.

Butcher G.D. & Jacob J.P. 2009. Respiratory diseases: common poultry diseases. Poult Sci, 47, 6-7.

Catania S., Dania Bilato A.C., Gobbo A.F., Granato A.A., Terregino A.C. & Iob A.L. 2010. Treatment of eggshell abnormalities and reduced egg production caused by Mycoplasma synoviae infection. Avian Dis, 54, 961-964.

Cobb S.P. 2011. The spread of pathogens through trade in poultry hatching eggs: overview and recent developments. Rev Sci Tech, 30, 165-175.

Dhondt A.A., Dhondt K.V., Hawley D.M. & Jennelle S. 2007.

Experimental evidence for transmission of Mycoplasma gallisepticum in house finches by fomites. Avian Pathol, 36, 205-208.

Feberwee A., Mekkes D.R., Klinkenberg D., Vernooij C.M., Gielkens L.J. & Stegeman J.A. 2005. An experimental model to quantify horizontal transmission of Mycoplasma gallisepticum. Avian Pathol, 34, 355-361.

Feberwee A., Mekkes D.R., de Wit J.J., Hartman E.G. & Pijpers A. 2005. Comparison of culture, PCR, and different serologic tests for detection of Mycoplasma gallisepticum and Mycoplasma synoviae infections.

Avian Dis, 49, 260-268.

Feberwee A., Vries T.S. & Landman W.J. 2008. Seroprevalence of Mycoplasma synoviae in Dutch commercial poultry farms. Avian Pathol, 37, 629-633.

Fiorentin L., Soncini R.A., Costa J.L., Mores M.A., Trevisol I.M. & Toda M. 2003. Apparent eradication of Mycoplasma synoviae in broiler breeders subjected to intensive antibiotic treatment directed to control Escherichia coli.

Avian Pathol, 32, 213-216.

Hammond P.P., Ramírez A.S., Morrow C.J. & Bradbury J.M. 2009. Development and evaluation of an improved diagnostic PCR for Mycoplasma synoviae using primers located in the haemagglutinin encoding gene vlhA and its value for strain typing. Vet Microbiol, 136, 61-68.

Hartput B.K., Mohammed H.O., Kollias G.V. & Dhondt A.A. 1998. Risk factors associated with mycoplasmal conjunctivitis in house finches. J Wildl Dis, 34, 281-288.

Kleven S.H. 1998. Mycoplasmas in the etiology of multifactorial respiratory disease. Poult Sci, 77, 1146-1149.

Kleven S.H. 2003a. Mycoplasmosis. In Diseases of Poultry, 11th Ed. (Saif Y.M., Barnes H.J., Fadly A.M., Glisson J.R., McDougald L.R. & Swayne D.E., eds) Iowa press, Iowa, 719-721.

98

Landman W.J. & Feberwee A. 2008. Field studies on the association between amyloid arthropathy and Mycoplasma synoviae infection, and experimental reproduction of the condition in brown layers. Avian Pathol, 30, 629-639.

Luciano R.L., Cardoso A.L., Stoppa G.F., Kanashiro A.M., Castro A.G. & Tessari E.N. 2011. Comparative study of serological tests for Mycoplasma synoviae diagnosis in commercial poultry breeders. Vet Med Int, 1, article ID 304349. doi:10.4061/2011/304349.

Marois C., Picault J.P., Kobisch M. & Kempf I. 2005.

Experimental evidence of indirect transmission of Mycoplasma synoviae. Vet Res, 36, 759-769.

McAuliffe L., Ellis R.J., Miles K. & Ayling R.D. 2006. Biofilm formation by mycoplasma species and its role in environmental persistence and survival. Microbiol, 152, 913-922.

Noormohammadi A.H. 2007. Role of phenotypic diversity in pathogenesis of avian mycoplasmosis. Avian Pathol, 36, 439-444.

Peebles E.D., Park S.W., Branton S.L., Gerard P.D. & Womack, S.K. 2011. Dietary poultry fat, phytase, and 25-hydroxycholecalciferol influence in the digestive and reproductive organ characteristics of commercial layers inoculated before or at the onset of lay with F-strain Mycoplasma gallisepticum. Poult Sci, 90, 797-803.

Ramírez A.S., Clive J.N., Hammond P.P. & Bradbury J.M. 2006. Development and evaluation of a diagnostic PCR for Mycoplasma synoviae using primers located in the intergenic spacer region and the 23 rRNA gene. Vet Microbiol, 118, 76-82.

Stanley W.A., Hofacre C., Speksnijder A.D., Kleven S.H. & Aggrey S.E. 2001. Monitoring Mycoplasma gallisepticum and Mycoplasma synoviae infection in breeder chickens after treatment with enrofloxacin. Avian Dis, 45, 534-539.

Stipkovits L., Glavits R., Palfi V., Beres A., Egyed L. & Denes B. 2012. Pathologic lesions caused by coinfection of Mycoplasma gallisepticum an H3N8 low pathogenic Avian Influenza Virus in chickens. Vet Pathol, 49 (2), 273-283.

Thrusfield M. 2007 Surveys. In Veterinary Epidemiology, 3rd Ed. (Thrusfield M., eds). Blackwell Scienece, Oxford, 228-242.

Vogl G., PLaickner A., Szathmary S., Stipkovit L., Rosengarten R. & Szostak M.P. 2008. Mycoplasma gallisepticum invades chicken erythrocytes during infection. Infect Immun, 76, 71-77.

Xavier J., Pascal D., Crespo E., Schell H.L., Trinidad J.A. & Bueno D.J. 2011. Seroprevalence of Salmonella and Mycoplasma infection in backyard chickens in the state of Entre Ríos in Argentina. Poult Sci, 90, 746-751.

Veterinaria Italiana 2015, 51 (2), 93-98. doi: 10.12834/VetIt.116.329.3

A diagnostic protocol to identify water buffaloes (Bubalus bubalis) vaccinated with Brucella abortus strain RB51 vaccine Manuela Tittarelli1, Marcello Atzeni1, Paolo Calistri1, Elisabetta Di Giannatale1, Nicola Ferri1, Enrico Marchi1, Alessandra Martucciello2 & Fabrizio De Massis1* 1

Istituto Zooprofilattico Sperimentale dell’Abruzzo e del Molise ‘G. Caporale’, OIE Reference Laboratory for Brucellosis, Campo Boario, 64100 Teramo, Italy.

2 Istituto Zooprofilattico Sperimentale del Mezzogiorno, Via Salute 2, 80055 Portici (NA), Italy. * Corresponding author at: Istituto Zooprofilattico Sperimentale dell’Abruzzo e del Molise ‘G. Caporale’, OIE Reference Laboratory for Brucellosis, Campo Boario, 64100 Teramo, Italy.

Tel.: +39 0861 332231, e-mail: f.demassis@izs.it.

Veterinaria Italiana 2015, 51 (2), 99-105. doi: 10.12834/VetIt.472.2296.3 Accepted: 21.11.2014 | Available on line: 16.06.2015

Keywords Brucella abortus, Brucellosis, Brucellin, Water Buffalo, Complement fixation test, Italy, RB51, Skin test, Vaccination.

Summary The use of live vaccine strain RB51 for vaccination of domestic water buffaloes (Bubalus bubalis) at risk of infection with Brucella abortus is permitted notwithstanding the plans for the eradication and only under strict veterinary control. The antibodies induced by RB51 vaccination are not detectable using conventional diagnostic techniques; therefore, it is necessary to have a specific diagnostic tool able to discriminate vaccinated from unvaccinated animals. The combination of a complement fixation test (CFT) with specific RB51 antigen (RB51-CFT) and a brucellin skin test has been demonstrated to be a reliable diagnostic system to identify single cattle (Bos taurus) vaccinated with RB51. So far, no data are available in the international scientific literature regarding the use of this test association in water buffalo. For this reason the suitability of this test combination has been evaluated in a water buffalo herd. One hundred twenty-seven animals farmed in a herd of Salerno province (Campania, Southern Italy), in the context of a presumptive unauthorized use of RB51 vaccine were chosen for this study. All tested animals resulted negative to Rose Bengal test (RBT) and complement fixation test (CFT) used for the detection of specific antibodies against Brucella field strains. Seventy-one animals (56%) developed RB51 antigen-specific CFT (RB51-CFT) antibodies against RB51 vaccine in a first sampling, while 104 animals (82%) gave positive result to a second serum sampling conducted 11 days after the intradermal inoculation of the RB51 brucellin. One hundred and seven animals (84%) showed a positive reaction to the RB51-CFT in at least 1 sampling, while 111 animals (87%) resulted positive to the RB51 brucellin skin test. Thus, analysing the results of the 3 testing in parallel, 119 animals (94%) were positive to at least 1 of the performed tests. The results suggest that the use in parallel of the RB51 brucellin skin test with RB51-CFT may represent a reliable diagnostic system to identify water buffaloes vaccinated with RB51 vaccine.

Un protocollo diagnostico per identificare bufali domestici (Bubalus bubalis) vaccinati con Brucella abortus ceppo RB51 Parole chiave Brucella abortus, Brucellina, Brucellosi, Bufalo domestico (Bubalus bubalis), Fissazione del complemento, Intradermoreazione, Italia, RB51, Vaccinazione.

Riassunto L'uso del vaccino vivo derivato dal ceppo RB51 di Brucella abortus in bufali domestici (Bubalus bubalis) a rischio di infezione può essere consentito in deroga al piano nazionale di eradicazione e solo sotto stretto controllo veterinario. Gli anticorpi vaccinali indotti da RB51 non sono rilevabili con le tecniche diagnostiche convenzionali, pertanto è necessario disporre di uno strumento diagnostico specifico in grado di discriminare gli animali vaccinati da quelli non vaccinati. La combinazione della prova di fissazione del complemento (CFT) con antigene specifico RB51 (RB51-CFT) con la prova di intradermoreazione alla brucellina ha dimostrato di essere un sistema diagnostico affidabile per identificare singoli bovini (Bos taurus) vaccinati con RB51. Non sono attualmente disponibili in letteratura scientifica dati sull'uso di questa associazione nel bufalo domestico. L'efficacia di questa combinazione di prove è stata, pertanto, valutata in un allevamento bufalino. Centoventisette animali allevati in un’azienda della provincia di Salerno (Campania, Italia meridionale), nel contesto di un

99

Identification of water buffaloes vaccinated with Brucella abortus strain RB51 vaccine

Tittarelli et al.

sospetto uso non autorizzato di vaccino RB51, sono stati selezionati per questo studio.

Tutti gli animali saggiati sono risultati negativi alla prova di sieroagglutinazione rapida con antigene Rosa Bengala (RBT) e alla prova di fissazione del complemento (CFT) utilizzato per l'individuazione di anticorpi specifici contro ceppi di campo di Brucella. Settantuno animali (56%) hanno sviluppato anticorpi specifici contro il vaccino RB51 rilevati mediante prova di fissazione del complemento specifica (RB51‑CFT) al prelievo iniziale, mentre 104 animali (82%) hanno fornito un risultato positivo alla prova RB51-CFT effettuata 11 giorni dopo la prova di inoculazione intradermica di brucellina RB51. Centosette animali (84%) hanno mostrato una reazione positiva alla RB51-CFT in almeno uno dei due prelievi, mentre 111 animali (87%) sono risultati positivi al test di intradermoreazione alla brucellina RB51.

Pertanto, analizzando i risultati delle tre prove in parallelo, 119 animali (94%) sono risultati positivi ad almeno una delle prove effettuate. I risultati suggeriscono che l'utilizzo in parallelo della prova RB51-CFT e della prova di intradermoreazione con brucellina RB51 può essere una combinazione diagnostica affidabile per identificare i bufali domestici vaccinati con il vaccino RB51.

Introduction Brucellosis is one of the most important zoonotic diseases worldwide and is responsible for heavy economic losses due to late term abortions, stillbirths, and parturition of weakly calves (Neta et al. 2010). The disease is also a serious public health problem wherever the infectious agent is present. In Italy, although a constant decrease of human cases has been observed in the last decade (from an incidence of 1.84 cases/100,000 inhabitants to 0.29 cases/100 000 inhabitants), brucellosis still remains one of the major zoonoses in 4 regions of Southern Italy (Campania, Apulia, Calabria, and Sicily), accounting for the 86% of all Italian cases1. A particular epidemiological situation is represented by the infection in domestic water buffalo (Bubalus bubalis), which is mostly farmed in Campania region, where the 73% (272,540 heads out of a total of 375,278 in Italy) of National stock of this species is farmed2. Historically, the most common strains isolated from water buffalo populations in Italy have been mainly Brucella abortus biovars 1, 3, 6 and Brucella melitensis biovar 3 (Di Giannatale et al.

2008). The objective of brucellosis eradication was introduced in the Italian legislation in 19943, when the vaccination of animals was forbidden and a test-and-slaughter strategy of seropositive animals was adopted. The main goal of the eradication plan was to achieve the officially brucellosis free (OBF) status for herds and territories. However, despite the application of eradication measures, the brucellosis epidemiological scenario in water buffalo of

Campania region, and especially in Caserta province, still remains problematic (Caporale et al. 2010). As a consequence, European and Italian authorities decided to adopt additional measures to face the persistence of infection and to reduce the impact of the disease in both human and animal health.

On 2 August 2007, and for the first time for water buffalo, the European Commission approved the use of B. abortus strain RB51 vaccine (RB51) under strictly controlled conditions for the immunization of animals at risk of infection with B. abortus in the Caserta province and in the surrounding areas with the highest incidence of brucellosis4.

RB51 is a genetically stable, rough mutant strain primarily produced by several passages of B. abortus smooth strain 2308 in media supplemented with sub‑inhibitory concentrations of rifampicin and penicillin (Schurig et al. 1991). This strain has proven safety and efficacy against abortion and infection in cattle (Cheville et al. 1996, Lord et al. 1998, Olsen 2000), although there are reports on abortions induced by RB51 vaccine in pregnant dairy cows (Yadzi et al. 2009).

However, preliminary studies conducted in Trinidad (Fosgate et al. 2003) found that the RB51 commercial vaccine, administered at the recommended calfhood dose, failed to protect water buffalo from infection following natural exposure to a wild strain of B. abortus biovar 1. To increase the efficacy of RB51 vaccine in buffalo, some authors proposed to immunize water buffalo using a vaccination protocol different from the one used in cattle. This

ttp://brucellosi.izs.it/brucellosi/ accessed on 31.12.2011. h Data acceded on 31.12.2011; http://statistiche.izs.it/portal accessed on 31.12.2011.

3 Italian Ministry of Health. 1994. Decree n. 651 of 27 August 1994. Regolamento concernente il piano nazionale per la eradicazione della brucellosi negli allevamenti bovini. Off J, 277, 26.09.1994.

4 European Commission (EC). 2007. Commission Decision 2007/561/EC of 2 August 2007 approving the amendment to the programme for the eradication of bovine brucellosis in Italy for the year 2007, approved by Decision 2006/875/EC, as regards buffalo brucellosis in Caserta, Region Campania. Off J, L 213, 15.08.2007.

1 2

100

Veterinaria Italiana 2015, 51 (2), 99-105. doi: 10.12834/VetIt.472.2296.3

Tittarelli et al.

Identification of water buffaloes vaccinated with Brucella abortus strain RB51 vaccine

protocol includes the vaccination of impuberal animals between the ages of 6 and 8 months with a first dose 3 times higher than the one used for cattle, followed by a second dose administered 1 month after the first administration (Iovane et al.

2007). This vaccinal scheme has been proved to be safe in young animals (Iovane et al. 2007) and to protect against infection caused by the wild type of B. abortus (Caporale et al. 2010).

It worthwhile noticing that when RB51 is used in adult buffaloes, it could be excreted in milk (Longo et al. 2009), and could induce abortion in pregnant females (Galiero 2009). RB51 is devoid of the lipopolissacaride (LPS) O-side chain (Schurig et al.

1991) and, therefore, the vaccination with this strain would not induce the production of antibodies detectable by the conventional brucellosis serologic tests listed by European legislation (Diptee et al.

2007, Schurig et al. 2002, Stevens et al. 1994, Stevens et al. 1995). This characteristic, even if useful for the differentiation of RB51 vaccinated animals from animals infected by B. abortus field strains, requires the availability of diagnostic tools specifically addressed to the detection of anti-RB51 antibodies (Tittarelli et al. 2008). In cattle, the tests useful for this purpose are a dot blot test (Olsen et al. 1997) and a complement fixation test (CFT) using specific RB51 antigen (RB51-FDC) (1, 2), Tittarelli and colleagues (Tittarelli et al. 2009) suggested that the gamma interferon test is not suitable for the detection of cattle vaccinated with RB51 at calfhood. In addition, the combination of RB51-CFT with a RB51 brucellin skin test has proven to be particularly effective in identifying animals vaccinated with RB51 vaccine (De Massis et al. 2005). To date, the use of these methods has been documented mainly in cattle.

The association of RB51-CFT with RB51 brucellin skin test has been implemented, in addition to a proper epidemiological investigation, by the Italian National Reference Centre for Brucellosis, Istituto Zooprofilattico Sperimentale dell’Abruzzo e del Molise ‘G. Caporale’ (IZSAM) in Teramo, to design a diagnostic protocol to be used by the National Veterinary Services when an illegal use of RB51 vaccine is suspected in cattle5. To these days, no data are available in international scientific literature on the use of this protocol in domestic water buffalo.

The aims of this paper are: • to report the results of the application of a diagnostic protocol based on the combination of RB51-CFT with a RB51 brucellin skin test, when applied to domestic water buffalo (Bubalus bubalis) suspected of having been vaccinated with RB51;

5

• to evaluate the suitability of this diagnostic protocol for the identification of water buffalo vaccinated with RB51 vaccine.

Materials and methods Herd tested The diagnostic protocol was applied to a buffalo herd in the Salerno province (Campania Region, Italy) after the isolation of RB51 from a lymph node sampled from a serologically negative buffalo at slaughter. The herd was under the control of the veterinary services due to an outbreak of bubaline brucellosis in which B. abortus had been isolated. At the time of isolation of strain RB51, no vaccination against buffalo brucellosis was officially approved in Salerno province. According to national rules on brucellosis eradication, all animals which resulted positive to the classical serological test for brucellosis (RBT and CFT) had already been slaughtered and the herd was awaiting the restoring of the Officially-free status for the disease after a first negative result on a whole herd testing with RBT and CFT. The isolated strain has been identified by PCR‑RFLP (Restriction Fragment Length Polymorphism) performed by the National Reference Laboratory brucellosis in IZSAM, according to the method described in the chapter 2.4.3 of OIE Manual of diagnostic tests and vaccines for terrestrial animals.

Diagnostic protocol According to the diagnostic protocol, all animals in the herd aged more than 12 months (127 heads) were tested to confirm the suspicion of unauthorized use of RB51, as follows: • intradermal injection of 0.1 ml of RB51 brucellin produced in accordance with the method described by De Massis and colleagues (De Massis et al. 2005) for cattle, and simultaneous collection of blood samples to be tested by a CFT with specific RB51 antigen (CFT-RB51) (sampling time: t0); • collection of an additional blood sample, 11 days after brucellin RB51 inoculation to be tested by CFT-RB51 (t1), as described for cattle by De Massis and colleagues (De Massis et al. 2005).

Animals resulted positive to RB51-CFT (at t0 or t1) and/or to the brucellin intradermal reaction were considered as vaccinated with RB51. All animals were also tested with RBT and CFT both at sampling time t0 and t1.

Istituto Zooprofilattico Sperimentale dell’Abruzzo e del Molise ‘G. Caporale’. Centro di Referenza Nazionale per le Brucellosi. 2010. Protocollo per la gestione di un allevamento in cui si sospetti vaccinazione con vaccino RB51 per brucellosi. brucellosi.izs.it/brucellosi/common/mostra_articolo.do?id=172.

Veterinaria Italiana 2015, 51 (2), 99-105. doi: 10.12834/VetIt.472.2296.3

101

Identification of water buffaloes vaccinated with Brucella abortus strain RB51 vaccine

Sample collection Blood samples were collected via coccygeal venipuncture from local veterinary services in sterile vacutainer tubes without anticoagulant. Samples were refrigerated without delay and were kept at +4°C during transport and dispatched within 24 hours to the National Reference Laboratory for Brucellosis, IZSAM.

Serological tests All serum samples were tested for anti-B. abortus and anti-RB51 antibodies. Rose Bengal test (RBT) and CFT, both performed according to the methods described in chapter 2.4.3 of the OIE Manual of diagnostic tests and vaccines for terrestrial animals5, were used for anti-B. abortus antibody detection.

Presence of anti-RB51 antibodies was evaluated using an RB51 antigen-specific CFT (RB51-CFT), as previously described (Adone and Ciuchini 1999, Adone et al. 2001). A dilution of 1:4, showing 100% fixation, was considered as threshold for positivity.

Eleven days after the first blood sampling all animals were bled and tested again with the same serological tests.

Skin test In each tested animal, 10 cm2 of healthy clean skin on left shoulder was shaven with scissors. A tuberculin syringe was used to inject 0.1 ml of RB51 brucellin intradermally. Before injection, the skin thickness was measured and registered for each animal. The skin reaction was evaluated 72 hours after the inoculation, by measuring the difference of the skin thickness at the injection site. A spring meter (Aesculap) was used to measure the skin thickness.

An increase of at least 1.5 mm was considered as a positive result.

The statistical correlation between the RB51-CFT antibody titres before and after brucellin inoculation was measured using the Spearman’s rank correlation coefficient (Spearman’ r). Calculations were performed using Xlstat® software, a Microsoft® Excel® add-in.

Results and discussion The results of the serological tests are presented in Table I. Sera from all tested animals gave always negative results to RBT and to CFT tests for antibodies against field strains of B. abortus.

A total of 71 animals (56%) and 104 animals (82%) gave a positive response to serological CFT-RB51 at t0 and t1 time, respectively.

Overall, 107 buffalos (84%) showed a positive reaction to RB51-CFT in at least 1 sampling, whereas 111 animals (87%) gave a positive reaction to RB51 brucellin skin test (Table II).

Combining in parallel the results obtained to RB51CFT and RB51 brucellin skin test, 119 animals (94%) resulted positive to at least 1 of the performed diagnostic tests; in particular, 99 animals (78%) were positive on both diagnostic tests, 12 animals (10%) were positive only to RB51 brucellin skin test, and 8 animals (6%) showed a positive reaction only to RB51-CFT. Eight animals (6%) were negative to both diagnostic tests (Table II). The mean and standard deviation of skin thickness values observed after 72 hours post inoculation are reported in Figure 1.

Table III presents the results of RB51-CFT before and after RB51 brucellin inoculation, in comparison with the results of the latter test. Twenty animals (16%) showed negative results to RB51-CFT on both samplings, whereas 12 of these animals reacted to RB51 brucellin skin test. Thirty-six animals (28%) with negative results to RB51-CFT at t0 sampling developed a serological positive (anamnestic) response to RB51‑CFT after RB51 brucellin inoculation.

The increase of RB51-CFT antibody titre after brucellin inoculation was evaluated using the Wilcoxon test for paired samples (Siegel and Castellan 1988).

A statistically significant increase of the number of samples positive to RB51-CFT has been observed at t1 (Wilcoxon T = 1618.000; 1-tailed p = 0.000013), especially evident at dilutions between 1:4 and 1:16 (Figure 2).

Table I. Results of serological tests (number of positive on tested) carried out on 127 water buffaloes (Bubalus bubalis) on samples collected on the day of RB51 brucellin inoculation (t0) and 11 days after (t1).

Table II. Overall results of the association in parallel of Complement Fixation test using the RB51 antigen (RB51-CFT) conducted at t0 and t1 time and the RB51 brucellin skin test conducted at t0 time.

Statistical analysis

Sampling time Day 0 (t0) Day 11 (t1)

RBT* 0/127 0/127

CFT* 0/127 0/127

RB51-CFT* 71/127 104/127

RBT = Rose Bengal test; CFT = complement fixation test; RB51-CFT = RB51 complement fixation test; * number of positive animals on total tested; (t0) = day of 1st sampling; (t1) = day of 2nd sampling.

102

Tittarelli et al.

RB51-CFT

Positive Negative Total

RB51 Brucellin Positive Negative 99 8 12 8 111 16

Total 107 20 127

Veterinaria Italiana 2015, 51 (2), 99-105. doi: 10.12834/VetIt.472.2296.3

Tittarelli et al.

Identification of water buffaloes vaccinated with Brucella abortus strain RB51 vaccine

60

23,000

56

t0 sampling

51

50

t1 sampling

20

Number of animals

Value of skin thickening (mm)

25

15

10

9,278 8,700

29

30 23

72h post inoculation with RB51 brucellin(PBI)

Figure 1. Mean, maximum value, minimum value, 25th percentile, and 75th percentile of RB51 brucellin skin test results in 127 animals, tested with RB51 brucellin skin test at t0 time.

Table III. Comparison of the results of RB51-Complement fixation test (CFT) conducted at t0 and t1 time and the RB51 brucellin with skin test results conducted at t0 time.

N P Total

NN 8 12 20

NP 0 36 36

RB51-CFT PN PP 1 7 2 61 3 68

Total 16 111 127

N = negative to RB51 brucellin skin test; P = positive to RB51 brucellin skin test; NN = negative to RB51-CFT at both samplings; NP = negative to RB51-CFT at t0 sampling, positive at t1 sampling; PN = positive to RB51-CFT at t0 sampling, negative at t1 sampling; PP = positive to RB51-CFT at both samplings.

In addition, the RB51-CFT titres before and after the inoculation of brucellin were significantly correlated (Spearman r = 0.545, p < 0.0001).

The brucellosis vaccine which is employed in buffalo worldwide is B. abortus strain 19. However, the use of this vaccine leads to the production of antibodies that are detectable by the official tests used for the diagnosis of brucellosis in the context of national control and eradication plans (Caporale et al. 2010). Brucella abortus strain RB51 vaccine has been developed for use in cattle and could be preferred to B. abortus strain 19 vaccine for its negligible interference with diagnostic serology (Diptee et al. 2007, Schurig et al. 2002, Stevens et al. 1994, Stevens et al. 1995). Nonetheless, when a strict test and slaughter policy is applied in a country or zone and the application of vaccines is, therefore, not allowed, the illegal use of vaccines is of particular concern. Indeed, the fraudulent use of a live vaccine could also be a serious public health problem. In particular, RB51 could infect humans and it is highly resistant to rifampicin, one of the antibiotics of choice for the treatment of human brucellosis. It is also worth stressing

Veterinaria Italiana 2015, 51 (2), 99-105. doi: 10.12834/VetIt.472.2296.3

20

20

0

2,700

RB51Brucellin

35

15

10

5

0

40

8

6

6 1

Neg

1:4

1:8

1:16

1:32

2

1:64

1

1

1:128

RB51-CFT Titre

Figure 2. RB51-Complement fixation test (CFT) antibody response prior (t0) and after (t1) intradermal inoculation of RB51 brucellin. that the diagnosis of the infection produced by RB51 requires special tests not available in most hospitals (Tittarelli et al. 2008). In addition, field trials indicated that RB51 could be excreted in milk of buffalo vaccinated as adults (Longo et al. 2009) and that it could induce abortion if consumed by pregnant women (Galiero 2009). Therefore, the availability of a reliable diagnostic tool to identify animals vaccinated with RB51 is necessary.

Considering that the possibility of using of the RB51–CFT to identify cattle vaccinated at calfhood is limited in terms of time, and considering the low sensitivity of the RB51 skin test when used alone, De Massis and colleagues (De Massis et al. 2005) suggested the use of RB51 skin test and RB51-CFT in parallel to correctly identify all vaccinated animals.

The association of these tests has been used by the Italian National Reference Centre for Brucellosis (IZSAM) along with a proper epidemiological investigation, to design an official diagnostic protocol to be applied when an illegal use of RB51 vaccine is suspected in cattle.

Actually, this type of findings has not been previously reported for water buffalo, but only for vaccinated cattle. However, the results of this field study suggest the suitability of the diagnostic protocol also when applied in water buffalo. Following RB51 brucellin inoculation in the study animals, the serological test RB51-CFT is able to reveal a significant greater number of positive animals, discovering those vaccinated heads not reacting to the serological tests at t0. The increase of sensitivity of this diagnostic protocol, with respect to the use of the single test alone, is due to the specific and anamnestic humoral response elicited by the use of RB51 brucellin, which represents the evidence of previous vaccine administration.

Results from this field study show that 71 animals (56%) and 104 animals (82%) developed specific

103

Identification of water buffaloes vaccinated with Brucella abortus strain RB51 vaccine

antibodies against RB51 vaccine, which were revealed with the RB51 antigen-specific CFT (RB51‑CFT), before and after intradermal inoculation of the RB51 brucellin, respectively. The classical tests (RBT and CFT) performed at t0 and t1 (i.e. before and after brucellin inoculation) resulted negative, therefore suggesting that animals with latent infection were no longer present in the herd under study and the reactions against brucellin were caused by vaccination.

One hundred and seven animals (84%) showed a positive reaction to the RB51-CFT in at least 1 sampling, while 111 animals (87%) resulted positive to the RB51 brucellin skin test. Thus, analysing the results of the 2 testing in parallel, 119 animals (94%) were positive to at least 1 of the performed tests. The application of a single test alone would have revealed a lesser proportion of vaccinated

104

Tittarelli et al.

animals. In particular, 36 animals (28%) of the total number of animals identified as positive (Table III) developed a serological response to RB51-CFT after RB51 brucellin inoculation and all of them were also positive to the RB51 brucellin skin test (Table III).

Furthermore, many of the inoculated animals showed an increase of volume of prescapular lymph nodes located near the site of inoculation. The value of skin thickening observed (Figure 1) revealed the presence of a strong cell-mediated immune response against B. abortus RB51 in accordance with a previous study (Iovane et al. 2007).

The results of the present study suggests that the use of a diagnostic protocol based on the parallel application of a RB51 skin test and a RB51-CFT assays could be a reliable diagnostic system able to identify water buffalo vaccinated with RB51.

