Veterinaria Italiana, Volume 50 (3), July-September 2014

ISSN 0505-401X

Volume 50 (3) Luglio-Settembre July-September

2014

Rivista trimestrale di Sanità Pubblica Veterinaria, edita dall’Istituto Zooprofilattico Sperimentale dell’Abruzzo e del Molise “G. Caporale” A quarterly journal devoted to veterinary public health, veterinary science and medicine, published by the Istituto Zooprofilattico Sperimentale dell’Abruzzo e del Molise ‘G. Caporale’ in Teramo, Italy

Volume 50 (3), 2014

Carlo Verdecchia (Casoli di Atri, Teramo, 1905 - Napoli, 1984) Carro agricolo e animali. Olio su tela/Oil on canvas, cm 32x45.

Pinacoteca Civica, Teramo, Italy Opera peculiare della produzione di Carlo Verdecchia, questo Carro agricolo e animali appartiene a una fase stilistica ormai matura e pertanto può essere datato intorno alla metà degli anni cinquanta. Carlo Verdecchia, dopo aver avuto i primi contatti con l’arte attraverso Giuseppe, suo padre, di professione veterinario, ma anche sensibile paesaggista e fine intagliatore, aveva studiato all’Accademia di Belle Arti di Napoli e iniziato la propria attività artistica alla fine degli venti.

La ricerca di Verdecchia, superando lo stile novecentista allora dilagante, si volge subito “… a rivisitare la sintassi cubista, per quanto atteneva ad una formulazione spaziale autre; ad indagare lo sfaccettato corpus dell’espressionismo, per quanto invece concerneva una calibratura cromatica in chiave psicologica…” (Munari, 1982).

A un tal stile, così come ai temi legati alla sua terra d’origine, l’Abruzzo, Carlo Verdecchia resterà fedele per l’intero corso della sua carriera artistica.

This painting, Carro agricolo e animali (farm wagon with animals), belongs to a mature stylistic phase and as such it can be dated around the mid 50s. The painter first approached art thanks to his father, Giuseppe, who was a veterinary doctor but also a sophisticated painter and carver. Verdecchia was educated at the Accademia di Belle Arti in Naples and began his artistic production in the late 20s. His artistic efforts overcome the so-called novecentistic style, which was pervasive at the time of his activity. Rather, he was devoted to “revise the cubistic syntax, although it would resort to a different [autre] spacial definition; investigated the polyhedral corpus of the expressionism, for the choice the colours and their psychological implications […]”

(Munari, 1982). Verdecchia endorsed this stylistic approach as well as his interest to his region, the Abruzzi, for the entire course of his artistic career.

A cura di/By Polo Museale Città di Teramo

Questa rivista è nata nel 1950 con il nome di Croce Azzurra.

Dal 1954 si chiamerà Veterinaria Italiana.

Comitato direttivo Managing Scientific Board Romano Marabelli Fernando Arnolfo

Direttore Editor-in-Chief Giovanni Savini

Membri onorari Honorary Members Hassan Abdel Aziz Aidaros – Egypt Ayayi Justin Akakpo – Senegal Nicola T. Belev – Bulgaria Louis Blajan – France Stuart C. MacDiarmid – New Zealand J. Gardner Murray – Australia Yoshihiro Ozawa – Japan Alexander N. Panin – Russia

Victor E. Saraiva – Brazil Aristarhos M. Seimenis – Greece Arnon Shimshony – Israel Samba Sidibé – Mali James H. Steele – United States of America Gavin R. Thomson – South Africa Carlo Turilli – Italy Norman G. Willis – Canada

Comitato di redazione Editorial Board Maria Cesarina Abete – Italy Marina Bagni – Italy Gioia Capelli – Italy Pierfrancesco Catarci – Italy Giovanni Cattoli – Italy Annamaria Conte – Italy Paolo Cordioli† – Italy Esterina De Carlo – Italy Antonio Fasanella – Italy Rosario Fico – Italy Adriana Ianieri – Italy

Valerio Giaccone – Italy Ciriaco Ligios – Italy N. James MacLachlan – United States of America Paola Nicolussi – Italy Janusz Paweska – South Africa Giovanni Pezzotti – Italy Roberto Piro – Italy Giuseppe Ru – Italy Fabrizio Vitale – Italy Stéphan Zientara – France

Comitato scientifico Scientific Advisory Board L. Garry Adams – United States of America Menachem Banai – Israel Elie K. Barbour – Lebanon A.C. David Bayvel – New Zealand Giorgio Battelli – Italy Roy G. Bengis – South Africa Ingrid E. Bergmann – Argentina Peter F. Billingsley – United States of America Silvio Borrello – Italy Canio Buonavoglia – Italy Mike Brown – United Kingdom Gideon Brücknerr – South Africa Giovanni Cattoli – Italy Bernadette Connolly – United Kingdom Julio De Freitas – Brazil Piergiuseppe Facelli – Italy Gianluca Fiore – Italy Cesidio Flammini – Italy Riccardo Forletta – Italy Bruno Garin-Bastuji – France Giorgio Giorgetti – Italy Rob Gregory – New Zealand

Anwar Hassan – Malaysia Barry J. Hill – United Kingdom Katsuyuki Kadoi – Japan Bruce Kaplan – United States of America R. Paul Kitching – Canada Corinne I. Lasmézas – France Salvatore Magazzù – Italy Franco Mutinelli – Italy Klaus Nielsen – Canada Lisa Oakley – New Zealand Massimo Palmarini – United Kingdom Attilio Pini – Italy Santino Prosperi – Italy Franco M. Ruggeri – Italy Domenico Rutili – Italy Paul Sutmoller – The Netherlands Peter M. Thornber – Australia Silvio Arruda Vasconcellos – Brazil Patrick Wall – Ireland Alexander I. Wandeler – Canada Kazuya Yamanouchi – Japan Cristóbal Zepeda – United States of America

Segreteria di redazione Associate Editors Monica Bucciarelli, Guido Mosca, Mariarosaria Taddeo, Carlo Turilli Recensioni Book reviews Manuel Graziani Progetto grafico e web Graphic and web design Paola Di Giuseppe Amministrazione Administration Istituto Zooprofilattico Sperimentale dell’Abruzzo e del Molise “G. Caporale” Campo Boario, 64100 Teramo, Italia veterinariaitaliana@izs.it Stampa Printer Giservice srl, Teramo, Italia http://www.izs.it/vet_italiana/index.html © 2014 Istituto Zooprofilattico Sperimentale dell’Abruzzo e del Molise “G. Caporale” Campo Boario, 64100 Teramo, Italia

ISSN 0505-401X Formato elettronico Electronic format ISSN 1828-1427 Stampato su carta ecologica TCF Printed on 50% recycled, 100% chlorine- and acid-free environmentally friendly paper Aut. Trib. Teramo n. 299 del 16/05/1990 Sped. in Abb. Post. Art. 2 comma 20/c L. 66/96 DCB/DC Abruzzo Pescara

Istituto Zooprofilattico Sperimentale dell’Abruzzo e del Molise “G. Caporale” Campo Boario, 64100 TERAMO, Italia telefono +39 0861 3321, fax +39 0861 332251 www.izs.it

ROME, NOVEMBER 5-7, 2014 www.btconference2014.izs.it

The Steering Committee and the Scientific Committee are delighted to announce the IV International Conference on Bluetongue and related Orbiviruses, which will be held in Rome on November 5-7, 2014.

Ten years after the III International Conference on Bluetongue, Orbivirus-related diseases are still priority and, in some cases, an emergency for official veterinary services and livestock industry.

The evolution of such diseases, their dissemination in different areas and the innovations introduced in laboratory diagnosis pose the need for a new meeting devoted to update the international scientific community on the current situation, compare different approaches, and define new strategies for disease control.

Submissions of abstract for oral or poster presentations are welcome.

IV INTERNATIONAL CONFERENCE ON BLUETONGUE AND RELATED ORBIVIRUSES

CONFERENCE TIMELINE

July

September

October

November

November

2014

2014

2014

2014

2014

ASBTRACT SUBMISSION

NOTIFICATION OF ACCEPTANCE

CONFERENCE REGISTRATION

FULL PAPER SUBMISSION

1

15

18

7

5-7

CONFERENCE DAYS

PARTICIPATION Please go to the conference website for online registration and abstract submission (www.btconference2014.izs.it).

Selected abstract for oral presentations will be included in the conference program; posters will be displayed for the entire conference period and brief discussion sessions will be organized

during the conference breaks. All the accepted abstracts will be made available in the Conference Abstract Book, which will be distributed both in paper and electronic format. The booklet will also appear in the conference website.

TOPIC OF INTEREST SESSION III

SESSION V

SESSION VII

EPIDEMIOLOGY AND RISK ANALYSIS

ANIMAL-VECTOR-HOSTVIRUS INTERACTIONS

DIAGNOSTICS: RECENT DEVELOPMENTS

ECONOMIC AND TRADE IMPACT

• Global ecology • Distribution and variation • Factors of emergence and spread • Host-virus-vector evolution • Modelling • Wildlife SESSION II

• Host specificity • Factors of virulence • Pathogenesis • Immune response • Cellular target • Challenge models

• Virological detection and identification in hosts and vectors • Antibody detection

• Economic and trade impact of BT (policy makers : invited speakers only)

SESSION I

VECTORS • Ecology and global distribution • Taxonomy and identification • Competence and capacity • Immune response • Genome analysis • Vector-virus interactions • Vector-host interactions • Modelling • Control and genetic modification

SESSION IV

SESSION VI

CELL/VIRUS INTERACTIONS

SURVEILLANCE AND CONTROL

• Omics • Reverse genetics • Structure • Attachment and release • Replication • Protein functions • Antiviral mechanisms

• Animals • Vectors • Strategic approaches to surveillance • Vaccines and vaccination strategies • AHS control strategies

WEBSITE: btconference2014.izs.it EMAIL: bt2014@izs.it

Volume 50 (3), 2014 Dirk U. Pfeiffer From risk analysis to risk governance Adapting to an ever more complex future........................................ 169-176 Dall’analisi alla gestione del rischio per adattarsi ad un futuro ancora più complesso del presente (riassunto)..................................................... 169 Thomson Reuters Science Journal Citation Reports® database (JCR/Science Edition®) Journal impact factor 2012: 0.519 • National Library of Medicine’s MEDLINE/ PubMed system • Thomson Reuters Science Citation Index Expanded™ (SciSearch®) • CABI’s Full-Text Repository • Directory of Open Access Journals (DOAJ) • Elsevier’s SciVerse Scopus

Le pubblicazioni dell’Istituto Zooprofilattico Sperimentale dell’Abruzzo e del Molise “G. Caporale” (IZSAM) sono protette dalla legge internazionale sul copyright. Gli estratti possono essere letti, scaricati, copiati, distribuiti, stampati, recuperati; è consentito inoltre il collegamento ai file pdf di Veterinaria Italiana.

Informazioni per fini commerciali devono essere richieste all’IZSAM. Le traduzioni a stampa e gli adattamenti sono consentiti previa autorizzazione scritta da parte dell’IZSAM. Le opinioni espresse negli articoli pubblicati sono esclusivamente sotto la responsabilità degli autori. L’eventuale citazione di specifiche Ditte o prodotti, siano essi brevettati o meno, non implica che essi siano stati consigliati dall’IZSAM e vengano preferiti ad altri di simile natura non menzionati nei testi.

Publications of the Istituto Zooprofilattico Sperimentale dell’Abruzzo e del Molise ‘G. Caporale’ (IZSAM) are protected by international copyright law. Users are permitted to read, download, copy, distribute, print, search abstracts; besides they can link to Veterinaria Italiana full pdf files. Should information be required for commercial purposes, prior written permission must be sought from the IZSAM. Published translations and adaptations also require prior written approval from the IZSAM. The views expressed in signed articles are solely the responsibility of the authors. The mention of specific companies or products of manufacturers, whether or not patented, does not imply that these have been endorsed or recommended by the IZSAM in preference to others of a similar nature that are not mentioned.

Nadia Maria Sulli, Fabrizio De Massis, Stefania Salucci, Berardina Costantini, Luigi Iannetti & Vincenza Prencipe Detection of Listeria monocytogenes in food samples in Avezzano, Sulmona and Castel di Sangro (province of L'Aquila, Abruzzo, Italy) between 2000-2009 .............. 177-184 Ricerca di Listeria monocytogenes in campioni di alimenti prelevati nel periodo 2000-2009 nei comuni di Avezzano, Sulmona e Castel di Sangro, provincia di L'Aquila, Abruzzo, Italia (riassunto)............................................ 177

Akhigbe Ivbade, Olufemi Ernest Ojo & Morenike Atinuke Dipeolu Shiga toxin-producing Escherichia coli O157:H7 in milk and milk products in Ogun State, Nigeria ............................ 185-191 Escherichia coli O157:H7 e produzione di tossina shiga in latte e derivati nello stato di Ogun, Nigeria (riassunto)........................................................... 185

Stefania Dall'Olio, Emilio Scotti, Luca Fontanesi & Marco Tassinari Analysis of the 227 bp short interspersed nuclear element (SINE) insertion of the promoter of the myostatin (MSTN) gene in different horse breeds ................. 193-197 Analisi dell'inserzione della breve sequenza interspersa (SINE) di 227 bp nel promotore del gene miostatina in diverse razze di cavalli (riassunto).............................. 193

CASE REPORT Daniela Malatesta, Vic R. Simpson, Romina Fusillo, Manlio Marcelli, Laura Bongiovanni, Mariarita Romanucci, Chiara Palmieri & Leonardo Della Salda First description of adiaspiromycosis in an Eurasian otter (Lutra lutra) in Italy............................................ 199-202 Prima descrizione di un caso di adiaspiromicosi in lontra eurasiatica (Lutra lutra) in Italia (riassunto).................................................................. 199

Adela Sarvašová, Maria Goffredo, Igor Sopoliga, Giovanni Savini & Alica Kočišová Culicoides midges (Diptera: Ceratopogonidae) as vectors of orbiviruses in Slovakia.................................................. 203-212 Studio sui Culicoides (Diptera: Ceratopogonidae) possibili vettori di orbivirus in Slovacchia (riassunto).................................................................. 203

Volume 50 (3), 2014 Majid Esmaelizad & Rohani Kargar-Moakhar Phylogenetic study on the 5'-untranslated region of bovine viral diarrhoea virus isolates from Iran............................. 213-218 Studio filogenetico della struttura genomica di 5'-untranslated region di ceppi del virus della diarrea virale bovina in Iran (riassunto)................................................ 213

SHORT COMMUNICATION Clara Escudero, Rocío Vázquez, Ana Doménech, Esperanza Gómez-Lucía & Laura Benítez First report of a variant bovine papillomavirus type 2 (BPV-2) in cattle in the Iberian Peninsula........................................................ 219-226 Primo report di una variante di Papillomavirus bovino tipo-2 (BPV-2) nella Penisola iberica (riassunto)....................................................................................................... 219

SHORT COMMUNICATION Andrea Balboni, Giorgia De Lorenzo Dandola, Alessandra Scagliarini, Santino Prosperi & Mara Battilani Occurrence of different Canine distemper virus lineages in Italian dogs....................................................................... 227-231 Presenza di diversi lineage di Canine distemper virus in cani in Italia (riassunto)................................................................................................................... 227

SHORT COMMUNICATION Hartwig P. Huemer, Alexandra Zobl, Andrea Windisch, Walter Glawischnig, Mathias Büttner, Maria Kitchen & Karin Trevisiol Serological evidence for Parapoxvirus infection in chamois from the Tyrol regions of Austria and Italy ........................ 233-236 Evidenza sierologica di Parapoxvirus in camosci (Rupicapra rupicapra) in Tirolo (Austria e Italia) (riassunto)................................................................................................ 233

LIBRI/Book reviews (a cura di) Paolo Ciaramella Semeiologia Clinica Veterinaria ..................................................................................237 FNOVI, Autori Vari Rapporto Nomisma 2014: La professione medico veterinaria Prospettive future .............................................................................................................238

From risk analysis to risk governance - Adapting to an ever more complex future Dirk U. Pfeiffer Veterinary Epidemiology, Economics and Public Health Group, The Royal Veterinary College, London, United Kingdom Corresponding author at: Dirk U. Pfeiffer, Veterinary Epidemiology, Economics and Public Health Group, The Royal Veterinary College, Royal College St, London NW1 0TU, United Kingdom.

Tel: +44 1707 666205, e-mail: pfeiffer@rvc.ac.uk.

Veterinaria Italiana 2014, 50 (3), 169-176. doi: 10.12834/VetIt.313.1220.3 Accepted: 20.07.2014 | Available on line: 30.09.2014

Conference 2013 on Risk analysis in the Mediterranean Basin, Risk Analysis as a tool for the control of Animal Diseases and Zoonoses in the Mediterranean Basin. November 5-7, 2013 - Teramo, Italy - Selected papers Keywords Animal health, Disease control, Interdisciplinarity, Policy, Systems perspective.

Summary Risk analysis is now widely accepted amongst veterinary authorities and other stakeholders around the world as a conceptual framework for integrating scientific evidence into animal health decision making. The resulting risk management for most diseases primarily involves linking epidemiological understanding with diagnostics and/or vaccines. Recent disease outbreaks such as Nipah virus, SARS, avian influenza H5N1, bluetongue serotype 8 and Schmallenberg virus have led to realising that we need to explicitly take into account the underlying complex interactions between environmental, epidemiological and social factors which are often also spatially and temporally heterogeneous as well as interconnected across affected regions and beyond. A particular challenge is to obtain adequate understanding of the influence of human behaviour and to translate this into effective mechanisms leading to appropriate behaviour change where necessary. Both, the One Health and the ecohealth approaches reflect the need for such a holistic systems perspective, however the current implementation of risk analysis frameworks for animal health and food safety is still dominated by a natural or biomedical perspective of science as is the implementation of control and prevention policies. This article proposes to integrate the risk analysis approach with a risk governance framework which explicitly adds the socio-economic context to policy development and emphasizes the need for organisational change and stakeholder engagement.

Dall’analisi alla gestione del rischio per adattarsi ad un futuro ancora più complesso del presente Parole chiave Analisi del rischio, Epidemiologia, Gestione del rischio, Interdisciplinarità, Sanità Animale.

Riassunto In campo veterinario l’analisi del rischio è uno strumento che permette l’integrazione dei risultati scientifici con i processi di gestione della sanità animale correlando tra loro epidemiologia, diagnostica e sierologia (vaccini). La recente diffusione di focolai (virus Nipah, SARS, influenza aviaria H5N1, Bluetongue sierotipo 8 e Schmallenberg virus) ha evidenziato la necessità di prendere in considerazione le interazioni tra fattori ambientali, epidemiologici e sociali. In questo contesto è determinante identificare l’influenza del comportamento umano sull’insorgenza e la diffusione dei focolai epidemici per poter definire protocolli e campagne di informazione che modifichino i comportamenti rischiosi. Sia l’approccio One Health sia quello EcoHealth evidenziano la necessità di adottare una prospettiva olistica nell’analisi e gestione del rischio. Tuttavia, le prospettive scientifiche naturale e biomedica sono ancora quelle dominanti negli impianti concettuali delle analisi del rischio contemporanee e nell’implementazione dei protocolli per il controllo e la prevenzione delle malattie. Questo studio propone di integrare l’analisi del rischio con una gestione del rischio che nel definire i protocolli di controllo e prevenzione prenda esplicitamente in considerazione il contesto socio-economico e che, inoltre, enfatizzi la necessità di rivedere i processi decisionali e i criteri di coinvolgimento di tutti gli operatori coinvolti.

169

From risk analysis to risk governance

Introduction Risk analysis frameworks for animal health and food safety, as defined in the OIE Animal Health Code (Anonymous 2013a) and the Codex Alimentarius (Anonymous 2013b) have had major influence on the adoption of science-led decision making in animal health around the world (Anonymous 2010).

Veterinary authorities in most countries have used it to inform the development of disease control and prevention policies. The emphasis of these frameworks has been on risk pathways defined by epidemiological system characteristics taking account of scientific knowledge in relation to the relevant infectious pathogen, its host’s characteristics and the associated diagnostic methods. This has resulted in an improved transparency of the policies for disease control and international negotiations.

At the same time, however, the risk of emergence and spread of existing and new pathogens has increased as a consequence of global changes in food production, animal-human interfaces and human movement networks, as well as many other factors that characterise the age of the anthropocene (Crutzen 2002; McMichael 2014). Examples for such events in relation to animal health have been the emergence of bluetongue virus serotype 8 and Schmallenberg virus in Northern Europe, the Nipah virus outbreak in Malaysia and the highly pathogenic avian influenza virus (HPAIV) H5N1 epidemics in South-East and East Asia. This increased disease threat has led to the realisation that effective control and prevention of animal and human diseases require the development of new approaches to risk management that integrate knowledge about epidemiological risk factors with environmental and social risk factors. The One Health and ecohealth approaches are a result of this vision; but while the risk analysis framework provides sufficient flexibility to accommodate the holistic principles of a One Health or ecohealth approach, established practice around the world currently focuses primarily on biomedical and epidemiological system aspects. The following is a brief review of the scientific principles underlying risk analysis and its role in policy development. The article concludes stressing the need to embed risk analysis in animal health within risk governance frameworks so as to allow the development of more effective risk management policies, particularly when dealing with significant uncertainty in relation to the likelihood of disease occurrence and its consequences.

Science and knowledge As has been remarked by Hansson and Aven, it is essential to reflect on the role of science in the context of decision making when examining the use of risk analysis in policy development (Hansson

170

Pfeiffer

and Aven 2014). An important purpose of science is to generate the knowledge that allows us to understand cause-effect relationships within the world we live in (Van den Hove 2007). Until the end of the 19th century, it was believed that these relationships were of a deterministic nature, in that with complete knowledge it will be possible to precisely predict the behaviour of natural systems.

The fact that uncertainty is an inherent feature of natural systems has only been recognised since the beginning of the 20th century (Sarewitz and Pielke 1999). General public thinking is still dominated though by a conscious or subconscious preference for deterministic interpretation of cause-effect relationships. It is the aim of scientific research to reduce and where possible remove the uncertainty about cause-effect relationships, thereby improving the ability to effectively prevent or control diseases both in animal and human health. In this respect, the traditional perspective has been to emphasize the importance of the biomedical sciences, and the general view was that only reductionist science would lead to meaningful advances in scientific knowledge. This resulted in a specific research focus at the organism and the molecular level.

As a consequence, the importance of the effects generated by the interactions between entities within complex systems was not recognised or at least underestimated (Parkes et al. 2005). The emphasis on reductionism also resulted in the development of rigid boundaries separating different scientific disciplines, hence compromising the effectiveness of interdisciplinary approaches (Gieryn 1983). While research projects involving multiple disciplines have been encouraged by funding agencies for some time, such activities typically lead to working in parallel (i.e. multidisciplinary projects) rather than in an integrated fashion (i.e. interdisciplinary projects).

As a result the outputs of this type of research may well be of high scientific quality from a single discipline perspective but typically are unlikely to generate integrated knowledge. It is now recognised that to be able to deal with disease threats more effectively, it is essential to appreciate the complexity of the underlying system, including its biological, environmental and social dimensions (Fish et al. 2011; Leach and Scoones 2013). High quality reductionist and disciplinary science is necessary, but its outputs need to be integrated using interand transdisciplinary approaches (Lowe et al. 2013; Stokols et al. 2008; Wilkinson et al. 2011). In order to generate knowledge suitable for designing effective risk management policies, scientific researchers also need to recognise the potential importance of integrating a wide variety of knowledge perspectives in addition to scientific ones (Parkes et al. 2005). It is also important for policymakers and society in general to accept that certainty about cause-effect

Veterinaria Italiana 2014, 50 (3), 169-176. doi: 10.12834/VetIt.313.1220.3

Pfeiffer

From risk analysis to risk governance

relationships in complex systems is never completely attainable (Jasanoff 2007).

Interdisciplinary and transdisciplinary research The effective development of inter- and transdisciplinary research is compromised by a disciplinary and epistemological silo mentality amongst scientists which is still promoted by research and academic institutions as well as funding agencies (Syme 2008). The most difficult barrier to overcome is the one between the 2 disciplinary blocks comprising the natural and social sciences (Lele and Norgaard 2005). An element of such a process will have to be that scientists become more comfortable with epistemological pluralism (Miller et al. 2008).

Lyall et al (2011) provide a practical introduction to the implementation of interdisciplinary research projects. An integrated perspective towards the research question can be facilitated by developing an agreed conceptual framework outlining the relevant elements in the underlying eco-social system, such as the one described by Coker et al. (2011). The definition of transdisciplinary research varies in that some researchers view it as several disciplines working together for extended periods of time and developing novel conceptual and methodological frameworks, whereas others define it as adding a participatory dimension to interdisciplinary research (Klein 2008). The terms team science and action research have also been used to emphasise the translational aspect of transdisciplinary research (Stokols 2006; Stokols et al. 2008).

A particular challenge in inter- and transdisciplinary research is the need to use and integrate qualitative and quantitative data analysis approaches. Social scientists are usually very comfortable with this, whereas natural scientists tend to believe that qualitative data lacks scientific rigour and are therefore not suitable for generating knowledge that enhances our understanding of causeeffect relationships (Lele and Norgaard 2005).

Quantitative approaches emphasise the importance of measurement precision and representativeness in relation to a larger or other population to which inferences from the research are to be applied.

A recognised strength of qualitative data is the accuracy of the data collected concerning individuals in the sample. However, such data are less, if not completely, unsuitable for inferences beyond the sampled individuals. Mixed methods analysis techniques have been used in social sciences for some time to integrate qualitative and quantitative data analysis, which are for this reason able to benefit from the strengths of both approaches in data collection and analysis (Creswell 2014).

Veterinaria Italiana 2014, 50 (3), 169-176. doi: 10.12834/VetIt.313.1220.3

Systems perspective (Ecohealth/ One Health) Since the emergence of HPAIV H5N1, there has been increasing recognition that the complexity of ecosocial systems needs to be better understood to be able to deal effectively with current and future endemic, emerging and new infectious disease threats (Leach and Scoones 2013; Pfeiffer 2013; Pfeiffer et al. 2013; van Helden et al. 2013). The One Health and ecohealth approaches are a result of this development; while these approaches vary somewhat in the underlying concepts, they are now likely to converge towards a single approach which should reduce confusion and therefore increase acceptance amongst stakeholders (Zinsstag 2012).

The animal health scientists and policymakers found it relatively easy to accept the relevance of these concepts, while it appears to have been more difficult in human health. For risk questions suitable in the context of a One Health approach, the active engagement of ecological and environmental sciences and associated policy development is still quite poor, the situation is even worse with respect to the social sciences. But it is inevitable that as a result of the need for more effective risk management, policymakers will increasingly demand use of integrative approaches, and therefore the research communities will have to accept their relevance and integrated research will eventually also become part of mainstream academic education. One example of a major challenge that humanity will have to urgently deal with is the emergence and spread of antimicrobial resistance (Laxminarayan et al.

2013). Antimicrobials have become an essential risk management tool for protecting animal and human health from infectious disease threats as well as for achieving food security and safety. As a result, enormous quantities of antimicrobials are used in humans and animals for curative and preventive purposes, which in turn have become a major driver of emergence of resistance. There are also still some antimicrobial compounds that are used both in humans and animals, whereas many are now restricted to only human use. Attempts to regulate usage need to adopt a systems perspective able to take into account the variety of economic and social drivers that influence antimicrobial usage in humans as well as animals.

Risk analysis and risk governance A more effective link between scientific knowledge and policy development/implementation has been achieved by the widespread adoption of risk analysis frameworks concerning animal health, food safety and many other areas (Anonymous 2009; Anonymous 2010; Anonymous 2011; Vose 2008). A

171

From risk analysis to risk governance

key component of this framework is communication amongst the stakeholders involved or affected by the particular risk that is to be mitigated. Where risk management policies have been ineffective, poor communication between risk managers and risk assessors has often been mentioned as one of the reasons. A particular challenge is the communication of uncertainty by scientists to both decision makers and stakeholders affected by the decisions. It is widely recognised that quantitative information in relation to risk and uncertainty is difficult to communicate, as a result of differences in education and/or variation in risk perception amongst recipients of the relevant information (Hermans et al. 2012). Nonetheless, this admittedly very important issue has also detracted attention from the fact that the emphasis of risk assessment and management on biomedical drivers of the disease process often misses some of the key ecosocial factors influencing disease risk, and that these may well be a more important reason for ineffective risk management. For example, human behaviour has significant influence on animal disease emergence and the impact of any intervention (Aven and Renn 2010). Kasperson et al (1988) developed a conceptual framework describing the influence of psychological, social, institutional and cultural processes on risk (i.e. the social amplification of risk). Slovic et al (2004) emphasized the various dimensions of the concept of risk by referring to ‘risk as analysis’, ‘risk as feelings’ and ‘risk as politics’.

Given the extensively developed scientific theory and practical knowledge in relation to human behavioural drivers of risk, it is surprising that animal health risk assessment and management rarely take these factors explicitly into account (Brown 2008). Furthermore, the emphasis on independence between risk assessment and management has had a detrimental effect on the utility of the generated outputs, in that risk assessors and risk managers often find it difficult to work together (Anonymous 2009; Anonymous 2011; Ely et al. 2009a). While it is essential to maintain a conceptual separation between risk assessment and management, and thereby prevent risk managers from introducing undue bias into the risk assessment process, it is important to consider risk management options in the process of assessing the risk. Indeed, this also more appropriately reflects the difference between what Jasanoff (1995) defined as ‘research science’ and ‘regulatory science’, in that risk assessment as a scientific approach is usually conducted in response to a specific policy need and may inform actual regulatory actions, as distinct from scientific endeavours primarily aimed at improving knowledge. The influence of institutional and organisational factors also needs to be considered in the process of risk-based policy development. Rothstein and Downer (2012) and

172

Pfeiffer

Huber and Rothstein (2013) found that various aspects of organisational culture can adversely affect the impact of adopting a risk analysis approach in a government department. It was suggested that risk-based approaches were used to ‘cloak’ entrenched behaviours and perceptions as ‘rational’ and transparent policy. In another study, Rothstein et al. (2013) concluded that the adoption of risk-based policymaking (i.e. risk analysis) varies significantly between 3 European countries as a result of differences in societal, organisational and/or political norms and accountability in relation to risk governance. Stakeholders usually interpret animal health and food safety risk analysis frameworks as technical tools to support decision making, without realising or wanting to realise that they usually also require changes in institutional and organisational structures as well as behaviours, if they are to be effective. As part of a comprehensive review of risk analysis, the International Risk Governance Council (IRGC) identified 25 different deficits in risk governance structures and processes (Aven 2011). Apart from technical deficiencies, such as incomplete understanding of underlying biological processes, these included, for example, incomplete stakeholder consultation, inability to acknowledge incompleteness of knowledge and failure to take account of important factors, such as risk perception and risk acceptance.

Many of the aspects discussed above can also be examined in the context of the direction of the flow of information and the sequence of actions involved in risk analysis, and how all this influences the effectiveness of the resulting policies for risk management. Usually, a linear information flow underpins the development of risk management policies, in that following a risk problem identification (i.e. hazard identification) a risk assessment is conducted, which tends to be dominated by a biomedical science perspective.

The output from the risk assessment informs the policy development which is then communicated to relevant stakeholders. A commonly used variation on this approach is that the interpretation or evaluation of the outcomes of the risk assessment and the development of the risk management strategy are shaped by other information, such as the one concerning social and economic factors.

Millstone et al (2004) named the first option the technocratic and the second the decisionistic model. Given their linear nature and the biomedical science focus, both approaches do not adequately acknowledge the influence of system complexity including feedback loops on risk, stakeholder perceptions in response to risk and/or risk mitigation, and the potential for endorsing different mitigation options. Millstone et al (2004) therefore proposed the need to adopt a transparent model

Veterinaria Italiana 2014, 50 (3), 169-176. doi: 10.12834/VetIt.313.1220.3

Pfeiffer

From risk analysis to risk governance

based on a process that starts with development of a risk assessment policy grounded on socioeconomic and political considerations involving a wide group of stakeholders rather than starting with risk problem identification performed by a narrow group of stakeholders, which often ends up being just the policymakers. This approach places major emphasis on communication and stakeholder participation during risk analysis which, while being more demanding on resources, should enhance the likelihood of policy acceptance by key stakeholders.

Recognising the limitations of the risk analysis framework, some scholars (Renn 2005, Aven and Renn 2010) have proposed the IRGC risk governance framework that explicitly integrates the factual dimension of risk with its socio-cultural context. The term ’risk governance’ reflects the wider societal context of policy making. It can be defined as “the totality of actors, rules, conventions, processes, and mechanisms concerned with how relevant risk information is collected, analysed and communicated and management decisions are taken” (Aven and Renn 2010; Hermans et al. 2012). The components of the IRGC risk governance framework are pre-assessment, risk appraisal, tolerability & acceptability judgement and risk management (Renn 2005). Pre-assessment, tolerability and acceptability components have a particularly strong stakeholder engagement emphasis, whereas risk appraisal and risk management are broadly similar to the risk assessment and risk management components in the OIE’s risk analysis framework for animal health. Roodenrijs et al (2014) evaluated the feasibility of applying the IRGC framework for recent Q-fever and Schmallenberg virus outbreaks in the Netherlands. They found it to be broadly applicable but noted that one of the challenges will be to decide on the breadth of stakeholder input that will be required, particularly during the early phases of a disease outbreak when the situation is dominated by uncertainty. Through its extensive stakeholder engagement, the IRGC framework performs particularly well for risks associated with significant ambiguity, for example when there is wide variation in societal values and risk perception and therefore disagreement with respect to the appropriateness of different policy options. The IRGC risk governance framework has recently been adapted for application in food safety governance (Dreyer and Renn 2009). The resulting general framework consists of the 4 sequential components of risk framing, risk assessment, risk evaluation and risk management (Ely et al. 2009b). Both, risk framing and evaluation involve integrating socio-political considerations into the risk governance process, and thereby expand the very broad and somewhat vaguely defined risk communication component in the risk analysis framework.

Veterinaria Italiana 2014, 50 (3), 169-176. doi: 10.12834/VetIt.313.1220.3

Policy development and implementation Decision-making in relation to risk has become more challenging not only because of the physical and biological aspects of ecological and environmental changes together with vastly increased global connectedness, but also due to the increasing heterogeneity in social values and individual preference associated with educational and economic development. Rittel and Webber (1973) already recognised this trend as one of several factors contributing to the difficulty of policymakers being able to deal effectively in particular with so-called ‘wicked problems’. There are various examples of this type of decision-making challenge, including global issues such as climate change or locally relevant ones such as tuberculosis control in cattle in Great Britain.

Policy development is ultimately about making a judgment leading to a decision for a particular risk mitigation strategy, which will then either be effective (and potentially also accepted by stakeholders) or not.

This decision will be informed by several factors, such as risk estimates, resource availability, stakeholder values and legislation. It therefore integrates facts with values (Hansson and Aven 2014), The knowledge about the likelihood of event occurrence and the significance of its consequences together are widely interpreted as the ‘risk’. Traditional risk assessment will aim to quantify this risk. Nonetheless, it is important to recognise that risk is a complex multidimensional concept (Kasperson et al. 1988; Slovic et al. 2004) and therefore primarily focusing on scientific knowledge as the basis for a risk mitigation strategy is unlikely to achieve the desired outcomes (Hermans et al. 2012).

To more adequately reflect this complexity, Stirling (2010) developed an uncertainty matrix which uses the knowledge in relation to the probability of the event and its consequences (including. risk management options) as its 2 dimensions. He thereby defines the 4 knowledge states of ‘risk’, ‘uncertainty’, ‘ambiguity’ and ‘ignorance’. Using this approach, the detection of bovine spongiform encephalopathy (BSE) during the first couple of years after detection represents an example of the knowledge state of ‘ignorance’ where there is major uncertainty with respect to probability of occurrence and lack of knowledge about the consequences of occurrence. The situation with bovine tuberculosis in Great Britain offers an instance for the ‘ambiguity’ knowledge state, in that there is relatively good knowledge about the probability of infection in cattle but significant variation in knowledge and opinion about the consequences of occurrence and any interventions. An example for the knowledge state of ‘risk’ is the occurrence of bovine virus diarrhoea (BVD) in intensive livestock production systems where the probability of BVD occurrence is relatively well understood and the consequences

173

From risk analysis to risk governance

are known and there is little disagreement about the management options. It may indeed be more appropriate to refer to this particular knowledge state as ‘simple risk’ (Renn et al. 2011). The knowledge state of ‘uncertainty’ applies to exotic diseases such as foot-and-mouth disease, where the introduction of the causative virus is subject to uncertainty but the consequences are well understood and the management tools established. The risk analysis framework for animal health performs best for the knowledge state of ‘simple risk’, less so for that of ‘uncertainty’, but it is of limited utility when confronted with ‘ambiguity’ or ‘ignorance’. Policy makers should use these 4 broad categories to inform their choice of tools for integrating different types of knowledge such that it optimises their chances of being able to make good decisions. It is very understandable that policy makers are most comfortable in the knowledge state of ‘simple risk’, since they have to deal with very limited uncertainty in relation to event occurrence and its consequences. At the same time, it is surprising that both the science-policy interface and government decision making processes are usually ‘optimised’ for the ‘simple risk’ states and to a lesser extent for ‘uncertainty’ knowledge states, despite of both these representing less difficult challenges for decision making compared with the knowledge states of ‘ambiguity’ and ‘ignorance’. Indeed, there have been many challenges to animal health in the past 20 years that have been in the 3 knowledge state categories of ‘uncertainty’, ‘ambiguity’ or ‘ignorance’.

In these situations, targeted public engagement strategies become particularly important and knowledge generated using qualitative analytical methods is likely to be as useful or even more useful than quantitative analysis (Stirling 2012). These cases unveil the limitations of risk analysis frameworks for animal health and food safety which have a primary biomedical focus (Ely et al. 2009b). The risk framing phase of the IRGC risk governance framework will allow policy makers to clarify which knowledge state applies to a particular hazard, and inform decision making in relation to the most appropriate risk assessment methods. It involves explicit interaction between risk assessors and managers as well as any other important stakeholders. The evaluation of the findings from the risk assessment is aimed at assessing the tolerability or acceptability of the risk and, therefore, determines whether nothing will have to be done, further risk assessment or a risk mitigation policy will be required. This is also the stage where a decision to invoke the precautionary principle can be made (Renn 2008; Stirling and Gee 2002). Public engagement is a key aspect of the IRGC risk governance framework, and it needs to be based on a detailed stakeholder analysis to be conducted during the risk framing phase. Mills et al. (2011) present an example of this process for identifying

174

Pfeiffer

stakeholder groups with ‘interest’ and ‘influence’ in plant health issues, and they emphasize that appropriate stakeholder choice for involvement in a risk assessment will strongly benefit the acceptance of any risk management policies. Overall, the IRGC risk governance framework should be used as a model for an evolutionary adaptation of the current risk analysis frameworks for animal health and food safety that will take advantage of the experience with their use in the last 20 years and our improved understanding of decision making processes, particularly in terms of the role of a wider range of sciences.

Conclusions As a result of technological development, globalisation, environmental change and modern society’s expectations, policy development in animal health has become an ever more challenging process.

