Incidence of Listeria monocytogenes in some slaughtered animals at Dakahlia province slaughterhouses - Egypt . Eldaly, E.A1. El-Gaml, A.M2. and Marwa E.Elkenawy2 1-Food Control Dept., Faculty of Vet. Medicine, Zagazig University Zigzag/Egypt. 2- Research Institute Institute of Vet. Medicine, Mansoura Lab., Mansoura, Egypt.
Abstract Listeria monocytogenes has gained worldwide interest because it causes food borne illnesses. Present study was performed on 630 specimens who were collected from 90 slaughtered carcasses (30each of cattle, buffalo and sheep) after their postmortem examination and passed as fit for human consumption. Such samples representing (Heart, Liver, kidney, muscle, mesenteric L.N., Skin of neck, Intestinal content) were randomly collected from different Governmental abattoirs located at Dakahlia province, Egypt through the period extended from 2011 to 2012. The obtained results revealed that the examined sheep samples had the highest incidence of L.monocytogenes, 23(10.95%), followed by buffalo samples 14(6.7%), meanwhile, the examined cattle samples had the lowest incidence 11(4.8%) respectively, with overall recoveries 48(7.62%).L. monocytogenes was much higher in Intestinal contents followed by liver samples, then mesenteric l.n. Skin of neck, Kidney, liver and muscle samples respectively. The isolates of L. monocytogenes were found pathogenic by using Multiplex PCR incorporating inlA,inlC and inlJ primers and PCR incorporating listeriolysin O virulence gene hlyA. The public health hazards as well as suggestive measures to reduce human Listeriosis have been discussed.
Introduction The importance of meat in the diet is as a concentrated source of protein which is not only of high biological value but its amino acid composition complements that of cereal and other vegetable proteins. It is also a good source of iron and zinc and several B vitamins, and liver is a very rich source of vitamin A. However consumption of such palatable and nutritious foods may cause many hazards to the consumers probably due to contamination with various food borne pathogens such as L. monocytogenes, therefore, the safety of meat calls for control throughout the food chain from the farm of origin, and inspection before and after slaughter, to the handling and storage of meat and the products until the time it is consumed. Listeriosis is a serious public health issue due to its severity of infection and high case fatality rate. According to the Centers for Disease Control and Prevention (CDC), there are an estimated 2,500 cases of Listeriosis in the United States each year, resulting in 500 deaths FDA-FSIS.(2003).Persons with compromised immune systems, pregnant women, neonates, and the elderly are at the greatest risk of Listeriosis.
foods may become contaminated with L. monocytogenes due to cross contamination or physical contact with contaminated raw foods (Mead et.al,1999). The ubiquitous nature of L. monocytogenes in the environment poses a challenge in reducing cases of listeriosis. The food industry is incapacitated in producing food free of this pathogen. Its wide distribution increases the chances of cross–contamination between appliances or several products during processing. Listeria also has the ability to colonize surfaces, forming biofilms that remain attached to equipment used in food production (Wong et al., 1998). The organism ability to grow at low water activity, low pH (Buchanan et al., 2000) as well as refrigerated vacuum packed food products (Duffy et al., 1994) makes it difficult to eliminate from retail food products. L. monocytogenes is also problematic due to its resistance to multiple antibiotics, which makes it difficult to treat (Charpentier et al., 1995). The high incidence o f L. monocytogenes in foods ( Farber and Peterk in, 1991; Jorgensen and Hus s, 1998 ) and the high fatality rate associated with listeriosis, has contributed to L.monocytogenes being considered as a public health hazard and causing loss to many food processing. The important characteristics of L. monocytogenes contributing to foodborne transmission, are the ability to grow as low as − 0.4 °C (Walker et al., 1990), withstand osmotic stress and survive mild preservation treatment (Linton et al., 1992; Lovett, 1989 ),measures commonly used to control the growth of organisms in foods. The unique ability of multiplication in food stored in refrigerators, increase the risk of infection from contaminated cold foods including chilled ready to eat (RTE) foods. Therefore, this study was designed to throw a light on the presence of L. monocytogenes in some slaughtered animals in Governmental abattoirs as well as detection the virulence genes beside its pathogenicity by detection of listeriolysin O virulence gene. Material and methods