Veterinaria Italiana 2015, 51 (2), 99-105. doi: 10.12834/VetIt.472.2296.3

Tittarelli et al.

Identification of water buffaloes vaccinated with Brucella abortus strain RB51 vaccine

References Adone R. & Ciuchini F. 1999. Complement fixation test to assess humoral immunity in cattle and sheep vaccinated with Brucella abortus RB51. Clin Diagn Lab Immunol, 6, 787-790.

Adone R., Ciuchini F & Olsen S. 2001. Field validation of the use of RB51 as antigen in a complement fixation test to identify calves vaccinated with Brucella abortus RB51.

Clin Diagn Lab Immunol, 8, 385-387.

Caporale V., Bonfini B., Di Giannatale E., Di Provvido A., Forcella S., Giovannini A., Tittarelli M. & Scacchia M. 2010. Efficacy of Brucella abortus vaccine strain RB51 compared to the reference vaccine Brucella abortus strain 19 in water buffalo. Vet Ital, 46, 13-19.

Cheville N.F., Olsen S.C., Jensen A.E., Stevens M.G., Palmer M.V. & Florance A.M. 1996. Effects of age at vaccination on efficacy of Brucella abortus RB51 to protect cattle against brucellosis. Am J Vet Res, 57, 1153-1156.

De Massis F., Giovannini A., Di Emidio B., Ronchi G.F., Tittarelli M., Di Ventura M., Nannini D. & Caporale V. 2005. Use of complement fixation and brucellin skin test to identify cattle vaccinated with Brucella abortus strain RB51. Vet Ital, 41 (4), 281-290.

Diptee M.D., Asgarali Z., Campbell M., Fosgate G. & Adesiyun A.A. 2007. Post-exposure serological and bacteriological responses of water buffalo (Bubalus bubalis) to Brucella abortus biovar 1 following vaccination with Brucella abortus strain RB51. Rev Sci Tech, 26, 669-678.

Di Giannatale E., De Massis F., Ancora M., Zilli K. & Alessiani A. 2008. Typing of Brucella field strain isolated from livestock populations in Italy between 2001 and 2006.

Vet Ital, 44, 383-388.

Fosgate G.T., Adesiyun A.A., Hird D.W., Johnson W.O., Hietala S.K., Shurig G.G., Ryan J. & Diptee M.D. 2003.

Evaluation of brucellosis RB51 vaccine for domestic water buffalo (Bubalus bubalis) in Trinidad. Prev Vet Med, 15, 211-225.

Galiero G. 2009. Innocuità del vaccino Brucella abortus RB51 nella bufala mediterranea. Large Anim Rev, 15 (1), 19-22.

Iovane G., Martucciello A., Astarita S., Galiero G., Pasquali P., Adone R., Ciuchini F., Pagnini U., Guarino A. & Fusco G. 2007. Vaccino Brucella abortus RB51 – Primi risultati sull’innocuità ed attività immunogena nella bufala mediterranea. Progresso Veterinario, 62 (1), 19-21.

Longo M., Mallardo K., Montagnaro S., De Martino L., Gallo S., Fusco G., Galiero G., Guarino A., Pagnini U. & Iovane G. 2009. Shedding of Brucella abortus rought mutant strain RB51 in milk of water buffalo (Bubalus bubalis).

Prev Vet Med, 90, 113-118.

Veterinaria Italiana 2015, 51 (2), 99-105. doi: 10.12834/VetIt.472.2296.3

Lord V.R., Schuring G.G., Cherwonogrodzky J.W., Marcano M.J. & Melendez G.E. 1998. Field study of vaccination of cattle with Brucella abortus strains RB51 and 19 under high and low prevalence. Am J Vet Res, 59, 1016-1020.

Neta A.V.C., Mol J.P.S., Xavier M.N., Paixao T.A., Lage A.P. & Santos R.L. 2010. Pathogenesis of bovine brucellosis.

Vet J, 184, 146-155.

Olsen S.C., Stevens M.G., Cheville N.F. & Schurig G. 1997.

Experimental use of a dot-blot assay to measure serologic responses of cattle vaccinated with Brucella abortus strain RB51. J Vet Diagn Invest, 9, 363-367.

Olsen S.C. 2000. Immune responses and efficacy after administration a commercial Brucella abortus strain vaccine in cattle. Vet Ther, 1, 183-191.

Siegel S. & Castellan N.J. 1988. Non parametric statistics for the behavioral sciences, 2nd Ed. McGraw-Hill Book Co., Statistics Series, New York, 399 pp.

Schurig G.G., Roop R.M., Bagchi T., Boyle S., Buhrrman D. & Sriranganathan N. 1991. Biological properties of RB51; a stable rough strain of Brucella abortus. Vet Microbiol, 28, 171-188.

Schurig G.G., Sriranganathan N. & Corbel M.J. 2002.

Brucellosis vaccines: past, present and future. Vet Microbiol, 90, 479-496.

Stevens M.G., Hennager S.G., Olsen S.C. & Cheville N.F. 1994. Serologic responses in diagnostic tests for brucellosis in cattle vaccinated with Brucella abortus 19 or RB51. J Clin Microbiol, 32, 1065-1066.

Stevens M.G., Olsen S.C. & Cheville N.F. 1995. Comparative analysis of immune responses in cattle vaccinated with Brucella abortus strain 19 or strain RB51. Vet immunol Immunopathol, 44, 223-235.

Tittarelli M., Bonfini B., De Massis F., Giovannini A., Di Ventura M., Nannini D. & Caporale V. 2008. Brucella abortus strain RB51 vaccine: immune respone after calfhood vaccination and field investigation in Italian cattle population. Clin Develop Immunol.

10.1155/2008/584624.

Tittarelli M., De Massis F., Bonfini B., Di Ventura M & Scacchia M. 2009. An ELISA for the evaluation of gamma interferon production in cattle vaccinated with Brucella abortus strain RB51. Vet Ital, 45, 355-361.

Yazdi H.S., Kafi M., Haghkhan M., Tamadon A., Behroozikhah A.M. & Ghane M. 2009. Abortion in pregnant dairy cow after vaccination with B. abortus strain RB51. Vet Rec, 165, 570-571.

105

Reorganization of actin cytoskeleton in L929 cells infected with Coxiella burnetii strains isolated from placenta and foetal brain of sheep (Sardinia, Italy) Gabriella Masu1, Rosaura Porcu1, Valentina Chisu1, Antonello Floris2 & Giovanna Masala1* 1

Istituto Zooprofilattico Sperimentale della Sardegna, Via Duca degli Abruzzi 8, 07100 Sassari, Italy.

2 Dipartimento di Medicina Veterinaria, Università di Sassari, Via Vienna 2, 07100 Sassari, Italy.

* Corresponding author at: Istituto Zooprofilattico Sperimentale della Sardegna, Via Duca degli Abruzzi 8, 07100 Sassari, Italy.

Tel.: +39 079 2892325, e‑mail: giovanna.masala@izs‑sardegna.it.

Veterinaria Italiana 2015, 51 (2), 107-114. doi: 10.12834/VetIt.51.3542.1 Accepted: 27.12.2014 | Available on line: 30.06.2015

Keywords Actin cytoskeleton, Confocal fluorescence microscope, Coxiella burnettii strains, Phagocytosis, Q Fever.

Summary Coxiella burnetii, the etiological agent of Q Fever, is a zoonotic pathogen distributed worldwide. It has been reported that virulent strains of C. burnetii are poorly internalized by monocytes compared to avirulent variants. Virulence is also associated to the formation of pseudopodal extensions and transient reorganization of filamentous actin. In this article, we investigated the ability of 2 Coxiella strains isolated from ovine aborted samples to induce reorganization of the actin cytoskeleton in mouse fibroblast cells. Cells were exposed for 24 and 48 hours to ovine placenta and foetal brain tissue homogenates and then analysed by polymerase chain reaction (PCR) in order to detect Coxiella infection. The formation of pseudopodal extensions, the polarized distribution of F‑actin, and the involvement of C. burnetii strain in cytoskeleton reorganization have been assessed using a laser scanning confocal fluorescence microscope. Results indicate that similarly to the virulent reference strain, strains of C. burnetii isolated from foetal brain induced morphological changes – modification in F‑actin distribution and in the localization of bacteria. By contrast, C. burnetii strain isolated from ovine placenta did not induce any significant change in L929 cell morphology. In conclusion, both C. burnetii strains isolated from ovine placenta and foetal brain were pathogenic causing ovine abortion, but in vitro the C. burnetii strain isolated from brain only was able to induce F‑actin reorganization in L929 infected cells.

Riorganizzazione dell’actina del citoscheletro in cellule L929 infettate con ceppi di Coxiella burnetii isolati da placenta di pecora e cervello fetale ovino (Sardegna, Italia) Parole chiave Actina del citoscheletro, Ceppi di Coxiella burnetii, Fagocitosi, Febbre Q, Microscopio confocale a fluorescenza.

Riassunto Coxiella burnetii, l’agente eziologico della Febbre Q, è un patogeno zoonotico presente in tutto il mondo. È stato riportato che l’internalizzazione dei ceppi virulenti è meno efficiente rispetto ai ceppi avirulenti. La virulenza di un ceppo è stata anche associata alla capacità di formare pseudopodi e di riorganizzare in modo transitorio l'actina del citoscheletro cellulare.

In questo lavoro, è stata studiata la capacità di due ceppi di Coxiella isolati da aborti ovini di indurre la riorganizzazione di dell’actina del citoscheletro in cellule di fibroblasto di topo. Le cellule sono state infettate per 24 e 48 ore con omogenati di placenta e cervello e sottoposte a PCR per valutare l’infezione di Coxiella. Inoltre, tramite microscopio confocale a fluorescenza è stata valutata l'abilità di alcuni ceppi di Coxiella burnetii di formare pseudopodi, di localizzare l'acina F polarizzata e riorganizzare il citoscheletro cellulare. I risultati indicano che il ceppo di C. burnetii, similmente al ceppo virulento di riferimento, isolato dal campione di cervello di feto ovino induceva modificazioni morfologiche (modificazioni nella distribuzione dell’actina e nella localizzazione batterica). Al contrario, il ceppo di C. burnetii isolato dalla placenta ovina non ha indotto alcun cambiamento significativo nelle cellule L929. In conclusione, entrambi i ceppi di C. burnetii isolati dalla placenta ovina e dal cervello fetale ovino sono stati in grado di causare aborti ovini ma, in laboratorio, il ceppo isolato dal cervello fetale è stato l'unico capace di riorganizzare l'actina F nelle cellule L929 infettate.

107

Cytoskeleton reorganization by C. burnetii strains isolated from ovine abortion

Introduction Coxiella burnetii (C. burnetii) is a gram‑negative obligate intracellular acidophile bacterium that is highly adapted to live within the eukaryotic phagolysosome (Maurin Raoult 1999, Mege et al.

1997). It is the etiological agent of Q Fever, a pathology characterized by acute and chronic courses. Recently, C. burnetii has been propagated in axenic media, thus it is not considered an obligatory intracellular bacterium anymore (Omsland et al. 2011). Infections with this zoonotic pathogen occur worldwide. In human, the main route of infection is inhalation of contaminated aerosol or dust containing bacteria shed by infected animals through milk, faeces, vaginal or placenta secretions during animal birthing (Arricau‑Bouvery and Rodolakis 2005, Arricau‑Bouvery et al. 2006, Rodolakis 2009). Both the high concentration of infectious organisms released at parturition and the remarkable resistance of the organism to environmental extremes underlie the heavy environmental contamination associated with parturient livestock. Concerning its pathogenicity, it seems that it varies according to country, region, climate, type of animal, system of management and other circumstances, including virulence of the agent (Agerholm 2013).

Different virulence levels of infections have been observed but it is still not clear whether disease severity is the result of a variability in bacterial virulence factors or depends on the immunological background of the host (Arricau‑Bouvery et al. 2006).

The antigenic variation, also known as phase variation, is one of the most important aspects of C. burnetii. In Phase I, organisms isolated from acutely infected animals, arthropods or humans express a wild virulent form, characterised by smooth full‑length lipopolysaccharide (LPS).

Avirulent Phase II bacteria show a truncated, rough LPS molecule. Differences in surface protein composition, surface charge, and cell density may also be detected. Transition from virulent Phase I to an avirulent Phase II requires several serial passages in embryonated eggs or cell cultures (Hotta et al.

2002, Marrie 2000).

Coxiella burnetii enters monocytes/macrophages, the only known target cells, by phagocytosis that differs in Phase I and Phase II cells (Angelakis and Raoult 2010). Coxiella burnetii virulence depends on its ability to enter macrophages and to escape from their microbicidal activity. Virulent strains increase their content in filamentous actin (F‑actin) and induce its intense and transient rearrangement. As the phagocytosis of virulent C. burnetii is associated with the formation of pseudopodal extensions and polarized distribution of F‑actin (Ghigo et al. 2002, Ghigo et al. 2009), we have characterized the isolates

108

Masu et al.

by assessing F‑actin localization in cytoskeleton reorganization. The objective of this paper is to determine the virulence of C. burnetii strains isolated from placenta and brain of sheep abortion in Sardinia, Italy, by comparison with a virulent reference strain of C. burnetii. For this purpose, we evaluated the effect of isolated strains on reorganization of host actin cytosckeleton during infection.

Materials and methods Preparation of clinical samples, DNA isolation and PCR Ovine placental and foetal brain tissue samples collected from 2 sheep aborted foetuses collected during a Q fever outbreak which occurred in Sardinia in 2012 were used to discriminate among C. burnetii isolates. Samples were washed with sterile phosphate‑buffered saline (PBS, 0.1M phosphate, 0.33 M NaCl), pH 7.2 containing 1,000,000 units/ml of penicillin G sodium salt (Fluka‑Sigma‑Aldrich, St. Louis, Mi, USA), and 1,000,000 units/ml of streptomycin sulphate salt (Fluka‑Sigma‑Aldrich, St. Louis, Mi, USA). They were then digested for 3 hours at 37°C with 0.6% and 2% trypsin solutions (Difco, Detroit, Mi, USA), respectively. Digested tissues were filtered with an aseptic gauze and centrifuged at 6,000 x g for 10 min. DNA extraction was then performed using a DNeasy Blood & Tissue kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions.

Polymerase chain reaction (PCR) was performed to evaluate the presence of C. burnetii, using the GeneAmp PCR System 9700 (Applied Biosystems, Foster City, CA, USA). The assay amplified specifically a 257 bps region within the superoxide dismutase (SOD) gene (F: 5’‑ACTCAACGCACTGGAACCGC‑3’; R: 5’‑TAGCTGAAGCCAATTCGCC‑3’) of C. burnetii (Stein and Raoult 1992). Positive control DNAs were also extracted from C. burnetii (Nine mile/I/ EP1). Water samples were included in all amplifications as a negative control; PCR products were resolved on a 1.5% agarose gel in TAE buffer (0.04 M Tris/acetate, 0.001 M EDTA). After electrophoresis at 100 V for 60 min, gels were stained with ethidium bromide and examined over UV light.

Infection of L929 cells with C. burnetii from reference strain, placenta and brain homogenates Coxiella burnetii (Nine Mile/I/EP 1) and pellet of digested tissue samples were propagated in mouse fibroblast cells (L‑929; ECACC n°85011425) at a bacterium‑to‑cell ratio of 200:1 as described

by Meconi and colleagues (Meconi et al., 1998) and cultured in DMEM (Dulbecco’s modified eagle

Veterinaria Italiana 2015, 51 (2), 107-114. doi: 10.12834/VetIt.51.3542.1

Masu et al.

Cytoskeleton reorganization by C. burnetii strains isolated from ovine abortion

medium, Gibco‑Life Tecnologies, Eragny, France) supplemented with 4% foetal bovine serum and cultivated at 37°C in an atmosphere containing 5% CO2 into 25 cm2 tissue culture flasks containing a semi‑confluent monolayer of L929 cells at an initial density of 4x105 cells/ml. The culture medium was replaced daily with fresh medium. The vitality of organisms was assessed by observing the characteristic motility of bacteria into vacuoles per cell with an inverted optic microscope (40X) after 24 and 48 hours from infection. Moreover, PCR was performed in order to support the culture infection.

All other methods pertaining to the cell culture have been implemented in accordance with established procedures. All the propagative methods and those related to the manipulation of the reference strain, placentas, and foetal brain tissues from domestic ruminant were performed under Biosafety level 3 (BSL3) conditions.

Laser scanning confocal fluorescence microscopy analysis Cells cultured for 24 and 48 hours were displaced into chamber slide, fixed with 4% paraformaldehyde (pH 7.3‑7.4), and incubated over night at room temperature. Cells were then permeabilized with 0.1% saponin (Fluka‑Sigma‑Aldrich, St. Louis, Mi, USA) in phosphate buffered saline (PBS) containing 10% horse serum (Invitrogen, Carlsbad, CA, USA) for 30 min at room temperature. Cells were rinsed with PBS 3 times. In order to detect a possible reorganization of F‑ actin induced by C. burnetii, L929 cells were incubated with a mix of 10 U/ml Alex fluor 555 phalloidin for F‑actin intracellular distribution staining and 0,1mg/ ml of DAPI (Molecular Probes, Eugen, Oregon, USA) for nucleus staining at 37°C for 30 minutes in the dark. In addition, for bacteria localization, cells were incubated with 500 µl of anti‑Coxiella positive human serum (QGP‑110927, Fuller Laboratories, Fullerton, CA, USA) at 37°C for 30 minutes. Coxiella burnetii was

a

b

revealed by using 100 µl of fluorescein‑coniugated goat anti‑human immunoglobulin serum (KPL).

Thereafter, cells were washed, mounted with Mowiol (Calbiochem, San Diego, CA, USA) and stored at 4°C in the dark. Samples were then examined with a laser scanning confocal fluorescence microscope (LAS AF, Leica Microsystem‑Application Suite Advanced Fluorescence).

Results After 24 hours from infection, control cells were vigorously grown as colonies and were confluent (Figure 1a) conversely, about 80% of cells infected with C. burnetii Nine Mile I showed a cytopathic effect characterized by increased size with membrane extensions and polartised protrusions. The growth was inhibited and numerous cells were detached from the monolayer and floating in the medium (Figure 1b). Cells infected with C. burnetii strains isolated from placenta and brain tissues did not show morphological modifications after 24 hours.

After 48 hours from infection, cells infected with C. burnetii Nine Mile I and with C. burnetii strain isolated from foetal brain exhibited alterations in morphology such as cell spreading, membrane extensions, polarized filopodia, and lamellipodium protrusions (Figure 1c). C. burnetii strain isolated from sheep placenta did not show any morphological cell alteration at 48 hours post‑infection.

After 24 hours from infection, fluorescently‑labeled phalloidin for labelling and localization of F‑actin, produced an homogenous and peripheral ring of F‑actin in control cells (Figure 2a). By contrast, staining of cells infected with C. burnetii Nine Mile I showed F‑actin inside the protrusion and in the areas away from cell deformation (Figure 2b). Cells infected with C. burnetii strains isolated from placenta and brain tissues did not show pseudopodal extensions or polarized distribution of F‑actin (Figure 2c and Figure 2d). After 48 hours, 80% of L929 infected with

c

Figure 1. Morphological features of L929 observed in the living state with an inverted optic microscope (40X): control cells (a) and cells infected with C. burnetii Nine Mile I (b) 24 hours after infection; cells infected with C. burnetii strain isolated from foetal brain 48 hours after infection (c).

Veterinaria Italiana 2015, 51 (2), 107-114. doi: 10.12834/VetIt.51.3542.1

109

Cytoskeleton reorganization by C. burnetii strains isolated from ovine abortion

Masu et al.

a

b

c

d

e

Figure 2. Reorganization of F‑actin induced by C. burnetii after incubation with DAPI (in blue), for nucleus staining and Alex fluor 555 phalloidin (in red), for intracellular distribution of F‑actin staining: control L929 cells (a). L929 cells infected with C. burnetii Nine Mile I (b). L929 infected with C. burnetii strain isolated from placenta after 24 hours (c). L929 cells infected with C. burnetii strain isolated from foetal brain after 24 and 48 hours from infection, respectively (d and e). The protrusions are pointed out by arrows. Objective HCX PL APO lambda blue 40.0 x 1.15 OIL UV, Emission band with PMT 2: begin end 513 nm‑546nm. Bars, 10 µm.

C. burnetii strain isolated from foetal brain showed an alteration in F‑actin distribution that resulted inside the protrusion and around the cells (Figure 2e).

Coxiella burnetii localization was observed by double fluorescence after 24 and 48 hours from infection.

110

The localization of bacteria closely apposed to the protrusion in cells infected with C. burnetii Nine Mile I after 24 hours is shown in Figure 3a. In L929 cells infected with C. burnetii strain isolated from sheep placenta, the bacteria occupied a dominant portion of the cytoplasmic space of the cell (Figure 3b). L929

Veterinaria Italiana 2015, 51 (2), 107-114. doi: 10.12834/VetIt.51.3542.1

Masu et al.

Cytoskeleton reorganization by C. burnetii strains isolated from ovine abortion

a

b

c

d

Figure 3. Localization of C. burnetii in L929 cells infected with: C. burnetii Nine Mile I (a); C. burnetii strain isolated from sheep placenta (b); C. burnetii strain isolated from foetal brain 24 and 48 hours (c and d) from infection. Nucleus, intracellular distribution of F‑actin and bacteria were labeled with DAPI, Alex fluor 555 phalloidin and FITC, respectively. Objective HCX PL APO lambda blue 40.0 x 1.15 OIL UV, Emission band with PMT 2: begin end 511 nm‑545nm. Bars, 10µm. cells infected with C. burnetii strain isolated from brain showed a low fluorescence after 24 hours from infection (Figure 3c). After 48 hours, the same cells showed citoplasmatic extensions and Coxiella presence near F‑actin protrusion, as shown in Figure 3d.

Cells with protrusions (%)

100

80

60

40

20

0 Control

Cb Nine Mile I 24h

Cb placenta

Cb brain

48h

Figure 4. Percentage of L929 cells showing protrusions 24 and 48 hours after infection with incubated with C. burnetii reference strain (Cb Nine Mile I), C. burnetii strain isolated from sheep placenta (Cb placenta) and C. burnetii strain isolated from foetal brain (Cb brain). Controls were represented by L929 non‑infected cells. The histogram represents the mean ± SD of 4 experiments.

Veterinaria Italiana 2015, 51 (2), 107-114. doi: 10.12834/VetIt.51.3542.1

The correlation between C. burnetii‑infected cells showing membrane protrusion and the time of infection is represented in Figure 4. Coxiella burnetii Nine Mile I induced F‑actin reorganization in 90±3 % of L929 cells both at 24 and 48 hours. No F‑actin polimerization was observed after 24 or 48 hours in L 929 cells infected with C. burnetii strain isolated from placenta. An increase in the level of F‑actin reorganization occurred only after 48 hours in cells infected with C. burnetii strain isolated from brain.

Discussion This is the first report of detection, identification, and isolation of C. burnetii from ovine abortion samples

111

Cytoskeleton reorganization by C. burnetii strains isolated from ovine abortion

in Sardinia, Italy. Even though the traditional technique used for isolation of the bacterium is the shell vial centrifugation assay (Gouriet et al.

2005), the culture method used in the present study allowed the isolation of C. burnetii from ovine samples due to their high concentration of bacteria, which facilitated the isolation.

In vitro, C. burnetii infects several cultured cell lines, such as P338D1 mouse macrophage‑like cells (Akporiaye et al. 1983), L929 fibroblast cells (Baca et al. 1985), and Vero cells (Maurin and Raoult 1999).

Differences in the cellular response to infection have been observed (Graham et al. 2013).

The bacterium resides in an acidic parasitophorous vacuole (PV) with late endosome‑lysosome characteristics (Aguilera et al. 2009). Recently, PV has also been shown to interact with the autophagic pathway, acquiring autophagosomal features (Beron et al. 2002, Gutierrez et al. 2005, Romano et al. 2007). An important aspect worth considering is the virulent Coxiella’s ability to entry into macrophages and to escape from their microbicidal activity (Honstettreet al. 2004). Indeed, virulent organisms are poorly internalized and survive in monocytes, whereas avirulent variants are efficiently phagocytozed but are eliminated (Meconi et al. 2001).

The virulence and pathogenic mechanisms of C. burnetii are not clearly understood but it is generally accepted that the bacterial LPS is important in the pathogenesis of Q fever in humans and animals and it is the only defined virulence factor of C. burnetii (Woldehiwet 2004).

Eukaryotic host cell cytoskeleton (actin filaments, microtubules, and intermediate filaments) are a common target of molecular interactions for intracellular microbial pathogens (Bhavsar et al.

2007). The actin cytoskeleton is differentially modulated to support bacterial internalization (Meconi et al. 1998). It has been shown that virulent C. burnetii affects F‑actin reorganization in THP‑1 human monocyte cells and that changes in cell morphology can be associated with the mobilization of actin cytoskeleton and consequent formation of pseudopodal extensions and polarized distribution of F‑actin (Meconi et al. 1998, Meconi et al. 2001).

Only virulent organisms induce cell protrusions rich in F‑actin in monocytes, suggesting that actin cytoskeleton is involved in the control of C. burnetii phagocytosis (Meconi et al. 1998).

112

Masu et al.

The results of this study suggest that C. burnetii strain isolated from foetal brain stimulates the reorganization of actin cytoskeleton inside cell protrusions also in L929 non‑macrophage‑like cells.

Coxiella burnetii entered slowly into fibroblasts and only after 48 hours from infection cells showed membrane protrusions and polarized projections and bacteria resulted closely apposed to the protrusion of F‑actin into the characteristic PV. Unlike other intracellular bacteria that use mechanisms to evade endocytic pathways, C. burnetii has a unique intracellular life cycle. After internalization into a host cell, C. burnetii establishes the PV that eventually fuses with compartments of the lysosomal network and expands to occupy the majority of the cytoplasmic space within the infected cells (Graham et al. 2013, Heinzen et al. 1996). This phenomenon is specifically related with F‑actin that not only is recruited to but is also involved in the formation of the typical PV (Aguilera et al. 2009).

By contrast, C. burnetii strain isolated from ovine placenta did not induce any significant change in cell morphology after 24 or 48 hours from infection.

Moreover, F‑actin resulted as a homogeneous and peripheral ring around L929 cells demonstrating that bacteria belong to an avirulent strain. Avirulent organism did not stimulate the activation of Lyn and Hck, 2 src‑related protein tyrosine kinases that lead to actin cytoskeleton reorganization involved in the impairment of phagocytosis of virulent C. burnetii (Meconi et al. 2001, Thomas and Brugge 1997).

In Italy, Q fever has been detected in Northern and Southern Italy; more specifically it has been recorded in both Sicilia and Sardinia in sheep, goats, cattle, and dogs by seroprevalence and PCR analysis (Baldelliet al. 1992, Cabassiet al. 2006, Capuano et al. 2004, Martini et al. 1994, Masala et al.

2004, Torina and Caracappa 2006). Both human and animal C. burnetii infections are under‑diagnosed and under‑reported. The diagnosis of Q fever is laboratory‑based and requires expensive and elaborate methods and well‑trained personnel to establish an unequivocal diagnosis. Since it requires biosafety laboratory level 3 conditions, it is rarely performed for routine diagnosis in veterinary medicine and restricted to laboratories specialized in cell‑culture technique (Fournier et al.

1998). Further studies on aborted ovine foetuses are necessary for improving our knowledge about the virulence and pathogenicity of Coxiella strains, which causes ovine abortion in Sardinia.

Veterinaria Italiana 2015, 51 (2), 107-114. doi: 10.12834/VetIt.51.3542.1

Masu et al.

Cytoskeleton reorganization by C. burnetii strains isolated from ovine abortion

References Agerholm J.S. 2013. Coxiella burnetii associated reproductive disorders in domestic animals ‑ a critical review. Acta Vet Scand, 55 (13), 1‑11. doi: 10.1186/1751‑0147‑55‑13.

Aguilera M., Salinas R., Rosales E., Carminati S., Colombo M.I. & Berón W. 2009. Actin dynamics and rho GTPases regulate the size and formation of parasitophorous vacuoles containing Coxiella burnetii. Infect Immun, 77 (10), 4609‑4620.

Akporiaye E.T., Rowatt J.D., Aragon A.A. & Baca O.G. 1983.

Lysosomal response of a murine macrophage‑like cell line persistently infected with Coxiella burnetii. Infect Immun, 40, 1155‑1162.

Angelakis E. & Raoult D. 2010. Q Fever. Vet Microbiol, 140 (3‑4), 297-309.

Arricau‑Bouvery N. & Rodolakis N.A. 2005. Is Q Fever an emerging or re‑emerging zoonosis? Vet Res, 36, 327‑349.

Arricau‑Bouvery N., Hauck Y., Bejaoui A., Frangoulidis D., Bodier C.C., Souriau A., Meyer H., Neubauer H., Rodolakis A. & Vergnaud G., 2006. Molecular characterization of Coxiella burnetii isolates by infrequent restriction site‑PCR and MLVA typing. BMC Microbiol, 6, 38. doi: 10.1186/1471‑2180‑6‑38.

Baca O.G., Scott T.O., Akporiaye E.T., Deblassie R. & Crissman H.A. 1985. Cell cycle distribution patterns and generation times of L929 fibroblast cells persistently infected with Coxiella burnetii. Infect Immun, 47 (2), 366‑369.

Beron W., Gutierrez M.G., Rabinovitch M. & Colombo M. I. 2002. Coxiella burnetii localizes in a Rab7‑labeled compartment with autophagic characteristics. Infect Immun, 70, 5816‑5821.

Mege J.L. 2009. Intracellular life of Coxiella burnetii in macrophages. Ann N Y Acad Sci, 1166, 55-66.

Gouriet F., Fenollar F., Patrice J.Y., Drancourt M. & Raoult D. 2005. Use of shell‑vial cell culture assay for isolation of bacteria from clinical specimens: 13 years of experience.

J Clin Microbiol, 43, 4993‑5002.