The still widely used linear technocratic models for policy development have limited effectiveness when dealing with risks occurring within complex eco-social systems. The utility of the established risk analysis frameworks for animal health and food safety could be enhanced if they were subsumed into a risk governance framework that better recognises the wider meaning of the term ‘risk’. Specifically, the addition of risk framing and risk evaluation to the current animal health risk analysis components of hazard identification, risk assessment, management and communication places a more explicit emphasis on the socio-economic and participatory dimensions of policy responses to risk. Furthermore, the risk assessment process itself has to take account of the breadth of factors influencing pathogen transmission from the molecular to the population/ landscape/regional level, including socio-economic factors, and interactions between factors as well as emergent properties at system level. This requires an inter- or transdisciplinary research approach which is comfortable with bringing together knowledge from different scientific disciplines including that generated by quantitative and qualitative approaches, rather than being dominated by the natural and biomedical sciences and quantitative methods, as is currently the case. It is also important to consider the impact of organisational culture on risk management. Indeed, organisational behaviour varies within and between countries and regions, such that it may be possible to implement effective science-led decision making in some countries with relative ease but only with major difficulty or not at all in others. Finally, and may be most importantly, a risk governance approach will have to optimise its public engagement component based on the socioeconomic risk characteristics of the hazard, since this will positively influence appropriateness and acceptance, and therefore impact of policies.

Veterinaria Italiana 2014, 50 (3), 169-176. doi: 10.12834/VetIt.313.1220.3

Pfeiffer

From risk analysis to risk governance

References Aven T. & Renn O. 2010. Risk management and governance.

Heidelberg, Germany, Springer Verlag, 276 pp.

Aven T. 2011. On risk governance deficits. Safety Science, 49, 912-919.

Brown V.A. 2008. A collective social learning pattern. In EuroPLoP 2008: 13th Annual European Conference on Pattern Languages of Programming, (T. Schümmer, & A. Kelly, eds.) CEUR Workshop Proceedings, Irsee, Germany, 14.

Coker R., Rushton J., Mounier-Jack S., Karimuribo E., Lutumba P., Kambarage D., Pfeiffer D., Stark K. & Rweyemamu M. 2011. Towards a conceptual framework to support one-health research for policy on emerging zoonoses. Lancet Infect Dis,11, 326-331.

Creswell J.W. 2014. Research design: Qualitative, quantitative and mixed methods approaches. London, UK, SAGE Publications, 304 pp.

Cribb A., Dohoo I.R., Donahue D., Fairbrother J.M., Frank D., Hall D.C., Hurd H.S., Laycraft D., Leighton F.A., Leroux T., Pfeiffer D. & Sargeant J. 2011. Health Animals, Health Canada: The Expert Panel on Approaches to Animal Health. Council of Canadian Academies, Ottawa, 253 pp.

Crutzen P.J. 2002. Geology of mankind. Nature, 415, 23.

Kasperson R.E., Renn O., Slovic P., Brown H.S., Emel J., Goble R., Kasperson J.X. & Ratick S. 1988. The social amplification of risk: a conceptual framework. Risk Analysis, 8, 177-187.

Klein J.T. 2008. Evaluation of interdisciplinary and transdisciplinary research: a literature review. Am J Prev Med, 35, S116-S123.

Laxminarayan R., Duse A., Wattal C., Zaidi A.K., Wertheim H.F., Sumpradit N., Vlieghe E., Hara G.L., Gould I.M., Goossens H., Greko C., So A.D., Bigdeli M., Tomson G., Woodhouse W., Ombaka E., Peralta A.Q., Qamar F.N., Mir F., Kariuki S., Bhutta Z.A., Coates A., Bergstrom R., Wright G.D., Brown E.D. & Cars O. 2013. Antibiotic resistance - the need for global solutions. Lancet Infect Dis, 13, 1057-1098.

Leach M. & Scoones I. 2013. The social and political lives of zoonotic disease models: narratives, science and policy. Social science & medicine, 88, 10-17.

Lele S. & Norgaard R.B. 2005. Practising interdisciplinarity.

BioScience, 55, 967-975.

Lowe P., Phillipson J. & Wilkinson K. 2013. Why social scientists should engage with natural scientists.

Contemporary Social Science: Journal of the Academy of Social Sciences, 8(3), 207-222.

Dreyer M. & Renn O. 2009. Food safety governance. Berlin, Germany, Springer Verlag, 249 pp.

Lyall C., Bruce A., Tait J. & Meagher L. 2011. Interdisciplinary research journeys. Practical strategies for capturing creativity. London, UK, Bloomsbury Publishing, 240 pp.

Ely A., Stirling A., Dreyer M., Renn O., Vos E. & Wendler F. 2009a. The need for change. In Food safety governance (M. Dreyer & O. Renn, eds.) Springer Verlag, Berlin, Germany, 11-27.

McMichael A.J. 2014. Population health in the Anthropocene: gains, losses and emerging trends. The Anthropocene Review, 1(1), 44-56.

Ely A., Stirling A., Dreyer M., Renn O., Vos E & Wendler F. 2009b. Overview of general framework. In Food safety governance (M. Dreyer & O. Renn, eds.) Springer Verlag, Berlin, Germany, 29-45.

Fish R., Austin Z., Christley R., Haygarth P.M., Heathwaite A.L., Latham S., Medd W., Mort M., Oliver D.M. & Pickup R. 2011. Uncertainties in the governance of animal disease: an interdisciplinary framework for analysis.

Philos Trans R Soc Lond B Biol Sci, 366, 2023-2034.

Gieryn T.F. 1983. Boundary-work and the demarcation of science from non-science. Strains and interests in professional ideologies of scientists. American Sociological Review, 48, 781-795.

Hansson S.O. & Aven T. 2014. Is risk analysis scientific? Risk Analysis, 34(7), 1173-1183.

Hermans M.A., Fox T. & van Asselt M.B.A. 2012. Risk governance. In Handbook of risk theory. Epistemology, decision theory, ethics, and social implications of risk (S. Roeser, R. Hillerbrand, P. Sandin & M. Peterson, eds.)

Springer, Dordrecht, The Netherlands, 1093-1117.

Huber M. & Rothstein H. 2013. The risk organisation: or how organisations reconcile themselves to failure.

Journal of Risk Research, 16, 651-675.

Jasanoff S. 1995. Procedural choices in regulatory science.

Technology in Society, 17, 279-293.

Jasanoff S. 2007. Technologies of humility. Nature, 450, 33.

Veterinaria Italiana 2014, 50 (3), 169-176. doi: 10.12834/VetIt.313.1220.3

Miller T.R., Baird T.D., Littlefield C.M., Kofinas G., Chapin III.F.S. & Redman C.L. 2008. Epistemological pluralism: reorganizing interdisciplinary research. Ecology and Society, 13(2), 46. http://www.ecologyandsociety.org/ vol13/iss2/art46/.

Mills P., Dehnen-Schmutz K., Ilbery B., Jeger M., Jones G., Little R., MacLeod A., Parker S., Pautasso M., Pietravalle S. & Maye D. 2011. Integrating natural and social science perspectives on plant disease risk, management and policy formulation. Phil Trans R Soc Lond B Biol Sci, 366, 2035-2044.

Millstone E., van Zwanenberg P., Marris C., Levidow L. & Torgerson H. 2004. Science in trade disputes related to potential risks: Comparative case studies. In Technical Report Series (O. Wolf, D. Ibarreta & P. Sorup, eds.)

European Commission Joint Research Centre, Institute for Prospective Technological Studies, Seville, Spain, 58 pp.

National Research Council (NRC). 2009. Science and decisions: advancing risk assessment. The National Academies Press, Washington DC, USA, 403 pp.

Parkes M.W., Bienen L., Breilh J., Hsu L.N., McDonald M., Patz J.A., Rosenthal J.P., Sahani M., Sleigh A., Waltner-Toews D. & Yassi A. 2005. All hands on deck: transdisciplinary approaches to emerging infectious disease. EcoHealth, 2, 258-272.

Pfeiffer D.U. 2013. Epidemiology caught in the causal web of bovine tuberculosis. Transbound Emerg Dis, 60 (Suppl 1), 104-110.

175

From risk analysis to risk governance

Pfeiffer D.U., Otte M.J., Roland-Holst D. & Zilberman D. 2013. A one health perspective on HPAI H5N1 in the Greater Mekong sub-region. Comp Immunol Microbiol Infect Dis, 36(3), 309-319 .

Renn O. 2005. Risk governance. Towards an integrative approach. The International Risk Governance Council, Geneva, Switzerland, 154 pp.

Renn O. 2008. Precaution and ecological risk. In Human Ecology (S.E. Jorgensen & B.D. Fath, eds.) Elsevier, Oxford, UK, 2909-2916.

Renn O., Klinke A. & van Asselt M. 2011. Coping with complexity, uncertainty and ambiguity in risk governance: a synthesis. Ambio, 40, 231-246.

Rittel H.W.J. & Webber M.M. 1973. Dilemmas in general theory of planning. Policy Sci, 4, 155-169.

Roodenrijs J.C.M., Kraaij-Dirkzwager M.M., van den Kerkhof J.H.T.C. & Runhaar H.A.C. 2014. Risk governance for infectious diseases: exploring the feasibility and added value of the IRGC-framework for Dutch infectious disease control. Journal of Risk Research, 1-22. doi:10.1 080/13669877.2013.875935.

Rothstein H. & Downer J. 2012. Renewing DEFRA': exploring the emergence of risk-based policymaking in UK central government. Public Administration, 90, 781-799.

Rothstein H., Borraz O. & Huber M. 2013. Risk and the limits of governance: exploring varied patterns of risk-based governance across Europe. Regulation & Governance, 7, 215-235.

Sarewitz D. & Pielke R.A. Jr. 1999. Prediction in science and policy. Technology in Society, 21, 121-133.

Slovic P., Finucane M.L., Peters E. & MacGregor D.G. 2004.

Risk as analysis and risk as feelings: some thoughts about affect, reason, risk, and rationality. Risk Analysis, 24, 311-322.

Stirling A. & Gee D. 2002. Science, precaution, and practice.

Public Health Rep, 117, 521-533.

Stirling A. 2010. Keep it complex. Nature, 468, 1029-1031.

Stirling A. 2012. Opening up the politics of knowledge

176

Pfeiffer

and power in bioscience. PLoS Biol, 10(1), e1001233. doi:10.1371/journal.pbio.1001233.

Stokols D. 2006. Toward a science of transdisciplinary action research. American journal of community psychology, 38, 63-77.

Stokols D., Hall K.L., Taylor B.K. & Moser R.P. 2008. The science of team science: overview of the field and introduction to the supplement. Am J Prev Med, 35, S77-89.

Syme S.L. 2008. The science of team science: assessing the value of transdisciplinary research. Am J Prev Med, 35, S94-95. van den Hove S. 2007. A rationale for science-policy interfaces. Futures, 39, 807-826. van Helden P.D., van Helden L.S. & Hoal E.G. 2013.

One world, one health. Humans, animals and the environment are inextricably linked - a fact that needs to be remembered and exploited in our modern approach to health. EMBO reports, 14, 497-501.

Vose D. 2008. Risk analysis. A quantitative guide. Chichester, West Sussex, England, John Wiley & Sons, 735 pp.

Wilkinson K., Grant W.P., Green L.E., Hunter S., Jeger M.J., Lowe P., Medley G.F., Mills P., Phillipson J., Poppy G.M. & Waage J. 2011. Infectious diseases of animals and plants: an interdisciplinary approach. Phil Trans R Soc B, 366, 1933-1942.

World Organisation for Animal Health (OIE). 2010.

Handbook on import risk analysis for animals and animal products: Introduction and qualitative risk analysis. Paris, France, OIE Publications, 88 pp.

World Organisation for Animal Health (OIE). 2013a.

Terrestrial animal health code. Paris, France, World Organisation for Animal Health.

World Organisation for Animal Health (OIE). 2013b. Codex Alimentarius Commission. Procedural Manual. 21 ed.

World Health Organisation / Food and Agriculture Organization of the United Nations, Rome, Italy.

Zinsstag J. 2012. Convergence of Ecohealth and One Health. EcoHealth, 9, 371-373.

Veterinaria Italiana 2014, 50 (3), 169-176. doi: 10.12834/VetIt.313.1220.3

Detection of Listeria monocytogenes in food samples in Avezzano, Sulmona and Castel di Sangro (province of L'Aquila, Abruzzo, Italy) between 2000-2009 Nadia Maria Sulli*, Fabrizio De Massis, Stefania Salucci, Berardina Costantini, Luigi Iannetti & Vincenza Prencipe Istituto Zooprofilattico Sperimentale dell’Abruzzo e del Molise ‘G. Caporale’, Campo Boario, 64100 Teramo, Italy * Corresponding author at: Sezione Diagnostica di Avezzano (AQ), Istituto Zooprofilattico Sperimentale dell'Abruzzo e del Molise 'G. Caporale', Campo Boario, 64100 Teramo, Italy.

Tel.: +39 0861 332600, e-mail: n.sulli@izs.it.

Veterinaria Italiana 2014, 50 (3), 177-184. doi: 10.12834/VetIt.22.1805.12 Accepted: 18.04.2014 | Available on line: 30.09.2014

Keywords Abruzzo, Food categories, Foodborne deseases, Listeria monocytogenes.

Summary The retrospective study of the results of the analysed samples is a fundamental tool for the identification of major risk related to food and for planning future monitoring activities. The evaluation of the quality of data collected may also allow for estimating the effectiveness of the controls so to improve their efficacy. In this article, the authors evaluated the results of tests for the detection of Listeria monocytogenes performed by the Istituto Zooprofilattico Sperimentale dell’Abruzzo e del Molise ‘G. Caporale’ (IZSAM) on food samples collected during the years 2000-2009 in the territory of Avezzano, Sulmona and Castel di Sangro (province of L’Aquila, Abruzzo, Italy). The comparison of the data examined with those from studies conducted in Italy and in other countries shows that the categories with higher percentages of positivity for Listeria monocytogenes are meat and fish products. Data collected do not indicate cheese as a vehicle of contamination in the sampled areas, in contrast to what reported in the national and international literature. It would therefore be necessary to promote an ad hoc sampling in the areas covered by this study to verify this aspect in more depth.

Ricerca di Listeria monocytogenes in campioni di alimenti prelevati nel periodo 2000-2009 nei comuni di Avezzano, Sulmona e Castel di Sangro, provincia di L’Aquila, Abruzzo, Italia Parole chiave Abruzzo, Categorie alimentari, Tossinfezioni alimentari, Listeria monocytogenes.

Riassunto Lo studio retrospettivo dei risultati delle analisi dei campioni di alimento rappresenta uno strumento fondamentale per l’individuazione dei principali prodotti a rischio e per la pianificazione delle future attività di controllo nel territorio. La valutazione della qualità dei dati raccolti, inoltre, può permettere di stimare l’efficacia dei controlli precedentemente attuati, in prospettiva di un successivo miglioramento. Nel presente lavoro gli autori hanno valutato i risultati degli esami per la ricerca di Listeria monocytogenes effettuati dall’Istituto Zooprofilattico Sperimentale dell’Abruzzo e del Molise “G. Caporale” (IZSAM) su campioni di alimento prelevati nel decennio 2000-2009 nei comuni di Avezzano, Sulmona e Castel di Sangro in provincia di L’Aquila, Abruzzo, Italia. Dal confronto dei dati riportati in questo lavoro con quelli provenienti da studi effettuati in Italia e in altri Paesi si evince come gli alimenti con maggiori percentuali di positività per Listeria monocytogenes siano i prodotti carnei e ittici. I dati rilevati dal presente lavoro, inoltre, non evidenziano un ruolo dei formaggi come veicolo di contaminazione del microrganismo nei territori oggetto di campionamento, a differenza di quanto riportato in letteratura nazionale e internazionale. Sarebbe necessario, pertanto, promuovere un campionamento ad hoc nei territori interessati dal presente studio mirato a verificare questo aspetto.

177

Listeria moncytogenes in food samples in Abruzzo

Introduction Listeria monocytogenes is the causative agent of listeriosis, a serious disease that affects mostly infants, pregnant women and patients with immunosuppressive diseases causing septicaemia and meningitis in adults, abortions and stillbirths in pregnant women (Cordano and Rocourt 2001, Rantsiou et al. 2012). In the early stages, the infection has nonspecific symptoms such as fatigue, headache, joint and muscle pain, gastroenteritis.

Without appropriate antibiotic treatment, however, it can develop into an invasive form characterized by septicaemia, meningitis, encephalitis and death (Vitas and Garcia-Jalon 2004). The incubation period is highly variable and can range from 3 to 70 days.

The virulence of L. monocytogenes is associated with the individual sensitivity (Conter et al. 2007) and various characteristics of the strains including the serotype. Four (1/2a, 1/2b, 1/2c, and 4b) of the 13 serotypes identified and described in literature are responsible for the majority of clinical cases in humans. The 4b serotype is the most frequently isolated from outbreaks (Cordano and Rocourt 2001, Norrung et al. 1999). According to the results of the considered studies, long periods of adaptation to environmental stresses (changes in temperature, pH, aw) due to the intrinsic characteristics of certain foods may affect the virulence of this organism (Ryser and Marth 1999)1.

L. monocytogenes causes disease in humans with an incidence ranging between 0.1 and 11.3 cases per million inhabitants. In Europe, the incidence is 3.5 cases per million inhabitants, while, in the United States of America and Australia, the incidence is 3 and 4.4 cases per million inhabitants, respectively (Nuvoloni et al. 2006, Mena et al. 2004, Uyttendaele et al. 1999, Farber and Peterkin 1991). Nonetheless, the severity of the disease and the associated high mortality (20-30%) justifies the interest devoted to it in terms of public health (Olesen et al. 2008).

Listeriosis is generally considered a foodborne disease, due to the consumption of contaminated food. In fact, L. monocytogenes has been isolated in many aliments of animal origin (milk, cheese, ice cream, meat, meat products, fishery products) and in processing environments (Gattuso et al. 2005, Scallan et al. 2011)2. In cooked products, the contamination can occur after the heat treatment or may be the consequence of an insufficient healing process. Ready to eat (RTE) foods are most frequently implicated in

Sulli et al.

outbreaks. Particularly, 3 categories of RTE foods have been identified as most at risk for consumers (Farber and Peterkin 1991): meat products subjected to heat treatment and subsequently manipulated (already portioned meat products, delicatessen products), soft or semi-soft cheeses (gorgonzola, taleggio cheese, brie, queso fresco) and smoked fish (salmon). Even raw milk, ricotta and different types of fruit and vegetables have been identified as cause of listeriosis outbreaks (Farber and Peterkin 1991, Conter et al. 2007, Olesen et al. 2008).

In accordance with the provisions of EC Regulation 882/2004, the official control activities should be conducted according to a previous programming based on risk analysis (Ramaswamy et al. 2007).

The retrospective study of the results of the analysed samples is a fundamental tool for the identification of major risk foods and the planning of monitoring activities. The evaluation of the quality of the collected data may also allow for assessing the effectiveness of the controls previously implemented in the perspective of future improvements. The purpose of this study, therefore, is to explain critically the results of tests for the detection of L. monocytogenes performed by the IZSAM on food samples collected from 2000 to 2009 in the territory of Avezzano, Sulmona and Castel di Sangro (province of L'Aquila, Abruzzo).

Materials and methods The samples were delivered to the Avezzano diagnostic section of IZSAM by the Public Veterinary Service (Avezzano, Sulmona and Castel di Sangro districts) and by the Food Hygiene and Nutrition Service (FINS) (only Avezzano district) of the Local Health Unit (LHU) of Avezzano-Sulmona-Castel di Sangro, as well as by the Carabinieri Health Protection Unit (NAS). Food samples were collected by means of official sampling at retail and at production and administration level as part of surveillance programs on food security.

The technique for the isolation of L. monocytogenes from food has been ISO 112903 (Baek et al. 2000).

Results The total number of samples tested for detection of L. monocytogenes is shown in Table I. The number of samples submitted is variable from year to

E uropean Commision (EC). 2004. Regulation (EC) N. 882/2004 of the European Parliament and of the Coouncil of 29 April 2004 on official controls performed to ensure the verification of compliance with feed and food law, animal health and animal welfare rules. Off J, L 191, 28/05/2004.

2 C enters for Disease Control and Prevention (CDC). 2012. Multistate outbreak of listeriosis linked to imported frescolina marte brand ricotta salata cheese (final update). www.cdc.gov/listeria/outbreaks/cheese-09-12/.

3 C EN ISO 11290-1:1996/Amd.1:2004. Microbiology of food and animal feeding stuffs - Horizontal method for the detection and enumeration of Listeria monocytogenes - Part 1: Detection method- Amendment 1: Modification of the isolation media and the haemolysis test and inclusion of precision.

1

178

Veterinaria Italiana 2014, 50 (3), 177-184. doi: 10.12834/VetIt.22.1805.12

Sulli et al.

Listeria moncytogenes in food samples in Abruzzo

year (Table I) and ranges from a minimum of 33 in 2008 (4.2%) to a maximum of 147 in 2004 (18.1%).

In the period 2000-2002, the number of samples remains approximately the same, then it increases over the period 2003-2006 and subsequently decreases in 2007-2008, before returning to higher values in 2009 (Table I).

Figure 1 shows the percentage of samples in relation to the year and the sampling body. The Veterinary Service of Avezzano submitted 30.4% of the samples, Sulmona 61.1%, and Castel di Sangro 1.2%., NAS 2.6% and FINS 4.7%. Until 2004, the Veterinary Services of Avezzano and Sulmona have given mostly the same number of samples, from 2005 to 2009 the Veterinary Services of Sulmona has given the majority.

Table I. Total number of samples tested for Listeria monocytogenes between 2000 and 2009 in Avezzano, Sulmona and Castel di Sangro (province of L'Aquila, Abruzzo, Italy) by year.

The examined samples were divided into categories related to those identified in the last EFSA Report on zoonoses (Farber and Peterkin 1991) (Table II). Even the food categories subject to sampling (Table II) are numerically different over the years. In fact, for dairy products, samples ranged from 7 in 2008 to 78 in 2009, for meat products the samples ranged from 5 in 2000 to 62 samples in 2004, while for fish products the samples ranged from 26 samples in 2003 to 2 in 2006 (no fish samples were considered during years 2007, 2008 and 2009). For other food matrices, samples ranged from 29 samples in 2004 to 2 in 2001, while there were no samples in 2000, 2003 and 2009.

Dairy products were the majority (51.7%), followed by meat products (31.3%) and fish products (8.6%).

The first 2 were received in greater numbers over the years, with meat products prevailing in a few cases

Year 2000 2001 2002 2003 2004 2005 2006 2007 2008 2009 Total

Total samples 50 62 41 102 147 121 98 48 33 110 812

% 6.2 7.6 5.0 12.6 18.1 14.9 12.1 5.9 4.1 13.5 100.0

100% 90% 80% 70%

Percentage

60% 50% 40% 30% 20% 10% 0%

2000

2001

2002

2003

2004

2005

2006

2007

2008

2009

Year Veterinary Services Avezzano

Veterinary Services Sulmona

NAS

Veterinary Services Castel di Sangro

SIAN

Figure 1. Percentage of samples collected from various body sampler in the period 2000-2009 in Avezzano, Sulmona and Castel di Sangro (province of L'Aquila, Abruzzo, Italy).

Veterinaria Italiana 2014, 50 (3), 177-184. doi: 10.12834/VetIt.22.1805.12

179

Listeria moncytogenes in food samples in Abruzzo

Sulli et al.

Table II. Number of samples tested for Listeria monocytogenes between 2000 and 2009 in Avezzano, Sulmona and Castel di Sangro (province of L'Aquila, Abruzzo, Italy) arranged by food group.

Food group Dairy products Meat products Fish products Other food matrices Total

2000 40 5 5 0 50

2001 32 23 5 2 62

2002 11 18 5 7 41

2003 35 41 26 0 102

2004 46 62 10 29 147

2005 74 19 17 11 121

2006 67 20 2 9 98

2007 30 15 0 3 48

2008 7 17 0 9 33

2009 78 32 0 0 110

Total 420 252 70 70 812

% 51.7 31.0 8.6 8.6 100.0

Table III. Number of matrices examined tested for Listeria monocytogenes between 2000 and 2009 in Avezzano, Sulmona and Castel di Sangro (province of L'Aquila, Abruzzo, Italy) organised by group and type.

Category Meat products Fish products

Dairy

Other Total

Matrices RTE meat products Non-RTE meat products RTE fish products Non-RTE fish products Cheese Heat-treated milk Bulk milk Other RTE products based on milk Other RTE foods Other non-RTE foods

2000 0 5 5 0 40 0 0

2001 6 16 0 5 33 0 0

2002 8 10 5 0 10 1 0

2003 16 25 21 5 25 5 0

2004 37 25 10 0 36 0 0

2005 5 14 10 7 61 7 0

2006 8 12 2 0 56 1 0

2007 2 13 0 0 30 0 0

2008 4 13 0 0 1 0 5

2009 17 15 0 0 40 22 16

Total 103 148 53 17 332 36 21

% 12.7 18.2 6.5 2.1 40.9 4.4 2.6

0

0

0

5

10

6

10

0

1

0

32

3.9

0 0 50

0 2 62

0 7 41

0 0 102

28 1 147

6 5 121

5 4 98

3 0 48

7 2 33

0 0 110

49 21 812

6.0 2.6 100.0

although, more often, the dairy ones proved to be in greater quantity. The majority of the fish products was collected in the period 2003 - 2005.

The submitted group of meat products included fresh meat from different animal species (pig, bovine, sheep, goat and poultry), cooked pig meat products (porchetta, wurstel, mortadella), fresh sausages and mature sausages (salami) and seasoned salted products (ham, loin and shoulder). The dairy products group included cattle and sheep cheeses, mozzarella cheese, ice cream, ricotta, milk and bulk milk, while the seafood products group included mainly salmon, fresh or smoked, as well as other species such as tuna, swordfish and flounder. The other food matrices consisted of various foods such as vegetables (salads, carrots, spinach and eggplant) and food preparation, including also prepared meals from canteens. Table III shows in detail the number of matrices examined over the period.

The monthly distribution of the samples received during the period under consideration is shown in Table IV. Most of the samples (38.3%) were submitted each year from March to May. Percentages of isolation greater than 10% were observed in the years 2002, 2003, 2007 and 2009 (Figure 2). However, the percentages do not

180

significantly differ from each other. Within the meat products group, the greater number of positive results has been recorded for fresh meat (4.0%) and sausages (salame and sausage) (14.3%); while, within fishery products, salmon (smoked or fresh) was the most contaminated product (40.0%). Only bovine bulk milk (0.5%) tested positive within dairy products. From 2007 to 2008, fish samples were no longer collected and therefore the higher percentage of isolation concerns meat products. For other food matrices, in 2002 a sample of bread skewers was found contaminated with L. monocytogenes.

Discussion Listeriosis, a foodborne illness, is rather rare but serious diseases, whose economic and social impact is considered one of the highest among foodborne illnesses (Farber and Peterkin 1991). For this reason, a proper sampling conducted by the bodies in charge of surveillance [Veterinary Services, Food Hygiene and Nutrition Service (FINS), Carabinieri Health Protection Unit (NAS)] would be extremely valuable as it could help to clarify the prevalence and contamination levels of L. monocytogenes on most at risk food categories.

Veterinaria Italiana 2014, 50 (3), 177-184. doi: 10.12834/VetIt.22.1805.12

Sulli et al.

Listeria moncytogenes in food samples in Abruzzo

Table IV. Monthly distribution of the number of samples tested for Listeria monocytogenes between 2000 and 2009 in Avezzano, Sulmona and Castel di Sangro (province of L'Aquila, Abruzzo, Italy).

Months January February March April May June July August September October November December Total

2000 3 0 0 17 10 0 0 15 0 0 5 0 50

2001 1 1 19 7 2 10 1 3 6 9 1 2 62

2002 0 1 0 5 3 6 8 0 13 0 2 3 41

2003 12 11 12 10 11 13 0 10 1 7 5 10 102

2004 10 16 7 19 29 3 23 1 13 4 10 12 147

2006 2 0 26 4 58 0 3 3 2 0 0 0 98

2007 0 1 0 2 5 0 0 0 36 3 1 0 48

2008 2 4 3 4 0 1 6 0 1 0 5 7 33

2009 1 0 0 0 15 7 0 5 20 20 42 0 110

Total 37 45 85 81 145 68 52 39 98 45 77 40 812

% 4.6 5.5 10.5 10.0 17.9 8.4 6.4 4.8 12.1 5.5 9.5 4.9 100.0

It is also worth noticing that the number of nonRTE samples is rather low (Table III), although a Ministerial Order of 19934 expressly provides the sampling of non-RTE products as well.

35% 30%

% positive samples

2005 6 11 18 13 12 28 11 2 6 2 6 6 121

25%

The applied sampling plan, therefore, shows a lack of planning and goal setting. On the basis of historical and national reference, the food groups at risk of contamination by L. monocytogenes (i.e. those relevant for colleting samples) could be identified on yearly basis.

20% 15% 10% 5% 0% 2000 2001 2002 2003 2004 2005 2006 2007 2008 2009

Year

Figure 2. Percentage of samples which resulted positive for Listeria monocytogenes between 2000 and 2009 in Avezzano, Sulmona and Castel di Sangro (province of L'Aquila, Abruzzo, Italy).

The data presented in this paper suggest the existence of deficiencies in planning preventative controls, especially for what concerns the provision that it should be based on risk analysis as required

by Article 3 of the Reg. (CE) 882/2004 .

In fact, the number of samples collected is variable from year to year (Table I) and also food categories considered are numerically different across the years (Table II). The number of matrices examined (grouped

by RTE and non-RTE products) shows how the category of RTE products - whether they are derived from meat products, fish or dairy products - has not been taken sufficiently into account (Table III), while the most interesting results are those concerning the contamination prevalence of RTE products.

Veterinaria Italiana 2014, 50 (3), 177-184. doi: 10.12834/VetIt.22.1805.12

Referring to the distribution of the various matrices examined within the food categories in the considered period (Table III), we can see that their number changes from year to year and that some of them have been taken into account only for 1 or a few years, but always with a small number of samples. The definition of a sampling plan, instead, could allow the evaluation of the consumer exposure level, by focusing on the most at risk food or most consumed food, in order to define a criterion to identify the food matrices to be included in the plan.

Moreover, by considering the distribution of samples in different months from 2000 to 2009 (Table IV), it could be noted that the number of samples is not constant (sometimes even absent), in the course of the year. As a consequence, the food sampling do not meet the randomness that would be required to obtain usable data in order to highlight the possible presence of seasonality in food contamination by L. monocytogenes.

4

I talian Ministry of Health. 1993. Ordinanza of 7 December 1993. Limiti di Listeria monocytogenes in alcuni prodotti alimentari. Off J, 291, 13.12.1993.

181

Listeria moncytogenes in food samples in Abruzzo

Therefore, it is unlikely that this type of data can provide comprehensive information on the risk factors. However, they could be used in order to assess the level of exposure of the consumer, taking into consideration the most at risk foods (or those most consumed) as a possible criterion for the identification of the matrices to be included in an organized sampling plan.

Regarding the percentage of positive samples for L. monocytogenes during the considered period, it was quite low and has never been linked to foodborne outbreaks. This can be explained by the fact that the disease occurs only as a result of contact with a high bacterial load5. Comparing the data obtained in the various categories with those obtained in the rest of Italy in similar studies, it may be noted that for meat products in the years 2001-2002 in Italy (Hudson et al. 1992) and in 2004 in Emilia Romagna6, the percentage of positive samples ranges from 3.6% to 4.6% for raw meats and processed meats respectively, to 16.0% for fresh red meat and 17.5% for fresh poultry meat, to 33.1% for minced meat and 26.9% in sausages. The matrices most represented are raw and processed meats (sausages like). The percentage of positive samples within fish category is 6.4% for fish and fish derivative products and 13% for prepared or preserved fish. The dairy product category presents low positive rates. The EFSA report on zoonosis of 2006 and 2007 reported positive rates for cattle and sheep cheeses ranging from 0.1% to 7.1% for 2006 and from 0.1% to 4.4% for 2007, while the Istituto Superiore di Sanità recorded a rate of 0.9% (Hudson et al. 1992). Also for other food matrices the percentages of positivity are low.

Moving on to examine some data relating to European countries such as Portugal (Miettinen et al.

2001), Spain7 (Vitas and Garcia-Jalon 2004.), Belgium

Sulli et al.

(Vazquez-Boland et al. 2001), Finland (Miettinen et al. 2001), meat products (especially raw meats and sausages) and fish products (fresh and smoked fish) categories result more positive than the others, with the exception of The Netherlands (Bergey's Manual of Systematic Bacteriology 2009) and Denmark (Notermans et al. 1998). The Netherlands and Denmark have percentages of positivity for L. monocytogenes in cheeses and dairy category of 10.0% and 18.9%, respectively. United Kindom (McGowan et al. 1994), on the contrary, has a low percentage of positives for this food category and a high percentage for meat products. The data presented in studies concerning Chile (Cordano and Rocourt 2001), Japan (Inoue et al. 2000), India (Moharem Ahmed Saif et al. 2007), Ethiopia (Molla et al. 2004), New Zealand (Hudson et al. 1992), Australia (Ibrahim and Macrae 1991), Korea (Baek et al. 2000), tropics (Jeyasekaran et al. 1996 ), and the United States of America (Jinneman et al. 1999) show that the largest number of positivity is found in meat and fish products rather than in dairy products.

Chile (Cordano and Rocourt 2001) and Ethiopia (Molla et al. 2004) recorded a positivity rate of 3.5% and 19.6%, respectively, for the matrix ‘ice cream’, while the positivity observed in Italy was very low (0.3%) (Gattuso et al. 2005). The comparison of the data shown in this work with those from studies conducted in Italy and in other states shows how the categories and matrices with higher percentages of positivity for L. monocytogenes are those that fall within the meat and fish products. In this case, the data collected from this study do not indicate a role of cheese as a vehicle of contamination in the areas sampled, in contrast to what reported in the national and international literature. It would therefore be necessary to promote an ad hoc sampling in the areas covered by this study to verify this aspect in more depth.

E uropean Food Safety Authority (EFSA) 2009. The Community Summary Report on Trends and Sources of Zoonoses and Zoonotic Agents in the European Union in 2007. EFSA Journal, 223, 1-313. www.efsa.europa.eu/de/scdocs/doc/223r.pdf.

6 I stituto Zooprofilattico Sperimentale della Lombardia e dell’Emilia Romagna. 2005. Il controllo microbiologico sugli alimenti di origine animale in Emilia Romagna. Lettera di informazione, 62, settembre 2005. http://www.izsler.it/izs_bs/ftp/doc/controllo%20alimenti/micro04.pdf.

7 E uropean Food Safety Authority (EFSA) 2007. The Community Summary Report on Trends and Sources of Zoonoses, Zoonotic Agents, Antimicrobial Resistance and Foodborne Outbreaks in the European Union in 2006. EFSA Journal, 130, 1-353. www.efsa.europa.eu/en/efsajournal/doc/130r.pdf.

5

182

Veterinaria Italiana 2014, 50 (3), 177-184. doi: 10.12834/VetIt.22.1805.12

Sulli et al.

Listeria moncytogenes in food samples in Abruzzo

References Baek S.K., Lim S.Y., Lee D.H., Min K.H. & Kim C.M. 2000. Incidence and characterization of Listeria monocytogenes from domestic and imported foods in Korea. J Food Protection, 63, 186-189.

Beckers H.J., Soentoro P.S.S. & Delfgou-van Asch E.H.M. 1987. The occurrence of Listeria monocytogenes in soft cheeses and raw milk and its resistance to heat. Int J Food Microbiol, 4, 249-256.

Bergey's Manual of Systematic Bacteriology 2nd ed.

The Firmicutes 2009 (P. De Vos, G. Garrity, D. Jones, N.R. Krieg, W. Ludwig, F. Rainey, K.H Schleifer &. W.B. Whitman, eds). Vol. 3, Springer, New York.

Buchanan R.L., Stahl H.G., Bencivengo M.M., & Del Corral F. 1989. Comparison of lithium chloride-phenylethanolmoxalactam and Modified Vogel Johnson agars for detection of Listeria spp. in retail-level meats, poultry, and seafood. Appl Environ Microbiol, 55, 599-603.

Conter M., Paludi D., D’Orio V., Vergara A. & Ianieri A. 2007.

Antimicrobial susceptibility of Listeria monocytogenes isolated from food and food processing environment.

Annali della Facoltà di Medicina Veterinaria di Parma, 27, 157-164.

Cordano A.M. & Rocourt J. 2001. Occurrence of Listeria monocytogenes in food in Chile. Int J Food Microbiol, 70(1-2), 175-178.

Dominguez M.L., Calero L.G., Martin V.M.J. & Robaina R.L. 2001. A comparative study of sediments under a marine cage farm at a Gran Canaria island (Spain).

Aquaculture, 192, 225-231.

European Food Safety Authority (EFSA) 2007. Scientific Opinion of the Panel on Biological Hazards on a request from the European Commission on Request for updating the former SCVPH opinion on Listeria monocytogenes risk related to ready-to-eat foods and scientific advice on different levels of Listeria monocytogenes in ready-to-eat foods and the related risk for human illness. EFSA Journal, 599, 1-42. www. efsa.europa.eu/en/efsajournal/doc/599.pdf

Ibrahim A. & Macrae I.C. 1991. Incidence of Aeromonas and Listeria spp. in red meat and milk samples in Brisbane, Australia. Int J Food Microbiol, 12, 263-270.

Inoue S., Nakama A., Arai Y., Kokubo Y., Maruyama T., Saito A., Yoshida T., Terao M., Yamamoto S. & Kumagai S. 2000. Prevalence and contamination levels of Listeria monocytogenes in retail foods in Japan. Int J Food Microbiol, 59(1-2), 73-77.

Jeyasekaran G., Karunasagar I. & Karunasagar I. 1996.

Incidence of Listeria spp. in tropical fish. Int J Food Microbiol, 31(1-3), 333-340.

Jinneman K.C., Wekell M.M. & Eklund M.W. 1999. Incidence and behaviour of L. monocytogenes in fish and seafood products. In Listeria, Listeriosis and Food Safety (T. Ryser & E.H. Marth, eds.). Marcel Dekker, New York, 631-655.

McGowan A.P., Bowker K., Mc Lauchlin J., Bennet P.M. & Reeves D.S. 1994. The occurrence and seasonal changes in the isolation off Listeria spp. in shop bought food stuffs, human faeces, sewage and soil from urban sources. Int J Food Microbiol, 21, 325-334.

Mead P.S., Slutsker L., Dietz V., McCaig L.F., Bresee J.S., Shapiro C., Griffin P.M. & Tauxe R.V. 1999 Food-related illness and death in the United States. Emerg Infect Dis, 5, 607-625.

Mena C., Almeida G., Carneiro L., Teixeira P., Hogg T. & Gibbs P.A. 2004. Incidence of Listeria monocytogenes in different food products commercialized in Portugal.

Food Microbiology, 21, 213-216.

Miettinen I.T., Zacheus O., von Bonsdorff C.H. & Vartiainen T. 2001. Waterborne epidemics in Finland in 1998-1999.

Water Science and Technology, 43(12), 67-71.