Collection and preparation of samples: A total of 630 specimens were collected from 90 apparent healthy slaughtered carcasses (30each of cattle, buffalo and sheep) after their post-mortem examination and passed as fit for human consumption. Such samples representing (Heart, Liver, kidney, muscle, mesenteric L.N., Skin of neck, Intestinal content) were randomly collected from different Governoratal abattoirs located at Dakahlia province, Egypt. Samples were collected separately in sterile plastic bag, .well identified. The specimens were transported in ice box (4ْ c) to Mansoura Veterinary laboratory within 2hrs. after collection. Collected Samples were cultured on the same day. Isolation of L. monocytogenes: The techniques recommended by (USDA), "FSIS" (1989) and FAO (1992) were adopted as following: Enrichment procedure: Twenty five gm. from each collected sample was aseptically weighted and added to 225ml. of Listeria Enrichment Broth, University of Vermont Medium
provided from Biolife (LEBUVMІ). The mixture was homogenized by using sterile mixture (New National) at high speed for 2 minutes. The inoculated enrichment was incubated at 30°C for 24 hrs. then 0.1 of incubated (LEBUVMІ) were transferred to 10 ml (LEBUVMП) and further incubated at 30°C for 24 hours. A loopful from each of enrichment culture UVMІ and UVMП broth were streaked onto PALCAM agar plates, and then incubated at 30°C for 48 hours (Van Netten et al., 1998 and Jemmi and Keusch, 1994).Colonies showing morphological characters as dew drop-like, black with brown hallow, or dark brown colonies 1-2 mm in diameter were streaked onto Trypticase soya agar supplemented with 0.6%-yeast extract (TSA-YE) and incubated at 30°C for 24 hours till obtaining satisfactory pure separate colonies; which will inoculated into semisolid agar and kept in refrigerator at 4°C for further identification Identification of isolates: Pure presumptive isolate were identified morphological by Gram's stain and biochemically according to FAO (1992) using the following chemical test by using motility, catalase ,oxidase, Asculin hydrolysis, haemolysis on sheep blood agar, CAMP test and for further confirmation of L.monocytogenes the isolates were inoculated into 0.5% carbohydrate broth fermentation media of (xylose, rhamnose and manitol). Genomic DNA extraction: (Liu et al., (2007). Suspected colonies obtained by cultural methods were resuspended in nutrient broth and incubated at 37oC for 24hrs. Bacterial cells were harvested in a micro-centrifuge tube and centrifuged at 10,000rpm for 30 seconds. Bacterial pellets were resuspended and washed in 200 µl physiological saline, then centrifuged at 10,000rpm for 30 seconds. The cells pellets were resuspended in 200 µl of physiological saline, followed by adding 200 µl buffer CB and 20 µl proteinase K(20mg/ml).The solution was thorough mixed, incubation at 70oC water bath for 10min,then cooled to room temperature; 100 µl of isopropyl alcohol was added and mixed. The last step, solution was then transferred into a spin-column AC, centrifugation at 10,000rpm for 2 min. and then flowthrough was discarded adding IR buffer (500 µl), centrifuged at 12,000rpm for 30seconds, discarding the flow- through, spin-column was centrifuged at 13,000rpm for 2 min. to remove the ethanol, spin-column was placed in the clear centrifuge tube for elution of the extracted DNA. Elution of the extracted DNA One hundred µl of preheated buffer EB was added into the column, incubated at room temperature for 3-5 min. centrifuged at 12,000rpm for one min. to recover the purified DNA. Multiplex PCR for detection of Internalin genes Oligonucleotide primers synthesized by BioTeke Corporation (Canada) were used for the amplification of L. monocytogenes Internalin genes inlA, inlC and inlJ. The inlA primers were intended for species-specific recognition, and the inlC and inlJ primers were designed for virulence determination of L. monocytogenes. Table (1) shows the sequence of the primers and the expected product sizes
PCR for detection of Listeriolysin O virulence genes For the detection of Listeriolysin O virulence gene (hlyA) in the molecularly identified L. monocytogenes according to Jaradat et al. (2002), the primers synthesized by BioTeke Corporation (Canada) had the following sequences: hlyA-Forward: 5'- CGG AGG TTC CGC AAA AGA TG-3' and hlyA-Reverse: 5'- CCT CCA GAG TGA TCG ATG TT-3' (Mengaud et al., 1989). The reaction was performed in 25 µl reaction volume containing 12.5 µl of readymade 2 x PCR master mixes (BioTeke Corporation) and 100 nM of each hlyA primers and 2 µl of the purified DNA. A reaction mixture with no added DNA was run in the PCR as a negative control.figure (2) Table (1): Primer sequences and expected product sizes of the multiplex PCR (Liu et al., 2007).