Graham J.G., Mac Donald S.K.H., Sharma U.M., Kurten R.C. & Voth D.E. 2013. Virulent Coxiella burnetii pathotypes productively infect primary human alveolar macrophages. Cell Microbiol, 15, 1012‑1025. doi: 10.1111/cmi.12096.

Gutierrez M.G., Vázquez C.L., Munafo D.B., Zoppino F.C., Beron W., Rabinovitch M. & Colombo M.I. 2005.

Autophagy induction favours the generation and maturation of the Coxiella‑replicative vacuoles. Cell Microbiol, 7, 981‑993.

Heinzen R.A., Scidmore M.A., Rockey D.D. & Hackstadt T. 1996. Differential interaction with endocytic and exocytic pathways distinguish parasitophorous vacuoles of Coxiella burnetii and Chlamydia trachomatis.

Infect Immun, 64 (3), 796-809.

Honstettre A., Ghigo E., Moynault A., Capo C., Toman R., Akira S., Takeuchi O., Lepidi H., Raoult D. & Mege J.L. 2004. Lipopolysaccharide from Coxiella burnetii is involved in bacterial phagocytosis, filamentous actin reorganization, and inflammatory responses through toll‑like receptor 4. J Immunol, 172 (6), 3695‑3703.

Hotta A., Kawamura M., To H., Andoh M., Yamaguchi T., Fukushi H. & Hirai K. 2002 Phase variation analysis of Coxiella burnetii during serial passage in cell culture by use of monoclonal antibodies. Infect Immun, 70 (8), 4747‑4749.

Bhavsar A.P., Guttman J.A. & Finlay B.B. 2007. Manipulation of host‑cell pathways by bacterial pathogens. Nature, 449 (7164), 827‑834.

Marrie T.J. 2000. Coxiella burnetii (Q fever). In Principles and practice of infectious diseases, 5th ed. (G.L. Mandell, R. Douglas & J.E. Bennett, eds). Philadelphia, Churchill Livingstone, 2043‑2050.

Baldelli R., Cimmino C. & Pasquinelli M. 1992.

Dog‑transmitted zoonoses: a serological survey in the province of Bologna. Ann Ist Super Sanità, 28 (4), 493‑496.

Martini M., Balzelli R. & Paulucci‑De Calcoli L. 1994. An epidemiological study on Q fever in the Emilia‑Romagna Region, Italy. Zentralbl Bakteriol, 280 (3), 416‑422.

Cabassi C.S., Taddei S., Donofrio G., Ghidini F., Piancastelli C., Flammini C.F. & Cavirani S. 2006. Association between Coxiella burnetii seropositivity and abortion in dairy cattle of Northern Italy. New Microbiol, 29 (3), 211‑214.

Capuano F., Parisi A., Cafiero M.A., Pitaro L. & Fenizia D. 2004. Coxiella burnetii: what is the reality? Parassitologia, 46 (1‑2), 131‑134.

Fournier P.E., Marrie T.J. & Raoult D. 1998. Diagnosis of Q Fever. J Clin Microbiol, 36 (7), 1823‑1834.

Ghigo E., Capo C., Tung C.H., Raoult D., Gorvel J.P. & Mege J.L. 2002. Coxiella burnetii survival in THP1 monocytes involves the impairment of phagosome maturation: IFN‑gamma mediates its restoration and bacterial killing. J Immunol, 169 (8), 4488‑4495.

Ghigo E., Pretat L., Desnues B., Capo C., Raoult D. &

Veterinaria Italiana 2015, 51 (2), 107-114. doi: 10.12834/VetIt.51.3542.1

Masala G., Porcu R., Sanna G., Chessa G., Cillara G., Chisu V. & Tola S. 2004. Occurrence, distribution, and role in abortion of C. burnetii in sheep and goat in Sardinia, Italy. Vet Microbiol, 99 (3‑4), 301‑305.

Masala G., Porcu R., Daga C., Denti S., Canu G., Patta C. & Tola S. 2007. Detection of pathogens in ovine and caprine abortion samples fron Sardinia, Italy, by PCR. J Vet Diagn Invest, 19 (1), 96‑98.

Maurin M. & Raoult D. 1999. Q Fever. Clin Microbiol Rev, 12, 518‑553.

Meconi S., Jacomo V., Boquet P., Raoult D., Mege J.L. & Capo C. 1998. Coxiella burnetii induces reorganization of the actin cytoskeleton in human monocytes. Infect Immun, 66 (11), 5527‑5533.

Meconi S., Capo C., Remacle‑Bonnet M., Pommier G., Raoult D. & Mege J.L. 2001. Activation of protein tyrosine kinase by Coxiella burnetii: role in actin cytoskeleton

113

Cytoskeleton reorganization by C. burnetii strains isolated from ovine abortion

reorganization and bacterial phagocytosis. Infect Immun, 69 (4), 2520‑2526.

modulated by phase II Coxiella burnetii to efficiently replicate in the host cell. Cell Microbiol, 9, 891‑909.

Mege J.L., Maurin M., Capo C. & Raoult D. 1997. Coxiella burnetii: the ‘query’ fever bacterium. A model of immune subversion by a strictly intracellular microorganism.

FEMS Microbiol Rev, 19 (4), 209-217.

Stein A. & Raoult D. 1992. Detection of Coxiella burnetii by DNA amplification using polymerase chain reaction. J Clin Microbiol, 30 (9), 2462-2466.

Omsland A., Beare P.A., Hill J., Cockrell D.C., Howe D., Hansen B., Samuel J.E. & Heinzen R.A. 2011. Isolation from animal tissue and genetic transformation of Coxiella burnetii are facilitated by an improved axenic growth medium. Appl Environ Microbiol, 77 (11), 3720‑3725.

Romano P.S., Gutierrez M.G., Beron W., Rabinovitch M. & Colombo M.I. 2007. The autophagic pathway is actively

114

Masu et al.

Torina A. & Caracappa S. 2006. Dog tick‑borne diseases in Sicily. Parassitologia, 48 (1‑2), 145‑147.

Thomas S.M. & Brugge J.S. 1997. Cellular functions regulated by src family kinases. Annu Rev Cell Dev Biol, 13, 513-609.

Woldehiwet Z. 2004. Q fever (coxiellosis): epidemiology and pathogenesis. Res Vet Science, 77, 93‑100.

Veterinaria Italiana 2015, 51 (2), 107-114. doi: 10.12834/VetIt.51.3542.1

Loop‑mediated Isothermal Amplification assay (LAMP) based detection of Pasteurella multocida in cases of haemorrhagic septicaemia and fowl cholera Mayurkumar P. Bhimani*, Bharat B. Bhanderi & Ashish Roy Department of Veterinary Microbiology, College of Veterinary Science and A.H., Anand Agricultural University, Anand, Gujarat, India * Corresponding author at: Department of Veterinary Microbiology, College of Veterinary Science and A.H., Anand Agricultural University, Anand‑388001, Gujarat, India.

Tel.: +91 9033794615, e‑mail: mayur_bhimani@yahoo.co.in.

Veterinaria Italiana 2015, 51 (2), 115-121. doi: 10.12834/VetIt.242.812.4 Accepted: 18.02.2015 | Available on line: 30.06.2015

Keywords Fowl cholera, Haemorrhagic septicaemia, Loop‑mediated Isothermal amplification (LAMP), Pasteurella multocida, Polymerase Chain Reaction.

Summary Twenty two isolates of Pasteurella multocida were obtained from different tissues of dead birds and animals (cattle, buffalo, sheep, and goat) suspected of fowl cholera and haemorrhagic septicaemia. The isolates were confirmed as P. multocida by various biochemical tests and PM PCR. An attempt was made to standardize Loop mediated isothermal amplification (LAMP) using newly designed primer sequences of KMT1 gene. Loop mediated isothermal amplification was conducted using 6 sets of primers at 65°C for 30 minutes and the result was confirmed by visual observation using SYBR green fluorescence dye as marker of positive reaction under UV transilluminator. On electrophoretic analysis of the products on 2% agarose gel, a ladder like pattern was observed, which suggested a positive amplification, whereas no amplification was observed in negative controls. Additionally, product of positive reaction yielded a green fluorescence following addition of SYBR green under UV transilluminator. It was observed that LAMP is a more sensitive test than polymerase chain reaction (PCR), as the former could detect DNA to lower limit of 22.8 pg/µl, while the latter could detect DNA to lower limit of 2.28 ng/ µl, thus LAMP could detect 100 times lesser concentration of DNA in comparison to PCR. Loop mediated isothermal amplification is a rather newer molecular technique, which can be used for rapid detection of infectious agent at field level and which does not require sophisticated instrument, i.e. thermal cycler. Furthermore, unlike the conventional PCR technique, LAMP requires lesser time to perform and result can be read visually.

Rilevamento di Pasteurella multocida mediante amplificazione isotermica mediata da loop del DNA in casi di setticemia emorragica e colera aviare Parole chiave Amplificazione isotermica del DNA mediata da loop, Colera aviare, Pasteurella multocida, PCR (Reazione a catena della polimerasi), Setticemia emorragica.

Riassunto Ventidue ceppi di Pasteurella multocida ottenuti da tessuti e organi di uccelli deceduti per sospetto colera aviare e da animali (bovini, bufali, pecore e capre) morti per sospetta setticemia emorragica sono stati utilizzati in questo studio. I ceppi sono stati identificati come P. multocida mediante l’utilizzo di test biochimici e di una PCR specifica. Questo studio ha avuto lo scopo di sviluppare e standardizzare la tecnica di amplificazione isotermica del DNA mediata da loop [LoopMediated Isothermal Amplification (LAMP)] per l’amplificazione del gene KMT1 di P. multocida utilizzando nuovi primers. L’amplificazione LAMP è stata condotta utilizzando un set di 6 primers mantenuti a 65 °C per 30 minuti mentre la visualizzazione dei risultati è avvenuta attraverso il transilluminatore UV aggiungendo il colorante SYBR green per colorare le reazioni positive. Inoltre l’analisi elettroforetica su gel d’agarosio al 2% degli amplificati LAMP ha rilevato il classico profilo multibanda per i campioni positivi, mentre nessuna banda di amplificazione è stata osservata nei controlli negativi. Lo studio ha rilevato che il LAMP test è più sensibile della PCR, infatti il test permette di rilevare il DNA fino al limite minimo di 22,8 pg/µl, mentre la PCR permette di rilevare il DNA fino al limite di 2,28 ng/µl. Si può verosimilmente concludere che il LAMP test permette di rilevare concentrazioni di DNA fino a 100 volte minori rispetto alla PCR. Il LAMP è una nuova metodica molecolare che può essere utilizzata per il rilevamento rapido di agenti infettivi in campo perché non necessita di strumenti sofisticati. Inoltre, rispetto alla PCR, la tecnica LAMP ha tempi di esecuzione più brevi ed è possibile rilevare la reazione positiva ad occhio nudo.

115

LAMP based detection of P. multocida Bhimani et al.

Introduction Pasteurella multocida is a heterogeneous species of gram‑negative bacteria and it has been recognized as an important veterinary pathogen for over a century.

The organism can occur as a commensal in the naso‑pharyngeal region of apparently healthy host and it can be either a primary or secondary pathogen in the disease processes. Five capsular serotypes are routinely identified in P. multocida (A, B, D, E, and F) and each is generally associated with, but not completely restricted to, a specific host (Harper et al. 2006).

Pasteurella multocida causes a number of diseases in various domestic and wild animals. The most important diseases are haemorrhagic septicaemia (HS) and septicemic pasteurellosis affecting sheep and goat; pneumonia, atrophic rhinitis, and septicaemia affecting pig and fowl; cholera or avian cholera in poultry/turkey. The organism is also known to be the causative agent for snuffles in rabbit and pasteurellosis in American bison, yak, deer, elephant, camel, horse, elk, and other wild animals. Fowl cholera is of significant economic importance. It is caused by infection with Pasteurella multocida, is a disease of many avian species. The majority of fowl cholera strains belong to serotype A (Christensen and Bisgaard 1997) and mostly affect domestic avian species, like chicken, turkey, duck, quail, and emu. The definitive diagnosis of P. multocida in field condition is difficult to achieve and in most of the cases it results in faulty diagnosis. Accurate and early diagnosis is the most effective tool to frame the strategy for control of the disease. Conventional diagnostic system is not effective, since it is time consuming and less sensitive as compared to molecular techniques including Loop‑Mediated Isothermal Amplification (LAMP).

LAMP is rather recently developed and adapted technique based on nucleic acid amplification method which is rapid, simple, and easy to perform compared to other nucleic acid based detection techniques, i.e. polymerase chain reaction (PCR). In LAMP amplification of target gene takes place under isothermal condition and in presence of Bst DNA polymerase enzyme with 4 specific set of primers.

However, Nagamine and colleagues (Nagamine et al.

2002) stated that the addition of 2 loop primers helps in decreasing the reaction time and also increases the specificity of the test. For these reasons, LAMP is preferred for early and specific detection of various infectious diseases in human as well as in animals.

Compared to PCR, LAMP has higher specificity and amplification efficiency, hence has been employed for detection of various pathogenic organisms like protozoa, virus, fungi, and bacteria, like Leishmania infantum (Chaouch et al. 2013), Yellow fever virus (Kwallah et al. 2013), Fusarium graminearum (Niessen 2013), and Salmonella (Wang et al. 2008). In the present study we propose LAMP assay for the early and rapid detection of P. multocida.

Materials and methods Bacterial strains A total of 22 isolates of P. multocida earlier isolated from emu, cattle, buffalo, poultry, sheep, goat and maintained at the Department of Veterinary Microbiology, Veterinary College, Anand, Gujarat, India, were used in this study. Isolates were confirmed to be P. multocida by using various biochemical tests as well as PCR, conducted using species specific primers (Townsend et al. 1998). Three known strain of P. multocida capsular type A (PAP‑11‑88/2013), P. multocida capsular type D (PAS‑8‑85/2013), and P52 strain of P. multocida (Capsular type B) were also used in this study as positive control. Escherichia coli (ATCC‑25922), Proteus mirabilis (ATCC‑12453), and Klebsiella pneumoniae (ATCC‑13883) were also used as negative control to assess the efficacy of the LAMP primer. All the strains used were grown on 5% defibrinated sheep blood agar or Brain hearth infusion broth (BHI) at 37°C.

DNA preparations Bacterial DNA for PCR was extracted by boiling procedure. Isolates were cultured overnight in BHI

Table I. Primers sequences used in this study to detect P. multocida.

Test PCR

LAMP

116

Primer Name KMT1-forward KMT1-reverse F3 B3 FIP (F1c+F2) BIP(B2+B1c) Loop F Loop B

Oligonucleotide sequence GCTGTAAACGAACTCGCCAC ATCCGCTATTTACCCAGTGG GGTGCCTATCTTGCTTCG TCGATCGCTAGCACCACA TGCCGTAGCAGAAACTGGAC + AGGTGAGCCATGTGAGCT CACACCGAAGCCAGGACTT + CACCAAATGTACTGGTTGCTTC CGACCATCGGTTGCATTTC TGGCATTGCATGGCTATCA

Reference Townsend and colleagues, (Townsend et al. 1998) Townsend and colleagues (Townsend et al. 1998) This study This study This study This study This study This study

Veterinaria Italiana 2015, 51 (2), 115-121. doi: 10.12834/VetIt.242.812.4

Bhimani et al.

LAMP based detection of P. multocida

Figure 1. Primer design for LAMP to detect Pasteurella multocida DNA. Nucleotide sequence of Kmt1 gene (GenBank accession no. AFF24839), used to design LAMP primers. Underlining indicates the positions of targeting sequences. broth at 37°C and 2 ml of the culture suspension was centrifuged and the pellet was resuspended in 200 µl of doubled distilled water (ddH2O), which was boiled for 10 minutes in a water bath and then stored at ‑20°C for 10 minutes. After thawing, the suspension was once again centrifuged at 8,000 rpm for 10 minutes and 200 µl of the supernatant was taken as template DNA. The concentration of DNA was measured spectrophotometrically (Nanodrop 1000, Thermo scientific, Wilmington, Delaware, USA) at 260 nm and the same DNA template was used to carry out both LAMP and PCR.

Veterinaria Italiana 2015, 51 (2), 115-121. doi: 10.12834/VetIt.242.812.4

DNA oligonucleotides In order to obtain a specific primers for the LAMP, previously identified conserved gene (KMT1) was targeted (Townsend et al. 1998). Six primers for LAMP were designed based on the KMT1 gene sequence (EMBL accession no. AFF24839) according to the criteria described previously (Notomi et al.

2000, Tomita et al. 2008), including 2 outer primers (F3 and B3), 1 forward inner primer (FIP), 1 backward inner primer (BIP), and 2 loop primers (Loop F and Loop B) by using LAMP Designer (Optigene, Horsham, UK) (Table I) (Figure 1). These primers

117

LAMP based detection of P. multocida Bhimani et al.

recognize 6 distinct regions on the target DNA. For the PCR, we used primers designed by Townsend and colleagues (Townsend et al. 1998).

Pasteurella multocida specific PCR (PM‑PCR) Pasteurella multocida strains were subjected to PM‑PCR to detect the species KMT gene (Townsend et al. 1998). For PCR reactions 3 µl (~228 ng/µl) template DNA was added to the reaction mixture (22 µl) containing 1 µl of each primer pair (MWG‑Biotech, Banglore, INDIA) in a 10 pmol primary concentration, 12.5 µl of 2x PCR Master mix (Fermentas, Thermo Fisher Scientific, Carlsbad, California, USA) and 7.5 µl of molecular grade nuclease free water. The samples were subjected to 30 cycles of amplification in a thermal cycler as per the protocol described by Townsend and colleagues (Townsend et al. 1998) (Veriti, Applied Biosystem, Foster City, California, USA).

DNA‑sequences of oligonucleotide primers and reference sequences are listed in Table I.

Comparison of specificity and sensitivity between LAMP and PCR Specificity and sensitivity of LAMP and PCR were determined by using genomic DNA of P. multocida, which was used to conduct earlier PCR and LAMP as previously described. The results were compared with those of conventional PCR with the same template DNA at identical concentrations. To assess the species specificity, P. multocida capsular type A, P. multocida capsular type D, P. multocida (P52‑ capsular type B), Escherichia coli, Proteus mirabilis, and Klebsiella pneumoniae were used. To evaluate the sensitivity of the LAMP and PCR, 10‑fold serial dilutions were made using 228 ng/µl purified DNA of P. multocida (P52 strain) and DNA concentration was measured spectrophotometrically (Nanodrop 1000, Thermo scientific, Wilmington, Delaware, USA) at 260 nm. The final tube showing positive reaction was considered as detection limit and the reactions were carried out in triplicate.

Results

LAMP reaction

Detection by LAMP Assay

The LAMP reaction was carried out with 25 μL of mixture containing 5 pmol of each primer F3 and B3; 20 pmol of each primer FIP and BIP; 10 pmol of each primer Loop F and Loop B, 1x LAMP ISO‑001 master mix (Optigene, Horsham, UK), and 3 µl of DNA template (~228 ng/µl). The reactions were carried out in a thermocycler at 65°C for 30 minutes and the reaction was terminated by increasing the temperature to 80°C for 5 minutes. A positive control (purified DNA of P. multocida) and a negative control (distilled water) were included in each run.

The result of the LAMP reaction could be observed by naked eye under daylight or UV light. Under daylight, the positive reaction (with target DNA template) turned green; whereas the negative one (without target DNA template) remained orange.

Under UV light, the positive reaction emitted strong green fluorescence while the negative reaction did not emit any fluorescence (Figure 2).

On electrophoresis, amplicons of positive reaction

1

2

3

4

5

6

-Ve

1

2

3

4

5

6

-Ve

Detection and analysis of visual LAMP and PCR products Amplified product of LAMP was directly visualized under the day light or UV light following addition of 1x SYBR green nucleic acid stain (Life science, Carlsbad, California, USA). To check the presence of the LAMP products, the amplified products were subjected to gel electrophoresis in 2% agarose gel along with 100 bp DNA Ladder (GeneRuler‑Fermentas, Thermo Fisher Scientific, Carlsbad, California, USA) and stained with ethidium bromide (1 % solution at the rate of 5 μl/100 ml).

The PCR products were separated by electrophoresis in 2% agarose gel at 5 V/cm for 1 hour and stained with ethidium bromide (1 % solution at the rate of 5 μl/100 ml). View was captured under gel documentation system (Genetix Biotech Asia, Delhi, INDIA).

118

Figure 2. Positive reaction of LAMP gives fluorescence after addition of SYBR green dye under UV light. Tube 1-6: positive sample; -Ve: negative control.

Veterinaria Italiana 2015, 51 (2), 115-121. doi: 10.12834/VetIt.242.812.4

Bhimani et al.

1

LAMP based detection of P. multocida

2

3

4

5

6

7

8

1

2

3

4

5

6

7

8

Figure 3. Specificity of LAMP. Lane 1: ladder; Lane 2: P. multocida type A; Lane 3: P. multocida type B; Lane 4: P. multocida type D; Lane 5: E. coli; Lane 6: P. mirabilis; Lane 7: K. pneumoniae; Lane 8: negative control (water).

Figure 4. Specificity of PCR. Lane 1: ladder; Lane 2: P. multocida type A; Lane 3: P. multocida type B; Lane 4: P. multocida type D; Lane 5: E. coli; Lane 6: P. mirabilis; Lane 7: K. pneumoniae; Lane 8: negative control (water).

gave typical ladder like pattern, which were the same for all the P. multocida 22 isolates, as well as for the known P. multocida isolates, while no ladder like pattern of amplification was observed in lanes containing genomic DNA of other isolates (negative control) (Figure 3).

On the basis of electrophoretic analysis, in assessing the comparative sensitivity for both the assay, we concluded that the detection limit of the LAMP assay was 68.4 pg/tube (containing 3 µl of DNA template) or 22.8 pg/µl of genomic DNA for 30 minutes of reaction time, while agarose gel electrophoresis of PCR products showed that the detection limit of PCR assay for the same was 6.84 ng/tube (containing 3 µl of DNA template) or 2.28 ng/µl of genomic DNA (Table III and Figure 5 and Figure 6). Thus LAMP assay was found to be more sensitive than PCR in this study.

Detection by Pm‑PCR On electrophoresis of PCR products, it was observed that all the 22 isolate of P. multocida, including the known P. multocida isolates had generated a single 460 kb band, while other isolates failed to generate any amplified product (Figure 4).

Specificity and sensitivity of LAMP and PCR The visual observation of LAMP reaction, as described earlier, could specifically detect presence of amplified products obtained from all the 22 P. multocida field isolates as well as P. multocida type A, P. multocida type D, and P. multocida (P52‑ Capsular type B).

While no such observation could be made for other bacterial strains and negative (no template) reaction control (Table IIA, IIB and Figure 3).

PCR results based on the observation following electrophoresis revealed similar findings by specific detection of genomic DNA of P. multocida isolates including known strains. It did not reveal any specific products for other bacterial strain (Table IIA, IIB and Figure 4).

Veterinaria Italiana 2015, 51 (2), 115-121. doi: 10.12834/VetIt.242.812.4

Discussion Pasteurella multocida is a prevalent organism responsible for causing haemorrhagic septicaemia and fowl cholera in ruminant and bird, respectively.

Moreover, it causes atrophic rhinitis in pig, and snuffles in rabbit. Haemorrhagic septicaemia usually occurs as very acute disease in ruminants.

It is often fatal if specific treatment is not given in primary phase. Hence efficient, rapid detection of P. multocida is necessary for prevention of outbreak and specific therapy for the disease. In HS very rapid death occurs, thus there is a need to develop a novel technique for rapid detection.

In tropical countries like India, Pasteurellosis is a major cause of mortality in ruminant and result in high economic losses. In present study, we succeeded in designing specific sets of primer for rapid detection of P. multocida isolated from various animal hosts. In this assay, we targeted the conserved gene of P. multocida, which was earlier

119

LAMP based detection of P. multocida Bhimani et al.

reported by Townsend and colleagues (Townsend et al. 1998). The LAMP assay successfully detected all the isolates of P. multocida strains and gave negative reaction in all other bacterial species, which was in good agreement with the results Table II. A. Specificity of LAMP and PCR for the detection of P. multocida.

B. Detail results of LAMP and PCR for the field isolates of P. multocida.

A Name of the isolates P. multocida field isolates (22) (Table IIA) P. multocida (capsular type A) P. multocida P52 strain (capsular type B) P. multocida (capsular type D) E. coli Proteus mirabilis Klebsiella pneumoniae Negative Control (Water)

Result of LAMP + + + + -

Result of PCR + + + + -

of PCR assay. The specificity of the LAMP is high because it employs 6 specially designed primers recognizing 6 regions on the KMT1 gene sequence, which is specific to P. multocida. The sensitivity of the LAMP was found to be higher as it could detect to a lower limit of 22.8 pg/µl of genomic DNA, which is 100‑fold more sensitive than that of the conventional PCR. The result is in agreement with previous results of Sun and colleagues (Sun et al.

2010) who reported that LAMP could detect 10 cfu/ ml more than conventional PCR.

1

2

3

4

5

6

7

8

B Sr. no Isolate No. 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22

PAB-1 PAB-2 PAB-3 PAB-4 PAB-5 PAB-6 PAB-7 PAB-9 PAB-10 PAB-11 PAB-12 PAB-13 PAB-14 PAC-1 PAC-2 PAC-3 PAS-1 PAG-1 PAP-1 PAP-2 PAE-1 PAE-2

Host Species Buffalo Buffalo Buffalo Buffalo Buffalo Buffalo Buffalo Buffalo Buffalo Buffalo Buffalo Buffalo Buffalo Cattle Cattle Cattle Sheep Goat Poultry Poultry Emu Emu

Capsular Result type of LAMP B + B + B + B + B + B + B + B + B + B + B + B + B + B + B + B + D + F + A + A + A + A +

Result of PCR + + + + + + + + + + + + + + + + + + + + + +

Figure 5. Sensitivity of the LAMP to detect P. multocida. Lane 1: ladder; Lane 2: 228 ng/µl; Lane 3: 22.8 ng/µl; Lane 4: 2.28 ng/µl; Lane 5: 228 pg/µl; Lane 6: 22.8 pg/µl; Lane 7: 2.28 pg/µl; Lane 8: 228 fg/µl.

1

2

3

4

5

6

7

8

Figure 6. Sensitivity of the PCR to detect P. multocida. Lane 1: ladder; Lane 2: 228 ng/µl; Lane 3: 22.8 ng/µl; Lane 4: 2.28 ng/µl; Lane 5: 228 pg/µl; Lane 6: 22.8 pg/µl; Lane 7: 2.28 pg/µl; Lane 8: 228 fg/µl.

Table III. Comparison between the sensitivity of LAMP and PCR.

120

Isolate

Test

P. multocida P52-Strain

LAMP PCR

Concentration of Genomic DNA after dilution (per 3µl of genomic DNA template) 684 ng 68.4 ng 6.84 ng 684 pg 68.4 pg 6.84 pg 684 fg + + + + + + + + -

Veterinaria Italiana 2015, 51 (2), 115-121. doi: 10.12834/VetIt.242.812.4

Bhimani et al.

Loop mediated isothermal amplification is highly sensitive test, thus it is recommended that post‑amplification operation should be done in separate room away from the reaction and reagent that are being used for the PCR and LAMP to reduce the chance of contamination (Zhu et al.

2009). This test requires only regular water bath or heating block that maintains temperature at 65°C, making LAMP assay more economical compared to conventional PCR. Moreover, addition of 2 extra loop primers increases speed (Nagamine et al. 2002) and specificity of amplification, which reduces the overall time and makes the LAMP faster than conventional PCR. It takes almost 3 hours to detect the P. multocida using PCR; while in present study we have detected the P. multocida in approximately 30 minutes only. Commercially available LAMP master mixes decrease the amplification speed as they contain some advanced Bst polymerase. The reaction time reported in this study (approximately 30 minutes) was significantly faster than the one reported by

LAMP based detection of P. multocida

Sun and colleagues (Sun et al. 2010), which required 1 hour to complete the assay. An other important feature of LAMP assay is that positive amplification can be detected by naked eye, it does not require electrophoretic assessment, which is by contrast a requisite for conventional PCR. Other methods available for visual detection of LAMP reaction include addition of calcein and manganese ion to the reaction and results could be interpreted just by observing the change in colour of reaction mixture; or addition of SYBR green dye which emanates fluorescence in positive reaction under UV light.

Also these techniques eliminate the need for the time‑consuming electrophoresis and requirement of other sophisticated instruments. To conclude, because of its simplicity, specificity, sensitivity, and being economic, LAMP is more efficient than conventional PCR for the detection of P. multocida infection at field level and this technique can be used during the outbreak of haemorrhagic septicaemia and fowl cholera to ensure rapid diagnosis.

References Chaouch M., Mhadhbi M., Adams E.R., Schoone G.J., Limam S., Gharbi Z., Darghouth M.A., Guizani I. & BenAbderrazak S. 2013. Development and evaluation of a loop‑mediated isothermal amplification assay for rapid detection of Leishmania infantum in canine leishmaniasis based on cysteine protease B genes. Vet Parasitol, 198, 78‑84.

Notomi T., Okayama H, Masubuchi H., Yonekawa T., Watanabe K., Amino N. & Hase T. 2000. Loop‑mediated isothermal amplification of DNA. Nucleic Acids Res, 28, e63.

Christensen J.P. & Bisgaard M. 1997. Avian pasteurellosis: taxonomy of the organisms involved and aspects of pathogenesis. Avian Pathol, 26, 461‑483.

Tomita N., Mori Y., Kanda H. & Notomi T. 2008.

Loop‑mediated isothermal amplification (LAMP) of gene sequences and simple visual detection of products. Nat Protoc, 3, 877-882.

Harper M., Boyce J.D. & Adler B. 2006. Pasteurella multocida pathogenesis: 125 years after Pasteur. FEMS Microbiol Let, 265, 1‑10.

Kwallah A., Inoue S., Muigai A.W., Kubo T., Sang R., Morita K. & Mwau M. 2013. A real‑time reverse transcription loop‑mediated isothermal amplification assay for the rapid detection of yellow fever virus. J Virol Methods, 193, 23‑27.