Moharem A.S., Raj A.P.C. & Janardhana G.R. 2007. Incidence of Listeria species in seafood products of Mysore, India.

J Food Safety, 27(4), 362-372.

Molla B., Yilma R. & Alemayehu D. 2004. Listeria monocytogenes and other Listeria species in retailmeat and milk products in Addis Ababa, Ethiopia. Ethiop J Health Dev, 18, 208-212.

European Food Safety Authority (EFSA) and European Centre for Disease Prevention and Control (ECDC). 2012.

The European Union Summary Report on antimicrobial resistance in zoonotic and indicator bacteria from humans, animals and food in 2010. EFSA Journal,10, 2598.doi:10.2903/j.efsa.2012.2598. http://www.ecdc. europa.eu/en/publications/Publications/1203-SURECDC-EFSA-report-antimicrobial-resistance.pdf.

Murphy M., Corcoran D., Buckley J.F., O’Mahony M., Whyte P. & Fanning S. 2007. Development and application of multiple-locus variable number of tandem repeat analysis (MLVA) to subtype a collection of Listeria monocytogenes. Int J Food Microbiol, 115, 187-194.

Farber J.M. & Peterkin P.I. 1991. Listeria monocytogenes, a foodborne pathogen. Microbiol Rev, 55, 476-511.

Notermans S., Dufrenne J., Teunis P. & Chackraborty T. 1998. Studies on the risk assessment of Listeria monocytogenes. J Food Protect, 61, 244-248.

Gattuso A., Gianfranceschi M. & D’Ottavio M.C. 2005 L. monocytogenes : attività di sorveglianza della listeriosi e monitoraggio di prodotti tipici. In Workshop Focus Sicurezza d’uso e nutrizione degli alimenti, Roma 2122 Novembre 2005. Istituto Superiore di Sanità, Roma.

Hudson J.A., Mott S.J., Delacy K.M. & Edridge A.L. 1992.

Incidence and coincidence of Listeria spp., motile aeromonads and Yersinia enterocolitica on ready-to-eat fleshfoods. Int J Food Microbiol, 16(2), 99-108.

Veterinaria Italiana 2014, 50 (3), 177-184. doi: 10.12834/VetIt.22.1805.12

Norrung B., Anderson J.K. & Schlundt J. 1999. Incidence and control of Listeria monocytogenes in foods in Denmark. Int J Food Microbiol, 53, 195-203.

Nuvoloni R., Pedonese F., D’Ascenzi C. & Rindi S. 2006. La valutazione del rischio da Listeria monocytogenes in alimenti pronti per il consumo. Ann Fac Med Vet Pisa, LIX, 29-45.

Olesen I., Vogensen F.K. & Jespersen L. 2008. Gene transcription and virulence potential of Listeria monocytogenes strains after exposure to acidic and NaCl stress. Foodborne Pathog Dis, 6, 669-680.

183

Listeria moncytogenes in food samples in Abruzzo

Ramaswamy V., Cresence V.M., Rejitha J.S., Lekshmi M.U., Dharsana K.S., Prasad S.P. & Vijila H.M. 2007. Listeria review of epidemiology and pathogenesis. J Microbiol Immunol Infect, 40(1), 4-13.

Uyttendaele M., Troy P.D. & Debevere J. 1999. Incidence of Listeria monocytogenes in different types of meat products on the Belgian retail market. Int J Food Microbiol, 53, 75-80.

Rantsiou K., Mataragas M., Alessandria V. & Cocolin L. 2012.

Expression of virulence genes in Listeria monocytogenes in food. J Food Safety, 32(2), 161-168.

Vazquez-Boland J.A., Kuhn M., Berche P., Chacraborty T., Dominguez-Bernal G., Goebel W., Gonzalez-Zorn B., Wehland J. & Kreft J. 2001. Listeria pathogenesis molecular virulence determinants. Clin Microbiol Rev, 14, 584-640.

Ryser E.T. & Marth E.H. 1999. In Listeria, Listeriosis, and Food Safety. 2 ed. revised and expanded.(E.T. Ryser & E.H. Marth, eds). Marcel Dekker, New York, 738.

Scallan E., Oexkstra R.M., Angulo F.J., Tauxe R.V., Widdowson M.A., Roy S.L., Jones J.L. & Griffin P.M. 2011. Foodborne illness acquired in the United States - major pathogens.

Emerg Infect Dis, 17(1), 7-15.

184

Sulli et al.

Vitas A.I. & Garcia-Jalon V.A. 2004. Occurrence of Listeria monocytogenes in fresh and processed foods in Navarra (Spain). J Food Microbiol, 90(3), 349-356.

Veterinaria Italiana 2014, 50 (3), 177-184. doi: 10.12834/VetIt.22.1805.12

Shiga toxin-producing Escherichia coli O157:H7 in milk and milk products in Ogun State, Nigeria Akhigbe Ivbade1, Olufemi Ernest Ojo2* & Morenike Atinuke Dipeolu1 1

Department of Veterinary Public Health and Reproduction, College of Veterinary Medicine, Federal University of Agriculture Abeokuta, Abeokuta, Nigeria.

2 Department of Veterinary Microbiology and Parasitology, College of Veterinary Medicine, Federal University of Agriculture Abeokuta, Abeokuta, Nigeria.

* Corresponding author at: Department of Veterinary Microbiology and Parasitology, College of Veterinary Medicine, Federal University of Agriculture Abeokuta, Abeokuta, Ogun State, Nigeria.

Tel.: +234 803 5803 716, e-mail: oeoefemi@yahoo.com, ojooe@funaab.edu.ng.

Veterinaria Italiana 2014, 50 (3), 185-191. doi: 10.12834/VetIt.129.2187.1 Accepted: 21.05.2014 | Available on line: 30.09.2014

Keywords Milk, Milk products, Multidrug resistance, Nigeria, STEC O157, Virulence genes.

Summary Shiga toxin producing Escherichia coli (STEC) O157 is a major cause of food-borne illnesses in humans. This study investigated the presence of STEC O157 in milk and milk products in Ogun State, Nigeria. Of a total of 202 samples 10 (5%) were positive for STEC O157 including 1 (2%) of 50 raw milk samples, 3 (6%) of 50 samples of fresh local cheese, 1 (2%) of 50 samples of fried local cheese and 5 (9.6%) of 52 fermented milk samples. There was no significant difference (p>0.05) in the prevalence of STEC O157 among the sample types. Of 10 isolates, shiga toxin 1 gene (stx1) was detected only in 2 samples (20%), shiga toxin 2 (stx2) was extracted only in 6 samples (60%), stx1 /stx2 in 2 samples (20.0%), intimin gene (eaeA) in 5 samples (50%), and enterohaemolysin (E-hlyA) gene was isolated in 7 (70%) samples. Rates of resistance of the STEC O157 isolates were: amoxicillin/clavulanic acid 100%, ampicillin 100%, chloramphenicol 60%, nalidixic acid 20%, norfloxacin 10%, streptomycin 30%, sulphamethoxazole/trimethprim 20%, and tetracycline 90%. The isolates were all susceptible to ciprofloxacin and neomycin.

The presence of virulent multidrug resistant E. coli O157 strains in milk and milk products as revealed by this study unveils a risk of human exposure to these potentially fatal pathogens following consumption of contaminated products.

Escherichia coli O157:H7 e produzione di tossina shiga in latte e derivati nello stato di Ogun, Nigeria Parole chiave Antibiotico resistenza, Derivati del latte, Escherichia coli (STEC) O157, Latte, Nigeria, Tossina shiga, Virulenza.

Riassunto Escherichia coli (STEC) O157 produttore di tossina shiga è una delle maggiori cause di patologie di origine alimentare nell’uomo. Lo studio ha analizzato la presenza di STEC O157 in latte e derivati nello stato di Ogun, Nigeria. Su 202 campioni, 10 (5%) sono risultati positivi per STEC O157, in particolare, 1 (2%) dei 50 campioni di latte crudo, 3 (6%) dei 50 campioni di formaggio fresco locale, 1 (2%) dei 50 campioni di formaggio locale fritto e 4 (9,6%) dei 52 campioni di latte fermentato. Non è stata riscontata una differenza significativa (p>0,05) tra le prevalenze di STEC O157 nei diversi tipi di campione. Nei 10, il gene 1 della tossina shiga (stx1) è stato rinvenuto in 2 campioni (20%), il gene 2 (stx2) in 6 campioni (60%), stx1 / stx2 in 2 campioni (20%), il gene intimin (eaeA) in 5 campioni (50%) e il gene enterohaemolysin (E-hlyA) in 7 campioni (70%). I tassi di antibiotico resistenza di STEC O157 sono stati: 100% per amoxicillina/acido clavulanico, 100% per ampicillina, 60% per cloramfenicolo, 20% per acido nalidixico, 10% per norfloxacina, 30% per streptomicina, 20% per sulfametossazolo/ trimetoprim e 90% per tetraciclina. Gli isolati si sono dimostrati tutti sensibili a ciprofloxacina e neomicina. La presenza nel latte e derivati di ceppi di Escherichia coli O157 virulenti e resistenti a più farmaci, rilevata nello studio, ha evidenziato il rischio per il consumatore di esposizione ad agenti patogeni potenzialmente letali.

185

Shiga toxin-producing Escherichia coli O157:H7 in Nigeria

Introduction Some members of the shiga toxin-producing Escherichia coli (STEC) group have proved to be important food-borne pathogens of significant public health importance. These pathogenic STEC strains are widely associated with both outbreaks and sporadic cases of food-borne disease in humans, ranging from complicated diarrhoea to haemorrhagic colitis (HC) and haemolytic uraemia syndrome (HUS). Shiga toxin-producing E. coli serotype O157:H7 is considered one of the most important of all known food-borne pathogens because of the severity of associated illnesses and the apparent low infective dose of less than 10 cells (Bach et al. 2002, Blanco et al. 2003). At the same time, non-O157 STEC strains belonging to other serogroups including O26, O91, O103, O111, O128 and O145 are also known to cause fatal infections in humans (Johnson et al. 2006).

Shiga toxin producing E. coli O157:H7 primarily colonizes the large intestine. Intimate adhesion to the microvilli of the intestine is made possible by the presence of intimin, a major virulence factor contributing to the pathogenicity of STEC O157:H7 (Osek and Gallien et al. 2002). Intimin production is controlled by the eaeA gene. The growth of STEC O157:H7 in human intestinal tract leads to elaboration of large quantity of toxins, which can cause severe damage to the lining of the intestine and other vital organs of the body (Nataro and Kaper 1998, Osek and Gallien et al. 2002). These toxins are very similar to the toxins produced by Shigella dysenteriae hence the appellation ‘shiga toxins’ (Osek and Gallien et al. 2002). The 2 major shiga toxins recognised are shiga toxin 1 (Stx 1) and shiga toxin 2 (Stx 2) coded for by stx1 and stx2 respectively.

The most virulent STEC O157:H7 also possesses an additional virulence gene, E-hlyA, which is responsible for the production of enterohaemolysin (Osek and Gallien et al. 2002).

The intestinal tract of asymptomatic ruminants is the main reservoir of STEC O157:H7. Zoonotic transmission to humans usually occurs through consumption of undercooked contaminated foods of bovine origin. Faecal contamination of other food products or direct contact with infected animals can also lead to human infection. Milk and milk products are among the most common sources of STEC O157:H7 infection mainly due to faecal contamination (Armstrong et al. 1996). The frequent epidemiological evidence of fresh milk as a source of human O157:H7 infection also suggests the mammary gland as a potential source of infection (Wells et al. 1991).

In Nigeria, there is a dearth of information on the role of milk and milk products as vehicle for the

186

Ivbade et al.

transmission of STEC O157:H7 to humans. Therefore, this study investigated the occurrence, virulence genes and antimicrobial resistance of STEC O157:H7 in raw milk and ready-to-eat milk products in Ogun State, Nigeria, with the goal to assess the possible risk of human exposure to STEC O157:H7 through consumption of milk and milk products. Samples were also screened for the detection and antimicrobial susceptibility of non-O157 E. coli strains.

Materials and methods Samples and sampling procedures Two hundred and two samples were collected and screened for the presence of shiga toxin–producing E. coli O157. Collected samples included raw milk (50), fermented milk called nono in local dialect (52), local fresh cheese called wara (50) and fried wara cheese (50). Sampling was conducted from May to August 2011. In the study area, this period of the year correspond to the peak of rainy season with high availability of pasture resulting in high milk yield and increase in the street hawking of milk products. There is also an increase in the possibility of food contamination from runoff and flood-water.

An inspection of each sampling sites was conducted every week throughout the sampling period. Freshly expressed raw milk samples were collected from apparently healthy lactating cows in 5 cattle herds located in suburban areas of Ogun State, Nigeria. Fifty millilitres of raw milk were collected directly from the lactating cow into sterile universal bottles after cleaning the udder with warm disinfectant solution and ethanol soaked in cotton wool. Ready‑to‑eat milk products (fermented milk/nono, fresh cheese/wara and fried cheese/wara) were collected from vendors hawking these products along streets in 4 major towns in Ogun State, Nigeria. Fifty grammes of fresh wara, fried wara and 50 ml of nono were collected from different street vendors. Samples were collected into sterile containers held opened for the sellers and only 1 sample was obtained from an individual vendor on each visit. Samples were properly labelled and transported in cooler with ice-packs to laboratory for immediate microbiological analysis.

Isolation and identification of E. coli including STEC serogroups One millilitre of each fresh milk and fermented milk samples was inoculated into 9 ml of sterile tryptic soy broth (TSB, Oxoid®, Basingstoke, UK) in a universal bottle for pre-enrichment. The pre-enrichment culture was incubated at 37 °C for 8 hours. Ten grammes of each of the cheese samples were aseptically weighed and thoroughly homogenised

Veterinaria Italiana 2014, 50 (3), 185-191. doi: 10.12834/VetIt.129.2187.1

Ivbade et al.

in 90 ml of sterile distilled water and 1 ml of the homogenate was inoculated into 9 mls of sterile tryptic soy broth for pre-enrichment. Following pre-enrichment, 1 ml of all the TSB culture was inoculated into 9 ml of modified tryptic soy broth (mTSB, Oxoid®, Basingstoke, UK) supplemented with novobiocin (Oxoid®, Basingstoke, UK ) and incubated at 37 °C for 18 - 24 hours for selective enrichment. A loopful of the mTSB culture was streaked onto a plate of Sorbitol MacConkey agar containing 5-bromo-4-chloro-3-indolylβ-D-glucuronide (BCIG) (SMAC-BCIG, Oxoid®, Basingstoke, UK) into which cefixime and tellurite supplement (Oxoid®, Basingstoke, UK) has been incorporated for selective isolation of E. coli O157.

The inoculated plates were incubated at 37 °C for 18 - 24 hours. The plates were subsequently examined for growth. Straw colour or pale yellow colonies representing non-sorbitol fermenter on SMAC-BCIG plates were tentatively identified as suspected E. coli O157:H7 colonies. On each plate, 5 non-sorbitol fermenting and 5 sorbitol fermenting colonies were tested for oxidase and catalase production. When the numbers of available colonies for each category were less than 5, all available colonies were tested.

Oxidase negative, catalase positive colonies were subjected to further identification using a commercially available biochemical test kit for the identification of Gram-negative, oxidase negative bacilli (Microbact GNB 24E, Oxoid®, Basingstoke, UK) and the results interpreted using the accompanying computer software package (Microbact® 2000 version 2.03, Oxoid®, Basingstoke, UK). Isolates with characteristics consistent with those of E. coli irrespective of their sorbitol fermentation reactions were identified serologically using a latex agglutination test kit (E. coli O157 latex test, Oxoid®, Basingstoke, UK) according to manufacturer’s instruction. Isolates producing positive reaction (agglutination) with E. coli O157 latex test were also tested with E. coli H7 antiserum (Difco®, Sparks, Maryland, USA) by a slide agglutination test.

Isolates lacking the E. coli O157 antigen were further screened for group detection of STEC serogroups O26, O91, O103, O111, O128 and O145 using polyvalent latex agglutination test kit (Dryspot Seroscreen DR0300, Oxoid®, Basingstoke, UK ).

Shiga toxin-producing Escherichia coli O157:H7 in Nigeria

Determination of antimicrobial susceptibility of E. coli O157 isolates All identified E. coli O157:H7 isolates and additional 46 non-O157 E. coli isolates (1 isolate from each E. coli-positive sample) were tested for susceptibility to selected antimicrobial agents on Mueller Hinton Agar (Oxoid®, Basingstoke, UK) by the standard Kirby-Bauer disk diffusion method and the results interpreted in accordance with the recommendation of Clinical and Laboratory Standards Institute (CLSI)1.

Selected antimicrobials included amoxycillin/ clavulanic acid (Amc, 30µg), ampicillin (Amp, 10µg), chloramphenicol (Chl, 30µg), ciprofloxacin (Cip, 5µg), nalidixic acid (Nal, 30µg), neomycin (Neo, 30µg), norfloxacin (Nor, 10µg), streptomycin (Str, 10µg), sulphamethoxazole/trimethoprim 19:1 (Sul, 25µg) and tetracycline (Tet, 30µg).

Statistical analysis Data were expressed in absolute values and in percentages and the compared by Chi-square test at p<0.05 probability level using Statistical Software Package for Social Sciences2.

Results Escherichia coli O157:H7 was isolated from 10 (5.0%) of the 202 samples examined. The organism was detected in 1 (2.0%) of the 50 samples of raw milk, 3 (6.0%) of the 50 samples of fresh cheese, 1 (2.0%) of the 50 samples of fried cheese, and 5 (9.6%) of the 52 samples of fermented milk (Table I).

The differences in prevalence of E. coli O157:H7 Table I. Prevalence of Escherichia coli in milk and milk products in Ogun State, Nigeria.

Sample types Fresh raw milk Fresh cheese (wara) Fried cheese Fermented milk (nono) Total

Detection of virulence genes in E. coli O157:H7 Virulence genes, including shiga toxin 1 (stx1), shiga toxin 2 (stx2), intimin (eaeA) and enterohaemlysin (E-hlyA) as well as the E. coli O157 somatic antigen encoding gene (rfbEO157), were detected in serologically identified isolates by polymerase chain reaction (PCR) using specific primers as previously described (Osek and Gallien 2002, Ojo et al. 2008).

Veterinaria Italiana 2014, 50 (3), 185-191. doi: 10.12834/VetIt.129.2187.1

Number (%) Number positive for STEC sampled O157:H7 50 1 (2.0)

Number (%) positive for non-O157 E. coli 15 (30)

50

3 (6.0)

12 (24)

50

1 (2.0)

2 (4)

52

5 (9.6)

17 (32.7)

202

10 (4.9)

46 (22.8)

C linical and Laboratory Standards Institute (CLSI). 2008. Performance standards for antimicrobial disk and dilution susceptibility tests for bacteria isolated from animals. Approved standard. 3th ed, CLSI document M31-A3. Clinical and Laboratory Standards Institute, 940 West Valley Road, Wayne Pennsylvania, USA, 28(8), 1-99.

2 S tatistical Package for Social Sciences version 16 (SPSS). 2007. SPSS Inc. 233 South Wacker Drive, 11th floor Chicago, Illinois 60606. http://www. spss.com.

1

187

Shiga toxin-producing Escherichia coli O157:H7 in Nigeria

Ivbade et al.

Table II. Rates of antimicrobial resistance of Escherichia coli isolates from milk and milk products in Ogun State, Nigeria.

Antimicrobial agents Amoxycillin/clavulanic acid Ampicillin Ciprofloxacin Chloramphenicol Nalidixic acid Neomycin Norfloxacin Streptomycin Sulphamethoxazole/trimethoprim Tetracycline

STEC O157:H7 (n=10) Number (%) sensitive Number (%) resistant 5 (50.0) 5 (50.0) 0 (0.0) 10(100.0 10 (100.0) 0(0.0) 4 (40.0) 6 (60.0) 8 (80.0) 2 (20.0) 10(100.0) 0(0.0) 9 (90.0) 1(10.0) 7 (70.0) 3 (30.0) 8 (80.0) 2(20.0) 1 (10.0) 9 (90.0)

non-O157 E. coli (n=46) Number (%) sensitive Number (%) resistant 27 (58.7) 19 (41.3) 3 (6.5) 43 (93.5) 40 (87.0) 6 (13.0) 35 (76.1) 11 (23.9) 37 (80.4) 9 (19.6) 42 (91.4) 4 (8.7) 40 (87.0) 6 (13.0) 15 (32.6) 31 (67.4) 37 (80.4) 9 (19.6) 7 (15.2) 39 (84.8)

Table III. Antimicrobial resistance patterns and virulence gene profiles of STEC O157:H7 isolates from milk and milk products in Ogun State, Nigeria.

S/NO 1 2 3 4 5 6 7 8 9 10

Source of isolate

Antimicrobial resistance patterns

Raw Milk AmpTet Wara AmcAmpChlStrSulTet Wara AmpChlTet Wara AmcAmpChlNalNorSulTet Fried Wara AmpChlTet Nono AmpStrTet Nono AmcAmpTet Nono AmcAmpChlNalTet Nono AmpAmpChlStrTet Nono Amp Total number (%) positive for virulence genes

stx1 only + + 2 (20)

Virulence genes stx2 only stx1 /stx2 + + + + + + + + 6 (60) 2 (20)

eaeA + + + + + 5 (50)

E-hlyA + + + + + + + 7 (70)

+ = positive reaction; - = negative reaction.

among the sample types were not statistically significant (p>0.05). Furthermore, non-O157 E. coli was detected in 46 (22.8%) of the 202 samples. The prevalence of non-O157 E. coli was 30% in fresh raw milk, 24% in fresh cheese, 4% in fried cheese and 32.7% in fermented milk (Table I). The prevalence was significantly lower (p<0.05) in fried cheese than in other sample types. None of the tested sorbitolfermenting E. coli isolates was positive for E. coli O157 antigen. Moreover, all the samples were negative for non-O157 STEC serogroups O26, O91, O103, O111, O128 and O145.

All E. coli O157:H7 isolates detected in this study were resistant to ampicillin but susceptible to ciprofloxacin and neomycin. Some isolates also showed resistance to amoxicillin/clavulanic acid (50.0%), chloramphenicol (60.0%), nalidixic acid (20.0%), norfloxacin (10.0%), streptomycin (30.0%), sulphamethoxazole/trimethoprim (20.0%) and tetracycline (90.0%) (Table II). Resistance to

188

chloramphenicol was higher among STEC O157 than non-O157 E. coli isolates, while resistance to streptomycin was higher among non-O157 E. coli than STEC O157 isolates. Nevertheless, resistance to other tested antimicrobials was comparable between the 2 groups of E. coli strains (Table II).

Eight of 10 STEC O157:H7 isolates showed resistance to more than 3 antimicrobial agents from different classes (multidrug resistance). Two of the isolates had similar resistance pattern (AmpChlTet), but all other isolates had diverse resistance patterns (Table III). Among the 46 non-O157 E. coli isolates, 3 were susceptible to all tested antimicrobials, while 31 demonstrated multidrug resistance (Table IV).

Virulence genes were detected in all the E. coli O157:H7 isolates. In more details, stx1 was detected in 2, stx2 in 6, stx1/stx2 in 2, eaeA in 5 and E-hlyA in 7 of 10 E. coli O157:H7 isolates. The virulence gene profile of each of the isolates is presented in Table III.

Veterinaria Italiana 2014, 50 (3), 185-191. doi: 10.12834/VetIt.129.2187.1

Ivbade et al.

Shiga toxin-producing Escherichia coli O157:H7 in Nigeria

Table IV. Resistance patterns of non-O157 Escherichia coli isolates from milk and milk products in Ogun State, Nigeria.

Resistance patterns AmcAmpCipChlNalNeoNorStrSulTet AmcAmpCipChlNalNorStrSulTet AmcAmpChlNalStrSulTet AmcAmpChlStrTet AmcAmpStrTet AmpStrTet AmpTet Amp Susceptible to all Total

Raw milk 2 1 1 4 3 2 1 1 15

Number of isolates by sample types Wara Fried Wara 1 2 1 1 3 1 1 1 2 1 12 2

Discussion The present study confirmed the presence of STEC O157 in milk and milk products in Ogun State, Nigeria.

Among the 4 milk products examined, the prevalence of E. coli O157 was higher in nono (9.6%), followed by fresh wara (6.0%), raw milk (2.0%) and fried wara (2.0%). However, the observed differences in prevalence were not statistically significant (p>0.05).

The prevalence of STEC O157 in raw milk is lower than the 30.9% reported in raw unpasteurized milk in Syria (Nazih 2007). In the Syrian study (Nazih 2007), raw milk samples were bought at the local market, which could introduce contamination by handling along the food chain; while for our study, fresh milk samples were collected directly from lactating cows after disinfection of the udder so as to prevent extraneous contamination of the samples and ensure that bacteria present in the raw milk came directly from the mammary gland.

This facilitated identification of the likely sources of bacterial contaminants in milk products along the processing and marketing chains. Furthermore, in the Syrian study 10 colonies were tested, against the 5 considered in the present study, which could possibly lead to higher prevalence. Besides, differences in farming practices between Syria and Nigeria could also account for the differences in the prevalence of STEC O157 in their cattle populations.

A 3.0% prevalence of STEC O157 in raw milk, similar to the finding reported in this article, has been detected in Plateau State, Nigeria (Itelima and Agina 2010). However, it is noteworthy that STEC O157 was not found in raw milk in Egypt (Abd El-Atty and Meshref 2007). The detection of STEC O157:H7 in raw milk could be due to secretion of the pathogen in infected udder. Raw milk obtained from a healthy udder is usually sterile; however, coliform mastitis caused by E. coli can lead to the presence of E. coli in milk expressed from mastitic udder. Shiga toxin

Veterinaria Italiana 2014, 50 (3), 185-191. doi: 10.12834/VetIt.129.2187.1

Nono 1 1 1 3 5 4 1 1 17

Total 4 2 4 1 8 12 8 4 3 46

producing E. coli has been associated with coliform mastitis in cow (Kobori et al. 2004). Although the examined cows were apparently healthy, the only positive cow could be suffering subclinical mastitis.

Bacterial contaminants from the skin and faeces of cow can also lead to the presence of E. coli O157 in raw milk. Escherichia coli O157 has been detected in the faeces and hide of ruminants especially cattle (Elder wt al. 2000, Ojo et al. 2010).

Itelima and Agina reported 2.9% prevalence of STEC O157 in fermented milk/nono samples in Plateau State Nigeria (Itelima and Agina 2010), this is a lower value than the 9.6% prevalence observed in the present study. This could be due to difference in the levels of hygiene along nono processing and marketing chain between the 2 locations. The 2.0% prevalence of STEC O157 in fresh and fried wara observed is similar to the 2.0% prevalence reported in Kareish cheese in Egypt (Abd El-Atty and Meshref 2007).

The presence of E. coli O157 in milk products especially fermented cheese/nono, fresh cheese/ wara, and fried cheese/wara observed, could be the result of faecal contamination from cattle, the environment, or water used for processing the milk. Unhygienic handling during processing and marketing can lead to contamination. To avoid the risk of such a contamination, the samples were collected from vendors hawking these products along the streets with little regards to sanitary measures.

Apart from STEC O157, other E. coli strains were found. The overall detection of E. coli in the samples could have been higher but for the selective agents (novobiocin and cefixime-tellurite) incorporated into culture media to promote the recovery of STEC at the expense of other bacteria which are inhibited by the selective agents. Therefore, the detected E. coli strains were only those resistant to the selective agents. The presence of E. coli in samples is generally used as an indication of faecal contamination.

189

Shiga toxin-producing Escherichia coli O157:H7 in Nigeria

The reported rate of detection of STEC O157 of both stx1/stx2 genes in association is lower than reported in a previous study (Ojo et al. 2010), but the rate of detection of either stx1 or stx2 alone is higher. The higher detection of stx2 than stx1 in STEC O157, as observed, is similar to the one reported of other studies (Paton and Paton 1998a, Sasaki et al. 2012, Wagneret al. 2004). Although the mechanism of action of stx1 and stx2 are the same, they produce different degrees and types of tissue damage (Lee et al. 2007). Strains of E. coli O157 positive for stx2 are more frequently encountered in STEC-associated diseases in humans than stx1-positive strains (Wagner et al. 2004). Moreover, E. coli O157 strains that possessed stx2 are generally more implicated in severe infections and are more likely to cause HUS that those possessing stx1 (Lee et al. 2007). Similar to the findings presented in this article, Ojo et al. (2010) also reported 54.7% and 70.8% detection rates for eaeA and hlyA respectively in E. coli O157. The detection of virulence genes in STEC O157 isolates from milk and milk products suggests that these isolates are potentially pathogenic and may induce illness when transmitted to humans.

The emergence and dissemination of antimicrobial resistance in bacteria is becoming worrisome, E. coli O157 isolates from milk and milk products showed very high (90% and above) rates of resistance to ampicillin and tetracycline, moderate (50-60%) resistance rates to chloramphenicol and amoxicillin/ clavulanic acid, low (10%-30%) resistance rates to streptomycin, nalidixic acid, sulphamethoxazole/ trimethoprim and norfloxacin but no resistance to ciprofloxacin and neomycin. High resistance rates to ampicillin (82.5%) were previously reported in Nigerian E. coli O157 isolates (Ojo et al. 2008, Ojo et al. 2010), it is noteworthy that the observed 90% resistance of STEC O157 to tetracycline is much higher than 16.4% resistance reported in Syria (Nazih 2007). The rate of STEC O157 resistance to quinolones is lower than those reported by other authors (Orden et al. 2001). Furthermore non-O157 E. coli isolates showed antimicrobial resistance rates comparable with those observed in STEC O157 except for the higher chloramphenicol and lower streptomycin resistance rates observed in STEC O157 than in the non-O157 E. coli isolates. The isolates displayed multidrug resistance to 3 or more classes of antimicrobials. This may be a consequence of the use of these antimicrobials in the prevention and

3

190

Ivbade et al.

treatment of diseases in animals. The development of antimicrobial resistance in bacteria has been attributed to the use of these agents in animals3.

Herdsmen involved in our research had unrestricted access to antimicrobial agents and used these drugs indiscriminately in livestock production.

Antimicrobial resistance in pathogenic bacteria implies non-effectiveness of antimicrobial therapy in cases of infection with these organisms leading to protracted morbidity, increased mortality and economic loss. Antimicrobial resistant bacteria resident in the gut of carrier animals contribute significantly to environmental contamination and spread of antimicrobial resistant bacterial strains in the environment and in edible animal products.

Although STEC O157:H7 infections are generally not treated with antibiotics, resistant strains identified may play important roles in the maintenance and dissemination of resistant traits in the community.

Escherichia coli strains can share resistance-encoding genetic materials among themselves and with other pathogenic and non-pathogenic members of the family Enterobacteriaceae thereby widening the antimicrobial resistance niche. The transmission of multidrug resistance STEC O157 from animals to humans through food especially milk products can cause food-borne infection refractory to antimicrobial therapy leading to protracted illness and possibly death.

This study revealed that milk and milk products in Ogun State are contaminated with potentially virulent, multidrug resistant STEC O157. Thus, milk and milk products are potential vectors for zoonotic STEC O157 transmission from cattle to humans in the study area. Subclinical mastitis, unhygienic handling during processing and marketing may contribute to the presence of STEC O157 in milk and milk products.

There is a need for stricter regulatory measure to prevent STEC contamination in animal-source foods including milk and milk products. Routine tests should be conducted on dairy cows to detect subclinical mastitis before milking. Regular public enlightenment and education programmes on food safety for food vendors will help in minimising food contamination and thus reduce the risk of human infection with STEC O157:H7. Overdependence on antimicrobial and misuse of antimicrobial agents in animals can be prevented by policy formulation and enforcement to curb the continuous emergence of antimicrobial resistance in bacteria.

W orld Health Organization (WHO). 1998. Use of quinolones in food animals and potential impact on human health. Report of a WHO meeting Geneva, Switzerland. WHO/EMC/ZDI/98.10.http://whqlibdoc.who.int/HQ/1998/WHO_EMC_ZDI_98.10.pdf.

Veterinaria Italiana 2014, 50 (3), 185-191. doi: 10.12834/VetIt.129.2187.1

Ivbade et al.

Shiga toxin-producing Escherichia coli O157:H7 in Nigeria

References Abd El-Atty N.S. & Meshref A.M.S. 2007. Prevalence of Salmonella and Escherichia coli O157 in some foods. BS Vet Med J, 5th Scientific Conference, 73-78.

Armstrong G.L., Hollingswort. J. & Morris J.G. 1996. Emerging foodborne pathogens: Escherichia coli O157:H7 as a model of Entry of a new pathogen into the food supply of the developed world. Epidemiol Rev, 18(1), 414-419.

Bach S.J., McAllister T.A., Veira D.M., Gannon V.P.J. & Holley R.A. 2002. Transmission control of Escherichia coli O157:H7: A review. Can J Anim Sci, 2, 475-490.

Blanco M., Blanco J.E., Mora A., Rey J., Alonso J.M., Hermoso M., Hermoso J., Alonso M.P., Dhabi G., Gonzalez E.A., Bernardez M.I. & Blanco J. 2003. Serotypes, virulence genes and intimin types of shiga toxin (verotoxin)producing E. coli isolates from healthy sheep in Spain. J Clin Microbiol, 41, 1351-1356.

Elder R.O., Keen J.E., Siragusa G.R., Barkocy-Gallagher G.A., Koohmaraie M. & Laegreid W.W. 2000. Correlation of enterohemorrhagic Escherichia coli O157 prevalence in faeces, hides, and carcasses of beef cattle during processing. Proc Natl Acad Sci U S A, 97, 2999-3003.

ItelimaU.J. & Agina S.E. 2010. Occurrence of Escherichia coli O157:H7 in raw and locally fermented milk (‘Nono’) in Plateau state Nigeria. Glob J Agric Sci, 2, 31-36.

Johnson K.E., Thorpe C.M. & Sears C.L. 2006. The emerging clinical importance of non-O157 shiga toxin-producing Escherichia coli. Clin Infect Dis, 43, 1587-1595.

Kobori D., Rigobelo E.C., Macedo C., Marin J.M. & Avila F.A. 2004. Virulence properties of shiga toxin-producing Escherichia coli isolated from cases of bovine mastitis in Brazil. Rev Elev Med Vet des Pays Trop, 57(1-2), 15-20.

Lee J.E., Reed J., Shields M.S., Spiegel K.M., Farrell L.D. & Sheridan P.P. 2007. Phylogenetic analysis of shiga toxin 1 and shiga toxin 2 genes associated with disease outbreaks. BMC Microbiology, 7, 109.

Nataro J.P. & Kaper J.B. 1998. Diarrheagenic Escherichia coli.

Clin Microbiol Rev, 11, 142-201.

Nazih D. 2007. Detection and antimicrobial susceptibility of Escherichia coli O157:H7 in raw bovine milk, some of dairy products and water samples. Damascus University Journal for Basic sciences, 23, (1)m, 217-219.

Veterinaria Italiana 2014, 50 (3), 185-191. doi: 10.12834/VetIt.129.2187.1

Ojo O.E., Ajuwape A.T.P., Otesile E.B., Owoade A.A., Oyekunle M.A. & Adetosoye A.I. 2010. Potentially zoonotic shiga toxin-producing Escherichia coli serogroups in the faeces and meat of food-producing animals in Ibadan, Nigeria. Intl J Food Microbiol, 142, 214-221.

Ojo O.E., Oyekunle M.A., Ogunleye A.O. & Otesile E.B. 2008. Escherichia coli O157:H7 in food animals in parts of South Western Nigeria: Prevalence and in vitro antimicrobial susceptibility. Trop Vet, 26, 23-30.

Orden J.A., Ruiz-Santa-Quiteria J.A., Cid D., Díez R., Martínez S. & de la Fuente R. 2001. Quinolone resistance in potentially pathogenic and non-pathogenic Escherichia coli strains isolated from healthy ruminants.

J Antimicrob Chemother, 48, 421-424.

Paton J.C. & Paton A.W. 1998a. Pathogenesis and diagnosis of shiga toxin-producing Escherichia coli infections. Clin Microbiol Rev, 11, 450-479.

Paton A.W. & Paton J.C. 1998b. Detection and characterisation of shiga toxigenic Escherichia coli by using multiplex PCR assays for stx1, stx2, eaeA, enterohemorrhagic Escherichia coli hlyA, rfbO111, and rfbO157. J Clin Microbiol, 36, 598-602.

Osek J. & Gallien P. 2002. Molecular analysis of Escherichia coli O157 strains isolated from cattle and pigs by the use of PCR and pulsed-field gel electrophoresis methods.

Vet Med Czech, 47(6), 149-158.

Sasaki Y., Usui M., Murakami M., Haruna M. Kojima A., Asai T. & Yamada Y. 2012. Antimicrobial resistance in shiga toxin-producing Escherichia coli O157 and O26 isolates from beef cattle. Jpn J Infect Dis, 65, 117-121.

Wagner M., Allerberger F., Manafi M., Lindner G., Friedrich A.W., Sonntag A.-K. & Foissy H. 2004. Characterization of pathogenic Escherichia coli isolated from humans in Austria: phenotypes, toxin gene types and epidemiology. J Vet Med B, 51, 288-292.

Wells J.G., Shipman L.D., Greene K.D., Sower E.G., Green J.H., Cameron D.N., Downes F.P., Martin M.L., Griffin P.M., Ostroff S.M., Potter M.E., Tauxe R.V. & Wacchsmuth I.K. 1991. Isolation of Escherichia coli serotype O157:H7 and other shiga-toxin-producing Escherichia coli from dairy cattle. J Clin Microbiol, 29, 985-89.

191

Analysis of the 227 bp short interspersed nuclear element (SINE) insertion of the promoter of the myostatin (MSTN) gene in different horse breeds Stefania Dall’Olio1*, Emilio Scotti1, Luca Fontanesi1 & Marco Tassinari2 Dipartimento di Scienze e Tecnologie Agro-Alimentari, Università di Bologna, Viale Fanin 48, 40127 Bologna, Italy.

2 Dipartimento di Scienze Mediche Veterinarie, Università di Bologna, Via Tolara di Sopra 50, 40064 Ozzano dell’Emilia(BO) Italy.

1

* Corresponding author at: Dipartimento di Scienze e Tecnologie Agro-Alimentari, Università di Bologna, Viale Fanin 48, 40127 Bologna, Italy.

Tel.: +39 051 20 9 6531, Fax: +39 051 20 9 6596, e-mail: stefania.dallolio@unibo.it.

Veterinaria Italiana 2014, 50 (3), 193-197. doi: 10.12834/VetIt.61.178.3 Accepted: 01.08.2014 | Available on line: 30.06.2014

LXVII Meeting of the Italian Society for Veterinary Sciences (SISVet). 17-19 September 2013, Brescia, Italy - Selected papers Keywords Allele frequencies, Breeds, Gene, Horse, Myostatin MSTN, Short interspersed repetitive elements (SINE).