Gene
InlA InlC InlJ
Primer sequence (5' 3')
inlA-Forward ACGAGTAACGGGACAAATGC inlA-Reverse
CCCGACAGTGGTGCTAGATT
inlC-Forward AATTCCCACAGGACACAACC inlC-Reverse
CGGGAATGCAATTTTTCACTA
inlJ-Forward
TGTAACCCCGCTTACACAGTT
inlJ-Reverse
AGCGGCTTGGCAGTCTAATA
Expected product size (bp)
800 bp 517 bp 238 bp
N.B.: bp=base pair Gel electrophoresis All amplification products were resolved in 1% agrose gel, stained with ethidium bromide, detected under a short wavelength UV light source, and photographed with EDVOTEX gel documentation system. The 1-KE plus DNA ladder (Invitrogen) was used as molecular size marker. Pathogencity test: Each strain of well identified of L. monocytogenes was isolated from the examined samples grew overnight in trypticase soya broth with o.6% yeast extract at 37oC, centrifuged and the sediment was suspended in physiological saline(o.9%) and adjusted to the level used for inculcation ( 108 cell/ml). Each mouse was inoculated intraperitonealy with 0.1ml. of the bacterial suspension, the inoculated mice were maintained under observation for evaluation of clinical signs and moralities. Control mice were inoculated intraperitonealy with 0.1ml of physiological saline. The liver, spleen and brain of each dead mouse were collected and screened for the presence of L. monocytogenes using Palcam medium.
Results and discussion Table (2) Incidence of Listeria monocytogenes in the examined samples of slaughtered animals Type of examined samples
No. of examined samples
Heart Liver Kidney Muscle Mesenteric L.N. Skin of neck
30 30 30 30 30 30 30 210
Intestinal content
Total
Sheep N o. 2 3 2 2 4 3 7 23
Cattle
Buffalo
%
No.
%
No.
%
6.7 10.0 6.7 6.7 13.3 10.0 23.3 10.95
1 3 2 1 2 2 11
3.3 10 6.7 0 3.3 6.7 6.7 4.8
1 4 2 1 2 2 2 14
3.3 13.3 6.7 3.3 6.7 6.7 6.7 6.7
Total No. of examined samples 90 90 90 90 90 90 90 630
No. of +ve samples No.