Nagamine K., Hase T. & Notomi T. 2002. Accelerated reaction by loop‑mediated isothermal amplification using loop primers. Mol Cell Probes, 16, 223-229.

Niessen L. 2013. Detection of Fusarium graminearum DNA using a loop‑mediated isothermal amplification (LAMP) assay. Methods Mol Biol, 968, 177‑193.

Veterinaria Italiana 2015, 51 (2), 115-121. doi: 10.12834/VetIt.242.812.4

Sun D., Wang J., Wu R., Wang C., He X., Zheng J. & Yang H. 2010. Development of a novel LAMP diagnostic method for visible detection of swine Pasteurella multocida. Vet Res Commun, 34, 649‑657.

Townsend K.M., Frost A.J., Lee C.W., Papadimitriou J.M. & Dawkins H.J. 1998. Development of PCR Assays for species and type specific identification of Pasteurella multocida isolates. J Clin Microbiol, 36, 1096‑1100.

Wang L., Shi L., Alam M.J., Geng Y. & Li L. 2008. Specific and rapid detection of food borne Salmonella by loop‑mediated isothermal amplification method. Food Res Int, 41, 69‑74.

Zhu R.Y., Zhang K.X., Zhao M.Q., Liu Y.H., Xu Y.Y., Ju C.M., Li B. & Chen J.D. 2009. Use of visual loop‑mediated isotheral amplification of rimM sequence for rapid detection of Mycobacterium tuberculosis and Mycobacterium bovis. J Microbiol Methods, 78, 339‑343.

121

African horse sickness outbreaks in Namibia from 2006 to 2013: clinical, pathological and molecular findings Massimo Scacchia1, Umberto Molini2, Giuseppe Marruchella1, Adrianatus Maseke2, Grazia Bortone1, Gian Mario Cosseddu1, Federica Monaco1, Giovanni Savini1 & Attilio Pini1* 1

Istituto Zooprofilattico Sperimentale dell’Abruzzo e del Molise ‘G. Caporale’, Campo Boario, 64100 Teramo, Italy.

2 Central Veterinary Laboratory, 24 Goethe Street, Windhoek, Namibia. * Corresponding author at: Istituto Zooprofilattico Sperimentale dell’Abruzzo e del Molise ‘G. Caporale’, Campo Boario, 64100 Teramo, Italy.

Tel.: +39 0861 332481, e‑mail: a.pini@izs.it.

Veterinaria Italiana 2015, 51 (2), 123-130. doi: 10.12834/VetIt.200.617.3 Accepted: 05.07.2014 | Available on line: 30.06.2015

Keywords African horse sickness (AHS), Clinical signs, Genomic segment 10 (S10), Laboratory diagnosis, Molecular characterization, Namibia, Pathology, Serotyping.

Summary African horse sickness (AHS) is a vector‑borne viral disease of equids, endemic in Sub‑Saharan Africa. This article reports the clinic‑pathological and laboratory findings observed in the framework of passive surveillance during the AHS outbreaks which occurred in Namibia between 2006 and 2013. This study was conducted in the framework of the collaboration among the Istituto Zooprofilattico Sperimentale dell’Abruzzo e del Molise (Teramo, Italy), the Namibian Ministry of Agriculture Water and Forestry, and the Namibian National Veterinary Association. A total of 92 horses were investigated, showing different clinical form of AHS: peracute/acute (n = 43), sub‑acute (n = 21) and mild AHS fever (n = 19). Clinical data were not available for 9 horses, because they were found dead. Pathological findings have been recorded for 35 horses. At necropsy, pulmonary and subcutaneous oedema, haemorrhages and enlargement of lymph nodes were mainly observed. Diagnosis was confirmed by laboratory testing, AHS virus (AHSV) was isolated from 50 horses and the identified serotypes were: 1, 2, 4, 6, 7, 8, and 9. The phylogenetic analysis of the S10 genome sequences segregated the Namibian AHSV strains in the same clusters of those circulating in South Africa in recent years. The description of AHS clinical, pathological, and laboratory features of AHS provided in this article is of value for differential diagnosis and control of AHS, especially in areas currently free from this disease.

Episodi di peste equina in Namibia dal 2006 al 2013: rilievi clinici, patologici e molecolari Parole chiave Caratterizzazione molecolare, Diagnostica di laboratorio, Lesioni, Peste equina, Segmento genomico 10 (S10), Serotipizzazione, Sintomatologia.

Riassunto La peste equina è una malattia degli equidi ad eziologia virale e trasmessa da insetti vettori, endemica nell’Africa sub‑Sahariana. Si riportano i dati clinico‑patologici e laboratoristici degli episodi di peste equina verificatisi in Namibia dal 2006 al 2013. Lo studio è frutto della collaborazione tra l’Istituto Zooprofilattico Sperimentale dell’Abruzzo e del Molise “G. Caporale”, il Ministero dell’Agricoltura, delle Risorse Idriche e delle Foreste della Namibia e l’Associazione Nazionale dei Medici Veterinari della Namibia. In totale, sono stati esaminati 92 cavalli affetti da diverse forme di peste equina: peracuta/acuta (n = 43), sub‑acuta (n = 21) ed oligosintomatica (n = 19). Nove cavalli sono stati rinvenuti già morti, senza che fosse possibile riportare alcun dato clinico. In 35 casi è stato possibile osservare e descrivere dettagliatamente le lesioni macroscopiche. In sede necroscopica, le principali lesioni sono state l’edema polmonare e sottocutaneo, le emorragie e l’aumento di volume dei linfonodi.

Il sospetto diagnostico è stato costantemente confermato dalle indagini di laboratorio. Il virus della peste equina è stato isolato da 50 cavalli e la sierotipizzazione ha dimostrato la presenza dei seguenti sierotipi: 1, 2, 4, 6, 7, 8 e 9. Le analisi filogenetiche del segmento S10 hanno permesso di collocare i ceppi virali namibiani all’interno degli stessi clusters circolanti in Sud Africa. La presente descrizione degli episodi di peste equina e delle loro caratteristiche cliniche, patologiche e laboratoristiche è utile per una rapida diagnosi differenziale ed un efficace controllo di tale malattia, soprattutto nelle regioni attualmente indenni.

123

Scacchia et al.

AHS in Namibia from 2006 to 2013

Introduction African horse sickness (AHS) is a non‑contagious, insect‑borne disease of equids caused by a double stranded RNA virus – namely, AHS virus (AHSV) – which belongs to the genus Orbivirus (family Reoviridae) and shares some morphological features with bluetongue and equine encephalosis viruses.

The biting midge Culicoides imicola is considered the most important vector of AHSV in Africa (Mellor and Hamblin 2004).

Up to date, 9 AHSV serotypes (AHSV‑1 to ‑9) have been identified by virus neutralization test. Some evidence exists about serological cross‑reactions between serotypes, whereas no relationship has been demonstrated with other known orbiviruses (von Teichman et al. 2010). The AHSV genome consists of 10 double‑stranded (ds)RNA segments, which encode 7 structural (VP1 to VP7) and 4 non‑structural (NS1, NS2, NS3, and NS3A) proteins. The segment 10 (Seg‑10) (755 ‑764 bp) is the smallest one and encodes NS3 and NS3A proteins (van Staden and Huismans 1991). The Seg‑10 nucleotide‑sequence analysis has been demonstrated to be a useful tool to investigate the genetic relationships among AHSV isolates (de Sá et al. 1994, Quan et al. 2008, Sailleau et al. 1997, van Niekerk et al. 2001).

Equids, including crossbreeds, are all susceptible to AHSV infection. Zebras rarely exhibit clinical signs, although they are likely to play a pivotal epidemiological role for AHS in Africa, thus being regarded as the natural vertebrate reservoir host of AHSV. However, AHSV persists also in African countries where zebra population is absent or negligible. Donkeys are also very resistant, most AHSV infections being sub‑clinical, at least in Southern Africa (Coetzer and Guthrie 2004). On the contrary, high mortality rates are usually recorded in horses and occasionally in mules, which do not contribute to the ‘persistence’ of AHSV, thus being considered as ‘indicator hosts’ of AHS (Mellor and Hamblin 2004).

African Horse Sickness is endemic in Sub‑Saharan Africa where all serotypes are present, while AHSV‑9 has been involved in most of the epidemics outside Africa, with the only exception of AHS outbreaks caused by AHSV‑4 in the Iberian peninsula (Mellor and Hamblin 2004). In Southern Africa, AHS occurs with a typically seasonal (December‑May) and cyclical incidence, closely related to heavy rain and density of vectors (Scacchia et al. 2009).

Different AHSV serotypes are progressively colonizing Western African countries (from Nigeria to Mauritania), a finding which indicates that AHSV spreading capacity is greater than previously thought (Laaberki 1969, Mellor and Hamblin 2004,

124

Diouf et al. 2007). African Horse Sickness outbreaks have been occasionally reported outside the African continent: Middle East (1959‑63), Spain (1966, 1987‑90), Portugal (1989), Saudi Arabia, Yemen (1997), and Cape Verde Islands (1999) (Anwar and Qureshi 1972, Coetzer et al. 2004, Howell 1960, Howell 1963, Mellor and Hamblin 2004). Such epidemics mainly resulted from the movement of infected animals (de Sá et al. 1994, Mellor and Hamblin 2004), although the propagation of infected vectors by wind over long distances cannot be ruled out, as it is possible given the case concerning the bluetongue virus (Alba et al. 2004, Mellor and Hamblin 2004, Sellers et al. 1978).

This article describes the clinic‑pathological and laboratory findings observed in the framework of passive surveillance during AHS outbreaks which occurred in Namibia between 2006 and 2013. The study was conducted within the framework of the policy of preparedness of the Italian National Reference Centre for Exotic Diseases at the Istituto Zooprofilattico Sperimentale dell’Abruzzo e del Molise (IZSAM), and it was implemented in collaboration with the Namibian Ministry of Agriculture, Water and Forestry and the Namibian National Veterinary Association.

Materials and methods Data collection: anamnesis, clinical signs and pathology African Horse Sickness was suspected on the basis of anamnestic data (including the seasonality), clinical signs, and gross lesions. Whenever possible, the immune status – with respect to AHS vaccination – was recorded.

As far as symptoms are concerned, 4 AHS clinical forms are usually classified: pulmonary, cardiac, mixed, and horse sickness fever (Coetzer et al. 2004, Mellor and Hamblin 2004). However, such distinction is not easy to implement under field conditions.

Therefore, AHS cases have been classified herein using the following criteria: (a) peracute/acute, with sudden clinical onset and fatal outcome within 2 days; (b) sub‑acute, characterized by a slower progression of the disease and fatal outcome, if any, after more than 2 days; (c) AHS fever, with mild symptoms and steady recovery.

Blood samples in EDTA were collected from live animals during the febrile stage of infection. Dead horses were submitted for necropsy. Gross lesions were systematically recorded and several tissues (spleen, lung, cephalic, tracheo‑bronchial, and mediastinal lymph nodes) sampled.

Veterinaria Italiana 2015, 51 (2), 123-130. doi: 10.12834/VetIt.200.617.3

Scacchia et al.

Laboratory tests The diagnosis of AHS was always confirmed by laboratory testing. In detail, reverse transcriptase‑polymerase chain reaction (RT‑PCR) was firstly conducted either to demonstrate or to rule out the presence of AHSV in the aforementioned collected samples (Monaco et al.

2011, Stone‑Marschat et al. 1994); AHSV serotype was determined by using a serotype‑specific RT‑PCR (Sailleau et al. 2000). Attempts to isolate AHSV were made from all RT‑PCR positive samples, as previously described. The isolated strains were then serotyped by virus neutralization assay as previously described (OIE 2010).

AHS in Namibia from 2006 to 2013

amplicons were then purified, cloned (TOPO TA Cloning Kit for Sequencing ‑ Life Technologies, Carlsbad, CA, USA) in competent cells (One Shot TOP10 cells ‑ Life Technologies, Carlsbad, CA, USA) and a 665 nt fragment sequenced (ABI PRISM 377 DNA sequencer ‑ PE Applied Biosystems, CA, USA).

Raw sequence data were assembled using Contig Express (Vector NTI suite 9.1; Invitrogen) and the consensus sequence was aligned with homologous sequences of 114 AHSV strains available in GenBank (Table S1, available online).

Results

Molecular characterisation

Anamnestic data

The Seg‑10s of 5 AHSV isolates were partially sequenced as follows: confluent VERO cells were infected with AHSV field isolates and incubated at 37°C until the occurrence of the cytopathic effect. Total viral RNA was extracted from infected cells using the ‘High Pure Viral Nucleic Acid’ extraction kit (Roche Diagnostic, Basel, Switzerland) and amplified by RT‑PCR as previously described (Monaco et al. 2011). The

The large majority of AHS outbreaks occurred between January and April, during 2010 (12 cases) and 2011 (40 cases). A total of 92 AHS‑affected horses from 41 farms located in different Namibian districts were investigated (Figure 1). Fifty‑three of them were vaccinated against AHS. The affected animals were mainly Arab, English thoroughbred or saddle horses of both sexes, their age ranging from 2 months to 18 years.

Figure 1. The Namibian districts where cases of African horse sickness (AHS) have been observed between 2006 and 2013. Different colours indicate the number of AHS cases observed in each district.

Veterinaria Italiana 2015, 51 (2), 123-130. doi: 10.12834/VetIt.200.617.3

125

Scacchia et al.

AHS in Namibia from 2006 to 2013

Table I. African horse sickness in Namibia between 2006 and 2013: clinical, pathological and laboratory findings. Clinic-pathological data are expressed as the percentage of animals showing specific symptoms and lesions.

N° affected horses Age Aged> 2 years Aged ≤ 2 years

Peracute/acute 43 4 months-14 years 18 (12 vaccinated) 25 (9 vaccinated)

Death

43

Fever Froth from the nares Subcutaneous oedema Haemorrhagic conjunctivitis

+++ +++ +++ +++

Pulmonary oedema Subcutaneous oedema Serosal petechiae

+++ +++ ++

RT-PCR positive horses AHSV isolates AHSV serotypes

43 25 1, 2, 4, 6, 8, 9

AHS clinical forms Sub-acute Mild AHS fever 21 19 2 months-13 years 10 months-18 years 17 (12 vaccinated) 15 (all vaccinated) 4 (1 vaccinated) 4 (all vaccinated) 4 ≤ 2 year-old 2 > 2 year-old 0 (irrespective of the immune status) Clinical signs +++ ++++ +++ ++++ ++++ ++ ++++ Gross lesions +++ na ++++ na +++ na Laboratory investigations 21 19 11 9 4, 8, 9 2, 4, 6, 9

Found dead 9 4-8 years 9 0 9

na na na na +++ + ++ 9 5 6, 7, 8

+ = <25%; ++ = 25-50%; +++ = 50-75%; ++++ = 75-100%; na = not applicable.

Clinical signs Clinical data were available for 83 animals. In addition, AHS was confirmed in 9 horses found dead without any clinical data (Table I).

In 43 animals aged from 4 months to 14 years, the observed clinical pattern could be included in the constantly fatal peracute/acute form. Of these animals, 21 were vaccinated against AHS, while this information was not available for 6 horses. Fever up to 41°C, subcutaneous oedema of the supraorbital fossae, head and neck, conjunctival petechiae, permanent recumbency, severe dyspnoea, and discharge of frothy fluid from the nares were usually observed (Figure 2).

In 21 horses aged from 2 months to 13 years, we observed fever (about 40°C), subcutaneous oedema of head, neck and chest; the sub‑acute form was characterised by the presence of lingual and conjunctival petechiae (Figure 3). Irrespective of the immune status, the fatal outcome occurred in 6 horses (4 aged ≤ 2 years).

Mild AHS fever was observed in 19 horses aged between 10 months and 18 years (4 aged ≤ 2 years), all vaccinated against AHS and recovered after showing mild to moderate fever (39‑40°C) and oedema of the supraorbital fossae.

126

Figure 2. Peracute/acute form of African horse sickness in a horse during an outbreak in Namibia between 2006 and 2013. Permanent recumbency and abundant discharge of frothy fluid from the nares.

Gross pathology Necropsy was conducted on 35 out of 49 dead animals. Severe and diffuse pulmonary oedema, gelatinous exudate of the sub‑pleural and interlobular connective, and abundant froth within the upper airways (Figure 4) were observed; hydrothorax were the main lesions noted in peracute/acute AHS affected horses. Tracheal and

Veterinaria Italiana 2015, 51 (2), 123-130. doi: 10.12834/VetIt.200.617.3

Scacchia et al.

AHS in Namibia from 2006 to 2013

Figure 4. Peracute/acute of African horse sickness in a horse during an outbreak in Namibia between 2006 and 2013. Frothy fluid fills the tracheal lumen.

Figure 3. Sub-acute form of African horse sickness in a horse during an outbreak in Namibia between 2006 and 2013. Prominent head oedema and severe conjunctivitis. The present picture has been published in a previous paper (Scacchia et al. 2009). sub‑pleural haemorrhages were also commonly detected, along with ascites and hyperaemia of gastric mucosa.

The sub‑acute form was mainly characterized by prominent subcutaneous, haemorrhagic‑gelatinous oedema.

Endocardial and/or epicardial haemorrhages (Figure 5) were also founded along to petechiae on the serosal surface of the large intestine. Typically, a distinct demarcation was noted between affected and unaffected tracts of the intestine. Haemorrhagic gastritis was also commonly recorded. Lymph nodes – with the only exception of the mesenteric ones – appeared enlarged because of oedema and haemorrhages.

Laboratory tests The genome of the African Horse Sickness virus was detected in blood and/or tissue samples from all the 92 horses included in the study. However, it was possible to isolate AHSV only from 50 horses. Of these ones, 25 were affected with the peracute/acute form, 11 with the sub‑acute form, 9 with the mild AHS fever, and 5 were found dead without clinical records. The virus was most frequently isolated from spleen and lymph nodes, and the isolated strains belonged to serotypes 1, 2, 4, 6, 7, 8 and 9 (Table II).

Veterinaria Italiana 2015, 51 (2), 123-130. doi: 10.12834/VetIt.200.617.3

Figure 5. Sub-acute form of African horse sickness in a horse during an outbreak in Namibia between 2006 and 2013. Disseminated endocardial haemorrhages.

Table II. African horse sickness virus (AHSV) serotypes identified in Namibian districts between 2006 and 2013.

Namibian District Grootfontein Windhoek Otjiwarongo Bethanie Okahandja Outjo Gobabis Windhoek Kharibib Omaruru Swakopmund Mariental

AHSV serotypes 4 1, 2, 4, 6, 8, 9 9 7 1, 4, 6, 9 9 2, 6, 8 9 8 8 2 9

Molecular characterisation The Seg‑10s of 5 AHSV strains were partially sequenced (Table III). According to the Seg‑10 phylogenetic analysis, AHSV strains are divided in

127

Scacchia et al.

AHS in Namibia from 2006 to 2013

Table III. Details of the Namibian strains selected for Seg-10 partial sequencing between 2006 and 2013.

Virus AHSV 1_Namibia 2008 AHSV 2_Namibia_2006 AHSV 4_Namibia_2006 AHSV 4_Namibia_2008 AHSV 9_Namibia_2008

Serotype 1 2 4 4 9

Year of collection 2008 2006 2006 2008 2008

Tissue Spleen Lymph node Blood Spleen Lymph node

Municipality (District) Okahandja (Okahandja) Witvlei (Gobabis) Okahandja (Okahandja) Omitara (Windhoek) Derm (Mariental)

3 phylogenetic clades, which have been indicated as α, β and γ (Quan et al. 2008, Sailleau et al. 1997, van Niekerk et al. 2001). The Namibian AHSV strains were closely related to the South African strains. The AHSV 4_Namibia_2006, the AHSV 4_Namibia_2008, and the AHSV 9_Namibia_2008 clustered in the α clade, whereas the AHSV 1_Namibia 2008 and the AHSV 2_Namibia_2006 clustered in the γ clade. A high level of sequence homology (close to 100%) was observed between AHSV 4_Namibia_2006 and AHSV 4_Namibia_2008 (α clade), as well as between AHSV 1_Namibia_2008 and AHSV 2_Namibia_2006 (γ clade). The seg‑10 sequence of AHSV 9_ Namibia_2008 was included in the α clade (Figure 6).

Discussion African horse sickness represents a major health concern and negatively impacts the equine industry, mainly in those countries, such as Namibia, where high quality horses are bred and vaccination is not compulsory. A freeze‑dried, polyvalent, live attenuated vaccine against AHS (Onderstepoort Biological Products, OBP) is currently used in Africa.

Horses should be inoculated 3 times – at 6, 9, and 12 months of age – and then annually re‑vaccinated, before the rainy season, to become immune to all the serotypes in the vaccine. As a result, the immune status of Namibian horses is likely to be variable, such speculation reasonably explaining the occurrence of severe, sometimes fatal AHS, in a number of immunized horses. Furthermore, a growing body of evidence indicates that prophylactic immunization against AHS is useful to prevent serious losses, but cannot fully protect horses from infection and disease under natural condition (Coetzer et al. 2004, Crafford et al. 2013, Weyer et al. 2013, Molini et al. forthcoming).

Furthermore, AHSV‑5 is not included in OBP vaccine because of severe, sometimes fatal, adverse reactions reported in immunized animals.

At the same time, AHSV‑9 is not included in the OBP vaccine because considered of low virulence, epidemiologically irrelevant in Southern Africa, and antigenically cross‑related with AHSV‑6. However, AHSV‑5 and AHSV‑9 have been causing several AHS outbreaks in that region since 2006 (von Teichman

128

Figure 6. Phylogenetic tree. Genetic relationships among African horse sickness virus isolates.

The tree was constructed on the basis of a 665 bp fragment of the Seg-10. Black spots indicate the unique sequences obtained in the present study. The following data identify each strain: serotype, Country, year of collection, GenBank accession numbers. Analyses have been carried out by means of MEGA 5 software and maximum likelihood method (Tamura et al. 2011). Bootstrap support values >70 are shown (1,000 replicates). To facilitate the comprehension of data, highly similar sequences have been collapsed in clusters (Table S1, available online).

Veterinaria Italiana 2015, 51 (2), 123-130. doi: 10.12834/VetIt.200.617.3

Scacchia et al.

et al. 2010). Interestingly enough, AHSV‑9 has been detected in peracute/acute, sub‑acute, and mild AHS‑affected horses under study. Therefore, our data show that AHSV‑9 is relevant in Southern Africa (von Teichman et al. 2010), and/or that the vaccine does not confer protection against that serotype, in spite of the antigenic cross‑relation with AHSV‑6. As suggested by Howell (Howell 1960), AHSV‑9 strains provided with different pathogenicity may be also present in that region.

Our results confirm RT‑PCR as the first choice diagnostic tool. Spleen, tracheo‑bronchial, and mediastinal lymph nodes are appropriate tissue samples for virus isolation, although it is worthwhile stressing that these samples could be negatively influenced by pH and temperature changes during transport to the laboratory (Coetzer et al. 2004)1.

Although preliminary and partial, phylogenetic analyses suggest that a common viral population could circulate in Namibia and South Africa. In fact, the comparison of Seg‑10 sequences did not generate geographically distinct virus lineages (topotypes), as observed in other Orbiviruses (Balasuriya et al. 2008). Up to date, almost exclusively Namibian and South Africa AHSV strains have been sequenced. Therefore, implementing the gene sequence database is of crucial relevance to define the existence of different AHSV topotypes.

AHSV 1_Namibia_2008 and AHSV 2_Namibia_2006 show an almost identical Seg‑10, which is closely related with Seg‑10 of several attenuated vaccine strains (Genbank accession: AF276693, AF276700 and U59279). Similarly, Seg‑10s of AHSV 4_Namibia_2006

Veterinaria Italiana 2015, 51 (2), 123-130. doi: 10.12834/VetIt.200.617.3

AHS in Namibia from 2006 to 2013

and AHSV 4_Namibia_2008 are closely related with an AHSV‑6 vaccine strain (AF276686). These findings suggest that the reassortment of genomic segments may have occurred between field and vaccine viruses. In this respect, it would be worthy of interest to evaluate if AHSV circulates among immunized, sub‑clinically AHS‑affected horses in Namibia; in that case, the genetic constitution of such viruses should be carefully investigated.

A global approach is mandatory to effectively contrast trans boundary animal diseases. From that perspective, the cooperation network among IZSAM, on one side, and a number of Institutions and diagnostic laboratories located in the Mediterranean basin, Balkan area, Southern America, and Central‑Southern Africa, on the other side, is a strategy of paramount relevance.

In particular, IZSAM has been working in Namibia since 1996, to develop diagnostic tests and vaccines against emerging infectious diseases endemic in the tropics, such as AHS and Rift Valley fever (Caporale et al. 2009, Monaco et al. 2013).

AHS still represents a major concern for animal health, and the recent expansion of bluetongue virus northwards indicates that AHSV could enter into Europe (Alba et al. 2004, Mellor and Hamblin 2004, Sellers et al. 1978), thus further enhancing the need of valuable diagnostic tools and effective control strategies against vector‑borne diseases.

In this context, we consider of particular value the description of clinical, pathological, and laboratory findings provided in this article, which are crucial for a prompt differential diagnosis and control of AHS, especially in naïve areas.

129

AHS in Namibia from 2006 to 2013

Scacchia et al.

References Alba A., Casal J. & Domingo M. 2004. Possible introduction of bluetongue into the Balearic Islands, Spain, in 2000, via air streams. Vet Rec, 155, 460‑461.

Anwar M. & Qureshi A. 1972. Control and eradication of African horse sickness in Pakistan. In Control and eradication viral diseases in the CENTO region (M.M. Lawrence, ed). Central Treaty Organisation, Ankara, 110‑112.

Balasuriya U.B.R., Nadler S.A., Wilson W.C., Pritchard L.I., Smythe A.B., Savini G., Monaco F., De Santis P., Zhang N., Tabachnick W.J. & MacLachlan N.J. 2008. The NS3 proteins of global strains of bluetongue virus evolve into regional topotypes through negative (purifying) selection. Vet Microbiol, 126, 91-100.

Caporale V., Lelli R., Scacchia M. & Pini A. 2009. Namibia: an example of international cooperation in the study of emerging diseases. Vet Ital, 45 (2), 249‑253.

Coetzer J.A.W. & Guthrie A.J. 2004. African Horse Sickness.

In Infectious diseases of livestock (J.A.W. Coetzer & R.C. Tustin, eds). Southern Africa, Oxford University Press, 1231‑1246.

Crafford J.E., Lourens C.W., Gardner I.A., Maclachlan N.J. & Guthrie A.J. 2013. Passive transfer and rate of decay of maternal antibody against African horse sickness virus in South African Thoroughbred foals. Equine Vet J, 45 (5), 604‑607. de Sá R.O., Zellner M. & Grubman M.J. 1994. Phylogenetic analysis of segment 10 from African horsesickness virus and cognate genes from other orbiviruses. Virus Res, 33 (2), 157‑165.

Howell P. 1960. The 1960 epizootic in the Middle East and SW Asia. J S Afr Vet Assoc, 31, 329‑334.

Quan M., van Vuuren M., Howell P.G., Groenewald D. & Guthrie A.J. 2008. Molecular epidemiology of the African horse sickness virus S10 gene. J Gen Virol, 89, 1159‑1168.

Diouf N.D., Etter E., Lo M.M., Lo M. & Akakpo A.J. 2013.

Outbreaks of African horse sickness in Senegal, and methods of control of the 2007 epidemic. Vet Rec, 172 (6), 152.

Sailleau C., Moulay S. & Zientara S. 1997. Nucleotide sequence comparison of the segments S10 of the nine African horsesickness virus serotypes. Arch Virol, 142, 965-978.

Sailleau C., Hamblin C., Paweska J.T. & Zientara S. 2000.

Identification and differentiation of the nine African horse sickness virus serotypes by RT‑PCR amplification of the serotype‑specific genome segment 2. J Gen Virol, 81, 831‑837.

Scacchia M., Lelli R., Peccio A., Di Mattia T., Mbulu R.S., Hager A.L., Monaco F., Savini G & Pini A. 2009. African horse sickness: a description of outbreaks in Namibia.

Vet Ital, 45 (2), 265‑74.

Sellers R.F., Pedgeley D.E. & Tucker M.R. 1978. Possible windborne spread of bluetongue to Portugal, June‑July 1956. J Hyg (London), 81, 189‑196.

Stone‑Marschat M.A., Carville A., Skowronek A. & Laegreid W.W. 1994. Detection of african horse sickness virus by reverse transcription‑PCR. J Clin Microbiol, 32 (3), 697‑700.

Howell P. 1963. African Horse Sickness. In Emerging diseases of animals. FAO Agricultural Studies n. 61.

Rome , FAO, 71‑108.

Tamura K., Peterson D., Peterson N., Stecher G., Nei M. & Kumar S. 2011. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol, 28, 2731‑2739.

Laaberki A. 1969. Évolution d'une épizootie de peste équine africaine au Maroc. Bull Off Int Epizoot, 71, 921‑936.

van Staden V. & Huismans H. 1991. A comparison of the genes which encode non‑structural protein NS3 of different orbiviruses. J Gen Virol, 72, 1073-1079.

Mellor P.S. & Hamblin C. 2004. African horse sickness. Vet Res, 35, 445-466.

van Niekerk M., van Staden V., Van Dijk A. A. & Huismans H. 2001. Variation of African horse sickness virus nonstructural protein NS3 in southern Africa. J Gen Virol, 82, 149-158.

Molini U., Marruchella G., Maseke A., Ronchi F, Di Ventura M., Salini R., Scacchia M. & Pini A. 2015. Serological immune response in horses vaccinated with African horse sickness polyvalent live attenuated vaccine and occurrence of disease in a Namibian farm. Trials in Vaccinology, in press.

Monaco F., Polci A., Lelli R., Pinoni C., Di Mattia T., Mbulu R.S., Scacchia M. & Savini G. 2011. A new duplex real‑time RT‑PCR assay for sensitive and specific detection of African horse sickness virus. Mol Cell Probes, 25 (2‑3), 87‑93.