Summary The myostatin (MSTN) gene encodes a protein known to be a negative regulator of muscle mass in mammalian species. Different polymorphisms of the horse (Equus caballus) MSTN gene have been identified, including single nucleotide polymorphisms and a short interspersed nuclear element (SINE) insertion of 227 bp within the promoter of the gene. The SINE insertion has been associated with performance traits in Thoroughbred racehorses and it was proposed as a predictor of optimum racing distance. The aims of this study were to perform in silico analysis to identify putative gains or abrogation of transcription-factor binding sites (TFBSs) generated by the SINE allele of the promoter and to analyse the frequency of the SINE insertion in horses used for racing (gallop and trot) and other purposes. The SINE insertion was genotyped in 227 horses from 10 breeds belonging to different morphological types (brachimorphic, mesomorphic, meso-dolichomorphic and dolichomorphic). The presence of the insertion was confirmed in the Quarter Horse (SINE allele frequency of 0.81) and in the Thoroughbred (0.51), whereas the SINE allele did not segregate in any of the other analysed breeds. As the SINE MSTN gene polymorphism may be population or breed specific, it is not a useful marker for association studies in all breeds.

Analisi dell'inserzione della breve sequenza interspersa (SINE) di 227 bp nel promotore del gene miostatina in diverse razze di cavalli Parole chiave Cavallo, Gene, Frequenze alleliche, MSTN, Razza, SINE.

Riassunto Il gene miostatina (MSTN) codifica una proteina che svolge una funzione regolativa negativa dello sviluppo muscolare nelle diverse specie di mammiferi. Nel cavallo (Equus caballus) sono stati individuati diversi polimorfismi del gene MSTN, fra cui alcuni a singolo nucleotide e un’inserzione SINE (short interspersed nuclear element) di 227 bp nel promotore del gene. Tale inserzione è risultata associata alle prestazioni sportive del cavallo purosangue inglese ed è stata proposta come condizione predittiva per risultati ottimali nelle corse in funzione della distanza. La presente ricerca ha avuto come obiettivi l’analisi in silico dell’inserzione SINE per identificare potenziali creazioni o abrogazioni di siti di legame per fattori di trascrizione e per verificare la frequenza allelica in cavalli utilizzati nelle corse (galloppo e trotto) e altri scopi.

L’inserzione è stata analizzata in 227 cavalli di 10 razze appartenenti a diversi tipi morfologici (brachimorfo, mesomorfo, meso-dolicomorfo e dolicomorfo). La presenza dell’inserzione è stata confermata in quarter horse (0,81) e purosangue inglese (0,51), l’allele SINE non è risultato segregare nelle altre razze analizzate. Poiché il polimorfismo dovuto alla presenza dell’inserzione SINE è popolazione o razza specifico, non è da considerare un utile marcatore per effettuare studi di associazione in tutte le razze di cavalli.

193

227 bp SINE insertion of the MSTN promoter in horses

Introduction The myostatin gene (MSTN; ECA18: 66,490,208– 66,495,180) encodes a protein, named growth differentiation factor (GDF8), which is well known to be a negative regulator of muscle growth and development in mammalian species (Joulia-Ekaza and Cabello 2002, Joulia-Ekaza and Cabello 2006). At the same time, studies on humans and animal models suggested that MSTN has pleiotropic effects such as an involvement in regeneration of skeletal muscle, bone formation, cardiomyocyte homeostasis, glucose metabolisms and adipocyte proliferation (Elliott et al. 2012, Elkasrawy and Hamrick 2010). Natural mutations of the MSTN gene have been identified in different mammalian species (Stinckens et al. 2011), including horses (Equus caballus) for which mutations have been identified in exonic, intronic and regulative regions (Dall'Olio et al. 2010, Hill et al. 2010a, Baron et al. 2012, Petersen et al. 2013). Two single nucleotide polymorphisms (SNPs) in the promoter of the MSTN gene have been shown to be associated with variability of morphological traits in horse breeds (Dall'Olio et al. 2010, Dall'Olio et al. 2012, Dall'Olio et al. 2014). A SNP located in intron 1 (g.66493737C>T based on EquCab 2.0 or GQ183900:g.2115A>G) has been associated with racing performance (sprinting ability, racing stamina, optimum racing distance) in Thoroughbred horses (Hill et al. 2010a, Hill et al.

2010b, Binns et al. 2010, Tozaki et al. 2012, McGivney et al. 2012, Hill et al. 2012a). This intronic SNP showed high linkage disequilibrium with a short interspersed nuclear element (SINE) insertion (227 bp) within the promoter (phase: presence of SINE insertion and g.66493737C allele) and these polymorphisms were proposed as good predictors of optimum racing distance performances (Hill et al. 2010b, Hill et al. 2012b). In the Quarter Horse breed the MSTN SINE insertion and intron 1 SNP showed significant association with muscle type 2B and type 1 fiber proportions (Petersen et al. 2010).

The aims of this study were (i) to perform in silico analysis of the MSTN gene to identify putative gains or abrogation of transcription-factor binding sites (TFBSs) generated by the SINE insertion, and (ii) to investigate the segregation of the SINE insertion in different horse breeds used for racing and other purposes with the objective to eventually propose this marker for association studies with specific distinguishing phenotypes of different horse breeds.

Materials and methods In silico analysis To search for putative gains or abrogation of transcription-factor binding sites (TFBSs) generated by the INS allele, sequences surrounding the WT

194

Dall’Olio et al.

(GenBank accession number GQ183900) and INS alleles were subjected to in silico analysis using the TFSEARCH tool1. The vertebrate transcription factor matrices and threshold of 90.0 point were used to reduce the incidence of false positives.

The TFSEARCH outputs originated by alternative alleles were visually compared to identify putative gains or losses of TFBSs. Enhancer box motif (E-box, consensus sequence CANNTG) were visually identified.

Sampling We analysed 227 horses from 10 breeds: Haflinger (n = 18), Italian Heavy Draught Horse (n = 26), Italian Saddle (n = 23), Italian Trotter (n = 37), Lipizzan (n = 11), Pinzgauer (n = 13), Quarter Horse (n = 18), Thoroughbred (n = 47), Spanish Purebred (n = 7) and Uruguayan Creole (n = 27). Horses were officially registered to the corresponding National Breeder Association’s studbook and pedigree information was also available. Specimens were selected to represent a random sample of unrelated animals within each breed.

Genotyping Genomic DNA was extracted from hair roots.

PCR reactions were carried out in a 20 µl reaction volume, that included 2-4 µl of DNA template (10-80 ng), 10 pmol of each primer (Forward: ATCAGCTCACCCTTGACTGTAAC; Reverse: TCATCTCTCTGGACATCGTACTG) (Hill et al. 2010b), 250 mM of each dNTP, 1.6 mM MgCl2 and 1 U of EuroTaq DNA polymerase (EuroClone, Milan, Italy).

The PCR cycles included a first denaturation step at 95 °C for 5 minutes, 35 cycles (30 sec at 95 °C, 30 seconds at 58 °C, 60 seconds at 72 °C) and a final step at 72 °C for 9 minutes. Amplicons were checked for amplification on 2.0% agarose gels stained with 1×GelRed Nucleid Acid Gel Stain (Biotium Inc., Hayward, CA, USA). Genotyping was performed based on size determination of amplicons: the wild type (WT) allele, without the insertion, produces a fragment 600 bp long, and the SINE insertion (INS) allele a product of 827 bp (Hill et al. 2010b).

Statistical analysis Hardy-Weinberg equilibrium of the genotyped polymorphism was evaluated in breeds where sample size was at least 20 individuals using the HWE software program (Linkage Utility Programs, Rockefeller University, New York, NY, USA).

1

http://www.cbrc.jp/research/db/TFSEARCH.html.

Veterinaria Italiana 2014, 50 (3), 193-197. doi: 10.12834/VetIt.61.178.3

Dall’Olio et al.

227 bp SINE insertion of the MSTN promoter in horses

Results Figure 1 shows the sequence of the proximal promoter of the horse MSTN gene with the SINE insertion of 227 bp (in bracket), the putative 5’-untranslated region (Dall'Olio et al. 2010) and the ATG start codon. The SINE allele, located at -373/-147 bp from the ATG, based on BLAST search, was identified as an equine-specific SINE known as ERE-1 (Hill et al. 2010b, Sakagami et al. 1994).

Putative consensus for DNA sequences known as TFBS or cis-regulatory elements are shown in bold text and are underlined (Figure 1). In particular, the SINE insertion produced putative gains of the following motives: upstream stimulator factor (referred as USF; TFSEARCH score of 90.8) and RAS‑responsive element binding protein 1 (referred as RREB-1; TFSEARCH score of 90.9). In addition, a putative additional enhancer box (E-box, consensus sequence CANNTG) and a TATA-box like motif were identified.

Allele and genotype frequencies of the MSTN SINE polymorphism of 10 horse breeds are shown in Table I. The breeds are classified based on their morphological types (Dall’Olio et al. 2010) as

brachimorphic or heavy (Noric and Rapid Heavy breeds), mesomorphic (Haflinger, Lipizzan and Uruguayan Creole), meso-dolichomorphic (Italian Saddle, Quarter Horse and Spanish Purebreed) and dolichomorphic or light (Italian Trotter and Thoroughbred). Except for Quarter Horse and Thoroughbred breeds, and just 1 horse of the Uruguayan Creole breed, all horses were homozygous for the WT allele. The SINE allele was found at frequency of 0.81 in the Quarter Horse, 0.51 in the Thoroughbred and 0.02 in the Uruguayan Creole breed. The polymorphism does not deviate from Hardy-Weinberg equilibrium in the genotyped Thoroughbred horses (P>0.05).

Discussion In silico analysis indicated that the SINE insertion may generate gains of putative TFBS such as USF and RREB‑1. The USF transcription factors (USF1 and USF2), that recognize the CACGTG DNA motif, are key regulators of a wide number of genes involved in cell cycle and proliferation, stress and immune responses, lipid and glucid metabolism

Table I. Allele and genotype frequencies of the SINE insertion in the promoter region of the MSTN gene in different horse breeds.

Morphologycal types Brachimorphic or heavy

Mesomorphic

Meso-dolichomorfic

Dolichomorphic or light

Horse breeds (N°) Noric (13) Rapid Heavy breed (26) Haflinger (18) Lipizzan (11) Uruguayan Creole (27) Italian Saddle (23) Quarter Horse (18) Spanish Purebreed (7) Italian Trotter (37) Thoroughbred (47)

Allele frequency allele WT allele INS 1.00 1.00 1.00 1.00 0.98 0.02 1.00 0.19 0.81 1.00 1.00 0.49 0.51

WT/WT 1.00 1.00 1.00 1.00 0.96 1.00 0.78 1.00 1.00 0.30

Genotype frequency WT/INS INS/INS 0.04 0.06 0.16 0.38 0.32

TTGTGACAGACAGGGTTTTAACCTCTGACAGCGAGATTCATTGTGGAGCAGGAGCCAATCATAGATCCTGACGAC ACTTGTCTCATCAAAGTTGGAATATAAAAAGCCACTTGG[GGGGCTGGCCCCGTGGCCGAGTGGTTAAGTTCGTG TATA CGCTCCGCTGCAGGCGGCCCAGTGTTTCGTCGGTTCGAGTCCTGGGCGCGGACATGGCACTGCTCGTCGGACCAC GCTGAGGCAGCGTCCCACATGCCACAACTAGAGGAACCCACAACGAAGAATACACAACTATGTACCGGGGGGCTT USF RREB-1 TGGGGAGAAAAAGGAAAATAAAATCTTTAAAAAGCCACTTGG]AATACAGTATAAAAGATTCACTGGTGTGGCAA TATA TATA GTTGTCTCTCAGACTGTACAGGCATTAAAATTTTGCTTGGCATTGCTCAAAAGCAAAAGAAAAGTAAAAGGAAGA AATAAGAGCAAGGAAAAAGATTGAACTGATTTTAAAATCATG

Figure 1. Results of in silico analysis of the proximal promoter (SINE insertion of 227 bp is in bracket) and putative 5’-untranslated region of the horse MSTN gene. ATG start codon is in italic bold text. The consensus for putative transcription-factor binding sites (TFBSs) is in bold text and underlined, the E-box motives are within box.

Veterinaria Italiana 2014, 50 (3), 193-197. doi: 10.12834/VetIt.61.178.3

195

227 bp SINE insertion of the MSTN promoter in horses

(Luo and Sawadogo 1996, Corre and Galibert 2005). In particular, members of the USF family may serve as negative regulators of cell proliferation (Luo and Sawadogo 1996). RREB-1 is implicated in RAS signalling involved in cell proliferation and differentiation. The insertion creates an additional E-box motif. The E-box can be activated by the myogenic regulatory factors (MRFs) such as myoblast determining factor (MyoD), Myf5, myogenin and MRF4. E-boxes are considered as critical regulatory components in muscle gene expression (Spiller et al. 2002) and their number and position show variability among MSTN promoter of different mammalian species (Dall’Olio et al. 2010). In cattle, 3 close E-boxes resulted functional, suggesting that they might function as a cluster in the regulation of MSTN expression Dall’Olio et al. 2010). These in silico predictions support the observations of other researchers that the insertion could have functional roles in regulating MSTN gene expression with potential phenotypic effects on traits including body composition, muscle mass, morphological traits, type of fibres and athletic performances in horses (Hill et al. 2010a, Baron et al. 2012, Petersen et al. 2013, Hill et al. 2012a, Hill et al. 2012b, Sakagami et al. 1994, Luo and Sawadogo 1996, Corre and Galibert 2005, Spiller et al. 2002, Tozaki et al. 2011). In particular, histological evidences showed that the presence of the SINE (and of the g.66493737C allele) confers higher proportion of Type 2B fibres and lower proportion of Type 1 fibres in Quarter Horse indicating that one or both these polymorphisms could play a functional role

196

Dall’Olio et al.

in muscle fibres composition (Petersen et al. 2013).

Other studies proposed that these 2 polymorphisms were good predictors of optimal racing distance in Thoroughbreds: the homozygous for the SINE allele (and g.66493737C allele) are better suited for short distance racing (<1,207 m), heterozygous horses are more capable at middle-distance, and homozygous animals for the WT allele (and g.66493737T) have greater stamina for long-distance races (i.e.

1,600 m). Interestingly, the Italian Trotter horses, usually competing at a distance of 1,600 m under harness at a trot, were homozygous both for the allele without the insertion and g.66493737T allele (data not shown), supporting, indirectly, the putative effects of these polymorphisms. The Quarter Horse, which was originally breed to sprint 400 m (1/4 mile), showed the highest frequency of the SINE allele in this trial. In conclusion, the analysed SINE polymorphism of the MSTN gene, that according to the literature has been associated with gallop racing performances in Thoroughbred and muscle fibre proportions in Quarter Horse, may be population or breed specific. Based on allele frequencies, this polymorphism might be an useful marker for association study with performances in Quarter Horse and Thoroughbred horses reared in Italy but not in the other analysed horses.

Grant support This study was funded by the University of Bologna, Italy, RFO program.

Veterinaria Italiana 2014, 50 (3), 193-197. doi: 10.12834/VetIt.61.178.3

Dall’Olio et al.

227 bp SINE insertion of the MSTN promoter in horses

References Baron E.E., Lopes M.S., Mendonça D. & da Câmara Machado A. 2012. SNP identification and polymorphism analysis in exon 2 of the horse myostatin gene. Anim Genet, 43, 229-232. doi: 10.1111/j.1365-2052.2011.02229.x.

Binns M.M., Boehler D.A. & Lambert D.H. 2010. Identification of the myostatin locus (MSTN) as having a major effect on optimum racing distance in the Thoroughbred horse in the USA. Anim Genet, 41, 154-158.

Corre S. & Galibert M.D. 2005. Upstream stimulating factors: highly versatile stress-responsive transcription factors. Pigment Cell Res, 18, 337-348.

Dall'Olio S., Fontanesi L., Nanni Costa L., Tassinari M., Minieri L. & Falaschini A. 2010. Analysis of horse myostatin gene and identification of single nucleotide polymorphisms in breeds of different morphological types. J Biomed Biotechnol, 2010. ID: 542945. http:// dx.doi.org/10.1155/2010/542945.

Dall’Olio S., Fontanesi L., Antonelli C., Nanni Costa L., Tassinari M. & Falaschini A. 2012. Association study between a SNP of the myostatin gene promoter and morhological traits in Uruguayan Creole horse. Atti della Società Italiana delle Scienze Veterinarie, 66, 412-414.

Dall’Olio S., Wang Y., Sartori C., Fontanesi L. & Mantovani R. 2014. Association of myostatin (MSTN) gene polymorphisms with morphological traits in the Italian Heavy Draft Horse breed. Livestock Science, 160, 29-36.

Elliott B., Renshaw D., Getting S. & Mackenzie R. 2012. The central role of myostatin in skeletal muscle and whole body homeostasis. Acta Physiol (Ox), 205, 324-340.

Elkasrawy M.N. & Hamrick M.W. 2010. Myostatin (GDF-8) as a key factor linking muscle mass and bone structure. J Musculoskelet Neuronal Interact, 10, 56-63.

Hill E.W., Gu J., Eivers S.S., Fonseca R.G., McGivney B.A., Govindarajan P., Orr N., Katz L.M.& MacHugh D.E. 2010a.

A sequence polymorphism in MSTN predicts sprinting ability and racing stamina in Thoroughbred horses.

PLoS One, 5, e8645. doi:10.1371/journal.pone.0008645.

Hill E.W., McGivney B.A., Gu J., Whiston R. & Machugh D.E. 2010b. A genome-wide SNP-association study confirms a sequence variant (g.66493737C>T) in the equine myostatin (MSTN) gene as the most powerful predictor of optimum racing distance for Thoroughbred racehorses. BMC Genomics, 11, 552. doi: 10.1186/14712164-11-552.

Hill E.W., Fonseca R.G., McGivney B.A., Gu J., MacHugh D.E. & Katz L.M. 2012a. MSTN genotype (g.66493737C/T) association with speed indices in Thoroughbred racehorses. J Appl Physiol, 112, 86-90.

Hill E.W., Ryan D.P. & Machugh D.E. 2012b. Horses for courses: a DNA-based test for race distance aptitude in Thoroughbred racehorses. Recent Pat DNA Gene Seq, 6(3), 203-208.

Veterinaria Italiana 2014, 50 (3), 193-197. doi: 10.12834/VetIt.61.178.3

Joulia-Ekaza D. & Cabello G. 2002. The myostatin gene: physiology and pharmacological relevance. Cur Opinion Pharmacol, 7, 310-315.

Joulia-Ekaza D. & Cabello G. 2006. Myostatin regulation of muscle development: molecular basis, natural mutations, physiopathological aspects. Exp Cell Res, 312, 2401-2414.

Luo X. & Sawadogo M. 1996. Antiproliferative properties of the USF family of helix-loop-helix transcription factors.

Proc Natl Acad Sci U S A, 93, 1308-1313.

McGivney B.A., Browne J.A., Fonseca R.G., Katz L.M., Machugh D.E., Whiston R. & Hill E.W. 2012. MSTN genotypes in Thoroughbred horses influence skeletal muscle gene expression and racetrack performance.

Anim Genet, 43, 810-812.

Petersen J.L., Mickelson J.R., Rendahl A.K., Valberg S.J., Andersson L.S., Axelsson J., Bailey E., Bannasch D., Binns M.M., Borges A.S., Brama P., da Câmara Machado A., Capomaccio S., Cappelli K., Cothran E.G., Distl O., FoxClipsham L., Graves K.T., Guérin G., Haase B., Hasegawa T., Hemmann K., Hill E.W., Leeb T., Lindgren G., Lohi H., Lopes M.S., McGivney B.A., Mikko S., Orr N., Penedo M.C., Piercy R.J., Raekallio M,. Rieder S., Røed K.H., Swinburne J., Tozaki T., Vaudin M., Wade C.M. & McCue M.E., 2013. Genome-wide analysis reveals selection for important traits in domestic horse breeds. PLoS Genet, 9(1), e1003211. doi:10.1371/journal.pgen.1003211.

Sakagami M., Ohshima K., Mukoyama H., Yasue H. & Okada N. 1994. A novel tRNA species as an origin of short interspersed repetitive elements (SINEs). Equine SINEs may have originated from tRNA(Ser). J Mol Biol, 239, 731-735.

Spiller M.P., Kambadur R., Jeanplong F., Thomas M., Martyn J.K., Bass J.J. & Sharma M. 2002. The myostatin gene is a downstream target gene of basic helix-loop-helix transcription factor MyoD. Mol Cell Biol, 22, 7066-7082.

Stinckens A, Georges M. & Buys N. 2011. Mutations in the myostatin gene leading to hypermuscularity in mammals: indications for a similar mechanism in fish? Anim Genet, 42, 229-234. doi: 10.1111/j.13652052.2010.02144.x.

Tozaki T., Hill E.W., Hirota K., Kakoi H., Gawahara H., Miyake T., Sugita S., Hasegawa T., Ishida N., Nakano Y. & Kurosawa M. 2012. A cohort study of racing performance in Japanese Thoroughbred racehorses using genome information on ECA18. Anim Genet, 43, 42-52.

Tozaki T., Sato F., Hill E.W., Miyake T., Endo Y., Kakoi H., Gawahara H., Hirota K., Nakano Y., Nambo Y. & Kurosawa M. 2011. Sequence variants at the myostatin gene locus influence the body composition of Thoroughbred horses. J Vet Med Sci, 73, 1617-1624.

197

CASE REPORT First description of adiaspiromycosis in an Eurasian otter (Lutra lutra) in Italy Daniela Malatesta1*, Vic R. Simpson2, Romina Fusillo3, Manlio Marcelli3, Laura Bongiovanni1, Mariarita Romanucci1, Chiara Palmieri1 & Leonardo Della Salda1 Faculty of Veterinary Medicine, University of Teramo, Italy.

2 Wildlife Veterinary Investigation Centre, Cornwall, UK. 3 LUTRIA snc Wildlife Research and Consulting, Roma, Italy.

1

* Corresponding author at: Faculty of Veterinary Medicine, University of Teramo, Piazza A. Moro 45, 64100 Teramo, Italy.

Tel.: +39 0861 266852, e-mail: dmalatesta@unite.it.

Veterinaria Italiana 2014, 50 (3), 199-202. doi: 10.12834/VetIt.40.1916.8 Accepted: 28.04.2014 | Available on line: 30.09.2014

Keywords Adiaspiromycosis, Cholesterol granuloma, Lung, Otter, RECAL.

Summary Adiaspiromycosis is a pulmonary disease caused by the inhalation of the ubiquitous fungus Emmonsia spp., a common soil inhabitant. Information about the replication and dissemination of the fungus from the primary site is lacking. Members of the Family Mustelidae seem to be highly susceptible to this infection, which has been previously reported in otters (Lutra lutra) in Czech Republic/Slovakia, Finland and in the UK. In many cases, Emmonsia-associated lesions have also been reported as incidental findings during necropsies of otherwise healthy animals. A road-killed male Eurasian otter was submitted for the post-mortem examination on 21st December 2009 at the Veterinary Pathology Unit of the Faculty of Veterinary Medicine of Teramo, as part of the RECAL [RECovery and post‑mortem Analysis of Eurasian otters (Lutra lutra) in the National Park of Cilento, Vallo di Diano and Alburni (Salerno, Italy), and surrounding areas] project. Histologically, multifocal round structures with a PAS-positive thick tri-laminar wall and a central basophilic granular mass were observed within the alveoli.

The adiaspores were surrounded by a severe granulomatous reaction with high number of macrophages, multinucleated giant cells, eosinophils, neutrophils and fibroblasts. Numerous multifocal cholesterol granulomas were observed close to those fungal-induced. To the best of our knowledge, this is the first description of adiaspiromycosis in an Eurasian otter in Italy.

Prima descrizione di un caso di adiaspiromicosi in lontra eurasiatica (Lutra lutra) in Italia Parole chiave Adiaspiromicosi, Granuloma colesterinico, Lontra, Polmone, RECAL.

Riassunto L’adiaspiromicosi è una malattia fungina polmonare causata dall’inalazione di spore di Emmonsia spp., funghi filamentosi ubiquitari frequentemente isolabili dal suolo, caratterizzati da assenza di moltiplicazione e disseminazione a partire dal sito primario di infezione. I Mustelidi sembrano particolarmente suscettibili, l’infezione è stata descritta nella lontra in Cecoslovacchia, Finlandia e Gran Bretagna. Nella maggior parte dei casi le lesioni sono state rilevate occasionalmente in esami necroscopici su animali morti per altre cause. L’adiaspiromicosi, generalmente, non ha significato patologico nella lontra, sebbene sia stato descritto un caso mortale. In Italia, nell’ambito del progetto RECAL [RECupero e Analisi post‑mortem di esemplari di Lontra (Lutra lutra), nel Parco Nazionale del Cilento, Vallo di Diano e Alburni (Salerno) e aree contigue] un esemplare maschio subadulto di lontra eurasiatica, rinvenuto morto con evidenti lesioni traumatiche, è stato conferito per l’esame necroscopico il 21 Dicembre 2009, presso l’Unità di Ricerca di Anatomia Patologica della Facoltà di Medicina Veterinaria di Teramo.

L’osservazione microscopica di campioni di tessuto polmonare, sottoposti a processazione istologica di routine, ha evidenziato negli spazi alveolari la presenza di formazioni tondeggianti multifocali con spessa parete trilaminare intensamente PAS positiva e presenza nella parte interna di materiale granulare basofilico amorfo. Le formazioni sono risultate circondate da zone con intensa reazione granulomatosa caratterizzata da numerosi macrofagi, cellule giganti multinucleate, granulociti eosinofili e neutrofili, fibroblasti. Nel tessuto adiacente sono stati rilevati numerosi granulomi colesterinici. Gli autori presumono che il lavoro rappresenti la prima segnalazione di adiaspiromicosi nella lontra eurasiatica in Italia.

199

Malatesta et al.

Adiaspiromycosis in an Eurasian otter

Introduction Adiaspiromycosis is primarily a mycotic pulmonary disease caused by the inhalation of the ubiquitous, common soil inhabitants, dimorphic fungi of the genus Emmonsia: Emmonsia parva (E. parva) and Emmonsia crescens (E. crescens) (Chantrey et al. 2006).

Emmonsia crescens has been isolated from over 96 species of animals (Sigler 1996) and it is the most common isolate in Europe, while E. parva has been isolated in few species of animals (Morandi et al. 2012, Sigler 1996). The laboratory diagnosis can prove to be difficult for the mycelial stages of E. parva and E. crescens that are morphologically similar and their differentiation requires the use of polymerase chain reaction (PCR) (Borman et al.

2009). Although at a first sight the histology image of adiaspore resembles a parasite, an accurate analysis the absence of organs allows for correctly identifying the organism (Mörner et al. 1999); which is in turn characterized by large globose, thick-walled, non-proliferating structures called adiaspores (Sigler 1996). The term Adiaspore comes from the Greek terms adia and speirein meaning negative and scattering, respectively, and therefore adiaspiromycosis describes an infection without replication or dissemination of the fungus from the original site (Emmons and Jellison 1960).

200

14.73"), near the National Park of Cilento, Vallo di Diano and Alburni (PNCVDA), most likely hit by a car, and submitted for post-mortem examination on 21st December 2009. The animal weighed 6,8 Kg and was 110 cm long from the nose to the tail tip. This case is one of a series of post-mortem examinations performed at the Veterinary Pathology Unit of the Faculty of Veterinary Medicine of Teramo, from 2009 to 2013, as part of the RECAL project established for investigating the causes of death, the overall health, biometric and demographic parameters and levels of contaminants in the Eurasian otter (Lutra lutra) population in the PNCVDA and surrounding areas, by means of post-mortem analysis.

Representative tissues of all major organs were fixed in 10% neutral buffered formalin, embedded in paraffin, cut in 5 μm-thick sections, stained with haematoxylin-eosin (H&E) and examined by light microscopy. Selected lung sections containing fungal spherules were also stained with periodic acid-Schiff (PAS) and Grocott’s methenamine silver (GMS) stains.

Results

Adiaspores are distributed within the pulmonary alveoli, being surrounded by a granulomatous inflammatory reaction consisting of macrophages, multinucleated giant cells and eosinophils, which are represented by small gray nodules. Infections may be asymptomatic but characterized by a granulomatous pneumonia, and the severity depends on the number of adiaspores and the host immunity.

At necropsy, the carcass had multiple to diffuse subcutaneous hemorrhages associated with fractures of both shoulders. Multiple fractures of the thoracic vertebrae, multiple and bilateral rib fractures with laceration of the parietal pleura, rupture of the pericardium and right atrium and severe hemothorax were also detected. In the cardiac cavity, a heartworm (subsequently identified as Dirofilaria immitis) was also found, without associated lesions. Other gross findings were multifocal bilateral severe pulmonary hemorrhages and moderate hemoperitoneum with intestinal tract herniation into the thoracic cavity.

Adiaspiromycosis has been described as pulmonary infection due to spores inhalation in mammals (Hamir 1999), particularly in different wild species of rodents and mustelids that are highly susceptible to this infection (Burek 2001, Simpsonet al. 2013).

The disease has been previously described in otters (Lutra lutra) in Czech Republic/Slovakia (Krivanec et al. 1976), Finland (Rudback and Stjernberg 1998) and England (Simpson 1998).

In most cases, Emmonsia‑associated lesions represent incidental findings during necropsies of otherwise healthy animals, thus being considered of limited pathological significance. However, fatal adiaspiromycosis has been described in an otter as well (Simpson and Gavier-Widen 2000).

Histological examination of lung tissue revealed multifocal scattered round structures within the alveolar space, up to 250 μm in diameter with a 20‑30 μm thick tri-laminar wall consisting of a basophilic outer-layer (3.4 µm in diameter), an eosinophilic mid-layer (11 µm in diameter), a pale inner layer (43 µm in diameter) and a basophilic granular retiform center (Figure 1). The adiaspores were surrounded by a severe granulomatous inflammation with high number of epithelioid macrophages, Langhans multinucleated giant cells, eosinophils, neutrophils and fibroblasts (Figure 2).

The cell wall was strongly PAS- and GMS-positive (Figure 2a and 2b). Numerous multifocal granulomas containing cholesterol clefts (Figure 3).

Materials and methods

Discussion

A male Eurasian otter was found dead on the road SP430 (Latitude 40° 13' 47.17", Longitude 15° 10'

Based on the fungal shape, staining features and associated histological lesions, pulmonary

Veterinaria Italiana 2014, 50 (3), 199-202. doi: 10.12834/VetIt.40.1916.8

Malatesta et al.

Figure 1. Lung of a male Eurasian otter found near the National Park of Cilento, Vallo di Diano and Alburni (Salerno, Italy; 21.12.2009): multiple variably sized adiaspores randomly scattered in the pulmonary parenchyma (Bar = 110 μm) (H&E).

Adiaspiromycosis in an Eurasian otter

Figure 2. Lung of a male Eurasian otter found near the National Park of Cilento, Vallo di Diano and Alburni (Salerno, Italy; 21.12.2009): adiaspores surrounded by a severe granulomatous inflammation (Bar = 55 μm) (H&E). Insets: strongly PAS- (a) and GMS- (b) positive adiaspores (Bar = 85 μm).

adiaspiromycosis, due to Emmonsia spp. infection was diagnosed (Malatesta et al. 2013).

Unfortunately, we could not confirm the species involved, although, considering the worldwide distribution, E. crescens infection is the most likely (Borman et al. 2009).

Despite fatal adiaspiromycosis has been observed

by Simpson and Gavier-Widen (Simpson and GavierWiden 2000) in an otter, in this case the primary cause of death would seem to be the traumatic lesions, due to a car accident. In fact, while the grossly-detectable lung hemorrhages were of traumatic origin, pulmonary lesions referable to adiaspiromycosis were only histologically observable and were not so severe and diffuse to cause clinical signs of respiratory failure. Furthermore, no other organs were affected by the fungal infection. The latter finding confirm the commonly accepted evolution and outcome of this infection in animals, since lesions of adiaspiromycosis are usually confined to the lungs, and the extrapulmonary involvement has been rarely observed only in immunocompromised human patients (Echevarria et al. 1993).

Figure 3. Lung of a male Eurasian otter found near the National Park of Cilento, Vallo di Diano and Alburni (Salerno, Italy; 21st December 2009): a focal granuloma containing cholesterol clefts, associated with adiaspore‑induced granulomatous inflammation (Bar = 110 μm) (H&E).

Veterinaria Italiana 2014, 50 (3), 199-202. doi: 10.12834/VetIt.40.1916.8

In Italy the adiaspiromycosis was described for the first time by Splendore (Splendore 1920) in voles and many years later in a wild rabbit (Rosmini et al. 1989), in small mammals (Gallo et al. 1962) and

201

Adiaspiromycosis in an Eurasian otter

in a Crested porcupine (Morandi et al. 2012). To the best of our knowledge, this is the first description of adiaspiromycosis in an Eurasian otter in Italy.

Malatesta et al.

assistance and the National Park of Cilento, Vallo di Diano and Alburni, the coordinating partner of the RECAL project involving authors M.D., F.R., M.M., B.L., R.M, P.C., D.S.L.

Acknowledgements The authors would like to thank Dr Marina Baffoni and Dr Marcella Massimini for the technical

References Borman A.M., Simpson V.R., Palmer M.D., Linton C.J. & Johnson E.M. 2009. Adiaspiromycosis due to Emmonsia crescens is widespread in native British mammals.

Mycopathologia, 168, 153-163.

Burek K. 2001. Mycotic diseases. In Infectious diseases of wild animals. 3rd ed., (E.S. Williams & I.K. Barker, eds,).

Manson Publishing, London, UK, 522-523.

Chantrey J.C., Borman A.M., Johnson E.M. & Kipar A. 2006.

Emmonsia crescens infection in a British water vole (Arvicola terrestris). Med Mycol, 44, 375-378.

Echevarria E., Cano E. & Restrepo A. 1993. Disseminated adiaspiromycosis in a patient with AIDS. J Med Vet Mycol, 31, 91-97.

Emmons C.W. & Jellison W.L. 1960. Emmonsia crescens sp. and adiaspiromycosis (haplomycosis) in mammals. Ann N Y Acad Sci, 89, 91-101.

202

Morandi F., Galuppi R., Buitrago M.J., Delogu M., Lowenstine L.J., Panarese S., Benazzi C. & Sarli G. 2012.

Disseminated pulmonary adiaspiromycosis in a crested porcupine (Hystrix cristata Linnaeus, 1978). J Wildl Dis, 48, 523-525.

Mörner T., Avenäs A. & Mattsson R. 1999. Adiaspiromycosis in a European beaver from Sweden. J Wildl Dis, 35, 367-370.

Rosmini R., Marocchio L., Morganti L., Corradini L. & Bassi S. 1989. Adiaspiromycosis in a wild rabbit. Rivista di Coniglicoltura, 26, 51-53.

Rudback E. & Stjernberg T. 1998. Trauma is the major cause of mortality in Finnish otters. Proceedings of the European Wildlife Disease Association, 3rd International Conference, Edinburgh, September 16-20, 1998.

Gallo M.G., Cornaglia E. & Gargano D. 1992. Adiaspiromicosi in micromammiferi del Piemonte. Prima segnalazione in Italia. Risultati preliminari. Atti Società Italiana delle Scienze Veterinarie, 46, 1231-1236.

Sigler L. 1996. Ajellomyces crescens sp. nov., taxonomy of Emmonsia spp., and relatedness with Blastomyces dermatitidis (teleomorph Ajellomyces dermatitidis). J Med Vet Mycol, 34, 303-314.

Hamir A.N. 1999. Pulmonary adiaspiromycosis in raccoons (Procyon lotor) from Oregon. J Vet Diagn Invest, 11, 565-567.

Simpson V.R. 1998. A postmortem study of otters (Lutra lutra) found dead in south-west England. R&D Technical Report W148. Rio House, Bristol, Environment Agency.

Krivanec K., Otcenasek M. & Slais J. 1976. Adiaspiromycosis in large free-living carnivores. Mycopathologica, 58, 21-25.

Simpson V.R. & Gavier-Widen D. 2000. Fatal adiaspiromycosis in a wild Eurasian otter (Lutra lutra).

Vet Rec, 147, 239-241.

Malatesta D., Simpson V., Fusillo R., Marcelli M., Bongiovanni L., Romanucci M.R., Palmieri C. & Della Salda L. 2013.

Prima descrizione in Italia di un caso di adiaspiromicosi polmonare in una lontra euroasiatica (Lutra lutra). X Congresso Nazionale AIPVET (Associazione Italiana Patologi Veterinari), 29-31 Maggio 2013, Giulianova Lido (TE), Italy.

Simpson V.R., Hargreaves J., Butler H.M., Davison N.J. & Everest D.J. 2013. Causes of mortality and pathological lesions observed post-mortem in red squirrels (Sciurus vulgaris) in Great Britain. BMC Vet Res, 9, 229.

Splendore D.A. 1920. About parasites of voles. Annali di Igiene, 30, 445-468.

Veterinaria Italiana 2014, 50 (3), 199-202. doi: 10.12834/VetIt.40.1916.8

Culicoides midges (Diptera: Ceratopogonidae) as vectors of orbiviruses in Slovakia Adela Sarvašová1, Maria Goffredo2, Igor Sopoliga3, Giovanni Savini2 & Alica Kočišová1* University of Veterinary Medicine and Pharmacy in Košice, Department of Parasitology, Komenského 73, 041 81 Košice, Slovak Republic.

2 Istituto Zooprofilattico Sperimentale dell'Abruzzo e del Molise 'G. Caporale', 64100 Teramo, Italy.

3 University of Veterinary Medicine and Pharmacy in Košice, Special Centre for study of Breeding and Diseases of Wild Animals, Fish and Bees, Rozhanovce, Slovak Republic.

1

* Corresponding author at: Department of Parasitology, University of Veterinary Medicine and Pharmacy in Košice, Komenského 73, 041 81 Košice, Slovak Republic.

Tel.: +421915984641, e-mail: alica.kocisova@uvlf.sk.

Veterinaria Italiana 2014, 50 (3), 203-212. doi: 10.12834/VetIt.2405.11

Accepted: 30.05.2014 | Available on line: 30.09.2014

Keywords Bluetongue virus, Culicoides, Epizootic haemorrhagic disease virus, ITS-1, ITS-2, Slovakia.

Summary In recent years, rapid spread of Culicoides-borne pathogens such as bluetongue (BT) and Schmallenberg viruses have been reported in Europe. In this study we examined the Culicoides populations in farms with wild and domestic ruminants in Eastern Slovakia with the aim to confirm the presence of biting midges serving as potential vectors of important pathogens. The main vector complexes were the Obsoletus complex (54%; n=4,209) and the Pulicaris complex (23%; n=1,796). To estimate the relative abundance of the cryptic species of the Obsoletus complex (Culicoides obsoletus, Culicoides scoticus and Culicoides montanus), we performed the multiplex polymerase chain reaction (PCR) based on ITS-2 and ITS-1 segments, on 125 midges randomly sampled. The relative abundance of C. obsoletus ranged from 5.26% in the farm with wild ruminants to 85.71% in another farm with cattle and sheep.

A total of 112 pools of parous and gravid females belonging to the Obsoletus and Pulicaris complexes were tested for virus detection by the real-time reverse transcription polymerase chain reaction (RT-PCR) for BT virus, as well as for the Epizootic Hemorrhagic Disease Virus (EHDV), with negative results.