%
4 10 6 3 7 7 11 48
4.40 11.11 6.67 3.33 7.78 7.78 12.22 7.62
Fig.: (1)Agarose gel electrophoresis of inlA, inlC and inlJ amplicons obtained from L. monocytogenes suspected isolates (L: 100 bp ladder, 1: positive control of L. monocytogenes, 2: negative control, 3-10: suspected L. monocytogenes DNA from the examined samples)
Fig 2: Agarose gel electrophoresis of listeriolysin O amplicon (234 bp) obtained from L. monocytogenes suspected isolates (L: 100 bp ladder, 1: negative control, 2: positive control of L. monocytogenes, 3-11: suspected L. monocytogenes DNA from the examined samples)
The obtained results in Table (2) revealed that the examined sheep samples had the highest incidence of L.monocytogenes, 23(10.95%), followed by buffalo samples 14(6.7%), meanwhile, the examined cattle samples had the lowest incidence 11(4.8%) out of 210samples of each respectively, with overall recoveries 48(7.62%). Such results coincide with that reported by Yu et al.(1995); Gomez et. al. (1999); Bailey et al. (2003) and Madden et al. (2007). Meanwhile, higher percentages were found by Destro et al, (1991); Varabioff (1992); Amal and Ali (1999) and SCVM. (2000). The frequencies L. monocytogenes (4.8 and 6.7 %) in bovine carcasses (cattle and buffalo respectively) obtained in this research were higher than those reported by Madden, Espie, andMoran (2001), who did not detect the presence of the genera in 200 samples of carcasses in North Ireland. Fenlon, et.al, (1996) found 7% of positive carcasses for L. monocytogenes in the United Kingdom. In 2089 carcasses from the United States, 4.1% were positive for L. monocytogenes (McNamara, 1995), and in Australia this frequency was 0.77% (n=130) in carcasses from exporting slaughterhouses (Vanderlinde, et.al, 1998). It should also be pointed out that sampling animal at the abattoirs is likely to result in a higher prevalence because of the stress effect of transportation of them on the shedding rate (Fenlon et al. 1996). Other studies reported higher shedding rates among pastured animals to be processed at the abattoir (Buncic 1991; Bailey et al. 2003). We believe that these higher rates are a reflection of
the variation in the impact of transportation stress among animals which harboured the organism and the change in the immediate environment in terms of crowding, however, the occurrence of the organism was reported to vary by region among beef cattle slaughtered in the United States (Rivera-Betancourt et al. 2004). This variation in the occurrence of the organism among farms in the study population could be attributed to several factors including management and geography (Fenlon et al. 1996; Ueno et al. 1996). On the other hand, the results of the examined samples it is clear that the intestinal content samples of sheep carcasses had the highest percentages (23.3%), followed by mesenteric lymph nodes of sheep (13.3%), then the liver samples of buffalo (13.3%) and liver samples of sheep and cattle (10% of each), meanwhile, the lowest recovery of L. monocytogenes was found in heart and muscle samples of the examined animals which ranged from 0% to 3.3%.(table 2). Nearly similar values were reported by Jalali and Abedi (2008). The occurrence of L. monocytogenes in beef and meat products is described in several countries, emphasizing the contamination during the processing to the final and ready-to-eat products (Cordano & Rocourt, 2001; Rørvik, et.al, 2003;Mena et al., 2004 and Uyttendaele, et.al, 1999). Analysis the PCR profiles, 10 of Listeria isolated strains showed amplified products (Fig.1) 800bp, 517bp and 238bp) which are species specific and 200bp which is virulence specific of L. monocytogenes (Fig.2) this results suggests the presence of a significant public health hazard linked to the consumption of meat of such slaughtered animals as well as their products as they contaminated by pathogenic L. monocytogenes.
Contamination of the meat with L. monocytogenes generally occur after the slaughter and may come from the skin of the animals, the hands of the workers, the equipment and the tools used (Marinsek and Grebenc, 2002).It is also important to comment that the presence of any listeria spp. may be indicative of poor hygiene and cross-contamination scenarios which cold favor the persistence of L. monocytogenes (Azevedo et al., 2005). In order to minimize human listeriosis, foods should be cooked to an internal temperature of 70°C for more than 20 minutes to ensure distraction of l. listeria monocytogenes. Reheat cooked food thoroughly (70°C) immediate aseptic packaging of the finished product to avoid post processing environmental contamination. Proper cold storage of meat and meat products (freezing -18°C) and proper personal hygiene of food handlers is advisable (Mahmoud et al., 2003).