Monaco F., Pinoni C., Cosseddu G.M., Khaiseb S., Calistri P., Molini U., Bishi A., Conte A., Scacchia M. & Lelli R. 2013.

130

Rift valley Fever in Namibia, 2010. Emerg Infect Dis, 19 (12), 2025‑2027.

von Teichman B.F., Dungu B. & Smit T.K. 2010. In vivo cross‑protection to African horse sickness serotypes 5 and 9 after vaccination with serotypes 8 and 6. Vaccine, 28, 6505‑6517.

Weyer C.T., Quan M., Joone C., Lourens C.W., MacLachlan N.J. & Guthrie A.J. 2013. African horse sickness in naturally infected, immunized horses. Equine Vet J, 45 (1), 117‑119.

World Organisation for Animal Health (OIE). 2012. African horse sickness. In Manual of standard for diagnostic tests and vaccines for terrestrial animals. OIE, Paris, France.

Veterinaria Italiana 2015, 51 (2), 123-130. doi: 10.12834/VetIt.200.617.3

Vector species of Culicoides midges implicated in the 2012‑2014 Bluetongue epidemics in Italy Maria Goffredo*, Monica Catalani, Valentina Federici, Ottavio Portanti, Valeria Marini, Giuseppe Mancini, Michela Quaglia, Adriana Santilli, Liana Teodori & Giovanni Savini Istituto Zooprofilattico Sperimentale dell’Abruzzo e del Molise ‘G. Caporale’, Campo Boario, 64100 Teramo, Italy. * Corresponding author at: Istituto Zooprofilattico Sperimentale dell’Abruzzo e del Molise ‘G. Caporale’, Campo Boario, 64100 Teramo, Italy.

Tel.: + 39 0861 332416, Fax: +39 0861 332251, e‑mail: m.goffredo@izs.it.

Veterinaria Italiana 2015, 51 (2), 131-138. doi: 10.12834/VetIt.771.3854.1 Accepted: 06.06.2015 | Available on line: 30.06.2015

Keywords Bluetongue, Culicoides, C. newsteadi, C. punctatus, Vector competence.

Summary In 2012, serotypes 1 and 4 of bluetongue virus (BTV) entered and co‑circulated in Sardinia.

The following year, BTV‑1 spread all over Sardinia and invaded Sicily and the Italian Tyrrenian coast. In 2014, this strain spread extensively in mainland Italy, causing severe outbreaks.

In late 2014, BTV‑4 was detected in Southern Italy (Apulia region). This study reports the detection of BTV in species of Culicoides (Diptera: Ceratopogonidae) collected in Italy during the epidemics between 2012 and 2014. A total of 2,925 pools (83,102 midges), sorted from 651 collections made on 339 affected farms of 12 Italian regions, were tested for the presence of BTV by real time polymerase chain reaction (RT‑PCR). The study clearly shows that Culicoides imicola and Obsoletus complex have played a crucial role in the bluetongue (BT) epidemics in Italy in 2012‑2014. Nevertheless, it also shows that other species may have played a role in transmitting BTV during these outbreaks. Culicoides dewulfi and at least 3 species of the Pulicaris complex, namely Culicoides pulicaris, Culicoides newsteadi and Culicoides punctatus, were found positive to BTV. Serotype 1 was detected in all species tested, whereas the BTV‑4 was detected in the Obsoletus complex, C. imicola, and C. newsteadi.

Specie di Culicoides coinvolte nell’epidemia di Bluetongue 2012‑2014 in Italia Parole chiave Bluetongue, Culicoides, C. newsteadi, C. punctatus, Competenza vettoriale.

Riassunto Nel 2012 i sierotipi 1 e 4 del virus della bluetongue (BTV) sono entrati ed hanno circolato in Sardegna. L’anno seguente il BTV‑1 si è diffuso in tutta l’isola, in Sicilia e nelle coste tirreniche italiane mentre, nel 2014, ha invaso gran parte della penisola italiana causando numerosi focolai e casi clinici. Infine, verso la fine dello stesso anno, il BTV‑4 è stato nuovamente rilevato nell’Italia meridionale, in Puglia. Questo studio descrive le specie di Culicoides (Diptera: Ceratopogonidae) in cui è stato possibile rilevare il BTV nelle epidemie 2012‑2014.

Gli insetti sono stati catturati in 12 regioni italiane, in 339 allevamenti colpiti dalla bluetongue (BT). In totale 2.925 pool (composti da 83.102 Culicoides), selezionati da 651 catture, sono stati analizzati per BTV tramite real time RT‑PCR. Questo studio mostra chiaramente il ruolo cruciale giocato da Culicoides imicola e Obsoletus complex in Italia durante le epidemie di BT occorse tra il 2012 e il 2014. Evidenzia inoltre come altre specie possono aver giocato un ruolo nella trasmissione del virus. Culicoides dewulfi e almeno 3 specie del Pulicaris complex, precisamente Culicoides pulicaris, Culicoides newsteadi e Culicoides punctatus, sono infatti risultate positive al BTV. Il sierotipo BTV‑1 è stato riscontrato in tutte le specie testate, mentre l’Obsoletus complex, C. imicola e C. newsteadi sono risultati positivi anche al BTV‑4.

Introduction In the late 1990s, when bluetongue (BT) re‑appeared in the Mediterranean basin, knowledge about the vectors in this area was scanty. Apart from the major renowned vector Culicoides imicola, 2 additional species were listed as potential vectors of bluetongue

virus (BTV) in Europe, namely Culicoides obsoletus and Culicoides pulicaris. Culicoides obsoletus was incriminated as a BTV vector in Cyprus in 1979 and it was believed to sustain the outbreaks in Bulgaria in 1998. Culicoides pulicaris was included as a potential vector of BTV after the African horse sickness virus

131

Goffredo et al.

Vectors and Bluetongue in Italy

was isolated from a mixed pool of C. obsoletus and C. pulicaris in Spain in 1989 (Mellor and Pitzolis 1979, Mellor et al. 1990).

During the last decade, following numerous incursions of various BTV serotypes in Europe, the knowledge on the capability of several species of Culicoides to transmit orbiviruses in general, and BTV in particular, greatly improved. Thanks to morphologic and phylogenetic studies, the taxonomy of the potential Palearctic vector species C. obsoletus and C. pulicaris ‘groups’ was further clarified, even though it can be still considered an ‘unfinished business’ (Meiswinkel et al. 2004, Harrup et al. 2015, Nielsen and Kristensen 2015).

Culicoides pulicaris belongs to the subgenus Culicoides (Culicoides). At present, this subgenus includes about 50 species that should probably be divided into at least 4 subgenera. The subgenus Culicoides sensu stricto includes, among others, some species commonly found in Italy such as Culicoides pulicaris Linné, 1758; Culicoides punctatus Meigen, 1818; Culicoides newsteadi Austen, 1921; and Culicoides lupicaris Downes and Kettle, 1952.

Moreover, the subgenus Culicoides could be divided into at least 3 species complexes: the Pulicaris, Newsteadi, and Impunctatus complexes and, finally, more than one taxon probably refer to C. pulicaris and C. newsteadi (Meiswinkel et al. 2004, Gomulski et al.

2006, EFSA 2008, Harrup et al. 2015). In this study, for convenience, the species belonging to the subgenus Culicoides were referred to as the ‘Pulicaris complex’.

collected in Italy during the epidemics between 2012 and 2014 and in which BTV could be detected, with a particular focus on the midges belonging to the Pulicaris complex (C. newsteadi, C. pulicaris, and C. punctatus).

Materials and methods Culicoides light trap collections were performed according to the protocol of the National Reference Center for Exotic Diseases (Goffredo and Meiswinkel 2004). Culicoides were collected on farms where BTV circulation was demonstrated by seroconversions of sentinel animals and/or clinical outbreaks.

The Culicoides collected were identified (Campbell and Pelham‑Clinton 1960, Delécolle 1985, Goffredo and Meiswinkel 2004) and age‑graded (Dyce 1969).

Particularly, C. pulicaris, C. punctatus, and C. newsteadi were identified according to the wing morphology as described by Delécolle (Delécolle 1985). When it was not possible to assign a midge to any of these 3 taxa based on these criteria, the species was classified as belonging to the Pulicaris complex.

The parous females were divided in pools of not more than 50 midges. The pools were tested for BTV by real time polymerase chain reaction (RT‑PCR)

To date, in Europe, BTV was isolated from C. imicola, C. obsoletus/scoticus, and C. pulicaris. The genome of BTV was also detected from parous females of C. dewulfi, C. chiopterus, C. lupicaris, and C. obsoletus (Caracappa et al. 2003, Savini et al. 2005, Vanbinst et al. 2009, Romón et al. 2012).

Within the Pulicaris complex, C. punctatus and C. newsteadi are known to be widespread and abundant in Europe, but have never been found infected with orbiviruses in the field (EFSA 2008, Meiswinkel et al. 2008).

In 2012, serotypes 1 and 4 of BTV entered and co‑circulated in Sardinia. The following year, in absence of vaccination, BTV‑1 spread throughout Sardinia and invaded Sicily and the Italian Tyrrenian coast. In 2014, the same strain spread extensively in mainland Italy, causing severe outbreaks. In late 2014, serotype 4 of BTV was detected in Southern Italy (Apulia region) (Figure 1).

The National Entomological Surveillance Plan for Bluetongue, which is in place in Italy since 2001. includes Culicoides collections on BTV affected farms with the goal of identifying and evaluating the vector species involved in virus transmission.

This study reports on the species of Culicoides

132

Figure 1. Culicoides collection sites and bluetongue circulation in Italy (seroconversions and/or clinical outbreaks) during the epidemics 2012-2014.

Veterinaria Italiana 2015, 51 (2), 131-138. doi: 10.12834/VetIt.771.3854.1

Goffredo et al.

Vectors and Bluetongue in Italy

(BTVHof, Hofmann et al. 2008) or processed with a commercial real time PCR kit able to recognize all known BTV serotypes (BTVLSI, LSI ‑ Laboratoire Service International Lissieu, France ‑ VetMAX™ Bluetongue Virus NS3 Real‑Time PCR Kit, all genotypes).

Threshold cycle (Ct) values of less than 50 or 40, respectively, were considered positive. Serotyping

was performed on all BTV positive samples by using the TaqVet European BTV Typing kit (BTVsero, LSI ‑ Laboratoire Service International Lissieu, France).

If necessary midges belonging to the Obsoletus complex were identified with a multiplex PCR based on internal transcribed spacer 2 ribosomal DNA sequences (ITS2) (Gomulski et al. 2005).

Table I. Adult parous females of Culicoides, tested during the 2012-2014 bluetongue epidemics in Italy (from 651 collections made on 339 affected farms).

Region and species ABRUZZO C. dewulfi C. newsteadi C. pulicaris C. punctatus Nubeculosus complex Obsoletus complex Pulicaris complex APULIA C. dewulfi C. imicola C. newsteadi C. pulicaris C. punctatus Obsoletus complex Pulicaris complex CALABRIA C. dewulfi C. newsteadi C. pulicaris C. punctatus Obsoletus complex Pulicaris complex CAMPANIA C. dewulfi C. imicola C. newsteadi C. pulicaris C. punctatus Nubeculosus complex Obsoletus complex Pulicaris complex EMILIA ROMAGNA C. dewulfi C. pulicaris C. punctatus Obsoletus complex Pulicaris complex LAZIO C. newsteadi C. pulicaris Obsoletus complex

Number of positive/tested pools; Number of tested midges (Minimum Infection Rate %) 2012 2013 2014 Total 0/31; 502 94/338; 7,764 (1.2) 94/369; 8,266 (1.1) 2/18; 40 (5) 2/18; 40 (5) 0/1; 1 0/1; 1 0/3; 7 7/44; 204 (3.4) 7/47; 211 (3.3) 0/2; 5 5/20; 263 (1.9) 5/22; 268 (1.9) 1/4; 12 (8.3) 1/4; 12 (8.3) 0/26; 490 76/211; 7,079 (1.1) 76/237; 7,569 (1) 3/40; 165 (1.8) 3/40; 165 (1.8) 0/17; 337 45/190; 3,262 (1.4) 45/207; 3,599 (1.3) 0/2; 2 0/2; 2 4/5; 218 (1.8) 4/5; 218 (1.8) 0/5; 35 1/15; 35 (2.9) 1/20; 70 (1.4) 0/2; 99 3/20; 350 (0.9) 3/22; 449 (0.7) 0/1; 1 1/7; 9 (11.1) 1/8; 10 (10) 0/9; 202 10/75; 1,097 (0.9) 10/84; 1,299 (0.8) 26/66; 1,551 (1.7) 26/66; 1,551 (1.7) 106/179; 6,425 (1.6) 106/179; 6,425 (1.6) 0/1; 2 0/1; 2 2/7; 70 (2.9) 2/7; 70 (2.9) 1/7; 78 (1.3) 1/7; 78 (1.3) 0/5; 7 0/5; 7 102/149; 6,226 (1.6) 102/149; 6,226 (1.6) 1/10; 42 (2.4) 1/10; 42 (2.4) 0/46; 1,172 42/322; 7,426 (0.6) 42/368; 8,598 (0.5) 0/24; 265 0/24; 265 0/3; 9 0/3; 9 0/9; 220 0/11; 19 0/20; 239 0/6; 30 0/20; 182 0/26; 212 0/8; 170 0/23; 163 0/31; 333 0/3; 3 0/3; 3 0/20; 749 41/179; 6,490 (0.6) 41/199; 7,239 (0.6) 1/62; 298 (0.3) 1/62; 298 (0.3) 1/21; 334 (0.3) 1/21; 334 (0.3) 0/1; 1 0/1; 1 0/1; 1 0/1; 1 0/1; 1 0/1; 1 1/15; 323 (0.3) 1/15; 323 (0.3) 0/3; 8 0/3; 8 0/3; 5 0/3; 5 0/1; 3 0/1; 3 0/1; 1 0/1; 1 0/1; 1 0/1; 1 continued

Veterinaria Italiana 2015, 51 (2), 131-138. doi: 10.12834/VetIt.771.3854.1

133

Goffredo et al.

Vectors and Bluetongue in Italy

The Minimum Infection Rate (MIR) was calculated by dividing the number of positive pools by the number of midges tested. The MIR is calculated on the assumption that a positive pool contains only 1 infected midge, an assumption that may have underestimated high infection rates.

Results A total of 651 collections were assayed for the presence of BTV between 2012 and 2014. The collections were made on 339 affected farms in 12 Italian regions including Southern Italy, Central

Table I. Adult parous females of Culicoides, tested during the 2012-2014 bluetongue epidemics in Italy (from 651 collections made on 339 affected farms).—cont’d Region and species LIGURIA C. pulicaris C. punctatus Obsoletus complex MARCHE C. imicola C. pulicaris C. punctatus Obsoletus complex Pulicaris complex SARDINIA C. imicola C. newsteadi C. pulicaris C. punctatus Obsoletus complex SICILY C. imicola C. newsteadi C. pulicaris C. punctatus Nubeculosus complex Obsoletus complex Pulicaris complex TUSCANY C. dewulfi C. imicola C. newsteadi C. pulicaris C. punctatus Nubeculosus complex Obsoletus complex Pulicaris complex UMBRIA C. dewulfi C. imicola C. newsteadi C. pulicaris C. punctatus Obsoletus complex Pulicaris complex Total

134

Number of positive/tested pools; Number of tested midges (Minimum Infection Rate %) 2012 2013 2014 Total 2/13; 192 (1) 2/13; 192 (1) 0/1; 1 0/1; 1 0/1; 1 0/1; 1 2/11; 190 (1.1) 2/11; 190 (1.1) 25/162; 6,185 (0.4) 25/162; 6,185 (0.4) 0/1; 1 0/1; 1 1/16; 280 (0.4) 1/16; 280 (0.4) 4/33; 1,097 (0.4) 4/33; 1,097 (0.4) 20/107; 4,792 (0.4) 20/107; 4,792 (0.4) 0/5; 15 0/5; 15 417/584; 23,538 (1.8) 39/121; 4,252 (0.9) 456/705; 27,790 (1.6) 387/454; 22,032 (1.8) 20/45; 2,002 (1) 407/499; 24,034 (1.7) 18/42; 1,364 (1.3) 5/46; 1,721 (0.3) 23/88; 3,085 (0.7) 1/10; 62 (1.6) 3/9; 89 (3.4) 4/19; 151 (2.6) 0/4; 6 4/7; 12 (33.3) 4/11; 18 (22.2) 11/74; 74 (14.9) 7/14; 428 (1.6) 18/88; 502 (3.6) 0/55; 683 181/348; 6,618 (2.7) 4/76; 495 (0.8) 185/479; 7,796 (2.4) 0/3; 51 123/160; 4,838 (2.5) 4/12; 130 (3.1) 127/175; 5,019 (2.5) 0/28; 546 46/111; 1,152 (4) 0/12; 41 46/151; 1,739 (2.6) 0/7; 47 3/11; 71 (4.2) 0/1; 3 3/19; 121 (2.5) 0/5; 13 0/5; 9 0/1; 1 0/11; 23 0/1; 2 0/1; 1 0/2; 3 0/12; 26 7/49; 417 (1.7) 0/19; 159 7/80; 602 (1.2) 2/11; 129 (1.6) 0/30; 160 2/41; 289 (0.7) 0/29; 691 31/136; 4,851 (0.6) 31/165; 5,542 (0.6) 0/5; 15 0/5; 15 0/1; 1 0/1; 1 0/3; 10 0/3; 10 0/4; 8 2/12; 118 (1.7) 2/16; 126 (1.6) 0/5; 71 0/3; 3 0/8; 74 0/1; 4 0/1; 4 0/14; 592 28/98; 4,578 (0.6) 28/112; 5,170 (0.5) 0/1; 5 1/18; 137 (0.7) 1/19; 142 (0.7) 120/254; 8,370 (1.4) 120/254; 8,370 (1.4) 0/4; 4 0/4; 4 0/1; 1 0/1; 1 0/1; 1 0/1; 1 3/23; 185 (1.6) 3/23; 185 (1.6) 3/17; 167 (1.8) 3/17; 167 (1.8) 111/180; 7,798 (1.4) 111/180; 7,798 (1.4) 3/28; 214 (1.4) 3/28; 214 (1.4) 417/639; 24,221 (1.7) 222/608; 13,769 (1.6) 468/1,678; 45,112 (1) 1,107/2,925; 83,102 (1.3)

Veterinaria Italiana 2015, 51 (2), 131-138. doi: 10.12834/VetIt.771.3854.1

Goffredo et al.

Vectors and Bluetongue in Italy

Table II. Threshold cycle (Ct) values of real time RT-PCR tests for BTV (total positive pools 1,107).

Species

Number of positive pools

C. dewulfi C. imicola C. newsteadi C. pulicaris C. punctatus Nubeculosus complex Obsoletus complex Pulicaris complex

2 538 72 24 17 1 416 37

BTVHof (positive <50) Min Max 20 46 30 43 33 42 36 44 22 44 33 37

Mean 32.1 37.3 36.3 39 37.5 35

Min 18 22 32 35 26 -

Ct values BTVLSI (positive < 40) Max 38 34 32 35 38 -

Mean 25.5 30.2 32 35 34.8 -

Min 27 18 25 35 36 38 21 32

BTVsero (positive < 45) Max 38 41 43 40 41 38 42 39

Mean 32.5 27.9 34.3 37.4 38.2 38 35.7 35.7

BTVHof = real time RT-PCR (Hofmann et al. 2008); BTVLSI = commercial real time PCR kit (LSI - Laboratoire Service International Lissieu, France - VetMAX™ Bluetongue Virus NS3 Real-Time PCR Kit, all genotypes); BTVsero = TaqVet European BTV Typing kit (LSI - Laboratoire Service International Lissieu, France).

A

B

100%

100%

90%

90%

80%

80%

70%

70%

60%

60%

50%

50%

40%

40%

30%

30%

20%

20%

10%

10%

0%

Central Italy Pulicaris complex C. imicola

Sardinia

Sicily

Obsoletus complex C. dewulfi

Southern Italy Nubeculosus complex

0%

Central Italy

Pulicaris complex

Sardinia

C. punctatus

Sicily

Southern Italy

C. pulicaris

C. newsteadi

Figure 2. Species composition of the Bluetongue virus positive pools (total pools 1,107) in Sardinia, Sicily, Southern Italy (Calabria, Apulia, Campania regions) and Central Italy (Abruzzo, Marche, Umbria, Tuscany, Southern parts of Emilia Romagna and Liguria regions). The species of the Pulicaris complex are shown as complex (A) and in detail (B).

Italy, and the main islands of Sicily and Sardinia (Figure 1).

In this study, 2,925 pools (83,102 midges) were sorted and tested for BTV. They were composed

by Obsoletus complex (43.2%), C. imicola (23.4%), C. newsteadi (10%), Pulicaris complex (9.4%), C. pulicaris (6.8%), C. punctatus (5%), C. dewulfi (1.9%), and Nubeculosus complex (0.3%). BTV was detected in 11 Italian regions, with the MIR ranging from 0.3% to 2.4%, in Emilia Romagna and Sicily, respectively (Table I). Overall 1,107 pools were positive for BTV resulting in a MIR of over 1%. The minimum, maximum, and mean Ct values are reported in Table II. Figure 2 shows the species composition of the positive pools according to regions.

Veterinaria Italiana 2015, 51 (2), 131-138. doi: 10.12834/VetIt.771.3854.1

All the taxa tested resulted positive to BTV, at least once. In particular, C. imicola, C. newsteadi, C. pulicaris, and the Obsoletus complex were found positive during the 3 epidemics 2012‑2014. The MIR of these 4 taxa can be seen in Figure 3.

BTV‑1 was detected in all species tested, whereas the BTV‑4 was detected in the Obsoletus complex collected in Apulia in 2014. In addition, BTV‑1 and BTV‑4 were simultaneously found in 14 pools of C. imicola and in 1 pool of C. newsteadi, collected in Sardinia in 2012.

Among the Obsoletus complex collected in Sardinia, and positive to BTV‑1, 42 individuals were identified at species level: 35 were C. scoticus (min Ct value 26, BTVLSI), 4 C. montanus (min Ct value 35, BTVLSI), and 3 C. obsoletus (min Ct value 34, BTVLSI).

135

Goffredo et al.

Vectors and Bluetongue in Italy

4 3.5 3

MIR %

2.5 2 1.5 1 0.5

ia br Um

Tu

sc a

ny

ly Sic i

ia in rd

M ar

Sa

ch

e

ia ur Lig

Ro E m mi ag lia na

Ca m

pa

ni

a

ia br Ca la

lia Ap u

Ab r

uz zo

0

Region C. newsteadi

C. pulicaris

C. imicola

Obsoletus complex

Figure 3. Minimum Infection Rate (MIR %) in 4 Culicoides taxa, found positive for Bluetongue virus during 3 epidemics in Italy (2012-2014).

Discussion The results of this study clearly show that C. imicola and Obsoletus complex have played a crucial role in the BT epidemics in Italy in 2012‑2014. However, it also become evident that other species could have played a role in transmitting BTV during these outbreaks. Culicoides dewulfi and at least 3 species of the Pulicaris complex, namely C. pulicaris, C. newsteadi, and C. punctatus, were found positive to BTV. The Nubeculosus complex resulted positive as well, but only once, in Abruzzo region in 2014.

Furthermore, within the Obsoletus complex, 3 species were found positive for BTV in the field: C. scoticus, C. obsoletus and, for the first time, C. montanus in Sardinia.

136

2014, confirming the potential role of C. pulicaris in the epidemiology of BTV. Unexpectedly, BTV was also detected in C. punctatus and C. newsteadi which, to the best of our knowledge, had never been identified as BTV vectors before (Meiswinkel et al. 2007, Meiswinkel et al. 2008, EFSA 2008).

According to WHO (WHO 1967), to assess the vector competence of a Culicoides species for viruses such as BTV, 4 criteria should be satisfied: i) the species should be associated to the disease in the field; ii) the virus should be recovered from field collected adult females, which do not have a fresh blood meal in the abdomen; iii) the species should be able to become infected after oral infection; iv) the species should be able to biologically transmit the infection.

BTV‑1 and BTV‑4 were detected in C. imicola and in species of the Obsoletus complex collected during these 3 years of epidemics. When examining the species composition of the positive pools, C. imicola was particularly relevant in Sardinia and Sicily, while the Obsoletus complex was dominant in Southern and Central Italy (Figure 2 A).

Very few of the Culicoides species, considered as potential vectors, have satisfied all 4 requirements (i.e. C. imicola), and, actually, the detection of viral genome by PCR in field collected Culicoides, has been recently used to impeach ‘new’ European vectors, i.e. C. dewulfi and C. chiopterus (Meiswinkel et al. 2007, Dijkstra et al. 2008).

According to this survey, species of Pulicaris complex, although to a lesser extent, also seem to have played a role in all the affected areas (Figure 2 A). Regarding the species of the complex involved, as expected BTV‑1 was found in C. pulicaris. Bluetongue virus was previously isolated from this species in Italy (Caracappa et al. 2003). In the present study, positive pools of C. pulicaris were collected from 8 regions during the 3 epidemics occurred between 2012 and

The Ct values could give further indications on vector competence of species found positive to real time RT‑PCR in the field (Veronesi et al. 2013).

Low Ct values, indicating high amounts of viral RNA, may not always be sufficient to demonstrate that viable virus are present. On the contrary, it is indeed possible to isolate viable virus from pools with high Ct values. Nevertheless, in this study, among the ‘new’ potential BTV vector species, C. newsteadi

Veterinaria Italiana 2015, 51 (2), 131-138. doi: 10.12834/VetIt.771.3854.1

Goffredo et al.

showed low Ct values (min. 22, when utilizing a cut‑off value of 40) comparable to those of ‘known’ vectors, such as C. imicola, C. pulicaris, Obsoletus complex, and C. dewulfi (Table II). The RNA of BTV was repeatedly found in parous females of C. newsteadi and C. punctatus collected in areas where BTV was circulating, as demonstrated by seroconversions in sentinel animals or presence of clinical outbreaks.

Within the Pulicaris complex, C. newsteadi represented more than 70% of the positive pools in Sicily and Sardinia (Figure 2 B). Positive pools were, however, also found in Apulia and Calabria during the 2014 epidemic (Table I). In addition, BTV‑1 and BTV‑4 were simultaneously detected in a single pool of C. newsteadi.

Culicoides punctatus resulted positive to BTV‑1 in 5 regions (Sardinia, Southern and Central Italy) in 2 BTV seasons (Table I; Figure 2 B). This species was recently also found positive for Schmallenberg virus in Poland (Larska et al. 2013) and it was previously reported in literature as a potential vector of epizootic haemorrhagic disease virus (EHDV), an Orbivirus closely related to BTV (Yanase et al. 2005).

Vectors and Bluetongue in Italy

Culicoides dewulfi has been listed as a BTV vector since 2006, after it was found positive to BTV, during the BTV‑8 outbreak in Northern Europe (Meiswinkel et al. 2007). In Italy, BTV has never been detected in this species and the finding of this survey represents the first record.

In conclusion, the results of this study implicate multiple vectors in the recent epidemics of BTV‑1 and, to a lesser extent, of BTV‑4. Although further field and laboratory studies are needed to proof the vector status of these species, this survey also indicates that C. newsteadi and C. punctatus might act as BTV vectors. Further studies are also required to better know the possible role as vector played by species of Nubeculosus complex (including in Italy at least C. nubeculosus, C. puncticollis, and C. riethi), and by C. montanus, a species belonging to the Obsoletus complex. Other significant information provided by this survey is that, as demonstrated in other European countries, C. dewulfi may also be responsible of BTV transmission in Italy. However, because of its low relative abundance, it probable does not play a pivotal role.

References Campbell J.A. & Pelham‑Clinton E.C. 1960. A taxonomic review of the British species of Culicoides Latreille (Diptera: Ceratopogonidae). Proc R Soc Edinburgh, 67 (3), 181‑302.

the subgenus Avaritia Fox, 1955 including Culicoides obsoletus (Diptera, Ceratopogonidae) in Italy based on internal transcribed spacer 2 ribosomal DNA sequences. Syst Entomol, 30 (4), 619‑631.

Caracappa S., Torina A., Guercio A., Vitale F., Calabrò A., Purpari G., Ferratelli V., Vitale M. & Mellor P.S. 2003.

Identification of a novel bluetongue virus vector species of Culicoides in Sicily. Vet Rec, 153 (3), 71‑74.

Gomulski L.M., Meiswinkel R., Delécolle J.C., Goffredo M. & Gasperi G. 2006. Phylogeny of the subgenus Culicoides and related species in Italy, inferred from internal transcribed spacer 2 ribosomal DNA sequences. Med Vet Entomol, 20 (2), 229‑238.

Delécolle J.C. 1985. Nouvelle contribution à l'étude systématique et iconographique des espéces du genre Culicoides (Diptera: Ceratopogonidae) du Nord‑Est de la France. Thesis, Université Louis Pasteur de Strasbourg, UER Sciences, Vie et terre, 238 pp.

Harrup L.E., Bellis G.A., Balenghien T. & Garros C. 2015.

Culicoides Latreille (Diptera: Ceratopogonidae) taxonomy: current challenges and future directions.

Infect Genet Evol, 30, 249‑266.

Dijkstra E., van der Ven I.J., Meiswinkel R., Holzel D.R. & Van Rijn P.A. 2008. Culicoides chiopterus as a potential vector of bluetongue virus in Europe. Vet Rec, 162 (13), 422.

Hofmann M., Griot C., Chaignat V., Perler L. & Thür B. 2008.

Bluetongue disease reaches Switzerland. Schweiz Arch Tierheilkd, 150 (2), 49‑56.

Dyce A.L. 1969. The recognition of nulliparous and parous Culicoides (Diptera: Ceratopogonidae) without dissection. J Aust Entomol Soc, 8 (1), 11‑15.