Studio sui Culicoides (Diptera: Ceratopogonidae) possibili vettori di orbivirus in Slovacchia Parole chiave Bluetongue, Culicoides, ITS-1, ITS-2, Malattia emorragica epizootica, Slovacchia.

Riassunto Recentemente in Europa si è verificata una rapida diffusione di malattie trasmesse da Culicoides come la Bluetongue (BT) e l‘infezione determinata da Schmallenberg virus (SBV).

In questo lavoro sono state studiate le popolazioni di Culicoides in allevamenti di ruminanti di specie domestiche e selvatiche nella Slovacchia orientale con l’obiettivo di verificare la presenza di potenziali specie vettori di virus. Quelle più abbondanti sono risultate le specie di Culicoides appartenenti all‘Obsoletus e Pulicaris Complexes (rispettivamente 54%; n=4.209 e 23%; n=1.796). Per valutare l’abbondanza relativa delle singole specie dell‘Obsoletus Complex (Culicoides obsoletus, Culicoides scoticus e Culicoides montanus) sono stati identificati 125 moscerini mediante PCR multiplex basata sui segmenti ITS-2 e ITS-1. L’abbondanza relativa di C. obsoletus è risultata compresa tra 5,26% in un allevamento con ruminanti selvatici e 85,71% in un allevamento con bovini e ovini. In totale sono stati analizzati, con real-time RT-PCR per BT e RT-PCR per malattia emorragica epizootica, 112 femmine adulte, pluripare e gravide di specie appartenenti a Obsoletus e Pulicaris Complexes, tutte risultate negative.

203

Sarvašová et al.

Orbivirus vectors in Slovakia

Introduction Vector-borne pathogens, such as bluetongue and Schmallenberg viruses, have recently emerged and spread in Europe. Another vector borne pathogen, such as the Epizootic Hemorrhagic Disease (EHD) Virus, has lately been reported in countries bordering the European Union. All these viruses affected mainly ruminants and are transmitted by biting midges of the Culicoides genus.

Bluetongue is an infectious, non-contagious disease of wild and domestic ruminants caused by the Bluetongue virus (BTV) of the Orbivirus genus in the Reoviridae family. In August 2006, the first cases of the BTV serotype 8 infections were detected in Western Europe: Netherlands, Belgium, and Germany (Wilson and Mellor 2009). In 2007, a massive geographic spread of the disease and a dramatic increase in the number of affected farms and infected animals were observed. In 2007 and 2008, the outbreaks of bluetongue were reported in countries bordering the Slovak Republic, such as Czech Republic, Hungary, and Austria (Carpenter et al. 2009). In 2012, the BTV-14 appeared in Poland and other Baltic states1. In countries where the main Afro-Asian vector Culicoides imicola is not present, the BTV transmission among hosts occurs through the indigenous species of Avaritia and Culicoides subgenera. The bluetongue virus has been detected in the Obsoletus complex (De Liberato et al. 2005, Mehlhorn et al. 2007, Mellor and Pitzolis 1979, Savini et al. 2004, Savini et al. 2005), Culicoides obsoletus (Hoffmann et al. 2009), Culicoides dewulfi (Meiswinkel et al. 2007), Culicoides chiopterus (Dijkstra et al. 2008), and also Culicoides pulicaris (Caracappa et al. 2003, Vanbinst et al. 2009) and Culicoides lupicaris (Romón et al. 2012).

Epizootic Haemorrhagic Disease is an infectious non-contagious viral disease of wild ungulates and rarely cattle. The causative agent, the Epizootic Haemorrhagic Disease Virus (EHDV), also belongs to the Reoviridae family, Orbivirus genus. The disease was observed in North America, Australia, Asia, and Africa; while, the EHDV has never been reported in Europe (Savini et al. 2011). In recent years, the disease has been expanding in countries surrounding the Mediterranean basin, including Morocco, Algeria, Tunisia (Efsa 2009), Israel (Wilson and Mellor 2009), and Turkey (Temizel et al. 2009).

The EHDV can share common vectors with the BTV in South Africa (Paweska et al. 2002, Venter et al.

1998) and it is likely that the species of Culicoides that could transmit the EHDV in Europe are similar,

1

204

P RO/AH/EDR. 2012. Bluetongue - Europe (10): Estonia, Latvia, Lithuania, Poland, BTV-14, susp., archive number: 20121127.1426885. 2012. http:// www.geostrategicforecasting.com/proahedr-bluetongue-europe10estonia-latvia-lithuania-poland-btv/.

if not identical to those transmitting the BTV (Savini et al. 2011).

Within the Avaritia subgenus there are several species involved in the arbovirus transmission in Europe: C. imicola, the Obsoletus complex, C. dewulfi and C. chiopterus. The Obsoletus complex includes cryptic species (C. Obsoletus sensu stricto, C. scoticus and C. montanus) which are very difficult to identify by means of morphology (Meiswinkel et al. 2004).

The males of C. obsoletus and C. scoticus can be distinguished according to the shape of genitalia; while the diagnostic characters of females overlap.

Several molecular tools have been developed to identify the Culicoides species or to study their phylogenetic relationships. Many of them have focused on the internal transcribed spacer 1 (ITS-1) (Cêtre-Sossah et al. 2004, Mathieu et al. 2007) and ITS‑2 region of the ribosomal DNA (Gomulski et al.

2005), or on mitochondrial cytochrome oxidase subunit I (COI) DNA (Augot et al. 2010, Lehmann et al.

2012, Nolan et al. 2007, Pagès et al. 2009, Pagès and Sarto 2005, Schwenkenbecher et al. 2009). In addition to these qualitative PCR assays, the quantitative real‑time PCR has recently been developed (Mathieu et al. 2011) to estimate simultaneously the relative abundance of C. obsoletus and C. scoticus in large samples.

In this study we examined the Culicoides populations in farms with ruminants in Eastern Slovakia with the aim to identify the presence and profusion of the species of Culicoides in the region and to assess the presence of biting midges that could act as potential vectors of important pathogens such as BTV and EHDV. To identify the species of the Obsoletus complex (C. obsoletus, C. scoticus and C. montanus) and to estimate their relative abundance, we performed the multiplex PCR based on ITS-2 and ITS-1 segments.

Material and methods Insect collections A total of 6 Culicoides captures were collected between May and June 2011 from 3 farms in Eastern Slovakia: a cattle farm (Tulcik, 1 collection), a farm with cattle and sheep (Michalany, 1 collection), and a farm with fallow deer and mouflons (Rozhanovce, 4 collections). Midges were collected by miniature blacklight traps model 1212. The traps were situated in close proximity to the cattle in the first 2 livestock farms, while in the farm with wild animals, where more than 200 fallow deer and 70 mouflons are reared on the 470 ha area, the trap was hung on a tree near a water pond on the border between the forest and the meadow.

Veterinaria Italiana 2014, 50 (3), 203-212. doi: 10.12834/VetIt.2405.11

Sarvašová et al.

The Culicoides captures were analysed and morphologically identified according to Delécolle (Delécolle 1985), Campbell and Pelham-Clinton (Campbell and Pelham-Clinton 1960) and Goffredo and Meiswinkel (Goffredo and Meiswinkel 2004).

The males were identified on the basis of the shape of the genitalia (Delécolle 1985). Subsequently, the females were age-graded according to the abdomen pigmentation as nulliparous, parous, gravid and freshly engorged (Dyce 1969) and stored in 70 % ethanol.

To estimate the relative abundance of the species belonging to the Obsoletus complex, a total of 125 nulliparous females were randomly sorted out (at least 21 midges per location) and identified individually by the multiplex PCR. Of these, 110 were identified by using the ITS-2 ribosomal DNA segment (Gomulski et al. 2005) and 15 by using the ITS-1 segment (Mathieu et al. 2011). The multiplex PCR based on the ITS-1 segment was also used to confirm the identification of 4 midges morphologically suspected to belong to C. chiopterus.

The parous and gravid females belonging to the Obsoletus and to the Pulicaris complexes were divided into pools and tested for the presence of EHDV and BTV RNA.

DNA extraction The DNA for molecular analysis was extracted from randomly selected 125 individuals morphologically ascribed on the basis of wing pattern to the Obsoletus complex and 4 females suspected as C. chiopterus. Extraction was carried out using the automated Maxwell 16 system (Promega, Madison, Wisconsin, USA) with the DNA IQ Casework Sample kit (Promega, Madison, Wisconsin, USA) according to manufacturer´s instructions.

PCR amplification of the ITS-2 segment for identification of species belonging to the Obsoletus Complex The ITS-2 segment of ribosomal DNA was amplified using the primers 5.8 SF, 28 SR, Scoticus-194R, MOU‑316F, and Montanus-227R (Gomulski et al.

2005). The reaction volume was 25 µl, consisting of 2.5 µl 10x buffer, 2 mM of MgCl2, 0.2 mM of dNTPs (Promega, Madison, Wisconsine, USA), 1 µM of primer 5.8SF, 0.8 µM of primer 28 SR, 0.4 µM of Scoticus-194R, 0.2 µm of primer MOU-316F, 1 µM of primer Montanus-227R, 0.2 µl of Ampli Taq Gold (Applied Biosystems, Carlsbad, California, USA), 16.1 µl of H2O, and 2 µl of DNA. The thermal profile consisted of an initial denaturation step at 94°C for 10’, followed by 40 cycles of denaturation at 94°C for 30”, annealing at 56°C for 30”, elongation at 72°C for

Veterinaria Italiana 2014, 50 (3), 203-212. doi: 10.12834/VetIt.2405.11

Orbivirus vectors in Slovakia

30” and ended with the final elongation at 72°C for 7’. The PCR products were separated on the E-gel 4% Agarose (Invitrogen, Carlsbad, California, USA).

PCR amplification of the ITS-1 segment for identification of species belonging to the Obsoletus Complex, C. chiopterus and C. dewulfi Multiplex PCR based on ITS-1 sequences (Mathieu et al. 2007) were used to identify 15 individuals from the Obsoletus complex and 4 specimens morphologically described as C. chiopterus, as well to categorise the species of Obsoletus complex and the morphologically related species C. chiopterus and C. dewulfi. The midges DNA was amplified with the primers PanCulF, Obs-sl-R, Obs-ss-R, Dewulfi-R, Montanus-R, and Chiopterus-R (Mathieu et al. 2007).

Reactions were performed in a total volume of 25 µl consisting of 10 x PCR reaction buffer; 1.5 mM of MgCl2; 250M of each dATP, dCTP, dGTP, and dTTP; 20 pmol of the primers Obs-ss-R, Obs-sl-R, Dewulfi-R, and Chiopterus-R; 40 pmol of Montanus-R; 60 pmol of Pan CulF; and 2.5 U of TaqDNA polymerase and 1 µl of DNA. The PCR reaction was carried out under the following cycling conditions: an initial denaturation stage at 94°C for 5’ and then 30 cycles at 94°C, 1’; 61°C, 1’; 72°C, 1’, and the final extension phase at 72 °C for 10’. PCR products were examined by electrophoresis in the 2.5% agarose gel.

RNA extraction for BTV and EHDV detection Individual pools containing the maximum of 50 parous and gravid females were homogenized with the pellet pestle motor (Kontes, Vineland, New Jersey, USA) before extraction in 2 ml tubes filled with 300 µl of PBS. The RNA was extracted using the High Pure Viral Nucleic Acid Kit (Roche, Mannheim, Germany) according to the manufacturer´s instructions.

Real-Time RT-PCR for BTV detection The BTV detection (Hofmann et al. 2008) was carried out using the real time RT-PCR Kit SuperScript III Platinum® One-Step Quantitative RT-PCR System (Invitrogen, Carlsbad, California, USA) and primers and the TaqMan probe were used for the region NS1 of the Bluetongue virus and for the NS5-2 region of the West Nile virus (Table I). The West Nile virus was used as the internal positive control. In total, 5 μl of viral RNA with 5 µl of the denaturation mix composed of 0.9 µM primers BTNS1-F and BTNS1-N and water was heated at 95 °C for 5 minutes and then submerged in ice for 5 minutes. Subsequently, 10 µl of denatured RNA was added to the amplification mix consisting of 12.5 µl 2x Reaction Mix, 0.5 µl

205

Sarvašová et al.

Orbivirus vectors in Slovakia

of ROX Reference Dye, 0.2 µM of primer NS5-2 F and NS5-2 R, 0.15 µM of probe NS5-2 P, 0.08 µM of probe WNEnv-P, 0.99 µl of nuclease free water, 1µl of armored WND (NY 1999) (dilution 1:100), and 0.5 µl of SuperScript III Platinum Taq Mix. The thermal cycle condition was: retrotranscription at 50°C for 15 minutes, activation 95°C for 2 minutes, 45 cycles of denaturation at 95°C for 15 seconds, annealing at 60 °C for 30 seconds.

at 95°C for 5 seconds and submerged in ice also for 5 seconds. It was followed by the addition of 40 µl of Master Mix (10µl of 5x Buffer, 10 µl of Q-solution, 2 µl of 10mM dNTP, 2 µl of RT-PCR enzyme, 16 µl of water), while respecting the One-Step RT-PCR kit (Qiagen, Hilden, Germany) instructions. The thermal cycler conditions were: 48°C for 30 minutes, 95°C for 10 minutes, 40 cycles at 95°C for 1 minutes, 55 °C for 30 seconds, 72 °C for 30 seconds, and 72°C for 10 minutes. The PCR products were examined by electrophoresis in a 1.5% agarose gel.

RT-PCR for EHDV detection The EHDV detection (Clavijo et al. 2010) was performed in one step RT‑PCR with primers E1 (5'-TCG AAG AGG TGA TGA ATC GC-3') and E4 (5'-TCA TCT ACT GCA TCT GGC TG‑3'). The mixture of 0.8 µM of primers E1-E4 and 3 µl of RNA in 5 µl of water was denatured

Results A total of 7,773 midges were collected and morphologically identified in 6 collections from the 3 localities, 1,888 from Rozhanovce, 3,940 from Michalany and 1,945 from Tulcik. The Obsoletus complex represented 54 % (n=4209) of total midges, followed by the Pulicaris complex (23%; n= 1,796).

On 2 farms, species belonging to the Nubeculosus complex were also captured, constituting 6.5% of the collected midges at Michalany (n=255) and 0.1% in Tulcik (n=2) (Table II).

Table I. Primers and probe TaqMan for the region NS1 of BTV and for the NS5-2 region of WNV (IPC).

Primers and probe TaqMan for the region NS1 of BTV 5'-FAM-CGC TTT TTG AGA AAA TAC AAC ATC AGT BTNS1 probe TaqMan GGG GAT-TAMRA-3' Primer BTNS1-F 5'-TGG CAA CCA CCA AAC ATG G-3' Primer BTNS1-N 5'-CCA AAA AAG TCC TCG TGG CA -3' Primers and probe TaqMan for the NS5-2 region of WNV 5'-VIC-CCA ACG CCA TTT GCT CCG CTG – NS5-2 probe TaqMan TAMRA-3' Primer NS5-2-F 5'-GAA GAG ACC TGC GGC TCA TG -3' Primer NS5-2-R 5'-CGG TAG GGA CCC AAT TCA CA -3'

The Pulicaris complex was represented by C. pulicaris, C. punctatus, C. newsteadi, and C. lupicaris (Table III).

Only 1 male of C. pulicaris was captured (Table IV).

Culicoides imicola and C. dewulfi resulted absent in all collection sites. Only 2 out of 4 females suspected of C. chiopterus were confirmed by the PCR; the remaining 2 were identified as C. scoticus.

Within the 125 randomly selected females of the

Table II. Culicoides collected on three farms in Eastern Slovakia (2011).

Locality

Date

Rozhanovce Rozhanovce Rozhanovce Rozhanovce Michalany Tulcik

13/05/2011 26/05/2011 02/06/2011 23/06/2011 25/05/2011 25/05/2011

Total Culicoides 619 125 415 729 3940 1945

Pulicaris Complex (%) 38 (6.14) 22 (17.6) 82 (19.76) 130 (17.83) 1149 (29.16) 375 (19.28)

Obsoletus Complex (%) 562 (90.79) 81 (64.8) 170 (40.96) 438 (60.1) 1517(38.5) 1441 (74.09)

Nubeculosus Complex (%) 0 0 0 0 255 (6.47) 2 (0.11)

Culicoides spp. (%) 19 (3.07) 22 (17.6) 163 (39.28) 161 (22.09) 1019 (25.87) 124 (6.38)

Table III. Species composition of Pulicaris complex.

Locality Rozhanovce Rozhanovce Rozhanovce Rozhanovce Michalany Tulcik

206

Date 13/05/2011 26/05/2011 02/06/2011 23/06/2011 25/05/2011 25/05/2011

C. pulicaris 32 (84.21) 6 (27.27) 74 (90.24) 40 (30.77) 246 (21.41) 350 (93.34)

C. punctatus 6 (15.79) 16 (72.73) 8 (9.76) 90 (69.23) 854 (74.33) 14 ((3.73)

C. lupicaris 0 0 0 0 2 (0.17) 0

C. newsteadi 0 0 0 0 47 (4.09) 11 (2.93)

Total 38 22 82 130 1149 375

Veterinaria Italiana 2014, 50 (3), 203-212. doi: 10.12834/VetIt.2405.11

Sarvašová et al.

Orbivirus vectors in Slovakia

Table IV. Age grading of Obsoletus and Pulicaris complexes.

Locality Rozhanovce Rozhanovce Rozhanovce Rozhanovce Michalany Tulcik

N (%) 485 (86.3) 19 (23.46) 80 (47.06) 347 (79.22) 297 (19.58) 697 (48.37)

Obsoletus complex scoticus P (%) G (%) E (%) C. M (%) 62 10 0 0 (11.03) (1.78) 61 0 1 (1.23) 0 (75.31) 77 (45.29) 1 (0.59) 4 (2.35) 4 (2.35) 85 0 6 (1.37) 0 (19.41) 531 687 0 0 (35.0) (45.29) 600 130 11 0 (41.64) (9.02) (0.76)

Pulicaris complex C. obsoletus M (%)

Total

N (%)

P (%)

5 (0.89)

562

0

81

4 (2.35)

170

0

438

2 (0.13)

1517

3 (0.21)

1441

17 (44.74) 6 (27.27) 44 (53.66) 72 (55.38) 513 (44.65) 149 (39.73)

20 0 1 (2.63) 0 (52.63) 16 0 0 0 (72.73) 36 0 1 (1.22) 1 (1.22) (43.9) 41 17 0 0 (31.54) (13.08) 624 12 0 0 (54.31) (1.04) 224 0 (59.73) 1 (0.27) 1 (0.27)

G (%)

E (%)

M

Total 38 22 82 130 1149 375

N = nulliparous; P = parous; G = gravid; E = engorged; M = males.

Figure 1. Gel electrophoresis of amplification products of multiplex PCR assay for ITS-2.

Lines 2-4, 6, 8 - C. scoticus; lines 5, 7 - C. obsoletus; line 9 - C. scoticus (positive control); line 10 - C. obsoletus (positive control); line 11 - C. montanus (positive control).

(C. obsoletus - 400 and 89 bp; C. scoticus - 400 and 213 bp; C. montanus - 400, 252 and 89 bp).

Obsoletus complex identified by the multiplex PCR, C. obsoletus sensu stricto and C. scoticus were confirmed, while C. montanus resulted absent in the samples (Figures 1 and 2). Their relative abundance is shown in Table V. At the locality of Rozhanovce, C. scoticus resulted as the most abundant species of the complex (59.04%). At the other 2 sites of Michalany and Tulcik, C. obsoletus resulted largely as the most abundant in the samples, 85.71% and 80.95%, respectively. The males of C. obsoletus were caught in all locations and C. scoticus only in Rozhanovce (Table IV).

Within the Obsoletus and Pulicaris complexes, the parous/gravid rate observed in the 6 collections ranged between 11%-80% and 31.5%-73%, respectively (Table IV).

Figure 2. Gel electrophoresis of amplification products of the multiplex PCR assay for ITS-1.

Lines 1, 4-7, 9, 10 - C. obsoletus; lines 2, 3, 8, 11-15, 17, 18 - C. scoticus; lines 16, 19 - C. chiopterus; line 20 - C. obsoletus (positive control); line 21 - C. montanus (positive control); line 22 C. dewulfi (positive control); line 23 - C. chiopterus (positive control); line 24 - C. scoticus (positive control).

(C. obsoletus - 302 bp and 166 bp; C. scoticus - 166 bp; C. chiopterus - 166 bp and 117 bp; C. montanus - 302 bp, 166 bp and 125 bp; C. dewulfi - 166 bp and 78 bp).

Veterinaria Italiana 2014, 50 (3), 203-212. doi: 10.12834/VetIt.2405.11

207

Sarvašová et al.

Orbivirus vectors in Slovakia

Table V. Relative abundance of the sibling species of the Obsoletus complex.

Locality

Date

Rozhanovce Rozhanovce Rozhanovce Rozhanovce Michalany Tulcik

13/05/2011 26/05/2011 02/06/2011 23/06/2011 25/05/2011 25/05/2011

N. of PCR C. obsoletus C. scoticus analysed F (%) (%) 21 13 (61.9) 8 (38.1) 19 1 (5.26) 18 (94.74) 22 4 (18.18) 18 (81.82) 21 16 (76.19) 5 (23.81) 21 18 (85.71) 3 (14.29) 21 17 (80.95) 4 (19.05)

F = females.

A total of 112 pools of parous and gravid females were prepared; 79 from the Obsoletus complex (n=2,233) and 33 from the Pulicaris complex (n=978).

When tested for BTV and EHDV, all pools resulted negative.

Discussion The lack of information about the Culicoides abundance and biology in the Slovak Republic and current situation in Culicoides-borne diseases in Europe are the reasons why we performed this entomological survey. The last entomological survey focused on Culicoides abundance in Slovakia was carried out in 1993-1994 in Western Slovakia (Mráz and Országh 1998). The most abundant species found in this study was C. obsoletus (87.94%‑88.33%) and the second one was C. punctatus (4.72%-7.36%). The species included in the Obsoletus complex (including C. obsoletus and C. scoticus) were similarly the predominant species captured at each trapping site, representing 40.96%-90.79% at Rozhanovce, 38.5% at Michalany, and 74.09% at Tulcik (Table II). The distribution of the Obsoletus complex is in accordance with the results observed by several authors (Ander et al.

2012, Balenghien et al. 2011, Mehlhorn et al. 2007, Purse et al. 2006, Romón et al. 2012) meaning that C. obsoletus/C. scoticus represents the dominant species of Culicoides recorded from throughout the Palaearctic region. The data from the neighbouring countries (Ukraine, Poland, Hungary) are not available, however the results from Austria confirm that the majority of Culicoides specimens belong to the Avaritia subgenus (89.3%), followed by the Culicoides subgenus (5.8%) and the Monoculicoides subgenus (0.8%) (Anderle et al. 2008). The relative abundances of these 3 subgenera in our study are comparable: the abundance of the Pulicaris complex (subgenus Culicoides) ranged from 6.14% to 19.76% at Rozhanovce, 29.16% at Michalany and 19.28% at Tulcik (Table II); the Nubeculosus complex (subgenus Monoculicoides) resulted

208

absent at the forested site of Rozhanovce, very low abundant north in Tulcik (0.11%) and presented in higher abundance only in south-eastern Slovakia, in Michalany (6.47%) (Table II).

As we expected, Culicoides imicola, the most important Culicoides vector species in the Mediterranean basin, was not found in our sampling.

Since wild ruminants may serve as a reservoir for the BTV virus (Linden et al. 2008, Niedbalski and Kesy 2008, Ruiz-Fons et al. 2008), we included a farm with wild ruminants in this entomological survey. The aim was to find out the presence of potential vectors in the nature close to wild ruminants and compare the abundance of vectors with the abundance on the farms with domestic animals. The abundance of midges on the farms with domestic animals was 2.7‑fold higher in Tulcik and 5.4‑fold higher in Michalany, in comparison to the most abundant collection in Rozhanovce. This could be related to the proximity of the traps to the cattle, whereas the wild animals in Rozhanovce are not close to the traps.

Due to uncertainty of morphological characters of females, C. obsoletus and C. scoticus are usually determined as Obsoletus complex, but the vector competence for virus transmission is not identical.

Carpenter and colleagues (Carpenter et al. 2008) demonstrated in experimental infections using the BTV-8 and BTV-9 that C. scoticus was infected with 3 log10 higher virus titers than C. obsoletus. Similarly, Elbers and colleagues (Elbers et al. 2013) confirmed that in field caught Obsoletus complex, the rate of C. scoticus SBV positive females was higher than SBV positive C. obsoletus females (Elbers et al. 2013). On the other hand, in Belgium, the SBV was not detected in C. scoticus but only in C. obsoletus (De Regge et al.

2012) and in Italy, C. obsoletus resulted as the most abundant species of the Obsoletus complex in the area where the SBV circulated, and was positive to SBV (Goffredo, pers. obs.)

Results of the multiplex PCR identification based on the ITS-1 and the ITS-2 segments gave an estimation of the relative abundance of C. obsoletus and C. scoticus species in the three sampling sites in Slovakia. The two species were present in all sites, representing overall also the most abundant potential vectors of Culicoides-borne diseases in the study area. On the two farms with domestic animals, Tulcik and Michalany, C. obsoletus resulted largely as the most abundant species of the complex being identified in the 85.71 % and 80.95 % of the captured Culicoides, respectively. On the contrary, in Rozhanovce, C. scoticus was found more abundant (94.74%) in the same period (25th-26th May); however, its abundance varied during individual captures from 23.81% to 94.74% (Table V).

The analysis of the reasons causing such variations

Veterinaria Italiana 2014, 50 (3), 203-212. doi: 10.12834/VetIt.2405.11

Sarvašová et al.

can only be speculative; they could be ascribed to the different ecology of the Rozhanovce area, to the different animal species in the surrounding of the traps, or to different climatic conditions during various collection nights. More studies are needed for better understanding of these data, representing the first survey based on molecular methods in Slovakia.

The BT and the EHD are diseases caused by closely related viruses of the Orbivirus genus. Although no autochthonous outbreak of bluetongue was confirmed in the Slovak Republic, the presence of bluetongue antibodies was observed in Holstein heifers imported from France in August 2008 (Lacková et al. 2012). The occurrence of BT outbreaks in the Czech Republic and Hungary caused that a part of the Slovak area was lying in the restricted zones in 2008-2010. Serological testing in 10 sentinel animals on 100 farms has been carried out every month since April 2008, and entomological monitoring on 8 farms performed by the State Veterinary and Food Administration2. All 3 farms selected for this study were lying in restricted zones.

The EHD has not been reported in Europe yet, but it is unknown whether the virus is present in Europe causing subclinical infection or not (Savini et al.

2011). After experimental infection of the European Holstein cattle with EHDV-7 and EHDV-6 the cattle was productively infected, but caused no clinical signs (Batten et al. 2011, Eschbaumer et al. 2012). The EHDV has been associated with the disease in wild cervids (Kastard et al. 1961). In recent years, however, clinical cases due to EHDV-6 or EHDV-7 infections were reported in cattle in Israel in the autumn of 2006 (Yadin et al. 2008), and in Turkey in 2007 (Temizel et al. 2009). No clinical signs were observed in wild and domestic small ruminants (Kedmi et al. 2011).

Since the infection of wild ruminants with the BTV

2

Orbivirus vectors in Slovakia

is frequently asymptomatic (Falconi et al. 2011) and similarly the EHDV infection may be asymptomatic, 3,211 parous and gravid females of Obsoletus and Pulicaris complexes collected in this study were tested for BTV and EHDV. No BTV or EHDV RNA was detected in any of the tested samples.

Conclusions Considering the current situation of Culicoides-borne diseases in Europe and the scanty information about Culicoides in Slovakia, further research is required to understand the ecology of the midges and the potential spread of pathogens.

The study highlights the presence of Culicoides vectors in Slovakia and the abundance of competent species, such as C. obsoletus and C. scoticus, in proximity of wild and domestic ruminants. These vectors are able to transmit viruses presently circulating in Europe, such as BTV and SBV. However, the abundance of midges can change in space and time, and subsequently the risk of Culicoides-borne diseases spread changes; therefore a survey with longer duration should be implemented in Slovakia.

Acknowledgements This research was supported by the grant VEGA No. 1/0236/12, basic research of the National Referential Laboratory for Pesticides of the University of Veterinary Medicine and execution of the Project ‘Centre of Excellence for Parasitology’ (ITMS code: 26220120022) upon the support of the operation program Research and Development, financed by the European Regional Development Fund (part 0.5).

S tate Veterinary and Food Administration. 2012. Plán prieskumu (surveillance) katarálnej horúčky oviec (Bluetongue) v Slovenskej republike pre rok 2012. http://www.svps.sk/dokumenty/zvierata/BT2012.pdf.

Veterinaria Italiana 2014, 50 (3), 203-212. doi: 10.12834/VetIt.2405.11

209

Orbivirus vectors in Slovakia

Sarvašová et al.

References Ander M., Meiswinkel R. & Chirico J. 2012. Seasonal dynamics of biting midges (Diptera: Ceratopogonidae: Culicoides), the potential vectors of bluetongue virus, in Sweden. Vet Parasitol, 184, 59-67.

Anderle F., Sehnal P., Schneemann Y., Schindler M., Wöss G. & Marschler M. 2008. Culicoides surveillance in Austria (Diptera: Ceratopogonidae) – a snap-shot 2008.

Beiträge zur Entomofaunistik, 9, 67-79.

Augot D., Sauvage F., Jouet D., Simphal E., Veuille M., Couloux A., Kaltenbach M.L. & Depaquit J. 2010. Discrimination of Culicoides obsoletus and Culicoides scoticus, potential bluetongue vectors, by morphometrical and mitochondrial cytochrome oxidase subunit I analysis.

Infect Genet Evol, 10, 629-637.

Balenghien T., Delécolle J.C., Setier-Rio M.L., Rakotoarivoany I., Allène X., Venail R., Delécolle D., Lhoir J., Gardès L., Chavernac D., Mathieu B., Languille J., Baldet T. & Garros C. 2011. Bluetongue - report on entomological surveillance in France in 2010. Bulletin épidémiologique, santé animale et alimentation (Special Contagious Diseases), 46, 26-31.

Batten C.A., Edwards L., Bin-Tarif A., Henstock M.R. & Oura C.A.L. 2011. Infection kinetics of Epizootic Haemorrhagic Disease virus serotype 6 in HolsteinFriesian cattle. Vet Microbiol, 154, 23-28.

Campbell J.A. & Pelham-Clinton E.C. 1960. A taxonomic review of the british species of Culicoides Latreille (Diptera: Ceratopogonidae). Proceedings of the Royal Society of Edinburgh. Section B. Biology, 68, 181-302.

Caracappa S., Torina A., Guercio A., Vitale F., Calabro A., Purpari G., Ferrantelli V., Vitale M. & Mellor P.S. 2003.

Identification of a novel bluetongue virus vector species of Culicoides in Sicily. Vet Rec, 153, 71-74.

Carpenter S., McArthur C., Selby R., Ward R., Nolan D. V., Luntz A.J., Dallas J.F., Tripet F. & Mellor P.S. 2008.

Experimental infection studies of UK Culicoides species midges with bluetongue virus serotypes 8 and 9. Vet Rec, 163, 589-592.

Carpenter S., Wilson A. & Mellor P.S. 2009. Culicoides and the emergence of bluetongue virus in northern Europe.

Trends Microbiol, 17, 172-178.

Cêtre-Sossah C., Baldet T., Delécolle J.C., Mathieu B., Perrin A., Grillet C. & Albina E. 2004. Molecular detection of Culicoides spp. and Culicoides imicola, the main vector of bluetongue and African horse sickness in Africa and Europe, by ITS1 rDNA PCR amplification. Vet Res, 35, 325-337.

Clavijo A., Sun F., Lester T., Jasperson D.C. & Wilson W. C. 2010. An improved real-time polymerase chain reaction for the simultaneous detection of all serotypes of Epizootic hemorrhagic disease virus. J Vet Diagn Invest, 22(4), 588-593.

De Liberato C., Scavia G., Lorenzetti R., Scaramozzino P., Amaddeo D., Cardeti G., Scicluna M. & Ferrari G. 2005. Identification of Culicoides obsoletus (Diptera: Ceratopogonidae) as a vector of bluetongue virus in central Italy. Vet Rec, 156, 301-304.

210

De Regge N., Deblauwe I., De Deken R., Vantieghem P., Madder M., Geysen D., Smeets F., Losson B., van den Berg T. & Cay A.B. 2012. Detection of Schmallenberg virus in different Culicoides spp. by real-time RT-PCR. Transbound Emerg Dis, 59, 471-475.

Delécolle J.C. 1985. Nouvelle contribution à l'étude systématique et iconographique des espèces du genre Culicoides (Diptera : Ceratopogonidae) du NordEst de la France. Thesis, Université Louis Pasteur de Strasbourg, 229 pp.

Dijkstra E., van der Ven I.J., Meiswinkel R., Holzel D.R. & Van Rijn P.A. 2008. Culicoides chiopterus as a potential vector of bluetongue virus in Europe. Vet Rec, 162, 422.

Dyce A.L. 1969. The recognition of nulliparous and parous Culicoides (Diptera: Ceratopogonidae) without dissection. Australian Journal of Entomology, 8, 11-15.

Elbers A.R.W., Meiswinkel R., van Weezep E., Sloet van Oldruitenborgh-Oosterbaan M.M. & Kooi E.A. 2013.

Schmallenberg virus in Culicoides spp. biting midges, the Netherlands, 2011. Emerg Infect Dis, 19, 106-109. http://dx.doi.org/10.3201/eid1901.121054.

Eschbaumer M., Wernike K., Batten C.A., Savini G., Edwards L., Di Gennaro A., Teodori L., Oura C.A.L., Beer M. & Hoffmann B. 2012. Epizootic hemorrhagic disease virus serotype 7 in European cattle and sheep: Diagnostic considerations and effect of previous BTV exposure. Vet Microbiol, 159, 298-306.

European Food Safety Authority (EFSA) EFSA Panel on Animal Health and Welfare (AHAW). 2009. Scientific Opinion on Epizootic Hemorrhagic Disease. EFSA Journal, 7(12), 1418. doi:10.2903/j.efsa.2009.1418.

Falconi C., Lopez-Olvera J.R. & Gortazar C. 2011. BTV infection in wild ruminants, with emphasis on red deer: A review. Vet Microbiol, 151, 209-219.

Goffredo M. & Meiswinkel R. 2004. Entomological surveillance of bluetongue in Italy: methods of capture, catch analysis and identification of Culicoides biting midges. Vet Ital, 40, 260-265.

Gomulski L.M., Meiswinkel R., Delécolle J.C., Goffredo M. & Gasperi G. 2005. Phylogenetic relationships of the subgenus Avaritia Fox, 1955 including Culicoides obsoletus (Diptera: Ceratopogonidae) in Italy based on internal transcribed spacer 2 ribosomal DNA sequences. Systematic Entomology, 30, 619-631.

Hoffmann B., Bauer B., Bauer C., Batza H.J., Beer M., Clausen P.H., Geier M., Gethmann J.M., Kiel E., Liebisch G., Liebisch A., Mehlhorn H., Schaub G.A., Werner D. & Conraths F.J. 2009. Monitoring of putative vectors of bluetongue virus serotype 8, Germany. Emerg Infect Dis, 15, 1481-1484. http://wwwnc.cdc.gov/eid/ article/15/9/09-0562_article.

Hofmann M., Griot C., Chaignat V., Perler L. & Thür B. 2008.

Bluetongue disease reaches Switzerland. Schweiz Arch Tierheilkd, 150(2), 49-56.

Kastard L., Winter A. & Trainer D.O. 1961 Pathology of epizootic hemorrhagic disease of deer. Am J Vet Res, 22, 227-230.

Veterinaria Italiana 2014, 50 (3), 203-212. doi: 10.12834/VetIt.2405.11

Sarvašová et al.

Kedmi M., Levi S., Galon N., Bomborov V., Yadin H., Batten C. & Klement E. 2011. No evidence for involvement of sheep in the epidemiology of cattle virulent epizootic hemorrhagic disease virus. Vet Microbiol, 148, 408-412.

Lacková Z., Bíreš J., Smaržik M. & Tinák M. 2012. Clinical and laboratory picture in calves in rearing with incidence Bluetongue. The Open Agriculture Journal, 6, 74-78.

Lehmann K., Werner D., Hoffmann B. & Kampen H. 2012.

PCR identification of culicoid biting midges (Diptera, Ceratopogonidae) of the Obsoletus complex including putative vectors of bluetongue and Schmallenberg viruses. Parasites & Vectors, 26, 213. doi: 10.1186/1756-3305-5-213.

Linden A., Mousset B., Grégoire F., Hanrez D., Vandenbussche F., Vandemeulebroucke E., Vanbinst T., Verheyden B. & de Clerck K. 2008. Bluetongue virus antibodies in wild red deer in southern Belgium. Vet Rec, 162, 459.

Mathieu B., Delécolle J.-C., Garros C., Balenghien T., Setier-Rio M.-L., Candolfi E. & Cêtre-Sossah C. 2011. Simultaneous quantification of the relative abundance of species complex members: Application to Culicoides obsoletus and Culicoides scoticus (Diptera: Ceratopogonidae), potential vectors of bluetongue virus. Vet Parasitol, 182, 297-306.

Mathieu B., Perrin A., Baldet T., Delécolle J.C., Albina E. & Cêtre-Sossah C. 2007. Molecular identification of Western European species of Obsoletus Complex (Diptera: Ceratopogonidae) by internal transcribed spacer-1 rDNA Multiplex Polymerase Chain Reaction Assay. J Med Entomol, 44, 1019-1025.

Mehlhorn H., Walldorf V., Klimpel S., Jahn B., Jaeger F., Eschweiler J., Hoffmann B. & Beer M. 2007. First occurrence of Culicoides obsoletus-transmitted Bluetongue virus epidemic in Central Europe. Parasitol Res, 101, 219-228.

Meiswinkel R., Gomulski L. M., Delécolle J.-C., Goffredo M. & Gasperi G. 2004. The taxonomy of Culicoides vector complexes - unfinished business. Vet Ital, 40, 151-159.

Meiswinkel R., van Rijn P., Leijs P. & Goffredo M. 2007.

Potential new Culicoides vector of bluetongue virus in northern Europe. Vet Rec, 161, 564-565.

Orbivirus vectors in Slovakia

C. & Nunez J.I. 2009. Identification of cryptic species of Culicoides (Diptera: Ceratopogonidae) in the subgenus Culicoides and development of speciesspecific PCR assays based on barcode regions. Vet Parasitol, 165, 298-310.

Pagès N. & Sarto I Monteys V. 2005. Differentiation of Culicoides obsoletus and Culicoides scoticus (Diptera: Ceratopogonidae) based on Mitochondrial Cytochrome Oxidase Subunit I. J Med Entomol, 42, 1026-1034.

Paweska J.T., Venter G.J. & Mellor P.S. 2002. Vector competence of South African Culicoides species for bluetongue virus serotype 1 (BTV-1) with special reference to the effect of temperature on the rate of virus replication in C. imicola and C. bolitinos. Med Vet Entomol, 16, 10-21.

Purse B.V., Nedelchev N., Georgiev G., Veleva E., Boorman J., Denison E., Veronesi E., Carpenter S., Baylis M. & Mellor P.S. 2006. Spatial and temporal distribution of bluetongue and its Culicoides vectors in Bulgaria. Med Vet Entomol, 20, 335-344.