References Amal, A.M. and Ali, M.M. (1999): incidence of Listeria monocytogenes in some meat products and poultry. Assuit Vet. Med. J. 40 (80): 187 – 196. Azevedo,I.; Regalo,M.;Menaa,C.; Almeidaa,G.;Luısa Carneiro,L.; Teixeira,P.; Hogg,T and Gibbs,P.( 2005 ): Incidence of Listeria spp. in domestic refrigerators in Portugal. Food Control Volume 16, Issue 2, February 2005, Pages 121–124 Bailey, G.D., Vanselow, B.A., Hornitzky, M.A., Hum, S.I., Eamens, G.J., Gill, P.A., Walker, K.H. and Cronin, J.P. (2003): A study of the foodborne pathogens: Campylobac-ter, Listeria and Yersinia, in faeces from slaughter-age cattle and sheep in Australia. Commun Dis Intell 27, 249–257. Buchanan, R.L, Smith, J.L, and Long W. (2000): Microbial risk assessment: doseresponse relations and risk characterization. International Journal of Food Microbiology, Vol. 58, No. 2000 (November 2000), pp. (159-172). Bunci, S., (1991): The incidence of Listeria monocytogenes in slaughtered animals, in meat, and in meat products in Yugoslavia. International Journal of Food Microbiology 12, 173–180. Charpentier, E., Gerbaud, G., Jacquet, C., Rocourt, J. and Courvalin, P. (1995): Incidence of antibiotic resistance in Listeria species. Journal of Infectious Diseases 172: 277-281. Cordano, A. M., & Rocourt, J. (2001): Occurrence of Listeria monocytogenes in food in Chile. International Journal of Food Microbiology, 70,175–178. Destro, M.T., Melo-Serrano, D.A and Kabuki, D.Y. (1991): isolation of listeria spp. from some Brazilian meat and dairy products. Food control, 2:110-174. Duffy, L.L., Vanderlinde, P.B., and Grau, F.H. (1994): Growth of Listeria monocytogenes on vacuum-packed cooked meats; effects of low pH, aw, nitrite and ascorbate. International Journal of Food Microbiology, Vol. 23, issues 3-4 (November 1994), pp. (377-390) FAO (1992): Manual of food quality control. 4 Rev. Chapter 11, pp. 119-129. 1. Microbiological analysis of food and Agriculture Organization of the United Nation, Rome. Farber,J.M. Peterkin,P.I., (1991): Listeria monocytogenes, food-borne pathogen Microbiology Reviews 55, 476-511. FDA-FSIS. Date, (2003) : Quantitative assessment of relative risk to public health from foodborne Listeria monocytogenes among selected categories of ready-to-eat foods. Available at: http://www.foodsafety.gov/~dms/lmr2toc.html. Accessed. Fenlon, D.R., Wilson, J., Donachie, W., (1996): The incidence and level of Listeria monocytogenes contamination of food sources at primary production and initial processing. Journal of Applied Bacteriology 81, 641–650. FSIS ˝United State Department of Agriculture, Food Safety Inspection Service˝ (1989): Method for the isolation and identification of Listeria monocytogenes from meat and poultry products. Laboratory Communities. NO. 57, US Department of Agriculture, Washington, D.C. Gomez, G., J.L. Fernandez, M.C. and Rodriguez J.M. (1999): Incidence of Listeria monocytogenes and Escherichia coli O157:H7 in meat and meat products marketed at Castilla and Leon Alimenntaria. 36 (303): 71-75.