Larska M., Lechowski L., Grochowska M. & Żmudziński J.F. 2013. Detection of the Schmallenberg virus in nulliparous Culicoides obsoletus/scoticus complex and C. punctatus ‑ The possibility of transovarial virus transmission in the midge population and of a new vector. Vet Microbiol, 166 (3), 467‑473.

European Food Safety Authority (EFSA). 2008. Scientific Opinion of the Panel on Animal Health and Welfare on a request from the European Commission (DG SANCO) on Bluetongue. EFSA J, 735, 1‑70.

Goffredo M. & Meiswinkel R. 2004. Entomological surveillance of bluetongue in Italy: methods of capture, catch analysis and identification of Culicoides biting midges. Vet Ital, 40 (3), 260‑265.

Gomulski L.M., Meiswinkel R., Delécolle J.C., Goffredo M. & Gasperi G. 2005. Phylogenetic relationships of

Veterinaria Italiana 2015, 51 (2), 131-138. doi: 10.12834/VetIt.771.3854.1

Meiswinkel R., Baldet T., De Deken R., Takken W., Delécolle J.C. & Mellor P.S. 2008. The 2006 outbreak of bluetongue in northern Europe ‑ the entomological perspective.

Prev Vet Med, 87 (1), 55‑63.

Meiswinkel R., Gomulski L., Delécolle J.C., Goffredo M. & Gasperi G. 2004. The biosystematics of Culicoides vector complexes – unfinished business. Vet Ital, 40 (3), 151‑159.

137

Vectors and Bluetongue in Italy

Meiswinkel R., van Rijn P., Leijs P. & Goffredo M. 2007.

Potential new Culicoides vector of bluetongue virus in northern Europe. Vet Rec, 161 (16), 564‑565.

belonging to the Obsoletus complex (Culicoides, Diptera: Ceratopogonidae) in Italy. Vet Rec, 157 (5), 133‑143.

Mellor P.S. & Pitzolis G. 1979. Observations on breeding sites and light‑trap collections of Culicoides during an outbreak of bluetongue in Cyprus. Bull Entomol Res, 69 (2), 229‑234.

Vanbinst T., Vandenbussche F., Vandemeulebroucke E., De Leeuw I., Deblauwe I., De Deken G., Madder M., Haubruge E., Losson B. & De Clercq K. 2009. Bluetongue virus detection by real‐time RT‐PCR in Culicoides captured during the 2006 epizootic in Belgium and development of an internal control. Transbound Emerg Dis, 56 (5), 170‑177.

Mellor P.S., Boned J., Hamblin C. & Graham S. 1990.

Isolations of African horse sickness virus from vector insects made during the 1988 epizootic in Spain.

Epidemiol Infect, 105 (2), 447‑454.

Nielsen S.A. & Kristensen M. 2015. Delineation of Culicoides species by morphology and barcode exemplified by three new species of the subgenus Culicoides (Diptera: Ceratopogonidae) from Scandinavia. Parasit Vectors, 8 (1), 151.

Romón P., Higuera M., Delécolle J.C., Baldet T., Aduriz G. & Goldarazena A. 2012. Phenology and attraction of potential Culicoides vectors of bluetongue virus in Basque Country (northern Spain). Vet Parasitol, 186 (3), 415‑424.

Savini G., Goffredo M., Monaco F., Di Gennaro A., Cafiero M.A., Baldi L., De Santis P., Meiswinkel R. & Caporale V. 2005. Bluetongue virus isolations from midges

138

Goffredo et al.

Veronesi E., Antony F., Gubbins S., Golding N., Blackwell A., Mertens P.P., Brownlie J., Darpel K.E., Mellor P.S. & Carpenter S. 2013. Measurement of the infection and dissemination of bluetongue virus in Culicoides biting midges using a semi‑quantitative rt‑PCR assay and isolation of infectious virus. PLoS One, 8 (8), e70800.

World Health Organization (WHO). 1967. Arboviruses and Human Disease. World Health Organization Technical Report Series n. 369.

Yanase T., Kato T., Kubo T., Yoshida K., Ohashi S., Yamakawa M., Myura Y. & Tsuda T. 2005. Isolation of bovine arboviruses from Culicoides biting midges (Diptera: Ceratopogonidae) in southern Japan: 1985‑2002. J Med Entomol, 42 (1), 63‑67.

Veterinaria Italiana 2015, 51 (2), 131-138. doi: 10.12834/VetIt.771.3854.1

RAPID COMMUNICATION Bluetongue virus in Oryx antelope (Oryx leucoryx) during the quarantine period in 2010 in Croatia Sanja Bosnić1*, Relja Beck1, Eddy Listeš2, Ivana Lojkić1, Giovanni Savini3 & Besi Roić1 1 Croatian Veterinary Institute, Savska cesta 143, 10000 Zagreb, Croatia.

Croatian Veterinary Institute, Split Regional Veterinary Institute, Poljička cesta 33, 21000 Split, Croatia.

3 Istituto Zooprofilattico Sperimentale dell’Abruzzo e del Molise ‘G. Caporale’, Campo Boario, 64100 Teramo, Italy.

2

* Corresponding author at: : Laboratory of Parasitology, Croatian Veterinary Institute, Savska cesta 143, 10000 Zagreb, Croatia.

Tel.: +38 51 6123 658, fax: +38 51 6190 841, e‑mail: bosnic@veinst.hr.

Veterinaria Italiana 2015, 51 (2), 139-143. doi: 10.12834/VetIt.385.1795.2 Accepted: 09.04.2015 | Available on line: 30.06.2015

Keywords BTV‑1, BTV‑16, Croatia, Entomological survey, Oryx antelope, Quarantine.

Summary Bluetongue (BT) is a viral infectious non‑contagious disease of domestic and wild ruminants.

Insect species of the genus Culicoides (Diptera: Ceratopogonidae) serve as biological vectors that transmit bluetongue virus (BTV) to susceptible hosts. The infection is present in the Mediterranean region. Recently, it has also been reported in Central, Western, and Northern Europe where BTV‑8 was recognised as the causative serotype. In the meantime, BTV‑14 has appeared in the North‑Eastern part of Europe. In the present study, BTV serotype 16 (BTV‑16) was detected by virus neutralisation (VNT)‑assay and real‑time reverse transcription‑PCR (rRT‑PCR) in 1 antelope and BTV‑1 in 3 of 10 Oryx antelopes (Oryx leucoryx) imported in Croatia from the Sultanate of Oman. No BTV vectors were collected during the antelope quarantine on the Veliki Brijun Island. Also, no BTV antibodies were detected in sheep, cattle, and deer on the Island. Entomological studies did not reveal any new vector species that may have been introduced with the infected antelopes on their transportation. It was the first time that BTV was demonstrated in animals imported in Croatia. It involved BTV‑1, which had never been demonstrated before and BTV‑16, which had been previously recorded in domestic ruminants.

Virus della Bluetongue rinvenuto in antilope (Oryx leucoryx) durante il periodo di quarantena nel 2010 in Croazia Parole chiave Antilope (Oryx leucoryx), BTV‑1, BTV‑16, Croazia, Entomologia, Quarantena.

Riassunto La Bluetongue (BT) è una malattia virale non contagiosa dei ruminanti domestici e selvatici.

Gli insetti del genere Culicoides (Diptera: Ceratopogonidae) fungono da vettori biologici nella trasmissione del virus della Bluetongue (BTV) a ospiti sensibili. L'infezione è presente nella regione del Mediterraneo. Recentemente è stata anche documentata in Europa centrale, occidentale e settentrionale, dove BTV‑8 è stato riconosciuto come sierotipo causale. In questo contesto è stata registrata la comparsa di BTV‑14 nella parte nord‑orientale dell'Europa.

Questo studio riporta il rilevamento della presenza di BTV in 10 antilopi (Oryx leucoryx), in quarantena sull'isola di Brioni Maggiore, importate in Croazia dal Sultanato dell'Oman nel 2010. Mediante le prove di Virus neutralisation test (VNT) e Real‑time reverse transcription‑PCR (Real‑time RT‑PCR) il sierotipo BTV‑16 è stato rilevato in 1 esemplare, il serotipo BTV‑1 in 3 dei 10 antilopi. Non sono stati indentificati vettori del BTV, né sono stati rilevati anticorpi per BTV negli ovini, bovini, e cervi presenti sull'isola durante la quarantena delle antilopi. Gli studi entomologici non hanno evidenziato la presenza di nuove specie di vettore introdotte con le antilopi. Questo studio riporta il primo caso di BTV in animali importati in Croazia e dimostra, per la prima volta, la presenza nel Paese di BTV‑1 e di BTV‑16 che però è stato già in precedenza rilevato nei ruminanti domestici.

139

Bosnić et al.

Bluetongue virus in Oryx antelope in Croatia

Introduction Bluetongue (BT) is an insect‑borne, infectious, non‑contagious disease of ruminants transmitted among its hosts by Culicoides biting midges (Diptera: Ceratopogonidae) (Meiswinkel et al. 2004).

Bluetongue virus (BTV) infection involves domestic and wild ruminants such as sheep, goats, cattle, buffaloes, deer, most species of African antelope, and various other Artiodactyla as vertebrate hosts (OIE 2009). About 30 Culicoides species play a role in BT transmission worldwide (Meiswinkel et al. 2004).

From 1998 to 2012, at least 6 serotypes (BTV‑1, BTV‑2, BTV‑4, BTV‑8; BTV‑9, and BTV‑16) were present in Southern Europe (Saegerman et al. 2008, Savini et al. 2009 ).

In the Mediterranean region, the most important vector is Culicoides imicola, which is probably responsible for 90% of disease transmission (Meiswinkel et al. 2004). The 3 remaining vectors are Culicoides obsoletus and Culicoides scoticus ‑ also of the subgenus Avaritia, but placed within the Obsoletus Complex ‑ and Culicoides pulicaris (subgenus Culicoides) (Meiswinkel et al. 2004).

Earlier serological surveys have shown that many BTV serotypes, including those that have recently caused outbreaks in the Mediterranean region, have been present at the periphery of Europe for several decades, most notably in the sub‑Saharan Africa, Cyprus, Turkey, and the Middle East (Mellor et al.

2009). Most commonly, transmission of BTV occurs by incursions from the wind‑assisted movement of infectious Culicoides midges or imported viraemic livestock (Carpenter et al. 2013). Numerous wild ruminant species may serve as BTV reservoirs in Europe and are likely to play a role in the disease epidemiology (Falconi et al. 2011).

In Croatia, the disease was first reported in 2001 in Dubrovnik‑Neretva County, where the BTV‑9 serotype was identified in domestic ruminants (Listeš et al. 2004, Listeš et al. 2011). Extensive serological studies of sentinel ruminants were carried out in the area, where the BTV‑16 serotype was first demonstrated in 2004 (Listeš et al. 2009).

Entomological survey of the blood‑sucking genus Culicoides revealed the potential vectors of the Culicoides obsoletus group and Culicoides pulicaris group to be widely represented (Bosnić 2011).

Here we describe the detection of the BTV‑1 and BTV‑16 serotypes in the Arabian Oryx antelopes (Oryx leucoryx), imported from the Sultanate of Oman, during the quarantine period on the island of Veliki Brijun in Croatia. The results of testing for BTV accompanying the shipment were negative.

In addition, comprehensive investigation for the presence of Culicoides vectors on the quarantine object was performed in order to assess the

140

possibility of viral dissemination after departure of Oryx antelopes by serological testing of the sheep, cattle, and the wild population of fallow deer living on the island.

Materials and methods Case history and study area On March 4, 2010, 10 Oryx antelopes were imported to Croatia from the Sultanate of Oman. The animals were air transported, each in a separate box. The Oryx antelopes were placed into quarantine on the island of Veliki Brijun. As per protocol, they were meant to spend 6 months on the island before being transported to their final destination in the United Kingdom. The antelopes were accommodated in a vector‑free facility to protect them from Culicoides attacks.

The Veliki Brijun National Park is located in the North of Adriatic Sea, 3 km from the South‑West part of the Istria Peninsula. The island is characterized by mild Mediterranean climate, rather high air humidity, rich vegetation, with 3 ponds, and stagnant waters. The island has a considerable population of wild animals, predominantly fallow deer (Dama dama) and axis deer (Axis axis), mouflon (Ovis musimon), and exotic herbivores. Domestic animals, sheep, goats, cattle, horses, and donkeys, as well as autochthonous birds also live on the island.

Serology and virology During quarantine, serum and ethylenediaminetetraacetic acid (EDTA) blood samples were collected from 10 Oryx antelopes.

Serum samples were serologically tested at the Croatian Veterinary Institute using a commercial competitive enzyme linked assay (c‑ELISA; INGEZIM BTV Compact 12.BTV.K.3, INGENASA, Madrid, Spain), which detects antibodies against the BTV VP7 protein.

All serum and blood samples were also sent to the European Reference Laboratory for Bluetongue at The Pirbright Institute, UK, for further analyses including virus neutralization assay (VN‑assay) (OIE 2009), real‑time reverse transcription‑PCR (rRT‑PCR) (Shaw et al. 2007), and serotype specific rRT‑PCR (Mertens et al. 2007). Immediately upon detection of the infection, in April 2010, blood samples were collected from 11 sheep accommodated some 30 metres from the quarantine stable. Then, 11 sheep and 13 cattle living nearby were blood sampled every 15 days (a total of 182 samples) from the end of June to the mid‑October 2010, and 46 fallow deer sera were also collected once in August to monitor the possible BTV circulation by c‑ELISA.

Veterinaria Italiana 2015, 51 (2), 139-143. doi: 10.12834/VetIt.385.1795.2

Bosnić et al.

Bluetongue virus in Oryx antelope in Croatia

Entomological survey Following the Oryx arrival, entomological survey of biting midges of the genus Culicoides Latreille, 1809 (Diptera: Ceratopogonidae) was performed using the Onderspoort‑type blacklight suction traps (car battery) (Goffredo and Meiswinkel 2004).

The traps were placed in the Oryx quarantine and in the sheep stable nearby the quarantine site. Insect samples were collected until April 5, when the animals were transported back to the Sultanate of Oman. Six samples were captured in the Oryx quarantine facility and another 6 in the sheep stable. Entomological survey was continued upon departure of Oryx antelopes. From March to October 2010, a total of 139 light trap collections and 90 Culicoides specimens were obtained from the empty Oryx quarantine facility, sheep stable, and ornithological reserve also inhabited by deer.

All captured adult Culicoides were identified at the species level based on the wing pattern and sex (Delécolle 1985). Male C. obsoletus/scoticus genitals were differentiated by form and size, and were classified at the species level. All caught females were age‑graded (Dyce 1969) as nulliparous, parous, and blood fed.

Results Four of 10 Oryx sera were positive to c‑ELISA. In 3 of them, BTV‑1 neutralising antibodies were detected, whereas 1 had antibodies against BTV‑16. Specific antibodies titre ranged from 1:80 to ≥ 1:1280 (Table I). The real time rRT‑PCR also identified 4 positive samples from the same 4 seropositive Table I. Results of serological tests for Bluetongue virus (BTV) antibodies performed on antelope sera.

Antelope sera

ELISA

1715/1 1715/3 1715/4 1715/8

positive positive positive positive

VN-test antibody titre 1:640 1:80 ≥1:1280 ≥1:1280

BTV-serotype BTV-16 BTV-1 BTV-1 BTV-1

animals. Serotype‑specific rRT‑PCR showed that 1 blood sample contained BTV‑16 and 2 blood samples tested positive for BTV‑1. In the fourth rRT‑PCR‑positive sample, the attempt to identify serotype failed. All 182 sheep and cattle, and 46 fallow deer serum samples tested with ELISA were negative.

The predominant species collected at the 2 sites were C. obsoletus/scoticus (subgenus Avaritia) belonging to the Obsoletus complex (43%, n = 39), followed by Culicoides newsteadi (subgenus Culicoides) of the Pulicaris complex (40%, n = 36), Culicoides circumscriptus (subgenus Beltranmya) (13%, n = 12) and Culicoides maritimus (subgenus Oecacta) (3%, n = 3) (Table II). None of the 6 catches in the Oryx quarantine facility included species of the genus Culicoides. During the quarantine period, adult females of C. obsoletus/ scoticus (10 nulliparous) were collected in the trap in the sheep stable. One C. obsoletus/scoticus (1 nulliparous) was caught in the facility 4 months after departure of the antelopes. The highest number of the BTV potential vector (C. obsoletus/ scoticus) was detected in sheep stable, i.e. in 12 of 48 light trap collections. According to age grade, 18 of 32 adult females were nulliparous, 11 parous, and 3 blood fed; whereas males belonged to the C. obsoletus (n = 2) and C. scoticus (n = 1) species.

Accordingly, only C. obsoletus/scoticus (n = 35) were detected in the catches placed in the sheep stable.

Out of 43 catches in the ornithological reserve, 3 C. obsoletus/scoticus (1 nulliparous, 1 parous and 1 male belonging to C. obsoletus), 36 C. newsteadi (17 nulliparous, 11 parous, 2 blood fed and 6 males), 12 C. circumscriptus (7 nulliparous and 5 parous) and 3 C. maritimus (2 nulliparous and 1 parous) were collected in 9 samples.

Discussion At the beginning of March 2010, 10 Oryx antelopes were imported to Croatia from the Sultanate of Oman. BTV‑1 and BTV‑16 were detected in 4 animals housed in the quarantine facility on the Veliki Brijun Island. We found that the antelopes

Table II. Culicoides adults collected at 3 sites in Veliki Brijun island (Croatia).

a

Culicoides species

Quarantin facility

Empty stablea

Sheep stable

C. obsoletus/scoticus C. newsteadi C. circumscriptus C. maritimus Total

0 0 0 0 0

1 0 0 0 1

35 0 0 0 35

Ornithological reserve 3 36 12 3 54

Total 39 (43.4%) 36 (40.0%) 12 (13.3%) 3 (33.3%) 90 (100%)

after departure of antelope.

Veterinaria Italiana 2015, 51 (2), 139-143. doi: 10.12834/VetIt.385.1795.2

141

Bosnić et al.

Bluetongue virus in Oryx antelope in Croatia

had already been infected when transported from the Sultanate of Oman. While BTV‑16 had been previously detected in Dubrovnik‑Neretva County (Listeš et al. 2004), BTV‑1 was identified for the first time in Croatia, as confirmed by the VN‑assay and the RT‑PCRs used in the study.

The first European isolates of BTV‑1 GRE2001 proved to be related to viruses from India and Malaysia (Mellor et al. 2009). The virus is thought to have entered Europe from the East, possibly via Turkey, even though the serological survey conducted in Turkey in the early 1980s did not find any BTV‑1 positive animals. Instead, a Western corridor was hypothesised for the BTV‑1 2006‑2007 incursions in Sardinia (Italy), Spain, Portugal, Gibraltar, and France (Mellor et al. 2009). New BTV‑1 incursions have recently been observed in Sardinia and mainland Italy (Lorusso et al. 2013, Lorusso et al.

2014). Bluetongue virus has been reported in the Arabian Peninsula, as well as in the Sultanate of Oman, Saudi Arabia, and the United Arab Emirates (Al‑Busaidy and Mellor 1991, Frölich et al. 2005).

In Oman, BTV (serotypes 3, 4, 17, 20 and 22) was detected in 1987‑1988, having become enzootic in the Northern part of the country (Al‑Busaidy and Mellor 1991). In another study, Taylor and colleagues (Taylor et al. 1991) indicated that BTV was present throughout Oman and that domestic ruminants were involved to a varying extent in its maintenance. In 2009, BTV‑1, BTV‑4, BTV‑8, and BTV‑16 were also isolated in Oman1. According to literature reports, there are no data demonstrating BTV‑1 and BTV‑16 in Oryx leucoryx.

Concerning the Arabian Oryx, Frölich and colleagues (Frölich et al. 2005) found a high prevalence of antibodies against BTV and epizootic hemorrhagic disease virus in Saudi Arabia and the United Arab Emirates during the 1999‑2001 period. These findings indicate that Arabian Oryx antelopes are likely to be susceptible to both viruses, yet saying nothing about the possible epidemiological role played by this species.

Based on these data, the possibilities that infected Culicoides might have been carried with antelopes on their transportation and disseminated over the island as well as viraemic animals infected by local vectors were investigated during and after the quarantine period. Serological testing did not demonstrate the presence of BTV in the sheep, cattle, and fallow deer living near the quarantine facility.

No potential Culicoides vectors were captured in the Oryx antelope facility during the quarantine period.

Moreover, no other potential vectors that are not normally present in Croatia were captured at any

1

142

other study site. Finally, after 33 days of quarantine, the antelopes were removed from the island and transported back to the Sultanate of Oman.

According to the results of this study, BTV was not disseminated via vectors to domestic and wild animals on the island. Previous entomological studies have demonstrated that the species belonging to the Obsoletus and Pulicaris complexes were likely to play an important role in transmitting BTV in Croatia (Bosnić 2011). In the present study, C. obsoletus/scoticus were the Culicoides species most often detected in the sheep stable. Only 1 C. obsoletus/scoticus (1 nulliparous) was captured in the quarantine facility after departure of the antelopes; the midges may have entered the facility upon door opening. As the trap was placed in the ornithological reserve near the marshy lake inhabited by wild ducks and in the reserve inhabited by fallow deer, the mammalophilic species Culicoides newsteadi predominated among the captured species, followed by the ornithophilic species Culicoides circumscriptus and Culicoides maritimus favouring saline areas and occurring mostly along the coastlines of Europe (Meiswinkel, personal communication).

The peak catches occurred in the second half of April and in May 2010. In contrast to the results of a previous monitoring in Croatia reporting the peak catches occurred in September, October and November (Bosnić 2011). Obviously, ecological conditions and heterogeneous animal population on the island proved to be favourable for the development of certain Culicoides species.

According to the Decree Prohibiting the Importation and Transit into the Republic of Croatia Territory of Domestic and Wild Ruminants and Genetic Material Derived from Ruminants in Order to Prevent the Introduction of the Bluetongue Disease (NN 66/08), no ban was in force on the import of wild ruminants from the Sultanate of Oman at the time. However, a ban has been enforced after this incident. Based on the measures taken and the results of this study, it was very important that no BTV vectors were identified in the quarantine during the stay of the Oryx antelopes, and that serology tests in the sheep, cattle, and fallow deer were negative for BTV. Accordingly, the risk of BTV circulation could be considered negligible.

Acknowledgements The authors would like to thank The Pirbright Institute, Woking, UK for their collaboration.

www.reoviridae.org/dsRNA_virus_proteins/outbreaks.htm#AHS-2010/.

Veterinaria Italiana 2015, 51 (2), 139-143. doi: 10.12834/VetIt.385.1795.2

Bosnić et al.

Bluetongue virus in Oryx antelope in Croatia

References Al‑Busaidy S.M. & Mellor P.S. 1991. Epidemiology of bluetongue and related orbiviruses in the Sultanate of Oman. Epidemiol Infect, 106, 167‑178.

Bosnić S. 2011. Entomological surveillance insects of the genus Culicoides in Croatia. Thesis, University of Zagreb, Faculty of Veterinary Medicine, 176 pp.

Carpenter S., Groschup M.H., Garros C., Felippe‑Bauer M.L. & Purse B.V. 2013. Culicoides biting midges, arboviruses and public health in Europe. Antiviral Res, 100, 102‑113.

Delécolle J.‑C. 1985. Nouvelle contribution à l’étude systematique et iconographique des espèces du genre Culicoides (Diptera: Ceratopogonidae) du nord‑est de la France. Thesis, Université Louis Pasteur de Strasbourg, UER Sciences, Vie et Terre, 238 pp.

Dyce A.L. 1969. The recognition of nulliparous and parous Culicoides (Diptera: Ceratopogonidae) without dissection. J Aust Ent Soc, 8, 11‑15.

Falconi C., López‑Olvera J.R. & Gortázar C. 2011. BTV infection in wild ruminants, with emphasis on red deer: a review. Vet Microbiol, 151, 209‑219.

Frölich K., Hamblin C., Jung S., Ostrowski S., Mwanzia J., Streich W.J., Anderson J., Armstrong R.M. & Anajariyah S. 2005. Serologic surveillance for selected viral agents in captive and free‑ranging populations of Arabian Oryx (Oryx leucoryx) from Saudi Arabia and the United Arab Emirates. J Wildl Dis, 41 (1), 67‑79.

Goffredo M. & Meiswinkel R. 2004. Entomological surveillance of bluetongue in Italy: methods of capture, catch analysis and identification of Culicoides biting midges. Vet Ital, 40 (3), 260‑265.

Listeš E., Bosnić S., Benić M., Lojkić M., Čač Ž., Cvetnić Ž., Madić J., Šeparović S., Labrović A., Savini G. & Goffredo M. 2004. Serological evidence of bluetongue and a preliminary entomological study in southern Croatia. Vet Ital, 40 (3), 221‑225.

Listeš E., Monaco F., Labrović A., Paladini C., Leone A., Di Gialleonardo L., Cammá C. & Savini G. 2009. First evidence of bluetongue virus serotype 16 in Croatia.

Vet Microbiol, 138, 92‑97.

Listeš E., Bosnić S., Benić M., Madić J., Cvetnić Ž., Lojkić M., Šeparović S., Labrović A. & Savini G. 2011. An outbreak of bluetongue virus serotype 9 in southern Croatia. Acta Vet Brno, 80, 331‑336.

Lorusso A., Sghaier S., Carvelli A., Di Gennaro A., Leone A., Marini V., Pelini S., Marcacci M., Rocchigiani A.M., Puggioni G. & Savini G. 2013. Bluetongue virus serotypes 1 and 4 in Sardinia during autumn 2012: New incursions or re‑infection with old strains?

Infect Genet Evol, 19, 81‑87.

Lorusso A., Sghaier S., Ancora M., Marcacci M., Di

Veterinaria Italiana 2015, 51 (2), 139-143. doi: 10.12834/VetIt.385.1795.2

Gennaro A., Portanti O., Mangone I., Teodori L., Leone A., Cammà C., Petrini A., Hammami S. & Savini G. 2014. Molecular epidemiology of bluetongue virus serotype 1 circulating in Italy and its connection with northern Africa. Infect Genet Evol, 28, 144‑149.

Meiswinkel R., Gomulski L.M., Delécolle J.‑C., Goffredo M. & Gasper G. 2004. The taxonomy of Culicoides vector complexes – unfinished business. Vet Ital, 40 (3), 151‑159.

Mellor P.S., Carpenter S., Harrup L., Baylis M. & Mertens P.P.C. 2008. Bluetongue in Europe and the Mediterranean Basin: history of occurrence prior to 2006. Prev Vet Med, 87, 4‑20.

Mellor P.S., Baylis M. & Mertens P.P.C. 2009. Molecular epidemiology studies of bluetongue virus. In Bluetongue. Biology of Animal Infections (P.S. Mellor, M. Baylis & P.P.C Mertens, eds). Elsevier Academic Press, Oxford, 135‑166.

Mertens P.P., Maan N.S., Prasad G., Samuel A.R, Shaw A.E., Potgieter A.C., Anthony S.J. & Maan S. 2007. Design of primers and use of RT‑PCR assays for typing European bluetongue virus isolates: differentiation of field and vaccine strains. J Gen Virol, 88, 2811-2823.

Ministry of Agriculture. 2008. Decree prohibiting the importation and transit into the Republic of Croatia territory of domestic and wild ruminants and genetic material derived from ruminants in order to prevent the introduction of the Bluetongue disease. Official Gazette of the Republic of Croatia, 66/08.

Shaw A.E., Monaghan P., Alpar H.O., Anthony S., Darpel K.E., Batten C.A., Guercio A., Alimena G., Vitale M., Bankowska K., Carpenter S., Jones H., Oura C.A., King D.P., Elliott H., Mellor P.S. & Mertens P.P. 2007.

Development and initial evaluation of a real‑time RT‑PCR assay to detect bluetongue virus genome segment 1. J Virol Methods, 145 (2) 115-126.

Saegerman C., Berkvens D. & Mellor P.S. 2008.

Bluetongue epidemiology in the European Union.

Emerg Infect Dis, 14 (4), 539‑544.

Savini G., Hamers C., Conte A., Migliaccio P., Bonfini B., Teodori L., Di Ventura M., Hudelet P., Schumacher C. & Caporale V. 2009. Assessment of efficacy of a bivalent BTV‑2 and BTV‑4 inactivated vaccine by vaccination and challenge in cattle. Vet Microbiol, 133, 1‑8.

Taylor W.P., Al‑Busaidy S.M. & Mellor P.S. 1991.

Bluetongue in the Sultanate of Oman, a preliminary epidemiological study. Epidemiol Infect, 107, 87‑97.

World Organisation for Animal Health (OIE). 2009.

Bluetongue and Epizootic Haemorrhagic Disease, Chapter 2.1.3. In Terrestrial Manual, Paris, OIE. http://web.oie.int/eng/normes/MMANUAL/2008/ pdf/2.01.03_BLUETONGUE.pdf.

143

SHORT COMMUNICATION A new lineage of foot-and-mouth disease virus serotype O in India Saravanan Subramaniam, Punam Bisht, Jajati K. Mohapatra, Aniket Sanyal & Bramhadev Pattnaik* ICAR-Project Directorate on Foot-and-mouth disease, Mukteswar-Kumaon, Nainital-263138, Uttarakhand, India. * Corresponding author at: ICAR-Project Directorate on Foot and Mouth Disease, Mukteswar, Nainital-263 138, Uttarakhand, India.

Tel.: +91 5942 286004, e-mail: pattnaikb@gmail.com.

Veterinaria Italiana 2015, 51 (2), 145-149. doi: 10.12834/VetIt.106.296.2 Accepted: 18.03.2015 | Available on line: 30.06.2015

Keywords Foot and mouth disease virus, Ind2011, PanAsia, Serotype O.

Summary The complete nucleotide sequence of a new lineage of foot and mouth disease virus (FMDV) serotype O was determined. The lineage designated as Ind2011 first appeared during 2011 in the Southern region of India. Excluding the poly C tract and poly A tail, the genome of Ind2011 ranged from 8,169 to 8,172 nucleotides. Variation in the genome length was due to insertions/deletions in LF-UTR. The lineage had a higher sequence identity with lineage PanAsia-1 at P1 and P2 regions, and with lineage PanAsia-2 at P3 and L regions.