Romón P., Higuera M., Delecolle J.C., Baldet T., Aduriz G. & Goldarazena A. 2012. Phenology and attraction of potential Culicoides vectors of bluetongue virus in Basque Country (northern Spain). Vet Parasitol, 186, 415-424.

Ruiz-Fons F., Reyes-García A.R., Alcaide V. & Gortázar C. 2008. Spatial and temporal evolution of bluetongue virus in wild ruminants, Spain. Emerg Infect Dis, 14, 951‑953. doi: 10.3201/eid1406.071586 Savini G., Goffredo M., Monaco F., Di Gennaro A., de Santis P., Meiswinkel R. & Caporale V. 2004. The isolation of bluetongue virus from field populations of the Obsoletus Complex in central Italy. Vet Ital, 40, 286-291.

Savini G., Goffredo M., Monaco F., Di Gennaro A., Cafiero M. A., Baldi L., de Santis P., Meiwinkel R. & Caporale V. 2005.

Bluetongue virus isolations from midges belonging to the Obsoletus complex (Culicoides, Diptera: Ceratopogonidae) in Italy. Vet Rec, 157, 133-139.

Savini G., Afonso A., Mellor P., Aradaib I., Yadin H., Sanaa M., Wilson W., Monaco F. & Domingo M. 2011. Epizootic heamorragic disease. Res Vet Sci, 91, 1-17.

Mellor P.S. & Pitzolis G. 1979. Observations on breeding sites and lighttrap collections of Culicoides during an outbreak of bluetongue in Cyprus. Bull Entomol Res, 69, 229-234.

Schwenkenbecher J.M., Mordue A.J., Switek K. & Piertney S.B. 2009. Discrimination of Culicoides midges larvae using multiplex polymerase chain reaktion assays based on DNA sequence variation at the mitochondrial cytochrome C oxidase I gene. J Med Entomol, 46, 610-614.

Mráz R. & Országh I. 1998. Biting midges of the genus Culicoides (Diptera, Ceratopogonidae) collected by light trap on the right bank of the Danube in Bratislava (Slovakia). Biologia, 53, 239-246.

Temizel E.M., Yesilbag K., Batten C., Senturk S., Maan N. S., Mertens P.P.C. & Batmaz H. 2009. Epizootic Hemorrhagic Disease in Cattle, Western Turkey. Emerg Infect Dis, 15, 317-319. doi: 10.3201/eid1502.080572.

Niedbalski W. & Kesy A. 2008. Seroprevalence of antibodies against bluetongue virus in animals imported to Poland from EU countries. Pol J Vet Sci, 11, 205-208.

Vanbinst T., Vandenbussche F., Vandemeulebroucke E., De Leeuw I., Deblauwe I., De Deken G., Madder M., Haubruge E., Losson B. & De Clercq K. 2009. Bluetongue virus detection by real-time RT-PCR in Culicoides captured during the 2006 epizootic in Belgium and development of an internal control. Transbound Emerg Dis, 56, 170-177.

Nolan D.V., Carpenter S., Barber J., Mellor P.S., Dallas J.F., Mordue Luntz A.J. & Piertney S.B. 2007. Rapid diagnostic PCR assays for members of the Culicoides obsoletus and Culicoides pulicaris species complexes, implicated vectors of bluetongue virus in Europe. Vet Microbiol, 124, 82-94.

Pagès N., Munoz-Munoz F., Talavera S., Sarto V., Lorca

Veterinaria Italiana 2014, 50 (3), 203-212. doi: 10.12834/VetIt.2405.11

Venter G.J., Paweska J.T., Van Dijk A.A., Mellor P.S. & Tabachnick W.J. 1998. Vector competence of Culicoides bolitinos and C. imicola (Diptera: Ceratopogonidae) of

211

Orbivirus vectors in Slovakia

South African bluetongue virus serotypes 1, 3 and 4.

Med Vet Entomol, 12, 101-108.

Wilson A. & Mellor P. 2009. Bluetongue in Europe: vectors, epidemiology and climate change. Parasitol Res, 103, 69-77.

212

SarvaĹĄovĂĄ et al.

Yadin H., Brennen J., Bumbrov V., Oved Z., Stram Y., Klement E., Perl S., Anthony S., Maan S., Batten C. & Mertens P.P. 2008. Epizootic haemorrhagic disease virus type 7 infection in cattle in Israel. Vet Rec, 162, 53-56.

Veterinaria Italiana 2014, 50 (3), 203-212. doi: 10.12834/VetIt.2405.11

Phylogenetic study on the 5'-untranslated region of bovine viral diarrhoea virus isolates from Iran Majid Esmaelizad1* & Rohani Kargar-Moakhar2 1

Genomics and Genetic Engineering Department, Razi Vaccine and Serum Research Institute, Alborz, Karaj, Iran 2 Virology Department, Razi Vaccine and Serum Research Institute Alborz, Karaj, Iran

* Corresponding author at: Genomics and Genetic Engineering Department, Razi Vaccine and Serum Research Institute, Alborz, Karaj, Iran.

Tel.: +98 34570038, e-mail: m.esmaelizad@rvsri.ac.ir.

Veterinaria Italiana 2014, 50 (3), 213-218. doi: 10.12834/VetIt.78.249.2 Accepted: 22.05.2014 | Available on line: 30.09.2014

Keywords 5'UTR, Bovine viral diarrhoea virus (BVDV), Exportation, Iran, Phylogenetic, Population genetic, Semen.

Summary Bovine viral diarrhoea virus is a pathogen of bovids associated with reproduction system, causing in infected animals a range of ailments, from abortion to congenital defects. In this article, the nucleotide structure of the 5'-untranslated region (5-UTR) from 7 Iranian bovine diarrhoea virus (BVDV) isolates was characterized and subjected to comparative analysis against a panel of BVDV isolates from different sources. To this end, a 288 bp-long stretch of the internal ribosome entry site was amplified by RT-PCR. The PCR products subsequently cloned into PTZ57T vector and sequenced using T7 promoter primers. This resulted in detection of 3 new point mutations GA and GT in 2 isolates. When these findings were phylogenetically assessed, all the examined Iranian isolates were deemed to belong to the type1 of BVDV. Besides, 2 subtypes were identified among these isolates. In group A, a high level of similarity (99.2%) between Iranian isolates with a cytopathic Australian strain of BVDV-1c was detected; while in group B, the 4 Iranian isolates proved to be very similar to NADL-like BVDV-1a strains. We believe that the surprisingly high level of similarity between group A Iranian isolates and their corresponding Australian strain is likely to be an indication of a shared common ancestor. If correct, the most likely explanation of this observation is the introduction of such strains from Australia to Iran, possibly through exportation of infected live animals or animal productions (e.g. semen and meat) at some points in the past. Nevertheless, this hypothesis remains to be proved as further epidemiological work at genomic level is required to understand population of BVDV in Iran.

Studio filogenetico della struttura genomica di 5'-untranslated region di ceppi del virus della diarrea virale bovina in Iran Parole chiave 5'-UTR, Esportazione, Filogenetica, Genetica di popolazione, Iran, Sperma, Virus della diarrea virale bovina (BVDV).

Riassunto Il virus della diarrea virale bovina (BVDV) è un agente patogeno dei bovini associato alla riproduzione. Negli animali infetti si osservano aborto e difetti congeniti. Questo studio ha riguardato la caratterizzazione della struttura nucleotidica di 5'-untranslated region (5'‑UTR) di 7 isolati iraniani di DVBV e l’analisi comparativa degli stessi con altri isolati di BVDV. A questo scopo, una porzione di 288 bp della parte interna del ribosoma è stata amplificata mediante RT-PCR. I prodotti ottenuti sono stati successivamente clonati in un vettore PTZ57T e quindi sequenziati usando T7 promoter primer. Questo processo ha portato all’identificazione di 3 nuovi punti di mutazione GA and GT in 2 ceppi.

L’analisi filogenetica dei risultati ha mostrato l’appartenenza di tutti i ceppi di BVDV iraniani al tipo 1. Tra questi, sono stati identificati 2 sottotipi, gruppo A e gruppo B. Gli isolati iraniani appartenenti al gruppo A hanno mostrato un’alta similarità (99,2%) con il ceppo australiano citopatico di BVDV‑1c. Nel gruppo B, 4 isolati iraniani sono risultati molto simili ai ceppi NADL e BVDV-1a. L’alta similarità degli isolati iraniani appartenenti al gruppo A con i ceppi australiani è, probabilmente, indicativa dell’origine comune dei due ceppi. In questo caso, è plausibile ipotizzare che ceppi australiani del virus siano stati introdotti in Iran con l’importazione di animali o prodotti come carne e sperma. Quest’ipotesi, ancora da confermare, richiede ulteriori studi epidemiologici e genetici allo scopo di acquisire una comprensione esaustiva della popolazione genetica del BVDV in Iran.

213

Esmaelizad et al.

Bovine viral diarrhoea virus in Iran

Introduction

RNA extraction

Bovine viral diarrhoea virus (BVDV) is a pathogen of cattle associated with reproductive defects (Baker 1990). This virus is a Pestivirus carrying a positive‑stranded RNA and it belongs to family Faviviridae (Poole et al. 1995). To these days, 3 types of BVDV have been identified, namely: BVDV‑1, BVDV‑2 and HoBi-like BVDV‑3. Further, 2 biotypes of BVDV including cytopathic (cp) and non‑cytopathic (ncp) types have been characterized, their co‑existence has also been frequently reported in in vitro observations (Moennig and Plagemann 1992), HoBi‑like viruses BVDV-3 have been initially described in 2004 in Europe, Brazil and Australia (Peletto et al. 2012, Schirrmeier et al. 2004, Stalder et al. 2005, Xia et al. 2011, Xia et al. 2013). The BVDV genome is about 12 kb long with 2 untranslated regions (UTRs) at the 5' and 3' ends and a single open reading frame (Meyers and Thiel 1996). The 5'UTR fragment is known to be the most conserved region of the virus genome (De Moerlooze et al.

1993). It has a highly structured internal ribosome entry site (IRES) (Poole et al. 1995, Chon et al. 1998, Le et al. 1998), which is involved in the regulation of replication and gene expression (Becher et al. 2000, Yu et al. 2000). A number of virulence markers have been characterized in 5'UTR region of BVDV genome (Topliff and Kelling 1998). There are a number of convincing evidences to implicate the 5'UTR in tropism and pathogenesis of both picornaviruses and hepaciviruses (Funkhouser et al. 1999, Lerat et al. 2000, Nakajima et al. 1996). The 5'UTR is a frequently-used locus in taxonomical and epidemiological studies (Baule et al. 1997, Harasawa and Giangaspero 1998, Hofmann et al. 1994, Pringle 1999, Sakoda et al. 1999). This article describes the genotyping and phylogenetic analysis of BVDV isolates from Iran, with a focus on genomic structure of the virus 5'UTR region.

Viral RNA was extracted from transfected and noninfected cells using an RNX reagent (Cinnagen, Iran). In brief, cells were centrifuged at 85,000×g at 4 °C for 2 hours. They were then re-suspended in 200 ml of PBS and 400 ml of RNX reagent was subsequently added. This cocktail was mixed throughly and incubated at room temperature for 5 minutes. Extraction was done with 0.2 ml chloroform/isoamylalcohol (24:1). The total RNA, in the aqueous solution, was precipitated by adding an equal volume of isopropanol. This mixture was subsequently centrifuged at 10,000×g for 20 minutes. The RNA pellet was washed by 75% ethanol and re-dissolved in 20 ml of RNase-free water.

Materials and methods Virus isolation from clinical specimens Blood specimens from 7 Holstein-Friesian calves bearing symptoms to arouse clinical suspicion of BVDV infection (high fever of 41-42 °C along with dysentery) were collected from Tehran province. All specimens were processed and cultured in MDBK cell line (Razi institute, Iran) as described elsewhere (Becher et al. 2000). The cells were maintained in Dulbecco’s Modified Eagle’s Medium (DMEM) (GIBCO, San Francisco, California, USA) supplemented with 10% FCS serum (SIGMA-ALDRICH, Munich, Germany), 100 µg/m streptomycin and 100 U/ml penicillin, 5% CO2 at 37 °C for 72 hours.

214

RT-PCR amplification of 5'UTR fragment A conventional RT-PCR, using universal pestiviruses BVF (5'-cat gcc cat agt agg act agc-3') and BVR (5'- tca act cca tgt gcc atg tac-3') primers, was conducted to amplify a 288 bp-long fragment of internal ribosome entry site of 5'UTR locus of BVDV. At the second step, 2 pairs of primers the Table I. Accession numbers, types and origins of 5'UTR sequences of BVDVs used in alignment.

Accession no.

AJ133739 AY763004 AJ312930 AJ312931 U65031 AB078952 D50826 Z79781 Z79780 L32878 AB003621 AB003622 AB003620 U18059 U97427 AB014339 U97426 U97428 U97429 JN703311.1 KC544256.1 DQ897641.1 HQ403056.1

Type/Origin NADL Non-cytopathic VR991 Australia Ireland Ireland Sweden -Ovine BVDV1 Japan Japan Germany Germany Canada - strain C1 BVDV-2 Japan BVDV-2 Japan BVDV-2 Japan BVDV-2 USA M139B/91-South Africa BVDV-1 Italy Southern Africa M140B Southern Africa M1515 Southern Africa BVDV-3 Italy 280/11-A BVDV-3 Brazil LPV-WR/BR11 BVDV-3 Thailand khonkaen BVDV-3 Australia

Veterinaria Italiana 2014, 50 (3), 213-218. doi: 10.12834/VetIt.78.249.2

Esmaelizad et al.

optimized 50 ml RT‑PCR mixture contained 10 ml of 5X reaction buffer, 4 ml of dNTPs (2.5 mM each), 1 ml of AMV enzyme (Titan one tube RT-PCR system kit, Roche Diagnostic, Mannheim, Germany), 1 ml (10 rmol) of each primer, 4 ml of RNA template, 2.5 ml of DTT, 3 ml of MgCl2 (25mM), and 23.5 ml of PCR water. RT-PCR conditions comprised a single cycle of 42 °C for 30 minutes, followed by 94 °C for 3 minutes, plus 30 cycles of 94 °C for 30 seconds, 52 °C for 30 seconds, and 72 °C for 40 seconds, followed by a final extention step of 72 °C for 5 minutes. For negative control, DNA templates obtained from non‑infected cell culture were used accordingly. In order to identify type 1 and type 2 of BVDV, a second PCR was conducted using BVDV1f (5'-ggtagc aac agt ggt gag-3') and BVDV1r (5'-gta gca ata cag tgg gcc-3'), specific for type 1 along with BVDV2f (5'act agc ggt agc agt gag-3') and BVDV2r specific for type 2. In this PCR protocol, a typical BVDV type1 is expected to produce a 288 bp‑long amplicon; while amplification of a BVDV type 2 produces a 225 bp‑long product.

Bovine viral diarrhoea virus in Iran

Cloning and sequencing of PCR products For ligation, the reaction contained 0.165µg of plasmid pTZ57T, 100 Ng of purified PCR fragment, 3 µl 10X ligation buffer, 1 µl PEG 4000, 5 units of T4 DNA ligase and deionized water to make up the final volume of 30 µl. The ligation reactions were incubated at 22 °C for 16 hours and transformed into XL1-blue cells. The white colony selected by LcZ genetically marker according to the method of Sambrook. The recombinant plasmid was purified by purification kit (Roche Diagnostic, Mannheim, Germany). For sequencing of the PCR products, the dideoxy method was employed, the sequencing itself was conducted by the collaborating laboratory, MWG (Ebersberg, Germany) using T7 promoter primer in both the forward and reverse directions. Compilation and analysis of obtained sequences was performed using the MegAlign program (DNASTAR Inc., Madison, USA).

Figure 1. Multiple alignment of different types of BVDV and Iranian isolates based on 5'UTR sequences.

Veterinaria Italiana 2014, 50 (3), 213-218. doi: 10.12834/VetIt.78.249.2

215

Esmaelizad et al.

Bovine viral diarrhoea virus in Iran

2 Irish isolates. Six of the 9 SNPs, C109, T136, C150, G189, A199, G249 were identically shared by both Iranian subtype A and Australian isolates. A comparative SNP analysis of Iranian isolates with their matching isolates in GenBank, resulted in detection of 3 novel polymorphism in 2 of the Iranian isolates. The isolate carried 2 novel points mutation (GA) at nucleotide positions 52 and 175 (Figure 1). Moreover, in isolate Ir03, another GT at nucleotide position 134 (Figure 1).

Phylogenetic analysis Figure 2. Phylogenetic tree designed by MegAlign software based on 5'UTR sequences of BVDV.

Phylogenetic analysis For multiple alignment of the obtained sequences Clustal V method was used. This was conducted

by MegAlign program. Similarly, calculation of distance matrices as well as generation of the phylogenetic tree was performed by the same software, where the neighborhood joining method was endorsed for the analysis of both the distance and alignment data.

Results Amplification of BVDV-1- specific locus of 5’ UTR using BVF1 and BVR1 primers was successful for all of the blood specimens. No amplicon was observed in non-infected cell cultures. Multiple alignment of sequences from 7 Iranian studied isolates along with 23 more strains (Table I) from around the world resulted in detection of 13 Specific Nucleotide Patterns (SNP) in 5' UTR region of BVDV isolates subtype A10, T17, CCC55‑59, A62, A70, Y74, R75, T80, G95, W115, A117. Nine specific nucleotide patterns in all sequences of BVDV-2 at nucleotide positions T36, A58, G71, T76, A94, A169, R205, T219 and T250 were identified (Figure 1). Surprisingly, at nucleotide position 213 a unique SNP (G213) was characterized in Iranian isolates belonged to group A and an AustralianVR991 isolate (Figure 2). Similarly, an identical SNP was identified at each of the nucleotide positions 54, 71, 100 and 114, mutually shared by group A Iranian isolates and the Australian-VR991 isolate (Figure 2).

Four Iranian isolates (Ir01, Ir02, Ir03 and Ir04) hold 5 specific SNPs including T95, C105, A113, TA121-122, G127 (Figure 1). The other Iranian isolates of Ir05, Ir06 and Ir07, represented 9 SNPs at positions G93, C109, T136, C150, G189, A199, G249, T\C283, A287 (Figure 1), all these SNPs also existed in a cytopathic Australian and in

216

The generated phylogram based on nucleotide structure of the 5' untranslated region of BVDVs classified all the isolates into 2 lineages (Figure 2): BVDV 1 isolates stood alone in a single lineage; while both BVDV-2 and HoBi-like BVDV-3 isolates were co-located in another lineage. The largest observed genomic divergence level was as high as 17% detected among the BVDV-1, BVDV-2 and BVDV-3 HoBi like isolates. The study panel included 30 isolates, 7 Iranian and 23 from around the world.

All the Iranians isolates were classified into lineage 1 under 2 groups: group A holding 3 Iranian isolates (Ir-06, Ir-05 and Ir-07) and a single Australian BVDV‑2 isolate (AY763004), the remaining Iranian isolates (IR-01, Ir-02, Ir-03 and Ir-04) along with a Japanese NADL-non cytopathic isolate (AJ133739) were gathered in group B. No lineage 2 Iranian isolate was identified.

Discussion This work pioneers in population genetic study of BVDV in Iran, BVDV infected bulls have the potential to transmit the infection through breeding and also shed the virus through the semen. The very high genomic similarity observed between Iranian and Australian BVDV isolates might be an indication of epidemiological link between the 2 sets of isolates.

Australia has been one of the major cattle and also bovine semen exporting countries to Iran over the last 30 years. We assume this cattle-farming activity might have played a role in introduction of BVDV to the Iranian cattle herd, but this needs to be investigated through more epidemiological studies.

Besides, a high level of genomic similarity was detected between 2 Iranian isolates (Ir-03 and Ir-04) and a Japanese NADL strain as all the 3 carried 3 new points of mutations in their genomes.

BVDV has the capability to cross placenta and infect fetus. Persistent infected (PI) calves with BVDV are known to shed virus and infect susceptible animals (Pringle 1999). In those PI calves that mature, at some stages, a non cytopathotic infection, might spontaneously turn to a cytopathic infection

Veterinaria Italiana 2014, 50 (3), 213-218. doi: 10.12834/VetIt.78.249.2

Esmaelizad et al.

resulting in the onset of fatal mucosal disease (Brownlie et al. 1984, Meyers et al. 1991, Meyers and Thiel 1996).

The findings of the present work can help veterinary authorities to consider BVD as an emerging transboundary transmissible disease in the Iranian environment with practical measures required to control it.

Bovine viral diarrhoea virus in Iran

Acknowledgments This work was funded with the State funds from Razi Vaccine and Serum Research Institute (RVSRI) under grant number 82-0411231000-01. We would like to express our gratitude to the technical staff at Virology Department for their assistance in preparation and culture of blood specimens. We are grateful to Mr Keyvan Tadayon for his help in revising the manuscript.

References Baule C., van Vuuren M., Lowings J.P. & Belák S. 1997.

Genetic heterogeneity of bovine viral diarrhoea viruses isolated in Southern Africa. Virus Res, 52, 205-220.

virus by reverse transcription-polymerase chain amplification of the 5' untranslated region. Vet Microbiol, 64, 155-167.

Baker J.C. 1990. Clinical aspects of bovine virus diarrhoea virus infection. Rev Sci Tech OIE, 9, 25-41.

Meyers G., Tautz N., Dubovi E.J. & Thiel H.J. 1991. Viral cytopathogenicity correlated with integration of ubiquitin-coding sequences. Virol, 180(2), 602-616.

Brownlie J., Clarke M.C., Howard C.J. 1984. Experimental production of fatal mucosal disease in cattle. Vet Rec, 114(22), 535-536.

Becher P., Orlich M. & Thiel H.J. 2000. Mutations in the 5' nontranslated region of bovine viral diarrhea virus result in altered growth characteristics. J Virol, 74, 7884‑7894.

Chon S.K., Perez D.R. & Donis R.O. 1998. Genetic analysis of the internal ribosome entry segment of bovine viral diarrhea virus. Virol, 251, 370-382.

De Moerlooze L., Lecomte C., Brown-Shimmer S., Schmetz D., Guiot C., Vandenbergh D., Allaer D., Rossius M., Chappuis G., Dina D., Renard A. & Martial J.A. 1993.

Nucleotide sequence of the bovine viral diarrhoea virus Osloss strain: comparison with related viruses and identification of specific DNA probes in the 5' untranslated region. J Gen Virol, 74, 1433-1438.

Funkhouser A.W., Schultz D.E., Lemon S.M., Purcell R.H. & Emerson S.U. 1999. Hepatitis A virus translation is rate‑limiting for virus replication in MRC-5 cells. Virol, 254, 268-278.

Meyers G. & Thiel H.J. 1996. Molecular characterization of Pestiviruses. Adv Virus Res, 47, 53-118.

Moennig V. & Plagemann P.G. 1992. The pestiviruses. Adv Virus Res, 41, 53-98.

Nakajima N.M., Hijikata M., Yoshikura H. & Shimizu Y.K. 1996. Characterization of long term cultures of hepatitis C virus. J Virol, 70, 3325-3329.

Peletto S., Zuccon F. & Pitti M. 2012. Detection and phylogenetic analysis of an atypical pestivirus, strain IZSPLV_To. Res Vet Sci, 92, 147-150.

Poole T.L., Wang C., Popp R.A., Potgieter L.N.D., Siddiqui A. & Colett M.S. 1995. Pestivirus translation occurs by internal ribosome entry. Virol, 206, 750-754.

Pringle C. 1999. Virus taxonomy 1999. The universal system of virus taxonomy, updated to include the new proposals ratified by the International Committee on Taxonomy of Viruses during 1998. Arch Virol, 144, 421‑429.

Roeder P.L. & Harkness J.W. 1986. BVD virus infection: prospects for control. Vet Rec, 118(6), 143-147.

Harasawa R. & Giangaspero M. 1998. A novel method for pestivirus genotyping based on palindromic nucleotide substitutions in the 5'-untranslated region.

J Virol Methods, 70, 225-230.

Sakoda Y., Ozawa S., Damrongwatanapokin S., Sato M., Ishikawa K. & Fukusho A. 1999. Genetic heterogeneity of porcine and ruminant pestiviruses mainly isolated in Japan. Vet Microbiol, 65, 75-86.

Hofmann M.A., Brechtbühl K. & Stäuber N. 1994.

Rapid characterization of new pestivirus strains by direct sequencing of PCR-amplified cDNA from the 5'-noncoding region. Arch Virol, 139, 217-229.

Schirrmeier H., Strebelow G., Depner K., Hoffmann B., Beer M. 2004. Genetic and antigenic characterization of an atypical pestivirus isolate, a putative member of a novel pestivirus species. J Gen Virol, 85, 3647-3652.

Le S.Y., Liu W.M. & Maizel Jr. 1998. Phylogenetic evidence for the improved RNA higher-order structure in internal ribosome entry sequences of HCV and pestiviruses.

Virus Genes, 17, 279-295.

Stalder H.P., Meier P., Pfaffen G., Wageck-Canal C., Rufenacht J., Schaller P., Bachofen C., Marti S., Vogt H.R. & Peterhans E. 2005. Genetic heterogeneity of pestiviruses of ruminants in Switzerland. Prev Vet Med, 72, 37-41.

Lerat H., Shimizu Y.K. & Lemon S.M. 2000. Cell type-specific enhancement of hepatitis C virus internal ribosome entry site-directed translation due to 5' nontranslated region substitutions selected during passage of virus in lymphoblastoid cells. J Virol, 74, 7024-7031.

Letellier C., Kerkhofs P., Wellemans E. & Vanodenbosch E. 1999. Detection and genotyping of bovine diarrhea

Veterinaria Italiana 2014, 50 (3), 213-218. doi: 10.12834/VetIt.78.249.2

Topliff C.L. & Kelling C.L. 1998. Virulence markers in the 5' untranslated region of genotype 2 bovine viral diarrhea virus isolates. Virol, 250, 164-172.

Xia H., Larska M., Giammarioli M., De Mia G.M., Cardeti G., Zhou W., Alenius S., Belak S.M. & Liu L. 2013. Genetic detection and characterization of atypical bovine

217

Bovine viral diarrhoea virus in Iran

pestiviruses in foetal bovine sera claimed to be of Australian origin. Transbound Emerg Dis, 60(3), 284-288.

Xia H., Vijayaraghavan B., BelĂĄk S. & Liu L. 2011. Detection and identification of the atypical bovine pestiviruses in commercial foetal bovine serum batches. PLoS One, 6(12), e28553.

218

Esmaelizad et al.

Yu H., Isken O., Grassmann C.W. & Behrens S. 2000. A stemâ&#x20AC;&#x201C;loop motif formed by the immediate 5' terminus of the bovine viral diarrhea virus genome modulates translation as well as replication of the viral RNA. J Virol, 74, 5825-5835.

Veterinaria Italiana 2014, 50 (3), 213-218. doi: 10.12834/VetIt.78.249.2

SHORT COMMUNICATION First report of a variant bovine papillomavirus type 2 (BPV-2) in cattle in the Iberian Peninsula Clara Escudero1, Rocío Vázquez1, Ana Doménech2, Esperanza Gómez-Lucía2 & Laura Benítez1* 2

1 Department of Microbiology III, Biology Faculty, Universidad Complutense de Madrid, 28040 Madrid, Spain.

Department of Animal Health, Veterinary Faculty, Universidad Complutense de Madrid, 28040 Madrid, Spain.

* Corresponding author at: Department of Animal Health, Veterinary Faculty, Universidad Complutense de Madrid, 28040 Madrid, Spain.

Tel.: +34 91 3944963, fax: +34 913 944 964, e-mail: lbenitez@bio.ucm.es.

Veterinaria Italiana 2014, 50 (3), 219-226. doi: 10.12834/VetIt.248.836.4 Accepted: 14.08.2014 | Available on line: 30.09.2014

Keywords Bovine papillomavirus, BPV-2, L1, Rolling circle amplification, Spain.

Summary Infections caused by bovine papillomavirus (BPV) have been described worldwide.

Some types, like BPV-1 and BPV-2, have been reported in association with skin warts and fibropapillomas in cattle and sarcoids in equids. In this study we have investigated the presence of BPV in cutaneous warts isolated from a steer in Spain. Cutaneous fibropapillomatosis was confirmed by histopathological analysis. Complete genome was amplified by multiple-primed rolling circle and the L1, E5 and E6 genes were sequenced.

The isolate was classified as a variant of BPV-2 on the basis of the L1 gene sequences.

Genetic variability of L1, E5 and E6 genes was compared with BPV-2 isolates from different hosts in several continents. Some mutations involved non-synonymous substitutions when compared to the prototype strain. One of these non-conservative mutations was located in the jelly roll β-barrel of the EF loop of the capsid protein (encoded by L1). This study presents the first report of a variant of BPV-2 infection in the Iberian Peninsula and contributes to extend the knowledge of the spreading and circulation of BPV.

Primo report di una variante di Papillomavirus bovino tipo-2 (BPV-2) nella Penisola iberica Parole chiave BPV-2, Multiple-primed rollingcircle amplification (RCA), Papillovirus bovino (BPV), Spagna.

Riassunto Le infezioni causate da Papillomavirus bovino (BPV) sono state ampiamente descritte.

In particolare, le infezioni da BPV-1 e BVP-2 sono state associate a verruche della pelle e fibropapilloma nei bovini e sarcoidi negli equini. In questo studio è stata analizzata la presenza di BPV in verruche cutanee riscontrate in un bovino della Penisola iberica. La fibropapillomatosi cutanea è stata confermata dall’analisi istopatologica e il genoma completo è stato amplificato con metodica multiple-primed rolling-circle (RCA). I geni L1, E5 e E6 sono stati sequenziati. Il ceppo è stato classificato come variante di BPV-2 sulla base della sequenza del gene L1. Quando le sequenze dei geni L1, E5 ed E6 sono state confrontate con quelle omologhe di ceppi di BPV-2 isolati da ospiti diversi nei vari continenti, sono state evidenziate mutazioni dissenso rispetto al ceppo prototipo. Una di queste mutazioni non conservative è stata rilevata nel jelly roll β-barrel del loop EF della proteina del capside (codificata da L1). Questo studio, che rappresenta la prima relazione sull’infezione da una nuova variante di BPV-2 nella Penisola iberica, contribuisce ad aumentare le conoscenze sulla diffusione e circolazione di BPV.

219

New variant of BPV-2 in cattle in the Iberian Peninsula

The bovine papillomaviruses (BPV) are associated with skin warts in cattle that usually develop on the forehead, neck, upper chest and back (Borzacchiello and Roperto 2008). Bovine papillomaviruses are characterized by high viral diversity and to date 13 types have been recognized, BPV-1 to BPV-13, the latter has been described in 2013 (Lunardi et al.

2013). As in all other Papillomaviridae, the genome of BPV is circular and has up to 10 genes, which encode 8 early proteins (E1-E8), and 2 late proteins (L1 and L2). In addition, there is a long control region (LCR) between late (L1) and early (E6) genes.

220

Escudero et al.

Bovine papillomavirus types 1 and 2 can produce different manifestations as skin warts and fibropapillomas (Borzacchiello and Roperto 2008), placenta infections and bladder tumours in cattle (Roperto et al. 2012). The benign lesions like warts or fibropapillomas usually regress but they may also occasionally persist, leading to a high risk of evolution into cancer of both epithelial and mesenchymal origin, particularly in the presence of environmental carcinogenic co-factors (Borzacchiello and Roperto 2008).

Infections caused in cattle by BPV have been described worldwide, and the genotype BPV-2 is one of the most prevalent. It has been isolated from bovine cutaneous warts (CW) in Brazil (Silva et al. 2010, Carvalho et al. 2012, da Silva et al. 2012), India (Pangty et al. 2010), Japan (Hatama et al. 2011), Germany (Schmitt et al. 2010) and New Zealand (Munday and Knight 2010), and from bovine digital dermatitis in Austria (Brandt et al. 2011a). It has also been associated with urinary bladder tumors in Brazil (Wosiacki et al. 2005), India (Pathania et al. 2012), Italy (Borzacchiello et al. 2003, Roperto et al. 2013), Romania (Balcos et al. 2008) and Azores Archipelago, Portugal (Resendes et al. 2011). Recent studies report the detection of BPV-2 in cattle warts, both as simple infections and in co-infections with other BPV types (Schmitt et al. 2010, Carvalho et al. 2012) or with feline sarcoid-associated PV (da Silva et al.

2012). Additionally, productive infection of BPV-2 has been shown in peripheral blood of asymptomatic or papillomatosis-affected cattle (Roperto et al. 2011, Silva et al. 2013) or reproductive tissues like uterus/ ovarium (Yaguiu et al. 2006) or placental epithelium (Roperto et al. 2012); BPV-2 has been found as well in seminal fluid, milk or urine from infected animals (Lindsey et al. 2009, Silva et al. 2011).

In this study we analysed skin warts located in the head and neck of a 15-month old yearling steer reared in an extensive grazing farm in the Central Mountain Range of Spain. DNA was extracted from a 0.1 g slice using 500 µL of lysis buffer (10 mM Tris-HCl, 5 mM EDTA, 200 mM NaCl, 0.2% SDS) with homogenization, followed by 3 hours of incubation at 60ºC with Proteinase K (500 µg/mL) and phenol: chloroform extraction. DNA was resuspended in 50 µL H2O and stored at -20ºC until use. The DNA was amplified using multiple-primed rolling circle amplification (RCA) technique (Rector et al. 2004) with TempliphiTM 100 Amplification (GE Healthcare) following the manufacturer’s instructions and using different DNA concentrations (0.02 µg/µL and 1 µg/µL). Multiple primed RCA amplifications were carried out with 0.5 µL of DNA in a final volume of 10 µL. RCA products (4 µL) were digested overnight with restriction enzymes (XbaI, SmaI, KpnI, BamHI and HindIII) (Biotools) and DNA was purified from the bands of electrophoresis of the appropriate size (Speedtools PCR clean-up kit, Biotools). Discrete bands were obtained after KpnI (around 4 kb) and BamHI digestions (around 2 and 6 kb) (Figure 1) while a band migrating at approximately 8 kb, compatible with undigested BPV size, was observed in the 2 remaining digestions.

Even though cattle are the natural host for BPV, some genotypes such as BPV-1 and BPV-2 have also been reported to infect other animal species.

Bovine papillomaviruses type-2 has been detected in skin tags and in the digestive tract of buffaloes and yaks in India (Pangty et al. 2010, Somvanshi et al. 2012, Bam et al. 2013), urinary bladder tumour in water buffaloes in Turkey (Roperto et al. 2013) and in fibropapillomas and sarcoids in zebras, giraffes and sable antelopes in South Africa (van Dyk et al.

2009, van Dyk et al. 2011). In addition, BPV-2 has also been found associated with equine sarcoid in horses in Austria, Switzerland, Poland, Belgium, UK, Canada, USA and Australia (Bloch et al. 1994, Carr et al. 2001, Chambers et al. 2003a, Bogaert et al. 2010, Haralambus et al. 2010, Szczerba-Turek et al. 2010, Wobeser et al. 2010, Brandt et al. 2011b) and in donkeys (Reid et al. 1994). Furthermore, BPV-2 has been detected in peripheral blood and semen of healthy horses (Silva et al. 2012).

The two bands from both digestions of around 4 kb and 6 kb (Figure 1, lanes 2 and 1, respectively), were excised from the agarose gel and cloned in the vector pUC19 in a total volume of 10 µL with the T4 DNA ligase (Roche Applied Sciences). One Shot TOP10 competent Escherichia coli (Invitrogen, Carlsbad CA, USA) were transformed with the resulting plasmids.

The extraction of plasmid DNA from recombinant clones was performed with QIAprep Miniprep Spin kit (Qiagen, Hilden, Germany), and partial sequencing of several clones of each construction was performed in an ABI Prism 3730 automated sequencer (Perkin Elmer Applied Biosystems, Foster City, CA, USA) at the Genomic Unit of the Scientific Park of Madrid-UCM, using M13 forward (-20) primer (5´-GTAAAACGACGGCCAG-3´), M13 reverse primer (5´-CAGGAAACAGCTATGAC-3´) and walking primers (5´-TATAGCTTGCATCCCTCCTTGTTGA-3´; 5´AACCTTACTATTAGTGTAGCTGCAG-3´; 5´GCTGAAGATGCTGCTGGAAACA-3´).

The clone

Veterinaria Italiana 2014, 50 (3), 219-226. doi: 10.12834/VetIt.248.836.4

Escudero et al.

New variant of BPV-2 in cattle in the Iberian Peninsula

1

2

with the KpnI digestion allowed the nucleotide sequencing of the L1 and L2 genes and partially of the LCR region, while the clone with the BamHI digestion allowed the nucleotide sequencing of the complete E5, E6 genes and the partial sequencing of the L1 and L2 genes. Sequences were deposited in GenBank under the Accession Numbers KF171968 (L1), KF293659 (E5), and KF171969 (E6).

M

23.1 kb 9.4 kb 6.5 kb

Sequences were compared to the GenBank database using the BLAST algorithm. All sequences showed high homology with published BPV-2 sequences. The complete L1 gene had a length of 1494 nt and 497 amino acids (aa). The L1 sequence of the Spanish isolate (KF171968) was compared to other complete and partial sequences of BPV-2 L1 available in GenBank (Table I). The L1 nucleotide sequence from the Spanish isolate showed 14, 11 and 7 nt changes with M20219, X01768 and KC256805, respectively. These changes generate conservative amino acid changes (N323D, S340T, L386V and R484K) and 2 non-conserved changes (L176P, N178M) (Table I). Only the conservative

4.4 kb 2.3 kb 2 kb

Figure 1. Digestion profile of the rolling circle amplification (RCA) performed on 10 ng of total DNA extracted from a skin wart. Each digestion was carried out with 4 µL of RCA product: BamHI (lane 1) and KpnI (lane2). Lane M: λ/HindIII ladder (Biotools).

Table I. Amino acidic variation among complete and partial L1 sequences from 15 cows (Bos taurus), five buffalos (Bos bubalis), two yaks (Bos mutus) and three unknown hosts (ND, not determined). GenBank Accesion number KF171968 (the Spanish isolate) corresponds to the present work. Positions are numbered with respect to the first amino acid of the BPV-2 prototype sequence (GenBank accession number M20219). Shaded boxes represent absence of sequence data. White cells represent identity with the prototype. ND, not determined.

Residues

Accession No.

Host

Origin

Length (aa)

M20219 KF171968 X01768 KC256805 GQ369512 GQ369513 GQ369514 HE600126 HQ144251 HQ144252 HQ144253 HQ144254 HQ144255 HQ166712 JQ071445 JQ071446 GQ369510 GQ369511 HE600123 HE600124 HE600125 HE603639 HE603640 EF151531 EF151532

Bos taurus Bos taurus Bos taurus ND Bos taurus Bos taurus Bos taurus Bos taurus Bos taurus Bos taurus Bos taurus Bos taurus Bos taurus Bos taurus Bos taurus Bos taurus Bubalus bubalis Bubalus bubalis Bubalus bubalis Bubalus bubalis Bubalus bubalis Bos mutus Bos mutus ND ND

ND Spain ND China India India India India India India India India India India Brazil Brazil India India India India India India India India India

498 498 498 498 54 54 54 54 55 55 55 55 54 67 142 142 54 54 54 54 54 54 54 42 42

Veterinaria Italiana 2014, 50 (3), 219-226. doi: 10.12834/VetIt.248.836.4

176 178 323 340 386 442 444 445 447 450 454 457 464 465 466 467 468 484

L1 (major capsid protein)

L N N P M D I D I D

S T

L V V V

K W S

D

E

L

D

R

D A S

D

L

Y Y I

I R K

A

Q

P P

H H

R

R R

E

V V V

F

F

R

R

H

K

221

Escudero et al.