Jalali, M. and Abedi, D.(2008) :Prevalence of Listeria species in food products in Isfahan, Iran. International Journal of Food Microbiology 122 (2008) 336 – 340 Jaradat, Z. W.; Schutze, G.E. and Bhunia, A.K. (2002): Genetic homogeneity among Listeria monocytogenes strains from infected patients and meat products from two geographic locations determined by phenotyping, ribotyping and PCR analysis of virulence genes. International Journal of Food Microbiology 76: 1 – 10. Jemmi, T. and Keusch, A. (1994): Occurance of listeria monocytogenes in fresh water fish farms and fish-smoking plants. Food Microbiol. 11: 309-316. Jorgens e n, L .V., Huss , H. H. , (1998): Prevalence and growth of Listeria monocytogenes in naturally contaminated seafood. International Journal of Food Microbiology 42, 127– 131. Linton, R.H., Webster, J.B., Pierson, M.B., Bishop, J.R., Hackney, C.R., (1992): The effect of sublethal heat shock and growth atmosphere on the heat resistance of Listeria monocytogenes. Scott A. Journal of Food Protection 55, 284–287. Liu, D., Lawrence, M.L., Austin, F.W., Ainsworth, A.J. (2007): A multiplex PCR for species- and virulence-specific determination of Listeria monocytogenes. Journal of Microbiological Methods 71: 133–140 Lovett, J., (1989): Listeria monocytogenes. In: Doyle, M.P. (Ed.), Foodborne Madden, R.H., Murray, K.A. and Gilmour, A. (2007): Carriage of four bacterial pathogens by beef cattle in Northern Ire-land at time of slaughter. Lett Appl Microbiol 44, 115–119. Mahmoud, M.S., Ahmed, A.N. and Hussain, I. (2003): Prevalence of Listeria monocytogenes in poultry meat, poultry meat products and other related inanimates at faisaladad. Pakistan journal of nutrition, 2(6): 346-349. Marinsek, J. and Grebenc, S. (2002): Listeria monocytogenes in minced meat and thermally untreated meat products in Slovenia. Slovenian Veterinary Research, 39 (2): 131-136. McNamara, A. M. (1995): Establishment of baseline data on the microbiota of meats. Journal of Food Safety, 15, 113–119. Mead, P. S., L. Slutsker, V. Dietz, L. F. McCaig, J. S. Bresee, C. Shapiro, P. M. Griffin, and R. V. Tauxe. (1999): Food-Related Illness and Death in the United States. Emerging Infectious Diseases. 5:607-625. Mena, C., Almeida, G., Carneiro, L., Teixeira, P., Hogg, T., & Gibbs, P. A. (2004):Incidence of Listeria monocytogenes in different food products commercialized in Portugal. Food Microbiology, 21, 213–216. Mengaud, J., Vicente, M.F., Cossart, P. (1989): Transcriptional mapping and nucleotide sequence of the Listeria monocytogenes hlyA region reveal structural features that may be involved in regulation. Infect. Immun. 57, 3695– 3701. Rivera-Betancourt, M., Shackelford, S.D., Arthur, T.M., Westmoreland, K.E., Bellinger, G., Rossman, M., Reagan, J.O. and Koohmaraie, M. (2004): Prevalence of Escherichia coli O157:H7, Listeria monocytogenes, and Salmonella in two geographically distant commercial beef processing plants in the United States. J Food Prot. 67, 295–302. Rørvik, L. M., Aase, B., Alvestad, T., & Caugant, D. A. (2003): Molecular epidemiological survey of Listeria monocytogenes in broilers and poultry products. Journal of Applied Microbiology, 94, 6333–6640. SCVM – Scientific Committee on Veterinary Measures (2000): Opinion on foodborne zoonoses.Brussels,12th April 2000.
Ueno, H., Yokota, K., Arai, T., Muramatsu, Y., Taniyama, H., Iida, T. and Morita, C. (1996): The prevalence of Listeria monocytogenes in the environment of dairy farms. Micro-biol Immunol 40, 121–124. Uyttendaele, M., De Troy, P., & Debevere, J. (1999): Incidence of Listeria monocytogenes in different types of meat products on the Belgian retail market. International Journal of Food Microbiology, 53, 75–78 Van Netten, P., Perales, I., Vandemoosdij, K.A., Curtis, G.D.W. and Mossel, D.A.A. (1998): Liquid and solid selective differential media for the detection and enumeration of Listeria monocytogenes and other listeria species. Int. J. Food Microbial. 8: 299-316. Vanderlinde, P. B., Shay, B., & Murray, J. (1998): Microbiological quality of Australian beef carcasses meat and frozen bulk packed beef. Journal of Food Protection, 61, 437–443. Varabioff,Y. (1992):Incidence of Listeria in small goods. Letter in Applied Microbiology, 14,167-169 Walker, S.F., Archer, P. and Banks, J.G. (1990): Growth of listeria monocytogenes at refrigeration temperatures. J. appl. Bacteriol., 63: 20-23. Wong, A.C. (1998): Biofilms in food processing environment. Journal of Dairy Science 81: 2765-2770. Yu, L.S.L.; Parasi, P.K. and Fung, D.Y.C. (1995): Most probable numbers of Listeria spp. in raw meats detected by selective motility enrichment. J. food prot., 58: 943-945.