Phylogenetically, the isolates were placed closely to both PanAsia-1 and 2 lineages, and appear to be a novel variant of the PanAsian lineage.

Sequenziamento nucleotidico completo di un nuovo lineage del virus dell'afta epizootica, sierotipo O, in India Parole chiave Afta epizootica, Ind2011, PanAsia, Sierotipo O, Virus.

Riassunto La comunicazione descrive il sequenziamento nucleotidico completo di un nuovo lineage del virus dell'afta epizootica, sierotipo O. Ind2011 è apparso per la prima volta nel corso del 2011 nella regione meridionale dell'India. Escludendo il tratto poly C e la coda del tratto poly A, il genoma di Ind2011 varia tra 8169-8172 nucleotidi. La variabilità nella lunghezza genomica è dovuta ad inserzioni/cancellazioni in LF-UTR. Ind2011 mostra una sequenza simile al lineage PanAsia1 nelle regioni P1 e P2, e al lineage PanAsia-2 nelle regioni P3 e L. Filogeneticamente, il nuovo lineage è simile a PanAsia-1 e 2, e sembra essere una nuova variante del lineage PanAsian.

Foot-and-mouth disease virus (FMDV) belongs to the family of Picornaviridae and is classified within genus Aphthovirusgenus. The genome of FMDV consists of a single-stranded positive-sense RNA of approximately 8,500 nucleotides. The viral genome contains a 5'and 3' untranslated regions (UTRs), which are essential for viral RNA replication. The 5' UTR consists of SF-UTR and LF-UTR. The genome is translated as a single large polyprotein that is cleaved into 4 structural proteins, VP1, VP2, VP3, and VP4, and 10 nonstructural proteins, L, 2A, 2B, 2C, 3A, 3B1-3, 3C, and 3D. The genome is encapsulated in an icosahedral capsid composed of 60 copies of 4 structural proteins; VP1, VP2, and VP3 are surface exposed, while VP4 is entirely internal. (Acharya et al.

1989). The P1 region encodes structural proteins VP1 to VP4. The P2 (2A, 2B, 2C) and P3 (3A, 3B, 3C, and 3D)

regions encode nonstructural proteins involved in viral replication. Foot-and-mouth disease viruses are categorised in 7 serotypes [A, O, C, Asia1 and Southern African Territories (SAT1-3)] on the basis of the antigenic and nucleotide differences. For each serotype, different genotypes and lineages can be identified. Three serotypes (A, O and Asia1) are currently prevalent in India. Serotype O accounts for about 85% of the FMD incidence in the country (Subramaniam et al. 2012). The isolates collected to date belong to Middle East-South Asia topotype.

During the last 10-12 years, 2 prominent lineages have been circulating in India; PanAsia and Ind2001.

A new genetic group (named Ind2011) in serotype O appeared in 2011 in India (Subramaniam et al. 2013).

Geographically, the Ind2011 lineage was restricted to Southern regions in the states of Karnataka,

145

Subramaniam et al.

A new genetic lineage of foot-and-mouth disease virus in India

Tamilnadu, Andhra Pradesh, and Kerala. Four FMDV strains representing Ind2011 lineage were selected for genetic characterization at complete coding and non-coding region. This short communication describes the degree of genetic variations in these strains at the whole genome level with respect to other lineages circulating in India.

Total RNA was extracted using RNeasy Mini Kit (Qiagen, Hilden, Germany). Reverse transcription was performed using oligod(T)15 primer and M-MLV Reverse transcriptase (Promega, Fitchburg, Wisconsin, USA). The complete genome was amplified in 7 overlapping fragments (SF1F-SF370R, LFIF-DHP2, L463R-NK61, DHP13-DH5, MG33CTLV10, CTLV2-V4, 3D1081-anchored oligodT) using Pfu DNA polymerase (Fermentas, Opelstrasse, Germany). The details of the primers used in this study are specified in Table I. After the gel purification of the polymerase chain reaction (PCR) products conducted using QIA quick Gel Extraction Kit (Qiagen, Hilden, Germany), cycle sequencing reactions were performed using BigdyeV3.1 terminator kit on 3,130 genetic analyzer (Applied

Biosystems, Waltham, Massachusetts, USA).

Multiple sequence reads were assembled using Edit seq module of Lasergene core suite 10 (DNASTAR, Inc., Madison, Wisconsin, USA). Percent nucleotide and amino acid identities were calculated through Megalign module of Lasergene core suite 10.

Phylogenetic analysis was conducted using MEGA 5.05 software (Tamura et al. 2011) employing the best fit nucleotide substitution model, GTR+G +I under Maximum Likelihood (ML) method.

The complete genome sequence was determined from BHK-21 cell culture adapted isolates (n = 4) of Ind2011 lineage at passage level ~2-3 (Table II). The clinical materials were collected from the suspected FMD outbreaks during the year 2011. Frank vesicular/ erosive lesions were evident on tongue and feet of affected cattle. Smacking lips and excessive salivation was also observed. Nucleotide and amino acid (aa) sequences were compared with sequences of FMDV isolates available in the genetic database of Project Directorate on FMD, India and GenBank.

Excluding the poly C tract and polyA tail, the length of the genome of Ind2011 isolates ranged from

Table I. The deoxyoligonucleotide primers used in this study with location and polarity. The details of the primers can be found in the corresponding references.

Designation SF1Fa, b SF370Ra SF370Rsb LF1Fa DHP2a DH13b L463Fa, b NK61a, b ARS4b DHP4a, b DHP5a, b MG33a, b CTLV10a CTLV2a, b CTLV4a, b 3D1081a, b 3D26Rb 2C540R DHP13 3D331Rb NK72Fb O1C(S)237R 2B325b 3D786Rb

Sequence (5'3') TTGAAAGGGGGCGCTAGGGTC CGGTAAAACTTAGGGGGGATGAAAGGCGGGCGCCGGGTG CGGTAAAACTTAGGGGGGATG CCCCCCTAAGTTTTACCGTCGTTCCCG CCGATTCCGGTGTTGAGCAGGTG TGTAGACCCAGTCGAAG ACCTCCRACGGGTGGTACGC GACATGTCCTCCTGCATCTG ACCAACCTCCTTGATGTGGCT CACAAACAAAAGATTGTGGCA GTGTTGTACTTTCTCATTGAAAAA ATGCAACAAGATATGTTTAAGCC CATCGACAATGCGAGTCTTGCC TGATCTGTAGCTTGGTATCT TGACCCTGAACCACAACACG GGCCAAACCATCACTCCAGCTGA ACATCTCTGGTGTCAACAATCAACCCCTCGTG GGTSGARACCATYTGGGCAAARTA GTGACTGAACTGCTTTACCGCAT AGGCGCGGTGTCTGGCTCCAT GAGTCCAACCCTGGGCCCTTC CATTGCTTTGCTGCCAAAGAC GACTCGCTCTCCAGTCTCTTT GCGGAACACCTCCTCAAACAT

Location and polarity SFUTR1 (+) SFUTR370 (-) SFUTR370 (-) LFUTR1 (+) L 325 (-) L217 (-) L463 (+) 2B77 (-) VP3 124 (+) 1D600 (+) 3A25 (-) 2C835 (+) 3D547 (-) 3D1371 (-) 3C 618 (+) 3D1081 (+) 3D26 (-) 2C540 (-) VP1 516 (+) 3D351 (-) 2A34 (+) 1C237(-) 2B325 (+) 3D786 (-)

Reference Toja et al.1999 Sanyal et al. 2004 Sanyal et al. 2004 Sanyal et al. 2004 Sabarinath 2005 Sanyal et al. 2004 George 2000 Knowles & Samuel 1995 Knowles & Samuel 1995 Sabarinath 2005 Sabarinath 2005 George 2000 Pattnaik et al. 1997 Pattnaik et al. 1997 Pattnaik et al. 1997 George 2000 Sanyal et al. 2004 This study Sabarinath 2005 George 2000 Sanyal et al. 2004 This study Sanyal et al. 2004 George 2000

a = primers used for PCR amplification of the complete genome; b = primers used for sequencing of the complete genome.

146

Veterinaria Italiana 2015, 51 (2), 145-149. doi: 10.12834/VetIt.106.296.2

Subramaniam et al.

A new genetic lineage of foot-and-mouth disease virus in India

Table II. History of the field isolates used in the study.

Isolate ID PD367/2011 PD369/2011 PD411/2011 PD422/2011

Place Srirangapura, Karnataka Thammanapalli, Karnataka Kattur, Kerala Palakkad, Kerala

Date of Collection 07-10-2011 07-10-2011 14-10-2011 18-11-2011

8,169 to 8,172 nucleotides. Variability in the genome length was due to insertions/deletions in LF-UTR. The ORF of all the 4 isolates encodes a polyprotein consisting of 2,332 aa and ends in stop codon TAA. The individual proteins were identical in size to that of other lineages. The level of nucleotides and the aa sequence identity varied among individual proteins.

The highest degree of sequence divergence from the other lineages circulating in India was observed at P1 region (7.3-12.2%) followed by P2 (6.8-8.2%) and P3 (6.5-8.6%) regions. The Ind2011 lineage had higher sequence identity with lineage PanAsia-1 at P1 (92.5-92.7%) and P2 (92.9-93.2%) regions, and with lineage PanAsia-2 at P3 (92.3-93.5%) and L (89.4-90.5%) regions. At the level of complete ORF, this lineage had close genetic homology with lineage PanAsia-1 (92-92.3%) followed by PanAsia-2 (91.6-92%), Ind2001 lineage (91-91.4%) and vaccine strain, INDR2/1975 (89.6-90.1%). Similar trend was observed at aa level. The SF-UTR and LF-UTR of Ind2011 lineage had close sequence homology with PanAsia-2 lineage. Among the 4 strains of Ind2011 lineage, a maximum divergence of 1 and 1.1% at nucleotide and aa level respectively, was observed between PD367/2011 and PD411/2011. Though the strains PD367/2011 and PD369/2011 were collected on the same day from adjacent villages, they showed 0.5 and 0.8% divergence at nucleotide and aa level, respectively. Irrespective of the genetic differences from the vaccine strain, the Ind2011 lineage isolates tested in micro‑neutralization test were found to be antigenically related to the currently used Indian vaccine strain INDR2/1975 and antigenic relationships (r-value) for this 4 isolates ranged from 0.49 to 0.86.

Phylogenetic trees were constructed based on the complete ORF and individual protein coding regions.

In the ORF based tree (Figure 1), the Ind2011 isolates were clustered distinctly and shared branching with PanAsia-1 similar to that of VP1 coding region-based tree. But phylogenetic analysis based on individual protein coding regions yielded different results.

In VP2, VP3, 2C, 3A, 3C, and LF-UTR based tree, the Ind2011 strains were positioned more proximally to PanAsia-1. Whereas in L, 2B, and 3D based phylogeny, the isolates were placed closely with PanAsia-2 than PanAsia-1. The results of phylogenetic analysis are consistent with the percentage identity observed

Veterinaria Italiana 2015, 51 (2), 145-149. doi: 10.12834/VetIt.106.296.2

Host Cow Cow Cattle Cattle

Source Tongue epithelium Tongue epithelium Tongue epithelium Buccal mucosa

O/UKG/2001_(FJ542372) O/MAY/3/2000_(0HQ632768) O/skr_(AY593824) O/SKR/2000_(AF377945) PanAsia I 1 00 O/China_(HQ009509) O/IND271/2001 PD367/2011 1 00 PD369/2011 1 00 Ind2011 PD411/2011 1 00 PD422/2011 O/PAK_(GU384683) PanAsia II 1 00 O/IND320/2007 O/MAY/1/2004_(HQ632770) 89 O/Israel_(FJ175666) Ind2001 O/IND120/2002 O/MAY/7/2001_(HQ632769) 1 00 O/MAY/7/2007_(HQ632772) O/orey-iran_(AY593834) Vaccine strain O/INDR2/1975 O/manisa_(AY593823) O/phi_(AY593812) 85

98

99

1 00

85

0.02

Figure 1. Maximum Likelihood tree showing the phylogenetic relationship of FMDV serotype O isolates at complete coding region.

The numbers at each node represent the percentage bootstrap scores (10,000 replicates). Isolates sequenced in this study are marked with filled diamond.

between these strains and PanAsian lineages.

Incongruent tree topologies for different genomic regions indicate possibilities of recombination; such events occur frequently in the non-structural protein coding region and less often in the structural protein coding region. Inter and intratypic recombination was shown to play an essential role in genome evolution and to the generation of FMDV genetic and population diversity (Carrillo et al. 2005).

The length of SF-UTR of the new lineage isolates was 371 nucleotides, and for Indian isolates of serotype O, the length varied between 348 and 397 nucleotides (Mathapati 2012). Mean length of SF-UTR of Euroasiatic isolates was reported to be 373 nucleotides (Carrillo et al. 2005). The secondary structures (minimum free energy and thermodynamically stable) predicted using m-fold web server (http://bioweb.pasteur.fr/seqanal/ interfaces/mfold-simple.html) revealed a single stem loop structure similar to other lineages.

The length of LF-UTR ranged from 707 to 710 nucleotides for Ind2011 isolates, whereas for serotype O Indian isolates, the length varied from 626 to 716 nucleotides (Mathapati 2012). All the 4 Pseudoknots (PK 1-4) could be predicted without

147

Subramaniam et al.

A new genetic lineage of foot-and-mouth disease virus in India

any junk deletion; presence of such deletions was most commonly observed to disrupt the formation of PK-I and PK-II. Secondary structure predicted here for Ind2011 isolates possessed all the 5 domains and well defined motifs. The A238AACA motif in cre (Domain I) essential for virus replication and VPg uridylylation (Nayak et al. 2006) was found to be fully conserved. The GNRA motif in domain 3 essential for maintenance of tertiary structure of IRES and long range RNA-RNA interaction was GTAA in the Ind2011 isolates and was found to be totally conserved. The 3'UTR excluding poly A tail was 92 nucleotides in length. The secondary structure predicted with minimum free energy showed the typical Y shaped structure observed in picornaviruses (Carrillo et al. 2005). Motif TCCTCAGATGT which follow stop codon TAA was fully conserved across all the isolates.

Although the catalytic triad C51, H148 and D163 (Guarne et al.2000) of the L protein were found to be fully conserved, the residue 76 implicated in autocatalysis revealed EK substitution in 2 isolates (PD367/2011 and PD369/2011). Residues E147 and G98 involved in hydrogen bonding with L200 and K201 were found to be conserved totally except KR substitution at position 201 in 2 isolates

148

(PD369/2011 and PD422/2011). Apart from this, the critical residues in the non-structural proteins and UTRs were found to be fully conserved. The antigenically critical residues and receptor-binding motif in the structural protein were also found to be conserved and identical to that of vaccine strain INDR2/1975. Lineage specific substitutions were observed in the L region at positions 14 (F/LI) and 24 (RQ), and in 3D region at positions 47 (ND), 68 (EK), 72 (A-E), and 291 (TV).

In summary, we describe the full genome analysis of a new lineage of FMDV serotype O identified in the Southern region of India. Phylogenetic analyses based on complete genome sequences suggest that the Ind2011 lineage could be a variant of PanAsia lineage that caused a worldwide pandemic in 2001.

The Ind2011 lineage, which emerged in 2011 was not detected in the subsequent years.

Acknowledgements This work was supported by the Indian Council of Agricultural Research, New Delhi, India. We are sincerely grateful to all the scientific and technical staff associated with the network laboratories for providing clinical materials and all the required data.

Veterinaria Italiana 2015, 51 (2), 145-149. doi: 10.12834/VetIt.106.296.2

Subramaniam et al.

A new genetic lineage of foot-and-mouth disease virus in India

References Acharya R., Fry E., Stuart D., Fox G., Rowlands D. & Brown F. 1989. The three-dimensional structure of foot-andmouth disease virus at 2.9 Ă&#x2026; resolution. Nature, 337, 709-716.

Pattnaik B., Sanyal A., George M., Tosh C., Hemadri D. & Venkataramanan R. 1997. Evaluation of primers for PCR amplification of RNA polymerase gene sequences of foot-and-mouth disease virus. Acta Virol, 41, 333-336.

Carrillo C., Tulman E.R., Delhon G., Lu Z., Carreno A., Vagnozzi A., Kutish G.F. & Rock D.L. 2005. Comparative genomics of foot-and-mouth disease virus. J Virol, 79, 6487-6504.

Sabarinath G.P. 2005. Evaluation of Foot-and-Mouth disease virus serotype O isolates for use as candidate vaccine strains. Ph.D. Thesis, Deemed University, IVRI, Mukteswar/Izatnagar, India.

George M. 2000. Molecular cloning and expression of the nonstructural proteins of foot- and-mouth disease virus serotype Asia1. Ph.D. Thesis, Deemed University, Indian Veterinary Research Institute, Izatnagar/Mukteswar, Uttar Pradesh, India.

Sanyal A., Mohapatra J.K., Manoj Kumar R., Biswas S., Hemadri D., Tosh C., Sabarinath G.P., Gupta S.K., Mittal M., Giridharan P. & Bandyopadhyay S.K. 2004. Complete nucleotide sequence analysis of a vaccine strain (IND491/97) and a field isolate of foot-and-mouth disease virus serotype Asia1 with an insertion in VP1 genomic region. Acta Virol, 48, 65-72.

Guarne A., Hampoelz B., Glaser W., Carpena X., Tormo J., Fita I. & Skern T. 2000. Structural and biochemical features distinguish the foot-and-mouth disease virus leader proteinase from other papain-like enzymes. J Mol Biol, 302, 1227-1240.

Knowles N.J. & Samuel A.R. 1995. Polymerase chain reaction amplification and cycle sequencing of the 1D (VP1) gene of foot-and-mouth disease viruses. Report of the Session of the Research Group of the Standing Technical Committee of the European Commission for the Control of Foot and Mouth Disease, Vienna, Austria.

Appendix 8, FAO, Rome, 45-53.

Subramaniam S., Pattnaik B., Sanyal A., Mohapatra J.K., Pawar S.S., Sharma G.K., Das B. & Dash B.B. 2012. Status of Foot-and-Mouth Disease in India. Transbound Emerg Dis, 60, 197-203.

Subramaniam S., Sanyal A., Mohapatra J.K., Sharma, G.K., Biswal J.K., Ranjan R., Rout M., Das B., Bisht P., Mathapati B.S., Dash B.B. & Pattnaik B. 2013. Emergence of a novel lineage genetically divergent from the predominant Ind2001 lineage of serotype O foot-and-mouth disease virus in India. Infect Genet Evol, 18, 1-7. doi: 10.1016/j. meegid.2013.04.027.

Mathapati B.S. 2012. Assessment of antigenic and genetic variation in serotype O Foot and mouth disease virus in India: antigenic cartography and complete genome analysis. Ph.D. Thesis, Deemed University, IVRI, Mukteswar/Izatnagar, India.

Tamura K.,Peterson D., Peterson N., Stecher G., Nei M. & Kumar S. 2011. MEGA5: Molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol, 28, 2731-2739.

Nayak A., Goodfellow I.G., Woolaway K.E., Birtley J., Curry S. & Belsham G.J. 2006. Role of RNA structure and RNA binding activity of foot-and-mouth disease virus 3C protein in VPguridylylation and virus replication. J Virol, 80, 9865-9875.

Toja M., Escarmis C. & Domingo E. 1999. Genomic nucleotide sequence of a foot-and-mouth disease virus clone and its persistent derivatives.Implications for the evolution of viral quasispecies during a persistent infection. Virus Res, 64, 161-172.

Veterinaria Italiana 2015, 51 (2), 145-149. doi: 10.12834/VetIt.106.296.2

149

SHORT COMMUNICATION First report of Brucella suis biovar 2 in a semi free-range pig farm, Italy Giulia Barlozzari1*, Alessia Franco1, Gladia Macrì1, Serena Lorenzetti1, Fabiana Maggiori1, Samuele Dottarelli1, Marina Maurelli1, Elisabetta Di Giannatale2, Manuela Tittarelli2, Antonio Battisti1 & Fabrizio Gamberale1 Istituto Zooprofilattico Sperimentale del Lazio e della Toscana ‘M. Aleandri’, Via Appia Nuova 1411, 00178 Roma, Italy.

2 Istituto Zooprofilattico Sperimentale dell’Abruzzo e del Molise ‘G. Caporale’, Campo Boario, 64100 Teramo, Italy.

1

* Corresponding author at: Istituto Zooprofilattico Sperimentale del Lazio e della Toscana ‘M. Aleandri’, Via Appia Nuova 1411, 00178 Roma, Italy.

Tel.: +39 06 79099456, e-mail: giulia.barlozzari@izslt.it.

Veterinaria Italiana 2015, 51 (2), 151-154. doi: 10.12834/VetIt.50.3384.1 Accepted: 07.11.2014 | Available on line: 16.06.2015

Keywords Brucella suis biovar 2, Italy, PCR, Pig, Wild boar.

Summary This communication describes the isolation of Brucella suis (B. suis) biovar 2 in semi‑free‑range pigs located in the province of Rome, Italy. Sera of 28 pigs from a herd with reproductive problems were tested for brucellosis. Twenty-five sera (89%) were found positive to Rose Bengal Test (RBT), while 22 (79%) were positive to Complement Fixation Test (CFT). Two positive pigs were slaughtered, organs were collected and tested for the presence of bacteria.

Brucella spp. was isolated from the spleens and the abdominal lymph nodes of the 2 subjects.

The isolates were identified as B. suis biovar 2 by biochemical and Polymerase Chain Reaction (PCR) tests. The frequent infringement in the fences of the premises and the birth of striped piglets provided evidence that sows mated with wild boar, the major reservoir of B. suis biovar 2. Conversely, the isolation of B. suis biovar 2 from spleens and lymphnodes of seropositive slaughtered animals only, as well as the constant negative results from all vaginal swabs and the abortion materials tested, raise doubts on the implication of B. suis biovar 2 in the infertility of the holding.

Prima segnalazione di Brucella suis biovar 2 in allevamento semibrado di suini in Italia Parole chiave Brucella suis biovar 2, Cinghiale, Italia, PCR, Suino.

Riassunto Il presente studio riporta il primo isolamento di Brucella suis (B. suis) biovar 2 in un allevamento semibrado di suini in provincia di Roma, Italia. I sieri di 28 suini di un allevamento con problemi riproduttivi sono stati saggiati per brucellosi. Venticinque sieri (89%) sono risultati positivi al test Rosa Bengala (TRB) e 22 (79%) alla Fissazione del Complemento (FDC). Due soggetti sono stati abbattuti e sottoposti ad esami colturali. Brucella spp. è stata isolata dalla milza e dai linfonodi addominali di entrambi i soggetti. Gli isolati sono stati identificati come B. suis biovar 2 mediante prove biochimiche e biomolecolari. La nascita di suinetti striati ed il rilievo di infrazioni nei recinti dell'allevamento dimostrano l'avvenuto contatto con il cinghiale, serbatoio più importante della malattia. L’isolamento di B. suis biovar 2 dalla milza e dai linfonodi dei due animali sieropositivi abbattuti e la sua costante assenza in tutti i tamponi vaginali o aborti esaminati non chiarisce la sua implicazione come causa di infertilità nell’allevamento.

151

First report of Brucella suis biovar 2 in pigs, in Italy

Porcine brucellosis is mainly supported by Brucella suis (B. suis), rarely by B. abortus or B. melitensis. B. suis includes 5 biovariants. Pigs are the main reservoir for variants 1, 2, and 3. In Europe, the brown hare (Lepus europaeus) and the wild boar (Sus scrofa) are the natural reservoirs of B. suis biovar 2 (EFSA 2009, OIE 2013)1. Biovariants 1 and 3 are important human pathogens (Godfroid et al. 2005, OIE 2013), while biovar 2 is rarely zoonotic (Institut de Veille Sanitaire 2007, Paton et al. 2001, Teyssou et al. 1989).

In Italy B. suis biovar 2 was first reported in brown hares in the 1990s (Quaranta et al. 1995) and recently, it was isolated in wild boars in North-Western Italy, Abruzzo and Latium (Bergagna et al. 2009, De Massis et al.

2012, Battisti, personal communication). However, no data about its isolation in domestic pig have been published. In this study, we describe the isolation of B. suis biovar 2 in pigs of semi free-range farm in Italy.

In 2009, we received samples (28 sera, 24 vaginal swabs, 2 aborted fetuses, and 9 stillborn piglets) from a breeding farm of out-reared pigs with reproductive problems. The farm, located in the province of Rome, counted about 100 Casertana and Large White breed pigs. The farm is surrounded by a wooded area abounding in wildlife, including wild boar.

The sera were tested by Rose Bengal (RBT) and Complement Fixation (CFT) tests, according to the methods described in the OIE Manual (OIE 2013). Of the 28 sera, 25 (89%) were positive to RBT and 22 (79%) to CFT, with titres ranging from 20 to 640 ICFTU/ml. The results were confirmed by the National Reference Laboratory for Brucellosis (Istituto Zooprofilattico Sperimentale dell’Abruzzo e del Molise, Teramo). Pigs were then slaughtered and the organs of the 2 subjects with the highest CFT titres were further processed by culture tests.

Culture tests for Brucella spp. were performed in accordance with the International Standards (OIE 2013), using enrichment cultures on Trypticase‑soy broth + 5% equine serum with amphotericin B, polymixin B, bacitracin and vancomycin, on Farrell's and on Modified Thayer Martin's media with incubation at 10% CO2 and aerobically.

Brucella spp. was isolated through direct and enrichment cultures from spleens and abdominal lymph nodes of both examined subjects, 1 of which was an hybrid boar. The isolates readily grew under both aerobic and microaerophilic conditions. The isolates were confirmed by bcsp31 Polymerase Chain Reaction (PCR) assay as belonging to the Brucella genus (Elfaki et al. 2005).

1

152

Iowa State University, Center for Food Security & Public Health, Iowa State University. 2007. Porcine and rangiferine brucellosis: Brucella suis, 1-6. http://www.cfsph.iastate.edu/Factsheets/pdfs/brucellosis_suis.pdf.

Barlozzari et al.

Vaginal swabs, fetuses, and stillborn piglets were also collected to be examined for the presence of Bacteria. They were negative for Brucella spp. as well as for major infectious abortion agents.

Species and biovar molecular identification were performed according to the AMOS-PCR (Abortus Melitensis Ovis Suis-PCR) protocol using the primers described in literature (Bricker et al.

1994, Bricker and Halling 1995, Félix et al. 1994, Vemulapalli et al. 1999). The omp2a and omp31 PCR products were submitted to Restriction Fragment Lenght Polymorphism (RFLP) by digestion with NcoI (omp2a) and AvaII (omp31) restriction endonuclease (Vizcaino et al. 1997). The identification at biovar level was also performed using additional tests (CO2 demand, H2S production, agglutination with anti-A, anti-M anti-R -CVL, Addlestone-mono specific antisera and growth in Thionine agar and fuchsin agar), according to the OIE Manual (OIE 2013). The identification at biovar and species level demonstrated the presence of B. suis biovar 2.

In areas where B. suis biovar 2 is reported, the presence of wild boar and hare infected populations is considered the most important risk factor for pigs reared ‘outdoor’ (EFSA 2009). In wild boar B. suis biovar 2 is often isolated without any macroscopic lesions in target organs (Godfroid 2002) and its role in abortion is not well defined by the available literature, even when data on biovars detected in the same areas are retrospectively compared (Cvetnić et al. 2003, Cvetnić et al. 2009). Brucellosis in domestic and wild suids is not subject to official eradication or control plans, its real diffusion is therefore still unknown.

Additionally, the available serological tests do not assure high sensitivity and specificity, so that they may not be reliable for the routine diagnosis of swine brucellosis (Praud et al. 2012).

In recent years, several studies have been conducted to evaluate the performances of some alternative serological tests as Fluorescence Polarization Assay (FPA), Indirect Enzyme-Linked Immunosorbent Assay (I-ELISA), Competitive Enzyme-Linked Immunosorbent Assay (c-ELISA), DissociationEnhanced Lanthanide Fluorescent Immunoassay (DELFIA). These tests, while having comparable or better performances than traditional tests (RBT, CFT), are not sufficient for the individual diagnosis, although they represent a valuable tool to enhance the overall sensitivity, if used in parallel testing (Di Febo et al. 2012, Praud et al. 2012, Silva et al.

2000). Even in our study, we suspected that the introduction of the disease could have occurred following the mating with wild boars from the adjacent wooded area. The hypothesis was confirmed by the frequent finding of infringement in the farm fences and the birth of striped piglets.

Veterinaria Italiana 2015, 51 (2), 151-154. doi: 10.12834/VetIt.50.3384.1

Barlozzari et al.

The disease could have spread by the use of hybrid boars as production stock, as confirmed by farmers, and through fomites. Despite these observations, it is still difficult to consider B. suis biovar 2 as the possible cause of infertility and abortions in the breeding farm, since, in this farm, B. suis biovar 2 has never been isolated from fetuses, stillborn piglets or vaginal swabs. Indeed, the role of B. suis biovar 2 as a cause of abortion or infertility remains elusive in literature, in contrast with the role played by biovar 1 (Lord et al. 1998) or biovar 3 (Cornell et al. 1989).

The correct characterization at biovar level has important implications both for animal and public health. In fact, the zoonotic role and impact of B. suis biovar 2 in public health is considered minor in comparison with B. suis biovars 1 and 3 (Institut de Veille Sanitaire 2007, Paton et al. 2001, Teyssou et al. 1989).

Brucellosis is one of the most important endemic agents of wild boars (Sus scrofa) in Europe (Al Dahouk et al. 2005, Bergagna et al. 2009, Gennero et al. 2006, Godfroid et al. 1994, Grégoire et al. 2012, Hars et al. 2004, Leuenberger et al. 2007, Melzer et al. 2007, Ruiz-Fons et al. 2006, Vengust et al.