New variant of BPV-2 in cattle in the Iberian Peninsula

mutations N323D and L386V were coincident in all 3 isolates (Table I). The 2 non synonymous substitutions are located in the EF loop inside the jelly roll β-barrel (Wolf et al. 2010). Some isolates from cattle from Brazil and India showed one or both N323D and L386V mutations mentioned above and others at new positions. Residues 465 to 469, which correspond to a short ι-helix in the C-terminal part of the L1 protein, are particularly interesting, as conservative (F465Y, L466I) and non-conservative changes (F465I, L466R, L466K, A467P or Q468H) have been detected in some

Indian isolates. However, these mutations were not observed in the Spanish isolate (Table I).

The analysis of the E5 ORF from the Spanish isolate showed 100% homology with the corresponding gene in the prototype sequence (M20219). However, some differences were observed with BPV-2 E5 protein sequences from zebras and horses from South Africa (Table II).

The E6 sequence showed several amino acidic changes with the prototype sequence M20219: S5T, P23L, V45L and N135K; no other BPV-2 E6 genes from GenBank were available for the analysis at the time

Table II. Amino acidic variation among complete and partial E5 sequences from one cow (Bos taurus), 30 horses (Equus caballus), and three zebras (Equus zebra). GenBank Accesion number KF171968 (the Spanish isolate) corresponds to the present work. Positions are numbered with respect to the first amino acid of the BPV-2 prototype sequence (GenBank accession number M20219). Shaded cells represent absence of sequence data. White cells represent identity with the prototype. ND, not determined.

Accession No. M20219 KF171968 AF102551 AY232264 FJ865503 FJ865504 FJ895874 FJ895875 FJ895876 FJ895877 HQ541333 HQ541334 HQ541335 HQ541336 HQ541337 HQ541338 HQ541339 HQ541340 HQ541341 HQ541342 HQ541343 HQ541344 HQ541345 HQ541346 HQ541347 HQ541348 HQ541349 HQ541350 HQ541351 HQ541352 HQ541353 HQ541354 FJ648526 FJ648527 FJ648528

222

E5 (major transforming protein) Host Origin Bos taurus ND Bos taurus Spain Equus caballus ND Equus caballus Switzerland Equus caballus Austria Equus caballus Austria Equus caballus Canada Equus caballus Canada Equus caballus Canada Equus caballus Canada Equus caballus South Africa Equus caballus South Africa Equus caballus South Africa Equus caballus South Africa Equus caballus South Africa Equus caballus South Africa Equus caballus South Africa Equus caballus South Africa Equus caballus South Africa Equus caballus South Africa Equus caballus South Africa Equus caballus South Africa Equus caballus South Africa Equus caballus South Africa Equus caballus South Africa Equus caballus South Africa Equus caballus South Africa Equus caballus South Africa Equus caballus South Africa Equus caballus South Africa Equus caballus South Africa Equus caballus South Africa Equus zebra South Africa Equus zebra South Africa Equus zebra South Africa

Length (aa) 45 45 26 45 45 45 41 41 41 41 45 45 45 45 45 45 45 45 45 45 45 45 45 45 45 45 45 45 45 45 45 45 45 45 45

6 F

9 F

S S L

Residues 24 L

40 T

41 G

M M M M M M M M M M M M M M M I I I M

S S S S S S S S S S S S S S S S S S S

N N N N N N N N N N N N N N N N N N N

P

Veterinaria Italiana 2014, 50 (3), 219-226. doi: 10.12834/VetIt.248.836.4

Escudero et al.

To the best of our knowledge, this is the first report of BPV-2 presence in cattle in the Iberian Peninsula.

According to the sequencing results, the present isolate could correspond to a new variant of BPV‑2, as there were 14 nt substitutions of the 1494 nt that encode L1 when compared to the M20219 prototype strain. This rate of substitutions would define a variant (de Villiers et al. 2004). Contrariwise to human papillomaviruses (HPV), where variants have been largely studied, no variants had been described for BPV-2. Some isolates of BPV-2 have shown homology in the L1 gene less than a 100% when compared to the prototype, which would have been enough for considering them as variants (Silva et al. 2010, Silva et al. 2011). However, besides the possibility of sequencing errors, they have not been classified as such because of the incomplete sequence of the L1 gene.

The genetic analysis of L1 gene of the Spanish isolate and 24 others of BPV-2 showed a total of 48 nucleotide variations corresponding most of them to silent mutations. Five non-synonymous substitutions have been identified in at least 2 isolates (residues 176, 465, 466, 467 and 468). The non-conservative mutation N178M was only seen in the Spanish isolate. Secondary structure is unlikely altered by the mutation L176P or N178M because these residues are located in the EF loop in the jelly roll β-barrel at the N-terminal region. This region is also coincident with a non-conserved region described in HPV (Bishop et al. 2007). However, residues 465 to 468 are located in a ten-amino acid conical hollow around the pentamerous axis (positions 460 to 469) that shapes a short α-helix (α5). This motif is highly conserved in most BPV types and coincides with descriptions of HPV types (Bishop et al. 2007), and emphasizes the need of conserving the structure of the short helix (residues 460-469) followed by a strand (residues 478-484), which increases the contact edge between capsid subunits.

Additionally to L1 gene analysis, the comparison of the E5 and E6 sequence of the Spanish isolate to other published sequences might contribute to

Veterinaria Italiana 2014, 50 (3), 219-226. doi: 10.12834/VetIt.248.836.4

A

 

A slice of tissue was submitted for histopathological analysis at the Department of Pathology of the Veterinary Clinical Hospital of the Veterinary Faculty at the UCM (Madrid, Spain). The formalin-fixed sample was embedded in paraffin by routine methods and sections were stained with haematoxylin and eosin (HE) and evaluated by a certified pathologist.

Histopathological analysis confirmed the molecular results. Alterations compatible with papillomavirus infection, as hyperplasia of epidermis, hyperkeratosis or acanthosis, were observed (Figure 2).

the better knowledge of these proteins. The E5 is the smallest oncoprotein described; it has different biological activities and is essential for efficient cellular transformation (Corteggio et al. 2013).

The E5 protein interacts with the PDGF receptor in both epithelial and vascular tumours of the urinary bladder, suggesting a possible role of the virus also in mesenchymal carcinogenesis. The E5 of the Spanish variant from this work is unchanged



of the study. The 2 non-conserved changes (P23L and N135K) are located in several arms between beta-laminar and alpha helix structures.

New variant of BPV-2 in cattle in the Iberian Peninsula



B

C

 

 Figure 2. Histopathological section of a bovine skin wart stained with HE (haematoxylin-eosin). (A) Hyperplasia and acanthosis of epidermis with papillary projections into the dermis (indicated by black arrows).

Hyperkeratosis and growth of keratin tubular formations (indicated by grey arrows). (B and C) Nuclear vacuolization in dermal stratum spinosum, with presence of empty nuclei (indicated by arrows in C).

(Magnification: A, x2; B, x10; C, x40).

223

Escudero et al.

New variant of BPV-2 in cattle in the Iberian Peninsula

compared to the prototype sequence (M20219) and BPV-2 sequences from Equus caballus in Austria (Haralambus et al. 2010) and Canada (Wobeser et al.

2010). The inclusion of additional 33 BPV-2 E5 protein sequences of horses (GenBank accession numbers HQ541333 to HQ541354) and zebras (accession numbers FJ648526 to FJ648528) (van Dyk et al.

2009) from South Africa in the comparison revealed 2 amino acidic positions frequently altered (L24M and G41N) in the horse sequences from South Africa isolates. These changes are also present in BPV-1 isolates detected in equine sarcoid in Switzerland (Chambers et al. 2003b) and in European elk papillomavirus and deer papillomavirus (Horwitz et al. 1988). Thus, they might be involved in host range or lesion development.

Mutations were also observed in the E6 gene of the Spanish isolate when compared to prototype M20219, the only sequence of BPV-2 E6 gene available in GenBank. Nevertheless, 1 of the 2 non‑conserved changes, K135N, has been described in other BPV types, such as BPV-13 in Brazil (Lunardi et al. 2013), BPV-1 associated with hoof canker in Austria (Brandt et al. 2011b) and Bos grunniens BgPV type 1 in China (Zhu et al. 2013), so they must not affect host range or produce a big impact on virulence.

Since BPV was first characterized, it has been found in many countries and hosts, although the worldwide

224

distribution of different types is poorly known. Even though fibropapillomas have been described in cattle in Spain, no BPV had been published up till now. We report for the first time the identification of BPV-2 in the Iberian Peninsula, although type 2 has been described in neighbouring countries and regions including Italy, Germany, Romania and Azores Archipelago (Balcos et al. 2008, Schmitt et al.

2010, Resendes et al. 2011, Roperto et al. 2012), it has also been associated with skin warts or bladder tumours in cattle. As this isolate could be considered a variant, its description can contribute to the knowledge of dispersion and circulation of BPV, similar to HPV where several intragenotypic variants with different geographical and ethnic distributions have been identified. This would help to design protocols to protect cattle or avoid infections in other animals.

Acknowledgements This study was funded by UCM 920620 GR35/10-A. 2011 (Program of establishment and consolidation of Research Groups BSCH-UCM). The authors are indebted to the practitioner A. Díez Guerrier, for providing the samples, and to Dr M. Pizarro (Veterinary Clinic Hospital, Veterinary Sciences School of the UCM) for the pathological analysis.

Veterinaria Italiana 2014, 50 (3), 219-226. doi: 10.12834/VetIt.248.836.4

Escudero et al.

New variant of BPV-2 in cattle in the Iberian Peninsula

References Balcos L.G.F., Borzacchiello G., Russo V., Popescu O., Roperto S. & Roperto F. 2008. Association of bovine papillomavirus type-2 and urinary bladder tumours in cattle from Romania. Res Vet Sci, 85, 145-148.

Bam J., Kumar P., Leishangthem G.D., Saikia A. & Somvanshi R. 2013 Spontaneous cutaneous papillomatosis in yaks and detection and quantification of bovine papillomavirus-1 and -2. Transbound Emerg Dis, 60, 475-480.

Bernard H.-U., Burk R.D., Chen Z., van Doorslaer K., zur Hausen H. & de Villiers E.-M. 2010. Classification of papillomaviruses (PVs) based on 189 PV types and proposal of taxonomic amendments. Virology, 401, 70-79.

Bishop B., Dasgupta J., Klein M., Garcea R.L., Christensen N.D., Zhao R. & Chen X.S. 2007. Crystal structures of four types of human papillomavirus L1 capsid proteins: understanding the specificity of neutralizing monoclonal antibodies. J Biol Chem, 282, 31803-31811.

Bloch N., Breen M. & Spradbrow P.B. 1994. Genomic sequences of bovine papillomaviruses in formalinfixed sarcoids from Australian horses revealed by polymerase chain reaction. Vet Microbiol, 41, 163-172.

Bogaert L., Martens A., Kast W.M., Van Marck E. & De Cock H. 2010. Bovine papillomavirus DNA can be detected in keratinocytes of equine sarcoid tumors. Vet Microbiol, 146, 269-275.

Borzacchiello G., Ambrosio V., Roperto S., Poggiali F., Tsirimonakis E., Venuti A., Campo M.S. & Roperto F. 2003. Bovine papillomavirus type 4 in oesophageal papillomas of cattle from the south of Italy. J Comp Pathol, 128, 203-206.

Borzacchiello G. & Roperto F. 2008. Bovine papillomaviruses, papillomas and cancer in cattle. Vet Res, 39, 45.

Brandt S., Apprich V., Hackl V., Tober R., Danzer M., Kainzbauer C., Stanek C. & Kofler J. 2011a. Prevalence of bovine papillomavirus and Treponema DNA in bovine digital dermatitis lesions. Vet Microbiol, 148, 161-167.

Brandt S., Schoster A., Tober R., Kainzbauer C., Burgstaller J.P., Haralambus R., Steinborn R., Hinterhofer C. & Stanek C. 2011b. Consistent detection of bovine papillomavirus in lesions, intact skin and peripheral blood mononuclear cells of horses affected by hoof canker. Equine Vet J, 43, 202-209.

Carr E.A., Théon A.P., Madewell B.R., Griffey S.M. & Hitchcock M.E. 2001. Bovine papillomavirus DNA in neoplastic and nonneoplastic tissues obtained from horses with and without sarcoids in the western United States. Am J Vet Res, 62, 741-744.

Carvalho C.C.R., Batista M.V.A., Silva M.A.R., Balbino V.Q. & Freitas A.C. 2012. Detection of bovine papillomavirus types, co-infection and a putative new BPV11 subtype in cattle. Transbound Emerg Dis, 59, 441-447.

Chambers G., Ellsmore V.A., O’Brien P.M., Reid S.W.J., Love S., Campo M.S. & Nasir L. 2003a. Association of bovine papillomavirus with the equine sarcoid. J Gen Virol, 84, 1055-1062.

Chambers G., Ellsmore V.A., O’Brien P.M., Reid S.W.J., Love S., Campo M.S. & Nasir L. 2003b. Sequence variants of

Veterinaria Italiana 2014, 50 (3), 219-226. doi: 10.12834/VetIt.248.836.4

bovine papillomavirus E5 detected in equine sarcoids.

Virus Res, 96, 141-145.

Corteggio A., Altamura G., Roperto F., Borzacchiello G. 2013. Bovine papillomavirus E5 and E7 oncoproteins in naturally occurring tumors: are two better than one?

Infect Agent Cancer, 8, 1.

Da Silva M.A.R., Carvalho C.C.R., Coutinho L.C.A., Reis M.C., de Aragao Batista M.V., de Castro R.S., Dos Anjos F.B.R. & de Freitas A.C. 2012. Co-infection of Bovine Papillomavirus and feline-associated Papillomavirus in bovine cutaneous warts. Transbound Emerg Dis, 59, 539-543.

De Villiers E.-M., Fauquet C., Broker T.R., Bernard H.-U. & zur Hausen H. 2004. Classification of papillomaviruses.

Virology, 324, 17-27.

Haralambus R., Burgstaller J., Klukowska-Rötzler J., Steinborn R., Buchinger S., Gerber V. & Brandt S. 2010. Intralesional bovine papillomavirus DNA loads reflect severity of equine sarcoid disease. Equine Vet J, 42, 327-331.

Hatama S., Ishihara R., Ueda Y., Kanno T. & Uchida I. 2011.

Detection of a novel bovine papillomavirus type 11 (BPV-11) using xipapillomavirus consensus polymerase chain reaction primers. Arch Virol, 156, 1281-1285.

Horwitz B.H., Burkhardt A.L., Schlegel R. & Di Maio D. 1988.

44-amino-acid E5 transforming protein of bovine papillomavirus requires a hydrophobic core and specific carboxyl-terminal amino acids. Mol Cell Biol, 8, 4071-4078.

Lindsey C.L., Almeida M.E., Vicari C.F., Carvalho C., Yaguiu A., Freitas A.C., Beçak W. & Stocco R.C. 2009. Bovine papillomavirus DNA in milk, blood, urine, semen, and spermatozoa of bovine papillomavirus-infected animals. Genet Mol Res, 8, 310-318.

Lunardi M., Alfieri A.A., Otonel R.A.A., de Alcântara B., Rodrigues W., de Miranda A. & Alfieri A.F. 2013. Genetic characterization of a novel bovine papillomavirus member of the Deltapapillomavirus genus. Vet Microbiol, 162, 207-213.

Munday J.S. & Knight C.G. 2010. Amplification of feline sarcoid-associated papillomavirus DNA sequences from bovine skin. Vet Dermatol, 21, 341-344.

Ogawa T., Tomita Y., Okada M. & Shirasawa H. 2007.

Complete genome and phylogenetic position of bovine papillomavirus type 7. J Gen Virol, 88, 1934-1938.

Pangty K., Singh S., Goswami R., Saikumar G. & Somvanshi R. 2010. Detection of BPV-1 and -2 and quantification of BPV-1 by real-time PCR in cutaneous warts in cattle and buffaloes. Transbound Emerg Dis, 57, 185-196.

Pathania S., Dhama K., Saikumar G., Shahi S. & Somvanshi R. 2012. Detection and quantification of bovine papilloma virus type 2 (BPV-2) by real-time PCR in urine and urinary bladder lesions in enzootic bovine haematuria (EBH)-affected cows. Transbound Emerg Dis, 59, 79-84.

Rector A., Tachezy R. & Van Ranst M. 2004. A sequenceindependent strategy for detection and cloning of circular DNA virus genomes by using multiply primed rolling-circle amplification. J Virol, 78, 4993-4998.

225

New variant of BPV-2 in cattle in the Iberian Peninsula

Reid S.W., Smith K.T. & Jarrett W.F. 1994. Detection, cloning and characterisation of papillomaviral DNA present in sarcoid tumours of Equus asinus. Vet Rec, 135, 430-432.

Resendes A.R., Roperto S., Trapani F., Urraro C., Rodrigues A., Roperto F. & Borzacchiello G. 2011. Association of bovine papillomavirus type 2 (BPV-2) and urinary bladder tumours in cattle from the Azores archipelago.

Res Vet Sci, 90, 526-529.

Roperto S., Comazzi S., Ciusani E., Paolini F., Borzacchiello G., Esposito I., Lucà R., Russo V., Urraro C., Venuti A., Roperto F. 2011. PBMCs are additional sites of productive infection of bovine papillomavirus type 2.

J Gen Virol, 92, 1787-1794.

Roperto S., Borzacchiello G., Esposito I., Riccardi M., Urraro C., Lucà R., Corteggio A., Tatè R., Cermola M., Paciello O., Roperto F. & Kimman T. 2012. Productive infection of bovine papillomavirus type 2 in the placenta of pregnant cows affected with urinary bladder tumors.

PLoS ONE, 7, e33569.

Roperto S., Russo V., Ozkul A., Corteggio A., Sepici-Dince A., Catoi C., Esposito I., Riccardi M., Urraro C., Lucà R., Ceccarelli D., Longo M. & Roperto F. 2013. Productive infection of bovine papillomavirus type 2 in the urothelial cells of naturally occurring urinary bladder tumors in cattle and water buffaloes. PLoS ONE, 8, e62227.

papillomavirus in blood of healthy and papillomatosisaffected cattle. Genet Mol Res, 12, 3150-3156.

Somvanshi R., Pathania S., Nagarajan N., Pangty K. & Kumar P. 2012. Pathological study of non-neoplastic urinary bladder lesions in cattle and buffaloes: a preliminary report. Trop Anim Health Prod, 44, 855-861.

Szczerba-Turek A., Siemionek J., Wasowicz K., Szweda W., Ras A. & Platt-Samoraj A. 2010. Partial sequence analysis of the L1 gene of bovine papillomavirus type 1 detected by PCR with MY09/MY11 primers in equine sarcoids in Poland. Pol J Vet Sci, 13, 241-246.

Tomita Y., Literak I., Ogawa T., Jin Z. & Shirasawa H. 2007.

Complete genomes and phylogenetic positions of bovine papillomavirus type 8 and a variant type from a European bison. Virus Genes, 35, 243-249.

Van Dyk E., Oosthuizen M.C., Bosman A.-M., Nel P.J., Zimmerman D. & Venter E.H. 2009. Detection of bovine papillomavirus DNA in sarcoid-affected and healthy free-roaming zebra (Equus zebra) populations in South Africa. J Virol Methods, 158, 141-151.

Van Dyk E., Bosman A.M., van Wilpe E., Williams J.H., Bengis R.G., van Heerden J. & Venter E.H. 2011. Detection and characterisation of papillomavirus in skin lesions of giraffe and sable antelope in South Africa. J S Afr Vet Assoc, 82, 80-85.

Schmitt M., Fiedler V. & Müller M. 2010. Prevalence of BPV genotypes in a German cowshed determined by a novel multiplex BPV genotyping assay. J Virol Methods, 170, 67-72.

Wobeser B.K., Davies J.L., Hill J.E., Jackson M.L., Kidney B.A., Mayer M.L., Townsend H.G.G. & Allen A.L. 2010.

Epidemiology of equine sarcoids in horses in western Canada. Can Vet J, 51, 1103-1108.

Silva M.S.E., Weiss M., Brum M.C.S., Dos Anjos B., Torres F., Weiblen R. & Flores E. 2010. Molecular identification of bovine papillomaviruses associated with cutaneous warts in southern Brazil. J Vet Diagn Investig, 22, 603-606.

Wolf M., Garcea R.L., Grigorieff N. & Harrison S.C. 2010.

Subunit interactions in bovine papillomavirus. Proc Natl Acad Sci U S A, 107, 6298-6303.

Silva M.A.R., Pontes N.E., Da Silva K.M.G., Guerra M.M.P. & Freitas A.C. 2011. Detection of bovine papillomavirus type 2 DNA in commercial frozen semen of bulls (Bos taurus). Anim Reprod Sci, 129, 146-151.

Silva M.A.R., Silva K.M.G., Jesus A.L.S., Barros L.O., Corteggio A., Altamura G., Borzacchiello G. & Freitas A.C. 2012. The presence and gene expression of bovine papillomavirus in the peripheral blood and semen of healthy horses. Transbound Emerg Dis, 129, 146-151.

Silva M.A.R., De Albuquerque B.M.F., Pontes N.E., Coutinho L.C.A., Leitao M.C.G., Reis M.C., Castro R.S. & Freitas A.C. 2013. Detection and expression of bovine

226

Escudero et al.

Wosiacki S.R., Barreiro M.A., Alfieri A.F. & Alfieri A.A. 2005.

Semi-nested PCR for detection and typing of bovine Papillomavirus type 2 in urinary bladder and whole blood from cattle with enzootic haematuria. J Virol Methods, 126, 215-219.

Yaguiu A., Carvalho C., Freitas A.C., Góes L.G.B., Dagli M.L.Z., Birgel E.H., Beçak,W. & dos Santos R.C.S. 2006.

Papillomatosis in cattle: In situ detection of bovine papillomavirus DNA sequences in reproductive tissues.

Braz J Morphol Sci, 23, 525-529.

Zhu W., Dong J.-B., Zhang J., Uchida K., Watnabe K., Goto Y. & Haga T. 2013. Bos grunniens papillomavirus type 1: a novel deltapapillomavirus associated with fibropapilloma in yak. J Gen Virol, 94, 159-165.

Veterinaria Italiana 2014, 50 (3), 219-226. doi: 10.12834/VetIt.248.836.4

SHORT COMMUNICATION Occurrence of different Canine distemper virus lineages in Italian dogs Andrea Balboni*, Giorgia De Lorenzo Dandola, Alessandra Scagliarini, Santino Prosperi & Mara Battilani Department of Veterinary Medical Sciences, Alma Mater Studiorum-University of Bologna, Via Tolara di Sopra 50, 40064 Ozzano dell’Emilia (BO), Italy * Corresponding author at: Department of Veterinary Medical Sciences, Alma Mater Studiorum-University of Bologna, Via Tolara di Sopra 50, 40064 Ozzano dell’Emilia (BO), Italy.

Tel.: +39 051 2097084, e-mail: a.balboni@unibo.it.

Veterinaria Italiana 2014, 50 (3), 227-231. doi: 10.12834/VetIt.52.2173.2 Accepted: 04.09.2014 | Available on line: 30.09.2014

Keywords Arctic-like, Canine distemper virus, Dog, Europe 1, Gene H, Italy.

Summary This study describes the sequence analysis of the H gene of 7 Canine distemper virus (CDV) strains identified in dogs in Italy between years 2002-2012. The phylogenetic analysis showed that the CDV strains belonged to 2 clusters: 6 viruses were identified as Arctic‑like lineage and 1 as Europe 1 lineage. These data show a considerable prevalence of Arctic‑like‑CDVs in the analysed dogs. The dogs and the 3 viruses more recently identified showed 4 distinctive amino acid mutations compared to all other Arctic CDVs.

Presenza di diversi lineage di Canine distemper virus in cani in Italia Parole chiave Arctic-like CDV, Cane, Canine distemper virus (CDV), Europe 1 CDV, Gene H, Italia.

Riassunto L’articolo riporta l’analisi della sequenza del gene H di 7 ceppi di Canine distemper virus (CDV) identificati in cani, in Italia, tra il 2002 e il 2012. L’analisi filogenetica ha mostrato l’appartenenza dei 7 ceppi a 2 gruppi genetici: 6 ceppi al lineage Arctic-like e un ceppo al lineage Europe 1. I dati raccolti hanno mostrato una considerevole prevalenza nei cani testati di CDV appartenenti al lineage Arctic-like, evidenziando negli ultimi 3 ceppi virali identificati la presenza di 4 mutazioni aminoacidiche distintive rispetto agli altri ceppi di Arctic-like CDV.

Currently, 9 genetic lineages of Canine distemper virus (CDV) are recognized throughout the world: America 1, America 2, Asia 1, Asia 2, Europe Wildlife, Arctic-like, South Africa, Europe 1/South America 1 and South America 2. In addition, new CDV lineages were recently proposed to include viruses circulating in Asia (Asia 3) and viral strains related to Rockborn vaccine strain (Calderon et al. 2007, Martella et al. 2011, Panzera et al. 2012, Zhao et al. 2010). The attachment/haemagglutinin (H) is the most variable CDV protein and has been used throughout the years to distinguish the different genetic lineages and to classify the CDV circulating strains. Furthermore, the 3' end of H gene codifies for important amino acid domains involved in interaction between virus and cellular receptor and it has been hypothesized that residues 530 and 549 might affect the viral tropism (McCarthy et al. 2007, Nikolin et al. 2012).

The CDV-related disease in canine population

has generally been controlled by live attenuated vaccines, but outbreaks of CDV are still reported worldwide also in vaccinated animals (Martella et al. 2007). Moreover, sequencing of several CDV strains belonging to different genetic lineages has highlighted considerable genetic and antigenic diversities (especially in the H gene/protein).

However the effects that these mutations may have on the virulence remain unclear, as well as the susceptibility of different carnivore hosts and the ability of the currently available vaccines to protect from infection (McCarthy et al. 2007, Nikolin et al.

2012, Sekulin et al. 2011).

Three CDV genetic lineages are currently circulating in Italy: the Europe 1 lineage (historically spread in the dogs as well as in wild animals), also named Europe 1/South America 1 because it also circulates in South America, the Europe Wildlife (prevalently diffused in wildlife and sporadically reported in

227

Balboni et al.

Canine distemper virus in Italian dogs

dogs) and the Arctic-like lineage (native to the Arctic ecosystem and recently detected in Italian dogs) (Martella et al. 2006, Martella et al. 2007, Monne et al. 2011, Panzera et al. 2012). Furthermore, a distinct viral subgroup insight the Europe 1 lineage (named Wildlife Europe 2006-2009) has been shown to be responsible for the recent epidemic in Alpine wildlife, both in Italy and in Central Europe (Monne et al. 2011, Sekulin et al. 2011). Until the year 2000, only the Europe 1 lineage had been circulating in the Italian dog population. Instead, after the year 2000, several cases of Arctic-like CDVs infection were reported in dogs. Between 2002 and 2006, Martella and collaborators revealed cases of Arctic-like CDVs infection in Central and Southern Italy (Martella et al. 2006, Martella et al. 2007) and, between 2000 and 2007, cases of Arctic-like CDVs infection were also reported in the North-Eastern Italy (Monne et al. 2011). In contrast, a survey conducted on 53 dogs with symptoms attributable to CDV infection from Central Italy only identified CDV strains belonging to the classical Europe 1 lineage (Di Francesco et al. 2012). It is therefore yet to be understood if the genotype Arctic-like is permanently established in the Italian canine population or if it represents occasional findings in certain geographic areas.

In order to get further information on the CDV strains circulating in Italy, 7 CDV strains from Emilia Romagna and Lazio were analysed. They were capable of causing clinical signs in infected dogs as referred by local veterinary surgeons (Table I).

With this aim, viral RNA was extracted from the footpad or brain using the RNeasy Mini Kit (QIAGEN, Hilden, Germany) and molecular diagnosis of CDV was done by TaqMan based real-time polymerase chain reaction (RT-PCR) (Scagliarini et al. 2007). The CDV H gene was amplified using the SuperScript III One-Step RT-PCR System with Platinum Taq DNA Polymerase (Invitrogen, Carlsbad, CA, USA) and the set of primers C previously described by Demeter and colleagues (Demeter et al. 2007). The extremity 3’ of H gene was directly sequenced obtaining a fragment of 582 bp in length, corresponding to the

last 193 amino acid residues of the H protein. The obtained nucleotide sequences were aligned and compared with 119 reference sequences available from the GenBank database1 using the CLUSTALW software implemented in BioEdit sequence alignment editor version 7.0.9. The phylogenetic relationships were evaluated using MEGA version 5.05, with the best-fit model of nucleotide substitution determined using the function Find Best DNA/Protein Model implemented in the program.

Pairwise genetic distances were calculated by Tamura-Nei model with γ distribution that resulted optimal for all the sequence data and phylogenetic trees were constructed using the neighbor-joining method. Bootstrap values were determined by 1000 replicates to assess the confidence level of each branch pattern. The nucleotide sequences obtained have been lodged within the GenBank sequence database under accession numbers: KF184985KF184991.

The nucleotide sequences demonstrate that the analysed CDV strains belonged to 2 clusters. The first cluster included 6 Arctic-like lineage viruses (444.2002, 456.2003, 64.2004, 99.2011, 319.2012 and 352.2012) that showed an identity of 97.7‑99.8% among themselves and of 97.2-100% with other Arctic-like strains. In particular, 444.2002 showed a complete identity with 3 North Italian CDVs identified in dogs in 2000-2001 (HM443711, HM443719 and HM443720). The last identified CDV strain (741.2006) belonged to Europe 1 lineage, showing an identity of 93.2-94.8% with viruses of the first cluster and of 95.7-99.8% with Europe 1 strains. Notably, the nucleotide identity calculated by comparing the viruses of the first cluster with Artic-like reference strains decreases progressively from oldest samples to samples collected more recently. Furthermore, the identities between 741.2006 and 99.2011, 319.2012 and 352.2012 were found to be lower than those calculated with the Arctic-like reference strains.

1

www.ncbi.nlm.nih.gov/genbank/.

Table I. Details of 7 CDV strains identified in dogs in Italy between years 2002-2012.

Virus 444 456 64 741 99 319 352

Sampling date 2002 2003 2004 2006 2011 2012 2012

Breed Labrador retriever German shepard Cane Corso Mixed-breed Mixed-breed Mixed-breed Mixed-breed

Sex M F F Un F M F

Age 2m 2m 1y 3m Un 5m 2m 2m

Origin Emilia-Romagna Emilia-Romagna Emilia-Romagna Emilia-Romagna Lazio Lazio Lazio

Vaccination status Yes No Yes Un Un Un No

Symptoms R+N R+N GI + N + C Un GI + N GI + N N

M = male; F = female; m = months; y = years; R = respiratory symptoms; N = neurological symptoms; GI = gastrointestinal symptoms; C = cutaneous lesions; Un = unknown.

228

Veterinaria Italiana 2014, 50 (3), 227-231. doi: 10.12834/VetIt.52.2173.2

Balboni et al.

Canine distemper virus in Italian dogs

DE_badger_2008_FJ416338 DE_fox_2008_FJ416339 DE_fox_2008_FJ416336 DE_fox_2008_FJ416337 IT_badger_2008_HM443704 CH_lynx_2010_JF810109 IT_fox_2007_HM443705 CH_fox_2010_JF810107 CH_dog_2010_JF810111 IT_fox_2009_HM120874 CH_marten_2002_JF810110 86 CH_fox_2010_JF810108 CH_fox_2010_JF810106 IT_fox_2006_HM443726 IT_badger_2006_HM443725 99 IT_fox_2009_HM443709 IT_marten_2009_HM443708 IT_fox_2008_HM443707 HU_dog_2004_DQ889177 DE_fox_2007_JN153024 91 DE_fox_2007_JN153025 100 ES_lynx_2005_GU001863 ES_marten_2005_GU001864 PT_wolf_1998_HM563057 100 PT_wolf_2008_HM563058 PT_dog_2007_HM563059 AU_dog_2002_GQ214376 AU_dog_2002_GQ214378 97 AU_dog_2002_GQ214380 AU_dog_2002_GQ214384 IT_dog_2003_DQ494319 IT_dog_741.2006_KF184988 97 IT_dog_2002_DQ494318 IT_dog_2007_HM443723 DK_dog_1994_Z47761 89 IT_dog_2000_HM443718 TR_dog_2002_AY093674 IT_dog_2003_DQ494317 DE_dog_1996_Z77671 DE_dog_1996_Z77672 DE_dog_1996_Z77673 AR_dog_2003_FJ392652 UY_dog_2008_JN215474 99 UY_dog_2007_JN215473 99 UY_dog_2008_JN215475 UY_dog_2009_JN215476 UY_dog_2009_JN215477 US_raccoon_2001_AY498692 US_dog_1995_Z47762 US_raccoon_2001_AY526496 US_bleopard_1992_Z47763 CN_gpanda_1999_AF178038 JP_dog_2005_AB212965 JP_dog_1996_D85754 98 JP_badger_2007_AB329581 CN_dog_2008_FJ409464 CN_fox_2006_EU325722 CN_fox_2006_HQ540293 AR_dog_2003_AM422846 98 AR_dog_2003_AM422847 AR_dog_2005_FJ392651 US_dog_2004_AY964110 Rockborn-Candur_GU266280 US_dog_2004_AY964114 95 Rockborn-46th_GU810819 CN_lesser-panda_1999_AF178039 IT_fox_2000_DQ228166 DK_mink_1992_Z47759 HU_dog_2006_DQ889188 100 HU_dog_2006_DQ889189 HU_dog_2006_DQ889187 100 AU_badger_2006_GQ214374 AU_marten_2007_GQ214369 DE_raccoon_2007_JN153022 DE_raccoon_2007_JN153019 100 DE_raccoon_2007_JN153020 DE_raccoon_2007_JN153021 DE_raccoon_2007_JN153023 ZA_dog_2007_FJ461714 ZA_dog_2007_FJ461698 99 ZA_dog_2007_FJ461720 ZA_dog_2007_FJ461724 GL_dog_1992_Z47760 IT_dog_2000_HM443710 IT_dog_2000_HM443713 97 87 IT_dog_444.2002_KF184985 IT_dog_2000_HM443720 93 IT_dog_2000_HM443719 IT_dog_2001_HM443711 IT_dog_2000_HM443716 IT_dog_2000_HM443717 IT_dog_2000_HM443714 US_dog_2004_AY964112 US_dog_2004_AY964108 IT_dog_2005_HM443712 IT_dog_2005_DQ226088 IT_dog_99.2011_KF184989 98 IT_dog_319.2012_KF184990 88 IT_dog_352.2012_KF184991 IT_dog_2008_HM443706 IT_dog_2002_HM443721 IT_dog_2004_HM443715 IT_dog_2004_DQ226087 84 IT_dog_64.2004_KF184987 IT_dog_456.2003_KF184986 IT_dog_2002_HM443724 AU_dog_2003_GQ214373 IT_dog_2002_HM443722 HU_dog_2005_DQ889181 HU_dog_2005_DQ889178 HU_dog_2005_DQ889179 HU_dog_2005_DQ889180 HU_dog_2005_DQ889182 HU_dog_2005_DQ889183 HU_dog_2006_DQ889184 HU_dog_2006_DQ889185 HU_dog_2006_DQ889186 CN_fox_2005_EU743935 JP_dog_1998_AB025270 97 JP_dog_2006_AB252718 91 Onderstepoort_AF305419 Convac_Z35493 Lederle_EF418782 99 SnyderHill_AF259552 99 US_raccoon_1998_AY548109 PDV-1_AF479277

A Europe 1

South America Proposed Lineage America II Asia I

South America Proposed Lineage Rockborn-like Proposed Lineage

Europe Wildlife

South Africa

Arctic-like

Asia II America I

0.05

Figure 1. Rooted phylogenetic tree constructed on nucleotide sequences of the 3â&#x20AC;&#x2122; fragment of H gene of the CDV genome (582 base pairs).

The phylogenetic tree was constructed using the neighbor-joining method with the nucleotide sequences generated in this study and with sequences of 118 CDV reference strains obtained from the GenBank database and a Phocine distemper virus as outgroup. Bootstrap values greater than 80% are indicated on the respective branches. The CDV strains included in the phylogenetic analysis are named with: acronym of nation, host species and year of identification (with lab numbers for sequences generated in this study), plus the GenBank accession number. When the year of identification was not available, the year of deposition of the nucleotide sequence in the GenBank database was indicated. Highlighted in black: sequences generated in this study. Highlighted in gray: Wildlife Europe 2006-2009 subgroup.

Veterinaria Italiana 2014, 50 (3), 227-231. doi: 10.12834/VetIt.52.2173.2

229

Balboni et al.

Canine distemper virus in Italian dogs

These findings are further supported by the phylogenetic tree, which depicts 6 viruses clustering in the Arctic-like lineage and 741.2006 in the Europe 1/South America 1 lineage (Figure 1). Furthermore, 99.2011, 319.2012 and 352.2012, formed a monophyletic clade inside the Arctic-like lineages, strictly related with a North Italian CDV identified in 2008 (HM443706).

The H protein of the 6 Arctic-like CDVs exhibited residues asparagine (N) at position 530 and tyrosine (Y) at position 549, in accordance with all Arctic-like strains sequenced until now; whereas, in accordance with all Europe 1 strains identified in domestic dogs, 741.2006 exhibited residues glycine (G) at position 530 and tyrosine (Y) at position 549 (Martella et al.

2007, Monne et al. 2011). Some differences were detected in other amino acid positions, as shown in Figure 2. In particular, 99.2011, 319.2012 and 352.2012 exhibit methionine (M) at position 445 and serine (S) at position 559 which were never reported previously in other CDVs. Furthermore, these latter Arctic-like viruses exhibit threonine (T) at position 417 and asparagine (N) at position 435 previously reported in another North Italian CDV strain HM443706.

These data show a considerable spread of Arctic‑like lineage in the sampled dogs, in agreement with previous reports on CDV strains collected in Italy which had revealed the presence of Arctic-like CDVs in dogs since 2000 and confirm the dissemination of this novel genotype in Italy (Martella et al.

2006, Martella et al. 2007, Monne et al. 2011). The Arctic‑like lineage is native to the Arctic ecosystem and was usually related to infection of wild animals; it was only occasionally associated with outbreaks in domestic dogs from country geographically distant from Italy, such as Hungary, United States of America, China and Greenland (Blixenkrone‑Möller et al. 1992, Demeter et al. 2007, Pardo et al. 2005). Subsequently to the arrival of Arctic-like CDVs in Italy, probably due to a significant movement of viruses from the East‑Central Europe to Italy in consequence of intense trade of dogs (Martella et al. 2006), the increasing detection of these viruses might suggest that strains belonging to Arctic‑like lineage are becoming progressively endemic in Italy. Furthermore, the 3 viruses more recently identified (99.2011, 319.2012 and 352.2012) showed 4 distinctive amino acid mutations compared to all other Arctic CDVs. Although the study shows a high prevalence of Arctic-like CDV in sampled dogs, the number of viral

Figure 2. Amino acids differences in the sequence tract of H gene between the 7 viral strains identified in dogs in Italy between years 2002-2012.

The ruler at the top shows the amino acid positions corresponding to the entire H protein.

230

Veterinaria Italiana 2014, 50 (3), 227-231. doi: 10.12834/VetIt.52.2173.2

Balboni et al.

strains analysed should be increased, extending the monitoring activities also to other geographical areas, to properly assess the incidence of Arctic-like CDV strains in Italian dogs. Further studies would

Canine distemper virus in Italian dogs

be necessary to understand what benefits the new amino acid mutations can confer to the Arcticlike CDVs and in which way these may affect their spreading in Italy and in Europe.

References Blixenkrone-Möller M., Svansson V., Appel M., Krogsrud J., Have P. & Orvell C. 1992. Antigenic relationships between field isolates of morbilliviruses from different carnivores. Arch Virol, 123(3-4), 279-294.

Calderon M.G., Remorini P., Periolo O., Iglesias M., Mattion N. & La Torre J. 2007. Detection by RT-PCR and genetic characterization of canine distemper virus from vaccinated and non-vaccinated dogs in Argentina. Vet Microbiol, 125(3-4), 341-349.

Demeter Z., Lakatos B., Palade E.A., Kozma T., Forgách P. & Rusvai M. 2007. Genetic diversity of Hungarian canine distemper virus strains. Vet Microbiol, 122(3-4), 258-269.

Di Francesco C.E., Di Francesco D., Di Martino B., Speranza R., Santori D., Boari A. & Marsilio F. 2012. Detection by hemi-nested reverse transcription polymerase chain reaction and genetic characterization of wild type strains of Canine distemper virus in suspected infected dogs. J Vet Diagn Invest, 24(1), 107-115.

Martella V., Blixenkrone-Møller M., Elia G., Lucente M.S., Cirone F., Decaro N., Nielsen L., Bányai K., Carmichael L.E. & Buonavoglia C. 2011. Lights and shades on an historical vaccine canine distemper virus, the Rockborn strain. Vaccine, 29(6), 1222-1227.

Martella V., Cirone F., Elia G., Lorusso E., Decaro N., Campolo M., Desario C., Lucente M.S., Bellacicco A.L., Blixenkrone-Møller M., Carmichael L.E. & Buonavoglia C. 2006. Heterogeneity within the hemagglutinin genes of canine distemper virus (CDV) strains detected in Italy. Vet Microbiol, 116(4), 301-309.

Martella V., Elia G., Lucente M.S., Decaro N., Lorusso E., Banyai K., Blixenkrone-Møller M., Lan N.T., Yamaguchi R., Cirone F., Carmichael L.E. & Buonavoglia C. 2007. Genotyping canine distemper virus (CDV) by a hemi-nested multiplex PCR provides a rapid approach for investigation of CDV outbreaks. Vet Microbiol, 122(1-2), 32-42.

McCarthy A.J., Shaw M.A. & Goodman S.J. 2007. Pathogen

Veterinaria Italiana 2014, 50 (3), 227-231. doi: 10.12834/VetIt.52.2173.2

evolution and disease emergence in carnivores. Proc Biol Sci, 274(1629), 3165-3174.

Monne I., Fusaro A., Valastro V., Citterio C., Dalla Pozza M., Obber F., Trevisiol K., Cova M., De Benedictis P., Bregoli M., Capua I. & Cattoli G. 2011. A distinct CDV genotype causing a major epidemic in Alpine wildlife.

Vet Microbiol, 150(1-2), 63-69.

Nikolin V.M., Wibbelt G., Michler F.U., Wolf P. & East M.L. 2012. Susceptibility of carnivore hosts to strains of canine distemper virus from distinct genetic lineages.

Vet Microbiol, 156(1-2), 45-53.

Panzera Y., Calderón M.G., Sarute N., Guasco S., Cardeillac A., Bonilla B., Hernández M., Francia L., Bedó G., La Torre J. & Pérez R. 2012. Evidence of two co-circulating genetic lineages of canine distemper virus in South America. Virus Res, 163(1), 401-494.

Pardo I.D., Johnson G.C. & Kleiboeker S.B. 2005.

Phylogenetic characterization of canine distemper viruses detected in naturally infected dogs in North America. J Clin Microbiol, 43(10), 5009-5017.

Scagliarini A., Dal Pozzo F., Gallina L., Vaccari F. & Morganti L. 2007. TaqMan based real time PCR for the quantification of canine distemper virus. Vet Res Commun, 31(Suppl 1), 261-263.

Sekulin K., Hafner-Marx A., Kolodziejek J., Janik D., Schmidt P. & Nowotny N. 2011. Emergence of canine distemper in Bavarian wildlife associated with a specific amino acid exchange in the haemagglutinin protein. Vet J, 187(3), 399-401.

Zhao J.J., Yan X.J., Chai X.L., Martella V., Luo G.L., Zhang H.L., Gao H., Liu Y.X., Bai X., Zhang L., Chen T., Xu L., Zhao C.F., Wang F.X., Shao X.Q., Wu W. & Cheng S.P. 2010.

Phylogenetic analysis of the haemagglutinin gene of canine distemper virus strains detected from breeding foxes, raccoon dogs and minks in China. Vet Microbiol, 140(1-2), 34-42.

231

SHORT COMMUNICATION Serological evidence for Parapoxvirus infection in chamois from the Tyrol regions of Austria and Italy Hartwig P. Huemer1*, Alexandra Zobl1, Andrea Windisch1, Walter Glawischnig2, Mathias Büttner3, Maria Kitchen4 & Karin Trevisiol5 Dpt. Hygiene, Microbiology & Social Medicine, Med. University Innsbruck, Fritz-Pregl-Str. 3, A-6020 Innsbruck, Austria.

2 AGES - Austrian Agency for Health and Food Safety, Technikerstrasse 70, A-6020 Innsbruck, Austria.

3 Bavarian Health and Food Safety Authority, Veterinärstrasse 2, D- 85764 Oberschleissheim, Germany.

4 Dpt. Dermatology & Venereology, Med. University Innsbruck, Anichstrasse 35, A-6020 Innsbruck, Austria.

5 Istituto Zooprofilattico Sperimentale delle Venezie, V. Bivio 59, I-39100 Bolzano, Italy.

1

* Corresponding author at: Med. University Innsbruck, Dpt. Hygiene, Microbiology & Social Medicine, Fritz-Pregl-Str.3, R. 301, A-6020 Innsbruck, Austria.

Tel.: +43 512 9003 70799, fax: +43 512 9003 73799, e-mail: hartwig.huemer@i-med.ac.at.

Veterinaria Italiana 2014, 50 (3), 233-236. doi: 10.12834/VetIt.1304.14 Accepted: 07.05.2014 | Available on line: 30.09.2014

Keywords Antibody, Austria, Chamois, Italy, Orf-virus, Parapoxvirus, Rupicapra rupicapra, Seroprevalence.

Summary Orf-virus (ORFV) is a parapoxvirus that infects small ruminants worldwide causing sporadic zoonotic infections, mainly transmitted by direct contact with sheep and goats. Following an ORFV case in a hunter of Alpine chamois (Rupicapra rupicapra), who did not report previous contact to domestic animals, a serological survey in Western Austria was conducted to assess the seroprevalence of ORFV in this species. In addition, this study also tested blood/tissue samples of chamois from different areas of the adjacent province of Bolzano/Northern Italy for antibodies against ORFV using immunofluorescence and ELISA. The observed seropositivity rates in the chamois tested on the Austrian and Italian side of the Alps were 23.5% and 9.5%, respectively, with a combined 95% confidence interval ranging from 0.0678 to 0.238. Although the prevalence was significantly lower than the one observed in Austrian sheep flocks, this study provided the first evidence that parapoxviruses have spilled over into chamois populations to a significant degree in the Tyrol regions of Austria and Italy.

Evidenza sierologica di Parapoxvirus in camosci (Rupicapra rupicapra) in Tirolo (Austria e Italia) Parole chiave Anticorpi, Austria, Camoscio, Italia, Orf-virus, Parapoxvirus, Rupicapra rupicapra, Sieroprevalenza

Riassunto ORF-virus (ORFV) è un Parapoxvirus che colpisce i piccoli ruminanti ed è diffuso in tutto il mondo, può causare infezioni zoonotiche sporadiche negli esseri umani, che sono trasmesse principalmente attraverso il contatto diretto con pecore e capre. L’indagine sierologica in camosci provenienti dalla zona colpita in Austria occidentale descritta in questo studio è stata condotta a seguito di un caso di ORFV in un cacciatore di camosci delle Alpi (Rupicapra rupicapra), che non aveva avuto contatti precedenti con animali domestici. Nell’ambito dello stesso studio, campioni di sangue e di tessuto di camosci di diverse aree della provincia adiacente Bolzano (Nord Italia) sono stati testati per anticorpi ORFV con immunofluorescenza ed ELISA. I tassi di sieropositività osservati nei camosci testati è risultato del 23,5% nell’area austriaca e del 9,5% nel versante italiano delle Alpi, con un intervallo di confidenza del 95% compreso tra i valori 0,0678 e 0,238. Sebbene la prevalenza sia significativamente inferiore a quella osservata in greggi di pecore austriache, i dati relativi a questo studio forniscono la prima prova che Parapoxvirus interessa ad un livello significativo le popolazioni di camosci presenti nelle regioni del Tirolo austriaco e italiano.

233

Parapoxvirus infection in Chamois in Austria and Italy

Orf-virus (ORFV) is a member of the Poxviridae family, genus Parapoxvirus, causing contagious ecthyma (also known as scabby/sore mouth disease) in small ruminants and it is spread worldwide. The morbidity in sheep and goats is high whereas the mortality is low. Animals can be infected repeatedly due to the insufficient immune response caused by immune-evasive peculiarities of the virus. Orf-virus also causes zoonotic infections in humans following unnoticed scarification and direct contact with infected animals or virus-contaminated surfaces (Haig, 2006).

Farmers and veterinarians are the main risk groups for human ORFV infections. However, children infected while visiting petting zoos and infections due to meat processing during food preparation have been reported (Centers for Disease Control and Prevention 2012). The infection in humans is mostly benign, self-limited and usually restricted to a few painful sores on the hands and resolves in 2 months. Fever and more widespread infections are rare and mostly associated with immunosuppressive conditions (Larcher et al. 2009, Lederman et al. 2007). Sequence data suggest that there are no distinct strains or ORFV variants showing an enhanced virulence or capacity to infect humans (Scagliarini et al. 2004).

In 2012, a case of ORFV infection in a hunter without a history of contact with domestic animals has been reported (Kitchen et al. 2014). The virus was identified by electron microscopy and the diagnosis confirmed by semi-nested PCR (Inoshima et al. 2001) and subsequent DNA sequencing. The sequence, which aligned with European ORFV sheep strains, was deposited in Genbank under the accession number HE9969651. As this patient had been hunting Alpine chamois (Rupicapra rupicapra), we decided to perform a small epidemiological survey concerning this species. Blood/tissue-fluid samples were extracted by centrifugation from fresh tissue samples (lung, liver, kidney) provided by the local hunter’s community. Samples were collected from 17 chamois of the suspected area of the index case, i.e. the Sellrain valley of North Tyrol, Austria.

Subsequently, 42 samples of extracts of lung tissue from chamois, collected in the same year (2012), were obtained from 9 areas of the neighboring Italian province of Bolzano.

The samples were centrifuged at 13.000 x g and tested for parapoxvirus specific antibodies using indirect immunofluorescence (IF) as recently described (Kitchen et al. 2014, Larcher et al. 2009). In brief, Vero (African green monkey kidney) cells were infected with laboratory ORFV BO15 strain (Cottone

1

234

w ww.ncbi.nlm.nih.gov/genbank/.

Huemer et al.

et al. 1998). The infected cells were spotted on 12 well microscopic slides (Thermo Scientific, Portsmouth, NH, USA), air-dried and fixed with ice cold methanol/ acetone (1:1). The slides were then vacuum-sealed and stored at -80°C until use. Dilutions of animal blood/tissue fluids and secondary antibodies were performed in phosphate buffered salt solution (PBS) containing 10% bovine serum. Antibodies in chamois samples were detected with a mixture of FITC-labeled anti-goat (from KPL, Gaithersburg, MD, USA) and anti-sheep antiserum (from DAKO, Glostrup, Denmark), both raised in rabbit, at the working dilution suggested by the manufacturer (1:100). Sheep sera from different areas of Tyrol and Styria (Austria) served as positive and negative controls using FITC labeled anti-sheep rabbit serum alone. For better contrast in microscopy, the cells on the IF microscopic slides were counter-stained with a 1:1000 dilution of a 1% (w/v) Evans blue stock solution before mounting with 80% glycerol/ PBS under glass cover slides (Kitchen et al. 2014). A repeatedly observed fluorescence titer of >1:40 was considered positive.

Additionally, ultracentrifuge concentrated ORFV laboratory BO15 strain, which had been heat inactivated and treated with detergent following published protocols, was used in enzyme-linked immune-sorbent assay (ELISA) as described (Chin and Petersen 1995).

As shown in Table I, 4 (23.5 %) of the 17 chamois (95% Confidence Interval (CI) = 0.0956 – 0.4726) from the Austrian North Tyrol were seropositive, whereas 4 (9.5 %) of the 42 animals from the Italian province of Bolzano tested positive (95% CI = 0.0376 – 0.2354).

Sixteen of the 17 Austrian chamois came from the Sellrain valley, where the human index case occurred, and 3 of them tested positive. An additional positive animal was detected in the Austrian Karwendel mountains North of Innsbruck. This is of interest as 5 samples from Alpine ibex (Capra ibex) from the same Karwendel mountains were serologically negative for ORFV (not shown).

In contrast to North Tyrol, where mainly the location of the human index case was tested, the samples from South Tyrol originated from 9 areas as listed in Table I. The majority of seropositve chamois was detected in the Zillertaler mountains and 1 case occurred in the Ötztaler mountains, all close to the Austrian-Italian border (Figure 1). In the Ötztaler mountains infection of sheep had been reported in previous years including human cases (Larcher et al. 2009).

In game animals, parapoxviruses had been detected sporadically by molecular methods and some of these sequences had been included in Genbank (Scagliarini et al. 2011). But so far, no studies concerning the seroprevalence of parapoxviruses

Veterinaria Italiana 2014, 50 (3), 233-236. doi: 10.12834/VetIt.1304.14

Huemer et al.

Parapoxvirus infection in Chamois in Austria and Italy

Table I. Number of chamois positive for antibodies against parapoxvirus from different regions (Austrian and Italian) of the Tyrol alpine area (titer >1:40 in indirect immunofluorescence).

No. animals No. tested positive North Tyrol Sellrain valley 16 3 North Tyrol Karwendel 1 1 North Tyrol Summary 17 4 South Tyrol / Alto Adige Mühlwald 2 0 South Tyrol / Alto Adige Lappach 5 2 South Tyrol / Alto Adige Moos 5 1 South Tyrol / Alto Adige Pfunders 5 0 South Tyrol / Alto Adige Vahrn 5 0 South Tyrol / Alto Adige Mühlbach 5 0 South Tyrol / Alto Adige Terenten 5 1 South Tyrol / Alto Adige Vintl 5 0 South Tyrol / Alto Adige Trens 5 0 South Tyrol / Alto Adige Summary 42 4 Area

Location

in wild animals have been performed in Central Europe. Even in domestic animals, parapoxviruses are often ignored due to the mild symptoms of the infection. No national incidence/prevalence data of ORFV in sheep or goats are available for Austria or Italy. Therefore, we also tested domestic animals and found a rather high seroprevalence of parapoxviruses in Austrian sheep: 24 (63%) of 38 sheep from Styria and Tyrol were seropositive (95% CI = 0.4729 – 0.7662). This rate was significantly higher than the rate observed in goats (p < 0.0001 in Fishers exact test): only 5 (7%) of 71 goats had detectable antibodies against parapoxvirus (95% CI = 0.0304 – 0.1545). Whether this reflects a lower susceptibility for ORFV infection, a weaker immune response or regional differences in herding of goats remains speculative. However, the lower seropositivity rate of 10-20% of the tested chamois seems plausible given the rather solitary living of these animal, the infrequent contact with sheep on high mountain pastures as well as the presumably low risk of virus transmission via salt licks.

With the exception of variola, poxviruses often have a broad host tropism. The spreading of parapoxviruses to animals other than the common ruminant hosts has also been observed, especially in countries with a high density of sheep. In New Zealand, for instance, infection of cats with ORFV has been recently described (Fairley et al. 2008). Parapoxviruses have also been found in red deer (Cervus elaphus), which is considered a separate species: i.e. parapoxvirus of

Veterinaria Italiana 2014, 50 (3), 233-236. doi: 10.12834/VetIt.1304.14

Kufstein

Reutte Imst

Innsbruck

Kitzbuhel Schwaz

NORDTIROL

Landeck Sterzing Schlanders

SÜDTIROL- Bruneck ALTO ADIGE Meran

OSTTIROL Lienz

Brixen

Bozen

Figure 1. Geographic location of seropositive chamois samples.

Positive samples detected are from the Sellrain Valley, and the Karwendel mountains in North Tyrol and the Zillertaler Alps (right) and Ötztaler Alps (left) of the South Tyrol/Alto Adige area. red deer New Zealand (PVNZ) type (Robinson and Mercer 1995). Surprisingly, recently a PVNZ related strain has also been detected in red deer of Northern Italy (Scagliarini et al. 2011). Cattle might also be a source of infection for red deer as suggested by the detection of a strain related to pseudocowpox virus (PCPV) in American deer hunters (Roess et al.

2010). PCPV and ORFV also could cross the species barrier to reindeer (Rangifer tarandus), as severe outbreaks with both viruses have been described in those animals in Finland (Tikkanen et al. 2004). A similar situation seems to exist in Japanese serows (Capricornis crispus), goat/antelope-like mammals, in which bovine papular stomatitis virus (BPSV) as well as ORFV related strains have been found (Inoshima et al. 2001).

This report is the first to highlight that ORFV related parapoxviruses may have infected a significant number of wild animals in different areas of the Alpine mountains. Game animals, including chamois, could in return also serve as reservoir for infection of domestic animals and even zoonotic infections.

As poxviruses cause more severe disease in immunocompromised persons (Huemer et al. 2007, Larcher et al. 2009, Lederman et al. 2007), patients with autoimmune disease, rheumatoid arthritis, organ transplantation, taking chemotherapy for cancer, corticosteroids, or other immunosuppressive drugs, are advised to avoid direct contact not only to the known domestic reservoirs of parapoxviruses like sheep or goats, but also to wild animals or raw meat of game animals potentially susceptible to parapoxvirus infection.

235

Parapoxvirus infection in Chamois in Austria and Italy

Huemer et al.

References Centers for Disease Control and Prevention (CDC). 2012.

Human Orf virus infection from household exposures - United States, 2009-2011. MMWR Morb Mortal Wkly Rep, 61(14), 245-248.

Chin J.C. & Petersen R.K. 1995. Comparison of native and subunit antigens as ELISA reagents for the detection of antibodies against scabby mouth virus. Vet Microbiol, 46(1-3), 327-334.

Cottone R., Büttner M., Bauer B., Henkel M., Hettich E. & Rziha H.J. 1998. Analysis of genomic rearrangement and subsequent gene deletion of the attenuated Orf virus strain D1701. Virus Res, 56(1), 53-67.

Fairley R.A., Whelan E.M., Pesavento P.A. & Mercer A.A. 2008. Recurrent localised cutaneous parapoxvirus infection in three cats. N Z Vet J, 56(4), 196-201.

Haig D.M. 2006. Orf virus infection and host immunity.

Curr Opin Infect Dis, 19(2), 127-131.

Huemer H.P., Himmelreich A., Hönlinger B., Pavlic M., Eisendle K., Höpfl R., Rabl W. & Czerny C.P. 2007.

"Recreational" drug abuse associated with failure to mount a proper antibody response after a generalised orthopoxvirus infection. Infection, 35(6), 469-473.

Inoshima Y., Murakami K., Yokoyama T. & Sentsui H. 2001.

Genetic heterogeneity among parapoxviruses isolated from sheep, cattle and Japanese serows (Capricornis crispus). J Gen Virol, 82(5), 1215-1220.

Kitchen M., Müller H., Zobl A., Windisch A., Romani N. & Huemer H.P. 2014. Orf virus infection in a hunter presumably transmitted by game in Western Austria.

Acta Derm Venereol, 94(2), 212-214.

236

Larcher C., Daniel E., Pagani E., Maier K., Pasquetto V., Mellina-Bares M.F., Nemati E., Egarter-Vigl E., Zampieri P. & Huemer H.P. 2009. Generalized parapoxvirus infection associated with increased antibody titres for varicella zoster virus and measles. Eur J Dermatol, 9(4), 375-379.

Lederman E.R., Green G.M., DeGroot H.E., Dahl P., Goldman E., Greer P.W., Li Y., Zhao H., Paddock C.D. & Damon I.K. 2007. Progressive ORF virus infection in a patient with lymphoma: successful treatment using imiquimod. Clin Infect Dis, 44(11), e100-103.

Robinson A.J. & Mercer A.A. 1995. Parapoxvirus of red deer: evidence for its inclusion as a new member in the genus parapoxvirus. Virology, 208(2), 812-815.

Roess A.A., Galan A., Kitces E., Li Y., Zhao H., Paddock C.D., Adem P., Goldsmith C.S., Miller D., Reynolds M.G., Zaki S.R. & Damon I.K. 2010. Novel deer-associated parapoxvirus infection in deer hunters. N Engl J Med, 363(27), 2621-2627.

Scagliarini A., Gallina L., Dal Pozzo F., Battilani M., Ciulli S., Prosperi S. & Pampiglione S. 2004. Diagnosis of orf virus infection in humans by the polymerase chain reaction.

New Microbiol, 27(4), 403-405.

Scagliarini A., Vaccari F., Turrini F., Bianchi A., Cordioli P. & Lavazza A. 2011. Parapoxvirus infections of red deer, Italy. Emerg Infect Dis, 17(4), 684-687.

Tikkanen M.K., McInnes C.J., Mercer A.A., Büttner M., Tuimala J., Hirvelä-Koski V., Neuvonen E. & Huovilainen A. 2004. Recent isolates of parapoxvirus of Finnish reindeer (Rangifer tarandus tarandus) are closely related to bovine pseudocowpox virus. J Gen Virol, 85(6), 1413-1418.

Veterinaria Italiana 2014, 50 (3), 233-236. doi: 10.12834/VetIt.1304.14

a cura di Manuel Graziani

LIBRI/Book reviews

(a cura di) Paolo Ciaramella

Semeiologia Clinica Veterinaria (Poletto, pp. 632, € 95,00) www.polettoeditore.it

Il grado di specializzazione raggiunto nel settore clinico veterinario non è dissimile da quello presente in campo umano, soprattutto se si pensa agli animali d’affezione che sono oramai considerati parte integrante di una società moderna e civile in cui anche il fattore benessere animale ha acquisito importanza non secondaria, in particolare nell’allevamento degli animali da reddito. In questo contesto è sempre più richiesta la figura di uno specialista competente e aggiornato, in grado di risolvere in modo adeguato le problematiche che gli vengono proposte, in un mercato in concorrenza che non contempla imperizia, inesperienza e ignoranza professionale. Lo studio della semeiologia clinica è uno dei primi passi di questo lungo e affascinate cammino che permette di apprendere un metodo di analisi sistematico, affidabile, efficiente e accurato per educare il futuro medico veterinario verso le procedure della buona pratica clinica. La semeiotica insegna ad allenare i propri sensi: a guardare attraverso l’osservazione diretta e indiretta, a sentire ascoltando suoni o rumori, a percepire sensazioni tattili e, non da ultimo, a saper discernere con cognizione e competenza quando ricorrere alle indagini strumentali e di laboratorio; sempre e comunque nella consapevolezza che non possono in nessun modo sostituire l’esame fisico diretto del paziente.

Paolo Ciaramella, professore ordinario di Clinica Medica Veterinaria all’Università Federico II di Napoli, presenta così il volume che ha curato: “L’idea di questo libro ha preso forma durante un simposio di medicina interna tenutosi a Torino nel 2008. Con alcuni colleghi presenti si pensò alla possibilità di elaborare un nuovo testo di Semeiotica Medica che potesse ampliare e aggiornare il glorioso Messieri e Moretti, non tanto perché esso avesse perduto il suo valore intrinseco, quanto piuttosto perché nel corso degli anni sono cambiate la patologia animale e con essa la semeiotica e la clinica.”

Semeiologia Clinica Veterinaria è un corposo volume di oltre 600 pagine, frutto di un lavoro di gruppo cui hanno partecipato cultori diversi delle discipline cliniche provenienti dall’Università ma anche liberi professionisti. Un volume “importante” anche nella forma, cartonato e di grande formato (22x28 cm), e multimediale in quanto corredato da video visualizzabili sul sito dell’editore attraverso un codice di accesso riportato all’interno.

237

LIBRI/Book reviews

a cura di Manuel Graziani

FNOVI, Autori Vari

Rapporto Nomisma 2014: La professione medico veterinaria Prospettive future (Agra Editrice, pp. 154, € 18,00)

Il presidente della Federazione Nazionale degli Ordini Veterinari Italiani (FNOVI), Gaetano Penocchio, si pone alcune domande: “Chi siamo per il “mondo del lavoro”? Quanto ha bisogno di noi?

Siamo preparati a rispondere o a stimolare la domanda di professionalità veterinarie? Come restare competitivi e come garantire nuovi sbocchi occupazionali?”. Il nuovo Rapporto sulla professione medico veterinaria, che esce a 4 anni di distanza dal precedente ed è ancora curato da Nomisma, nasce proprio per dare risposta agli interrogativi di cui sopra, proponendosi come strumento informativo aggiornato per il mondo veterinario e per le Istituzioni, nonché come strumento di approfondimento su cui fondare ulteriori riflessioni.

Il volume si focalizza soprattutto sui diversi ambiti occupazionali del medico veterinario e sulla dimensione prospettica al 2030 dei possibili scenari evolutivi della professione. Lo “sguardo demoscopico” del Rapporto non prescinde da un dato che deve far riflettere, ovvero che in Italia il rapporto fra popolazione e medici veterinari è (ancora) il più alto d’Europa. In vent’anni i veterinari sono raddoppiati fino agli attuali 30.415 di cui il 77% liberi professionisti, quindi esposti al rischio di non avere una continuità lavorativa. Tutto questo, peraltro, nel pieno di spinte recessive che ciclicamente colpiscono il Paese e nel quadro di una crisi globale che si protrae dal 2007. Eppure il Rapporto mette in luce che il 27% delle esportazioni italiane è rappresentato da prodotti alimentari di origine animale e che il comparto della filiera agroalimentare, strettamente connesso alla professione medico veterinaria, ha tenuto contenendo il calo dei consumi alimentari. Una chiave per rilanciare la professione potrebbe essere, ad esempio, quella della specializzazione nell’ambito della sicurezza alimentare: un settore poco curato soprattutto in ambito universitario, come afferma il presidente della FNOVI che chiosa così: “La competenza è tale quando è applicata e si trasforma in sviluppo collettivo, agendo su dinamiche di mercato più virtuose e governance di pianificazione e controllo improntate ad una organizzazione pubblica ammodernata, guidata da una classe veterinaria con capacità gestionali, regolatorie e di analisi utili allo sviluppo di una catena alimentare che scorre veloce su ingranaggi leggeri in quanto sburocratizzati e affidabili in quanto fondati sulla più qualificata gestione del rischio.”

238

IN MEMORIAM Cinzia Prencipe: a discrete presence, an astonishing bravery DVM, 1967-2014

Dr Vincenza Annunziata Prencipe, Cinzia for her friends and colleagues, passed away.

She passed away quietly, discretely, in the same way she lived her life, after a long and painful sickness to which she never bowed.

With an absolute pride she kept working for as long as possible, making of her work her reason for living, the source of her strength and of her energy to fight an unrelenting destiny, which did not gave her a second chance. The Institute was always a second family, a home, to Cinzia. This has been the case since the very same moment she began working here, as a young researcher at an early stage of her career. She never stood back or denied her support to any of her colleagues and was always keen to share her research results, her passion and determination for the scientific truth.

Within our Institute, Cinzia was always reliable, a source of scientific knowledge as well as of wise advices.

With discretion and determination she carved her career achieving important goals, which at the same time also allowed the Institute to gain visibility and respect both at national and international levels.

With her departure, the candle of her knowledge and wisdom, which led her life and her career, burned to soon.

We lost a generous person, who devoted time and efforts to all of us, who never denied help and support to her friends and colleagues.

Thank you Cinzia, thanks for having accompanied us on this road and for having followed your dreams in a lab, our lab. Thanks for having shown us, especially during your illness, your braveness and commitment, making of your sense of human dignity a model for all of us. You have been an example of will power and stubbornness, which none of us will ever forget.

IN MEMORIAM

Cinzia Prencipe: una presenza discreta, un coraggio ostinato DVM, 1967-2014

È venuta a mancare la Dottoressa Vincenza Annunziata Prencipe.

Cinzia per tutti i colleghi e gli amici. È andata via in silenzio, quasi in punta di piedi com’era suo costume vivere, dopo una lunga e dolorosa malattia alla quale non si è mai voluta piegare.

Con orgoglio ostinato è rimasta con noi fino a quando ha potuto, facendo del lavoro una ragione di vita, una fonte di forza e di energia per combattere contro un destino inesorabile che non le ha consentito una prova d’appello. Per Cinzia l'Istituto è sempre stato la sua seconda famiglia, la sua casa. Sin da quando è arrivata, giovane ricercatrice all'inizio della carriera, non si è mai risparmiata, non ha mai negato le sue energie e ha sempre messo a disposizione di tutti noi il suo studio, la sua passione, la sua determinazione ad arrivare sempre fino in fondo.

Cinzia è sempre stata una certezza, una fonte di conoscenza, un giudizio pacato, una risposta sicura.

Con discrezione e determinazione allo stesso tempo, ha cercato i suoi spazi, ha raggiunto i suoi traguardi e con lei l’Istituto ha potuto guadagnarsi la stima, la fiducia e la credibilità che servono per dialogare a livello nazionale e soprattutto internazionale.

Con la sua scomparsa si spegne una luce, la luce della conoscenza e della saggezza che hanno sempre guidato le sue scelte e il suo percorso.

Se ne va anche una persona generosa, che ha voluto dedicare tempo e fatica a tutto e a tutti, senza mai tirarsi indietro, senza mai dire di no, senza mai anteporre le proprie priorità.

Grazie Cinzia, grazie per aver fatto tanta strada con noi e per aver inseguito i tuoi sogni tra le mura di un laboratorio, il nostro. Grazie per aver fatto della tua dignità soprattutto nella malattia, un modello di coraggio e impegno, un esempio di volontà e caparbietà che resteranno per noi un insegnamento.

IN MEMORIAM Paolo Cordioli: passion and talent at the service of international veterinary research DVM, 1956-2014

Paolo Cordioli spent more than 30 years working at the Istituto Zooprofilattico Sperimentale della Lombardia e dell’Emilia Romagna (IZSLER), where he developed his career and reached a high level of expertise. Along with his career, also the IZSLER grew over the past decades to become a centre of excellence for the veterinary virology.

Paolo was a great scientist, with a formidable knowledge of “ortodox” diagnostic virology (which is in these days overlooked by young researchers fascinated by more innovative methods relying on biomolecular techniques). He was also eclectic, ingenious and capable of mastering different fields within veterinary research and practise: from epidemiology to vaccinology, from control and surveillance to the regulation of veterinary policing.

Like many other researchers of his generation, before joining the Virology Laboratory, he had a comprehensive training, which began at the Laboratory of Virological Diagnostic in February 1987. Throughout these years, the structure of the IZSLER supported his scientific growth and training and gave him the chance to express his potentialities and to collaborate with a group of scientists, who later founded one of the first laboratories of Veterinary Biotechnologies and Molecular Biology in Italy.

Paolo was moved by an innate gumption as well as by the ability to foresee the needs of the field. He focused on the virological and serological diagnosis of the most common respiratory and enteric diseases in bovines and pigs, on producing viral antigens and on developing new diagnostic methods.

Although he was very much committed to applied research, he never undermined the importance of presenting the results of his studies at meeting and conferences, both national and international. He was always aware of the relevance of being an active member of the scientific community, in which he participated with enthusiasm and prodigality offering valuable suggestions and presenting scientific innovations as well as grooming his eagerness for scientific knowledge.

Such an eagerness, his attitude to constant scientific updates, has been a distinguishing mark of his life, which was very well represented by Paolo’s desk, always crowded by scientific articles, witnessing his enthusiasm for scientific training and mentoring as well as for passing scientific knowledge to collaborators and colleagues. It is not a coincidence that he was member of the steering boards of several scientific societies like the SIPAS o la SIDILV (for which he served as secretary).

Paolo had a fast pace career which, despite his reserved character and his attitude “to do things” more than “to appear”, deservingly led him to the top management of the IZSLER.

IN MEMORIAM In 2008 he was appointed Direttore Sanitario of the IZSLER, a position that he accepted scarifying his passion for the laboratory work in the name of the respect for his profession and for the work of his colleagues. After one year from the appointment, having achieved all the relevant goals, he resigned to return to work in his Virology ward, to continue to focus on diagnostic and on applied research.

Although he knew the relevance of his scientific publications, Paolo never vaunted it nor did he keep an up to date list of his publications. However, it is worth mentioning that the IZSLER archive keeps 345 entries concerning his work focusing on the most diverse topics: avian and pig flu, enteric and respiratory diseases in cattle (IBR, BVD, pestivirus, rota and coornavirus), in pigs (PRRS, pseudorabbia, parvovirus, circovirus) and viral illnesses transmitted by vectors (TBSE, SBV, WND, Usutu, SBV, CHIKV).

Memories of Paolo, of a bright and reserved man, devoted to his family (to his wife and his three children), passionate for art, literature, movies and theatre, will always remain with us. The stories, the anecdotes, the confidences proper of the daily life shared with him for more than 30 years will always keep him among us.

Moreover, his lessons will remain alive. We are aware of our duties: looking ahead, moving forward so to continuing working on the road that he paved for us, in the constant attempt of improving our scientific efforts by following his example. No doubt that it will be tough, but we have to do it to honour his memory.

IN MEMORIAM

Paolo Cordioli: passione ed intuito al servizio della veterinaria internazionale DVM, 1956-2014

Paolo Cordioli ha trascorso oltre 30 anni all’Istituto Zooprofilattico Sperimentale della Lombardia e dell’Emilia Romagna.

Vi è cresciuto professionalmente sino a raggiungere elevati livelli di competenza tecnica così come, con Lui, l’Istituto è cresciuto sino a diventare centro di eccellenza per la virologia veterinaria.

Paolo era un ricercatore di gran valore dotato di un ineguagliabile bagaglio di conoscenze, prediligeva la virologia quella diagnostica “classica”, quella che oggi troppo spesso viene snobbata dai giovani ricercatori ammaliati dai metodi innovativi basati su tecniche biomolecolari. È stato un tecnico eclettico, capace, geniale, con una competenza “allargata” in molti campi della veterinaria: dall’epidemiologia alla vaccinologia, dal controllo al monitoraggio, fino alle norme di polizia veterinaria.

Del resto, prima di approdare al Laboratorio di Virologia, al pari di molti altri veterinari della sua generazione, aveva sviluppato una preparazione a 360 gradi.

Inizia nel febbraio del 1987 la sua straordinaria avventura nel Laboratorio di Diagnostica Virologica. L’assetto organizzativo dell’ IZSLER ne favorì la formazione e la maturazione tecnica, dandogli l’opportunità di esprimere pienamente le proprie potenzialità e collaborare con il gruppo di lavoro che, da lì a qualche anno, avrebbe fondato uno dei primi Laboratori di Biotecnologie Veterinarie e Biologia molecolare in Italia.

Animato da un forte senso pratico e da un’innata capacità di intuire e prevedere le esigenze del territorio, si interessava di diagnosi virologica e sierologica delle principali malattie respiratorie ed enteriche di bovini e suini, della produzione di antigeni virali a scopo diagnostico e della messa a punto e standardizzazione di nuove metodiche diagnostiche.

Pur focalizzando l’attenzione sulla finalità ultima di trasferire il frutto della ricerca nella pratica quotidiana, non trascurava la presentazione dei risultati a Convegni e Congressi, nazionali ed internazionali, conscio dell’importanza di essere membro attivo di una comunità scientifica cui partecipava con slancio e generosità, prodigo di consigli e novità ma anche “affamato” di conoscenza. L’attitudine alla lettura, all’aggiornamento ne ha caratterizzato la vita, come testimoniavano le pile di articoli della letteratura scientifica che affollavano sempre la sua scrivania, una vocazione non fine a se’ stessa ma sempre propensa a formare, insegnare e trasmettere conoscenza a collaboratori e colleghi. Non a caso è stato più volte membro di direttivi di società scientifiche come la SIPAS o la SIDILV (che lo aveva quale Segretario).

Una carriera fulgida che, nonostante il carattere schivo e l’innata attitudine a “fare”

IN MEMORIAM più che “apparire”, lo portava a scalare velocemente, e con merito, le gerarchie all’IZSLER. Nel 2008 veniva nominato Direttore Sanitario, incarico che accettava per amore del suo lavoro, ma unitamente al lavoro di tutti, sacrificando la passione per il laboratorio. Dopo un anno in tale ruolo, considerando esaurito il compito, lasciava l'incarico per tornare volontariamente al Suo Reparto di Virologia, ove continuava a profondere il proprio impegno nella diagnostica e nella ricerca applicata.

Pur non conoscendo la consistenza esatta della sua produzione scientifica, era il primo a non vantarsene e a non tenerne un elenco aggiornato. La consultazione del catalogo delle pubblicazioni IZSLER restituisce ben 345 records , che abbracciano molteplici e diversi temi e argomenti. Particolarmente ricordiamo l’influenza aviaria e suina, le malattie enteriche e respiratorie dei bovini (IBR, BVD, pestivirus, rota e coornavirus), dei suini (PRRS, pseudorabbia, parvovirus, circovirus) e le malattie virali trasmesse da vettori (TBSE, SBV, WND, Usutu, SBV, CHIKV).

Ci resta il ricordo grato di Paolo: di un uomo intelligente e schivo, dedito alla famiglia (alla moglie e ai tre figli), appassionato d’ arte, di lettura, di cinema e teatro. Restano le testimonianze, gli aneddoti, le confidenze proprie di una convivenza quotidiana protrattasi per oltre 30 anni, che lo rendono ancora vivo e presente in noi.

Di Lui soprattutto resta e vive ciò che ci ha insegnato: guardare avanti, seguendo la strada che ha tracciato, migliorarci sulla scorta del suo esempio. Sarà dura, non c’è dubbio, ma Paolo merita tutto ciò.