2006). Control measures should be implemented for domestic and wild species to limit the mutual transmission of pathogens. In light of this study, it appears appropriate to adopt risk-based surveillance measures, applying a proper strategy of diagnostic testing, including free-range or outdoor breeders for semen screening, either employed for natural

First report of Brucella suis biovar 2 in pigs, in Italy

mating or artificial insemination, in conformity with the current laws2.

Further studies would be needed to estimate the prevalence in domestic and wild swine populations, to isolate the biovars in the study areas and explore patterns involving wildlife and domestic animals.

It is important to highlight that the evaluations related to the ecology of the diseases in wild animal populations should involve different professionals and pursue a population-based approach (Lanfranchi et al. 2003). The aim of the disease surveillance in wild animals is to preserve the health of wild populations and to ensure the health status of humans (i.e. zoonotic diseases) and farmed species in the areas under surveillance, therefore, in that sense, the etiologic agents of swine brucellosis are no exception.

Acknoledgements The authors wish to thank Carlo Proietti (Veterinary Practitioner) and Marta Scanzani (Public Health Veterinarian-ASL RM/G) for their support in field investigation, Carmela Buccella and Luigi Sorbara for their outstanding technical assistance and Patrizia Gradito for the copy-editing.

2

European Union (EU). 2012. Commission Implementing Regulation

(EU) No 176/2012 of 1 March 2012 amending Annexes B, C and D to Council Directive 90/429/EEC as regards animal health requirements for brucellosis and Aujeszky’s disease. Off J, L 61, 02/03/2012.

References Al Dahouk S., Nockler K., Tomaso H., Splettstoesser W.D., Jungersen G., Riber U., Petry T., Hoffmann D., Scholz H.C., Hensel A. & Neubauer H. 2005. Seroprevalence of Brucellosis, Tularemia, and Yersiniosis in wild boars (Sus scrofa) from North-Eastern Germany. J Vet Med, 52, 444-455.

Bergagna S., Zoppi S., Ferroglio E., Gobetto M., Dondo A., Di Giannatale E., Gennero M.S. & Grattarola C. 2009.

Epidemiologic survey for Brucella suis Biovar 2 in a wild boar (Sus scrofa) population in Northwest Italy. J Wildl Dis, 45, 1178-1181.

Bricker B.J. & Halling S.M. Differentiation of Brucella abortus bv. 1, 2 and 4, Brucella melitensis, Brucella ovis and Brucella suis bv. 1 by PCR. 1994. J Clin Microbiol, 32, 2660-2666.

Bricker B.J. & Halling S.M. 1995. Enhancement of the Brucella AMOS PCR Assay for differentiation of Brucella abortus vaccine strains S19 and RB51. J Clin Microbiol, 33, 1640-1642.

Cornell W.D., Chengappa M.M., Stuart L.A., Maddux R.L. & Hail R.I. 1989. Brucella suis biovar 3 infection in a Kentucky swine herd. J Vet Diagn Invest, 1, 20-21.

Veterinaria Italiana 2015, 51 (2), 151-154. doi: 10.12834/VetIt.50.3384.1

Cvetnić Z., Mitak M., Ocepek M., Lojkic M., Terzic S., Jemersic L., Humski A., Habrun B., Sostaric B., Brstilo M., Krt B. & Garin-Bastuji B. 2003. Wild boars (Sus scrofa) as reservoirs of Brucella suis biovar 2 in Croatia. Acta Vet Hung, 51, 465-473.

Cvetnić Z., Spicić S., Toncić J., Majnarić D., Benić M., Albert D., Thiébaud M. & Garin-Bastuji B. 2009. Brucella suis infection in domestic pigs and wild boar in Croatia. Rev Sci Tech, 28, 1057-1067.

De Massis F., Di Provvido A., Di Sabatino D., Di Francesco D., Zilli K., Ancora M. & Tittarelli M. 2012. Isolation of Brucella suis biovar 2 from a wild boar in the Abruzzo Region of Italy. Vet Ital, 48, 387-395.

Di Febo T., Luciani M., Portanti O., Bonfini B., Lelli R. & Tittarelli M. 2012. Sviluppo e valutazione di test diagnostici per la sierodiagnosi di brucellosi suina. Vet Ital, 48, 133-144.

European Food Safety Agency (EFSA). 2009. Porcine brucellosis (Brucella suis). Scientific Opinion of the Panel on Animal Health and Welfare. The EFSA Journal, 1144, 2-112.

153

First report of Brucella suis biovar 2 in pigs, in Italy

Elfaki M.G., Uz-Zaman T., Al-Hokail A.A. & Nakeeb S.M. 2005. Detection of Brucella DNA in sera from patients with brucellosis by polymerase chain reaction. Diagn Microbiol Infect Dis, 53, 1-7.

Félix J., Sangari J.M., García-Lobo & Agüero J. 1994. The Brucella abortus vaccine strain B19 carries a deletion in the erythritol catabolic genes. FEMS Microbiology Letters, 121, 337-342.

Gennero M.S., Grattarola C., Bergagna S., Zoppi S., Barbaro A. & Dondo A. 2006. Trend of Brucella suis infection in wild boar in Piedmont Region (2002-2005).

Epidémiologie et santé animale, 49, 59-62.

Godfroid J. 2002. Brucellosis in wildlife. Rev Sci Tech, 21 (2), 277-286.

Godfroid J., Michel P., Uytterhagen L., De Smedt C., Rasseneur F., Boelaert F., Saegerman C., Patigny X. 1994. Brucellose enzootique à Brucella suis biotype 2 chez le sanglier (Sus scrofa) en Belgique. Ann Méd Vét, 138, 263-268.

Godfroid J., Cloeckhaert A., Liautard J.P., Kohler S., Fretin D., Walravens K., Garin-Bastuji B. & Letesson J.J. 2005.

From the discovery of the Malta fever’s agent to the discovery of a marine mammal reservoir, brucellosis has continuously been a re-emerging zoonosis. Vet Res, 36, 313-326.

Grégoire F., Mousset B., Hanrez D., Michaux C., Walravens K. & Linden A. 2012. A serological and bacteriological survey of brucellosis in wild boar (Sus scrofa) in Belgium.

BMC Vet Res, 8, 80. doi: 10.1186/1746-6148-8-80.

Hars J., Thiebaud M., Cau C., Rossi S., Baudet E., Boué F. & Garin-Bastuji B. 2004. La brucellose du sanglier et du lièvre due à Brucella suis 2 en France. Faune sauvage, 26, 18-23.

Mailles A & Vaillant V. 2007. Etude sur les brucelloses humaines en France métropolitaine, 2002-2004. Institut de Veille Sanitaire (INVS), Saint-Maurice, France. http:// ws1000izs.izs.it/cgi-bin/patience.cgi?id=c5dad574d174-42e4-ab92-88558149e076.

Lanfranchi P., Ferroglio E., Poglayen G. & Guberti V. 2003.

Wildlife Veterinarian, Conservation and Public Health.

Vet Res Comm, 27, 567-574.

Leuenberger R., Boujon P., Thür B., Miserez R., GarinBastuji B., Rüfenacht J. & Stärk K.D. 2007. Prevalence of classical swine fever, Aujeszky's disease and brucellosis in a population of wild boar in Switzerland.

Vet Rec, 160, 362-368.

Lord V.R., Cherwonogrodzky J.W., Schurig G.G., Lord R.D., Marcano M.J. & Meléndez G.E. 1998. Venezuelan field

154

Barlozzari et al.

trials of vaccines against brucellosis in swine. Am J Vet Res, 59, 546-551.

Melzer F., Lohse R., Nieper H., Liebert M. & Sachse K. 2007.

A serological study on brucellosis in wild boars in Germany. Eur J Wildl Res, 53, 153-157.

World Organization for Animal Health (OIE) 2013. Chapter 2.8.5. Porcine brucellosis. In Manual of diagnostic tests and vaccines for terrestrial animals, Paris, OIE. Paton N.I., Tee N., Vu C.H. & Teo T. 2001. Visceral abscess due to Brucella suis infection in a retired pig farmer. Clin Infect Dis, 32, 129-130.

Praud A., Gimenez O., Zanella G., Dufour B., Pozzi N., Antras V., Meyer L. & Garin-Bastuji B. 2012. Estimation of sensitivity and specificity of five serological tests for the diagnosis of porcine brucellosis. Prev Vet Med, 104, 94-100.

Quaranta V., Farina R., Poli A., Cerri D. & Palazzo L. 1995.

Sulla presenza di Brucella suis biovar 2 nella lepre in Italia. Selezione Veterinaria, 36, 953-958.

Ruiz-Fons F., Vicente J., Vidal D., Hofle U., Villanua D., Gauss C., Segales J., Almeria S., Montoro V. & Gortazar C. 2006. Seroprevalence of six reproductive pathogens in European wild boar (Sus scrofa) from Spain: the effect on wild boar female reproductive performance.

Theriogenology, 65, 731-743.

Silva P., Vigliocco A.M., Ramondino R.F., Marticorena D., Bissi E., Briones G., Gorchs C., Gall D. & Nielsen K. 2000.

Evaluation of primary binding assays for presumptive serodiagnosis of swine brucellosis in Argentina. Clin Diagn Lab Immunol, 7, 828-831.

Teyssou R., Morvan J., Leleu J.P., Roumegou P., Goullin B. & Carteron B. 1989. A case of brucellosis in man due to Brucella suis biovar 2. Médecine et Maladies Infectieuses, 19, 160-161.

Vemulapalli R., McQuiston J.R., Schurig G., Sriranganathan N., Halling S.M. & Boyle S.M. 1999. Identification of an IS711 element interrupting the wboA gene of Brucella abortus vaccine strain RB51 and a PCR assay to distinguish strain RB51 from other Brucella species and strain. Clin Diagn Lab Immunol, 6, 760-764.

Vengust G., Valencak Z. & Bidovec A. 2006. A serological survey of selected pathogens in wild boar in Slovenia. J Vet Med B, 53, 24-27.

Vizcaino N., Verger J.M., Grayon M., Zugmunt M.S. & Cloeckaert A. 1997. DNA polymorphism at the omp-31 locus of Brucella spp.: evidence for a large deletion in Brucella abortus, and other species-specific markers.

Microbiology, 143, 2913-2921.

Veterinaria Italiana 2015, 51 (2), 151-154. doi: 10.12834/VetIt.50.3384.1

SHORT COMMUNICATION Blue‑colour variants of the crayfish Austropotamobius pallipes in 2 rivers of the Abruzzo region, Italy Riccardo Caprioli*, Paola Garozzo, Carla Giansante & Nicola Ferri Department of Freshwater Biology, Istituto Zooprofilattico Sperimentale dell’Abruzzo e del Molise ‘G. Caporale’, Campo Boario, 64100 Teramo, Italy * Corresponding author at: Department of Freshwater Biology, Istituto Zooprofilattico Sperimentale dell’Abruzzo e del Molise ‘G. Caporale’, Campo Boario, 64100 Teramo, Italy.

Tel.: +39 0861 332764, e‑mail: r.caprioli@izs.it.

Veterinaria Italiana 2015, 51 (2), 155-158. doi: 10.12834/VetIt.246.834.1 Accepted: 29.03.2015 | Available on line: 30.06.2015

Keywords Abruzzo region, Austopotamobius pallipes, Blue‑colour, Freshwater crayfish, White clawed crayfish.

Summary Blue‑colour variants have been reported in American and Australian freshwater crayfish species. We report here the observation of 2 Austropotamobius pallipes individuals with a blue‑colour carapace in 2 rivers of the Aterno‑Pescara river basin, located in the Abruzzo region, Central Italy.

Varianti di colore blu dei gamberi Austropotamobius pallipes in 2 fiumi della regione Abruzzo, Italia Parole chiave Abruzzo, Austopotamobius pallipes, Colore blu, Gamberi d'acqua dolce, Gambero di fiume dai piedi bianchi.

Riassunto Varianti di colore blu di specie americane e australiane di gamberi d'acqua dolce sono state riportate in passato. Questo studio descrive 2 individui della specie Austropotamobius pallipes con un carapace di colore blu ritrovati in 2 corsi d'acqua del bacino del fiume Aterno‑Pescara, in Abruzzo, nell’Italia centrale.

Crayfish belong to the Decapoda taxon and are the largest mobile freshwater invertebrates (Holdich, 2002). They occur naturally in a wide range of freshwater ecosystems where they may play both the role of consumers and prey, and act as key energy transformers in aquatic food webs (Momot et al. 1978).

Many species are present in North America, where some of them are the objects of intensive aquaculture activities (Huner, 1994). There are only 5 native species in Europe: the noble crayfish (Astacus astacus) of North‑West Europe, the white clawed crayfish (Austropotamobius pallipes) of South‑West and West Europe, the related Austropotamobius torrentium, and the Turkish crayfish (Astacus leptodactylus). The populations of the European species, in particular A. astacus and A. pallipes, have drastically declined in recent years because of human factors, including pollution, damage to the

habitats, and the introduction of North American crayfish species (Holdich et al. 2009, Aquiloni et al.

2010). Besides acting as competitors of the native species, the American crayfish are often carriers of the ‘crayfish plague’, an infectious disease caused by the oomycete Aphanomyces astaci that, in some European countries, has eliminated entire populations of native crayfish (Edgerton et al. 2004, OIE 2009). In Europe, A. astacus and A. pallipes are involved in conservation and management programs. These 2 species are infact listed as endangered in the IUCN Red List of Threatened Species (Füreder et al. 2010) and included in Annexes II and V of the EC Habitats Directive1.

1

European Commission. 1992. Council Directive 92/43/EEC of 21 May 1992 on the conservation of natural habitats and of wild fauna and flora.

Off J, L 206, 22/07/1992.

155

Caprioli et al.

Blue‑colour crayfish in Abruzzo region, Italy

In Italy, A. pallipes represents the most common native species (Scalici et al. 2009, Aquiloni et al., 2010). It inhabits cold and well‑oxygenated waters (Souty‑Grosset et al. 2006) and shows the characteristics of K‑selected species: high longevity, low fertility, low juvenile survival rates, slow growth, and late maturity (Scalici et al. 2008). Austopotamobius pallipes adults may reach a total length of over 12 cm from the tip of the rostrum to the telson. Their carapace colour is highly variable and may depend on the developmental stage, the environment as background coloration, and the diet; but variants may also depend on genetic factors (Hedgecock et al.

1982). Austopotamobius pallipes adults are mainly olive‑brown or brown, but black, whitish‑grey, or beige variant may occur, while blue variants have been occasionally recorded (Souty‑Grosset et al.

2006). We report here the observation of 2 A. pallipes individuals with a blue‑colour carapace found in 2 watercourses of the Aterno‑Pescara river basin, located in the Abruzzo region, Central Italy.

The 2 animals were observed during field monitoring activities of the A. pallipes populations in the river basins of the Abruzzo region, conducted within the framework of a regional conservation and management program of the natural crayfish populations (Caprioli et al. 2013b). Both crayfish were adult females and were found during sampling visit carried out during the night, by using flashlights. The first individual was observed in the Samocito brook on August 4, 2010. The second individual was found in the Tirino river on the September 1, 2013. Figure 1 and Table I show respectively the map of the Aterno‑Pescara river basin and the location and characteristics of the sites where the blue color variants of A. pallipes were observed.Both animals showed a dark blue‑colour (Figure 2), but otherwise had the typical morphological characteristics of A. pallipes.

They were maintained in captivity for 24 hours and released in the capture place after being accurately classified, sexed, and photographed.

The earliest record of blue‑colour variants in freshwater crayfish was published by Lereboullet (Lereboullet 1851). Later on, blue‑colour variants have been distinguished in light and dark blue phenotypes and have been reported for several North American crayfish species, including Cambarus carolinus, Pacifasticus spp., Procambarus clarkii, Procambarus acutus acutus, Orconectes immunis, and Orconectes virilis (reviewed

by Momot & Gall, 1971). A blue‑colour variant has also been reported for the Australian crayfish Cherax destructor (Walker et al. 2000). For European crayfish, to the best of our knowledge, specific reports of blue variants have never been published. Athough blue specimens have been mentioned in the general morphological description of the species (Holdich 2002, Souty‑Grosset et al. 2006).

156

Table I. Geographic coordinates and features of the 2 river sites where the Austropotamobius pallipes blue color variants were observed.

Brook characteristics

Samocito Brook

Tirino Brook

Geographic coordinates

42,47171° N 13,23058° E

43° 16,635 N 13°46,321 E

Altitude (m)

844

342

Mean brook width (m)

1

3.5

Mean water depth (m)

0.2

0.9

Stream flow velocity (0-5)

1

3

Shelters avalaibility (0-5)

1

4

Silt (% sup)

90

30

Sand (% sup)

0

20

Pebbles (% sup)

0

5

Cobbles (% sup)

0

40

Boulders (% sup)

10

5

Bedrock (% sup)

0

0

Temperature at sampling (°C)

16.2

11.7

pH

7.57

7.28

Conductivity μS/cm

545

617

O2mg/l

9.71

8.42

Figure 1. Map of the Aterno-Pescara river basin (Abruzzo region, Italy), with the location of the sampling sites on the Samocito and Tirino rivers, where the blue colour variants of A. pallipes were observed .

Veterinaria Italiana 2015, 51 (2), 155-158. doi: 10.12834/VetIt.246.834.1

Caprioli et al.

Blue‑colour crayfish in Abruzzo region, Italy

Figure 2. Photographs of the blue crayfish found in the Samocito Brook (Abruzzo region, Italy).

In crayfish, the colour of the carapace is due to the presence of carotenoid pigment deposits on the first layer of the endocuticle, which forms the exoskeleton (Goodwin 1960). The pigment mainly involved is the astaxanthin (Meyers and Bligh 1981), but other carotenoids have been identified in A. astacus (Czeczuga and Czerpa 1969). In normally coloured crayfish, carotenoid molecules combine with proteins to form different carotenoproteins that mixed together give the characteristic olive‑brown coloration. If the pigment‑protein complexes are not properly formed, blue‑colour variants may occur (Momot and Gall 1971). Black and Huner (Black and Huner 1980) and Nakatani (Nakatani 1999) demonstrated that the dark blue phenotype of Procambarus clarkii is the result of an inherited, autosomal recessive trait, resulting from a mutation in the gene responsible for pigment formation. The mutation was shown to be controlled by Mendelian laws and is also apparently lethal for males in early development stages, since all the dark blue P. clarkii observed in those studies were females. It is interesting to note that also the 2 blue A. pallipes individulas observed in this study were females.

The frequency of the blue‑colour variants among the A. pallipes populations of the Abruzzo rivers appears

Veterinaria Italiana 2015, 51 (2), 155-158. doi: 10.12834/VetIt.246.834.1

to be low, taking into account that the 2 individuals herein described were observed within a 5‑years monitoring period (Caprioli et al. 2013b). During this period of time 1000 individuals were recorded and epidemic outbreaks of crayfish plague involving many animals were also detected (Cammà et al.

2010, Caprioli et al., 2013a). Interviews conducted with tour‑operators who manage canoeing centers operating in the same rivers described in this study revealed that the observations of blue‑colour crayfish were not unprecedented, albeint rare. Data on the frequency of blue‑colour variants in A. pallipes or other crayfish species are scanty. However, in a study conducted on the Orconectis virilis populations of 2 lakes in Michigan, US, the percentage of crayfish that were blue in colour was reported as very small (Momot & Gall 1971), and blue phenotypes were reported to occur at low frequency also in natural or cultured populations of Procambarus acutus (Black 1975) and Cherax destructor (Walker et al. 2000).

In conclusion, the blue variants of A. pallipes recorded in the Abruzzo rivers represent a natural phenomenon, which, as in other crayfish species (Momot & Gall, 1971; Black, 1975; Walker et al. 2000), is likely to occur at very low rates and can be due to an inherited autosomal recessive trait.

157

Blue‑colour crayfish in Abruzzo region, Italy

Caprioli et al.

References Aquiloni L., Tricarico E. & Gherardi F. 2010. Crayfish in Italy: distribution, threats and management. Int Aquat Res, 2, 1-14.

Holdich D.M. 2002. Background and functional morphology. In Biology of freshwater crayfish (D.M. Holdich, ed). London, Blackwell Science, 3-29.

Black J.B. 1975. Inheritance of the blue color mutation in the crawfish Procambarus acutus acutus (Girard).

Proceedings of the Louisiana Academy of Sciences, 38, 25-27.

Holdich D.M., Reynolds J.D., Souty‑Grosset C. & Sibley P.J. 2009. A review of the ever increasing threat to European crayfish from non‑indigenous crayfish species. Knowl Manag Aquat Ecosyst, 11, 394-395.

Black J.B. & Huner J.V. 1980. Genetics of the red swamp crawfish, Procambarus clarkii (Girard): state of the art. Proceedings of the Annual Meeting of the World Mariculture Society, 11, 535-543.

Huner J.V. 1994. Freshwater crayfish aquaculture in North America, Europe, and Australia. (J.V. Huner, ed). The Haworth Press, New York.

Cammà C., Ferri N., Zezza D., Marcacci M., Paolini A., Ricchiuti L. & Lelli R. 2010. Confirmation of crayfish plague in Italy: detection of Aphanomyces astaci in white clawed crayfish. Dis Aquat Org, 89, 265-268.

Caprioli R., Cargini D., Marcacci M., Cammà C., Giansante C. & Ferri N. 2013a. Self‑limiting outbreak of crayfish plague in an Austropotamobius pallipes population of a river basin in the Abruzzo region (central Italy). Dis Aquat Org, 103, 149.156.

Caprioli R., Garozzo P., Giansante C. & Ferri N. 2013b. Reproductive performance in captivity of Austropotamobius pallipes in Abruzzo Region (central Italy). Inv Rep & Dev, doi: 10.1080/07924259.2013.827136.

Meyers S.P. & Bligh D. 1981. Characterization of astaxanthin pigments from heat‑processed crawfish waste. J Agric Food Chem, 29, 505‑508.

Momot W.T., Gowing H. & Patricia D.J. 1978. The dynamics of crayfish and their role in ecosystems.

Am Mid Nat, 99, 10‑35.

Momot W.T. & Gall J.E. 1971. Some ecological notes on the blue color phase of the crayfish Orconectes virilis, in two lakes. Ohio J Sci, 71, 363-370.

Nakatani I. 1999. An albino of the crayfish Procambarus clarkii (Decapoda: Cambaridae) and its offspring. J Crust Bio, 19, 380‑383.

Czeczuga B. & Czerpak R. 1969. On carotenoids in the carapace of crayfish (Astacus astacus L.) (Crustacea: Decapoda). Hydrob, 33, 379‑384.

Scalici M., Belluscio A. & Gibertini G. 2008. Understanding the population structure and dynamics in threatened crayfish. J Zool, 275, 160-171.

Edgerton B.F., Henttonen P., Jussila J., Mannonen A., Paasonen P., Taugbøl T., Edsman L. & Souty‑Grosset C. 2004. Understanding the causes of disease in European crayfish. Conserv Biol, 18, 1466-1474.

Scalici M., Pitzalis M. & Gibertini G. 2009. Crayfish distribution updating in central Italy. Knowl Manag Aquat Ecosyst, 394‑395

Füreder L., Gherardi F., Holdich D., Reynolds J., Sibley P. & Souty‑Grosset C. 2010. Austropotamobius pallipes.

In IUCN 2010. IUCN Red List of Threatened Species.

Version 2010.3. http://www.iucnredlist.org.

Goodwin T.W. 1960. Biochemistry of pigments. In The physiology of Crustacea (T.H. Waterman, ed.). Academic Press, New York and London, 1, 101‑140.

Hedgecock D., Tracey M.L. & Nelson K. 1982. Genetics. In The biology of Crustacea (D.E. Bliss, ed). Academic Press, New York, 2, 283-403.

158

Lereboullet A. 1851. Note sur varietiés rouge et bleue de l'écrevisse fluviatile. Compt Rend, 33, 376‑379.

Souty‑Grosset C., Holdich D.M., Noël P.Y., Reynolds J.D. & Haffner P. 2006. Atlas of crayfish in Europe. Paris, Museum national d’Histoire naturelle.

Walker M.L., Austin C.M. & Meewan M. 2000. Evidence for the inheritance of a blue variant of the australian fresh‑water crayfish Cherax destructor (Decapoda: Parastacidae) as an autosomal recessive. J Crust Bio, 20, 25-30.

World Organisation for animal Health (OIE). 2009. Crayfish plague (Aphanomyces astaci), Chap 2.2.1. In Manual of diagnostic tests for aquatic animals, 6th ed. Office international des épizooties, Paris, 63-77.

Veterinaria Italiana 2015, 51 (2), 155-158. doi: 10.12834/VetIt.246.834.1

a cura di Manuel Graziani

LIBRI/Book reviews

Ernesto Correale

Il bufalo Allevamento e gestione (Edagricole, pp. 348, € 40,00) www.edagricole.it

Nello scrivere questo manuale Ernesto Correale, l’agronomo esperto di allevamento bufalino che ha collaborato con il Ministero delle Politiche Agricole, si è posto innanzi tutto l’obiettivo di costruire una guida aggiornata per i tecnici e le imprese zootecniche del comparto. La presenza nel nostro paese del bufalo, animale originario dell’india Orientale che si ritiene sia stato introdotto in Italia dai Longobardi, ha subito una drastica riduzione nella prima metà del ‘900 passando da 19.000 capi nel 1908 ad appena 5.500 nel 1950. La presenza è tornata ad aumentare esponenzialmente nel dopoguerra, tanto che oggi possiamo contare nel territorio nazionale circa 200.000 capi. Un incremento quantitativo ma soprattutto “qualitativo”, dato che l’allevamento bufalino ha cambiato radicalmente volto in questi anni e la sua evoluzione è stata supportata dal contributo rilevante della ricerca attraverso l’adozione di tecniche innovative finalizzate al miglioramento genetico, quindi della riproduttività, con l’utilizzo del Libro Genealogico e dei controlli funzionali. Senza sottacere le radicali trasformazioni di tipo strutturale che si sono succedute, come il passaggio alla stabulazione e alla mungitura meccanica e in genere a tutti quei sistemi sostenibili e automatizzati che concorrono al benessere dell’animale, al buon andamento dell’azienda e alla qualità dei suoi prodotti.

Questo aspetto è di fondamentale importanza perché gli allevamenti che si sono evoluti in base al concetto di specializzazione produttiva, hanno creato anche politiche di salubrità, sicurezza del lavoro e sostenibilità ambientale grazie all’uso di materiali riciclabili e naturali: ad esempio in molti allevamenti sono state sostituite le strutture in cemento armato con legno e acciaio.

Oltre alle tematiche di base il manuale approfondisce, quindi, temi quali il benessere animale mediante la sorveglianza dello stato di salute, la gestione delle risorse foraggere e la soddisfazione delle esigenze biologiche dell’animale perché migliorare la gestione e le tecniche di allevamento con un management attento, in cui ogni parametro è sotto controllo, significa prevenire l'incorrere in errori che si ripercuoterebbero negativamente sul bilancio aziendale e sulle condizioni di salute del bestiame. In proposito, chiosa l’autore: “L’adozione di tecniche di allevamento e di sistemi di stabulazione che garantiscono la salute e il benessere degli animali sono una condizione inderogabile non solo per motivazioni etiche, ma anche perché rappresentano un sinonimo di imprescindibile qualità.”

159

LIBRI/Book reviews

a cura di Manuel Graziani

(a cura di) Ambito Territoriale Caccia di Napoli

SOS Gabbiani Gestire la convivenza con il gabbiano reale (Ad Est dell’Equatore, pp. 80, € 9,00) www.adestdellequatore.com

I gabbiani reali sono una componente romantica e suggestiva dei panorami e dei tramonti marini, una specie intelligente e adattabile ma anche onnivora e opportunista. “Spazzini del mare” in grado di effettuare notevoli spostamenti giornalieri, cibandosi di una grande varietà di alimenti e spingendosi anche nell’entroterra verso discariche, campi, laghi e fiumi. Da qualche anno i gabbiani si stanno avvicinando agli uomini fino ad entrarci in contatto: una vicinanza a volte sgradita e spesso causa di inquietudine. La loro nidificazione sulle terrazze, sui balconi e sui lastrici solari può diventare un problema, soprattutto nelle città di mare e in quelle attraversate da fiumi (si pensi a Roma), tanto da spingere chi si sente minacciato a richiedere aiuto alle Forze dell’Ordine, ai Vigili del Fuoco e alla Lipu, la Lega italiana protezione uccelli.

Le risposte, però, non sono sempre risolutive. L’agile e ben curato libro dato alle stampe da Ad Est dell’Equatore è il primo in Europa a trattare in maniera mirata questa nuova materia, con consigli pratici e metodologie da seguire per affrontare con successo, oltre che in modo etico e consapevole, i casi concreti di convivenza con i gabbiani che, non va dimenticato, sono una specie protetta dalla legge. Nel volume vengono illustrate sia le tecniche di dissuasione preventive che quelle da seguire una volta avvenuta la nidificazione, con un ricco apparato fotografico sugli interventi effettuati da Sos Gabbiani: un progetto di studio teso a risolvere i problemi procurati da questi grandi volatili, nonché il primo servizio in Italia di assistenza per privati e Istituzioni. Con i suoi esperti ornitologi e professionisti, Sos Gabbiani ha affiancato, assistito e gestito tutti i casi segnalati dalle persone che hanno lanciato l’sos a partire dalla stagione riproduttiva del 2014. Il pionieristico progetto curato dell’Ambito Territoriale Caccia di Napoli, è stato realizzato fattivamente dagli attivisti della Lipu Fabio e Roberto Procaccini, il primo è un avvocato specializzato in gestione e diritto dell’ambiente. Davide Zeccolella, laureato in Scienze della Natura, attivista e guardia venatoria volontaria della Lipu che collabora con ornitologi dell’Ispra nell’attività di inanellamento degli uccelli a scopo scientifico. Infine Marco Dinetti che si è formato presso il Museo di Storia Naturale di Livorno e anche lui titolare della licenza per l’inanellamento a scopo scientifico degli uccelli.

160